1.1 4:. 355 l
11»... . 1%figa h.
1 ”mung

taunt...’
a. . . .

tutu:
. 4 a

. a
a a
5.3.4.41... ..

3K .,

..
u.

 

. v Ho
.1 a aid”; ... hwxfi, u..ll 4.14.95“! R1 5
:1 I: .lan~§.»x....t!\¢

{1.31. t 1.3
1333‘.
7.

pa; ‘ .n

 

 

7mm

5 LIBRARY
23 O Michigan State
L’ University

This is to certify that the
dissertation entitled

CHARACTERIZATION OF REGUALTORY REGIONS OF THE
Q4400 AND Q4499 PROMOTERS, TWO C-SIGNAL-DEPENDENT
PROMOTERS IN MYXOCOCCUS XANTHUS

presented by
Deborah Ruth Himes

has been accepted towards fulfillment
of the requirements for the

PhD. degree in Microbiology and Molecular
Genetics

Egflm

Major Professor’s Signature

to!25/05
Date

 

MSU is an Affinnativo Action/Equal Opportunity Institution

 

- -._.—.—.-.-u-n-o-o-o-o----

.o-‘-u-o-a-0-O-I-o-o-o-c-o-I-n-0-I-o-0-.-I-I-o-o-o-l-u-I-D-I-I-<-0. -

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2/05 p:lClRC/DateDue.indd-p.1

 

 

CHAIM“
PROMOT

 

CHARACTERIZATION OF REGUALTORY REGIONS OF THE Q4400 AND Q4499
PROMOTERS, TWO C-SIGNAL-DEPENDENT PROMOTERS IN MYXOC OCC US
XANT H US

By

Deborah Ruth Himes

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Department of Microbiology and Molecular Genetics

2005

CHAIM
PROM

T
difierem?
(aggrega
some ce
requres

lhousan

Mutatic

afier 6

 

trans“

leadin:

 

ABSTRACT

CHARACTERIZATION OF REGUALTORY REGIONS OF THE Q4400 AND Q4499
PROMOTERS, TWO C-SIGNAL-DEPENDENT PROMOTERS IN MYX 0C 0C C US
JOIN TN US

By

Deborah Ruth Himes

The gram-negative bacterium Myxococcus xanthus undergoes multicellular
differentiation under nutrient limitation. Cells move to create areas of high cell density
(aggregation), and, when enough cells are present, a fi'uiting body is formed, inside which
some cells differentiate into spherical myxospores. This multioellular development
requires extracellular signals to coordinate the movement and gene expression of
thousands of cells.

One extracellular signal, C-signal, is required for aggregation and sporulation.
Mutations in C-signaling reduce or abolish expression of most genes that are expressed
after 6 hours into development. C-signaling leads to the activation of F ruA, a
transcription factor that governs a branched pathway in the cell. One pathway governs
cell movements leading to aggregation, while another pathway governs gene expression
leading to sporulation.

To better understand how C-signal regulates gene expression during development,

the regulatory regions of two partially C-signal-dependent genes, 04400 and (24499,

lmvebeen
into devell
that are Sll
importanc
investigat

D
elements
two elem

signal de

the Q44
express:
regUIal \

elemerr

DNA-E

 

Chron‘

”i0 la

SOVer

I
under

 

have been characterized. The promoters of these genes become active around 6 hours
into development. The regulatory regions upstream of these promoters share elements
that are similar in sequence and position relative to the start site of transcription. The
importance of these conserved elements for developmental expression has been
investigated.

Deletion analysis showed that the region from -86 to +155 bp contains all the
elements required for expression from the 04400 promoter. Mutational analysis revealed
two elements that regulate expression. One of these elements mediates, in part, the C-
signal dependence of the (24400 promoter.

DNA from -100 to +50 bp to drives expression from the 04499 promoter. Like
the (24400 promoter, the (24499 promoter requires two regulatory elements for
expression. However, when mutated, similar sequences in the (24400 and 04499
regulatory regions exhibited different effects on expression, suggesting that these
elements are regulated differently.

Expression from the (24400 promoter depends absolutely on M. Purified F ruA
DNA-binding domain binds upstream of the 94400 promoter site-specifically in vitro.
Chromatin immunoprecipitation showed that F ruA is bound near the (24400 promoter in
viva late in development.

These results yield insight into the complex transcriptional regulatory network
governing M. xanthus development and provide a foundation for fitrther studies aimed at

understanding C-signal-dependent gene regulation.

To in,

 

To my husband Paul, and my parents, Patrick and Ellen Yoder, who taught me that I
could do anything I wanted if I set my mind to it.

iv

done it al

the way.

what it n

dissertat

and whc
Without

like to II

underst
gratitu
almost
Contin:

Was a

 

Than}.

Imam

adl'lc:

 

ACKNOWLEDGEMENTS

This path in science was not always easy for me and I certainly could not have
done it alone. Therefore, I must express my gratitude to those who have helped me along
the way.

I must especially thank my mentor, Dr. Lee Kroos, whose guidance taught me
what it means to be a good scientist. I thank him for his patience and support.

I would also like to thank the members of my committee — Dr. Cindy Arvidson,
Dr. Larry Snyder, and Dr. Min-Hao Kuo for all of their helpful advice with regards to my
dissertation project.

I would like to thank my parents who have supported me all during my schooling
and who have encouraged me to be a strong person by demonstrating it themselves.
Without their help, I could not have accomplished any of my goals in life. I would also
like to thank the rest of my family for their love and support.

Working day in and day out with my co-workers in the Kroos lab has led me to
understand science, life, and new cultures. I would like to express my appreciation and
gratitude to Dr. Poorna Vi swanathan who has been my Myxococcus xanthus colleague for
almost my entire duration here. We have learned a lot fiom each other and hopefully will
continue to do so. Additionally, I would like to give thanks to Dr. Ruanbao Zhou who
was a constant source of help for my enzyme work and for advice on publications.

Thank you also to the other members of the Kroos lab: Heather Prince, Dr. Daisuke
Imamura, Sheenu Mittal, Rachel Aikman, Lijuan Wang, and Mike Stone for helpful

advice and creating an environment rich with science.

I
the hall t7
tethniqm
she has b

L
el'erythit
him and
would bl
peaceful
today It

myself a

 

 

I would also like to thank a dear fiiend, Gauri Jawdekar, who has worked down
the hall for many years. She has helped me with class and lab work by offering advice on
techniques and we endured our preliminary examinations together. Outside of the lab,
she has been a great friend and I hope she will continue to be one.

Lastly, but certainly not least, I would like to thank my husband, Paul Himes, for
everything that he has done for me inside lab and outside. I owe much of my success to
him and he has been an amazing resource in science for me. Many people said that it
would be hard to work and live together but we have always managed to do so in a
peacefitl and supportive way. From our scientific discussions of global topics to our day-
to-day lab work, the environment, which we have created, has allowed me to define

myself and be a better scientist.

vi

uhomou
moor FIGL'R
usror ABBR
moment
tillPTERl: L

General I
Motility
huights 1
Multicell
hlotphol
Signalin
l
l

[HER II
high into Dc

Abstra .

lntrod.
hia'fl‘

Result

 

 

 

TABLE OF CONTENTS

LIST OF TABLES ...................................................................................... x
LIST OF FIGURES ................................................................................... xi
LIST OF ABBREVIATIONS ..................................................................... xiii
INTRODUCTION ..................................................................................... 1

CHAPTER I: Literature Review

General characteristics of Mfyxococcus xanthus ......................................... 5
Motility and sensory reception ............................................................. 6
Insights from the M. xanthus genome ................................................... 10
Multicellular development ............................................................... 12
Morphology of Development ............................................................ 12
Signaling During Development .......................................................... 14
The A-signal ........................................................................ 15
The B-signal ........................................................................ 18
The D-signal ........................................................................ 19
The E-signal ........................................................................ 20
The C-signal ........................................................................ 21
Downstream Effects of C-signaling ............................................. 26
Developmental gene expression ................................................ 28

CHAPTER II. Mutational Analysis of the Myxococcus xanthus Q4400 Promoter Provides
Insight into Developmental Gene Regulation by C-signaling

Abstract ...................................................................................... 37
Introduction ................................................................................. 39
Materials and Methods ..................................................................... 43
Results
Effects of mutations in a C box centered at -49 bp ........................... 51
Effects of mutations in the C box centered at —80 bp ........................ S4
Deletion analysis of the 04400 promoter region .............................. 57
Effects of mutations between -86 and -64 bp ................................. 60
Effects of mutations in the 5-bp element ....................................... 61
Effects of mutations between -58 and -53 bp ................................. 64
Effects of mutations downstream of -46 bp .................................... 65

vii

 

Discus
(INTER Ill
Rett’lis Share.
homers

Abstra

Introdt

Mateo

Result:

Discus

CHAP
directl'

Abstra
lntrod

Mater

 

Resu,‘

 

 

C-signal dependence of the Q4400 promoter ................................. 65

Expression of Q4400 in act mutants ............................................ 69
Expression of Q4400 in sigD and sigE mutants .............................. 72
Discussion ................................................................................... 76

CHAPTER III: Mutational Analysis of the Myxococcus xanthus Q4499 Promoter Region
Reveals Shared and Unique Properties in Comparison with Other C-signal-dependent
Promoters

Abstract ...................................................................................... 58
Introduction ................................................................................. 87
Materials and Methods ..................................................................... 91
Results
Deletion analysis of the 04499 promoter region .............................. 98
Effects of mutations in the —25 to —10 bp region of the 04499
promoter ........................................................................... 103
Effects of mutations in the C box centered at -33 bp and
adjacent regions ....................... 106
Effects of mutations in the S-bp element. .............................................. 109

Effects ofmutations between -71 and —49 bp...... 112
Effects ofmutations between -101 and -72 bp... 112

C-signal dependence of the (24499 promoter ................................ 113
Effects of sigD and SigE mutations ............................................ 116
Discussion ................................................................................. 119

CHAPTER IV. Transcription fi'om the Myxococcus xanthus Q4400 promoter is
directly regulated by the essential developmental protein FruA

Abstract ................................................................................................................ 130
Introduction .......................................................................................................... l3 1
Materials and Methods ......................................................................................... 135
Results

A fiuA null mutation abolishes Q4400 expression ........................... 143

The FruA DNA-binding domain binds to the (24400 promoter

region .............................................................................. 143

viii

Discuss
APPEXDIX l.

SDDIARY A

, REFERENCES

 

FruA-DBD-Hiss binds to upstream DNA in the 04400 promoter

region .............................................................................. 146
FruA-DBD-Hiss binds to the —86 to -77 bp region upstream of

the (24400 promoter ............................................................. 149

FruA binds to the Q4400 regulatory region in vivo ......................... 154

Discussion ................................................................................. 159

APPENDD( I ....................................................................................... 169

SUMMARY AND PERSPECTIVES ........................................................... 189

REFERENCES ..................................................................................... 195

ix

lztle 21

Title 12

Tableil

 

 

 

LIST OF TABLES

Table 2.1 List of strains and plasmids used in the study ............................................ 44
Table 2.2 Activities of mutant Q4400 promoters ...................................................... 52
Table 3.1 List of strains and plasmids used in the study ........................................... 92
Table 3.2 Summary of activities of mutant Q4499 promoters .................................. 99
Table 4.1 List of strains and plasmids used in the study ................................ 136
Table A1 List of strains and plasmids used in the study .......................................... 177

figure H M

Figurt 1.2 Tl

figure 2.1 M
pr

figure 2.2 D

I l'tgurcu Si

 

tl
figure 2.4 C

Figure 2.5 E1
pr

figure 2.6 E

Figure 3.l D

“gum C

.l
l
lures;

 

 

I.
“tutti ,

Fllure 3.5

I litre 3.6

 

LIST OF FIGURES

Figure 1.1 Model of the C signal transduction pathway of Myxococcus xanthus .......... 25

Figure 1.2 Three models for FruA activation ................................................................. 30

Figure 2.1 Mutational analysis of the C box centered at -49 bp in the 04400

promoter region and comparison with the 04403 promoter region .............. 56
Figure 2.2 Deletion analysis of the 04400 promoter region .......................................... 59
Figure 2.3 Summary of mutational effects on developmental expression from

the (24400 promoter ..................................................................................... 63
Figure 2.4 C-signal dependence of mutant Q4400 promoter regions ............................ 68
Figure 2.5 Effects of actB and actC mutations on expression of the (24400

promoter and extracellular complementation of the defects ......................... 71
Figure 2.6 Expression of (24400 in sigD and sigE mutants ................................ 75
Figure 3.1 Deletion analysis of the 04499 promoter region .............................. 102

Figure 3.2 Comparison of the (24499 promoter region to promoters of
M xanthus genes believed to be transcribed by (554 RNA
polymerase ........................................................................... 105

Figure 3.3. Mutational analysis of the C box centered at —33 bp in the
04499 promoter ............................................................................................ 108

Figure 3.4 Summary of the effects of mutations in the (24499 promoter region ....... 111
Figure 3.5 C-signal dependence of a 5'-deleted Q4499 promoter region .................... 115

Figure 3.6 Effects of sigD and sigE mutations on expression from the 04499
promoter ............................................................................ 118

figure 4.1 U
[wt 4.2 In
figural} in

figure“ En
lht

hgurtl.5 In
figure“ Al

ligurelfi' II

I
l
i figurrAl De
l

1 figurIAZ Dr

 

 

 

Figure 4.1 A fiuA null mutation abolishes Q4400 expression ............................ 145

Figure 4.2 F ruA-DBD-Hiss binds specifically to the Q4400 promoter region ......... 148
Figure 4.3 F ruA-DBD-Hiss binds upstream of the Q4400 promoter ..................... 151
Figure 4.4 FruA-DBD-Hiss binds to a region important for expression from

the Q4400 promoter ............................................................... 153
Figure 4.5 FruA binds to the Q4400 promoter in vivo ...................................... 157
Figure 4.6 Alignment of F ruA-DBD-Hisg binding sites .................................... 163

Figure 4.7 The position of Q4400 in the C-signal transduction pathway model ........ 166

Figure Al Developmental activity of the 4403/4400 chimeric promoter ................ 183

Figure A2 Developmental activity of the 4400/4403 chimeric promoter ................ 186

xii

 

Ap

ATP

C TT
DNA
DTT

EDTA

[PIG
Km
kb
kDa
LB

om

 

.\l

ml

 

mM

Ap

ATP

CTT
DNA
DTT

EDTA

IPTG

kb

kDa

LB

ONPG

ml

ng

ABBREVIATIONS
ampicillin
adenosine-5’-triphosphate
adenine
base pair
cytosine
casitone-Tris media
deoxyribonucleic acid
dithiothreitol
(ethylenedinitriol) tetraacetic acid
guanosine
isopropyl -B-D-galactopyranoside
kanamycin
kilobase
kilodalton
Luria-Bertani media
ortho-nitrophenyl-B-D-galactopyranoside
molar
milliliter
millimolar

nanogram

xiii

 

pmol
ou
PAGE
PCR
tplptGp
P.\lSF
mp
rpm

SDS

Tc
1PM

ln's

 

.ut

 

 

pmol
ORF
PAGE
PCR

(p)ppGpp

PMSF

rpm
SDS

To
TPM
Tris
H8

pl

picomole

open reading frame
polyacrylamide gel electrophoresis
polymerase chain reaction
guanosine (penta) tetraphosphate
phenylmethylsulfonyl fluoride
RNA polymerase

revolutions per minute

sodium dodecyl sulfate

thymine

oxytetracycline
Tris-phosphate-magnesium media
tris(hydroxyl)aminomethane
micrograrn

microliter

xiv

 

 

T‘:
multicell1
move to .
nascent t
spherica‘

the acti\

The late

afierb't

 

express

deoend

develo

agate;

With I
U e re
Coma
SCVEI

“Pu:

 

 

INTRODUCTION

The rod-shaped, gram-negative bacterium Myxococcus xanthus undergoes
multicellular differentiation in order to propagate itself during nutrient limitation. Cells
move to create areas of high cell density and build a three-dimensional structure, the
nascent fruiting body. Inside the fruiting body, some of the cells differentiate into
spherical myxospores. This complex process requires extracellular signals to coordinate
the activities of thousands of cells.

Intercellular signaling dictates the set of genes transcribed during development.
The latest-acting signal, the C-signal, controls the expression of most genes activated
after 6 hours into development. To begin to understand how C-signaling controls gene
expression late in development, the regulatory regions of two partially C-signal-
dependent genes have been characterized.

Chapter one contains a review of the knowledge of M. xanthus motility and
development. Motility plays an important role in development as it is required for
aggregation.

Chapter two describes the characterization of the regulatory region associated
with the Q4400 promoter. Mutagenesis was used to delineate the cis-acting elements that
are required for expression. Two elements were identified. One element is large and
contains the conserved 5-bp element and the C box that have been found to be essential in
several developmental promoter regions. A second element is smaller and lies in the

upstream part of the regulatory region. This element exerts a two- to four-fold effect on

 

expre.‘

chaptt‘

impor
simila
how
mutati
of die
suggee
044D
promc
regula
61611161
0449‘

Bacte

 

asst:

Sub:

 

expression and mediates, at least in part, the C-signal-dependence of this promoter. This
chapter was published in the Journal of Bacteriology in 2004.

The second chapter described the identification of cis-acting elements that are
important for expression from the Q4499 promoter. This promoter is expressed at a
similar time during development as the Q4400 promoter. The Q4499 promoter appears,
however, to be regulated differently than the Q4400 promoter. Individual base pair
mutations in a C box element in the Q4499 regulatory region yielded a different pattern
of effects when compared to similar mutations made in the Q4400 promoter region,
suggesting that different transcription factors may bind to these elements. Like the
Q4400 promoter region, two regions are important for expression from the Q4499
promoter and they bear some similarity to the Q4400 regulatory elements. The Q4499
regulatory region contains a large element with two matches to the C box and two 5-bp
elements. Additionally, a smaller element farther upstream exerts a two-fold effect on
Q4499 expression. The work in this chapter was also published in the Journal of

Bacteriology in 2004.

The third chapter presents evidence that a protein that requires C-signal for
activation, FruA, is required for Q4400 expression. In vitro experiments show that the
FruA DNA-binding domain binds to the small upstream element in the Q4400 regulatory
region to activate transcription during development. In vivo studies show that FruA
associates with the Q4400 promoter region during development. This chapter will be

submitted to the Journal of Biological Chemistry in late 2005.

 

futun
may i
of the

bindi

 

 

The Summary and Perspectives section contains conclusions and proposals for
firture work. It seems the Q4400 and Q4499 promoters are differently regulated. This
may be due to different transcription factors that bind to the regulatory regions upstream
of the core promoters and/or this could be due to different forms of RNA polymerase

binding to the core promoters to activate transcription.

Chapter 1: Literature Review

 

mm

and:

ram

lifes

 

 

Litgrature Review

Unlike many bacteria that act individually, the group of organisms known as
myxobacteria exhibits many social characteristics including group feeding, social motility
and multicellular development. The best characterized myxobacterium, Myxococcus
xanthus, has been studied in some detail to determine the advantages conferred by such a
lifestyle. Because M. xanthus has a short developmental cycle and is amenable to genetic
and biochemical analyses, it serves as a good model system for studying multicellular

differentiation.

ngral chagcteristics 9f macaw xanthus

M. xanthus is a rod-shaped gram-negative bacterium. Based on 16S ribosomal RNA
sequence, the myxobacteria cluster as a monophyletic clade within the 8-proteobacteria
branch, whose nearest neighbors are the bdellovibrios and sulfur- and sulfate-reducing
bacteria (Shimkets and Woese 1992).

M. xanthus is typically isolated from topsoil, dung pellets, and detritus where oxygen
content is sufficient for growth. Because it competes with small multicellular and other
unicellular organisms for nutrients, M. xanthus synthesizes anti-microbial agents to
provide it with a competitive advantage. The genome for M. xanthus has approximately
20 gene clusters encoding secondary metabolites including antimicrobials, carotenoid
biosynthesis genes, and polyketide synthetases (N ierman et al.).

Many members of the myxobacteria family, including M. xanthus, can hydrolyze

proteins (Bender 1963), polysaccharides (Bourgerie et al. 1994, Barreaud et al. 1995),
peptidoglycan (Sudo and Dworkin 1972), cellulose (Reichenbach and Dworkin 1992),

S

 

nuclei
Other
the pr
in “w
(Rose
prote

achie‘

Motil

.ii
motili
respOi
functi
The p
thoug
(ll'olg
stainit
have I

slime

 

 

 

nucleic acids (Mayer and Reichenbach 1978), and lipids (Sorhaug 1974) as food sources.
Other food sources are protozoa, yeast, and other bacteria, which can be lysed through
the production of extracellular enzymes. When feeding, populations of M. xanthus travel
in “wolf packs” in search of food and exhibit synergistic growth at high cell densities
(Rosenberg et al. 1977). This social behavior of swarming allows high levels of
proteolytic enzymes to be achieved, and lysis of prey is more effective than can be

achieved by the bacteria individually.

Motility and sensory reception in Myxococcus xanthus

M xanthus does not have flagella but has two distinct mechanisms for gliding
motility — the A (adventurous) and S (social) motility systems. Adventurous motility is
responsible for the outward movement of individual cells awayfi'om neighbors and may
firnction as a means of finding new sources of nutrients in the surrounding environment.
The precise molecular mechanism that leads to A motility has yet to be elucidated but is
thought to be mediated through directed slime secretion at the poles of the cells
(Wolgemuth et al. 2002). Small round polar nozzles have been observed by negative
staining and transmission electron microscopy of isolated cell envelopes. These nozzles
have been proposed to be analogous to the nozzles that are responsible for the directed
slime secretion that leads to gliding motility in cyanobacteria. Bacteria unable to move
by A motility have mutations in two classes of genes — cgl (gontact or gonditional
gliding), and agl (adventurous gliding).

Bacteria with mutations in the cgl class of genes can be rescued for A motility by
mixing with wild-type cells (Kalos and Zissler 1990); thus, cgl mutants may be

6

responsive to an extracellular signal that allows the restoration of individual cell
movement. Two of the five cg] genes, chB and cglC, seem to fimction outside the
cytoplasm based on TnphoA mutagenesis but the exact firnction of the cgl genes has not
been determined.

The identified members of the agl class of genes are more extensive than those of the
cgl class. Strains bearing an agl mutation cannot be complemented extracellularly
(Hodgkin and Kaiser 1977). The best characterized member of the agl class of genes is
aglU, which encodes a putative 58 kDa outer membrane protein that is cleaved to a 55
kDa form (White and Hartzell 2000). AglU also may contain a WD-repeat region
(determined by a glycine-histidine dipeptide in the N-terminus and a tryptophan-aspartate
dipeptide in the C-terminus of the region), which functions in other proteins to assemble
multimeric protein complexes (Smith et al. 1999). The agl mutants are unique among the
A-motility mutants because they lead to a defect in the differentiation of vegetative cells
into dormant cells called myxospores.

Social motility involves the swarming of cells in groups and is used for attacking prey
and during development. It is observed as group cell movement at the edge of a colony
rather than the movement of individual cells, and is known to be dependent on cell-cell
contact (Kaiser and Crosby 1983). In contrast to many A motility mutants, most of the S
motility mutants are also defective in multicellular development (Hodgkin and Kaiser
1979b). Many of the genes found to be essential for S motility share similarity to pilin
biosynthesis, processing, export, and assembly genes in other bacteria (Hodgkin and

Kaiser 1979b, Wu and Kaiser 1997). Studies have shown that S motility may function

 

thml

IBUE

mot

reve
proc
resp
to th
inter
reguj

then

muta

 

 

through the extension of type IV pili, which attach to sloughed slime or other cells, and
retraction of the pili to pull the cell forward (Li et al. 2003),

Only two loci have been identified as essential for both adventurous and social
motility — mg] (Stephens et al. 1988) and nlaQ4 (Lancero et al. 2004). Mutations in the
mg] locus do not lead to the inability to move. Instead, they seem to uncouple the
regulation between the A and S motility systems leading to a high frequency of cell
reversals and therefore no net gain in movement. The mgl locus (mutual gliding)
produces two proteins MglA and Mng that are expected to be 22 kDa and 17 kDa
respectively (Stephens et al. 1988, Hartzell and Kaiser 1991b). MglA has been localized
to the cytoplasm (Hartzell and Kaiser 1991a) and may firnction as a GDP- or GTPase that
interacts with the tyrosine kinase, MasK (Thomasson et al. 2002). Mng appears to
regulate the levels of MglA protein in the cell (Hartzell and Kaiser 1991b). Mutations in
the mg] locus render the cells unable to undergo development similar to S motility
mutants.

The nld24 (NtrC-like activator) gene was originally identified based on its sequence
similarity to the transcription factor NtrC of E. coli (Caberoy et al. 2003). When
mutated, a nIaQ4 mutant strain is non-motile on an agar surface but has firnctional type IV
pili (Lancero et al. 2004). The nla24 mutant strain does not produce wild-type levels of
the extracellular polysaccharide portion of the fibril matrix that is necessary for motility
on solid surfaces. nla24 mutant strains also have a severe aggregation defect during

multicellular development (Caberoy et al. 2003).

To date, eight chemotaxis operons have been identified in the M. xanthus genome
based on homology to known chemotaxis systems in other bacteria (i.e., the Che system
in E. coli) (Niermau et al.). The best characterized group of chemotaxis genes is the fiz
operon (Zusman 1982). The F rz system controls the rate of cell reversals when
transversing over a solid surface during multicellular development (McBride et al. 1989).
Most mutations in the seven known members of the fiz system result in mutants that
rarely change direction (frzA, -B, -C, -E, -F) (Blackhart and Zusman 1985, Bustamante et
al. 2004) while a few mutants (frzCD) change direction more frequently than wild-type
cells (Blackhart and Zusman 1985). FrzA and FrzB show sequence similarity to the
CheW coupling protein of E. coli. The frzCD gene shows homology to the C-terminal
domain of the methyl-accepting proteins (MCP’s) that lie in the inner membrane and
function as receptors for various stimuli in other organisms (Bustamante et al. 2004).
However, M. xanthus F rzCD is cytoplasmic. The F rzE protein may function as a CheA-
CheY hybrid protein (McCleary and Zusman 1990) for this system. F rzF may firnction
as CheR and FrzG may firnction as CheB, both of which coordinate the methylation state
of methyl accepting proteins (MCPs) (McBride et al. 1989). The frzZ gene is not located
in the fiz operon but lies upstream of the frz operon and is transcribed in the opposite
direction (Trudeau et al. 1996). FrzZ is thought to encode a transcription factor though
no target has been identified. To date, three other chemotaxis operons have been
examined - the difoperon which is required for S motility, multicellular development,
and the production of extracellular matrix fibrils (Yang et al. 1998, Yang et al. 2000), the

che3 gene cluster which controls deve10pmental gene expression through a 054

transcriptional activator (CrdA) (Kirby and Zusman 2003), and the che4 gene cluster
which modulates type IV pili function and thus is required for S motility and
multicellular development (Vlamakis et al. 2004). The remaining chemotaxis systems
have yet to be studied experimentally.

Elasticotaxis is another sensory behavior of M xanthus. Elasticotaxis is the
ability to respond to elastic forces in the agar on which they are grown. M. xanthus cells
will re-orient themselves and move perpendicularly to forces generated by compressing
agar in plates (F ontes and Kaiser 1999). The exact mechanism by which elasticotaxis

works is not clear; however, it has been shown that A motility, not S motility, is involved.

Insights from the M. xanthus genome

The M xanthus strain DK1622 chromosome has been sequenced by Monsanto
and the Institute for Genomic Research (TIGR) and found to contain 9.1 Mbp of DNA
that encodes 7,435 putative open reading frames (N ierman et al.). Interestingly, the
number of putative transcription factors in M xanthus is extremely low compared to the
number of transcriptional regulators in other developmental bacteria, such as
Streptomyces coelicolor and Nostoc, when taken as a percentage of whole genome size.
It has been proposed that M xmrthus utilizes numerous extracytoplasmic function (ECF)
sigma factors, of which M xanthus has thirty-eight (Niermau et al.), and many two-
component signal transduction systems to compensate for the lack of traditional
transcriptional regulators.

M xanthus contains an unusually high number of 6 factor genes at 48 making it

second only to Streptomces sp. (with over 60) of sequenced bacteria. Five of the o
10

factors that fall into the 070 family have been characterized. The major vegetative sigma
factor, 0'", is encoded by the tpoD gene and is essential for grth (Inouye 1990). GB,
encoded by the sigB gene, is required for the maturation of myxospores (Apelian and
Inouye 1990), while 0C (encoded by the sigC gene) is expressed at the beginning of
development and is repressed during late development. Mutations in the sigD gene,
which encodes a”, cause a decrease in cell viability during stationary phase, lead to a
delay in fruiting body development, and cause a deficiency in spore formation (U eki and
Inouye 1998). The sigD gene is expressed during vegetative growth, stationary phase,
and development. The gene for GE, sigE, shows sequence similarity to heat shock sigma
factors (Ueki and Inouye 2001) but does not seem to regulate the heat shock response in
M xanthus, It is expressed during vegetative growth and development. Mutations in the
sigE gene lead to aberrant development.

Three additional o factors have been characterized, o“, carQ, and IpoEl. Unlike
in other bacteria, the M xanthus (:54 (encoded by rpoN) is essential for growth (Keseler
and Kaiser 1997). The M xanthus genome encodes a disproportionate number of o”—
like activators when compared to most bacteria, suggesting that M xanthus may rely on
o“ to a greater extent than most bacteria (Niel-man et al.).

CarQ is an extracytoplasmic function (ECF) 0 factor that regulates the expression
of light-inducible carotenoid biogenesis genes. CarQ has been proposed to be
sequestered by the anti-sigma factor CarR in the absence of light, and is released in the

presence of light due to CarR degradation (Gorham et al. 1996). Another ECF a factor,

11

RpoEl, is produced during vegetative grth and development and is required for
motility and developmental aggregation (Ward et al. 1998).

Myxococcus xanthus serves a simple model system for extracellular signaling that
leads to multicellular morphogenesis and cellular differentiation events similar to those
observed during development of higher eukaryotic organisms. Continued studies of M
xanthus may also lead to a better understanding of regulation in soil bacteria, to improve

our use of these organisms for beneficial purposes.

Multicellular Development of M. xanthus
Morphology of Development

Upon the onset of starvation at a high cell density on a solid surface, M xanthus i
exhibits two behaviors, rippling and aggregation, that serve to move and gather cells at
the foci of future three-dimensional structures called fi'uiting bodies, which will contain
the mature myxospores.

Rippling is the coordinated movement of cells that appear like waves traveling on
water (Shimkets and Kaiser 1982). Studies by Roy Welch and Dale Kaiser using time-
lapse microscopy to examine rippling revealed that cells travel in the direction of the
wave with a frequency of reversal lower than that of vegetative cells (Welch and Kaiser
2001). When two waves of cells collide with each other, the cells reverse direction until
another collision. End-to-end contacts between the cells in the waves, like those
generated in collisions, are thought to be critical for cell density sensing and the

progression of development (Kim and Kaiser 1990a).

12

Aggregation occurs when waves of rippling cells collide and become immobilized
as in traffic jams (Igoshin et al. 2004). The aggregates grow as rippling cells pass over
the jams and become immobilized. The aggregates gain a circular symmetry when
rippling cells bend in order to travel over the aggregate. The related myxobacterium
Stigmatella aurauntica forms aggregates when circular swirls of bacteria collapse and
form centers of high cell density (Varon et al. 1984). It is not known how the shape or
size of the aggregate is determined in M xanthus. The cells that remain outside of the
fruiting bodies are known as peripheral rods. While peripheral rods express many of the
genes activated during development, they neither lyse nor sporulate. It has been
proposed that the peripheral rods are a specifically differentiated subset of the general
population but their role in development has yet to be defined (O'Connor and Zusman
1991b)

After 24 hours into development, some of the cells within the fruiting body
initiate a program of gene expression that leads to sporulation. There are conflicting
reports about the percentage of cells that differentiate into myxospores within the fruiting
body. Initial studies from several sources indicated that between 10-20% of cells within
fiuiting body become spores (W ireman and Dworkin 1975). However, subsequent
research suggested that up to 98% of the population form spores (O'Connor and Zusman
1991b).

The addition of several compounds can also lead to the formation of myxospores
in a cell density-independent manner (Dworkin and Gibson 1964, Dworkin and Sadler

1966, Sadler and Dworkin 1966). Glycerol-induced spores differ substantially from

13

spores formed in fruiting bodies when comparing respiratory rates (Dworkin and
Niederpruem 1964, Dworkin 1973), induction of germination by inorganic phosphate
(Ramsey and Dworkin 1968, White 1975), cell wall thickness (Inouye et al. 1979), and
regulatory events (Downard and Zusman 1985, Kroos 1986, Apelian and Inouye 1993).

Another matter of controversy is the fate of undifferentiated cells. Wireman and
Dworkin showed by radioactive thymidine incorporation that 65% of the population
undergoes autolysis during sporulation and the remaining cells are predominantly
myxospores (W ireman and Dworkin 1977). O’Connor and Zusman used microscopic
methods to show that up to 98% of the population became myxospores and claimed that
previous reports of autolysis were most likely artifacts of manipulating the M xanthus
cells (O'Connor and Zusman 1988).

To test O’Connor and Zusman’s prediction, anotherigroup designed a system that
virtually eliminated manipulation of cells by encapsulating small numbers of M xanthus
in agarose microbeads and monitoring the cell numbers during development (Rosenbluh
et al. 1989). They found that some of the non-sporulating cells lyse and the percentage of
lysed cells is inversely proportional to the number of cells that sporulate. The percentage
of cells that lysed or sporulated fluxuated depending on the cell density within the

microbeads.

Signaling During Development

To coordinate the events required for the multicellular morphogenesis and cellular
differentiation fi'om vegetative cells to myxospores, several extracellular signals are
employed by M xantlms. These signals were first described in 1978 when chemical

l4

mutagenesis was used to identify genes required for development (Hagen et al. 197 8).
Mutant strains were shown to fall into four classes that cannot individually undergo
development but can when mixed with wild-type cells or mutants fi'om another class.
Each mutant class lacks the production of an extracellular signal, which can be provided
by wild-type cells or mutants fiom a different class. These signals were designated the
A-, B-, C-, and D- signals. A fifth class, the E-signal, was subsequently identified
(Downard et al. 1993). The A- and B-signals act early in development (0-2 hours), the B-
and D-signals act a little later (3-5 hours), and C-signal acts still later in development
(after 6 hours) (Downard and Kroos 1993, Downard et al. 1993, Kaiser and Kroos 1993).
The A- and C-signals have been examined in depth while the B-, D-, and E-signals have

yet to be characterized in detail.

The A-signfl
When starvation conditions are sensed by M xanthus, the RelA protein

synthesizes guanosine pentaphosphate (pppGpp) and guanosine tetraphosphate (ppGpp)
in a reaction known as the stringent response (Manoil and Kaiser 1980). The production
of (p)ppGpp induces a series of genes that are transcribed early during development
(Harris et al. 1998). Shortly thereafter, the A-signal is produced. Strains deficient in A-
signaling arrest early in development at a stage prior to the onset of rippling, aggregation,
or sporulation (Hagen et al. 1978).

The nature of A-signal was first examined in 1992 when it was discovered that the

A-signal consists of two distinct components. One component is heat stable while the

15

other is heat-labile. The heat-labile portion of A-signal is responsible for 40-60% of gene
expression fiom one early developmental gene, Q4521, and was shown to have trypsin-
like proteolytic activity (Plamann et al. 1992). These studies led to the suggestion heat-
labile A-signal is a combination of extracellular proteases that allow the cleavage of outer
membrane proteins to produce peptides and amino acids (Plamann et al. 1992). The heat-
stable portion of A-signal was shown to be a mixture of peptides and amino acids
including proline, tyrosine, phenylalanine, tryptophan, leucine, isoleucine, and alanine
(Kuspa et al. 1992a). These amino acids may also serve as signals to the cells to induce
A-signal-dependent gene expression.

Mutations resulting in A-signaling defects have been mapped to five genetic loci,
asgA, asgB, asgC, asgD, and ang (Kuspa and Kaiser 1989, Cho and Zusman 1999,
Garza et al. 2000b). AsgA contains a domain similar to a transmitter domain of histidine
protein kinases and another domain similar to the receiver domains of response regulators
from the two-component systems of bacteria (Plamann et al. 1995). The AsgB protein
bears resemblance to transcription factors containing a DNA-binding helix-turn-helix
motif (Mayo and Kaiser 1989). Mutations in a third locus essential for A-signaling,
asgC, have been mapped to the gene encoding the major sigma factor, 6A (Davis et al.
1995). AsgD is another two-component system protein hybrid (Cho and Zusman 1999).
Like AsgA, AsgD contains two domains that resemble a receiver domain and histidine
kinase domain. The filnction of Ang is still under investigation (Garza et al. 2000a,
Garza et al. 2000b). In the current model for A-signaling [reviewed in (Shimkets 1999)]

starvation is sensed by the cells allowing RelA to produce (p)ppGpp, which, in turn,

16

triggers the expression of the asg genes. Expression of the A-signal-dependent genes
leads to a signal transduction cascade that results in the production and secretion of
extracellular proteases which are thought to proteolyze extracellular membrane proteins
to generate amino acids and peptides that are sensed by thecells. In this model, A-
signaling is thought to be a cell density-sensing mechanism that allows the M xanthus
cells to determine when cell density is sufficient for multicellular development (Kuspa et
al. 1992b).

Genes under the control of developmental promoters were identified by random
insertion of a transposon containing a promoter-less lacZ gene into the M xanthus
chromosome (Kroos and Kaiser 1984). Developmental promoters were identified as
sequences upstream of insertions that caused at least a three-fold increase in B-
galactosidase expression during development compared to vegetative grth (Kroos et
al. 1986). One of the fusions identified in this study, Q4521, was subsequently shown to
be A-signal-dependent (Kuspa et al. 1986). The promoter responsible for expression of
the Q4521 insertion was identified and resembles the 054-regulated promoters in E. coli
(Keseler and Kaiser 1995). Mutational analysis of individual base pairs of the Q4521
promoter showed that conserved base pairs in 654-regulated promoters were also essential
for expression driven from the Q4521 promoter. This suggests that Q4521 expression is
(SM—dependent though a activator that binds to the Q4521 promoter and recruits c” has
yet to be identified.

The Q4521 promoter is also controlled by a negative regulator, SasN, and two

positive regulators, SasS and SasR, which were identified as genes in which mutations

17

 

ant

ma

reg-

reg

to a
ll'h.
sn'a

boo:

ATE

has I

dewe

 

allow the expression of Q4521 in the absence of A-signaling (Kaplan et al. 1991). SasS
and SasR may encode a sensor histidine kinase and response regulator, respectively, that
may Function to activate Q4521 expression (Yang and Kaplan 1997, Yang and Kaplan
1998). SasN does not resemble any known protein but may firnction to negatively
regulate Q4521 expression during growth (Xu et al. 1998). It is still unknown whether

regulation by these proteins is direct or indirect.

The B-sigggl

Mutations in B-signal lead to arrest at a similar time as A-signal mutants and lead
to a unique motility defect during growth (Kroos and Kaiser 1987, Gill et al. 1988).
When spotted near wild-type cells on agar plates, strains bearing mutations in B-signaling
swarm until they encounter motile wild-type cells, at which point they form a ridge at the
boundary of the swarm edge (Gill et al. 1988). All mutations that lead to a B-signal
deficiency have been mapped to a single locus, bsgA, which is thought to encode an
ATP-dependent protease (Gill and Bomemann 1988, Gill et al. 1988, Tojo et al. 1993). It
has been proposed that BsgA is involved in degrading and modulating the half-lives of
developmental proteins, particularly those involved in gene expression during
development (Gill et al. 1993). Because the BsgA protein has been localized solely to the
cytoplasm of the cell, the mechanism of extracellular complementation remains a mystery
(Gill and Bomemann 1988).

Interestingly, two suppressor mutations have been identified that allow

aggregation and sporulation to occur in the absence of B-signaling (Cusick et al. 2002).

18

 

On

tr a

gel

81;

in;

req

mu

lien

Hos

the l

 

liar

flof
l

 

One mutation has been mapped to the 3de gene, which shares homology with NtrC-like
transcription factors (Hagar et al. 2001). Another mutation has been mapped to the bcsA
gene, the product of which bears similarity to flavin-containing monooxygenases (Cusick
et al. 2002). It does not appear that sde and bcsA function in the same pathway because,
in addition to bypassing the B-signaling requirement, mutations in sde also bypass the
requirement for A-signaling, but not C-signaling (Hagar et al. 2001). Conversely,
mutations in bcsA also bypass the requirement for C-signaling, but not A-signaling
(Cusick et al. 2002). Additionally, the expression of two developmentally-regulated
genes, Q4427 and Q4273, are different in 5de and bcsA mutants. It was proposed that
these proteins normally act to delay the progression of development as mutations in these
genes led to fruiting body formation and sporulation more quickly than wild-type cells.
However, the identification of these suppressor genes still does not lead to information on

the mechanism of extracellular complementation.

The D-signal

Point mutations in genes responsible for D-signaling lead to reduced aggregation
and no detectable spore formation (Hagen et al. 197 8, Cheng and Kaiser 1989a). The
chromosomal region responsible for D-signaling was found to contain a single gene,
dsgA, that encodes a protein that shows similarity to translation initiation factor 3 (IF3)
from E. coli (Cheng and Kaiser 1989b). In bacteria, this protein firnctions during
translation by assisting the ribosome to recognize the initiation codon. The dsgA gene

from M xanthus can complement an injC mutation, which encodes IF 3, in E. coli (Cheng

l9

et al. 1994). Antibodies against E. coli IF 3 crossreact with DsgA in M xanthus and have
been used to demonstrate that DsgA is produced at a high level during grth and
development. Attempts to create a dsgA null mutation in M xanthus have failed,
suggesting that this gene is essential for grth (Cheng and Kaiser 1989b). In order to
study the effects of a dsgA mutation, point mutations that reduced, but did not eliminate,
dsgA expression were created. After three days into development, strains with dog point
mutations yielded a 1000-fold fewer spores compared to wild-type; however, after seven
days, the number of spores was similar (Cheng and Kaiser 1989a). This suggests that
DsgA affects the timing of development. Because IF 3 functions solely in the cytoplasm
in E. coli, this homology offers little clue to the mechanism of extracellular
complementation. Presumably, DsgA is necessary for translation of 3 mRNA whose

protein product is involved in D-signaling.

The E-sign_a_l

Random insertion of the Tn5 transposon into the M xanthus chromosome
revealed another group of mutants that were unable to complete development on their
own but could in the presence of wild-type cells or other signaling mutants of the
previously known four classes. These mutants seem to comprise a fifth extracellular
signaling class, defective in the production of E-signal (Downard et al. 1993). The
mutations identified in this screen mapped to two genes that putatively encode the Ela
and E1 B subunits of branched-chain keto acid dehydrogenase. This enzyme serves to

convert branched-chain amino acids such as isoleucine, leucine, and valine to derivatives

20

of the branched-chain fatty acids isovalerate, methylbutyrate, and isobutyrate, which
serve as primers for fatty acid biosynthesis. Strains harboring esg mutations respond to
nutrient limitation by increasing the unsaturated fatty acids in their membranes. Kearns
et. al. demonstrated that cells bearing an esg mutation make fewer cell reversals in the
presence of a synthetic fatty acid (phosphotidylethanolamine— 16:1055c/16:1m5c ) than
wild-type cells (Kearns et al. 2001). Because of this, they suggest that the product of the
esg gene exerts a positive effect on chemoattraction. Fibrils, which are necessary for
development, are required for sensing the synthetic fatty acid. It is still not clear how the

esg gene product and chemoattraction are linked to extracellular complementation.

The C-signgl

The C-signal has been purified fi'om the supernatant of developing M xdmthus
(Kim and Kaiser 1990d). The addition of purified C-signal to C-signal-deficient strains
can rescue development. C-signal consists of a single polypeptide with a molecular mass
of 17 kDa that depends on magnesium and calcium for activity. By adding back purified
C-signal to csgA mutant strains, it was shown that the cellular behaviors of rippling,
aggregation, and sporulation require increasing amounts of C-signal, such that a low
amount of C-signal is required for rippling, a higher amount is needed for aggregation,
and still higher levels are necessary for sporulation (Kim and Kaiser 1991, Li et al. 1992).
These observations led to a model of C-signaling in which different threshold levels

dictate the sequence of the cellular behaviors during development.

21

Transmission of the C-signal requires cell-cell contacts (Kim and Kaiser 1990b).
When cells are artificially aligned in grooves on an agar surface, developmentally-
regulated genes are observed to be activated. Small groups of randomly oriented cells do
not exhibit the same pattern of gene expression. The transmission of C-signal also
requires motility (Kim and Kaiser 1990b). M xanthus strains bearing a mutation in the
mg] locus are non-motile and cannot rescue the development of C-signaling mutant
strains when co-developed even though they produce the C-signal at wild-type levels.

All defects in C-signaling map to a single locus, csgA (Shimkets et al. 1983). The
product of this gene bears similarity to short-chain alcohol dehydrogenases (Baker 1994,
Lee et al. 1995a). When residues conserved in short-chain alcohol dehydrogenases are
mutated in csgA, C-signaling is lost (Lee et al. 1995a). Additionally, overproduction of
another short-chain alcohol dehydrogenase in M xanthus, SocA, can substitute for loss of
ngA (Lee and Shimkets 1994, Lee and Shimkets 1996). Together, these results suggest
that the NAD(P)+-binding and dehydrogenase activities of ngA may be essential for C-
signaling, but the substrate and product for the enzymatic activity of ngA have yet to be
identified.

The enzymatic role of ngA may be to arrest growth at the onset of development
in conjunction with SocE, a protein that is essential for growth in M xanthus but has no
homology to any known proteins (Crawford and Shimkets 2000). These two proteins
have been shown to function antagonistically to regulate the onset of development with

depletion of SocE correlating with a ngA-dependent increase in (p)ppGpp levels. In

22

contrast to csgA, the socE gene is expressed highly during vegetative grth and
minimally during development.

In addition to its intracellular role, ngA acts as an extracellular signal (Figure
1.1). Shimkets and Raifee have used colloidal gold labeling and transmission electron
microscopy to show that antibodies raised against a LacZ-ngA fusion protein localize to
the outer matrix of developing M xanthus (Shimkets and Rafiee 1990). In subsequent
studies, ngA was shown to be produced as a 25 kDa protein that is putatively
transported to the outer membrane and cleaved by a serine protease to its active 17 kDa
form (Lobedanz and Sagaard-Andersen 2003)(Figure 1.1). The proteolytic processing
occurs in the N-terminal region and removes the NAD(P)-binding pocket, which implies
that the enzymatic activity of ngA may be unnecessary for its extracellular signaling
activity. Indeed, the purified 17 kDa form no longer binds NAD(P)+. Antibodies raised
against a MalE-ngA fusion protein made in E. coli react with purified C-signal
suggesting that ngA is the C-signal (Kim and Kaiser 1990d).

The regulatory region responsible for transcription of the csgA gene during
development is nearly the length of the gene itself (Li et al. 1992). Interestingly, up to
930 base pairs of upstream DNA is required for firll expression if the cells undergo
development on a medium with trace amounts of nutrients; however, only 400 base pairs
are required for firll expression on a more stringent starvation medium, suggesting that
the region between -930 and -400 modulates a response to nutrients. The level and
timing of csgA expression is regulated by the four products of the act operon, ActA,

ActB, ActC, and ActD. Gronewold and Kaiser used mutations in these genes to

23

Figure 1.1. Model of the C-signal transduction pathway of Myxococcus xdmthus. The
diagram represents some of the major events that occur during C-signaling. In this
model, the gene product of the csgA gene is the signaling moiety and is produced in a 25
kDa form that is cleaved by a serine protease to the 17 kDa active form outside the cell.
The signal is sensed by neighboring cells through an unknown mechanism and is
proposed to result in a positive feedback loop through the products of the act operon
(Gronewold and Kaiser 2001). As a result of C-signaling, FruA is activated and acts on a
branched pathway inside the cell (Sagaard-Andersen et al. 1996). One branch leads to
the activation of the Frz proteins and the cellular behaviors of rippling and aggregation.

The second branch leads to the expression of the devRS operon and to sporulation.

24

 

 

 

fi / Frz—p Rippling

Fru A Aggregation

8“ dovRS -
090m" oporonfi Sporulatlon

<—-

 

 

Crotease

Neighboring M. xanthus cell

M. xanthus
cell

 

25

demonstrate that ActA and ActB positively control the level of csgA expression, while
ActC appears to delay the expression of csgA, and ActD (and/or any other downstream
genes) appears to advance the timing of expression (Gronewold and Kaiser 2001). The
expression of genes that depend on ngA is also affected by mutations in the act genes in

a similar manner (Gronewold and Kaiser 2002).

Downstregm Effects of C-siggaling

C-signaling is proposed to activate the FruA protein (Figurel.1). F ruA bears
similarity to response regulators of two-component signal transduction systems of
bacteria (Ellehauge et al. 1998). In bacteria, two component systems are a method of
relaying environmental signals and are typically composed of two proteins (Hoch and
Silhavy 1995). The histidine protein kinase (HPK) receives an input signal and
undergoes a conformational change. This change allows an auto-phosphorylation event
to occur at a conserved histidine residue in the C—terminus. The HPK then binds to the
second protein, a response regulator, and transfers its phosphoryl group to a conserved
aspartic acid in the N-terminal domain of the response regulator. This phosphate transfer
leads to a conformational change and allows the response regulator to bind to DNA or
other proteins. In many cases, a glutanric acid substitution for the conserved aspartic acid
in response regulators creates a constitutively active protein as the additional carbon atom
in the side chain mimics addition of a phosphoryl group to the aspartic acid.

The N-terminal domain of FruA contains a conserved aspartic acid residue that is

essential for aggregation and sporulation (Ellehauge et al. 1998). An alanine, asparagine,

26

or glutamine substituted for this conserved residue renders the protein inactive; however,
a glutamic acid substitution at this same site (D59E) is able to complement a fruA
mutation. The D59E mutation in FruA leads to neither aberrant aggregation nor
sporulation, as might have been expected for a constitutively active mutant. Perhaps
FruA does not function as a response regulator. One line of evidence that that supports
this is that FruA contains eight additional residues adjacent to the conserved aspartic acid
that are not found in other response regulators. The requirement of these eight additional
amino acids for FruA activity has not been determined.

FruA controls a branched pathway in developing M xanthus cells (Sogaard-
Andersen et al. 1996). One branch of the pathway leads to the activation of the Frz
proteins, which control the motility behaviors of rippling and aggregation. Another
branch leads to the expression of the dev operon, the genes regulated by the Q7536
promoter, and fdgA, all of which are required for sponrlation (Ellehauge et al. 1998,
Licking et al. 2000, Ueki and Inouye 2005).

Several developmental promoters require the expression of fi'uA. Some of these
promoters are C-signal-independent such as the tps, ops, and dofA promoters (Horiuchi et
al. 2002a, Horiuchi et al. 2002b). Other promoters are C-signal-dependent such as the
dev, Q7536, and fdgA promoters (Ellehauge et al. 1998, Licking et al. 2000, Ueki and
Inouye 2005). These observations have led to the hypothesis that FruA may have several
mechanisms of activation.

Three models have been proposed to explain the varying levels of C-signal

dependence among fiuA-dependent genes (Figure 1.2). The first model proposes that

27

F ruA is post-translationally modified (most likely phosphorylated) at a single site and the
cellular number of FruA proteins that are modified determines the subset of genes that are
activated by FruA (Figure 1.2A) (Horiuchi et al. 2002b). This model states that a low
level of F ruA activation prior to C-signaling leads to the expression of the C-signal-
independent genes while a high level of activation leads to the expression of the C-signal-
dependent genes. Alternatively, two competing activators activate FruA by modifying a
single site (Figure 1.2B). One activator would activate F ruA in response to C-signal, thus
conferring C-signal dependence, while the other activator would activate FruA at the
same site in response to other stimuli and allow activation of C-signal-independent genes
(U eki and Inouye 2003). In order for this model to hold true, the level or type of
modifications made by the two competing activators must be different and mutually
exclusive. A third model requires FruA to be post-translationally modified at two or
more sites by different activators with at least one modification being C-signal-dependent
(Figure 1.2C). Thus, the subset of genes that are activated is dependent on which sites or

how many modifications of a particular type are present.

Developmental gene expression

As described in the A-signal section, regulatory regions showing an increase in
expression during development were identified using the Tn5 lac transposon (Kroos and
Kaiser 1984). These insertions were assigned a four-digit number until a firnctional

assessment could be made. Of the 2,374 insertions analyzed, only 29 insertions showed

28

Figure 1.2. Three models for FruA activation. In all the models presented,
activation occurs through activator proteins (A) and the modifications they make
(lollipops). (A) The population threshold model. This model hypothesizes that FruA is
activated at a single site. The cellular levels of activated FruA determine which subset of
genes is expressed. (B) The competition model. This model also shows FruA being
modified at a single site but two different activators compete for binding to FruA. In this
model, the activators modify FruA by attaching different groups, or by attaching the same
group but at different rates (not shown). One activator confers the C-signal dependence
and the second activator is not C-signal-dependent. (C) The multiple site model. This
model supposes that FruA can be modified at two or more sites by multiple activators.
With at least one of the activators responding to the C-signal, the number and position of

the attached groups can then dictate which subset of genes is expressed.

29

 

 

 

m

In hm
d aes

mam he

one mm...
H d

 

30

 

more than a three-fold increase in B-galactosidase, of which only eight showed
developmental defects (loss or decreased efficiency of aggregation or sporulation). The
intercellular signaling requirements of a subset of these insertions were assessed in two
independent studies. In one study, eighteen of twenty-one developmentally-regulated
insertions tested were found to be A-signal-dependent (Kuspa et al. 1986). In another
study, all of the twenty-six insertions that were analyzed were found to be B-signal-
dependent while only fifteen were found to be C-signal-dependent (Kroos and Kaiser
1987). Many additional studies have focused on understanding the regulatory network
leading to the expression of the C-signal-dependent insertions.

One C-signal-dependent insertion that leads to developmental defects is Q4414.
Cells harboring this insertion form loose aggregates and produce 1000-fold fewer spores
than wild-type cells (Thony-Meyer and Kaiser 1993). The insertion was mapped to a
multigene operon containing two genes, devR and devS. Neither of the genes bears any
homology to known proteins but DevR may have an auto-regulatory role for the dev
operon. Three additional genes, devT, orfl , and orf2, were subsequently identified
(Boysen et al. 2002). DevT was examined and found to be involved in a positive
feedback loop with the fi‘uA gene in an A- and E-signal-independent manner.

Another interesting insertion is Q7 536. This insertion blocks the proper
formation of not only developmental myxospores, but glycerol-induced spores as well
and may represent a common step in spore formation (Licking et al. 2000). Indeed, the
Q7 536 insertion leads to a heterogeneous mixture of cell shapes rather than the spherical

myxospores that are formed by wild-type cells.

31

Other genes regulated by C-signaling have a less-defined role as no
developmental defects have been observed under the standard laboratory conditions. One
such insertion is Q4400. The expression of lacZ fiom this insertion occurs after five
hours into development (Kroos et al. 1986), and the insertion was found to lie within a
predicted open reading frame (Brandner and Kroos 1998). The putative gene interrupted
by the Q4400 insertion is predicted to encode a 756 amino acid protein that contains an
ATP- or GTP-binding pocket. The transcriptional start site that regulates the expression
of the gene interrupted by the Q4400 insertion has been identified. When fused to the
lacZ gene and inserted at the Mx8 phage attachment site in the M xanthus chromosome,
DNA fiom -101 to +455 bp was sufficient to drive expression at levels comparable to the
Q4400 Tn5 lac insertion suggesting that -101 to +455 bp contains all the regulatory
sequences necessary for Q4400 expression. The expression fi'om the Q4400 insertion is
reduced, but not eliminated, in a csgA mutant background, indicating that expression
from the Q4400 insertion depends partially on C-signaling (Kroos and Kaiser 1987). The
Q4400 promoter does not appear to be transcribed by o'B or do as mutations in either of
the genes encoding these sigma factors does not change its developmental expression.

Another developmentally-regulated insertion that does not cause a developmental
defect under normal laboratory conditions is the Q4499 insertion. This insertion,
expressed at 6 hours into development (Kroos and Kaiser 1987), was found to lie in the
second gene of a two gene operon predicted to encode a cytochrome P-450 system
oxidase and reductase (F isseha et al. 1999). The transcriptional start site of the promoter

regulating the expression of the Q4499 insertion has been identified and it was found
32

that, when inserted site-specifically at the Mx8 phage attachment site of the Myxococcus
chromosome, DNA from -218 bp to +2.68 kilobase pairs was sufficient to drive
expression at levels comparable to the Q4499 Tn5 lac insertion. As with the Q4400
insertion, the Q4499 insertion is also partially C-signal-dependent (Kroos and Kaiser
1987) and not dependent on sigB or sigC (Brandner and Kroos 1998).

Other insertions that have been studied include the Q4403 and Q4514 insertions.
The Q4403 insertion interrupts a predicted serine protease that is dispensable for
development (F isseha et al. 1996). The DNA between -80 bp and +3 82 bp relative to the
start site of transcription is sufficient for expression fiom this promoter. This promoter
differs from the Q4400 and Q4499 promoters because it is absolutely C-signal-dependent
and is expressed only after eight hours into development.

The Q4514 insertion is C-signal-independent (Hao et al. 2002) and is expressed
nine hours into development (Kroos et al. 1986). The Q4514 insertion is in the third gene
of a predicted four gene operon that encodes a transcriptional regulator, which is required
for firll sporulation efficiency, subunits A and B of the glutaconate coenzyme transferase
enzyme and an alcohol dehydrogenase (Hao et al. 2002). The region between -54 to +65
bp relative to the start site of transcription was found to be sufficient for expression.
Interestingly, unlike the Q4400, Q4499, Q4403 promoters (D. Biran and L. Kroos,
unpublished data), the Q4514 promoter can be transcribed by RNA polymerase
containing the major vegetative sigma factor, 0", in vitro (Hao et al. 2002).

Several conserved DNA elements have been found in the regulatory regions of

developmental genes. Mutational analysis of the Q4403 regulatory region revealed that
33

several sequences are essential for expression (Viswanathan and Kroos 2003). The first
sequence is centered at -49 bp. This seven base pair sequence, CATCCCT, was named
the C box for the number of cytosine nucleotides present and its presence in the
regulatory regions of C-signal-dependent genes (Fisseha et al. 1999). This exact
sequence is found at precisely the same location (centered at -49 bp) in the Q4400
regulatory region (Brandner and Kroos 1998). Similar sequences are also found in the
find and csgA promoters, at an additional site in the Q4400 regulatory region, and three
times in the Q4499 regulatory region (Fisseha et al. 1999). By comparing the C boxes in
different promoters, the consensus sequence, CAYYCCY (where Y is either pyrimidine
nucleotide) was generated (F isseha et al. 1999). Most recently, the C box in the MA
regulatory region was found to be essential for expression (Srinivasan and Kroos 2004).

In addition to the C box, a second conserved element was identified in the Q4403
regulatory region. This sequence, termed the five base pair (5-bp) element, whose
consensus sequence is 5’ GAACA 3’, is located seven base pairs upstream of the C box
centered at -49 bp (V iswanathan and Kroos 2003). Similar sequences are found between
five and eight base pairs upstream of C boxes in the Q4400,fi14A, csgA, and Q4499
promoter regions. In the final regulatory region, a mutation in the 5-bp element led to a
decrease in activity, suggesting that this element is important for fiuA transcription
(Srinivasan and Kroos 2004).

The third essential element in the Q4403 regulatory region extends from —-79 to —
70 bp and is called the ten base pair (lO-bp) element (Viswanathan and Kroos 2003).
This element is not conserved among the fiuA, csgA, Q4400, or Q4499 promoters and

34

may represent a novel binding site for a developmental protein that drives Q4403

expression.

35

Chapter 2: Mutational Analysis of the Myxococcus xanthus Q4400 Promoter Provides

Insight into Developmental Gene Regulation by C-signaling

The work in this chapter was published in the J oumal of Bacteriology in February 2004

Volume186, Issue 3, pages 661-71.

36

ABSTRACT

Myxococcus xanthus utilizes extracellular signals during development to
coordinate cell movement, difl'erentiation, and changes in gene expression. One of these
signals, the C-signal, regulates the expression of many genes, including Q4400, a gene
identified by an insertion of Tn5 lac into the chromosome. Expression of Tn5 lac Q4400
is reduced in csgA mutant cells, which fail to perform C-signaling, and the promoter
region has several sequences similar to those found in the regulatory regions of other C-
signal-dependent genes. One such gene, Q4403, depends absolutely on C-signal for
expression, and its promoter region has been characterized previously by mutational
analysis. To determine if the similar sequences within the Q4400 and Q4403 regulatory
regions firnction in the same way, deletion analysis and site-directed mutagenesis of the
Q4400 promoter region was performed. A 7-bp sequence centered at —49 bp, termed a C
box, is identical in the Q4400 and Q4403 promoter regions, yet mutations in the
individual base pairs affected expression from the two promoters very differently. Also,
a single bp change within a similar 5-bp element, which is centered at -61 bp in both
promoter regions, had very different effects on activity of the two promoters. Further
mutational analysis showed that two regions are important for Q4400 expression: one,
from —63 to —31 bp, is required for Q4400 expression, and the other, from —86 to —81 bp,
exerts a two- to four-fold efl‘ect on expression and is at least partially responsible for the
C-signal-dependence of the Q4400 promoter. Mutations in sigD or sigE, which are genes
that encode 6 factors, abolished or reduced Q4400 expression, respectively. Expression

of Q4400 in actB or actC mutants correlated well with the altered levels of C-signal
37

produced in these mutants. The results provide the first detailed analysis of an M
xanthus regulatory region that depends partially on C-signaling for expression, and
indicate that similar DNA sequences in the Q4400 and Q4403 promoter regions filnction

differently.

38

INTRODUCTION

The gram-negative bacterium, Myxococcus xanthus, exhibits social behavior
during multicellular development (Dworkin 1996). When starved at a high cell density
on a solid surface, rod-shaped M xanthus cells begin to glide to foci where three-
dimensional mounds, each containing approximately 10’ cells, are built. Within these
mounds (called fruiting bodies), some of the cells undergo a morphological change to
form heat- and desiccation-resistant, spherical myxospores.

The developmental program of M xanthus relies on a specific temporal and
spatial pattern of events, the progression of which is controlled by extracellular signals
(Shimkets 1999). A defect in production of any of the signals leads to arrest at a specific
juncture during development, and these defects can be complemented by co-development
with wild-type cells (which provide the missing signal) or mutants defective in
production of a different signal (Hagen et al. 1978, LaRossa et al. 1983). C-signaling is
required after 6 hours into development (Kroos and Kaiser 1987) and involves the
product of csgA, a 25 kDa protein that may have enzymatic activity and is believed to be
cleaved to a 17 kDa form associated with the cell surface (Kim and Kaiser 1990c, d,
Shimkets and Rafiee 1990, Lee et al. 1995b, Kruse et al. 2001, Sagaard-Andersen et al.
2003). C-signaling is essential for three behaviors exhibited by M xanthus during
development; a low level is sufficient for rippling (formation of parallel ridges that
appear as traveling waves in movies made by time-lapse microscopy), a higher level is
needed for aggregation to foci, and an even higher level is necessary for sporulation

within the linking body (Kim and Kaiser 1991, Li et al. 1992). Transmission of the C-

39

signal requires motility presumably due to the need for cell-cell contacts (Kroos et al.
1988, Kim and Kaiser 1990b, a, Sager and Kaiser 1994). The response to C-signaling
involves a putative transcription factor, FruA (Ogawa et al. 1996, Ellehauge et al. 1998),
which governs a branched pathway inside the recipient cell (Sogaard-Andersen et al.
1996). One branch leads to rippling and aggregation through modification of the gliding
movements of cells, mediated by the products of the frz operon (Jelsbak and chaard-
Andersen 1999, 2002). A second branch includes expression of genes such as the dev
operon (Thony-Meyer and Kaiser 1993) and the locus identified by insertion Q7536
(Licking et al. 2000). This branch leads to sporulation. Expression of other genes also
depends on the response to C-signaling mediated by FruA (Ogawa et al. 1996), but some
of these genes are not required for development. These genes were identified by random
insertions into the M. xanthus genome of a transposon, Tn5 lac, which contains a
promoterless E. coli lacZ gene (Kroos and Kaiser 1984). Insertions of Tn5 lac led to
transcriptional fusions between M. xanthus promoters and lacZ. To understand how C-
signaling regulates developmental gene expression, one fusion, (24403 (F isseha et al.
1996), that depends absolutely on C-signaling for expression, and two filsions, Q4400
(Brandner and Kroos 1998) and (24499 (F isseha et al. 1999), whose expression depends
partially on C-signaling, have been studied previously.

The 04403 promoter region has been extensively mutagenized to identify the
DNA elements that are important for expression (Viswanathan and Kroos 2003). Three
elements, the C box, a 5-bp element, and a lO-bp element, were found to be absolutely

necessary for expression from the 94403 promoter, and similar sequences were observed

40

in several other C-signal-dependent genes. A C box, which has the consensus sequence
of CAYYCCY where Y is a pyrimidine nucleotide, is centered at —49 bp relative to the
transcriptional start site in the (24403 promoter region (Fisseha et al. 1996).
Interestingly, the same sequence (CATCCCT) is found at precisely the same location in
the (24400 regulatory region (Brandner and Kroos 1998). The S-bp element has a
consensus sequence GAACA and is located between —63 to —59 bp in the (24403
promoter region (Viswanathan and Kroos 2003). The 04400 upstream region exactly
matches the S-bp element consensus sequence at —63 to -59 bp. The lO-bp element in
the (24403 promoter region is located at —79 to -70 bp, and the (24400 promoter region
has a sequence matching at 6 out of 10 positions, located at —82 to —73 bp.

To determine if the three elements important for 04403 expression are
functionally conserved in the (24400 upstream region and to firrther characterize this
promoter region, we have performed mutational analysis. Our results show that the C
box centered at —49 bp is absolutely required for 04400 expression; however, the pattern
of mutational effects of the individual base pairs within the C box is different than
observed for the (24403 promoter. The 5-bp element is also essential for 04400
expression, as is the entire region immediately downstream to about -31 bp. Unlike the
absolutely required lO-bp element of (24403, the upstream region of 04400 seems to
have a short sequence between —86 and —81 bp that exerts a two- to four-fold positive
effect on expression. We conclude that the 94400 promoter is regulated differently than
the 04403 promoter and we speculate that the promoter regions are recognized by

different transcription factors. Further studies indicated that the level of 04400
41

 

expressil

expressi

 

 

expression correlates well with the level of C-signaling during development and that

expression from the (24400 promoter is dependent on 0D and GE.

42

MATERIALS AND METHODS

Bacterial strains and plasmids. Strains and plasmids that were used in this
study are listed in Table 2.1.

Growth and development. Escherichia coli DHSor strains were grown at 37°C
in Luria-Bertani medium (Sambrook et al. 1989) containing 50 pg of ampicillin (Ap) per
ml. M. xanthus strains were grown at 32°C in CTT broth or agar (1.5%) plates (Hodgkin
and Kaiser 1977) (1% Casitone, 10 mM Tris-HCl [pH 8.0], 1 mM KH2P04-K2HPO4, 8
mM MgSO4 [final pH = 7 .6]). When necessary, 40 ug of kanamycin (Km) per ml or 12.5
ug of oxytetracycline (Tc) per ml was used for selection. Fruiting body development was
performed on TPM agar (1.5%) plates (10 mM Tris-HCl [pH 8.0], 1 mM KH2P04-
K2HPO4, 8 mM MgSO4 [final pH = 7 .6]) as described previously (Kroos et al. 1986).

Construction of plasmids. An EcoRI-Smal restriction fragment containing the
94400 promoter region fiom -101 bp to +155 bp relative to the start site of transcription
was purified from pJB40015 and ligated into pGEM7Zf to form pJB40029. Additional
deletion constructs were created by PCR using pJB40029 as a template and primers
designed to produce a product with a XhoI restriction site at the upstream end and a
BamHI restriction site at the don end. PCR products were then restricted with
XhoI and BamHI, gel-purified, ligated into pGEM7Zf, and the ligation products were
electroporated into E. coli DHSa. Ap-resistant (Ap') transformants were selected and
plasmid DNA was sequenced at the Michigan State University Genomics Technology

Support Facility to confirm the sequence and end points of the M. xanthus DNA insert.

43

 

DK162

DK429

lPB4OC
MDYl '
MGW
MGM
MGWA
MDY6
MDYS
MDYlC
MDYlZ
MDYIA
llDYlt
llDYlE
MDY2l
MDYZZZ
MDYZA
MDth
MDYZE
MDY3€
MDY32
MDY3 ‘-
MDY3
MDY3
MDYS
MDYS
llDYs,
MDYé,
MDYn
MDYc.
MDYh
rDYG
DY?

 

TABLE 2.1. Bacterial strains and plasmids used in this study

 

 

 

Strain or Relevant characteristics Source or
plasmid reference
E. coli strain
DH5a (D80 IacZAMlS AlacU169 recAI endAI hst17 supE44 (Hanahan
(hi-1 gyrA reIAI 1983)
M. xanthus
strains
DK1622 Wild type (Kaiser
1979)
DK4292 Tn5 lac (Km') Q4400 (Kroos et al.
1986)
JPB40030 atthszB40030 This study
MDY1727 attB::pREGl727 This study
MGV4400.2 attB::pGV4400.2 This study
MGV4400.10 attB::pGV4400. 10 This study
MGV4400. 12 attB: :pGV4400. 12 This study
MDY6 attB: :pDY6 This study
MDY8 attB::pDY8 This study
MDYIO attB::pDY10 This study
MDY12 atthzpDY12 This study
MDY14 attB::pDYl4 This study
MDY16 atthzpDY16 This study
MDYl 8 attB: :pDY18 This study
MDY20 attB: :pDY20 This study
MDY22 attB: :pDY22 This study
MDY24 attB: :pDY24 This study
MDY26 attB::pDY26 This study
MDY28 attB::pDY28 This study
MDY30 attB: :pDY30 This study
MDY32 attB::pDY32 This study
MDY34 attB: :pDY34 This study
MDY36 attB: :pDY36 This study
MDY38 atthzpDY38 This study
MDY54 atthzpDY54 This study
MDY56 atthzpDY56 This study
_MDY58 atthzpDY58 This study
MDY60 attB: :pDY60 This study
MDY62 attB: :pDY62 This study
MDY64 attB::pDY64 This study
MDY66 attB: :pDY66 This study
MDY68 attB: :pDY68 This study
MDY70 attB: :pDY70 This study

 

llDYll
Table 2.
MDY'M
MDY76
MDYYS
MDYSO
MDYlO
DKSZOE

MDYSZ
MDY44
DK106C

MDY44'
DK106O

MDY44<
AsigD
MDY44
AsigE
MDY44

Plasml -

\

pGEll

If).

PREGl‘

 

PJBthO

plBlOl?
pIB40f.
PGV44
PGWi

PGW
PGV'

MDY72 attB::pDY72 This study
Table 2.1 (cont’d)

MDY74 attB: :pDY74 This study
MDY76 attB::pDY76 This study
MDY78 attB: :pDY78 This study
MDY80 attB: :pDY80 This study
MDY102 atthzpDY102 This study
DK5208 csgA::Tn5-132 (Tc’) 0205 (Shimkets
and Asher
1988)
MDY5208-30 csgA::Tn5-132 (Tc') 0205 atthzpDY30 This study
MDY4400.CA csgA::Tn5-132 (Tc') 0205 attB::pJB40030 This study
DK10603 AactB (Gronewold
and Kaiser
2001)
MDY4400.AB AactB atthszB40030 This study
DK10604 AactC (Gronewold
and Kaiser
2001)
MDY4400.AC AactC attB::pJB40030 This study
AsigD AsigD (U eki and
Inouye 1998)
MDY4400.SD AsigD Tn5 lac (Km') (24400 This study
AsigE AsigE (Ueki and
Inouye 2001)
MDY4400. SE AsigE Tn5 lac (Km') 04400 This study
Plasmids
pGEM7Zf Apr laca Promega
pREGl 727 Apr Kmr Pl-inc attP ‘lacZ (F isseha et
al. 1996)
pJB40015 Ap’ (pGEM7Zf); 0.64-kb ApaLI-anHI fi'agment from (Brandner
pJB4001 and Kroos
1998)
pJB40029 pGEM7Zf with 267-bp EcoRI-Smal fi'agment from This study
pJB40015
pJB40030 pREGl727 with 297-bp XhaI-BamHI fiagment fiom This study
pJB40029
pGV4400.1 pJB40029 with CATCCCT to ACGAAAG mutation from - This study
52 to -46 bp
pGV4400.2 pREGl727 with 297-bp XhoI-BamI-II fragment fiom This study
pGV4400.1
pGV4400.5 pJB40029 with C to A mutation at -48 bp This study

pGV4400.7 pJB40029 with C to A mutation at -47 bp This study

45

pGV4400. 10 pREGl727 with 297-bp XhoI-BamHI fiagment from This study
pGV4400.5

Table 2.1 (cont’d)

pGV4400. 12 pREGl727 with 297-bp XhaI-BamI-II fragment from This study
pGV4400.7

pDYS pJB40029 with T to G mutation at -50 bp This study

pDY6 pREGl 727 with 297-bp XhoI-BamHI fragment fi'om pDY6 This study

pDY7 pGEM7Zf with zUioI-BamI-II fragment fi'om -86 to +155 bp This study
of 04400 DNA generated by PCR using pJB40029 as
template

pDY8 pREGl 727 with 265-bp XhoI-BamI-II fragment fi'om pDY7 This study

pDY9 pJB40029 with C to A mutation at -52 bp This study

pDY10 pREGl727 with 297-bp XhaI-BamI-II fragment from pDY9 This study

pDYll pJB40029 with A to C mutation at -51 bp This study

pDY12 pREGl 727 with 297-bp XhoI-BamHI fi'agrnent fi'om This study
pDYl 1

pDY13 pJB40029 with C to Amutation at -49 bp This study

pDYl4 pREGl727 with 297-bp Mol-BamHI fi'agment from This study
pDY13

pDY15 pJB40029 with C to T mutation at -49 bp This study

pDY16 pREGl 727 with 297-bp XhoI-BamHI fragment from This study
pDYl 5

pDY17 pJB40029 with T to C mutation at -46 bp This study

pDY18 pREGl727 with 297-bp XhoI-BamI-II fragment fiom This study
pDYl7

pDY19 pJB40029 with T to G mutation at -46 bp This study

pDY20 pREGl 727 with 297-bp XhoI-BamHI fragment from This study
pDY19

pDY21 pJB40029 with G to T mutation at -77 bp This study

pDY22 pREGl 727 with 297-bp XhoI-BamHI fi'agment from This study
pDY21

pDY23 pJB40029 with T to G mutation at -78 bp This study

pDY24 pREGl 727 with 297-bp XhoI-BamI-II fi’agment from This study
pDY23

pDY25 pJB40029 with G to T mutation at -79 bp This study

pDY26 pREGl727 with 297-bp XhoI-BamI-II fragment from This study
pDY25

pDY27 pJB40029 with G to T mutation at -80 bp This study

pDY28 pREGl 727 with 297-bp XhoI-BamI-II fi'agrnent fiom This study
pDY27

pDY29 pJB40029 with G to T mutation at -81 bp This study

pDY30 pREGl 727 with 297-bp XhoI-BamHI fi'agment from This study
pDY29

pDY3l pJB40029 with G to T mutation at -82 bp This study

pDY32 pREGl 727 with 297-bp XhoI-BamI-II fragment from This study

pDY3 l
46

pDY33

Table 2.1

pDY34
pDY35
pDY36
pDY37
pDY38
pDY53
pDY54
pDY55
pDY56

pDY57
pDY58

pDY59
pDY60

pDY6]
pDY62

pDY63
pDY64

pDY65
pDY66

pDY67
pDY68

pDY69
pDY70

pDY7 1

pJB40029 with G to T mutation at -83 bp

(cont’d)
pREGl727 with 297-bp XhaI-BamI-II fiagment from
pDY33
pJB40029 with GAAC to TCCA mutation at -63 bp to -60
bp
pREGl727 with 297-bp XhoI-BamHI fragment from
pDY35
pJB40029 with CGGTG to ATTGT mutation at -74 to -70
hp
pREGl727 with 297-bp XhoI-BamHI fiagment from
pDY37
pJB40029 with TACAAC to GCACCA mutation at -13 to
-8 bp
pREGl 727 with 297-bp XhoI-BamHI fragment from
pDY53
pJB40029 with AGGCGC to CTTATA mutation at -36 to -
30 bp
pREGl727 with 297-bp XhoI-BamHI fragment from
pDY55 ,
pJB40029 with A to C mutation at -53 bp
pREGl 727 with 297-bp XhoI-BamI-II fragment from
pDY57
pJB40029 with GTCCC to TGAAA mutation at -58 to -54
bp
pREGl 727 with 297-bp XhoI-BamHI fragment from
pDY59
pJB40029 with A to C mutation at -59 bp
pREGl 727 with 297-bp fial-BamHI fi'agment from
pDY6]
pJB40029 with C to A mutation at -60 bp
pREGl 727 with 297-bp {Viol-BamHI fragment from
pDY63
pJB40029 with GGGAGC to TTTCTA mutation at -69 to -
64 bp
pREGl727 with 297-bp XhoI-BamHI fiagment fi'om
pDY65
pJB40029 with TG to GT mutation at -76 to -75 bp
pREGl727 with 297-bp XhoI-BamHI fragment from
pDY67
pJB40029 with GTC to TGA mutation at -86 to -84 bp
pREGl 727 with 297-bp flroI-BamHI fi'agment from
pDY69
pJB40029 with GGCGG to 'I'I'ATT mutation at -45 to -41
bp

47

This study

This study
This study
This study
This study
This study
This study
This study
This study
This study

This study
This study

This study
This study

This study
This study

This study
This study

This study
This study

This study
This study

This study
This study

This study

 

pDY7?
Table I
pDY73
pDYle‘

pDY75

pDY76

pDY77

pDY78
pDY79
pDY80

pD01
le'lOl

 

 

pDY72 pREGl727 with 297-bp XhoI-BamHI fragment from This study
pDY7]

Table 2.1 (cont’d)

pDY73 pJB40029 with CCGG to AATT mutation at -40 to -37 bp This study

pDY74 pREGl 727 with 297-bp XhoI-BamHI fragment fi'om This study
pDY73

pDY75 pGEM7Zf with .«WroI-BamI-II fragment from -73 to +155 bp This study
of (24400 DNA generated by PCR using pJB40029 as
template

pDY76 pREGl727 with 252-bp MoI-BamI-II fragment from This study
pDY75

pDY77 pGEM7Zf with XhoI-BamHI fragment fi'om -86 to +25 bp This study
of (24400 DNA generated by PCR using pJB40029 as
template

pDY7 8 pREGl 727 with 111-bp XhoI-BamHI fiagment fi’om This study
pDY77

pDY79 pJB40029 with GGGGGTG to TTI‘TI‘GT mutation fi'om This study
-83 to -77 bp

pDY80 pREGl727 with 297-bp XhoI-BamHI fi'agment from This study
pDY79

pDOl pJB40029 with T to C at -50 bp . This study

jDYlOZ pREGl 727 with 297-bp XhoI-BamI-II fi'agment from pDOl This study

 

48

The Quikchange site-directed mutagenesis kit (Stratagene) was used to create
mutations in the 04400 promoter region that, in most cases, were A<—>C or T<—>G single
base pair or multiple base pair transversion mutations. In addition, three mutations were
made that were T<—>C transition mutations (Table 2.2). The plasmid pJB40029 described
above was used as a template in PCR reactions with various combinations of mutagenic
primers. The M. xanthus DNA insert was sequenced at the Michigan State University
Genomics Technology Support Facility to ensure only the proper mutations had been
created.

Each mutant derivative of pJB40029 was restricted with )0201 and anIII, gel-
purified and ligated into pREGl727 previously cut with the same enzymes. The ligation
products were introduced into E. coli DHSor by electroporation and Ap'transformants
were selected. A transformant containing the mutant Q4400 plasmid was identified using
colony PCR with primers to ensure proper orientation. The transformants containing the
mutated Q4400 promoter regions were then used to prepare plasmid DNA for
introduction into M xanthus.

Construction of M xanthus strains and determination of lacZ expression
during developman Strains containing pREGl727 derivatives integrated at the Mx8
phage attachment site (designated attB in Table 2.1) were constructed by electroporation
(Kashefi and Hartzell 1995) of M xanthus and transformants were selected on CTT-Km
plates. Based on previous experience in our laboratory (F isseha et al. 1996, Brandner and
Kroos 1998, Fisseha et al. 1999), the majority of transformants have a single copy of the

plasmid integrated at attB. To eliminate colonies with unusual developmental lacZ

49

 

expression, we screened at least 10 transformants on TPM agar plates containing 40 pg of
5-bromo—4-chloro-3-indolyl-B-D-galactopyranoside (X-Gal) per ml. Any colonies with
unusual expression of lacZ were discarded and of the remaining candidates, three
independent isolates of each mutant construct were chosen for development. In all cases,
the three transformants gave similar results (Table 2.2) when developmental B-
galactosidase activity was measured as described previously (Kroos et a1. 1986).

To transduce Tn5 lac Q4400 into M xanthus sigD and sigE mutants, Mx4 phage stocks
(Campos and Zusman 1975, Geisselsoder et al. 1978, Kaiser 1984) were prepared on M
xanthus DK4292 and used to infect the mutants at multiplicities of 2.0, 1.0, 0.5 and 0.1.
Transductants were selected on CTT-Km plates. Developmental B-galactosidase activity

was determined as described previously (Kroos et al. 1986) for three transductants.

50

 

RESULTS

Effects of mutations in a C box centered at -49 bp. A conserved seven base
pair sequence (CATCCCT), termed a C box (Fisseha et al. 1999), is centered at -49 bp in
both the 04400 (Brandner and Kroos 1998) and (24403 (F isseha et al. 1996) promoter
regions. The effects of single base pair changes in this C box in the 04403 promoter
region have already been established (Viswanathan and Kroos 2003). Ifthe C box
centered at —49 bp functions in the same way in both promoter regions, the effects of
mutations should be the same. To test this prediction, we created a plasmid that contains
the (24400 wild-type promoter region (-101 bp to +155 bp) and used site-directed
mutagenesis to create AHC and T(-)G transversion mutations at each of the base pairs
within the C box centered at —49 bp (Table 2.2). In addition, we made three mutations,
which were T<—->C transitions at —50 bp, -49 bp and —46 bp, and a multiple bp change of
the entire C box (Table 2.2). These mutant promoter regions were subcloned directly
upstream of the E. coli lacZ gene in pREGl727 and the resulting plasmids were
transformed into the M xanthus wild-type strain DK1622 for determination of lacZ
expression during development (see Materials and Methods). A strain bearing a
pREGl 727 derivative containing the (24400 wild-type promoter region served as a
positive control and a strain containing only the pREGl 727 vector (without a promoter)
served as a negative control. Table 2.2 shows the average maximum activity and the
percentage of wild-type activity for each strain. The complete developmental lacZ
expression data for the controls, and for mutants with a T to C transition at —50 bp or a C

to A transversion at -49 bp, are shown as examples in Figure 2.1A Five of the eleven

51

TABLE 2.2. Activities of mutant Q4400 promoters

 

Promoter or strain assayed Avg maximum B-galactosidase % Wild-type activity

 

 

sp act during development3 measured in she same
expt
Vector (no insert) 11 1 5
VVlld-type Q4400 promoter 210 1 52

Deletions:

-86to+155 186124 9318
-73to+155 bp 160119 6017
-86to+25bp 146131 54112

Mutations:

TACAAC -13 to -8 GCACCA 5 1 2 0 1 0.4
AGGCGC -36 to -31 CTTATA 19 1 0 5 1 0.7
CCGG ~40 to -37 AATT 12 1 1 2 1 0.4
GGCGG -45 to ~41 TTATT 25 1 6 9 1 3
CATCCCT -52 to -46 ACGAAAG 16“ 5
T 46 G 364 1 90 210 1 53
T-460 273155 156133
C -47 A 15 1 1 4 1 0.3
C-48A 2081140 109176
C -49 A 25 1 3 9 1 2
C -49 T 171 5 4 1 3
T-5OG 150141 5014
T -50 C 276 1 38 158 1 23
A-51C 184111 9814
C-52A 1612 410.9
C -53 A 54 1 18 15 1 8
GTCCC -58 to -54 TGAAA 15 1 0.2 3 1 0.8
A-59C 1211 210.2
GAAC -63 to -60 TCCA 1214 212
C -60 A 12 1 2 1 1 0.7
GGGAGC-69 to ~64 TITCTA 167 1 4 87 1 2
CGGTG -74 to -70 ATTGT 214 1 7 89 1 3
TG -76 to -75 GT 176 1 47 92 1 26
GGGGGTG -83 to -77 TUTTGT 102 1 1 51 1 0.4
G-77T 271115 11617
T-7BG 220125 92112
G-79T 199111 8215
G -80 T 192 1 6 79 1 3
G-81 T 130130 57.0115
G-82T 176153 71124
G-83T 285151 122124
GTC-86to-84TGA 61116 2117

 

a The maximum B-galactosidase specific activity in nanomoles of o-nitrophenyl phosphate per minute per

milligram of protein (average plus or minus 1 standard deviation) is listed for three independently isolated
M. xanthus transformants (one determination each) in the case of mutant promoters and for one isolate

52

Table 2.2 (cont’d)

(thirteen determinations) in the case of the wild-type promoter (JPB40030). Samples were assayed at 0,
6,12, I8, 24, 30, 36, and 48 h dining development.

b The wild-type promoter and vector-only strains were included in each experiment. The maximum for

each mutant promoter is expressed as a percentage of the maximum observed for the wild-type promoter in
the same experiment, after subtracting fi'om both values the maximum observed for vector only in that
experiment. The average percentage plus or minus 1 standard deviation is listed. A zero in this column
indicates that expression from the mutant promoter was equal to or slightly less than that observed for the
vector only control.

c For example, mutant TACAAC -13 to -8 GCACCA has a mutation changing TACAAC at positions -13
to -8 to GCACCA, and mutant T -50 G has a mutation changing T at position -50 bp to G.

53

mutations showed a strong (more than ten-fold) decrease in maximum B—galactosidase
specific activity, including the multiple bp change of the entire C box, the transversions at
-52, -49 and -47 bp, and the transition at —49 bp (Table 2.2 and Figure 2.1). Transversion
mutations at -51 or -48 bp had no significant effect on lacZ expression (Table 2.2) while
mutations at -46 bp increased maximum activity. The T to C and T to G changes at —50
bp caused a small increase or decrease, respectively, in activity. Taken together, the
results show that certain bp in the C box centered at —49 bp are critical for developmental
expression from the 94400 promoter.

The pattern of effects of transversion mutations in the C boxes centered at -49 bp
in the (24400 and (24403 (Viswanathan and Kroos 2003) promoter regions is compared
in Figure 2.1B. A very different effect is observed at four of the seven positions. The
most profound difference is at -49 bp, where in the (14400 promoter region the mutation
leads to a 90% decrease in activity, while in the 04403 promoter region it leads to a
360% increase in activity. Because the pattern of mutational effects for the two C boxes
is markedly different, we conclude that they function differently. For example, if these
sequences are recognized by transcription factors, our results suggest that different
proteins bind to the two promoter regions.

Effects of mutations in the C box centered at —80 bp. The presence of a
second C box, centered at -80 bp in the Q4400 promoter region, was noted previously
(F isseha et al. 1999). To determine if this C box is important for 04400 promoter
activity, a multiple bp change of GGGGGTG (note that the sequence of the opposite
DNA strand, CACCCCC, matches the C box consensus sequence) to 'ITTI‘T GT was

54

Figure 2.1. Mutational analysis of the C box centered at -49 bp in the (24400 promoter
region and comparison with the (24403 promoter region. (A) Developmental lacZ
expression was determined for three independent isolates for each strain. The closed
squares (I) represent the 04400 wild-type promoter (-101 to +155 bp), which served as a
positive control. The closed circles (0) represent the vector without insert negative
control. The single base pair changes shown are T to C at -50 bp (A) and C to A at -49
bp (0). The average B-galactosidase activity is expressed as nanomoles of o-nitrophenyl
phosphate per minute per milligram of protein. Error bars show one standard deviation
of the data. (B) A summary of the effects of transversion mutations at each bp of the C
box centered at ~49 bp in both the (14400 (dark bars) and 04403 (light bars) promoter
regions is shown with bars depicting the average maximum B-galactosidase specific
activity during a 48-h time course, expressed as a percentage of the maximum observed
for the corresponding wild-type promoter, and error bars showing one standard deviation

of the data, taken from Table 2.2 here and in (V iswanathan and Kroos 2003).

55

5..

 

 

350-

. _
0 0 0
0 5

2

3004
2504
150‘
1001

@3305 058% omaEmSufiawd

36 42 48

0

Time (hr)

18 24 3

12

 

 

nnnnnnnnnl
32.8 25.25 so
1538.“ 953% engages—sud

Location in the promoter

56

tested as described above. This mutation showed a 50% decrease in developmental
promoter activity (Table 2.2). The effects of single bp changes in this C box were also
examined. None of the mutations showed as strong an effect as the multiple bp change,
although the G to T change at position —81 bp did decrease activity by about 40% (Table
2.2). We conclude that the C box centered at —80 bp in the 04400 regulatory region is
not essential for developmental expression, though it does exert an approximately two-
fold positive effect. This is different from the 04403 regulatory region, which has an
essential lO-bp element between —79 and —70 bp.

Deletion analysis of the (24400 promoter region. Brandner and Kroos
(Brandner and Kroos 1998) previously identified the transcriptional start site for the
04400 promoter and reported that a fragment spanning fi'om —101 to +455 bp could drive
developmental lacZ expression comparable to that of the original Tn5 lac Q4400
insertion in the M xanthus chromosome, but a 5’ deletion to -73 bp (erroneously reported
as -76 bp to +455 bp) with the same downstream end lost all activity. All the mutations
described above were tested in the context of 04400 DNA fi'om -101 to +155 bp,
because this fragment produced similar levels of B-galactosidase activity during
development (Figure 2.2) as the —101 to +455 bp construct (Brandner and Kroos 1998).
In order to determine whether a smaller region is sufficient for firll expression of the
94400 promoter, a series of deletions (both 5’ and 3’) were constructed, firsed to lacZ in
pREGl727, transformed into M xanthus DK1622 and tested for developmental
production of B-galactosidase. A 5’deletion that contained -86 to +155 bp exhibited

comparable activity as the —101 to +155 bp segment (Table 2.2 and Figure 2.2),
57

Figure 2.2. Deletion analysis of the (24400 promoter region. The 5’ deletion constructs
contained Q4400 DNA from ~86 to +155 bp (A) or ~73 to +155 bp (A), whereas the 3’
deletion construct had ~86 to +25 bp (9). The closed squares (I) represent the 04400
promoter region fi'om ~101 to ~155 bp, which served as the positive control for these
experiments. Also shown is the vector, no insert negative control (0). The average B-
galactosidase activity of at least three independent isolates is expressed as nanomoles of

o-nitrophenyl phosphate per minute per milligram of protein. Error bars show one

standard deviation of the data.

58

 

 

 

 

mi
3
aver

mm. menu
2214'

won 053% ouflEaSua—dué

 

18 24 30 36 42 48
Time (hr)

13 12

0

59

indicating that the region between —101 and -86 bp is not necessary for expression. A 5’
deletion containing ~73 bp to +155 bp showed a 40% decrease in average maximum
activity, which is similar to the effect of the multiple bp change in the C box centered at —
80 bp, or the single bp change at —81 bp (Table 2.2 and Figure 2.2). This result was
surprising, because, as noted above, the segment spanning fiom —73 to +455 bp was
reported previously to be inactive (Brandner and Kroos 1998). The finding that
considerable activity is observed for the —73 to +155 bp segment (Table 2.2 and Figure
2.2) suggests that a potential negative regulatory element lies between +155 and +455 bp.
However, negative regulation is only observed in the absence of suflieient upstream
DNA (i.e. beyond ~~73 bp) because no significant difference in activity was observed for
two constructs with the same 5’ end at —101 bp and different downstream ends at +155 bp
(Table 2.2 and Figure 2.2) or +455 bp (Brandner and Kroos 1998).

To determine the role, if any, of the sequence between +25 and +155 bp, a 3’
deletion containing from ~86 to +25 bp was tested. This deletion reduced the
developmental promoter activity nearly two-fold (Table 2.2 and Figure 2.2), suggesting
that the region between +25 and +155 bp plays a weak positive role in expression from
the (24400 promoter. Because DNA between —86 and +25 bp relative to the (24400
transcriptional start site displayed considerable activity, we focused our efforts toward
identifying and characterizing cis-regulatory elements within this region by testing the
effects of additional mutations in the context of (24400 DNA fiom —101 to +155 bp.

Effects of mutations between ~86 and ~64 bp. To test the importance of the

region surrounding the C box centered at ~80 bp, we constructed several multiple bp

60

mutations in this region (Table 2.2 and Figure 2.3). A ~86 to ~84 bp mutation of GTC to
TGA retained only 26% activity when compared to wild-type. We do not understand
why this particular mutation impairs developmental expression more than the 5’ deletion
to —73 bp, but both results support the idea that a positive regulatory element exists in this
region. We also created a dinucleotide mutation of TG to GT at ~76 to ~75 bp because this
region was shown to be essential in the 04403 promoter region (V iswanathan and Kroos
2003). This mutation had little effect on Q4400 promoter activity (Table 2.2 and Figure
2.3). Likewise, neither a CGGTG to ATTGT mutation centered at ~72 bp nor a
GGGAGC to TTTCTA mutation spanning ~69 bp to ~64 bp had much effect on
expression. These results, together with the mutations in the C box centered at -80 bp
and the 5’ deletion to —-73 bp suggest that a positive regulatory element exerting a two. to
four-fold effect on developmental lacZ expression exists between -86 and -81 bp in the
Q4400 regulatory region.

Effects of mutations in the 5-bp element. Another conserved sequence that is
found in the 04400 and 04403 promoter regions, as well as the Q4499,fi-uA and csgA
promoter regions, has been termed the 5~bp element (Viswanathan and Kroos 2003). In
all of these regulatory regions, a 5—bp sequence with the consensus GAACA can be found
approximately 5-7 bp upstream of a C box sequence. In the 94400 promoter region, the
sequence is ~63 GAACA ~59. In the case of (24403, the sequence is ~63 GACCG ~59,
and this element appears to be essential for activity of the Q4403 promoter (Viswanathan
and Kroos 2003). A single bp change at any position, except the C at —60 bp, greatly
impaired or abolished expression. To determine if this element is important for

61

FIG 2.3. Summary of mutational effects on developmental expression fi'om the 04400
promoter. The promoter region is shown from —86 to -—8 bp. Downward arrows indicate
decreased developmental lacZ expression caused by the given mutations and numbers
indicate the relative amount of B-galactosidase specific activity observed for the mutant,
expressed as a percentage of wild-type promoter activity measured in the same

experiment (Table 2.2). Mutations are alternately underlined or boxed.

62

 

c m N a ((“GU( n N N
(004400 (FAT—.0 $14 :1 FPO 47 mguhwijh on
A < F
«m
NO on NO FEE:
(FOE PUP—k he a

a 2 s
a- Eouoouuoiuopogo co 3... our 3 5o .593 on-

 

 

 

 

 

 

 

 

 

63

expression fiom the (24400 promoter, we first constructed a strain with a four base pair
mutation fiom GAAC to TCCA at -63 to —60 bp. This change led to a complete loss of
promoter activity (Table 2.2 and Figure 2.3). A single bp mutation of A to C at position ~
59 bp also caused a complete loss of activity (Table 2.2 and Figure 2.3). Because the
fourth bp of the 5~bp element is the most conserved, yet when this bp was mutated in the
(24403 promoter region a nearly two-fold increase in developmental lacZ expression was
observed (Viswanathan and Kroos 2003 ), we tested the effect of making the same change
in the 04400 promoter region. Mutating C to A at position —60 bp abolished Q4400
promoter activity (Table 2.2). We conclude that base pairs in the —60 region are essential
for activity of both the Q4400 and 04403 promoters, but the effect of changing C to A at
position —60 bp is quite different for the two promoters, consistent with the notion that
these promoter regions may be recognized by different transcription factors.

Effects of mutations between ~58 and ~53 bp. Two mutations were created in
the region between the 5~bp element and the C box centered at ~49 bp. A multiple bp
mutation of GTCCC to TGAAA centered at ~56 bp led to a complete loss of promoter
activity (Table 2.2 and Figure 2.3). In contrast, a comparable mutation in the
corresponding region of the 04403 promoter region caused a 1.6-fold increase in activity
(V iswanathan and Kroos 2003). A single base change at ~53 bp from A to C caused a
strong decrease in (24400 promoter activity (Table 2.2 and Figure 2.3), which was
comparable to the effect of a T to G change at position —53 bp in the (24403 promoter
region (Viswanathan and Kroos 2003). As summarized in Table 2.2 and Figure 2.3, the
region between —64 and —46 bp contains many bp that are vital for expression of 124400.

64

Effects of mutations downstream of ~46 bp. We made two mutations between
the C box centered at —49 bp and the promoter ~35 region. Changing —45 GGCGG —41 to
TTATT showed a strong decrease in developmental expression as did changing ~40
CCGG —37 to AATT (Table 2.2 and Figure 2.3). We note that both of these mutations
not only change the DNA sequence but also alter the local GC content of the DNA,
although this was also the case when we changed —69 GGGAGC —64 to TTTCTA, ~74
CGGTG -70 to ATTGT, and —83 GGGGGTG —77 to T'I'I’TTGT, yet these mutations has
less than a two-fold effect on (24400 expression (Table 2.2 and Figure 2.3).

The (24400 promoter has a ~10 region with the sequence TACAAC (Figure 2.3),
which resembles the E. coli (:70 consensus sequence of TATAAT (Lisser and Margalit
1993). However, the ~~35 region of the (24400 promoter (AGGCGC) does not match the
(:70 consensus sequence (TTGACA) (Lisser and Margalit 1993). To determine the effects
of mutating these regions, we created two mutations, a —13 TACAAC —8 to GCACCA
and -36 AGGCGC -31 to CTTATA. In both cases, we observed a complete loss of
promoter activity (Table 2.2 and Figure 2.3).

To summarize the results of our mutational analyses, the (24400 promoter —10
region and DNA spanning at least fi'om the —35 promoter region to —60 bp are critical for
developmental expression, and DNA extending fiom —81 bp to approximately —86 bp
stimulates expression two- to four-fold.

C~signal dependence of the 04400 promoter. The (24400 promoter exhibits
partial dependence on extracellular C~signaling; a three-fold decrease in developmental
expression was observed in a csgA mutant that is unable to make C~signal, but expression

65

was restored in the csgA background upon co—development with wild-type cells, which
provided C~signal (Brandner and Kroos 1998). Since our mutational analysis suggested
that a positive regulatory element between —86 and —81 bp stimulates Q4400 promoter
activity two- to four-fold, we hypothesized that this element might mediate the partial C-
signal dependence of the promoter. Ifthis hypothesis is correct, mutations in the —86 to —
81 bp region might reduce or eliminate dependence on C~signaling. We transformed
pDY70 containing the —86 to —84 bp mutation fiom GTC to TGA into csgA mutant
DK5208 cells and measured developmental lacZ expression (Figure 2.4A). The activity
of the mutant promoter in the csgA mutant background was not significantly different
than in the wild-type background. Addition of wild-type DK1622 cells to the csgA
mutant bearing the mutant promoter region did not alter developmental lacZ expression.
These results indicate that the mutant regulatory region is C~signal-independent, and are
consistent with the idea that the —86 to —84 bp region mediates the partial C~signal
dependence of the Q4400 promoter.

We also transformed pDY30, which has a G to T mutation at —81 bp, into csgA
mutant cells and carried out a similar experiment (Figure 2.4B). This mutant promoter
showed about half as much activity in the csgA mutant as in the wild-type background,
suggesting some residual dependence on C~signaling. However, expression of the mutant
promoter in the csgA background did not increase significantly upon co-development
with wild~type DK1622 cells. This mutant promoter appears to be less responsive to C~
signaling than the wild-type Q4400 promoter, filrther supporting the notion that the

partial C~signal dependence of the 524400 promoter is mediated, at least in part, through

66

Figure 2.4. C~signal dependence of mutant Q4400 promoter regions. Developmental
lacZ expression of pDY70 (A) or pDY30 (B), integrated at atlB of wild-type DK1622
(O) or csgA mutant DK5208 in the absence (0) or the presence (A) of an equal number
of DK1622 cells (lacking lacZ but capable of C~signaling). The average B-galactosidase
activity of at least three independent isolates is expressed as nanomoles of o-nitrophenyl
phosphate per minute per milligram of protein. Error bars show one standard deviation
of the data. Single isolates with pJB40030 (wild~type Q4400 promoter fiom ~101 to +155
bp) (I) or pREGl727 (vector without insert) (0) integrated at attB were included as

controls.

67

 

 

 

 

O 6

 

a A _ _ _ _
0 0 0 0 0 0 O
0 5 0 5 0 5
3 2 2 1 1
33:3 959on omaEmSofiuwtn

g,
12 18 24 30 36 42 48

Time (hr)

 

 

 

5
4;—
0 612182430364248

_ _ J - _ _

0000000
050505
32211

53:01 058% omaEmSofiauln

Time (hr)

68

the -86 to —81 bp region.

Expression of (24400 in act mutants. Gronewold and Kaiser previously
identified the act operon, which controls the timing and level of ngA production in M
xanthus (Gronewold and Kaiser 2001). In-fiame deletions in actA or actB reduced the
amount of ngA accumulated during development. An in-frame deletion in actC caused
earlier accumulation of ngA during development, whereas an insertion mutation in actD
delayed the normal rise in ngA level. Expression of several C~signal-dependent genes
correlated with the timing and level of ngA production in the act mutants (Gronewold
and Kaiser 2002). To test whether Q4400 expression behaves similarly, we transformed
both an actB mutant, DK10603, and an actC mutant, DK10604, with the plasmid
pJB40030 that contains the (24400 wild~type promoter region firsed to lacZ and measured
developmental lacZ expression.

Figure 5 shows that expression of 04400 correlates with ngA production. In the
actB mutant, expression was reduced 50% (Figure 2.5A), as was observed for two other
developmental promoters ((24414 and (24499) that depend partially on C~signaling for
expression (Gronewold and Kaiser 2002). In the actC mutant, Q4400 expression
increased 6 hours earlier than in the wild-type background (Figure 2.5B). This correlates
with the earlier rise in ngA level in the actC mutant and matches the behavior of several
other developmental reporters (04414, £24499, (27536) in the actC background
(Gronewold and Kaiser 2002). Ifexpression of 04400 correlates with ngA production
in the act mutants only because of the role ngA plays in extracellular C~signaling, it

might be possible to restore Q4400 expression in the act mutant to the wild-type pattern

69

Figure 2.5. Effects of actB and actC mutations on expression of the 04400 promoter and
extracellular complementation of the defects. The 94400 wild-type promoter fused to
lacZ in pJB40030 was integrated into the Mx8 phage attachment site of DK10603
(AactB) and DK10604 (AactC). (A) Developmental lacZ expression in the actB mutant
alone (0) or upon co—development with wild-type DK1622 (A). (B) Expression in the
actC mutant alone (9) or upon co-development with DK1622 (A). In both panels, the
average B-galactosidase activity is expressed as nanomoles of o~nitrophenyl phosphate
per minute per milligram of protein. Error bars show one standard deviation of the data.
Single isolates with pJB40030 (wild~type Q4400 promoter fiom -101 to +155 bp) (I) or

pREGl727 (vector without insert) (0) integrated at attB were included as controls.

70

 

 

A.

 

 

4:4;
12 18 24 30 36 42 48

 

 

 

v.11 6
_‘ a J _ _ _ _ 0
0 0 0 0 0 0 0 0
5 0 5 0 5 0 5
3 3 2 2 1 1..
235.53“ 053% 05mm§fiwé

Time (hr)

12 18 24 30 36 42 48

0 6

 

 

Time (hr)

71

by co-development with wild-type cells. Figure 2.5A shows that wild-type cells restored
the normal level of developmental lacZ expression to 04400 in the actB mutant. For the
actC mutant, co-development with wild-type cells produced little change in the pattern of
lacZ expression during the first 12 hours of development (Figure 2.5B, triangles), but at
18 and 24 h, Q4400 expression was more similar to that in the wild-type background
(squares) than in the actC mutant without co-developing wild-type cells (diamonds).
Apparently, at a ratio of 1:1 in the mixture, wild-type cells cannot compensate for the
excess ngA produced by the actC mutant early in development, but as aggregation and
mound formation progress later in development, the wild-type cells appear to dilute C-
signaling interactions and partially restore Q4400 expression to the normal, lower levels.
Taken together, these results demonstrate that expression fiom the (24400 promoter
responds to the timing and level of ngA production. Moreover, the defects in ngA
production in actB and actC mutants can be complemented extracellularly by co-
development with wild-type cells, restoring Q4400 expression to nearly the normal level
by 18 hours into development.

Expression of (24400 in sigD and sigE mutants. The form of RNA polymerase
responsible for transcription fi'om the (24400 promoter is unknown. 6A RNA
polymerase, the major form in growing cells (Biran and Kroos 1997), was unable to
produce transcripts from the 04400 promoter in vitro (Biran and Kroos). Brandner and
Kroos showed previously that null mutations in the sigB (encoding GB) or sigC (encoding
cc) genes did not effect the expression of 04400 (Brandner and Kroos 1998). To

investigate if the remaining (:70 sigma family members that been described (Ueki and
72

Inouye 1998, Ueki and Inouye 2001) directly or indirectly control the expression of
(24400, we used Mx4 phage to transduce two M xanthus strains that contain a null allele
of the sigD (encoding c”) or sigE (encoding o5) gene with the original Tn5 lac (24400
insertion from DK4292. Transductants containing a mutation in the sigD gene failed to
express B-galactosidase fi'om the (24400 promoter (Figure 2.6), suggesting that on RNA
polymerase activity is directly or indirectly required for (24400 expression. In a sigE
mutant, the expression of (24400 was reduced and did not reach the maximum wild~type
activity level by 48 hours into development (Figure 2.6). This suggests that 0’5 RNA
polymerase is not solely responsible of transcription of 04400, although is may be partly

responsible or it may indirectly effect Q4400 expression.

73

Figure 2.6. Expression of (24400 in sigD and sigE mutants. Developmental B-
galactosidase activity was determined for Tn5 lac Q4400 transduced into sigD (A) and
sigE (9) mutant backgrounds. The average 8~galactosidase activity fiom three ‘
independent isolates is expressed as nanomoles of o-nitrophenyl phosphate per minute l
per milligram of protein. Error bars show one standard deviation of the data. A single

isolate of DK4292 bearing Tn5 lac (24400 in an otherwise wild~type background is

shown as a positive control (I).

74

 

 

 

._
g
._

 

200 1

_ _ _ _ 2 _ _
0 0 0 0 0 0 0
6 4 2 0 8 6 4

_
0
8
1

.0533 053% 815332.54“

 

 

 

204
0

612

0

13 24 30 36 42 43

Time (hr)

75

DISCUSSION

Our characterization of the 04400 regulatory region provides the first
comprehensive examination of a partially C~signal-dependent promoter region in M
xanthus. The mutational analysis of the (24400 promoter region indicates that the C box
centered at —49 bp firnctions differently than the same sequence in the absolutely C-
signal-dependent Q4403 promoter region. Also, the C box centered at —80 bp in the
Q4400 regulatory region is not essential for expression, unlike the C boxes centered at —
49 bp in the (24400 and 04403 promoter regions. The picture that emerges from our
mutational analysis is that, in addition to the -10 region, there are two regions important
for expression of the Q4400 promoter. One region spans from at least —60 bp through the
promoter -35 region and is essential for expression. The other region lies between -—86
and —81 bp and only exerts a two- to four-fold positive effect on expression. This picture
is quite different fi'om the one that emerged fi'om mutational analysis of the 04403
promoter region (V iswanathan and Kroos 2003), as will be discussed firrther below.
Because these two promoters exhibit difi‘erent degrees of dependence on C~signaling
(F isseha et al. 1996, Brandner and Kroos 1998), our findings provide the first insight into
how differential regulation of C~signal-dependent genes is achieved. Moreover, our
results show that the region responsible for conveying partial C~signal-dependence on the
(24400 promoter includes, but may not be limited to, the —86 to —81 bp region. We also
showed that expression of the Q4400 promoter tracks with the levels of ngA expression
in actB and actC mutants, and the effects of these mutations on expression can be rescued

by mixing with wild-type cells, demonstrating that the 04400 promoter is very
76

responsive to the level of C~signaling. Finally, we showed that Q4400 expression is
completely dependent on sigD and partially dependent on sigE.

The C box element has been found in the regulatory region of several C~signal-
dependent genes, including csgA, 04499, and fruA (F isseha et al. 1999). However, upon
comparing the pattern of mutational effects on C boxes of identical sequence located at -
49 bp in the (24400 and (24403 promoter regions, striking differences were observed at 4
of the 7 positions (Figure 2.1B). Ifthese C boxes are bound by transcription factors, as
seems likely, the results suggest that different proteins bind in a different way to the
identical sequence in the two promoter regions. Alternatively, a single protein might
bind differently to the C boxes in the two promoter regions by adopting different
conformations, possibly due to interactions with other proteins Or with DNA surrounding
the C boxes. In either case, the protein(s) involved seems most likely to be a
transcriptional activator(s) rather than a o factor(s), as the C boxes centered at —49 bp are
located farther upstream than the regions typically recognized by 0. Another possibility
is that C boxes function in a manner analogous to UP elements, which are AT-rich
sequences typically located between —60 and —40 bp, that interact with the C~terminal
domain of the or subunit of RNA polymerase (Ross et al. 1993, Ross et al. 2001).
According to this model, the M xanthus or subunit would have to interact differently with
the C boxes in the two promoters, in order to explain our results.

A 7~bp mutation of the C box centered at —80 bp in the (24400 regulatory region
indicated that this element is not essential for expression (Figure 2.3). Furthermore, none

of the single bp mutations within this C box showed even a two-fold effect on expression

77

(Table 2.2). The 3~bp sequence directly upstream of this C box appeared to have more of
an effect when mutated, though still exhibiting only a four-fold decrease in expression
(Figure 2.3). It is possible that a transcriptional activator binds to this region. This
putative activator may mediate the response of the 04400 promoter to C~signaling,
because a 3-bp change at -86 to —84 bp made the promoter oblivious (Figure 2.4A) to the
normal three-fold reduction in expression caused by a csgA mutation (Brandner and
Kroos 1998). In contrast to the partial dependence on C~signaling of the wild-type
Q4400 promoter, expression of the 04403 promoter depends absolutely on C~signaling
(F isseha et al. 1996). Interestingly, in the 04403 regulatory region, a 10~bp element fi'om
—79 to -70 bp is absolutely required for expression (V iswanathan and Kroos 2003).
Perhaps this element mediates the absolute dependence of 04403 expression on C-
signaling. For example, the same or a different transcriptional activator may bind
differentially in response to C~signaling to the lO-bp element in the 04403 promoter
region and to the —86 to -81 bp region upstream of 04400. As noted previously, the —84
to —73 bp region upstream of 04400 matches the 04403 10~bp element at only 5
positions, but it matches a sequence between —72 and —61 bp in the partially C~signal-
dependent Q4499 promoter at 9 of 12 positions (V iswanathan and Kroos 2003).

Deletion analysis of the Q4400 promoter region suggested surprising complexity
in the transcriptional regulation of this gene. In addition to the 86 bp of upstream DNA
that is required for fiill expression, an element between +25 and +155 bp exerts a weak
positive effect (Figure 2.2). Also, a strong negative element between +155 and +455

only acts in the absence of the region between —86 and —73 bp (Figure 2.2) (Brandner and
78

Kroos 1998). Above, we speculated that the region between —86 and —81 bp interacts
with a transcriptional activator that mediates the response to C~signaling. Perhaps the
transcription complex assembled in the presence of this putative activator is more
resistant to premature termination as RNA polymerase traverses the +155 to +455 bp
region. Participation of an upstream sequence in transcriptional antitemtination would be
unusual since such mechanisms in prokaryotes typically involve sequences downstream
of the transcriptional start site (Hean and Yanofsky 2002).

The developmentally-regulatedfiuA promoter of M xanthus also has a
downstream regulatory sequence that acts negatively; however, this negative element
firnctions with a heterologous promoter (Horiuchi et al. 2003), suggesting it does not
require a particular upstream sequence, as appears to be the case for the 04400 promoter.

The (24400 regulatory region has a 5-bp element similar to that found centered at
—61 bp in the (24403 promoter region (V iswanathan and Kroos 2003). As shown in
Figure 2.3, a 4-bp mutation from —63 to —60 bp eliminated activity, as did a mutation at —
59 bp. The loss of activity is in accordance with the effect seen by mutating the 5~bp

element in the (24403 promoter region (Viswanathan and Kroos 2003). However, in the
(24400 promoter region, a single base substitution at -60 bp (the most conserved of all
five bases in the 5-bp element) from a C to an A caused a complete loss of activity (Table
2.2). In the Q4403 promoter region, the same mutation increased activity 1.8~fold
(Viswanathan and Kroos 2003). The differential effects of mutations within the 5~bp
element further support the conclusion that the 04400 promoter is regulated differently

than the (24403 promoter.

79

Additional evidence for differences between the (24400 and (24403 promoter
regions comes fiom comparison of the effects of mutations between the 5~bp elements
and C boxes centered at —49 bp, and comparison of the effects of mutations in the —35
regions. A mutation of the 5~bp sequence spanning fi'om —58 to —54 bp led to a strong
decrease in activity of the (24400 promoter (Figure 2.3). In contrast, a mutation spanning
from -58 to —54 bp led to a 1.6-fold increase in (24403 promoter activity (V iswanathan
and Kroos 2003). Whereas the region fiom at least —41 to —36 bp (and perhaps as large
as —45 to —31 bp) was shown to be essential for expression of the 94400 promoter
(Figure 2.3), a multiple bp change in the —35 region of the (24403 promoter was shown to
retain 60% activity (V iswanathan and Kroos 2003). Sequence analysis of the 94400
regulatory region revealed an imperfect inverted repeat spanning fi'om -48 to —27 bp that
could potentially be a recognition site for a dimeric DNA-binding protein that serves to
activate transcription. Classic examples of this type of regulator include the cI protein of
phage 71, which binds in a dimeric fashion to the —51 to —35 bp region upstream of the
PRM promoter (Ptashne 1992), and the CRP protein of E. coli, which binds in a dimeric
fashion to a similar region upstream of the melR and gaIPI class H promoters (Rhodius et
al. 1997).

One similarity between the 04400 and Q4403 promoter regions is that in both
cases a single bp change at —53 bp strongly decreased promoter activity (Figure 2.3)
(Viswanathan and Kroos 2003). This position was not included in the C box consensus
sequence because the nucleotide found at this position was variable in the 9 sequences

used to generate the consensus (F isseha et al. 1999). Four of the nine C box sequences

80

have been subjected to single bp changes and in each case the pattern of effects on
promoter activity is different (Figure 2.1B and Table 2.2) (Y oder). Clearly, these C
boxes are not being bound by a protein(s) in the same way. While the C box consensus
sequence has been usefirl in identifying regions important for developmental promoter
activity, the concept of a C box adhering to the initially proposed CAYYCCY consensus
(F isseha et al. 1999) or even the more degenerate (C/A)(A/C)Y(C/A)CC(T/G) consensus
proposed subsequently (Viswanathan and Kroos 2003) no longer appears usefirl.

Regulation of the (24400 promoter was also studied by measuring expression in
mutants. We found that expression of (24400 correlated with the timing and level of
ngA production in actB and actC mutants (Figure 2.5). This is consistent with the
behavior of two other partially C~signal—dependent promoters, 04414 and (24499, and
also with the absolutely C~signal-dependent Q7536 promoter (Gronewold and Kaiser
2002). We also showed that the defects in 04400 expression in the act nmtants could be
corrected by co~development with wild-type cells. This is the first demonstration of
extracellular complementation of act mutants. The results indicate that the actB and actC
genes do not affect Q4400 promoter expression in a cell-autonomous fashion. Rather,
actB and actC affect Q4400 expression by altering extracellular C~signaling. Likewise,
other defects observed for act mutants, such as blocked or reduced sporulation
(Gronewold and Kaiser 2001), may be due to altered C~signaling, and it may be possible
to rescue these defects by co~development with wild-type cells.

The (24400 promoter failed to be expressed in a sigD mutant (Figure 2.6). The

product of sigD, o”, is known to function during the transition between growth and

81

development (Ueki and Inouye 1998), though its exact role has yet to be elucidated. The
sigD mutant did not aggregate under the conditions we used, suggesting an early block in
development. Hence, it seems likely that the effects of the sigD mutation on (24400
promoter expression are indirect. However, we cannot rule out the possibility of a direct
effect, especially since our mutational analysis showed that the promoter —35 and -10
regions are essential for expression, suggesting that a (rm-family member (such as 0D)
recognizes this promoter. The 94400 promoter in a sigE mutant exhibited severely
reduced expression (Figure 2.6), though this mutant seems to aggregate normally. The
effect of the sigE mutation could indicate that OE RNA polymerase is partly responsible
for (24400 expression. 0’8 and 0C are similar in sequence to CE and functional redundancy
may exist among these 0 factors (Ueki and Inouye 2001). It is also possible that the sigE
mutation affects Q4400 expression by an indirect mechanism.

The results of this study will facilitate the identification of proteins that regulate
expression of the (24400 promoter during development. Very few developmental
transcription factors have been identified in M xanthus. They include ActB (Gronewold
and Kaiser 2001), MrpC (Sun and Shi 2001), Protein X (Horiuchi et al. 2003), and FruA
(Ogawa et al. 1996). ActB probably does not bind to the (24400 promoter region since
expression of Q4400 in an actB mutant was restored to the normal level upon co~
development with wild-type cells (Figure 2.5A). MrpC binds to two sets of inverted
repeats in the —154 to —107 bp region upstream of fruA (Ueki and Inouye 2003). The
sequences to which MrpC binds in the MA promoter region are not found in the (24400

promoter region, providing no indication that this protein binds to the (24400 regulatory
82

region. Likewise, the (24400 regulatory region does not exhibit the short sequence found
at +78 to +94 bp downstream of the fiuA transcription start site, which is bound by
Protein X (Horiuchi et al. 2003). The best candidate for a protein that binds to the region
upstream of the 94400 promoter is F ruA, a putative response regulator with no known
sensor kinase (Ogawa et al. 1996, Ellehauge et al. 1998). Expression of 04400 is

absolutely dependent on fiuA (Sagaard-Andersen), but F ruA has not yet been reported to

bind DNA. Of course, it is also possible that the transcription factors that directly

regulate the Q4400 promoter have yet to be identified.

83

Chapter 3: Mutational Analysis of the Myxococcus xanthus Q4499 Promoter Region
Reveals Shared and Unique Properties in Comparison with Other C~signal-
dependent Promoters

The work in this chapter was published in the Journal of Bacteriology, June 2004 Volume

186, Issue 12, pages 3766-76.

84

ABSTRACT

The bacterium Myxococcus xanthus undergoes multicellular development during
times of nutritional stress and uses extracellular signals to coordinate cell behavior. C-
signal affects gene expression late in development, including that of 94499, an operon
identified by insertion of Tn5 lac into the M xanthus chromosome. The (24499 promoter
region has several sequences in common with those found previously to be important for
expression of other C~signal-dependent promoters. To determine if these sequences are
important for (24499 promoter activity, the effects of mutations on expression of a
downstream reporter gene were tested in M xcmthus. Although the promoter resembles
those recognized by E. coli o“, mutational analysis implied that a (rm-type a factor likely
recognizes the promoter. A 7~bp sequence known as a C box, and a 5~bp element located
6 bp upstream of the C box, have been shown to be important for expression of other C-
signal-dependent promoters. The (24499 promoter region has C boxes centered at —33
and ~55 bp with 5~bp elements located 7 and 8 bp upstream, respectively. A multiple-
base-pair mutation in any of these sequences reduced Q4499 promoter activity more than
two-fold. Single-base-pair mutations in the C box centered at —33 bp yielded a different
pattern of effects on expression than similar mutations in other C boxes, indicating that
each firnctions somewhat differently. An element from about ~81 to ~77 bp exerted a
two-fold positive effect on expression, but did not appear to be responsible for the C~
signal dependence of the (24499 promoter. Mutations in sigD and sigE, which are genes

that encode 0 factors, reduced expression fiom the (24499 promoter. The results provide

85

firrther insight into the regulation of C~signal-dependent genes, demonstrating both

shared and unique properties among the promoter regions so far examined.

86

INTRODUCTION

Myxococcus xanthus is a gram-negative, rod-shaped bacterium that is found in
most soils. It has the ability to undergo multicellular development (Shimkets 1999,
Kaiser 2003, Kaplan 2003, Segaard-Andersen et a1. 2003), distinguishing it from most
other bacteria. Under starvation conditions on a solid surface, M xwrthus cells move in a
coordinated fashion called rippling and accumulate at foci. When approximately 105 cells
have aggregated, mound-shaped structures called fi'uiting bodies are built, inside which
some of the cells differentiate into heat- and desiccation-resistant, spherical myxospores.

The developmental process is believed to be regulated by several extracellular
signals (Shimkets 1999, Kaiser 2003, Kaplan 2003, Segaard—Andersen et al. 2003),
including the A- and C~signals, which are the best characterized. A-signaling early in
development leads to the production of extracellular proteases, peptides, and amino acids,
which are thought to provide a mechanism for cell density sensing (Kuspa et al. 1992a,
Kuspa et al. 1992b, Plamann et al. 1992, Kaplan and Plamann 1996). C- signaling is the
latest-acting of the known signals and is required for rippling, aggregation, and
sporulation (Shimkets et al. 1983, Kim and Kaiser 1991, Li et al. 1992). Signaling also
leads to changes in gene expression during development (Gill and Cull 1986, Kuspa et al.

1986, Kroos and Kaiser 1987).

Genes expressed during M xanthus development have been identified by
transposition of Tn5 lac into the chromosome (Kroos and Kaiser 1984, Kroos, 1986 #17).
Tn5 lac contains a promoterless lacZ gene whose transcription can come under the
control of a promoter outside the transposon. Among 2,374 Tn5 lac insertions, 29 were

shown to be developmentally regulated (Kroos et al. 1986), and 15 of these were shown
87

to depend on C~signaling for firll expression (Kroos and Kaiser 1987). The 15 filsions are
expressed at various times after 6 hours into development. Several were shown to

depend absolutely on C~signaling for expression (e. g., Q4403). Others, such as (24400
and 04499, were shown to depend partially on C~signaling (i.e., expression was reduced,
but not abolished in the absence of C~signaling).

To gain insight into the differential regulation of C~signal-dependent genes, the
promoter regions upstream of Tn5 lac insertions 04403 (F isseha et al. 1996), 94400
(Brandner and Kroos 1998), and (24499 (Fisseha et al. 1999) have been identified and
searched for conserved sequence elements. Mutational analysis of the (24403
(V iswanathan and Kroos 2003) and 04400 (Y oder and Kroos 2004a) promoter regions
has revealed important cis-acting DNA elements. In both promoter regions, the identical
7~bp sequence (CATCCCT), which has been called a C box (consensus sequence
CAYYCCY in which Y means pyrimidine), is centered at ~49 bp, and a 5~bp element
(consensus sequence GAACA) is centered at ~61 bp. Both the C boxes and the 5~bp
elements were found to be essential for promoter activity. However, single-base-pair
changes in these elements had different effects on promoter activity, suggesting that
different transcription factors bind to these regions. Activity of the 04403 promoter also
required a 10-bp element centered at ~74.5 bp. Activity of the (24400 promoter required
a large region fiom approximately ~63 to ~31 bp, which encompasses the 5~bp element,
the C box, and adjoining DNA. In addition, a small region fiom approximately ~86 to ~
81 bp exerted a two-fold to four-fold positive effect on expression, and was shown to be

at least partially responsible for the C~signal dependence of the (24400 promoter.

88

Tn5 lac (24499 is an insertion in the second gene of an operon that is predicted to
code for reductase and oxidase components of a cytochrome P-450 system (F isseha et al.
1999). The insertion does not cause a developmental defect, but expression of lacZ is
strongly induced during development. The timing of expression is similar to that fiom
Tn5 lac Q4400 (Kroos et al. 1986). Expression from both the (24499 and 04400
promoters was reduced in a csgA mutant (Kroos and Kaiser 1987), which fails to produce
the ngA protein involved in C~signaling (Kim and Kaiser 1990c, Lee et al. 1995b,
Lobedanz and Segaard-Andersen 2003), and expression was restored by co~developing
the csgA mutant with wild-type cells, which supplied the C~signal (Brandner and Kroos
1998, Fisseha et al. 1999). Moreover, expression from both promoters has been shown to
correlate closely with the altered levels of ngA produced in act mutants (Gronewold and
Kaiser 2002, Yoder and Kroos 2004a). Examination of the (24499 promoter region
revealed three sequences that match the C box consensus sequence, centered at ~55, ~33,
and ~l bp (F isseha et al. 1999). In addition, centered at ~65 bp, is a sequence that matches
a sequence in the 04400 promoter region in 8 of 9 positions. The sequence is centered at
~80 bp in the 04400 promoter region, and is in the opposite orientation relative to the
start site of transcription, but interestingly it includes the region shown to mediate, at
least in part, the response to C~signaling (Yoder and Kroos 2004a).

Here, we report the results of mutational analysis of the (24499 promoter region.
We found some similarities between the (24499 and (24400 promoter regions in terms of
overall organization, but the effects of single-base-pair changes were different in many

cases fiom either the (24400 (Y oder and Kroos 2004a) or (24403 (V iswanathan and

89

Kroos 2003) promoter regions, indicating that DNA elements similar in sequence

function uniquely to regulate transcription fiom the three promoters.

9O

MATERIALS AND METHODS

Bacterial strains and plasmids. Strains and plasmids that were used in this study
are listed in Table 3.1.

Growth and development. Escherichia coli DHSa strains were grown at 37 °C in
Luria-Bertani medium (Sambrook et al. 1989) containing 50 pg of ampicillin per ml. M
xanthus strains were grown at 32°C in CTT broth or agar (1.5%) plates (Hodgkin and
Kaiser 1977) (1% Casitone, 10 mM Tris-HCl [pH 8.0], 1 mM KHzPO4, 8 mM MgSO4
[final pH = 7 .6]). When necessary, 40 ug of kanamycin (Km) per ml was used for
selection. Fruiting body development was performed on TPM agar (1.5%) plates (10
mM Tris-HCl [pH 8.0], 1 mM KHzPO4~K2HPO4, 8 mM MgSO4 [final pH = 7.6]) as
described previously (Kroos et al. 1986).

Construction of plasmids. A PCR fragment containing the 524499 promoter
region from ~218 bp to +50 bp relative to the start site of transcription was generated
using pMF 0051 as the template. The PCR fragment was ligated into )fltoI-Bam ~
digested pGEM7Zf to form pDY100. Additional deletion constructs were created by
PCR using pDY100 and primers designed to produce a product with a )0201 restriction
site at the upstream end and a BamHI restriction site at the downstream end. PCR
products were then digested with X7201 and BamI-II, gel-purified, ligated into pGEM7Zf,
and the ligation products were electroporated into E. coli DHSor. Ampicillin-resistant
transformants were selected and plasmid DNA was sequenced at the Michigan State
University Genomics Technology Support Facility to confirm the sequence and end

points of the M xanthus DNA insert.

91

TABLE 3.1. Bacterial strains and plasmids used in this study

 

 

 

Strain or Relative characteristics Source or
plasmid Reference
E. coli
DH5a (1)80 lacZAMIS AlacU169 recA 1 web! I hstI 7 supE-I-I thi- (Hanahan
1 gyrA relAl 1983)
M xanthus
DK1622 Wild type (Kaiser
1979)
MDB01 attB: :pDBOl (F isseha et
al. 1999)
MDY1727 attB::pREGl727 (Yoder)
This study
MDY101 attB: :pDYlOl (pREGl727 with 268-bp XhoI-BamHI
fiagment fiom pDYIOO)‘ This study
WY103 attB: :pDY103 (pREGl727 with 121~bp XhoI-BamHI
fiagment fiom pD02) This study
MDY104 attB::pDY104 (pREGl 727 with 111-bp Mol-BamI-II
fi'agment from pDO3) This study
MDY40 attB::pDY4O (pREGl727 with 268~bp XhoI-BamHI
fiagment fi'om pDY3 9) This study
MDY42 attB: :pDY42 (pREGl727 with 268-bp Xhol-BamHI
fragment fi'om pDY41) This study
MDY44 attB: :pDY44 (pREGl 727 with 268~bp 217101-an111
fragment from pDY43) This study
MDY46 attB: :pDY46 (pREGl727 with 268-bp XhoI-BamI-II
fragment fiom pDY45) This study
MDY48 attB::pDY48 (pREGl727 with 268~bp XhoI-BamHI
fiagment fiom pDY47) This study
MDYSO attB: :pDY50 (pREGl727 with 268-bp Mol-BamHI
fragment from pDY49) This study
MDY52 attB::pDY52 (pREGl727 with 150-bp XhoI-BamHI
fiagment from pDY51) This study
MDY106 attB: :pDY106 (pREGl 727 with 268-bp )0wl-BamHI
fi'agment from pDY105) This study
MDY108 attB::pDY108 (pREGl727 with 268-bp Mol-BamI-II
fragment from pDY107) This study
MDY110 attB: :pDYl 10 (pREGl727 with 268-bp M101~anHI
fragment fi'om pDY109) This study
MDY112 attB: :pDYl 12 (pREGl 727 with 268-bp XhoI-BamHI
fiagment from pDYl 1 1) This study
MDY114 attB: :pDYl 14 (pREGl727 with 268~bp Xhol-BamHI

fragment from pDYl 13)

92

Table 3.1
MDY116

MDY118
MDY120
MDY122
MDY124
MDY126
MDY128
MDY13O
MDY132
MDY134
MDY136
MDY138
MDY140
MDY142

MDY144

DK5208

MDY5208-103
MDY5208-l34

AsigD

MDY4499. SD

AsigE

MDY4499. SE

(cont’d)

attB: :pDYl l6 (pREGl727 with 268~bp XhoI-BwnI-II
fi'agment from pDY115)

attB: :pDYl l8 (pREGl 727 with 268-bp Mol-Baml—II
fiagment fiom pDY117)

attB: :pDY120 (pREGl 727 with 268-bp final-BamI-II
fragment from pDYl 19)

attB: :pDY122 (pREGl727 with 268-bp XhoI-BamHI
fragment fiom pDY121)

attB: :pDY124 (pREGl727 with 268~bp Mid-BantHI
fi'agment fiom pDY123)

attB: :pDY126 (pREGl727 with 268~bp A7101-BamHI
fragment from pDY125)

attB: :pDY128 (pREGl727 with 268~bp )Grol-BwnI-II
fragment from pDY127)

attB: :pDY130 (pREGl727 with 268-bp )fliol-BamI-II
fragment from pDY129)

attB: :pDY132 (pREGl727 with 268-bp )fltol-BamI-II
fragment from pDY131)

attB: :pDY134 (pREGl727 with 268~bp XhoI-BamHI
fi'agment from pDYl33)

attB: :pDY136 (pREGl 727 with 268~bp XhoI-BamHI
fiagment fi'om pDY135)

attB: :pDYl 38 (pREGl 727 with 268~bp Mol-BamHI
fiagment from pDY137)

attB: :pDY140 (pREGl727 with 268-bp Xhol-BwnHI
fi'agment from pDY139)

attB: :pDY142 (pREGl727 with 268-bp XhoI-BamHI
fragment from pDYl41)

attB: :pDY144 (pREGl727 with 268-bp ”101-an111
fragment from pDY143)

csgAzzTn5-132 (Tc') £2205

csgA::Tn5-132 (Tc') £2205 attB::pDY103
csgAzzTn5-132 (Id) (2205 attB::pDY134
AsigD

attB::pDYlOl
Mel?

attB::pDYlOl

93

This study

This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
(Shimkets
and Asher
1988)
This study
This study
(Ueki and
Inouye
1998)
This study
(Ueki and
Inouye

2001)
This study

Table 3.1
Plasmids
pGEM7Zf
pREGl 7 27

pMFOOSI

pDYl 00

pD02

pDO3

pDY39
pDY4l
pDY43
pDY45

pDY47
pDY49

pDYSI

pDY105
pDY107
pDY109
pDY111
pDYl l3
pDY115
pDY117
pDY119
pDY121

pDY123
pDY125

pDY127

pDY129

(cont’d)

Apr laca
Apr Kmr P 1 -inc attP 'lacZ

pGEM7Zf with 3.2-kb PstI-BamHI fragment from pMF002

pGEM7Zf with 268-bp fragment from -218 to +50 bp of
04499 DNA generated by PCR using pMF0051 as
template, inserted as a Xhol-BamHI fiagment

pGEM7Zf with 121-bp fragment from -71 to +50 bp of
Q4499 DNA generated by PCR using pDY100 as a
template, inserted as a XhoI-BamI-II fiagment

pGEM7Zf with 111-bp fi'agment from -61 to +50 bp of
(24499 DNA generated by PCR using pDY100 as a
template, inserted as a XhoI-BamHI fiagment

pDY100 with C to A mutation at -36 bp

pDY100 with C to A mutation at -32 bp

pDY100 with C to A mutation at -31 bp

pDY100 with CATTCCT to ACGGAAG mutation from -
36 to ~30 bp

pDY100 with GAAC to TCCA mutation from ~48 to ~45
bp

pDY100 with TCATTC to GACGGA mutation fiom -59 to
-54 bp

pGEM7Zf with 150-bp fi'agment from ~100 to +50 bp of
Q4499 DNA generated by PCR using pDY100 as template,
inserted as a XhoI-BamHI fragment

pDY100 with CGA to TAT mutation fiom ~12 to -10 bp
pDY100 with T to G mutation at ~25 bp

pDY100 with T to G mutation at ~30 bp

pDY100 with T to G mutation at -33 bp

pDY100 with T to G mutation at -34 bp

pDY100 with A to C mutation at -35 bp

pDY100 with C to A mutation at -37 bp

pDY100 with T to G mutation at ~44 bp

pDY100 with CC'I'I‘C to AAGGA mutation from -53 to -
49 bp

pDY100 with TCA to GAC mutation fi'om ~59 to -57 bp
pDY100 with CCGG to AATT mutation from -63 to -60
bp

pDY100 with ACCA to CAAC mutation fi'om -67 to ~64
bp

pDY100 with GGAC to TTCA mutation from -71 to -68
bp

94

Promega
(F isseha et
al. 1996)
(F isseha et
al. 1999)
This study

This study

This study

This study
This study
This study
This study

This study
This study

This study

This study
This study
This study
This study
This study
This study
This study
This study
This study

This study
This study

This study

This study

Table 3.1 (cont’d)
pDY131 pDY100 with TCGCT to GATAG mutation from ~76 to - This study
pDY133 1:12)?)100 with GCCGC to TAATA mutation fiom ~81 to - This study
pDY135 1:17)?)100 with CATAC to ACGCA mutation fi'om -86 to - This study
pDYl37 18:12)qu with GCGTT to TATGG mutation fiom -91 to - This study
pDY139 1811151100 with AGATT to CTCGG mutation fi'om -96 to - This study
pDYl41 19112)?)100 with CGAGG to ATCTT mutation from -101 to - This study
JDY143 1317);!)100 with CCC to AAA mutation fiom -29 to -27 bp This study

 

‘ Where possible, the plasmid description is given in parentheses after the strain

description.

95

The Quikchange site-directed mutagenesis kit (Stratagene) was used to create
mutations in the 04499 promoter region that, in most cases, were AHC or THG single-
base-pair or multiple—base-pair transversion mutations. The plasmid pDY100 described
above was used as a template in PCR reactions with various combinations of mutagenic
primers. The M xanthus DNA insert was sequenced to ensure only the proper mutations
had been created.

Each mutant derivative of pDY100 was digested with )0101 and BamHI, gel-
purified and ligated into pREGl727 previously cut with the same enzymes. The ligated
constructs were introduced into E. coli DHScr by electroporation and ampicillin-resistant
transformants selected. A transformant containing the mutant Q4499 plasmid was
identified using colony PCR with primers to ensure proper orientation. The
transformants containing the mutated Q4499 promoter regions were then used to prepare
plasmid DNA for introduction into M xcmthus.

Construction of M. xanthus strains and determination of lacZ expression
during development. Strains containing pREGl727 derivatives integrated at the Mx8
phage attachment site (designated attB in Table 3.1) were constructed by electroporation
(Kashefi and Hartzell 1995) of M xanthus and transformants were selected on CTT-Km
plates. Based on previous experience in our laboratory (F isseha et al. 1996, Brandner,
1998 #393, Fisseha, 1999 #412), the majority of transformants have a single copy of the
plasmid integrated at attB. To eliminate colonies with unusual developmental lacZ
expression, we screened at least 10 transformants on TPM agar plates containing 40 1.1g of
5-bromo~4~chloro-3-indolyl-B-D~galactopyranoside (X-Gal) per ml. Any colonies with

unusual expression of lacZ were discarded and of the remaining candidates, three
96

independent isolates of each mutant construct were chosen for development. In all cases,
the three transformants gave similar results (Table 3.2) when developmental B-

galactosidase activity was measured as described previously (Kroos et al. 1986).

97

ll

RESULTS

Deletion analysis of the (24499 promoter region. Previous analysis of the
Q4499 regulatory region showed that a segment containing fiom ~218 bp to +2.68 kbp
relative to the start site of transcription, fused to the E. coli lacZ gene and integrated at
the Mx8 phage attachment site in the M xanthus chromosome, showed a similar pattern
of developmental lacZ expression as the M xanthus strain, DK4299, which contains Tn5
lac Q4499 (Fisseha et al. 1999). A 5’ deletion to ~49 bp with the same 3’ end resulted in
a dramatic decrease in expression. To further define the minimal region required for
(24499 promoter activity, a DNA fiagment spanning fiom ~218 to +50 bp of the (24499
promoter region was generated by PCR, fused to lacZ, and tested for developmental
expression (see Material and Methods). Figure 3.1A shows that the segment fi'om ~218
to +50 bp directed a similar level of B-galactosidase production during development as
the segment from ~218 bp to +2.68 kbp. This demonstrates that the region between +50
bp and +2.68 kbp is not essential for 94499 promoter activity.

To further characterize the upstream boundary of the 04499 regulatory region, 5’
deletions were made to ~100, ~71, and ~61 bp in the context of a 3’ end at +50 bp. The
segment fi'om ~100 to +50 bp showed comparable developmental expression as the
segment from ~218 to +50 bp (Figure 3.1A), indicating that DNA between ~218 and ~
100 bp is not necessary for 04499 promoter activity. The deletion to ~71 bp led to a
60% decrease in activity compared to the ~218 to +50 bp promoter region (Figure 3.13
and Table 3.2), indicating that DNA between —100 and ~71 bp is important for Q4499

activity. Furthermore, the 5’ deletion to ~61 bp retained only 4% of wild-type promoter

98

TABLE 3.2. Summary of activities of mutant Q4499 promoters

 

Avg maximum values for % Wild-type activity
B-galactosidase sp act measured in the same exptb
during development8

Promoter assayed

 

Vector (no insert) 11 1 4
Wlld-type Q4499 promoter 39 1 18
Deletions:
-101 to +50 bp 51110 141110
-71to+50bp 2515 41115
-61to+50bp 1312 416
Mutations°2
CGA-1210 -10 TAT 161110 877158
T-ZSG 2815 49115
CCC -29 to -27 AAA 45 1 6 178 1 30
CATTCCT ~36 to~30 1211 1214
ACGGAAG
T -30 G 27110 46 1 28
C~31A 3116 53119
C-32A 2916. 59121
T -33 G 7 1 0.6 0
T -34 G 7 t 2 0
A-35C 1712 61110
C -36 A 55 1 9 134 1 26
C -37 A 11 1 2 0
T -44 G 17 1 3 63 1 15
GAAC-481045TCCA 1914 18113
CCTl'C -53 to ~49 AAGGA 10 1 1 0
TCATTC ~59 to -54 GACGGA 12 1 2 10 1 6
TCA -59 to ~57 GAC 9 1 1 0
CCGG-63to-60AA1‘I' 712 516
ACCA ~67 to ~64 CAAC 10 1 0.8 0
GGAC-71 to ~68 TI'CA 7 1 2 0
TCGCT-76 to ~72 GATAG 36 1 4 170 1 23
GCCGC -81 to ~77 TAATA 19 1 1 45 1 6
CATAC-86 to ~82 ACGCA 44 1 8 214 1 45
GCGTT -91 to ~87 TATGG 41 1 14 155 1 72
AGATT ~96 to ~92 CTCGG 48 1 7 235 1 40
CGAGG-101 to -97 ATCTT 30 1 3 99 1 15

 

99

Table 3.2 (cont’d)
’ The maximum B-galactosidase specific activity in nanomoles of o-nitrophenyl phosphate per minute per

milligram of protein (average plus or minus 1 standard deviation) is listed for three independently isolate
M xanthus transformants (one determination each) in the case of mutant promoter regions and for one
isolate in the case of the wild-type promoter (16 determinations) and vector controls (11 determinations).

Samples were assayed at 0, 6, 12, 18, 24, 30, 36, and 48 hours during development.

b The wild-type promoter and vector-only strains were included in each experiment. The maximum for

eachmutantpromoterregionisexpressedasapercentageofthemardmumobmrvedforthewild-type
pmmotermmesameexpefimentafierwbnacfimfiombmhvaluesmenmdmumobscwed forvectoronly
inthatexperiment. Theaveragepercentageplusorminus l standmddeviationislisted. Azeroindicates
that the expression from the mutant promoter region was equal to or less than that observe for the vector

only control.

c For example, mutant CGA -12 to ~10 ATC has mutation changing CGA at positions -12 to -10 to ATC,

andmutantT-ZSGhasmutationchangingTatposition-ZStoG.

100

Figure 3.1. Deletion analysis of the (24499 promoter region. A) Developmental lacZ
expression was determined for M xanthus strains bearing integrated plasmids with
(24499 DNA fiom ~218 bp to +2.68 kbp (O), ~218 to +50 bp (A), or ~100 to +50 bp
(I), along with a vector, no insert control (0). B) The 5’deletion constructs contained
Q4499 DNA from ~71 to +50 bp (A) or ~61 to +50 bp (0). Constructs containing ~100
to +50 bp (I) or no insert (0) were included as controls. The data for the ~100 to +50 bp
construct is the same in both panels and represents six independent determinations made
in three separate experiments. The average B-galactosidase activity is expressed as
nanomoles of o-nitrophenyl phosphate per minute per milligram of protein. Error bars

show 1 standard deviation of the data.

101

 

 

fl,
.4- -
. _ . . _ . y,- .
m fl 5 w m m w 0
A aspen canoe 85382542

 

31342 48

Time (hr)

18 24

6 12

 

 

 

 

1

u q
0 0 0 0 0 0 0 0
7 5 5 4 3 2 .1.

B 5538 058% 3380254“

 

33 42 48

18 24 30

8 12

Time (hr)

102

activity (Figure 3.1B and Table 3.2), so DNA between ~71 and ~61 bp is essential for
expression of the (24499 promoter.

Effects of mutations in the ~25 to ~10 bp region of the (24499 promoter. The
product of the rpoN gene, (:54 (Keseler and Kaiser 1997), is believed to recognize several
promoters in M xanthus, including those for mber (Romeo and Zusman 1991), sdeK
(Garza et al. 1998), pilA (55), spi (Gulati et al. 1995, Keseler and Kaiser 1995), actABCD
(Gronewold and Kaiser 2001), and ang and orfl (Garza et al. 2000a). An alignment of
these promoter regions with the consensus sequence found in E. coli 054~dependent
promoters (Thony and Hennecke 1989) is shown in Figure 3 2A The 04499 promoter
matches the consensus sequence at 4 of 7 positions in the ~24 region and at 3 of 5
positions in the ~12 region (Figure 3.2A), suggesting that the 04499 promoter may be
recognized by 0“ RNA polymerase. To test this hypothesis, two mutations were created
in the context of the (24499 promoter region fi'om ~218 to +50 bp. One mutation was a T
to G transversion at position ~25 bp, which creates a better match to the E coli <354
consensus sequence (Thony and Hennecke 1989) in the ~24 region. This mutation
decreased Q4499 promoter activity by 50% (Figure 3.2B and Table 3.2). In contrast, a
mutation of CGA to TAT at ~12 to ~10 bp, which changes the highly conserved C in the
~12 region to T and creates a perfect match in the ~10 region to the consensus sequence
recognized by E. coli (:70 (TATAAT) (Lisser and Margalit 1993), resulted in a dramatic
increase in promoter activity (Figure 3.2B and Table 3.2). These results suggest that a a

factor in the 070 family, rather than o”, recognizes the (24499 promoter.

103

Figure 3.2. A) Comparison of the 04499 promoter region to promoters of M xanthus
genes believed to be transcribed by 0’54 RNA polymerase (see text for references). Also
shown is the consensus sequence to which E. coli 054 binds (Thony and Hennecke 1989).
The numbers to the left indicate the location within the promoter relative to the start site
of transcription. The bold nucleotides indicate those that match the consensus sequence
and the underlined nucleotides match those most highly conserved in the consensus
sequence. B) Mutational analysis of the -25 to -10 bp region of the Q4499 promoter.
Developmental lacZ expression was determined for M xrmthus strains bearing integrated
plasmids with a mutation of ~12 to ~10 bp from CGA to TAT (O) or a mutation at ~25
bp fiom T to G (A). The 04499 wild-type promoter region fiom -218 to +50 bp (I)
(four determinations in two experiments) and the vector with no promoter insert (0) were
included as controls. The meaning of points and error bars is the same as in the Figure

3.1 legend.

104

~29 ngcACAACCArgggT
~24 TCQCGGAGTCCGGQQA
-28 CEQTGCACAAGGGEQT
—26 CEQCGCTCTCAGCQEG
—28 GAgcACGCGTcrgggT
-27 IggcACGCCATcgggT
~29 TQQCATGCGTAGEQQT
~26 Grgccccrcccagggc

ngxRxR.N4 mecca

200 -
180 a
160
140
120
100

 

B-galactosidase specific activity

actABCD
(Ni?
ang'
sdéK'
spi
rnbhA
pflA
£24499

054 consensus

 

o ‘ ".1- l +WT“._ 'T‘m“ T _l_%_“l

06121824303642“

'Thne(hr)

105

Effects of mutations in the C box centered at ~33 bp and adjacent regions.

The (24499 promoter region contains 3 sequences that match the C box consensus
sequence (F isseha et al. 1999). Among these, the one centered at ~33 bp is 7 bp
downstream of a 5-bp sequence (GAACT) that matches the 5-bp element consensus
sequence (GAACA) in 4 of 5 positions (Viswanathan and Kroos 2003 ). To determine if
this C box functions in the same way as any of the C boxes mutated previously, eight
mutations were made; a 7~bp change of the entire C box, and 7 single-base-pair changes
within the C box. These and all subsequent mutations reported here were made in the
context of (24499 DNA from ~218 to +50 bp.

The 7-bp change of the entire C box caused a loss of promoter activity, as did
single-base—pair mutations at ~34 and ~33 bp (Table 3.2). Single bp mutations at ~35, ~
32, -31, and -30 led to intermediate activity, and the mutation at -36 bp caused a slight
increase in expression (Figure 3.3A and Table 3.2).

The pattern of mutational effects observed was different than for any of the C
boxes examined previously. Figure 3 .3B compares the effects of single-base-pair
mutations in the C box centered at ~33 bp in the 04499 promoter with the effects of

mutations in the C boxes centered at ~49 bp in the 04400 (Y oder and Kroos 2004a) and
04403 (Vrswanathan and Kroos 2003) promoter regions. These C boxes have the
sequence C ATCCCT, which differs fiom the CATTCCT sequence centered at ~33 bp in
the 04499 promoter only at position 4. Except at this position, the single-base—pair
changes compared in Figure 3.3B are the same. Striking differences between the effects
of mutations at positions 1, 4, 5, and 7, on 94400 and 04403 promoter activity, indicate

that the C boxes centered at ~49 bp firnction differently. The effects of mutations in the
106

Figure 3.3. Mutational analysis of the C box centered at ~33 bp in the 04499 promoter.
A) Developmental lacZ expression was measured for M xanthus strains with a T to G
change at ~30 bp (A) or a C to A change at ~36 bp (9). The wild-type promoter region
from -218 to +50 bp (I) (seven determinations in three experiments) and the vector with
no insert (0) were included as controls. The meaning of points and error bars is the same
as in the Figure 3.1 legend. B) Comparison of the effects of single-base—pair mutations in
three different C boxes. The x-axis represents the position in the C box corresponding to
the consensus sequence 5’ CAYYCCY 3’ with the A being position 2, etc. The bars
represent the average maximum developmental lacZ activity expressed as a percentage of
the wild-type promoter activity for the C boxes centered at ~49 bp in the (24400 (black)
(Yoder and Kroos 2004a) and 04403 (gray) (Viswanathan and Kroos 2003) promoter
regions, or centered at ~33 bp in the Q4499 promoter region (white) (Table 3.2). Error

bars show 1 standard deviation of the data.

107

 

 

 

 

40-
304
20-
10-
0+

2 a _
o o o
7 6 5

@551 958% $15 mega—ewé

0 6 12182430364248

Time (hr)

 

 

 

olmmemmmmmm
umfimfimfiws
~55an$

B 23552... 558% emacmaewoa—awin

1

Position Within the C box

108

C box centered at —33 bp in the 04499 promoter differ markedly from those in the
04400 C box at positions 1, 3, 6, and 7, and fi'om those in the (24403 C box at positions
3, 5, and 6 (at position 4, a C to A change increases activity of the 04403 promoter, as
indicated in Figure 3.3B, but a C to G change abolishes activity (V iswanathan and Kroos
2003), as does a T to G change in the (24499 promoter). A C box centered at —80 bp in
the Q4400 promoter has also been subjected to mutational analysis (Yoder and Kroos
2004a). Single-base-pair changes had less than a two-fold effect on expression. We
conclude that the 94499 C box centered at —33 bp fimctions differently than the other
three C boxes that have been examined.

Two mutations were made in regions adjacent to the C box centered at —33 bp in
the 04499 promoter. A C to A change at —37 bp led to a complete loss of promoter
activity while a CCC to AAA mutation from -29 to —27 bp increased activity nearly two-
fold (Figure 3.4 and Table 3.2).

Effects of mutations in the S-bp element. The (24499 promoter region has a 5-
bp element centered at —46 hp with the sequence GAACT, which matches the GAACA
consensus sequence at 4 out of 5 positions (Viswanathan and Kroos 2003). To determine
if this S-bp element is essential for expression, as are the S-bp elements centered at —61
bp in the Q4400 (Yoder and Kroos 20043) and (24403 (Viswanathan and Kroos 2003)
promoters, two mutations were made. A 4-bp mutation, which converted GAAC at -48
to —45 bp to TCCA, resulted in a strong decrease (80%) in activity, demonstrating that
this element is important for (24499 promoter expression (Figure 3.4 and Table 3.2). A

single-base-pair change from T to G at —44 bp retained 60% activity compared to the

109

Figure 3.4. Summary of the effects of mutations in the (24499 promoter region. DNA
subjected to mutagenesis is alternately underlined and boxed. Upward and downward
arrows indicate that developmental lacZ expression was increased or decreased,
respectively, by the given change in DNA sequence, and numbers indicate the maximum
B-galactosidase specific activity observed for the mutant, expressed as a percentage of

wild-type promoter activity measured in the same experiment (Table 3.2).

110

240

 

 

CTCGG 214
4‘ ACGCA
170
155
TATGG GATAG
"i° '1' “‘l'
-101 . Wm-n
ATCTT
99
TAATA
45 GACGGA
TI'CA CAAC AATT 10
0 0 5
877
TAT
178
AM
46 ails T -2ls

|
-53 ccrrc- gamma lecsccrccnc @340

H; l l.

TCCA ACGGAAG 49
“gm 28 3 12

111

wild-type promoter (Figure 3.4 and Table 3.2). This result is surprising because
mutations at the corresponding position of the S-bp elements centered at —61 bp in both
the (24400 (Yoder and Kroos 2004a) and 04403 (V iswanathan and Kroos 2003)
promoter regions caused nearly complete loss of promoter activity. It appears that the 5-
bp element, like the C box, functions somewhat differently in the (24499 promoter region
than in the Q4400 and (24403 promoter regions.

Effects of mutations between ~71 and —49 hp. Six mutations were made to
investigate the role of DNA upstream of the S-bp element centered at -46 bp, which our
deletion analysis had indicated includes an element between —7 1 and —61 bp that is
essential for (24499 promoter activity (Figure 3.1B and Table 3.2). Five of these
mutations are shown in Figure 3.4. The sixth was a TCA to GAC mutation from —59 to
—57 bp. All six mutations caused a dramatic decrease or loss of 04499 promoter activity.
These results show that the entire region fiom approximately -70 bp to the S-bp element
centered at -46 bp is required for expression from the (24499 promoter.

Effects of mutations between —101 and —72 bp. The region between —101 and
—72 bp was divided into S-bp sections that were mutated to attempt to define the
element(s) that led to a 60% decrease in activity upon 5’ deletion to —7 1 bp (Figure 3.1B
and Table 3.2). Only one of the six mutations decreased Q4499 promoter activity;
changing GCCGC to TAATA from —81 to —77 bp lowered activity by 55% (Figure 3.4
and Table 3.2), which is very similar to the decrease observed upon 5’ deletion to —7 1 bp.
This shows that a small region approximately 29 bp upstream of the 5—bp element exerts

a two-fold positive effect on expression from the (24499 promoter.

112

C-signal dependence of the 04499 promoter. The 04499 promoter is partially
dependent on C-signaling for expression (Kroos and Kaiser 1987, Fisseha et al. 1999). In
a csgA mutant defective in C~signaling, a two-fold decrease in 04499 promoter activity
has been observed. The loss in activity can be restored upon co~deve10pment with wild-
type cells, which provide C-signal. Since a 5' deletion to -71 bp resulted in about a two-
fold loss in expression (Figure 3. IB and Table 3.2), we hypothesized that DNA upstream
of -7 1 bp might be responsible for the partial C-signal dependence of the Q4499
promoter, especially since DNA from -86 to —81 bp was shown previously to mediate, at
least in part, the partial C-signal dependence of the 04400 promoter (Y oder and Kroos
2004a). We transformed pDY103 containing the (24499 promoter region from -71 to +50
bp, into csgA mutant M. xanthus DK5208, and measured developmental lacZ expression
(Figure 3.5). B-galactosidase specific activity was lower in the csgA mutant than in the
wild-type background, indicating that the 5'-deleted promoter region remains dependent
on csgA. Addition of wild-type cells to the csgA mutant restored lacZ expression during
development. This demonstrates that the promoter region remains responsive to
extracellular C-signal despite the absence of DNA beyond -71 bp upstream. Similar
results were observed for pDY134, which contains the GCCGC to TAATA mutation
from -81 to -77 bp in the context of the (24499 promoter region from -218 to +50 bp (data
not shown). Although this mutation causes a two-fold decrease in expression in a wild-
type background (Figure 3.4 and Table 3.2), the mutant promoter region remains
dependent on csgA and responsive to extracellular C-signal. We conclude that DNA

upstream of -71 bp is not responsible for the partial C-signal dependence of the Q4499

113

Figure 3.5. C-signal dependence of a 5'—deleted Q4499 promoter region. Developmental
lacZ expression of pDY103 integrated at attB of wild-type DK1622 (O) or csgA mutant
DK5208 in the absence (A) or presence (A) of an equal number of wild-type DK1622
cells (lacking lacZ but capable of C-signaling). The meaning of points and error bars is

the same as in the Figure 3.1 legend.

114

 

 

 

 

‘ l

     
   
  

4., ..
z.
4”
a.

/. .

_____. 1
wamxmsoso
11

@3qu 050on omeEmoaoflswfi

 

 

l

 

 

 

18 24 30 33
Time (hr)

12

115

promoter.

Effects of sigD and sigE mutations. Our mutational analysis suggests that the
(24499 promoter is recognized by a 0' factor in the 670 family, rather than by 654. 0"
RNA polymerase, the major form in growing cells (Biran and Kroos 1997), was unable to
produce transcripts from the (24499 promoter in vitro (F isseha et al. 1999). Also, a null
mutation in sigB (encoding GB) or sigC (encoding cc) had no effect on 04499 expression
(Brandner and Kroos 1998). We tested the effect of a null mutation in sigD (U eki and
Inouye 1998) or sigE (U eki and Inouye 2001) on expression from the wild-type Q4499
promoter region (-218 to +50 bp). Both mutations led to decreased expression from the

(24499 promoter, at about 30% the wild-type level (Figure 3.6). These results

demonstrate that a” and 0E directly or indirectly effect activity of the 04499 promoter.

116

Figure 3.6. Effects of sigD and sigE mutations on expression from the (24499 promoter.
Developmental B-galactosidase activity was determined for the wild-type Q4499
promoter region from -218 to +50 bp fiised to [col and integrated into the chromosome
of M. xanthus sigD (O), sigE (A), or wild-type DK1622 strains (I). The vector with no
insert (0) served as a negative control. The meaning of points and error bars is the same

as in the Figure 3.1 legend.

117

 

 

12 18 24 30 36 42 48

 

 

0 6

 

_ _ T

0 0 0 0 0 0
5 4 3 2 l

5333 9592—» omeEmewoSewun

—‘

Time (hr)

118

DISCUSSION

Our characterization of the cis-elements required for activity of the 04499
promoter provides further insight into C-signal—dependent gene regulation during M.
xanthus development, especially when compared with previous mutational analyses of
other promoter regions that depend on C—signaling for expression (V iswanathan and
Kroos 2003, Yoder and Kroos 2004a). The other C-signal-dependent promoters
examined so far do not resemble those thought to be recognized by a“ RNA polymerase
of M. xanthus. Our mutational analysis suggests that the 04499 promoter is not
recognized by a“ RNA polymerase either. The overall organization of the 04499
promoter region is much like that of the (24400 promoter region (Y oder and Kroos
2004a). Both include a large region spanning from about --30 to -60 or -70 hp with many
sequence elements essential for promoter activity. Both also have a short (5-6 bp) region
farther upstream (near -81 bp) that exerts a two-fold positive effect on expression. Also,
expression from both is reduced comparably in a sigE mutant. However, our results also
reveal unique properties of (24499 promoter regulation. The effects of mutations in the C
boxes are different than has been observed for other C-signal-dependent promoter
regions. The short region near -81 bp does not appear to be necessary for C-signal
dependence of the (24499 promoter, as it is for the 94400 promoter. Also, whereas a
sigD mutation eliminates expression from the (24400 promoter, it does not completely
abolish Q4499 expression. We conclude that regulation of the 04499 operon exhibits
both shared and unique properties in comparison with regulation of other C-signal-

dependent genes.
1 19

Despite a resemblance between the 94499 promoter and M. xanthus promoters
that are thought to be recognized by a“ RNA polymerase, our mutational analysis did
not support the idea that 0’“ RNA polymerase is responsible for transcription form the
(24499 promoter. In the alignment shown in Figure 3.2A, none of the putative 6“-
dependent promoters have a T at the position corresponding to the T at -25 bp in the
Q4499 promoter. Five out of seven have a G at that position, as does the E. coli 054
consensus sequence (Thony and Hennecke 1989). A mutation from T to G at -25 bp was
expected to increase, or possibly not change, activity of the Q4499 promoter, if it is
recognized by a” RNA polymerase. However, the mutation led to a two-fold loss in
activity (Figure 3.2B and Table 3.2). Conversely, mutating the perfectly conserved C at -
12 bp in the (24499 promoter was expected to decrease activity. Instead, changing CGA
to TAT at -12 to -10 bp led to an eight-fold increase in activity (Figure 3.23 and Table
3.2). Taken together, the two results suggest that the 04499 promoter is not recognized
by a“ RNA polymerase. These findings call into question whether all of the promoters
shown in Figure 3 .2A really are 654-dependent promoters. Only the .goi promoter has
been subjected to detailed mutational analysis, and the results support the idea that this
promoter is recognized by a“ RNA polymerase (Keseler and Kaiser 1995).

Why did the CGA to TAT change at -12 to --10 bp increase activity of the Q4499
promoter? The change creates a perfect match in the -10 region of the mutant promoter
to the consensus sequence recognized by E. coli 070 RNA polymerase (Lisser and
Margalit 1993). Therefore, the high activity of the mutant promoter could reflect better

recognition and/or initiation by RNA polymerase with a 0 factor in the 670 family. Its is
120

noteworthy that the mutant promoter was no more active during growth than the wild-
type promoter (Figure 3.28). Also, the time of maximum lacZ expression from the
mutant promoter was similar to that for the wild-type promoter (Figure 3 .2B). Whether
the mutant promoter is transcribed by RNA polymerase(s) with the same a factor(s) as
the wild-type Q4499 promoter remains an open question.

The (24400 and (24403 promoters, which are the only other C-signal-dependent
promoters so far characterized, do not resemble a“ promoters (F isseha et al. 1996,
Brandner and Kroos 1998). Neither of these promoters (D. Biran and L. Kroos,
unpublished data) nor the 04499 promoter (F isseha et al. 1999) directed transcription by
M. xanthus 0A RNA polymerase in vitro. 0'" RNA polymerase is the major form of RNA
polymerase in growing M. xanthus cells (Biran and Kroos 1997). It was able to
transcribe from the 94514 promoter in vitro, but this developmentally regulated promoter
does not depend on C-signaling for expression and its --35 region matches perfectly the
consensus sequence (TTGACA) recognized by E. coli 070 RNA polymerase (Hao et al.
2002). In contrast, the -35 regions of the three C-signal-dependent promoters do not
match this consensus sequence (F isseha et al. 1996, Brandner and Kroos 1998, Fisseha et
al. 1999). One or more transcription factors bound to upstream DNA elements in the C-
signal-dependent promoter regions might enable 0" RNA polymerase to transcribe from
these promoters, or a different a factor might be involved.

In addition to 0‘“, six other 6 factors in the 670 family have been described in M.
xanthus (Apelian and Inouye 1990, Apelian and Inouye 1993, Browning et al. 1997, Ueki

and Inouye 1998, Ward et a]. 1998, Ueki and Inouye 2001). Among these, OB and 0C do
121

not appear to be responsible for transcription of (24499, 04400, or 04403, since sigB and

sigC mutants exhibited normal expression of lacZ reporters fused to these genes

(Brandner and Kroos 1998). On the other hand, sigD and sigE mutants showed reduced
expression from the 04499 promoter (Fig 3.6). Since mutations in sigD block
aggregation (Ueki and Inouye 1998), the effect on 04499 expression might be indirect.
Interestingly, in the sigD mutant, the (24499 promoter retained 30% as much activity as
in wild type (Figure 3.6), whereas the 04400 promoter retained no activity (Yoder and
Kroos 2004a). Apparently, one or more transcription factors essential for 04400
promoter activity is missing, or its level is insufficient in the sigD mutant, but this does
not prevent a low level of transcription from the (24499 promoter. Unlike the sigD
mutant, the sigE mutant appears to aggregate normally (U eki and Inouye 2001). Yet,
Q4499 expression was reduced in the sigE mutant to a similar extent as in the sigD
mutant (Figure 3 .6). The reduction in (24499 expression in the sigE mutant is
comparable to that seen previously for expression from the (24400 promoter (Y oder and
Kroos 2004a). This may imply that GE RNA polymerase is partially responsible for
transcription from the (24499 and Q4400 promoters. The proposed firnctional
redundancy of GE with the highly similar on and ac (Ueki and Inouye 2001) may account
for the residual transcription observed in the sigE mutant (Figure 3.6). Alternatively, the
effect of the sigE mutation on (24499 expression may be indirect.

The (24499 promoter region is unique among C-signal-dependent promoters

examined thus far in terms of the positions of C boxes and S-bp elements. It has C boxes

122

centered at -33 and -55 bp (F isseha et al. 1999) with S-bp elements located 7 and 8 bp
upstream, respectively (Viswanathan and Kroos 2003). There is also a C box centered at
-1 bp (F isseha et al. 1999), but there is no apparent 5-bp element 5 to 10 bp upstream, and
we did not test the effects of mutations in this C box. The 94400 and 04403 promoter
regions have the identical C box (CATCCCT) centered at -49 bp (F isseha et al. 1996,
Brandner and Kroos 1998) and in each case a 5-bp element is located 6 bp upstream,
centered at -61 bp (Viswanathan and Kroos 2003). Also, the Q4400 promoter region has
a C box centered at -80 bp, which is in the opposite orientation as the one centered at -49
bp (Fisseha et al. 1999), and has no apparent 5-bp element located 5 to 10 bp away in the
5' direction.

We chose to perform detailed mutational analysis of the C box centered at -33 bp
in the Q4499 promoter region because it matches the C boxes centered at -49 bp in the
(24400 and (14403 promoter regions more closely (6 out of 7 positions) than does the C
box centered at -55 bp (5 out of 7 positions), and because its distance from the S-bp
element was more similar to that in the (24400 and (24403 promoter regions (7 bp versus
6 bp) than for the C box centered at -55 bp (8 bp versus 6 bp). However, we found that
single-base-pair changes in the Q4499 C box centered at -33 bp had a very different
pattern of effects on lacZ expression than did changes in the 04400 or (24403 C box
centered at -49 bp (Figure 3.33), or the (24400 C box centered at -80 bp (Viswanathan
and Kroos 2003, Yoder and Kroos 2004a). Each C box appears to firnction somewhat
difi‘erently. Conceivably, the (24499 C box centered at -55 bp might behave in a more

similar fashion to one of the other C boxes, but that would be a break from the results

123

observed so far, and it remains to be tested.

In keeping with the observation of different effects of mutations in similar
sequences, each 5-bp element examined so far behaves differently with respect to single-
base-pair changes, although the mutational analysis is much less complete than for C
boxes. In this study, a T to G change at -44 bp had relatively little efl'ect on 04499
promoter activity (Figure 3.4 and Table 3.2) in comparison to changes at the
corresponding position (-59 bp) of the 5-bp elements centered at -61 bp in the (24400 and
04403 promoter regions (V iswanathan and Kroos 2003, Yoder and Kroos 2004a). In
prior studies, the effects of changing C to A at -60 bp in the (24400 and (24403 promoter
regions were shown to be very different (V iswanathan and Kroos 2003, Yoder and Kroos
2004a).

Given that different effects of mutations in similar sequences is observed for both
the 5~bp elements and the C boxes, and given the similar distance between these cis-
acting DNA elements in all three C-signal dependent promoters examined so far, we
propose that a S-bp element and a C box together constitute a recognition site for a
transcription factor, and that different transcription factors bind to these recognition sites
in the (24499, 04400, and 04403 promoter regions.

The DNA between the C box and the S-bp element may be part of a transcription
factor recognition site in some cases, but not others. Changing CCGG to AATT between
the C box centered at -55 bp in the 04499 promoter region and the S-bp element that lies
8 bp upstream nearly abolished expression (Figure 3.4 and Table 3.2). Likewise,
changing the C at -37 bp, which is the first base pair upstream of the 04499 C box

124

centered at -33 bp, abolished promoter activity (Figure 3.4 and Table 3.2). A single—base-
pair change at the position immediately upstream of the C box centered at -49 bp in the
(24400 or (24403 promoter region also greatly reduced expression, as did a change from
GTCCC to TGAAA between the 04400 C box centered at -49 bp and the S-bp element
centered at -61 bp (Viswanathan and Kroos 2003, Yoder and Kroos 2004a). On the other
hand, changing CCGTC to AATGA at the corresponding position in the (24403 promoter
region caused a 1.5-fold increase in expression, and deleting the CCGTC segment
abolished promoter activity (V iswanathan and Kroos 2003), suggesting that the segment
is an essential spacer between the C box and the S-bp element, but may not be part of a
recognition site for a sequence-specific DNA-binding protein.

If our hypothesis that a 5-bp element and a C box (and in some cases the DNA in
between) together constitute a recognition site for a transcription factor is correct, it is
intriguing that the 04499 promoter regions has two such sites in tandem. The more
upstream site is located upstream of the region typically occupied by RNA polymerase,
while the downstream site overlaps the promoter -35 region. Hence, the upstream and
downstream sites are located at positions occupied by the E. coli catabolite activator
protein (CAP) in class I and class II CAP-dependent promoters (Busby and Ebright
1999). The basic features of transcription activation at class I and class II CAP-
dependent promoters are understood and appear to be generalizable to other activators.
Perhaps one or more transcription factors bind to the putative two sites in the 04499
promoter region and activate transcription by contacting RNA polymerase, facilitating

formation of closed and open RNA polymerase-promoter complexes, as does CAP.

125

According to this model, the C boxes centered at -49 bp and 5-bp elements centered at -
61 bp in the (24400 and 04403 promoter regions would each constitute a single site
located at a position analogous to that occupied by CAP in class I CAP-dependent
promoters. Based on the different effects of mutations in these putative transcription
factor recognition sites (Figure 3.33), we speculate that a family of sequence-specific
DNA-binding proteins might interact in different ways with similar sequences in the three
C~signal-dependent promoter regions. Alternatively, a single protein might bind
differently to the putative recognition sites by adopting different conformations, possibly
due to different states of post-translational modification, interactions with other proteins,
and/or the influence of DNA adjacent to the putative recognition sites.

The 04499 promoter region shares with (24400 and (24403 promoter regions the
requirement for DNA farther upstream, beyond the S-bp elements, for firll promoter
activity. In each case, these DNA elements are separated from the S-bp elements by 5 to
17 bp of DNA in which transversion mutations have little effect on promoter activity
(Figure 3.4 and Table 3.2 (Viswanathan and Kroos 2003, Yoder and Kroos 2004a). Both
the Q4499 and Q4400 promoter regions contain a small element near -81 bp that exerts a
two-fold to four-fold positive effect on expression. The boundaries of these elements are
not well-defined. In the (24499 promoter region, the element is defined by a mutation
that changes GCCGC to TAATA at -81 to -77 bp, resulting in a two-fold decrease in
promoter activity (Figure 3.4 and Table 3.2). In the 94400 promoter region, mutations
that change GTC to TGA at -86 to -84 bp, and G to T at -81 bp, result in a four-fold and a

two-fold decrease in activity, respectively, defining an element with the sequence

126

GTCGGG (Y oder and Kroos 2004a). This sequence is not strikingly similar to the
GCCGC sequence in the 94499 promoter region. Both are GC-rich, but such sequences
are common in the M. xcmthus genome with its high (near 70%) G+C content. In the
Q4403 promoter region, the sequence GGCATGTTCA from -79 to -70 bp has been
called a lO-bp element (Viswanathan and Kroos 2003). Single-basepair transversions at
any position in this element decrease expression more than two-fold, and many abolish
expression completely.

The element fiom -86 to -81 bp in the (24400 promoter region was shown to be
responsible, at least in part, for the partial dependence of the promoter on C~signaling
(Y oder and Kroos 2004a). It was attractive to think that the element from -81 to -77 bp
in the (24499 promoter region might play the same role, since activity of this promoter
also depends partially on C-signaling (Kroos and Kaiser 1987, Fisseha et al. 1999).
However, this does not appear to be the case. A segment lacking Q4499 DNA upstream
of —7 1 bp was still C-signal-dependent (Figure 3.5). Another candidate sequence to
mediate C-signal dependence of the 04499 promoter was a 9-bp sequence centered at —65
bp, which matches a 9-bp sequence centered at -80 bp in the (24400 promoter region
(Fisseha et al. 1999). However, transversion mutations at -80 to -76 bp had little effect
on (24400 promoter activity (Y oder and Kroos 2004a) and, in contrast, mutations at -67
to -60 bp nearly abolished Q4499 promoter activity (Figure 3.4 and Table 3.2), so despite
their similarity, the 9-bp sequences firnction differently.

Further studies of the Q4499 promoter region will aim to identify and characterize

the tram-acting factors that bind to the important cis-acting DNA elements defined by
127

our mutational analysis. There do not appear to be binding sites in the (24499 promoter
for an NtrC-like activator (Reitzer and Magasanik 1986) such as ActB (Gronewold and
Kaiser 2001), or for the CAP-like activator MrpC (U eki and Inouye 2003), or for Protein
X (Horiuchi et a1. 2003). Of the putative M xanthus transcription factors, FruA (Ogawa
et al. 1996, Ellehauge et al. 1998) is the best candidate for a protein that binds to the

04499 regulatory region; however, FruA has not yet been reported to bind DNA.

128

Chapter 4: Transcription of the M. xanthus partially C-signal-dependent Q4400
promoter is directly regulated by the essential developmental protein FruA.

This work is currently being prepared for submission to Journal of Biological Chemistry
for publication

129

ABSTRACT

The gram-negative bacterium Myxococcus xanthus employs extracellular signals
to coordinate movement, aggregation, and sporulation during multicellular development.
The latest-acting signal, C-signal, leads to the activation of a putative response regulator
F ruA, which acts on a branched pathway inside the cell. One branch regulates cell
movement, leading to aggregation. The other branch regulates gene expression, leading
to sporulation. C~signaling is required for firll expression of most genes induced afier 6

hours into development, including the gene identified by the Tn5 lac insertion Q4400.

Transcription from the (24400 promoter depends absolutely on DNA elements extending
from -63 bp to the promoter -35 region. A second region extending from -86 to -81 bp
exerts a two- to four-fold effect on expression, and mediates, at least in part, the C-signal
dependence of the 04400 promoter. To determine if F ruA is a direct regulator of (24400
transcription, a combination of in vivo and in vitro experiments was performed. Q4400
expression is abolished in a fiuA mutant. The DNA-binding domain of FruA bound
specifically to DNA upstream of the promoter -35 region in vitro and mutations between
-86 and -77 bp greatly reduced binding. Chromatin immunoprecipitation assays were
developed for M. xcmthus and showed that F ruA is associated with the (24400 promoter
region late in development in viva. Taken together, the results strongly support a model
in which FruA, activated in response to C—signaling, binds to the -86 to -81 bp region

upstream of the (24400 promoter and activates transcription.

130

INTRODUCTION

Under low nutrient conditions, the Gram-negative bacterium M. xanthus initiates
a program of gene expression that leads to multicellular development (Dworkin 1996).
When starved at a high cell density on a solid surface, rod-shaped M. xanthus cells begin
to move in a coordinated fashion to foci where, when suflicient numbers of cells
accumulate, three-dimensional structures called fi'uiting bodies are formed each
containing approximately 105 cells. Within these nascent fi'uiting bodies, some of the
bacterial cells differentiate into heat- and dessication-resistant spherical myxospores.

The cells remaining outside the linking bodies (called peripheral rods) are
morphologically distinct from either spores or vegetative cells and may function as
nutrient sensors (O'Connor and Zusman 1991b, a).

In order to form multicellular structures, a bacterium must be able to
communicate with its neighbors to coordinate the spatial and temporal patterns that allow
this progression. To accomplish this, M. xanthus produces several extracellular signals
(Shimkets 1999, Kaiser 2004). A defect in the production or loss of activity of any of the
signals leads to arrest at a specific stage during the developmental process and the defects
can be complemented by adding wild-type cells or mutant cells defective in the
production of another signal (Hagen et al. 1978, LaRossa et al. 1983, Downard et al.
1993). The two signals that have been the most well-characterized are the A- and C-
signals. A-signaling occurs early in development (1-2 hrs) and involves the production of
extracellular proteases. These proteases are thought to cleave outer membrane proteins

into amino acids and peptides, which serve as the A-signal. A-signaling is thought to be

131

a cell density-sensing mechanism that allows the M. xanthus cells to know when cell
density is high enough to undergo development (Kuspa et al. 1992b).

The C-signal is essential for three behaviors exhibited by M. xanthus during
development (Kim and Kaiser 1990b, 1991, Li et al. 1992). Rippling, the coordinated
movement of cells that appear as traveling waves in time-lapse microscopy movies
(Reichenbach 1965), requires a low amount of C-signaling. Aggregation of M. xanthus
cells into foci requires a higher amount of C-signaling. Sporulation within the fruiting
body requires a very high level of C-signaling.

C-signaling involves the product of the csgA gene (Kim and Kaiser 1990c).
Initially produced as a 25 kDa protein, ngA is cleaved by a serine protease to produce a
17 kDa active form (Kim and Kaiser 1990c, d, Shimkets and Rafiee 1990, Kruse et al.
2001, Lobedanz and Sagaard-Andersen 2003). The C-signal has been localized to the
extracellular matrix (Shimkets and Rafiee 1990) and is presumably sensed by
neighboring M. xanthus cells through an unknown receptor. An effect of C-signaling is
the activation of the transcription factor F ruA (Ogawa et al. 1996, Ellehauge et al. 1998).
FruA resembles response regulators of bacterial two-component systems and is essential
for M. xanthus development. Once activated, F ruA acts on a branched pathway within
the cell (Sagaard-Andersen et a1. 1996). One pathway involves the activation of the Frz
system and leads to rippling and aggregation. The second pathway involves the
expression of genes such as those in the dev operon which are required for sporulation
(Ellehauge et al. 1998). Recently, a gene (fdgA) on this pathway that is likely to be a

direct target of FruA transcriptional activation was identified (Ueki and Inouye 2005).

132

Other potential target genes of C-signaling and FruA were identified using a Tn5
transposon containing a promoterless lacZ gene (Kroos and Kaiser 1984). When inserted
into the chromosome, Tn5 lac created a transcriptional fusion between lacZ and an
upstream M. xanthus promoter. Insertions that exhibited a three-fold increase in
developmental B-galactosidase production were considered to be under the control of a
developmentally-regulated promoter (Kroos et al. 1986). Of 2,3 74 insertions examined,
29 were shown to be developmentally regulated. Of these, the expression of 15 insertions
was subsequently shown to be dependent on C-signal (Kroos and Kaiser 1987).

One of these C-signal-dependent insertions, 04400, has been the focus of several
studies. The transcriptional start site has been mapped and regulatory regions identified
(Brandner and Kroos 1998, Yoder and Kroos 2004a). The promoter for the (24400
insertion is regulated by DNA upstream of the -35 region. Using mutational analysis, the
region between -63 bp and the promoter -35 region was determined to be absolutely
essential for expression (Yoder and Kroos 2004a). This region contains two elements
that are conserved in other developmental M. xwrtlrus promoters. A 7-bp sequence
known as the C box (Fisseha et al. 1999) is centered at -49 bp in the (24400 upstream
region (Brandner and Kroos 1998). The pattern of effects when individual base pairs
were mutated was different when compared to mutations in similar sites in other
promoters (Viswanathan and Kroos 2003, Srinivasan and Kroos 2004, Yoder and Kroos
2004b, a), suggesting that the Q4400 promoter is regulated differently than the other
promoters examined thus far. A second element, the 5-bp element (Viswanathan and

Kroos 2003), is found centered at -61 bp in the Q4400 upstream region. An element not

133

shared with other promoter regions examined so far extends from -86 to -81 bp. This
element was found to exert a two- to four-fold positive effect on expression and is at least
partially responsible for the C-signal dependence of the (24400 promoter. While
regulatory elements have been identified in the 04400 promoter region, knowledge of
transcription factors that bind to these sequences has been lacking.

Here we present evidence that Q4400 expression is directly regulated by the
transcription factor FruA Expression fi'om the (24400 promoter was lost in a M null
mutant, indicating that F ruA is required for (24400 expression in vivo. The F ruA DNA-
binding domain fused to an octahistidine tag (FruA-DBD-Hisg) was purified and used in
gel shift assays to determine that FruA-DBD-Hiss binds to the region upstream of the
(24400 core promoter in vitro. Using probes that were mutated at various sites within the
Q4400 upstream region, FruA-DBD-Hiss binding was localized to the region between -
86 and -77 bp, which was previously identified as being important for C-signal-
dependent expression (Yoder and Kroos 2004a). Lastly, we adapted the chromatin
immunoprecipitation procedure for use on development M xanthus and used it for the

first time to show that FruA associates with the 04400 region in vivo.

134

MATERIALS AND METHODS

Bacterial strains and plasmids. Strains and plasmids that were used in this
study are listed in Table 4.1.

Growth and development. Escherichia coli BL21(DE3) strains were grown at
37°C in Luria-Bertani (LB) medium (Sambrook et al. 1989) containing 200 ug of
ampicillin (Ap) per ml. M. xanthus strains were grown at 32°C in CTT broth or on agar
(1.5%) plates (Hodgkin and Kaiser 1977) (1% Casitone, 10 mM Tris-HCl [pH 8.0], 1
mM KHZPO4-K2HPO4, 8 mM MgSO.. [final pH = 7 .6]). When necessary, 40 pg of
kanamycin (Km) per ml was used for selection. Fruiting body development was
performed on TPM agar (1.5%) plates (10 mM Tris-HCl [pH 8.0], 1 mM KHzPO4-
K2HP04, 8 mM MgSO4 [final pH = 7 .6]) as described previously (Kroos et al. 1986).

Construction of M. xanthus strains and determination of lacZ expression
during development. Strains containing pREGl727 derivatives integrated at the Mx8
phage attachment site were constructed by electroporation (Kashefi and Hartzell 1995) of
M. xanthus and transformants were selected on CTT-Km plates. To eliminate colonies
with unusual developmental lacZ expression, we screened at least 10 transformants on
TPM agar plates containing 40 ug of 5-bromo-4-chloro-3 -indolyl-B-D-galactopyranoside
(X-Gal) per ml. Any colonies with unusual expression of lacZ were discarded and of the
remaining candidates, three independent isolates of each mutant construct were chosen
for analysis. In all cases, the three transformants gave similar results when
developmental B-galactosidase activity was measured as described previously (Kroos et

al. 1986).

135

Table 4.1. List of bacterial strains and plasmids used in this study

 

 

 

Bacterial strain Relevant characteristics Source or Reference
or plasmid

E. coli

DHSor cp80 lacZAMlS AlacU169 recAI endAI hst17 (Hanahan 1983)
supE44thi-1 gyrA relAI

BL21(DE3) F— ompT hstB(r — m —) gal dcm (DE3) Novagen

EDYFruA BL21(DE3) transformed with meA'DBD'Hi56, This paper
Apt

M xanthus

DK1622 Wild-type (Kaiser 1979)

1514A null mutant fiuA::TnV (2786 (Ogawa et al. 1996)

JPB40030 DK1622 attB:: pJB40030 (Yoder and Kroos

2004)
MDY4400.FA fruA null attB:: pJB40030 This paper
MDY1727 DK1622 attB:: pREGl727 (Y oder and Kroos
2004)

MDY1727.FA fi-uA null attB:: pREGl727 This paper

Plasmids

pMF A05 pPlinc with 1.6 kbp HincII fragment containing (Ogawa et al. 1996)
the fiuA gene of M. xanthus

pFruADBD-Hisg pETl la with a 266-bp NdeI-BamHI fragment (Ueki and Inouye 2005)
generated by PCR using pMFAOS as template

pREGl727 Apr Kmr Pl-inc attP'lacZ (F isseha et al. 1996)

pJB40029 pGEM7Zf with 267-bp EcoRI-Smal fiagment (Yoder and Kroos
from pJB40015 2004)

PJB40030 pREGl 727 with 297-bp XhoI-BamHI fragment (Y oder and Kroos
fiom pJB40029 2004)

pDY69 pJB40029 with GTC to TGA mutation at -86 to - (Y oder and Kroos
84 hp 2004)

pDY79 pJB40029 with GGGGGTG to T'I'I‘ITGT (Y oder and Kroos
mutation from -83 to -77 hp 2004)

pDY67 pJB40029 with TG to GT mutation at -76 to -75 (Yoder and Kroos
hp 2004)

pDY65 pJB40029 with GGGAGC-to-T'I'I‘CTA mutation (Y oder and Kroos
at -69 to -64 bp 2004)

pDY35 pJB40029 with GAAC to TCCA mutation at -63 (Y oder and Kroos
bp to -60 hp 2004)

pDY59 pJB40029 with GTCCC to TGAAA mutation at - (Y oder and Kroos
58 to -54 bp 2004)

pGV4400.3 pJB40030 with CATCCCT to ACGAAAG (Y oder and Kroos
mutation from -52- to -46 bp 2004)

pDY7] pJB40029 with GGCGG to 'I'I'ATT mutation at - (Y oder and Kroos
45 to -41 hp 2004)

 

136

Preparation of FruA-DBD-Hisg and Hisg-FruA protein. E. coli strain BL21(DE3)

(N ovagen/Eh/fl) Biosciences, Inc., San Diego, Calif.) was transformed with a pETl 1a
derivative (Ueki and Inouye 2005) containing the FruA DNA-binding domain fused to an
octahisitidine tag under the control of the IPTG-inducible T7 promoter. A single
ampicillin-resistant colony was used to inoculate 5 ml LB broth containing 200 ug/ml
Ap. This culture was grown overnight at 37°C with shaking. One ml of overnight culture
was used to inoculate flasks containing 100 ml of LB-Ap broth. Cultures were grown to
80-90 Klett Units (445 x108 cells/ml) at 37°C, at which time IPTG was added to a final
concentration of 1 mM. Cells were harvested after two hours by centrifirgation (5900 x g
/25°C/ 15 minutes). Cell pellets were washed with 25 ml of 10 mM Tris-HCl (pH 7.9)
and recentrifuged. All remaining steps were performed on ice or in the cold room.
Pellets were resuspended in 0.5 ml Buffer H [10 mM Tris-HCl (pH 7 .9), 500 mM NaCl,
lmM B-mercaptoethanol, 10 mM imidazole] supplemented with protease inhibitors
(Roche Mini EDTA-fi'ee tablets) (Ueki and Inouye 2005) and sonicated 6 X 10 seconds
to disrupt cells. After ultracentrifirgation at 100,000 x g/4°C/30 minutes, Triton X-100
was added to the supematants to a final concentration of 0. 1%. Ni-NTA beads (Qiagen)
were prepared by washing 3 times with Buffer H supplemented with protease inhibitors
and added at a 1:1 ratio to the supernatant. The Ni-NTA bead/supematant mixture was
rotated for 45 nrinutes and applied to a Cell Thru 2 ml disposable column (Clontech) that
had been rinsed with 1 ml Buffer H supplemented with protease inhibitors. The beads
were washed with 4 ml of Buffer H containing protease inhibitors and 0.1% Triton X~100

and 4 ml of Buffer H containing protease inhibitors and 40 mM imidazole. F ru-DBD-

137

His; was eluted from the column in 4 ml Elution Buffer [10 mM Tris-HCl (pH 7.9), 50
mM NaCl, 1 mM B-mercaptoethanol, 250 mM imidazole] and dialyzed against a buffer
containing 10 mM Tris-HCl (pH 7.9), 50 mM NaCl, 1 mM B-mercaptoethanol, 1 mM
EDTA, and 50% (w/v) glycerol. Uninduced cultures to which no IPTG was added were
processed in parallel with the induced cultures. Both uninduced and induced protein
preparations were stored at -20°C. To determine the purity of the F ruA-DBD-Hiss
extract, samples of uninduced and induced preparations were run on SDS 14%
polyacrylamide gels and either stained with Coomassie Brilliant Blue or subjected to
Western blot analysis with antibodies prepared against full-length F ruA-Hiss. Protein
concentration was estimated using the Bradford method (Bradford 1976).

Hiss-FruA was prepared by transforming E. coli BL21(DE3) with the pEES 12
plasmid which was a gift from E. Ellehauge and L. chaard-Andersen. This plasmid
contains sequence corresponding to an N—terminal hexahistidine tag firsed to the full-
length fiuA gene under the control of a T7 promoter. Hisé-FruA was induced and
purified in a similar manner to FruA-DBD-Hisg, as described above.

Gel shift assay. The 04400 promoter probes from —101 to +25 bp, -101 to —41
bp and —41 to +25 bp were generated by PCR using wild-type or mutant plasmid (Table
4.1) as the template and combinations of the following primers: 5’ CCTAAG
CTTTGCACTGCGACGCGAGTC 3’ (for -101), 5’ GCGGATCCCGGTCCTTCGCGTC
GCCG 3’ (for +25), 5’ CCGCCAGGGATGTGGGACTGTT 3’ (for -41 in combination
with the upstream primer ending at -101) and 5’ CCGGAGGCGCGAGGCGC 3’ (for -41

in combination with the downstream primer ending at +25). The PCR fragments were

138

purified using a PCR Purification Kit (Qiagen) and labeled with [y-nP] ATP using T4
polynucleotide kinase (New England Biolabs). All labeled probes were purified by
electrophoresis on a 15% polyacrylamide gel followed by cutting the gel at a position
corresponding to labeled bands visualized by autoradiography. Probes were eluted from
gels by soaking overnight at 37°C in 250 pl TE buffer [10 mM Tris-HCl (pH 8.0), 1 mM
EDTA (pH 8.0)]. DNA concentration was estimated by agarose gel electrophoresis and
staining with ethidium bromide.

Binding reactions contained 10 mM Tris-HCl (pH 8.0), 50 mM KCl, 1 mM
dithiothreitol, 10% glycerol, 10 rig/ml bovine serum albumin, 1 pg of double-stranded
poly(dI-dC) (Amersham Biosciences, Inc), and 1 ng of 32P-labeled DNA fragment in a
10 ul reaction. Unless specified otherwise, 2 ug of purified protein fi'om cells induced to
produce FruA-DBD-Hisg was added per reaction. Reactions were incubated at 30°C for
10 minutes and loaded on a 5% polyacrylamide gel. After electrophoresis using 0.5 X
TBE [45 mM Tris-borate (1 :1), 1 mM EDTA], gels were dried and exposed to X-ray film
for autoradiography and/or bands were quantified with a Storm 820 Phosphorlmager
(Molecular Dynamics) using ImageQuant software (Amersham Biosciences, Inc.)

Preparation of Kiss-FruA antibodies. Purified Hiss-FruA was dialyzed in
phosphate buffered saline to decrease the glycerol in the buffer. Purified protein (100 ug)
was mixed with an equal volume of TiterMax adjuvant (Cthx) and emulsified using a
double hub syringe according to the manufacturer’s instructions. Rabbits were injected

subcutaneously three times over the course of three months. Twenty milliliters of blood

139

was collected fi'om the marginal ear vein at the end of each month and the serum was
prepared as described previously (Harlow and Lane 1988)

Western blot analysis. M. xanthus wild-type or a MA null mutant were grown
and subjected to starvation conditions to induce development as described above. At 2
and 18 hours into development, approximately 5 X 108 cells were collected and boiled in
100 pl of 1 X sample buffer [0.125 M Tris-HCl (pH 6.8), 5% B-mercaptoethanol, 2%
sodium dodecyl sulfate, 10% glycerol, 0.1% bromophenol blue) for 5 nrinutes. Equal
volumes (8 pl) were loaded on SDS 12% polyacrylamide gels and electrophoresed.
Proteins were electrotransferred to a polyvinylidene difluoride membrane (Millipore).
The membrane was incubated with l X TBS buffer [20 mM Tris-HCl (pH7.5), 500 mM
NaCl] containing 5% nonfat dry milk for one hour at room temperature to block non—
specific binding of the primary antibodies to the membrane. The membrane was then
probed by incubating with 1:5000 dilution of polyclonal Hisg-FruA antibodies from the
3rd bleed in 10 ml of TBS-2% nonfat dry milk. Detection of immunocomplexes was
performed using goat anti-rabbit immunoglobin G—horseradish peroxidase (BioRad) and
chemiluminecense (Western Lightning — Perkin Elmer) according to the manufacturer’s
recommendations.

Chromatin immunoprecipitation. Wild-type DZFl or fruA null mutant cells
were grown to 100 Klett Units in 10 ml of CTT liquid culture, centrifirged at 10,000 rpm
for 10 minutes, and resuspended to 1000 Klett Units in TPM liquid. The cell suspension
was spotted (20 pl) on TPM agar and allowed to dry briefly at room temperature, then

incubated at 32°C for either 2 hours or 18 hours. Cells were collected by scraping and

140

dispersed into 10 ml 1X SHP buffer [10 mM sodium phosphate (pH 7.3)] containing 1%
formaldehyde to crosslink proteins to DNA and incubated 30 minutes at 32°C with
shaking. Glycine (1.1 ml of a 1.25 M stock) was added to a final concentration of 125
mM to stop the crosslinking. The sample was centrifirged as above and the cell pellet
was washed with 25 ml 1X SHP bufl‘er and then centrifuged again. The cell pellet was
resuspended in 1 ml cold (4°C) IPlSO buffer [50 mM Tris-HCl (pH 8.0), 150 mM NaCl,
0.5% Triton X-100] supplemented with 40 pM pepstatin, 1 mM EDTA, 4 mM Pefabloc,
20 mM leupeptin, 28 pM EM, and 1.5 pM aprotinin, then sonicated 6 X 10 seconds on
ice to disrupt cells and shear chromosomal DNA into fragments ranging from about 500
to 1000 bp. Insoluble material was pelleted in a microfirge at 14,000 rpm for 10 seconds.
A sample (20 pl) of the supernatant, representing 2% of the total cellular extract, was
removed and set aside as the input DNA sample. The remaining supernatant was rotated
with an equal volume of a 50% slurry (in IPlSO buffer) of Protein A-Sepharose beads
(Amersham Biosciences, Inc — after washing three times in [PI 50 buffer) for one hour at
4°C. The beads were removed with two centrifugation steps of 14,000 rpm for 1 minute
and the resulting supernatant was split into two equal parts. To one part, 2 pl of pre-
immune sera was added. To the other part, 2 pl of Hiss-FruA antibodies was added.
These reactions were rotated 18 hours at 4°C. Samples were centrifuged at 14,000 rpm
for 5 minutes at 4°C, the supernatant was placed in a fresh tube, and 50 pl of Protein A-
Sepharose beads was added, and the sample was rotated at 4°C for 1 hour. Beads were
collected by centrifirging at 500 rpm for 1 mimrte and washed for 15 minutes twice with
IPlSO buffer and twice with IP300 buffer [50 mM Tris-HCl (pH 8.0), 300 mM NaCl,

141

0.5% Triton X-100]. To the washed beads and to the input DNA samples, 150 pl of
elution buffer [50 mM Tris-HCl (pH 8.0), 10 mM EDTA, 1% SDS] was added and the
samples were incubated at 65°C for 4 hours to reverse crosslinks. Samples were
centrifirged at 500 rpm for 1 minute, supematants were removed to fresh tubes, and
proteins were digested for 30 minutes at 37°C by adding 150 pl TEpK [TE (pH8.0), 100
pg/ml proteinase K]. DNA was then purified by phenol-chloroform-isoamyl alcohol
(25:24: 1) extraction followed by ethanol precipitation after the addition glycogen to a
final concentration of 0.27 pg/ml. The dried DNA was resuspended in 30 p1 sterile
water.

Ten-fold serial dilutions were made of the input DNA samples, representing 0.2,
0.02, 0.002, or 0.0002% of the total cellular extract for each candition. PCR reactions
(25 pl) contained 10 pmoles of each primer and 5 pl of template under standard
conditions for Taq DNA polymerase as specified by the manufacturer (New England
Biolabs). The number of cycles was optimized for each primer pair. For the (24400
promoter region, the -101 to +25 primers are listed above. The rpoC primer sequences
are as follows: 5’ CCTTGAGCGCGATGGAGATA 3’ and 5’
CTCGGCGGCCTCATCGAC 3’. These primers allow the amplification of a 125-hp
fiagment starting at +1780 bp into the putative coding region of M xanthus rpoC. The
results of the PCR reactions were visualized after electrophoresis of 8 p] on a 1.5%

agarose gel and staining with ethidium bromide.

142

RESULTS

A firm null mutation abolishes Q4400 expression. To determine the effect of
fi‘uA on (24400 expression, we transformed a firm null mutant strain of M. xanthus with a
plasmid containing the 524400 promoter from -—101 to +155 bp transcriptionally fused to
the lacZ gene. This plasmid also contains an Mx8 phage attachment site which allows for
efficient site-specific recombination into the M. xmrthus chromosome. We measured [3—
galactosidase production from three kanamycin-resistant transformants as well as
negative control strains bearing the vector with promoterless lacZ over the course of 48
hrs under starvation conditions (Fig. 4.1). As a positive control, Q4400 expression in the
wild-type DZFl background was also assessed. The fruA null mutation abolished
activity from the (24400 promoter. We conclude that fruA is eSsential for (24400
expression.

The FruA DNA-binding domain binds to the 04400 promoter region. To
determine if FruA can bind directly to the Q4400 promoter region, gel shift analyses
were performed with purified FruA DNA-binding domain. E. coli BL21(DE3) cells were
transformed with a plasmid containing the DNA-binding domain (amino acids 152 to
229) of FruA fused to an octahistidine tag under the control of an IPTG-inducible
promoter. One ampicillin-resistant transformant was selected and named EDYFruA.
Because F ruA is thought to firnction as a response regulator in a two-component system
(Ogawa et al. 1996, Ellehauge et al. 1998), this construct was expected to eliminate the
requirement for activation of the F ruA protein through phosphorylation or other

modifications in its N-terminal domain. After overexpression and purification of the

143

Figure 4.1. Effect of a fiuA null mutation on (24400 expression. Developmental lacZ
expression was determined for three independent isolates of wild-type DZFl bearing the
wild-type Q4400 promoter (-101 to +155 bp) (I) or no promoter (O) firsed to lacZ, and
the corresponding fiuA null mutant strains with the wild-type promoter (0) or no
promoter (0) firsed to lacZ. The average B-galactosidase activity fi'om three independent
isolates of each strain is expressed as nanomoles of o-nitrophenyl phosphate per minute

per milligram of protein. Error bars depict one standard deviation of the data.

144

 

 

 

 

B

—

_

m

_ E

 

r

2

612182430364248

:58 9:8on 0823823.“.

ad

is:

era's

Time in development (m

145

F ruA DNA-binding domain (FruA-DBD-Hng) using a Ni2+ column as described in the
Materials and Methods, the purified protein was tested for binding to the 04400 promoter
region. An uninduced culture of EDYFruA was subjected to the same purification
procedure and the corresponding fraction served as a negative control. F ruA-DBD-Hiss
was highly enriched in the preparation from induced EDYFruA (Fig. 4.2A). Figure 4.2B
shows that increasing amounts of purified proteins fi'om cells induced to produce FruA-
DBD-Hiss shifted the Q4400 DNA probe (—101 to +25 bp), producing a single band,
while proteins purified from the uninduced culture did not produce a shifted complex.
These results strongly suggest that FruA-DBD-Hisg binds to 94400 promoter region
DNA. Formation of a discretely-migrating shifted complex in the presence of a 1000-
fold excess of nonspecific competitor DNA (poly dI-dC) is suggestive of specific
binding. As a control, a 125 bp fi'agment amplified from near the center (1780 bp into
the putative coding region) of the rpoC gene, which is predicted to encode the M. xanthus
[3’ subunit of RNA polymerase, was also analyzed for FruA-DBD-I-Iiss binding. This
probe was not bound by either the induced or the induced purified proteins, indicating
that the binding between the (24400 probe and the purified protein from cells induced to
produce FruA-DBD-Hisg is specific.

FruA-DBD-Hisg binds to upstream DNA in the (14400 promoter region. To
determine the location of FruA-DBD-Hisg binding in the (24400 promoter region, we
tested shorter radioactive probes in gel shift experiments. The region fi'om —101 to +25

bp is known to be suflicient for full Q4400 expression during development

146

Figure 4.2. FruA-DBD-Hisg binds specifically to the (24400 promoter region. A) Proteins
were purified fi'om either uninduced or induced cultures of E. coli transformed with the

F ruA-DBD-Hiss overexpression plasmid pETl la/FDBD-Hg as described in Materials and
Methods. Equal volumes (8 pl) of the purified proteins were electrophoresed on a SDS
14% polyacrylamide gel and stained with Coomassie Brilliant Blue. The arrow denotes
FruA-DBD-Hiss in the sample from induced cells. B) Gel shifts were performed with
3azP-labeled probes containing either Q4400 DNA from —101 to +25 bp or a 125-hp
fi'agment that starts 1780 bp into the putative open reading frame of the M xanthus rpoC
(predicted to encode the [3’ subunit of RNA polymerase). The leftmost lane in each panel
shows the probe alone negative control. Other lanes show 0.02, 0.2 or 2 pl of purified

proteins fiom induced cells or uninduced cells added to the binding reaction.

147

  

5
e .
M
E
- .
C
D q- 16
. ~46— FruA-DBD-Hiss
. g- 4
B.
Pro be: 94400 5200

 

Uninduced: - - - - A - - - - A

 

 

148

(Yoder and Kroos 2004a). We generated three probes by PCR: -101 to +25 bp (which
served as a positive control), —101 to —41 bp, and —41 to +25 bp. The —101 to —41 bp
probe encompasses the entire region upstream of the promoter —35 region. The «41 to
+25 bp probe contains the promoter -35 and —10 regions and the transcriptional start site,
and some downstream DNA

As expected, FruA-DBD-Hiss shifted the positive control probe containing Q4400
DNA from —101 to +25 bp (Fig. 4.3). Additionally, the -101 to —41 bp probe was shifted
by FruA-DBD-Hng, but the —41 to +25 bp probe was not shifted. This firrther
demonstrates the specificity of F ruA-DBD—Hisg and localizes the binding to the region
upstream of the 94400 promoter.

FruA-DBD-His. binds to the —86 to -77 bp region upstream of the 04400
promoter. To identify the sequence to which FruA-DBD-Hiss binds in the upstream
region of the 04400 promoter, we performed gel shifts with wild-type and mutated
probes in the context of DNA from -—101 to +25 bp. Probes were created by PCR using
templates that had been mutated for earlier expression studies (Fig. 4.4A) (Yoder and
Kroos 2004a). The mutations were all transversions (T<—>G and C<—)A). For example,
the ~86 to —84 bp mutated probe contains a GTC to TGA change. The mutations roughly
span the region between —86 and —41 bp, covering most of the region (-101 to -41 bp)
bound by FruA-DBD-Hisg (Fig. 4.3).

Figure 4B shows that the wild-type Q4400 probe was shifted in the presence of

FruA-DBD-Hisg as expected. Likewise, the probes mutated at -76 to —75 bp, -69 to —64

149

Figure 4.3. F ruA—DBD-Hiss binds upstream of the (24400 promoter. Gel shifts were
performed with 32P-labeled probes spanning the indicated regions relative to the start site
of 04400 transcription. In the indicated lanes, F ruA-DBD-Hiss was added to the

reaction. The autoradiographs represent typical results from several experiments.

 

150

Probe: ~101to+25 -101to-41 41to+25
FruA—DBD-Hlsac - + - + - +

 

 

 

 

 

151

Figure 4.4. FruA-DBD-Hiss binds to a region important for expression from the (24400
promoter. A) Summary of the effects on developmental expression from wild-type or
mutant Q4400 promoter regions. Promoter regions with the indicated mutations
(alternately underlined or boxed) were fused to a lacZ reporter and developmental [3-
galactosidase production was measured as described previously (Y oder and Kroos
20043). Downward arrows indicate decreased developmental lacZ expression caused by
the given mutations and numbers indicate the relative amount of B-galactosidase specific
activity ob served for the mutant, expressed as a percentage of wild-type promoter activity
measured in the same experiment. The dashed lines above nucleotides -72 to -67 and -57
to -52 bp on the opposite strand) represent potential binding sites for FruA-DBD-Hisg
based on the consensus sequence generated in Figure 4.6. B) Gel shifts were performed
with 32P-labeled DNA probes generated by PCR fiom templates containing wild-type or
mutant Q4400 DNA from —101 to +25 bp. In the indicated lanes, F ruA-DBD-Hisg was
added. C) The intensities of the shifted complex and the unshifted probe bands were
quantified as described in the Materials Methods section and the ratio was normalized to
that observed for the wild-type probe in the same experiment, which is presented as
100% in the bar graph. Error bars represent one standard deviation of the data from four

individual experiments.

152

  

mam; %A§ ~ meme-41
GTA GT TTTCTA
92 89 a7
TITTI'GT
TCCACTGAAA ACGAAAG 9
2 2 3 o
B 0‘9 39599299st
6
Probe £_°_°_-*°_°_S°° _9?’ _a‘” _>°
FruA-DBD-Hisaz-+-+-+-+ -+-+ -+ -+

 

PercentofWTbrnding
a a a 8 § 8 S
”—
”I
”I
‘9—
’4—
“——
‘a—e
«.—_
”_—

(9 \9 v9 0 \0 \0 we 0
,e 9° 9 «s a e «a e ,9
Probe

153

bp, -63 to -60 bp, -58 to -54 bp, -52 to —46 bp, or —45 to —41 bp were all shifted to a
discrete band that co-migrated with the wild-type shifted complex, suggesting that F ru-
DBD-Hiss does not bind specifically to these sites. In contrast, the probes mutated at —86
to —84 bp and —83 to —77 bp were bound very little by FruA-DBD-Hisg. Quantification
of the gel bands indicated that these mutated probes were reduced three- to five-fold in
their ability to be bound by FruA-DBD-Hiss compared to the other probes (Fig. 4.4C).
We conclude that FruA-DBD-Hisg recognizes sequences in the —86 to —7 7 bp region
upstream of the 04400 promoter, which has been shown to be important for expression
and for C-signal-dependence previously (Yoder and Kroos 2004a).

FruA associates with the (24400 promoter region in viva. To assess whether

F ruA becomes associated with the (24400 promoter region in developing M. xanthus
cells, chromatin immunoprecipitation (ChIP) was performed using antibodies created
against firll—length FruA-Hiss protein. The procedure uses formaldehyde to cross-link
proteins to DNA followed by selective immunoprecipitation of the complexes. Cross-
links are then broken and the DNA is purified and used in PCR reactions designed to
amplify chromosomal regions of interest.

The fl‘uA gene is expressed starting at about 6 hours into development and
reaching a peak at 18-24 hours (Ogawa et al. 1996, Ellehauge et a1. 1998). Expression
from the (24400 promoter shows a similar pattern during development (Fig. 4.1). M
xanthus wild-type DZFl or a fruA null mutant derivative were allowed to develop for
either 2 or 18 hours as described in the Materials and Methods. Western blot analysis

showed that FruA is not expressed at 2 hours, but is present in wild-type cells at 18 hours

154

into development (Fig. 4.5A). Developed cells were also subjected to ChIP assays as
described in the Materials and Methods. The resulting purified DNA was used as a
template in PCR reactions with primers designed to amplify either the [24400 promoter
region from -101 to +25 bp (relative to the start site of transcription) or the IpaC coding
region from +1780 to +1905 bp (relative to the putative start site of translation), which
serves as a negative control. A ten-fold dilution series of input DNA served as a template
for PCR reactions with either 04400 or rpaC primers to show that the PCR conditions
were in the linear range of amplification for each primer set.

The top panel in Figure 4.5B shows the results for the region surrounding the
(24400 promoter. Lanes 5 and 6 show ChIP results for wild-type cells harvested at 2
hours into development with either pre-immune serum or antibodies against FruA There
appears to be no difference in signal intensity, consistent with the expected absence of
FruA at this time in development. However, for wild-type cells harvested at 18 hours, the
intensity of the band produced using FruA antibodies (lane 12) is much greater than the
band produced using the preimmune serum (lane 11). This difference was observed in 5
additional experiments, while a difference was never observed for cells harvested at 2
hours. Also, no signal difference was observed comparing preimmune serum versus
F ruA antibodies at 2 or 18 hours for the fruA null mutant (lanes 23 and 24). We conclude
that FruA is associated with DNA (within about 1000 bp) near the (24400 promoter at 18

hours into development.

155

Figure 4.5. FruA associates with the (24400 promoter region in viva. A) Equal volumes
of cellular extracts fiom M xanthus wild-type DZFl or a fruA null mutant, which had
been collected at 2 or 18 hours into development, were electrophoresed on a SDS 14%
polyacrylamide gel and subjected to Western blot analysis using antibodies generated
against F nrA-His5 (Materials and Methods). B) Chromatin immunoprecipitation was
performed on cell extracts from M xanthus wild-type DZFl or a fruA null mutant. Cells
were collected at either 2 or 18 hours into development and protein/DNA complexes
were immunoprecipitated with either pre-immune serum or polyclonal antibodies against
full-length FruA-Hiss. Input samples correspond to 0.2%, 0.02%, 0.002% or 0,0002% of
the total cellular extract prior to immunoprecipitation. The top panel shows PCR with
primers designed to amplify the Q4400 promoter region (-101 to +25 bp relative to the
start site of transcription) and the bottom panel shows PCR with primers designed to
amplify the IpOC coding region (+1780 to 1905 bp relative to the predicted translation

start).

156

 

VNmNNNFNONmewth mp: Mr N_. Sowm m n m m v m N F

 

 

 

 

 

 

 

 

  

OOQKI ll- ll' - =-- 1"--i
ODE: " 1"--.‘=-‘ . "l I: Isl
n Hrl‘ n H . n M. n H“
L: 4. Sec. .r e Sec. .1 6 Sec. .5 6 Sec.
w d W... m w m w w
w w w w
n n n n
w w w m
=5; 2. .50: N .50: 3 So; N
can .55.: =2§ {No 33.2%
(an—.8 I u ;

«segue—oat 8:. 9:0: lolllw .N. or N. ..
ElfilllaEé

 

 

157

The bottom panel shows ChIP results for the rpaC coding region. For both wild-
type and the fruA mutant, at both 2 and 18 hours into development, the intensity of the
signal with pro-immune serum versus F ruA antibodies is similar. As expected, F mA did

not appear to be associated with DNA in the vicinity of the rpaC coding region.

158

DISCUSSION

Our results suggest that FmA binds near -80 bp and activates Q4400 transcription
during M xanthus development. This model is supported by the finding that 1) Q4400
expression absolutely requires MA in viva (Fig. 4.1), 2) FruA-DBD-Hiss bound
specifically to the sequence between -86 and —77 bp (Figs. 42-44), which was shown
previously to be important for C-signal-dependent expression fi'om the 94400 promoter
in viva (Y oder and Kroos 2004a), and 3) FruA associates with the (24400 promoter
region in vivo (Fig. 4.5B).

A previous mutational study determined that two regions upstream of the
promoter are required for (24400 expression (Y oder and Kroos 2004a). One of the
regions extends item -63 bp through the promoter —35 region and is absolutely required
for transcription. The second region extends from —86 to —-81 bp and is at least partially
responsible for C-signal-dependent expression. This region is unique compared to other
C-signal-dependent promoter regions examined thus far. In the case of the 94403
promoter region, a 10—bp element centered at -74. 5 bp is absolutely required for
expression (V iswanathan and Kroos 2003). This element bears little similarity to the
(24400 sequence between -86 and -81 bp, suggesting that they act differently. The
(14499 promoter appears to have a short sequence centered at -—79 bp that exerts a two-
fold effect on expression (Yoder and Kroos 2004b); however, this element, like the
(24403 lO-bp element, has little sequence similarity to the (24400 sequence between -86
and -81 bp. On the basis of sequence inspection, it seems unlikely that F ruA binding near

-80 bp will explain C-signal-dependent activation of the 94403 and 04499 promoters.
1 59

Indeed, our previous study showed that the C-signal-dependence of the (24499 promoter
was not likely to be mediated through an element upstream of -71 bp (Yoder and Kroos
2004b).

Mutational analysis suggests that the sequence near -80 bp bound by FruA only
exerts a two- to four-fold effect on (24400 expression, yet Q4400 promoter activity is
abolished in a fiuA mutant (Fig. 4.1). A simple explanation would be that FruA affects
Q4400 expression both directly and indirectly. For example, F ruA might be required for
transcription of an activator protein that binds to the regulatory elements from -63 bp
through the promoter -35 region.

FruA has been proposed to function as a NarL-type response regulator in a two-
component system (Ellehauge et a1. 1998). However, the N—terminal receiver domain of
FruA shows no BLAST similarity scores of less than c“5 to proteins in the GenBank
database. In comparison, the N-terminal domain of the response regulator NarL matches
4 proteins in the database with BLAST scores near e's". Also, FruA contains 8 amino
acids adjacent to the conserved aspartic acid in the receiver domain that are not found in
any other response regulator (Ellehauge et al. 1998). The C-terrninal domain of F ruA
bears a strong similarity (many protein matches less than e'7) to the DNA-binding
domains of other transcription factors (Ogawa et al. 1996), mostly those in the LuxR
family. These considerations, together with our results, make it seem quite likely that
FruA functions as a transcription factor rather than a DNA-modifier like the E. coli

protein IHF, but there is less certainty that it functions as a response regulator.

160

In this study, the F ruA DNA-binding domain appeared to bind to a region of
DNA containing the sequence 5’-GTCGGGGGTG-3. Ueki and Inouye have previously
found that FruA-DBD-Hiss binds to the fdgA and dofA promoter regions of M xanthus in
vitra ( Inouye, Ueki and Inouye 2005). In both cases, FruA-DBD-Hiss footprints a large
region upstream of the core promoter elements. Within these regions, three sequences in
the case of fdgA and four sequences in the case of dofA can be found with similarity to
the sequence bound in the 04400 upstream region (Fig. 4.6). This allows us to predict a
consensus binding site for Fru-DBD-Hiss of 5’ GTCG/CGA/G 3’. Interestingly, two
other sequences that match this consensus in 5 of 6 positions are found directly in the
04400 upstream region (dashed lines in Fig. 4.4A). One of these, located at -72 to -67
bp, could be mutated in half its sequence with no effect on expression in viva (Yoder and
Kroos, 2004a, Ueki and Inouye 2005) or FruA-DBD-Hiss binding in vitra (Fig. 4.4B and
4.4C). The other, located on the opposite strand at -52 to -57 bp, was critical for
expression in viva (Fig. 4.4A) (Y oder and Kroos 2004a) but there was little effect on
FruA-DBD-Hisg binding in vitra when the sequence from -58 to -54 bp was changed
(Fig. 4.43 and 4.4C).

Sequences similar to the putative FruA consensus binding site can be found in
regions known to be important for expression in other C-signal-dependent promoters. A
sequence that matches the consensus at 5 of 6 positions is located at -47 to -42 bp in the
essential region of the absolutely C-signal-dependent Q4403 promoter. Certain

mutations in this region abolish expression (V iswanathan and Kroos 2003) and

161

Figure 4.6. Alignment of sequences in F ruA-DBD-Hisg binding sites. FruA-DBD-Hiss
has been shown to bind to two other M xanthus developmental promoter regions, dofA
and fdgA (Inouye, Ueki and Inouye 2005). Within the protected regions, several
sequences can be found that closely resemble the region of the 04400 promoter to which

F ru-DBD-Hisg binds. A putative consensus sequence is shown.

162

 

 

 

 

fdgA
fdgA
fdgA
dofA
dofA
dofA
dofA
Q4400

Putative consensu- binding
site for FruA-DBD-Hia.

 

163

preliminary studies have indicated that FruA-DBD-Hiss binds to this sequence (P.
Viswanathan, unpublished data). In the partially C-signal-dependent Q4499 promoter
region, three sequences (-38 to -43 bp, -45 to -50 bp, and -58 to -63 bp) match the
consensus at 5 of 6 positions. Of these, two regions have been shown to abolish promoter
activity when mutated (Yoder and Kroos 2004b). However, DNA surrounding the
04499 promoter is not bound by FruA-DBD-Hisg under conditions used for this study (S.
Mittal, unpublished results).

The current model for C-signal transduction involves the transmission of the
active signaling moiety (p17) through an unknown receptor on the cell surface (Fig. 4.7).
One proposed consequence of C-signaling is a positive feedback loop on csgA expression
mediated by the product of the act operon (Gronewold and Kaiser 2001). Another
proposed consequence of C-signaling is the activation of the FruA protein either through
phosphorylation or another post-translational modification (Ellehauge et al. 1998). Until
now, the model only showed the active form of FruA affecting rippling and aggregation
through Frz proteins, and sporulation through genes such as those in the dev operon. Our
results support a new branch in the pathway (Fig. 4.7), since FruA directly activates the
04400 gene which is not required for aggregation or sporulation. Additionally, SdeK, a
histidine kinase that acts early in development, affects Q4400 promoter expression
(Garza et al. 1998, Pollack and Singer 2001) (Fig. 4.7). This protein may lead to the
production of C—signal-independent activators, which may directly regulate Q4400

expression in conjunction with FruA.

164

Figure 4.7. The position of 04400 in the C-signal transduction pathway model. C-
signaling is mediated through the csgA gene of M xanthus and leads to the activation of
FruA. FruA acts on at least three pathways in response to C-signaling. The first leads
through the Frz proteins, which are required for rippling and aggregation. The second
leads to the expression of genes, like the dev operon, that are required for sporulation.
The third pathway leads to the transcription of genes whose firnction remains to be
determined, such as 04400. The (24400 promoter is also regulated by SdeK, a C-signal-
independent protein kinase that acts early in development (Garza et al. 1998, Pollack and

Singer 2001)

165

C-signal

 

 

 

4)-

 

 

 

l T
C-signal
receptor

 

 

Neighboring
M. xanthus cells

 

166

Regulation of (24400 expression may also rely on other proteins. The region extending
from -63 bp through the promoter -3 5 region is essential for developmental expression
(Y oder and Kroos 2004a). Partially-purified DNA-binding proteins from developing M
xanthus cells contain at least one protein that binds specifically to the 5-bp element,
which extends fi'om -63 to -59 bp in the (24400 upstream region (D. Yoder, unpublished
results). Future research will be directed at identifying this protein as well as those

proteins that bind between -60 bp and the promoter -35 region.

167

SUPPLENIENTAL MATERIAL

168

APPENDIX

169

Title: Upstream Elements Stimulate Developmental Transcription from Heterologous

Core Promoters but Fail to Confer C-Signal Dependence in Myxacaccus xanthus

Please note: This work is part of a larger paper that was submitted to the Journal of
Bacteriology. The reviewers suggested that the results were too complex to yield
valuable information and it was not published at that time. Pooma Viswanathan
performed the majority of the work and was listed as the first author. I performed the
minority of the work and was listed as the second author on the paper. However, I have

written the text for this section for the purposes of this thesis.

170

INTRODUCTION

The rod-shaped Gram-negative Mxyacaccus xanthus undergoes multicellular
development when faced with nutrient limitation on a solid surface at high cell density
(Dworkin 1996, Kaiser 2003). Cells move in a coordinated fashion that resembles waves
under time-lapse microscopy (known as rippling) to aggregation foci where cells become
immobilized in a manner similar to traffic jams (W elch and Kaiser 2001, Kaiser and
Welch 2004). Continued movement of cells surrounding the traflic jam results in the
formation of three-dimensional structures, inside which some cells differentiate from
vegetative rods to heat- and desiccation-resistant spherical myxospores.

This process requires extracellular signals that serve to coordinate the thousands
of cells required for this process (Shimkets 1999, Kaiser 2003, Kaplan 2003, Sagaard-
Andersen et al. 2003). Five extracellular signals have been identified as being required
for normal developmental progression; a defect in the production of any of these signals
results in developmental arrest at a specific time during development (Hagen et al. 1978,
Downard et al. 1993). M xanthus extracellular signaling mutants can be rescued for
development by the addition of wild-type cells or cells lacking the production of a
different signal (Hagen et al. 1978, LaRossa et al. 1983). The A- and B-signals firnction
at 0-2 hours in development (Gill and Cull 1986, Kuspa et al. 1986, Kroos and Kaiser
1987). The D— and E-signals acts between 3 and 5 hours into development (Cheng and
Kaiser 1989b, Downard et al. 1993). C-signaling acts after 6 hours into development and
is required for rippling, aggregation, and sporulation (Kroos and Kaiser 1987, Li and
Shimkets 1993). It was shown that these cellular behaviors correlate with the levels of C-

171

signaling such that low levels of C-signaling are necessary for rippling, high levels are
needed for aggregation, and still higher levels are required for sporulation (Kim and
Kaiser 1991, Li and Shimkets 1993). C-signaling requires motility and cell-to-cell
contact for transmission (Kroos et al. 1988, Kim and Kaiser 1990b, a, Sager and Kaiser
1994).

C-signaling involves the csgA gene (Shimkets et al. 1983, Li et al. 1992). The
csgA gene is expressed at low levels during growth and increases with time in
development (Li et al. 1992). The product of this gene, ngA, is produced as a 25 kDa
protein and cleaved by a serine protease to an active 17 kDa form (Kim and Kaiser
1990c, d, Shimkets and Rafiee 1990, Lobedanz and Sagaard-Andersen 2003). The ngA
protein has been localized to the extracellular matrix (Shimkets and Rafiee 1990) where it
is presumably sensed through an unknown receptor on the neighboring cells. ngA may
act through a positive feedback loop involving the genes of the act operon (Gronewold
and Kaiser 2001, 2002).

In addition to a positive feedback loop, ngA production also leads to the
activation of the FruA protein (Ellehauge et al. 1998). F ruA, which resembles response
regulators of two component systems, acts on a branched pathway in the cell (Sagaard-
Andersen et a]. 1996). One branch leads to the activation of the F rz proteins (Sagaard-
Andersen and Kaiser 1996), which control the rate of cell reversals on a solid surface and
affect rippling and aggregation during development (Blackhart and Zusman, 1985).
Another branch leads to the expression of genes required for sporulation such as the dev

operon (Thony-Meyer and Kaiser 1993).

172

A Tn5 transposon containing a promoterless lacZ gene was used to identify genes
that are regulated during development (Kroos and Kaiser 1984). By randomly inserting
the Tn5 lac transposon into the chromosome, firsions between M xanthus DNA and a
promoterless lacZ gene were made. Insertions that increased more than three-fold were
considered to be developmentally-regulated (Kroos et al. 1986). Of the 2,374 insertions
identified, 29 insertions were developmentally regulated, and, of these, 15 insertions
depended on C-signaling for expression. The regulatory regions of several of these
insertions have been characterized.

The regulatory region associated with the (24403 promoter has been investigated
using mutational analysis (F isseha et al. 1996, Viswanathan and Kroos 2003). The DNA
between -80 and +3 82 bp is sufficient to drive developmental expression of a lacZ
reporter gene to levels comparable to the original 94403 T n5 lac insertion (F isseha et al.
1996). Mutations of the base pairs were made within the -80 bp to —7 bp region and
three cis-acting elements were found to be essential for developmental expression. The
first element is the C box (consensus sequence of CAYYCCY with Y being a pyrimidine
(Fisseha et al. 1996)) centered at -49 bp, a second element is the S-bp element (consensus
sequence of GAACA (Viswanathan and Kroos 2003 )) centered at -61 bp, and the third
element is the lO-bp element centered at -74.5 bp (V iswanathan and Kroos 2003). The C
box and 5-bp element were also found 5-7 bp apart in several other developmental
promoters such as the (24400, (24499, fiuA, and csgA promoters (V iswanathan and Kroos

2003)

173

The (24400 promoter has also been characterized by mutational analysis
(Brandner and Kroos 1998, Yoder and Kroos 2004a). When fused to a lacZ reporter
gene, the region from -86 to +155 bp is sufficient to drive developmental expression to

levels comparable to the original Q4400 Tn5 lac insertion. (Y oder and Kroos 2004a).

Interestingly, both the (24400 and the (24403 promoters have the same sequence
(CATCCCT) centered at -49 bp; however, identical mutations in the individual base
pairs in this sequence show different effects on expression indicating that these two
elements may firnction differently. In the (24400 promoter, the region extending fi'om —
63 bp through the promoter -35 region (which encompasses the C box and S-bp element)
is essential for expression. Another region extends from -86 to -81 bp and exerts a two-
to four-fold effect on expression. This element appears to some extent mediate the partial
C-signal dependence of the promoter.

To determine the effect of the upstream regulatory regions on core promoter
elements of the (24400 and 04403 promoters, a pair of chimeric promoters were
constructed containing either the (24400 upstream region firsed to the (24403 core
promoter (4400/4403) or the 04403 upstream region firsed to the 04400 core promoter
(4403/4400). The C box centered at -49 bp was chosen as the firsion point as both
promoters contain the exact same 7-bp sequence in this region. Both chimeric promoters
were fused to the lacZ gene and the timing and levels of developmental expression, as
well as the C-signal dependence, from these chimeric promoters was measured. Our

results suggest that the timing and levels of developmental expression were driven by the

174

upstream regions rather than the core promoter elements. The upstream regions were not

solely able, however, to confer the C-signal dependence to the chimeric promoters.

175

 

MATERIALS AND METHODS

Bacterial strains and plasmids. Strains and plasmids that were used in this work
are listed in Table A1.

Growth and development. Escherichia coli was grown at 37 °C in Luria-Bertani
medium containing 50 pg/ml of ampicillin (Ap). M xanthus was grown at 32°C in CTT
medium (Hodgkin and Kaiser 1977) ( 1% casitone, 10 mM Tris-HCl [pH 8.0], 1 mM
KHZPO4-K2HPO4, 8 mM MgSO4 [final pH 7 .6]) in liquid cultures or on agar (1 .5%)
plates. Forty micrograms of kanamycin (Km) per ml or 12.5 pg/ml of oxytetracycline
(Tc) was used when required for selective growth. Fruiting body development was
performed on TPM (10 mM Tris-HCl [pH 8.0], 1 mM KHzPO4-K2I-IPO4, 8 mM MgSO.;
[final pH 7 .6]) agar (1.5%) plates as described previously (KrOos et al. 1986).

Construction of plasmids. The plasmid pDY500 was created to generate an
Q4403 promoter region from which to make a chimeric 4400/4403 promoter. PCR was
used to amplify Q4403 DNA from -103 to +36 bp using pMF3.4 as a template and
primers that generate a fiagment with synthetic XbaI and BamHI ends. This fi’agment
was restricted with XbaI and BamHI, and ligated into pGEM7Zf previously digested with
the same enzymes to generate pDY500. The same fiagment had been previously ligated
into XbaI-BamHI digested pREGl727 to generate pTH6-1, which showed developmental
lacZ expression that was indistinguishable fi'om pMFlOO (containing Q4403 DNA fi'om -
80 to +3 82 bp) when the plasmids were integrated at the Mx8 phage attachment site in
the M xanthus chromosome. The plasmid pDY503 was created by synthesizing
complementary oligonucleotides corresponding to the -86 to -49 bp region of (24400

176

Table A1. Bacterial strains and plasmids used in this study

 

 

 

 

Strain or plasmid Relevant characteristics Source or
Reference

E. coli strain

DHSa ¢80 lacZAMlS AlacU169 recAI endAI hst17 (Hanahan

supE44 (hi-1 gyrA reIAI 1983)

M minibus strains

DK1622 Wild type (Kaiser
1979)

DK5208 csgA: :Tn5-132 (Tc') (2205 (Shimkets
and Asher
1988)

IPB40030 attB: :pJB40030 (Yoder and
Kroos
2004a)

MDY1727 attB: :pREG1727 (Yoder and
Kroos
2004a)

MTH6-1 attB::pTI-I6-l (Hao 2001)

MDY504 attB: :pDY504 This study

MDY506 csgAzzTn5-132 (Tc') (2205 attB: :pDY504 This study

MDY510 attB: :pDYS 10 This study

MDYS 12 csgA::Tn5-132 (Tc‘) (2205 attB::pDY506 This study

MPV100-2 attB: :pMF 100 This study

Plasmids

pUCl9 Apr Iaca (Y 8.1118011-
Perron et al.
1985)

177

Table A1
pGEM7Zf

pREGl727
pMFlOO

pJB40029

pJB40030

pMF3 .4

pDYSOO

pTH6-1

pDY503

pDY504

pDY509

pDY510

(cont’d)
Ap' laca

Apr Kmr Pl-inc attP 'lacZ

pREGl727 with -80 to +382 bp fi'agment of

(24403 DNA

pGEM7Zf with -101 to +155 bp fragment of

(24400 DNA

pREGl 727 with 256-bp XhaI-BamHI fi’agment

fi'om pJB40029

pUC19 with 04403 DNA from -230 to +3 82 bp

pGEM7Zf with -103 to +36 bp XbaI-chrI-II
fragment of (24403 DNA generated by PCR

pREGl727 with -103 to +36 bp XbaI-BamHI
fiagment of (24403 DNA generated by PCR

pDY500 with -86 to -49 bp of (24400 DNA firsed
to -48 to +36 bp of (24403 DNA

pREGl727 with 122-bp XbaI-BamI-II fragment

from pDY503

pGEM7waith -81 to .49 bp of 94403 DNA
fused to -48 to +155bp of (24400 DNA

pREGl 727with 236-bp XbaI-BamHI fragment

from pDY509

Promega

(F isseha et
al. 1996)

(F isseha et
al. 1996)

(Y oder and
Kroos
20043)

(Yoder and
Kroos
20043)

(F isseha et
al. 1996)

This study

(Hao 2001)

This study

This study

This study

This study

 

178

with overhanging ends compatible to those produced by XbaI and BsmBI restriction
digestion. The complementary oligonucleotides were synthesized by Macromolecular
Synthesis Facility at Michigan State University. After annealing as described above, the
oligonucleotides were ligated into pDYSOO, which had been previously digested with
XbaI and BsmBI. After transformation into E. coli DH50t, ampicillin transformants were
selected. A transformant with 3 recombinant plasmid was identified by PCR and the
structure of the resulting plasmid, designated pDY503, was verified by sequencing at the
Michigan State University Sequencing Facility. pDY503 was restricted with XbaI and
BamHI, and the insert was subcloned into pREGl 727 previously digested with the same
enzymes. The recombinant plasmid was verified by PCR and named pDY504.

In a similar manner, pDY509 containing a chimeric 4403/4400 promoter was
generated by annealing oligonucleotides corresponding to the -81 to -49 bp region of the
(24403 promoter. The fragment generated had overhanging ends compatible with those
produced by XbaI and EagI digestion, which were used to ligate the fi'agment into
pJB40029 previously digested with those enzymes. The ligation products were
transformed into DHSa and ampicillin-resistant transformants were selected.
Transformarrts were screened by PCR and sequenced at the Michigan State University
Sequencing Facility. The insert within pDY509 had the correct sequence for the chimeric
4403/4400 promoter and this insert was subcloned into pREGl727 previously digested
with XbaI and BamHI to form pDY510. The orientation of the insert in pDY510 was

verified using PCR.

179

 

Construction of M xanthus strains and determination of lacZ expression
during development. Strains containing pREGl 727 derivatives integrated at the Mx8
phage attachment site in the chromosome (designated attB in Table A1) were
constructed by electroporation (Kashefi and Hartzell 1995) of M xanthus strains DK1622
or DK5208 and selection for kanamycin-resistant transformants. Based on previous
experience in our laboratory (F isseha et al. 1996, Brandner and Kroos 1998, Fisseha et al.
1999, Hao et al. 2002, Viswanathan and Kroos 2003, Yoder and Kroos 2004b, 3), the vast
majority of transformants have a single copy of plasmid integrated at attB.
Developmental B-galactosidase activity of at least three transductants was measured as
described previously (Kroos et al. 1986) and, in all cases, the three transformants for a

given plasmid gave similar results.

180

RESULTS AND DISCUSSION

Chimeric promoters that swap upstream elements between 94403 and
94400. To determine the activity and C signal dependence of chimeric promoters that
swap upstream elements between two different C signal-dependent promoters, we fused
the (24403 upstream region (-81 bp to —49 bp) to the (24400 downstream region (-49 bp
to +155 bp) to construct 3 4403/4400 chimera and we fused the (24400 upstream region (-
86 bp to —49 bp) to the (24403 downstream region (-49 bp to +36 bp) to construct 3
4400/4403 chimera (Materials and Methods). The fusion point is described as position -
49 bp in both chimeric promoters but, in fact, the 04400 and (24403 promoters have the
identical sequence (CATCCCT) at the identical position (-52 bp to —46 bp) and this is
preserved in both chimeric promoters.

The 4403/4400 chimeric promoter exhibited a maximum B-galactosidase specific
activity of 15 :t 0.8 units in a wild-type background at 30 hours into development (Figure
A1). This level correlates to a two-fold decrease in the expression normally observed
from the (24403 promoter and a fifteen-fold decrease compared to wild-type Q4400
expression. Several explanations could account for this. This would be observed if a
putative activator(s) bound weakly to the upstream Q4403 promoter and was able to
interact, though poorly, with the RNA polymerase that normally binds the (24400
promoter. Alternatively, a putative activator that binds the upstream region of (24403
may weakly bind and recruit a form of RNA polymerase that may not normally bind to
the (24400 core promoter. A third explanation could be that the fission of 04403

upstream DNA and 04400 downstream DNA generated an artificial repressor site for a
1 8 l

Figure Al. Developmental activity of the 4403/4400 chimeric promoter. Developmental
B-galactosidase specific activity was measured for three independent transformants of the
4403/4400 chimeric promoter in the DK1622 wild-type background (O)(MDY510) or in
a csgA mutant background (MDY512) in the absence (A) or the presence (D) of an equal
number of wild-type DK1622 M xanthus cells. Strains carrying the (24403 promoter (-
80 to +3 82 bp) (I) (MPV100-2) or the vector without a promoter insert (0) (MDY1727)
were included as controls. Points show the average B-galactosidase specific activity in
nanomoles of a-nitrophenyl phosphate per minute per milligram of protein. Error bars

show 1 standard deviation of the data.

182

 

 

 

 

 

\q‘
“C"
. ..-

m-
,2
6

Time (Hr)

183

protein that does not normally bind to either of the two promoter regions but that is
expressed during development.

It is also interesting that the timing of expression fiom the 4403/4400 chimeric
promoter more closely resembles the timing of (24403 expression (Fig. A1) than 04400
expression (Fig. A2). This suggests that the upstream regulatory region dictates the
timing of expression.

In a csgA mutant background, the 4403/4400 chimeric promoter failed to be
expressed during development, suggesting a possible dependence on C-signaling (Figure
A1). However, co-development with wild-type cells did not restore developmental lacZ
expression fi'om the 4403/4400 chimera (Figure A1). Hence, the 4403/4400 chimeric
promoter did not respond to extracellular C-signaling, and may depend on csgA in a cell-
autonomous fashion. This is the first published report of 3 C-signal-dependent promoter
that cannot be rescued by the addition of wild-type cells. This could imply that the
4403/4400 chimera depends on an intracellular firnction of ngA rather than an
extracellular function. Another explanation could be that this chimeric promoter is less
responsive to C-signaling such that a 1:1 mixture of wild-type to csgA mutant cells is not
sufficient to rescue expression; however, a greater percentage of wild-type cells in the
mixture might be enough to restore expression.

The 4400/4403 chimeric promoter in a wild-type background expressed a
maximum B-galactosidase specific activity of 723 i 52 units at 24 hours into
development (Figure A2). This corresponds to a 2.7-fold increase in maximum activity
relative to the native Q4400 promoter and a greater than twenty-fold increase in

maximum activity relative to the native Q4403 promoter. One explanation for such an
1 84

Figure A2. Developmental activity of the 4400/4403 chimeric promoter. Developmental
B-galactosidase specific activity was measured for three independent transformants of the
4400/4403 chimeric promoter in the DK1622 wild-type background (9) (MDY504), or
in a csgA mutant background (MDY506) in the absence (A) or the presence (El) of an
equal number of wild-type DK1622 M xanthus cells. Strains carrying the 04400
promoter (-100 to +155 bp) (A) (JPB40030) or the vector without a promoter insert (0)
(MDY1727) were included as controls. Points show the average B-galactosidase specific
activity is expressed as nanomoles of a-nitrophenyl phosphate per minute per milligram

of protein. Error bars show 1 standard deviation of the data.

185

 

 

   
 

 

- q q a . 1 c d
U U 0 U 0 U U U U
D U U U 0 U 0 U
8 7 6 5 4 3 2 4"-

befioe 0&6on omemBoflew tn

‘ gnu-u
{10131.54
1 1 ,1] Y
J) otai

arts '05::
. 0
emf
e sped:
111’ £15

18 24 30 36 42 48
Time (Hr)

12

186

increase in expression could be that an activator bound to the (24400 upstream region and
was able to strongly recruit the RNA polymerase that transcribes the (24403 promoter or
that this activator recruits additional RNA polymerases that do not usually transcribe the
(24403 promoter. Another possibility is that the fusion of (24400 upstream DNA and
04403 downstream DNA disrupted the binding site of a repressor that represses
expression from the 04400 promoter. Indeed, there is an inverted repeat that spans fiom
-48 to -27 bp in the (24400 regulatory region that would not be firlly present in the
4400/4403 chimeric promoter. This could be the binding site of a dimeric protein, which,
when bound, obstructs binding of the RNA polymerase due to the proximity of the
binding site to the promoter -35 region. 1

The timing of expression of the 4400/4403 shows a sharp increase in lacZ
expression between 6 and 12 hours into development. This more closely resembles the
timing of the native Q4400 promoter (Fig. A2) than that of the native Q4403 promoter
(Fig. A1).

In a csgA mutant background, the 4400/4403 chimera retained high activity and
there was little change upon co-development with wild-type cells (Figure A2). We
conclude that the 4400/4403 chimera is a potent combination for driving developmental
transcription but does not exhibit dependence on C-signaling as was observed for the
promoters from which it was derived. The region between ~86 and -81 bp in the 04400
upstream region has been suggested as one element that confers the partial C-signal
dependence to this promoter but that other elements may be necessary (Y oder and Kroos

20043). The results of the 4400/4403 chimeric promoter confirm this hypothesis as the

187

addition of the upstream region of the 04400 promoter was not sufficient to confer C-
signal dependence on the 4400/4403 chimeric promoter. Perhaps another protein that
binds downstream of the C box centered at -49 bp (such as a repressor that may bind to
the inverted repeat between -48 and -27 bp or the sigma factor associated with RNA
polymerase that transcribes the native Q4400 promoter) also confers C-signal
dependence to the (24400 promoter.

We conclude that that the upstream regions of the (24400 and 04403 promoter
can drive expression from a different developmental core promoter. For both chimeric
promoters, we observed that the upstream region seems to dictate the level and timing of
developmental expression. Also for both chimeric promoters, the upstream regions did
not confer the C-signal dependence of the native promoter.

Our interpretation of this data is currently restricted by the lack of knowledge
about proteins that bind to the upstream elements and core promoter elements. We are

currently pursuing the identification of proteins that bind to specifically to the 04403 and

(24400 regulatory regions.

188

SUMMARY AND PERSPECTIVES

189

The goal of the research presented in this thesis was to explore and compare the
regulation of two developmental promoters, 04400 and (14499. When the genes that are
regulated by these promoters were interrupted by a transposon, neither insertion led to a
developmental defect under standard laboratory conditions. Both promoters depend
partially an extracellular C-signaling and are expressed starting at six hours into
development. Several conserved elements, which have been found to be essential when
associated with other developmental promoters, are present in the regulatory regions in
the (24400 and (24499 promoters. Taken together, this data implies that the 04400 and
Q4499 promoters are regulated in the same manner.

Two lines of evidence presented in this thesis support this hypothesis. Both
promoters contain two regulatory elements upstream of the core promoters: one small
element upstream and one larger element. For both the (24400 and (24499 regulatory
regions, the large element is absolutely essential for expression and the small element
exerts a two- to four-fold effect on expression. Additionally, expression fi'om both
promoters is reduced by a mutation in the M xwrthus sigE gene.

Several lines of evidence presented in this thesis do not support the hypothesis
that the (24400 and (24499 promoters are regulated in the same manner. Mutations in the
individual base pairs of conserved C box element and in the base pairs adjacent to the
conserved 5-bp element in both promoters yielded a very difl‘erent pattern of effects. The
effect of a sigD mutation on (24400 and (24499 promoter expression was also different.
In the case of the (24400 promoter, the region between -86 and -81 confers at least, in

part, the dependence on C-signaling; however, in the case of the (24499, the upstream

190

element did not appear to confer the C-signal dependence. The region between -86 and -
77 bp in the 04400 regulatory region is bound by FruA at 18 hours into development
based on in vitra and in viva experiments while there is no evidence that 04499 is bound
by F ruA in vitra. Indeed, a putative binding site based on the consensus sequence
generated in chapter four cannot be found in the 04499 regulatory region. Thus, it seems
likely that the 04400 and (24499 promoters are regulated differently.

The foundation for finding treats-acting factors that regulate Q4400 promoter
expression has been laid with the discovery that FruA binds during development. Further
studies will focus on identifying new transcription factors that bind to both the 04400
and Q4499 promoters. One candidate that could be tested is the or C-terminal domain
(aCTD) of RNA polymerase, which has been shown to bind to regions known as UP
elements that lie in the regulatory regions of ribosomal RNA genes. As the essential
regulatory regions for both the 04400 and Q4499 promoters sit adjacent (and maybe
overlap) the promoter ~35 region, atCTD binding and activation may be a strong
possibility.

Another method to identify potential transcription factors is to use a transposon in
a genetic screen to look for insertions that lead to a loss or gain in expression during
development. A mutagenesis protocol has been developed for M xanthus using the mini-
himw transposon and has been used to identify regulators that bind to the promoters of
early developmental genes. It currently being used in the Kroos lab to look for additional
regulators of 04400 expression.

To identify regulators of the dev operon, a technique has been developed in the

191

Kroos lab that utilizes an protein fraction prepared fi'om developmental cells (devAS) to
bind oligonucleotides corresponding to the regulatory region of interest. Bound proteins
are collected and subjected to mass spectrometry for identification. This technique can
be adapted to identify regulators of the (24499 and (24400 promoters. There is some
evidence that this method will work successfirlly with the (24400 regulatory region.
Mutant Q4400 probes (such as those used in chapter four) are not bound equally by the
devAS fraction. A probe containing a mutation from -63 to -60 bp is not bound by this
protein fraction suggesting that a component of the devAS fraction may selectively bind
to the 5-bp element.

Regardless of how the transcription factors are identified, null mutations in the
genes encoding them should be made to verify that 04400 and (24499 promoter
expression is increased or abolished. The final goal of this research will be to
reconstitute transcription in vitro using purified transcription factors identified by these
various methods. The results from these experiments will help elucidate one more step in
the transcriptional regulatory network in M xanthus development.

Another gap in our knowledge involves the function of proteins that are encoded
by genes that are expressed during development, but, when mutated, show no
developmental defect under the standard laboratory conditions. These genes, including
the genes interrupted by the (14400, 04403, and (24499 insertions, may provide valuable
insight into the molecular events that occur during C-signaling. One hypothesis is that
these genes are expressed as a part of a general stress mechanism in M xanthus.
Expression fiom these promoters could be tested under a variety of conditions, such as

hot and cold shock, oxygen limitation, ultraviolet irradiation, changes in pH, stationary
192

phase growth, and dessication. Another possibility is that standard laboratory conditions
do not accurately represent environmental conditions. Ifthis is the case, perhaps
developmental defects would be observed in strains bearing the 04400, (24403, or
(24499 insertions under conditions that more closely mimic actual environmental
conditions. Understanding the function of these genes would greatly enhance our

knowledge of how M xanthus develops.

193

REFERENCES

194

REFERENCES

Apelian, D., and S. Inouye. 1990. Development-specific o-factor essential for late-stage
differentiation of Myxacaccus xanthus. Genes Dev. 4: 1396-1403.

Apelian, D., and S. Inouye. 1993. A new putative sigma factor of Myxacaccus xanthus. J.
Bacteriol. 175:3335-3342.

Baker, M. E. 1994. Wacaccus xanthus C-factor, 3 morphogenetic paracrine signal, is
similar to Escherichia coli 3-oxoacyl-[acyl-carrier-protein] reductase and human
17B-hydroxysteroid dehydrogenase. Biochem. J. 301 :3 1 1-3 12.

Barreaud, J. P., S. Bourgerie, R Julien, J. F. Guespin-Michel, and Y. Karamanos. 1995.
An endo-N-acetyl-bet3-D-glucosaminidase, acting on the di-N-acetylchitobiosyl
part of N-linked glycans, is secreted during sporulation of thxacaccus xanthus. J
Bacteriol 177:916-920.

Bender, H. 1963. [Studies on Myxacaccus xanthus. II. Partial lysis of Pullularia pullulans
and some true yeasts by an extracellular enzyme system]. Arch Mikrobiol
45:407-422.

Biran, D., and L. Kroos. Unpublished data.

Biran, D., and L. Kroos. 1997. In vitra transcription of Myxacaccus xanthus genes with
RNA polymerase containing 0A, the major sigma factor in growing cells. Mol.
Microbiol. 25:463-472.

Blackhart, B. D., and D. R. Zusman. 1985. "Frizzy" genes of Myxacaccus xanthus are
involved in control of fi'equency of reversal of gliding motility. Proc. Natl. Acad.
Sci. USA 82:8767-8770.

Bourgerie, S., Y. Karamanos, T. Grard, and R. Julien. 1994. Purification and
characterization of an endo-N-acetyl-beta-D-glucosaminidase from the culture
medium of Stigmatella aurantiaca DW4. J Bacteriol 176:6170-6174.

Boysen, A., E. Ellehauge, B. Julien, and L. Sagaard-Andersen. 2002. The DevT protein
stimulates synthesis of F ruA, a signal transduction protein required for fi'uiting
body morphogenesis in Myxacaccus xanthus. J Bacteriol 184: 1540-1546.

Bradford, M. 1976. A rapid and sensitive method for the quantitation of microgram

quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem.
72:248-254.

195

Brandner, J. P., and L. Kroos. 1998. Identification of the 04400 regulatory region, a
developmental promoter of Maracaccus xanthus. J. Bacteriol. 180: 1995-2004.

Browning, D., N. Khoshkhoo, and D. Hodgson. 1997 . CarQ is a sigma factor, CarR is an
inner membrane protein of Myxacaccus xanthus and CarS appears not to be a
DNA binding protein, p. 2. In Abstracts of the 24th Annual Meeting an the
Biology of the Myxobacteria.

Busby, S., and R H. Ebright. 1999. Transcription activation by catabolite activator
protein (CAP). J Mol Biol 293: 199-213.

Bustamante, V. H., I. Martinez-Flares, H. C. Vlamakis, and D. R Zusman. 2004.
Analysis of the F rz signal transduction system of vaacaccus xanthus shows the
importance of the conserved C-terminal region of the cytoplasmic chemoreceptor
FrzCD in sensing signals. Mal Microbial 53: 1501-1513.

Caberoy, N. B., R. D. Welch, J. S. Jakobsen, S. C. Slater, and A. G. Garza. 2003. Global
mutational analysis of NtrC-like activators in Myxacaccus xanthus: identifying
activator mutants defective for motility and fi'uiting body development. J
Bacteriol 18526083-6094.

Campos, J. M., and D. R Zusman. 1975. Regulation of the development in Myxacaccus
xanthus: effect of 3' : 5'-cyclic AMP, ADP, and nutrition. Proc. Natl. Acad. Sci.
USA 72:518-522.

Cheng, Y., and D. Kaiser. 19893. dsg , a gene required for Myxacaccus development, is
necessary for cell viability. J. Bacteriol. 17123727-3731.

Cheng, Y., and D. Kaiser. 1989b. dsg, a gene required for cell-cell interaction early in
Myxacaccus development. J. Bacteriol. 17123719-3726.

Cheng, Y. L., L. Kalman, and D. Kaiser. 1994. The dsg gene of Myxacaccus xanthus
encodes a protein similar to translation initiation factor IF3. J. Bacterial.
17621427-1433.

Cho, K., and D. R. Zusman. 1999. AsgD, a new two-component regulator required for A-
signaling and nutrient sensing during early development of Myxacaccus xwrthus.
Mal Microbial 34:268-281.

Crawford, E. W., and L. J. Shimkets. 2000. The stringent response inMyxacaccus

xanthus is regulated by SacE and the ngA C-signaling protein. Genes Dev.
14:483-492.

196

Cusick, J. K., E. Hagar, and R. E. Gill. 2002. Characterization of bcsA mutations that
bypass two distinct signaling requirements for Myxacaccus xanthus development.
J Bacterial 184:5141-5150.

Davis, J ., J. Mayor, and L. Plamann. 1995. A missense mutation in rpaD results in an A-
signaling defect in vaacaccus xanthus. Mol. Microbiol. 181943 -952.

Downard, J., and L. Kroos. 1993. Transcriptional regulation of developmental gene
expression in Myxacaccus xanthus. Pages 183-199 in M. Dworkin and D. Kaiser,
editors. Myxobacteria II. American Society for Microbiology, Washington, DC.

Downard, J., S. V. Rarnaswamy, and K. Kil. 1993. Identification of esg, a genetic locus
involved in cell-cell signaling during Myxacaccus xanthus development. J.
Bacterial. 175:7762-7770.

Downard, J. S., and D. R Zusman. 1985. Differential expression of protein S genes
during Myxacaccus xanthus development. J. Bacterial. 161:1 146-1 155.

Dworkin, M. 1973. Cell-cell interactions in the myxobacteria. Pages 125-142 in J. M.
Ashwarth and J. E. Smith, editors. Microbial Differentiation Cambridge
University Press, Cambridge.

Dworkin, M. 1996. Recent advances in the social and developmental biology of the
myxobacteria. Microbial. Rev. 60:70-102.

Dworkin, M., and S. M. Gibson. 1964. A System for Studying Microbial Morphogenesis:
Rapid Formation of Micracysts in Myxacaccus xanthus. Science 146:243-244.

Dworkin, M., and D. J. Niederpruem. 1964. Electron Transport System in Vegetative
Cells and Micracysts of Myxacaccus xmrtlms. J Bacteriol 87 :3 16-322.

Dworkin, M., and W. Sadler. 1966. Induction of cellular morphogenesis in Myxacaccus
xanthus. I. General description. J Bacterial 91: 1 5 1 6-15 19.

Ellehauge, E., M. Norregaard—Madsen, and L. Sogaard-Andersen. 1998. The FruA signal
transduction protein provides a checkpoint for the temporal coordination of
intercellular signals in Myxacaccus xanthus development. Mal. Microbial.
30:807-817.

Fisseha, M., D. Biran, and L. Kroos. 1999. Identification of the (24499 regulatory region

controlling developmental expression of a Myxacaccus xanthus cytochrome P—450
system. J Bacterial 181:5467-5475.

197

Fisseha, M., M. Giaudemans, R. Gill, and L. Kroos. 1996. Characterization of the
regulatory region of a cell interaction-dependent gene in Alyxacaccus xanthus. J.
Bacteriol. 178:2539-2550.

F antes, M., and D. Kaiser. 1999. Myxacaccus cells respond to elastic forces in their
substrate. Prac Natl Acad Sci U S A 96:8052-8057.

Garza, A. G., B. Z. Harris, B. M. Greenberg, and M. Singer. 20003. Control of ang
expression during growth and development of Myxacaccus xanthus. J Bacterial
182:6622-6629.

Garza, A G., B. Z. Harris, J. S. Pollack, and M. Singer. 2000b. The ang locus is
required for cell-cell signalling during Myxacaccus xanthus development. Mol
Microbiol 35:812-824.

Garza, A G., J. S. Pollack, B. Z. Harris, A Lee, I. M. Keseler, E. F. Licking, and M.
Singer. 1998. SdeK is required for early fi'uiting body development in
Myxacaccus xanthus. J. Bacteriol. 180:4628-4637.

Geisselsoder, J., J. M. Campos, and D. R Zusman. 1978. Physical characterization of
bacteriophage Mx4, a generalized transducing phage for Myxacaccus xanthus. J.
Mol. Biol. 119:179-189.

Gill, R E., and M. C. Barnemann. 1988. Identification and characterization of the
Myxacaccus xanthus bsgA gene product. J. Bacterial. 170:5289-5297.

Gill, R. E., and M. G. Cull. 1986. Control of developmental gene expression by cell-ta-
cell interactions in Myxacaccus xanthus. J. Bacterial. 168:341-347.

Gill, R E., M. G. Cull, and S. Fly. 1988. Genetic identification and cloning of a gene
required for developmental cell interactions in Myxacaccus xanthus. J. Bacteriol.
170:5279-5288.

Gill, R E., M. Karlak, and D. Benton. 1993. Myxacaccus xanthus encodes an ATP-
dependent protease which is required for developmental gene transcription and
intercellular signaling. J. Bacteriol. 175:4538-4544.

Garharn, H., S. McGowan, P. Robson, and D. Hodgson. 1996. Light-induced
carotenagenesis in Myxacaccus xanthus: light-dependent membrane
sequestration of ECF sigma factor CarQ by anti-sigma factor CarR Mol.
Microbiol. 19:171-186.

Gronewold, T. M., and D. Kaiser. 2001. The act operon controls the level and time of C-
signal production for Myxacaccus xanthus development. Mal Microbial 40:744-
7 56.

198

Gronewold, T. M., and D. Kaiser. 2002. act operon control of developmental gene
expression in Myxacaccus xanthus. J. Bacteriol. 184:1 172-1 179.

Gulati, P., D. Xu, and H. Kaplan. 1995. Identification of the minimum regulatory region
of a Myxacaccus xanthus A-signal-dependent developmental gene. J. Bacterial.
177 :4645-465 1 .

Hagen, D. C., A P. Bretscher, and D. Kaiser. 1978. Synergism between morphogenetic
mutants of Myxacaccus xanthus. Dev. Biol. 64:284-296.

Hager, E., H. Tse, and R E. Gill. 2001. Identification and characterization of sde
mutations that bypass the BsgA protease-dependent regulation of developmental
gene expression in Myxacaccus xanthus. Mol Microbiol 39:765-7 80.

Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol.
Biol. 166:557.

Hao, T. 2001. Characterization of regulatory mechanism of cell-cell interaction-
dependent genes of Myxacaccus xanthus. Michigan State Univeristy, East
Lansing.

Haa, T., D. Biran, G. J. Velicer, and L. Kroos. 2002. Identification of the 04514
regulatory region, a developmental promoter of Myxacaccus xanthus that is
transcribed in vitra by the major vegetative RNA polymerase. J Bacteriol
18423348-3359.

Harlow, E., and D. Lane. 1988. Antibodies. Cold Spring Harbor Laboratory, Cold Spring
Harbor, NY.

Harris, B. Z., D. Kaiser, and M. Singer. 1998. The guanosine nucleotide (p)ppGpp
initiates development and A-factar production in Myxacaccus xanthus. Genes
Dev. 12:1022-1035.

Hartzell, P., and D. Kaiser. 19913. Function of MglA, 3 22-kilodalton protein essential
for gliding in Myxacaccus xwrthus. J. Bacteriol. 173:7615-7624.

Hartzell, P., and D. Kaiser. 1991b. Upstream gene of the mg! operon controls the level of
MglA protein in Myxacaccus xanthus. J. Bacterial. 173:7625-7635.

Henkin, T. M., and C. Yanofsky. 2002. Regulation by transcription attenuation in

bacteria: haw RNA provides instructions for transcription
termination/antitermination decisions. Bioessays 24:700-707.

199

Hoclr, J. A, and T. J. Silhavy. 1995. Two Component Signal Transduction. American
Society for Microbiology, Washington, DC.

Hodgkin, J., and D. Kaiser. 1977. Cell-to-cell stimulation of motility in nonmatile
mutants of Myxacaccus. Proc. Natl. Acad. Sci. USA 74:2938-2942.

Hodgkin, J ., and D. Kaiser. 1979b. Genetics of Gliding Motility in Myxacaccus xanthus
(Myxobacterales): Two Gene Systems Control Movement. Mol. Gen. Genet.
171:177-191.

Horiuchi, T., T. Akiyama, S. Inouye, and T. Kamano. 20023. Analysis of dofA, afiuA-
dependent developmental gene, and its homologue, dajB, in Myxacaccus xanthus.
J Bacterial 184:6803-6810.

Horiuchi, T., T. Akiyama, S. Inouye, and T. Kamano. 2003. Regulation of FruA
expression during vegetative growth and development of Myxacaccus xanthus. J
Mol Microbial Biotechnol 5:87-96.

Horiuchi, T., M. Taoka, T. Isabe, T. Kamano, and S. Inouye. 2002b. Role of fiuA and
csgA genes in gene expression during development of Myxacaccus xanthus.
Analysis by two-dimensional gel electrophoresis. J Biol Chem 277 :26753-26760.

Igoshin, O. A., A. Goldbeter, D. Kaiser, and G. Oster. 2004. A biochemical oscillator
explains several aspects of Myxacaccus xanthus behavior during development.
Proc Natl Acad Sci U S A 101:15760-15765.

Inouye, M., S. Inouye, and D. R Zusman. 1979. Biosynthesis and self-assembly of
protein S, a development-specific protein of Myxacaccus xtmthus. Proc. Natl.
Acad. Sci. USA 76:209-213.

Inouye, S. personal communication.

Inouye, S. 1990. Cloning and DNA sequence of the gene coding for the major sigma
factor fi'om Myxacaccus xanthus. J. Bacteriol. 172280-85.

Jelsbak, L., and L. Sogaard-Andersen. 1999. The cell surface-associated intercellular C-
signal induces behavioral changes in individual Myxacaccus xanthus cells during
fi'uiting body morphogenesis. Proc Natl Acad Sci U S A 96:5031-5036.

Jelsbak, L., and L. Sogaard-Andersen. 2002. Pattern formation by a cell surface-
associated morphogen in A/Iyxacaccus xanthus. Proc Natl Acad Sci U S A
99:2032-2037.

Kaiser, D. 1979. Social gliding is correlated with the presence of pili in Myxacaccus
xanthus. Proc. Natl. Acad. Sci. USA 76:5952-5956.

200

Kaiser, D. 1984. Genetics of myxobacteria. Pages 163-184 in E. Rosenberg, editor.
Myxobacteria, development and cell interactions. Springer-Verlag, New York.

Kaiser, D. 2003. Coupling cell movement to multicellular development in myxobacteria.
Nat Rev Microbiol 1:45-54.

Kaiser, D. 2004. Signaling in myxobacteria. Annu Rev Microbiol 58:75-98.

Kaiser, D., and C. Crosby. 1983. Cell movement and its coordination in swarms of
Myxacaccus xanthus. Cell Motil. 3:227-245.

Kaiser, D., and L. Kroos. 1993. Intercellular signaling. Pages 257-284 in M. Dworkin and
D. Kaiser, editors. Myxobacteria II. Amer. Soc. for Microbial, Washington, DC.

Kaiser, D., and R Welch. 2004. Dynamics of fi'uiting body morphogenesis. J Bacteriol
186:919-927.

Kalos, M., and J. F. Zissler. 1990. Defects in contact-stimulated gliding during
aggregation by Myxacaccus xanthus. J. Bacteriol. 17216476-6493.

Kaplan, H. B. 2003. Multicellular development and gliding motility in Alyxacaccus
xanthus. Curr Opin Microbial 6:572-577.

Kaplan, H. B., A Kuspa, and D. Kaiser. 1991. Suppressors that permit A-signal-
independent development gene expression in Myxacaccus xanthus. J. Bacteriol.
173: 1460-1470.

Kaplan, H. B., and L. Plamann. 1996. AMyxacaccus xanthus cell density-sensing system
required for multicellular development. FEMS Microbiol Lett 139:89-95.

Kashefi, K., and P. Hartzell. 1995. Genetic supression and phenotypic masking of a
Myxacaccus xanthuxfrzF' defect. Molec. Microbial. 15:483-494.

Kearns, D. B., A Venot, P. J. Bonner, B. Stevens, G. J. Boons, and L. J. Shimkets. 2001.
Identification of a developmental chemoattractant in Myxacaccus xanthus through
metabolic engineering. Proc Natl Acad Sci U S A 98: 13990-13994.

Keseler, I., and D. Kaiser. 1995. An early A-signal-dependent gene in Myxacaccus
xanthus has a o54—1ike promoter. J. Bacteriol. 177:4638-4644.

Keseler, 1., and D. Kaiser. 1997. a”, a vital protein for Myxacaccus xanthus. Proc. Natl.
Acad. Sci. USA 94: 1979-1984.

201

Kim, S. K., and D. Kaiser. 19903. Cell alignment required in differentiation of
Myxacaccus xanthus. Science 249:926-928.

Kim, S. K., and D. Kaiser. 1990b. Cell motility is required for the transmission of C-
factor, an intercellular signal that coordinates fi'uiting body morphogenesis of
Mfyxacaccus xanthus. Genes Dev. 4:896-905.

Kim, S. K., and D. Kaiser. 1990c. C-factor: a cell-cell signaling protein required for
fi'uiting body morphogenesis of M xanthus. Cell 61:19-26.

Kim, S. K., and D. Kaiser. 1990d. Purification and properties of Myxacaccus xanthus C-
factor, an intercellular signaling protein. Proc. Natl. Acad. Sci. USA 87 :3635-
3639.

Kim, S. K., and D. Kaiser. 1991. C-factor has distinct aggregation and sporulation
thresholds during Myxacaccus development. J. Bacteriol. 173:1722-1728.

Kirby, J. R, and D. R. Zusman. 2003. Chemosensory regulation of developmental gene
expression in Myxacaccus xanthus. Prac Natl Acad Sci U S A 100:2008-2013.

Kroos, L. 1986. Ph.D. thesis (Stanford University, Stanford, CA).

Kroos, L., P. Hartzell, K. Stephens, and D. Kaiser. 1988. A link between cell movement
and gene expression argues that motility is required for cell-cell signaling during
fi'uiting body development. Genes Dev. 2: 1677-1685.

Kroos, L., and D. Kaiser. 1984. Construction of Tn5 lac, a transposon that fuses lacZ
expression to exogenous promoters, and its introduction into Myxacaccus
xanthus. Proc. Natl. Acad. Sci. USA 81:5816—5820.

Kroos, L., and D. Kaiser. 1987. Expression of many developmentally regulated genes in
Myxacaccus depends on 3 sequence of cell interactions. Genes Dev. 1:840-854.

Kroos, L., A Kuspa, and D. Kaiser. 1986. A global analysis of developmentally
regulated genes in Myxacaccus xanthus. Dev. Biol. 117:252-266.

Kruse, T., S. Lobedanz, N. M. Berthelsen, and L. Sogaard-Andersen. 2001. C-signal: a
cell surface-associated morphogen that induces and co-ordinates multicellular
fruiting body morphogenesis and sporulation in Myxacaccus xanthus. Mol
Microbiol 40: 156-168.

Kuspa, A, and D. Kaiser. 1989. Genes required for developmental signaling in
Myxacaccus xanthus: three asg loci. J. Bacteriol. 171:2762-2772.

202

Kuspa, A, L. Kroos, and D. Kaiser. 1986. Intercellular signaling is required for
developmental gene expression in Myxacaccus xtmthus. Dev. Biol. 117:267-276.

Kuspa, A, L. Plamann, and D. Kaiser. 19923. Identification of heat-stable A-factor from
Myxacaccus xanthus. J. Bacteriol. 174:3319-3326.

Kuspa, A, L. Plamann, and D. Kaiser. 1992b. A-signaling and the cell density
requirement for Myxacaccus xanthus development. J. Bacteriol. 174:7360-7369.

Lancero, H., N. B. Caberoy, S. Castaneda, Y. Li, A Lu, D. Dutton, X. Y. Duan, H. B.
Kaplan, W. Shi, and A. G. Garza. 2004. Characterization of aMyxacaccus
xanthus mutant that is defective for adventurous motility and social motility.
Microbiology 15024085-4093.

LaRossa, R, J. Kuner, D. Hagen, C. Manoil, and D. Kaiser. 1983. Developmental cell
interactions of Myxacaccus xanthus: analysis of mutants. J. Bacteriol. 153:1394-
1404.

Lee, B., K. Lee, J. Robles, and L. J. Shimkets. 19953. Developmental C-signaling of
Myxacaccus xanthus involves an extracellular NAD(P)-containing protein. Abstr.
of the 22nd Intl. Conf. on the Biol. of the Myxobacteri3224.

Lee, B.-U., K. Lee, J. Mendez, and L. Shimkets. 1995b. A tactile sensory system of
Myxacaccus xanthus involves an extracellular NAD(P)+-cont3ining protein.
Genes Dev. 9:2964-2973.

Lee, K., and L. Shimkets. 1994. Cloning and characterization of the sacA locus which
restores development to Myxacaccus xanthus C-signaling mutants. J. Bacteriol.
176:2200-2209.

Lee, K., and L. Shimkets. 1996. Suppression of a signaling defect during Myxacaccus
xanthus development. J. Bacteriol. 178: 977-984.

Li, S.-F., B. Lee, and L. J. Shimkets. 1992. csgA expression entrains Myxacaccus xanthus
development. Genes Dev. 6:401-410.

Li, S.-F., and L. J. Shimkets. 1993. Effect of lira mutations on the cell-to-cell
transmission of ngA in Myxacaccus xanthus. J. Bacteriol. 175:3648-3652.

Li, Y., H. Sun, X. Ma, A Lu, R. Lux, D. Zusman, and W. Shi. 2003. Extracellular

polysaccharides mediate pilus retraction during social motility of vaacaccus
xanthus. Proc Natl Acad Sci U S A 100:5443-5448.

203

Licking, E., L. Gorski, and D. Kaiser. 2000. A common step for changing cell shape in
fruiting body and starvation-independent sporulation of Myxacaccus xanthus. J
Bacteriol 182:3553-3558.

Lisser, S., and H. Margalit. 1993. Compilation of E. coli mRN A promoter sequences.
Nucleic Acids Res. 21: 1507-1516.

Lobedanz, S., and L. Sogaard-Andersen. 2003. Identification of the C-signal, a contact-
dependent morphogen coordinating multiple developmental responses in
Alyxacaccus xanthus. Genes Dev 17:2151-2161.

Manoil, C., and D. Kaiser. 1980. Accumulation of guanosine tetraphosphate and
guanosine pentaphosphate in Myxacaccus xanthus during starvation and
myxospore formation. J. Bacteriol. 141:297-304.

Mayer, H., and H. Reichenbach. 1978. Restriction endonucleases: general survey
procedure and survey of gliding bacteria. J Bacteriol 136:708-713.

Mayo, K. A, and D. Kaiser. 1989. asgB, a gene required early for developmental
signalling, aggregation, and sporulation of Wacaccus xanthus. Mol. Gen. Genet.
218:409-418.

McBride, M. J ., R. A. Weinberg, and D. R Zusman. 1989. "Frizzy" aggregation genes of
the gliding bacterium Myxacaccus xanthus show sequence similarities to the
chemotaxis genes of enteric bacteria. Proc. Natl. Acad. Sci. USA 86:424-428.

McCleary, W. R, and D. R. Zusman. 1990. Purification and characterization of the
Myxacaccus xanthus FrzE protein shows that it has autophosphorylation activity.
J Bacteriol 172:6661-6668.

Nierman, W. C., D. Kaiser, S. Slater, A S. Durkin, J. Eisen, J. Jakobsen, C. Ronning, L.
J. Shimkets, J. Varnathevan, R Welch, T. H. Adams, M. S. Avadhani, W. B.
Barbazuk, M. Blanchard, W. P. Black, H. B. Bode, P. Bonner, L. Brinkac, J. M.
Buchner, V. Bustamante, A Castaneda-Garcia, M. Chavira, A. Clement, P.
Curtis, S. C. Daugherty, T. Davidsen, R T. DeBoy, M. Diodati, R J. Dodson, X.
Y. Duan, T. V. Feldblyum, C. Field, A Garza, R E. Gill, V. Grinberg, M. L.
Gwinn, D. Halt, J. C. Haller, C. Hailing, P. Hartzell, P. Higgs, G. Hinkle, D. A.
Hodgson, O. Iartchuk, S. Inouye, L. Jelsbak, B. Julien, A. C. Karls, H. S. Kim, J.
Kirby, L. Kroos, Y. Li, A Lu, R Lux, X. Ma, C. Mackenzie, R Madupu, N.
Miller, R Muller, J. Munoz-Dorado, H. Nariya, W. C. Nelson, J. Pérez, V. Pham,
J. Ravel, R Reid, F. Riggs, J.J. Riveral4, M.J. Rosovitzl, J. Selengutl, W. Shi12,
A. Shvartsbeyn, M. H. Singer, L. Sogaard-Andersen, D. Srinivasan, B. Stark, S.
Sullivan, A. Truener-Lange, L. Tzeng, M. Vaudin, P. Vrswanathan, R Weigand,
0. White, D. E. Whitworth, Z. Yang, D. R Yoder, R Yu, N. Zafer, L. Zhou, D.

204

R Zusman, C. M. Fraser, B. S. Goldman, and H. B. Kaplan. Myxobacteria,
decyphering multicellular development in a predator. Science. Submitted.

O'Connor, K. A, and D. R Zusman. 1988. Reexamination of the role of autolysis in the
development of vaacaccus xanthus. J Bacteriol 170:4103-4112.

O'Connor, K. A, and D. R Zusman. 19913. Analysis of Myxacaccus xanthus cell types
by two-dimensional polyacrylamide gel electrophoresis. J Bacteriol 173:3334—
3341.

O'Connor, K. A, and D. R Zusman. 1991b. Development in Myxacaccus xanthus
involves differentiation into two cell types, peripheral rods and spares. J Bacteriol
173:3318-3333.

Ogawa, M., S. Fujitani, X. Mac, S. Inouye, and T. Kamano. 1996. FruA, a putative
transcription factor essential for the development of Myxacaccus xanthus. Mol.
Microbiol. 22:757-767.

Plamann, L., A. Kuspa, and D. Kaiser. 1992. Proteins that rescue A—signal-defective
mutants of Myxacaccus xanthus. J. Bacteriol. 1742331 1-3318.

Plamann, L., Y. Li, B. Carrtwell, and J. Mayor. 1995. The Myxacacws xanthus asgA gene
encodes a novel signal transduction protein required for multicellular
development. J. Bacteriol. 177:2014-2020.

Pollack, J. S., and M. Singer. 2001. SdeK, a histidine kinase required for Myxocaccus
xanthus development. J Bacteriol 183:3589-3596.

Ptashne, M. 1992. A genetic switch. Blackwell Scientific Publications, Cambridge, MA

Ramsey, W. S., and M. Dworkin. 1968. Microcyst germination in Myxocaccus xanthus. J
Bacteriol 95:2249-2257.

Reichenbach, H. 1965. Rhythmische vorange bei der schwarmentfaltung von
Myxobacterien. Ber. Deutsch Bot. Ges. 78:102-105.

Reichenbach, H., and M. Dworkin. 1992. The Myxobacteria. Pages 3416-3487 in A
Balows, M. Dworkin, H. G. Truper, W. Harder, and K. H. Schleifer, editors. The
Prokaryotes. Springer Verlag, New York.

Reitzer, L. J ., and B. Magasanik. 1986. Transcription of glnA in E. coli is stimulated by
activator bound to sites far from the promoter. Cell 45:785-792.

205

Rhodius, V., D. West, C. Webster, S. Busby, and N. Savery. 1997 . Transcription
activation at class H CRP-dependent promoters: the role of different activating
regions. Nucleic Acids Res 25:326-332.

Romeo, J. M., and D. R Zusman. 1991. Transcription of the myxobacteria]
hemagglutinin gene is mediated by a 654-like promoter and a cis-acting upstream
regulatory region of DNA. J. Bacteriol. 173:2969-2976.

Rosenberg, E., K. H. Keller, and M. Dworkin. 1977 . Cell density-dependent growth of
Myxacaccus xanthus on casein. J Bacteriol 129:770-77 7.

Rosenblulr, A, R Nir, E. Sahar, and E. Rosenberg. 1989. Cell-density-dependent lysis
and sporulation of Myxacaccus xanthus in agarose microbeads. J Bacteriol
171:4923-4929.

Ross, W., A Ernst, and R L. Gourse. 2001. Fine structure of E. coli RNA polymerase-
promoter interactions: alpha subunit binding to the UP element minor groove.
Genes Dev 15:491-506.

Ross, W., K. K. Gosink, J. Salomon, K. Igarashi, C. Zou, A Ishihama, K. Severinov, and
R L. Gourse. 1993. A third recognition element in bacterial promoters: DNA
binding by the alpha subunit of RNA polymerase. Science 262: 1407-1413.

Sadler, W., and M. Dworkin. 1966. Induction of cellular morphogenesis in Myxacaccus
xamthus. II. Macromolecular synthesis and mechanism of inducer action. J
Bacteriol 91: 1520-1525.

Sager, B., and D. Kaiser. 1994. Intercellular C-signaling and the traveling waves of
Myxacaccus. Genes Dev. 8:2793-2804.

Sambrook, J ., E. Fritsch, and T. Maniatis. 1989. Molecular Cloning: a laboratory
manual, second edition. Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, New York.

Shimkets, L., and C. R. Woese. 1992. A phylogenetic analysis of the myxobacteria: basis
for their classification. Proc Natl Acad Sci U S A 89:9459-9463.

Shimkets, L. J. 1999. Intercellular signaling during fi'uiting-body development of
Myxacaccus xanthus. Annu Rev Microbiol 53:525-549.

Shimkets, L. J ., and S. J. Asher. 1988. Use of recombination techniques to examine the
structure of the csg locus of Myxacaccus xanthus. Mol. Gen. Genet. 211 :63-71.

206

Shimkets, L. J ., R E. Gill, and D. Kaiser. 1983. Developmental cell interactions in
ll/Iyxacaccus xanthus and the spaC locus. Proc. Natl. Acad. Sci. USA 80: 1406-
1410.

Shimkets, L. J ., and D. Kaiser. 1982. Induction of coordinated movement of Myxacaccus
xanthus cells. J. Bacteriol. 1522451-461.

Shimkets, L. J., and H. Rafiee. 1990. ngA, an extracellular protein essential for
Myxacaccus xanthus development. J. Bacteriol. 172:5299-5306.

Smith, T. F., C. Gaitatzes, K. Saxena, and E. J. Neer. 1999. The WD repeat: a common
architecture for diverse firnctions. Trends Biochem Sci 24: 181-185.

Sogaard-Andersen, L. personal communication.

Sogaard-Andersen, L., and D. Kaiser. 1996. C factor, a cell-surface-associated
intercellular signaling protein, stimulates the cytoplasmic Frz signal transduction
system in Myxacaccus xanthus. Proc. Natl. Acad. Sci. U S A 93:2675-2679.

Sogaard-Andersen, L., M. Overgaard, S. Lobedanz, E. Ellehauge, L. Jelsbak, and A A.
Rasmussen. 2003. Coupling gene expression and multicellular morphogenesis
during fruiting body formation in Myxacaccus xanthus. Mol Microbiol 48: 1-8.

Sogaard-Andersen, L., F. Slack, H. Kimsey, and D. Kaiser. 1996. Intercellular C-
signaling in Myxacaccus xanthus involves a branched signal transduction
pathway. Genes Dev. 10:740-754.

Sorhaug, T. 1974. Glycerol ester hydrolase, lipase, of Myxacaccus xanthus FB. Can J
Microbiol 20:611-615.

Srinivasan, D., and L. Kroos. 2004. Mutational analysis of the firm promoter region
demonstrates that C-Box and 5-base-pair elements are important for expression of
an essential developmental gene of Myxacaccus xanthus. J Bacteriol 186:5961-
5967.

Stephens, K., P. Hartzell, and D. Kaiser. 1988. Gliding motility in Axlyxocaccus xanthus :
mg] locus, RNA and predicted protein products. J. Bacteriol. 171:819-830.

Sudo, S., and M. Dworkin. 1972. Bacteriolytic enzymes produced by Myxacaccus
xrmthus. J Bacteriol 110:236-245.

Sun, H., and W. Shi. 2001. Genetic studies of mp, a locus essential for cellular
aggregation and sporulation of Myxacaccus xanthus. J Bacteriol 183:4786-4795.

207

Thomasson, B., J. Link, A. G. Stassinopoulas, N. Burke, L. Plamann, and P. L. Hartzell.
2002. MglA, a small GTPase, interacts with a tyrosine kinase to control type IV
pili-mediated motility and development of Myxacaccus xanthus. Mol Microbiol
46:1399-1413.

Thony, B., and H. Hennecke. 1989. The -24/-12 promoter comes of age. FEMS Microbiol
Rev 5:341-357.

Thony-Meyer, L., and D. Kaiser. 1993. devRS, an autoregulated and essential genetic
locus for fiuiting body development in Myxacaccus xanthus. J. Bacteriol.
175:7450-7462.

Tojo, N., S. Inouye, and T. Kamano. 1993. The lanD gene is homologous to the Ian gene
encoding an ATP-dependent protease and is essential for the development of
Myxocaccus xanthus. J. Bacteriol. 175:4545-4549.

Trudeau, K. G., M. J. Ward, and D. R Zusman. 1996. Identification and characterization
of F r22, 3 novel response regulator necessary for swarming and fruiting-body
formation in Myxacaccus xanthus. Mol Microbiol 20:645-655.

Ueki, T., and S. Inouye. 1998. A new sigma factor, SigD, essential for stationary phase is
also required for multicellular differentiation in Myxacaccus xanthus. Genes Cells
32371-385.

Ueki, T., and S. Inouye. 2001. SigB, SigC, and SigE from Myxacaccus xanthus
homologous to sigma32 are not required for heat shock response but for
multicellular difl‘erentiation. J Mol Micro Biotechnol 3:287-293.

Ueki, T., and S. Inouye. 2003. Identification of an activator protein required for the
induction of fiuA, a gene essential for fiuiting body development in Myxacaccus
xanthus. Proc Natl Acad Sci USA 100:8782-8787.

Ueki, T., and S. Inouye. 2005. Identification of a Gene Involved in Polysaccharide Export
as a Transcription Target of FruA, an Essential Factor for Myxacaccus xanthus
Development. J Biol Chem 280:32279—32284.

Varon, M., S. Cohen, and E. Rosenberg. 1984. Autocides produced by Myxacaccus
xanthus. J. Bacteriol. 160: 1 146-1 150.

Viswanathan, P., and L. Kroos. 2003. cis Elements necessary for developmental

expression of aAJyxacaccus xanthus gene that depends on C signaling. J Bacteriol
185:1405-1414.

Vlamakis, H. C., J. R Kirby, and D. R Zusman. 2004. The Che4 pathway of Myxacaccus
xanthus regulates type IV pilus-mediated motility. Mol Microbiol 52:1799-1811.

208

Ward, M., H. Lew, A. Treuner-Lange, and D. Zusman. 1998. Regulation of motility
behavior in Myxacaccus xanthus may require an extracytoplasmic-function sigma
factor. J. Bacteriol. 180:5668-5675.

Welch, R, and D. Kaiser. 2001. Cell behavior in traveling wave patterns of
myxobacteria. Proc. Natl. Acad. Sci. USA 98:14907-14912.

White, D. 1975. Myxospores of Myxacaccus xanthus. Pages 44-51 in P. Gerhardt, H. L.
Sadoff, and R. N. Costilow, editors. Spores VI. American Society of
Microbiology, Washington, DC.

White, D. J ., and P. Hartzell. 2000. AglU, a protein required for gliding motility and
spare maturation of Myxacaccus xanthus, is related to WD-repeat proteins.
Molecular Microbiology 42:503-518.

Wireman, J. W., and M. Dworkin. 1975. Morphogenesis and developmental interactions
in myxobacteria. Science 189:516-523.

Wireman, J. W., and M. Dworkin. 1977. Developmentally induced autolysis during
fi'uiting body formation by Myxacaccus xanthus. J. Bacteriology 1292796-802.

Wolgemuth, C., E. Hoiczyk, D. Kaiser, and G. Oster. 2002. How myxobacteria glide.
Curr Biol 12:369-377.

Wu, S. S., and D. Kaiser. 1997 . Regulation of expression of the pilA gene in Myxacaccus
xanthus. J. Bacteriol. 179:7748-7758.

Xu, D, C. Yang, and H. B. Kaplan. 1998. Myxacaccus xanthus sasN encodes a regulator
that prevents developmental gene expression during growth. J Bacteriol
180:6215-6223.

Yang, C ., and H. Kaplan. 1998.A/1}Ixacaccus xanthus sasR encodes an NtrC-like response
regulator required for early developmental gene expression. In preparation.

Yang, Q, and H. B. Kaplan. 1997. Myxacaccus xanthus sasS encodes a sensor histidine
kinase required for early developmental gene expression. J. Bacteriol. 179:7759-
7767.

Yang, 2., Y. Geng, D. Xu, H. B. Kaplan, and W. Shi. 1998. A new set of chemotaxis

homologues is essential for Myxacaccus xmrthus social motility. Mol Microbiol
30: 1 123-1 130.

209

Yang, Z., X. Ma, L. Tang, H. B. Kaplan, L. J. Shimkets, and W. Shi. 2000. Myxacaccus
xanthus drfgenes are required for biogenesis of cell surface fibrils essential for
social gliding motility. J Bacteriol 182:5793-5798.

Yarrisch-Perron, C., J. Vieria, and J. Messing. 1985. Improved M13 phage cloning
vectors and host strains: nucleotide sequences M13 mp18 and pUC19 vectors.
Gene 33:103-119.

Yoder, D. Unpublished data.

Yoder, D. R, and L. Kroos. 20043. Mutational analysis of the Myxacaccus xanthus
Q4400 promoter region provides insight into developmental gene regulation by C
signaling. J Bacteriol 186:661-671.

Yoder, D. R, and L. Kroos. 2004b. Mutational analysis of the Myxacaccus xanthus
Q4499 promoter region reveals shared and unique properties in comparison with
other C-signal-dependent promoters. J Bacteriol 186:3766-3776.

Zusman, D. R. 1982. ”Frizzy” mutants: a new class of aggregation-defective
developmental mutants of It/Iyxacaccus xanthus. J Bacteriol 150: 1430-1437.

210

3 1293 02845 1114