_) 1:4...112
.. m -

31111.1...4.” . I ..

1 £2. E

 

 

1 ”3.611354%.

1A1).- ..... 1

.. . .
111. :1 . $13.4 :Mfissuuzmu.
l .. xv 1.:

1.1. 311....

 

5. :0. .1?

l 1111.. ”Ea-‘71
.IQJ .1
I V I

.Is. .1.
19:1!
.51 (411..
1.9.1.1:
1. 15. . 5.4.1.52 . .4.
:31. 4.11.}...
:27. .1113...»
.r

 

 

13:...
m..:1?.....n.fi.! Iw
9.3 .1: o.

.41.! 1D.

 

 

 

.11.;1. :

’3 Y‘Divlil.
3.1.. 731....) .
1511!.

.1... 3...

WNW! .: 3.4

61 3.1111:

 

 

 

   

 

. In? £53. .. 1.3.1. . E d ...H£1...fl¥
_. 1—H: . .15}... «5.? EEr . . . ‘3‘}. .w. gtw‘fluifl'Hanxkfi

using .. m: .145 n. a... a. _. . , _ . I.
- I - I ..

 

 

 

YHESIS

2 . LIBRARY
W Mlchigan State
University

This is to certify that the
dissertation entitled

TRANSCRIPTIONAL REGULATION OF PROSTAGLANDIN H
SYNTHASE (PGHS)—2 GENE IN A MACROPHAGE MODEL OF
INFLAMMATION

presented by

YEON-JOO KANG

has been accepted towards fulfillment
of the requirements for the

Doctoral degree in Cell and Molecular Biology

 

 

WW; W

 

Major Professor’s Signature

Maw/L 2f; 24239

Date

MSU is an Afi'innative Action/Equal Opportunity Institution

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE
JUN 2 0 2007

 

 

: i 0; 5';

 

 

 

 

 

 

 

 

 

 

 

 

 

2/05 p:lClRC/DateDue.indd-p.1

TRANSCRIPTIONAL REGULATION OF PROSTAGLAN DIN H SYNTHASE

(PGHS)-2 GENE IN A MACROPI-IAGE MODEL OF INFLAMMATION

By

Yeon-Joo Kang

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Cell and Molecular Biology Program

2006

ABSTRACT
TRANSCRIPTIONAL REGULATION OF PROSTAGLANDIN H SYNTHASE
(PGHS)-2 GENE IN A MACROPHAGE MODEL OF INFLAMMATION
By

Yeon-Joo Kang

Prostaglandins, cyclooxygenase (COX, PGHS) products, are lipid-derived
hormones that play a crucial role in the development of local and systemic inflammatory
responses. Chronic inflammation is an essential step in the progression of many diseases,
such as atherosclerosis, cancer, and neurodegenerative diseases. Two COX isozymes,
COX-1 and COX-2, are responsible for the production of prostaglandin H2, the
committed step in prostanoid biosynthesis. COX-2 is involved in immune responses.
Nonsteroidal anti-inflammatory drugs (N SAIDs) and selective COX-2 inhibitors are
commonly used to relieve symptoms associated with inflammation by targeting COX-2.

Exposure of macrophages to lipopolysaccharide (LPS), a major component of the
outer membrane of Gram negative bacteria induces sustained COX-2 activation. LPS
mediates signaling through the toll-like-receptor—4 (TLR4), which results in the activation
of JNK, ERK, and p38 MAP kinase cascades and NF-KB inducing kinase (NIK). I have
examined COX-2 gene expression in RAW 264.7 macrophages treated with LPS as a
model for COX-2 gene expression during inflammation. Using this system, I have
established that COX-2 is highly regulated at the transcriptional level and that LPS-
induced COX-2 transcriptional activation is sustained for at least 12 hr after LPS

stimulation and occurs in three phases including an initial increase (1-4 hr), a middle

phase (4-9 hr), and a second increase (9-12 hr).

LPS-induced transcriptional activation of COX-2 is mediated by the binding of
transcription factors such as CREB, NF-KB, ATF, AP-l, C/EBP to cis-acting elements
present in the COX-2 promoter. Previous studies with LPS-treated RAW 264.7 cells
identified three cis-acting elements including a NF-KB site, a C/EBP site, and a CRE
(CRE-1). Using promoter analysis, three additional functional cis-acting elements in the
COX-2 promoter--a second CRE site (CRE-2), an AP-l site, and an E-box that overlaps
the CRE-1 were identified. Five of those elements are involved in COX-2 transcriptional
activation, while the E-box appears to be involved in COX-2 transcriptional repression. I
also characterized trans-acting factors involved in several different phases of sustained
activation of COX-2 in LPS-stimulated RAW 264.7 macrophages using electrophoretic
mobility supershift assays and chromatin immunoprecipitation assays. I observed that
CREB is constitutively bound to CRE-1 or CRE-2 during the entire 12 hr time period.
The initial increase in COX-2 transcription involves p65/p50 binding to an NF-KB site
and phosphorylated c-Jun/c-fos binding to an AP-l site. The p65/p50 heterodimer is
replaced by p50 homodimers at 4 hr of LPS-treatment and phosphorylated c-Jun/c-fos
binding is replaced by phosphorylated c-Jun homodimers after 1 hr. Treatment of cells
with JNK and p50 inhibitor after 3.5 hr of LPS stimulation abolished COX-2 mRNA
induction at 6 hr; however partial recovery of COX-2 mRNA induction was observed
after 9-12 hr. Thus, my data suggest that at least certain of the cis-elements and their
cognate transcription factors participate at different times and to different degrees to
regulate the prolonged COX-2 gene expression that occurs during the development of an

inflammatory response.

For mom and dad

for their constant support, guidance, and abundant love.

iv

ACKNOWLEDGMENTS

My sincere thanks go to my thesis advisor, Dr. William Smith. His guidance,
patience, and assistance in carrying out my thesis research and in preparing this thesis
have been invaluable. He has always been accessible and approachable and has given me
space to develop scientifically and personally. I not only learned biochemistry, molecular
biology, independence, and philosophy, but most importantly I learned how to do good
science, build a model, and find answers for unexpected questions that arise during
research. I also value the time and suggestions that each member of my thesis committee
contributed; Dr. Richard Schwartz, Dr. William Henry, Dr. Walt Esselman, and Dr.
Laura McCabe all served valuable roles. I also thank Drs. Roland Kwok and Daniel
Bochar from the University of Michigan Medical School for helpful comments and
insightfirl discussions. Dr. Roland Kwok generously provided ACREB and p300
expression vectors and helped design USF-l and USP-2 expression vectors.

I especially appreciate my current and former labmates: Dr. Cindy Delong, Dr.
Byron Wingerd, Dr. Masayuki Wada, Dr. Chong Yuan, Dr. Dmitry Kuklev, Jiayan Liu,
Uri Mbonye, Dr. Christine Harman, and Jill Rieke for their help and friendship
throughout the years. I have enjoyed exchanging ideas with them and their comradeship
has made the atmosphere in the laboratory a welcome one, no matter how the
experiments were going. Additionally, I must thank my very good friends Gauri
J awdekar, Kae Koh, and Russell Nofsinger for supporting me in good and bad times.

Finally, I want to thank my parents, Hee-Kyung Lee and Dr. Yoon-Ho Kang, and

my brothers, Tae-Hyuk and Tae-Jong for their constant support, love, guidance and

encouragement throughout my life. Tae-Jong stayed in Michigan for most of my
graduate school years. I thank him for always being there for me, supporting me and

being a wonderful brother. Most of all I thank my beautiful mother and also my best

friend, Hee-Kyung Lee for her patience, tremendous support, and abundant love.

vi

PREFACE

This thesis is composed of three related manuscripts, each representing a chapter
(1-3). These chapters either have been or will be submitted to peer-reviewed journals.
The introduction (chapter 1) summarizes background information, the explosive progress
and unresolved questions in the field. This chapter will be submitted as a review article
to Biochemica et Biophysica Acta, Molecular and Cell Biology of Lipids with minor
modifications. Chapter 2 consists of studies on the dynamics and mechanisms of
sustained COX-2 transcriptional regulation over 12 hr period of LPS-stimulated murine
macrophages. This chapter contains the manuscript that has been submitted to Journal of
Immunology with some modifications in the result section. The third chapter forms the

core of a manuscript in preparation.

vii

TABLE OF CONTENTS

LIST OF TABLES ............................................................................................................. ix
LIST OF FIGURES ............................................................................................................ x
LIST OF ABBREVIATIONS ........................................................................................... xii

CHAPTER 1: INTRODUCTION: LITERATURE REVIEW
CYCLOOXYGENASE GENE EXPRESSION AND

PROTEIN DEGRADATION

Abstract .................................................................................................................... 1
Introduction .............................................................................................................. 2
1. The Regulation of COX-1 Gene Expression ...................................................... 8
2. The Regulation of COX-2 Gene Expression ..................................................... 10
2.1. Transcriptional Regulation of COX-2 in Fibroblasts ...................................... 15
2.2. Transcriptional Regulation of COX-2 in Endothelial Cells ............................ 17
2.3. Transcriptional Regulation of COX-2 in Smooth Muscle Cells ..................... 18
2.4. Transcriptional Regulation of COX-2 in Epithelial Cells ............................... 19
2.5. Transcriptional Regulation of COX-2 in Granulosa Cells .............................. 20
2.6. Transcriptional Regulation of COX-2 in Bone ............................................... 22
2.7. Transcriptional Regulation of COX-2 in Monocytes/Macrophages ............... 24
3. COX Protein Degradation .................................................................................. 32
Concluding Remarks .............................................................................................. 34
References .............................................................................................................. 35

CHAPTER 2: CYCLOOXYGENASE-2 GENE TRANSCRIPTION IN A
MACROPHAGE MODEL OF INFLAMMATION

Summary ................................................................................................................ 48
Introduction ............................................................................................................ 50
Materials and Methods ........................................................................................... 53
Results .................................................................................................................... 61
Discussion .............................................................................................................. 92
References ............................................................................................................ 101

CHAPTER 3: TRANSCRIPTIONAL REPRESSION OF CYCLOOXYGENASE-2
THROUGH THE E-BOX ELEMENT IN LIPOPOLYSACCHARIDE-
STIMULATED MACROPHAGE CELLS

Summary .............................................................................................................. 107
Introduction .......................................................................................................... 108
Materials and Methods ......................................................................................... 110
Results... .............................................................................................................. 111
Discussion ............................................................................................................ 1 17
References ............................................................................................................ 120

viii

LIST OF TABLES

Table I. COX-1 inducers ......................................................................................... 11
Table II. COX-2 inducers ......................................................................................... 11

Table III. Oligonucleotides used for EMSAs and
preparation of COX-2 promoter mutations ................................................ 65

ix

Figure 1.
Figure 2.

Figure 3.

Figure 4.

Figure 5.

Figure 6.

Figure 7.

Figure 8.

Figure 9.

Figure 10.

Figure 1 1.

Figure 12.

Figure 13.

Figure 14.

Figure 15

LIST OF FIGURES

Arachidonic acid metabolism ...................................................................... 4
Prostaglandin synthesis and actions ............................................................. 5

Comparison of the protein structures of the cyclooxygenase

isoforms COX-1 and COX-2 ...................................................................... 7
Schematic representation of the functional regulatory elements

in the human COX-1 and COX-2 promoter ................................................ 9
Schematic representation of COX-2 gene induction

signaling patyways .................................................................................... 14
Chemical structure of lipopolysacchride (LPS)

and the LPS receptor ................................................................................. 25
Toll-like receptor 4 signal transduction pathways ..................................... 27

Schematic representation of the major conserved
response element in the murine COX-2 promoter .................................... 62

Sustained increase of mCOX-2 gene expression in
LPS-stimulated RAW264.7 cells .............................................................. 63

Promoter activity of COX-2 deletion and mutation constructs ................. 67

EMSA supershift assays analyzing transcription factor
binding to mCOX-2 promoter elements ................................................... 71

CREB and p65/p50 binding to a probe containing
both the CRE-2 and the NF -KB site .......................................................... 72

Representative immunoblots showing transcription factor

binding to the biotinylated probe that contains

the CRE-2 and the NF-KB site in the presence or

absence of LPS stimulation ........................................................................ 75

AP-l transcription factor binding to a COX-2 AP-l probe ....................... 76

CREB, USF-l , USF-2, and phosphorylated c-Jun binding
to a COX-2 probe with the overlapping CRE-1/E-box probe .................... 79

Figure 16.

Figure 17.

Figure 18.

Figure 19.

Figure 20.

Figure 21.

Figure 22.

Figure 23.

Figure 24.

Specific binding of nuclear protein to
the AP-l/CRE-llE-box probe .................................................................... 81

CREB/ATP and AP-l transcription factor bind to
the AP-l/CRE-l/E-box probe .................................................................... 82

Chromatin immunoprecipitation (ChIP) assays
to identify transcription factors associated with the
mCOX-2 promoter in LPS-stimulated RAW264.7 cells ........................... 84

Functional assays of COX-2 transcriptional regulation
in LPS-treated RAW 264.7 cells ................................................................ 87

Effects of JNK and p50 inhibitors on COX-2 mRNA

induction in LPS-treated RAW 264.7 macrophages

as determined by semi-quantitative RT-PCR ............................................ 91
Model depicting the actions of transcription factors

at the COX-2 promoter at different times after beginning

LPS-induced COX-2 expression in RAW264.7 macrophages .................. 97

Transcription factor binding to E-box probe ........................................... 113

Effect of USF overexpression
on LPS-induced COX-2 promoter activity .............................................. 114

Effect of USF overexpression on LPS-induced
WT or mE-box COX-2 promoter activity ................................................ 116

xi

AP- 1
ATF
ASK]
bFGF
CAK
C/EBP
cAMP
COX
CR
CRE
CREB
DMEM
ECSIT
EGF
EMSA
ERK
GF
GFR
HFF
I-xb
IKK
IL- 1
IL- 1 R
IRAK
IRF
JNK
LPS
MAPK

LIST OF ABREVIATIONS

Activator Protein-1

Activating Transcrtiption Factor
Apoptosis Signal-regulating Kinase

basic Fibroblast Growth Factor

Ceramide Activated Kinase

CAAT Enhancer Binding Protein

Cyclic Adenosine Monophosphate
Cyclooxygenase

Cytokine Receptor

cAMP Response Element

cAMP Response Element Binding Protein
Dulbecco's Modified Eagle's Medium
Evolutionary Conserved Signaling Intermediate in Toll
Epidermal Growth Factor
Electrophoretic Mobility Shift Assay
Extracellular signal-Regulated Kinase
Growth Factor

Growth Factor Receptor

Human F oreskin Fibroblast

Inhibitor of KB

Inhibitor of KB Kinase

Interleukin-1

Interleukin-1 Receptor

Interleukin-1 Receptor Associated Kinase
IFN (Interferon) regulatory factor

c-Jun N-term Kinase

Lipopolysaccharide

Mitogen Activated Protein Kinase

MAPKAP-Kl MAPK- Activated Protein Kinase-1

MBD
MEK
MEKK
MKK
MKKK

MSK-l, -2

MyD88
NF-KB
NIK
p50
p65
PAK
PDGF

Membrane Binding Domain
See MKK
See MKKK

Mitogen Activated Protein Kinase Kinase, also called MEK
Mitogen Activated Protein Kinase Kinase Kinase, also called MEKK

Mitogen and stress Activated Kinase-1, -2
Myeloid Differentiation Factor

Nuclear Factor-kappa B

Nuclear Factor-kappa B Inducing Kinase
Rel protein 50, NF-KB transcription factor
Rel protein 65, NF-KB transcription factor
p21 Associated Kinase

Platelet Derived Growth Factor

xii

PGD2
PGE2
PGF2Q
PGG2
PGH2
PGHS
PGI2
PI3K
PKA
PKC
PLC
PMA
PTH

SP

SRE
TAE
TAK-l
TBK- 1
TCF
TGF-a -B
TIR

TKR
TLR4
TNF-ct -B
TNFR
TPA
TRADD
TRAF
TRAM
TRIF

Prostaglandin D2
Prostaglandin E2
Prostaglandin F 2a
Prostaglandin G2
Prostaglandin H2

Prostaglandin H Synthase, Prostaglandin Endoperoxide Synthase

Prostaglandin I2

Phosphatidyl-Inositol-3-Kinase

cAMP dependent Protein Kinase

Calcium dependent Protein Kinase

Phospholipase C

Phorbol 12-Myristate 13-Acetate

Parathyroid Hormone

TNF Receptor Interacting Protein

Signal Peptide

Sterol Response Element

Tris-Acetate EDTA

Transforming growth factor-beta Activated Kinase-1
TANK-Binding Kinase-1

T-Cell Factor

Transforming Growth Factor-0t -B

Toll/IL-l Receptor

Tyrosine Kinase Receptor

Toll-Like Receptor-4

Tumor Necrosis Factor-ct -0

Tumor Necrosis Factor Receptor

Phorbol lZ-Tetradecanoate l3-Acetate

Tumor Necrosis Factor Receptor Associated Death Domain
Tumor Necrosis Factor Receptor Associated Factor
TRIP-related Adaptor Molecule

TIR domain-containing adaptor-inducing IFN-B

xiii

I

CHAPTER 1

LITERATURE REVIEW
CYCLOOXYGENASE GENE EXPRESSION AND PROTEIN DEGRADATION

Summary

Cyclooxygenase-1 (COX-1) expression is induced during development, and
COX-1 mRNA and COX-1 protein are very stable. This combination of properties can
explain why COX-1 protein levels are relatively high and remain constant in most cells
expressing this enzyme. COX-2 is usually expressed inducibly in association with cell
replication or differentiation and both COX-2 mRNA and COX-2 protein have short-lives
relative to those of COX-1. Consequently, COX-2 protein is typically present for only a
few hr after its synthesis.

There are major gaps in our understanding of (a) the mechanisms involved in the
induction of COX-1 gene expression; (b) the way in which COX-2 gene expression is
regulated and (c) the molecular basis for the rapid turnover of COX-2 protein. Here we
review what is currently known about these topics. In particular, we develop the two
concepts (a) that COX-2 gene expression can be regulated by numerous signaling
pathways that generate trans-acting factors that, in turn, interact interactive with different
combinations of cis-elements in a coordinate manner and (b) that the relative contribution
of each cis-element depends on the cell type, the stimulus and the time following the

stimulus.

Introduction

Cyclooxygenase (COX, PGHS) metabolizes arachidonic acid, hydrolyzed from
cell membrane phospholipids by phospholipase A2, to prostaglandin endoperoxide H2
(PGH2), the precursor of thromboxane A2 (TxA2) and prostaglandins (PGs) (Fig. l).
Prostaglandins are lipid mediators that normally act in a paracrine and autocrine manner
to coordinate intercellular events stimulated by a circulating hormone. TxA2 from
platelets is an important mediator of platelet aggregation. Prostaglandins play critical
roles in normal physiological process such as stomach mucus secretion, kidney water
excretion, ovulation, fertilization, fetal development, and parturition. Moreover,
prostaglandins are involved in the pathophysiology of tumorigenesis, inflammation, fever
and pain transmission (Fig. 2) (1, 2).

Nonsteroidal anti-inflammatory drugs (N SAIDs), which act primarily via
inhibition of cyclooxygenase activity and abrogation of prostaglandin biosynthesis, are
commonly used for the treatment of acute inflammation, pain, fever, and chronic
inflammatory diseases such as asthma, rheumatoid arthritis, and inflammatory bowel
disease (IBD). NSAIDs are also used for the prevention of coronary artery thrombosis,
Alzheimer’s diseases, and gastrointestinal and breast cancer (3).

There are two unique, yet highly related COX isozymes--a housekeeping COX-1
and an inducible COX-2. Although COX-1 is constitutively expressed in most cells and
tissues, it is developmentally controlled and can be upregulated by tumor-promoting
phorbol ester and growth factors as seen with primary megakaryocytes and
megakaryoblast cell lines (Table 1) (4-6). In contrast, COX-2 expression is highly
regulated and can rapidly induced by bacterial endotoxin (LPS), cytokines such as IL-1,

IL-2, and TNF-0t, growth factors, and the tumor promoter phorbol myrisate acetate

(PMA) depending on the cell type (7). Brain, kidney, pancreatic B-cells, and colon
carcinomas exhibit constitutive COX-2 expression references for all but this topic is not
addressed in this review.

The ability of the COX enzymes to orchestrate the complex physiologic
functions that are mediated by prostaglandins reflects an elaborate interplay between the
two isoforms. The differences in these isozymes in structure, expression level, and
regulation could contribute to the unique roles of each enzyme. COX-1 and COX-2
have approximately 60% amino acid sequence identity and their active site structures are
highly conserved. Both are homodimeric proteins with a molecular mass of roughly 71
KDa. Their active sites both consist of a hydrophobic channel, and the amino acids in
this region are almost identical; however, COX-2 has a larger and more accessible side
pocket than COX-1 (8, 9). COX-1 and COX-2 proteins have some sequence and
structural differences. These differences include different signal peptides and significant
sequence differences in their membrane binding domains (10). Most notably, COX-2
but not COX-1 contains a unique 18 amino acid cassette near the C-terrninus (Fig. 3).

While little is known about the transcriptional regulation of COX-1 gene and the
mechanism of COX-1 enzyme degradation, the regulation of COX-2 has been
investigated extensively. Numerous studies indicate that COX-2 expression is regulated
at the transcriptional and post-transcriptional levels. In most settings COX-2 expression
is mainly regulated at the level of gene transcription although in a few cases COX-2
induction is primarily due to mRNA stabilization. In this review, we focus on recent
advances in our understanding of the transcriptional regulation of COX isozymes and

their degradation.

 

 

LMszmefbeseholipisel

I
Activated P

Arachidonic Acid

I
Iooxygenase

Prostaglandin GZ (PGG2)]

[Prostaglandin H2 (PGH2)|

I
Syntheses

F

[Prostaglandins Dz, E2, F2]

COX-1I-2

 

Prostacyclin (PGIZ)
Thromboxanes (TxA2)

 

Figure 1. Arachidonic acid (AA) metabolism.

Prostaglandin biosynthesis is mediated by either the COX-1 or the COX-2 enzyme.
Phospholipase A2, which is activated by a number of mechanical or hormonal factors,
releases AA from cell membrane phospholipids. Free AA is then bound by COX, which
has cyclooxygenase and peroxidase activity. converted into unstable prostaglandin G2
(PGG2) and then prostaglandin H2 (PGH2). PGH2 is transformed into prostaglandin,
prostacyclin, and thromboxane by in a cell specific manner by PGE, prostacyclin and
thromboxane synthases.

Figure 2. Prostaglandin synthesis and actions.

When a cell is activated by various stimuli, arachidonic acid (AA) is released from
membrane lipids by cytosolic phospholipase (cPLA2) and metabolized by COX-1 or
COX-2, resulting in the production of PGH2. There is also de novo COX-2 enzyme
synthesis induced by a host of factors (top). PGH2 can be converted into different
prostacyclins (PGE2, PGD2, PGF2a, PGI2) and thromboxane A2 (TxA2). These
prostaglandins are transported from the cell through the prostaglandin transporter (PGT)
to exert autocrine or paracrine actions via perhaps a family of prostaglandin receptors
including EPI, EP2, EP3, EP4, DP], DP2, FP, IP, TPa, and TPB associated with the cell
types indicated above. Figure adapted from Funk et. al. (11)

          

2.2822
ago—8
9.2:... l!‘ oo.<wz u x
—'0
8:88. :3. Al/I 2.2 g E. , , ,2 3.25:: a 2
mm

Sauna! Fl 38 oo .o,./,,,.,////,.,2 so
con-5.6 3.. cow-Si: i a
w

an 5 P150 3 Ice-'2 in
5:88... .26.... Ti «M “m

  

COX-llPGHS-l

N67 N143 N409
l 1 1

EG BD] Catalytic

 

 

PTEL
COX-2/PGHS-2
N53 N130 N396 N580
1 l I l
EiflEGFjMBDl Catalytic .1
STEL

Figure 3. Comparison of the protein structures of the cyclooxygenase isoforms
COX-1 and COX-2. Both isoforms have a signal peptide (SP), an epidermal growth
factor (EGF)—like domain, a membrane-binding domain (MBD). and a catalytic domain.
The C-terminal PTEL and STEL sequences in COX-1 and COX-2. respectively, represent
an ER targeting signal. The glycosylation sites are also shown; note the additional
glycosylation site in the COX—2 protein. COX-2 has a shorter signal peptide than COX-
1, and there is a unique 18 amino acid insertion near the C-terminus of COX-2 (residues
595-612).

l. The regulation of COX-1 gene expression

The human COX-1 gene, located on chromosome 9, is approximately 22 kb in
length and contains 11 exons (12, 13). The COX-1 promoter lacks a TATA or CAAT
box, has a high GC content, and contains several transcriptional start sites. All of these
properties are characteristic of “housekeeping” genes (14, 15). Although COX-1
protein is constitutively expressed in most tissues, COX-1 is upregulated by PMA in
some cell types including monocytes (16), human embilical vein endothelial cells
(HUVEC) (17), and primary megakaryocytes and megakaryoblasts (5, 6) as they
differentiate during development (Table I). COX-1 is also induced by shear stress in
HUVEC cells (18), by bradykinin in the gallbladder (19), and by estrogen in endothelial
cells (20). Within the 5’ flanking region of the human COX-l promoter there are three
functional Spl binding sites at -610, -111, and -89 relative to the ATG start site (Fig. 4).
In HUVECs the Spl motifs at -610 and -111 contribute to constitutive expression but not
to PMA-induced expression of the COX-1 gene (17). The Spl binding site at -111 is
required for PMA-induced COX-1 transcription in the megakaryoblast cell line MEG-01
(21) and for estradiol induction of COX-1 in ovine endothelial cells (20) where both the
Spl site at -111 and to an even greater extent the Spl site at -89 are required for COX-l
induction. These three Spl sites are the only functional regulatory elements that have
been described within 2 kb upstream of the ATG start codon. However, there is a highly
conserved AP-l site in intron 8 of the COX-1 gene that interacts with the ~111 SP-l site

of the promoter to regulate PMA-induced expression of COX-1 in MEG-01 cells (21).

 

Human COX-1 Promoter

 

 

  
    
 

   

' I l
.’«' i II
-610 -111 -89 +1 +13,138 +13,145 t
Human COX-2 Promoter
-510 -504 -388 -380 —223 -214 -74 -62 -55 —50

-27t -265 -l33 -124 -32 -29 +1

Figure 4. Schematic representation of the functional regulatory elements in the
human COX-1 and COX-2 genes. The Cir-acting elements are noted in the shaded
boxes and their location relative to the transcriptional start site are noted above or below
each element. Note that the COX-1 promoter lacks a TATA box. Abbreviations: CRE,
cAMP Response Element; SRE. Sterol Response Element; NF-KB, Nuclear Factor-kappa
B; C/EBP, CAAT Enhancer Binding Protein; AP-l, Activator Protein-1

2. The regulation of COX-2 gene expression

The human COX-2 gene, located on chromosome 1, is about 8.3 kb long and has
10 exons. Except for the first exon the intron/exon boundaries of the COX-1 and COX-
2 genes are the same (14, 22). There are two major transcripts of COX-2--a 4.5 kb full
length mRNA and a 2.6 kb polyadenylated variant that lacks the terminal 1.9 kb of the 3’-
untranslated region (UTR). The 3’—UTR of the COX-2 gene contains 23 copies of the
‘ATTTA’ RNA instability element that participates in post-transcriptional regulation of
COX-2 expression (23). Sequence analysis of the 5’-flanking region of the human
COX-2 gene has identified several potential transcriptional regulatory elements,
including a peroxisome proliferator response element (PPRE), two cyclic AMP response
elements (CRE), a sterol response element (SRE), two nuclear factor kappa B (NF-KB)
sites, an SP1 site, a CAAT enhancer binding protein (C/EBP, or nuclear factor for
interleukin-6 expression (NF-1L6» motif, two AP-2 sites, an E-box, and a TATA box (Fig.
4). The promoter regions of COX-2 genes have the sequences of typical immediate
early genes (14). There are some subtle interspecies differences in the sequences of the
human, mouse, rat, cow and horse COX-2 genes. For example, the mouse COX-2
promoter has one NF-KB motif and two C/EBP sites instead of the two NF-KB sites and
one C/EBP motif found in the human COX-2 promoter. Transcriptional regulation of
the COX-2 gene is very complex in that it can involve numerous signaling pathways, and
the mechanism varies depending on the specific stimulus and the cell type. Here, we
compare COX-2 gene regulation in several different cell types (Table II) and the

regulatory elements (fig. 4) and signaling pathways (fig. 5) involved in each system.

10

5.: BE :3 am .652
:3 ammo .miz

83 “337%. .652 .3:

as am: £7: .Soam .msiz .8:

as an .e 9 3:2 .33 7.2 .GQ ammo
$75 GEESEEEEEEM

£7: a Mz=€§§z=7§m§§

.33 :otgtqov 3:83—93 £388.:
.3: m5 .5: £2... .5: a 7.: £2:
3s “50> Am. .9: 38:.

:3 <2: .93

83 :7:

as 57.:

Ge mm: d 7.: .Eze .GQ <2:
2.0 .5: amp: size .n 7.:
83 a 27> £2: men: .820:

6:25:

m=oo 322.898 E9» .3238: 58::

39.5: 2.8 32:85 .235 use:
2.8 3358::

$8305: 3:65? 583.:
awe—noficga 3:325 5853

Eat $535: .5328 5:5:

39.22:: m: 52
cases:

 

3:35am mpg—5&5

£335

25 =8

 

e835 380 .N 22:.

 

ac meowoeoao 822:; .G_ .e .3 <2: .am .215

as 28 sees:
a: 0:: gains:
:3 22.: save. assess Econ:

83 an. 22358 5:23 .3 a see 32m .38 ”6.”;

as nice .cé :7:

awn—nohaoawovém03882
«8833232

5233—30

.58 3.223 .8:an
m=3 3:38—50 338.3

eases”:

 

B0265

25 :8

 

28.65 7x8 4 2.3

11

 

Ame .03 5:3 $505—$385 65:50:50 .Mm

Amev <2: .55: 0:055: 32.355:

.38 9:2 .580 .38 0:7: .28 $25 32:.

:8 :50 .7:< .580 .5585 .88 .7.: 58:0: :0: :05
88 9:2 .09: .0052 .88 3:25 2:28: 25:238. 25:

338 :5 .2858: .825:

33.8 5:: 5m: .5328 £882.80
:8 Q75: :50 .0752 98 .285 $038.5: .52:
a8 :2: .3: .0705: .02: a8 <2:

28405.2 .332

:8 52:: 52:52.: 523585
88 :50 .550 52:2 .88 :7: .05
.0 a8 25:? d 7.: .50.: .38 0::

A28 N< 85:00:55: 00350 8.05.:
.68 285., .7.:

3550552830052

385028 5-2.82
0:0:

2.00 «m0_:5:0

5:08 88 3.22:... 2:2: :25:
99.: £00 3.23:0 5855: 5:5:

88 32:5:

A2m<:v "£00 205:: 5005: 53:: 5:5:
625:: 2.8
205:: £005: .005 5:053: 5:5:

£00 2052 500.5

12

 

at 9&2

as vim .Egmé £52

38 V2 .3. Jam 5: £52

5 68 Biz .mmao $22 ”a .85
as 3.7: .3.

2.22 3.53 $355 .8595
$8 mudz mama

.83 <5. Bugging
.83 53>.onan

SE .1: .24 .38 2,336
5 68 GE 3.8% is

$8 m2
5% 7d .39: an: .32“.

mowasnohoafi fivem 3<M
£8 23025:. TE

£3 23028:. ROD SE5:

13

 

 

 

 

    
 
  

Mm

\\

‘ A;
s’ m [MEKKSfiVIEKKZIIi .v@

 

,—

COX-2 gene

CRE-2 NF-KB C/EBP AP-l CRE-l/E-box

   

Figure 5. Schematic representation of COX-2 gene induction signaling pathways.

14

2.1. Transcriptional Regulation of COX-2 in Fibroblasts

COX-2 expression is upregulated in murine NIH 3T3 fibroblast lines in response
to fetal calf serum, PDGF, PMA, v-src (31, 32, 71), IL-lB, TNFa, PGEz, and PGE3
(Table II) (34). v-Src oncogene-induced COX-2 expression in NIH 3T3 cells is
mediated mainly by CREB and AP-l transcription factors working through CRE-l. AP-
1 activity at the CRE-1 is modulated by the Ras/MEKK-l/JNKK(MKK4)/JNK pathway
leading to c-Jun phosphorylation and the Ras/Raf-l/MAPKK/ERK1/2 pathway that
activates secondary response genes such as c-fos that form heterodimers with c-Jun (31,
71). In addition to the CRE-1 site, there is an E-box element within the mCOX-2
promoter that is also required for v-src-induced COX-2 expression in NIH 3T3
fibroblasts. Serum, PGEz and PGE3 also induce COX-2 mRNA through Ras/JNK- and
Ras/ERK-mediated signaling pathways (34). Transcriptional activation of COX-2 by
serum, PGEz, and PGE3 requires a C/EBP site and the CRE-l site; however, the NF-KB
site and E-box element are not involved. This indicates that COX-2 gene activation is
moderated by distinct combinations of cis-regulatory elements and trans-acting factors
that are specific for different stimuli.

Human foreskin fibroblasts (HFF) express COX-2 protein after 2 hrs of PMA
treatment and the protein level increases over a 4 hr period (35). In contrast, serum-
treated NIH 3T3 fibroblasts exhibit more transient COX-2 expression lasting just 2 hrs.
COX-2 transcriptional activation in PMA-treated HFF is through the CRE-1 and the
C/EBP element. In the basal state, C/EBP5 binds to both the C/EBP site and the CRE-l.
In response to PMA, C/EBPB at the C/EBP site is replaced by C/EBPB, C/EBPB-LAP
(activating form) or C/EBPB-LIP (inhibitory form); binding of C/EBP8 to the CRE-1 site

is unchanged even after 4 hr of stimulation. PMA stimulation induces COX-2 gene

15

expression in HFF cells by reducing C/EBP8 protein levels and increasing C/EBPB
phosphorylation which enhances its DNA binding affinity and increases C/EBPB-LAP
binding to the C/EBP element. These changes lead to recruitment of the coactivator
p300 to the transcriptional machinery to initiate transcription.

PMA treatment of HF F also induces the binding of the c-Jun/c-fos heterodimer to
the CRE-l site. Stimulation by TNFa relies upon the inducible binding of the p65/p50
heterodimer to the NF-kB site (36-38). The CRE-1 motif is also bound by
CREBZ/ATF 2 transcription factors; however, their recruitment to the COX-2 promoter
does not depend upon PMA or TNFa stimulation. In addition to PMA and TNFa, IL-lB
and LPS can induce COX-2 expression in HFF.

p300 is the predominant transcriptional coactivator in HFF with CBP being
barely detectable (36). p300 and PCAF (p300/CBP associated factor) are recruited by
transcription factors that are bound to their cognate cis-elements within the COX-2
promoter. p300 and PCAF direct gene expression by acetylating nearby histone tails
leading to a “loosened” chromatin structure that is more accessible to transactivators.
HDAC-l (histone deacetylase-l), on the other hand, cleaves acetyl moieties from histone
tails and thus negatively regulates COX-2 expression. A balance between acetylation
and deacetylation is required to maintain COX-2 expression at physiologically relevant
levels.

IL-la induces COX-2 expression in human intestinal myofibroblasts (39).
Activation of protein kinase C (PKC), NF-KB, ERK-l/Z, and INK are all required for
optimal COX-2 transcriptional activation whereas p38 activation is involved in the
stabilization of COX-2 mRNA. COX-2 mRNA levels increase after 1 hr of IL-la

treatment, peak after 8 hr and then remain the same for the next 16 hr. COX-2 protein

16

expression is observed after 4 hr of IL-la stimulation and is maximal at 16-24 hr. In
contrast, with serum induction, COX-2 mRNA levels decrease to baseline after 4 hr.

In human synovial fibroblasts, IL-lfi treatment also results in prolonged
expression of COX-2 which is mediated by mRNA stabilization involving p38 MAP
kinase (40). IL-la stimulation induces binding of p65/p50 to the NF-KB motif and of
AP-l/ATF transcription factors to the CRE-1 while binding of nuclear proteins to the

C/EBP site is not inducible.

2.2. Transcriptional Regulation of COX-2 in Endothelial Cells

LPS and PMA act synergistically to induce COX-2 mRNA in bovine arterial
endothelial cells (BAECs) (72). This COX-2 transcriptional activation is mediated by
the NF-KB and C/EBP elements and unlike in fibroblasts, the CRE-1 motif appears not to
be required. However, the CRE-1 element is required for COX-2 induction when
C/EBP6 is activated independently (i.e. by transfection), suggesting that there is an
interplay between the CREB and C/EBPS transcription factors bound to their cognate
sites during COX-2 gene activation.

COX-2 expression and prostaglandin synthesis in human umbilical vein
endothelial cells (HUVEC) can be stimulated by physical stimuli and by agents, such as,
PMA, IL-lB, TNF-0L, LPS, vascular endothelial growth factor (VGEF), thrombin,
hypoxia, vanadate (an inhibitor of protein-tyrosine phosphatases), cholesterol deprivation
and platelet-derived thromboxane A2 (Table II) (42-47). Hypoxia causes increased
binding of p65 to the proximal NF-KB site of the COX-2 promoter in HUVEC without
influencing the levels of cytoplasmic p65 or IKBa, an inhibitory protein that binds

cytoplasmic p65/p50. Promoter deletion analysis implicate other regulatory cis-

17

elements and their cognate transcription factors such as C/EBP, AP-l, and the CRE-l/E-
box in this response, however their roles in this system have yet to be determined.
Hypoxic HUVEC also exhibit nuclear localization of Spl while Sp3 protein levels are
unaffected, thus elevating the Spl/Sp3 ratio in the nucleus. Spl and Sp3 protein bind to
the SP1 motif in the COX-2 promoter and mediate COX-2 transcription (42). High '
concentrations of cholesterol down regulate COX-2, whereas cholesterol deprivation
upregulates COX-2 gene expression in endothelial cells. Cholesterol-dependent COX-2
regulation is mediated by sterol response element binding protein (SREBP) through an

SRE located at -422 from the transcription start site (45).

2.3. Transcriptional Regulation of COX-2 in Smooth Muscle Cells

Bradykinin (BK) binds to specific cell surface G protein-coupled receptors and
induces COX-2 expression in human pulmonary artery smooth muscle cells (HPASMC)
(48). COX-2 mRNA increases 2 fold after 1 hr of BK treatment and returns almost to
basal levels within 4 hrs indicating that COX-2 gene activation is transient in this system.
BK-induced COX-2 expression is transcriptionally regulated by CREB binding to the
CRE-1 motif. COX-2 transcription is also activated by cytosolic phospholipase A2
(cPLA2)-mediated arachidonic acid release and an autocrine loop involving the action of
endogenous PGEz on Gs-linked EP2 and EP4 receptors (48, 50). BK activates IL-IB
mRNA expression in human lung fibroblasts by activating NF «B, and in HeLa cells BK
activates C/EBP during IL-8 gene expression. However, COX-2 gene activation by BK
in HPASMC does not involve either the NF-KB or C/EBP motifs. Thus, BK can induce
transcription in a gene- and transcription factor-specific manner.

BK and IL-lB activate COX-2 expression in human airway smooth muscle cells

18

(HASM) in a stimulus-specific manner (50). BK induces COX-2 protein expression
more quickly (1 hr) than does IL-IB (2 hr). BK induction is also more transient — COX-
2 protein disappears within 16 to 24 hrs. With IL-lB-stimulated COX-2 protein can be
sustained beyond 24 hrs. Both stimuli involve CREB, but not c-Jun binding to the
CRE-1 element. However, IL-1 [5 induced COX-2 transcription requires two other cis-
elements, the NF-KB and the C/EBP sites, for maximal COX-2 gene expression. COX-2
transcriptional regulation by BK and IL-lB involving different sites in the COX-2
promoter may due to the different chromatin structure resulting from different patterns of
histone modification (50, 73).

While NSAIDs inhibit COX activity, there has been speculation that they induce
COX-2 expression in HASM (51). Indomethacin, flurbiprofen, NS-398 (a selective
COX-2 inhibitor) and lSd-PGJZ induce COX-2 expression and enhance IL-lB-induced
COX-2 expression through the peroxisome proliferator response element (PPRE) in the
COX-2 promoter. NSAID treatment causes nuclear translocation of PPARy but not NF -
KB in HASM cells. PPARy binds to the PPRE of the COX-2 promoter and can

transactivate the gene.

2.4. Transcriptional Regulation of COX-2 in Epithelial Cells

In contrast to what is reported for NSAID-treated smooth muscle cells, PPARy
ligands such as ciglitazone and lSd—PGJz inhibit PMA-mediated induction of COX-2 in
human mammary epithelial cells (184B5/HER) (52). PMA-stimulated COX-2 induction
in these cells is mediated by the CRE-1. PMA treatment leads to c-Jun, c-Fos, and ATF-
2 binding to the CRE-1 site; this can be prevented by PPARy ligands by inhibition of AP-

1 activity. PMA treatment activates PKC, ERK-U2, p38, and JNK signaling pathways

19

in human mammary epithelial cells. Activated ERK-1/2 induces c-fos expression, p38
phosphorylates ATF-2 and ATF-2 dimerizes with c-Jun and induces more c-Jun
expression. Activated JNK both induces c-Jun expression and phosphorylates c-Jun,
allowing it to activate the COX-2 gene expression. PMA-induced COX-2 transcription
in this system also requires a functional CBP/p300 coactivator complex having HAT
activity. Retinoic acid (RA) and other nuclear receptor ligands, and carnosol, a phenolic
antioxidant isolated from rosemary oil, suppress PMA-mediated COX-2 transcription.
RA is thought to downregulate COX-2 expression by a receptor-dependent mechanism
whereby the ligand-bound receptor complex sequesters the CBP/p300 that is available for
AP-l mediated induction of COX-2. Carnosol reduces binding of AP-l to the CRE-1
element by inhibiting PKC, ERK1/2, p3 8, and JNK signal transduction pathway (74).
Helicobacter pylori and PMA stimulate transient COX-2 transcription (1.5 hr to
4.5 hr afier stimulation) in human gastric epithelial cells (hGECs) through the CRE-l/E-
box, but not via the C/EBP, AP-l or NF-KB sites (53). Helicobacter pylori activates the
MEK-U2 kinase cascade, which in turn activates CREB and USF-l/2 transcription
factors. Unlike in PMA-stimulated HER cells, in hGECs CREB protein but not c-Jun
binds to the CRE-1 site. USF-l/2 binds to the E-box and activates COX-2 gene
transcription. Helicobacter pylori treatment does not require any cis-regulatory element
other than the CRE-l/E-box element. Whether there are interactions between CREB

and USF-l/2 transcription factors bound to this site remains to be determined.

2.5. Transcriptional Regulation of COX-2 in Granulosa Cells
Prostaglandins play important roles in several aspects of female reproduction.

For example, follicular prostaglandin levels increase dramatically prior to ovulation (75)

20

and NSAIDs such as indomethacin block ovulation (75). COX-2 deficient female mice
are infertile because of problems with ovulation, fertilization, implantation and
decidualization (76). ‘

COX-2 is induced by gonadotropins in granulosa cells prior to ovulation, and
also by forskolin, follicle-stimulating hormone (FSH), luteinizing hormone (LH), and
phorbol didecanoate all acting through the protein kinase A (PKA) signaling pathway
(54-58). The duration of COX-2 induction in granulosa cells varies from 2-4 hr in rats
to 18-30 hr in cows and mares. Bovine and rat COX-2 promoter analyses revealed that
the proximal 150-200 bp upstream of the transcriptional start site is sufficient to confer
inducible promoter activity. This region of the COX-2 promoter contains the C/EBP,
CRE-1 and E-box elements, and mutational analyses have suggested that only the E-box
element is required for promoter activity in rat granulosa cells but that both the C/EBP
and E-box elements are required in bovine granulosa cells. Supershifi EMSAs have
established that USP -1 and USF-2 bind to the E-box element of both the bovine and the
rat COX-2 promoters and that gonadotropin treatment has no effect on the binding of
protein complexes to the E-box. In contrast, C/EBPB binds to the bovine C/EBP site in
the absence of stimulation and gonadotropin treatment decreases C/EBPB binding.
However, in rat granulosa cells, there is no C/EBPB binding to the C/EBP site prior to
treatment but C/EBPB binding rapidly increases upon treatment with gonadotropin (57,
58). This difference may explain the molecular basis for the variation in the duration of
COX-2 expression among species.

Recent studies have indicated that phosphorylation of USF is involved in the
regulation of COX-2 promoter activity in granulosa cells (77). PKA-mediated USF

phosphorylation increases USF binding to the E-box promoter element thereby enhancing

21

COX-2 promoter activity. In contrast, activation of the PKC pathway with PMA had no
stimulatory effect on the COX-2 promoter. Thus, activation of the cAMP/PKA pathway
by luteinizing hormone and consequent phosphorylation of USF proteins that bind to the

E-box appears to be essential for induction of COX-2 in granulosa cells.

2.6. Transcriptional Regulation of COX-2 in Bone

COX-2 plays a significant role in bone resorption and formation. The
regulation of COX-2 expression has been extensively studied in MC3T3-El osteoblasts.
MC3T3-E1 cells established from newborn mouse calvaria, have the capacity to
differentiate into osteoblasts and osteocytes and to form calcified bone tissue in vitro.
COX-2 can be up-regulated by many stimuli in MC3T3-E1 cells including BMP-2, bFGF,
EGF, TGF-a/B, IL-l, TNF-a, PTH, thrombin, bradykinin, forskolin, epinephrine, and
prostaglandins (PGIz, PGEz, PGan) or their stable analogues (Table II) (14, 59-63).

TNF-a treated MC3T3-El cells exhibit a triphasic change in COX-2 mRNA
expression. There is an initial increase that reaches a maximum 2 hr after TNF-a
stimulation. This is followed by a decrease at 3 hr, and then a second increase in COX-
2 mRNA at 6-12 hr. The second increase is due to PGEz produced by the COX-2
formed in the first phase (62). Binding of p65/p50 to the NF -1(B site and C/EBPB to the
C/EBP-l site at 1 hr are necessary for TNF-a induced COX-2 expression in MC3T3-El
osteoblasts. However, different transcription factors and cis-elements may be involved
during the first and second increases in COX-2 transcription.

bFGF, PDGF, PGEz or a combination of TNF-a and IL-lB stimulation causes
after 4 hr the activation of c-Jun, MEKK and JNK signaling pathways in MC3T3-E1 (60).

Promoter analysis identified a second C/EBP motif in the murine COX-2 promoter that is

22

required together with the C/EBP-l site for optimal promoter activity. C/EBPB and
C/EBP8 transactivate murine COX-2 gene expression via C/EBP sites. The CRE-1
element is necessary for COX-2 transcriptional activity while neither the NF-KB site as
the E-box are not required for bFGF, PDGF, PGEZ, or TNFa+IL-IB induced COX-2
expression in MC3T3-El osteoblasts.

When MC3T3-El cells are treated with PMA or serum for 3 hr, the -371/+70
region of the COX-2 promoter, which does not include the CRE-2 or the NF-KB sites, is
sufficient to activate COX-2 transcription (63). PMA or serum treatments cause inducible
binding of c-Jun and c-fos to the AP-l site and constitutive binding of nuclear protein to
the CRE-1 site. This suggests that there is a cooperative interaction between
transcription factors bound to the AP-l site and the CRE-1 in trans-activating COX-2
transcription. The CRE-1 site is quantitatively more important for the serum response
and the AP-l site is more important for the PMA response (63).

Mechanical loading is crucial for maintaining bone mass and integrity. This
generates extracellular matrix deformation and fluid flow. Mechanical stimuli such as
loading and fluid shear stress cause the production of signaling factors. In bone forming
cells, prostaglandins are formed that modulate the overall process of bone metabolism.
Fluid sheer stress induces COX-2 expression through a process involving the activation
of a cytoskeleton-associated Ca2+ channel, phospholipase C, PKA, PKC and
phospholipase A2 (78, 79). COX-2 mRNA levels increase after 1 hr of fluid sheer stress
and show a sustained increase for up to 9 hr of treatment. Sustained COX-2 gene
activation likely occurs via the PKA pathway. The CRE-2, NF-KB, C/EBP-2 and E-box
appear not play roles in fluid sheer stress-mediated COX-2 transcription in MC3T3-El

cells. Instead, the process involves the C/EBP-l site bound inducibly by C/EBPB, the

23

AP-l element bound inducibly by c-Jun/AP-l transcription factors, and the CRE-l
constitutively bound by CREB. This is similar to the mechanisms by which PMA and

serum induce COX-2 gene activation.

2.7. Transcriptional Regulation of COX-2 in Monocytes/Macrophages

Monocytes/macrophages are crucial to the development of the immune response
because of their ability to present antigens and secrete mediators of inflammation
including cytokines and prostaglandins. These products regulate cell proliferation,
differentiation, and, in general, the acquisition of immune functions. Regulation of
prostaglandin synthesis in monocytes is important in immune responses

Inflammation is a nonspecific response of the immune system to damaged cells
and is characterized by redness, pain, heat and swelling of tissue (80). Although there
are many components to inflammation, prostaglandin E2 (PGE2) is known to be highly
associated with inflammation which is substantially reduced by NSAIDs. PGE2 acts as
vasodilator allowing more blood to flow through affected tissues, and the increased blood
flow generates the heat and redness of inflammation. Prostaglandins play a direct role
in sensing pain, and also cause the emigration of phagocytes through capillary walls.

LPS, also known as lipopolysaccharide or endotoxin, is an outer membrane
constituent of Gram-negative bacteria such as E. coli and a potent activator of innate
immune responses that result in the production of pro- and anti-inflammatory mediators.
The LPS molecule that constitutes the outer layer of the outer membrane is composed of
a hydrophobic region, called Lipid A, which is attached to a hydrophilic linear
polysaccharide region, consisting of the core polysaccharide and the O-specific

polysaccharide (Fig. 6A). The Lipid A head of the molecule is the toxic component and

24

\
/hll|an—Abe\ ‘
l '3'“ l > O-antigen
\fial /n J
(lilu—GluNAc \
Cal
glu— Gal
".‘ep > Core
Hep
Ho 9 Koo—Koo ,

110' P\ O

;> Lipid A

 

 

l
l
f

 

 

 

) TLM

/‘\/‘\

Figure 6. Chemical structure of lipopolysacchride (LPS) and a diagram of the
LPS receptor. A. Bacterial LPS is composed of a hydrophobic domain known as lipid
A (endotoxin), a nonrepeating core oligosaccharide, and a distal polysaccharide (0-
antigen). B. Components of toll—like-receptor—4 (TLR4) complex. CD14 is a
glywsf,‘ ,L 16.," " ‘ (GPI) anchored, high-affinity membrane protein that also
exists in a soluble form and concentrates LPS for binding to the TLR4-MD2 complex.
LRR, leucine-rich repeats; HYP, hypervariable region. Figure adapted from Miller et.
al. (81)

25

the O-specific polysaccharide provides ligands for bacterial attachment and confers some
resistance to phagocytosis (82, 83). While there are many agents that can trigger the
synthesis of COX-2, LPS attracts much attention because over-reaction to LPS can
provoke life-threatening conditions such as septic shock or the systemic inflammatory
response syndrome.

LPS is recognized by Toll-like receptor-4 (TLR4), a member of TLR family, that
is defined by having a conserved cytosolic region termed the Toll-IL-l receptor (TIR)
domain (Fig. 6B) (84). TLRs are crucially involved in the innate immune response to
microbes. This is accomplished by sensing pathogen-associated molecular patterns such
as LPS (TLR4), peptidoglycan (TLR2), ds RNA (TLR3), and CpG DNA (TLR9), which
are also inducers for COX-2. TLRs activate signaling pathways that are critical for
induction of the immune response such as releasing TNF-a, IL-IB and prostaglandins in
macrophage and monocyte cells (85).

LPS forms a complex with LPS-binding protein (LBP) and this complex interacts
with the monocyte differentiation antigen CD14 (Fig. 7) (84, 86, 87). The binding of
the LPS/LBP complex to CD14 and the TLR4-MD2 complex induces receptor
dimerization. Ligand binding to the extracellular domain of TIR domain-containing
receptors results in the recruitment of soluble adapter molecules including myeloid
differentiation factor (MyD88), IL—lR associated kinase (IRAK), Toll/IL-IR domain-
containing adaptor inducing IFN-B (TRIF; TICAM-l) and TRIP-related adaptor molecule
(TRAM/TICAMZ/TIRP) to its intracellular TIR domain. TLR4 signaling consists of
two distinct pathways (Fig. 6 & 7). The MyD88 dependent pathway leads to the
production of inflammatory cytokines, and the MyD88 independent (TRIP-dependent)

pathway is associated with the stimulation of IFN-B and the maturation of dendritic cell

26

  
 
 

 
   

iilnlitiii"

* u;.;. w.- 5 . .
ll:r...~§~:»:::l.!.-:-:»

  
    

MyD88 dependent
pathway

MyD88 independent
pathway

Figure 7. Toll-like receptor 4 signal transduction pathways.

There are two groups of TLR4 signaling pathways based on their use of TLR adaptors.
A. MyD88 independent pathway which leads to inductioin of IFN-B, IFN-inducible
genes, and maturation of dendritic cells with delayed activation of NF—KB and MAPK.
B. MyD88 dependent pathway which leads to pro-inflammatory cytokine production
including prostaglandins, TNF-a, IL-6, and IL—12 with early activation of NF-KB and
MAPK.

27

(88).
MyD88 contains both a TIR domain and a death domain. When associated with

a TLR, MyD88 recruits IRAK through death domain-death domain homophilic
interactions. IRAK is a serine-threonine kinase involved in the phosphorylation and
activation of TNF receptor associated kinase-6 (TRAP-6), and the TRAP-6 recruits
evolutionarily conserved intermediate in toll (ECSIT) signaling factor (84, 87) leading to
activation of a MAPK kinase kinase (MAPKKK), MEKK-l and TGFB-activated kinase
(TAK-l). Activated MEKK-l and activated TAK-l phosphorylate MAPK kinases,
MKK1/2, MKK4/7 and MKK3/6, which in turn, activate ERK1/2, JNK and p38 MAPKs
(Fig. 5). TRAP-6 and TAK-l also activate the IKBa kinase complex (IKK) through NF-
KB inducing kinase (N 1K), leading to NF-KB activation (84).

Another signaling pathway, the MyD88-independent pathway involving
TRIF/TRAM adaptor proteins leads to delayed NF-KB activation (88, 89). TRIF also
induces the activation of the transcriptional regulator, IFN regulatory factor (IRF)-3 and
the expression of IFN-B and IFN-inducible genes through the activation of TANK-
binding kinase (TBK)1 and IKKe (Fig. 7) (90). In RAW 264.7 macrophages, activated
MAP kinases and NIK up-regulate COX-2 expression as well as expression of other pro-
inflammatory cytokines (85).

Human U937 monocytic cells undergo morphologic and functional changes and
differentiate to macrophage-like cells when treated with PMA. U937 cells do not
express COX-2 mRNA or protein in the undifferentiated state, but during differentiation,
low levels of COX-2 are expressed. COX-2 is further induced by inflammatory stimuli
such as LPS, TNF-a or IL-1 (Table II) (64). LPS-induced COX-2 expression in U937

cells involves CRE-1, C/EBP and the downstream NF-KB elements.

28

Platelet microparticles (MP), formed by platelet activation, activate the COX-2
gene expression and lead to prostaglandin production in U937 cells (65). MP activates
PI-3-kinase resulting in the transient activation of several PKC isoforms (PKC-B/S/Ult),
ERK-U2, p42/p44 MAPK, p38, and the sustained activation of JNK-1 as well as
activation of c-Jun and Elk-1 transcription factors. Curiously, MP-induced COX-2
expression does not involve the CRE-1 motif.

Prostaglandins also play a role in complications of diabetes such as
hyperglycemia, accelerated atherosclerotic and inflammatory disease, oxidant stress and
glycation products (AGES) (66, 67, 91). High glucose (HG) and AGE treatment of
THP-l monocytic cells, which are similar to U937 monocytes, lead to a significant
increase in COX-2 mRNA and protein. The increase in COX-2 mRNA is predominantly
due to transcriptional upregulation (67). AGES act via RAGE (receptor for AGE) and
AGES and SIOOb, a specific ligand for RAGE, activate multiple signaling pathways
including those involving p3 8, MEK/ERK, oxidant stress, PKC, and NF-KB; however, the
JNK pathway is not activated in THP-1 cells in response to AGES (91). Interestingly,
AGES and SIOOb induce COX-2 via the distal NF-KB site (-455/-428) while HG induces
COX-2 transcription via the proximal NF-KB site (-232/-205) (66).

HG treatment of THP-l monocytes activates PKC and the p38 MAPK pathway
but not the ERK or JAK-STAT pathways. HG-induced COX-2 expression requires the
CRE-1 element and activation of the CREB transcription factor as well as NF-KB
activation (66). The association of CBP/p300, p/CAP (p300/CBP associated protein)
and NF-KB transcription factor with the COX-2 promoter were evaluated by chromatin
immunoprecipitation assays (ChIPs) with HG treated THP-1 cells (67). CBP, p/CAP,

and p65 are recruited to the COX-2 promoter sequentially. p65 and CBP association

29

occurs after 16 hr of HG treatment, peaks after 24 hr, and decreases at 48 to 72 hr.
p/CAP and p50 are recruited to the COX-2 promoter in parallel and appears as early as 16
hr after HG stimulation, increasing over time, and remaining at 72 hr. The
transcriptional repressor, HDAC-l is associated with the COX-2 promoter under basal
conditions. After HG treatment, the association decreases with time as the binding of
CBP increases. This suggests that recruitment of activated transcription factors such as
p65 to the COX-2 promoter after HG stimulation in THP-l monocytes is enabled by
dissociation of HDAC-l from the promoter.

The murine macrophage cell line RAW 264.7 has been used extensively as a
model for examining macrophage activation and the inflammatory response. Various
inflammatory mediators and cytokines, catalase, peptidoglycan (a cell wall component of
gram-positive bacteria), double-stranded RNA, viral infection, and LPS stimulation cause
COX-2 induction and prostaglandin formation in RAW 264.7 macrophages (14, 68-70).

It has been shown that COX-2 induction in LPS-stimulated RAW 264.7 cells
consisting of an early phase of rapid induction of COX-2 mRNA expression after 1 hr of
LPS-treatment followed by a phase of sustained mRNA expression (92). These authors
also suggested that these different phases of mRNA expression required different sets of
transcriptional activators. Consistent with this idea, the early phase of COX-2
expression was shown to be independent of de novo protein synthesis, whereas in the
second phase, synthesis of C/EBP8 was required. Furthermore, a C/EBPB homodimer
was bound to a C/EBP element in the initial phase while a C/CBPB-S heterodimer bound
to the C/EBP element during the second phase (92, 93). It has also been demonstrated
that CREB and NF-KB are important in LPS-induced COX-2 transcription in RAW 264.7

cells. Taken together, these studies suggested that the NF-KB and C/EBP sites and the

30

CRE-l are important for regulating COX-2 transcription in LPS-stimulated macrophages
and that COX-2 transcription in this system consists of several phases that lead to
persistent gene activation.

Using nuclear run-on assays and northern blot analyses we have shown recently
that COX-2 gene transcription is rapidly increased and sustained during the 12 hr after
LPS stimulation in RAW 264.7 cells (unpublished data). These findings indicate that
COX-2 is mainly regulated at the transcriptional level in this system. In addition to a
previously identified CRE-1, we identified a second functional cAMP response element
(CRE-2) within the COX-2 proomoter. The CRE-2 is constitutively bound by CREB.
On the other hand, the p65/p50 heterodimer inducibly binds to the NF-KB site after 1 hr
of LPS treatment but after 4-12 hr is replaced by p50 homodimer (unpublished data).
Thus, it is possible that the p65/p50 heterodimer together with CREB is required to
initiate COX-2 gene transcription, and the p50 homodimer together with CREB is
required to sustain the activation by interacting with a different set of transcriptional
coactivators. It will be important to determine if there is a cooperative interplay
between the factors bound to the CRE-2 and the NF -1<B site in the COX-2 gene promoter.

We also found that an AP-l element is required for optimal induction of COX-2
in LPS-stimulated RAW 264.7 cells. Consistent with what has been observed in PMA-
treated MC3T3 cells, the CRE-1 site is constitutively bound by CREB/ATF transcription
factor family members and the AP-l element is inducibly bound by phosphorylated c-Jun
and c-fos in the initial phase and by phosphorylated c-Jun dimers at the late phase of
COX-2 transcription in LPS-treated RAW 264.7 macrophages (unpublished data). It is
clear that COX-2 gene transcription is activated through multiple redundant mechanisms

by LPS in macrophages.

31

 

3. COX protein degradation

COX-1 and COX-2 have very different rates of degradation. COX-1 is very
slowly degraded whereas COX-2 protein degredation varies from 2-24 hr depending on
the cell type (94). Thus, COX-1 protein is more stable even though both isoforms have
very similar structures. The mechanism of COX-1 enzyme degradation has not been
studied. It has been reported that COX-2 protein is ubiquitinated and degraded by the
26S proteasome in the cytoplasm in certain cell types including colon carcinoma cells
and mouse neuronal cells (94-96). The 26S proteasome degrades misfolded or
structurally damaged ER proteins by unfolding and translocating ubiquitinated targets
into the interior of the proteasome complex (97). It is likely that both COX-1 and COX-
2 enzymes can be degraded via the ER-associated degradation (ERAD) pathway
involving retrograde movement of the enzymes from the ER into the cytoplasm because
both isoforms are located and associated monotopically with the luminal faces of the
endoplasmic reticulum membrane, the inner nuclear membrane, and the outer nuclear
membrane (97-104).

The molecular basis for the differences in stabilities of COX isoforms is
unknown. It is possible that COX-2 is transported into the ERAD pathway by virtue of
its having specific markers that are absent from COX-l (105, 106). AS noted earlier, the
most obvious structural difference between COX-1 and COX-2 is the 18 amino acids
cassette unique to COX-2 (Fig.1).

In addition, the binding of nonsteriodal anti-inflammatory drugs (NSAIDs) or
COX-2 inhibitors retards COX-2 but not COX-1 protein degradation (unpublished data).
This stabilization of COX-2 is consistent with formation of a more compact, ERAD-

resistant form of the enzyme. Alternatively, NSAIDS may protect COX-2 by preventing

32

catalysis.

33

 

Concluding Remarks

Regulation of COX gene expression is a complex process that varies in different
cell types and even between the same cell types in different species. COX-1 and COX-2
genes are activated by a wide variety of stimuli acting through numerous signaling
pathways and the relative contribution of each depends upon the stimulus, the cell type,
and the time of stimulation. These factors and conditions determine which transcription
factors are associated with the COX response elements. Although we now have a
general understanding of the factors involved in COX-2 gene regulation, the interplay

between the various regulatory transcription factors remains to be elucidated.

34

References

Narumiya, S., and G A. FitzGerald. 2001. Genetic and pharmacological analysis
of prostanoid receptor function. Journal of Clinical Investigation 108:25.

Dubois, R. N., S. B. Abramson, L. Crofford, R. A. Gupta, L. S. Simon, L. B. Van-
De-Putte, and P. E. Lipsky. 1998. Cyclooxygenase in biology and disease [see
comments]. The FASEB Journal 12:1063.

Warner, T. D., and J. A. Mitchell. 2004. Cyclooxygenases: new forms, new I
inhibitors, and lessons from the clinic. Faseb J 18:790. 4.

Murakami, M., C. O. Bingham, 3rd., R. Matsumoto, K. F. Austen, and J. P. Arm.
1995. IgE-dependent activation of cytokine-primed mouse cultured mast cells
induces a delayed phase of prostaglandin D2 generation via prostaglandin
endoperoxide synthase-2.1 Immunol. 155:4445.

Matijevic-Aleksic, N., S. K. Sanduja, L. H. Wang, and K. K. Wu. 1995.
Differential expression of thromboxane A synthase and prostaglandin H synthase
in megakaryocytic cell line. Biochemica et Biophysica Acta I 269:] 6 7.

Ueda, N., R. Yarnashita, S. Yamamoto, and K. Ishimura. 1997. Induction of
cyclooxygenase-1 in a human megakaryoblastic cell line (CMK) differentiated by
phorbol ester. Biochim Biophys A cta 1 3 44 :1 03.

Smith, W. L., and D. L. Dewitt. 1996. Prostaglandin endoperoxide H synthases-l
and ~2. Adv Immunol 62:167.

Smith, W., D. DeWitt, and R. Garavito. 2000. Cyclooxygenases: structural,
cellular, and molecular biology. Annu Rev Biochem 69:145.

Smith, W. L., and D. L. DeWitt. 1995. Biochemistry of prostaglandin
endoperoxide synthases-l and -2 and their differential suceptibility to nonsteroidal
anti-inflammatory drugs. Seminars in Nephrology 15:1 79.

35

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

Smith, W. L., D. L. DeWitt, and R. M. Garavito. 2000. Cyclooxygenases:
Structural, Cellular and Molecular Biology. Annu. Rev. Biochem. 69:149.

Funk, C. D. 2001. Prostaglandins and leukotrienes: advances in eicosanoid
biology. Science 294 :1 871 .

Yokoyama, C., and T. Tanabe. 1989. Cloning of the human gene encoding
prostaglandin endoperoxide synthase and primary structure of the enzyme.
Biochemical and Biophysical Research Communications 1 65:888.

Kraemer, S. A., S. A. Meade, and D. L. DeWitt. 1992. Prostaglandin endoperoxide
synthase gene structure: identification of the transcriptional start Site and 5'-
flanking regulatory sequences. Archives of Biochemistry and Biophysics 293 :391 .

Tanabe, T., and N. Tohnai. 2002. Cyclooxygenase isozymes and their gene
structures and expression. Prostaglandins Other Lipid Mediat 68-69: 95.

Wang, L., A. Hajubeigi, X. Xu, D. Loose-Mitchell, and K. K. Wu. 1993.
Characterization of the promoter of human prostaglandin H synthase—1 gene.
Biochemical and Biophysical Research Communications 1 90:406.

Smith, C. J ., J. D. Morrow, L. J. Roberts, and L. J. Mamett. 1993. Differentiation
of monocytoid THP-1 cells with phorbol ester induces expression of
prostaglandin endoperoxide synthase-1 (Cox-l). Biochemical and Biophysical

Research Communications 192: 787.

Xu, X. M., J. L. Tang, X. Chen, L. H. Wang, and K. K. Wu. 1997. Involvement of
two Spl elements in basal endothelial prostaglandin H synthase-1 promoter
activity. Journal of Biological Chemistry 272: 6943.

Okahara, K., B. Sun, and J. Kambayashi. 1998. Upregulation of prostacyclin
synthesis-related gene expression by Shear stress in vascular endothelial cells.

Arterioscler Thromb Vasc Biol 18:1922.

Bogar, L. J ., L. L. Bartula, H. P. Parkman, and S. I. Myers. 1999. Enhanced
bradykinin-stimulated prostaglandin release in the acutely inflamed guinea pig

36

 

20.

21.

22.

23.

24.

25.

26.

27.

gallbladder is due to new synthesis of cyclooxygenase 1 and prostacyclin synthase.

J Surg Res 84:71.

Gibson, L. L., L. Hahner, S. Osborne-Lawrence, Z. German, K. K. Wu, K. L.
Chambliss, and P. W. Shaul. 2005. Molecular basis of estrogen-induced
cyclooxygenase type 1 upregulation in endothelial cells. Circ Res 96:518.

Delong, C. J ., and W. L. Smith. 2005. An intronic enhancer regulates
cyclooxygenase-1 gene expression. Biochem Biophys Res Commun 338: 53.

Smith, W. L., and D. L. DeWitt. 1996. Prostaglandin endoperoxide H synthases-l
and -2. In Advances in Immunology, Vol. 62. F. J. Dixon, ed. Academic Press, San
Diego, CA, p. 167.

Sawaoka, H., D. A. Dixon, J. A. Oates, and O. Boutaud. 2003. Tristetraprolin
Binds to the 3'-Untranslated Region of Cyclooxygenase-2 mRNA. A
POLYADENYLATION VARIANT IN A CANCER CELL LINE LACKS THE
BINDING SITE. J. Biol. Chem. 278:13928.

Kirtikara, K., S. J. Laulederkind, R. Raghow, T. Kanekura, and L. R. Ballou. 1998.
An accessory role for ceramide in interleukin-lbeta induced prostaglandin
synthesis. Mol Cell Biochem [81:41.

Diaz, A., K. P. Chepenik, J. H. Korn, A. M. Reginato, and S. A. Jimenez. 1998.
Differential regulation of cyclooxygenases 1 and 2 by interleukin-1 beta, tumor
necrosis factor-alpha, and transforming growth factor-beta l in human lung
fibroblasts. Exp Cell Res 241:222.

Bryant, C. E., I. Appleton, and J. A. Mitchell. 1998. Vascular endothelial growth
factor upregulates constitutive cyclooxygenase 1 in primary bovine and human
endothelial cells. Life Sci 62:2195.

Kitzler, J ., E. Hill, R. Hardman, N. Reddy, R. Philpot, and T. E. Eling. 1995.
Analysis and quantitation of splicing variants of the TPA-inducible PGHS-1
mRN A in rat tracheal epithelial cells. Archives of Biochemistry and Biophysics
31 6:856.

37

1‘

28.

29.

30.

31.

32.

33.

34.

35.

36.

Schneider, N., S. Lanz, R. Ramer, D. Schaefer, and M. Goppelt-Struebe. 2001.
Up-regulation of cyclooxygenase-1 in neuroblastoma cell lines by retinoic acid
and corticosteroids. J Neurochem 77:416.

Ueda, N., R. Yamashita, S. Yamamoto, and K. Ishimura. 1997. Induction of
cyclooxygenase-l in a human megakaryoblastic cell line (CMK) differentiated by
phorbol ester. Biochemica et Biophysica Acta 1344:103.

Rioux, N., and A. Castonguay. 2000. The induction of cyclooxygenase-1 by a
tobacco carcinogen in U937 human macrophages is correlated to the activation of
NF-kappaB. Carcinogenesis 21 :1 745.

Xie, W., B. S. Fletcher, R. D. Andersen, and H. R. Herschman. 1994. v-src
induction of the TISlO/PGSZ prostaglandin synthase gene is mediated by an

ATF/CRE transcription response element. Molecular and Cellular Biology
1 4: 6531 .

Xie, W., and H. R. Herschman. 1996. Transcriptional regulation of prostaglandin
synthase 2 gene expression by platelet-derived growth factor and serum. Journal
of Biological Chemistry 271 :31 742.

Xie, W., and H. R. Herschman. 1995. v-src induces prostaglandin synthase 2 gene
expression by activation of the c-Jun N-terminal kinase and the c-Jun
transcription factor. J Biol Chem 270:2 7622.

Bagga, D., L. Wang, R. FariaS-Eisner, J. A. Glaspy, and S. T. Reddy. 2003.
Differential effects of prostaglandin derived from omega -6 and omega -3
polyunsaturated fatty acids on COX-2 expression and IL-6 secretion. PNAS
100:1 751.

Zhu, Y., M. A. Saunders, H. Yeh, W. G Deng, and K. K. Wu. 2002. Dynamic
regulation of cyclooxygenase-2 promoter activity by isoforms of

CCAAT/enhancer-binding proteins. J Biol Chem 2 77: 6923.

Deng, W. G., Y. Zhu, and K. K. Wu. 2004. Role of p300 and PCAF in regulating

38

37.

38.

39.

40.

41.

42.

43.

cyclooxygenase-2 promoter activation by inflammatory mediators. Blood
1 03 :21 3 5 .

Deng, W. G, M. A. Saunders, D. W. Gilroy, X. Z. He, H. Yeh, Y. Zhu, M. I.
Shtivelband, K. H. Ruan, and K. K. Wu. 2002. Purification and characterization of

a cyclooxygenase-2 and angiogenesis suppressing factor produced by human
fibroblasts. F aseb J 1 6:1286.

Deng, W. G, Y. Zhu, A. Montero, and K. K. Wu. 2003. Quantitative analysis of
binding of transcription factor complex to biotinylated DNA probe by a
streptavidin-agarose pulldown assay. Anal Biochem 323 :1 2.

Mifflin, R. C., J. I. Saada, J. F. Di Mari, P. A. Adegboyega, J. D. Valentich, and D.
W. Powell. 2002. Regulation of COX-2 expression in human intestinal

myofibroblasts: mechanisms of IL-l-mediated induction. Am J Physiol Cell
Physiol 282:C824.

F aour, W. H., Y. He, Q. W. He, M. de Ladurantaye, M. Quintero, A. Mancini, and
J. A. Di Battista. 2001. Prostaglandin E(2) regulates the level and stability of
cyclooxygenase-2 mRN A through activation of p38 mitogen-activated protein

kinase in interleukin-l beta-treated human synovial fibroblasts. J Biol Chem
276:3] 720.

Inoue, H., C. Yokoyama, S. Hara, Y. Tone, and T. Tanabe. 1995. Transcriptional
regulation of human prostaglandin-endoperoxide synthase-2 gene by
lipopolysaccharide and phorbol ester in vascular endothelial cells. Involvement of
both nuclear factor for interleukin-6 expression site and cAMP response element.
J Biol Chem 270:24965.

Xu, Q., Y. S. J i, and J. F. Schmedtje, Jr. 2000. Spl increases expression of
cyclooxygenase-2 in hypoxic vascular endothelium. Implications for the
mechanisms of aortic aneurysm and heart failure. J Biol Chem 275 :24583 .

Wu, G., A. P. Mannam, J. Wu, S. Kirbis, J. L. Shie, C. Chen, R. J. Laharn, F. W.
Sellke, and J. Li. 2003. Hypoxia induces myocyte-dependent COX-2 regulation in
endothelial cells: role of VEGF. Am J Physiol Heart Circ Physiol 285:H2420.

39

44.

45.

46.

47.

48.

49.

50.

51.

Jones, D. A., D. P. Carlton, T. M. McIntyre, G A. Zimmerman, and S. M. Prescott.
1993. Molecular cloning of human prostaglandin endoperoxide synthase type II

and demonstration of expression in response to cytokines. Journal of Biological
Chemistry 268: 9049.

Smith, L. H., M. S. Petrie, J. D. Morrow, J. A. Oates, and D. E. Vaughan. 2005.
The sterol response element binding protein regulates cyclooxygenase-2 gene
expression in endothelial cells. J Lipid Res 46:862.

Hirai, K., H. Takayama, K. Tomo, and M. Okuma. 1997. Protein-tyrosine-kinase-
dependent expression of cyclo-oxygenase-l and -2 mRNAs in human endothelial
cells. Biochem J 322 (Pt 2) :3 73.

Caughey, G. E., L. G Cleland, J. R. Gamble, and M. J. James. 2001. Up-
regulation of Endothelial Cyclooxygenase-2 and Prostanoid Synthesis by Platelets.
ROLE OF THROMBOXANE A2. J. Biol. Chem. 276:3 7839.

Bradbury, D. A., R. Newton, Y. M. Zhu, H. El-Haroun, L. Corbett, and A. J. Knox.
2003. Cyclooxygenase-2 induction by bradykinin in human pulmonary artery
smooth muscle cells is mediated by the cyclic AMP response element through a

novel autocrine loop involving endogenous prostaglandin E2, E-prostanoid 2
(EP2), and EP4 receptors. J Biol Chem 278:49954.

Bradbury, D. A., R. Newton, Y. M. Zhu, J. Stocks, L. Corbett, E. D. Holland, L. H.
Pang, and A. J. Knox. 2002. Effect of bradykinin, TGF-betal , IL-lbeta, and
hypoxia on COX-2 expression in pulmonary artery smooth muscle cells. Am J
Physiol Lung Cell Mol Physiol 283 :L 71 7.

Nie, M., L. Pang, H. Inoue, and A. J. Knox. 2003. Transcriptional regulation of
cyclooxygenase 2 by bradykinin and interleukin-lbeta in human airway smooth
muscle cells: involvement of different promoter elements, transcription factors,
and histone h4 acetylation. Mol Cell Biol 23: 9233.

Pang, L., M. Nie, L. Corbett, and A. J. Knox. 2003. Cyclooxygenase-2 expression
by nonsteroidal anti-inflammatory drugs in human airway smooth muscle cells:

40

52.

53.

54.

55.

56.

57.

58.

role of peroxisome proliferator-activated receptors. J Immunol 1 70.1043.

Subbaramaiah, K., D. T. Lin, J. C. Hart, and A. J. Dannenberg. 2001. Peroxisome
roliferator-activated receptor gamma ligands suppress the transcriptional
activation of cyclooxygenase-2. Evidence for involvement of activator protein-1
and CREB-binding protein/p300. J. Biol. Chem. 276:12440.

Juttner, S., T. Crarner, S. Wessler, A. Walduck, F. Gao, F. Schmitz, C. Wunder, M.
Weber, S. M. Fischer, W. E. Schmidt, B. Wiedenmann, T. F. Meyer, M. Naumann,
and M. Hooker. 2003. Helicobacter pylori stimulates host cyclooxygenase-2 gene
transcription: critical importance of MEK/ERK-dependent activation of USF1/-2

and CREB transcription factors. Cell Microbiol 5:821 .

Tsai, S. J ., M. C. Wiltbank, and K. J. Bodensteiner. 1996. Distinct mechanisms
regulate induction of messenger ribonucleic acid for prostaglandin (PG) G/H
synthase-2, PGE (EP3) receptor, and PGF 2 alpha receptor in bovine preovulatory
follicles. Endocrinology 13 7:33 48.

Wong, W. Y. L., D. L. DeWitt, W. L. Smith, and J. S. Richards. 1989. Rapid
induction of prostaglandin endoperoxide synthase in rat preovulatory follicles by
luteinizing hormone and cAMP is blocked by inhibitors of transcription and
translation. Molecular Endocrinology 3:1 714.

Sirois, J. 1994. Induction of prostaglandin endoperoxide synthase-2 by human
chorionic gonadotropin in bovine preovulatory follicles in vivo. Endocrinology.
135:841.

Liu, J ., M. Antaya, D. Boerboom, J. G Lussier, D. W. Silversides, and J. Sirois.
1999. The delayed activation of the prostaglandin G/H synthase-2 promoter in

bovine granulosa cells is associated with down-regulation of truncated upstream
stimulatory factor-2. J Biol Chem 274.3503 7.

Sirois, J ., and J. S. Richards. 1993. Transcriptional regulation of the rat
prostaglandin endoperoxide synthase 2 gene in granulosa cells. Journal of
Biological Chemistry 268:2] 931 .

41

59.

60.

61.

62.

63.

64.

65.

66.

Chikazu, D., X. Li, H. Kawaguchi, Y. Sakuma, O. S. Voznesensky, D. J. Adams,
M. Xu, K. Hoshio, V. Katavic, H. R. Herschman, L. G Raisz, and C. C. Pilbeam.
2002. Bone morphogenetic protein 2 induces cyclo-oxygenase 2 in osteoblasts via

a bea1 binding site: role in effects of bone morphogenetic protein 2 in vitro and
in vivo. J Bone Miner Res 1 7:143 0.

Wadleigh, D. J ., and H. R. Herschman. 1999. Transcriptional regulation of the
cyclooxygenase-2 gene by diverse ligands in murine osteoblasts. Biochem
Biophys Res Commun 264:865.

Ogasawara, A., T. Arakawa, T. Kaneda, T. Takuma, T. Sato, H. Kaneko, M.
Kumegawa, and Y. Hakeda. 2001. Fluid shear stress-induced cyclooxygenase-2

expression is mediated by C/EBP beta , cAMP-response element-binding protein,
and AP-l in osteoblastic MC3T3-E1 cells. J. Biol. Chem 276: 7048.

Yamamoto, K., T. Arakawa, N. Ueda, and S. Yamamoto. 1995. Transcriptional
roles of nuclear factor kappa B and nuclear factor-interleukin-6 in the tumor
necrosis factor alpha-dependent induction of cyclooxygenase-2 in MC3T3-E1
cells. Journal of Biological Chemistry 2 70:31315.

Okada, Y., O. Voznesensky, H. Herschman, J. Harrison, and C. Pilbeam. 2000.
Identification of multiple cis-acting elements mediating the induction of
prostaglandin G/H synthase-2 by phorbol ester in murine osteoblastic cells. J Cell
Biochem 78:197.

Inoue, H., T. Nanayama, S. Hara, C. Yokoyama, and T. Tanabe. 1994. The cyclic
AMP response element plays an essential role in the expression of the human
prostaglandin-endoperoxide synthase 2 gene in differentiated U937 monocytic
cells. F EBS Letters 350:51.

Barry, 0. P., M. G. Kazanietz, D. Pratico, and G A. FitzGerald. 1999. Arachidonic
acid in platelet microparticles up-regulates cyclooxygenase-2-dependent
prostaglandin formation via a protein kinase C/mitogen—activated protein kinase-

dependent pathway. Journal of Biological Chemistry 2 74: 7545.

Shanmugam, N., I. T. Gaw Gonzalo, and R. Natarajan. 2004. Molecular

42

67.

68.

69.

70.

71.

72.

73.

74.

mechanisms of high glucose-induced cyclooxygenase—2 expression in monocytes.
Diabetes 53:795.

Miao, F., I. G Gonzalo, L. Lanting, and R. Natarajan. 2004. In vivo chromatin
remodeling events leading to inflammatory gene transcription under diabetic
conditions. J Biol Chem 279:18091.

Jang, B. C., D. H. Kim, J. W. Park, T. K. Kwon, S. P. Kim, D. K. Song, J. G Park,
J. H. Bae, K. C. Mun, W. K. Baek, M. H. Suh, T. Hla, and S. I. Suh. 2004.
Induction of cyclooxygenase-2 in macrophages by catalase: role of NF-kappaB
and PI3K signaling pathways. Biochem Biophys Res Commun 316:398.

Chen, B. C., Y. S. Chang, J. C. Kang, M. J. Hsu, J. R. Sheu, T. L. Chen, C. M.
Teng, and C. H. Lin. 2004. Peptidoglycan induces nuclear factor-kappaB
activation and cyclooxygenase-2 expression via Ras, Raf-1, and ERK in RAW
264.7 macrophages. J Biol Chem 279:20889.

Steer, S. A., J. M. Moran, L. B. Maggi, Jr., R. M. Buller, H. Perlman, and J. A.
Corbett. 2003. Regulation of cyclooxygenase-2 expression by macrophages in
response to double—stranded RNA and viral infection. J Immunol 1 70:1070.

Xie, W., and H. R. Herschman. 1995. v-src induces prostaglandin synthase 2 gene
expression by activation of the c-Jun N-terminal kinase and the c-Jun
transcription factor. Journal of Biological Chemistry 270:2 7622.

Inoue, H., C. Yokoyama, S. Hara, Y. Tone, and T. Tanabe. 1995. Transcriptional
regulation of human prostaglandin-endoperoxide synthase-2 gene by
lipopolysaccharide and phorbol ester in vascular endothelial cells. Involvement of
both nuclear factor for interleukin-6 expression site and cAMP response element.
J. Biol. Chem. 270:24965.

Pang, L., and A. J. Knox. 1998. Bradykinin stimulates IL-8 production in cultured
human airway smooth muscle cells: role of cyclooxygenase products. J Immunol

161:2509.

Subbaramaiah, K., P. A. Cole, and A. J. Dannenberg. 2002. Retinoids and carnosol

43

75.

76.

77.

78.

79.

80.

81.

82.

83.

suppress cyclooxygenase-2 transcription by CREB-binding protein/p300-
dependent and -independent mechanisms. Cancer Res 62:2522.

Sirois, J ., K. Sayasith, K. A. Brown, A. E. Stock, N. Bouchard, and M. Dore. 2004.

Cyclooxygenase-2 and its role in ovulation: a 2004 account. Hum Reprod Update
1 0:3 73 .

Scherle, P. A., W.-g. Ma, H. Lim, S. K. Dey, and J. M. Trzaskos. 2000. Regulation
of Cyclooxygenase-2 Induction in the Mouse Uterus During Decidualization. An
Event of Early Pregnancy. J. Biol. Chem 275 :3 7086.

Sayasith, K., J. G Lussier, and J. Sirois. 2005. Role of upstream stimulatory factor
phosphorylation in the regulation of the prostaglandin G/H synthase-2 promoter in
granulosa cells. J. Biol. Chem. :M413434200.

Ajubi, N. E., J. Klein-Nulend, M. J. Alblas, E. H. Burger, and P. J. Nijweide. 1999.

Signal transduction pathways involved in fluid flow-induced PGE2 production by
cultured osteocytes. Am J Physiol 276:E1 71.

Wadhwa, S., S. Choudhary, M. Voznesensky, M. Epstein, L. Raisz, and C.
Pilbeam. 2002. Fluid flow induces COX-2 expression in MC3T3-E1 osteoblasts
via a PKA signaling pathway. Biochem Biophys Res Commun 297:46.

Katori, M., and M. Maj ima. 2000. Cyclooxygenase-2: its rich diversity of roles
and possible application of its selective inhibitors. Inflamm Res 49:367.

Miller, S. I., R. K. Ernst, and M. W. Bader. 2005. LPS, TLR4 and infectious
disease diversity. Nat Rev Microbiol 3:36.

Seydel, U., M. Oikawa, K. Fukase, S. Kusumoto, and K. Brandenburg. 2000.
Intrinsic conformation of lipid A is responsible for agonistic and antagonistic
activity. Eur J Biochem 26 7:3 032.

Brandenburg, K., and A. Wiese. 2004. Endotoxins: relationships between structure,

function, and activity. Curr Top Med Chem 4:1127.

44

84.

85.

86.

87.

88.

89.

90.

91.

92.

93.

Barton, G M., and R. Medzhitov. 2003. Toll-like receptor signaling pathways.
Science 300:1524.

Hwang, D. 2001. Modulation of the expreession of cyclooxygenase-2 by fatty
acids mediated through Toll-like receptor 4 derived signaling pathways. FASEB J.
1 5: 2556.

Guha, M., and N. Mackman. 2001. LPS induction of gene expression in human
monocytes. Cell Signal 13:85.

Takeda, K., and S. Akira. 2004. TLR signaling pathways. Semin Immunol 16:3.

Yamamoto, M., S. Sato, H. Hemmi, S. Uematsu, K. Hoshino, T. Kaisho, O.
Takeuchi, K. Takeda, and S. Akira. 2003. TRAM is specifically involved in the
Toll-like receptor 4-mediated MyD88-independent signaling pathway. Nat
Immunol 4: 1144.

Jiang, Z., P. George], X. Du, L. Shamel, S. Sovath, S. Mudd, M. Huber, C. Kalis,
S. Keck, C. Galanos, M. Freudenberg, and B. Beutler. 2005. CD14 is required for
MyD88-independent LPS signaling. Nat Immunol 6:565.

Fitzgerald, K. A., S. M. McWhirter, K. L. Faia, D. C. Rowe, E. Latz, D. T.
Golenbock, A. J. Coyle, S. M. Liao, and T. Maniatis. 2003. IKKepsilon and TBKl
are essential components of the IRF3 signaling pathway. Nat Immunol 4:491.

Shanmugam, N., Y. S. Kim, L. Lanting, and R. Natarajan. 2003. Regulation of
cyclooxygenase-2 expression in monocytes by ligation of the receptor for
advanced glycation end products. J Biol Chem 278:34834.

Caivano, M., B. Gorgoni, P. Cohen, and V. Poli. 2001. The Induction of
Cyclooxygenase-2 mRN A in Macrophages Is Biphasic and Requires both CCAAT
Enhancer-binding protein beta (C/EBPbeta ) and C/EBPdelta Transcription
Factors. J. Biol. Chem 276:48693.

Gorgoni, B., M. Caivano, C. Arizmendi, and V. Poli. 2001. The transcription
factor C/EBPbeta is essential for inducible expression of the cox-2 gene in

45

94.

95.

96.

97.

98.

99.

macrophages but not in fibroblasts. J. Biol. Chem 276:40 769.

Shao, J ., H. Sheng, H. Inoue, J. D. Morrow, and R. N. DuBois. 2000. Regulation
of Constitutive Cyclooxygenase-2 Expression in Colon Carcinoma Cells. J. Biol.
Chem. 275:33951.

Rockwell, P., H. Yuan, R. Magnusson, and M. F igueiredo-Pereir... 2000.
Proteasome inhibition in neuronal cells induces a proinflammatory response
manifested by upregulation of cyclooxygenase-2, its accumulation as ubiquitin
conjugates, and production of the prostaglandin PGE(2). Arch Biochem Biophys
3 74:325.

F igueiredo-Pereira, M. E., Z. Li, M. Jansen, and P. Rockwell. 2002. N-
Acetylcysteine and Celecoxib Lessen Cadmium Cytotoxicity Which Is Associated

with Cyclooxygenase-2 Up-regulation in Mouse Neuronal Cells. J. Biol. Chem.
277:25283.

Voges, D., P. Zwickl, and W. Baumeister. 1999. The 26S proteasome: a molecular
machine designed for controlled proteolysis. Annu Rev Biochem 68.-1015.

DeMartino, G N., and C. A. Slaughter. 1999. The Proteasome, a Novel Protease
Regulated by Multiple Mechanisms. J. Biol. Chem. 274:22123.

Gardner, R. G, H. Shan, S. P. T. Matsuda, and R. Y. Hampton. 2001. An
Oxysterol-derived Positive Signal for 3-Hydroxy- 3-methylglutaryl-COA
Reductase Degradation in Yeast. J. Biol. Chem. 276:8681.

100. Tsai, A.-1., G Palmer, G Wu, S. Peng, N. M. Okeley, W. A. van der Donk, and R. J.

101.

102.

Kulmacz. 2002. Structural Characterization of Arachidonyl Radicals Formed by
Aspirin-treated Prostaglandin H Synthase-2. J. Biol. Chem. 277:38311.

Kostova, Z., and D. H. Wolf. 2003. NEW EMBO MEMBER'S REVIEW: For
whom the bell tolls: protein quality control of the endoplasmic reticulum and the

ubiquitin-proteasome connection. EMBO J. 22:23 09.

McCracken, A., and J. Brodsky. 2003. Evolving questions and paradigm shifts in

46

103.

104.

105.

106.

endoplasmic-reticulum-associated degradation (BRAD). Bioessays 25:868.

Khanna, R., E. J. Lee, and D. M. Papazian. 2004. Transient calnexin interaction
confers long-term stability on folded K+ channel protein in the ER. J. Cell Sci.
11 7:289 7.

Shearer, A. G, and R. Y. Hampton. 2004. Structural Control of Endoplasmic
Reticulum-associated Degradation: EFFECT OF CHEMICAL CHAPERONES
ON 3-HYDROXY-3-METHYLGLUTARYL-C0A REDUCTASE. J. Biol. Chem.
279:188.

Otto, J. C., D. L. DeWitt, and W. L. Smith. 1993. N-glycosylation of
prostaglandin endoperoxide synthaseS-l and -2 and their orientations in the
endoplasmic reticulum. Journal of Biological Chemistry 268:18234.

Percival, M., L. Bastien, P. Griffin, S. Kargman, M. Ouellet, and G O'Neill. 1997.
Investigation of human cyclooxygenase-2 glycosylation heterogeneity and protein

expression in insect and mammalian cell expression systems. Protein Expr Purif
9:388.

47

CHAPTER 2

CYCLOOXYGENASE-2 GENE TRANSCRIPTION IN A MACROPHAGE MODEL
OF INF LAMMATION
Summary

Infections involving lipopolysaccharide (LPS)-bearing, gram-negative bacteria
can lead to acute inflammation and septic shock. Cyclooxygenase-2 (COX-2), the target
of nonsteroidal anti-inflammatory drugs and selective COX-2 inhibitors, is importantly
involved in these immunological responses. We examined the dynamics of COX-2 gene
expression in RAW264.7 murine macrophages treated with LPS as a model for COX-2
gene expression during inflammation. We first established using Northern blotting and
nuclear run-on assays that COX-2 transcriptional activation continues for at least 12 hr
afier LPS treatment and involves at least three phases. Previous Studies with murine
macrophages identified an NF-KB Site, a C/EBP site, and a CRE-1 as cis-aoting elements
in the COX-2 promoter. We identified three additional functional elements including a
second CRE (CRE-2), an AP-l site, and an E-box that overlaps the CRE-1. The E-box
mediates transcriptional repression whereas the other cis-elements are activating. Using
electrophoretic mobility supershift assays and chromatin immunoprecipitation assays, we
cataloged binding to each functional cis-element and found them to be occupied to
varying extents and by different transcription factors during the 12 hrs following LPS
treatment. This suggests that the cis-elements and their cognate transcription factors
participate in a sequential, coordinated regulation of COX-2 gene expression during an

inflammatory response. In support of this concept, we found using inhibitors of Jun

48

kinase and NF-KB p50 nuclear localization that COX-2 gene transcription was
completely dependent on phospho-c-Jun plus p50 at six hr after LPS treatment but only

partially dependent on the combination of these factors at later treatment times.

49

Introduction

Prostaglandin endoperoxide H synthases, commonly known as
“cyclooxygenases,” (COX) catalyze the committed step in the conversion of arachidonic
acid to prostaglandins (1, 2). There are two COX isoforms, the predominantly
constitutive isoform, COX-1, and an inducible isoform, COX-2. Although both enzymes
catalyze the same reaction with similar kinetics in vitro, in vivo studies with isoform
specific inhibitors and COX-1 and COX-2 knock out mice indicate that there are some
physiological processes that require one specific enzyme and others where the isoforms
can complement one another (3, 4).

Bacterial lipopolysaccharide (LPS) is a potent inducer of COX-2 expression in
macrophage cells. This induction is a result of LPS activation of the toll-like receptor-4
(TLR4), which, in turn, initiates signaling through MyD88/IRAK/TRAF6/ECSIT
resulting in the activation of ERK, JNK, p38, PKC, and NIK (5, 6). These kinases exert
their actions by phosphorylating either transcription factors or other downstream effectors
to cause the transcriptional machinery to begin transcribing the COX-2 gene. LPS-
induced COX-2 transcription is regulated through multiple redundant mechanisms
involving several central response elements present in the COX-2 promoter (6, 7). The
CRE-1 at —57/-52 in the murine COX-2 promoter is necessary for mediating the effects of
a wide variety of stimuli, while a C/EBP site and an NF-KB response element appear to
function in more specialized signaling events.

The promoters of the human, murine, rat, equine, and bovine COX-2 genes have a
number of common putative regulatory elements. In the mouse promoter, there are both

a cAMP response element (CRE—2) and an NF-KB site located between 400 and 550 bp

50

upstream of the transcription start site, a C/EBP site at -138/-130, an AP-l site at -73/-61
and an overlapping CRE-llE-box element at -59/-48 (Fig. 1). The NF-KB site is
necessary for inducible COX-2 promoter activity in TNF-0L stimulated MC3T3-E1 cells
(8). More recently, Hwang et a]. have demonstrated that blocking NF-KB activation at
several levels results in a large decrease in COX-2 promoter activity in RAW 264.7 cells
(6, 9). The CRE-2 site has previously been tested in fluid sheer stress stimulated
osteoblastic MC3T3-E1 cells, but a mutation in this Site had no effect on the
transcriptional activation of a COX-2 promoter reporter gene in this system (10).
However, the CRE-2 site has been demonstrated to play an important role in IL-IB-
induced COX-2 transcription in the endometrium (11). MC3T3-E1 osteoblasts cells
treated with PMA activate COX-2 transcription in a process mediated by the AP-l site
(12, 13). The overlapping CRE-1 and E-box element of the human promoter have been
studied in transfected LPS-stimulated RAW 264.7 macrophages (14) and shown to be
involved in stimulation of COX-2 transcription. The E-box element has also been shown
to act as a positive regulatory element for COX-2 expression in granulosa cells (15) and
in PMA-treated human gastric epithelial cells (16).

Unlike fibroblasts where COX-2 is only transiently expressed (17),
monocytes/macrophages express COX-2 for a prolonged time (18). Although the
transcriptional regulation of COX-2 has been extensively studied, little is known about
the dynamics of the essential cis-acting elements of COX-2 promoter during
transcriptional activation and the mechanism of sustained activation. In this report we
demonstrate the involvement of the CRE-l, CRE-2, NF-KB, and AP-l Sites in positive

COX-2 transcriptional regulation and provide the first evidence of negative regulation of

51

COX-2 gene transcription through the E—box element in LPS-treated RAW 264.7
macrophages. We have also identified nuclear proteins associated with these response
elements over a 12 hr time period following LPS treatment and established that o-Jun
phosphorylation and p50 nuclear translocation are uniquely required in the middle phase
of COX-2 transcription. Cumulatively, our data demonstrate that the COX-2 gene is
transcriptionally regulated in LPS-treated RAW 264.7 macrophages in a coordinated
manner by unique pairings of transcription factors and promoter elements to sustain

COX-2 transcriptional activation for 12 hr afler initiating LPS treatment.

52

Materials and Methods

Reagents and antibodies. Lipopolysaccharide (LPS) from Salmonella minnesota
was purchased from Sigma-Aldrich Chemical Co. Rabbit anti-p50 and anti-p65
antibodies were kindly provided by N. Rice (N CI-Frederick) and CREB-1, ATF, USF-l,
and USF-2 antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA),
antibody to phospho-CREB was purchased from Upstate Biotechnology (Lake Placid,
NY) and antibodies to CREB and CBP were purchased from Cell Signaling (Beverly,
MA). CompleteTM Protease Inhibitor Cocktail and Pefabloc were purchased from Roche
Molecular Biochemicals (Mannheim, Germany). Poly(dI-dC)-Poly(dI-dC) (average
length 8517 bp) was purchased from Pharmacia Biotech. All other chemicals and
reagents were purchased from J .T. Baker (Phillipsburg, NJ). Plasmid DNA was isolated

with Qiagen Endo-FreeTM Maxi-prep columns. Nuclei for electrophoretic mobility shift

assays (EMSAS) were isolated with NE-PERTM nuclear and cytoplasmic extraction
reagents from Pierce Biochemical Co. (Rockford, IL). JNK inhibitor and p50 inhibitor

were purchased from Calbiochem.

Plasmids. The various regions of the murine COX-2 promoter were cloned into
pGL3basio (Promega). The -966/+23 construct was cloned from a KpnI and HindIII
fragment (19). Mutagenesis was performed using the Stratagene Quick Change protocol
with pfu Turbo DNA polymerase (Stratagene). The sequences of the mutant and
promoter constructs were verified; the mutations are summarized in Table III. pRC-p50
expression plasmid was kindly provided by Professor Richard Schwartz (Michigan State
University), and the mCOX-2 plasmid, pSVLN-muCOX-2, was provided by Professor

David L. DeWitt (Michigan State University). pRSV—ACREB, pRSV-IKB SR, and

53

pET23b-p300 expression plasmids were kindly provided by Professor Roland Kwok
(University of Michigan). The pcDNA3-USF-1/-2 expression vectors were generated by
cloning HindIII-XbaI-flanked PCR products derived from USF-l/USF-Z cDNA into the

Hind III-XbaI-digested pcDNA3 vector (Invitrogen).

Cell culture and transfections. RAW 264.7 cells (American Type Culture
Collection, Rockville, MD) were cultured in Dulbecco's modified Eagle's medium
(DMEM), supplemented with 10% heat inactivated fetal bovine serum, penicillin (100
units/ml), streptomycin (100 pg/ml), and Gentamicin (100 pg /m1) (Life Technologies,
Inc.) and were maintained at 37° C in 5% CO2. RAW 264.7 cells were cultured in six
well plates at a density of 5 x 105 cells/ml one day prior to transfection. A luciferase
reporter plasmid (2.5 pg) and a pCMV-B-galactosidase plasmid (0.5 pg; Pharmacia) were
transfected into RAW 264.7 cells for 45 min using DEAE-dextran (400 pg/ml) and 100
mM Tris-HCI, pH 7.3, in 600 ml of DMEM. The transfection reaction mixture was
removed, and the cells were cultured in DMEM with 10% FBS for 12 to 24 hr before
LPS (200 ng/ml) stimulation for 12 hr. For transfections using Superfect (Qiagen), 5 x
105 cells/well were plated 24 hr prior to transfection. COX-2 (1 pg) plasmid and pSV-B-
galactosidase (0.5 pg) plasmids (Promega) were transfected into RAW 264.7 cells

according to manufacture’s instruction.

Luciferase reporter assays. Chemiluminescent luciferase activity assays were
performed using reagents from Promega and a Molecular Dynamics luminometer. [3-

galactosidase activity was measured using an ONPG assay (Invitrogen) per the

instructions of the manufacturer. Protein concentrations were determined using the

54

Bradford reagent (BioRad). Spectrophotometric measurements were made on a
Molecular Dynamics 96 well plate reader. Luciferase activity is represented as relative
luciferase units of firefly per B-galactosidase activity. Statistically significant differences
between groups versus control were obtained with a Student t test, and significant

differences are indicated by asterisks.

Western blot analysis. RAW 264.7 cells were treated without or with LPS for
various times (1, 2, 4, 6, 8, 10, or 12 hr) and lysed in 1% SDS lysis buffer. Protein
concentration is measured and 20 pg of protein for each sample is loaded to SDS-PAGE
gel and transferred onto a PVDF membrane. The membrane was incubated with COX-2

or actin antibodies and visualized with an enhanced chemiluminescence system.

Northern blot analysis. Total cellular RNA was isolated from cells using Trizol
RNA isolation reagent (Life Technologies). Total cellular RNA (15 pg) was
electophoresed on a 3.7% formaldehyde, 0.8% agarose gel in TAE (10 mM Tris-acetate,
pH 8 to 8.1, 10 mM EDTA) and transferred to a nitrocellulose membrane. The
membrane was pro-hybridized for 1 hr at 65° C in pre-hybridization buffer (5x SSC, 50%
formamide, 5x Denhardt’s, 1% SDS, and sheared salmon sperm DNA (100 pg/ml)) and
hybridized with a probe in TES/NaCl Solution (10 mM TrisHCl, pH 7.4, 10 mM EDTA,
0.2% SDS, and 0.6 M NaCl). Following hybridization, the membranes were washed
twice in 2x SSC at 65°C for 20 min. A 1.8 kb NotI fragment of pSVLN mCOX-2 and a
1.3 kb EcoRl, XhoI fragment of a B-plasmid (Stratagene) were labeled by random

priming using a Mega Prime Labeling kit (Amersham) with a-32P-CTP (New England

55

Nuclear). The membranes were exposed to a phosphoimaging screen, and densitometry

was performed using Image Quant Sofiware.

Electrophoretic mobility shift assays. Nuclei were isolated from RAW 264.7
cells that had been stimulated for 1 or 12 hr with LPS (200 ng/ml). Cell lysis and nuclear
isolations were performed using NE-PERTM reagents (Pierce) per the instructions of the
manufacturer in the presence of 2 mM Pefabloc and 1X Complete Protease Inhibitor
Cocktail. Oligonucleotide probes (Michigan State University Macro-molecular Structure
Facility and Invitrogen) were annealed in T4 PNK Buffer and end-labeled with T4
Polynucleotide Kinase (New England Biological) and y32P-ATP (New England Nuclear).
The sequences of the probes are summarized in Table III. The probes were
electrophoresed on a TAE 10% acrylamide gel. The double stranded probes were excised
and eluted for 2 hr at 37° C in 0.5 M sodium acetate, 10 mM MgC12, 1 mM EDTA and
0.1% SDS, ethanol precipitated and resuspended in TE. Binding reactions were
performed with nuclear extract (5 pg of protein) and probe in the presence of 100 mM
KCl, 20 mM HEPES, pH 7.9, 1 mM EDTA, 10% glycerol, 2 mM Pefabloc, 1X Complete
Protease Inhibitor Cocktail, 2 mM DTT and 2 pg of Poly(dI-dC)-Poly(dI-dC) and
electrophoresed on 5% TBE acrylamide gels at 150 VDC for 1.5 hr. For EMSAS, the
probes were incubated with the nuclear extracts for 1 hr at 25° C, and for supershifi
assays, the nuclear extracts were combined with the probes for 15 min at 25° C and then
incubated with antisera for 4-6 hr at 2-8° C. EMSA gels were dried on 3M filter paper
and exposed to a phosphoimaging screen, and densitometry was performed using Image

Quant software (Molecular Dynamics).

56

Nuclear run-on assays. RAW 264.7 cells (ca. 107) were stimulated with LPS
(200 ng/ml) for 0.25, 0.5, 1, 3, 6, 9 or 12 hr. The cells were rinsed twice with ice cold
PBS and were scraped into 1 ml of PBS. The cells were collected by centrifugation and
lysed by resuspension in 1 ml of 10 mM Tris-HCI, pH 7.4, 10 mM NaCl, 3 mM MgCl2
and 0.5% IGEPAL CA-650 (Sigma) for 5 min. The nuclei were collected by
centrifugation for 10 min at 1000 rpm in a mini-centrifuge and resuspended in 500 pl of
Freeze Buffer (50 mM Tris-HCI, pH 8.3, glycerol (40% v/v), 5 mM MgCl2, and 0.1 mM
EDTA). Nuclei were either used fresh or stored at —80° C. To begin a rim-on reaction,
225 pl of suspended nuclei (ca. 107) was combined with 60 pl of Run-On Buffer (25 mM
Tris-HCI, pH 8.0, 12.5 mM MgCl2, 750 mM KCl, 1.25 mM ATP, GTP, CTP, 2 mM
DTT), 120 units of RNase-OUT (Life Technologies), and 100 pCi of a-32P-UTP. After
15 min at 37° C, 1 ml of Trizol was added, followed by 200 p1 of chloroform. The
mixture was vortexed vigorously and transferred to pro-Spun Phase Look Gel tube
(Beckman/Eppindorf) and centrifuged for 10 min at 10,000 x g. The aqueous phase was
removed and combined with 500 pl of isopropanol. The RNA was precipitated at -—80° C
for 15 min then centrifuged for 20 min at 10,000 x g and resuspended in RNase-free H2O.
The RNA was further purified and genomic DNA was fragmented with RNase-free
DNase I (Life Technologies) at 37° C for 5 min, then chilled on ice for 5 min before the
addition of 1 M NaOH for exactly 2 min, followed by the addition of 1 M HEPES (free
acid). The RNA was then precipitated by the addition of isopropanol. After
centrifugation the pellets were resuspended in DEPC treated water. The activity was

determined by scintillation counting. Slot blots were prepared on nitrocellulose

57

membranes (Schleicher and Schuell) with 10 pg of denatured, linearized murine COX-2
expression plasmid (pSVLN-mCOX-Z), B-plasmid (Stratagene), empty vector, or vehicle
without plasmid. After baking, the membranes were pre-hybridized in 5x SSC, 50%
formamide, 5x Denhardt’s solution, 1% SDS, and sheared salmon sperm DNA (100
pg/ml) for 1 hr at 65° C. Hybridization of the labeled RNAs with membranes was
performed at 65 °C in TES/NaCl Solution (10 mM Tris-HCI, pH 7.4, 10 mM EDTA,
0.2% SDS, and 0.6 M NaCl). Following hybridization the membranes were rinsed twice
in 10x SSC, then washed twice in 2x SSC at 65° C for 20 min. The dried membranes
were exposed to a phosphoimaging screen, and densitometry was performed using Image

Quant Software (Molecular Dynamics).

Reverse transcriptase—PCR. RAW 264.7 cells were treated with 200 ng/ml of LPS for
various times and total RNA was isolated using RNAeasy kit (Quagen). For JNK
inhibitor and p50 inhibitor studies, 10 pM of JNK inhibitor or 90 pM of p50 inhibitor was
added after 3.5 hr of LPS treatment. The RNA (2 pg) was treated with DNase I and 8 pl
of each sample was reverse-transcribed and amplified using one-step RT-PCR system
(invitrogen) for 35 cycles with specific primers for COX-2 mRNA and actin control
nRNA. The one step RT-PCR cycle parameters were 45 °C for 30 min, 94 °C for 2 min,
followed by 35 cycles of 94 °C for 30 s, 55 0C for 30 s, 68 °C for 1 min. The primers
used for COX-2 mRNA: forward primer ACACTCTATCACTGGCATCC; reverse
primer GAAGGGACACCCTTTCACAT, primers for actin mRNA: forward primer

CACACCCGCCACCAGTTC; reverse primer ACGCACGAI I ICCCTCTCA. PCR

58

products were electrophoresed on 1% agarose gel and visualized by staining with

cybergreen.

Chromatin immunoprecipitation assay. LPS treated RAW 264.7 cells were
treated with 1% aqueous formaldehyde at room temperature for 20 min. Cells were
washed twice with 10 ml of ice cold PBS and scraped into 10 ml conical tubes. The
suspended cells were then washed with 10 ml of ice cold Buffer A (0.25% NP-40, 10 mM
EDTA, 0.5 mM EGTA, 10 mM HEPES, pH 6.5, 0.5 mM PMSF) and Buffer B (20 mM
NaCl, 1 mM EDTA, 0.5 mM EGTA, 10 mM HEPES, pH 6.5, 0.5 mM PMSF) and lysed
with a lysis buffer (1% SDS, 10 mM DETA, 50 mM Tris-HCl, pH 8, 1X complete
protease inhibitor cocktail, 2 mM perfobloc); lml of the lysis buffer was used for per 108
cells. Cell lysates were sonicated seven times for 15 sec each at setting 3 on a Misonix
sonicator to shear the DNA to lengths between 200 and 1000 bp. Samples were then
centrifuged for 10 min at 12,000 rpm at 4° C. The supernatant fraction was diluted ten
fold in dilution buffer (1% Triton-X 100, 2 mM EDTA, 150 mM NaCl, 20 mM TrisHCl,

pH 8, 1X complete protease inhibitor cocktail, 2mM perfobloc) and 2 pg of p50, p65,

CREB-1, c-Jun, p300, USF-l, or USP-2 antibody was added for each
immunoprecipitation. After an overnight incubation with the antibody, 20 pl of 50 %
slurry of Protein A/G agarose, which had been washed three times with dilution buffer
was added to the sample and the samples incubated for four hr at 4 °C with gentle mixing.
Immunoprecipitated materials were washed 1 time with Buffer TSE (0.1% SDS, 1%
TritonXlOO, 2 mM EDTA, 20 mM Tris pH 8.0), 1 time with Buffer TSE+250 mM NaCl,

1 time with Buffer TSE+500 mM NaCl, 1 time with Buffer C (0.25 M LiCl, 1% NP-40,

59

1% DOC, 1 mM EDTA, 10 mM Tri-HCl, pH 8), and 3 times with TE Buffer. Protein-
DNA complexes were eluted with 300 pl of elution buffer (1% SDS, 0.1 M NaHCO;;) for
30 min at room temperature. NaCl (200 mM) was added, and the samples were
incubated at 65 ° C for 16 hr. Afier reverse cross-linking, 3 pl of protease K (20 mg/ml)
and 1 pl of an aqueous glycogen solution (20 mg/ml) were added, and the samples were
incubated at 42 °C for 2 hr. DNA was extracted with phenol/chloroform. The pellet was
resuspended in 40 pl of water. For PCR reactions, 5 pl of each sample was used and 20
pl of the 50 pl PCR product was loaded onto agarose gels. To obtain conditions where
the signal intensity was linear with the input, various numbers of cycles of PCR were
performed; 28 cycles (26 cycles for CBP ChIP assay) of reaction were used in the
experiments depicted in the figures. PCR primers were as follows: for GAPDH: 5’-
GCTGACATCAACTCCCAGGT-3’, 5’-TTCCG'ITCTCAGCCTTGACT-3’, for COX-2
(distal region): 5’-TCCCGGGATCTAAGGTCCTA-3’,
5’CAGATGTGGACCCTGACAGA-3’, for COX-2 (proximal region): 5’-
TCCTTCGTGAGCAGAGTCCT-3’, 5’-CGCAACTCACTGAAGCAGAG-3’. PCR
products were electrophoresed on 2% agarose gels and visualized by staining with
cybergreen. PCR products for GAPDH, COX-2 (distal region) and COX-2 (proximal

region) are 470 bp, 159 bp and 248 bp respectively.

60

 

Results

LPS causes sustained increases in the rate of COX-2 gene transcription in
RAW 264.7 cells. Stimulation of macrophage and macrophage-like cells with LPS
results in the synthesis of prostaglandins and sustained increases in the expression of
COX-2 protein and other inflammation-related proteins (Fig. 9A) (6, 20-23). It has been
hypothesized that the sustained increase in COX-2 expression is a result of increased
transcription of the COX-2 gene, but there has been no direct demonstration of this.
Using nuclear run-on assays we established that LPS treatment of RAW 264.7 cells does
cause a rapid and prolonged increase in the rate of synthesis of COX-2 mRNA (Fig.
9)(24). Furthermore, the rate of mRNA synthesis correlates temporally with the amounts
of COX-2 mRNA extracted from RAW 264.7 cells at various times before and afler LPS
treatment. A decrease or pause in the rate of COX-2 mRNA synthesis and mRNA
accumulation was consistently seen between 4-8 hr after initiating LPS treatment in all of
the nuclear run-on assays and Northern blot time courses that were performed during our
studies. This suggests that LPS-induced COX-2 gene expression in this model system has
early (ca. 0-4 hr), middle (ca. 4-8 hr) and late (ca. 8-12 hr) phases. Further support for

this is presented at the end of the Results section.

Characterization of new cis-acting elements in the murine mCOX—2
promoter associated with LPS-induced COX-2 gene expression. Several cis-acting
elements in the mCOX-2 promoter, including an NF-KB site at —401/-393, a C/EBP
response element at —138/-l30, and a CRE-1 at -59/—52, have been shown previously to

be required for LPS-induced COX-2 transcription in RAW 64.7 cells (25-27). To further

61

 

-434 -428 —138 -130 -73 -61 -53 ~48 _,,
cmz NF-kB C/EBP - 0.13%
-401 -393 -59 —52 -3o -25

Figure 8. Schematic representation of the major conserved response elements in the
murine COX-2 promoter.

Cis-acting elements found within the COX-2 promoter are noted in the shaded boxes and
their location relative to the COX-2 transcriptional start site are noted above or below
each element. CRE, cAMP response element; N F—KB, Nuclear factor kappa B; C/EBP,
CCAAT/enhancer—binding proteins; AP. Activator protein

62

A

LPS(hr)0 1 2 4 6 8 1012
i -----—--r <—oox-2

(— Aotin

 

 

 

 

 

 

CD
0

 

to
ac

 

OI

 

(a)

 

&

/
/\.._./

p

 

/\ /»

 

 

 

 

.'.
(JIM

 

(COX-ZIActln)

-‘

 

 

d N
K

Relative COX-2 Transcripts
(COX-ZIActln)
0)
Relative COX-2 Transcription

O
0 0|
0.—

 

 

 

 

 

 

o I T T V

o 2 1012 53651012

4 Tim?» (ha)a Tlme (hr.)

”’3th ° 0-51 2 3 4 3 9 ‘2 LPSlhr‘Hl 0.25 0.5 1 3 e 9 12
COX-2 ' f“ ‘1'“ an n a-p' fl Vehicle

* ’ cox-2 ~— --. -- -
LPS(hr
B-Actln IIHHCI

 

 

. 1
Mn... .5... ". “Sn-Io-‘

Empty ‘ 22 a.
Vector

 

 

 

Figure 9. Sustained increase of mCOX-2 gene expression in LPS-stimulated RAW
264.7 cells. A. RAW 264.7 cells were treated with LPS (200 ng/ml) for the indicated
times and cell lysates were prepared. Western blot analysis was performed with COX-2
or actin antibody as indicated with the arrows. B. Northern blot analysis was performed
with RNA isolated from RAW 264.7 cells that had been treated with LPS (200 ng/ml) for
the indicated times. Total RNA (15 pg) was separated on a 0.8% agarose, 4%
formaldehyde gel, transferred to a nitrocellulose membrane and hybridized to COX-2 or
l3-actin probes as detailed in the Methods section. Similar results were obtained in five
independent experiments. C. Nuclei were isolated from RAW 264.7 cells stimulated with
LPS (200 ng/ml) for the indicated times and incubated with 7-32P-UTP to label newly
synthesized RNA transcripts. RNA was isolated and blotted onto a nitrocellulose
membrane with vehicle, COX-2 cDNA, B-actin cDNA or an empty vector DNA control.
Similar results were obtained in two separate experiments with two different cell
preparations. B and C are obtained from wingerd et. al. (24).

63

elucidate the transcriptional regulatory components of the mCOX—2 promoter, deletion
constructs of the promoter driving a luciferase reporter were transfected into RAW 264.7
cells (Fig. 10A) (24). Transfected cells were treated for 12 hr with or without LPS to
determine which general regions of the mCOX-2 promoter are necessary for maximal
LPS responses (Figs. 8, 10). Deletion of a segment from —459 to -—414 removes a
previously unoharacterized CRE (CRE-2) without eliminating the adjoining, conserved
NF-KB response element (Fig. 8). Deletion of this CRE-2 site resulted in an
approximately 50% reduction in the LPS-induced COX-2 expression (Fig. 10A). Larger
deletions that removed the NF-KB and C/EBP-l response elements caused no further
decreases in the LPS-induced promoter responses, suggesting that the CRE-2 site is an
important regulatory component of LPS mediated COX-2 induction. Additional deletion
analyses of proximal regions of murine COX-2 were not performed in this study, as this
region had been characterized previously in LPS-treated RAW 264.7 cells and shown to
be important in regulating COX-2 mRNA accumulation (25, 28).

To investigate the relative contribution of the CRE-2 and other putative cis-acting
elements of the COX-2 promoter, we engineered and analyzed mutations in the CRE-1 (-
59/-52), E-box (-53/-48), AP-l (~73/-61), CRE-2 (-434/-428), and c-Ets (~312/-306) sites
in the mCOX-2 promoter (—966 to +23) fused to a luciferase reporter gene (Table III; Fig.
10B). Consistent with the deletion analysis (Fig. 10A), mutation of the CRE-2 resulted in
a loss of about half of the LPS stimulated luciferase activity. The AP-l and CRE-1
mutations eliminated approximately 75% of the reporter activity, whereas the c-Ets
mutation did not cause any change in luciferase activity when compared with the wild

type promoter (Fig. 10, and data not shown). Our data indicate that in addition to the

64

Table III. Oligonucleotides used for EMSAs and preparation of COX-2 promoter
mutations.

Sequences of the primers used for EMSA probes and the generation of mutant COX-2
promoter reporter constructs. Mutated bases are denoted in lower case letters. Both the

sense and anti-sense primers were used in EMSAs and mutagenesis.

 

 

 

 

 

 

 

 

 

 

 

Oligonucleotide Sequence

CRE-2 5’-GAGCAGCGAGCACGTCAGACTGCGCC-3’
Mutant CRE-2 5’-GAGCAGCGAGCAatTCAGACTGCGCC-3’
NF -1cB 5’-GAGAGGTGAGGGGATTCCCTTAGTTAG-3’
Mutant NF -1cB 5 ’-GAGAGGTGAGGGccTTCCC'ITAGTTAG-B ’
AP-l 5’-CGCTTGATGACTCAGCCGGAA-3’

Mutant AP-l 5’-CGCTTGATGACTtgGCCGGAA-3 ’

CRE-ll E-box 5 ’-TCACCACTACGTCACGTGGAGTCCG-3’

 

 

Mutant CRE- l/ E-box 5 ’-TCACCACTAatTCACGTGGAGTCCG-3 ’

 

CRE-l/ Mutant E-box 5’-TCACCACTACGTCAQITGGAGTCCG-3’

 

 

c-Ets 5’-TGCGCGACTGGGAGGAAACCGGAGACCC-3’
Mutant cEts 5’-TGCGCGACTGGGAGgaAACCGGAGACCC-3’

 

 

 

 

65

Figure 10. Promoter activity of COX-2 deletion and mutation constructs.

A. A nested set of deletions were prepared from the native —966/+23 murine COX-2
promoter. RAW 264.7 cells were transiently co-transfected with 2.5 pg of luciferase
promoter reporter plasmids containing the indicated regions of the COX-2 promoter and
0.5 pg of a CMV B-galactosidase expressing plasmid. Twenty-four hr post transfection
the cells were stimulated for 12 hr with LPS (200 ng/ml). Measurements of relative light
intensities from the luciferase activity (Relative Luciferase Units, RLU) were normalized
to the units of B-galactosidase activity as described in the Methods section. Bars
represent the average fold increase in promoter activity between unstimulated control and
LPS-stimulated RAW 264.7 cells for each of the COX-2 promoter reporter plasmid. The
error bars represent the standard deviation relative to the average fold increase in
promoter activity observed across three independent experiments. Adopted from Wingerd
eta]. (24).

B. Reporter activities of mCOX-2 promoter reporter constructs with individual cis-
elements mutated. RAW 264.7 cells were transiently co-transfected with 3 pg of
luciferase promoter-reporter plasmids containing mutations in the indicated elements of
the mCOX-2 promoter (-966/+23) and 0.5 pg of a pSV B-galactosidase expression
plasmid. LPS treatment and quantification of transfection data were performed as above.
Data represent the promoter activity from cells transfected with reporters driven by either
the wild type COX-2 promoter or promoters with the indicated mutations, normalized to
the B-galactosidase activity, with and without LPS treatment. Error bars represent the
standard deviation from the average values obtained from three independent experiments
performed in duplicate. *P<0.05 and **P<0.01 for native (WT) plasmid-transfected
LPS-treated cells vs. mutants plasmid-transfected LPS-treated cells.

.J\

0X-2
"erase
r and
than
light

 

Fold Increase (RLU/B -gal)

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

llh-n

 

-966/+23 -459/+23 -414/+23 -350/+23 -l70/+23 -98/+23

 

 

 

 

 

 

 

** ll LPS-

 

 

 

 

 

 

 

 

 

 

 

 

wr moan-2 mNF-xB mAP-l nCRE-l iii-box Enpty

 

-434 -428 -138 -130 -73 -61 -53 -48

 

  

iii/EB? Ail

-401 -393 -59 -52 -30 -25

67

 

 

previously reported cis-acting elements (i.e. NF -1<B, C/EBP, and CRE-1), the CRE-2 and
the AP-l elements are required for maximal mCOX-2 promoter activity elicited by LPS
treatment of RAW 264.7 cells. Interestingly and in contrast to the reduced activity
resulting from mutation of the other regulatory elements of COX-2 promoter, mutation of
the E-box caused a significant increase in luciferase activity (Fig. 10B), suggesting that
the E-box is involved in inhibition of mCOX-2 gene transcription in LPS-stimulated

RAW 264.7 macrophages.

Transcription factor binding to cis-acting elements in the mCOX-2 promoter.
EMSA supershift assays were performed to identify proteins binding to the COX-2 cis-
acting elements. To examine binding to the CRE-2, a 32P-labeled 26 bp double-stranded
DNA probe containing the CRE-2 (5’-ACGTCA-3’) (Table III) was incubated with
nuclear extracts from either control RAW 264.7 cells or cells that had been treated with
LPS for 0, 1 or 12 hr (Figs. 11A and 11B, lanes 1-3). The mobility and intensities of the
radioactive CRE-2 protein complexes with control IgG were similar when using nuclear
extracts from both treated and untreated cells. That is, the amount of CRE-2 bound by
nuclear proteins does not appear to be substantially up or down regulated by LPS.
Supershifi assays with antibodies against CREB, ATF-1, ATF-2, or phospho-c-Jun (Figs.
11A and 11B) indicated that CRE-2 is bound constitutively by members of the
CREB/ATF transcription factor family (i.e. CREB and ATF-2) and by phosphorylated c-
Jun.

The NF-KB response element (5’-GGGGATTCCC-3’; Table III) is necessary for

maximal mCOX-2 promoter activity in RAW 264.7 cells (5, 29), but the nuclear proteins

68

bound to this response element had not been characterized (Fig. 11C). p65 and p50 are
known to be involved in distinct dimeric NF-KB complexes (30). To determine the
proteins bound to the NF-KB site, supershift assays were performed using nuclear
proteins from untreated cells or cells treated with LPS for either 1 or 12 hrs. Two distinct
complexes were observed with the NF-KB probe and these nuclear extracts. Anti-p50
antibody caused shifts in both the high and low mobility complexes, whereas the anti-p65
antibody shified only the low mobility complex (Fig. 11C). This indicates that the low
mobility complex includes a p50/p65 heterodimer while the high mobility complex
includes a p50/p50 homodimer. Interestingly, our data revealed that the NF-KB site is
primarily occupied by the p65/p50 heterodimer during the early phase (1 hr) of the LPS
response and predominantly occupied by the p50 homodimer at the late phase (12 hr) of
COX-2 transcriptional activation (Fig. 11C). It was after four hrs of exposure of RAW
264.7 cells to LPS that we observed a shift in the composition of the nuclear complex
bound to the NF-KB site from predominantly p50/p65 heterodimers to predominantly p50
homodimers (data not shown). This result is despite the fact that COX-2 transcription is
up-regulated for at least 12 hr by LPS treatment (Fig. 9) and that the p50 homodimer is
typically associated with inhibition of gene expression.

NF -KB and CRE-2 Sites seemed to function coordinatedly in LPS-induced COX-2
gene expression as determined using promoter assay (24). This raises the possibility that
there are protein-protein interactions linking CREB/ATF binding at the CRE-2 with
p65/p50 heterodimer and/or p50 homodimer binding at the NF-KB site. To investigate
transcription co-factors that are associated with this region, a 57 bp double stranded

Oligonucleotide probe containing both the CRE-2 and the NF-KB site was used for EMSA

69

(Fig. 12). Nuclear proteins bound to the 57 bp probe to form several complexes (Fig. 12,
lane 1-3). To discriminate among these radioactive bands, 100X cold probe competitors
(Fig. 12A) or 32P-labeled probes (Fig. 12B) containing mutations of either CRE-2 or NF-
KB site or both were used. Mutant CRE-2 cold probe that competes NF-KB site binding
(Fig. 12A, lane 4-6) and 32P-labeled mutant NF -1<B probe (Fig. 12B, lane 7-9) were able
to eliminate the shifts caused by p65/p50 heterodimers and p50 homodimers, and there
are no additional bands that represent CRE-2 complex when compared with WT cold
probe, which competes for both CRE-2 and NF-KB binding (Fig. 12A, lane 13-15) and
32P-labeled double mutant (Fig. 12B, lane 13-15).

To identify transcription factors bound to this 57 bp probe, supershift assays
were performed using antibodies to p65, phosphorylated p65, p50, or CREB was
performed (Fig. 12C). p50 antibody was be able to shift the entire complex (Fig. 12C,
lane 10-12) whereas anti-CREB antibody caused only very faint shifts in bands (Fig. 12C,
lane, 4-6), indicating that CREB is bound to 57 bp probe even though CRE-2 complex
was difficult to detect in EMSAs (Fig. 12A,B). However, phosphorylated p65 and p65
supershifis were not observed, which could be observed if higher quality antibodies were
used.

Another way to characterize transcription factor binding to the upstream region
of COX-2 after LPS stimulation is to use biotin-streptavidin pull down assays. Briefly,
biotin-labeled probe is incubated with nuclear extract, and the complex formed is
immobilized with streptavidin-coated beads. The beads are washed and proteins were
eluted and immunoblotted with antibodies against different transcription factors.

Because a CRE could be bound by members of the AP-l transcription factor family as

70

A Probe w— 3 Probe @—

 

 

 

 

Antibodies IgG CREB ATF-2 Antibodies .96 pwun ATM
LPS(hr)o11201120112 LPS(hr)o112 01120112
CREB/ATF-ZIP-c-Jun )> g a '

if " - g . supershifts ._ ,-
m .. We CRE-zoomplex —> 6.0..

 

 

 

 

 

w Freeprobes.—>
123456789

123456789

Probe @—
Antibodies 1913 p50 p65
LPS(hr)o1120112 0112

we: -
' “i. .. fires/£50 ss
.ll ‘ -141 gig

123456789

 

 

 

 

Figure 11. EMSA supershift assays analyzing transcription factor binding to
mCOX-2 promoter elements. A and B. Transcription factor binding to CRE-2. EMSA
supershift 2assays were performed as described in the Methods section. The double-
stranded3 2P-labeled CRE-2 probe was incubated with a nuclear extract from RAW 264. 7
cells stimulated with LPS (200 ng/ml) for 0, 1, or 12 hr and either an IgG control
antibody or an antibody to CREB or ATF-2 (A) or to phosphorylated c-Jun or ATF-1 (B).
CREB, ATF-2, and P-c-Jun supershifted complexes are denoted with Open arrows and the
CRE-2 complex is indicated with the closed arrows. C. p65 and p50 binding to NF—KB
probe (24). The double-stranded 32P-labeled NF-KB probe was incubated with a nuclear
extract from RAW 264.7 cells stimulated with LPS (200 ng/ml) for 0, l or 12 hr and
either an IgG control antibody or an antibody to p50 or p65. Complexes of the NF-KB
probe and p50/p65 heterodimers or p50/p50 homodimers are indicated with closed
arrows. The supershifted (SS) complexes bound to antibody to p50 or p65 are indicated
with open arrows.

71

 

 

Probe
Cold probe NONE mCRE-2 mNF-kB double mut. WT
LPS(hr)o112 0112 011201120112

7' I d»; 12‘ _. U er”! t‘»

 

   

.137. - p65/p50
<— p50/p50

 

<— Free probes

 

123456789101112131415

“m

m
Probe WT(57bp) mCREZ mNF—kB double mut
LPS(hr)o112 0112 01120112

 

 

1,2,. g 3, . u <.:}—— p65/p50
0.. u < ~ p50/p50

 

 

+~ Free probes

 

12345678 9101112

72

Probe
Antibodies IgG CREB P-p65 p50 p65

LPS(hr)o1120112011201120112

 

 

I <6 CREB/p50/p65 SS
.1 .1. <1— 965/1150
- '- ‘u ~ I" <——- p50/p50

 

 

 
 

I .22 ‘1 ‘ ; .. II («Freeprobes

1234 56 78 9101112131415

Figure 12. CREB and p65/p50 binding to a probe containing both the CRE-2 and
the NF-KB site. An EMSA was performed using a double-stranded 32P-Iabeled 57 bp
probe containing the CRE-2 and NF—KB site and nuclear extracts from RAW 264.7 cells
that has been stimulated with LPS (200 ng/ml) for 0, 1, or 12 hr. (A). The double
stranded 32P-labeled 57 bp probe was incubated with each of the three nuclear extracts in
the presence and absence of a 100 fold molar excess of unlabeled probes containing
mutations of either or both of the CRE-2 and the NF-KB site. (B) Double stranded 2P-
labeled 57 bp probes containing mutations of either or both of the CRE-2 and NF—KB was
incubated with nuclear extracts from each time point. (C) Normal IgG or antibodies to
CREB, phosphorylated p65, p65, or p50 was incubated with 59 bp probe and nuclear
extracts. The CREB and p50 supershifted complexes are indicated with open arrows (C),
p65/p50 complex is denoted with small open arrows, and p50 homodimers are indicated
with closed arrows.

73

 

well as by CREB/ATF family members, antibodies to phosphorylted c-Jun, CREB,
phosphorylated CREB, ATF-1, and ATF-2 were used in addition to antibodies to p65 and
p50 for NF-KB element (Fig. 13). Consistent with previous EMSA anaysis, p65 binding
was inducible and peaked at 1 hr and decreased after 4 and 12 hr of LPS stimulation
whereas p50 binding increased with time. Phosphorylated CREB binding was detected
even without LPS treatment, decreased after 1 hr but increased again after 12 hr of LPS
stimulation. ATF—l and ATF-2 are also bound constitutively to CRE-2 site (Fig. 13). It
has been shown that phosphorylated CREB or phosphorylated p65 can recruit co-
activators such as CBP/p300 to transcriptional response elements. For this reason, a
CBP/p300 immunoblot was also performed to determine if CBP/p300 was present;
however, little or no co—activator could be precipitated (Fig. 13).

Gel shift analysis revealed that the binding of nuclear proteins to the AP-l site
(5’-ACAGAGTCACCAC-3’; Table III) is induced by LPS stimulation but that the extent
of binding then remains about the same 1 and 12 hr after initiating LPS treatment (Fig.
14). To identify the transcription factors bound to the AP-l site, supershift assays were
performed using antibodies reactive with c-Jun, phosphorylated c-Jun, c-fos, Jun D, Fra 1,
Fra 2, ATF-1, ATF-2, and CREB. This analysis indicated that the AP-l site is bound
primarily by phosphorylated c-Jun and c-fos (Fig. 14A). No binding of members of the
other AP-l or CREB/ATF transcription factor family to the AP-l site was observed (Fig.
14B, data not shown). Specific binding activity of phosphorylated c-Jun was almost
undetectable in untreated control cells but was increased considerably after stimulation of
macrophages with LPS. Binding of c-fos to the AP—l site was increased at 1 hr treatment

of LPS but absent at 12 hr of LPS treatment, suggesting that the c-fos is specifically

74

 

a“ B 3:19 more

 

 

WT (57bp) double mutant Nuclear Extract
LPS(hr)o141201412 01412
“u-” ”"1” ' .‘.'-..- 965

if " ‘ ' . ' ._,__,_
RfiMr-bg. W ”50

 

P-c-jun
--- '4 n ”i" D" P-CREB

er "
r..-- - u‘ L“ r--- CREB

fl-fl- [EMM‘ ATF-1
-‘-'- "" "" "" ' M ATF-2
' ‘ '. ‘ A ’ p300

. '12-- CBP
9 10 11 12

Figure 13. Representative immunoblots showing transcription factor binding to the
biotinylated probe that contains the CRE-2 and the NF-KB site in the presence or
absence of LPS stimulation. A double stranded biotin-labeled 57 bp probe containing
the CRE-2 and the NF—KB site was prepared and a probe with mutations of both elements
as a negative control. Nuclear extracts from RAW 264.7 cells treated with LPS at l, 4, or
12 hr (200 pg) were incubated with the probe (2 pg) then streptavidin-beads was added to
precipitate the protein-DNA complexes. Bound protein was eluted and subjected to
western blottings with anti-p65, -p50, -P-c-Jun, -P—CREB, -CREB, -ATF-l, -ATF-2, -
p300, or -CBP antibodies as shown in the left hand panel. 20 pg of nuclear extract from
different time points were subjected to western blotting as Shown in the right hand panel.

75

A Probe —IE—
Antibodies IgG p-c-jun c-fos
LPS(hr,o112 01120112

.1 .1 ..- *1 -e
V l
m I...
V." r '\

 

 

<6 p-c-junlc-fos $8
+ AP—1 complex

   

 

 

 

 

123456789

B Probe
Antibodies IgG c-Jun JunD Fra1 Fra2

LPS(hr)01120112 01120112 0112

 

 

<9 o—Jun SS

.1 g .. 9. 4—AP-1Complex

 

 

 

123 456789101112131415

Figure 14. AP-l transcription factor binding to a COX-2 AP-l probe.

A and B. EMSA supershift assays were performed using a double-stranded 32P—labeled
AP—l probe. The probe was incubated with nuclear extracts from RAW 264.7 cells
stimulated with LPS (200 ng/ml) for 0, 1, or 12 hr and either an IgG control antibody or
an antibody to (A) phosphorylated c-Jun or c-fos, (B) c-Jun, Jun D, Fra 1, or Fra 2. The
AP—l complex is indicated with closed arrows and the (A) P-c-Jun and c-fos, (B) c-Jun
supershifted complex is indicated with open arrows.

76

 

playing an important role in the early phase of COX-2 induction.

To identify nuclear proteins that bind to the overlapping CRE-1 (5’-ACGTCA-3’;
Table III) and E-box element (5’-CACGTG-3’; Table III), a 32P-labeled 25 bp
Oligonucleotide containing the overlapping CRE-1 and E-box was prepared for EMSA
supershift assays (Fig. 15). As was observed at the NF -1<B probe, two distinct complexes
were formed with the 25 bp CRE-l/E-box probe (Fig. 15A, lanes 1-3). The lower
mobility complex was shifted by anti-CREB antibody (Fig. 15A, lanes 4-6 and Fig. 15B,
lanes 4-6) and the higher mobility complex was shifted by USF-l (Fig. 15A, lane 7-9) or
USP-2 antibodies (Fig. 15A, lane 10-12). Additionally, low amount of phorphorylated c-
Jun was inducibly bound to CRE-llE-box probe. However, ATF-2 antibody failed to
shift the complex, suggesting the absence of ATF-2 in the CRE-l/E-box complex. Super
shifting with CREB, USP-1, and USP-2 antibodies could shift whole the complex (Fig.
15C). Transcription factor recruitment to this element appears to be constitutive, as
similar levels of binding are observed in untreated RAW 264.7 cells and after 1 and 12 hr
of LPS stimulation. Although mutation of the E-box lead to a significant increase in
COX-2 transcription, overexpression of USF-l or USF-2 failed to repress COX-2
promoter activity (Chapter 3) suggesting that the repression does not directly involve
USP -1 or USP-2 binding to the E-box.

Since AP-l and CRE-1 sites on COX-2 promoter are only 2 bp distant away from
each other, it is possible that they could compete for binding to nuclear proteins. To test
this, a 32P-labeled 39 bp Oligonucleotide containing both AP-l and CRE-l site was
prepared for EMSA and supershift assays. As Shown in Fig. 16A, three complexes were

formed with the 39 bp probe (Fig. 16A, lane 1-3); two lower complexes were formed

77

 

when mAP-l probe was used (Fig. 16A, lane 4-6), upper complex was formed when
mCRE-l probe was used (Fig. 16A, lane 7-9), indicating that the AP-l complex migrated
slower than CRE-1/E-box complex. AP-l and CRE-1 complexes were abolished using
probe containing mutations on both sites (Fig. 16A, lane 10-12). A similar experiment
was performed using cold probe as a competitor (Fig. 16B). Phosphorylated c-Jun,
CREB, USF-l, and USP-2 antibodies were used in supershift experiments to identify the
protein composition of the complexes formed with the APl/CRE-llE-box probe (Fig. 17).
The AP-l complex was supershifted by phosphorylated c-Jun antibody (Fig. 17, lane 4-6),
CRE-1 complex was supershifted by CREB antibody (Fig. 17, lane 7-9), and E-box
complex was supershifted USF-l antibody (lane 10-12), or USP-2 antibody (lane 13-15).
The results indicate that phosphorylated c-Jun, CREB, and USF-1/-2 binding was

mutually exclusive and the binding pattern did not change when a longer probe was used.

In vivo association of transcription factors with the mCOX-2 promoter in LPS-
stimulated RAW 264.7 cells. Results of the EMSA supershift assays suggest that CREB,
p65, and p50, phosphorylated c-Jun and c-fos and USF-l/-2 transcription factors can bind
to the CRE-1 and CRE-2, NF-KB, AP-l, and the E-box, respectively. Chromatin
immunoprecipitation (ChIP) analysis were performed to determine the composition of
trans-acting factors associated with the mCOX-2 promoter in intact RAW 264.7 cells
after 0, l or 12 hr of LPS stimulation (Fig. 18). In agreement with the EMSA supershift
results, ChIP assays revealed that CREB and USF-1/-2 are constitutively associated with

the COX-2 promoter (Fig. 18C, 18F). As predicted by the observed changes in the

78

A

Probe
Antibodies lgG CREB USF-1 USF-2 Pc—Jun

LPS(hr 01120112011201120112

 

USF1I2 SS
~ CREBlP-c-Jun SS

1. CRE-1 comlex
1" Ebox complex

<—~ Free probes

 

 

I123 4 5 6 7 89101112131415,

B Probe
Antibodies IgG CREB ATF-2
LPS(hr)0112 0112 0112

 

 

<6 CREB supershift

<W— CRE/Ebox complex

 

 

 

123456789

79

 

Probe
IgG + +
CREB + + + +
USF-1 + + + +
USF-Z + + + +
LPS(hr)o101o1o1o1
<— USF1/2 supershift
<9 CREB supershift

‘— CRE/Ebox complex

 

 

 

M

123456718910

Figure 15. CREB, USF-l, USP-2, and phosphorylated c-Jun binding to a COX-2
probe with the overlapping CRE-llE-box probe. EMSA supershift assays were
performed with a double-stranded 32P-labcled COX-2 probe containing the overlapping
CRE/E-box. The probe was incubated with a nuclear extract from RAW 264.7 cells
stimulated with LPS (200 ng/ml) for 0, 1, or 12 hr (0 or 1 hr for C) and either an IgG
control antibody or an antibody to (A and C) CREB, USF-l, USF-2, or phosphorylated c-
Jun, (B) CREB or ATF-2. The CRE-1, and E-box complexes are indicated with closed
arrows and the supershifted complexes are indicated with open arrows.

 

80

A 031 mam Dill ”iii!!!
“can -@:131m
Probe WT mAP1 mCRE1 double mutant
LPS(hr011201120112 0112

I I < AP-1 complex
.6 . ' . « CRE-1E-box complex

 

 

 

 

 

 

 

<1 Free probes

123456789101112

Probe H3] 333113813
Cold Probe NONE WT mAP-1 mCRE-1mAP-1/mCRE-1

LPS(hr)01120112011201120112

< AP-1 complex
.. . (— CRE-1/E-box complex

 

<— Free probes
“W

12 34 5 67 8 9101112131415

 

 

 

Figure 16. Specific binding of nuclear protein to the AP-l/CRE-l/E-box probe. A
double-stranded 32P-labeled 39 bp probe containing AP-l and CRE-I/E-box site was
incubated with nuclear extracts from RAW 264.7 cells stimulated without or with LPS
(200 ng/ml) for 1 or 12 hr. A. WT 39 bp probe that did not contain any mutations or
probes with a mutation on either or both AP-l and CRE-1 were used for EMSA. AP-l
and CRE-l/E-box complexes are indicated with the arrows. B. WT 32P-labeled 39 bp
probe was incubated with each of the three extracts in the presence or absence of 20
molar excess of unlabeled WT, mutant AP-l, mutant CRE-1, or mutant AP-l/mutant
CRE-1. AP-l and CRE-l/E-box complexes are indicated with the arrows.

81

 

Probe '13] CRE1 rm
Antibodies IgG p-c-Jun CREB USF-1 USP-2

LPS(hr)01,120112011201120112
in: .1311

. - .. '3‘
,. . '. _
. 1‘ _ ,
l e‘ ‘
.' - , .1
1 . 1 - s
u
1. l
_
54*} - z ‘0- ’
1
L‘ ‘
’(n
s
,1.

OQSOQQHT’ 3.2

 

 

    

USF1/USF2 SS
p-c-Jun SS
CREB SS

¢_2_ CRE/Ebox complex

     

 

 

123456789101112131415

 

Figure 17. CREB/ATF and AP-l transcription factors bind to the AP-l/CRE-l/E-
box probe. An EMSA supershift assay was performed. A double-stranded 32P-labeled
41 bp probe containing AP—l and overlapping CRE-llE-box element was incubated with
a nuclear extract from RAW 264.7 cells stimulated with LPS (200 ng/ml) for 0, 1, or 12
hr, and either a control IgG antibody or an antibody to phosphorylated c-Jun, CREB,
USF—l, or USP-2. The P-c-Jun, CREB, USF—l, and USE-2 supershifted complexes are
indicated with open arrows and the CRE-l/E-box complexes are indicated with closed
arrows.

82

 

composition of the NF-KB dimer by EMSA supershifts, p65 binding is increased at 1 hr
and decreased after 4 hr whereas p50 association increases from 0-12 hr (Fig. 188).
Similar to the in vitro pattern of c-Jun recruitment, c-Jun binding in vivo is increased 1 hr
after LPS treatment, is decreased at 4 hr and then is increased again at 12 hr (Fig. 18D).
Consistent with increased COX-2 gene transcription (Fig. 9), the transcriptional
coactivators CBP and p300 as well as RNA polymerase II associate with the COX-2
promoter in response to LPS treatment (Fig. 18E).

Collectively, the results the EMSA supershift assays and the ChIP analyses are
qualitatively and semi-quantitatively consistent and suggest that there is a distinct
temporal pattern to the binding of different transcription factors to different cis-acting

elements in the COX-2 promoter in response to LPS stimulation.

Effect of dominant negative transcription factors on COX-2 transcriptional
activation. To investigate the mechanism whereby CREB regulates COX-2 transcription,
a dominant negative CREB called ACREB, which cannot bind DNA, was cotransfected
into RAW264.7 cells along with the COX-2 promoter luciferase reporter construct (Fig.
19A). Transfection of increasing amounts of ACREB lead to a reduction in LPS-
inducible luciferase activity (Fig. 19A), suggesting that recruitment of endogenous
cofactors to the promoter by native CREB is required for LPS-induced COX-2
transcription in RAW 264.7 cells. The COX-2 promoter has two CRE sites, both of
which can bind CREB (Fig. 11, 15). To determine the impact of the interaction with
CREB at each of the CRE sites, the ACREB expression vector was co-transfected with

reporter constructs driven by either the native mCOX-2 promoter or a version of the

83

 

 

Figure 18. Chromatin immunoprecipitation (ChIP) assays to identify transcription
factors associated with the mCOX-2 promoter in LPS-stimulated RAW 264.7 cells.
A. RAW 264.7 cells were stimulated with LPS for various times (0, 1, 4 or 12 hr) and
PCR analyses were performed on three-fold serial dilutions of the input chromatin to
establish that the amounts of PCR reaction products are proportional to the amounts of
starting material. B-F. PCR analysis of DNA from the ChIP assays. Mock
immunoprecipitation with IgG (B-F) was performed as a negative control and PCR was
performed using the same primers. Chromatin from the RAW 264.7 cells was diluted
1:10 and the samples were processed through the ChIP protocol as described in the
Methods section. Antibodies to p65 or p50 were used for (B), antibody to CREB-l was
used for (C), c-Jun antibody was used for (D), antibodies to CBP, p300, RNA polymerase
II were used for (E), and USF-l and USP-2 for (F). GAPDH primers were used as
negative controls for the PCR.

84

A

 

 

 

 

 

LPS (hr) 0 1 4 12
Chromatin lnpm ‘_ ‘_ _. ‘—
.. arm-1. inn-5 ~"e ' 0*«3 r”e ‘ {my ‘— GAPDH
,2. ..... - 1 ..... ..... .1... <1 cox-2
8 Antibodies IgG p65 p50
LPS (hr) 0 1 4 12 0 1 4 12 0 1 4 12
<- GAPDH
m --- _— <(- COX-2
C Antibodies IgG CREB
LPS (hr) 0 1 4 12 0 1 4 12

<7 GAPDH
1 one! " m < COX'2

D Antibodies IgG c~Jun
LPS(hr)01412 01412

1! v---<COX'2

 

<~—— GAPDH

E Antibodies IgG CBP p300 Pol ll
LPS(hr)0112011201120112

“usual-gun ~11. << COX-2

 

 

4 GAPDH

Antibodies IgG USP-1 USF-2
LPS(hr)0112 0112 0112

----&-¢00x_2

 

< GAPDH

85

promoter with individual mutantions in either CRE-1 or CRE-2 (Fig. 19B). Although
expression of the mutant CRE-1 reporter construct lead to a more substantial reduction in
reporter activity than expression of the mutant CRE-2 construct, both mutations resulted
in a significant reduction in reporter activity compared to intact mCOX-2 promoter.
Furthermore, cotransfection of each of the mutant CRE reporters with ACREB resulted in
a comparable fold reduction in reporter activity (Fig. 19B). These results indicate that
LPS-induced expression of mCOX-2 depends on CREB binding through both the CRE-1
and the CRE-2 and suggests that another transcription factor may also be activating
COX-2 expression through the CRE-1.

To evaluate the role of NF-KB activation in this system, RAW 264.7 macrophages
were cotransfected with the COX-2 reporter construct and a dominant negative IKB (IKB
S/R) that fails to release p65/p50 after activation and thus traps NF-KB in the cytoplasm
(Fig. 19C). Again, transfection of increasing amounts of the dominant negative
expression vector lead to a reduction in mCOX-2 transcriptional activity. This suggests

that p65/p50 is also required for COX-2 transcription.

CBP and p300 are both involved in COX-2 transcriptional regulation. CBP
and p300 are homologous coactivators that interact with many trans-acting transcription
factors including CREB, NF-KB, and c-Jun (31, 32). To determine the influence of CBP
and p300 on LPS-induced COX-2 transcriptional regulation, we overexpressed each of
these coactivators and evaluated the effect on COX-2 reporter activity. In both cases,
LPS-inducible COX-2 luciferase activity was increased with increasing amounts of CBP

and p300 expression vector (Fig, 19D, 19E). This suggests that transcriptional

86

350 -

-l— LPS-*-

411-1733 '

300 4

 

_,.
o
5
2 1

25.9—51.1

_.. .. 1_.
O 0
5 0
2

 

 

 

4.5

0.5

ACREB (P9)

160 r

 

 

I] LPS-
. LPS+

 

 

140 r

120 *-

m m
8-93m

0
6

 

 

87

400
350
300
250 '
200
150 ’

0 05 1 15 2 25 3 35
IKB SIR (pg)

LPS- "
—_I- LPS+

 

RLUIrenilla

 

 

 

 

901

 

li—o— LPS-7

 

RLU/p-gal

30~

20 ~ .4
10 .

0 0.2 0.4 0.6 0.8 1 1.2
CBP lug)

 

 

 

 

 

88

 

 

 

 

 

 

 

 

1200 —
1000 f
g. 800 ;
'E
g 600
D
at
400 '
200 __._, A
1 +—
F +
0 I ._ _l 1 l __,.a____l_. ___._1__._.__ _-.__._._____1__ _-__l__.._ __l
0 0.5 1 1.5 2 2.5 3 3.5 4 4.5
03006191

Figure 19. Functional assays of COX-2 transcriptional regulation in LPS-treated
RAW 264.7 cells. RAW 264.7 cells were transiently co-transfected with the indicated
amounts of ACREB expression plasmid (A), IKB expression plasmid (C), CBP
expression plasmid (D), or p300 expression plasmid (E) as well as 1 pg of COX-2
luciferase promoter reporter plasmid and 0.5 pg of the renilla (A, C, and E) or B-
galactosidase expression plasmid (D). ACREB (cannot bind to DNA) and [KB S/R (traps
p65/p50 heterodimer in the cell cytoplasm) suppressed COX-2 promoter activity (A and
C respectively) and CBP and p300 overexpression increased COX-2 promoter activity (D
and E) in LPS-treated RAW 264.7 cells. Cells were stimulated with 200 ng/ml of LPS
for 12 hr after 24 hr of transfection and cell extracts were prepared and processed to
measure luciferase activity. Data represent two independent experiments performed in
duplicate. B. Both CRE-l and CRE-2 element require CREB binding for LPS-
stimulated COX-2 transcription in RAW 264.7 cells. RAW 264.7 cells were transiently
co—transfected with 1 pg of ACREB expression vector and 1 pg of wild type (WT),
mutant CRE-1, or mutant CRE-2 COX-2 promoter construct and 0.5 pg of the B-
galactosidase expression plasmid for measuring transfection efficiency. Data represent
three independent experiments performed in duplicate. Error bars represent the standard
deviation of the average values attained from all three experiments. *P<0.05 and
**P<0.01 for WT plasmid-transfected LPS-treated cells vs. mutant COX-2 construct
and/or ACREB expression plasmid-transfected LPS-treated cells.

89

coactivators, CBP and p300 are involved in LPS-induced COX-2 transcriptional

activation in RAW 264.7 cells.

P50 and phosphorylated c-Jun are uniquely required for the middle phase of
COX-2 gene transcription. Consistent with Northern blot analysis (Fig. 9), semi-
quantitative RT-PCR analysis Showed that COX-2 mRNA levels increased over the 12 hr
period of LPS treatment and that there are three phases (Fig. 20, top panel). Our ChIP
data suggest that binding of both p50 homodimers and phosphorylated c-Jun to the COX-
2 promoter increase from 4 to 12 hr of LPS treatment (Fig. 188 and 18D). To determine
the relative contribution of phosphorylated c-Jun and p50 at the middle and late phases of
COX-2 induction, JNK and p50 inhibitors were added separately and in combination 3.5
hrs after initiating the LPS treatment and the COX-2 mRNA levels were analyzed by
semi-quantitative RT-PCR at 4, 6, 9 and 12 hr (Fig. 20). COX-2 gene transcription was
reduced by about half by the individual inhibitors and was completely abrogated at 6 hrs
after LPS treatment in cells treated with both JN K and p50 inhibitors. However, COX-2
expression begins to recover at the 9 and 12 hr time points (Fig. 20) likely as a result of
the involvement of other transcription factors such as phosphorylated CREB or C/EBP.
This experiment demonstrates that the contribution of different transcription factors

varies with time during LPS-induced COX-2 expression.

90

A LPS(hr)012 4 6 912
~~~N~fl w/o inhibitors

—‘----~ Actin

1' "' "" ~ JNK inhibitor

-’.-- Actin
he'd-ii! p50 inhibitor
uncle-- Actin

in New Both inhibitors

'- 'I' ~- Actin

V

 

 

Inhibitors added
140 1 ”4:11.76" ' _,_
+JNK Inhibitor
120 r +9501nmbitor
-O—Both inhib:tors

 

 

 

COX-ZIActin

 

 

 

14

 

 

LPS (hr)

 

Figure 20. Effects of JNK and p50 inhibitors on COX-2 mRNA induction in LPS-
treated RAW 264.7 macrophages as determined by semi-quantitative RT-PCR. A.
Cells were stimulated for 1, 2, 4, 6, 9, or 12 hr with or without LPS (200 ng/ml). and JNK
or p50 inhibitors were added after 3.5 hrs after LPS treatment as described in the
Methods section. Total RNA was extracted and subjected to RT-PCR using specific
primers for COX-2 and B-aotin (internal control), and agarose gels stained with
cybergreen. B. Densitometric analysis combining results from two independent
experiments. COX-2 values were normalized to B-actin values in all experiments.

91

 

 

Discussion

LPS and certain cytokines and growth factors increase the expression of COX-2
which, in turn, leads to the formation of pro-inflammatory prostaglandins. Specific
COX-2 inhibitors such as celecoxib and rofecoxib are effective anti-inflammatory and
analgesic agents. While the mechanism of COX-2 transcription in macrophage cells is
complex, resolving the complicated network of regulatory events controlling COX-2
expression during inflammation will likely uncover new potential clinical targets for
lowering COX-2 activity in a cell specific manner. In this study, we have used LPS-
treated RAW 264.7 cells as a model to study the role of COX-2 transcription and how it
is controlled during an acute inflammatory response. We have (a) identified three
previously unoharacterized, functional cis-elements in the COX-2 promoter in addition to
the three that had been reported previously, (b) catalogued the binding of transcription
factors to each element over a 12 hr time course following LPS treatment, (c) showed that
there are at least three distinct temporal phases of COX-2 transcriptional activation, and
((1) provided evidence that each phase involves the participation of unique combinations

of cis-elements and trans-activating factors.

LPS treatment of RAW264.7 cells increases the rate of COX-2 transcription.
We first established using nuclear run-on experiments and measurements of mRNA
accumulation that LPS treatment causes an increase in the rate of COX-2 gene
transcription that continues for 12 hr but occurs in distinct early, middle and late phases.
COX-2 transcription is rapid for the first 4 hrs of LPS treatment (early phase), then there

is a slowing of the transcription rate during the next 2-4 hrs (middle phase), and finally,

92

the rate of COX-2 gene transcription increases again between 8-12 hrs (late phase). The
sustained COX-2 mRNA expression observed in LPS-treated RAW 264.7 cells contrasts
with the more transient inducible COX-2 expression observed in other cell types and in
response to other agonists (e.g. serum-induced COX-2 expression in murine fibroblasts
(17, 33) where gene transcription rates also increase rapidly but with COX-2 mRNA
levels peaking within one hr and then decreasing to basal levels within 2-3 hr. Although
the rate of COX-2 transcription is significantly increased in LPS-treated RAW264.7 cells,
it has been previously reported that the increased amount of COX-2 mRNA in response
to LPS is a result of a decrease in the rates of post-transcriptional processing (34). Our
studies focus on the transcriptionally modulated aspects of COX-2 expression and cannot

rule out the participation of mRNA stability in this process.

Cis-acting elements functional in LPS-induced COX-2 gene expression.
Previously published reports have identified several cis-acting elements of the murine
COX-2 promoter that are necessary for a response to LPS. These elements include a
CRE (CRE-1) at -59/-52 (7), a C/EBP site at —138/-130 (28), and an NF-KB response
element at -401/—393 (5, 6, 9, 35) (Fig. 8). In addition, it has been shown that inhibition
of NF-KB activation with specific inhibitors or decoy Oligonucleotides inhibits COX-2
activation (36-40). Using promoter reporter assays, we have identified a second CRE
(CRE-2) located at -447/-440 and established that the AP-l site located at -73/-61 is
necessary for maximal LPS induction of the murine COX-2 gene (Fig. 8). Additionally,
we have provided evidence for a role of the E-box element at -53/-48 in repression of

mCOX-2 transcription.

93

T tans-acting factors functional in LPS-induced COX-2 gene expression.
Using EMSA and ChIP assays, we found that AP-l or CREB bind to the CRE-1 site.
Studies with dominant negative ACREB suggest that CREB binding to both CRE-1 and
CRE-2 is important in COX-2 transcriptional activation. USF transcription factors bind
to the E-box that overlaps the CRE-1 site. However, binding of AP-l or CREB to the
CRE-1 site and binding of USF-1/2 to the E-box are mutually exclusive. Unlike other
systems where the E-box is involved in activation of COX-2 transcription (15, 41, 42),
our promoter reporter assays indicate that the E-box in the murine COX-2 promoter is
involved in repression in RAW 264.7 cells. Mestre et al. (14) reported that the E-box
mediates COX-2 transcriptional activation in response to LPS and involves USF-l
binding to the E-box; however, their study used a reporter gene under the control of a
short human COX-2 promoter construct (-327/+59) that did not contain the CRE-2 or
NF-KB element. There could also be species differences in COX-2 transcriptional
regulation that complicate the interpretation of the results. There are precedents for an E-
box mediating repression in other cell types. In mesangial cells USF-l and USP-2 trans-
repress IL-lB-induced iNOS transcription by binding to the E-box element (43).
However, in our studies USF-l and USF-2 overexpression did not lower COX-2
promoter activity. This suggests that an as yet unidentified repressor complex binds to
the E-box in LPS-treated RAW 264.7 cells to mediate transcriptional repression.

The AP-l element has been shown to be required for COX-2 promoter activation
in herpersvirus 6 (HHV—6)-infected monocytes (44), PMA-treated MC3T3 cells (45), and
fluid shear stress-treated osteoblasts (46). However, the AP-l site in LPS-induced COX-

2 transcription in RAW 264.7 cells had not previously been studied. Our results establish

94

that mutation of the AP-l site causes a decrease in promoter activity similar in magnitude
to that caused by mutation of CRE-1. Additionally, as shown by EMSA supersift assays,
members of the AP-l transcription factor family--phosphorylated c-Jun and c-fos--bind to
the AP-l site and activate the COX-2 gene at early time points. Phosphorylated c-Jun
homodimers are the predominant species bound to this site and play an important role in
the middle and late phases of COX-2 transcription.

We have also discovered that the p50/p65 heterodimer and the p50 homodimer
bind to the NF-KB site in a temporally regulated manner following LPS treatment. The
p50/p65 dimer predominates in the early phase and the p50 homodimer predominates in
the middle and late phases of LPS-induced COX-2 gene transcription.

CREB/ATF transcription factors bind to the CRE-2 site and studies with
dominant negative CREB suggest that the regulatory action of CREB occurs through the
CRE-2 site as well as the CRE-1 site.

Although not examined in the present studies, others have documented the
binding of several C/EBP transcription factors the C/EBP response element of the COX-2
promoter (25, 47).

Putative c-Ets sites at -734/-725 and -329/-320 in the mCOX-2 promoter have
been previously described as mediating COX-2 transcriptional activation in response to
LPS induced phosphorylation of PU.1 (48). We were unable to identify a functional c-
Ets element using promoter analyses. Sequence analysis of the mCOX-2 promoter using
the Genomatrix program (www.genomatrix.de) located a potential c-Ets site (5’-
GAGGAA-3’) at -312/-306, but this site is different from those previously reported. The

study that implicated PU.1 in mediation of COX-2 transcription in LPS-treated RAW

95

264.7 cells did not include promoter assays or evidence of PU.1 binding to an c-Ets site.
If PU.1 is fimotional in this system, it is likely binding to an element other than an c-Ets

site or activating COX-2 transcription indirectly.

Dynamics of COX-2 transcriptional activation. The results of nuclear run-on
assays Showing that there are three different phases of transcriptional activation and
EMSA and ChIP assays showing differences in the composition of the transcription
factors bound to cis-elements in the COX-2 promoter at different times after LPS
treatment suggest that the process of COX-2 gene activation involves sequential,
coordinated events. In testing this concept, we found that when inhibitors of Jun kinase
and p50 translocation were added together to RAW 264.7 cells 3.5 hr after initiating LPS
treatment that transcription was completely blocked at 6 hr, but that during the period
from 8-12, only partial inhibition of transcription was observed. Based on these
observations, we developed a model illustrating events that are likely occurring at the
COX—2 promoter at different times after LPS treatment (Fig. 21).

Even before LPS stimulation, CREB, USF-l and USF-2 are bound to their
cognate CRE-2, CRE-1 or E-box response elements within the mCOX-2 promoter (Fig.
21). In contrast, there is little or no binding of cognate transcription factors to the NF-KB,
C/EBP or AP-l sites. CBP, p300, and Pol II are associated with the COX-2 promoter at
low levels. The presence of these activating components may permit basal COX-2
expression. We have not examined how these latter factors are recruited to the COX-2

promoter prior to LPS induction, but unphosphorylated CREB can bind CBP/p300 (32)

96

A Unstimulated

 

97

D 6 hr after LPS stimulation

 

Figure 21. Model depicting the actions of transcription factors at the COX-2
promoter at different times after beginning LPS-induced COX-2 expression in
RAW 264.7 macrophages A. CBP/p300 interacts weakly with one of the
unphosphorylated CREB molecules bound at CRE-1 or CRE-2. B and C. CBP/p300 is
bound tightly through interactions with several phosphorylated transcription factors; an
alternative arrangement would involve CBP/p300 bound to P-CREB via CRE-2. D. This
formulation is based on experiments with JNK and p50 inhibitors which together
completely block transcription at 6 hr. E. Experiments with JNK and p50 inhibitors and
EMSAs indicate that promoter activity involves the NF—KB and AP-l sites plus one or
more additional sites such as CRE— 1/2 and C/EBP.

98

and such an interaction involving one of the two CREs could recruit CBP/p300 and
subsequently Pol II to the promoter.

During the early phase (0-4 hr) of LPS treatment (Fig. 21B), we speculate that
CREB bound at CRE-1 and CRE-2 becomes phosphorylated which enhances the
recruitment of coactivators such as CBP and p300 (32). Additionally, the 65/p50

heterodimer is the major species that binds to the NF-KB Site and p65 is presumably

phosphorylated, and the C/EBPB homodimer binds to the C/EBP element (25). In the
proximal region of the COX-2 promoter a heterodimer of newly phosphorylated c-Jun/c-
fos becomes bound to the AP-l Site. Phosphorylated p65, C/EBPB, and phosphorylated
o-Jun have all been shown to interact with CBP/p300 (49-51). This suggests that the
various activated transcription factors acting in concert may be recruiting CBP/p300 and
general transcription factors to the COX-2 promoter leading to active transcription.

Based on EMSA and ChIP assays and the experiment showing that the
combination of a JNK and a p50 inhibitor abolishes COX-2 induction at 4 hrs of LPS
treatment, the middle phase of COX-2 transcription (4-8 hr, Fig 21C and 21D) appears to
be dominated by the AP-l and NF-KB sites and presumably involves phosphorylated c-
Jun homodimers bound to the AP-l site and p50 homodimers bound to the NF-KB site.
p50 Homodimers are typically associated with negative regulation of gene transcription
(52), but there are reports suggesting that p50 homodimers can act as transcriptional
activators (53, 54).

The rate of COX-2 transcription increases at about 8 hrs of LPS after the middle
phase of induction and remains elevated at 12 hr (Fig. 21E). During the late stage of

induction (ca. 8-12 hr), there is increased phosphorylation of c-Jun such that the

99

concentration of phosphorylated c-Jun is increased and a relatively higher level of
phosphorylated c-Jun homodimer binds to the AP-l site. Binding of p50 homodimers to
the NF-KB sites also occurs and at levels comparable to those seen during the middle
phase of induction. The amount of CREB bound to the CRE-2 and CRE-1 elements
remains the same before and throughout the LPS treatment, however CREB may be
phosphorylated during the late phase of LPS stimulation. Binding of C/EBP transcription
factors to the C/EBP site may also contribute to enhanced transcription during the late
phase. Again, all these transcriptional activators are likely to be facilitating transcription

by binding to CBP/p300.

100

10.

References

Smith, W. L., D. L. DeWitt, and R. M. Garavito. 2000. Cyclooxygenases:
Structural, Cellular and Molecular Biology. Annu. Rev. Biochem. 69:149.

Marnett, L. J., and R. N. DuBois. 2002. COX-2: a target for colon cancer
prevention. Annu Rev Pharmacol Toxicol 42:55.

Smith, W. L., and R. Langenbach. 2001. Why there are two cyclooxygenases. J.
Clin. Invest. 107:1491.

Langenbach, R., C. D. Loftin, C. Lee, and H. Tiano. 1999. Cyclooxygenase-
deficient Mice: A Summary of Their Characteristics and Susceptibilities to
Inflammation and Carcinogenesis. Ann. N. Y. Acad. Sci. 889:52.

Hwang, D. 2001. Modulation of the expreession of cyclooxygenase-2 by fatty
acids mediated through Toll-like receptor 4 derived signaling pathways. FASEB J.
I 5 :255 6.

Lee, J. Y., J. Ye, Z. Gao, H. S. Youn, W. H. Lee, L. Zhao, N. Sizemore, and D. H.
Hwang. 2003. Reciprocal Modulation of Toll-like Receptor-4 Signaling Pathways
Involving MyD88 and Phosphatidylinositol 3-Kinase/AKT by Saturated and
Polyunsaturated Fatty Acids. J. Biol. Chem. 278:3 7041.

Mestre, J. R., P. J. Mackrell, D. E. Rivadeneira, P. P. Stapleton, T. Tanabe, and J.
M. Daly. 2001. Redundancy in the signaling pathways and promoter elements
regulating cyclooxygenase-2 gene expression in endotoxin-treated
macrophage/monocytic cells. J. Biol. Chem 276:3977.

Yamamoto, K., T. Arakawa, N. Ueda, and S. Yamamoto. 1995. Transcriptional
roles of nuclear factor kappa B and nuclear factor-interleukin-6 in the tumor

necrosis factor alpha-dependent induction of cyclooxygenase-2 in MC3T3-E1
cells. Journal of Biological Chemistry 2 70:31315.

Rhee, S. H., and D. Hwang. 2000. Murine TOLL-like receptor 4 confers
lipopolysaccharide responsiveness as determined by activation of NFkappa B and
expression of the inducible cyclooxygenase. J. Biol. Chem 2 75 :34035 .

Ogasawara, A., T. Arakawa, T. Kaneda, T. Takuma, T. Sato, H. Kaneko, M.
Kumegawa, and Y. Hakeda. 2001. Fluid shear stress-induced cyclooxygenase-2
expression is mediated by C/EBP beta , cAMP-response element-binding protein,
and AP-l in osteoblastic MC3T3-E1 cells. J. Biol. Chem 276: 7048.

101

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

Wu, M. H., C. A. Wang, C. C. Lin, L. C. Chen, W. C. Chang, and S. J. Tsai. 2005.
Distinct regulation of cyclooxygenase-2 by interleukin-lbeta in normal and

endometriotic stromal cells. J Clin Endocrinol Metab 90:286.

Ogasawara, A., T. Arakawa, T. Kaneda, T. Takuma, T. Sato, H. Kaneko, M.
Kumegawa, and Y. Hakeda. 2001. Fluid shear stress-induced cyclooxygenase-2
expression is mediated by C/EBP beta, cAMP-response element-binding protein,
and AP-l in osteoblastic MC3T3-E1 cells. J Biol Chem 276: 7048.

Chua, C. C., R. C. Hamdy, and B. H. Chua. 2000. Mechanism of transforming
grth factor-beta] -induced expression of vascular endothelial growth factor in
murine osteoblastic MC3T3-E1 cells. Biochim Biophys Acta 1497:69.

Mestre, J. R., D. E. Rivadeneira, P. J. Mackrell, M. Duff, P. P. Stapleton, V.
Mack-Strong, S. Maddali, G. P. Smyth, T. Tanabe, and J. M. Daly. 2001.
Overlapping CRE and E-box promoter elements can independently regulate
COX-2 gene transcription in macrophages. F EBS Lett 496:14 7.

Sayasith, K., N. Bouchard, M. Sawadogo, J. G. Lussier, and J. Sirois. 2004.
Molecular characterization and role of bovine upstream stimulatory factor 1 and 2
in the regulation of the prostaglandin G/H synthase-2 promoter in granulosa cells.
J Biol Chem 279:632 7.

Juttner, S., T. Cramer, S. Wessler, A. Walduck, F. Gao, F. Schmitz, C. Wunder,
M. Weber, S. M. Fischer, W. E. Schmidt, B. Wiedenmann, T. F . Meyer, M.
Naumann, and M. Hooker. 2003. Helicobacter pylori stimulates host
cyclooxygenase-2 gene transcription: critical importance of MEK/ERK-dependent
activation of USF1/-2 and CREB transcription factors. Cell Microbiol 5 :821 .

DeWitt, D., and E. Meade. 1993. Serum and glucocorticoid regulation of gene
transcription and expression of the prostaglandin H synthase-1 and prostaglandin
H synthase-2 isozymes. Arch. Biochem. Biophys. 306:94.

Riese, J ., T. Hoff, A. Nordhoff, D. DeWitt, K. Resch, and V. Kaever. 1994.
Transient expression of prostaglandin endoperoxide synthase-2 during mouse
macrophage activation. J. Leukoc. Biol. 55:476.

Kraemer, S. A., K. A. Arthur, M. S. Denison, W. L. Smith, and D. L. DeWitt.
1996. Regulation of prostaglandin endoperoxide H synthase-2 expression by
2,3,7,8,-tetrachlorodibenzo-p-dioxin. Archives of Biochemistry and Biophysics
330:3 1 9.

Chen, C.-C., K.-T. Chiu, Y.-T. Sun, and W.-C. Chen. 1999. Role of the cyclic
AMP-protein kinase A pathway in lipopolysaccharide-induced nitric oxide
synthase expression in RAW 264.7 macrophages. Involvement of
cyclooxygenase-2. J. Biol. Chem 274:31559.

102

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

Riese, J ., T. Hoff, A. Nordhoff, D. L. DeWitt, K. Resch, and V. Kaever. 1994.
Transient expression of prostaglandin endoperoxide synthase-2 during mouse
macrophage activation. J. Leukoc. Biol. 55:4 76.

Aderem, A., D. Cohen, S. Wright, and Z. Cohn. 1986. Bacterial
lipopolysaccharides prime macrophages for enhanced release of arachidonic acid
metabolites. J. Exp. Med. 164:165.

Lee, S., E. Soyoola, P. Chanmugarn, S. Hart, W. Sun, H. Zhong, S. Liou, D.
Simmons, and D. Hwang. 1992. Selective expression of mitogen-inducible

cyclooxygenase in macrophages stimulated with lipopolysaccharide. J. Biol.
Chem 26 7:25 934 .

Wingerd, B. A. 2001. The transcriptional regulation of prostaglandin synthase-2
in lipopolysaccharide stimulated macrophage cells. In Microbiology and
Molecular Genetics and Cell and Molecular Biology Program. Michigan State
University, East Lansing, p. 145.

Caivano, M., B. Gorgoni, P. Cohen, and V. Poli. 2001. The Induction of
Cyclooxygenase-2 mRNA in Macrophages ls Biphasic and Requires both
CCAAT Enhancer-binding protein beta (C/EBPbeta ) and C/EBPdelta
Transcription Factors. J. Biol. Chem 276:48693.

Herschman, H. R. 1994. Regulation of prostaglandin synthase-1 and
prostaglandin synthase-2. Cancer. Metastasis. Rev. 13:241.

Tanabe, T., and N. Tohnai. 2002. Cyclooxygenase isozymes and their gene
structures and expression. Prostaglandins Other Lipid Mediat 68-69: 95 .

Wadleigh, D. J ., S. T. Reddy, E. Kopp, S. Ghosh, and H. R. Herschman. 2000.
Transcriptional activation of the cyclooxygenase-2 gene in endotoxin-treated
RAW 264.7 macrophages. J. Biol. Chem 275 :6259.

Tanabe, T., and N. Tohnai. 2002. Cyclooxygenase isozymes and their gene
structures and expression. Prostaglandins Other Lipid Mediat 68-69: 95 .

Viatour, P., M. P. Merville, V. Bours, and A. Chariot. 2005. Phosphorylation of
NF-kappaB and IkappaB proteins: implications in cancer and inflammation.
Trends Biochem Sci 30:43.

Gerritsen, M. E., A. J. Williams, A. S. Neish, S. Moore, Y. Shi, and T. Collins.
1997. CREB-binding protein/p300 are transcriptional coactivators 45 f if. 65.
PNAS 94:292 7.

103

32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

Goldman, P. S., V. K. Tran, and R. H. Goodman. 1997. The multifunctional role
of the co-activator CBP in transcriptional regulation. Recent Prog Horm Res
52: I 03.

Evett, G. E., W. Xie, J. G. Chipman, D. L. Robertson, and D. L. Simmons. 1993.
Prostaglandin G/H isoenzyme 2 expression in fibroblasts: regulation by

dexamethasone, mitogens, and oncogenes. Archives of Biochemistry and
Biophysics 306: 1 69.

Barrios-Rodiles, M., G. Tiraloche, and K. Chadee. 1999. Lipopolysaccharide
modulates cyclooxygenase-2 transcriptionally and posttranscriptionally in human

macrophages independently from endogenous IL-1 {beta} and TNF-{alpha}. J.
Immunol. 163:963.

Hwang, D., B. C. Jang, G. Yu, and M. Boudreau. 1997. Expression of mitogen-
inducible cyclooxygenase induced by lipopolysaccharide: mediation through both
mitogen-activated protein kinase and NF -kappaB signaling pathways in
macrophages. Biochem. Pharmacol. 54:8 7.

D'Acquisto, F ., T. Iuvone, L. Rombola, L. Sautebin, M. Di Rosa, and R.
Carnuccio. 1997. Involvement of NF-kappaB in the regulation of

cyclooxygenase-2 protein expression in LPS-stimulated J 774 macrophages. FEBS
Lett 418:] 75.

Sub, N., T. Honda, H. Finlay, A. Barchowsky, C. Williams, N. Benoit, Q. Xie, C.
Nathan, G. Gribble, and M. Sporn. 1998. Novel triterpenoids suppress inducible
nitric oxide synthase (iNOS) and inducible cyclooxygenase (COX-2) in mouse
macrophages. Cancer Res. 58: 71 7.

Abate, A., S. Oberle, and H. Schroder. 1998. Lipopolysaccharide-induced
expression of cyclooxygenase-2 in mouse macrophages is inhibited by
chloromethylketones and a direct inhibitor of NF-kappa B translocation.
Prostaglandins Other Lipid Mediat 56:277.

Roshak, A. K., J. R. Jackson, K. McGough, M. Chabot—Fletcher, E. Mochan, and
L. A. Marshall. 1996. Manipulation of distinct NFkappaB proteins alters
interleukin-lbeta-induced human rheumatoid synovial fibroblast prostaglandin E2
formation. J. Biol. Chem. 271:31496.

von Knethen, A., D. Callsen, and B. Brune. 1999. Superoxide attenuates
macrophage apoptosis by NF-{kappa}B and AP-l activation that promotes
cyclooxygenase-2 expression. J. Immunol. 163:2858.

Wu, Y. L., and M. C. Wiltbank. 2002. Transcriptional regulation of the
cyclooxygenase-2 gene changes from protein kinase (PK) A- to PKC-dependence
after luteinization of granulosa cells. Biol Reprod 66:1505.

104

42.

43.

44.

45.

46.

47.

48.

49.

50.

51.

Sirois, J ., K. Sayasith, K. A. Brown, A. E. Stock, N. Bouchard, and M. Dore.
2004. Cyclooxygenase-2 and its role in ovulation: a 2004 account. Hum Reprod
Update 1 0:3 73 .

Gupta, A. K., and B. C. Kone. 2002. USF-l and USF-2 trans-repress IL-lbeta-
induced iNOS transcription in mesangial cells. Am J Physiol Cell Physiol
283: C1 065.

Janelle, M. E., A. Gravel, J. Gosselin, M. J. Tremblay, and L. Flamand. 2002.
Activation of monocyte cyclooxygenase-2 gene expression by human herpesvirus

6. Role for cyclic AMP-responsive element-binding protein and activator protein-
1. J Biol Chem 277:30665.

Okada, Y., O. Voznesensky, H. Herschman, J. Harrison, and C. Pilbeam. 2000.
Identification of multiple cis-acting elements mediating the induction of

prostaglandin G/H synthase-2 by phorbol ester in murine osteoblastic cells. J Cell
Biochem 78:197.

Ajubi, N. E., J. Klein-Nulend, M. J. Alblas, E. H. Burger, and P. J. Nijweide.
1999. Signal transduction pathways involved in fluid flow-induced PGE2
production by cultured osteocytes. Am J Physiol 276:E1 71 .

Inoue, H., C. Yokoyama, S. Hara, Y. Tone, and T. Tanabe. 1995. Transcriptional
regulation of human prostaglandin-endoperoxide synthase-2 gene by
lipopolysaccharide and phorbol ester in vascular endothelial cells. Involvement of

both nuclear factor for interleukin-6 expression site and cAMP response element.
J. Biol. Chem. 270:24965.

Joo, M., G. Y. Park, J. G. Wright, T. S. Blackwell, M. L. Atchison, and J. W.
Christrnan. 2004. Transcriptional regulation of the cyclooxygenase-2 gene in
macrophages by PU. 1. J Biol Chem 279:6658.

Zhong, H., R. E. V011, and S. Ghosh. 1998. Phosphorylation of NF -kappa B p65
by PKA stimulates transcriptional activity by promoting a novel bivalent
interaction with the coactivator CBP/p300. Mol Cell 1 :66].

Chen, L. C., B. K. Chen, J. M. Chang, and W. C. Chang. 2004. Essential role of c-
Jun induction and coactivator p300 in epidermal growth factor-induced gene
expression of cyclooxygenase-2 in human epidermoid carcinoma A431 cells.
Biochim Biophys Acta 1 683 :38.

Kovacs, K. A., M. Steinmann, P. J. Magistretti, O. Halfon, and J. R. Cardinaux.

2003. CCAAT/enhancer-binding protein family members recruit the coactivator
CREB-binding protein and trigger its phosphorylation. J Biol Chem 278:3 6959.

105

52.

53.

54.

Baeuerle, P. A., and D. Baltimore. 1996. NF -kappa B: ten years after. Cell 87:13.

Kurland, J. F., D. W. Voehringer, and R. E. Meyn. 2003. The MEK/ERK pathway
acts upstream of NF kappa B1 (p50) homodimer activity and Bcl-2 expression in
a murine B-cell lymphoma cell line. MEK inhibition restores radiation-induced
apoptosis. J Biol Chem 278:32465.

Agrawal, A., H. Cha-Molstad, D. Sarnols, and I. Kushner. 2003. Overexpressed
nuclear factor-kappaB can participate in endogenous C-reactive protein induction,
and enhances the effects of C/EBPbeta and signal transducer and activator of
transcription-3. Immunology 108.539.

106

r

CHAPTER 3

TRANSCRIPTIONAL REPRESSION OF CYCLOOXYGENASE-2 THROUGH
THE E-BOX ELEMENT IN LIPOPOLYSACCHARIDE-STIMULATED
MACROPHAGE CELLS
Summary

The cyclooxygenase-2 (COX-2) enzyme is highly induced by cytokines and
proinflammatory mediators such as bacterial endotoxin (lipopolysaccharide, LPS) in
monocytes and macrophages, leading to increased production of proinflammatory
prostaglandins that exert diverse actions in inflammation. COX-2 transcriptional
activation in RAW 264.7 murine macrophages is rapidly upregulated upon LPS treatment
and involves coordination of several cis-acting elements and trans-acting factors. As
mentioned in chapter 2, we have used promoter analysis to demonstrate that the E-box
element is involved in repression of COX-2 gene transcription in LPS-stimulated RAW
264.7 macrophages. Here, we examine the mechanism through which the E-box element
of COX-2 mediates COX-2 transcriptional inhibition.

Using electrophoretic mobility supershift assays, we determined that the USP-1,
USP-2, c-myc, and Miz-l transcription factors are constitutively bound to the E-box and
not further recruited in response to LPS treatment. Interestingly, overexpression of USF-
1 or USP-2 did not suppress COX-2 promoter activity, suggesting that E-box mediated
inhibition does not involve USF-l or USP-2 even though they can bind to the E-box

element of the COX-2 promoter.

107

Introduction

Cyclooxygenase (COX)-2 is one of two known COX isozymes (also known as
prostaglandin endoperoxide H synthase, PGHS), which catalyzes conversion of
arachidonic acid to prostaglandin H2 (PGH2), the precursor of prostaglandins,
prostacyclin, and thromboxane (1). Arachidonic acid is released from membrane
phospholipids in response to inflammatory stimuli such as LPS. Early in inflammation,
newly transcribed COX-2 appears to be responsible for the production of prostaglandins
whose overall function is to promote inflammation, fever, and pain (2).

In chapter 2, we described several cis-regulatory elements including a CRE-2
motif at -434/-428, an NF-KB element at -401/-393, a C/EBP site at -138/-130, an AP-l
site at -73/-61, and an overlapping CRE-1 and E-box element at -59/-48 that are involved
in COX-2 transcriptional regulation. We further suggested that the E-box is involved in
inhibition of COX-2 gene expression in LPS-treated RAW 264.7 cells.

The mouse COX-2 promoter contains a consensus E-box (5’-CACGTG-3’) which
is the principle binding site for members of the basic helix-loop—helix (b-HLH) and basic
helix-loop-helix leucine-zipper (b-HLH-LZ) transcription factor families. The bHLH
protein family is characterized by a basic DNA binding region adjacent to a helix-loop-
helix dimerization region, both of which are required for the formation of functional
DNA binding complexes (3). Upstream stimulatory factor (USF) is a bHLH-LZ protein
that binds to the consensus E-box sequence (3). The bHLH-LZ transcription factor
family also includes Myc (4) and Myc-subfamily factors Max (5), and Mad (6). There

are two variants of USF. USF-l and USP-2 are homologous genes which code for

108

 

 

structurally and functionally related proteins. Both USF proteins associate with E-box as
homo- or heterodimers to regulate transcription of their target genes (3).

USF has been implicated in activating COX-2 expression in Helicobacter pylori-
stimulated human gastric epithelial cells (7) and gonadotropin—treated granulosa cells (8).
However, USF has been shown to act as a transcriptional suppressor in glutamate-
cysteine ligase (GCLC) gene expression in rat lung epithelial L2 cells (9) and IL-18-
induced iNOS expression in mesangial cells (10). Another class of bHLH family
members is the Myc transcription factors. Myc-family members such as Max, Mad, and
Miz-l function as dimers by interacting with a partner protein (11). Myc can both
activate and repress transcription depending on the partner with which they
heterodimerize. For example, the Myc/Max heterodimer activates transcription while the
Myc/Miz-l heterodimer inhibits transcription (11).

To investigate the mechanism by which the E-box plays a suppressive role in
COX-2 gene expression, we identified transcription factors bound to the E-box of
mCOX-2 promoter in LPS-treated RAW 264.7 macrophage cells. We also studied the
role of USF in COX-2 inhibition. Although the E-box has proven to mediate
transcriptional repression of COX—2 in RAW cells, we have determined that USF

overexpression does not contribute to this suppression.

109

Materials and Methods

Antibodies. Miz-l antibody was purchased from Santa Cruz Biotechnology
(Santa Cruz, CA), and antibody to c-myc was purchased from Cell Signaling (Beverly,

MA).

Plasmids. The pCMV-Miz-l, pCMV -Miz-1APOZ, and pCMV-Miz-l (A190-
284) expression plasmids were kindly provided by Professor Martin Eilers (University of

Marburg) (11).

Cell culture, transfections, luciferase reporter assays, electrophoretic mobility

shift assays (EMSA), and all other antibodies and plasmids are described in the Materials

and Methods section in chapter 2.

110

Results

Transcription factor binding to the E-box element in the mCOX-2 promoter.
mCOX-2 promoter analysis including analysis of E-box mutations (Fig. 10) suggested
that the E-box plays an inhibitory role in LPS-stimulated RAW 264.7 macrophages. To
identify nuclear proteins bound to the E-box element, EMSA supershift assays were
performed using a 32P-labeled 25 bp double-standed DNA probe containing the
overlapping CRE-1 and E-box element (Fig. 15 & Fig. 21). As was described in chapter
2, two distinct complexes were formed with the CRE-I/E-box probe (Fig. 21, lanes 1-3)
and the amount of E-box protein complexes were not increased by LPS treatment. The
higher mobility complex was shifted by antibodies to Miz-l (Fig. 21, lanes 4-6), c-myc
(Fig. 21, lanes 7-9), USF-1 (Fig. 21, lanes 10-12), or USF-2 (Fig. 22, lanes 13-15). These
results indicate that the E-box is bound constitutively by Miz—l, c-myc, USF—1, and USF-
2. The CRE-I/E-box complex that was not shifted by antibodies against the latter

transcription factors involves CREB binding to CRE-l (Fig. 15).

Effect of transcription factors bound to the E-box element on mCOX-2
promoter activity. EMSA supershift assays indicated that USF-1 or USF-2 binds to the
CRE-l/E-box probe. To determine their influence on COX-2 transcription, USF-1, USF-
2, 0r USF-l T153A (a mutant missing a key phosphorylation site) expression plasmids
were co-transfected into RAW 264.7 cells along with the COX-2 promoter luciferase
construct (Fig. 22-24). Unexpectedly, USF-1, USF-2, or USF-1 plus USF-2
overexpression all caused a significant increase in luciferase activity (Fig. 22). This

suggests that these factors are involved in activating COX-2 transcription even though

11]

they bind to the E-box probe (Fig. 20) and are associated with the COX-2 promoter in
vivo (Fig. 18). However, the extent of transcriptional activation by LPS did not change
with USF-1 overexpression. Additionally, USF-1 T153A overexpression failed to
increase luciferase activity to the level of wild type USF-1 or USF-2, indicating that the
increase in COX-2 transcription by USF-1 requires T153 phosphorylation.
Overexpression of USF-1 or USF-2 along with a luciferase reporter driven by a mutant E-
box element of COX-2 promoter had the same activating effect as the wild type COX-2
promoter construct. These results indicate that USF-1 and USF-2 may not mediate COX-
2 activation through the E-box, suggesting that there is an unidentified element within the

COX-2 promoter that is responsive to USF transcription factors.

112

 

Probe
Antibodies IgG Miz-1 o-myc USF-1 USF-2

LPS(hr)o1120112011201120112

 

.4 .1 <6 USF1I2 33
<{— Miz-1Ic-myc SS
.Q . .'. 111‘ . 1 .21 1 1 pt *1 4’ <~CRE~1IEbox complex

 

 

+— Free probes

    

 

 

12 34 5'6 7 89101112131415

Figure 22. Transcription factor binding to the E-box probe. Nuclear extracts (5 pg)
from RAW 264.7 cells treated without or with LPS for 1 or 12 hr were incubated with
control IgG, Miz-l, c-myc, USF-l or USF-2 antibodies, then a double stranded 32F
labeled 25 bp probe containing overlapping CRE-1 and E-box was added. Miz-l , c-myc,
USF-1, and USF-2 supershifted complexes are indicated with open arrows and CRE-I/E-
box complex and free probe are indicated with closed arrows.

RLUIfl-gal

RLU/p-gal

200

180 ~

160
140
120
100

 

 

-o— LPS-

 

 

 

 

 

 

 

 

 

 

0.5 1 1 .5 2 2.5
USF-1 (pg)

 

1

0.5 1 1.5 2 2.5
USF-2 (pg)

114

C 250

 

El LPS-

 

 

 

RLUIB-gal

 

 

 

 

 

 

 

Expression plasmld

Figure 23. Effect of USF overexpression on LPS-induced COX-2 promoter activity.
RAW 264.7 macrophages were transiently co-transfected with 1 pg of luciferase reporter
driven by the COX-2 promoter the and indicated amounts of USF-l (A), USF-2 (B), or 1
pg of USF-l, USF-2, USF-l/2, or USFl-T153A expression plasmids (C). At 24 hr
posttransfection, cells were either not or treated with LPS for 12 hr. Luciferase activities
were measured in cell lysates and normalized to B—galactosidase activities. Values
represent the means of the results from duplicate samples. The results from a
representative experiment of three independent transfections are shown.

115

J

140

 

 

 

120

 

100

RLUIB-gal
J:- O) on
O O O

N
O

 

 

 

Figure 24. Effect of USF overexpression on LPS-induced WT or mutant E-box
COX-2 promoter activity. A reporter construct driven by the WT COX-2 promoter or a
mutant E-box COX-2 promoter having a mutated E-box were transiently co-transfected
with empty vector, USF-l, or USF-2 expression plasmid into RAW 264.7 macrophage
cells and incubated for 24 hr. LPS was added and cells were incubated for an additional
12 hr before being harvested and assayed for luciferase activity. Results of promoter
assays are normalized to the expression of co-transfected B-galactosidase and are the
average of two experiments in duplicate :SD. The sequence of the E-box mutation is
shown in Table III.

116

Discussion

In this study, we found evidence that the E-box element of the mCOX-2 promoter
mediates transcriptional repression in LPS-stimulated RAW 264.7 cells. EMSA
supershift assays revealed that the E-box element is bound by bHLH transcription family
members, USF-1, USF-2, c-myc, or Miz-l. Consistent with this result, ChlP anlaysis
showed that USF-1 and USF-2 are associated with the COX-2 promoter in viva (Fig. 18).
Binding of these proteins was observed with nuclear extracts from unstimulated RAW
264.7 cells and the level of binding did not increase or decrease afier LPS treatment (Fig.
21). We speculated that USF-l or USF-2 may function as a repressor by binding to the
E-box element of COX-2 promoter. However, USF overexpression did not cause a
decrease in COX-2 promoter activity as expected (Fig. 22). Contrary to our expectation,
USF overexpression increased the luciferase activity in both basal and LPS treated
samples by approximately 2.5 fold, respectively. The overall fold increases before and
after LPS treatment did not change with or without USF overexpression.

USF-l has a phosphorylation site at T153 which can be phosphorylated by
various kinases including p38, protein kinase A (PKA), protein kinase C (PKC), cdkl,
and PI3-kinase (12-15). While p38, PKA, PKC, and cdkl kinase-mediated
phosphorylation increases USF binding to the E-box, PI3K phosphorylation inhibits its
binding to this element. In our overexpression studies, mutation of the USF-1
phosphorylation site (USF-1-T153A) abolished its ability to increase both basal and LPS-
induced COX-2 promoter activities, indicating that USF-1 activation of COX-2 requires

phosphorylation of T1 53.

117

Cotransfection assays with a mutant E-box COX-2 promoter construct (Fig. 23)
suggest that USF-1 and USF-2 do not function through the E-box motif to activate COX-
2 expression but rather may bind another region of the COX-2 promoter. Recently, USF-
1 has been shown to associate in vivo with Fral, a member of the b-Zip protein family, to
promote transcription, demonstrating the cross-talk between distant members of the
protein family (16). Thus, it is also possible that USF might interact with other
transcription factors to increase transcriptional activity in our system.

Another potential mechanism by which the E-box motif may repress COX-2
expression in LPS-treated murine macrophage cells is through the Myc/Miz-l
transcriptional repressor complex. The Myc protein forms a binary activating complex
with its partner protein Max. However, Max proteins may interact with the zinc-finger
transcription factor Miz-l to form a ternary repressor complex (11). Our EMSA
supershifi assays showed that c-myc or Miz-l also binds to the E-box element of mCOX-
2 promoter. The functional role of the Myc/Miz-l transcription factor in LPS-stimulated
RAW 264.7 cells still needs to be investigated.

The E-box motif of the COX-2 promoter has been reported to be involved in
activation of COX-2 transcription through the USPS in other systems including human
gastric epithelial cells by Helicobacter pylori (7) and granulosa cells by gonadotropin (8).
However, the E-box as a repressor element in COX-2 gene expression had not previously
been reported. Elucidation of the molecular basis for the differences between systems
where the E-box acts as a positive regulator and those where the E-box as a negative
regulator will greatly improve our understanding of COX-2 transcriptional regulation.

Pharmaceutically modulating the factors associated with this bifunctional E-box element

118

may allow COX-2 gene expression to be regulated a cell or tissue specific fashion. For
example, inhibiting the interaction between regulatory trans-acting factors and the E-box
in macrophage would be expected to lead to increased COX-2 expression in response to
LPS, but would likely lead to reduced COX-2 expression in granulosa cells during

ovulation.

119

10.

References

Smith, W., D. DeWitt, and R. Garavito. 2000. Cyclooxygenases: structural,
cellular, and molecular biology. Annu Rev Biochem 69:145.

Narumiya, S., and G. A. F itzGerald. 2001. Genetic and pharmacological analysis
of prostanoid receptor function. Journal of Clinical Investigation 1 08:25.

Sirito, M., S. Walker, Q. Lin, M. T. Kozlowski, W. H. Klein, and M. Sawadogo.
1992. Members of the USF family of helix-loop-helix proteins bind DNA as
homo- as well as heterodimers. Gene Expr 2:231.

Murre, C., P. S. McCaw, H. Vaessin, M. Caudy, L. Y. Jan, Y. N. Jan, C. V.
Cabrera, J. N. Buskin, S. D. Hauschka, A. B. Lassar, and et al. 1989. Interactions
between heterologous helix-loop-helix proteins generate complexes that bind
specifically to a common DNA sequence. Cell 58:53 7.

Blackwood, E. M., and R. N. Eisenman. 1991. Max: a helix-loop-helix zipper
protein that forms a sequence-specific DNA-binding complex with Myc. Science
251:121 1.

Ayer, D. E., L. Kretzner, and R. N. Eisenman. 1993. Mad: a heterodimeric partner
for Max that antagonizes Myc transcriptional activity. Cell 72:211.

Juttner, S., T. Cramer, S. Wessler, A. Walduck, F. Gao, F. Schmitz, C. Wunder,
M. Weber, S. M. Fischer, W. E. Schmidt, B. Wiedenmann, T. F. Meyer, M.
Naumann, and M. Hooker. 2003. Helicobacter pylori stimulates host
cyclooxygenase-2 gene transcription: critical importance of MEK/ERK-dependent

activation of USF1/—2 and CREB transcription factors. Cell Microbial 5 :82] .

Sayasith, K., J. G. Lussier, and J. Sirois. 2005. Role of upstream stimulatory
factor phosphorylation in the regulation of the prostaglandin G/H synthase-2
promoter in granulosa cells. J. Biol. Chem. :M413434200.

Cheng, L. L., B. Li, J. D. Luo, H. B. Tu, Q. C. Liu, and P. Ran. 2005.
Identification of an E-box motif as a transcriptional repressor element in the

proximal promoter region of the GCLC gene in rat lung epithelial L2 cells. Free
Radic Biol Med 39:1030.

Gupta, A. K., and B. C. Kane. 2002. USF-1 and USF-2 trans-repress IL-lbeta-

induced iNOS transcription in mesangial cells. Am J Physiol Cell Physiol
283:C1 065.

120

11.

12.

13.

14.

15.

16.

Peukert, K., P. Staller, A. Schneider, G. Carmichael, F. Hanel, and M. Eilers.
1997. An alternative pathway for gene regulation by Myc. Emba J 16:5672.

Galibert, M. D., S. Carreira, and C. R. Goding. 2001. The Usf-l transcription
factor is a novel target for the stress-responsive p38 kinase and mediates UV-
induced Tyrosinase expression. Emba J 20:5 022.

Xiao, Q., A. Kenessey, and K. Ojamaa. 2002. Role of USFl phosphorylation on
cardiac alpha-myosin heavy chain promoter activity. Am J Physiol Heart Circ
Physiol 283 .'H21 3 .

Cheung, E., P. Mayr, F. Coda-Zabetta, P. G. Woodman, and D. S. Boam. 1999.
DNA-binding activity of the transcription factor upstream stimulatory factor 1

(USF-1) is regulated by cyclin—dependent phosphorylation. Biochem J 344 Pt
1 :1 45 .

Nowak, M., A. Helleboid-Chapman, H. Jakel, G. Martin, D. Duran-Sandoval, B.
Staels, E. M. Rubin, L. A. Pennacchio, M. R. Taskinen, J. Fruchart-Najib, and J.
C. Fruchart. 2005. Insulin-mediated down-regulation of apolipoprotein A5 gene

expression through the phosphatidylinositol 3-kinase pathway: role of upstream

stimulatory factor. Mal Cell Biol 25 .' I 5 3 7.

Pognonec, P., K. E. Boulukos, C. Aperlo, M. Fujimoto, H. Ariga, A. Nomoto, and

H. Kato. 1997. Cross-family interaction between the bHLHZip USF and bZip
Fral proteins results in down-regulation of APl activity. Oncogene [4:209].

121