PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2/05 p:/CIRC/DaleDue.indd-p.1

GENETIC LINKAGE MAP OF CREEPING BENTGRASS AND
CHARACTERIZATION OF LpCBF3 GENE FOR COLD TOLERANCE IN
PERENNIAL RYEGRASS

By

Han Zhao

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Department of Crop and Soil Sciences
Plant Breeding and Genetics Program

2006

ABSTRACT

GENETIC LINKAGE MAP OF CREEPING BENTGRASS AND
CHARACTERIZATION OF LpCBF3 GENE FOR COLD TOLERANCE IN
PERENNIAL RYEGRASS
By
Han Zhao

Colonial bentgrass (Agrostis capillaris L.) is a potential source for genetic improvement
of resistance to environmental stress and disease for other bentgrass species (Agrostis
spp.). Genetic diversity in colonial bentgrass species was investigated using amplified
fragment length polymorphism (AF LP) markers. Ten EcoRI/Msel and six PstI/MseI
AFLP primer combinations produced 181 and 128 informative polymorphic bands,
respectively. Cluster analysis of genetic similarity (GS) estimates revealed a high level of
diversity in colonial bentgrass species with averages of 0.51 (EcoRI/Msel) and 0.63
(PstI/Msel). Greater genetic diversity was detected by the EcoRI/Msel AFLP primer

combinations. A low but significant positive correlation (r=0.44, p=0.0099) between the

two Jaccard similarity matrices was obtained by the Mantel test.

To enhance creeping bentgrass disease resistance, interspecific hybrids between creeping
bentgrass and colonial bentgrass were produced for introgression of resistance. The
hybrids (2n=28) were confirmed by a species-specific sequence characterized amplified
region (SCAR) marker for the colonial bentgrass genome. In addition, an average of
seven ring bivalents, several univalents and multivalents were observed at meiosis of
hybrids. Pollen fertility of the hybrids ranged from 4% to 34.5%. The hybrids were

evaluated for gray snow mold disease resistance in the cold room and dollar spot disease

resistance in the greenhouse. Some of the hybrids had enhanced snow mold and dollar

spot resistance, exhibiting partially diminished disease symptoms.

A segregating pseudo-testcross population consisting of 188 progeny F1 full-sib
population was developed for linkage map construction and QTL detection in creeping
bentgrass. In the male parent map, 93 markers were assigned in 14 linkage groups
covering a total length of 7930M with an average interval of 8.2cM, while in the female
parent map 139 markers were assigned in 14 linkage groups spanning 805cM with an
average distance of 5.9cM between adjacent markers. Five putative QTLs were found in
this segregation population, three QTLs for leaf width, one QTL for snow mold disease

resistance, and one QTL for recovery rate afier snow mold disease infection.

A CBF homologous gene, LpCBF3, was isolated and characterized from a cold-tolerant
perennial ryegrass accession (Lolium perenne L.). LpCBF3 encodes a protein of 237
amino acids with a predicted molecular mass of 25.5 kDa. It carries sequences of the
typical AP2 DNA-binding domain and an acidic activation which are present in the
majority of the plant CBF family. Northern blotting and RT-PCR analysis found LpCBF 3
reached the highest expression after 90 minutes of cold-treatment (4°C). In Arabidopsis,
the over-expression of LpCBF3 under control of the 358 promoter resulted in plants that
were dwarf, later flowering, and freezing tolerant. These results lead us to propose
potential implications and applications of LpCBF 3 gene in turfgrass cold-tolerance and

quality breeding program.

(Dedicated to my parents ’anfiuai Zfiao anJZilei Wang, w/io nave
supported me at? tlie way, for t/ieir understanding, support, andeverflzsting
encouragement.

To my [oving wzfi Mug Sun wfio fias 5een a great source of motivation and

inspiration.

iv

ACKNOWLEDGMENTS
I would like to specifically thank major advisor Dr. Suleiman Bughrara for his guidance,
support, patience and consideration. I especially appreciate for his help in need, and

encouraging me during the trouble shooting period.

I wish to thank the members of guidance committee, Dr. Amy Iezzoni, Dr. James Kelly,
Dr. Donald Penner, and Dr. Ray Hammerschmidt for their advise, encouragement, and
teaching during the four years. Thanks also go to Drs. James Hancock, Ning Jiang,
Mitch McGrath, Dechun Wang, Michael F. Thomashow, Sarah Gilmour, Mian Rouf and
Malay Saha. I am also grateful to Ms. Deb Misiak, Ms. Rita House, Mr. Cal Bricker, Ms.
Darlene Johnson, Dr. Susannah Cooper, Mr. Scott Show, Mr. Xuewen Huang, Dr. Hua
Zhang, Dr.Veronica Vallejo, Dr.Jianrong Shi, Dr.Yiwu Chen, Dr.Chuansheng Mei, and
Dr. Changbao Li, for helpful discussion and sharing their experience in molecular

biology techniques.

I am particularly thankful to my colleagues in turfgrass breeding and genetics lab: Dr.
Gina Vergara, Dr.Jianping Wang, Dr. Yuexia Wang, Dr. Weixin Liu, Mr. Dean Smith,
Ms. Lori William, Ms. Shiranee Gunasekera, and Dr. Xinquan Zhang. Thanks go to them
for their invaluable assistance in laboratory, greenhouse, and field, also for their

fi'iendship.

TABLES OF CONTENTS

LIST OF TABLES .................................................................................... ix
LIST OF FIGURES ................................................................................... x
LITERATURE REVIEW .................................................................................................... 1
INTRODUCTION ................................................................................................................. 2
I. PHENOTYPIC AND GENETIC DIVERSITY RESEARCH ......................................................... 6
II. LINKAGE CONSTRUCTION AND QTL DETECTION IN OUT-POLLINATING PLANT SPECIES
....................................................................................................................................... 10
III. CBF AND COLD TOLERANCE ..................................................................................... 13
REFERENCES .................................................................................................................. 16
CHAPTER 1 ..................................................................................................................... 21
GENETIC DIVERSITY IN COLONIAL BENTGRASS (AGROSTIS CAPILLARIS L.)
REVEALED BY ECORI/MSEI AND PSTI/MSEI AFLP MARKERS ........................... 21
ABSTRACT ...................................................................................................................... 22
INTRODUCTION ............................................................................................................... 23
MATERIALS AND METHODS ........................................................................................... 25
Plant materials ........................................................................................................... 25
AFLP analysis ........................................................................................................... 25
Mitotic Analysis ........................................................................................................ 26
Data Analysis ............................................................................................................ 27
RESULTS ........................................................................................................................ 28
Chromosome numbers of 14 accessions of colonial bentgrass collected from
northern Spain. .......................................................................................................... 28
Cluster analysis determined by EcoRI/MseI AFLP markers. ................................... 28
Cluster analysis determined by PstI/MseI AF LP markers. ....................................... 30
Comparison between two sets of AF LP restriction enzyme combinations ............... 31
DISCUSSION ................................................................................................................... 32
Verification of colonial bentgrass accessions collected from northern Spain. ......... 32
Comparison between two enzyme combination results. ........................................... 32
Genetics diversity among the colonial bentgrass species. ........................................ 34
REFERENCES .................................................................................................................. 42
CHAPTER 2 ..................................................................................................................... 4S
GENERATION AND CHARACTERIZATION OF INTERSPECIFIC HYBRIDS
BETWEEN COLONIAL AND CREEPING BENTGRASS ............................................ 45

vi

ABSTRACT ...................................................................................................................... 46

INTRODUCTION ............................................................................................................... 47
MATERIALS AND METHODS ............................................................................................ 48
Plant materials ........................................................................................................... 48
Disease evaluation and rating procedure ................................................................... 49
Snow mold disease evaluation .................................................................................. 49
Dollar spot disease evaluation ................................................................................... 50
DNA extraction ......................................................................................................... 51
DNA amplification and analysis ............................................................................... 52
Cytological analysis .................................................................................................. 52
Pollen Viability Determination ................................................................................. 53
RESULTS ........................................................................................................................ 53
Phenotype of F1 hybrids of colonial and creeping bentgras ..................................... 53
Cytological analysis .................................................................................................. 54
Meiosis ...................................................................................................................... 54
Pollen viability of hybrids ......................................................................................... 55
Disease resistance evaluation .................................................................................... 55
DISCUSSION ................................................................................................................... 56
REFERENCES .................................................................................................................. 64
CHAPTER 3 ..................................................................................................................... 66
GENETIC LINKAGE MAPS AND QTL ANALYSIS OF CREEPING BENTGRASS
(AGROSTIS STOLONIFERA L.) .................................................................................... 66
ABSTRACT ...................................................................................................................... 67
INTRODUCTION ............................................................................................................... 68
MATERIALS AND METHODS ............................................................................................ 71
Plant materials ........................................................................................................... 71
DNA isolation ........................................................................................................... 72
AF LP analysis ........................................................................................................... 72
SSR analysis .............................................................................................................. 73
RAPD analysis .......................................................................................................... 74
Phenotypic measurements ......................................................................................... 74
Snow mold disease evaluation .................................................................................. 75
Data analysis ............................................................................................................. 76
Linkage map construction ......................................................................................... 76
QTL analysis ............................................................................................................. 77
RESULTS ........................................................................................................................ 77
Phenotypic variation .................................................................................................. 77
RAPD and SSR analysis ........................................................................................... 78
AFLP analysis ........................................................................................................... 79
Linkage (LG) map construction ................................................................................ 79
QTL identification ..................................................................................................... 80
DISCUSSION ................................................................................................................... 8 1
REFERENCES ................................................................................................................ 103

vii

CHAPTER 4 ................................................................................................................... 107

ISOLATION AND CHARACTERIZATION OF COLD-REGULATED
TRANSCRIPT IONAL ACTIVATOR LPCBF3 GENE FROM PERENNIAL

RYEGRASS (LOLIUM PERENNE L.) ......................................................................... 107
ABSTRACT .................................................................................................................... 108
INTRODUCTION ............................................................................................................. 109
MATERIALS AND METHODS ......................................................................................... 112

Freezing tolerance evaluation ................................................................................. 112
DNA extraction and Southern analysis ................................................................... 113
RNA extraction and Northern analysis ................................................................... 114
cDNA synthesis ....................................................................................................... 114
Isolation of full length LpCBF3 gene ..................................................................... 115
DNA sequence alignments and annotation ............................................................. 116
Real-time PCR conditions and analysis .................................................................. 116
PCR Reaction and Electrophoresis ......................................................................... 117
Vector Construction and Arabidopsis Transformation ........................................... 117
Freeze test for transgenic Arabidopsis .................................................................... 118
RESULTS ...................................................................................................................... 118
Screening perennial ryegrass accessions for freezing tolerance ............................. 118
Isolation of the CBF conserved regions .................................................................. 119
Isolation of and sequencing of perennial ryegrass LpCBF3 gene .......................... 119
Analysis of LpCBF3 and COR gene expression ..................................................... 120
Analysis of putative promoter of LpCBF3 ............................................................. 121
Tolerance of overexpressed LpCBF3 transgeneic Arabidopsis plants to the freeze
test ........................................................................................................................... 122
DISCUSSION ................................................................................................................. 123
REFERENCES ................................................................................................................ 138

APPENDIX A. GENETIC RELATIONSHIPS AMONG SNOW MOLD RESISTANT

CLONES OF CREEPING BENTGRASS ...................................................................... 142
ABSTRACT .................................................................................................................... 143
INTRODUCTION ............................................................................................................. 144
MATERIALS AND METHODS ......................................................................................... 146

Plant materials ......................................................................................................... 146
AFLP analysis ......................................................................................................... 147
Data Analysis .......................................................................................................... 148
RESULTS ...................................................................................................................... 149
Genetic relationship among the bentgrass species .................................................. 149
Genetic relationship within the creeping bentgrass species .................................... 150
Heterogeneous of the creeping bentgrass clone ...................................................... 150
DISCUSSION ................................................................................................................. 151
REFERENCES ................................................................................................................ 155

viii

LIST OF TABLES

Table 1.1 Proposed genomic compositions of five common-used bentgrass species. . .......5
Table 2.1. List of PI, species, geographic origin and chromosome number Of colonial. . .36
Table 2.2. List of adapters and pre-primers used ................................................ 37

Table 3.1. Snow mold and dollar spot disease index of 10 hybrids (CCl to CC7) and their
parents and cultivars ................................................................................ 60

Table 4.1. AF LP, SSR and RAPD primers used for mapping the creeping bentgrass
population ............................................................................................. 85

Table 4.2. Phenotypic values of three quantitative traits (leaf with, snow mold disease
resistance and recovery afier Typhula infection) for parental lines (ASR368 and MSU#8)
and 188 F1 progeny ................................................................................. 86

Table 4.3. Characteristics of the detected QTL for three traits (leaf with, snow mold
disease resistance and recovery after Typhula infection). In linkage group column, Flg
means female linkage and Mlg means male linkage ........................................... 87

LIST OF FIGURES
Figure 2.1. Mitosis of colonial bentgrass accession of SP1275 from Spain ................. 38

Figure 2.2. UPGMA dendrogram of 39 colonial bentgrass accessions revealed by
EcoRI/Msel AF LP markers ........................................................................ 39

Figure 2.3. Three-dimensional plot of principal component analysis with 128 amplified
fragment length polymorphism markers and 39 colonial bentgrass accessions defining
three groups marked as 1, 2, and 3 from the CPCA and plot options OfNTSYS v. 2.1 . . .40

Figure 2.4. UPGMA dendrogram of 39 colonial bentgrass accessions revealed by
PstI/Msel AFLP markers ............................................................................ 41

Figure 3.1. The image of SCAR marker often hybrids and their parents. From CC] to
CC17 are 10 hybrids. ASR368 is creeping bentgrass and PI 578528 is colonial bentgrass
......................................................................................................... 61

Figure 3.2. Mitosis of (left) colonial bentgrass accession of P1578528, (center) creeping
bentgrass ‘ASR368’, and (right) hybrid CC6 .................................................... 62

Figure 3.3. Meiosis of hybrid (CC6), seven bivalents several, some univalents and
multivalents at meiosis were observed ........................................................... 63

Figure 4.1a Frequency distribution in 188 F1 progeny from cross between ASR368 and
MSU#8 for a leaf width (mm). Parental trait values are indicated by arrows ............... 88

Figure 4. lb Frequency distribution in 188 F1 progeny from cross between ASR368 and
MSU#8 for resistance to snow mold. Parental trait values are indicated by arrows ....... 89

Figure 4.1c Frequency distribution in 188 F1 progeny from cross between ASR368 and
MSU#8 for recovery after Iyphula infection. Parental trait values are indicated by arrows
......................................................................................................... 90

Figure 4.2. A genetic linkage map of female parent (MSU# 8) generated from 188
individuals. The numbers on the left are the genetic distances in Kosambi centiMorgans
(cM) between markers. Marker names are on the right ......................................... 91

Figure 4.3. A genetic linkage map of male parent (ASR368) generated from 188
individuals. The numbers on the left are the genetic distances in Kosambi centiMorgans
(cM) between markers. Marker names are on the right (cont’d) .............................. 95

Fig.4. 4a. Linkage map and the QTL likelihood plots indicating leaf width QTLS. The
vertical dot lines in QTL likelihood plots indicate significant threshold level based on
permutation tests, corresponding to LOD score=2.5. LG2 and LG7 are female parent
(MSU#8) linkages ................................................................................. 99

F ig.4. 4a-1. Linkage map and the QTL likelihood plot indicating leaf width QTL. The
vertical dot line in QTL likelihood plot indicates Significant threshold level based on

permutation tests, corresponding to LOD score=2.5. LG12 is female parent (MSU#8)
linkage ............................................................................................... 100

Fig. 4.4b Linkage map and the QTL likelihood plot indicating recovery QTL. The
vertical dot lines in QTL likelihood plot indicate significant threshold level based on

permutation tests, corresponding to LOD score=3.0. LG] is female parent (MSU#8)
linkage .............................................................................................. 101

Fig.4. 4c Linkage map and the QTL likelihood plots indicating snow mold disease
resistant QTL. The vertical dot lines in QTL likelihood plots indicate significant
threshold level based on permutation tests, corresponding to LOD score=3.0. LGIO is
male parent (ASR368) linkage ................................................................... 102

Figure 5.1. Comparison of CBF3 amino acid sequence from ryegrass, rice, barley, maize
and Arabidopsis. Amino acids are designed in single letter code. The red color letter
indicates identical, the blue color indicates closely related. Black bold line indicates the
NLS and red bold line indicates the AP2. This figure was created by Multalin
(http://prodes.toulouse.inra.fr/multa1in/multalin.html). Ryegrass (LpCBF 3), Rice
(AAN02486), Barley (AAG59618), Maize (AAN76804) ................................... 128

Figure 5.2 Comparison of amino acid sequences of the LpCBF3 gene with that from oher
species and result is produced by CLUSTALW. Scale indicates branch lengths. . . . 129

Figure 5.3 Putative LpCBF 3 gene promoter sequence compared with that of Arabidopsis.
BoxIV, BoxV and Bole are critical motifs for Arabidopsis cbf expression after cold
treatment ........................................................................................... 130

Figure 5.4 Promoter sequence comparison between that from cold-tolerant and cold-
sensitive ryegrass accessions. S means cold-sensitive promoter and promoter means cold-
tolerant promoter .................................................................................. 131

F igure5.5. Expression of CBF gene(s) in ryegrass by Northern blotting. The plant
materials were 2-month old growing with 16-h photoperiod at 25°C. The total RNAS
were isolated from stems and leaves of different times (0, l, 4, 24hrs) of cold treatment
(4°C). The bottom is total RNA stained with ethidium bromide ............................ 132

F igure5.6. Expression pattern of LpCBF 3 in ryegrass by RT-PCR analysis. Plants
(P1598441) were 2-month old growing with l6-h photoperiod at 25°C. The total RNAS
were isolated from whole plants of different times of cold treatment (4°C). The ryegrass
actin expressions act as the control ............................................................ 133

Figure5.7. Expression of COR15 orthologue gene in ryegrass. The plant materials are 2-
month old growing with 16-h photoperiod at 25°C. The total RNAS were isolated from

xi

stems and leaves of different times (0, 1, 4, 24hrs) of cold treatment (4°C). The bottom is
total RNA stained with ethidium bromide ..................................................... 134

Figure5.8 Overexpressing LpCBF 3 gene in Arabidopsis detected by RT-PCR with
specific primers. WT is Columbia Al-A6 are T3 transgenic Arabidopsis plants. Only Al ,
A3 and A4 can express LpCBF 3 ................................................................ 135

F igure5.9 Growth characteristics oprCBF3-expressing transgenic plant (A3-1 T3) with
wild type (Columbia) ............................................................................. 136

F igure5. 10 Effect of LpCBF 3 overexpression on plant freezing tolerance. Seedlings of
control Arabidopsis Columbia (Center, 12 day old), LpCBF3-expressing A1 (Lefi, 12 day
old) and LpCBF3-expressing A1 (Right, 20 day Old) were grown at 20°C on solid
medium and then frozen at -2°C for 24 h followed by 24 h at -6°C ....................... 137

Fig A. 1 The unweighted pair group method with the arithmetic mean dendrogram of 35
genotypes from 199 amplified fragment length polymorphism markers. Bootstrap values
obtained from 1000 replicate analyses ......................................................... 154

xii

LITERATURE REVIEW

Introduction

Bentgrass species (Agrostis spp.), native to western Europe, belong to the Poaceae
family and are cool season turfgrasses (Harlan, 1992). Distribution of the Species spans
from shade to open habitats, lowlands to highlands and cool to extremely arctic areas.

' Bentgrasses are normally out-crossing pollinated Species and vary in ploidy levels. There
are over 220 known species of bentgrass (Hitchcock, 1951). Five species are used
commercially as turfgrass in the USA. These include creeping bentgrass (A. stolom‘fera),
colonial bentgrass (A. capillaris), dryland bentgrass (A. castellana), velvet bentgrass (A.

canina) and redtop bentgrass (A. gigantean).

Creeping bentgrass is best known for its fine texture and adaptation to mowing heights
as low as 3mm, which makes it well suited for use on golf course tees, greens and
fairways. The commercial value of creeping bentgrass makes it attractive for genetic
improvement. However, breeding progress in this species has lagged behind other grass
species. Creeping bentgrass species is susceptible to a wide range of diseases, including
dollar spot (Sclerotinia homoeocarpa); (Viji et al., 2004), brown patch (Rhizoctonia
solanr) ;(Burpee and Goulty, 1984), and gray snow mold (Typhula incarnate); (Wu and
Hsiang, 1998). No commercial cultivars Show an acceptable resistance to these pathogens
(V incelli et al., 1997). Control of these diseases relies heavily on firngicide applications
and cultivation management (Abernathy et al., 2001). The fungicides are expensive to
apply, have limited efficacy, and may adversely affect the environment. Some fungal

pathogens may develop resistance to fungicides after years of repeated applications

(Latin, 2006; Reicher and Throssell, 1997). In addition, disease control by cultivation

management has been met with limited success due to the environmental effects.

Developing disease-resistant creeping bentgrass cultivars is believed to be an efficient
alternative method to overcome these disease infections. However, disease-resistant
germplasm should be identified for the eventual development of resistant cultivars
(Boerma and Hussey, 1992). Fortunately, two types of disease resistance germplasm are
available within creeping bentgrass breeding programs. The first resistance is derived
from creeping bentgrass related species, such as colonial bentgrass. Some colonial
bentgrass accessions show good resistance to dollar spot and snow mold diseases
(Belanger et al., 2003). These resistant genes can be integrated into the creeping
bentgrass genome by interspecific hybridization and genome introgression. However, this
strategy requires multiple selfing and backcrossing to minimize the length of alien
chromosome segments and eliminate deleterious gene combinations, thereby reducing
linkage drag. The second approach is to screen the resistant turfgrass clones from old golf
courses that have not been sprayed with fungicide or over-seeded for several years.
Creeping bentgrass populations from the old golf courses are under a high selection level
of disease. Some clones which may contain the resistant genes from natural mutations
should be able to preserve and thrive. The resistant genes from these clones could be
exploited and utilized to enhance disease resistance levels and diversifyng the resistance

base in bentgrass cultivars by interpollination.

Understanding the genetics of resistant genes of bentgrass species could accelerate the
processes of resistance selection and improvement. The basic chromosome number of
bentgrass species genome is x=7. Genome compositions of some Agrostis species were
determined by examining chromosome pairing configurations of species or their hybrids
(Jones, 1956a; Jones, 1956b). Creeping bentgrass species is a strict allotetraploid with a
genome composition of C2C2SS, and Shares a common genome C2C2 with colonial
bentgrass. Colonial bentgrass is a segmental allotetraploid with a genome composition of
C1C|C2C2. These two species are sexually compatible and capable of producing hybrids,
which may result in introgression of the alien genes between common genomes after
pairing. Redtop bentgrass is an allopolyploid with a genome composition of C1C1C2C2$S,
which includes the three genomes of creeping bentgrass and colonial bentgrass. Redtop
and creeping bentgrass are cross-compatible and capable of producing sterile pentaploid

hybrids. More details on genome compositions of bentgrass species are listed in Table 1.1.

 

 

anmxoso=< mmNUNU _U .0 we 2336MB”. .V $8959 moaned

22:5 5 G 3 62.289 .v. mmfiwfion 329/

Beanbag; SEEMS :36 G _O a. $3328 .w BED:
229288? _S:oEwom NUNU _U _0 mm M26338 .V mmfiwucon EEO—00
32%5822 mmNUNU mm EOxEONSH .V mmfiwugn wfiqoeu
:eEmoA—Eeu 2:82:er Lea—Ea: 2:82:950 86an 0:3: :eEEeU

 

88on mafiwacon 33:85:00 u>c Co mcoEmanoO “Viacom 38:05 Z 2an

Although the ambiguities of genome composition from some species still need
clarification, the cytogenetics research conducted a half century ago has already provided
an excellent initial examination of the Species relationship in this complex genus (Jones,
K. 1956a). Molecular techniques can be used to add resolution in cytogenetics studies.
Diversity analysis with AF LP provides an alternative approach to elucidate genome
composition relationships in the not under-researched and complex genus. In our study,
relatedness of creeping bentgrass and three other bentgrass species, colonial bentgrass,
dryland bentgrass, and velvet bentgrass was elucidated by using 199 polymorphic AFLP
markers. Both principal component analysis (PCA) and unweighted pair group method
with arithmetic mean (UPGMA) dendrogram distinguished these four bentgrass species
into three groups, which are consistent with their genome compositions. Colonial and
dryland bentgrass were clustered into the same group based on their similarity of genome
compositions. Although this method cannot completely replace the traditional meiosis
research to determine genome composition, it can provide preliminary genome
composition information based on the genetic distance of different species (Zhao and

Bughrara, submitted).

1. Phenotypic and genetic diversity research

Bentgrass Species have an abundance of phenotypic and molecular diversity that can be
harnessed for gains in cultivar development. However, to utilize this diversity effectively,
an understanding of the phenotypic and molecular variations of the germplasm are

necessary because genetic diversity is considered as one of the criteria for germplasm

conservation and parent selection for cultivars (Menkir et al., 2006; Thompson and
Nelson, 1998). Diverse genetic backgrounds provide an ample supply of allelic variation
that can be used to create a new, favorable and unique gene combination for maximizing
genetic gain by hybridization (Carena and Wicks, 2006). In plants, two procedures are
available to evaluate diversity among the genotypes: investigating morphological traits or
estimating the genetic relatedness based on fingerprint of DNA markers (Ferriol et al.,
2004). Morphological characteristics can be analyzed by Euclidian distance, and is
applied to examine the morphological divergence in large collections of plant genotypes
(Anderson et al., 2006). These traits can be evaluated in situ or in the greenhouse.
Morphological characters are easiest to measure and may provide a primary classification
of the collection. However, because these morphological characters are subject to
considerable environmental influence and different plant growth stages, the data collected
from different years and locations could vary. Estimating genetic distance based on DNA
marker polymorphisms offers the unique capacity to describe genetic diversity, and
distinguish heterotic groups within plant species due to their abundant polymorphism and
independence of environmental effect. Several types of molecular markers are available
for evaluating the extent of genetic diversity in crops. Microsatellite or simple sequence
repeat (SSR) markers and restriction fragment length polymorphism (RFLP) markers are
dependable marker systems for diversity research (Guarino et al., 2006; Paull et al., 1998).
However, they are unavailable in some plant genera because of limited genomic sequence
information. Random amplified polymorphic DNA (RAPD) markers can be applied in
diversity research in turfgrass species, but the approach has been criticized because the

results are lack of reliable or reproducible (Rajasekar et al., 2006). Amplified fragment

length polymorphism (AFLP) markers provide a powerful tool for genetics diversity
research among turfgrass species because their polymorphism and no prior sequence
information is required for their application (Vergara and Bughrara, 2003, 2004). AFLP
markers can be generated by CNG methylation-sensitive (PstI/MseI) or by CN G
methylation-insensitive (EcoRI/MseI) restriction enzyme combinations that target

different chromosome regions (Menz et al., 2002).

In theory, phenotypic diversity from morphological variations should reflect the
genetic relationship drawn from the DNA markers. As the diversity of morphological
traits increases in a population, accordingly, the diversity of genes involved in the control
of morphological traits Should increase. Several studies have attempted to correlate plant
diversity drawn from DNA markers with a diversity of morphological traits with the
expectation that morphological variations would be reflected by genetic diversity derived
from molecular markers (Borba et al., 2002; Bruschi et al., 2003). However, in most
cases, information on genetic diversity from molecular markers does not appear to
correlate with differences in morphological traits in other species (Tar'an et al., 2005;
Tommasini et al., 2003). Genomic similarity which does not necessarily reflect
resemblance of morphological traits may be the results of the following. First, a small
number or common set of genes/QTLS may control several correlated morphological
traits observed in the experiment. The genome coverage represented by morphological
traits is likely to be extremely low. Second, most of the morphological traits used as
genetic markers were controlled by QTLS. Different morphological traits may be
controlled by a different numbers of genes that are difficult to distinguish by applying

different statistical weights in diversity calculation. When comparing AF LP markers,

every marker is given the same statistical weight. This could directly lead to a lack of
correlation between two dendrograms drawn from DNA markers and morphological traits.
Third, a significant proportion of environmental variation can be present in the estimation
of morphological traits. Fourth, an absolute measure of genetic difference is not
technically feasible without the entire genome sequences. Consequently, any molecular
markers used to study differences will represent a subset of the variation sampled. The
limited proportions and different specific regions of the genome scanned by DNA
markers will lead to deviation of estimations. Lastly, AF LP fragments with the same size
could originate from different loci and may have different locus origins. This could be the
case in segmental allotetraploid colonial bentgrass due to its genome composition and
multiple homologous loci. The approaches used to attempt to overcome the above
problems are as follows. Markers developed from expressed sequences would be used
that may be directly responsible for morphological traits of genotypes. Single nucleotide
polymorphisms (SNPs) could be applied to genetic diversity research. SNPs has great
potential for the detection of associations between allelic forms of a gene and phenotypes

(Rafalski, 2002).

Genetic dendrograms may be used for universal taxonomic studies because the -
molecular markers offer the possibility to screen a large number of anonymous loci, and
provide the unique capacity to classify genotypes regardless of environmental condition
and plant growth stage. Since most desirable traits in plants are the result of the
interaction among expressed genes, they cannot be easily elucidated by DNA markers.

Morphology studies are still critical in germplasm description, serving as an efficient tool

for selection of morphologically diverse parents for the breeding programs. Therefore,
determination of molecular diversity can be considered as complementing the

morphological classification.

11. Linkage construction and QTL detection in out-pollinating plant species

Linkage maps provide researchers insights with into genome structure and evolution
by comparing the genetic synteny among related species. Linkage maps are useful for
identifying. QTLS or genes of interest by providing the framework to understand the
biological basis of complex traits. In out-crossing heterozygous turfgrass species, such as
creeping bentgrass species, F2 or backcross segregation populations are rarely available
due to self-incompatibility. Genetic linkage construction is performed commonly on F.
progeny (pseudo F2) derived from the crossing between two heterozygous parents
(Chakraborty et al., 2005; Inoue et al., 2004). Since genetic segregations in the F1
progeny are the result of meiotic recombination fi'om both parents (not between two
parents), segregation data can be analyzed as a double pseudo-testcross strategy and used
in developing two separate maps (female and male parent maps). AFLP (Amplified
Fragment Length Polymorphism), which does not require the prior knowledge of the
DNA sequence, is considered to be a highly productive and reproducible DNA marker
system. AFLP has been applied to rapidly create genetic linkage maps and detect the
QTLS in some grass species (Saha et al., 2005). QTL, an association between marker loci

and the phenotypic variation in the segregation population, can be studied in terms of the

10

magnitude of effects on phenotype, the parental origins of the favorable QTL alleles and
the interactions between different QTLS. Several examples have been reported for QTL
mapping in out-pollinating plant species. In grapevine (Vitis vinifera), putative QTLS for
seedlessness, berry weight, and fruit yield were identified (Doligez et al., 2002; Fanizza
et al., 2005). In perennial ryegrass (Lolium perenne), three potential QTLS of resistance
to gray leaf spot were characterized (Curley et al., 2005) and four QTLS controlling
crown rust resistance were detected (Muylle et al., 2005). For turfgrass species in general,
and creeping bentgrass in particular, QTL analysis has met with limited success. No
documented information is currently available on documented QTL analysis in creeping

bentgrass species.

Linkage information from well-studied major crops provides a promising approach to
elucidating turfgrass linkage structure and arrangement. Some crop species such as rice
(Oryza sativa), wheat (T riticum aestivum), barley (Hordeum vulgare), oat (Avena sativa),
maize (Zea mays) and other Gramineae species have been studied separately by different
linkage construction projects. Comparative mapping using homologous sequences across
the species can merge the separate genetic linkages and maps which would be useful for
cross-referencing genetic information (Lagercrantz, 1998). RFLP (cDNA probe) and SSR
(derived from EST sequence fiom the homologous regions across different species)
markers in linkage map often reveal extensive conservations of syntenic relationships
among related species. Comparative maps between species can provide insights into the
chromosome, even chromosome segments arrangement, which cannot be solved by using

traditional cytogenetical methods. Conserved chromosomal segments identified in these

11

species Show the translocation, conservation, deletion and duplication that occurred
during evolution and selection process (Beales et al., 2005). In addition, by comparing
the genetic changes responsible for evolving similar traits in widely separated
populations, it should be possible to determine whether there are many different

approaches to evolve a new characteristic.

Developing a platform to rapidly dissect complex traits by utilizing both association
and linkage based approaches is playing a critical role in QTL analysis. To conduct these
analyses, linkage and association populations that capture much of the natural variation
inherent in the plant genome need to be developed. Extensive phenotyping and surveys of
tens of thousands of candidate gene sequences will then be employed. This approach
should allow the rapid dissection of complex traits at the gene (DNA sequence) level.
Although QTL mapping has been successfirl in describing the genetic architecture of
complex traits, the molecular basis of quantitative variation is less well-understood.
Besides gene sequence differences which directly lead to functional variations, the
intergenic sequences (non—coding sequence) also have an impact on phenotypic
polymorphism by changing gene expression patterns and levels. Clark and his colleagues
(2006) provide an excellent example of elucidating the intergenic DNA sequence basis
for phenotypic variation and the role of cis-regulatory evolution by studying a distant
upstream enhancer of th gene in maize. Recently, expression QTL (eQTL) analyses
have provided a new approach to dissect QTL (Farrall, 2004). eQTL can be split into two
categories, cis-acting and trans-acting classes, based on the relative genomic locations of

the transcriptvand its phenotypic QTL. This has provided a glimpse into some basic

12

principles regarding the relative contributions of cis-acting versus trans-acting loci.
Significantly more trans-acting QTLS (N=110) than cis-acting QTLS (N=17) were found
in human lymphoblastoid cell lines study (Morley et al., 2004). Some of the trans-acting
QTLS were found to aggregate in genomic ‘hotspots’. These hotspots presumably contain
the ‘master regulators’, each controlling a large number of transcripts. A global
understanding of genetic variations will provide new insights into the vast amount of

genetic linkage and gene expression data accumulated over time.

111. CBF and cold tolerance

Plants from temperate regions can increase their cold tolerance in response to low,
non-freezing temperature. This process is called cold acclimation which contributes to an
ability to survive, grow, and acclimate at low temperatures. Cold acclimation process
involves physiological and biochemical adaptations which are regulated by at least two
pathways, abscisic acid (ABA) and ABA independent (Shinozald and Yamaguchi-
Shinozaki, 2000, Nordin et al., 1991). The plant hormone abscisic acid (ABA) modulates
a wide spectrum of responses, including gene activation and repression, guard cell
closure, cell cycle blockage, and photosynthesis inhibition, under multiple environmental
stress conditions such as drought, cold, and salinity (Sheen, 1998). In the ABA-
independent process, cold temperatures trigger the transcription of the CBF family by an
upstream transcription factor, ICE 1 (inducer of CBF expression 1); (Chinnusamy et al.,
2003). The expression of CBF factors activates the transcription COR genes encoding a

diverse array of proteins with a presumed function in tolerance to dehydration caused by

13

freezing (Mohapatra et al., 1989). Cold signaling for freezing tolerance requires a
cascade of transcriptional regulations. In Arabidopsis, the transcription of COR genes

has been shown to be regulated by cis-acting drought and cold responsive elements (DRE)
containing a core CCCGAC (CRT) sequence (Y amaguchi-Shinozaki and Shinozaki, 2001 ,
Stockinger et al., 1997). The trans-acting factor CBF (Core Binding Factor) that could
bind to DRE and activate COR genes’ expression was firstly isolated from Arabidopsis.
The CBF genes in Arabidopsis are a multigene family, with a potential nuclear
localization sequence (NLS), an AP2-DNA-binding domain and an acidic activation
domain (Gilmour et a1, 1998). Three members of the CBF/DREBI family, CBF], CBFZ,
and CBF 3 (or DREBI b, DREBIc, and DREBI a, respectively), are induced within 15
minutes in cold temperatures, followed by expression of the CBF regulon of target genes,

such as COR genes (Gilmour et al., 1998; Liu et al., 2004).

Overexpression of the CBF/DREBI transcription factors in transgenic Arabidopsis
plants resulted in the accumulation of compatible solutes that have cryoprotective
activities, including proline, sucrose, and raffinose accumulation(Gilmour et al., 2000),
improvement of cold tolerance by driving expression of COR genes at the whole plant
level in both nonacclimated and cold-acclimated plants (Thomashow et al., 2001), and
the enhancement of the tolerance of plants to dehydration caused by either imposed
water deficit or exposure to high salinity (Kasuga et al., 1999). Transgenic plants with
overexpressed CBF gene exhibit phenotypic traits such as dwarf, stunting growth, and
later flowering (Gilmour et al., 2000). The dwarf and stunting growth are desired in

turfgrass breeding because of reducing mowing frequency and labor input to lawn

l4

maintenance. The later flowering trait can improve the forage quality of ryegrass by

decreasing the fiber content.

Understanding the mechanism controlling cold tolerance by connecting phenotypes to

the molecular pathway is a critical first step toward the eventual unraveling of the

complex interplay among gene, regulator, and environment.

15

References

Abernathy, S.D., R.H. White, P.F. Colbaugh, M.C. Engelke, G.R. Taylor, and TC. Hale.
2001. Dollar Spot resistance among blends of creeping bentgrass cultivars. Crop
Science 41 :806-809.

Anderson, M.S., R. Schultze-Kraft, M. Peters, B. Hincapie, and CE. Lascano. 2006.
Morphological, agronomic and forage quality diversity of the Flemingia
macrophylla world collection. Field Crops Research 96:387-406.

Beales, 1., DA. Laurie, and KM. Devos. 2005. Allelic variation at the linked API and
PhyC loci in hexaploid wheat is associated but not perfectly correlated with
vemalization response. Theoretical and Applied Genetics 110: 1099-1 107.

Belanger, F.C., K.A. Plumley, P.R. Day, and W.A. Meyer. 2003. Interspecific
hybridization as a potential method for improvement of Agrostis species. Crop
Science 43:2172-2176.

Boerma, HR, and RS. Hussey. 1992. Breeding Plants for Resistance to Nematodes.
Journal of Nematology 24:242-252.

Borba, E.L., G.J. Shepherd, C. van den Berg, and J. Semir. 2002. Floral and vegetative
morphometrics of five Pleurothallis (Orchidaceae) species: correlation with
taxonomy, phylogeny, genetic variability and pollination systems. Annals of
Botany 90:219-30.

Bruschi, P., G.G. Vendramin, F. Bussotti, and P. Grossoni. 2003. Morphological and
molecular diversity among Italian populations of Quercus petraea (Fagaceae).
Annals of Botany 91:707-716.

Burpee, LL, and LG. Goulty. 1984. Suppression of Brown Patch Disease of Creeping
Bentgrass by Isolates of Nonpathogenic Rhizoctom‘a Spp. Phytopathology 74:692-
694.

Carena, M.J., and Z.W. Wicks. 2006. Maize population hybrids: An exploitation of US
temperate public genetic diversity in reserve. Maydica 51:201-208.

Chakraborty, N., J. Bae, S. Warnke, T. Chang, and G. Jung. 2005. Linkage map
construction in allotetraploid creeping bentgrass (Agrostis stolonifera L.).
Theoretical and Applied Genetics 111:795-803.

Chinnusarny, V., M. Ohta, S. Kanrar, B.H. Lee, X.H. Hong, M. Agarwal, and J.K. Zhu.

2003. ICEl: a regulator of cold-induced transcriptome and freezing tolerance in
Arabidopsis. Genes & Development 17: 1043-1054.

16

Clark, R.M., T.N. Wagler, P. Quijada, and J. Doebley. 2006. A distant upstream enhancer
at the maize domestication gene th has pleiotropic effects on plant and
inflorescent architecture. Nature Genetics 38:594-597.

Curley, J., S.C. Sim, S. Warnke, S. Leong, R. Barker, and G. Jung. 2005. QTL mapping
of resistance to gray leaf spot in ryegrass. Theoretical and Applied Genetics
111:1107-1117.

Doligez, A., A. Bouquet, Y. Danglot, F. Lahogue, S. Riaz, C.P. Meredith, K.J. Edwards,
and P. This. 2002. Genetic mapping of grapevine (Vitis vinzfera L.) applied to the

detection of QTLS for seedlessness and berry weight. Theoretical and Applied
Genetics 105:780-795.

F arrall, M. 2004. Quantitative genetic variation: a post-modern view. Hum Mol Genet.13
Spec No l:R1-7

Fanizza, G., F. Lamaj, L. Costantini, R. Chaabane, and MS. Grando. 2005. QTL analysis
for fi'uit yield components in table grapes (Vitis vinifera). Theoretical and Applied
Genetics 111:658-664.

Ferriol, M., B. Pico, and F. Nuez. 2004. Morphological and molecular diversity of a
collection of Cucurbita maxima landraces. Journal of the American Society for
Horticultural Science 129:60-69.

Gilmour, S.J., A.M. Sebolt, M.F. Salazar, J.D. Everard, and M.F. Thomashow. 2000.
Overexpression of the Arabidopsis CBF3 transcriptional activator mimics
multiple biochemical changes associated with cold acclimation. Plant Physiology
124:1854-1865.

Gihnour, S.J., D.G. Zarka, EJ. Stockinger, M.P. Salazar, J.M. Houghton, and M.F.
Thomashow. 1998. Low temperature regulation of the Arabidopsis CBF family of
AP2 transcriptional activators as an early step in cold-induced COR gene
expression. Plant Journal 16:433-442.

Guarino, C., S. Santoro, L. De Simone, O. Lain, G. Cipriani, and R. Testolin. 2006.
Genetic diversity in a collection of ancient cultivars of apple (Malus x domestica
Borkh.) as revealed by SSR-based fingerprinting. Journal of Horticultural Science
& Biotechnology 81:39-44.

Harlan, JR. 1992. Crops and Man. 2nd ed. American Society of Agronomy, Madison,
WI.

Hitchcock 1951. Manual of the grasses of United States. USDA Misc.Publ.200.U.s.Gov.
print. office, Washington, DC.

17

Inoue, M., Z.S. Gao, and H.W. Cai. 2004. QTL analysis of lodging resistance and related

traits in Italian ryegrass (Lolium multiflorum Lam.). Theoretical and Applied
Genetics 109:1576-1585.

Jones, K. 1956a. Species differentiation in Agrostis II. The significance of chromosome
pairing in the tetraploid hybrids of Agrostis canina subsp. montana Hartm., A.
tennis Sibth. and A. stolonifera L. Journal of Genetics. 54:377-393.

Jones, K. 1956b. Species differentiation in Agrostis III. Agrostis gigantea Roth. and its
hybrids with A. Tennis Sibth. and A. stolonifera L. Journal of Genetics 54:394-
399.

Kasuga, M., Q. Liu, S. Miura, K. Yamaguchi-Shinozaki, and K. Shinozaki. 1999.
Improving plant drought, salt, and freezing tolerance by gene transfer of a single
stress-inducible transcription factor. Nature Biotechnology 17:287-291.

Lagercrantz, U. 1998. Comparative mapping between Arabidopsis thaliana and Brassica
nigra indicates that Brassica genomes have evolved through extensive genome
replication accompanied by chromosome fusions and frequent rearrangements.
Genetics 150:1217—1228.

Latin, R. 2006. Residual efficacy of fungicides for control of dollar spot on creeping
bentgrass. Plant Disease 90:571-575.

Liu, S.X., X.L. Wang, Z.Q. Fan, Y.Z. Pang, X.F. Sun, X.R. Wang, and K.X. Tang. 2004.
Molecular cloning and characterization of a novel cold-regulated gene from
Capsella bursa-pastoris. DNA Sequence 15:262-268.

Menkir, A., MD. Olowolafe, I. Ingelbrecht, I. Fawole, B. Badu-Apraku, and BI. Vroh.
2006. Assessment of testcross performance and genetic diversity of yellow

endosperm maize lines derived from adapted x exotic backcrosses. Theoretical
and Applied Genetics 113:90—99.

Menz, M.A., R.R. Klein, J .E. Mullet, J .A. Obert, N.C. Unruh, P.E. Klein. 2002. A high-
density genetic map of Sorghum bicolor (L.) Moench based on 2926 AFLP®,
RFLP and SSR markers. Plant Molecular Biology 48: 483—499.

Mohapatra, S.S., L. Wolfi'aim, R.J. Poole, and RS. Dhindsa. 1989. Molecular-Cloning
and Relationship to Freezing Tolerance of Cold-Acclimation-Specific Genes of
Alfalfa. Plant Physiology 89:375-380.

Morley, M., C.M. Molony, T.M. Weber, J.L. Devlin, K.G. Ewens, R.S. Spielman, and

V.G. Cheung. 2004. Genetic analysis of genome-wide variation in human gene
expression. Nature 430:743-747.

18

Muylle, H., J. Baert, E. Van Bockstaele, J. Pertijs, and I. Roldan-Ruiz. 2005. Four QTLS
determine crown rust (Puccinia coronata f. sp lolii) resistance in a perennial
ryegrass (Lolium perenne) population. Heredity 95:348-357.

Nordin, K, P. Heino, and ET. Palva. 1991. Separate Signal Pathways Regulate the
Expression of a Low-Temperature-Induced Gene in Arabidopsis-Maliana (L)
Heynh. Plant Molecular Biology 16: 106 l- 1071 .

Paull, J.G., K.J. Chalmers, A. Karakousis, J.M. Kretschmer, S. Manning, and P.
Langridge. 1998. Genetic diversity in Australian wheat varieties and breeding
material based on RFLP data. Theoretical and Applied Genetics 96:435-446.

Rafalski, A. 2002. Applications of single nucleotide polymorphisms in crop genetics.
Current Opinion in Plant Biology 5:94-100.

Rajasekar, S., S.H. Fei, and NE. Christians. 2006. Analysis of genetic diversity in rough
bluegrass determined by RAPD markers. Crop Science 46: 162-167.

Reicher, Z.J., and GS. Throssell. 1997. Effect of repeated fungicide applications on
creeping bentgrass turf. Crop Science 37:910-915.

Saha, M.C., R. Mian, J.C. Zwonitzer, K. Chekhovskiy, and A.A. Hopkins. 2005. An
SSR- and AFLP-based genetic linkage map of tall fescue (F estuca arundinacea
Schreb.). Theoretical and Applied Genetics 110:323-336.

Sheen, J. 1998. Mutational analysis of protein phosphatase 2C involved in abscisic acid
signal transduction in higher plants. Proceedings of the National Academy of
Sciences of the United States of America 95:975-980.

Shinozaki, K., and K. Yamaguchi-Shinozaki. 2000. Molecular responses to dehydration
and low temperature: differences and cross-talk between two stress signaling
pathways. Current Opinion in Plant Biology 3:217-223.

Stockinger, E.J., S.J. Gilmour, and M.F. Thomashow. 1997. Arabidopsis thaliana CBFl
encodes an AP2 domain-containing transcriptional activator that binds to the C-
repeat/DRE, a cis-acting DNA regulatory element that stimulates transcription in
response to low temperature and water deficit. Proceedings of the National
Academy of Sciences of the United States of America 94: 1035-1040.

Tar'an, B., C. Zhang, T. Warkentin, A. Tullu, and A. Vandenberg. 2005. Genetic
diversity among varieties and wild species accessions of pea (Pisum sativum L.)

based on molecular markers, and morphological and physiological characters.
Genome 48:257-72.

19

Thomashow, M.F., S.J. Gilmour, E.J. Stockinger, K.R. Jaglo-Ottosen, and DC. Zarka.
2001. Role of the Arabidopsis CBF transcriptional activators in cold acclimation.
Physiologia Plantarum 112: 171-175.

Thompson, J.A., and KL Nelson. 1998. Utilization of diverse germplasm for soybean
yield improvement. Crop Science 38: 1362-1368.

Tommasini, L., J. Batley, G.M. Arnold, R.J. Cooke, P. Donini, D. Lee, J.R. Law, C.
Lowe, C. Moule, M. Trick, and K.J. Edwards. 2003. The development of
multiplex simple sequence repeat (SSR) markers to complement distinctness,

uniformity and stability testing of rape (Brassica napus L.) varieties. Theoretical
and Applied Genetics 106:1091-101.

Vergara, G.V., and SS. Bughrara. 2003. AFLP analyses of genetic diversity in bentgrass.
Crop Science 43:2162-2171.

Vergara, G.V., and SS. Bughrara. 2004. Genetic differentiation of tetraploid creeping
bentgrass and hexaploid redtop bentgrass genotypes by AFLP and their use in
turfgrass breeding. Crop Science 44:884-890.

Viji, G., W. Uddin, N.R. O'Neill, S. Mischke, and J.A. Saunders. 2004. Genetic diversity
of Sclerotinia homoeocarpa isolates from turfgrasses from various regions in
North America. Plant Disease 88: 1269-1276.

Vincelli, P., J.C. Doney, and A]. Powell. 1997. Variation among creeping bentgrass
cultivars in recovery from epidemics of dollar spot. Plant Disease 81199-102.

Wu, C., and T. Hsiang. 1998. Pathogenicity and formulation of Typhula phacorrhiza, a
biocontrol agent of gray snow mold. Plant Disease 82: 1003-1006.

Yamaguchi-Shinozaki, K., and K. Shinozaki. 2001. Improving plant drought, salt and
freezing tolerance by gene transfer of a single stress-inducible transcription factor.
Rice Biotechnology: Improving Yield, Stress Tolerance and Grain Quality
236: 176-189.

Zhao, H., and SS. Bughrara. 200X. Genetic relationships among snow mold resistant
clones of creeping bentgrass. Submitted

20

CHAPTER 1
GENETIC DIVERSITY IN COLONIAL BENTGRASS (Agrostis capillaris L.)
REVEALED BY ECORI/MSEI AND PSTI/MSEI AFLP MARKERS

21

Abstract

The colonial bentgrass species (Agrostis capillaris L.) is a potential source for genetic
improvement of resistance to environmental stress and disease for other bentgrass species
(Agrostis spp.). To conserve and study the existing genetic resources of colonial
bentgrass for use in breeding, genetic diversity in the colonial bentgrass species was
investigated using amplified fragment length polymorphism (AFLP) markers. Included in
this study were twenty-two accessions from USDA germplasm collected from 11
countries, consisting of fourteen accessions from northern Spain, and three commercial
cultivars. Ten EcoRI/MseI and six PstI/MseI AFLP primer combinations produced 181
and 128 informative polymorphic bands, respectively. Cluster analysis of genetic
similarity estimates revealed a high level of diversity in colonial bentgrass species with
averages of 0.51 (EcoRI/Msel) and 0.63 (PstI/Msel). Greater genetic diversity was
detected by the EcoRI/Msel AF LP primer combinations. A low but Significant positive
correlation (r=0.44, p=0.0099) between the two Jaccard similarity matrices was obtained
by the Mantel test. Commercial cultivars of bentgrass Showed a narrow genetic
background. The assessment of genetic diversity among colonial bentgrass accessions
suggested the potential value of the colonial bentgrass germplasm in turfgrass cultivar

improvement.

Key words: Colonial bentgrass, Genetic diversity, AF LP, Cluster analysis

22

Introduction

Colonial bentgrass (Agrostis capillaris L. 2n=4x=28), native to Europe and temperate
Asia, is commonly used for tennis courts, high-grade lawns, fairways and erosion control
(Hubbard, 1984). Colonial bentgrass prefers mowing height between 1.0 to 2.5 cm, which
limits its use on the golf course to fairways and tees (Ruemmele, 2003). For this reason
colonial bentgrass has been partially replaced by creeping bentgrass (Agrostis stolonifera
L. 2n=4x=28), which has a fine texture, high density, and good adaptation to low mowing
height (Warnke, 2003). However, creeping bentgrass is susceptible to a wide range of
fungal diseases such as dollar spot, caused by Sclerotinia homoeocarpa (Murphy et al.,
2000), and gray snow mold caused by Typhula incarnata (Wu and Hsiang, 1998). Dollar
spot is a foliar disease favored by high humidity, warm days, and cool nights. Gray snow
mold is common in cold, humid conditions, especially under snow cover. These diseases
are particularly important in northern regions of the United States where they cause
considerable turf loss. Every year, at least one hundred million dollars worth of
fungicides are applied to control these diseases, much of it for snow mold and dollar spot

(Watson et al., 1992).

Certain colonial bentgrass accessions are widely recognized as having good resistance
to gray snow mold (V ergara and Bughrara, 2005) and dollar spot (Belanger et al., 2004).
Transferring resistance from colonial to creeping bentgrass is a promising goal in
bentgrass breeding programs. Hybridization between creeping and colonial bentgrass
species can occur naturally in the field (Jones, 1956) or in the greenhouse (Belanger et al.,

2003), which makes it possible to utilize the colonial bentgrass disease resistance by

23

genome introgression to the creeping bentgrass species. Assessment of genetic diversity
among accessions of colonial bentgrass species could contribute to the elimination of
undesirable duplications in the germplasm collection and increase the efficiency of
research efforts. Researchers could select potential diverse resistant genes from different
colonial bentgrass sources, and incorporate and pyramid them into creeping or other

bentgrass species to enhance levels and durability of disease resistance.

Estimates of genetic distance based on molecular markers have proven a usefirl method
for describing genetic diversity and distinguishing heterotic groups within plant species
because of their abundant polymorphism and the fact they are independent of
environmental effect. Several types of molecular markers are available for evaluating the
extent of genetic diversity in crops. These include restriction fragment length
polymorphism (RFLP); (Paull et al., 1998), random amplified polymorphic DNA (RAPD);
(Garcia-Mas et al., 2001), amplified fragment length polymorphism (AFLP); (V ergara
and Bughrara, 2003; Mian et al., 2002), and microsatellite or simple sequence repeat
(SSR); (Bumham et al., 2002). Species-Specific RF LP and SSR markers are unavailable
in colonial bentgrass due to a lack of existing genomic information. AFLP involving the
use of random, largely dominant markers is efficient and cost-effective and requires no
prior sequence knowledge. AF LP markers can be generated by CN G methylation-
sensitive (PstI/MseI) or by CNG methylation-insensitive (EcoRI/Msel) restriction enzyme
combinations. AF LP analysis has been applied increasingly for genetic diversity research,
and is suitable for evaluating genetic diversity among turfgrass Species in which the

genetic information is limited (Guthridge et al., 2001; Vergara and Bughrara, 2003).

24

The genetic diversity of the colonial bentgrass species has not been studied previously.

The objectives of this study were to identify new collected colonial bentgrass
germplasm and confirm correct Species by mitotic analysis, to investigate the genetic
diversity in a collection of the colonial bentgrass species by using AFLP markers
(EcoRI/Msel and PstI/MseI enzyme combinations), and to compare the correlation

between estimates of genetic diversity derived from these two enzyme combinations.

Materials and Methods

Plant materials

Twenty-two different accessions of colonial bentgrass collected from 11 countries
were obtained from the USDA Regional Plant Introduction Station (Pullman,
Washington). Another fourteen colonial bentgrass accessions were collected from
northern Spain. Three commercial cultivars ‘Golfin’, ‘SR 7150’, ‘Tiger’ were also

included in this study (Table 2.1).

AFLP analysis

Total genomic DNA was extracted from fresh leaves of 25 plants per accession using
the protocol of Gill et al. (1991), and was quantified by DYNA Quant 200 Fluorometer

(Pharrnacia Biotech, San Francisco, CA). Approximately 200 ng of DNA was digested

25

with two restriction enzyme combinations (EcoRI/Msel and PstI/MseI). The PstI and
EcoRI are six base pair cutters that are methylation-sensitive and methylation-insensitive,
respectively. The MseI is a four base pair cutter. The AF LP protocol applied in this
research was as described by Vos et a1. (1995) with some modifications. Preamplification
was done on PTC-lOO thermal cycler (MJ Research, Waltham, MA) using 30 cycles of
94°C 453, 52°C 45s, 72°C 1min, followed by elongation at 72°C 10min. Combinations of
fluorescent dye labeled PstI and non-labeled MseI primers, each with three selective
nucleotides at the 3’ ends, were used for selective amplification with 56°C annealing
temperature. Adapters and pre-primers used include MseI adapter, M00 (universal
primer), EcoRI adapter, E00 (universal primer), PstI adapter, P00 (universal primer) as
listed in Table 2.2. The PCR products were separated on 5% denaturing polyacrylarrride
gels at a constant 800V for 6h at 50°C and analyzed with a LI-COR DNA Analyzer A200
(LI-COR Inc., Lincoln, NE). The PCR products from the other EcoRI /MseI primer
combinations with three selective nucleotides at the 3’ ends were separated on 5%
denaturing polyacrylamide gels and were visualized with silver staining following the

protocol of the Promega silver DNA sequencing systemTM (Promega Inc., Madison, WI).

Mitotic Analysis

Plants were grown in the greenhouse at 20 :t 5°C. Roots of the plants were collected at
1:00 pm. They were pretreated in 0°C water for 25 h to accumulate metaphase cells, fixed
in 3:1 ethanol (95%, v/v), acetic acid (Farmer’s fixative), and stored at 4°C. Root tips
were macerated in 45% acetic acid for 10 to 20 min, were squashed on a glass slide and

flame-dried. Slides were viewed under a phase contrast microscope to determine the

26

number of chromosomes in the root-tip cell. In the metaphase, the chromosome numbers
of the 14 accessions from northern Spain were counted. Images of chromosomes were
recorded on film using a single-lens reflex camera attached to an Olympus (BX-51)

microscope system at 1,500 X magnification.

Data Analysis

Gels were visualized by means of Gene ImagIR 4.0 (Scanalytics, Inc., VA). Bands that
Showed clear polymorphisms were scored visually as present (‘1’) or absent (‘0’). Bands
of different electrophoretic mobilities were assumed to be non-allelic, while bands of the
same mobility were assumed to be allelic. Some ambiguous bands were ignored. Genetic
diversity analyses were conducted by using Numerical Taxonomy and the Multivariate
Analysis System, NTSYSpc v.2.2 (Rohlf, 1993). Genetic similarities based on Jaccard’s
coefficients (J accard, 1908) were computated among all possible pairs with the
SIMQUAL option and ordered in a similarity matrix. The similarity matrix was run by
Sequential, Agglomerative, Hierarchical, Nested clustering (SAHN); (Sneath and Sokal,
1973) with Unweighted Pair Group Method with Arithmetic Mean (U PGMA) as an
option (Sokal and Michener, 1958). The dendrogram and cluster groupings were
constructed by the UPGMA clustering algorithm from the SAHN option of NTSYSpc
v2.2. Cophenetic correlation was calculated to measure goodness of fit between the
similarity and cophenetic matrices. Principle coordinate analysis was run with the
Common Principal Components Analysis (CPCA) option (NT SYS) to identify the
number of groups based on eigenvectors. The principal coordinates' analysis result was

displayed by the Mod3D plot module. Correlation between the two matrices obtained

27

with two marker sets was estimated by means Of the Mantel matrix correspondence test

(Mantel, 1967).

Results

Chromosome numbers of 14 accessions of colonial bentgrass collected fi'om northern
Spain.

Five root-tip cells per accession showed that all 14 of the accessions have 28
chromosomes at metaphase. These chromosomes are uniform in length (Fig.2.1). Based
on the chromosome number, we can distinguish these accessions from dryland bentgrass

(Agrostis castellana) which has 42 chromosomes.

Cluster analysis determined by EcoRI/Msel AFLP markers.

The AFLP fiagment size ranged from 50 bp to 1000 bp, but only the bands from 150
bp to 500 bp were selected. A total of 181 unequivocally recognizable polymorphic
bands were obtained. The number of polymorphic bands varied from seven (EcoRI-
CTG/MseI-ATG) to 25 (EcoRI-AGC/MseI-CAC) among the accessions by using
different primer combinations. Pair-wise comparison of genetic similarity among
accessions revealed a wide genetic diversity within the colonial bentgrass species. The
genetic similarity (J accard) coefficients (GSj) ranged fiom 0.34 to 0.70 with a mean of

0.51. The most similar colonial bentgrass accessions were SP 1274 collected from Spain

28

and PI 491264 collected from Finland (GS,- =0.70), followed by P1290708 and P1420235
(GS,- =0.69) both collected from England. The least similar accessions (GS,- =0.34) were
detected among SP 1270 from Spain and PI 325194 collected from the Russian
Federation.

A dendrogram among 39 colonial accessions based on their cluster analysis of GS,-
coefficients showed that no major ‘ball cluster’ (Rohlf, 1993) was found (Fig.2.2). The
14 colonial bentgrass accessions collected from Spain formed three main groups that
were separated into other colonial bentgrass PI accessions from the USDA germplasm
collection. The first group consisted of accession numbers SP 1274, SP 1275, SP 1285,
SP 1278, SP 1286, SP 1273 and SP 1276 with an average GS,- of 0.63. Three commercial
colonial bentgrass cultivars (Golfin, SR 7150 and Tiger) were assigned to this group (GS,-
=O.65). SP1265 and SP1266 were clustered into the second group (GS,- =0.64). The third
group possessed accessions SP 1267, SP 1269, SP 1268 and SP 1271 (GS,- =0.56). SP
1270 was separated from the other colonial bentgrass accessions in the dendrogram by a
finer leaf when grown in the greenhouse. The three accessions collected from England, PI
42023 5, P1420236 and PI 290708 clustered with each other (OS, =0.66), but none of the
four accessions from Turkey clustered together and had a low GS,- (0.47). Three PI
accessions from the United States, P1469217, PI 578528 and PI 578528 which we were
unable to group, Showed a wide genetic diversity (GS,- =0.43). PI 469217 and PI 578528
were reclassified as dryland bentgrass on the basis of their morphological characteristics
(Steiner and Lupold, 1978). However in this research, these two accessions showed no

evidence of deviation from other colonial accessions. P1469217 was grouped with

29

P1252045, PI 538785, PI 237717 and PI 578528 from Italy, the Former Soviet Union,

Germany and the US respectively with an average GS,- of 0.60.

Cluster analysis determined by PstI/MseI AFLP markers.

Six AFLP primer pairs produced 128 polymorphic bands based on the selection criteria
mentioned above (150 bp-500 bp), resulting in an average of 20 polymorphic loci per
primer pair. Values of GSj ranged from 0.99 between commercial cultivar SR 7500 and
the Spanish accession SP 1267 to 0.45 between P1325194 fiom Stavropol, the Russian
Federation, and the Spanish accession SP 1270. Using the CPCA subroutine programs of
NTSYS, a rotated PCA with the AFLP markers was used to determine the number of
groups based on Eigen values >1. Three groups were formed with an average GS,- =0.63
(Fig. 2.3). Thirty-three accessions were clustered in the first group. The second group
consisted of five accessions and the third group comprised only PI 325194. Fig.2. 4
Shows the dendrogram generated from the UPGMA cluster analysis with one possible tie
found between the closest pair. In the first group, a mean GS,- for all colonial bentgrass
accessions was 0.71 consisting of more than 80% tested materials. Thirteen out of 14
accessions from Spain were clustered in this group except accession SP 1270. No main
subgroup was formed among these 13 accessions. Within this group, three cultivars,
Golf'm, SR 7150 and Tiger, clustered in a subgroup with a mean GS,- =0.95, which is
Similar to EcoRI/Msel AF LP analysis. Commercial cultivar SR 7150 and Spanish
accession SP 1276 shared the highest genetic similarity with a GS,=0.99. The second
group consisted of five other accessions collected from five different countries with a

mean of GS,- =0.62. P1469217 from the United States and four other accessions (PI

30

237717, P1252045, P1440109 and SP 1270) were clustered in this group. In the third
group, P1 325194 showed the largest genetic distance fi'om accession SP 1270 in the
whole dendrogram, which is consistent with the results obtained from the EcoRI/Msel

enzyme combination.

Comparison between two sets of AFLP restriction enzyme combinations.

The co-phenetic correlation coefficients (r-value) for EcoRI/Msel was 0.94 and
PstI/Msel data was 0.95, suggesting a good fit between the dendrogram clusters and the
similarity matrices from which they were derived. AF LP markers from PstI/MseI
(methylation sensitive) produced higher estimates of GS,- with a narrower distribution
than those by EcoRI/Msel (methylation insensitive) in the colonial bentgrass species. A
low but Significantly positive correlation between the genetic similarity coefficients
Obtained through these two restriction enzyme combinations was observed (r=0.44
p=0.0099, one-tailed Mantel test). The pattern of clustering of the genotypes remained
more or less the same between the two enzyme combinations in both dendrogram figures.
The three cultivars showed the closest genetic relationship based on the GS,- in both
experiments. PI 325194 and SP 1270 showed the least genetic similarity coefficients,
with SP 1270 separated from other Spanish accessions in both enzyme combinations.
However, the different classification of accessions was also detected between two figures.
Three major groups were clustered by using the PstI/MseI AF LP markers, but the same

groups were not formed using the EcoRI/Msel. combination.

31

Discussion

Verification of colonial bentgrass accessions collected from northern Spain.

Colonial bentgrass is taxonomically related to dryland bentgrass (Agrostis castellana),
which makes it difficult to distinguish between the two species based on phenotype.
However, the colonial bentgrass species has 28 chromosomes and the dryland bentgrass
Species has 42 chromosomes (Jones, 1953; Bjorkrnan, 1954), making it possible to
distinguish between the two species based on the number of chromosomes. The identity
of 14 Spanish accessions was confirmed in this study by counting chromosome numbers.
The C-banding technique can also provide more cytological information on chromosome
descriptions (Friebe et al., 1992) by comparing the C-banding patterns between the

Spanish accessions and the USDA PIS for further analysis of their relationship.

Comparison between two enzyme combination results.

In this study, a set of EcoRI/Msel and PstI/MseI AFLP markers were utilized to
determine the genetic similarity among colonial bentgrass accessions and produced two
dendrograms which shared a low correlation (r=0.44, p=0.0099). The explanation for the
difference might be that markers from two restriction enzyme combinations target
different regions of the genome. The EcoRI/Msel combination can produce three kinds of
fragments that include the EcoRI/EcoRI, the EcoRI/Msel and the MseI/Msel types
originating from both the methylation sensitive and insensitive regions. All of these

bands can be detected with silver staining technique, and are prone to cluster along the

32

hypennethylation regions of the genome, such as the region around the centromere
(Menz et al., 2002). The PstI/Msel combination also can produce three kinds of
fiagments including PstI/PstI, PstI/MseI and MseI/MseI types. In this experiment, we
labeled the PstI primer. The MseI/Msel fragments do not have fluorescent dye labeled
primer ends, and therefore cannot be visualized and scored. The PstI/PstI and PstI/Msel
fragments produced from unmethylated regions of the genome can be visualized because
of their labeled ends. Bands generated by the PstI/Msel combination are distributed along
the genome except for the methylated regions of the chromosomes (Young et al., 1999).
The genome region distribution of the AFLP markers did affect the classification of 39
accessions although there is a correlation between two clustering results. The lower
estimates of GS,- from the EcoRI/Msel combination compared with PstI/MseI can be
explained by the higher variation within the hypermethylated regions compared to
hypomethylated regions of colonial bentgrass species. Barrett and Kidwell (1998)
evaluated the genetic diversity of wheat cultivars using AF LP markers produced from
PstI/MseI and EcoRI/Msel combinations, and a low correlation (r=0.53 p=0.001) was
observed between two genetic diversity estimate matrices. With the advent of high-
density genetic maps and high-throughout marker systems for turfgrass species (Jones et
al., 2002), it is possible to estimate genetic diversity with a large number of markers that
are evenly distributed across the plant genome. The advantage of using markers
distributed over the entire genome with known map position instead of by random
selection should make it possible to avoid over- or under-representation of certain regions
of the genetic map, thus avoiding inaccurate estimates of genetic similarities among

individuals.

33

Genetics diversity among the colonial bentgrass species.

Information about genetic diversity permits the classification of germplasm into
heterotic groups, which affects the potential genetic gain through breeding selection
(Casler et al., 2003). Genetic diversity among the accessions provides the information for
core germplasm collection. AF LP-based genotyping was effective in revealing DNA
polymorphism for fingerprinting among colonial bentgrass accessions representing 12
countries. A low level of genetic similarity among colonial bentgrass accessions is a
result of their inter-pollination characteristics. The wide genetic background in this
Species provides diverse germplasm for exploiting and pyramiding disease resistance into
the bentgrass cultivars. Highly related as well as diverse accessions can be grouped and
distinguished by AFLP marker analysis, and the diverse disease resistant accessions from
heterotic groups will be selected and used in breeding. Further allelism tests are needed
to determine if loci controlling disease resistance have a high level of diversity in selected
accessions. Utilizing interspecific and intraspecific hybridization between these diverse
resistant colonial bentgrass accessions and creeping bentgrass species is the promising

goal of bentgrass breeding.

AFLP analysis revealed its usefulness for assessing the germplasm collection. The 14
accessions collected from Spain were included in this study. AFLP clustering results
showed that 14 accessions were distributed in the colonial bentgrass accessions from the
USDA germplasm collection, and revealed a broad genetic diversity with high

similarities observed between some accessions. Spain is one of the native areas of origin

34

of the colonial bentgrass species and is well suited for exploitation of diverse germplasm.
In this study, the accessions from different countries showed different levels of genetic
diversity. For example, three accessions from England have high genetic similarities,
whereas the four accessions from Turkey showed wide genetic diversity. The genetic
diversity of three commercial cultivars released within the past 20 years in the US.
revealed that genetic backgrounds were more closely related to accessions from Spain,
than from other countries. In contrast to the broad diversity existing among the colonial
bentgrass accessions, these three cultivars share a very narrow genetic base. Variability of
germplasm will play a key role in future turfgrass (bentgrass) breeding selection and

genomic research.

35

Table 2.1 List of PIS, species, geographic origin and chromosome number of colonial

bentgrass accessions

 

 

Colonial bentgrass accessions Origin chromosome number
PI 171470 A grostis capillaris Turkey 28
PI 172698 Agrostis capillaris Turkey 28
PI 204397 Agrostis capillaris Turkey 28
PI 206626 Agrostis capillaris Turkey 28
PI 234685 Agrostis capillaris Denmark 28
PI 23 77 l 7 Agrostis capillaris Germany 28
PI 252045 Agrostis capillaris Italy 28
PI 283173 Agrostis capillaris Czechoslovakia 28
PI 290708 Agrostis capillaris England, UK 28
PI 325194 Agrostis capillaris Stavropol, Russian Federation 28
PI 392338 Agrostis capillaris Former Soviet Union 28
PI 420235 Agrostis capillaris England, UK 28
PI 420236 Agrostis capillaris England, UK 28
PI 440109 Agrostis capillaris Stavropol, Russian Federation 28
PI 469217 Agrostis capillaris Oregon, US 28
PI 491264 Agrostis capillaris Finland 28
PI 494120 Agrostis capillaris Germany 28
PI 494121 Agrostis capillaris Netherlands 28
PI 509437 Agrostis capillaris Romania 28
PI 538785 Agrostis capillaris Former Soviet Union 28
PI 578527 Agrostis capillaris Oregon, US 28
PI 578528 Agrostis capillaris Rhode Island, US 28
SP1286 Agrostis capillaris Spain 28“
SP1265 Agrostis capillaris Spain 28*
SP1266 Agrostis capillaris Spain 28*
SP1267 Agrostis capillaris Spain 28*
SP1268 Agrostis capillaris Spain 28"
SP1269 Agrostis capillaris Spain 28*
SP1270 Agrostis capillaris Spain 28*
SP1271 Agrostis capillaris Spain 28"
SP1273 Agrostis capillaris Spain 28"
SP1274 Agrostis capillaris Spain 28“I
SP1275 Agrostis capillaris Spain 28"
SP1276 Agrostis capillaris Spain 28‘I
SP1278 Agrostis capillaris Spain 28"
SP1285 Agrostis capillaris Spain 28"
Tiger Agrostis capillaris Cultivars 28
Golfin Agrostis capillaris Cultivars 28
SR7150 A grostis capillaris Cultivars 28

 

*Number of chromosome was determined in this study.

36

Table 2.2 List of adapters and pre-primers used

 

 

Primer/adapters Sequences
MseI adapter 5 ' -GACGATGAGTCCTGAG-3’
3 ' -TACTCAGGACTCAT-5 ’
M00 (universal primer) GATGAGTCCTGAG TAA
EcoRI adapter 5’-CTCGTAGACTGCGTACC-3'
3 ’ -CTGACGCATGG'ITAA-5 ’
E 00 (universal primer) GACTGCGTACCAATTC
PstI adapter 5 ’ -ACGCAGTCTACGAGTGCA-3 '

3 ' -CCATGCGTCAGATGCTC-5 ’
P00 (universal primer) CAGTCTACGAGTGCAG

 

37

Fig. 2.1 Mitosis of colonial bentgrass accession of SP1275 from Spain. 28 chromosomes

were observed.

1- "rr‘
‘2. ,,-u ,
. ‘S
" ‘r‘l CC

38

Figure 2.2 UPGMA dendrogram of 39 colonial bentgrass accessions revealed by EcoRI/Msel AF LP markers

H‘I'f DEMO-1‘ (75 C050 O—‘OOOl‘-4r.|f.r=l‘~ r'r'TOJ‘:

WOO” "To (I o "‘1“. f‘ If H“ O‘J-OW'Tc-OFI MCXOO‘.
:2'“S“ “ =w HE ::Tsrsasa 273“
v --I -‘ I \' I .
comer "‘30 .I'I'I- "° 8" Efif‘fficoggo I -I --.~'icr.vr £333: 4 rI-rgr?
$32—11...th 6.2pr .. It It" rage Ir Inf—3r It I: Wdfiflv'r 'Ziflr It It to 5433’ I
GHQ-MG-IOB-dOa—dl—H—I—Jvm—wfium-w-rflu mamma—~~—mmmm~

u l

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

39

0.70

0.64

0.59
Similarity Coefficient

0.53

W

 

0.47

m 95:6

 

N 9:80

A .m
.> m>mHZ we 20qu 8E 28 <95 65 80b m 98 .N 4 mm @832: 3.5% web: guano: £85808 339:3 EEO—co am :5...
£8.38 EwEEQFA—oa 5&5: EoEwEm uoczmfim MN— fits marge. E2388 39055 no “2: REESEEOEFH m.N 223m

40

2.20508 £335

8... 3o 2.... Be one
2.223 r .

r flaw—mm

. Orr .— -
a: 31.3

1.. a -

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

'3000

(
rim—inn

and-in.“

 

if
so
a:
'?
cowwo

 

r.

 

 

00
N".
V.
H

 

 

.2832: AS"? EHVSEQ .3 @285: @2888 383:3 EEO—co on Co 838:5: <20m3 YN 83E

References

Barrett, B.A., K.K. Kidwell. 1998. AFLP-based genetic diversity assessment among
wheat cultivars from the Pacific Northwest. Crop Science 38: 1261-1271.

Belanger, F .C., S. Bonos, W.A. Meyer. 2004. Dollar spot resistant hybrids between
creeping bentgrass and colonial bentgrass. Crop Science 44: 581-586.

Belanger, F .C., T.R. Meagher., P.R. Day., K. Plumley, W.A. Meyer. 2003. Interspecific
hybridization between Agrostis stolonifera and related Agrostis species under
field conditions. Crop Science 43: 240—246.

Bjorkrnan, 8.0. 1954. Chromosome studies in Agrostis II. Hereditas 40 (2): 254-258.

Burnham, K.D., D.M. Francis, A.E. Dorrance, R.J. Fioritto, S.K. Martin. 2002. Genetic
diversity patterns among Phytophthora resistant soybean plant introductions
based on SSR markers. Crop Science 42: 338—343.

Casler, M.D., Y. Range1., J.C. Stier, G. Jung. 2003. RAPD marker diversity among
creeping bentgrass clones. Crop Science 43: 688—693.

Friebe, B., Y. Mukai, B.S. Gill. 1992. C-banding polymorphisms in several accessions of
Triticum tauschii (Aegilops squarrosa). Genome 35: 192-199.

Garcia-Mas, J ., M. Oliver, H. GOmez-Paniagua, M.C. de Vicente. 2001. Comparing
AFLP, RAPD and RFLP markers for measuring genetic diversity in melon.
Theoretical and Applied Genetics 101: 860-864.

Gill, K.S., E.L. Lubbers, B.S. Gill. 1991. A genetic linkage map of Triticum tauschii (DD)
and its relationship to the D genome of bread wheat (AABBDD). Genome 34:
362-373.

Guthridge, K.M., M.P. Dupal, R. Kolliker, E.S. Jones, K.F. Smith, J .W. Forster. 2001.
AFLP analysis of genetic diversity within and between populations of perennial
ryegrass (Lolium perenne L.). Euphytica 122: 191-201.

Hubbard, J.C.E. 1984. Grasses: A guide to their structure, identification, uses and
distribution in the British Isles. 3rd ed. Viking Penguin, Inc., New York, pp. 298-
299, 327.

Jaccard, P. 1908. Nouvelles recherches sur la distribution floral. Bull. Soc. Vaud. Sci. Nat.
44: 223-270.

42

Jones, E.S., M.D. Dupal, J .L. Dumsday, L.J. Hughes, J .W. Forster. 2002. An SSR-based
genetic linkage map for perennial ryegrass (Lolium perenne L.). Theoretical and
Applied Genetics 105: 577-584.

Jones, K. 1953. The cytology of some British species ongrostis and their hybrids.
British Agricultural Bulletin 5: 316.

Jones, K. 1956. Species differentiation in Agrostis. II. The Significance of chromosome
pairing in the tetraploid hybrids ongrostis canina subsp. montana Hartrnn, A.
tenuis Sibth and A. stolonifera L. Journal of Genetics 54: 377—393.

Mantel, N. 1967. The detection of disease clustering and a generalized regression
approach. Cancer Research, 27: 209-220.

Menz, M.A., R.R. Klein, J .E. Mullet, J .A. Obert, N.C. Unruh, P.E. Klein. 2002. A high-
density genetic map of Sorghum bicolor (L.) Moench based on 2926 AFLP®,
RFLP and SSR markers. Plant Molecular Biology 48: 483—499.

Mian, M.A.R., A.A. Hopkins, J .C. Zwonitzer. 2002. Determination of genetic diversity in
tall fescue with AF LP markers. CrOp Science 42: 944—950.

Murphy, J .A., W.A. Meyer., K.A. Plumley, B.B. Clarke, S.A. Bonos, W.K. Dickson, J .B.
Clark, D.A. Smith, T.J. Lawson. 2000. Performance of bentgrass cultivars and
selections in New Jersey turf trials. In 1999 Rutgers Turfgrass Proceedings.
New Jersey Turfgrass Expo, Atlantic City, NJ. vol. 31.

Paull, J .G., K.J. Chalmers, A. Karakousis, J .M. Krestchmer, S. Manning, P. Langridge.
1998. Genetic diversity in Australian wheat varieties and breeding material based
on RFLP data. Theoretical and Applied Genetics 96: 435—446.

Rohlf, F.J. 1993. NTSYS-PC. Numerical taxonomy and multivariate analysis system.
Exeter Software, New York.

Ruemmele, BA. 2003. Agrostis capillaris (Agrostis tenuis Sibth.) colonial bentgrass.
In M.D. Casler and RR. Duncan (ed.) Turfgrass biology, genetics, and breeding.
John Wiley & Sons, Hoboken, NJ. pp. 187—200.

Sneath, P.H.A., R.R. Sokal. 1973. Numerical Taxonomy. Freeman, San Francisco, CA.

Sokal, R.R., C.D. Michener. 1958. A statistical method for evaluating systematic
relationship.University Kansans Science Bulletin 28: 1409—1438.

Steiner, A.M., H. Lupold. 1978. The verification of species of Agrostis by means of

morphological characters of the florets. Landwirtschaftliche-Forschung 31 (4):
359-369, in CAB Abstracts no. 790782352.

43

Vergara, G.V., S.S. Bughrara. 200x. Evaluation of Bentgrass for Resistance to Typhula
incarnata Lasch. Plant Disease (submitted).

Vergara, G.V., S.S. Bughrara. 2003. AFLP analyses of genetic diversity in bentgrass.
Crop Science 43: 2162—2171.

Vos, R, R. Hogers, M. Bleeker, M. Reijans, T.V.D. Lee, M. Homes, A. Fritjers, J. Pot, J.
Poleman, M. Kuiper, M. Zabeau.1995. AFLP: A new technique for DNA
fingerprinting. Nucleic Acid Research 23: 4407—4414.

Warnke, S. 2003. Creeping bentgrass (Agrostis stolonifera L.). In M.D. Casler and RR.
Duncan(ed.) Turfgrass biology, genetics, and breeding. John Wiley & Sons,
Hoboken, NJ. pp. 175-185.

Watson, J.R., H.E. Kaerwer, D.P. Martin.1992. The turfgrass industry. In D.V.
Waddington et al. (ed.) Turfgrass. ASA, Madison, WI. pp. 29-88.

Wu, C. and T. Hsiang. 1998. Pathogenicity and Formulation of Typhula phacorrhiza, a
Biocontrol Agent of Gray Snow Mold. Plant Disease 82: 1003-1006.

Young, W.P., J .M. Schupp, P. Keim. 1999. DNA methylation and AFLP marker
distribution in the soybean genome. Theoretical and Applied Genetics 99: 785—
790.

CHAPTER 2
GENERATION AND CHARACTERIZATION OF INTERSPECIFIC HYBRIDS
BETWEEN COLONIAL AND CREEPING BENTGRASS

45

Abstract

Creeping bentgrass (Agrostis stolonifera L.) is commonly used in putting greens, tees
and fairways. No commercial cultivars exhibited an adequate tolerance to various fungal
pathogens such as dollar spot (Sclerotinia homeocarpa), gray snow mold (Typhula
incarnata), and brown patch (Rhizoctonia solani). The related species, colonial bentgrass
(A. capillaris L.), has good level of resistance to dollar spot and snow mold. To improve
resistance on creeping bentgrass, interspecific hybrids between creeping bentgrass and
colonial bentgrass were generated for introgression of resistance genes. The hybrids
(2n=28) were confirmed by a species-specific sequence characterized amplified region
(SCAR) marker present in the colonial bentgrass genome. In addition, cytogenetic
analysis revealed an average of seven ring bivalents, several univalents and multivalents
at meiosis in the hybrids. Pollen fertility of the hybrids ranged from 4% to 34.5%. The
hybrids were evaluated for gray snow mold disease resistance in the cold room and dollar
spot disease resistance in the greenhouse. A few of the hybrids had moderate level of
resistance to snow mold and dollar Spot, and exhibited partially enhanced disease

resistance.

Key words: Colonial bentgrass, Creeping bentgrass, Interspecific hybridization, Snow

mold disease, Dollar Spot disease

46

Introduction

Creeping bentgrass (2n=4x=28 C2C2$S Allotetraploid) is a cool-season grass and is
the predominant turfgrass species in temperate climates of North America. It is
commonly used in putting greens, tees and fairways due to its fine texture, high density,
and adaptation to low mowing height (Wamke et al., 1998). However, creeping bentgrass
is susceptible to a wide range of diseases such as dollar Spot, gray snow mold, and brown
patch. Each year, approximately a hundred million dollars worth of fungicides is applied
to golf courses in the United States (Latin, 2006). Currently, no cultivars show a desirable
level of resistance to these pathogens. Breeding resistant creeping bentgrass cultivars is

therefore one of the main objectives in breeding programs.

Colonial bentgrass (2n=4x=28 CICIC2C2 Segmental allotetraploid), a related species
of creeping bentgrass, shows good level of resistance to dollar spot and snow mold
diseases (V ergara and Bughrara, 2003). Colonial bentgrass was originally used for golf
greens, bowling greens, and tennis courts. Because of the higher mowing height, its use is
limited to tees. However, it was widely recognized by breeders as having high resistance
to gray snow mold and dollar spot. Transferring resistance from colonial to creeping

bentgrass provides an opportunity to improve disease resistance in creeping bentgrass.

Introgression of alien chromosomes, or chromosome segments, carrying useful genes

by interspecific hybridization, is a valuable method for crop improvement. Hybridization

between crops and wild relatives species followed by backcrossing and selfing is

47

commonly used to integrate desirable genes into crop genomes (Qi et al., 1996), and has
been used in breeding for improving resistance, quality and stress tolerance of numerous
species (Li et al., 2005). Hybridization between creeping and colonial bentgrass can
naturally occur in the field, which makes it easy to utilize the colonial bentgrass disease
resistance by genome introgression. Jones (1956) found naturally occurred hybrids
between the creeping and colonial bentgrass species and examined them for chromosome
pairing configuration with 14 bivalents at metaphase I of meiosis. Belanger et a1. (2003)
produced hybrids between these two species and field-tested them against dollar spot.
Some of the hybrids had excellent dollar spot resistance, exhibiting essentially no disease
symptoms. In addition to dollar spot resistance in colonial bentgrass, Vergara (2003)
found that some colonial bentgrass accessions possessed an adequate resistance to snow

mold disease, a prevalent turfgrass winter disease in the Northern US.

The principle aim of our work was to produce interspecific hybrids between a snow
mold resistant colonial bentgrass accession and a creeping bentgrass cultivar. The
interspecific hybrids were characterized by cytogenetics and molecular methods, and the

disease resistant reaction was evaluated in the greenhouse and cold room.

Materials and methods

Plant materials

48

The colonial bentgrass accession P1578528 was obtained from the USDA Plant
Introduction Station at Pullman, Washington. It has been tested in our lab for dollar spot
and snow mold diseases for two years and shown to be resistant to both diseases (V ergara,
unpublished data). P1578528 was used as male parents in crossing with creeping
bentgrass. The second parent, ‘ASR368’, was transgenic glyphosate-resistant creeping
bentgrass plants provided by Scotts Company (Marysville, OH). The creeping bentgrass
plants were resistant to glyphosate via the expression of a cp4-epsps gene, which encodes
a glyphosate-resistant form of EPSP from the CP4 strain ongrobacterium species. The
procedure used for generating the transgenic plants is described by Hartman et a1 (1994)
and Lee (1996). The F1 seeds collected from creeping bentgrass were grown and
maintained in the greenhouse. Two creeping bentgrass commercial cultivars, ‘Penncross’
and ‘Crenshaw’ were included as susceptible controls for snow mold and dollar spot

disease evaluations, respectively.

Disease evaluation and rating procedure

Snow mold disease evaluation

Sclerotia of gray snow mold (Typhula incarnata) was collected from Hancock
Turfgrass Research Center at Michigan State University and was grown on sterilized

potato dextrose agar (PDA). The pathogen was grown on PDA at 5 °C for 2 months. PDA
and was cut into 1- by l-cm pieces and transferred to sterilized cornmeal mixture for

multiplication. Growth of fungus in cornmeal was continued at 5 °C for another two

months (V ergara and Bughrara, submitted). The plants with three replications of each F 1

49

hybrids were brought into the cold room (4~5 °C) for seven days for acclimation prior to

disease inoculation using a completely randomized design. Equal amount of infected
cornmeal (l g) containing the pathogen was put in the center of each pot and covered
with moistened cheesecloth. The pots were placed into trays which were filled with
approximately 1cm water and covered with plastic bags to maintain high humidity and
optimize disease severity. Visually scoring for resistant and susceptible plants was
performed at 6 weeks. Nine represented 100% to 95% diseased turf, eight represented
approximately 90% diseased turf, seven represented approximately 75% to 85% diseased
turf, Six represented approximately 60% to 70% diseased turf, five represented 40% to
50% diseased turf, four represented approximately 30% to 40% diseased turf, three
represented approximately 15% to 25% diseased turf, two represented approximately
10% diseased turf, and one represented 0 to 5% diseased turf (Bonos et al., 2003). The
disease scores obtained by two evaluators were averaged for analysis. One-way CRD
with three replications was used to investigate the disease index. ANOVA analysis was
conducted using PROC GLM function in SAS system V8 (SAS Institute, 2002, Cary,

NC).

Dollar spot disease evaluation

An isolate of Sclerotinia homoeocarpa was used as inoculum in the greenhouse (East
Lansing, M1) to simulate natural infection. This isolate (A) was obtained from the
department of Plant Pathology at Michigan State University (East Lansing, MI). The
isolate was grown on sterilized Kentucky bluegrass seed for inoculation. Two hundred

grams of Kentucky bluegrass seed were autoclaved for 15 min. at 151°C. Seventy-five

50

milliliters of dH20 was added to the Kentucky bluegrass seed in an Erlenmeyer flask, and
was let sit overnight. One half of a Petri dish containing a Single isolate was cut into 1- by
l-cm pieces and transferred to the flask. The isolate (isolate A) was grown in flasks for
approximately 3 weeks at room temperature. The inoculum was dried on newspaper for 3
days. Equal amounts of seeds (3 grains) infested with the isolate pathogen were put in the
center of each pot of eleven-week old plants which were grown in the greenhouse. The
pots were randomly placed into trays and covered with plastic bags to maintain high
humidity and optimize disease severity. After three days, the plants were scored for
disease symptom. Nine represented 100% to 95% diseased turf, eight represented
approximately 90% diseased turf, seven represented approximately 75% to 85% diseased
turf, six represented approximately 60% to 70% diseased turf, five represented 40% to
50% diseased turf, four represented approximately 30% to 40% diseased turf, three
represented approximately 15% to 25% diseased turf, two represented approximately
10% diseased turf, and one represented 0 to 5% diseased turf (Bonos et al., 2003). The
disease scores obtained by two evaluators were averaged for analysis. One-way CRD
with three replications was used to investigate the disease index. ANOVA analysis was
conducted using PROC GLM function in SAS system V8 (SAS Institute, 2002, Cary,

NC).

DNA extraction

Fresh leaves (about 3g) were ground in liquid nitrogen and then the fine powder was
transferred to 50 ml polypropylene tubes. The extraction buffer (0.1 M Tris pH8.0, 0.05

M EDTA pH 8.0, 0.5 M NaCl, 1.24% SDS) was added to the powdered tissue in a

51

volume of 1:1. Afier incubating at 65 °C for approximately 1 hour, the samples were

purified with chloroform/isoamyl alcohol (24:1; v/v), and centrifuged at 2000 rpm for 25
min. The supernatant was added into pre-cooled 100% ethanol. DNA was washed in 70%
ethanol and diluted in TE buffer after removing excess ethanol. RNAase was added and

DNA was quantified.

DNA amplification and analysis

A SCAR marker was amplified in creeping and colonial bentgrass plants following
procedure of Scheef et al., 2003. PCR products were run on a 1.5% (w/v) agarose gel
and stained with ethidium bromide. Presence and absence of the SCAR band in the F1

hybrids was visually scored and compared with each parent species.

Cytological analysis

Plants were grown in a greenhouse at 20 i 5°C. Roots of the hybrids were collected at
1:00 pm. and were pretreated in 0°C water for 25 h to accumulate prometaphase cells,
fixed in methanol-acetic acid (3:1), and stored at 4°C. Root tips were macerated in 2.5%
cellulase at 37°C for 1.5 h. Squashes were made in the fixative on a glass slide and flame-

dried. The young panicles of the hybrids were fixed in ethanol:chloroform:acetic acid

(3:221) for 2 days at 4°C and transferred to ethanol: acetic acid (3:1). Anther squashes

were made in 1% acetocarmine. Chromosome pairing was analyzed on semiperrnanent

slides sealed with a gelatine-acetic acid medium. Images of chromosomes were recorded

52

on film using a single-lens reflex camera attached to an Olympus (BX-51) microscope

system at 1,500 X magnification.

Pollen Viability Determination

Plants were transferred to the laboratory for pollen staining from 11:00 am to 3:00 pm
on a sunny day when the flowers first opened. Pollen viability of all hybrids and their
parents was determined by staining the pollen gains from four flowers with 1% carmine
in 45% acetic acid. Stained and unstained pollen gains were counted in 10 fields per
slide. Pollen viability, based on pollen stainability, was expressed as an average
percentage of stained pollen gains on a slide with four replicate slides. Photogaphs were

taken with an Olympus microscope with Magna Fire-Sp® soflware.

Results

Phenotype of F 1 hybrids of colonial and creeping bentgrass

Bentgass species are generally considered to be self-incompatible. However, some
creeping bentgass clones exhibiting high levels of self-fertility have been reported
(Wamke et al., 1998). Therefore, the seeds produced from crossing need to assessed to
eliminate any individuals that may have been generated from self-pollination. A SCAR
marker was used to amplify a specific band (about 400 bp) from the genome of colonial

bentgass accessions. This band was not amplified in creeping bentgass species with the

53

same SCAR marker. After testing all F l progeny, six seedlings were determined to result
from self-pollination because the SCAR marker was not observed. The other 10 plants
produced that specific band and were planted in the geenhouse for firrther research and

backcrossing (Fig. 3.1).

The gowth habit of the hybrids was similar to that of colonial bentgass, being more
upright and having fewer stolons than creeping bentgass. Phenotypes between these 10
interspecific hybrids were also variable for stature height, stolons number and
vemalization sensitivity. The difference of the morphology reflects their parents’

heterozygosity.

Cytological analysis

Somatic metaphase chromosomes of colonial (2n=28) and creeping (2n=28) bentgass
are shown in Fig. 3.2. The chromosomes of both species are relatively small and
morphologically uniform, which creates difficulty in identifying any chromosome
differences between these two bentgass species. Root-tip cells of all 10 hybrids showed

28 chromosomes at mitosis.

Meiosis
Seven plants were selected from the F1 population. Chromosomes pair configurations

of the F1 hybrid cells were examined at the first meiotic metaphase. The most striking

54

feature of the F1 hybrids was that homologous chromosomes paired regulme in ring
bivalents in all pollen mother cells (PMCs); (Fig. 3.3). Chromosome pairing at metaphase
I was typified by the mean values of 6.7 univalents, 8.1 bivalents, 1.1 trivalents, and 0.45
quadrivalents per PMC, which indicates that the C2 genome of creeping and colonial
bentgass are highly homologous; C1 and S genomes were partially homologous based on
the multivalents formed. The parental chromosomes were evenly segegated into

daughter cells because no lagging chromosomes were observed at anaphase and telophase.

Pollen viability of hybrids

Utilization of wild germplasm depends on the production of fertile interspecific
hybrids. Pollen viability from seven F1 hybrids was estimated by pollen stainability.
Pollen viability of the hybrids ranged from 4% to 34.5% with an average of 19.6%, which
was significantly lower than that of the colonial and creeping bentgass parents, for which

the pollen viabilities were 94 % and 96%, respectively.

Disease resistance evaluation

Three vegetative clones of each F 1 hybrid and their parents were subjected to screening
for snow mold and dollar Spot diseases. In the snow mold evaluation, disease rating
means and analysis of variance showed that differences were Significant across the
population at six weeks after inoculation. The colonial bentgass parent showed moderate
resistance compared to the creeping bentgass parent after disease evaluation (Table 3.1).

Eight hybrids exhibited geater snow mold disease resistance than the creeping bentgass

55

control, ‘Penncross’, but two of them (CCl and CC6) did not exhibit significant
improved resistance compared to ‘Penncross’. In the dollar spot disease screening
evaluation, eight hybrids showed geater resistance than creeping bentgass control,
‘Crewshaw’, and CC6 had a high level of resistance comparing to the colonial bentgass

parent. However, CC6 did not show any desirable resistance to snow mold disease.

Discussion

Creation of interspecific hybrids of creeping and colonial bentgass is the first step to
eventually releasing resistant creeping bentgass cultivars with alien genes (Sukno et al.,
1999). Considering the partial self-fertility of creeping bentgass, the hybrids should be
confirmed with DNA marker analysis or other phenotypic traits to eliminate selfing seeds.
Belanger and his colleagues (2003) used herbicide resistance gene (bar) as selection
marker. In their study, colonial bentgass was used as female parent, and transgenic
creeping bentgass served as the donor parent. The F1 hybrids were confirmed by
herbicide selection. This method is straightforward with high efficiency, however, it
requires a transgenic parent, and the hybrids contain colonial cytoplasm which may have
a deleterious effect on the further recovery of creeping bentgass backgound. In our
experiment, a specific SCAR as a selectable maker for colonial bentgrass genome was
used. From 16 potential hybrids (seeds were collected from creeping bentgass), 10
interspecific hybrid plants were confirmed by this marker. However, in further
continuous backcrossing with creeping bentgass, this SCAR marker may be limited

because it may not represent entire colonial genome. Some backcross progeny having

56

partial colonial bentgass genome can not be detected by a single SCAR marker. More
colonial bentgass specific SCAR markers representing the entire genome should be
developed for detecting backcross progeny which only carries the partial colonial

bentgass genome.

The karyotype of parents and their hybrids were analyzed by measuring chromosome
length and centromeres location. No sigrificant differences exist in these parameters. The
C-banding can not produce desirable information because of the small chromosomes and
faint bands (data not shown), which creates difficulty to distinguish chromosome
originality by C-banding method. The multi-color genomic in situ hybridization
(McGISH) method provides an alternative solution to paint species specific genome or
fragment instead of individual chromosome. All the chromosomes fi'om the different
genomes could be identified by different fluorescent colors. The McGISH method has
been used for hybrid confirmation, and is effective in identifying chromosomes and
examining the distribution of each genome in the nucleus. Ali et a1. (2002) employed the
McGISH method for the identification of alien chromosomes in the backcross progeny of
fusion hybrids between potato and tomato, where the chromosomes were similar and
small. They discriminated tomato chromosomes from potato chromosomes and showed
the usefulness of this method for plant breeding. In future studies, two genomic probes
(creeping bentgass and colonial bentgass) simultaneously and label them with two
different colors respectively for discriminating their genomes in hybrids will be used.
Because these two parents share one genome (C2) and some fragnents in the other

genome according to hybrid meiosis pairing configuration, three colors will be detected,

57

one color indicting the C1 genome from colonial, the other color indicating the S genome
from creeping and the mixture of the above colors presenting C2 genome or homologous

fragments from both colonial and creeping bentgass genomes.

At meiosis, an average of seven ring bivalents was observed. This result is consistent
with Jones’s (1956) conclusion that creeping and colonial bentgass probably have one
ancestral diploid species in the common and Show good homology in one pair of their
genomes and partial homology in the other one. The resistant genes could be introgessed
into creeping bentgass genome fiom colonial bentgass genome if genes located the
homologous chromosomes. However, if a resistant gene(s) was on colonial bentgass
chromosome (s) which can not pair with creeping bentgass’ chromosome(s) at meiosis,
the biological and physical approaches to induce small segmental chromosome
translocations would be applied (Yuan et al., 1998). Short arm of rye (Secale cereale L.)
chromosome IR is useful in wheat (Triticum aestivum L.) breeding because it confers
resistance to several pests and diseases and improve yield, but it reduces bread making
quality. To remedy this defect, segnental chromosome translocations of rye chromosome
arm 1R with wheat lBL or lDL was induced by the phlb mutation to eliminate linkage

drag (Lukaszewski, 2000).

Some of the F1 plants exhibited hybrid vigor for certain morphological traits. However
some of the hybrids gew weakly although all hybrids were planted in same environment,
and not all of the hybrids showed improved resistance. Since 28 chromosomes were

observed in the hybrids at mitosis, no chromosomes were eliminatied. Locus (gene)

58

interactions may lead to the hybrids’ morphological and resistant difference. The plants
that are the most resistant to both dollar spot and snow mold will be used in backcrossing
progam with a creeping bentgass cultivar as a recurrent parent for recovering creeping
bentgass elite phenotypes. Also interpollination between these hybrids provide an

opportunity to combine the snow mold resistance and dollar spot resistance.

The 2001 National Bentgass Test sponsored by USDA and National Turfgass
Federation findings showed that from the snow mold complex ratings of 26 bentgass
cultivars gown on fairway or tee, only one cultivar of colonial bentgass, SR 7100 was
found to be resistant to snow mold. In this study, the colonial bentgass parent, P1578528,
whose genetic backgound derived from genetic distance analysis is different from
SR7100 (Zhao et al., 2006), was used to improve the disease resistance in creeping
bentgass. In further research, we will combine the resistance of SR7100 with our
resistant hybrids to broaden resistance basis and pyramid the potential different resistance

into new creeping bentgass cultivars.

59

03255 :0: <2
.wmmwnmE 0: 5:50 05 :00 :5 200 .000 .m00 .N

4:00:06 3350:.ch 05 3:05: 03... ._ :05 5:00 .m .3352: 00 5:50. 05 N00 :5 200 .m 05:00:: bEmocEwi 05 3:05: 03:. ._ ”EOE 305
$0006 :5 3,550.0 00:5 050E: 5: wommmxx

modvm 5 $03 SEES: .3 50:00.2: 3:520:53 8: 05 30: 25m 05 5:3 0:2 058 05 .3 530:8 .0502

00% 5:0: 050:: m0 :5 :_0E 30% 050E 2m 0:: 0500‘: 3007.003 u o .0500: c\omé u _

 

 

005500..

83 83 BE 83 05 05 «5 0: :03 as: as: <2 05 m0
Docwwwfiuh

0:. 82: 2033 02:0 ~82 02:0 883 89m: can as: <2 a; 2.? 2m

 

:00 £00 200 200 E00 200 :00 :00 ~00 _00 Bap—0:000 820:5: wmmwnma

053:3 :5 3:05: :05 :5 3.00 3 _00V 02.5.3 2 .00 08:5 0500:: 00% 5:0: :5 :_0E 30:m 2033.

60

 

m ,

“"13 ”A... . . 4 :5 I I... . . fi‘. yum. e u all .I .o! ..I-lfluwhflhfl...0...$31....“a,.301,39336....Nu~.-W\..§I§iiwu§flam~fi ¢§§§§Iuiu§3vzsm
of G . ... .... . ..... .. . . 3.. . . .. ... ... . . .1 .. 33.. . . .. . . . ..... .h.. V ... . .
. . . . . . . . JV
...: . .. . . .. I. «a y . ... .. .v . . .0 u , ..- .A
w.” y. .. .... : ... . . ., . . .n. ...» .- . ..." . w»- n,
x“.

x...

n

0 . . . . r g . .

.1" .... .. LE}... .1....... .3...:.. .... .. .4..Nr..fi.t..>w ......‘l..l-|.. . . . .31.... .. R n.... ... . . .m ..sI-l- .i ...).u... .... .u.«.;..vn4...~l ..C INHE-buut. WEI... .w
.0. ... . . | . .. w A. . .. ; l l .

refining ibis?

wmmwhma womMm< :00 200 SUD .m—UU SUD SUD >00 :00 N00 _UU

 

08%“:09 3:200 3 wmmwbm E :8 000E050

@5008 3 335%.. .025»: E 08 :00 00 ~00 80:: 3:08: :05 :8 025%: :00 .«0 000—88 m<Um :0 0w08_ 0E. :m 08%:

61

:00

25.3 9&5 :8 ..womMm<. 08:98: 85008 C883 .mmmwnwa :0 :08008 03:98: EEO—00 30: mo 300:2 NM 059:

62

 

.:0>._030 0:03 3020:: 8 3:083:35 :8 3:08>_:: 2:8 ._80>0m 3:083: :0>0m .308 2.3.3 «0 30202 Wm 08E

63

References

Ali, S.N.H., M.S. Ramanna, E. Jacobsen, and R.G.F. Visser. 2002. Genome
differentiation between Lycopersicon esculentum and L. pennellii as revealed by
genomic in situ hybridization. Euphytica 127:227-234.

Belanger, F.C., K.A. Plumley, P.R. Day, and W.A. Meyer. 2003. Interspecific
hybridization as a potential method for improvement of Agrostis species. Crop
Science 43:2172-2176.

Bonos, S.A., M.D. Casler, and W.A. Meyer. 2003. Inheritance of dollar spot resistance in
creeping bentgrass (Agrostis stolonifera L.). Crop Science. 43:2189—2196.

Hartman, C.L., L. Lee, P.R. Day, and NE. Turner. 1994. Herbicide-Resistant Turfgrass
(Agrostis Palustris Huds) by Biolistic Transformation. Bio-Technology 12:919-
923.

Horsfall, J .G., and R.W. Barratt. 1945. An Improved Grading System for Measuring
Plant Diseases. Phytopathology 35:655-655.

Jones, K. 1956. Species differentiation in Agrostis HI. Agrostis gigantea Roth. and its
hybrids with A. Tenuis Sibth. and A. stolonifera L. Journal of Genetics. 54:394-
399.

Latin, R. 2006. Residual efiicacy of fungicides for control of dollar spot on creeping
bentgrass. Plant Disease 90:571-575.

Lee,L. 1996. Turfgrass biotechnology. Plant Science. 11521-8

Li, H.J., M. Arterbum, S.S. Jones, and TD. Murray. 2005. Resistance to eyespot of
wheat, caused by T apesia yallundae, derived from Thinopyrum intermedium
homoeologous group 4 chromosome. Theoretical and Applied Genetics 111:932-
940.

Lukaszewski, AJ. 2000. Manipulation of the 1RS.1BL translocation in wheat by induced
homoeologous recombination. Crop Science 40:216-225.

Qi, L.L., M.S. Cao, P.D. Chen, W.L. Li, and DJ. Liu. 1996. Identification, mapping, and
application of polymorphic DNA associated with resistance gene Pm21 of wheat.
Genome 39:191-197.

Scheef, B.A., M.D. Casler, and G. Jung. 2003. Development of species-specific SCAR
markers in bentgrass. Crop Science 43:345-349.

Sukno, S., J. Ruso, C.C. Jan, J .M. Melero-Vara, and J .M. Femandez-Martinez. 1999.
Interspecific hybridization between sunflower and wild perennial Helianthus
species via embryo rescue. Euphytica 106269-78.

Vergara, G.V., and SS. Bughrara. 2003. AFLP analyses of genetic diversity in bentgrass.
Crop Science 43:2162-2171 .

Vergara, G.V., S.S. Bughrara. 200x. Evaluation of Bentgrass for Resistance to Typhula
incarnata Lasch. Plant Disease (submitted).

Warnke, S.E., D.S. Douches, and BE. Branham. 1998. Isozyme analysis supports
allotetraploid inheritance in tetraploid creeping bentgrass (Agrostis palustris
Huds.). Crop Science 38:801-805.

Yuan, W.Y., M. Tomita, S.C. Sun, and Y. Yasumuro. 1998. Introduction of multi-alien
chromatins carrying different powdery mildew-resistant genes from rye and
Haynaldia villosa into wheat genome. Genes & Genetic Systems 73:377-3 84.

Zhao, H., S.S. Bughrara, and J .A. Oliveira. 2006. Genetic diversity in colonial bentgrass
(Agrostis capillaris L.) revealed by EcoRI-MseI and PstI-Msel AF LP markers.
Genome 49:328-335.

65

CHAPTER 3
GENETIC LINKAGE MAPS AND QTL ANALYSIS OF CREEPING
BENTGRASS (Agrostis stolonifera L.)

66

Abstract

Creeping bentgrass is the most widely cultivated turfgrass species in United States.
Genetic linkage maps of creeping bentgrass were constructed for QTL analysis of gray
snow mold resistance (Typhula incarnate), recovery after Typhula infection and leaf
width. A segregating population of 188 F1 progeny was developed by two-way pseudo-
testcross mapping strategy. Amplified fragment length polymorphism (AFLP), Random
amplified polymorphic DNA (RAPD) and simple sequence repeat (SSR) markers,
corresponding to DNA polymorphisms heterozygous in one parent and null in the other,
were scored and placed on the two separate genetic linkage maps, representing each
parent. In the male parent map, 93 markers were mapped to 14 linkage groups covering a
total length of 793cM with an average interval is 8.2cM. In the female parent map, 139
markers were clustered in another 14 linkage groups spanning 805cM with an average
distance of 5.9cM between adjacent markers. In the same population, we investigated the
associations between the genetic markers with three agronomically quantitative traits:
leaf width, snow mold disease resistance and recovery after Typhula infection. Three
quantitative trait loci (QTL) explained 23% of the phenotypic variation for leaf width.
One QTL explained 9% of the phenotypic variation for snow mold disease resistance, and
one QTL explained 7% of the phenotypic variation for recovery after Typhula infection.
The construction of linkage map and QTL analysis in this study provide a useful tool for

the genetic dissection of some complex quantitative traits in creeping bentgrass.

67

Keywords: Creeping bentgrass; Linkage; QTL; Leaf width; Snow mold resistance;

Recovery after Typhula infection

Introduction

Creeping bentgrass (Agrostis stolonifera L. 2n=28), native to Western Europe, belongs
to genus Agrostis which consists of approximately 220 species (Hitchcock, 1951). It has
fine leaf texture, high density, and good adaptation to low mowing heights, which make it
widely used on golf course tees, greens and fairways. Creeping bentgrass is reported to
have a moderate genome size (5.65 pg/ZC); (Arumuganathan et al., 1999). Jones (1955)
examined chromosome pairing configuration of tetraploid creeping bentgrass and found
14 bivalents formed at metaphase I in the pollen mother cell. Creeping bentgrass is
considered to be a strict allotetraploid (C2C28S). Isozyme analysis provided genetic
evidence to support disomic segregation in creeping bentgrass (Wamke et al., 1998).
Despite commercial importance of creeping bentgrass, understanding of its genetic
mechanisms has received little attention and lags behind other plant species partially due

to its self-incompatibility which makes traditional genetic analysis difficult.

In the last decade, with the advent of DNA-based markers, genetic studies have been
greatly facilitated and hundreds of genetic linkage maps have been published in many
crops (Collard et al., 2005). Molecular marker-based genetic linkage maps allow
researchers to further elucidate inheritance mechanisms of important agronomical traits
(Kolkman and Kelly, 2003), isolate genes (even QTLs) by providing the framework to

understand the biological basis of complex traits (Ashikari et al., 2005), and determine

68

chromosome synteny and evolution (Jung et al., 2006). A segregating population is
necessary to construct a genetic linkage map. In out-crossing plant species, such as
creeping bentgrass, F2 or backcross segregation populations are rarely available because
of self-incompatibility. Genetic linkage construction in such species is commonly
performed in the F1 progeny (pseudo F2) derived from a cross between two heterozygous
parents ( Wu et al., 2000, Chakraborty et al., 2005;). Because of genetic segregation in
the F1 progeny is the result of meiotic recombination from both parents, marker data can
be analyzed by a double pseudo-testcross strategy, and used in developing two separate
linkage maps for the female and male parents (Grando et al., 2003). However, as a
pseudo-F2 mapping population, no crossovers can occur between the parents’
homologous chromosomes in the F1 generation. The chromosome recombination events
detected by segregation of DNA marker were from previous generation. Several types of
molecular markers are available for constructing genetic linkage maps in plant species.
These included RFLP (Devey et al., 1996), RAPD (Boiteux et al., 2000), AP LP (Qin et
al., 2005), and SSR (Okogbenin et al., 2006) markers. Species-specific RFLP and SSR, as
co-dominant marker systems, need some existing genomic information, which is
unavailable in some turfgrass species. RAPD markers have been criticized because their
banding patterns are not always reliable or reproducible. AFLP is considered to be a
highly productive and reproducible DNA marker system and does not require prior
genome sequence knowledge. It is widely applied to rapidly create genetic linkage maps
and detect QTLS in some grass species (Saha et al., 2004) and diversity research. QTL, as
an association between marker loci and phenotypic variation of a quantitative trait in the

mapping population, is a valuable parameter for the genetic dissection of complex traits.

69

QTL are studied in terms of the magnitude level of the effects on the phenotype or the
parental origins of the favorable QTL alleles, or the interactions between different QTL.
Several examples have been documented for QTL mapping in out-crossing plant species,
such as in grapevine (Vitis vinifera). Several putative QTLS for seedlessness, berry
weight and fruit yield were identified (Doligez et al., 2002; Fanizza et al., 2005). In
perennial ryegrass (Lolium perenne L.), three potential QTLs for gray leaf spot disease
resistance (Curley et al., 2005), and four QTLs determining crown rust resistance were
characterized (Muylle et al., 2005). Based on the information on QTL, marker-assisted
selection (MAS) can complement the traditional breeding tools and help implement more
efficient breeding strategies in out-crossing species (Studer et al., 2006; Lima et al.,
2006). QTL analysis also can unveil masked and interesting wild alleles, such as disease
resistance, and makes for easier introduction of desirable and specific genetic materials
from related and unrelated wild species for germplasm enhancement (Bai et al., 2003;
Singh et al., 2005; Villamon et al., 2005). However, limited information is available on

QTL analysis in turfgrass species in general and creeping bentgrass in particular.

Gray snow mold, caused by Typhula incarnata, is a major disease of creeping
bentgrass (Wu et al., 2000). Gray snow mold is prevalent in cold humid conditions with
snow cover for over 90 days (Burpee et al., 1987) and is particularly important in
northern regions of the United States where it can cause considerable turf loss.
Improvement of host plant resistance is therefore one of the practical objectives in current
creeping bentgrass breeding programs (Belanger et al., 2003). Mapping QTL controlling

disease resistance is an approach to providing information on the locations and effects of

70

the locus influencing the traits, and help direct the breeding efforts for accelerating

selection and pyramiding resistance genes or loci (Jones et al., 2002).

The objectives of the present study were: (1) to develop the genetic linkage of creeping
bentgrass based on a two-way pseudo-testcross strategy using AFLP, RAPD, and SSR
markers, and (2) to identify QTL controlling leaf width, snow mold disease resistance

and recovery after Typhula infection.

Materials and methods

Plant materials

The mapping population was derived from a cross between two heterozygous creeping
bentgrass genotypes, ‘ASR368’ and ‘MSU#8’, with contrasting phenotypes for leaf width,
snow mold disease resistance and recovery rate after disease infection. ‘MSU#8’, used as
a female parent, has wide leaf, desirable resistance to snow mold disease, good recovery
after Diphula infection (V ergara and Bughrara, 200x) and glyphosate-sensitivity
compared to male parent ‘ASR368’. ‘ASR368’ is a transgenic glyphosate-resistant
creeping bentgrass plant provided by Scotts Company (Marysville, OH). The creeping
bentgrass plants were resistant to glyphosate due to the expression of a gene cp4-epsps,
which encodes a glyphosate-resistant form of EPSP from the CP4 strain of
Agrobacterium species. The procedure used for generating the transgenic plants is

described by Hartman et al (1994) and Lee (1996). ‘MSU#8’ and ‘ASR368’ have high

71

DNA polymorphisms based on AF LP analysis (Appendix A). About 700 F1 seeds were
germinated on wet filter paper for seven days at 25°C. 600 seedlings were transferred into
soil filled pots and grown in greenhouse. After excluding plants resulted from self-
fertilization, which were identified after spraying glyphosate herbicide (Simarmata et al.,
2005), 188 randomly selected progeny were used as the mapping population. All the
progeny and their parents were propagated vegetatively into several clones for further

DNA isolation and phenotype evaluation.

DNA isolation

Total genomic DNA was extracted from 5 g fresh leaves of the parents and their
progeny using the procedure reported by Gill et a1. (1991). DNA was quantified by

DYNA Quant 200 F luorometer (Pharmacia Biotech, San Francisco, CA).

AFLP analysis

The AF LP analysis was conducted according to the protocol provided by the AF LP
Plant Mapping Kit of Perkin-Elmer Applied Biosystems (Foster City, Ca.). The pre-
amplification products were diluted 20-fold for template DNA for selective
amplifications. Selective amplification was performed with the fluorescently labeled PstI
selective primers (Saha et al., 2004). PCR reactions were run under standard conditions
for all primers using 1U AmpliTaq Gold with GeneAmp PCR buffer 11 (Applied
Biosystems/Roche, Branchburg, N.J.), 3mM MgClz, 200uM dNTPs, 0.2mM of each

primer and 20ng of template DNA in a 10ul reaction. Pre-amplification was done on

72

PTC-lOO thermal cycler (MJ Research, Waltham, MA) using 30 cycles of 94C 45s, 52°C
45s, 72 ’C 1min, followed by elongation at 72 "C 10min. Combinations of fluorescent dye
labeled PstI and non-labeled MseI primers, each with three selective nucleotides at the 3 ’
ends, were used for selective amplification at 56°C annealing temperature. The samples
were electrophoresed on an A31 3100 capillary genetic analyzer (Perkin-Elmer Applied
Biosystems) with an injection time of 83 and a run time of 28min. Raw data were
analyzed with GENESCAN (ver.2. 1 , Perkin-Elmer Applied Biosystems). The AFLP
fragments 50—500 bp in length were scored as present (A) or absent (B). Scores were
recorded and formatted for analyses using the CONVERT GENOGRAPHER software (Noble
Foundation, Ardmore, OK.). Scores thus obtained were verified on the gel images. A

total of 15 primer combinations were selected to assay the whole population (Table 4.1).

SSR analysis

A set of 31 tall fescue (TF)-EST-SSRs (NFFA) developed by the Noble Foundation
was used for genetic mapping in this creeping bentgrass pseudo—testcross population

(Saha et al., 2004); (Table 4.1). PCR reaction conditions consisted of 5 min at 95 'C,
followed by 40 cycles of 503 at an annealing temperature between 58C and 64°C
(optimum annealing temperature for each primer), 90s at 72 °C, and a final extension step

of 10min at 72 °C. The SSR products were resolved by analyzing samples on 6%

polyacrylamide denaturing gels run under standard conditions. The amplified products

were visualized by silver staining. Polymorphism was determined by the presence or

73

absence of a SSR locus according to the single-dose restriction fragment approach (Wu et

aL,2000)

RAPD analysis

One hundred decamer oligonucleotides (Operon Technologies, Alameda, CA) were
used to screen the parents to detect the polymorphism at annealing temperature 41°C. The
RAPD profiles were generated in 2% (w/v) agarose gel with 0.003% (w/v) ethidium
bromide. A l-kb ladder was used to mark the size of fi'agments. The images of RAPD
were obtained through an Eagle Eye H Still Video System V3.2 (Stratagene, La Jolla,
CA). The 26 primers which can clearly reveal the polymorphism between parents and a
subset of six F1 progeny randomly selected from population were used for mapping the

whole population.

Phenotypic measurements

Leaf morphology was measured on the parents and all F1 progeny using l2-week old
plants grown at 30°C under constant illumination in Baccto planting mix (Michigan Peat,
Houston) at MSU greenhouse (East Lansing, MI). Leaf width was determined from
measurements taken at the base of fully expanded mature leaf from randomly chosen

tillers and measured across the leaf at its widest point. The data was collected from three

replications per genotype and ten leaves per replication.

74

Snow mold disease evaluation

Sclerotia of gray snow mold (T. incarnata) was collected from Hancock Turfgrass
Research Center at Michigan State University and was grown on sterilized potato

dextrose agar (PDA). The pathogen was grown in PDA at 5 °C for 2 months. The

pathogen was grown on PDA at 5 °C for 2 months. PDA and was cut into 1- by l-cm

pieces and transferred to sterilized cornmeal mixture for multiplication. Growth and

incubation in cornmeal was made at 5°C for another two months (V ergara and Bughrara,

submitted). The plants with three replications of each F1 progeny were brought into the

cold room (4~5 °C) for seven days for acclimation prior to disease inoculation in a

completely randomized design. Equal amount of infected cornmeal (l g) containing the
pathogen was placed in the center of each pot and covered with moistened cheesecloth.
The pots were placed into trays which were filled with approximately 1cm water and
covered with plastic bags to maintain high humidity and optimize disease severity.
Visually scoring for resistant and susceptible plants was performed at 6 weeks using the
following scale. Nine represented 100% to 95% diseased turf, eight represented
approximately 90% diseased turf, seven represented approximately 75% to 85% diseased
turf, six represented approximately 60% to 70% diseased turf, five represented 40% to
50% diseased turf, four represented approximately 30% to 40% diseased turf, three
represented approximately 15% to 25% diseased turf, two represented approximately
10% diseased turf, and one represented 0 to 5% diseased turf (Bonos et al., 2003).
Recovery was scored after another 10 days (1, 3, 5, 7, 9, 10 scale, with 10 as 100%
recovered). The disease scores and recovery rate obtained by two evaluators were

averaged for analysis. One-way CRD with three replications was used to investigate the

75

disease index. ANOVA analysis was conducted using PROC GLM function in SAS

system V8 (SAS Institute, 2002, Cary, NC).

Data analysis

Data from each replication were statistically using PROC MIXED function in SAS
system V8 (SAS Institute, 2002, Cary, NC). The mean values of three replications were
then used to summarize the range and mean of each genotype, and derive a matrix of
correlations between leaf width, snow mold resistance and recovery after Iyphula

infection.

Linkage map construction

Linkage analysis was carried out using JoinMap 3.0 (Van Ooijen and Voorrips, 2002).
Segregation ratios of DNA markers in mapping population (3:1 and 1:1) were scored
depending on the allelic state of the parents at analyzed loci. Only markers that fitted the
expected ratios (1:1 for mono-parental markers, Aaxaa or aaan) were further considered
followed by Chi-square test (P> 0.05). Two parental maps were constructed using a LOD
of 3.0 for the grouping of the markers by JoinMap 3.0. In each linkage group, the order of
the markers was inferred using the pairwise data of only those loci that showed a
recombination frequency less than 0.4 and a LOD value larger than 1.0. The Kosambi
mapping function was used to convert recombination data to map distances. The linkage

maps were drawn using MapChart 2.1 (Voom'ps, 2002).

76

QTL analysis

QTL analysis was carried out using QTL Cartographer 1.13 (Basten et al., 1999). Two
linkage maps of the parents using only the DNA markers with a segregation ratio of 1:]
were analyzed for QTL with the BC1 algorithm. Composite Interval Mapping (CIM)
analysis was performed separately on each map (from both maps) associated with the
trait. CIM was run with model 6 of the program and a window size of 2 cM for all
analysis. The number of markers for the background control was set to 5, which means
that the 5 most significant markers outside the interval under the analysis were fitted to
the model. The markers used for the background control were detected through forward
and backward stepwise regression (Wang et al., 2000). The LOD thresholds generated by
1000 times permutation tests at a 0.05 significant level were used to determine putative

QTL (Inoue et al., 2004).

Results

Phenotypic variation

In the pseudo F2 population, all traits showed a continuous phenotypic variation typical
of quantitative or polygenic inheritance. The frequency distributions for three traits are
presented in Fig.4. 1. Mean values of leaf width, snow mold disease resistance and
recovery after Typhula infection for both parents and pseudo F2 progeny are reported in
Table 4.1. ‘ASR368’ showed significantly (P<0.05) narrower leaf width compared with
‘MSU#8’. However, ‘MSU#8’ showed a significantly (P<0.05) higher snow mold

disease resistance and better recovery after Typhula infection than ‘ASR368’. Some

77

progeny exhibited transgressive segregation for these three traits. The segregations of
three traits were normally distributed when checked by skewedness and kurtosis
parameters (Table 4.2); (Fig.4.1). A significant positive correlation was observed
between disease resistance and recovery afier Typhula infection (r=0.58, P<0.001), but
no other significant correlations between leaf width and resistance or recovery were

observed.

RAPD and SSR analysis

Twenty-six primers that generated polymorphisms between the parents and progeny
were used to screen the mapping population. The selection was made based on clear and
reproducible band patterns to provide unambiguous scoring. Of the 28 polymorphic
markers amplified, 10 were inherited from the female parent ‘MSU#8’, 12 from the male
parent ‘ASR368’, and 6 from both parents. Seventeen markers with distorted segregation
that did not fit the expected single-dose restriction fragment ratios (1:1 or 3:1) were not
included for further analysis based on the chi-square test (P<0.05) with 1:1 or 3:1

segregation ratio.

Thirty one EST-SSR primers successfully amplified 89 polymorphism bands between
two parents and their progeny. Forty six polymorphic markers were inherited from the
female parent ‘MSU#8’, and forty three from the male parent ‘ASR368’. After the chi-
square test (P<0.05) with 1:1 segregation ratio, 57 markers with distorted segregation

were not included in linkage construction.

78

AFLP analysis

AFLP markers were generated from methylation-sensitive restriction enzyme PstI. The
14 AF LP primer combinations (MseI/PstI) revealed a total of 383 polymorphic markers
with optimally repeatable size of 50—450 bp, and an average of 28 markers per primer
pair. Of the AF LP markers, 328 were heterozygous in one parent and null in another (202
from female parent and 126 from male parent, testcross configuration segregating 1:1),
while 55 were segregating in both. Chi-square analysis revealed 252 markers (77 %)
fitted a 1:1 segregation ratio and 28 (9%) fitted a 3:1 ratio. The remaining 48 (15 %)

showed segregation distortion within the population.

Linkage (LG) map construction

Map construction was carried out according to the two-way pseudo-testcross procedure
with JoinMap 3.0 based on 188 individuals. Of the 292 markers showing 1:1 Mendelian
segregation, 232 (220 AFLPs, 5 RAPDs and 7 SSRs) markers were successfully mapped
(79.5 %) on fourteen linkages for each of the two parents using a LOD score of 3.0. Sixty
markers were unlinked. The linkage map of female map, ‘MSU#8’, consisted of 139
markers assigned to 14 LGs. Among these LGs, 11 LGs included 4 to 33 markers, and
the remaining 3 LGs consisted of only two or three markers, respectively. The map
spanned 805cM of the genome with an average inter-marker distance of 5.8 cM. The
average size of the 14 LGs was 57.5 cM, ranging from 208cM (LG3) to 5cM (LGl l);
(Fig.4.2). In male parental map of ‘ASR368’, 93 markers were assembled into 14 LGs
ranging fiom 12 markers per LG (LGIO) to 2 markers per LG (LG6, LG9 and LG13).

The sizes of these LGs varied from 12 ch (LG12) to 9cM (LG9). The length of the male

79

parental maps was covered 793 cM of an average 8.2 cM between two adjacent markers
(Fig.4.3). Marker distribution in the map linkages seemed fairly even, and no pronounced
clustering of any markers was found. However, some large gaps (above 200M) still

remained on some LGs.

QTL identification

To identify the position of genomic regions involved in leaf width, snow mold disease
resistance, and recovery after Typhula infection, QTL analyses were performed on each
parental linkage map (‘ASR368’ and ‘MSU#8’) seperately. Using composite interval
mapping (CIM), the permutation test was conducted to establish an appropriate
experiment-wise threshold of significance for trait-marker associations (Churchill and
Doerge, 1994). This process was repeated 1,000 times at P=0.05 for each trait to
determine the significant threshold for LR statistics. The threshold scores (LOD) of QTLs
were 2.7 (leaf width), 3.1 (snow mold disease resistance) and 3.0 (recovery afier Typhula
infection). Three QTLS for leaf width (LW) were found on ‘MSU#8’ linkage map which
has wide leaf parent. The proportion of variance explained by three QTLs detected was
estimated. LWl on LG2 (9%), LW2(6%) on LG7 and LW3 (7%) on LG12, explained
phenotypic variance of leaf width (Table 4.3); (Fig.4.4a) . Multiple regression analyses
using combinations of significant markers and their interactions revealed that epistatic
interactions were not significant among these QTLS. In the second parent ‘ASR368’, no
significant QTL for leave width was found. One QTL with LOD=3.81 explained 9% of
the phenotypic variance for snow mold disease resistance was detected on LGIO from

‘ASR368’ (susceptible parent); (Table 4.3); (Fig.4.4b). No significant QTLs associated to

80

resistance were located on the ‘MSU#8’ linkage map. One QTL affecting recovery after
Typhula infection was found on LG] of ‘MSU#8’ (higher recovery rate), explaining 7%
of the phenotypic variance of the trait, and no significant QTLs were detected from

‘ASR368’ (Table 4.3); (Fig.4.4c).

Discussion

The development of a genetic linkage map in creeping bentgrass is the first step in
understanding the genetic control of traits of agronomic interest. The double pseudo-
testcross strategy was used in constructing the female and male linkage maps of creeping
bentgrass based on AF LPs, SSRs, and RAPDs. Because AF LP are dominant markers,
two types of segregation ratios (1 :1 and 3: 1) were observed in pseudo-F2 mapping
population with disomic inheritance. The markers which are heterozygous in only one
parent and recessive homologous in the other parent segregate 1:1 in pseudo-F2 mapping
population (similar to backcross), whereas markers heterozygous in both parents should
segregate in a 3:1 ratio. Markers segregating in a 3:1 ratio can be used as ‘bridging locus’
to align the homologous chromosomes of male and female linkage maps (Hanley etal.,
2002). However, these markers (3:1 ratio) were not included in this study because double
heterozygous markers are less informative than single heterozygous ones based on the
fact that AF LP markers used as a main marker system in linkage map construction are
dominant and can not distinguish AA, Aa, and aA genotypes in the progeny. Also,

distorted markers (> 5%) were not used in linkage map construction to preserve linkage

accuracy. The length of genetic map of the female parent was estimated to be 805cM and

81

that of the male parent linkage was 793cM. Chakraborty et a1. (2005) constructed a
creeping bentgrass map which consists of 424 mapped loci covering 1,110 cM in 14
linkage groups by using RAPD, AF LP and RFLP markers. Since no common markers
were shared among linkage maps, comparison can not be conducted. Mapping of
additional co-dominant markers may help to combine these linkage maps and identify
homoeologous linkage groups. A comparative map between creeping bentgrass and other
members of the Poaceae such as, rice, wheat and maize is desired. The comparative
genetic information will benefit creeping bentgrass researchers working on the

improvement of agronomic traits.

QTL mapping is a common genetic analysis practiced in many plant species to study
quantitative variations. However, no QTL analysis has been reported in creeping
bentgrass species. To improve the understanding of the inheritance mechanism of some
complex agronomical traits, and to facilitate creeping bentgrass breeding programs, five
QTLS involved in leaf morphology, plant disease resistance and recovery after Typhula
infection, which could have important roles in improvement of creeping bentgrass
cultivar were identified. QTL mapping strategies of out-crossing plant species are
different from self-pollination crops, such as wheat and rice. Separate QTL analysis for
each parent was conducted to determine the QTL originality and magnification. To
identify more major QTLs related to these traits, factors, such as, linkage coverage and
saturation, size of mapping population and accmacy of phenotype data should be
considered. Improved linkage coverage and saturation can increase the ability to detect

QTLs and estimate their location. The creeping bentgrass linkage maps presented herein

82

have some gaps between the markers. QTLS present in these gaps may not have been
detected. More markers are desired to be integrated into linkage maps for bridging the
gaps and increasing coverage and saturation. Size of mapping population is another factor
to determine QTL analysis results. The small size of mapping population could lead to an
underestimation of the number of QTL per trait and to an overestimation of the
phenotypic effect associated with each QTL from simulation studies (Jansen et al., 2003).
Large population sizes will increase the accuracy of QTL mapping in cases of sparse
marker coverage (J annink, 2005). Vales et al. (2005) detected more QTLs controlling
barley stripe rust disease resistance by using a large segregation population (n=409),
although they also found there was little improvement when population size is beyond
300. In this study, we selected 188 progeny out of 600 F1 progeny to construct linkage
and analyze QTL. To improve the power of QTL detection, more progeny could be
included in the mapping population. Accurate phenotypic data also plays a key role in
QTL analysis because QTL is derived from co-segregation analysis between markers and
agronomic characters. To guarantee consistent phenotypic scoring, the artificial
evaluation of snow mold disease was conducted in the cold rooms, in which provides a
constant environment. However, further evaluations with field inoculation will provide

additional information on QTL detection and environmental effect.

We detected three QTLs associated with leaf width that explained only 22% of the
phenotypic variance in F1 population. These data would indicate the presence of
additional QTLS in creeping bentgrass. In rice, leaf width is inherited quantitatively and

influenced largely by grth environments. More than a dozen genes, located on

83

different chromosome regions with different functions, were involved in the genetic
mechanisms of leaf development (Kobayashi et al., 2003). Utilizing DNA markers
linked to QTLS for leaf width of other crops opens a new avenue for elucidating the
genetic mechanism of leaf morphology and selecting leaf morphology in creeping
bentgrass. Improvement of snow mold disease resistance is another creeping bentgrass
breeding goal. Creeping bentgrass cultivars possess a limited resistance to gray snow
mold which is prevalent in North America (Wang et al., 2005). ‘MSU#8’, which has the '
desirable resistance to gray snow mold disease, could be used as useful germplasm for
improving resistance of modern cultivars. In addition disease resistance, recovery ability
after disease infection also should be considered in the breeding. Pyramiding QTLs
controlling resistance and recovery after lyphula infection should provide an opportunity
to develop cultivars combining higher snow mold resistance with better recovery ability

in creeping bentgrass breeding program.

84

Table 4.1 AF LP,SSR and RAPD primers used for mapping the creeping bentgrass

 

 

 

 

 

 

 

 

 

 

population.

AFLPs (Pstl +Mse|l ssas (Tall fescue EST-SSRa) a RAPDS
P-ACC/M-CACG NFFA015 ,NFFA093 701
P-ACC/M-CAG NFFA021 ,NFFA101 777
P-ACC/M-CGGC NFFA022 ,NFFA106 BA01
P-ACC/M-CTCG NFFA023 ,NFFA109 BAo2
P-ACC/M-CTG NFFA042 ,NFFA115 BA08
P-AGG/M-CAG NFFA045 ,NFFA117 opcos
P-AGG/M-CAT NFFA050 ,NFFA121 013010
P-AGG/M-CGGA NFFA056 ,NFFA126 OPY07
P-AGG/M-CGGC NFFA062 ,NFFA132 OPY17

 

P-AGT/M-CAG

NFFA063 ,NFFA142

 

P-AGT/M-CAT

NFFA066 ,NFFA147

 

P-AGT/M-CCGG

NFFA072 ,NFFA148

 

P-AGT/M-CGGC

NFFA075 ,NFFA150

 

P-AGT/M-CTCG

NFFA082 ,NFFA151

 

P-AGTIM-CTG

NFFA088 .NFFA154

 

NF FA090 .

 

a The tall fescue EST-SSRs were develop at Noble Foundation, and sequences of these primer pairs were

published in Saha et al. (2004)

85

b00000 goon: 52,000: t2 o\co_n_ D0000:

:5 3.8% 82-33 u a .3800 $2 u _ 8:838:

8:00.33 03:3”: 8:: E0300: 080E E0300: :8 0083300: 0803: 20:: 30:0 080.: 0083.00:

 

 

 

 

 

2. 3o 7: n m 8.68:
:3 .0. 5o otm v n 0080300:
8.5523
3.: 9: mi ”N v; .801:
303:6: m00::0303m 0w8: .3592. .woamaf 38;
x:0w0:: E 00:5 83:08:

 

.3008: E 3: Es A3502 05 823: m8: 3:88 5:
A:0:00::_ SEEN: 8:: E0000: :8 0083300: 0803: 20:: 30:0 £33 .80: 38: 0384383: 00:: :0 m020> 03:30:05: N4» 038:.

86

 

8050000 00:Sm_m0m

 

 

 

 

 

foo o. m w.m €42.0de \ va:*OHU-2\UU<-m Eowém o M w=2 000005
mo Mair—RU

.XR o. m N. m -EFOaTm \ mnmc*O<U-—z\,~0<i 20:6: NEE b0>000m
5 _ 50000

XE 9N o.m €600me \ th=*OUHU-2\HO<-m 20mg: NEE 20:5? .0004
CM _=*UOOU

o\oo 9N Nam $600me \ 0m mc*D<U-E>—b<-m 20:. _ N nwE N523 M004
M: meOOUU

foo 9N :0 -E\HO<¢ \ w _ N:*U<U-§\OO<-L Zomdv NwE 30:5? @004

205003.“. 0000m action @0000
X2 DOA 004 0:00:02 0000002 x00m 0900—05 01:0

 

.0w0x0: 208 0000:. $2 :00 0w00—E— 2060.: 8008 En .05300 9.0% 0w0x0= E .Acouoflfi
3:00:05 00:0 @0300: :00 00003600 00002: 206 3000 5:3 0005 0:00 00:: 000 APO :000000: 05 00 moumtfiofifiu m6 030%

87

030000 3 “0000065 000 w0=_0> :00 5:20.» .AEEV £23 002 0 Sm £534 :00
womMm< 0002500 00000 05 80b Eamoa fl m mm: E 5:332: 3:01.005 0: .v 03mE

ea: 523 00.:
m 0.0 0.0 0.0 00 N 3 m: .1 2 P

        
   

 

» iliailIe

it $352. I. 1.1.1111

 

,gla‘iiiia‘s
.womeaf

 

ov

 

 

.8

Number of plants

88

.03 0830.0 $87003 u a .02 08820

$30 u _ “00003630 030000 3 :800_:0_ 000 0020> :00 300000 .200. 3000 00 000003000 000

@0me :00 wommm< 0003000 3000 05 E00.“ >00woa _ m mm: E 00:05.50: 0300000000 3 .v 00=wE
00080600 00002: 200. 300m

9 m n o m v m N

 

 

 

 

 

Number of plants

89

00003000 000 .xbmua $005000 0.0: gay—HE 0005030 030000 3 :000E:E 000 $305 :00 300000 00:08E
353$ 00c0 303000 00.“ qum2 :00 womdm< 00003000 $0.00 0.: 80¢ >00w000 _ 0 mm: E 005550: 30000000 00 .v 00=mE

00000000 EVERQ 0200 b0>000m

\. o m v m N r

       

V. 1,! ll ll: , , . , ..... ,ll,1,ll.i[ ‘ OF
.manE.

lllylillll llll l la '1 l l. . . a . llllirilrllf‘ 1 ON

 

 

Number of plants

ov

 
 

 

.wcmmmxf iylllll_lll1!y om

 

loo

>5>oow~

90

.Ewt 05 so 98 BE? 5x52 $81.2: 5953 A23 gums—23:8 5530! E mug—Swag 28:me 05

 

 

 

 

 

n ScL<o$Po<d I;
Smcbomoépgd r t m. I
ooc.ommo-2;o<d \ul Q8
82.0<o-§oo<d &lfl 98
59L<o§oo<d 9mm
Ec.o<o-§oo<d v.8
$2.0<o-200<d JI\ v.»
mficbgoéfiofia ....v
B~Fo<o§oo<d \G/ 9o
#0..

82339263-“.
35089203-“.
32.35.2524;
8535-269;
2. 2.35-2592
$2.2 2&2
m.mc.»<o-25<d
mmmc.o_.o-§5<d
o?opo-§5<d
camc.o<o-200<d
fiébSéBofia
Ec.m9.o-§oo<d
K EL<o-Zow<d
Bvc.o<o-s=ow<d _,
Noecbgoiagd 4
Ec.mo<o-§oo<d
S EL<o-§oo<d
chL<9é5<d
Emcbgoiaofia
8:.05-25<d
ENFBQ$BQ<¢
E E.<aao-_2\oo<d
owwc.ommo-z\oo<d
m 8535-263;

_
—
.
a
m
m
“

 

\H__, 7

 

32689283-;
2c.05-25<d
:mc.»<o-s=oo<d
82.05-§oo<d
momc.o<o-2\oo<d
Rmckmmoéaofia
3c.oopo-§»o<d
mowc.o<o-s=5<d

 

mm E.o$o-§ow<d

m0...

 

mKow
mdmp
floor
Qwvw
mdmw
92:
9me
m6:
NM:
OP:
m6:
060'
fiwop
Wmow

mhmcbo<uuz

§:.o<o-éoo<d
~8505é§o<d
SNENSEHE
ch.mo»o-§oo<d
ENFEQEogd
upmc.oooo-25<d
S~:.o<o-s=ow<d
$2.32sz
Buc.0<o-éoo<d
Suc.o»o-§5<d
mafmifiz
82.o<o-25<d
8N...»<o-s=ww<d

 

./

/
fl

1

I

I

II

. ‘9.
m 0:
rs co

 

X
\
\
.\
.\

u

I

// \\\\\

T.

r

 

.QNQQEQON
3393858

 

N0...

8m a2 05 so 235:: och £86365 ww~ an woufiucuw Aw quEV 82mm 038$ 05 mo 9:: owe—c: 285w < and 23$"—

83 ; New
oNEL<oéio<d 03
$505- Zoo<d 9S
82L<9250<d v.8
22.080- 260$“. m2
mmmcL<oéau<d Q8
vomcL<oéFo<d Co
32.85.2545. 93
momcL<o$Po<d <8
mumc.o<o-2:b<d 08
522892504“. o8
mamc.h<o-2\oo<d «.5
82539203-“. 3N
~o~c.0mmo-§wo<d 3:
82.080-2oo<d 2:
Ec.o<o-§oo<d NS
visokoétgd mm
mm .c.ommo-2Fo<d o.o

90..

9|

.3283 Ewt 05 :0 8m 8:8: 6x32 .8812: :83on £23 mcmwhozscoo Begox 5 80:8va 285m 05 8a
a2 05 co E323: 23 22.232: ww~ 80¢ voafiocow Am 559): E83 0388 2: mo 38 owSE: 032% < nmé 2&5

vm~:.o<o-§oo<-a l
«mmcbmmoéaoara

\\. héN
wéw

 

mvwcbgoétofia

 

“85039253-.“

 

9m
0.0

 

 

may;

 

mifooooéiofia/ m.m~
wmmc.ommo.§ow<d /D 3%
ompc.ommo-_2\oo<d 08

I

wmmc.0<0-_2:.0<-a 1” adv
PNFc.O<O-2:.O<-n_

opw-~.o>

 

 

 

~04

 

 

 

 

 

wmc.ommo-§oo<d 05
«mmc.o<o-§oo<d/[\m.8
ENCL<0-§oo<-a/ \QNN
32.05-280<d/H\m.3
mmmcL<oéto<d F I:
mt...0<o-2po<d\ /m.:
32.05-2397.“ o.o
m0;

omméPO

9mm

 

$~=.oho-2:o<d /
mmmc.oooo-2:o<d/

\ 2m
\ o3

 

mmmc.omoo-z;o<d
onnc.o»o-§oo<d\

mFNc.._.<O-$:h0<-m

Dov
./ 0.9V
9mm

 

 

noc.0h0-2\h0<-a

82.85-5304;

 

WON

 

0.0

 

90..

92

.3288 Emu 20 :0 an 8:80 08.32 £0me 5253 328 98332050 5830M E 32836 ouocuw

Nfimc.ommo-§oo<d
S?.o<o-§oo<d
82.05-2Po<i
82.: 0-26 o<d

$2.08 o-2\oo<-a
82:2 o-§oo<-n_
.Sc.opo-2:o<d

B.:.ommo-§oo<d

Emc.mopo-2tw<d
$503 o-§ow<d

vtho<oéBo<d

SNEmBQéBQ‘d

Nmmckam 0-252-;
8%.: 0-25 o<d
mocha o-§ow<d

www.—

FPFFNNNNNNNO’)

°°’.".°’.".°’."."°9"."’.°9¢’.".N.
OWQMLDCDQFNMLDCONO’O

32639252-;
8:.65-Zoo<d

:0.—

0.?
0.0

mwmc.0._.0-_2\00<-a
Neat—.430- _2\00<-n_

0mc.0000- .2\._.0<-a

 

 

 

 

 

3.0..—

WON
f:
0.0

2: 2m 02 05 co 23:5: 2? .flwscSEE mi :50 vowwpocow Am £520 383 2950 20 mo 92: owmxcz 385% < 0N4» oSwE

mmcbmmoéic<d 3
8c.p<o-§wo<d W®m co
8:.ommo-2\oo<d o.o

00..

93

.25:on Em: on: :o o8 888: 8x82 8.8.8.: 8838: 028 88802080 5683— E 80:82: 288w
20 08 02 05 :o 880:3: och 883365 mm: 800 888:% S 35920 :88: 28:80 05 mo 88 88::— 288w < 3.: Esz

 

 

 

 

 

 

 

 

mwmc.ommo-2:uo<-a 98:
32.29.2508: «.8
8:.ommo-s:oo<-a :8
82.o<o-s:00<d fit. $:L<o.§oo<d 8.8M
- - . owmc.o»o-z\oo<d :
ENFZQ 2Fo< a v 8 8c.ommo-zio<d 5:
mm.c.mo:o-2;o<d NZ
«ffokoéiofia N:
vmmcbmmoéfio<d 93
82.05-§oo<-a 8.:
omcL<oéFo<d o.o mtc.o<o-2;o<d 8.8
~m=L<oéBo<d v.8
88.089253; to
vomc.oooo-z;o<d o.o

«...va MPG.—

94

.28: 05 :o 08 8:8: 8x82 888:: 8038: 323 88:02:80 5880M :_ 8888: 38:8 20
08 02 20 :0 83:3: 0:... 8832305 ww_ 80.0 888:8 cham/xv «:98: 288 we 88 2.0 83:: 08:8 < «m: 28E

0007s w>

 

 

8850892003-“.

Ewc.mo»o-éoo<d [I\ n:
8:L<o-§oo<d \1/ 8.8

 

 

vomc.oooo-2:o<d m8
8280<oé$o<d 8.3
8w...05-éoo<d / \ no

 

 

88.08.2033 \0/ 3.

v0.—

 

 

 

 

 

 

 

mmmc.ogo-§5<d o8
mmmcbgoéogd v.8
35089283-; 98
Sasogéwgd 11“ m8
mmmc.mo»o-25<d 08
38.83.2093 \1] 8.2
«szoéogd /1\ «a.
82.35-25,.8 \Hl o. 2
8 2.88-263; \ / 0.8
82.080-288d 9°
«6..

rum:.0.r0-_2\00<-m

88.38-2504;

mnm:.0<0-5<00<-n_

32889208-“.

2c.<mmo-2\oo<i
B~Fo<o§oo<d
mhmcbkoéagd

82.88-2683.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

0.8.
885080-250?“ N8
«.8 8.:.w5-§oo<d m8
35089253-“. 1L\ 8.8
. 82.<mmo-§oo<d \II :8
m 3 NocL<o$6w<d 0.8
:2.
mm:.0»o-éoo<-n_ m8
8.:.<mmo-§oo<d 2.8
v.8 :EL<o-§oo<d «.2
N. :
o:
o.o 88889253-“. o.o
PG.-

95

APEOQV Ewt 05 :o 8: 8:8: 5:32 $8.88 5933 328 38:32:50 5830M E 82836 05:8
2: 2: an: an. :o 235:: 2C. $126365 ww~ Bob US$28 Awommmxb “:28 2:6 05 mo 9:: 83:: 28:8 < an...» 885

N.¢c.ommo-2.oo<d /D\ 33

 

 

 

 

 

 

 

 

 

 

 

om.c.p<o-2.oo<d II\ 36
8F<mmoéEo<d \I/ :3
~m.c.mo<o-2.oo<d :v
vmmcbmmo- 2.09:. 1D\ mam «3505-253-.. :8
82.0 0.259.... 1\ :8 2505-253-.. NS .
mpmcbmgéfgd / wen . t E.ommo-§oo<d m vm
12.05. 2.09.-.. \L( «.3 momc.oomo-25<d mm. .
Emcbohoiaofia m m. vw~:.ommo-2:o<d v m.
22.089252-.. 1m
oomc.h<o-z.ow<d m...
:mc.ommo-2:o<d o.o 3.2.35-2;3d 3. SFwwooéE<d o.o 32.039203-.. o.o

 

 

 

 

 

 

 

 

 

 

8.. 5.. 3.. 3..

96

$0.608 Em: 05 :0 0:.» 8:8: 6me £8.88 50250: $28 88:02:50 Bammovu E 30536 030:8
05 0:: .80— 2: :0 20025: 05- .25.2305 mm: 80¢ 088058 8095/... 0:23 0:2: 05 mo :9: 88:-:— 030:8 < 0m... 0:8E

82.05208... ...-D\ o. 5
moms-080-254.-.. \1! mm:

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

came-omm0-2»0<-n. m. S Nomc.0<0-200<-a m8
wmmc-m0p92»0<d YE No.c.m0»0-2:0<d m3
. 80-80 :0
80...... 2&2 0 mm Ruc.0<0.200<-n. Sm
Ema-000925,.-. mam
Ems...<0-200<-n. :3
wMNCcOmooufiaw<uQ Ill\\ mdm mnc¢0m00u200<nl / \ h 0m
Name-0.292005. \ll 63 cm 2.05-2004... /H\ 05
82.080203-.. won t E. < 2 0<d m8 80:85.2 9%
0 9 0 oovc.080-2h0<d 98
NNE.0PQ200<-n. \H/ 3N
«8508920042-: \1/ 9%
New-505.203-.. \I/mdw
«9505.203-.. 3: .
- . c. - - N m
mmrc.._.<0._2\00< n. m m :wc.b<O-S_\Oo<d VflAwa-w on? 0000 2FO< a
. . 82.3 -20 <4. 3 .
mac-0000-25<d o o cums-089200,; o o w8c.<mmw-20w<d \G/ o o 2205200.}. 0 o

20.. 30.. S0. 8..

97

APESV Emu 05 :0 80 0080: 000.82 $8.38 0002509 328 mammhozscoo 5833— 5 80:80.6 0:0:0m
05 000 a“: 05 :0 2008:: 05- .m_0=E>€E wmz 80¢ wofibcow Sag-ma; .0008 0:2: 05 mo 92: “$83: ozocow < 00v ouswE

 

8 Fc.0mmo-2F0<d
$~=.0<0-§00<d i
82.05-26 0<d

 

 

 

 

mac-080-25: V
Ema-0000-20 0<-n_

([
/\

3.0..

«.3.
m.mm
mhm

m.o

con-eon NON

 

 

 

 

mmc.<mmo-§00<d 0.0

2.0..

98

.mowme AwanZV “:83 2080-:

0:0 Rug 0:: NO: ANN-0:08 004 8 wfigoamobS £00: 83838.8: :0 0003 3?: 2050:: ::m0§:w_m 80065 803
0005—005 APO E 8:: 8: 303:2, 0:..- .m-E-O 523-32 $9865 303 0005—00.: 3.0 05 0:0 :5: 0w§Eq 0.: .v.wE

 

 

 

 

 

4 q q 4 q
0. 5 O 5 0 5 0
4 3. 3 2 2 1 1

 

 

 

 

 

4 mm.c.0000-§»0<d 3N
82.089200<d /I\ 0%
.3 on 2080-2593 \If mg
a ommc.0<0-§-0<d 02
.-.- ...-J...“ RE.0<92:0<¢ \I/ 0.:
H mm.
a.
”- 90-2; 0.0
504

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

. mums-8502 0.3
- 52.0<0-§00<d «.2
Ar
4 NRC-05-2540 0.8
- meme-«35:2 Em
A-/.\\\-.- hmwcbO-roigooxxd /.1\ Non
x3. chL<0-§00<d \17 new
-.-:-- -------\ - v Soc-0000-2:0<d a?
fur-.--- .. .. .- w- ! Ema-05-20043 N. :-
/.-.-.-. ENFNEEuz can
- -- V- mmmc.0<0-2\00<d SN
/-, Ewe-05-3543 fl:
meme-«SEuz E:
.. 82.0<0-2:0<¢ E
d a q < 4 J «‘4 OONCL<032\MVO<-Q 0.0
o 5 o 5. o 5 0. 5. 0..
4 3 3 2 2 4| 4| 0 0
Q04

N04

99

.0092: $3020 :53: 295: 0 S00 .3058
Q04 9 w:_::o%0:00 .050: 5:03.50: :0 0000: _0>0_ 20:00:: Ema-«Em?- 003065 :2: 000560.:

do a 8: 08 35> 2E 45 £23 :02 058205 83 82:85 db 2: 23 use 003:: 73- «.0:

Ema-030-202-“.
Ema-0<0-§00<d
82.05-2E0<d

m \u-v wane-20-20043 K 0.0m
A-\-\ H mmmc.0mmo-2\00<d 3N
-.w--wn--- . _ moi-50-200 <d ZN

Ani- , . BE.05-2C0<-a 0:8

 

 

 

.. :0 E.080-§00<d
./!:.-i -r. nmmcbopoétgd
\\--..\ veg-080-2004:
Ann- . vo.c.mo<0-200<d
J... o rue-005-203-:
,. ~mmc.<30-2\00<d
w moms-20-5.0040
mos-<mmo-z\00<d

I
r

- \I

-

 

 

 

 

4O

35*
30~
25-
2.0q
15‘
10-1
osJ

«PG...

100

.0308: 3359.6 80:0: 2080: 2 :04 .o.mu0:oom
DOA 2 w:€:o:m0-:00 .800: 8:08:80: :0 0000: _0>0_ 20:00:: 800E:w_m 0:00:08 :2: 0002—00.: APO 8 00::
:20 _02:0> 0E. 82:00.:8 SEE-AN 8:0 490 80300: w::00=08 :2: 0002—00:— 12.0 05 0:0 :08 owe—:3 £10 .wE

 

80.x. ; New

 

 

owchgtn-u’xd m-mw

 

 

 

 

 

 

 

 

 

 

 

8.552005. /I\0.~0
82.202002... I..\ 0.00
296802008 / \00:
89ng<¢ .- 08
32:52:05. /1 20
002-8525,}. /I \000
mac-Fig.0: /H \ 08
A 05.052208 /n \ 0.8
.8532005. 3 / 0.8
V
O
C
9
R
82:52.85. NR
$852005. 0.0
Sac-0802.00,}. /1\ 0.0:
82.080209}. \1/ x:
«magi 00:
32.052205. 0.0
. . . . . . 0020032208 :0
4 3 3 2 2 1 1. 0 0

 

5..

101

 

WQICI

 

 

 

008.00 0000020 .0200 205 0. 0:0: 0.00:8.
DOA 0: w:m0:0:00:00 .0000: :0008800: :0 0000: _0>0_ 20:00:00 0:00E:w_0 00020:: 0.2: 0002—00:— A PO 8

00:: :00 _000:0> 0: P .A PO 80200: 000020 208 30:0 800208 002: 0002—02: APO 05 0:0 :08 0322A 00 .vwE

 

 

 

 

 

4.0

3.5“

3.0

2.5‘

2.0"

1.5“
1.0“

0.5‘
0.0

 

DS

 

 

 

 

 

 

 

 

 

 

 

3055-2000.: 00..
02.00.002.005". 0.00
00:905-262.". 0.00
000.02%? 0.00
002-080-8002.... 0.00
002.052.0040: 0. 00
300.030.2630. 0.00
000505-2505. 0.00
002.000.2005. 0.:
t 2.952.005. /1\ 0-0
002.052.00.00. \1/ 5.
0000-3002005. 0.0

 

0 PG.—

102

References

Arumuganathan, K., S.P. Tallury, M.L. Fraser, A.H. Bruneau, and R. Qu. 1999. Nuclear
DNA content of thirteen turfgrass species by flow cytometry. Crop Science
39:1518-1521.

Ashikari, M., H. Sakakibara, S.Y. Lin, T. Yamamoto, T. Takashi, A. Nishimura, ER.
Angeles, Q. Qian, H. Kitano, and M. Matsuoka. 2005. Cytokinin oxidase
regulates rice grain production. Science 309:741-745.

Bai, Y.L., CC. Huang, R. van der Hulst, F. Meijer-Dekens, G. Bonnema, and P.
Lindhout. 2003. QTLS for tomato powdery mildew resistance (Oidium lycopersici)
in Lycopersicon parviflorum G1 . 1601 co-localize with two qualitative powdery
mildew resistance genes. Molecular Plant-Microbe Interactions 16:169-176.

Basten, C.J., B.S. Weir, and Z.-B. Zeng. 1999. QTL Cartographer, version 1.13.
Department of Statistics, North Carolina State University, Raleigh, NC.

Belanger, F.C., K.A. Plumley, P.R. Day, and W.A. Meyer. 2003. Interspecific
hybridization as a potential method for improvement of Agrostis species. Crop
Science 43:2172-2176.

Boiteux, L.S., J.G. Belter, P.A. Roberts, and P.W. Simon. 2000. RAPD linkage map of
the genomic region encompassing the root-knot nematode (Meloidogynejavanica)
resistance locus in carrot. Theoretical and Applied Genetics 100:439-446.

Bonos, S.A., M.D. Casler, and W.A. Meyer. 2003. Inheritance of dollar spot resistance in
creeping bentgrass (Agrostis stolonifera L.). Crop Science 43:2189—2196.

Burpee, L.L., L.M. Kaye, L.G. Goulty, and MB. Lawton. 1987. Suppression of Gray
Snow Mold on Creeping Bentgrass by an Isolate of Typhula phacorrhiza. Plant
Disease 71 :97-100.

Chakraborty, N., J. Bae, S. Warnke, T. Chang, and G. Jung. 2005. Linkage map
construction in allotetraploid creeping bentgrass (Agrostis stolonifera L.).
Theoretical and Applied Genetics 111:795-803.

Churchill, G.A., and R.W. Doerge. 1994. Empirical Threshold Values for Quantitative
Trait Mapping. Genetics 138:963-971.

103

Collard, B.C.Y., M.Z.Z. Jahufer, J .B. Brouwer, and B.C.K. Pang. 2005. An introduction
to markers, quantitative trait loci (QTL) mapping and marker-assisted selection
for crop improvement: The basic concepts. Euphytica 142:169-196.

Curley, J ., S.C. Sim, S. Warnke, S. Leong, R. Barker, and G. Jung. 2005. QTL mapping
of resistance to gray leaf spot in ryegrass. Theoretical and Applied Genetics
111:1107-1117.

Devey, M.E., J.C. Bell, D.N. Smith, D.B. Neale, and GE Moran. 1996. A genetic
linkage map for Pinus radiata based on RFLP, RAPD, and microsatellite markers.
Theoretical and Applied Genetics 92:673-679.

Doligez, A., A. Bouquet, Y. Danglot, F. Lahogue, S. Riaz, C.P. Meredith, KJ. Edwards,
and P. This. 2002. Genetic mapping of grapevine (Vitis vinifera L.) applied to the
detection of QTLS for seedlessness and berry weight. Theoretical and Applied
Genetics 105:780-795.

Fanizza, G., F. Lamaj, L. Costantini, R. Chaabane, and MS. Grando. 2005. QTL analysis
for fruit yield components in table grapes (Vitis vinifera). Theoretical and Applied
Genetics 111:658-664.

Grando, M.S., D. Bellin, K.J. Edwards, C. Pozzi, M. Stefanini, and R. Velasco. 2003.
Molecular linkage maps of Vitis vinifera L. and Vitis riparia Mchx. Theoretical
and Applied Genetics 106:1213-1224.

Hartman, C.L., L. Lee, P.R. Day, and NE. Turner. 1994. Herbicide-Resistant Turfgrass
(Agrostis Palustris Huds) by Biolistic Transformation. Bio-Technology 12:919-
923.

Hanley, S., J.H.A. Barker, J.W. Van Ooijen, C. Aldam, S.L. Harris, I. Ahman, S. Larsson,
and A. Karp. 2002. A genetic linkage map of willow (Salix viminalis) based on
AFLP and microsatellite markers. Theoretical and Applied Genetics 105:1087-
1096.

Hitchcock. 1951. Manual of the grasses of United States. USDA Misc.Publ.200.U.s.Gov.
print. office, Washington, DC.

Inoue, M., 2.8. Gao, and H.W. Cai. 2004. QTL analysis of lodging resistance and related
traits in Italian ryegrass (Lolium multiflorum Lam.). Theoretical and Applied
Genetics 109:1576-1585.

Jannink, J.L. 2005. Selective phenotyping to accurately map quantitative trait loci. Crop
Science 45:901-908.

104

Jansen, R.C., J .L. Jannink, and W.D. Beavis. 2003. Mapping quantitative trait loci in

plant breeding populations: Use of parental haplotype sharing. Crop Science
43:829-834.

Jones, E.S., M.P. Dupal, J .L. Dumsday, L.J. Hughes, and J .W. Forster. 2002. An SSR-
based genetic linkage map for perennial ryegrass (Lolium perenne L.). Theoretical
and Applied Genetics 105:577-584.

Jones, K. 1956. Species differentiation in Agrostis III. Agrostis gigantea Roth. and its
hybrids with A. Tenuis Sibth. and A. stolonifera L. Journal of Genetics. 54:394-
399.

Jung, S., D. Main, M. Staton, I. Cho, T. Zhebentyayeva, P. Arus, and A. Abbott. 2006.
Synteny conservation between the Prunus genome and both the present and
ancestral Arabidopsis genomes. Bmc Genomics 7:81-97.

Kobayashi, S., Y. Fukuta, S. Morita, T. Sato, M. Osaki, and G. S. Khush. 2003.
Quantitative trait loci affecting flag leaf development in rice (oryza sativa L.).
Breeding science 53 255-262.

Kolkman, J.M., and J .D. Kelly. 2003. QTL conferring resistance and avoidance to white
mold in common bean. Crop Science 43:539-548.

Lee,L. 1996. Turfgrass biotechnology. Plant Science. 115:1-8

Lima, M.D.A., C.L. de Souza, D.A.V. Bento, A.P. de Souza, and LA. Carlini-Garcia.
2006. Mapping QTL for grain yield and plant traits in a tropical maize population.
Molecular Breeding 17:227-239.

Muylle, H., J. Baert, E. Van Bockstaele, J. Pertijs, and I. Roldan-Ruiz. 2005. Four QTLS
determine crown rust (Puccinia coronata f. sp lolii) resistance in a perennial
ryegrass (Lolium perenne) population. Heredity 95:348-357.

Okogbenin, E., J. Marin, and M. Fregene. 2006. An SSR-based molecular genetic map of
cassava. Euphytica 147:433-440.

Qin, F., J.S. Li, X.H. Li, and H. Corke. 2005. AFLP and RFLP linkage map in Coix.
Genetic Resources and Crop Evolution 52:209-214.

Saba, M.C., M.A.R. Mian, I. Eujayl, J .C. Zwonitzer, L.J. Wang, and GD. May. 2004.
Tall fescue EST-SSR markers with transferability across several grass species.
Theoretical and Applied Genetics 109:783-791.

105

Simarmata, M., S. Bughrara, and D. Penner. 2005. Inheritance of glyphosate resistance
in rigid ryegrass (Lolium rigidum) from California. Weed Science 53: 615-619

Singh, S., R.K. Gumber, N. Joshi, and K. Singh. 2005. Introgression from wild Cicer

reticulatum to cultivated chickpea for productivity and disease resistance. Plant
Breeding 124:477-480.

Studer, B., B. Boller, D. Herrmann, E. Bauer, U.K. Posselt, F. Widmer, and R. Koelliker.
2006. Genetic mapping reveals a single major QTL for bacterial wilt resistance in
Italian ryegrass (Lolium multiflorum Lam.). Theoretical and Applied Genetics
113:661-671.

Vales, M.I., C.C. Schon, F. Capettini, X.M. Chen, A.E. Corey, D.E. Mather, C.C. Mundt,
K.L. Richardson, J .S. Sandoval-Islas, H.F. Utz, and RM. Hayes. 2005. Effect of

population size on the estimation of QTL: a test using resistance to barley stripe
rust. Theoretical and Applied Genetics 111:1260-1270.

Vergara, G.V., and SS. Bughrara. 200x. Evaluation of Bentgrass for Resistance to
Typhula incarnata Lasch. Plant Disease (submitted).

Villamon, F .G., D.M. Spooner, M. Orrillo, E. Mihovilovich, W. Perez, and M.
Bonierbale. 2005. Late blight resistance linkages in a novel cross of the wild

potato species Solanum paucissectum (series Piurana). Theoretical and Applied
Genetics 111:1201-1214.

Voorrips, RE. 2002. MapChart: Software for the graphical presentation of linkage maps
and QTLS. Journal of Heredity 93:77-78.

Wang, D., R. Karle, and A.F. Iezzoni. 2000. QTL analysis of flower and fruit traits in
sour cherry. Theoretical and Applied Genetics 100:535-544.

Wang, Z., M.D. Casler, J .C. Stier, J .S. Gregos, and SM. Millett. 2005. Genotypic
variation for snow mold reaction among creeping bentgrass clones. Crop Science
45:399-406.

Warnke, S.E., D.S. Douches, and BE. Branham. 1998. Isozyme analysis supports

allotetraploid inheritance in tetraploid creeping bentgrass (Agrostis palustris
Huds.). Crop Science 38:801-805.

Wu, R.L., Y.F. Han, J.J. Hu, J.J. Fang, L. Li, M.L. Li, and Z.B. Zeng. 2000. An

integrated genetic map of Populus deltoides based on amplified fragment length
polymorphisms. Theoretical and Applied Genetics 100: 1249-1256.

106

CHAPTER 4
ISOLATION AND CHARACTERIZATION OF COLD-REGULATED
TRANSCRIPTIONAL ACTIVATOR LPCBF3 GENE FROM PERENNIAL
RYEGRASS (Lolium perenne L.)

107

Abstract

In plants, low temperatures can activate the CBF cold response pathway which plays a
prominent role in cold acclimation by triggering a set of cold-related gene expression. We
identified and characterized a CBF homologous gene, designated as LpCBF 3, from a
cold-tolerant perennial ryegrass (Lolium perenne L.) accession, P1598441. LpCBF 3
encodes a protein of 237 amino acids with a molecular mass of 25.5kDa. It carries the
sequences for the typical nuclear localization signal (NLS), AP2 DNA-binding domains
and an acidic activation present in most of the plant CBF proteins. Monocot CBF genes
are grouped together and separately clustered from dicot CBF genes. Southern analysis
indicated the presence of at least three homologs of LpCBF 3 gene in the perennial
ryegrass genome. Only one amino acid variation in LpCBF 3 protein between cold-
tolerant and -sensitive (P1610939) perennial ryegrass accessions was observed. A glycine
to glutamine substitution at amino acid residue 190 was found in the cold-tolerant
accession. However, in their putative promoter regions, some differential regions were
found. Northern blotting and RT-PCR analysis found LpCBF 3 reached the highest
expression after 1.5 hours of cold treatment (4°C). A COR homologous gene, a
downstream gene of CBF, can be expressed in the plant stem of cold-tolerant perennial
ryegrass accession without cold treatment. Conversely, the COR gene can not be
activated in cold-sensitive perennial ryegrass accession without cold treatment, although
the cold treatment can prompt expression level of COR homologous gene in both
perennial ryegrass accessions. In transgenic Arabidopsis, the over-expression of LpCBF 3

with the 35S promoter resulted in plants with dwarfrsm, later flowering and greater

108

freezing tolerance. Implications and applications of LpCBF 3 gene for improvement of

cold tolerance with other desirable traits in turfgrass breeding program are proposed.

Key Words: LpCBF 3, Perennial ryegrass, COR, Promoter regions, Cold tolerance

Introduction

Perennial ryegrass (Lolium perenne L.) is the most common grass grown in the
temperate regions of the world (Asay, 1992). It is primarily used for turf and forage
because of its high quality and yield, but low winter hardiness (ability of a plant to
survive winter) limits its application in northern continental climates (Humphreys and
Eagles, 1988). Improving cold tolerance in perennial ryegrass is one of the most
important breeding objectives. However, implementing this objective has been met with
limited success by conventional breeding methods because of the quantitative
characteristics of the cold tolerance trait (Skinner et al., 2006; Skot et al., 2002). Modern
biotechnology provides an opportunity to improve cold tolerance and winter hardiness in
perennial ryegrass, as well as other plant species by manipulating cold-tolerant related

genes and their expression (Kosmala et al., 2006; Zhang et al., 2006).

Many plant species from temperate regions can increase their cold tolerance in
response to low, non-freezing temperatures, a phenomenon called cold acclimation. Cold

acclimation undergoes physiological and biochemical adaptations which are regulated by

109

at least two pathways, abscisic acid (ABA) and ABA independent pathways (Knight et al.,
2004; Liu et al., 1998). In the ABA-independent process, cold temperatures indirectly
trigger the transcription of the CBF family which in turn activates the transcription of
COR genes encoding a diverse array of proteins with a presumed function in tolerance to
the dehydration caused by freezing (Kobayashi et al., 2005). In Arabidopsis, the
transcription of COR genes has been shown to be regulated by cis-acting drought and
cold responsive elements (DRE) containing a core CCCGAC (CRT) sequence (Liu et al.,
1998; Skinner et al., 2006). The trans-acting factor, CBF which can bind to DRE and
activate COR genes’ expression, was first isolated fi'om Arabidopsis (Liu et al., 1998) and
then several other plants, such as rice (Oryza sativa);(Qin et al., 2005), diploid wheat

(T riticum monococcum.); (Miller et al., 2006), barley (Hordeum vulgare);(Choi et al.,
2002). The CBF genes, as transcriptional factors, belong to a small multi-gene family
and have a potential nuclear localization sequence (NLS), an APETALAZ (AP2) DNA-
binding motif and an acidic activation domain (Gilmour et al., 2000; Skinner et al., 2006).
In Arabidopsis, the genes, CBF] , CBF 2 and CBF 3 (also known as DREBI b, DREBIc
and DREBI a, respectively), are located in tandem on chromosome 4 (Medina et al.,
1999), and are cold and stress-inducible. The transcription of CBF genes was positively
regulated by an upstream transcription factor, ICE 1 (inducer of CBF expression 1), after
the cold treatment (Chinnusamy et al., 2003). While the transcription of CBF3 and CBF]
can be negatively regulated by over-expressed CBF 2 (Novillo et al., 2004). CBF gene
expression may also be controlled by Caz": related processes, because the CBF gene
expression pattern can be altered in mutations of Cay/H+ transporter CAXl and Ca2+-

sensor protein CBLl (Albrecht et al., 2003; Catala et al., 2003). Therefore, cold signaling

110

of freezing tolerance requires a cascade of transcriptional regulation events. After cold
treatment, the upstream transcriptional factor ICE 1 or other factors can up- or down-
regulate the CBF transcription which activates or represses CBF regulon expression
(Xiong et al., 2002). This pathway may be conserved in a variety of plant species at the

molecular level (Cook et al., 2004).

Because CBF genes are master switches that control the expression of a regulon of
CRT/DRE-controlled genes that include some of COR gene family (Fowler and
Thomashow, 2002), constitutive over-expression of CBF] and CBF 3 in the Arabidopsis
was shown to be able to drive expression of COR genes in absence of low temperature
stimulation and then increase plant cold tolerance by increasing the sugar and proline
content (Gilmour et al., 2000). Also transgenic plants exhibit some traits such as a
‘striking dwarf’, later flowering and stunted phenotype (Gilmour et al., 2000), which are
considered to be side effects due to over-expressed CBF gene. However, these
morphological characteristics of transgenic plants are desirable in turfgrass breeding

since they may reduce mowing frequency in turfgrass and increase cold tolerance.

To screen cold tolerant perennial ryegrass, the germination rate of 300 perennial
ryegrass accessions across a range of temperatures was evaluated in the laboratory by
using a thermogradient plate to determine if accessions would germinate equally well as
temperatures declined. In the field, the accessions were grown as monocultures and as

binary mixtures with ladino white clover and rated for winter hardiness at three Michigan

111

field locations (Wamock et al., 2005). Based on the results from the laboratory and field,

30 cold-tolerant accessions of perennial ryegrass were identified.

The objectives of this study were to screen 30 cold-tolerant perennial ryegrass
accessions, to isolate and characterize a CBF-type gene and its putative promoter
sequence from the most cold tolerant and sensitive perennial ryegrass accessions, and to
determine the effects of overexpression of the gene in transgenic Arabidopsis plants. We

also discuss the application of LpCBF 3 in turfgrass breeding.

Materials and Methods

Freezing tolerance evaluation

All the Plant Introductions (PI) used in this study were provided by the USDA
Regional Plant Introduction Station (Pullman, Washington). Thirty accessions obtained
after cold tolerance evaluation were germinated and grown in 0.9L plastic pots filled with
Baccto planting mix (Michigan Peat, Houston) at Michigan State University greenhouse
(East Lansing, M1) at 25°C for five weeks. The plants were gently pulled out of the soil
and cleaned with tap water. The leaves and partial roots were removed. The plants were
transferred to freezing incubator and the temperature controller was set to -1, -3, -5, -7, -9,
-11,-13, respectively. After leaving in the incubator for 24 hours at the appropriate

temperatures, the plants were moved to cold room (4°C) for 12 hours. Then plants were

112

 

transferred to pots and grown at greenhouse (25°C) for scoring after 1 week. Every
accession has six replications at every appropriate temperature. The temperature at which
50% of the plants were killed (LTso) was determined. The plants which have the lowest
LTso were used in gene isolation. The accession, PI 610939 with LTso=-1°C, was used as

a control.

DNA extraction and Southern analysis

DNA was isolated from 4 g of perennial ryegrass leaves and purified by chloroform
extraction (Sharp et al., 1989). Ten micrograms of DNA that had been pretreated with
RNase was digested with restriction enzymes (New England Biolabs, Inc., Beverly, MA,
USA.) at 37°C for 2 hours. Conditions for electrophoresis and blotting were performed
according to Sharp et al. (1989). DNA was transferred to Hybond-N extra membranes
(Amersham, Buckinghamshire, UK). Pre-hybridization, hybridization and probe labeling
were followed the manual of the DIG High Prime DNA Labeling and Detection Starter
Kit 11 (Roche, Germany). The digested DNA were hybridized overnight at 28°C or 27°C
according to probe’s CG content and length, washed in 0.1X SSC/O.5% SDS in room
temperature, and exposed to X-ray film (KODAK) for 10 min. The probes were prepared
from a full-length cDNA of LpCBF 3 and LpCBF 3 fragment containing AP2 and NIL
domains produced by PCR with the primers CDlF TCGCAGAGCAAAACCACTTCA

and CDlR TGGTGTCGCTCGAATTCGT at Tm=57°C.

113

RNA extraction and Northern analysis

RNA from leaves and stems of cold tolerant and sensitive perennial ryegrass
accessions were isolated at 0 min, 15 min, 30 min, 1 hr, 2 hours, 4 hours and 24 hours

with cold treatment (4 °C) respectively by using Trizol reagent (GIBCO, BRL, Rockville,

MD) according to manufacturer’s protocol. Five micrograms of total RNA from different
treatments were fractionated in 1.2% agarose/formaldehyde gel and transferred to
Hybond-N extra membranes. Total RNA was pre-hybridized in 50% formamide, 5xSSC,
0.1% SDS, 20mM of sodium phosphate pH6.5, 0.1% Ficoll, 0.1% polyvinylpyrolidone,
1% glycine, 250mg/ml of denatured salmon sperm DNA at 42 C for at least 2hours.

Hybridization was performed at 65°C overnight in the pre-hybridized solution with 32P-

labeled probes (>107 cpm specific activity, cpm/ g DNA). The filters were washed three
times in 2x SSC, 0.1% SDS at room temperature for 10 min and then two washes in 0.1
SSC, 0.1% SDS at 65 C for 30min each. The probes were prepared from LpCBF3 gene
and wheat COR39 of the entire cDNA insert from pWGl (Guo et al., 1992; Takurni et al.,
2003). Probes were labeled with (a-32P)-dCTP (1 ,000 Ci/mmol, Amersham,
Buckinghamshire, UK) using the Prime-a-Gene Labeling System (Promega, Madison,

Wis., USA).

cDNA synthesis

cDNA was generated from RNA samples from a whole plant with 4-hours 4 °C
treatment by using SuperScriptII First-Strand Synthesis System for RT-PCR (Invitrogen,

Carlsbad, CA) following the manufacturer's instructions and using 3 pg RNA and 50-ng

114

random hexamers per reaction. Control reactions without reverse transcriptase were run

for all samples to confirm removal of contaminating genomic DNA.

Isolation of full length LpCBF 3 gene

A perennial ryegrass genomic DNA fragment encoding a CBF-like polypeptide was
isolated by PCR using primerDl: GGCCGGCGGGGCGAACCAAGTTCC,
D22AGGCAGAGTCGGCGAAGTTGAGGC and CBF degenerate forward primer
CC(AGCT)AA(AG)AA(AG)CC(AGCT)GC(ACGT)GG(ACGT), CBF degenerate
reverse primer GG(AGCT)A(AG)(AGCT)A(AG)CAT(AGCT)CC(CT)TC(AGCT)GCC .
These primers were designed according to conserved regions of the Rice and Arabidopsis
CBF proteins at the beginning of the AP2/EREBP domain and putative activation domain,
respectively (Thomashow et al., 2001). 3’-and 5’-ends of cDNA were isolated based on
the partial gene sequence obtained above using 5’ and 3’RACE (5 ’/3’ cDNA
amplification kit, Roche, German). The gene-specific primers are Spl
CCCGCGGCGAGGGCGAGCATGGCGGC and SpSR
GGCGGGGCGAACCAAGTTCC for amplifying 5’ and 3’ sequence of LpCBF3 gene.
The full length LpCBF 3 gene was synthesis by PCR. The primers were designed
according to 5’ and 3’ sequence of LpCBF 3 gene and the primers are: Forward-primer
be3-4F: ACTGAGGTAGCGCTAGCTCCTAT'I’, Reverse-primer be3-4R:

CACAATCACATTACCAGAAACTGC at Tm=60°C.

115

DNA sequence alignments and annotation

DNA was sequenced by Michigan State University Genetics Facility. Alignments were
made by Multalin (http://prodes.toulouse.inra.fr/multalin/multalin.html). Other sequences
used in this study were obtained from GenBank. Gene-prediction program used to
annotate was GENSCAN 1.0 (http://genes.mit.edu/GENSCAN.html). Predicted
polypeptide sequences were defined by results of BLASTp searches against National
Center for Biotechnology Information nonredundant database

(http://www.ncbi.nlm.nih.gov/blastl).

Real-time PCR conditions and analysis

Polymerase chain reactions were performed with the Mx4000 Multiplex Quantitative
PCR System (Stratagene Inc, La Jolla, Ca.), using SYBR® Green to monitor dsDNA
synthesis. Reactions contained 5 ul 2x SYBR® Green Master Mix reagent (Applied
Biosystems), 2.5 ng cDNA and 200 nM of each gene-specific primer in a final volume of
25 al. The following standard thermal profile was used for all PCRs: 50°C for 2 min;
95°C for 10 min; 40 cycles of 95°C for 15 sec and 65°C for 1 min. The quantity of actin
gene expression was measured as a normalization control. Optics graphs showing the
fluorescence intensity of each reaction plotted against PCR cycles were generated for
each run. Melt curves and first derivative melt curves were run immediately after the last
PCR cycle. Melt curves were produced by plotting the fluorescence intensity against
temperature as the temperature was increased from 65 to 95°C at 0.2°C/s. Data was
collected and viewed using the software and graphics programs provided with the

Mx4000 Multiplex Quantitative PCR System. For confirmation of amplicon presence and

116

purity, the RT-PCR product was run on a 2% agrose gel, stained with ethidium bromide,

and photographed.

PCR Reaction and Electrophoresis

PCR reactions were performed in 25-uL volumes containing 10 mM Tris-HCl (pH 8.3),
50 mM KCl, 1.5 uM MgC12, 11200 M of each deoxynucleotide, 50 ng of each primer
(totally 6 primers), about 50 ng template DNA, and 1 U Taq DNA polymerase. The
amplification was performed in an Thermcycler using the following program: 94°C for 2
min followed by 40 cycles at 94°C for 1 min, 60°C for 1 min and 72°C for l min and 50 s,
with a final extension at 72°C for 5 min. PCR products were separated on 1.4% (w/v)

agarose gels and visualized under UV light after ethidium bromide staining.

Vector Construction and Arabidopsis Transformation

A 890-bp BamHI/HindIII fragment from a cDNA clone containing the whole coding
region of LpCBF 3 was inserted into the AscI and BamHI sites of the binary
transformation vector pFGC5941. The resulting plasmid, which contains the LpCBF 3
coding sequence under control of the CaMV 35S promoter, was transformed into
Agrobacterium tumefaciens strain GV3101 by electroporation. Arabidopsis plants
(Columbia) were transformed with the construct or the transformation vector pFGC5941
using the floral dip method (Clough and Bent, 1998). Transformed plants were selected
on the basis of bialaphos herbicide resistance. Homozygous T3 plants were used in all

experiments.

117

Freeze test for transgenic Arabidopsis

Under sterile conditions in Petri dishes, Columbia (wild type) and transgenic plants
were grown on Gamborg's B-S medium. The plants were tested for freezing tolerance by
first placing the plates at -2°C in the dark for 3 hours followed by ice nucleation with
sterile ice chips. The plates were incubated an additional 21 hours at -2°C, then the
temperature of the freezer was turned down to -6°C, and the plates were left at this
temperature for an additional 24 hours. The plates were taken from the freezer and placed
at 4°C in the dark for 18 hours, followed by 2 days at 25°C under cool-white fluorescent
lights (40-50 umol m'zs") with an l8-hour photoperiod. The plates were then scored for

freezing damage as either dead or alive. The freeze test was repeated three times.

Results

Screening perennial ryegrass accessions for freezing tolerance

The lethal temperature (LTso) of most ryegrass accessions spans a range of 9°C, from -
1°C to -9°C, except for P1598441accession. The P1598441 is the most freezing tolerance
accession with a corresponding LTso = -11°C. P1598441 was originally collected fiom
Switzerland at a 46.583(Latitude), 6.9333(Longitude) and 860m (Elevation). In the
greenhouse, P1598441 has a high-tiller number and dark green leaves. It shows a delay in

flowering afier vemalization compared to other perennial ryegrass accessions.

118

Isolation of the CBF conserved regions

The degenerated primers based on the Arabidopsis and rice CBF conserved nuclear
NLS and AP2 regions amplified a 240bp fi'agment from perennial ryegrass genomic
DNA of P1598441. The deduced amino acid sequence of the fragments consists of 77
amino acids with most significant similarity with rice RCBF3 responding to the NLS and

AP2 regions (blast score=58.2 bits, expect=6e-O8).

Isolation of and sequencing of perennial ryegrass LpCBF 3 gene

To obtain the full length perennial ryegrass cbf gene, 5’and 3’ Rapid Amplification
cDNA Ends (RACE) were used to amplify two flanking sequences. A set of primers was
designed according to 240bp fragment from perennial ryegrass genomic DNA for
amplifying the 5’ and 3’ flanking regions. A 180 bp fragment was produced by 5’ RACE
and an 800 bp fi'agment was produced by 3’ RACE. We deduced that the full length of
CBF homolog was close to 1000bp (including 5’ and 3’ untranslated regions, UTR). The
primers for the 5’ UTR region and 3’ polyA anchor sequence were designed for
amplifying the full length CBF homolog from cDNA. An approximate 1000bp fragment
was obtained and sequenced. Sequence data revealed that it consists of 974 bp. The
711bp ORF of the gene encodes a mass of 25.5-kD polypeptide consisting 237 amino
acids (aa); (pl 5.04), which was quite similar to rice CBF3 and barley CBF3. This gene
was designed as LpCBF 3 . Sequence comparison between LpCBF3 genes from cDNA
and genomic DNA indicated that there is no intron present in the perennial ryegrass
LpCBF3 gene. Genomic DNA was digested with EcoRV that cannot cut within the

LpCBF3 coding region, and was hybridized by the labeled LpCBF3 probe in low

119

stringency hybridization condition. The results revealed that three hybridization bands
were present, which showed LpCBF3 has at least three homologs in the perennial
ryegrass genome. Induced LpCBF 3 protein carries the sequences for the typical NLS,
AP2-DNA binding motifs and an acidic domain which are present in most plant CBF
proteins. A TMpred (http://www.ch.embnet.org) analysis predicted a helix domain
between 199 a.a. and 217 a.a. with significant high scores (775). Although the LpCBF 3
amino acid sequence shares conserved NLS, AP2 domains with other species CBF
protein family, there is little similarity in the regions corresponding to the activation
domain and other regions (Fig.5.1) (Image in this dissertation is presented in color). A
glycine to glutamine substitution at amino acid residue 190 was found in the cold-tolerant
accession. The amino acid sequence of the LpCBF3 was compared with that of several
CBF3-related proteins to understand the evolutionary relationship of the plant CBF
homologs. A phylogenetic analysis revealed that these CBF3-related proteins were
clustered into two distinct groups based on sequence similarity. The first group consists
of monocot plants with two most closely related sequences between rice and perennial

ryegrass, whereas, the second group consisted of dicot plants (Fig.5.2).

Analysis of LpCBF 3 and COR gene expression

The expression pattern of the LpCBF 3 was determined by Northern blotting by using
the full-length LpCBF3 gene as the probe. Total RNA was isolated separately from leaves
and stems of the cold-tolerant and sensitive perennial ryegrass accessions after exposure
to different cold treatment (4 °C) time. The results showed that the expression of LpCBF3

is up-regulated for the first 4 hours of cold treatment. At 24 hours, gene expression was

120

below detection in whole plant (Fig.5.5). Due to the presence of at least three potential
homologs of LpCBF3 gene in the perennial ryegrass genome, the cross-hybridization
homologs may lead to obscure specific LpCBF3 expression by using Northern analysis.
Real time PCR was applied for specifically monitoring the LpCBF3 expression in the
most cold-tolerant perennial ryegrass accession. The results showed that the LpCBF 3
gene is up-regulated by cold treatment (Fig.5.6). LpCBF 3 transcripts began to increase
after 15 minutes of cold treatment and reached a maximum level at 1.5 hours. Later,
LpCBF3 transcripts declined until they were below detection after 24 hours. These results
are consistent to the CBF gene expression pattern in other plants (Tar'an et al., 2005).

To determine expression patterns of COR genes which represent a cbf downstream gene
family, a COR gene (COR39 from wheat) was used as the probe. The highest expression
level of the COR homologous gene was detected after 24 hours in the leaves and stems of
perennial ryegrass accessions. But in the most cold-tolerant perennial ryegrass accessions,
the COR gene was expressed well without cold treatment and the expression level in the
stem was much stronger than the expression in the cold-sensitive perennial ryegrass at all
time points tested (F ig.5.7). Cold treatment can prompt expression level of the COR

homologous gene in both perennial ryegrass accessions.

Analysis of putative promoter of LpCBF 3

The LpCBF 3 was further defined by using a primer extension to position the
transcription start site with cDNA as template and the putative promoter sequence by
using genomic DNA. After analysis of the two putative promoter regions from cold-

tolerant and sensitive perennial ryegrass accessions, a conserved motif LTR that can

121

sense the upstream cold signal in barley was found in both accessions. The putative
promoter region of cold-tolerant perennial ryegrass accession has three potential
conserved boxes, boxIV, boxV and boxVI, which play a critical role in Arabidopsis CBF
gene expression (Fig.5.3 and F ig.5.4) (Image in this dissertation is presented in color). In
Arabidopsis, these three boxes are located in a 155-bp upstream region of CBF2 gene
(Zarka etal., 2003). However, in the cold-sensitive ryegrass accession, only two boxes
(Box V and Bole) were found and BoxIV was missing. The BoxIV contains the MYB

motif responsible for cold signal reception.

Tolerance of overexpressed LpCBF 3 transgeneic Arabidopsis plants to the freeze test

To determine the function of the LpCBF3 gene, six transgenic Arabidopsis plants
having LpCBF3 gene fused to a cauliflower mosaic virus 35S (CaMV35S) promoter were
generated. Three transgenic plants with constitutive expression of LpCBF 3 were found by
real time PCR using LpCBF3-specifical primers (Fig5.8). Growth characteristics of the
35 S:LpCBF3 transgenic Arabidopsis were compared with wild type plants. After the
same number of days of vegetative growth at normal temperature (25°C), the transgenic
plants showed a "dwarf” phenotype. The size of the leaves and overall dimensions of
transgenic plants were considerably less than those of the control plants. Also, there was a
substantial difference in time to flowering between the wild type and LpCBF3-expressing
plants. After nine-week growth, wild type plants bolted and formed flowers well ahead of
the transgenic plants period (Fig 5.9) (Image in this dissertation is presented in color).
The overexpression of CBF] and CBF3 of Arabidopsis has been reported to increase the

freezing tolerance of non-acclimated plants (Gilmour et al., 2000; Liu et al., 1998).

122

Similarly, most the non-acclimated wild type Arabidopsis plants were killed by freezing
at -6°C after 24 hours. After the freeze test, 5% of the wild type plants survived. However,
the transgenic plants showed a high freeze tolerance with 95% plants surviving (Fig 5.10)
(Image in this dissertation is presented in color). These results indicated that the over-

expressed LpCBF3 transgenic plants had tolerance to freezing.

Discussion

To improve the winter hardiness of perennial ryegrass or other warm season turfgrass
species, a perennial ryegrass CBF homolog from a most cold-tolerant perennial ryegrass
accession (P1598441) was isolated, sequenced, characterized and overexpressed in
Arabidopsis (Bughrara etal., 2005). Recently, another LpCBF3 gene from perennial
ryegrass cultivar Caddyshack was isolated (Xiong and Fei, 2006). The 2 genes share
more than 74% identities at the amino acid levels. Considerable differences can be

observed in the non-AP2 regions.

In this study, we found that the deduced amino acid sequence of LpCBF3 shared high
similarities to the other plant species CBF families. In Arabidopsis, CBF3 polypeptides
contain a 66-amino acid motif, an AP2 domain, which is evolutionarily conserved in
plants (Xue, 2003) and has been described as a DNA-binding domain. The CBF3 gene
has potential nuclear localization sequences in its N-terminal regions, and a putative

acidic activation domain that is less conserved. Differences in N- and C-terminal acidic

123

regions among plant CBF gene families may contribute to the CBF gene species
specificity. Perennial ryegrass LpCBF3 has a LWSY motif at the end of C-terminal
region which was observed in several CBF3-related proteins. In addition, the potential

protein kinase phosphorylation sites, Arg-rich and Ser-rich sites were found in LpCBF3.

The LpCBF3 allele fiom cold-sensitive perennial ryegrass accession was isolated,
sequenced and compared with LpCBF3 of cold-tolerant plant. Surprisingly, only one
amino acid difference in the putative acidic activation domain was detected. A glycine to
glutamine substitution at amino acid residue 190 was found in the cold-tolerant accession.
Without further association between genotypic and phenotypic variations in segregation
population derived from cold-resistant & sensitive perennial ryegrass accessions, no
definitive conclusions can be made that these variations of LpCBF 3 alleles result in the
expression changes of their downstream genes, which in turn affect freeze tolerance. The
eco-TILLING (Targeting Induced Local Lesions In Genomes)(Comai et al., 2004)
provides a method for further studying allelic variation of LpCBF 3 gene from of different

perennial ryegrass accessions that exhibit different lethal temperatures.

The variations in promoters may suggest the possibility that genes might differ slightly
in their expression patterns and levels, which can further be amplified and lead to
phenotypic changes by a cascade of transcriptional regulation events. A 500bp putative
promoter region of LpCBF3 was isolated. Some cold response-related motifs were found
in this promoter region. At -160bp, a cis-acting element involved in low-temperature

responsiveness (LTR) is sharing 100% similarities with barley promoter. There are three

124

key conserved motifs in Arabidopsis CBF 3 gene promoter which is extended about
150bp. These motifs also were found in LpCBF3 gene promoter. After comparing
tolerant and sensitive perennial ryegrass accessions, we found considerable differences in
their putative promoter regions, including three key motifs mentioned above. From the
evolution perspective, adjusting gene expression levels or patterns by tuning cis- and
trans-elements interactions is the most efficient and accurate method to affect gene
function in different ecosystems. Studying the expression diversity of promoters may
provide more information on evolution than gene coding sequence in some cases. Wang
and his colleagues (1999) provide an excellent example of alterations in the regulation of

th promoter brought about the change from teosinte to maize plant architecture.

Expression analyses revealed that LpCBF3 is positively regulated by cold treatment.
The accumulation of LpCBF3 transcripts increases drastically after cold treatment, and
reaches the highest level after a couple of hours of low temperature (4°C) exposure,
followed by decreases to below detection after 24 hours. This indicates that the
responsiveness of LpCBF3 to low temperature is an early event that is consistent with the
temporal induction of other plant CBF genes. The Northern analysis shows the
expression of CBF-induced perennial ryegrass COR homologous gene(s) continues to
increase during the 24-hour cold treatment. At 24-hour after cold treatment, the highest
expression was detected in the leaves and stems from both tolerant & sensitive perennial
ryegrass accessions. The COR gene from stem of cold-tolerant perennial ryegrass’ stern
can strongly express even without cold induction (O-hour), although it still increases its

expression level during cold treatment period. COR gene has a role in freezing tolerance

125

which encodes a polypeptide target to chloroplasts (Artus et al., 1996). The expression
level and pattern of COR gene in the stem of cold-tolerant perennial ryegrass accession
may contribute to its cold tolerance resulting from the COR encoded protein stabilizing
membranes against injury. A slight expression level of LpCBF 3, which cannot be
detected by Northern blotting, was detected by RT-PCR even without cold treatment and
mechanical agitation. We deduce that the COR gene of cold-tolerant perennial ryegrass
can be activated by CBF at a very low concentration level and this scenario would not
happen in cold-sensitive material. Other factor(s) besides CBF can regulate the COR
homolog expression (Chinnusamy et al., 2003). The discovery of a link between COR
gene expression and CBF is of potential agronomic importance for improvement of cold

tolerance ( Mastrangelo et al., 2000).

Determining the molecular mechanisms that plants have evolved to survive freezing
would not only increase our fundamental knowledge of how plants adapt to changes in the
environment, but would also contribute to the development of new strategies to improve
the tolerance of crop species to adverse cold. A large number of genes are involved in
cold-response physiology process, but only a few of them, as transcriptional factors, can
produce a global effects on cold tolerance. To compare the function of perennial ryegrass
LpCBF 3 with that of Arabidopsis CBF 3 gene, transgenic plants were generated in which
the LpCBF 3 cDNA was over-expressed under the control of the CaMV 35S promoter.
Constitutive expression of LpCBF 3 gene in transgenic Arabidopsis may result in multiple
biochemical changes associated with cold acclimation. In addition to an increase of cold

tolerance, the transgenic plant displayed some ‘side-effects’ such as a dwarf, delay

126

flowering, and stunting. However, these phenotypes are desired in turfgrass breeding
program, which will directly lead to improved turfgrass with low maintenance

requirements and cold-tolerant characteristics.

127

22330330000”2.000.000.0005«unimaiz «3:028
Im3Simcowauugzczccmmmm0.0—350035.05 0.3.0:
53.00.:0.0.::ua:m=$>§fl.—:E&azjfifmztwu auto:
05:firemncauealfrzcm00mFEMSEmcil. 82
833E.omgwgawlécccpficz 535mmil «3.503—

. n u . n n
u _

0.0008 0.00 000 000 000

 

i—W OWE"”$0".—.00*...t000000w4VMQOflOQUMOO....omm..0.m.waw.amm0wufl0COMM..tmofiohmvmwMbcwOQILm’flmldOOAQWOOQhCI—Aaxmaw$240....OWMNI—MOficl—zccafiImI gun-3
dragaEzcfimgsgwecu—35mfig:amp—.....mmmmmmmmcam—cwaccawmmamm.0a00:03.55.mamadfigtmncju:8&2illnmcamwscdcmazic fin:
SI:Eb:imzwmazugm052cm;mmpuhmucmamumwmmammcummcmgfimg:cum;a0ac0cupccmgafiaémlmbcjzcmac 0zdlpcmuogfizcézcac vodka
Saw:5.531111!m0c.32:338:5:mmmngxfimmtmmwmpcmégcdmEEHiEEcEE:A—gumufie 50:02.0 Edamgucfifzccazzé 8.5—
33008.55 m.0.0—m8Sammgmmmimwmhmcmammcfiuwézz.0w“.maumwgczgmamgmrcm»cjmcmac 0:5.lmfix-Sc E. SE: .00 an;

8m Sm 30 SN emu 3a 8m 8" 8H 0: 8n emu 03 an"

 

 

 

 

 

 

 

 

0. 0: .5200.0e.,.00000 0.: .0002.500.0000000300:000 00.00. 2.00:... z a: e... .. Z . a 320.88
000050030 :00 0000000000000000000300000.0000 00 . 0_ 000 00.000000m0500:0.00.maammmwmmfispwmmeigdsi 83.
00:30:30 00.000.00.000.000:0.00:00:00,000:0:0 .00000080.00050000000wmammma00=§000000§0§§§§dd§ 000.00
00.005005: 000000000000 00002.00. 000.00.005.000._E.00000:§:§000000wl§wm=g§ 80.
0000500000325:3. _ ......0e:000_00000Etgafigdwflamtsmfiagaz «a;
03 000 03 03 8 8 00 8 0m 3. 8 00 3 a

.028 e0 020820 00 8000800 000 0: ewes: $0002.03 0002 $808.03 .0200 0000002500 80: .5000 0.020%:
.9SEE00:50.0:00:050.:005.00.538.0002 \0 0:: 503—32 3 08080 003 0590 05,—. Nag. 20 08020:_ 0:: Eon 00: 0:0
wAZ 20 080o_0:_ 0:: Eon 00.05 .0803: D820 080205 :28 0:3 20 400052 080205 502 :28 02 BE. .0000 8:2 Bwfim :0

0o:m_mo0 20 0060 05:5. 06305050 0:0 000:: $2000 dot 000:9»: 50¢ 8:268 060 03:00 mmmU .«o :8t0mEoU ._.m PSmE

128

Figure 5.2 Comparison of amino acid sequences of the CBF gene family by using
CLUSTALW. Scale indicates branch lengths.

RYE (AAL35760)

 

WHEAT (AAL37944)

FESTUCA (AY423713)

LPCB F- RYEGRASS
R 1C E (AAN02486)

BARLEY (AAGS9618)
MAIZE (AAN76804)

ARABIDOPSIS (AAD15977)
BRASSICA (AAL38243)

 

130
V

 

 

 

 

COTTON (AY321150)
TOMATO (AAS77sl9)

P EPPE R (AAQ33400)
...—.1 O PAM

129

 

...0.0.9.9....0000006......OOOOOOOOOOOOOO0.9.0.9000.........OOOOIOIOCO0.0.0.0........OOOOQOOOOOOOOOOOOQOOOOO.

 

 

 

BSEEEES—Efisficfiasa5000:0000...—00885000.:8.0050000088000005.85000008820005:3.000
.
000 00.. 08 0.5 mi 000 03 00.. 00v 0:. 000 :00

00050

0 E0
00 0 0000:

Sxom
03:08:885088880eafitficauBamfiafiatuéufiifigmfigagaeBuafitsauuasaéufisfis—B55:0
_ _
000 000 0B 80 000 ...00 0B 000 08 ...00 ~00 000 000 30
0800GBBE0008£8§0008£B0003£88205“:E50000058880:00850050500505.5550»:58508585000008.000—
_ . . .

000 000 000 ..000 000 000 000 000 ms 0: m0: 0,...“ m3 5
>025 immu—

>onm

£8850
00005508000

cEwucgifigcauu—BESun—5.5.8805ESEQEESEBGEFMBSS—5388393555 CaMEEEEQ—wsfifimzuwnfifipzeHUGH—u:
. 4 4 _
and 83 3.4 R: an 8 mi. 8 an 8 mm cm a —

 

00:0 w:_0:5 3% mg 80 ~59 0:0 EmUH 0:00.502: 28 $0.00 :ommmoaxo Gnu 0000005050 :8

0.:on 00000 80 _>xom 0:0 >xom .>onm 003005050 00 005 505 0200550 8:00:08 :80an 3% 0.0%qu 300:5 m6 8&5

0:88:09
9.25
5:.—

>06:
3.8m
8,-0.8...—

388:3
9.8:
E:—

>28
3.8:
.8889:—

888:5
gsom
E..—

9x05
338
88:0,;

389.55
2025
SE

.08:
3.8m
530.8,...

130

 

cum-0:1...
32mg...
gaggg—Echa—Bufiuugu—cugu

E0000 .8 .8 .3 800m

$350.5855535203598:ch:...Emmfigu:Epazzamtsuusg:“0358355529035. . . .9853“:uuuc.§au5uw¢ccéu=§83
£305: 55:: m Eacaxfiznag w _ 0:335:50. £5: :5 F: _ 5:: EH: HE 50.350.58.00 Has-.050 HES-llamas“. _ 50:92.25— 5200000520335
SumcfifibEEEEEEEBBSEEEEEES. EPS— EcEECu _ 5:50-50:QEEEEEEmgugucgcééfiffigéumfis

 

..00 an 8.: 09 .0 0: 09 00 08 000 .8. 3 be 8m

: .5”: .830: 003.350”: 5h: _ _ 53.: we”: 8520.01.52 30505235: uH_-ue5..§§.a 533:: _ ...-33:3. ”Eu—330.33.:3833—035
Zuzutiueéxc.BEEBCBPE:50.05..HE“:gum:::8p»5c0u!:§= 3305555585 5593 — CgHWSBHEESSE: 80...: 8.555555
: u:u~.—EE¢E§Q¢§EEEC— :55: 033353055: “5580:9000: EuEnBEuwfii—Euuuf 2505552.“: :mm.u¥uu:.!u:pufimE—¢u.:¢u

can as 2n .8 SH an 8n awn can g as an chm «on
BBB-3.: 53035:: 2130:250330532353: 3:35.033» 3.0953350:in E _§c.5:33:2352375335.:90033 :2:

”0:535”: 535—5500332— _u€.S:u,-:Eu::z: E 5.: 0:20.00:— E:5558§::EE05.555033: _zBSEE—uu.55:00:533:
EBREE::ufiuficquéfiuE EEEEBSEEEEE335555:— HE—0.05:5:E:a:§:¢§§u¢5§5~:xgbgpuEC—uc—EE03555

 

4 a a t n

08 08 8.0 8w gnu on 80 8— 03 05 03 on: 3: «3
00.3000050030000000500.003105500000100:30100050333._tisgfiagi:.00000_=:0_3_80£§§00_S_5030::0
000.003.00.000:.00...0.08520230000-30000002003000000331:0.,.z._3,..,._0-05z_00.:0000000;.3:83:00500500000:00:03:
10000000000:05050008:0$_.ES0:00000000000:000:0:0%000000£E0000:0:0500EEE008EE0:08::0000:0:000:&t00:005$

m: 00: 0:: 8: 8 8 00 8 00 s s 00 s :

"’11 ”ll ”ll ”11 “El

.A:0_00 E 02:80:: 0: 5000:0000 02: E 090:5 0000200: 0:80.00 03020::
:28 0:3 20 00000200: .8052 08020:: :88— :200 00: 0::- .:o:0::0:: 80:28-28 0:008 5080:: 0:0 80080:: 320:8

-200 0:00:: w 0:23.800 008%.»: 32050-200 0:0 50:28-28 :50 :05 503000 80:09:00 00:00:00: 800805 Tm 0::wE

131

Figure5.5. Expression of CBF gene(s) in perennial ryegrass by northern blotting. Plant
materials were 2 months old grown in a 16-h photoperiod at 25°C. The total RNAS were
isolated from stems and leaves at different times (0, 1, 4, 24 hr) of cold treatment (4°C).

The bottom is total RNA stained with ethidium bromide.

 

 

 

P1610939 l” i F- ‘J 84 4 1 P1610939 P1508441
01424 01424 0142401424
Stems I Leaves
‘.
i
Q

 

 

132

 

 

 

~5.~.ab..o.=N-u..o 2.5» W. 9.30.:
3500
5.3 £5 o

.1589 05 mm 8: 228298 :8: 38on 3:88:

2C. .622 E258: 28 a: 8:2: 2:22.26 mo 2:2: 20:? EB.“ 8:202 225 398 :38 of. .Uomm 8 “65:30:: 2-2 :23
mus/8w 20 22:56 N 8: 932325 255 .2922: Mam-HM 3 mmfiwob 22:88: :_ MKMDR-Co E28: :28»:qu o.m2=mE

 

133

Figure5.7. Expression of COR39 orthologue gene in perennial ryegrass. Plant materials
were 2-month old growing with 16—h photoperiod at 25°C. The total RNAS were isolated
from stems and leaves at different times (0, l, 4, 24 hr) of cold treatment (4°C). The
bottom is total RNA stained with ethidium bromide.

P1610939 P15913441 P1610939 P1598441

 

01 43.401434014240142“

 

Stems Leaves

 

134

Figure5.8 Overexpressing LpCBF3 gene in Arabidopsis detected by RT-PCR with
specific primers. WT is Columbia, Al—A6 are T3 transgenic Arabidopsis. Only transgenic

Arabidopsis, Al , A3 and A4, can constitutively express LpCBF 3.

Ladder Plasmid WT A6 A5 A4 A3 A2 A1

 

-~. .. ‘-‘f-\"o'z&~’¢‘x stlgk'.'-'u .‘cu—iq..us-’.‘ _ , ‘ _ ‘ ' v ‘ ('3’ .. , . - v .. .fi.u rs
_> .~H.-- . .‘ V. , . . ...», - ~.

A. . ‘
: Nanny-two p~t¥harfikmfi¢hhd

 

 

 

J
a
2.
i
1
l
t

135

Figure5.9 Growth characteristics of LpCBF3-expressing transgenic Arabidopsis Al-3 (T3)
with wild type (Columbia).

Wl' (Columbia) A1-3(T3)

       

One week
(Growth chamber)

Four weeks

(Greenhouse)

Six weeks

Greenhouse)

Nine weeks

(Greenhouse)

136

 

.C28 2 08:08:: 2 808820 28 :_ own—5500- a: E vm 3 0032—8 : 0N :0.“ Dow. a: 8:02 88 0:: 8202:

28 8 008 a use: use 83 2% 8 .3020 2 053280-283 2: es 2.8 a :20 2 08880883 .220 2%
N. .8888 038300 2800502 68:8 .20 mw820oom .8828 $2892 «:2: :0 888888.»: mkmoquo “comm S 62sz

I37

References

Albrecht, V., S. Weinl, D. Blazevic, C. D'Angelo, O. Batistic, U. Kolukisaoglu, R. Bock,
B. Schulz, K. Harter, and J. Kudla. 2003. The calcium sensor CBLl integrates
plant responses to abiotic stresses. Plant Journal 36:457-70.

Artus, N.N., M. Uemura, P.L. Steponkus, S.J. Gilmour, C. Lin, and M.F. Thomashow.
1996. Constitutive expression of the cold-regulated Arabidopsis thaliana CORISa

gene affects both chloroplast and protoplast freezing tolerance. Proceedings of the
National Academy of Sciences of the United States of America 93: 13404-13409.

 

Asay, K.H. 1992. Breeding Potentials in Perennial Triticeae Grasses. Hereditas 1162167-
173.

Bughrara,S.S.,H, Zhao and Y.X. Wang. 2005. Isolation and characterization of LpCBF 3
from ryegrass. The US patent application number 10/883,512. PCT application
number PCT/US/2005/023516

Catala, R., E. Santos, J .M. Alonso, J .R. Ecker, J .M. Martinez—Zapater, and J. Salinas.
2003. Mutations in the Ca2+/H+ transporter CAXl increase CBF/DREBI
expression and the cold-acclimation response in Arabidopsis. Plant Cell 15:2940-
51.

Chinnusamy, V., M. Ohta, S. Kanrar, B.H. Lee, X.H. Hong, M. Agarwal, and J .K. Zhu.
2003. ICE 1: a regulator of cold-induced transcriptome and freezing tolerance in
Arabidopsis. Genes & Development 17: 1043-1054.

Choi, D.W., E.M. Rodriguez, and T.J. Close. 2002. Barley be3 gene identification,
expression pattern, and map location. Plant Physiology 129:1781-7.

Clough, S.J., and A.F. Bent. 1998. Floral dip: a simplified method for Agrobacterium-
mediated transformation of Arabidopsis thaliana. Plant Journal 16:735-743.

Comai, L., K. Young, B.J. Till, SH. Reynolds, E.A. Greene, C.A. Codomo, L.C. Enns,
J .E. Johnson, C. Burtner, A.R. Odden, and S. Henikoff. 2004. Efficient discovery
of DNA polymorphisms in natural populations by Ecotilling. Plant Journal
37 :778-86.

Cook, D., S. Fowler, 0. Fiehn, and M.F. Thomashow. 2004. A prominent role for the
CBF cold response pathway in configuring the low-temperature metabolome of
Arabidopsis. Proceedings of the National Academy of Sciences of the United
States of America 101:15243-8.

138

Fowler, 8., and M.F. Thomashow. 2002. Arabidopsis transcriptome profiling indicates
that multiple regulatory pathways are activated during cold acclimation in
addition to the CBF cold response pathway. Plant Cell 14: 1675-90.

Gilmour, S.J., A.M. Sebolt, M.P. Salazar, J .D. Everard, and M.F. Thomashow. 2000.
Overexpression of the Arabidopsis CBF3 transcriptional activator mimics

multiple biochemical changes associated with cold acclimation. Plant Physiology
124: 1854- 1 865.

Guo, W.W., R.W. Ward, and M.F. Thomashow. 1992. Characterization of a Cold-
Regulated Wheat Gene Related to Arabidopsis Cor47. Plant Physiology 100:915-
922.

Humphreys, M.O., and C.F. Eagles. 1988. Assessment of Perennial Ryegrass (Lolium-
Perenne L) for Breeding .1. Freezing Tolerance. Euphytica 38:75-84.

Knight, H., D.G. Zarka, H. Okamoto, M.F. Thomashow, and MR. Knight. 2004.
Abscisic acid induces CBF gene transcription and subsequent induction of cold-
regulated genes via the CRT promoter element. Plant Physiology 135: 1710-7.

Kobayashi, F., S. Takumi, S. Kume, M. Ishibashi, R. Ohno, K. Murai, and C. Nakamura.
2005. Regulation by Vm-l/Fr-l chromosomal intervals of CBF-mediated Cor/Lea
gene expression and freezing tolerance in common wheat. Journal of
Experimental Botany 562887-95.

Kosmala, A., Z. Zwierzykowski, D. Gasior, M. Rapacz, E. Zwierzykowska, and M.W.
Humphreys. 2006. GISH/FISH mapping of genes for freezing tolerance
transferred from Festuca pratensis to Lolium multiflorum. Heredity 96:243-251.

Larsen, A. 1994. Breeding Winter Hardy Grasses. Euphytica 77:231-237.

Liu, Q., M. Kasuga, Y. Sakuma, H. Abe, S. Miura, K Yamaguchi-Shinozaki, and K.
Shinozaki. 1998. Two transcription factors, DREBl and DREB2, with an
EREBP/AP2 DNA binding domain separate two cellular signal transduction
pathways in drought- and low-temperature-responsive gene expression,
respectively, in Arabidopsis. Plant Cell 10: 1391-1406.

Mastrangelo, A.M., P. Baldi, C. Mare, V.V. Terzi, G. Galiba, L. Cattivelli, and N. Di
Fonzo. 2000. The cold dependent accumulation of COR TMC-AP3 in cereals
with contrasting, frost tolerance is regulated by different mRNA expression and
protein turnover. Plant Science 156:47-54.

139

Medina, J ., M. Bargues, J. Terol, M. Perez-Alonso, and J. Salinas. 1999. The Arabidopsis
CBF gene family is composed of three genes encoding AP2 domain-containing
proteins whose expression is regulated by low temperature but not by abscisic
acid or dehydration. Plant Physiology 119:463-70.

Miller, A.K., G. Galiba, and J. Dubcovsky. 2006. A cluster of 11 CBF transcription
factors is located at the frost tolerance locus Fr-A(m)2 in Triticum monococcum.
Molecular Genetics and Genomics 275: 193-203.

Novillo, F ., J .M. Alonso, J .R. Ecker, and J. Salinas. 2004. CBF2/DREBIC is a negative
regulator of CBFl/DREB 1B and CBF3/DREB1A expression and plays a central
role in stress tolerance in Arabidopsis. Proceedings of the National Academy of
Sciences of the United States of America 101:3985-90.

Skinner, J ., P. Szucs, J. von Zitzewitz, L. Marquez-Cedillo, T. Filichkin, E.J. Stockinger,
M.F. Thomashow, T.H.H. Chen, and RM. Hayes. 2006. Mapping of barley
homologs to genes that regulate low temperature tolerance in Arabidopsis.
Theoretical and Applied Genetics 112:832-842.

Skot, L., N.R. Sackville Hamilton, S. Mizen, K.H. Chorlton, and ID. Thomas. 2002.
Molecular genecology of temperature response in Lolium perenne: 2. association
of AFLP markers with ecogeography. Molecular Ecology 11:1865-76.

Takumi, S., A. Koike, M. Nakata, S. Kume, R. Ohno, and C. Nakamura. 2003. Cold-
specific and light—stimulated expression of a wheat (Triticum aestivum L.) Cor

gene Wcor15 encoding a chloroplast-targeted protein. Journal of Experimental
Botany 54:2265-74.

Thomashow, M.F., S.J. Gilmour, E.J. Stockinger, K.R. Jaglo-Ottosen, and D.G. Zarka.
2001. Role of the Arabidopsis CBF transcriptional activators in cold acclimation.
Physiologia Plantarum 1 12:171-175.

Wade, L.J., G.L. Hammer, and MA. Davey. 1993. Response of Germination to
Temperature Amongst Diverse Sorghum Hybrids. Field Crops Research 31 :295-
308.

Wang, R.L., A. Stec, J. Hey, L. Lukens, and J. Doebley. 1999. The limits of selection
during maize domestication. Nature 398:236-239.

Warnock, D.L., R. H. Leep, S. S. Bughrara. 2005. Cold Tolerance Evaluation of
Improved Diploid and Tetraploid Cultivars of Perennial Ryegrass. Crop
Management 21 February 2005.

140

 

Xiong, L.M., H. Lee, M. Ishitani, Y. Tanaka, B. Stevenson, H. Koiwa, R.A. Bressan, PM.
Hasegawa, and J .K. Zhu. 2002. Repression of stress-responsive genes by FIERYZ,
a novel transcriptional regulator in Arabidopsis. Proceedings of the National
Academy of Sciences of the United States of America 99: 10899-10904.

Xiong Y.W. and S. Z. Fei. 2006. Emotional and phylogenetic analysis of a DREB/CBF-
like gene in perennial ryegrass (Lolium perenne L.). Planta 224:878-888.

Xue, GP. 2003. The DNA-binding activity of an AP2 transcriptional activator HvCBF2
involved in regulation of low-temperature responsive genes in barley is modulated
by temperature. Plant Journal 33:373-83.

Zarka, D.G., J .T. Vogel, D. Cook, and M.F. Thomashow. 2003. Cold induction of
Arabidopsis CBF genes involves multiple ICE (inducer of CBF expression)
promoter elements and a cold-regulatory circuit that is desensitized by low
temperature. Plant Physiology 13 3:910-8.

Zhang, Y., M.A.R. Mian, and J .H. Bouton. 2006. Recent molecular and genomic studies
on stress tolerance of forage and turf grasses. Crop Science 46:497-511.

141

APPENDIX A. GENETIC RELATIONSHIPS AMONG SNOW MOLD RESISTANT
CLONES OF CREEPING BENTGRASS

142

Abstract

Creeping bentgrass (Agrostis stolonifera) is the most important turfgrass species for
golf courses in temperate climate regions with prevalent gray snow mold disease in
winter. The aim of this study was undertaken to evaluate the genetic diversity among 18
snow mold resistant clones and 4 creeping bentgrass commercial cultivars. Meanwhile,
the phylogenetic relatedness of creeping bentgrass and other three bentgrass species,
colonial bentgrass (A. capillaris), dryland bentgrass (A. castellana), and velvet bentgrass
(A. canina) was elucidated. A total of 199 polymorphic AFLP markers were amplified
from six selected primer combinations. Both principal component analysis (PCA) and
unweighted pair group method with arithmetic mean (UPGMA) dendrogram
distinguished three groups, which are consistent with genome compositions of these
bentgrass species. Cluster analysis of genetic similarity estimates revealed a high level of
diversity among bentgrass species ranged fiom 0.43 to 0.90 with an average of 0.55. In
18 disease-resistant creeping bentgrass clones, genetic similarities ranged from 0.55 to
0.90 with an average of 0.61. The mean of genetic similarity among the four creeping

bentgrass commercial cultivars is 0.67.

Key words: Creeping bentgrass, Bentgrass species, Snow mold resistance, Diversity,

AFLP

143

Introduction

Bentgrass species (Agrostis spp.), native to Western Europe, are cool season
turfgrasses. Distribution of the species spans shade to open habitats, low to high lands
and cool to extremely arctic areas (Harlan, 1992). The bentgrass species are primarily
deployed in putting green, golf courses, parks and forage. There are over 200 species of
bentgrass with five species predominately used commercially in the United States
(Hitchcock, 1951). These include creeping bentgrass (2n=4x=28, A2A2SS), colonial
bentgrass (2n=4x=28, AlAlAzAz), Dryland bentgrass (2n=4x=28, A1A1A2A2), velvet
bentgrass (2n=2x=l4, A1A1) and redtop bentgrass (2x=6x=42, A1A1A2A23S) (Jones,
1956a; Jones, 1956b; Jones, 1956c). Creeping bentgrass has high commercial value due
to its fine texture and adaptation to mowing heights as low as 3mm, and commonly used
in golf course, putting green, tees and fair ways. It has high commercial value. However,
all commercial creeping bentgrass cultivars are susceptible to gray snow mold, caused by
T yphula incarnata (Wu and Hsiang, 1998). Gray snow mold is prevalent in cold, humid
conditions, especially under snow cover. This disease is particularly important in
northern regions of the United States where it causes significant economical loss (Wang
et al., 2005). Fungicides are traditionally used to inhibit this pathogen on the golf courses.
However, fungicides are expensive, limited efficacy and adversely affect to the
environment. In addition, some fungi pathogens have developed resistance to fungicides
after years of repeated applications (Reicher and Throssell, 1997). The deployment of
disease resistant cultivars is economically and ecologically attractive. Exploring the
resistant resources in creeping bentgrass species is the first step to develop the desirable

and disease-resistant cultivars. To identify such resistant resources, we collected one

144

 

thousand of creeping bentgrass clones with potential gray snow mold resistance from old
Northern Michigan golf courses that have not been sprayed with fungicide or over-seeded
for the last 10 years. Because creeping bentgrass populations of old golf courses were
under a high degree selection of disease (Casler et al., 2003), some clones which may
contain the resistant genes derived from natural mutations would be proving to survive
and thrive. After two-year repeat artificial snow mold disease screening, eighteen gray
snow mold resistant clones were identified. Exploiting and utilizing resistance genes from
these clones could be practiced for resistance improvement in bentgrass cultivars, which
eliminates the extraordinary efforts of interspecific hybridization for utilizing resistance

from related species.

A comprehensive study to clarify the phylogenetic relationship, and reveal genetic
diversity among creeping bentgrass resistance clones would be desirable to facilitate the
use of resistance resources for improvement in this species by eliminating the duplication
of germplasm collection. Estimates of genetic diversity based on molecular markers have
proven a useful method for describing phylogenetic relationship and distinguishing
heterotic groups within plant species because of their abundant polymorphism and the
fact they are independent of environmental effect (Hall et al., 2002) (Bai et al., 2003)
(Kress et al., 2005). Two basic types of molecular markers are applied for evaluating the
extent of genetic diversity in plant. They are (1) hybridization-based, restriction fi'agment
length polymorphism (RFLP) (Dij khuizen et al., 1996), and (2) amplification-based,
microsatellite or simple sequence repeat (SSR) (Santacruz-Varela et al., 2004), random

amplified polymorphic DNA (RAPD) (Hollman et al., 2005), amplified fragment length

145

polymorphism (AFLP) (Miklas et al., 2001) (Spooner et al., 2005). AFLP combines the
advantages of RF LP and PCR to provide greatly enhanced performance in terms of
reproducibility, resolution, and polymorphism detection on the whole genome level.
AFLP technique permits analysis of a subset of restriction fragments from a complete
digest of genomic DNA, followed by amplification of a subset of the restriction

fragments using PCR with specific primers. It has been applied increasingly for genetic
diversity research, and is especially suitable for evaluating genetic diversity among
turfgrass species in which no prior DNA sequence information is available (V ergara et al.,

2004) (Mian et al., 2002).

The objectives of this study were to assess the genetic diversity within snow mold
resistant clones and four commercial creeping bentgrass cultivars, and to quantify the
genetic relatedness among creeping bentgrass and other three bentgrass species based on

AFLP marker profiling.

Materials and Methods

Plant materials
Eighteen gray snow mold resistant clones (designed to MSU#) of creeping bentgrass

were identified by disease evaluation from 1000 candidate clones collected from four
Michigan golf courses. These clones were grown in the greenhouse of Michigan State
University (East Lansing, Michigan). Four disease susceptible clones designed as S#
were included in this experiment. Creeping bentgrass PIs (P1204390 and P1221960),

colonial bentgrass PIs (P1234685 and P1171470), dryland bentgrass PIs (P1240131 and

146

P1240132) and velvet bentgrass (P1194697 and P1230233) were obtained from the USDA
Regional Plant Introduction Station (Pullman, Washington). Four cultivars ‘ASR368’,
‘PENN A4’, ‘PENN G2’, and ‘Providence’ were included in this study. ‘ASR368’ is a
transgenic glyphosate-resistant creeping bentgrass plant provided by Scotts Company
(Marysville, OH). The creeping bentgrass plants were resistant to glyphosate via the
expression of a gene cp4-epsps, which encodes a glyphosate-resistant form of EPSP from
the CP4 strain of Agrobacterium species. The procedure used for generating the

transgenic plants is described by Hartman et a1 (1994) and Lee (1996).

AFLP analysis

Total genomic DNA was extracted from fresh leaves of clones or 25 plants per PI
using the protocol of Sharp et al. (Sharp et al., 1989), and was quantified by DYNA
Quant 200 Fluorometer (Pharmacia Biotech, San Francisco, CA). Approximately 200 ng
of DNA was digested with EcoRI and MseI. The AF LP protocol applied in this research
was as described by Vos et al. (V 05 et al., 1995) with some modifications.
Preamplification was conducted on FTC-100 thermal cycler (MJ Research, Waltham,
MA) using 30 cycles of 94°C ,455, 54°C ,455, 72°C, 1min, followed by elongation at
72°C ,10min. The condition of selective amplification PCR was 1 cycle for 94°C, 30 sec;
65 °C, 30 sec; 72 °C, 1 min; followed by 11 cycles for 94 °C, 30sec; 65 °C, 30 sec; 72 °C,
1 min, with decreasing temperature of the second step by 0.7 °C for each cycle; 23 cycles
for 94 °C, 30 sec; 56 °C, 30 sec; 72 °C, 1 min, followed by 1 cycle for 72 °C, 15 min.
Adapters and pre-primers used include MseI adapter, M00 (universal primer), EcoRI

adapter, E00 (universal primer), as listed in Table 2. 2. Selective primers are E-ACA/M-

147

CAT, E-ACA/M-CAG, E-ACA/M-CGG, E-ACA/M-CGA, E-AGC/M-CAT, E-AGC/M-
CGG. The PCR products from the other EcoRI /MseI primer combinations were
separated on 5% denaturing polyacrylamide gels at a constant 2000V for 3h at 60°C and
were visualized with silver staining following the protocol of the Promega silver DNA

sequencing systemTM (Promega Inc., Madison, WI).

Data Analysis
Bands that showed clear polymorphisms were scored visually as present (‘1’) or absent

(‘0’). Bands of different electrophoretic mobilities were assumed to be non-allelic, while
bands of the same mobility were assumed to be allelic. Some ambiguous bands were
ignored. Genetic diversity analyses were conducted by using Numerical Taxonomy and
the Multivariate Analysis System, NTSYSpc v.2.2 (Rohlf 1993). Genetic similarities
based on Jaccard’s coefficients were computated among all possible pairs with the
SIMQUAL option and ordered in a similarity matrix. The similarity matrix was run by
Sequential, Agglomerative, Hierarchical, Nested clustering (SAHN) (Sneath and Sokal
1973) with Unweighted Pair Group Method with Arithmetic Mean (UPGMA) as an
option (Sokal and Michener 195 8). The dendrogram and cluster groupings were
constructed by the UPGMA clustering algorithm from the SAHN option of NTSYSpc
v2.2. Also, cluster analysis was based on similarity matrices using the UPGMA program
in the WIN BOOT sofiware package with a sample number of 100. Cophenetic
correlation was calculated to measure goodness of fit between the similarity and
cophenetic matrices. Principle coordinate analysis was run with the Common Principal

Components Analysis (CPCA) option (NTSYS) to identify the number of groups based

148

on eigenvectors. The principal coordinates' analysis result was displayed by the Mod3D
plot module. Correlation between the two matrices obtained with two marker sets was

estimated by means of the Mantel matrix correspondence test (Mantel 1967).

Results

Genetic relationship among the bentgrass species
The six AFLP primer combinations produced 199 polymorphism bands ranging in size

from 150 to 500bp. The 35 genotypes were clustered into three major groups on the basis
of the UPGMA dendrogram of similarity coefficients with the high cophenetic
correlation coefficient value (r=0.96) (Fig. A. 1). Principal coordinate analysis with the
same data set supports the above cluster analysis. These three groups closely
corresponded with the genome compositions of these species (A2A2SS, A1A1A2A2, and
AlAl). Group A had creeping bentgrass species with the genome composition, A2A288.
In this group, twenty-three creeping bentgrass genotypes, four cultivars and two PIs were
included. Group B consisted of two different bentgrass species, colonial bentgrass and
dryland bentgrass, which have the same genome compositions (A1A1A2A2). In this group,
two colonial bentgrass PIs were separated from two dryland bentgrass PIs, which leads to
form two subgroups. The group C included velvet bentgrass PIs with genome
composition (AlAl). From broader aspect, the group B and group C can be clustered
because they share a common genome of A- as shown in the Jone’s research (Jones,
1956a), However, groupA and groupC were well separated due to no common genome

shared each other.

149

Genetic relationship within the creeping bentgrass species
Group A consisted of the creeping bentgrass species. Genetic similarities coefficients

(Jaccard) for pair-wise comparisons ranged from 0.47 to 0.90 with a mean of 0.59. Group
A was separated to two subgroups. The first subgroup included the clones from old golf
courses and four commonly-used commercial cultivars. The genetic similarities of four
cultivars, ‘ASR368’, ‘PENN A4’, ‘PENN G2’, and ‘Providence’, ranged from 0.68
between ‘Providence’ and ‘PENN GZ’ to 0.66 between ‘ASR368’ and ‘Providence’ with
a mean of 0.67. ‘ASR368’ is separated from other three recent cultivars, ‘PENN A4’
(released in 1995), ‘PENN G2’ (released in 1995), and ‘Providence’ (released in 1987),
which grouped together. Four susceptible controls, S39, S13, S21 and S7 were randomly
distributed in this subgroup, No obvious genetic classification based on gray snow mold
resistance and susceptibility was established. The resistant clones shown a broader
diversity (average genetic similarities coefficient—0.61) comparing to the selected
cultivars in this study. The MSU#8 showed the greater diversity to commercial cultivars
comparing to other resistant clones. The grouping of these clones did not reflect their
geographic distribution of the golf courses. The second subgroup consisted of two PIs, PI

204390 from Turkey and P1221960 from Afghanistan.

Heterogeneous of the creeping bentgrass clone
Creeping bentgrass populations in old golf courses may contain considerable amounts

of genetic variation because of their perennial growth habits and stoloniferous growth. To
test the heterogeneous of single selected creeping bentgrass clone, one resistant clone,
MSU# 247, was divided into two copies designed as MSU#247A and MSU#247B. These

two copies were grown, isolated DNA, and conducted AFLP analysis, separately.

150

Thirteen different bands were detected between MSU#247A and MSU#247B
representing 10% of the total number of bands (132) amplified by the six AFLP primer

combinations.

Discussion

The bentgrass species has been described as one of the most difficult and complicated
of the grass genera from the taxonomic of view (Casler, 2002). The observations of
chromosome paring in pollen mother cell and genomic in situ hybridization (GISH) can
determine their genome composition (Chen et al., 1998). Jones (1956a, 1956b, 1956c)
conducted the cytogenetic research of some bentgrass species for elucidating their
genome compositions by meiotic chromosome pairing, and designed their genomes. Also,
in our previous study, seven bivalents, some univalents and multivalents were observed
in the interspecific hybrids between creeping and colonial bentgrass, which shown a
common genome shared between these two species. Determination of genome
composition by observing the chromosome pairing and GISH is based on the similarity of
chromosome composition. However, both methods are time-consuming and require
extensive work. The strong hybridization barriers that exist between two species prevent
the development of F1 plants. GISH can be carried out to provide genome composition
information. However, interference of homeologous chromosomes can produce the
ambiguous results. Diversity analysis of AFLP provides one of promising approaches to
elucidate genome composition relationship in the not well-studied and complex genus. In

this study, the three groups derived from AF LP markers were consistent with the genome

151

compositions, which offer the alternative method to determine genome relationship. The
species lack of genome composition information can be initially clustered into the certain
groups accompanying other species with known genome compositions. The cytogenetic

research can be applied to further confirm the cluster results.

The dryland and colonial bentgrass species share the same genome composition, and
can not be easily differentiate by traditional cytogenetic methods. By using AFLP, these
two species were clustered into the different groups. A better understanding of genome
relationship between these two species may facilitate the exploitation and incorporation

of the desirable characteristics in colonial and dryland bentgrass breeding.

Four commonly-used commercial cultivars were evaluated. The ‘ASR368’ shared least
genetic similarity with new released creeping bentgrass cultivars (‘PENN A4’, ‘PENN
G2’, and ‘Providence’). The newer cultivars were found having narrow genetic diversity,
because they have selected as being unique. The low level genetic variation in new
released cultivars may result in a bottleneck in future breeding work. The AFLP data
showed 18 resistant clones with broader genetic diversity than cultivars, and can severe
as a source to improve the cultivar resistance and genetic bases. However, all of the
clones were not immune to disease. Inter-pollination between these clones based on the
classification results may be deployed to develop higher resistance by pyramiding
different sources of resistance and optimizing the resistant gene combinations. Above
strategy is successfully applied in the wheat resistance breeding. Wheat scab resistant

cultivar, Sumai3, is derived from the two moderate resistance lines, Funo and Taiwan

152

wheat (Bai and Shaner, 1994). This is a successful example of integration of diverse
genetic sources to broaden genetic diversity, and enhance disease resistance. One of 18
resistant clones, MSU# 8, was found to be separated from other clones based on genetic
distance. It will be used as the parent to construct the mapping population aiming to
uncover the QTL linked to gray snow mold resistance in creeping bentgrass species. QTL
mapping of different source genes could further facilitate accurate classification of these
resistant genes, and improve the breeding efficiency to develop a resistant cultivar to

snow mold in near future.

153

+ ----------------------------------------------------------- MSU#8
. -------------------------------------------- ususls
6----MSUOZ4
'+----usus191
+----MSUOZS
+ .0
-ZS.? +----usu#249
+ --------- MSU#79
,o -------------- "$00336
+--S.0 i i
; ~ . ------------------- MSU#64S
; ............................. "509223
------------------- ASR368
+ -------------- $21
-28.0
+ --------- $13

4.
I
I
I I
I +-56.0
-------- 5.0 I +----HSU!247B
I
|
I

4.

I

I

I

I

I

I

I

I

I

I

I

I

I

I

I

I
N
m

I

I
I
I
V'I
+-——u—-uo-u——-

i
+-22.?
+

I
I
\I

+ ..-.

.0
+----MSU#247A
+----539
.0
+----flSUfl537
0----"SU'560
'+----usuI585
3----Paovroeucc

 

I
+-SS.0

I
H
N
.--m_._ _..-- _. O‘-----—- -- -.

 

+ .
-ll.? +----PennA4
+ --------- PennGZ
6----HSUIZO
.+----NSU#22
------------------------------------------------------ MSU#ZG
| +----S7
.0
¢----MSU#484
| 3----P1221960
'+----9120439o
+----P1230233
+ .0
: +----P1194697
-------------------------------------------------------- 45.? +----PI240132
l
+

-49.0

4.
I
p.-
b
O
+ --- -----—--O- - --‘~' '----—~ +

 

 

+-——n———-n————n————-—-—~———+

'+----prz40131
3----91171470
'+----91234685

Fig A. l The unweighted pair group method with the arithmetic mean dendrogram of 35
genotypes fiom 199 amplified fragment length polymorphism markers. Bootstrap values
obtained from 1000 replicate analyses.

154

 

References

Bai, G.H., and G. Shaner. 1994. Scab of Wheat - Prospects for Control. Plant Disease
78:760-766.

Bai, G.H., P.G. Guo, and FL. Kolb. 2003. Genetic relationships among head blight
resistant cultivars of wheat assessed on the basis of molecular markers. Crop
Science 43:498-507.

Casler, M.D., Y. Rangel, J .C. Stier, and G.W. Jung. 2003. RAPD marker diversity among
creeping bentgrass clones. Crop Science 43:688-693.

Casler, M.D.D., RR. 2002. Turfgrass biology, genetics, and breeding. John Wiley&sons,
Inc., Hoboken, New Jersey.

Chen, Q., R.L. Conner, F. Ahmad, A. Laroche, G. Fedak, and J.B. Thomas. 1998.
Molecular characterization of the genome composition of partial amphiploids
derived from T riticum aestivum x T hinopyrum ponticum and T -aestivwn x 771-
intermedium as sources of resistance to wheat streak mosaic virus and its vector,
Aceria tosichella. Theoretical and Applied Genetics 97: 1-8.

Dijkhuizen, A., W.C. Kennard, M.J. Havey, and J .E. Staub. 1996. RFLP variation and
genetic relationships in cultivated cucumber. Euphytica 90:79-87.

Hall, J .C., K.J. Sytsma, and H.H. Iltis. 2002. Phylogeny of Capparaceae and
Brassicaceae based on chloroplast sequence data. American Journal of Botany
89: 1826-1842.

Hartman, C.L., L. Lee, P.R. Day, and NE. Turner. 1994. Herbicide-Resistant Turfgrass
(Agrostis Palustris Huds) by Biolistic Transformation. Bio-Technology 12:919-
923.

Hitchcock. 1951. Manual of the grasses of United States. USDA Misc.Publ.200.U.s.Gov.
print. office, Washington, DC.

Hollman, A.B., J.C. Stier, M.D. Casler, G. Jung, and LA. Brilman. 2005. Identification
of putative velvet bentgrass clones using RAPD markers. Crop Science 45:923-
930.

Jones, K. 1956a. Species differentiation in A grostis I. Cytological relationships in
Agrostis canina L. J.Genetz370-376. ‘

155

Jones, K. 1956b. Species differentiation in A grostis II. The significance of chromosome
pairing in the tetraploid hybrids of A grostis canina subsp. Montana Hartm, A
capillaris Sibth. and A. stolonifera L. J .Genet. 54.

Jones, K. 1956c. Species differentiation in Agrostis 1H. Agrostis gigantea Roth. and its
hybrids with A. capillaris Sibth. and A. stolonifera. J.Genet. 54.

Kress, W.J., KJ. Wurdack, E.A. Zimmer, L.A. Weigt, and DH. Janzen. 2005. Use of
DNA barcodes to identify flowering plants. Proceedings of the National Academy
of Sciences of the United States of America 102:8369-8374.

Lee,L. 1996. Turfgrass biotechnology. Plant Science. 115:1-8

Mian, M.A.R., A.A. Hopkins, and J.C. Zwonitzer. 2002. Determination of genetic
diversity in tall fescue with AFLP markers. Crop Science 42:944-950.

Miklas, P.N., W.C. Johnson, R. Delorrne, and P. Gepts. 2001. QTL conditioning
physiological resistance and avoidance to white mold in dry bean. Crop Science
41:309-315.

Reicher, Z.J., and CS. Throssell. 1997. Effect of repeated fungicide applications on
creeping bentgrass turf. Crop Science 37:910-915.

Santacruz-Varela, A., M.P. Widrlechner, K.E. Ziegler, R.J. Salvador, M.J. Millard, and
PK. Bretting. 2004. Phylogenetic relationships among North American popcoms

and their evolutionary links to Mexican and South American popcoms. Crop
Science 44: 1456-1467.

Sharp, F.J., S. Chao, S. Desai, and MD. Gale. 1989. The Isolation, Characterization and
Application in the Triticeae of a Set of Wheat Rflp Probes Identifying Each
Homeologous Chromosome Ami. Theoretical and Applied Genetics 78:342-348.

Spooner, D.M., K. McLean, G. Ramsay, R. Waugh, and G.J. Bryan. 2005. A single
domestication for potato based on multilocus amplified fragment length
polymorphism genotyping. Proceedings of the National Academy of Sciences of
the United States of America 102214694-14699.

Vergara, G.V., S.S. Bughrara, and G. Jung. 2004. Genetic variability of grey snow mould
(Typhula incarnata). Mycological Research 108:1283-1290.

Vos, R, R. Hogers, M. Bleeker, M. Reijans, T. Vandelee, M. Homes, A. Frijters, J. Pot, J.

Peleman, M. Kuiper, and M. Zabeau. 1995. Aflp - a New Technique for DNA-
Fingerprinting. Nucleic Acids Research 23:4407-4414.

156

Wang, Z., M.D. Casler, J.C. Stier, J.S. Gregos, and SM. Millett. 2005. Genotypic
variation for snow mold reaction among creeping bentgrass clones. Crop Science
452399-406.

Wu, C., and T. Hsiang. 1998. Pathogenicity and formulation of T yphula phacorrhiza, a
biocontrol agent of gray snow mold. Plant Disease 82:1003-1006.

157

 

 

 

it"giii‘igiiiigiiii(in