n"!fl“"’fi“”u“m

.uu

 

 

 

 

g «5.

1.....7.

 

\2\

t.715...

FIG. I
.1 1

1:1.

 

.o .Vtv:

...\ NW.

.4 m3. 1:?
99......

‘3
.19.

1.. .

1...]
i!¢.:..lz.
:Irisaz

.15 ..
‘4‘
.11.... :

E. 2

la 4.} .. .

. $3.... r .1
v

$14.7 \l ll I
‘vl. on t. .u .I.
gutterr.»
xevk: .A‘uva,

I‘L: it,
.v\rvs.. n
. .ya‘. ta:

.2331,‘
.11.. .
\ :3 .

k 78’?ng

‘Q

I)

This is to certify that the
dissertation entitled

PHASE CHANGES IN PLANT DEVELOPMENT WITH
RESPECT TO FLORAL TRANSITION AND SECONDARY
XYLEM FORMATION

presented by

Sookyung Oh

has been accepted towards fulfillment
of the requirements for the

PhD. degree in Plant Breeding and Genetics
Program; Department of
Horticulture

 

 

 

Major Professor’s Signature
5; L, ZLl Z/U‘C/(o
I

Date

 

MSU is an Affirmative Action/Equal Opportunity Institution

 

UBP’PV
Michigan State
University

 

 

_..,_._.-.-.-.-r-._._.-.-.-._.-.-.-.-t-.-,-._ ..—.-.—.-.-.-.-.-t-.--.---.-._-----.-o_.-.-.-.-v--.-t-‘-r------.—._.—

"

"

_J'_. v P-

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2/05 p:/ClRC/DateDue.indd-p.1

 

PHASE CHANGES IN PLANT DEVELOPMENT WITH RESPECT TO FLORAL
TRANSITION AND SECONDARY XYLEM FORMATION

By

Sookyung Oh

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Plant Breeding and Genetics Program
Department of Horticulture

2006

ABSTRACT
PHASE CHANGES IN PLANT DEVELOPMENT WITH RESPECT TO FLORAL
TRANSITION AND SECONDARY XYLEM FORMATION

By

Sookyung Oh

During development, plants undergo a switch in the potential of meristems,
termed “phase change”. Phase changes are initiated by competency of meristems to
respond to internal and external developmental cues, and the changes are characterized
by a unique set of morphological and physiological traits. Our understanding of how
phase change is regulated at the molecular level is less clear. My thesis is to understand
the molecular mechanism underlying phase changes in plants, by investigating the
transition of vegetative to reproductive and of primary to secondary growth. First, a
functional genomic approach was employed to identify genes involved in sequential
events of wood formation using Arabidopsis thaliana as a model. Several candidate
genes and potential regulatory cis-elements were identified that may play key roles in the
genetic regulation of secondary growth. In addition, functional category analysis of the
genes suggests the involvement of specific transcription factors in the transition from
primary to secondary growth. Second, to better understand molecular mechanism of
flowering, I undertook a genetic and molecular analysis of the early-flowering
vernalization independence 5 (vip5) and vip6 mutants. VIP5 and VIP6 were cloned
through mapping and transcriptional profiling. Both proteins are closely related to distinct

components of budding yeast Pafl C, a transcription factor that assists in establishment

and/or maintenance of transcription-promotive chromatin modifications. Loss of function
of VIP5 and VIP6 resulted in downregulation of FLC/MAF MADS-domain gene family.
The results suggest that an evolutionary conserved transcriptional mechanism plays an
essential role in the floral transition. Finally, I explored the mechanism of VIP proteins in
transcription by characterizing the effects of loss of VIP genes on histone modifications,
Pol II distribution, and phosphorylation of carboxyl-terminal domain (CTD) of Pol 11.
VIP proteins are required for chromatin modifications in a locus-specific manner,
recruitment of Pol II, and dephosphorylation of CTD, suggesting a significant role of VIP

in P0] II-mediated transcription.

ACKNOWLEDGMENTS

I would like to acknowledge people for helping me during my doctoral work.
First, I would like to especially and sincerely thank my advisor, Dr. Steven van Nocker
for his guidance, encouragement, and support at all levels. I would also like to thank my
committee members Dr. Zach Burton, Dr. Rebecca Grumet, Dr. Jim Hancock and Dr.

Amy Iezzoni for their continual encouragement and offering constructive comments.

I would like to thank colleagues in van Nocker laboratory, including Sunchung

Park, Hua Zhang, Philip Ludwig, Lingxia Sun, Ying Yan, and Julissa Ek-Ramos.

Finally, I would like to thank my family for their life-long love and

encouragement. I am especially grateful to my husband, Sunchung, for his support.

TABLE OF CONTENTS

 

 

 

LIST OF TABLES ............... . _ -- -- -viii
LIST OF FIGURES - - -- ix
CHAPTER 1: LITERATURE REVIEW - - - -- -- l
1. Phase change in plants ................................................................................................ 2

2. Wood formation .......................................................................................................... 3
2.1. Plants produce wood through secondary growth. ................................................ 3

2.2. Hormones and wounding have positive effects on wood formation .................... 5

2.3. Wood biosynthesis ............................................................................................... 7

2.4. Model systems for studying wood formation ...................................................... 9
2.4.1 . Arabidopsis ....................................................................................................... 9
2.4.2. Zinnia elegans ................................................................................................. 10
2.4.3. Poplars ............................................................................................................. 10

2.5. Functional genomic approaches to wood formation .......................................... 10

2.6. Conclusion ......................................................................................................... 12

3. F Ioral transition ......................................................................................................... 13
3.1. Cellular memory and chromatin structure ......................................................... 14

3.2. Molecular and epigenetic mechanisms mediating vemalization ....................... 19

3.3. Conclusion ......................................................................................................... 27

4. References ................................................................................................................. 28

CHAPTER II: Transcriptional Regulation of Secondary Growth in Arabidopsis

 

thaliana - -- ............... 41
Abstract ......................................................................................................................... 42
Introduction ................................................................................................................... 43
Materials and Methods .................................................................................................. 45

Plant growth and treatment for wood formation in Arabidopsis .............................. 45
RNA extraction and cDNA synthesis ....................................................................... 46
cRNA synthesis ......................................................................................................... 47
GeneChip array hybridization ................................................................................... 47
Data analysis ............................................................................................................. 48
Northern blot analysis of selected R2R3-type MYB genes ...................................... 49
Analysis of cis-regulatory elements .......................................................................... 50
Results and Discussion ................................................................................................. 51
Secondary xylem formation in Arabidopsis ............................................................. 51
Differential gene expression in treatment stem, bark and xylem .............................. 54
Cell division .............................................................................................................. 58

Cell elongation .......................................................................................................... 59

Cell wall synthesis .................................................................................................... 6O
Lignification .............................................................................................................. 63
Cell death .................................................................................................................. 64
Transcriptional regulation of secondary xylem formation ........................................ 65
Identification of regulatory cis-elements for secondary grth ............................... 70
References ..................................................................................................................... 78

CHAPTER III: A Mechanism Related to the Yeast Transcriptional Regulator
PaflC Is Required for Expression of the Arabidopsis FLC/MAF MADS Box Gene

 

Family - - ........... - - -- 84
Abstract ......................................................................................................................... 85
Introduction ................................................................................................................... 86
Materials and Methods .................................................................................................. 89

Plant and Yeast Material and Manipulations ............................................................ 89
Cloning of VIP6 ........................................................................................................ 90
Molecular Techniques ............................................................................................... 90
RT-PCR Analysis ...................................................................................................... 92
Immunoblot Analysis ................................................................................................ 92
Sequence Analyses .................................................................................................... 93
Microarray Analysis .................................................................................................. 94
Results ........................................................................................................................... 95
VIP5 and VIP6 Function in Concert with VIP3 and VIP4 ........................................ 95
VIP5 and VIP6 Participate in the Regulation of a Heterogeneous Subset of Genes
Including Other Members of the FLC/MAF Gene Family ....................................... 96
VIP6 Encodes a Plant Homolog of the PaflC Component Ctr9 ............................. 103
The VIP6 Protein Physically Interacts with VIP3 and VIP4 in Vivo ..................... 109
VIP5 Encodes an Additional Pafl C Subunit Homolog .......................................... 113
VIP Genes Are Not Required for Global Methylation of Histone H3 .................... 114
Discussion ................................................................................................................... 1 15
The VIP Genes Have a Central Role in Flowering through Activation of the
FLC/MAF Gene Family .......................................................................................... 115
VIP5 and VIP6 Define Important Pleiotropic Regulators of Development ............ 118
The VIP Genes Cooperatively Regulate Gene Expression through a Mechanism
Related to the Yeast Transcriptional Regulator Pafl C ........................................... 119
References ................................................................................................................... 1 25

CHAPTER IV: Global and Locus-Specific Roles for Arabidopsis PaflC Homologs

 

in Transcription and Chromatin Modifications - - - - -- -130
Abstract ....................................................................................................................... 131
Introduction ................................................................................................................. 1 3 2
Materials and Methods ................................................................................................ 136

Plant Materials ........................................................................................................ 136
Isolation of histones ................................................................................................ 136

vi

Antibodies ............................................................................................................... 1 37

 

 

 

 

Coimmunoprecipitation .......................................................................................... 1 37
Electrophoresis and Immunoblotting ...................................................................... 138
Chromatin lmmunoprecipitation (ChIP) ................................................................. 138
Results ......................................................................................................................... 139
VIP3 is not required for global modification of either canonical or variant histone
H3 ............................................................................................................................ 139
VIP3 is required for H3 methylation in a locus-specific manner ............................ 140
Mutation of VIP3 is associated with a reduction of Pol II on F LC chromatin ....... 143
VIP genes are required for modification of CTD of Pol II ..................................... 146
Discussion ................................................................................................................... 1 50
References ................................................................................................................... 1 52
CHAPTER V: Perspectives and Future Directions - - - - 156
' VIP complex is required for histone H3 methylation in a locus-specific manner ...... 157
VIP3 may be a higher eukaryote-specific component of Pafl C ................................. 158
VIP complex is required for Ser-2 and Set-5 phosphorylation of CTD of Pol II ....... 159
References ................................................................................................................... 1 64
APPENDIX A: Protocol for extraction of histones ----------- - - 168
APPENDIX B: Primers for ChIP analysis - 170
APPENDIX C: Protocol for ChIP analysis -- -- 172

vii

LIST OF TABLES

Table 2-1. Expression patterns of selected xylogenesis-related genes ............................. 61

Table 2-2. Regulatory cis-element motifs identified from the promoter regions of the
genes up-regulated in wood-forming stems ...................................................................... 77

Table 4-]. Partial list of genes down-regulated in both the vip5 and vip6 mutants, relative
to WT plants .................................................................................................................... 142

Table B. List of primers and sequences .......................................................................... 171

viii

LIST OF FIGURES

Figure 1-1. Organization of the primary and secondary vascular tissues in Arabidopsis
schematically ....................................................................................................................... 4

Figure 1-2. Flowering time control in Arabidopsis. ......................................................... 21

Figure 1-3. Maintenance of active and repressed states of FLC transcription by chromatin
modification. ..................................................................................................................... 22

Figure 2-1. Cross-sections of control and treatment stems of Arabidopsis thaliana. ....... 52

Figure 2-2. Venn diagram showing up-regulated (22-fold) genes in control and treatment
stems, xylem, and bark from the A rabidopsis Genome array analyses. ........................... 56

Figure 2-3. Functional classification of the up-regulated genes in control and treatment
stems, bark and xylem ....................................................................................................... 57

Figure 2-4. R2R3-type MYB transcription factor genes up-regulated in xylem (A) or bark
(B). .................................................................................................................................... 68

Figure 2-5. Northern blot analysis of selected R2R3-type MYB genes that were highly

up-regulated in xylem (MYB59 and MYB48) or bark (MYBI3) ........................................ 69
Figure 2-6. Homeodomain (HD) genes up-regulated in xylem (A) or bark (B). .............. 71
Figure 2-7. Phylogenetic tree of homeodomain (HD) genes. ........................................... 72

Figure 2-8. Hierarchical clustering of differentially regulated genes and selection of
xylem (Group I) and bark (Group II) up-regulated genes ................................................. 75

Figure 3-1. Flowering Time of vip3, vip4, vip5, and vip6 Single and Double Mutants. .. 97

ix

Figure 3-2. Characteristics of Microarray Data Derived from flc, vip5, and vip6 Mutants.
........................................................................................................................................... 99

Figure 3-3. Expression of the F LC—Related MAF Genes in flc, vip5, and vip6 Mutants. 102

Figure 3-4. Map Position, Structure, and Expression of the VIP6 Gene and Protein. 104

Figure 3-5. Analysis of VIP6 mRNA and Protein Abundance in Various Genetic

Backgrounds and in Response to Vemalization. ............................................................ 107
Figure 3-6. Coimmunoprecipitation of VIP3, VIP4, VIP5, and VIP6 in Vivo ............... 111
Figure 3-7. Structure and Expression of VIP5. ............................................................... l 12

Figure 3-8. Immunoblot Analysis of Histone H3 Methylation in Strong vip3, vip4, vip5.
and vip6 Mutants, the flc-3 Null Mutant, and the Col Ecotype. ..................................... 116

Figure 4-1. VIP3 is not required for global modification of either canonical or variant
histone H3. ...................................................................................................................... 141

Figure 4-2. VIP3 is required for histone H3 methylation in a locus-specific manner. 144

Figure 4-3. VIP-FLAG proteins do not appear to coprecipitate with Pol II. .................. 147
Figure 4-4. VIP genes are required for modification of the CTD of Pol II ..................... 148
Figure 5-1. The phosphorylation cycle of the CTD of Pol II .......................................... 162

CHAPTER I

LITERATURE REVIEW

 

 

fit
PIi
SIU

ecc

Und

1. Phase change in plants

During their life cycle, plants go through a succession of developmental phases
distinguished from one another by various morphological, physiological, and biochemical
traits, and the phenomenon is so-called phase change (Brink, 1962). The phase changes
begin with seed germination, and progress generally through juvenility, maturity, and
flowering. The changes are associated with competence of the meristems (a tissue
populated by actively dividing and undifferentiated cells) responding to internal and
external developmental cues (Bemier, 1981; Steeves and Sussex, 1989). Understanding
the mechanisms by which developmental phase changes are regulated will be a perpetual
question throughout plant biology because they are controlled by myriad signal
transduction pathways.

The most obvious example of phase change is the transition from vegetative to
reproductive development when leaf development is arrested and meristems are
differentiated as flowers (Poethig, 1990). Although the floral transition has been
extensively studied, and as a result, many components of flowering pathways have been
identified and characterized, the biochemical roles of them in cellular heredity during
floral transition are less studied. Another example of phase change is the transition from
primary to secondary growth responsible for lateral growth in most tree species, and the
study of molecular mechanism for secondary growth is very limited despite its
economical and ecological significance.

The objective of my thesis research is to understand the molecular mechanisms

underlying phase changes in plants, by studying the switch from vegetative to

 

 

 

1'6

\\

\\

CC

SC

EC

fu

Cl

pr

Pa

reproductive development and the transition of primary to secondary growth in relation to

wood formation.

2. Wood formation
Wood represents the majority of terrestrial biomass and is a valuable resource
economically and ecologically providing timber, pulp, paper, and a range of ecological
services, such as carbon sequestration and nutrient cycling. Despite the economical and
ecological importance of wood, our understanding of wood formation at the molecular
level is very limited (Plomion et al., 2001) partly due to difficulties in performing
practical scales of physiological and molecular biological experiments using woody
plants. However, the development of model plant systems for wood formation (e.g.
Arabidopsis, Zinnia) and the recent advances in genomic tools allow us to take integrated

functional genomic approaches to study wood formation at the molecular level (Brunner

et al., 2004).

2.1. Plants produce wood through secondary growth.

Primary growth in plants is determined by the activity of primary meristems, which
provide a reservoir of undifferentiated stem cells and produce the various plant tissues
(Schnittger et al., 1996). For instance, procambium, a primary meristematic tissue
produces the primary xylem, which is composed of water-conducting tracheary elements,

parenchyma cells, and fibers (Esau, 1977).

 

 

prim.xylem

I sec.xylem: cell expansion

I sec.xylem: cell wall deposition
I, sec.xylem: cell death

I Procambiumlcambium
Sec. phloem
I prim. phloem

 

 

Figure 1-1. Organization of the primary and secondary vascular tissues in
Arabidopsis schematically.

Whole plant, longitudinal view (A). Shoot apex, cross section (B). Leaf, cross section
(C). Root tip, cross section (D). Organization of vascular tissues in the basal region of the
inflorescence stem during the secondary phase of vascular development (E). Inside the
secondary xylem, the position of layers associated with cell expansion, cell wall
deposition, and cell death has been indicated (from Nieminen et a1. 2004).

 

 

 

 

[C

re
sc
bi

$6

In

In

Many plants, including tree species, undergo a phase change from primary growth
to secondary growth. Secondary growth is responsible for lateral growth and controlled
by secondary meristematic tissues such as vascular cambium and cork cambium (Steeves
and Sussex, 1989). The secondary xylem tissues (i.e. wood) are produced from the
vascular cambium (Figure 1-1). Secondary xylem is almost identical in basic functions to
primary xylem (e.g. water conducting and mechanical strength). In addition, it was
recently proposed that the mechanisms underlying cell proliferation during primary and
secondary growth might be common (Nieminen et al., 2004), suggesting a close link
between primary and secondary xylem formation. However the biomass produced by
secondary growth is tremendous, particularly in trees, and secondary growth occurs only
after primary growth is established, suggesting a different mechanism of regulation
between procambium and vascular cambium.

Our understanding of the transition from primary to secondary growth is still
fragmentary because the transition is complex and involves many signal pathways. The
transition from primary to secondary growth has been known to be associated with
external factors including temperature and wounding, and with internal factors such as

hormones and aging.

2.2. Hormones and wounding have positive effects on wood formation

2.2.1. Hormones

Auxin is a key hormone in wood formation (Aloni, 1988). Auxin-overproducing
transgenic Arabidopsis plants have increased numbers of xylem cells; plants with

lowered auxin levels contain fewer xylem cells (Klee et al., 1987). In poplar, xylem

differentiation from the cambial cells is associated with a gradient distribution of auxin
across vascular regions regardless of absolute amount of auxin (Uggla et al., 1998).

In Arabidopsis, several auxin-related genes are important for xylem
differentiation. PIN] encodes an auxin efflux carrier, suggesting a potential role in the
differential distribution of auxin, and mutation of this gene causes discontinuous vascular
strand development (Galweiler et al., 1998). RE VOLUTA/INTERFASCIC ULAR
F IBERLESS 1 (RE V/IF L1) encodes a HD-ZIP transcription factor and its mutation caused
the disruption of interfascicular fiber differentiation (Zhong and Ye, 1999). In rev/iflI
mutants, auxin polar flow rate was reduced and genes encoding auxin efflux carriers were
downregulated (Otsuga et al., 2001; Zhong and Ye, 2001). AT HB-8 encodes a HD-ZIP
transcription factor and its ectopic expression caused exaggerated xylem production
(Baima et al., 2001). AT HB-8 itself is positively regulated by auxin (Baima et al., 1995)
and upregulated during vascular regeneration after wounding (Baima et al., 2001 ).

Other hormones also are important for xylem formation. In Zinnia cell cultures,
cytokinin is necessary for tracheary element induction (Milioni et al., 2002). In
Arabidopsis, CREI/WOL encoding a cytokinin receptor is highly expressed in the
vascular tissue, and creI/wol mutant plants showed a reduced number of cell files within
the vascular bundle (Méihbnen et al., 2000; [none et al., 2001). GA3 stimulates
meristematic activity and elongation of xylem fibers (Digby and Wareing, 1966). In
tobacco, overexpressing a Arabidopsis GAZO-oxidase gene, a key regulatory gene in GA
biosynthesis, causes increased biomass and number of lignified vessels (Biemelt et al.,
2004). Ethylene has been considered as a positive agent in wood formation. Exogenous

application of ethylene increases cambial cell division and tracheid production in some

 

 

 

 

Ll

\\

f0

Ba
for
elo

20rj

OIILT
Cons
CI 3)

I977

gymnosperm species (Eklund and Tiltu, 1999; Kalev and Aloni, 1999). It has been shown
that an ACC oxidase gene from poplar (PIIACOI) is expressed primarily in developing
secondary xylem, suggesting a positive role for ethylene in wood formation (Andersson-

Gunneras et al., 2003).

2.2.2. Wounding

Mechanical wounding can also induce vessel element formation (Jacobs, 1952). The
disturbance of hormone transport by wounding may result in the formation of new
vascular bundles (Aloni, 1995). Auxin has been suggested as a hormone transferring
wounding signal from the wounded cells to the distal cells (Yamada, 1993). However
mechanisms for cross-talk between hormonal signaling and wounding signal in wood

formation have not been proposed.

2.3. Wood biosynthesis

Based on morphological, biochemical, and molecular changes occurring .during wood
formation, wood biosynthesis can be summarized to five serial events; cell division, cell
elongation, secondary cell wall formation, lignification, and programmed cell death (Ye,
2002)

Wood is produced through periclinal divisions of the vascular cambium
originating from differentiated procambium (Steeves and Sussex, 1989). The zone
consists of a few layers of narrow, elongated, thin-walled, and vacuolated cells (Plomion
et al., 2001). Vascular cambium is composed of fusiform initials and ray initials (Esau,

1977). The fusiform initials produce secondary xylem and phloem, and ray initials

 

 

 

 

ell

di

for

CC]

PTO

I Pa
enc
elio
“ht

NQV

produce the ray cells transporting water and solutes between xylem and phloem (Roberts
and Aloni, 1988).

After cell divisions, plant cells expand continuously to reach their final size.
Xyloglucan endotransglycosylases, endoglucanases, pectin methyl esterases, pectinases
and expansins are the primary determinants of this process (Plomion et al., 2001).
Particularly, expansins, cell wall-loosening enzymes, seem to be important in the
elongation of vessel cells because expansin mRNAs are preferentially localized to the
differentiating tracheary elements in Zinnia (Cosgrove, 1999).

Once elongation is completed, the formation of the secondary cell wall occurs in
immature tracheary elements in order to provide a mechanical strength (N ieminen et al.,
2004). Numerous genes specifically involved in the biosynthesis of polysaccharides
(cellulose, hemicellulose) and cell wall proteins are expressed in this stage. For example,
IRREGULAR XYLEM3 (IRX3) encoding a cellulose synthase in Arabidopsis is required
for xylem cell wall formation, and mutation of the IRX3 gene caused collapsed xylem
cells (Taylor et al., 1999).

During cell wall formation, lignins are impregnated in the polysaccharide matrix,
providing mechanical strength, a water barrier, and a defense system. In pine, a group of
R2R3 MYB transcription factors are involved in the lignin biosynthesis pathway
(Paftzlaff et al., 2003). For example, PtMYB4 is shown to bind to promoters of genes
encoding lignin biosynthetic enzymes (Paftzlaff et al., 2003). In Arabidopsis, de-
etiolated3 (det3) and ectopic lignification] (eliI) mutants deposit lignin inside of the cell
where lignin polymers are not found in wild type plants (Cano-Delgado et al., 2000;

Newman et al., 2004). Transcriptional profiling of those mutants revealed that a member

of the R2R3-MYB transcription factor families regulates lignin biosynthesis during
xylem formation (Rogers et al., 2005).

Finally, xylem cells undergo programmed cell death (PCD) to remove their
cellular contents (Fukuda, 1996). Cell death is initiated by the disruption of vacuolar
membranes, resulting in the release of hydrolytic enzymes into the cytosol (Groover and
Jones, 1999). During xylogenesis in Zinnia cell culture, several hydrolysis enzymes (e.g.
cystein proteases, serine proteases, and nucleases) were identified (Ye and Vamer, 1996;
Zhao et al., 2000). Although little is known about the signals triggering the biosynthesis
of the hydrolytic enzymes and their release, calcium has been suggested as a potential

regulator of PCD in xylem formation (Groover and Jones, 1999).

2.4. Model systems for studying wood formation

2.4.]. Arabidopsis

Arabidopsis is a small plant with a small genome, a rapid lifecycle (Goodman et al.,
1995). Unlike woody plants, Arabidopsis can produce only a restricted amount of
secondary xylem. However, enhanced secondary grth can occur in the stem and root
junction regions in mature Arabidopsis when the shoot apex is decapitated (Lev-Yadun,
1994). Anatomical characteristics of secondary xylem from Arabidopsis are similar to
that of wood from trees (Lev-Yadun and F laishman, 2001). Recently, an inducible system
for xylem vessel element differentiation has been established in Arabidopsis, in which
half of subculture cells differentiated into xylem vessel elements within 7 days (Kubo et

al., 2005).

11E
re

Pr

 

 

 

UC

 

2.4.2. Zinnia elegans

Leaf mesophyll cells in Zinnia elegans can redifferentiate into tracheary elements in
suspension culture (Fukuda and Komarnine, 1980). In this system, up to 60 % of the cells
eventually transdifferentiate into dead lignified tracheary elements over the course of four
days (Fukuda, 1996). This system is ideal for biochemical and molecular study of
xylogenesis because the differentiation is synchronously induced in a large number of the
cells in a relatively homogenous cell population (Fukuda, 1996). Although non-woody
systems from Arabidopsis and Zinnia provide information for the cell biology of xylem
formation, tree plants may be a more practical model for field studies because wood
formation is regulated by complex signal pathways (e.g. seasonal cycling of cambial

activity).

2.4.3. Poplars

Poplars have a relatively small genome (550 Mb), rapid growth rate, and are amenable to
tissue culture (Plomion et al., 2001). Moreover, recent accumulation of poplar genomic
resources such as ESTs, genomic sequences, and microarray data supports its value as a
model species for wood formation research (Brunner et al., 2004). However, the
relatively longer generation of poplar compared to annual plants limits its use in reverse

genetics and mutant screening.

2.5. Functional genomic approaches to wood formation

Functional genomics is the study of genome structural elements (e. g. protein binding sites

and chromatin structure) and gene expression at the whole genome level using high-

10

throughput technologies. Functional genomic approaches have been successfully used in
wood formation studies to discover key genes and signaling pathways (Fukuda, 2004;
Kubo et a1, 2005).

Sterky et al. (1998) identified genes related to secondary xylem formation through
the comparison of the EST frequency between vascular cambial cDNA library and
mature xylem cDNA library. Kirst et al. (2003) performed comparative genomics by
analyzing ESTs from wood-forming tissues of loblolly pine and Arabidopsis and
suggested that the genetic mechanisms of wood formations may be conserved between
trees and Arabidopsis.

Microarray analysis in poplar using cambial tissue, immature secondary xylem,
and mature secondary xylem showed that genes involved in lignin biosynthesis or
cellulose biosynthesis are upregulated during secondary xylem formation, and MYB
transcription factor genes were expressed highly in cambium and immature xylem tissue
(Hertzberg et al., 2001). Schrader et al. (2004) identified poplar genes expressed
differentially in vascular cambium zones, developing xylem, phloem, shoot apical
meristem, and root apical meristem using microarrays. In this analysis, a poplar CL V1, a
homolog of Arabidopsis CLA VATA 1 (CLVI), involving in maintenance of a stable
population of meristem at shoot apical meristem, is upregulated in both vascular
cambium and apical meristem, suggesting similarity in regulatory networks between
primary and secondary meristems (Schrader et al., 2004). In Arabidopsis, xylem vessel
elements developed in vitro have been used for microarray analysis (Kubo et al., 2005).

This analysis revealed that NAC-domain transcription factors, such as VND6 and VND7

ll

participate in xylem formation. In fact, overexpression of VND6 or VND7 results in an
induced transdifferentiation of mesophyll cells into xylem (Kubo et al., 2005).

The concept of proteomics has emerged to provide comprehensive information for
understanding biological processes at the translational level (Wasinger et al., 1995). A
proteomic analysis with xylem and bark tissue in poplar demonstrated that lignin
biosynthesis-related proteins were abundant in xylem (Vander Mijnsbrugge et al., 2000).
Similar approaches using wood-forming tissues from pine tree showed that only 30% of
proteins were correlated with their corresponding mRNA expression, suggesting that a

proteomic approach could provide new insight into genes involved in wood formation

(Gion et al., 2005).

2.6. Conclusion

Despite the economical and ecological importance of wood, our understanding of wood
formation at the molecular level is very limited. Wood formation is a complicated
biological process undergoing a phase transition from primary to secondary growth, and
serial events such as cell division and elongation, lignification, and programmed cell
death. Genetic, biochemical, and genomic approaches to wood formation using poplar
and Arabidopsis were able to identify genes related to hormonal signals for xylem
differentiation and xylem cell wall biosynthesis. In addition, those studies suggest that
secondary and primary meristems may utilize similar regulatory networks. However, it
remains to be answered how the genes are orchestrated in wood production and what

triggers secondary growth.

3. Floral transition
Vemalization is a phenomenon, whereby flowering is promoted after prolonged exposure
to winter cold. Plants may have evolved vemalization to maximize seed production after
winter (Koomneef et al., 1998). Vemalization is an example of epigenetics, which is
defined as any heritable influence on gene activity that does not involve a change in DNA
sequence (Russo et al., 1996). For example, Hyocyamus niger, requiring long day
condition and cold treatment for flowering, does not flower immediately after vemalizing
cold, instead it maintains the vegetative phase under the short-day condition, and later
flowers when exposed to long-day (Lang, 1965), suggesting that plants can ‘remember’
their past experience of the vemalizing cold. The memory of vemalization is transmitted
mitotically. In experiments using Lunaria biennis (Wellensiek, 1964) and Arabidopsis
(Burn et al., 1993), various tissues are vemalized and then subjected to regeneration in
vitro. Only plants derived from young leaves or root apical meristem (containing actively
dividing cells) can flower without additional vemalization treatment, and the vemalized
states are maintained through tissue culture. The vemalized cells lose their memory of
vemalization when they pass through meiosis and into the next generation and then next
generation cells need cold for flowering (Bemier et al., 1981). The mechanism whereby
vemalization is maintained and perpetuated in somatic cells is an unsolved problem.
There is now limited evidence suggesting that the cellular memory mechanism for

vemalization is associated with chromosome structural modifications.

13

3.1. Cellular memory and chromatin structure

In eukaryotic cells, genomic DNA is compacted and organized inside the nucleus as
chromatin built by nucleosomes. The nucleosome contains DNA wound twice around a
histone octamer which consists of two each of H2A, HZB, H3, and H4 histone proteins
(Luger, 2003). The organization of DNA into chromatin poses immediate challenges for
enzymatic processes that require DNA as a template such as replication, DNA repair,
recombination, and transcription. For protein factors targeting DNA elements, the tightly
packed chromatin must be partially dissociated. Structural alteration of chromatin can be
an important regulatory mechanism. For instance, heterochromatin, a form of chromatin
tightly packaged is transcriptionally inactive, while euchromatin, loosely wrapped around
histones, represents a transcriptionally active state. It is now evident that structural
modulation of chromatin plays a crucial role in cell differentiation and development by

mediating epi genetic control of gene transcription.

3.1.1. Post-translational modifications of histones
Histones can be modified by the addition of acetyl, methyl, phosphate, and ubiquitin at
their amino-terminal tails. Distinct histone amino-terminal modifications can generate
synergistic or antagonistic interaction affinities for chromatin-associated proteins, which
in turn dictate dynamic transitions between transcriptionally active or transcriptionally
silent chromatin states. The combinatorial nature of histone modifications thus reveals a
histone code that considerably extends the information potential of the genetic code
(Orphanides and Reinberg, 2000; Strahl and Allis, 2000).

Histone acetylations catalyzed by histone acetyltransferases (HATS) are

associated with transcriptional activation (Turner, 2000). A yeast HAT complex, SAGA

 

 

 

 

3]

pi

SI

dr

)r

tr

II

tr

(1

(Spt-Ada—anS-containing HAT) switches its target promoter chromatin from an inactive
to an active state through histone acetylation, and the active state can be maintained for
long periods even after the switching signal has disappeared (Cosma et al., 1999). In
Arabidopsis, proteins related to Gcn5 and Ada physically interact with each other, and
also interact with a transcriptional activator (CBFl), suggesting that the Arabidopsis
protein complex is a functional equivalent of SAGA (Stockinger et al., 2001;
Vlachonasios et al., 2003). Histone acetylation reversed by histone deacetylases
(HDACs) is associated with transcriptional repression (Wu and Grunstein, 2000). The
Arabidopsis genome encodes for at least 17 HDACs (Pandey et al., 2002), and some of
them have been characterized (for review, Hsieh and Fischer, 2005). For example,
AtHDA6 is required for maintenance of transcriptional gene silencing and chromatin
structure in the rDNA repeats (Probst et al., 2004).

Histone methylations have been linked to gene activation or repression,
depending on the modified residues (Kouzarides, 2002; Jaskelioff and Peterson, 2003). In
yeast, trimethylation of histone H3 lysine-4 (H3 K4) is associated with active
transcription (Krogan et al., 2002; Strahl et al., 2002), and hypermethylated H3 K4 within
the transcribed region persists for considerable time after transcriptional inactivation,
indicating that H3 K4 hypennethylation provides a molecular memory of recent
transcriptional activity (Ng et al., 2003). In Arabidopsis, the histone KRYPTONITE
(KYP) is able to methylate H3 K9 in vitro (Jackson et al., 2002), and its gene mutation
caused decreased CprG methylation globally, suggesting a link between histone
methylation and DNA methylation in gene repression (Malagnac et al., 2002). Since

DNA methylation represents a mechanism of genetic memory (Bird, 2002), it may be an

 

 

 

 

hi
of
Rt."

Su

Chi

l‘te

I63

I'm"

interesting speculation that KYP is required for recruiting DNA methylases for epigenetic

gene repression.

3.1.2. Pc-G and Trx-G
Cavalli and Paro (1999) showed that brief transcriptional activation (or inactivation) of
homeobox-containing Hox genes leads to stable activity (or inactivity) thereafter in early
Drosophila development and attempts to alter the expression at later stages of
development were unsuccessful. The result indicates that there is a window of time
during which transcription patterns can be committed to developmental cellular memory
(Bird, 2002). Polycomb-Group (Pc-G) and Trithorax-Group (Trx-G) proteins are
identified as epigenetic regulators of the Hox gene clusters (Francis and Kingston, 2001).
Pc-G proteins reinforce the transcriptionally suppressed states probably by packaging
and/or maintaining chromatin in states less accessible to transcriptional machinery
(Pirrotta, 1997; F ischle et al., 2003). For instance, Pc-G proteins assist dimethylation of
histone H3 K9 recognizing HETEROCHROMATIN PROTEIN 1 (HPI), an integral part
of heterochromatin (Grewal and Elgin, 2002). Some Pc-G proteins comprise Polycomb
Repressive Complex 2 containing a core of four subunits: Enhancer of zeste (E[z]),
Suppressor of zeste (Su[z]), Extra sex combs (ESC), and p55 (Lund and van Lohuizen,
2004). Antagonistically, Trx-G proteins are necessary for maintenance of active states of
chromatin (Beltran et al., 2003). Trx-G proteins include ATP-dependent chromatin-
remodeling complex SWI/SNF required for conformational change of chromatin,
resulting in accessible condition for transcriptional machinery (Muller and Leutz, 2001).
The Arabidopsis putative homologues of Pc-G were well documented in several

reviews (Guyomarc’h et al., 2005; Hsieh and Fischer, 2005). Interestingly, targets of

several Pc-G proteins are MADS (MCMl/AGAMOUS/QEFICIENS/SRFI) box-
containing transcription factor genes, rather than homeobox-containing genes as in
Drosophila (Kohler and Grossniklaus, 2002). For example, CURLY LEAF (CLF),
similar to E(z), acts as a repressor of the floral homeotic MADS box gene AGAMOUS
(AG) (Goodrich et al., 1997). AtMSII, encoding a homolog of p55, represses AG gene
expression in leaves (Henning et al., 2003). EMBRYONIC F LOWERZ, sharing domains
with SU(z)12, is involved in the transition from the vegetative phase to flowering phase
by repressing more than twenty flowering-specific genes including MADS box genes
such as AG, APETALAI, and PISTILLATA (Yoshida et al., 2001; Moon et al., 2003).
Arabidopsis genome encodes at least five Trx-G proteins. Among them, ATXl
methylates H3 K4 in vitro and its gene mutation caused a growth defect and floral
abnormality (Alvarez-Venegas et al., 2003; Alvarez-Venegas and Avramova, 2005). The
functional targets and mechanism of ATXI in gene activation have not been shown.
Although a subset of Pc-G and Trx-G proteins seems to be conserved among higher
eukaryotes, their antagonistic roles for gene regulation and cellular memory in plants

have not been demonstrated.

3.1.3. Histone variants

Higher eukaryotes have two types of histones; canonical histones and variants. The
sequence similarity between the canonical histones and the variants ranges from almost
no amino acid differences to extremely divergent changes (Malik and Henikoff, 2003).
Canonical histones are deposited at replication forks. By contrast, histone variants can be
deposited through replication-independent pathways and particularly within euchromatic

regions (Ahmad and Henikoff, 2002; Hsieh and Fischer, 2005). Unlike canonical H3,

17

 

 

 

 

V2

re
di

pl

Cl
nu
20'
3e:
\Vi
disr

pm]

al., ,

Em.

variant H3 (named H33 in humans and flies, H32 in plants) is relatively enriched in di-
or trimethylated H3 K4 but deficient in dimethylated H3 K9 in flies, suggesting a link
between replacement of H33 and histone modifications in transcriptional activation
(McKittrick et al., 2004). Mito et al. (2005) found that H3.3 is deposited at sites of
abundant RNA polymerase II and methylated H3 K4 throughout the fruit fly genome,
suggesting that the replacement of canonical H3 with H33 is a mechanism mediating
transcriptional memory for efficient and prompt transcriptional cycling.

In Alfalfa, higher level of acetylation of H32 than canonical H3 is observed
(Waterborg, 1993; Robertson et al., 1996). Most histone H3.2 genes are expressed in
replication independent manner in Arabidopsis (Okada et al. 2005). However there is no
direct evidence that the histone replacement is involved in epigenetic gene regulation in

plants.

3.1.4. Nucleosome remodeler
Chromatin-remodeling complexes containing ATPase subunits are known to slide
nucleosomes, alter the histone-DNA interactions, and/or replace histones (Tsukiyama,
2002; Langst and Becker, 2004). The SWI/SNF ATP-dependent remodeling complex in
yeast is associated with active or repressed state depending on its target region (Wu and
Winston, 1997). Kingston and Narlikar (1999) showed that yeast SWI/SNF complex
disrupts nucleosome structure and helps recruit of transcriptional factors to their target
promoter in vitro.

In Arabidopsis genome, there are at least forty SWI/SNF-like proteins (Reyes et
al., 2002; Hsieh and Fischer, 2005). Among them, PHOTOPERIOD-INDEPENDENT

EARLY FLOWERINGI (PIE 1 ) encodes a protein that is similar to yeast ATP-dependent

 

 

 

 

ar
ar
tr:
31.
SC.
VCI

his

FM
Shel

and

chromatin-remodeling proteins of ISWI and SWIZ/SNFZ family, and is required for
transcriptional activation of a MADS box gene (Noh and Amasino, 2003). Since some
members of the ISWI and SW12/SNF 2 families are components of Trx-G proteins in fruit
flies (Kennison, 1995), PIEl may function as a transcriptional activator through
chromatin remodeling activity. However biochemical activity of PlEl has not been

demonstrated.

3.2. Molecular and epigenetic mechanisms mediating vemalization

The presence of winter and summer annuals in various Arabidopsis accessions led to the
finding that the vemalization cold requirement for flowering is mediated by natural allelic
variations of two loci, FRIGIDA (FRI), and FLOWERING LOC US C (FLC). The
functional, dominant FRI and semi-dominant FLC act synergistically to confer a winter-
annual growth habit, requiring vemalizing cold for rapid flowering. In contrast to winter-
annual plants, summer-annual accessions, which do not require vemalizing cold
treatment for flowering, have either a non-functional fri allele or a weak flc allele (Lee et
al., 1993, 1994; Koomneef et al., 1994; Johanson et al., 2000; Michaels et al., 2003;
Schmitz et al., 2005). It is now evident that the nature of the cellular memory of
vemalization is associated with epigenetic regulation of FLC, which is achieved by

histone modifications (Sung and Amasino, 2004).

3.2.1. FLC
F LC encodes a MADS box-containing transcription factor (Michaels and Amasino, 1999;

Sheldon et al., 1999). FLC mRNA is expressed most strongly in shoot apex (Michaels

and Amasino, 2000) where vemalizing cold signal is perceived. and the FLC mRNA

 

 

 

abun
ksar
epuy
gene
200C
FI(‘

(Sun

(Rat
prot.
expr
Venj
FL(

aHfi

abundance decreased to an undetectable level after vemalizing cold, suggesting that FLC
is a mediator of vemalization (Sheldon et al., 2000; Rouse et al., 2002). Consistent with
epigenetic nature of vemalization, FLC mRNA is reset to a normal level in next
generations (Michaels and Amasino, 1999; Sheldon et al., 1999; Michaels and Amasino,
2000). Under the vemalizing cold treatment, the acetylation levels of histone H3 within
F LC promoter and intronic regions decrease, and methylation of histone H3 K9 increases
(Sung and Amasino, 2004).

FLC belongs to a family of closely related MADS box proteins in Arabidopsis
(Ratcliffe et al., 2001), which includes five other MADS-AFFECTING FLOWERING
proteins, MAFl-S. Like FLC, the MAF genes function as floral repressors when
expressed constitutively in transgenic plants, and some MAF genes are downregulated by
vemalizing cold (Ratcliffe et al., 2001, 2003). Several positive or negative regulators of
F LC or MAF genes are identified (Figure 1-2). Werner et a1. (2005) found that the natural
allelic variation of MAF] gene causes the different vemalization responses between
accessions. Thus the function of the FLC clade is evolutionary conserved in mediating

the vemalization responses.

3.2.2 Histone modifications for FLC repression
A model for the regulation of expression of FLC through chromatin modifications has

been proposed (Figure 1-3) (Sung and Amasino, 2005).

20

 

 

 

 

III
EN
g(
35
M
in.

ARP6, ESD4,
PIE 1, EFS

FRI VIP Photoperiod

-/
> (D

Vemalization l

FLD, F VE l

 

 

Vegetative phase Reproductive phase

Figure 1-2. Flowering time control in Arabidopsis.

This is a simplified model that does not contain all of the genes involved in flowering
time control in Arabidopsis. High levels of FLC and its paralogs, MAF genes repress the
activity of the floral promotion pathways and many genes (e.g. autonomous pathway
genes: FLD, F VE, etc; vemalization pathway genes: VRNI, VRNZ, VIN3; chromatin-
associated genes: VIP, ARP6, PIE1, EFS, ESD4) are identified as regulators of FLC or
MAF genes. In the diagram, the arrow indicates a promotive effect, while the “.L”
indicates an inhibitory effect.

21

   
  

triMeK4 '

 

triMeK4

 

VIN3, VRN1,
VRN2, E(z) etc. ”PI

diMeK9 diMeK9 diMeK9 diMeK9 diMeK9

Repression by
vernallzatlon

 

Figure 1-3. Maintenance of active and repressed states of FLC transcription by
chromatin modification.

(a) EFS and Arabidopsis PaflC homologue, VIP may regulate FLC positively utilizing
histone modification-associated mechanism. (b) Heterochromatin formation at the FLC
locus. Heterochromatin formation requires the induction of VIN3 and involves a series of
histone modifications, such as deacetylation and methylation. VRN2 and VRNI are also
involved in the methylation of K9 of histone H3. Enhancer of Zeste (E(z)) is histone
methyltransferase that is responsible for methylation on histone H3 in Pc-G-mediated
repression. HPl may recognize and bind to dimethylated histone H3 K9, to participate in
maintaining the heterochromatin-like state of FLC (this picture is adapted from Sung and
Amasino, 2005).

22

 

 

I.)

p4

VI

Uni
trat
Wh.
that

initi

and 1’.

2004A

VERNALIZA T I 0N INSENSI T I VE3 (VIN3)

VERNALIZA TION INSENSITIVE3 (VIN3) when mutated causes the plants to be
insensitive to vemalization (Sung and Amasino, 2004). VIN3 is induced only after
prolonged exposure to cold, suggesting its involvement in the repression of FLC (Sung
and Amasino, 2004). VIN3 plays a role in histone modifications of FLC chromatin. In
vin3 mutants, FLC continued to be expressed at high levels after vemalizing cold and
vemalization-associated histone H3 deacetylation were not observed (Sung and Amasino,
2004). VIN3 encodes a protein containing a plant homeodomain (PHD) known as a

possible component of chromatin-remodeling complex (Sung and Amasino, 2004).

VERNALIZA TION] (VRNI) and VRN2

VERNALIZA TION (VRN) genes are required for maintenance of epigenetic F LC silencing
under vemalizing cold treatment. vrnI and vrn2 mutants, like wild type plants show F LC
transcription repression afier cold treatment, but the repression state is not maintained
when vemalizing cold is removed (Gendall et al., 2001; Levy et al., 2002), suggesting
that VRNl and VRN2 are required for stable maintenance of repression rather than the
initial cold-induced repression of FLC (Gendall et al., 2001). VRN2 is homologous to
Su(z)12, which is a component of a Drosophila Pc-G complex possessing a histone
methyltransferase activity for H3 K9 (Birve et al., 2001; Czermin et al., 2002). VRN2
also interacts physically with CLF and SWINGER (SWN) homologous with Drosophila
E(z), revealed in yeast two-hybrid analysis. These facts suggest a conserved function of
VRN2 as Pc-G proteins in plants (Chanvivattana et al., 2004). Consistent with this, vrnl
and vrn2 mutants show hypomethylation of H3 K9 on FLC chromatin (Bastow et al.,

2004). However, it is not yet clear whether CLF and SWN are in vivo partners of VRN2

23

for F LC regulation because clf or swn mutation has no effects on vemalization response.
CLF and S WN could act redundantly with respect to the vemalization response, so that

defect may not be manifest in single-mutant plants (Chanvivattana et al., 2004).

F VE, FLD, and RELATIVE 0F EARLY FLOWERING6 (REF 6)

In addition to being suppressed by vemalization, FLC is also negatively regulated by
F VE, F LD, and REF 6. fire or fld mutants flower late but can still respond to vemalization
(Koomneef et al., 1991; Simpson et al., 1999). FVE is a homolog of mammalian
retinoblastoma-associated proteins (RbAp) and yeast multicopy suppressor of IRA]
(MSIl), components of HDAC complex and components of the chromatin assembly
factor CAF -1 (Ausin et al., 2004; Kim et al., 2004). In fve mutants, histones within FLC
chromatin are hyperacetylated (Ausin et al., 2004), suggesting that a mechanism for
repressing FLC by FVE may include histone deacetylation. FLD is homologous with
human lysine specific demethylase 1 (LSDl) known for histone H3 K4 demethylation
activity (Shi et al., 2004) and is required for hypomethylation of histone H3 K4 and
hypoacetylation of histone H4 on FLC chromatin (He et al., 2003; He et al., 2004). The
facts suggest that F LD may have histone H3 K4 demethylation activity. REF 6 is also
likely related to histone lysine demethylation (Noh et al., 2004; Tsukada et al., 2006).
REF6 contains jumonji (ij)N/C domains identified in a mouse protein, JU MONJ I (J MJ)
(Balciunas and Ronne, 2000). JMJ interacts with retinoblastoma protein and represses
transcription, implicating a certain role of JMJ in chromatin-based gene repression (Jung
et al., 2005). Recently, a human jumonji domain-containing protein, JHDMI was shown
to specifically demethylate histone H3 K36 (Tsukada et al., 2006). Thus, REF6 could

function as a transcriptional repressor of F LC through histone H3 K36 demethylation.

24

 

 

 

 

 

thl

3C1

th
L05
levc
sugé
deve
al.3
have
{SI};

COmpl‘

3.2.3 Histone modifications for FLC activation

EARLY FLOWERING IN SHORT DA YS (EFS)

Mutants for the EFS gene show repressed FLC gene expression level, early flowering,
and a globally reduced level of specifically dimethylation of H3 K36, suggesting that
EFS is a key enzyme methylating H3 K36 for FLC activation (Soppe et al., 1999; Zhao et
al., 2005). In fact, EFS encodes a protein containing SET-domain commonly found in
histone methyltransferases (Kim et al., 2005). Lesions of EFS gene also cause a reduced
H3 K4 trimethylation on F LC chromatin (Kim et al., 2005; Zhao et al., 2005), implicating
that both H3 K4 and H3 K36 methylations may be required for activation of FLC
synergistically. Further characterization of EFS and possible H3 K4 methyltransferases
through genetic and biochemical analysis may explain their synergistic effect on FLC

activation.

ACT IN-RELA T ED PROTEIN6 (ARP6) (SUPPRESSOR 0F FRIGIDA3 [SUF3])

Loss of function of ARP6 (also known as SUF3) gene caused a decrease in the transcript
level of FLC and early flowering as well as pleiotropic developmental abnormalities,
suggesting diverse roles of ARP6 (SUF3) in not only FLC regulation but also other
development-related gene regulations (McKinney et al., 2002; Choi et al., 2005; Deal et
al., 2005). However biochemical roles and potential targets of Arabidopsis ARP6 (SUF3)
have not yet been demonstrated. Since the possible equivalent of Arabidopsis ARP6
(SUF3) in yeast is a component of ATP-dependent chromatin-remodeling protein

complex SWRl that functions to replace histone H2A with its variant H2A.Z on

25

 

 

4 _4___..‘-,_.._.

 

chrc

witl

EAI

ESL

MO

ESL

(Re

al‘l‘e

of I

pro
SL7

H0

chromatin (Krogan et al., 2003; Mizuguchi et al., 2004), ARP6 (SUF3) may be associated

with histone replacement.

EARL Y IN SHORT DA YS4 (ESD4)

ESD4 encodes a protein homologous with yeast SMALL UBIQUITIN-RELATED
MODIFIER (SUMO)-specific protease Ulpl (Murtas et al., 2003). The mutations of
ESD4 gene result in a decreased mRNA level of FLC and pleiotropic mutant phenotypes
(Reeves et al., 2002). SUMO proteins can bind to lysine residues of target proteins and
affect the interactions of their targets (Nathan et al., 2003). For example, SUMOylation
of H4 from human cell is required for recruitment of HDAC and HP], which is resulting
in gene silencing (Shiio and Eisenman, 2003). SUMO-specific proteases are required for
processing of immature SUMO and recycling of SUMO. esd4 mutants accumulate
SUMO-protein conjugates, suggesting a protease activity of ESD4 (Murtas et al., 2003).

However there is no direct evidence that ESD4 regulates F LC through SUMOylation.

VERNA LIZA TION INDEPENDENCE (VIP)

A group of vemalization independence (vip) mutants have been isolated based on
vemalization-independent early flowering mutant screening to define novel F LC positive
regulators (Zhang and van Nocker, 2002; Zhang et al., 2003). VIP2 (also known as
EARLY FLOWERING7 [ELF7]), VIP4, VIP5, and VIP6 (also known as ELF8) are
closely related to Pafl, Leol, Rtfl, and Ctr9 from yeast, respectively (Zhang and van
Nocker, 2002; He et al., 2004; Oh et al., 2004). These yeast proteins are components of a
transcriptional regulator called ‘RNA Polymerase 11 Associated Factor 1 Complex’

(Pafl C), which mediates the establishment and/or maintenance of specific chromatin

26

 

 

 

3e

lat

mo
of I
reg.
Hm
Chit

FM

modifications for gene activation during transcription (Mueller and Jaehning, 2002; Ng et
al., 2003; Penheiter et al., 2005). However, the potential roles of these proteins in
transcription and the epigenetic maintenance of gene activity have not been studied in
plants. Another VIP protein, VIP3 contains WD motifs known as platforms for the
assembly of protein complexes. Although vip3 mutants show the same mutant
phenotypes as other vip mutants, VIP3 is not related to components of yeast PaflC
(Zhang et al., 2003). The possibility of functional conservation between VIP proteins and
yeast Pafl C, and role(s) of VIP proteins in the epigenetic gene regulation are discussed

later chapters.

3.3. Conclusion

Vemalization is a phase change resulting in floral transition and is mediated through
cellular memory processes by repressing FLC. It is now evident that cellular memory
mechanisms are associated with chromatin structural changes including histone
modifications. Recent genetic and biochemical studies suggest that the epigenetic process
of vemalization is caused by an altered FLC chromatin structure. Several transcriptional
regulators of FLC have been identified to be associated with histone modifications.
However, it is unclear what are biochemical mechanisms of these regulators on FLC
chromatin modification and how they are orchestrated for establishment and maintaining

FLC expression.

27

 

W“.
.1

 

Au

Bai

 

Bai

Bait

Bast

 

4. References

Ahmad, K., and Henikoff, S. (2002). Epigenetic consequences of nucleosome dynamics.
Cell 111:281-284.

Aloni, R. (1988). Vascular differentiation within the plant. Vascular differentiation and
plant growth regulators. Springer-Verlag, New York.

Aloni, R. (1995). The induction of vascular tissues by auxin and cytokinin. In plant
hormones: Physiology, biochemistry and molecular biology, 2nd ed. Kluwer
Academic Publishers, Dordrecht, The Netherlands.

Alvarez-Venegas, R., and Avramova, Z. (2005). Methylation patterns of histone H3 Lys
4, Lys 9, and Lys 27 in transcriptionally active and inactive Arabidopsis genes and in
ath mutants. Nucleic Acids Res. 33:5199-5207.

Alvarez-Venegas, R., Pien, S., Sadder, M., Witmer, X., Grossniklaus, U., and Avramova,
Z. (2003). ATX-l, an Arabidopsis homolog of trithorax, activates flower homeotic
genes. Curr. Biol. 13:627-637.

Andersson-Gunneras, S., Hellgren, J.M., Bjorklund, S., Regan, S., Moritz, T., and
Sundberg, B. (2003). Asymmetric expression of a poplar ACC oxidase controls
ethylene production during gravitational induction of tension wood. Plant J. 34:339-
349.

Ausin, I., Alonso-Blanco, C., Jarillo, J.A., Ruiz-Garcia, L., and Martinez-Zapater, J.M.

(2004). Regulation of flowering time by FVE, a retinoblastoma-associated protein.
Nat. Genet. 36:162-166.

Baima, S., Nobili, F., Sessa, G., Lucchetti, S., Ruberti, 1., and Morelli, G. (1995). The
expression of the Athb-8 homeobox gene is restricted to provascular cells in
Arabidopsis thaliana. Development 121 :4171-41 82.

Baima, S., Possenti, M., Matteucci, A., Wisman, E., Altamura, M.M., Ruberti, I., and
Morelli, G. (2001). The Arabidopsis ATHB-8 HD-zip protein acts as a
differentiation-promoting transcription factor of the vascular meristems. Plant
Physiol. 126:643-655.

Balciunas, D., and Ronne, H. (2000). Evidence of domain swapping within the jumonji
family of transcription factors. Trends Biochem. Sci. 25:274-276.

Bastow, R., Mylne, J .S., Lister, C., Lippman, Z., Martienssen, RA, and Dean, C. (2004).
Vemalization requires epigenetic silencing of FLC by histone methylation. Nature
427:164-167.

28

Beltran, S., Blanco, E., Serras, F ., Perez-Villamil, B., Guigo, R., Artavanis-Tsakonas, S.,
and Corominas, M. (2003). Transcriptional network controlled by the trithorax-group
gene ash2 in Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 100:3293-3298.

Bemier, G., Kinet, J.M., and Sachs, RM. (1981). The Physiology of Flowering. Boca
Raton, FL: CRC Press.

Biemelt, S., Tschiersch, H., and Sonnewald, U. (2004). Impact of altered gibberellin
metabolism on biomass accumulation, lignin biosynthesis, and photosynthesis in
transgenic tobacco plants. Plant Physiol. 135:254-265.

Bird, A. (2002). DNA methylation patterns and epigenetic memory. Genes Dev. 16:6-21.

Birve, A., Sengupta, A. K., Beuchle, D., Larsson, J., Kennison, J. A., Rasmuson-
Lestander, A., and Muller, J. (2001). Su(z)12, a novel Drosophila Polycomb group
gene that is conserved in vertebrates and plants. Development 128:3371-3379.

Brink, A. 1962. Phase change in higher plants and somatic cell heredity. Quart. Rev.
Biol. 3721-22.

Brunner, A.M., Busov, V.B., and Strauss, SH. (2004). Poplar genome sequence:
functional genomics in an ecologically dominant plant species. Trends Plant Sci.
9:49-56.

Burn, J.E., Smyth, D.R., Peacock, W.J., and Dennis, ES. (1993). Genes conferring late
flowering in Arabidopsis thaliana. Genetica 90: 145-1 57.

Cano-Delgado, A.I., Metzlaff, K., and Bevan, M.W. (2000). The eliI mutation reveals a
link between cell expansion and secondary cell wall formation in Arabidopsis
thaliana. Development 127:3395-3405.

Cavalli, G., and Pam, R. (1999). Epigenetic inheritance of active chromatin after removal
of the main transactivator. Science 286:955-958.

Chanvivattana, Y., Bishopp, A., Schubert, D., Stock, C., Moon, Y.H., Sung, Z.R., and
Goodrich, J. (2004). Interaction of Polycomb-group proteins controlling flowering in
Arabidopsis. Development 131 :5263-5276.

Choi, K., Kim, S., Kim, S.Y., Kim, M., Hyun, Y., Lee, H., Choe, S., Kim, S.G.,
Michaels, S., and Lee, I. (2005). SUPPRESSOR 0F FRIGIDA3 encodes a nuclear
AC TIN-RELA TED PROTEIN6 required for floral repression in Arabidopsis. Plant
Cell 17:2647-2660.

Cosgrove, DJ. (1999). Expansins and other agents that enhance cell wall extensibility.
Ann. Rev. Plant Physiol. Plant Mol. Biol. 50:391-417.

29

 

 

 

I)i

13k.

Esa

Fisc

an‘

Fuki

Fuki

Fuku

Cosma, M., Tanaka, T., and Nasmyth, K. (1999). Ordered recruitment of transcription
and chromatin remodeling factors to a cell cycle and developmentally regulated
promoter. Cell 97:299-31 1.

Czermin, B., Melfi, R., McCabe, D., Seitz, V., Imhof, A., and Pirrotta, V. (2002).
Drasophila enhancer of Zeste/ESC complexes have a histone H3 methyltransferase
activity that marks chromosomal Polycomb sites. Cell 111:185-196.

Deal, R.B., Kandasamy, M.K., McKinney, EC, and Meagher, RB. (2005). The nuclear
actin-related protein ARP6 is a pleiotropic developmental regulator required for the
maintenance of FLOWERING LOC US C expression and repression of flowering in
Arabidopsis. Plant Cell 17:2633-2646.

Digby, J., and Wareing, PF. (1966). The effect of applied grth hormones on cambial
division and the differentiation of the cambial derivates. Ann. Bot. 30:539-548.

Eklund, L., and Tiltu, A. (1999). Cambial activity in normal spruce Picea abies Karst (L.)
and snake spruce Picea abies (L.) Karst f. virgata (Jacq.) Rehd in response to
ethylene. J. Exp. Bot. 50: 1489-1493.

Esau, K. (1977). Anatomy of Seed Plants, 2nd ed. Wiley, New York.

Fischle, W., Wang, Y., Jacobs, S.A., Kim, Y., Allis, CD, and Khorasanizadeh, S.
(2003). Molecular basis for the discrimination of repressive methyl-lysine marks in
histone H3 by Polycomb and HP] chromodomains. Genes Dev. 17: 1 870-1 881.

Francis, N.J., and Kingston, RE. (2001). Mechanisms of transcriptional memory. Nat.
Rev. Mol. Cell Biol. 2:409-421.

Fukuda, H. (1996). Xylogenesis: initiation, progression, and cell death. Annu. Rev. Plant
Biol. 47:299-325.

Fukuda, H. (2004). Signals that control plant vascular cell differentiation. Nature Rev.
Mol. Cell Biol. 52379-391.

Fukuda, H., and Komarnine, A. (1980). Establishment of an experimental system for the
study of tracheary element differentiation from single cells isolated from the
mesophyll of Zinnia elegans. Plant Physiol. 65:57-60.

Galweiler, L., Guan, C., Muller, A., Wisman, E., Mendgen, K., Yephremov, A., and
Palme, K. (1998). Regulation of polar auxin transport by AtPINI in Arabidopsis
vascular tissue. Science 282:2226-2230.

Gendall, A.R., Levy, Y.Y., Wilson, A., and Dean, C. (2001). The VERNALIZA TION2
gene mediates the epigenetic regulation of vemalization in Arabidopsis. Cell
107:525-535.

30

 

 

 

Gr

lie

H81

[“01

Jacl

Gion, J.M., Lalanne, C., Le Provost, G., Ferry-Dumazet, H., Paiva, J., Chaumeil, P.,
Frigerio, J.M., Brach, J., Barre, A., de Daruvar, A., Claverol, S., Bonneu, M.,
Sommerer, N., Negroni, L., and Plomion, C. (2005). The proteome of maritime pine
wood forming tissue. Proteomics 5:3731-3751.

Goodman, H.M., Ecker, J .R., and Dean, C. (1995). The genome of Arabidopsis thaliana.
Proc. Natl. Acad. Sci. U S A 92:10831-10835.

Goodrich, J., Puangsomlee, P., Martin, M., Long, D., Meyerowitz, E.M., and Coupland,
G. (1997). A Polycomb-group gene regulates homeotic gene expression in
Arabidopsis. Nature 386144-51.

Grewal, S.I.S., and Elgin, S.C.R. (2002). Heterochromatin: new possibilities for the
inheritance of structure. Curr. Opin. Genet. Dev. 12:178-187.

Groover, A., and Jones, AM. (1999). Tracheary element differentiation uses a novel
mechanism coordinating programmed cell death and secondary cell wall synthesis.
Plant Physiol. 119:375-384.

Guyomarc’h, S., Bertrand, C., Delarue, M., and Zhou, D.X. (2005). Regulation of
meristem activity by chromatin remodeling. Trends Plant Sci. 10:332-338.

He, Y., Doyle, M.R., and Amasino, RM. (2004). PAF l-complex-mediated histone
methylation of FLOWERING LOC US C chromatin is required for the vemalization-
responsive, winter-annual habit in Arabidopsis. Genes Dev. 18:2774-2784.

He, Y., Michaels, 8., and Amasino, R. (2003). Regulation of flowering time by histone
acetylation in Arabidopsis. Science 30221751-1754.

Hennig, L., Taranto, P., Walser, M., Schonrock, N., and Gruissem, W. (2003).
Arabidopsis MSII is required for epigenetic maintenance of reproductive
development. Dev. 130:2555-2565.

Hertzberg, M., Aspeborg, H., Schrader. J ., Andersson, A., Erlandsson, R., Blomqvist, K.,
Bhalerao, R., Uhlen, M., Teeri, T.T., Lundeberg, J., Sundberg, B., Nilsson, P., and
Sandberg, G. (2001). A transcriptional roadmap to wood formation. Proc. Natl. Acad.
Sci. U S A 98:14732-14737.

Hsieh, TE, and Fischer, R.L. (2005). Biology of chromatin dynamics. Annu. Rev. Plant
Biol. 56:327-351.

Inoue, T., Higuchi, M., Hashimoto, Y., Seki, M., Kobayashi, M., Kato, T., Tabata, S.,
Shinozaki, K., and Kakimoto, T. (2001). Identification of CREl as a cytokinin
receptor from Arabidopsis. Nature 409: 1060-1063.

Jackson, J.P., Lindroth, A.M., Cao, X., and Jacobsen, SE. (2002). Control of CprG
DNA methylation by the KRYPTONITE histone H3 methyltransferase. Nature
416:556-560.

31

 

 

 

Ki

Ki

Klr

K0

KOI

Jacobs, WP. (1952). The role of auxin in differentiation of xylem around a wound.
Amer. J. Bot. 39:301-309.

Jaskelioff, M., and Peterson, CL. (2003). Chromatin and transcription: Histones continue
to make their marks. Nat. Cell Biol. 5:395-399.

Johanson, U., West, J., Lister, C., Michaels, 8., Amasino, R., and Dean, C. (2000).
Molecular analysis of FRIGIDA, a major determinant of natural variation in
Arabidopsis flowering time. Science 290:344-347.

Jung, J., Kim, T.G. Lyons, G.E., Kim, HR, and Lee, Y. (2005). Jumonji regulates
cardiomyocyte proliferation via interaction with retinoblastoma protein. J. Biol.
Chem. 280:30916-30923.

Kalev, N., and Aloni, R. (1999). Role of ethylene and auxin in regenerative

differentiation and orientation of tracheids in Pinus pinea seedlings. New Phytol.
142:307-313.

Kennison, J .A. (1995). The Polycomb and trithorax group proteins of Drosophila: trans-
regulators of homeotic gene function. Annu. Rev. Genet. 29:289-303.

Kim, H.J., Hyun, Y., Park, J.Y., Park, M.J., Park, M.K., Kim, M.D., Kim, H.J., Lee.
M.H., Moon, J., Lee, I., and Kim, J. (2004). A genetic link between cold responses
and flowering time through F VE in Arabidopsis thaliana. Nat. Genet. 36:167-171.

Kim, S.Y., He, Y., Jacob, Y., Noh, Y.S., Michaels, 8., and Amasino. R. (2005).
Establishment of the vemalization-responsive, winter-annual habit in Arabidopsis
requires a putative histone H3 methyl transferase. Plant Cell 17:3301-3310.

Kingston, R.B., and Narlikar, GJ. (1999). ATP-dependent remodeling and acetylation as
regulators of chromatin fluidity. Genes and Dev. 13:2338-2352.

Kirst, M., Johnson, A.F., Baucom, C., Ulrich, E., Hubbard, K., Staggs, R., Paule, C.,
Retzel, E., Whetten, R., and Sederoff, R. (2003). Apparent homology of expressed
genes from wood-forming tissues of loblolly pine (Pinus taeda L.) with Arabidopsis
thaliana. Proc. Natl. Acad. Sci. U S A 100:7383-7388.

Klee, H.J., Horsch, R.B., Hinchee, M.A., Hein, M.B., and Hoffmann, N.L. (1987). The
effects of overproduction of two Agrobacterium tumefaciens T-DNA auxin
biosynthetic gene products in transgenic petunia plants. Genes Dev. 1:86-96.

Kohler, C., and Grossniklaus, U. (2002). Epigenetic inheritance of expression states in
plant development: the role of Polycomb group proteins. Curr. Opin. Cell Biol.
14:773-779.

Koomneef, M., Hanhart, OJ, and Van Der Veen, J.H. (1991). A genetic and

physiological analysis of late flowering mutants in Arabidopsis thaliana. Mol. Gen.
Genet. 229:57-66.

32

Koomneef, M., Blankestijn-de Vries, H., Hanhart, C., Soppe, W., and Peeters, T. (1994).
The phenotype of some late-flowering mutants is enhanced by a locus on

chromosome 5 that is not effective in the Landsberg erecta wild-type. Plant J. 6:911-
919.

Koomneef, M., Alonso-Blanco, C., Blankestijn-de Vries, H., Hanhart, C.J., and Peeters,
A.J.M. (1998). Genetic interactions among late-flowering mutants of Arabidopsis.
Genetics 1482885-892.

Kouzarides, T. (2002). Histone methylation in transcriptional control. Curr. Opin. Genet.
Dev. 12:198-209.

Krogan, N.J., Dover, J., Khorrami, S., Greenblatt, J.P., Schneider, J ., Johnston, M., and
Shilatifard, A. (2002). COMPASS, a histone H3 (Lysine 4) methyltransferase
required for telomeric silencing of gene expression. J. Biol. Chem. 277: 10753-10755.

Krogan, N.J., Keogh, M.C., Datta, N., Sawa, C., Ryan, O.W., Ding, H., Haw, R.A.,
Pootoolal, J., Tong, A., Canadien, V., Richards, D.P., Wu, X., Emili, A., Hughes,
T.R., Buratowski, S., and Greenblatt, J.F. (2003). A San family ATPase complex
required for recruitment of the histone H2A variant thl. 1. Mol. Cell. 12:1565-1576.

Kubo, M., Udagawa, M., Nishikubo, N., Horiguchi, G., Yamaguchi, M., Ito, J., Mimura,
T., Fukuda, H., and Demura, T. (2005). Transcription switches for protoxylem and
metaxylem vessel formation. Genes Dev. 19:1855-1860.

Lang, A. (1965). Physiology of flower initiation. In Encyclopedia of Plant Physiol. (ed.
W. Ruhland), pp. 1371-1536. Springer-Verlag, Berlin.

Langst, G., and Becker, PB. (2004). Nucleosome remodeling: one mechanism, many
phenomena? Biochim. Biophys. Acta. 1677:58-63.

Lee, 1., Bleecker, A., and Amasino, RM. (1993). Analysis of naturally occurring late
flowering in Arabidopsis thaliana. Mol. General Genet. 237: 1 71-176.

Lee, I., Michaels, D.D., Masshardt, AS, and Amasino, RM. (1994). The late-flowering
phenotype of FRIGIDA and mutations in LUMINIDEPENDENS is suppressed in the
Landsberg erecta strain of Arabidopsis. Plant J. 62903-909.

Levy, Y.Y., Mesnage, S., Mylne, J .S., Gendall, A.R., and Dean, C. (2002). Multiple roles
of Arabidopsis VRNI in vemalization and flowering time control. Science 297:243-
246.

Lev-Yadun, S. (1994). Induction of sclereid differentiation in the pith of Arabidopsis
thaliana (L.) Heynh. J. Exp. Bot. 45:1845-1849.

Lev-Yadun, S., and Flaishman, MA. (2001). The effect of submergence on ontogeny of

cambium and secondary xylem and on fiber lignification in inflorescence stems of
Arabidopsis. IAWA J. 22:159-169.

33

Luger, K. (2003). Structure and dynamic behavior of nucleosomes. Curr. Opin. Genet.
Dev. 13:127-135.

Lund, AH, and van Lohuizen, M. (2004). Polycomb complexes and silencing
mechanisms. Curr. Opin. Cell Biol. 16:239-264.

Mahonen, A.P., Bonke, M., Kauppinen, L., Riikonen, M., Benfey, RN, and Helariutta,
Y. (2000). A novel two-component hybrid molecule regulates vascular
morphogenesis of the Arabidopsis root. Genes Dev. 14:2938-2943.

Malagnac, F., Bartee, L., and Bender, J. (2002). An Arabidopsis SET domain protein
required for maintenance but not establishment of DNA methylation. EMBO J.
21:6842-6852.

Malik, HS, and Henikoff, S. (2003). Phylogenomics of the nucleosome. Nat. Struct.
Biol. 10:882-891.

McKinney, E.C., Kandasamy, M.K., and Meagher, RB. (2002). Arabidopsis contains
ancient classes of differentially expressed actin-related protein genes. Plant Physiol.
128:997-1007.

McKittrick, E., Gaflten, P.R., Ahmad, K., and Henikoff, S. (2004). Histone H3.3 is
enriched in covalent modifications associated with active chromatin. Proc. Natl.
Acad. Sci. U S A 101:1525-1530.

Michaels, SD, and Amasino, RM. (1999). FLOWERING LOC US C encodes a novel
MADS domain protein that acts as a repressor of flowering. Plant Cell 11:949-956.

Michaels, SD, and Amasino, RM. (2000). Memories of winter: vemalization and the
competence to flower. Plant Cell. Environ. 23:1145-1153.

Michaels, S.D., He, Y., Scortecci, K.C., and Amasino, RM. (2003). Attenuation of
FLOWERING LOC US C activity as a mechanism for the evolution of summer-annual
flowering behavior in Arabidopsis. Proc. Natl. Acad. Sci. U S A 100:10102-10107.

Milioni, D., Sado, P.E., Stacey, N.J., Roberts, K., and McCann, MC. (2002). Early gene
expression associated with the commitment and differentiation of a plant tracheary

element is revealed by cDNA-amplified fragment length polymorphism analysis.
Plant Cell 14:2813-2824.

Mito, Y., Henikoff, J. G., and Henikoff, S. (2005). Nat. Genet. 37:1090-1097.
Mizuguchi, G., Shen, X., Landry, J., Wu, W.H., Sen, 8., and Wu, C. (2004). ATP-driven

exchange of histone H2A.Z variant catalyzed by SWRl chromatin remodeling
complex. Science 303:343-348.

34

 

 

Kloo

Slur
Klul

hiur

b§c

or
()k

()r

Moon, Y.H., Chen, L., Pan, R.L., Chang, H.S., Zhu, T., Maffeo, D.M., and Sung, Z.R.
(2003). EMF genes maintain vegetative development by repressing the flower
program in Arabidopsis. Plant Cell: 1 5:681-693.

Mueller, CL, and Jaehning, J.A. (2002). Ctr9, Rtfl, and Leo] are components of the
Pafl /RNA polymerase II complex. Mol. Cell Biol. 22:1971-1980.

Muller, C., and Leutz, A. (2001). Development and chromatin remodeling. Curr. Op.
Gen. Dev. 11:167-174.

Murtas, G., Reeves, P.H., Fu, Y.F., Bancroft, 1., Dean, C., and Coupland, G. (2003). A
nuclear protease required for flowering-time regulation in Arabidopsis reduces the
abundance of SMALL UBIQUITIN-RELATED MODIFIER conjugates. Plant Cell
15:2308-2319.

Nathan, D., Sterner, DE, and Berger, S.L. (2003). Histone modifications: Now
summoning sumoylation. Proc. Natl. Acad. Sci. U S A 100:13118-13120.

Newman, L.J., Perazza, D.E., Juda, L., and Campbell, M.M. (2004). InvOlvement of the
R2R3-MYB, AIMYB6I, in the ectopic lignification and dark-photomorphogenic
components of the det3 mutant phenotype. Plant J. 37:239-250.

Ng, H.H., Robert, F., Young, R.A., and Struhl, K. (2003). Targeted recruitment of Set]
histone methylase by elongating Pol 11 provides a localized mark and memory of
recent transcriptional activity. Mol. Cell. 1 1:709-719.

Nieminen, K.M., Kauppinen, L., and Helariutta, Y. (2004). A weed for wood?
Arabidopsis as a genetic model for xylem development. Plant Physiol. 135:653-659.

Noh, B., Lee, SH, Kim, H.J., Yi, 0., Shin, E.A., Lee, M., Jung, K.J., Doyle, M.R.,
Amasino, R.M., and Noh, Y.S. (2004). Divergent roles of a pair of homologous

jumonji/zinc-finger-class transcription factor proteins in the regulation of Arabidopsis
flowering time. Plant Cell 16:2601-2613.

Noh, Y.S., and Amasino, RM. (2003). PIE1, an ISWI family gene, is required for FLC
activation and floral repression in Arabidopsis. Plant Cell 15:1671-1682.

Oh, S., Zhang, H., Ludwig, P., and van Nocker, S. (2004). A mechanism related to the
yeast transcriptional regulator PaflC is required for expression of the Arabidopsis
FLC/MAF MADS-box gene family. Plant Cell 16:2940-2953.

Okada, T., Endo, M., Singh, M.B., and Bhalla, PL. (2005). Analysis of the histone H3
gene family in Arabidopsis and identification of the male-gamete-specific variant
AIMGH3. Plant J. 44:557-568.

Orphanides, G., and Reinberg, D. (2000). RNA polymerase II elongation through
chromatin. Nature 407:471-475.

35

 

 

PI

PI
PI

Pr

Re

R.

R0]

Otsuga, D., DeGuzman, B., Prigge, M.J., Drews, G.N., and Clark, SE. (2001).
RE VOL UTA regulates meristem mitiation at lateral positions. Plant J. 25:223-236.

Pandey, R., Muller, A., Napoli, C. A., Selinger. D. A., Pikaard, C. S., Richards, E. J.,
Bender, J., Mount, D. W., and Jorgensen, R. A. (2002). Analysis of histone
acetyltransferase and histone deacetylase families of Arabidopsis thaliana suggests

functional diversification of chromatin modification among multicellular eukaryotes.
Nucleic Acids Res. 30:5036-5055.

Patzlaff, A., Newman, L.J., Dubos, C., Whetten, R.W., Smith, C., McInnis, S., Bevan,
M., Sederoff, RR, and Campbell, M.M. (2003). Characterization of PtMYBI, an
R2R3-MYB from pine xylem. Plant Mol. Biol.53:597-608

Penheiter, K.L., Washbum, T.M., Porter, S.E., Hoffman, M.G., and Jaehning, J.A.
(2005). A posttranscriptional role for the yeast Pafl -RNA polymerase II complex is
revealed by identification of primary targets. Mol. Cell 20:213-223.

Pirrotta, V. (1997). Pc-G complexes and chromatin silencing. Curr. Opi. Genet. Dev.
7:249-258.

Plomion, C., Leprovost, G., and Stokes, A., (2001). Wood formation in trees. Plant
Physiol. 12:1513-1523.

Poethig, RS. (1990). Phase change and the regulation of shoot morphogenesis in plants.
Science 250:923-930.

Probst, A.V., Fagard, M., Proux, F., Mourrain, P., Boutet, S., Earley, K., Lawrence, R.J.,
Pikaard, C.S., Murfett, J ., Fumer, 1., Vaucheret, H., and Mittelsten Scheid, O. (2004).
Arabidopsis histone deacetylase HDA6 is required for maintenance of transcriptional

gene silencing and determines nuclear organization of rDNA repeats. Plant Cell
16:1021-1034.

Ratcliffe, O.J., Kumimoto, R.W., Wong, B.J., and Riechmann, J.L. (2003). Analysis of
the Arabidopsis MADS AFFECTING FLOWERING gene family: MAFZ prevents
vemalization by short periods of cold. Plant Cell 15:1159-1169.

Ratcliffe, O.J., Nadzan, G.C., Reuber, T.L., and Riechmann, J.L. (2001). Regulation of
flowering in Arabidopsis by an FLC homologue. Plant Physiol. 126:122-132.

Reeves, P.H., Murtas, G., Dash, S., and Coupland, G. (2002). early in short days 4, a
mutation in Arabidopsis that causes early flowering and reduces the mRNA
abundance of the floral repressor F LC . Development 129:5349-5361.

Reyes, J. C., Hennig, L., and Gruissem, W. (2002). Chromatin remodeling and memory
factors — new regulators of plant development. Plant Physiol. 130:1090-1101.

Robert, L.W., and Aloni, P. B. (1988). Vascular differentiation and plant grth
regulators. Berlin: Springer-Verlag.

36

 

 

Rt
RC.

Ru

Scl
SCI
Sci.
She
She
Shi.

Shiir

Robertson, A.J., Kapros, T., Dudits, D., and Waterborg, J .H. (1996). Identification of the
three highly expressed replacement histone H3 genes of Alfalfa. DNA Sequence
6:137-146.

Rogers, L.A., Dubos, C., Surman, C., Willment, J., Cullis, I.F., Mansfield, SD, and
Campbell, M.M. (2005). Comparison of lignin deposition in three ectopic
lignification mutants. New Phytol. 168: 123-140.

Rouse, D.T., Sheldon, C.C., Bagnall, D.J., Peacock, W.J., and Dennis, ES. (2002). FLC,
a repressor of flowering, is regulated by genes in different inductive pathways. Plant
J. 29:183-191.

Russo, V.B.A., Martienssen, R.A., and Riggs, AD. (1996). Epigenetic mechanisms of
gene regulation. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Schmitz, R., Hong, L., Michaels, 8., and Amasino, RM. (2005). FRIGIDA-ESSENTIAL I
interacts genetically with FRIGIDA and FRIGIDA-LIKE 1 to promote the winter-
annual habit of Arabidopsis thaliana. Development 132:5471-5478.

Schnittger, A., Grini, P.E., Folkers, U., and Lskamp, M.H. (1996). Epidermal fate map of
the Arabidopsis shoot meristem. Dev. Biol. 1752248-255.

Schrader, J ., Nilsson, J ., Mellerowicz, E.J., Berglund, A., Nilsson, P., Hertzberg, M., and
Sandberg, G. (2004). A high-resolution transcript profile across the wood-forming

meristem of poplar identifies potential regulators of cambial stem cell identity. Plant
Cell 16:2278-2292.

Sheldon, C.C., Burn, J.E., Perez, P.P., Metzger, J., Edwards, J.A., Peacock, W.J., and
Dennis, ES. (1999). The FLF MADS box gene: a repressor of flowering in
Arabidopsis regulated by vemalization and methylation. Plant Cell 11:445-458.

Sheldon, C.C., Rouse, D.T., Finnegan, E.J., Peacock, W.J., and Dennis, ES. (2000). The
molecular basis of vemalization: the central role of FLOWERING LOC US C (FLC).
Proc. Natl. Acad. Sci. USA 97:3753-3758.

Shi, Y.J., Lan, F., Matson, C., Mulligan, P., Whetstine, J.R., Cole, P.A., Casero, R.A.,
and Shi, Y. (2004). Histone demethylation mediated by the nuclear amine oxidase
homolog LSDl. Cell 119:941-953.

Shiio, Y., and Eisenman, R. (2003). Histone sumoylation is associated with
transcriptional repression. Proc. Natl. Acad. Sci. U S A 100:13225-13230.

Simpson, G.G., Gendall, A.R., and Dean, C. (1999). When to switch to flowering. Annu.
Rev. Cell Dev. Biol. 99:519-550.

Soppe, W.J., Bentsink, L., and Koomneef, M. (1999). The early-flowering mutant efr is

involved in the autonomous promotion pathway of Arabidopsis thaliana.
Development 126:4763-4770.

37

Steeves, T. A., and Sussex, 1. M. (1989). Patterns in Plant Development. Cambridge:
Cambridge University Press.

Sterky, F ., Regan, S., Karlsson, J., Hertzberg, M., Rohde, A., Holmberg, A., Amini, B.,
Bhalerao, R., Larsson, M., Villarroel, R., Van Montagu, M., Sandberg, G., Olsson,
O., Teeri, T.T., Boerjan, W., Gustafsson, P., Uhlen, M., Sundberg, B., and

Lundeberg, J. (1998). Gene discovery in the wood-forming tissues of poplar: analysis
of 5,692 expressed sequence tags. Proc. Natl. Acad. Sci. USA 95:13330-13335.

Stockinger, B.J., Mao, Y., Regier, M., Triezenberg, S.J., and Thomashow, M.F. (2001).
Transcriptional adaptor and histone acetyltransferase proteins in Arabidopsis and
their interactions with CBFl, a transcriptional activator involved in cold-regulated
gene expression. Nucleic Acids Res. 29:1524-1533.

Strahl, B.D., and Allis, CD. (2000). The language of covalent histone modifications.
Nature 403241-45.

Strahl, B.D., Grant, P.A., Briggs, S.D., Bone, J.R., Caldwell, J .A., Cook, R.G., Sun, Z.W,
Mollah, S., Shabanowitz, J ., Hunt, D.F., and Allis, CD. (2002). Set2 is a nucleosomal

histone H3-selective methyltransferase that mediates transcriptional repression. Mol.
Cell Biol. 22: 1298-1 306.

Sung, S., and Amasino, RM. (2004). Vemalization in Arabidopsis thaliana is mediated
by the PHD finger protein VIN3. Nature 427: 1 59-164.

Sung, S., and Amasino, RM. (2005). Remembering winter: toward a molecular
understanding of vemalization. Annu. Rev. Plant Biol. 56:491-508.

Taylor, N.G., Scheible, W.R., Cutler, S., Somerville, CR, and Turner, SR. (1999). The
irregular xylem3 locus of Arabidopsis encodes a cellulose synthase required for
secondary cell wall synthesis. Plant Cell 11:769-779.

Tsukada, Y., Fang, J ., Erdjument-Bromage, H., Warren, M.E., Borchers, C.H., Tempst,
P., and Zhang, Y. (2006). Histone demethylation by a family of ijC domain-
containing proteins. Nature 439281 1-816.

Tsukiyarna, T. (2002). The in viva functions of ATP-dependent chromatin-remodeling
factors. Nat.Rev. Mol. Cell. Biol. 32422-429.

Turner, BM. (2000). Histone acetylation and an epigenetic code. Bioessays 22:836-845.

Uggla, C., Mellerowicz, B.J., and Sundberg, B. (1998). Indole-3-acetic acid controls
cambial growth in scots pine by positional signaling. Plant Physiol. 117:113-121.

Vander Mijnsbrugge, K., Meyermans, H., Van Montagu, M., Bauw, G., and Boerjan, W.

(2000). Wood formation in poplar: identification, characterization, and seasonal
variation of xylem proteins. Planta 2102589-598.

38

vr

 

\yc

Ye

Y0

Zh;i

Vlachonasios, K.E., Thomashow, M.F., and Triezenberg, SJ. (2003). Disruption
mutations of ADA2b and GCN5 transcriptional adaptor genes dramatically affect
Arabidopsis growth, development, and gene expression. Plant Cell 152626-638.

Wasinger, V.C., Cordwell, S.J., Cerpa-Poljak, A., Yan, J.X., Gooley, A.A., Wilkins,
M.R., Duncan, M.W., Harris, R., Williams, KL, and Humphery-Smith, I. (1995).
Progress with gene product mapping of the Mollicutes. Electrophoresis 1621090-
1094.

Waterborg, J. H. (1993). Histone synthesis and turnover in Alfalfa. Fast loss of highly
acetylated replacement histone H3.2. J. Biol. Chem. 26824912-4917.

Wellensiek, SJ. (1964). Dividing cells as the prerequisite for vemalization. Plant Physiol.
392832-835.

Werner, J.D., Borevitz, J.O., Uhlenhaut, N.H., Ecker, J.R., Chory, J., and Weigel, D.
(2005). FRIGIDA-independent variation in flowering time of natural Arabidopsis
thaliana accessions. Genetics 170:] 197-1207.

Wu, L., and Winston, F. (1997). Evidence that Snf-Swi controls chromatin structure over
both the TATA and UAS regions of the S UC2 promoter in Saccharomyces cerevisiae.
Nucleic Acids Res. 25:4230-4234.

Wu, J., and Grunstein, M. (2000). 25 years after the nucleosome model: chromatin
modifications. Trends Biochem. Sci. 25: 619-623.

Yamada, T. (1993). The role of auxin in plant-disease development. Ann. Rev.
Phytopath. 31:253-273.

Ye, Z.H., and Varner, J.E. (1996). Induction of cysteine and serine proteases during
xylogenesis in Zinnia elegans. Plant Mol. Biol. 30:1233-1246.

Ye, Z.H. (2002). Vascular tissue differentiation and pattern formation in plants. Annu.
Rev. Plant Biol. 53:183-202.

Yoshida, N., Yanai, Y., Chen, L., Kato, Y., Hiratsuka, J., Miwa, T., Sung, Z. R., and
Takahashi, S. (2001). EMBRYONIC FLOWER2, a novel plycomb group protein

homolog, mediates shoot development and flowering in Arabidopsis. Plant Cell
13:2471-2481.

Zhang, H., and van Nocker, S. (2002). The VERNALIZA TION INDEPENDENCE4 gene
encodes a novel regulator of FLOWERING LOC US C. Plant J. 31:663-673.

Zhang, H., Ransom, C., Ludwig, P., and van Nocker, S. (2003). Genetic analysis of early-
flowering mutants in Arabidopsis defines a class of pleiotropic developmental
regulator required for activity of the flowering-time switch F LOWERING LOC US C.
Genetics 164:347-358.

39

Zhao, C., Johnson, B.J., Kositsup, B., and Beers, ER (2000). Exploiting secondary
growth in Arabidopsis. Construction of xylem and bark cDNA libraries and cloning
of three xylem endopeptidases. Plant Physiol. 123:1185-1196.

Zhao, Z., Yu, Y., Meyer, D., Wu, C., and Shen, W.H. (2005). Prevention of early
flowering by expression of FLOWERING LOCUS C requires methylation of histone
H3 K36. Nat. Cell Biol. 721156-1160.

Zhong, R., and Ye, Z.H. (1999). [FL], a gene regulating interfascicular fiber
differentiation in Arabidopsis, encodes a homeodomain-leucine zipper protein. Plant
Cell 11:2139-2152.

Zhong, R., and Ye, Z.H. (2001). Alteration of auxin polar transport in the Arabidopsis
ifll mutants. Plant Physiol 1262549-563.

40

CHAPTER II

Transcriptional Regulation of Secondary Growth in Arabidopsis thaliana

This work was published in Sookyung Oh, Sunchung Park, Kyung-Hwan Han (2003), J.
Exp. Bot. 5422709-2722, Transcriptional regulation of secondary growth in
Arabidopsis thaliana. Computational analysis of cis-element in Table 2-2 was done by

Sunchung Park.

41

 

 

 

[)es

bun.

behi
rece

seco
trani
Aral
\Verc
fiunc
trans
gene
EXpa
S€Vel
gant

Pane
SGCOI
Clemr
menu
Varky
IDfinT

prOCe:

Abstract

Despite its economic and environmental significance, understanding the molecular
biology of secondary growth (i.e. wood formation) in tree species has been lagging
behind that of primary growth, primarily due to the inherent difficulties of tree biology. In
recent years, Arabidopsis has been shown to express all of the major components of
secondary growth. Arabidopsis was induced to undergo secondary growth and the
transcriptome profile changes were surveyed during secondary growth using 8.3 K
Arabidopsis Genome Arrays. Twenty per cent of the ~8300 genes surveyed in this study
were differentially regulated in the stems treated for wood formation. Genes of unknown
function made up the largest category of the differentially expressed genes, followed by
transcription regulation-related genes. Examination of the expression patterns of the
genes involved in the sequential events of secondary growth (i.e. cell division, cell
expansion, cell wall biosynthesis, lignification, and programmed cell death) identified
several key candidate genes for the genetic regulation of secondary growth. In order to
gain further insight into the transcriptional regulation of secondary growth, the expression
patterns of the genes encoding transcription factors were documented in relation to
secondary growth. A computational biology approach was used to identify regulatory cis-
elements from the promoter regions of the genes that were up-regulated in wood-forming
stems. The expression patterns of many previously unknown genes were established and
various existing insights confirmed. The findings described in this report should add new
information that can lead to a greater understanding of the secondary xylem formation

process.

42

Introduction
Plant growth by means of apical meristems results in the development of sets of primary
tissues such as epidermis, vascular bundles, and leaves. In addition to this primary
growth, tree species undergo secondary growth and produce the secondary tissue ‘wood’
(secondary xylem) from the vascular cambium (i.e. secondary meristems). The vascular
cambium originates from the procambium and normally consists of 5—15 dividing cells. It
occurs as a continuous ring of meristem cells that are located between the xylem and the
phloem (the so-called ‘cambial zone’) (Larson, 1994; Mauseth, 1998). The transition
from procambium to cambium is not clearly understood. On the xylem side of the
cambium, the cells first go through stages of differentiation that involve cell division,
expansion, maturation, lignification, secondary cell wall thickening, and programmed cell
death, in which all cellular processes are terminated (Chaffey, 1999). The growth of
vascular cambium increases the diameter (by periclinal divisions) and the circumference
(by anticlinal divisions) of an axis. Positional information appears to be required to co-
ordinate this development of secondary xylem (Uggla et al., 1996, 1998). To achieve the
patterned growth, each cell must express the appropriate sets of genes in a co-ordinated
manner after receiving the necessary positional information. In other words, the control of
cambial growth and differentiation is accomplished by changing the activity of key genes
involved in developmental pathways. Recently, significant progress has been made in the
study of the genes and signaling mechanisms responsible for secondary wall formation,
lignin and cellulose biosynthesis (Arioli et al., 1998), and xylem development (Fukuda,

1997; Ye, 2002).

43

Secondary growth is one of the most important biological processes on Earth. Its
product, wood, is of primary importance to humans as timber for construction, fuelwoods,
and wood-pulp for paper manufacturing. It is also the most environmentally cost-effective
renewable source of energy. However, despite its economic and environmental
significance, secondary growth has received little research interest, mainly because most
agricultural products are derived from seeds or roots. Furthermore, the biology of wood
formation is surprisingly understudied because of the inherent problems of tree species:
long generation time, large size, and lack of genetically pure lines. Study of wood
formation at the molecular level using real trees has begun in recent years. A genomics
approach has been successfully used to examine global gene expression patterns in
developing xylem tissues of black locust (Yang et al., 2003), pine (Allona et al., 1998;
Lorenz and Dean, 2002), and poplar (Sterky et al., 1998; Hertzberg et al., 2001).
However, current understanding of the molecular mechanisms of wood formation in trees
is still limited.

Recently, Arabidopsis, the most well-studied herbaceous model species, has been
used as a model for the study of wood and fiber production in trees (Lev-Yadun, 1994;
Zhao et al., 2000). When kept from flowering by repeated removal of inflorescences (i.e.
decapitation) and grown at a low density, Arabidopsis produces a significant quantity of
secondary xylem (i.e. wood) that is sufficient for various developmental studies (Lev-
Yadun, 1994; Beers and Zhao, 2001). Zhao et al. (2000) characterized xylem-specific
proteases in Arabidopsis. Chaffey et al. (2002) reported wood formation in the

hypocotyls of short-day-grown Arabidopsis plants and demonstrated that the secondary

44

 

ge
\sz
(ie
cor
ide
eXp
'Thc

and

Plam
Arab,
BaCct
f9nna

afler I

xylem tissues produced in their study were structurally similar to those of an angiospenn
tree (poplar).

The primary objectives of this research were to identify xylogenesis-associated
genes and to determine how they are regulated in Arabidopsis thaliana. Wood formation
was induced as described by Lev-Yadun (1994). Then, using Arabidopsis Genome
GeneChip (8.3K) Arrays, the global gene expression patterns were examined by
comparing treatment versus control stems and xylem versus bark tissues, the genes were
identified that are differentially regulated for wood formation, and the differentially
expressed genes were clustered into several groups based on their expression patterns.
The expression profiles of three types of transcription factors (AUX/1AA, R2R3-MYB,
and HD-containing) that have previously been shown to regulate the developmental
processes involved in secondary growth were also documented. A computational biology
approach was then used to identify several cis-regulatory elements from the promoter
regions of genes whose expression patterns could be associated with wood formation.
Elucidation of any commonality found in those regulatory elements frequently presented
in wood fonnation-associated genes might provide some insight into the genetic

regulation of secondary growth.

Materials and Methods
Plant growth and treatment for wood formation in Arabidopsis
Arabidopsis thaliana (L.) Heynh. Columbia plants were grown in a greenhouse using
Baccto soil under l6/8 h light/dark conditions at 23i3 °C. The plants in the wood
formation treatment were grown at the density of one plant per 100 cm2 pot. Four weeks

after germination, the inflorescence was removed as previously described (Lev-Yadun,

45

1994). At that time, most of the plants had about ten rosette leaves and 4—5 cm long
inflorescences. The removal all newly emerging inflorescences was continued for an
additional 5 weeks. In addition, a 4-month-old poplar (Populus deltoides) stem was
prepared as sample material to be used for an anatomical comparison of xylem structures
found in Arabidopsis plant samples. For use in the control stem, 25 Arabidopsis plants
were grown in a 100 cm2 pot. After 3 weeks without any treatment, 3-4 cm long young
inflorescence samples were harvested and used as control stems. Xylem and bark samples
were also isolated from the treatment plant as described by Zhao et al. (2000). Briefly,
about 1 cm of the root—hypocotyl junction region was excised from treatment plants and
the lateral roots were trimmed from the primary root using a razor blade (VWR Co., West
Chester, PA). Xylem and bark portions were separated by forceps and razor blade,
quenched with liquid N2 and stored at —80 °C until use. Cross-section samples were
prepared by fixation in 3% paraforrnaldehyde and 1.25% gluteraldehyde solution. After
fixation, the samples were dehydrated in a series of ethanol solutions (25, 50, 75, 95, and
100%), embedded in paraffin (Sigma-Aldrich Co., St Louis, MO), cut using razor blade
(VWR) and stained with 0.025% toluidene blue 0. The sliced samples were observed

under the microscope (American Optical Instruments, Buffalo, NY).

RNA extraction and cDNA synthesis

For treatment stem, control stem, xylem tissue, and bark tissue samplings, two
biologically duplicate sets were prepared. At least 150 individual plants were harvested
for each set. Total RNA was isolated using Qiagen RNeasy columns (Qiagen Co.,
Valencia, CA) and mRNA was isolated using Qiagen mRNA Midi kit (Qiagne Co.). The

first strand cDNA was synthesized from 800 ng of mRNA, in the reaction mixture using

46

100 pmol of an oligo dT (24) primer, containing a 5'-T7 RNA polymerase promoter
sequence, and 200 units of SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA)
in 75 mM KCl, 3 mM MgC12, 50 mM Tris-HCI (pH 8.3), 10 mM dithiothreitol (DTT),
and 0.5 mM dNTP. The second cDNA synthesis was performed in a reaction mixture
with 25 mM Tris-HCI (pH 7.5), 100 mM KCl, 5 mM MgC12, 10 mM (NH4)ZSO4, 1 mM
dNTP, 40 units E. coli DNA polymerase, 10 units E. coli ligase, and two units of RNase
H. Double-stranded cDNA products were purified by phenol/chloroform extraction and

ethanol precipitation.

cRNA synthesis

Biotinylated cRNA were in vitro transcribed from synthesized cDNA by T7 RNA
polymerase (BioArray high yield RNA Transcript Labeling Kit, Enzo Diagnostics Inc.,
Farmingdale, NY). The cRNAs were purified using Qiagen RNeasy Spin Columns. 20 pg
were then randomly fragmented via incubation at 94 °C for 35 min, in a buffer containing
30 mM magnesium acetate, 100 mM potassium acetate and 40 mM Tris-acetate (pH 8.1),

in order to produce molecules of approximately 35—200 base long cRNA.

GeneChip array hybridization

The following hybridization was performed at the Genomics Technology Support Facility
(GTSF) on the campus of Michigan State University. Briefly, fragmented cRNAs were
denatured at 99 °C for 5 min in the mixture of 0.1 mg ml”I sonicated herring sperm DNA
and hybridization buffer containing 100 mM 2-N-morpholino-ethanesulphonic acid
(MES), l M NaCl, 20 mM EDTA, and 0.01% (w/v) Tween 20. Then, the hybridization

mix was hybridized with GeneChip® Arabidopsis Genome Arrays (Affymetrix, Santa

47

Clara, CA) at 45 °C for 16 h on a rotisserie at 60 rpm. After hybridization, the array
cartridge was rinsed and stained in a fluidics station (Affymetrix). The hybridized arrays
were first rinsed with wash buffer A (6x SSPE [0.9 M NaCl, 0.06 M NaHzPO4, 0.006 M
EDTA], 0.01% [w/v] Tween 20, and 0.005% [w/v] Antifoam) at 25 °C for 10 min and
then incubated with wash buffer B (100 mM MES, 0.1 M NaCl, and 0.01% [w/v] Tween
20) at 50 °C for 20 min. Next, the arrays were incubated with streptavidin phycoerythrin
(SAPE) solution containing 100 mM MES, l M NaCl, 0.05% [w/v] Tween 20, 0.005%
[w/v] Antiform, 10 mg ml‘1 SAPE, and2 mg ml”l bovine serum albumin at 25 °C for 10
min, washed with wash buffer A at 25 °C for 20 min, and stained with biotinylated
antistreptavidin antibody at 25 °C for 10 min in a fluidics station (Affymetrix). The probe
array was scanned twice, and then the intensities were averaged with a Hewlett-Packard

GeneArray Scanner.

Data analysis

Gene expression levels were measured by the calculated signal value which assigns a
relative measure of abundance to the transcript, and the reliability of those data were
evaluated using the P-value system as described in the Microarray Suite 5.0 (Affymetrix).
A global scaling strategy that sets the average signal intensity of the array to a target
signal of 500 was used for scaling and normalization, so all of the signal values are
directly comparable. Expression data for all gene sequences on the GeneChip arrays were
analysed using Microsoft Excel. The reproducibility of the array experiments was
characterized by comparing each set of signal values from the duplicated experiments.
Synthesis of cDNA and cRNA from each set of biological samples was performed

independently. The labeled cRNA samples were then hybridized to two different

48

GeneChip arrays. A coefficient of determination was calculated between the duplicate
experiments. The average signal value from the duplicated set and its standard deviations
was calculated. The genes whose standard deviations exceed their average signal values
were eliminated from the gene list. The average signal values from the control stems,
treatment stems, xylem samples, and bark samples were compared. Genes presenting
more than a 2-fold difference in average signal values in each comparison were defined
as differentially expressed genes. Selected genes were clustered according to their
expression level by complete linkage hierarchical clustering using GeneSpringTM
(SiliconGenetics). Functional annotations of the genes were obtained from the Munich
Information Center for Protein Sequences (MIPS) Arabidopsis database (MATDB,
http://mips.gsf.de/proj/thal/db/) by using the AGI (Arabidopsis Gene Index,
http://www.tigr.org/tdb/tgi/agi/) numbers provided by the GeneChip manufacturer

(Affymetrix Co.).

Northern blot analysis of selected R2R3-type MYB genes

For probe DNA isolation in northern blot analysis, 50 ng of poly (A)+ RNA was isolated
from the xylem tissue samples and used in the synthesis of cDNA as described above.
Two microlitres of the reverse transcription reaction mixture was used as atemplate for
RT-PCR cloning with Taq polymerase (Promega, Madison, WI, USA) using gene-
specific primers. The gene-specific primers were designed for MYB59 (accession no.
AF062894), MYB48 (accession no. F272733), and MYBI3 (accession no. Z97048). The
sequences of primers used included the following: MYB59 (5'-AGAGA
TGAAACTTGTGCAAG-3' and 5'-ACAGAAGCTTCAAAAGTC TAT-3'), MYB48 (5'-

ATGATGCAAGAGGAGGGAAA-3' and 5'-TTAACCTGACGACCACGGTGA-3'),

49

 

 

 

 

.III’B
'lhe I
min.
min;
into
total
5098
fomi

trans

Anal
All 0
One I
COdin
‘0 See
8080;
Using
c0000
Using ;

groups

MYBI3 (5‘AGATGGG GAGAAGACCATG-3' and 5'-GGAAACGTAAACGACTTT-3').
The reaction parameters were as follows: the first cycle involved incubation at 94 °C for 5
min, which was followed by 30 cycles at 94 °C for 30 s, 55 °C for 1 min, and 72 °C for 1
min; and a final incubation at 72 °C for 7 min. The resulting PCR fragments were cloned
into pGEM-T Easy vectors (Promega) and sequenced at the GTSF. Next, 4 pg of isolated
total RNA from each sample was denatured with the mixture of 2. l 5 M formaldehyde and
50% forrnamide, fractionated by electrophoresis on 1.0% agar gels that contained 2.2 M
formaldehyde according to the protocol as described in Oh et al. (2000) and then
transferred to nylon membranes using 20x SSC. 32P-labeled probes were prepared using a
random labeling kit according to the manufacturer’s instructions (Amersharn Biosciences,
Piscataway, NJ, USA). After hybridization, the membranes were washed with 2x SSC (1x
SSC is 150 mM NaCl and 15 mM sodium citrate) and 0.1% (w/v) SDS at room

temperature for 20 min and with 0.1x SSC and 0.1% SDS at 60 °C for 30 min.

Analysis of cis-regulatory elements

All of the Arabidopsis genomic sequences were obtained from TIGR (fip2//ftp.tigr.org).
One kilo-base sequence was extracted from the 25,613 genes with known or predicted
coding sequences found in the whole Arabidopsis genome. Then, that sequence was used
to search for the known cis-elements listed at PLANTCARE (http://oberon.rug.ac.be:-
8080/PlantCARE) or PLACE (http://www.dna.affrc.go.jp/htdocs/PLACE/wais.html)
using a custom Perl script. Next, bootstrapping was performed by generating 1000
control promoter sets from whole Arabidopsis genes. Bootstrapped sets were generated
using a custom Microsoft Excel macro and used to compare each of the selected gene

groups (I and II) as well as the control sets. The DNA sequence fragments, frequently

50

detected in the selected genes groups, were obtained from MotifSampler 2.0
(www.esat.kuleuven.ac.be/~thijs/Work/MotifSampler.htrnl) and their frequencies were

compared with a control group generated by the bootstrapping analysis.

Results and Discussion

Secondary xylem formation in Arabidopsis

Rosette leaves of treatment plants grew much larger than those of the plants in the control
group plants (Figure 2-1A, B), as previously observed in similar studies (Lev-Yadun,
1994). The stems of treated plants formed a considerable amount of secondary xylem and
had a rather thick cortex at the rosette level (Figure 2-1D) with the development of
interfascicular vascular cambium, when compared to the control plants that had no
observable vascular cambium developed at the interfascicular region (Figure 2-1C). The
anatomy of the hypocotyls (Figure 2-1F) from the treated Arabidopsis plants was similar
to that of the 4-month-old poplar stem (Figure 2-1E). This corroborates with the recent
observation by Chaffey et al. (2002) that the anatomy of secondary xylem in Arabidopsis
closely resembles the wood of a poplar tree. While the xylem tissue similarity suggests a
similar xylem formation process occurring in the two species, Arabidopsis stems do not
have the ray parenchyma cells that are present in poplar and other angiosperrn tree
species. Another limitation in the Arabidopsis system is the lack of a perennial nature in
stem growth. Therefore, very important aspects of secondary growth, such as seasonal
cycle of cambial activity cannot be studied in Arabidopsis. Nonetheless, Arabidopsis
offers an outstanding model system to study the molecular mechanisms for secondary

growth, mainly due to its wealth of genetic resources.

51

Figure 2-1. Cross-sections of control and treatment stems of Arabidopsis thaliana.
Cross-sections were stained with 0.025% toluidine blue 0. (A) A 3-week-old Arabidopsis
plant grown in high-density growth condition (control). (B) A 9-week-old Arabidopsis
plant grown in a low-density growth condition with repeated removal of all newly
emerging inflorescences (treatment). The arrow bars in (A) and (B) indicate the stem
samples used in this experiment. (C) Thin cross-sections of paraffin-embedded control
stems was made with a razor blade. No secondary grth is observed. (D) Thin cross-
section of treatment stem. Cambium zone was observed in vascular bundle and
interfascicular region. Extensive secondary vascular tissue production was observed in
treatment stems. Arrowheads and arrow bars in (C) and (D) indicate vascular bundle
region and interfascicular region, respectively. (E) Thin cross-section of poplar stem (4-
months-old) without any treatment. (F) Thin cross-section of hypocotyl region from
treated plants. Vertical line in (E) and (F) indicates bark region. X, xylem; P, phloem
region; PF, phloem fiber; C, cortex; B, bark; CZ; cambial zone. Bars=0.7 cm (A, B), 80
pm (C, D), and 220 um (E, F).

52

 

 

 

 

Figure 2-1

53

The wood formation treatment procedure involves several weeks of repeated removal of
inflorescences, which leads to significant plant wounding. Wounding might be a
contributing factor for secondary xylem induction (Lev-Yadun, 2002). Mechanical
wounding often induces transdifferentiation of parenchyma cells into tracheary elements
(TE), which is demonstrated by vessel formation at the wounding site (Jacobs, 1952). The
disturbed hormonal transport caused by wounding may result in new vascular tissue
formation around the wound site. It was proposed that systemic wound signals might be
involved in the initiation of transdifferentiation of parenchyma and epidermal cells into
TEs (Fukuda, 1996). Carnbial-like activity in the vascular bundle and interfascicular
region was induced by wounding in Zinnia stems (Nishitani et al., 2002). Therefore,
wounding caused by the repeated removal of inflorescences in this experiment may lead

to increased cambial activity, resulting in enhanced secondary xylem formation.

Differential gene expression in treatment stem, bark and xylem

The reproducibility of the experiments was tested by calculating the coefficient of
determination between the two biological replicates. All of the experiments were highly
reproducible with R2=0.92 for the control, 0.89 for the treatment group, and 0.86 for the
bark and xylem experiments. A total of 1658 genes (20% of the ~8300 genes on the array)
had differential expressions with 2-fold or more change. Of those, 543 genes were up-
regulated in the treated stem group, while 530 genes were up-regulated in the control stem
group, 304 genes in the xylem tissue group, and 281 genes in the bark tissue group
(Figure 2-2). Of the 304 xylem up-regulated genes, 66 genes were also up-regulated in
the treatment stem group (Figure 2-2). Furthermore, 108 of the genes up-regulated in the

bark tissue group were also up-regulated in the treatment stem group (Figure 2-2).

54

In order to gain functional inference of the up-regulated genes in the treatment, control,
xylem, and bark groups, the differentially expressed genes were assigned to functional
categories according to the annotation by AGI (Arabidopsis Gene Index,
http://www.tigr.org/tdb/tgi/agi/) numbers in the Munich Information Center for Protein
Sequences (MIPS) Arabidopsis database (MATDB, http://mips.gsf.de/proj/thal/db0.
Across all four samples, unclassified genes made up the largest category (about 18—24%)
(Figure 2-3). A higher number of transcription regulation-related genes were up-regulated
in the treatment stem group and xylem tissue group, when compared to those in the
control stem and bark tissue groups (Figure 2-3). These results support the hypothesis that
secondary growth in a plant species is a matter of regulation, and does not result from the
presence of structural genes necessary for secondary growth. In fact, many non-woody
plant species, with the exception of monocots, can be induced to undergo secondary
growth as it has been demonstrated in Arabidopsis. As expected, defence-related genes
were highly represented among the genes up-regulated in bark tissue (16%), but not in
xylem tissue (4%), further demonstrating that plant defence responses occur within the
sieve element—companion cell complex of phloem (Ruiz-Medrano et al., 2001). When
comparing treatment and control stems, higher numbers of photosynthetic genes were up-
regulated in control stems than in treatment stems (Figure 2-3). In Zinnia, the
transdifferentiation of in vitra-cultured mesophyll cells to xylem cells reduced the
expression levels of photosynthetic genes and increased the expression levels of protein

synthesis-related genes (Demura et al., 2002).

55

Bark

(ZZ-fold than xylem)
(total 281 genes)

 
     
   

Control Treatment
(ZZ-fold than treatment) (2.2-fold than control)
(total 530 genes total 543 genes)

a»

“fret;

Xylem
(ZZ-fold than bark)
(total 304 genes)

Figure 2-2. Venn diagram showing up-regulated (3:2-fold) genes in control and
treatment stems, xylem, and bark from the Arabidopsis Genome array analyses.

56

 

A 30 .Wreatment agar-Well. _ . ,

 

 

 

 

 

% of Upregulated Genes

f;

a

e
.1”;
¢ ..
a

é't‘j
;-
Z :7
£4»;
'// ..'
Z 8
5;, ~

 

 

 

 

B 25 l Xylem LJ Bark I

 

 

 

 

 

% of Upregulated Genes

 

 

 

 

T at?! d“ oP-«(ep gi \tb
.r‘és’ia‘toe ‘1’“ (E: gififlifet‘w firsf gaff
“Tia'b‘cpcflww (”do «#6459
cr as

Figure 2-3. Functional classification of the up-regulated genes in control and
treatment stems, bark and xylem.

The differentially expressed genes in each sample were assigned to functional categories
following those of the Munich Information Center for Protein Sequences (MIPS)
Arabidopsis database (MATDB, http://mips.gsf.de/proj/thal/db/). (A) Comparison
between control and treatment stems; (B) comparison between bark and xylem.

57

Cell division

During secondary xylem formation, the cells on the xylem side of the cambium first go
through stages of differentiation that involve a division zone where the xylem mother
cells continue to divide, then an expansion zone where the derivative cells expand to their
final size, next a maturation zone where lignification and secondary cell wall thickening
occurs, and finally through a zone of programmed cell death where all cellular processes
are terminated (Chaffey, 1999). The cell division for secondary xylem is initiated in the
l~2 layers of the cambium region (Mellerowicz et al., 2001). In the xylem and bark tissue
comparison, four cell cycle-related genes (CYCD3;1, SKPI, CDC20, and CDC20-like
protein) were significantly up-regulated in bark (Table 2-1). CYCD3;1 is a G1 type cyclin
and is involved with the induction of cell division during multicellular trichome
development (Schnittger et al., 2002). SKPl is a homologue of yeast kinetochore protein
that is required for cell cycle progression at both the SI and M phases. SKPI has been
suggested as a marker for actively dividing cells and meristematic activity in Arabidopsis
(Porat et al., 1998). Auxin is thought to be involved in the regulation of cell division
(Hagen and Guilfoyle, 2002). Three auxin biosynthesis- related genes (nitrilase 4, indole-
3-acetaldehyde oxidase, and C YP78BZ mono-oxygenase) were up-regulated in the bark.
Kip-related protein 4 (KRP4) gene was up-regulated in the xylem. This cyclin-dependent
kinase inhibitor is a negative regulator of cell cycle progression in leaf primordial cells of
Arabidopsis (Veylder et al., 2001). These results show that the genes promoting cell
division were up-regulated in bark, while the cell division inhibitor was up-regulated in
xylem. It is likely that the vascular cambium cells might have come off with the bark

tissue when it was separated from the xylem tissue. Therefore, the gene expression profile

58

of bark tissue might also include cambium cells. Beers and Zhao (2001) have separated
bark tissue from the xylem of Arabidopsis hypocotyls, but did not attempt to locate the
cambial cells. In poplar, cell-cycle control genes were highly expressed in the phloem and
meristematic region of a stem cross-section (Hertzberg et al., 2001). The present study
does not provide any gene expression patterns at cell-type resolution. A transgenic
approach using marker proteins (e.g. GUS or GFP) or in situ hybridization with selected

genes is needed to obtain such information.

Cell elongation

Pectin is related to cell expansion. The degree of its methylation influences cell wall
extensibility for increasing the cell size (Goldberg et al., 1996). Pectin methyl esterase
(PME) catalyses dimethylesterification of cell wall polygalacturonans. Depending on the
cell wall properties, PME promotes the action of pH-dependent cell wall hydrolysis and
contributes to cell wall loosening. It causes the cell wall to become rigid by blocking free
carboxyl groups that interact with bivalent ions like Ca2+ (Micheli, 2001). In this study,
four PMEs were up-regulated in xylem, but only one putative PME was up-regulated in
bark (Table 2-1), suggesting the differential involvement of different PMEs in cell
expansion in both xylem and bark tissue. Xyloglucan endotransglycosylases (XETs) are
thought to be involved in the restructuring of cell wall cross-links by cutting a xyloglucan
at an internal site and then ligating its end to a different xyloglucan chain. In poplar,
XETs have a multifunctional role in cell wall construction (Bourquin et al., 2002). In
pine, an XET gene was specifically found in xylem and juvenile wood tissues, indicating
its role in the structural modification of xylem cell walls (Allona etal., 1998; Whetten et

al., 2001). In the current study, an Arabidopsis XET (XT H28) showed xylem abundant

59

expression patterns compared with bark and no differential expression between treatment
and control stem groups (Table 2-1). In xylem tissue, XETs might be involved in a
shuffling of xyloglucan chains for xylem cell expansion. It is notable that the XT H4 gene
was up-regulated in bark, but down-regulated in the stems treated for wood formation.
The meristematic cambium region is suggested to be a major site of XET activity in
poplar stem (Bourquin et al., 2002). XT H4 had a higher (>2-fold) level of expression in
the flower than in the stem of a 4-week-old Arabidopsis plant (Yokoyama and Nishitani,
2001). Thus, the members of the XET gene family as a whole seem to be expressed in
versatile cell types and have various functions including secondary xylem forrnation-
related activities.

Cell wall synthesis

Major constituents of the cell wall are cellulose, hemicelluloses and pectins.
Microtubules, which are strands formed by alpha-beta tubulin heterodimers, control the
orientation of cellulose microfibrils in xylem cells (Chaffey and Barlow, 2002).
Successive changes in microtubule density and orientation have been observed in
developing fibers of hybrid aspen (Mellerowicz et al., 2001). Several tubulin genes were
up-regulated in xylem or treatment stems (Table 2-1). The primary-walled developing
xylem and phloem tissues of Populus tremuloides were comprised of 47% pectin, 22%
cellulose and others (Simson and Timell, 1978). By contrast, the mature wood from P.
nigra contains large amounts of cellulose (48%) and lignin (19%) (McDougall et al.,
1993). Cellulose has been the subject of wood formation studies using poplar (Allona et

al., 1998) and pine (Hertzberg et al., 2001). In the present study, there was no cellulose

60

Table 2-1. Expression patterns of selected xylogenesis-related genes

 

 

 

 

 

, , Fold changea
Functional category AGI No. Putative [D X /B T /C
Cell division At4g34l60 CYCD3;1 —2.4
At1g10230 SKPI —2
At5g40880 Putative CDC20 —2.6
At4g33260 CDC20 protein—like —2.8
At2g32710 KRP4 2.4
At5g22300 Nitrilase 4 —2 -3.5
At3g43600 1ndole—3—acetaldehyde oxides —3
At4g39950 CYP79BZ monooxygenase —2.6
Cell elongation At3g47380 Putative PME (pectin methyl esterase) 7.3
Atlg05310 Putative PME 4
At2g47550 Putative PME 2.5
At2g45220 Putative PME 2 —2.8
At3gl4310 Putative PME —-2.5
Atlgl4720 XTH28 (xyloglucan endotransglycosylases) 3
At2g06850 XTH4 —3.7 —6.3
Cell wall biosynthesis At5g23860 Beta—8 tubulin 5.4 —4.7
At5g12250 Beta—6 tubulin 2.8 —3.3
Atlg64740 Alpha—l Tubulin 3
At5g17420 IRX3 (CesA, cellulose synthase) 9.9
At4gl 8780 Putative CesA 4.9 —2.8
At4g240 I O Putative CesA 2.6
At5g49720 Cellulase homolog 2
Atlg13930 HRGP (hydroxyprolin—rich glycoproteins) 3.5
Atl g62500 Proline—rich protein —20
At2g05520 Glycine—rich protein (GRP) —7.1 10.5
Lign ification At2g30210 Putative Iaccase —2.7
At4g34050 PutativeCCoAMT 2.5 —2.7
At4g36220 FAHl (ferulate-—5—hydroxy1ase) 10.3 2.4
At2g21890 CAD (cinnamyl alcohol dehydrogenase) 8.9
Atl g51680 At4CLl (4 coumarate—CoA Iigase) 4.8
At2g40370 Putative Iaccase 2.7
At2 g3 7040 PAL 1 2.6 2
At5 g54 160 O—methyltransferase 2.4
At2g30490 C4H 2.4
At3g53260 PAL 2.1 —3.2
Atl g02500 SAMS (S—adenosyl methionine synthetase) 2.5
At4g01850 SAMA2 2.3 —2
At4g37930 Glycine HRMT like 28.8 —7.9
Cell death Atl g20850 XCP2 (cystein peptidases) 25.4 —3.9
At4g35350 XCPI 9.1 —2.3
At2g45040 Metalloproteinase 2.3
At4g00230 XSPl (serine peptidase) 3.5
At4g11320 Cysteine proteinase —26
At4gl 6190 Cysteine proteinase 5.9

 

 

8 Fold change: X/B, fold change between xylem versus bark; T/C, treatment versus
control. Negative values in fold change mean down-regulation. For example, ‘-2’ in T/C
means ‘2-fold down-regulation’ in treatment stems (or 2-fold up-regulation in control
stems).

61

synthase gene (CesA) up-regulated in bark, while three CesA genes had higher expression
levels in the xylem tissue when compared with the bark tissue (Table 2-1). One of the
three genes, IRX3, was about 10-fold up-regulated in xylem. IRX3 is thought to be
important in xylogenesis because Arabidopsis plants with a mutation in the gene (irx3)
show a severe deficiency of cellulose deposition in secondary cell walls, resulting in
collapsed xylem cells (Turner and Somerville, 1997). Poplar CesA gene, having high
sequence homology (78% DNA identity) with IRX3, has been isolated from developing
xylem and was shown to be induced by stem banding and mechanical stress (Wu et al.,
2000). However, it is notable that the expression level of CesA genes did not vary
between the treatment and control stem groups, with exception of one CesA gene
(At4g18780) that was up-regulated in the control stems (3-fold).

Several classes of structural proteins may serve a structural role, eventually
becoming solidly cross-linked in response to grth termination or pathogen attack. A
list of such cell wall proteins includes hydroxyproline-rich glycoproteins (HRGPs),
proline-rich proteins (PRPs), and glycine-rich proteins (GRPs) (Cassab and Varner,
1988). The expression of HRGP genes is regulated both developmentally and
environmentally by signals such as wounding and infection (Fukuda, 1996). Bao et al.
(1992) isolated an extensin-like HRGP from the xylem of loblolly pine and showed that
the protein was present in secondary cell walls of xylem cells during lignification. In this
study, a putative HRGP gene was up-regulated in xylem, but remained constant between
treatment and control stems (Table 2-1). GRPs are a class of proteins that have a 60%
glycine residue arranged predominantly in (Gly-X)n repeats (Keller et al., 1988). GRP1.8

had been localized in the cell walls of primary phloem in many plant species (Keller et

62

al., 1988; Ye et al., 1991). A GRP gene (At2g05520) was found that was up-regulated in
both the bark and treatment stem groups, suggesting its involvement in bark secondary

wall formation.

Lignification

Lignin is a heterogeneous phenolic polymer that is deposited in secondary cell walls
along with cellulose and hemicelluloses. It was found that 4 coumarate-CoA ligase (4CL,
Atl g51680), cinnamyl alcohol dehydrogenase (CAD, At2g21890), ferulate-S-hydroxylase
genes (FAHI, At4g36220) and putative Iaccase (At2g40370) were highly expressed in
xylem, but not in bark (Table 2-1), suggesting their roles in the polymerization of lignin
in secondary xylem formation. However, there was one putative lignin biosynthesis-
related gene (At2g30210) that was up-regulated in bark. Interestingly, the expression
levels of most lignin biosynthesis-related genes did not differ between treatment and
control stems, except the FAHI that had a higher expression in treatment stems. One
possible explanation for this is that lignin biosynthesis occurs in both treatment and
control stems, but mainly in xylem tissues. This explanation is supported by the
observation that young Arabidopsis plants that do not undergo secondary growth still
undergo extensive lignification (Dharmawardhana et al., 1992). The methylation of the
lignin precursors is carried out by S-adenosyl methionine synthetase (SAMS) and
CCoAOMT enzymes (Zhong et al., 1998). SAMS catalyses the transfer of an adenosyl
group from ATP to the sulphur atom of methionine, resulting in the synthesis of SAM, a
common methyl group donor. Although SAMS is a housekeeping enzyme, its activity has
been found to occur more frequently in xylem than in bark or other poplar tissues (Vander

et al., 1996). In the poplar developing xylem EST library, SAMS was clearly presented as

63

a xylem tissue abundant gene (Sterky et al., 1998). In the current study, it was found that
two SAMS were up-regulated in xylem not in bark (Table 2-1). In addition, putative
glycine hydroxymethyltransferase, which mediates the conversion of 5,10-methylene-
tetrahydrofolate to and from tetrahydrofolate (Mijnsbrugge et al., 2000), was highly up-
regulated (>28-fold) in xylem (Table 2-1), indicating that the methyl cycle for

lignification is more active in xylem than in bark.

Cell death

Cell death is initiated by the disruption of vacuole membranes that results in the release of
hydrolytic enzymes into the cytosol (Groover and Jones, 1999). Such hydrolytic enzymes
as cystein proteinases, serine proteinases, and nucleases are highly induced during
xylogenesis (Fukuda, 1996). Papain-type cysteine peptidases (XCPl and XCP2) and
putative subtilisin-type serine peptidase(XSP1) have been identified from Arabidopsis
xylem (Zhao et al., 2000). In their report, XCPI and XCP2 genes were expressed
abundantly in xylem when compared with bark tissue, but less abundantly in the young
stem when it was compared with the flower. The authors suggested that these proteinases
had specialized functions (e.g. autolysis of xylem TE) associated with plant growth and
differentiation. In the present study, it was found that the two genes (XCPI and XCP2)
were more highly expressed in xylem than in bark, and in control over treatment stems
(Table 2-1). These findings are similar to those previously reported by Zhao et al. (2000).
It is possible for these enzymes to have multiple functions in the programmed cell death
(PCD) process during xylogenesis as well as in the developmental process. Recently,
ectopic expression of XCPI resulted in early senescence in Arabidopsis (Funk et al.,

2002). However. the exact mechanism by which XCPl or XCP2 activate the cell death

64

process as a final step of xylem formation is unknown. Another PCD-related protein,
metalloproteinase, gene was up-regulated in xylem compared with bark. A cucumber
metalloproteinase, having a 38.6% identity with Arabidopsis metalloproteinase, expressed
at the boundary of senescence and PCD (Delorme et al., 2000). Zhao et al. (2000) were
unable to find any bark abundant endopeptidase in their cDNA library screening. On the
contrary, one cysteine proteinase gene (At4gl 1320) that was 26-fold up-regulated in bark
when compared with xylem was discovered. However, its signal intensity was low (1140)

when compared with the average signal intensity of the other genes (2620).

Transcriptional regulation of secondary xylem formation

Transcription factors were more highly expressed in xylem than in bark and in the
treatment than in the control stem (Figure 2-3). This could partially explain what kind of
transcriptional activities are promoted in the xylem and the treatment groups, where
secondary xylem formation events have occurred. The possibility is presented that
transcription factors can be involved in secondary xylem formation.

AUMIAA expression: Auxin plays diverse roles in cellular and developmental
regulation such as cell division, expansion, differentiation, and patterning of vascular
tissue (Reed, 2001). Auxin is a key signal for secondary xylem formation (Sundberg er
al., 2000). AUX/1AA genes, which are induced rapidly by auxin, have been indicated in
auxin signal transduction (Worley et al., 2000). Moyle et al. (2002) recently isolated eight
AUX/1AA genes (PttIAAs) from a hybrid aspen (Populus tremula x P. tremuloides) and
described tissue-specific expression patterns of the genes, having five AUX/1AA genes
(PttIAAl, 2, 3, 4, and 8) up-regulated in xylem. Arabidopsis is estimated to have 29

genes encoding AUX/1AA proteins with highly conserved domains (Liscum and Reed,

65

2002). The 8.3 k Arabidopsis GeneChip contains 19 AUX/1AA genes. It was found that
eight of the AUX/1AA genes (IAA19, IAA28, IAA22, IAA2, IAA12, IAA8, IAA13, and
IAA26) were up-regulated (>2-fold) in xylem compared with bark. IAA19 was highly up-
regulated (7.5-fold) in xylem compared with bark and in the control stems (5.5-fold)
compared with the treatment stems. It should be noted that it was not possible to detect
any AUX/1AA genes up-regulated in bark.

R2R3-MYB transcription factors: It is estimated that there are about 1600
transcription factor genes and 131 of them are classified as R2R3-type MYB transcription
factors (Riechmann et al., 2000). It has been proposed that the MYB family genes are
involved in plant-specific processes because their presence is limited to plants (Martin
and Paz-Ares, 1997; Stracke et al., 2001). Several MYB family genes have been
implicated in the regulation of lignification and flavonoid biosynthesis in Antirrhinum
species (Tamagnone et al., 1998). It has also been suggested that xylem-abundant MYB
proteins might be involved in the transcriptional regulation of secondary xylem formation
(Newman and Campbell, 2000). In the present study, it was found that eleven R2R3-type
MYB genes were up-regulated in xylem compared with bark (Figure 2-4A). The poplar
orthologue of MYBSZ (AL 164087) was expressed abundantly in the late cell expansion
and late cell maturation region of stem cross-sections (Hertzberg et al., 2001). In
Arabidopsis, MYB52 was up-regulated in xylem and down-regulated in bark. Also, two
phylogenetically close MYB genes (MYB59 and MYB48) (Romero etal., 1998), were up-
regulated in xylem and treatment stems. Northern blot analysis of MYB59 and MYB48
confirmed their GeneChip expression patterns (Figure 2-5). Two MYB binding cis-

elements (MBS) were found in the 1 kb upstream region of the MYB48 gene, suggesting

66

that the expression of MYB-l8 could be regulated by other MYB genes (Figure 2-4A).
However, how W348 regulates the transcriptional events during secondary xylem
formation is currently not known. There were four MYB genes up-regulated in bark
(Figure 2-4B). MYB34 carries three ABA (abscisic acid) response cis-elements (ABREs—
CCGAC) in 1 kb upstream region of the gene and was previously described as drought-
inducible (Kranz et al., 1998). ABREs are usually responsive to environmental stress such
as cold, drought and salt stress, and act to transfer the ABA signal or its corresponding
molecule (Baker et al., 1994; Straub et al., 1994). This gene was up-regulated in bark and
treatment stems. Another bark up-regulated MYB gene (MYBZ8) also has three ABRE
motifs in its promoter region. MYBI3 is regulated by dehydration, exogenous ABA and
wounding, and can be detected at the shoot apex and base of developing flowers (Kirik et
al., 1998; Jin and Martin, 1999), suggesting its potential role in shoot morphogenesis. In
this study, MYBI3 was up-regulated in bark and treatment stems. Its expression pattern
was confirmed by northern blot analysis (Figure 2-5).

Homeodomain (HD) genes: Homeodomain (HD) transcription factors play key
roles in developmental processes, cell fate and pattern formation (Affolter et al., 1990).
One Arabidopsis HD-leucine zipper protein, ATHB-8, can be an early marker of vascular
development because it is active in the provascular cells of embryos (Baima et al., 1995).
Overexpression of the gene in transgenic Arabidopsis and tobacco plants resulted in high
amounts of primary and secondary xylem production (Baima et al., 2000), suggesting its
role in the regulation of vascular development. A poplar orthologue of ATHB-8 was

expressed in the cambial meristem and the expansion region of poplar stems, but not in

67

A AGI No. F016 chm -1ooo Ipstream rayon Function
X! 8 WC or CIT
441917950 26.0 1.3 *
N5959780 13.5 26.5
N3946130 12.5 17.0

 

 

N5916600 8.6 - 1.6 *

N5912870 7.7 -23

116949620 6.6 3.1 *

7114933450 3.8 1.1

N2g46830 2.4 4.1

7112947190 2.3 1.5

4114912350 2.2 1.3

P11979180 2.1 “1.4

.1000 -500 -1
B Act No. m -1ooo upstream rayon Function
Bl X TI C

N1917950 4.3 9.7 *

N5959780 3.6 4.3

At3g46130 3.0 3.4

N5916600 2.6 2.7 *

 

Figure 2-4. R2R3-type MYB transcription factor genes up-regulated in xylem (A) or
bark (B).

The promoter region sequences (1 kb upstream) were obtained from the TIGR web site
(fip://flp.tigr.org). The cis-elements survey was performed using the tools available at
PLANTCARE (http://oberon.rug.ac.be28080/PlantCARE). X/B, signal intensity of xylem
over that of bark; B/X, bark/xylem; T/C, treatment/control. Negative values mean down-
regulation. For example, ‘-2’ in T/C means ‘2-fold down-regulation’ in treatment stems
(or 2-fold up-regulation in control stems). Asterisk: ratio based on non-passing values
(below detection level). Black triangles: ABA response motif (ABRE, CCGAC) (Baker
et al., 1994). Black squares: drought-response element (TACCGACAT) (Yamaguchi-
Shinozaki and Shinozaki, 1994). Grey squares: c-repeat drought-response element
(TGGCCGAC) (Baker et al., 1994). (Black circles) MYB binding motif (MBS,
CAACTG) (Yamaguchi-Shinozaki and Shinozaki, 1994). (Black inverted triangles), bZIP
protein recognition site (TGACGTCA) (Cheong et al., 1998).

68

 

 

MYB59

 

 

 

 

M YB48

 

 

 

MYB13

 

 

 

 

25S _
18$ —

 

 

 

 

Figure 2-5. Northern blot analysis of selected R2R3-type MYB genes that were
highly up-regulated in xylem (M YBS9 and MYB48) or bark (M YBI3).

Total RNA (4 pg) was isolated from control stems (C), treatment stems (T), xylem (X),
and bark (B) tissues. Immobilized RNA was hybridized with 32P-labelled probes of
selected MYB genes. The probes were amplified from xylem tissue using gene-specific
primers. The bottom panel shows the EtBr-stained rRNA under UV illumination before
blotting, indicating equal amount of total RNA loading.

69

phloem and maturation region (Hertzberg et al., 2001). In Arabidopsis, AT HB-8 was
highly up-regulated in xylem compared with bark (Figure 2-6A). However, there was no
significant difference in its expression level between control and treatment stems. AT HB-
15 was phylogenetically very close to ATHB-8 at the amino acid level (Figure 2-7).
ATHB-15 was also up-regulated in xylem. However, unlike AT HB-8 it was up-regulated
in treatment stems compared with control stems. This suggests that these structurally
similar genes might be involved in different stem developmental stages. Two other HD
genes (A THE-9 and ATHB-l-I) that are close to ATHB-8 in the phylogenetic tree (Figure
2-7) were also up-regulated in xylem (Figure 2-6A). It is implicated that the Arabidopsis
PHABULOSA gene (A THE-14) and PHAVOLUTA gene (ATHB-9) have roles in the
perception of radial positional information when determining radial patterning in shoots
(McConnell et al., 2001). It is notable that three HD genes (ATHB-5, ATHB-6, and
AT HB-l6) were also structurally similar to each other (Figure 2-7) and were up-regulated
in bark (Figure 2-6B). A Zinnia HD gene, ZeHB3, has high sequence homology with the
three genes. Because of its immature phloem cell-specific expression pattern, it has been
suggested as a marker for early stages of phloem differentiation (Nishitani et al., 2001).
The fact that these genes were up-regulated in bark suggests that they might act as

transcriptional regulators in the development of primary and/or secondary phloem.

Identification of regulatory cis-elements for secondary growth

Cluster analysis was performed for the 585 differentially expressed genes (304 xylem up-
regulated and 281 bark up-regulated genes) using average signal values (Figure 2-8).
From the cluster analysis, two groups were chosen for further study. Group I comprised

25 genes that were up-regulated in both xylem and treatment stems, but down-regulated

70

A AGI No. Fold Chang; .1000 upstream region Function
X i 8 TC or CIT

 

 

 

 

 

 

 

 

 

At4gs2880 4.7 - 1.2
Attg’52150 5.2 2.1 ATHB-15
At1930490 2 2 1.7 ATHB-Q
At2934710 2-9 - 1.1 1 ATHB-14
At2923760 12.8 . 1.2 BLH4
At4936870 5.3 - 1.1
At4934610 31 - 2.0

-1000 -500 -1
B AGI No. Fold chance .1000 upstream region Function
- 8 II X T r' C

At5965310 5.1 1.6 [ L f
At2922430 2 2 3.7 ATHB-S
At4g40060 2.1 5.2 ATHB-16

 

4000 -500 -1

Figure 2-6. Homeodomain (HD) genes up-regulated in xylem (A) or bark (B).

The promoter region sequences (1 kb upstream) were obtained from the TIGR web site
(ftp://fip.tigr.org) (www.arabidopsis.org). The cis-elements survey was performed using
the tools available at PLANTCARE (http://oberon.rug.ac.be28080/PlantCARE). X/B,
signal intensity of xylem over that of bark; B/X, bark/xylem; T/C, treatment/control.
Negative values mean down-regulation. For example, ‘-2’ in T/C means ‘2-fold down-
regulation’ in treatment stems (or 2-fold up-regulation in control stems). Asterisk: ratio
based on non-passing values (below detection level). Black triangles: ABA response
motif (ABRE, CCGAC). Black squares: drought-response element (TACCGACAT).
Grey squares: c-repeat drought-response element (TGGCCGAC). Black circles: MYB
binding motif (MBS, CAACTG).

71

RTHB].
flTl-IB-3
91108-13
RTHB-E’i
91118-6
RTHB-fils
HTHB-‘I
FlTHB-12
RTHB~2
BTHB—4
“THE-17
RTHB-B
RTHB-15 Xylem
"Tug-.9 Upregulated

Bark
Upregulated

flTHB-14
flTflB-10
BLH4
Xylem
LH2
B Upregulated
I‘D-like

Figure 2-7. Phylogenetic tree of homeodomain (HD) genes.

Amino acid sequences from the 19 selected HD genes were used to generate the
phylogenetic tree using the GeneBee program (http2//www.genebee.msu.su/services). The
corresponding AGI numbers with each HD gene are follows: ATHB-I, At3g01470;
ATHB-Z, At4g16780; ATHB-3, At5g15150; ATHB-4, At2g44910; ATHB-5, At5g65310;
ATHB-6, At2g22430; ATHB-7, A12g46680; ATHB-8, At4g32880; ATHB-9, Atlg30490;
ATHB-IO, Atlg79840; ATHB-IZ, At3g61890; ATHB-I3, At1g69780; AT HB-I 4,
At2g34710; AT HB-l5, At1g52150; ATHB-16, At4g40060; AT HB-I 7, A12g01430; BLH2,
At4g3 68 70; BLH4, At2g23 760; HD-like, At4g3461 0.

72

in both the bark and control stem (i.e. secondary xylem forrnation-associated genes)
(Figure 2-8). It includes two MYB genes (MYB59 and MYB48) and two lignin-
biosynthesis related genes (FAHI and putative CAD). Group 11 contains 25 genes that are
up-regulated in both the bark and treatment stems together, but down-regulated in both
the xylem and control stems (Figure 2-8). Two HD genes (A THE-6 and ATHB-lo) and
one MYB gene (MYBI4) are included in Group II.

In an attempt to identify putative cis-elements for secondary xylem formation
signaling, the promoter region of the genes from the two groups was surveyed for known
cis-elements listed at PLANTCARE or PLACE as described in the Materials and
Methods section. Frequency of cis-element motifs in the promoter regions of 1000
randomly selected Arabidopsis gene sets were used as a control. The frequency of a
putative ABRE3 cis-element sequence (CAACGTG) was significantly high in Group I at
a 95% confidence interval given from 1000 control promoter sets (Table 2-2). ABRE3
motif (GCAACGTGTC) is found in the promoter region of this gene, which encodes a
Class 3 late embryogenesis-abundant protein (HVA I) in barley (Straub et al., 1994).

The extA cis-element sequence (AACGTGT) was frequently presented in Group I
(Table 2-2). ExtA cis-element is located in the promoter region of an extensin gene that
responds to wounding and tensile stress in Brassica napus (Elliott and Shirsat, 1998).
Wounding and tensile stress stimulate secondary xylem formation in poplar (Wu et al.,
2000; Demura et al., 2002). The AACGTGT motif of extA cis-element is similar to the G
box motif (CACGTG), a binding site for transcriptional activators in the promoter regions
of many plant genes (Holdsworth and Laties, 1989). While experimental verification is

needed, the presence of the two functional cis-elements (putative ABRE3 and extA) in the

73

promoter regions of Group 1 genes suggests that the expression of those genes involved in
secondary xylem formation might be regulated by such signals as ABA, tensile stress, and
wounding. This Arabidopsis system might provide a model for the study of stress-induced
secondary xylem formation in trees (6. g. reaction and tension wood).

Soybean Small Auxin-Up RNA (SAUR) genes are transcriptionally induced by
exogenous auxin within a few minutes (Hagen and Guilfoyle, 2002). The promoter of a
SAUR gene (SAUR 15A) has been shown to contain multiple auxin response motifs (Xu
et al., 1997), and is necessary and sufficient for auxin induction (Li et al., 1994). The
frequency of CATATG (SAUR) motif was present in significantly higher numbers (60
versus 29 in control) in the promoter regions of Group 11 genes (Table 2-2), suggesting
that auxin may play a significant role in secondary growth, especially secondary phloem
and bark formation. The promoter sequence analysis using Motifsampler 2.0 identified
several previously not described putative cis-elements that were present in significantly
high numbers in the promoter regions of the selected genes (Table 2-2). For example, a
motif (‘ATA[GC]AA[AT]C’) was present about twice as often in the promoter regions of
Group I genes than in the control. Careful evaluation of the functional roles of these
unknown motifs might provide some new insight into the transcriptional regulation of

secondary growth in plants.

74

0.0

Group |

 

 

At4909760
At1 914030
At5949630
At2g262oo
At3947500
At4908290
Atl 962570
At5g49620
At4936850
At2915890
At5905690
At2931380
At2g45450
At1959740
At1gl1080
At4g34600
At2937900
A12936120
A12922860
At4936220
At2g21690

At5g59780
At3946130
Atl 949320
A1491 51 00

Choline kinase -|ik‘e protein
RuBisCO methylase
Amino acid permease
Putative zinc-finger protein
Promoter binding factor-2a
N odulin-like protein
Glutamate synthase

P utative transc ripti on factor

Putative protein

Expressed protein

Cytochrome P450

B-box zinc finger protein

Expressed protein

Hypothetical protein

Serine carboxypeptidase

Putative protein

Putative protein transporter

U nknown protein

U nlxnown protein
Ferulate-S-hydrcmylase
Cinnamyl-alcohol

dehydrogenase

MYBSS

MYB48

U nknown protein
Hydroxynitrile Iyase

 

 

75

Figure 2-8. Hierarchical clustering of differentially regulated genes and selection of
xylem (Group I) and bark (Group II) up-regulated genes.
Red color indicates the gene carrying a putative ABRE3 motif (CAACGTG) in its
promoter region, green for extA motif (AACGTGT), purple color for SAUR motif
(CATATG), and blue for the genes carrying both ABRE3 and extA motifs.

 

Group II

 

 

 

A12943150
A14936070
A12929120
A14912460
At1909740
A11927030
A13947340
At2g42610
A14937520
At4g40060
A12938860
At2g23610
A12930210
At2g47780
At4gO2280
A11924100
A12944460
A12922430
A12919990
A13943600
At2g'31180
At2g22920
A11906090
A14900660
A1290295o

Putative extensin
Putative protein

Ion channel protein
PEARLI 1

ERG protein

U nknown protein
Asparagine synthetase
Expressed protein
Peroxidass2-like
ATHB16

Expressed protein
Cyanohydrin Iyase-like
Putative lac case

U nknown protein
Sucrose synthetase
IAA-glycosylase
Putative beta-glucosidase
ATHB-6

PR-l

Aldehyde oxidase

MYB '14

Serine carboxypeptidase I
Nitrate transporter ACH 1
Auxin-induced protein
Phytochrome kinase

 

76

Figure 2-8 (cont’d). Hierarchical clustering of differentially regulated genes and
selection of xylem (Group I) and bark (Group II) up-regulated genes.

 

Table 2-2. Regulatory cis-element motifs identified from the promoter regions of the
genes up-regulated in wood-forming stems

 

. Moti f _ Per cent occurrence‘ c
Function ID” Motif sequence 95% C 1 Reference

Controlc Group ld Group lld

 

 

ABA ABRE3 CAACGTG 5 24 0~12 Strafgg‘: 3'"
, Elliott and

Activator extA AACGTGT 8 24 0- 20 Shirsat, 1998
Unknownf l l ATA[GC]AA[AT]C 23 56 8~36
Unknown l_2 TAI l IGTT 19 40 8~32
Unknown l_3 ATTGTTAT 10 28 0~20
Unknown l_4 GAAT[AC]GT 20 44 8~36

1AA SAUR CATATG 29 60 16~44 Xu et al., 1997
Unknown ll_1 CACACAC[AG] 9 23 0~20
Unknown ll_2 ATATACA[AG] I8 50 4~32
Unknown [l_3 [AT]AGCCAT I7 42 4-32
Unknown n_4 ACGTAAA 14 31 4~28

 

8 Percent occurrence, frequency of the motifs among the gene in each group. For
example, SAUR motif it occurred in 16 genes of Group II while it occurred in 290 genes
of 1 000 randomly selected genes (control).

b MotifIDs were from PLACE or PLANTCARE.

° Control, the promoter regions of l 000 randomly selected Arabidopsis genes were used
for calculation of average occurrence of the motifs.

d Group I and 11, promoter regions of 25 genes in each group were used to identify the
frequent motifs.

e CI, confidence interval at 95% were calculated from bootstrapping analysis.

1 Unknown motifs were identified using MotifSampler 2.0.

This analysis was done by Sunchung Park.

77

References

Affolter M, Schier A, Gehring WJ. 1990. Homeodomain proteins and the regulation of
gene expression. Current Opinion in Cell Biology 2, 485—495.

Allona 1, Quinn M, Shoop E, et al. 1998. Analysis of xylem formation in pine by cDNA
sequencing. Proceedings of the National Academy of Sciences, USA 95, 9693—9698.

Arioli T, Peng L, Betzner AS, et al. 1998. Molecular analysis of cellulose biosynthesis in
Arabidopsis. Science 279, 717—720.

Baima S, Nobili F, Sessa G, Lucchetti S, Ruberti I, Morelli G. 1995. The expression of
the Athb-8 homeobox gene is restricted to provascular cells in Arabidopsis thaliana.
Development 121, 4171—4182.

Baima S, Tomassi M, Matteucci A, Altamura MM, Ruberti I, Morelli G. 2000. Role of
the ATHB-8 gene in xylem formation. In: Savidge RA, Barnett JR, Napier R, eds.

Cell and molecular biology of wood formation. Oxford, UK: Bios Scientific
Publishers Ltd, 445—455.

Baker SS, Wilhelm KS, Thomashow MF. 1994. The 5'-region of Arabidopsis thaliana
cor15a has cis-acting elements that confer cold-, drought- and ABA-regulated gene
expression. Plant Molecular Biology 24, 701—713.

Bao W, O’Malley DM, Sederoff RR. 1992. Wood contains a cell-wall structural protein.
Proceedings of the National Academy of Sciences, USA 89, 6604—6608.

Beers E, Zhao C. 2001. Arabidopsis as a model for investigating gene activity and
function in vascular tissues. In: Molecular breeding of wood plants. Proceedings of
the International Wood Biotechnology Symposium, Narita, Japan, 43—52.

Bourquin V, Nishikubo N, Abe H, Brumer H, Denman S, Eklund M, Christiemin M,
Teeri TT, Sundberg B, Mellerowicz E. 2002. Xyloglucan endotransglycosylases have

a function during the formation of secondary cell walls of vascular tissues. The Plant
Cell 14, 3073—3088.

Cassab GI, Vamer JE. 1988. Cell wall proteins. Annual Review of Plant Biology 39, 321—
353.

Chaffey N. 1999. Cambium: old challenges—new opportunities. Trees 13, 138—151.

Chaffey N, Barlow P. 2002. Myosin, microtubules, and microfilaments: co-operation
between cytoskeletal components during cambial cell division and secondary vascular
differentiation in trees. Planta 214, 526—536.

Chaffey N, Cholewa E, Regan S, Sundberg B. 2002. Secondary xylem development in
Arabidopsis: a model for wood formation. Physiologia Plantarum 114, 594—600.

Cheong YH, Yoo CM, Park JM, Ryu GR, Goekjian VH, Nagao RT, Key JL, Cho MJ,
Hong JC. 1998. STFl is a novel TGACG-binding factor with a zinc-finger motif and

78

a bZIP domain which heterodimerizes with GBF proteins. The Plant Journal 15, 199—
209.

Delorme VGR, McCabe PF, Kim D, Leaver CJ. 2000. A matrix metalloproteinase gene is

expressed at the boundary of senescence and programmed cell death in cucumber.
Plant Physiology 123, 917—927.

Demura T, Tashiro G, Horiguchi G, et al. 2002. Visualization by comprehensive
microarray analysis of gene expression programs during transdifferentiation of
mesophyll cells into xylem cells. Proceedings of the National Academy of Sciences,
USA 99, 15794—15799.

Dharmawardhana DP, Ellis BF, Carlson JE. 1992. Characterization of vascular
lignification in Arabidopsis thaliana. Canadian Journal of Botany 70, 2238-2244.

Elliott KA, Shirsat AH. 1998. Promoter regions of the extA extensin gene from Brassica
napus control activation in response to wounding and tensile stress. Plant Molecular
Biology 37, 675—687.

Fukuda H. 1996. Xylogenesis: initiation, progression, and cell death. Annual Review of
Plant Biology 47, 299—325.

F ukuda H. 1997. Tracheary element differentiation. The Plant Cell 9, 1147—1156.

Funk V, Kositsup B, Zhao C, Beers E. 2002. The Arabidopsis xylem peptidase XCPl is a
tracheary element vacuolar protein that may be a papain ortholog. Plant Physiology
128, 84—94.

Goldberg R, Morvan C, Jauneau A, Jarvis MC. 1996. Methyl-esterification,
deesterification and gelation of pectins in the primary cell wall. In: Visser J, Voragen
AF G, eds. Pectins and pectinases. Elsevier Science, 151—172.

Groover A, Jones AM. 1999. Tracheary element differentiation uses a novel mechanism
coordinating programmed cell death and secondary cell wall synthesis. Plant
Physiology 119, 375—384.

Hagen G, Guilfoyle T. 2002. Auxin-responsive gene expression: genes, promoters and
regulatory factors. Plant Molecular Biology 49, 373—3 85.

Hertzberg M, Aspeborg H, Schrader J, et al. 2001. A transcriptional roadmap to wood
formation. Proceedings of the National Academy of Sciences, USA 98, 14732—1473 7.

Holdsworth MJ, Laties GG. 1989. Site specific binding of a nuclear factor to the carrot
extensin gene is influenced by both ethylene and wounding. Planta 179, 17—23.

Jacobs WP. 1952. The role of auxin in differentiation of xylem around a wound.
American Journal of Botany 39, 301—309.

Jin H, Martin C. 1999. Multifunctionality and diversity within the plant MYB-gene
family. Plant Molecular Biology 41, 577—585.

79

Keller B, Sauer N, Lamb CJ. 1988. Glycine-rich cell wall proteins in bean: gene structure
and association of the protein with the vascular system. EMBO Journal 7, 3625—
3633.

Kirik V, Kolle K, Wohlfarth T, Miséra S, Baumlein H. 1998. Ectopic expression of a
novel MYB gene modifies the architecture of the Arabidopsis inflorescence. The
Plant Journal 13, 729—742.

Kranz HD, Denekamp M, Greco R, et a1. 1998. Towards functional characterization of
the members of the R2R3-MYB gene gamily from Arabidopsis thaliana. The Plant
Journal 16, 263—276.

Larson PR. 1994. The vascular cambium. Berlin: Springer-Verlag.

Lev-Yadun S. 1994. Induction of sclereid differentiation in the pith of Arabidopsis
thaliana L. Heynh. Journal of Experimental Botany 45, 1845—1849.

Lev-Yadun S. 2002. The distance to which wound effects influence the structure of

secondary xylem of decapitated Pinus pinea. Journal of Plant Growth Regulation 21,
191—196.

Li Y, Liu Z, Shi X, Hagen G, Guilfoyle T. 1994. An auxin-induced element in soybean
SAUR promoters. Plant Physiology 106, 37—43.

Liscum E, Reed JW. 2002. Genetics of Aux/1AA and ARF action in plant growth and
development. Plant Molecular Biology 49, 387—400.

Lorenz WW, Dean JF. 2002. SAGE profiling and demonstration of differential gene
expression along the axial developmental gradient of lignifying xylem in loblolly pine
Pinus taeda. Tree Physiology 22, 301—310.

McDougall GJ, Morrison IM, Stewart D, Weyers JDB, Hillman JR. 1993. Plant fibres:
botany, chemistry and processing for industrial use. Journal of the Science of Food
and Agriculture 62, 1—20.

McConnell JR, Emery J, Eshed Y, Bao N, Bowman J, Barton MK. 2001. Role of
PHABULOSA and PHAVOLUTA in determining radial patterning in shoots. Nature
411, 709—713.

Martin C, Paz-Ares J. 1997. MYB transcription factors in plants. Trends in Genetics 132,
67—73.

Mauseth J. 1998. Botany: an introduction to plant biology. Sudbury, Massachusetts:
Jones and Bartlett Publishers.

Mellerowicz E, Baucher M, Sundberg B, Boerjan W. 2001. Unraveling cell wall
formation in the woody dicot stem. Plant Molecular Biologr 47, 239—274.

Micheli F. 2001. Pectin methylesterases: cell wall enzymes with important roles in plant
physiology. Trends in Plant Science 6, 414—419.

80

Mijnsbrugge KV, Meyerrnans H, Montagu MV, Bauw G, Boerjan W. 2000. Wood
formation in poplar: identification, characterization, and seasonal variation of xylem
proteins. Planta 210, 589—598.

Moyle R, Schrader J, Stenberg A, Olsson O, Saxena S, Sandberg G, Bhalerao RP. 2002.
Environmental and auxin regulation of wood formation involves members of the
Aux/1AA gene family in hybrid aspen. The Plant Journal 31, 675—685.

Newman LJ, Campbell MM. 2000. MYB proteins and xylem differentiation. In: Savidge
RA, Barnett JR, Napier R, eds. Cell and molecular biology of wood formation.
Oxford, UK: Bios Scientific Publishers Ltd, 437—444.

Nishitani C, Demura T, Fukuda H. 2001. Primary phloem-specific expression of a Zinnia
elegans homeobox gene. Plant and Cell Physiology 42, 1210—1218.

Nishitani C, Demura T, Fukuda H. 2002. Analysis of early processes in wound-induced
vascular regeneration using TED3 and ZeHB as molecular markers. Plant and Cell
Physiology 43, 79—90.

Oh SK, Kim IJ, Shin DH, Yang J, Kang H, Han KH. 2000. Cloning, characterization and
heterologous expression of a functional geranylgeranyl pyrophosphate synthase from
sunflower Helianthus annuus L. Journal of Plant Physiology 157, 535—542.

Porat R, Lu P, O’Neil SD. 1998. Arabidopsis SKPI, a homologue of a cell cycle
regulator gene, is predominantly expressed in meristematic cells. Planta 204, 345—
351.

Reed J W. 2001. Roles and activities of Aux/1AA proteins in Arabidopsis. Trends in Plant
Science 6, 420—425.

Riechmann JL, Heard J, Martin G, et al. 2000. Arabidopsis transcription factors:
Genome-wide comparative analysis among eukaryotes. Science 290, 2105—2110.

Romero I, Fuertes A, Benito M, Malpica JM, Leyva A, Paz-Ares J. 1998. More than
80R2R3-MYB regulatory genes in the genome of Arabidopsis thaliana. The Plant
Journal 14, 273—284.

Ruiz-Medrano R, Xoconostle-Cazares B, Lucas WJ. 2001. The phloem as a conduit for
inter-organ communication. Current Opinion in Plant Biology 4, 202—209.

Schnittger A, Schdbinger U, Bouyer D, Weinl C, Stierhof Y, Hiilskamp M. 2002. Ectopic
D-type cyclin expression induces not only DNA replication but also cell division in

Arabidopsis trichomes. Proceedings of the National Academy of Sciences, USA 99,
6410—6415.

Simson BW, Timell TE. 1978. Polysaccharides in cambial tissues of Populus tremuloides
and Tilia americana, 1. Isolation, fractionation and chemical composition of cambial
tissues. Cellulose Chemistry and Technology 12, 39—50.

81

Sterky F, Regan S, Karlsson J, et al. 1998. Gene discovery in the wood-forming tissues of
poplar: analysis of 5692 expressed sequence tags. Proceedings of the National

Academy ofSciences, USA 95, 13330—13335.

Stracke R, Werber M, Weisshaar B. 2001. The R2R3-MYB gene family in Arabidopsis
thaliana. Current Opinion in Plant Biology 4, 447—456.

Straub PF, Shen Q, Ho TD. 1994. Structure and promoter analysis of an ABA- and stress-
regulated barley gene, H VAI . Plant Molecular Biology 26, 617—630.

Sundberg B, Ugglar C, Tuominen H. 2000. Cambial growth and auxin gradient. In:
Savidge RA, Barnett JR, Napier R, eds. Cell and molecular biology of wood
formation. Oxford, UK: Bios Scientific Publishers Ltd.

Tamagnone L, Merida A, Parr A, Mackay S, Culianez-Macia FA, Roberts K, Marin C.
1998. The amMYB308 and amMYB330 transcription factors from antirrhinum

regulate phenylpropanoid and lignin biosynthesis in transgenic tobacco. The Plant
Cell 10, 135—154.

Turner SR, Somerville CR. 1997. Collapsed xylem phenotype of Arabidopsis identifies
mutants deficient in cellulose deposition in the secondary cell wall. The Plant Cell 9,
689—701.

Uggla C, Moritz T, Sandberg G, Sundberg B. 1996. Auxin as a positional signal in

pattern formation in plants. Proceedings of the National Academy of Sciences, USA
93, 9282—9286.

Uggla C, Mellerowicz EJ, Sundberg B. 1998. Indole-3-acetic acid controls cambial
growth in Scots pine by positional signaling. Plant Physiology 117, 113—121.

Vander MK, Montagu M, Inzé D, Boerjan W. 1996. Tissue-specific expression conferred
by the S-adenosyl-L-methionine synthetase promoter of Arabidopsis thaliana in
transgenic poplar. Plant and Cell Physiology 37, 1108—1115.

Veylder LD, Beeckman T, Beemster GTS, Krols L, Terras F, Landrieu I, Schueren EVD,
Maes S, Naudts M, Inzé D. 2001. Functional analysis of cyclin-dependent kinase
inhibitors of Arabidopsis. The Plant Cell 13, 1653-1667.

Whetten R, Sun Y, Zhang Y, Sederoff R. 2001. Functional genomics and cell wall
biosynthesis in loblolly pine. Plant Molecular Biology 47, 275—291.

Worley CK, Zenser N, Ramos J, Rouse D, Leyser O, Theologis A, Callis J. 2000.
Degradation of Aux/1AA proteins is essential for normal auxin signalling. The Plant
Journal 21, 553—562.

Wu L, Joshi CP, Chiang V. 2000. A xylem-specific cellulose syntehase gene from aspen,
Populus tremuloides, is responsive to mechanical stress. The Plant Journal 22, 495—
502.

82

Xu N, Hagen G, Guilfoyle T. 1997. Multiple auxin response modules in the soybean
SAUR 15A promoter. Plant Science 126, 193—201.

Yamaguchi-Shinozaki K, Shinozaki K. 1994. A novel cis-acting element in an
Arabidopsis gene is involved in responsiveness to drought, low-temperature, or high-
salt stress. The Plant Cell 6, 251—264.

Yang J, Park S, Kamdem DP, Keathley DE, Retzel E, Paule C, Kapur V, Han K-H. 2003.
Novel insight into trunk-wood gene expression profiles in a hardwood tree species,
Robinia pseudoacacia. Plant Molecular Biology 52, 93 5—956.

Ye ZH. 2002. Vascular tissue differentiation and pattern formation in plants. Annual
Review of Plant Biology 53, 183—202.

Ye ZH, Song YR, Marcus A, Vamer JE. 1991. Comparative localization of three classes
of cell wall proteins. The Plant Journal 1, 175—183.

Yokoyama R, Nishitani K. 2001. A comprehensive expression analysis of all members of
a gene family encoding cell-wall enzymes allowed us to predict cis-regulatory regions
involved in cell-wall construction in specific organs of Arabidopsis. Plant and Cell
Physiology 42, 1025—1033.

Zhao C, Johnson b, Kositsup B, Beers E. 2000. Exploiting secondary growth in
Arabidopsis. Construction of xylem and bark cDNA libraries and cloning of three
xylem endopeptidases. Plant Physiology 123, 1185—1196.

Zhong R, Morrison III WH, Negrel J, Ye Z. 1998. Dual methylation pathways in lignin
biosynthesis. The Plant Cell 10, 2033—2046.

83

CHAPTER III

A Mechanism Related to the Yeast Transcriptional Regulator PaflC Is Required for

Expression of the Arabidopsis FLCflWAF MADS Box Gene Family

This work was published in Sookyung Oh, Hua Zhang, Philip Ludwig, and Steven van
Nocker (2004), A mechanism related to the yeast transcriptional regulator PaflC is
required for expression of the Arabidopsis FLC/MAF AMDS box gene family, Plant Cell
1622940-2953. Hua Zhang mainly contributed to Figure 3-1 (analysis of flowering time
of vip double mutants) and performed co-IP analysis of VIP proteins in Figure 3-6.
Positional cloning of VIP6 in Figure 3-4 was done by Philip Ludwig.

84

Abstract

The Arabidopsis thaliana VERNALIZA T ION INDEPENDENCE (VIP) gene class has
multiple functions in development, including repression of flowering through activation
of the MADS box gene FLC. Epigenetic silencing of FLC plays a substantial role in the
promotion of flowering through cold (vemalization). To better understand how VIP genes
influence development, we undertook a genetic and molecular study of the previously
uncharacterized VIP5 and VIP6 genes. We found that loss of function of these genes also
resulted in downregulation of other members of the FLC/MAF gene family, including the
photoperiodic pathway regulator MAFI/FLM. We cloned VIP5 and VIP6 through
mapping and transcriptional profiling. Both proteins are closely related to distinct
components of budding yeast Pafl C, a transcription factor that assists in establishment
and maintenance of transcription-promotive chromatin modifications such as
ubiquitination of H28 by Brel/Rad6 and methylation of histone H3 lysine-4 by the
trithorax-related histone methylase Setl. Genetic analysis and coimmunoprecipitation
experiments suggest that VIP5 and VIP6 function in the same mechanism as the
previously described VIP3 and VIP4. Our findings suggest that an evolutionarily
conserved transcriptional mechanism plays an essential role in the maintenance of gene

expression in higher eukaryotes and has a central function in flowering.

85

Introduction

The activity of most eukaryotic genes results from the coordinated effort of a multitude of
diverse factors that serve both to recognize the gene and to promote or repress initiation,
elongation, and termination of transcription (Lee and Young, 2000). The access of the
transcriptional machinery to gene regulatory regions, as well as its progression through
transcribed regions, depends both on disruption of higher-order chromatin packaging and
the accessibility of DNA at the nucleosomal level (Orphanides and Reinberg, 2000;
Svejstrup, 2004). Recent attention in the field of transcription, originating predominately
from studies in the budding yeast Saccharomyces cerevisiae, has turned to the astonishing
array of factors that modify chromatin structure. These include chromatin-remodeling
factors, which displace nucleosomes along the DNA, and histone-modifying enzymes,
which add or remove various posttranslational modifications including small chemical
groups (acetylation, phosphorylation, and methylation) and proteins (ubiquitination and
SUMOylation) on nucleosomal histones. The number and pattern of histone
modifications have been hypothesized to play a key role in orchestrating gene activity,
both by directly affecting chromatin architecture and by providing interaction sites for
other chromatin-associated proteins (J enuwein and Allis, 2001; F ischle et al., 2003).
Superimposed on the complexity of transcription in higher eukaryotes is the
requirement to alter gene expression in response to developmental cues and faithfully
maintain patterns of gene activity in related cell types in the mature organism. The so-
called trithorax group (trxG) and Polycomb group (PcG) proteins have been implicatedas
having crucial roles in the maintenance of activity states of developmental regulatory
genes (Francis and Kingston, 2001). In fruit flies and mammals, trxG and PcG proteins

maintain activity or repression, respectively, of the homeotic Hox genes set up during

86

embryogenesis. This activity is accomplished at least in part by the ability of these and
associated proteins to carry out and recognize various histone modifications, most notably
lysine methylation (F ischle et al., 2003). In plants, although the role of trxG genes has not
been well defined, it is becoming increasingly evident that at least the PcG proteins play
crucial roles in various developmental progressions through maintenance of the repression
of homeotic-function MADS box genes (Goodrich et al., 1997; Gendall et al., 2001;
Kohler et al., 2003).

An excellent model to study the epigenetic dynamics of developmentally
important genes in eukaryotes is the silencing of the Arabidopsis thaliana MADS box
floral repressor gene FLC, and associated initiation of flowering, after extended growth of
the plant in the cold. Promotion of flowering by long periods of cold, a phenomenon
known as vemalization, is an ecologically and agriculturally important response common
to many plants and long recognized as having an epigenetic component (Lang, 1965).

FLC is one member of a family of six closely related MADS box proteins in
Arabidopsis (Ratcliffe et al., 2001). FLC has been the most extensively studied gene of
this family, both because of its substantial effect on the vemalization response and
because genetic variation at FLC and its activator FRI are responsible for the natural
diversity in flowering habit among Arabidopsis ecotypes (Lee et al., 1993; Johanson et
al., 2000; Michaels et al., 2003). The other members of the FLC gene family, designated
MAF I -MAF 5, can act as floral repressors when expressed constitutively to high levels in
transgenic plants, and at least MAFI, MAFZ, MAF3, and M4F4 have been shown to be

downregulated in vemalized plants (Ratcliffe et al., 2001, 2003). This suggests a

87

conserved function for this clade of MADS box genes in mediating the vemalization
response.

Genetic approaches have identified several factors required for silencing of FLC
in vemalized plants (Surridge, 2004). These include VRN2, a homolog of the fly PcG
protein Su(z)12 (Gendall et al., 2001), VRNI, a putative DNA binding protein (Levy et
al., 2002), and VIN3, a plant homeodomain-containing protein (Sung and Amasino,
2004). Examination of vemalization-associated changes in histone modifications of FLC
chromatin in wild-type and mutant plants is leading to a framework of a model for the
involvement of chromatin changes in FLC silencing (Bastow etal., 2004; Sung and
Amasino, 2004). The activity of VIN3, which accumulates during the cold and is
associated with deacetylation of histone H3 within FLC promoter and intronic regions,
may create favorable conditions for subsequent methylation of H3 at Lys residues K27
and K9 within these regions mediated by VRN2 and VRNI. Although information in
plants is limited, studies in animals and fission yeast suggest that methylation at H3K9
within euchromatic regions promotes the formation of heterochromatin and long-term
gene silencing, suggesting a precedence for the stable repression of FLC in vemalized
plants.

To better understand the dynamics of FLC expression at the molecular level, we
have used genetic screens to identify genes required for the maintenance of FLC activity
in nonvernalized plants. To date, our group has identified at least 20 loci (Zhang et al.,
2003), including seven that comprise the VERNAle TION INDEPENDENCE (VIP)
gene class (Zhang and van Nocker, 2002; Zhang et al., 2003). FLC expression is not

detectable in strong vip mutants, indicating a critical function for these genes. VIP3

88

encodes a protein composed of so-called WD repeats. WD repeat proteins are well
represented in eukaryotes, and are believed to coordinate dynamic protein assemblies
(van Nocker and Ludwig, 2003). VIP4 encodes a highly charged protein closely related to
budding yeast Leol. Subsequent to our identification of VIP4, Leol was identified as a
component of a 1.7 mD transcriptional complex called PaflC (Mueller and Jaehning,
2002; see below).

Phenotypic analysis of vip mutants suggests that the VIP genes likely have
additional roles unrelated to their activation of FLC. For example, vip mutants flower
earlier than flc null mutants, suggesting that other flowering-time genes are targeted
(Zhang et al., 2003). In addition, strong vip mutants exhibit mild developmental
pleiotropy, which is not seen in an flc null mutant, suggesting that the VIP genes also
target mechanisms unrelated to flowering (Zhang et al., 2003). The objectives of this
research were to further characterize the mechanism by which the VIP genes activate
F LC, through the identification of the VIP5 and VIP6 genes, and to investigate the role of
these VIP genes in F LC—independent flowering and other developmental processes.

Materials and Methods
Plant and Yeast Material and Manipulations
The late-flowering, winter-annual introgression lines ColeRISFZ (used here as the wild
type) and LerzFRISFzzFLCSF‘? were as described previously (Zhang et al., 2003). The null
flc-3 mutant in the ColeRISFZ background was a gift from R. Amasino (University of
Wisconsin). Populations derived from introgression line ColeRlSFz mutagenized by fast-
neutron radiation, ethyl methanesulfonate, or T-DNA insertion were described previously

(Zhang et al., 2003). Mutant lines were backcrossed three times in succession to wild-type

89

plants before phenotypic analysis. The vip5-I and vip6-3 lines were backcrossed to wild-
type plants an additional two times before microarray analysis. Sequence-indexed T-
DNA-mutagenized lines developed at SIGnAL were obtained from the Arabidopsis
Biological Resource Center at The Ohio State University (Columbus, OH). Standard
genetic techniques were used in the production of double mutants. For vemalizing cold
treatments, seeds were allowed to germinate on sterile media (Zhang and van Nocker,
2002) at 5°C in an 8-h-light/1 6-h-dark photoperiod for various lengths of time.

The Escherichia coli strain harboring BAC T7Pl was obtained from the
Arabidopsis Biological Resource Center. Yeast strains YJJ662 (wild type) and its
derivative YJJ1303 (rtfl deletion) were obtained from T. Washbum and J. Jaehning,
University of Colorado Health Science Center, and are described in Betz et a1. (2002).
Cloning of VIP6
Positional cloning of the VIP6 gene utilized early-flowering F2 progeny of a single F1
individual derived from a cross between vip6-1 and introgression line LerzFRISFzzFLCW.
Bulked-segregant analysis was performed with 24 F2 individuals and molecular markers
described by Lukowitz et al. (2000). Fine mapping was done entirely using molecular
markers based on small insertion-deletion polymorphisms as characterized and cataloged
by Cereon (Cambridge, MA) (http://www.arabidopsis.org/Cereon/index.jsp) and noted in
Figure 2-4A.

Molecular Techniques
For production of VIP6 antisense plants, a 2.6-kb fragment corresponding to a portion of
the translated region was amplified from apex cDNA using the primers VIP6FBam (5'-

AAAGGATCCTATGGATTTGCAAGCAAATGATTG-3') and VlP6RBam (5'-

90

AAAGGATCCCTGTTGTTATGTATGAAATA-3') and inserted into vector
pPZP2012BAR23SS (Zhang and van Nocker, 2002). For production of VIP5 antisense
plants, a 2-kb cDNA corresponding to the entire translated region was amplified from
shoot apex-derived cDNA using primers VIPSFBam (5'-
AAAGGATCCTATGGGTGATTTAGAGAACTTGC-3') and VIP5RBam (5'-
AAAGGATCCAAGAAGCAG'ITI‘TCAGAAG-3'), and inserted into
pPZP201zBAR23SS. For production of transgenic plants constitutively expressing VIP5 in
the sense orientation, VIP5 coding and 3’ nontranslated region was amplified from
genomic DNA using primers F3SSVIP5 (5'-
AAATCTAGACCTTAGAAGATTATGGGTGA-3') and R3SSVIP5 (5'-
AAAGGATCCCCACGATCCATACACGAGCA-3'), and ligated into
pPZP201:BAR23SS. For molecular complementation of the vip5 mutation, a 5.5-kb
SalI/BamHI fragment DNA containing the At1g61040 transcriptional unit was excised
from purified BAC T7Pl DNA and inserted into vector pPZP2012BAR (Zhang and van
Nocker, 2002). Transgenic plants expressing F LAG-epitope-tagged VIP3 protein were
engineered by ligating the VIP3 transcriptional unit, containing 1.2 kb of 5'/promoter
DNA, into the plant expression vector pHuaF LAG (H. Zhang, unpublished results), and
introducing the resulting construction directly into the vip3-1 mutant background. The
pHuaFLAG vector is based on pPZP2012BAR, and allows for a C-terminal translational
fusion of two tandem copies of the FLAG epitope. The VIP3 transcriptional unit was
amplified from wild-type plant DNA using the primers PstI-VIP3F (5'-
AAACTGCAGTAACGCTCGAGCTTCTTCACCC-3') and BamHI-VIP3R (5'-

AAAGGATCCTGAGTAATCATAGAGCGATACA-3').

91

RT-PCR Analysis

Relatively quantitative RT-PCR analysis of FLC/MAF gene family expression was
performed using conditions and oligonucleotide primers as described by Ratcliffe et al.
(2001, 2003). The number of cycles was varied for each primer set: MAF], 35 cycles;
FLC, MAF2, MAF3, and MAF4, 30 cycles; and ACTIN, 20 cycles. Similar conditions
were used to analyze VIP6 expression, with primers VIP6FNcoI (5'-
AAACCATGGATTTGCAAGCAAATGATTC-3') and VIP6R2Bam (5'-
AAAGGATCCAGTTATGTGGCCTTTCGCATGTACTC-3') and 39 cycles.
Immunoblot Analysis

For use as antigen in rabbits, an N-terrninal portion (amino acids 2 to 404) of the
predicted VIP6 protein, and an N-terrninal portion (amino acids 1 to 202) of the predicted
VIP4 protein, were expressed in E. coli as hexahistidine fusions and purified using Ni”-
affinity chromatography. Anti-FLAG M2 monoclonal antibody was purchased from
Sigma (St. Louis, MO; catalog no. F-3165).

Total protein extracts from aerial portions of 3-week-old plants were prepared as
described previously (Zhang et al., 2003 ). Histone-enriched extracts were prepared as
described by Moehs et al. (1988). Immunoblot analysis of histone-enriched extracts
utilized the following antibodies: H3 di-M-K4 (Upstate, Lake Placid, NY; catalog no. 07-
030), H3 di-M-K36 (Upstate; catalog no. 07-369), H3 di-M-K79 (Upstate; catalog no. 07-
366), and H3 tri-M-K4 (Abcam, Cambridge, MA; catalog no. Ab 8580-50).

For immunoprecipitation experiments, anti-VIP4 and anti-VIP6 IgGs were
purified by elution from Protein A-agarose (Roche, Indianapolis, IN) using a procedure

described by the manufacturer. We used protein extracts from inflorescence apices,

92

because VIP4 and VIP6 are strongly expressed in these tissues; 500 pg of protein extract,
in a volume of 500 IIL of extraction buffer (50 mM Tris-HCI, pH 8.0, 150 mM NaCl, 1
mM EDTA, 0.2% Triton X-100, containing 1 mM phenylmethylsulfonyl fluoride) was
incubated with 10 pL of IgGs, and mixed continuously for 2 h. Protein A-agarose beads
(15 pL) were then added, and the mixture was incubated a further 1 h. Protein A-agarose
beads were collected by centrifugation and washed with 1 mL ice-cold washing buffer
(extraction buffer lacking Triton X-100) four times. After the final wash, the beads were
resuspended in 30 pL of SDS-PAGE sample buffer. All immunoprecipitation procedures
were performed at 4°C.

Immunoblotting was done as described by Harlow and Lane (1988) , using
polyvinylidene difluoride membranes (Bio-Rad, Hercules, CA) blocked with Tween-20 in
phosphate-buffered saline, and alkaline-phosphatase-labeled, goat anti-rabbit IgGs (Bio-
Rad), or enhanced chemiluminscence (Amersham Biosciences, Piscataway, NJ), using
nitrocellulose membranes (Amersham) blocked with 3% skim milk in phosphate-buffered
saline, and peroxidase-conjugated, anti-rabbit IgGs (Amersham).

Sequence Analyses

Motifs in the VIP5 and VIP6 proteins were identified using PFam version 13.0 on a Web
server maintained by Washington University in St. Louis
(http://pfam.wustl.edu/hmmsearch.shtml) or the PredictNLS server at the Columbia
University Bioinforrnatics Center (http://cubic.bioc.columbia.edu/; Cokol et al., 2000).
Other sequence analyses were performed using BLAST on Web servers maintained by

the National Center for Biotechnology Information (NCBI; http://www.ncbi.nlm.nih.gov)

93

or The Arabidopsis Information Resource (http2//www.arabidopsis.org), and programs of
the Genetics Computer Group (Madison, WI).

Microarray Analysis

Each of the two replicates for each genotype was composed of three independently
derived samples. Each sample included between 12 and 20 plants. Total aerial tissues
were harvested when the first flower was fully opened. Total RNA was isolated using
Qiagen RNAeasy columns (Qiagen, Valencia, CA). Synthesis of cDNA employed the
SuperScript double-stranded cDNA synthesis kit (Invitrogen, Carlsbad, CA) and 100
pmol of oligo(dT)24 primer (Proligo, Boulder, CO), following the manufacturers'
instructions. Synthesis of biotinylated cDNA utilized the BioArray high yield RNA
transcript labeling kit (Enzo Diagnostics, Farmingdale, NY). The Arabidopsis ATHl
Genome Array (Affymetrix, Santa Clara, CA) was used for hybridization. Hybridization
and scanning of microarrays was performed at the Genomics Technology Support Facility
at Michigan State University.

Microarray data were analyzed using the statistical algorithms within the
Affymetrix Microarray Suite (MAS) 5.0 software. We employed pairwise comparisons of
the independent biological replicates to identify genes that exhibited a marked change in
transcript abundance according to an arbitrary stringent or relaxed definition. For the
stringent definition, the gene must have been detected at a statistically significant level
(i.e., called present or marginal by the MAS software) in both replicates of either the
experiment (vip5 or vip6) or the baseline (flc). In addition, the MAS software must have
observed a statistically significant change in expression (i.e., called decrease, marginal

decrease, increase, or marginal increase) in at least three of the four comparisons, and the

94

mean difference in signal intensity must have been threefold or greater. The number of
genes that were detected and exhibited a significant change in expression of at least
threefold in any one comparison of replicate sample pairs (i.e., flc versus flc, vip5 versus
vip5, or vip6 versus vip6) was, at most, 80 (0.35% of microarrayed genes). For the relaxed
definition, the gene must have been detected at a statistically significant level in either
replicate of either the experiment or the baseline, the MAS software must have observed a
statistically significant change in expression in at least two of the four comparisons, and
the mean change in signal intensity must have been twofold or greater. The number of
genes that met this relaxed criteria for any one comparison of replicate sample pairs was,
at most, 512 (2.25% of microarrayed genes). Microarray data discussed here have been
deposited with the Gene Expression Omnibus database at the NCBI
(http://www.ncbi.nlm.nih.gov/geo/; series no. GSE1516).
Results

VIP5 and VIP6 Function in Concert with VIP3 and VIP4

Based on phenotypic similarity among mutants at the seven VIP loci reported previously,
we proposed that the respective genes work in concert in a common mechanism or
pathway (Zhang and van Nocker, 2002; Zhang et al., 2003). To explore this idea further,
we evaluated the phenotypic effects of combining strong vip3 and vip4 mutations with
strong vip5 and vip6 mutations (This analysis was done by Hua Zhang). In short-day
photoperiods, where the promotive effects of extended daylengths are minimized, and
under a variety of growth temperatures and light intensities, vip5 and vip6 single mutants
flowered with a similar number of leaves to either vip3 or vip4 (Figure 3-1). As

previously observed (Zhang et al., 2003), these mutants flowered significantly earlier than

95

an flc null mutant (Figure 3-1). There was no significant difference in flowering time
between any single mutant and any of the derived double mutant combinations evaluated.
In addition, in the double mutants, we did not observe phenotypic effects that were more
severe than those exhibited by any single mutant (data not shown). The lack of synergistic
effects of coincident inactivity of these genes is consistent with our hypothesis that these
genes are closely related in function, possibly as components of a protein complex or

molecular pathway.

VIP5 and VIP6 Participate in the Regulation of a Heterogeneous Subset of Genes
Including Other Members of the FLC/MAF Gene Family

The observation that strong vip3, vip4, vip5, and vip6 mutants flower earlier than an flc
null mutant suggested that these genes participate in the regulation of flowering-time
genes in addition to F LC . The unique (nonredundant) function of the F LC gene appears to
be limited to flowering time, because flc null mutants do not exhibit gross defects beyond
timing of flowering. In contrast, the developmental pleiotropy seen in strong vip mutants
suggests that these genes participate in the regulation of a subset of genes that include,
but are not limited to, F LC (Zhang et al., 2003).

To assist in the identification of these genes, and to evaluate similarity in
molecular phenotype between vip5 and vip6 mutants, we performed transcriptional
profiling experiments using Affymetrix ATHl microarrays representing 22,700
Arabidopsis genes (Figure 3-2). To eliminate indirect effects on gene expression because
of differential activity of FLC and its effects on flowering, we related transcriptional
profiles of the strong vip5-I or vip6-3 mutant plants, in which FLC transcripts are not

detectable, with those of theflc-3 null mutant, which produces a dysfunctional transcript

96

N
N
1 I l
I
I
K
N
1.1
\IF—I—d

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

. 33.1
28" Jim... :
4 ~R.‘
1 1 .-
K 24- __ 20-
G.) 4: ~7: 4 .4—
e i 2 -- 1 *2
3 16: 18: ‘-
t . 4 L '11-
k“ .1 --1r— .. —Il-1 1'- —
(U 1 - q- l L
Q 14- I __ 16- -. -
——1 -L
\ ‘ -*- ..
:9. . -- r . __ -1
9, 12, -— 144 --
10- ‘ 12.
l '1- '? L “.4 “.1
“3 "5 s1- s:-
< .g g, 1 .Q. g.
m «3 to u': to ' ‘ on s'r u's us ' 10
~ 0.9-8.3.9-3- - 6.9.9.939,
it > > > > > , I: > > > > >
6 8

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Figure 3-1. Flowering Time of vip3, vip4, vip5, and vip6 Single and Double Mutants.
Flowering time (measured as the total number of rosette and cauline leaves produced) is
indicated for (A) vip3-I, vip5-I, vip6-3, and derived double mutants and (B) vip4-2, vip5-
], vip6-1, and derived double mutants. Plants were grown under noninductive (8 h
light/16 h dark) photoperiods. Results from independent experiments are shown;
flowering time of the flc null mutant fie-3 in each experiment is shown for comparison.
Values represent the mean and standard deviation for at least 20 plants of each genotype.
This analysis was done by Hua Zhang.

97

(Michaels and Amasino, 2001). All of these mutants were derived from the same
parental genotype, and, under the long-day conditions in which these experiments were
performed, flowered at approximately the same time and developmental stage (Zhang et
al,2003)

We employed pairwise comparisons of the replicates and standard statistical
analyses (see Methods) to define subsets of represented genes with expression affected in
the vip5-1 mutant, the vip6-3 mutant, or in both the vip5-1 and vip6-3 mutants, relative to
the flc-3 null mutant. Confirming the efficacy of this approach, and consistent with
previous results based on RNA gel blotting (Zhang et al., 2003), we found that FLC
transcripts were easily detectable in the flc-3 mutant, but undetectable (statistically
absent) in the vip5 and vip6 mutant (Figure 3-2 and data not shown). In addition to FLC,
~ 40 other genes showed a strong decrease in expression in the vip5 or vip6 mutants
relative to flc-3; we also identified 20 genes that were strongly upregulated in the vip5 or
vip6 mutants relative to fie-3. The genes that were in vip5 or vip6 were not obviously
related with respect to structure, genomic location, or potential function (data not shown).

The essentially indistinguishable phenotype conferred by strong mutation at each
vip locus (Zhang et al., 2003) suggested that a similar subset of genes would be affected
in each mutant. This was indeed the case with vip5 and vip6. The data for these two
mutants revealed a high degree of overlap (Figure 3-2); the subset of genes that showed a
strong decrease in both mutants represented 79% of the strongly decreased genes in vip5,
and 77% of the strongly decreased genes in vip6. The degree of overlap was nearly

complete when the subset was defined by slightly relaxed criteria for either of the

98

Figure 3-2. Characteristics of Microarray Data Derived from flc, vip5, and vip6
Mutants.

Signal intensity was plotted to compare single replicates of flc with vip5 (top), flc with
vip6 (middle), or vip5 with vip6 (bottom). The signal positions for FLC and/or VIP6 are
indicated. For each comparison, representative data are shown.

99

105

vip5

vip6

vip6

 

10’

101

 

 

 

10'1
10’ 101 10' ‘105

 

 

10°

103

101

 

 

10*
10’ 101 1o3 105

 

 

 

105

103

101

 

 

10"
10'1

 

 

101 _ 103 105
vrp5

Figure 3-2

100

pairwise comparisons (see Methods). For example, all of the 42 genes exhibiting a strong
decrease in vip5, as defined by the more stringent criteria, also met the relaxed criteria for
a decrease in vip6. The overlap was also apparent when the data for vip5 and vip6 were
compared directly using the more stringent criteria; for example, only two genes showed
a strong decrease in vip6 relative to vip5, and one of these was subsequently identified as
the VIP6 gene itself (Figure 3-2 and data not shown).

Interestingly, among the genes showing decreased expression in both vip5 and
vip6 was the FLC paralog MAF] (Ratcliffe et al., 2001; also known as FLM [Scortecci et
al., 2001]). We confirmed this result through RT-PCR analysis (Figure 3-3). Like FLC,
MAF] acts as a repressor of flowering, and at least in the Columbia (Col) background is
downregulated in vemalized plants (Ratcliffe et al., 2001; our unpublished results). The
FLC/FLM MADS box clade in Arabidopsis is represented by four additional genes,
designated MAF 2-MAF 5, that also can act as floral repressors (Ratcliffe et al., 2001, 2003
). We considered whether VIP5 and VIP6 also participate in the regulation of these genes.
MAF 2, MAF 4, and MAF 5 were also represented on the microarrays, but their expression
was statistically undetectable (MAFZ and MAF 4) or did not exhibit a significant change
(MAF 5) in our microarray data. However, RT-PCR analysis indicated a modest but
reproducible decrease in MAF2, and a marked silencing of the remaining MAF genes, in
both vip5 and vip6 mutants, relative to the flc null (Figure 3-3). Notably, the involvement
of VIP5 or VIP6 in the activation of the MAF genes did not depend on FLC activity,
because this experiment was performed in an flc null genetic background. This suggests

that the MAF gene family members represent additional regulatory targets of VIP5 and

VIP6.

101

MAF1

MAF2 - u a

 

MAF3

MAF4

MAF5

AC TIN

 

Figure 3-3. Expression of the FLC-Related MAF Genes in flc, vip5, and vip6
Mutants.

Expression was monitored in flc-3, vip5-1, and vip6-3 plants by RT-PCR as described in
Methods. Results shown are representative of two independent biological replicates.

102

VIP6 Encodes :1 Plant Homolog of the PaflC Component Ctr9

The VIP6 gene was represented by three alleles derived from fast-neutron mutagenesis
(vip6-I) and T-DNA mutagenesis (vip6-2 and vip6-3) that, based on phenotypic similarity
of the respective mutants, were of equivalent severity (data not shown). Initial attempts to
identify VIP6 by characterizing genomic DNA flanking the T-DNA insertion site in the
vip6-2 or vip6-3 mutants were not successful. Therefore, we used a positional cloning
approach, and localized VIP6 within a ~1.2-mb region of chromosome 11 (Positional
cloning of VIP6 was done by Philip Ludwig) (Figure 3-4A). Because no recombination
was detected in the immediate region of VIP6, we analyzed the activity of the majority of
genes within the ~1.2-mb region in the vip6-3 mutant using data derived from microarray
hybridizations (above). A single analyzed gene within this region, designated At2g06210,
showed a statistically significant decreased expression in the vip6-3 mutant as compared
with the flc-3 mutant (Figures 3-2 and 3-4B; data not shown). We were not able to detect
At2g06210 transcripts in wild-type plants by RNA gel blotting, even using
phosphorimaging and extended exposures. However, analysis of the At2g06210 gene by
RT-PCR in wild-type plants and in the strong vip6-I mutant revealed a strong decrease in
mRNA accumulation in the mutant (Figure 3-5A). PCR analysis using T-DNA-specific
primers and sets of overlapping primers encompassing the At2g06210 genomic region
revealed the presence of T-DNA within the At2g06210 predicted transcribed region in the
vip6-3 mutant (Figure 3-4A and data not shown). We were unable to amplify any region
of At2g06210 genomic DNA from vip6-I mutant plants, suggesting that the At2g06210

gene was deleted, and that vip6-I represents a true null allele. As further evidence that

103

Figure 3-4. Map Position, Structure, and Expression of the VIP6 Gene and Protein.
(A) Region of chromosome 11 containing the VIP6 gene. Molecular markers used in
mapping are shown, with genetic distance (recombinations/chromosomes analyzed)
between the vip6 mutation and marker indicated. Relevant BAC clones are shown. In the
depiction of the VIP6 transcriptional unit, exons are shown as black (translated region) or
gray (untranslated region) boxes, and an alternative exonic region detected in some
cDNAs is shown as a gray box. The positions of the start codon (ATG) and termination
codons (TAG and TGA; the TAG termination codon is within the alternative exonic
region) are shown. The positions of the T-DNA insertions in the vip6-3 allele and the
SIGnAL alleles 090130 and 065364 are indicated. Positional cloning of VIP6 was done
by Philip Ludwig.

(B) Expression of VIP6 and adjacent genes in the flc-3, vip5-I, and vip6-3 mutants.
Predicted transcriptional units are indicated by arrows. Expression data were derived as
described in Methods (+, detected in both replicates; +/— detected in one replicate; -, not
detected; NC, no significant change in expression relative to flc mutant; D, significant
decrease in expression relative to flc mutant). All predicted transcriptional units within 15
kb of the VIP6 gene that were represented on the microarray are shown.

(C) Expression of the VIP6 protein in wild-type plants (WT) and in five vip6 mutant
backgrounds. An unrelated, immunoreactive protein species is indicated (*).

(D) Domain structure of the VIP6 protein and related murine p150TSP and budding yeast
Ctr9. TPR motifs (T) are indicated, with those most strongly resembling the canonical
TPR motif (T) shown in black. Potential nuclear localization signal sequences are also
shown (N). Coiled-coil regions are depicted as sinuous segments. The highly charged
regions of the C termini are represented with increased stroke weight.

104

A VIP6 EL”:

34/1140 0/1140 0/1140 0/1140 0/1140 2/1140
452469 4526 44 458108 461659 461342 458202
mama thmflnbm

T2OGZO T6P5 F18P14

   
   

vip6-090130
V

 

Arc TAG TGA
B 5 kb
P—-—-—4
VIP6
At2_g£6230 A12906210 A29061 80
At2006220 21129076200 152306190 At2g06170
”0 expression - - + - - - -
vip5 expression - - + 44- - - -
vip6 expression - - +l- +4-- - - -
vip5 v NC change NC NC
vip6 v fIc change D NC
9° «9‘
c e
3‘ , Sir £5 9 9
SSSSSS

 

VlP6:l»-o T ~i<130 k0

D VIP6 meant—W-

p150TSP WW

Ctr9 W

Figure 3-4

105

At2g06210 represents the VIP6 gene, we analyzed the phenotype of two additional
A12g06210 T-DNA insertion mutants from a collection developed at the Salk Institute
Genomic Analysis Laboratory (SIGnAL; Alonso et al., 2003 ). For both lines, plants
homozygous for the mutations exhibited a pleiotropic phenotype that was essentially
indistinguishable from that of the three previously described vip6 mutants. The SIGnAL
mutant alleles were isolated in the Col background, which does not strongly express F LC
and flowers soon after germination; when introduced into the synthetic, winter-annual
ColeRlSF" background, these alleles conferred early flowering and loss of FLC
expression (data not shown). Finally, antibodies raised against a portion of the At2g06210
protein recognized a ~130-kD species in wild-type plants that was absent in plants
carrying strong vip6 alleles (Figure 3-4C). Based on these observations, we concluded
that At2g06210 is VIP6.

Transgenic antisense expression of a VIP6 cDNA in a wild-type (ColeRISF?)
background conferred a broad degree of acceleration of flowering time, with
approximately one-half of initial transformants (T1 plants) flowering during the course of
the experiment, and the earliest flowering plants (~10% of the population) flowering at
approximately the same time as vemalized wild-type plants. Interestingly, only a minor
fraction of VIP6 antisense plants exhibited developmental pleiotropy. As with flowering
time, a range of pleiotropy was seen, with the most severe effects limited to the earliest-
flowering T1 individuals. However, several of the earliest-flowering T1 plants did not
exhibit obvious phenotypic defects other than flowering timing (data not shown).

We found that VIP6 transcript and protein levels were similar in vemalized and

nonvemalized plants (Figure 3-5), suggesting that vemalization-mediated silencing of

106

A 551/5555
g (,5 V°3(O~"O\
eAsSSSSSS

 

 

ACT/N «354 bp
B 5 $17
SASSSSSS
V|P6 > ;—é~-~-; ‘130kD

 

Figure 3-5. Analysis of VIP6 mRNA and Protein Abundance in Various Genetic
Backgrounds and in Response to Vemalization.

(A) RT-PCR was used to compare VIP6 transcript levels in nonvemalized wild-type
plants (NV); wild-type plants subjected to a 70-d cold treatment (V); the fIc-3 null
mutant; strong vip3, vip-i, and vip5 mutants; the strong vip6-1 and vip6-3 mutants; and in
the Col ecotype. For each sample, a portion of the AC TIN gene was amplified in parallel
to demonstrate relative quantity and quality of the cDNA template.

(B) VIP6 protein was monitored by immunoblotting of extracts from nonvemalized wild-
type plants (NV); wild-type plants subjected to a 70-d cold treatment (V); the flc-3 null
mutant; strong vip3, vip4, and vip5 mutants; the strong vip6-3 mutant; and in the Col
ecotype. An unrelated, immunoreactive protein species is indicated (*) to indicate the
total amount of protein present in each lane.

107

FLC does not directly involve modulation of VIP6 expression. Also, VIP6 mRNA and
protein were expressed at wild-type levels in the Col genetic background, which lacks a
functional FRI allele (Figure 3-5), suggesting that VIP6 does not regulate FLC
downstream from FRI. Immunoblot analysis of dissected whole plants indicated that the
VIP6 protein is ubiquitously expressed, with the strongest accumulation in apical tissues
(data not shown).

We also detected VIP6 mRNA expression at wild-type levels in strong vip3, vip4,
and vip5 mutants (Figure 3-5A), suggesting that the VIP6 gene was not subject to
regulation by these other VIP genes. Interestingly, however, in contrast with wild-type
plants, the VIP6 protein was not easily detectable in strong vip3, vip4, or vip5 genetic
backgrounds (Figure 3-SB). We also observed this effect on VIP6 protein levels in vip]
and vip2 mutants (data not shown). This observation suggests a posttranslational role for
these other VIP genes in maintaining VIP6 protein levels. Based on sequence analysis of
several cDNAs, VIP6 could encode two proteins of 1091 and 740 amino acids that would
originate from alternative processing of a common precursor RNA (Figures 3-4A and 3-
4D). These putative proteins differ only in the extent of their C termini, and contain so-
called tetratricopeptide repeats (TPRs) throughout much of their length. TPRs are 34-
amino acid domains found in proteins of diverse function, and are generally considered to
mediate protein-protein interactions and/or assembly of protein complexes (D'Andrea and
Regan, 2003). The larger form of the VIP6 protein contains predicted coiled-coil domains
near its C terminus, and the C-terminal 200 amino acid region is highly enriched in
charged amino acids such as Glu, Asp, Arg, and Lys (Figure 3-4D). This C-terminal

region also contains four potential nuclear localization motifs (Figure 3-4D), suggesting

108

compartmentalization in the nucleus. Immunoblot analysis using antibodies directed
against the N-terminal region of the VIP6 protein recognized only a single, ~130-kD
species in wild-type plant extracts, suggesting that the longer form of the protein is
relatively more abundant.

A query of public sequence databases identified known and hypothetical VIP6-
related proteins in various divergent eukaryotes, including human, fruit fly, frog, slime
mold, rice, and yeasts. Of these, only the Ctr9 protein from budding yeast has been
functionally characterized. This protein has been described as a component of PaflC
(Mueller and Jaehning, 2002), a transcription factor required for specific transcription-
promotive covalent modifications of chromatin-associated histones: ubiquitination of
H28 within its C-terminal domain, and methylation of H3 at residues K4, K36, and K79
(Ng et al., 2003a; Wood et al., 2003b ). PaflC is associated with the initiating and
elongating forms of RNA polymerase 11 (Pol II; Mueller and Jaehning, 2002) and during
elongation may serve as a platform for the association of specific histone methylases with
chromatin (Hampsey and Reinberg, 2003). It has been postulated that PaflC provides a
mechanism for the memory of recent gene transcription, potentially by antagonizing the

activity of silencing proteins and thus reinforcing the active state of genes (Ng et al.,

2003b).

The VIP6 Protein Physically Interacts with VIP3 and VIP4 in Vivo

The observation that VIP6 encodes a PaflC subunit homolog was especially intriguing in
light of the previous identification of VIP4 as homologous to yeast Leol (Zhang and van

Nocker, 2002 ). Leol copurified from yeast cells with Ctr9 and other PaflC proteins

109

(Mueller and Jaehning, 2002; Krogan et al., 2002; Squazzo et al., 2002 ), and so is
probably an integral subunit of Pafl C. We performed coimmunoprecipitation
experiments to determine if, like their yeast counterparts, VIP6 and VIP4 interact in vivo
(This coimmunoprecipitation analysis was done by Hua Zhang) (Figure 3-6A, B). Indeed,
antisera generated against recombinant VIP4 protein specifically immunoprecipitated a ~
l30-kD protein from wild-type plant extracts that was strongly immunoreactive with anti-
VIP6 antibodies (Figure 3-6A). This protein was absent from parallel immunoprecipitates
using extracts from the strong vip6-I mutant (Figure 3-6A). Conversely, anti-VIP6
antibodies immunoprecipitated an anti-VIP4 immunoreactive, ~125-kD protein from
wild-type extracts that was absent from immunoprecipitates from the strong vip4-2
mutant (Figure 3-6B). Only a marginally detectable amount of VIP6-immunoreactive
protein was immunoprecipitated from vip4-2 extracts with anti-VIP6 IgGs (Figure 3-6B),

consistent with the previous observation that VIP6 protein accumulation is dependent on

functional VIP4.

To determine if the VIP6 and VIP4 proteins also interact with the previously
described VIP3 in vivo, we constructed and expressed a FLAG-epitope-tagged copy of
the VIP3 protein in vip3-1 mutant plants. This epitope-tagged VIP3 protein fully
complemented the vip3 mutant phenotype, indicating that it is functional (data not
shown). Anti-FLAG antibodies specifically immunoprecipitated anti-VIP4- and anti-
VIP6-immunoreactive proteins of the molecular masses expected for VIP4 and VIP6
(This immunoprecipitation analysis was done by Hua Zhang) (Figure 3-6C). Based on
these observations. we conclude that VIP4, VIP6, and VIP3 interact in a protein complex

in vivo.

llO

 

 

 

 

 

 

 

 

 

 

 

anti-VIP6. , ‘130 “0
anti-VIP4 .1. f .2 «125 kD
Q:
a 40 (ss
x. ~\\ q.- .8 7‘ ‘3’
(i) {S 0° o" 6° .3‘
-S m 6 é a) &
anti-VIP4 i.»- «125m
7;
anti-VIP6.;."""".._.. *-- ' 3‘13“”
c 59
s g .3
s9 e S
anti-VIP6.:: “'“ “30“”

 

anti-VIP4 ’ 2.-.. «125 kD

 

 

 

Figure 3-6. Coimmunoprecipitation of VIP3, VIP4, VIP5, and VIP6 in Vivo.

(A) and (B) Interaction between VIP4 and VIP6. Total protein from wild-type
inflorescence apices (four lanes on left in each panel) was subjected to
immunoprecipitation using anti-VIP4 IgGs (A) or anti-VIP6 IgGs (B).
Immunoprecipitates were analyzed by protein gel blotting using anti-VIP6 or anti-VIP4
serum as indicated at left. No immunoreactive protein was detected when
immunoprecipitations were performed in the absence of IgGs (mock) or using the
respective preimmune sera. Parallel immunoprecipitations were performed using extracts
from the strong vip4-2 and vip6-I mutants (two lanes on right in each panel). (C)
Interaction between VIP3, and VIP4 and VIP6. Total inflorescence apex protein from
vip3-I plants expressing a transgenic copy of FLAG-epitope-tagged VIP3 was subjected
to immunoprecipitation using anti-FLAG antibody. Immunoprecipitates were analyzed
by protein gel blotting using anti-VIP6 or anti-VIP4 serum as indicated at left. No
immunoreactive protein was detected when immunoprecipitations were performed in the
absence of antibody (mock). In each panel, an unrelated, VIP6-immunoreactive protein
species present in total protein extracts is indicated (*). Immunoblots were developed
using colorimetric detection (anti-VIP6) or enhanced chemiluminescence and
autoradiography (anti-VIP4). This analysis was done by Hua Zhang.

lll

1kb

 

 

A t-——t
At1gB1030 At1961040 At1961050
4 BaIInHI s2»: <—
At1961020 At1961060

vip5-1 vip5-062223

 

I I
ATG TGA

U
V4.06: 7
W7

0

 

42.4kb VIP5 Wm
R111 W

I
I

VIP5

 

ACTIN

:2

 

 

Figure 3-7. Structure and Expression of VIP5.

(A) VIP5 genomic region and transcriptional unit. Exons are shown as black (translated
region) or gray (untranslated region) boxes. The positions of the start codon (ATG) and
termination codon (TGA) are shown. The positions of the insertion/deletion in the vip5-1
allele and of the T-DNA insertion in the SIGnAL allele vip5-062223 are indicated. The
BamHI/Sall fragment utilized in molecular complementation of the vip5 mutation is
depicted as a thickened line encompassing the VIP5 gene.

(B) Gel blot analysis of VIP5 mRNA abundance in the strong vip5-1 mutant and in wild-
type plants. The migration position of a 2.4—kb RNA size marker is indicated. The blot
was subsequently hybridized with an AC TIN probe to indicate relative quantity and
quality of mRNA in each lane.

(C) Domain structure of the VIP5 protein and related budding yeast Rtfl. The Plus-3
motif is indicated. Potential nuclear localization signal sequences are also shown (N).
Coiled-coil regions are depicted as sinuous segments.

112

VIP5 Encodes an Additional PaflC Subunit Homolog

The homology of VIP4 and VIP6 with yeast Pafl C components brought up the possibility
that other VIP genes encode plant homologs of additional PaflC subunits. Besides Ctr9
and Leol, the PaflC complex includes at least three other proteins: Rtfl, Pafl, and
Cdc73. Rtfl is represented by a single Arabidopsis homolog, designated At1g61040 (data
not shown). This gene is located within the likely genetic interval determined for both
VIP2 and VIP5 (Zhang et al., 2003 ), and therefore we explored the possibility that
At1g61040 was one of these genes. We sequenced the At1g61040 gene from the vip5-I
mutant and found a small insertion-deletion mutation that would terminate the reading
frame after amino acid 319 of the predicted 643-amino acid protein (Figure 3-7A). RNA
gel blotting indicated a 2.4-kb species that was present at reduced levels in the vip5-1
mutant relative to wild-type plants, suggesting that this mutation affects mRNA
accumulation in addition to protein sequence (Figure 3-7B). We also found that the
SIGnAL T-DNA line 062223, which has an insertion within the open reading frame of
At1g61040 (Figure 3-7A), exhibited a phenotype superficially indistinguishable from that
of vip5-I (data not shown). As further evidence that At1g61040 is VIP5, transgenic
introduction of a 5.5-kb DNA containing the AtIg61040 transcriptional unit into the vip5-
] mutant background fully complemented the vip5-I phenotypes (Figure 3-7A and data
not shown). Antisense expression of At1g61040 in a wild-type background conferred a
varying degree of early flowering to a majority of primary (T1) transformants. Similar to
the effect seen with VIP6-antisense plants, only a fraction of early-flowering plants

exhibited strong developmental pleiotropy as seen in the vip5-I mutant. Ectopic

113

expression of VIP5 in transgenic wild-type plants did not confer obvious phenotypic
consequences (data not shown).

We found that VIP5 mRNAs were expressed to similar levels in strong vip3, vip4,
and vip6 mutants, and, similar to VIP6, were expressed ubiquitously throughout the plant,
with strongest accumulation in apices, and were unchanged in vemalized plants or in the
Col background (data not shown). Based on current genomic annotation and sequence
analysis of several cDNAs, AtIg61040/VIP5 encodes a protein containing coiled-coil
regions, four potential nuclear localization signal sequences, and a so-called Plus-3
domain (Figure 3-7C). The Plus-3 domain (PFam accession number PFO3126), so named
because of the presence of three conserved positively charged residues, has no recognized
function, but is found in several other Arabidopsis and eukaryotic proteins (data not
shown). The homologous yeast Rtfl protein also contains these structural features (Figure
3-7C).

VIP Genes Are Not Required for Global Methylation of Histone H3

The conservation of the VIP4/Leol, VIP5/Rtfl, and VIP6/Ctr9 proteins, and the role of
the PaflC complex in histone methylation in yeast, suggested that these proteins may be
involved in histone methylation in plants. To address this, we examined global histone
methylation profiles in strong vip4, vip5, and vip6 mutants. Chromatin histone-enriched
proteins were extracted and analyzed by immunoblotting using antisera specific for
histone H3 methylated at K4, K36, or K79. In each case, the antibodies reacted strongly
with a single species of the predicted appropriate molecular mass (Figure 3-8), suggesting
that these histone modifications are conserved in plants. However, there was no

discernible difference in apparent abundance of modified histones in the vip4, vip5, or

114

vip6 mutants when compared with control (fie-3 or Col) extracts. Similar results were
obtained with a strong vip3 mutant (Figure 3-8). Thus, these VIP proteins do not appear
to be essential for these histone modifications in Arabidopsis, at least when assayed in
total plant tissues at the whole-genome level.

Discussion

Through the work reported here, we show that proteins related to a transcriptional
complex from budding yeast are conserved in higher eukaryotes, and in Arabidopsis play
a role in the expression of a diverse subset of genes including members of the FLC/MAF
family of flowering-time regulators. Our findings add to the increasing complexity of

mechanisms of both epigenetic gene regulation and flowering time.

The VIP Genes Have a Central Role in Flowering through Activation of the

FLC/MAF Gene Family

Our previous observations that vip mutants flower earlier than flc null mutants suggested
that other flowering-time genes in addition to FLC are targeted (Zhang et al., 2003). In
accordance with this, here we found that loss of VIP5 or VIP6 function led to
downregulation of not only FLC, but also other members of the FLC/MAF MADS-box
gene family, all of which have the capacity to act as floral repressors (Ratcliffe et al.,
2001, 2003; Scortecci et al., 2001). MADS box genes are commonly involved in
regulatory cascades, and we considered the possibility that the downregulation of the
MAF genes in vip5 and vip6 was mediated through silencing of FLC. However, these
experiments were performed in an flc null genetic background and in strong vip mutants

where F LC expression was not detected, suggesting that the regulation of the MA F genes

115

‘bv‘o‘o qr

drum-ml“-..- .. .. 1 ""1

 

 

     
 

ix

 

 

 

‘bv‘ob a:
“'

di-M-K36 Cantu...

 

 

 

 

99°) b‘o éxq,
ssSss aSg
“'-

di-M-K79 - ...... «A» we»

 

 

 

 

Figure 3-8. Immunoblot Analysis of Histone H3 Methylation in Strong vip3, vip4,
vip5, and vip6 Mutants, the flc-3 Null Mutant, and the Col Ecotype.

Histone-enriched extracts were resolved by SDS-PAGE and subjected to immunoblotting
using antibodies directed against dimethylated Lys-4 (di-M-K4), trimethylated Lys-4 (tri-
M-K4), dimethylated Lys-36 (di-M-K36), or dimethylated Lys-79 (di-M-K79). Histone-
enriched extracts from human Hela cells, or total protein extracts from wild-type yeast
and a yeast rtfl deletion strain (rtfl) are included as controls. The separate images of
Hela cell extract results were taken from the same immunoblot. A portion of a
representative SDS-PAGE gel (stained with Coomassie blue) is shown to indicate relative
quality and quantity of proteins in each lane (total).

116

occurred independently of FLC activity. Conversely, we considered the possibility that
the observed silencing of FLC in the vip5 and vip6 backgrounds was an indirect result of
downregulation of MAF genes. However, Ratcliffe et al. (2001 , 2003 ) formerly
demonstrated that F LC mRN A abundance was not affected by enhanced, constitutive
expression of MAF1 or MAF2, or by mutation in MAFZ, suggesting that FLC is normally
not subject to regulation by at least these two genes. Therefore VIP5 and VIP6 likely
regulate members of the FLC/MAF gene family independently.

The observed common regulation of distinct members of the FLC/MAF gene
family by VIP5 and VIP6 is surprising because genetic and molecular analyses have
identified clear differences in regulation and function among at least some of these genes.
For example, mutation in FLC abrogated the late flowering conferred by functional FRI
alleles and loss of function of autonomous pathway genes such as F VE and F CA (Sanda
and Amasino, 1996), whereas having little effect on the photoperiodic response (Michaels
and Amasino, 2001). In accordance with this, FLC gene expression was found to be
strongly activated by FRI and repressed by the autonomous pathway genes, but relatively
insensitive to regulation by genes intimately involved in photoperiodic flowering
(Sheldon et al., 1999). By contrast, a strong mafI/flm mutation led to substantial loss of
the photoperiodic flowering response and abrogated late flowering conferred by
mutations in photoperiodic pathway genes (Scortecci et al., 2001 , 2003 ). Also,
MAF1/FLM is apparently not subject to appreciable regulation by FRI or autonomous
pathway genes (Ratcliffe et al., 2001; Scortecci et al., 2001). Interestingly, however, like

FLC, at least the MAF1-MAF4 genes have been reported to be downregulated afier

117

growth in the cold, albeit to different degrees and with different kinetics (Ratcliffe et al.,
2001,2003)

The regulation of these FLC/MAF genes by both cold and the VIP genes might
suggest a link between vemalization and VIP gene function. One possibility is that
vemalization attenuates VIP activity, potentially through modifying abundance or activity
of one or more VIP genes/proteins, thus resulting in FLC/AMP gene downregulation and
silencing. However, we have not observed vemalization-associated changes in mRNA or
protein levels for any of the VIPs tested, including VIP5 or VIP6. Also arguing against
this possibility is the apparent requirement for VIP gene activity in unrelated
developmental events in vemalized plants, as evidenced by the fact that the molecular and
developmental pleiotropy of the respective vip mutants is not observed in vemalized wild-
type plants (Zhang et al., 2003). Therefore, it is most likely that vemalization and the VIP

genes regulate FLC/MAF genes through independent mechanisms.

VIP5 and VIP6 Define Important Pleiotropic Regulators of Development

Our transcriptional profiling experiments identified FLC as one of the genes most
severely affected in the vip mutants (Figure 3-2), suggesting a special dependence on VIP
activity. However, we also observed misregulation of a subset of genes not obviously
related to FLC, and this was expected given the developmental pleiotropy conferred by
the vip mutations. The subset of genes regulated by VIP5 and VIP6 appears diverse in
structure, function, and genomic location (data not shown), and the common features that
confer dependence on VIP5/VIP6 are not known. A trivial explanation is that expression

of these genes may be localized to flowers or shoot and inflorescence apices, where the

118

VIP5 and VIP6 genes are preferentially expressed. However, our microarray data
indicated that expression of a variety of genes formerly reported to be localized to flowers
or shoot/inflorescence apices, including VIP3 and VIP4, was independent of VIP5/VIP6

(data not shown).

The VIP Genes Cooperatively Regulate Gene Expression through a Mechanism

Related to the Yeast Transcriptional Regulator PaflC

The seven defined VIP genes carry out a common function in plant growth and
development, based on their indistinguishable developmental pleiotropy (Zhang et al.,
2003). Consistent with this, we did not observe enhanced effects on flowering time or
development when vip3 or vip4 mutations were combined with vip5 or vip6 mutations. A
common function for VIP5 and VIP6 was also reflected by the high degree of overlap
among misregulated genes in the respective mutants. Because the VIP6 protein is not
effectively expressed in the vip5 mutant background, the limited differences that we
observed in transcriptional profiles between the vip5 and vip6 mutants could reflect roles
for VIP5 that are independent of VIP6. Alternatively, although the vip5 and vip6 mutants
were backcrossed to wild-type plants extensively before analysis, these distinctions could
also have resulted from genetic lesions unrelated to the vip mutations that were sustained
in the original mutagenesis and are still harbored by either vip5 or vip6.

Our observation that the abundance of VIP6 protein, but not mRNA, is dependent
on functional VIP3, VIP4, and VIP5 could be explained by reduced posttranslational
stability of VIP6 in the absence of participation in a protein complex, presumably

involving VIP3, VIP4, and VIPS. The finding that at least VIP3, VIP4, and VIP6

119

physically interact in vivo is also consistent with the hypothesis that these proteins
comprise a protein complex. We formerly reported that VIP4 is a plant homolog of
budding yeast Leol (Zhang and van Nocker, 2002). Subsequently, it was revealed that
Leol is a component of the PaflC transcriptional complex (Mueller and Jaehning, 2002).
Here, we identified VIP5 and VIP6 as homologous to the PaflC components Rtfl and
Ctr9, respectively. These cumulative findings suggest that the Arabidopsis VIP proteins
define a plant counterpart of Pafl C. Consistent with this, we have determined that the
At1g79730 gene, which encodes a protein weakly related to the Pafl component of the
PaflC complex, is likely VIP2 (M.J. Ek-Rarnos and S. van Nocker, unpublished results).
The WD-repeat protein VIP3 has obvious homologs in animals but not budding yeast
(Zhang et al., 2003). WD-repeat proteins are common constituents of large chromatin-
associated complexes (van Nocker and Ludwig, 2003), and it is tempting to speculate that
VIP3 represents an elaboration of the PaflC mechanism not relevant for the relatively
simple chromatin of yeast.

Although the core components of yeast PaflC are conserved in higher eukaryotes,
their cellular and organismal role has not been explored. The VIP6/Ctr9 protein exhibits
homology with murine p15OTSP. This protein was previously isolated based on its in vitro
affinity for an isolated Src homology (SH2) domain, a conserved, 100 amino acid,
phosphopeptide binding module that has been best characterized as a component of
proteins with roles in cellular signaling pathways including signal transducer and
activator of transcription and suppressor of cytokine signaling proteins, janus kinases, and

other tyrosine kinases (Pawson, 2004). Although these signaling pathways are generally

not tightly conserved in plants, it remains a possibility that VIP6 couples transcription

120

with plant-specific signaling pathways. In support of this, in vitro binding of p150TSP

protein to SH2 is dependent on phosphorylation of Ser/Thr residues and the highly
charged C-terminal region of pl 50TSP (Malek et al., 1996), features that are conserved in
VIP6.

PaflC plays a central role in transcription in yeast and, although not essential for
viability, is required for full expression of a variety of yeast genes (Porter et al., 2002).
PaflC components assist in the ubiquitination of the C-terminal domain of histone H2B
by the ubiquitin conjugating/ligase proteins Rad6/Bre1 (N g et al., 2003a; Wood et al.,
2003b ). Ubiquitination of HZB within promoter regions, as well as ensuing
deubiquitination by the SAGA histone acetyltransferase-associated pr8, is required for
efficient activation of many genes in yeast (Henry et al., 2003). At least in yeast, HZB
ubiquitination is also a prerequisite for methylation of histone H3 at lysines 4 and 79 by
the histone methylases Setl/COMPASS and Dotl, respectively, within open reading
frames (Wood et al., 2003b ). These histone modifications have most often been
associated with actively transcribed genes (Harnpsey and Reinberg, 2003). At least the
Rtfl subunit of PaflC is also required for efficient, locus-specific H3K36 methylation by
an additional histone methylase, Set2, an activity that is apparently independent of H2B
ubiquitination (N g et al., 2003a). Unlike yeast strains deleted for components of Pafl C,
Arabidopsis vip mutants did not exhibit detectable defects in methylation at H3K4, K36,
or K79 when assayed on a bulk chromatin and total plant tissue basis. Potentially, such an
activity is redundant in plants, or occurs in a tissue-specific or locus-specific manner.

PaflC subunits associate with the initiating and elongating forms of Pol II

(Mueller and Jaehning, 2002), and are bound within 5' regions and open reading frames

12]

of various genes (Krogan et al., 2002; Simic et al., 2003). Given the association of PaflC
with elongating Pol II, the capacity of PaflC to promote H3K4 methylation, and the
observation that trimethylation at H3K4 is uniquely associated with actively transcribed
loci, together with the apparent lack of enzymes that could demethylate histones, it has
been hypothesized that H3K4 trimethylation comprises a molecular memory of recent
gene transcription (N g et al., 2003b). How this memory mechanism is manifested at the
molecular level remains mostly unknown. However, methylation of H3K4 can recruit the
lswl chromatin-remodeling ATPase (Santos-Rosa et al., 2003), which generates specific
chromatin changes at the 5' end of genes needed for correct distribution of Pol 11
throughout the transcribed region and assembly of the cleavage and polyadenylation
machinery (Morillon et al., 2003).

The prospect that the homologous plant mechanism also participates in FLC
transcription through generating active patterns of histone modification is intriguing. In
animals, epigenetic maintenance of homeotic gene activity involving the trxG proteins
also involves histone methylation at residues including H3K4. For example, the human
trx-related MLL (mixed lineage leukemia) protein carries out H3K4 methylation at Hox
loci in vivo (Milne et al., 2002). Similarly, in flies, H3K4 methylation by the epigenetic
activator Ashl is essential to maintain activity of homeotic genes in the developing
embryo (Tripoulas et al., 1994; Beisel et al., 2002). Similar to the observed recruitment of
Iswl by methylated H3K4 in yeast, Ashl activity involves the recruitment of the trxG
chromatin-remodeling ATPase Brahma (Beisel et al., 2002). We hypothesize that the role
of the VIP proteins in promoting FLC activity in nonvemalized plants is to provide a

transcription-associated platform for the modification of FLC chromatin by a trxG-like

122

  

u .. f7.

  

 

.u.‘ I?!

\.~

.1

,.i......

   

.54...
. i

w

    

z... 3...? a :03...”

 

.1
JE..

u..:fi$.~.1~. : .4114? fisqflfi «oat-«m.

(nutty-

  

?! .v.

L»: I a,

mechanism, that would antagonize repression by a VRN2-associated PcG mechanism.
This effect could involve the recruitment of chromatin-remodeling factors such as PIE1,
an ISWI-farnily protein formerly shown to be required for full expression of FLC (Noh
and Amasino, 2003). The only Arabidopsis trx-like protein to have been characterized to
date, ATXl , functions in the activation of homeotic genes, and can methylate a synthetic
peptide corresponding to the H3 amino-terminus on K4 in vitro (Alvarez-Venegas etal.,
2003 ). A strong ath mutation conferred mildly delayed flowering and floral
abnormalities that were seemingly distinct from that of the vip mutants (Alvarez-Venegas
et al., 2003), suggesting that the activity of ATXl is not closely tied to that of the VIP
genes. However, the Arabidopsis genome encodes for several additional trx-related
proteins that could promote F LC expression (Baumbusch et al., 2001).

A very recent study indicates that PaflC also has transcriptional roles seemingly
distinct from chromatin modification (Mueller et al., 2004). Loss of Rtfl or Cdc73, which
dissociated remaining PaflC proteins from chromatin, conferred only mild phenotypes
relative to those resulting from loss of other PaflC proteins such as Pafl or Ctr9.
Similarly, loss of Pafl or Ctr9 affected growth to a greater extent than loss of Brel or
histone methylation (Wood et al., 2003a; Mueller et al., 2004). Moreover, loss of Pafl or
Rtfl led to global defects in mRNA polyadenylation, suggesting an important function for
PaflC in posttranscriptional events. The increasingly diverse repertoire of activities
attributed to PaflC and its subunits allows wide latitude for speculation on the means by
which the related plant VIP mechanism participates in FLC expression, and provides
numerous avenues for further exploration. The identification of additional factors

required to maintain FLC expression through genetic and biochemical methods holds

123

exceptional promise and may illuminate many more unanticipated connections between

basic transcription and development in higher eukaryotes.

124

References

Alonso, J.M., et al. (2003). Genome-wide insertional mutagenesis of Arabidopsis
thaliana. Science 301, 653—657.

Alvarez-Venegas, R., Pien, S., Sadder, M., Witmer, X., Grossniklaus, U., and Avramova,
Z. (2003). ATX-l, an Arabidopsis homolog of trithorax, activates flower homeotic
genes. Curr. Biol. 13, 627—637.

Bastow, R., Mylne, J .S., Lister, C., Lippman, Z., Martienssen, R.A., and Dean, C. (2004).
Vemalization requires epigenetic silencing of FLC by histone methylation. Nature
427, 164—167.

Baumbusch, L.O., Thorstensen, T., Krauss, V., Fischer, A., Naumann, K., Assalkhou, R.,
Schulz, I., Reuter, G., and Aalen, RB. (2001). The Arabidopsis thaliana genome
contains at least 29 active genes encoding SET domain proteins that can be assigned
to four evolutionarily conserved classes. Nucleic Acids Res. 29, 4319—4333.

Beisel, C., Imhof, A., Greene, J ., Kremmer, B., and Sauer, F. (2002). Histone methylation
by the Drosophila epigenetic transcriptional regulator Ashl. Nature 419, 85 7—862.

Betz, J.L., Chang, M., Washbum, T.M., Porter, S.E., Mueller, C.L., and Jaehning, J.A.
(2002). Phenotypic analysis of Pafl /RNA polymerase II complex mutations reveals

connections to cell cycle regulation, protein synthesis, and lipid and nucleic acid
metabolism. Mol. Genet. Genomics 268, 272—285.

Cokol, M., Nair, R., and Rost, B. (2000). Finding nuclear localization signals. EMBO
Rep. 1, 411—415.

D'Andrea, L.D., and Regan, L. (2003). TPR proteins: The versatile helix. Trends
Biochem. Sci. 28, 655—662.

Fischle, W., Wang, Y., and Allis, CD. (2003). Binary switches and modification
cassettes in histone biology and beyond. Nature 425, 475—479.

Francis, N.J., and Kingston, RE. (2001). Mechanisms of transcriptional memory. Nat.
Rev. Mol. Cell Biol. 2, 409—421.

Gendall, A.R., Levy, Y.Y., Wilson, A., and Dean, C. (2001). The VERNALIZA TION 2
gene mediates the epigenetic regulation of vemalization in Arabidopsis. Cell 107,
525—535.

Goodrich, J ., Puangsomlee, P., Martin, M., Long, D., Meyerowitz, E.M., and Coupland,
G. (1997). A Polycomb-group gene regulates homeotic gene expression in
Arabidopsis. Nature 386, 44—5 1.

Hampsey, M., and Reinberg, D. (2003). Tails of intrigue: Phosphorylation of RNA
polymerase II mediates histone methylation. Cell 113, 429—432.

125

Harlow, E., and Lane, D. (1988). Antibodies: A Laboratory Manual. (Cold Spring
Harbor, NY: Cold Spring Harbor Laboratory Press.)

Henry, K.W., Wyce, A., Lo, W.S., Duggan, L.J., Emre, N.C., Kao, C.F., Pillus, L.,
Shilatifard, A., Osley, M.A., and Berger, S.L. (2003). Transcriptional activation via
sequential histone H2B ubiquitylation and deubiquitylation, mediated by SAGA-
associated pr8. Genes Dev. 17, 2648—2663.

Jenuwein, T., and Allis, CD. (2001). Translating the histone code. Science 293, 1074—
1080.

Johanson, U., West, J., Lister, C., Michaels, 8., Amasino, R., and Dean, C. (2000).
Molecular analysis of FRIGIDA, a major determinant of natural variation in
Arabidopsis flowering time. Science 290, 344-347.

Kohler, C., Hennig, L., Spillane, C., Pien, S., Gruissem, W., and Grossniklaus, U. (2003).
The Polycomb-group protein MEDEA regulates seed development by controlling
expression of the MADS-box gene PHERESI . Genes Dev. 17, 1540—1553.

Krogan, N.J., Kim, M., Ahn, S.H., Zhong, G., Kobor, M.S., Cagney, G., Emili, A.,
Shilatifard, A., Buratowski, S., and Greenblatt, JF. (2002). RNA polymerase II

elongation factors of Saccharomyces cerevisiae: A targeted proteomics approach.
Mol. Cell. Biol. 22, 6979—6992.

Lang, A. (1965). Physiology of flower initiation. In Encyclopedia of Plant Physiology,
W. Ruhland, ed (Berlin: Springer-Verlag), pp. 1380—1536.

Lee, 1., Bleecker, A., and Amasino, RM. (1993). Analysis of naturally occurring late
flowering in Arabidopsis thaliana. Mol. Gen. Genet. 237, 171—176.

Lee, TL, and Young, RA. (2000). Transcription of eukaryotic protein-coding genes.
Annu. Rev. Genet. 34, 77—137.

Levy, Y.Y., Mesnage, S., Mylne, J.S., Gendall, A.R., and Dean, C. (2002). Multiple roles
of Arabidopsis VRNI in vemalization and flowering time control. Science 297, 243—
246.

Lukowitz, W., Gillmor, CS, and Scheible, W.R. (2000). Positional cloning in
Arabidopsis. Plant Physiol. 123, 795—805.

Malek, S.N., Yang, C.H., Earnshaw, W.C., Kozak, C.A., and Desiderio, S. (1996).
pISOTSP, a conserved nuclear phosphoprotein that contains multiple tetratricopeptide
repeats and binds specifically to SH2 domains. J. Biol. Chem. 271, 6952—6962.

Michaels, SD, and Amasino, RM. (2001). Loss of FLOWERING LOCUS C activity
eliminates the late-flowering phenotype of FRIGIDA and autonomous pathway
mutations but not responsiveness to vemalization. Plant Cell 13, 93 5—941.

126

Michaels, S.D., He, Y., Scortecci, K.C., and Amasino, RM. (2003). Attenuation of
FLOWERING LOC US C activity as a mechanism for the evolution of summer-annual
flowering behavior in Arabidopsis. Proc. Natl. Acad. Sci. USA 100, 10102—10107.

Milne, T.A., Briggs, S.D., Brock, H.W., Martin, M.B., Gibbs, D., Allis, CD, and Hess,
J .L. (2002). MLL targets SET domain methyltransferase activity to Hox gene
promoters. Mol. Cell 10, 1107—1117.

Moehs, C.P., McElwain, ER, and Spiker, S. (1988). Chromosomal proteins of
Arabidopsis thaliana. Plant Mol. Biol. 11, 507—515.

Morillon, A., Karabetsou, N., O'Sullivan, J., Kent, N., Proudfoot, N., and Mellor, J.
(2003). Iswl chromatin remodeling ATPase coordinates transcription elongation and
termination by RNA polymerase 11. Cell 115, 425—435.

Mueller, C.L., and Jaehning, J.A. (2002). Ctr9, Rtfl, and Leol are components of the
Pafl [RNA polymerase II complex. Mol. Cell. Biol. 22, 1971—1980.

Mueller, C.L., Porter, S.E., Hoffman, M.G., and Jaehning, J.A. (2004). The Pafl complex
has functions independent of actively transcribing RNA polymerase 11. Mol. Cell 14,
447—456.

Ng, H.H., Dole, S., and Struhl, K. (2003a). The Rtfl component of the Pafl
transcriptional elongation complex is required for ubiquitination of histone HZB. .1.
Biol. Chem. 278, 33625—33628.

Ng, H.H., Robert, F., Young, R.A., and Struhl, K. (2003b). Targeted recruitment of Set]
histone methylase by elongating PolII provides a localized mark and memory of
recent transcriptional activity. Mol. Cell 11, 709—719.

Noh, Y.S., and Amasino, RM. (2003). PIE1, an ISWI family gene, is required for FLC
activation and floral repression in Arabidopsis. Plant Cell 15, 1671—1682.

Orphanides, G., and Reinberg, D. (2000). RNA polymerase II elongation through
chromatin. Nature 407, 471—475.

Pawson, T. (2004). Specificity in signal transduction: From phosphotyrosine-SH2 domain
interactions to complex cellular systems. Cell 116, 191—203.

Porter, S.E., Washbum, T.M., Chang, M., and Jaehning, J.A. (2002). The yeast Pafl-
RNA polymerase II complex is required for full expression of a subset of cell cycle-
regulated genes. Eukaryot. Cell 1, 830—842.

Ratcliffe, O.J., Kumimoto, R.W., Wong, B.J., and Riechmann, J.L. (2003). Analysis of
the Arabidopsis MADS AFFECTING FLOWERING gene family: MAFZ prevents
vemalization by short periods of cold. Plant Cell 15, 1159—1169.

Ratcliffe, O.J., Nadzan, G.C., Reuber, T.L., and Riechmann, J.L. (2001). Regulation of
flowering in Arabidopsis by an F LC homologue. Plant Physiol. 126, 122—132.

127

Sanda, S., and Amasino, RM. (1996). Interaction of FLC and late-flowering mutations in
Arabidopsis thaliana. Mol. Gen. Genet. 251, 69—74.

Santos-Rosa, H., Schneider, R., Bernstein, B.E., Karabetsou, N., Morillon, A., Weise, C.,
Schreiber, S.L., Mellor, J ., and Kouzarides, T. (2003). Methylation of histone H3 K4
mediates association of the Iswlp ATPase with chromatin. Mol. Cell 12, 1325—1332.

Scortecci, K.C., Michaels, SD, and Amasino, RM. (2001). Identification of a MADS-
box gene, FLOWERING LOC US M, that represses flowering. Plant J. 26, 229—236.

Scortecci, K., Michaels, SD, and Amasino, RM. (2003). Genetic interactions between

FLM and other flowering-time genes in Arabidopsis thaliana. Plant Mol. Biol. 52,
915—922.

Sheldon, C.C., Burn, J.E., Perez, P.P., Metzger, J., Edwards, J.A., Peacock, W.J., and
Dennis, ES. (1999). The FLF MADS box gene: A repressor of flowering in
Arabidopsis regulated by vemalization and methylation. Plant Cell 11, 445—458.

Simic, R., Lindstrom, D.L., Tran, H.G., Roinick, K.L., Costa, P.J., Johnson, A.D.,
Hartzog, G.A., and Amdt, KM. (2003). Chromatin remodeling protein Chdl interacts

with transcription elongation factors and localizes to transcribed genes. EMBO J. 22,
1846—1856.

Squazzo, S.L., Costa, P.J., Lindstrom, D.L., Kumer, K.E., Simic, R., Jennings, J .L., Link,
A.J., Arndt, K.M., and Hartzog, GA. (2002). The Pafl complex physically and

functionally associates with transcription elongation factors in vivo. EMBO J. 21,
1764—1774.

Sung, S., and Amasino, RM. (2004). Vemalization in Arabidopsis thaliana is mediated
by the PHD finger protein VIN3. Nature 427, 159—164.

Sunidge, C. (2004). Plant development: The flowers that bloom in the spring. Nature
427, 112.

Svejstrup, J O. (2004). The RNA Pol II transcription cycle: Cycling through chromatin.
Biochim. Biophys. Acta 1677, 64—73.

Tripoulas, N.A., Hersperger, E., LaJeunesse, D., and Sheam, A. (1994). Molecular

genetic analysis of the Drosophila melanogaster gene absent, small or homeotic
discsl (ashl). Genetics 137, 1027-1038.

van Nocker, S., and Ludwig, P. (2003). The WD-repeat protein superfamily in
Arabidopsis: Conservation and divergence in structure and function. BMC Genomics
4, 50.

Wood, A., Krogan, N.J., Dover, J., Schneider, J., Heidt, J., Boateng, M.A., Dean, K.,
Golshani, A., Zhang, Y., Greenblatt, J.F., Johnston, M., and Shilatifard, A. (2003a).

Brel, an E3 ubiquitin ligase required for recruitment and substrate selection of Rad6
at a promoter. Mol. Cell 11, 267—274.

128

Wood, A., Schneider, J., Dover, J ., Johnston, M., and Shilatifard, A. (2003b). The Pafl
complex is essential for histone monoubiquitination by the Rad6-Brel complex,

which signals for histone methylation by COMPASS and Dotl p. J. Biol. Chem. 278,
34739—34742.

Zhang, H., and van Nocker, S. (2002). The VERNALIZA T ION INDEPENDENCE 4 gene
encodes a novel regulator of FLOWERING LOC US C. Plant J. 31, 663—667.

Zhang, H., Ransom, C., Ludwig, P., and van Nocker, S. (2003). Genetic analysis of early
flowering mutants in Arabidopsis defines a class of pleiotropic developmental

regulator required for expression of the flowering-time switch F LOWERING LOC US
C. Genetics 164, 347—358.

129

CHAPTER IV

Global and Locus-Specific Roles for Arabidopsis PaflC Homologs in Transcription

and Chromatin Modifications

130

Abstract
RNA Polymerase II-Associated Factor 1 Complex (Pafl C) in budding yeast plays a key

role in reinforcing transcriptional activity by mediating the establishment and/or
maintenance of specific chromatin modifications, promoting elongation and linking Pol II
with elements of pre-mRNA processing machinery. This transcription factor is associated
with chromatin at all canonical transcriptional units yet investigated and therefore
probably plays a general transcriptional role. Although components of PaflC are
conserved in higher eukaryotes, their potential mechanism in transcription has not been
explored. In Arabidopsis, PaflC subunit homologs are encoded by the VERNALIZA TION
INDEPENDENCE (VIP) genes. We found that loss of VIP gene function affects a
substantial portion of the transcriptome, but strongly silences only a small subset of
genes, including the FLC/MAF family of MADS-domain flowering regulators. To better
understand the mechanism of VIP proteins in transcription, we characterized genome-
wide and locus-specific effects of loss of VIP3 on histone modifications, Pol 11
distribution, and phosphorylation of the carboxyl-terminal domain (CTD) of Pol II. We
analyzed methylation (Lys-4, Lys-36) and acetylation (Lys-9, Lys-14) sites on the
canonical and variant histone H3 proteins, and found that VIP3 does not play a
significant role in establishing these modifications when evaluated on a bulk-chromatin
level, but is important for establishing these modifications within a subset of VIP-
dependent genes. Loss of VIP3 resulted in a decrease of Pol II occupancy throughout
FLC chromatin, including the promoter regions, suggesting that the major influence on
FLC expression is effected through Pol II recruitment and/or transcriptional initiation.

Loss of VIP2, VIP3, VIP4, VIP5, or VIP6 gene function resulted in CTD

131

hyperphosphorylation, suggesting a significant role of VIP complex in regulating the

activity of the CTD.

Introduction

Precise control of transcription is crucial for growth and development in eukaryotes. The
formation of mRNA by RNA Polymerase 11 (Pol II) involves a complex, multistep
pathway wherein each step provides an opportunity for regulation (Shilatifard et al.,
2003). The primary phases of transcript generation form a so-called transcription cycle
and include preinitiation, initiation, promoter clearance, elongation, and termination. An
immense amount of research has been performed to identify and characterize
transcription factors that are involved in the regulation of the transcription cycle. Recent
evidence indicates that there is a dynamic interplay between the protein complexes that
carry out mRN A transcription, processing, and export, such that the efficiency of one step
can have significant consequences for other steps in the pathway. Thus, understanding the
mechanisms of transcriptional regulation requires the identification of both the direct and
indirect activities of the numerous factors implicated in RNA production.

The budding yeast Pafl complex (PaflC) containing at least five polypeptides
(Pafl, Ctr9, Cdc73, Rtfl, and Leol) was first identified as a Pol II-associated factor
(Wade et al., 1996). PaflC interacts with TATA-box binding protein (TBP) (Stolinski et
a1, 1997), elongation factors Spt4-5 and FACT (FAcilitates Chromatin Transcription)
(Squazzo et al., 2002) and can stimulate transcription elongation in vitro (Rondon et al.,
2004). PaflC has been shown to be present at both promoter and coding regions of
transcriptionally active genes (Pokholok et al., 2002). Thus, PaflC was initially thought

to be a factor involved in both Pol II-mediated transcription initiation and elongation.

132

Recent evidence has revealed that PaflC plays an important role in cotranscriptional
histone modification and mRNA 3’ end processing. PaflC assists in the ubiquitination of
histone H2B at lysine (K) 123 (H2B K123) in the promoter-proximal region of activated
genes (Ng et al., 2003; Wood et al., 2003). PaflC-dependent H2B ubiquitination is
required for subsequent methylation of histone H3 K4 and H3 K79, catalyzed by Set]
and Dotl, respectively (Ng et al., 2003). Cells lacking functional Rtfl show global
defects in di- and trimethylation of H3 K4 and dimethylation of H3 K79 (N g et al., 2003).
These histone modifications have most ofien been associated with actively transcribed
genes (Hampsey and Reinberg, 2003). Histone lysine methylation exists in the mono-, di-
, or trimethylated state and each distinct methylation might have unique biological
relevance. For example, in budding yeast, dimethylation of H3 K4 occurs on a genome-
wide scale, whereas trimethylation of H3 K4 strictly corresponds to actively transcribed
genes (Santos-Rosa et al., 2002). PaflC is also required for methylation of H3 K36 and
recruitment of yeast Set2 (a histone H3 K36 methylase) at specific loci (Krogan et al.,
2003). PaflC also assists in modification of the carboxyl-terminal domain (CTD) of Pol
II (Mueller et al., 2004). The CTD consists of multiple repeats of the amino acid
sequence YISZP3T4SSP6S7 and the phosphorylation state of serine (Ser) on the CTD is
important not only for proper initiation/elongation of transcription but also pre-mRNA
processing. Ser-S of CTD is phosphorylated by a cyclin-dependent kinase associated with
the general transcription machinery at the 5' region of the gene during initiation; when
Pol 11 travels toward the 3' end of the gene, Ser-2 of CTD becomes preferentially
phosphorylated (Cho et al., 2001). In yeast, dephosphorylation of Ser-5 or Ser-2 residues

within the CTD is catalyzed by Fcpl and Ssu72 (Sims et al., 2004). Loss of P4]? or Rtfl

133

 

 

gene function results in a reduction of Ser-2 phosphorylation of CTD of Pol II (Mueller et
al., 2004), but the mechanism of PaflC in modification of CTD is not known. Pre-mRNA
cleavage/polyadenylation specificity factor complex (CPSF) is recruited to elongating Pol
11 near the poly(A) site in a process that requires Ser-2 phosphorylation of CTD (Ahn et
al., 2004). Loss of Pafl or Rtfl gene function also causes alternative poly(A) site
utilization within PaflC target genes, and shortened poly(A) tails globally (Mueller etal.,
2004; Penheiter et al., 2005).

Homologous components of PaflC have been found in higher eukaryotes,
including plants, humans and fruit flies (Zhang and van Nocker, 2002; Oh et al., 2004;
Zhu et al., 2005; Adelman et al., 2006). In Arabidopsis, PaflC subunit homologs are
encoded by VERNALIZA TION INDEPENDENCE (VIP) genes; VIP2 (also known as
EARLY FLOWERING 7 (ELF 7) [He et al., 2004]), VIP4, VIP5, and VIP6 (also known
as ELF 8 [He et al., 2004]) are closely related to Pafl, Leol, Rtfl, and Ctr9 from yeast,
respectively (Zhang and van Nocker, 2002; Oh et al., 2004). VIP3 is homologous with
hSki8, a higher eukaryotic-specific subunit of human Pafl C. hSki8 is initially identified
as a component of the human Superkiller (SKI) complex, interacting with the exosome, a
protein complex required for 3’-5’ mRNA decay (Andrulis et al., 2002; Zhu et al., 2005).
VIP3 physically interacts with VIP4 and VIP6 in vivo, and abundance of VIP6 protein is
dependent on functional VIP3, VIP4, and VIP5, suggesting that these proteins comprise a
protein complex analogous to PaflC (Oh et al., 2004). VIP complex is required for
expression of only a restricted subset of genes, including the F LC/MAF family of MADS-
box floral repressors (Zhang and van Nocker, 2002; Zhang et al., 2003; Oh et al., 2004).

VIP complex from Arabidopsis may perform a conserved functions but in a different

134

 

 

biochemical mechanism. For example, in vip3, vip4, vip5, or vip6 mutants, there is no
discernible reduction in global abundance of di— or trimethylated H3 K4, or dimethylated
H3 K79 (Oh et al., 2004), although trimethylated H3 K4 at the 5’ region of FLC is
decreased in vip2 (elf7) or vip6 (elf8) mutants (our unpublished results; He et al., 2004).

Interestingly, unlike budding yeast, which does not carry variant H3 genes
(Ahmad and Henikoff, 2002), the genome of higher eukaryotes including Arabidopsis, fly
and human encodes for both canonical and variant H3 proteins (Waterborg, 1992; Hake
and Allis, 2006). Canonical H3 proteins (named H31 in plants) are the major class of
histones and their expression is coupled to the S-phase of the cell cycle, when histones
assemble with the newly replicated DNA to form a duplicate set of chromatin
(Schumperli, 1986). Variant H3 proteins (named H3.3 in humans and flies, H32 in
plants) are synthesized outside the S-phase throughout the cell cycle in a replication-
independent manner. (Schumperli, 1986; Waterborg, 1992; McKittrick et al., 2004). In
human and fly, chromatin associated with transcriptionally active loci becomes enriched
for H3.3 di-or trimethylated at K4 (McKittrick et al., 2004; Mito et al., 2005).

To investigate the role of Arabidopsis PaflC homologs in transcription, we first
questioned whether the function of VIP complex in establishment and/or maintaining
gene activity might be associated with modification of a subset of H3 histones,
specifically H3.2. To this end, we analyzed the consequence of loss of VIP3 function for
global modification of H32 and could not detect any difference in methylation or
acetylation levels of either H3.] or H3.2 between vip3 mutant and wild-type plants.
However we found that VIP3 is required for H3 K4 methylation of a subset of VIP-

dependent genes and H3 K36 methylation of FLC. To further elucidate the regulatory

135

role of PaflC for Pol II activity, we have measured the abundance of Pol 11 within the
FLC gene, and the phosphorylation of Pol II in vip3 mutants. We found that loss of VIP3
function resulted in a decrease of Pol II occupancy throughout FLC chromatin and
overall increase of Ser-2 and Ser-5 phosphorylation of CTD of Pol 11, suggesting an

important role for VIP proteins in recruitment/retention and modification of Pol 11.

Materials and Methods
Plant Materials

The flc-3 null mutant, winter annual FRI-introgressed line ColeRISFZ, vip mutants, and
transgenic line expressing F LAG-epitope-tagged VIP3 protein were previously described
(Zhang et al., 2003). Transgenic line expressing FLAG-epitope-tagged VIP3 protein was
as described previously (Zhang et al., 2003; Oh et al., 2004). Plant growth conditions and

vemalizing cold treatments were previously described (Zhang and van Nocker, 2002).

Isolation of histones

Histone-enriched extracts were prepared as described by Waterborg et a1. (1987) from
floral tissues. Briefly, total proteins were extracted from 1 g of liquid Nz-ground tissues
using 2 ml of Lysis Buffer [40% w/v guanidine hydrochloride (GuCl), 10 mM phosphate
buffer (pH 8.0 at 22 °C), 1 mM phenylmethylsulfonyl fluoride (PMSF), and 1 ug/ml
Pepstatin A (Sigma)]. Cell lysates were incubated with 100 mg of cation exchange resin
(BioRex —70; Bio-Rad, Hercules, CA) per 1 g of plant samples at room temperature
overnight. Resin was washed five times with 1 ml ice-cold washing buffer (5% GuCl in
10 mM phosphate buffer, pH 8.0 at 22 °C), and subjected to elution with Lysis Buffer.

See note on Appendix A.

136

Antibodies

The anti-VIP3 and -VIP6 antisera were as described previously (Zhang et al., 2003; Oh et
al., 2004). Anti-FLAG M2 monoclonal antibody was obtained from Sigma (St. Louis,
MO, catalog no. F-3165); Anti-H3 antibodies including anti-di-M-K4 (catalog no. 07-
030), anti-di-M-K36 (catalog no. 07-369), anti-Ac-K9/14 (catalog no. 06-599), and anti-
H3-CT (catalog no. 06-866) were obtained from Upstate (Lake Placid, NY); Anti-H3 tri-
M-K4 antibody was obtained from Abcam (Cambridge, MA). The 8WGl6 antibody
recognizing non-phosphorylated CTD of Pol II , H5 antibody recognizing Ser-2
phosphorylated CTD of Pol II, and H14 antibody recognizing Ser-5 phosphorylated CTD

of Pol II were obtained from Covance (Denver, PA).

Coimmunoprecipitation

Proteins were extracted from floral tissues using a protocol described previously (Zhang
et al., 2003). As a result, approximately 500 pg of protein was obtained in 500 pl of
Extraction Buffer (50 mM Tris-HCl [pH 8.0 at 22 °C], 150 mM NaCl, 1 mM EDTA,
0.2% Triton X-100, containing 1 mM PMSF and phosphatase inhibitors [10 mM sodium
fluoride, 5 mM sodium phosphate, and 1% phosphatase inhibitor cocktail 1; Sigma]). The
extract was incubated with 1 ug/ml of anti-FLAG antibody, and mixed continuously for 2
h. Protein A-agarose beads (30 ul; Roche Biochemical, Indianapolis, IN) were then

added, and the mixture was incubated for a further 1 h. Protein A-agarose beads were
collected by centrifugation and washed five times consecutively with 1 ml ice-cold

washing buffer (Extraction Buffer lacking Triton X—IOO). Afier the final wash, the beads

137

were resuspended in 50 ul of SDS-PAGE sample buffer and boiled. All procedures

described here were carried out at 4 °C.

Electrophoresis and Immunoblotting

Proteins were resolved on SDS-polyacrylamide gels or acetic acid/urea/triton X-100
(AUT)-polyacrylamide gels as described in Harlow and Lane (1988) and Bonner et al.
(1988), respectively, and transferred to nitrocellulose membranes (Amersham
Biosciences, Piscataway, NJ) for immunoanalysis. The membranes were incubated with
phosphate-buffered saline (PBS) containing 3 % (w/v) non-fat dried milk at room
temperature for 1 h to block non-specific binding. The membranes were then incubated
with the same solution containing the primary antibody at room temperature for 2 h.
Membranes were then washed three times for 5 min each with PBS containing 0.05 %
(v/v) Tween 20, and then incubated with secondary antibody in the same buffer. Primary
antibodies were used at the following dilutions: 1:3000 for anti-di-M-K4, anti-di-M-K36,
and anti-tri-M-K4, 1:25000 for anti-H3-CT, 1:1000 for 8WG16, H5, and H14.
Horseradish peroxidase-conjugated (HRP) anti-rabbit IgG (Bio-Rad) or HRP-anti-mouse
IgG (KPL, Gaithersburg, MD) was used as a secondary antibody. Proteins were detected
using an ECL reagent kit from Amersham. For quantification, the density of each protein

band was measured with image analyzing software NIH Image Version 1.63 f.

Chromatin lmmunoprecipitation (ChIP)

ChIP was modified from the method of Bowler et al. (2004). Two grams of aerial tissues

from 14-d-old soil-grown plants were used. lmmunoprecipitation employed 3 ul of

I38

primary antibody and 60 ul of protein-A agarose beads (Roche Biochemical). Each
immunoprecipitation was replicated using biologically independent samples. Primer
sequences were listed in Appendix B. The AC TIN 7 primers were as described in Johnson
et al. (2002). PCR conditions were as follows: 94 0C for 5 min, 33-35 cycles (94 °C for
30 sec, 56 °C for 30 sec, and 72 °C for 45 sec), and 72 °C for 5 min. Aliquots of the PCR
reactions were resolved by electrophoresis in 1.5 % agarose gels. The intensities of PCR
bands were quantified with an Eagle Eye 11 Still Video System (Stratagene, Cedar Creek,

TX). See note on Appendix C.

Results

VIP3 is not required for global modification of either canonical or variant histone
H3

We previously showed that at least VIP3, VIP4, VIP5, and VIP6 are not essential for
histone modification when analyzed in bulk chromatin on a whole plant level (Oh et al.,
2004). To test whether the function of the VIP complex in establishment and/or
maintaining gene activity might be associated with modification of variant H3, we
analyzed the consequence of loss of VIP3 function for global modification of variant H3.
H3 isoforms (canonical H3, referred to as H3.l, and variant histone H3, referred to as
H3.2) were separated by acetic acid/urea/triton X-lOO-polyacrylamide gel electrophoresis
and analyzed for the presence of specific methylation and acetylation (Figure 4-1). We
found that H3.2, relative to H3.], was more strongly methylated at K36 (~70 fold) and
K4 (~2 fold), and more strongly acetylated at K9/14 (~2 fold), which is consistent with
previous observations in Arabidopsis and fly (Johnson et al., 2004; McKittrick et al.,

2004).

139

However, we could not detect any difference in methylation or acetylation levels of either
H3.] or H3.2 between the vip3 mutants and wild-type plants, suggesting that at least
VIP3 does not play a significant role in establishing these modifications when evaluated

on a whole-chromatin level.

VIP3 is required for H3 methylation in a locus-specific manner

Previously, He et al. (2004) showed that VIP2 (ELF7) and VIP6 (ELF8) are required for
the trimethylation of H3 K4 within FLC chromatin. We questioned whether the
requirement for VIP proteins for methylation of histone H3 is locus-specific, since VIP
regulates only a subset of genes, including FLC (Oh et al., 2004). First, we selected three
potential VIP target genes (FLC, AtIg3I690 encoding a potential amine oxidase: AMINE
OXIDASE, AtIg14580 encoding a protein with a zinc finger: ZINC-FINGER PROTEIN),
which were found to be downregulated in both the vip5 and vip6 mutants (Table 4-1).
Then, we investigated the methylation state of H3 K4 or K36 within chromatin of these
genes, using ChIP analysis. Relative to wild-type plants, vip3 mutants showed decreased
level of trimethylation of H3 K4 (H3 tri-M-K4) throughout FLC chromatin, which is
consistent with previous observations in vip2 (elf7) or vip6 (cl/8) mutants (He et al.,
2004). We found that VIP3 is also required for dimethylation of H3 K36 (H3 di-M-K36)
on F LC chromatin; the loss of methylation was most pronounced in the first intron region
(Figure 4-2 A). In wild-type plants that had been vemalized (i.e. FLC is silenced), we
observed that FLC chromatin was hypomethylated relative to non-vemalized wild-type

plants at H3 K4 as reported (Sung and Amasino, 2004) and also at H3 K36 (Figure 4-2).

140

WT vip3
:1 H . H3.1

 

 

 

 

di'M'K4 M
. {3 H32
. L3 1 D H3.1
tri-M-K4 :
‘ u ‘0 H3. 2
as. A H3. 1
di-M-K36 _
f. g. = an
i A’ H3 1
Ac-K9I14 -
.3. at Q H3. 2
Total H3
Coomassie blue .._. ......

Figure 4-1. VIP3 is not required for global modification of either canonical or
variant histone H3.

Histones were resolved by acetic acid/urea/triton X-lOO (AUT)-polyacrylamide gel
electrophoresis and immunoblotted using antibodies specific for histone H3 dimethylated
at Lys-4 (di-M-K4), trimethylated at Lys-4 (tri-M-K4), dimethylated at Lys-36 (di-M-
K36), acetylated at Lys-9/14 (Ac-K9/Kl4), or the carboxyl terminus of H3 (Total H3). A
Coomassie blue-stained AUT-gel was shown to indicate the relative quantity of protein in
each lane.

141

Table 4-1. Partial list of genes down-regulated in both the vip5 and vip6 mutants,

relative to WT plants

VIP target genes were identified by transcriptional profiling of vip mutants using the
Affymetrix ATH] gene chip, which represents about 23,000 transcriptional units (Oh et

 

 

 

aL,2004)
Log ratio '
AGI No. vip5/WT vip6/WT Annotations
At 1 g73330 -2.5 -2.6 Protease inhibitor
Atlg3 1690 -1.8 -1.7 Copper amine oxidase
At5g54l90 -l .7 -2.0 Protochlorophyllide oxidoreductase A
At5g44420 -3.3 -3.2 Antifungal protein-like protein
At5 g3 8000 -2.3 -2.7 Oxidoreductase-like protein
At5g23020 -l .8 -1.9 2-isopropylmalate synthase-like protein
At5g10140 -3.9 -3.2 MADS domain protein (FLC)
At5g04950 -1.9 -2.0 Nicotianamine synthase
At4g24540 -l .7 -l .8 MADS-box protein AGL24
At4g21650 -2.0 -2.0 Subtilisin proteinase-like protein
At3g23470 —3.9 -5.5 Cyclopropane phospholipid synthase
At3 g1 6530 -4.2 -3 .5 Putative lectin
At2g26020 -4.0 -4.1 Putative antifungal protein
At3g04270 -2.4 -2.2 PR-4
At1g14580 -2.5 -2.2 Zinc-finger protein
Atl g75930 -3.9 -3.9 Amber-specific proline-rich protein
At1g04l60 -2.0 -2.4 Myosin heavy chain MYA2
At2g05510 -2.5 —4.2 Putative glycine-rich protein
At2g39330 -2.3 -2.0 Putative myrosinase-binding protein

 

' Mean value for four vip/WT comparisons.

142

Those observations show that VIP3 activity is required for H3 K4 trimethylation and H3
K36 dimethylation of FLC chromatin, and that these histone modifications may be
associated with F LC transcriptional activity.

For Atlg31690, vip3 mutants showed decreased H3 tri-M-K4 relative to wild-type
plants within a promoter region and exonic region (Figure 4-2 C). Although At1g14580
was silenced in vip mutants, the level of H3 tri-M-K4 was similar between vip3 mutants
and wild-type plants, suggesting that the Atlg14580 may not be a direct target of VIP3
(Figure 4-2 D) or that VIP3 participates in regulation of AtIg14580 by a mechanism that
does not involve histone H3 tri-M-K4. ACTIN 7, which is expressed to wild-type levels in
vip mutants (Zhang et al., 2003) did not show decreased levels of H3 tri-M-K4 relative to
wild-type plants (Figure 4-2 E). Those observations suggest that VIP3 is required for

histone H3 methylation in a locus-specific manner.

Mutation of VIP3 is associated with a reduction of Pol II on FLC chromatin

PaflC is physically associated with Pol II (Wade et al., 1996). To determine whether the
VIP complex is required for recruitment of Pol II at specific loci, we examined the effect
of vip3 mutations on Pol II occupancy within FLC chromatin. Using ChIP analysis with
antibodies directed against non-phosphorylated CTD of Pol II (8WG16), we observed
that Pol II occupancy throughout FLC chromatin, including the promoter regions was
reduced dramatically in the vip3 mutants. Vemalized wild-type plants also showed the
reduced level of Pol II occupancy compared to non-vemalized wild-type plants (Figure 4-
2 B). Since vemalizing cold treatment or loss of VIP genes function results in

transcriptional silencing of FLC, VIP complex may assist the recruitment of Pol II for

143

 

 

A A5910,“ (FLC) _= 1 Kb
1:] 1:1 -

1 2 3 4 5

N

 

dl-M-K36 tri-M-K4
Fold Change Fold Change
9 .-‘ .N P P .-‘
O N!
E E
E N E N

 

 

 

 

 

 

 

 

 

 

wvaanvvaa

B ‘1 1 2 5 7
JMJ ilrii rm

NV V vip3 NV V vip3 NV V vlp3 NV V vip3

 

Pol II occupancy

 

 

 

Figure 4-2. VIP3 is required for histone H3 methylation in a locus-specific manner.
Loss of VIP3 gene function resulted in reduction of trimethylation of H3 K4 (H3 tri-M-
K4) (A), dimethylation of H3 K36 (A), and Pol II occupancy (B) at FLC. Loss of VIP3
gene function reduced H3 tri-M-K4 at Atlg31690 (C). Loss of VIP3 gene function did
not result in reduction of H3 tri-M-K4 at At1g14580 (D) or ACTIN7 (E). Schematic
structures of target genes were shown. An arrow indicated the annotated transcription
start site. Numbered segments represented the regions examined by ChIP. Formaldehyde
cross-linked extracts from 14-d-old non-vemalized WT (NV), vemalized WT (V), or vip3
mutants were used. ChIP analysis was performed using antibodies directed against H3 tri-
M-K4, H3 di-M-K36, or non-phosphorylated CTD of Pol II (8WG16). In panels A, B, C,
and D, ChIP signals for each gene were normalized based on those of ACT IN 7. In panel
E, the level of methylation for each sample was relative to input DNA. The level of
histone methylation or Pol II occupancy of V or vip3 was shown as fold changes relative
to that of NV (the ChIP signals in NV were arbitrarily set at l).

144

Amine oxidase

 

 

 

 

 

 

 

    

C E Augarsso =o.5 Kb "2 1 2
— E‘ o
1 2 g
N
5 0.6
2
12
0.0
NV v vip3 NV v v1p3
D ZInc-fingerprotein
E At1914580 = 05 Kb 15;
1 2 81 ;
5
6 0.8
2
o
u.

 

 

r——r_-

_ o
1 or 0.8

c

a

.c

U
E 0.4

0

LL
0.0

 

NV v vip3

Figure 4-2 (cont’d). VIP3 is required for histone H3 methylation in a locus-specific

manner.

 

activation of F LC . In addition, a major influence of VIP complex on F LC expression may
be through transcriptional initiation.

To further elucidate whether VIP3 is required for recruitment/retention of Pol 11,
potential interactions between Pol II and the VIP complex were examined. To this end,
co-immunoprecipitation analysis was performed on protein extracts from plants
expressing FLAG-epitope-tagged VIP3 with anti-FLAG antibody (Oh et al., 2004). The
immunoprecipitates were probed for the presence of non-phosphorylated and Ser-2
phosphorylated CTD of Pol 11. Whereas VIP3 and VIP6 proteins were easily detectable in
the immunoprecipitates, we could not detect Pol II (Figure 4-3). We also were unable to
detect VIP3 (or VIP6) in immunoprecipitations that employed antibodies against non-
phosphorylated CTD of Pol II (data not shown). These observations suggest that VIP3
may not interact physically with Pol 11, although it is possible that Pol II is associated
with other components of VIP complex or that interaction between Pol II and the VIP

proteins may not be stable under the precipitation conditions used in this experiment.

VIP genes are required for modification of CTD of Pol II

CTD phosphorylation is important for multiple steps in the regulation of transcription
including mRNA 3’ end processing and termination (Komamitsky et al., 2000). We
tested if VIP3 is involved in modification of CTD of Pol II by evaluating the level of
CTD phosphorylation in vip3 mutants (Figure 4-4). Total proteins from floral tissues
were analyzed using 8WG16 (recognizing non-phosphorylated CTD), H5 (recognizing
Ser-2 phosphorylated CTD) or H14 (recognizing Ser—5 phosphorylated CTD) antibodies.

All antibodies reacted strongly with a single species of the predicted molecular mass

146

 

 

Co-IP fractions Non-bound fractions
Input anti-FLAG mock anti-FLAG mock
WT TAP WT TAP TAP WT TAP TAP

an I' ’ in 37 kD

 

 

 

 

 

 

 

 

 

 

8WG16 3...; .3.-- .. ”14220110
H5 220 kD
anti-VIP6 au- ,_......... M Juso kD

 

 

Figure 4-3. VIP-FLAG proteins do not appear to coprecipitate with Pol II.

Total proteins from floral tissues from vip3 plants expressing FLAG-tagged VIP3 (TAP)
as described in the text were subjected to immunoprecipitation with anti-F LAG antibody.
The immunoprecipitates were subjected to western blot analysis using anti-VIP3, anti-
VIP6, 8WG16 (recognizing non-phosphorylated CTD of Pol II) or H5 (recognizing Ser-
2- phosphorylated CTD of Pol II) antisera as indicated at lefi. No immunoreactive protein
was detected when immunoprecipitations were performed in the absence of anti-F LAG
antibody (mock). Non-bound fractions were analyzed to show efficiency of
immunoprecipitation. Arrowheads to the right indicated the molecular mass of
immunoreactive proteins.

147

Figure 4-4. VIP genes are required for modification of the CTD of Pol II.

(A) Protein extracts from floral tissues were resolved by SDS-PAGE and subjected to
immunoblotting using antibodies for non-phosphorylated CTD of Pol II (8WG16), Ser—2
phosphorylated CTD of Pol 11 (H5), Set-5 phosphorylated CTD of Pol II (H14) or the
carboxyl terminus of H3 (H3-CT) as an internal control. (B) Quantification of western
blots from (A). Band intensity of H3-CT in each genotype was set to 1, and signal
intensity for 8WG16, H5, or H14 relative to that of H3-CT for each genotype was shown.
The hyperphosphorylated pattern observed in vip3 or vip6 mutants was reproducible
when the experiment was repeated using biologically independent plant materials.

148

wr vip2 vip3 vip4 vip5 vip6
8WG16 """" W “I'- 9” mm

 

 

2.0

8WG16

 

2.!)

H5

 

3.0

H14

2.0

 

 

 

o.o
WT vip2 vr'p3 vip4 Vip5 vip6

Figure 4-4

149

(~220 kDa), which is consistent with previous observations in Arabidopsis (Koiwa et al.,
2004). We found that Ser-2 and Ser-5 of CTD of Pol II is significantly
hyperphosphorylated in vip3 mutants (~2.2—3 fold) and vip6 mutants (~2 fold) relative to
wild-type. We detected moderate increase (< 1.3 fold) of non-phosphorylated CTD of Pol
II in vip mutants relative to wild-type (Figure 4-4). Although Set-2 and Ser-S
hyperphosphorylation was observed in all five vip mutants, it was most obvious in vip3
and vip6 mutants. These observations suggest the necessary role of VIP complex in

regulating the activity of the CTD.

Discussion

To better understand the mechanism of VIP proteins in transcription, we characterized
genome-wide and locus-specific effects of loss of VIP proteins on histone modifications,
Pol 11 distribution, and CTD phosphorylation. We found that VIP3 is required for H3 K4
trimethylation and H3 K36 dimethylation in a locus-specific manner. However, unlike
yeast (Ng et al., 2003), Arabidopsis vip3 mutants did not exhibit a global defect of
methylation (Lys-4, Lys-36) or acetylation (Lys-9, Lys-14) of either canonical or variant
histone H3 protein, indicating that the VIP complex from Arabidopsis may perform a
conserved functions but in a different biochemical mechanism. Loss of function of VIP3
gene resulted in a decrease of Pol II occupancy throughout FLC chromatin, including the
promoter regions, suggesting that the major influence on FLC expression is effected
through Pol II recruitment and/or transcriptional initiation rather than elongation or pre-
mRNA processing. We observed that loss of function of VIP2, VIP3, VIP4, VIP5 or VIP6

gene resulted in global increase of Ser—2 and Ser-5 phosphorylation of CTD of Pol II.

150

CTD phosphorylation and dephosphorylation are crucial for the progression of the
transcriptional cycle as they regulate the association of Pol II with the pre-initiation
complex and the factors responsible for elongation and pre-mRNA processing. It is
tempting to speculate that VIP complex is required for CTD mediated Pol II activity

through interaction with the CTD phosphatase(s).

151

References

Adelman, K., Wei, W., Ardehali, M.B., Werner, J., Zhu, B., Reinberg, D., and Lis, J.T.
(2006). Drosophila Pafl modulates chromatin structure at actively transcribed genes.
Mol. Cell Biol. 26:250-260.

Ahmad, K., and Henikoff, S. (2002). Histone H3 variants specify modes of chromatin
assembly. Proc. Natl. Acad. Sci. U S A 99: 16477-16484.

Ahn, SH, Kim, M., and Buratowski, S. (2004). Phosphorylation of serine 2 within the
RNA polymerase II C-terminal domain couples transcription and 3’ end processing.
Mol. Cell 13; 67—76.

Andrulis, B.D., Werner, J ., Nazarian, A., Erdjument-Bromage, H., Tempst, P., and Lis,
J .T. (2002). The RNA processing exosome is linked to elongating RNA polymerase II
in Drosophila. Nature 420: 837—841 .

Bonner, W.M., Wu, R.S., Panusz, HT, and Muneses, C. (1988). Kinetics of
acetunulation and depletion of soluble newly synthesized histone in the reciprocal
regulation of histone and DNA synthesis. Biochemistry 27:6542—6550.

Bowler, C., Benvenuto, G., Laflamme, P., Molino, D., Probst, A.V., Tariq, M., and
Paszkowski, J. (2004). Chromatin techniques for plant cells. Plant J. 39:776-789.

Cho, E.J., Kobor, M.S., Kim, M., Greenblatt, J., and Buratowski, S. (2001). Opposing
effects of Ctkl kinase and Fcpl phosphatase at Ser 2 of the RNA polymerase II C-
terminal domain. Genes Dev. 15:3319—3329.

Hake, SB, and Allis, CD. (2006). Histone H3 variants and their potential role in
indexing mammalian genomes: The "H3 barcode hypothesis". Proc. Natl. Acad. Sci.
U S A 103:6428-6435.

Hampsey, M., and Reinberg, D. (2003). Tails of intrigue: phosphorylation of RNA
polymerase II mediates histone methylation. Cell 113:429-432.

Harlow, B., and Lane, D. (1988). Antibodies: A Laboratory Manual (Cold Spring Harbor,
NY: Cold Spring Harbor Laboratory Press).

He, Y., Doyle, M.R., and Amasino, RM. (2004). PAFl-complex-mediated histone
methylation of FLOWERING LOCUS C chromatin is required for the vemalization-
responsive, winter-annual habit in Arabidopsis. Genes Dev. 18:2774-2784.

Johnson, L., Cao, X., and Jacobsen, S. (2002). Interplay between two epigenetic marks.
DNA methylation and histone H3 lysine 9 methylation. Curr. Biol. 12: 1360-1367.

Johnson, L., Mollah, S., Garcia, B.A., Muratore, T.L., Shabanowitz, J., Hunt, DR, and
Jacobsen, SE. (2004). Mass spectrometry analysis of Arabidopsis histone H3 reveals

distinct combinations of post-translational modifications. Nucleic Acids Res.
32:6511-6518.

152

Koiwa, H., Hausmann, S., Bang, W.Y., Ueda, A., Kondo, N., Hiraguri, A., Fukuhara, T.,
Bahk, J.D., Yun, D.J., Bressan, R.A., Hasegawa, P.M., and Shuman, S. (2004).

Arabidopsis C-terrninal domain phosphatase-like l and 2 are essential Ser-5-specific
C-terrninal domain phosphatases. Proc. Natl. Acad. Sci. U S A 101:14539-14544.

Komarnitsky, P., Cho, E.J., and Buratowski, S. (2000). Different phosphorylated forms of
RNA polymerase II and associated mRNA processing factors during transcription.
Genes Dev. 14: 2452—2460.

Krogan, N.J., Kim, M., Tong, A., Golshani, A., Cagney, G., Canadien, V., Richards,
D.P., Beattie, B.K., Emili, A., Boone, C., Shilatifard, A., Buratowski, S., and
Greenblatt, J. (2003). Methylation of histone H3 by Set2 in Saccharomyces cerevisiae
is linked to transcriptional elongation by RNA polymerase II. Mol. Cell Biol.
23 :4207-42 1 8.

McKittrick, E., Gafl(en, P.R., Ahmad, K., and Henikoff, S. (2004). Histone H3.3 is
enriched in covalent modifications associated with active chromatin. Proc. Natl.
Acad. Sci. U S A 101:1525-1530.

Mito, Y., Henikoff, J.G., and Henikoff, S. (2005). Genome-scale profiling of histone
H3.3 replacement patterns. Nat. Genet. 37: 1090-1097.

Mueller, C.L., Porter, S.E., Hoffman, M.G., and Jaehning, J .A. (2004). The Pafl complex
has functions independent of actively transcribing RNA polymerase II. Mol. Cell
14:447-456.

Ng, H.H., Dole, S., and Struhl, K. (2003). The Rtfl component of the Pafl transcriptional
elongation complex is required for ubiquitination of histone HZB. J. Biol. Chem.
278:33625-33628.

Oh, S., Zhang, H., Ludwig, P., and van Nocker, S. (2004). A mechanism related to the
yeast transcriptional regulator PaflC is required for expression of the Arabidopsis
FLC/MAF MADS-box gene family. Plant Cell 16: 2940-2953.

Penheiter, K.L., Washbum, T.M., Porter, S.E., Hoffinan, M.G., and Jaehning, J.A.
(2005). A posttranscriptional role for the yeast Pafl -RNA polymerase II complex is
revealed by identification of primary targets. Mol. Cell. 20:213-223.

Pokholok, D.K., Hannett, N.M., and Young, RA. (2002). Exchange of RNA polymerase
II initiation and elongation factors during gene expression in viva. Mol. Cell 9:799-
809.

Rondon, A.G., Gallardo, M., Garcia-Rubio, M., and Aguilera, A. (2004). Molecular

evidence indicating that the yeast PAF complex is required for transcription
elongation. EMBO Rep. 5:47-53.

153

Santos-Rosa, H., Schneider, R., Bannister, A.J., Sherriff, J., Bernstein, B.E., Emre, N.C.,
Schreiber, S.L., Mellor, J ., and Kouzarides, T. (2002). Active genes are tri-methylated
at K4 of histone H3. Nature 419:407-411.

Schumperli, D. (1986). Cell-cycle regulation of histone gene expression. Cell 45:471-
472.

Shilatifard, A., Conaway, RC, and Conaway, J.W. (2003). The RNA polymerase II
elongation complex. Annu. Rev. Biochem. 72:693-715.

Sims, R.J., Belotserkovskaya, R., and Reinberg, D. (2004). Elongation by RNA
polymerase II: the short and long of it. Genes Dev. 18:2437-2468.

Squazzo, S.L., Costa, P.J., Lindstrom, D.L., Kumer, K.E., Simic, R., Jennings, J .L., Link,
A.J., Arndt, K.M., and Hartzog, GA. (2002). The Pafl complex physically and

functionally associates with transcription elongation factors in viva. EMBO J.
21:1764-1774.

Stolinski, L.A., Eisenmann, D.M., and Amdt, KM. (1997). Identification of RTFI, a
novel gene important for TATA site selection by TATA-box binding protein in
Saccharomyces cerevisie. Mol. Cell. Biol. 17:4490-4500.

Sung, S., and Amasino, RM. (2004). Vemalization in Arabidopsis thaliana is mediated
by the PHD finger protein VIN3. Nature 427: 159-164.

Wade, P.A., Werel, W., Fentzke, R.C., Thompson, N.E., Leykam, J.F., Burgess, R.R.,
Jaehning, J.A., and Burton, Z.F. (1996). A novel collection of accessory factors
associated with yeast RNA polymerase 11. Protein Expr. Purif. 8: 85—90.

Waterborg, J .H. (1992). Existence of two histone H3 variants in dicotyledonous plants

and correlation between their acetylation and plant genome size. Plant Mol. Biol. 18:
181—187.

Waterborg, J.H., Winicov, I., and Harrington, RE. (1987). Histone variants and

acetylated species from the alfalfa plant Medicago sativa. Arch. Biochem. Biophys.
256:167-178.

Wood, A., Schneider, J., Dover, J., Johnston, M., and Shilatifard, A. (2003). The Pafl
complex is essential for histone monoubiquitination by the Rad6-Brel complex,
which signals for histone methylation by COMPASS and Dotlp. J. Biol. Chem.
278:34739-34742.

Zhang, H., and van Nocker, S. (2002). The VERNALIZA TION INDEPENDENCE4 gene
encodes a novel regulator of FLOWERING LOC US C. Plant J. 31: 663-673.

Zhang, H., Ransom, C., Ludwig, P., and van Nocker, S. (2003). Genetic analysis of early-
flowering mutants in Arabidopsis defines a class of pleiotropic developmental

154

regulator required for activity of the flowering-time switch FLOWERING LOC US C.
Genetics 164: 347-358.

Zhu, B., Manda], S.S., Pham, A.D., Zheng, Y., Erdjument-Bromage, H., Batra, S.K.,
Tempst, P., and Reinberg, D. (2005). The human PAF complex coordinates
transcription with events downstream of RNA synthesis. Genes Dev. 19:1668-1673.

155

CHAPTER V

Perspectives and Future Directions

156

VIP complex is required for histone H3 methylation in a locus-specific manner

We found that VIP3 is required for H3 methylation in a locus-specific manner. As shown
in the ChIP analysis, trimethylation of H3 K4 within FLC and Atlg31690 was reduced in
vip3 mutants. However, unlike yeast (N g et al., 2003), Arabidopsis vip mutants did not
exhibit a global defect in the trimethylation of H3 K4, indicating that the VIP complex
from Arabidopsis may perform a conserved functions but in a different biochemical
mechanism. In human or fruit fly, loss of function of Ctr9 or Pafl-related genes causes
loss of trimethylation of H3 K4 when assayed using single cell lines (Zhu et al., 2005;
Adelman et al., 2006), suggesting that the locus-specific role of VIP complex for
trimethylation of histone H3 K4 could be specific to plants. Molecular cloning of several
other VIP-like loci identified by our group (Zhang et al., 2003) would provide an insight
into the functional divergence of VIP complex.

Besides trimethylation of H3 K4, the reduced level of dimethylation of H3 K36
within FLC chromatin in vip3 mutants suggests that, similar to Pafl C, VIP3 may be
required for recruitment of a H3 K36 dimethylating activity to F LC. Arabidopsis EARLY
F LOWERING IN SHORT DAYS (EF S), homologous to yeast Set2 is required for FLC
activation, and loss of function of EFS gene results in globally reduced levels of H3 K36
dimethylation (Zhao et al., 2005), suggesting that EFS is a plausible candidate for H3
K36 dimethylation activity. Thus, we speculate that VIP complex may assist in the
recruitment of EFS at particular genes to maintain or reinforcing the transcriptional

activity through a mechanism related to dimethylation of H3 K36.

157

VIP3 may be a higher eukaryote-specific component of PaflC
Human PaflC shares five subunits with yeast PaflC and additionally contains a WD-

repeat protein, hSki8 (Zhu et al., 2005). WD-repeat proteins are common constituents of
large chromatin-associated complexes (van Nocker and Ludwig, 2003), and our
phylogenetic analysis (data not shown) revealed that VIP3 is the closest Arabidopsis
WD-repeat protein to hSki8 (35% identity with 2e-2 E-value at amino acid level). hSki8
is also a component of the human SKI complex, interacting with the exosome, which is
required for 3’-5’ mRNA decay (Araki et al., 2001; Andrulis et al., 2002). The exosome
in eukaryotes is known to serve as an RNA surveillance mechanism, which ensures high
fidelity of gene expression by degrading aberrantly processed mRNAs. For example,
alternative splicing requires RNA surveillance to ensure high fidelity of gene expression
in higher eukaryotes. Higher eukaryotes developed the process of alternative splicing to
generate multiple mRNAs from one gene; 45% of human genes or 22% of Arabidopsis
genes are suggested to be alternatively spliced (Gupta et al., 2004; Wang and Brendel,
2006). However alternative splicing appears to be rare or non-existent in budding yeast
because of the rare number of introns (i.e. budding yeast has introns in only ~3% of its
genes) (Ast, 2004). Since hSki8 and exosome co-localize to transcriptionally active genes
in a human Pafl C-dependent manner (Mitchell and Tollervey, 2003; Zhu et al., 2005), it
is tempting to speculate that VIP3 coordinates surveillance of RNA quality required for
alternative splicing. Northern blot analysis of genes misregulated in vip mutants relative
to wild-type plants or comparison of cDNA and genomic DNA from these genes may be
a plausible approach to test if VIP complex is involved in alternative splicing. In addition,

ChlP-on-chip analysis (combining conventional ChIP and microarray analysis) could be

158

performed to determine whether the VIP proteins participate directly in the regulation of

these genes through alternative splicing.

VIP complex is required for Ser-2 and Ser-S phosphorylation of CTD of Pol II
CTD phosphorylation and dephosphorylation are crucial for the progression of the

transcriptional cycle as they regulate the association of Pol II with the pre-initiation
complex and the factors responsible for elongation, pre-mRNA 5’ capping, splicing, and
3’-end processing (Proudfoot et al., 2002; Sims et al., 2004). CTD phosphorylation
during transcription is coordinated by various kinases (Kin28, Ctkl, Burl, and SrblO/ 11
in budding yeast; p-TEFb in fruit fly), and phosphatases (Fcpl and Ssu72 in budding
yeast) (Ganem et al., 2003). The phosphorylation cycle of the CTD of Pol 11 mainly
studied in yeast has been summarized (Sims et al., 2004; see Figure 5-1). The observation
that loss of function of VIP genes was associated with global increase of Ser-2 and Ser-5
phosphorylation of CTD of Pol 11 suggests a requirement for the VIP complex to regulate
modification of CTD. One possibility is that loss of function of VIP genes causes
misregulation of genes encoding cyclin-dependent kinases or phosphatases of CTD.
However we could not detect any striking change of expression of these genes in our
microarray analysis.

An alternative possibility is that VIP complex assists the activity of CTD
phosphatases. Ser-S phosphorylation level of CTD is high at the promoter and then
decreases towards the 3’-end of the gene; presumably, protein phosphatases target Ser-5
residues (Sims et al., 2004). Ser-2 phosphorylation level reaches a peak near the poly(A)
site and then drops beyond the site (Cho et al., 2001), and complete dephosphorylation

occurs prior to Pol II recycling (Sims et al., 2004). Budding yeast cells lacking Fcpl

159

function cease transcription of majority of genes (Kobor et al., 1999) and accumulate Ser-
2 phosphorylation of CTD at the coding region of specific genes (Cho et al., 2001).
Similarly, human Fcpl dephosphorylates Ser-2 and Ser-S of CTD to an equal degree (Lin
et al., 2002), and Arabidopsis Fcpl dephosphorylates Ser-S of CTD specifically (Koiwa
et al., 2004). Fcpl purified from human HeLa cells exhibits elongation stimulatory
activity in vitro and participates in Pol II recycling (Cho et al., 1999; Mandal et al.,
2002). F cpl genetically interacts with PaflC in yeast; rtfl mutants are lethal in
combination with fcpI mutants (Costa and Amdt, 2000). Fcpl also genetically interacts
with a Ser-S CTD phosphatase, Ssu72 in yeast; Ssu72 mutation can be suppressed by
Fcpl overexpression (Ganem et al., 2003; Krishnamurthy et al., 2004). Like Fcpl, Ssu72
is involved in recycling the Pol II for reinitiation and subsequent rounds of transcription,
although the specifics of recycling are currently unknown (Sims et al., 2004). Ssu72 is a
component of the cleavage/polyadenylation specificity factor complex (CPSF) (He et al.,
2003) and required for mRNA 3’ end processing (Ganem et al., 2003). Based on the
genetic interaction of Fcpl with PaflC and Ssu72, it is an interesting assumption that
they may function in the same pathways. Since hyperphosphorylation of CTD has been
observed in vip mutants, we hypothesize that the VIP complex assists in recruitment of
Arabidopsis F cpl and/or Ssu72 homologs on target genes, resulting in proper mRNA 3’
end processing. To begin to investigate the role of the VIP complex in mRNA 3’ end
processing, it is necessary to test if loss of function of VIP genes can alter the recognition
of poly(A) site of specific genes misregulated in vip mutants. Previously we identified
eleven genes, the mRNA of which reproducibly and strongly increased (>3-fold) in both

vip5 and vip6 mutants through microarray analysis (Oh et al., 2004). These genes could

160

be used for hybridization probes in northern blot analyses to detect an extended 3’ end of
mRNA in vip mutants. If extended forms of mRNA were detected in vip mutants, ChIP
analysis could be performed to determine whether the VIP complex is required for the
localization of the Arabidopsis Fcpl or Ssu72 homolog at poly(A) recognition site.
AtCPLl and AtCPL2 are Arabidopsis Fcpl homologs (Koiwa et al., 2004). Both have
been characterized as negative transcriptional regulators of cold and drought stress-
related genes (Koiwa et al., 2002) and loss of function of AtCPL2 causes early flowering
and reduced fertility (Koiwa et al., 2004). The Arabidopsis genome encodes one Ssu 72
homolog that has not been characterized.

Although the phosphorylation status of CTD of Pol 11 just after transcriptional
termination is unknown, complete dephosphorylation occurs prior to polymerase
recycling (Ejkova and Tansey, 2002). As mentioned above, both Fcpl and Ssu72 appear
to be required for the complete dephosphorylation of Pol II to possibly ensure rapid Pol II
recycling. It is tempting to speculate that the VIP complex coordinates Pol II recycling
through dephosphorylation of CTD of Pol II. To explore the role of VIP complex in
recycling of Pol II, ChIP analysis or ChIP-on-chip analysis could be used to test if loss of
function of VIP genes causes altered localization of phosphorylated CTD of Pol II at
termination site. If phosphorylated Pol II is not released at the termination site in vip
mutants, the role of VIP complex is to prevent the stalling of Pol II at termination site by

assisting dephosphorylation of CTD of Pol II.

161

Figure 5-1. The phosphorylation cycle of the CTD of Pol II.

The unphosphorylated CTD of Pol II is targeted on Ser-S by the kinase activity of the
Kin28 subunit of TFIIH. Ctkl kinase in yeast targets Ser-2 on the CTD. During
elongation, phosphatases dephosphorylate Ser-5 residues within the CTD. The precise
details surrounding the identity of the phosphatases and the specific residues that are
targeted are not clear. However, the Ser—S-specific phosphatase Ssu72 is involved in
allowing the correct transcript cleavage necessary for efficient termination. F cpl, a CTD-
phosphatase is involved in recycling the Pol II for reinitiation and subsequent rounds of
transcription, although the specifics of recycling are currently unknown. In the diagram,
the arrow indicates a promotive effect, while the “.1.” indicates an inhibitory effect (this
figure is adapted from Sims et al., 2004).

162

Hm ohm—ma

mc=u>oo¢
\ raun—
= _On_. = _On__ = _0n_. = .0."—
m an an .m
N N, N
_.Q I a . I NI
mnmimm- amnmim N- ammrmm- _ mm1mm-

«tam _ _ ma... __. n. 2E

mEmmouoE Ugo .m amp—h 5:0
cozomcofi

163

References

Adelman, K., Wei, W., Ardehali, M.B., Werner, J., Zhu, B., Reinberg, D., and Lis, J.T.
(2006). Drosophila Pafl modulates chromatin structure at actively transcribed genes.
Mol. Cell Biol. 26:250-260.

Andrulis, B.D., Werner, J., Nazarian, A., Erdjument-Bromage, H., Tempst, P., and Lis,
J .T. (2002). The RNA processing exosome is linked to elongating RNA polymerase II
in Drosophila. Nature 420: 837—841.

Araki, Y., Takahashi, S., Kobayashi, T., Kajiho, H., Hoshino, S., and Katada, T. (2001).
Ski7p G protein interacts with the exosome and the Ski complex for 3'-to-5' mRNA
decay in yeast. EMBO J. 20: 4684—4693.

Ast, G. (2004). How did alternative splicing evolve? Nat. Rev. Genet. 5:773-782.

Cho, B.J., Kobor, M.S., Kim, M., Greenblatt, J., and Buratowski, S. (2001). Opposing
effects of Ctkl kinase and Fcpl phosphatase at Ser 2 of the RNA polymerase II C-
terminal domain. Genes Dev. 15:3319—3329.

Cho, H., Kim, T.K., Mancebo, H., Lane, W.S., Flores, 0., and Reinberg, D. (1999). A
protein phosphatase functions to recycle RNA polymerase II. Genes Dev. 13:1540-
1552.

Costa, P. J ., and Amdt, K. M. (2000). Synthetic lethal interactions suggest a role for the

Saccharomyces cerevisiae Rtfl protein in transcription elongation. Genetics 1562535-
547.

Ejkova, B., and Tansey, WP. (2002). Old dogs and new tricks: meeting on mechanisms
of eukaryotic transcription. EMBO Rep. 3:219-223.

Ganem, C., Devaux, F., Torchet, C., Jacq, C., Quevillon-Cheruel, S., Labesse, G., Facca,
C., and Faye, G. (2003). Ssu72 is a phosphatase essential for transcription termination
of snoRNAs and specific mRNAs in yeast. EMBO J. 22:1588-1598.

Gupta, 8., link, D., Korn, B., Vingron, M., and Haas, SA. (2004). Genome wide
identification and classification of alternative splicing based on EST data.
Bioinformatics 20:2579-2585.

He, X., Khan, A.U., Cheng, H., Pappas, D.L., Hampsey, M., and Moore, CL. (2003).
Functional interactions between the transcription and mRNA 3' end processing
machineries mediated by Ssu72 and Sub]. Genes Dev. 17:1030-1042.

Kobor, M.S., Archambault, J., Ifister, W., Holstege, F.C., Gileadi, 0., Jansma, D.B.,
Jennings, E.G., Kouyoumdjian, F., Davidson, A.R., Young, R.A., and Greenblatt, J.
(1999). An unusual eukaryotic protein phosphatase required for transcription by RNA
polymerase II and CTD dephosphorylation in S. cerevisiae. Mol Cell 4:55-62.

164

Koiwa, H., Barb, A.W., Xiong, L., Li, F ., McCully, M.G., Lee, B.H., Sokolchik, I., Zhu,
J., Gong, Z., Reddy, M., Sharkhuu, A., Manabe, Y., Yokoi, S., Zhu, J.K., Bressan,
R.A., and Hasegawa, RM. (2002). C-terminal domain phosphatase-like family
members (AtCPLs) differentially regulate Arabidopsis thaliana abiotic stress
signaling, growth, and development. Proc. Natl. Acad. Sci. U S A 99: 10893-10898.

Koiwa, H., Hausmann, S., Bang, W.Y., Ueda, A., Kondo, N., Hiraguri, A., Fukuhara, T.,
Bahk, J .D., Yun, D.J., Bressan, R.A., Hasegawa, P.M., and Shuman, S. (2004).
Arabidopsis C-terminal domain phosphatase-like 1 and 2 are essential Ser—5-specific
C-terminal domain phosphatases. Proc. Natl. Acad. Sci. U S A 101:14539-14544.

Krishnamurthy, 8., He, X., Reyes-Reyes, M., Moore, C., and Hampsey, M. (2004). Ssu72
is an RNA polymerase II CTD phosphatase. Mol. Cell 14:387-394.

Lin, P.S., Dubois, M.F., and Dahmus, ME. (2002). TFIIF-associating carboxyl-terminal
domain phosphatase dephosphorylates phosphoserines 2 and 5 of RNA polymerase II.
J. Biol. Chem. 277:45949-45956.

Mandal, S.S., Cho, H., Kim, S., Cabane, K., and Reinberg, D. (2002). FCPl, a
phosphatase specific for the heptapeptide repeat of the largest subunit of RNA
polymerase II, stimulates transcription elongation. Mol. Cell Biol. 22:7543-7552.

Mitchell, P., and Tollervey, D. (2003). An NMD pathway in yeast involving accelerated
deadenylation and exosome-mediated 3'-5' degradation. Mol. Cell 11: 1405—1413.

Ng, H.H., Dole, S., and Struhl, K. (2003). The Rtfl component of the Pafl transcriptional
elongation complex is required for ubiquitination of histone H2B. J. Biol. Chem.
278:33625-33628.

Oh, S., Zhang, H., Ludwig, P., and van Nocker, S. (2004). A mechanism related to the
yeast transcriptional regulator PaflC is required for expression of the Arabidopsis
FLC/MAF MADS-box gene family. Plant Cell 16: 2940-2953.

Proudfoot, N.J., Furger, A., and Dye, M.J. (2002). Integrating mRNA processing with
transcription. Cell 108:501-512.

Sims, R.J., Belotserkovskaya, R., and Reinberg, D. (2004). Elongation by RNA
polymerase II: the short and long of it. Genes Dev. 18:2437-2468.

van Nocker, S., and Ludwig, P. (2003). The WD-repeat protein superfamily in
Arabidopsis: conservation and divergence in structure and function. BMC Genomics
4:50.

Wang, BB, and Brendel, V. (2006). Genomewide comparative analysis of alternative
splicing in plants. Proc. Natl. Acad. Sci. U S A 10327175-7180.

Zhang, H., Ransom, C., Ludwig, P., and van Nocker, S. (2003). Genetic analysis of early-
flowering mutants in Arabidopsis defines a class of pleiotropic developmental

165

regulator required for activity of the flowering-time switch FLOWERING LOCUS C.
Genetics 164: 347-358.

Zhao, 2., Yu, Y., Meyer, D., Wu, C., and Shen, W.H. (2005). Prevention of early
flowering by expression of FLOWERING LOC US C requires methylation of histone
H3 K36. Nat. Cell. 721156—1160.

Zhu, B., Mandal, S.S., Pham, A.D., Zheng, Y., Erdjument-Bromage, H., Batra, S.K.,
Tempst, P., and Reinberg, D. (2005). The human PAF complex coordinates
transcription with events downstream of RNA synthesis. Genes Dev. 19:1668-1673.

166

APPENDICES

167

APPENDIX A: Protocol for extraction of histones

168

Protocol for extraction of histones

Note: Lysis buffer (40% Guanidine hydrochloride [GuCl], 10 mM phosphate buffer [pH
6.8 by KOH]) includes proteolysis inhibitors; lmM PMSF and l ug/ml pepstatin. Bio-
Rex —70 resin (100-200 mesh) was been activated using 5% GuCl buffer until refractive
index and pH of the effluent is identical to that of 5% GuCl buffer. If small amounts of

histones were prepared, a minimum column volume of 0.5 ml is maintained by the
addition of Sephadex G-25 Fine (1 g swells to 4-6 ml).

Grind 1 g of floral tissues in liquid N2.

Add 2 ml Lysis buffer on ice into the ground tissues.

Centrifugation for 5 min at 1,250 g at 4°C, and save supernatant.

Centrifugation for 10 min at 30,000 g at 4°C.

Save supernatant.

. Add concentrated HCl to 0.25 N and incubate for 15 min on ice (DNA and acidic
proteins will be precipitated).

7. Centrifugation for 30 min at 30,000 g at 4°C.

8. Dilute the supernatant with 0.1 M potassium phosphate buffer (pH 6.8 at 22°C) to a
refractive index equal to that of 5 % GuCl buffer.

9. Adjust #8 to pH 6.8 by concentrated KOH.

10. Incubate #9 with washed Bio-Rex resin for overnight at RT with agitation.

1 1. Rinse the resin at least three times with large volume of 5 % GuCl buffer.

12. Settle the resin, and then discard the supernatant.

13. Pack the resin in a small polypropylene column (Bio-Rad, catalog No.: 731-1550).
14. Wash the column with eight volume of 5 % GuCl buffer.

15. Elute with 10 volume of 40 % GuCl at proper speed (Do not exceed 1 column volume
per 5 min).

16. Dialyze the eluate against 100 volume of 5 % acetic acid twice for 1 h and once
overnight.

17. Freeze it and lyophilize it.

18. Dissolve with 1 mg/ml water.

19. Add 1 volume of 10% Perchloric acid (PCA) and then precipitate on ice for 30 min.
20. Centrifugation for 15 min at 10,000 g at 4°C.

21. Save supernatant (Histone H1 is soluble in 5% PCA).

22. Dissolve the PCA-insoluble pellet in 5 % acetic acid (Pellet is the histone core).
23. Dialyze #24 against 5 % acetic acid.

24. Lyophilize.

QMPPNr

169

APPENDIX B: Primers for ChlP analysis

170

Table B. List of primers and sequences

 

 

 

 

 

 

 

 

 

 

 

 

 

Target Primer Sequence (S'-3')
F LC (A (5 g1 0140) 1 -F AGGCGAGTGGTTCTTTGTTTT
1 -R C TTTGCTACTTTTGCATTGCC
2-F TTGCATCACTCTCGTTTACCC
2-R GCGTCACAGAGAACAGAAAGC
3-F ACCTGGGTITTCATTTGTTCC
3-R TC ACTCAACAACATCGAGCAC
4-F GTATATGCACGTCCGGGAGATTTA
4-R GTGGGAAACTATAAACCTTTGGAC
5-F TCCCACTCTTGCAGTTACACAC
5-R GTCAGGTGTCTCGACAATTCC
6-F CATTTTGAATCTTTTCCCTGATGGA
6-R TTTGACTGATGATCCTGCCCATG
7-F CACCTTAAATCGGCGGTTGAAATC
7-R GATCTCGATGCAATTCTCACACG
A mine oxidase A-l -F AACTGAGGAGCTCAACTTTTGAA
(A II g3 l 690) A- 1 -R TGCGGAG'ITGCGTCAGAT
A-2-F CCGCAGTTGAACGTAAATCC
A-2—R TGCCCATCTATTCACCATCA
Zinc finger protein Z- 1 -F TGTCGTCAATCTCTATGGCTTC
(Atl g1 45 80) Z- 1 -R AGAGGAGGAAGGTCGGAGTG
Z-2-F GGCAAAGCTTGAGATGATCG
Z-2-R AGCCTCCCACCATGACATTA
A CTIN 7 J P1 595 CGTTTCGC'ITTCCTTAGTGTTAGCT
JP1596 AGCGAACGGATCTAGAGACTCACCTTG

 

171

APPENDIX C: Protocol for ChIP analysis

172

ChIP analysis
Note: All steps must be carried out at 4°C, unless stated otherwise.

Preparation of plant material.
1. Sow Arabidopsis seeds on soil covered with miracloth.

2. After 10 days, harvest 1.5 g of seedlings in a 50 ml Falcon tube.

3. Rinse seedlings twice with 40 ml of double distilled (dd) autoclaved water by gently
shaking the tube (room temperature).

Formaldehyde cross-linking;

4. After thoroughly removing the water, submerge seedlings in 37 m1 of 1 %
formaldehyde in cross—linking solution, extraction buffer 1 (see below, room temperature)
and vacuum infiltrate for 10 min.

5. After vacuum infiltration, stop the cross-linking by addition of glycine to a final
concentration of 0. l 25 M (2.5 ml of 2 M glycine in 37 ml of extraction buffer 1, see
below) and application of vacuum for additional 5 min (At this stage, seedlings should
appear translucent).

6. Rinse seedlings three times with 40 ml cold dd autoclaved water.

7. Remove water as thoroughly as possible by placing seedlings on a paper towel before
transferring to a new Falcon tube. At this stage cross-linked material is frozen in liquid
nitrogen and stored at -80°C.

Isolation and sonication of chromatin.
8. Grind seedlings to a fine powder using liquid N2.
9. Resuspend the powder in 30 m1 extraction buffer 1 (4°C) in a 50 ml Falcon tube.

Extraction buffer 1: 0.4 M Sucrose, 10 mM Tris—HCl (pH 8 at 22°C), 5 mM ,B-ME, 0.1
mM PMSF.

10. Filter the solution through four layers of miracloth into a new 50 ml Falcon tube.
11. Spin the filtered solution for 20 min at 3000g at 4°C.
12. Gently remove supernatant and resuspend the pellet in 1 m1 of extraction buffer 2.

Extraction buffer 2: 0.25 M Sucrose, 10 mM Tris—HCl (pH 8 at 22°C), 10 mM MgC12,
1% Triton X-100, 5 mM ,B-ME, 0.1 mM PMSF.

13. Transfer the solution to 1.5 ml Eppendorf tube.
14. Centrifuge at 12,000 g for 10 min at 4°C.
15. Remove the supernatant and resuspend pellet in 300 pl of extraction buffer 3.

Extraction buffer 3: 1.7 M Sucrose, 10 mM Tris—HCl (pH 8 at 22°C), 0.15% Triton X-
100, 2 mM MgC12, 5 mM fl-ME, 0.1 mM PMSF.

16. Overlay the resuspended pellet onto 300 pl of extraction buffer 3 in a fresh Eppendorf
tube.

173

17. Spin for 1 h at 14 000 g at 4°C.

18. Remove the supernatant and resuspend pellet in 300 p1 of nuclei lysis buffer by
vortexing and pipetting up and down (keep solution at 4°C).

Nuclei lysis buffer: 50 mM Tris—HCl, pH 8.0, 10 mM EDTA, 1% SDS, lmM PMSF.

19. Once resuspended, sonicate the chromatin solution for 10 sec, four times on 5%
power (setting 3) using a sonicator, to shear DNA to approximately 0.5—2 kb DNA
fragments. The sonicated chromatin solution can be frozen at -80°C.

lmmunoprecipitation.
20. Spin the sonicated chromatin suspension for 5 min at 4°C (16,000 g) to pellet debris.

21. Remove supernatant to a new tube. Use an aliquot of 5 p1 to check sonication
efficiency by reverse cross-linking (follow from step 35) and electrophoretic
determination of the average size of DNA fragments as compared with the aliquot from
step 18.

22. Split the 200 pl into two tubes with 100 pl each.
23. Add 900 pl of ChIP dilution buffer to each tube. This dilutes the SDS to 0.1% SDS.

ChIP dilution buffer: 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris—HCl, 167 mM
NaCl, lmM PMSF.

24. Pre-clear each chromatin sample with 60 p1 of salmon sperm-sheared DNA/protein A
agarose beads for 1 h at 4°C with gentle agitation. Prior to use, the beads should be rinsed
three times and resuspended in ChIP dilution buffer.

25. Spin the chromatin/beads solution at 4°C for 2 min at 16,000 g.

26. Combine the two 1 ml supematants into a 15 ml Falcon tube, and then split the 2 ml
into three Eppendorf tubes (660 pl each).

27. Add 3 pl of antibody (One tube without antibody should be used as mock/negative
control).

28. Incubate overnight at 4°C with gentle agitation.

29. Collect immunoprecipitate with 60 p1 of protein A agarose beads (rinsed in ChIP
dilution buffer) for 2 h at 4°C with gentle agitation.

30. Prepare fresh elution buffer (1% SDS, 0.1 M NaHCO3).

31. Pellet beads by centrifugation (2 min, 16,000 g) and wash them with gentle agitation
for 10 min at 4°C each wash, using 1 ml of buffer per wash followed by pelleting the
beads. Apply the following washes in the order listed below:

Low salt wash buffer mne wash)

Low salt wash buffer: 150 mM NaCl, 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20
mM Tris—HCl, pH 8.

High salt wash buffer (one wash)

 

 

174

High salt wash buffer: 500 mM NaCl, 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20
mM Tris—HCl (pH 8).

LiCl wash buffer (one wash)

LiCl wash buffer: 0.25 M LiCl, 1% NP-40, 1% sodium deoxycholate, 1 mM EDTA, 10
mM Tris—HCl (pH 8).

TE buffer (two washes)
TE buffer: 10 mM Tris—HCl, pH 8, 1 mM EDTA.
After the final wash, remove TE thoroughly.

 

Elution and reverse cross-linking of chromatin.

 

32. Release bead-bound complexes by adding 250 pl of elution buffer to the pelleted
beads.

33. Vortex briefly to mix and incubate at 65°C for 15 min with gentle agitation.

34. Spin beads and carefully transfer the supernatant (eluate) to a fresh tube and repeat
elution of beads. Combine the two eluates.

35. Add 20 pl 5 M NaCl to the eluate to reverse the cross-links by an overnight
incubation at 65°C.

36. Add 10 pl of 0.5 M EDTA, 20 pl 1 M Tris—HCl (pH 6.5), and 1.5 pl of l4mg/ml
proteinase K to the eluate and incubate for 1 h at 45°C.

37. Extract DNA by phenol/chloroform (equal volume) and precipitate with ethanol in
the presence of Novagen pellet paint (CN Bioscience). Wash pellets with 70% ethanol.

38. Resuspend the pellet in 50 pl of TE supplemented with 10 pg/ml RNase A (Roche
Biochemical). The immunoprecipitated and purified DNA is then used in PCR reactions
to amplify examined target genes. The DNA precipitated in ChIP can be normalized by
using a primer pair (Johnson et al., 2002) specific for the promoter region of AC T IN 7.

39. Use 0.5 pl for a 25 pl PCR reaction. The amount of recovered templates may vary
between experiments depending upon efficiency of immunoprecipitation, thus PCR
conditions, for example, number of cycles may need adaptation.

175

IIIIIIIIIIIIIIIIIIIIIIIIIIIIII

11111111111111111111111111:u