.
. .AWukfing
v J‘

.fvft

, um...)

.
mgr”... .
a. O. h...
II...IuJ
.45.»?
dlfil“?
,2;
w. :23?
‘f‘
.9. .Lm . .
A i 1‘? 1.

Sign».

 

x.
it
3.32.2».

.31 .4 . In.” .
aura .. arifina§
l 4.131.“... [xe/zui...
32% .1 watch.

.553. «1....

461...". ”If.

. r .. ~ I...»

. ‘1 I)

.911

.nth?

x... - r

.....um%wn.flm.nw.«umpf.
ziawfis .31
1' v

. . .2. J

. . . i1

.2; ~1- .

.
z. .311!

. . T.
.I. 3.? .
f? . ?i§......z:s......
1.. £55.34}... if. . 4...“!
23.43%“. v 3.71"!“ ”5.3”. 2%,.79303131
t: .. . . A11.“ , .
s L52: 1... I... t it? shut... LE
.9. :31 Qwudlrias .1.
.J .. . {IE-ah: e
a: . 4 :
. It’d . ‘51:.
knit..ud:.¢

.2 ., .k u.
. :glflgib .715“.
W): 2... .t 32:21....
2-2.0.2.. 2.5.).
.. i=3". 2...?

.Ilau

gringix
IL. .31}? f
:27 59!...) .
(3.7.13!

a|

. .51....
3.3.1....(13

’15..

3.2
.1... $5.514! -
l .al}\1|.vl.l 1!.
I“ a) «8:11.11
.. “1...! 5. i.

 

”5.3. i:

. . :33. a In.
J a. . run.
. 2.}, 2E « a... fag.

2:25

 

I'l'i

. . . , . .u. . in...
.3... . . .ri... . . , .

5 $9:
...zr§7_....!.,.l .2:

This is to certify that the
thesis entitled

Vitamin E Biosynthesis in Tubers
of Potato (Solanum tuberosum)

presented by

Elizabeth Faris Crowell

has been accepted towards fulfillment
of the requirements for the

MS. degree in Plant Breeding and Genetics

 

 

M 9W

Major Professor’s Signature
If U L} .2 8; J 00 (0

Date

 

MSU is an Affirmative Action/Equal Opportunity Institution

 

LIBRARY
Michigan State
University

 

..-v-.-.Q-_.-—a-u.------‘--.-n-.-.-----._-.-.—.u..-.-a-.-.-.-.-.--.—-.-.-.-.-.-.-.-.-.-.-.-.-.-._ _ -

 

PLACE IN RETURN BOX to remove this checkout from your record.
To AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE

DATE DUE

DATE DUE

 

9

Inn. A
\E-
U- a!

' t

.-

DUE

 

2
05

U1,

'031

 

 

 

 

 

 

 

 

 

 

 

 

2/05 p:/CIRC/Date0ue.inddcp.1

 

 

VITAMIN E BIOSYNTHESIS IN TUBERS OF
POTATO (SOLANUM T UBEROS UM)

By

Elizabeth Faris Crowell

A THESIS

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

MASTER OF SCIENCE

Department of Crop and Soil Sciences

2006

ABSTRACT

VITAMIN E BIOSYNTHESIS IN TUBERS OF
POTATO (SOLAN UM T UBEROS UM)

By
Elizabeth 'Faris Crowell

Vitamin E (tocopherol) is a powerful antioxidant essential for human health and
synthesized only by photosynthetic organisms. The roles of tocopherol biosynthetic
enzymes in regulating pathway flux have been established in leaves and seeds, but not in
a non-photosynthetic, below-ground organ. Genetic and molecular approaches were used
to determine if increased levels of tocopherols can be accumulated in potato (Solanum
tuberosum) tubers through metabolic engineering. Two transgenes were constitutively
overexpressed in potato: Arabidopsis thaliana p-hydroxyphenylpyruvate dioxygenase
(At-HPPD) and A. thaliana homogentisate phytyltransferase (At-HPT). a-Tocopherol
levels in the transgenic plants were determined by high performance liquid
chromatography. Overexpression of At-HPPD resulted in a maximum 266 % increase in
(l-tOCOphel‘Ol, and overexpression of At-HPT yielded a 106 % increase. The results
indicate that the tocopherol biosynthetic pathway in tubers is highly regulated compared
to leaves and seeds, and physiological constraints may prevent effective engineering of

enhanced tocopherol levels in potato.

ACKNOWLEDGMENTS

I would like to thank my advisor, Dr. Dave Douches, who provided me the freedom to
explore my own ideas. I am gratefiil to Dave for allowing me time off to venture across
the Atlantic every six months, for helping me discover the joys of bicycling, and for
sharing his pistachios, blueberries, and (of course) chocolates.

I would like to thank Dr. Dean DellaPenna for his continued involvement and interest in
my research, beginning with the generous gift of the genes At-HPPD and At—HPT. Dr.
DellaPenna provided me with frequent access to the HPLC instrument, for which I am
extremely grateful. Most importantly, Dr. DellaPenna provided indispensable guidance
for my research.

Dr. Mitch McGrath made much of my research possible, thanks to his providing
greenhouse space, allowing me access to his laboratory equipment, and providing primers
for RT-PCR. Most of all, I would like to thank Dr. McGrath for his wonderful advice, his
sense of humor, and for teaching me how to do a Southern blot properly.

I am grateful to the professors of “From Analysis of Metabolism to Systems Biology:”
Dr. Christoph Benning, Dr. Yair Shachar—Hill, Dr. Christina Chan, Dr. Claire Vieille, and
Dr. Syed Hashsham. I would like to thank all the members of the Douches lab for training
me in potato transformation, and for their helpful advice. I thank Scott Shaw and Suba
Nagendra for advice on qPCR and handling RNA.

Lastly, I would like to thank Jean-Luc, who humbly helped me harvest potato tubers one

hot day in May. Rien ne m’aurait été possible sans toi ; tu m’as donné 1a force de vivre.

iii

TABLE OF CONTENTS

LIST OF TABLES .......................................................................... v
LIST OF FIGURES ......................................................................... vi
INTRODUCTION .......................................................................... I
The Potato ........................................................................... 1
Genetic Engineering of Potato .................................................... 2
Nutritional Improvement of Potato ............................................... 7
Vitamin E ............................................................................ 11
RESEARCH OBJECTIVES ............................................................... 23
MATERIALS AND METHODS ......................................................... 24
Plant Material ....................................................................... 24
Plasmid Engineering ................................................... . ........... 24
Plant Transformation .............................................................. 25
Plant Growing Conditions ........................................................ 29
High Performance Liquid Chromatography .................................... 30
Polymerase Chain Reaction ...................................................... 31
Real-time RT-PCR ................................................................ 32
Southern Analysis ................................................................. 34
Statistical Analysis ................................................................ 35
RESULTS .................................................................................... 36
Plant Transformation .............................................................. 36
Characterization of HPPD-Overexpressing Plants ............................ 39
Characterization of HPT-Overexpressing Plants .............................. 49
Southern Analysis of HPPD and HPT Lines ................................... 55
a-Tocopherol Content of Selected HPPD and HPT Lines ................... 59
Comparison to Other Reports ................................................... 62
Relative Transcript Levels of Endogenous Pathway Genes .................. 64
DISCUSSION ............................................................................... 67
Individual Effects of Overexpression of HPPD and HPT .................... 73
Status of Applied Research to Increase Vitamin E Content
in Crops ............................................................................. 75
APPENDICES .............................................................................. 82
LITERATURE CITED ..................................................................... 87

iv

LIST OF TABLES

Table 1. Enzyme names, abbreviations, and their corresponding genes. ............ 16
Table 2. Primer sequences for PCR. ...................................................... 28

Table 3. Transformation results for selected genotypes with the vectors
pHPPD and pHPT. ................................................................ 37

Table 4. a—Tocopherol content in leaves of Spunta pHPPD transforrnants
compared to untransformed Spunta control. ................................... 41

Table 5. a—Tocopherol content of tubers of HPPD transforrnants and

controls. ............................................................................. 46
Table 6. Tuber fresh weight for transgenic plants and control plants. .......... fi. 51
Table 7. a-Tocopherol content of tubers of HPT transforrnants and controls. 53

Table 8. a-Tocopherol content of tubers of HPPD and HPT transforrnants
selected for characterization. ...................................................... 60

Table 9. Comparison of tocopherol content in HPT- and HPPD-
overexpressing Arabidopsis and potato plants. ................................ 63

Table A1. Nutrient content of potato. .................................................... 82

LIST OF FIGURES

Figure l. Committed reaction steps in tocopherol biosynthesis. .................... 13

Figure 2. Construction of pPDH, pHPPD, and pHPT plant transformation
vectors. ................................ ‘ ............................................. 27

Figure 3. Confirmation of presence of At-HPPD and At-HPT in
transgenic plants by PCR. ....................................................... 38

Figure 4. Phenotype of HPPD transgenic plants. ...................................... 40

Figure 5. a-Tocopherol levels in leaves of four Spunta transgenic lines
transformed with pHPPD. ........................................................ 42

Figure 6. Representative chromatogram from HPLC analysis of a 0.5 g
tuber sample showing peak areas corresponding to tocol internal

standard, endogenous y-tocopherol, and endogenous a-tocopherol. ....... 43

Figure 7. Results of a screen of 11 HPPD transgenic plants for enhanced
a-tocopherol levels in tubers. .................................................... 45

Figure 8. Relative transcript levels of the At—HPPD transgene in

characterized HPPD transgenic lines. ........................................... 47
Figure 9. Relative transcript levels of the At-HPPD transgene in

characterized HPPD transgenic lines. ........................................... 48
Figure 10. Phenotype of normal HPT transgenic plants. .............................. 50
Figure 11. Phenotype of altered morphology SpHPT transgenic plants. ............ 52

Figure 12. Results of a screen of 11 HPT transgenic plants for enhanced
a-tocopherol levels in tubers. .................................................... 54

Figure 13. Relative transcript levels of the At—HPT transgene and the
endogenous St-HPT in characterized HPT transgenic lines. ................. 56

Figure 14. Products of real-time RT-PCR experiments to determine
relative transcript levels of the At-HPT transgene and endogenous
homologue St-HPT. ................................................................ 57

Figure 15. Southern analysis of 12 HPPD and HPT transgenic lines. ............... 58

vi

Figure 16. a-Tocopherol levels in tubers of two transgenic lines of each
genotype/vector combination were quantified using HPLC. ................ 61

Figure 17. Relative transcript levels of endogenous potato homologues of
tocopherol biosynthetic genes in leaves of ‘Yukon Gold.’ ................... 65

Figure 18. Amplification products from a representative real-time RT-
PCR experiment to determine relative mRN A levels of endogenous
potato homologues of tocopherol biosynthetic genes were
electrophoresed on 0.8 % agarose gel. .......................................... 66

Figure 19. Biosynthetic pathways using geranylgeranyldiphosphate as a
reactant. .............................................................................. 77

Figure A1. Digital Northern of 16 genes involved in synthesis of vitamin

E and its precursor molecules, showing expression changes during
abiotic stress. ........................................................................ 85

vii

INTRODUCTION
The Potato

The potato (Solanum tuberosum L.) is the most important vegetable, with world
production averaging over 311 million metric tons in 2003 (National Potato Council,
2006). The United States is one of the highest producers, along with China, Russia, India,
Ukraine, Poland, and Germany. In the US, potatoes are grown on over 1.3 million acres
per year and have an estimated $3 billion production value (National Potato Council,
2006).

Cultivated potato is known to have originated fiom Andean and Chilean landraces
originally domesticated approximately 7,000 years ago. The particular wild species from
which these landraces were derived have been contested for more than a decade (Spooner
et al., 2005). Several studies have suggested multiple origins fi'om both the Peruvian and
Bolivian/Argentinean clades of the S. brevicaule complex (Hawkes, 1990). The most
comprehensive investigation to date used 438 amplified fi'agment length polymorphisms
(AF LPs) to genotype the complete set of landraces, wild progenitors, and outgroups,
allowing a more definitive phylogenetic analysis to be conducted (Spooner et al., 2005).
These analyses clearly indicated a single origin of the Andean and Chilean landraces in
the Peruvian component of the S. brevicaule complex, most likely derived from the wild
species S. bukasovii.

An autotetraploid (2n = 48), cultivated potato exhibits inbreeding depression, and
thus poses considerable challenges to the breeder who wishes to fix traits. For large scale
production, potato is propagated strictly by clonal means. Compared to storage of dry

seed, storage of potato tubers is complicated by requirements for cool temperatures, large

amounts of space, and control of pathogens and pests while in storage. Furthermore, the
bulk of potato tubers necessitates special equipment and large numbers of laborers for
planting and harvest. These inconveniences of clonal propagation are outweighed by the
advantage that desirable potato varieties can be maintained indefinitely. One of the first
cultivars to attain widespread popularity was Russet Burbank, which has been grown in
the western states of the US. for nearly 100 years (Davis, 1992).

Potato breeding benefits fiom an incredibly diverse pool of wild germplasm,
consisting of 199 wild species found in 18 countries (Hijmans and Spooner, 2001). While
most of the wild relatives of cultivated potato are diploid, various methods exist to allow
the introgression of traits into S. tuberosum cultivars by conventional crosses. The
discovery of a clone of S. phureja that allows recovery of haploid S. tuberosum has
facilitated crosses with many wild species (Samitsu and Hosaka, 2002). However, the
endosperm balance number (EBN) is an additional factor that results in reproductive

isolation of potato species and restricted breeding possibilities (Carputo et al., 1997).

Genetic Eng’neering of Potato

Genetic modification has many advantages for plant breeding, and these
advantages are even more striking in crops with complex inheritance such as potato.
While conventional breeding manipulates genomes in a largely uncontrolled fashion,
requiring generations of selection to assemble and fix the maximum number of desirable
traits, transformation offers a direct approach, allowing introgression of a single, distinct
trait (Rommens et al., 2004). Thus, genetic modification allows rapid and often powerful

improvement of crops, and is not limited by compatibility barriers. In cases where genetic

diversity among sexually compatible relatives of crop species is insufficient for a
particular trait, genetic modification may represent the only possibility for crop
improvement in that trait.

Like most Solanaceous species, potato is readily transformed by Agrobacterium
tumefaciens. Potato was first transformed in 1987 in order to compare the expression of
an organ-specific endogenous gene and a tagged variant introduced by Agrobacterium-
mediated transformation (Stockhaus et al., 1987). Also in 1987, De Block and colleagues
reported the generation of transgenic potato expressing the bar gene, which confers
herbicide resistance to bialaphos. Soon after these initial transformation experiments, the
Monsanto company announced the creation of transgenic potatoes resistant to potato
viruses X and Y (Newell et al., 1991). Viruses are among the most formidable plant
pathogens and among the most difficult to control by chemical means. However,
transgenic expression of viral coat proteins was able to confer resistance in cultivated
potato, representing a major breakthrough in potato breeding. These transgenic lines,
which Monsanto trademarked as NewLeaf, were grown in the United States and Canada
with great success. The advantages of NewLeaf potatoes included higher yields of high
quality tubers, reduced pesticide use, and lower production costs. However, the NewLeaf
potatoes were withdrawn from the market in 2001 as a result of antibiotechnology
campaigns (Kaniewski and Thomas, 2004).

In 1993, two groups reported the development of genetically modified potatoes
resistant to Colorado potato beetle through expression of cryIIIA (Perlak et al., 1993;
Adang et al., 1993). The cryIIIA protein is derived fi'om Bacillus thuringiensis, and is one

of several related proteins collectively termed Bt toxins. The various forms of Bt have

been proven to confer highly durable resistance against insects in the orders Coleoptera,
Lepidoptera and Diptera, which include some of the most destructive crop pests (Romeis
et al., 2006). The potato tuber moth, the most destructive pest of potato in tropical and
sub-tropical regions, was shown to be effectively combated using resistance derived from
the B. thuringiensis protein crleal (Mohammed et al., 2000). Transgenic potatoes
expressing Bt-cryIIaI were extensively tested in field trials in Egypt over three years,
illustrating that potato tuber moth could be completely controlled in the best lines without
compromising yield or other quality traits (Douches et al., 2004).

Late blight disease caused by the biotrophic fungus Phytopthora infestans has
plagued potato production for over a century, and, notably, was responsible for the Irish
potato famine in the 1840’s (Y arnamizo et al., 2006). Thus far, efforts to breed resistance
into cultivated varieties have not been able to keep pace with the rapid evolution of new
resistant strains of the pathogen, and late blight remains the most devastating disease of
potato (Song et al., 2003). Van der Lee and colleagues (2001) demonstrated that the rapid
evolution of new virulent strains of P. infestans may be partly due to an unstable
telomeric locus, termed M5.1. This locus was shown to undergo spontaneous deletions at
a high rate, thus eliminating specific avirulence genes from the pathogen’s genome. In
concordance with this observation, resistance genes introgressed from wild relatives of
potato generally only confer resistance to specific races of P. infestans, and thus are of
limited use (Song et al., 2003). However, the wild species Solanum bulbocastanum shows
resistance to all known races of P. infestans. Since S. bulbocastanum is not sexually
compatible with cultivated potato, somatic hybridization was used to generate backcross

populations. Mapping of these populations permitted the resistance gene to be cloned

along with its endogenous promoter, and should allow development of late blight
resistant cultivars with all the desirable agronomic traits of cultivated potato (Song et al.,
2003)

In a recent report, Yamamizo and colleagues used transgenic modification of the
plant’s innate immune response to engineer a resistance to late blight that might be
expected to be highly durable (Yamamizo et al., 2006). Their approach consisted of
introducing a constitutively active allele of the mitogen-activated protein kinase
StMEKl DD into cultivated potato, effectively generating plants that activate the
hypersensitive response (HR) pathway, leading to cell death. The key to the success of
their approach lies in the high specificity of the promoter used for expression of the
StMEKl DD allele. The endogenous, pathogen-induced promoter from the vetispiradiene
synthase gene allowed expression of StMEKlDD only upon pathogen infection,
preventing uncontrolled HR. Interestingly, the transgenic potatoes were resistant to both
P. infestans and Alternaria solani, a necrotrophic pathogen.

While early transformation experiments were employed with the goal of
improving agronomic quality of crops or for fundamental molecular studies, recent years
have seen the emergence of novel research goals. The high potential for biomass
production has made the potato tuber an attractive target organ for accumulating a range
of industrially important compounds, fi'om therapeutic drugs to plastics and lipids. For
example, Klaus et al. (2004) attempted to engineer lipid accumulation in potato tubers by
either redirecting flux away from starch synthesis, overexpressing a plastidic ATP
transporter, or overexpressing the biosynthetic enzyme acetyl-CoA carboxylase. Their

results indicate that flux to lipid synthesis in potato tubers is not limited by starch

production or ATP levels. Enhanced levels of the regulatory enzyme acetyl-CoA
carboxylase led to a significant increase in lipid content of tubers, specifically a 5-fold
increase in triacylglycerol levels (Klaus et al., 2004).

Poly-aspartate is a soluble, non-toxic polymer with excellent potential for use as a
biodegradable plastic (Conrad, 2005). Poly-aspartate is currently produced from
hydrolysis of cyanophycin, a polymer produced exclusively in cyanobacteria. When the
cyanophycin synthetase gene was overexpressed using the CaMV 358 promoter in potato
plants, cyanophycin accumulated to approximately 0.24% of dry weight in leaves, and
could be elevated to approximately 2% of dry weight in selected clonally propagated
plants (Neurnann et al., 2005). Problems with reduced growth rates and phenotypic
changes in the transgenic plants remain to be surmounted, likely through targeting
accumulation of cyanophycin in intracellular compartments. In a second example,
dextran, a sucrose-derived polymer important for industrial applications and for the
medical field, was accmnulated to levels of 1.7 mg/gfw in potato tubers by the expression
of a glucosyltransferase from Leuconostoc mesenteroides (Kok-Jacon et al., 2005). In this
case, no adverse effects on yield or plant growth were observed.

Potato tubers have also been considered as candidates for delivery of edible
vaccines. In a particularly interesting example, potatoes were engineered to express an
immunogenic Beta amyloid (AB) peptide, a protein associated with the development of
Alzheimer’s disease. Since the causative agent of Alzheimer’s disease is the AB prion, no
effective drug treatments exist for patients already affected; therefore, blocking the
generation of AB is a highly desirable strategy for preventing the onset of Alzheimer’s

disease (Y oum et al., 2005). One of the most promising strategies is immunization with

AB peptides to induce clearance of AB from the brain. Indeed, when extracts of
transgenic potato plants expressing AB peptides were fed to transgenic amyloid protein
precursor mice, the mice produced antibodies against AB and showed clearance of AB
plaques in the brain, without any side effects on health (Y oum et al., 2005).

Several viral vaccines have also been tested for the potential of using potato as a
production system. Potatoes engineered to express the plant codon usage-optimized L1
capsid protein of human papillomavirus type 11 (l-IPVl 1) showed accumulation of virus-
like particles, and, furthermore, were able to induce an immune response in mice when
fed in conjunction with an adjuvant (Warzecha et al., 2003). Potatoes expressing the
hepatitis B surface antigen showed promise as a vehicle for vaccine delivery in a recent
human trial (Thanavala et al., 2005). Afier three 100 g doses of raw transgenic potato, an
immune response was induced in ten of 16 human volunteers, notably without the need
for adjuvant (Thanavala et al., 2005). These reports and others demonstrate that potato is
an excellent candidate for edible vaccine production, due to an efficient transformation
system, the facility of storing tubers, and low production costs, and thus could provide

vaccines to resource-poor populations (J oung et al., 2004).

Nutritional Improvement of Potato

Increasingly, transgenic approaches are being explored to modify plant secondary
metabolism for improvement of nutritional quality, flavor, and other traits with benefits
for the consumer. Throughout these studies, it has become clear that engineering plant
metabolism is challenging, often requiring multiple manipulations and sophisticated

analyses to determine a successful strategy (Niederberger et al., 1992). While conferring

pesticide or insect resistance can be as simple as introducing a single transgene,
modifying flux in endogenous metabolic pathways requires overriding the plant’s natural
regulatory mechanisms, which normally prevent excessive accumulation of products and
intermediates. The intuitive approach of increasing the levels of an enzyme that appears
to be “rate-limiting” fails under most circumstances, because most biosynthetic enzymes
exert only a minor control over flux. The complex regulatory networks and abundance of
transcription factors, the extensive compartmentation of reactions within cells, and the
existence of multiple substrate pools all contribute to the difficulty of manipulating
metabolism in plants (McNeil et al., 2000).

The potato is an excellent target for metabolic engineering for nutritional
enhancement due to the relative ease with which it can be transformed and the naturally
high nutritional value of potato. Potatoes are an excellent source of energy with low fat
and low sodium content. Potatoes also contain high quality protein; contribute minerals
such as calcium, magnesium, and phosphorus; provide high levels of vitamin C, vitamin
K, and potassium; contain important compounds such as folate, and contribute
carotenoids with special health benefits (Table A1; USDA, 2005). Taken together, these
excellent qualities make potato a highly nutritious staple food.

Breeding for nutritionally enhanced potato varieties has been aided by several
recent studies on the natural variation and inheritance of various nutrients in potato.
Specific transgenic approaches to enhance nutritional qualities have also proven fruitful
in many cases. Medical research illustrating the potential health benefits of specific

carotenoids such as lutein and zeaxanthin has incited studies to determine the

composition of carotenoids in tuber flesh (Breithaupt and Bamedi, 2002; Nesterenko and
Sink, 2003).

Potato is naturally rich in a variety of carotenoids beneficial to human health, and
the content and composition of carotenoids varies widely between cultivars (Breithaupt
and Bamedi, 2002). The relative ease by which carotenoid biosynthesis can be modified
in potato has been illustrated in several reports. Potato plants overexpressing phytoene
synthase accumulated 19-fold higher levels of lutein, as well as higher B-carotene levels
(Ducreux et al., 2004). In efforts to increase accumulation of zeaxanthin, Romer and
colleagues used both an antisense construct and cosuppression of zeaxanthin epoxidase to
eliminate zeaxanthin catabolism (Romer et al., 2002). In their best performing line,
zeaxanthin contents were increased up to 130-fold. Intriguingly, some of the transgenic
plants also exhibited a significant 2 to 3-fold increase in a—tocopherol levels in the tubers.
Potato has additionally been targeted for the production of astaxanthin, a carotenoid
important both for human nutritional and for industrial applications. Current production
systems include culture of slow-growing green algae or chemical synthesis, which are
considered suboptimal due to economic limitations and environmental pollution,
respectively (Morris et al., 2006). The B-carotene ketolase gene from Haematococcus
pluvialis was expressed in potato to test whether synthesis of astaxanthin could be
engineered in potato tubers. A very low level of accumulation of astaxanthin, at a
maximum of 13.9 ug/gdw, was observed (Morris et al., 2006).

In addition to carotenoids, potato is also a valuable source of vitamin C (ascorbic
acid). For instance, in the United Kingdom, potatoes contribute over 30% of the daily

intake of vitamin C, and in Australia provide 25% (Dale et al., 2003). Statistical

differences in vitamin C content have been shown between potato varieties, aiding
conventional breeding efforts (Love et al., 2004). Ascorbic acid was shown to decrease in
tubers by 42-48% during cold storage (Dale et al., 2003).

An improvement in protein quality of potato was achieved by Chakraborty and
colleagues in a novel approach using transgenic expression of the Amaranthus
hypochondriacus seed albumin gene (Chakraborty et al., 2000). Amaranth seed albumin
protein (AmAl) is non-allergenic, has a well-balanced amino acid composition, and is
encoded by a single gene, qualities that lend to its possible use for nutritional
improvement of food crops. The transgenic expression of AmAl in potato resulted in an
increase in all essential amino acids, with notable 2.5 to 4-fold increases in lysine,
methionine, cysteine, and tyrosine (Chakraborty et al., 2000). The simplicity of this
approach makes it especially attractive, since these enhancements in levels of rare amino
acids were obtained without the need for manipulation of complex amino acid metabolic
pathways.

Potato is an excellent target for nutritional improvement. Due to the high yield
and low cost of cultivation, potatoes are an important part of the diet in many cultures,
with intake in the US equaling approximately one potato per day on average. Nutritional
improvement of potato would have a significant impact on vitamin and nutrient intake for
many populations (Nat. Pot. Coun. 2004). To our knowledge, this represents the first
study that has attempted to enhance vitamin E content of potato tubers. Additionally, it is

the first study of vitamin E biosynthesis in an underground plant organ.

10

Vitamin E

Vitamin E is the collective term for eight structurally related tocochromanol
compounds, four tocopherols (a, B, 5, and y) and four tocotrienols (a, B, 5, and y). a-
Tocopherol appears to be the most biologically active in humans, and is the most
powerful lipid soluble antioxidant known (Schneider, 2005). It has been known for many
years that a—tocopherol is essential to health, and evidence suggesting important roles for
the other isomers, notably tocotrienols and y-tocopherol, has recently emerged (J iang et
al., 2004; Kamal-Eldin and Appelqvist, 1996). In addition to serving as a potent
antioxidant, a-tocopherol has also been shown to act as a signaling molecule in muscle
tissue (Ricciarelli et al., 1998). The antioxidant activity of tocopherols suggests an
implication in the prevention of atherosclerosis, certain cancers, or cardiovascular
disease; however, medical trials have yielded inconclusive results (Friedrich, 2004).

In plants, the function of tocopherols remains unclear. The accumulation of
tocopherols in the plastid membrane in leaves suggests a role in scavenging free radicals
generated from photooxidation (Havaux et al., 2005). A perplexing role in sucrose
transport is also apparent, since tocopherol-deficient plants fails to export photoassimilate
from leaves (Provencher et al., 2001; Hofius et al., 2004). The different isomers of
tocopherols and tocotrienols may also have unique fiinctions in plants, as suggested from
their distribution in different tissues. In general, seeds accumulate high levels of y-
tocopherol and leaves accumulate a higher percentage of a—tocopherol, while the
remaining isomers are not naturally abundant. Tocotrienols are abundant in the seeds of

most monocots, and rarely found in dicots (Cahoon et al., 2003).

ll

Humans and other animals are not capable of synthesizing tocopherols or
tocotrienols autonomously and must obtain them from their diet. Approximately 90% of
children and adults in the United States do not consume the recommended amount of
vitamin E (Drewel etal., 2006; Ahuja et al., 2004). Surprisingly, after food mixtures such
as sauces, consumption of fiied potato products provides the most significant source of
vitamin E in the American diet (Ahuja et al., 2004). The contribution of fried potato
foods to vitamin E intake is due almost entirely to the vitamin E content of the frying oils,
and not from the potatoes themselves.

The four tocopherol isomers (a, B, 8, and y) and four tocotrienol isomers (a, B, 8,
and y) differ from one another based on the number and position of methyl groups on the
chromanol ring. The reader is referred to Figure 1 for the structures of the molecules and
the names of the enzymes catalyzing the committed reaction steps in tocopherol
biosynthesis (modified from AraCyc, Mueller et al., 2003). The first committed step of
tocopherol biosynthesis is the condensation of the aromatic head group of homogentisic
acid derived from the shikimate pathway with isoprenoid-derived phytyldiphosphate
(Cheng et al., 2003). Tocotrienols are synthesized by the condensation of homogentisic
acid with a different prenyl-diphosphate, geranylgeranyldiphosphate. Along with
tocochromanols, the essential compounds chlorophyll, plastoquinone, and phylloquinone
(vitamin K.) are synthesized in closely related reactions between various aromatic
precursors and a prenyl-diphosphate substrate (Collakova and DellaPenna, 2001). The
enzymes involved in tocochromanol synthesis are all membrane bound and localized to
the chloroplast inner membrane, with the exception of p-hydroxyphenylpyruvate

dioxygenase, which has been shown to be cytosolic (Garcia et al., 1999).

12

p—hydroxyphenylpyruvate

Figure 1. Committed
reaction steps in HPPD
tocopherol biosyn-

thesis. Modified from it

Ara 11 t 1.,
2003c (Mm er 3 a Homogentisate

Phytyl diphosphate \

J

v

 

C02, diphosphate

 

2-methyl-6-phytyl-l,4-benzoquinone

\TC

MPBQ MT
5-tocopherol
2,3-dlmethyI-6-plrytyI-l,4-benzoquinone
y-TMT
1 TC
toco herol
y-tocopherol B- p
1 y-TMT

(rt-tocopherol

l3

The biochemistry of vitamin E synthesis in plants was elucidated using
radiotracer experiments over 30 years ago (Schneider 2004). In recent years, all of the
genes in the pathway have been cloned, many of which were identified using a genomics
approach based on sequence homology between the model plant Arabidopsis thaliana
and the cyanobacterium Synechocystis (Shintani and DellaPenna 1998) (Table 1).
Homologues in many crop plants, including potato, have been identified using similar
methods based on sequence similarities (TIGR Gene Index Databases, 2004). These
discoveries precipitated a large number of genetic studies that have added to our
understanding of the regulation of the pathway, and demonstrated the potential to
increase accumulation of vitamin E in crops by metabolic engineering. Due its apparent
higher activity in mammalian cells, a-tocopherol has been the major target for
enhancement in crops by metabolic engineering.

The Arabidopsis y-tocopherol methyltransferase (y-TMT) gene (VTE4) was one
of the first tocopherol biosynthetic genes to be cloned from plants (Shintani and
DellaPenna, 1998). Since y-TMT catalyzes the conversion of y-tocopherol to the more
active a-tocopherol isomer, an approach to engineer nutritionally enhanced crops using 7-
TMT was immediately apparent. Indeed, overexpression of VTE4 with a seed specific
promoter increased seed a-tocopherol levels more than 80-fold, corresponding to a 9-fold
increase in vitamin E activity in the transgenic seeds (Shintani and DellaPenna, 1998).
Similarly, overexpression of VTE4 and VTE3, the gene encoding 2-methyl-6-
phytylbenzoquinol methyltransferase (MBPQ MT), in soybean resulted in a 5-fold

increase in vitamin E activity due to accumulation of (rt-tocopherol (Eenenaam et al.,

14

2003). While modifying the tocopherol pool composition is relatively straight-forward,
increasing the content of tocopherols in plants has proven far more challenging.

The first tocopherol biosynthetic gene to be cloned from plants was PDSI (At-
HPPD), which encodes p-hydroxyphenylpyruvate dioxygenase (HPPD) (Norris et al.,
1998). HPPD converts 4-hydroxyphenylpyruvate (HPP) to homogentisic acid (HGA), an
important precursor for tocopherol synthesis. HPPD was predicted to be a regulatory
enzyme in tocopherol biosynthesis for numerous reasons: the enzyme catalyzes one of the
first committed steps in tocopherol biosynthesis; increased At-HPPD expression in
senescing leaves is associated with tocopherol accumulation; and feeding safflower cell
cultures with exogenous HGA leads to increased tocopherol accumulation (Tsegaye et
al., 2002). HPPD is essential for viability due to the requirement of HGA for
plastoquinone biosynthesis. Overexpression of At-HPPD in the cyanobacteria
Synechocystis led to a 7-fold increase in tocochromanols (Karunanandaa et al., 2005).
However, HPPD seems to have very limited control on tocopherol pathway flux in plants.
In transgenic Arabidopsis showing 10-fold increases in HPPD activity, leaf tocopherol
levels were only 15 to 37 % elevated over wild-type levels (Tsegaye et al., 2002). In this
same study, 9- to 17-fold higher HPPD protein levels in the seeds from transgenic plants

translated to a meager 24 to 28 % increase in tocopherols.

15

£83..“me ewmgcm.

mg? MATH 3338 Bafifiosoxomaaomouvmfiv 332305

 

3.83.33 ueuafioaeceem mama mam umaaomoavmfiv 33335
out .333 £3.89 .wbbm. Boom emacumamh fimaauowafiuom 29m owmucomofiom
enemefi mfifionwaeam. WOO MQOO 330.38 3.3% oaafimgcoflagbo
3.233% unmonficéw ~30 mHQ 038.8? 33% osafiémofibmfi -bSuQA
cmemefi mfimonwaeéx “smut; Ewi emacomagifiofi Ecuaaooohtr
assess meanness. BE E 3% assemsaaeoe sass oaoefifie-_§uz-m
encasemlaasaew Shannan Em seemssfifi awesomoeom
«.2333 mfimcnwacéw an...» OH 8388 #82383.
exemefi mnaenficéx Edi. QAEHH umaaommxomo upgamafimfisgxofiwm- A
8&5qu 280 couaEfinfiw ogm

.mocom mqaoaoamutonu has» ~28 .maouafifinnm define ogm .H £an

16

As with At—HPPD, upregulation of the majority of cloned tocopherol biosynthetic
genes yields very minor changes in tocopherol levels. One exception is homogentisate
phytyltransferase (HPT), encoded by HPT] (synonymous with VTE2). This enzyme was
shown to have a significant individual control on pathway flux. Overexpression of HPT]
in Arabidopsis led to a 3- to 4.4-fold increase in tocopherols in leaves (Collakova and
DellaPenna, 2003), and a maximum 2-fold increase in homozygous seed when expressed
with a seed-specific promoter (Savidge et al., 2002).

The highest increase in tocopherols attained thus far from overexpression of a
single gene was reported by Kanwischer et a1. (2005). Arabidopsis overexpressing VTE 1,
the gene encoding tocopherol cyclase (TC), exhibited a 7-fold increase in total
tocopherols in leaves. This result was surprising for two reasons. First, it had previously
been demonstrated that seed-specific overexpression of VTEI under control of the napin
promoter resulted in increases of only 18 to 28% in seed tocochromanols in Brassica
napus (Kumar et al. 2005). Secondly, expression levels of VTEI were not observed to
change significantly under conditions of high light stress, and reaction intermediates
immediately upstream of TC were not observed to accumulate in plants overexpressing
HPT] (Collakova and DellaPenna, 2003a). These data indicated that TC activity does not
limit tocopherol biosynthesis, even when levels of precursors are increased. In contrast to
the results of Collakova and DellaPenna (2003a), Kanwischer et a1. (2005) showed that
expression levels of VTEI increase substantially in plants exposed to high light stress,
and that increased expression of VTEI was clearly correlated with increased tocopherol
accumulation. A second discrepancy with previous studies relates to the composition of

tocopherols found in the WEI-overexpressing plants. The results of Kanwischer et al.

17

(2005) suggest that y-TMT activity is limiting in leaves of Arabidopsis overexpressing
VTEI, since these plants accumulate 80.5 % of tocopherols as y-tocopherol. However,
stressed wild-type and HPTI-overexpressing Arabidopsis exhibiting much larger
increases in total tocopherols (18-fold) accumulated only 10 % as y-tocopherol
(Collakova and DellaPenna, 2003a).

Genetic studies in Arabidopsis overexpressing or silencing l-deoxy-D-xylulose-S-
phosphate synthase (DXS) suggest that levels of isopentenyl diphosphate, a precursor for
phytyldiphosphate, may significantly limit flux in the plastidic isoprenoid pathway
(Estevez et a1. 2001). Although DXS acts far upstream of the committed steps of
tocochromanol biosynthesis, overexpression of this enzyme resulted in 1.5- to 2-fold
increases in (rt-tocopherol levels in specific lines. Notably, the enzyme level was
increased by only 32 to 72% in these transgenic lines. It is reasonable to consider that
isoprenoid metabolism is tightly regulated, since a number of essential compounds for
photosynthesis are synthesized from isoprenoid-derived precursors (chlorophyll,
plastoquinone, phylloquinone). Since many studies suggest minor control on flux by
downstream enzymes such as HPPD, it is likely that this control resides elsewhere,
possibly in the steps leading to synthesis of prenyl-diphosphate precursors or HGA.

A clever approach to avoid rate limitations at the protein level made use of the
feedback-insensitive form of prephenate dehydrogenase (PDH) isolated from
Saccharomyces cerevisiae (Rippert et al., 2004). Arogenate dehydrogenase (AD) is
inhibited by its product tyrosine. The yeast PDH, which catalyzes the conversion of
prephenate directly to p-hydroxyphenylpyruvate (HPP), allows the feedback-sensitive

step to be bypassed. In transgenic plants overexpressing the yeast PDH gene (T yrI ), the

18

increased flux to HPP creates a new metabolic state where HPPD activity immediately
becomes limiting. Simultaneous overexpression of T yr] and At-HPPD in tobacco
(Nicotiana) resulted in a 10- to 11-fold increase in tocochromanol levels in leaves.
Surprisingly, this increase was due to accumulation of tocotrienols, and tocopherol levels
did not change significantly (Rippert et al., 2004). Similar results were obtained using the
bifunctional prephenate dehydrogenase/chorismate mutase from Erwinia herbicola
(Karunanandaa et al., 2005). The reason for this increased flux to tocotrienol production
is still unclear.

In several studies, large increases in tocochromanol levels resulted from increases
in tocotrienol accumulation, while tocopherol levels remained largely unchanged
(Cahoon et al., 2003; Karunanandaa et al., 2005; Rippert et al., 2004). Embryo-specific
overexpression of a barley homogentisic acid geranylgeranyl transferase (HGGT) in
maize (Zea mays) increased tocotrienol levels by even 20-fold (Cahoon et al., 2003).
Increases of this magnitude have not been attained for tocopherols. While this result is of
little interest fi'om the practical standpoint of increasing the nutritional value of food, it
raises interesting questions regarding the regulation of the biosynthetic pathway and the
functionality of the enzymes therein. The close similarities between the prenyl transferase
and methylase reactions that characterize prenquuinone synthesis initially prompted the
hypothesis that many of the enzymes might have activity for multiple substrates.
However, in higher plants, it appears that several structurally and sequence-related
enzymes have diverged to catalyze prenyltransferase reactions with high substrate
specificity. Arabidopsis HPT uses only phytyldiphosphate and homogentisic acid as

substrates (Collakova and DellaPenna, 2001), while the structurally similar HGGT is

19

active with geranylgeranyldiphosphate and homogentisic acid (Cahoon et al., 2003). The
methylases downstream of these first committed steps are shared between the tocotrienol
and tocopherol pathways. The question remains as to how overexpression of yeast PDH
and HPPD induces massive accumulation of tocotrienols in leaves where these
compounds normally cannot be detected (Rippert et al., 2004). Equally confounding is
the fact that upregulation of GGDR in plants overexpressing HPT, HPPD, and Erwinia
PDH/CM did not divert flux to tocopherols, in contrast to the result of overexpression of
GGDR in Synechocystis (Karunanandaa et al., 2005).

Tocopherols are observed to accumulate to high levels naturally in plants
undergoing a wide variety of stress conditions. Arabidopsis plants subjected to high-light
stress and nutrient deficiency for 15 days show an 18-fold increase in tocopherol levels
(Collakova and DellaPenna, 2003a). In potato tubers, tocopherols increase up to 4-fold
during cold storage (Spychalla and Desborough, 1990). Transcriptional changes are
associated with increased tocopherol accumulation in stress conditions. For example,
mRNA levels of tyrosine arninotransferase increase 3- to 5-fold, homogentisic acid
dioxygenase mRNA levels increase 2.7-fold, HPT mRNA levels increased up to 3.5-fold,
and HPPD mRNA levels increase up to 5.4-fold (Collakova and DellaPenna, 2003a).
Additionally, mRNA levels of TC were observed to increase approximately 10-fold after
high light stress (Kanwischer et al., 2005). Other genes encoding enzymes essential for
tocopherol biosynthesis, such as geranylgeranyldiphosphate synthase] and y-TMT, do
not change significantly in steady-state mRNA level under high light stress (Collakova

and DellaPenna, 2003 a).

20

Understanding induction of tocopherol biosynthesis during stress is useful for
developing strategies to engineer crops with enhanced tocopherol levels. Since the
expression profiles for genes involved in tocopherol biosynthesis have only been studied
under conditions of high light and nutrient stress, Genevestigator (Zimmermann et al.,
2004) was used to generate a Digital Northern from microarray data that shows the
expression changes of 16 genes under a wide variety of abiotic stress treatments (Figure
A1). Many genes involved in tocopherol biosynthesis are expressed at very low levels
and thus do not give a strong signal on microarrays; therefore, these analyses are not
considered highly reliable but provide an indication of gene expression changes. The
Digital Northern indicates that genes encoding enzymes involved primarily in generating
precursors for chlorophyll or carotenoid biosynthesis, such as geranylgeranyldiphosphate
reductase and phytoene synthase, are downregulated in most of the stress conditions
tested. Direct experimental evidence supports this result, since decreases in chlorophyll
and other photosynthetic pigments have been observed under stress conditions
(Kanwischer et al., 2005). As might be expected, VI’EI, HPT], VTE4, At—HPPD, and
enzymes catalyzing the formation of precursor compounds are upregulated in conditions
of osmotic stress. Contrary to expectations, most of these genes are downregulated in
oxidative stress or cold stress, conditions in which tocopherols are known to play an
essential protective role (Maeda et al., 2005). Tocopherol levels are known to decrease in
senescing leaves (Munné-Bosch and Pefiuelas, 2003), but HPT], VTE4, and At-HPPD are
induced under these conditions. Thus the expression profiles obtained from Digital
Northern analysis do not show any obvious coordinated induction patterns. Overall, these

observations indicate that transcriptional induction is only a small part of the regulatory

21

network controlling tocopherol accumulation in stressed tissues, and that the pathway is

highly controlled on many levels.

22

RESEARCH OBJECTIVES

This research was conducted to determine the changes in potato tuber a-
tocopherol content resulting from individual overexpression of genes encoding HPPD
and HPT, two biosynthetic enzymes potentially limiting flux through the tocopherol
biosynthetic pathway. Within this overall objective, specific steps were: 1) to construct
plant expression vectors with the genes encoding HPPD and HPT under the control of the
Cauliflower mosaic virus 35S promoter; 2) to transform at least two genetically distinct
potato cultivars with these vectors; and 3) to molecularly characterize and determine the
phenotype of the transgenic plants. We hypothesized that overexpression of the genes
encoding HPPD and HPT would result in increases in tocopherol levels, with no
concomitant changes in tocopherol composition, and that transgenic plants would be
identical to control plants in all other respects. In order to test these hypotheses, growth,
appearance, and tuber set were evaluated in comparison to untransformed plants under
greenhouse conditions; HPLC analysis was used to quantify tocopherol levels and
determine their composition; and expression levels of the transgenes were compared
between transgenic lines to test for correlations in expression levels and tocopherol
accumulation. Expression levels of endogenous potato tocopherol biosynthetic genes
were compared in order to study transcriptional control of tocopherol biosynthesis in
potato.

Results from the HPPD overexpressing plants will be presented first, followed by
results from HPT overexpressing plants. Finally, results pertaining to transcriptional
control of tocopherol biosynthesis will be presented, and the status of research to

engineer increased vitamin E in crop plants will be discussed.

23

MATERIALS AND METHODS
Plant Material:

The potato genotypes ‘Spunta,’ ‘Atlantic,’ MSEl49-5Y, ‘Michigan Purple,’ and
‘Yukon Gold’ were obtained fi'om the tissue culture bank maintained by the MSU Potato
Breeding and Genetics laboratory. Plants were propagated fi'om nodal cuttings in 25 x
150 mm culture tubes with general propagation medium (4.3 g/L MS salts, 3 % sucrose
(w/v), 1.1 uM thiamine, 0.55 mM myo-inositol, 1.4 mM sodium phosphate, 8 g/L agar,

pH 6.0) (Y adav and Sticklen, 1995).

flasmid Engineering;

Genes encoding Arabidopsis thaliana HPPD (PDSI) and HPT (HPT!) were
kindly provided by Dr. Dean DellaPenna (Department of Biochemistry, Michigan State
University). HPPD is encoded by the Arabidopsis gene locus PDSI (At1g06590) (Norris
et al., 1998), but will be referred to as At-HPPD for clarity. HPT is encoded by the
Arabidopsis gene locus HPT 1/ VTE2 (At2g1 8950) (Collakova and DellaPenna, 2001), and
will be referred to as At—HPT. All genes were subcloned into the plant transformation
vector, pSPUD4, a derivative of pBIl21 (Clontech, Palo Alto, CA) (Figure 2). A 1,737
base-pair (bp) BamHI-Xbal fragment containing the HPPD open reading frame was
subcloned into pSPUD4 to generate pHPPD. The HPT coding sequence was PCR
amplified and cloned into pCR-XL-TOPO (Invitrogen, Carlsbad, CA); subsequently a
1,577 bp BamHI fragment was subcloned into pSPUD4 to construct pHPT. The

sequenced plant transformation vectors were introduced into Agrobacterium tumefaciens

24

strain LBA 4404 by electroporation, using a Bio-Rad (Hercules, CA) electroporator and
cuvettes according to manufacturer’s instructions.

For use in eventual construction of multi-gene vectors, the Saccharomyces
cerevisiae T yrI gene encoding PDH was amplified by direct PCR on yeast strain W 303
a, a gift of Dr. John J. LaPres (Department of Biochemistry, Michigan State University).
The sequenced product was cloned into pCR-XL-TOPO (Invitrogen, Carlsbad, CA) and a
1,450 bp fiagment subcloned into pSPUD4 using the BamHI restriction site to generate

pPDH. Primers for cloning, PCR, and RT-PCR are listed in Table 2.

Plant Transformation:

Four genotypes of tetraploid cultivated potato (Solanum tuberosum), ‘Spunta,’
‘Atlantic,’ ‘Michigan Purple,’ and MSEl49-5Y, were selected for transformation with
vectors pHPPD or pHPT. These genotypes were selected for their high transformation
efficiencies, and for differing flesh and skin colors. The media used for transformation
was developed by Yadav and Sticklen (1995) and the transformation protocol was used
from Douches et al. (1998). Leaf and intemode segments were cultivated on callus
induction medium (4.4 g/L MS salts, 3 % sucrose (w/v), 0.9 mg/L thiamine-HCI, 0.8
mgL trans-zeatin riboside, 2 mg/L 2,4-dichlorophenoxy acetic acid, 7 g/L agar, pH 5.8)
for two days, followed by co-cultivation for four days with A. tumefaciens LBA 4404
carrying either plasmid pHPPD or pHPT. The explants were then washed in a 10 ug/ml
solution of Timentin (Glaxo Smith Kline, Philadelphia, PA) to remove the bacteria, and
transferred to shoot induction medium (4.4 g/L MS salts, 3 % sucrose (w/v), 0.9 mg/L

thiamine-HCl, 0.8 mg/L trans-zeatin riboside, 2 mg/L gibberellic acid, 200 mg/L

25

Timentin, 50 mg/L kanamycin, 7 g/L agar, pH 5.8). The explants and developing callus
were transferred to new shoot induction medium every 7 to 10 days. Once developing
shoots had initiated leaves, they were excised from callus and rooted in culture tubes
containing general propagation medium. (All recovered shoots were labeled to ensure
propagation of a single shoot originating fiom each independent transformation event.
Transgenic shoots were selected on general propagation medium containing 50 mg/L
kanarnycin. Shoots that successfully rooted were propagated, planted in the greenhouse,
and confirmed by PCR (see Table 2 for primers).

Spunta lines resulting from transformation with Agrobacterium carrying pHPPD
were designated SpHPPD, followed by an arbitrary number representing the order in
which the shoots were removed from callus. Similarly, Spunta lines transformed with
pHPT were designated SpHPT, MSEl49-5Y lines transformed with pHPPD were
designated EHPPD, and MSEl49-5Y lines transformed with pHPT were designated

EHPT.

26

_IEmm .9?

I? is. was... lag: a... $.8sz]
mm m3

\

iguml 3E2 Em T

.mnx
i 3 82 Sam T1

£85 £58 5302' now—«83mg :83 EA

ll 3 8: mELJ: as .E..% £93.. 832580 .N Baa
_IEmm _IEwm

 

 

 

 

 

 

27

toga “EH.

OOO<O<HOHOOB¢OOO<OO¢OO 8.8%:

 

 

28

to? £9 0404004404000444994040400 EEOC 4.8.4 .34
488 £9 44904444090480940448980404 ”was:
to? E9 8444840094090990009099040 vague 99044 4.4
488 E9 o4o44904484o44408944084o cage
:82 £9 04840440009480.8948904804 vague 333-9% 4.9.
:82 £9 94444084444483.489489484 saga
:88 3:. 8.4944948494888888 vague omsaocmsgfifi 0338888 4w
482 £9 8944888949444884090 ”mass
:82 449 48890080889409.9888 waste 384539508 338801 4.9.
:88 E9 44904488948989804984 sage
toaoc «EH H4OOH§OOOBOBOOOOHO§O “c838.“ 839.68 Saaamoaafixfihmaqfiom 4w.
:82 E9 94904884448499.44448409044 ease
:88 E9 09904080408909.9094849494 vests 08884.38 aaomos 4.9.
89-2 05.39
:82 £9 809844048888448048 ”age
:82 £9 40808890890480484 EEOC 3%
:88 E9 04434040440444884848480 sage
:82 E9 09484848408408848 waste 490$
:88 E9 494oEoE8848484E44 as?
488 E9 9484848408408848 vague 49.94
uncommghmo ooaomoua 500
38 .4 3 e088 84094448494949.44988440 cage
38. .4 e 888 0409940449484040949009489008948 vague 429 038% as; com Em. £34
:88 £9 894009049044049098 sass
:88 :9 89.994044998440888 $23 429 Ema sow 99% £944
oococomom oocoscom 309:5

 

dog com moocoscom 8895 .m 0348

Plant GrowinLConditions:

Tissue culture propagated plants were planted in the greenhouse in Baccto High
Density media (Michigan Peat Company, Houston, TX) in 4-inch pots and subsequently
transferred to S-gal pots after 1 month. The plants were fertilized using Osmocote (Scotts,
Marysville, OH) according to manufacturer’s instructions, and watered weekly with a
dilution of 2020-20 fertilizer (Scotts, Marysville, OH) according to manufacturer’s
instructions. Young plants were treated with Marathon granules (Olympic Horticultural
Products, Mainland, PA) and sprayed with Conserve (Dow AgroSciences, Indianapolis,
IN) to prevent whitefly and thrip damage. Additionally, plants grown in the spring were
treated every two weeks with Stature DM (SePRO, Carmel, IN) to control early blight.
HPPD transgenic lines were grown in the greenhouse from July until November 2005
with untransformed Spunta and MSEl49-5Y control plants. HPT transgenic lines were
grown in the greenhouse from February 15 to May 6, 2006 with untransformed control
plants and four selected HPPD lines.

Location of the plants in the greenhouse was randomized for all experiments, and
re-randomized every three weeks to reduce the possibility of variation resulting from
different light intensities or temperatures within the greenhouse. Six plant replicates of
each independent line were planted. Tubers were harvested by hand and immediately
protected from light. Following determination of the fresh weight yield from each plant,

the tubers were stored at room temperature for two days and subsequently stored at 4°C.

29

High Performance Liquid Chromflgrgphv (HPLC):

A screening procedure was adopted to rapidly select lines that had higher
tocopherol levels than controls due to limited access to HPLC equipment. Lines selected
from the screen were then characterized in detail. Transgenic lines were screened for
enhanced leaf tocopherol levels using three plant replicates and pooled leaves, and
characterized using five plant replicates and pooled leaves. Transgenic lines were
screened for enhanced tuber tocopherol levels using two plant replicates and two to three
pooled tubers from each plant, and characterized using five plant replicates and pooled
tubers. In all screens, the measurements on control untransformed plants were replicated
five times. Two lines of each genotype/vector combination were selected for
characterization of tuber tocopherol content. Tubers for characterization were harvested
from plants that had been grown together under the same conditions and in the same time
period.

Method for extraction of total lipids from potato tuber was developed based on
published protocols (Romer et al., 2002; Sattler et al., 2003). Tubers that had any traces
of green were not used for analysis. The exact mass of tissue extracted was recorded for
each sample. Total lipids were extracted from approximately 0.5 g fresh tuber
homogenized in a commercial blender and immediately suspended in 2.5 ml extraction
buffer (methanolzchloroform 2:1, BHT 1 mg/ml and tocol 1.25 ug/ml) to which was
added 2 ml Tris-HCl (50 mM, pH 7.5) and 500 pl chloroform. After vortexing for 2
minutes and centrifugation at 3000 x g for 10 minutes, the dried residue from the organic
layer was resuspended in 100 pl acetonitrile. Fifty u] was injected for HPLC analysis on a

Spherisorb ODS-2 5 pm, 250 x 4.6 mm reverse phase column. Tocopherols were detected

30

by fluorescence using 290 nm excitation and 325 nm emission, identified by retention
times, and quantified by integrating peak area relative to nanograms of tocopherol in
standard curve samples. Tocopherol standards and toool were obtained fi'om Matreya
(Pleasant Gap, PA).

Leaf tocopherol content was determined by extracting total lipids from 30 mg of
pooled leaf tissue (modified from Sattler et al., 2003). The tissue was ground in liquid
nitrogen, and extracted as above with proportionately adjusted volumes of buffer and
solvent. The resuspended residue was injected as for tuber samples. Only newly

expanded, healthy, unshaded leaves were used for analysis.

Polymerase chain reaction (PCR):

Primers were designed using DNAStar (DNAStar Inc, Madison, WI), or by visual
examination of sequences (Table 2). Compatibility of primers was evaluated using
OligoAnalyzer 3.0 (IDTDNA, Coralville, IA). Primers were ordered from IDTDNA
(Coralville, IA).

Plant genomic DNA was isolated using the Qiagen (Valencia, CA) DNAEasy kit
according to manufacturer’s instructions, or CTAB extraction method (modified from
Monsanto Biotech. Reg. Sci., 2004). The CTAB method consisted of grinding 2 g fresh
leaf tissue in 7 ml extraction buffer (0.1 M Tris HCl pH 8, 1.4 M NaCl, 0.02 M EDTA
pH 8, 2 % hexadecyltrimethylammonium bromide (w/v)) with proteinase K (1
mg/ 100ml). Samples were incubated at 55°C for 1 hour and mixed every 10 minutes.
After cooling, 7 ml phenolzchloroformzisoamyl alcohol (25:24:1 vzv) was added and

tubes were inverted to mix. Centrifugation was performed at 3000 x g for 10 min, and the

31

supernatant transferred to a new tube. The phenolzchloroform extraction was repeated
three times, with 50 ul RNase A (10 mg/ml) being added and the sample incubated for 30
minutes at room temperature before the final extraction. Six ml cold isopropanol was
added to precipitate the DNA, followed by centrifugation at 7000 x g for 20 minutes. The
pellet was washed with 2 ml 70 % ethanol and resuspended in 500 pl Tris-EDTA.
Primers for PCR were used at a final concentration of 25 pmol/ul. Invitrogen
(Carlsbad, CA) Taq polymerase, buffer, and MgClz were used according to
manufacturer’s instructions. All PCR programs consisted of an initial step at 94°C for 4
minutes, followed by 25 to 30 cycles of amplification. Each cycle consisted of 45 seconds
at 94°C, 45 seconds at the optimal calculated annealing temperature of primers, extension
for 1 min per 1 kilobase product at 72°C, and a hold cycle at 4°C. Products were
visualized by electrophoresis on 0.8 % agarose gels stained with 0.01 mg/ml ethidium

bromide.

ml-time RT-PCR:

Primers to amplify endogenous potato homologues of vitamin E biosynthetic
genes were designed based on consensus cDNA sequences obtained from The Institute
for Genomic Research Potato Gene Index (TIGR Gene Index Databases, 2004). All
primers were tested for specificity using genomic DNA as template, and further tested
using cDNA template. Sequence data was obtained to verify the identity of the PCR
products. Amplification of a single product of the predicted size was verified by
examining dissociation curves and by electrophoresis of the product on 0.8 % agarose

gel. Primers used to compare transcript levels of transgenes were designed to anneal to

32

transgene sequences dissimilar from endogenous homologues by examining aligned
sequences using BLAST (Altschul et al., 1990). Primers for amplification of transgenes
did not produce amplification products from genomic DNA of untransformed plants.

To extract RNA, tissue samples wereharvested and immediately frozen in liquid
nitrogen, then homogenized with mortar and pestle. RNA from 30 mg leaf tissue was
extracted using the Machery-Nagel plant RNA kit according to manufacturer’s
instructions. Traces of genomic DNA were removed by applying DNase directly to the
column, incubating for 30 minutes, and washing the column. RNA was quantified by
spectrophotometry and first-strand cDNA synthesis performed using Moloney Murine
Leukemia Virus reverse transcriptase (M-MLV RT) (Invitrogen, Carlsbad, CA) and gene-
specific primers (Table 2). The manufacturer’s protocol was modified as follows:
following denaturation at 65°C, the reaction was incubated at the average optimal
annealing temperature for the primers, then chilled on ice before addition of M-MLV RT.

Real-time measurements were made using a MX4000 thermal cycler (Stratagene,
La Jolla, CA) and SYBR green with ROX reference dye. Comparative threshold (C,)
values were normalized to B-tubulin internal control and compared to obtain relative
expression levels. In reactions to which no reverse transcriptase had been added,
fluorescence was below background levels (no Ct), indicating the absence of
contaminating genomic DNA. All experiments were conducted with two to three plant
replicates, from which RNA was extracted and cDNA synthesized independently. All
experiments were performed two to three times on different days. Genotype ‘Yukon
Gold’ was used for experiments to determine transcript levels of endogenous potato

genes.

33

Southern Andy/sis

Southern analysis was performed according to the method of McGrath et a1.
(1993). Total plant genomic DNA isolated by CTAB extraction method (see above) was
digested overnight using 13le restriction enzyme (New England Biolabs, Beverly,
MA). Approximately 10 pg of the restricted fragments were separated on a 0.8 % agarose
gel at 3 Wm voltage and using TAE running buffer (40 mM Tris-acetate, 1 mM EDTA).
The gel was treated in 0.2 N HCL for approximately 10 minutes, followed by
denaturation in 1.5 M NaCl, 0.5 M NaOH for 30 minutes. The gel was equilibrated in
alkaline transfer buffer (1.5 M NaCl, 0.25 M NaOH) for 10 min and blotted onto a
Hybond N+ positively charged nylon membrane (Amersham Biosciences UK Limited,
Buckingharnshire, England) using downward capillary transfer. The membrane was
irradiated at 0.12 J for 1 minute using a Spectrolinker XL-l 000 (Spectronics Corporation,
Westbury, NY) and baked at 60°C for 1 hour.

A 366 bp probe against the nptII gene was amplified from plasmid DNA (P1:
ACCTTGCTCCTGCCGAGAAAGTAT, P2: TATCACGGGTAGCCAACGCTATGT).
Approximately 50 pg probe was labeled overnight using a Random Primers DNA
Labeling kit (Invitrogen, Carlsbad, CA) according to manufacturer’s instructions.
Residual unincorporated nucleotides were removed by purification through a Sephadex
column.

After wetting the blot in 2X SSC, prehybridization was carried out with constant
agitation at 65°C overnight in 5X SSPE, 0.5 % SDS, and 5X Denhardt’s reagent with 20
pg/ml fragmented salmon testes DNA. Purified, denatured, radiolabeled probe was

hybridized to the blot in 10 ml total volume of prehybridization solution with constant

34

agitation and overnight incubation at 65°C. The blot was washed in 2X SSC, 1 % SDS
(w/v) for 15 minutes at room temperature, followed by a wash in 2X SSC, 1 % SDS at
65°C, and two 15 minute washes in 2X SSC, 0.1 % SDS at 65°C. The blot was exposed
to Hyperfilm MP film (Amersham Biosciences UK Limited, Buckingharnshire, England)

for 33 hours at -80°C and developed.

Statistical Analysis

Results from experiments were analyzed using PROC GLM program of SAS
(SAS Institute, 2005). Statistically significant differences were determined using a one-
way ANOVA and by making pair-wise comparisons between least squares means. Means

were considered significantly different at a level 0.05.

Images in figures 4, 10, and 11 are presented in color in the original thesis.

35

RESULTS
flant Transformation

Transformations with vectors pHPPD and pHPT were conducted with four
different potato genotypes: ‘Atlantic,’ MSEA149-5Y, ‘Spunta,’ and ‘Michigan Purple.’
Callus developed in cultivars Atlantic and Michigan Purple; however, no shoots were
formed. Transformation was successful in cv. Spunta and MSEl49-5Y (Table 3).
Transformation was slightly more efficient in cv. Spunta, yielding 38 shoots from
transformation with the pHPPD vector (SpHPPD), and 9 shoots from pHPT (SpHPT).
MSEl49-5Y yielded 30 pHPPD regenerants (EHPPD) and 3 pHPT regenerants (EHPT).
All shoots were able to root in selective media containing kanamycin (50 mg/L), with the
exception of two SpHPT lines that were subsequently discarded.

From among the 68 putative pHPPD transforrnants, 10 individual SpHPPD lines
and 11 EHPPD lines were randomly selected for further study. Following planting in the
greenhouse, the presence of At-HPPD and nptII in these 21 lines was confirmed by PCR.
Additionally, seven SpHPT lines and three EHPT lines were verified to be positive for
At-HPT and nptII. Images of representative gels used for PCR confirmation are shown in

Figure 3.

36

 

 

 

42 42 42 42 42 42 o o 2839 $4.32
42 42 42 42 42 42 o o 3844
m : m 2 m 8 m 8 99-94592
9 S 9 2 9 mm 9 mm 38%
99.2a 9229 9.224 92% 99929 Emma 992AH Emma
obflfimom mom won—m on. mom .gx E «Von—o om 398.850on .02

.ocommfih 099.8%8 ufi com “Samoa on 3 venom 84.50 .8983 05 was .ocommaah $64.99-“? .8 QnmnwEAvx
ofi mo 3480a 05 .8.“ «828. 3380 89834 08. Adwahofl thgafix 995348 £88 2.. “ooc o» 034 303
“as... 300% mo .8983 05 .9393“.on .05 weafioaomfl 933083 was “8.8308 38% mo 8983 29.

388%: 3239 Emma «69. Qmmmm 9.8809. 29. fig mogoaom @3633 .8.“ 3398 40935.8.“ch .m 0399

37

Figure 3. Confirmation of presence of At—HPPD and At—HPT in transgenic plants by
PCR. PCR products were electrophoresed on 0.8% gels and amplification of the pre-
dicted size product was ascertained visually. M: molecular marker. Sp: template fiom
Spunta untransfonned plants. MSE: template from MSEl49-SY \mtransformed plants.
Numbered lanes: template from transgenic lines.

A, Remesentative PCR products from reactions to amplify At—HPPD from genomic
DNA of SpHPPD transgenic plants. pHPPD: positive control plasmid template. B, Rep-
resentative PCR products from reactions to amplify At—HPT from genomic DNA ofHP'I‘

transgenic plants. pHPT: positive control plasmid template. Primers used for PCR are
listed in Table 2.

$p9 SplO Spll Spll Sp13 Splfi pHPPD 5p

.\l Sp MSE Sp} Sp4 Sps Sp6 3p? SpS Sp9 E1 E2 E3 pHPT

 

38

Metefization of HPPD-overexpressingjflagg

SpHPPD and EHPPD transgenic plants were grown in the greenhouse with
untransformed cv. Spunta and MSEl49—5Y control plants. The growth, foliage, flowers,
and tubers of transgenic and untransformed plants could not be distinguished from one
another visually (Figure 4). All plants completed their life cycle normally.

Ten SpHPPD transgenic lines were screened for enhanced a-tocopherol levels in
leaves. Four lines, SpHPPD], SpHPPDZ, SpHPPD13, and SpHPPD17, were higher than
untransformed controls (average of 8.1 ug/gfw compared to 5.8 ug/gfw for control), but
these differences were not statistically significant with two replicates. These four lines
were selected for firrther characterization with five replicates. Leaf a-tocopherol levels
were shown to be significantly higher than untransformed cv. Spunta in all four selected
transgenic SpHPPD lines (P < 0.01), while cv. Spunta and MSEl49-5Y controls were not
significantly different from one another. Percent increase in a-tocopherol ranged from 41
to 112 %, with untransformed cv. Spunta accumulating 7.4 pg a—tocopherol per gram
fresh weight (gfw) and transgenic plants accumulating 12.4 ug/gfw on average (Table 4,
Figure 5).

Tubers from transgenic plants overexpressing At-HPPD or At-HPT did not exhibit
changes in tocopherol composition. As in tubers of untransformed plants, tubers of
transgenic plants accumulated over 90 % of tocopherols as a-tocopherol, y-tocopherol
was barely detectable, and 5- and B-tocopherol were not detected (Figure 6). For all
subsequent experiments, a—tocopherol levels were quantified by integrating peak area

relative to an a-tocopherol standard curve.

39

 

Figure 4. Phenotype of HPPD Transgenic Plants. A, Spunta untrans-
formed control (left) and representative SpHPPD transgenic plant. B,
MSEl49-5Y untransformed control (left) and representative EHPPD
transgenic plant. C, Representative tubers from Spunta (lefl) and line
SpHPPDl3, both harvested from 2.5-month-old plants. D, Representa-
tive tubers from MSEl49-5Y (lefl) and line EHPPD6 harvested from 5-
month-old plants. E, Representative tubers from MSEl49-5Y (left) and
line EHPPDIZ harvested from 2.5-month-old plants.

40

 

 

2.... mmood we Vow
mm @256 VA N:
hm. Noood 5N VNH
m: :50de MN many
v.0 Vb
mmmbo we may
88.88.. AK. 0288 8 flammxmé

2888038 808

92 922%
m 2 884m
848%
884m
888m

Wndimmz

.mogboaom 880% ogmo 483a 880%888
8.. 8.8% 458034 322: “88988.8 Mung 03838 2 88am 3
8.8088 29.3 Mmdvfimmg vogommqaha: 8 :53 20.828084. mam: 888
SF .8805 880%888 08 88.8.5288 808.88 8237a :4. .God

".8 450qu 29.3-80 a 5 8.823 84.08 8850 808888 35-8.88
.3 88.8888 803 808.8% 8834 hfiofiafim 38803308 new

mo omaeoea 08 808.88 8963 .388 9.85% 880%888 3 8.80288
3880Mm§b anfima Susan mo 3.943 E 8088 38880Hé .v oBaH

41

 

Leaf alpha-tocopherol ug/gfw

 

 

 

G 3 t S a 2

Q 5 D o. o. D

n. n. n. a. D-

E ‘0 % :l: I %

O. O.

2 m 6’ (3 a.
Line

Figure 5. a-Tocopherol levels in leaves of four Spunta transgenic lines transformed with
pHPPD. Tissue culture-derived plants were grown in the greenhouse for 2 months prior
to quantification of a-tocopherol by HPLC. Each line represents the average 2!: standard
deviation of five measurements (five biological replicates, pooled leaves). Statistic‘AIly
significant differences were determined by pair-wise comparisons at a = 0.05 using one-
way ANOVA. Lines significantly different from untransformed Spunta are marked ‘2

42

 

 

 

919_ _.
753
till
3.

 

S
V
7
0
9

88888...

 

 

 

 

458m 8 .

-888 _88 m8? 88.588 88 mag—.28 3 c8 08 88qu ~80
-8885 8 8 w8888 84 884 M88 8szqu an 8888::
83 88828855 .8888 8: 803 882888-“. e8 .w .888
980.888 8 8.88888 8 888 8 8888 8: 803 838
c8 .8888 mo :8: 08 88 83 88888.-» .858 8:8 888
8 8888 m 888 .8 88 88.28 08 we? 38888.8 280
-8886 88888 88 88888-» genome—c8 688m :8
.888 :88 8 8888888 88 8.8 wfikofi 8888 88 w md
a mo amen—8m 0.3: Sou 88888 38888808 .e 085

 

 

 

S rszgoz

8

8:4

 

 

43

Mature tubers harvested from 22 HPPD lines and untransformed controls were
screened for enhanced (it-tocopherol levels to identify lines for further characterization
(Figure 7). Two SpHPPD lines and two EHPPD lines with means higher than controls
were selected for characterization. These four lines accumulated an average 302 ng/gfw
tuber compared to an average 202 ng/gfw in controls, corresponding to an approximate
50 % increase (Table 5). Notably, line SpHPPD13, which accumulated a-tocopherol in
leaf tissue at significantly higher levels than control plants, also had a higher mean a-
tocopherol level than control plants in tuber tissue. Other than line SpHPPD13, no
positive correlations were found between tuber and leaf a-tocopherol levels.

Real-time RT-PCR was used to compare the expression level of At—HPPD in the
four selected transgenic lines, SpHPPDlB, SpHPPDIS, EHPPD6, and EHPPD12. The
primer sets used did not amplify genomic DNA from untransformed plants, the RNA
preparations were shown to be free of contaminating genomic DNA since reactions
containing no reverse transcriptase produced no amplification, and the dissociation
curves generated from amplification of the cDNA showed a single, distinct product.
Figure 8 shows representative PCR products electrophoresed on a 0.8 % gel. High levels
of the At-HPPD transcript were detected in all four transgenic lines, with low variability

between lines (Figure 9).

44

 

 

 

 

soo- “'
2’
0400‘
C
6
b
a)
.C
§-300- ’
o
‘7‘
(u
.c
2200‘
or
L
a)
.o
3
l‘100- .
or
FNMNOONmmhflervaNmem>
ooooovwrvwgooooooooovvm
mammmooflooanmamamaadood,
amaammlmllfimaamamaammfl-v
IIIIID-O-O-D-O- IIIIIIIIIn-n-F
ananaIIIII LumuJLouuJuJquIIUJ
WWWWUDQQQQO. LIJLIJU)
wmwwm T T 5
Line

Figure 7. Results of a screen of 11 HPPD transgenic plants for enhanced u-tocoph-
erol levels in tubers. Tissue culture-derived plants were grown in the greenhouse
for 5 months prior to quantification of a-tocopherol by HPLC. Each line represents
the average i standard deviation of two measurements (two biological replicates,
pooled tubers) for transgenic lines and five measurements (five biological repli-
cates, pooled tubers) for untransformed controls. Pair-wise comparisons at a = 0.05
using one-way ANOVA revealed no significant differences between lines. Lines se-
lected for further characterization are marked T.

45

Table 5. a-Tocopherol content of tubers of HPPD transforrnants and

controls. Values represent the mean of two measurements

(transgenic lines) or the mean of five measurements (untransformed
controls). Statistically significant difl‘erences were determined by pair-
wise comparisons of least means squares in a one-way ANOVA (o.

= 0.05). All p-values represent comparisons to the respective

untransformed genotype.

mean 1).-tocopherol

 

(ngfgfw') p-Value

Spunta 169.5 72.9

SpHPPDl 125.3 5.3 0.7314
SpHPPD2 154.9 67.6 0.6990
SpHPPD3 212.3 146.6 0.9845
SpHPPD? 145.7 17.5 0.7247
SpI-IPPD9 197.2 76.9 0.7492
SpHPPDIO 131.8 35.1 0.7044
SpI-IPPDIZ 176.4 35.4 0.9774
SpI-IPPD13 276.8 249.5 0.0823
31611991315 241.5 74.1 0.4511
SpI-IPPD17 183.6 16.6 0.8454
MSEl49-5Y 234.7 92.2

EI-IPPDI 236.4 276.2 0.7938
EI-IPPD2 213.0 143.5 0.7948
EI-IPPD3 201.9 81.6 0.5890
EI-IPPD4 207.1 70.4 0.6602
EHPPD5 246.9 71.5 0.9809
EHPPD6 318.9 37.5 0.3319
EHPPD? 252.7 18.5 0.7850
EHPPD8 353.3 127.6 0.6974
EHPPD9 294.9 90.0 0.8833
EHPPDIZ 369.8 82.4 0.3009
EHPPD13 134.1 106.5 0.3097

 

46

gnu—=— uiwmunuuflmo §§§l<§§§§§u§
iiQflnfiEV §:§g§ofigéflu§i§

Ann—558mm fAHfivgfiuEéSgnggw—Efilg
giggeflianafiaanmafinfimfifia an; Agni—um «pawn

 

 

140

120 -

100 -

% Beta-Tubulin

80-

 

 

 

SpHPPD13 SpHPPD15 EHPPDB EHPPD12

Line

Figure 9. Relative transcript levels of the At-IH’PD transgene in characterized HPPD
transgenic lines. Real-time RT-PCR was used to obtain data on relative transcript
abundance (see Table 2 for primers) and plotted as comparative threshold values nor-
malized to Beta-Tubulin internal control. Each line represents the average 1- standard
deviation of two individual measurements.

48

Meterization of HPT-Overexpressing Plants

With the exception of three SpHPT lines, growth and morphology of HPT
transgenic plants and control plants were indistinguishable by visual means. The seven
lines that did not have altered morphology flowered, produced fruit, and developed tubers
indistinguishable from those of control plants (Figure 10). Fresh weights of tubers were
not significantly different from controls at a = 0.05; except in line EHPT], which showed
a marginally significant increase in average tuber yield (P = 0.0274) (Table 6).

Three SpHPT lines showed an exceptionally abnormal phenotype (Figure 11). In
tissue culture these lines grew slowly and exhibited small leaves with altered
morphology. In the greenhouse, plants had stunted growth, exhibited thick, brittle,
wrinkled leaves, developed poor root systems, and had significantly lower tuber yields
than control plants (P < 0.001) (Table 6).

Tubers from the HPT lines, including those with abnormal morphology, were
harvested and screened for increases in a-tocopherol (Table 7, Figure 12). Two of the
three EHPT transgenic lines had higher mean levels of a—tocopherol than untransformed
control MSEl49-5Y. EHPT] accumulated 613 11ng and EHPTZ accumulated 801
ng/gfw, compared to 550 ng/gfw in control MSEl49-5Y. Surprisingly, none of the seven
SpHPT lines showed a clear increase in a-tocopherol content compared to control plants.
The highest mean was 523 ng/gfw in SpHPT7, and was not significantly different from
the mean of untransformed cv. Spunta, at 469 ng/gfw. The mean a-tocopherol levels of
four lines were lower than the control mean. These four lines had average a-tocopherol

levels of 294 ng/gfw, 321 ng/gfw, 333 ng/gfw, and 434 ng/gfw.

49

 

Figure 10. Phenotype of normal HPT Transgenic Plants. A, Spunta un-
transformed control (left) and representative SpHPT transgenic plant. B,
MSEl49-5Y untransformed control (left) and representative EHPT trans-
genic plant. C, A SpHPT transgenic plant flowering. D, Representative
tubers from Spunta (left) and line SpHPT7, both harvested from 2.5-
month-old plants. E, Representative tubers from MSEl49-5Y (left) and
line EHPT] harvested from 2.5-month-old plants.

50

Table 6. Tuber fresh weight for transgenic plants and control
plants. Values are the mean of six measurements (transgenic

lines) or the mean often measurements (untransformed

controls). Statistic ally significant difl‘erences were determined
by pair-wise comparisons of least means squares in a one-way
ANOVA ((1.: 0.05). All p-values represent comparisons to

the respective untransformed genotype.

Spunta
SpHPT3
SpHPT4
SpHPT5
SpHPT6
SpHPT?
SpI-IPT8
SpHPT9
SpI-IPPD9
SpHPPD 1 3
SpHPPD 1 5
MSE14 9- 5 Y
EI-IPTl
EHPT2
EI-IPT3
EHPPD 6
EHPPD 1 2

 

 

51

mean fw (g) p-value
157.18 27.45
184.45 35.80 0.1279
90.69 24.90 0.0003
151.32 44.12 0.7420
158.41 44.66 0.9450
185.35 30.87 0.1159
64.67 39.13 < 0.0001
72.77 31.96 <1 0.0001
136.34 40.70 0.2434
177.81 23.53 0.2481
163.60 29.58 0.7184
122.84 40.23
162.62 35.96 0.0274
94.67 39.53 0.1159
98.51 35.31 0.1994
148.03 25.12 0.1593
158.12 13.40 0.0498

 

‘V-

Figure 11. Phenotype ofaltered morphology SpHPT Transgenic
Plants. A, Spunta untransformed control (left) and representative
mutant SpHPT transgenic plant. B, Altered leaf morphology show-
ing prominent trichomes and mottling in 2-week—old SpHPT
mutant. C, Thickened stems and stunted growth of a 2.5-month-old
SpHPT mutant.

52

Table 7. a—Tocopherol content of tubers of HPT transforrnants and
controls. Values represent the mean of two measurements

(transgenic lines) or the mean of five measurements (untransformed
controls). Statistically significant difierences were determined by pair-
wise comparisons of least means squares in a one-way ANOVA (or.
= 0.05). All p-values represent comparisons to the respective
untransformed genotype.

mean a-tocopherol

 

(ng/gfw) sd p-value

Spunta 468.7 159.2

CSpI-IPT3 517.9 82.4 0.8565
CSpHPT4 332.6 204.4 0.6175
CSpI-IPT5 293.9 77.2 0.5223
CSpI-IPT6 433.7 223.6 0.7559
CSpHPT7 523.2 151.2 0.5591
CSpHPT8 925.1 1110.6 0.0808
CSpHPT9 321.2 45.4 0.9721
MSEl49-5Y 550.0 269.3

CEHPTl 612.9 121.7 0.8170
CEHPT2 801.3 66.9 0.3608
CEHPT3 502.2 268.5 0.8603

 

53

 

1500 -

 

1000 ..

Tuber alpha-tocopherol ng/gfw

 

 

 

:2
a
I
I.Ll

‘* SpHPT3
SpHPT4
SpHPTs
SPHPTs
SpHPTa
SpHPTg
Spunta
‘* EHPT1

«1- EH PT2 l .
MSE149.5Y

Line

Figure 12. Results of a screen of 11 HPT transgenic plants for enhanced a
-tocopherol levels in tubers. Tissue culture-derived plants were grown in
the greenhouse for 2.5 months prior to quantification of a-tocopherol by
HPLC. Each line represents the average :t standard deviation of two mea-
surements (two biological replicates, pooled tubers) for transgenic lines
and five measurements (five biological replicates, pooled tubers) for un-
transformed controls. Pair-wise comparisons at a = 0.05 using one-way
ANOVA revealed no significant differences between lines. Lines selected
for further characterization are marked 1'.

54

Transcript levels of At-HPT and the endogenous potato HPT] homologue (St-
HPT) were determined by real-time RT-PCR in seven transgenic lines. High levels of At-
HPT transcript were detected in all seven lines, including those that had lower mean 01-
tocopherol levels than controls (Figure 13). The endogenous potato St-HPT had lower
steady-state RNA levels than the transgenic At-HPT. Variation in levels of St-HPT
expression between lines was low, but Spunta transforrnants appeared to express the

endogenous HPT at slightly higher levels than MSEl49-5Y transforrnants (Figure 14).

Southern Analysis of HPPD and HPT Lines

Integration of the At—HPPD or At—HPT transgene was inferred by Southern
analysis of genomic DNA using a probe against the mat]! selectable marker gene. The
nptII probe did not hybridize to genomic DNA from untransformed Spunta or MSEl49-
SY, but produced a detectable signal in lanes containing pHPPD or pHPT plasmid DNA
affixed to the membrane (Figure 15). Integration of nptII, and by extension, At—HPPD or
At-HPT, was confirmed for 12 transgenic lines. All the lines tested contained a single
copy of the transgene, with the exception of lines SpHPT3 and SpHPT8, which had two

integrated copies.

55

 

140

120 -

100 .

% Beta-Tubulin

m.
, . .

.gg: .‘ t _. .
firming/z... 1.. 2 .. . -, .

. 73533.5 1“ V

80‘

60-

 

 

SpHPT3 SpHPTS SpHPT7 SpHPT9 EHPT1 E-IPTZ EHPT3

Line

 

- St-H PT
At-HPT

 

 

 

Figure 13. Relative transcript levels of the At-HPT transgene and the
endogenous St-HPTin characterized HPT transgenic lines. Real-time
RT-PCR was used to obtain data on relative transcript abundance (see
Table 2 for primers) and plotted as comparative threshold values nor-
malized to Beta-Tubulin internal control. Each line represents the aver-
age :t standard deviation of two individual measurements. No signifi-
cant differences in endogenous At-HPT were detected between lines
using pair-wise comparisons at a = 0.05 in a one-way ANOVA.

56

dog Juno Ba china
42835668656333.8159 §§~8e§§§§§
.3 3:53.53“ was Ecw. ”anagram £95 8 3368c 3632 95:0 mun—vol Rt
365 am 85862? a 9 Bears 83%? genre e5» 2 now 68.9. .\. M3
8 8838583 use eased Ed. 3398: 3888 an 4835949 3.
do 2662 .9695 Base 8988 s afiafias 54.9 953:6 03.84 .2 65mm

 

57

a—Sflfihumwmm HELd.‘ GJSDSH$ZQMH Hamméw GJSDSH.-H~Um MELKH gmfiflfixfi-50m ngum

. 'ii'livs; '._I’i

     

Figure 15. Southern analysis of 12 HPPD and HPT transgenic lines. Genomic
DNA was digested with EcoRI and hybridized with a probe against nptH to
infer the integration of At—HPPD orAt-IH’T. Integration of the transgene into
the genomewas confirmedforall 12 lines.Asingle copy ofthetransgene
was present, except in SpHPT3 and SpHPT8, where two copies were pm

58

a-Tocopherol Content of Selected HPPD and HPT Lines

Screens of tuber tocopherol levels permitted the selection of two lines each of
SpHPPD, EHPPD, SpHPT, and EHPT. As in previous experiments, tubers harvested
from Spunta transforrnants did not significantly differ in a-tocopherol levels compared to
tubers from untransformed control plants (Table 8, Figure 16). In tubers of SpHPT
transforrnants, no significant increase in a-tocophcrol levels could be detected. Means of
the two characterized SpHPT lines (459 ng/gfw and 507 ng/gfw) approximately equaled
the cv. Spunta mean (433 ng/gfw). The two characterized SpHPPD transforrnants
accumulated 338 ng/gfw and 367 ng/gfw (rt-tocopherol in their tubers, values that were
slightly lower than the control mean (433 ng/gfw).

In contrast to results in the Spunta genotype, three of the four transforrnants of
MSEl49-5Y had significantly higher levels of tuber a-tocopherol than the control (Table
8, Figure 16). Compared to untransformed MSEl49-5Y with a mean of 208 ng/gfw,
EHPTZ accumulated significantly higher levels of a-tocopherol, representing an increase
of 106% with a mean of 579 ng/gfw. This increase was highly significant at P = 0.0019.
EHPT1 also had higher levels of (it-tocopherol at 413 ng/gfw, but was not significantly
different from the control (P = 0.1483).

Additionally, the two characterized EHPPD lines accumulated significantly
higher levels of (it-tocopherol in tuber tissue than untransformed MSEl49-5Y. EHPPD6
had a mean of 502 ng/gfw, representing a significant 78 % increase over the control mean
(P = 0.0178). The best performing line was EHPPD12, which showed a 2.66-fold
increase over control values, and accumulated 1.03 pg a-tocopherol per gram fresh

weight tuber tissue. This increase was highly significant at P < 0.0001.

59

Table 8. a—Tocopherol content of tubers of HPPD and HPT transforrnants
selected for characterization. Two transgenic lines of each genotypefvector
combination were selected based on higher mean 1).-tocopherol levels than controls
in screening experiments. Values represent the mean of five measurements (four
biological replicates and pooled tubers). Statistically significant differences were
determined by pair-wise comparisons of least means squares in a one-way
ANOVA (01.= 0.05). All p-values represent comparisons to the respective

untransformed genotype.

mean u—tocopherol

 

(ng/gfw) p-value % change

Spunta 432.9 165.8

SpHPT3 458.6 53.4 0.7750 6
SpHPT7 506.7 99.4 0.4131 17
SpHPPD13 338.5 145.0 0.2969 -22
SpHPPDIS 367.4 147.0 0.4674 ~15
MSEl49-5Y 281.5 114.4

EHPT1 413.1 64.1 0.1483 47
EHPT2 578.6 109.9 0.0019 106
EHPPD6 502.1 136.4 0.0178 78
EHPPD12 1030.7 261.8 < 0.0001 266

 

60

1400

 

 

 

 

1200-

8

r£1000-

E

2

Q800-

8

2

d: 600-

.C

2-

(U

a 400-

£1

3

'1—

200-

o-
('0 In m is 3 g ‘- N >
5 a 1: I: 9 § 0 t: I: 3
n. a. :r: :1: ‘3. n. a I :r:
n. O. o. n. I u. u.l uJ ‘—
a a '9 9 w a a
w o) 2
Line

Figure 16. a-Tocopherol levels in tubers of two transgenic lines of each
genotype/vector combination were quantified using HPLC. Tissue culture-
derived plants were grown in the greenhouse for 2.5 months prior to analysis.
Each line represents the average i standard deviation of five measurements
(five biological replicates, pooled tubers). Statistically significant differences
were determined by pair-wise comparisons at a = 0.05 using one-way
ANOVA. Lines significantly different from the respective untransformed geno-
type are marked *.

61

Comparisons to Other Reports

Results in potato overexpressing At-HPPD or At-HPT under control of CaMV
35$ promoter were compared to results in Arabidopsis overexpressing these genes under
control of the same promoter (Table 9). Nanograms tocopherol were converted to
picomole (pmol) to facilitate comparison with other reports. Leaves of Arabidopsis and
potato accumulate similar levels of tocopherols (20 pmol per milligram fresh weight
(mgfw) and 17 pmol/mgfw, respectively). Overexpression of At-HPPD results in similar
increases in tocopherol content in the two species, with accumulation of an additional 7.4
pmol/mgfw in Arabidopsis and an additional 8.83 pmol/mgfw in potato.

To compare tocopherol content of tubers, leaves, and seeds, these tissues were
compared on a dry weight basis to adjust for differing water contents (Table 9).
Tocopherol contents in leaves and seeds of Arabidopsis overexpressing At-HPPD are
342.5 pmol/mgdw and 1377.38 pmol/mgdw, respectively, whereas tocopherol content in
tubers of potato overexpressing At-HPPD is as high as 11.58 pmol/mgdw. Tocopherol
contents in leaves and seeds of Arabidopsis overexpressing At—HPT are similar values in
the range of 1200 pmol per milligram dry weight (mgdw), but only 6.5 pmol/mgdw in

potato tubers.

62

.moom :84me 89m 838: Baumo has? omaacoocoa co SEQ h

 

 

toe: ME. 8.: 8 .m 8.8 8.: 8m mom 8.8 spa
:88 was Sn .3 .m 3.8 :3 ma. 2 .: 8.0 83
:88 an. 86.8 SEN 8.8 m3 8 8.8 E .: as
33...: Q8:
88 a a 883. 8.8.8 8.8“ 8.8 8.8 R 8.8 8.8 as
88 a a ”swap 8.8.: 8.82 8.: 8.8m mm 8.8.: :38 was
8835.
:69: 9F 8.... m: .m 8.8 8.0 8: an: So .33
85.5“
88 .8635 as 26360 8.8: 8.08 8.8 8.8 84 8.8 8.8 as: Em
88 68635 ea 9638 8.8: 8:8 8.: 8.3 R 8.8: 8.88 83
2.82.12.
ooceomom 3mg: 40% maehofin. hONE £0 sfimfihogm t5 ego 3W3: «mmaHMEhofinw

endowment “B 38:63 83.83 “X. gamma—Nb Sp

 

$53 230a v5 mfiuonfieava Weamoaxocoao-flmmm we“ -Hmm 5 E880 38.3808 mo acmfiaeoo .o 0389.

63

Relative Transcript Levels of Endogenous Pathway Genes

Real-time RT-PCR was used to obtain semi-quantitative measurements on the
transcript levels of four endogenous potato homologues of tocopherol biosynthetic genes.
Data on transcript levels in potato leaf tissue was obtained for geranylgeranyldiphosphate
reductase (GGDR), arogenate dehydrogenase (AD), y-tocopherol methyltransferase (y-
TMT), and homogentisate phytyltransferase (HPT). The expression level of GGDR was
significantly higher than all other genes studied (Figure 17). y-TMT was expressed at a

moderate level, but AD and HPT expression levels were very low (Figure 18).

64

 

% Beta-Tubulin

 

 

 

B-tub AD GG DR TMT HPT

Gene

Figure 17. Relative transcript levels of endogenous potato homologues of
tocopherol biosynthetic genes in leaves of ‘Yukon Gold.’ Real-time
RT-PCR was used to obtain data on relative transcript abundance (see
Table 2 for primers) and plotted as comparative threshold values normal-
ized to Beta-Tubulin internal control. Each line represents the average :h
standard deviation of two individual measurements. GGDR was shown
to be significantly different from all other genes tested by pair-wise com-
parisons using one-way ANOVA at a = 0.05.

65

 

§=H.§ EH...» £000 a - 0

.§§:§a 38383

J» H Elan 62503.00 3£m§_§w_§w H “Q00 .omnawoahaov
858on H a u§5fi>§< 003% as? <ZQ 33953 on 5053 8 50.5095
and :10 Au woflggoflgagoswfiuo 00,028.53 005530505303

03H. 40w vacuums Ex. x. O 50 Eggnog? 0003 «050» 0505.53:— 3855003.?
guano—0305 3805 3°50»ng £2.6— <ZME 2558 05.55330 8 «5035098
MEAME Eggs Eégggas M: 00:9..."

66

DISCUSSION

All of the genes encoding the biosynthetic enzymes for vitamin B have been
cloned in the past decade (DellaPenna, 2005a). The challenges that remain are to define
the role of tocopherols in the plant, to understand the regulation of the pathway, and to
apply this knowledge to engineer crops with enhanced vitamin E levels. Our work in
potato represents the first attempt to increase vitamin E content in a non-photosynthetic,
below-ground plant organ through metabolic engineering. As an important staple food
with high nutritional value and high consumption rates worldwide, research to enhance
the nutrient content of potato is a worthwhile endeavor.

Tocopherols accumulate in plastid or thylakoid membranes, where they are
purported to protect lipids from reactive oxygen species generated from photosynthesis
(Pefiuelas and Munné-Bosch, 2005). Potato tubers are non-photosynthetic and very low
in lipids (Klaus et al., 2004), precluding the physiological requirement for high levels of
tocopherols and limiting the capacity for their accumulation. Reports in the literature
suggest that potato has low natural variation in tocopherol levels among cultivated
varieties (Romer et al., 2004; Spychalla and Desborough, 1990). A screen of six varieties
conducted in our own laboratory revealed low natural variation of approximately 2-fold
(data not shown). Wild potato germplasm is extremely diverse, and there are 199 wild
Solanum species. It would be preferable to screen an optimized core collection
representing the germplasm diversity in order to minimize sample number, since
processing tubers for analysis by HPLC is tedious and requires ample replicates to show

statistically significant differences.

67

In light of the low endogenous levels of tocopherols in potato tubers and the low
natural variation in cultivated varieties, conventional breeding strategies alone do not
appear feasible for enhancing the tocopherol levels in potato. Therefore, we sought to
explore the possibilities of enhancing tocopherol content through genetic engineering of
plant metabolism. I

To test the individual effects of overexpression of specific tocopherol biosynthetic
enzymes, plant transformation vectors pHPPD and pHPT were constructed. Additionally,
the Saccharomyces cerevisiae prephenate dehydrogenase (PDH) gene (T yrI ) was cloned
by PCR and introduced into a plant transformation vector. Since overexpression of T yrI
in tobacco was shown to have no effect on tocopherol levels (Rippert et al., 2004), the
individual effects of T yrI on tocopherol synthesis in potato were not tested. Our research
was focused on overexpression of At-HPT and At-HPPD, which have been shown to
significantly increase tocopherol levels when expressed individually (Collakova and
DellaPenna, 2003; Savidge et al., 2002; Karunanandaa et al., 2005; Tsegaye et al., 2002).

Due to the heterogenous nature of potato cultivars, four different genotypes were
selected for Agrobacterium-mediated transformations with vectors pHPPD and pHPT.
We were interested in transforming at least two genotypes in order to observe a potential
influence of genetic background on the effect of upregulation of HPPD and HPT.
Transformations were conducted with cv. Michigan Purple because this genotype had
slightly higher levels of tocopherols in a screen of six genotypes (data not shown).
Cultivars Atlantic, Spunta, and MSEl49-5Y were selected because they have shown high
transformation efficiencies in our laboratory, and because they accumulate differing

levels of carotenoids in the tuber flesh. Since carotenoid and vitamin E biosynthesis are

68

closely related, we postulated that the level of production of carotenoids in a genotype
may influence its capacity for vitamin E production.

The cultivars Atlantic and Michigan Purple produced callus, but no shoots were
formed. Potato is known to display significant variation in transformation efficiency
among genotypes (de Vetten et al., 2003). Other work in our laboratory has indicated cv.
Michigan Purple does not regenerate efficiently from callus; however, the transformation
results for cv. Atlantic were surprising. A distinct difference in transformation success
was found with respect to the vector used, with far fewer regenerants being obtained with
the pHPT vector than the pHPPD vector. Additionally, three transgenic lines with altered
morphology were recovered from transformation experiments with pHPT. Since the
transformations with these two vectors were not conducted in the same time period, it
cannot be determined whether the differing efficiencies are related to the vectors
themselves, or some other factor. No explanation for these results is immediately
apparent with respect to current knowledge about ectopic expression of At-HPT.

Among the 78 transgenic lines obtained, three lines with altered morphology were
observed in transforrnants of cv. Spunta with pHPT. These lines exhibited stunted
growth, showed changes in leaf morphology, developed poor root systems, and produced
few tubers. Since this same phenotype has been observed previously in our laboratory
following transformation with unrelated vectors (Felcher et al., 2003), it is likely due to
somaclonal variation of plants derived from tissue culture, and does not appear to be
related specifically to overexpression of HPT. With the exception of the three lines
mentioned above, untransformed controls and transgenic plants performed equally well

under greenhouse conditions, yielding statistically similar fresh weights of tubers. The

69

performance of the transgenic lines must also be evaluated in the field to confirm results
obtained in greenhouse-grown plants. It might be expected that increases in vitamin E in
potato would lead to increased stress tolerance and productivity, since tocochromanols
are beneficial to the plant as scavengers of free radicals (Munné-Bosch and Allegre,
2002). While other groups have speculated that enhancement of tocochromanol
production could increase stress tolerance in crops, this has not been experimentally
proven (Cahoon et al. 2003; Munné-Bosch and Pefiuelas, 2003).

a-Tocopherol has been shown to protect lipids from damage due to oxidative
stress (Maeda et al., 2005; Sattler et al., 2004). In concordance with this observation,
tocopherol synthesis is tightly regulated and highly sensitive to the stress status of the
plant. Tocopherol levels are observed to increase 10-fold in plants exposed to high light
stress (Havaux et al., 2000), increase 4-fold in potato tubers following cold treatment for
40 weeks (Spychalla and Desborough, 1990), and increase 18-fold in Arabidopsis plants
subjected to high light and nutrient stress (Collakova and DellaPenna, 2003a). Since
minor differences in water status, nutrient availability, light intensity, temperature,
pathogen challenge, and multiple other factors lead to several fold changes in tocopherol
levels, conclusively demonstrating small but significant increases in tocopherols in
transgenic plants is a challenging task. Therefore, we adopted a procedure of screening
multiple lines for increases in tocopherol content, followed by detailed characterization of
selected lines using five replicates and pooled samples. Using these parameters, we were
able to demonstrate statistically significant changes in tocopherol content in leaves and
tubers of transgenic potato plants. Results from quantification of a-tocopherol in leaves

and tubers of potato plants agree with other reports in the literature, and are within the

70

limits of genotypic and environmental variation (Hofius et al., 2004; Romer et al., 2002).
Values for control plants vary between screening experiments (Figs. 7, 12) because these
plants were grown under different conditions at different seasons, and were analyzed at
different ages.

Plant tissues vary widely in tocopherol content and composition, with oil seeds
having the highest tocopherol concentrations and potato tubers having the lowest
(DellaPenna, 2005). While seed oils contain high tocopherol content, they accumulate
mainly y-tocopherol, which has 10 % the vitamin E activity of a—tocopherol (Shintani and
DellaPenna, 1998). Potato tubers, however, accumulate primarily (Jr-tocopherol, the most
active of the four isomers. The enzyme y-tocopherol methyltransferase (y-TMT)
catalyzes the conversion of y-tocopherol to a-tocopherol, and has been shown to be
limiting in seed tissue (Shintani and DellaPenna, 1998). Transgenic Arabidopsis
overexpressing HPT exhibit increased flux toward y—tocopherol synthesis, with the result
that y—TMT activity becomes limiting in leaves as in seeds (Collakova and DellaPenna,
2003). Our transgenic potato lines showed up to 2.6—fold increases in tocopherol content,
with no changes in tocopherol composition observed (Figure 6).

The pHPPD and pHPT transforrnants of cv. Spunta and MSEl49-5Y differed
greatly in percentage increase of tocopherols, although these genotypes have similar
yellow tuber flesh and similar endogenous tocopherol levels. Cultivar Spunta and
MSEl49-5Y are not related in parentage, with the former originating from a cross of cv.
Béa and USDA 96-56, and the latter developed from a cross of cv. Saginaw Gold and
ND860—2 (Hils and Pieterse, 2005). Notably, MSEl49-5Y includes traits introgressed

from the wild potato diploid Solanum phureja (Douches, personal communication). The

71

reason for the disparity in the effect of overexpression of HPPD or HPT in these two
genotypes remains unknown, and may reflect a difference in flexibility of isoprenoid
metabolism, abundance of precursors, or a number of other such factors.

Three individual transforrnants of cv. Spunta lines decreased in tocopherol
content by 3 to 22 %, although these decreases were not significant (Table 8). Co-
suppression was one possible explanation for the observed decrease in tocopherol content
in these transgenic plants, and has been observed previously when strong promoters such
as CaMV 358 are used (Napoli et al., 1990). To test this hypothesis, expression data for
At-HPT and the endogenous potato HPT] homolog were obtained for seven pHPT
transforrnants using comparative RT-PCR. Additionally, expression data for At-HPPD
was obtained in four pHPPD transforrnants. All transgenic lines tested expressed the
respective transgene at similar, high levels (Figs. 9, 13). No obvious correlations could be
detected between transgene expression level and tocopherol accumulation, due to low
variability in expression levels across the transgenic lines tested. Transgenic lines
overexpressing At-HPT did not show any changes in steady-state mRNA levels of
endogenous St-HPT compared to untransformed plants or between transgenic lines. The
minor decreases in tocopherol content observed in three transgenic lines were not
statistically significant and most likely represent error stemming from environmental
variation rather than a genotypic effect.

Southern analysis showed that most transformation events resulted in integration
of a single copy of the transgene, with the exception of two lines containing two copies of
the transgene. A probe against the selectable marker gene nptII was used since the

endogenous potato HPT] and PDSI are known to have a high degree of similarity with

72

the Arabidopsis transgenes used in this study and could result in unwanted hybridization
signals (TIGR Gene Index Databases, 2004). The nptII probe was demonstrated to
hybridize specifically to the nptII transgene since no signal was detected in genomic
DNA of untransformed plants and a signal was detected from plasmid DNA containing
nptII. All three transgenic lines with significantly higher tocopherol levels than controls,
EHPPD6, EHPPD12, and EHPTZ, were determined to have single copy insertions of At-
HPPD or At-HPT. Therefore, increased gene dosage cannot explain the higher tocopherol
levels in these lines. Positional effects of integration of the transgene into the genome
may explain the significant increases observed in EHPPD6, EHPPD12, and EHPT2. The
stress status of these plants was not quantified and remains an open question; however, it
would be unlikely that the increases in tocopherols in these lines are due solely to
increased stress, since great care was taken to firlly randomize the location of the plants in

the greenhouse and to sample from five replicate plants and pooled tissue samples.

Individual Effects of Overexpression of HPPD and HPT

While there are multiple indications that HPPD has an important role in
controlling flux to tocopherol synthesis, overexpression of At-HPPD in Arabidopsis has
little impact on tocopherol accumulation, resulting in a maximum 37% increase of total
tocopherols in leaves and a 28% increase in seeds (Tsegaye et al., 2002). Results from
quantification of tocopherols in leaves of potato plants overexpressing At-HPPD roughly
agreed with these previous reports. Four SpHPPD transgenic lines were shown to exhibit
increases in leaf tocopherols in the range of 41 to 112 %. In tuber tissue, overexpression

of At-HPPD seems to have a proportionately greater effect on tocopherol accumulation

73

than in leaves or seeds. Two MSEl49-5Y transforrnants overexpressing At-HPPD were
fully characterized, and showed highly significant increases in a-tocopherol of 78% and
266%, respectively.

Overexpression of At-HPT has been observed to result in increases in total
tocopherols of 4.4-fold in Arabidopsis leaves and 40% in Arabidopsis seeds (Collakova
and DellaPenna, 2003). Potato tubers from HPT transforrnants accumulated 106% higher
levels of a-tocopherol, indicating that overexpression of At-HPT leads to increased
tocopherol synthesis in tuber tissue. The differences in the magnitude of the increases
observed in these three tissues relates to their respective water contents (see Table 9), but
may also be affected by the availability of precursors for tocopherol synthesis and
differing flux control coefficients for HPT in the metabolic context of the tissue.

Compared to results in Arabidopsis plants expressing At-HPT or At—HPPD under
the control of CaMV 358 promoter, results in potato suggest the existence of a severe
metabolic block to tocopherol synthesis in tuber tissue (Table 9). Arabidopsis and potato
overexpressing At~HPPD show similar increases in tocopherols in leaves, resulting in
accumulation of an additional 7.4 pmol tocopherol per milligram fresh weight (mgfw) in
Arabidopsis and 8.83 pmol per mgfw in potato. Based on these results, it is probable that
the flux coefficient of HPPD and the availability of precursors for tocopherol synthesis in
Arabidopsis and potato leaves are similar, indicating that there are no significant species-
specific differences for tocopherol synthesis in potato and Arabidopsis. When leaves,
seeds, and tuber tocopherol contents of transgenic plants overexpressing At-HPT are
compared on a dry weight basis, tocopherol contents in leaves and seeds are found to be

similar values in the range of 1200 pmol per milligram dry weight (mgdw), but are only

74

6.5 pmol per mgdw in potato tubers. These results suggest the presence of a metabolic
block in tuber tissue that may be related to availability of precursors, regulatory
constraints, or the physiological capacity of tuber tissue for accumulation of tocopherols.
While we have demonstrated that overexpression of the genes encoding HPPD and HPT
lead to increased tocopherol accumulation in potato tubers, HPPD and HPT activity are

clearly not the only limiting factors.

Status of Applied Research to Increase Vitamin E Content in Crops

As the role of tocopherols in plants begins to be elucidated, a complex regulatory
network coordinating tocopherol synthesis with metabolism of chlorophyll and
plastoquinone is becoming apparent. The discovery of a phytol kinase activity that
recycles chlorophyll to phytyldiphosphate adds another element to this complex
metabolic network (Valentin et al., 2006). Understanding the regulation of tocopherol
metabolism in plants will help target efforts to engineer crops with enhanced vitamin E.
In potato tubers, the highest increase in tocopherols in our transgenic lines was 2.6-fold,
while tuber tissue is known to increase 4-fold in tocopherol content following cold
storage (Spychalla and Desborough, 1990). Thus far, transgenic approaches have attained
a maximum increase of tocopherols of only 7-fold in Arabidopsis leaves (Kanwischer et
al., 2005). Increases of total tocochromanols up to 11.5-fold have been attained in
soybean seed, but were due entirely to tocotrienol accumulation with a net decrease in
tocopherols (Karunanandaa et al., 2005). When one considers that under abiotic stress

conditions, tocopherol biosynthesis is increased approximately 18-fold in leaves

75

(Collakova and DellaPenna, 2003a), it is clear that the potential for tocopherol
accumulation far exceeds what we have been able to engineer.

In order to better understand the role transcriptional control may have in
regulating tocopherol synthesis, primers for RT-PCR were developed to quantify the
transcript level of homologues of four vitamin E genes in potato. These endogenous
genes were observed to be expressed at very different levels in potato leaves (Figure 17).
Homogentisate phytyltransferase (HPT) and arogenate dehydrogenase (AD) were
observed to have comparatively low steady-state RNA levels, and y-tocopherol
methyltransferase (y-TMT) was expressed at a moderately higher level. The steady-state
RNA levels of geranylgeranyldiphosphate reductase (GGDR) were significantly higher
than any of the other biosynthetic genes tested. In concordance with this result, increasing
the transcription levels of GGDR further by transgenic overexpression had no significant
effect on tocochromanol levels in transgenic Arabidopsis (Karunanandaa et al. 2005). It is
not surprising that GGDR is expressed at high levels in leaves, since it reduces
geranylgeranyldiphosphate to phytyldiphosphate, a precursor for both tocopherol and
chlorophyll synthesis. The necessity of chlorophyll for photosynthesis in leaves may
contribute to the difficulty of redirecting carbon toward branch points in the pathway, i.e.
toward tocopherol biosynthesis. In tuber tissue, however, chlorophyll is not synthesized,
and geranylgeranyldiphosphate is mainly a precursor for carotenoids (Figure 19). It
would be interesting to determine if GGDR activity is limiting in tuber tissue, and if
targeted overexpression of this enzyme combined with overexpression of HPT and HPPD

will direct carbon flux to the tocopherol pathway.

76

 

a £8896

 

 

 

 

 

 

a 88225 n .3 59,58
£22809 03.0an S
g. a $5892.83
:
82_8o~=§.w§§£me-~ 833% 88295 8385:?
8 l\ .2855
E: / o§§8§s
9888852 _ 85%?
22829.. 23a 8888
$5032 08.922.23.58.“
Sggceg S§§5§:§
843.8388

.088 r? 50 8:036 among Sea 35:02 55583 a ma
mafiamonmmv—znfiowggumw mam: 99353:“ 05055585 .9 oawm

77

As in the majority of metabolic networks studied to date, no single enzyme
appears to represent a major bottleneck for tocopherol biosynthesis, and successful
strategies to engineer enhanced vitamin E levels will require tissue-specific
overexpression of multiple pathway genes. Our results agree with those of Karunanandaa
et a1. (2005), who reported no significant difference between controls and the population
of transgenic events in Arabidopsis transformed with HPPD or HPT under the control of
the CaMV 358 promoter. Other studies have also indicated that tissue-specific expression
of vitamin E pathway genes has a greater average impact on enhancing tocopherol
production in these tissues than constitutive overexpression (Savidge et al., 2002;
Collakova and DellaPenna, 2003). Further research to enhance tocopherol contents in
potato tubers would be best conducted using a strong tuber-specific promoter, such as the
granule-bound starch synthase promoter (Romer et al., 2002).

Tocotrienols have been suggested to provide benefits for the plant and for human
health, but their accumulation is less desirable than that of tocopherols (J iang et al., 2004;
Kamal-Eldin and Appelqvist, 1996). Recent data suggests that the bifunctional
prephenate dehydrogenase/chorismate mutase enzymes from Erwinia herbicola and
Saccharomyces cerevisiae are implemented in carbon shunt toward tocotrienol
accumulation (Rippert et al., 2004; Karunanandaa et al., 2005). Overexpression of plant
prephenate aminotransferase may therefore be more effective in increasing tocopherol
biosynthetic flux, although the problem of inhibition of AD by tyrosine would not be
resolved using this approach. Recent work in rice (Oryza sativa) has illustrated the
importance of evaluating multiple isoforms of enzymes from different source organisms

(Paine et al., 2005). It would useful to systematically test plant, cyanobacterial, and yeast

78

enzymes with prephenate dehydrogenase and aminotransferase activities to determine
their suitability for engineering enhanced tocopherol accumulation.

A potential strategy to increase tocopherol levels in potato might include
overexpression with tuber-specific promoters of all the genes observed to be expressed at
low levels in potato, and those demonstrated to have a significant impact on tocopherol
accumulation in model plant species: At-HPPD, At-HPT, AD, and VTEI. As discussed
above, expressing GGDR at high levels in potato tubers may also yield interesting results.
Finally, 'y-tocopherol methyltransferase activity would likely become limiting in
transgenic plants as was the case in Arabidopsis plants overexpressing HPT (Collakova
and DellaPenna, 2003). It would be desirable to overexpress VT E4 (encoding y-TMT) to
prevent accumulation of tocopherol isoforms with less vitamin B activity. The greatest
increase in tocopherol content attained thus far in transgenic plants is 7-fold in leaves
through overexpression of VTEI (encoding tocopherol cyclase) (Kanwischer et al., 2005).
If a proportionate increase were obtained in potato tubers, tubers from the transgenic
plants would contain 2 to 3 pg a—tocopherol per gram fresh weight, depending on the
genotype transformed. While potatoes accumulating tocopherols at these levels would not
be considered a significant dietary source of vitamin E compared to seeds and leafy
vegetables, they would contribute to intake of vitamin E in many populations where
potatoes are consumed at high rates.

In conclusion, I have shown that expression of At—HPPD and At—HPT limit
tocopherol synthesis in potato tubers. The effects of overexpression of At-HPPD and At-
HPT are of a similar magnitude; however, data on additional transgenic lines will be

required to compare the contribution of these two genes to tocopherol synthesis in potato

79

tubers. The transgenic lines generated in this study accumulated up to 1 :1ng a-
tocopherol in their tubers, representing an approximate 2.6-fold increase over wild-type.
Since tocopherol levels increase approximately 4-fold during cold-storage (Spychalla and
Desborough, 1990), tubers of the best performing transgenic line may accumulate up to 4
ug/gfw a-tocopherol following cold storage. Additionally, plants grown in field
conditions are exposed to more stress than greenhouse-grown plants, which may also
result in further elevated tocopherol levels. It will be necessary to determine tocopherol
levels for tubers from field-grown plants and following cold storage before the vitamin E
value of the transgenic potatoes can be firmly established.

The perplexing results from recent applied research studies to increase vitamin E
levels in crop plants leave many open questions on the fundamental aspects of the
biochemistry of vitamin E synthesis. Current knowledge cannot explain the accumulation
of tocotrienols occurring when HPPD is expressed in conjunction with the bifunctional
prephenate dehydrogenases from Erwinia herbicola or Saccharomyces cerevisiae (TyrA
and T yrI ). Furthermore, a possible role for tocopherol cyclase (VTEI) in determining
tocopherol composition is emerging through mutant studies (Kanwischer et al., 2005). It
is currently unknown how tocopherol synthesis is induced during stress. Our results in
potato raise additional questions regarding the regulation of vitamin E synthesis in
different plant tissues. A more complete understanding of the regulatory networks
coordinating the metabolism of tocopherols and related isoprenoids and the induction of

tocopherol synthesis during stress will greatly aid efforts to engineer crops for human

health benefits.

80

APPENDICES

81

Table A1. Nutrient content of potato. Data fiom USDA National Nutrient Database for

Standard Reference, Release 18 (2005).

Baked potato, flesh and skin
Nutrient Units Value per
100 grams
Proximates
Water g 74.89
Energy kcal 93
Energy kj 390
Protein g 2.5
Total lipid (fat) g 0.13
Ash g 1.33
Carbohydrate, by difference g 21.15
Fiber, total dietary g 2.2
Sugars, total g 1.18
Sucrose g 0.4
Glucose (dextrose) g 0.44
Fructose g 0.34
Lactose g 0
Maltose g 0
Galactose g 0
Starch g 17.27
Minerals
Calcium, Ca mg 15
Iron, Fe mg 1.08
Magnesium, Mg mg 28
Phosphorus, P mg 70
Potassium, K mg 535
Sodium, Na mg 10
Zinc, Zn mg 0.36
Copper, Cu mg 0.118
Manganese, Mn mg 0.219
Selenium, Se mcg 0.4
Vitamins
Vitamin C, total ascorbic acid mg 9.6
Thiamin mg 0.064
Riboflavin mg 0.048
Niacin mg l .41
Pantothenic acid mg 0.376
Vitamin B-6 mg 0.311

82

N 0.
Data

Points

21
0

21
21
21
0
15
0
21
21
21
21
21
ll
21

46
47
47
46
47
47
47
46
47
22

21
21
21
21
21
21

Std.

Error

OOOOOOOOOOOOOOOO

0.182
0.022
0.188
0.442
3.398
0.133
0.001
0.002
0.003

0.01

OOOOOO

Table A1. (cont’d)
Folate, total
Folic acid
Folate, food
Folate, DFE
Vitamin B-12
Vitamin B-12, added
Vitamin A, IU
Vitamin A, RAE
Retinol
Vitamin E (alpha-tocopherol)
Vitamin E, added
Tocopherol, beta
Tocopherol, gamma
Tocopherol, delta
Vitamin K (phylloquinone)
Lipids
Fatty acids, total saturated
Fatty acids, total monounsaturated
16:1 undifferentiated
18:1 undifferentiated
20:01
22:1 undifferentiated
Fatty acids, total polyunsaturated
18:2 undifferentiated
18:3 undifferentiated
18:04
20:4 undifferentiated
20:5 n-3
22:5 n-3
22:6 n-3
Cholesterol
Amino acids
Tryptophan
Threonine
Isoleucine
Leucine
Lysine
Methionine
Cystine

Phenylalanine

mcg_DFE

mcg__RAE

83

mcg
mcg

mcg

mcg

mcg

mcg
mg
mg
mg
mg
mg

mcg

UOOOUOOOOOUOOOOOOOUOUQUOOOOO

3
co

UOOOUOUQOOO'OOOOO

28

28

10
1

0.04

NOOOO

0.035
0.003
0.001
0.001

0.058
0.043
0.013

OOOOOO

0.039
0.091
0.101

0.15
0.152
0.039
0.031
0.11 1

N
Bo_.

NNNONOOOOOO

N
0.:

OOOOOOOOOOOOOOO

OOOOOOOO

OOOOOOOOOOOOOOO

OOOOOOOOOOOOOOO

OOOOOOOO

Table A1. (cont’d)
Tyrosine

Valine

Arginine
Histidine

Alanine

Aspartic acid
Glutamic acid
Glycine

Proline

Serine

Other

Alcohol, ethyl
Caffeine
Theobromine
Carotene, beta
Carotene, alpha
Cryptoxanthin, beta
Lycopene

Lutein + zeaxanthin

84

OOUOOOOOUOO‘OOOUOOOUO

mg
mg
mcg
mcg
meg
meg

mcg

0.092
0.141
0.115
0.054
0.077
0.611
0.419
0.074

0.09
0.109

OOOGOOO

30

OOOOOOOOOO

O

21
21
21
21
12

OOOOOOOOOO

OOOOOOOO

2.95980554.A...9.9A 39A9N9N A59...A, NA99999A 559A9NA ...A 999A89A .9A.9...9A. 9.999.359 9A5.9.89N
999990954SWA 999A 999.A..N59AN9A9 599.N. 99A.N.A9N.A. 9NwA95919 99999599 9999 995:95A5A
993NON5§§9 999.9939 5999999.. N99.99NN.9.. 9999.93 .9 9999. 999.9N99A 9951A A99. A92 A

 

 

 

9995NON54~999A. 999A99NA 99AA. 5959999A9A5LN .9..9A...A NN9A999A .9999 A99uA A.9.AA 99A1A999A

 

09N9N095i9Ah9 999A9999 N9A A gfiA A9N...A999..A ...9.99.A. 999A9Nm.9 ..RNNNAMA 559A 999. A 999.9

 

959990554..9999 NN99A9A A .9999999A.. 29.9.9959. 9N9.A....5959 55.9...A... 9M9N99AA 95AA 99A. A999A

 

99995095299 AA59 999...A9959..99A.A. 3999599 9.959 595, 9.93.9. 9N9N9599 .9599 9AfiA 995.9

 

955309549999 999A999A A8..A99NN n59A 99%? 999959959. N55..9. 5AW9999.A. 959A N9NA 959.9
998502499519 95999: A 58......WAA959 99A A9999. 955.9. 89..A...N9.9....A... .99N959 99NA 999:95999

 

 

 

95N95095iN959 995:99A99 599.....99N99 99999959. A5995959 99.99.. 999A99NA 959A N9N..A9999

 

9599909549999 $999909 999999519 995:9:59 39.92.59. ..99AA..... NA9.9.99N.A 99A.A_99N.A 9999
959950554. AN59 A959 9999 99999999 9N999999. 9.599999 NAA. A... 99.9999NA .92 A ..999 9999.9
9559—0551NN9.A..A9Q9.N..999 99999959 9999 59999599999 9.95....9 :N999 53. A. N..: ..N99A9N9A
99999055495999 A99A..9999 999A999A. N99A.NA99. 9AA..A .99.A..A.. 9.3.9.... .9599 959A9999. 9N9A9999

 

 

 

 

 

 

 

 

9995—0954A98A 959952 A A99L99A99 .5N9.9.. 9:9..A.. HAAbA A9.9A 999.9 9999.399 989999A 9999

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

. . . . DmmwoOmhdAuAbAA NAM—996.9. 99A Afic 999.9 9:99.999A AGANA .AN5.9 badge OAQ99999 9999.
. ..2525163301 E .... ... mm m... m m 3 SA .5. M ..u. ..u. ..u. .m.
. J J .. J m J m. J J J J J . J a 3 a 3 P
a a a a . a . a a a a a , a .. u. u. u. J
s s W s H s M s s s s s . s .... 1 1 o
s s .. s m s m s s s s s w s s 3
O. ...A I. m 9..» CO .0 O. I. I. 0. w m . M m- m
.....2._.._r_§2.... 2....os__aaa=.. m m m M W m m m m f m .... m m ...... u
9 v 39: 2.3 v 00 n 9 A .90: can. A 00 m a: 11. PM w .m 1 0 mm P m 1 1 s J
93.... 2.5 v I 992:: can. A 09 w m. “.1 n. m. m. mo: w ..n. ..n. ..u. m
5 v ._ . 9 . . u n M r: o e x .1 a .n r.
s m .. x ... m m n .. m.
_ a . ) a . A
W .9 m _ W T.
N l\ a U T- \I.
W W a .m. H
. ... ,
....... . .. :EoEfioF
‘- :

 

 

.993 :3 .0 5:58:90 039993550 952. 90320 .828 09939 95.39 39590 928298 ME
.329 «0.30.2: 085029 m: 95 9 SEE? .8 985:? 5 9029:: 3:09 9— 90 529.82 .9995 .5. 2:99

85

LITERATURE CITED

86

LITERATURE CITED

Ahuja J KC, Goldman JD, Moshfegh AJ. 2004. Current status of vitamin E nutriture. Ann.
NY. Acad. Sci. 1031:387-390.

Altschul, S.F., Gish, W., Miller, W., Myers, E.W. & Lipman, DJ. 1990. Basic local
alignment search tool. J. Mol. Biol. 215:403-410.

Balluz LS, Kieszak SM, Philen RM, Mulinare J. 2000. Vitamin and mineral supplement
use in the United States. Results fiom the third National Health and Nutrition
Examination Survey. Arch Fam Med. 9:258-62.

Bergmiiller E, Porfirova S, Dormann. 2003. Characterization of an Arabidopsis mutant
deficient in y-tocopherol methyltransferase. Plant Mol. Biol. 52:1 181-1190.

Biemelt S, Sonnewald U, Galmbacher P, Willmitzer L, Miiller M. 2003. Production of
human papillomavirus type 16 virus-like particles in transgenic plants. J. of
Virology. 77:921 1-9220.

De Block M, Botterman J, Vandewiele M, Dockx J, Thoen C, Gosselé V, Movva NR,
Thompson C, Van Montagu M, Leemans J. 1987. Engineering herbicide

resistance in plants by expression of a detoxifying enzyme. EMBO Journal.
6:2513-2518.

Breithaupt DE, Bamedi A. 2002. Carotenoids and carotenoid esters in potatoes (Solanum
tuberosum L.): new insights into an ancient vegetable. J. Agric. Food Chem.
50:7175-7181.

Brigelius-Flohé R, Traber MG. 1999. Vitamin E: function and metabolism. F ASEB
Journal. 13:1145-1155.

Brown CR, Wrolstad R, Durst R, Yang CP, Clevidence B. 2003. Breeding Studies in
Potatoes Containing High Concentrations of Anthocyanins. Amer. J. of Potato
Res. 80:241-250.

Cahoon EB, Hall SE, Ripp KG, Ganzke TS, Hitz WD, Coughlan SJ. 2003. Metabolic
redesign of vitamin E biosynthesis in plants for tocotrienol production and
increased antioxidant content. Nature. 21 :1082-1087.

Carputo D, Barone A, Cardi T, Sebastiano A, Frusciante L, Peloquin SJ. 1997.
Endosperrn balance number manipulation for direct in viva germplasm

introgression to potato from a sexually isolated relative ( Solanum commersom'i
Dun.). PNAS. 94:12013-12017.

87

Chakraborty S, Chakraborty N, Datta A. 2000. Increased nutritive value of transgenic
potato by expressing a nonallergenic seed albumin gene from Amaranthus
hypochondriacus. PNAS. 97:3724—3729.

Cheng Z, Sattler S, Maeda H, Salcuragi Y, Bryant DA, DellaPenna D. 2003. Highly
divergent methyltransferases catalyze a conserved reaction in tocopherol and

plastoquinone synthesis in cyanobacteria and photosynthetic eukaryotes. Plant
Cell. 15: 2343- 2356.

Collakova E, DellaPenna D. 2001. Isolation and functional analysis of homogentisate
phytyltransferase from Synechocystis sp. PCC 6803 and Arabidopsis. Plant
Physiology. 127211 13-1 124.

Collakova E, DellaPenna D. 2003. Homogentisate Phytyltransferase activity is limiting
for Tocopherol Biosynthesis in Arabidopsis. Plant Physiology. 131 :632-642.

Collakova E, DellaPenna D. 2003a. The role of homogentisate phytyltransferase and
other tocopherol pathway enzymes in the regulation of tocopherol synthesis
during abiotic stress. Plant Physiology. 1332930-940.

Conrad U. 2005. Polymers from plants to develop biodegradable plastics. Trends in Plant
Science. 10:511-512.

Dale MFB, Griffiths DW, Todd DT. 2003. Effects of genotype, environment, and
postharvest storage on the total ascorbate content of potato (Solanum tuberosum)
tubers. J. Agric. Food Chem. 51:244-248.

Davis J W. 1992. Aristocrat in burlap : a history of the potato in Idaho. Boise : Idaho
Potato Commission. 203 pp.

DellaPenna D. 2001. Plant metabolic engineering. Plant Physiology. 125:160-163.

DellaPenna D. 2005. A decade of progress in understanding vitamin E synthesis in plants.
J. Plant Physiol. 162:729-737.

DellaPenna D. 2005a. Progress in the dissection and manipulation of vitamin E synthesis.
Trends in Plant Science. 10:574-579.

DellaPenna D, Pogson B. 2006. Vitamin synthesis in plants: tocopherols and carotenoids.
Annu. Rev. Plant Biol. 57:711-738.

Douches DS, Westedt AL, Zarka K, Grafius EJ. 1998. Transformation of Cry V-Bt

transgene combined with natural resistance mechanisms for resistance to tuber
moth in potato (Solanum tuberosum L.) HortScience 33:1053-1056.

88

Douches DS, Pett W, Santos F, Coombs J, Grafius E, Li W, Metry EA, Nasr El-Din T,
Madkour M. 2004. Field and storage testing Bt potatoes for resistance to potato
tuberwonn (Lepidoptera: Gelichiidae). J. Econ. Entomol. 97:1425-1431.

Ducreux UM, Morris WL, Hedley PE, Shepherd T, Davies HV, Millam S, Taylor MA.
2005. Metabolic engineering of high carotenoid potato tubers containing
enhanced levels of beta-carotene and lutein. J. Exp. Bot. 56:81-89.

Eggennont E. 2006. Recent advances in vitamin E metabolism and deficiency. Eur. J.
Pediatr. Advance online publication.

Estevez J M, Cantero A, Reindl A, Reichler S, Leon P. 2001. l-Deoxy-D-xylulose-S-
phosphate synthase, a limiting enzyme for plastidic isoprenoid synthesis in plants.
J. Biol. Chem. 276:22901-22909.

Felcher KJ, Douches DS, Kirk WW, Hammerschmidt R. 2003. Expression of a fungal
glucose oxidase gene in three potato cultivars with different susceptibility to late
blight (Phytophthora infestans Mont. deBary). J. Amer. Soc. Hort. Sci. 128: 238-
245.

Ford ES, Sowell A. 1999. Serum a-tocopherol status in the United States population:
findings from the Third National Health and Nutrition Examination Survey. Am J
Epidemiol. 150:290-300.

Fritze 1M, Linden L, Freigang J, Auerbach G, Huber R, Steinbacher S. 2004. The crystal
structures of Zea mays and Arabidopsis 4-hydroxylphenylpyruvate dioxygenase.
Plant Physiology. 134: 1388-1400.

Friedrich MJ. 2004. To “B” or not to “E,” vitamin E’s role in health and disease is the
question. Reprinted in JAMA. 292:671-673.

Fryer MJ. 1992. The antioxidant effect of thylakoid vitamin E (on-tocopherol). Plant Cell
Environ. 15:381-392.

Gao X, Wilde PE, Maras J E, Berrnudez OI, Tucker KL. 2004. The maximal amount of a-
tocopherol intake from foods alone in US. adults (1994-1996 CSFII). An analysis
by linear programming. Ann. NY. Acad. Sci. 1031 :385-386.

Garcia 1, Rodgers M, Pepin R, Hsieh T-F, Matringe M. 1999. Characterization and
subcellular compartmentation of recombinant 4-hydroxyphenylpyruvate
dioxygenase from Arabidopsis in transgenic tobacco. Plant Physiology. 1 19:1507-
1516.

Grusak MA, DellaPenna D. 1999. Improving the nutrient composition of plants to
enhance human nutrition. Annu. Rev. Plant Physiol. Plant Mol. Biol. 50: 1 33-161.

89

Han J-S, Kozukue N, Young K-S, Lee K-R, Friedman M. 2004. Distribution of ascorbic
acid in potato tubers and in home-processed and commercial potato foods. J.
Agric. Food Chem. 52:6516-6521.

Havaux M, Bonfils J, Liitz C, Niyogi K. 2000. Photodamage of the photosynthetic
apparatus and its dependence on the leaf development stage in the nqu
Arabidopsis mutant deficient in the xanthophyll cycle enzyme violaxanthin de-
epoxidase. Plant Physiol. 124:273—284.

Havaux M, Eymery F, Porfirova S, Rey P, Donnann P. 2005. Vitamin E protects against
photoinhibition and photooxidative stress in Arabidopsis thaliana. Plant Cell.
17:3451-3469.

Hawkes JG. The Pogto: Evolution, Biodiversity, and Genetic Resources. Belhaven Press,
London : 1990.

Hijmans RJ, Spooner DM. 2001. Geographic distribution of wild potato species. Amer. J.
ofBot. 88:2101-2112.

 

Hils U, Pieterse L. World Catalogue of Potato Varieties. Bergen/Dumme, Germany :
Agrimedia, 2005.

Hofius D, Hajirezaei M-R, Geiger M, Tschiersch H, Melzer M, Sonnewald U. 2004.
RNAi-mediated tocopherol deficiency impairs photoassimilate export in
transgenic potato plants. 135:1256-1268.

Ischebeck T, Zbierzak AM, Kanwischer M, Dormann P. 2006. A salvage pathway for
phytol metabolism in Arabidopsis. J. Biol. Chem. 281:2470-2477.

Joung YH, Youm JW, Jeon JH, Lee BC, Ryu CJ, Hong HJ, Kim HC, Joung H, Kim HS.
2004. Expression of the hepatitis B surface S and preS2 antigens in tubers of
Solanum tuberosum. Plant Cell Rep. 22:925-930.

Kamal-Eldin A, Appelqvist LA. 1996. The chemistry and antioxidant properties
of tocopherols and tocotrienols. Lipids 31: 671—701

Kaniewski WK, Thomas PE. 2004. The potato story. AgBioForum. 7:41-46.

Karunanandaa B, Qi Q, Hao M, Baszis SR, Jensen PK, Wong Y-H H, Jiang J,
Venkatramesh M, Gruys KJ, Moshiri F, Post-Beittenmiller D, Weiss JD, Valentin
HE. 2005. Metabolically engineered oilseed crops with enhanced seed tocopherol.
Metabolic Engineering. 7:384-400.

Klaus D, Ohlrogge J B, Ekkehard Neuhaus H, Dorrnann P. 2004. Increased fatty acid

production in potato by engineering of acetyl-CoA carboxylase. Planta 2192389-
396.

90

Knaggs AR. 2001. The biosynthesis of shikimate metabolites. Nat. Prod. Rep. 18:334-
355.

Kok-Jacon GA, Vincken J -P, Suurs LCJM, Wang D, Liu S, Visser RGF. 2005.
Production of dextran in transgenic potato plants. Transgenic Research. 14:385-
395.

Kumar R, Raclaru M, SchiiBeler T, Gruber J, Sadre R, Liihs W, Zarhloul KM, Friedt W,
Enders D, Frentzen M, Weier D. 2005. Characterisation of plant tocopherol

cyclases and their overexpression in transgenic Brassica napus seeds. FEBS
Letters. 579:1357-1364.

Lin Y-H, Yeh C-S, Lu S. 2002. Evaluation on Quality Indices and Retained Tocopherol
Contents in the Production of the Rice-Based Cereal by Extrusion. J our. of Food
and Drug Anal. 10:183-187.

Love SL, Salaiz T, Shafii B, Price WJ, Mosley AR, Thornton RE. 2004. Stability of
Expression and Concentration of Ascorbic Acid in North American Potato
Germplasm. HortScience. 39: 156-160.

Lukaszewicz M, Matysiak-Kata I, Skala J, Fecka I, Cisowski W, Szopa J. 2004.
Antioxidant capacity manipulation in transgenic potato tuber by changes in
phenolic compounds content. J. Agric. Food Chem. 52:1526-1533.

Maeda H, Sakuragi Y, Bryant DA, DellaPenna D. 2005. Tocopherols protect
Synechocystis sp. Strain PCC 6803 from lipid peroxidation. Plant Physiology.
138:1422-1435.

McGrath JM, J ancso MM, Pichersky E. 1993. Duplicate sequences with similarity to
expressed genes in the genome of Arabidopsis thaliana. Theor. Appl. Genet.
86:880-888.

McNeil SD, Rhodes D, Russell BL, Nuccio ML, Shachar-Hill Y, Hanson AD. 2000.
Metabolic modeling identifies key constraints on an engineered glycine betaine
synthesis pathway in tobacco. Plant Physiology. 124: 153-162.

Miller III ER, Pastor-Barriuso R, Dalal D, Riemersma RA, Appel LJ, Guallar E. 2004.
Meta-Analysis: High dosage vitamin E supplementation may increase all-cause
mortality. Ann. Intern. Med. 142:epub.

Mohammed A, Douches DS, Pett W, Grafius E, Coombs J, Liswidowati, Li W, Madkour

MA. 2000. Evaluation of potato tuber moth (Lepidoptera: Gelechiidae) resistance
in tubers of Bt-cryS transgenic potato lines. J. Econ. Entomol. 93:472-476.

91

Monsanto Biotechnology Regulatory Services, 2004. Monsanto Company, St. Louis, MI.
Retrieved from http://gmo-cr1.jrc.it/detectionmethods/MON-Art47-
dnaextractionpdf May 2006.

Moran GR. 2005. 4-Hydroxyphenylpyruvate dioxygenase. Archives of Biochemistry and
Biophysics. 433 :1 17-128.

Morris WL, Ducreux L, Griffiths DW, Stewart D, Davies HV, Taylor MA. 2004.
Carotenogenesis during tuber development and storage in potato. J. Exp. Bot.
55:975-982.

Morris WL, Ducreux LJM, Fraser PD, Millam S, Taylor MA. 2006. Engineering
ketocarotenoid biosynthesis in potato tubers. Metabolic Engineering. Advance
online publication.

Mueller LA, Zhang P, Rhee SY. 2003. AraCyc: a biochemical pathway database for
Arabidopsis. Plant Physiol. 132:453-60.

Munné-Bosch S, Alegre L. 2002. The function of tocopherols and tocotrienols in plants.
Crit. Rev. Plant Sci. 21:31-57.

Munné-Bosch S. 2005. Linking tocopherols with cellular signaling in plants. New
Phytologist. 166:363-366.

Napoli C, Lernieux C, and Jorgensen R. 1990. Introduction of a chimeric chalcone
synthase gene into Petunia results in reversible co-suppression of homologous
genes in trans. Plant Cell. 2:279-289.

National Potato Council, 2006. “Potato Statistics.” Retrieved fi'om
http://www.nationa]potatocouncil.org/ March 8, 2006.

Nesterenko S, Sink KC. 2003. Carotenoid profiles of potato breeding lines and selected
cultivars. Hortscience 38:1 173-] 177.

Newell C, Rozman R, Hinchee M, Lawson C, Haley L, Sanders P, Kaniewski W, Turner
N, Horsch R, Fraley R. 1991. Agrobacterium-mediated transformation of
Solanum tuberosum L. cv. Russet Burbank. Plant Cell Reports. 10:30-34.

Norris SR, Shen X, DellaPenna D. 1998. Complementation of the Arabidopsis pdsI
mutation with the gene encoding p-hydroxyphcnylpyruvate dioxygenase. Plant
Physiology. 117:1317-1323.

Paine JA, Shipton CA, Chaggar S, Howells RM, Kennedy MJ, Vernon G, Wright SY,
Hinchliffe B, Adams J L, Silverstone AL, Drake R. Improving the nutritional
value of Golden Rice through increased pro-vitamin A content. Nat Biotechnol.
2005 23:482-7.

92

 

Pefiuelas J, Munné-Bosch S. 2005. Isoprenoids: an evolutionary pool for photoprotection.
Trends Plant Science. 10:166-169.

Perlak F, Stone T, Muscopf Y, Petersen L, Parker G, McPherson S, Wyman J, Love S,
Reed G, Biever D. 1993. Genetically improved potatoes: Protection from damage
by Colorado potato beetles. Plant Molecular Biology. 22:313-321.

Pfluger P, Kluth D, Landes N, Bumke-Vogt C, Brigelius-Flohe R. 2004. Vitamin E:
underestimated as an antioxidant. Redox Rep. 9:249-254.

Provencher LM, Miao L, Sinha N, Lucas WJ . 2001. Sucrose Export Defective] encodes a
novel protein implicated in chloroplast-to-nucleus signaling. Plant Cell. 13:1127-
1141.

Rippert P, Scimerni C, Dubald M, Matringe M. 2004. Engineering Plant shikimate
pathway for production of tocotrienol and improving herbicide resistance. Plant
phys. 134:92-100.

Rocheford TR, Wong J C, Egesel CO, Lambert RJ. 2002. Enhancement of vitamin E
levels in corn. J. Amer. Coll. Nutr. 21:19]S-1988.

Romer S, Lubeck J, Kauder F, Steiger S, Adomat C, Sandmann G. 2002. Genetic
Engineering of a Zeaxanthin-rich Potato by Antisense Inactivation and Co-
suppression of Carotenoid Epoxidation. Metabolic Engineering. 4:263-272.

Romeis J, Meissle M, Bigler F. 2006. Transgenic crops expressing Bacillus thuringiensis
toxins and biological control. Nature Biotechnology. 24:63-71.

Samitsu Y, Hosaka K. 2002. Molecular marker analysis of 24- and 25- chromosome
plants obtained from Salanum tuberosum L. subsp. andigena (2n = 4x = 48)
pollinated with a Salanum phureja haploid inducer. Genome. 45:577-583.

SAS Institute. 2005. The SAS system for Windows. Release 8.02. SAS Institute, Cary,
NC.

Sattler SE, Cahoon EB, Coughlan SJ, DellaPenna D. 2003. Characterization of
Tocopherol Cyclases from Higher Plants and Cyanobacteria. Evolutionary

Implications for Tocopherol Synthesis and Function. Plant Physiology.
132:2184-2195.

Sattler SE, Cheng Z, DellaPenna D. 2004. From Arabidopsis to agriculture: engineering
improved Vitamin E content in soybean. Trends in Plant Science. 9:365-367.

93

 

Sattler SE, Gilliland LU, Magallanes-Lundback M, Pollard M, DellaPenna D. 2004.
Vitamin E is essential for seed longevity and for preventing lipid peroxidation
during germination. Plant Cell. 16:1419—1432.

Savidge B, Weiss JD, Wong Y-H H, Lassner MW, Mitsky TA, Shevvmaker CK, Post-
Beittenmiller D, Valentin HE. 2002. Isolation and characterization of
homogentisate phytyltransferase genes from Synechacystis sp. PCC 6803 and
Arabidopsis. Plant Physiology. 129:321-332.

Sévenier R, van der Meer IM, Bino R, Koops AJ. 2002. Increased production of
nutriments by genetically engineered crops. J. Amer. Coll. Nutr. 21:199S-204S.

Schneider C. 2005. Chemistry and biology of vitamin E. Mo]. Nutr. Food Res. 49:7-30.

Shewmaker CK, Sheehy JA, Daley M, Colbum S, Ke DY. 1999. Seed specific
overexpression of phytoene synthase: increase in carotenoids and other metabolic
effects. Plant Journal 20:401-412.

Shibata M, Tsuyarna M, Takami T, Shimizu H, Kobayashi Y. 2004. Accumulation of
menaquinones with incompletely reduced side chains and loss of a-tocopherol in

rice mutants with alterations in the chlorophyll moiety. J. Exp. Bot. 55:1989-
1996.

Shintani DK, Cheng Z, DellaPenna D. 2002. The role of 2-methyl-6-phytylbenzoquinone
methyltransferase in determining tocopherol composition in Synechacystis sp.
PCC6803. FEBS Letters. 511:1-5.

Shintani DK, DellaPenna D. 1998. Elevating the vitamin E content of plants through
metabolic engineering. Science. 282:2098-2100.

Song J, Bradeen J M, Naess SK, Raasch JA, Wielgus SM, Haberlach GT, Liu J, Kuang H,
Austin-Phillips S, Buell CR, Helgeson JP, J iang J. 2003. Gene RB cloned from

Salanum bulbacastanum confers broad spectrum resistance to potato late blight.
PNAS. 100:9128-9133.

Spooner DM, McLean K, Ramsay G, Waugh R, Bryan GJ. 2005. A single domestication
for potato based on multilocus amplified fi'agment length polymorphism
genotyping. PNAS. 102: 14694-14699.

Spychalla JP, Desborough SL. 1990. Superoxide dismutase, catalase, and alpha-
tocopherol content of stored potato tubers. Plant Physiol. 94:1214—1218.

Stockhaus J, Eckes P, Blau A, Schell J, Willmitzer L. 1987. Organ-specific and dosage-

dependent expression of a leaf/stem specific gene from potato after tagging and
transfer into potato and tobacco plants. Nucleic Acids Research. 15:3479—3491.

94

Tanaka R, Oster U, Kruse E, Rudiger W, Grimm B. 1999. Reduced Activity of
Geranylgeranyl Reductase Leads to Loss of Chlorophyll and Tocopherol and to
Partially Geranylgeranylated Chlorophyll in Transgenic Tobacco Plants
Expressing Antisense RNA for Geranylgeranyl Reductase. Plant Physiol.
120:695-704.

Thanavala Y, Mahoney M, Pal S, Scott A, Richter L, Natarajan N, Goodwin P, Amtzen
CJ, Mason HS. 2005. Irnmunogenicity in humans of an edible vaccine for
hepatitis B. PNAS. 102:3378-3382.

The TIGR Gene Index Databases, The Institute for Genomic Research, Rockville, MD
20850 (URL: http://www.tigr.org/tdb/tgi) Accessed online 10/2004.

Traber MG. 2003. Vitamin E. Linus Pauling Institute Micronutrient Information Center,
Oregon State University.
http://lpi.oregonstate.edu/infocenter/vitamins/vitaminE/index.htrnl

Tsegaye Y, Shintani DK, DellaPenna D. 2002. Overexpression of the enzyme p-
hydroxyphenolpyruvate dioxygenase in Arabidopsis and its relation to tocopherol
biosynthesis. Plant Physiol. Biochem. 40:913-920.

Tu HM, Godfrey LW, Sun SSM. 1998. Expression of the brazil nut methionine-rich
protein and mutants with increased methionine in transgenic potato. Plant Mol.
Biol. 37:829-838.

United States Department of Agriculture. 2005. Nutrient Data Laboratory - National
Nutrient Database for Standard Reference, Release 18.
http://www.nal.usda.gov/firic/foodcomp/.

Valentin HE, Lincoln K, Moshiri F, Jensen PK, Qi Q, Venkatesh TV, Karunananadaa B,
Baszis SR, Norris SR, Savidge B, Gruys KJ, Last RL. 2006. The Arabidopsis
vitamin E pathway gene5-1 mutant reveals a critical role for phytol kinase in seed
tocopherol biosynthesis. Plant Cell. 18:212-224.

Van der Lee T, Testa A, van ‘t Klooster J, van den Berg-Velthuis G, Govers F. 200].
Chromosomal deletion in isolates of Phytapthara infestans correlates with
virulence on R3, R10, and R11 potato lines. MPMI. 14:1444-1452.

Van Eenennaam AL, Lincoln K, Durrett TP, Valentin HE, Shewmaker CK, Thorne GM,
Jiang J, Baszis SR, Levering CK, Aasen ED, Hao M, Stein JC, Norris SR, Last
RL. 2003. Engineering Vitamin E Content: From Arabidopsis Mutant to Soy Oil.
Plant Cell. 15:3007-3019.

Van Eenennaam AL, Li G, Venkatramesh M, Levering C, Gong X, J amieson AC, Rebar
EJ, Shewmaker CK, Case CC. 2004. Elevation of seed a-tocopherol levels using

95

plant-based transcription factors targeted to an endogenous locus. Metabolic
Engineering. 62101-108.

De Vetten N, Wolters AM, Raemakers K, van der Meer I, ter Stege R, Heeres E, Heeres
P, Visser R. 2003. A transformation method for obtaining marker-free plants of a
cross-pollinating and vegetatively propagated crop. Nat. Biotech. 212439-42.

Warzecha H, Mason HS, Lane C, Tryggvesson A, Rybicki E, Williamson A-L, Clements
JD, Rose RC. 2003. Oral immunogenicity of human papillomavirus-like particles
expressed in potato. J. of Virology. 77:8702-8711.

Yadav NR, Sticklen M. 1995. Direct and efficient plant regeneration from leaf explants
of Salanum tuberosum 1. cv. Bintje. Plant Cell Reports. 14:645-647.

Yamamizo C, Kuchimura K, Kobayashi A, Katou S, Kawakita K, Jones J DG, Doke N,
Yoshioka H. 2006. Rewiring mitogen-activated protein kinase cascade by positive
feedback confers potato blight resistance. Plant Physiology. 140:681-692.

Youm JW, Kim H, Han JHL, Jang CH, Ha HJ, Mook-Jung I, Jeon JH, Choi CY, Kim
YH, Kim HS, Joung H. 2005. Transgenic potato expressing AB reduce AB burden
in Alzheimer’s disease mouse model. FEBS Letters. 579:6737-6744.

Zimmermann P, Hirsch-Hoffmann M, Hennig L, Gruissem W

GENEVESTIGATOR. Arabidopsis Microarray Database and Analysis Toolbox.
Plant Physiol. 2004 136: 2621-2632.

96

 

ll111111111111111111111111111]