2. .. 1 :25... 27. .1.)
(.132 c .. .. 3.9.va . 1. _
. 3&2»??? $22 1?...»
. .2 .
E.

. r2 5......
t 1

. “N. u. .2
y a. 2.2.3.
.zv5zs25h. .39.... l
2 q 5
121.15.... .

12$ .1... 3:551 .
I. .3 n ‘1 . ‘IA ul¢n ‘55-
....3 .1: .7. 1
12-1.1.2...

.l .‘l?

& 1
1...» .2... .2. .25.. 1.21...
.- s 2 .5: a)!
2...... 2:13.. 1 5r.
:2. vav»...§.~.€$ 050139.11.-

l“ ‘?flv".filmht. .. It "41.

. .22

a
.

11):]
3......

..
unannw...

.12.,
11.22.41.113?

unHqu....§:

fiafi?
I O .

A1...

1. .3

. .933
I... .21..-
.22. :i
1‘ .41;-

1")
‘3}
, 2: 7. 2.! 13.2.1
12...: .1... .1. 2...
Irinfib
h6!.1.rll$k$
. ,‘lb‘r
urns}...
”.12....

.2

. .2,»

3.2.11: 5.3%..5

5.7? in. u

2 35.2.2223:

, 43“

$2
. .21.,

2.0.1.5310;
. r n 5
, 1'5“..- 75L.
nuitifikgmv . 1 1

Enltévznu)V SI! 13.2.2.1? .

1 . .15.. 22.1.1.3 ”1.2.1. 1222.}. .5.» 1.. 2 {2.1.5.2.

4., an km»... 23.5.. «3 , .

41.11.... . 3111!: . 22 ark}; 2 a 1,

45- 4 1 k 5 2

3.3.54.3 . ..

i e.

 

1 more
‘ LIBRARY
2% Michigan State
University

This is to certify that the
thesis entitled

IDENTIFICATION AND CHARACTERIZATION OF
TRYPANOSOMA BRUCEI PPR PROTEINS, PUTATIVE
MITOCHONDRIAL RNA METABOLISM PROTEINS

presented by
Melissa Kay Mingler

has been accepted towards fulfillment
of the requirements for the

Master of degree in WSW and Molecular
Science A / Biology
: 7

   

-.-.-.-¢--n-o-n-I-o-o--I-o-n-o---1-.--

 

 
 

MSU is an Affinnative Action/Equal Opportunity Institution

4. __ 1+ “

'_—"—' * ‘.

 

PLACE IN RETURN BOX to remove this checkout from your record.
To AVOID FINES return on or before date due.
MAY BE RECAU£D with earlier due date if requested.

 

DATE DUE

DATE DUE

DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2/os'c/c'i—RC/oa't'e—oueindd-"—p. 15 ‘

IDENTIFICATION AND CHARACTERIZATION OF TRYPANOSOMA BRUCEI PPR
PROTEINS, PUTATIVE MITOCHONDRIAL RNA METABOLISM PROTEINS

BY

Melissa Kay Mingler

A THESIS
Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of
MASTERS OF SCIENCE
Department of Biochemistry and Molecular Biology

2005

ABSTRACT

IDENTIFICATION AND CHARACTERIZATION OF TRYPANOSOMA BRUCEI PPR
PROTEINS, PUTATIVE MITOCHONDRIAL RNA METABOLISM PROTEINS

BY
Melissa Kay Mingler

A new class of proteins, characterized by Pentatricopeptide Repeat (PPR)
motifs, have been identified recently in plants. These proteins contain multiple
35-amino acid repeats that are proposed to form a superhelix capable of binding
a strand of RNA. All PPR proteins characterized to date appear to be involved in
RNA metabolism in organelles. Comparative genomic studies show that while
there are 23 PPR proteins within Trypanosoma brucez; plants contain over 450
PPR proteins. In contrast, eukaryotes only contain 2-6 PPR proteins. Studies
began with bioinformatics that characterized a 7'. brucei-speciflc PPR motif. One
of the putative 72 brucei mitochondrial PPR proteins, TbPPR1, was further
characterized using RNA interference (RNAi). TbPPRI is predicted to be
mitochondrially targeted and contains 14 predicted PPR motifs, with the majority
occurring in tandem. RNAi experiments designed to knockdown expression of
TbPPRl show a repeatable slow growth phenotype. The mitochondrial mRNA
levels from the RNAi experiments were studied using Northern blot analysis and
with a “poison primer“ extension assay, and several messages showed an altered
expression pattern. Through these studies we hope to identify relevant RNA

processing factors of mitochondrial messages.

ACKNOWLEDGMENTS

Thank you to Donna Koslowsky, Ph.D. who supported and instructed me
through my graduate studies. Also a thank you to Sandra L. Clement, Ph.D. for
instructing me in many of the lab techniques used in this thesis as well as for all

her helpful advice. I would like to acknowledge Kaillathe Padmanabhan, Ph.D.
for his help in using the HMMER 2.2 package for my bioinformatics studies and
all his other computer expertise. I would also like to acknowledge Annette
Thelen, Ph.D. for all her helpful advise on the Real Time PCR studies and Shirley

Owens for her help in the fluorescent microscopy studies.

iii

TABLE OF CONTENTS

LIST OF TABLES ...................................................................................................... V
LIST OF FIGURES ................................................................................................... VI
CHAPTER 1: INTRODUCTION ................................................................................. 1
Introduction .................................................................................................. 2
Trypanosomes: Lifecycle, and Medical Significance ................................... 2
Trypanosoma brucei Metabolism ................................................................. 6
Mitochondrial Genome and mRNA Editing ................................................... 8
Mitochondrial Regulation ............................................................................ 15

PPR Proteins ................................................................................................ 20
Overview ..................................................................................................... 26
CHAPTER 2: BIOINFORMATICS ............................................................................ 28
Introduction ................................................................................................ 29
Materials and Methods ................................................................................ 30
Results .......................................................................................................... 31

PPR Consensus Motifs Identified with HMMER and MEME .............. 31

Protein Characterization ................................................................... 34

Discussion ................................................................................................... 42
CHAPTER 3: RNAi DATA ....................................................................................... 50
Introduction ................................................................................................. 51
Materials and Methods ................................................................................ 52

RNAi constructs ................................................................................ 52
Transfection, RNAi induction, and Growth Curve ............................ 56

Northern Analyses ............................................................................ 57
Poison Primer Extension ................................................................... 57
Results ......................................................................................................... 58
RNAi .................................................................................................. 58

Evaluation of TbPPR1 Depletion effects on Mitochondrial RNA

Transcripts ............................................................................. 65

Poison Primer Extension ................................................................... 72

Discussion and Conclusion .......................................................................... 76
Future Work ..................................................................................... 78
BIBLIOGRAPHY ...................................................................................................... 80

iv

LIST OF TABLES

. Gene overlap of 72 brucei Maxicircle .......................................................... 14
. Regulation of 72 brucei Mitochondrial Expression ..................................... 19
. Eukaryotic PPR proteins .............................................................................. 23
. PPR proteins are specific to Eukaryotes ..................................................... 25
. 72 brucei PPR proteins ................................................................................. 39

. Orthologs of 72 brucei PPR proteins ........................................................... 41

LIST OF FIGURES

1. Trypanosoma brucei life cycle ...................................................................... 5
2. Linearized maxicircle map ........................................................................... 11
3. 7i brucei minicircle ...................................................................................... 12
4. Position of the maxicircle encoded gMURFII-Z gene in 7? brucei. ............. 13
5. 72 bmcei specific PPR motif ........................................................................ 33
6. TbPPR1 PPR motif sequences ..................................................................... 36
7. TbPPR1 putative RNA contacting residues ................................................. 44
8. Family of a—helical repeat proteins ............................................................. 47
9. TbPPR1 PPR domains .................................................................................. 53
10.pZ]M, T. bruceidsRNA expression vector .................................................. 55
11.TbPPR1 RNAi Growth Curves ...................................................................... 61
12. Control for Tetracycline Exposure ............................................................... 62

13. Northern blot of TbPPR1 RNAi Trial A: TbPPR1 and dsRNA expression....64

14. Northern blot of TbPPR1 RNAi Trial C/D: 125 and 9s rRNA expression ..... 66
15.Northern blot of TbPPR1 RNAi Trial C/D: Complex I expression ............... 69
16. Northern blot of TbPPR1 RNAi Trial C/D: CYb expression ......................... 71
17. Poison Primer Extension of CYb on TbPPR1 RNAi Total RNA .................... 75

vi

CHAPTER 1
INTRODUCTION

Introduction

Pentatricopeptide Repeat (PPR) proteins are an important family of a-
helical repeat proteins involved in several aspects of organellar RNA post-
transcriptional processing in many different eukaryotic organisms. A large
number of these proteins have been identified in Trypanosoma brucei. We plan
to investigate their role in mitochondrial mRNA processing, stability or
expression. This chapter introduces the organism 72 brucei its significance for

study, and its mitochondrial biogenesis, as well as the family of PPR proteins.

Trypanosomes: Lifecycle, Medical and Economical Significance.
Trypanosoma brucei are parasitic protozoa that cause African Sleeping
Sickness in humans and Nagana in cattle. They threaten over 60 million people
in 36 different countries in sub-Saharan Africa. In 1999, 45,000 cases of African
Sleeping Sickness were diagnosed. However, the World Health Organization
(WHO) estimates that the number of people affected is ten times greater due to
the lack of screening. There are several villages in Angola, the Democratic
Republic of Congo and Southern Sudan where Sleeping Sickness is the first or
second greatest cause of mortality, even ahead of HIV/AIDS (www.who.int). 7'.
brucei is not only detrimental to the health of the people of sub-Saharan Africa,
but also to their well-being. Infection in animals causes decimation of cattle and

abandonment of fertile land to avoid the disease.

The symptoms in the early stages of the disease are fever, headaches,
pains in the joints, and itching. The second stage is the neurological phase
where 7? brucei crosses the blood-brain barrier into the central nervous system.
The symptoms are confusion, sensory disturbances, poor coordination, and
disturbances in the sleep cycle that all can culminate in fatality. Treatment in the
initial stage is more effective and safer. The only second stage drug on the
market today is Melarsoprol, which is an arsenic derivative with severe and
deadly side effects, killing 4-12% of all patients who receive it [3]. Elfornithine
also treats late stage infections, but only those caused by one of the subspecies.
Elfornithine’s maker, Adventis, has only guaranteed production of the injectable
form until the year 2005 (www.who.int). *

The 7'. brucei parasite is transmitted through the bite of the Tsetse fly,
Glossina, when it takes a blood meal from a vertebrate host. It then proliferates
in waves in the host’s bloodstream where it evades the immune system by
continually changing its antigenic coat of variant surface glycoproteins [4-6].
There are two life forms in the bloodstream. The long, slender form is able to
undergo replication. The short, stumpy forms are nonreplicative and begin to
change in metabolism in preparation to enter the next lifecycle stage in the
tsetse fly. When the tsetse fly takes a blood meal from an infected individual,
the short and stumpy bloodstream form will differentiate into the procyclic form
in the mid-gut of the insect. This is the form that we study in the lab. The

parasites then travel up to the salivary glands of the fly and differentiate again

into the epimastigotes and then metacyclics, which are then delivered to the

mammals when the tsetse takes a bloodmeal (Fig. 1).

Trypanosoma brucei lifecycle.

tsetse fly mammal

 

procyclic bloodstream form

 

Figure 1. The lifecycle of Trypanosoma brucei. The light gray
areas represent the mitochondria that have great morphological
changes between lifecycle stages. The large circle with the dot
is the nucleus and the smaller oval with the dot is the
kinetoplast. Obtained from homepage.mac.com/mfield/

lab/Images/Iifecycle.gif.

FIGURE 1

Trypanosoma brucei Metabolism

Metabolism in 72 brucei is quite complex due to the digenetic life cycle.
The bloodstream form parasite, in the mammalian host, depends on glucose
from the hosts’ bloodstream for its energy production and secretes pyruvate [7,
8]. The procyclic or insect form parasite uses proline, glucose and threonine
from the insects’ gut for its energy production and secretes succinate, acetate,
lactate, alanine, and C02 [9, 10].

The respiration rate in the bloodstream form of Trypanosoma brucei is
quite high, 50-fold higher than any eukaryotic cell [11]. Metabolism in the
bloodstream form occurs in a unique peroxisome-like organelle called the
glycosome. Glycosomes have a single phospholipid bilayer with an electron
dense proteinaceous matrix and no DNA. The glycosome contains glycolytic
enzymes and enzymes of peroxide metabolism, fatty acid oxidation, and ether
lipid biosynthesis. Metabolism occurs here through substrate level
phosphorylation of glucose that produces 2 moles of ATP for every mole of
glucose consumed. No net ATP or NADH is produced in the glycosome, as the
ATP is actually produced in the cytoplasm by pyruvate kinase [10]. In the
mitochondria of the bloodstream forms, there is no TCA cycle and most of the
cytochromes are not expressed [12]. The intermembrane space of the
mitochondria does contain a glycerol-3-phosphate dehydrogenase and a terminal

alternative oxidase that are principal in the glycerol-3-phosphate and

dihydroxyacetone phosphate shunt between the glycosome and the
mitochondria. This shunt maintains the NAD+/NADH balance within the
glycosome. There is also evidence of an active Complex I in the mitochondria
that may transfer electrons via the alternative oxidase [13]. The Fo/Fl-ATP
synthase of the mitochondria is responsible for maintaining a proton gradient
across the mitochondrial membrane in the bloodstream form trypanosomes [14].
The metabolism in the procyclic form is quite different. At low levels of
glucose, oxidative phosphorylation within the mitochondria is essential. The
mitochondria contain and use an incomplete TCA cycle. The succinyl-CoA
synthetase of the TCA has been found to be essential as the last step in both the
glucose and proline degradation pathways [15-17]. The TCA cycle is thought to
feed into the electron transport chain when Complex II transfers the electrons
from succinate of the TCA cycle to ubiquinone of the electron transport chain,
thereby skipping Complex I in the procyclic forms [10, 18]. The procyclic form
contains two terminal oxidases in its electron transport chain, the cytochrome c
oxidase and the plant-like alternative oxidase. The cytochrome c oxidase is
active in the mitochondrial oxidative phosphorylation, but the role of the
alternative oxidase within the procyclic form is unknown. The protein levels of
the alternative oxidase are lower in the procyclic then they are in the
bloodstream form [19]. There is some evidence that the alternative oxidase is
responsible for decreasing the reactive oxygen species (ROS) in procyclics [20].

The Fo/Fl-ATP synthase is the principal site of ATP generation.

Metabolism Summary. The glycosome is highly active in the bloodstream
form of the parasite producing energy through substrate level phosphorylation.
The role of the mitochondria in the bloodstream form is minor in that it contains
a glycerol-3-phosphate dehydrogenase and the alternative oxidase that are
important in maintaining the NAD+/NADH ratio in the glycosome, has some
Complex I activity and uses the Fo/Fl-ATP synthase to maintain the proton
gradient. Mitochondrial function in the procyclic is increased with its use of the

oxidative phosphorylation, substrate level phosphorylation, and TCA cycle.

Mitochondrial Genome and mRNA Editing

The mitochondrial genome of 72 brucei consists of ~50 copies of 3 ~23 kb
maxicircle (Fig. 2) and 5,000-10,000 1.0 kb minicircles (~300 sequence
families)(Fig. 3). These circles are topologically interlocked forming a network in
the form of a disk called the kinetoplast DNA (kDNA). The maxicircles are
analogous to mtDNA of other organisms. They encode 18 messenger RNAs
(mRNAs), two guide RNAs (gRNA), a large and small ribosomal RNA (rRNA), but
surprisingly, there are no transfer RNAs (tRNA) encoded in the maxicircles.
Though the maxicircles are ~23 kb in size, only about 15 kb of this is actually
coding region (Fig. 2). The remaining 8 kb of the maxicircle is called the
variable region and it is thought that transcription of the polycistronic message
begins somewhere in this region [21-23] (Fig. 2). Michelotti et al. have shown

the existence of a transient precursor element, which would place the

transcription start site about 1,200 nt upstream of the 125 rRNA mature 5' end
[22], but the exact location is still unknown. The only mapped transcription start
site on the maxicircle is for gMURFZ-II, one of the two gRNAs that are encoded
on the 72 brucei maxicircle. The gMURFZ-II gene is found completely within the
5’ end of the gene ND4, introducing more complexity to the transcription and
processing of the maxicircle [24] (Fig. 4).

Minicircle transcription is somewhat different; each of the three gRNAs on
a minicircle are primary transcription products located within cassettes of
imperfect inverted 18-bp repeats [25, 26]. The 5’ ends of many gRNAs have
been mapped 29-33 bp from the upstream repeat [26, 27]. The 18-bp inverted
repeats have been implicated in playing a role in transcription, but the few gRNA
genes located outside of these 18-bp repeats have also been found to be primary
transcripts [24, 28, 29]. Even though each gRNA gene has the ability to initiate
transcription, it appears that minicircle gRNA genes can be transcribed
polycistronically [30], but the majority of the gRNAs found 'n the cell have 5’ di-
or tri-phosphates, indicating they are not processed at their 5’ ends [24, 26].

Though the transcription start site of the maxicircle is unknown, it is
known that transcription of the maxicircle results in polycistronic transcripts from
which the individual RNAs are then processed out. The 5’ and 3’ ends of many
maxicircle genes have been mapped. The coding region is very compact, with
the majority of the genes overlapping [3 1](T able 1) at the 5’ and 3’ ends. Thus

processing of one message will often result in the destruction of its neighbor(s)

[31, 32]. The control of which of the neighboring messages is processed out
and translated remains unknown.

Extensive RNA processing of maxicircle transcripts must occur before a
translatable message is obtained, including endonucleolytic cleavage,
polyadenylation and RNA editing [22, 24, 31]. Kinetoplastid RNA editing inserts
or deletes uridylates into the mRNA transcripts, forming the correct open reading
frames, start and stop codons for translation. Once transcribed, many of the
mRNAs are edited by gRNAs, primary transcripts encoded mainly by the
minicircles [27] (Fig. 3). These gRNAs are present in both life cycle stages,
though almost nothing is known about gRNA transcription, processing or

transcript level regulation.

10

Linearized Maxicircle Map.

 

 

Coding region (~15 kb‘r

Variable

region
(~7_4 kb) N07 CYb cna MURF2 N04
93

CO3 A6 CO2

N05

 

 

 

 

 

 

3’ 8. 5’ ends overlapping

Figure 2. Linearized maxicircle map (coding region). 125 and 9s = rRNA
subunits; ND=NADH dehydrogenase; CO=cytochrome oxidase;
CYb=Cytochrome b; MURF=maxicircle unidentified reading frame; CR=C—rich
region; RSP12=ribosomal protein 12. Overlapping regions are shown in gray,
unedited genes are striped, extensively edited genes are in black, and the
dimpled genes are genes that go through some mRNA editing. Courtesy of

Sandra Clement.

FIGURE 2

11

T. brucei Minicircle

 

 

 

 

   

BEND ' Ol‘i

4 // Minicircle // 0°
/ /

P. % lkb % 5
s It

.. ’
.

 

' =18bp inverted repeats
lefi

Figure 3. 73 brucei minicircle. The gray arrows represent the 18bp
inverted repeats that flank most gRNA genes. The striped regions are the
gRNAs, typically 3 per minicircle. The oval, ori, represents the origin of
replication and the box indicates the bend present in the minicircle DNA
structure. The black arrows indicate the direction of the gRNA

transcription.

FIGURE 3

12

Position of the maxicircle encoded gMURFII—Z gene in 11 brucei

5 ’ ND4 5 ’ gMurfII-Z
TAAGAAGG—-)AAATTT:>ATAGAAAGCACAAAAATAAAATTAAATTAGAGTAATTGAATGTTAAAATTiAAATT

Figure 4. Position of the maxicircle encoded gMurfII-Z gene in T. brucei. The
mapped 5’ ends of both ND4(—->) and gMurfII-Z (:>) are indicated with arrows
pointing in the direction of transcription. The 5’ end of ND4 is processed,
whereas the 5’ end of gMurfII-2 is a primary transcript. The arrow pointing
down indicates the position of gRNA mapped 3’ end. The ATG start codon for

ND4 is shown in bold. Courtesy of Donna Koslowsky.

FIGURE 4

13

Gene overlap of T. brucei Maxicircle.

 

 

 

 

 

 

 

 

 

 

 

Opposite Strands Orientation Overlap Same Strand Orientation Overlap

N DB/N 09 373' 49nts ND7/COI l| 3'/5' 32nts
A6/ M U R Fl 3'/3' 57nts COI l I/Cyb 3'/5' 3nts

MU R Fl/C R3 5'/5' 61 nts Cyb/A6 3'/5' 0nts
ORB/ND1 3'/3' 41 nts COI l/MU RFll 3'/5' 31 nts
ND1/COII 5'/5' 129nts COI/CR4 5'/3' 56nts

MU R Fl I/COI 3'/3' 76nts RSP12/ND5 3'/5' 39nts
C R4/N D4 5'/5' 8nt intergen
N D4/C R5 3'/3' 44nts

CR5/RSP12 5'/5' 50nts

 

 

 

 

 

 

Table 1. Table representing gene overlap on the maxicircle for border regions

of different genes. The left half of the table lists neighboring genes on

opposite strands with their orientation and overlap region. The right half of

the table lists the neighboring genes on the same strand with their orientation

and overlap region. Courtesy of Donna Koslowsky.

TABLE 1

14

 

Mitochondrial Regulation

During the life cycle, the changes in energy metabolism, discussed
previously, are accompanied by distinct changes in mitochondrial gene
expression. Steady state levels of mitochondrial mRNAs and rRNAs,
polyadenylation of mitochondrial mRNAs, and editing of these same RNAs are

also developmentally regulated in a transcript specific manner[33-36].

mRNA Editing

7: brucei mitochondrial mRNA editing is regulated in a transcript specific
manner between the two life cycle stages. This regulation is not controlled by
the gRNA since they are present in both life cycle stages [27]. The Complex I
edited mRNAs NADH Dehydrogenase 8 (ND8) and the 3’ editing domain of ND7
are only fully edited in the bloodstream forms, whereas ND9 edited mRNA is
similar in abundance in both life cycle stages [32, 37-39]. Ribosomal protein
subunit 12, RP512, has a higher level of edited mRNA in the bloodstream form
[32] and C-rich region 4 (CR4) is only fully edited in the bloodstream form, just
like ND7 and N08 [40]. In contrast, the edited form of Cytochrome Oxidase III
(COIII), Cytochrome b (CYb), and C011 occurs to a higher extent in procyclic
than bloodstream forms [36, 39, 41-44]. ATP Synthase 6 (A6) and Maxicircle

Unidentified Reading Frame II (MURFII) have similar levels of the edited form

15

between life cycle stages [43, 45]. MURFI, COI, ND4, and ND5 are never edited

(Table 2).

te e mRNA evels
Though the transcription rates of the mitochondrial RNAs are unchanged

between the two life cycle forms, the steady state levels of many of the
mitochondrial transcripts differ in a transcript specific manner [22]. Steady state
levels of the mitochondrial 125 and 95 rRNAs are 30 fold higher in the procyclic
form compared to the long, slender bloodstream form [21]. Similarly, transcripts
for members of both Complex III (CYb) and Complex IV (C011 and COI) are also
upregulated in procyclic forms [29, 46]. In contrast, Complex I subunits NDB-S
and ND7-9, MURFI, and RP512 are elevated in the bloodstream forms of 72
brucei [32, 35, 37, 38, 47, 48]. This supports the suggestion that the procyclics
bypass Complex I in the electron transport chain [41]. Other transcripts, A6,
N01, and MURFII are constitutively expressed and show no difference in

transcript levels between the two forms [35, 45, 46] (Table 2).

P l en l ti n

All protein coding mRNAs in the mitochondria of 72 brucel; with the
exception of ND5, occur in 2 size classes that differ by 120-200 nucleotides in
length, a difference which cannot be accounted for by RNA editing [33, 34, 36,

49]. RNase H digestion using oligo(dT) showed that this can be accounted for

16

by the addition of two separate poly(A) tail lengths, short (20 nucleotides) and
long (120-200 nucleotides)[46]. Evidence is beginning to emerge that this
poly(A) tail is involved in mitochondrial mRNA decay in T. brucei. Unedited
RP512 is targeted for degradation with the addition of a poly(A) tail, but has a
much longer half life if a poly(A) tail is not added. In contrast, an edited RP512
mRNA or even a 10% partially 3’ edited RP512 mRNA is quickly degraded if it
does not possess a poly(A) tail. The longer (120-200 nt) poly(A) tails on edited
RP512 mRNAs actually are degraded faster then the shorter (20 nt) tails, but
slower then a non-poly(A) tail edited mRNA. This suggests a role of both the 6119
edited portion of the mRNA and the poly(A) tail in stabilization [50]. This
pathway of mRNA degradation is also dependent on the addition of UTP [51].
This brings up the question of why the larger size transcript (larger poly(A) tail)
class consists of mainly edited mRNAs [32, 37, 46, 47, 52, 53] if a longer poly(A)
tail is more destabilizing? Complex I mRNA ND8 has a higher percentage of the
longer poly(A) tails in the bloodstream form compared to the procyclic form [46].
COIII, CYb, C011, and COI on the other hand have a higher ratio of long poly(A)
tails in the procyclic form [42, 46]. ND4 and MURFI have a similar size
distribution between the two forms [46] (Table 2).

Poly(A) tail addition in prokarya, such as Escherichia coll; acts as a
targeting signal for mRNA decay. In the cytosol of eukarya, including humans
and Saccharomyces cerevisiae, poly(A) tail addition protects them from mRNA

degradation. In the mitochondria of S. cerevisiae, the poly(A) tail addition is

17

dispensable without effects on the mRNA metabolism. Plant mitochondrial and
chloroplast mRNAs are also not constitutively polyadenylated, although there is
evidence that a small proportion of each mRNA can be polyadenylated. Recent
data have shown that the polyadenylation in plant mitochondria and chloroplasts
can actually trigger degradation of the mRNA [54-57]. Human H-strand
mitochondrial mRNAs are all polyadenylated with 50-60 residues, generating
functional stop codons and conferring mt-mRNA stability [58-60]. It seems that
72 brucei mitochondria is another decay system regulated partially by
polyadenylation, but unlike other systems, the edited state also seems to
regulate the mRNA decay.

Regulation Summary. 7? brucei mitochondria show numerous levels of
post transcriptional regulation. Alhough very little is known about mRNA
processing, it is clear that this processing is unique and important in the overall
mitochondrial gene expression. Therefore, identifying and learning about the
machinery that performs these tasks is important. We believe the PPR proteins

will play a important role, as described below.

18

Regulation of 1: brucei Mitochondrial Expression

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Higher Steady . Fully Involved In
mRNA State mRNA Higher 200'” nt Edited/Higher Mitochondrial Mitochondrial
poly(A) tail ratio Complex
level Levels Respiration
ND1 Constitutive Never Edited Bloodstream l
N03 Bloodstream Bloodstream Bloodstream Bloodstream l
ND4 Bloodstream Similar Never Edited Bloodstream l
N05 Bloodstream Single size Never Edited Bloodstream l
ND7 Bloodstream Bloodstream Bloodstream Bloodstream l
NDB Bloodstream Bloodstream Bloodstream Bloodstream l
N09 Bloodstream Constitutive Bloodstream l
CYb Procyclic Procyclic Procyclic Procyclic lll
COI Procyclic Procyclic Never Edited Procyclic IV
COll Procyclic Procyclic Procyclic Procyclic IV
COlll Procyclic Procyclic lV
A6 Constitutive Constitutive Both V

MURFI Bloodstream Similar Never Edited

MURFII Constitutive
CR3
CR4 Bloodstream

RSP12 Bloodstream Bloodstream Ribosomal

 

 

 

 

 

 

Table 2. Regulation of 72 brucei mitochondrial gene expression. For each

mitochondrial mRNA it is listed which lifecycle form has the higher steady

state mRNA level, the higher 200nt:20nt poly(A) tail ratio, the higher level of

fully edited mRNA, the lifecycle form in which it is thought to function, and

in the mitochondrial complex in which it acts.

TABLE 2

19

 

PPR Proteins

Pentatricopeptide Repeat (PPR) proteins contain multiple, tandem PPR
motifs that are degenerate 35-amino acid sequences that form two antiparallel
a—helices with characteristic distributions of hydrophobic and hydrophilic amino
acids. Multiple PPR domains are thought to form a superhelix with a central
groove proposed to serve as the ligand-binding surface. The width of the groove
is sufficient to hold a single strand of RNA. The sidechains lining the central
groove are almost all hydrophobic, with positive residues at the bottom to bind
the phosphate backbone. This suggests that the PPR motifs may be RNA-binding
instead of protein-binding. The PPR proteins have been implicated in stability,
translation, mRNA editing and mRNA processing of mitochondrial and chloroplast
encoded messages. The largest groups of PPR proteins are found in the higher
plants like Arabidopsis, rice, and maize probably due to the complex organelle
gene expression in these systems. In all studies with PPR proteins thus far,
mutants were not rescued by the other PPR proteins present in the cell,
indicating that although there are many PPR proteins, they are not completely
redundant.

Pet309 and cya5 are PPR proteins implicated in stability and translation of
mitochondrial cytochrome c oxidase subunit 1 (COXI) transcripts in yeast and
neurospora respectively [61-64]. Maize CRP1 is required for translation of plastid

petA and petD transcripts and in processing of petD from the polycistronic

20

precursor in the chloroplast [65, 66]. There are cytoplasmic male sterility (CMS)
restorer genes that encode PPR proteins in petunia (Rf1)[67], radish (Rfk and
Rfo)[68-70], as well as rice (Rf-1). Rf-1 is responsible for processing atp6 mRNA
from polycistronic precursor [71, 72]. Most of the other PPR CMS restorers are
involved through mRNA stability or processing as well [1]. Arabidopsis HCF152
null mutant shows impaired 5’-end processing and splicing of petB transcripts
and the HCF152 protein has been found to bind the exon-intron junction of this
RNA with high affinity [73-75]. In higher eukaryotes, Drosophila melanogaster
BSF PPR protein binds a region of the bicoidmRNA 3’ untranslated region that
supports normal mRNA maternal deposition and localization in the embryo during
oogenesis through its role in mRNA stabilization. Drosophi/a BSF PPR protein is
the only one studied to date that does not have an organellar localization [76].

A single missense mutation in the human LRP130/LRPPC gene, encoding the only
human PPR protein studied, is the cause of the genetic LSFC disease, Leigh
syndrome French Canadian, characterized by COX1 deficiency [77]. Levels of
COXI and COXIII mRNAs were measurably reduced in LSFC patients. Translation
of COXI is also reduced, indicating a role in translation or stability of mRNA for
COXI [78]. The LRPPC protein has also been found to associate with
mRNA/mRNP complexes [79-81] (Table 3). These studies show the involvement
of PPR proteins in different aspects of organellar biogenesis. Several of the
processes affected in plants are similar in 72 brucel; such as processing of

polycistronic messages.

21

There have been a few PPR proteins studied that do not fit in to the
umbrella description of being organellar targeted and involved in the processes
of mitochondrial mRNA stability, processing and translation. There has only been
one PPR protein studied to date that is involved in mRNA editing. Mutations in
the ch4 gene of Arabidopsis thaliana have been found to be responsible for a
decrease in the level of the NA(P)DH dehydrogenase (NDH) complex. There is
no alteration in the size or level of the NDH transcripts, but by restriction analysis
the mutants were found to be defective in one of their C to U editing sites in the
initiation codon of the nth message [82]. The authors concluded that the PPR
mutants are unable to edit this necessary NDH complex message [82] (Table 3).
Researchers studying other PPR proteins in plants have looked for effects on RNA
editing, but have not found any others as of yet. This may be due to editing
mutations not presenting a obvious phenotype. This also may be due to the
enormity of possible editing sites within the plant organellar genomes, making it
hard to scan for these mutations. In the future, many other PPR proteins will

probably be found to be involved in plant organellar RNA editing.

22

Eukaryotic PPR Proteins

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

£r_g_anism PPR protein Gene Affected Affect
Yeast Pet309 COXl Stability & Translation
Neurospora Cyas COX! Stability 8 Translation
Human LRP130 COXl Stability & Translation ?
Drosophila BSF bicoid Stability
Maize Crp1 petA & psaC 8 petD Translation
petB/petD Processing
Rice Rf-1 atp6 Processingfi
Arabidopsis HCF 152 psbB-pst-pst-petB-petD Processing
Wheat p63 COXII Transcription Initiation
Arabidopsis CRR4 nth mRNA editing

 

Table 3. Eukaryotic PPR proteins. The table lists representative PPR

proteins that have been studied as well as their parent organism, what

genes/mRNAs they affect and which mRNA process they affect.

TABLE 3

23

 

There are many PPR proteins that may bind mRNA, but there is little
direct evidence of this activity. Radish p67 and Drosophila BSF were both
purified as sequence-specific RNA binding proteins in vitro [66, 76]. The C-
terminal half of LRP130 has been shown to bind single-stranded polyadenylated
RNA in vivo [83, 84]. Arabidopsis thaliana Hcf152 is a chloroplast protein that
binds as a homodimer to the petB exon-intron junctions with high affinity [73-
75]. The strongest evidence comes from recent immunoprecipitations and
microarray analysis showing that CRP1 binds specifically to petA and psaC
mitochondrial mRNA messages in maize [85].

The same group that identified over 400 PPR proteins in plants have
identified 18 PPR proteins in the 72 brucei database [86](T able 4). Next to
plants, Trypanosomes have the most PPR proteins of all the organisms
investigated. This may be relevant because during evolution Trypanosomes may
have had a secondary loss of chloroplasts and they still contain some chloroplast-
specific metabolic proteins today [87, 88]. They also both have complex
organellar mRNA processing, including polycistronic precursor processing and
mRNA editing. We have initiated a project to identify and characterize PPR
proteins within I brace/2 We then proceeded to investigate the role of one of
these proteins, TbPPR1, in 72 brucei mitochondrial biology. TbPPR1 was found to
influence the growth rate of the 72 brucei cells and affect the expression of

several mitochondrial messages.

24

PPR proteins are specific to Eukaryotes

 

 

 

 

 

 

 

 

 

 

 

 

 

Organism Genes PPR Hits
Homo sapiens 37,490 6
Drosophila melanogaster 17,087 2
Caenorhabditis elegans 20,673 2
Schizosacrhammyces pombe 5,010 6
Saccharomyces cerewlsrae 6,304 5
Trypanosoma brucei 16,757 19
CYan/dioschyzon merolae 4,772 10
Arabidopsis thaliana 28,581 470
Oryza sativa 74,385 655
Ralstonia solanacearum 5,118 1
Ric/rettsia pmwazekii 834 0
Synechocystls 5p. 3, 169 0

 

 

 

 

 

Table 4. PPR Proteins are Specific to Eukaryotes. The number of PPR
genes (PPR Hits) found through bioinformatics in the eukaryotic
organisms that have been sequenced is shown. Genes=number of
identified genes for each organism. Modified from: Lurin, C., et al.,
Genome-wide analysis of Arabidopsis pentatricopeptide repeat proteins
reveals their essential role in organelle biogenesis. Plant Cell, 2004.

16(8): p. 2089-103.

TABLE 4

25

Overview

A new family of over 400 proteins with PPR domains have been identified,
but most of which are in plants. All of the investigated proteins in this family
have been implicated in RNA metabolism in the mitochondria and chloroplasts,
with the exception of Drosophila melanogaster BSF. The massive expansion of
this protein family in the plant kingdom is most likely due to the high complexity
of organellar expression in plants, including polycistronic processing and RNA
editing. 72 bruceialso undergoes complex mitochondrial RNA processing to
obtain a complete message. The mRNAs must be excised out from the
polycistronic precursor, some are edited, and all of them must be polyadenylated
before translation can occur. There is a great deal of information on 72 brucei
mRNA editing and research on polyadenylation is progressing, but nothing is
known about the processing of these messages from the polycistronic
precursors. I have performed bioinformatics to characterize this family of
proteins in 72 brucel; which, next to plants, has the highest number of PPR
proteins of the sequenced eukaryotes. The majority of the 23 PPR proteins
identified in 72 brucei have the traditional mitochondrial targeting signals.
Knockdown of one of these proteins produces a slow growth phenotype and
alterations in mitochondrial mRNA expression. Based on the current PPR
literature and our own research, this family of proteins is highly likely to be

involved in 72 hrucei mitochondrial mRNA expression.

26

 

My hypothesis is that PPR proteins in 72 brucei are involved in
mitochondrial mRNA metabolism through processing of the polycistronic
maxicircle transcript and/or mRNA stabilization of the processed products or
mRNA translation. With this study, we have started to characterize the role

these important proteins play in 72 hrucei mitochondrial biogenesis.

27

 

 

CHAPTER 2
BIOINFORMATICS

28

Introduction

Trypanosoma brucei is a parasitic protozoan with a very complex lifecycle.
Throughout the lifecycle the metabolism and the mitochondria of the protozoan
go through many changes. The factors that control this complex regulation of
metabolism and mitochondrial expression between the two lifecycle stages is
unknown, but may be related to a family of Pentatricopeptide Repeat (PPR)
proteins present in other organisms and 72 brucei itself. Through studies in
plants[1, 2, 65-75, 82, 85, 86, 89-98], humans [76-81, 83, 84, 99], Drosophila
[76], Chlamydomonas reinhardtii [100], yeast [61-63], and Neurosopora crassa
[64, 101], the PPR proteins are emerging as important factors in organellar
mRNA metabolism. -

It was not until the Arabidopsis sequencing project, that the enormity of
this family, over 400 putative PPR proteins, within Arabidopsis was realized.
Almost all of the PPR proteins studied are implicated in organellar RNA
metabolism. Along with all the PPR proteins identified in Arabidopsis, Lurin et.
al. [86] identified 18 PPR proteins within the 72 brucei genome. This is the
highest number of PPR proteins identified in non-plant eukaryotes. We began
looking at the 18 putative 72 hrucei PPR proteins through bioinformatics. Of
these 18 proteins, 13 have conventional mitochondrial targeting signals predicted
by both Predotar (http://genoplante—info.infobiogen.fr/predotar/) and MitoProt
[102], suggesting that this class of proteins plays an important role in

Trypanosome mitochondrial biology. We identified the PPR domains in the 18

29

 

putative proteins through Pfam and created a probability matrix of the motif in
HMMER and MEME. Using this T. bruceispeciflc probability matrix, we identified
6 other putative PPR proteins within 72 brace/2 and additional PPR domains were
found in almost all of the PPR proteins previously identified in Lurin et al. [86].
Materials and Methods

Protein and Motif Identification.

The PPR domains from the 18 identified proteins [86] were found with
Pfam [103] and aligned in ClustalX version 1.81 [104]. The ClustalX alignment
was imported into both the HMMER 2.2 package (http://hmmer.wustl.edu/)
[105, 106] and MEME [107]. Using hmmbuild and hmmcalibrate, HMMER
constructed a probability matrix or position-specific scoring system of the 72
brucei PPR motif using profile hidden Markov models which can put in additions
and deletions anywhere within the alignment. This was then used in hmmsearch
for a more extensive search of the 72 brace/2 Leishmania major, and
Trypanosoma cruzi databases for other PPR proteins. MEME [107] used a
slightly different algorithm, two-component finite mixture model, which uses a
“motif” rather then “profile" method to produce alignments of ungapped blocks.
MEME also gave us a slightly more 72 brucei specific motif to search the
databases with (Fig. 5). All amino acids in the MEME have a probability of 0.2 or
higher, with the highest probability amino acids listed on the first line. For the
consensus sequence from the HMMER the capital letters have probability >05 of

occurrence.

30

Mitmhonorial Targeting.
Mitochondrial targeting was determined through TargetP [108], Predotar

(http://genoplante-info.infobiogen.fr/predotar/), and MitoProt [102].
Dogma;
We also used the following databases in our search for kinetoplast and

other eukaryotic Orthologs:

Sanger www.sanger.ac.uk

1" a.“

TIGR www.tigr.org

Trypanosoma cruzi Database tcruzidb.org

Results
PPR nen i i nifl w'hHMMER n ME

We began by formulating a 72 brucei specific consensus PPR motif and
comparing it to the Arabidopsis to see if we could find species specific
differences. A Clustal X alignment of all the Pfam identified PPR domains within
the 18 PPR proteins identified by Lurin et al. [86] was imported into both HMMER
and MEME. HMMER then calculated a probability matrix based on profile hidden
Markov models for the consensus sequence. Capital letters within the consensus
indicate a probability of occurrence >0.5. For 16 out of the 35 positions, the 72
brucei PPR HMMER consensus sequence was identical to the Arabidopsis PPR
consensus sequence (Fig. 5). The only differences between the two sequences

were conservative replacements such as leucine in position 6 in place of

31

isoleucine found in Arabidopsis, arginine at position 8 in place of asparagine,
cysteine at position 10 in place of tyrosine, and arginine at position 12 in place of
lysine. The 72 brucei HMMER consensus included additional amino acids where
the Arabidopsis consensus did not list any, including an alanine at position 13, an
aspartic acid at position 15, tryptophan at position 16, glutamic acids at 20, 21,
24, 25, 28 and 36, arginines at positions 27 and 29, a valine at position 31, and

proline at 32 and 35. These additions were probably based on the smaller

.1; 1. mm 1.3-- .“

number of PPR domains aligned in 72 brucei versus the enormous number of
Arabidopsis PPR domains that were used for the same type of consensus
sequence. All of these additions do provide a consensus sequence that is more
specific for 72 brucel; but with only 5 differences between the two sequences
being conservative replacements and 16 out of the 35 amino acids being
identical, this gives us a highly conserved PPR motif (Fig. 5).

The Clustal X alignment of PPR domains was also imported into MEME
[107] for a consensus sequence based on the two-component finite mixture
model. The T. brucei MEME consensus included amino acids above a probability
of occurrence at 0.2. The only differences the MEME and HMMER programs
found between the T. brucei consensus sequences were at positions 21 and 23,
with the tyrosine to leucine change at position 23 being a conservative

replacement (Fig. 5).

32

7'. brucei Specific PPR Motif

 

PPR
COIISCTISUS
. 123456789flflQflfifififlflflmz28253288$32$$$$
T-bmce‘ .mxlt xlflcfll‘k A131) ..... AIYEEIERERIEVxL—gfi].
MEME T I 1. v L Q K D

Y F
T. brucei human 1 rgcgt aQ'd ew- eml )e eEr e (EB-v pmp e

HMMER

 

 

 

 

T HelixA HelixB
Arabidopsis .nm1~myx._ .-. .ly. m. . .I- .nl.

thalianaa

[:Iomsewedbetmenbothorgarisrrs
Trypanosomabmoeispeoific

Figure 5. 72 brucei specific PPR domains. Helix A and Helix B denote the

 

 

 

 

 

 

1.! . ‘4. _‘

area where the two a—helices of the PPR motif are predicted to be. The
MEME consensus sequence is listed first with alternative amino acids on
the second and third line. All amino acids in the MEME have a probability
of 0.2 or higher, with the highest probability amino acids listed on the first
line. The consensus sequence generated from the HMMER program is
aligned underneath the MEME with the capital letters having a probability
of >0.5. The Arabidopsis thaliana PPR consensus sequence published by
Small et al. [1] is shown last. Amino acids conserved between both

organisms are boxed and the T. brucei specific amino acids found are

FIGURE 5

33

Protein Characterization

With the HMMER program [105, 106] we identified 14 additional PPR
motifs on most (10 of 17) of the 72 brucei PPR proteins already identified by
Lurin et al. [86]. (One of the PPR proteins found by Lurin et al. (Tb11.01.5980)
was also dropped because the 2 PPR domains identified were not in tandem.) A
representation of the conservation in the 72 brucei domains aligned with the

HMMER 72 brucei and the Pfam PPR consensus sequences is shown in Figure 6,

E .4 I". vases—5.51:1

using the Tb927.2.3180 PPR domains as representative domains.

34

Figure 6. TbPPR1 PPR motif sequences. Depleted here is an alignment of all the
PPR motifs found in TbPPR1 as well as the Pfam consensus motif and the
HMMER consensus motif. The light gray amino acids are the amino acids in the
TbPPR1 motifs that match the HMMER consensus motif. The medium gray amino
acids in the TbPPR1 motifs are what HMMER considers a conservative
replacement to the HMMER consensus motif. The outlines boxes of the TbPPR1
motif sequences are amino acids that match the Pfam consensus motif
sequence. The portions of the sequence corresponding to helix A or B are above

the labeled cylinder for that helix.

3S

TbPPR1 PPR motif sequences

Position

 

T.brucei HMMER
Pfam PPR
TbPPR1-1
TbPPR1-2
TbPPR1-3
TbPPR1-4
TbPPR1-5
TbPPR1-6
TbPPR1-7
TbPPR1-8
TbPPR1-9
TbPPR1-10
TbPPR1-11
TbPPR1-12
TbPPR1-13
TbPPR1-14

 

.5
‘1
.s
(D
N
0

Position
T.brucei HMMER

 

21

f

.K-‘svasrly-cr-<-<

22 23 24 25 26 27 28

l

29 30
FT—

V

31 32 33

 

w
“on

 

Pfam PPR
TbPPR1-1
TbPPR1-2
TbPPR1-3
TbPPR1-4
TbPPR1-5
TbPPR1-6
TbPPR1-7
TbPPR1-8
TbPPR1-9
TbPPR1-10
TbPPR1-11
TbPPR1-12
TbPPR1-13
TbPPR1-14

 

 

{—l—

 

,-_--—L
\uulmwm

 

 

 

——>u

 

mm<>ommm>>m
G) v
-mmmm.

l‘l'l
4mmm0m

 

HMMER consensus

HMMER conserved replacement "I

Pfam consensus

e
e

—zm_m

mm

. > .-

VI"

 

f
E

K

_'

Q

36

e
E

r—‘Dm'z‘r'omlm

mg.

33-<‘:;

13

FIGURE 6

.HUifr

k

-

 

 

--l>€‘!""‘

F

 

(DI

 

4:013»

 

1:; '1

 

D

X

93>

m<r'r—-<H

U<r0<

; <

'U'nl'fl v

'32

-IJI(I)

P
P
p
D
A

w
. - .

ovum—l

m-I

'—

 

Not surprisingly, the new domains were all in tandem with the domains
previously identified. PPR domains are usually found in tandem and the new
domains that we identified filled in some “holes” in our tandem arrays, making
almost every PPR repeat found part of a tandem array. We also identified 6
additional 72 brucei PPR proteins that fit the criteria of having more then one PPR
domain in tandem (separated by less then 60 amino acids) and an E-value less
then 10. Arabidopsis PPR proteins contain an average of 12 PPR domains. Only
3 out of the total 23 72 brucei proteins had 13-14 PPR domains in the proteins.
The rest of the proteins had 6 or fewer PPR domains, with 9 of the proteins only
containing 2 tandem repeats. Nineteen out of the 23 72 brucei PPR proteins
were predicted to be mitochondrially targeted by at least two of the following
prediction programs: TargetP [108], Predotar (http://genoplante-
info.infobiogen.fr/predotar/), and MitoProt [102]. It should be noted that the
percentage of observed false negative results from these programs is ~20-30%
[76]. With all of the TbPPR proteins identified, we used the Pfam database [103]
to try to identify other known protein motifs outside of the PPR domains, but no
significant matches were found. Table 5 lists the protein properties of the

identified 72 brucei PPR proteins.

37

in 1mm

Table 5. 72 brucei PPR proteins. The table lists each putative 72 brucei PPR
protein found through bioinformatics. Lurin, Pfam and HMMER indicate the
number of PPR motifs identified by Lurin et al. [86], by Pfam as listed in the T.
brucei database, and by our HMMER search. The predicted protein length,
molecular weight in Daltons, and the presence of a mitochondrial targeting signal
are listed for each protein. The proteins below the bold line are the additional
PPR proteins found with using HMMER with the 72 brucei specific probability

matrix.

38

7'. brucei PPR proteins

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

39

Number of PPR Motifs
Lurln et HMMER Protein Predicted

ID number al. Pfam HMMER E-value Length MW MTS
Tb927.2.3180 11 12 14 3.9E-95 1004 114384.? yes
Tb11.01.6040 11 10 14 8.1 E-83 823 94413.33 no
Tb10.6k15.0120 5 6 6 3.2E-55 459 50695.05 no
Tb09.21 1.3720 9 10 13 2.6E-81 1023 1165454 yes
Tb927.1 .2990 3 4 5 2.1 E-26 1025 1 15951.1 yes
Tb927.7.1350 2 3 2 5.1E-11 351 40688.09 yes
Tb927.4.4720 3 2 2 5.2E-11 528 59081.97 yes
Tb10.70.7360 2 3 2 4E-1 1 604 67488.74 no
T6927.1 .1 160 3 3 4 3.4E-19 532 58512.57 yes
Tb1 1.02.5120 2 4 4 9E-16 947 1040923 yes
T610.70.5780 3 4 5 9.1 E-13 614 69058.75 yes
T610.389.0260 3 3 4 1.8E-17 929 1021528 yes
Tb10.61 .2890 2 1 2 0.000017 362 39633.05 yes
T6927.3.4450 2 3 3 6.1E-19 676 74840.09 yes
T6927.3.5240 2 3 3 9.2E-08 582 66655.51 yes
Tb927.8.6040 3 3 4 715-19 240 26898.62 no
T6927.6.4190 3 3 6 425-22 552 60803.04 yes
FbQZ7.8.4860 2 3 0.00023 679 76539.96 yes
Tb927.3.1330 1 2 0.005 1425 1560516 yes
T6927.6.4400 0 3 0.0088 603 67159.65 yes
Tb927.5.1790 2 2 0.18 631 71956.81 yes
T61 1.01 .7930 0 2 9.3 607 67981.12 yes
[11091604750 0 2 9.6 667 75135.48 yes

TABLE 5

We used the Leishmania majorand 72 cruzi genomic databases
(www.5anger.ac.uk, www.tigr.org, and tcruzidb.org) to look for homologues.
Homologues were found in both L. majorand T. cruzi for every putative 72 brucei
PPR protein (Table 6) indicating that this is a highly conserved family of proteins
across the Kinetoplastida family. Future work should be done to further
characterize the L. majorand 72 cruzi homologues to see if they also have
predicted mitochondrial targeting signals and if their PPR motif distribution

throughout the protein is similar to their homologue in 72 brucei.

40

0%,. “

Orthologs of 72 brucei PPR Proteins

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

T.cruzl Ortho.

Name TC00.10470535... L. major Ortho. Other Ortho E-value
Tb927.2.3180 ..09123.30 Lij18.0010 Zea mays Crp1 2.60E-18
Tb11.01.6040 ..06871.10 Lij32.1210
Tb10.6k15.0120 ..08307.50 Lij36.4810
T609.21 1 .3720 ..08463.20 Lij35.2950
T6927.1.2990 ..06363.50 Lij20.1580
T6927.7.1350 ..09505.80 Lmj F26.0610
T6927.4.4720 ..10087.50 Lij31.1700
Tb10.70.7360 ..03479.10 Lij21.1270
T6927.1 .1 1 60 ..07949.80 Lij20.0480
Tb11.02.5120 ..08239.20 Lij28.0040
T610.70.5780 ..08951 .10 Lij21 .0260
Tb10.389.0260 ..11275.40 Lij18.0910
Tb10.61.2890 ..11277.310 Lij18.0500
T6927.3.4450 ..07257.10 Lij29.2010
T6927.3.5240 ..10143.129 Lij29.0430
1692786040 ..04037.40 Lij24.2200
T6927.6.4190 ..1 1733.30 Lij30.2880
Er6927.8.4860 ..08837.160 Lij16.156
T6927.3.1330 ..09451 .24 Lij25.1230
T6927.6.4400 ..04257.20 Lij30.3100

b927.5.1790 ..10825.10 Lij15.041
Tb1 1 .01 .7930 ..08525.40 Lij32.3940
T609.160.4750 ..04881.40 Lij15-1.76

 

Table 6. Orthologs of 72 brucei PPR proteins. This table lists the orthologs

found in 72 cruzi and Leishmania majorthrough www.sanger.ac.uk,

www.tigr.org, and tcruzidb.org for each T brucei PPR protein.

TABLE 6

41

 

 

Discussion

Through our bioinformatics studies we found a PPR consensus sequence
that was slightly more 72 brucei specific, but aside from 5 conservative
replacements, the sequence was identical to the Arabidopsis derived PPR
consensus sequence. The bioinformatics studies were able to expand the list of
previously identified PPR genes from 18 [86] to 23 and identify homologs within
Le/shmania major and Trypanosoma cruzi. We also identified more PPR domains
in almost every putative PPR protein previously identified.

Based on the high conservation of the PPR consensus motifs that were
found between Arabidopsis and 72 brucei; the RNA binding properties suspected
in the plant PPR proteins were compared to the PPR domains of 72 brucei.
Williams et al. predicted that based on the TPR structure, positions 4 and 12 in
helix A of PPR motifs will be important in RNA binding. In a comparison of
several plant PPR motifs he found the pattern that position 4 is mostly uncharged
polar amino acids, asparagine being the most prevalent. Residues at position 12
are highly charged amino acids where lysine and arginine are most likely [2]. If
we look at a representative alignment of 72 brucei PPR motifs (Fig. 6 & 7), 9 out
of 14 of the motifs have an asparagine, serine or threonine at position 4 and 8
out of the 14 motifs have a lysine or arginine at position 12. Five out of the 14
of the representative motifs have both of these elements. Extending this

analysis to the total of the 72 brucei PPR domains, about half of them follow the

42

trend at position 4, one-third of them at position 12, and about a quarter of
them at both positions. Arginine, asparagine, serine, and lysine are the most
preferred amino acids at the RNA-protein interfaces, based on a statistical study
of 45 crystal structures between RNA and protein complexes by Treger et al.
[109]. This corresponds to the trends seen at positions 4 and 12 0f the 72 brucei
PPR motifs and the plant PPR motifs investigated by Williams et al. [2]. Another
interesting statistic from Treger et al. was that amino acids proline and
asparagine prefer contacts with RNA bases, and arginine and lysine prefer
phosphate contacts [109]. Asparagine is highly represented at position 4 in our
72 brucei motif alignments, implying possible contact with the bases of RNA
through hydrogen bonding. Arginine and lysine are highly represented at
position 12 inferring RNA phosphate contacts at this position of the 72 brucei

motifs.

43

PPR Putative RNA Contacting Residues

 

#- ‘AAA 3166-1144
‘3 1319119191] alfllfllflll 2 :2
m .9ng 5.0.29 9 . . 4
A1
C N

Figure 7. PPR Putative RNA contacting residues. Depiction of the amino
acids from positions 4 and 12 of each PPR motif in Tb927.2.3180 , that are
hypothesized to be involved in the substrate contacts. N is the N-terminus
and C, the C-terminus, of the protein, with A1 representing the first A helix
of the protein and progressing towards the C-terminus. 4, 8 and 12 are the
positions within the PPR motif sequence. The gray boxes in the back
represent the B helices. The amino acids circled in bold and clustered
towards the C-terminus are the ones that are predicted by Williams et al. [2]

to determine RNA binding of the PPR domains.

FIGURE 7

PPR proteins belong to the a-helical tandem repeat family of proteins that
include Tetracopeptide Repeat (TPR) proteins, HEAT repeat proteins, the Puf
family of proteins and armadillo (Arm) repeat proteins. Of these family
members, the Puf family of proteins has been shown to be RNA binding proteins
(Fig. 8). Puf family proteins are regulators of translation and mRNA stability that
are characterized by eight imperfect repeats of 36 amino acids. Each Puf repeat
forms a trihelical bundle that combines with other tandem Puf repeats to form a
right-handed superhelical arc type structure (Fig. 8). The Puf family of proteins
have been found in files, worms, slime mold, frogs, mouse, humans and yeast.
The crystal structure of the Drosophila Pumilio protein, a protein involved in the
control of hunchback mRNA in early Drosophila embryongenesis, showed that
the repeated a—helical structure of tandem Puf domains actually presents an RNA
binding surface for the 3' UTR of the hunchback mRNA on its inner, concave
surface. It is thought to bind other repressional proteins on its outer, convex
surface [110]. The crystal structure of human Pumiliol showed that each of its
eight tandem Puf repeats makes contacts with a different RNA base on its
concave, inner surface and it is sequence specific. Based on the structural
similarities of Puf repeat proteins and that of the PPR proteins, it is conceivable
that PPR proteins may bind RNA and other components of protein complexes as

well.

45

Figure 8. Family of a—helical repeat proteins. (A.) Pumillo protein made up of 8
Puf domains, a triple helix repeat protein found in Drosophila and humans. (3)
Cartoon of how the Pumilio protein is hypothesized to contact both the mRNA it
stabilizes as well as the other proteins in the complex. (C.) Three of the 01-
helical repeat family members. The first is B-catenin, a protein containing
armadillo repeats. The second is a Pumillo protein containing 8 Puf repeats. The
final one is a pp2A protein containing HEAT motifs. Obtained from Edwards,
T.A., et al., Structure of Pumilio reveals similarity between RNA and peptide

binding motilB. Cell, 2001. 105(2): p. 281-9.

46

Family of a-helical Repeat Proteins

A. B.

 

FIGURE 8

47

In general most of the studies in which PPR protein expression has been
altered,have specific effects on certain organellar RNAs [2, 62, 64, 65, 69, 71,
73-75, 78, 82, 85, 91, 94, 100]. However, direct evidence of PPR proteins
binding to RNA is limited. Both Radish p67 and Drosophila BSF were purified as
sequence-specific RNA binding proteins in vitro [66, 76]. The C-terminal half of
LRP130 has been shown to bind single-stranded polyadenylated RNA in vivo [83,
84]. Arabidopsis thaliana Hcf152 is a chloroplast protein that binds as a
homodimer to the petB exon-intron junctions with high affinity [73-75]. The
strongest evidence comes from recent immunoprecipitations and microarray
analysis showing that CRP1 binds specifically to petA and psaC mitochondrial
mRNA messages in maize [85]. The statistical evidence presented by Williams et
al. [2] and Treger et al. [109] also support PPR proteins binding to RNA.

Accumulated evidence suggests that PPR proteins are organellar proteins
involved in RNA metabolism. While the number of definitive studies is limited,
the mutant phenotypes and the characteristics of the PPR motif strongly suggest
that they are RNA binding proteins. In plants, the explosive expansion of this
family is thought to be due to the unique nature of the RNA processing that is
required. In trypanosomes, the mitochondrial genome is also transcribed in
polycistronic units and requires extensive processing to generated translatable
messages. The unique organization of the trypanosome mitochondrial genome

suggests that specific RNA binding proteins will be required for many of the

48

maturation steps. The identification of a large number of T. brucei PPR proteins,
most of which are mitochondrially targeted, suggests that PPR proteins will play

important roles in T. brucei mitochondrial biogenesis.

49

CHAPTER 3
RNAi DATA

50

Introduction

We have identified a large class of PPR proteins in Trypanosoma bruceI;
most of which have predicted mitochondrial targeting signals. This class of
proteins appears to play important roles in organellar RNA metabolism in plants.
In order to determine if one is important in organellar gene expression in 72
brucei as well, we have studied the effects of TbPPR1 (Tb927.2.3180) down
regulation on mitochondrial RNA expression. TbPPR1 was chosen because it had
the highest e-value of its PPR domains. TbPPR1 has the highest number of PPR
domains, when compared to the other identified 72 brucei PPR proteins, at 14
(Fig. 9). TbPPR1 is predicted to be 1004 amino acids in length with a molecular
weight of about 114 kD. Both MitoProt [102] and Predotar (http://genoplante-
info.infobiogen.fr/predotar/) predict TbPPR1 to contain a traditional
mitochondrial targeting signal.

We have targeted TbPPR1 for RNAi knockdown regulation in 72 brucei and
observed a reproducible slow growth phenotype when compared to non-induced
procyclic cells. The decrease in TbPPR1 mRNA was associated with specific
changes in the levels of several mitochondrial mRNAs and in RNA editing. For
the CYb transcript, we observed a decrease in the longer poly(A) tail and
increase in the shorter poly(A) tail size class. The 125 rRNA, 95 rRNA, and the
ND4 transcript showed a steady decrease throughout TbPPR1 RNAi induction.

We then looked further to investigate mRNA editing in our TbPPR1 deficient cell

51

line through using a “poison primer extension” assay and showed that the edited

CYb message is greatly decreased when TbPPR1 is knocked down.

Materials and Methods
RNAi construct

A double-stranded RNA target homologous to PPR1 was chosen with the
help of the TrypanoFAN: RNAit program (Whitehead Institute for Biomedical
Research). The program uses both MIT primer 3 [111] and NCBI Blast [112] to
both identify good fragments for PCR amplification and avoid crosstalk between
related gene products. A fragment from TbPPR1 was amplified through PCR of
29-13 72 brucei genomic DNA with primers synthesized by IDT:

PPR1F1XhoI 5’ TAGCT CGAGT GATTGT GCT GCAGGAG‘I'I' C 3’

PPR1 R1 HindIII 5’ TAGAAGCTT CT AAATCATCCGGCT CCAAA 3’

This amplified TbPPR1 from nucleotides 224-721 (Fig. 9).

52

TbPPR1 PPR domains

1 1 I I I I

I
T I I T I T T

;:_1 118.11) 300 300 400 500 (will) 7110 800 901) 10110

D =Pfam PPR domain

=Additional PPR domain
found with HMMER

Figure 9. TbPPR1 PPR domains. This figure is a graphical depiction of the
location of PPR domains on the TbPPR1 protein and the ones that are
located in tandem. They are concentrated between the middle to the C-
terminal end of the protein, with the majority of the motifs being in
tandem. The light gray boxes are PPR motifs found through Pfam and the
dark gray boxes are additional PPR motifs found with HMMER. The double
headed arrow indicates the region of the protein that was targeted for

RNAi in the pZIM vector.

FIGURE 9

53

Both the TbPPR1 fragment and pZJM vector (Fig. 10) were digested with XhoI
and HindIII (New England Biolabs), gel purified and ligated with T4 DNA Ligase

(Invitrogen) according to manufacturers instructions.

54

pZJM, 72 bruceidsRNA Expression Vector

    
 
   
   

 

 

T7 Terniknaltor

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

ACT polyA BLE

 

 

 

ALD polyA 7’71 #DNA spacer

 

 

 

 

Figure 10. pZJM T. brucei dsRNA expression vector. The pZJM construct has
two opposable T7 promoters (17) that drive the expression of the insert under
the control of a tetracycline operator (Tet Op). Integration is selected for by
bleomycin (BLE) resistance, driven by a separate, unregulated T7 promoter.
The construct contains rDNA sequence for plasmid integration. The SAS is the
splice acceptor site. ACT poly A and ALD poly A are the actin and aldolase
poly adenylation sites respectively. The construct is specific for the 72 brucei

cell line, 29-13, that stably expresses the T7 polymerase and Tetracycline

repressors.

FIGURE 10

55

Tranafefiion, RNAi inoogtion, and Growth Curve
Procyclic 72brucei strain 29-13 (generated by the George Cross lab) cells

are maintained in SDM-79 medium with 10% fetal bovine serum (FBS) (Sigma),
15 ug/ml G418 and 50 ug/ml hygromycin B. While on ice, 20 ug of linearized
plasmid in 100u| Elution Buffer (EB)(10 mM Tris-Cl, pH 8.5) was added to 0.5 ml
of 1 x 108 cells that had been washed and resuspended in three-quarters cytomix
(120mM KCI, 150uM CaClz, 10mM KzHPO4, 25mM HEPES, 2mM EDTA, and 5mM
MgClz, pH 7.6) and one-quarter PB (277mM sucrose, 7mM KHzPO4, 1mM MQCIz,
pH 7.4). The cells were electroporated with a BioRad Gene Pulser at 1.5 kV, 25
0F, co resistance for 2 pulses with 10 seconds between each pulse.
Electroporated cells were immediately transferred to 9.5 ml of SUM-79 medium
with 10% FBS and allowed to recover in a non-shaking 27°C incubator for ~16
hours. The cells were then centrifuged at 1500 x g and resuspended in SDM-79
with 10% FBS and 2.5 ug/ml phleomycin and put into a 27°C non-shaking
incubator for selection of stable transfectants. Cells were then induced for RNAi
production in the same medium with 1 ug/ml tetracycline and harvested in log
phase at the indicated times by centrifugation. Growth curves were plotted with
the cell counts multiplied by the dilution factors used to keep the cells in a
constant log phase of growth. Excel (Microsoft) was used to fit an exponential
line to the growth curves and the slope of the plus Tet divided by the slope of

the no Tet controls was used to calculate the growth rate.

56

Nofihern Anaylses

Total cellular RNA was isolated using a guanidinium-phenol-choloroform
procedure [113]. Ten micrograms of total RNA were run for each time point in
the RNAi growth curve on 1.5% formaldehyde denaturing agarose gels. RNA
was then transferred by downward capillary transfer overnight to a Nytran
membrane (Schliecher & Schuell Bioscience Inc.) and crosslinked. Probes for B-
tubulin, ND8 unedited, ND7 unedited, CYb, ND1 and ND4 were DNA probes
made with a random priming system (Invitrogen, Cat. No 18187-013) using a
PCR template with a32P-dATP. The CYb probe was designed to pick up both
edited and unedited messages. Probes specific for 125 and 9s ribosomal RNAs
were oligodeoxyribonucleotides (IDT), 32P—ATP end-labeled (Invitrogen T4
Kinase) according to the manufacturer’s instructions. Riboprobes made with the
T7 Maxiscript kit (Ambion, Cat. No 1312) and 0132P-ATP were used for PPR1 and

dsRNA-PPR1. Bands were quantitated using ImageQuant software (Amersham

Biosciences).

Poieon Primer Extensions

Total cellular RNA was isolated using a guanidinium-phenol-choloroform
procedure and DNase treated to remove contaminating genomic DNA [113]. The
following oligo was 5’ end-labeled with T4 kinase (Invitrogen) and 732-ATP

according to the manufacturer's instructions:

57

CY b poison RT 5’ CT ATATAAACAACCT GACATTAAAAGAC 3’

End-labeled primers were mixed in 1x RT Buffer (50 mM KCI, 20 mM Tris pH 8.3,
0.5 mM EDTA, and 8 mM MgCl2) with the indicated amounts of RNA in a volume
of 20 pl. The mixture was heated to 70°C for 2 minutes and then slowly cooled
2°C per minute to 50°C. Five pl of extension cocktail (1x RT Buffer, 10 mM
dATP, 5 mM d'l'l’P, 5 mM dCTP, 2 mM ddGTP, 20 units RNasin, 15 units of
Seikagaku AMV) ore-warmed to 50°C was added to the RNA-oligo mixture, and
the reaction incubated at 50°C for 45 minutes. Reactions were quenched on ice,
phenol/chloroform extracted and extension products were ethanol precipitated.
Primer extension products were analyzed by electrophoresis on 8%

polyacrylamide gels containing 8M urea.

Results
3M1

Induction of double-stranded RNA transcription causes a slow growth
phenotype when compared to uninduced cells (Fig. 11). Stable transfectants of
an RNAi strain against TbPPR1 were induced for RNAi production with 1 ug/ml
tetracycline. The growth rate is decreased on average to 64% 0f uninduced for
trials A through D. No morphological phenotype was seen by light microscopy in
these cells. Cell growth recovery was observed in every case after about 2
weeks, which is normal for RNAi in this system [114]. Cells were harvested at

time points throughout the growth curves from induced and non-induced cells

58

and the total RNA from these cells was isolated (Fig. 11). A control growth
curve is shown in Figure 12 to show that tetracycline has no significant effect on

untransfected 29-13 cells, the parent cell line.

59

Figure 11. TbPPR1 RNAi Growth Curves. The top graph depicts the
average growth curve for A and 8 trials for the TbPPR1 RNAi and the bottom
graph is for C and D trials. Total cells is calculated by the cell count multiplied by
the dilution factor used to keep the cells in a log phase of growth. The
black/diamond lines are cells not exposed to tetracycline, therefore not induced
for TbPPR1 RNAi. The gray/square lines are cells exposed to tetracycline and are
induced for TbPPR1 RNAi. A and B TbPPR1 RNAi cells decrease growth to 60%

of uninduced and C and D to 67.7% of uninduced.

6O

Total Cells (cells/ml)

Total Cells (cells/ml)

1 .00E+14

1.00E+13

1.00E+12

1.00E+11

1.00E+10

1 DOE-+09

1 .00E+08

1 .00E+07

1 DOE-+06

1.00E+1 1

1 .00E+10

1 DOE-+09

1 .00E+08

1 .00E+07

1.00E+06

i

TbPPR1 RNAi Growth Curves

PPR1 RNAi A 81 B

Z

//

 

 

 

 

/""”

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

+ NO TET
1‘ PLUS TET
2 6 8 10 12 14 15
PPR1 RNAI C & D
+ NO TET /
1‘ PLUS TE'll’

 

Day0

Day 2 Day 4 Day 6 Day 7 Day 9 Day 11 Day 13
Day Past Induction

FIGURE 11

 

Control for Tetracycline Exposure

 

 

 

 

 

 

 

 

 

 

 

1.00E+13 -
1.00E+12 /
-0 -no tet / ’

_ 1.00E+11 + plus tel ,4
e / I
= 1.00E+10 f
0
° /
'2 /

1.00E+08 , (

1,005+07 /

1.00E'I'06 T I r I I l T l I

 

 

Day 0 Day 2 Day 4 Day 6 Day 7 Day 9 Day Day
1 1 1 3
Days post induction

Figure 12. Control for Tetracycline Exposure. The graph depicts the
growth curve for untransfected 29-13 cells exposed to tetracycline. Total
cells is calculated by the cell count multiplied by the dilution factor used to
keep the cells in a log phase of growth. The black/diamond, dotted lines
are cells not exposed to tetracycline. The gray/square lines are cells
exposed to tetracycline. The growth rate of the cells show no significant

difference upon exposure to tetracycline.

FIGURE 12

62

The RNA was then used in Northern blot analysis and hybridized with end-
labeled oligos, random primed labeled oligos, or riboprobes to recognize TbPPR1
mRNA, the dsRNA-TbPPR1 that was used in the vector construct, and other
mitochondrial messages.

The TbPPR1 message, from growth curve A, was probed with a riboprobe
that hybridized to the same portion of TbPPR1 message that is in the RNAi
construct. This will give bands for the TbPPR1 message and for the smaller
dsRNA that is produced from our pZJM-TbPPR1 construct. The TbPPR1 message
was visibly decreased in the cells that were induced for RNAi with tetracycline.
There is some noticeable recovery of the cells by Day 15, which is a common
occurrence for RNAi in trypanosomes [114-116]. There was a dramatic increase
in production of the dsRNA upon tetracycline addition to the media, with the
highest production on Day 3. There is also some leaky expression of dsRNA that
is apparent in the no tetracycline lanes. This has also been reported in
Trypanosomes [114, 117]. However, TbPPR1 levels were not visibly reduced by
the leaky dsRNA expression when compared to the parent cell line (data not

shown) (Fig. 13).

63

Northern Blot of TbPPR1 RNAi Trial A: TbPPR1 and dsRNA

Expression

+Tet NoTet
Day 35791215 35791115

 

   
 

   
     

 

Figure 13. Northern blot of TbPPR1 RNAi Trial A: TbPPR1

 

 

mRNA and dsRNA expression. The left side of the blot shows
samples from cells induced for TbPPR1 RNAi expression (+Tet)
and the right side shows samples from uninduced cells (No Tet)
RNA was isolated on Days 3, 5, 7, 9, 11/12, 15 post induction.
The top band is the TbPPR1 full-length message, which is visibly
decreased in the + tetracycline lanes. The middle three bands
represent the rRNAs of the cell from nonspecific binding of the
probe. The bottom band is the dsRNA TbPPR1 message
produced from the pZJM-TbPPR1 vector when cells are induced
with tetracycline. There is evidence of the dsRNA production

without the presence of tetracycline.
FIGURE 13

 

Evl tinf PP 1Del inEff nMit hnrilRNATrnscri

The Northerns from Growth Curves C/D were probed and the signals were
normalized against the B-Tubulin signal for that lane (Fig. 14—16). Then the ratio
of the plus Tet signal to the no Tet signal was calculated. The 125 rRNA signal
at ~2 kb decreased about 50%, Days 2-9, but it then increased on Day 13 (Fig.
14). The 95 rRNA signal is at about 606 nucleotides (nt) and went from an slight
induction on Day 2 down to 52% of no Tet on Day 9. It also increased above
100% on Day 13 (Fig. 14). This shows that initially 95 is slightly induced, but
there is an overall decrease in the ribosomal expression through the TbPPR1
RNAi induction Days 2-9. There then is an increase in steady state levels on Day
13 indicating that the cells may be recovering from the RNAi effect on this day.
Days 12 and 15 on the Northern of the TbPPR1 expression also show that the

TbPPR1 expression is increasing at this time as well (Fig. 13).

65

 

Northern Blot of TbPPR1 RNAi Trial C/D: 12s and 95 rRNA Expression

 

 

 

 

 

 

A. +Tet no Tet
Day 247913 247913

 

 

 

 

 

 

 

 

as Y

B-Tubulin ..1 ..1 a at a. 115 ..1 ..., .1.»

A

 

 

 

 

 

 

 

 

 

B.

I I Day 2 I Day 4 I Day 7 I Day 9 I Day 13 I
| 12s | 0.98 0.64 | l . 0.52 | 2.01 |
| 9s | 1.20 | 0.74 | 0.90 | 0.52 | 1.48 ]

 

Figure 14. Northern blot of TbPPR1 RNAi Trial C/D: 125 and 9s rRNA
expression. A. + Tet=induced (+ tetracycline) and no
Tet=uninduced (no tetracycline) for TbPPR1 RNAi expression on Days
2-13 post induction. 125=125 ribosomal RNA, 9s=9s ribosomal RNA,
and B-Tubulin message used as a loading control. B. Quantitation of
the signal normalized against B-Tubulin indicates decrease in
expression of both rRNAs with a recovery observed by Day 13. 125
Day 7 not quantitated due to defects in gel that could not be

accounted for in the ouantitation.

FIGURE 14

66

The ND7, 8, and 9 from mitochondrial Complex I, all had no significant
change in the expression for the unedited forms when induced for TbPPR1 RNAi
(Fig. 15) Days 2-9 post induction. The never edited ND1 also remains
unchanged during the TbPPR1 RNAi induction. The single band at 1300 nt ND1
is between 102% and 115% Days 2-13, remaining unchanged (Fig. 15). ND7
unedited signal, at ~850 nt, remained between 89% and 99% of no Tet. The
ND8 unedited signal at about 520-550 nt remained between 94% and 84% of no
Tet Days 2-9. On Day 13 ND8 unedited signal increased. The ND9 unedited at
340 nt was between 91% and 97% Days 2-7 and increased by Day 13 (Table 7).
This shows little overall change in most Complex I mitochondrial mRNA
expression throughout Days 2-9 of our TbPPR1 RNAi induction. Some of the
mRNA messages do show an increase on Day 13, similar to that seen in the 125
and 9s rRNAs. This may also indicate recovery of the cells from the tetracycline
induced RNAi effect.

While most Complex I members show no change in expression Days 2-9
of the TbPPR1 RNAi induction, there is a specific decrease in both size transcripts
(1600 and 1400 nt) of ND4 for the same time points. The larger transcripts are
the long size class of poly(A) tail (~200 nt) and the smaller transcripts are the
short poly(A) tail size classes (~20 nt). ND4 decreases from 135% of no Tet on
Day 2 to 46% on Day 9. Similar to 125, 95 and some other Complex I members,

the ND4 expression increases back up to 112% of no Tet on Day 13 (Fig. 15).

67

Figure 15. Northern blots of TbPPR1 RNAi Trial C/D: Complex I expression. A.
+ Tet: induced (+tetracycline) and no Tet=uninduced (no tetracycline) for
TbPPR1 RNAi expression Days 2 —13 post induction. The top panels are the
Complex I Northern blots: ND8un= NADH dehydrogenase subunit 8 unedited
message, ND9un= ND9 unedited message, ND7un=ND7 unedited message,
ND1, and ND4 message. The bottom panel is the B-Tubulin message used as a
loading control. B. Quantitation of the signals normalized to B-Tubulin indicate
no overall change in expression of Complex I mRNAs during the TbPPR1
induction Days 2-9, except for a decrease in both bands of the ND4 message.
Many messages also show an increase in their steady state levels on Day 13.

The arrows point to the two size class transcripts of ND4.

68

Northern Blots of TbPPR1 Trial C/ D: Complex I Expression

A.
+ Tet no Tet

Day 247913 247913
ND8un I T I I - 1 I

 

 

 

 

 

 

 

ND9un

 

 

 

 

ND7un

 

 

 

 

 

 

ND 1
ND4

 

 

 

 

 

 

 

 

 

 

 

 

 

 

B-Tubulin - .1... ..1. I? I" Ii" in I" 4.. CI

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

B.
Day 2 Day 4 Day 7 Day 9 Day 13
N08 0.94 0.84 0.92 0.93 4.02
N09 0.95 0.91 0.97 1.31 1.69
ND7 0.99 0.89 0.88 0.99 0.90
ND1 1.14 1.15 1.04 1.02 1.14
ND4 1.37 0.80 0.78 0.46 1.12
FIGURE 15

69

72 brucei mitochondrial Complex III’s CYb transcripts showed some
interesting results on the Northern. The probe used recognized both the edited
and unedited CYb message. The upper transcript (1350 nt), long poly(A) tail size
class, decreases along with the induction of TbPPR1 RNAi in the plus Tet induced
lanes. It is also evident that the lower transcript (1200 nt), short poly(A) tail size
class, increases when induced for TbPPR1 RNAi (Fig. 16). The steady state
levels of the total CYb transcripts increase during all 13 Days of TbPPR1 RNAi
induction. It begins at 165% of no Tet on Day 2, decreases to 103% on Day 4,
and then progressively increases to 459% on Day 13 (Fig. 16). This shows the
overall steady state levels of CYb message increases during TbPPR1 RNAi
induction, but the size classes of poly(A) tail steady state levels change with the
longer class decreasing and the shorter size class increasing. The longer poly(A)
size class of CYb is primarily edited CYb messages while the unedited CYb

messages are only in the shorter poly(A) size class [43].

70

Northern Blot of TbPPR1 RNAi Trial CID: CYb Expression

 

 

 

 

 

 

 

 

 

 

 

 

 

 

A.
+Tet no Tet
Day 247913 247913
. ' .. ‘4— T 1 <—
CYb , ..1 111— .. 1. .. ,_
B-Tubulin 1.. 1..., g, 1... a g, a a, ..1
B.
I I Day2 I Day4 I Day7 I ILayQ I Day13I
| CYb | 1.65 | 1.03 | 1.41 | 2.28 | 4.59 J

 

Figure 16. Northern blot of TbPPR1 RNAi Trial C/D: CYb expression. A.
+ Tet=induced (+ tetracycline) and no Tet=uninduced (no tetracycline)
for TbPPR1 RNAi expression on Days 2-13 post induction.
CYb=Cytochrome b mRNA and B-Tubulin message is used as a loading
control. There is an obvious decrease in the upper band or longer
poly(A) tail size class when induced for TbPPR1 RNAi. The arrows point
to both poly(A) size classes of CYb. B. Quantitation of the signal
normalized against B-Tubulin indicates an increase in expression of both

size class of transcripts combined through Day 13.

FIGURE 16

71

Notthern Sommaty. The Northern results show a decrease in expression
of the ribosomal RNAs, though the 9s rRNA may be slightly induced initially.
Complex I messages, N01, 7, 8, and 9 also show no significant change in steady
state expression levels throughout the TbPPR1 RNAi induction Days 2-9. CYb of
Complex III, had a great decrease in the intensity of the long poly(A) size class
transcripts during TbPPR1 RNAi, but it had an overall increase in its steady state
levels of the shorter poly(A) size class transcripts. ND4 also looked like it
followed the same pattern as CYb, loss of longer poly(A) size class transcripts,
but when it was further quantitated there was a decrease in both of its bands,
not just the longer poly(A) size class. ND4 is the only Complex I member to
decrease in expression that we have identified.

Poison Primer Extension

The longer poly(A) tail size class of CYb is primarily edited CYb and the
unedited CYb messages are only in the short poly(A) size classes [43]. Based on
the loss of the longer poly(A) size class transcripts of CYb during TbPPR1 RNAi,
we investigated whether the editing of CYb was truly affected through “poison"
primer extension analysis. CYb is edited by the insertion of 34 U-residues at 13
different sites near the 5’ end of the transcript [36]. Placing a reverse
transcription (RT) primer directly 3' of the first CYb editing site and replacing
dG‘l’ P in the Poison Primer reaction cocktail with ddGTP will stop synthesis at the

first cytosine residue encountered, producing a 74 nt band for the edited CYb

72

messages and a 45 nt band for the unedited CYb messages (Fig. 17). Both
bands are then quantitated and the ratio of edited to unedited CYb message is
calculated. Our analyses indicate that there is a distinct loss of editing activity in
the samples induced for TbPPR1 RNAi induction (+Tet) compared with those that
were not (- Tet). The samples from the cells induced for TbPPR1 RNAi induction
showed an edited:unedited ratio of ~1% to 9%, indicating that most of the
messages are unedited. The cells that were not induced for TbPPR1 RNAi
showed ratios between 47% to 114%. In the no Tet lanes there is a lower ratio
for the 10ug RNA samples versus the 5 ug RNA samples. This may be due to a
limiting factor in our Poison Primer Reaction Buffer, most likely dATP due to all of
the editing that is present. This experiment shows a clear loss of CYb editing
activity that accompanies the loss of the long poly(A) tail size class of transcripts

when the cells are induced for TbPPR1 RNAi.

73

Figure 17. Poison Primer Extension of CYb on TbPPR1 RNAI Total RNA. A. The
RNA sequences of both unedited (top) and edited (bottom) where the capital
letters are nucleotides encoded by the maxicircle genome and the lowercase,
bold u’s are the u's added during mRNA editing as directed by the gRNA. The
outlined “C" is where the reverse transcription will stop when (1de is
incorporated. Position of the primer is indicated with black boxes. The arrow
shows the extension that we expect with the size of each product, including the
primer length, listed. B. Primer extension analysis of CYb editing during PPR
knockdowns when both 5 and 10 micrograms of + tetracycline and no
tetracycline total RNA from the corresponding time points were analyzed. The
ratio of the edited to unedited band was then quantified and shown below its

corresponding lane.

74

Poison Primer Extension of CYb on TbPPR1 RNAi Total RNA

 

 

 

A. 5' AAAG©GGAGAAAAAAGAAAGGGUCUUUUAAUGUCAGGUUGUUUAUAUAG 3'
5' "(TC T '.C.'.__.._...'.__.' '.__.'....._.'.C."..“.""""""""""' IflIlIlIlIAAUGUCAGG" 3
.2... N
Day 2 Day 4 Day 7
B. r—‘x r \ r \
Tet + + + + - - + + - -

ugRNA 510510510510510

 

Edited CYb—> my. all!" w
74nt

 

Unedited CYb

 

 

 

    

         

45nt
Primer """
Ratio 0.09 0.08 0.01 0.05 1.14 0.76 0.01 0.03 0.64 0.47
Edited/Unedited
FIGURE 17

75

Discussion and Conclusion

The family of PPR proteins is an interesting and greatly expanding family
in plants. Therefore their functions in 72 brucei should also prove to be of great
interest. Based on analysis of the other RNA binding proteins, PPR proteins
show a high probability of being RNA binding proteins. Studies of plant PPR
proteins and those in other eukaryotes, show that they are involved in different
processes of organellar mRNA expression. Our bioinformatics studies built on
the 18 72 brucei PPR proteins found by Lurin et al. [86], expanding the family to
23 proteins in 72 brucei and finding more PPR domains in the proteins already
discovered. It also showed that this is a family of proteins that is well conserved
throughout the kinetoplastid family.

Knocking down TbPPR1 (Tb927.2.3180) through RNAi has a clear effect
on the growth of 72 brucei. This same growth defect was seen using this
plasmid for RNAi in other studies [117-121]. The slow growth phenotype that
accompanied the knockdown of TbPPR1 along with the importance of PPR
proteins in other organisms led us to further investigate the function of TbPPR1
in the mitochondrial RNA metabolism in 72 brucei. The ribosomal RNAs decrease
in expression and ND1, ND7, ND8 and ND9 mRNAs all remain relatively
unchanged during TbPPR1 RNAi induction. The ribosomal decrease may be a
direct or indirect effect from the loss of TbPPR1, but not enough is understood

about 72 brucei mitochondrial biogenesis to know for sure. A similar ribosomal

76

RNA decrease also occurs in the cytoplasm of bacteria when undergoing stress
induced by pH changes [122].

For CYb mRNA, the amount of long poly(A) tail size class present during
TbPPR1 RNAi induction, seems to decrease whereas the short poly(A) tail size
class is stabilized. ND4 also appeared to lose the long poly(A) tail size class, but
without any stabilization of the short poly(A) tail size class; however
quantification showed that there is a decrease in both poly(A) tail size classes.
There are several possibilities to explain why the long poly(A) tail size class of
CYb decreased. One theory is that there may be a defect in polyadenylation.
Loss of TbPPR1 could be affecting the poly(A) machinery itself or a simple loss of
ATP to incorporate into the poly(A) tails due to cellular stress as the TbPPR1
RNAi progresses. It could also be due to loss of CYb editing as shown in the
poison primer extension analysis. It has been shown that the majority of the
long poly(A) tail size class is composed of edited CYb messages, where the
unedited messages are in the short poly(A) tail size class [43]. We do know that
for the RP512 mRNA, the edited form is targeted for destruction when it does
not posses a poly(A) tail. In contrast the unedited form is targeted for
destruction when it does contain a poly(A) tail [50, 123]. So for this mRNA,
there is a connection between the editing state, poly(A) tail addition and mRNA
degradation which may also be occurring for CYb. Both mRNA editing and
processing/polyadenylation have been shown to be two independent events [31].

Based on this information, the composition of the CYb poly(A) tails in the TbPPR1

77

knockdowns should be studied next. The loss of ND4 would not fit this
hypothesis since ND4 is never edited. Unfortunately, there is not yet enough
information available on T. brucei mitochondria RNA metabolism to speculate any
further.

Further studies should then tell us if transcripts within the bloodstream
form are affected by TbPPR1 RNAi and whether the protein expression is
affected confirming a role in mitochondrial mRNA biogenesis. Further structural
studies should also confirm that these PPR proteins are in fact RNA binding
proteins.

Future Work

We have been attempting to confirm the Northern results using Real Time
PCR, but we are still optimizing this procedure. We have developed good primer
pairs that produce high quality melt curves for almost every mitochondrial
transcript. Primer concentrations and cDNA concentrations are still being
optimized for each primer set. We have also begun to characterize the poly(A)
tails in the TbPPR1 RNAi cells through 5’ and 3’ RACE, but more primer pair
optimization must also be worked out here.

Regulation of both the TbPPR1 protein and RNA from both bloodstream
and procyclic Trypanosomes can be further studied with Westerns and Northerns
respectively. Many characterization studies can also be done when we in vivo
epitope label the PPR1 protein or obtain antibodies against the TbPPR1 protein.

Western blot protein characterization, immunolocalization, subcellular

78

fractionation, and protein complex studies can all be done with these epitope
tags and/or antibodies.

We are also working on a collaboration to express the TbPPR proteins and
perform crystallography and NMR studies with the proteins and their RNA
substrates (determined through mRNA expression alterations via Northern blots
and ribonuclease protection assays) to look at the binding surface of the PPR
motif. These proteins and RNA substrates will also be used in gel mobility shift
assays to determine the kinetics of binding. Eventually we hope to use several

different approaches to find some drugs that target these PPR proteins.

79

BIBLIOGRAPHY

8O

10.

ll.

12.

13.

14.

Small, ID. and N. Peeters, The PPR motif - a TPR-related motif prevalent in
plant organellar proteins. Trends Biochem Sci, 2000. 25(2): p. 46-7.

Williams, RM. and A. Barkan, A chloroplast-localized PPR protein required for
plastid ribosome accumulation. Plant J, 2003. 36(5): p. 675-86.

Pepin, J., et al., Trial of prednisolone for prevention of melarsoprol-induced
encephalopathy in gambiense sleeping sickness. Lancet, 1989. 1(8649): p. 1246-
50.

Vickerman, K. and AG. Luckins, Localization of variable antigens in the surface

coat of Trypanosoma brucei using ferritin conjugated antibody. Nature, 1969.
224(224): p. 1125—6.

Le Ray, D., J .D. Barry, and K. Vickerrnan, Antigenic heterogeneity of metacyclic
forms of Trypanosoma brucei. Nature, 1978. 273(5660): p. 300-2.

Jenni, L., Comparisons of antigenic types of Trypanosoma (T)brucei strains
transmitted by Glossina m. morsitans. Acta Trop, 1977. 34(1): p. 35-41.

Ryley, J .F., Studies on the metabolism of the protozoa. 9. Comparative
metabolism of blood-stream and culture forms of Trypanosoma rhodesiense.
Biochem J, 1962. 85: p. 211-23.

Flynn, I.W. and LB. Bowman, The metabolism of carbohydrate by pleomorphic
African trypanosomes. Comp Biochem Physiol B, 1973. 45(1): p. 25-42.

Cazzulo, J .J ., Aerobic fermentation of glucose by trypanosomatids. Faseb J, 1992.
6(13): p. 3153-61.

Lamour, N., et al., Praline metabolism in procyclic Trypanosoma brucei is down-
regulated in the presence of glucose. J Biol Chem, 2005. 280(12): p. 11902-10.

Grant, RT. and J .R. Sargent, L-alpha-Glycerophosphate dehydrogenase, a
component of an oxidase system in Trypanosoma rhodesiense. Biochem J, 1961.
81: p. 206-14.

Bienen, E.J., E. Hammadi, and CC. Hill, Trypanosoma brucei: biochemical and
morphological changes during in vitro transformation of bloodstream- to
procyclic-trypomastigotes. Exp Parasitol, 1981. 51(3): p. 408-17.

Beattie, D.S. and M.M. Howton, The presence of rotenone-sensitive NADH
dehydrogenase in the long slender bloodstream and the procyclicforms of
Trypanosoma brucei brucei. Eur J Biochem, 1996. 241(3): p. 888-94.

Nolan, DP. and HF. Voorheis, The mitochondrion in bloodstream forms of

Trypanosoma brucei is energized by the electrogenic pumping of protons
catalysed by the F I F O-ATPase. Eur J Biochem, 1992. 209(1): p. 207-16.

81

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

Bochud-Allemann, N. and A. Schneider, Mitochondrial substrate level

phosphorylation is essential for growth of procyclic Trypanosoma brucei. J Biol
Chem, 2002. 277(36): p. 32849-54.

Coustou, V., et al., ATP generation in the Trypanosoma brucei procyclic form:

cytosolic substrate level is essential, but not oxidative phosphorylation. J Biol
Chem, 2003. 278(49): p. 49625-35.

van Weelden, S.W., et al., Procyclic Trypanosoma brucei do not use Krebs cycle
activity for energy generation. J Biol Chem, 2003. 278(15): p. 12854-63.

Schultz, BE. and SI. Chan, Structures and proton-pumping strategies of
mitochondrial respiratory enzymes. Annu Rev Biophys Biomol Struct, 2001. 30:
p. 23-65.

Walker, R., Jr., et al., The effect of over-expression of the alternative oxidase in
the procyclic forms of Trypanosoma brucei. Mol Biochem Parasitol, 2005.
139(2): p. 153-62.

Fang, J. and D.S. Beattie, Alternative oxidase present in procyclic Trypanosoma

brucei may act to lower the mitochondrial production of superoxide. Arch
Biochem Biophys, 2003. 414(2): p. 294-302.

Michelotti, BF. and S.L. Hajduk, Developmental regulation of trypanosome
mitochondrial gene expression. J Biol Chem, 1987. 262(2): p. 927-32.

Michelotti, E.F., et al., Trypanosoma brucei mitochondrial ribosomal RNA
synthesis, processing and developmentally regulated expression. Mol Biochem
Parasitol, 1992. 54(1): p. 31-41.

Myler, P.J., et al., Structural organization of the maxicircle variable region of
Trypanosoma brucei: identification of potential replication origins and
topoisomerase [1 binding sites. Nucleic Acids Res, 1993. 21(3): p. 687-94.

Clement, S.L., M.K. Mingler, and DJ. Koslowsky, An Intragenic Guide RNA
Location Suggests a Complex Mechanism for Mitochondrial Gene Expression in
Trypanosoma brucei. Eukaryot Cell, 2004. 3(4): p. 862-9.

J asmer, DP. and K. Stuart, Conservation of kinetoplastid minicircle

characteristics without nucleotide sequence conservation. Mol Biochem Parasitol,
1986. 18(3): p. 257-69.

Pollard, V.W. and S.L. Hajduk, Trypanosoma equiperdum Minicircles Encode
Three Distinct Primary Transcripts Which Exhibit Guide RNA Characteristics.
molecular and Cellular Biology, 1991: p. 1668-1675.

82

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

37.

Koslowsky, D.J., et al., Guide RNAs for transcripts with developmentally
regulated RNA editing are present in both life cycle stages of Trypanosoma
brucei. Mol Cell Biol, 1992. 12(5): p. 2043-9.

Hong, M. and L. Simpson, Genomic organization of Trypanosoma brucei
kinetoplast DNA minicircles. Protist, 2003. 154(2): p. 265-79.

Riley, G.R., R.A. Corell, and K. Stuart, Multiple guide RNAs for identical editing
of Trypanosoma brucei apocytochrome b mRNA have an unusual minicircle
location and are developmentally regulated. J Biol Chem, 1994. 269(8): p. 6101-
8.

Grams, J ., M.T. McManus, and S.L. Hajduk, Processing of polycistronic guide
RNAs is associated with RNA editing complexes in Trypanosoma brucei. The
EMBO Journal, 2000. 19(20): p. 5525-5532.

Koslowsky, DJ. and G. Yahampath, Mitochondrial mRNA 3'
cleavage/polyadenylation and RNA editing in Trypanosoma brucei are
independent events. Mol Biochem Parasitol, 1997. 90(1): p. 81-94.

Read, L.K., P.J. Myler, and K. Stuart, Extensive editing of both processed and

preprocessed maxicircle CR6 transcripts in Trypanosoma brucei. J Biol Chem,
1992. 267(2): p. 1123-8.

Feagin, J .E., D.P. J asmer, and K. Stuart, Apocytochrome b and other

mitochondrial DNA sequences are differentially expressed during the life cycle of
Trypanosoma brucei. Nucleic Acids Res, 1985. 13(12): p. 4577-96.

J asmer, D.P., J .E. Feagin, and K. Stuart, Diverse patterns of expression of the
cytochrome c oxidase subunit I gene and unassigned reading frames 4 and 5
during the life cycle of Trypanosoma brucei. Mol Cell Biol, 1985. 5(11): p. 3041-
7.

Feagin, J .E. and K. Stuart, Diflerential expression of mitochondrial genes between
life cycle stages of Trypanosoma brucei. Proc Natl Acad Sci U S A, 1985. 82(10):
p. 3380-4.

Feagin, J .E., D.P. J asmer, and K. Stuart, Developmentally regulated addition of

nucleotides within apocytochrome b transcripts in Trypanosoma brucei. Cell,
1987. 49(3): p. 337-45.

Souza, A.E., P.J. Myler, and K. Stuart, Maxicircle CR1 transcripts of
Trypanosoma brucei are edited and developmentally regulated and encode a

putative iron-sulfur protein homologous to an NADH dehydrogenase subunit. Mol
Cell Biol, 1992. 12(5): p. 2100-7.

83

38.

39.

40.

41.

42.

43.

44.

45.

46.

47.

48.

49.

Souza, A.E., et al., Extensive editing of CR2 maxicircle transcripts of
Trypanosoma brucei predicts a protein with homology to a subunit of NADH
dehydrogenase. Mol Cell Biol, 1993. 13(11): p. 6832-40.

Koslowsky, D.J., et al., The M URF 3 gene of T. brucei contains multiple domains
of extensive editing and is homologous to a subunit of NADH dehydrogenase.
Cell, 1990. 62(5): p. 901-11.

Corell, R.A., P. Myler, and K. Stuart, Trypanosoma brucei mitochondrial CR4
gene encodes an extensively edited mRNA with completely edited sequence only in

bloodstream forms. Mol Biochem Parasitol, 1994. 64(1): p. 65-74.

Priest, J .W. and S.L. Hajduk, Developmental regulation of Mitochondrial
Biogenesis in Trypanosoma brucei. Journal of Bioenergetics and Biomemebranes,

1994. 26(2): p. 179-191.

Feagin, J .E., J .M. Abraham, and K. Stuart, Extensive editing of the cytochrome c
oxidase III transcript in Trypanosoma brucei. Cell, 1988. 53(3): p. 413—22.

Feagin, J .E. and K. Stuart, Developmental aspects of uridine addition within
mitochondrial transcripts of Trypanosoma brucei. Mol Cell Biol, 1988. 8(3): p.
1259-65. -

Blum, B., N. Bakalara, and L. Simpson, A model for RNA editing in kinetoplastid
mitochondria: "guide" RNA molecules transcribed from maxicircle DNA provide
the edited information. Cell, 1990. 60(2): p. 189-98.

Bhat, G.J., et al., An extensively edited mitochondrial transcript in kinetoplastids
encodes a protein homologous to ATPase subunit 6. Cell, 1990. 61(5): p. 885-94.

Bhat, G.J., et al., Transcript-specific developmental regulation of polyadenylation
in Trypanosoma brucei mitochondria. Mol Biochem Parasitol, 1992. 52(2): p.
231-40.

Militello, K.T. and L.K. Read, Coordination of kRNA editing and polyadenylation
in Trypanosoma brucei mitochondria: complete editing is not required for long
poly(A) tract addition. Nucleic Acids Res, 1999. 27(5): p. 1377-85.

Read, L.K., et al., Editing of Trypanosoma brucei maxicircle CR5 mRNA
generates variable carboxy terminal predicted protein sequences. Nucleic Acids
Res, 1994. 22(8): p. 1489-95.

Feagin, J .E., D.P. J asmer, and K. Stuart, Differential mitochondrial gene

expression between slender and stumpy bloodforms of Trypanosoma brucei. Mol
Biochem Parasitol, 1986. 20(3): p. 207-14.

84

50.

51.

52.

53.

54.

55.

56.

57.

58.

59.

60.

61.

Kao, CY. and L.K. Read, Opposing efi‘ects of polyadenylation on the stability of
edited and unedited mitochondrial RNAs in Trypanosoma brucei. Mol Cell Biol,
2005. 25(5): p. 1634-44.

Militello, K.T. and L.K. Read, UTP-dependent and -independent pathways of
mRNA turnover in Trypanosoma brucei mitochondria. Mol Cell Biol, 2000.
20(7): p. 2308-16.

Decker, C]. and B. Sollner—Webb, RNA editing involves indiscriminate U
changes throughout precisely defined editing domains. Cell, 1990. 61(6): p. 1001-
11.

Read, L.K., et al., Developmental regulation of RNA editing and polyadenylation
in four life cycle stages of Trypanosoma congolense. Mol Biochem Parasitol,
1994. 68(2): p. 297-306.

Gagliardi, D. and C]. Leaver, Polyadenylation accelerates the degradation of the
mitochondrial mRNA associated with cytoplasmic male sterility in sunflower.
Embo J, 1999. 18(13): p. 3757-66.

Gagliardi, D., et al., Plant mitochondrial polyadenylated mRNAs are degraded by

a 3 '- to 5 '-exoribonuclease activity, which proceeds unimpeded by stable
secondary structures. J Biol Chem, 2001. 276(47): p. 43541-7.

Lupold, D.S., A.G. Caoile, and DB. Stern, Polyadenylation occurs at multiple
sites in maize mitochondrial cox2 mRNA and is independent of editing status.
Plant Cell, 1999. 11(8): p. 1565-78.

Kuhn, J ., U. Tengler, and S. Binder, Transcript lifetime is balanced between
stabilizing stem-loop structures and degradation-promoting polyadenylation in

plant mitochondria. Mol Cell Biol, 2001. 21(3): p. 731-42.

Ojala, D., J. Montoya, and G. Attardi, tRNA punctuation model of RNA
processing in human mitochondria. Nature, 1981. 290(5806): p. 470-4.

Temperley, R.J., et al., Investigation of a pathogenic mtDNA microdeletion
reveals a translation-dependent deadenylation decay pathway in human
mitochondria. Hum Mol Genet, 2003. 12(18): p. 2341-8.

Gagliardi, D., et al., Messenger RNA stability in mitochondria: different means to
an end. Trends Genet, 2004. 20(6): p. 260-7.

Manthey, G.M., B.D. Przybyla-Zawislak, and J .E. McEwen, The Saccharomyces
cerevisiae Pet309 protein is embedded in the mitochondrial inner membrane. Eur
J Biochem, 1998. 255(1): p. 156-61.

85

62.

63.

65.

66.

67.

68.

69.

70.

71.

72.

73.

Krause, K., et al., The mitochondrial message-specific mRNA protectors Cpr
and Pet309 are associated in a high-molecular weight complex. Mol Biol Cell,
2004. 15(6): p. 2674-83.

N aithani, S., et al., Interactions among COX1, C 0X2, and C 0X3 mRNA-specific
translational activator proteins on the inner surface of the mitochondrial inner
membrane of Saccharomyces cerevisiae. Mol Biol Cell, 2003. 14(1): p. 324-33.

Coffin, J .W., et al., The Neurospora crassa cya-5 nuclear gene encodes a protein
with a region of homology to the Saccharomyces cerevisiae PET309 protein and

is required in a post-transcriptional step for the expression of the mitochondrially
encoded COX1 protein. Curr Genet, 1997. 32(4): p. 273-80.

Fisk, D.G., M.B. Walker, and A. Barkan, Molecular cloning of the maize gene
crpI reveals similarity between regulators of mitochondrial and chloroplast gene
expression. Embo J, 1999. 18(9): p. 2621-30.

Lahmy, S., et al., A chloroplastic RNA-binding protein is a new member of the
PPR family. FEBS Lett, 2000. 480(2-3): p. 255-60.

Bentolila, S., A.A. Alfonso, and MR. Hanson, A pentatricopeptide repeat-
containing gene restores fertility to cytoplasmic male-sterile plants. Proc N at]
Acad Sci U S A, 2002. 99(16): p. 10887-92.

Brown, G.G., et al., The radish Rfo restorer gene of Ogura cytoplasmic male
sterility encodes a protein with multiple pentatricopeptide repeats. Plant J, 2003.
35(2): p. 262-72.

Desloire, S., et al., Identification of the fertility restoration locus, Rfo, in radish,

as a member of the pentatricopeptide-repeat protein family. EMBO Rep, 2003.
4(6): p. 588-94.

Koizuka, N., et al., Genetic characterization of a pentatricopeptide repeat protein
gene, orf68 7, that restores fertility in the cytoplasmic male-sterile Kosena radish.
Plant J, 2003. 34(4): p. 407-15.

Kazama, T. and K. Toriyama, A pentatricopeptide repeat-containing gene that
promotes the processing of aberrant atp6 RNA of cytoplasmic male-sterile rice.
FEBS Lett, 2003. 544(1-3): p. 99-102.

Komori, T., et al., Map-based cloning of a fertility restorer gene, Rf-l, in rice
(Oryza sativa L. ). Plant J, 2004. 37(3): p. 315-25.

N akamura, T., et al., Chloroplast RNA-binding and pentatricopeptide repeat
proteins. Biochem Soc Trans, 2004. 32(Pt 4): p. 571-4.

86

74.

75.

76.

77.

78.

79.

80.

81.

82.

83.

84.

85.

Nakamura, T., et al., RNA-binding properties of H CF 1 52, an Arabidopsis PPR
protein involved in the processing of chloroplast RNA. Eur J Biochem, 2003.
270(20): p. 4070-81.

Meierhoff, K., et al., HCF152, an Arabidopsis RNA binding pentatricopeptide
repeat protein involved in the processing of chloroplast psbB-pst-pst—petB-
petD RNAs. Plant Cell, 2003. 15(6): p. 1480-95.

Mancebo, R., et al., BSF binds specifically to the bicoid mRNA 3 ' untranslated
region and contributes to stabilization of bicoid mRNA. Mol Cell Biol, 2001.
21(10): p. 3462-71.

Mootha, V.K., et al., Identification of a gene causing human cytochrome c
oxidase deficiency by integrative genomics. Proc Natl Acad Sci U S A, 2003.
100(2): p. 605-10.

Xu, F ., et al., The role of the LRPPRC (leucine-rich pentatricopeptide repeat
cassette) gene in cytochrome oxidase assembly: mutation causes lowered levels of
COX (cytochrome c oxidase) I and COX III mRNA. Biochem J, 2004. 382(Pt 1):

p. 33 1-6.

Ostrowski, J ., et al., Heterogeneous nuclear ribonucleoprotein K protein

associates with multiple mitochondrial transcripts within the organelle. J Biol
Chem, 2002. 277(8): p. 6303-10.

Liu, L. and W.L. McKeehan, Sequence analysis of LRPPRC and its SEC 1 domain
interaction partners suggests roles in cytoskeletal organization, vesicular

trafficking, nucleocytosolic shuttling, and chromosome activity. Genomics, 2002.
79(1): p. 124-36.

Mili, S., et al., Distinct RNP complexes of shuttling hnRNP proteins with pre-
mRNA and mRNA: candidate intermediates in formation and export of mRNA.
Mol Cell Biol, 2001. 21(21): p. 7307-19.

Kotera, E., M. Tasaka, and T. Shikanai, A pentatricopeptide repeat protein is
essential for RNA editing in chloroplasts. Nature, 2005. 433(7023): p. 326-30.

Mili, S. and S. Pinol-Roma, LRP130, a pentatricopeptide motif protein with a
noncanonical RNA-binding domain, is bound in vivo to mitochondrial and
nuclear RNAs. Mol Cell Biol, 2003. 23(14): p. 4972-82.

Tsuchiya, N., et al., LRP130, a single-stranded DNA/RNA-binding protein,

localizes at the outer nuclear and endoplasmic reticulum membrane, and
interacts with mRNA in vivo. Biochem Biophys Res Commun, 2004. 317(3): p.
736-43.

Schmitz-Linneweber, C., R. Williams-Carrier, and A. Barkan, RNA
Immunoprecipitation and Microarray Analysis Show a Chloroplast

87

86.

87.

88.

89.

90.

91.

92.

93.

94.

95.

96.

97.

Pentatricopeptide Repeat Protein to Be Associated with the 5 ' Region of mRNAs
Whose Translation It Activates. Plant Cell, 2005.

Lurin, C., et al., Genome-wide analysis of Arabidopsis pentatricopeptide repeat
proteins reveals their essential role in organelle biogenesis. Plant Cell, 2004.
16(8): p. 2089-103.

Martin, W. and P. Borst, Secondary loss of chloroplasts in trypanosomes. Proc
Natl Acad Sci U S A, 2003. 100(3): p. 765-7.

Hannaert, V., et al., Plant-like traits associated with metabolism of Trypanosoma
parasites. Proc Natl Acad Sci U S A, 2003. 100(3): p. 1067-71.

Ikeda, T.M. and M.W. Gray, Characterization of a DNA-binding protein
implicated in transcription in wheat mitochondria. M01 Cell Biol, 1999. 19(12):
p. 8113-22.

Oguchi, T., et al., Genomic structure of a novel Arabidopsis clock-controlled
gene, AtC401, which encodes a pentatricopeptide repeat protein. Gene, 2004.
330: p. 29-37.

Hashimoto, M., et al., A nucleus-encoded factor, CRR2, is essential for the
expression of chloroplast nth in Arabidopsis. Plant J, 2003. 36(4): p. 541-9.

Yamazaki, H., M. Tasaka, and T. Shikanai, PPR motifs of the nucleus-encoded
factor, PGR3, function in the selective and distinct steps of chloroplast gene
expression in Arabidopsis. Plant J, 2004. 38(1): p. 152-63.

Cushing, D.A., et al., Arabidopsis embl 75 and other ppr knockout mutants reveal
essential roles for pentatricopeptide repeat (PPR) proteins in plant
embryogenesis. Planta, 2005.

Barkan, A., et al., A nuclear mutation in maize blocks the processing and
translation of several chloroplast mRNAs and provides evidence for the
difierential translation of alternative mRNA forms. Embo J, 1994. 13(13): p.
3170-81.

Gothandam, K.M., et al., OsPPRI, a pentatricopeptide repeat protein of rice is
essential for the chloroplast biogenesis. Plant M01 Biol, 2005. 58(3): p. 421-33.

Akagi, H., et al., Positional cloning of the rice Rf-I gene, a restorer of BT-type
cytoplasmic male sterility that encodes a mitochondria-targeting PPR protein.
Theor Appl Genet, 2004. 108(8): p. 1449-57.

Klein, R.R., et al., Fertility restorer locus Rf] of sorghum (Sorghum bicolor L.)

encodes a pentatricopeptide repeat protein not present in the colinear region of
rice chromosome 12. Theor Appl Genet, 2005.

88

98.

99.

100.

101.

102.

103.

104.

105.

106.

107.

108.

109.

110.

111.

Hattori, M., M. Hasebe, and M. Sugita, Identification and characterization of

cDNAs encoding pentatricopeptide repeat proteins in the basal land plant, the
moss Physcomitrella patens. Gene, 2004. 343(2): p. 305-11.

Tsuchiya, N., et al., LRP130, a protein containing nine pentatricopeptide repeat
motifs, interacts with a single-stranded cytosine-rich sequence of mouse
hypervariable minisatellite Pc-I. Eur J Biochem, 2002. 269(12): p. 2927-33.

Auchincloss, A.H., et al., Characterization of Tbc2, a nucleus-encoded factor
specifically required for translation of the chloroplast pst mRNA in
Chlamydomonas reinhardtii. J Cell Biol, 2002. 157(6): p. 953-62.

Lown, F.J., A.T. Watson, and S. Purton, Chlamydomonas nuclear mutants that

fail to assemble respiratory or photosynthetic electron transfer complexes.
Biochem Soc Trans, 2001. 29(Pt 4): p. 452-5.

Claros, MG. and P. Vincens, Computational method to predict mitochondrially
imported proteins and their targeting sequences. Eur J Biochem, 1996. 241(3): p.
779-86.

Bateman, A., et al., The Pfam protein families database. Nucleic Acids Res, 2004.
32(Database issue): p. D138-41.

Thompson, J .D., et al., The CLUSTAL_X windows interface: flexible strategies for
multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res,
1997. 25(24): p. 4876-82.

Eddy, S.R., Profile hidden Markov models. Bioinformatics, 1998. 14(9): p. 755-
63.

Eddy, S.R., Hidden Markov models. Curr Opin Struct Biol, 1996. 6(3): p. 361-5.

Bailey, TL. and C. Elkan, Fitting a mixture model by expectation maximization to
discover motifs in biopolymers. Proc Int Conf Intell Syst M01 Biol, 1994. 2: p. 28-
36.

Emanuelsson, 0., et al., Predicting subcellular localization of proteins based on
their N-terminal amino acid sequence. J Mol Biol, 2000. 300(4): p. 1005-16.

Treger, M. and E. Westhof, Statistical analysis of atomic contacts at RNA-protein
interfaces. J M01 Recognit, 2001. 14(4): p. 199-214.

Edwards, T.A., et al., Structure of Pumilio reveals similarity between RNA and
peptide binding motifs. Cell, 2001. 105(2): p. 281-9.

Rozen, S. and H. Skaletsky, Primer3 on the W for general users and for
biologist programmers. Methods M01 Biol, 2000. 132: p. 365-86.

89

112.

113.

114.

115.

116.

117.

118.

119.

120.

121.

122.

123.

Altschul, S.F., et al., Gapped BLAST and PSI-BLAST: a new generation of protein
database search programs. Nucleic Acids Res, 1997. 25(17): p. 3389-402.

Chomczynski, P. and N. Sacchi, Single—step method of RNA isolation by acid
guanidinium thiocyanate-phenol—chloroform extraction. Anal Biochem, 1987.
162(1): p. 156-9.

Motyka, SA. and RT. Englund, RNA interference for analysis of gene function in
trypanosomatids. Curr Opin Microbiol, 2004. 7(4): p. 362-8.

Shi, H., et al., Genetic interference in Trypanosoma brucei by heritable and
inducible double-stranded RNA. Rna, 2000. 6(7): p. 1069-76.

Djikeng, A., et al., RNA interference in Trypanosoma brucei: cloning of small
interfering RNAs provides evidence for retroposon-derived 24-26-nucleotide
RNAs. Rna, 2001. 7(11): p. 1522—30.

Wang, Z., et al., Inhibition of Trypanosoma brucei gene expression by RNA
interference using an integratable vector with opposing T7 promoters. J Biol
Chem, 2000. 275(51): p. 40174-9.

Liu, Q., et al., Identification and functional characterization of lsm proteins in
Trypanosoma brucei. J Biol Chem, 2004. 279(18): p. 18210-9.

Tu, X. and CC. Wang, Pairwise knockdowns of cdc2-related kinases (CRKs) in
Trypanosoma brucei identified the CRKs for GI/S and GZ/M transitions and
demonstrated distinctive cytokinetic regulations between two developmental

stages of the organism. Eukaryot Cell, 2005. 4(4): p. 755-64.

Vondruskova, E., et al., RNA interference analyses suggest a transcript-specific
regulatory role for MRP1 and MRP2 in RNA editing and other RNA processing in
trypanosoma brucei. J Biol Chem, 2004.

Downey, N., et al., Mitochondrial DNA Ligases of Trypanosoma brucei. Eukaryot
Cell, 2005. 4(4): p. 765-74.

El-Sharoud, W.M. and G.W. Niven, The activity of ribosome modulation factor

during growth of Escherichia coli under acidic conditions. Arch Microbiol, 2005.
184(1): p. 18-24.

Ryan, C.M., K.T. Militello, and L.K. Read, Polyadenylation Regulates the
Stability of Trypanosoma brucei Mitochondrial RNAs. The Journal of Biological
Chemistry, 2003. 278(35): p. 32753-32762.

90

 

I"Ellililllljflljjillljjflll