. 19 :5.
3.1.}
_.

£311"?
..\ .m a!!!
... n...
.. :3.
q ’5‘.
9:43.? ..

 

 

 

I’ltq h.’ . .
0.....1l In”
.I. In. Mung! Vinit4tg|a§
.. ringe s
xlzl:.51’!.w3§.
: .x 3.

 

 

 

 

 

 

I:

\3i)

1 .:
Iv‘. J )3.
I‘ I». éx
I} C» v o. .n)..IXa..P«uI
{it’ll-5‘ y“ D . .

 

319

9WB . LIBRARY
' ., Muchigan State
University

This is to certify that the
dissertation entitled

NUTRITIONAL INFLUENCES ON BODY AND MAMMARY
GROWTH AND EFFECT OF LEPTIN AND IGF-l IN
PREPUBERTAL DAIRY HEIFERS

presented by

LAURIE ELLEN DAVIS RINCKER

has been accepted towards fulfillment
of the requirements for the

PhD. degree in Animal Science

 

 

 

7 ; é Major grofessor’z Signature

fiazvn/m 07/; 0200 :—
Date

MSU is an Alfinnative ActiorVEqual Opportunity Institution

 

PLACE IN RETURN BOX to remove this checkout from your record.
To AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2/05 p:/ClRC/DateDue.indd-p.1

NUTRITIONAL INFLUENCES ON BODY AND MAMMARY GROWTH AND
EFFECT OF LEPTIN AND IGF-I IN PREPUBERTAL DAIRY HEIFERS

By

Laurie Ellen Davis Rincker

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Department of Animal Science

2005

ABSTRACT

NUTRITIONAL INFLUENCES ON BODY AND MAMMARY GROWTH AND
EFFECT OF LEPTIN AND IGF-I IN PREPUBERTAL DAIRY HEIFERS

By

Laurie Ellen Davis Rincker

Feeding high energy diets to prepubertal dairy heifers for 12 wk or more increases
daily gain and can reduce the number of non-productive days before first calving, but
also can impair mammary growth relative to body growth and decrease subsequent milk
production. Recent research indicates that feeding calves a high energy diet prior to
weaning for a shorter duration results in an increase in body weight gain without
impairing mammary growth. The objective of this research was to determine the effect
of feeding a high energy diet to prepubertal heifers for a short and long duration of time
on body growth, mammary growth, and protein and mRNA abundance of leptin and IGF-
I in serum and mammary parenchymal tissue. Sixty-four heifers (age = 11 wk) were
assigned to 1 of 4 treatments and fed 2 diets for a different duration: H0, H3, H6, and
H12 were fed a low energy diet for 12, 9, 6, and 0 wk followed by a high energy diet for
O, 3, 6, and 12 wk, respectively. The low and high energy diets were fed to achieve 0.6
and 1.2 kg daily gain, respectively. Heifers were slaughtered at 23 wk of age.

Body, carcass, carcass fat, liver, and perirenal fat weights increased linearly with
a longer duration fed the high energy diet. A longer time fed the high energy diet

increased weights of total mammary gland, extraparenchymal fat, and intraparenchymal

fat, but did not change the weight of mammary parenchyma. When expressed relative to
carcass weight to adjust for treatment differences in physiological maturity, fat-free
parenchymal tissue weight and mammary RNA and DNA content decreased as heifers
were fed a high energy diet for a longer duration. An increase in body or carcass growth
without a proportional increase in mammary growth would result in less mammary
parenchyma at puberty because heifers fed for rapid gains reach puberty at a younger age.

The phenomenon of why high energy intake impairs mammary growth relative to
body growth is not clearly understood. An increase in fat deposition could play a role in
the impairment of mammogenesis. Leptin is produced by adipocytes and impairs
mammary epithelial cell proliferation in heifers. To determine whether heifers fed high
energy diets had greater amounts of leptin, concentration and mRN A expression of leptin
in mammary parenchymal tissue were measured. Heifers fed a high energy diet for a
longer duration had increased leptin concentrations in serum and mammary tissue and
increased leptin mRN A expression in mammary tissue.

Feeding prepubertal heifers a high energy diet for rapid gains increases serum
concentration of IGF-I, a mitogen for mammary epithelial cells. To better understand
this apparent contradiction, IGF-I and IGF-1 receptor mRN A expression in mammary
parenchymal tissue were measured. There was no dietary effect on IGF-I mRNA
expression, while a short duration of time fed a high energy diet decreased IGF-I receptor
mRNA expression in mammary tissue. A potential inhibition of IGF-I stimulation via
leptin, IGFBP-3, or another factor not yet elucidated could explain why high energy

intake impairs mammary growth relative to body grth in prepubertal dairy heifers.

In honor of Flora Diehl Williams and Joyce McCune Davis
and in memory of Lydia Driver Diehl.

Mothers and grandmothers are the glue that holds a family together.
Thanks for teaching me how to be a strong-minded woman
hifififln
hifinnfly,

and in love.

iv

ACKNOWLEDGEMENTS

I thank both Dr. Miriam Weber Nielsen and Dr. Mike VandeHaar for their
support and guidance throughout my years at Michigan State. I also thank the members
of my guidance committee, Dr. Matt Doumit, Dr. Roy Fogwell, and Dr. Dan Grooms for
your time, expertise, and ideas to make this research project more complete. Also
gratitude is expressed to Dr. Duane Keisler, University of Missouri, for analysis of leptin
concentrations in mammary extracts and serum samples. A special thanks is extended to
Dr. Joe Domecq for your fiiendship and for giving me the opportunity to gain experience
in coaching and youth extension. My graduate experience in research, teaching, and
extension has given me great opportunities to learn all facets of the university setting.

Many thanks to all of my student employees, Jamie Perry, Jodi Crossgrove,
Jessica Hammond, Jennifer Ackerman, Thomas Chapin, Katie Hyde, and Bryce Slavik.
The many hours spent taking care of heifers and collecting data for both research projects
is appreciated. Special thanks to Jamie Perry, my right-hand woman, who gave 110% to
these projects (even over Christmas vacation).

A special thanks to Larry Chapin for your genuine friendship and the many hours
you spent with me at the barn and in the lab. Thanks to Jim Liesman for your help with
SAS, data collection, and our informative chats. To Dr. Yass Kobayashi, many thanks
for collecting reproductive weights at slaughter.

I would like to recognize the BCRC farm crew for your help in caring and feeding

the heifers. Special thanks to Ken Metz for sharing his knowledge of animal husbandry

with me. Also, thanks to the dairy farm crew for putting up with the “spoiled”, but very
well-trained heifers for the calf research project!

Lastly, I would like to thank Mike, Mom, Jim, Julie, Brad, and Jared for all of

their continued support and love.

vi

TABLE OF CONTENTS

LIST OF TABLES .............................................................................................................. x
LIST OF FIGURES .......................................................................................................... xii
LIST OF ABBREVIATIONS .......................................................................................... xiv
INTRODUCTION .............................................................................................................. 1
CHAPTER ONE
LITERATURE REVIEW ................................................................................................... 6
Statement of Problem ...................................................................................................... 6
Physiology of Mammary Development .......................................................................... 7
Length of Prepubertal Period ........................................................................................ 10
Growth Patterns and Requirements of Dairy Heifers ................................................... 12
Nutrition: Restricted Compared to Ad libitum Feeding ............................................... 16
Nutrition: Different Diet Composition .......................................................................... 17
Nutrition: Effect of Dietary Protein and Energy ........................................................... 19
Nutrition: High Energy Diets Fed for a Short Duration ............................................... 21
Body Fatness ................................................................................................................. 23
Leptin ............................................................................................................................ 25
Growth Hormone (GH) / Insulin-like Growth F actor-I (IGF-I) Axis ........................... 28
IGF Binding Proteins (IGFBP) ..................................................................................... 34
Sensitivity of Mammary Tissue to IGF-I ...................................................................... 37
Other Factors with a Potential Role in Nutritional Modulation of Mammary Growth 38
Summary and Statement of Objectives ......................................................................... 39
CHAPTER TWO

EFFECT OF FEEDING HIGH ENERGY DIETS TO PREPUBERTAL HEIFERS FOR
LONGER DURATIONS OF TIME ON BODY GROWTH, CARCASS

COMPOSITION, AND FEED EFFICIENCY ................................................................. 41
ABSTRACT .................................................................................................................. 41
INTRODUCTION ........................................................................................................ 42
MATERIALS AND METHODS .................................................................................. 45

Animals and Dietary Treatments .............................................................................. 45
Evaluation of NRC .................................................................................................... 48
Tissue Collection ...................................................................................................... 48
Estimated Carcass Composition ............................................................................... 49
Statistical Analysis .................................................................................................... 49
RESULTS ..................................................................................................................... 50

vii

DISCUSSION ............................................................................................................... 54

CONCLUSION ............................................................................................................. 59
CHAPTER THREE
EFFECTS OF FEEDING A HIGH ENERGY DIET TO PREPUBERTAL HEIFERS
FOR LONGER DURATIONS OF TIME ON MAMMARY DEVELOPMENT ............ 82
ABSTRACT .................................................................................................................. 82
INTRODUCTION ........................................................................................................ 83
MATERIALS AND METHODS .................................................................................. 85
Animals and Treatment ............................................................................................. 85
Tissue Collection ...................................................................................................... 86
Mammary Gland Composition ................................................................................. 87
Statistical Analysis .................................................................................................... 88
RESULTS ..................................................................................................................... 89
DISCUSSION ............................................................................................................... 90
CONCLUSIONS ........................................................................................................... 95
CHAPTER FOUR

EFFECTS OF FEEDING A HIGH ENERGY DIET TO PREPUBERTAL HEIFERS
FOR LONGER DURATIONS OF TIME ON ABUNDAN CE OF LEPTIN AND IGF-I

IN MAMMARY TISSUE AND SERUM ...................................................................... 105
ABSTRACT ................................................................................................................ 105
INTRODUCTION ...................................................................................................... 106
MATERIALS AND METHODS ................................................................................ 109

Animals and Treatment ........................................................................................... 109
Preparation of Mammary Extracts .......................................................................... 111
Leptin Radioimmunoassay (RIA) ........................................................................... 111
IGF-I Radioimmunoassay (RIA) ............................................................................ 112
Western Ligand Blot ............................................................................................... 113
RNA Isolation ......................................................................................................... 115
Quantitative Reverse Transcriptase — Polymerase Chain Reaction (RT-PCR) ...... 116
Statistical Analysis .................................................................................................. 1 18
RESULTS ................................................................................................................... 119
DISCUSSION ............................................................................................................. 121

viii

CONCLUSION ........................................................................................................... 129

CHAPTER FIVE

SUMMARY AND CONCLUSIONS ............................................................................. 144
CHAPTER SIX

FUTURE RESEARCH ................................................................................................... 148
REFERENCES ............................................................................................................... 1 52
APPENDIX ...................................................................................................................... 168

ix

 

LIST OF TABLES

CHAPTER ONE

Table 1. Nutritional Requirements for Dairy Heifers ........................................................ 15
CHAPTER TWO

Table 1. Ingredient content of diets ................................................................................... 61
Table 2. Feedstuff analysis ................................................................................................ 62
Table 3. Least square means for body growth ................................................................... 69
Table 4. Least square means for feed intake and efficiency .............................................. 72
Table 5. Least square means for body and estimated carcass composition ....................... 74
Table 6. Least square means for uterine and ovarian weights ........................................... 78
Table 7. Measurements of predicted versus observed daily intakes and gains .................. 80
CHAPTER THREE

Table 1. Least square means for body and carcass characteristics ................................... 97
Table 2. Least square means for mammary gland composition ......................................... 98
Table 3. Least square means for mammary gland nucleic acid content .......................... 101

Table 4. Least square means for daily compounded fractional accretion rates (FAR) ....103

Table 5. Difference in daily fractional accretion rates (FAR) of heifers fed high compared

to low energy diets for 12 wk .......................................................................................... 104
CHAPTER FOUR

Table 1. Primer Sequences (5’ to 3’) ............................................................................... 130
Table 2. Least square means for serum leptin concentrations ......................................... 132

Table 3. Correlation of leptin variables and mammary intraparenchymal fat percent 1 37

Table 4. Least square means for serum IGF-I concentrations ......................................... 139
APPENDIX

Table 1. Least square means for body and carcass characteristics (non-transformed) ...169
Table 2. Least square means for mammary gland composition (non-transformed) ........ 171

Table 3. Least square means for mammary gland nucleic acid content (non-transformed)

.......................................................................................................................................... 173

xi

LIST OF FIGURES

INTRODUCTION

Figure 1. A proposed mechanism for why feeding a high energy diet to prepubertal
heifers impairs mammogenesis relative to body growth ..................................................... 5
CHAPTER ONE

Figure 1. Overview of Growth Hormone (GH) / Insulin-like Growth Factor-1 (IGF-I)

axis ..................................................................................................................................... 33
CHAPTER TWO

Figure 1. Tirneline for experiment ..................................................................................... 60
Figure 2. Weekly body weight measurements ................................................................... 63
Figure 3. Weekly average daily gain (ADG) ..................................................................... 64
Figure 4. Daily dry matter intake (DMI) averaged each week .......................................... 65

Figure 5. Dry matter intake (DMI) in kg/d as a proportion of 100 kg body weight (BW)

............................................................................................................................................ 66
Figure 6. Hip width measurements .................................................................................... 67
Figure 7. Weekly withers height measurements ................................................................ 68
Figure 8. Grams of CP consumed per day ......................................................................... 70
Figure 9. Meal of ME consumed per day .......................................................................... 71
Figure 10. Daily accretion rates of carcass protein and fat ................................................ 76
Figure 11. Amount of carcass protein and carcass fat adjusted for BW ............................ 77
Figure 12. Representative picture of heifers fed low and high energy diets ...................... 81
CHAPTER THREE

Figure 1. Grams of fat-free parenchymal tissue relative to 100 kg fat-free carcass ....... 100

xii

CHAPTER FOUR

Figure 1. Serum leptin concentrations ............................................................................. 131
Figure 2. Leptin protein concentrations in mammary tissue and serum ......................... 133
Figure 3. Leptin mRN A expression in mammary parenchymal tissue ........................... 134
Figure 4. Leptin receptor mRNA expression in mammary parenchymal tissue ............. 135
Figure 5. Intraparenchymal fat percent in mammary tissue ........................................... 136
Figure 6. Serum IGF-I concentrations ............................................................................. 138
Figure 7. Abundance of IGF-binding protein-2 (IGFBP-Z) in serum ............................. 140
Figure 8. Abundance of IGF-binding protein-3 (IGFBP-3) in serum ............................. 141
Figure 9. IGF-I mRNA expression in mammary parenchymal tissue ............................ 142
Figure 10. IGF-I receptor mRN A expression in mammary parenchymal tissue ............ 143
CHAPTER FIVE

Figure 1. A proposed mechanism for why feeding a high energy diets to prepubertal

heifers impairs mammogenesis relative to body grth ................................................. 147
APPENDIX

Figure 1. Grams of fat-free parenchymal tissue relative to 100 kg fat-free carcass ........ 172
Figure 2. Estimate of fat-free parenchyma present at the onset of puberty ..................... 174
Figure 3. Serum leptin concentrations ............................................................................ 175
Figure 4. Serum IGF-I concentrations ............................................................................ 176
Figure 4. Representative autoradiograph of a western ligand blot ................................. 177
Figure 4. Abundance of IGFBP-3 in serum .................................................................... 178
Figure 5. Abundance of IGFBP-2 in serum .................................................................... 179

xiii

LIST OF ABBREVIATIONS

ADF = acid detergent fiber

ALS = acid labile subunit

AOAC = association of official analytical chemistry
ADG = average daily gain

BL = baseline

bST = bovine somatotropin

BrdU = bromodeoxyun'dine

BW = body weight

C = cubic

CP = crude protein

CW = carcass weight

DM = dry matter

DMI = dry matter intake

FBS = fetal bovine serum

FAR = fractional accretion rate

GAPDH = glyceraldehyde -3 — phosphate dehydrogenase
GLM = general linear model

GH = growth hormone

GHRH = growth hormone releasing hormone
IGF-I = insulin-like grth factor-I

IGFBP = insulin-like growth factor binding protein

xiv

L = linear

LS means = least square means

LH = luteinizing hormone

MAC-T = mammary alveolar cell large T-antigen
ME = metabolizable energy

NRC = National Research Council

NE... = net energy for maintenance

NEg = net energy for gain

NPY = neuropeptide Y

NDF = neutral detergent fiber

Ob-R = leptin receptor

Q = quadratic

RIA = radioirnmunoassay

RT-PCR = reverse transcription polymerase chain reaction
RDP = rumen degradable protein

RUP = rumen undegradable protein

SRIF = somatotropin releasing inhibitory factor
TMR = total mixed ration

TGF—Bl = transforming growth factor 431

Trt = treatment

XV

INTRODUCTION

Raising replacement heifers is costly for the producer and is estimated to be 20%
of total dairy herd expenses (Heinrichs, 1993). Growing heifers faster for earlier
breeding and calving can reduce these costs. However, feeding a high energy diet to
prepubertal heifers for gains of greater than 1 kg/d can impair mammary growth relative
to body growth and reduce subsequent milk yield (Radcliff et al., 2000; Sejrsen etal.,
1982). Since 1915, research studies have focused on understanding why high dietary
energy intakes impair mammary growth (Eckles, 1915).

The importance of understanding mammary gland development in heifers and
how this foundation for subsequent development and future milk yield can be affected by
factors during early life is the focus of many reviews (Akers, 1990; Sejrsen, 1994;
Tucker, 1981). The mammary gland is a unique organ because the epithelial tissue is still
rudimentary at birth, and its development can be influenced by management factors, such
as nutrition. The critical window for when high energy intake can negatively alter
mammary growth is from a few months of age until around the onset of puberty. During
this time, growth of the mammary gland is allometric, meaning that the rate of gland
growth is faster than that of body growth.

Studies with numerous designs have tested the effects of nutrition on mammary
growth. These studies include: 1) ad libitum versus restricted feeding of the same diet; 2)
diets differing in energy and protein content; 3) diets with varying levels of protein but
similar energy densities; and 4) diets with varying levels of rumen undegradable protein.

Results of most studies indicate that gains greater than 1 kg/d can impair mammary

growth relative to body growth. However, the influence of protein within the diet on
mammary growth is still not clear. Compensatory growth studies indicate that a stair-step
feeding regimen of alternating feed intake of heifers by 25 — 30% above
recommendations for 2 mo and 20 - 30% below recommendations for 3 to 5 mo in length
can positively affect lactation potential of heifers (Park et al., 1998). Whether this
influence on mammary growth is due to the stair-step regimen or due to a short time
period fed a high energy diet is not known. Data from younger heifers may indicate the
latter. For example, increasing the energy and protein intake in calves from 2 to 8 wk of
age resulted in an increase in body growth and nearly a doubling of mammary
parenchymal DNA (Brown et al., 2005a). Other studies have measured an increase in
milk production when heifers were fed for greater gains during the preweaning period
(Bar-Peled et al., 1997; Sharnay et al., 2005). Whether these positive results of feeding a
high energy diet to calves were due to the younger age of the animal or the short time
period fed this diet is not known. How a short duration (e. g. S 6 wk in length) of feeding
a high energy diet alters mammary growth in older prepubertal heifers is not known.
Several theories have been proposed to explain the nutritional impairment of
mammary growth, but the mechanism is still not understood. For example, Swanson
(1960) noted that twin heifers fed a high energy diet had undeveloped areas of
parenchyma, whereas the glands from control twins appeared normal. Mammary
parenchymal tissue accretion rates for heifers fed high or low energy diets were similar,
indicating that heifers fed a high energy diet may have a shortened allometric growth
phase because they reach puberty at a younger age (Meyer et al., 2004). When heifers

are fed high energy diets, serum growth hormone (GH) levels decrease, but serum

insulin-like growth factor-I (IGF-I) levels increase. This seems contradictory because
IGF-I is a known mitogen for mammary epithelial cells. No difference in mRNA
expression or concentration of IGF-I in the mammary gland was noted in prepubertal
heifers fed a high or low energy diet (Weber et al., 2000b). Specific binding of IGF-I to
mammary tissue was unaffected by feeding level (Purup et al., 1999). However,
mammary tissue explants from heifers fed a high energy diet were less sensitive to the
mitogenic activity of IGF-I compared to explants from heifers fed a low energy diet
(Purup et al., 1996). One explanation for this difference in sensitivity could be that
nutrition alters the number of IGF-I receptors. To my knowledge, studies analyzing
nutritional effects on IGF-I receptor mRN A expression and/or quantification of IGF-I
receptors in mammary epithelial cells have not been published.

In the last few years, our laboratory has focused on earlier observations of higher
amounts of mammary fat deposited within the mammary gland of heifers fed high energy
diets. Mammary tissue extracts from heifers fed a high compared to a low energy diet
were less mitogenic for mammary epithelial cells in vitro (Weber et al., 2000a). Also,
bovine mammary fat pad explants inhibited mammary epithelial cell proliferation in vitro
(McFadden and Cockrell, 1993). These results indicate that adipocytes may produce a
substance that inhibits mammary cell growth. Our laboratory’s working hypothesis is
that leptin, a protein produced by fat cells, may play a role in this inhibition. When
infused into the mammary gland of prepubertal heifers, leptin inhibited the IGF-I
stimulation of mammary growth (Silva et al., 2003). Whether protein concentration and
mRNA expression of leptin are increased in the mammary tissue of heifers fed a high

compared to a low energy diet is not known. Our current working model of the

mechanism by which high energy intake impairs mammary growth relative to body

growth is illustrated in Figure 1.

The objectives of this project were to determine the effects of feeding a high

energy diet to prepubertal heifers for longer durations (0, 3, 6, or 12 wk) on:

1)
2)
3)
4)
5)

6)

Body growth and carcass composition

Mammary growth and composition

Protein levels of IGF-I and IGFBP within serum

Messenger RNA expression of IGF-I and IGF-1 receptor in mammary tissue
Protein concentrations of leptin in serum and mammary tissue

Messenger RNA expression of leptin and leptin receptor in mammary tissue

The hypotheses were that:

1)

2)

Feeding a high energy diet for a short duration (3 or 6 wk) would increase the
grth of mammary parenchyma, but a long duration (12 wk) of feeding a
high energy diet would be detrimental to mammary growth relative to body
growth in prepubertal heifers.

Feeding a high energy diet would increase abundance of IGF-I and IGFBP-3
and decrease IGFBP-2 in serum, but would not change mRNA expression of
IGF-I in mammary tissue. Expression of IGF-I receptor mRNA in mammary
parenchymal tissue would decrease as heifers were fed a high energy diet for a

longer duration.

3) Feeding a high energy diet would increase leptin protein concentrations in
serum and mammary parenchymal tissue and mRN A expression of leptin in

mammary parenchymal tissue.

Body Growth
4

+

High Bl 0d T IGF-I Concentration
Energy __,
Intake T Leptin Concentration

i
_\‘ Mammary Parenchymal Tissue Growth

1 Leptin Concentration

T Leptin mRNA expression

H Leptin-R mRNA expression
H IGF-I mRN A expression

1 IGF-I-R mRNA expression

Figure 1. A proposed mechanism for why feeding a high energy diet to prepubertal
heifers impairs mammogenesis relative to body growth. Items not in italics are already
known, while those in italics are not known and the hypothesized effect of high energy
intake on these measurements is indicated.

CHAPTER ONE
LITERATURE REVIEW

Statement of Problem

The most important factors affecting heifer management decisions are economics
and how heifer growth will affect both reproduction and lactation performance (Hoffman
and Funk, 1992; Swanson, 1960). The cost of raising replacement heifers accounts for
approximately 20% of total dairy herd expenses (Heinrichs, 1993). Cost of raising
replacement heifers from birth to calving is between $1000 and $1300 per heifer (Cady
and Smith, 1996). Costs associated with raising replacements can be decreased if heifers
are bred at a younger age for earlier calving, thus decreasing the number of non-
productive days.

Heifers must be of adequate size for both reproductive purposes (minimizing
dystocia) and lactation potential (Hoffman and Funk, 1992). Research from the mid-
1970’s indicated that if heifers were of adequate size, the most economical age at first
calving was between 22.5 and 23.5 mo (Gill and Allaire, 1976). Recommendations for
heifers calving at 22 to 24 mo of age include a pre-calving body weight of 635 kg and
post-calving body weight of 570 kg, height of 56 in, and body condition score of 3.0 to
3.5 (V andehaar, 1998b). Meeting these recommendations for size at a younger age (20 to
21 mo) is achievable if heifers are fed a high energy diet allowing for rapid gains.
However, feeding heifers high energy diets for gains of greater than 1 kg/d impaired
mammary growth relative to body growth and decreased subsequent milk production

(Little and Kay, 1979; Petitclerc et al., 1999; Radcliff et al., 2000; Sejrsen et al., 1982;

Swanson, 1960). In addition, some researchers would argue that even gains of 0.8 to 1
kg/d are detrimental (Sejrsen et al., 2000).

The phenomenon of high energy intake impairing milk production was first
published 90 years ago (Eckles, 1915). Eckles noted that excessive fleshing of heifers
during the growing period might lower milk production. Although many studies have
been performed since Eckles’ work, there is still not a clear mechanism for why feeding a
high energy diet to prepubertal heifers can hamper mammary growth and reduce

subsequent milk yield.

Physiology of Mammary Development

During development of an embryo, a mammary line or ridge is formed from the
thickening of epithelial cells (Anderson, 1978). This ridge thickens to a hillock that
differentiates into buds that form pairs of glands. The bovine has two pairs of glands that
form in the inguinal area. The cells in this region differentiate into what will become the
mammary parenchyma. Mammary buds determine the number of glands and teats an
organism will have, corresponding to four in the bovine. These sprouts will later give
rise to the gland cistern and major ducts of each mammary gland. The mesenchyme (fat
pad) grows outwardly creating pressure that forms the shape of the teat. At birth, the
epithelial tissue is still rudimentary and the basic structures of the mammary gland are
present. The fat pad provides the space for future development, as the parenchymal
tissue grows into the fat pad in later stages during prepubertal development. The
periphery of the duct in the bovine gland is surrounded by connective tissue (Woodward

et al., 1993). During the prepubertal period, the fat pad and ducts that branch into it

undergo rapid growth, yet the alveoli are not yet formed. Alveoli are not formed until
conception (Tucker, 1987).

Mammary secretory cell numbers increase rapidly during gestation until the onset
of lactation (Tucker, 1981). During gestation, mammary ducts elongate, alveoli form,
and these replace lipid within the mammary fat pad (Tucker, 1969). Rate of increase in
the amount of mammary parenchymal tissue in a heifer is approximately 25% per month
during gestation (Swanson and Poffenbarger, 1979). There is a gradual loss of mammary
cells during the course of a lactation (Capuco et al., 2001). After peak lactation, the rate
of secretory cell atrophy becomes greater than cell division and milk yield begins to
decrease (Knight, 2000; Knight and Wilde, 1987).

Much of the recent research concludes that feeding prepubertal heifers a high
energy diet for gains of greater than 1 kg/d impairs mammary growth (Sejrsen et al.,
1982; Swanson, 1960). However, feeding postpubertal heifers a high energy diet results
in no detrimental effects on mammary growth (Harrison et al., 1983; Sejrsen et al., 1982).
Therefore, the critical window for nutritional effects on mammary development is during
the prepubertal period. During this time from approximately 3 mo until a few estrous
cycles past puberty, the mammary gland is growing at an allometric rate, meaning that
the gland is growing faster than the rest of the body (Sinha and Tucker, 1969). The
growth and development of the mammary gland in heifers is important, as the number of
mammary epithelial cells is a major factor limiting milk production (Tucker, 1981).
Mammary tissue DNA content was positively correlated (r = 0.85) to litter weight gain in
rats (Tucker, 1966). Mammary tissue DNA content from 5 mo-old heifers was also

positively correlated to milk yield (0 to 30—d; r = 0.21) and to mammary tissue DNA

 

collected at 60-d into first lactation (r = 0.25) (Tucker et al., 1973). The milk yield
potential is determined partially by the growth of the mammary gland prior to puberty
and during pregnancy (Sejrsen, 1994). This is why high energy diets fed during the
prepubertal period can have long-lasting detrimental effects on milk yield. At the end of
the allometric period, weight of mammary tissue is 2 to 3 kg, with 0.5 to 1 kg of this
being parenchymal tissue. This parenchyma consists of 10-20% epithelium, 40-50%
connective tissue, and 30-40% adipose tissue (Sejrsen etal., 1982).

Sinha and Tucker (1969) determined that in calves from birth until 2 mo of age,
the growth of the mammary gland occurs at the same rate as body growth, which is
referred to as isometric growth. The mechanism for the switch from isometric to
allometric mammary growth occurring at 2 to 3 mo of age is not known. More recent
evidence indicates that mammary growth rate was allometric by 100 kg BW and became
isometric shortly before puberty (Meyer et al., 2004). Only a small streak of
parenchymal tissue is evident at 1 mo of age, but growth of the mammary gland increases
60-fold by 90 d in calves (Akers etal., 2005). Therefore, recent studies indicate that the
allometric phase of mammary growth relative to body grth may occur earlier than
originally reported by Sinha and Tucker.

From approximately the third estrous cycle until pregnancy, the growth of the
mammary gland is isometric relative to growth of the rest of the body (Sinha and Tucker,
1969). Growth of the mammary gland within an estrous cycle occurs mainly around
estrus and is least during the luteal phase (Sinha and Tucker, 1969). The physiological
explanation for why the growth of the mammary gland deviates to an isometric rate

around puberty is unknown. However, Tucker (1981) suggested that it may be due to the

asynchronous secretion of estrogen and progesterone occurring at puberty. As puberty
approaches, luteinizing hormone (LH) pulse frequency increases, stimulating
development of large follicles and leading to an increase in estrogen production and
secretion. After puberty, secretion of progesterone is also thought to contribute to the
shift from the allometric to the isometric growth phase (Knight and Peaker, 1982).
However, Sejrsen (1994) suggested that termination of the allometric phase is
independent of ovarian secretions since heifers that had puberty permanently delayed
(immunized for gonadotropin-releasing hormone at 8 mo) had similar amounts of

mammary parenchyma as heifers that reached puberty at a normal age.

Length of Prepubertafleriod

One reason for why heifers fed a high energy diet have impaired mammary
grth may be due to a shorter period of accelerated mammary growth relative to body
growth. This allometric phase of mammary growth is concluded around the onset of
puberty. Body weight is a factor known to influence the onset of puberty, and the degree
of body fatness and serum leptin concentration may also play a role (Garcia et al., 2002;
Schillo et al., 1992). Dairy heifers typically reach puberty at about 55% of their mature
weight (NRC, 2001). On average, the onset of puberty occurs between 9 and 11 mo of
age and 250 to 280 kg BW in large dairy breeds. However, this age range varies
tremendously (Sejrsen, 1994). Reproductive development is more closely related to body
development than actual chronological age (Schillo et al., 1992). The main source of
within breed variation in age at pubertal onset is level of feeding (Schillo et al., 1992).
Heifers fed a high energy diet during the prepubertal period reached puberty at a younger

age than heifers fed a moderate or low energy diet (Schillo et al., 1992). Van Amburgh

10

and co-workers (1991) suggested that consumption of excess energy before puberty could
truncate parenchymal tissue growth because of a shorter period of allometric growth
relative to body growth. Rapidly grown heifers had less mammary parenchymal DNA
measured soon after puberty than moderate fed heifers (N iezen et al., 1996). In a recent
abstract, daily mammary parenchymal DNA accretion rate was not influenced by energy
intake, but heifers fed restricted energy diets had more mammary parenchymal DNA
content and less fat pad weight measured between 250 to 350 kg BW (Meyer et al.,
2004). Meyer et a1. suggested that the reduction in mammary parenchymal DNA
associated with high energy intake resulted from a shorter time to puberty instead of a
decrease in epithelial cell proliferation. However, one study (Silva et al., 2002b) has
analyzed age at puberty as a covariate to explain variation in mammary parenchymal
DNA and did not find a significant correlation using data from Whitlock et a1. (2002). It
would be helpful to test other datasets given that only one study was used to test this
relationship. That is, do early maturing heifers (irrespective of nutrition) produce less
milk during first lactation than later maturing heifers? In addition, the physiological
explanation for the switch from allometric to isometric growth and its relationship to
puberty has not been determined. Some have suggested that reproductive hormones play
a role in this development (Knight and Peaker, 1982; Tucker, 1981). Others have noted
that concentrations of serum IGFBP-3 and leptin increase until the onset of puberty in
heifers (Luna-Pinto and Cronge, 2000), but whether these factors play a direct role in the

switch from allometric to isometric phases is unknown.

11

Growth PattemL and Requirements of Daim Heifers

Growth is defined as an increase in tissue mass, either by hyperplasia (increase in
cell number) or hypertrophy (increase in cell size). Tissues grow and develop in a
sequence, starting with neural tissue, then bone, muscle, and adipose tissue (Owens et al.,
1993). This is why bone percentage decreases with age, muscle percentage increases
early until deposition of fat occurs, and fat percentage increases over time (Berg and
Butterfield, 1976). Deposition of fat typically occurs first around the kidneys, then
intermuscular, subcutaneous, and finally intramuscular areas (Owens et al., 1993).
Mature size is generally considered to be attained when muscle mass reaches a maximum
(Owens et al., 1993). Hyperplasia of muscle primarily occurs prenatally (Allen et al.,
1979). Postnatal growth of muscle mass is by hypertrophy and satellite cell replication
and incorporation, but the number of muscle fibers remains static (Goldspink, 1991).
Body weight from conception until mature size and carcass weight from birth through 2
yr of age plotted against age of the animal depicts a sigmoidal curve (Berg and
Butterfield, 1976; Owens et al., 1993). The point of inflection for carcass weight equaled
the time point of increased fat deposition in F riesian steers (Berg and Butterfield, 1976).
Age of an animal and the level of energy intake determine how dietary energy is
partitioned into protein or fat synthesis (Koch et al., 1979).

Mass of visceral organs varies in weight in proportion to nutrient energy intake
(Drouillard et al., 1991). As mass of the digestive tract and liver increases, an animal’s
maintenance energy requirements also increase. This may explain why maintenance
requirements decrease during feed restriction, because weight is decreased in organs that

typically undergo rapid cell turnover during re-feeding, such as the small intestine and

12

liver. For example, in compensatory growth studies, heifers are alternately fed at below
and above requirements (stair-step) or maintained at requirements. In these trials, the
stair-step managed heifers gain more body weight, consume less dry matter and therefore,
are more efficient compared to those maintained at requirement levels (Choi et al., 1997).
During the compensatory growth phase, the stair-step managed heifers have greater
gains, partly because of a lower maintenance requirement than control animals and also
due to weight reductions in the liver and intestine (Carstens et al., 1991).

Body growth of dairy heifers from birth to first calving has been measured in a
number of studies. For example, Kertz et al. (1998) estimated that 50% of the total
height increase occurred from birth to 6 mo of age, 25% from 7 to 12 mo of age, and 25%
from 13 to 24 mo of age. Approximately 25% of the total BW increase occurred from
birth to 6 mo of age, an additional 25% from 7 to 12 mo of age, and the remaining 50%
occurred from 13 to 24 mo of age. Feed cost per unit of gain and per unit of height
increase was lowest during the first 6 mo. A positive correlation exists between height at
the withers and first lactation milk yield (Heinrichs and Hargrove, 1987).

Nutritional requirements for dairy heifers at specific body weights and gaining at
3 different rates (0.6, 0.8, and 1.0 kg/d) are given in Table 1 adapted from the 2001
Nutrient Requirements of Dairy Cattle (NRC, 2001). Heifers with higher rates of gain
have greater energy and protein requirements for growth (Table 1). As weight gain
increases (e.g., 0.6 to 1.0 kg/d), energy proportion of the gain increases and protein
pr0portion of the gain decreases (NRC, 2001). This is because an increase in growth rate
is associated with a higher proportion of gain as fat. Since more fat is deposited at higher

rates of gain, the body content of ash, protein, and water is diluted.

l3

Few studies have been published that evaluate nutritional requirements of heifers
as outlined in the 2001 NRC (NRC, 2001). However, data from a number of previously
published studies were used by the NRC committee to evaluate equations for predicting
energy and protein requirements for growth (Fox et al., 1999; Garrett, 1980; Waldo et al.,
1997). A number of assumptions must be made using the new NRC. Requirements are
given assuming that heifers are equivalent to a body condition score of 3.0. The RUP
intestinal digestibility is estimated to be 67%. However, this value could be as low as
60% with mature forages or 75% with supplemental protein from concentrate sources.
With mature forage diets, RUP needed for metabolizable protein would need to be
increased by 10% and decreased by 10% for high concentrate diets. A potential problem
is that CP requirement may be underestimated. For example, the CP requirement
recommended by NRC for a large frame heifer weighing 200 kg and gaining l kg/d is
15.8%. Kertz and co-workers (1987) suggested that 3 to 6 mo old heifers gaining around
1 kg/d may require diets greater than 17% protein if fattening is a concern. Van
Amburgh (2005) suggested that the activity level and energy needs of grazing heifers
may be greater than recommended and that actual gains of non-grazing heifers are

typically higher than those predicted by the 2001 NRC model.

14

Table l. Nutritional Requirements for Dairy Heifers.

 

 

 

 

 

 

 

 

Mature Wt* Live BW during growth (kg)

650 kg Holstein 200 250 300 350 400 450 500
800 kg Holstein 246 308 369 431 493 554 616
SWG (kg/d)” NEg required (Meal/d)

0.6 1.34 1.58 1.81 2.03 2.25 2.46 2.66
0.7 1.83 2.17 2.48 2.79 3.08 3.37 3.64
1.0 2.34 2.77 3.17 3.56 3.94 4.30 4.65
SWG (kg/d) Net protein required for growth (g/d)

0.6 122 114 108 101 95 89 83
0.8 161 151 141 132 124 115 107
1.0 199 187 175 163 152 142 131
SWG (kg/d) Metabolizable protein required for growth (g/d)

0.6 182 183 185 187 190 194 199
0.8 241 241 243 245 248 253 259
1.0 299 299 300 302 305 310 316

 

Adapted from NRC, 2001

*Mature weights are full body weights

”swo = shrunk body weight (96% of full body weight)

15

 

Nutrition: Restricted Compared to Ad libitum Feeding

Nutritional studies have been performed to better explain how dietary
manipulation can have an effect on mammary growth in prepubertal heifers. Some
studies involved feeding of the same diet to both treatments, but restricted intake fed to
the heifers on the lower diet. Sejrsen and others (1982) fed a 60:40, concentrate to forage
ratio diet either ad libitum or restricted to 60% DMI. Daily gains were 613 and 1218 g
for the restricted and ad libitum groups, respectively. All heifers were slaughtered at 320
kg of body weight. Mammary parenchymal DNA content was reduced and mammary
adipose tissue weight was increased by ad libitum feeding. In another study (Petitclerc et
al., 1999), heifers were given a grass hay and concentrate diet fed for 700 g/d or for ad
libitum intake. Actual gains were 615 and 954 g/d for restricted and ad libitum groups,
respectively. Heifers started treatments at 6 wk and then were slaughtered at 4 mo of age.
After adjusting for BW at slaughter, amount of parenchymal tissue was reduced in heifers
fed for ad libitum intake. Milk production was 8% greater (305-d, fat corrected) in
heifers grown at standard rates compared to accelerated rates from 4.5 to 9.5 mo of age
(Lammers et al., 1999). In this study, heifers were fed the same diet with intakes
allowing for 0.7 and 1.0 kg/d of gain. These studies suggest that when heifers are
allowed to eat ad libitum and gain approximately 1.0 kg/d or greater they have impaired
mammary growth relative to body growth and decreased milk production compared to

heifers with restricted intake of the same diet.

16

Nutrition: Different Diet Composition

Other studies have fed two different diets resulting in a difference in energy and
protein concentrations of the diet and in daily intake amounts. During the prepubertal
period, Little and Kay (1979) fed a diet consisting of 80% rolled barley and 20% grain to
heifers for actual gains of or exceeding 1 kg/d. Heifers fed a low energy diet were grazed
during the summer with supplement or were fed a concentrate mix and hay during the
winter for gains of approximately 0.6 kg/d. Half of the heifers fed the high energy diet
were first mated at an average of 43 wk of age and weighed an average of 302 kg at
breeding. The other half of the rapidly reared heifers and all of the low fed heifers were
first mated at an average of 78 wk of age and averaged 443 and 353 kg BW, respectively.
Milk yield (305-d, fat corrected), during the first lactation was 58% and 97% higher for
the heifers fed the low energy diet than the rapidly reared heifers that were mated at 78
and 43 wk, respectively. Early age at calving and high energy intake significantly
reduced milk production during the first lactation. Radcliff and others (2000) fed a
standard diet of 10% grain and 90% haylage (16.3% CP; 0.6 Meal/kg NEg), while the
high energy diet consisted of 75% grain and 25% haylage (19.4% CP; 1.2 Mcal/kg NEg).
Heifers fed the standard and high energy diet gained 0.77 and 1.15 kg/d, respectively,
from 3 or 4 mo of age until confirmed pregnant. In the Radcliff study, standard fed
heifers produced 15% more milk (projected 305-d; P < 0.01) during their first lactation
than heifers fed the high energy diet. Prior to this study, Radcliff and co-workers (1997)
published a study with a similar design but measured mammary growth of heifers
slaughtered during the fifth estrous cycle after the onset of puberty. In that study, there

was no effect of diet on mammary parenchymal tissue mass, but high energy intake did

17

increase the amount of extraparenchymal fat. The authors suggested that high energy
intake may have not affected parenchymal mass due to the high level of protein (19.4%)
within the high energy ration. Other reports have noted a detrimental effect on mammary
growth when heifers were fed high energy diets with lower amounts of protein (Petitclerc
et al., 1984; Sejrsen et al., 1982). Radcliff concluded that high dietary protein intake
might overcome the negative effects of high dietary energy on mammary growth.
However, Radcliff and co-authors did not speculate on why there was a detrimental effect
of high energy diets on milk production but not on mammary development. In the milk
production study, heifers fed the high energy diet during the prepubertal period were only
11 mo old at first insemination, and gained less weight and lost body condition during
gestation compared to standard fed heifers. However, in a different study, slow growth
rates during gestation did not hamper milk production (Lacasse et al., 1993). In another
study, heifers gained 0.6, 0.8, or 1.0 kg/d during the prepubertal period (Van Amburgh et
al., 1998b). Post-treatment daily gain was greater for those heifers gaining 0.6 kg/d
during the treatment period and resulted in these heifers fed the low diet being larger in
BW at calving but less conditioned than heifers on a high plane of nutrition. Although
actual 305-d and fat corrected milk yields were reduced by high gains, postcalving BW
accounted for more variation in milk yield than prepubertal BW gain. Van Amburgh et
al. (1998b) suggested that postpubertal management may have impacted lactation yield
and that lighter postcalving BW could have an effect on DMI and nutrient partitioning for

growth during first lactation.

l8

Nutrition: Effect of Dietary Protein and Energy

Since mammary development and subsequent milk yield are not always both
decreased during high energy intake in heifers, other dietary components or management
factors may play a role in these discrepancies. VandeHaar (1998b) noted that one of
these factors may be the ratio of protein to energy in the diet. VandeHaar suggested that
feeding high protein diets (65 g CP/ Meal ME) could potentially reduce the detrimental
effect of feeding high energy diets on mammary development. To address the question
of high compared to low protein fed in conjunction with high energy diets, studies were
designed in which the ration was constant in energy but differed in protein
concentrations. Increasing CP:ME ratios in the diet (48, 59, 68, 77 g CP/ Mcal ME)
resulted in linear increases in feed efficiency and structural growth (Gabler and
Heinrichs, 2003). These measurements along with rate of gain and indirect measures of
mammary growth (change in teat length) were increased in prepubertal heifers fed diets
containing higher ratios of CP:ME (46, 54, and 61 g CP/ Mcal ME) from 200 to 341 kg
BW (Lammers and Heinrichs, 2000). But, measurement of teat length as an indirect
indicator of mammary growth is questionable (Whitlock et al., 2002). No differences in
weight of mammary parenchymal tissue or mammary fat were evident when rapidly
grown heifers were fed rations with CP:ME ratios of 48. l , 56.8, or 66.0 g CP/ Mcal ME
(Whitlock et al., 2002). In addition, no advantage in gains or skeletal grth with a
higher CP diet was evident in the Whitlock study. Further analysis using regression
predictions indicated that heifers reaching puberty early had less mammary parenchyma
if fed the low protein compared to high protein diet. Dobos et al. (2000) found that

heifers fed high CP diets (18.2%) had less mammary fat than heifers fed a low CP diet

19

(14.2%), but secretory tissue area and milk yield were not altered by dietary CP
concentration. In a fourth study, prepubertal heifers fed corn silage to gain 950 compared
to 725 g/d had lower amounts of mammary parenchymal DNA and RNA, whereas
mammary growth was not changed in heifers fed alfalfa silage to achieve different daily
gains (Capuco et al., 1995). No effect of rate of gain on milk production was evident
with either the corn or alfalfa silage diet. VandeHaar (1998a) noted that the difference in
mammary growth of heifers in the Capuco study that had accelerated versus restricted
gains on a corn silage diet could be due to the lower protein content of the corn silage diet
(54 g CP/ Mcal ME) compared to the alfalfa silage diet (83 g CP/ Mcal ME). Recent
evidence supports feeding of more dietary protein as heifers that were supplemented with
fish meal to supply 2% CP in the diet fed from 180 to 270 d of age had 5% greater fat-
corrected daily milk yield (Shamay et al., 2005). However, the standard diet contained
only 13.2% CP. High dietary protein compared to moderate levels of protein may be one
way to increase gains without causing impairment of mammary development, but overall
the data are inconclusive and more studies need to be performed to better understand how
dietary protein affects mammary development.

The amount of rumen undegradable protein included in the diet has also been
tested. The amount of by-pass protein included in the diet (rapeseed meal vs. urea) did
not affect mammary development when heifers gained between 0.65 and 0.90 kg/d
(Mantysaari et al., 1995). Capuco et al. (2004) fed heifers either a control diet of 14.9%
CP and 5.9% RUP or supplemented the diet with an additional 2% RUP (Capuco et al.,
2004). Mammary parenchymal DNA, Ki-67 labeling of epithelial cells, and lipid content

were not affected by RUP supplementation. Daily gains were between 0.90 and 1.07

20

kg/d and were significantly higher for RUP supplemented heifers, averaging 0.10 kg/d
higher than heifers on the control diet. Increasing the RUP content of the diet may be one
way to increase growth rates for earlier breeding without causing a detrimental effect on

mammary development.

Nutrition: High Energy Diets Fed for a Short Duration

Results of most studies indicate that feeding prepubertal heifers a high energy diet
to promote rapid gains is detrimental to mammary growth relative to body growth and
reduces subsequent milk production. Very few of these studies focused on the effects of
a high energy diet fed for a short duration on mammary growth. The shortest treatment
period discussed so far in this review was about 11 wk (Petitclerc et al., 1999), which
resulted in an impairment of mammary growth (adjusted for BW) when heifers were
allowed ad libitum intake for gains of approximately 1 kg/d. Most other published
studies involve treatment periods of 5 mo in length or longer. A question remaining is
how feeding prepubertal heifers a high energy diet for a short duration of time (_<_ 6 wk)
affects mammary growth.

Compensatory growth studies indicate that a stair-step feeding regimen of
alternating feed intake of heifers by 25 — 30% above recommendations for 2 mo and 20 —
30% below recommendations for 3 to 5 mo in length can positively affect the lactation
potential of heifers (Park et al., 1998). Whether this influence on mammary growth is a
result of the stair-step regimen or a short time period fed a high energy diet is not known.
Data from studies that evaluated different levels of energy intake during the preweaning
phase suggest the latter may be true, since these studies were performed for a short time

period. In one of these studies, calves were either allowed to suckle the dam 3 times a

21

day or were fed milk from a bucket for the first 6 wk of age. Calves allowed to suckle
had higher daily gains during the treatment period and also tended to produce more milk
during the first lactation (Bar-Peled et al., 1997). In a recent study, calves were either fed
milk replacer resulting in gains of 0.59 kg/d or given free access to whole milk for two
30-min intervals/day for gains of 0.88 kg/d (Shamay et al., 2005). Feeding whole milk to
calves affected BW but not skeletal size of the adult animal and increased milk yield by
4% during first lactation (daily 3.5% fat corrected; P < 0.01) compared to calves fed milk
replacer. In a more controlled study, calves were fed two types of milk replacer and
starter grain from 2 to 8 wk of age with gains of 0.38 and 0.67 kg/d for moderate and
high energy diet, respectively (Brown et al., 2005a). Calves fed the high energy diet
during this period had more fat-free tissue, DNA, and RNA in the mammary parenchyma,
but also had more extraparenchymal fat than calves fed the moderate diet. Calves not
slaughtered during the first period were fed either a low or high energy diet until 14 wk
of age during period 2. Diet during the second period did not alter amount of mammary
parenchyma. Results from the above studies show that increasing energy intake of calves
during the preweaning phase causes no detrimental effects on mammary growth and
subsequent milk yield, and may actually be beneficial to mammogenesis and future milk
production. These results differ from other studies that observe a detrimental effect of
high energy intake on mammary growth relative to body grth in older prepubertal
heifers. Whether these positive results of feeding a high energy diet to calves are due to
the younger age of the animal is not known. This differential response of high energy
intake on mammary development from preweaning to postweaning phases as seen in the

Brown study (2005a) and in studies using older heifers may be due to changes in the

22

growth of the mammary gland. The mammary gland grows at an isometric rate
compared to overall body growth during the first few mo of life and then switches to an
allometric rate until around puberty (Sinha and Tucker, 1969). Recent evidence indicates
that the mammary gland is undergoing allometric growth relative to body growth in
calves at 100 kg BW and the allometric phase ends shortly before puberty (Meyer et al.,
2004). The change in growth patterns from isometric to allometric rates coincides with
the time period when high energy intake impairs mammary growth relative to body
growth. In these preweaning period studies, heifer calves were also fed a high energy
diet for a shorter period of time compared to studies using older prepubertal heifers.
However, mammary tissue extracts from prepubertal heifers fed a high energy diet for
only 5 wk were less mitogenic than those from heifers fed a low energy diet (Berry et al.,
2003; Weber et al., 2000a). How a short duration (e.g. S 6 wk in length) of feeding a
high energy diet affects mammary growth in older prepubertal heifers has not been

published.

Bodv Fatness

Another idea that has evolved recently is the relationship between the degree of
body fatness and the impairment of mammary development and milk yield. Data
collected from 2 studies (Radcliff et al., 2000; Whitlock et al., 2002) were used to
identify factors accounting for variation in milk production and mammary growth (Silva
et al., 2002b). A significant covariate for milk production was body condition score at
breeding with prepubertal BW gain, gestational BW gain, postpartum BW gain,
postpartum BW, and BCS at calving within treatment also tested and not significant

covariates. A significant covariate for mammary parenchymal DNA was body fat

23

content at slaughter with BW at slaughter, age at puberty, prepubertal BW gain, and body
protein at slaughter also tested and not significant covariates. Results suggest that
increased body fatness may be a better indicator of impaired mammary growth than daily
gain. Obesity is also linked to impaired mammary development and lactogenesis in
rodents (Flint et al., 2005; Rasmussen et al., 2001). Whole mount analysis of mammary
tissue from pregnant mice showed abnormal ductal and alveolar development and less
parenchyma per unit area was evident in obese compared to lean mice (Flint et al., 2005).
Heifers fed high energy diets typically have an increase in fat deposition in
locations such as carcass, perirenal, and mammary extraparenchymal tissues (Radcliff,
1995; Swanson, 1960). Swanson (1960) noted that twin heifers fed a high energy diet
had undeveloped areas of parenchyma, whereas the glands from control twins appeared
normal. The growth of mammary epithelial cell organoids is inhibited when co-cultured
with bovine mammary fat pad explants (McFadden and Cockrell, 1993). This finding
suggests that mammary fat may secrete a factor that inhibits mammary epithelial cell
growth. Also, mammary tissue extracts were less mitogenic for mammary epithelial cells
in vitro from heifers fed a high compared to a low energy diet (Berry et al., 2003; Weber
et al., 2000a). The idea that high energy intake increases mammary fat, which might
secrete an inhibitory factor, has led our laboratory to further investigate potential factors
produced by adipose tissue that may inhibit mammary growth. Leptin, a protein mainly
produced by adipocytes (Chilliard et al., 2001), but also produced by bovine mammary
epithelial cells (Smith and Sheffield, 2002), was chosen as a candidate for further

research.

24

m

The lipostatic theory, proposed by Kennedy (1953), explains that energy balance,
body weight, and body composition in mammals are regulated by a hypothalamic
feedback loop whereby fat reserves control food intake and energy expenditure. Leptin, a
component of this system, has many fimctions including regulation of appetite, regulation
of energy expenditure, nutrient partitioning, hormone secretion, reproduction, immune
function, etc. (Chilliard et al., 2001). Leptin, a 16 kDa protein, was discovered over a
decade ago as the product of the ob gene (Zhang et al., 1994). In ob/ob mice, a mutation
occurs in the ob gene and causes these mice to be obese. This obesity was partially cured
when these ob/ob mice were parabiosed to lean mice (Hausberger, 1959).

Leptin regulation of energy homeostasis is mediated in the hypothalamus. Leptin
regulates the synthesis of neurotransmitters involved in food intake and secretion of
growth hormone from the pituitary (Carro etal., 1997). Leptin inhibited the synthesis of
neuropeptide Y (NPY), leading to a reduction in food intake (Erickson et al., 1996).
Intracerebroventricular infusions of leptin into ewes caused a reduction in appetite
(Henry et al., 1999). Regulators of leptin include proopiomelanocortin, melanocortin
stimulating hormone, and agouti-related peptide (Houseknecht and Portocarrero, 1998).
Leptin may also have a role in regulating the neuroendocrine mechanisms involved in the
partitioning of energy (Ahima and Flier, 2000). For example, when animals were fasted
or underfed, low plasma leptin supported the conservation of energy at the expense of
reproduction and immunity (Ahima and Flier, 2000).

Leptin mRNA expression is highly correlated to fat mass, adipocyte size, and

basal metabolic index (Houseknecht and Portocarrero, 1998). Plasma leptin

25

concentration was positively related to adiposity in growing and mature ruminants
(Blanche et al., 2000; Delavaud et al., 2000; Ingvartsen and Boisclair, 2001). Bull calves
(1 to 8 wk of age) fed for higher rates of gain had higher concentration of plasma leptin
and more body fat content than calves fed for lower gains (Block et al., 2003b; Ehrhardt
et al., 2000). This effect of energy intake on serum leptin in heifer calves was apparent
from 3 to 6 wk of age, but not apparent from 7 to 14 wk of age (Brown et al., 2005b).
Fasting for 48 hr lowered leptin gene expression in adipose tissue and concentration of
serum leptin in prepubertal beef heifers (Amstalden et al., 2000). In addition, the onset of
negative energy balance in lactating dairy cows either at parturition or induced by feed
restriction was associated with reduced plasma leptin and insulin and increased plasma
growth hormone (GH) concentrations (Block et al., 2001; Block et al., 2003a). Source of
fat within the diet (calcium salts of palm fat or conjugated linoleic acid) had no effect on
plasma leptin concentrations when prepubertal heifers were fed for gains of 1 kg/d (Block
eta1., 2003b). It remains to be seen whether dietary energy levels affect plasma leptin
and leptin expression in older prepubertal dairy heifers.

Leptin has been proposed as a signal that links body weight and adiposity to the
onset of puberty (Chehab, 2000). Plasma leptin remained fairly constant (2.3 ng/ml) until
about 1 yr of age in prepubertal dairy heifers at which point leptin increased until 400 d
of age (Block et al., 2003b). This age corresponds to the time when nutrients are being
increasingly partitioned to fat deposition instead of lean gain. These results may indicate
that leptin increased prior to puberty, but this was only true of heifers reaching puberty at
a later age (414 d) who were also heavier than those reaching puberty at an earlier age

(286 d). In another study, weekly serum leptin concentration and leptin expression in

26

adipose tissue of beef heifers increased from 16 wk prior until the onset of puberty
(Garcia et al., 2003; Garcia et al., 2002). Body weight accounted for the most variation
associated with onset of puberty, but leptin concentration was closely related to body
weight and without body weight in the model was most predictive of pubertal onset.

Our laboratory has recently performed experiments that provide evidence for
leptin as a candidate in mediating the inhibitory effect of high energy intake on mammary
growth. Leptin protein is present in bovine milk and is produced by a bovine mammary
epithelial cell line (MAC-T) (Smith and Sheffield, 2002). Bovine mammary epithelial
cells from prepubertal heifers and MAC-T cells express the long form of the leptin
receptor (Ob-Rb) but not the short form (Silva et al., 2002a). Physiological concentration
(2 — 6 ng/mL) of leptin inhibited IGF-I-stimulation and F BS-stirnulation of DNA
synthesis in MAC-T cells (Silva et al., 2002a). However, this inhibitory effect of leptin
on IGF-I action was not replicated in bovine primary epithelial cells isolated from
prepubertal heifers (Pump and Sejrsen, 2000). Intrarnammary infusion of leptin caused a
48% decrease in the stimulatory effects of IGF-I on Brd-U labeling of mammary
epithelial cells in prepubertal heifers (Silva et al., 2003). Intrarnammary infusion of
leptin also decreased Brd-U labeling of mammary epithelial cells by 19% in saline-
treated quarters. But, these concentrations used in vivo were supraphysiological, and it is
not known if a physiological level of leptin can inhibit mammary growth. Mammary
extracts fi'om heifers fed a high energy diet were less mitogenic than mammary extracts
from heifers fed a low energy diet when used as treatments with MAC-T and primary
bovine mammary epithelial cells (Berry et al., 2003; Weber et al., 2000a). These results

suggest that changes in growth factor concentrations in mammary parenchymal tissue are

27

at least partially modulated by feeding level. However, it is not known whether
prepubertal heifers fed a high energy diet compared to a moderate or low energy diet
have greater leptin gene expression and leptin protein levels in mammary tissue and if
this correlates to a decrease in mammary development.

Administration of GH to heifers increased daily gain and mammary parenchymal
DNA and RNA content without changing body composition (Radcliff et al., 1997).
Recent research indicated that GH may be a potential inhibitor of leptin within mammary
tissue. For example, GH treatment in vitro decreased leptin mRN A expression in bovine
mammary epithelial cells (Yonekura et al., 2005). Moreover, GH administration to
heifers fed a high energy diet decreased leptin mRNA expression in mammary I
parenchymal tissue compared to heifers fed a high energy diet and not treated with GH

(Lew et al., 2005).

Grth Hormone (GH) / In_sulin-lil_<e Growth Factor-1 (IGF-I) Axis

Older experiments have clearly demonstrated that growth hormone (also known
as somatotropin, bST) is required for normal mammary development (Forsyth, 1989;
Sejrsen, 1994). Exogenous administration of GH increased milk production in cows
(Peel and Bauman, 1987) and stimulated peri-pubertal mammary growth in sheep
(McFadden et al., 1990) and dairy heifers (Sandles and Peel, 1987; Sejrsen et al., 1986).
However, local infusion of GH into the mammary gland did not increase milk production
in sheep (McDowell and Hart, 1984) indicating that GH does not act directly on
mammary epithelial cells to stimulate milk production. Moreover, mammary tissue did
not bind GH, and GH did not stimulate cell proliferation in cultures of mammary

epithelial cells (Akers, 1985; Pump et al., 1993; Sejrsen, 1994). However, Glimm and

28

colleagues (1990) used molecular hybridization analysis to detect GH-R mRNA in
lactating bovine mammary tissue. In addition, GH-R mRNA was detected via Northern
blots in mammary tissue from prepubertal heifers and band density was not changed with
feeding level (Purup etal., 1999). The receptor gene may be transcribed but it is not
known whether the mRN A is translated.

Much evidence suggests that the effect of GH on the mammary gland is mediated
indirectly through the IGF-I system (Akers, 1985; Kleinberg, 1997; Sejrsen, 1994).
Insulin-like grth factor-I, a 7.6 kD protein, is primarily synthesized and secreted by the
liver when GH binds to hepatic GH receptors (Gluckrnan et al., 1987; Wong et al., 1989).
However, many tissues produce the IGF-I peptide including heart, lung, skeletal muscle,
and the gonads (D'Ercole et al., 1984). Vander Kooi et al. (1995) observed increases in
serum IGF-I concentration, hepatic IGF-I mRNA abundance, and serum IGFBP-3
abundance after intravenously infusing lactating cows with either GH or GH Releasing
Hormone (GHRH). A subcutaneous injection of GH in lactating dairy cows and goats
resulted in increased milk yield (Bauman and Vernon, 1993; Faulkner, 1999). A greater
increase of IGF-I in milk compared to plasma was noted and it was suggested that
changes in IGF-I concentrations within the mammary gland occur prior to the general
circulation (Faulkner, 1999). IGF-I (-/-) null mice had significantly less mammary
development than same age wild-type controls (Ruan and Kleinberg, 1999).
Administration of IGF-I, but not OH or estrogen, had a stimulatory effect on mammary
development in these null mice. Thus, even when GH is present, mammary development
is reduced unless IGF-I is present. IGF-I is a major mitogen for mammary epithelial cells

when infused into the mammary gland of cattle (Collier et al., 1993; Silva et al., 2005).

29

IGF-I treatment stimulated the growth of primary bovine (Shamay et al., 1988) and ovine
(Winder et al., 1989) mammary epithelial cells and MAC-T cells (Zhao et al., 1992).

Cell stimulation is caused by IGF-I binding to membrane receptors on secretory epithelial
cells and is detected as an increase in DNA synthesis in myoepithelial, ductal, and
alveolar epithelial cells (Baumrucker and Stemberger, 1989; McGrath etal., 1991).
Bovine mammary epithelial cells express IGF system receptors (IGF-I, -II, and insulin)
and do not produce IGF-I (Hadsell et al., 1990). IGF-I is produced in the stromal portion
of the mammary gland; therefore, a paracrine role for IGF-I action in the epithelium has
been suggested (Hauser et al., 1990). However, data from Hodgkinson and co-workers
(1991) suggests that blood is the major source of IGF-I in the mammary epithelium.
Weber and co-workers (1999) measured IGF-I concentrations in serum and extracts of
mammary tissue of heifers, finding averages of 107 ng/mL and 133 ng/ g, respectively.

In 1983, Sejrsen and others suggested that the negative influence of excess
feeding on mammary growth in prepubertal heifers might be associated with the decrease
in circulating GH concentration noted in these heifers. Mammary growth and milk
production are positively correlated with plasma concentration of GH (Bauman and
Vernon, 1993; Sejrsen et al., 1983). Serum concentration of IGF-I is generally increased,
not decreased as with GH, in steers and heifers fed for high rates of gain compared to low
rates of gain (Breier et al., 1986; Vestergaard et al., 1995). This high rate of body grth
in heifers is associated with decreased mammary development. Possible explanations for
why this contradiction occurs may be due to changes in the IGFBP profile, differences in I
sensitivity of mammary tissue to IGF-I, local numbers or binding capabilities of IGF-I

receptors, local production of IGF-I in the mammary gland, potential inhibition of IGF-I

30

stimulation via leptin (previously discussed) and/or another factor that has not been
elucidated.

Administration of somatotropin increased growth rate and decreased carcass fat in
beef steers (Moseley et al., 1992). Bovine somatotropin (bST) administration to heifers
caused an increase in mammary parenchymal tissue and a decrease in extraparenchymal
adipose tissue (Sejrsen et al., 1986). Other studies have also investigated whether bST
administration can lessen the negative effects of high energy intake on fat deposition and
mammary parenchymal development. Overall, injection of bST increased the content of
mammary parenchymal DNA, RNA, and the ratio of RNA: DNA (Radcliff et al., 1997).
Injection of bST also increased daily BW gain but had no effect on body condition or age
at puberty. Body weight and withers height taken at puberty were increased with
administration of bST. Using the same dietary treatments, Radcliff and co-workers
(2000) were unable to measure a difference in milk production in heifers fed high energy
diets and treated with or without bST. However, heifers fed the standard diet were
similar in milk production to heifers fed the high energy diet and treated with bST.
Heifers fed the standard diet gave 15% more milk (projected 305-d; P < 0.01) than
heifers fed the high energy diet without bST treatment. Therefore, injection of bST in
conjunction with feeding a high energy diet during the prepubertal period was able to
decrease age at calving (P < 0.01) without reducing milk production (Radcliff et al.,
2000). In a recent study with only 3 heifers per treatment for each age group, bST
administration gave no positive effects on prepubertal mammary growth (Capuco et al.,
2004), although ADG and skeletal growth were greater with bST injection and the weight

ratio of fatzparenchyma was decreased with bST treatment. Therefore, it may be possible

31

to use bST to negate the detrimental effect of feeding prepubertal heifers a high energy
diet on mammary growth and milk production.

Another reason for why high energy feeding decreases serum GH but increases
serum IGF-I concentrations could be due to a negative feedback mechanism (see Figure
1). GH-releasing hormone (GHRH) is produced by the hypothalamus and regulates the
amount of GH synthesized and secreted from the pituitary (Thissen et al., 1994). GH
secretion is controlled by both the stimulatory influence of GHRH and the inhibitory
effect of somatostatin (SRIF, somatotropin releasing inhibitory factor). In pituitary cells,
IGF-I inhibited the GHRH-stimulated GH secretion by 67%. High levels of circulating
IGF-I may provide a negative feedback mechanism by either decreasing the amount of
GHRH secreted or increasing the amount of SRIF secreted, thereby decreasing the

amount of GH synthesized and released from the pituitary (Ceda et al., 1987).

32

     

Hypothalamus

 
     
      
 

/

GHRH SRIF
+\APituitary K-
GH
Serum

Udder

IGF-I

 

IGF-I
IGF-I

 

IGF-I Receptor

 

Figure 1. Overview of Growth Hormone (GH) / Insulin-like Growth Factor-I (IGF-I)
axis. See text for description.

33

IGF Binding Protein_s (IGFBP)

The IGF-I ligand can be found in the circulation in three different forms. Little
free IGF-I is found in the circulation. Approximately 80% of all circulating IGF-I is
bound to IGFBP. Of this bound IGF-I, 80% is part of a 140-kD ternary complex, which
is formed by binding to the acid-labile subunit (ALS) and either IGFBP-3 or-5. The other
20% is bound to single binding proteins. These binary complexes are small enough to
cross the capillary endothelium, but the ternary complex is too large (Baxter, 1993).

The function of a labile pool of IGF-I in the circulation is to provide an available
source of IGF-I for delivery to target tissues. Regulation of this labile pool is through the
IGFBP. These multifunctional proteins have the capacity to both inhibit and enhance
IGF-I actions. The binding proteins assist in transporting IGF-I to target organs and
tissue via the blood stream. Binding proteins function to extend the half-life of IGF-I in
the circulation (mainly IGFBP-3 associating with the ALS), transport IGF-I from the
vasculature to tissues, and to localize IGF-I to specific target tissues and cells (Cohick,
1998). Binding proteins may act by inhibiting the bioactivity of IGF-I through
competition with receptors, interacting with other growth factors, or by acting
independently of IGF-I (Baumrucker and Erondu, 2000; Oh, 1998). Six high affinity BP
(IGFBP 1-6; (Keifer et al., 1991) and lower affinity IGFBP—related proteins (Hwa et al.,
1999) are able to bind to IGF and alter its activity. For example, addition of IGFBP-3
reduced the mitogenic activity of serum and IGF-1 treatments on mammary epithelial
cells (Weber et al., 1999). Addition of IGFBP-3 to basal media also inhibited DNA
synthesis in bovine mammary epithelial cells (Weber et al., 1999). Few studies have

indicated the effects of other IGFBP on the proliferation of bovine mammary epithelial

34

cells, thus their role in mammary epithelial cell growth is unclear. Bovine mammary
epithelial cells from pregnant and lactating cows synthesize IGFBP-2 (34-kD), IGFBP-3
(46 and 42-kD), IGFBP-4 (24-kD), and IGFBP-5 (30-kD) (Gibson et al., 1999).
Mammary tissue extracts from prepubertal heifers contained IGFBP-2 (32-kD), IGFBP-3
(40 to 43-kD), and IGFBP of 28-kD and 24-kD (putatively IGFBP-1 and -4) (Weber et
al., 2000b). IGFBP-3 constitutes the majority of IGFBP in the serum of heifers (McGrath
et al., 1991) and in bovine mammary tissue extracts (Weber et al., 2000b). It was
suggested that bioavailability of IGF-I to tissues is regulated by serum IGFBP levels,
whereas the IGF-I activity in mammary tissue is controlled by local IGFBP levels
(Lemozy et al., 1994).

Circulating levels of IGF-I change over the lifetime of a cow. Plasma
concentration of IGF-I is low in the newborn calf and rise following birth, increasing
from 50 to 450 ng/mL from 1 to 45 weeks of age (Skarr et al., 1994). The postnatal rise
in serum IGF-I is suggested to occur because of the maturation of the somatotropic axis
in the liver and the onset of GH-dependent IGF-I release (Cordano et al., 2000). It is
difficult to distinguish between the effect of nutrition and body size on IGF-I since there
is a positive correlation among ADG, BW, and IGF-1 concentration (Kerr et al., 1991).
Calves fed a high energy diet from 2 to 8 wk or from 8 to 14 wk of age compared to
calves fed a low or moderate diet had increased plasma IGF-I concentration (Brown et
al., 2005b). A similar response in serum IGF-I concentration to dietary intake was also
seen with older heifers in various studies (Petitclerc et al., 1999; Radcliff et al., 2004). In

adult cows, serum IGF-l concentration fluctuates depending on the physiological state of

35

the animal and is inversely related to milk production (Ronge et al., 1988; Vega et al.,
1991)

Abundance of serum IGFBP-3 and IGF-1 are generally decreased during feed
deprivation, while IGFBP-1 and IGFBP-2 are increased. It was suggested that the GH/
IGF-I axis is uncoupled during severe feed restriction and this restriction may even
abolish the ability of GH to increase IGF-I (Bauman, 1999). Two studies have
investigated how feeding level and bST administration regulate the expression and
concentration profiles of IGF-I and IGFBP in a number of tissues. These two studies
were similar in design, with heifers fed high or low energy diets and with or without
inclusion of bST treatment (Radcliff et al., 2004; Weber et al., 2000b), although the
treatment period was much shorter in the Weber study. Feeding heifers a high energy
diet resulted in an increase in liver IGF-I mRN A abundance and serum IGF-I
concentration (Radcliff et al., 2004). Administration of bST also increased IGF-I levels
in the serum and liver mRNA (Radcliff et al., 2004). High fed heifers had lower liver
IGFBP-2 mRNA abundance and serum IGFBP-2 compared to low fed heifers (Radcliff et
al., 2004). However, dietary treatments did not alter the expression or concentration of
IGFBP-3. Expression of IGFBP-2 and IGFBP-3 mRNA were unchanged in mammary
tissue from bST-treated heifers or high fed heifers (Weber et al., 2000b). High feeding
level reduced the expression of IGFBP-1 mRNA in the mammary gland. IGF-I mRNA
expression in mammary tissue was not influenced by nutrition. The combination of bST
administration and high feeding level increased IGF-I concentration in mammary tissue
extracts compared to other treatments. High feeding level decreased protein levels of

IGFBP-2 and increased the abundance of a 24-kD IGFBP in mammary tissue extracts.

36

Somatotropin tended to increase the abundance of IGFBP-3 in mammary tissue extracts.
In summary, high feeding level increased IGF-I concentration in the serum and IGF-I
mRNA expression in the liver but not in mammary tissue. Feeding level was capable of
altering the IGFBP expression profile within the mammary gland and in the liver.
Administration of bST increased both mRNA expression of IGF-I in the liver and serum
IGF-I concentration. Injection of bST had no effect on mRNA expression of IGF-I in
mammary tissue and concentration of IGF-I was only increased in mammary tissue

extracts when bST is used in combination with high energy intake.

Sensitivity of Mammary Tissue to IGF-I

Heifers fed high energy diets have impaired mammary growth relative to body
growth. Yet, high energy intake increases IGF-I, a known mammary mitogen, in serum
and mRN A expression in the liver of prepubertal heifers. This contradiction could be
explained by differences in receptor numbers or in the sensitivity of mammary tissue. In
addition, no diet-related change in the mRN A expression or concentration of IGF-I in the
mammary gland of prepubertal heifers were noted (Weber et al., 2000b). It is possible
that the negative effect of high energy intake on mammary growth may be due to
decreased sensitivity to IGF-I. A study using mammary tissue explants from prepubertal
heifers fed a high plane of nutrition showed a decrease in mammary sensitivity to IGF-I
treatment compared to explants from heifers fed a low plane of nutrition (Purup et al.,
1996). However, IGF-I and IGFBP are expressed and secreted by mammary tissue and
the IGFBP profile is modulated by feeding level (Weber et al., 2000b), so it is difficult to
determine if this difference in mitogenic response was due solely to differences in tissue

sensitivity. Another study indicated that specific binding of IGF-I to mammary

37

membranes was similar in mammary tissue from heifers fed a low and high energy diet
(Purup et al., 1999). Thus, the negative effect of high feeding level on mammary
development probably cannot be explained by changes in binding to IGF-I receptors.
However, serum IGF-I concentration was not different between dietary treatments in the
Purup study (Mantysaari et al., 1995; Pump et al., 1999), and differences in daily gain
were marginal (674 and 848 g/d). Further research is needed to more accurately
determine the influence of energy intake on IGF-I receptor binding parameters.

Another explanation of the negative effect of high energy feeding on mammary
growth could be that the number of IGF-I receptors is altered by nutritional modulation.
To my knowledge, studies analyzing IGF-I receptor expression and/or quantifying IGF-I
receptors in mammary epithelial cells in heifers fed different diets have not been

published.

Other Factors with a Potential Role in Nutritiongl Modulation of Mammary Growth

Expression of mRN A for all three forms of transforming growth factor-B (TGF-B)
were identified in the mammary gland of mature cows and in calves (Maier et al., 1991).
Physiologically, TGF ~01 has a biphasic response. That is, depending on the
concentrations used in cell culture, TGF-B1 can be either inhibitory or stimulatory to
mammary epithelial cell proliferation (Purup et al., 2000). Addition of 5 ng TGF-Bll mL
culture media inhibited the mitogenic response of IGF—I (50 ng/mL) in primary mammary
epithelial cells (Purup et al., 2000). When implanted into the mammary gland of
pregnant mice, 100 ng of TGF 431 completely inhibited ductal elongation and inhibited
DNA synthesis in the mammary epithelium (Daniel et al., 1989). Pump and co-workers

(2000) cited unpublished results by Plaut that serum concentration of TGF-Bl tended to

38

be higher in heifers fed at a high feeding level than at a moderate feeding level. The
significance of this finding is important because TGF-Bl is known to have an inhibitory
role in mammary development. Further research is needed to determine if TGF-Bl plays
a role in the detrimental effects of feeding prepubertal heifers a high energy diet on
mammary growth.

Beta-agonists are well known to increase muscle protein deposition and decrease
deposition of body lipid (Reeds and Mersmann, 1991). Examples of B-agonists include
cimaterol, clenbuterol, isoproterenol, L-644-969, ractopamine and salbutamol. Since
high energy intake increases fat deposition within the mammary gland and fat cells may
produce an inhibitory substance, decreasing lipid deposition could be a way to control
mammary growth. But when fi-agonists were given to prepubertal ewes, weight of the
mammary gland, fat-free parenchymal tissue, and parenchymal fat were all reduced
(Zhang et al., 1995). In addition, ewes treated with B-agonists tended to have 20% less

milk yield compared to control ewes.

Summm and Statement of Obiectives

Many factors and hormones regulate mammary development in prepubertal
heifers. One of the factors most studied is nutrition, yet the mechanism for why feeding
high energy diets impairs mammary growth relative to body growth is not clearly
understood. The effect of feeding postweaned dairy heifers a high energy diet for a short
time period (5 6 wk) has not been reported. The first objective of this study was to
evaluate if feeding a high energy diet for a short duration compared to a long duration

would result in a positive effect on mammary growth relative to body growth.

39

IGF-I is a known mitogen for mammary epithelial cells. Serum IGF-I
concentration is greater in heifers fed a high energy diet compared to heifers fed a low or
moderate energy diet. The mRNA expression of IGF-I within mammary tissue and IGF-1
concentration in mammary tissue extracts were similar in heifers fed a high compared to
a low energy diet (Weber et al., 2000b). Mammary explants from prepubertal heifers fed
a high plane of nutrition were less sensitive to IGF-I treatment compared to explants from
heifers fed a low plane of nutrition (Purup et al., 1996). This difference in sensitivity to
IGF-I suggests that the number of IGF-I receptors might be altered by nutritional
modulation and/or that a potential inhibitor of IGF-I could be more abundant in
mammary tissue of heifers fed a high energy diet. Leptin, a protein produced by both
adipocytes and mammary epithelial cells, can inhibit the IGF-I stimulation of mammary
growth. Serum leptin concentration is increased in calves and sheep fed a high energy
diet compared to a low energy diet. Yet, it is not known if prepubertal heifers fed a high
energy diet have a greater concentration of leptin and increased mRN A expression
abundance of leptin within the mammary tissue than heifers fed a low energy diet. A
second objective of this study was to determine the effects of feeding a high energy diet
to prepubertal dairy heifers for short and long durations on serum levels of IGF—I, IGFBP,
and leptin; leptin concentration in mammary parenchymal tissue; and mRN A expression

of IGF-I, IGF-I receptor, leptin, and leptin receptor in mammary parenchymal tissue.

40

CHAPTER TWO

EFFECT OF FEEDING A HIGH ENERGY DIET TO PREPUBERTAL HEIFERS FOR
A LONGER DURATION ON BODY GROWTH, CARCASS COMPOSITION, AND

FEED EFFICIENCY

ABSTRACT

Our objective was to determine the effects of feeding prepubertal dairy heifers a
high energy diet for a longer duration on body growth, body composition, and carcass
composition. We also used feed composition, daily intake, and body grth data to
evaluate the 2001 NRC for predicting intakes and gains. Holstein heifers (age = 11 wk;
BW = 107 i 1 kg) were assigned to 1 of 4 treatments (n = l6/trt) and fed 2 diets for
different durations of time: H0, H3, H6, and H12 were fed the low energy diet for 12, 9,
6, and 0 wk followed by the high energy diet for 0, 3, 6, and 12 wk, respectively. The
low energy diet was fed to achieve 0.6 kg average daily gain (ADG) and contained 0.72
Mcal NEE/kg, 16.3 % CP, and 46.1 % NDF. The high energy diet was fed to achieve 1.2
kg ADG and contained 1.17 Meal NEg/kg, 18.4 % CP, and 22.6 % NDF. Actual daily
gains averaged over the 12 wk treatment period were 0.64, 0.65, 0.83, and 1.09 kg for
H0, H3, H6, and H12, respectively. Daily gains during the last 2 wk of the treatment
period were 0.72, 1.05, 1.34, and 1.19 kg for H0, H3, H6, and H12, respectively. Body
weight, withers height, hip width, carcass weight, liver weight, and total carcass protein
and fat increased in heifers fed a high energy diet for a longer duration. Percentage of

carcass fat increased with a longer duration of feeding a high energy diet, but the opposite

41

was true for percentage of protein in the carcass. The efficiency of converting dietary
protein and energy into carcass protein and fat increased as heifers were fed the high
energy diet for longer durations. Evaluation of NRC indicated that the 2001 version
underestimated daily intake of the high energy diet and underestimated daily gain in
heifers fed both the high and low energy diets. The Spartan Dairy Ration
Evaluator/Balancer Program (Version 2.02b) underestimated daily intakes of both diets.
A more complete evaluation of NRC is needed to more clearly determine where
improvements should be made in heifer requirements and diet formulation. We conclude
that feeding a high energy diet for a short duration altered body growth and carcass
composition in a time-dependent linear manner consistent with feeding a high energy diet

for a long duration.

Key Words: heifer, nutrition, growth

Abbreviation Key: ADG = average daily gain; BL = baseline; BW = body weight; CP =
crude protein; CW = carcass weight; DMI = dry matter intake; ME = metabolizable
energy; NEg = net energy for gain; NEm = net energy for maintenance; NRC = National

Research Council; TMR = total mixed ration

INTRODUCTION

Raising replacement dairy heifers is costly and accounts for approximately 20%
of total dairy herd expenses (Heinrichs, 1993). Actual costs until calving range from
$1000 to $1300 per heifer (Cady and Smith, 1996). Feeding a high energy diet to allow

for rapid growth enables heifers to be bred and calve earlier, potentially reducing costs

42

associated with raising replacement heifers. The optimal BW of heifers before calving
ranges from 590 to 640 kg (Hoffman, 1997; Keown and Everett, 1986) and can be
reached as early as 19 to 20 mo of age if gains average approximately 1 kg/d. However,
mammary growth relative to body growth and milk yield potential are reduced when
heifers that are approximately 3 to 10 mo of age are fed a high energy diet for periods of
12 wk or longer (Petitclerc et al., 1999; Radcliff et al., 2000; Sejrsen et al., 1982).
Feeding heifers for rapid gains also increases the amount of fat deposited within the
body, carcass, and mammary gland.

A positive correlation exists between height at the withers at parturition and first
lactation milk production, and it was estimated that 50% of the total height increase from
birth to first calving occurred during the first 6 mo (Heinrichs and Hargrove, 1987; Kertz
et al., 1998). A high plane of nutrition increased skeletal growth in young heifers (Brown
et al., 2005b; Shamay et al., 2005) and in older heifers when measured at a similar age
(Lammers etal., 1999). However, increasing daily gains of heifers does not seem to alter
frame height and width (Radcliff et al., 1997) when measured near the onset of puberty at
similar body weights.

Restricting the energy intake of heifers may improve mammary growth, but it also
delays puberty and increases the number of non-productive days. However, heifers that
are fed according to a stair-step regime grow similar to heifers raised on a continuous
moderate diet, have minimal delay in the onset of puberty, and produce more milk (Park
et al., 1987; Peri et al., 1993). A stair-step feeding regime involves alternating between
high energy diets fed for periods of 2 mo in length and energy restricted diets fed for 3

mo or longer (Choi et al., 1997; Park et al., 1998). These stair-step managed heifers have

43

improved efficiency of growth, dietary energy, and dietary protein compared with control
heifers (Park et al., 1987). Therefore, feeding heifers a high energy diet for a short
duration may be one way to decrease age at first calving without causing detrimental
effects on mammary parenchymal tissue growth.

Body composition of beef steers slaughtered at the end of a compensatory growth
period was similar to steers fed a control diet (Carstens et al., 1991; Fox et al., 1972).
However, steers undergoing compensatory growth deposit more protein and less fat than
controls during the early portion of the compensatory growth phase (Fox et al., 1972).
Although carcass composition data of dairy heifers undergoing compensatory growth is
lacking, Holstein heifers have a similar percentage of empty body fat at the same body
weight as Angus steers (Fox and Black, 1984). Fat deposition is usually not dramatically
increased until approximately 12 mo of age (Berg and Butterfield, 1976). Therefore,
feeding young heifers a high energy diet for a short duration following low energy intake
may be one way to feed heifers for rapid gains without an increase in fat deposition.

Many academic and industry professionals use the NRC Nutrient Requirements of
Dairy Cattle (NRC, 2001) as a reference for nutrient analysis, nutrient utilization of the
animal, and diet formulation. Few studies have been published that perform a
comprehensive evaluation of the growth equations used in NRC (Van Amburgh et al.,
1998a) and only one heifer study has briefly evaluated the 2001 edition of NRC (Gabler
and Heinrichs, 2003). Van Amburgh (2005) suggested that actual gains of heifers are
typically higher than those predicted by the model.

Our objective was to determine how feeding prepubertal dairy heifers a high

energy diet for a short duration compared to a low duration affects body growth, carcass

44

composition, and mammary growth. Prior studies that involved treatment periods of 12
wk or greater indicated a detrimental effect of high energy intake on mammary growth
relative to body growth. Thus, we selected 12 wk as our long duration time point, 6 and
3 wk as our shorter duration time points, and 0 wk of feeding a high energy diet as our
base control treatment. Treatment effects on mammary growth in these heifers are
reported in Chapter 3. We also evaluated the 2001 NRC predictions for intakes and gains

of heifers using growth and diet composition data from this trial.

MATERIALS AND METHODS

Animals and Dietary Treatments

All procedures were approved by the Michigan State University Animal Use and
Care Committee. Sixty-eight Holstein heifers (approximate age = 8 wk) were purchased
during 4 consecutive wk in the fall (17 heifers/wk) with each wk classified as a separate
purchase group. Heifers were housed at the Michigan State University Beef Cattle
Research Center and were exposed to ambient temperatures and lighting during the
adaptation and treatment periods, which occurred during late fall and winter. Heifers
were housed in an open-sided barn with enough space per pen (dimensions: 14 X 38 ft) to
allow for exercise. Each purchase group was allowed a 3-wk adaptation period for
adjustment to facilities and diet. During this adaptation period, heifers were gradually
transitioned from a diet similar to that fed before purchase to a total mixed ration (T MR)
similar to a mixture of the treatment diets. At the beginning of the adaptation period,

heifers were fed a texturized complete feed (21% CP, ADM Alliance Nutrition, Quincy,

45

IL) and alfalfa hay. Alfalfa silage, oatlage, straw, and corn silage were slowly introduced
into the diet during the adaptation period. One heifer within each purchase group was
randomly selected and slaughtered at 11 wk of age for baseline (BL) measurements used
for calculation of carcass accretion rate data.

During the first wk of the adaptation period, body temperatures were taken daily
and then only if heifers appeared ill (lethargic appearance, nasal discharge, labored
breathing, or coughing). Heifers were treated if body temperatures were greater than
39.7°C, appeared ill, or were lame. Various medications [Nuflor (Schering-Plough),
Micotil (Elanco), Recovr (Fort Dodge), A-l80 (Pfizer), LA-200 (Pfizer), Excenel
(Pfizer)] were used depending on the signs (see Appendix) and previous treatments.
During the second week of the adaptation period, heifers were vaccinated against bovine
rhinotracheitis, bovine virus diarrhea, parainfluenza type 3, and leptospirosis
(BoviShield4, Pfizer); pasteurella (Pfizer); and clostridium perfiingens
(U ltrabac7/Somubac, Pfizer). No animals died during the adaptation or treatment
periods. A total of 6 heifers appeared ill and were medicated during the treatment period.
One heifer (trt = H3) had chronic bloat and the other 5 heifers were treated once for
respiratory-type symptoms (H0 = 1; H3 = 2; H6 = 2; H12 = 0). All heifers given
medication were being fed the low energy diet at the time of apparent illness.

At 11 wk of age (BW = 107 i 1 kg), 16 heifers within each purchase group were
blocked by body weight and randomly assigned within block to 1 of 4 treatments. All
heifers within a given treatment in the same purchase group were housed in the same pen.
Thus, 4 pens of 4 heifers (l pen per purchase group) were used in each of the 4

treatments. A timeline for the experiment is depicted in Figure 1. The treatment period

46

lasted 12 wk and treatments were as follows: H0 (low energy diet fed for 12 wk); H3
(low energy diet fed for 9 wk followed by high energy diet for 3 wk); H6 (low energy
diet fed for 6 wk followed by high energy diet for 6 wk); and H12 Grigh energy diet for
12 wk). The low energy diet was fed to achieve 0.6 kg average daily gain (ADG) and
consisted of 10% straw, 33% mature alfalfa silage, 33% oatlage, and 24% concentrate on
a DM basis. The low energy diet had 0.77 Mcal NEg/kg DM, 16.4% CP, and 43.6%
NDF. The high energy diet was fed to achieve 1.2 kg ADG and consisted of 20%
immature alfalfa silage, 20% corn silage, and 60% concentrate on a DM basis. The high
energy diet had 1.17 Mcal NEg/kg DM, 18.4% CP, and 22.6% NDF. Both diets and
water were available ad libitum. Composition of diets based on actual individual
feedstuff analyses (Dairy One Forage Analysis Laboratory, Ithaca, NY) is given in Table
1. Sodium decoquinate (Deccox®, Alpharma, Fort Lee, NJ) was included in both
vitamin/mineral mixes as a coccidiostat to supply approximately 0.5 mg/kg of BW/d.
Diets were fed as a TMR once daily between 0900 and 0930 h and refusals were
measured daily at 0700 h. Amount of TMR fed was adjusted so that daily refirsals were
approximately 10%. Daily intakes for each pen were collected and are reported as an
average per heifer (Figure 4).

During the treatment period, body weight was measured weekly before feeding.
Withers height and hip width were measured initially before treatments began and then
on odd wk and on wk 12 of the treatment period. Heifers were slaughtered at the end of
the treatment period when heifers were 23 wk of age. Heifers were allowed to consume
the TMR from the prior day’s feeding until they were transported at 0600 h via trailer to

the abattoir at the Michigan State University Meats laboratory.

47

Evaluation of NRC

Diet composition, dry matter intake, and daily gains of heifers from the H0 and
H12 treatment groups were used to evaluate actual versus predicted values for intakes
and gains according to the NRC (NRC, 2001). Treatment groups H3 and H6 were not
included due to the short duration of time in which heifers received the low or high diet.
Time is required to diminish the carry—over effect of the previous diet on variables
measured; therefore inaccurate comparisons of actual versus predicted measurements

may have occurred if data from H3 and H6 had been used.

Tissue Collection

Heifers were weighed, stunned by captive bolt, and killed by exsanguination.
Heifers were killed on 2 different days each wk for 4 consecutive wk with 8 heifers (2/trt)
killed per day. The gallbladder was removed from the liver and the liver was weighed.
Four heifers on the H12 treatment had liver abscesses and these livers were condemned at
slaughter. Liver abscesses were likely due to acidosis caused by the high grain diet
(Nagaraja and Chengappa, 1998). Also, 2 heifers on the H6 treatment had “sawdust
liver” or Telaniectasis. After the hide was removed, the carcass was split into halves and
weighed (CW). Perirenal fat was removed from both sides of the carcass and weighed.
The day after slaughter, the left half of the carcass was cut between the 7th and 8th and the
12th and 13th ribs. The 8th through 12th rib section was removed and stored at -20°C until
composition was analyzed.

Reproductive tracts were examined to confirm that heifers were not freemartins
and had not reached puberty. The uterus and ovaries were removed and weighed. One

heifer (trt = H3) was a freemartin and her data were eliminated from the results. Another

48

heifer (trt = H12) was confirmed postpubertal after a corpus lutem was detected and her
data were removed from the study. Uterine and ovarian weights, along with liver,
perirenal fat, and carcass weights, were taken to determine how short and long durations
of high energy intake alter growth of various tissues. These measurements were then also
compared to the growth of mammary tissue in prepubertal dairy heifers fed a high energy

diet for a longer duration (see Chapter 3).

Estimated Carcass Composition

The rib section containing the 8th through the 12th rib section was slightly thawed.
The 9, 10 and 11 ribs were then dissected according to Hankins (1946) and weighed. The
soft tissue was dissected from the bone and put into separate piles and then weighed. The
soft tissue was then ground, mixed, and subsampled. The tissue was stored at -20°C until
fat, protein, and water content was analyzed. Fat was determined by Soxhlet ether
extraction (AOAC, 1990). Crude protein was determined using the method of Hach et al.
(1987). Water was determined as the difference in weight after drying samples in 3

106°C oven for 24 h.

Statistical Analysis

Statistical analysis used the PROC GLM procedure of SAS. Pen (11 = 4 heifers
per treatment in each purchase group) was used as the experimental unit with purchase
group as a random variable and treatment" purchase group as the error term.
Comparisons were tested using a linear (L) contrast with coefficients -7, -3, 1, and 9; a
quadratic (Q) contrast with coefficients 7, 4, -8, and 5; and a cubic (C) contrast with

coefficients 3, 8, -6, and 1 for H0, H3, H6, and H12, respectively. Least square means

49

 

and standard errors of the mean are presented. Differences were declared to be
statistically significant at P < 0.05 and tendencies at P < 0.10. All data from the 2 heifers
that were eliminated from the trial were removed so that final animal numbers were 16,
15, 16, and 15 for treatment groups H0, H3, H6, and H12, respectively.

Data that were collected every wk or every other wk were treated as a repeated
measure and analyzed using PROC MD(ED with either compound symmetry or first-
order autoregressive as the covariance structure. The data for ME consumed, carcass
protein percent, amount of carcass fat, ovarian weight relative to BW, and ovarian weight
relative to CW were log transformed to achieve homogeneous variance and normality and
the results presented were back transformed. The error term for the transformed data is
the average of the back transformed lower and upper 68% confidence intervals. Non-

transformed means are presented in the Appendix.

RESULTS

Initial BW was not different between treatments (Table 3; all contrasts: P > 0.10).

Body weights averaged during the treatment period were significant for both a linear and
quadratic response as heifers were fed the high energy diet for a longer duration (Figure
2; L: P < 0.01; Q: P = 0.02). Ending BW averaged 165, 167, 181, and 203 kg for H0,
H3, H6, and H12 respectively, and was significant for linear, quadratic, and cubic
contrasts (all contrasts: P < 0.01). Daily gain averaged during the treatment period
increased as heifers were fed the high energy diet for a longer duration (Figure 3; Table

3; L: P < 0.01), but also was significant for quadratic and cubic contrasts (P < 0.01).

During the entire treatment period, daily gain averaged 0.64, 0.65, 0.83, and 1.09 kg for

50

H0, H3, H6, and H12, respectively. Thus, 0.64 kg/d for the low energy diet and 1.09
kg/d for the high energy diet were very close to the 0.6 and 1.2 kg daily gain formulated
for within the diets. Average daily gain during the last 2 wk was also significant for all 3
contrasts tested and averaged 0.72, 1.05, 1.34, and 1.19 kg for H0, H3, H6, and H12,
respectively (Table 3; P < 0.01). There was a delay of 1 wk in the increase in daily gain
after the switch to the high energy diet for both H3 and H6 treatments. Gains calculated
during the 2"d and 3rd week after the dietary switch for H6 and H3 were 1.22 and 1.05
g/d, respectively (Table 4). The H3 treatment group never reached the target gain of 1.2
kg/d on the high energy diet. However, there was no delay in daily gain of the H12
treatment when switched to the high energy diet from the adaptation diet.

Average daily DMI increased with a longer duration fed the high energy diet
(Figure 4; L: P < 0.01). There was an increase in daily DMI until wk 4 of the treatment
period. After wk 4, feed consumption was fairly constant for H0 and H12 heifers and
increased for H3 and H6 heifers when switched to the high energy diet (Table 4). Daily
DMI was also adjusted for BW (Figure 5) and averaged 2.79, 2.99, 3.03, and 3.29 kg/ 100
kg for H0, H3, H6, and H12, respectively (SE = 0.07; L: P < 0.01).

Initial withers height and hip width were not different among treatment groups
(Table 3; all contrasts: P > 0.4). Hip width and withers height measurements increased
with age (Figure 6 and 7) and showed a linear increase with a longer duration fed the
high energy diet when measured during the last 2 wk of the treatment period (Table 3.; L:
P < 0.01). Although significant for a linear increase, the nominal difference between H0
and H12 treatments at the end of the treatment period in withers height and hip width was

5 cm and 4 cm, respectively.

51

The amount of CP consumed averaged 616, 679, 737, and 932 g/d for H0, H3,
H6, and H12, respectively (SE = 15; L: P < 0.01), and is depicted per week in Figure 8.
Consumption of CP increased for H3 and H6 when switched to the high energy diet
(Table 4). The amount of ME consumed averaged 7.67, 8.64, 10.00, and 14.41 Meal/d
for H0, H3, H6, and H12, respectively (confidence interval = 0.20, 0.22, 0.26, and 0.37
for H0, H3, H6, and H12; L: P < 0.01) and followed a similar pattern per week as CP
(Figure 9). Efficiency of protein and energy deposition were calculated using daily
accretion rates of carcass protein and carcass fat as a percentage of dietary consumption
of protein and energy (Table 4). Efficiency of both protein and energy deposition
increased in a linear manner with a longer duration fed the high energy diet. Energy
efficiency was also significant for a quadratic response due to similarities between H6
and H12 (P < 0.01).

Carcass weight increased in a linear fashion as heifers were fed the high energy
diet for a longer duration (Table 5; L: P < 0.01). But, BW at slaughter was significant for
all 3 contrasts (Table 3). There was a lack of a BW difference between the H0 and H3
treatment groups. Carcass weight expressed as a percentage of live BW was significant
for both linear and quadratic contrasts (P < 0.01). Total amounts of estimated carcass
protein and fat unadjusted and adjusted for BW increased with a longer duration fed the
high energy diet (Table 5; Figure 11; L: P < 0.01). Similarly, a longer duration fed the
high energy diet increased the percentage of fat in the carcass, but the percentage of
protein in the carcass decreased (L: P < 0.01). Percentage of carcass fat was also
significant for a quadratic effect (Q: P < 0.01) due to a small difference in means for H6

and H12 treatments. Relative to baseline measurements, percentage of carcass fat

52

increased and percentage of carcass protein decreased with age (Table 5). Fat-free
carcass weight increased in a linear manner and also had a tendency for a quadratic
relationship because of the large amount of fat-free carcass of the H12 treatment (L: P <
0.01; Q: P = 0.08). Daily accretion rates for carcass fat and carcass protein both
increased in a linear manner as heifers were fed a high energy diet for a longer duration
(Figure 10; P < 0.01).

Liver weight increased in a linear fashion with a longer duration fed a high energy
diet and also was quadratic and cubic (Table 5; P = 0.01) due to the biggest difference
between H0 and H3 and similar results for H3 and H6. Liver weight as a proportion of
BW was significant for all 3 contrasts (P = 0.01) and this was due to the large adjusted
liver weight of the H3 treatment. The amount of perirenal fat unadjusted and adjusted for
BW increased in a linear fashion with time fed the high energy diet (L: P < 0.01).

Uterine and ovarian weights unadjusted and adjusted for BW and CW are
presented in Table 6. There was a significant cubic contrast for uterine weight (C: P =
0.05). When adjusted for CW and BW, uterine weight was significant for a cubic
contrast due to the large uterine weight for the H3 treatment (C: P = 0.03 and P = 0.04,
respectively). Uterine weight adjusted for carcass weight also decreased in a linear
response as heifers were fed the high energy diet for a longer duration of time (L: P =
0.04). Ovarian weight was not significant for any contrasts (all contrasts: P > 0.10).
However, when adjusted for BW and CW, ovarian weight decreased as heifers were fed
the high energy diet for a longer duration (L: P = 0.02 and P < 0.01 , respectively).
Uterine and ovarian weights were also combined and mimicked the response of uterine

weight alone. Although follicles were quite large on some ovaries (12 to 15 mm; Davis

53

Rincker and Kobayashi, observation), the number of follicles and the diameter of follicles
were not calculated.

Predicted values for intake and gains by NRC relative to actual values are
depicted in Table 7. The Spartan Dairy Ration Evaluator/Balancer Program
underestimated daily intakes by 2.91% for the low diet and 28.2% for the high diet. The
2001 version of NRC underestimated daily intakes by 19.3% for the low diet and 28.4%
for the high diet. Daily gains, using actual intake data, were underestimated by 31.3% for

the low diet and 5.5% for the high diet using the 2001 NRC.

DISCUSSION

A number of researchers (Petitclerc et al., 1984; Vestergaard et al., 2003) have
observed an increase in carcass weight and body weight when heifers are fed a high
energy diet for rapid gains. In this study both carcass and body weights increased in a
linear manner as heifers were fed a high energy diet for a longer duration. However,
body weight at slaughter was also significant for quadratic and cubic contrasts. There
was a lack of a BW difference between the H0 and H3 treatment groups at slaughter and
this was likely because of the increased gut fill of heifers fed the low energy diet (see
Figure 12). Empty body weights were not taken, but would have likely been lower for
the H0 compared to H3 treatment group.

Previous studies (Ferrell et al., 1978; Petitclerc et al., 1984) noted that at similar
body weights, cattle fed on a higher plane of nutrition will have increased fat storage,
which was the case in this study when carcass fat and perirenal fat were adjusted to BW.

The amount of carcass fat and percentage of fat within the carcass both increased as

54

heifers were fed a high energy diet for a longer duration. Similar results were shown by
Petitclerc et al. (1984) and Waldo et al. (1997). However, this is the first study to
demonstrate the short term effects of nutrition on body growth and carcass composition
of prepubertal dairy heifers. The linear increase in carcass fat and perirenal fat observed
in this study as heifers were fed a high energy diet for a longer duration may be a concern
for the future performance of heifers fed for rapid gains. Recent evidence indicated that
the degree of body fatness is negatively correlated with mammary parenchymal DNA and
milk production (Silva et al., 2002b).

In evaluating nutritional impacts on heifer performance it is critical to not only
analyze the effects on body weight and body composition but also on skeletal growth.
Heifers in this study started treatments at 11 wk of age and were slaughtered at 23 wk of
age. It is estimated that 50% of the height gain from birth to calving occurs in the time
period from birth until 6 mo of age, while only 25% of the body weight gain occurs
during the first 6 mo (Kertz et al., 1998). Withers height measured at 24 mo is positively
correlated with first lactation milk yield in Holsteins (Heinrichs and Hargrove, 1987).
Previous reports demonstrated that increasing the energy intake of young heifers can
increase the daily gain of frame height and width (Lammers et al., 1999; Pirlo et al.,
1997), similar to findings of this study. However, dietary intake did not affect growth
measurements taken at the onset of puberty (N iezen et al., 1996). Measurements of body
weight and withers height of heifers in the present study were within the range of
previous reports for heifers of a similar age (Heinrichs and Hargrove, 1987; Hoffman,
1997), except that H12 heifers were heavier than the range reported for 5 to 6 mo-old

heifers.

55

Compensatory growth studies using heifers and steers indicate that this type of
feeding can be beneficial to mammary development (Choi et al., 1997) and lean body
growth during the early phase (Fox et al., 1972). However, heifers on treatment H3 and
H6 did not seem to experience compensatory growth and deposited body fat in a time-
dependent manner similar to the H12 treatment. Kabbali et al. (1992) noted that feeding
a high energy diet after a moderate diet did not have a compensatory effect in sheep while
feeding a high energy diet following a low energy diet yielded higher gains and more
efficient feed conversion compared to continuously high fed controls. Carcasses fiom
steers fed at maintenance and then full fed compared to full fed control steers were higher
in protein and lower in fat when harvested at similar body weights (364 kg) during the
early refeeding period, but were similar in composition at final slaughter weights (454
kg) (Fox et al., 1972). Fox and co-workers suggested that steers deposit lean gain during
the early compensatory growth period. The low energy diet fed in the present study may
have not been low enough to yield compensatory results after 3 and 6 wk fed the high
energy diet. Body weight differences between H6 and H12 treatment groups were steady
at 26 to 27 kg from wk 8 to wk 12 (see Figure 1) indicating no compensatory gain in H6
heifers. Although accretion rate of carcass protein increased linearly with a longer
duration fed the high energy diet, accretion rate of carcass fat also increased with time fed
the high diet.

In the present study, the weight of the liver increased in a linear fashion with time
fed the high energy diet. Liver weight was also significant for quadratic and cubic
contrasts due to similar values for H3, H6, and H12. However, liver weight expressed as

a percentage of body weight was highest for heifers on the H3 treatment, followed by H6,

56

H12, and H0. These results indicate that there is elevated growth of the liver early on in
the switch from a low to high energy diet and that when adjusted for body weight this
acceleration decreases over time on a high plane of nutrition. Similar results have been
observed in compensatory growth studies where the growth coefficient of the liver was
higher in beef steers during the refeeding phase compared to continuously grown steers
(Carstens et al., 1991). The weight of the liver was greater in lambs that were switched
from a low to a high feeding level compared to lambs that were continuously fed a high
energy diet (Kabbali et al., 1992). These authors suggested that during the first phase of
the compensatory period, energy is diverted to metabolic organs to replenish protein and
glycogen reserves.

After a review of recently published reports, there is limited evidence to support a
role for nutrition in altering reproductive organ weights in prepubertal heifers. Pritchard
et al. (1972) indicated that when heifers were allowed ad libitum intake of corn silage and
alfalfa hay and fed either 0.9 or 4.5 kg of grain/d, treatments had similar uterine weights
at first estrus. Daily gain averaged 0.83 and 1.08 kg for heifers fed standard or high grain
diet, respectively. We hypothesized that weights of uterine and ovarian tissue would
have a linear increase with longer durations of time fed the high energy diet and thus,
parallel overall body growth. This would seem likely if heifers were to have similar
reproductive organ weights at the onset of puberty. Body weight and possibly the degree
of body fatness are factors that affect the onset of puberty and heifers fed for rapid
growth attain puberty at an earlier age (Schillo et al., 1992; Wiltbank et al., 1969).
Evidence from this experiment indicates that reproductive organ weight did not increase

in a linear fashion with a longer duration fed a high energy diet. In fact, uterine and

57

ovarian weights relative to carcass weight decreased with a longer duration fed the high
energy diet. Overall, these results suggest that heifers fed a high energy diet will have
smaller reproductive organs at puberty than heifers fed a moderate or low energy diet.
However, high energy intake during the prepubertal period did not negatively alter pelvic
area, conception rates, or calving rates of heifers (Radcliff et al., 2000; Radcliff et al.,
1997) and may not be a long-term concern.

Similar to liver weight, uterine weight was highest for the H3 treatment group.
Uterine weight adjusted for body weight or carcass weight was significant for a cubic
contrast due to the large mean for the H3 treatment group. This increase in uterine
weight that was evident shortly after switching to a high energy diet may be due to an
acute hormonal response since serum levels of IGF-I increased soon after heifers were
switched to a high energy diet (Chapter 4). Insulin could also play a role in the large
uterine weight for the H3 treatment, but serum insulin concentration was not measured.
Plasma concentration of insulin increased three-fold in heifers fed a high energy diet for 5
wk compared to heifers fed a low energy diet (V estergaard et al., 2003). Both insulin and
IGF-1 are thought to play a role in follicular growth and development of cows in early
lactation (Butler, 2000). Improved nutrition in sheep results in an increase in the number
of follicles and in the ovulation rate (Downing and Scararnuzzi, 1991). This increase in
number of follicles was later confirmed in Hereford-Fresian heifers fed for increased
dietary intake (Gutierrez et al., 1997). Although size and number of follicles were not
measured in this study, unadjusted ovarian weight was not different. Less is known about
the role of IGF-I and insulin in bovine endometrial cells. In human endometrial cells,

IGF-I is thought to mediate mitogenesis through estrogen-mediated proliferation

58

(Murphy and Ghahary, 1990). However, it is unclear if IGF-I or insulin can stimulate
uterine growth in prepubertal heifers. More research is needed to understand the role of
dietary energy intake on growth of reproductive tissues relative to body growth and how

hormonal mechanisms might alter this growth.

CONCLUSION

Body weight, skeletal growth, and carcass weight in dairy heifers increased in a
linear fashion with a longer duration fed a high energy diet. Feeding prepubertal heifers a
high energy diet for a longer duration increased the daily accretion rate of both carcass
protein and carcass fat. A longer duration of feeding a high energy diet improved the
efficiency of converting dietary protein and energy into carcass growth. Uterine and
ovarian weights adjusted for carcass weight, decreased as heifers were fed a high energy
diet for a longer duration. An increase in body or carcass growth without a proportional
increase in reproductive organ weight might result in smaller organs at puberty in heifers
fed a high energy diet. Evaluation of NRC for heifer requirements indicates that daily

intakes and gains were underestimated compared to actual values for both diets.

59

Start
Treatments Slaughter

age=8wk 11 wk 23 wk
l adaptation l

 

H0

 

 

H3

 

 

 

 

H6

 

 

 

H12 1"

 

Figure 1. Timeline for experiment. Low energy diet is represented by lighter shaded bar
and high energy diet is represented by darker shaded bar. The low and high energy diets
were formulated for gains of 0.6 and 1.2 kg/d, respectively. Heifers (n = 15 or 16/trt) on
H0, H3, H6, and H12 were fed the low energy diet for 12, 9, 6, and 0 wk followed by the

high energy diet for 0, 3, 6, and 12 wk, respectively.

60

Table l. Ingredient content of diets.

 

Low diet High diet
Ingredients, % of DM
Alfalfa silage, late stage 30.8 -
Alfalfa silage, early stage - 20.0
Corn silage - 20.0
Oatlage 30.8 -
Straw 9.9 -
Ground corn 17.0 42.9
Solvent-extracted soybean meal 1.6 7.6
Expeller soybean meal1 8.6 7.5
Minerals and Vitamins 1.32 2.03
Nutrient Composition, DM basis

NDF, % 46.1 22.6
ADF, % 29.9 14.1
MB, Meal/kg 2.07 2.86
NEW Meal/kg 1.30 1.79
NEg, Meal/kg 0.72 1.17
CP, % 16.3 18.4
RUP, % of CP 35.6 37.9
RDP, % of CP 64.4 62.1
CP:ME (g CP/kg Mcal ME) 72.1 63.9

 

1 The expeller soybean meal was SoyPlus (West Central Cooperative, Ralston, IA).

2 Composition: 43.1 % salt, 33.3 % sodium decoquinate (5007 mg/kg), 13.6 % calcium:
phosphorus (17 %:21 %), 8.61 % mineral mix, 1.38 % vitamin mix. The mineral and
vitamin mix was formulated so that the diet provided 100% of mineral and vitamin
requirements.

3 Composition: 74.6 % limestone, 38.0 % salt, 24.8 % sodium decoquinate (5007 mg/kg),
8.28 % calcium: phosphorus (17 %:21 %), 7.46 % mineral mix, 1.19 % vitamin mix. The
mineral and vitamin mix was formulated so that the diet provided 100% of mineral and
vitamin requirements.

61

Table 2. Feedstuff analysis.

 

 

CP, % NDF, % ME, Meal/kg]
Ingredients
Alfalfa silage, late stage 17.4 50.0 1.76
Alfalfa silage, early stage 23.9 39.0 2.05
Corn silage 8.00 45.0 2.40
Oatlage 16.4 58.0 1.69
Straw 3.60 85.0 1.20
Ground corn 10.0 9.00 3.35
Solvent-extracted soybean meal 55.0 10.0 3.46
Expeller soybean meal 47.5 15.0 3.39

 

1 Calculated using equation: ME (Meal/kg DM) = NE", (Meal/kg DM) * 1.6

62

 

200

 

 

 

 

 

175
3"
E 150—~—-t

125 ’, ._.

100 i . . . . . . . . T . .

 

Treatment Period (wk)

Figure 2. Weekly body weight measurements of heifers on treatment H0 (—<>-——), H3
(- — -o- - -), H6 (- - -A- - -), H12 (— —c1——). Heifers (n = 15 or 16/trt) on H0, H3, H6,
H12 were fed the low energy diet for 12, 9, 6, 0 wk followed by the high energy diet for

0, 3, 6, 12 wk, respectively. Linear: P < 0.01; Quadratic: P = 0.02.

63

 

 

1.6
1.4
1.2

 

 

 

 

 

 

0.8
0.6
0.4
0.2

 

ADG (kg/d)

 

 

 

 

 

O
H
N

Treatrmnt Period (wk)

Figure 3. Weekly average daily gain (ADG) of heifers on treatment H0 (—-0—), H3 (-
— -o- — -), H6 (- - -A- - -), H12 (-—121— —). Heifers (n = 15 or 16/trt) on H0, H3, H6,
H12 were fed the low energy diet for 12, 9, 6, 0 wk followed by the high energy diet for

0, 3, 6, 12 wk, respectively. Linear: P < 0.01.

 

 

 

DMI (kg/d)
h

 

 

 

 

Treatment Period (wk)

Figure 4. Daily dry matter intake (DMI) averaged each week of heifers on treatment H0
(—<>-—), H3 (- — -O- — -), H6 (- - -A- - -), H12 (— —I:J— —). Heifers (n = 15 or 16/trt)
on H0, H3, H6, H12 were fed the low energy diet for 12, 9, 6, 0 wk followed by the high

energy diet for 0, 3, 6, 12 wk, respectively. Linear: P < 0.01.

65

 

4.5

\
I

 

3.5

 

2.5

DMI / BW (kg/100 kg

 

 

 

1 .5 l f T I l l I 7 I l l j
Treatment Period (wk)
Figure 5. Dry matter intake (DMI) in kg/d as a proportion of body weight (BW, 100 kg)
of heifers on treatment H0 (—0—), H3 (- — -o- — -), H6 (- - -A- - -), H12 (— —t'_'l'— —).

Heifers (n = 15 or l6/trt) on H0, H3, H6, H12 were fed the low energy diet for 12, 9, 6, 0

wk followed by the high energy diet for 0, 3, 6, 12 wk, respectively. Linear: P < 0.01.

66

 

38

 

36

 

34

 

32 4—

Hip Width (cm)

 

30

 

 

 

28 T I I I T I I I I I I I

Treatment Period (wk)

Figure 6. Hip width measurements of heifers on treatment H0 (-—-<>—), H3 (- - -O- — -
), H6 (- - -A- - -), H12 (- —C1- —). Heifers (n = 15 or 16/trt) on H0, H3, H6, H12 were
fed the low energy diet for 12, 9, 6, 0 wk followed by the high energy diet for 0, 3, 6, 12

wk, respectively. Linear: P < 0.01; Quadratic: P = 0.03.

67

108 ‘F

 

 

 

 

 

 

 

E), 103 -
in

:E’ 98

Z!

é’

.... 93 -.
3

88 I I I I I T I I I I I l

Treatment Period (wk)

Figure 7. Withers height measurements of heifers on treatment H0 (—<>—), H3 (- - -
O- - -), H6 (- - -A- - -), H12 (— —CI— —). Heifers (n = 15 or l6/trt) on H0, H3, H6, H12
were fed the low energy diet for 12, 9, 6, 0 wk followed by the high energy diet for 0, 3,

6, 12 wk, respectively. Linear: P < 0.01.

68

3253.: con moon v 53, Eco“ coho 05 8 5m .8 9.8m omenocsnteogeob mam: mm woo—com m

03:0 u 0 638ng n 0 ”Boos u A N

.bo>zoonE

.me NA 98 ed mo modem com 333.58 803 8% 38:0 :3: one 8% 3.85 Bo. 2E. 50382:“: J3 S .o .m 6 com Home .855
:wE 05 .3 330:8 :3 o 6 .o .Q com Home .355 32 05 pom 803 Q3 .03 .mm .3“ co $5pr 630:8 we 8.» $5on 5253.9 _

 

 

 

 

 

9.5 one :3 v N3 Em is 92 gm .5 .923 e: see
:3 ad :3 v «2 2: m2 2: 08 so .3%: soars as N can
:3 v as v :3 v So a: n; mod $6 one. saw 3m =so>o
:3 v :3 v :3 v 2:. a: 42 a: N2 23 as 3m x3 N a3
8.0 v Se v :3 v 2 8m a: 52 m2 we defies... so 3m
33 %d 23 woo cam ham com «.3 so .523 e: 3:5
65 :8 moo N2 3o 4.8 35 mow :5 Jews: poem? 325
N; ed as is we we 2: 2: we. .25 was

2 2 2 2 o: ass:

0 o a .3 Q: o: m: o:
mmebcoo .89 & 3:80 “connect.

 

.gem been com 282: 236m «mood .m ozah

69

 

 

1200

 

 

 

 

 

 

A 1000 —
“O
3’ 800 ~
8
E 600
g r-
U 400 "—‘“
D-
U 200
O I I I I I I I I I I I

 

 

Treatment Period (wk)

Figure 8. Grams of CP consumed per day of heifers on treatment H0 (—0—), H3 (- —

-O- — -), H6 (- - -A- - -), H12 (-—c1—-). Heifers (n = 15 or 16/trt) on H0, H3, H6, H12
were fed the low energy diet for 12, 9, 6, 0 wk followed by the high energy diet for 0, 3,

6, 12 wk, respectively. Linear: P < 0.01.

70

 

 

 

 

 

 

 

 

 

ME Consumed (Meal/d)

 

 

Treatment Period (wk)

Figure 9. Meal of ME consumed per day of heifers on treatment H0 (—-0—), H3 (- — -
O- — -), H6 (- - -A- - -), H12 (— —Ci- -). Heifers (n = 15 or 16/trt) on H0, H3, H6, H12
were fed the low energy diet for 12, 9, 6, 0 wk followed by the high energy diet for 0, 3,
6, 12 wk, respectively. ME consumed values were log transformed to achieve
homogeneous variance. ME consumed means presented are back transformed. The error

term is the average of the lower and upper confidence intervals. Linear: P < 0.01.

71

2.5 u 5 55236 u o 535 u 5 .

45355555

.555. m._ 55 ed mo 55% 5.5 553855 553 55 .555 52 55 55 .555 >5— 55. 55255555 £3 2 d .m d .85 55 .655
53 55 .3 535:5 5.3 o d .d .2 55 55 .355 32 55 55 553 53 d: .m: d: no 55553 ”530:5 55 55 anew 55:555.“. _

 

 

 

 

dmd Sd v 8d v mod d.m_ :5 dad $6 5.3 Q;
o $555555 35cm

mvd wmd 3d v Ed 1: mod mus cos x3 SA
a gov 55555 558.5

omd 3d v 3d v mm 53 35 wow mmc x3 «7:

mod Ed 5d v ow and 5mm owe v3 5.3 arm

Ed 3d v 5d v mm :5 nme 53 and x3 orm
4 9:3 58:55 mu

...md 8d v 5d v 3d a: 3..— mdA mud 5.3 2.:

8d v add 8d v 2d 34 mm; mmd mod 5.3 arm

cod 8d v 5d v 3d so; mad de hmd 5.3 dim
8.555 on...

wed vod Sd v 8d and 3d and 8+ 5.3 NT:

Cd 3d 3d v mmd 56 mod mad and 5.3 arm

Ed 5d v 5d v vmd Ed 3d dad mad 5.3 era
3555 :5

o o 5 .55 NE 5: m: a:
mannaou 55 & L955 55855:.

 

.5355 55.5555 55 .55 :3 5555mm waist 55555 .55 55.85 55.5 .85 5558 55:55 5554 .v 535,—.

72

Ao\ov 52 .55 555555 355 >055 55555 .50 558 55555 .55 + 5.9.5585 555555 55 558 55555 .259 o
gov 5585 555 50 5595555 .55 \ 5555 5555 we 555 55555 .559 m
.5555 5:85 526:5 585:5 52 4

55:55.5 5a 555 v 55» E55 585 55 55 5g 5 95% 5555555555555 Q5: mm 5.00m m

73

05:0 .1. 0 6:96:30 n 0 £354 u A N

.bozuoonE
.33 NA 98 We no 38w “om vows—zgom 203 6:. 38:0 :wE 98 8% >928 32 05. 525038.: £3 Q .0 .m .o 8m 8% 3.55
:mE 05 .3 330:8 :3 o .0 d .N_ 8m 5% .385 32 05 wow 983 Q: .81— .mm .0: co muobum 330:8 an Ex 8:on 3:258; _

 

 

 

 

Rd 83 :3 v em :3 in ”an 3:. - 3m 3 8:» .3 .225:
53 83 :3 v 2: en: 8: :3 mac - m .3 3:25:
:3 v :3 v :3 v :3 3: :3 :3 8.: - 25.8 .x. .2303 .25
:3 :3 v :3 v :3 3m :3 3m 83 - 3. Jams; .35
:3 :3 :3 v 33 N; :fl «.3 o. E .3% 9. 3805 83.3:
m3 :3 v :3 v 93 as 93 23 SA .83 3m 3 8:3 .3 .805
93 :3 v :3 v ...m a: mi 8.» $3 .83 9. .3 385
33 $3 :3 v :3 $3 23 N3 :3 .2: 3m 3 8:3 .5223 2830
£3 33 :3 v 83 02 3.2 :2 3; .3: m: .5283 2.26
:3 :3 v :3 v m3 m3 W8 33 a. E N. K .x. .333 .395
33 :3 v :3 v 33 3; mi 2: MS 23 .x. .3 .305
«.3 N3 :3 v ...< 2: 2: 3: 3.2 3m ..x. .538: 38.5
x3 :3 v :3 v £3 9% 3m v.9. 3.2. .22. ammo .x. .2325 38.5
23 33 :3 v 83 B: m. a 3w 3.3 .03 3 Emma $856

2 S 2 2 3. 8 .52»:

u o 4 .mm 2: w: m: o: .E
mung—“GOO “on K 339—9 «augmouh

 

doEmoquo 88.30 @338qu 98 33 Ho.“ 2qu 98:3 ammo; .m «Sub

74

596033.: .8:on 30:58: SE 93 .8: .mm 63 8m wwd Ea dud .36 .36 08 3.225 3:35:00 omfio>< m
526898: .8293 32585 23 23 .03 .m: 6: 8m Ed can .35 .26 .26 23 mfitofim 3:02.38 ow8o><<
.338 .3 3 8588 333: 3038: mama: 388:8 203 3582388 Emma? $8.80 0::on 3

.963 3258: some you mgr—3:: moaovfioo “can: 93 832 05 mo awaken. 05 m_ 323
3339: 8:8 Hobo 2E. .uogommawb x23 23 3382: 832 .3593 goocowoao: 3038 8 3:88.035 mo. 803 Sum.

3253.: hon mac: v 5.3 8.8“ Hobo 05 3 can .8 95am ommsousutcogmob wfim: mm @200: n

75

160 ——

 

 

'
I
O
C
.
‘0
.
o
o'-
O
I
.
O
O
O
O
U
.0

120 -.—.-~"'

 

 

 

 

 

 

Accretion Rate (g/d)

 

—<>— carcass protein

------D carcass {at
O I I I l 1

0 3 6 12
Time Fed High Energy Diet (wk)

 

Figure 10. Daily accretion rates of carcass protein and fat averaged during treatment
period. Heifers (n = 15 or 16/trt) were fed a high energy diet for O, 3, 6, or 12 wk in

duration. Accretion rates for both protein and fat were significant for a linear efl‘ect (P <

0.01).

76

 

 

 

 

 

 

 

 

 

 

83—“ ............................ Q
a ...q ---------
m 5 - _
.94” mg.
a 4 . A
a) i"
x 2 ____ +fi —<>—carcass protein
---U---carcassfat
O I I I I
O 3 6 12
Time Fed HighEnergy Diet (wk)

Figure 11. Amount of carcass fat or carcass protein adjusted for BW (kg/ 100 kg BW).
Heifers (n = 15 or l6/trt) were fed a high energy diet for O, 3, 6, or 12 wk. Carcass fat
adjusted for BW was significant for both linear and quadratic effects (P < 0.01). Carcass

protein adjusted for BW was significant for a linear effect (P < 0.01).

77

 

50.33030.“ .0983 30338 SE 28 .03 .mm .28 3.8 and 28 .23 .mmd .36 03 23332 332.33 0333. <

.9.on 308308 33 38 203032 332.33 33: 28 332 08 .3 03330 05 2 320p
3322: 838 3.3 0E. .3383 203 03 33303 332 .3333 3003380: 03an 2 338808 w2 033 Sun .

303308 3a 33 v .23 :38 3:0 05 3 3a 3 9.on 0333930338 m2»: mm 3.3m »

280 u 0 .8835 u o 805 u A .

50330303

.23— NA 28 ed .3 23% 3.8 33338 033 3:0 .833 33 23 803 .833 32 05. 50.33030“ .23 N2 .0 .m .o 3.8 3% .333
33 08 .3 330:8 23 o .o .a .2 38 3:0 .333 32 08 3.8 033 N23 63 .mm .22 3 8833 83228 00 03 3503 30:308. _

 

 

 

 

3o 88 8.8 3. «.8 a. K 3» an» .3 »s_ 8:» .3»? o + D
88 88 N; o.» E» m8 3.. 2» 3m »6_ 8:» .233 o + a
88 :8 88 3. N8 30 2: 3.0 » .5»? o + D
02 m8 :8 v .m 8.» ts 8.» 2: .3 »V_ 8:» .833 536
88 28 8.8 ...< K.» 8.» 2.... 8... .3 »s_ 8:» .833 585
3o » 8 .o 3 8.8 m2. :3 m: 8.» » .233 55.6
88 8.8 88 w.» 88 O8 3» mi 30 »x 8:» .2»? 2.55
8.8 28 m8 0.» mm» 2» v»... 3.» .3 »c_ 8:» .2»? 835
88 8.8 88 3. v.8 :8 o. 8 m8 » .233 83:

2 2 2 2 8 £523

0 o a .3 NE 0: .3 oz
$3.530 88 & 33.5 303308.

 

.3333 33.6 23 0233 H8 308 03v» 332 .w 030,—.

78

50.80032 .0983 3033.: Q3 23 6E .mm 63 H8 hmd 23 find find .36 03 0330:: 0038300 0w30>< m

79

Table 7. Measurements of predicted versus observed daily intakes and gains.

 

 

HO H12
Heifers, no 16 15
DMI, kg/d
Actual DMI 3.78 5.07
Predicted DMI, Spartan 3.05 3.63
Predicted DMI, NRC 3.67 3.64
ADG, kg/d
Target ADG 0.60 1.20
Actual ADG 0.64 1.09
Predicted ADG, NRC' 0.44 1.03

 

’ Predicted values for ADG with DMI adjusted for actual values.

80

 

 

Figure 12. Representative picture of heifers fed low and high energy diets. Picture A is
a heifer fed the low energy diet for 12 wk. Picture B is a heifer fed the high energy diet
for 12 wk. Note the difference in apparent gut fill, body condition, and hair coat between

heifers fed the two different diets.

81

CHAPTER THREE

EFFECTS OF FEEDING A HIGH ENERGY DIET TO PREPUBERTAL HEIFERS

FOR A LONGER DURATION ON MAMMARY DEVELOPMENT

ABSTRACT

Our objective was to determine the effects of feeding prepubertal dairy heifers a
high energy diet for a longer duration on mammary growth and composition. Holstein
heifers (age = 11 wk; BW = 107 :t 1 kg) were assigned to 1 of 4 treatments (n = 16/trt)
and fed 2 diets for different durations: H0, H3, H6, and H12 were fed a low energy diet
for 12, 9, 6, and 0 wk followed by a high energy diet for O, 3, 6, and 12 wk, respectively.
The low and high energy diets were fed to achieve 0.6 and 1.2 kg average daily gain
(ADG), respectively. Heifers were slaughtered at 23 wk of age and mammary tissue was
collected. A longer duration of feeding the high energy diet increased total mammary
gland weight, extraparenchymal fat weight, and intraparenchymal fat weight, but did not
alter fat-free parenchymal tissue weight. When adjusted for fat-free carcass weight to
more accurately reflect differences in physical maturity, fat-free parenchymal tissue
weight decreased with a longer duration fed the high energy diet. Total amount of
mammary parenchymal DNA and RNA and concentration of DNA were not different.
However, after adjustment for carcass weight, the amount of DNA and RNA decreased as
heifers were fed the high energy diet for a longer duration. We conclude that feeding
prepubertal heifers a high energy diet for a longer duration results in a linear decrease in

mammary fat-free parenchymal mass and a linear increase in extraparenchymal fat when

82

data are adjusted for carcass weight. Because heifers fed for rapid gains reach puberty at
a younger age, feeding heifers a high energy diet will result in less mammary

parenchymal tissue at puberty and potentially lower milk production.

Key Words: mammary growth, heifer, nutrition
Abbreviation Key: ADG = average daily gain; BL = baseline; CW = carcass weight;

FAR = fractional accretion rate

INTRODUCTION

The cost of raising replacement dairy heifers accounts for approximately 20% of
total dairy herd expenses (Heinrichs, 1993). Feeding a high energy diet to allow for a
rapid growth rate enables heifers to be bred and calve earlier, potentially reducing costs
associated with raising replacement heifers. However, mammary growth relative to body
growth and milk yield potential are reduced when heifers that are approximately 3 to 10
mo of age are fed a high energy diet promoting gains of greater than 1 kg/d for periods of
12 wk or longer (Petitclerc et al., 1999; Radcliff et al., 2000; Sejrsen et al., 1982).

Several recent studies indicate that increasing the energy intake of calves and
heifers for a short duration (5 8 wk) may improve mammary development and future
milk yield. Increasing the energy and protein intake of calves fed milk replacer from 2 to
8 wk of age resulted in increased body growth, mammary parenchymal mass, and content
of mammary DNA and RNA (Brown et al., 2005a; Brown et al., 2005b). In another
study, calves were either allowed to suckle a cow or were fed milk replacer until 6 wk of

age. Calves that suckled gained more (0.86 versus 0.56 kg/d) and tended to yield more

83

 

 

milk during first lactation (Bar-Peled et al., 1997). In a recent study, calves were either
fed milk replacer resulting in gains of 0.59 kg/d or given free access to whole milk for 2,
30-min intervals/day for gains of 0.88 kg/d (Shamay et al., 2005). Feeding whole milk to
calves affected BW but not skeletal size of the adult animal and increased milk yield by
4% during first lactation (daily 3.5% fat corrected; P < 0.01) compared to those calves
fed milk replacer. Compared to a consistent growth regime, a stair-step feeding regime
for heifers, which consisted of feeding high energy diets for 2 mo and energy-restricted
diets for 3 mo, resulted in higher concentrations of mammary DNA, RNA, and protein,
and increased milk yield in dairy and beef heifers (Choi et al., 1997; Park et al., 1998).
However, the mechanism for how a high energy intake during the preweaning period and
a stair-step feeding regime for heifers increases mammary growth has not been
determined. One possibility is that preruminant calves and heifers respond differently
when fed a high energy diet for a short versus along duration.

The question remains as to how a short duration compared to a long duration of
feeding of a high energy diet will affect mammary growth relative to body growth. Prior
studies that indicated a detrimental effect of feeding a high plane of nutrition involved
treatment periods of 12 wk or greater. Thus, we choose 12 wk as our long duration time
point, 6 and 3 wk as our short duration time points, and 0 wk of feeding a high energy
diet as our base control treatment. Our objective was to determine the effects of feeding
prepubertal dairy heifers a high energy diet for a longer duration on mammary growth
and composition. We hypothesized that feeding a high energy diet for a short duration

would stimulate grth of mammary parenchyma, but a long duration of feeding a high

84

energy diet would be detrimental to mammary growth relative to body grth in

prepubertal heifers.

MATERIALS AND METHODS

Animals and Treatment

All procedures were approved by the Michigan State University Animal Use and
Care Committee. Sixty-eight Holstein heifers (approximate age = 8 wk) were purchased
within 4 consecutive wk in the fall (17 heifers/wk) with each wk classified as a separate
purchase group. Heifers were housed at the Michigan State University Beef Cattle
Research Center and were exposed to ambient temperatures and lighting during the
adaptation and treatment periods, which occurred during late fall and winter. Heifers
were housed in an open-sided barn with enough space per pen (dimensions: 14 X 38 ft) to
allow for exercise. Each purchase group was allowed a 3-wk adaptation period for
adjustment to facilities and diet. During this adaptation period, heifers were gradually
transitioned fi'om a diet similar to that fed before purchase to a TMR similar to a mixture
of the treatment diets. One heifer within each purchase group was randomly selected
and slaughtered at 11 weeks of age for baseline (BL) measurements used for calculation
of mammary tissue accretion rates.

At 11 wk of age (BW = 107 i 1 kg), 16 heifers within each purchase group were
blocked by body weight and randomly assigned within block to 1 of 4 treatments. All
heifers within a given treatment in the same purchase group were housed in the same pen.

Thus, 4 pens of 4 heifers (1 pen per purchase group) were used in each of the 4

85

 

treatments. The treatment period lasted 12 wk and treatments were as follows: HO (low
energy diet fed for 12 wk); H3 (low energy diet fed for 9 wk followed by high energy diet
for 3 wk); H6 (low energy diet fed for 6 wk followed by high energy diet for 6 wk); and
H12 (high energy diet for 12 wk). The low energy diet was fed to achieve 0.6 kg average
daily gain (ADG) and consisted of 10% straw, 33% mature alfalfa silage, 33% oatlage,
and 24% concentrate on a DM basis. The low energy diet had 0.72 Mcal NEg/kg DM,
16.3% CP, and 46.1% NDF. The high energy diet was fed to achieve 1.2 kg ADG and
consisted of 20% immature alfalfa silage, 20% corn silage, and 60% concentrate on a DM
basis. The high energy diet had 1.17 Meal NEg/kg DM, 18.4% CP, and 22.6% NDF. A
more detailed description of diets was presented previously (Chapter 2). Both diets and
water were available ad libitum. Diets were fed as a TMR once daily between 0900 and
0930 h. Actual daily gains previously reported (Chapter 2) averaged during the treatment
period were 0.64, 0.65, 0.83, and 1.09 kg (:1: 0.01) for H0, H3, H6, and H12, respectively.
During the last 2 wk during the treatment period daily gains were 0.72, 1.05, 1.34, and
1.19 kg (:1.- 0.09) for H0, H3, H6, and H12, respectively.

Heifers were slaughtered at the end of the treatment period when heifers were 23
wk of age. Heifers were allowed to consume the TMR from the prior day’s feeding until
they were transported at 0600 h via trailer to the abattoir at the Michigan State University

Meats Laboratory.

Tissue Collection

Heifers were weighed, stunned by captive bolt, and killed by exsanguination.
Heifers were killed on 2 different days each wk for 4 consecutive wk with 8 heifers (2/trt)

killed per day for each purchase group. Mammary glands were quickly removed after

86

slaughter, cleaned, and bisected through the median suspensory ligament into right and
left halves. The left half was weighed, put into a plastic bag, and frozen by submersion
into a dry ice and 95% ethanol mixture. Frozen left hemiglands were stored at -20°C
until composition was analyzed. Mammary parenchymal tissue samples were excised
from the right front quarter for histology. Samples for histology were processed in the
laboratory of Dr. Mike Akers at Virginia Tech and will not be discussed in this
dissertation. Body weights, carcass weights (CW), and composition of other tissues
collected at slaughter were previously reported (Chapter 2)

Reproductive tracts were examined to confirm that heifers were not freemartins
and had not reached puberty. One heifer (trt = H3) was a freemartin and her data was
eliminated from all results. Another heifer (trt = H12) was confirmed postpubertal after a

corpus lutem was detected at slaughter and her data were also removed from the study.

Mammary Gland Composition

The frozen left half of the udder was cut transversely using a band saw into 5- to
10- mm thick slices. Slices on the anterior and posterior ends that did not contain
parenchymal tissue were discarded. Slices were then placed on a cutting board and
allowed to thaw slightly. Skin, teats, and lymph nodes were removed and discarded. The
parenchymal tissue was dissected from the extraparenchymal fat and these 2 types of
tissue were then weighed. Parenchymal tissue was ground with liquid nitrogen into a fine
powder using a blender (Waring Commercial, New Hartford, CT). The powder was
mixed and subsampled for analysis of DNA, RNA, fat, protein, and water. DNA and
RNA content were measured as indicators of cell number and metabolic activity,

respectively, using the same methods as Tucker (1964). Fat was determined by Soxhlet

87

ether extraction (AOAC, 1990). Crude protein was determined using the method of Hach
et al. (1987). Water was determined as the difference in weight after drying mammary

parenchymal tissue in an oven at 106°C for 24 h.

§t_atisticafl Analysis

Statistical analysis used the PROC GLM procedure of SAS. Pen (n = 4 heifers
per treatment in each purchase group) was used as the experimental unit with purchase
group as a random variable and treatrnent*purchase group as the error term.
Comparisons were tested using a linear (L) contrast with coefficients -7, -3, 1, and 9; a
quadratic (Q) contrast with coefficients 7, -4, -8, and 5; and a cubic (C) contrast with
coefficients -3, 8, -6, and 1 for H0, H3, H6, and H12, respectively. Least square means
and standard errors of the mean are presented. Differences were declared to be
statistically significant at P < 0.05 and tendencies at P < 0.10. All data from the 2 heifers
that were eliminated from the trial were removed so that final animal numbers were 16,
15, 16, and 15 for treatment groups H0, H3, H6, and H12, respectively.

Accretion rates for mammary and body tissues were quantified by calculating the
average daily accumulation of mammary tissue using the averages of the 4 baseline
heifers as initial value and number of days between slaughter dates for baseline and
treatment heifers. These accretion rates were then calculated on a fractional basis
(fractional accretion rates: FAR) that was compounded over time.

Data for extraparenchymal fat weight, intraparenchymal fat weight,
intraparenchymal fat weight adjusted for carcass weight, fat-free parenchymal tissue
weight, fat-free parenchymal tissue weight adjusted for carcass weight, fat-free

parenchymal tissue weight adjusted for fat-free carcass weight, DNA weight, DNA

88

 

 

concentration, DNA weight adjusted for carcass weight, RNA weight, RNA weight
adjusted for carcass weight, and the ratio of RNAzDNA were log transformed to achieve
homogeneous variance and normality. Means presented for these data points are back
transformed. Error is depicted as the average of the back transformed upper and lower

68% confidence intervals. Non-transformed means are presented in the Appendix.

RESULTS

Total weight of the mammary gland increased as heifers were fed the high energy
diet for a longer duration (Table 2; L: P < 0.01). This was due to a linear increase in
extraparenchymal fat (L: P < 0.01), as parenchymal tissue weights were not different (all
contrasts: P > 0.10). When adjusted for carcass weight to more accurately reflect the
differences in physiological maturity of the heifers, parenchymal tissue weight tended to
decrease as heifers were fed the high energy diet for a longer duration (L: P = 0.06).
Similar to extraparenchymal fat, intraparenchymal fat mass and also the percent of
intraparenchymal fat increased as heifers were fed the high energy diet for a longer
duration (L: P < 0.01). When adjusted for carcass weight, extraparenchymal fat
increased in heifers fed the high energy diet for a longer duration, but there was no effect
on adjusted intraparenchymal fat (L: P < 0.01; all constrasts: P > 0.10, respectively). Fat-
free parenchymal tissue weight relative to carcass weight or fat-free carcass weight
decreased with a longer duration fed the high energy diet (Table 2 and Figure l; L: P <
0.01 and P = 0.02, respectively). Mammary parenchymal protein mass was not different,
but the percentage of protein in mammary tissue tended to be less with a longer duration

of feeding the high energy diet and for a cubic relationship (L: P = 0.09 and C: P = 0.08).

89

The total amount of parenchymal DNA and RNA and concentration of DNA were
not different among treatment groups (Table 3; all contrasts: P > 0.10). A linear decrease
with a longer duration fed the high energy diet was evident when DNA mass was
adjusted for carcass weight (L: P = 0.05). Both the concentration of RNA and the ratio of
RN AzDNA displayed a cubic effect due to the higher abundance of mammary RNA
within the H3 heifers (C: P = 0.07 and P = 0.05, respectively).

Daily compounded FAR of extraparenchymal fat and intraparenchymal fat within
the mammary gland increased as heifers were fed the high energy diet for a longer
duration (Table 4; L: P < 0.01). Body weight and carcass fat FAR were significant for
linear and quadratic effects and these were mainly due to the duration of time that heifers
received the high energy diet (L: P < 0.01 and Q: P = 0.01 for both measurements). Daily
accretion rates for mammary parenchyma, fat-free parenchyma, mammary DNA, and
mammary RNA did not change with time fed the high energy diet (all contrasts: P >

0.10).

DISCUSSION

Feeding prepubertal heifers a high energy diet for a longer duration results in a
linear decrease in fat-free mammary parenchymal weight and a linear increase in
mammary fat when data are adjusted for carcass weight. Our results are in agreement
with other studies that have demonstrated an impairment of mammogenesis in
prepubertal heifers fed high energy diets for time periods of 12 wk or more (Harrison et
al., 1983; Petitclerc et al., 1999). Similar to earlier work (Capuco etal., 1995; Radcliff et

al., 1997), these findings indicate that high energy intake in prepubertal heifers results in

90

accelerated body growth rates, but also excessive fattening within the mammary gland.
However, this is the first study to demonstrate the effects of feeding a high energy diet
for a short duration on mammary growth in prepubertal heifers.

Our original hypothesis was that a short duration of feeding a high energy diet
would stimulate mammary parenchymal growth relative to body growth. This idea
originated from observations in compensatory growth studies and nutritional studies
during the preweaning growth phase. Compensatory growth studies indicate that a stair-
step feeding regimen of alternating feed intake of heifers by 25 to 30% above
recommendations for 2 mo and 20 to 30% below recommendations for 3 to 5 mo in
length can positively affect the lactation potential of heifers (Choi et al., 1997). The
mechanism for why this phenomenon occurs is not known. The positive influence on
mammary growth could be due to the stair-step regime or potentially the short time
period that heifers were fed above recommendation levels. However, some have
suggested that the treatment period in these compensatory growth studies is either
completely or partly outside the critical window, because feeding high energy diets to
postpubertal heifers does not alter mammary growth (Sejrsen et al., 1982; Sejrsen and
Purup, 1997). Nutritional studies during the preweaning period indicate that increasing
the energy and protein intake in calves for a period of 6 wk in length (2 to 8 wk of age)
resulted in an increase in body grth and nearly a doubling of mammary parenchymal
DNA (Brown et al., 2005a; Brown et al., 2005b). However, increasing the energy and
protein intake of postweaned calves from 8 to 14 wk of age resulted in no difference in
mammary parenchymal growth (Brown et al., 2005a). Other studies have measured an

increase in 300-d milk production and daily fat corrected milk yield when heifers were

91

allowed greater gains during the preweaning period (Bar-Peled et al., 1997; Shamay et
al., 2005). The mechanism for why feeding diets promoting rapid gains might stimulate
mammogenesis during the preweaning period, but not during the later prepubertal period
is not understood. However, the results from this present study using older prepubertal
heifers indicate that high energy diets fed for a short duration of 3 and 6 wk are not
stimulatory to mammogenesis and instead inhibit mammary growth relative to body
growth in a time-dependent manner consistent with a long duration. Therefore, it seems
more likely that the positive influence on mammary growth in the above studies is due to
the stair-step regime and due to high energy intake before weaning and not because of
short-term high energy intakes. Thus, the mechanisms explaining why these feeding
programs are stimulatory to mammary growth are still unknown.

The growth and development of the mammary gland in heifers is crucial to
productivity, as the number of mammary epithelial cells is a major factor determining
milk production (Tucker, 1981). Mammary tissue DNA content was positively correlated
(r = 0.85) to litter weight gain in rats (Tucker, 1966). Mammary tissue DNA content
from 5 mo-old heifers was positively correlated to milk yield (0 to 30-d; r = 0.21) and to
mammary tissue DNA collected at 60-d into first lactation (r = 0.25) (Tucker et al.,
1973). The milk yield potential is partially determined by the growth of the mammary
gland prior to puberty and during pregnancy (Sejrsen, 1994). This is why high energy
diets fed during the prepubertal period can have long lasting detrimental effects on milk
yield. In this study, all heifers were slaughtered at the same age, but there were
significant differences in body weight and carcass weight at slaughter. Mammary data

were adjusted for carcass weight to more accurately reflect the difference in physiological

92

maturity of the heifers. We chose carcass weight instead of body weight due to the
difference in the forage: concentrate ratios in the diets, which resulted in apparent
differences in gut fill between the HO treatment and the other 3 treatment groups at
slaughter. Fat-free mammary parenchymal tissue weight adjusted for fat-free carcass
weight decreased in a linear, time-dependent manner with a longer duration fed the high
energy diet. This indicates impaired mammary development. Heifers fed a high energy
diet during the prepubertal period reached puberty at a younger age than heifers fed a
moderate or low energy diet (Schillo et al., 1992). The onset of puberty is influenced by
body weight, degree of body fatness, and plane of nutrition (Schillo et al., 1992). The
rate of mammary growth becomes isometric relative to other tissues around the onset of
puberty (Meyer et al., 2004; Sinha and Tucker, 1969). Therefore, this demonstrates that
high energy intake did inhibit mammary growth because it is likely that if heifers had
been slaughtered at the onset of puberty, the amount of mammary parenchymal tissue
would have been greater in the heifers fed the low energy diet than heifers fed the high
energy diet.

An increase in the amount of extraparenchymal fat, amount of intraparenchymal
fat, intraparenchymal fat percent, and extraparenchymal fat adjusted for carcass weight
were all observed in this study when heifers were fed a high energy diet for a longer
duration. Heifers fed high energy diets containing corn silage had more fat deposited
within the mammary gland (Capuco et al., 1995). An increase in body fatness, which
was also observed in these heifers (Chapter 2), is negatively correlated with mammary
parenchymal DNA and milk production (Silva et al., 2002b). Similarly, the amount of

mammary secretory tissue is inversely related to extraparenchymal fat mass in heifers

93

(Sejrsen et al., 1982). The growth of mammary epithelial cell organoids is inhibited
when co-cultured with bovine mammary fat pad explants (McFadden and Cockrell,
1993). In addition, mammary tissue extracts from prepubertal heifers fed a high
compared to a moderate energy diet were less mitogenic for mammary epithelial cells in
vitro (Berry et al., 2003; Weber et al., 2000a). These studies demonstrate that heifers fed
a high energy diet have an increased deposition of fat and that mammary fat may secrete
a factor that inhibits mammary epithelial cell growth. In agreement with this idea,
metabolic activity (RNA), cell number (DNA), and fat-free mammary parenchymal mass
were all decreased with time fed a high energy diet when adjusted for carcass weight.
Previous results indicate that heifers fed a high energy diet had a tendency for decreased
parenchymal DNA weight (Sejrsen et al., 1982) and a tendency for decreased
parenchymal DNA concentration and total DNA adjusted for body weight (Petitclerc et
al., 1984).

Most studies observe that the amount of extraparenchymal fat is increased in
heifers fed a high energy diet for rapid gains. But, some have not observed a dietary
effect on the amount of intraparenchymal fat (Sejrsen et al., 1982). Sejrsen and co-
workers suggested that the slower growth of parenchymal DNA measured in heifers fed a
high energy diet was not caused by increased fat infiltration of the gland but due to an
inhibitory effect of higher amounts of extraparenchymal fat. Intraparenchymal fat
percentage in 14 wk old calves ranged from 7.0 to 13.2 % and calves fed a high energy
diet from 8 to 14 wk had a greater percentage of intraparenchymal fat than calves fed a

low energy diet, but mammary parenchymal weights were similar (Brown et al., 20053).

94

In this study, we were able to detect an increase in both extraparenchymal and
intraparenchymal fat with a longer duration fed a high energy diet.

Data collected from 4 baselines heifers were used to calculate compounded F AR
of mammary growth. Baseline values (age = 11 wk) for parenchymal tissue weight,
DNA content, and RNA content were similar to those previously reported for 14 wk old
calves (Brown et al., 2005a). Results clearly indicate that FAR of extraparenchymal fat
and intraparenchymal fat were increased with a longer duration fed the high energy diet,
but FAR of mammary parenchyma, RNA, and DNA were not altered by diet. There was
no change in the FAR of fat-free mammary parenchyma when comparisons between the
H12 and the H0 treatment groups were performed, but fractional rate of both body weight
and fat-free carcass weight accretion were increased with high feeding by 45% and 78%,
respectively (see Table 5). This indicates that although high energy feeding did not
reduce the fractional rate of mammary tissue accretion, it did increase the accretion rate

of body weight and carcass weight compared to the low plane of nutrition.

CONCLUSIONS

We conclude that increasing the dietary energy intake of prepubertal heifers for a
short duration does not improve mammary growth but rather alters growth of mammary
tissues relative to body growth in a time-dependent manner, consistent with feeding high
energy diets for a long duration. Fat-free mammary parenchymal tissue weight adjusted
for fat-free carcass weight decreased in a linear fashion as heifers were fed a high energy
diet for a longer duration. An increase in body or carcass growth without a proportional

increase in mammary growth would result in less mammary parenchymal tissue at

95

puberty and potentially lower milk yield because heifers fed for rapid gains reach puberty
at a younger age. Feeding prepubertal heifers a high energy diet increases the deposition

of fat in the mammary gland and may play a role in the impairment of mammogenesis.

96

8858b 8a 98a v 55 E8 ~28 8% we can .8 %on 834989888885 m5? mm woo—com m

05:0 u U 8:8930 n 0 ”88:5 n A N

$828388

.3?— N._ was 0.0 («0 38m .8.“ 8835—8 083 8% 38:8 :wE use 8% $8.8 32 22. 583838» J3 N— 6 .m .o no.“ 8% 38.8
:wE 8% 3 326:8 :3 o 6 .a .Q 8% 8% 3.88 32 85 won 883 33 63 .mm .om co maommom ”950:8 mm 8.8 8:on 88889:. _

 

 

 

 

 

Ed 85 :3 v Mad N. a 2K a: o. E E @828 Beam
Ed 93 :3 v 8.9 2: n; 3” 0.3 3 James macho
:3 v :3 v :5 v o: 8m x: E as wa .5233 a 25
m3 2 .o m3 is we we we 2: mg .25 3:5
2 2 2 2 8 .5?
o o n Mmm NE 8: mm o:
mama—:8 8% R 3380 88888:.

 

 

.momamtouogo $858 28 icon .8.“ 888 233 88A A 03.5.

97

82885 8m mung w 53, 8.8“ 5.8 05 me can .8 %on 83559888895 wfim: mm woo—com m
05:0 n 0 638390 n 0 ”88:5 n A N
38382”?—

.%h& N; 28 ed .«o 23% 8m “88388.“ 883 8% 38:8 nwE was 8% .388 32 2:. $8388qu J? S 6 .m .o 8% 8% 38.8
AME 8% .3 330:8 x3 o 6 5 .Q 8.“ 8% $88 32 85 we.“ 88? N2.— .wm .mm 63 no 3&8: $328.“ me Be 3:on 88889:. _

 

 

 

 

3o 93 3o :5 a? 3..” 3.” a.” 42 «3:088 Co as .5305 aifisam
So So «.2 Ed 3; 8.2 «.2 ed Rd m .3388 32:85
So 42 :5 v .m 2: 42 e: E 3; £32.» maoeo we 8% aififii Beam
3o 23 So .a m: g as a: as m £83083 Beam
who and :5 .o mam 3m 3m tom 3:. £33 38:8 3 8% .8 ainoaoaafis
Rd 23 :3 v 2: 2m 9% 2: a: m? “panacea mo .x. 3e aiaoaoaafis
23 a3 :3 v .m Em 9mm 98 SN 33 m .8 aififiififi
Ed and :3 v at. an es. ”mm ”8 ad. Ewes 828 we 8:» .3 ainofisafixm
as 86 :3 v .< %m a? 8a SN mam m .8 agnoseaeam
.33 Se 86 92 m2 :2 n: :2 3; Ema; wages 3 8% aififié
mod ”to NS 2: § 3: N: e: 8.” w afiaofiam
mac and :3 v 98 ME: 2: :2 8w 2: w Jams; 22» $552

2 2 2 2 v nee:

o o 4 mm 2: e: m: o: 8
amebaoo 8m & fl@380 “cognac;

 

doummomag wan—m E8888 8% 2888 88:3 884 .N 933—.

98

$838885 £988 805585 $3 %8 6E .mm .0: 8.5 has 98 .36 .2: .2: 8.8 28858 889.88 owfio>< m
$838885 £988 585585 23 98 63 .mm 63 8.5 mod 98 .Nw.w dad .wm.w 88 $8.855 882.88 8883.. 8
582888.. £988 88585 fi: %8 .03 .mm .2.“ 8.5 and %8 .wxd .moN .me 88 28.855 882.88 8.83.. 0
3838885 £988 88585 SE %8 .0: .mm .CE 8.5 mo.m %8 .ocN .3 .N fin.— 88 28.85: 858980 owflo>< m
$838888 £988 88585 NS.— 98 .03 .mm .2.— 8w 5.9. US“ .c.mm .cdm .52 88 $885: 8:888 0883.. <

.988 285585 88 8.5 28825 858580 .899. %8 .832 85 .8 88.8.6 05 .5 >885
858%.: :53 858 2:. 8888.855 88 8.8 88888 882 8238., 8888.85 8838 8 888.5855 m2 083 Sun.

99

 

200 ’

 

s
*‘f
*f”

 

100

 

F at-Free Parenchymal
Fat-Free Carcass (g/ 100 kg)
M
O

 

 

Time Fed High Energy Diet (wk)

Figure l. Grams of fat-free parenchymal tissue relative to 100 kg fat-free carcass.
Heifers (n = 15 or l6/trt) on H0, H3, H6, H12 were fed the low energy diet for 12, 9, 6, 0
wk followed by the high energy diet for O, 3, 6, 12 wk, respectively. Data was log
transformed to achieve homogeneous variance. Means presented are back transformed.
The error term is the average of the lower and upper confidence intervals for each

treatment group. Data are significant for a linear effect (Linear: P = 0.02).

100

3.033032 .mmnew “cogent Em tau .0: .mm 65 Sm Owe can .fimu .fiwh dds 2a mREBE oocouwdoo owfio>< m

5038032 .mqsew Susanna S: 98 .0: .mm .om com 5.3 Ba .N.$ 6.3 .w.wm as mfitfifi cocoa—So 09203.. <

96% 8253: :80 com 33.6%: 352.38 can: can .532 05 mo 0&8on 05 mm 323
panama: .58 echo BE. .uoacofizg x23 0.8 3303:“ $802 .8393 3005380: 26an B vogofig m2 203 San .

22585 can Eon v 5MB Show Hobo 05 we can .8 9.on amazogmtcogmob mama: mm @208 m

05:0 n 0 6396.30 n O ”.8054 u A N

50.58%?—

6\wv_ N; can 9o «0 88m 8m woos—280m 203 Home .385 swE was Home 3.85 32 2:. $338on2 £3 2 .w .m .o com Home .385
amE 05 .3 330:8 :3 o .o .a .3 .8.“ Home 3.85 32 05 com 803 NS; .03 .mm 63 :0 Echo: ”$523.“ 8 2a museum 20839:. _

 

 

 

 

 

3o 33 as .m *3 35 NS 3o 2: <zau<zm
So and as :6 mom Gm 3.0 m} 8.” was 5.3588 52
moo «no So .m :5 as $2 32 a: Ema; :85 we. 8:»... Jim
86 one as b c3 5 an E 0% we Jim 3558:...
N3 $5 85 .0 5m 3m 23 m3 o3. Ewe £23588 <75
8.9 33 85 .m w; 82 92 5: mac Emma 2830 we. 8:»... .55
85 as Ed .< 80 08 as 8» 2m we .55 35.683.“

2 2 2 2 v 8 .3%:

u o q 3 NE e: E am am
mmabqoo 8% K .955 “5828:.

 

33:8 Eon 220:: 98% 58:88 8m 838 0.833 «304 .m 939—.

101

5026038 .3:on Bumbag fix 28 .02 .mm .om com Nod 98 .86 .mod .86 Ba 23.8%: oocoumcg om80>< n
5038038 .manew Bumbag S: 23 .0: .m: 62 BM m. G 98 .SK .0; .wdn can mBEBE oocovmaoo 0333.. m
50382;”: wan—Em 8258b 2: can .03 .mm 63 com Woe can {we {we 6.5m 2.» $3.82: 8:02.38 own—03¢. a

50380qu .mmsew 32585 SE was .om .mm .o: How Ed can .m_.c .36 .26 2a £9:an vacuums—co 09203.. c

102

555555 .55 555 v 5m? 5.55 555 55 55 55 .5 95% 5555555555555 m5? mm 5555 m

055 u 5 55535 u 5 $555 u 5 .

553555555

.33 NA 55 9o .5 555m 5.“ 5555558 553 5:5 .355 52 55 5:5 .355 >5— 55. 55.655555 .5? S .5 .m .o .5.“ 5:5 .355
52 55 .3 5325.5 5.3 c .5 .5 .N_ 58 5:5 .355 32 55 5.5 553 SE .53 .mm .8» 5 5.5.55: ”535:8 55 55 555% 55:55; _

 

 

 

 

 

33 8.5 v 8.5 v 8.5 5.5 53 a: $5 55 55 5 .828
8.5 8.5 85 v 8.5 :5 52 as as 55 55 35
£5 93 52 85 85 3.5 55 8.5 g 55 <75
55 one on: 3.5 55.5 85 5.5 55 55 mi <25
33 5.5 5.5 v 2.5 53. m3 m3. 3.». £5 55 5 38553955
3.5 $5 8.5 8.5 $5 3.5 9.5 RN 5 mi 35583.. 85.5
3.5 .33 :5 5.5 85 5.5 8.5 2.5 3.5 «<5 55555
as 5.5 a... v 8.5 m2 5.. N2 52 5 «<5 5 aiaoauaafixm

2 2 2 2 8 .555:

5 o 5 .55 NE 5: 5 cm
Namabfioo How K F9550 “Gog—wok?

 

.926 555.. 55.55 5558.5 559555855 .355 5.5 558 55:55 5554 .v 535,—.

103

Table 5. Difference in daily fractional accretion rates (F AR) 1 of heifers fed high
compared to low energy diets for 12 wk.

 

 

Percent
H01 H122 Difference
Carcass fat FAR (%) 0.69 1.88 172
Extraparenchymal fat FAR (%) 1.14 2.35 106
Fat-free carcass FAR (%) 0.37 0.66 78
Body weight FAR (%) 0.49 0.71 45
Intraparenchymal fat FAR (%) 3.89 4.46 15
RNA FAR (%) 2.08 2.22 7
DNA FAR (%) 2.80 2.93 5
Parenchymal FAR (%) 2.53 2.65 5
Fat-free parenchymal FAR (%) 2.37 2.37 0

 

1 Variable “x” FAR = [In (x adjusted to 84 d) — In (x for baseline or at wk 11)]/84 d

2 Treatment groups are as follows: heifers on HO were fed the low energy diet for 12 wk
and heifers on H12 were fed the high energy diet for 12 wk. The low energy diet and
high energy diet were formulated for gains of 0.6 and 1.2 kg/d, respectively.

104

CHAPTER FOUR

EFFECTS OF FEEDING A HIGH ENERGY DIET TO PREPUBERTAL HEIFERS
FOR A LONGER DURATION ON ABUNDANCE OF LEPTIN AND IGF-I IN

MAMMARY TISSUE AND SERUM

ABSTRACT

Feeding a high energy diet to prepubertal heifers for a longer duration decreased
fat-free mammary parenchymal tissue mass when adjusted for fat-free carcass weight and
increased mammary fat. The mechanism by which feeding a high energy diet to
prepubertal dairy heifers impairs mammary growth relative to body growth is not clear
but may involve leptin and IGF-1 synthesis. Our objective was to determine the effects of
feeding prepubertal heifers a high energy diet for a longer duration on serum protein
levels of leptin, insulin-like growth factor-I (IGF-I), and IGF binding proteins (IGFBP);
protein concentration of leptin in extracts of mammary parenchymal tissue; and mRNA
expression of leptin, leptin receptor, IGF-I, and IGF-1 receptor in mammary parenchymal
tissue. Heifers (n = 64; age = 11 wk; BW = 107 kg) were randomly assigned to l of 4
treatments and fed 2 diets for different lengths of time: H0, H3, H6, H12 were fed the low
energy diet for 12, 9, 6, and 0 wk followed by the high energy diet for 0, 3, 6, and 12 wk,
respectively. The low and high energy diets were formulated for 0.6 and 1.2 kg daily
gain, respectively. Animals were slaughtered at 23 wk of age and mammary
parenchymal tissue samples were collected for analysis. Concentrations of leptin protein

in serum and mammary tissue and mRN A expression of leptin in mammary tissue

105

increased as heifers were fed the high energy diet for a longer duration. Dietary intake
did not alter the abundance of leptin receptor, IGF-I, or IGF-I receptor mRNA expression
in mammary tissue. A longer duration fed the high energy diet increased serum levels of
IGF-I and decreased abundance of IGFBP-2. Abundance of serum IGFBP-3 increased in
a linear fashion in heifers fed a high energy diet for a longer duration, but was also
significant for a cubic contrast. These dietary effects on leptin abundance, taken together
with prior research indicating that leptin inhibited the proliferation of mammary epithelial
cells, show that leptin may in part mediate the inhibitory effects of high energy intake on

mammary growth relative to body growth in prepubertal heifers.

Key Words: mammary gland, heifer, nutrition, leptin, IGF-I
Abbreviation Key: GAPDH = glyceraldehyde 3-phosphate dehydrogenase; IGF-I =

insulin-like growth factor-I; IGFBP = insulin-like growth factor binding protein

INTRODUCTION

Raising replacement heifers is costly for the producer and is estimated to be 20%
of total dairy herd expenses (Heinrichs, 1993). Growing heifers faster for earlier
breeding and calving can reduce these costs. However, feeding a high energy diet for
rapid gains of greater than 1 kg/d to prepubertal heifers can impair mammary growth
relative to body growth and reduce subsequent milk yield (Petitclerc et al., 1999; Radcliff
et al., 2000; Sejrsen et al., 1982). Since 1915, researchers have focused on understanding

the link between high energy intake and impairment of mammary growth (Eckles, 1915).

106

Several theories to explain the nutritional impairment of mammary growth have
been suggested, but the mechanism is still not understood clearly. Earlier studies noted
that high energy feeding resulted in undeveloped areas of mammary parenchyma and
lower milk yields (Swanson, 1960). More recent studies showed an increase in the
deposition of fat in the mammary glands of heifers fed for rapid gains during the
prepubertal period (Radcliff et al., 1997; Sejrsen et al., 1982). Mammary tissue extracts
from heifers fed a high compared to a low energy diet were less mitogenic for mammary
epithelial cells in vitro (Weber et al., 2000a). Also, bovine mammary fat pad explants
inhibit mammary epithelial cell proliferation in vitro (McFadden and Cockrell, 1993).
Taken together, these results indicate that adipocytes within the gland may produce a
substance that inhibits mammary epithelial cell growth. Leptin, a protein produced by fat
cells, may play a role in this inhibition. When infused into the mammary gland of
prepubertal heifers, leptin inhibited the insulin-like growth factor-I (IGF-I) stimulation of
mammary growth (Silva et al., 2003). Infusion of leptin also decreased the percentage of
BrdU-labeled mammary epithelial cells compared to control quarters infused with saline
(Silva et al., 2003). Whether leptin protein concentration and mRN A expression of leptin
are increased in the mammary tissue of heifers fed a high compared to a low energy diet
has not been established.

When heifers are fed a high energy diet associated with impaired mammogenesis,
serum growth hormone concentration decreases, but serum IGF-I concentration increases
(V estergaard et al., 2003). This seems contradictory because IGF-I is a known mitogen
for mammary epithelial cells (Shamay et al., 1988; Silva et al., 2005). No change in

mRNA expression or concentration of IGF-I in the mammary gland was noted in

107

prepubertal heifers fed a high or low energy diet (Weber et al., 2000b). Specific binding
of labeled IGF-I to mammary membranes was unaffected by feeding level in heifers
(Purup et al., 1999). However, mammary tissue explants from heifers fed a high energy
diet was less sensitive to IGF-I treatment compared to explants from heifers fed a low
energy diet (Purup et al., 1996). One explanation for this difference could be that
nutrition alters the number of IGF-I receptors present on mammary epithelial cells.

The objective of this experiment was to determine the effects of feeding a high
energy diet for a longer duration on serum protein levels of IGF-I, IGF binding proteins
(IGFBP), and leptin; protein concentration of leptin in extracts of mammary
parenchymal tissue; and mRNA expression of leptin and IGF-1 and their receptors in
mammary parenchymal tissue. We hypothesized that feeding a high energy diet would
increase abundance of IGF-I and IGFBP-3 and decrease IGFBP-2 in serum, but would
not change mRNA expression of IGF-I in mammary tissue. Expression of mRNA for the
IGF-I receptor in mammary parenchymal tissue would decrease as heifers were fed a
high energy diet for a longer duration. Feeding a high energy diet would increase leptin
protein concentrations in serum and mammary tissue and expression of mRN A for leptin
in mammary tissue. Results of treatment effects on body growth, carcass composition,

and mammary growth are presented elsewhere (Chapters 2 and 3).

108

MATERIALS AND METHODS

Animals and Treatment

All procedures were approved by the Michigan State University Animal Use and
Care Committee. Specific details of the experiment were described earlier (Chapter 2).
Briefly, 64 Holstein heifers (approximate age = 8 wk) were purchased within 4
consecutive wk in the fall (16 heifers/wk) with each wk classified as a separate purchase
group. Heifers were housed at the Michigan State University Beef Cattle Research
Center in an open-sided barn. Each purchase group was allowed a 3-wk adaptation
period for adjustment to facilities and diet. During this adaptation period, heifers were
gradually transitioned from a diet similar to that fed before purchase to a TMR similar to
a mixture of the treatment diets.

At 11 wk of age (BW = 107 d: 1 kg), heifers within each purchase group were
blocked by body weight and randomly assigned within block to 1 of 4 treatments. All
heifers within a given treatment in the same purchase group were housed in the same pen.
Thus, 4 pens of 4 heifers (1 pen per purchase group) were used in each of the 4
treatments. The treatment period lasted 12 wk and treatments were as follows: HO (low
energy diet fed for 12 wk); H3 (low energy diet fed for 9 wk followed by high energy diet
for 3 wk); H6 (low energy diet fed for 6 wk followed by high energy diet for 6 wk); and
H12 (high energy diet for 12 wk). The low energy diet was fed to achieve 0.6 kg average
daily gain (ADG) and consisted of 10% straw, 33% mature alfalfa silage, 33% oatlage,
and 24% concentrate on a DM basis. The low energy diet had 0.72 Meal NEg/kg DM,
16.3% CP, and 46.1% NDF. The high energy diet was fed to achieve 1.2 kg ADG and

consisted of 20% immature alfalfa silage, 20% corn silage, and 60% concentrate on a DM

109

basis. The high energy diet had 1.17 Mcal NEg/kg DM, 18.4% CP, and 22.6% NDF.
Diets were fed as a TMR and both diets and water were available ad libitum.
Composition of diets based on actual individual feedstuff analyses are presented
elsewhere in more detail (Chapter 2). Actual daily gains previously reported (Chapter 2)
averaged during the treatment period were 0.64, 0.65, 0.83, and 1.09 kg (3: 0.01) for H0,
H3, H6, and H12, respectively. Blood samples were taken on wk 0, 2, 4, 6, 8, 10, 11, and
12 during the treatment period and at slaughter. Blood samples were kept at room
temperature for 4 to 6 hr to clot and then refrigerated overnight at 4°C. Blood tubes were
then centrifuged at 2700 x g for 20 min at 4°C. Serum was collected and stored at -20°C
until analysis.

Heifers were slaughtered at the end of the treatment period when heifers were 23
wk of age. Heifers were allowed to consume the TMR from the prior day’s feeding until
they were transported at 0600 h via trailer to the abattoir at the Michigan State University
Meats Laboratory. Heifers were weighed, stunned by captive bolt, and killed by
exsanguination. Mammary glands were quickly removed afier slaughter (12 min :1:
0.002), cleaned, and bisected through the median suspensory ligament into right and left
halves. The left half was placed into a plastic bag and frozen by submersion into a dry
ice and 95% ethanol mixture. Frozen lefi hemiglands were stored at -20°C until further
analysis. Mammary parenchymal tissue samples were excised from the right rear quarter
for isolation of RNA and stored at -80°C until further analysis. The right rear quarter was
visually separated into 3 regions and small pieces of tissues were taken from the outer
third region of parenchyma closest to the fat pad, but not including any extraparenchymal

fat.

110

Preparation of Mammy Extracts

The frozen lefi half of the udder was cut transversely using a band saw into 5- to
10-mm thick slices. The parenchymal tissue was dissected from the extraparenchymal
fat. Parenchymal tissue was ground with liquid nitrogen into a fine powder using a
blender and stored at -20°C until extracts were prepared. Extracts were prepared by
weighing 1 g of parenchymal tissue powder into tarred tubes and then 2 mL of saline
(0.9% sodium chloride) was added to the tube. Tissue was homogenized for 1 min using
a Polytron (PT 10 20 350D, Switzerland). The tip of the Polytron was rinsed between
samples with 1 mL of saline, which was then combined with the homogenate to yield a
total of 3 mL, with a 3:1 saline to tissue ratio. Protease inhibitory cocktail (Sigma, 25
uL) was added to the homogenate, and the mixture was vortexed. Homogenate was
centrifuged at 10,000 x g and 4°C for 45 min. The supernatant was recovered and filtered
through a 0.22-micron low protein binding filter unit. Extracts of mammary tissue from
each heifer were stored at -20°C in microcentrifuge tubes until leptin concentration was

analyzed.

Leptin Radioimmunoassay (RIA)

Leptin concentrations in mammary extracts and serum samples (wk 0, 2, 4, 6, 8,
10, 11, 12, and slaughter) were determined as in Delavaud et al. (2000). Serum samples
at wk 0, 2, 4, 6, 8, 10, 11, and 12 were run in a separate assay from serum samples taken
at slaughter and mammary extracts. A standard curve (0.08 to 4 ng) prepared from
recombinant ovine leptin was included in the assay. For samples, triplicate aliquots of
200 uL were assayed. Both sample and standard tubes were incubated for 24 h at 4°C

with 50 uL of a 1:1,500 dilution of rabbit anti-ovine leptin antisera. After this incubation,

lll

tubes were incubated an additional 20 h afier 20,000 CPM ”SI-ovine leptin was added to
each tube. Final dilution of antisera was 1:15,000. Bound and free leptin were separated
by addition of 100 uL of sheep anti-rabbit plasma and the antibody-antigen complex was
precipitated through the addition of 2 mL of 4.4% polyethylene glycol and centrifugation.
Radioactivity of the pellet was quantified with a gamma counter (Cobra 11 Auto Gamma,

Packard BioScience Co, Dowers Grove, IL).

IGF-I Radioimmunoassay (RIA)

IGF-I concentration was measured in serum samples (wk 0, 2, 4, 6, 8, 10, 11, 12,
and slaughter) from each heifer. A total of 4 assays were performed, each with equal
representation of the treatment groups and with each purchase group as a separate assay.
Binding proteins were separated from IGF-I by acid-ethanol cryoprecipitation (Breier et
al., 1991). Formic acid (2.4 M; 25 uL) and ethanol (100%; 500 uL) were added to each
sample (100 uL) and the mixture was vortexed. Samples were incubated for 30 min at
room temperature and then centrifuged at 600 x g and 4°C. The supernatant (100 uL)
was pipetted into a clean tube with 2 mL of neutralizing buffer [53.5% ethanol/HCl
mixture (87.5%ethanol, 12.5% 2 M HCL) 28.6% 0.855 M Tris, 17.9% deionized H20].
For samples, duplicate aliquots of 200 uL were assayed. A standard curve (25 to 6400
pg) prepared from recombinant human IGF-I was included in the assay. Both standard
and sample tubes were incubated with 20,000 CPM 125l-IGF--I isotope per tube and 250
uL of rabbit anti-human IGF-I antisera (GroPep, Adelaide, SA, Australia) was added to
each sample for a final assay dilution of 1 to 100,000. Samples were vortexed and
incubated overnight at 4°C. Protein A (Staphylococcus aureus, Zymed, San Francisco,

CA) was added the next day at 1 mg/tube and tubes were vortexed. Afier a 2 h

112

incubation at room temperature, 2 mL of assay buffer (0.03 M NaH2P04, 0.01 M EDTA,
0.02% Na azide, 0.005% Tween 20, 0.02% protamine sulfite; pH to 7.5) was added to
each tube and then centrifuged for 30 min at 3070 x g. Liquid was decanted and
radioactivity of the pellet was quantified in a gamma counter (Cobra 11 Auto Gamma,

Packard BioScience Co, Dowers Grove, IL).

Western Ligand Blot

Western ligand blotting was used to analyze the relative abundance of IGFBP in
serum samples taken at wk 0 and wk 12 of the treatment period. Samples from 32 heifers
were analyzed using a total of 8 gels. Each gel contained wk 0 and wk 12 samples from 4
heifers, with each treatment group represented on a gel and a total of 2 gels for each
purchase group. A 12.5% acrylamide setparating gel solution was prepared and
deaerated [24.9 mL monomer solution (30.8% acrylamide, 2.7% bisacrylamide), 15 mL
4X separating buffer (1.5 M Tris-Cl, pH 8.8), 600 1.1L 10% SDS, and 19.2 mL deionized
H20]. Tetramethylethylenediamine (TEMED, 20 uL, Eastman, Rochester, NY) and 10%
ammonium persulfate solution (300 uL, Sigma) was added to the deaerated separating gel
solution. Separating gels were allowed to polymerize and were then removed from the
gel apparatus to the electrophoresis unit.

A mini vertical gel electrophoresis instrument (Hoefer SE 250, San Francisco,
CA) was used. A 4% acrylamide stacking gel solution was prepared and deaerated [2.64
mL monomer, 4.98 mL 4X stacking gel buffer (0.5 M Tris-Cl, pH 6.8), 198 uL 10%
SDS, and 12.18 mL deionized H20]. After adding TEMED (10 uL) and ammonium
persulfate (100 uL), the gel solution was pipetted on top of the separating gel and a comb

(1.5 mm thick, 16 X 5 mm) was inserted into each stacking gel. The gel was allowed to

113

polymerize for 1 hr and the comb was then removed. Tank buffer (0.025 M Tris, 0.192
M glycine, 0.1% SDS, pH 8.3) was placed into the upper and lower chambers and into
each well. Serum samples were prepared using equal part of sample and 2X treatment
buffer (0.125 M Tris-Cl, 4% SDS, 20% glycerol, 0.02% bromophenol blue, pH 6.8). The
samples were placed in a 70°C waterbath for 2.5 min to denature the protein in the
sample. The sample was then loaded at 200 ug of protein per lane. It was assumed that
serum samples were approximately 8% protein and were similar among samples. A
molecular ladder (BenchMark Prestained Protein Ladder, Invitrogen, Carlsbad, CA)
containing proteins from 10 to 190-kD was used as a marker for binding protein sizes.
The voltage remained constant at 180 V throughout electrophoresis (~75 min) and was
stopped when the bromophenol blue dye reached the bottom of the gel.

Gels and filter paper were placed into transfer buffer (0.025 M Tris, 0.192 M
glycine, 20% methanol, pH 8.3). Polyvinylidene difluoride (PVDF) membranes were
pre-wetted in 100% methanol before rinsing in transfer buffer. 0n the semi-dry transfer
cell (BioRad TransBlot SD, Hercules, CA); items were layered in the following order:
filter paper, PVDF membrane, gel, and filter paper. Voltage was set constant at 25 V for
approximately 130 min. Membranes were removed and placed in Tris buffer (100 mM
Tris/HCl, 0.9% NaCl, pH 7.5) with 1% BSA (RIA grade, Sigma, St Louis, MO) and
0.1% Tween 20 for 1 h and then incubated overnight with 500,000 CPM 125LIGF-I
isotope per mL of buffer. The next day membranes were washed using Tris buffer with
and without Tween 20, allowed to dry, and placed in a x-ray cassette with film. Film was
scanned with a densitometer (Fluor-S Multilrnager, BioRad; Quantity One v4.1, BioRad)

to quantify differences in the density of the bands corresponding to various IGFBP.

114

RNA Isolation

RNA was isolated from mammary parenchymal tissue using the Trizol method.
Tissue was kept cold using dry ice and 200 mg of mammary tissue was weighed and
added directly to 3 mL of Trizol reagent (Invitrogen) in a culture tube. Tissue was then
homogenized using a Polytron for 30 s. The tip of the Polytron was rinsed in between
samples using diethyl pyrocarbonate (DEPC, Sigma) treated water. Samples were split
into 3, l-mL samples and incubated at room temperature for 5 min. Chlorofonn (200 uL)
was added to each microcentrifuge tube. The tube was vortexed, incubated for 3 min at
room temperature, and centrifuged at 10,500 rpm for 15 min at 4°C. The upper phase
was transferred to a clean tube. Isopropanol (500 uL) was added to the precipitated
RNA. The tube was vortexed, incubated at room temperature for 10 min, and centrifuged
at 10,500 rpm for 10 min at 4°C. The isopropanol was decanted and the remaining pellet
was washed with 75% ethanol, centrifuged at 8500 rpm for 5 min at 4°C, decanted, and
dried. Water free of RNAse (52 uL), DNase buffer (10 uL of 10X; Ambion, Austin, TX),
and DNase (1 [LL of 2U/uL; Ambion) were added to the pellet and then incubated at 37°C
for 30 min. Then, RN ase-free water (37 uL) and phenol/chloroform (100 pL) were
added. The tube was shaken and centrifuged for 2 min at 14,000 rpm. The upper phase
was transferred to a fresh tube, sodium acetate (3 M, 9 pL) and ethanol (250 uL) were
added to this phase, and the mixture was incubated overnight at -20°C. The next day, the
tube was centrifuged at 14,000 rpm at 4°C for 15 min. The liquid was decanted and the
pellet was washed with ethanol (75%, 500 uL). The tube was centrifuged at 14,000 rpm
at 4°C for 10 min. The ethanol was decanted and the pellet was dried in the hood for 15

min. The pellet was resuspended in 50 [TL of nuclease-flee water and incubated at 60°C

115

for 10 min. The tube was then removed, put on ice, and the RNA concentration was
determined using a spectrophotometer (N anoDrop, ND-1000 Spectrophotometer,
Wilmington, DE). Quality of the RNA was also determined (Agilent 2100 BioAnalyzer,

Palo Alto, CA) and samples used for analysis were of high quality.

Quantitative Reverse Traascriptase — Polymerase Chain Reaction (RT-PCR)

A master mix (4 [1L 5X First Strand Buffer, 2 [1L 0.1 M DTT, 1 [1L SuperScript II,
2 pL H20, and 1 [LL 10 mM dNTP mix; Invitrogen) was prepared and kept on ice. RNA
was removed from the freezer, thawed, and 2 pg RNA was combined with 1 uL dTls
primer and RNase-free water to equal 10 [LL total volume. Tubes were placed in a
thermocycler (GeneAmp PCR System 9700, Applied Biosystems, Foster City, CA),
which was set for the following: 70°C for 5 min, 20°C for 5 min, 10 [LL of master mix
was added, 42°C for 60 min, 70°C for 5 min, 37°C for 20 min, and 0.5 uL of RNase H
was added when the reaction reached 37°C. The reaction tubes were removed from the
thermocycler and 0.2 ML of 0.5 M EDTA was added and mixed. Then, 25 [LL of water, 5
[LL 3M sodium acetate, and 125 uL of ethanol (-20°C) were added to the tube. This was
allowed to precipitate overnight at -20°C. Tubes were then centrifuged at 14,000 rpm and
4°C for 20 min and the supernatant was decanted. The pellet was washed with 250 [1L of
ethanol (75%, -20°C) and the tube was centrifuged at 14,000 rpm and 4°C for 6 min. The
supernatant was decanted and the pellet was allowed to dry for 15 min. The pellet was
resuspended in 50 [LL of water and incubated at 60°C for 5 min. The cDNA
concentration was analyzed using a spectrophotometer (N anoDrop), then was diluted to a

final concentration of 10 ng/uL, and stored at -80°C until the PCR reaction was initiated.

116

Primers (Table 1) were designed using Abi Prism Primer Express Version 2.0
(Applied Biosystems) and made by Invitrogen. Control genes [Glyceraldehyde-3-
phosphate dehydrogenase (GAPDH), Hydroxymethyl-bilane synthase (HMBS),
Hypoxanthine phosphoribosyltransferase l (HPRTl), TATA box binding protein (TBP),
Succinate dehydrogenase complex, subunit A (SDHA)] were tested to determine the
variability between samples for a given gene. Each sample tested was a pool of 2 heifers
from the same treatment group with a total of 2 samples per treatment group. The
coefficient of variation for samples was low and ranged from 1 to 2% for each of the
control genes. GAPDH was chosen because it has previously been used as a control gene
is experiments with mammary tissue (Smith and Sheffield, 2002; Song and Oka, 2003).

The amount of primer used was determined by performing an optimization matrix
for each primer using three concentrations of primers: 50:50 nM, 300:300 nM, 900:900
nM. Dissociation curves were similar for all concentrations and the 300:300 nM matrix
was chosen, thus 3 [LL of primer was used for all experiments. Standard curves were
performed using different amounts of cDNA (5, 10, 20, 40, 80 ng) and tested primers for
both GAPDH and the gene of interest. After normalization to GAPDH, the delta CT
values were plotted against the log amount of cDNA and the slope of this line was less
than 0.04 for all of the genes tested. This demonstrates that the efficiencies of the two
primers (GAPDH and gene of interest) were similar and that the data could be analyzed
using the delta delta CT method (Livak and Schmittgen, 2001). Each gene of interest
(leptin, leptin receptor, IGF-I, IGF-I receptor) and the control gene were measured in
duplicate. A total of 4 plates for each gene of interest were assayed with each plate

containing all samples from a single purchase group. Therefore, each plate contained

117

samples from 15 or 16 heifers with 3 or 4 heifers per treatment group. Within each well
of a 96-well reaction plate (MicroAmp Optical, Applied Biosystems), 20 ng of sample
cDNA (2 uL), 7.5 uL DEPC water, 3 [1L primer, and 12.5 uL Sybr Green (Applied
Biosystems) were added. The PCR system used was the ABI PRISM 7000 Sequence

Detection System (Applied Biosystems).

S_tatistica1 Analysis

Statistical analysis used the PROC GLM procedure of SAS. Pen (n = 4 heifers
per treatment within each purchase group) was used as the experimental unit with
purchase group as a random variable and treatment*purchase group as the error term.
Comparisons were tested using a linear (L) contrast with coefficients -7, -3, 1, and 9; a
quadratic (Q) contrast with coefficients 7, -4, -8, and 5; and a cubic (C) contrast with
coefficients -3, 8, -6, and 1 for H0, H3, H6, and H12, respectively. Least square means
and standard errors of the mean are presented. Differences were declared to be
statistically significant at P < 0.05 and tendencies at P < 0.10. All data from the 2 heifers
that were eliminated from the trial were removed so that final animal numbers were 16,
15, 16, and 15 for treatment groups H0, H3, H6, and H12, respectively.

Repeated measures (first-order autoregressive or compound symmetry covariance
structure) within the PROC MIXED procedure of SAS was used to test treatment effects
on serum IGF-I and leptin concentrations. Initial serum samples (wk 0) were used as a
covariate for analysis of leptin and IGF-1 concentrations in serum taken during the
treatment period. Results from both the leptin and IGF-1 RIA were log transformed to
achieve homogeneous variance and normality. Both non-transformed data and back

transformed data (see Appendix) are presented for serum leptin and IGF-1 concentrations.

118

The error term for the transformed data is the average of the back transformed lower and
upper 68% confidence intervals. For abundance of IGFBP-2 and -3, initial serum
samples (wk 0) were used as a covariate for analysis of serum samples from wk 12 of the
treatment period. The average of the initial serum samples is also presented. Expression
of mRNA for leptin, leptin receptor, IGF-I, and IGF-1 receptor in mammary parenchymal
tissue samples were normalized to the GAPDH expression of the sample that was assayed
on the same plate. Results were analyzed using the delta delta CT method with the H0
treatment group serving as the reference. Pearson correlations using the PROC CORR
procedure of SAS were calculated to determine the relationship between the following
variables: intraparenchymal fat percent, serum leptin protein concentrations, mammary

tissue leptin protein concentrations, and mammary tissue leptin mRNA expression.

RESULTS

Serum leptin concentrations from samples taken during wk 0, 2, 4, 6, 8, 10, 11,
and 12 of the treatment period are depicted in Figure 1. Initial serum leptin concentration
was not different (all contrasts: P > 0.10). Serum leptin concentrations at wk 2, 8, 11 and
at slaughter are shown in Table 2. No differences existed in serum leptin concentrations
at wk 2 and 8 of the treatment period (all contrasts: P > 0.10). At wk 11, serum leptin
concentration increased in a linear fashion and was also significant for a quadratic
contrast because of the small mean difference between H6 and H12. Leptin protein
concentrations in serum collected at slaughter and in mammary parenchymal tissue
samples increased as heifers were fed the high energy diet for a longer duration (Figure 2;

L: P < 0.03 and P < 0.01, respectively). These effects were also quadratic for tissue and

119

serum leptin concentrations because of the small mean difference between H6 and H12
(Q: P = 0.07 and P < 0.01, respectively).

Leptin mRN A expression in mammary parenchymal tissue increased as heifers
were fed the high energy diet for a longer duration (Figure 3; L: P < 0.02). Feeding a
high energy diet for 12 weeks (H12) increased leptin mRNA expression in mammary
parenchymal tissue by 2.5-fold compared to feeding a low energy diet (HO). However,
diet did not alter the abundance of leptin receptor mRN A expression in mammary
parenchymal tissue (Figure 4; all contrasts: P > 0.10).

Mammary gland composition was presented previously (Chapter 3). Because
leptin is mainly but not exclusively produced by adipocytes (Chilliard et al., 2001), it is
important to observe the effects of treatment on the percent of fat interspersed within the
parenchyma, called intraparenchymal fat. The percentage of intraparenchymal fat
increased as heifers were fed the high energy diet for a longer duration (Figure 5; L: P <
0.01). Intraparenchymal fat percent, leptin protein in serum, leptin protein in mammary
tissue, and leptin mRNA expression in mammary tissue were all positively correlated
with each other (Table 3), but no one relationship explained more than 30% of the
variation within a variable. For example, intraparenchymal fat percent explained
approximately 15 and 8% of the variation within leptin mRN A expression and leptin
protein concentration within mammary parenchymal tissue, respectively. Although not
presented in Table 3, carcass fat, as an indicator of body fatness, was positively
correlated with serum leptin concentration (r = 0.52, P < 0.0001).

Serum IGF-I concentrations from samples taken during wk 0, 2, 4, 6, 8, 10, 11,

and 12 of the treatment period are depicted in Figure 6. Initial serum IGF-I concentration

120

was not different (all contrasts: P > 0.10). Serum IGF-I concentration taken at wk 2 was
significant for a linear and quadratic contrast because of the similarities in H0, H3, and
H6, which were all consuming the low energy diet at wk 2 (Table 4; P < 0.01 for both).
At wk 8, serum IGF-I concentration increased in a linear response (P < 0.01) and was
significant for a cubic contrast (P < 0.01) because of the low mean for the H3 treatment
compared to H6 and H12. Serum IGF-I concentrations taken at wk 11 and at slaughter
were both significant for a linear contrast (P < 0.01) and tended to be significant at
slaughter for a quadratic response (P = 0.06).

When abundance of plasma IGFBP-2 at wk 0 was used as a covariate, protein
abundance of IGFBP-2 in plasma samples taken at slaughter (23 wk of age) decreased as
heifers were fed a high energy diet for a longer duration (Figure 7; L: P = 0.03).
Abundance of serum IGFBP-3 increased in a linear fashion as heifers were fed a high
energy diet for a longer duration when analyzed using wk 0 as a covariate in the model
(Figure 8; L: P < 0.01). Serum abundance of IGFBP-3 was also significant for a cubic
contrast when wk 0 was used as a covariate (C: P = 0.02).

There was no dietary effect on IGF-I mRNA expression in mammary
parenchymal (Figure 9; all contrasts: P > 0.10). However, a short duration of feeding
prepubertal heifers a high energy diet decreased IGF-I receptor mRNA expression in

mammary parenchymal tissue (Q: P = 0.02).

DISCUSSION

Previous studies have associated the amount of fat deposited within the body and

mammary gland with impaired mammary growth. The degree of body fatness is

121

negatively correlated to mammary parenchymal DNA content and milk production in
dairy cattle (Silva et al., 2002b). Obesity has also been linked to impaired mammary
development and lactogenesis in rodents (Flint et al., 2005; Rasmussen et al., 2001). The
growth of bovine mammary epithelial cell organoids was inhibited when co-cultured with
mammary fat pad explants (McFadden and Cockrell, 1993). Mammary tissue extracts
from prepubertal heifers fed a high compared to a low energy diet were less mitogenic for
mammary epithelial cells in vitro (Berry et al., 2003; Weber et al., 2000a). These
findings suggest that mammary fat secretes a factor that inhibits mammary epithelial cell
growth. A candidate for this factor may be leptin.

This is the first study indicating that protein concentration and mRNA expression
of leptin in mammary parenchymal tissue are increased by feeding a high energy diet to
prepubertal heifers. This effect is also influenced by the duration of time that heifers are
fed a high energy diet. These findings may help to explain why feeding a high energy
diet decreases mammary growth relative to body growth in prepubertal dairy heifers.
Also, our results may help to explain the reason why high energy diets decrease
mammogenesis while increasing serum IGF-I concentration, given that IGF-I is a known
mitogen for mammary epithelial cells in prepubertal heifers (Shamay et al., 1988; Silva et
al., 2005). Previous research indicated that leptin infusion into the mammary gland of
prepubertal dairy heifers decreased BrdU-labeling of mammary epithelial cells in IGF-I
treated quarters by 48% and in saline treated quarters by 19% (Silva et al., 2003).
Therefore, if heifers fed a high energy diet have greater leptin mRNA expression and

leptin protein concentration in mammary parenchymal tissue, then this higher abundance

122

of leptin might hamper mammary development directly or indirectly by inhibiting IGF-I
stimulation of mammary growth.

Leptin is mainly, but not exclusively, produced by adipocytes (Chilliard et al.,
2001) and deposition of fat within the mammary gland is increased when heifers are fed a
high energy diet (Capuco et al., 1995; Radcliff et al., 1997). Leptin mRNA is present in
mammary tissue and a bovine mammary epithelial cell line (MAC-T), leptin protein is
present in bovine milk (Smith and Sheffield, 2002), and the long form of the leptin
receptor is expressed on mammary epithelial cells (Silva et al., 20023). Also, bovine
mammary fat cells likely express mRNA for leptin (Block et al., 2003b). It is not known
whether nutrition alters leptin mRNA expression to a different extent in adipocytes versus
epithelial cells within the mammary gland. Since there was an increase in the percent of
intraparenchymal fat, the increase in leptin mRNA expression in this study could be due
to an increase in the number or size of fat cells within the parenchyma. Further studies
are needed to better understand nutritional effects on leptin mRN A expression in different
cell types within the mammary gland and could be accomplished through the use of laser
capture micro-dissection or in situ hybridization techniques.

Another potential question is how leptin delivery from the blood compared to
synthesis of leptin in the mammary gland affects leptin concentration in mammary tissue.
We found that leptin protein concentrations in both serum and mammary tissue at
slaughter increased as heifers were fed the high energy diet for a longer duration. Block
et al. (2003b) suggested that synthesis of leptin within the tissue rather than delivery from
the blood could determine concentration of leptin within developing mammary tissue. In

the present study, serum and mammary tissue leptin protein concentrations were

123

 

correlated positively and had the highest correlation of all variables tested (r = 0.55).
But, leptin protein concentration in mammary parenchymal tissue was also positively
correlated with mRN A expression of leptin in mammary parenchymal tissue and
intraparenchymal fat percent. These results indicate that leptin concentration in
mammary tissue is altered by dietary energy intake and that leptin level in the tissue is
likely due to leptin delivered to the tissue from the blood and leptin synthesized by
mammary epithelial cells and/or fat cells within mammary tissue.

Other studies have clearly demonstrated the nutritional regulation of plasma leptin
in young calves. Research indicates that increased energy consumption during the
preweaning period results in a greater concentration of leptin within the blood (Block et
al., 2003b; Brown et al., 2005b; Ehrhardt et al., 2000). The dietary effect on serum leptin
concentration was significant within 4 wk on treatment for preweaned calves (Brown et
al., 2005b). It is well established that feed-restricted or fasted animals have reduced
leptin concentrations, but variation in plasma leptin may be more related to body fatness
than plane of nutrition (Amstalden et al., 2000; Delavaud et al., 2000). Actual serum
leptin concentration in the present study averaged approximately 2 ng/mL, which is
similar to those reported in dairy heifers of the same age (Block et al., 2003b). Leptin
concentration in this study was similar for treatments prior to wk 10 of the treatment
period. Similarly, energy intake did not alter plasma leptin concentrations in heifer
calves from 8 to 14 wk of age (Brown et al., 2005b). Separation of treatment means for
serum leptin began to occur at wk 10 of the treatment period and by wk 11 were
significant for linear and quadratic effects. In addition, serum samples taken at slaughter

indicated that leptin concentration increased in a linear fashion as heifers were fed the

124

high energy diet for a longer duration. Serum leptin protein concentration at slaughter
was also quadratic because of the similar means for H6 and H12 treatments. It is not
known why treatment differences in serum leptin were not evident earlier during the
treatment period, especially for the H12 treatment. It is also difficult to separate the
effects of nutrition from the effects of physiological maturity on serum leptin
concentration. Garcia and co-workers (2002) noted that concentration of leptin began to
increase 16 wk prior to the onset of puberty in beef heifers. One heifer from the H12
treatment group was removed from the dataset due to the presence of a corpus luteum. It
is likely that H12 heifers were closer to the onset of puberty than the H0 heifers, so
perhaps differences in physiological maturity may have influenced serum leptin
differences at the end of the treatment period. These results also suggest that degree of
body fatness may not be as important a factor in determining leptin concentration as with
preruminant calves. In this study, carcass fat, as an indicator of body fatness, was
positively correlated with serum leptin concentration, but only explained approximately
30% of the variation in serum leptin. Similarly, body condition scores explained 37% of
the variation in serum leptin in well-fed cows in late lactation (Ehrhardt et al., 2000),
while body fatness explained 83% of the differences in serum leptin in milk-fed calves.
The degree of body fatness of heifers in this study may have not been high enough to
elicit an increase in leptin concentration in the H12 heifers earlier in the treatment period.
Although carcass fat and other measures of body fatness increased as heifers were fed the
high energy diet for a longer duration, the time during which fat accretion occurred in
these heifers was not measured (Chapter 2). Carcass fat percent nearly doubled and mass

of perirenal fat more than doubled in heifers fed the high energy diet for 12 wk compared

125

to heifers fed the low energy diet for 12 wk. Further research is needed to better
understand why nutrition seems to alter serum leptin concentration to a greater extent in
the preruminant period compared to older prepubertal heifers.

Insulin-like growth factor-I is a known mitogen of mammary epithelial cells and
serum IGF-I likely plays a role in the abundance of IGF-I in the mammary gland. Actual
serum concentrations of IGF-I were within a similar range to those previously reported in
young heifers (Brown et al., 2005b; Petitclerc et al., 1999). As expected, concentration of
serum IGF-I increased as heifers were fed the high energy diet for a longer duration and
this dietary effect is in agreement with previous research (Elsasser et al., 1989; Radcliff et
al., 2004; Vestergaard et al., 2003). Serum IGF-I concentration also dramatically
increased in H6 heifers (cubic effect at wk 8) and to a lesser extent in H3 heifers afier
being switched from the low to the high energy diet (no quadratic effect at wk 11).

Serum IGF-I mimicked the response in daily gain after the dietary switch in H6 and H3
heifers, as H6 and H3 treatments averaged 1.15 kg/d and 0.96 kg/d of gain, respectively,
during the time period fed the high energy diet (see Chapter 2).

The activity and availability of IGF-I is modulated by the IGF binding proteins.
Therefore, the regulation of IGFBP is crucial in understanding the function of IGF-I.
Nutrition also altered the protein abundance of serum IGFBP-2 and -3. The abundance of
serum IGFBP-2 decreased as heifers were fed a high energy diet for longer durations and
this dietary effect is in agreement with previous research (Radcliff et al., 2004;
Vestergaard et al., 2003). The major IGFBP within serum is IGFBP-3 (McGrath et al.,
1991). The abundance of serum IGFBP-3 increased in a linear fashion with time fed the

high energy diet, but was also significant for a cubic effect, due to the high abundance of

126

IGFBP-3 within the serum from H3 heifers. The abundance of IGFBP-3 in serum
typically mimics the response of IGF-I, and increases with a high plane of nutrition

(V estergaard et al., 2003). An acute increase in sermn IGFBP-3 in response to feeding a
high energy diet is not surprising since heifers in the Vestergaard study were only on
treatments for 5 wk. In the present study, the concentration of serum IGF-I increased in
heifers as they were fed the high energy diet for a longer duration. The amount of free
IGF-I in serum could potentially not differ between treatments because of the increase in
serum IGFBP-3. Since IGFBP-3 constitutes the majority of IGFBP within the serum, the
higher abundance of IGFBP—3 could possibly bind more serum IGF-I in heifers fed high
compared to low energy diets.

It seems contradictory that feeding a high energy diet to prepubertal heifers
increases the serum concentration of IGF-I, a known mitogen of the mammary gland,
given that high energy intake also decreases mammary growth relative to body growth
(Chapter 3). The liver is the primary source of circulating IGF-I in animals (Daughaday
and Rotwein, 1989) and serum concentration of IGF-I is increased by high energy intake
(Radcliff et al., 2004; Vestergaard et al., 2003). Bovine mammary epithelial cells express
IGF system receptors (IGF-I, -II, and insulin); but do not produce IGF-I (Hadsell et al.,
1990). IGF-I is produced in the stromal portion of the mammary gland (Hauser et al.,
1990). The level of IGF-I protein found within the mammary tissue is due to a
combination of IGF-I produced within the tissue and that which travels to the mammary
gland via the circulation. A high correlation (r = 0.84) existed between IGF-I
concentrations in serum and mammary extracts from heifers fed a high or a low energy

diet and with or without bST administration (Weber et al., 2000b). There was no dietary

127

effect on IGF-I concentration and abundance of mRN A in mammary parenchymal tissue
from prepubertal dairy heifers (Weber et al., 2000b). Therefore, this apparent
contradiction of high energy diets and increased concentration of serum IGF-I may be
subdued by the lack of a dietary effect on IGF-I concentration in mammary extracts.
Furthermore, no significant correlation existed between IGF-I concentration in mammary
extracts and the mitogenic response of the mammary extracts used in the Weber study
(Purup et al., 2000).

Negative effects on mammary growth that are attributed to feeding a high energy
diet may be caused by a decrease in sensitivity within the mammary gland to IGF-I. A
study using mammary explants from prepubertal heifers fed a high energy diet showed a
decrease in mammary tissue sensitivity to IGF-I treatment compared to explants from
heifers fed a low energy diet (Purup etal., 1996). However, because IGF-I and IGFBP
are expressed and secreted by mammary tissue and the IGFBP profile is modulated by
feeding level (Weber et al., 2000b), the difference in mitogenic response noted in Purup
et al. (1996) may not be due solely to differences in tissue sensitivity. Another study
reported no effect of diet on labeled IGF-I binding to mammary membranes (Purup et al.,
1999). In the present study, mRNA expression of IGF-I in mammary tissue was not
altered by nutrition. This is in agreement with Weber et al. (2000b) who reported no
dietary effect on IGF-I mRN A expression in the mammary gland of prepubertal heifers.
But, a short duration of feeding a high energy diet to prepubertal heifers decreased IGF-I
receptor mRNA expression in mammary parenchymal tissue. This could partially explain
the dietary difference in sensitivity of explants to IGF-I observed in the Pump study

(1996), but expression of mRNA for the IGF-I receptor was only decreased for the H3

128

and H6 treatment groups and the numerical differences in mRNA expression levels were
minimal. Unless the number of IGF-I receptors present on mammary epithelial cells is
decreased by translational or post-translational modifications, it is difficult to understand
how nutrition can affect the sensitivity of mammary tissue to IGF-I. However, a potential
inhibition of IGF-I stimulation via leptin, IGFBP-3, and/or another factor that has not
been elucidated could explain why feeding a high energy diet to prepubertal heifers

impairs mammary growth relative to body growth, but also increases serum IGF-I.

CONCLUSION

Feeding heifers a high energy diet for a longer duration of the prepubertal period
causes a linear increase in leptin protein concentrations at 23 wk of age in serum and
mammary parenchymal tissue and increases leptin mRN A expression in mammary
parenchymal tissue. These data, along with prior work indicating that leptin reduced the
proliferation of bovine mammary epithelial cells, indicate that leptin may play a role in
the inhibitory effects of a high plane of nutrition on mammary growth relative to body
growth in prepubertal heifers. Serum protein levels of IGF-I and IGFBP-3 were
increased with time fed the high energy diet, while IGFBP-2 levels were decreased. A
short duration of feeding a high energy diet decreased IGF-I receptor mRNA expression
in mammary tissue. But, dietary effects did not alter mRN A expression of leptin receptor
and IGF-1 in mammary parenchymal tissue. Nutrition clearly affects the concentration of
sermn IGF-I, but the extent that dietary intake alters IGF-I within mammary tissue seems

less profound.

129

Table 1. Primer Sequences (5’ to 3’).

 

 

Gene Name Sequence

GAPDH-forward GCATCGTGGAGGGACTTATGA
GAPDH-reverse GGGCCATCCACAGTCTTCTG
IGFI-forward TGCTGCTTCCTGGTCCTCAT
IGFI-reverse TGTGCCAGTCCCTTTCCATC
IGFI Receptor-forward TICTGGACAAGCCGGACAA
IGFI Receptor-reverse GCTGCTGATGATCTCCAGGAA
Leptin-forward GGGTGATTTCAGAGCCTTTGG
Leptin-reverse CCATCGTATGTIGTGTGGGAAT
Leptin Receptor-forward GGGCACATCCAAGCATTAAAA
Leptin Receptor-reverse GGCCGGCATCAAAGCTTT

 

130

 

 

 

 

 

 

 

 

Leptin (ng/mL)

 

 

 

 

Treatment Period (wk)

Figure 1. Serum leptin concentrations taken every 2 wk and weekly during the last 3 wk
of the treatment period in heifers 11 to 23 wk of age. Heifers (n = 15 or 16/trt) on
treatment H0 (—0——), H3 (- — -o- — -), H6 (- - -A- - -), H12 (— —D- --) were fed the
low energy diet for 12, 9, 6, 0 wk followed by the high energy diet for 0, 3, 6, 12 wk,

respectively. The serum leptin least square means are non-transformed.

131

 

50.800600: .m::o:w 325:0: N::.: 6:: .6:.: .mm .63 :8 E6 6:: .N:6 .: :6 .666 0:: m::>:0::: 8:068:00 0w::0>< :
50380600: .m::o:w ::0:::0:: 2:: 6:: .6:.: .mm 6:: :8 6:6 6:: .26 .m:6 .N:6 0:: m::>:0::: 3:068:00 0m::0>< 0
$338068: .m::o:m ::0::::0:: Q: 6:: .62 .mm 6:: :8 :6 6:: .6:6 .m:6 .36 0:: m::>:0::: 00:68:00 0w::0>< :

50800600: .m::o:w 828:0: NZ: 6:: .63 .m:.: 6:: :8 m:6 6:: .: :6 .m:6 .: :6 0:: 0:856: 3:068:00 0w::0><<

.::o:w ::0:::0:: 5:0 :8 8:206: 8:068:00 :25: 6:: :030: 08 .:o 0w::0>: 05 m: 30:06

63:86:: 8:0: 8:0 05. 608.805: :86 0:: 63:80:: 0::02 08:83 30056082: 056:0: 0: 608.805: me: 0:03 5:3 .

.::0::::0:: :0: 0:0: v 8:3 8:0: 8:0 08 m: :0: :o 98w 08:0::Qn::0:::0:: mam: mm 60:00:: m

05:0 u U :0::::6::O n O :::0::: n t: N

50.800600:

6%: N: 6:: 6.6 .:o m:::w :8 60:::::::8 0:03 0:6 30:0 .36: 6:: 0:6 3:0:0 3c: 0:: £03838: .:3 N: .6 .m .6 :8 0:6 >m:0:0
AME 08 .3 6030::8 0:3 6 .6 .6 .N: :8 0:6 .305 30: 08 68 0:03 NS: .6:.: .mm: 6:: :o 0:88.: ”032:8 m: 0:: 090% ::0::::0:.:t _

 

 

 

 

 

6:6 :66 v :66 v ...Q and 9.6 EN :m: :0Em:::m
$6 :66 :66 v ...U med :NN 66.: 6:: V:3 ::
3.6 $6 6:.6 ...m: 66.: 66.: 56.: 66.: 0:3 w
m : .6 :56 mm6 r< N66 3.: 66.: 65.: V:3 N
380.: 5:3
0 o .: .mm .2: 2: m: 2:
$3880 :8 R 3:80 ::0::::0:.:.

 

68:0: ::0::::0.: 08 .:o :3 08:00:: w::::6 0:0:::.::00:00 :63: 830.: :8 0508 08:60. 6:01: .N 03:.

132

 

 

Leptin (ng/mL or g)

 

 

H0 H3 H6 H12
Treatment

Figure 2. Leptin protein concentrations in mammary parenchymal tissue (ng/g wet
tissue) and serum (ng/mL) collected at slaughter from 23 wk old heifers. Heifers (n = 15
or 16/trt) on H0, H3, H6, H12 were fed the low energy diet for 12, 9, 6, 0 wk followed by
the high energy diet for 0, 3, 6, 12 wk, respectively. Serum leptin values were log
transformed to achieve homogeneous variance. Serum leptin means presented are back
transformed. The error term is the average of the lower and upper confidence intervals.
Actual values for mammary tissue leptin are not final due to ongoing assay validation.
Leptin protein concentrations in both mammary parenchymal tissue and serum samples
increased as heifers were fed a high energy diet for longer durations of time (Linear: P <
0.01 and P < 0.01, respectively). Concentrations of leptin in tissue and serum also had a

quadratic effect (Quadratic: P = 0.07 and P < 0.01, respectively).

133

 

3.0

 

 

 

     

:
.2
g 2.0
“ ‘6
a.
.E':
8 1.0 1
:1

0.0 -

H0 H3 H6 H12
Treatment

Figure 3. Leptin mRN A expression in mammary parenchymal tissue collected at
slaughter from 23 wk old heifers. Heifers (n = 15 or 16/trt) on H0, H3, H6, H12 were fed
the low energy diet for 12, 9, 6, 0 wk followed by the high energy diet for O, 3, 6, 12 wk,
respectively. Gene expression is normalized to GAPDH expression. The HO treatment is
the reference group. Leptin mRN A gene expression in mammary parenchymal tissue
increased as heifers were fed a high energy diet for longer durations of time (Linear: P <
0.02). Feeding a high energy diet for 12 Wk (1112) in length increased leptin gene
expression in mammary tissue by 2.5-fold compared to the low energy diet control

treatment (H0).

134

 

 

 

1.5

1.0 -

0.5 ‘

Leptin receptor expression
2 AACT

 

     

0.0 -

H0 H3

Treatment

H6 H12

Figure 4. Leptin receptor mRN A expression in mammary parenchymal tissue collected
at slaughter from 23 wk old heifers. Heifers (n = 15 or 16/trt) on H0, H3, H6, H12 were
fed the low energy diet for 12, 9, 6, 0 wk followed by the high energy diet for 0, 3, 6, 12
wk, respectively. Gene expression is normalized to GAPDH expression. The H0
treatment is the reference group. There was no response in leptin receptor mRN A gene
expression in mammary parenchymal tissue as heifers were fed a high energy diet for

longer durations of time (All contrasts: P > 0.10).

135

 

 

 

3O

 

3
g 20
-§‘ 10
a _
g
04

O_

 

 

H12

Treatment

Figure 5. Intraparenchymal fat percent in mammary tissue collected at slaughter from 23
wk old heifers. Heifers (n = 15 or l6/trt) on H0, H3, H6, H12 were fed the low energy
diet for 12, 9, 6, 0 wk followed by the high energy diet for O, 3, 6, 12 wk, respectively.

Intraparenchymal fat percent increased as heifers were fed a high energy diet for longer

durations of time (Linear: P < 0.01)

136

Table 3. Correlation of leptin variables and mammary intraparenchymal fat percent'.

 

2 - 2 - 3 .
Intrarnamz Mam leptm Mam. leptm Serum leptin
f mRNA protein proteln
at percent . . .
expressron concentrations concentrations
2
Ifnumam 1 0.39‘ 0.29T 0.40‘
at percent
Marn2 leptin " ‘
mRN A 1 0.43 0.34
expression
2 .
Mam. leptin 1 0.55m
protein
concentrations
Serum3 leptin 1
protein
concentrations

 

' Table contains r values.
2 Mam = Mammary parenchymal tissue

3 Serum leptin protein concentration data used for correlation were log transformed to
achieve homogeneous variance.

P < 0.0001
" P < 0.001
‘ P < 0.01

*P<0.03

137

 

 

 

 

350
300
250
200
150
100

50

 

 

 

 

 

IGF-I (ng/mL)

 

 

 

 

 

 

Treatment Period (wk)

Figure 6. Serum IGF-I concentrations taken every 2 wk and weekly during the last 3 wk
of the treatment period in heifers 11 wk to 23 wk of age. Heifers (n = 15 or 16/trt) on
treatment H0 (—<>—), H3 (- — -o- — -), H6 (- - -A- - -), H12 (— —Cl— —) were fed the
low energy diet for 12, 9, 6, 0 wk followed by the high energy diet for 0, 3, 6, 12 wk,

respectively. The serum IGF-I least square means are non-transformed.

138

 

 

 

503000500 .masoum 058050 SE 05 .02 .mm .om 00m oewm 05 ._.Nm .0: 6.: 05 £0385 00509.00 .0353. 0
503000050 .masocm 05805.: S: 05 .0: .mm .om 00m 5.5m 05 .asm .aém £3 05 $5505 0050580 ow80>< 0
50300005.— .masocm «58050 NE; 05 .02 .mm 63 00.0 mém 05 .mAm .04: .m0— 0.8 03:85 00509000 ow05>< 0
5260005.. .3005 «50500 SE 05 .0m .mm .03 .8“ 0mm 05 find. .000 .38 20 £0285 0052300 ow80>< <

.985 058055 500 00.0 2552: 0052.200 5&0 05 530— 06 m0 095% 05 mm 3200
088mg: :50 0005 2:. 008080.55 x000 0.3 08555 0:52 .0055.» 00005380: 05an 00 00808050 m2 053 «ED .

058050 50 050 v 5.? :50 00.5 05 mm 50 .8 macaw 000559058050 mam: mm 0200a m
0300 u 0 600.6000 0 O 5003 n A N
50200052

.23 m; 05 0.0 .00 gm .5.“ 03038.8.“ 053 5% .355 nwE 05 5:0 .655 30. 22. $338052 .0...» Q .0 .m .o 00.“ 5% E55
nwE 05 .3 530:0.“ 0.3 o .0 .o .m— 00m 5% .355 32 05 00m 053 ES .03 .mm .0: 00 05.20: ”030:0.“ mm 0.8 809% 05:05; _

 

 

 

 

$0 8.0 8.0 v .0 98 5 E E 520:2...
$0 Rd 8.0 v .0 SN 2: NE N: a? :
8.0 v 8.0 5.0 v .0 2a SN 03 m: 0.3 a
3.0 5.0 v 8.0 v ...< o: 0.2 0.0m new a? N
3805 29
0 o 0 .5 NE 00 mm on
mpg—HOD How R map—O 2.5—human.

 

 

.0350 058050 05 .00 x3 ofioomm wfihfi 00008050000 7:: 8:50 00.“ 0508 08:9. 3.54 .v 03:.

139

IGFBP-2 Abundance
(ODU/mmz)

 

Initial H0 H3 H6 H12

Treatment

Figure 7. Abundance of IGF-binding protein-2 (IGFBP-2) in serum samples taken at
slaughter with wk 0 samples serving as a covariate. Data represent means from 8 heifers
per treatment group. Heifers on H0, H3, H6, H12 were fed the low energy diet for 12, 9,
6, 0 wk followed by the high energy diet for 0, 3, 6, 12 wk, respectively. The abundance
of IGFBP-2 in serum decreased as heifers were fed a high energy diet for a longer

duration of time (Linear: P < 0.03).

140

 

 

 

 

 

IGFBP-3 Abundance
(ODU/mmz)

 

 

Figure 8. Abundance of IGF-binding protein-3 (IGFBP-3) in serum samples taken at
slaughter with wk 0 samples serving as a covariate. Data represent means for 8 heifers
per treatment group. Heifers on H0, H3, H6, H12 were fed the low energy diet for 12, 9,
6, 0 wk followed by the high energy diet for 0, 3, 6, 12 wk, respectively. Abundance of
IGFBP-3 increased in a linear fashion with a longer duration fed the high energy diet and

was also significant for a cubic contrast (P < 0.01 and P = 0.02, respectively).

141

 

 

1.5

 

 

 

c:
.2
m
m
0.
. a.
mi.
2 0.5 —

0.0 -

H0 H3 H6 H12
Treatment

Figure 9. IGF-I mRNA expression in mammary parenchymal tissue collected at
slaughter from 23 wk old heifers. Heifers (n = 15 or 16/trt) on H0, H3, H6, H12 were fed
the low energy diet for 12, 9, 6, 0 wk followed by the high energy diet for O, 3, 6, 12 wk,
respectively. Gene expression is normalized to GAPDH expression. The H0 treatment is
the reference group. There was no response in IGF-I mRNA gene expression in
mammary parenchymal tissue as heifers were fed a high energy diet for a longer duration

of time (All contrasts: P > 0.10).

142

 

 

1.5

 

      

 

C.‘
.2
a
2
g 1.0 ~
§ 2
5 N
g 0.5 ——
u'.

0.04

H0 H3 H6 H12

Treatment

Figure 10. IGF-I receptor mRNA expression in mammary parenchymal tissue collected
at slaughter from 23 wk old heifers. Heifers (n = 15 or 16/trt) on H0, H3, H6, and H12
were fed the low energy diet for 12, 9, 6, and 0 wk followed by the high energy diet for 0,
3, 6, and 12 wk, respectively. Gene expression is normalized to GAPDH expression.

The H0 treatment is the reference group. A short duration (3 or 6 wk) of feeding a high
energy diet to prepubertal heifers decreased IGF-I receptor mRN A expression in

mammary parenchymal tissue (Q: P = 0.02).

143

CHAPTER FIVE
SUMMARY AND CONCLUSIONS

My original hypothesis was that feeding a high energy diet to prepubertal heifers
for a short duration would increase the growth of mammary parenchyma, but that feeding
a high energy diet for a long duration would impair mammary growth relative to body
growth. However, the results presented in Chapter 2 and 3 of this dissertation indicate
that feeding heifers a high energy diet for a short duration alters body, carcass, and
mammary growth in a time-dependent manner, consistent with feeding a high energy diet
for a long duration. My hypothesis stemmed from studies that indicated a stimulatory
effect on mammary growth when heifers were fed high energy diets for short periods of
time, either before weaning (Brown et al., 20053) or in compensatory growth studies
(Choi etal., 1997). In these two studies, the positive influence on mammary growth is
more likely due to the stair-step regime and high energy intake before weaning, rather
than the duration of high energy intake.

In my study, daily gain, skeletal growth, and fat-free carcass weight increased in a
linear fashion as heifers were fed high energy diets for a longer duration. But, feeding a
high energy diet for a longer duration also increased fat deposition within the body and
carcass. Total weight of the mammary gland increased as heifers were fed the high
energy diet for a longer duration, but this was due to greater amounts of
extraparenchymal fat, as parenchymal tissue weights were not different. I chose to
express mammary tissue weights adjusted for carcass weight to more accurately reflect
the differences in physiological maturity of the heifers. F at-free mammary parenchymal

tissue weight adjusted for fat-free carcass weight decreased as heifers were fed the high

144

 

 

energy diet for a longer duration. An increase in body or carcass growth without a
proportional increase in mammary growth would result in less mammary parenchymal
tissue at puberty because heifers fed for rapid gains reach puberty at a younger age and
growth of the mammary gland becomes isometric relative to body growth around the
onset of puberty.

I also examined how dietary intake affects the accretion of several other tissues in
addition to the carcass and mammary gland. Liver weight increased in a linear fashion as
heifers were fed a high energy diet for a longer duration. However, similar to weight of
mammary parenchyma, uterine and ovarian weights adjusted for carcass weight
decreased as heifers were fed the high energy diet for a longer duration. An increase in
body or carcass growth without a proportional increase in reproductive organ weights
would likely result in smaller reproductive organs at puberty in heifers fed a high energy
diet.

A proposed mechanism for why high energy intake in prepubertal heifers impairs
mammogenesis relative to body growth is depicted in Figure 1. In support of this model,
my research demonstrated that high energy intake in prepubertal heifers increases the
amount of fat deposited within the carcass and mammary gland. Leptin is a protein that
is mainly, but not exclusively, secreted by adipocytes. I found that feeding heifers a high
energy diet for a longer duration increased leptin protein concentrations in serum and in
mammary tissue. Silva et al. (2003) found that leptin inhibited the proliferation of bovine
mammary epithelial cells. In addition, I found that high energy intake in heifers increases
mRNA expression of leptin. There was an increase in the percentage of fat within the

parenchymal tissue as heifers were fed the high energy diet for a longer duration.

145

Therefore, the increase in leptin concentration and mRN A expression in mammary
parenchymal tissue could be due to an increased number or size of adipocytes within the
mammary parenchyma, or possibly mammary epithelial cells from heifers fed a high
energy diet might express more leptin. An increase in leptin concentration in mammary
parenchymal tissue and an increase in leptin mRN A expression in mammary
parenchymal tissue might explain the impairment of mammogenesis relative to body
growth observed when prepubertal heifers are fed high energy diets.

An increase in serum IGF-I concentration due to high dietary intake had
previously seemed contradictory since IGF-I is a known mitogen for mammary epithelial
cells. But, my work also showed that high energy intake in prepubertal heifers does not
alter mRN A expression of IGF-I in mammary parenchymal tissue. Another study
indicated that IGF-I concentration in extracts of mammary tissue was not different from
heifers fed high compared to low energy diets (Weber et al., 2000b). These results
indicate that serum concentration of IGF-I may be increased by high energy intake, but in
mammary parenchymal tissue, protein levels and mRN A expression of IGF-I are not
altered by diet. This may help to explain the apparent contradiction of high energy intake
impairing mammogenesis while also increasing serum IGF-I concentrations.

An important question remains as to why a high energy intake in prepubertal
heifers increases muscle and fat accretion, but does not increase the grth of mammary
parenchymal, ovarian, and uterine tissues. Dietary intake might cause inhibitory and/or
mitogenic growth factors to be synthesized in one tissue differently than in another tissue.

Moreover, a potential inhibition of IGF-I stimulation of mammary growth via leptin,

146

IGFBP-3, and/or another factor that has not been elucidated could explain why feeding a

high energy diet to prepubertal heifers impairs mammogenesis relative to body growth.

Body Growth ‘

Blood

High 1 IGF- Iconcentrations
Energy —.
Intake 1 Leptin concentrations

_ Mammary Parenchymal Tissue Growth

1 Leptin concentrations

T Leptin mRNA expression

H Leptin-R mRN A expression
H IGF-I mRNA expression

H IGF-I-R mRNA expression

Figure l. A proposed mechanism for why feeding a high energy diet to prepubertal

heifers impairs mammogenesis relative to body growth. Results from this dissertation are

listed.

147

 

CHAPTER SIX
FUTURE RESEARCH

Many different studies could be carried out using tissues from the heifers in this

study.

1.) I measured the abundance of leptin mRN A expression within mammary parenchymal
tissue, which contains epithelial cells, stromal cells, and adipocytes. The next step would
be to determine if leptin mRN A expression is altered by diet specifically within epithelial
cells, fat cells, etc., in mammary tissue and could be determined using laser capture

microdissection techniques along with qRT-PCR or using in situ hybridization.

2.) Only four genes of interest were tested for mRN A expression in mammary tissue.
Use of microarray techniques would allow one to test possible changes in gene
expression in pathways involved with leptin, cell proliferation, cell death, etc. Other
factors with potential inhibitory roles in mammary growth (i.e. TGF-Bl, interleukin-6,
SOCS-3) could be found to be altered by nutrition or unknown factors could be found

within the mammary tissue that are altered by diet.

3.) Mammary tissue extracts from heifers fed high energy diets were less stimulatory to
mammary epithelial cells in vitro than extracts prepared from heifers fed low energy diets
(Weber et al., 2000a). Mammary tissue extracts from the heifers fed high energy diets
likely had lower amounts of a particular stimulatory factor or greater abundance of an

inhibitory factor. My dissertation research indicated that leptin, a potential inhibitory

148

factor, was increased in mammary tissue extracts from heifers fed high energy diets.
Mammary extracts could be prepared from tissue collected from heifers on this study and
used as treatments on mammary epithelial cells. If extracts from H12 heifers are less
stimulatory to mammary epithelial cells than extracts from H0 heifers, then it would be
interesting to block the action of leptin by adding a leptin antibody to the culture media.
If mitogenic activity is not different after the action of leptin is blocked, then it could be
concluded that leptin is the inhibitory substance causing a difference in mitogenic activity
within the mammary extracts. Also, co-culture of mammary fat pad explants with
mammary epithelial cells inhibits the growth of the epithelial cells (McFadden and
Cockrell, 1993). A study could also be performed, similar to the one above, but using
mammary fat pad explants instead of mammary tissue extracts. This would determine if
leptin secretion by fat cells (as opposed to potentially many cell types) could also be

blocked and result in growth stimulation of epithelial cells.

Other studies could be performed to better understand the role of nutrition on

body and mammary growth in prepubertal dairy heifers.

1.) The allometric phase of mammary growth seems to end, and an isometric phase
begins around the onset of puberty (Meyer et al., 2004; Sinha and Tucker, 1969). If the
onset of puberty could be delayed, then this might delay the switch to isometric growth,
resulting in increased mammary growth. In an abstract, Sejrsen et al. (1994) indicated
that GnRH immunization of heifers inhibited the onset of puberty, but did not alter

mammary gland weight. However, factors that trigger the switch from allometric to

149

isometric mammary growth are not known. Serum concentrations of leptin increase prior
to the attainment of puberty (Garcia et al., 2002). Daily treatment of mice with leptin (2
ug/g BW) accelerated the onset of puberty (Ahima et al., 1997). Blocking the increase in
serum concentrations of leptin may be one way to delay the onset of puberty in dairy

heifers.

2.) Increasing the energy and protein intake of dairy calves from 2 to 8 wk of age
increases mammary parenchymal tissue mass, and content of DNA and RNA (Brown et
al., 2005a). The reason for why high energy intake stimulates mammary growth in
preruminant calves, but not in older calves or heifers is not known. More research is
needed to answer this phenomenon. Whether the increase in mammary growth observed
in the Brown study will result in greater milk yield during first lactation will be answered

in another experiment currently taking place at MSU.

3.) Finding potential inhibitors of leptin might be one way that producers could feed
heifers faster without potential impairment of mammogenesis. Treatment of heifers on a
high plane of nutrition with bST decreased leptin mRNA expression in mammary tissue
compared to placebo-treated heifers on a high plane of nutrition (Lew et al., 2005).
Isoprothiolane treatment alters lipid mobilization and decreases serum lipid
concentrations in rats (Katamoto et al., 1991). Isoprothiolane also increased the
proliferation of mammary epithelial cells and inhibited the production of IL-1 and IL-6
by mammary epithelial cells (Okada et al., 1999). Pathway similarities exist between

leptin and interleukins. More research is needed to understand how bST alters leptin

150

expression and if isoprothiolane is an inhibitor of leptin expression in the mammary

gland.

4.) A question remains as to why high energy intake in prepubertal heifers increases
muscle and fat accretion, but does not increase mammary growth. Microarrays could be
used to quantitate differences in expression between heifers fed high compared to low
energy diets using mammary, muscle, and adipose tissue. A comparative analysis
between tissues could determine if particular mitogenic factors were upregulated within
muscle and adipose compared to mammary tissue. For example, my research determined
that IGF-I mRNA expression was not altered by feeding level and IGF-I receptor mRNA
expression was lower in heifers fed a high energy diet for a short duration (actual fold
change was minimal). However, Vestergaard et al. (2003) showed that IGF-I receptor

density in longissimus muscle was increased in heifers fed a high energy diet.

151

REFERENCES

Ahima, R. S., J. Dushay, S. N. Flier, D. Prabakaran, and J. S. Flier. 1997. Leptin
accelerates the onset of puberty in normal female mice. J. Clin. Invest. 99:391-395.

Ahima, R. S. and J. S. Flier. 2000. Leptin. Annu. Rev. Physiol. 62:413-437.

Akers, R. M. 1985. Lactogenic hormones: binding sites, mammary growth, secretory cell
differentiation, and milk biosynthesis in ruminants. J. Dairy Sci. 68:501-519.

Akers, R. M. 1990. Lactation physiology: a ruminant animal perspective. Protoplasma.
159:96-111.

Akers, R. M., S. E. Ellis, and S. D. Berry. 2005. Ovarian and IGF-I axis control of
mammary development in prepubertal heifers. Domest. Anim. Endocrinol. 29:259-267.

Allen, R. E., R. A. Merkel, and R. B. Young. 1979. Cellular aspects of muscle growth:
myogenic cell proliferation. J. Anim Sci. 49:115-127.

Amstalden, M., M. R. Garcia, S. W. Williams, R. L. Stanko, S. E. Nizielski, C. D.
Morrison, D. H. Keisler, and G. L. Williams. 2000. Leptin gene expression, circulating
leptin, and luteinizing hormone pulsatility are acutely responsive to short-term fasting in

prepubertal heifers: relationships to circulating insulin and insulin-like growth factor 1.
Biol. Reprod. 63:127-133.

Anderson, R. A. 1978. Embryonic and fetal development of the mammary apparatus.
Pages 3-40 in Lactation: A Comprehensive Treatise. Vol. IV. B. L. Larson, ed. Academic
Press, NY.

AOAC. 1990. Official Methods of Analysis. 15th ed, Assoc. Official Anal. Chem., Int.,
Arlington, VA.

Bar-Peled, U., B. Robinzon, E. Maltz, H. Tagari, Y. Fohnan, I. Bruckental, H. Voet, H.
Gacitua, and A. R. Lehrer. 1997. Increased weight gain and effects on production

parameters of Holstein heifer calves that were allowed to suckle from birth to six weeks
of age. J. Dairy Sci. 80:2523-2528.

Bauman, D. E. 1999. Bovine somatotropin and lactation: from basic science to
commercial application. Domest. Anim. Endocrinol. 17:101-116.

Bauman, D. E. and R. G. Vernon. 1993. Effects of exogenous bovine somatotropin on
lactation. Ann. Rev. Nutr. 13:437-461.

Baumrucker, C. R. and N. E. Erondu. 2000. Insulin-like growth factor (IGF) system in
the bovine mammary gland and milk. J. Mam. Gland Biol. Neoplasia. 5:53-64.

152

Baumrucker, C. R. and B. H. Stemberger. 1989. Insulin and insulin-like growth factor-I
stimulate DNA synthesis in bovine mammary tissue in vitro. J. Anim Sci. 67:3503-3514.

Baxter, R. C. 1993. Circulating binding proteins for the insulin-like growth factors.
Trends in Endocrinol. and Metab. 4:91-96.

Berg, R. T. and R. M. Butterfield. 1976. Growth patterns of bovine muscle, fat and bone.
Pages 611-619 in New concepts of cattle growth. Sydney University Press, Sydney,
Australia.

Berry, S. D. K., M. S. Weber Nielsen, K. Sejrsen, R. E. Pearson, P. L. Boyle, and R. M.
Akers. 2003. Use of an immortalized bovine mammary epithelial cell line (MAC-T) to
measure the mitogenic activity of extracts from heifer mammary extracts from heifer

mammary tissue: effects of nutrition and ovariectomy. Domest. Anim. Endocrinol.
25:245-253.

Blanche, D., R. L. Tellam, L. M. Chagas, M. A. Blackberry, P. E. Vercoe, and G. B.
Martin. 2000. Level of nutrition affects leptin concentrations in plasma cerebrospinal
fluid in sheep. J. Endocrinol. 165:625-637.

Block, S. S., W. R. Butler, R. A. Ehrhardt, A. W. Bell, M. E. Van Amburgh, and Y. R.
Boisclair. 2001. Decreased concentration of plasma leptin in periparturient dairy cows is
caused by negative energy balance. J. Endocrinol. 171:339-348.

Block, S. S., R. P. Rhoads, D. E. Bauman, R. A. Ehrhardt, M. A. McGuire, B. A.
Crooker, J. M. Griinari, T. R. Mackle, W. J. Weber, M. E. Van Amburgh, and Y. R.
Boisclair. 2003a. Demonstration of a role for insulin in the regulation of leptin in
lactating dairy cows. J. Dairy Sci. 86:3508-3515.

Block, S. S., J. M. Smith, R. A. Ehrhardt, M. C. Diaz, R. P. Rhoads, M. E. Van Amburgh,
and Y. R. Boisclair. 2003b. Nutritional and developmental regulation of plasma leptin in
dairy cattle. J. Dairy Sci. 86:3206-3214.

Breier, B. H., J. J. Bass, J. H. Butler, and P. D. Gluckman. 1986. The somatotrophic axis
in young steers: influence of nutritional status on pulsatile release of grth hormone and
circulating concentrations of insulin-like growth factor 1. J. Endocrinol. 111:209-215.

Breier, B. H., B. W. Gallaher, and P. D. Gluckman. 1991. Radioimmunoassay for insulin-
like growth factor-I: solutions to some potential problems and pitfalls. J. Endocrinol.
128:347-357.

Brown, E. G., M. J. VandeHaar, K. M. Daniels, J. S. Liesman, L. T. Chapin, J. W.
Forrest, R. M. Akers, R. E. Pearson, and M. S. Weber Nielsen. 2005a. Effect of

increasing energy and protein intake on mammary development in heifer calves. J. Dairy
Sci. 88:595-603.

153

Brown, E. G., M. J. VandeHaar, K. M. Daniels, J. S. Liesman, L. T. Chapin, D. H.
Keisler, and M. S. Weber Nielsen. 2005b. Effect of increasing energy and protein intake
on body growth and carcass composition of heifer calves. J. Dairy Sci. 88:585-594.

Butler, W. R. 2000. Nutritional interactions with reproductive performance in dairy
cattle. Anim. Reprod. Sci. 60-61:449-457.

Cady, R. A. and T. R. Smith. 1996. Economics of heifer raising programs. Proceedings
from the Calves, Heifers and Dairy Profitability National Conference, January 10-12,
1996. Harrisburg, PAzNRAES Pub]. 74. Ithaca, NY.

Capuco, A. V., G. E. Dahl, D. L. Wood, U. Moallem, and R. E. Erdman. 2004. Effect of
bovine somatotropin and rumen-undegradable protein on mammary growth of
prepubertal dairy heifers and subsequent milk production. J. Dairy Sci. 87:3762-3769.

Capuco, A. V., J. J. Smith, D. R. Waldo, and C. E. Rexroad, Jr. 1995. Influence of
prepubertal dietary regimen on mammary growth of Holstein heifers. J. Dairy Sci.
78:2709-2725.

Capuco, A. V., D. L. Wood, R. Baldwin, K. McLeod, and M. J. Paape. 2001. Mammary
cell number, proliferation, and apoptosis during a bovine lactation: relation to milk
production and effect of bST. J. Dairy Sci. 84:2177-2187.

Carro, E., R. Senaris, R. V. Considine, F. F. Casanueva, and C. Dieguez. 1997.
Regulation of in vivo grth hormone secretion by leptin. Endocrinology. 138:2203-
2206.

Carstens, G. E., D. E. Johnson, M. A. Ellenberger, and J. D. Tatum. 1991. Physical and
chemical components of the empty body during compensatory grth in beef steers. J.
Anim. Sci. 69:3251-3264.

Ceda, G. P, R. G. Davis, R. G. Rosenfeld, and A. R. Hoffman. 1987. The growth
hormone (GH)-releasing hormone (GHRH)-GH-somatomedin axis: evidence for rapid
inhibition of GHRH-elicited GH release by insulin-like growth factor I and II.
Endocrinology. 120: 1658-1662.

Chehab, F. F. 2000. Leptin as a regulator of adipose mass and reproduction. Trends in
Pharmacological Sci. 21 :309-314.

Chilliard, Y., M. Bonnet, C. Delavaud, Y. Faulconnier, C. Leroux, J. Djiane, and F.
Bocquier. 2001. Leptin in ruminants. Gene expression in adipose tissue and mammary
gland, and regulation of plasma concentration. Domest. Anim. Endocrinol. 21 :271-295.

Choi, Y. J ., I. K. Han, J. H. Woo, H. J. Lee, K. Jang, K. H. Myung, and Y. S. Kim. 1997.
Compensatory growth in dairy heifers: the effect of a compensatory growth pattern on
growth rate and lactation performance. J. Dairy Sci. 80:519-524.

154

Cohick, W. 1998. Role of the insulin-like growth factors and their binding proteins in
lactation. J. Dairy Sci. 81 : 1769-1777.

Collier, R. J ., M. F. McGrath, J. C. Byatt, and L. L. Zurfluh. 1993. Regulation of bovine
mammary growth by peptide hormones: involvement of receptors, growth factors and
binding proteins. Livest. Prod. Sci. 35:21-33.

Cordano, P., H. M. Harnmon, C. Morel, A. Zurbriggen, and J. W. Blum. 2000. mRNA of
insulin-like growth factor (IGF) quantification and presence of IGF binding proteins, and
receptors for grth hormone, IGF-I and insulin, determined by reverse transcribed

polymerase chain reaction, in the liver of growing and mature male cattle. Domest. Anim.
Endocrinol. 19:191-208.

D'Ercole, A. J ., A. D. Stiles, and L. E. Underwood. 1984. Tissue concentrations of
somatomedin C: further evidence for multiple sites of synthesis and paracrine or
autocrine mechanisms of action. Proc. Natl. Acad. Sci. USA. 81 :935-939.

Daniel, C. W., G. B. Silberstein, K. Van Horn, P. Strickland, and S. Robinson. 1989.
TGF-Bl -induced inhibition of mouse mammary ductal growth: developmental specificity
and characterization. Dev. Bio. 135:20-30.

Daughaday, W. H. and P. Rotwein. 1989. Insulin-like growth factor I and II. Peptide
messenger ribonucleic acid and gene sequences, serum, and tissue concentrations.
Endocrine Rev. 10:68-91.

Delavaud, C., F. Bocquier, Y. Chilliard, D. H. Keisler, A. Gertler, and G. Kann. 2000.
Plasma leptin determination in ruminants: effect of nutritional status and body fatness on

plasma leptin concentration assessed by a specific RIA in sheep. J. Endocrinol. 165:519-
526.

Dobos, R. C., K. S. Nandra, K. Riley, W. J. Fulkerson, I. J. Lean, and R. C. Kellaway.
2000. The effect of dietary protein level during the pre-pubertal period on mammary
gland development and subsequent milk production in fresian heifers. Livestock Prod.
Sci. 63:235-243.

Downing, J. A. and R. J. Scaramuzzi. 1991. Nutrient effects on ovulation rate, ovarian
function and the secretion of gonadotrophic and metabolic hormones in sheep. J. Reprod.
Fertil. Suppl. 43:209-227.

Drouillard, J. S., C. L. Ferrell, T. J. Klopfenstein, and R. A. Britton. 1991. Compensatory
growth following metabolizable protein or energy restrictions in beef steers. J. Anim. Sci.
69:811-818.

Eckles, C. H. 1915. The ration and age of calving as factors influencing the growth and
dairy qualities of cows. Res. Bull. No. 135, Missouri Agr. Exp., Columbia.

Ehrhardt, R. A., R. M. Slepetis, J. Siegal-Willott, M. E. Van Amburgh, A. W. Bell, and
Y. R. Boisclair. 2000. Development of a specific radioimmunoassay to measure

155

 

 

 

physiological changes of circulating leptin in cattle and sheep. J. Endocrinol. 166:519-
528.

Elsasser, T. H., T. S. Rumsey, and A. C. Hammond. 1989. Influence of diet on basal and
growth hormone-stimulated plasma concentrations of IGF-I in beef cattle. J. Anim. Sci.
67:128-141.

Erickson, J. C., G. Hollopeter, and R. D. Palmiter. 1996. Attenuation of the obesity
syndrome of ob/ob mice by the loss of neuropeptide Y. Science. 274: 1704-1707.

Faulkner, A. 1999. Changes in plasma and milk concentrations of glucose and IGF-I in
response to exogenous growth hormone in lactating goats. J. Dairy Res. 66:207-214.

Ferrell, C. L., R. H. Kohlmeier, J. D. Crouse, and H. Glimp. 1978. Influence of dietary
energy, protein and biological type of steer upon rate of gain and carcass characteristics. J
Anim. Sci. 46:255-270.

Flint, D. J ., M. T. Travers, M. C. Barber, N. Binart, and P. A. Kelly. 2005. Diet-induced
obesity impairs mammary development and lactogenesis in murine mammary gland. Am.
J. Physiol. Endocrinol. Metab. 288:E1179-1187.

Forsyth, I. A. 1989. Growth factors in mammary gland function. J. Reprod. F ertil.
85:759-770.

Fox, D. G. and J. R. Black. 1984. A system of predicting body composition and
performance of growing cattle. J. Anim Sci. 58:725-739.

Fox, D. G., R. R. Johnson, R. L. Preston, T. R. Dockerty, and E. W. Klosterrnan. 1972.
Protein and energy utilization during compensatory grth in beef cattle. J. Anim Sci.
34:310-318.

Fox, D. G., M. E. Van Amburgh, and T. P. Tylutki. 1999. Predicting requirements for
growth, maturity, and body reserved in dairy cattle. J. Dairy Sci. 82: 1968-1977.

Gabler, M. T. and A. J. Heinrichs. 2003. Dietary protein to metabolizable energy ratios
on feed efficiency and structural grth of prepubertal holstein heifers. J. Dairy Sci.
86:268-274.

Garcia, M. R., M. Amstalden, C. D. Morrison, D. H. Keisler, and G. L. Williams. 2003.
Age at puberty, total fat and conjugated linoleic acid content of carcass, and circulating

metabolic hormones in beef heifers fed a diet high in linoleic acid beginning at four
months of age. J. Anim Sci. 81:261-268.

Garcia, M. R., M. Amstalden, S. W. Williams, R. L. Stanko, C. D. Morrison, D. H.
Keisler, S. E. Nizielski, and G. L. Williams. 2002. Serum leptin and its adipose gene
expression during pubertal development, the estrous cycle, and different seasons in cattle.

J. Anim Sci. 80:2158-2167.

156

Garrett, W. N. 1980. Energy utilization by growing cattle as determined in 72
comparative slaughter experiments. Energy Metab. Proc. Symp. 26:3-7.

Gibson, C., M. Staley, and C. Baumrucker. 1999. Identification of IGF binding proteins
in bovine milk and the demonstration of IGFBP-3 synthesis and relase by bovine
mammary epithelial cells. J. Anim Sci. 77:1547-1557.

Gill, G. S. and F. R. Allaire. 1976. Relationship of age at first calving, days open, days
dry, and herdlife to a profit function for dairy cattle. J. Dairy Sci. 59:1131-1139.

Glimm, D. R., V. E. Baracos, and J. J. Kennelly. 1990. Molecular evidence for the
presence of growth hormone receptors in the bovine mammary gland. J. Endocrinol.
126:R5-R8.

Gluckrnan, P. D., B. H. Breier, and S. R. Davis. 1987. Physiology of the somatotropic
axis with particular reference to the ruminant. J. Dairy Sci. 70:442-466.

Goldspink, G. 1991. Prospectives for the manipulation of muscle growth. Pages 169-202
in Growth regulation in farm animals. Advances in meat research. Vol. 7. A. M. Pearson
and T. R. Dutson, eds. Elsevier Science Publishers, New York.

Gutierrez, C. G., J. Oldham, T. A. Bramley, J. G. Gong, B. K. Campbell, and R. Webb.
1997. The recruitment of ovarian follicles is enhanced by increased dietary intake in
heifers. J. Anim. Sci. 75:1876-1884.

Hach, C. C., B. K. Bowden, A. B. Kopelove, and S. V. Brayton. 1987. More powerful
kjedahl digestion method. J. AOAC. 70:783-787.

Hadsell, D. L., P. G. Campbell, and C. R. Baumrucker. 1990. Characterization of the
change in type I and II insulin-like growth factor receptors in bovine mammary tissue
during the pre- and postpartum period. Endocrinology. 126:637-643.

Hankins, O. G. 1946. Estimation of the composition of beef carcasses and cuts. USDA
Tech. Bull. 926, Washington, DC.

Harrison, R. D., I. P. Reynolds, and W. Little. 1983. A quantitative analysis of mammary
glands of dairy heifers reared at different rates of live weight gain. J Dairy Res. 50:405-
412.

Hausberger, F. X. 1959. Parabiosis and transplantation experiments of hereditarily obese
mice. Anat. Rec. 130:313-313.

Hauser, S., M. McGrath, R. Collier, and G. Krivi. 1990. Cloning and in vivo expression
of bovine growth hormone receptor mRNA. Mol. Cell. Endocrinol. 72:187-200.

Heinrichs, A. J. 1993. Raising dairy replacements to meet the needs of the 21 st century. J.
Dairy Sci. 76:3179-3187.

157

 

Heinrichs, A. J. and G. L. Hargrove. 1987. Standards of weight and height for Holstein
heifers. J. Dairy Sci. 70:653-660.

Henry, B. A., J. W. Goding, W. S. Alexander, A. J. Tilbrook, B. J. Canny, F. R. Dunshea,
A. Rao, A. Mansell, and I. J. Clarke. 1999. Central administration of leptin to
ovariectomized ewes inhibits food intake without affecting the secretion of hormones
from the pituitary gland: evidence for a dissociation of effects on appetite, and
neuroendocrine function. Endocrinology. 140:1 175-1 182.

Hodgkinson, S. C., G. S. G. Spencer, J. J. Bass, S. R. Davis, and P. D. Gluckman. 1991.
Distribution of circulating insulin-like growth factor-I (IGF-I) into tissues.
Endocrinology. 12922085-2093.

Hoffman, P. C. 1997. Optimum body size of Holstein replacement heifers. J. Anim. Sci.
75:836-845.

Hoffman, P. C. and D. A. Funk. 1992. Applied dynamics of dairy replacement grth
and management. J. Dairy Sci. 75:2504-2516.

Houseknecht, K. L. and C. P. Portocarrero. 1998. Leptin and its receptors: regulators of
whole-body energy homeostasis. Domest. Anim. Endocrinol. 15:457-475.

Hwa, V., Y. Oh, and R. G. Rosenfeld. 1999. The insulin-like growth factor-binding
protein (IGFBP) superfamily. Endocrine Rev. 20:761-787.

Ingvartsen, K. L. and Y. R. Boisclair. 2001. Leptin and the regulation of food intake,
energy homeostasis and immunity with special focus on periparturient ruminants.
Domest. Anim. Endocrinol. 21 :215-250.

Kabbali, A., W. L. Johnson, D. W. Johnson, R. D. Goodrich, and C. E. Allen. 1992.
Effects of compensatory growth on some body component weights and on carcass and
noncarcass composition of growing lambs. J. Anim. Sci. 70:2852-2858.

Katamoto, H., N. Yoneda, and Y. Shimada. 1991. Effects of isoprothiolane and
phytosterol on adipocytes metabolism and fatty acid composition of serum and tissue
lipids in rats. J. Vet. Med. Sci. 53:905-910.

Keifer, M. D., F. R. Masiarz, D. Bauer, and J. Zaph. 1991. Identification and molecular
cloning of two new 30 kDa insulin-like growth factor binding proteins isolated from adult
human serum. J. Biol. Chem. 266:9043-9049.

Kennedy, G. C. 1953. The role of depot fat in the hypothalamic control of food intake in
the rat. Proc. Royal Soc. 140:578-592.

Keown, J. F. and R. W. Everett. 1986. Effects of days carried calf, days dry, and weight
of first calf heifers on yield. J. Dairy Sci. 69:1891-1896.

158

Kerr, D. E., B. Laarveld, M. I. Fehr, and J. G. Manns. 1991. Profiles of serum IGF-I in
calves from birth to eighteen months of age and in cows throughout the lactation cycle.
Can. J. Anim. Sci. 71 :695-705.

Kertz, A. F., B. A. Barton, and L. F. Reutzel. 1998. Relative efficiencies of wither height
and body weight increase from birth until first calving in holstein cattle. J. Dairy Sci.
81 :1479-1482.

Kertz, A. F., L. R. Prewitt, and J. M. Ballam. 1987. Increased weight gain and effects on
growth parameters of Holstein heifer calves from 3 to 12 months of age. J. Dairy Sci.
70:1612-1622.

Kleinberg, D. L. 1997. Early mammary development: grth hormone and IGF-1. J.
Mam. Gland Biol. Neoplasia. 2:49-57.

Knight, C. H. 2000. The importance of cell division in udder development and lacation.
Livestock Prod. Sci. 66: 1 69-176.

Knight, C. H. and M. Peaker. 1982. Development of the mammary gland. J. Reprod.
Fertil. 65:521-536.

Knight, C. H. and C. J. Wilde. 1987. Mammary growth during lactation: implications for
increasing milk yield. J. Dairy Sci. 70:1991-2000.

Koch, A. R., R. P. Kromann, and T. R. Wilson. 1979. Grth of body protein, fat, and
skeleton in steers fed on three planes of nutrition. J. Nutr. 109:426-436.

Lacasse, P., E. Block, L. A. Guilbault, and D. Petitclerc. 1993. Effect of plane of nutrition
of dairy heifers before and during gestation on milk production, reproduction, and health.
J. Dairy Sci. 76:3420-3427.

Lammers, B. P. and A. J. Heinrichs. 2000. The response of altering the ratio of dietary

protein to energy on growth, feed efficiency, and mammary development in rapidly
growing prepubertal heifers. J. Dairy Sci. 83:977-983.

Lammers, B. P., A. J. Heinrichs, and R. S. Kensinger. 1999. The effects of accelerated
growth rates and estrogen implants in prepubertal Holstein heifers on estimates of

mammary development and subsequent reproduction and milk production. J. Dairy Sci.
82:1753-1764.

Lemozy, S., J. B. Pucilowska, and L. E. Underwood. 1994. Reduction of insulin-like
grth factor-I (IGF-I) in protein-restricted rats is associated with differential regulation
of IGF-binding protein in liver and serum. Endocrinology. 135:617-623.

Lew, B. J ., J. S. Liesman, M. D. S. Oliveira, and M. J. Vandehaar. 2005. Effects of diet
and bST on expression of leptin and leptin receptor in mammary parenchyma of heifers.
J. Dairy Sci. 88(Suppl. 1):277.

159

 

Little, W. and R. M. Kay. 1979. The effects of rapid rearing and early calving on the
subsequent performance of dairy heifers. Anim. Prod. 29:131-142.

Livak, K. J. and T. D. Schmittgen. 2001. Analysis of relative gene expression data using
real-time quantitative PCR and the 2'CT method. Methods. 25:402-408.

Luna-Pinto, G. and P. B. Cronge. 2000. The roles of the insulin-like growth factor system
and leptin as possible mediators of the effects of nutritional restriction on age at puberty
and compensatory growth in dairy heifers. South Afiican J. Anim. Sci. 30:155-163.

Maier, R., P. Schmid, D. Cox, G. Bilbe, and G. McCaster. 1991. Localization of
transforming growth factor-Bl, -B2 and -B3 gene expression in bovine mammary gland.
Mol. Cell. Endocrinol. 82:191-198.

Mantysaari, P., K. L. Ingvartsen, V. Toivonen, and K. Sejrsen. 1995. The effects of
feeding level and nitrogen source of the diet on mammary development and plasma

hormone concentrations of pre-pubertal heifers. Acta. Agric. Scand. A. Anim. Sci.
45:236-244.

McDowell, G. H. and I. C. Hart. 1984. Responses to infusion of growth hormone into the
mammary arteries of lactating sheep. Can. J. Anim. Sci. 64(Suppl.):306-307.

McFadden, T. B. and D. C. Cockrell. 1993. Regulation of growth in cultured mammary
epithelimn from beef and dairy heifers. Proc. New Zealand Soc. Anim. Prod. 53:143-145.

McFadden, T. B., T. E. Daniel, and R. M. Akers. 1990. Effects of plane of nutrition,
growth hormone and unsaturated fat on growth hormone, insulin and prolactin receptors
in prepubertal lambs. J Anim Sci. 68:3180-3189.

McGrath, M. F., R. J. Collier, D. R. Clemmons, W. H. Busby, C. A. Sweeny, and G. G.
Krivi. 1991. The direct in vitro effect of insulin-like growth factors (IGFs) on normal
bovine mammary cell proliferation and production of IGF binding proteins.
Endocrinology. 129:671-678.

Meyer, M. J ., A. V. Capuco, and M. E. Van Amburgh. 2004. Effects of energy intake and
time to puberty on mammary growth of prepubertal Holstein heifers. J. Dairy Sci.
87(Suppl l):497.

Moseley, W. M., J. B. Paulissen, M. C. Goodwin, G. R. Alaniz, and W. H. Claflin. 1992.
Recombinant bovine somatotropin improves growth performance in finishing beef steers.
J. Anim Sci. 70:412-425.

Murphy, L. J. and A. Ghahary. 1990. Uterine insulin-like growth factor-1: regulation of
expression and its role in estrogen-induced uterine proliferation. Endocr. Rev. 11:443-
453.

Nagaraja, T. G. and M. M. Chengappa. 1998. Liver abscesses in feedlot cattle: a review.
J. Anim. Sci. 76:287-298.

160

Niezen, J. H., D. G. Grieve, B. W. McBride, and J. H. Burton. 1996. Effect of plane of
nutrition before and afier 200 kilograms of body weight on mammary development of
prepubertal Holstein heifers. J. Dairy Sci. 79:1255-1260.

NRC. 2001. Nutrient Requirements of Dairy Cattle. Natl. Acad. Sci., Washington, DC.

Oh, Y. 1998. IGF-independent regulation of breast cancer growth by IGF binding
proteins. Breast Cancer Res. Treat. 47:283-293.

Okada, H., Y. Miyake, H. Ohtsuka, Y. Kiku, S. Fukuda, A. Watanabe, Y. Yokomizo, T.
J. Rosol, and T. Yoshino. 1999. Effects of isoprothiolane on cell growth of cultured
bovine mammary epithelial cells. J. Vet. Med. Sci. 61 :553-556.

Owens, F. N., P. Dubeski, and C. F. Hanson. 1993. Factors that alter the growth and
development of ruminants. J. Anim Sci. 71 :3138-3150.

Park, C. S., R. B. Danielson, B. S. Krefi, S. H. Kim, Y. S. Moon, and W. L. Keller. 1998.
Nutritionally directed compensatory growth and effects on lactation potential of
developing heifers. J. Dairy Sci. 81 :243-249.

Park, C. S., G. M. Erickson, Y. J. Choi, and G. D. Marx. 1987. Effect of compensatory
growth on regulation of growth and lactation: response of dairy heifers to a stair-step
growth pattern. J. Anim. Sci. 64:1751-1758.

Peel, C. J. and D. E. Bauman. 1987. Somatotrophin and lactation. J. Dairy Sci. 70:474-
486.

Peri, 1., A. Gertler, I. Bruckental, and H. Barash. 1993. The effect of manipulation in
energy allowance during the rearing period of heifers on hormone concentrations and
milk production in first lactation cows. J. Dairy Sci. 76:742-751.

Petitclerc, D., L. T. Chapin, and H. Tucker, A. 1984. Carcass composition and mammary
development responses to photoperiod and plane of nutrition in Holstein heifers. J. Anim.
Sci. 58:913-919.

Petitclerc, D., P. Dumoulin, H. Ringuet, J. Matte, and C. Girard. 1999. Plane of nutrition
and folic acid supplementation between birth and four months of age on mammary
development of dairy heifers. Can. J. Anim. Sci. 79:227-234.

Pirlo, G., M. Capelletti, and G. Marchetto. 1997. Effects of energy and protein

allowances in the diets of prepubertal heifers on growth and milk production. J. Dairy
Sci. 80:730-739.

Pritchard, D. E., H. D. Hafs, H. A. Tucker, L. J. Boyd, R. W. Purchas, and J. T. Huber.
1972. Growth, mammary, reproductive, and pituitary hormone characteristics of Holstein
heifers fed extra grain and melengesterol acetate. J. Dairy Sci. 552995-1004.

161

Pump, 8., P. Mantysaari, and K. Sejrsen. 1999. Effect of feeding level and nitrogen
source of the diet on GH, IGF-I, and prolactin receptors in mammary and liver tissue
from pre-pubertal heifers. Acta Agric. Scand. 49:96-102.

Purup, S. and K. Sejrsen. 2000. Influence of leptin on proliferation of bovine mammary
epithelial cells in collagen gel culture. 51st EAAP.230 (Abstr.).

Pump, 8., K. Sejrsen, J. Foldager, and R. Akers. 1993. Effect of exogenous bovine
growth hormone and ovariectomy on prepubertal mammary growth, serum hormones and

acute in-vitro proliferative response of mammary explants from Holstein heifers. J.
Endocrinol. 139:19-26.

Pump, 8., M. Vestergaard, and K. Sejrsen. 1996. The influence of feeding level and
exogenous bST on mammary tissue sensitivity to IGF-I in prepubertal heifers. J. Dairy
Sci. 79(Suppl. 1):71 (Abstr.).

Pump, 8., M. Vestergaard, M. S. Weber, K. Plaut, R. M. Akers, and K. Sejrsen. 2000.
Local regulation of pubertal mammary growth in heifers. J. Anim Sci. 78(Suppl. 3):36-
47.

Radcliff, R. P. 1995. Effects of prepubertal diet and injection of bST on body growth,
carcass composition, age at puberty, and mammary development of dairy heifers.
Michigan State University, East Lansing.

Radcliff, R. P., M. J. Vandehaar, L. T. Chapin, T. E. Pilbeam, D. K. Beede, E. P.
Stanisiewski, and H. A. Tucker. 2000. Effects of diet and injection of bovine

somatotropin on prepubertal growth and first-lactation milk yields of Holstein cows. J.
Dairy Sci. 83:23-29.

Radcliff, R. P., M. J. VandeHaar, Y. Kobayashi, B. K. Sharma, H. A. Tucker, and M. C.
Lucy. 2004. Effect of dietary energy and somatotropin on components of the
somatotropic axis in Holstein heifers. J. Dairy Sci. 87:1229-1235.

Radcliff, R. P., M. J. Vandehaar, A. L. Skidmore, L. T. Chapin, B. R. Radke, J. W.
Lloyd, E. P. Stanisiewski, and H. A. Tucker. 1997. Effects of diet and bovine
somatotropin on heifer growth and mammary development. J. Dairy Sci. 80:1996-2003.

Rasmussen, K. M., J. A. Hilson, and C. L. Kjolhede. 2001. Obesity may impair
lactogenesis II. J. Nutr. 131:3009S-301 lS.

Reeds, P. J. and H. J. Mersmann. 1991. Protein and energy requirements of animals
treated with beta-adrenergic agonists: a discussion. J. Anim Sci. 69: 1 532-1550.

Ronge, H., J. lBlum, C. Clement, F. Jans, H. Leuenberger, and H. Binder. 1988.
Somatomedin C in dairy cows related to energy and protein supply and to milk
production. Anim. Prod. 47: 165-183.

162

 

Ruan, W. and D. L. Kleinberg. 1999. Insulin-like growth factor I is essential for terminal
end bud formation and ductal morphogenesis during mammary development.
Endocrinology. 140:5075-5081.

Sandles, L. D. and C. J. Peel. 1987. Mammogenesis and first lactation milk yields of
identical-tvvin heifers following pre-pubertal administration of bovine growth hormone.
Anim. Prod. 45:349-357.

Schillo, K. K., J. B. Hall, and S. M. Hileman. 1992. Effects of nutrition and season on the
onset of puberty in the beef heifer. J. Anim. Sci. 70:3994-4005.

Sejrsen, K. 1994. Relationships between nutrition, puberty and mammary development in
cattle. Proc. Nutr. Soc. 53:103-111.

Sejrsen, K., W. J. Enright, D. J. Prendiville, L. J. Spicer, and D. Petitclerc. 1994.
Prevention of puberty by GnRH immunization of prepubertal heifers: plasma hormones
and mammary growth. J. Dairy Sci. 77(Suppl. 1):1098.

Sejrsen, K., J. Foldager, M. T. Sorensen, R. M. Akers, and D. E. Bauman. 1986. Effect of
exogenous bovine somatotropin on pubertal mammary development in heifers. J. Dairy
Sci. 69:1528-1535.

Sejrsen, K., J. T. Huber, and H. Tucker, A. 1983. Influence of amount fed on hormone
concentrations and their relationship to mammary growth in heifers. J. Dairy Sci. 66:845-
855.

Sejrsen, K., J. T. Huber, H. A. Tucker, and R. M. Akers. 1982. Influence of nutrition of
mammary development in pre- and postpubertal heifers. J. Dairy Sci. 65:793-800.

Sejrsen, K. and S. Purup. 1997. Influence of prepubertal feeding level on milk yield
potential of dairy heifers: a review. J. Anim. Sci. 75:828-835.

Sejrsen, K., S. Purup, M. Vestergaard, and J. Foldager. 2000. High body weight gain and
reduced bovine mammary growth: physiological basis and implications for milk yield
potential. Domest. Anim. Endocrinol. 19:93-104.

Shamay, A., N. Cohen, M. Niwa, and A. Gertler. 1988. Effect of insulin-like growth
factor I on deoxyribonucleic acid synthesis and galactopoiesis in bovine undifferentiated
and lactating mammary tissue in vitro. Endocrinology. 123:804-809.

Shamay, A., D. Werner, U. Moallem, H. Barash, and I. Bruckental. 2005. Effect of
nursing management and skeletal size at weaning on puberty, skeletal growth rate, and
milk production during first lactation of dairy heifers. J. Dairy Sci. 88: 1460-1469.

Silva, L. F. P., J. S. Liesman, B. E. Etchebarne, M. S. Weber Nielsen, and M. J.
VandeHaar. 2005. Short communication: intramarnmary infusion of IGF-I increases

bromodeoxyuridine labeling in mammary epithelial cells of prepubertal heifers. J. Dairy
Sci. 88:2771-2773.

163

Silva, L. F. P., J. S. Liesman, M. S. Weber Nielsen, and M. J. Vandehaar. 2003.
Intramammary infusion of leptin decreases proliferation of mammary epithelial cells in
prepubertal heifers. J. Dairy Sci. 86(Suppl. 1):685.

Silva, L. F. P., M. J. Vandehaar, M. S. Weber Nielsen, and G. W. Smith. 2002a. Evidence
for a local effect of leptin in bovine mammary gland. J. Dairy Sci. 85:3277-3286.

Silva, L. F. P., M. J. VandeHaar, B. K. Whitlock, R. P. Radcliff, and H. A. Tucker.
2002b. Short communication: relationship between body growth and mammary
development in dairy heifers. J. Dairy Sci. 85:2600-2602.

Sinha, Y. and H. Tucker, A. 1969. Mammary development and pituitary prolactin levels
of heifers from birth through puberty and during the estrous cycle. J. Dairy Sci. 52:507-
512.

Skarr, T. C., C. R. Baumrucker, D. R. Deaver, and J. W. Blum. 1994. Diet effects and
ontogeny of alterations of circulating insulin-like growth factor binding proteins in
newborn dairy calves. J. Anim Sci. 72:421-427.

Smith, J. L. and L. G. Sheffield. 2002. Production and regulation of leptin in bovine
mammary epithelial cells. Domest. Anim. Endocrinol. 22: 145-154.

Song, S. and T. Oka. 2003. Regulation of type II deiodinase expression by EGF and
glucocorticoid in HCll mouse mammary epithelium. Am. J. Physiol. Endocrinol. Metab.
284:E1119-1124.

Swanson, E. W. 1960. Effect of rapid grth with fattening of dairy heifers on their
lactational ability. J. Dairy Sci. 3:377-387.

Swanson, E. W. and J. I. Poffenbarger. 1979. Mammary gland development of dairy
heifers during their first gestation. J. Dairy Sci. 62:702-714.

Thissen, J. P., J. M. Ketelslegers, and L. E. Underwood. 1994. Nutritional regulation of
the insulin-like growth factors. Endocrine Rev. 15:80-101.

Tucker, H. 1987. Quantitative estimates of mammary growth during various
physiological states: a review. J. Dairy Sci. 70:1958-1966.

Tucker, H., A. 1969. Factors affecting mammary gland cell numbers. J. Dairy Sci.
52:720-729.

Tucker, H. A. 1964. Influence of number of suckling young on nucleic acid content of
lactating rat mammary gland. Proc. Soc. Exp. Biol. Med. 116:218-220.

Tucker, H. A. 1966. Regulation of mammary nucleic acid content by various suckling
intensities. Am. J. Physiol. 210: 1209-1214.

164

Tucker, H. A. 1981. Physiological control of mammary growth, lactogenesis, and
lactation. J. Dairy Sci. 64:1403-1421.

Tucker, H. A., J. A. Koprowski, and W. D. Oxender. 1973. Relationships among
mammary nucleic acids, milk yield, serum prolactin, and growth hormone in heifers from
3 months of age to lactation. J. Dairy Sci. 56:184-188.

Van Amburgh, M. E. 2005. An evaluation of the calf and heifer models within the 2001
dairy NRC publication. J. Dairy Sci. 88(Suppl. l):439.

Van Amburgh, M. E., D. G. Fox, D. M. Galton, D. E. Bauman, and L. E. Chase. 1998a.
Evaluation of National Research Council and Cornell Net Carbohydrate and Protein
Systems for predicting requirements of Holstein heifers. J. Dairy Sci. 81:509-526.

Van Amburgh, M. E., D. M. Galton, D. E. Bauman, R. W. Everett, D. G. Fox, L. E.
Chase, and H. N. Erb. 1998b. Effects of three prepubertal body growth rates on
performance of Holstein heifers during first lactation. J. Dairy Sci. 81 :527-538.

Van Amburgh, M. E., D. M. Galton, D. G. Fox, and D. E. Bauman. 1991. Optimizing
heifer growth. Proc. Cornell Nutr. Conf. Feed Manuf. Conf.:85-93.

Vandehaar, M. J. 1998a. Accelerated heifer growth: truth or consequences. Tri-State
Dairy Nutrition Conference: 1 53-166.

Vandehaar, M. J. 1998b. Efficiency of nutrient use and relationship to profitability on
dairy farms. J. Dairy Sci. 81:272-282.

Vander Kooi, W. K., M. J. Vandehaar, B. K. Sharma, M. Binelli, H. Tucker, A., R. M.
Akers, and W. M. Moseley. 1995. Comparison of growth hormone-releasing factor and

somatotropin: the somatotropic axis in lactating primiparous cows. J. Dairy Sci. 78:2140-
2149.

Vega, J. R., C. A. Gibson, T. C. Skarr, D. L. Hadsell, and C. R. Baumrucker. 1991.
Insulin-like growth factor (IGF)-I and II and IGF binding proteins in serum and

mammary secretions during the dry period and early lactation in dairy cows. J. Anim Sci.
69:2538-2547.

Vestergaard, M., S. Purup, J. Frystyk, P. Lovendahl, M. T. Sorensen, P. M. Riis, D. J.
Flint, and K. Sejrsen. 2003. Effects of growth hormone and feeding level on endocrine

measurements, hormone receptors, muscle growth and performance of prepubertal
heifers. J. Anim. Sci. 81 :2189-2198.

Vestergaard, M., S. Purup, P. Henckel, E. Tonner, D. J. Flint, L. R. Jensen, and K.
Sejrsen. 1995. Effects of growth hormone and ovariectomy on performance, serum

hormones, insulin-like growth factor-binding proteins, and muscle fiber properties of
prepubertal fresian heifers. J. Anim Sci. 73:3574-3584.

165

Waldo, D. R., H. F. Tyrrell, A. V. Capuco, and C. E. Rexroad, Jr. 1997. Components of
growth in Holstein heifers fed either alfalfa or corn silage diets to produce two daily
gains. J. Dairy Sci. 80:1674-1684.

Weber, M. S., S. Purup, M. Vestergaard, R. M. Akers, and K. Sejrsen. 2000a. Nutritional
and somatotropin regulation of the mitogenic response of mammary cells to mammary
tissue extracts. Domest. Anim. Endocrinol. 18:159-164.

Weber, M. S., S. Purup, M. Vestergaard, R. M. Akers, and K. Sejrsen. 2000b. Regulation
of local synthesis of insulin-like growth factor-1 and binding proteins in mammary tissue.
J. Dairy Sci. 83:30-37.

Weber, M. S., S. Purup, M. Vestergaard, S. Ellis, J. Scndergard-Anderson, R. Akers, and
K. Sejrsen. 1999. Contribution of insulin-like growth factor (IGF)-I and IGF-binding

protein-3 to mitogenic activity in bovine mammary extracts and serum. J. Endocrinol.
161:365-373.

Whitlock, B. K., M. J. VandeHaar, L. F. P. Silva, and H. A. Tucker. 2002. Effect of
dietary protein on prepubertal mammary development in rapidly growing dairy heifers. J.
Dairy Sci. 85: 1 516-1525.

Wiltbank, J. N., C. W. Kasson, and J. E. Ingalls. 1969. Puberty in crossbred and
straightbred beef heifers on two levels of feed. J. Anim. Sci. 29:602-605.

Winder, S. J ., A. Turvey, and I. A. Forsyth. 1989. Stimulation of DNA synthesis in
cultures of ovine mammary epithelial cells by insulin and insulin-like growth factors. J.
Endocrinol. 123:319-326.

Wong, E. A., S. M. Ohlsen, J. A. Godfredson, D. M. Dean, and J. E. Wheaton. 1989.
Cloning of ovine insulin-like growth factor-I cDNAs: heterogeneity in the mRNA
population. DNA. 8:649-657.

Woodward, T. L., W. E. Beal, and R. M. Akers. 1993. Cell interactions in initiation of
mammary epithelial proliferation by oestradiol and progesterone in prepubertal heifers. J.
Endocrinol. 136:149-157.

Yonekura, S., K. Sakarnoto, T. Komatsu, A. Hagino, K. Katoh, and Y. Obara. 2005.
Grth hormone and lactogenic hormones can reduce the leptin mRN A expression in
bovine mammary epithelial cells. Domest. Anim. Endocrinol. in press.

Zhang, J ., D. G. Grieve, R. R. Hacker, and J. H. Burton. 1995. Effects of dietary protein
percentage and beta-agonist administered to prepubertal ewes on mammary gland growth
and hormone secretions. J. Anim Sci. 73:2655-2661.

Zhang, Y., R. Proenca, M. Maffei, M. Barone, L. Leopold, and J. M. Friedman. 1994.
Positional cloning of the mouse obese gene and its human homologue. Nature. 372:425-
432.

166

Zhao, X., B. W. McBride, 1. Politis, H. T. Huynh, R. M. Akers, J. H. Burton, and J. D.
Turner. 1992. Receptor binding and growth-promoting activity of insulin-like growth
factor-I in a bovine mammary cell line (MAC-T3). J. Endocrinol. 134:307-312.

167

Medication

APPENDIX

Various medications were used depending on the symptoms and previous

treatments [Nuflor (Schering-Plough), Micotil (Elanco), Recovr (Fort Dodge), A-180

(Pfizer), LA-200 (Pfizer), Excenel (Pfizer)]. Listed below was the protocol for which

drugs were used depending on symptoms:

 

 

Symptom Drug

Lame LA-200

Respiratory (1St time) Nuflor or Nuflor + Recovr
Respiratory (2nd time) Micotil or Micotil + Recovr
Respiratory (3rd time) A-180

If sick and near slaughter Excenel

 

168

0530 n 0 6:96.30 n 0 ”30:5 u A N

5038383
.39— N._ 93 We mo 83% 8m “down—3&8 203 “0:6 .335 .32 98 5% 3.85 >22 2:. 503838.. .V—B Q .0 .m .o .8.“ 8% .335
:9: 05 .3 330:8 x3 c .c .a .2 .8.“ 8% .335 32 05 com v.83 Q3 .03 .23 6E no Euro: EBB—om mm 08 anew 3258C. _

 

 

 

 

Rd ddd 8d v an 3d 2.. 3m 2.. - 3m E 8:» .3 3.3.3
Rd dad 8d v 2: d2: dd: 23 8d - m .3 .8233
8d v dd V dd V dd 8.. 8d :d 84 - 33.. .x. 3.3.3 as:
Ed 8d V dd V dd 3..“ K... add 8d - E 33.... .23
Ed add 8d V «dd 2d SK a: d: .3. do. .338 83.33
2d 8d V dd V dd Rd 3d 8d d3 .92 3m 9. 8:». .3 .3980
2d 3d 8d v end ...2 ...S «d 3 .mdd 3 .3 32.0
dad 3d 8d v Ed 3d ed Rd 3d .md_ 25 3 8:3 332.. .805
2d mmd 8d v 2d 2. d2 ...2 3; .dd. 3. .520... .305
3d 8d V dd v Rd and mdd add d. K N. : .\. .53. .285
Ed 8d V dd v Gd 3; we 2: as Ed .x. .3 .305
odd :d 8d V 2d 3: 2: S: ..2 SN .\. 32.3 .285
Ed dd V dd V end 9% ddm ..d... «d. .3. ammo .x. .53.... .305
2d dud dd v 8d 2: m. a 3. odd .ddm we. .23... .330

2 2 2 E v 2. 33.3

o o 4 .mm 2: 3 3 dz .5
$3.280 no.“ m _390 30830;

 

.Qogommcdbéocv 22:89:00 3353 9:. aces 8m 3808 08:3 634 .m 03:.

169

 

.338 ..E a0 8585 $800.. 88308 wfim: 8088300 0:03 0808080008 3303 80800 0:20QO a

.983 808808 :80 :8 £03008 00:08.88 8&3 8:0 8032 05 .8 0w80>0 05 8 320a
80:00:08 :88 8.80 05. 8088.385 x03 08 8080008 08.02 00:08; 8805880: 05200 2 3:80.388 m2 0:03 80D .

808808 :0: 0:0: v 53> 8:8 .880 08 00 :0: 8 98% 0005089808008 wfim: mm w0_oom m

170

80800:: :0: 0:0: :0 8:3 8:0: 8::0 0:: 00 :0: 8 :88 00088980800: 87.: Mm 8080: 0

08:0 n 0 “0308050 n 0 £008.: n A 0

53:80:00:
.809: N: :80 ed .8 0::0w 8.: 830888.: 0:03 :08 88:0 :38 8:0 :08 38:0 30: 0:: 53:80:00: J? N: .0 .m .o 8.: :08 88:0
:2: 0:: :3 80328.: 0:? o 6 d .N: 8.: :08 3:0:0 30: 08 80.: 0:03 NS: .3: .mm d: :0 80:8: ”030:0: 00 0:0 0:88 ::08:00:.:. :

 

 

 

 

 

00.0 0....0 00.0 :0 00.0 00.0 00.0 00.0 00.0 05.300200 :0 .0 0:32.: 05:00:20.:
00.0 00.0 00.0 :0 0.0: 0.0: 0.0: 0.0: 00.0 0 0:320 08008200
00.0 00.0 00.0 0.: 0:: 0:: :0: 00: 0.0: 20:03 00028 00 00:0 0500820.: 80-00.:
00.0 00.0 00.0 00.0 00: 00: 00: 00: 00.0 0 0800820.: 80-00:
00.0 00.0 00.0 0:.0 0.00 :.::. 0.00 0.:0 00.0 20:03 00028 00: 00:0 .8 08000500000:
00.0 00.0 :00 v 00.: 0.0.0. :00 0.0: 0.0: 00.0 00000 .x. .00.: 08000500000:
00.0 00.0 :00 v 00.0 :0:. 0.00 0.00 :00 00.0 0 .8 08008200000:
00.0 00.0 :00 v 0.0:. 000 000 000 000 0.00 50:03 00028 00: 00:0 080082000000:
000 00.0 :00 v 0.0:. 000 000 000 0:0 0.00 0 080082000000:
:00 00.0 00.0 0.0: 00: :0: 00: :0: 0.0: 50:03 00028 0: 00:0 0800820.:
00.0 00.0 00.0 0.0: 00: 00: 00: 00: 00.0 0 0500820.:
00.0 00.0 :00 v 0.00 0:0: 0:0: 0:0: 000 :.00 0 .5003 05:0 0.06802

0: 0: 0: 0: 0 0:00:00:

0 o 0 0:0 0:: 0:: 0:: 0:: 00:
80.9.50 :0: K 350:0 3005089

 

.808:o.:0:0::-:o:v 83:00:88 808 808808 8.: 0:008 0:00:00 8000‘: .N 030,—.

171

 

200
if w’>\<>\<>
150 , ~ ,

100 -

Fat free parenchyma/
fat free carcass (g/l 00 kg)
til
0

 

 

Time fed high diet (wk)

Figure 1. Grams of fat-free parenchymal tissue relative to 100 kg fat-free carcass.
Heifers (n = 15 or 16/trt) on H0, H3, H6, H12 were fed the low energy diet for 12, 9, 6, 0
wk followed by the high energy diet for O, 3, 6, 12 wk, respectively. Data presented are

non-transformed. Data are significant for a linear effect (Linear: P < 0.05).

172

88800:: :0: 0:0: :0 8:3 8:0: 8::0 0:: 00 :0: 8 :83 000:08:0::08:00:: 380:: um 80:00: 0

0:000 u 0 008008 n o 0000:: u 0 N

0083:0800:

.8030: N: 8:0 8.8 .:o 0803 8.: 880888.: 0:03 :08 3:0:0 :38 8:0 :08 3:0:0 30: 0::. $838800: .03 N: .8 .m .o 8.: :08 38:0
:38 0:: :0: 80328.: :3 c .8 .m .N: 8.: :08 38:0 30: 0:: 80.: 0:03 9: 8:: .mm d: :0 08:8: ”030:00: 00 0:0 0:83 ::08:00:.:. :

 

 

 

 

00.0 00.0 00.0 00.0 00.0 00.0 00.: 00.0 00.: 0.7882:
00.0 00.0 00.0 0:.0 00.0 :00 00.0 00.0 00.0 0:0:: 000000808 <20
00.0 00.0 00.0 0.00 000 000: 0: :: 000: 0: : 20:03 00028 00: 00:08 .58:
00.0 00.0 00.0 0.00 000 000 :00 000 0.00 08 .0020: 8800820:
00.0 00.0 00.0 0:.0 00.0 00.0 :00 :00 00.0 0:08 000000808 <2:
00.0 :00 0:.0 0.00 0:0 000: 00:: :0:: 0.00 30:03 00028 00: 00:08 .0020:
00.0 00.0 00.0 0.00 000 000 000 000 0.00 0:: .58 88:820.:

0: 0: 0: 0: 0 00 .808:

0 o .: 00:0 0::: 0:: 0:: 0:: :0: -
0:00:80 8.: :0 ::8:0 80888:.

 

 

 

.A808:o.:0:0::-8:: 80:80 8:00 0:0—0::: 8803 0:08:88 8.: 0:008 0:080 :000: .m 030,—.

173

at Onset of Puberty

 

Estimated Fat-Free Parenchyma

 

H0 H3 H6 H12

Treatment

Figure 2. Estimated fat-free parenchymal tissue present at the onset of puberty. Data are
presented relative to H0 treatment. The onset of puberty in heifers was assumed to be
approximately 275 kg (Capuco et al., 2004; Capuco et al., 1995; Niezen et al., 1996;
Whitlock et al., 2002). Data were calculated using daily accretion rates for both body

weight and fat-free parenchymal tissue weight.

174

 

2.75 1'

2.50

2.25 L’é
r
i

 

 

2.00 ‘ 0. L I T I0"

_’-—-—

C
175 .............. .‘O c'.
e .‘h‘ ‘0 0’
'

Serum Leptin (ng/mL)
{
i
i
:LH
07>.

1.50 I

 

 

1 .25 F l l l l 7 l l l l l l 7
O 1 2 3 4 5 6 7 8 9 10 1 l 12
Treatment Period (wk)

Figure 3. Serum leptin concentrations taken every 2 wk and weekly during the last 3 wk
of the treatment period in heifers 11 to 23 wk of age. Heifers (n = 15 or 16/trt) on
treatment HO (—<>-—), H3 (- — -o- — -), H6 (- - -A- - -), H12 (— —CJ— —) were fed the
low energy diet for 12, 9, 6, 0 wk followed by the high energy diet for O, 3, 6, 12 wk,
respectively. Serum leptin values were log transformed to achieve homogeneous
variance. Serum leptin means presented are back transformed. The error term is the
average of the lower and upper confidence intervals. Initial serum leptin (wk 0) was used
as a covariate. An overall linear effect was evident as heifers were fed the high energy

diet for longer durations of time (L: P < 0.01).

175

 

 

 

 

 

 

 

Serum IGF-I (ng/mL)

 

 

 

Treatment Period (wk)

Figure 4. Serum IGF-I concentrations taken every 2 wk and weekly during the last 3 wk
of the treatment period in heifers 11 wk to 23 wk of age. Heifers (n = 15 or l6/trt) on
treatment HO (—<>—), H3 (- — -o- - -), H6 (- - -A- - -), H12 (— —L'.l— —) were fed the
low energy diet for 12, 9, 6, 0 wk followed by the high energy diet for O, 3, 6, 12 wk,
respectively. Serum IGF-I values were log transformed to achieve homogeneous
variance. Serum IGF-I means presented are back transformed. Initial serum IGF-I (wk
0) was used as a covariate. The error term is the average of the lower and upper
confidence intervals. Longer durations fed the high energy diet increased serum IGF-I

concentration in a linear fashion (L: P < 0.01).

176

H12 H12 H6 H6 H3 H3 HO HO
ka wk12 ka wk12 ka wk12 ka wk12

.'_':.. hm ‘ -.-‘ : .:=-tr-’.-_--.l--.:.-.s2iI-I'. '

43-kD _

Mr

‘-1 'flilfi-“Ihn .!

 

32-kD . it“? 0.4 00‘ ' 'w‘ -‘_‘:":': I': “5.0%; W; ‘ ’

Figure 5. Representative autoradiograph of a western ligand blot showing relative

 

IGFBP-3 (43-kD) and IGFBP-2 (32-kD) abundance in serum samples taken at wk 0 and
at slaughter. Heifers on H0, H3, H6, H12 were fed the low energy diet for 12, 9, 6, 0 wk
followed by the high energy diet for 0, 3, 6, 12 wk, respectively. Samples were
fractionated on a gel, transferred to a membrane and hybridized with [125 I]-IGF-I. Mr =

relative molecular mass.

177

 

l0wk I12wk

 

IGFBP-3 Abundance
(ODU/mmz)

 

 

H0 H3 H6 H12

Treatment

Figure 6. Abundance of IGF-binding protein-3 (IGFBP-3) in serum samples taken at wk
0 and wk 12 of the treatment period. Data represent means for 8 heifers per treatment
group. Heifers on H0, H3, H6, H12 were fed the low energy diet for 12, 9, 6, 0 wk

followed by the high energy diet for 0, 3, 6, 12 wk, respectively.

178

 

I0wk I12wk

 

 

IGFBP-2 Abundance
(ODU/mmz)

 

 

H0 H3 H6 H12

Treatment

Figure 7. Abundance of IGF-binding protein-2 (IGFBP-2) in serum samples taken at wk
0 and at wk 12 of the treatment period. Data represent means for 8 heifers per treatment
group. Heifers on H0, H3, H6, H12 were fed the low energy diet for 12, 9, 6, 0 wk

followed by the high energy diet for 0, 3, 6, 12 wk, respectively.

179