 

.1 5.11.3;

”MK.
_... Hyena“.
$.33,

.\ «

«Er .0.

t .5152“. n
. E. 1:... .

HT; .. .z.
.. t. s 44.,

1.2....
u .3 £11: 0

km... .Ww‘axl.
. .

“unpriih.
a... :5?!
.4 2:15....

It".
2.! e3... .
3. .¢ . i
:1 .z....:...-...
1‘:

3...;
. u. 13..
”n" v‘ I 3‘]‘
.h, .3 turn-“1i? mil. :8." 14...“.
. z . . . . .
.52 .zcuﬁhanh‘

 

 

 

 

 

 

“a... .95 ..
P I-.. .1

“a 71.4"»av.
..

”w‘an‘ia
i.§1.....,_...§~
aﬂzawltﬁhmn
. i. .. z.
, 1...:

..
.. .Is).

.17.. .5335.
52:: , i151:

. .5...» .! .(s i...

. u: .1. . .

.n..r.f.,..‘. ﬁlly-h 7.4“”. n n. c .Gkﬁdl . ﬁt. I}. ‘z. . «Huh 5.
.ﬁ "5.1.3. Emgx guy. i :a

 

 

me LIBRARY
02 l/ Mlchlgan State
"W ‘ University

 

This is to certify that the
thesis entitled

TRANSFORMATION AND IN VITRO CULTURE STUDIES TO
ENHANCE WHITE MOLD RESISTANCE IN DRY BEANS
(Phaseolus vulgaris L.)

presented by
ANN ROSELLE ORILLO ARMENIA

has been accepted towards fulﬁllment
of the requirements for the

MS. degree in PLANT BREEDING AND
GENETICS

Zoe 9/ 25427
/

 

 

Major Professor’s Signgf ure

3//5/0 (a
I /

Date

MSU is an Affirmative Action/Equal Opportunity Institution

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2/05 p:/CIRCIDateDue.indd-p.1

TRANSFORMATION AND IN VITRO CULTURE STUDIES TO ENHANCE
WHITE MOLD RESISTANCE IN DRY BEANS (Phaseolus vulgaris L.)

By

Ann Roselle Orillo Armenia

A THESIS

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

MASTER OF SCIENCE
Department of Crop and Soil Sciences

2006

ABSTRACT

TRANSFORMATION AND IN VITRO CULTURE STUDIES TO ENHANCE
WHITE MOLD RESISTANCE IN DRY BEANS (Phaseolus vulgaris L.)

By
Ann Roselle Orillo Armenia

White mold, caused by Sclerotinia sclerotiorum, is a serious yield limiting disease
in dry beans. Based on evidence that identiﬁes oxalic acid as the major pathogenicity
factor for white mold, this study aimed to engineer enhanced white mold resistance in dry
beans by overexpressing the wheat oxalate oxidase gene, gf-Z. 8, using particle
bombardment and electrotransformation approaches; and to evaluate effects of cytokinin
and particle bombardment on the survival and growth of three bean cultivars in vitro. A
total of 1,150 Matterhorn and Olathe bean plants were putatively transformed using the
electrotransformation procedure. Screening for bar identiﬁed herbicide resistant plants
(T1) and PCR analysis conﬁrmed the integration ofg/12.8 in 18 Matterhorn and 11 Olathe
plants, the majority of which resulted ﬁom Hormone (identity preserved) pretreatments
of the apical meristems prior to electrotransformation. Four T2 gf-2.8 PCR positive plants
were generated and the expression of gf-2.8 was conﬁrmed in 3 T2 plants through RT-
PCR. Indirect tests of T2 and T3 plants showed increased H202 production and reduction
in lesion size suggesting enhanced white mold resistance. In vitro culture studies of three
dry bean cultivars showed that 6-benzylaminopurine in the shoot regeneration media
caused a reduction in shoot growth and lengthened the culture time requirement.
Bombardment injuries to the cultivar Olathe causes a signiﬁcant decrease in shoot grth
and longer culture time. Red Hawk was observed to be a more suitable cultivar for in

vitro culture and transformation efforts of dry beans with particle bombardment.

to

mom, dad, nonoy and bordi

iii

ACKNOWLEDGEMENT

I am greatly indebted to all the people who have made this a reality for me.

Sincere appreciation is extended to my major professor and adviser, Dr. James D.
Kelly for the opportunity to learn about dry beans, for the guidance and encouragement
throughout my graduate program, and for being a great mentor. Appreciation also goes to
my graduate committee members, Dr. Richard Allison, Dr. Ken Sink, and Dr. Mariam
Sticklen for the countless support.

Thank you to my ﬁ’iends in the bean lab and the PEG program who have
generously helped me ﬁgure out weird gels and blots and for just being fun to be around
with. Thank you Veronica, Halima, Karolyn, Esteban, Belinda, Malen, Eliana, Evan, and
Enka

Life in East Lansing have been less lonely without my family due to the
wonderful people in the MSU Filipino Club including Maricris, Gizelle, Jocy, Lara,
Neslie, and Christian. Thank also to the Javier Family especially to Tito Sonny.

Gratitude also is extended to my family (Mom, Dad, Nonoy and Bordi) for all the
love, prayers and support. Thank you to the ‘bestest’ friends in the world: Joyce, Jennifer,
Vanessa, Queenie, Aura and Karen.

The journey has been tough but the people I have met and the friends I have made

have made it all worthwhile. Thank you so much!!!

iv

TABLE OF CONTENTS

LIST OF TABLES ............................................................................................. vii
LIST OF FIGURES ........................................................................................... ix
CHAPTER 1: LITERATURE REVIEW ........................................... 1
Dry Beans ........................................................................ l
Sclerotinia sclerotiorum ........................................................ 3
Life Cycle ................................................................ 3
Signs and Symptoms ................................................... 5
Role of Oxalic Acid on Pathogenicity ............................... 5
Oxalate Oxidase .................................................................. 6
Role in Plant Defense .................................................. 7
Breeding for White Mold Resistance ................................ 8
Plant Transformation ............................................................ 10
Protoplast Transformation ............................................. l l
A grobacterium-mediated Transformation ........................... l 1
Biolistic Transformation ............................................... 12
Transformation for Disease Resistance ....................................... 13
Plant Transformation with OXOs ............................................. 14
Transformation in Phaseolus ................................................... 16
A grobacterium-mediated transformation ............................. 16
Biolistic Transformation ................................................ 17
Electroporation ........................................................... 1 8
Tissue culture in Phaseolus vulgaris .......................................... l9
Transformation in Crops Without a Well Established Regeneration
System .................................................................... 20

CHAPTER II: ELECTROTRANSFORMATION AND BIOLISTIC
APPROACHES FOR INTRODUCING gf-2.8 INTO DRY BEANS
(Phaseolus vulgaris L.) FOR ENHANCED WHITE MOLD

RESISTANCE ................................................................ 21
Introduction ....................................................................... 2 1
Materials and Methods .......................................................... 25
Plant Material ............................................................ 25
Plasmid Construction ................................................... 25
Electrotransformation ................................................... 25
Biolistic Method ......................................................... 28
Herbicide Screening for bar ........................................... 29
PCR Analysis ............................................................ 29
Oxalate Oxidase Assay: Fluorescent Assay ......................... 3O
Oxalic Acid Assay ...................................................... 31
Fungal Bioassay ......................................................... 31
Southern Blot Analysis for gf-2.8 and bar ........................... 32

Reverse Transcription-PCR (RT-PCR) .............................. 33

Results .............................................................................. 35
Study I: Particle Bombardment ....................................... 35

Study II: Electrotransformation ....................................... 37

PCR Analysis on T. and T2 ................................... 37

Southern Hybridization ...................................... 38

RT-PCR ......................................................... 44

Oxalate Oxidase: Fluorescent Assay ........................ 45

Evaluation for White Mold Resistance ...................... 48

Bioassay on T3 Plants .......................................... 50

Discussion .......................................................................... 53
Particle Bombardment ................................................... 53
Electrotransformation ................................................... 54
Conclusion ........................................................................ 58

CHAPTER III: EFFECT OF CYTOKININ AND PARTICLE
BOMBARDMENT ON IN VITRO GROWTH OF Phaseolus vulgaris

SEEDLINGS ................................................................. 59

Introduction ....................................................................... 59

Objectives ................................................................ 62

Materials and Methods .......................................................... 63

Preparation and Plating of Meristems ................................ 63

Bombardment of Meristems ........................................... 64

Statistical Analysis ...................................................... 64

Results .............................................................................. 66

Experiment I: Effect of Cytokinin on Shoot Production ........... 66

Experiment II: Effect of Cytokinin and Bombardment on shoot

Production ............................................... 71

Conclusion ........................................................................ 81

APPENDICES ............................................................................. 82
REFERENCES ............................................................................ 104

vi

LIST OF TABLES

Table 1. Pre-transformation hormone treatments performed on seedling apical
meristems prior to electrotransformation ................................... 27

Table 2. Summary of results from particle bombardment experiments with bar and
gf-2.8 genes ..................................................................... 36

Table 3. Results of herbicide (glufosinate ammonium) and PCR screening of
Matterhorn plants using the electrotransformation protocol ............. 39

Table 4. Results of herbicide (glufosinate ammonium) and PCR screening of Olathe
plants using the electrotransformation protocol ............................ 40

Table 5. Mean H202 production in four T2 PCR positive plants and percent increase
in H202 concentration over the batch untransformed control ............ 47

Table 6. Average lesion size in the four PCR positive T2 plants and the percent
reduction in lesion area from the untransformed control using the oxalic
acid assay ....................................................................... 49

Table 7. Average lesion size in the four PCR positive T2 plants and the percent
reduction in lesion area from the untransformed control using ﬁmgal
bioassay ......................................................................... 49

Table 8. Lesion area and lesion size reduction over batch controls in selected T3
plants following oxalic acid assays with mean lesion size reduction of at
least 20% ....................................................................... 51

Table 9. Lesion area and lesion size reduction over batch controls in selected T3
plants following fungal bioassays with mean lesion size reduction of at
least 15% ........................................................................ 52

Table 10. Summary of experiments conducted and the media treatments used for each
experiment ..................................................................... 65

Table 1A. Mean lesion size from leaves of T2 plants and batch controls following
oxalic acid assay ............................................................. 82

Table 2A. Mean lesion size from leaves of T2 plants and batch controls following
fungal bioassay .............................................................. 88

Table 3A. Average H202 production in T2 plants and experimental batch control as
assessed by the Amplex Red Fluorescence Assay ....................... 94

vii

Table 4A. Lesion size in T2 plants included in T3 oxalic acid and fungal
bioassays ....................................................................... 99

Table 5A. Average lesion size from leaves of T3 plants and experimental batch
controls following oxalic acid assay ....................................... 100

Table 6A. Average lesion size from leaves of T3 plants and experimental batch
controls following fungal bioassays ........................................ 102

viii

LIST OF FIGURES

Figure 1. Life cycle of S. sclerotiorum on beans ....................................... 4
Figure 2. Diagram of the transformation plasmid pBKSbar/gf—2.8 .................. 27

Figure 3. Set-up of assays conducted on T2 and T3 plants. a, oxalic acid assay. b,
fungal bioassay ................................................................ 32

Figure 4. Olathe and Matterhorn shoots growing in 10 mg/L BAP after 3 weeks in
culture .......................................................................... 36

Figure 5. Polymerase Chain Reaction (PCR) results in 29 dry bean T. plants using gf-
2.8 speciﬁc primers. *=Olathe; (unmarked)=Matterhom; (bold)=produced
gf-2.8 PCR and/or RT-PCR positive
plants ............................................................................. 41

Figure 6. Polymerase Chain. Reaction (PCR) from 20 dry bean Tl plants using bar
speciﬁc primers. *=Olathe; (unmarked)=Matterhom; (bold)=produced gf-
2.8 PCR and/or RT-PCR positive
plants ............................................................................. 42

Figure 7. Polymerase Chain Reaction (PCR) from four T2 plants using gf-2.8 speciﬁc
primers. Genotypes with * are Olathe, and Matterhorn if
unmarked ........................................................................ 43

Figure 8. RT-PCR with gf-2.8 and bean actin speciﬁc primers on four T2 plants
previously conﬁrmed for gf-2.8 gene integration with PCR .............. 44

Figure 9. Mean ﬂuorescence units of the PCR positive T2 plants relative to the batch
untransformed control ......................................................... 46

Figure 10. Mean increase in shoot length (ISL) of dry bean plantlets as affected by
BAP concentration in the shooting media. Means followed by the same
letter designation are not signiﬁcantly different
(a=0.05) ......................................................................... 68

Figure 11. Plantlet production efﬁciency (PPE) in Olathe and Red Hawk in various
BAP levels ..................................................................... 69

Figure 12. Growing Olathe plantlets. a, plantlets grown in 0 mg/L to 10 mg/L at two
weeks after transfer to the shooting media; b, comparison of root and
shoot development without BAP and in high BAP concentration
(AASS) ............................................................................ 70

ix

Figure 13. Mean number of weeks (NWS) required for culture in shooting media of
three dry beans cultivars as affected by BAP concentration. Means
followed by the same letter designation are not signiﬁcantly different
(a=0.05) .......................................................................... 72

Figure 14. Mean number of weeks (NWS) required for culture in shooting media by
three dry bean varieties as affected by bombardment. Means followed by
the same letter designation are not signiﬁcantly different (u=0.05) 73

Figure 15. Mean increase in shoot length (ISL) of dry bean as affected by BAP
concentration in the shooting media. Means followed by the same letter
designation are not signiﬁcantly different (a=0.05) ....................... 74

Figure 16. Plantlet production efﬁciency (PPE) of three dry bean cultivars in vitro 75

Figure 17. Growing plantlets of Matterhorn, Olathe and Redhawk after two weeks of
grth in shooting media. a, unbombarded Matterhorn, b) bombarded
Matterhorn, c) unbombarded Olathe, d) bombarded Olathe, e)
unbombarded Redhawk, i) bombarded Redhawk ........................ 79

Figure 18. Plantlets growing in vitro. a, callus formation at shoot base in Olathe; b,
callus formation at shoot base in Redhawk; c, comparison of root
formation of Redhawk plantlets grown in control and 5 mg/L
treatments ....................................................................... 80

CHAPTER I

LITERATURE REVIEW

White mold, caused by the ﬁmgal pathogen Sclerotim’a sclerotiorum, is one the
most devastating diseases that seriously limit dry bean (Phaseolus vulgaris L.) production
in temperate regions. Major genes conferring resistance to white mold have not been
found in dry beans, however, minor genes providing partial resistance to the pathogen
have been identiﬁed in various QTL (Quantitative Trait Loci) analyses (Ender and Kelly,
2005; Kolkman and Kelly, 2003, Park et al., 2001; Miklas et al., 2001). Thus, breeding
efforts to improve partial resistance to white mold have mainly focused on the
incorporation of physiological resistance and architectural traits that provide avoidance
mechanisms to the disease (Kolkman and Kelly, 2002). To ﬁirther enhance the partial
resistance found in current cultivars, this study attempted to genetically engineer
enhanced resistance to white mold in dry beans by introducing and overexpressing an
oxalate oxidase gene from wheat. This chapter will review the importance of dry beans,
the biology of S. sclerotiorum, the status of white mold resistance breeding in dry beans,
the nature and signiﬁcance of oxalate oxidases in disease resistance, plant transformation,

and the current status of transformation and tissue culture in Phaseolus.

Dry Beans

Dry beans are one of the most important grain legumes for human consumption in
the world. Total bean production in 2004 was 18.4 M metric tons (MT) of which 8.4M
MT were produced in Latin America and Africa (FAO, 2004). In 2004, 548,000 hectares

were planted to beans in the United States with about 1.8M metric tons total production

(NASS, USDA, 2004). In Michigan, the area planted to beans was 76,900 hectares in
2004 and 95,100 hectares in 2005 (NASS, USDA, 2005). Following North Dakota,
Michigan is the second highest dry bean producing state of the US, producing 15% of the
national output in 2002-2004.

Beans play a signiﬁcant role in human nutrition because they are excellent and
inexpensive sources of dietary proteins and essential vitamins and minerals. Most beans,
when uncooked, contain about 20-25% protein making them a good substitute for animal-
based protein sources (Haytowitz and Matthews, 1986). In addition to having only about
1% fat content, beans provide the important minerals calcium, iron, magnesium,
phosphorus, potassium and zinc (Geil and Anderson, 1994). Studies have shown that
comsumption of dietary ﬁber, isoﬂavones and antioxidants present in dry beans may
provide cardiovascular beneﬁts (Anderson et al., 1999). Low glycemic indexes and high
soluble dietary ﬁber in beans may contribute to the prevention and improvement of
diabetic stages, could aid in weight control and may reduce risk of heart disease
(Anderson et al., 1999; Bennink, 2005). Consumption of dry beans has also been linked
to inhibition of various types of cancer including breast, prostate and colon cancers which
have been attributed to their low glycemic acid and phytonutrient contents.
Epidemiological studies have suggested that beans reduce the likelihood of certain types
of cancers, these predictions are supported by a reduction in prostate and colon cancers in
animal studies (Singh and Fraser, 1998; Bennink, 2002; Hangen and Bennink, 2003).

Major breeding objectives for genetic improvement in dry beans are focused on
improving resistance to various diseases. White mold caused by S. sclerotioum is the

most serious disease that affects dry bean production. In Michigan, white mold is

considered by dry bean growers as the most important problem compared to other
diseases that affect dry beans (Webster and Kelly, 2000). Although chemical control
currently provides the best control strategy, often treatments are ineffective. Compared
with resistance to other major bean diseases, white mold resistance in dry beans is still
inadequate (Singh, 2001), hence, the necessity to breed for enhanced resistance to the

white mold pathogen.

Sclerotinia sclerotiorum

Sclerotinia sclerotiorum is an aggressive fungal pathogen that is capable of
infecting a wide range of hosts (Purdy, 1979; Bolton et al., 2006) including soybean,
sunﬂower, peanut, canola and dry beans. In dry beans, the cottony mycelium of by S.
sclerotiorum has led to the common name, white mold.

Life Cycle. S. sclerotiorum is a necrotrophic ascomycete that produces large
sclerotia and lacks a functional conidia or other sexual spores. The formation of sclerotia,
the perpetuating structures of S. sclerotiorum, is a very important survival mechanism for
the fungus. A sclerotium is a compact mass of fungal mycelium capable of surviving
many years in the soil (Steadman, 1983). Studies have shown that environmental factors
such as light, moisture and temperature affect apothecial development in S. sclerotiorum.
Sclerotial germination requires adequate soil moisture and cool temperatures which
usually occur during partial to complete row cover of bean crop (Schwartz and Steadman,
1978). Germination of the sclerotia leads to the production of apothecial stalks bearing
ascospores (Figure 1). An increase in relative humidity in the environment then triggers
mature ascospores to be released, creating a “pufﬁng” phenomenon which assists in spore

dispersal (Steadman, 1983). The germinating ascospores require an exogenous energy

source such as injured or senescent plant tissues (e.g. ﬂowers) which provide the
necessary nutrients required for the development of fungal mycelia in order to
successfully colonize a bean plant. Following colonization, the fungus can then begin to
infect green pods, leaves, and stems. Sclerotia are then produced from diseased plant

tissue.

Ascospores infect wet M Sclerotia are produced
blossoms and spread among the white, cottony
from them to other parts fungal strands on

of the plant / diseased plants

/

   

Disease Cycle of Sclerotia

AS°9Sp°'°S_a'° ‘ White Mold of Beans overwinter 0"
carried by air I the soil

and some of

them land on ‘

bean plants \

 

A/Apothecia develop from
Minute ascospores are the sclerotia
produced by apothecia

and ejected into the air as
a cloud of spores when a?
they mature -

 

Figure 1. Life cycle of S. scleroriorum on beans (Abawi and Hunter, 1979).

Signs and Symptoms. The penetration of host tissues by the fungal pathogen and
subsequent enzymatic processes that occur during infection result in rapid disorganization
of tissues (Purdy, 1979). The ﬁrst symptoms observed in most hosts of the pathogen are
watersoaked spots. These watery spots or lesions tend to enlarge and become rotted and
are later covered by fungal mycelia. Signs of the ﬁingus, in association with almost all
hosts, are copious amounts of white cottony mycelium and the subsequent production of
black sclerotia. Infection of stems and branches leads to wilting and in some cases plant
death with stems and branches appearing dry and bleached (Steadman, 1983). S.
sclerotiorum causes major yield losses in dry beans as a consequence of the reduced
number of seeds and seed weight (Kerr et al., 1978).

Role of Oxalic Acid on Pathogenicity. Oxalic acid production by S. sclerotiorum
has been implicated as a pathogenicity factor for white mold infection (Maxwell and
Lumsden, 1970) and is thought to aid in the fungal virulence by reducing the apoplastic
pH to levels more suitable for pectolytic enzyme degradation of plant cell walls (Bateman
and Beer, 1965; Bateman and Millar, 1966). Mutants of S. sclerotiorum deﬁcient in
oxalic acid production were used to conﬁrm that oxalic acid is a major pathogenicity
factor for white mold infection (Godoy et al., 1990). Oxalic acid also has been found
associated with chloroplast degeneration caused by the rupturing of chloroplast
membranes (Tariq and Jeffries, 1985; Tu, 1989).

Tolerance of the white bean cultivar Ex Rico 23 to S. sclerotiorum was noted to
be associated with tolerance to oxalic acid and to restricted movement of oxalic acid from
veins to interveinal tissues (Tu, 1985). In a study comparing white mold resistant and

susceptible dry bean cultivars, chloroplast and plasma membrane stability was associated

with tolerance to oxalic acid (Tu, 1989). F oliar dehydration has been attributed to oxalic
acid due to its capability to deregulate guard cells and inhibit abscisic acid-induced
stomatal closure (Guimaraes and Stotz, 2004). Oxalic acid also suppresses the active
oxygen generation of host plants (Cessna et al., 2000) thereby compromising major host
defense responses.

Therefore, an alternative breeding strategy to develop dry bean cultivars with
resistance to white mold would be to incorporate genes coding oxalic acid degrading
enzymes, whether from existing dry bean germplasm or from novel sources, through

plant transformation.

Oxalate Oxidase (0X0)

Oxalate oxidases (0X0) are enzymes that are capable of oxidizing oxalic acid
into hydrogen peroxide (H202) and carbon dioxide possibly leading to a reduction of the
toxic effects of oxalic acid-producing pathogens. A small group of homologous proteins
(Lane, 2002), with peroxide-generating and oxalate oxidase activity, are found in the
cereals: barley, maize, oat, rice, rye, and wheat. These proteins are often referred to as
germins (G-0X0) and have been known as a marker of growth onset in germinating
seeds of cereals (Thompson and Lane, 1980; Lane, 1994). Two full-length germin
sequences (gf-2.8 and gf-3. 8) have been cloned from wheat and gf-2.8 was found to have
apoplastic (Lane et al., 1986) and protease resistance properties (Grzelczak and Lane,
1984). A thermostable, protease-resistant oxalate oxidase with high homology to the
wheat germin protein also has been isolated from barley (Woo et al., 1998; Dumas et al.,

1993).

Role in Plant defense. The induction of oxalate oxidase and oxalate oxidase-like
proteins have been implicated in plant defense against a variety of pathogens
(Ramalingam et al., 2003; Zhou et al., 1998; Hurkman and Tanaka, 1996). Gel-based and
quantitative spectrophotometric enzyme assays on germin 0X03 and germin-like
proteins (GLPs) have provided evidence of a superoxide dismutase activity which is
involved in the response of plants to biotic and abiotic stresses (Woo et al., 2000). Berna
and Bemier (1999) have previously shown upregulation of expression of the wheat 0X0
(gf-Z. 8) by biotic and abiotic stresses including heavy metals, polyamines, wounding and
infection with Tobacco Mosaic Virus (TMV) in transgenic tobacco. Studies of wood-
rotting basidiomycetes suggested that the breakdown of oxalic acid by oxalate oxidases
delays wood decay by neutralizing the pH around the infection sites (Shimada et al.,
1994). This capability to neutralize apoplastic pH could possibly lead to inhibition or
delay of degradation of plant cell walls by pectolytic enzymes.

In addition to its ability to degrade oxalic acid, oxalate oxidases subsequently
generate hydrogen peroxide (H202). H202 is a major participant in the oxidative burst, the
production of reactive oxygen species related to host defense response, thereby making
oxalate oxidase a vital agent for disease resistance. The production of H202 promotes
ligniﬁcation and cross linking in host cell wall proteins providing a generalized barrier
against fungal penetration. In addition, studies have shown that H202 contributes to host
plant resistance through a hypersensitive response by promoting a localized cell necrosis
in resistant plant cultivars, thus forming a barrier that limits ﬁmgal invasion to sites of
infection (Bolwell and Wojtasek, 1997; Bolwell et al., 2002; Levine et al., 1994;

Tenhaken et al., 1995). Moreover, H202 is involved in the induction of systemic acquired

resistance (SAR) by acting as a diffusible signal (Alvarez and Lamb, 1997; Lamb and
Dixon, 1997) and has also been suggested to trigger downstream components of the
defense pathway and induce expression of defense related genes associated with SAR
(Chen et al., 1993). Increased endogenous production of H202 in transgenic potato and
tobacco expressing a peroxide-generating glucose oxidase gene resulted in accumulation
of salicylic acid and expression of PR proteins which are commonly associated with the

induction of SAR during plant defense (Kazan et al., 1998).

Breeding for White Mold Resistance

Resistance of dry beans to white mold may be achieved by combining disease
avoidance and physiological defense mechanisms. Disease avoidance can limit fungus
establishment and disease development and is primarily inﬂuenced by plant architecture,
phenological traits, and agronomic management practices (Kolkman and Kelly, 2002).
These traits include erectness, canopy elevation and porosity and late or early ﬂowering.
In a previous study, Fuller et al. (1984) showed that the elevation of canopy in a highly
susceptible indeterminate great northern bean lead to a reduced white mold infection,
whereas, increased plant height is associated with lower white mold levels in the ﬁeld in
dry bean Recombinant Inbred Line (RIL) populations (Miklas et al., 2001; Park et al.,
2001). Moreover, the development of favorable microclimates within dense canopies is
associated with higher white mold severity (Park, 1993; Coyne, 1980; Coyne et al.,
1974). Physiological resistance, however, is controlled by biochemical factors and may
be conditioned by increased activities of plant defense related enzymes (Miklas et al.,

1993) and accumulation of phytoalexins (Sutton and Deverall, 1984).

Various QTL analyses have been conducted to identify possible QTL contributing
to physiological resistance and avoidance traits to white mold in dry beans. In the study
by Miklas et a1. (2001), QTL conferring physiological resistance and avoidance
mechanisms have been identiﬁed in the A55 x G122 dry bean RIL population. A QTL
contributing 38% of phenotypic variation for disease score in greenhouse tests was
identiﬁed on linkage group B7. The identiﬁed QTL on linkage group B7 and another on
Bl conditioned 26% and 18% of variability for ﬁeld resistance, respectively. QTL for
white mold resistance conditioned by both physiological resistance as well as disease
avoidance have also been identiﬁed in a PC-50/XAN+159 RIL population (Park et al.,
2001). In this study, QTL conferring white mold resistance in the ﬁeld were mapped on
B4, B7, BS and B11 linkage groups whereas the major QTL on B7 accounted for 12% of
the phenotypic variation. QTL for avoidance traits such as plant height and canopy
porosity were also identiﬁed on linkage groups BZ, B5, B7, B8 and BIO. In the Bunsi x
Newport and Huron x Newport RIL populations, markers linked to QTL conferring
partial white mold resistance were identiﬁed on BZ and B7 (Kolkman and Kelly, 2003).
In both linkage groups, the markers were associated with QTL for reduced Disease
Severity Index (DSI) while, on B7, the markers were associated with QTL for oxalate
resistance, yield, days to ﬂowering, branching pattern, lodging and seed size. Moreover,
QTL that accounted for 9 to 15% of phenotypic variation were mapped to BZ, BS, B7 and
B8 using a Middle American bean RIL population (Ender and Kelly, 2005).

Breeding strategies for improving white mold resistance in dry beans have
therefore focused on combining architectural avoidance mechanisms with physiological

resistance. Currently, minor genes identiﬁed in various QTL analyses provide partial

resistance to the white mold pathogen in dry beans. Studies in the scarlet runner bean (P.
coccineus), however, have reported a single dominant gene controlling white mold
resistance in the species (Abawi et al., 1978) suggesting a possible source of resistance to
white mold for possible introgression into P. vulgaris. Although this resistance was
reported in the hybrid P. vulgaris x P. cocaineus, F2 and back cross populations, the
resistance was not confirmed in later generations. Consequences of genetic background
and difﬁculty in crossing between secondary gene pools of Phaseolus have proved to be
hindrances to this breeding strategy. Therefore, in the enhancement of white mold
resistance in current dry bean cultivars, breeders should consider novel sources of

resistance such as those provided by oxalate oxidases.

Plant Transformation

Plant transformation technology has provided various beneﬁts in the study of
gene function as well as in crop improvement. With genetic engineering, it is now
possible to incorporate novel genes and DNA sequences into diverse organisms. Plant
transformation serves as an experimental tool in the genetic analyses of cell signals in
addition to studies on enzyme and hormone function in development. Transformation has
also been used to introduce economically desirable traits into crop plants (reviewed by
Birch, 1997). Since the establishment of reproducible transformation protocols in many
crop plants, the number of transgenic crops produced commercially and acreage of
planting has increased. In 2005, a total of 90 million hectares was approved for planting
to genetically modiﬁed (GM) crops in over 20 countries (James, 2005). The increase in

growth rate of global GM production areas since its commercialization in 1996 implies

10

improved productivity leading to economic, environmental and social beneﬁts provided
by GM cr0ps.

There are various methods through which desirable genetic sequences can be
transferred to plants, most of which require a tissue culture stage. Totipotency, a single
cell’s ability to carry out all the stages of development, underlies the success of the major
transformation techniques developed to date. Somatic embryogenesis and organogenesis
are the two important developmental pathways in the production of transgenic plants
(Hansen and Wright, 1999). The three most commonly used transformation systems are
protoplast transformation, Agrobacterium-mediated transformation and particle
bombardment.

Protoplast Transformation. Protoplast transformation requires the production of
protoplasts through mechanical or enzymatic processes from immature embryos,
immature inﬂorescences, mesocotyls, immature leaf bases or anthers (Hansen and
Wright, 1999; Maheshwari et al., 1995). Successful transformations have been achieved
with this method in rice (Abdullah et al., 1986), Arabidopsis (Damm et al., 1989), and
tobacco (Hu et al., 1996). However, limitations of this method in many other crops
include problems associated with plant regeneration and transient gene expression
(Rakoczy-Trojanowska, 2002).

Agrobacterium-mediated Transformation. Agrobacterium-mediated
transformation system is a complex method where success is based on ﬁnding genetic
determinants in the bacterium and host cell. The vector used in this system is a tumor
inducing (Ti) plasmid which contains a T-DNA, the portion of the plasmid that can be

constructed to speciﬁcally contain the gene of interest and transferred from the bacterium

ll

into the host cell with the aid of virulence genes expressed in wounded plant cells
(Gelvin, 2000; Hansen and Wright, 1999). This system has been used to successfully
transform crops like rice (Hiei et al., 1994), Arabidopsis (Valvekens et al., 1988), corn
(Gould et al., 1991), and soybean (Donaldson et al., 2001). Agrobacterium-mediated
transformation is the major method used due to its capability to insert single copies of the
transgene into the host plant thereby avoiding the possibilities of suppression or changes
of transgene expression. However, problems associated with genotype dependency of
Agrobacterium strains create some limitations to the application of this method in all
crops.

Biolistic Transformation. The biolistic transformation technique, also known as
particle bombardment, involves the bombardment of plant cells or tissues with
microparticles in the form of gold or tungsten which are coated with the genetic
sequence(s) of interest. Delivery of the particles is achieved by acceleration provided by
gunpowder, helium gas or electric discharge (Hansen and Wright, 1999). Successful and
highly efﬁcient transformation with this method has been obtained in crops like corn and
wheat (Wright et al., 2001). Biolistic transformation can also be conducted on a broad
range of cell and tissue types and in certain cases do not require a plant regeneration step
from single cell or callus tissues, thus making it a highly suitable system for plants
without established regeneration protocols. Bombardment of apical meristems excised for
mature dry bean embryos has led to production of transgenic beans although with very
low efﬁciency (Aragao et al., 2002). Due to the physical nature of the transformation

procedure, this method is not limited by plant genotype (Christou, 1992), however, the

12

complex and unpredictable patterns of transgene integration often results in integration of

multiple copies leading to transgene silencing (Reddy et al., 2003).

Transformation for Disease Resistance

Plant disease is a major constraint of crop production. Disease infection in an
agricultural ﬁeld can result in minor crop loss or even total crop failure. Thus, many
breeding programs include breeding for disease resistance to major plant pathogens. With
the advent of biotechnology, plant breeders have turned to plant transformation
approaches to engineer disease resistance.

Antifungal and antibacterial proteins produced by a wide variety of fungi and
bacteria provide excellent sources of transgenes for disease resistance breeding. Genetic
studies on the antifungal properties of T richoderma spp. have led to the puriﬁcation of
enzymes with various inhibitory roles to a number of plant pathogens (Lorito et al.,
1998). Transformation work with the endochitinase gene (ThEn-42) from T. harzianum
resulted in a high and broad range of resistance to the pathogens (Alternaria alternata, A.
solani, Botrytis cinerea, and Rhizoctom'a solam') in potato and tobacco. Overexpression
of a chimeric endochitinase gene in oilseed rape (Brassica napus var. oleifera) increased
tolerance to the fungal pathogens Cylindrosporium concentricum, Phoma Iingam, and S.
sclerotiorum (Grison et al., 1996). Other microbial genes that have been expressed in
plants for enhanced resistance to pathogens include glucose oxidase from Aspergillus
niger, ribonuclease (pacl) from Schizosaccharomyces pombe, trichodiene synthase (T 115)
from Fusarium sporotrichioides, killer toxin from Ustilago maydis, and BI toxin from

Bacillus thuringensis (reviewed by Lorito and Scale, 1999).

13

Disease resistance breeding through transformation has also employed genes
involved in the successful infection of plant pathogens. Transformation of tobacco with
the exp] gene which encodes a signal involved in quorum sensing of Erwim'a carotovora
led to increased resistance to the pathogen (Mae et al., 2001). Coat protein-mediated
resistance has been used to provide enhanced host plant resistant to viruses (Gonsalves
and Slightom, 1993). Transgenic tomato expressing the coat protein of the U1 strain of
TMV exhibited partial resistance to infection and disease development of TMV and
tomato mosaic virus (ToMV) (Nelson et al., 1988). Similarly, transformation in papaya
with the papaya ringspot virus (PRSV) coat protein gene resulted in a broad range of
resistance to PRSV isolates from Hawaii, Thailand and Mexico (Bau et al., 2003).

Another mode for breeding disease resistance into plants has focused on genes
that are capable of inactivating toxins produced by plant pathogens or improving the
host’s tolerance to the pathogen. For instance, the gene encoding a tabtoxin
acetyltransferase from Pseudomonas syringae pv. tabaci (pst) detoxiﬁes tabtoxin, a toxin
produced by pst pathogen. The transgene was shown to provide resistance to pst in
transgenic tobacco plants (Anzai, 1989). Moreover, transformation of tobacco with argK,
an enzyme involved in arginine biosynthesis, provided resistance to Pseudomonas
syringae pv. phaseolicola through detoxiﬁcation of the phaseolotoxin produced by the

fungal pathogen (de la F uente-Martinez et al., 1992).

Plant Transformation with 0X0s
Following the isolation and cloning of oxalate oxidases from wheat and barley,
efforts have been made to transform various crop plants in order to enhance resistance to

oxalic acid-generating pathogens like S. sclerotiorum. Improved resistance to exogenous

l4

application of oxalic acid, as exhibited by resistance to wilting, has been demonstrated in
transgenic canola expressing a barley oxalate oxidase gene (Thompson et al., 1995).
Donaldson et al. (2001) reported improved resistance to white mold, relative to wild type,
against leaf and stem inoculation of S. sclerotiorum in soybean using a wheat G-0X0
(gf-2. 8) gene. The report established that transgenic soybean had greatly reduced disease
progression and lesion length after inoculation with S. sclerotiorum. Transformation of
the hybrid poplar clone, Populus x euramericana cv. ‘Ogy’ with wheat 0X0 resulted in
increased tolerance to oxalic acid and a more efﬁcient increase in apoplastic pH to neutral
levels compared to the wild type. In addition, improved resistance to the oxalic acid-
producing poplar pathogenic fungus, Septoria musiva, was observed in the 0X0-
transformed plants (Liang et al., 2002). Studies of sunﬂower transformed with gf-2.8
have shown increased accumulation of H202, salicylic acid, and defense gene transcripts
which were associated with hypersensitive response-like lesions. Moreover, this
accumulation was closely associated with a progressive increase of oxalate oxidase
activity during plant development and the transgenic sunﬂower plants produced exhibited
enhanced resistance to white mold (Hu et al., 2003). Recently, transformation of peanut
(Arachis hypogaea) with the barley oxalate oxidase gene resulted in enhanced resistance
to the Sclerotinia blight pathogen, S. minor. Detached leaf assays against oxalic acid and
fungal mycelia resulted in as much as 97% reduction of lesion size (Livingstone et al.,
2005). Due to the success of 0X03 in providing enhanced resistance to oxalic acid-
producing pathogens like S. sclerotiorum using plant transformation, this study aims to

improve white mold resistance in dry beans using a similar approach.

15

Transformation in Phaseolus

Currently, there are only a few reports on successful transformation within the
genus Phaseolus. Early efforts to transform of P. vulgaris and P. acutifolius (tepary bean)
employed Agrobacterium-mediated systems, electroporation and PEG-mediated
protoplast transformation (Aragao, 2001). However, these attempts either failed to
provide molecular evidence for genetic transformation or progeny analysis or were
unable to produce transgenic plants due to regeneration problems. Recently, modest
success has been attained in P. acutzfolius using Agrobacterium, and in P. vulgaris using
particle bombardment/biolistic methods (Zambre et al., 2005; Aragao et al., 2002).

Agrobacterium-mediated transformation. Agrobacterium-mediated
transformation has long been attempted in dry beans but no successful reports have been
published to date. However, stable transformation has been successfully achieved only in
tepary beans (P. acutifolius) (Zambre et al., 2005). Successful transformation with
Agrobacterium-mediated systems was obtained using Agrobacterium strain C58C1RifR in
six tepary bean genotypes. Transient expression of uidA was detected in calli explants for
ﬁve out of the six genotypes tested (Dillen et al., 1997). These procedures were
optimized at 22°C, 16-8 hr photoperiod in acidic medium with co-cultivation in the
presence of acetosyringone, and molecular tests conﬁrmed the stable integration and
expression of gus in primary transgenes and T1 progenies (De Clercq et al., 2002).
Recently, Zambre et al. (2005) developed a reproducible transformation system for
cultivated tepary bean with different arcelin genes for resistance to the Mexican bean

weevil.

l6

Biolistic Transformation. Transgenic bean plants were ﬁrst obtained from navy
bean (P. vulgaris cv. Seafarer) transformed using an electrical particle acceleration
device (Russel et al., 1993). However, the frequency of transgenic plants obtained was
very low (0.03% transformation efﬁciency) and the tissue culture protocol involved was
time-consuming, required several temperature treatments and media transfers of the
bombarded embryos prior to achieving transgenic shoots.

Embryonic axes of the French bean (P. vulgaris cv. Goldstar) were transformed
using gold particle bombardment (Kim and Minamikawa, 1996). Unfortunately, most
shoot apexes obtained were chimeric showing both transformed and non-transformed
sectors and only 0.5% of the explants produced transgenic seeds. The biolistic or particle
bombardment method involving tungsten microparticles has also been utilized to
transform apical meristems of the dry bean cv. Olathe (Aragao et al., 1996, 1998).
Transformation was performed with neomycin phosphotransferase II (neo) and B-
glucuronidase (gus) marker genes, the methionine-rich 2S albumin gene from Brazil nut
and the antisense sequence of genes from the bean golden mosaic geminivirus (BGMV).
In a co-transformation study 40% to 50% co-transformation efﬁciency was obtained with
unlinked genes and 100% with linked genes (Aragao et al., 1996). Introduction of
resistance to BGMV with Rep-TrAP-REn and BCl antisense viral genes resulted in the
production of 16 independently transformed bean plants which when challenged-
inoculated with BGMV exhibited delayed and attenuated symptoms (Aragao et al., 1998).

Transgenes encoding a methionine-rich storage albumin from the Brazil nut
(Bertholletia excelsa H. B. K.) was introduced in dry beans using the biolistic approach

mentioned earlier (Aragao, 1999) in an effort to correct a deﬁciency for essential amino

l7

acids like methionine and cysteine in beans. Stable transformation and expression
exhibited by signiﬁcantly increased methionine content (14% and 23%) was observed in
two of the ﬁve transgenic lines. Recently, Aragao et al. (2002) transformed dry bean cvs.
Olathe and Carioca for resistance to the herbicide glufosinate ammonium using a biolistic
approach. Only 0.6% of the regenerated plants from Olathe were resistant to the
herbicide, and of these 24 plants, only two were tolerant in the ﬁrst sexual generation
(T1). Nevertheless, these plants were resistant to herbicide in both glasshouse and ﬁeld
trials and have now been incorporated in the bean breeding program in Brazil.
Electroporation. Electroporation is a gene transformation technique which
involves brief, high intensity electrical pulse(s) to create transient pores in the cell
membrane thereby facilitating the entry of exogenous DNA (Prassana and Panda, 1997).
Electroporation has been successfully used in crops like rice (Muniz de Padua et al.,
2001; Li et al., 1991) and corn (Sawahel, 2002). This transformation method is dependent
on efﬁcient callus production and regeneration systems whereby, transient or stable
expression of exogenous genes have been obtained from electroporation of cells from
suspension cultures, protoplasts, and pollen in various crop plants. However, successful
in planta transformation involving in vivo transformation of plants as they are developing
normally has been achieved in a number of crops using electroporation. In planta
transformation by electroporation has been achieved in pea, lentil, cowpea and soybean
nodal meristems (Chowrira et al., 1995, 1996). Transient transformation of kidney bean
(P. vulgaris cv. Giza3) was also obtained using electroporation of callus derived from

shoot tips (Saker and Kuhne, 1997).

18

Tissue Culture in Phaseolus vulgaris

A reproducible and efﬁcient in vitro regeneration protocol is one of the vital
factors for successful transformations, particularly for methods such as Agrobacterium-
mediated transformation and electroporation which rely on shoot induction from cell
suspensions or callus. Due to the absence of a reliable in vitro regeneration protocol in
beans, transformation in this economically important species has been difﬁcult to achieve
to date. However, transgenic plants have been obtained from callus with acceptable
efﬁciency in other grain legume plants including Glycine max (Donaldson et al., 2001),
Pisum sativum (Schroeder et al., 1993), and P. acutifolius (Dillen et al., 1997). Among
the early reports on in vitro shoot production in P. vulgaris (McClean and Grafton, 1989;
Franklin et al., 1991; Malik and Saxena, 1992; Mohamed et al., 1993), only one report
(Mohamed et al., 1993) involved production of shoots from regeneration competent
callus obtained from pedicels of P. vulgaris.

Using mature embryo explants on medium containing thidiazuron and indole-3-
acetic acid, regeneration competent callus was obtained from P. vulgaris and P.
acutifolius (Zambre et al., 1998). The in vitro produced plantlets from P. vulgaris,
however, required in vitro grafting with epicotyls and hypocotyls of 4-day old seedlings
due to hardening problems in the greenhouse. Plant regeneration has been achieved using
intact seedling and cotyledonary node explants of P. vulgaris cvs. F6nix and Maxidor on
MS media supplemented with benzylaminopurine and naphthaleneacetic acid (Ahmed et
al., 2002). Recently, successful in vitro cultivation and regeneration was achieved from
petioles explants of P. vulgaris Bulgarian cvs. Plovdiv 10, Plovdiv 11M and

Dobroudjanski 7 (Veltcheva and Svetleva, 2004).

19

Transformation in crops without a well established regeneration system

Currently, difﬁculties in transformation still exist in crops where reproducible and
efﬁcient transformation and tissue culture protocols have yet to be established. Even
when successful regeneration approaches have been reported, problems relating to
reproducibility and efﬁciency of the protocols for in vitro shoot regeneration as well as
genotype-dependency of developed systems provide difﬁculties in producing transgenic
plants using methods relying on regeneration procedures. Thus, breeding strategies to
introduce foreign DNA into dry beans using plant transformation should consider
approaches that do not involve a tissue culture or regeneration step. Due to these
difﬁculties, various alternative transformation techniques which include inﬁltration,
electroporation of cells and tissues, electrophoresis of embryos, microinjection, pollen-
tube pathway, silicon carbide-mediated transformation (Rakoczy-Trojanowska, 2002)
and the Ac/Ds transposable elements transposition system (Lebel et al., 1995) have been
developed. This study aims to enhance white mold resistance in dry beans using the novel
electrotransformation protocol (Allison, personal communication), a transformation
approach that targets cells in the apical meristem that are destined for meiosis and does

not involve a tissue culture step.

20

CHAPTER II
ELECTROTRANSFORMATION AND BIOLISTIC APPROACHES FOR
INTRODUCING gf-2.8 INTO DRY BEANS (Phaseolus vulgaris L.) FOR
ENHANCED WHITE MOLD RESISTANCE
INTRODUCTION

Production of dry beans has been constantly threatened by various biotic and
abiotic stresses resulting in major crop losses. One of the diseases that seriously affects
dry bean productivity is white mold caused by Sclerotim'a sclerotiorum, an aggressive
fungal pathogen that infects hundreds of plant species worldwide (Steadman, 1983;
Purdy, 1979). Current breeding strategies for white mold resistance in dry beans involves
combining physiological resistance conditioned by Quantitative Trait Loci or QTL
(Miklas et al., 2001; Park et al., 2001; Kolkman and Kelly, 2003 Ender and Kelly, 2005)
with architectural avoidance mechanisms (Coyne, 1980; Kolkman and Kelly, 2002;
Kelly, 2000). However, low and variable QTL effects for resistance to white mold have
limited breeding efforts to combine QTL for resistance. Thus, breeders need to go beyond
the traditional genetic approaches and consider transgenic breeding methods to enhance
resistance to white mold in dry beans.

Studies of S. scleroriorum oxalic acid-deﬁcient mutants have identiﬁed oxalic
acid as an important pathogenicity factor in white mold (Godoy et al., 1990). Oxalic acid,
which is a strong chelator of Ca2+, induces wilting as a consequence of lowering the
apoplastic pH to a value suitable for enzymatic degradation of plant cell walls (Bateman
and Beer, 1965; Maxwell and Lumsden, 1970). In addition, oxalates suppress the
oxidative burst of the host plant thereby compromising one of the host’s natural defense

responses (Cessna et al., 2000).

21

Genetic engineering techniques have been utilized to introduce exogenous genes
for desirable agronomic traits in cr0p plants. An obvious breeding strategy for white mold
resistance is the development of a transgenic dry bean which produces an enzyme that
degrades oxalic acid. Lane (2002) has demonstrated that oxalate oxidases (0X0’s) and
the germin 0X0 (G-0X0) gene are involved in defense responses to white mold in
cereals. The product of the germin gene is an oxalate oxidase that degrades oxalic acid
into water and hydrogen peroxide (H202). By transducing the hypersensitive response,
H202 promotes a localized cell necrosis in resistant cultivars, thereby limiting the site of
fungal invasion (Bolwell and Wojtaszek, 1997). The production of H202 is a key in plant
defense as an inducer of cellular protection genes and a hypersensitive response (Levine
et al., 1994; Tenhanken et al., 1995). Since the identiﬁcation and cloning of germin genes
from wheat and barley, a few crops have been successfully transformed with oxalate
oxidase including canola, peanut, soybean and sunﬂower (Thompson et al., 1995;
Livingstone et al., 2005; Donaldson et al., 2001; Hu et al., 2003).

Only a few reports appear in the literature on the successful transformation of
Phaseolus. Earlier efforts to produce transgenic bean plants have failed due to inefﬁcient
transformation systems and regeneration problems (Aragao, 2002). In contrast,
researchers have successfully optimized stable transformation of the tepary bean (P.
acutz’folius) using Agrobacterium (Dillen et al., 1997, Zambre et al., 2005). The use of
tepary bean as a ‘bridging species’ to introduce transgenes into economically more
important common bean species has been suggested, but no successful reports have
surfaced to date. Due to lack of success in regeneration and Agrobacterium-mediated

transformation of P. vulgaris, other methods have been pursued. Biolistic methods have

22

been used to transform dry beans that have generated successful transformants. Russel et
al. (1993) employed electrical-discharge particle acceleration, however, the tissue culture
regeneration protocol involved was tedious, time consuming, and genotype dependent.
Separate transformations for resistance to bean golden mosaic gemini virus and the
herbicide glufosinate ammonium have also been reported in dry beans using particle
bombardment method (Aragao et al., 1998, 2002). Stable integration of a transgene
coding for a methionine rich storage albumin from Brazil nut was obtained by Aragao et
al. (1999) using biolistic methods. However, the frequencies of transgenic plants obtained
from these studies were quite low.

Electrotransformation is a novel transformation procedure developed in the
Allison Laboratory (Plant Biology, MSU) that involves long-time exposure of plants to
electrical charge. This procedure has shown potential in transformation of large-seeded
legumes. In unpublished data, gus and bar transformed plants have been obtained using
this method with cowpea (Richard Allison, personal communication).
Electrotransformation targets cells in the apical meristem of a seedling including those
that are destined for meiosis. Transformation of pre-meiotic cells insures that the
introduced trait will be inherited by the progeny. One feature that makes
electrotransformation a more useful system particularly in crops like dry beans where
efﬁcient plant regeneration protocols have yet to be developed, is the lack of a tissue
culture requirement.

The study aims to investigate the use of electrotransformation and biolistic
methods to transform dry beans using the wheat G-0X0 gene (gf-2.8) to enhance

resistance to white mold. Speciﬁc objectives of the study were to: a) develop a

23

transformation plasmid with gf-2.8 and bar as the reporter gene, b) develop a
reproducible protocol for transformation in dry beans; c) evaluate effects of culture and
transformation conditions in efﬁciency of transformation; and c) evaluate white mold

resistance in putative transgenic plants.

24

MATERIALS AND METHODS
Plant Material

The dry bean (Phaseolus vulgaris L.) cvs. Matterhorn and Olathe were used.
Matterhorn is a white medium-seeded, high yielding, widely adapted great northern
cultivar (Kelly et al., 1999) while Olathe is a semi prostrate indeterminate pinto (Wood

and Keenan, 1982). Both cultivars are highly susceptible to white mold.

Plasmid Construction

The 1.7 kb EcoRI/HindII fragment, consisting of gf—2.8 linked to the cauliﬂower
mosaic virus (CaMV) 358 enhanced promoter and 3’ terminator region, from
pRD400/35S-gf-2.8 (Donaldson et al., 2001) was excised and ligated into
pCAMBIA3300 (CAMBIATM) that had been linearized with EcoRI/HindIII. The 4.8 kb
SspI/HindIII fragment, including the bar gene linked to the 358 promoter and nos
terminator was excised from pCAMBIA3300 (CAMBIATM) and subcloned to
pBluescriptKSII(-) (Stratagene) previously linearized with SspI/HindIII. The bar gene
encodes a phosphinothricin acetyl transferase known to confer tolerance to the herbicide
glufosinate ammonium. The resulting plasmid, pBKSbar/gf—2.8 carried the enh35S-g12.8

transgene and the selectable marker gene bar (Figure 2).

Electrotransformation

Electrotransformation was conducted using the protocol developed by Richard
Allison (Department of Plant Biology, Michigan State University). This procedure
involved the use of electrotransformation units designed and built to MSU speciﬁcations

by the Hyland Seed Company (Blenheim, Ontario).

25

Dry bean seeds were planted in pots containing autoclaved soil (BACCTO High
Porosity Professional Planting Mix, Michigan Peat Company, Houston, TX). After 5 to 8
days, the seedlings were removed slowly from the soil, washed and placed in a
transformation tube constructed from a 50ml polypropylene tube. One microliter of
SspI/HindIII digested plasmid DNA (25 ng/ul) was mixed with 49 pl of 1% TAE agarose
and allowed to set at the tip of a 200p1 pipette tip with a widened tip. Prior to
electrotransformation various pretreatments of the apical meristem were performed
(Table l). The terminal apical meristem of the seedling was then inserted in the widened
tip. Both the pipette tip and the transformation tube were ﬁlled with 1X TAE
transformation buffer, connected to a power source and allowed to run at 125 V and 0.15
mA for 15 minutes of direct current and 30 seconds of alternating current.

Following transformation, the seedlings were rinsed with distilled water,
transplanted directly into pots containing the potting material stated previously and kept
in the laboratory growth room for 24-48 hrs at 22-28°C with a 16/8 hr light/dark
photoperiod. The transformed plants (T0) were grown to maturity in the greenhouse and

T1 seeds were harvested.

26

EcoRl

  
 

gf.2.8
pBKSbar/ _ 3 .
gt-2-8 HdeII
6.9 kb
in ‘.-~
». . at,
Amp 4"" pUC on

Figure 2. Diagram of the transformation plasmid pBKSbar/gﬁZ. 8.

Table l. Pre-transformation treatments performed on seedling apical meristems prior to
electrotransformation.

 

Treatment Concentration
Control -
Meristems pierced with needle -
Hormone (identity preserved) lmM
Hormone SmM
Hormone lOmM
Hormone 15mM
Hormone 30mM
Hormone 50mM
Hormone 75mM
Hormone IOOmM
Lipofectin 20 pg/ml
Lipofectin 50 ug/ml
Lipofectin 100 ug/ml
Lipofectin 150 jig/ml
Lipofectin 200 pg/ml
Hormone + Lipofectin lmM + 50 ug/ml Lipofectin
Hormone + Lipofectin IOmM + 50 ug/ml Lipofectin
Ascorbic Acid 30mM
Ascorbic Acid 50mM

 

 

Hormone identity preserved at the request of Richard Allison.

27

Biolistic method

A. Tissue preparation

Mature seeds of cvs. Matterhorn and Olathe were surface sterilized with 20%
bleach and soaked in sterile distilled water for 16-18 hours at 22-28°C. The embryonic
axes were then excised from the seeds and the primary leaves and radicles were removed
to expose the apical meristems. The meristems were sterilized with 2% bleach and
inserted in 9—cm diameter petri dishes containing solidiﬁed MS medium (Murashige and

Skoog, 1962) with the apical region directed upward.

B. Preparation of microparticles

Preparation of microparticles was done as described by Aragao et al. (1996) with
some modiﬁcations. In a 1.5 ml eppendorf tube, 50 pl of 1.2pm-diameter tungsten
microparticles (M10, Biorad, Munich, Germany), 5 pl (lpg/pl) plasmid DNA, 50 pl
CaCl2 (2.5 M) and 20 ml spermidine free base were mixed sequentially while vortexing.
The DNA coated microparticles were then centrifuged at 15,000 g for 10 seconds.
Afterwards, the supernatant was removed and the pellet was washed with 250 pl of 100%
ethanol. The ﬁnal pellet was then resuspended in 60 ml 100% ethanol and vortexed for 1
minute before use. Aliquots of 10 pl were spread on macrocarrier membranes (Biorad,
Munich, Germany) and allowed to dry.
C. Bombardment

Transformation was done as previously described by Aragao et al. (1996) with
modiﬁcations to be amenable to the PDS-lOO Helium Particle Delivery System (DuPont,
Wilmington, DE) used. These modiﬁcations included: distance from rupture disk to

macrocarrier — 1.5 cm; distance from macrocarrier to stopping screen (Biorad, Munich,

28

Germany) — 2 cm; distance from stopping screen to the target — 9 cm; vacuum in the
chamber — 27 inches of Hg; and rupture disc (Biorad, Munich, Germany) pressure levels
1100 psi. The bombarded shoots were kept in the bombardment medium (basal MS
media) for one week and subsequently subcultured into MS medium supplemented with
44.3 pM 6-benzylaminopurine (BAP) as reported by Aragao et al. (1996). The shoots
were cultivated at 25°C with a 16-hr photoperiod. After 3-4 weeks in culture, elongated
shoots of about 4-6 cm in length and with roots produced from the bombarded apical
meristems (T0) were transferred to 15-cm diameter pots containing BACCTO High
Porosity Professional Planting Mix (Michigan Peat Company, Houston, TX) and covered
with a plastic bag for 1-2 week to acclimatize in the greenhouse. The plants were grown

to maturity and T. seeds were harvested.

Herbicide Screening for bar

A dose curve for the herbicide glufosinate ammonium of 50 mg/l to 300 mg/l was
conducted to determine the minimum level of herbicide appropriate for screening. A
subset of the T. seeds were sown and maintained in the greenhouse. Screening of the T.
generation was done by spraying plants about 7-10 days after planting with an herbicide
application rate determined from the dose curve conducted prior to each herbicide screen
(150 to 250 mg/l). Tolerant plants were transplanted into 15-cm diameter pots and grown

to maturity.

PCR Analysis
The PCR reaction was carried out in 25 pl reactions containing 200pM of each

dNTP, 2.5 mM MgCl2, 1X PCR Buffer (Invitrogen, Carlsbad, CA), 0.2 pM of each

29

primer, 1 U of T aq polymerase (Invitrogen, Carlsbad, CA) and 20 ng of genomic DNA.
PCR ampliﬁcation of the bar gene was conducted using the primers P2510
(5’GAAGTCCAGCTGCCAGAAAC3’) and P2958
(5’GGTCTGCACCATCGTCAACC3’) (Aragao et al., 2002), while ampliﬁcation of gf-
2.8 was performed with the primers 5’GCCTGTTCGCAATGCTGTTA3’ and
5’ACCGACGTTGAACTGGAAGTG3’. The reaction mixture was denatured for 2
minutes at 94°C and ampliﬁed with 35 cycles (94°C for 1 minute, 60°C for 1 minute,
72°C for 1 minute) with a ﬁnal 5 minute cycle at 72°C using a PTC-lOO Thermal Cycler

device (MJ Research, Inc., Watertown, MA).

Oxalate Oxidase Assay: Fluorescence Assay

The ﬂuorescent assays were done with the Amplex Red kit (Molecular Probes,
Eugene, OR). The Amplex Red assay allowed the measurement of H202 generation. In
the presence of peroxidase (supplied as Horseraddish peroxidase) the Amplex Red
Reagent (ARR) reacts with H202 to produce a red ﬂuorescent oxidation product,
resofurin. This assay relies on the detection of H202 produced by the activity of oxalate
oxidase on oxalic acid. Two 4-mm leaf discs from 208 putative transgenic T2 plants were
incubated in microtiter plates with the oxalate oxidase assay buffer (18 mg oxalic acid in
100 ml of 2.5 mM succinic acid, pH 4) for 20 minutes at 37°C. After incubation of the
leaf discs with the oxalic acid buffer, a 20 pl aliquot of each sample was transferred to a
fresh plate using a multichannel pipettor and brought to 50 m1 volume with the kit
reaction buffer. For the detection reaction, 50 pl Amplex Red horseradish peroxidase
reagent was added to each well and the plates were incubated in the dark for 1 hr.

Fluorescence was detected with a plate reader, using a 531 nm excitation ﬁlter and 572

30

nm emission ﬁlter at 30 min and one hr after incubation. A standard curve allowed the

calculation of the total H202 released.

Oxalic Acid Assay

Detached leaf assays were performed to assess the ability of oxalate oxidase
expression to prevent leaf damage in response to application of oxalic acid to plant tissue.
Detached leaﬂets were arranged on inverted plastic weighing boats in 15-cm petri dishes
containing moist ﬁlter papers. The primary trifoliates were used in the assay for leaves
from 208 T2 plants, with each leaﬂet representing a sample. Each leaﬂet was wounded in
two locations with an 18-gauge needle, and 20 pl of oxalic acid (200mM) was applied to
each wound and incubated for 6 hrs (Figure 3a). To quantify lesion size, leaﬂets were
scanned using a ﬂatbed scanner and images were analyzed for lesion size using ASSESS:

Image Analysis for Plant Disease Quantiﬁcation (Lamari, 2002).

Fungal Bioassay

Fungal assays were performed using detached leaﬂets inoculated with an agar
plug of S. sclerotiorum mycelia as described by Livingstone et al. (2005) with some
modiﬁcations. S. sclerotiorum was isolated from infected dry bean plants and grown at
room temperature on potato dextrose agar (Difco, VWR, Montreal, Quebec, Canada). For
inoculum source in fungal bioassays, fungal mycelia plugs were inoculated on Petri
dishes in the same medium composition and stored in the incubator at 25°C. Agar plugs
(5.5 mm diameter) were taken from the actively growing edge. Leaﬂets were wounded
with an 18-gauge needle near the midvein and the plugs were placed over the wounded

area. Three leaﬂets from the second trifoliate were inoculated for each plant line tested

31

using a minimal quantity of agar in each plug (Figure 3b). The inoculated leaﬂets were
then incubated for 30 hrs at 25°C, and lesion areas were measured as previously

described in the oxalic acid assays.

_ who}!

 

Figure 3. Set-up of assays conducted on T2 and T3 plants. a, oxalic acid assay. b, fungal
bioassay.

Southern Blot Analysis for bar and gf-2.8

Total DNA was isolated from the gf-2.8 PCR positive plants. Fifteen pg of DNA
was then digested with EcoRI, electrophoresed through 1% agarose and transferred to
nylon membranes (Southern, 1975). The primers 5’GAAGTCCAGCTGCCAGAAAC3’
and 5’GGTCTGCACCATCGTCAACC3’ were used for the generation of a 445 bp probe
for bar while 5’GTGAAGGTCAAGTTGCAGCCA3’ and

5’GCCTG'ITCGAATGCTG'1'I‘A3’ were used to generate a 470 bp probe for gf-2.8 in 35

32

cycles of 94°C — l min, 60°C — 1 min, 72°C 1 min. The probes were then labeled with 32P
using The Megaprime Labelling Kit (Amersham Biosciences, Piscataway, NJ). The
prehybridization blots were hybridized with each probe overnight at 65°C. The blots were
then washed in Low Stringency wash (2X SSC, 0.1% SDS) twice for 15 min at 25°C,
Moderate Stringency Wash (0.2X SSC, 0.1% SDS) twice for 5 minutes at 37°C and High
Stringency Wash (0.1X SSC, 0.1% SDS) twice for 5 minutes at 65°C and then visualized

by autoradiography.

Reverse Transciption-PCR (RT-PCR)

From the gf-2.8 PCR positive T2 plants, about 200 mg of leaf tissue was collected
and frozen on liquid nitrogen. The tissue samples were homogenized with 1 ml of Trizol
Reagent (Invitrogen, Carlsbad, CA). The homogenized samples were incubated for 5 min
at 22°-25°C. Then, 0.2 ml chloroform was added to each tube and the tubes were shaken
by hand for 15 sec. The tubes were incubated at 22°- 25°C for 3 min and were centrifuged
at 12,000xg for 15 min at 2-8°C. The aqueous phase was transferred to a fresh tube and
0.5 ml of isopropanol was added. The samples were incubated at 22°- 25°C for 10 min
and centrifuged at 12,000xg for 10 min at 2-8°C. The supernatant was then removed and
the RNA pellet was washed with 1 ml 75% ethanol. The samples were vortexed brieﬂy
and centrifuged at 7,500xg for 5 min at 2-8°C. The RNA pellets were then allowed to dry
for 10-15 min, dissolved in RNase-free water and stored at -80°C.

RT-PCR was performed using the SuperscriptTM F irst-Strand Synthesis System
for RT-PCR (Invitrogen, Carlsbad, CA) using the primers
5’GCCTGTTCGCAATGCTGTTA3’ and 5’ACCGACGTTGAACTGGAAGTG3’ to

amplify the gf-2.8 transcripts. KBACT-N and KBACT-C (Hamada et al., 2002) primers

33

were used to amplify the bean actin transcripts. The reaction was carried out in 25 pl
reactions containing 200pM of each dNTP, 2.5 mM MgCl2, 1X PCR Buffer (Invitrogen,
Carlsbad, CA), 0.2 pM of each primer, 1 U of Taq polymerase (Invitrogen, Carlsbad,
CA) and 20 ng of cDNA. The reaction mixture was denatured for 2 min at 94°C and
ampliﬁed with 35 cycles (94°C for 1 min, 60°C for 1 min, 72°C for 1 min) with a ﬁnal 5

min cycle at 72°C using a FTC-100 Thermal Cycler device (MJ Research, Inc.).

Note: Images in this thesis are presented in color.

34

RESULTS
Study 1: Particle Bombardment

Eight batches of embryos were bombarded with the circular pBKSbar/gf-2.8
DNA for the experiment for a total of 760 dry bean embryos. Using the shooting medium
containing 10 mg/l of the cytokinin, 6-benzylaminopurine (BAP), all of the explants in
the ﬁrst two batches of bombardment were lost due to shoot death. Shoot growth and leaf
development in the growing embryos was observed during the ﬁrst week in the shooting
media, however, growth of the plantlets appeared stunted, root formation was absent or
inferior and shoots eventually turned brown and died after 3 to 4 weeks in the media
(Figure 4). Due to these observations, it was suspected that the BAP concentration used
in the shooting media had affected normal growth of embryos and plantlet development
and survival in vitro. Therefore, succeeding embryo batches were either transferred to or
grown initially on the shooting medium containing BAP levels less than 10 mg/l. In the
last 6 batches of transformations conducted, 42 Matterhorn and 84 Olathe plants (T0)
were produced. The T0 plants were allowed to set seed and a subset consisting of 6 seeds
from each To plant were screened for herbicide tolerance. The screen of 594 T. plants
generated 4 Matterhorn and 5 Olathe herbicide tolerant putative transformed plants.
Genomic DNA extracted from these 9 herbicide survivors were screened for integration

of both bar and gf-2.8 using PCR, however, no ampliﬁcation was observed.

35

Table 2. Summary of results from particle bombardment experiments with bar and gf-2.8

 

 

genes.

Matterhorn Olathe
embryos bombarded 360 400
plants produced 42 84
screened with herbicide 187 407
herbicide tolerant 4 5
PCR positives (bar and gf-2.8) 0 0

 

 

 

 

Fig 4. Olathe and Matterhorn shoots growing in 10 mg/L BAP after 3 weeks in culture.

36

Study 2: Electrotransformation

Using the electrotransformation protocol, a total of 1,150 dry bean seedlings were
transformed with the linearized SspI/HindIII fragment of pBKSbar/gf-2.8 (Table 3 and
4). About 84% and 92% seedling survival was noted on Matterhorn and Olathe plants,
respectively. Using a sample of T. seeds from each To plant, 4,250 Matterhorn and 2,888
Olathe plants were screened for herbicide tolerance. A total of 92 Matterhorn and 71

Olathe plants survived the herbicide screenings.

PCR Analysis on T. and T2

Polymerase chain reaction (PCR) from herbicide tolerant plants using the gf-2.8
speciﬁc primers showed integration of the germin (G-OXO) gene in a total of 18
Matterhorn and 11 Olathe T. plants (Figure 5). PCR analysis, however, with the bar
speciﬁc primers showed integration in only 12 Matterhorn and 8 Olathe T. plants (Figure
6). Sixteen (89%) of the gf-2.8 PCR positive plants from the cv. Matterhorn were
progenies of To plants pretreated with various levels of Hormone (identity preserved)
prior to transformation. Of these plants, ten (62.5%) were from To plants that were
pretreated with 5mM Hormone. In Olathe, 9 (82%) of the PCR positive plants were from
To seedlings pretreated with various Hormone concentrations. In contrast to Matterhorn,
the majority (63.6%) of the PCR positive plants of Olathe were from the 30mM Hormone
pretreatment. Due to earlier results on the generation of bar and gf-2.8 PCR positives
from pretreatments with Hormone, additional electrotransformations were performed on
Matterhorn plants pretreated with 5, 30, 75 and IOOmM Hormone. However,
transformation and herbicide screens did not produce additional bar or gf-2.8 PCR

positive plants. In Figure 7, integration of the germin gene was conﬁrmed through PCR

37

in only 4 T2 plants, three of which are Matterhorn (D2Ml-5, E13Ml-3 and E13M2-1)

and one was Olathe (D230l-5).

Southern Hybridization
Several attempts were conducted to verify gene integration in gf-2.8 PCR positive
T. and T2 plants using Southern hybridizations with probes for both the bar and gf-2.8

genes without success.

38

 

 

 

_ _ K gm ”2 8n Bee
o N E am 2 m 29.. 03.82 25%
_ _ a: R em a 22 288...... 283
o o s; R on a 5385 Eu: 8 + eeeeee: .282
o _ N: em on o eeeeeas Bee: on + 885: 2::
- e we 2 o... z eeeeeen :5»: 8m
- o Mr em 3 2 eeeeea: En: o:
_ e E am on ._ eeeeeea =5»: 2:
o m a: R on x 58885 Eu: 8
o a 9: an cm A 532.: :5»: cm
o 2 2». mm mm z ease: 25%
e 2 RM em 2 0 22:5: 252
o m a: 2 2 a 82:8: 2:5
_ a m3. 2. mm m eeeece: .252
_ _ am a 2 a 885: zen
o e mm x 2 o eeeeee: 2e:
0 m N: a on _ 282 5:. Bass masseuse
e e ma em 8 m .< eases: oz
adixw wager—3 Arc tome—am 2:323 2.5 cog—£89: 2:2.
3.. + 19— 0293.8: 3.33 be 3:53. He hon—5:. 8:2; .3 3:5...— aoaaa E05328

 

 

 

 

 

 

 

30989 cocaﬁcoﬁcmboboo—o 05 ME? 355 6520 we wﬁcoeom do; can ASA—Eoﬁﬁm 836823 0203.6: Co 333% .v 2an

39

 

 

 

M: Na 39 wmn 0mm .88.
_ 2 mi mm om m Eo< 2:803. 2E3
o o m 2 mm cm m 20.4. 05.83. 253
o _ m 2 cm om m ccoﬂomﬁ :5»: am + 258.8: 283
o o E S em 0 eeeeea: :5»: 0m + 08:5: 2::
o _ E _ em on Z croutons _E\m= com
o o E _ on on 2 ccuﬂomﬁ Eh: om _
_ e N: em 2 a 538: in: 2:
o _ N: am Om M 588094 :5»: om
o v hm _ am on a 580C094 ER: om
o n gm om om D BEES: 2E2:
o o EN vw mm .H. 32:83 2E3.
_ w Nmm em mm 3 255.5: 2E3
N 2 Sb mm 8 O sconce: EEO».
o m x: mm mm ”— ococco: 252
m m vow mm mm m ococto: 282

2 2 Gm mm on Q 32:8: 32%
o o 2: vm mm D 288.8: 2::
o _ om _ om om _ 0:60: FEB 382; 2:93:02
o o mmm E. on m .< E253: 02

KW”: 29:23 1.5 3»:an 233.5.“ 2.5 oncemga. oEa: EoEaaock
+ mu.— oEoESl 853 he pea—8:: he .35.:— 853 he hon—E:— =32

 

 

 

 

48205 :ozaeEoﬁEmhoboo—o 2t muslin mace—m €25th

 

 

Co mchocom mon— E:

 

 

AﬁacoEEw BeEméawv 03055: Co awed .m ﬁne...

40

  
  

.8N8 E8
.8N8 ~28
.. 5s8 - EB
.. _o_ e m ESQ
.. 8N8 - N25 been —
... #0 M NU - Ngm—m— nmﬁiémgme
.88 n 58
mSKQ _ Sam—m 83>»
Etc.
:28 — 2:8
:88
. as; _ a 525%:
3,55 . EN 2 o
.. 5w E
.83 w 958
.. 82m :88
:98

ZZwQ

-
.
. m 883 g

age 3.5:.

.
_ a

  

Figure 5. Polymerase Chain Reaction (PCR) results in 29 dry bean T. plants using g”-

=Matterhom; (bold)=produced gf-2.8 PCR

2.8 speciﬁc primers. *=Olathe; (unmarked)

and/or RT-PCR positive plants.

41

.353 “Eamon yam

-E SE m8 mime Boéoanﬁoa ”Eoeozmzueﬁsaaa

65203 .muoEtm 2&0on x3 mean 383 it :89 En om E8.“ 30% cowomom EEO ommuoEbom .e 2:me

s'z-J3/4vqsxad

1919M
9qu0

moqjauew

W178

ZWEIEI

* {OZZD

*ZOZZD
*IOIE)
*IOZZD
#2091

I

, . in a .r.

km

:4: [08 RI
* IO6lEl
lWSSI—I
ZWICI
ZW6CI
lW6ZD
IWZID
asIOEZG
VWLG
SWLCI
IWEIEI
ZWSI'I
IWOICI

 

42

‘ Matterhorn
pBKSbar/gf-2.8

*
'ﬁ‘Tﬁm
5523*
“ENCORE:
“NH—N
gamma

Olathe

 

Figure 7. Polymerase Chain Reaction (PCR) from four T2 plants using gf-2.8 speciﬁc
primers. Genotypes with * are Olathe, and Matterhorn if unmarked.

43

RT-PCR

Since the Southern analyses were unsuccessful, RT-PCR was performed on the 4
gf-2.8 PCR positive T2 plants. Positive RT-PCR results were obtained from two T2
Matterhorn lines, D2M1-5 and El3M2-1, and the Olathe line, D230l-5, indicating the

production of the gf-2.8 transcript which conﬁrms the expression of the gf-2.8 gene

(Figure 8).

Matterhorn

‘—

Q)
'0
'0
i.“

a.
.o
o
o

Olathe
D2301-5
E13M1-3
D2M1-5
E l 3M2-l

 

gf-2. 8
i—
0)
E 58
0 tn "9 'T "3 «s
E o ._'. " N 5 “a"
d)
a ﬁ 2 E 33 m a
2 O (J Lu LU Q —
bean actin

 

Figure 8. RT-PCR with gf-2.8 and bean actin speciﬁc primers on four T2 plants previously
conﬁrmed for gf-2.8 gene integration with PCR.

44

Oxalate Oxidase: Fluorescence Assay

The assay was performed on 208 T2 plants from 23 T; gf-2.8 PCR positive plants
(Table 3A). However, ﬂuorescence results are only reported for four T2 PCR and RT-
PCR positive plants. The four plants were obtained from experiments performed on
different dates; thus, respective Matterhorn and Olathe untransformed control plants for
each experimental batch are reported for comparisons.

In comparison to controls, higher ﬂuorescence readings were noted from the 4 T2
plants after both 30 min and 1 hr incubation. A higher mean ﬂuorescence reading was
also consistently observed in the T2 plant D2M15-1 compared to D2301—5, E13Ml-3 and
El3M2-l (Figure 9).

A consistently higher H202 concentration was observed in all of the four gf-2.8
PCR positive T2 plants relative to the control (Table 5). Statistical analysis continued
signiﬁcant increase in H202 concentration in some of the T2 plants over the respective
batch controls in both incubation durations. Among the four plants, the Matterhorn
DZMl-S was observed to have the highest amount of H202 produced relative to the
untransformed control. As much as 37% and 54% signiﬁcant increases in H202
concentration over the control was recorded for DZMl-S after 30 min and 1 hr
incubations, respectively. The second highest H202 concentration was noted from the
Olathe, D230-5 with about 32% increase in H202 amounts over the control aﬂer 1 hr

incubation.

45

6000.00

 

 

 

5000.00 'r
,, l
§4000.00 f
= l
23000 00 " EOE;
é ' I Ilhour '
2 ‘ -, w
o l
32000.00 ‘
e
1000.00 i . 3
0.00 l . - _ m' .n m
l—l '— II)
«a g g ‘E _- g 3 i=3
v—I o m
E E 2 g E ‘5 a 6
a g m 33 Q g Q
E z 2
Genotype

Figure 9. Mean ﬂuorescence units of the PCR positive T2 plants relative to the batch
untransformed control.

46

Sodv E Enocmcwiia. ”56v E 38$:me 0...... ﬁch 8 282.:ch u ..

m

 

 

 

 

 

 

 

 

50.2 hvmmd Sud wvd Nc.w mm _ md mmd bmd Tmzﬂm
mod mommd mvd mvd Omd vmwnd .md mmd m-:2m_m
wagm *Lmood mm..— 054 vow. 536 and vod $530
owdm *Rvod 9N6 mud noﬁm *cnvod ovd who m-_2~d
A23 . , A23 .
omNMWMw—cw” acme 5282588 .828 N sziwwwwwm “WW—Wan.” «:98 :ozﬁEoocoo 65:8 N Awéiwwwuwm
. \o -3 02.9fm 38.8282: 53m 0 I < . \c .: nigh 38828:: seam O I < QhN
E2 H

 

8:835 .50: _

 

222335 5E om

 

 

.7580 38088382:
:88 05 58 8:388:00 NONI E 0882: :5ch was ﬂaw—Q “Eamon MUm N H Sow E 852605 NONE :32 .m oEaH

47

Evaluation for White Mold Resistance

The oxalic acid and fungal bioassays were conducted on 208 T2 plants on different
dates, and the results from the 4 gf-2.8 PCR and/or RT-PCR positive T2 plants are
reported with respect to controls (Table 1A and 2A). The four T2 PCR positive plants had
a lower average lesion size in comparison to controls following inoculation, however,
signiﬁcant reduction in mean lesion size was noted only in D230l-5 and E13M2-1
(Table 6). The highest reduction in lesion size was obtained from El3M2-l with as much
as 36% reduction over the untransformed Matterhorn. This was closely followed by about
28% reduction in lesion size from D230l-S.

Fungal bioassays with mycelia] plugs of S. sclerotiorum were also performed to
evaluate enhanced white mold resistance. Similar to the oxalic acid assay, only results
from the 4 gf-2.8 PCR and/or RT-PCR positive T2 plants are reported with respective
batch controls for comparisons. Enhanced resistance in this case was suggested by a
reduction in lesion size in comparison to controls. Fungal bioassays showed a smaller
lesion area in the four PCR positive T2 plants compared to controls implying a minor
enhancement of resistance to S. sclerotiarum. Statistical analysis showed a signiﬁcant
reduction in mean lesion size in the three T2 lines: D2M1-5, El3M1-3 and E13M2-1
(Table 7). In contrast to oxalic acid assay results, E13M1-3 had the lowest mean lesion
area recorded (381 m2) and highest reduction in mean lesion area (24%) among the T2
plants screened. D2M1-5 closely followed with about 19% reduction in lesion area.
Although the T2 plant, D23OS-1, which previously showed promising resistance based on
ﬂuorescent and oxalic acid assays, was observed to have a relatively low lesion size

reduction (10%); not signiﬁcantly different from the control.

48

Table 6. Average lesion size in the four PCR positive T2 plants and the percent reduction

in lesion area from the untransformed control using the oxalic acid assa .

 

Average lesion

Batch untransformed

p-value (t-test)a

% reduction from

 

 

 

 

 

T2 p'a‘" ID area (mmz) control lesion area (mm) batch control
D2M1-5 61.13 72.09 0.3775 15.21
D2301-5 84.12 116.16 00174“ 27.59
E13M1-3 107.93 119.59 0.3484 9.75
E13M2-1 74.06 114.85 0.0038** 35.51

 

a * = signiﬁcant at <0.05; **= signiﬁcant at <0.0l; ***signiﬁcant at <0.001

Table 7. Average lesion size in the four PCR positive T2 plants and the percent reduction
in lesion area from the untransformed control using fungal bioassay.

 

Average lesion

Batch untransformed

% reduction from

 

T2 plant ID area (mmz) control lesion area (mm) p'value “46598 batch control
D2M1-5 432.33 533.48 0.0072** 18.96
D230l-5 553.15 617.20 0.0693 10.38
E13M1-3 381.36 502.54 0.0020** 24.11
E13M2-1 396.58 474.70 0.0304* 16.46

 

 

 

 

 

a * = signiﬁcant at <0.05; **= signiﬁcant at <0.0l; ***signiﬁcant at <0.001

49

Bioassays on T3 Plants

T3 plants derived from the 4 PCR positive T2 plants and 3 T2 plants with lowest
lesion size in the two assays conducted (Table 4A) were used to assess activity of the
oxalate oxidase gene. Eight seeds from each plant were planted in the greenhouse;
however, oxalic acid and fungal bioassays were conducted only on plants that
germinated. Similar to the assays conducted on T2 plants, the genotypes were assessed on
different dates, hence, comparisons were done based on respective controls (Table 5A
and 6A).

Table 8 shows the genotypes selected based on a 20% or higher reduction in
lesion area relative to batch controls. Among the progenies from the 4 PCR and/or RT-
PCR positive T2 plants evaluated with oxalic acid assay, E13Ml3-8 had the highest
signiﬁcant reduction in mean lesion size at 39%. This reduction is considerably higher
than what was previously observed from the T2 parent (E13M1-3). The T2 plant, E13M2-
1 which had the highest reduction in lesion size (35%) among the PCR conﬁrmed plants
produced the T3 progeny E13M21-3 with a signiﬁcant mean lesion size reduction of 29%.
The T3 plants D23015-4 and D23015-7, progenies of the T2 plant D230l-5 previously
exhibiting moderate improvements in white mold resistance in majority of the indirect
tests performed, had 23 and 20% reduction in lesion size, respectively.

Results from fungal bioassays showed that the T3 plant, D23015-2, was observed
to have the highest reduction (39%, p<0.0001) in lesion size (Table 9). This reduction is
about 4-fold over that observed in the T2 parent. Three T3 progenies from the T2 line
El3M1-3 grouped among the progenies with highest reduction in lesion size (27, 25 and

19% reduction). It should be noted that T3 plants D2M15-3 and D2M15-4 had both high

50

lesion size reduction relative to the control in both oxalic acid and fungal bioassays.
These observations indicate potential improved gene activity and expression from
progenies as well as more stable transgene transfer to succeeding generations than
previously noted among T2 progenies. However, veriﬁcation of transgene integration

through PCR analysis in the T3 lines has yet to be conducted.

Table 8. Lesion area and lesion size reduction over batch controls in selected T3 plants
following oxalic acid assays with mean lesion size reduction of at least 20%.

 

 

Average lesion Batch 3 % reduction

T3 plant ID area (mmz) zgggﬁonrrggd p-value (t-test) frzginzaglch
E13M13-8 64.32 105.11 0.0015" 38.81
E13M21-3 73.50 103.63 0.0180* 29.07
E13M13-7 73.88 103.63 0.0194* 28.70
D23015-4 92.94 120.20 0.0319* 22.68
D2M15-4 59.28 75.93 0.1655 21.93
E13M13-4 71.44 90.74 0.1086 21.26
D23015-7 82.83 103.88 0.0963 20.27
D2M15-3 62.20 77.70 0.2197 19.95

 

 

 

 

 

a * = signiﬁcant at <0.05; **= signiﬁcant at <0.01; "*signiﬁcant at <0.001

5]

Table 9. Lesion area and lesion size reduction over batch controls in selected T3 plants
following fungal bioassays with mean lesion size reduction of at least 15%.

 

 

T3 plant ID Agggéllﬁzif“ untraﬁiastffoli'med p-value (t-test)a %£edumi°" from
control (mmz) atch control
D23015-2 348.59 541.12 <0.0001*** 35.58
E13M13-1 219.03 311.51 0.0044“ 29.69
E13M21-7 312.19 424.58 0.0006*** 26.47
E13Ml3-6 265.41 352.70 0.0010" 24.75
D2M15-4 323.41 418.57 0.0034** 22.74
E13M21-8 258.87 330.90 0.0258* 21.77
E13M13-3 269.52 330.90 0.0567 18.55
D2M15-3 272.52 330.90 0.0698 17.64
El3M21-1 292.08 352.70 0.0203* 17.19
E13M21-3 292.57 352.70 0.0213* 17.05
D2M15-5 279.76 330.90 0.1117 15.45

 

 

 

 

 

a * = signiﬁcant at <0.05; **= signiﬁcant at <0.01; ***signiﬁcant at <0.001

52

DISCUSSION
Particle Bombardment

The failure to produce PCR positive bean plants via particle bombardment led us
to terminate further bombardment efforts and focus on producing transformants with the
eletrotransformation protocol. Early efforts with bean transformation using particle
bombardment by Allavena and Bemacchia (1991) had transformed embryo axis of P.
vulgaris and P. coccineus with the gas and nptII genes. However, no molecular
conﬁrmation of gene integration was reported.

In the study by Aragao et al. (2002), biolistic transformation of over 11,000 dry
bean embryos for the bar gene resulted in a 39% plantlet production efﬁciency and
0.53% transformation rate. Because of the extremely low plantlet production and
transformation efﬁciencies in dry beans associated with the biolistic procedure, the
failure to produce transformants in this study could be attributed to the small number of
embryos bombarded. Although, the physical nature of the particle bombardment
approach eliminates genotype-dependency, Aragao et al. (1997) found that
morphological factors of the apical meristem are vital for the transformation of dry bean
embryos. Thus future studies with beans using this transformation procedure should
consider the use of dry bean cultivars with exposed apical meristems. Plant growth
hormones have been used in tissue culture to inﬂuence growth and development of plant
tissues. Optimizing the growth hormone concentrations in the shooting medium may also
help improve the low plantlet production efficiency in this study and could possibly help

in the recovery of transformed shoots in the future.

53

Due to the difference in the apparatus for explant bombardment used, certain
changes in the transformation conditions used by Aragao et al. (1996), were implemented
in the study. These modiﬁcations included various longer ﬂying distances of
microparticles to target and lower pressure level. Moreover, the limited capability for
bombardment pressure levels in the PDS-Helium System available for use in the study
allowed only for bombardment of embryos at 1100 psi instead of 1200 psi as used by
Aragao et al. (1996, 2002). Thus, use of other bombardment pressure levels for

bombardment could be investigated.

Electrotransformation

Previously, cowpea plants were transformed with the electrotransformation
protocol and integration of the bar gene was conﬁrmed through PCR (Allison, personal
communication). This study is the ﬁrst report of the successful transformation with the
novel protocol of electrotransformation that provides PCR, RT-PCR and bioassay
evidences of transformation beyond the To generation in dry beans. Moreover, in
comparison to the work on cowpea (Allison, personal communication) where transfer of
the bar gene to the T2 progeny failed, we have provided evidence through PCR and/or
RT-PCR for the successful inheritance of the gf-2.8 gene in four T2 plants.

PCR with T2 genomic DNA indicates inheritance following reproduction.
However, the rate of 1.9% transfer to the next generation was lower than expected. It is
speculated that in almost all of the T2 plants screened, both the bar and gf-2.8 were not
successfully transferred to the next generation. The loss of the transgene can be attributed
to a possible mode for gene insertion in the genome that occurs during

electrotransformation suggesting instability in gene integration, and subsequent

54

elimination that could be associated with the transformation approach. Further studies
need to be conducted to determine mode of transgene integration with the
electrotransformation procedure.

The majority of the bar and gf-2.8 PCR positive T1 plants were progenies from
plants pretreated with Hormone. The Hormone is commonly associated with signaling in
gram-negative bacteria, and in bacterial conjugation which has been suggested to share a
similar mechanism with T-DNA transfer using Agrobacterium-mediated plant
transformation (Binns and Thomashow, 1988). Effective transformation, as evidenced by
PCR, was achieved using 5mM Hormone in Matterhorn and 30mM Hormone in Olathe.

The ﬂuorescence assays performed showed a considerable increase in H202
concentration following incubation with oxalic acid and subsequently peroxidase. As
much as 54% and 32% increases in H202 concentration were observed in D2M1-5 and
D2301-5, respectively. This data supports the RT-PCR results indicating positive
transgene expression in these two lines. The ﬂuorescence units observed in this study,
where twice as much tissue was utilized for the assay, was about 3 to 10 times higher that
obtained in ﬂuorescence assays reported by Livingstone et al. (2005).

This study has demonstrated a slight increase in resistance of detached dry bean
leaves to exogenous application of 200mM oxalic acid. Oxalic acid is a very strong
organic acid and can cause extensive damage to plants tissues (Bateman and Beer, 1965).
The levels of oxalic acid used for exogenous application in the study is about 20-fold
higher than levels normally found in infected plant tissue. In this study, as much as 36%
reduction in lesion size was observed in the line, E13M2-l. This reduction in lesion size

however, was lower than what was previously observed in peanut transformed with the

55

barley oxalate oxidase gene wherein 65% to 89% reduction was observed (Livingstone et
al., 2005). However, the reduction observed in this study was considerably higher than
the 17% to 18% lesion reduction in transgenic hybrid poplar leaf disks exposed to 200
mM oxalic acid (Liang et al., 2002). The differences in the resistance to oxalic acid
observed between this study and the peanut and poplar studies could be due to differences
in plant species, gene expression levels and the assay conditions used.

Enhanced resistance to the application of S. sclerotiorum ﬁingal mycelia was also
exhibited by the four T2 transgenic plants. In this study, the greatest reduction in lesion
size was noted from E13M1-3, with a 24% reduction in lesion size. This value, however,
is lower than both the oxalate oxidase transformed peanut and hybrid poplar. In the case
of the barley OXO transformed peanut, inoculation with the fungus S. minor resulted in a
mean lesion size reduction of 75 to 97%, whereas a lesion size reduction of 63% was
observed in the wheat OXO transformed hybrid poplar (Livingstone et al., 2005; Liang et
al., 2001). The differences in the indirect test for resistance observed in this study in
comparison to transgenic peanut and hybrid poplar studies may have resulted from the
different pathogens and assay conditions used.

The results from the ﬂuorescence assay, however, do not appear to correspond
with those observed in the oxalic acid and fungal bioassays. The variable results in the
three assays conducted could be due to different reasons. Indirect tests to evaluate
improvement in white mold resistance were chosen due to lack of prior knowledge on the
activity of this transgene in dry beans as well as the apparent lack of an in vitro culture
system that would allow for the generation of multiple clones from a single T2 plant for

all the different assays. The detached leaf method is one of the methods used to evaluate

56

bean genotypes for resistance to white mold. However, several reports have shown that
ﬁndings in detached leaf assays oﬁen do not correlate with ﬁeld results (Steadman et al.,
2001). Moreover, Kull et a]. (2003) found that the detached leaf assay was less sensitive
in evaluating white mold resistance in dry beans compared to the cut stem inoculation
methods.

Oxalic acid and fungal bioassays were conducted on a sample of T3 plants from
the 4 PCR positive T2 plants. From these assays, higher reductions in average lesion size
were obtained from a few T3 plants compared to the T2 parents. However, these
differences in enzyme activity could be due to the varying planting dates and
environmental conditions despite the similar incubation conditions maintained during the
assays. Based on the results of the various assays conducted on T2 and T3 progenies to
indirectly assess gene activity and white mold resistance, further evaluation of the
remaining progenies from the four PCR positive T2 parents and the T3 parents, D23015-

2, D2M15-3, D2M15-4, E13M13-8 and E13M21-3, is suggested.

57

CONCLUSIONS

From the herbicide screens on T1 and subsequent analyses through PCR, four T2
plants were conﬁrmed to contain the gf-2.8 transgene. RT-PCR was used to further
establish gene integration in only 3 of the 4 T2 gf-2.8 PCR positive plants. Indirect tests
that quantify gene activity showed a slight improvement for potential white mold
resistance in the four T2 PCR positive and T3 lines. Increased H202 production over
controls, as well as decreased lesion size following fungal mycelia or oxalic acid
inoculations indicated minor gene activity toward oxalic acid degradation. The four PCR
positive T2 lines as well as T3 plants from these lines, however, still need further
molecular conﬁrmation either by Southern or Northern Hybridizations.

This study established the applicability of the electrotransformation protocol for
plant transformation particularly in dry beans. This approach will have wide applications
particularly to crops where reproducible and reliable plant regeneration systems have not
yet been established.

Based on the assays conducted in this study, only a slight improvement in white
mold resistance was attained in the transformed plants. In the white mold infection
process, multiple factors are involved besides the production of oxalic acid by the fungal
pathogen. Establishment of fungal disease and infection involves hydrolytic enzymes and
other cell wall degrading enzymes. A better and more durable resistance to a very
complex disease as white mold may require expression of other endogenous resistance

genes in combination with the oxalate oxidase gene.

58

CHAPTER III
EFFECT OF CYTOKININ AND PARTICLE BOMBARDMENT ON IN VI TRO
GROWTH OF Phaseolus vulgaris SEEDLINGS
INTRODUCTION

Genetic transformation of plants has been used as an essential breeding tool to
successfully transfer novel genes for the purpose of improving such traits as biochemical
properties, quality, disease resistance, and yield in crops. One of the vital factors for the
success of genetic transformation as a breeding tool for crop improvement is a
reproducible and efﬁcient in vitro regeneration protocol in the species of interest (Hansen
and Wright, 1999; Birch, 1997) particularly for transformation methods that rely on shoot
regeneration from cell suspension or callus cultures.

Efﬁcient and reproducible tissue culture and transformation procedures are
presently available for a number of leguminous species. Successes in both vital aspects
have lead to the production of transgenic plants from soybean, pea, and tepary bean
(Donaldson et al., 2001; Shade etal., 1994; Dillen et al., 1997). Studies on in vitro culture
and transformation of dry beans (Phaseolus vulgaris L.) are still limited and only two
groups have successfully produced regeneration competent callus tissues (Mohamed et
al., 1993; Zambre et al., 1998).

Plant grth regulators (PGRs) are biologically active molecules naturally
produced by plants that inﬂuence such physiological processes as growth, differentiation
and development (Gaspar et al., 1996). PGRs are routinely used in the tissue culture of
plants for various purposes. Two of the major PGR groups used in plant tissue culture

media are auxins and cytokinins. Auxins inﬂuence such developmental processes as

59

apical dominance, abscission, root formation, and delay of leaf senescence and fruit
ripening (reviewed by Gaspar et al., 1996). In tissue culture, auxins are generally used for
root formation, induction of somatic embryos, and callus formation and grth
(Hangarter et al., 1980). The major auxins used in plant culture media include a-
naphthaleneacetic acid (NAA), indole-3-acetic acid (1AA), indole-3-butyric acid (IBA),
and 2,4-dichlorophenoxyacetic acid (2,4-D). In contrast, cytokinins are PGRs discovered
as early as the 19505 that inﬂuence aspects of plant grth and physiology such as seed
germination, apical dominance, and ﬂower and fruit development (Haberer and Keiber,
2002; Jameson, 2000). Cytokinins such as 6-benzylaminopurine (BAP), kinetin, zeatin
and 2-isopentenyl-adenine (2ip) may be supplemented in plant tissue culture media to
enhance shoot formation, inhibit root formation, promote cell division, and callus
initiation and grth (Werner et al., 2001).

In P. vulgaris, limited information exists on successful and efﬁcient tissue culture
protocols. Zambre et al. (1998) obtained regeneration competent callus from both P.
vulgaris and P. acutifolius from media supplemented with 0.1 mg/l of the cytokinin
thidiazuron and 0.05 mg/l IAA. Plant regeneration has also been achieved in P. vulgaris
cvs. Fonix and Maxidor on MS medium supplemented with 1 mg/l BAP and 0.1mg/L
NAA (Ahmed et al., 2002). Shoot production from particle bombarded mature bean
embryos was successfully achieved in MS medium supplemented with 44.3 M BAP
(Aragao et al., 1996). Successful shoot elongation was obtained in three Bulgarian dry
bean varieties on MS containing 22.2 uM BAP and 0.057 uM IAA, and plant recovery
was established on MS with 4.4 uM BAP and 0.58 uM GA3 (Veltcheva and Svetleva,

2005).

60

A limitation, however, to the adoption of the type and amount of plant growth
regulators stated in current literature that have shown success in tissue culture
experiments is irreproducibility. Concentrations of PGRs that have worked in previous
studies can produce variable results in other laboratories even under similar culture
conditions. Moreover, varietal differences in response to various culture conditions can
limit applicability and suitability of certain media formulations and grth hormone

concentrations in other laboratories.

Successful transformation system of dry beans has only been reported with the
particle bombardment process (Aragao et al., 1996, 1998, 2002). Using this procedure it
is now possible to transform shoot apical meristems of bean embryonic axes and produce
transgenic plants directly without requiring callus production and regeneration. However,
production of transgenic plants by particle bombardment still requires efﬁcient
transformation and in vitro plantlet production procedures. The production of dry bean
plantlets from bombarded meristems in plant transformation has been extremely
inefﬁcient due to the slow shoot production and failure of majority of the meristems to
grow and develop in the cytokinin levels reported by Aragao et a1. (1996). Therefore, the
evaluation of the effects of cytokinin on in vitro growth of bean embryos as well as the
determination of the optimum level of cytokinin for shoot production in dry bean
cultivars would greatly improve the efﬁciency of producing transgenic plants. Moreover,
analysis on possible injury effects of the transformation procedure and subsequent

reduction of shooting efﬁciency and shoot growth needs to be evaluated.

61

Objectives

This study speciﬁcally aimed to: a) evaluate the effect of various cytokinin levels
on the grth of dry bean embryos in vitro, b) compare differences in the grth of
meristems between three dry bean cultivars in vitro c) determine the optimum cytokinin
level for grth of meristems, and d) evaluate the effects of the particle bombardment

process on shoot production.

62

MATERIALS AND METHODS
Preparation and plating of meristems

Mature seeds of dry bean cvs. Matterhorn, Red Hawk and Olathe were surface
sterilized with 20% bleach for 15 min and soaked in sterile distilled water for 16-18 hrs at
22-28°C. The embryonic axes were then excised from the seeds, and the primary leaves
and radicles were removed to expose the apical meristem. The embryos were sterilized
with 2% bleach for 10 min and inserted on 9-cm Petri dishes containing MS medium
(bombardment media) with the apical region directed upward (Murashige and Skoog,
1962). After a week, the developing meristems were transferred to shooting media (MS +
varying levels of 6-benzylaminopurine, BAP) (Table 11). The shoots were cultured at
25°C with a l6-hr photoperiod. Plantlets were transferred to fresh shooting medium after

3 weeks in culture.

Shoot length measured from the base of the shoot to the shoot tip was taken
weekly starting from the week after transfer to the shooting medium with varying levels
of BAP. Measurements were taken until the second week aﬁer transfer. This parameter
allowed for the measurement of the increase in shoot length (ISL). The number of
plantlets produced as well as the number of weeks required in vitro culture from transfer
to shooting medium to size ready for transfer to the greenhouse (NWS) was determined.
Shoot lengths of above 3 cm with ample branching, and good leaf development were
among the visual criteria used to classify a plantlet as ready for transfer to planting

medium in the greenhouse. Plantlet production efﬁciency (PPE) was computed:

63

number of shoots produced
Plantlet Production Efﬁciency (PPE) = x 100

number of embryos plated

 

Bombardment of meristems

Transformation of Matterhorn, Red Hawk and Olathe meristems using particle
bombardment was done as described by Aragao et al. (1996) with the following
modiﬁcations: distance from rupture disk to macrocarrier — 1.5 cm; distance from
macrocarrier to stopping screen (BioRad, Munich, Germany) — 2 cm; distance from
stopping screen to the target —- 9 cm; vacuum in the chamber — 27 inches of Hg; and
rupture disc (BioRad, Munich, Germany) pressure levels 1100 psi to be amenable to the
PDS-100 Helium Particle Delivery System (Dupont, Wilmington, DE). The bombarded
shoots were kept in the bombardment medium (without cytokinin) for one week and
subsequently subcultured to MS supplemented with various levels of BAP (Table l). The
shoots were cultivated and measurements for shoot length, number of weeks in culture

and number of shoots produced were taken as previously described.
Statistical analysis

The number of weeks in shoot induction media (NWS), increase in shoot length

(ISL) and plantlet production efﬁciency (PPE) were analyzed using proc glm.

64

Table 10. Summary of experiments conducted and the media treatments used for each
experiment.

 

 

13:31:21; :nt Treatment name BAP (mg/l)
1 Control (M80) 0
MSI l
MS3 3
MSS 5
MSlO 10
MSlS 15
2 Control (MSO) 0
MSI 1
MS3 3
M85 5

 

 

 

65

RESULTS AND DISCUSSION

Aragao et al. (1996) successfully produced bean plantlets from bombarded Olathe
embryos within 3 weeks in culture using 44.3 uM (9.98 mg/l) BAP. However, in a
biolistic transformation experiment previously conducted, growth of embryos and later
shoots were greatly affected causing longer culture time, poor shoot and root growth and
even shoot death. So far, successﬁJl efforts to transformation dry beans have only been
achieved with the particle bombardment procedure (Aragao et al., 1996, 1998, 2002). An
efﬁcient and reproducible in vitro culture procedure for dry beans needs to be established
prior to efforts in transformation using the particle bombardment approach. Thus, a study
which looked at wider concentration ranges of BAP was performed. Three dry bean
genotypes each belonging to different market classes were selected. Matterhorn, a great
northern cultivar (Kelly et al., 1999), and Olathe, a pinto bean (Wood and Keenan, 1982),
are cultivars involved in a transformation study for enhanced white mold resistance while
Red Hawk is a red kidney bean cultivar (Kelly et al., 1998). Both Red Hawk and
Matterhorn are successﬁil high yielding cultivars in Michigan and would be suitable
genotypes for trait improvement using plant transformation. Olathe was included as it
was the bean cultivar successfully transformed by Aragao et al. (1998, 2002). The
selection of different dry bean market classes was designed to investigate possible

genotypic differences in performance of grth in vitro.

Experiment 1: Effect of Cytokinin on Shoot Production
Among the three dry bean cultivars, plantlets were recovered only from Olathe
and Red Hawk. No plantlets were produced from Matterhorn, as the majority of the

Matterhorn meristems plated in the control (no BAP) and 1 mg/l BAP were lost due to

66

bacterial contamination. The few remaining Matterhorn embryos on 3-15 mg/l BAP
treatment exhibited elongation of the shoot tip during the ﬁrst week of culture but the
shoot apices later turned brown and eventually died. Due to these problems, results from
Matterhorn were not considered in the statistical analyses.

One week after transfer to the shooting media with varying cytokinin
concentrations, increase in growth of shoots was signiﬁcantly affected by the BAP level
(p=0.009). The highest increase in shoot length of 0.75 cm was observed from the control
without BAP, however, this was not signiﬁcantly different from the increase observed in
the MS + l and 3 mg/l BAP which had mean shoot length increases of 0.65 cm and 0.52
cm, respectively (Figure 10). The lowest increase was noted in the shoots produced from
the treatments with 5, 10 and 15 mg/l BAP indicating that BAP levels of 5 mg/l or higher
can signiﬁcantly reduce the grth of dry bean shoots in vitro. The effect of genotype on
shoot grth during the ﬁrst week of culture was not signiﬁcant (p=0.4198) for the two
dry bean cultivars, Olathe and Red Hawk.

Two weeks after transfer to the shooting media, the increase in shoot length of the
plantlets produced was signiﬁcantly affected by BAP (p<0.0001). The highest increase in
shoot length was observed from plantlets grown in the control medium, with a mean ISL
of 2.33 cm (Figure 10). Plantlets from MS + 3 to 15 mg/l BAP have the least mean ISL of
0.71 cm to 0.76 cm, respectively. These results suggest that after two weeks of growth,
cytokinin levels of 3 mg/L BAP or higher have a negative effect on shoot grth
inhibiting grth compared to those grown on much lower BAP concentrations. The

signiﬁcant reduction in shoot grth at 3 mg/l BAP indicates that prolonged exposures of

67

embryos to levels of cytokinin as low as 3 mg/l can signiﬁcantly reduce grth of

plantlets in vitro.

   

 

 

 

 

 

 

 

2.5

2 * z
E
3 15
._1
Z.)

1 i —

b
b
0.5 a _a
0 L . _. . .
0 1 3 5 10 15

BAP concentration (mg/1)

l D week] . week2

Figure 10. Mean increase in shoot length (ISL) of dry bean plantlets as affected by BAP
concentration in the shooting media. Means followed by the same letter designation are
not signiﬁcantly different (a=0.05).

 

Statistical analyses shows that BAP concentration did not signiﬁcant affect PPE
in the three bean cultivars used (p=0.9252). However, A generally higher PPE (77%
mean efﬁciency) was observed from Red Hawk compared to Olathe (47% mean
efﬁciency) (p=0.0003). This observation suggests a better in vitro performance of Red
Hawk in terms of plantlet production as well as possible bombardment injury
susceptibility of Olathe embryos. In Red Hawk, highest shoot production efficiency

(93%) was obtained in shooting media with 1 mg/l BAP level with a decrease in

68

efﬁciency in treatments with 5 mg/l BAP or higher (Figure 11). In Olathe, highest shoot

efﬁciency was produced from 0 mg/l and 5 mg/l (60% and 62%). Reduced efﬁciencies in

Olathe at 1 and 3 mg/l BAP treatments could to be due to injuries imparted to the embryo

during handling.

100
90
80

70 '
60

PPE (%)

4o.
30;

20
10

Figure l 1.
levels.

50'

1
‘- *- Redhawk
l l+01athe '

 

0 1 3 5 10 1 5
BAP concentration (mg/L)

Plantlet production efﬁciency (PPE) in Olathe and Red Hawk in various BAP

Although high efﬁciencies of plantlet production were obtained at BAP levels of

5 mg/l for Olathe as well as in l and 3 mg/l for Red Hawk, the rate of growth of the

plantlets produced was considerably lower than the control plantlets. This suggests that

although the amendment of the MS with BAP can results in slight increase of plantlets

produced in vitro, BAP can lead to signiﬁcant reductions in the shoot growth.

69

General observations noted during the course of the experiment included better
root development from the plantlets produced at levels less than 3 mg/l BAP for Red
Hawk and less than 1 mg/l BAP for Olathe. In both genotypes superior root development
was consistently achieved by control plantlets (Figure 12b). Finally, shoots produced by
both bean genotypes grown in higher cytokinin levels (>3 mg/l) were stunted whereas
those in lower BAP levels appeared normal with better shoot growth and leaf
development (Figure 12a). Although more plantlets were obtained in certain treatments
containing BAP in both genotypes, the slow shoot growth, limited leaf development,
general stunting and poor root development of the plants led to more culture time and

possibly additional hardening problems upon transfer of the plants to the greenhouse.

 

IL
Figure 12. Growing Olathe plantlets. a, plantlets grown in 0 mg/L to 10 mg/L at three

weeks after transfer to the shooting media; b, comparison of root and shoot development
without BAP and in high BAP concentration (M85).

70

Experiment 2: Effect of cytokinin and bombardment on shoot production in three
dry bean genotypes

Based on the analysis of variance, number of weeks in the shooting media (NWS)
was signiﬁcantly affected by the growth media (p<0.0001). The least mean NWS (3.11
weeks) was obtained from embryos grown in the control medium followed by embryos
cultured on MS + 1 mg/l BAP (3.39 weeks). Embryos grown on media with 3 and 5 mg/l
BAP had the highest number of weeks (3.96 weeks) required for culture in shooting
media (Figure 13). These observations indicated that BAP levels used in this study
delayed shoot and leaf development by almost 2 weeks compared to embryos grown
without BAP. The delay in the in vitro culture requirement for plantlets grown in any
media with BAP were primarily due to slow and poor shoot growth in combination with
inferior leaf development as will be shown and discussed later.

Signiﬁcant differences in mean NWS were noted among the bombarded and non-
bombarded embryos from the three varieties (p=0.0018). Bombarded Matterhorn
embryos required signiﬁcantly fewer weeks than those which were not bombarded
(Figure 14). No difference was seen between bombarded and non-bombarded Red Hawk
embryos indicating that for this genotype, the bombardment process employed imparts
less injury effects on the growth of embryos and plantlet development to signiﬁcantly
affect the time required for in vitro culture and production of plantlets. Bombardment
appeared to have a signiﬁcantly negative effect on Olathe, causing non-bombarded
embryos to produce plantlets which were ready for transfer to the greenhouse as much as
one week earlier than those which were bombarded. The higher NWS in bombarded
Olathe embryos could possibly suggest the susceptibility of Olathe to injuries from the

bombardment procedure leading to a slightly longer culture time. Olathe is the bean

71

cultivar consistently used by Aragao et al. (1996, 1998, 2002). Although the particle
bombardment procedure can deliver DNA into any target cells and is not limited by
genotype, morphology of the apical meristem is a vital factor for successﬁJl
transformation of bean embryos through particle bombardment. Transgenic dry beans of
the Carioca type which have exposed shoot apices were obtained in a study by Aragao
and Rech (1997). The presence of leaf primordia partially covering the meristem apex
reduces the number of meristematic cells that can be reached by the microparticles.
Olathe is a cultivar similar to the Carioca cultivars in Brazil and the longer culture period
requirement for this cultivar could be due to excessive injuries to the exposed apical

meristems during bombardment.

 

 

 

b.)

 

NWS (weeks)

 

 

 

 

 

 

 

 

 

 

 

 

O 5

BAP concentration (m3g/l)

Figure 13. Mean number of weeks (NWS) required for culture in shooting media of three
dry beans cultivars as affected by BAP concentration. Means followed by the same letter
designation are not signiﬁcantly different (a=0.05).

72

 

ab

NWS (weeks)
5”
‘G.’

 

 

 

 

 

 

 

 

 

 

 

Matterhorn Olathe Redhawk

Cultivar

 

Eﬁﬁéembarécd I! Eagléfded:

Figure 14. Mean number of weeks (N WS) required for culture in shooting media by three
dry bean varieties as affected by bombardment. Means followed by the same letter
designation are not signiﬁcantly different (a=0.05).

The ISL after 1 and 2 weeks of growth in the shooting medium was signiﬁcantly
affected by BAP (p<0.0001; p<0.0001). A higher ISL was obtained by the control
compared to the other three media treatments that contained different levels of BAP
(Figure 15). The lowest ISL was obtained from the plantlets growing in MS + 5 mg/l
BAP and MS + 3 mg/l BAP during the ﬁrst and second weeks, respectively. These results
indicated that BAP levels in media of 1 mg/l and above can inhibit shoot growth in vitro.
Similar to the ﬁrst experiment, the highest ISL during the ﬁrst week in culture was noted
for the control, however, during that study signiﬁcant reduction in shoot growth was

observed only with BAP levels of 5 mg/l or higher. A slightly larger sample size for each

73

treatment was used in the second study which could account for the variable results
between the second and the ﬁrst experiment.

Individual effects of genotype were not signiﬁcant (p=0.3143). The three dry bean
cultivars used in this study each belong to different market classes, pinto, great northern
and kidney, suggesting that even among different dry bean market classes a possibly

similar in vitro culture response in terms of shoot growth of embryos may be observed.

 

 

     

 

 

 

 

 

0 l 3 5
BAP concentration (mg/l)

(Dyan. 7 1I_ week i .
Figure 15. Mean increase in shoot length (ISL) of dry bean as affected by BAP
concentration in the shooting media. Means followed by the same letter designation are
not signiﬁcantly different (a=0.05).

Statistical analyses shows that BAP concentration did not signiﬁcantly affect PPE
in the three bean cultivars used (p=0.0507). However, signiﬁcant differences in PPE were

notes among the cultivars (p=0.0004). Similar to the ﬁrst experiment, a generally higher

74

PPE was observed from Red Hawk compared to both Matterhorn and Olathe (Figure 16).
Particularly for Matterhorn, 48% reduced efﬁciency over Red Hawk can be noted. Better
in vitro performance of Red Hawk appeared consistent with the ﬁrst experiment where

Red Hawk had greater efﬁciencies over Olathe in the different media treatments.

 

 

PPE (%)
“a;

 

 

 

 

 

 

 

 

 

 

 

Matterhorn Olathe Redhawk

Cultivar

Figure 16. Plantlet production efﬁciency (PPE) of three dry bean cultivars in vitro.

Although plant regeneration and multiple shoot production have been achieved
using higher cytokinin concentrations (ZlOmg/l BAP) in beans and other leguminous
species, optimal levels involving lower BAP concentration (1 to 3 mg/l) have also been
reported. In the study by Sam (1983), a medium supplemented with 1 and 3 mg/l BAP
was found to be optimal for shoot multiplication in one pinto and three great northern
bean cultivars. Plant regeneration studies in dry beans have shown optimal induction of

multiple shoot formation using MS with 1 mg/l BAP and 0.1 mg/l NAA (Ahmed et al.,

75

2002). Avenido and Hattori (2000) have successfully regenerated the adzuki bean (Vigna
angularis) with R media (MS basal medium with B5 vitamins) amended with 4.4 uM (:1
mg/l) BAP. High frequency plant regeneration from soybean (Glycine max) hypocotyl
explants was achieved using 0.5mg/l NAA and 3 mg/l BAP (Tripathi and Tiwari, 2003).
These reports and results obtained from this study conﬁrm that lower BAP concentrations
are needed for in vitro culture of beans.

Saam (1983) also noted a sharp decrease in shoot production and internode
elongation as well as the development of rosette-like cultures and multiple bud formation
in grth media with a higher BAP concentration (above 10mg/l). In this study, the
majority of plantlets produced from the three BAP treatments were observed to have
reduced branching, rosette leaf formation and an overall stunting as suggested by the
signiﬁcantly lower ISL than the control (Figure 17). Also, the plantlets produced from
media BAP treatments seemed to have an inferior root system compared to the control
indicating that BAP levels used in the study may have severe effects on root
development. Root grth from these treatments was observed during the ﬁrst week
following transfer to the shooting media but additional root formation was no longer
observed. Plantlets from control clearly had better branching, leaf development and root
growth.

Auxin is a growth hormone that is used in tissue culture experiments mainly to
induce root development. Given the higher plantlet production efﬁciencies from the BAP
treatments in the initial study, use of cytokinin in combination with auxin for plantlet
production in dry beans can be evaluated. Root development was successfully achieved

using low concentrations of IAA (0.3mg/L) and NAA (0.6mg/L) (Saam, 1983).

76

Additional studies could look into the use of low auxin concentrations either alone or in
combination with cytokinin for root development.

In addition to inferior root formation in the cytokinin amended treatments (Figure
18c), enlargement of the shoot base was noticed in the majority of the Matterhorn and
Olathe plantlets. Callus formation at the shoot base was also observed in some Olathe and
Red Hawk plantlets (Figure 18 a and b). This suggests that the cytokinin levels used in
this study were sufﬁcient to promote callus growth and thus it would be interesting to
look at the regenerative capabilities of the calli produced.

For both Olathe and Matterhorn, high plantlet production efﬁciency can be
attained using MS medium without BAP. Moreover, MS alone resulted in faster shoot
elongation and shorter culture duration. In Red Hawk, where generally higher PPE was
noted compared to both Matterhorn and Olather, no considerable differences were noted
in PPE among the treatments. However, BAP concentration for this cultivar was found to
affect rate of shoot grth as well as time required for in vitro culture.

The better in vitro performance observed in Red Hawk in terms of efﬁcient
production of plantlets as well as better shoot and root development compared to
Matterhorn and Olathe suggests genotypic differences in performance among different
dry bean cultivars. Genotypic effect on in vitro performance has been reported in a
number of crops affecting such developmental processes as embryogenesis and plant
regeneration (Bailey et al., 1993; McKently, 1995). In addition, the physiological state of
the explant is also a vital factor for in vitro performance. Red Hawk belongs to the large-
seeded Andean bean gene pool (Evans, 1980). Seed size affects biomass accumulation of

bean cultivars, with larger seeds producing larger stern, root and leaf mass than smaller

77

seeded; thus providing larger seeded beans better grth early on in the season (Lima et
al., 2005). This in vivo performance advantage of large seeded beans in terms of growth
over small seeded cultivars could possibly explain the superior in vitro performance of
Red Hawk over the medium seeded Olathe and Matterhorn. Red Hawk embryos were
considerably larger than both Olathe and Matterhorn, possibly imparting more embryo
vigor and initiating faster initial growth. The increased dry matter production in large
seeded beans has also been linked to increased cell number and cell volume (Sexton et
al., 1997). The larger cell size in tissues of Andean beans including the kidneys may also
contribute to generally more vigorous plantlets possibly leading to the increased tolerance
to bombardment injuries than both medium seeded beans, Matterhorn and Olathe.

Based on the results from this study, future transformation work with dry beans
employing similar conditions for DNA delivery should consider targeting Red Hawk and
generating plantlets in MS without BAP. Moreover, due to relatively high efﬁciencies
obtained in Red Hawk and its apparent tolerance to injuries from bombardment, it is
necessary to evaluate the morphological structure of its apical meristem for suitability to

transformation using the particle bombardment approach.

78

~-?‘V!_

:4 ﬁt

Minus: C lell \ﬂUz;

 

Figure 17. Growing plantlets of Matterhorn, Olathe and Red Hawk after two weeks of
growth in shooting media. a, unbombarded Matterhorn, b) bombarded Matterhorn, c)
unbombarded Olathe, d) bombarded Olathe, e) unbombarded Red Hawk, 1) bombarded
Red Hawk.

79

 

Figure 18. Plantlets growing in vitro. a, callus formation at shoot base in Olathe; b, callus
formation at shoot base in Red Hawk; c, comparison of root formation of Red Hawk
plantlets grown in control and 5 mg/L treatments.

80

CONCLUSIONS

Based on the results of this study, the presence of BAP in the growth medium for
plantlet production from dry bean embryos caused an overall reduction in shoot growth, a
slight decrease in plantlet production efﬁciency, longer in vitro culture period
requirement prior to greenhouse transfer, and poor root development. Although, in the
initial study slightly higher plantlet production efﬁciencies were produced in media with
1 and 5 mg/L for Red Hawk and Olathe, respectively, these high efﬁciencies have greatly
compromised the rate of shoot grth and time requirements. Thus, our results indicate
that the optimum medium for growth of dry bean embryos is basal MS medium without
BAP.

No signiﬁcant differences in the performance of the cultivars were detected in the
two studies conducted. However, under speciﬁc media treatments and bombardment
procedures some differences were noted.

Due to the modiﬁcations made on the bombardment process in the transformation
experiment, it was imperative to look into possible injury effects. Results of the study,
however, conﬁrmed that the bombardment process does not impart injuries to the embryo
that can signiﬁcantly affect grth of bombarded embryos as well as efﬁciency of
generating plantlets although it resulted in a slightly reduced shoot grth and longer

culture time in vitro for Olathe.

81

APPENDICES

Table 1A. Mean lesion size from leaves of T2 plants and batch controls following oxalic
acid assay.

 

 

 

 

 

Genotype Average Lesion Area
Batch 1
D20M1-1 133.07
D20Ml-10 103.59
D20M1-2 89.73
D20M1-5 98.57
D20Ml-6 99.25
D20M1-9 84.41
D8M1-10 91.55
D8M1-2 99.46
D8Ml-6 75.71
D8M1-9 77.19
E13Ml-1 82.99
E13M1-10 96.18
E13M1-2 82.95
El3M1-3 107.93
El3M1-5 96.16
El3M1-8 93.77
El3M1-9 111.00
GlZMl-l 97.64
GlZMl-Z 95.17
GlZMl-3 98.02
G12Ml-4 98.72
G12Ml-6 85.26
GlZMl-7 98.43
G12M1-8 120.54
G12M1-9 80.90
H35M1—3 96.12
H35M1-4 88.05
H35Ml-5 91.57
H35M1-6 96.29
Matterhorn 1 19.59
Batch 2
D20M1-3 95.10
D20M1-4 84.58
D20M1-7 97.20
D20M1-8 96.31
D8M1-1 87.44

 

82

 

Table 1A (cont-d).

 

 

 

 

D8Ml-3 93.68
D8Ml-4 80.03
D8Ml-5 78.13
D8M1-7 90.87
D8Ml-8 85.15
E13Ml-7 100.73
G12M1-10 74.95
G12M1-5 84.12
H35Ml-1 84.84
H35Ml-2 83.38
H35Ml-7 106.45
H35M1-8 80.67
Matterhorn 86.02
Batch 3
G29Ml-l 84.75
G29M1-3 86.61
G29Ml-5 89.92
G29Ml-6 72.83
G29Ml-9 84.26
D9Ml-1 81.72
D9Ml-3 88.31
D9M1-5 75.88
D9Ml-7 84.69
D9Ml-9 87.04
G29Ml-2 94.74
GZ9M1-4 90.57
G29Ml-7 95.02
G29Ml-8 96.88
G29M 1 - 10 94.85
D9M1-2 90.91
D9M14 84.24
D9Ml-6 86.30
D9Ml-8 84.73
D9Ml-10 90.74
E13M2-10 76.33
E13M2-2 94.02
E13M2-3 77.96
El3M2-4 76.73
El3M2-9 84.60
El9Ml-7 75.65
El9Ml-5 74.30

 

83

 

Table 1A (cont-d).

 

 

El9M1-3
E 1 9M 1 -l
El3M2-5
E l 3M2-6
E l 3M2-7
E l 3M2-8
E l 3M2-9
E 1 9M] -8
E l9M1-6
E 1 9M 1 -4
E 19M 1-2
D7M3-10
D7M3-9
D7M3-8
D7M3-7
D7M3-6
D7M3-5
D7M3-4
D7M3-3
D7M3-2
D7M4-2
D7M3-l
D7M4-10
D7M4-9
D7M4-8
D7M4-7
D7M4-6
D7M4-5
D7M4-3
D7M4-l
D7M4-4
D2M l -l
D2M l -10
D9M2-10
D9M2-6
D9M2-4
D9M2-2
D9M2-l
D2M l -7
D2M 1-6
DZM l -8

 

73.62
87.71
87.69
87.71
88.05
81.47
93.98
98.53
1 12.12
72.83
103.63
79.48
66.53
61.98
69.45
85.87
81.00
71.37
55.35
70.27
93.30
72.14
79.18
78.00
89.20
79.90
75.48
67.06
59.33
102.28
82.70
69.09
66.29
71.25
67.69
62.76
61.26
51.92
77.66
70.68
69.53

 

84

 

Table 1A (cont-d).

 

 

 

 

 

 

 

D9M2-9 84.73
D2M1-2 64.24
D2Ml-9 59.22
D9M2-7 56.01
D9M2-5 73.43
D9M2-3 66.99
D2Ml-3 63.71
D2Ml-5 61.13
D2M1-4 71.40
Matterhorn 72.09
Batch 4
El3M2-1 74.06
Matterhorn 1 14.85
Batch 5
D9M2-8 95.55
Matterhorn 73.03
Batch 6
D5M1-9 96.35
D5M1-7 102.98
D5M1-10 96.82
D2301-9 101.09
D2301-3 94.66
D2301-10 87.78
D1M2-l 85.77
Matterhorn 1 19.25
Olathe 80.31
Batch 7
D10M1-l 89.51
D10M1-8 88.46
D1M2-10 95.80
D1M2-2 103.80
D1M2-3 119.40
D1M2-4 102.36
D1M2-5 87.88
D1M2-6 99.04
D1M2-7 106.24
D1M2-8 115.78
D1M2—9 92.14
D2301—6 100.46
D2301-7 79.90
D2301-1 110.32

 

85

 

Table 1A (cont-d).

 

 

 

D2301-2 1 1 1.46
D2301-8 43.14
D5M1-2 79.84
DSMl-3 86.61
D5M1-4 90.02
D5M1-5 89.60
D5Ml-6 84.46
D5M1-8 100.01
E1901-2 93.03
E1901-8 166.81
E1901-9 125.37
G2101-1 90.21
G2101-2 70.10
02101-4 51.67
G2101-5 95.17
G2101-7 65.79
G2101-10 93.45
G2101-8 98.57
G2101-9 116.44
G402-l 130.62
G402-2 115.80
G402-5 141.44
L18M2-2 112.61
L18M2-3 146.11
L18M2-5 104.39
L18M2-6 99.95
L18M2-8 123.49
L18M2-9 93.05
S4M1-1 95.61
S4M1-2 91.02
S4M1-3 94.19
S4Ml-S 128.12
S4Ml-7 101.18
S4M 1-9 123.59
Olathe 82.21
Olathe 87.12
Matterhorn 82.85
Matterhorn 77.62
Batch 8
D10Ml-10 87.63
D10Ml-2 76.67

 

 

86

 

Table 1A (cont-d).

 

 

 

 

D10M1-3 76.18
D10Ml-4 82.42
D10M1-5 78.78
D10Ml-6 73.96
D10M1-7 70.42
D10M1-9 81.53
D2301-5 84.12
El901-1 120.33
G101-3 103.36
G2101-3 125.92
G2101-6 84.54
G402-10 121.84
(3402-3 144.80
0402-4 106.51
G402-6 l 15.91
G402-8 103.72
G402-9 138.68
Ll8M2-l 113.11
L18M2-10 92.41
Ll 8M2-4 176.78
S4M1-10 178.27
S4M1.4 90.61
S4M1-6 119.10
S4Ml—8 98.32
Matterhorn 95.19
Olathe 116.16
Batch 9
El901-3 143.34
E1901-4 111.68
Olathe 1 10.72

 

87

 

Table 2A. Mean lesion size from leaves of T2 plants and batch controls following fungal
bioassay

 

 

 

 

 

Genotype Average Lesion Area
Batch 1
D20M1-1 408.50
DZOMl-IO 372.47
D20M1-2 401.32
D20M1-5 294.30
D20M1-7 445.37
D20M1-9 460.27
E13M1-1 430.91
E13M1-3 381.36
E13M1-7 366.23
E13M1-9 362.10
G12M1-1 433.15
G12M1-2 409.51
G12M1-3 412.98
G12M1—4 446.62
H35M1-3 360.32
Matterhorn 502.54
Batch 2
D20M1-3 490.35
D20M1-4 507.58
D20M1-8 602.95
D8M1-1 456.14
D8M1-10 498.67
D8M1-2 570.63
D8M1-3 487.30
D8M1-6 562.74
D8M1-7 545.76
D8M1-8 522.03
D8M1-9 512.02
El3M1-10 551.05
El3M1-2 574.36
E13M1-8 535.14
G12M1-5 580.41
G12M1-6 567.33
G12M1-7 591.02
G12M1-8 536.00
H35M1-2 539.26
H35Ml-4 524.95
H35M1-5 529.19

 

88

 

Table 2A (cont-d).

 

 

 

 

 

 

H35M1-6 538.80
H35M1-7 564.79
Matterhorn 580.54
Batch 3
D20M1-6 449.18
D8Ml-4 455.80
D8M1—5 464.54
G12M1-10 475.62
H35M1-1 493.73
H35Ml-8 400.83
Matterhorn 5 12.2 1
Matterhorn 485.50
Batch 4
D2Ml-l 414.23
D2Ml-5 432.33
D2M1-6 432.65
D7M3-7 422.97
D9M1-1 499.32
D9M1-5 434.26
D9M1-6 442.40
D9M1-9 496.27
D9M2-3 457.77
El3M2-2 419.80
E13M2-3 416.92
E13M2-7 457.86
E13M2-9 456.99
G29M1-6 452.23
Matterhorn 533.48
Batch 5
D2Ml-10 479.09
D2M1-2 403.42
D2M1-3 504.51
D2M1-4 453.6
D2M1-7 482.9
D2M1-8 485.99
D2Ml-9 492.95
D7M3-l 477.75
D7M3-10 492.19
D7M3-4 482.66
D7M3-5 458.81

 

89

 

Table 2A (cont-d).

 

 

D7M3—6
D7M3-8
D7M3-9
D7M4-l
D7M4-10
D7M4-2
D7M4-3
D7M4-5
D7M4-6
D7M4-7
D7M4-8
D7M4-9
D9M l -10
D9M1-2
D9M 1-3
D9Ml-4
D9M1-7
D9Ml-8
D9M2-l
D9M2-10
D9M2-2
D9M2-5
D9M2-6
D9M2-7
D9M2-9
E 13M2- 10
E13M2-4
E13M2-5
E l 3M2-6
E l 3M2-8
E 19M l-l
E19M 1-2
B 19M 1 -3
E 19M] -4
E 19M 1 -5
E19M 1 -6
E19M 1 -7
E19M 1 -8
E 1 9M 1 -9
GZ9M1-l

 

513.55
560.62
500.72
514.77
512.1 1
489.99
525.17
457.75
548.92
518.39
490.2
528.62
465.62
565.23
494.22
610.83
442.15
525.42
431.25
503.41
475.06
431.14
527.79
524.49
561.59
533.70
520.64
484.04
431.82
476.74
465.88
482.98
494.69
460.99
507.81
468.88
482.92
480.44
482.43
495.72

 

90

 

Table 2A (cont-d).

 

 

 

 

G29M1-10 493.20
G29M1- 2 481.33
G29M1-3 458.70
G29M1-4 455.38
G29M1-5 477.33
G29M1-7 482.1 1
G29M1-8 440.44
G29M1-9 440.14
Matterhorn 461 .56
Matterhorn 535.26
Batch 6
E13M2-1 396.58
D7M4-4 440.99
D7M3-2 359.73
D7M3-3 302.39
D9M2-4 400.07
D9M2-8 378.59
Matterhorn 474.70
Batch 7
D10Ml-l 428.12
D1M2-l 458.85
D1M2—2 487.02
D1M2-3 450.24
DlM2-4 509.48
D1M2-5 466.11
DlM2-6 469.35 '
DlM2-8 509.78
D1M2-9 403.08
D2301-3 459.25
D2301-10 538.16
D2301-5 553.15
D2301-6 496.02
D2301-8 413.77
DSMl-l 362.08
D5M1-10 475.59
D5M1-3 387.67
D5M1-6 425.01
D5M1-7 422.34
D5M1-8 524.38
D5M1-9 422.87

 

 

91

 

Table 2A (cont-d).

 

 

 

 

G2101-5 433.58
G2101-7 441.58
(3402-2 589.41
G402-5 522.50
S4M1-1 469.90
Olathe 617.20
Matterhorn 366.27
Matterhorn 474.56
Batch 8
D10M1-10 352.93
D10M1-2 396.39
D10M1-3 359.62
D10M1-4 393.11
D10M1-5 370.48
D10M1-6 396.45
D10M1-8 404.28
D10Ml-9 383.14
D1M2-10 466.09
D2301-1 481.90
D2301-2 417.26
D5M1-2 464.80
D5M1-4 372.70
DSMl-S 414.36
E1901-8 466.89
E1901-9 538.99
G2101-8 552.28
G2101-1 478.37
G2101-10 396.41
G2101-2 466.98
G2101-3 529.89
02101-4 581.00
G2101-9 484.89
G402-1 610.32
G402—3 610.74
G402-8 489.73
Ll8M2-2 471.72
L l 8M2-3 424.03
L18M2-5 412.62
L18M2-6 420.67

 

92

 

Table 2A (cont-d).

 

 

 

L18M2-8 440.94
L18M2-9 441.88
S4M1-2 442.49
S4M1-3 425.30
S4M 1-5 389.19
S4M1-7 401.83
S4M1-9 373.89
Matterhorn 429.07
Matterhorn 462.8 1
Olathe 576.09
Batch 9
D10M1-7 388.92
E1901-2 517.69
G 101-3 382.31
G2101-6 385.34
G402-10 521.42
G402-6 588.39
G402-7 485.25
L18M2-1 470.77
L18M2-10 482.41
L18M2-4 450.41
S4M1-10 466.53
S4M1-4 479.04
S4M1-8 463.85
S4M1-6 446.93
Matterhorn 507.77
Olathe 655.17
Olathe 516.74

 

 

93

 

Table 3A. Average H202 production in T2 plants and experimental batch control as
assessed by the Amplex Red Fluorescence Assay.

 

 

 

 

 

1D Average H202 concentration
30 min 1 hour
Batch 1
H35M1-1 0.35 0.47
H35M1-2 0.45 0.64
H35M1-3 0.38 0.53
H35M1-4 0.36 0.52
H35M1-5 0.39 0.57
H35M1-6 0.44 0.68
H35M1-7 0.37 0.54
H35M1-8 0.42 0.62
E13M1-1 0.34 0.45
E13M1-2 0.32 0.44
E13M1-3 0.33 0.45
El3M1-4 0.36 0.53
E13M1-5 0.37 0.52
E13M1-7 0.36 0.52
E13M1-8 0.34 0.46
E13M1-9 0.35 0.49
E13M1-10 0.31 0.46
D8Ml-1 0.37 0.50
D8M1-2 0.37 0.55
D8M1-3 0.38 0.52
D8M1-4 0.37 0.52
D8M1-5 0.42 0.57
D8M1-6 0.36 0.51
D8M1-7 0.36 0.53
D8M1-8 0.39 0.56
D8M1-9 0.45 0.66
D8M1-10 0.45 0.60
D20M1-1 0.44 0.54
DZOMl-Z 0.50 0.64
D20M1-3 0.45 0.60
D20M1-4 0.47 0.63
DZOMl-S 0.51 0.67
D20M1-6 0.49 0.64
D20M1-7 0.43 0.58
D20M 1-8 0.48 0.64
D20M1-9 0.49 0.67

 

 

 

94

Table 3A (cont-d).

 

 

 

 

 

DZOMl-IO 0.47 0.62
G12M1-1 0.48 0.66
Gl2M1-2 0.80 1.06
G 12M 1 -3 0.76 0.92
G 12M1-4 0.47 0.64
G12Ml-5 0.54 0.79
G12M1-6 0.54 0.76
G 12M1-7 0.34 0.50
G12M1-8 0.50 0.64
G12M1-9 0.46 0.61
G12M1-10 0.51 0.75
Matterhorn 0.3 1 0.43
Batch 2
El9Ml-l 0.57 0.50
E 19M 1-2 0.60 0.59
E19M1-3 0.57 0.52
E19M1-4 0.54 0.48
E19M1-5 0.56 0.48
E19M1-6 0.53 0.45
E19M1-7 0.59 0.56
E19M1-8 0.52 0.45
E19M1-9 0.55 0.49
E13M2-1 0.57 0.48
E13M2-2 0.53 0.49
E13M2-3 0.53 0.36
E13M2-4 0.52 0.46
E13M2-5 0.50 0.41
E13M2-6 0.57 0.53
E13M2-7 0.47 0.37
E13M2-8 0.57 0.56
E13M2-9 0.49 0.43
E13M2-10 0.55 0.52
D9M1-1 0.45 0.31
D9M1-2 0.53 0.45
D9M1-3 0.52 0.47
D9Ml-4 0.50 0.37
D9M1-5 0.46 0.32
D9M1-6 0.57 0.47
D9Ml-7 0.52 0.43
D8M1-8 0.49 0.51

 

95

 

Table 3A (cont-d).

 

 

 

 

 

 

Matterhorn 0.53 0.41
Batch 3
D8M1-9 0.30 0.36
D8M1-10 0.34 0.39
G29M1-1 0.42 0.60
G29M1-2 0.42 0.55
G29M1-3 0.34 0.37
G29Ml-4 0.36 0.39
G29Ml-5 0.28 0.28
GZ9M1-6 0.35 0.50
G29M1-7 0.34 0.33
G29M1-8 0.26 0.31
G29M1-9 0.31 0.35
G29M 1-10 0.28 0.36
D7M4-1 0.33 0.35
D7M4-2 0.29 0.33
D7M4-3 0.27 0.35
D7M4-4 0.34 0.45
D7M4-5 0.34 0.41
D7M4-6 0.34 0.41
D7M4-7 0.27 0.35
D7M4-8 0.25 0.31
D7M4-9 0.32 0.42
D7M4-10 0.27 0.31
D7M3-1 0.18 0.27
D7M3-2 0.30 0.45
D7M3-3 0.28 0.36
D7M3-4 0.23 0.28
Matterhorn 0.28 0.36
Batch 4
D7M3-5 0.55 0.72
D7M3-6 0.47 0.64
D7M3-7 0.57 0.77
D7M3-8 0.32 0.61
D7M3-9 0.39 0.45
D7M3-10 0.49 0.64
D2M1-1 0.50 0.67
D2M1-2 0.36 0.44
D2M1-3 0.36 0.54
D2M1-4 0.47 0.67
D2M1-5 0.55 0.75

 

96

 

Table 3A (cont-d).

 

 

 

 

 

D2M1-6 0.47 0.70
D2M1-7 0.37 0.45
D2M1-8 0.49 0.64
D2Ml-9 0.62 0.85
D2M1-10 0.45 0.61
D9M2-l 0.39 0.56
D9M2-2 0.49 0.62
D9M2-3 0.60 0.72
D9M2-4 0.47 0.67
D9M2-5 0.34 0.46
D9M2-6 0.43 0.59
D9M2—7 0.60 0.79
D9M2-8 0.45 0.63
D9M2-9 0.35 0.46
D9M2-10 0.47 0.65
Matterhorn 0.40 0.49
Batch 5
G2101—1 0.98 1.23
G2101-2 0.94 1.18
02101-3 1.09 1.33
G2101-4 1.01 1.22
G2101-5 0.97 1.27
G2101-6 1.06 1.37
G2101-7 1.07 1.38
G2101-8 1.05 1.41
G2101—9 0.91 1.08
G2101-10 0.99 1.28
E1901-1 1.07 1.38
E1901-2 1.07 1.45
E1901-3 1.02 1.32
El901-4 0.98 1.24
E1901-8 1.06 1.41
E1901-9 1.06 1.46
0402-1 0.94 1.18
G402-2 0.99 1.27
G402-3 0.97 1.29
0402-4 1.05 1.40
G402-5 1.03 1.32
G402-6 1.11 1.51
G402-8 1.33 1.87
G402-9 1.19 1.54

 

97

 

Table 3A (cont-d).

 

 

 

 

 

 

G402-10 1.13 1.47
G101-3 1.07 1.40
Matterhorn 1 .34 1.86
Olathe 1.03 1.38
Batch 6
D2301-1 0.76 1.20
D2301-2 0.81 1.47
D2301-3 0.84 1.44
D2301-5 0.94 1.76
D2301-6 0.75 1.24
D2301-7 0.95 2.00
D2301-8 0.83 1.70
D2301-9 0.94 1.78
D2301-10 0.76 1.26
L18M2-1 0.98 2.00
L18M2-2 0.92 1.90
L18M2-3 0.86 1.51
L18M2-4 0.89 1.62
L18M2-5 1.10 2.13
L18M2-6 0.99 1.89
L18M2-8 0.88 1.52
L18M2-9 0.83 1.48
L18M2-10 1.11 2.15
S4M1-1 0.95 1.68
S4M1-2 0.83 1.30
S4M1-3 0.81 1.40
S4M1-4 0.86 1.73
S4M1-5 0.87 1.60
S4M1-6 0.82 1.29
S4M1-7 0.80 1.28
Olathe 0.79 1.33
Matterhorn 0.84 1 .72
Batch 7
S4M1-8 0.91 1.30
S4M 1 -9 0.78 1.15
S4Ml-10 0.77 1.09
D1 M2-1 0.85 1.24
D1M2-2 0.89 1.27
D1M2-3 0.86 1.20
DlM2-4 0.87 1.28
D1M2-5 0.85 1.19

 

98

 

Table 3A (cont-d).

 

 

 

 

 

D l M2-6 0.79 1.09
DlM2-7 0.81 1.18
D l M2-8 0.84 1.19
D1M2-9 0.88 1.25
D1M2-10 0.83 1.16
D5M1-5 0.98 1.43
D5Ml-2 0.85 1.18
D5M1-3 0.84 1.32
D5M1-4 0.79 1.07
D5Ml-6 0.80 1.20
D5M1-7 0.87 1.26
D5M1-8 0.99 1.46
D5M1-9 0.94 1.34
D5M1-10 0.95 1.40
Matterhorn 0.80 l .09
Batch 8
D10M1-1 0.69 0.93
D10M1-2 0.70 1.00
D10M1-3 0.79 1.16
D10M1-4 0.75 1.07
D10M1-5 0.73 1.01
D10M1-6 0.69 0.99
D10M1—7 0.70 0.97
D10M1-8 0.66 0.90
D10M1- 9 0.70 0.95
D10M1-10 0.68 0.92
Matterhorn 0.64 0.87
Olathe 0.72 0.92

 

 

Table 4A. Lesion size in T2 plants included in T3 oxalic acid and fungal bioassays.

 

Oxalic acid assay

Fungal bioassay

 

 

 

 

 

T210181" ID Average lesion %reduction from Average lesion %reduction from
area (mmz) batch control area (mmz) batch control
D9M2-l 51.92 54.79 431.25 6.57
D20M-5 98.57 17.58 294.30 35.99
D2301-8 43.14 50.49 413.77 19.49

 

 

 

99

 

Table 5A. Average lesion size from leaves of T3 plants and experimental batch controls
following oxalic acid assay.

 

 

 

 

 

 

Genotype Average Lesion Area
Batch 1
D20M15-6 84.42
D9M21-6 70.21
D2M15-3 62.20
E13M21-8 74.28
E13M21-4 64.00
E13M13-5 103.12
E13M13-3 78.02
D23018-4 104.49
MATTERHORN 77.70
OLATHE 90.40
Batch 2
D23015-7 82.83
D20M15-1 50.96
D20M15-8 86.79
E13M21-3 73.50
D20M15-7 81.13
E13M21-5 95.08
D20M15-3 62.90
E13M21-2 89.70
D20M15-2 76.98
E13M21-1 99.66
E13M13-7 73.88
E13M13~6 94.53
E13M13-2 112.13
MATTERHORN 103.63
OLATHE 103.88
Batch 3
E13M21-6 85.54
D9M21-8 74.16
E13M13-8 64.32
D2M15-5 89.91
D9M21-1 84.31
023015-2 103.07
E13M13-1 98.41
D23018-6 143-38
MATTERHORN 105.1 1
OLATHE 1 18.70

 

 

Table 5A (cont-d).

 

 

 

 

 

 

Batch 4
D20M15-4 64.28
D2M15-4 59.28
D20M15-5 88.02
D23018-7 95.95
D9M21-3 62.41
D9M21-5 80.05
D9M21-2 81.37
D23018-8 102.86
MATTERHORN 75.93
OLATHE 93.29

Batch 5
D23015-8 81.73
DZ3018-2 78.63
E13Ml3-4 71.44
D9M21-4 104.88
D2M15-8 75.73
MATTERHORN 90.74
OLATHE 96.35

Batch 6
E13M21-7 74.71
D23015-4 92.94
MATTERHORN 77.15
OLATHE 120.20

 

101

 

Table 6A. Average lesion size from leaves of T3 plants and experimental batch controls

following fungal bioassays.

 

 

 

 

 

 

 

Genotype Average Lesion Area
Batch 1
D9M21-6 260.03
E13M21-4 304.99
E13M13-3 269.52
D2M15-3 272.52
E13M21-8 258.87
D2M15-5 279.76
MATTERHORN 330.90
Batch 2
E13M21-2 477.01
D20M15-1 428.77
D20M15-8 406.51
E13M13-6 265.41
E13M21-3 292.57
E13M21-1 292.08
E13M13-2 334.14
E13M13-5 358.42
D20M15-6 344.38
D23018-4 444.31
D23015-7 334.29
D20M15-4 350.24
MATTERHORN 352.70
OLATHE 446.87
Batch 3
E13M21-6 357.59
E13M21-5 342.86
E13M13-7 358.46
E13M13-8 352.17
D20M15-2 411.44
D9M21-1 210.54
D20M15-3 254.19
D9M21-8 195.60
E13M13-1 219.03
MATTERHORN 31 1.51
OLATHE 430.68
Batch 4
D9M21-3 329.33
D20M15-5 346.69

 

102

 

Table 6A (cont-d).

 

 

 

 

 

 

D2M15-4 323.41
D23018-7 389.49
D9M21-5 352.57
MATTERHORN 418.57
OLATHE 506.45
Batch 5
023015-4 443.61
D9M21-2 437.24
MATTERHORN 316.55
OLATHE 513.82
Batch 6
D23018-2 424.84
D9M21-4 361.48
D23018-8 430.97
D23015-2 348.59
E13M13-4 399.29
D20M15-7 329.31
MATTERHORN 349.63
OLATHE 541.12
Batch 7
D23018-6 516.51
D2M15-8 413.26
D23015-8 437.98
E13M21-7 312.19
MATTERHORN 424.58
OLATHE 512.23

 

103

 

REFERENCES

Abawi, G. S. and J. E. Hunter. 1979. White Mold of Beans. New York’s Food and Life
Sciences Bulletin. No. 77

Abawi, G. S., R. Provvidenti, D. C. Crosier, and J. E. Hunter. 1978. Inheritance of
resistance to white mold disease in Phaseolus cocaineus. Heredity. 692200-202

Abdullah, R., E. C. Cocking, and J. A. Thompson. 1986. Efﬁcient plant regeneration
from rice protoplasts through somatic embryogenesis. Bio/Technology
421087-1090

Ahmed, E. E. G. Y. D. Bisztray, and I. Velich. 2002. Plant regeneration from seedling
explants of common bean (Phaseolus vulgaris L.). Proceedings of the 7
Hungarian Congress on Plant Physiology. 46(3-4)27-28

Allavena, A and G. Bemacchia. 1991. Attempting genetic transformation of bean by high
velocity microprojectiles. Annual Report of the Bean Improvement Cooperative.
34: 137-138

Allison, R. F. personal communication

Alvarez, ME. and C. Lamb. 1997. Oxidative burst-mediated defense responses in plant
disease resistance. In: Scandalios JG (ed.), Oxidative Stress and the Molecular
Biology of Antioxidant Defenses. Cold Spring Harbor Laboratory, Plainview,
NY. 815-839

Anderson, J. W., B. M. Smith, and C. S. Washnock. 1999. Cardiovascular and renal
beneﬁts of dry bean and soybean intake. American Journal of Clinical Nutrition.
70(3):464S-474

Anzai H., K. Yoneyama, I. Yamaguchi. 1989. Transgenic tobacco resistant to a bacterial
disease by the detoxiﬁcation of a pathogenic toxin. Molecular and General
Genetics 219: 492-494

Aragao F. J. L. and Rech EL. 1997. Morphological factors inﬂuencing recovery of
transgenic bean plants (Phaseolus vulgaris L.) of a carioca cultivar. International

Journal of Plant Science. 158: 157-163

Aragao, F. J. L. 2002. Development of transformation methods towards producing
transgenic plants with abiotic stress tolerance. JIRCAS Working Report. 35-42

Aragao, F. J. L., L. M. G. Barros, A. C. M. Brasileiro, D. P. Maxwell, J. C. Faria and E.
L. Rech. 1996. Inheritance of foreign genes in transgenic bean (Phaseolus

104

vulgaris L.) cotransformed via particle bombardment. Theoretical and Applied
Genetics. 93: 142-150

Aragao, F. J. L., S. G. Ribeiro, L. M. G. Barros, A. C. M. Brasileiro, D. P. Maxwell, E. L.
Rech and J. C. Faria. 1998. Transgenic bean (Phaseolus vulgaris L.) engineered
to express viral antisense RNAs showed delayed and attenuated symptoms to
bean golden mosaic virus. Molecular Breeding. 4:491-499

Aragao, F. J. L., L. M. G. Barros, M. V. de Sousa, M. F. Grossi de Sé, E. R. P. Almeida,
E. S. Gander and E. L. Rech. 1999. Expression of a methionine-rich storage
albumin from the Brazil nut (Bertholletia excelsa H.B.K., Lecythidaceae) in
transgenic bean plants (Phaseolus vulgaris L., F abaceae). Genetics and Molecular
Biology. 22(3):445-449

Aragao, F. J. L., G. R. Vianna, M. M. C. Albino, and E. L. Rech. 2002. Transgenic dry
bean tolerant to the herbicide glufosinate ammonium. Crop Science. 4211298-
1302

Avenido, R. A. and K. Hattori. 2000. Benzyladenine-induced adventitious shoot
regeneration form hypocotyls of adzuki bean (Vigna angularis {Willd.} Ohwi &
Ohashi). Plant Growth Regulation. 31 :147-153

Bailey, M. A., H. R. Boerma, and W. A. Parrott. 1993. Genotype effects on proliferative
embryogenesis and plant regeneration of soybean. In Vitro Cellular and
Developmental Biology. 29: 102-108

Bateman, D. F. and S. V. Beer. 1965. Simultaneous production and synergistic action of
oxalic acid and polygalacturonase during pathogenesis by Sclerotiorum roljfs‘ii.
Phytopathology. 55:204-21 1

Bateman, D. F. and R. L. Millar. 1966. Pectic enzymes in tissue degradation. Annual
Review of Phytopathology. 4: 1 19-146

Bau, H. J., Y. H. Cheng, T. A. Yu, J. S. Yang, S. D. and Yeh. 2003. Broad spectrum
resistance to different geographic strains of papaya ringspot virus in coat protein
gene transgenic papaya. Phytopathology 932112-120

Bennink, M. R. 2002. Consumption of black beans and navy beans (Phaseolus vulgaris)
reduced azoxymethane-induced colon cancer in rats. Nutrition and Cancer.
44(1):60-65

Bennink, M. R. 2005. Eat beans for good health. Annual Report of the Bean
Improvement Cooperative. 1-4

105

Berna, A. and F. Bemier. 1999. Regulation by biotic and abiotic stress of wheat germin
gene encoding oxalate oxidase, a H202-producing enzyme. Plant Molecular
Biology. 39(3):539-549

Binns. A. N., and M. F. Thomashow. 1988. Cell Biology of Agorbacterium infection and
transformation of plants. Annual Review of Microbiology. 42:575-606

Birch, R. G. 1997. Plant transformation: problems and strategies for practical
applications. Annual Review of Plant Physiology and Plant Molecular Biology.
48:297-326

Bolton, M. D., B. P. H. J. Thoma, and B. D. Nelson. 2006. Sclerotinia sclerotiorum (Lib.)
de Bary: biology and molecular traits of a cosmopolitan pathogen. Molecular
Plant Pathology. 7(1): 1-16

Bolwell, G. P., L. V. Bindschedler, K. A. Blee, V. S. Butt, D. R. Davies, S. L. Gardner,
C. Gerrish and F. Minibayeva. 2002. The apoplastic oxidative burst in response to
biotic stress in plants: a three-component system. Journal of Experimental Botany.
53(372):1367-1376

Bolwell, G. P., and P. Wojtaszek. 1997. Mechanisms for the generation of reactive
oxygen species in plant defence-a broad perspective. Physiological and Molecular
Plant Pathology. 15(6):347-366

Broughton, W. J., G. Hernandez, M. Blair, S. Beebe, P. Gepts, and J. Vanderleyden.
2003. Bean (Phaseolus spp.) —- model food legumes. Plant and Soil 252(1):55-128

Cessna, S. G., V.E. Sears, M. B. Dickman, and P. S. Low. 2000. Oxalic acid, a
pathogenecity factor for Sclerotinia sclerotiorum, suppresses the oxaditive burst
of the host plant. Plant Cell. 12:2191-2199

Chen Z., H. Silva and D. F. Klessig. 1993. Active oxygen species in the induction of
plant systemic acquired resistance by salicylic acid. Science 262: 1883—1886

Christou, P. 1992. Genetic transformation of crop plants using microprojectile
bombardment. The Plant Journal. 2(3):275-281

Chowrira, G. M., V. Akella, and P. F. Lurquin. 1995. Electroporation mediated gene
transfer into intact nodal meristems in planta. Molecular Biotechnology. 3: 17-23

Chowrira, G. M., V. Akella, P. E. Fuerst, and P. F. Lurquin. 1996. Transgenic grain
legumes obtained by in planta electroporation-mediated gene transfer. Molecular.
Biotechnology. 3:17-23

Coyne, D. P. 1980. Modiﬁcation of plant architecture and crop yield by breeding.
Horticultural Science. 15:244-247

106

Coyne, D. P., J. R. Steadman, and F. N. Anderson. 1974. Effect of modiﬁed plant
architecture of great northern dry bean varieties (Phaseolus vulgaris) on white
mold severity and components of yield. Plant Disease Reporter. 581379—382

Cuozzo, M., K. M. O'Connell, W. Kaniewski, R. Fang, N. Chua and N. E. Turner. 1988.
Viral protection in transgenic tobacco plants expressing the cucumber mosaic
virus coat protein or its antisense RNA. Bio/Technology. 6:549-557

Damm, B., R. Schmidt and L. Willmitzer. 1989. Efﬁcient transformation of Arabidopsis
thaliana using direct gene transfer to protoplasts. Molecular Genetics and
Genomics. 217(1): 6-12

De Clercq, J., M. Zambre, M. Van Montagu, W. Dillen, and G. Angenon. 2002. An
optimized Agrobacterium-mediated transformation procedure for Phaseolus
acutifolius A. Gray. Plant Cell Reports. 21(4):333-340

De la Fuente-Martinez J.M., G. Mosqueda-Cano, A. Alvarez-Morales, and L. Herrera-
Estrella. 1992. Expression of a bacterial phaseolotoxin resistant omithyl
transcarbamylase in transgenic tobacco confers resistance to Pseudomonas
syringae pv. phaseolicola. Biotechnology 10: 905-909

Dillen, W., J. DeClerq, A. Goossens, M. Van Montagu, and G. Angenon. 1997.
A grobacterium-mediated transformation of Phaseolus acutzfolius A. Gray.
Theoretical and Applied Genetics. 94: 151-158

Donaldson, P. A., T. Anderson, B. G. Lane, A. L. Davidson and D. H. Simmonds. 2001.
Soybean plants expressing an active oligomeric oxalate oxidase from the wheat
gf-2.8 (germin) gene are resistant to the oxalate-secreting pathogen Sclerotinia
sclerotiorum. Physiological and Molecular Plant Pathology. 59:297-307

Dumas, B., A. Sailland, J. P. Cheviet, G. Freyssinet and K. E. Pallett. 1993. Identiﬁcation
of barley oxalate oxidase as a germin-like protein. C. R. Academy Science Paris,
de la vie/Life Science. 316:793-798

Ender, M. and J. D. Kelly. 2005. Identiﬁcation of QTL associated with white mold
resistance in common bean. Crop Science. 45:2482-2490

Evans, A. M. 1980. Structure, variation, evolution, and classiﬁcation in Phaseolus. p.37—
347. In R.J. Summerﬁeld and AH. Bunting (ed.) Advances in legume science.
Royal Botanic Gardens, Kew, UK.

FAO. 2004. FAOSTAT Database. Url: http://faostat.fao.org/

107

Franklin CI, T. N. Trieu, R. A. Gonzales, R. A. Dixon. 1991. Plant regeneration from
seedling explants of green bean (Phaseolus vulgaris L.) via organogenesis. Plant
Cell Tissue and Organ Culture. 24: 199—206

Fuller, P. A., J. R. Steadman and D. P. Coyne. 1984. Enhancement of white mold
avoidance and yield in dry beans by canOpy elevation. Horticultural Science.
19(1):78

Gaspar, T., C. Kevers, C. Penel, H. Greppin, D. M. Reid, T. A. and Thorpe. 1996. Plant
hormones and plant grth regulators in plant tissue culture. In Vitro Cellular and
Developmental Biology. 32:272—289.

Geil, P. B. and J. W. Anderson. 1994. Nutrition and health implications of dry beans: 3
review. Journal of the American College of Nutrition. 13(6):549-558

Gelvin, S. B. 2000. Agrobacterium and plant genes involved in T-DNA transfer and
integration. Annual Review of Plant Physiology and Plant Molecular Biology.
512223—256

Godoy, G., J. R. Steadman, M. B. Dickman, and R. Dam. 1990. Use of mutants to
demonstrate the role of oxalic acid in the pathogenecity of Sclerotinia
sclerotiorum on Phaseolus vulgaris. Physiological and Molecular Plant
Pathology. 372179-191

Gonsalves, D., and J. L. Slightom. 1993. Coat protein-mediated protection: Analysis of
transgenic plants for resistance in a variety of crops. Seminars in Virology.
4(6):397-405

Gould, J., M. Devey, 0. Hasegawa, E. C. Ulian, G. Peterson and R. H. Smith. 1991.
Transformation of Zea mays L. using Agrobacterium tumefaciens and the shoot
apex. Plant Physiology. 95(2):426-434

Grison, R., B. Grezes-Besset, M. Schneider, N. Lucante, L. Olsen, J.J. Leguay and A.
Toppan. 1996. Field tolerance of fungal pathogens of Brassica napus
constitutively expressing a chimeric chitinase gene. Nature Biotechnology.
14:643-646

Grzelczak, Z. F. and B. G. Lane. 1984. Signal resistance of a soluble protein to enzymatic
proteolysis. An unorthodox approach to the isolation and puriﬁcation of germin, a
rare growth-related protein. Canadian Journal of Biochemistry and Cell Biology.
62:1351-1353

Guimaraes, R. L. and H. U. Stotz. 2004. Oxalate production by Sclerotinia sclerotiorum
deregulates guard cells during infection. Plant Physiology. 136:3703-3711

108

James, C. 2005. Global status of commercialized Biotech/GM crops: 2005. ISAAA.
Briefs No. 34-2005, ISAAA, Ithaca, NY, USA

Jameson. P. E. 2000. Cytokinins and auxins in plant-pathogen interactions-an overview.
Plant Growth Regulation. 32(2-3):369-380

Haberer G., and J. J. Keiber. 2002. Cytokinins: new insights into a classic phytohorrnone.
Plant Physiology 128: 354—362

Hangen, L. A., and M. R. Bennink. 2003. Consumption of black beans and navy beans
(Phaseolus vulgaris) reduced axozymethane-induced colon cancer in rats.
Nutrition and Cancer 44:60-65

Hangarter R. P., M. D. Peterson, and N. E. Good. 1980. Biological activities of
indoleacetylamino acids and their use as auxins in tissue culture. Plant
Physiology. 65:761—67

Hansen, G., and M. S. Wright. 1999. Recent advances in the transformation of plants.
Trends in Plant Science. 4(6):226-231

Haytowitz, D. B., and R. H. Matthews. 1986. Legumes and legume products. Washington
DC., USDA. 1-156.

Hiei, Y., S. 0hta, T. Komari, and T. Kumashiro. 1994. Efﬁcient transformation of rice
(Olyza sativa L.) mediated by Agrobacterium and sequence analysis of the
boundaries of the T-DNA. Plant Journal. 6:271—282

Hu, X., D. L. Bidney, N. Yalpani, J. P. Duvick, 0. Crasta, 0. Folkerts and G. Lu. 2003.
Overexpression of a gene encoding hydrogen peroxide-generating oxalate oxidase
evokes defense responses in sunﬂower. Plant Physiology. 133:170-181

Hu, K., K. Steinmuller, H. Wagner, C. Rossler, C. Eibl, and L. Sacher. 1996. Integration
of foreign sequences into the tobacco plastome via polyethylene glycol-mediated
protoplast transformation. Planta. 199(2): 193-201

Hurkman, W.J. and C. K. Tanaka. 1996. Effect of salt stress on germin gene expression
in barley roots. Plant Physiology. 110:971—977

Kazan K, F. R. Murray, K. C. Goulter, D. J. Llewellyn and J. M. Manners. 1998.
Induction of cell death in transgenic plants expressing a fungal glucose oxidase.
Molecular Plant-Microbe Interaction. 11:555—562.

Kelly, J. D., G. L. Hosﬁeld, G. V. Vamer, M. A. Uebersax, R. A. Long and J. Taylor.
Registration of ‘Red Hawk’ dark red kidney bean. Crop Science. 38:280-281

109

Kelly, J. D., G. L. Hosﬁeld, G. V. Vamer, M. A. Uebersax, and J. Taylor. 1999.
Registration of ‘Matterhorn’ great northern bean. Crop Science. 39:589—590.

Kelly, J. D. 2000. Remaking bean architecture for efﬁcient production. Advances in
Agronomy. 71:109-143

Kerr, E. D., J. R. Steadman, and L. A. Nelson. 1978. Estimation of white mold disease
reduction of yield and yield components of dry edible beans. Crop Science.
18:275-279

Kim, J .W. and T. Minamikawa. 1996. Transformation and regeneration of French bean
plants by the particle bombardment process. Plant Science. 117: 131—138

Kolkman, J. M. and J. D. Kelly. 2000. An indirect test using oxalate to determine
physiological resistance to white mold in common bean. Crop Science. 40:281-
285

Kolkman, J. M. and J. D. Kelly. 2002. Agronomic traits affecting resistance to white
mold in common bean. Crop Science. 42:693-699

Kolkman, J. M. and J. D. Kelly. 2003. QTL conferring resistance and avoidance to white
mold (Sclerotinia sclerotiorum) in common bean (Phaseolus vulgaris). Crop
Science. 43:539-548

Kull, L. S., T. D. Vuong, G. L. Hartman, K. S. Powers, K. M. Eskridge, and J. R.
Steadman. 2003. Evaluation of resistance screening methods for Sclerotinia stem
rot of soybean and dry bean. Plant Disease. 87: 1471-1476

Lamari, L. 2002. Assess for Windows: image analysis for disease quantiﬁcation.
Americal Phytopathological Society Press, St. Paul, Minn.

Lamb, C. J. and R. A. Dixon. 1997. The oxidative burst in plant disease resistance.
Annual Review of Plant Physiology and Plant Molecular Biology. 48: 251—275

Lane, B. J. 1991. Cellular dessication and hydration: developmentally regulated proteins,
and the maturation and germination of seed embryos. FASEB J. 5:2893-2901

Lane, B. J. 1994. Oxalate, germin and the external matrix of higher plants. FASEB J.
81294-301

Lane, B. J. 2002. Oxalate, germins and higher plant pathogens. IUBMB Life. 53:67-75
Lane B.G., Z. Grzelczak, T. Kennedy, R. Kajioka, J. Orr, S. D’Agostino, and A. Jaikaran.

1986. Gerrnin: compartmentation of the two forms of the protein by washing
growing wheat embryos. Biochemistry and Cell Biology. 64: 1025—1037

110

Lebel, E. G., J. Masson, A. Bogucki, and J. Paszkowski. 1995. Transposable elements as
plant transformation vectors for long stretches of foreign DNA. Theoretical and
Applied Genetics. 91(6-7):899-906

Levine, A., R. Tenhanken, R. Dixon, and C. Lamb. 1994. H202 from oxidative burst
orchestrates the plant hypersensitive disease resistance response. Cell. 79:583-593

Li, B. J ., X. P. Xu, and H. P. Shi. 1991. Electroinjected exogenous genes into rice mature
embryos and plant regeneration. Science in China. 3(B):270

Liang, H., C. M. Catranis, C. A. Maynard and W. A. Powell. 2002. Enhanced resistance
to the poplar fungal pathogen, Septoria musiva, in hybrid poplar clones
transformed with genes encoding antimicrobial peptides. Biotechnology Letters.
24: 383-389

Lima, E. R., A. S. Santiago, A. P. Araujo, and M. G. Teixeira. 2005. Effects of the seed
size of sown seeds on grth and yield of common bean cultivars of different
seed sizes. Brazilian Journal of Plant Physiology. 17(3):273-28l

Livingstone, D. M., J. L. Hampton, P. M. Phipps, and E. A. Grabau. 2005. Enhancing
resistance to Sclerotinia minor in peanut by expressing a barley oxalate oxidase
gene. Plant Physiology. 137:1354-1362

Lorito, M and F. Scala. 1999. Microbial genes expressed in transgenic plants to improve
disease resistance. Journal of Plant Pathology. 81(2):73-88

Lorito M., S. L. W00, 1. Garcia Fernandez, G. Colucci, G. E. Harman, J. A. Pintor-Toro,
E. Filippone, S. Muccifora, C. B. Lawrence, A. Zoina, S. Tuzun, and F. Scala.
1998. Genes from mycoparasitic fungi as a novel source for improving plant
resistance to fungal pathogens. Proceedings of the National Academy of Sciences
USA. 95: 7860-7865

Lumsden, R. D. and R. L. Dow. 1973. Histopathology of Sclerotinia sclerotiorum
infection of bean. Phytopathology. 63:708-715

M'ae, A., M. Montesano, V. Koiv and E. T. Palva. 2001. Transgenic plants producing the
bacterial pheromone N-acyl-honoserine lactone exhibit enhanced resistance to the
basterila phytopathogen Erwinia carotovora. The American Phytopathological
Society. 14(9): 1035-1042

Maheshwari N., K. Rajyalakshmi, K. Baweja, S. K. Dhir, C. N. Chowdhry and S. C.

Maheshwari. 1995. In vitro culture of wheat and genetic transformation:
retrospect and prospect. Critical Reviews in Plant Science. 14:149—178

11]

Malik K. A., and P. K. Saxena. 1992. Regeneration in Phaseolus vulgaris L.: high-
frequency induction of direct shoot formation in intact seedlings by N6-
benzylaminopurine and thidiazuron. Planta. 186:384—3 89

Maxwell, D. P. and R. D. Lumsden. 1970. Oxalic acid production by Sclerotinia
sclerotiorum in infected bean and in culture. Phytopathology. 60: 1395-1398

McClean P. and K. F. Grafton. 1989. Regeneration of dry bean (Phaseolus vulgaris L.)
via organogenesis. Plant Science. 60: 1 17—122

McKently, A. H. 1995. Effect of genotype on somatic embryogenesisfrom axes of mature
peanut embryos. Plant Cell Tissue and Organ Culture. 42:251-254

Miklas, P. N., K. F. Grafton, and P. E. McClean. 1993. Estimating phenylalanine
ammonia-lyase activity in common beans inoculated with Sclerotinia
sclerotiorum. HortScience. 282937-938

Miklas, P. N., R. Delorme, R. Hannan and M. H. Dickson. 1999. Using a subsample of
the core collection to identify new sources of resistance to white mold in common
bean. Crop Science. 39:569-573

Miklas, P. N., W. C. Johnson, R. Delorme, and P. Gepts. 2001. QTL conditioning
physiological resistance to white mold in dry bean. Crop Science. 41 :309-315

Miller, M. B. and B. L. Bassler. 2001. Quorum sensing in bacteria. Annual Review of
Microbiology. 55: 165-199

Mohamed M. F., D. P. Coyne and P. E. Read. 1993. Shoot organogenesis in callus
induced from pedicel explants of common bean (Phaseolus vulgaris L.). Journal
of the American Society for Horticultural Science. 118: 158—162

Muniz de Padua, V. L., R. P. F erreira, L. Meneses, N. Uchoa, M. Margis-Pinheiro, and E.
Mansur. 2001. Transformation of Brazilian elite Indica-type rice (Otyza sativa L.)
by electroporation of shoot apex explants. Plant Molecular Biology Reporter. 19:
55-64

Murashige, T. and F. Skoog. 1962. A revised medium for rapid grth and bioassays
with tobacco tissue cultures. Physiol. Plant. 15:473-497

National Agricultural Statistics Service, USDA. 2004
Nelson, R. S., S. M. McCormick, X. Delannay, P. Dube’, J. Layton, E. J. Anderson, M.
Kaniewska, R. K. Proksch, R. B. Horsch, S. G. Rogers, R. T. Fraley and R. N.

Beachy. 1988. Virus Tolerance, Plant Performance of Transgenic Tomato Plants
Expressing Coat Protein from Tobacco Mosaic Virus. Bio/Technology. 62403-409

112

Park, SJ. 1993. Response of bush and upright plant type selections to white mould and
seed yield of common beans grown in various row widths in southern Ontario.
Canadian Journal of Plant Science. 732265—272

Park, S. 0., D. P. Coyne, J. R. Steadman, P. W. Skock. 2001. Mapping of QTL for
resistance to white mold disease in common bean. Crop Science. 41: 1235-1264

Prassana, G. L. and T. Panda. 1997. Electroporation: basic principles, practical
considerations and applications in molecular biology. Bioprocess Engineering
161261-264

Purdy, L. H. 1979. Sclerotinia sclerotiorum: history, diseases and symptomatology, host
range, geographic distribution, and impact. Phytopathology. 69:875-880

Rakoczy-Trojanowska, M. 2002. Alternative methods of plant transforrnation- a short
review. Cellular and Molecular Biology Letters. 7:849-858

Ramalingam, J., C. M. Vera Cruz, K. Kukreja, J. M. Chittoor, J. L. Wu, S. W. Lee, M. R.
Baraoidan, M. L. George, M. Cohen, S. Hulbert, J. E. Leach and H. Leung. 2003.
Candidate resistance genes from rice, barley, and maize and their association with
qualitative and quantitative resistance in rice. Molecular Plant-Microbe
Interaction. 16:14-24.

Reddy, M. S. S., R. D. Dinkins, and G. B. Collins. 2003. Gene silencing in transgenic
soybean plants transformed via particle bombardment. Plant Cell Reports.
21(7):676-683

Russell, D. R., K. M. Wallace, J. H. Bathe, B. J. Martinell, and D. E. McCabe. 1993.
Stable transformation of Phaseolus vulgaris via electric-discharge mediated
particle acceleration. Plant Cell Reports. 12: 165-169

Saam, M. M. 1983. Clonal propagation of the common bean, Phaseolus vulgaris L., from
shoot tips in tissue culture. Unpublished Masters Thesis. Michigan State
University.

Sawahel, W. A. 2002. Production of herbicide resistant transgenic maize plants using
electroporation of seed-derived embryos. Plant Molecular Biology Reporter
20:303a-303h

Schroeder, H. E., A. H. Schotz, T. Wardley-Richardson, D. Spencer, and T. J. V.
Higgins. 1993. Transformation and Regeneration of two cultivars of pea (Pisum
sativum L.). Plant Physiology. 101(3): 751-757

Saker M. M. and T. Kuhne. 1998. Production of transgenic kidney bean shoots by
electroporation of intact cells. Biologia Plantarum. 40(4): 507-514

113

Sexton P. J., J. K. Boote, J. W. White, and C. M. Peterson. 1997. Seed size and seed
grth rate in relation to cotyledon cell volume and number in common bean.
Field Crops Research 54: 163—172

Schroeder, H. E., A. H. Schotz, T. Wardley-Richardson, D. Spencer and T. J. V. Higgins.
1993. Transformation and regeneration of two cultivars of pea (Pisum sativum
L.). Plant Physiology. 101: 751-757

Schwartz, H. F., and J. R. Steadman. 1978. Factors affecting sclerotium populations of,
and apothecium production by, Sclerotinia sclerotiorum. Phytopathology 68:383—
388

Shade, R.E., H. E. Schroeder, J. J. Pueyo, L. L. Tabe, T. J. V. Murdock, M. J. Higgins,
and M. J. Chrispeels. 1994 Transgenic pea seeds expressing the a-amylase
inhibitor of the common bean are resistant to bruchid beetles. Bio/Technolology.
12:793-796.

Shimada, M., D. B. Ma, Y. Akamatsu and T. Hattori. 1994. A proposed role of oxalic
acid in wood decay systems of wood-rotting basidiomycetes FEMS Microbiology
Reviews. 13(2-3):285-296

Singh, S. P. 2001. Broadening the genetic base of common beans. Crop Science.
41:1659-1675

Singh, P. N. and G. E. Fraser. 1998. Dietary risk factors for colon cancer in a low-risk
population. American Journal of Epidemiology 148, 761-774

Steadman, J. R. 1983. White mold-a serious yield-limiting disease of bean. Plant Disease.
67:346—350.

Steadman, J. R., J. M. Kolkman, and K. M. Eskridge. 2001. Search for resistance to
Sclerotinia sclerotiorum in common bean — Screening and sources. Proc. XI
International. Sclerotinia Workshop, York, UK. 63-64

Steel, R. G. D., and J. H. Torrie. 1980. Principles and procedures of statistics. McGraw-
Hill, New York.

Sutton, D. C., and B. J. Deverall. 1984. Phytoalexin accumulation during infection of
bean and soybean by ascospores and mycelium of Sclerotinia sclerotiorum. Plant
Pathology. 33:337—383

Tariq, V. N. and P. Jeffries. 1985. Changes occurring in chloroplast of Phaseolus

following infection by Sclerotinia: a cytochemical study. Journal of Cell Science.
75(1):]95-205

114

Tenhanken, R., A. Levine, L. F. Brisson, R. A. Dixon, and C. Lamb. 1995. Function of
the oxidative burst in hypersensitive disease resistance. Proceeding of the
National Academy of Science. USA. 92:4158-4163

Thompson, C, J. M. Dunwell, C. E. Johnstone, V. Lay, J. Ray, M. Schmitt, H. Watson,
and G. Wisbet. 1995. Degradation of oxalic acid by transgenic oilseed rape plants
expressing oxalate oxidase. Euphytica 85: 169-172

Thompson, E. W. and B. G. Lane. 1980. Relation of protein synthesis and imbibing
wheat embryos to the cell-free translational capacities of bulk mRNA from dry
and imbibing embryos. Journal of Biological Chemistry. 264:4896-4900

Tripathi, M. and S. Tiwari. 2003. Epigenesis and high frequency plant regeneration from
soybean (Glycine max (L.) Merr.) hypocotyls. Plant Tissue Culture. 13(1):61-73

Tu, J. C. 1985. Tolerance of white bean (Phaseolus vulgaris ) to white mold (Sclerotinia
sclerotiorum ) associated with tolerance to oxalic acid. Physiological Plant
Pathology. 26:1 1 1—1 17

Tu, J. C. 1989. Oxalic acid induced cytological alterations differ in beans tolerant or
susceptible to white mould. New Phytologist. 112: 519—525

Valvekens, D., M. V. Montagu, and M. V. Lijsebettens. 1988. Agrobacterium
tumefaciens-mediated transformation of Arabidopsis thaliana root explants by
using kanamycin selection. Proceedings of the National Academy of Science.
85(15):5536-5540

Veltcheva, M. R. and D. L. Svetleva. 2005. In vitro regeneration of Phaseolus vulgaris L.
via organogenesis from petiole explants. Journal of Central European Agriculture.
6(1):53-58

Webster, D. and Kelly, J. D. 2000. Commentary on germplasm enhancement and cultivar
development. Proceedings of the Idaho Bean Workshop. 55-59v

Werner, T., Motyka, V., Strnad, M., and Schmiilling, T. 2001. Regulation of plant grth
by cytokinin. Proceedings of the National Academy of Science. USA. 98: 10487-
10492

Woo, E. J., J. M. Dunwell, P. W. Goodenough, A. C. Marvier, and R. W. Pickersgill.
2000. Germin is a manganese containing homohexamer with oxalate oxidase and
superoxide dismutase activities. Natural Structural Biology. 7: 1036-1040

Woo, E. J ., J. M. Dunwell, P. W. Goodenough, and R. W. Pickersgill. 1998. Barley

oxalate oxidase is a hexameric protein related to seed storage proteins: evidence
from X-ray crystallography. F EBS Letters. 437287-90

115

Wood, D. R., and J. G. Keenan. 1982. Registration of Olathe bean. Crop Science.
22:1259—1260

Wright M, J. Dawson, E. Dunder, J. Suttie, J. Reed, C. Kramer, Y. Chang, R. Novitzky ,
H. Wang, and L. Artim-Moore. 2001. Efﬁcient biolistic transformation of maize
(Zea mays L.) and wheat (Triticum aestivum L.) using the phosphomannose
isomerase gene, pmi, as the selectable marker. Plant Cell Reports. 20: 429-436

Wu, G., B. J. Short, E. B. Lawrence, E. B. Levine, K.C. Fitsimmons, and D. M. Shah.
1995. Disease resistance conferred by expression of a gene encoding H202-
generating glucose oxidase in transgenic potato plants. Plant Cell. 7: 1357-1368

Zambre M. A., J. De Clercq, E. Vranova', M. Van Montagu, G. Angenon, and W. Dillen.
1998. Plant regeneration from embryo-derived callus in Phaseolus vulgaris L.
(common bean) and P. acutifolius A. Gray (tepary bean). Plant Cell Reports.
172626—630

Zambre, M., A. Goossens, C. Cardona, M. Van Montagu, N. Terryn and G. Angenon.
2005. A reproducible genetic transformation system for cultivated Phaseolus
acutifolius (tepary bean) and its use to assess the role of arcelins in resistance to
the Mexican bean weevil. Theoretical and Applied Genetics. 110(5):914-924

Zhou, F ., Z. Zhang, P. L. Gregersen, E. de Neergaard, D. B. Collinge and H. Thordal-
Christensen 1998. Molecular characterization of the oxalate oxidase involved in
the response of barley to the powdery mildew fungus. Plant Physiology. 117, 33—
41

116

. 1
3 1293 02736 8798