.)

t

.5».

.'
$0\

3... .11...
it. it

a: 2
. 3.5.... 4.5.. .
.. 3....
, .

#5., .

,n‘l’. 1.100s

rfifinfiwqfifi

r.

 

.7
.nt

.9513 .
I. x A.

y. r? . 1...

.[b

qur. .t’

.s 3..
2. “Tia...
.1 .22.. .
. Fin.
3.

'1

an}. .
“.45.

1 ~33...

.5315:

arax.

)« .1 u a
1......“
.3 11.1

14". 4 V!»-

i.
. i...
. .. A.
. 59.59““... .
«33w.
...
. I < 1.3).“
. I

I... 51.1]:

I 1.15.33”. 7““?th

“13.1. .iha.

1.1..

ti...)
2... 1..
. $9.1.

7...; L u

I...) 9 X). r. at
no. ’91.}. [31253.15 . I
“.4. -....xl..:.. \914

I 35". it via
03.23.15...) I. 5-

.3: 1,1." A
In! 9" I...
..

 

we

This is to certify that the
dissertation entitled

DNA-PK
A closer look

presented by

Shikha Gupta

has been accepted towards fulfillment
of the requirements for the

PhD. degree in Microbiology and Molecular
Genetics

 

 

trot-{m Km / ”LL 1Q,

 

f Major Professor’s Signature

IO’TC'S/

 

Date

MSU is an Affirmative Action/Equal Opportunity Institution

 

.LIBRARY
Michigan State
University

 

 

 

 

 

PLACE IN RETURN BOX to remove this checkout from your record.
To AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2/05 p:/ClRC/DateDue.indd-p.1

 

DNA-PK
A closer look

By

Shikha Gupta

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Department of Microbiology and Molecular Genetics
2005

ABSTRACT
DNA-PK: A closer look
By

Shikha Gupta

Double strand breaks (DSBs) arise endogenously during normal cellular
processes and exogenously by genotoxic agents such as ionizing radiation (IR). In
higher eukaryotes these breaks are repaired by non homologous end joining (NHEJ) and
to a lesser extent by homologous recombination. DNA-PK is a repair enzyme composed
of a catalytic subunit, DNA-PKcs and a DNA targeting subunit, Ku70/8O heterodimer.
The catalytic subunit is a DNA activated serine threonine protein kinase and has been
shown to phosphorylate Ku70/80 and numerous other substrates. Studies suggest once
bound to a DNA double strand break, Ku recruits the catalytic subunit of the DNA-
dependent protein kinase (DNA-PKcs). Five DNA-PK phosphorylation sites have been
identified in Ku70/ 80. This suggested that there is a phosphorylation-mediated
regulation of Ku in NHEJ. Here I show that Ku containing serine/threonine to alanine
mutations at these five sites is fully able to complement the radiation sensitivity of Ku
negative mammalian cells. This led us to conclude that DNA-PK mediated

phosphorylation of Ku is not required for DNA double strand break repair.

DNA-PKcs possesses an intrinsic, albeit weak DNA-end binding activity that
is stabilized by Ku70/80. DNA-PKcs is a kinase made up of 4128 residues and has at
least four identified domains: LRR, FAT, FATC and PI3kinase. However, besides the

kinase

domain the contribution of other domains in DNA-PKcs’s function in DSB repair is not
known. In the second part of my study I show that disrupting the LRR motif in DNA-
PKcs by point mutations affects its ability to function in NHEJ. I fiirther show that the
mutant protein does not bind DNA-cellulose as well as the wild type even though it
interacts with Ku70/80 as well as the wild type. These results led me to conclude that the
LRR domain in DNA-PKcs contributes to the intrinsic DNA-end binding property of

DNA-PKcs, which is required for its role in NHEJ.

DEDICATION

To my loving family, who have supported me through my foolish endeavors
To Vipra, who found me somewhere between my whims and fancies

AND

To the pursuit of skepticism, empiricism and synicism

iv

ACKNOWLEDGEMENTS

I want to start by acknowledging the efforts of my mentor, Dr. Kathy Meek, who
stood by me at every stage of this dissertation. She has been a constant source of
encouragement and inspiration. She has been immensely patient all through my failures
and has shared every moment of joy that I have experienced during these last four years.

I thank her for being an exceptional friend, philosopher and guide to me in this journey.

I wish to thank my committee members, Dr. Justin McCormick, Dr. David
Amosti, Dr. Susan Conrad and Dr. Walter Esselman for their input at various stages of

my dissertation.

I also want to thank members of the Carcinogenesis laboratory with whom I have
shared the lab space as well as lab meetings. It has been a pleasure knowing Justin and
Veronica who have bestowed their affection on me. They have guided me and supported
me through the ups and downs of my graduate training. Special thanks to Kathy
Bergdolt, Bethany Heinlen, Suzzane Kohler, Sandra O’Reilly and Terry McManus who
have helped me cruise through various administrative roadblocks and have helped keep

things up and running in our lab.

I want to acknowledge the past and present members of the Meek lab. Qi, Wei
and Tim, the team I started with in Kathy’s lab and shared the two wonderful years of my
graduate school and Clarissa and Xiaoping, who have helped me in the last two years of

my research.

Thanks to the people I met in N11, Omita, Patrali and Hoshang with whom I have
shared some of the best moments of my life. I must also thank Vipra, who I have known

for last six years and who constantly helps me stay sane and grounded.

Finally, I would like to thank my family, who has been my support system even

though they are thousands of miles away. I wouldn’t have completed this without them.

FOREWORD

The work discussed in Chapter 3 of this thesis is published as referenced below:

DNA-PK dependent phosphorylation of Ku70/8O is not required for non homologous end
joining. Shikha Gupta, Pauline Douglas, Nick Morrice, Katheryn Meek and
Susan P.Lees-Miller.

DNA repair 2005 Aug 15;4(9):1006-18

Images in this dissertation are presented in color.

TABLE OF CONTENTS

 

 

 

 

 

 

 

 

 

LIST OF FIGURES xi
LIST OF TABLES xiii
LIST OF ABBREVIATIONS xiv
CHAPTER 1 - 1
INTRODUCTION 1
CHAPTER 2: ......
REVIEW OF LITERATURE
2.1 Model for NHEJ .................................................................................................. 5
2.2 Role ofKu in NHEJ ........................................................................................... 11
2.3 Physiological relevance of DNA-PK’s kinase activity in NHEJ ......................... 13
2.4 Autophosphorylation of DNA-PKcs: .................................................................. 16
2.5 Phosphorylation of Ku heterodimer .................................................................... 18
2.6 Structure of DNA-PKcs ..................................................................................... 21
2.7 Lecuine Rich Region in DNA-PKcs ................................................................... 27
2.8 C1D ................................................................................................................... 29
2.8.1 ClD’s role in apoptosis: ............................................................................ 29
2.8.2 C1D in NHEJ: ........................................................................................... 30
2.9 DNA binding of DNA-PKcs in the absence of Ku .............................................. 32
CHAPTER 3 33
DNA-DEPENDENT PHOSPHORYLATION OF KU70/80 IS NOT REQUIRED
FOR NON HOMOLOGOUS END JOINING 33
ABSTRACT: ........................................................................................................... 33
INTRODUCTION: .................................................................................................. 35
MATERIALS AND METHODS: ............................................................................ 38
Immunoblotting: ................................................................................................ 38
Phosphorylation of Ku by DNA-PKcs: ............................................................... 38
Cell culture and cell extracts and dsDNA cellulose pulldown assays: ................. 39

viii

Oligonucleotides: ............................................................................................... 40

 

 

Construction and transfection of expression plasmid: ......................................... 40
Assessment of Radiation Sensitivity: ................................................................. 40
V(D)J Recombination assays: ............................................................................ 41
MTT Assays: ..................................................................................................... 41
Generation and purification of Baculovirus expressed Ku: ................................. 42
RESULTS: .............................................................................................................. 43
Single site phosphorylation at S577 or S580 or T715 in Ku80 does not alter its
role in NHEJ: ..................................................................................................... 43
Multi-site phosphorylation in Ku80 does not alter its role in NHEJ: ................... 44
Ku70 phosphorylation is not required for NHEJ: ................................................ 53
DNA-PK phosphorylation sites in Ku70/8O are not required for NHEJ: ............. 56
Ku7OALA expressed in baculovirus is phosphorylated on additional sites: ......... 58
DISCUSSION: ........................................................................................................ 68
CHAPTER 4 - - - - - - - .......... , “70
THE LEUCIN E RICH REGION OF DNA-PKCS FACILITATES ITS
TARGETING T0 DNA - - 70
ABSTRACT: ........................................................................................................... 70
INTRODUCTION: .................................................................................................. 71
MATERIALS AND METHODS: ............................................................................ 73
Cell lines and culture conditions: ....................................................................... 73
Oligonucleotides: ............................................................................................... 73
Construction and transfection of expression plasmids: ....................................... 74
DNA cellulose pulldown of DNA-PK, measurement of protein km’ ase activity,
and ..................................................................................................................... 75
nuclear matrix preparations: ............................................................................... 75
V(D)J recombination assays: .............................................................................. 76
Assessment of Radiation Sensitivity: ................................................................. 76
Expression of fusion proteins and pulldown experiments: .................................. 76
RESULTS: .............................................................................................................. 79
LR DNA-PKcs mutant can only partially reverse radiosensitive phenotype in V3
cells: .................................................................................................................. 79
DNA-PKcs mutant, LRle only supports reduced levels of either coding or
signal end joining in V3 cells: ............................................................................ 80
LRle has wild type interaction with C1D: ...................................................... 87
LRle is targeted to the nuclear matrix similar to the wild type DNA-PKcs: ..... 87

Additional regions outside the LRR contribute to DNA-PKcs’s interaction with

 

 

C1D: .................................................................................................................. 88
LRle binds poorly to DNA-cellulose: ............................................................ 96
The LRR mutant has wild type levels of kinase activity: .................................... 96
The LRR contributes to DNA-PKcs’s intrinsic affinity to bind DNA: .............. 102
CHAPTER 5 1 11
CONCLUSION AND FUTURE DIRECTIONS -- - - 111
REFERENCES.- -- - - -- - - - - 115

 

LIST OF FIGURES

CHAPTER 2
Figure 1. Model for NHEJ ................................................................. 7-10
Figure 2. Crystal structure for Ku ........................................................ 14-15
Figure 3. CryoEM structure of DNA-PKcs (30A) ..................................... 23-24
Figure 4. CryoEM structure of DNA-PKcs (13A) ..................................... 25-26
Figure 5. Diagrammatic representation of DNA-PKcs ................................ 28
CHAPTER 3
Figure 6. Alanine mutants at single site in Ku80 exhibit wild type complementation
of NHEJ deficit in xrs-6 cells ................................................... 45-46
Figure 7. Multi site alanine mutant in Ku80 exhibit wild type complementation of
NHEJ deficit in xrs-6 cells ...................................................... 47-49
Figure 8. Multi site aspartic acid mutant in Ku80 exhibit wild type complementation
of NHEJ deficit inxrs-6 cells ................................................... 50-51
Figure 9. Alanine and aspartic acid mutants of Ku7O exhibit wild type complementation
of NHEJ deficit in Ku70 deficient cells ........................................ 54-55
Figure 10. Co-expressing N-terminal deletion of Ku70 with wild type Ku80
confers radiosensitivity in xrs-6 cells .......................................... 60-61
Figure 11. Co-expressing alanine mutants of Ku70 and Ku80 does not confer
radiosensitivity in xrs-6 cells ..................................................... 62-63
Figure 12. Co-expressing aspartic acid mutants of Ku70 and Ku80 does not confer
radiosensitivity in xrs-6 cells ................................................... 64-65
Figure 13. Mutating three phosphorylation sites in Ku80 and two phosphorylation

sites in Ku7O reduces in vitro phosphorylation of Ku70/80 by
DNA-PKcs ......................................................................... 66-67

xi

CHAPTER 4

Figure 14. DNA-PKcs with point mutations in LR motif only partially

Figure 15.

Figure 16.

Figure 17.

Figure 18.

Figure 19.
Figure 20.

Figure 21.

complements the radiosensitivity in V3 cells ................................ 82-83
LRle has wild type interaction with C1D .................................. 90-91
LRle is targeted to nuclear matrix similar to the wild type

DNA-PKcs ........................................................................ 92-93
GST-LRle does not interact with C1D as well as the wild type

GST-LRR ......................................................................... 94-95
LRle has reduced kinase activity by virtue of reduced

DNA binding ..................................................................... 97-99
LRle has wild type levels of kinase activity ............................ 100-101
LRle has wild type interaction with Ku ........... . ..................... 104-105
The LRR contributes to DNA-PKcs’s intrinsic affinity to

bind DNA ....................................................................... 106-107

xii

LIST OF TABLES

CHAPTER 2
Table 1. Phosphorylation sites in Ku70 and Ku80 compared across

Vertebrates ........................................................................ 20
CHAPTER 3
Table 2. Ku80 ALA supports wild type levels of V(D)J recombination ............ 52
CHAPTER 4
Table 3. LRle supports reduced levels of V(D)J recombination ............... 84-85
Table 4. Sequence analysis of coding joints mediated by LRle ................... 86

xiii

aa

ALA

ASP

ATM

CDK

CHO

DNA-PK

DNA-PKcs

ds

DSB

EDTA

EGTA

EM

EMSA

GST

HR

IR

LRR

LZ

MALDI

MAPK

LIST OF ABBREVIATIONS

amino acid

alanine

aspartic acid

ataxia talengiectasia mutated

cyclin dependent kinase

Chinese hamster ovary

DNA protein kinase

DNA protein kinase catalytic subunit
double stranded

double stranded break

ethylene diamine tetra acetic acid
ethyleneglycol-bz's(B-aminoethyl)-N,N,N’,N’-tetraacetic Acid
electron microscopic

electromobility shifi assay

glutathione S transferase

homologous recombination

ionizing radiation

leucine rich region

leucine zipper

Matrix assisted laser desorption/ionization

mitogen activated protein kinase

xiv

MS

NHEJ

OA

PAGE

PIKK

PKA

PKC

PP2A

RNAase

RSS

SDS

SSA

SSB

TdT

VWA

XRCC

mass spectrometry

non homologous end joining

okadaic acid

polyacrylarnide gel electrophoresis
phosphatidylinositol 3-kinase-like kinase
protein kinase A

protein kinase C

protein phosphatase 2A
recombination activating gene
ribonuclease A

recombination signal sequence
sodium dodecyl sulphate

single strand annealing

single strand break

terminal deoxynucleotidyl transferase
vonWillebrand factor A

Werner syndrome protein

X-Ray cross complementing

XV

CHAPTER 1

INTRODUCTION

All through a cell’s life cycle, its DNA is constantly broken and repaired. Double
strand breaks (DSBs) are regarded as the most lethal of all DNA lesions. In a cell, DSBs
can arise endogenously by cellular processes like V(D)J recombination, meiotic
recombination and also during replication when the replication machinery encounters
single strand breaks (SSBs) causing a replication fork to collapse, generating DSB
(Haber, 2000; Karran, 2000; Norbury and Hickson, 2001; Bassing et al., 2002). When
left unrepaired, DSBs lead to the activation of cell cycle checkpoints and can also signal
cell death (Jackson, 2001). Misrepaired DSBs can lead to genetic translocations and
deletions, destabilize the genome and potentially cause cancer (van Gent et al., 2001;
Thompson and Schild, 2002; Vilenchik and Knudson, 2003). There are three main
pathways that repair DSBs: homologous recombination, single strand annealing and non-
homologous end joining. However, each of these pathways contributes differently in
lower and higher eukaryotes (Haber, 2000; Lees-Miller and Meek, 2003; Vilenchik and

Knudson, 2003; Shiloh and Lehmann, 2004).

Homologous recombination or gene conversion is favored in lower eukaryotes
like yeast. This process relies on utilizing genetic information on the sister chromatid or
the homologous chromosome to restore the DSB. Some of the proteins involved in this
process are RAD51, RAD52, RAD54, RAD57, RAD59 (RAD 52 epistasis group) and a

protein complex comprising of three proteins, RAD50/ MREll /XRS2. Homologous

recombination is the predominant repair pathway during the G2 and S phases of the cell
cycle (Featherstone and Jackson, 1999; Thompson and Schild, 2001; van den Bosch et
al., 2002). Single strand armealing (SSA) is another pathway that requires regions of
homology to repair the damaged DNA. It requires tandem repeats of homologous
sequences on both strands and the strands anneal to each other after resection of DNA
from 5’ ends specifically. Hence, SSA results in a tremendous loss of genetic
information. This process also requires RAD 52 (Featherstone and Jackson, 1999;

Thompson and Schild, 2001; van den Bosch et al. , 2002).

Non-homologous end joining (NHEJ) is the primary pathway that repairs the
majority of DSBs in all cell cycle phases, while HR contributes modestly in G1 and
progressively more as cells move through the cycle in G2 (Rothkamm et al., 2003). There
are six known proteins that unequivocally constitute the core of NHEJ machinery;
namely, Ku subunits (Ku70 and Ku80), DNA-PKcs, DNA ligase IV and its partner
XRCC4, and the nuclease Artemis (Critchlow and Jackson, 1998; Featherstone and
Jackson, 1999; Pierce et al., 2001; Jackson, 2002; Lees-Miller and Meek, 2003). In
addition, C1D, a nuclear matrix protein with high affinity for DNA (Yavuzer et al., 1998;
Erdemir et al., 2002), polymerase u and polymerase I have also been implicated to play a
role in NHEJ (Mahajan et al., 2002; Havener et al. , 2003; Nick McElhinny and Ramsden,

2003,2004)

The main focus of my study is the protein complex, DNA-PK (DNA dependent
protein kinase). Of the six factors, DNA-PK is central to the process of NHEJ . It is a
protein complex made up of three proteins- DNA-PKcs (serine/threonine kinase) and
Ku (a heterodimeric DNA binding protein) (Gottlieb and Jackson, 1993). DNA-PKcs
acts as a protein scaffold and binds to all five factors bringing them in close vicinity of
each other. Cells that lack DNA-PKcs are radiosensitive and defective in DSB repair
(Jackson and Jeggo, 1995; Jeggo et al., 1995; Peterson et al., 1995). Additionally, studies
have established that DNA-PK’s kinase activity is indispensable for NHEJ (Peterson et

al., 1997; Kurimasa et al., 1999; Kienker et al., 2000)

My studies have addressed two issues in NHEJ:

Role of Ku phosphorylation in NHEJ: DNA-PKcs has been shown to phosphorylate
numerous proteins in vitro and/or in vivo including Ku, XRCC4, Artemis and DNA-PKcs
itself (Chan et al., 1999; Douglas et al., 2002; Ma et al., 2002; Lee et al., 2004).
Recently our lab and others have shown that auotophosphorylation of DNA-PKcs is
important for DNA end processing in NHEJ (Ding et al., 2003; Meek et al., 2004; Reddy
et al., 2004). However, the physiological relevance of other phosphorylation events is yet
to be established. In this study, I will test the hypothesis that phosphorylation of Ku is

required for NHEJ.

Role of Leucine rich region in DNA-PKcs: The kinase activity of DNA-PKcs resides

in amino acids 3745 to 4013, a PI3 kinase domain. Another recognized domain within

this large protein is a leucine zipper (LZ) motif perhaps more appropriately designated a
leucine rich region (LRR), that spans residues 1503-1602 (20% of the residues are
leucines) (Hartley et al., 1995). Whereas DNA-PK's kinase activity has been shown to be
absolutely indispensable for its function in NHEJ, little is known about the functional
relevance of the LRR. In 1998, Jackson and colleagues identified the nuclear matrix
protein C1D as a factor that interacts specifically both in vitro and in vivo with the
leucine rich region of DNA-PKcs (Yavuzer et al, 1998). In this study, using a mutagenic

approach, I will determine the fimctional relevance of LRR in DNA-PKcs.

CHAPTER 2:

REVIEW OF LITERATURE

2.1 Model for NHEJ

Studies have established that binding of Ku to damaged DNA ends is the first step
in NHEJ (Dynan and Yoo, 1998; Yoo and Dynan, 1999; Doherty and Jackson, 2001;
Dudasova et al., 2004). Ku forms a ring around DNA, leaving the DNA ends accessflfle
to other factors such as DNA-PKcs (Walker et al., 2001). By itself, DNA-PKcs possesses
a very weak DNA binding activity (Hammarsten and Chu, 1998). The C terminal end of
Ku80 binds to DNA-PKcs; this allows for direct contact of DNA-PKcs with the DNA
terminus (Singleton et al., 1999). In this conformation, DNA-PKcs mediates synapsis of
two DNA ends and this DNA synapsis is also required to activate the kinase (DeFazio et
al., 2002). The kinase phosphorylates both Ku70 and Ku80 (Chan et al., 1999) followed
by translocation of Ku internally along the DNA (Dynan and Yoo, 1998; Calsou et al.,

1999; Yoo and Dynan, 1999; Doherty and Jackson, 2001).

DNA-PKcs also phosphorylates itself at two identified phosphorylation clusters
(ABCDE and PQR) and these autophosphorylation events have been shown to
reciprocally regulate the processing of DNA ends (Ding et al., 2003) (Cui et al, 2005
unpublished data). Phosphorylation at ABCDE opens the DNA ends for access by end-
processing factors namely, Artemis, polymerase u and 1t and TdT (in V(D)J

recombination), and phosphorylation at the PQR cluster blocks this access.

Artemis has been shown to possess endonuclease and exonuclease activity" in vitro and
has been proposed to play a role in DNA end processing in NHEJ (Ma et al., 2002;
Schlissel, 2002). Ku and UK have also been shown to interact with DNA polymerase u
(pol u) (Mahajan et al., 2002; Nick McElhinny and Ramsden, 2003). In vitro studies have
shown that pol u stabilizes the interaction between L/X, Ku and DNA and is also
required for gap filling activity in NHEJ (Lee et al., 2003). Polymerase it is yet another
polymerase implicated in NHEJ. Its yeast counterpart P014 has been linked both
genetically and biochemically to NHEJ (Wilson and Lieber, 1999; Tseng and Tomkinson,
2002). Pol J» has also been shown to associate with the core NHEJ factors Ku and
XRCC4-1igaseIV (Fan and Wu, 2004; Ma et al., 2004; Nick McElhinny et al., 2005).
Recently, it has been shown that in NHEJ, mammalian cells employ pol u, poly 2t and
TdT for distinctive end processing roles in DSB repair and V(D)J recombination (Nick

McElhinny et al. , 2005).

Ku and DNA-PKcs finally recruit the ligase IV/XRCC4 (L/X) complex (Nick
McElhinny et al., 2000) and DNA-PKcs phosphorylates the XRCC4 component (Leber et
al., 1998; Chen et al., 2000; Hsu et al., 2002; Calsou et al., 2003). Ligase IV and XRCC4
form a tight complex (Lee et al., 2000) and this interaction stimulates ligase 1V activity

(Modesti et al. , 1999).

Besides the six factors, Dai et al have suggested the requirement of an

unidentified factor for NHEJ (Dai et al., 2003). Additionally, C1D, a 16 Kda DNA

Fig. 1. Model for NHEJ

1. DNA damage: Double strand breaks in DNA can be induced by a variety of agents

and certain normal cellular processes.

2. Complex assembly: Ku binds DNA ends and then recruits catalytic subunit. The
catalytic subunit has been shown to possess three structural domains: two large globular
domains (“head” and “palm”) separated by the arm domain (Boskovic et al, 2003). The

head is composed of the kinase, FAT and FATC domains (Rivera-Calzada et al, 2005)

3. Synapsis and activation: DNA binding induces a conformational change in the head
and palm region. DNA-PKcs aligns two broken DNA ends to form a synaptic complex.

This synapsis of DNA ends is required to activate the kinase (DeFazio et al, 2002).

4. Autophosphorylation at ABCDE: Phosphorylation at one or more sites in the
ABCDE cluster (aa 2609-2647, shown in yellow) induces a conformational change that

allows access of DNA ends to DNA-end modifying factors (Ding et al, 2003)

Model For NHEJ

fl/

1 .
WW
DNA-PKCS
Ku "Whit. ”head'

L: \J
\ unbound conformation

Fig. 1

3. DNA-PK-bound

conformation
synapses
fl

\ --.,
kinase active
DNA ends protected

, -j 3: .n
"[5: 1‘. r W
ABCDE phosphorylation
(in yellow)

Model for NHEJ (cont)

5. End processing: DNA-PK’s kinase activity is required to activate the nuclease
activity of Artemis (Ma et al, 2002). Pol u and it have been shown to be required for gap
filling (Nick McElhinny et al, 2005). Other factors like polynucleotide kinase and TdT

would presumably work at this point as well.

6. Autophosphorylation of PQR: Further phosphorylation at a second cluster named
PQR (aa 2023-2056, shown in pink) in DNA-PKcs induces another conformational
change which blocks the DNA-end processing factors to access DNA ends, thus

preventing excessive nucleotide loss (Cui et al, unpublished data).

7. Ligation: At some point, XRCC4/Ligase IV complex is targeted to the processed

ends for the ligation of the broken DNA ends.

8. Complex Disassembly: The dissociation of DNA-PKcs fiom Ku-bound DNA is
phosphorylation dependent. Phosphorylation at two known clusters (ABCDE and PQR)
is not required for complex disassembly. It is unclear what sites in DNA-PKcs induce its

dissociation. It is also not known what and how Ku is released from DNA.

9. Recycling: A cellular phosphatase has been shown to interact with the
phosphorylation site cluster (ABCDE) in DNA-PKcs. This likely facilitates recycling of

the protein for future repair use.

{n fl protein-protein

5_ r . , interaction
9:39,.“ target
‘ L” end-processing
7 PQR phosphorylation
‘3‘ :7 (in pink)
6. ”5-3, .g
V "
ABCDE phosphorylation
(in yellow)
w r21
”Riggs“
7. 7 fl
X4/L4
8 W
' mi 3,0: further autophosphorylation
i“, it induces dissociation
L J
9 r - 4.:

Modified from Meek et al. Immunol. Rev. 2004, 200 (1) 132-141

binding protein has been shown to interact with DNA-PK (Yavuzer et al., 1998). C1D
has also been shown to play a role in repairing the DSBs via NHEJ and homologous
recombination in yeast (Erdemir etal., 2002). Its role in DNA repair in higher
eukaryotes is still under investigation.

Figure 1 is a simplified depiction of how the NHEJ pathway fimctions.

2.2 Role of Ku in NHEJ

Ku was identified as an autoantigen that cross-reacted with the immune sera from
patients with autoimmune disorders like systemic lupus erythromato sus and
polymyosytis-scleroderma (Mimori et al., 1981; Mimori et al., 1986). Its role in DSB
repair was elucidated using a radiosensitive CHO cell line, xrs-6. er-6 belongs to a group
of rodent cell lines that have impaired DSB repair and V(D)J recombination (Lee et al.,
1996). Complementation studies helped identify the defective gene in these mutants to be a
human gene XRCCS. (XRCC denotes X ray cross complementing) (Jeggo et al., 1992).
Ku80 was identified as the product of XRCCS gene (Taccioli et al., 1994). Human Ku80
cDNA was shown to substantially complement the DSB rejoining defect in xrs-6 cells

(Ross et al., 1995).

Ku is a heterodimeric protein comprised of Ku70 and Ku80. The heterodimer
fimctions as the regulatory subunit of the protein complex DNA-PK (DNA-dependent
protein kinase). Ku binds to the broken DNA ends, recruits and activates DNA-PKcs
(DNA-PK catalytic subunit), a ~450 kDA serine/threonine kinase (Doherty and Jackson,

2001).

ll

Ku70 (613 aa) and Ku80 (735 aa) tightly associate with each other and this
association plays a role in stabilization of the two subunits in the cell (Singleton et al. ,
1997). The central domain in Ku80 is comprised of amino acids 449 to 477 and has been
shown to be essential for its interaction with Ku70 (Osipovich et al., 1997; Cary et al. ,
1998; Osipovich et al., 1999). Also, the C terminal (12 a) of Ku80 has been shown to be
involved in its interaction with DNA-PKcs and this interaction is essential for DNA—PK
activity. It is interesting to note that this C-terminal 12 a is conserved in human, mouse
and hamster Ku80 but is absent in the C. elegans and S. cerevisae Ku homologues. This
correlates with the observation that orthologues of DNA-PKcs are present in all

vertebrates, but not in yeast (Gell and Jackson, 1999; Singleton et al., 1999).

Additionally, both Ku70 and Ku80 have an N-tenninal domain that belongs to the
vonWillebrand factor A (VWA) family of domains. These domains are known to
mediate protein-protein interactions. Thus, the VWA domain in Ku heterodimer might be
involved in recruiting proteins to the site of DNA damage (Wu and Lieber, 1996;
Doherty and Jackson, 2001) For example, WRN (Werner syndrome protein), a RecQ
family of DNA helicases with a 3’-5’ exonuclease activity, has been shown to interact
with this domain of Ku80 (Kannakar et al., 2002). This binding has no effect on helicase
activity of WRN but broadens the exonuclease specificity and enhances its processivity
(Li and Comai, 2000). It is suggetsed that Ku might play a role in activation of WRN to

remove certain replication blocks (Orren et al., 2001).

12

Also, Doherty and Jackson speculated that this domain might play an important
role in aligning the broken DNA ends via interaction between two Ku heterodirners in

trans (Doherty and Jackson, 2001).

Goldberg and colleagues recently elucidated the crystal structure of the Ku
heterodimer bound to DNA (Walker et al., 2001). The structure showed Ku in an open
ring shape forming a narrow bridge through which two turns of DNA helix are threaded.
Majority of the contacts in the Ku-DNA complex are with sugar-phosphate backbone and
not with bases directly. This provided an explanation for why Ku lacks significant
sequence preference for DNA. This unusual mode of Dna binding by Ku also expains as
to how Ku can translocate internally along DNA leaving the DNA ends accesmble to
other proteins (Fig. 2). Interestingly, the structure for free Ku heterodimer is similar to
the DNA-bound form. This raises a major question as to how the threaded Ku complex

becomes dissociated fi‘om the DNA once the DNA has religated?

2.3 Physiological relevance of DNA-PK’s kinase activity in NHEJ

Cells lacking functional DNA-PKcs are radiosensitive and lack the ability to
repair DSBs via NHEJ (Jackson and Jeggo, 1995; Peterson et al., 1995). The repair
defects can be reversed by ectopic expression of DNA-PKcs. However, deletion and site
directed mutants in the kinase domain of DNA- PKcs cannot reverse the repair deficits of
DNA-PKcs deficient cells demonstrating that the protein kinase activity of DNA-PKcs is

requisite for its role in NHEJ (Kurimasa et al., 1999; Kienker et al., 2000).

13

Fig. 2. Crystal Structure of Ku heterodimer-DNA complex: Ku70 is depicted in blue
strands and Ku80 in pink. The structure lacks the extreme carboxy terminus for both
Ku70 and Ku80, however their relative positions are indicated. The side view highlights
the orientation of Ku heterodimer with respect to the broken or free DNA end. Ku70 is

located proximal and Ku80 distal, to the broken DNA end.

14

Fig. 2

(a) Top view

(D) Direction of Ku
Ku80 translocation

   

Side View

Modified from Doherty and Jackson. Current Biology 2001 ,11; R920-923
and Walker et al. Nature 2001. 412; 607-614

15

2.4 Autophosphorylation of DNA-PKcs:

In vitro studies have shown that autophosphorylation of DNA-PK occurs on
Ku70, Ku80 and DNA-PKcs (Chan et al., 1999; Douglas et al., 2002). When
autophosphorylated, DNA-PKcs dissociates from the Ku-DNA complex which results in
the loss of kinase activity (Chan and Lees-Miller, 1996; Merkle et al., 2002). Cryo-
electron microscopic studies have shown that the number of DNA-protein complexes is
reduced when DNA-PK is phosphorylated and are restored in the presence of a protein
phosphatase-1 (PPl). The loss of kinase activity was further corroborated by EMSA and
kinase assays (Douglas et al., 2001; Merkle et al., 2002). Further, seven phosphorylation
sites were identified in DNA-PKcs using Mass spectrometery (MS). Of these seven sites,
four sites have been shown to be phosphorylated in vivo using phosphospecific antibodies

(Douglas et al., 2002).

Recently our lab has shown that mutating six phosphorylation sites in the above
mentioned cluster in DNA-PKcs abolishes its capacity to restore radioresistance in DNA-
PKcs deficient cell line, V3. The phosphorylation site mutant DNA-PKcs (ABCDE) was
able to phosphorylate other substrates like XRCC4 and Artemis and thus was shown to
have normal kinase activity (Ding et al., 2003). Additionally, the mutant protein was
shown to have reduced activity in V(D)J recombination. Sequence analysis of the joints
that did recombine in the presence of mutant protein revealed a lack of DNA end

processing.

16

Since autophosphorylation has been shown to cause disassembly of DNA-PKcs
with concomitant loss in the kinase activity (Chan and Lees-Miller, 1996; Merkle et al. ,
2002), the non-phosphorylatable DNA-PKcs should have a constitutive kinase activity
and should be resistant to the loss of kinase induced by pre-autophosphorylation.
Surprisingly, biochemical analysis using purified wild type and mutant DNA-PKcs
(ABCDE) revealed that the mutant protein is only slightly more resistant to the loss of
kinase activity compared to the wild type DNA-PKcs (Ding et al., 2003) suggesting
additional phosphorylation sites might be involved in the disassembly of DNA-PKcs
from Ku/DNA complex. Moreover, this mutant protein still underwent substantial
autophosphorylation in vitro (Ding et al., 2003; Reddy et al., 2004). Five potential
phosphorylation sites outside of ABCDE were identified and these sites were mutated to
alanine. The construct generated was designated as PQR (Cui et al, unpublished data).
When expressed in V3 cells and compared to wild type and ABCDE mutant,
phosphorylation at PQR was found to have a reciprocal fiinction to ABCDE
phosphorylation in regulating end access to processing factors. Ding et al proposed a
model suggesting that the conformation of ABCDE (unphosphorylated DNA-PKcs) does
not allow end processing factors to access the DNA termini and thus the breaks are left
unrepaired, leading to increased cell death. This was further corroborated by studies fi'om
Reddy et al and Block et al in in vitro end-joining assays (Block et al., 2004; Reddy et
al. , 2004). The recent data with the PQR mutant (partially unphosphorylated DNA-PKcs)
suggests an extension of the above model where phosphorylation at ABCDE would allow
the DNA-ends to be accessible for end processing and subsequent phosphorylation at

PQR would block this access and promote interaction with XRCC4/ligaseIV to ligate the

17

processed ends (Cui et al, unpublished data). There is further evidence that
autophosphorylation state of DNA-PKcs may also guide DSBs to be either repaired by
HR or NHEJ. Whereas initial phosphorylation at ABCDE promotes HR, subsequent

phosphorylation at PQR would block HR.

Finally, neither ABCDE nor PQR phosphorylation events cause DNA-PKcs to
dissociate fi'om DNA. The autophosphorylation events that cause the dissociation and

kinase inactivation are being currently investigated.

2.5 Phosphorylation of Ku heterodimer

The above studies have established autophosphorylation of DNA-PKcs to be a
physiologically important step in NHEJ, making DNA-PKcs to be the first unequivocally
physiologically relevant substrate. Ku is the DNA binding partner of DNA-PKcs and has
been shown to be phosphorylated by DNA-PKcs (Yaneva and Busch, 1986; Boubnov and
Weaver, 1995; Chan et al., 1999). MALDI based studies on phosphorylation of Ku in
Susan Lees-Miller’s laboratory resulted in identification of DNA-PKcs target sites; serine
577, serine 580 and threonine 715 in Ku80, and serine 6 in Ku70 (Chan et al., 1999). Jin
and Weaver identified serine 51 as another phosphorylation site in Ku70 (J in and

Weaver, 1997).

It has been suggested previously that the preferred substrate consensus of DNA-
PK is a serine/threonine followed by a glutamine (SQ/TQ motif) (Lees-Miller etal.,

1992; O'Neill et al., 2000). However, in vitro, purified DNA-PK can phosphorylate

18

serine and threonine residues that are followed by hydrophobic amino acids such as
tyrosine, leucine or alanine (Chan et al., 1999; Douglas et al., 2002; Yu et al., 2003).

F our out of five sites in Ku70/ 80 are S/T followed by a hydrophobic residue and serine

51 in Ku70 is a SQ site. When compared across vertebrates, serine 6 was conserved in
humans, rat, mouse, hamster but not in frog. Serine 51 in Ku70 was conserved in all
vertebrates. Similarly in Ku80, where serine 577 was conserved across the vertebrates,
serine 580 was not conserved in frog and threonine 715 was not conserved in hamster and

fiog (Table 2).

In vitro studies have shown that Ku’s translocation along DNA stimulates DNA
ligation by XRCC4/Ligase IV (Kysela et al. , 2003). Eventually Ku must dissociate fiom
the DNA to allow replication of the repaired DNA. Ku binds with high affinity to DNA
in in vitro assays and how Ku dissociates fi'om DNA remains to be elucidated (Doherty
and Jackson, 2001). Although in vitro studies have shown that phosphorylation of Ku is
not involved in dissociation of Ku fi'om DNA (Chan et al., 1999), there is some evidence
suggesting that it might have a role in translocation of Ku along DNA (Calsou et al.,
1999; Frit et al., 2000). Also, it is possible that phosphorylation of Ku might work in
concert with DNA-PKcs phosphorylation to facilitate dissociation of DNA-PKcs from Ku
bound DNA. In the face of several unanswered questions concerning phosphorylation

events in NHEJ, Ku makes an interesting phosphorylation substrate to study.

19

33— co 2.3M 20:3 $88 $298: 35852 bra—Ea .x. can >552 o\e

 

 

 

 

2233998 e E2 2 < < a mi .m 55... ass N
595858 - mm -_ o < < 982: 55. case:
_2a-_-_nn>oo< - mm m we a 80:2 95. 3.82
Ema-agave - mm a e e h 850. ooze 3.
EESQEOO m m: >< < a. 8sz 5:2 58::

m:
.a: :3 33 m a -_ m momlnnmx-UUE Ems .x
:3 so“: m< > m m _ m 58855502 ease:
as: $2- 93 m m ; Eommxmexbie. 9.82
$3 :3 B: m m ; Eommmflvcga am
§2 $8. m< a m m > m Egg-gig 58.5
35:83.; 3:52 .x. am new «a
85.
$3 :8 m E2; 5.3 in 5 ...... 225 : cam-E--- ”Es a
$3 x: m Es? ”5,3 >-E Sm ..... be; m mBomz-i cease:
sea :2 m Es? «35 >4... 5 ...... be; m mammz--- 3.82
$3 :3 m was? ”as >-E _-_m------.5_>> m mama?- B—
.\.8_ <32 m 32¢. :93 5m 5 ..... be; m maomz--- 585:
b523- bese .x. a e a
33.

38:509.?» 898: €22.58 35— .9.3 2.5— .: 8:“ aetsbesamesm ._ HAM—<8

20

2.6 Structure of DNA-PKcs

Electron microscopic structure of DNA-PKcs at 30 A resolution is shown to
contain three distinct regions which the authors have labeled as “head”, “pahn” and
“arm” (Boskovic et al., 2003). The arm region connects the head to the palm. The
structure further showed that when bound to DNA, DNA-PKcs undergoes substantial
conformational change compared to the unbound protein. When bound to DNA, the
palm region of the protein bends and locks around DNA and comes in contact with the
head region. (Fig. 3) The authors further speculated that this conformational change
could be responsible for activation of the kinase. Previously, DeFazio et al had shown
that
DNA-PKcs plays a role in bringing the broken ends together in a ligatable configuration,
which they referred to as “synapsis”. Using EM studies and pull down experiments, they
further showed that DNA-PKcs dimerizes during this synaptic event and that addition of
Ku enhances the ability of DNA-PKcs to mediate synapsis. The synapsis was also shown
to be a required for the activation of kinase. These studies together suggest a model
where in the two DNA-PKcs molecules bound to different DNA ends would form a
bridge across the break. The conformational change accompanying the DNA end
binding of DNA-PKcs and the “synapsis” of DNA ends would result in the activation of
kinase, triggering the pho sphorylation events (autophosphorylation of DNA-PKcs)

required for NHEJ.

Recently, a cryo EM three dimensional structure of 13A resolution was generated

(Rivera-Calzada et al. , 2005) (Fig. 4). This higher resolution allowed more detailed

21

definition of structural domains and revealed several new features. Using threading and
docking techniques, the authors placed the kinase domain in the head region of DNA-
PKcs. At this higher resolution the palm domain was further resolved into two distinct
segments or claws designated as proximal and distal claw. The two claws together

maintain a palm structure observed in the low resolution, 30A structure.

Sequence-based predictions led the authors to propose that the arm region is being
formed by a succession of HEAT repeat segments. HEAT repeat is a member of a family
of repeat motifs that form superhelices or solenoids. A HEAT repeat comprises two
helices A and B, which form helical hairpin. The A helices from the convex surface of
the superhelix and B helices form the concave surface. Brewerton et a! had first
identified the presence of HEAT repeats in the region N-terminal to the kinase domain in
DNA-PKcs and had further hypothesized that the HEAT repeats are present in the more
curved part of the DNA-PKcs (Brewerton et al., 2004). Further, by placing major
domains of the kinase in the structure, Rivera -Calzada et al could approximately predict
the physical locations of “landmark” residues. The flow of the polypeptide placed the
first ~800 residues to constitute the distal claw and associated arm region and residues
800-1900 forming the major segment of the arm and the proximal claw. The
autophosphorylation sites (T2609, S2612, T2620, S2624, T2638, T2647) were mapped to
the shoulder, which is the region connecting the arm to the head. This placement would
make these sites inaccessible to the active site of the same molecule, hence suggesting
autophosphorylation of DNA-PKcs occurs in trans via interaction with a second

molecule. The LRR region maps to the proximal claw of the arm in the structure.

22

Fig. 3. Two views of DNA-PKcs 3D structure (30A): The structures in blue are free
DNA-PKcs molecules and orange are DNA-bound complexes. The insert shows a

comparable View of ATM.

23

Fig. 3

E
8;!

head arm palm

DNAl

  

Modified from Boskovic at al. EMBO J. 2003, 22(21); 5875-5882

24

Fig. 4. Conformational changes of DNA-PKcs upon DNA binding:

(A) Negative-stain EM structure (gold) of DNA-PKcs bound to one end of a 54 bp DNA duplex.
The DNA (blue) which is clearly visible at a lower contour level (white) passes between and is in
contact with the edges of head and palm along its backbone, with the blunt end in contact with
the inner face of the palm

(B) Montage of the 13A cryo-EM structure of DNA-PKcs and the 30A negative-stain

structures for DNA-PKcs in the absence and presence of DNA. Functional domains identified in
the cryo-EM structure and their counterparts in the negative-stain structures are labeled as
follows: PIKK- catalytic domain; arm-man array of HEAT repeats; DC-distal calw of the palm;
PC-proximal claw, F AT-proetruding end of the FAT domain, FATC-FATC domain.

(C) as (B) but rotated ~90° around the vertical. The change in position of F ATC domain, FAT

protrusion and claws on DNA binding is evident.

25

Fig. 4

 

  
   

C

 

DC

Modified from Rivera-Calzada at al, Structure 2005, 13; 243-255

26

2.7 Lecuine Rich Region in DNA-PKcs

A potential leucine zipper motif within the DNA-PKcs coding sequence spanning
residues 1503-1538 was noted by Hartley et al. in the original sequence analysis of the
molecule (Hartley et al., 1995). It consists of 6 leucine residues, each separated by six
residues. However, as observed by Fujirnori et al, the first and fourth leucine residues
(aa1502 and aa1524 respectively) are substituted in chicken and Xenopus, however the
second and third leucine residues (a 1510 and aa 1517) are conserved among all
vertebrates (F ujirnori et al., 2000). More recently, other investigators consider this region
(1503-1539) to be more appropriately designated as a leucine rich region (33% leucine).
A more extensive overlapping region (1503-1602) is also relatively leucine rich (20%).
DNA-PKcs is highly homologous (63-85%) in the six species for which sequences are
available, (human, horse, dog, mouse, chicken and frog). The leucine rich region (LRR)
is similarly well conserved (Fig. 5). The LRR has also been shown to interact with a
nuclear matrix, DNA binding protein C1D (Yavuzer et al. , 1998). The authors further

showed that C1D could activate DNA-PKcs in absence of DNA ends.

27

Fig. 5

 

 

 

 

1 1502 1602 3205 4128
A.
PI3K domain
Caspase site
B. 1 5 o 2 LRR\ 1 5 3 9
SLDPSCKRLASGLLELAFAFGGLCEHLVSLLLNTAVLS
human --—L——-Q ————————————————— R _______ p__--
Equine ——-—N ——————————————————————————— D-T---
Canine ———————————————————————————— D-—-D .....
Murine ------- S--N ——————— G ----- D -------- S—M——
Gallus AV-I-S----DR--Q--——IDDQ--E -------- v-—-
Xenopus —--I-S----E ------- M--—Q——E ________ VI--
air it
WT DNA~PKCS SEDLSCKQIJASGWFAFGGECERLVSELLNPAVES...
LRR DNA-PKcs SEDLSCKQEASGIJQEAFAFGGECERLVSEILNPAV_L_S...

C. % Homology with huDNA-PKcs

complete LRR
Equine 84.5 82.1
Canine 82.9 84.6
Murine 78.8 78.9
Gallus 68.4 61.5
Xenopus 63.3 74.4

 

 

 

 

 

 

 

 

 

 

Fig. 5. Digrammatic representation of DNA-PKcs: A. A line diagram depicting
various domains in DNA-PKcs B. Mutations introduced in LR. C. LRR compared

across vertebrates

28

2.8 C1D

C1D was identified as a l6kDa polypeptide found to be covalently associated
with genomic DNA covalently. The cDNA was first cloned by expression cloning using a
monoclonal antibody to polypeptides released fi'om rigorously extracted and nuclease-
digested DNA (Nehls et al., 1998). The authors proposed it to be an epigenetic factor
involved in gene regulation. Later, C1D was found to be associated with the
transcriptional repressor RevErb and nuclear corepressors NcoR and SMRT, which led to
the hypothesis that C1D is a component of the complex involved in transcriptional

repression and was also in agreement with the role previously proposed for C1D (Zamir

et al., 1997).

2.8.1 ClD’s role in apoptosis:

Using human C1D cDNA as a probe with poly(A)+ RNAs from 50 human tissues,
C1D was shown to be expressed in all cells (Rothbarth et al., 1999). Rothbarth et al
also concluded that the expression level of the endogenous gene is cell type-specifically
regulated and that different cell types require and /or tolerate difi‘erent levels of C1D
protein. When over-expressed in cells, C1D triggers apoptosis. Rothbarth et al
speculated that over-expression of C1D mimics or substitutes for DNA strand breaks,
resulting in an initial DNA-end independent activation of DNA-PK, which fiirther results
in p53 activation and finally leads to apoptosis. However, they did not provide any
biochemical evidence for this pathway being activated by over-expression of C1D.
Another study by the same authors showed that inhibition of proteasome-dependent

proteolysis results in increase in the expression of C1D and similar increase in expression

29

on proteasome inhibition is also true for other apoptosis-related gene products like p53,

p73, p21Cipl, p27Kip and caspases (Rothbarth et al., 2002).

2.8.2 C1D in NHEJ:

Yavuzer et al in their study had shown that the protein and mRNA levels of C1D
increase upon y-irradiation. Also, they had identified C1D to be the first substrate that
was capable of activating DNA-PK in the absence of free-ends (Yavuzer et al., 1998).
With C1D being also identified as a player in apoptosis, it is highly likely that C1D plays
a role in DSB repair by either contributing to the activation of DNA-PK to help repair the
breaks or triggering apoptosis if the damage is beyond repair. Further, C1D was
identified as a polypeptide that might be involved in higher order chromatin folding. The
polypeptides that are covalently bound to DNA, like C1D, form a part of nuclear matrix
and some of them have been reported to be involved in targeting a subset of genomic
DNA to the nuclear matrix (N euer et al., 1983; Neuer and Werner, 1985). Given the
role of nuclear matrix in the regulation of important cellular events such as DNA
replication, transcription, RNA splicing and DSB repair (Mullenders et al., 1984; Nelson
et al., 1986; Nelson and Coffey, 1987; Getzenberg et al., 1991; Koehler and Hanawalt,

1996), it seems possible that C1D plays an important role in DSB repair.

Using S. cerevisiae as a model organism, Erdimir et al, analysed the consequence
of loss of functional C1D. In agreement with the proposed function of C1D, ycI d mutant
was sensitive for growth at 39°C, which is a common phenotype of mutants defective in

preservation of genomic integrity (Boulton and Jackson, 1996a, b; Hryciw et al., 2002).

30

Like yku 70, ycId was slightly sensitive to yirradiation. Using plasmid based assays, the
authors further showed that ye] d mutant was defective in DNA-end joining, specifically
3’-end processing. Also, in the absence off Ycldp, 50% of the 3’-overhanging breaks
were repaired inaccurately, suggesting that Ycldp might play a role to suppress error
prone DSB repair pathway and help in maintaing genomic integrity. When tested for
HR, ycId showed two fold reduction in HR efficiency compared to the wild type.
Further, the double knock out ycId/yku 70 were more deficient in 3’-end joining when
compared to the single mutants, suggesting the two proteins co-operate in this process

(Erdemir et al. , 2002) in yeast.

In spite of all the above evidence, the role of C1D in DSB repair in higher
eukaryotes is still a subject of speculation. Yavuzer et al had shown that C1D interacts
with DNA-PKcs directly through the leucine rich region (LRR) of DNA-PKcs and also
activates the kinase. Additionally, since the LRR is approximately mapped to the
proximal claw of the arm region, the LRR might be a putative DNA binding domain in

DNA-PKcs.

Thus, in mystudyl disrupted the LRR motif in DNA-PKcs, using site directed

mutagensis, to better understand the role of C1D in DSB repair and its interaction with

DNA-PKcs.

31

2.9 DNA binding of DNA-PKcs in the absence of Ku

Studies with purified DNA-PKcs have shown that DNA-PKcs is capable of binding
to DNA by itself. This DNA binding activity was strongest in low salt (Hammarsten and
Chu, 1998) and decreased sharply when the salt concentration increased. Further, this
complex was biochemically fiinctional and this DNA binding can activate the kinase,
however the activation was specific for dsDNA ends. This study was corroborated by
another study from Yoo and Dynan who concluded that DNA-PKcs makes extensive
contacts with both strands of the DNA in the vicinity of DNA termini (Yoo and Dynan,
1999). Using iodopyridinated probes and cross linking experiments the authors firrther
concluded that DNA-PKcs caps the free DNA ends and displaces Ku toward interior
positions on DNA. These studies suggest that DNA-PKcs has DNA binding domains,
which might play a role in DNA-PKcs function in DNA repair. The 13A structure of
DNA-PKcs bound to DNA does provide some insight into the regions making contacts
with DNA (Rivera-Calzada et al., 2005). The EM images suggest the stabilization of

DNA termini by the arm, palm and FATC domain of DNA-PKcs (Fig 4).

32

CHAPTER 3

DNA-DEPENDENT PHOSPHORYLATION OF KU70/80 IS NOT
REQUIRED FOR NON HOMOLOGOUS END JOINING

ABSTRACT:

The Ku70/ 80 heterodimer is a major player in the non-homologous end joining
pathway for the repair of IR-induced DNA double-strand breaks (DSBs). Once bound to
a DSB, Ku recruits the catalytic subunit of the DNA-dependent protein kinase (DNA-
PKcs) to form the DNA-dependent protein kinase holoenzyrne complex (DNA-PK). Our
collaborator Susan Lees-Miller had previously identified four DNA-PK phosphorylation
sites on the Ku70/ 80 heterodimer: serine 6 of Ku70, serine 5 77 and 580 and threonine
715 of Ku80. Jin and colleagues had identified serine 51 as yet another phosphorylation
site in Ku70. This raised the interesting possibility that DNA-PK dependent
phosphorylation of Ku provide a mechanism for regulation of non-homologous end
joining. Here, using site directed mutagenesis of each of these sites we show that
phosphorylation at any or all of these sites is not required for non-homologous end
joining. Ku containing serine/threonine to alanine mutations at these sites was fully able
to complement the radiation sensitivity of Ku negative mammalian cells, indicating that
phosphorylation at these sites is not required for Ku’s function in non-homologous end
joining. Surprisingly, data from our collaborator’s laboratory showed that okadaic acid-

induced phosphorylation of Ku did not require the presence of either DNA-PKcs or the

33

related protein kinase, ATM, but was sensitive to the protein kinase inhibitor,
staurosporine. This suggested that in addition to DNA-PKcs, Ku is phosphorylated by a
staurosporine sensitive kinase. In sum, we conclude that DNA-PKcs is not the only
kinase that phosphorylates Ku in cells and that DNA-PK mediated phosphorylation of Ku

is not required for DNA double strand break repair.

34

INTRODUCTION:

The Ku70/80 heterodimer is required in the non-homologous end joining (NHEJ)
pathway for the repair of (IR) induced DNA double-strand breaks (DSBs) (Ross et al.,
1995; Lee et al., 1996). In vitro, Ku binds to ends of double stranded (ds) DNA with
high affinity (Blier et al., 1993; Dynan and Yoo, 1998). Once bound to a DNA end, Ku
recruits the catalytic subunit of the DNA-dependent protein kinase, DNA-PKcs, to the
DSB, which stimulates the activity of DNA-PKcs approximately ten-fold (Gottlieb and
Jackson, 1993; Smith and Jackson, 1999). The protein kinase activity of DNA-PK is
essential for NHEJ (Kurimasa et al., 1999; Kienker et al., 2000) and inhibitors of DNA-
PK activity inhibit NHEJ in vitro and in vivo (Baumann and West, 1998; Chemikova et
al., 1999). Since DNA-PK assembles and becomes active at a DSB, it is reasonable to
assume that its physiological targets could also be present and be phosphorylated at the
DSB. Indeed, all factors known to be required for NHEJ can be phosphorylated by DNA-
PK in vitro, and, in some cases, in viva. Chan et al had shown previously that DNA-PK
phosphorylates serine 6 of Ku70, and serines 577, 580 and possibly 579, as well as
threonine 715 of Ku80 in vitro (Chan et al., 1999). Additionally, serine 51 in Ku70 was
also identified as a DNA-PK target site (J in and Weaver, 1997). Other components of
the NHEJ pathway that are phosphorylated by DNA-PK in vitro include XRCC4 (serines
260 and 318) (Yu et al., 2003; Lee et al., 2004), DNA ligase IV (threonine 650 and either
serine 668 or 672) (Wang et al., 2004), and Artemis (Ma et al., 2002). Phosphorylation of
DNA ligase IV is not required for DNA end joining in vitro, but may affect the stability
of DNA ligase IV in vivo (Wang et al., 2004). Similarly, phosphorylation of XRCC4 is

not required for NHEJ (Yu et al., 2003). DNA-PKcs has been shown to

35

autophosphorylate itselfboth in vitro and in vivo and these autophosphorylation events

have been shown to be required for NHEJ (reviewed in section 2.4).

Since Ku is the DNA targeting subunit of DNA-PK, we considered it an excellent
candidate for a physiological substrate of DNA-PK Ku70 and Ku80 each contain a
central DNA binding region that is flanked by unique amino terminal and carboxy-
terminal regions (Gell and Jackson, 1999). The central DNA binding region of the
Ku70/ 80 heterodimer forms a basket like structure that cradles a strand of dsDNA
(Walker et al., 2001). In addition, Ku70 contains a highly acidic amino terminal region of
unknown function, and carboxy terminal SAP (SAF-A/B, Acinus and BIAS) domain that
may be important for DNA binding (Walker et al., 2001). Ku80 contains a C terminal
domain comprised of a helix-tum helix-motif (Harris et al., 2004) and, at the extreme C
terminus, a small region of approximately 12 amino acids that represents the minimal
sequence required for interaction with DNA-PKcs (Gell and Jackson, 1999; Singleton et
al. , 1999; Falck et al., 2005). Interestingly the identified DNA-PK phosphorylation sites
all lie in the unique N and C terminal domains of Ku70/80 (Chan et al., 1999). These
regions are close to the DNA-binding canal and/or are required for the interaction of Ku

with DNA-PKcs.

The protein kinase activity of DNA-PK is required for NHEJ and Ku70 and
Ku80 are phosphorylated by DNA-PKcs in vitro, therefore Ku70 and Ku80 were
candidate physiological substrates of DNA-PK. Given the proximity of the in vitro

phosphorylation sites to the DNA binding region of the Ku heterodimer, one attractive

36

hypothesis was that DNA-PK-mediated phosphorylation of Ku could displace Ku from
DNA ends prior to religation. Thus, we hypothesized that phosphorylation of Ku by
DNA-PK could be important for NHEJ. However, when tested in vivo by expressing
alanine or aspartic acid mutants of the phosphorylation sites, none of the sites seem to
play a role in NHEJ. To flirther investigate the physiological importance of Ku
phosphorylation, our collaborator Dr. Lees Miller’s laboratory raised phosphospecific
antibodies to serine 6 of Ku70, and serines 578, 580 and threonine 715 of Ku80. Using
these antibodies, they show that Ku is phosphorylated at these sites in vivo in okadaic
acid treated cells under conditions previously shown to inhibit protein phosphatase 2A
(PP2A). Surprisingly, OA-induced phosphorylation of Ku was ablated by preincubation
with staurosporine but not with wortmannin. Further, using phosphospecific antibodies in
DNA-deficient and ATM-deficient cells, they show that Ku gets phosphorylated at these

sites in vivo even in the absence of DNA-PKcs or ATM.
Thus, we conclude that a staurosporine sensitive kinase phosphorylated Ku in

addition to DNA-PKcs and that DNA-PK dependent phosphorylation of Ku is not

required for DSB repair.

37

MATERIALS AND METHODS:
Immunoblotting:

To assess expression of transfected Ku70 and Ku80, the indicated amounts of
whole cell extracts from clonal transfectants were analyzed after electrophoresis on a
7.5% SDS polyacrylamide gel and transfer to PVDF membrane. Polyclonal rabbit
antisera raised against Ku80 or Ku70 (Serotech, Raleigh, NC) was used as the primary
antibody (1 :5 000 dilution). In some experiments, V5 tagged Ku70 was detected with an
anti-V5 conjugated horseradish peroxidase (1 :5000 dilution). Anti-rabbit IgG
conjugated to horseradish peroxidase was used as the secondary antibody (1:5000
dilution). Membranes were incubated with a chemiluminescent substrate (ECL, DuPont)

according to the manufacturer’s recommendations.

Phosphorylation of Ku by DNA-PKcs:

Purified DNA-PKcs (600 ng) and Ku 70/80 (200 ng) were incubated in the presence
of 50 mM Hepes/NaOH (pH 7.5), 50 mM KCl, 10 mM MgC12, 0.25 mM unlabelled (non
radioactive) ATP, plus sonicated calf thymus DNA at (10 mg/ml). Samples were
analyzed by SDS/PAGE on 10% acrylamide gels followed by coomassie blue staining

and autoradiography.

38

Cell culture and cell extracts and dsDNA cellulose pulldown assays:

The xrs-6, Ku80 deficient cell line was a generous gift fiom Dr. David Roth (New
York University). Cells were maintained in F12 nutrient medium with 10% fetal calf
serum (Gibco BRL, Gaithersburg, MD). Stable transfectants were maintained with 2.5
ug/ml Blasticidin. Transfectants co-expressing human Ku80 and human Ku70 were
maintained with 2.5 ug/ml blasticidin and 100 ug/ml G418. xrs-6 transfectants
expressing human Ku70 and/or human Ku80 were derived by stably transfecting cells
with 40ug PvuI I linearized plasmid. Transfections were performed in 60 mm dishes
using FuGENE 6 Transfection Reagent (Roche Molecular Biochemicals, Indianapolis,
IN) according to the manufacturer’s instructions. Forty-eight hours after transfection,
cells were placed under selection conditions (2.5ug/ml blasticidin or lOOug/ml G418)
and isolated clones derived. Individual colonies were screened for Ku80 or Ku70

expression by imrnunoblot analysis and further cultured.

Ku70'l' ES cells were a generous gift from Dr. Fred Alt (Harvard University
Medical School). Cells were maintained in DMEM supplemented with 20% fetal calf
serum and ESGRO (Chemicon, Temecula, CA) in gelatinized 60mm dishes. Stable
transfectants were maintained with 5 pg/ml blasticidin. Ku70'/' ES cell transfectants
expressing Ku70 were derived by stably transfecting cells with 25 pg PvuI I linearized

plasmid. Transfections were performed as described above.

39

Oligonucleotides:

The following oligonucleotides (and complements) were used generate Ku 70 and 80
mutants.

70S6A : 5’ ATT TGC GGC CGC AGA TGT CAG GGT GGG AGG CCT ATT
70S51A : 5’ GGC TAT GTT TGA AGC TCA GAG TGA AGA TGA G

7OS6D : 5’ ATT TGC GGC CGC AGA TGT CAG GGT GGG AGG ACT ATT
70S51D: 5’ ATG TTT GAA GAC CAG AGT GAA G

80S577-80A : 5’ GGA GCC CAC TTC GCT GTC TCC GCT CTG GCT GAA GGC
80S715A: 5’ AGT GGA GAC GCT GCA GCT GTA T

80S577-80D : 5’ GGA GCC CAC TTC GAC GTC TCC GAC CTG GCT GAA GGC

8OS7ISD: 5’ AGT GGA GAC GAC GCA GCT GTA T

Construction and transfection of expression plasmid:

Human Ku80 and Ku70 cDNAs were cloned from human mRNA into bacterial
expression plasmids. For expression in mammalian cells, the Ku80 cDNA was
subcloned into pcDNA6A (Invitrogen, Carlsbad, CA) and the Ku70 cDNA was

subcloned into plncx2 and pEF6-V5/1-Iis C (Invitrogen, Carlsbad, CA).

Assessment of Radiation Sensitivity:

Cells (1 x 103) in serum free media were exposed to various amounts of ionizing
radiation using a 60C0 source and immediately seeded in complete medium. After 7 days,
cell colonies were fixed with methanol, stained with crystal violet and colony numbers

are assessed.

40

V(D)J Recombination assays:

To assess V(D)J recombination in xrs-6 cells, RAG-1 and RAG-2 expression
constructs (3 pg each), expression plasmids encoding Ku80, or the pcDNA6A vector
control (6 pg) and a recombination substrate (pJH201 or pJH290; 1 pg) were transfected
by liposome using the F uGENE 6 transfection reagent (Roche Molecular Biochemicals).
In some experiments, 6 pg of a terminal deoxynucleotidyl transferase (Tdt) expression
plasmid was included in the transfections. Forty-eight hours later, plasmid substrates
were rescued from the cells by alkaline lysis. Alkaline lysates were restricted with Dpnl
and then used to transform chemically competent Escherichia coli. Transformed bacteria
were spread onto two Luria-Bertani agar plates, one containing 100 pg of ampicillin/ml
and the other containing 100 pg of ampicillin/ml plus 22 pg of chloramphenicol/ml. For
sequence analyses, plasmid DNA was prepared from individual chloramphenicol-

resistant colonies.

MTT Assays:

Cells (15 x 103) in serum free media were exposed to various amounts of ionizing
radiation using a 60Co source and immediately seeded into complete medium in
gelatinized 24 well plates. After 5 days, the cells were incubated with MTT (lmg/ml) for
2-3 hours at 37°C. The cells were then solubilised in 200pl of acidic iso-propanol. Cell

survival was assessed by plotting absorbance (590nm-650nm).

41

Generation and purification of Baculovirus expressed Ku:

Human Ku70 and Ku80 cDNA cloned into pFastBac Dual was a generous gift fiom
Dr. Dale Ramsden’s lab. A 300bp PCR product (using the Ku70 (S6,51A) in plncx2 as
the template) was subcloned into pFastBac Dual at BamHl/ EcoRl sites to generate
alanine substitutions at serine 6 and 51 in Ku70. A le PCR product (using Ku80
(SS77,5 80A, T715A) in pcDNA6A as the template) was subcloned into the pFastBac
Dual at Smal/Nhel sites to generate alanine substitutions at serine 577,580 and threonine
715 in Ku80. In each of these constructs Ku70 and Ku80 were co-transcribed and Ku70

was synthesized with a C-terminal His tag.

Pellets from Sf9 cells infected with baculovirus expressing Ku70 and Ku80 were
lysed in Buffer C (20mM HEPES pH7.9, 25% glycerol, 420mM NaCl, 1.5mM MgClz,
0.2mM EDTA, Complete Mini- Protease Inhibitor Cocktail tablets EDTA free (Roche), 5
mM imidazole) and incubated with Ni+-agarose beads (Qiagen) (preequilrbrated with
Buffer C) for 1 hour at 4°C. The beads were washed three times in buffer C containing
50mM irnidazole. The protein was then eluted in buffer C containing SOOmM irnidazole
and dialyzed overnight against Buffer D (20mM HEPES pH 7.9, 20% glycerol, 100mM
KC], 0.2mM EDTA). For phosphorylation assays, either wild type Ku or Ku containing 5
serine/threonine to alanine mutations (Ku ALA) was incubated with purified human

DNA-PKcs under standard autophosphorylation conditions as described above.

42

RESULTS:

Single site phosphorylation at S577 or $580 or T715 in Ku80 does not alter its role
in NHEJ:

We first addressed if phosphorylation of any single site in Ku80 was important
for its role in NHEJ. To address this, we used site directed mutagenesis to mutate the
phosphorylation sites (serine or threonine) to alanine. Alanine, unlike serine or
threonine, lacks a hydroxyl group and thus cannot be phosphorylated. Hence, mutating
serine/threonine to alanine makes a protein non-phosphorylatable. Dr. Lees-Miller’s
laboratory supplied us with bacterial expression constructs for fusion proteins of the
human Ku80 phosphorylation site mutants SS 77A, S5 80A andT715A. These were sub-
cloned into eukaryotic expression vectors before I joined the laboratory. I started by
stably transfecting these constructs in xrs-6, a cell line deficient in Ku80. The stable
clones were screened by western blotting for protein expression (Fig. 6A) and evaluated

for radioresistance.

Using single site mutants we wanted to first address if phosphorylation at any one
site by itselfwas important for Ku’s role in NHEJ. Since threonine 715 is located
towards the C-terminus of Ku80 and is extremely close to the 12aa tail that interacts with
DNA-PKcs, it seemed plausible that phosphorylation at threonine 715 might be involved
in regulation of dissociation of Ku fi‘om DNA-PKcs and DNA. In that case, blocking
phosphorylation at threonine 715 would block this disassembly and the downstream
factors from accessing DNA ends. This would lead to a block in the repair of DSBs

making cells radiosensitive.

43

However, as can be seen in Fig. 6B, cells expressing T715A mutant for Ku80
were as radioresistant as the cells expressing wild type Ku80. The same was also true for
S577A and SS 80A mutants. Thus, I concluded that blocking phosphorylation at either

S577, 580 or threonine 715 in Ku80 does not block Ku’s role in NHEJ.

Multi-site phosphorylation in Ku80 does not alter its role in NHEJ:

Next, I blocked phosphorylation at all three sites in Ku80 by constructing a
combined mutant cDNA (Ku80 ALA) to test whether multi-site phosphorylation (as
opposed to single site phosphorylation) is required for Ku80’s role in NHEJ. To address
whether or not phosphorylation makes Ku non-functional, I also generated a cDNA
expression vector for aspartic acid mutant of Ku80 where the three phosphorylation sites
were mutated to aspartic acid (Ku80 ASP) (aspartic acid sometimes can mimic
phosphoserine and phosphothreonine). Similar to above, stable transfectants were
generated and screened by western blotting for protein expression (Fig. 7A, 8A). These
clones were then assessed for radiosensitivity and compared to the stable clones
expressing wild type Ku80 (Fig. 7B, 8B). Both, Ku80 ALA and ASP mutants reversed
the NHEJ defect in xrs-6 to the wild type levels. Further, transient V(D)J recombination
assays revealed no fimctional deficits compared to wild type (Table 1). From this data, I

conclude that Ku80 phosphorylation is not required for Ku’s fiinction in NHEJ.

44

Fig. 6. Alanine mutants at single site in Ku80 exhibit wild type complementation of
NHEJ deficit in xrs-6: A. 100 pg of whole cell extracts from xrs-6 cells stably
transfected with vector alone (vector, lane 2) or wild type Ku80 (Ku80 WT, lane 1) or
alanine mutant at single site in Ku80 (Ku80 8577A, lane 3; Ku80 S580A, lane 4; Ku80
T715A, lane 5) were analyzed by western blot for Ku80 expression. B. Radioresistance
of xrs-6 cells stably transfected with vector alone (crosses, solid line) or wild type Ku80
(solid circles, dotted line) or alanine mutant at serine 577 (Ku80 S577A, open circles/
solid line) or alanine mutant at serine 580 (Ku80 8580A, open squares/solid line) or
alanine mutant at threonine 715 (Ku80 T715A, closed triangles/solid line) was

determined by clonal survival assays as described in section 3.1.

45

Fig. 6

gas

Ku80 WT
Ku80 $577A

Ku80 $580A
Ku80 371 5A

vector

 

 

 

46

Fig. 7. Multi site alanine mutant in Ku80 exhibit wild type complementation of
NHEJ deficit in xrs-6: A. 100 pg of whole cell extracts from Chinese hamster ovary
cells (CH0 9, lane 1) or xrs-6 cells stably transfected with vector alone (vector, lanes 2-
3) or wild type Ku80 (WT C, lane 4; WT D, lane 7) or Ku80 with serines 577, 580 and
threonine 715 mutated to alanine (TM ALA 6, lane 5; TM ALA 8, lane 8) were analyzed
by western blot for Ku80 expression. B. Radioresistance of xrs-6 cells stably transfected
with vector alone (open circles/solid line) or Ku80 WT (WT C, WT D, solid
squares/solid line) or TM ALA (TM ALA 6, TM ALA 8, solid triangles/solid line) or
CH0 9 (closed circles/solid line) was determined by clonal survival assays as described

in section 3.1.

47

A. 8 a 25 0;: 0;
.1. r s s a s a
1 2 3 4 5 6 7 8
B.

 

 

100
l —._ CH0 9
—°—‘ vector
+ wr c
+ TM ALA e
l
°\o 10
i
1 l T I T l l
0 100 200 300 400 500 600

Rads

48

Fig. 73 (cont)

100

 

 

1 —0— CH09
- \\ —°—" vector
\ -I— wro
+ TMALA8

°\o 10:

1

i

1 fl 1 I I f f I I
0 100 200 300 400 500 600

49

Fig. 8. Multi site aspartic acid mutant in Ku80 exhibit wild type complementation of
NHEJ deficit in xrs-6: A. 100 pg of whole cell extracts from xrs-6 cells stably
transfected with vector alone (vector, lane 2) or wild type Ku80 (WT C, lanel) or Ku80
with serines 577, 580 and threonine 715 mutated to aspartic acid (TM ASP 11, lane 3)
were analyzed by western blot for Ku80 expression. B. Radioresistance of xrs-6 cells
stably transfected with vector alone (open circles/solid line) or Ku80 WT (WT C, solid
circles/solid line) or TM ASP (TM ASP 11, solid squares/solid line) was determined by

clonal survival assays as described in section 3.1.

50

Fm.8

E
A. (D 'g 22
E 2
> I'-
KU80>-—- -
1 2 3
B.

100
_'°_WTC

—'— TM ASP 11
'—°— vector

10 .

%D

 

 

0 200 400 600 800 1000

Rads

51

Table 2.

 

 

 

 

coding joints (pJH290)
Transfected plasmids #Amp Cam/ Recombination (%)
#Amp

RAGS only 2/47,040 0.004

RAGS + Ku80WT 39/68,600 0.05
60/140,532 0.042
35/53,312 0.065

RAGS + Ku80ALA 65/35,280 0.13
14/117,600 0.012
47/ 123,480 0.038

 

 

 

 

 

Table 2. Ku80ALA supports wild type levels of V(D)J recombination: Transient
V(D)J recombination assays were performed as described in Experimental Procedures.
RAG expression from plasmid vectors initiates recombination in the V3 cells, as assessed
by the plasmid substrate pJH290 that detects coding joints or the pJH201 substrate that
detects signal joints as indicated. Numbers of ampicillin (amp) and
ampicillin/chloramphenicol (amp+cam) resistant colonies fiom at least three separate
experiments are presented. Recombination rate (%R) is calculated as the number of

chloramphenicol resistant colonies divided by ampicillin resistant colonies X 100.

52

Ku70 phosphorylation is not required for NHEJ:

Since Ku is a heterodimer made up of two proteins Ku70 and Ku80, it was also
important to address if phosphorylation of Ku70 is required during NHEJ. As mentioned
previously, there are two phosphorylation sites identified in Ku70, serine 6 and serine 51.
To address the relevance of these sites, I constructed cDNA(s) where serine 6 and 51
were mutated to either alanine (Ku70 ALA) to block phosphorylation or aspartic acid
(Ku70 ASP) to mimic constitutive phosphorylation. Wild type Ku70, Ku70 ALA or
Ku70 ASP were expressed in Ku70 4' ES cells (Fig. 9A) and clones with similar Ku70
expression were evaluated for radioresistance (Fig. 98). Both the alanine and aspartic
acid Ku70 mutants reversed the radiosensitive phenotype of Ku70'/' ES cells similarly to
wild type Ku70. Hence, I conclude that phosphorylation of Ku70 at either serine 6 or

serine 51 is not required for NHEJ.

53

Fig. 9. Alanine and aspartic acid mutants of Ku70 exhibit wild type
complementation of NHEJ deficit in Ku70"' ES cells. A. 100 pg of whole cell extracts
from Ku704' cells stably transfected with vector alone (vector, lane 1) or wild type V5-
Ku70 (WT, lane2) orV5-Ku70 with serines 6 and 51 mutated to either alanine (ALA,
lane 3) or aspartic acid (ASP, 1ane4) were analyzed by western blot for Ku70 expression
using anti-V5 antibody. B. Radioresistance of Ku70‘/' cells stably transfected with vector
alone (open circles/solid line) or wild type V5-Ku70 (Ku70 WT, solid circles/ bold line)
or V5-Ku70 ALA (open squares/solid line) or V5-Ku70 ASP (open triangles/solid line)

was determined using MTT assays as described in section 3.1.

54

Fig. 9

A’ isét

Ku70>= '-"-"
12 34

' —°— vector

'—0— ALA
—‘A'— ASP

 

 

 

‘ I ' I ' l

0 100 200 300 400 500
Rads

55

DNA-PK phosphorylation sites in Ku70/80 are not required for NHEJ:

As noted previously, DNA-PKcs autophosphorylates on multiple sites within two
major clusters spanning amino acids 2609-2647 and 2023-2056 and this
autophosphorylation is required for NHEJ (Ding et al., 2003). Moreover, our lab has
shown that phosphorylation at only one or two sites within a cluster of five or six sites
can suffice functionally in DNA-PKcs. Thus, it was possible that in the above
experiments phosphorylation of one protein (Ku70) can suffice for the block in

phosphorylation of the other (Ku80) in xrs-6 cells and vice versa for Ku704'ES cells.

Additionally, even though the phosphorylation sites were not present in the
crystal structure for Ku, the arrangement of the polypeptide chain in the structure
suggested that the two sites in Ku70 and three sites in Ku80 are in close proximity to
with each other. Thus, we next considered that phosphorylation at all five sites in Ku70
and Ku80 might act in concert and play a role in NHEJ. To address if phosphorylation of
Ku70 and Ku80 together is required for NHEJ, we needed a cell strain that was
genetically deficient in both Ku70 and Ku80. xrs-6 is only genetically defective in
Ku80. For Ku70, whereas mRNA levels are similar to wild type CHO cells, the amount
of protein detected in xrs-6 is minimal. The reason for this difference between the mRNA
and protein levels of Ku70 has been attributed to the instability of Ku70 in the absence of
Ku80. It has been shown previously that endogenous hamster Ku70 is stabilized by
ectopic expression of Ku80. However, expression of human Ku80 only partially reverses
the NHEJ deficit in the xrs-6 cell line (Smider et al., 1994). This partial

complementation has been attributed to the structural differences between hamster and

56

human Ku80 (76% identity). Considering these structural differences between hamster
and human Ku80, I hypothesized that human Ku70, when co-expressed with human
Ku80 in xrs-6 cells, should act as the dominant partner and should out compete
endogenous hamster Ku70 for heterodirnerization. This would result in instability of
endogenous hamster Ku70 and would enable me to test the fimctionality of mutant Ku

(with all five sites mutated to alanine and aspartic acid).

To test this hypothesis, I generated an expression vector encoding a fimctionally
inactive (for NHEJ) N-terminal Ku70 deletion mutant that has previously been shown to
efficiently heterodirnerize with Ku80 (J in and Weaver, 1997). This N—terminal deletion
mutant was expressed in xrs-6 cells expressing WT Ku80 (Fig. 10A). If human Ku70
preferentially heterodirnerizes with human Ku80, expression of the deletion mutant
should act as a dominant negative in the xrs-6 transfectants expressing wild type Ku80.
Stable clones were assessed for Ku70 expression (Fig. 10A) and as can be seen, the
amount of the deletion mutant protein is less than the endogenous hamster Ku70.
However, co-expressing the deletion mutant does not affect the levels of endogenous
hamster Ku70. This we believe is due to the reason that the deletion mutant is not
expressed at high levels (deletion mutants are often unstable) to out compete the
endogenous protein completely or partially. Also, it is possible that I was unable to
detect the slight decrease in the levels of endogenous hamster Ku70 in a western blot.
However, when tested in irradiation assays, the cells co-expressing the human Ku70
deletion mutant and wild type hamster Ku70 have a radiosensitive phenotype (Fig. 10B)

demonstrating that a non-fimctional Ku70 mutant (even in low amounts) can out compete

57

endogenous hamster Ku70 and can act as a dominant negative partner for Ku80 (albeit

incomplete).

Using this approach, we next addressed whether expression of human Ku
heterodirners with all five phosphorylation sites substituted with either alanine or aspartic
acid fimctionally complement the radiosensitive phenotype of xrs-6 cells. However, co—
expression of either alanine or aspartic acid Ku70 mutants with the corresponding Ku80
mutants did not induce radiosensitivity (Fig. 11B and 12B). This is true even in
transfectants that express substantial levels of the mutant Ku70 proteins (Fig. 11A and
12A). Thus, we conclude that phosphorylation at these five sites in the Ku heterodimer is

not required for IR induced double strand break repair.

Ku70ALA expressed in baculovirus is phosphorylated on additional sites:

Since mutating five known phosphorylation sites did not affect Ku’s role in
NHEJ, there was a possibility of additional phosphorylation site(s) present in the
heterodimer, which might be functionally relevant for Ku’s role in NHEJ. To address
this, I expressed wild type and mutant (all five sites mutated to alanine) Ku70 and Ku80
in Sf9 cells using baculovirus expression vectors (see Materials and Methods). The
proteins were partially purified and phosphorylated in the presence of purified DNA-
PKcs and y-3ZP [ATP]. As shown in Fig.13, the ability of purified DNA-PKcs to
phosphorylate the alanine mutant Ku proteins in vitro was reduced to approximately 30%
(for Ku70) and less than 10% (for Ku80) as compared to wild type Ku expressed in

baculovirus. This suggested that the identified sites in Ku70 and Ku80 represent the

58

major in vitro DNA-PK phosphorylation sites. Our collaborators also corroborated this

by mass spectrometric analyses of in vitro phosphorylated Ku.

Also, during the course of my studies our collaborator generated a panel of
phosphospecific antibodies to the identified DNA-PK phosphorylation sites in Ku. Using
these phosphospecific antibodies, it was confirmed that in the presence of okadaic acid,
serine 6 of Ku70 and serines 577, 580 and threonine 715 are phosphorylated in vitro and
in vivo. However, this phosphorylation was abrogated in the presence of protein kinase
inhibitor staurosporine and was not affected by wortmannin (DNA-PKcs inhibitor). This
suggested that in vivo, in addition to DNA-PKcs, Ku is also phosphorylated by a putative

staurosporine sensitive kinase whose identity is currently being investigated.

59

Fig. 10. Co-expressing N-terminal deletion of Ku70 (NdelKu70) with wild type
Ku80 confers radiosensitivity in xrs-6 cells. A. lOOpg of whole cell extracts from xrs-6

cells stably transfected with wild type Ku80 (WT C, lane 1) or both wild type Ku80 and
NdelKu70 (Ku70 Ndel/Ku80 WT, lane 2) was analyzed by western blot for Ku70
expression. B. xrs-6 cells stably transfected with wild type Ku80 (solid circles/solid line)
or both wild type Ku80 and NAKu70 (open squares/solid line) or vector alone
(crosses/solid line) were irradiated at the indicated doses and cell death was assessed by

colony formation as descnbed in section 3.1.

60

Fig.10

>
u80 WI'I Ndel Ku70

s
3

 

 

X
_, _, <Ku70 WT
W O
4 <Ku70 Ndel
1 2
B.
100
1 —-‘— Ku80 WT
I —D— Ku70Ndel/Ku80WT
—'— vector
i
10 3
1
.\° ‘ .
11
1
t
.1 ' l H I ' I ' I V l
0 200 400 600 800 1000
Rads

61

Fig. 11. Co-expressing alanine mutants of Ku70 and Ku80 do not confer
radiosensitivity. A. 100 pg of whole cell extracts fiom xrs-6 cells stably transfected with
vector alone (vector, lane 3) or wild type Ku80 (WT C, lane 1) or alanine mutant Ku80
(TM6, lane 2) or both alanine mutant Ku70 and alanine mutant Ku80 (Ku70/80 ALA 1
and 5, lanes 4 and 5) were analysed by western blot for Ku70 and Ku80 expression. B.
xrs-6 cells stably transfected with wild type Ku80 (solid circles/bold line) or alanine
mutant Ku80 (solid circles/solid line) or both alanine mutant Ku70 and alanine mutant
Ku80 (open squares/solid line and open triangles/solid line) or vector alone (crosses/solid
line) were irradiated at the indicated doses and cell death was assessed by colony

formation as described in section 3.1.

62

11’-

33750111

Fig. 11

v-IO
A. g;
E? a;
seis-
XX XX
Ku70> '6“,-
Ku80>-' 9"
12 345
e.

%

 

 

 

o zoo 400 600
Rads

63

fiIiTfi'

Ku80 WT
Ku80 ALA

Ku70l80 ALA 1
Ku70l80 ALA 5

vector

Fig.12. Co-expressing aspartic acid mutants of Ku70 and Ku80 do not confer
radiosensitivity. A. 100pg of whole cell extracts from xrs-6 cells stably transfected with
vector alone (vector, lane 3) or wild type Ku80 (WT C, lane 1) or aspartic acid mutant
Ku80 (TM ASP, lane 2) or both aspartic acid mutant Ku70 and aspartic acid mutant
Ku80 (Ku70/80 ASP 8,11 and 12, lanes 4, 5 and 6) were analysed by western blot for
Ku70 and Ku80 expression. B. xrs-6 cells stably transfected with wild type Ku80 (filled
circles/bold line) or aspartic acid mutant Ku80 (filled squares/solid line) or both aspartic
acid mutant Ku70 and aspartic acid mutant Ku80 (Open circles/solid line, open
squares/solid line and open triangles/solid line) or vector alone (crosses/solid line) were
irradiated at the indicated doses and cell death was assessed by colony formation as

described in section 3.1.

64

Fig. 12

.023!
a.£L CL
A- 2222
EB§§88
a geéé
§§x§§§
Ku70>" d“
Ku80>_. w
12 3 4 5 e
B.

—— Ku80 WT
—l— Ku80 Asp11
—0— Ku70/80 Asp8
—U— Ku70/80 Asp11
-—A— Ku70/80 Asp12
-—*— vector

 

 

 

1 r I ' I ' I I

1
0 200 400 600 800 1000

Rads

65

Fig. 13. Mutating three phosphorylation sites in Ku80 and two phosphorylation
sites in Ku70 reduces in vitro phosphorylation of Ku70/80 by DNA-PKcs:

A. Ku70/80 WT (lane 2, 4 and 6) or Ku70/80 ALA (lane 3, 5 and 7) were expressed in
Sf9 cells and 15p] of cell lysate (lanes 23), 15p] NF-agaorse beads (lanes 4,5), or 10pl
of eluted protein (lanes 6,7) was analyzed on a SDS-PAGE gel followed by coomassie
blue staining.

B. Partially purified Ku70/80 WT (lanesl-3) or ALA (lanes 5-7) was phosphorylated in
the presence of purified DNA-PKcs and y32-[ATP] using three molar ratios of KuzDNA-
PKcs (1 :3, 1:1 and 3:1) and phosphorylation was analyzed by SDS-PAGE followed by

autoradiography.

66

Fig. 13

 

.E

.. i .- g

_ i 1

8 'z E

235252

§sss§§

NNNNNN

12121212212
3;:2.;

p

a: a:
Ku80> a Isa--
Ku70>ig i! as."

I
1234567

Ku70/80 WT Ku70/80 ALA

 

 

KuzDNA-PKce 1:3 1:1 3:1 1:3 1:1 3:1

”°'" .1. - —

Ku80> 0. a... -

M70“ .-....-. «- e1-

1234567

67

DISCUSSION:

Our collaborator Susan Lees-Miller’s laboratory had shown that both Ku70 and
Ku80 are phosphorylated in vitro by purified DNA-PK (Chan et al., 1999). Further, using
phosphospecific antibodies, they showed that in the presence of protein phosphatase

inhibitor, okadaic acid, Ku is phosphorylated at these sites in vivo.

Thus, DNA-PK—dependent phosphorylation of the Ku heterodimer presented an
attractive model for the regulation of NHEJ . To test this hypothesis, I generated a panel
of cell lines expressing either the alanine or aspartic acid mutant of Ku80 (serines
577,580 and threonine 715 to either alanine, Ku80 ALA, or aspartic acid, Ku80 ASP) and
Ku70 (serines 6 and 51 mutated to either alanine Ku70 ALA or aspartic acid, Ku70
ASP). Expressing either Ku80 ALA or Ku80 ASP in xrs-6 or Ku70 ALA or ASP in
Ku70‘l' ES cells complemented the IR sensitivity of these cells like the wild type Ku80 or
Ku70. Co-expressing the Ku70 ALA or ASP and Ku80 ALA or ASP did not confer a

radiosensitive phenotype to xrs-6 cells.

As mentioned above, in vivo phosphorylation of Ku was observed only in cells
treated with okadaic acid. Surprisingly, this OA—induced phosphorylation was abrogated
by nanomolar concentrations of the protein kinase inhibitor, staurosporine. Although
staurosporine was originally identified as an inhibitor of PKC, subsequent studies showed
that it also iniubits CDK2/cyclinA, PKA, phosphorylase kinase and MAP kinase with
ICso of 20 nM or below (Johnson et al., 2002). Staurosporine does not inhibit protein

kinase activity of either ATM or DNA-PKcs (F eng et al., 2004; Goodarzi et al., 2004;

68

Goodarzi and Lees-Miller, 2004) and in vitro phosphorylation of of Ku by DNA-PKcs

was unaffected by staurosporine.

Thus, taken together the above results led us to conclude that phosphorylation on
serine 577, 580 and threonine 715 in Ku80 or serine 6 and 51 in Ku70 is not required for
DNA DSB repair by NHEJ and that in vivo, in addition to DNA-PKcs, Ku is
phosphorylated by a staurosporine sensitive kinase. This suggests that phosphorylation
of Ku might play a role in some processes other than NHEJ. However, to narrow down
the hunt, the logical step would be to identify the staurosporine sensitive kinase that

phosphorylates Ku.

69

CHAPTER 4

THE LEUCINE RICH REGION OF DNA-PKCS F ACILITATES ITS
TARGETING T0 DNA

ABSTRACT:

DNA-PK, a serine-threonine protein kinase is a central player in non-homologous
end joining (NHEJ), the favored pathway to repair double strand breaks (DSBs) in
vertebrates. The kinase consists of the DNA binding, regulatory subunit [Ku] and the
larger ~465 kDa catalytic subunit [DNA-PKcs]. The kinase activity of DNA-PKcs
resides in amino acid 3745 to 4013, a PI3 kinase domain. Another recognized domain
within this large protein is a leucine zipper (LZ) motif, or perhaps more appropriately
designated a leucine rich region (LRR), that spans residues 1503-1602 (20% residues are
leucines). Whereas DNA-PK’s kinase activity has been shown to be absolutely
indispensable for its function in NHEJ, little is known about the functional relevance of
the LRR. Here we show that DNA-PKcs with point mutations in the LRR can only
partially reverse the radiosensitive phenotype and V(D)J recombination deficits of V3

cells, a DNA-PKcs deficient cell line.

Disruption of the LRR motif affects the ability to purify DNA-PKcs by virtue of
its binding to DNA-cellulose. Thus, extracts from V3 cells expressing the mutant protein
display reduced kinase activity compared to wild type controls using a standard pull down
assay. These data suggest that the LRR region of DNA-PKcs in living cells may

contribute to its intrinsic DNA affinity.

70

INTRODUCTION:

The DNA-dependent protein kinase (DNA-PK) plays an essential role in non-
homologous DNA end joining [NHEJ] by initially localizing to DNA breaks. Its
immense size [~465kD] suggests that the catalytic subunit of DNA-PKcs (DNA-PKcs)
may fimction (at least in part) as a scaffold to organize a DNA repair complex. Indeed,
DNA-PKcs has been shown to interact with several other polypeptides including the Ku
heterodimer, the XRCC4/DNA ligase IV complex, the Artemis endonuclease, and the
nuclear matrix protein C1D. An emerging consensus of DNA-PK’s function is that after
initial binding (one DNA-PK complex per DNA end), the synapsis of the two complexes
activates DNA-PK's kinase activity (known to be requisite for NHEJ), and the active
complex targets other repair factors to the site of DNA damage (reviewed in Lees-Miller
et al., 2003). To date, the only DNA-PK phosphorylation event shown conclusively to be
required in NHEJ is phosphorylation of DNA-PKcs itself (Chan et al., 2002; Ding et al.,
2003; Soubeyrand et al., 2003). Consistent with a model whereby DNA-PKcs serves a
scaffolding role is data from our laboratory and several others suggesting that DNA-PKcs
regulates access of broken DNA ends to repair factors via autophosphorylation (Ding et
al., 2003, Block et al., 2004; Reddy et al., 2004). Thus, autophosphorylation induced
conformational changes of DNA-PK may orchestrate an as yet undefined sequence of

repair events.

- Recent structural studies suggest that DNA-PKcs has three major domains, and

that it shares this organization with the related kinase, ATM. The three domains have

been termed palm, arm, and head (Boskovic et al., 2003; Rivera-Calzada et al., 2005).

71

The head contains both the enzymatic (PI3 kinase) motifs as well as regions previously
implicated in DNA-PKcs’s interaction with Ku. The arm is a connecting domain and
likely contains important regulatory autophosphorylation sites. The pahn consists of two
protruding regions termed claws. The proximal claw is possibly comprised of the
extreme N-terminus of DNA-PKcs; the distal claw likely contains the LRR. In the DNA
bound confirmation, a significant conformational change occurs such that the head and

palm clamp together, possibly stabilizing the protein/DNA interaction.

In 1998, Jackson and colleagues identified the nuclear matrix protein C1D as a
factor that interacts specifically both in vitro and in viva with the leucine rich region of
DNA-PKcs (Yavuzer et al., 1998). Here, using a mutagenic approach, we address the
functional relevance of DNA-PK's LRR. We demonstrate that DNA-PKcs deficient cells
expressing the LRR mutant (LRle) protein are considerably more radiosensitive and
less proficient at V(D)J recombination than are the cells that express wild type DNA-
PKcs. We further show that DNA-PKcs harboring a mutation within the LRR(LRRm1)
fiactionates poorly with DNA cellulose as compared to the wild type protein. However,
pull down experiments demonstrate that the LRR mutant (LRle) has wild type
interaction with the DNA binding protein, C1D. Also, in vitro the LRle is recruited by
Ku to DNA ends similar to the wild type DNA-PKcs. The poor fi‘actionation on DNA
cellulose is therefore attributed to the disruption of a putative motif in the LRR region of
DNA-PKcs that may contribute to the innate DNA binding capabilities of DNA-PKcs.

Thus, we conclude that in addition to being recruited to DNA breaks by its DNA end

72

binding partner Ku, the intrinsic interaction of DNA-PKcs with DNA is fimctionally

important.

MATERIALS AND METHODS:

Cell lines and culture conditions:

The V3, DNA-PKcs deficient double strand break repair [DSBR] mutant CHO
cell line (Whitmore et al., 1989) was the generous gift of Dr. Martin Gellert. Cells were
maintained in aMEM with 10% fetal calf serum (Gibco BRL, Gaithersburg, MD). Stable
transfectants were maintained with 400 pg/ml G418 (Invitrogen). Sf9 cells were
maintained in Sf-900 II SFM medium (Invitrogen) containing 1% antrbiotic-antimycotic

(Invitrogen). The cells were grown at 27°C without C02.

Oligonucleotides:

Oligonucleotides used in this study are as follows (5' > 3'). The two oligonucleotides
flanking the LRR were KAM 110 (GGAACAAGAGAATGGAGATGA) and KAM 111
(GCTTCTGTGCATGTGCTTGAC) The two Oligonucleotides with the desired mutations
spanning across the LRR were KAM 112 (GACTTCTGGACCCAGGCTTTGC) and
KAM 113 (GCAAAGGCTGGGTCCCAGAAGTC). Positions at which glutamic acid
and leucine were changed to aspartic acid and proline are shown in bold face. The
mutations introduce identical substitutions as on construct studied in yeast two hybrid

experiments by Jackson and colleagues (Yavuzer et al, 1998).

73

Oligonucleotides used to clone human C1D cDNA were KAM 281
(TTGCGGCCGCGCACTTTTACTTTTTCCTTTATTGGC) and KAM 282
(TTAAGCTTCAGCCATAATGGCAGGTGAA).

Oligonucleotides used to clone human C1D in Baculovirus were KAM 390
(CGCTCTAGATCTGCCATAATGCATCACCATCACCATCACGCAGGTGAAGAAA
TTAATGAAGAC) and KAM 391
(TCTAGACTCGAGCGGCCGCGCTTAACTTTTACTTTTTCC)

Oligonucleotides used to subclone LRR in pGEX 5X-3 were KAM 439
(CGTGGGATCCCCAGGATGTCCACAGATTTG) and KAM 440
(GCGGCTCGAGTCCATTTTGGTATTATCCAC)

Oligonucleotides used to substitute proline for a leucine at position 1510 in GST-LRR
were KAM 482 (CTCAGTTGTAAGCAGCCGGCCAGCGGACTTCTG) and KAM 483

(CAGAAGTCCGCTGGCCGGCTGCTTACAACTGAG).

Construction and transfection of expression plasmids:

Construction of the wild-type human DNA-PKcs expression vector was described
previously (Shin et al., 2000). To generate the expression plasmids encoding the LRR
mutant, duplex oligonucleotides KAM 112 and KAM 113 flanking the LRR were used to
amplify a 5Kb fragment using human DNA-PKcs cDNA as the template DNA. The
subsequent PCR fragment was cloned using the Topo-TA cloning kit according to the
manufacturer’s protocol (Invitrogen, Carlsbad, CA). The resulting plasmid was utilized to
generate the LRR mutant by Quik change mutagenesis according to the manufacturer’s

protocol (Stratagene, La Jolla, Calif). This PCR fragment spans two Ehe I sites at

74

positions 1770 and 6280 in the open reading frame of the human DNA-PKcs cDNA. This
fragment was subsequently subcloned into the wild type DNA-PKcs expression vector
after sequencing analyses confirmed that no additional substitutions were introduced
during PCR arrrplifications.

V3 transfectants expressing human DNA-PKcs were derived as described previously

(Ding et al., 2003).

DNA cellulose pulldown of DNA-PK, measurement of protein kinase activity, and

nuclear matrix preparations:

Whole cell extracts were prepared and kinase activity was measured as described
previously (Ding et al., 2003). To assess fractionation of DNA-PKcs onto DNA-
cellulose, whole cell extracts were absorbed onto DNA-cellulose in 500 ul buffer A
[25mM Hepes, pH 7.9; 50mM KCl, lOmM MgClz, 10% (v/v) glycerol; 1mM EDTA;
1mM EGTA; 1mM DTT and the indicated concentration of NaCl] for 1 hour at 4°C.
Beads were washed three times in the same buffer and washed beads were suspended in
2X SDS-PAGE buffer (25mM Tris-Cl pH 6.8, 10% (v/v) glycerol, 1% SDS, 0.04 %
Bromophenol Blue and 25 pl 2-mercaptoethanol added fresh to 475 p1 of the buffer). The
beads were then heated for 5 minutes at 70°C, centrifuged at 1.5 rpm for 2 minutes. The
supernatant was then analysed by irnmunoblotting as described previously (Ding et al.,
2003). When pulled down with C1D, the kinase reaction was supplemented with

activation buffer and partially purified Ku (expressed in Baculovirus).

75

To visualize mobilization of DNA-PKcs in responsed to DSBs, V3 transfectants
were treated for 1 hour with bleomycin (Sigma). Membrane insoluble fractions were

prepared as described previously (Drouet et al, 2005).

V(D)J recombination assays:
Extrachromosomal recombination assays were performed as described previously

(Chapter 3, Materials and Methods).

Assessment of Radiation Sensitivity:

Cells (3 X 103) were exposed to various amounts of ionizing radiation using a
°°Co source and immediately seeded in complete medium containing 10% fetal bovine
serum. After 7 days, cell colonies were fixed with ethanol, stained with crystal violet, and

colony numbers were assessed.

Expression of fusion proteins and pulldown experiments:

A cDNA encoding for full-length human C1D was ampliflied from human brain
mRNA by RT-PCR using oligonucleotides KAM 281 and KAM 282. The termination
codon was not included, and the amplified fi'agment was cloned into pcDNA-6V5/His
expression vector (Invitro gen) that encodes a C-terminal V5-HIS tag. The above cDNA
was then used as a template to amplify and subclone C1D into BamHI and XhoI sites in
pFastBac I (generous gift from Dale Ramsden’s lab), a baculovirus expression vector

using oligonucleotides KAM 390 and KAM 391. The oligos were designed to encode a

76

N-terminal His tag. Human Ku70 and Ku80 cDNA cloned into pFastBac Dual was a

generous gift from Dr. Dale Ramsden’s lab.

Whole cell extracts fi'om V3 transfectants (2mg) and whole cell extracts fiom
either C1D-infected or Ku-infected or control virus-infected Sf9 cells were co-incubated
for 30 minutes in buffer A at 4°C. Subsequently, 30 pl of Ni+ agarose was added, and the
extracts were absorbed in buffer A with 25mM imidazole. After 1h, the Ni+ agarose was
washed three times with buffer A containing 50mM imidazole. Proteins were eluted with

SDS-PAGE buffer and analyzed by irnmunoblotting.

To express, LRR filSiOIl proteins in bacteria, the LRR (aa1471- aa1592) was
amplified using DNA-PKcs plasmids (either wild type or LRR mutant) as the template
using oligoucleotides KAM 439 and KAM 440. The PCR product was digested and
subcloned into BamHI and Xhol sites in pGEX-5X-3 (Amersham) to generate GST-LRR
or GST-LRle expression plasmids. The GST-LRle was then utilized as a template to
generate GST-LRRm2 (L1510P, E1516D, L1517P) by Quik change mutagenesis
(Stratagene) using oligonucleotides KAM 482 and KAM 483. The GST-LRRdel was
generated by deleting the Xbal-Ncol fragment (aa 1504-1551) from GST-LRR. All
plasmids were sequenced to confirm that no extra substitutions were introduced during

the PCR.

The expression plasmids for GST-fiision proteins were transformed into E. cali

BL-21 (DE3) (Stratagene, LaJolla, Calif). To express GST-fusion proteins, a 5m]

77

overnight culture was used as a seed culture for 100ml LB-broth. The bacteria were
grown at 37°C to reach the AbséoOnm of 0.6 and then induced with 1mM IPTG at 27°C for
4 hours. The cells were harvested and suspended in 5ml Lysis buffer (50mM Hepes pH
7.5, 150mM NaCl, 1.5mM MgClz, 1mM EGTA, 10% Glycerol, 1% Triton X-100 and
Protease inhibitor cocktail tablet (Complete Mini, Roche)) and sonicated for 15 minutes
on ice. The lysate was then centrifuged at 14,000 rpm for 15 minutes at 4°C. The

induction and solubility was assessed by SDS-PAGE followed by coomassie staining.

Whole cell lysate from bacteria expressing either GST alone or equal amounts of
GST-LRR, GST-LRle , GST-LRRmZ or GST-LRRdel and whole cell extracts from His
tagged C1D-infected Sf9 cells were co-incubated in buffer A for 30 minutes at 4°C.
Subsequently, 30 pl of pre-swollen Glutathione-agarose (pre-equilrbrated in buffer A)
was added and incubated for 1h at 4°C. After an hour, the Glutathione-agarose was
washed three times with buffer A containing 2mM Glutathione (reduced form). Proteins
were eluted with SDS-PAGE buffer and analyzed for C1D by irnmunoblotting using anti-
His (Qiagen) as the primary antibody (1:5000 dilution). A Goat anti-mouse conjugated to
horseradish peroxidase (Signal Transduction labs) was used as the secondary antibody
(1 :5000 dilution). The membrane was then incubated with a chemiluminescent substrate

(ECL, DuPont) according to manufacturer’s recommendations.

78

RESULTS:
. LRR DNA-PKcs mutant can only partially reverse radiosensitive phenotype in V3
cells:

A potential leucine zipper motif within the DNA-PKcs coding sequence spanning
residues 1503-1538 was noted by Hartley et al. in the original sequence analysis of the
molecule (Hartley et al., 1995). It consists of 6 leucine residues, each separated by six
residues. However, the fourth leucine in the putative zipper is not conserved in chicken
and fi'og. Thus, more recently, other investigators consider this region (1503-1539) to be
more appropriately designated as a leucine rich region (33% leucine). A more extensive
overlapping region (1503-1602) is also relatively leucine rich (20%). DNA-PKcs is
highly conserved (63-85%) in the six species for which sequenCes are available, (human,
horse, dog, mouse, chicken and frog). The LRR is similarly well conserved (Fig. 3). In
the report fiom Yavuzer et al, demonstrating that C1D interacts with the LRR of DNA-
PKcs, two site specific mutants of a DNA-PKcs polypeptide that ablated its interaction
with C1D were studied. One of the mutants contains two point mutations substituting
aspartic acid and proline for the glutamic acid and leucine residues at amino acids 1516
and 1517 as indicated in Fig. 5. This mutant peptide was not able to interact with CID as
assessed by yeast two hybrid assays (Yavuzer et al., 1998). Also, as observed by Fujirnori
et al, the first and fourth leucine residues (aa1502 and aa1524 respectively) are substituted
in chicken and Xenopus, however the second and third leucine residues (a 1510 and a
1517) are conserved among all vertebrates (Fujirnori et al, 2000) (Fig. 5), consistent with

the previous results that these two leucines are essential for binding of the C1D protein

79

(Yavuzer et al., 1998), further suggesting that the physical association of C1D and DNA-

PKcs is biologically significant.

To begin to assess the fimctional relevance of the LRR of DNA-PKcs in living
cells, one of these mutations was introduced into the complete DNA-PKcs cDNA. Wild
type and mutant constructs encoding DNA-PKcs [designated WT and LRle] were
stably transfected into DSBR mutant V3 cells that lack DNA-PKcs and are thus defective
in NHEJ. Clones with similar levels of DNA-PKcs expression were selected for further
study (Fig. 14A). To assess the ability of the wild type and mutant constructs to reverse
the known radiosensitive phenotype of V3 cells, cell irradiation assays were performed.
As can be seen (Fig. 14B), although expression of the LRR mutant protein renders cells
significantly more radioresistant than cells transfected with vector alone, cells expressing
the mutant protein are still substantially more radio sensitive than cells expressing
equivalent levels of wild type DNA-PKcs. Thus, we conclude that the LRR mutant

protein can only partially complement the radiosensitivity of V3 cells.

DNA-PKcs mutant, LRle only supports reduced levels of either coding or signal
end joining in V3 cells:

The ability of the mutant DNA-PKcs to support RAG induced V(D)J recombination in V3
cells was tested. The wild type DNA-PKcs substantially complements the coding end
joining deficit of V3 cells (assessed with substrate pJI-1290) (Table 3). In contrast,
LRle supports only reduced level of coding end joining (1.4 to 14 fold reduced) as

compared to wild type DNA-PKcs. We and others have reported previously that V3 cells

80

have a significant signal end joining deficit that is substantially reversed by transfecting
wild type DNA-PKcs (Ding et al., 2003; Kurimasa et al., 1999; Woods et al., 2002).
Consistent with those results, we find here that wild type DNA-PKcs substantially
increases the recovery of signal joints fiom V3 cells (assessed with substrate pJHZOl).
Although co-transfection of LRle also increases the recovery of signal joints flom V3
cells, the numbers are consistently reduced (1.2 to 8 fold) as compared to transfections
with wild type DNA-PKcs. As reported previously, co-transfection of an ATP binding site
mutant (K>M) does not alter the levels of either coding or signal joints in transient assays
as compared to transfections with no DNA-PKcs at all (Kienker et al., 2000). Thus, we
conclude that LRle can only partially support either signal or coding end joining during

V(D)J recombination.

Recently, work from our lab has demonstrated that mutations in DNA-PKcs’s
numerous autophosphorylation sites dramatically afl’ect end processing of coding joints
(Ding et al., 2003; Block et al., 2004; Reddy et al., 2004). However, sequence analysis of
coding joints mediated by the LRR mutant as compared to those mediated by the wild
type protein were comparable with regards to nucleotide loss, percent complete coding
ends, and the number of joints with short sequence homologies apparent at the joint
(Table 4). In sum, we conclude that coding joints mediated by the LRR mutant protein

are structurally normal.

81

Fig. 14. DNA-PKcs with point mutations in LR motif only partially complements
the radiosensitivity in V3 cells. (A) Immunoblot analysis of whole cell extracts fiom V3
transfectants expressing either fiill length DNA-PKcs (lanesl and 2), vector alone (lanes
3 and 4) and LRle (lanes 5 and 6). (B) The radiation resistance of V3 transfectants
expressing wild type DNA-PKcs, vector alone or LRle was assessed as described in
Materials and Methods. Data are presented as percent survival to that of non -irradiated
controls (set at 100%). Error bars, standard error of the mean of three separate

experiments.

82

Fig. 14

100‘

101

%

 

vector1
vector2

s;

1234

a, .LRRm1 10
a, \LRRm135

——°'— WT4
-—'— WT 17
——"— vector1
——‘— vector2
—0— LRRm1 35
-0— LRRm1 10

 

 

200 400 600 800

83

Table 3. LRRm1 supports reduced levels of V(D)J recombination. Transient V(D)J
recombination assays were performed as described in Experimental Procedures. RAG
expression fi'om plasmid vectors initiates recombination in the V3 cells, as assessed by
the plasmid substrate pJH290 that detects coding joints or the pJH201 substrate that
detects signal joints as indicated. Numbers of ampicillin (amp) and
ampicillin/chloramphenicol (amp+cam) resistant colonies from four separate

experiments are presented. Recombination rate (%R) is calculated as the number of

chloramphenicol resistant colonies divided by ampicillin resistant colonies X 100.

84

 

 

 

 

 

 

 

 

 

 

 

 

 

 

    

illlllljllllllllllllllallll in
mod 85m o coo m5
29o con—3w o coeds
c 25.25 mood 833
o 82:5 o 835
«mod 85$ 53 33% SAM + 85
S 83: med 8%:
no 8935.3. m3 832%
£3 83%? Sod coo-atom
Rod 834 886 cmmdozwm
23 83sz Sod 83 SW 2&5 + meg
3 83:3 0; RES
is 8352 w; own-58
_ :3 823: RS own. SS
«86 25.58. 83 25.8ch
m Ed 25.33: 8; 255mm 25 2? + mug
no 893 o 835
A 56 on? :N o 85.on
38¢ 83% o 83%
o 85:5 83 omnmm:
Sod SEN 3o 83: b8 8.2
Q: nae.» A5 95$
cogs—388.45% \Emu gnaw :o_§=BEoooM \EeU 95$ mEEme—a 85855“:-
2853 as... .2»: 83:3 35... ”584

.m 03.;

85

 

 

 

 

 

 

 

 

 

 

mg: a @sa 3 ~83 :. 8.3 E b8 we;
6:8 on GNE R $3: 3 3m 8 2%:
Sim: :- atoe a. ASS-V am me Q 25 2:5
6:0 owe—$55 Imm v.65 «5&1 moo—3.30m
\muaofiwum m .x. 829:8 .x. i8. 8am u

 

 

:55: .3 coin—=89. £53 ”£18.? mam—«.3 35.5% .v «Ea-F

86

LRRm1 has wild type interaction with C1D:

To test if the functional deficits of LRRm1 could be attributed to disruption of its
interaction with C1D, a baculovirus vector expressing His-tagged C1D was constructed
and expressed in SE cells, for pull down experiments (Fig. 15A). Extracts fi'om C1D-
infected 89 or control virus-infected Sf9 cells were incubated with the cell extracts from
V3 transfectants expressing either wild type or LRRm1 DNA-PKcs and Ni+ agarose. To
our surprise (and in contrast with the yeast two hybrid studies of Yavuzer et al.), both
wild type and mutant proteins fractionate similarly with immobilized C1D onto Ni+

agarose (Fig. 15B).

LRleis targeted to the nuclear matrix similar to the wild type DNA-PKcs:

There is a large body of evidence that DNA and RNA modifying enzymes are
sequestered to particular nuclear compartment, in some cases by association with the
nuclear matrix reviewed in (Berezney et al, 2002). Recently, Drouet et al have shown
that in response to DNA double strand breaks, DNA-PKcs is mobilized to the triton non-
extractable fraction of the nuclear compartment (the nuclear matrix). Yavuzer et al had
previously hypothesized that C1D might be involved in targeting DNA-PKcs to the
nuclear matrix in response to DNA damage. To corroborate that LRRm1 does indeed
interact with C1D as well as the wild type DNA-PKcs both in vitro and in vivo in
response to DNA damage, we next examined the mobilization of LRRm1 to the nuclear
matrix in response to DNA damage using the protocol outlined by Drouet et al. V3
transfectants expressing either the WT or the LRR mutant DNA-PKcs were treated with

Bleomycin for one hour to induce double strand breaks. The treated cells were washed

87

and extracted as outlined by Drouet et al. The extracted fiaction was then analyzed by

irnmunoblotting for DNA-PKcs levels.

As shown in Fig. 16, there is a significant mobilization and concentration of
DNA-PKcs and y—HZAX and not Lamin B in the nuclear matrix fraction in response to
the induction of DNA DSBs. Furthermore, both wild type and LRRm1 DNA-PKcs
associate with the nuclear matrix equally well. Thus, we conclude that the NHEJ defect
in the LRR mutant is neither because of the disruption of interaction with C1D nor
because of loss of association with nuclear matrix.

Additional regions outside the LRR contribute to DNA-PKcs’s interaction with
C1D:

To understand the discrepancy between our results and the results published by
Yavuzer et al, we considered that perhaps the LRR motif is not completely disrupted in
the full length LRR m1 DNA-PKcs. To address the possibility that second and third
leucines (aa1510 and aa1517 respectively) together contribute to DNA-PKcs’s interaction
with C1D, we generated several GST fusion proteins spanning the LRR. These included
wild type DNA-PKcs, GST-LRR (spanning residues1471-1592), the mutant GST-
LRle (with the same mutations already tested in the fill] length protein), an additional
mutant GST-LRRm2 (changing the second leucine, Ll SlOP as well as the previous
mutations E1516D, and L1517P), and a deletion mutant GST-LRRdel (that completely
deletes residues 1504-1551 fiom this region) (Fig. 17A). These GST fusion proteins
were then co-incubated with extracts from C1D infected 89 cells and immobilized onto

glutathione agarose beads and analyzed for C1D by irnmunoblotting. As can be seen

88

(Fig. 17B), GST-LRRm1 is substantially reduced in its ability to interact with C1D in
agreement with the yeast two-hybrid results published by Yavuzer et al. However,
mutating the second leucine (GST-LRRmZ) or deleting the region spanning the
conserved leucines (aa1510 and aa1517 implicated in DNA-PKcs’s interaction with C1D)
disrupts the LRR interaction with C1D to the same level as the GST-LRRm1 suggesting
mutating glutamic acid to aspartic acid and leucine to proline (E1516D, L1517P) does
indeed disrupt the LRR motif in a 100 a peptide (GST-LRRm1) as well as in fiill length
DNA-PKcs (LRRm1). Further, since the mutations in GST-LRRm1 are identical to the
fiill—length LRRm1, and the fact that C1D interaction is disrupted with GST-LRRm1 but
not with full length LRRm1, we conclude that regions outside the LRR contribute to
DNA-PKcs’s interaction with C1D, explaining the full-length LRRm1 interacting with

C1D similar to the wild type DNA-PKcs.

89

Fig. 15. LRRm1 has wild type interaction with C1D: A. Whole cell extract from 89
cells infected with baculovirus expressing His-tagged C1D was incubated with Ni+
agarose beads. Beads were washed and analyzed for C1D expression by SDS-PAGE
followed by coomassie blue staining (lane 3). Lane 1 represents 5 ul of Pre stained
protein marker. B. Whole cell extracts (2mg) from V3 transfectants expressing either WT
(lanes 1 and 4) or LRRm1 (lanes 2 and 5) was incubated with whole cell lysate from
either control virus infected-SE (lanes 1-2) cells or C1D-infected (lanes 4-5) Sf9 cells.
The C1D-DNA—PKcs complex was then absorbed onto Ni+ agarose beads. Beads were

washed and irnmunoblotted for DNA-PKcs.

90

Fig. 15

WT LRRm1 w1' LRRm1
C1D - - + 4'

“\KDNA-chs
1 2 3 1 2 3 4 5

18kDa>-_ «II-s: C10

91

Fig. 16. LRRm1 is targeted to the nuclear matrix similar to the wild type DNA-
PKcs: V3 transfectants expressing either wild type (lane1-2) or LRRm1 (lanes 3-4) were
left untreated or were treated with Bleomycin (140uM). Cells were then extracted twice
with Triton X-100 containing buffer and treated with RNase and DNase (as outlined by
Drouet et al). The pellet fraction (nuclear matrix) afier DNase digestion was solubilized
in SDS-containing gel loading buffer. The samples were then immunoblotted for DNA-

PKcs, yHZAX and Lamin B.

92

 

u f"

Fig. 16

P3

Bleomycin

DNA-PKcs

YHZAX

Lamin 8

WT LRRm1

93

Fig. 17. GST-LRRm1 does not interact with C1D as well as the wild type GST-
LRR: A. Whole cell lysates from bacteria expressing GST (lane 2) or GST-LRR (lane
4), GST-LRRm1 (lane 5), GST-LRRm2 (lane 6) and GST-LRRdel (lane 7) were
incubated with Glutathione-agarose beads. Beads were washed and analyzed for protein
expression by SDS-PAGE followed by coomassie-blue staining. B. Whole cell lysates
from bacteria (same amount as in A.) expressing GST (lane 1) or GST-LRR (lane 2),
GST-LRRm1 (lane 3), GST-LRRm2 (lane 4) and GST-LRRdel (lane 5) was co-
incubated with whole cell lysates from 819 cells infected with baculovirus expressing
His-C1D in SOOul of buffer A. The extracts were then absorbed onto Glutathione-

agarose. Glutathione beads were washed and immunoblotted for His-C1D.

94

Fig. 17

 

.035...ka
NEmmqukmO
9:51.750
~54...er
hmmv
$3.14.ka
«Em—KAFmO
wEmmlThwmu
mmrhmw
#8

+

.‘C- <C1D

010 +_

32kDa>!... - -

4

3

1

95

LRRm1 binds poorly to DNA-cellulose:

To explain the NHEJ defects in V3 transfectants expressing LRR mutant, we
tested the mutant for its enzymatic activity. LRRm1 consistently displayed approximately
two-fold lower kinase activity as compared to the wild type (Fig. 18A) in standard

pulldown assays. Further, we analyzed the DNA-cellulose fraction used for the kinase

assays, using western blots. As shown in Fig. 18B, the mutant DNA-PKcs fractionates

poorly with DNA cellulose. To ascertain whether the mutant is compromised in only r

m
\ - n ‘o- 3:?
l

DNA-binding and/or kinase activity, I quantitated three different DNA-cellulose pull
down assays. The densitometric analysis of these blots correlated well with the two-fold
reduction in kinase activity of the mutant (F ig. 18C) suggesting that the mutant protein’s
reduced ability to bind DNA explains its reduced kinase activity as opposed to an

intrinsic enzymatic defect.

The LRR mutant has wild type levels of kinase activity:

To conclusively prove that the mutant displays low kinase activity only due to a
defect in binding to DNA-cellulose, we used C1D to pull down DNA-PKcs (as described
in section 4.2). As discussed in section 4.2.3, both wild type and mutant DNA-PKcs
interact equally well with Ni+- agarose immobilized C1D (Fig. 19A). These Ni+-agarose
beads were then used to phosphorylate p53, as in standard DNA-PK pull down assays.
As shown in Fig. 19B, LRRm1 displayed kinase activity similar to the wild type DNA-
PKcs. Thus, we conclude that disrupting LRR does not alter the kinase activity of DNA-

PKcs.

96

Fig. 18. LRR mutant of DNA-PKcs has reduced kinase activity by virtue of reduced
DNA-binding. A. Whole-cell extracts (250 pg) prepared from V3 cells transfected with
either vector alone, WT DNA-PKcs, LRR mutant were assayed for enzymatic activity.
Phosphorylation of the p53 substrate was assessed after 60 min. Each cell extract was
tested in duplicate and three independent extracts were tested for each cell line. B.
Immunoblot analysis of extracts (SOOug) fi'om V3 transfectants expressing wild-type
(WT) or mutant (LRRm1) DNA-PKcs (lane 1-2) and DNA-cellulose fractions of extracts
(SOOug) from V3 transfectants expressing WT and LRRm1 (lane3-4) DNA-PKcs. C.
Densitometric analysis of three independent DNA-cellulose fiactions of extracts (SOOug)
from V3 transfectants expressing WT and LRRm1 DNA-PKcs. Error bars, standard

error of the mean.

97

 

Fig. 18

 

 

 

 

A.
25 -
20 -
3‘ -
z: ‘5
‘6
<
x
0.- 10 .
<
z
o
5-4
0
1
8.
Extract DNA -cellulose
Fraction
WT LRRm1 WT LRRm1
pp - -
1 2 3 4

98

Fig. 18 C (cont)

25 I WTEXTRACT
LRRm1 EXTRACT

 

 

 

 

>
9:
W
C
9
.E
0
.2
H
2
0
t:
I Wl'DNA-CELLULOSE
"5 1 LRRm1DNA-CELLULOSE
>
9.:
2 1.0 ‘
2
E
O
.2
a
2
0 0.5 ‘
n:
0.0 ‘

 

99

Fig. 19. LRRm1 has wild type levels of kinase activity A. Immunoblot analysis of
whole cell extracts (100pg) from V3 transfectants expressing either WT (lane 1), vector
(lane 2) or LRRm1 (lane 3). Whole cell extracts (2mg) fi'om V3 transfectants expressing
either WT (lanes 4-5) or LRRm1 (lanes 6-7) was incubated with whole cell lysate from
either control virus infected-Sf9 cells (lanes 4-5) or C1D-infected Sf9 cells (lanes 6-7).
The C1D-DNA-PKcs complex was then absorbed onto Ni+ agarose beads. Beads were
washed and immunoblotted for DNA-PKcs. B. DNA-PKcs absorbed onto Ni+-agarose
beads was assayed for enzymatic activity. Phosphorylation of the p53 substrate was
assessed after 60 min. Three independent extracts were tested for each cell line. Error

bars, standard error of the mean.

100

Fig. 19

 

 

 

 

 

 

 

A 5““
— wr LRRm1
32
E "' Cln-+ - +
DNA-PKG»- O ‘9 ..
123 4 5 '67
B. .
a
a.
31
2...
a
E
2
a:
q.
<
E 1*
O

 

lOl

LRRm1 has wild type interaction with Ku:
Ku associates with DNA-PKcs near the C-terminus (3002-3850aa), partially

overlapping its kinase domain (J in et al, 1997). This region is separated by approximately
1 500 a from LRR. However, electron microscopic studies of DNA-PKcs suggest a
head-arm-palm structure for DNA-PKcs (Boskovic et al, 2003; Rivera-Calzada et al,
2005) where it folds into a globular conformation to form a channel around dsDNA.
Thus it is likely that intramolecular interactions within DNA-PKcs occur between regions
far separated on the linear polypeptide chain. Since the mutant protein exhibits a defect in
DNA-binding, we considered the possibility that the LRR facilitates the interaction of
DNA-PKcs with Ku bound to DNA. To address this, His-tagged Ku70/80 was expressed
in baculovirus (Fig. 20A). Whole cell extracts from either Ku-infected or control-
infected S19 cells were incubated with extracts from transfectants expressing wild type or
LRR mutant DNA-PKcs. The Ku-DNA-PKcs complex was then absorbed onto Ni+
agarose beads. As shown in Fig. 20B, wild type and LRRm1 DNA-PKcs are recruited to
Ku bound DNA equally well. In sum, these data suggest that both DNA-PKcs’s intrinsic
DNA binding capacity as well as its interaction with the Ku affect its ability to associate

with a DSB.

The LRR contributes to DNA-PKcs’s intrinsic affinity to bind DNA:

To delineate the functional defect in the LRRm1 mutant, the following in vitro
analyses were performed. Previous studies have established that DNA-PKcs can bind
DNA in the absence of Ku (Chan et al, 1996; Dynan et al, 1998; Hammersten et al,
1998), however this binding is salt labile. Thus, we tested the ability of LRR mutant to

bind DNA in various salt conditions by incubating whole cell extracts from stable

102

transfectants with DNA cellulose. As can be seen in Fig. 21, the LRR mutant protein
fiactionates poorly onto DNA cellulose in both salt concentrations tested, however, in the
low salt conditions the difference between wild type and LRRm1 is far greater than in the
high salt conditions. This can also be seen in the fractions analyzed after DNA-binding
(the post fractions). The post fiaction from wild type protein has less protein than the
post fraction from LRRm1. This difference in the post fiactions is more pronounced in
low salt than in high salt. This result suggests that the LRR contributes to the innate
binding properties of DNA-PKcs and thus disrupting the LRR alters the DNA binding
properties of DNA-PKcs. An alternative explanation could also be that the LRRm1 is not
assembling in a DNA-binding complex as well as the wild type because it is not
interacting with a component, mo st likely a DNA-binding protein. The two identified
DNA-binding proteins in the NHEJ complex are Ku and possibly C1D. As shown
previously, LRRm1 has wild type interaction with both Ku and C1D. Thus, we conclude
that LRRm1 binds poorly to DNA because the mutant DNA-PKcs has reduced intrinsic

affinity for DNA.

103

Fig. 20. LRRm1 has wild type interaction with Ku: A. Lane 1 represents 511.1 of pre-
stained protein marker. Lane 2 represents 10p] of whole cell lysate from Sf9 cells
infected with baculovirus expressing His-tagged Ku. Whole cell extract from Sf9 cells
infected with baculovirus expressing His-tagged Ku was incubated with Ni+ agarose
beads. Beads were washed and analyzed for Ku expression by SDS-PAGE followed by
coomassie blue staining (lane 3). B. Whole cell extracts (2mg) fi'om V3 transfectants
expressing either WT (lanesl and 4) or LRRm1 (lanes 2 and 5) was incubated with
whole cell lysate from either control virus infected-Sf9 cells or Ku-infected Sf9 cells.
The Ku-DNA-PKcs complex was then absorbed onto Ni+ agarose beads. Beads were

washed and immunoblotted for DNA-PKcs.

104

Fig. 20

i

1

fl ' "" . <Ku80
82kDa> 9. a". ' <Ku70

E:

1 2 3

Ku

105

WT LRRm1 WT LRRm1

V.

1

.. + +
“a” <DNA-PKes
2 3' 4 5

Fig. 21. The LRR contributes to DNA-PKcs’s intrinsic affinity to bind DNA:
Immunoblot analysis of DNA-cellulose fractions of extracts (500ug) from V3
transfectants expressing wild-type (WT) DNA-PKcs in either 50mM salt (lane 3) or 150
mM salt (lane 3a) and from DNA-cellulose fractions of extracts (500ug) fi‘om V3
transfectants expressing LRRm1 in either 50mM salt (lane 7) or 150mM salt (lane 7a).
Pre (lanes 1,1a, 5, 5a) represents 2% of the total input and post (lanes 2, 2a, 6, 6a)

represents 2% of the protein fraction left after incubation with DNA-cellulose.

106

Fig. 21

 

w'r LRRm1
g i
a 3
g E g E E 2 e
50mMsaItC' ‘ «a-

123456-‘r'-/

150mMsalt~du “a”
1a 2a 3a 435a 63 7a

107

DISCUSSION:

C1D is a nuclear matrix associated protein and binds DNA with very high
affinity. Previous work from Jackson and colleagues had shown that DNA-PKcs interacts
directly with C1D both in vitro and in vivo (Yavuzer et al, 1998). The authors inferred
that this interaction requires an intact LRR region because in a yeast two-hybrid
experiment utilizing a DNA-PKcs fragment with the LRR mutated failed to interact with
C1D. Thus, at the onset of our studies, our working model was that DNA-PKcs is
targeted to the nuclear matrix or chromatin network via its interaction with C1D and afier
DNA damage, Ku targets DNA-PKcs to DNA ends. To test this model, we introduced
two mutations in the LRR region of DNA-PKcs (E1516D, L1517P); identical to the
construct used in the yeast two hybrid studies to disrupt the LRR region by Yavuzer et al.
The LRR mutant was expressed in V3 cells and compared to wild type DNA-PKcs for its
function in 1R repair and V(D)J recombination. The mutant DNA-PKcs was found to be

compromised in both assays.

Having disrupted the LRR region in DNA-PKcs, we hypothesized that the mutant is
not being targeted to DNA and /or the nuclear matrix via its association with C1D.
However, when tested for its interaction with C1D, the LRR mutant was found to interact
with C1D as well as wild type DNA-PKcs. In the previous study Yavuzer et al had
shown that the interaction between C1D and DNAfPKcs is direct and is not mediated by
Ku. Since C1D is also a DNA-binding protein, it was poss1b1e that C1D was pulling
down DNA-PKcs through a DNA-bound complex and is thus more a reflection of Ku-

DNA—PKcs interaction rather than C1D-DNA—PKcs interaction. To ascertain this, we

108

analyzed our pull down samples for Ku70 and Ku80. Unlike DNA-PKcs, Ku did not
come down with Ni+-agarose immobilized C1D (data not shown). These results
established that in our in vitro system, interaction between DNA-PKcs and C1D was
independent of Ku. However, there was still a possibility that in vivo the mutant DNA-
PKcs is unable to interact with C1D in response to DNA-damage and this was not being
detected in an in vitro pull down assay. Since C1D is not implicated in NHEJ directly,
the only way to test whether or not LRRm1 was interacting with C1D in vivo, was to test
for the proposed role of C1D in targeting DNA-PKcs to the nuclear matrix in response to
DNA-damage. Thus, we followed the procedure outlined by Drouet et al, and the results
established that the mutant DNA-PKcs was mobilized to the nuclear matrix similar to the
wild type DNA-PKcs. This result also suggested that the mutant protein, although
structurally and fimctionally capable of mobilizing to the right compartment to repair the

breaks, it is somehow compromised at a downstream event leading to the repair of DSBs.

When tested for its ability to phosphorylate p53, the mutant displayed two fold less
activity. However, the LRR mutant also fractionated poorly onto DNA-cellulose, which
explains its reduced kinase activity in standard pull down assays. To confirm that the
mutant DNA-PKcs had normal kinase activity, we replaced the DNA-cellulose
fi'actionation in kinase assay with DNA-PKcs pulled down by NFL-agarose immobilized
C1D. This result established that similar amounts of wildtype or mutant protein have
similar protein kinase activity. Although the mutant fractionated poorly with DNA-
cellulose, it was targeted to DNA ends by Ku similar to wild type DNA-PKcs. Therefore;

we propose that the LRR of DNA-PKcs contributes to the intrinsic ability of DNA-PKcs

109

to bind DNA. The point mutations introduced in this region, although not sufficient to
ablate its interaction with C1D, do alter the domain architecture to affect the intrinsic
DNA-binding property of DNA-PKcs. This was fiirther corroborated by the fact that the
mutant DNA-PKcs was particularly reduced in its capability to bind DNA in low salt
conditions, which earlier studies have established to be the conditions in which DNA-
PKcs can bind DNA in the absence of its DNA-binding partner Ku (Chan et al, 1996;
Dynan et al, 1998, Harnmarsten et al, 1998). Our hypothesis is also in agreement with
the recent Cryo-electron microscopic structure of DNA-PKcs (Rivera-Calzada et al,
2005) that suggests the pahn region of DNA-PKcs undergoes a conformational change in
the presence of a dsDNA and is utilized by DNA-PKcs to make contacts with DNA. The
cryo-EM structure resolves the pahn domain into two “claws” namely, proximal and
distal. The authors further predict that the first ~800 residues form the distal claw and
residues 800-1900 constitute the proximal claw of the pahn domain. This would suggest
that LRR (aa1492-1571) is a part of the proximal claw of DNA-PKcs and altering the
structural conformation of this region can alter the intrinsic DNA binding property of
DNA-PKcs. Taken together, these studies suggest that several distinct regions with in
DNA-PKcs may contact DNA and our work demonstrates that the LRR contributes to the
DNA binding property of DNA-PKcs, which is required for its complete fimction to

repair DNA breaks.

110

CHAPTER 5

CONCLUSION AND FUTURE DIRECTIONS

DNA-PK is composed of a 465 kDa serine/threonine protein kinase- DNA-PKcs
and DNA binding heterodimer Ku. Genetic and biocherrrical studies have established
that the protein kinase is activated when bound to a DSB and plays a central role in DSB
repair. However, the precise role of the kinase in repairing the breaks is still a topic of
speculation. One hypothesis is that the kinase modifies activity of other factors by
phosphorylation. One substrate that unequivocally falls in this category is DNA-PKcs
itself, which undergoes conformational changes post-phosphorylation and regulates end
processing in NHEJ. Ku, being a part of DNA-PK complex, is a possible target for
DNA-PKcs. However, from my studies I conclude that phosphorylation at known sites
in Ku70 and Ku80 does not alter Ku’s firnction in NHEJ as tested in irradiation assays.
Also, additional work from our collaborator’s laboratory shows that there is yet another
kinase that phosphorylates Ku in cells. This kinase was found to be sensitive to the
protein kinase inhibitor staurosporine. This raises an interesting possrbility of Ku’s role
in processes other than NHEJ. However, to dissect that role it becomes important to
identify the kinase. Ku has also been shown to be phosphorylated by cyclinAl/CDK2 in
vitro and this phosphorylation has been hypothesized to have a role in DSB repair.
However, the authors did not confirm if Ku was indeed an in vivo target for

cyclinAl/CDKZ (Muller-Tidow et al., 2004).

111

Some of the other known fiinctions of Ku are in regulation of apoptosis and
maintenance of telomeres. In addition to being phosphorylated, Ku70 can also get
acetylated and this acetylation has been shown to regulate Bax-mediated apoptosis in
cells (Cohen et al., 2004). There are three lysines identified as potential acetylation sites
in Ku70, which lie in the DNA binding ring. Whether or not acetylation of Ku is required
for its fimction in NHEJ is not known. Its possrble that acetylation of Ku helps it
dissociate from DNA after or during DNA repair. This can be addressed by generating
acetylation site mutants (K>A) using site directed mutagenesis. These mutants can then i

be tested for their function in DSB repair in irradiation assays.

As noted above, how DNA-PKcs repairs DSBs is still unclear. Recent work fiom
our laboratory has shown that phosphorylation at two separate clusters in DNA-PKcs
regulates end processing in NHEJ. However, the mechanics of the process are still not
very well understood. There are several other steps in the process of DSB repair that
require a detailed mechanistic study e.g., the signaling of DSB to the repair machinery,
the choice of the pathway (HR and NHEJ) to repair the break, translocation of Ku along
DNA, the synapsis, activation of the kinase, disassembly of the repair machinery. Cryo
EM structures of DNA-PKcs have provided more insight into some of these aspects, but
it is really important to be able to look at crystal structure of DNA-PKcs with or without
DNA and in complex with some other factors. However, this might be a very difficult

task owing to the huge size of the protein.

112

DNA-PKcs is a multi-domain protein, capable of acting as a scafiold, which is
required to bring the various participating factors in close proximity to each other during
the process of repair. The LRR region might have a role in this function. However, at
this point LRR does not have a well-characterized role in the structural or firnctional
aspect of DNA-PKcs. My work represents the first steps in identifying the importance of
LR and the results suggest that LRR is one of the DNA binding domains in DNA-PKcs
and lack of a functional LRR renders DNA-PKcs only partially functional in NHEJ. An
alternative explanation for reduced DNA binding of LRRm1 can be that disrupting LRR
in DNA-PKcs has disrupted the interaction between DNA-PKcs and an unidentified

DNA-binding protein, thus destabilizing the DNA binding of DNA-PKcs.

LRR may also be involved in other fimctions that were not measured by the
techniques I have employed. It is possible that there are some critical residues in this
region, which are important for either interaction with C1D or intramolecular interactions
in DNA-PKcs and those residues might not have been affected by the mutations
introduced (E1516D, L1517P). To address that, we are trying to generate a mutant that
has the LRR deleted from the fill] length DNA-PKcs. It would be interesting to see how

the mutant behaves in NHEJ and also how it interacts with other proteins in the pathway.

A previous study from Yavuzer et al had shown that a nuclear matrix protein C1D
interacts with DNA-PKcs through the LRR motif. At the outset of this study we wanted
to disrupt this interaction and address the role C1D in NHEJ. However, from my data I

conclude that there are regions outside LRR in DNA-PKcs that contribute to the

113

interaction between C1D and DNA-PKcs. To determine if this is the case one could use
the yeast two-hybrid assay using cDNA for different regions/domains of DNA-PKcs as
the bait and cDNA for C1D as the prey, and vice versa. This information can then be
used to disrupt interaction between C1D and DNA-PKcs and help unravel the role of

C1D in NHEJ in mammalian cells.

The other way to address ClD’s role in DNA repair is to knock out C1D.
However, the lack of any commercial antibodies makes this is a formidable task. During
the course of my study, I considered this approach and generated a peptide antibody.
However, the antibody was unable to detect any endogenous or over-expressed C1D in
mammalian cells. It did however detect C1D expressed in baculovirus. I think, this
approach is worth a second try and instead of generating a peptide antibody, we can
purify C1D expressed in baculovirus and use the whole protein to generate a second
antibody. This antibody will, in all probability, be more sensitive than the peptide
antibody. Once we have an antibody to detect endogenous levels of C1D, it would not be
a difficult task to knock out or knock down the expression level of C1D using siRNA. In
the absence of an antibody, quantitative RT-PCR can also employed to detect mRNA
levels of C1D, however this would be a more labour intensive approach than the western
blot analysis. Knocking down C1D will also help in understanding the role of a nuclear

matrix protein in DNA repair.

114

 

REFERENCES

Bassing, C.H., Swat, W., and Alt, F .W. (2002). The mechanism and regulation of
chromosomal V(D)J recombination. Cell 109 Suppl, 845-55.

Baumann, P., and West, SC. (1998). DNA end-joining catalyzed by human cell-
free extracts. Proc Natl Acad Sci U S A 95, 14066-14070.

Blier, P.R., Griffith, A.J., Craft, J ., and Hardin, J .A. (1993). Binding of Ku protein
to DNA. Measurement of afiinity for ends and demonstration of binding to nicks. J
Biol Chem 268, 7594-7601.

Block, W.D., Yu, Y., Merkle, D., Gifford, J .L., Ding, Q., Meek, K., and Lees-
Miller, SP. (2004). Autophosphorylation-dependent remodeling of the DNA-

dependent protein kinase catalytic subunit regulates ligation of DNA ends. Nucleic
Acids Res 32, 4351-4357. v

Boskovic, J ., Rivera-Calzada, A., Maman, J .D., Chacon, P., Willison, K.R., Pearl,
L.H., and Llorca, O. (2003). Visualization of DNA-induced conformational
changes in the DNA repair kinase DNA-PKcs. Embo J 22, 5875-5882.

Boubnov, N.V., and Weaver, D.T. (1995). scid cells are deficient in Ku and
replication protein A phosphorylation by the DNA-dependent protein kinase.
Molecular & Cellular Biology 15, 5700-5706.

Boulton, S.J., and Jackson, S.P. (1996a). Identification of a Saccharomyces
cerevisiae Ku80 homologue: roles in DNA double strand break rejoining and in
telomeric maintenance. Nucleic Acids Res 24, 4639—4648.

Boulton, S.J., and Jackson, S.P. (1996b). Saccharomyces cerevisiae Ku70
potentiates illegitimate DNA double-strand break repair and serves as a barrier to
error-prone DNA repair pathways. Embo J 15, 5093-5103.

Brewerton, S.C., Dore, A.S., Drake, A.C., Leuther, KK, and Blundell, TL.
(2004). Structural analysis of DNA-PKcs: modelling of the repeat units and
insights into the detailed molecular architecture. J Struct Biol 145, 295-306.

115

 

10.

ll.

12.

13.

14.

15.

16.

17.

18.

Calsou, P., Delteil, C., Frit, P., Drouet, J ., and Salles, B. (2003). Coordinated
assembly of Ku and p460 subunits of the DNA-dependent protein kinase on DNA
ends is necessary for XRCC4-ligase IV recruitment. Journal of Molecular Biology
326, 93-103.

Calsou, P., Frit, P., Humbert, 0., Muller, C., Chen, D.J., and Salles, B. (1999). The
DNA-dependent protein kinase catalytic activity regulates DNA end processing by
means of Ku entry into DNA. J Biol Chem 274, 7848-7856.

Cary, R.B., Chen, R, Shen, Z., and Chen, D]. (1998). A central region of Ku80
mediates interaction with Ku70 in vivo. Nucleic Acids Research 26, 974-979.

Chan, D.W., and Lees-Miller, SP. (1996). The DNA-dependent protein kinase is
inactivated by autophosphorylation of the catalytic subunit. J Biol Chem 271,
8936-8941.

Chan, D.W., Ye, R., Veillette, C.J., and Lees-Miller, SP. (1999). DNA-dependent
protein kinase phosphorylation sites in Ku 7 0/80 heterodimer. Biochemistry 38,
l 819- 1 828.

Chen, L., Trujillo, K, Sung, P., and Tomkinson, AB (2000). Interactions of the
DNA ligase IV-XRCC4 complex with DNA ends and the DNA-dependent protein
kinase. Journal of Biological Chemistry 275, 26196-26205.

Chemikova, S.B., Wells, R.L., and Elkind, M.M. (1999). Wortmannin sensitizes
mammalian cells to radiation by inhibiting the DNA-dependent protein kinase-
mediated rejoining of double-strand breaks. Radiat Res 151, 159-166.

Cohen, H.Y., Lavu, S., Bittermarr, K.J., Hekkirrg, B., Imahiyerobo, T.A., Miller, C.,
Frye, R., Ploegh, H., Kessler, B.M., and Sinclair, DA. (2004). Acetylation of the C
terminus of Ku70 by CBP and PCAF controls Bax-mediated apoptosis. Mol Cell
13, 627-638.

Critchlow, SE, and Jackson, SP. (1998). DNA end-joining: from yeast to man.
Trends Biochem Sci 23, 394-398.

116

19.

20.

21.

22.

23.

24.

25.

26.

27.

Dai, Y., Kysela, B., Hanakahi, L.A., Manolis, K, Riballo, E., Stumm, M., Harville,
T.O., West, S.C., Oettinger, M.A., and Jeggo, RA. (2003). Nonhomologous end

joining and V(D)J recombination require an additional factor. Proceedings of the
National Academy of Sciences of the United States of America 100, 2462-2467.

DeFazio, L.G., Stansel, RM., Griffith, J .D., and Chu, G. (2002). Synapsis of DNA
ends by DNA-dependent protein kinase. Embo J 21, 3192-3200.

Ding, Q., Reddy, Y.V., Wang, W., Woods, T., Douglas, P., Ramsden, D.A., Lees-
Miller, SP, and Meek, K (2003). Autophosphorylation of the catalytic subunit of
the DNA-dependent protein kinase is required for efficient end processing during
DNA double-strand break repair. Mol Cell Biol 23, 5836-5848.

Doherty, A.J., and Jackson, SP. (2001). DNA repair: how Ku makes ends meet.
Curr Biol 11, R920-924.

Douglas, P., Moorhead, G.B., Ye, R., and Lees-Miller, SP. (2001). Protein
phosphatases regulate DNA-dependent protein kinase activity. J Biol Chem 276,
18992-18998.

Douglas, P., Sapkota, G.P., Morrice, N., Yu, Y., Goodarzi, A.A., Merkle, D.,
Meek, K., Alessi, DR, and Lees-Miller, SF. (2002). Identification of in vitro and
in vivo phosphorylation sites in the catalytic subunit of the DNA-dependent protein
kinase. Biochem J 368, 243-251.

Dudasova, Z., Dudas, A., and Chovanec, M. (2004). Non-homologous end-joining
factors of Saccharomyces cerevisiae. FEMS Microbiol Rev 28, 581-601.

Dynan, W.S., and Yoo, S. (1998). Interaction of Ku protein and DNA-dependent
protein kinase catalytic subunit with nucleic acids. Nucleic Acids Res 26, 1551-
1 5 59.

Erdemir, T., Bilican, B., Cagatay, T., Goding, CR, and Yavuzer, U. (2002).
Saccharomyces cerevisiae C1D is implicated in both non-homologous DNA end
joining and homologous recombination. Mol Microbiol 46, 947-957.

117

28.

29.

30.

31.

32.

33.

34.

35.

36.

37.

Falck, J ., Coates, J ., and Jackson, SP. (2005). Conserved modes of recruitment of
ATM, ATR and DNA-PKcs to sites of DNA damage. Nature 434, 605-611.

Fan, W., and Wu, X. (2004). DNA polymerase lambda can elongate on DNA
substrates mimicking non-homologous end joining and interact with XRCC4-ligase
IV complex. Biochem Biophys Res Commun 323, 1328-1333.

Featherstone, C., and Jackson, SP. (1999). DNA double-strand break repair. Curr
Biol 9, R759-761.

Feng, J ., Park, J ., Cron, P., Hess, D., and Hemrrrings, BA. (2004). Identification of
a PKB/Akt hydrophobic motif Ser-473 kinase as DNA-dependent protein kinase. J
Biol Chem 279, 41189-41196.

Frit, R, Li, R.Y., Arzel, D., Salles, B., and Calsou, P. (2000). Ku entry into DNA
inhibits inward DNA transactions in vitro. J Biol Chem 2 75, 35684-35691.

Fujirnori, A., Araki, R., Fukumura, R., Ohhata, T., Takahashi, H., Kawahara, A.,
Tatsumi, K., and Abe, M. (2000). Identification of four highly conserved regions in
DNA-PKcs. Immunogenetics 51, 965-973.

Gell, D., and Jackson, SP. (1999). Mapping of protein-protein interactions within
the DNA-dependent protein kinase complex. Nucleic Acids Res 27, 3494-3502.

Getzenberg, R.H., Pienta, Kl, Ward, W.S., and Coffey, D.S. (1991). Nuclear
structure and the three-dimensional organization of DNA. J Cell Biochem 4 7, 289-
299.

Goodarzi, A.A., Jonnalagadda, J .C., Douglas, P., Young, D., Ye, R., Moorhead,
G.B., Lees-Miller, SP, and Khanna, K.K (2004). Autophosphorylation of ataxia-

telangiectasia mutated is regulated by protein phosphatase 2A. Embo J 23, 4451-
4461.

Goodarzi, A.A., and Lees-Miller, SP. (2004). Biochemical characterization of the
ataxia-telangiectasia mutated (ATM) protein from human cells. DNA Repair
(Amst) 3, 753-767.

118

38.

39.

40.

41.

42.

43.

44.

45.

46.

47.

Gottlieb, T.M., and Jackson, SP. (1993). The DNA-dependent protein kinase:
requirement for DNA ends and association with Ku antigen. Cell 72, 131-142.

Haber, J .E. (2000). Partners and pathwaysrepairing a double-strand break. Trends
Genet 16, 259-264. '

Hammarsten, 0., and Chu, G. (1998). DNA-dependent protein kinase: DNA
binding and activation in the absence of Ku. Proc Natl Acad Sci U S A 95, 525-
530.

Harris, R., Esposito, D., Sankar, A., Maman, J.D., Hinks, J .A., Pearl, L.H., and
Driscoll, RC. (2004). The 3D solution structure of the C-terminal region of Ku86
(Ku86CTR). J Mol Biol 335, 573-582.

Hartley, K.O., Gell, D., Smith, G.C., Zhang, H., Divecha, N., Connelly, M.A.,
Admon, A., Lees-Miller, S.P., Anderson, C.W., and Jackson, SP. (1995). DNA-
dependent protein kinase catalytic subunit: a relative of phosphatidylinositol 3-
kinase and the ataxia telangiectasia gene product. Cell 82, 849-856.

Havener, J .M., McElhinny, S.A., Bassett, E., Gauger, M., Ramsden, D.A., and
Chaney, S.G. (2003). Translesion synthesis past platinum DNA adducts by human
DNA polymerase mu. Biochemistry 42, 1777-1788.

Hryciw, T., Tang, M., Fontarrie, T., and Xiao, W. (2002). MMSl protects against
replication-dependent DNA damage in Saccharomyces cerevisiae. Mol Genet
Genorrrics 266, 848-857.

Hsu, H.L., Yannone, S.M., and Chen, D]. (2002). Defining interactions between
DNA-PK and ligase IV/XRCC4. DNA Repair 1, 225-235.

Jackson, SP. (2001). Detecting, signalling and repairing DNA double-strand
breaks. Biochem Soc Trans 29, 655-661.

Jackson, SP. (2002). Sensing and repairing DNA double-strand breaks.
Carcinogenesis 23, 687-696.

119

48.

49.

SO.

51.

52.

53.

54.

55.

56.

Jackson, SR, and J eggo, RA. (1995). DNA double-strand break repair and V(D)J
recombination: involvement of DNA-PK. Trends Biochem Sci 20, 412-415.

Jeggo, P.A., Hafezparast, M., Thompson, A.F., Broughton, B.C., Kaur, G.P.,
Zdzienicka, M.Z., and Athwal, RS. (1992). Localization of a DNA repair gene
(XRCCS) involved in double-strand-break rejoining to human chromosome 2.

Proceedings of the National Academy of Sciences of the United States of America
89, 6423-6427.

Jeggo, P.A., Taccioli, GE, and Jackson, SP. (1995). Menage a trois: double strand
break repair, V(D)J recombination and DNA-PK. Bioessays 1 7, 949-957.

J in, S., and Weaver, D.T. (1997). Double-strand break repair by Ku70 requires
heterodimerization with Ku80 and DNA binding functions. Embo J 16, 6874-6885.

Johnson, L.N., De Moliner, E., Brown, N.R., Song, H., Barford, D., Endicott, J .A.,
and Noble, ME. (2002). Structural studies with inhibitors of the cell cycle
regulatory kinase cyclin-dependent protein kinase 2. Pharmacol Ther 93, 113-124.

Karmakar, P., Piotrowski, J ., Brosh, R.M., Jr., Sommers, J .A., Miller, S.P., Cheng,
W.H., Snowden, C.M., Ramsden, D.A., and Bohr, VA. (2002). Werner protein is a
target of DNA-dependent protein kinase in vivo and in vitro, and its catalytic
activities are regulated by phosphorylation. J Biol Chem 277, 18291-18302.

Karran, P. (2000). DNA double strand break repair in mammalian cells. Curr Opin
Genet Dev 10, 144-150.

Kienker, L.J., Shin, E.K., and Meek, K. (2000). Both V(D)J recombination and
radioresistance require DNA-PK kinase activity, though minimal levels suffice for
V(D)J recombination. Nucleic Acids Res 28, 2752-2761.

Koehler, DR, and Hanawalt, RC. (1996). Recruitment of damaged DNA to the
nuclear matrix in hamster cells following ultraviolet irradiation. Nucleic Acids Res
24, 2877-2884.

120

57.

58.

59.

60.

61.

62.

63.

64.

65.

Kurimasa, A., Kumano, 8., Boubnov, N.V., Story, M.D., Tung, C.S., Peterson,
SR, and Chen, DJ. (1999). Requirement for the kinase activity of human DNA-
dependent protein kinase catalytic subunit in DNA strand break rejoining. Mol Cell
Biol 19, 3877-3884.

Kysela, B., Doherty, A.J., Chovanec, M., Stiff, T., Ameer-Beg, S.M., Vojnovic, B.,
Girard, P.M., and J eggo, RA. (2003). Ku stimulation of DNA ligase IV-dependent
ligation requires inward movement along the DNA molecule. Journal of Biological

Chemistry 278, 22466-22474.

Leber, R., Wise, T.W., Mizuta, R., and Meek, K. (1998). The XRCC4 gene product
is a target for and interacts with the DNA-dependent protein kinase. Journal of
Biological Chemistry 273, 1794-1801.

Lee, J .W., Yannone, S.M., Chen, D.J., and Povirk, LP. (2003). Requirement for
XRCC4 and DNA ligase IV in alignment-based gap filling for nonhomologous
DNA end joining in vitro. Cancer Research 63, 22-24.

Lee, K.J., Huang, J ., Takeda, Y., and Dynan, W.S. (2000). DNA ligase IV and
XRCC4 form a stable mixed tetrarner that fimctions synergistically with other

repair factors in a cell-free end-joining system. Journal of Biological Chemistry
275, 34787-34796.

Lee, KJ., Jovanovic, M., Udayakumar, D., Bladen, C.L., and Dynan, W.S. (2004).
Identification of DNA-PKcs phosphorylation sites in XRCC4 and effects of

mutations at these sites on DNA end joining in a cell-free system. DNA Repair
(Amst) 3, 267-276.

Lee, S.E., He, D.M., and Hendrickson, EA. (1996). Characterization of Chinese
hamster cell lines that are x-ray-sensitive, impaired in DNA double-strand break

repair and defective for V(D)J recombination. Curr Top Microbiol Immunol 21 7,
133-142.

Lees-Miller, SP, and Meek, K. (2003). Repair of DNA double strand breaks by
non-homologous end joining. Biochirnie 85, 1161-1173.

Lees-Miller, S.P., Sakaguchi, K, Ullrich, S.J., Appella, E., and Anderson, CW.
(1992). Human DNA-activated protein kinase phosphorylates serines 15 and 37 in

121

66.

67.

68.

69.

70.

71.

72.

73.

the amino-terminal transactivation domain of human p53. Mol Cell Biol 12, 5041-
5049.

Li, B., and Comai, L. (2000). Functional interaction between Ku and the wemer
syndrome protein in DNA end processing. J Biol Chem 275, 28349-28352.

Ma, Y., Lu, H., Tippin, B., Goodman, M.F., Shimazaki, N., Koiwai, 0., Hsieh,
C.L., Schwarz, K, and Lieber, MR. (2004). A biochemically defined system for
mammalian nonhomologous DNA end joining. Mol Cell 16, 701-713.

Ma, Y., Pannicke, U., Schwarz, K, and Lieber, MR. (2002). Hairpin opening and
overhang processing by an Artemis/DNA-dependent protein kinase complex in
nonhomologous end joining and V(D)J recombination. Cell 108, 781-794.

Mahajan, K.N., Nick McElhinny, S.A., Mitchell, BS, and Ramsden, DA. (2002).
Association of DNA polymerase mu (pol mu) with Ku and ligase IV: role for pol
mu in end-joining double-strand break repair. Mol Cell Biol 22, 5194-5202.

Meek, K, Gupta, S., Ramsden, D.A., and Lees-Miller, SP. (2004). The DNA-
dependent protein kinase: the director at the end. Immunol Rev 200, 132-141.

Merkle, D., Douglas, P., Moorhead, G.B., Leonenko, Z., Yu, Y., Cramb, D.,
Bazett-Jones, DR, and Lees-Miller, SP. (2002). The DNA-dependent protein
kinase interacts with DNA to form a protein-DNA complex that is disrupted by
phosphorylation. Biochemistry 41, 12706-12714.

Mirnori, T., Akizuki, M., Yamagata, H., Inada, S., Yoshida, S., and Homma, M.
(1981). Characterization of a high molecular weight acidic nuclear protein
recognized by autoantibodies in sera from patients with polymyositis-sclerodenna
overlap. Journal of Clinical Investigation 68, 611-620.

Mirnori, T., Hardin, J .A., and Steitz, J .A. (1986). Characterization of the DNA-
binding protein antigen Ku recognized by autoantibodies fiom patients with
rheumatic disorders. Journal of Biological Chemistry 261, 2274-2278.

122

74.

75.

76.

77.

78.

79.

80.

81.

82.

Modesti, M., Hesse, J .E., and Gellert, M. (1999). DNA binding of chc4 protein is
associated with V(D)J recombination but not with stimulation of DNA ligase IV
activity. EMBO Journal 18, 2008-2018.

Mullenders, L.H., van Kesteren, A.C., Bussmann, C.J., van Zeeland, A.A., and
Natarajan, A.T. (1984). Preferential repair of nuclear matrix associated DNA in
xeroderma pigrnentosum complementation group C. Mutat Res 141, 75-82.

Muller-Tidow, C., Ji, P., Diederichs, S., Potratz, J ., Baurner, N., Kohler, G.,
Cauvet, T., Choudary, C., van der Meer, T., Chan, W.Y., Nieduszynski, C.,
Colledge, W.H., Carrington, M., Koeffler, H.P., Restle, A., Wiesmuller, L.,
Sobczak-Thepot, J ., Berdel, W.E., and Serve, H. (2004). The cyclin Al-CDK2
complex regulates DNA double-strand break repair. Mol Cell Biol 24, 8917-8928.

Nehls, P., Keck, T., Greferath, R., Spiess, E., Glaser, T., Rothbarth, K, Stammer,
H., and Werner, D. (1998). cDNA cloning, recombinant expression and
characterization of polypetides with exceptional DNA affinity. Nucleic Acids Res
26, 1160-1166. '

Nelson, W.G., and Coffey, D.S. (1987). Structural aspects of mammalian DNA
replication: topoisomerase II. NCI Monogr, 23-29.

Nelson, W.G., Pienta, KJ., Barrack, ER, and Coffey, D.S. (1986). The role of the
nuclear matrix in the organization and firnction of DNA. Annu Rev Biophys
Biophys Chem 15, 457-475.

Neuer, B., Plagens, U., and Werner, D. (1983). Phosphodiester bonds between
polypeptides and chromosomal DNA. J Mol Biol 164, 213-235.

Neuer, B., and Werner, D. (1985). Screening of isolated DNA for sequences
released fi'om anchorage sites in nuclear matrix. J Mol Biol 181, 15-25.

Nick McElhinny, S.A., Havener, J .M., Garcia-Diaz, M., Juarez, R., Bebenek, K.,
Kee, B.L., Blanco, L., Kunkel, T.A., and Ramsden, DA. (2005). A gradient of

template dependence defines distinct biological roles for family X polymerases in
nonhomologous end joining. Mol Cell 19, 357-366.

123

83.

84.

85.

86.

87.

88.

89.

90.

91.

Nick McElhinny, S.A., and Ramsden, DA. (2003). Polymerase mu is a DNA-
directed DNA/RNA polymerase. Mol Cell Biol 23, 2309-2315.

Nick McElhinny, S.A., and Ramsden, DA. (2004). Sibling rivalry: competition
between Pol X family members in V(D)J recombination and general double strand
break repair. Immunol Rev 200, 156-164.

Nick McElhinny, S.A., Snowden, C.M., McCarville, J ., and Ramsden, DA. (2000).
Ku recruits the XRCC4-ligase IV complex to DNA ends. Molecular & Cellular
Biology 20, 2996-3003.

Norbury, C.J., and Hickson, ID. (2001). Cellular responses to DNA damage. Annu
Rev Pharrnacol Toxicol 41, 367-401.

O'Neill, T., Dwyer, A.J., Ziv, Y., Chan, D.W., Lees-Miller, S.P., Abraham, R.H.,
Lai, J .H., Hill, D., Shiloh, Y., Cantley, LC, and Rathbun, GA. (2000). Utilization
of oriented peptide hbraries to identify substrate motifs selected by ATM. J Biol
Chem 275, 22719-22727.

Orren, D.K, Machwe, A., Karmakar, P., Piotrowski, J ., Cooper, M.P., and Bohr,
V.A. (2001). A functional interaction of Ku with Werner exonuclease facilitates
digestion of damaged DNA. Nucleic Acids Res 29, 1926-1934.

Osipovich, 0., Duhe, R.J., Hasty, P., Durum, SK, and Muegge, K. (1999).
Defining functional domains of Ku80: DNA end binding and survival afier
radiation. Biochemical & Biophysical Research Communications 261, 802-807.

Osipovich, 0., Durum, SK, and Muegge, K. (1997). Defining the minimal domain
of Ku80 for interaction with Ku70. Journal of Biological Chemistry 272, 27259-
27265.

Peterson, S.R., Kurimasa, A., Oshirnura, M., Dynan, W.S., Bradbury, B.M., and
Chen, D]. (1995). Loss of the catalytic subunit of the DNA-dependent protein
kinase in DNA double-strand-break-repair mutant mammalian cells. Proc Natl
Acad Sci U S A 92, 3171-3174.

124

92.

93.

94.

95.

96.

97.

98.

99.

100.

Peterson, S.R., Stackhouse, M., Waltman, M.J., Chen, F ., Sato, K, and Chen, DJ.
(1997). Characterization of two DNA double-stranded break repair-deficient cell
lines that express inactive DNA-dependent protein kinase catalytic subunits. J Biol
Chem 272, 10227-10231.

Pierce, A.J., Hu, P., Han, M., Ellis, N., and Jasin, M. (2001). Ku DNA end-binding
protein modulates homologous repair of double-strand breaks in mammalian cells.
Genes Dev 15, 3237-3242.

Reddy, Y.V., Ding, Q., Lees-Miller, S.P., Meek, K, and Ramsden, DA. (2004).
Non-homologous end joining requires that the DNA-PK complex undergo an
autophosphorylation-dependent rearrangement at DNA ends. J Biol Chem 279,
39408-39413.

Rivera-Calzada, A., Maman, J.D., Spagnolo, L., Pearl, L.H., and Llorca, O. (2005).
Three-dimensional structure and regulation of the DNA-dependent protein kinase
catalytic subunit (DNA-PKcs). Structure (Camb) 13, 243-255.

Ross, G.M., Eady, J.J., Mithal, N.P., Bush, C., Steel, G.G., Jeggo, P.A., and
McMillan, T.J. (1995). DNA strand break rejoining defect in xrs-6 is

complemented by transfection with the human Ku80 gene. Cancer Res 55, 1235-
1238.

Rothbarth, K, Spiess, E., Juodka, B., Yavuzer, U., Nehls, P., Stammer, H., and
Werner, D. (1999). Induction of apoptosis by overexpression of the DNA-binding
and DNA-PK-activating protein C1D. J Cell Sci 112 ( Pt 13), 2223-2232.

Rothbarth, K, Stammer, H., and Werner, D. (2002). Proteasome-mediated
degradation antagonizes critical levels of the apoptosis-inducing C1D protein.
Cancer Cell Int 2, 12.

Rothkamm, K, Kruger, 1., Thompson, L.H., and Lobrich, M. (2003). Pathways of
DNA double-strand break repair during the mammalian cell cycle. Mol Cell Biol
23, 5706-5715.

Schlissel, MS. (2002). Does arternis end the hunt for the hairpin-opening activity
in V(D)J recombination? Cell 109, 1-4.

125

101.

102.

103.

104.

105.

106.

107.

108.

109.

110.

Shiloh, Y., and Lehmann, AR. (2004). Maintaining integrity. Nat Cell Biol 6, 923-
928.

Singleton, B.K., Priestley, A., Steingrimsdottir, H., Gell, D., Blunt, T., Jackson,
S.P., Lehmann, A.R., and Jeggo, RA. (1997). Molecular and biochemical
characterization of xrs mutants defective in Ku80. Molecular & Cellular Biology
17, 1264-1273.

Singleton, B.K., Torres-Arzayus, M.I., Rottinghaus, S.T., Taccioli, GE, and
J eggo, RA. (1999). The C terminus of Ku80 activates the DNA-dependent protein
kinase catalytic subunit. Mol Cell Biol 19, 3267-3277.

Srnider, V., Rathrnell, W.K, Lieber, M.R., and Chu, G. (1994). Restoration of X-
ray resistance and V(D)J recombination in mutant cells by Ku cDNA. Science 266,
288-291.

Smith, G.C., and Jackson, SP. (1999). The DNA-dependent protein kinase. Genes
Dev 13, 916-934.

Taccioli, G.E., Gottlieb, T.M., Blunt, T., Priestley, A., Demengeot, J ., Mizuta, R.,
Lehmann, A.R., Alt, F.W., Jackson, S.P., and Jeggo, RA. (1994). Ku80: product of
the XRCCS gene and its role in DNA repair and V(D)J recombination. Science

265, 1442-1445.

Thompson, L.H., and Schild, D. (2001). Homologous recombinational repair of
DNA ensures mammalian chromosome stability. Mutat Res 47 7, 131-153.

Thompson, L.H., and Schild, D. (2002). Recombinational DNA repair and human
disease. Mutat Res 509, 49-7 8.

Tseng, H.M., and Tomkinson, AB. (2002). A physical and functional interaction
between yeast P014 and Dnl4-Lifl links DNA synthesis and ligation in
nonhomologous end joining. J Biol Chem 27 7, 45630-45637.

van den Bosch, M., Lohman, RH, and Pastink, A. (2002). DNA double-strand
break repair by homologous recombination. Biol Chem 383, 873-892.

126

111.

112.

113.

114.

115.

116.

117.

118.

119.

van Gent, D.C., Hoeijmakers, J .H., and Kanaar, R. (2001). Chromosomal stability
and the DNA double-stranded break connection. Nat Rev Genet 2, 196-206.

Vilenchik, M.M., and Knudson, AG. (2003). Endogenous DNA double-strand
breaks: production, fidelity of repair, and induction of cancer. Proc Natl Acad Sci
U S A 100, 12871-12876.

Walker, J .R., Corpina, R.A., and Goldberg, J. (2001). Structure of the Ku
heterodimer bound to DNA and its implications for double-strand break repair.
Nature 412, 607-614.

Wang, Y.G., Nnakwe, C., Lane, W.S., Modesti, M., and Frank, KM. (2004).
Phosphorylation and regulation of DNA ligase IV stability by DNA-dependent
protein kinase. J Biol Chem 2 79, 37282-37290.

Wilson, T.E., and Lieber, MR. (1999). Emcient processing of DNA ends during
yeast nonhomologous end joining. Evidence for a DNA polymerase beta (P014)-
dependent pathway. J Biol Chem 274, 23599-23609.

Wu, K, and Lieber, MR. (1996). Protein-protein and protein-DNA interaction
regions within the DNA end-binding protein Ku70-Ku86. Mol Cell Biol 16, 5186-
5 193.

Yaneva, M., and Busch, H. (1986). A 10S particle released from
deoxyribonuclease-sensitive regions of HeLa cell nuclei contains the 86-kilodalton-
70-kilodalton protein complex. Biochemistry 25, 5057-5063.

Yavuzer, U., Smith, G.C., Bliss, T., Werner, D., and Jackson, SP. (1998). DNA
end-independent activation of DNA-PK mediated via association with the DNA-
binding protein C1D. Genes Dev 12, 2188-2199.

Yoo, S., and Dynan, W.S. (1999). Geometry of a conrplex formed by double strand
break repair proteins at a single DNA end: recruitment of DNA-PKcs induces
inward translocation of Ku protein. Nucleic Acids Res 27, 4679-4686.

127

120. Yu, Y., Wang, W., Ding, Q., Ye, R., Chen, D., Merkle, D., Schriemer, D., Meek,

121.

K, and Lees-Miller, SP. (2003). DNA-PK phosphorylation sites in XRCC4 are not
required for survival after radiation or for V(D)J recombination. DNA Repair

. (Amst) 2, 1239-1252.

Zamir, I., Dawson, J ., Lavinsky, R.M., Glass, C.K., Rosenfeld, M.G., and Lazar,
M.A. (1997). Cloning and characterization of a corepressor and potential

component of the nuclear hormone receptor repression complex. Proc Natl Acad
Sci U S A 94, 14400-14405.

128

   

|ifllliflflijllljlfljlijl11111415|