. .3...
4.5.5....3 ,
39:53....

2,,
R53».

, out):
1....
a .9- i
_ . , .
m
,... it: . .
£59.:
a: .
mi .

”s

f. i 3.“ «.6»?

‘ .II I
:r . ? III a
JP ‘ 9,! n 1‘... 0*
sfzfiaws‘w m: . ...
I 151.133.. .3... i 4...! .

11..."...
.3.

K3..-
3., .3
333.55%.
é- :

:
“swab:

Y...
inauguwu.
«GMrliuir
I

0.,

i.

“was:

4 wt!- Ito-if!
5?!th

 

0.1.!

I. . .
. 533. .
it... o i.

3...}.
Q 3 it

 

.1.
slat};
iii:

 

t. L .
5.1 ..

I. «Full-ii!!! it

1) .1... ”Hill!
:Jxajéfigfifi . A .

 

tut-3:3
.. 1) T5 f

This is to certify that the
dissertation entitled

innate Immunity in Arabidopsis thaliana: Induction and
Suppression by Pseudomonas syringae

 

 

I presented by
l ;.
William Robert Underwood

has been accepted towards fulfillment
of the requirements for the

Ph.D. degree in Genetics

 

 

7" \s
-rfiém WW

Major Professor’s Signature

13-49-06»

 

 

Date

MSU is an Affinnative Action/Equal Opportunity Institution

 

 

LIBRARY
Michigan State
University

 

 

 

 

 

PLACE IN RETURN BOX to remove this checkout from your record.
To AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2/05 p:/ClRC/Date0ue.indd~p.1

 

 

 

 

.7.
p

 

 

INNATE IMMUNITY IN ARABIDOPSIS T HALIANA:
INDUCTION AND SUPPRESSION BY PSEUDOMONAS S YRINGAE

By

William Robert Underwood

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY
Genetics Program

2006

ABSTRACT
INNATE IMMUNITY IN ARABIDOPSIS T HALIANA :
INDUCTION AND SUPPRESSION BY PSEUDOMONAS SYRINGAE
By
William Robert Underwood
Innate immunity refers to the ability of eukaryotic organisms to detect the
presence of potentially harmful microbes through recognition of highly conserved surface
molecules, referred to as pathogen-associated molecular patterns (PAMPs), and to
activate defense responses to prevent infection. Like mammals and insects, plants can
perceive microbial PAMPs and activate defenses. Microbial pathogens such as bacteria
cause significant agricultural losses each year and chemical treatments aimed at abating
these losses represent a substantial input cost for agriculture and are damaging to the
environment. Therefore, new strategies to control crop losses due to pathogens without
the use of chemicals will be highly desirable. To develop such strategies, a thorough
understanding of plant defenses and the mechanisms by which pathogens overcome them
will be necessary.
My research has contributed to our knowledge of both innate immunity in plants,
and the mechanisms used by pathogenic bacteria to overcome innate immune responses. I
performed genome-wide microarray analyses in collaboration with Dr. Roger Thilmony
to determine global gene expression changes associated with the activation of innate
immunity in Arabidopsis thaliana. This study provided the first look at the gene
expression changes induced by perception of PAMPs present on live bacteria. We also

investigated the specific effects of the Pseudomonas syringae pv. tomato DCBOOO (Pst

DC3000) virulence factors coronatine (COR) and the type III secretion system (T'TSS) on
modulating gene expression in Arabidopsis.

My work also contributed to the discovery of bacterium-induced stomatal closure
as a novel component of innate immunity in plants. This research was performed in
collaboration with Dr. Maeli Melotto and revealed that the guard cells of stomata, pores
on the surface of the plant leaf, can sense bacterial PAMPs and close stomata to restrict
entry of bacteria into the leaf tissue. Prior to this discovery, stomata were generally
regarded as passive ports of bacterial entry. We found that bacterium-induced closure of
stomata required the plant hormone abscisic acid (ABA) and an intact ABA signaling
pathway. Additionally, we discovered that the phytotoxin COR is required for Pst
DC3000 to open stomata, explaining the primary virulence function of COR.

Successful phytopathogens such as Pst DC3000 can overcome innate immunity
and infect plants. The TTSS and effector proteins injected into the plant cells are crucial
for the bacteria to overcome defenses and cause disease. I investigated the function of a
single 'ITSS effector, the protein tyrosine phosphatase HopD2, by creating transgenic
Arabidopsis lines expressing HopD2 or the catalytically-inactive HopD2cms. I found
that HopD2 blocks defense responses associated with PAMP-induced innate immunity,
but not the HR. This activity was dependent on an intact phosphatase catalytic site and,
interestingly, HopD2C3788 had a dominant-negative effect on the function of the wild-type
HopD2. Global gene expression profiling revealed that HopD2 does not affect gene
expression levels in Arabidopsis, suggesting that HopD2 acts at a late stage, downstream
or independent of PAMP-induced signaling and gene expression changes, to block

activation of innate immunity.

C0pyright by
William Underwood

2006

ACKNOWLEDGEMENTS

I would first like to thank my advisor, Dr. Sheng Yang He for the opportunity to
perform my doctoral studies in his laboratory. Sheng Yang has been an excellent teacher
and mentor and I have benefited greatly from his advice and support. Working with
Sheng Yang has been a really wonderful learning experience.

I would like to thank the members of my guidance committee: Dr. Rebecca
Grumet, Dr. Jonathan Walton, and Dr. Mike Thomashow, for their support and advice
throughout my progress as a graduate student. Their suggestions and insights have been
very helpful.

I would also like to thank all of my colleagues, past and present, in the He lab:
Elena Bray-Speth, Wei-Ning Huang, Christy Mecey-Smith, Maeli Melotto, Francisco
Uribe, Weiqing Zeng, Kinya Nomura, Young Nam Lee, Lori Imboden, Roger Thilmony,
Paula Hauck, Julie Zwiesler-Vollick, Sruti DebRoy, Qiaoling J in, Sarah Sarkar,
Shuocheng Zhang,Ola Kolade, Yong Hoon Lee, Yong Bum Kwak, and Anne Plovanich-
Jones. Our lab has always been a very positive work environment and I have been lucky
to have great interactions with my colleagues. I would particularly like to thank Maeli
Melotto and Roger Thilmony with whom I worked closely on the projects described in
chapters 2 and 3. I really enjoyed collaborating with both Maeli and Roger and learned
quite a lot from both of them.

In addition to an great lab environment, the PRL has also been an excellent

environment with many wonderful colleagues and friends. I would like to all of the

members of the PRL for providing such an intellectually stimulating environment and for
the collaborative and interactive spirit that is a hallmark of this institution.

Finally, I would like to thank my parents for their constant love and support and
all of my fi'iends in East Lansing. Especially my girlfriend Julia Letoutchaia for
understanding my sometimes long and ofien erratic work hours and my friends Harrie
van Brp, Hiroshi Maeda, Neil Adhikari, and the many other fi'iends who have attended
our frequent graduate student “therapy” sessions at the Peanut Barrel. Without the

support of my friends and family this would not have been possible.

vi

TABLE OF CONTENTS

List of Tables .......................................................................................... x
List of Figures ........................................................................................ xi
Chapter 1
Introduction and Literature Review ................................................................ 1
Introduction ................................................................................... 2
Life cycles and virulence strategies of phytopathogenic bacteria ..................... 3
The Arabidopsis thaliana-Pseudomonas syringae model for studying plant
disease ......................................................................................... 5
The bacterial pathogen Pseudomonas syringae .......................................... 6
Bacterial type III secretion .................................................................. 7
Type III effector proteins .......................................................... 9
Virulence functions of type III effectors ....................................... 11
Phytotoxins of plant pathogenic bacteria ................................................ 14
Plant defense responses .................................................................... 16
Plant basal defenses ............................................................... 17
Gene-for-gene resistance ......................................................... 21
Project summary and rationale ............................................................ 23
References ................................................................................... 27
Chapter 2

Genome-wide transcriptional analysis of the Arabidopsis thaliana interaction with the
plant pathogen Pseudomonas syringae pv. tomato DC3000 and the human pathogen

Escherichia coli 01571H7 .......................................................................... 36
Abstract ...................................................................................... 37
Introduction ................................................................................. 38
Experimental Procedures .................................................................. 41

Plant growth, bacterial strains and bacteria enumeration .................... 41
RNA isolation and labeling ...................................................... 42
Affymetrix GeneChip hybridization and data collection ..................... 43
Affymetrix GeneChip data analysis ............................................. 43
RNA isolation and blot analysis ................................................ 46
Results and Discussion .................................................................... 47
Rationale and experimental design ............................................. 47
PAMP-induced transcriptional changes ........................................ 50
Hierarchical cluster analysis or PAMP-induced genes ....................... 51
Transcription factors and signaling components are induced in response to
PAMPs .............................................................................. 54
PAMPs induced genes that may be involved in secretion and cell wall
modification ........................................................................ 56

vii

F lagellin does not contribute uniquely to PAMP-mediated transcriptional

changes ............................................................................. 61
Analysis of the TTSS- and COR-regulated genes ............................ 63
Impact of Pst pathogenesis on host metabolism .............................. 67
Coronatine activates J A responses and secondary metabolism ............. 71
Pst induces ABA/abiotic stress response genes ............................... 76
Defense response-related gene expression ..................................... 76
Expression of auxin- and cytokinin-related genes is altered during Pst
infection ............................................................................ 78
Conclusion .................................................................................. 80
Acknowledgements ........................................................................ 81
References ................................................................................... 83
Chapter 3
A novel function for plant stomata in innate immunity against bacteria ..................... 94
Abstract ...................................................................................... 95
Introduction ................................................................................. 96
Experimental Procedures .................................................................. 98
Plant Material ...................................................................... 98
Chemicals ........................................................................... 99
Assessment of response of stomata to treatments ............................. 99
Detection of nitric oxide in guard cells ....................................... 100
Bacterial growth assay .......................................................... 100
Results ...................................................................................... 102
Plant and human pathogenic bacteria induce closure of stomata ......... 102
Involvement of PAMPs in triggering stomatal closure ..................... 106
ABA synthesis and signaling components are required for bacteria- and
PAMP-induced stomatal closure ............................................... 108
Pst DC3000 overcomes stomatal closure by production of the phytotoxin
coronatine ......................................................................... 1 13
Biological relevance of stomatal closure in bacterial infection ............ 118
Discussion ................................................................................. 122
References ................................................................................. 128
Chapter 4

Characterization of the virulence function of HopD2, a type III effector tyrosine
phosphatase of Pst DC3000 that suppresses basal defenses in Arabidopsis thaliana. . .. 131

Abstract .................................................................................... 132
Introduction ................................................................................ l 3 3
Experimental Procedures ................................................................ 136
Bacterial strains and media ..................................................... 136
Plant growth and bacteria enumeration ....................................... 137
Generation of transgenic plants ................................................ 138
Site-directed mutagenesis of HopD2 .......................................... 138
Production of antibody ........ ' .................................................. 139
DEX and estradiol induction of transgene expression ...................... 140

viii

Microarray analysis .............................................................. 140

Lipid profiling analysis ......................................................... 142
Callose assay ..................................................................... 143
In-gel kinase assays .............................................................. 144
Immunoblotting and HopD2 protein fractionation .......................... 145
Results ...................................................................................... 147
Arabidopsis thaliana transgenic plants expressing HopD2 exhibit
chlorosis and necrosis upon induction ........................................ 147
HopD2 transgenic plants allow enhanced multiplication of the Pst
DC3000 hrpA‘ mutant ........................................................... 150
HopD2 transgenic plants show reduced callose deposition in response to
hrpA' .............................................................................. 1 53

Development of the HR is not effected in HopD2 transgenic plants. . ...157
Activation of the Arabidopsis MAPKs AtMPK3 and AtMPK6 is enhanced
in HopD2 transgenic plants .................................................... 159
HopD2 is a non-transmembrane protein tyrosine phosphatase and is
present in both the soluble and membrane fractions of Arabidopsis

thaliana protein extracts ........................................................ 162
Microarray analysis of HopD2 function using transgenic plants and
bacterial mutants ................................................................. 165
Lipid profiling analysis of HopD2 transgenic plants ........................ 169
Discussion ................................................................................. 172
Acknowledgements ....................................................................... 176
References ................................................................................. 1 77
Chapter 5
Conclusions and Future Perspectives ............................................................ 183
References ................................................................................. 192
Appendix A
Supplementary material for Chapter 2 .......................................................... 194

ix

LIST OF TABLES

Table 2-1. Arabidopsis genes reproducibly regulated by bacterial inoculation ............. 49
Table 2-2. Selected PAMP-induced Arabidopsis genes ....................................... 59
Table 4-1. Microarray analysis of HopD2 transgenic plants ................................. 167
Table 4-2. Genes differentially regulated by transgenic expression of HopD2 and

HopD2C3788 ......................................................................................... 168
Table A-1. Known and predicted kinases induced by PAMP perception .................. 196

LIST OF FIGURES

Images in this dissertation are presented in color.
Fig. 2-1. Expression profile of 347 PAMP-induced Arabidopsis genes ..................... 53

Fig. 2-2. Expression profile of the 2439 Arabidopsis genes reproducibly regulated by 1
x106 and/or 5x107 Pst bacteria/mL ............................................................... 66

Fig. 2-3. COR toxin and type III effectors target different aspects of plant metabolism..69

Fig. 2-4. Pst coordinately regulates hormone and stress response genes .................... 75
Fig. 3-1. Pst DC3000 triggers closure of Arabidopsis stomata .............................. 104
Fig. 3-2. Arabidopsis responses to E. coli 0157:H7 .......................................... 105
Fig. 3-3. PAMPs and E. coli trigger stomatal closure ........................................ 107
Fig. 3-4. Stomatal responses in Arabidopsis ABA mutants .................................. 110
Fig. 3-5. Stomatal responses of Arabidopsis ABA response mutants 0st], gorkI, and

rbohD/F ............................................................................................. 1 l 1
Fig. 3-6. Involvement of nitric oxide (N O) in PAMP-induced stomatal closure ......... 112

Fig. 3-7. Stomatal responses to cor' (DC3118) and hrcC mutants of Pst DC3000 ....... 115
Fig. 3-8. Purified COR blocks both ABA- and PAMP-induced closure of stomata......116

Fig. 3-9. COR does not effect NO production in guard cells in response to ABA or

PAMPs .............................................................................................. 1 17
Fig. 3-10. Movement of GFP-labeled Pst DC3000 and cor’ Pst DC3118 through stomata
of Arabidopsis Col-0 epidermal peels ........................................................... 120
Fig. 3-11. Multiplication of Pst DC3118 in wild-type Arabidopsis and stomatal closure
mutants .............................................................................................. 121
Fig. 4-1. Leaf phenotypes of transgenic Arabidopsis expressing HopD2 .................. 149
Fig 4-2. Bacterial multiplication in HopD2 transgenic plants ............................... 152
Fig 4-3. Papilla-associated callose deposition in HopD2 transgenic plants ............... 155

xi

Fig. 4-4. Transgenic expression of HopD2 blocks flg22-induced resistance to Pst

DC3000 ............................................................................................. 156
Fig. 4-5. Onset of HR in C01 g1] and HopD2 transgenic plants ........................ 158
Fig. 4-6. Effect of HopD2 on activation of Arabidopsis MAPKs AtMPK3 and

AtMPK6 ............................................................................................. 161
Fig. 4-7. Analysis of HopD2 localization and alignment of catalytic domain ............ 164
Fig. 4-8. Phosphoinositide (PI) lipid content in HopD2 transgenic plants ................. 171
Fig. A-l. RNA blot analysis of differentially expressed genes identified by microarray
analysis .............................................................................................. 198
Fig. A-2. RNA blot analysis of the PAMP-responsive gene F lagellin-Induced Receptor
Kinase 1 (FRKI) ................................................................................... 199
Fig. A-3. In planta multiplication of bacterial flagellin mutants ............................ 200

Fig. A-4. COR toxin induces genes involved in secondary metabolism and TTSS
effectors repress genes involved in photosynthesis ........................................... 201

Fig. A-5. Pst regulates the gene expression of enzymes in the tryptophan, glucosinolate

and related biosynthetic pathways ............................................................... 203
Fig. A-6. Bacterial inoculation alters auxin-related gene expression ....................... 205
Fig. A-7. Pst alters host cytokinin—related gene expression .................................. 208

xii

Chapter 1
Introduction and Literature Review

Phytopathogenic bacterial virulence and plant defense

Introduction

Plants constitute the primary source of energy and food for most terrestrial
species, including humans. By converting the energy of the sun into chemical energy
stored in the bonds of carbohydrates through photosynthesis, plants provide a readily
exploitable source of energy for animals, insects, and other organisms including
pathogenic microbes. Collectively, pathogens such as bacteria, fungi, nematodes,
protozoa, and viruses infect essentially all species of land plants and, of particular
importance, all varieties of crop plants. Crop loss due to disease represents a serious
threat to global security of food, fiber, and animal feed (Strange and Scott, 2005). The
percentage of crop losses worldwide caused by plant pathogens, insects, and weeds was
estimated to be 31-42% of potential production capacity and to account for at least $500
billion in damages (Agrios, 2005; Oerke et al., 1994). In the United States, crop losses
due to plant pathogens was estimated at $9.1 billion while worldwide losses as a result of
plant disease reduce overall productivity by 12% (Food and Agriculture Organization,
1993)

Set against a backdrop of a steadily increasing human population and stagnating
increases in agricultural production, it is clear that novel, cost effective, and
environmentally sound strategies aimed at reducing crop losses to pathogens will be
needed. Current efforts to control pathogens and pests include widespread use of
chemical sprays and pesticides. Large-scale use of such chemicals often results in
environmental damage such as soil and groundwater contamination. In addition, chemical
sprays and pesticides represent a large input cost for agricultural production. Estimated

worldwide costs for pesticide applications totaled $26 billion annually (Food and

Agriculture Organization, 1993). Traditional breeding efforts aimed at generating
resistant crop varieties have resulted in varying levels of success. Agricultural practices
of planting crops in large, genetically uniform plots place selective pressures on
pathogens to overcome resistance conferred by single genes and a lack of basic
understanding of the factors that contribute to durable, long-term resistance continues to
impair efforts to generate crop varieties that display long-lasting pathogen resistance.
Diseases caused by bacterial pathogens are difficult to control and can sometimes
result in severe crop losses. Control of bacterial diseases often involves foliar sprays to
control bacterial populations or use of insecticides to kill insects that act as vectors to
spread bacteria from plant to plant. Gram-negative bacteria from the genera
Pseudomonas, Ralstom'a, Agrobacterium, Xanthomonas, and Erwinia, and gram-positive
bacteria from the genera Clavibacter and Streptomyces are the most common causal
agents of bacterial disease in plants. Collectively, these bacteria infect a wide variety of
plants and cause numerous types of diseases including leaf specks, wilts, scabs, blights,
cankers, and rots. Examples of severe and agronomically important bacterial diseases of
plants include fire blight of apples and pears caused by Erwinia amylovora, leaf blight of
rice caused by Xanthomonas oryzae, and vvilts and rots of numerous crop plants caused

by Ralstonia solanacearum.

Life cycles and virulence strategies of phytopathogenic bacteria
Outbreak of bacterial disease in crop plants is often highly variable from year to
year depending on environmental conditions such as temperature, rainfall, insect

populations, and other factors. Most phytopathogenic bacteria survive through winters in

soil, crop residues and debris, seeds, perennial weeds, stem cankers, and sometimes even
insect hosts. Infections and outbreaks are subsequently promoted by favorable
environmental conditions and spread from plant to plant by rain drops, oozes, or insect
vectors. Although different phytopathogenic bacteria employ a broad range of
mechanisms for survival and spread, the disease cycles of most plant pathogenic bacteria
are very similar and can be summarized by the following stages: entry into host tissue;
suppression of host defenses and acquisition of nutrients to allow establishment of
infection; aggressive multiplication within host intercellular spaces; release of bacteria
from infected tissue and subsequent further infections of uninfected tissue from the same
host plant or spread to other uninfected plants. One common characteristic shared by
most phytopathogic bacteria is that, unlike many mammalian pathogens, they infect host
tissue and complete the disease cycle without entering plant cells. Interestingly, the
opportunistic bacterial pathogen Pseudomonas aeruginosa strain PA14 was observed to
infect Arabidopsis thaliana and to actually perforate mesophyll cell walls and enter
mesophyll cells (Plotnikova et al., 2000). More commonly, however, phytopathogenic
bacteria remain in the intercellular spaces of plant tissues and must employ strategies to
exploit host resources without actually entering host cells.

Common strategies employed by bacteria to exploit plant resources include the
secretion of toxins and injection of bacterial proteins into plant cells. These strategies
likely promote the release of water and/or nutrients from the host cells into the apoplast,
which is generally regarded as a harsh, nutrient poor environment that may not support
aggressive bacterial multiplication. Additionally, some bacteria such as Ralstonia

solanacearum and Erwim'a carotovora secrete hydrolytic enzymes that degrade the

polysaccharides present in the plant cell walls (Huang and Allen, 2000; Reid and
Collrner; 1986). Degradation products of the cell wall may provide nutrients for the
bacteria and promote multiplication and such hydrolytic degradation of the cell wall is
generally associated with rot and wilt diseases. In the following pages of this chapter, I
will focus specifically on virulence mechanisms of the model bacterial plant pathogen

Pseudomonas syringae.

The Arabidopsis thaliana-Pseudomonas syringae model for studying plant disease
During the past 15 years, a model system consisting of the bacterial plant
pathogen Pseudomonas syringae pathovar tomato and the model host plant Arabidopsis

thaliana has emerged as a powerful tool to facilitate inquiry into the molecular
mechanisms underlying plant disease resistance and bacterial virulence. Arabidopsis
thaliana is a small, dicotyledonous member of the Brassicaceae family and is the most
commonly used model organism for the study of plant molecular biology. A large
abundance of resources have been developed for the study of the biology of Arabidopsis
including a completed genome sequence and a collection of T-DNA insertional mutant
lines. With the emergence of Arabidopsis as a model system for the study of plant
biology, Brian Staskawicz and colleagues sought to identify a bacterial pathogen that
could infect Arabidopsis and potentially serve as a model for the study of bacterial
diseases of plants. Pseudomonas syringae pathovar tomato (Pst), a bacterial pathogen of
tomato, was found to infect Arabidopsis and one strain of Pst, strain DC3000, was found

to cause severe disease symptoms (Whalen et al., 1991).

The bacterial pathogen Pseudomonas syringae

Pseudomonas syringae is a gram-negative bacterium belonging to the family
Pseudomonadaceae. This family includes the genera Pseudomonas, Burkholderia, and
Ralstonia and belongs to the gamma subgroup of proteobacteria, which includes other
pathogenic bacteria including enteric mammalian pathogens such as Yersinia, Shigella,
Escherichia, and Salmonella and other plant pathogens including Xanthomonas, Pantoea,
and Erwinia. Pseudomonads are ubiquitous in the environment and inhabit a wide
variety of niches. Pseudomonas syringae strains collectively infect a wide variety of
plants and are classified as pathovars based on their host plant(s). Individual pathovars
generally have a very limited host range with the ability to infect only one or a few plant
species and often only specific ecotypes of a given plant species. At least 48 pathovars of
Pseudomonas syringae have been identified based on host range and DNA analysis
(Gardan et al., 1999).

Pst DC3000 can infect both Arabidopsis and tomato and causes leaf speck disease
on these hosts. Prior to infection, Pseudomonas syringae can generally live epiphytically
on leaf surfaces. Pst enters leaf tissues through stomata, the surface apertures that allow
plants to conduct gas exchange and regulate water relations, and through accidental
openings in the plant cuticle such as wounds. Once inside the leaf intercellular space, Pst
multiplies aggressively, attaining populations as high as 107-108 bacteria per square
centimeter of leaf tissue in only 3 to 4 days, and causes disease symptoms characterized
by necrotic lesions surrounded by chlorotic halos (Hirano and Upper, 2000). At least two

well-characterized virulence factors are known to contribute to Pst pathogenicity and

development of disease symptoms. These are the phytotoxin coronatine and the type III

secretion system and battery of type III effector proteins.

Bacterial type III secretion

Type III secretion apparatuses are employed by a number of gram-negative
bacteria to deliver proteins from the bacteria directly into the cytoplasm of the eukaryotic
host cell. Type III secretion systems (TTSSs) are often key virulence determinants for
pathogenic bacteria of both animals and plants and have been found in enteric
mammalian pathogens such as Yersinia, Escherichia, Salmonella, and Shigella and in
plant pathogens including Pseudomonas, Ralstonia, Xanthomonas, Erwinia, and others.
In addition to pathogenic species, TTSSs are also found in plant and insect symbiotic
bacteria which use the TTSS to interact with their hosts (Dale et al., 2001; Marie et al.,
2001)

In Pseudomonas, components of the TTSS are encoded by hrp (for hypersensitive
response and pathogenicity) and hrc (for hrp gene conserved) genes. The hrp genes were
originally identified as being required for bacteria to elicit the hypersensitive response
(HR, a plant defense response) in resistant plant varieties and to cause disease on
susceptible plants (Lindgren et al., 1986). It was subsequently discovered that the hrp
genes play a role in secretion when they were found to be involved in secretion of
bacterial proteins in culture (Arlat et al., 1994; He et al., 1993; Wei et al., 1993).

The type III secretion apparatus is composed of a basal body that facilitates
transport of proteins across the inner and outer bacterial envelopes, an extracellular

needle or pilus structure that likely acts as a conduit for protein transport into the host

cytosol, and accessory proteins that may be involved in translocation of proteins through
the host membrane by forming pores and potentially docking the needle or pilus structure
(He et al., 2004). Components of the basal body are encoded by 9 hrc genes that are
conserved among all bacteria with TTSSs and share a high degree of sequence similarity
(Hueck, 1998). Interestingly, a number of these conserved genes also share significant
sequence similarity with genes encoding components of the flagellar secretion system
(Blocker et al., 2003). Structural characterization of the TTSS basal body has been
facilitated by the isolation of at least part of the structure from Salmonella enterica
serovar typhimurium (Kubori et al., 1998). The basal body of the TTSS was found to be
similar to the flagellar basal body and is made up of outer rings within the bacterial outer
membrane and two inner rings interacting with the cytoplasmic membrane. In addition to
the basal body, the TTSS apparatus also includes an extracellular appendage that, in
mammalian pathogens, consists of a needle-like extension and in plant pathogens, is a
longer pilus-like structure. The needle structure has been studied most extensively in
mammalian pathogens such as Salmonella and Shigella. In Salmonella, the needle
structure is composed of a major structural subunit encoded by the prgI gene and was
found to be 80nm in length and to have a diameter of 8nm (Kimbrough and Miller, 2000;
Kubori et al., 1998). A needle-like structure has not been found to be associated with the
TTSS apparatus of plant pathogens. However, plant pathogenic bacteria have been found
to assemble a longer, pilus-like extracellular structure associated with the TTSS (He and
J in, 2003). These structures, referred to as Hrp pili, have the same diameter (8nm) as the
TTSS needle of mammalian pathogens, but are significantly longer (several pm). This

morphological difference between the extracellular components of mammalian and plant

pathogen TTSSs is likely due to the unique cell type encountered by plant pathogens.
Plant cells are surrounded by a thick cell wall, which must be penetrated by the
phytopathogenic bacterium to reach the plasma membrane and cytosol of the host cell.
The Hrp pilus of Pseudomonas syringae is composed of a major subunit encoded
by the hrpA gene. Purified HrpA protein has been shown to assemble into a pilus-like
structure in vitro and to be added to the tip of the nascent pilus during assembly (Li et al.,
2002; Roine et al., 1997). Additionally, experimental evidence has demonstrated that type
III effector proteins are secreted from the tip of the Hrp pilus, suggesting that the pilus
acts as a conduit for the translocation of effectors into the host cell (J in and He, 2001; Li
etal., 2002). Additional extracellular accessory proteins such as harpins are also
necessary for function of the TTSS. These proteins may play a role in guiding the
growing pilus through the plant cell wall and in forming pores in the host cell plasma

membrane to allow docking of the pilus (He et al., 2004).

Type III effector proteins

Proteins secreted into host cells via the TTSS are generally thought to subvert
host cell processes to create an environment favorable for bacterial multiplication (Grant
et al., 2006). This can include the suppression of host defense responses to avoid
detection or destruction by the host or the release of nutrients from the host cell to
promote bacterial multiplication. Type III effector proteins from mammalian pathogens
are generally less numerous than those from plant pathogens and many studies have shed

light on the functions of these proteins. However, this section will focus on type III

effectors from plant pathogens with an emphasis on the effectors encoded by
Pseudomonas syringae.

In 2003, the completed genome sequence of the model bacterial phytopathogen
Pst DC3000 became available (Buell et al., 2003). The availability of a complete genome
sequence for this bacterium prompted a number of studies aimed at cataloging the type III
effector proteins in the Pst DC3000 genome. These studies used various bioinforrnatics
and experimental approaches such as identification of a promoter element known as the
hrp box which is recognized by the alternative sigma factor HrpL and used to
coordinately regulate transcription of type III effectors and structural components of the
TTSS (Guttrnan etal., 2002; Petnicki-chieja et al., 2002; Zwiesler-Vollick et al., 2002).
One study suggested that Pst DC3000 may encode as many as 40 type III effectors
(Schechter et al., 2004). However, more recent evidence gained using a combination or
fluorescence-activated cell sorting, hrpL-dependent expression, and a reporter fusion
system suggests that the number may be closer to 30 (Chang et al., 2005).

Collectively, type III effector proteins are absolutely required for the
pathogenicity of Pst DC3000 and other phytopathogenic bacteria such as Xanthomonas,
Ralstonia, and Erwinia. Mutant bacteria such as hrp mutants that cannot translocate type
III effectors into the host cell are rendered non-pathogenic and cannot cause disease on
normally susceptible host plants (Lindgren et al., 1986). Because of their importance in
pathogenicity, many studies have recently been aimed at discovering their function within
the plant host. Type III effectors of phytopathogenic bacteria were originally
characterized for their role in imparting avirulence on normally pathogenic bacteria and

their ability to elicit the HR in a gene-for-gene manner on plants carrying a corresponding

10

resistance (R) gene. However, it has become clear that the primary function of type III

effector proteins is to act as virulence factors to promote pathogenicity.

Virulence functions of type III effectors

Studying the function of type III effector proteins from plant pathogenic bacteria
has proven to be difficult for a number of reasons. First, single pathovars of plant
pathogenic bacteria encode large numbers of type III effectors, many of which seem to
have overlapping functions in promoting virulence. Because of this, knockout mutants
defective in the production of individual type III effectors generally display no effect or
only a slight reduction in virulence, rendering the study of bacterial mutants relatively
uninformative. Second, although sequence information is available for type III effectors
from a variety of plant pathogenic bacteria, the nucleic acid and protein sequences share
little or no homology to other genes of known function and, with only a few exceptions,
provide little clue as to the virulence function. Recently, to circumvent these problems, a
number of groups have employed a strategy of expressing bacterial type III effectors
directly in plant cells to study their function. Such studies have begun to reveal clues as
to the targets and functions of type III effectors from phytopathogenic bacteria.

A number of type III effectors have been shown to suppress various aspects of
plant defense responses. The effector protein AvrPto was originally characterized for its
role in eliciting the HR in resistant tomato varieties carrying the Pto kinase (Ronald et al.,
1992). Transgenic expression of AvrPto in Arabidopsis revealed that AvrPto could
suppress the salicylic acid (SA)-independent deposition of callose in response to non-

pathogenic type III secretion-deficient mutants of Pst DC3000 (Hauck et al., 2003).

ll

Callose, a [3-1-3 glucan, is deposited in cell wall reinforcements known as papillae in
response to perception of bacteria by the plant (Brown et al., 1995). These cell wall
reinforcements are thought to play a role in defense potentially by restricting bacterial
access to host cells or by encapsulating bacteria and possibly facilitating their exposure to
antimicrobial compounds. In addition to suppression of callose deposition, AvrPto
transgenic Arabidopsis plants exhibited significant changes in gene expression.
Interestingly, it was found that there was a clear bias in AvrPto plants toward the
transcriptional repression of genes whose products were predicted to enter the plant cell
secretory pathway. Collectively, these results suggest that the function of AvrPto in plant
cells may be to block the assembly of defense-associated papillae. More recently, AvrPto
was also found to block kinase activation and upregulation of the flagellin—induced
receptor kinase 1 (frkI) gene in Arabidopsis cell cultures in response to treatment with
the flg22 peptide, a synthetic peptide representing a highly-conserved region of the
bacterial pathogen-associated molecular pattern (PAMP) flagellin (He et al., 2006). The
precise molecular mechanisms by which AvrPto carries out these functions and the host
target(s) on which it acts are still unknown.

Recently, a molecular target of the Pst DC3000 effector Hole was identified.
The hopMI gene lies within a conserved region of the Pst DC3000 genome known as the
conserved effector locus (CEL) (Alfano et al., 2000). Partial deletion of the CEL in the
ACEL mutant of Pst DC3000 results in a significant reduction in virulence and it was
found that expression of either hopMI or the sequence-unrelated aer was sufficient to
restore firll virulence (Alfano et al., 2000; DebRoy et al., 2004). These results suggest

that the CEL~encoded effectors Hole and Aer have overlapping function and that this

12

function is critical for virulence on host plants. Transgenic expression of Hole in
Arabidopsis revealed that this effector could suppress an SA-dependent pathway leading
to deposition of papillae (DebRoy et al., 2004). Subsequently, it was discovered that
Hole targets a plant ADP ribosylation factor (ARF) guanine nucleotide exchange
factor (GEF) named AtMIN7 (Arabidopsis thaliana Hole interactor 7) for degredation
via the plant proteasome (Nomura et al., 2006). ARF GEFs are regulatory components of
vesicle trafficking in eukaryotic cells, suggesting that Hole may interfere with vesicle
trafficking leading to deposition of papillae. Interestingly, Aer did not target AtMIN7
for degredation, suggesting that Aer functions in a manner mechanistically distinct from
Hole.

In addition to suppression of papillae-associated basal defenses, a number of Pst
DC3000 type III effectors have been shown to suppress programmed cell death
associated with the HR (Grant et al., 2006). A specific example of this type of effector is
AvrPtoB. Like AvrPto, AvrPtoB is capable of triggering HR in resistant tomato varieties
carrying Pto (Kim et al., 2002). However, AvrPtoB was found to suppress HR cell death
initiated by Pto when both proteins, along with AvrPto, were transiently expressed in
Nicotiana benthamiana (Abramovitch et al., 2003). Additionally, AvrPtoB was found to
suppress the HR initiated by the Cf9 resistance protein in N. benthamiana and
programmed cell death initiated by the pro-apoptotic mouse Bax protein in both N.
benthamiana and yeast. It was subsequently discovered that AvrPtoB acts as an E3
ubiquitin ligase and that E3 ligase activity is required for suppression of HR-associated
programmed cell death (Abramovitch et al., 2006; Janjusevic et al., 2006). However,

other recent publications suggest a role for AvrPtoB in blocking basal defenses triggered

13

by perception of PAMPs such as flagellin. AvrPtoB was found to block formation of
papillae and to promote virulence of the normally non-pathogenic Pseudomonas syringae
pv phaseolicola strain RW60 on Arabidopsis and these functions were not dependent on
E3 ligase activity (de Torres et al., 2006). AvrPtoB was also shown to suppress kinase
activation and transcriptional upregulation of Arabidopsisfi'kl in response to perception
of flg22 (He et al., 2006). In light of these recent results, the function(s) of AvrPtoB in
promoting virulence are not clear. It is possible that AvrPtoB has multiple functions in
the same plant host conferred by different regions of the protein. Alternatively, AvrPtoB
may serve different functions in distinct host plants. Identification of specific host targets
for AvrPtoB will likely help to sort out the exact virulence role of this interesting type III

effector.

Phytotoxins of plant pathogenic bacteria

In addition to type III effectors, many plant pathogenic bacteria also produce one
or more toxins that play a role in promoting virulence on host plants. The various
Pseudomonas syringae pathovars produce a number of different toxins including
coronatine produced by pv tomato and other pathovars, phaseolotoxin produced by pv
phaseolicola, tabtoxin of pv tabaci, and syringomycin and syringopeptin of pv syringae
(Bender et al., 1999). In many cases, phytotoxins have been demonstrated to contribute to
the pathogenicity of the toxin-producing strains, however, relatively little is known about
the specific mechanisms by which these toxins contribute to virulence.

The phytotoxin coronatine (COR) is produced by at least 5 different pathovars of

P. syringae including pvs tomato, glycinea, atropurpurea, maculicola, and morsprunorum

14

(Bender et al., 1999). COR is a polyketide toxin consisting of two distinct structural
components, coronofacic acid and coronarnic acid (Ichihara et al., 1977). Structurally,
COR is closely related to the plant hormone jasmonic acid (J A) and plants such as the
COR-insensitive Arabidopsis coiI mutants are also resistant to the effects of IA,
prompting researchers to hypothesize that COR may act as a molecular mimic of J A
(Feys et al., 1994; Greulich et al., 1995; Koda et al., 1996; Weiler et al., 1994). It was
observed that a COR-deficient mutant of Pst DC3000 could not cause disease when
inoculated onto the surface of Arabidopsis leaves, but was capable of causing disease
symptoms and multiplying to wild-type levels when infiltrated directly into the leaf
intercellular spaces (Mittal and Davis, 1995). These results led the authors to speculate
that COR may suppress an uncharacterized early defense response in Arabidopsis. In
chapter 3 I will present evidence that this early defense response is bacterium-induced
stomatal closure and that the primary virulence role for COR is the suppression of this
stomatal defense response.

The modes of action of several other P. syringae toxins have also been
determined, however, in most cases the precise mechanisms by which these toxins
promote virulence are not understood. For example, phaseolotoxin produced by pathovars
phaseolicola and actinidiae has been shown to inhibit ornithine carbamoyl transferase
(OCTase). OCTase is involved in the urea cycle in both prokaryotes and eukaryotes and
catalyzes the conversion of ornithine and carbamoyl phosphate to citrulline. P. syringae
pathovars that produce phaseolotoxin also produce resistant OCTase isoforms, rendering
them insensitive to the effects of the toxin. The result of inhibition of OCTase is the

accumulation of ornithine and a deficiency of intracellular arginine pools and leads to

15

chlorosis in plant tissues. However, it is not clear how phaseolotoxin contributes to
virulence. It has been speculated that phaseolotoxin may actually be involved in direct
competition with other epiphytic bacteria for niches in the phyllosphere (V olksch and
Weingart, 1998). Syringomycins and syringopeptin are lipodepsipeptide toxins produced
by pathovar syringae. These toxins contribute significantly to virulence and have been
shown to cause necrosis in plant tissues (Hutchison and Gross, 1997; Quigley etal.,
1993). The function of this class of toxins seems to be related to their ability to form
pores in the host plasma membrane (Hutchison and Gross, 1997). Pore formation in plant
cell membranes may be a mechanism for P. syringae pv syringae to acquire nutrients

fiom the host.

Plant defense responses

Although some bacteria have evolved mechanisms to successfully colonize plants
and cause disease, most bacteria are unable to infect plants. In addition, most pathovars
of phytopathogenic bacteria are only able to infect a very limited number of plant hosts
and are non-pathogenic on other plant species or cultivars. Therefore, plants are able to
successfully defend themselves against the majority of bacteria to which they are
exposed. Plants employ a number of mechanisms to successfully avoid infection by
potentially pathogenic bacteria including preformed physical barriers such as the leaf
cuticle and cell walls, a suite of basal defense responses including deposition of cell wall
reinforcements and synthesis of antimicrobial compounds such as phytoalexins, a form of
programmed cell death referred to as the hypersensitive response (HR), and a systemic

immunity known as systemic acquired resistance (SAR). During the last 15 years,

16

significant progress has been made toward understanding the perception and signaling
events associated with elicitation of the HR. In contrast, basal defenses have received less
attention, and only within the last few years has the importance of basal defenses been
recognized. It is likely that both basal defenses and the HR contribute to long-term,
durable resistance of plants to a broad spectrum of potential pathogens. Therefore, a
thorough understanding of both responses, including perception events, signal
transduction, gene expression changes, and ultimately the biochemical processes leading
to restriction of multiplication, will be required to develop strategies for engineering

durable resistance to agronomically important plant pathogens.

Plant basal defenses

Basal defenses in plants are analogous to innate immunity in animals and insects
(Staskawicz et al., 2001). Innate immunity is an evolutionarily ancient form of resistance
to microbes and is characterized by the recognition of conserved microbial molecules
referred to as pathogen-associated molecular patterns (PAMPs). PAMPs generally
contribute to a function that is critical to the lifestyle of the organism and thus, are
indispensable and are generally well conserved across a wide range of microbes
(N umberger et al., 2004). A major breakthrough in the understanding of innate immunity
in plants came when plants were found to perceive bacterial flagellin, the proteinaceous
subunit that is the main component of the bacterial flagellum (Felix et al., 1999).
Perception of flagellin or a 22 amino acid highly elicitor-active peptide, flg22, derived
from a well-conserved domain of flagellin, was found to inhibit growth of Arabidopsis

seedlings and elicit callose deposition in leaf tissue (Gomez-Gemez et al., 1999).

17

Additionally, treatment of suspension-cultured tobacco cells with flg22 led to
alkalinization of the culture medium, suggesting that flg22 triggers production of reactive
oxygen species (ROS). The receptor responsible for perception of flagellin by
Arabidopsis was identified as an LRR receptor-like kinase and named FLS2 (G6mez-
Gomez et al., 2000). It was subsequently discovered that signaling mediated by FLS2
proceeds through a mitogen—activated protein kinase (MAPK) cascade involving the
Arabidopsis MAPKs AtMPK3 and AtMPK6 and leads to the rapid transcriptional
induction of a number of genes including those encoding the WRKY transcription factors
WRKY22 and WRKY29 (Asai et al., 2002). ArabidopsisflsZ mutants lacking the flagellin
receptor were found to be slightly more susceptible to Pst DC3000 when the bacteria
were inoculated on the leaf surface, but not when bacteria were infiltrated directly into
the leaf apoplast, suggesting that flagellin perception may be important for triggering a
defense active on the leaf surface (Zipfel et al., 2004). Expression profiling studies of
Arabidopsis seedlings or cell cultures treated with flg22 identified a number of
transcriptional changes associated with flagellin perception including the induction of
genes whose products are associated with signal transduction, transcriptional regulation,
and defense (Navarro et al., 2004; Zipfel et al., 2004). In addition to flagellin,
Arabidopsis has subsequently been shown to perceive several other bacterial PAMPs
including elongation factor Tu (EF-Tu) and lipopolysaccharides (LPS) and the receptor
mediating perception of EF-Tu has been identified (Kunze et al., 2004; Zeidler et al.,
2004; Zipfel et al., 2006).

The above studies and others have shed significant light on PAMP perception and

signaling in plants, however, the subsequent defense responses and their role in

18

restricting bacterial infection are still poorly understood. Two relatively well-
characterized aspects of basal defenses are the deposition of cell wall appositions called
papillae and the production of phytoalexins. However, the role of papillae and
phytoalexins in restricting bacterial multiplication remains unclear.

The formation of papillae in response to a pathogen was first observed over 100
years ago (reviewed in Aist, 1976). The majority of the literature concerning papilla
formation in response to pathogens describes papilla deposition in response to attempted
penetration by fungal pathogens. However, formation of papillae or papilla-like structures
has also been observed in plants in response to bacteria, viruses, and nematodes
(Bestwick et al., 1995; Allison and Shalla, 1974; Riggs et al., 1973). The most prevalent
hypothesis for the function of papillae in response to fungal attack is that papillae serve
as a structural barrier allowing the plant cell to resist mechanical or enzymatic
penetration by the invading fitngus. Rapid formation of papillae has been correlated with
enhanced resistance to fungal penetration, whereas, delayed papilla formation has been
correlated with an increase in penetration frequency (Bayles et al., 1990; Collins et al.,
2003). The structural components of papillae seem to vary between plant species, but
compounds commonly found associated with papillae include: callose; lignin; phenolics;
reactive oxygen species (ROS); peroxidases; and hydroxyproline-rich glycoproteins
(Aist, 1976; McLusky et al., 1999). It is thought that these components are cross-linked,
possibly through the action of ROS, into a dense, insoluble matrix that serves to
strengthen the cell wall locally at the site of interaction with the invading pathogen.

Although the papilla response has been studied for more than a century, very little

is known about the elaboration of this response at the molecular level. Studies with

19

various pharmacological inhibitors suggest that transcription, translation, protein
glycosylation, and microfilament polymerization are required for normal papilla
deposition (Skalamera et al., 1997). The Arabidopsis callose synthase encoded by the
GSL5 gene was shown to be required for deposition of callose in papillae and for wound-
induced callose deposition (N ishimura et al., 2003; Jacobs et al., 2003). However, gsl5
mutant Arabidopsis plants were able to form papillae, which, although lacking callose,
did not differ significantly in size and shape from papillae formed by wild type plants.
Interestingly, gsl5 mutants showed enhanced resistance to several normally virulent
species of powdery mildew. This enhanced resistance was found to be dependent on a
functional salicylic acid (SA) defense signaling pathway, as double mutants impaired in
SA defense signaling regained susceptibility. Additionally, the Arabidopsis SNARE
(soluble NSF attachment protein receptor) protein PEN] (also known as SYP121) was
found to be associated with deposition of papillae in response to perception of non-host
fungal pathogens (Assaad et al., 2004; Collins et al., 2003; Lipka et al., 2005).

Deposition of papillae has been observed in response to strains of several plant-
associated bacteria including Pseudomonas syringae and Xanthomonas campestris in a
variety of plant species such as lettuce, pepper, bean, and Arabidopsis (Brown et al.,
1995; Bestwick et al., 1995; Brown et al., 1998). Whether components mediating the
deposition of papillae in response to fungi, such as PEN], are also involved in formation
of papillae in response to bacteria is currently not known. Of particular significance is the
observation that saprophytic strains, avirulent strains and non-pathogenic mutants such as
hrp mutants elicit deposition of papillae, whereas pathogenic strains do not elicit this

response (Brown et al., 1995). This observation suggests that pathogenic strains have the

20

ability to suppress this defense response, and that this suppression is dependent on a
functional type III secretion system, implicating the involvement of type III-secreted
effector proteins in suppressing this response. As discussed previously, several type III
effectors have already been implicated in suppressing this defense response. In chapter 4,
I will present evidence that the Pst DC3000 effector HopD2 can suppress deposition of

papillae.

Gene-for-gene resistance

In addition to recognition of PAMPs, plants have also evolved the ability to detect
the presence of virulence factors such as type III effectors secreted directly into the host
cell. Recognition of specific type III effectors is mediated by host resistance (R) proteins,
most of which belong to a family of leucine-rich repeat (LR) and nucleotide-binding
(NB) domain containing proteins with either a coiled-coil (CC) or Toll-interleukin-l
receptor (TIR) domain at their N terminus. Activation of R proteins leads to a defense
known as the hypersensitive response (HR), which involves the death of the affected cell
and is thought to be a form of programmed cell death. The requirement of a specific
single gene from the pathogen (generally referred to as an avirulence or avr gene) and a
specific single gene from the host (the R gene) to confer resistance led H.H. Flor to
describe this phenomenon as gene-for-gene resistance over 50 years ago (Flor, 1955).

The most straightforward and simple model for recognition of bacterial virulence
proteins and activation of plant R proteins is one in which the R protein acts as a receptor
for the bacterial virulence protein and, through direct interaction, becomes activated and

subsequently promotes initiation of the HR. In the case of several R-avr genetic

21

interactions, a direct physical interaction between R and Avr proteins has been
demonstrated experimentally. Specific examples include recognition of the AVR—Pita
protein from the rice blast fungus Magnaporthe grisea by the corresponding rice R
protein Pi-Ta (J ia et al., 2000); recognition of Avr proteins of the flax rust (Melampsora
Iini) Aer5 6 7 locus by the flax (Linum usitatissimum) R proteins L5, L6, and L7 (Dodds
etal., 2006); and recognition of the PopP2 Avr protein of Ralstonia solanacearum by the
Arabidopsis RRSl-R protein (Deslandes et al., 2003). However, for many other R-Avr
pairs, a direct interaction has not been demonstrated and strong experimental evidence
instead points to an alternative model referred to as the “guard hypothesis.” The guard
hypothesis proposes that R proteins act as sentries within the plant cell to guard virulence
targets of bacterial effector proteins by detecting the activity of the virulence proteins or
the perturbation of the host target, thus indirectly detecting the virulence factors

(N irnchuck et al., 2001). Recently, the guard hypothesis has gained significant
experimental support. The best characterized example of indirect recognition of bacterial
effector proteins is that of the Arabidopsis protein RIN4 (RPMl-interacting protein 4).
Activation of at least two Arabidopsis R proteins, RPSZ and RPMl , has been shown to be
associated with modification of RIN4. The R protein RPM] is activated in response to
phosphorylation of RIN4 by either of two unrelated P. syringae effectors, AvrB or
Aerme (Mackey et al., 2002). RPS2, on the other hand, is activated by the absence of
RIN4 caused by its proteolytic degradation by the P. syringae effector Aerpt2 (Axtell
and Staskawicz, 2003; Mackey et al., 2003). These results suggest that RIN4 may be an
important virulence target of these effectors, however, the precise role of RIN4 in the

plant response to bacteria is still not known. Recent work suggests that RIN 4 may play a

22

role in the plant basal defense system activated in response to PAMP perception (Kim et
al., 2005). Another example of an Arabidopsis R protein guarding a potential host
virulence target is that of RPSS. Similar to RPSZ, RPSS detects the proteolytic cleavage
of a host protein, the PBS] kinase, by the P. syringae type III effector AverhB (Shao et

al., 2003). The role of PBS] as a host virulence target is also currently unknown.

Project summary and rationale

One of the most important long-term goals underlying the study of plant-microbe
interactions is to develop new strategies for reducing the impact of microbial pathogens
on agricultural production. In order to successfully formulate and institute such strategies,
it is necessary to understand the mechanisms employed successfully by plants to defend
themselves against most potential pathogens and the strategies employed by successful
pathogens to overcome these defenses. While gene-for-gene resistance and defenses
associated with the hypersensitive response have received significant attention over the
past two decades, resistance conferred by a single R gene is not likely to be durable and
long-lasting due to significant selection pressure placed on the pathogen. Emerging
evidence suggests that stable and durable resistance is likely conferred by a combination
of basal defenses associated with PAMP perception and R gene-mediated defenses. In
comparison to R gene-mediated defenses, relatively little was known about plant basal
defenses at the onset of this study. One of the major goals of this work was to improve

our understanding of plant basal defenses associated with perception of PAMPs.

23

Successful pathogens have evolved mechanisms to overcome plant defenses. To
achieve effective pathogen resistance in crop plants, it will also be important to
understand the ways in which pathogens are able to block, break down, or circumvent
normally effective host defenses. A second goal of this work was to investigate
mechanisms by which the bacterial pathogen Pst DC3000 overcomes the basal defenses
of the host plant Arabidopsis thaliana. It was known that two major virulence factors,
COR and TTSS effectors, contribute to the ability of Pst DC3000 to overcome host
defenses. However, the mechanism of action of COR or any specific effector protein was
not known at the onset of this study. The work described here investigates aspects of both
virulence systems.

Chapter 2 describes microarray analyses of Arabidopsis gene expression changes
associated with activation of basal defenses and with the activities of each of the two
virulence factors of Pst DC3000, COR and the TTSS. Prior to the initiation of this study
expression profiling of the interaction of Pst DC3000 with Arabidopsis had been reported
(Tao et al., 2003). This study addressed the compatible interaction between Pst DC3000
and Arabidopsis and the incompatible interaction associated with Pst DC3 000 carrying
an avirulence gene. However, gene expression changes associated with the activation of
basal defense were not addressed in this study. Additionally, the specific roles of COR
and the TTSS in modulating gene expression also were not addressed. To identify gene
expression changes associated with the activation of basal defenses, I analyzed the
expression profiles of Arabidopsis plants inoculated with non-pathogenic hrp mutants of
Pst DC3000 or with the human pathogen E. coli 01 57:H7. Additionally, I sought to

determine the role of flagellin perception in mediating the gene expression changes

24

 

 

 

 

associated with basal defenses. At the onset of this study, flagellin was the only bacterial
PAMP known to be perceived by plants and it was conceivable that perception of
flagellin may contribute specifically and uniquely to gene expression changes associated
with the activation of basal defenses. To address this question, I compared the expression
profiles of Arabidopsis plants inoculated with fliC mutant bacteria lacking flagella to
those of plants inoculated with the wild-type, flagella producing strains. To address the
specific roles of TTSS effectors and COR in modulating host gene expression, I
collaborated with Dr. Roger Thilmony to analyze the expression profiles of plants
inoculated with defined Pst DC3000 mutants defective specifically in COR biosynthesis
or secretion of TTSS effectors.

Chapter 3 reports the discovery of a novel component of plant basal defenses,
closure of stomata. At the time this study was initiated, it was known that mutants of Pst
DC3000 defective in COR biosynthesis were significantly compromised in virulence
when inoculated onto the surface of host leaves, but were normally virulent when
infiltrated directly into the leaf apoplast, suggesting the possible existence of a defense
mechanism active on the leaf surface and a role for COR in overcoming this hypothetical
defense (Mittal and Davis, 1995). Additionally, flsZ mutant Arabidopsis plants lacking
the flagellin receptor were more susceptible to Pst DC3000 when inoculated on the leaf
surface, but not when the bacteria were infiltrated directly into the leaf apoplast (Zipfel et
al., 2004) This result suggested that flagellin perception may contribute to a defense
mechanism active on the leaf surface. These results led us to hypothesize that stomata
may play a role in basal defenses of plants against bacteria. To address this hypothesis, I

collaborated with Dr. Maeli Melotto to investigate the behavior of plant stomata in

25

response to perception of bacteria and PAMPs and to investigate a potential role for COR
in modulating stomatal behavior.

Chapter 4 describes my research on the virulence function of a specific Pst
DC3000 type III effector, HopD2. HopD2 shares some sequence similarity with protein
tyrosine phosphatases, including a conserved active domain (Bretz et al., 2003; Espinoza
et al., 2003). This potential enzyme activity provided a starting point for the study of this
type III effector. To study the function of HopD2 in Arabidopsis, I created transgenic
plant lines expressing wild-type HopD2 or a phosphatase-inactive mutant derivative
under the control of an inducible promotor. Transgenic Arabidopsis plants expressing
HopD2 allow enhanced multiplication of normally non-pathogenic hrp mutants of Pst
DC3000. Additionally, these transgenic plants display reduced papillae-associated callose
deposition in response to non-pathogens, suggesting that HopD2 may play a role in
blocking basal defenses. This defense-suppressing activity of HopD2 is dependent on its
tyrosine phosphatase activity as plants expressing the catalytically inactive mutant protein
did not show these phenotypes. To investigate the possibility that HopD2 might exert its
virulence function by inactivating Arabidopsis MAP kinases known to be involved in
PAMP-triggered signaling leading to activation of basal defense, I collaborated with Dr.
Shuqun Zhang to assess the activation of AtMPK3 and AtMPK6 in the HopD2 transgenic
plants. I performed microarray and lipid profiling analyses to address the phosphatase-
specific changes associated with HopD2 in host plants. These experiments provide
evidence of a role for HopD2 in suppressing basal defenses in the host plant Arabidopsis

thaliana.

26

References

Abramovitch, R.B., Janjusevic, R., Stebbins, CE, and Martin, GB. (2006) Type III
effector AvrPtoB requires intrinsic E3 ubiquitin ligase activity to suppress plant cell
death and immunity. Proc. Natl. Acad. Sci. USA, 103, 2851-2856.

Abramovitch, R.B., Kim, Y.J., Chen, S., Dickman, M.B., and Martin, GB. (2003)
Pseudomonas type III effector AvrPtoB induces plant disease susceptibility by inhibition
of host programmed cell death. EMBO J. 22, 60-69.

Agrios, ON. (2005) Plant Pathology 5th edn. Academic Press, San Diego.

Aist, J .R. (1976) Papillae and related wound plugs of plant cells. Annu. Rev. Phtyo.
Pathol. 14, 145-163.

Alfano, J .R., Charkowski, A.O., Deng, W.L., Bade], J .L., Petnicki-chieja, T., van Dijk,
K., and Collmer, A. (2000) The Pseudomonas syringae Hrp pathogenicity island has a
tripartite mosaic structure composed of a cluster of type III secretion genes bounded by

exchangeable effector and conserved effector loci that contribute to parasitic fitness and
pathogenicity in plants. Proc. Natl. Acad. Sci. USA, 97, 4856-4861.

Allison, A.V., and Shalla, TA. (1974) The ultrastructure of local lesions induced by
potato virus X: a sequence of cytological events in the course of infection.
Phytopathology, 64, 784-93.

Arlat, M., Gijsegem, F.V., Huet, J.C., Pemollet, J .C., and Boucher, CA. (1994) PopAl, a
protein which induces a hypersensitivity-like response on specific Petunia genotypes, is
secreted via the Hrp pathway of Pseudomonas solanacearum. EMBO J. 13, 543-553.

Asai, T., Tena, G., Plotnikova, J ., Willmann, M.R., Chiu, W.L., Gomez-Gomez, L.,
Boller, T., Ausubel, F.M., and Sheen, J. (2002) MAP kinase signaling cascade in
Arabidopsis innate immunity. Nature, 415, 977-983.

Assaad, F.F., Qiu, J .L., Youngs, R, Ehrhardt, D., Zimmerli, L., Kalde, M., Wanner, G.,
Peck, S.C., Edwards, H., Ramonell, K., Somerville, C.R., and Thordal-Christensen, H.
(2004) The PENl syntaxin defines a novel cellular compartment upon fungal attack and
is required for the timely assembly of papillae. Mol. Biol. Cell, 15, 5118-5129.

Axtell, M.J., and Staskawicz, B.J. (2003) Initiation of RPSZ-specified disease resistance

in Arabidopsis is coupled to the Aerpt2-directed elimination of RIN4. Cell, 112, 369-
377.

27

Bender, C.L., Alarcon-Chaidez, F., and Gross, DC. (1999) Pseudomonas syringae
phytotoxins: mode of action, regulation, and biosynthesis by peptide and polyketide
synthetases. Microbiol. Mol. Biol. Rev. 63, 266-292.

Bestwick, C.S., Bennet, M.H., and Mansfield, J .W. (1995) Hrp mutant of Pseudomonas
syringae pv. phaseolicola induces cell wall alterations but not membrane damage leading
to the hypersensitive reaction in lettuce. Plant Physiol. 108, 503-516.

Blocker, A., Komoriya, K., and Aizawa, S. (2003) Type III secretion systems and
bacterial flagella: insights into their fiinction from structural similarities. Proc. Natl.
Acad. Sci. USA, 100, 3027-3030.

Bretz, J .R., Mock, N.M., Charity, J .C., Zeyad, S., Baker, C.J., and Hutcheson, SW.
(2003) A translocated protein tyrosine phosphatase of Pseudomonas syringae pv. tomato
DC3000 modulates plant defence response to infection. Mol. Microbiol. 49, 389-400.

Brown, 1., Mansfield, J ., and Bonas, U. (1995) hrp genes in Xanthomonas campestris pv.
vesicatoria determine ability to suppress papilla deposition in pepper mesophyll cells.
Mol. Plant Microbe Interact. 8, 825-836.

Brown, I., Trethowan, J ., Kerry, M., Mansfield, J ., and Bolwell, G.P. (1998) Localization
of components of the oxidative cross-linking of glycoproteins and of callose synthesis in
papillae formed during the interation between non-pathogenic strains of Xanthomonas
campestris and French bean mesophyll cells. Plant J. 15, 333-343.

Buell, C.R., Joardar, V., Lindeberg, M., Selengut, J ., Paulsen, I.T., Gwinn, M.L., Dodson,
R.J., Deboy, R.T., Durkin, A.S., Kolonay, J .F., Madupu, R., Daugherty, S., Brinkac, L.,
Beanan, M.J., Hafi, D.H., Nelson, W.C., Davidsen, T., Zafar, N., Zhou, L., Liu, J ., Yuan,
Q., Khouri, H., Fedorova, N., Tran, B., Russell, D., Berry, K., Utterback, T., Van Aken,
S.E., Feldblyum, T.V., D'Ascenzo, M., Deng, W.L., Ramos, A.R., Alfano, J .R.,
Cartinhour, S., Chatterjee, A.K., Delaney, T.P., Lazarowitz, S.G., Martin, G.B.,
Schneider, D.J., Tang, X., Bender, C.L., White, 0., Fraser, C.M., and Collmer, A. (2003).
The complete genome sequence of the Arabidopsis and tomato pathogen Pseudomonas
syringae pv. tomato DC3000. Proc. Natl. Acad. Sci. USA, 18, 10181-10186.

Chang, J .H., Urbach, J .M., Law, T.F., Arnold, L.W., Hu, A., Gombar, S., Grant, S.R.,
Ausubel, F.M., and Dangl, J .L. (2005) A high-throughput, near-saturating screen for type
III effector genes from Pseudomonas syringae. Proc. Natl. Acad. Sci. USA, 102, 2549-
2554.

Collins, N.C., Thordal-Christensen, H., Lipka, V., Bau, S., Kombrink, E., Qiu, J .L.,
Huckelhoven, R., Stein, M., F reialdenhoven, A., Somerville, SC, and Schulze-Lefert, P.
(2003) SNARE-protein-mediated disease resistance at the plant cell wall. Nature, 425,
973-977.

28

Dale, G., Young, S.A., Haydon, D.T., and Welburn, SC. (2001) The insect endosymbiont
Sodalis glossinidius utilizes a type III secretion system for cell invasion. Proc. Natl.
Acad. Sci. USA, 98, 1883-1888.

de Torres, M., Mansfield, J .W., Grabov, N., Brown, I.R., Ammouneh, H., Tsiamis, G.,
Forsyth, A., Robatzek, S., Grant, M., and Boch J. (2006) Pseudomonas syringae effector
AvrPtoB suppresses basal defence in Arabidopsis. Plant J. 47, 368-3 82.

DebRoy, S., Thilmony, R., Kwak, Y.B., Nomura, K., and He, S.Y. (2004) A family of
conserved bacterial effectors inhibits salicylic acid-mediated basal immunity and
promotes disease necrosis on plants. Proc. Natl. Acad. Sci. USA, 101, 9927-9932.

Deslandes, L., Olivier, J., Peeters, N., Feng, D.X., Khounlotham, M., Boucher, C.,
Somssich, I., Genin, S., and Marco, Y. (2003) Physical interaction between RRSl-R, a
protein conferring resistance to bacterial wilt, and PopP2, a type III effector targeted to
the plant nucleus. Proc. Natl. Acad. Sci. USA, 100, 8024-8029.

Dodds, P.N., Lawrence, G.J., Catanzariti, A.M., Teh, T., Wang, C.I., Ayliffe, M.A.,
Kobe, B., and Ellis, J .G. (2006) Direct protein interaction underlies gene-for-gene

specificity and coevolution of the flax resistance genes and flax rust avirulence genes.
Proc. Natl. Acad. Sci. USA, 103, 8888-8893.

Espinosa, A., Guo, M., Tam, V.C., Fu, Z.Q., and Alfano, J .R. (2003) The Pseudomonas
syringae type III-secreted protein HothoD2 possesses protein tyrosine phosphatase
activity and suppresses programmed cell death in plants. Mol. Microbiol. 49, 377-3 87.

Felix, G., Duran, J .D., Volko, S., and Boller, T. (1999) Plants have a sensitive perception
system for the most conserved domain of bacterial flagellin. Plant J. 18, 265-276.

Feys, B.J.F., Benedetti, C.E., Penfold, C.N., and Turner, J .G. (1994) Arabidopsis mutants
selected for resistance to the phytotoxin coronatine are male sterile, insensitive to methyl
jasmonate, and resistant to a bacterial pathogen. Plant Cell, 6, 751-759.

Flor, H.H. (1955) Host-parasite interactions in flax rust-its genetics and other
implications. Phytopathology, 45, 680-685.

Food and Agriculture Organization (1993) Production year book, F AO, Rome.

Gardan, L., Shafik, H., Belouin, S., Broch, R., Grimont, F., and Grimont, P.A.D. (1999)
DNA relatedness among the pathovars of Pseudomonas syringae and description of

Pseudomonas tremae sp. nov. and Pseudomonas cannabina sp. nov. (ex Sutic and
Dowson 1959). Int. J. Syst. Bacteriol. 49, 469-478.

deez-Gémez, L., and Boller, T. (2000) FLS2: An LRR receptor-like kinase involved in
the perception of the bacterial elicitor flagellin in Arabidopsis. Mol. Cell, 5, 1003-1011.

29

Gomez-Gomez, L., Felix, G., and Boller, T. (1999) A single locus determines sensitivity
to bacterial flagellin in Arabidopsis thaliana. Plant J. 18, 277-284.

Grant, S.R., Fisher, B.J., Chang, J .H., Mole, B.M., and Dangl, J .L. (2006) Subterfuge and
manipulation: type III effector proteins of phytopathogenic bacteria. Annu. Rev.
Microbial. 60, 425-449.

Greulich, F ., Yoshihara T., and Ichihara, A. (1995) Coronatine, a bacterial phytotoxin,

acts as a stereospecific analog of j asmonate type signals in tomato cells and potato
tissues. J. Plant Physiol. 147, 359-366.

Guttman, D.S., Vinatzer, B.A., Sarkar, S.F., Ranall, M.V., Kettler, G., and Greenberg,
J .T. (2002) A functional screen for the type III (Hrp) secretome of the plant pathogen
Pseudomonas syringae. Science, 295, 1722-1726.

Hauck, P., Thilmony R., and He S.Y. (2003) A Pseudomonas syringae type III effector
suppresses cell wall-based extracellular defense in susceptible Arabidopsis plants. Proc.
Natl. Acad. Sci. USA, 100, 8577-8582.

He, P., Shan, L., Lin, N.C., Martin, G.B., Kemmerling, B., Numberger, T., Sheen, J.
(2006) Specific bacterial suppressor of MAMP signaling upstream of MAPKKK in
Arabidopsis innate immunity. Cell, 125, 563-575.

He, 8., Huang, A., and Collmer, A. (1993) Pseudomonas syringae pv. syringae harpinpssz
a protein that is secreted via the Hrp pathway and elicits the hypersensitive response in
plants. Cell, 73, 1255-1266.

He, S.Y., and J in, Q. (2003) The Hrp pilus: learning from flagella. Curr. Opin. Microbial.
6, 15-19.

He, S.Y., Nomura, K., and Whittam, TS. (2004) Type III protein secretion mechanism in
mammalian and plant pathogens. Biochim. Biophys. Acta. 1694, 181-206.

Hirano, SS, and Upper, CD. (2000) Bacteria in the leaf ecosystem with emphasis on
Pseudomonas syringae-a pathogen, ice nucleus, and epiphyte. Microbial. Ma]. Biol. Rev.
64, 624-653.

Huang, Q., and Allen, C. (2000) Polygalacturonases are required for rapid colonization
and full virulence of Ralstonia solanacearum on tomato plants. Physio]. and Mol. Plant
Pathol. 57, 77-83.

Hueck, CJ. (1998) Type III protein secretion systems in bacterial pathogens of animals
and plants. Microbial. Mol. Biol. Rev. 62, 379-433.

30

Hutchison, M.L., and Gross, DC. (1997) Lipopeptide phytotoxins produced by
Pseudomonas syringae pv. syringae: comparison of the biosurfactant and ion channel-

forming activities of syringopeptin and syringomycin. Ma]. Plant-Microbe Interact. 10,
347-3 54.

Ichihara, A., Shiraishi, K., Sato, H., Sakamura, S., Nishiyama, K., Sakai, R., Furusaki, A.,
and Matsumoto, T. (1977) The structure of coronatine. J. Am. Chem. Soc. 99, 636-637.

Jacobs, A.K., Lipka, V., Burton, R.A., Panstruga, R., Strizhov, N., Schulze-Lefert, P., and
Fincher, GB. (2003) An Arabidopsis callose synthase, GSL5, is required for wound and
papillary callose formation. Plant Cell, 15, 2503-2513.

Janjusevic, R., Abramovitch, R.B., Martin, GB, and Stebbins, CE. (2006) A bacterial
inhibitor of host programmed cell death defenses is an E3 ubiquitin ligase. Science, 311,
222-226.

Jia, Y., McAdams, S.A., Bryan, G.T., Hershey, HR, and Valent, B. (2000) Direct
interaction of resistance gene and avirulence gene products confers rice blast resistance.
EMBO J. 19, 4004-4014.

Jin, Q., and He, S.Y. (2001) Role of the Hrp pilus in type III secretion in Pseudomonas
syringae. Science, 294, 2556-2558.

Kim, M.G., de Cunha, L., Mcfall, A.J., Belkhadir, Y., DebRoy, S., Dangl, J.L., and
Mackey, D. (2005) Two Pseudomonas syringae type III effectors inhibit RIN4-regulated
basal defense in Arabidopsis. Cell, 121, 749-759.

Kim, Y.J., Lin N.C., and Martin, GB. (2002) Two distinct Pseudomonas effector
proteins interact with the Pto kinase and activate plant immunity. Cell, 109, 589-598.

Kimbrough, T.G., and Miller, SJ. (2000) Contribution of the Salmonella typhimurium
type III secretion components to needle complex formation. Proc. Natl. Acad. Sci. USA,
97,11008-11013.

Koda, Y., Takahashi, K., Kikuta, Y., Greulich, F., Toshima, H., and Ichihara, A. (1996)
Similarities of the biological activities of coronatine and coronafacic acid to those of
jasmonic acid. Phytochemistry, 41, 93-96.

Kubori, T., Matsushima, Y., Nakamura, D., Uralil, J ., Lara-Tejero, M., Sukhan, A.,
Galan, J .E., and Aizawa, SI. (1998) Suprarnolecular structure of the Salmonella
typhimurium type 111 protein secretion system. Science, 280, 602-605.

Kunze, G., Zipfel, C., Robatzek, S., Niehaus, K., Boller, T., and Felix, G. (2004) The N

terminus of bacterial elongation factor Tu elicits innate immunity in Arabidopsis plants.
Plant Cell, 16, 3496-3507.

31

Li, C.M., Brown, 1., Mansfield, J ., Stevens, C., Boureau, T., Taira M., and Taira S. (2002)
The Hrp pilus of Pseudomonas syringae elongates from its tip and acts as a conduit for
translocation of the effector protein HrpZ. EMBO J. 21, 1909-1915.

Lindgren, P.B., Peet, R.C., and Panopoulos, NJ. (1986) Gene cluster of Pseudomonas
syringae pv. phaseolicola controls pathogenicity of bean plants and hypersensitivity of
nonhost plants. J. Bacterial. 168, 512-522.

Lipka, V., Dittgen, J ., Bednarek, P., Bhat, R., Wiermer, M., Stein, M., Landtag, J .,
Brandt, W., Rosahl, S., Scheel, D., Llorente, F., Molina, A., Parker, J ., Somerville, S.,
and Schulze-Lefert, P. (2005) Pre- and postinvasion defenses both contribute to nonhost
resistance in Arabidopsis. Science, 310, 1180-1183.

Mackey, D., Belkhadir, Y., Alonso, J .M., Ecker, J .R., and Dangl, J .L. (2003) Arabidopsis
RIN4 is a target of the type III virulence effector Aerpt2 and modulates RPS2-mediated
resistance. Cell, 112, 379-389.

Mackey, D., Holt, B.F. 3rd, Wiig, A., and Dangl, J .L. (2002) RIN4 interacts with
Pseudomonas syringae type III effector molecules and is required for RPMl-mediated
resistance in Arabidopsis. Cell, 108, 743-754.

Marie, C., Broughton, W.J., and Deakin, WJ. (2001) Rhizabium type III secretion
systems: legume charmers or alarmers? Curr. Opin. Plant Biol. 4, 336-342.

McLusky, S.R., Bennett, M.H., Beale, M.H., Lewis, M.J., Gaskin, P., and Mansfield,

J .W. (1999) Cell wall alterations and localized accumulation of feruloyl-3’-
methoxytyramine in onion epidermis at sites of attempted penetration by Batryis allii are
associated with actin polarization, peroxidase activity and suppression of flavenoid

biosynthesis. Plant J. 17, 523-534.

Mittal, S.M., and Davis, KR. (1995) Role of the phytotoxin coronatine in the infection of
Arabidopsis thaliana by Pseudomonas syringae pv. tomato. Mal. Plant-Microbe Interact.
8, 165-171.

Navarro, L., Zipfel, C., Rowland, 0., Keller, 1., Robatzek, S., Boller, T., and Jones,
J.D.G. (2004) The transcriptional innate immune response to flg22. Interplay and overlap
with Avr gene-dependent defense responses and bacterial pathogenesis. Plant Physiol.

135,1113-1128.

Nimchuk, Z., Rohmer, L., Chang, J .H., and Dangl, J .L. (2001) Knowing the dancer from
the dance: R-gene products and their interactions with other proteins from host and
pathogen. Curr. Opin. Plant Biol. 4, 288-294.

Nishimura, M.T., Stein, M., Hou, B., Vogel, J.P., Edwards, H., and Somerville, SC.

(2003) Loss of a callose synthase results in salicylic acid-dependent disease resistance.
Science, 301, 969-972.

32

Nomura, K., Debroy, S., Lee, Y.H., Pumplin, N., Jones, J ., and He, S.Y. (2006) A
bacterial virulence protein suppresses host innate immunity to cause plant disease.
Science, 313, 220-223.

Numberger, T., Brunner, F ., Kemmerling, B., and Piater, L. (2004) Innate immunity in
plants and animals: striking similarities and obvious differences. Immuno. Rev. 198, 249-
266.

Oerke, EC. (1994) Estimated crop losses due to pathogens, animal pests and weeds. In
Crop Production and Crop Protection (Oerke, E.C., Dehne, H.W., Schonbeck, F ., and
Weber, A., eds). pp. 72-741. Amsterdam: Elsevier Science, pp. 72-741.

Petnicki-chieja, T., Schneider, D.J., Tam, V.C., Chancey, S.T., Shan, L., Jamir, Y.,
Schechter, L.M., Janes, M.D., Buell, C.R., Tang, X., Collmer, A., and Alfano, J .R. (2002)
Genomewide identification of proteins secreted by the Hrp type III protein secretion
system of Pseudomonas syringae pv. tomato DC3000. Proc. Natl. Acad. Sci. USA, 99,
7652-7657.

Plotnikova, J .M., Rahme, LG, and Ausubel, F.M. (2000) Pathogenesis of the human
opportunistic pathogen Pseudomonas aeruginosa PA14 in Arabidopsis. Plant Physio].
124, 1766-1774.

Quigley, N.B., Mo, Y.Y., and Gross, DC. (1993) SyrD is required for syringomycin
production by Pseudomonas syringae pathovar syringae and is related to a family of
ATP-binding secretion proteins. Mol. Microbiol. 9, 787-801.

Reid, J .L., and Collmer, A. (1986) Comparison of pectic enzymes produced by Erwinia
chrysanthemi, Erwinia carotavara subsp. carotovora, and Erwinia carotavara subsp.
atroseptica. Appl. Environ. Microbial. 52, 305-310.

Riggs, R.D., Kim, KS, and Gipson, I. (1973) Ultrastructural changes in Peking soybeans
infected with Heterodera glycines. Phytopathalagy, 63, 76-84.

Roine, E., Saarinen, J ., Kalkkinen, N., and Romantschuk, M. (1997) Purified HrpA of
Pseudomonas syringae pv. tomato DC3000 reassembles into pili. FEBS Lett. 417, 168-
172.

Ronald, P.C., Salmeron, J .M., Carland, F.M., and Staskawicz, B.J. (1992) The cloned
avirulence gene avrPta induces disease resistance in tomato cultivars containing the Pto
resistance gene. J. Bacteria]. 174, 1604-1611.

Schechter, L.M., Roberts, K.A., Jamir, Y., Alfano, J .R., and Collmer, A. (2004)

Pseudomonas syringae type III secretion system targeting signals and novel effectors
studied with a Cya translocation reporter. J. Bacterial. 186, 543-545.

33

Shao, F., Golstein, C., Ade, J ., Stoutemyer, M., Dixon, J .E., and Innes, R.W. (2003)
Cleavage of Arabidopsis PBSl by a bacterial type III effector. Science, 301, 1230-1233.

Skalamera, D., Jibodh, S., and Heath, MC. (1997) Callose deposition during the
interaction between cowpea (Vigna unguiculata) and the monokaryotic stage of the
cowpea rust fungus (Uramyces vignae). New Phytol. 136, 511-524.

Staskawicz, B.J., Mudgett, M.B., Dangl, J .L., Galan, J .E. (2001) Common and
contrasting themes of plant and animal diseases. Science, 292, 2285-2289.

Strange, RN, and Scott, RR. (2005) Plant disease: A threat to global food security. Ann.
Rev. Phytopatha]. 43, 83-116.

Tao, Y., Xie, Z., Chen, W., Glazebrook, J ., Chang, H.S., Han, B., Zhu, T., Zou, G., and
Katagiri, F. (2003) Quantitative nature of Arabidopsis responses during compatible and

incompatible interactions with the bacterial pathogen Pseudomonas syringae. Plant Cell,
15, 317-330.

Volksch, B., Weingart, H. (1998) Toxin production by pathovars of Pseudomonas
syringae and their antagonistic activities against epiphytic microorganisms. J. Basic
Microbial. 38, 135-145.

Wei, Z.M., and Beer, S.V. (1993) HrpI of Erwinia amylavara fitnctions in secretion of
harpin and is a member of a new protein family. J. Bacterial. 175, 7958-7967.

Weiler, E., Kutchan, W.T.M., Gorba, T., Brodschelm, W., Neisel, U., and Bublitz, F.
(1994) The Pseudomonas phytotoxin coronatine mimics octadecanoid signaling
molecules of higher plants. FEBS Lett. 345, 9-13.

Whalen, M.C., Innes, R.W., Bent, A.F., and Staskawicz, B.J. (1991) Identification of
Pseudomonas syringae pathogens of Arabidopsis and a bacterial locus determining
avirulence on both Arabidopsis and soybean. Plant Cell, 3, 49-59.

Zeidler, D., Zéihringer, U., Gerber, I., Dubery, 1., Hartung, T., Bors, W., Hutzler, P., and
Durner, J. (2004) Innate immunity in Arabidopsis thaliana: Lipopolysaccharides activate
nitric oxide synthase (NOS) and induce defense genes. Proc. Natl. Acad. Sci. USA, 101,
15811-15816.

Zipfel, C., Kunze, G., Chinchilla, D., Caniard, A., Jones, J .D., Boller, T., and Felix, G.
(2006) Perception of the bacterial PAMP EF-Tu by the receptor EFR restricts
Agrabacterium-mediated transformation. Cell, 125, 749-760.

Zipfel, C., Robatzek, S., Navarro, L., Oakeley, B.J., Jones, J .D.G., Felix, G., and Boller,

T. (2004) Bacterial disease resistance in Arabidopsis through flagellin perception.
Nature, 428, 764-767.

34

Zwiesler-Vollick, J ., Plovanich-Jones, A.E., Nomura, K., Bandyopadhyay, S., Joardar,
V., Kunkel, B.N., and He, S.Y. (2002) Identification of novel hrp-regulated genes
through fimctional genomic analysis of the Pseudomonas syringae pv. tomato DC3000
genome. Mal. Microbial. 45, 1207-1218.

35

Chapter 2
Genome-wide transcriptional analysis of the Arabidopsis thaliana interaction with
the plant pathogen Pseudomonas syringae pv. tomato DC3000 and the human

pathogen Escherichia coli 0157:117.

This chapter has been previously published in The Plant Journal.

Thilmony, R.,‘ Underwood, W.,. and He, S.Y. (2006) Genome-wide transcriptional
analysis of the Arabidopsis thaliana interaction with the plant pathogen Pseudomonas
syringae pv. tomato DC3000 and the human pathogen Escherichia coli 0157:H7. Plant
J. 46, 34-53.

I These authors contributed equally to this work.

I would like to acknowledge Dr. Roger Thilmony for contribution of figures 2-3 and 2-4.

36

Abstract

Pseudomonas syringae pv. tomato DC3000 (Pst) is a virulent pathogen, which
causes disease on tomato and Arabidopsis. The type III secretion system (TTSS) plays a
key role in pathogenesis by translocating virulence effectors from the bacteria into the
plant host cell, while the phytotoxin coronatine (COR) contributes to virulence and
disease symptom development. Recent studies suggest that both the TTSS and COR are
involved in the suppression of host basal defenses. However, little is known about the
interplay between the host gene expression changes associated with basal defenses and
the virulence activities of the TTSS and COR during infection. In this study, we used the
Affymetrix full genome chip to determine the Arabidopsis transcriptome associated with
basal defense to Pst DC3000 hrp mutants and the human pathogenic bacterium
Escherichia coli 01 57:H7. We then used Pst DC3 000 virulence mutants to characterize
Arabidopsis transcriptional responses to the action of hrp-regulated virulence factors
(e. g., TTSS and COR) during bacterial infection. Additionally, we used bacterial fliC
mutants to assess the role of the PAMP flagellin in induction of basal defense-associated
transcriptional responses. In total, our global gene expression analysis identified 2,800
Arabidopsis genes that are reproducibly regulated in response to bacterial pathogen
inoculation. Regulation of these genes provides a molecular signature for Arabidopsis
basal defense to plant and human pathogenic bacteria, and illustrates both common and
distinct global virulence effects of the TTSS, COR, and possibly other hrp-regulated

virulence factors during Pst DC3000 infection.

37

Introduction

Pseudomonas syringae strains collectively infect hundreds of taxonomically
diverse plant species and cause disease symptoms ranging from leaf spots to stem cankers
(Hirano and Upper, 2000). P. syringae pv. tomato (Pst) strain DC3000 used in this study
cause necrotic lesions that are ofien surrounded by chlorotic halos in susceptible tomato
and Arabidopsis plants (Katagiri et al., 2002; Ma et al., 1991; Whalen et al., 1991). To
successfully colonize plants, P. syringae strains have evolved a variety of virulence
factors to subvert host defenses or to obtain nutrients. One common virulence mechanism
is the hrp-gene-encoded type 111 protein secretion system (TTSS; He et al., 2004; J in et
al., 2003). The TTSS is used by P. syringae to inject > 40 virulence effector proteins into
the host cell (Chang et al., 2005; Collmer et al., 2002; Greenberg and Vinatzer, 2003;
Nomura and He, 2005). Different P. syringae strains also produce a variety of
phytotoxins (Bender et al., 1999). Athough phytotoxins are generally not required for
bacterial pathogenicity, they do enhance pathogen virulence in host plants (Bender et al.,
1999). Pst DC3000, for example, produces a polyketide toxin, coronatine (COR), which
is required for full virulence in Arabidopsis and tomato plants (Brooks et al., 2004; Ma et
al., 1991; Mittal and Davis, 1995; Zhao et al., 2003). Emerging evidence suggests that the
production of the TTSS and COR is coordinately regulated in Pst DC3000 (Fouts et al.,
2002; Penaloza-Vazquez et al., 2000) so that mutations in the regulatory hrp genes (e. g.,
hrpS, hrpL, and hrpA) could affect the expression of both the TTSS and COR
biosynthetic enzymes.

How TTSS effectors promote bacterial pathogenesis is poorly understood and

remains an outstanding question in biology. In a previous study, we conducted

38

microarray analysis examining the effects of wild-type Pst DC3000 and its hrpS mutant
(defective in hrp regulon expression producing a nonfunctional TTSS), Pst DC3118
COR' mutant (defective in COR toxin production), or the COR'hrpS double mutant
(defective in the TTS S, COR toxin and potentially other hrp regulon controlled virulence
factors) on the expression of about 7,200 Arabidopsis genes in the compatible
Arabidopsis-Pst DC3000 interaction (Hauck et al., 2003). That study revealed that the
TTSS is involved in biased suppression of Arabidopsis genes that encode putatively
secreted proteins (Hauck etal., 2003). The TTSS-mediated suppression of these
Arabidopsis genes is correlated with the ability of the TTSS and its effector AvrPto to
suppress callose deposition (Hauck et al., 2003) and presumably other host responses that
are associated with plant basal defense to hrp mutant bacteria (Bestwick et al., 1995) or
to “pathogen-associated molecular patterns” (PAMPs) such as bacterial flagellin or EF-
Tu (Gomez-Gomez et al., 1999; Kunze et al., 2004). However, it remains to be
determined what role Type III secreted effectors play in the transcriptional regulation of
other host physiological processes important for pathogenesis.

The molecular mechanism by which COR facilitates Pst DC3000 virulence is also
not well understood. COR shows a remarkable structural similarity to the plant hormone
methyl jasmonic acid (MeJ A), which is involved in defense and wound response
signaling (Bender et al., 1999; Benedetti et al., 1995; Feys et al., 1994; Uppalapati et al.,
2005). Identification of the Arabidopsis JA/COR perception mutant coil, which is
insensitive to both MeJA and COR, further suggests a similar mode of action of COR and
MeJA (Xie et al., 1998; Kloek et al., 2001). The C011 gene encodes a subunit of an

SCFC011 complex (E3 type ubiquitin ligase) presumably involved in proteasome-mediated

39

plOlC

al.,l

coli
an}
that
prec

host

cult
firs
2011
flag
det

int

 

 

 

 

 

 

protein degradation (Devoto et al., 2002; Turner et al., 2002; Xu et al., 2002). Kloek et
al., (2001) and Zhao et al., (2003) observed hyperexpression of a defense gene, PR-I, in
P. syringae-inoculated caiI Arabidopsis and tomato plants, respectively. Resistance in
caiI Arabidopsis plants is apparently caused by elevated SA-mediated defense, because a
cat] Arabidopsis mutant expressing the nahG gene, which encodes an SA-degrading
enzyme, fails to restrict bacterial growth (Kloek et al., 2001). These observations suggest
that COR is involved in the suppression of an SA-dependent host defense. However, the
precise nature of the COR-targeted host defense and the contribution of COR to global
host gene expression during bacterial infection have not yet been determined.

Recently, gene expression studies were performed using Arabidopsis suspension-
cultured cells or seedlings treated with purified flagellin peptide (flg22), providing the
first glimpse into the global gene expression changes during basal defense (Navarro et al.,
2004; Zipfel et al., 2004). Whether the same set of Arabidopsis genes are regulated by
flagellin and other PAMPs during bacterial infection of intact plant leaves remains to be
determined. Recent studies suggest that the TTSS and COR have overlapping functions
in the suppression of some PR genes and induction of some wounding response genes
(He et al., 2004; Zhao et al., 2003). The extent of such overlap, however, has not yet been
determined at the whole genome scale. Nor is it known how many of the PAMP-induced
genes are subjected to transcriptional suppression by the TTSS and/or COR, respectively.

In this study, we conducted genome-wide gene expression analysis of Arabidopsis
plants treated with defined Pst DC3000 and E. coli 0157:H7 mutants to gain molecular
insights into 1) the transcriptional changes associated with basal defense to live bacteria,

which carry multiple PAMPs, 2) the contribution of flagellin to the regulation of the basal

4o

defense transcriptome during infection, and 3) the global effects of hrp-regulated
virulence factors, primarily the TTSS and COR, on the basal defense transcriptome and
other host physiological processes. Previous global gene expression analyses have been
performed in resistant Arabidopsis-Pst interactions (Tao et al., 2003) and other defense-
related treatments (reviewed in Wan et al., 2002). We have conducted genome-wide
analyses aimed at understanding the transcriptional responses of Arabidopsis plants to
PAMPs, TTSS effectors, and COR from the same bacterium during infection. The results
should complement other studies and provide a useful resource for future study of Pst

DC3000 pathogenesis in plants.

Experimental Procedures

Plant Growth, Bacterial Strains and Bacteria Enumeration.

Arabidopsis thaliana accession Col-O gl] plants were grown in soil in grth
chambers with a day/night cycle of 12 h/12 h, a light intensity of 100 uE, and a constant
temperature of 20°C. F our-week-old plants were used for experiments. Each biological
replicate contains plants that were grown, inoculated and harvested side-by-side in the
grth chamber entirely independent of the other replicates (typically separated in time
by several weeks or months). Bacteria for inoculation were grown in low-salt Luria—
Bertani broth (Katagiri et al., 2002) to the mid-logarithmic phase at 30°C. Bacterial
cultures were centrifuged to recover bacteria, which were resuspended in sterile water to
a final OD6oo of 0.002 (equivalent to 1x106 bacteria/mL), 0.1 (equivalent to 5x107

bacteria/mL) or 0.2 (equivalent to 1x108 bacteria/mL). Dilution plating was used to

41

confirm the number of bacteria present in the inoculum. The mock inoculum was water
containing 0.004% Silwet L-77 surfactant (Osi Specialties, Friendship, WV). Fully
expanded leaves were vacuum-infiltrated with bacterial suspensions, and in planta
bacteria were enumerated as described by Katagiri et al., 2002. The mean values of the
bacterial populations are plotted with the standard deviation displayed as error. The
leaves of 10-15 plants grown in several different pots were harvested for each RNA
sample used for microarray and RNA blot analysis. The regulation/secretion-defective
Pst hrpS mutant, the Pst DC3118 COR'hrpS double mutant, the secretion-defective Pst
hrpA mutant, E. coli 01 57:H7 and the E. coli TUV86-2 fliC mutant have been previously
described (Berin et al., 2002; Hauck et al., 2003; Hayashi et al., 2001; Yuan and He,
1996). Inoculation with E. coli strains was staggered with the 108 dataset such that
replicate number 1 of inoculations with E. coli OlS7:H7 and TUV86-2fliC was
performed alongside replicate number 2 of the other 108 inoculations. To complete 3
replicates for each E. coli strain, we performed a final set of inoculations consisting of E.
coli OlS7:H7, E. coli TUV86-2fliC, and mock inoculum. Therefore, in the publicly
available dataset in the NASCArrays database, the E. coli inoculations are annotated as
replicates 2, 3, and 4 to correspond with the other 108 inoculation data to which they are

directly compared.

RNA Isolation and Labeling
Total RNA was isolated from Arabidopsis leaves using the Promega (Madison,
WI) RNAgents total RNA isolation system. The RNA concentration was determined by

absorbance at 260 nm and its quality was evaluated by separation on 2% formaldehyde

42

denaturing agarose gels. The total RNA was further purified using Qiagen (Valencia, CA)
RNeasy minicolumns. Biotinylated target complementary RNA (cRNA) was prepared
from 16ug of total RNA using the procedure described by the Affymetrix (Santa Clara,
CA). Briefly, a primer encoding a T7 RNA polymerase promoter sequence fused to
(dT)24 (Genset Oligos, La Jolla, CA) was used to prime double-stranded cDNA synthesis
using the Invitrogen (Carlsbad, CA) SuperScript II Reverse Transcriptase. The resulting
cDNA was transcribed in vitro using the BioArray High-Yield RNA Transcript Labeling
Kit (Enzo Biochem, New York, NY) in the presence of biotinylated UTP and CTP to

produce biotinylated target cRNA.

Affymetrix GeneChip Hybridization and Data Collection

The labeled target cRNA was purified, fragmented, and hybridized to Arabidopsis
ATHl GeneChip arrays according to protocols provided by the manufacturer
(Afiymetrix) in a Hybridization Oven model 640 (Affymetrix). The GeneChips were
washed and stained with streptavidin-phycoerythrin using a GeneChip Fluidics Station
model 400 and then scanned with a Gene Array Scanner (Hewlett-Packard, Palo Alto,

CA).

Affymetrix GeneChip data analysis

The gene expression data was normalized and analyzed using the Affymetrix
Microarray Program Suite (MAS 5.0 statistical algorithms and the Data Mining Tool
(version 2.0)). Output from all GeneChip hybridizations was scaled globally such that its

average intensity (TGT value) was equal to an arbitrary target intensity of 500 allowing

43

comparisons between GeneChips. Data was then compared between sample chips from
the same biological replicate producing a Signal Log; Ratio (SLR) calculated from the
GeneChip fluorescence signal intensity data. The software was used to determine whether
there was a genuine change in mRNA accumulation (Change Call, D for Decrease, I for
Increase) and Change Call p-value. SLRs, Change Calls and p-values were determined
for each bacterially inoculated sample compared with its corresponding mock control or
bacterial mutant treated sample.

Six pair wise comparisons were made within the 1x106 bacteria/mL dataset, 3 pair
wise comparisons for the 5x107 bacteria/mL dataset and 8 pairwise comparisons for the
1x108 bacteria/mL dataset (see Table 1). We used Significance Analysis of Microarrays
(SAM; Tusher et al. 2001) to identify significant genes based on their differential
expression between our set of samples. The SAM analysis feature contained in the TIGR
Microarray Experiment Viewer v3.1 (Saeed et al., 2003; http://www.tm4.org/mev.htmL)
was used to conduct the analysis. The normalized signal log; ratios for each replicate of
each comparison were used for the analysis. Each inoculation level dataset (7 HPI 1x108,
10 HPI 5x107 and 24 HPI 1x106) was independently analyzed using the multiclass design,
with the default settings. The delta value was set at level such that the median False
Discovery Rate was less than 5%. This analysis identified a nonredundant list of 3,864
probesets. Microsofi (Redmond, WA) Access database management software was used to
further filter and query the data. Reproducibly differentially expressed probe sets were
selected from this list of 3,864, based on signal log; ratio of at least -1 .0, a gene
expression change call of D (decrease) and p-value >0.995 or signal log; ratio of at least

1.0, change call of I (increase) and p-value of <0.005 for all 3 biological replicates for at

44

least one type of comparison. Probe sets that meet these rigorous selection criteria were
further analyzed in detail. To our surprise, not a single probeset was reproducibly
differentially regulated in the 1x106 bacteria/mL Pst COR'hrpS verses mock comparison
(Table 1). This result illustrates the stringency of our selection criteria, because one
would expect that a few probesets might be reproducibly differentially expressed just by
chance. Our failure to identify Pst COR'hrpS (PAMP) differentially regulated genes
following inoculation with 1x106 bacteria, suggest that the level of bacteria in this
treatment is insufficient to elicit robust, detectable changes in host gene expression 24
HPI and supports our rationale to use higher doses of bacteria to identify PAMP-
regulated gene expression in these comparisons.

Hierarchical clustering and viewing was performed using either the Cluster v3.0
and TreeView programs (Eisen et al., 1998; http://rana.lbl.gov/EisenSofiware.htm) or the
TIGR Microarray Experiment Viewer v3.1. The hierarchical clusters displayed in Figures
1 and 2 were analyzed using the Microarray Experiment Viewer with the default
similarity metric settings (Euclidean Distance) with the Complete Linkage Clustering
method selected. MapMan v1.6.0 (Thimm et al., 2004; Usadel et al., 2005) was used for
analysis of the functional classes and metabolic pathways impacted following bacterial
inoculation. The 944 COR toxin regulated genes were identified from the 1x106
bacteria/mL Pst DC3000 vs Pst COR' comparison, while the 791 hrp-regulated genes
were identified from the 5x107 bacteria/mL Pst COR' vs Pst COR'hrpS comparison using
the criteria listed above. The SLRs for the 3 biological replicates in the selected
comparison were averaged and displayed using the MapMan software onto the

Metabolism Overview, Secondary Metabolism and Photosynthesis displays. The

45

 

 

Nor

the:

its;

W I

also

auto
idea

56;!

 

 

At;

 

 

Nottingham Arabidopsis Stock Centre (NASC) web site (htygz//nasc.nott.ac.uk/) contains
the raw microarray data in a MIAME compliant format for all of the experiments

described, reference NASCArrays-340.

RNA isolation and blot analysis

Total RNA was isolated from Arabidopsis leaves using the Promega (Madison,
WI) RNAgents Total RNA isolation system. The RNA concentration was determined by
absorbance at 260 nm and separated on 2% formaldehyde denaturing agarose gels. The
RNA was blotted onto Amersham (Piscataway, NJ) Hybond N+ nylon membranes using
10xSSC and UV crosslinked using a Stratagene (La Jolla, CA) Statalinker using the
autocrosslink setting. The cDNA sequences of 15 differentially expressed genes
identified by microarray analysis were used for RNA blot hybridization. Fourteen of the
sequences were derived from ESTs acquired from the Arabidopsis Biological Resource
Center stock center. Upon receipt of the ESTs, they were sequenced to confirm their
identity. The cDNA probe sequences were liberated from the cloning vector using
restriction digestion or PCR amplification with vector primers. The following cDNA
sequences were used for labeling and RNA blot hybridization: At3 g163 70 from EST
175018T7, At1g12090 from EST 135D13T7, At2g38540 from EST 135H16T7,
At1g29670 from EST 240F18T7, At2g19860 from EST E1C7T7, At1g03 870 from EST
172M22T7, At3g16240 from EST 206H6T7, At1g33240 from EST 88L16XP,
At2g41940 from EST 163F20T7, At5g61590 from EST 215C17T7, Atlg72610 from
EST 85C7T7, At2g10940 from EST 40D7T7, At5g24780 from EST 114D3XP,

At1g52890 from EST 165P18T7, Atlg43160 from EST 132C14T7, At5g26340 from

46

 

 

ES“
31:
99‘;

fmr

10L

and

R63

R21

 

 

 

EST 181G24T7, At2g24850 from EST 245M18T7, At3g45140 from EST 304E6T7,
At2g17500 from EST 178E2T7, Atl g62660' from EST 145A20T7, At4g27410 from EST
99D19T7, At4g02380 from EST E5E10T7, At4g02940 from EST 251H23T7, At3g16390
from EST 215J18T7. A 1.15 kb cDNA sequence for CLHI/CORII (At1g19670) was
amplified with RT-PCR using the following primers: 5’-
CAGAATTCAACACAACTCTTTAATTATC-3’ and 5’-
ATCTCGAGTAACAAATGTTTTGATCGAGJ’. The amplified product was cloned
into the EcoRI and XhoI sites of pBluescript SK+ and sequenced . cDNA sequences from
the above listed clones were labeled with 32P-dCTP using the Stratagene Prime-It 11
Random Primer Labeling kit. RNA blot hybridizations were performed using Sigma (St.
Louis, MO) PerfectHyb Plus hybridization buffer following the manufacturers protocol

and then washed to 0.5x SCC and exposed to film.

Results and Discussion

Rationale and Experimental design

All the experiments described were conducted using the Affymetrix ATHl
GeneChip and four-week-old Arabidopsis leaves. For discovery of PAMP- TTSS- and
COR-regulated genes, we used Pst DC3000, Pst DC3118 COR' mutant, and the Pst
DC3118 COR‘hrpS double mutant bacteria, as described previously (Hauck et al., 2003).
Because some of the strains have different growth potentials in plants, we used three
different levels of bacterial inocula for gene expression profiling: low (1x106

bacteria/mL), moderately high (5x107 bacteria/mL) and high (1x108 bacteria/mL) (Table

47

2-1). At 1x106 bacteria/mL, Pst DC3000 reliably causes disease within 3 to 4 days and is
used in this and other laboratories as a standard disease assay (Katagiri et al., 2002). This
inoculum level has also previously been used to identify hundreds of Pst-regulated genes
(Hauck et al., 2003). Gene expression changes at this inoculum level were examined after
a 24 hour infection period (Figure A-l). During this time period, Pst DC3000 and the Pst
COR’ mutant multiply similarly to levels 40-to-50-fold higher than that of the Pst hrpA,
hrpS and COR'hrpS mutants (data not shown). Therefore, to minimize the effects the
different bacterial population numbers have on host gene expression, and to examine
samples with early, synchronous responses, we also used inoculum concentrations of
1x108 and 5x107 bacteria/mL. In these cases, the tissues could be harvested earlier (at 7
hours and 10 hours after inoculation respectively) when development of basal defense-
associated papillae is occurring (Hauck et al., 2003). At the inocula and time points
chosen for various strains, high and comparable expression levels of a known PAMP-
induced gene, F lagellin-Induced Receptor Kinase 1 (F RKI ), were observed (Figure A-2).

In total, we conducted eight pair wise comparisons for the 1x108 dataset, three for
the 5x107 dataset, and six for the 1x106 dataset. A summary of the number of genes that
passed our selection criteria (see Experimental Procedures) and were reproducibly
differentially regulated in all 3 biological replicates for each comparison is shown in
Table 2-1. These comparisons identified genes that are responsive to bacterial PAMPS of
Pst hrp mutants and E. coli 01 57:H7 as well as those that are regulated by Pst DC3000
TTSS effectors and/or COR toxin (Table 2-1). Our global transcriptional profiling

identified 2800 genes that were reproducibly differentially regulated.

48

Table 2-1: Arabidopsis genes reproducibly regulated by bacterial inoculation.

Repressed Induced

 

 

 

 

 

 

 

Comparlson Treatmenta Genes Genesb Total Expression Pattern Identified

1. Pst hrpA vs. mock W, 7 hrs 224 253 477 PAMP regulation

2. Pst hrpA fliC vs. mock 108. 7 hrs 5 95 100 PAMP regulation

3. Pst hIpA vs. Pst hrpA fliC 108. 7 hrs 11 9 20 Flagellin-specific regulation

4. E. coli O157:H7 vs. mock 108. 7 hrs 96 186 282 PAMP regulation

5. E. coli roves-2 fliC vs. mock 108. 7 ms 240 218 458 PAMP regulation

6. E. coli O157:H7 vs. E. coli TUV-86-2 MO 108, 7 hrs 0 0 0 Flagellin-specific regulation

7. Pst 003000 vs. mock 108, 7 hrs 901 495 1396 Pseudomonas regulation

8. P51003000 vs. Pst thA 108. 7 hrs 904 415 1319 Pst virulence factor regulation
1270 797 1901 Non-redundant Totals

9. Pst coa'mps vs. mock 5x107, 10 hrs 197 154 351 PAMP regulation

10. Pst COR' vs. mock 5x107, 10 hrs 829 399 1228 Pseudomonas regulation

11. Pst COR' vs. Pst COR-hrpS 5x107. 10 hrs 516 275 791 Type III effector Egulation
1018 549 1537 Non-redundant Totals

12. Pst COR’hrpS vs. mock 106. 24 hrs 0 o o PAMP regulation

13, PstCOR' vs. mock 106, 24 hrs 212 297 509 Pseudomonas regulation

14. Pst COR' vs. Pst COR'hrpS 106. 24 hrs 175 253 428 Type III effector regulation

15. Pst DC3000 vs. Pst COR' 106. 24 hrs 347 597 944 COR toxin regulation

16. Pst DC3000 vs. mock 106. 24 hrs 685 680 1365 Pseudomonas regulation

17. Pst DC3000 vs. Pst COR-hrpS 106, 24 hrs 777 700 1477 Pst virulence factoleation
955 1018 1929 Non-redundant Totals
1724 1430 2800 Overall Non-redundant Totals

aSummary data from plants 7 hours after inoculation with 1x108 bacteria/mL (rows 1-8),
10 hours after inoculation with 5x107 bacteria/mL (rows 9-11), and 24 hours after
inoculation with 1x10‘5 bacteria/mL Pst bacteria (rows 12-17) are shown.

bCriteria for gene selection is described in the text.

49

 

\V

’et

PAMP-induced transcriptional changes

In order to identify the transcriptional changes resulting from PAMP perception,
we inoculated Arabidopsis with three different bacteria: Pst DC3000 hrpA mutant, Pst
DC3000 COR'hrpS mutants, and human pathogenic E. coli 01 57:H7. The Pst hrpA and
COR'hrpS mutants lack the ability to secrete TTSS effectors into the host and are unable
to multiply significantly in plant host leaves or produce disease symptoms. Furthermore,
the COR-hrpS mutant is unable to produce COR toxin and similarly, the hrpA mutant is
also likely defective in COR toxin production via a feedback mechanism. The hrpA
mutant strain has repressed expression of the hrpS and hrpL genes, which globally
control the expression of genes involved in the production of the TTSS, COR toxin, and
possibly other virulence factors (F outs et al., 2002; Wei et al., 2000). Therefore, in the
hrpA and COR'hrpS mutants, many, if not all, plant-specific virulence factors are not
produced. E. coli 01 57:H7, a human pathogen, is also unable to multiply or cause any
symptoms on Arabidopsis leaf tissue (data not shown) and is not expected to carry plant-
specific virulence factors. We hypothesized that inclusion of these three bacterial strains
in the analysis should give us a global view of common and distinct plant transcriptional
responses through the perception of PAMPS displayed by human and plant pathogenic
bacteria. To assess the contribution of flagellin perception in host gene regulation during
bacterial infection, we examined Arabidopsis gene expression regulated by the hrpA fliC
double mutant of Pst DC3000 (Hu et al., 2001) and a fliC mutant derivative of E. coli
TUV86-2 (Gunzer et al., 1998).

We identified a set of 736 PAMP-responsive genes that were differentially

regulated at least 2-fold in 3 biological replicates for at least 1 out of the following 3

50

treatments with non-pathogenic bacteria: Pst hrpA vs mock 108 bacteria/mL, E. coli
OlS7:H7 vs mock 108 bacteria/mL, and Pst COR'hrpS vs mock 5x107 bacteria/mL. A
tally of the number of Arabidopsis genes regulated in response to each of the three
bacterial treatments is presented in Table 2-1. Of the 736 reproducibly regulated genes,
347 were induced and 389 were repressed. Because we are particularly interested in
genes whose products may be involved in the induction or elaboration of basal defenses,

we chose to focus our analysis primarily on the set of 347 PAMP-induced genes.

Hierarchical cluster analysis of PAMP-induced genes

To provide an overview of the regulation of the 347 PAMP-induced genes across
our set of treatments and biological replicates and to visualize the regulation of these
genes in response to inoculation with virulent Pst DC3 000, we performed hierarchical
clustering. The resulting cluster is displayed in Figure 2-1. The induction of Arabidopsis
genes after inoculation with E. coli was strikingly similar to the induction elicited by the
Pst hrp mutants. The correlation coefficients based on the PAMP induced genes for each
of the 1x108 and 5x107 comparisons are shown in Table A-3. Although Pst hrpA
inoculation resulted in the reproducible regulation of 195 more genes (that matched or
exceeded our selection criteria) than inoculation with E. coli 01 57:H7 (Table 2-1), the
expression profiles were remarkably similar for the two treatments as shown in Figure 2-
1 and their correlation coefficient was 0.79. We are particularly interested in identifying
genes whose products may play a role in the plant basal defense response. Virulent Pst
DC3000 is able to overcome or evade this host basal defense response and may do so by

repressing or blocking the induction of host genes whose products are involved in the

51

elaboration of these defenses. Therefore, we expected that some PAMP-induced genes
would be either repressed or simply not reproducibly induced upon inoculation with Pst
DC3000. The blue bar in Figure 2-1 illustrates a cluster of genes that exhibit an
expression pattern consistent with a role in basal defense. A total of 201 of the 347
PAMP-induced genes were either repressed or not significantly regulated (average fold
change of <1.5) in response to Pst DC3000 inoculation. We propose that these genes may

have a role in the Arabidopsis basal defense response to bacteria.

52

1 x 10‘ cfu/mL 5 x 107cfu/mL
A B C D E F G H I

'1‘

up:

i

1

III ll I
IQI!

int. i
l an

ill

 

Figure 2-1: Expression profile of 347 PAMP-induced Arabidopsis genes. Treatments:
A- E. coli v mock; B- E. calfliC v mock; C- hrpA v mock; D- hrpAfliC v mock; E-
DC3000 v mock; F- DC3000 v hrpA; G- corhrpS v mock; H- cor v mock; I- cor v
carhrpS. Genes highlighted by the blue bar on the right are of particular interest as these
genes are induced by PAMP perception, but are not reproducibly induced or are repressed
by Pst DC3000 and/or Pst COR'.

53

Transcription factors and signaling components are induced in response to PAMPs.

Of the 347 PAMP-induced Arabidopsis genes, 86 encode known or predicted
transcription factors and kinases. Thirty transcription factors are reproducibly induced in
response to PAMP perception, 17 of which are repressed or not significantly regulated in
response to DC3000 (Table 2-2A). Of these 30 PAMP-induced transcription factors, 12
belong to the WRKY family and 8 of these are induced by PAMPS but not by Pst
DC3000. WRKY22 (At4g01250) was previously shown to participate in the F LS2-
mediated signaling cascade triggered by perception of the synthetic flagellin peptide
flg22 (Asai et al., 2002). Additionally, 6 of these 12 WRKY transcription factor genes
(shaded gray in Table 2-2A) were shown to be induced in Arabidopsis seedlings in
response to treatment with flg22 (Zipfel et al., 2004). These data suggest that WRKY
family transcription factors play an important role in regulating the Arabidopsis basal
response to bacteria. Determining the target genes regulated by these PAMP-induced
WRKY transcription factors should further our understanding of the processes involved
in the plant basal defense response.

In addition to WRKY transcription factors, 9 known or putative zinc finger
transcription factors and 4 ERF/AP2 family transcription factors were induced by
PAMPS. Two of the four ERF/AP2 family transcription factors and 6 of the 9 zinc finger
proteins were previously shown to be induced by flg22 (Zipfel et al., 2004). Interestingly,
the ethylene responsive AtERFI transcription factor was found to be induced by PAMPS.
The plant hormone ethylene has been shown to play a role in plant defense against
pathogens, and AtERFI was also found to be induced in response to flg22 treatment.

However, our study shows that AtERF 1, while reproducibly induced approximately 2-

54

 

fbld b:
pa'lrog
induct
ngnal
flock:
fllustr
Pill)

by P:\

inducc
genes
induce
found
hnase
Innsll
(illil

irahh

 

' fold by PAMP perception, is even more strongly induced (~10-fold) by the virulent
pathogen Pst DC3000. These data suggest that ethylene signaling may play a role in the
induction of basal defenses, but that the basal defense responses triggered by ethylene
signaling are either insufficient to prevent Pst DC3000 pathogenesis or that Pst DC3 000
blocks ethylene signaling or responses downstream of AtERF I induction. This example
illustrates the value of determining the expression profile of these genes in response to
Pst DC3 000 in addition to PAMPS rather than simply identifying genes that are induced
by PAMPS.

In addition to transcription factors, a number of other signaling components were
induced by PAMP perception. Particularly abundant among PAMP-induced genes were
genes known or predicted to encode kinases. F ifiy-six known or putative kinases were
induced by PAMP perception (Table A-l). Of these 56 PAMP-induced kinases, 31 were
found to be induced by flg22 treatrnent (shaded gray in Table A-l). Receptor-like
kinases, including lectin family kinases, and wall-associated kinase-like proteins are the
most highly represented classes of kinases induced by PAMPS. Wall-associated kinases
(WAKs) and WAK-like kinases (WAKLs) have recently been implicated in the
Arabidopsis response to pathogens. AtWakI was shown to be induced by P. syringae and
SA (He et al., 1998) and WAKl was recently shown to interact with the glycine rich
protein AtGRP3 and to phosphorylate oxygen evolving enhancer protein 2 (OEE2; Yang
et al., 2003). Treatment of Arabidopsis protoplasts with purified AtGRP3 induced PR-I
gene expression and inoculation of plants with avirulent Pst DC3000 enhanced WAKl -
dependent phosphorylation of OEE2, suggesting that WAKl and GRP3 may play a role

in the response to pathogens. Additionally, the WAK-like kinase WAKL22 was recently

55

 

found

of i501
Al'thOt
the pn
recent

role it

recept
Recog
pereei
PR 1
Zeidit
is an I
PRPs
Path“
lCSpo

rttep

PAM

paths

DPICa

“lib ll

 

found to be identical to the resistance gene RfoI which confers to resistance to a number
of isolates of the fungal pathogen F usarium axysparum (Diener and Ausubel, 2005).
Although neither WAKI nor WAKL22 were specifically induced by PAMPS in our study,
the prevalence of WAK-like kinases among PAMP-induced genes taken together with the
recent results highlighted above suggest that this class of proteins may play an important
role in the plant response to pathogens.

Also of particular interest are a number of leucine-rich repeat (LRR)-containing
receptor-like kinases. These receptor-like kinases may be candidates for Pattern
Recognition Receptors (PRRs) in Arabidopsis. Although Arabidopsis is known to
perceive a number of bacterial PAMPS including flagellin, LPS, and EF-Tu, only a single
PR for bacterial PAMPS has been identified (Felix et al., 1999; Kunze et al., 2004;
Zeidler et al., 2004). FLSZ, the PR which mediates flagellin perception in Arabidopsis,
is an LRR receptor kinase (Gomez-Gomez and Boller, 2000). Identifying additional
PRRs in Arabidopsis is a high priority and should lead to new insights into the signaling
pathways initiated by perception of bacterial PAMPS and the downstream basal defense
responses that protect plants against a wide array of bacteria. These PAMP-induced LRR

receptor-like kinases provide a starting point in the search for other Arabidopsis PRRs.

PAMPs induce genes that may be involved in secretion and cell wall modification.
One of the most well characterized aspects of plant basal defense against

pathogens is modification of the cell wall. Plants challenged with bacteria or fungi

typically develop cell wall appositions referred to as papillae at the point of interaction

with the invading pathogen. Formation of papillae is characterized by the deposition of

56

 

 

 

 

   
  

elecuolt i'
15h) 1101“.
the test of
proper lot
the plant .

'tfioogen

polarized

potential:
lonnatio:
Ellit‘ptc
be met
Suretut
during
Peron,
linkin

Patio

“373g

3484/
I

0o...»

electron dense materials such as phenolic compounds, callose, and cell wall proteins such
as hydroxyproline-rich glycoproteins. Callose is synthesized at the plasma membrane, but
the rest of the components are synthesized within the cell and must be delivered to the
proper location at the wall for deposition into papillae. Because of this, components of
the plant secretory system are likely to play an essential role in basal defense against
pathogens. Consistent with the predicted importance of cell wall modification and
polarized secretion to basal defense, we found that a number of PAMP-induced genes are
potentially involved in these processes. Table 2-2B contains 28 PAMP-induced genes
that may have a role in cell wall modification or polarized secretion. Among these 28
genes are a large number of genes encoding putative hydrolase enzymes that may
potentially play a role in reorganizing the structure of the cell wall during papilla
formation. Additionally, 4 genes encoding proline-rich and hydroxyproline-rich
glycoproteins are induced by PAMPS. Seven putative peroxidases are induced which may
be involved in the oxidative cross-linking of proteins and polymers into the papilla
structure. The peroxidase AT P24a (At5g39580) was previously shown to be upregulated
during the RPP4 and RPP8-mediated resistance responses to the oomycete pathogen
Peranaspora parasitica (Eulgem et al., 2004). Consistent with a role in oxidative cross-
linking in the cell wall, all of these peroxidases are predicted to enter the secretory
pathway by TargetP (www.cbs.dtu.dk/services/TargetP).

Strikingly, 3 genes encoding potential components of the secretory pathway are
upregulated by PAMP perception. Two members of the RabA family of small GTPases,
RABA I a and RABA I e, were induced by PAMPS. Rab proteins are a class of small

GTPases that also function in vesicle trafficking and regulate vesicle docking. Based on

57

 

 

 

 

 

work in
post-go
from p
membl
(At3gf
su‘ount
also St
EXOT
treatm
induce
these ;
defen:

may ;

work in mammalian and yeast systems, this class of Rabs is predicted to participate in
post-golgi vesicle trafficking (V emoud et al., 2003). Additionally, two RabA isoforrns
from pea were suggested to have a role in delivery of cell wall components to the plasma
membrane (Nagano et al., 1995). Also, a member of the EXO70 family of proteins
(At3g55150) was upregulated in response to PAMPS. EXO70 family proteins are
subunits of the exocyst protein complex which is required for exocytosis in yeast and is
also suggested to play a role in docking of exocytotic vesicles (Cole et al., 2005). The
EXO70 family member was previously found to be upregulated in response to flg22
treatment (Zipfel et al., 2004), however, RABAIa and RABA 1e represent novel PAMP-
induced genes with functions related to secretion. Taken together, the upregulation of
these genes supports a role for targeted vesicle trafficking in the Arabidopsis basal
defense response to bacteria and identifies candidate secretory pathway components that

may play a role in secretion of papilla components or other defense-related compounds.

58

Table 2-2: Selected PAMP- induced Arabidopsis genes. The average fold changes of
each treatment compared to the mock control are shown. The hrpA, E. coli and DC3000
treatments were 7 hours post inoculation (HPI) with 1x108 bacteria/mL, while the COR
hrpS treatment was at 10 HPI with 5x107 bacteria/mL. (A) Transcription factors induced
by PAMP perception. (B) Genes encoding proteins known or predicted to be involved 1n
cell wall modification or secretion. Lines within tables denote cutoff for PAMP-induced
genes that are repressed or not significantly induced (less than 1.5-fold) by Pst DC3000.
Genes below the line are also induced by DC3000. Grey shading indicates genes
previously identified as induced by the bacterial PAMP flagellin.

A

Average Fold Change

Array

E.
Element AGl Desert tlon h A COR'h S coll DC3000

     

             

 

254231 _af A14923810;'A1WRK¥534 ‘- ”'1' ' ' .5"? 1" Z 5, 2.09 "’ 2764 .. 2.00 30.56“
267385_ at 1112944380 CHP—rl'ch zincfingerprotein putative: v . ~” 0 ‘_ ~ , 4.39 2.70 :. 4.00 '-6.06_,-_,
246993_ at A15g67450l AZF1CysZ/His2-typezincfingerprotein‘1 " n - .- ‘ ,1 2.96 ' 4.49 g 2.58 5 370,1
354159181. M9242LAMRWL 5 .5 4-6.x-” -f -55 . a. 42.70-125.58 421.48-232.51
255596_at At4gO1720 AtWRKY47 2.30 3.03 2.09 -2.58

   

   

25554731 At 01920 DC1 domain protein. similar to CHP-rich ' 1.55 2.41 1.38 -2.46

264616_ at AtZg17740 CHP- rich zinc fingeL protein, puta_t_ive 9.40 7461 J 579 -1. 38_1

 

255568:_at:A14901250 Ammo/2‘2 - : 1" “1'3—f :— 5.92 252 5.40 -1. 07 1
263797_ at Atzgzaszo AtWRKY17. .. f - ' " i . 276 .. 3,..03 3.25 1.00 3
2483.056 5apAt5052830-MNRKX27. 5 -5 5.- ' .5 5.14.459. 25.46;. 459511.11.
260783_ at At1gO6160 ERF subfamily ERF/APZtranscription factor family. 3.91 1.32 1.38 1.41
249690 at A15922570 AtWRKY36 5 5 1.41 4.19 1.62 1.48
25575’3_ at’ 1811916570" AMY§51 myb family trgpscription faotor T _ T ‘ 2.46 ‘— 274 :209 '1255
257919_ at 2113923250; AtMYB15rnyb fa'milytranscription faotor ~ . " 5.66 A. 2.64 2.96 1.74 ”t
25348.5. of 614931800 A'tWRKYte ' 5 . _‘ 1.78 2 3.17 . 1.62 200 ‘
12.59153131_615515¢_3_95AMRKY§;2 .5 :-;:_..5 55-- .- . - _- .5 .-.-_..$2.9- 54922-5. 5.7.9.. 2.52.”
267588_ at At2942060 CHP-rich zinc finger protein, putative 6.81 7.46 4.81 2. 58
260432 __at At1_g68150 AtWRKYQ fl - 713 3 65 4 39 3. 25
1251948581 7111527730. AIZAItOsalttoleranceztncfinaflrpmtem_ _.-.5 2.00- 55 -230 755.246 5.882..
246214_ at At4936990 AtHSF4 putative heat sh66k transcription_ factor 6 _-...... 317 .5. 6.17 2. 70 6. 81_ "
245252_at—At4912500-A15RF'1ewbnemsponsefaotoria f“ 2 '~ 2.565 5- 1.29 200 10.06;
245976_at A15g13060 AtWRKY75 7.29 3.17 3.73 11.56
DREB subfamily A5 of ERF/APZ transcription factor
252214_at At3g§0260 family. 1.87 2.56 1.78 13.30
267140_at A12938250 putative GT-1-Iike transcription factor 3.17 2.05 2.52 13.93
247264_at At5964530 no apical meristem (NAM) family protein 2.70 6.20 3.56 30.55

59

Table 2-2 (cont’d).

 

 

 

 

 

B
Avergge Fold Change
Array E.
Element 1 AG! n 4r“ -_ Description . hrpA COR ths coll DC3000
355524.9QM902339 hypothetical protein. jimilartopedinesterase . . 5. - .325. .8 3. 73......r 2.90.. 6.40 .i
245052,” at At2926449mput91ive pectinesteragg .__--5 “___ .5 _________4 _1 k2.__14___2_.96__1.74 __-_2_. 41
WW2!) .mmuymmma5 5--- .11.-.. 5.... 25.70.... “891:8”..4228-8
247954_ at At5_956870 hbeta-galactosidase. putative/lactase putative W . . 2. _‘24 _ 1. 23 4 2 70 M52129”.
3555M A14901700 dunnasa.puiauye,slmilartopeanuuypeii61111111858 _ 3. 03,-5.5 8.06 2.84 8.59....
264669_ at At1909630 AtRABA1a Rab small GTPase 1.70 2.24 1.52 -1.52
259173 61 _At6gO6640 AtGLUC beta g_urcosidase_ .5.-- .--. .._...-..-...- ".1595...- 8389.1... "1. 74 -1.48
£59_4fi__t_At_110__2360 _ehitinaeefltativL555555 555.555 _55 _5 3.25 ”5,454.43 3517 «1.45;.-
253099_ at At4g37530 peroxidase putative .- ‘1.“ .91 2.19 . 2.14 M31. .05
551832.61. 858885158 mmubitiamzo mm... . 5. .1428... “.583.- 9:19 .8802;
354.943.23.88481-991959890.51! M52999 far-119185.991” tame-9.9199989. 53-69 - 97?... .859- 51.92...-
1260556_at At2943620 glycosyl hydrolase family 19 (chitinase) ' 1.29 6.35 1.55 1.07
i“ glycosyl hydrolase family 81; similar to beta-glucan-elicitor -'
:246532_at A15915870 receptor 2.35 2.46 2.30 1.10
26549981 mmwoJMM9lueoawamteLase5-555 - 552.245 5314625 .1. 15 -.
254468_ at A14920460 ugff-glucose 4-epimerase-like grotein _ 3.73 2 30 3. 25 1.18
247327.318105954126 poiaxiaasq. putative. .. .8. 5. .5... .5 . .. 3.03 - 3.40 2858. 1.67::
254673_at At4918430 AtRABA1e RAB GTPase 4.81 4.49 2.76 1.70
254262_at A14923470 hydroxyproline-rich giycoprotein family protein 1.32 2.52 1.35 2.14
264960_ at Attg76930 AtEXT1/4 Extensin hydroxyproline-rich glycoprotein 1.59 2.76 1.38 2.14
255111__ _a_t At4908780wperox1dase putative_ .__-___..." _ _.- 5..- “J _3262____ _6. 82 ___1. ”91 2. 60
AWL Wehmpmlinefimmnfl; - . .- .. - 4.81..- _._.3. 98;:4888: 2._89.
proline-rich extensin-Iike family protein contains extensin-
259553__ at A11921310 like region; 55- 5 _W V HEM -__ ___ __ 666.656; _ 3.76 “6:26 _4 636 --
261474_ at At1g14540 anionic peroxidase Similar to Iignin forming peroxidase 6.35 5.66 6.35 3.32 1
249489.61A15838588M248mmase -8..- _ -.._...- 8.1.85 .....919 ...8.7Z..A3.9...8
245148_ at 65132945229” _pectinestergse Lamilyw pr_otei11_ ______ 5--.--- 6.29. 5 3.40 4.70 4.92 _
247467-81 1615682159 66888681768116de dommmimnwotem 53 25 2 76 a 03 81.988
246228_at At4936430 peroxidase. putative 11.06 3.40 11.5 8.98
255110_at At4908770 peroxidase, putative 54.44 9.40 14.5 24.82

60

Flagellin does not contribute uniquely to PAMP-induced transcriptional changes.

Given the substantial overlap of the PAMP-induced genes identified by our
microarray analysis with genes previously identified as induced by the synthetic flagellin
peptide flg22 (131 of 347 PAMP-induced genes), we sought to determine the specific
contribution of flagellin to the induction of these genes. To determine if perception of
flagellin makes a specific contribution to the transcriptional changes observed in
Arabidopsis afier bacterial inoculation, we compared the expression profiles of
Arabidopsis plants inoculated with fliC mutant derivatives of Pst hrpA and E. coli
OlS7:H7 to those of plants inoculated with the parent strains. fliC mutants are impaired
in the production of the flagellin protein. Therefore, this comparison allows us to
determine the specific contribution of flagellin perception to PAMP-induced
transcriptional changes.

A fliC mutant of E. coli OlS7:H7 was not available; therefore, a fliC mutant of
the 01 57:H7 derivative strain TUV86-2 was used. To validate the use of this strain, we
performed microarray analysis to compare the expression profiles of plants inoculated
with E. coli 01 57:H7 or E. coli TUV86-2 and found that the expression profiles of these
plants were highly similar (data not shown). The expression profiles of the 347 PAMP-
induced genes from plants inoculated with fliC mutant bacteria were similar to those
inoculated with the parental, flagellin-producing strains (Figure 2-1). The correlation
values for the Pst hrpA vs mock and Pst hrpA fliC vs mock comparisons is 0.93, and for
the E. coli vs mock and E. colifliC vs mock comparisons. it is 0.97. Consistent with the
similarity apparent in the clustering analysis and the calculated correlation, we found that

only 20 genes were reproducibly regulated more strongly by the flagellin-producing

61

strains than by the fliC mutant derivatives (Table 2-1). No genes were regulated more
strongly by E. coli 01 57:H7 than by the fliC mutant derivative. However, when we
compared the expression profile of plants inoculated with Pst hrpA fliC to mock
inoculation, we found that using our selection criteria 377 fewer genes were reproducibly
regulated by hrpA fliC than by hrpA (Table 2-1). This is a result of our stringent selection
criteria as genes were regulated similarly, but not as robustly, by Pst hrpA fliC. This
suggests that, at least in the case of hrpA, flagellin perception may make a quantitative
contribution to the PAMP-induced regulation of transcription. However, this quantitative
contribution is relatively minor as only 9 genes were reproducibly induced at least 2-fold
more strongly by the flagellin-producing hrpA strain than by hrpA fliC (Table 2-1). These
results suggest that although perception of flagellin induces transcriptional changes in
Arabidopsis, flagellin does not make a substantial unique contribution to the PAMP-
induced transcriptional changes observed after bacterial inoculation. Arabidopsis can
perceive other PAMPS such as LPS and EF-Tu and our results suggest that perception of
flagellin induces transcriptional changes that overlap almost completely with those
induced by other PAMPS. Consistent with these results, multiplication of fliC mutants of
Pst DC3000 and hrpA in Arabidopsis after vacuum-infiltration is similar to that of the
flagellin-producing parent strains (Figure A-3). These results suggest that although
flagellin may make a minor quantitative contribution to PAMP-induced transcriptional
changes, it is only one of multiple PAMPS recognized by plants and that different PAMPS
induce overlapping plant responses to bacteria within leaf tissue. The recent finding from
Zipfel et al. that multiplication of Pst DC3000 is enhanced afier inoculation by dipping,

but not after inoculation by vacuum-infiltration suggests that perception of bacterial

62

 

 

 

 

.Anal

hrpS
kxel
indut
5x10
th
TOge
gene

rEguf

flagellin may make a unique contribution to defenses effective on the surface of the leaf,
but does not make a unique contribution to elicitation of defenses when bacteria are

infiltrated directly into the leaf intercellular spaces. Our data support this notion.

Analysis of the TTSS- and COR-regulated genes

To put the results of the PAMP gene regulation in perspective relative to a
virulent pathogen capable of causing disease, and to identify host genes regulated by Pst
hrp-dependent TTSS effectors and COR toxin, we examined host gene expression using
wild-type Pst DC3000 and the virulence compromised mutants Pst COR' and Pst COR'
hrpS at both low (1x106 bacteria/mL) and moderately high (5x107 bacteria/mL) inoculum
levels (Table 2-1). Overall, we observed that relatively equal numbers of repressed and _
induced genes were identified in each comparison examined, with the exception of the
5x107 bacteria/mL Pst COR— vs mock and Pst COR' vs Pst COR' hrpS comparisons
which identified approximately twice as many repressed genes as induced genes.
Together the 5x107 and 1x106 datasets identified 2,439 host genes with Pst-responsive
gene expression. Hierarchical cluster analysis of these 2,439 reproducibly differentially
regulated genes is shown in Figure 2-2. Of these 2,439 genes, 1,027 (42%) were
reproducibly differentially expressed in both datasets (Table 2—1; Figure 2-2). Inspection
of Figure 2-2 illustrates that even though 1,412 of the genes were not contained in the
lists of differentially regulated genes for both datasets (because they failed to surpass the
selection criteria in both cases), many were regulated in a similar way. The overall
reproducibility between the independent biological replicates is evident as indicated by

the uniformity of the gene expression changes within the 3 biological replicates of each

63

comparison (Figure 2-2). COR toxin was a potent regulator, inducing or repressing the
expression of 944 genes 24 HPI (Table 2-1 Row 4). The COR-induced genes comprise
approximately 60% (597/101 8) of the reproducibly induced genes (Figure 2-2 clusters A1
and A2, Table 2-1), while only 347 genes are COR toxin repressed (Table 2-1). By
comparing the samples inoculated with 5x107 Pst COR' and COR'hrpS bacteria/mL (to
minimize bacterial population differences), a total of 791 genes exhibiting hrp/FT SS
effector-dependent regulation were identified (Table 2-1, Row 11). These two strains lack
COR and allow the identification of hrp/FT SS effector-dependent regulated genes, in the
absence of the effect of COR toxin. Two hundred and seventy five of these genes
exhibited hrp/Tr SS effector-dependent induction (Table 2-1; Figure 2-2, cluster B).
Upon visual inspection of Figure 2-2, it is clear that many of the differentially expressed
genes are coordinately regulated in response to Pst DC3 000 and the Pst COR' mutant
(repressed by both strains or induced by both strains compared to the mock control),
while other sets of genes are regulated in opposing directions. This result illustrates the
importance of using both hrp and COR' mutant bacterial strains in discerning the specific
effects of TTSS effectors and COR on host gene expression.

Independent validation of the microarray expression data was pursued using RNA
blot analysis. A total of 12 repressed and 13 induced genes were selected and cDNA
probes for each gene were used for RNA blot hybridization. The results are shown in
Figure A-l. The RNA samples used for blot analysis were from independent biological
samples (different from those used for Affymetrix chip hybridization) and included a
time-course following inoculation with 1x106 bacteria/mL. The results confirmed the

expression patterns observed with the microarray and illustrate well that genes

64

 

 

 

differem
early as

[163111161

 

 

 

 

differentially expressed 24 HPI in our microarray experiments may exhibit changes as
early as 6 hours and/or continue to be differentially expressed until at least 36 hours after

treatment.

65

5x107 bacteria/mL 1x10‘5 bacteria/mL
A B C D E F G H I

-5“.- ,

‘7
1.

$577

«’17.... ‘

'Ir

1’

W.,!

 

  
 

‘7 whiff" a J :1}:de

1‘. ll
1
I
_I

82

q
I

7' 1;?

 

I J‘s-IA rein.

 

Figure 2-2: The expression profile of the 2439 A rabidopsis genes reproducibly regulated
by 1 x106 and/or 5x107 Pst bacteria/mL is shown. Treatments: A- corhrpS V mock; B- cor
v mock; C- cor v corhrpS; D- corhrpS v mock; E- cor v mock; F- cor v corhrpS; G-
DC3000 v cor; H- DC3000 v mock; G— DC3000 v corhrpS.

66

Impact of Pst pathogenesis on host metabolism

An advantage of global gene expression profiling is the comprehensive view it
can provide concerning the transcriptional regulation of genes involved in all aspects of
plant physiology. In order to take advantage of this large dataset, we utilized MapMan to
visualize how Pst pathogenesis impacted the expression of genes involved in various host
metabolic pathways and processes (Thimm et al., 2004; Usadel et al., 2005). Some of the
most dramatic global differences are illustrated in MapMan’s metabolism overview map
displaying the 944 COR toxin regulated genes and 791 hrp-regulated genes. The most
obvious bias within the COR-regulated genes is the induction of many genes involved in
secondary metabolism (Figure 2-3A). Genes that encode enzymes in the
phenylpropanoid, terpanoid, anthocyanin and glucosinolate pathways are all COR-
induced (Figure 2-3A, Figure A-4). This result is consistent with recent data
demonstrating that J A and other jasmonates induce the expression of numerous genes
which encode enzymes involved in secondary metabolism (Sasaki-Sekimoto et al., 2005;
Taki et al., 2005). In contrast, hrp-dependent TTSS effectors are responsible for the
repression of cell wall genes, particularly pectin esterases, as well as fatty acid
biosynthesis (in the chloroplast) and a dramatic overall repression of photosynthesis
(Figure 2-3B). Many genes encoding chloroplast localized proteins involved in
photosynthesis and the Calvin cycle as well as genes involved in photorespiration and

tetrapyrrole synthesis are repressed by TTSS effectors (Figure 2-3B).

67

Figure 2-3
trelabolisr
COR toxir
HI’I. lxlO'
I gates iden

Mlcfiam

Ftpressed.

 

 

 

 

 

Figure 2-3: COR toxin and type III effectors target different aspects of plant
metabolism. (A) The MapMan ‘Metabolism Overview’ display created using the 944
COR toxin-regulated genes identified from the Pst DC3000 vs Pst COR" comparison (24
HPI, 1x106 bacteria/mL) is shown. (B) The display created using the 791 hrp-regulated
genes identified from the Pst COR' vs Pst COR' hrpS comparison (10 HPI, 5x10
bacteria/mL) is shown. The average fold change of the 3 biological replicates is displayed
as illustrated in the fold change color bar in the lower right of each panel (note red is
repressed, blue is induced).

68

Fig

 

 

 

 

 

Figure 2-3

noz

22.0.8..— .358m .3!

 

. ulu

2% 2.22

 

0:0 3:2.

2° Metabollsm

Llplds

Cell wall

69

T...
.t A

oAvU.‘
3:9130 .09:-
.Dbo

.
I‘a
f-l‘-

 

50:3:
010

 

 

Figure 2-3 (cont’d).

 

 

2° Metabollsm

2235:. 5565 6:!

 

Llplds

20.5%.“:

poo—3:095

Cell wall

010 3:2.

70

Coronatine activates JA responses and secondary metabolism

Analysis of the data has also uncovered that Pst challenge significantly targets
several plant hormone signaling and stress-response pathways. The expression patterns
observed for some genes involved in plant hormone signaling and stress responses are
displayed in Figure 2-4. Consistent with the results from an analysis of the effects of
purified COR in tomato (U ppalapati et al., 2005), known J A/COR toxin responsive genes
including chlorophyllase (CLHI/CORII At1g19670; Benedetti et al., 1998; Tsuchiya et
al., 1999) and COR13 (At4g23600; Lopukhina et al., 2001) were induced 24 HPI in a
coronatine-dependent manner. Interestingly, 4 genes encoding enzymes involved in
jasmonate biosynthesis (LOXZ At3g45140, AOS At5g42650, AOCI At3g25760 and
0PR3 At2g06050; Bell et al., 1995; von Malek et al., 2002; Schaller et al., 2000) are also
COR toxin induced, suggesting activation of not only jasmonate responses but the host
biosynthesis of jasmonates as well.

As suggested by the analysis using MapMan, host secondary metabolism is
activated by COR toxin including the induction of the PAP] transcription factor
(At1g56650), a regulator of secondary metabolism including the production of
anthocyanin pigments (Borevitz et al., 2000). As expected, CHS (At5g13930) and a
putative anthocyanidin synthase (At2g3 8240) and UDP- anthocyanidin transferase
(At4g27570) are strongly induced (Figure 2-4). The expression of PALI (At2g37040)
involved in phenylpropanoid biosynthesis and GSTFI 1 (At3g03190) also displayed
COR-dependent induction, consistent with their observed overexpression in PAP]
activation-tagged plants (Borevitz et al., 2000). Several other genes involved in

Phenylpropanoid metabolism also exhibited reproducible induction (F5H2 At5g04330,

71

 

 

 

4(19 .
others

A1595

 

confli.

linalo
shill:
4). 1}:

metal

 

 

4CL9 At1g20510 and Eli3-2/CAD-BZ At4g37990), but somewhat surprisingly, numerous
others were repressed (PAL3 At5g04230, F 5H1 At4g36220, 4CL1 Atl g51680, COMTI
At5g54160 and CAD] At4g39330; Gachon et al., 2005). The physiological impact of this
conflicting differential regulation on lignin biosynthesis is unclear.

Two genes encoding enzymes putatively involved in terpenoid biosynthesis (S-
linalool synthase At1g61 120 and T P503 At4g16740) and DHSI, the first enzyme of the
shikimate pathway (At4g39980; Keith et al., 1991) are induced by COR toxin (Figure 2-
4). The shikimate pathway produces precursors for the synthesis of numerous secondary
metabolites as well as chorismate for the production of aromatic amino acids. One
metabolic pathway coordinately regulated is that of tryptophan (Trp) biosynthesis. Pst
coordinately induces three genes that encode enzymes that convert chorismate to Trp
(Figure A-5). Phosphoribosyl anthranilate isomerase (PAII /PA12 At1g07780/At5g05590,
both represented by probe set 259770_s_at; He and Li 2001) is induced in a COR toxin-
dependent way, while ASAI (At5g05730; Niyogi and Fink 1992) and ASBI/ASBZ
(Atl g25220/At5g57890; Niyogi et al., 1993) are induced by both COR toxin and TTSS
effectors (Figure A-S). The coordinated induction of these genes is consistent with the
induced expression of A TR] (AtMyb34 At5g60890) and AT R2 (At5g46760) that are
known to activate Trp and glucosinolate production in Arabidopsis(Ce1enza et al., 2005;
Smolen et al., 2002). Since the tryptophan pathway activators ATRI and A TR2 are COR
toxin induced, we examined whether other genes which encode enzymes in this pathway
were differentially regulated, but did not meet our stringent selection criteria. Indeed, 5
genes, PAT (At5g17990) T SA] (At3g54640) TSBI/TSBZ (At5g54810/At4g27070;

Radwanski etal., 1995) IGPS (At2g04400; Li et al.,1995) and a tryptophan sysnthase

72

 

 

 

a1. 30|
{011ml
pain“
cama

Figur

1m
by C
tori:

“til

beta-like gene (At5 g3 8530) were also induced following bacterial inoculation (Figure A-
5). Tryptophan is likely being used as a substrate for the production of glucosinolates,
and 1AA, since CYP79BZ (At4g39950; Zhao et al., 2002), CYP79B3 (At2g22330; Zhao et
al., 2002), and NIT 3 (At3g44320; Vorwerk et al., 2001) are reproducibly induced
following inoculation with 1x106 bacteria/mL Pst DC3 000 bacteria. The tryptophan
pathway may also potentially contribute to the accumulation of the phytoalexin
carnalexin since PAD3 is a known Pst induced gene (At3g26830; Zhou et al., 1999;
Figure A-S). The synthesis of methionine-derived glucosinolates is also implied since
CYP79F1/CYP79F2 (At1g16400/At1g16410; Chen et al., 2003; Reintanz etal., 2001;
Tantikanjana et al., 2004), and AOP2 (At4g03060; Kliebenstein et al., 2001) are induced
by COR toxin. The expression pattern displayed in Figure A-S also illustrates how COR
toxin and TTSS effectors can both synergistically induce the expression of some genes

while antagonistically regulating the expression of other genes.

73

Figure 2-4: Pst coordinately regulates hormone and stress response genes. The
expression profile for 57 genes following Pst inoculation is shown. See Figure l legend
for a description of the gene expression display. Gene annotation is listed on the right
with background shading delineating a relationship to known pathways or responses.
Orange- JA or COR toxin inducible, yellow-JA biosynthesis, red-secondary metabolism,

green-ABA and abiotic stress response, violet-SA and defense responses, and blue-basal
defense.

74

 

 

 

Figure 2-4

1x108 5x107 1x106
ABCDE‘FGH IJKLM

40 30 20151.015 2.0 6:0

   

At1g19640 JMT1 JA Methyl Transferase
At2924850 TAT3 Tyrosine Amino Transferase
At3911480 BSMT1 Benzoic acid and SA Methyl
Transferase
At1919670 CLHi/CORH Chlorophyilase
At1952400 BLGL1 Beta Glucosidase
At5924780 VSP1 Vegetative storage protein
At3g16470 JR1 JA wounding responsive 1
At4923600 CORI3 COR-induced tyrosine aminotransferase
At4g15440 HPL Hyperoxide Lyase CYP74BZ
At5944420 PDF1.2 Defensin
At3945140 LOX2 13-Lipoxygenase
At5942650 AOS Allene oxide synthase
At3925760 AOC1 Allene oxide cyclase
At2906050 OPR3 12-OxoPhytodienoate-10,1 1-Roductase
At1956650 PAP1 MYB75 R2R3 transcription factor
At5913930 CHS Chalcone Synthase
At2938240 putative anthocyanidin synthase
At1961129 S—linalool synthase
At4g16740 TPSO3 terpenoid synthase
At4927570 anthocyanidin-a-gluooside
mamnosyitransferase

1At4939980 onsr DHAP synthase

At2937040 PAL1 phenylalanine ammonia lyase

  

     
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
   
   

75

Pst induces ABA/abiotic stress response genes

COR toxin and, to some degree, TTSS effectors induce numerous ABA
responsive genes, including a significant number of genes implicated in ABA/abiotic
stress-responsive signaling (Figure 2-4; Bray 2002; F inkelstein and Rock 2002)./1811
(At4g26080; Leung et al., 1994) and A312 (At5g57050; Leung et al., 1997) are both
induced in the absence of COR toxin at the 5x107 bacteria/mL inoculum level, suggesting
that their expression is at least partly regulated by TTSS effectors (Figure 2-4). NCED3
(At3g14440; Iuchi et al., 2001), a 9-cis-epoxycarotenoid dioxygenase crucial for ABA
synthesis, is also induced following Pst COR' inoculation (Figure 2-4). NCED4
(At4g19170), a related family member, is repressed by virulent Pst DC3000 and Pst
COR' bacteria at the higher inoculum levels. A total of 6 transcription factors associated
with ABA and abiotic stress responses (HE-12 At3g61890, HB-7 At2g46680,
NAC3/ANAC055 At3g15500, RD26 ANAC072 At4g27410, ANAC019 At1g52890 and
MY C2/RDZZBPI At1g32640) are also induced by Pst infection (Figure 2-4) (Abe et al.,
2003; Fujita et al., 2004; Greve et al., 2003; Olsson et al., 2004; Soderman et al., 1996;
Tran et al., 2004). These results imply that ABA responses are being activated by Pst and

that both TTSS effectors and COR toxin are involved in this activation.

Defense response-related gene expression

Of particular interest is the role COR toxin and TTSS effectors have on SA-
mediated defenses since those responses are necessary for resisting pathogen attack.
Several SA-responsive genes involved in pathogen defense (EDS5 At4g39030, ICSI

Atlg74710, PAD4 At3g33960, EDS] At3g48090, and NIMIN-I At1g02450) were

76

induced in a hrp-dependent manner (Figure 2-4) (Falk et al., 1999; J irage et al., 1999;
Nawrath et al., 2002; Wildermuth et al., 2001; Weigel et al., 2005). The Pst-induced
expression of these genes is consistent with previous published results, but it was
somewhat surprising that their induction is enhanced between 1.5- and 20-fold by TTSS
effectors. The expression of these genes is either not reliably induced or induced 2-to-5-
fold by Pst COR'hrpS bacteria relative to the mock inoculated control in the 5x107
dataset. This suggests that the host plant is recognizing PAMPS present on the Pst COR’
hrpS mutant and potentially also recognizing specific TTSS effectors and activating
defense gene expression (Figure 2-4). Interestingly, COR toxin actually dampens by
approximately 4-fold the induction of at least one SA-related defense gene (NIMIN-I). In
the samples examined, the defense response genes AIGI (At1g33960; Reuber and
Ausubel 1996), and TONB (At2g32190; de Torres et al., 2003) are induced 6-to-20-fold.

In contrast to the induction observed for the previously discussed SA/defense-
related genes, virulent Pst bacteria repress three genes associated with basal defense
responses. F lagellin Sensitive 2 (FLSZ At5g46330) which is required for the perception
of the PAMP flagellin is repressed by both COR toxin and TTSS effectors at high
inoculum concentrations (Figure 2-4) (Gomez-Gomez etal., 1999; Zipfel et al., 2004).
The F lagellin induced Receptor Kinase 1 (FRKI Atl g19l90; Asai et al., 2002; de Torres
etal., 2003) and WRKY22 (At4g01250; Asai et al., 2002) are induced by E. coli, Pst hrpA
and Pst COR'hrpS mutant bacteria at high inoculum levels and that induction is blocked
by TTSS effectors in the Pst COR" mutant (Figure 2-4). COR toxin produced by Pst

DC3000 also contributes to the repression of FRKI , WRKY22 and FLSZ expression at the

77

1x106 inoculum level. These results are consistent with the idea that TTSS effectors and

COR toxin contribute to pathogenesis by suppressing basal defense responses.

Expression of auxin and cytokinin-related genes are altered during Pst infection

It is clear that Pst virulence systems are modulating stress hormone response
pathways (JA, SA and ABA), but plant host physiology also appears to be experiencing
specific shifts in auxin and cytokinin responses as well. Thirty-one auxin-related genes
are repressed while 13 other genes are induced following Pst inoculation (Figure A-6). In
most cases the gene regulation appears to be partially dependent on both COR toxin and
TTSS effectors. A few genes are also reproducibly differentially regulated in response to
bacterial PAMPS present on E. coli and nonpathogenic strains of Pst as well. The 31
repressed genes include 4 A UX/LAA and 18 SA UR (Small Auxin Up-Regulated) genes, 6
auxin transporters (PIN3 Atl g70940, PIN4 At2g01420, PIN 7 Atl g23080, A UXI
At2g38120, LAX] At5g01240, and LAX3 Atl g77690) and ARF18 (At3g61830) (Hagen
and Guilfoyle, 2002; Okushima et al., 2005; Swarup et al., 2004). AUX/1AA genes are
rapidly induced by auxin and are hypothesized to act in a feedback loop repressing the
auxin response signaling pathway (Tiwari et al., 2004). Five SA UR genes, three 1AA-
amino acid hydrolases (ILRI At3g02875, ILL5 At1g51780 and ILL6 Atl g44350), 3 [AA-
arnido synthases (DFL2 At4g03400, GH3.3 At2g23170 and GH3.12 At5g13320), IAA18
(At3g16500) and NIT 3, are induced. NIT3 will synthesize 1AA (Figure A-SB) while
IAA-arnino acid hydrolases and arnido synthases convert 1AA between an amino acid
conjugate and free form (Staswick et al., 2005). Taken together, these results suggest that

Pst is impacting host auxin signaling, potentially de-repressing the pathway, altering

78

auxin movement and activating biosynthesis of the hormone. These results are consistent
with the observation that Pseudomonas syringae strains express biosynthetic enzymes
that can produce 1AA from tryptophan (Buell et al., 2003; Glickmann et al., 1998). Pst
DC3000 has been shown to elicit the accumulation of [AA in Arabidopsis leaves during
infection and that activation of this pathway contributes to disease susceptibility
(O’Donnell et al., 2003).

Auxin and cytokinin are involved in many important aspects of plant growth and
development. Pst pathogenesis appears to not only target auxin signaling but also genes
involved in cytokinin accumulation and signaling. Seven type A response regulators
(ARR4, 5, 6, 7, 9, I 5 and ARR16; D’Agostino et al., 2000; To et al., 2004) are repressed
by COR toxin following inoculation with 1x106 Pst DC3000 bacteria/mL (Figure A-7).
The other type A family members had low expression in the samples tested and in most
cases were scored as absent (data not shown). One type B response regulator (ARR14
At2g01760) was repressed by Pst, but in this case repression appears to be dependent on
TTSS effectors and not COR toxin. None of the other type B family members were
reproducibly differentially regulated. Cytokinin synthesis is mediated by the isopentenyl
transferase gene family, one member of that family; IPT3 (At3g63110) is COR toxin
repressed (Kakimoto 2003a, Miyawaki et al., 2004). Two cytokinin oxidase genes (CKX4
At4g29740, CKX5 Atl g7 5450; Werner et al., 2003) are induced by TTSS effectors and
COR toxin respectively. The repression of IPT3 together with CKX4 and CKX5 induction
suggests a reduction in the levels of cytokinin within the leaves following inoculation.
The type A response regulators are known to be rapidly induced by cytokinin and their

repression would be consistent with a fall in the cytokinin levels. Members of the type A

79

response regulator family appear to be negative regulators of cytokinin signaling and may
be part of feedback loop repressing induced responses (Kakimoto 2003b; To et al., 2004).
The coordinated repression of this gene family suggests that cytokinin signaling may be

de-repressed by Pst during infection.

Conclusion

Although the Arabidopsis-Pst DC3 000 interaction was initially developed as a
model for studying disease resistance mechanisms (Whalen et al., 1991), this
pathosystem is now also used widely for studying susceptible plant-pathogen interactions
(N omura et al., 2005). A comprehensive transcriptional analysis of this interaction using
defined Pst DC3000 virulence mutants, we thought, would provide the community a
valuable resource for future understanding of this interaction at whole plant, tissue,
cellular, and molecular levels. Indeed, this analysis revealed several interesting results.
First, it appears that Arabidopsis plants respond similarly to PAMPS presented on live
human and plant pathogenic bacteria, and that flagellin perception is not necessary for the
regulation of PAMP-induced genes or bacterial multiplication in the context of Pst
DC3 000 infection of Arabidopsis under our experimental conditions in which bacteria are
infiltrated directly into the leaf intercellular spaces. We found that an impressive number
of PAMP-induced genes belong to transcription factors, signaling components, and cell
wall- and/or secretion-associated proteins, suggesting coordinate regulation of genes
involved in signaling and secretion with those that encode secreted products during basal
defense. Second, use of Pst DC3000 mutant strains deficient in COR toxin (PstDC3118)

or COR and the TTSS (the hrpS COR' mutant) enabled us to obtain genome-wide

80

knowledge of both distinct and overlapping effects of these two important virulence
factors in modulating host gene expression during actual bacterial infection. There is
clear evidence for TTSS effector-mediated suppression of basal defense-associated genes.
In contrast, many of the SA-regulated defense genes, including some of those associated
with basal defense, are induced by TTSS effectors. The most dramatic effect of COR is
the induction of J A-regulated genes, as expected, but COR also appears to exert a major
impact on the expression of genes involved in secondary metabolism. Finally, both TTSS
effectors and COR contribute to the dramatic regulation of genes that are responsive to
plant hormones, such as auxin, ABA, and cytokinin.

We hope that the results described in this paper and the online supplemental
materials will facilitate future study of Pst DC3000 pathogenesis in Arabidopsis using a

variety of genomic, cell biology, and biochemical approaches.

Acknowledgements

We gratefully acknowledge Annette Thelen and the Genomic Technology
Support Facility at Michigan State University for valuable assistance with the Affymetrix
microarray analysis, Dr. Thomas Whittam (Department of Microbiology, Michigan State
University) and Dr. Arlette Darfeuille-Michaud (Pathogenic Bacterienne Intestinale,
Clermont-Ferrand, France) for providing E. coli strains, and Dr. Thomas Whittam for
providing lab space for work with human-pathogenic bacteria. Arabidopsis EST clones
used for RNA blot hybridization were obtained from the Arabidopsis Biological
Resource Center. This work was supported by research grants from the US Department of

Energy (DE-FG02-91ER20021) and National Institutes of Health (1 R21A1060761 -01)

81

to S.Y.H., a postdoctoral fellowship to RT. from the US Department of Agriculture, a
US Department of Education GAANN Graduate Fellowship and a Michigan State
University Plant Science Graduate Fellowship to W.U., and funds from the Center of

Microbial Pathogenesis at Michigan State University to S. Y. H. and Thomas Whittam.

82

References

Abe, H., Urao, T., Ito, T., Seki, M., Shinozaki, K. and Yamaguchi-Shinozaki, K. (2003)
Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional
activators in abscisic acid signaling. Plant Cell, 15, 63-78.

Asai, T., Terra, G., Plotnikova, J ., Willmann, M.R., Chiu, W., Gomez-Gomez, L., Boller,
T., Ausubel, F.M. and Sheen, J. (2002) MAP kinase signaling cascade in Arabidopsis
innate immunity. Nature, 415, 977 - 983.

Assaad, F.F., Huet, Y., Mayer, U., and Jiirgens, G. (2001). The cytokinesis gene KEULE
encodes a See] protein that binds the syntaxin KNOLLE. J. Cell Biol. 152, 531—543

Assaad, F.F., Qiu, J ., Youngs, H., Ehrhardt, D., Zimmerli, L., Kalde, M., Wanner, G.,
Peck, S.C., Edwards, H., Ramonell, K., Somerville, CR. and Thordal-Christensen, H.
(2004) The PEN] syntaxin defines a novel cellular compartment upon fungal attack and
is required for the timely assembly of papillae. Mol. Biol. Cell, 15, 5118-5129.

Bell, E., Creelman, RA. and Mullet, J.E. (1995) A Chloroplast lipoxygenase is required
for wound-induced jasmonic acid accumulation in Arabidopsis. Proc. Natl. Acad. Sci.
USA, 92, 8675-8679.

Bender, C.L., Alarcon-Chaidez, F. and Gross, DC. (1999) Pseudomonas syringae
phytotoxins: Mode of action, regulation, and biosynthesis by peptide and polyketide
synthetases. Microbiol. Mol. Biol. Rev. 63, 266—292.

Benedetti, C.E., Costa, C.L., Turcinelli, SR. and Arruda, P. (1998) Differential
expression of a novel gene in response to coronatine, methyl jasmonate, and wounding in
the C011 mutant of Arabidopsis. Plant Physiol. 116, 1037-1042.

Benedetti, C.E., Xie, D. and Turner, J .G. (1995) C011 -dependent expression of an
Arabidopsis vegetative storage protein in flowers and siliques and in response to
coronatine or methyl jasmonate. Plant Physiol. 109, 567 -572.

Berin, M.C., Darfeuille-Michaud, A., Egan, L.J., Miyamoto, Y. and Kagnoff, M.F.
(2002) Role of EHEC Ol 57:H7 virulence factors in the activation of intestinal epithelial
cell NF-KB and MAP kinase pathways and the upregulated expression of interleukin 8.

Cell. Microbiol. 4, 635-647.
Bestwick, C. S., Bennett, M. H. & Mansfield, J. W. (1995) Hrp mutant of Pseudomonas

syringae pv. phaseolicola induces cell wall alterations but not membrane damage leading
to the hypersensitive reaction in lettuce. Plant Physiol. 108, 503-516.

83

Borevitz, J .O., Xia, Y., Blount, J ., Dixon, RA. and Lamb, C. (2000) Activation tagging
identifies a conserved MYB regulator of phenylpropanoid biosynthesis. Plant Cell, 12,
23 83-2393.

Bray, EA. (2002) Abscisic acid regulation of gene expression during water deficit stress
in the era of the Arabidopsis genome. Plant, Cell and Environ. 25, 153-161.

Brooks D.M., Hernandez-Guzman G., Kloek A.P., Alarcon-Chaidez F., Sreedharan A.,
Rangaswamy V., Penaloza-Vazquez A., Bender CL. and Kunkel B.N. (2004)
Identification of a well-defmed series of coronatine biosynthetic mutants of Pseudomonas
syringae pv. tomato DC3000. Mol. Plant Microbe Interact. 17, 162-174.

Buell, C.R., Joardar, V., Lindeberg, M. et al. (2003) The complete genome sequence of
the Arabidopsis and tomato pathogen Pseudomonas syringae pv. tomato DC3000. Proc.
Natl. Acad. Sci. USA, 100, 10181—10186.

Celenza, J .L., Quiel, J .A., Smolen, G.A., Merrikh, H., Silvestro, A.R., Norrnanly, J. and
Bender, J. (2005) The Arabidopsis ATRl Myb transcription factor controls indolic
glucosinolate homeostasis. Plant Phys. 137, 253-262.

Chang, J .H., Urbach, J .M., Law, T.F., Arnold, L.W., Hu, A., Gombar, S., Grant, S.R.,
Ausubel, F.M. and Dangl, J .L. (2005) A high-throughput, near-saturating screen for type
III effector genes from Pseudomonas syringae. Proc. Natl Acad. Sci. USA, 102, 2540-
2554.

Chen, S., Glawischnig, E., Jorgensen, K., Naur, P., Jorgensen, B., Olsen, C.E., Hansen,
C.H., Rasmussen, H., Pickett, J .A. and Halkier, BA. (2003) CYP79F1 and CYP79F2
have distinct functions in the biosynthesis of aliphatic glucosinolates in Arabidopsis.
Plant J. 33, 923-937.

Cole, R.A., Synek, L., Zarsky, V. and Fowler, J .E. (2005) SEC8, a subunit of the putative
Arabidopsis exocyst complex facilitates pollen germination and competitive pollen tube
growth. Plant Physiol. 138, 2005-2018.

Collins, N.C., Thordal-Christensen, H., Lipka, V., Bau, S., Kombrink, E., Qiu, J .L.,
Huckelhoven, R., Stein, M., F reialdenhoven, A., Somerville, SC. and Schulze-Lefert, P.
(2003) SNARE-protein-mediated disease resistance at the plant cell wall. Nature, 425,
973-977.

Colhner, A., Lindeberg, M., Petnicki-chieja, T., Schneider, DJ. and Alfano, J .R.
(2002) Genomic mining type III secretion system effectors in Pseudomonas syringae
yields new picks for all TTSS prospectors. Trends Microbiol. 10, 462-469.

D'Agostino, I.B., Deruere, J. and Kieber, J .J . (2000) Characterization of the response of
the Arabidopsis response regulator gene family to cytokinin. Plant Physiol. 124, 1706-
1717. '

84

de Torres, M., Sanchez, P., Femandez-Delmond, I., and Grant, M. (2003). Expression
profiling of the host response to bacterial infection: the transition from basal to induced
defense responses in RPMl-mediated resistance. Plant J. 33, 665-676.

Devoto, A., Nieto-Rostro, M., Xie, D., Ellis, C., Harrnston, R., Patrick, E., Davis, J.,
Sherratt, L., Coleman, M. and Turner, J .G. (2002) C011 links jasmonate signaling and
fertility to the SCF ubiquitin-ligase complex in Arabidopsis. Plant J. 32, 457—466.

Diener, AC. and Ausubel, F .M. (2005) RESISTANCE T0 F USARIUM OXYSPORUM 1,
a dominant Arabidopsis resistance gene, is not race specific. Genetics, 171, 305-321.

Eisen, M.B., Spellman, P.T., Brown, PC. and Botstein, D. (1998) Cluster analysis and

display of genome-wide expression patterns. Proc. Natl. Acad. Sci. USA, 95, 14863-
14868.

Eulgem, T., Weigman V.J., Chang, H., McDowell, J .M., Holub, E.B., Glazebrook, J .,
Zhu, T. and Dangl, J .L. (2004) Gene expression signatures from three genetically
separable resistance gene signaling pathways for downy mildew resistance. Plant
Physiol, 135, 1 129-1 144.

Falk, A., Feys, B.J., Frost, L.N., Jones, J .D., Daniels, MJ. and Parker, J.E. (1999)EDS1,
an essential component of R gene-mediated disease resistance in Arabidopsis has
homology to eukaryotic lipases. Proc. Natl. Acad. Sci. U S A, 96, 3292-3297.

Felix, G., Duran, J .D., Volko, S. and Boller, T. (1999) Plants have a sensitive perception
system for the most conserved domain of bacterial flagellin. Plant J. 18, 265-276.

Feys, B.J.F., Benedetti, C.E., Penfold, ON. and Turner, J.G. (1994) Arabidopsis mutants
selected for resistance to the phytotoxin coronatine are male sterile, insensitive to methyl
jasmonate, and resistant to a bacterial pathogen. Plant Cell, 6, 7 51-759.

Finkelstein, RR. and Rock, CD. (2002) Abscisic acid biosynthesis and response. In The
Arabidopsis Book (Meyerowitz, E. M. and Somerville, C. R., eds). American Society of
Plant Biologists, Rockville, MD, USA, DOI 10.1199/tab.0058.

Fonts, D.E., Abramovitch, R.B., Alfano, J.R., Baldo, A.M., Buell, C.R., Cartinhour, S.,
Chatterjee, A.K., D'Ascenzo, M., Gwinn, M.L., Lazarowitz, S.G., Lin, N.C., Martin,
G.B., Rehm, A.H., Schneider, D.J., van Dijk, K., Tang, X. and Coller, A. (2002)
Genomewide identification of Pseudomonas syringae pv. tomato DC3 000 promoters
controlled by the HrpL alternative sigma factor. Proc. Natl. Acad. Sci. USA, 99, 2275-
2280.

85

Fujita, M., Fujita, Y., Maruyama, K., Seki, M., Hiratsu, K., Ohme-Takagi, M., Tran, L.S.,
Yamaguchi-Shinozaki, K. and Shinozaki, K. (2004) A dehydration-induced NAC protein,

RD26, is involved in a novel ABA-dependent stress-signaling pathway. Plant J. 39, 863-
876.

Gachon, C.M., Langlois-Meurinne, M., Henry, Y. and Saindrenan, P. (2005)
Transcriptional co-regulation of secondary metabolism enzymes in Arabidopsis:
functional and evolutionary implications. Plant Mol. Biol. 58, 229-245.

Glickmann, E., Gardan, L., Jacquet, S., Hussain, S., Elasri, M., Petit, A. and Dessaux, Y.
(1998) Auxin production is a common feature of most pathovars of Pseudomonas
syringae. Mol. Plant Microbe Interact. 11, 156-162.

Gomez-Gomez, L. and Boller, T. (2000) FLS2: An LRR receptor-like kinase involved in
the perception of the bacterial elicitor flagellin in Arabidopsis. Mol. Cell, 5, 1003-1011.

Greenberg, J .T. and Vinatzer, BA. (2003) Identifying type III effectors of plant
pathogens and analyzing their interaction with plant cells. Curr Opin Microbiol. 6, 20-28.

Greve, K., La Cour, T., Jensen, M.K., Poulsen, F.M., and Skriver, K. (2003). Interactions
between plant RING-H2 and plant-specific NAC (N AM/ATAF 1/2/CUC2) proteins:
RING-H2 molecular specificity and cellular localization. Biochem. J. 371, 97—108.

Gunzer, F., Bohn, U., Fuchs, S., Muhldorfer, 1., Hacker, J ., Tzipori S. and Donohue-
Rolfe, A. (1998) Construction and characterization of an isogenic slt-ii deletion mutant of
enterohemorrhagic Escherichia coli. Infect. Immun. 66, 2337-2341.

Guo, F.Q., Okamoto, M. and Crawford, NM. (2003) Identification of a plant nitric oxide
synthase gene involved in hormonal signaling. Science, 302, 100-103.

Hagen, G. and Guilfoyle, T. (2002) Auxin-responsive gene expression: genes, promoters
and regulatory factors. Plant Mol. Biol. 49, 373-385.

Halachmi, N., and Lev, Z. (1996) The Secl family: a novel family of proteins involved in
synaptic transmission and general secretion. J. Neurochem. 66, 889-897.

Hauck, P., Thilmony, R. and He, S.Y. (2003) A Pseudomonas syringae type III effector

suppresses cell-wall based extracellular defense in susceptible Arabidopsis plants. Proc.
Natl. Acad. Sci. USA, 100, 8577-8582.

86

Hayashi, T., Makino, K., Ohnishi, M., Kurokawa, K., Ishii, K., Yokoyama, K., Han,

C.G., Ohtsubo, E., Nakayama, K., Murata, T., Tanaka, M., Tobe, T., Iida, T., Takami, H.,
Honda, T., Sasakawa, C., Ogasawara, N., Yasunaga, T., Kuhara, S., Shiba, T., Hattori, M.
and Shinagawa, H. (2001) Complete genome sequence of enterohemorrhagic Escherichia
coli OlS7:H7 and genomic comparison with a laboratory strain K-12. DNA Res. 8, 11-22.

He, S.Y., Nomura, K. and Whittam, S. (2004) Type 111 protein secretion mechanisms in
mammalian and plant pathogens. Biochim. Biophys. Acta. 1694, 181-206.

He, Y. and Li, J. (2001) Differential expression of triplicate phosphoribosylanthranilate
isomerase isogenes in the tryptophan biosynthetic pathway of Arabidopsis thaliana (L.)
Heynh. Planta, 212, 641-647.

He, Z.H., Cheeseman, 1., He, D., Kohorn, ED. (1999) A cluster of five cell wall-
associated receptor kinase genes, Wakl-S, are expressed in specific organs of
Arabidopsis. Plant Mol. Biol. 39, 1189-1196.

Hirano, SS. and Upper, CD. (2000) Bacteria in the leaf ecosystem with emphasis on
Pseudomonas syringae-a pathogen, ice nucleus, and epiphyte. Microbiol. Mol. Biol. Rev.
64, 624-653.

Iuchi, S., Kobayashi, M., Taji, T., Naramoto, M., Seki, M., Kato, T., Tabata, S.,
Kakubari, Y., Yamaguchi-Shinozaki. K. and Shinozaki, K. (2001) Regulation of drought
tolerance by gene manipulation of 9-cis-epoxycarotenoid dioxygenase, a key enzyme in
abscisic acid biosynthesis in Arabidopsis. Plant J. 27, 325-333.

Jin, Q., Thilmony R., Zwiesler-Vollick, J. and He, S.Y. (2003) Type 111 protein secretion
in Pseudomonas syringae. Microbes & Infect. 5, 301-310.

Jirage, D., Tootle, T.L., Reuber, T.L., Frost, L.N., Feys, B.J., Parker, J.E., Ausubel, F.M.
and Glazebrook, J. (1999) Arabidopsis thaliana PAD4 encodes a lipase-like gene that is
important for salicylic acid signaling. Proc. Natl. Acad. Sci. U S A, 96, 13583-13588.

Kakimoto, T. (2003a) Biosynthesis of cytokinins. J. Plant Res. 116, 233-239.

Kakimoto, T. (2003b) Perception and signal transduction of cytokinins. Ann. Rev. Plant
Biol. 54, 605-627.

Katagiri, F., Thilmony, R. and He, S.Y. (2002) The Arabidopsis thaliana-Pseudomonas
syringae interaction. In The Arabidopsis Book (Meyerowitz, E. M. and Somerville, C. R.,
eds). American Society of Plant Biologists, Rockville, MD, USA, DOI 10.1199-tab.0039.

Keith, B., Dong X.N., Ausubel, F.M. and Fink, GR. (1991) Differential induction of 3-

deoxy-D-arabino-heptulosonate 7-phosphate synthase genes in Arabidopsis thaliana by
wounding and pathogenic attack. Proc. Natl. Acad. Sci. USA, 88, 8821-8825.

87

Kliebenstein, D.J., Lambrix, V.M., Reichelt, M., Gershenzon, J. and Mitchell-Olds, T.
(2001) Gene duplication in the diversification of secondary metabolism: tandem 2-

oxoglutarate-dependent dioxygenases control glucosinolate biosynthesis in Arabidopsis.
Plant Cell, 13, 681-693.

Kloek, A.P., Verbsky, M.L., Sharma, S.B., Schoelz, J .E., Vogel, J ., Klessig, DR and
Kunkel, B.N. (2001) Resistance to Pseudomonas syringae conferred by an Arabidopsis
thaliana coronatine-insensitive (coil) mutation occurs through two distinct mechanisms.
PlantJ. 26, 509-522.

Kunze, G., Zipfel, C., Robatzek, S., Niehaus, K., Boller, T. and Felix, G. (2004) The N
terminus of bacterial elongation factor Tu elicits innate immunity in Arabidopsis plants.
Plant Cell, 16, 3496-3507.

Leung, J., Bouvier-Durand, M., Morris, P.C., Guerrier, D., Chefdor, F. and Giraudat, J.
(1994) Arabidopsis ABA response gene ABII : features of a calcium-modulated protein
phosphatase. Science, 264, 1448-1452.

Leung, J ., Merlot, S. and Giraudat, J. (1997) The Arabidopsis ABSCISIC ACID-
INSENSITIVE 2 (ABIZ) and ABII genes encode homologous protein phosphatases 2C
involved in abscisic acid signal transduction. Plant Cell, 9, 759-771.

Li, J., Chen, S., Zhu, L. and Last, R.L. (1995) Isolation of cDNAs encoding the
tryptophan pathway enzyme indole-3-glycerol phosphate synthase from Arabidopsis
thaliana. Plant Physiol. 108, 877-878.

Li, X., Lin, H., Zhang, W., Zou, Y., Zhang, J ., Tang, X. and Zhou J. (2005) Flagellin
induces innate immunity in nonhost interactions that is suppressed by Pseudomonas
syringae effectors. Proc. Natl. Acad. Sci. USA, 102, 12990-12995.

Lopukhina, A., Dettenberg, M., Weiler, E.W. and Hollander-Czytko, H. (2001) Cloning
and characterization of a coronatine-regulated tyrosine aminotransferase from
Arabidopsis. Plant Physiol. 126, 1678-1687.

Ma, S.W., Morris, V.L. and Cuppels, DA. (1991) Characterization of a DNA region
required for the production of the phytotoxin coronatine by Pseudomonas syringae pv.
tomato. Mol. Plant Microbe Interact. 4, 69-74.

Mittal, S. and Davis, KR. (1995) Role of the phytotoxin coronatine in the infection of
Arabidopsis thaliana by Pseudomonas syringae pv. tomato. Mol. Plant Microbe Interact.
8, 1 65-1 71 .

Miyawaki, K., Matsumoto-Kitano, M. and Kakimoto, T. (2004) Expression of cytokinin

biosynthetic isopentenyltransferase genes in Arabidopsis: tissue specificity and regulation
by auxin, cytokinin, and nitrate. Plant J. 37, 128-138.

88

Nagano Y., Okada Y., Narita H., Asaka Y. and Sasaki Y. (1995) Location of light-
repressible, small GTP-binding protein of the YPT/rab family in the growing zone of
etiolated pea stems. Proc. Natl. Acad. Sci. USA, 92, 6314-6318.

Navarro, L., Zipfel, C., Rowland, 0., Keller, 1., Robatzek, S., Boller, T. and Jones, J .D.
(2004) The transcriptional innate immune response to flg22. Interplay and overlap with

Avr gene-dependent defense responses and bacterial pathogenesis. Plant Physiol. 135,
1113-1128.

Nawrath, C., Heck, S., Parinthawong, N. and Metraux J .P. (2002) EDSS, an essential
component of salicylic acid-dependent signaling for disease resistance in Arabidopsis, is
a member of the MATE transporter family. Plant Cell, 14, 275-286.

Niyogi, K.K. and Fink, GR. (1992) Two anthranilate synthase genes in Arabidopsis:
defense-related regulation of the tryptophan pathway. Plant Cell, 4, 721-733.

Niyogi, K.K., Last, R.L., Fink, GR. and Keith, B. (1993) Suppressors of trpl
fluorescence identify a new Arabidopsis gene, TRP4, encoding the anthranilate synthase
beta subunit. Plant Cell, 5, 1011-1027.

Nomura, K., and He, S.Y. (2005) Powerful screens for bacterial virulence proteins. Proc.
Natl. Acad. Sci. USA, 102, 3527-3528.

Nomura, K., Melotto, M. and He, S.Y. (2005) Suppression of host defense in compatible
plant-Pseudomonas syringae interactions. Curr. Opin. Plant Biol. 8, 361-368.

Nl'ihse, T.S., Boller, T. and Peck, SC. (2003). A plasma membrane syntaxin is
phosphorylated in response to the bacterial elicitor flagellin. J. Biol. Chem. 278, 45248-
45254.

O'Donnell, P.J., Schmelz, B.A., Moussatche, P., Lund, S.T., Jones, J .B. and Klee, H.J.
(2003) Susceptible to intolerance--a range of hormonal actions in a susceptible
Arabidopsis pathogen response. Plant J. 33, 245-257.

Okushima, Y., Overvoorde, P.J., Arima, K., Alonso, J .M., Chan, A., Chang, C., Ecker,
J .R., Hughes, B., Lui, A., Nguyen, D., Onodera, C., Quach, H., Smith, A., Yu, G. and
Theologis, A. (2005) Functional genomic analysis of the AUXIN RESPONSE FACTOR

gene family members in Arabidopsis thaliana: unique and overlapping fimctions of
ARF 7 and ARF 19. Plant Cell, 17, 444-463.

Olsson, A.S., Engstrom, P. and Soderman, E. (2004) The homeobox genes AtHBIZ and

AtHB7 encode potential regulators of growth in response to water deficit in Arabidopsis.
Plant Mol. Biol., 55, 663-677.

89

Penaloza-Vazquez, A., Preston, G.M., Collmer, A., and Bender, CL. (2000) Regulatory
interactions between the Hrp type III protein secretion system and coronatine

biosynthesis in Pseudomonas syringae pv. tomato DC3000. Microbiology, 146, 2447-
2456.

Radwanski, E.R., Zhao, J. and Last, R.L. (1995) Arabidopsis thaliana tryptophan
synthase alpha: gene cloning, expression, and subunit interaction. Mol. Gen. Genet. 248,
657-667.

Reintanz, B., Lehnen, M., Reichelt, M., Gershenzon, J ., Kowalczyk, M., Sandberg, G.,
Godde, M., Uhl, R. and Palme, K. (2001) Bus, a bushy Arabidopsis CYP79F1 knockout

mutant with abolished synthesis of short-chain aliphatic glucosinolates. Plant Cell, 13,
351-367.

Reuber, TL. and Ausubel, F.M. (1996) Isolation of Arabidopsis genes that differentiate
between resistance responses mediated by the RPSZ and RPMl disease resistance genes.
Plant Cell, 8, 241-249.

Saeed, A.I., Sharov, V., White, J., Li, J ., Liang, W., Bhagabati, N., Braisted, J ., Klapa,
M., Currier, T., Thiagarajan, M., Stum, A., Snuffin, M., Rezantsev, A., Popov, D.,
Ryltsov, A., Kostukovich, E., Borisovsky, 1., Liu, Z., Vinsavich, A., Trush, V. and
Quackenbush, J. (2003) TM4: a free, open-source system for microarray data
management and analysis. Biotechniques, 34, 374-378.

Sasaki-Sekimoto, Y., Taki, N., Obayashi, T., Aono, M., Matsurnoto, F., Sakurai, N.,
Suzuki, H., Hirai, M.Y., Noji, M., Saito, K., Masuda, T., Takarniya, K-I., Shibata, D. and
Ohta, H. (2005) Coordinated activation of metabolic pathways for antioxidants and

defence compounds by jasmonates and their roles in stress tolerance in Arabidopsis.
Plant J. 44, 653-668.

Schaller, F., Biesgen, C., Mussig, C., Altmann, T. and Weiler, E.W. (2000) 12-
oxophytodienoate reductase 3 (OPR3) is the isoenzyme involved in jasmonate
biosynthesis. Planta, 210, 979-84.

Smolen, G.A., Pawlowski, L., Wilensky, SE. and Bender, J. (2002) Dominant alleles of
the basic helix-loop-helix transcription factor ATR2 activate stress-responsive genes in
Arabidopsis. Genetics, 161, 1235-1246.

Soderman, E., Mattsson, J. and Engstrom, P. (1996) The Arabidopsis homeobox gene
AtHB-7 is induced by water deficit and by abscisic acid. Plant J., 10, 375-381.

Staswick, P.E., Serban, B., Rowe, M., Tiryaki, 1., Maldonado, M.T., Maldonado, MC.

and Suza, W. (2005) Characterization of an Arabidopsis enzyme family that conjugates
amino acids to indole-3-acetic acid. Plant Cell, 17, 616-627.

90

Swarup, R., Kargul, J ., Marchant, A., Zadik, D., Rahman, A., Mills, R., Yemm, A., May,
S., Williams, L., Millner, P., Tsurumi, S., Moore, 1., Napier, R., Kerr, ID. and Bennett,
M.J. (2004) Structure-function analysis of the presumptive Arabidopsis auxin permease
AUXl. Plant Cell, 16, 3069-3083.

Taki, N., Sasaki-Sekimoto, Y., Obayashi, T., Aono, M., Matsumoto, F., Sakurai, N.,
Suzuki, H., Hirai, M.Y., Noji, M., Saito, K., Masuda, T., Takamiya, K-I., Shibata, D. and
Ohta, H. (2005) lZ-oxo-phytodienoic acid triggers expression of a distinct set of genes
and plays a role in wound-induced gene expression in Arabidopsis. Plant Physiol. 139,

1268-1283.

Tantikanjana, T., Mikkelsen, M.D., Hussain, M., Halkier, BA. and Sundaresan, V.
(2004) Functional analysis of the tandem-duplicated P450 genes SPS/BUS/CYP79F1 and
CYP79F2 in glucosinolate biosynthesis and plant development by Ds transposition-
generated double mutants. Plant Physiol. 135, 840-848.

Tao, Y., Xie, Z., Chen, W., Glazebrook, J ., Chang, H.S., Han, B., Zhu, T., Zou, G. and
Katagiri, F. (2003) Quantitative nature of Arabidopsis responses during compatible and
incompatible interactions with the bacterial pathogen Pseudomonas syringae. Plant Cell,
15, 317-330.

Thimm, O., Blasing, O., Gibon, Y., Nagel, A., Meyer, S., Kruger, P., Selbig, J., Muller,
L.A., Rhee, S.Y. and Stitt, M. (2004) MapMan: a user-driven tool to display genomics
data sets onto diagrams of metabolic pathways and other biological processes. Plant J. 6,
914-939.

Tiwari, S.B., Hagen, G. and Guilfoyle. TJ. (2004) Aux/1AA proteins contain a potent
transcriptional repression domain. Plant Cell, 16, 533-543.

To, J .P., Haberer, G., Ferreira, F.J., Deruere, J ., Mason, M.G., Schaller, G.E., Alonso,
J.M., Ecker, J .R. and Kieber, J .J . (2004) Type-A Arabidopsis response regulators are
partially redundant negative regulators of cytokinin signaling. Plant Cell, 16, 658-671.

Tran, L.S., Nakashima, K., Sakuma, Y., Simpson, S.D., Fujita, Y., Maruyama, K., Fujita,
M., Seki, M., Shinozaki, K. and Yamaguchi-Shinozaki K. (2004) Isolation and functional
analysis of Arabidopsis stress-inducible NAC transcription factors that bind to a drought-
responsive cis-element in the early responsive to dehydration stress 1 promoter. Plant
Cell, 16, 2481-2498.

Tsuchiya, T., Ohta, H., Okawa, K., Iwamatsu, A., Shimada, H., Masuda, T. and
Takamiya, K. (1999) Cloning of chlorophyllase, the key enzyme in chlorophyll
degradation: finding of a lipase motif and the induction by methyl jasmonate. Proc. Natl.
Acad. Sci. USA, 96, 15362-15367.

Turner, J.G., Ellis, C. and Devoto, A. (2002) The jasmonate signal pathway. Plant Cell,
14, $153-$164.

91

Tusher, V.G., Tibshirani, R. And Chu, G. (2001) Significance analysis of microarrays
applied to the ionizing radiation response. Proc. Natl. Acad. Sci. USA, 98, 5116-5121.

Ueda, T. and Nakano, A. (2002) Vesicular traffic: an integral part of plant life. Curr.
Opin. Plant Biol. 5, 513-517.

Uknes, S., Mauch-Mani, B., Moyer, M., Potter, 8., Williams, S., Dincher, 8., Chandler,
D., Slusarenko, A., Ward, E., and Ryals, J. (1992) Acquired resistance in Arabidopsis.
Plant Cell, 4, 645-656.

Uppalapati, S.R., Ayoubi P., Weng, H., Palmer, D.A., Mitchell, R.E., Jones, W. and
Bender CL. (2005) The phytotoxin coronatine and methyl jasmonate impact multiple
phytohorrnone pathways in tomato. Plant J. 42, 201-217.

Usadel, B., Nagel, A., Thimm, O., Redestig, H., Blaesing, O.E., Palacios—Rojas, N.,
Selbig, J ., Hannemann, J., Piques, M.C., Steinhauser, D., Scheible, W.R., Gibon, Y.,
Morcuende, R., Weicht, D., Meyer, S. and Stitt, M. (2005) Extension of the visualization
tool MapMan to allow statistical analysis of arrays, display of corresponding genes, and
comparison with known responses. Plant Physiol. 138, 1195-204.

Vemoud, V., Horton, A.C., Yang, Z. and Nielsen, E. (2003) Analysis of the small
GTPase gene superfamily of Arabidopsis. Plant Physiol. 131, 1191-1208.

von Malek, B., van der Graaff, E., Schneitz, K. and Keller, B. (2002) The Arabidopsis
male-sterile mutant dde2-2 is defective in the ALLENE OXIDE SYNTHASE gene

encoding one of the key enzymes of the jasmonic acid biosynthesis pathway. Planta, 216,
187-92.

Vorwerk, S., Biemacki, S., Hillebrand, H., Janzik, I., Muller, A., Weiler, E.W. and
Piotrowski, M. (2001) Enzymatic characterization of the recombinant Arabidopsis
thaliana nitrilase subfamily encoded by the N1T2/NIT1/NIT3-gene cluster. Planta, 212,
508-516.

Wan, J ., Dunning, F .M. and Bent AF. (2002) Probing plant-pathogen interactions and
downstream defense signaling using DNA microarrays. F unct. & Integr. Genomics, 2,
259-273.

Weigel, R.R., Pfitzner, U.M. and Gatz, C. (2005) Interaction of NIMINl with NPRl
modulates PR gene expression in Arabidopsis. Plant Cell, 17, 1279-1291.

Werner, T., Motyka, V., Laucou, V., Smets, R., Van Onckelen, H. and Schmulling, T.
(2003) Cytokinin-deficient transgenic Arabidopsis plants show multiple developmental
alterations indicating opposite functions of cytokinins in the regulation of shoot and root
meristem activity. Plant Cell, 15, 2532-2550.

92

Whalen, M.C., Innes, R.W., Bent, AF. and Staskawicz, B.J. (1991) Identification of
Pseudomonas syringae pathogens of Arabidopsis and a bacterial locus determining
avirulence on both Arabidopsis and soybean. Plant Cell, 3, 49-59.

Wildermuth, M.C., Dewdney, J ., Wu, G. and Ausubel, F.M. (2001) Isochorismate
synthase is required to synthesize salicylic acid for plant defense. Nature, 414, 562-565.

Xie, D.X., F eys, B.F., James, S., Nieto-Rostro, M. and Turner, J .G. (1998) C011 : an
Arabidopsis gene required for jasmonate-regulated defense and fertility. Science, 280,
1091 —1094.

Xu, L., Liu, F., Lechner, E., Genschik, P., Crosby, W.L., Ma, H., Peng, W., Huang, D.
and Xie, D. (2002) The SCF (COIl)ubiquitin-1igase complexes are required for
jasmonate response in Arabidopsis. Plant Cell, 14, 1919-1935.

Yang, B.J., Oh, Y.A., Lee, E.S., Park, A.R., Cho, S.K., Yoo, Y.J. and Park, OK. (2003)
Oxygen-evolving enhancer protein 2 is phosphorylated by glycine-rich protein 3/wall-
associated kinase 1 inArabidopsis. Biochem. Biophys. Res. Commun. 305, 862—868.

Yuan, J. and He, S.Y. (1996) The Pseudomonas syringae Hrp regulation and secretion
system controls the production and secretion of multiple extracellular proteins. J.
Bacteriol. 178, 6399-6402.

Zeidler, D., Zéihringer, U., Gerber, I., Dubery 1., Hartung, T., Bors, W., Hutzler, P. and
Dumer, J. (2004) Innate immunity in Arabidopsis thaliana: Lipopolysaccharides activate
nitric oxide synthase (NOS) and induced defense genes. Proc. Natl. Acad. Sci. USA, 101,
15811-15816.

Zhao, Y., Hull, A.K., Gupta, N.R., Goss, K.A., Alonso, J ., Ecker, J.R., Normanly, J.,
Chory, J. and Celenza, J .L. (2002) Trp-dependent auxin biosynthesis in Arabidopsis:
involvement of cytochrome P4503 CYP79B2 and CYP79B3. Genes Dev. 16, 3100-3112.

Zhao, Y. Thilmony, R., Bender, C.L., Schaller, A., He, S.Y. and Howe, GA. (2003)
Virulence systems of Pseudomonas syringae pv. tomato promote bacterial speck disease
in tomato by targeting the jasmonate signaling pathway. Plant J. 36, 485-499.

Zhou, N., Tootle, TL. and Glazebrook, J. (1999) Arabidopsis PAD3, a gene required for
carnalexin biosynthesis, encodes a putative cytochrome P450 monooxygenase. Plant
Cell, 11, 2419-2428.

Zipfel, C., Robatzek, S., Navarro, L., Oakeley, B.J., Jones, J .D.G., Felix, G. and Boller,

T. (2004) Bacterial disease resistance in Arabidopsis through flagellin perception.
Nature, 428, 764-767.

93

Chapter 3

A novel function for plant stomata in innate immunity against bacteria

Part of this chapter has been previously published in Cell.

Melotto, M., Underwood, W., Koczan, J ., Nomura, K., and He, S.Y. (2006) Plant stomata
function in innate immunity against bacteria] invasion. Cell, 126, 969-980.

I would like to acknowledge Dr. Maeli Melotto for contribution of figures 3-1, 3-6A-C,
3-7A, 3-8, 3-9, and 3-10 and for contributing data to figure 3-6D.

94

Abstract

Stomata are microscopic pores on the surface of plant leaves that allow the plant
to conduct gas exchange and regulate water relations. Plants regulate the opening and
closing of these pores through changes in turgor pressure within the guard cells, the pair
of cells that creates a single stomata. Stomata have been instrumental in the evolution of
land plants; however, such openings on the surface of the leaf can potentially render the
plant vulnerable to invasion by pathogenic microbes. This is particularly relevant for
bacterial pathogens that must enter the plant tissue to initiate pathogenesis and, unlike
many fungal plant pathogens, are generally unable to directly penetrate the cuticle and
cell wall. It has been assumed that stomata serve as passive ports of entry for bacteria,
allowing potential pathogens to freely enter the leaf intercellular spaces. However, in this
chapter I report that stomata play a role in plant innate immrmity by closing in response
to perception of bacteria on the leaf surface. Specifically, stomata of Arabidopsis
epidermal peels were found to close in response to both plant and human pathogenic
bacteria, and in response to purified PAMPS. Bacteria- and PAMP-induced stomatal
closure required ABA biosynthesis and components of the ABA signaling pathway.
Unlike human pathogenic bacteria, the plant pathogen Pseudomonas syringae pv. tomato
strain DC3 000 was able to re-open Arabidopsis stomata afier approximately three hours
of incubation with epidermal peels. Re-opening of stomata by Pst DC3000 was

dependent on production of the phytotoxin coronatine.

95

Introduction

Entry into host tissue is often a critical first step in the establishment of infection
by microbial pathogens. Foliar pathogens of plants face unique challenges in gaining
entry into the host tissue. The epidermis and cuticle of the plant leaf must be traversed by
microbial pathogens in order to gain access to the intercellular spaces and internal leaf
tissues. Many fungal plant pathogens have the ability to directly penetrate the epidermis
using cell wall-degrading enzymes, mechanical force, or both. Bacterial pathogens, on
the other hand, generally cannot directly penetrate the leaf epidermis and are thought to
enter leaf tissues through natural openings or accidental wounds on the leaf surface.

Stomata, microscopic pores on the surface of the plant leaf that allow the plant to
conduct gas exchange and regulate water relations, provide such natural openings into the
leaf intercellular spaces through which bacteria may potentially enter. It is generally
believed that openings on the leaf surface such as stomata serve as passive ports of entry
for bacteria. However, emerging evidence suggests that plants may have a defense
mechanism that acts at an early stage of pathogenesis such as entry into the host tissue.
Recent studies have demonstrated the ability of plants to perceive pathogen-associated
molecular patterns (PAMPS) such as bacterial flagellin and lipopolysaccharide (LPS) and
that perception of PAMPS contributes to resistance to the bacterial phytopathogen
Pseudomonas syringae pv. tomato strain DC3000 (Pst DC3000; Felix et al., 1999; Kunze
et al., 2004; Zeidler et al., 2004; Zipfel et al., 2004). Interestingly, resistance to Pst
DC3000 mediated by perception of flagellin by the FLS2 receptor was found to be
effective against bacteria that had been inoculated onto the leaf surface, mimicking a

natural infection, but not against bacteria that were artificially delivered into the leaf

96

tissue by vacuum-infiltration, bypassing the leaf surface (Zipfel et al., 2004). However,
the mechanism by which PAMP perception contributes to limiting bacterial infection on
the leaf surface is not yet known.

Pst DC3000 infects both tomato and Arabidopsis and is widely used a model to
study bacterial diseases of plants. Plant pathogenic bacteria such as Pst DC3000 have
evolved a variety of virulence factors that contribute to their ability to colonize their hosts
through subversion of host defenses or release of nutrients (Abramovitch and Martin,
2004; Nomura et al., 2005). The type III secretion system (TTSS) encoded by the hrp
genes of Pst DC3000 is one such virulence factor (Alfano and Collmer, 2004; Buttner
and Bonas, 2002; He et al., 2004; Mudgett, 2005; Staskawicz et al., 2001). Pst DC3000
uses the TTSS to inject a number of virulence effector proteins into host cells (Chang et
al., 2005; Collmer et al., 2003; Greenberg and Vinatzer, 2003; Nomura and He, 2005). In
addition to TTSS effector proteins, another virulence factor produced by Pst DC3 000, the
phytotoxin coronatine (COR), seems to be required for full virulence. COR is a
polyketide toxin that is structurally similar to the plant hormone jasmonic acid (JA).
Interestingly, bacterial mutants impaired in COR biosynthesis were found to be
significantly reduced in virulence when inoculated onto the surface of Arabidopsis
leaves, but fully virulent when infiltrated directly into the leaf intercellular spaces (Mittal
and Davis, 1995). This observation prompted the authors to speculate that COR may
suppress an “early” defense in Arabidopsis. The nature of this early defense, however,
has remained elusive.

In this study, plant stomata were found to play an active role in innate immunity

against bacteria. Stomata of intact Arabidopsis leaves and epidermal peals were found to

97

close in response to incubation with both plant- and human-pathogenic bacteria.
Interestingly, the closure was transient after incubation with the plant pathogen Pst
DC3000, but persistent after incubation with the human pathogen E. coli OlS7:H7. This
result suggests that plant pathogens, but not human pathogens, have evolved mechanisms
to overcome stomatal closure. We found that closure of stomata in response to bacteria or
purified PAMPS required ABA synthesis and components of the ABA signaling pathway
and that re-opening of stomata by Pst DC3000 was dependent on COR biosynthesis.
These results suggest that stomata function as innate immunity gates to restrict entry of
bacteria into plant tissues and that overcoming stomatal closure may be a key step

required for bacterial pathogenicity on plants.

Experimental Procedures

Plant Materials

Arabidopsis plants (ecotypes Col-0, Col-5, WS, Landsberg erecta [Ler] and
mutant lines derived from these ecotypes) were grown in controlled growth chambers at
22°C with a 12hr photoperiod under light intensities of 100 uE/mZ/s. For all experiments,
5- to 6-week-old plants were used. Two independent T-DNA lines of the fls2 mutant
(SAIL_691C4 and SALK_93905) were used for the experiments and they showed similar

responses to treatments.

98

Chemicals

Purified chemicals were used at the following concentrations: 10 uM abscisic acid
(ABA, Sigma), 0.2 mM L-NNA (Nto-nitro-L-arginine, Sigma), 0.5 ng/pl coronatine
(COR, purchased from C. Bender, Oklahoma State University), 100 ng/ul
lipopolysaccharide (LPS from P. aeruginosa, Sigma), 5 uM flg22 peptide (Alpha
Diagnostics, Inc. and EZBiolab) Chemicals were diluted in MES (2-(N-morpholino)-
ethanesulfonic acid) buffer (25 mM MES-KOH [pH 6.15] and 10 mM KCl), except for
LPS solution, which also contained 0.25 mM MgClz and 0.1 mM CaClz. Ultrapure LPS
preparations from E. coli 055:B5 (Sigma) and Salmonella Minnesota R595 (Re,
Calbiochem) were also tested with similar results. Concentrations of LPS, flg22, and
COR were chosen based on previous studies (Zeidler et al., 2004; Zhao et al., 2003;

Zipfel etal., 2004) and dose-response experiments.

Assessment of Response of Stomata to Treatments

To assure that most stomata were open before beginning experiments, we kept
plants under light (100 umol.m'2.s") for at least three hours. Fully expanded, young
leaves were immersed in water or bacterial suspension [108 colony forming units
(CFU).ml'l in water]. At various time points, epidermis of three leaves was peeled off
and immediately observed under a microscope (Zeiss Axiophot D-7082 photomicroscope
with A3 fluorescence cube or laser scanning confocal microscope). Alternatively,
epidermis was peeled from fully expanded leaves and placed on glass slides with the
cuticle side in contact with water, MES buffer (25 mM MES-KOH, pH 6.15, and 10 mM

KCl), chemical solutions in MES buffer or bacterial suspensions in water. At various

99

time points, pictures were taken of random regions. The width of the stomatal aperture
was measured using the software Image-Pro, version 4.5 for windows (Cybernetics, Inc.
Silver Spring, MD, USA). We found that stomata in intact leaves and epidermal peels
responded similarly to various treatments. All stomatal aperture results reported here
were from blind experiments, in which genotypes and treatments were unknown to the
experimenters who measured stomatal responses until the completion of experiments. All

experiments reported here were performed at least 3 times with similar results.

Detection of Nitric Oxide Production in Guard Cells

Epidermal peels of Arabidopsis plants were pre-incubated for 3 hr in MES buffer (25 mM
MES-KOH, pH 6.15, and 10 mM KCl), soaked in 15 uM DAF-2 DA (4,5-
diaminofluorescein diacetate, Sigma) diluted in MES buffer for 20 min, washed three
times in MES buffer, and then incubated with chemicals or bacterial suspensions. To
assess the COR effect on PAMP-induced NO production, peels were incubated with COR
for 30 min prior to addition of purified PAMPS. MES buffer was used as control for
purified chemicals and water was the control for bacterial suspensions. Photographs of
guard cells were taken with a digital camera attached to a fluorescence microscope

equipped with a 502-530 band pass filter.

Bacterial Growth Assay
Pst DC3000 and mutant derivatives were cultured at 30°C in Luria-Bertani (LB;
Sambrook et al., 1989) medium supplemented with appropriate antibiotics until an OD6oo

of 0.8 was reached. Bacteria were collected by centrifugation and resuspended in water

100

to the final concentration of 108 CFU.ml'l containing 0.05% Silwet L-77 (Osi Specialties,
Friendship, WV). Arabidopsis plants were dipped in bacterial suspension and kept under
high humidity until disease symptoms developed. Some plants were vacuum-infiltrated
with bacterial suspension at a concentration of 106 CF U.ml°1 containing 0.004% Silwet L-
77. Infiltrated plants were allowed to dry until leaves were no longer water soaked and
then covered with humidity domes until completion of the experiment. Bacterial
population in the plant apoplast was determined as previously described (Katagiri et al.,
2002). All bacterial multiplication assays reported here were performed at least 3 times

with similar results.

101

Results

Plant- and human-pathogenic bacteria induce closure of stomata

Plant stomata have the ability to respond to a variety of environmental stimuli
including light, humidity, and C02 concentration (Schroeder et al., 2001; Fan et al.,
2004). However, the presence of pores on the surface of the plant leaf could potentially
leave the plant vulnerable to invasion by bacteria. To determine if plant stomata can also
respond to the presence of live bacteria, we first treated intact Arabidopsis leaves with the
plant pathogen Pst DC3000. Prior to treatment, Arabidopsis leaves generally contained
70%-80% open stomata and 20%-30% closed stomata under our growth conditions. After
treatment of detached leaves with 1 x 108 cfu/ml Pst DC3000, we observed a marked
reduction in the number of open stomata, to ~30% after 2 hours of treatment (data not
shown). This reduction in the percentage of open stomata was correlated with a
significant decrease in the average width of the stomatal apertures (Figure 3-1A).
Observations and measurements of stomatal behavior are commonly performed using
epidermal peels rather than intact leaves. Epidermal peels allow stomata to be more easily
viewed and recorded microscopically. We therefore tested the ability of stomata in
Arabidopsis epidermal peels to respond to Pst DC3000 in a manner similar to those in
intact leaves. Afier 1 hour of incubation with 1 x 108 cfu/ml Pst DC3000, stomata in
epidermal peels of Arabidopsis leaves were found to behave similarly to those in intact
leaves (Figure 3-1B), therefore, epidermal peels were used for all subsequent

experiments.

102

In nature, plants are exposed to a variety of bacteria including highly adapted
pathogens such as Pst DC3 000, but also epiphytes that survive on the leaf surface and
even human or animal pathogens. To determine whether closure of Arabidopsis occurs as
a general response to a wide variety of bacteria or is limited to highly adapted plant-
pathogenic bacteria such as Pst DC3000, epidermal peels of Arabidopsis leaves were
incubated with Escherichia coli 01 57:H7. E. coli 01 57:H7 is an enteric human pathogen
that is often a causal agent of food poisoning associated with fresh fruits and vegetables.
Despite this association, E. coli 01 57:H7 is not a pathogen of plants and is unable to
multiply in plant tissues under normal growth conditions (Figure 3-2A). Stomata in
Arabidopsis epidermal peels closed after incubation with 1 x 108 cfu/ml E. coli 01 57:H7,
similar to the response to Pst DC3000 (Figure 3-2B). This result suggests that closure of
stomata is likely to be a generalized response to perception of a wide variety of bacteria.
Interestingly, however, unlike stomata in epidermal peels incubated with Pst DC3000,
stomata incubated with E. coli OlS7:H7 remained closed throughout the entire duration
of the experiment (8hrs; Figure 3-2B). This result suggests that the adapted plant
pathogen Pst DC3000 may have evolved a mechanism (or mechanisms) to overcome the
closure of stomata and gain access to the leaf intercellular spaces, whereas the human

pathogen lacks this ability.

103

 

2.5 —
A ‘ I Leaf/Water
g ‘ ILeaf/DCSOOO
E
3
t:
OJ
0.
<2:
.73
(U
E
.9
(I)
B
I Peel/Water
I Peel/DC3000

Stomatal Aperture (um)

 

Figure 3-1: Pst DC3000 triggers closure of Arabidopsis stomata. Stomatal aperture in
(A) intact leaves or (B) epidermal peels of Col-O plants exposed to water (red bars) or
1 x 108 cfu/ml Pst DC3000 (blue bars). Results in panel A are shown as mean (n = 120
stomata) :t SEM. In panel B and all subsequent experiments, results are shown as mean
(11 = 60 stomata) 1 SEM.

104

1.0E+06 1
l

i ICoI/E.co|i O157:H7
1.0E+05 4
i

1.0E+04 1‘

CFU/om2

1.0E+03 i
i
1.0E+02 ‘

 

0 2 4
Days Post Inoculation

5 ‘ IWater
IO1572H7

Stomatal Aperture (pm)

 

2h 4h 8h

Figure 3-2: (A) Multiplication of E. coli OlS7:H7 in Arabidopsis Col glI plants after
inoculation at 1 x 106 cfu/ml of bacteria. Error bars represent standard deviation.

(B) E. coli OlS7:H7 triggers persistent closure of Arabidopsis stomata. Stomatal
apertures in epidermal peels of Col-0 after incubation with water (green bars) or 1 x 108
cfu/ml E. coli OlS7:H7 (blue bars).

105

Involvement of PAMPs in triggering stomatal closure

Pathogen-associated molecular patterns (PAMPs) such as flagellin,
lipopolysaccharides and elongation factor Tu (EF-Tu) are perceived by plants and trigger
the plant’s innate immune response (Felix et al., 1999; Kunze et al., 2004; Zeidler et al.,
2004). Recognition of PAMPs has been shown to contribute to disease resistance (Kim et
al., 2005; Zipfel et al., 2004). However, the precise mechanisms triggered by PAMP
perception that lead to resistance to infection have not yet been discovered. The ability of
stomatal guard cells to respond to both plant- and human-pathogenic bacteria suggests
that these cells can sense conserved bacterial molecules such as PAMPs. To test the
involvement of PAMPs in bacteria-triggered stomatal closure, we incubated epidermal
peels from Arabidopsis Col-0 plants with the purified PAMPs flg22 (a biologically active
22 amino acid peptide derived from a highly conserved domain of eubacterial flagellin)
or LPS. We consistently observed a reduction in stomatal aperture after 1 hour of
incubation with purified PAMPs (data not shown) and the closure was persistent for at
least 4 hours of treatment (Figure 3-3A). Closure of stomata in response to the flg22
peptide was dependent on the FLSZ flagellin receptor, as stomata of fls2 mutant plants
did not close in response to treatment with flg22. However, LPS (Figure 3-3A) and live
E. coli OlS7:H7 bacteria (Figure 3-3B) were still able to induce stomatal closure on fls2
leaves. These results suggest that perception of flg22 by guard cells requires the flagellin
receptor FLSZ, but that F LSZ is likely only one of a number of pattern recognition
receptors that allow guard cells to perceive PAMPs and initiate closure. The involvement
of PAMPs and FLSZ in stomatal closure suggests that closure of stomata may be an

integral component of the Arabidopsis innate immune response to bacteria.

106

IMES

Stomatal Aperture (um)

 

Col-0 flsZ

Iwater
O157:H7

A
444

   

Stomatal Aperture (um)
N

Col-0 flsZ

Figure 3-3: (A) Purified PAMPs trigger closure of Arabidopsis stomata. Stomatal
apertures in epidermal peels of Arabidopsis Col-0 or flsZ mutant (SAIL_691C4) leaves
after 4 hours of incubation with MES buffer (red bars), 5 uM flg22 (blue bars),

or 100 ng/ul LPS (green bars). (B) Stomatal responses of wild type (Col-0) and flsZ
mutant (SALK_93905) plants to 1 x 108 chl E. coli OlS7:H7. Stomatal aperture
measurements were determined after 4 hours of exposure to bacteria.

107

ABA synthesis and signaling components are required for bacteria- and PAMP-
induced stomatal closure.

Closure of stomata in response to environmental cues and abiotic stresses has
been studied extensively and is dependent on the plant hormone abscisic acid (ABA). The
ABA signal in guard cells is transduced through a network of signaling components
including the protein phosphatase 2Cs ABIl and ABIZ, a guard cell-specific kinase,
OSTl, nitric oxide (N O), and H202 (Fan et al., 2004; Schroeder et al., 2001). The
signaling events triggered by ABA ultimately lead to regulation of ion channels, such as
the guard cell outwardly rectifying potassium channel GORKI , that modulate ion efflux
from the guard cells (Hosy et al., 2003). Ion efflux from the guard cells drives the efflux
of water and results in a change in guard cell turgor that causes the closure of the
stomatal pore. To determine if ABA synthesis and/or signaling are required for PAMP-
induced closure of stomata we tested a number of mutants defective in ABA synthesis or
signaling for their ability to close stomata in response to PAMP perception. The
Arabidopsis abaZ-I and aba3-I mutants are defective in ABA biosynthesis and impaired
in stomatal closure in response to abiotic stresses (Leon-Kloosterziel et al., 1996; Merlot
et al., 2002). Neither flg22 nor LPS could induce closure of stomata in epidermal peels
from either aba2-I or aba3-I plants (Figure 3-4A), demonstrating that PAMP-induced
closure of stomata requires ABA. To determine if PAMP-induced ABA signaling in
guard cells leading to stomatal closure proceeds through known components of ABA
signaling, we tested mutant plants defective in components of guard cell ABA signaling
pathways for their response to flg22 and LPS. The protein phosphatase 2C proteins

encoded by ABA Insensitive I (ABII) and ABIZ are required for stomatal closure in

108

response to ABA (Leung et al., 1997; Pei et al., 1997). Stomata of Arabidopsis abiI and
abi2 mutant plants failed to respond to purified flg22 or LPS (Figure 3-4B). Additionally,
the Arabidopsis mutants ostI (Mustilli et al., 2002), lacking a guard cell-specific kinase,
and gorkI (Hosy et al., 2003), lacking a guard cell outwardly rectifying potassium
channel, both failed to close stomata in response to LPS and 0st] failed to close in
response to flg22 (Figure 3-5). The response of gorkl to flg22 was not tested as the gorkI
mutation is in the WS genetic background that naturally lacks the FLSZ flagellin receptor.
Production of the small signaling molecules nitric oxide (N O) and hydrogen peroxide
(H202) has also been associated with ABA signal transduction leading to closure of
stomata (Fan et al., 2004; Schroeder et al., 2001). The NADPH oxidase double mutant
rbohD/F was previously shown to be partially impaired in ABA-induced stomatal closure
(Kwak et al., 2003). Similarly, this mutant showed an intermediate response to both flg22
and LPS (Figure 3-5). To test the involvement of NO in PAMP-induced stomatal closure,
we performed DAF-2 DA staining on epidermal peels treated with flg22, LPS, or MES
buffer to detect production of NO in guard cells. Treatment of epidermal peels with flg22
and LPS rapidly (within 10 min) induced production of NO in guard cells of stomata that
eventually closed (Figures 3-6B and 3-6C). Additionally, treatment of epidermal peels
with Nco-nitro-L-arginine (L-NNA), an inhibitor of nitric oxide synthase (NOS),
prevented closure of stomata in response to flg22, LPS, and E. coli 01 57:H7. Taken
together, these results clearly demonstrate that ABA synthesis and downstream signaling
components of the ABA signal transduction network in guard cells are required for

bacteria- and PAMP-induced stomatal closure.

109

 

  

A IMES
g lflg22
j; ILPS
S
t'
(D
Q.
<
.79
(U
E
.9.
(I)
Col-O aba2—1 aba3-1
B

A 4'5 1 IMES
E, 41 Ifl922
3; 3-5 1 ILPS
‘5 34,
E 2.5 7‘
< 24,
.79 1.54,
(U
e 11
(+5 0.5 4‘

o 1

Col-0 abi1-1 abi2-1

Figure 3-4: Stomatal responses in Arabidopsis ABA (A) biosynthetic mutants aba2 and
aba3, and (B) signaling mutants abi1-I and abi2—I . Stomatal aperture measurements
were determined after 4 hours of incubation with MES buffer (red bars), 5 uM flg22
(blue bars), or 100 ng/ul LPS (green bars).

110

I MES
I LPS
Ifl922

Stomatal Aperture (um)

 

Figure 3-5: Stomatal responses of Arabidopsis ABA response mutants 0st], gorkI, and
rbohD/F. Stomatal aperture measurements were determined after 4 hours of incubation
with MES buffer (red bars), 5 uM flg22 (blue bars), or 100 ng/ul LPS (green bars). Col-0
was wild-type for rbohD/F, Landsberg eracta (Ler) was wild-type for 0st] , and WS was
wild-type for gorkI . The response of WS and gorkI to flg22 was not tested as the WS
genetic background naturally lacks the FLSZ flagellin receptor.

111

 

S”
01
1

oo
o
I—l—l
l-—I-—|

N
or
H-I
H—l
TH
til-1
1+!

8
1+:
H—i

Stomatal Aperture (pm)
2; '5’

SD
01
I

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

.0
o

 

Figure 3-6: Involvement of nitric oxide (N O) in PAMP-induced stomatal closure. (A-C)
NO production in guard cells of Col-0 treated with MES buffer (A), 5 uM flg22 (B), or
100 ng/ul LPS (C). Brightfield images are displayed on the left, with fluorescent images
displayed on the right. NO production was not observed in the control treatment;
therefore, only a black screen was seen under the fluorescent microscope. (D) Effect of
the NOS inhibitor L-NNA (0.2mM) on stomatal closure induced by PAMPs (5 pM flg22
or 100 ng/ul LPS) or 1 x 108 cfu/ml E. coli OlS7:H7. L-NNA represents the control
treatment of L-NNA dissolved in MES for treatment with purified PAMPs whereas L-
NNA“ represents the control treatment of L-NNA dissolved in water for treatment with
E. coli. Stomatal aperture measurements were determined after 2 hours of treatment.

112

Pst DC3000 overcomes stomatal closure by production of the phytotoxin coronatine.
The observation that Pst DC3000 causes a transient stomatal closure (Figure 3-1),
whereas E. coli 01 57:H7 causes persistant closure of stomata (Figure 3-2B) suggests that
Pst DC3000 may have evolved a mechanism (or mechanisms) to overcome PAMP-
induced stomatal closure and that the non-plant-pathogen E. coli 01 57:H7 lacks this
ability. It is likely that Pst DC3000 encodes a virulence factor that can promote re-
opening of stomata that initially closed in response to PAMP perception. Pst DC3000 is
known to encode two well-characterized virulence factors: a TTSS that secretes a battery
of effector proteins, and the phytotoxin COR. To determine if either the TTSS or COR
are required for re-opening of stomata by Pst DC3 000 we examined stomatal responses
to mutants defective either in the TTSS (nonpolar hrcC”; Penaloza-Vazquez et al., 2000)
or in COR synthesis (cor'; Ma et al., 1991). The TTSS-deficient hrcC mutant was not
impaired in the ability to re-open closed stomata, behaving similarly to the wild-type Pst
DC3000 (Figure 3-7B). The cor' mutant, however, was unable to re-open stomata, similar
to E. coli 01 57:H7 (Figure 3-7A). Furthermore, purified COR at a concentration of 0.5
ng/ul could interfere with stomatal closure elicited by both flg22 and LPS (Figure 3-8A).
To determine if COR acts downstream of ABA or at an earlier stage in guard cell
signaling such as PAMP perception or initial signaling from PAMP receptors, we tested
the ability of COR to interfere with stomatal closure induced by exogenous ABA.
Stomata of epidermal peels pretreated with 0.5 ng/ul COR and subsequently incubated
with 0.5 ng/ul COR + 10 uM ABA failed to close (Figure 3-8B), suggesting that COR
acts downstream of ABA to interfere with stomatal closure. COR interference of ABA-

induced stomatal closure was not observed in the COR-insensitive Arabidopsis mutant

113

coil. COR did not effect production of NO in guard cells elicited either by ABA or
PAMPs (Figure 3-9), suggesting that COR acts downstream or independent of NO

synthesis.

114

 

a"

 

 

 

3 - DWater
I DC3000
I 0031 18

N
01
1
EH

N
l

A
l

 

Stomatal Aperture (pm)
8 5‘.

 

 

 

 

 

0

1h 3h

9"
O1
1

El Water
I hrcC

(um)

 

N
no:
IL

H—l

 

1.5

_k
____l__

 

Stomatal Aperture
O
in

 

 

j-

1h 3h

1”;

 

Figure 3-7: Stomatal responses to (A) cor' (DC3118) and (B) hrcC mutants of Pst
DC3000. Epidermal peels of Col-0 leaves were exposed to water (white bars in both
figures), or 1 x 108 cfu/ml Pst DC3000 (red bars), cor' mutant Pst DC31 18 (blue bars), or
TTSS-deficient hrcC. Stomatal aperture measurements were determined after 3 hours of
treatment.

115

  

 

E25
9 2
E
01.5
o.
< 1
530.5
E
2 0
(I)
go
B
E 3—
92.5—
% 2‘
0.1.5-
<
Te 1‘
to -
E05 II
.9 OJ
(0 (D a: < a: < 1:
a 8 i a it
< <
0‘.) m
< <
Col-0 coi1-20

Figure 3-8: Purified COR blocks both ABA- and PAMP-induced closure of stomata.
(A) Epidermal peels of Col-0 leaves were incubated with MES buffer, 5 uM flg22, or 100
ng/ul LPS with our without 0.5 ng/ul COR. Apertures were measured afier 3 hours of
treatment. (B) Epidermal peels of Col-0 or coil -20 mutant leaves were incubated with
MES buffer, 0.5 ng/ul COR, 10 M ABA, or 0.5 ng/ul COR + 10 M ABA. For COR +
ABA experiments, peels were pre-incubated with COR for 30 min. The COR solution
was then replaced with COR + ABA. Apertures were measured after 1 hour of treatment.

116

 

Figure 3-9: COR does not effect NO production in guard cells in response to ABA or
PAMPs. (A-B) Fluorescence micrographs of Col-0 epidermal peels incubated with 10
uM ABA (A) or 10 uM ABA and 0.5 ng/ul COR (B). (C-E) Brightfield (left) and
fluorescence (right) images NO production in guard cells of Col-0 epidermal peels
incubated with 0.5 ng/ul COR (C), 0.5 ng/ul COR + 100 ng/ul LPS (D), or 0.5 ng/ul
COR + 5 uM flg22 (E).

117

Biological relevance of stomatal closure in bacterial infection.

The observation that plant stomata close in response to live bacteria and purified
PAMPs compellingly suggests that closure of stomata may be an important component of
the plant innate immune response and provide a defense barrier against bacterial ingress.
However, for this to be the case, stomata must effectively restrict entry of bacteria into
the host tissue. Thus, it is important to demonstrate that closure of stomata plays a
biologically relevant role in restricting bacterial entry into the leaf and protecting the
plant from potential infection. To address this important question, we placed GFP-labeled
Pst DC3000 or cor' Pst DC3118 directly underneath an epidermal peel (with the cuticle
side in contact with the bacterial suspension) and examined the ability of the bacteria to
move through stomata and reach the upper surface of the peel. After 3 hours of
incubation, numerous GFP-labeled Pst DC3000 were observed in clusters on the upper
surface of Col-0 epidermal peels (Figure 3-10A). In contrast, very few cor' mutant
bacteria were observed on the upper surface of epidermal peels (Figure 3-10B). This
result directly demonstrates that PAMP-induced stomatal closure can effectively restrict
the movement of cor’ mutant bacteria through stomata and that COR-producing Pst
DC3000 can overcome stomatal closure and move through stomata.

To further test the relevance of PAMP-induced stomatal closure in the context of
bacterial infection of intact plants, we examined the ability of the cor' mutant to infect
Arabidopsis mutants defective in stomatal closure. When vacuum-infiltrated directly into
the apoplast of Arabidopsis Col-0 leaves, cor' mutants achieved a population level similar
to DC3000 after 3 days (Figure 3-11A). However, when inoculated on the surface of

leaves by dipping, multiplication of cor' mutants in wild-type Col-0 or Landsberg erecta

118

(Ler) leaves was significantly reduced compared to wild-type Pst DC3000 (Figure 3-
11B). These results suggest that the cor' mutant is defective in entering the leaf tissue, but
is fully virulent once inside the apoplast. Remarkably, cor' mutant bacteria were able to
achieve a population level similar to that of wild-type Pst DC3000 after surface
inoculation onto leaves of aba3 or 0st] Arabidopsis mutants, which are impaired in
PAMP-induced stomatal closure (Figure 3-11B). Taken together , these results suggest
that the primary virulence function of COR is to promote opening of stomata to allow
bacterial entry into the leaf intercellular spaces and that this COR-mediated suppression

of plant stomatal defense is critical for pathogenicity of Pst DC3000.

119

l—-t

'3“ pm

 

Figure 3-10: Movement of GFP-labeled (A) Pst DC3000 and (B) cor' Pst DC3118
through stomata of Arabidopsis Col-0 epidermal peels. Bacterial suspensions (1 x 107
cfu/ml) were placed in contact with the cuticle surface of epidermal peels. Microscopic
images show the relative number of bacteria (green) that moved through stomata to reach
the upper side of the peel after 3 hours of incubation.

120

CFU/cm2

CFU/crrf

Figure 3-1 1:
bars) in Col-0 afier vacuum-infiltration of 1 x 106 CFU/ml bacteria. (B) Multiplication of
Pst DC3000 and cor' Pst DC3118 in Arabidopsis Col-0 (red bars), ABA-deficient aba3-I
(blue bars), Landsberg erecta (grey bars), and ost1-2 (green bars), alter dipping in 1 x 108
CFU/ml bacterial suspensions. Col-0 is the wild-type control for aba3-1, Ler is the
control for ost1-2. Multiplication was assessed 3 days after inoculation. Error bars
represent standard deviation.

1.0E+08 —

 

   

   
   

I ocsooo
1.oa+o7 . I DC3118
10E+06-
105+05—
1oe+o4-
1.0E+03 —

Day 0 Day 3

1.0E+08 - I Col-0

l I aba3-1
1.0E+07 1 3 Le,

. tLZ
loeme— '”

1
10E+051

i
1.0E+04 f
1

1.0E+03 ‘

DC3118 DC3000

(A) Multiplication of Pst DC3000 (red bars) and cor' Pst DC3118 (blue

121

Discussion

In nature, plants encounter and interact with a wide variety of microbes. Many of
these microbes may be potential pathogens against which the plant must defend itself. In
recent years, a new view of plant defenses against microbes as a multi-tiered system
consisting of several layers of defense responses has begun to emerge. The defenses
associated with the hypersensitive response (HR) have received the most attention over
the past decade, however, the discovery that plants perceive PAMPs has led to an
increased appreciation for so-called innate immrmity. In this chapter I have presented
evidence for a new layer of innate immunity in plants. We found that stomatal guard cells
present on the surface of Arabidopsis leaves could sense the presence of live bacteria and
close to prevent bacterial entry into the leaf intercellular spaces. Prior to this discovery,
stomata were widely regarded as passive ports of bacterial entry into the host, allowing
bacteria to indiscriminately enter the plant. The emerging picture is that of a gauntlet of
layered plant defenses that must be overcome in order for bacteria to infect a host plant
and cause disease.

Pathogenic bacteria must live epiphytically on the leaf surface prior to entering
the leaf through wounds or stomata, and during this period, potential pathogens are likely
to encounter competition from other epiphytic microbes normally present on the surface
of the leaf. Relatively little is known about the initial stages of infection, when bacteria
transition from living epiphytically on the leaf surface to a pathogenic lifestyle within the
host plant. This is largely due to the use of artificial inoculation procedures in the
laboratory, such as vacuum-infiltration, that bypass this transition and introduce bacteria

directly into the leaf tissue. The discovery that stomata play a role in defense against

122

bacteria is likely to open up many new areas of inquiry. It is likely that potential bacterial
pathogens face challenges before and directly after entry into the host through stomata. A
recent discovery suggests that immediately upon entry through stomata, pathogenic
bacteria may be challenged with a battery of antimicrobial compounds in the substomatal
cavity. The Arabidopsis ATP-binding cassette (ABC) transporter encoded by
PEN3/PDR8 has been shown to contribute to penetration resistance against a number of
non-host fungi (Stein et al., 2006). Unexpectedly, Arabidopsis pen3 mutant plants were
found to be resistant to the normally virulent powdery mildew Erisyphe cichoracearum.
This resistance was correlated with chlorosis, cell death, and activation of the SA
pathway and was partially suppressed by a mutation at another locus called PEN2. PEN2
encodes a peroxisome-localized glycosyl hydrolase that the authors speculate is involved
in the synthesis of an antimicrobial compound that is subsequently exported by the ABC
transporter encoded by PEN3. A recent study suggests that PEN3 may also participate in
the response to bacterial pathogens and, strikingly, found that PEN3 was strongly and
constitutively expressed in the cells of the substomatal cavity (Kobae et al., 2006). This
result suggests that plants may have a second line of defense, in the form of secreted
antimicrobial compounds, waiting for those bacteria that can overcome stomatal
defenses.

In addition to the novel discovery of stomata as a relevant battleground for plant-
bacteria interactions, our results have also shed light on the mystery of the role of
coronatine in bacterial virulence. Our results demonstrate that COR is required for Pst
DC3000 to overcome stomatal defenses, as the cor‘ mutant was unable to re-open closed

stomata. Additionally, purified COR was sufficient to interfere with stomatal closure

123

induced by PAMPs and ABA. The observation that Arabidopsis mutants defective in
closure of stomata, such as aba3 and 0st], allow cor' mutant bacteria to achieve
population levels similar to wild-type Pst DC3000 suggests that the primary firnction of
COR in bacterial virulence is to overcome stomatal defenses. This finding provides an
explanation for the observation of Mittal and Davis (1995) over a decade ago that the cor'
mutant was defective in virulence when inoculated on the leaf surface, but not when
infiltrated directly into the leaf tissue. Our results demonstrate that the “early defense”
postulated by Mittal and Davis is stomatal closure. We did not observe a role for the
TTSS and associated effectors in re-opening stomata. Whether the TTSS contributes to
bacterial fitness and virulence prior to entering the leaf tissue or is only involved in
manipulating host cells after the bacteria have entered through stomata is not yet clear. It
will be interesting to determine if the genes encoding TTSS components are expressed on
the leaf surface and if the TTSS plays a role in virulence prior to bacterial entry.

Only five pathovars of P. syringae are known to produce COR. This raises the
question of whether stomatal closure is a general defense response conserved in a broad
range of plants, and if so, how other P. syringae pathovars overcome stomatal defense.
To begin to address these questions, Dr. Maeli Melotto tested the stomatal response of
tomato to Pst DC3000 and LPS and the response of tobacco to P. syringae pv. tabaci.
The response of tomato to both LPS and Pst DC3000 was similar to that of Arabidopsis
(Melotto et al., 2006). Additionally, P. syringae pv. tabaci, which does not produce COR,
induced closure of stomata initially but was able to re-open stomata at later timepoints
similar to Pst DC3000. These results suggest that stomatal closure may be a common

plant defense response initiated by perception of bacterial PAMPs and that coronatine is

124

only one of a number of virulence factors used by bacteria to overcome stomatal
defenses. Collectively, P. syringae pathovars produce a variety of phytotoxins and it will
be interesting to determine if any of these other toxins are also involved in the
suppression of stomatal defenses.

During the course of our observations, we noticed that in experiments where
leaves and epidermal peels were incubated with bacteria or purified PAMPs, a population
of stomata (generally 25-3 5%) remained open regardless of the treatment. The
concentrations of bacteria used were clearly high enough to coat the entire leaf surface
with bacteria and we would expect that the leaf surface was evenly exposed to the
purified PAMPs, therefore, it is somewhat unexpected that some stomata would remain
open in the presence of a stimulus that should elicit closure. Stomata are required to
respond to a number of stimuli including light, humidity, CO2 concentration, bacteria,
and the circadian clock. How these inputs are prioritized by guard cells and the
mechanisms of prioritization are unknown but are interesting and important questions for
future study. Plant leaves are generally colonized by epiphytes and potential pathogens,
therefore, stomata are likely to perceive bacteria on a regular basis. However, it is likely
that only a proportion of stomata are interacting with bacteria at any given time, allowing
other stomata to normally carry out their roles in regulating water relations and gas
exchange. It is interesting to note that most severe outbreaks of bacterial disease in crop
plants are associated with periods of heavy rain or high humidity. It is possible that,
under these environmental conditions, stomatal defenses are compromised due to the
plant’s need to prioritize stomatal responses to other stimuli, therefore allowing more

bacteria to enter the leaf tissue and promoting infection. Further experiments will be

125

needed to determine how plants prioritize guard cell signaling events initiated by multiple
external stimuli and whether stomatal defense against bacteria is compromised under
conditions of rain or high humidity.

Our results demonstrate that stomata close initially in response to PAMPs present
on the surface of Pst DC3000 and that Pst DC3 000 can re-open stomata after
approximately 3 hours. This observation clearly demonstrates a role for stomata in the
early stages of bacterial infection. However, the movements of stomata throughout the
entire course of infection have not yet been investigated. It is possible that stomata may
also play a role later in the infection process, permitting exit of bacteria from infected
leaves and spread to uninfected tissue or to other plants. It will be interesting to determine
the role of stomata throughout the entire disease cycle and to determine if COR or TTSS
effectors potentially play a role in modulating stomatal movements at later stages of
infection.

The results presented in this chapter reveal a novel aspect of plant innate
immunity against bacteria. Closure of stomata is likely to be an important, and potentially
first line of defense against foliar bacterial pathogens and may be a widespread defense
mechanism in vascular plants. Therefore, to be a successful foliar pathogen of plants,
bacteria must either possess mechanisms to counteract stomatal defenses, or rely on
environmental conditions under which stomatal defenses may be compromised in order
to enter plant leaves. The discovery of PAMP-induced stomatal closureas a defense
mechanism effective against bacterial plant pathogens and of COR as a suppressor of

stomatal defense represents a significant advance in our understanding of bacterial

126

pathogenesis of plants and opens up many new avenues for potential future research on

bacterial pathogenesis, guard cell signaling, and microbial ecology.

127

References

Abramovitch, RB, and Martin, GB. (2004). Strategies used by bacterial pathogens to
suppress plant defenses. Curr. Opin. Plant Biol. 7, 356-364.

Alfano, J .R., and Collmer, A. (2005). Type III secretion system effector proteins: double
agents in bacterial disease and plant defense. Annu. Rev. Phytopathol. 42, 385-414.

Buttner, D., and Bonas, U. (2002). Getting across--bacterial type III effector proteins on
their way to the plant cell. EMBO J. 21, 5313-5322.

Chang, J .H., Urbach, J .M., Law, T.F., Arnold, L.W., Hu, A., Gombar, S., Grant, S.R.,
Ausubel, F.M., and Dangl, J .L. (2005). A high-throughput, near-saturating screen for type
III effector genes from Pseudomonas syringae. Proc. Natl. Acad. Sci. USA, 102, 2549-

25 54.

Collmer, A., Lindeberg, M., Petnicki-chieja, T., Schneider, D.J., and Alfano, J.R.
(2002). Genomic mining type III secretion system effectors in Pseudomonas syringae
yields new picks for all TTSS prospectors. Trends Microbiol. 10, 462-469.

Fan, L.M., Zhao, Z., and Assmann, SM. (2004). Guard cells: a dynamic signaling model.
Curr. Opin. Plant Biol. 7, 537-546.

Felix, G., Duran, J .D., Volko, S., and Boller, T. (1999) Plants have a sensitive perception
system for the most conserved domain of bacterial flagellin. Plant J. 18, 265-276.

Greenberg, J .T., and Vinatzer, BA. (2003). Identifying type III effectors of plant
pathogens and analyzing their interaction with plant cells. Curr. Opin. Microbiol. 6, 20-
28.

He, S.Y., Nomura, K., and Whittam, T. (2004). Type III secretion in mammalian and
plant pathogens. Biochim. Biophys. Acta. 1694, 181-206.

Hosy, E., Vavasseur, A., Mouline, K., Dreyer, 1., Gaymard, F., Poree, F., Boucherez, J.,
Lebaudy, A., Bouchez, D., Very, A.A., Simonneau, T., Thibaud, J .B., and Sentenac, H.
(2003) The Arabidopsis outward K+ channel GORK is involved in regulation of stomatal
movements and plant transpiration. Proc. Natl. Acad. Sci. USA, 100, 5549-5554.

Katagiri, F., Thilmony, R. and He, S.Y. (2002) The Arabidopsis thaliana-Pseudomonas
syringae interaction. In The Arabidopsis Book (Meyerowitz, E. M. and Somerville, C. R.,
eds). American Society of Plant Biologists, Rockville, MD, USA, DOI 10.1199-tab.0039.

Kim, M.G., de Cunha, L., Mcfall, A.J., Belkhadir, Y., DebRoy, S., Dangl, J.L., and

Mackey, D. (2005) Two Pseudomonas syringae type III effectors inhibit RIN4-regulated
basal defense in Arabidopsis. Cell, 121, 749-759.

128

Kobae, Y., Sekino, T., Yoshioka, H., Nakagawa, T., Martinoia, E., and Maeshima, M.
(2006) Loss of AtPDR8, a plasma membrane ABC transporter of Arabidopsis thaliana,

causes hypersensitive cell death upon pathogen infection. Plant Cell Physiol. 47, 309-
318.

Kunze, G., Zipfel, C., Robatzek, S., Niehaus, K., Boller, T., and Felix, G. (2004) The N
terminus of bacterial elongation factor Tu elicits innate immunity in Arabidopsis plants.
Plant Cell, 16, 3496-3507.

Kwak, J .M., Mori, I.C., Pei, Z.M., Leonhardt, N., Torres, M.A., Dangl, J .L., Bloom, R.E.,
Bodde, S., Jones, J.D., and Schroeder, J .I. (2003) NADPH oxidase AtrbohD and Atrbth
genes function in ROS-dependent ABA signaling in Arabidopsis. EMBO J. 22, 2623-
2633.

Leon-Kloosterziel, K.M., Gil, M.A., Ruijs, G.J., Jacobsen, S.E., Olszewski, N.E.,
Schwartz, S.H., Zeevaart, J.A.D., and Koomneef, M. (1996). Isolation and

characterization of abscisic acid-deficient Arabidopsis mutants at two loci. Plant J. 10,
655-661.

Leung, J., Merlot, S., and Giraudat, J. (1997) The Arabidopsis ABSCISIC ACID-
INSENSITIVE2 (AB12) and ABIl genes encode homologous protein phosphatases 2C
involved in abscisic acid signal transduction. Plant Cell, 9, 759-771.

Ma, S.W., Morris, V.L. and Cuppels, DA. (1991) Characterization of a DNA region
required for the production of the phytotoxin coronatine by Pseudomonas syringae pv.
tomato. Mol. Plant Microbe Interact, 4, 69-74.

Melotto, M., Underwood, W., Koczan, J., Nomura, K., and He, S.Y. (2006) Plant stomata
function in innate immunity against bacterial invasion. Cell, 126, 969-980.

Merlot, S., Mustilli, A.C., Genty, B., North, H., Lefebvre, V., Sotta, B., Vavasseur, A.,
and Giraudat, J. (2002) Use of infrared thermal imaging to isolate Arabidopsis mutants
defective in stomatal regulation. Plant J. 30, 601-609.

Mittal, S.M., and Davis, KR. (1995) Role of the phytotoxin coronatine in the infection of
Arabidopsis thaliana by Pseudomonas syringae pv. tomato. MoI. Plant-Microbe Interact.
8, 165-171.

Mudgett, MB. (2005). New insights to the function of phytopathogenic bacterial type III
effectors in plants. Annu. Rev. Plant. Biol. 56, 509-531.

Mustilli, A.C., Merlot, S., Vavasseur, A., Fenzi, F., and Giraudat, J. (2002). Arabidopsis

OSTl protein kinase mediates the regulation of stomatal aperture by abscisic acid and
acts upstream of reactive oxygen species production. Plant Cell, 12, 3089-3099.

129

Nomura, K., and He, S.Y. (2005). Powerful screens for bacterial virulence proteins. Proc.
Natl. Acad. Sci. USA, 102, 3527-3528.

Nomura, K., Melotto, M., and He, S.Y. (2005). Suppression of host defense in
compatible plant-Pseudomonas syringae interactions. Curr. Opin. Plant Biol. 8, 361-368.

Pei, Z.M., Kuchitsu, K., Ward, J .M., Schwarz, M., and Schroeder, J .I. (1997) Differential
abscisic acid regulation of guard cell slow anion channels in Arabidopsis wild-type and
abi1 and abi2 mutants. Plant Cell, 9, 409-423.

Penaloza-Vazquez, A., Preston, G.M., Collmer, A., and Bender, CL. (2000). Regulatory
interactions between the Hrp type 111 protein secretion system and coronatine

biosynthesis in Pseudomonas syringae pv. tomato DC3000. Microbiology, 146, 2447-
2456.

Sambrook, J ., Fritsch, E., and Maniatis, T. (1989). Molecular Cloning: a Laboratory
Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, USA.

Schroeder, M., Allen, G.J., Hugouvieux, V., Kwak, J .M., and Waner, D. (2001). Guard
cell signal transduction. Annu. Rev. Plant Physiol. Plant Mol. Biol. 52, 627—658.

Staskawicz, B.J., Mudgett, M.B., Dangl, J.L., and Galan, J.E. (2001). Common and
contrasting themes of plant and animal diseases. Science, 292, 2285-2289.

Stein, M., Dittgen, J., Sanchez-Rodriguez, C., Hou, B.H., Molina, A., Schulze-Lefert, P.,
Lipka, V., and Somerville, S. (2006) Arabidopsis PEN3/PDR8, an ATP binding cassette

transporter, contributes to nonhost resistance to inappropriate pathogens that enter by
direct penetration. Plant Cell, 18, 523-528.

Zeidler, D., Zéihringer, U., Gerber, I., Dubery, I., Hartung, T., Bors, W., Hutzler, P., and
Dumer, J. (2004) Innate immunity in Arabidopsis thaliana: Lipopolysaccharides activate
nitric oxide synthase (NOS) and induce defense genes. Proc. Natl. Acad. Sci. USA, 101,
15811-15816.

Zhao, Y. Thilmony, R., Bender, C.L., Schaller, A., He, S.Y. and Howe, GA. (2003)
Virulence systems of Pseudomonas syringae pv. tomato promote bacterial speck disease
in tomato by targeting the jasmonate signaling pathway. Plant J., 36, 485-499.

Zipfel, C., Robatzek, S., Navarro, L., Oakeley, B.J., Jones, J.D.G., Felix, G., and Boller,

T. (2004) Bacterial disease resistance in Arabidopsis through flagellin perception.
Nature, 428, 764-767.

130

Chapter 4
Characterization of the virulence function of HopD2, a type III effector tyrosine

phosphatase of Pst DC3000 that suppresses basal defenses in Arabidopsis thaliana

131

Abstract

The bacterial pathogen Pseudomonas syringae infects plants by colonizing leaf
tissue and multiplying aggressively in the leaf intercellular spaces. To promote
multiplication, Pst DC3 000 secretes a battery of effector proteins into host cells via a
type III secretion system. Type III effectors are critical for virulence of Pst DC3000 as
mutants that cannot secrete effectors are no longer virulent on normally susceptible hosts.
However, little is currently known about the molecular mechanisms by which individual
type III effectors promote virulence.

Most type III effectors identified in the Pst DC3000 genome have little or no
similarity to known proteins. However, the effector HopD2 has similarity to protein
tyrosine phosphatases, including a conserved active domain. To investigate the in planta
function of HopD2 I generated transgenic Arabidopsis plants expressing HopD2 under
the control of an inducible promotor. Expression of HopD2 suppresses basal defense-
associated callose deposition elicited by the Pst DC3 000 hrpA mutant and flg22-induced
resistance to Pst DC3000, suggesting that HopD2 blocks PAMP-induced innate
immunity. Transgenic plants expressing HopD2 also allow the normally non-pathogenic
hrpA mutant to multiply to high levels within the leaf tissue. The virulence function of
HopD2 is dependent on an intact phosphatase catalytic site, as transgenic plants
expressing a catalytically inactive derivative do not show these effects. Interestingly,
expression of the catalytically inactive HopD2 has a dominant-negative effect on the
function of the wild-type HopD2. Remarkably, genome-wide expression profiling

analysis suggests that HopD2 acts on host targets without affecting host gene expression.

132

Introduction

Type 111 protein secretion systems (W885) and associated secreted virulence
effector proteins play a major role in the infection of eukaryotic hosts by bacterial
pathogens belonging to many diverse genera including Yersinia, Salmonella, Escherichia,
Pseudomonas, Xanthomonas, and Ralstonia (Comelis and Van Gij segem, 2000). The
virulence functions of TTSS effectors from mammalian and human pathogens such as
Yersinia enterocolitica and Salmonella enterica have been studied extensively and have
been shown to participate in manipulation of host cytoskeleton and vesicle trafficking
systems to allow bacterial entry into host cells and suppression of host defenses such as
phagocytosis (Abrahams and Hansel, 2006; Navarro et al., 2005). In contrast to
mammalian and human pathogens, relatively little is known about the virulence functions
of TTSS effectors encoded by plant pathogenic bacteria. The recent availability of
genome sequences for a number of plant pathogenic bacteria such as P. syringae pv.
tomato (Buell et al., 2003), X. campestris pv. campestris (da Silva et al., 2002), X.
campestris pv. vesicatoria (Thieme et al., 2005), and R. solanacearum (Salanoubat et al.,
2002) has allowed researchers to mine these genomes for potential TTSS effector genes
using a variety of bioinformatics and functional approaches (Chang et al., 2005; Fonts et
al., 2002; Guttman et al., 2002; Noel et al., 2001; Petnicki-chieja et al., 2002; Roden et
al., 2004; Schecter et al., 2004; Zwiesler-Vollick et al., 2002). The results of these studies
showed that plant pathogenic bacteria, in general, encode and secrete many more TTSS
effector proteins than their mammalian- and human-pathogenic counterparts. For
example, the human pathogen Yersinia enterocolitica secretes 6 TTSS effectors (Navarro

et al., 2005) compared to 30-40 effectors secreted by P. syringae pv. tomato strain

133

DC3000 (Pst DC3000; Chang et al., 2005; Schechter et al., 2004). The importance of
TTSS effectors in promoting virulence is evidenced by the observation that bacterial
mutants defective in assembly of the TTSS and secretion of effectors, such as hrp
(hypersensitive response and pathogenicity) mutants of P. syringae, are unable to cause
disease on normally susceptible hosts (Lindgren et al., 1986). Given the important role of
TTSS effector proteins in the ability of plant-pathogenic bacteria to cause disease,
understanding the function of these proteins within the host cell should significantly
advance the study of plant-microbe interactions.

Studying the virulence functions of TTSS effector proteins from plant pathogenic
bacteria has proven to be difficult for a number of reasons. First, bacterial mutagenesis
approaches to study the function of single effector knock-out mutants have been largely
unsuccessful. Single effector mutants generally show little or no reduction in virulence,
presumably due to functional redundancy among the many TTSS effectors encoded by a
given plant pathogenic bacterium. Second, the gene and protein sequences of TTSS
effectors share little or no homology to proteins of known function, rendering
comparative approaches uninformative and hindering the ability to generate testable
hypotheses for the function of individual effectors. However, limited sequence similarity,
such as the presence of conserved enzyme active sites in some TTSS effectors, and new
approaches such as transgenic expression of effectors directly in host cells have led to
insights into the function of some effectors in the host. The Pst DC3 000 effectors
Aerpt2 and AverhB have both been shown to be cysteine proteases that mediate the
degradation of specific host proteins. Aerpt2 causes the degradation of the Arabidopsis

RIN4 protein, whereas AverhB degrades the Arabidopsis PBSl kinase (Kim et al.,

134

2005; Shao et al., 2003). It is not yet clear how the degradation of RIN4 and PBSl
contributes to the virulence of Pst DC3000. Other studies suggest that a major virulence
function of TTSS effectors from plant pathogens is the suppression of host defense
responses. Several Pst DC3000 effectors have been demonstrated to suppress
programmed cell death (PCD) associated with the hypersensitive response (HR;
Abramovitch et al., 2003; Jarnir et al. 2004). Most notably, AvrPtoB was found to
suppress PCD and to possess E3 ubiquitin ligase activity, and this activity was required
for PCD supression (Abramovitch et al., 2006; Janjusevic et al., 2006). In addition to HR
suppression, other Pst DC3000 effectors such as Hole, AvrPto, Aerme, and
Aerpt2 have been shown to suppress defense readouts associated with PAMP-induced
innate immunity (DebRoy et al., 2004; Hauck et al., 2003; Kim et al., 2005).

The Pst DC3000 TTSS effector HopD2 (also known as HothoDZ and HopAOl)
contains a conserved motif (HCxxGxxRS/T) characteristic of protein tyrosine
phosphateses (PTPs) and exhibits such enzymatic activities in vitro (Bretz etal., 2003;
Espinoza et al., 2003). This potential enzymatic activity provides a starting point for
studying the virulence function of this effector protein. HopD2 has previously been
shown to contribute to virulence of Pst DC3000 as deletion mutants lacking HopD2 were
reduced in virulence on Arabidopsis (10-100 fold reduction in multiplication; Bretz et al.,
2003). Additionally, when expressed ectopically in P. syringae pv. phaseolicola
(Espinosa et al., 2003) or Pst strain Psy6l (Bretz et al., 2003), HopD2 caused a delay in
the onset of HR in the non-host plants Nicotiana tabacum and N. benthamiana
respectively. When transiently expressed in N. tabacum, HopD2 was also able to

suppress HR-associated PCD initiated by expression of a constitutively active form of the

135

mitogen-activated protein kinase kinase (MAPKK) NtMEK2 (Espinosa et al., 2003).
However, in a screen for effectors that could suppress HR-associated PCD elicited by the
effector HopPsyA, HopD2 failed to suppress PCD in either N. tabacum or Arabidopsis
(Jamir et al., 2004). The contradictory nature of these results leaves open the question of
the true virulence function of HopD2 in susceptible host plants.

To study the virulence filnction of HopD2 in the susceptible host Arabidopsis, I
created transgenic plants expressing HopD2 or a catalytically inactive derivative under
the control of an inducible promotor. In this chapter, I report that HopD2 does not
suppress the HR when expressed transgenically in Arabidopsis. However, transgenic
expression of HopD2 does enhance the multiplication of the normally non-pathogenic Pst
DC3 000 hrpA mutant and suppresses defense responses associated with PAMP-induced
innate immunity. The phosphatase activity of HopD2 is required for these functions, as
transgenic plants expressing the catalytically inactive derivative do not show these
phenotypes. To address the firnction of HopD2 in suppressing host defenses, I
investigated the activation of defense-associated MAPKs, gene expression changes, and

lipid profiles in the transgenic plants.

136

Experimental Procedures

Bacterial strains and media

Bacterial cultures of Escherichia coli (E. coli) were grown at 37°C in low-salt
(Sg/L NaCl) Luria Bertani (LB) medium (Sambrook et al., 1989). P. syringae cultures
were grown in low salt LB at 30°C. Antibiotics were used at the following concentrations
unless otherwise specified - rifampicin 60 mg/L, kanamycin 50 mg/L, ampicillin 100

mg/L, spectinomycin, 50 mg/L.

Plant growth and bacterial enumeration

Arabidopsis thaliana plants were grown in controlled growth chambers at a
constant temperature of 20°C with a 12 hr photoperiod under a light intensity of 100
uE/mz/s. Four- to six-week-old plants were used for all experiments. Bacteria for plant
inoculations were grown to the mid-logarithmic phase, centrifuged at 2500 x g, and re-
suspended in sterile H2O to the specified inoculum density. For vacuum-infiltration,
Silwet L-77 (Osi Specialties, Friendship, WV) was added to bacterial suspensions at a
concentration of 0.004%. After inoculation, plants were left uncovered until leaves were
no longer water soaked, then covered with humidity domes until completion of
experiments. Bacterial population in the plant apoplast was determined as previously

described (Katagiri et al., 2002). The mean values of the bacterial populations are plotted

137

with the standard deviation displayed as error. To assess flg22-induced resistance to Pst
DC3000, plants were sprayed with 30 uM dexamethasone 12 hrs prior to syringe-
infiltration of 5 uM flg22 or water (control). After 24 hrs, plants were vacuum-infiltrated
with Pst DC3000 (1 x 106 cfu/ml) and bacterial multiplication was assessed 2 days after
inoculation. All bacterial multiplication assays reported here were performed at least 3

times with similar results.

Generation of transgenic plants

Genomic DNA was extracted from Pst DC3 000 as described previously (Chen
and Kuo, 1993). PCR was used to amplify the hopD2 coding sequence using HIFI Taq
polymerase (Invitrogen, Carlsbad, CA) and the following primers:
sense primer 5’-TACTCGAGCGAGATAGTTCATACAGCTATG-3 ’
antisense primer 5 ’-CAACTAGTGCGAGAAACACTAAAGGGC-3 ’.
The hopD2 gene was cloned into the pBD vector (a gift from Jeff Dangl, University of
North Carolina, Chapel Hill), allowing for inducible expression of the transgene after
application of the rat glucocorticoid hormone dexamethasone (DEX). The HopD2 insert
was sequenced and pBD/hopD2 was transformed into E. coli DHSa and transferred into
Agrobacterium tumefaciens strain C58C1 by tri-parental mating using the E. coli helper
strain pRK600. Four pots each of A. thaliana Col gII plants (5 plants per pot) were
transformed with A. tumefaciens carrying pBD/hopD2 using the floral dip method
(Clough and Bent, 1998). Seeds collected from each pot were kept separate to ensure that

independently transformed lines could be isolated. T1 pBD/hopD2 seeds were sowed in

138

soil and allowed to germinate. Two-week-old Tl seedlings were sprayed with a 0.2%
solution of the herbicide BASTA (glufosinate-ammonium, trade name Finale, AgroEvo

Environmental Health, Montvale, NJ) to select transformants.

Site-directed mutagenesis of HopD2

A phosphatase catalytically-inactive derivative of hopD2 (hopD2C378S) was
generated by site-directed mutagenesis using the QuickChange XL mutagenesis kit
(Stratagene, La J olla, CA) according to the manufacturers protocol. The mutagenesis
primers used to change the conserved catalytic Cysm to Ser were: .
sense primer 5’- GAGTCGCTAGTTGTGCACAGTAACGGCGGTCGGGGCCG-3’

antisense primer 5 ’ -CGGCCCCGACCGCCGTTACTGTGCACAACTAGCGACTC-3 ’.

Production of HopD2 antibody

The hopD2 gene was amplified by PCR from Pst DC3000 genomic DNA using
the following primers:
sense primer 5 ’-ATCATATGCCTTTCGTCAGCCAA'ITACTC-3 ’
antisense primer 5’-AGCTCGAGAAACACTAAAGGGCTG-3’.
The gene was cloned into the pET28(a) vector (Invitrogen, Carlsbad, CA) and
transformed into E. coli BL21. Protein was induced by addition of 1 mM IPTG to a mid-
log culture and incubated for 4 hrs at 37°C. HopD2 protein was extracted from E. coli
cells using a standard protocol (Qiagen, Valencia, CA) and purified using Ni-NTA
agarose. Purified HopD2 protein was analyzed by SDS-PAGE and the band

corresponding to HopD2 was excised for further purification. The gel slice was destained

139

for 2 hrs in 30% MeOH and 10% acetic acid followed by rinsing in H2O for 1 hr. The gel
slice was then cut into pieces and further macerated by centrifugation in a 1 ml pipette tip
loaded with copper wire coil. HopD2 protein was eluted from the macerated gel
overnight at room temperature by rocking in 50mM Tris + 1% SDS. The final purified
HopD2 protein was analyzed by SDS-PAGE and used to raise antibodies in rabbit at
Cocalico Biologicals, Inc., Reamstown, PA. Pre- and post-immune sera was obtained and

checked for the ability to recognize the antigen using immunoblot analysis.

DEX induction of transgene expression
Dexamethasone (Sigma Aldrich, St. Louis, MO) was dissolved in 100% ethanol at
a concentration of 30 mM and stored at -20°C. This stock solution was diluted in water to

the concentrations specified for individual experiments.

Microarray analysis

Pots of Arabidopsis Col glI, HopD2, or HopD2C3788 were sprayed with 30 uM
DEX to induce the HopDZ transgene. After 24 hrs, pots were vacuum-infiltrated with a
bacterial suspension of 1 x 108 cfu/ml of the Pst DC3000 hrpA mutant or a mock
inoculum of sterile H2O with 0.004% Silwet L77 (08] Specialties, Friendship, WV).
Plants were left uncovered until leaves were no longer water soaked and then covered
with a humidity dome. After 7 hrs, all fully expanded leaves from 10-12 plants for each
treatment were harvested, frozen in liquid N2, and stored at -80°C for subsequent RNA
isolation. For bacterial mutant analysis, Arabidopsis Col-0 plants were vacuum-infiltrated

with bacterial suspensions of 1 x 108 cfu/ml Pst DC3000, Pst DC3000 AhopDZ mutant,

140

or a mock inoculum of sterile H2O with 0.004% Silwet L77. Infiltrated plants were left
uncovered until leaves were no longer water soaked and then covered with a humidity
dome. Tissue was harvested for RNA isolation 7 hrs after infiltration in the manner
described above. Total RNA was isolated from Arabidopsis leaves using the Promega
(Madison, WI) RNAgents total RNA isolation system. The RNA concentration was
determined by absorbance at 260 nm and its quality was evaluated by separation on 2%
denaturing agarose gels containing formaldehyde. The total RNA was further pmified
using Qiagen (Valencia, CA) RNeasy minicolumns. Biotinylated target complementary
RNA (cRNA) was prepared from 16pg of total RNA using the procedure described by
Affymetrix (Santa Clara, CA). Labeled target cRNA was subsequently purified,
fragmented, and hybridized to Arabidopsis ATHl GeneChip arrays according to
protocols provided by the manufacturer (Affymetrix) in a Hybridization Oven model 640
(Affymetrix). The GeneChips were washed and stained with streptavidin-phycoerythrin
using a GeneChip Fluidics Station model 400 and then scanned with a Gene Array
Scanner (Hewlett-Packard, Palo Alto, CA). The gene expression data was normalized and
analyzed using the Affymetrix Microarray Program Suite (MAS 5.0 statistical algorithms
and the Data Mining Tool (version 2.0)). Output from all GeneChip hybridizations was
scaled globally such that its average intensity (TGT value) was equal to an arbitrary
target intensity of 500 allowing comparisons between GeneChips. Data was then
compared between sample chips fi'om the same biological replicate producing a Signal
Log2 Ratio (SLR) calculated from the GeneChip fluorescence signal intensity data. The
software was used to determine whether there was a genuine change in mRNA

accumulation (Change Call, D for Decrease, I for Increase) and Change Call p-value.

141

SLRs, Change Calls and p-values were determined for each bacterially inoculated sample
compared with its corresponding mock control or bacterial mutant treated sample.
Significance Analysis of Microarrays (SAM; Tusher et al. 2001) was used to identify
significant genes based on their differential expression between sets of samples. The
SAM analysis feature contained in the TIGR Microarray Experiment Viewer v4.0 (Saeed
et al., 2003; http://www.tm4.org/mev.html) was used to conduct the analysis. The
normalized signal log2 ratios for each replicate of each comparison were used for the
analysis. The two datasets (transgenic plants and bacterial mutant) were independently
analyzed using the multiclass design, with the default settings. The delta value was set at
a level such that the median False Discovery Rate was less than 5%. Access database
management software was used to further filter and query the data. The criteria used to
identify reproducibly differentially expressed probe sets were a signal log2 ratio of at
least -1.0, a gene expression change call of D (decrease) and p-value >0.995 or signal
log2 ratio of at least 1.0, change call of I (increase) and p-value of <0.005 for all 3

biological replicates for at least one type of comparison.

Lipid profiling analysis

Arabidopsis Col g1], HopD2, or HopD2C3788 plants were sprayed with 30 uM
DEX to induce the transgene. After 24 hrs, 5 fillly expanded leaves were harvested for
extraction of total lipids. Harvested leaves were quickly immersed in isopropanol +
0.01% butylated hydroxytoluene (BHT; Sigma Aldrich, St. Louis, MO) preheated to
75°C in a water bath and incubated for 15 min. Samples were removed from water bath

and 1.5 ml of chloroform and 0.6 ml water were added with vortexing. Samples were

142

incubated with shaking at room temperature for 1 hr. Lipid extracts for each sample were
transferred to a separate tube and 4 ml chloroformzmethanol (2:1) + 0.01% BHT was
added to the leaf samples. Samples were incubated for 30 min. at room temperature with
shaking. Lipid extracts were again removed and combined with the first extract.
Extraction with 2:1 chloroformzmethanol was repeated 4 times and extracts for each
sample were combined. Extracts were rinsed with 1 ml of 1M KCl followed by 2 ml of
H20. Solvents were evaporated by streaming nitrogen into the tubes and lipids were
resuspended in 0.5 ml chloroformzmethanol (2:1) + 0.01% BHT and stored at -80°C.
Extracted leaves were dried overnight in an oven and weighed to obtain dry weights. Dry
weights for each sample were 8-10 mg. Lipid samples were analyzed using high pressure
liquid chromatography (HPLC) coupled to a Waters MicroMass dual quadrupole mass
spectrometer using electrospray ionization (ESI) in the negative ion mode. To detect
phosphatidylinositol lipids, a parent ion method was used to scan the mass spectrum for
lipids that fragmented to yield parent ions of 241 m/z (representing the
phosphatidylinositol headgroup with no reversible phosphorylation) or 321 m/z
(representing the phosphatidylinositol headgroup with a single reversible
phosphorylation). Scans were conducted for 3 min. per sample. Data on P1 content

reported here are from single MS/MS analyses of single lipid extracts for each sample.

Callose assay
Arabidopsis Col glI, HopD2, or HopD2C378$ plants were sprayed with 30 uM
DEX and after 24 hrs were vacuum-infiltrated with a suspension of the type III secretion-

defective Pst DC3000 hrpA mutant (Wei et al., 2000) at a concentration of 1 x 108 cfu/ml

143

(OD600 = 0.2). Plants were left uncovered after infiltration and leaves were harvested after
7 hrs. Harvested leaves were cleared of pigment by vacuum-infiltrating alooholic
lactophenol (1 :1 :1 :1 :2 phenol:glycerol:lactic acidzwaterzethanol) followed by 30 min. of
incubation at 65°C. The leaves were then transferred to fresh alcoholic lactophenol
solution and incubated overnight at room temp. Cleared leaves were rinsed briefly in 50%
ethanol, then water, and stained with aniline blue solution (0.01% aniline blue [Sigma] in
150 mM K2HPO4, pH 9.5). Leaves were examined with a Zeiss Axiophot D-7082
fluorescence microscope with an excitation filter of 365 :1: 25 nm, a 400 nm dichroic
mirror, and a 450 nm longpass emission filter. The number of callose deposits (visualized
as white spots against a blue background) was determined using Quantity One software
(BioRad, Hercules, CA). More than 10 adjacent fields of view along the length of the leaf
were analyzed and averaged. Average numbers of callose deposits are plotted with
standard deviation displayed as error. Callose assays reported here were performed 3

times with similar results.

In-gel kinase assay

Arabidopsis Col glI, HopD2, or HopD2C3788 plants were sprayed with 30 11M
DEX and after 24 hours were inoculated by vacuum-infiltration with a bacterial
suspension of 1 x 108 cfu/ml of the Pst DC3000 hrpA mutant or a mock inoculum of H20.
Leaf tissue samples were collected at 0 (immediately prior to vacuum-infiltration), 1, 2,
3, and 6 hrs after inoculation. Four leaf discs (1.5 cm2) per sample were collected using a
#5 cork borer and immediately frozen in liquid N2. For analysis of kinase activation after

inoculation of bacterial mutants, Arabidopsis Col gII plants were inoculated with

144

bacterial suspensions of l x 108 cfu/ml of Pst DC3000, a Pst DC3 000 hopD2 deletion
mutant (AhopDZ; Bretz et al., 2003), or Pst DC3000 carrying the avirulence gene
aerpt2. Leaf tissue samples were collected at 0 (immediately prior to vacuum-
infiltration), 3, 6, and 9 hours after inoculation as described above. Frozen leaf tissue was
ground using plastic micro pestles and 200 pl of extraction buffer (100 mM Hepes, pH
7.5, 5 mM EDTA, 5 mM EGTA, 10 mM DTI‘, 10 mM Na3V04, 10 mM NaF, 50 mM [3-
glycerolphosphate, 1 mM phenylmethylsulfonyl fluoride, 5 ug/mL antipain, 5 ug/mL
aprotinin, 5 pg/mL leupeptin, 10% glycerol) was added to each sample followed by
further homogenization until no large leaf pieces remained. Homogenized samples were
centrifuged at 12,000 x g at 4°C for 30 min and supematants were transferred to new
tubes and stored at -80°C. Protein concentration for each sample was determined using a
Pierce BCA Protein Assay Kit (Pierce, Rockford, IL) according to the manufacturers
instructions. 10 pg of protein for each sample was separated on 10% SDS polyacrylamide
gels containing 0.25 mg/ml of myelin basic protein (MBP) and in-gel kinase assays were
performed as described previously (Zhang and Klessig, 1997). All in-gel kinase assays

reported here were performed two times on independent samples with similar results.

Immunoblotting and HopD2 protein fractionation

Following DEX treatment, one cm2 of leaf tissue was collected using a #2 cork
borer, homogenized in 100 pl of protein extraction buffer (0.125M Tris-HCl, pH 6.8, 4%
SDS, 20% glycerol, 10% B-mercaptoethanol) and denatured at 100°C for 10 min. Equal
volumes of each sample were separated on 12% SDS-polyacrylarnide gels and proteins

were transferred onto Immobilon-P blotting membrane (Millipore, Billerica, MA) using a

145

Semi-Phor semi-dry transfer apparatus (Hoefer Scientific Instruments, San Francisco,
CA). Immunoblotting was carried out using HopD2 antiserum and anti-rabbit alkaline
phosphatase or horseradish peroxidase conjugated secondary antibodies. HopD2 protein
bands were visualized by a standard color reaction using Sigma Fast BCIP/NBT reagent
(Sigma Aldrich, St. Louis, MO) or by enhanced chemiluminescence using a Pierce
SuperSignal chemiluminescent detection kit according to the manufacturers protocol
(Pierce, Rockford, IL). For localization of HopD2 to membrane or soluble fractions of
extracts of HopD2 transgenic Arabidopsis plants, plants were sprayed with 30 uM DEX
to induce the transgene. After 24 hrs, 2.5 cm2 of leaf tissue was collected using a #5 cork
borer and homogenized in 200 pl extraction buffer (50 mM Tris-HCI, pH 8.0, 150 mM
NaCl, 10% glycerol, 10 uM B-mercaptoethanol, 1x Sigma plant protease inhibitor
cocktail). Following homogenization, an additional 200 pl of extraction buffer was added
to each sample. Samples were centrifuged at 10,000 x g for 30 min at 4°C and
supernatants were transferred to new tubes. Samples were then centrifuged at 100,000 x g
for 1 hour at 4°C. The supernatant (soluble fraction) was removed and the pellet
(membrane fraction) was resuspended in 400 ill extraction buffer. Protein fractions were
concentrated approximately 8-fold using Centricon microcentrifuge units (Millipore,
Bellerica, MA) with a 10,000 MW cutoff. After concentration, 20 pl of each sample was
mixed with 5x SDS-PAGE loading buffer (0.2M Tris-HCl pH 6.8, 40% glycerol, 10%
SDS, 0.0005% bromophenol blue, 15% B-mercaptoethanol), loaded and separated on
12% SDS polyacrylamide gels, and blotted as described above. HopD2 was detected as

described above.

146

Results

Arabidopsis thaliana transgenic plants expressing HopD2 exhibit chlorosis and
necrosis upon induction.

To study the function of HopD2 in promoting virulence on susceptible host
plants, I created transgenic Arabidopsis Col glI plants expressing the hopD2 gene or the
catalytically inactive derivative hopD2C378S under the control of a DEX-inducible
promotor. Transgenic lines were selected on the basis of their resistance to the herbicide
BASTA. Seven independent HopD2 transgenic lines and 11 independent HopD2C3788
lines were analyzed by western blotting to detect the presence of the HopD2 protein after
induction with DEX. Each line was scored for the development of phenotypes after DEX
treatment. Two HopD2-expressing lines and two HopD2C37ss-expressing lines were
subsequently assayed for multiplication of the Pst DC3 000 hrpA mutant. HopD2 line 141
and HopD2C378$ line 193 were chosen for further characterization and the experiments
reported here were performed using these transgenic lines. Un-induced HopD2 and
HopD2C3788 plants were phenotypically normal and indistinguishable from the parental
Col glI line. However, by 3 days after induction of the HopD2 protein by spraying with
30 pM DEX, HopD2 141 plants began to develop leaf chlorosis (Figure 4-1A). By 5 to 6
days after DEX treatment, leaves of HopD2 141 plants began to exhibit a necrotic
phenotype and eventually collapsed, resulting in death of the transgenic plants (Figure 4-

1B). In contrast, HopD2C3785 193 plants did not develop these severe phenotypes after

DEX induction and were generally indistinguishable from Col glI plants (Figure 4-1 A

147

and B). Occasionally, HopD2C3785 developed mild chlorosis after several days of DEX

treatment.

148

 

Col glI HopD2 HopDzC378$

 

Col glI HopD2 HopD2C3788

Figure 4-1: Leaves of Col glI or HopD2 transgenic plants 3 days (A) or 7 days (B) after
treatment with 30 uM DEX. Plants were sprayed with DEX every 48 hours. Leaves of
HopD2 transgenic plants developed chlorosis and eventually collapsed. Note that leaves
of HopD2C37 3 plants did not develop this phenotype.

149

HopD2 transgenic plants allow enhanced multiplication of the Pst DC3000 hrpA
mutant.

Collectively, TTSS effectors secreted by Pst DC3000 into host cells function to
promote multiplication of the bacteria within the apoplastic space. Mutants that are
defective in assembly of the TTSS such as the hrpA mutant cannot secrete effectors and
are rendered completely non-pathogenic. Previous studies have demonstrated that
transgenic expression of single Pst DC3000 TTSS effectors in Arabidopsis can be
sufficient to promote significant multiplication of normally non-pathogenic hrp mutants
(Hauck et al., 2003; Kim et al., 2005). To determine if transgenic expression of HopD2 in
Arabidopsis could promote multiplication of normally non-pathogenic TTSS-deficient
bacteria, HopD2 and HopD2C3788 plants were inoculated with the Pst DC3000 hrpA
mutant. HopD2 transgenic plants allowed hrpA to multiply to significantly higher
population levels than the parental Col glI plants (Figure 4-2A). Irnportantly, this
enhanced multiplication was dependent on an intact HopD2 phosphatase catalytic site as
multiplication of hrpA in HopD2 C3783 was indistinguishable from Col gII . Although hrpA
was able to achieve population levels approaching that of Pst DC3 000 after 3 days, the
TTSS-deficient mutant was not able to cause typical disease symptoms such as water
soaking, chlorosis, or necrosis. DEX treated HopD2 plants inoculated with hrpA were
visually similar to un-inoculated, DEX treated plants. Expression of HopD2 had no effect
on the multiplication of Pst DC3000 (Figure 4-2B).

Interestingly, while HopD2C3788

plants did not allow the hrpA mutant to multiply,
transgenic expression of HopD2 C3783 had a dominant-negative effect on Pst DC3000

multiplication, causing a 5-10-fold reduction in population levels (Figure 4-2B). To

150

determine if this effect is a specific, dominant-negative effect on the virulence fimction of
the native HopD2 secreted by Pst DC3 000 during the course of an infection, the
multiplication of Pst DC3 000 AhopDZ, a deletion mutant lacking HopD2, was
investigated in C01 gll, HopD2 and HopD2 C3785 plants. Expression of wild-type HopD2
in planta complemented the AhopDZ mutant, allowing the mutant bacteria to achieve a
population level similar to wild-type Pst DC3000. Multiplication of AhopDZ was similar
in C01 g1] and HopD2 C3785 (Figure 4-2B) suggesting that: 1) Expression of HopD2 C3785
cannot complement the virulence defect of the AhopDZ mutant and, 2) HopD2 C3788 likely
interferes specifically with the function of wild-type HopD2 delivered by Pst DC3000 as

the virulence of the AhopDZ mutant is not further reduced in HopD2 C3783 plants.

151

 
  
   
  
  

  

 

1.0E+07 .
1 lCol gl1
1.0E+06 l ' H°pDZ
1 I HopD2 C3788
N ‘1
E 1.0E+05 1
U 1
\
D 1
LL 1.0E+04 1
0 1
1
1.0E+03 4‘
1
1.0E+02 T
o 3
Days Post inoculation
B
1 E+09
1 I Col gl1
1.E+08 1‘ I H°PDZ
1 I HopD2 C3788
1 E+07 7—1
" 1
5 1
5 1 E+06 1
LI- 1
O 1
1.E+05 1
1
1 E+04 1
1.E+03

DC3 000 AhopD2

Figure 4-2: Bacterial multiplication in HopD2 transgenic plants. (A) Multiplication of
the Pst DC3000 hrpA mutant in C01 glI (red bars), HopD2 (blue bars), or HopD2 "‘5
(green bars) plants. Plants were vacuum-infiltrated with a bacterial suspension of 1 x 106
cfu/ml. Error bars represent standard deviation for both charts. (B) Multiplication of Pst
DC3000 or the AhopDZ mutant in C01 glI (red bars), HopD2 (blue bars), or HopD2C 3785
(green bars) plants. Plants were vacuum-infiltrated with bacterial suspensions of 1 x 106
cfu/ml and multiplication was assessed 3 days after inoculation. Bacterial populations
immediately after inoculation (Day 0) were averaged and are represented by the solid
horizontal line with standard deviation represented by the dashed horizontal lines.

152

Transgenic expression of HopD2 suppresses defense responses associated with
PAMP-induced innate immunity.

TTSS effectors such as HopD2 can potentially promote multiplication and/or
symptom development through several possible mechanisms. Effectors may contribute to
virulence by suppressing host defense responses such as those associated with PAMP-
induced innate immunity or the HR, or by manipulating host cells to promote the creation
of an apoplastic environment that is more suitable for bacterial multiplication, potentially
through the release of water and/or nutrients. Transgenic plants expressing HopD2 allow
multiplication of the hrpA mutant, which is normally unable to multiply in Arabidopsis
presumably due, at least in part, to it’s inability to suppress PAMP-induced innate
immunity. Therefore, I investigated the ability of HopD2 transgenic plants to mount
defense responses associated with PAMP-induced innate immunity. One such defense
response is the deposition of callose-rich papillae at the cell well (Gomez-Gomez et al.,
1999; Soylu et al., 2005). Perception of PAMPs present on non-pathogens such as the
hrpA mutant leads to the deposition of papillae that can be visualized by aniline blue
staining for callose. After inoculation with the hrpA mutant, Col glI leaves exhibited
characteristic callose deposits (white spots on blue background) when stained with
aniline blue (Figure 4-3A). In contrast, HopD2 plants exhibited a significant reduction in
callose deposition (Figure 4-3A) to less than 50% of the number of callose deposits
observed in C01 g1] leaves (Figure 4-3B). An intact phosphatase catalytic site was
required for HopD2 suppression of callose deposition as the number of callose deposits in

HopD2C378 leaves was not significantly different than in C01 glI (Figure 4-3B).

153

To further test the effect of HopD2 on PAMP-induced innate immunity, the
ability of treatment with the flg22 peptide to confer partial resistance to Pst DC3000 was

investigated in C01 glI , HopD2, and HOpDZC3788

plants. Infiltration of Arabidopsis leaves
with the flg22 peptide prior to or along with Pst DC3000 has been shown to reduce
bacterial multiplication (Zipfel et al., 2004). Consistent with published results, treatment
of Col glI leaves with 5 llM flg22 24 hrs prior to infiltration with Pst DC3000 resulted in
an ~10-fold reduction in bacterial multiplication compared to H2O-treated control leaves
(Figure 4-4). Multiplication of Pst DC3000 in HopD2 transgenic plants did not differ
significantly between leaves treated with flg22 and H2O-treated (control) leaves,
suggesting that HopD2 can block defenses activated by flg22. Pst DC3000 population
levels in H2O-treated HopD2C3788 leaves were ~5 fold less than in H2O-treated Col glI
leaves, consistent with our prior observation of a dominant-negative effect of HopD2C3788
on Pst DC3000 multiplication. Multiplication of Pst DC3000 was further reduced in
flg22-treated HopD2C37°S leaves, suggesting that HopD2 phosphatase activity is required

for suppression of flg22-induced resistance to Pst DC3000.

154

HopD2 HopD2C378S

H2O

hrpA

   

160

   
   
   

ICol 911
140 4
, IHoppz
120 j IHopoz C3788

é

 

8

Average Callose Deposits
o 8 8 8

Water hrpA

Figure 4-3: Papilla-associated callose deposition in HopD2 transgenic plants. Col glI,
HopD2, and HopD2C3788 plants were inoculated with Pst DC3000 hrpA mutant bacteria
(1 x 108 cfu/ml) or sterile H2O. Leaf tissue was collected after 8 hrs, cleared, and stained
with aniline blue to detect callose. (A) Representative microscope images, callose
deposits appear as white spots on the blue background. (B) Quantitation of callose
deposition. Callose spots were counted for at least 10 microscope fields of view per
treatment. Average numbers of deposits per field are plotted with standard deviation
displayed as error.

155

CFUIcm2

1.00E+08 7 .Water

  
  
    
    

1 Ifl922
1.00E+07 1
1
1.00E+06 j
i
1.00E+05 1
1
1.00E+04 j
l- _
1.00E+03
Col gl1 HopD2 HopDZ
03788

Figure 4-4: Transgenic expression of HopD2 blocks flg22-induced resistance to Pst
DC3000. Multiplication ofPst DC3000 in C01 glI, HopD2, or HopD2 C3733 plants after
treatment with 5 11M flg22 (blue bars) or water (red bars) as a control. Leaves were
syringe-infiltrated with flg22 or water 24 hrs prior to vacuum-infiltration with Pst
DC3000 (1 x 108 cfu/ml). Multiplication was assessed 2 days after inoculation. Error bars
represent standard deviation. Bacterial populations immediately after inoculation (Day 0)
were averaged and are represented by the solid horizontal line with standard deviation
represented by the dashed horizontal lines.

156

Development of the HR is not effected in HopD2 transgenic plants.

In previous studies, transient expression of HopD2 was sufficient to block or
delay the onset of HR-associated PCD elicited by avirulent bacteria in the non-host plants
N. benthamiana and N. tabacum (Bretz et al., 2003; Espinosa et al., 2003). However, in a
screen for Pst DC3000 TTSS effectors that could suppress PCD elicited by the effector
HopPsyA in N. tabacum, HopD2 failed to suppress or delay HR-associated PCD (Jarnir
et al., 2004). These experiments were all carried out by transiently expressing HopD2 in
non-host Nicotiana plants. To determine if HopD2 could suppress or delay the onset of
HR-associated PCD in stable transgenic Arabidopsis plants, we investigated the ability of
the transgenic plants expressing HopD2 to mount the HR in response to Pst DC3000
carrying the avirulence gene AerptZ. Aerpt2 is secreted by Pst DC3000 into
Arabidopsis cells where it is recognized by the R protein RPS2, leading to the HR
(Kunkel et al., 1993; Yu et al., 1993). Under our laboratory conditions, recognition of
Aerpt2 by RPS2 led to the onset of the HR in C01 glI plants approximately 14-16 hours
after bacterial inoculation (Figure 4-5). Development of the HR in HopD2 and
HopD2C3788 transgenic plants was indistinguishable from Col glI in both the severity and
timing of PCD-associated tissue collapse. Similar results were obtained when plants were
inoculated with Pst DC3000 carrying the avirulence genes AvrB or AverhB (data not
shown). These results suggest that the virulence function of HopD2 in the susceptible

host Arabidopsis is not related to suppression of HR-associated PCD.

157

Col glI HopD2 HopD2C3788

16 hrs

 

24 hrs

 

Figure 4-5: Onset of HR in C01 g1] and HopD2 transgenic plants. Col glI , HopD2, and
HopDZC378$ plants were sprayed with 30 11M DEX 24 hrs prior to vacuum-infiltration
with bacterial suspensions of 1 x 108 cfu/ml Pst DC3000 carrying the avirulence gene
aerptZ. Onset of HR was observed by monitoring tissue collapse associated with cell
death. Representative leaves were detached for imaging at 16 hrs (upper panel) and 24
hrs (lower panel) after inoculation. Note that neither the timing, nor severity of the HR
was affected by transgenic expression of HopD2.

158

Activation of the Arabidopsis MAPKs AtMPK3 and AtMPK6 is enhanced in HopD2
transgenic plants.

Our observations that transgenic expression of HopD2 allows multiplication of
the hrpA mutant, reduces papilla-associated callose deposition, and blocks flg22-induced
resistance to Pst DC3000 suggest that the virulence function of HopD2 in host plants is to
suppress PAMP-induced innate immunity by dephosphorylating a host target or targets.
There are several potential mechanisms through which HopD2 could act to block
defenses associated with PAMP-induced innate immunity including blocking early
signaling events initiated by pattern recognition receptors (PRRs) such as FLS2, altering
gene expression changes associated with innate immunity, or blocking later events such
as vesicle trafficking leading to deposition of papillae. Activation of mitogen-activated
protein kinases (MAPKs) is known to be an early step in the signal transduction cascade
initiated by the FLS2 receptor (Asai et al., 2002). The MAPKs AtMPK3 and AtMPK6
are activated in response to perception of flg22 by FLS2. Because MAPKs require
tyrosine phosphorylation to become activated, we hypothesized that HopD2 may block
PAMP-induced signaling initiated by PRRs by dephosphorylating and thus, inactivating
AtMPK3, AtMPK6, or both. To test this hypothesis, we investigated the activation of
AtMPK3 and AtMPK6 in HopD2 transgenic plants and in wild-type Col plants after
inoculation with Pst DC3000 or the AhopDZ mutant. We observed no significant
difference in activation of AtMPK3 or AtMPK6 in C01 gl I plants inoculated with Pst
DC3000 or the AhopDZ mutant. Both Pst DC3000 and the AhopDZ mutant began to elicit
activation of AtMPK6 above background levels by 9 hrs after vacutun-infiltration with

more significant activation by 12 hrs after infiltration (Figure 4-6A). Activation of

159

AtMPK3 was not observed in response to either Pst DC3 000 or the A hopD2 mutant at the
time-points observed in our experiments. As a control, Col glI plants were inoculated
with Pst DC3000 carrying the avirulence gene aerpt2. This strain elicits the HR and
caused strong activation of both AtMPK3 and AtMPK6 as early as 3 hours after
infiltration. To our surprise, HopD2 transgenic plants exhibited significant activation of
AtMPK6 and slight activation of AtMPK3 compared to C01 glI or HopD2C37°° prior to
bacterial inoculation (0 hrs; Figure 4-6B). In addition to their role in signaling initiated by
the FLS2 receptor, AtMPK3 and AtMPK6 are activated by multiple biotic and abiotic
stresses including wounding. Constitutive activation of these kinases in plants expressing
HopD2 may result from general stress as these plants develop chlorosis and necrosis after
DEX treatment. AtMPK3 and AtMPK6 were activated even more strongly in HopD2
plants 1 hr after vacuum-infiltration with the Pst DC3000 hrpA mutant. HopD2C37°S
plants also exhibited slightly higher levels of kinase activation 1 hr after inoculation
compared to C01 glI . Taken together, our results with transgenic plants and the AhopDZ
bacterial mutant suggest that HopD2 does not exert its virulence activity by inactivating
the MAPKs AtMPK3 or AtMPK6. These results derived from bacterial infection of
stable transgenic plants are consistent with a recently published study in which HopD2
failed to block flg22-elicited activation of AtMPK3 or AtMPK6 in Arabidopsis
protoplasts (He et al., 2006), suggesting that HopD2 acts downstream or independent of

kinase activation to block PAMP-induced innate immunity.

160

Pst DC3000 Pst DC3000
1’“ DC3000 AhopDZ (aerptZ)

HP10369120369120369

 

err-“j. r," ,“""‘*‘W’iifi‘* "‘_‘-”.“'"-““ ”’VPTTWT*WW
3‘ _ 1 AtMPK6
.1" " ~=*~-*i'-- -----r In-
L.,... s. .__-.."s....-.... -4‘ ... ._ __ L' — ' ‘ “the *i ‘“
AtMPK3
B
Col glI HopD2 HopD2C3788

l
l
HP1012360123601236

 

 

H20 * - ” rung L.,. ”a”,
1’- ! "l. . . .
,

Figure 4-6: (A) Activation of the Arabidopsis MAPKs AtMPK3 and AtMPK6 in C01 gl 1
leaves after vacuum-infiltration with 1 x 10° cfu/ml suspensions of Pst DC3000, Pst
DC3000 AhopDZ, or Pst DC3000 (aerptZ). Leaf tissue was collected at the indicated
time-points and protein extracts were used for in-gel kinase assays. (B) Activation of
AtMPK3 and AtMPK6 in C01 gll , HopD2, or HopD2°°7°S leaves after inoculation with

1 x 10° cfir/ml hrpA mutant bacteria or a mock inoculum of sterile H2O. AtMPK3 and
AtMPK6 were identified by their electrophoretic mobility. In all panels, upper bands
represent AtMPK6 and lower bands represent AtMPK3.

161

HopD2 is a non—transmembrane protein tyrosine phosphatase and is present in both
the soluble and membrane fractions of Arabidopsis thaliana protein extracts.

Protein tyrosine phosphatases can be categorized into distinct subgroups based on
several aspects of their sequences, subcellular localizations, and substrate specificity
(Tonks, 2006). These proteins are classified as either transmembrane, receptor-like
phosphatases, or intracellular phosphatases. HopD2 lacks transmembrane domains, and
thus, is expected to be an intracellular phophatase. However, more specific information
about the localization of HopD2 in Arabidopsis cells could potentially provide clues to
help determine the substrate(s) of HopD2. Many TTSS effectors of Pst DC3000,
including AvrPto and Hole , have been discovered to be peripherally membrane
associated through modifications such as myrisoylation and other unknown mechanisms
(N omura et al., 2006; Shan et al., 2000). The effector AvrPto is associated with
membranes and membrane association is required for its ability to elicit the HR in
resistant tomato plants carrying the Pto kinase (Shan et al., 2000) and seems to be
required for its virulence function in Arabidopsis (Nomura and He, unpublished). To
determine if HopD2 is localized to membranes in Arabidopsis cells, protein extracts from
DEX-induced HopD2 and HopD2C378 plants were separated into soluble and membrane
fractions by ultracentrifugation. Western blots with HopD2 antibodies revealed that
HopD2 is detectable primarily in the soluble fraction of Arabidopsis protein extracts
(Figure 4-7A). However, some HopD2 was detected in the membrane fraction and
migrated at a slightly lower mobility, suggesting a potential post-translational
modification. Non-transmembrane protein tyrosine phosphatases are further categorized

into two classes based on substrate specificity. Classical protein tyrosine phosphatases

162

(PTPs) possess catalytic activity toward phosphotyrosine residues only, whereas dual
specificity phosphatases (DSPs) can act on phosphoserine or phosphothreonine residues
in addition to phosphotyrosine. Some DSPs have even been shown to act on non-protein
substrates such as phosphorylated lipids (Robinson and Dixon, 2006). The amino acid
sequence of HopD2 bears little similarity to known tyrosine phosphatases outside of the
conserved catalytic motif. However, the conserved catalytic domain bears greater

similarity to the canonical motif of PTPs than to that of DSPs (Figure 4-7B).

163

HopD2 HopD2C37°°

 

 

Soluble Membrane Soluble Membrane

5.! mu- 4.“ --'

   

‘45s.

- ‘._. mr‘nxr: W} _.
4 . ‘ ' .. . - Z
4‘ :l _ ‘p i
I ' .12 ‘ f ' .
‘ ‘ ‘=
. .
,‘ ‘ .I ~ ..
. . .
h
1 ‘ - "' ’-".'.'~ i . ' .31H’l'fl'i-EII

1t",

B
PTP-- PIVVHCSAGVGRTG
DSP-- rleHCqAGISRSa
HopD2-- SLVVHCNGGRGRTT

Figure 4-7: (A) Western blot analysis of soluble and membrane fractions of protein
extracts from HopD2 and HopD2C 7°° leaves. Plants were treated with 30 uM DEX 24 hrs
prior to extraction of total proteins. Total proteins were fractionated by
ultracentrifugation and fractions were analyzed by western blotting and detection with
HopD2-specific polyclonal antibodies. (B) Amino acid sequence alignment of the
consensus catalytic motifs of PTPs and DSPs (F auman and Saper, 1996) with the
catalytic region of HopD2. Capital letters in the FTP and DSP motifs represent highly
conserved residues present in 90% or more of family members.

164

Microarray analysis of HopD2 function using transgenic plants and bacterial
mutants.

As a protein tyrosine phosphatase, HopD2 has the potential to alter or disrupt
signaling pathways in the host. Given that transgenic expression of HopD2 in
Arabidopsis suppresses numerous defense readouts associated with PAMP-induced
innate immunity, we hypothesized that HopD2 may alter host signaling pathways and
changes in gene expression leading to the activation of basal defenses. To investigate the
effect of HopD2 on gene expression changes in Arabidopsis, we conducted microarray
analyses to profile gene expression changes associated with transgenic expression of
HopD2 in Arabidopsis, and with the presence or absence of HopD2 in bacteria using the
AhopDZ bacterial deletion mutant. To determine if transgenic expression of HopD2
altered gene expression changes associated with perception of the non-pathogenic hrpA
mutant (PAMP perception), Col gll, HopD2, and HopD2C°7°° plants were inoculated with
the hrpA mutant (1 x 10° cfu/ml) or a mock inoculum of sterile H20 24 hrs after spraying
with 30 11M DEX. Leaf tissue was collected 7 hrs after inoculation for RNA isolation,
labeling, and analysis of transcripts using Affymetrix ATHl genechips. Comparison of
mock-inoculated samples also allowed the identification of HopD2-dependent changes in
gene expression in the absence of bacterial challenge. A summary of the experiments and
comparisons performed using HopD2 transgenic plants is presented in Table 4-1. To
determine if transgenic expression of HopD2 is associated with gene expression changes
in unchallenged plants, expression profiles of mock-inoculated HopD2 plants were
compared to those of mock-inoculated Col gll plants. Remarkably, only 11 genes were

reproducibly differentially regulated in plants expressing HopD2 compared to wild-type

165

plants (Table 4-1, row 1). Furthermore, these changes in gene expression were not
dependent on phosphatase activity, as these genes were regulated similarly in HopD2°°7°S
plants (Table 4-1, row 2). These results suggest that HopD2 phosphatase activity does not
effect gene expression in unchallenged plants. To determine if HopD2 expression
suppresses or alters gene expression changes induced by PAMP perception, the
expression profiles of HopD2 plants inoculated with hrpA were compared to those of
hrpA-inoculated Col gl 1. This comparison revealed only 2 genes that were reproducibly
differentially regulated (Table 4-1, row 3). Similar to the previous comparison, the
alteration of expression observed for these genes was not dependent on HopD2
phosphatase activity (Table 4-1, row 4). Genes differentially regulated in HopD2 and
HopD2C3788 plants compared to C01 gll (Table 4-1, rows 1 and 3) are displayed in Table
4-2. To verify the quality and reproducibility of our dataset, the genes reproducibly
regulated in C01 gll by inoculation of the hrpA mutant were compared to the
independently identified set of genes regulated by the same treatment described in
Chapter 2. These datasets were found to be highly similar.

We also compared the expression profiles of Col gll plants inoculated with either
Pst DC3000, the AhopDZ mutant, or a mock inoculum of H20. Similar to the results with
our transgenic plants, we found no HopD2-specific gene expression changes in
comparisons of plants inoculated with the AhopDZ bacterial mutant to those inoculated
with wild-type Pst DC3000. Taken together, these results suggest that the virulence
function of HopD2 in Arabidopsis is not associated with alteration of gene expression or
blocking early signaling events mediated by PAMP perception and that HopD2 likely

blocks basal defenses at a relatively late stage, downstream of gene expression changes.

166

 

Repressed Induced

 

Comaflson Treatment Genesb Genesb Total Expression Pattern Identified
HopD2 vs. Col gl1 mock, 7 hrs. 3 8 11 HopDZ regulation
HopDZ vs. l-lopDan78$ mock, 7 his. 0 0 O Phophatase—dependent regulation
HopDZ vs. Col 9" 1x10° cfu/ml hrpA, 7 hrs. 2 0 2 HopDZ alteration of PAMP regulation
HopD2 vs. HopDZ03788 1x108 cfu/ml hrpA, 7 hrs. 0 0 0 Phosphatase-dependent regulation

 

Table 4-1: Microarray analysis of HopD2 transgenic plants. Summary of treatments and
comparisons used to identify gene expression changes resulting from transgenic
expression of HopD2 and changes dependent on the phosphatase activity of HopD2.

° Criteria for gene selection is described in the “Experimental Procedures” section of the
text.

167

 

 

 

 

Average Fold ("notifies
HopDZ HopDz
Array vs. vs.
Element AGI Description Col 9" Col {I1
266385_at_ At2914810 ~PR-1_ pathogenesis-related protein] 3.9 4.8
265943_at At2919570 .AtCDA1 cytidine deaminase 1 f 2.1 2.1
284648_at .At_1909080 putativelunfiljnalpingding prgteigflh _ fl H.,“... 3.5 3.3
264153_at A11965390 Putative TIR class disease resistance protein -4.9 -2.9
254975_at ‘At4g10500 oxidoreductase, ZOG-Fe(ll) oxygenase family protein; 4.3 2.5
254042_at At4925810 AtXTR6 xylogluean endotransglycosylase-related protein 5.7 13.0
251625_at At3957260 PR-2 pathogenesis-related protein 2, beta 1,3-glucanase 4.0 3.6
249032_at 7At5944910 putative disease resistance protein 7 -2.3 -2.3
248921_at ,At5945950 ,GDSL-motigf lipase/hydrolasg-likeprotein -2.3 -5.2
247925_at At5957560 AtTCH4 xylogluean endotransglycosylase 3.3 5.0
246302_at Atgq51860 AtCAX3 vacuolar CaZ+lH+-exchanging protein 4.8 4.4
B
Average Fold Chalclge’s
HopDZ HopDZ
Array vs. vs.
Element AGI Description Col 9" Col git
262399_at At1g49500 "expressed protein -3.4 -2.2
260101_at M3260 ‘trypsin and protease inhibitor family protein -4.9 -2.1

 

Table 4-2: Genes differentially regulated by transgenic expression of HopD2 and
HopD2C37°°. (A) Differentially regulated genes in HopD2 vs. Col gll and HopD2C°7°° vs.
Col gll comparisons after mock inoculation with sterile H2O (no bacterial challenge). (B)
Differentially regulated genes in HopD2 vs. Col gll and Ho D2C°7°° vs. Col gll
comparisons after inoculation with the hrpA mutant (1 x 10 cfu/ml).

168

Lipid profiling analysis of HopD2 transgenic plants.

Recent studies of protein tyrosine phosphatases have revealed that some DSPs,
particularly those of the myotubularin family in mammalian cells, can act on
phosphorylated lipids such as phosphoinositides (Robinson and Dixon, 2006).
Phosphatidylinositol lipids can be reversibly phosphorylated and exist in a number of
distinctly phosphorylated forms where the phosphotidylinositol headgroup can be
reversibly singly, doubly, and triply phosphorylated. Phosphoinositides (PIs) have been
shown to play an important role in regulating vesicle trafficking through interactions with
protein components of the membrane trafficking machinery (Di Paolo et al., 2004; Wenk
and Camilli, 2004). To determine if HopD2 dephosphorylates a PI lipid substrate in
Arabidopsis, the content of phosphotidylinositol species in lipid extracts from Col gll ,
HopD2, and HopD2C37°° leaves was analyzed by mass spectrometry. Previous studies
have analyzed phosphotidylinositol species in plants that fragment to give a parent ion of
mass-to-charge ratio (m/z) 241 using tandem mass spectrometry (Welti and Wang, 2004).
This parent ion represents the phosphotidylinositol head group with no additional
phosphate groups (ie. not reversibly phosphorylated). Using parent ion mode ESI-
MS/MS, we analyzed lipid extracts from Col gll, HopD2, and HopD2C°7°S for lipids that
fragmented to yield a parent ion of 241 m/z. In our lipid samples, the primary
phosphotidylinositol species detected were PI 34:3 (831 m/z) and PI 34:2 (833 m/z;
Figure 4-8). We did not observe any significant differences in the abundance of PI
species between HopD2 transgenic plants and Col gll (Figure 4-8). This result suggests
that HopD2 does not dephosphorylate a mono-phosphorylated PI lipid species. We also

examined the spectrum of lipids that fragmented to yield a parent ion of 321 m/z to

169

determine if HopD2 acts on a bi-phosphorylated PI lipid. Again, we found no significant
differences in the samples derived from HopD2 plants compared to C01 gll plants (data
not shown), suggesting that HopD2 does not dephosphorylate a bi-phosphorylated PI
lipid species. Further analysis of our lipid extracts to detect PI species that fragment to
yield a parent ion of 401 m/z will be required to determine if HopD2 acts on a tri-
phosphorylated PI lipid. However, these initial results of analyzing the PI lipid content of
HopD2 transgenic plants combined with the observation that the conserved active motif
of HOpD2 is more similar to that of PTPs rather than DSPs suggests that HopD2 is more
likely to act on a protein substrate, and, more specifically, a tyrosine-phosphorylated

protein substrate, than a phosphorylated lipid species.

170

A

 

 

1 ' 83‘18 3338
827.2 1
.33 3097 313381575175 823.4 . 335° 3418 844.9 848.8 553.9 8557.9 8°?28627
~. and ‘Vl‘m- ‘ 1. at“ ' ““"c-"e,1\,\,"‘\,.\J\ _J ‘o’jwt ,2 W V ,‘ --~.\-
011‘:U'—1""1'* 1 s. ' 1*1 1 '*’-**°'1*"ru
I
B
100 835.6 f333,3
. 815.0 5197 3232 i .6 855.5
°\ ”938100 j°1°f° 828.3 1'21“ 537.5 8434 M8475 848785578552 85397 351° ,1
a"! l V J vW‘ “'I'\,~ ‘*.-'°.‘»"' '4 'V‘r —- N“.'."‘»j ' ‘ w ‘m' 1..M “A ‘2 “MN ”\1‘ -"x "'
o .,...Tf.v ....--, c. as - .. -..,... , ..,.-c., - a,
100 8°16 (3335
815.0 519.7 3232 1'. 5346 855.5
5 8095110081“ , . 828.3 ‘ 5375 8434 847.5 8487 855711562 8597 °°1‘° 1‘1.
.57,"1'E~J\Vx\~\/“~I~»J°'~°l/ t' \“Il‘m 4v...“ ”ax—f -.__,' WN\AL ”‘55”wa .~‘.*..- '
0...--.-,. ...- -. - .s-.,..a..

 

Figure 4-8: Phos sghoinositide (PI) lipid content in extracts of (A) Col gll, (B) HopD2,

and (C) HopD2C3

°° leaves 24 hrs after treatment with 30 11M DEX. Lipid extracts were

analyzed by tandem mass spectrometry using a parent ion method to detect lipids
fragmenting to yield a parent ion of 241 m/z. Peaks at 831 m/z represent PI 34:3 and
peaks at 833 m/z represent PI 34:2. These data are from single MS/MS analyses of single

lipid extracts for each sample.

171

Discussion

Effector proteins delivered into host cells by plant pathogenic bacteria through
TTSSs are often essential virulence determinants. Emerging evidence suggests that a
major role of TTSS effectors in promoting bacterial virulence is the suppression of host
defense responses. However, the specific molecular mechanisms through which
individual TTSS effectors function to suppress host defenses are poorly understood. The
Pst DC3000 effector HopD2 is required for full virulence on the host plant Arabidopsis
and is a protein tyrosine phosphatase (Bretz et al., 2003; Espinosa et al., 2003). Previous
studies of HopD2 function carried out in non-host Nicotiana species suggested that
HopD2 may promote bacterial virulence through suppression of the HR (Bretz et al.,
2003; Espinosa et al., 2003). In this chapter I report that HopD2, when expressed
transgenically in the host plant Arabidopsis, does not suppress the HR elicited by Pst
DC3000 carrying the avirulence genes aerptZ, avrB, or averhB, suggesting that the
virulence function in the host plant is not related to suppression of the HR. Instead,
transgenic expression of HopD2 suppressed several defense responses associated with
PAMP-triggered innate immunity. Plants expressing HopD2 exhibited a reduced ability
to deposit callose associated with papillae in response to inoculation with the non-
pathogenic hrpA mutant and were completely impaired in resistance to Pst DC3000
induced by treatment with the flg22 peptide. Additionally, transgenic expression of
HopD2 was sufficient to promote significant multiplication of hrpA mutant bacteria.
Importantly, these effects of HopD2 expression were entirely dependent on an intact
phosphatase catalytic site as transgenic plants expressing HopD2‘33788 exhibited responses

similar to the parental Col gII plants.

172

HopD2, as a protein tyrosine phosphatase, may disrupt host signaling pathways
leading to the activation of basal defenses. MAPKs were obvious candidates for virulence
targets of HopD2 given their requirement for tyrosine phosphorylation for activation and
their roles in signal transduction. Specifically, the MAPKs AtMPK3 and AtMPK6 have
been shown to participate in signaling initiated by perception of bacterial flagellin by the
FLS2 receptor kinase (Asai et al., 2002). However, contrary to this expectation, we found
that transgenic expression of HopD2 caused enhanced activation of AtMPK3 and
AtMPK6. Even more strikingly, expression of HopD2 had no effect on gene expression
levels in Arabidopsis. No phosphatase-dependent alterations of gene expression were
observed in transgenic Arabidopsis plants in microarray experiments, nor did HopD2
effect changes in gene expression in response to perception of hrpA bacteria. These
results are in strong contrast with previous studies of transgenic plants expressing the Pst
DC3000 effector AvrPto. Transgenic expression of AvrPto was found to have significant
effects on gene expression and to cause changes in expression that were strikingly similar
to those induced by inoculation with Pst DC3000 (Hauck et al., 2003). The results of our
microarray experiments with HopD2 transgenic plants suggest that alteration of gene
expression is not a universal characteristic of transgenically expressed TTSS effector
proteins. Additionally, these results suggest that HopD2 acts at a significantly later stage
to suppress basal defenses, downstream of initial signaling events and gene expression
changes.

Protein tyrosine phosphatases are a broad group of enzymes including
transmembrane, receptor-like phosphatases and intracellular phosphatases that act on

diverse substrates including tyrosine-phosphorylated as well as serine- and threonine-

173

phosphorylated proteins and even phosphorylated lipids. HopD2 does not contain any
predicted transmembrane domains and was localized primarily to the soluble fraction of
protein extracts from HopD2 transgenic plants. However, some HopD2 protein was also
detected in the membrane fraction, suggesting that HopD2 may be peripherally
membrane associated. Several Pst DC3000 effectors, including Hole , AvrPto, and
Aerme , have been shown to localize to host membranes (N imchuk et al., 2000;
Nomura et al., 2006; Shan et al., 2000). Both AvrPto and Aerme carry potential
myristoylation signals that promote their membrane localization. HopD2 does not have
any predicted myristoylation signals. It will be interesting to determine how HopD2 is
targeted to host membranes and whether the membrane-localized pool of HopD2 is, in
fact, the active form. Alternatively, the presence of HopD2 in membranes may be an
artifact of overexpression in the plant cells.

Because our results suggest that HopD2 acts at a late stage to block PAMP-
triggered innate immunity, we suspect that HopD2 may potentially interfere with host
vesicle trafficking pathways leading to the deposition of papillae or secretion of
antimicrobial compounds. Reversibly phosphorylated PI lipids are hypothesized to play a
role in regulating vesicle trafficking events. We therefore examined the PI lipid content
of our HopD2 transgenic plants using mass spectrometry. Our results suggest that HopD2
does not act on mono- or bi-phosphorylated PI lipids. However, we have not investigated
the PI content of wild-type and HopD2 transgenic plants after induction of basal defenses
by the hrpA mutant or flg22. It is possible that the substrate of HopD2 is only
phosphorylated in response to detection of bacterial elicitors; therefore, further analysis

of the PI lipids will be required to rule out these molecules as targets of HopD2

174

phosphatase activity. However, it is noteworthy that the conserved PTP catalytic domain
of HopD2 bears greater similarity to that of tyrosine-specific phosphatases than to DSPs.
Taken as a whole, these results point toward a tyrosine-phosphorylated protein(s) as the
likely virulence target of HopD2.

Clearly, identifying the host target(s) of HopD2 phosphatase activity will be the
next step toward a mechanistic understanding of its virulence function. Additionally,
identifying the virulence target of HopD2 may provide novel information about the
mechanisms of PAMP-triggered innate immunity. Currently, relatively little is known
about the cell biological events leading to resistance to bacteria or about the compounds
that ultimately antagonize bacterial multiplication. During the past 5 years, significant
progress has been made toward understanding the early events of PAMP recognition
including the identification of the flagellin receptor, signal transduction components such
as MAPKs and transcription factors, and gene expression changes associated with innate
immunity (Asai et al., 2002; Gomez-Gomez et al., 2000; Thilmony et al., 2006; Zipfel et
al., 2004). However, the later events leading to enhanced resistance remain enigmatic.
Deposition of callose-rich papillae has long been correlated with restriction of bacterial
multiplication (Brown et al., 1995). However, the mechanisms by which plant cells target
defense-related compounds to specific locations at the site of interaction with invading
bacteria are unknown as are the specific compounds that act to restrict bacterial
proliferation. Because HopD2 acts at a late stage to block PAMP-induced defenses,
identifying the target(s) of HopD2 may also improve our understanding of these
enigmatic components of innate immunity in Arabidopsis. Interestingly, the human

pathogen Yersinia pseudotuberculosis also secretes a TTSS effector, YopH, that is a PTP.

175

Investigators were able to identify protein substrates of YopH by co-immunoprecipitation
using a catalytically inactive derivative that was found to trap substrates in unproductive
complexes in the absence of phosphatase catalytic activity (Black and Bliska, 1997). Our
observation that transgenic expression of the catalytically inactive HopD2C3788 has a
dominant-negative effect on the function of wild-type HopD2 delivered by Pst DC3000
suggests that HopD2C3788 may also form unproductive complexes with target proteins.
Therefore, it may be possible to co-immunoprecipitate substrates of HopD2 using the
catalytically inactive form as a substrate trap. Identifying the host target(s) of HopD2
should provide novel mechanistic insights into both bacterial virulence strategies and host

innate immune responses.

Acknowledgements

I would like to acknowledge Annette Thelen and the Research Technology
Support Facility at Michigan State University for valuable assistance with the Affymetrix
microarray analysis, Dr. Daniel Jones of the MSU mass spectrometry facility for training
and assistance with mass spectrometry and lipid profiling analyses, Dr. Shuqun Zhang
(Department of Biochemistry, University of Missouri) for performing in-gel kinase
assays reported in figure 4-6, and Dr. Steven Hutcheson (Department of Cell Biology and
Molecular Genetics, University of Maryland) for the kind gift of the Pst DC3000 AhopDZ

mutant.

176

References

Abrahams, G.L., and Hansel, M. (2006) Manipulating cellular transport and immune
responses: dynamic interactions between intracellular Salmonella enterica and its host
cells. Cell. Microbiol. 8, 728-737.

Abramovitch, R.B., Janjusevik, R., Stebbins, CB, and Martin, GB. (2006) Type III
effector AvrPtoB requires intrinsic E3 ubiquitin ligase activity to suppress plant cell
death and immunity. Proc. Natl. Acad. Sci. USA, 103, 2851-2856.

Abramovitch, R.B., Kim, Y.J., Chen, S., Dickman, M.B., and Martin, GB. (2003)
Pseudomonas type III effector AvrPtoB induces plant disease susceptibility by inhibition
of host programmed cell death. EMBO J. 22, 60-69.

Asai, T., Tena, G., Plotnikova, J ., Willmann, M.R., Chiu, W.L., Gomez-Gomez, L.,
Boller, T., Ausubel, F .M., and Sheen, J. (2002) MAP kinase signaling cascade in
Arabidopsis innate immunity. Nature, 415, 977-983.

Black, D.S., and Bliska, J.B. (1997) Identification of p130“IS as a substrate of Yersinia
YopH (Yop51), a bacterial protein tyrosine phosphatase that translocates into mammalian
cells and targets focal adhesions. EMBO J. 16, 2730-2744.

Bretz, J.R., Mock, N.M., Charity, J.C., Zeyad, S., Baker, C.J., and Hutcheson, SW.
(2003) A translocated protein tyrosine phosphatase of Pseudomonas syringae pv. tomato
DC3000 modulates plant defence response to infection. Mol. Microbiol. 49, 389-400.

Brown, 1., Mansfield, J., and Bonas, U. (1995) hrp genes in Xanthomonas campestris pv.
vesicatoria determine ability to suppress papilla deposition in pepper mesophyll cells.
Mol. Plant Microbe. Interact. 8, 825-836.

Buell, C.R., Joardar, V., Lindeberg, M., Selengut, J ., Paulsen, I.T., vainn, M.L., Dodson,
R.J., Deboy, R.T., Durkin, A.S., Kolonay, J .F ., Madupu, R., Daugherty, S., Brinkac, L.,
Beanan, M.J., Hafi, D.H., Nelson, W.C., Davidsen, T., Zafar, N., Zhou, L., Liu, J ., Yuan,
Q., Khouri, H., Fedorova, N., Tran, B., Russell, D., Berry, K., Utterback, T., Van Aken,
S.E., Feldblyum, T.V., D'Ascenzo, M., Deng, W.L., Ramos, A.R., Alfano, J .R.,
Cartinhour, S., Chatterjee, A.K., Delaney, T.P., Lazarowitz, S.G., Martin, G.B.,
Schneider, D.J., Tang, X., Bender, C.L., White, 0., Fraser, C.M., and Collmer, A. (2003).
The complete genome sequence of the Arabidopsis and tomato pathogen Pseudomonas
syringae pv. tomato DC3000. Proc. Natl. Acad. Sci. USA, 18, 10181-10186.

Chang, J .H., Urbach, J .M., Law, T.F., Arnold, L.W., Hu, A., Gombar, S., Grant, S.R.,
Ausubel, F.M., and Dangl, J.L. (2005) A high-throughput, near-saturating screen for type
III effector genes from Pseudomonas syringae. Proc. Natl. Acad. Sci. USA, 102, 2549-
2554.

177

Clough, 8.1., and Bent, A.F. ( 1998) Flora] dip: a simplified method for Agrobacterium-
mediated transformation of Arabidopsis thaliana. Plant J. 16, 73 5-743.

Comelis, G. R., and Van Gijsegem, F. (2000) Assembly and function of type III secretory
systems. Annu. Rev. Microbiol. 54, 735-774.

da Silva, A.C., Ferro, J .A., Reinach, F.C., Farah, C.S., Furlan, L.R., Quaggio, R.B.,
Monteiro-Vitorello, C.B., Van Sluys, M.A., Alrneida, N.F., Alves, L.M., do Amara],
A.M., Bertolini, M.C., Camargo, L.E., Camarotte, G., Cannavan, F., Cardozo, J .,
Chambergo, F., Ciapina, L.P., Cicarelli, R.M., Coutinho, L.L., Cursino-Santos, J .R., El-
Dorry, H., Faria, J .B., Ferreira, A.J., Ferreira, R.C., Ferro, M.I., Formighieri, E.F.,
Franco, M.C., Greggio, C.C., Gruber, A., Katsuyama, A.M., Kishi, L.T., Leite, R.P.,
Lemos, E.G., Lemos, M.V., Locali, E.C., Machado, M.A., Madeira, A.M., Martinez-
Rossi, N.M., Martins, E.C., Meidanis, J ., Menck, C.F., Miyaki, C.Y., Moon, D.H.,
Moreira, L.M., Novo, M.T., Okura, V.K., Oliveira, M.C., Oliveira, V.R., Pereira, H.A.,
Rossi, A., Sena, J .A., Silva, C., de Souza, R.F., Spinola, L.A., Takita, M.A., Tamura,
R.E., Teixeira, E.G., Tezza, R.I., Trindade dos Santos, M., Trufii, D., Tsai, S.M., White,
F.F., Setubal, J .C., and Kitajima, J.P. (2002) Comparison of the genomes of two
Xanthomonas pathogens with differing host specificities. Nature, 417, 459-463.

DebRoy, S., Thilmony, R., Kwak, Y.B., Nomura, K., and He, S.Y. (2004) A family of
conserved bacterial effectors inhibits salicylic acid-mediated basal immunity and
promotes disease necrosis in plants. Proc. Natl. Acad. Sci. USA, 101, 9927-9932.

Di Paolo, G., Moskowitz, H.S., Gipson, K., Wenk, M.R., Voronov, S., Obayashi, M.,
F lavell, R., Fitzsimonds, R.M., Ryan, T.A., and De Camilli, P. (2004) Impaired
PtdIns(4,5)P2 synthesis in nerve terminals produces defects in synaptic vesicle
trafficking. Nature, 431, 415-422.

Espinosa, A., Guo, M., Tarn, V.C., Fu, Z.Q., and Alfano, J .R. (2003) The Pseudomonas
syringae type III-secreted protein HothoD2 possesses protein tyrosine phosphatase
activity and suppresses programmed cell death in plants. Mol. Microbiol. 49, 377-3 87.

Fauman, BB, and Saper, MA. (1996) Structure and function of the protein tyrosine
phosphatases. Trends Biochem. Sci. 21, 413-417.

Fouts, D.E., Abramovitch, R.B., Alfano, J .R., Baldo, A.M., Buell, C.R., Cartinhour, S.,
Chatterjee, A.K., D'Ascenzo, M., Gwinn, M.L., Lazarowitz, S.G., Lin, N.C., Martin,
G.B., Rehm, A.H., Schneider, D.J., van Dijk, K., Tang, X., and Collmer, A. (2002)
Genomewide identification of Pseudomonas syringae pv. tomato DC3000 promoters
controlled by the HrpL alternative sigma factor. Proc. Natl. Acad. Sci. USA, 99, 2275-
2280.

Gomez-Gomez, L., and Boller, T. (2000) FLSZ: an LRR receptor-like kinase involved in
the perception of the bacterial elicitor flagellin in Arabidopsis. Mol. Cell, 5, 1003-1011.

178

Gomez-Gomez, L., Felix, G., and Boller, T., (1999) A single locus determines sensitivity
to bacterial flagellin in Arabidopsis thaliana. Plant J. 18, 277—284.

Guttman, D.S., Vinatzer, B.A., Sarkar, S.F., Ranall, M.V., Kettler, G., and Greenberg,
J .T. (2002) A functional screen for the type III (Hrp) secretome of the plant pathogen
Pseudomonas syringae. Science, 295, 1722-1726.

Hauck, P., Thilmony R., and He S.Y. (2003) A Pseudomonas syringae type III effector

suppresses cell wall-based extracellular defense in susceptible Arabidopsis plants. Proc.
Natl. Acad. Sci. USA, 100, 8577-8582.

Jamir, Y., Guo, M., Oh, H.S., Petnicki-chieja, T., Chen, S., Tang, X., Dickman, M.B.,
Collmer, A., and Alfano, J .R. (2004) Identification of Pseudomonas syringae type III

effectors that can suppress programmed cell death in plants and yeast. Plant J. 37 , 554-
565.

Janjusevic, R., Abramovitch, R.B., Martin, G.B., and Stebbins, CE. (2006) A bacterial
inhibitor of host programmed cell death defenses is an E3 ubiquitin ligase. Science, 311,
222-226.

Katagiri, F., Thilmony, R. and He, S.Y. (2002) The Arabidopsis thaliana-Pseudomonas
syringae interaction. In The Arabidopsis Book (Meyerowitz, E. M. and Somerville, C. R.,
eds). American Society of Plant Biologists, Rockville, MD, USA, DOI 10.1 l99-tab.OO39.

Kim, H.S., Desveaux, D., Singer, A.U., Patel, P., Sondek, J., and Dangl, J .L. (2005) The
Pseudomonas syringae effector AerptZ cleaves its C-terminally acylated target, RIN4,
from Arabidopsis membranes to block RPM] activation. Proc. Natl. Acad. Sci. USA, 102,
6496-6501.

Kim, M.G., da Cunha, L., McFall, A.J., Belkhadir, Y., DebRoy, S., Dangl, J .L., and
Mackey, D. (2005) Two Pseudomonas syringae type III effectors inhibit RIN4-regulated
basal defense in Arabidopsis. Cell, 121, 749-759.

Kunkel, B.N., Bent, A.F., Dahlbeck, D., Innes, R.W., and Staskawicz, B.J. (1993) RPSZ,
an Arabidopsis disease resistance locus specifying recognition of Pseudomonas syringae
strains expressing the avirulence gene aerptZ. Plant Cell, 5, 865-875.

Lindgren, P.B., Peet, R.C., and Panopoulos, NJ. (1986) Gene cluster of Pseudomonas
syringae pv. phaseolicola controls pathogenicity of bean plants and hypersensitivity of
nonhost plants. J. Bacteriol. 168, 512-522.

Navarro, L., Alto, M.N., and Dixon, J.E. (2005) Functions of the Yersinia effector
proteins in inhibiting host immune responses. Curr. Opin. Microbiol. 8, 21-27.

179

Nimchuk, Z., Marois, E., Kjemtrup, S., Leister, R.T., Katagiri, F ., and Dangl, J .L. (2000)
Eukaryotic fatty acylation drives plasma membrane targeting and enhances function of
several type III effector proteins from Pseudomonas syringae. Cell, 101, 353-363.

Noel, L., Thieme, F., Nennstiel, D., and Bonas, U. (2001) cDNA-AFLP analysis unravels
a genome-wide hrpG-regulon in the plant pathogen Xanthomonas campestris pv.
vesicatoria. Mol. Microbiol. 41, 1271-1281.

Nomura, K., DebRoy, S., Lee, Y.H., Pumplin, N., Jones, J ., and He, S.Y. (2006) A
bacterial virulence protein suppresses host innate immunity to cause plant disease.
Science, 313, 220-223.

Petnicki-chieja, T., Schneider, D.J., Tam, V.C., Chancey, S.T., Shan, L., Jarnir, Y.,
Schechter, L.M., Janes, M.D., Buell, C.R., Tang, X., Collmer, A., and Alfano, J .R. (2002)
Genomewide identification of proteins secreted by the Hrp type III protein secretion
system of Pseudomonas syringae pv. tomato DC3000. Proc. Natl. Acad. Sci. USA, 99,
7652-7657.

Robinson, F .L., and Dixon, J.E. (2006) Myotubularin phosphatases: policing 3-
phosphoinositides. Trends Cell Biol. 16, 403-412.

Roden, J .A., Belt, B., Ross, J .B., Tachibana, T., Vargas, J ., and Mudgett, MB. (2004)
A genetic screen to isolate type III effectors translocated into pepper cells during
Xanthomonas infection. Proc. Natl. Acad. Sci. USA, 101, 16624-16629.

Salanoubat, M., Genin, S., Artiguenave, F., Gouzy, J ., Mangenot, S., Arlat, M., Billault,
A., Brottier, P., Camus, J .C., Cattolico, L., Chandler, M., Choisne, N., Claudel-Renard,
C., Cunnac, S., Demange, N., Gaspin, C., Lavie, M., Moisan, A., Robert, C., Saurin, W.,
Schiex, T., Siguier, P., Thebault, P., Whalen, M., Wincker, P., Levy, M., Weissenbach, J .,
and Boucher, CA (2002) Genome sequence of the plant pathogen Ralstonia
solanacearum. Nature, 415, 497-502.

Sambrook, J ., Fritsch, E., and Maniatis, T. (1989). Molecular Cloning: a Laboratory
Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, USA.

Schechter, L.M., Roberts, K.A., Jamir, Y., Alfano, J.R., and Collmer, A. (2004)
Pseudomonas syringae type III secretion system targeting signals and novel effectors
studied with a Cya translocation reporter. J. Bacteriol. 186, 543-545.

Shan, L., Thara, V.K., Martin, G.B., Zhou, J .M., and Tang, X. (2000) The Pseudomonas
AvrPto protein is differentially recognized by tomato and tobacco and is localized to the
plant plasma membrane. Plant Cell, 12, 2323-2338.

Shao, F., Golstein, C., Ade, J ., Stoutemyer, M., Dixon, J.E., and Innes, R.W. (2003)
Cleavage of Arabidopsis PBSl by a bacterial type III effector. Science, 301, 1230-1233.

180

 

Soylu, S., Brown, I., and Mansfield, J .W. (2005) Cellular reactions in Arabidopsis
following challenge by strains of Pseudomonas syringae: From basal resistance to
compatibility. Mol. Plant Pathol. 66, 232-243.

Thilmony, R., Underwood, W., and He, S.Y. (2006) Genome-wide transcriptional
analysis of the Arabidopsis thaliana interaction with the plant pathogen Pseudomonas

syringae pv. tomato DC3000 and the human pathogen Escherichia coli 01 57:H7. Plant
J. 46, 34-53.

Thieme, F ., Koebnik, R., Bekel, T., Berger, C., Boch, J., Buttner, D., Caldana, C.,
Gaigalat, L., Goesmann, A., Kay, S., Kirchner, 0., Lanz, C., Linke, B., McHardy, A.C.,
Meyer, F., Mittenhuber, G., Nies, D.H., Niesbach-Klosgen, U., Patschkowski, T.,
Ruckert, C., Rupp, 0., Schneiker, S., Schuster, S.C., Vorholter, F.J., Weber, H., Puhler,
A., Bonas, U., Bartels, D., and Kaiser, O. (2005) Insights into genome plasticity and
pathogenicity of the plant pathogenic bacterium Xanthomonas campestris pv. vesicatoria
revealed by the complete genome sequence. J. Bacteriol. 187, 7254-7266.

Tonks, N.K. (2006) Protein tyrosine phosphatases: from genes, to function, to disease.
Nature Rev. Mol. Cell Biol. 7, 833-846.

Wei, W., Plovanich-Jones, A., Deng, W.L., Jin, Q.L., Collmer, A., Huang, HQ, and He,
S.Y. (2000) The gene coding for the Hrp pilus structural protein is required for type III

secretion of Hrp and Avr proteins in Pseudomonas syringae pv. tomato. Proc. Natl. Acad.
Sci. USA, 97, 2247-2252.

Welti, R., and Wang, X. (2004) Lipid species profiling: a high-throughput approach to
identify lipid compositional changes and determine the function of genes involved in
lipid metabolism and signaling. Curr. Opin. Plant Biol. 7, 337-344.

Wenk, M.R., and De Camilli, P. (2004) Protein-lipid interactions and phosphoinositide
metabolism in membrane traffic: Insights frOm vesicle recycling in nerve terminals. Proc.
Natl. Acad. Sci. USA, 101, 8262-8269.

Yu, G.L., Katagiri, F ., and Ausubel, F.M. (1993) Arabidopsis mutations at the RPSZ

locus result in loss of resistance to Pseudomonas syringae strains expressing the
avirulence gene aerptZ. Mol. Plant Microbe. Interact. 6, 434-443.

Zhang, S., and Klessig, DP. (1998) The tobacco wounding-activated mitogen-activated
protein kinase is encoded by SIPK. Proc. Natl. Acad. Sci. USA, 95, 7225-7230.

Zipfel, C., Robatzek, S., Navarro, L., Oakeley, B.J., Jones, J .D.G., Felix, G., and Boller,

T. (2004) Bacterial disease resistance in Arabidopsis through flagellin perception.
Nature, 428, 764-767.

181

Zwiesler-Vollick, J ., Plovanich-Jones, A.E., Nomura, K., Bandyopadhyay, S., Joardar,
V., Kunkel, B.N., and He, S.Y. (2002) Identification of novel hrp-regulated genes
through functional genomic analysis of the Pseudomonas syringae pv. tomato DC3 000
genome. Mol. Microbiol. 45, 1207-1218.

 

182

Chapter 5

Conclusions and Future Perspectives

183

The long-term goals of the study of plant-pathogen interactions are to improve our
understanding of plant defenses against pathogens and the mechanisms used by
pathogens to overcome these defenses and infect plants and to use this knowledge to
improve agricultural production. There is significant potential for improvement in
agricultural production through enhanced resistance to pathogens, as crop losses due to
disease have been estimated to reduce worldwide agricultural productivity by 12% (Food
and Agriculture Organization, 1993). In addition to increasing overall productivity and
agricultural output, development of more resistant crop varieties also has the potential to
reduce input costs associated with applications of pesticides and foliar sprays to control
pathogen spread and proliferation. Reducing the reliance on chemical sprays and
pesticides to control pathogens will also lessen the negative environmental impacts of
using such chemicals. Increasing agricultural productivity and efficiency is likely to
become very important in the near future, as increased demands will be placed on
agriculture for the food needs of a steadily increasing human population. In addition to
food needs, agriculture may also be relied on to provide other resources such as biofuels.
An increase in demand for agricultural output in the form of fuel crops will likely
challenge our agricultural systems to become more efficient in order to supply the
demands for both food and fuel.

To develop and institute novel strategies for controlling crop losses due to
pathogens will require a thorough understanding of the molecular nature of plant
defenses, the mechanisms by which successful pathogens overcome these defenses, and
the effects of varying environmental conditions on the effectiveness of defenses. It has

become clear that plants defend themselves from pathogens by employing multiple layers

184

of defense responses. It is likely that durable pathogen resistance, ofien described as non-
host resistance, is a combination of several successful layers of defense responses
including surface defenses and preformed barriers, apoplastic innate immune responses,
the hypersensitive response, and systemic acquired resistance. It will also be important to
understand why these defense responses are effective against many potential pathogens,
but fail to prevent infection by successful pathogens. The aims of the studies described
here were to improve our understanding plant innate immunity triggered by perception of
pathogen-associated molecular patterns (PAMPs) and the mechanisms used by a
successful bacterial pathogen to overcome these defenses.

When these studies were initiated, relatively little was known about PAMP-
induced innate immunity in plants. The discovery that Arabidopsis thaliana could
perceive bacterial flagellin was a significant breakthrough that sparked an increased
interest in innate immunity in plants (Felix et al., 1999). This discovery led to the
identification of the flagellin receptor and several downstream signaling components and
to the identification of several other PAMPs perceived by plants (Asai et al., 2002;
Gomez-Gomez et al., 2000; Kunze et al., 2004; Zeidler et al., 2004). An understanding of
PAMP perception and subsequent signaling events was beginning to take shape,
however, downstream events such as gene expression changes and activation of defense
responses were still poorly understood. We sought to investigate gene expression changes
in Arabidopsis thaliana associated with perception of PAMPs presented on live bacteria
by whole-genome microarray analysis. Additionally, we sought to analyze the specific
effects of the two well-characterized Pseudomonas syringae pv. tomato DC3000 (Pst

DC3000) virulence factors coronatine (COR) and the type III secretion system (TTSS) on

185

gene expression changes, including the effect of these virulence factors on expression
changes associated with PAMP-induced innate immunity. Our expression profiling
analyses described in chapter 2 identified 736 PAMP-regulated genes including 347
genes induced by PAMP perception. These expression profiles provide a molecular
signature of PAMP-induced innate immunity in Arabidopsis. Additionally, our analyses
identified candidate genes whose products may be involved in the downstream events
leading to defense responses such as deposition of papillae. Two particularly interesting
examples are the EXO70H1 and EXO70H2 genes that were strongly induced by PAMP
perception (5-15 fold). EXO70 proteins are components of a complex known as the
exocyst, which is composed of 8 subunits (Wang and Hsu, 2006). In yeast and
mammalian cells, the exocyst complex has been shown to be involved in targeted
exocytosis (Wang and Hsu, 2006). Although plants encode all 8 subunits of the exocyst
complex (Elias et al., 2003), the role of this protein complex in plants has not been
extensively characterized. Interestingly, a significant expansion of the EXO70 family of
proteins has occurred in plants. The genome of the yeast Saccharomyces cerevisiae
contains only a single EX 070 gene, while the Arabidopsis genome contains 22 EXO70
isoforms (Synek et al., 2006). The PAMP-induced EXO70H1 and EXO70H2 genes are
closely related and form a distinct clade (Synek etal., 2006). We are currently working to
identify T-DNA insertional mutants for each gene and to cross the mutants to determine
if these EXO70 proteins have a specific role in responses to pathogens such as facilitating
targeted vesicle trafficking leading to deposition of papillae. Our identification of

transcriptional changes associated with PAMP-induced innate immunity and with

186

specific effects of COR and the TTSS should facilitate further inquiry into the molecular
mechanisms of plant defense and COR and TTSS effector fimction in bacterial virulence.
Chapter 3 describes our discovery of bacterium-induced stomatal closure as an
integral part of the plant innate immune response. Prior to this study, stomata had been
generally regarded as passive ports of entry for bacteria. Although closure of stomata had
previously been observed in response to fungal elicitors such as chitosan (Lee et al.,
1999) and modulation of guard cell K+ currents was observed during the hypersensitive
response (HR) elicited by the Cladosporiumfulvum avr protein Avr9 (Blatt et al., 1999),
this study provided the first evidence that stomatal closure is a component of the plant
innate immune response and effectively restricts entry of bacteria into leaf tissue. We
found that stomata have the ability to perceive PAMPs present on the surface of bacteria
such as flagellin and LPS. PAMP-induced closure of stomata was dependent on the
presence of abscisic acid (ABA) and downstream components of the ABA signaling
pathway. Additionally, we found that the virulent pathogen Pst DC3000 can overcome
PAMP-induced stomatal closure. The phytotoxin COR was found to be the virulence
factor that allows Pst DC3000 to overcome stomatal closure and enter leaf tissue to
initiate infection. These findings open up many new areas for future research. Although
ABA and components of the ABA signal transduction pathway are required for
bacterium-induced stomatal closure, it is not yet clear if perception of PAMPs by pattern
recognition receptors such as F LS2 leads to increased biosynthesis of ABA or
relocalization of previously existing ABA pools. ABA and components of the ABA
signaling pathway mediate plant responses to numerous environmental stresses.

However, the signaling events upstream of ABA synthesis or mobilization are poorly

187

understood. Genetic screens are currently being pursued to identify signaling
intermediates linking activation of pattern recognition receptors by PAMPs to the ABA
signaling pathway (Zeng and He, unpublished).

The mode of action of COR in blocking stomatal closure or promoting opening of
closed stomata is not yet clear. COR did not block synthesis of nitric oxide (N 0) induced
by PAMP perception, suggesting that COR acts downstream or independent of NO
synthesis. However, the host target(s) of COR are yet to be discovered. Additionally,
only five P. syringae pathovars are known to produce COR, yet bacterium-induced
stomatal closure seems to be conserved among a variety of plant species, suggesting that
other pathovars and species of phytopathogenic bacteria have evolved distinct virulence
factors to overcome stomatal defense. Phytopathogenic bacteria are known to produce
numerous toxins and it will be interesting to determine if any of these toxins are also
involved in overcoming stomatal closure.

Guard cells are required to respond to numerous environmental stimuli including
light, C02 concentration, humidity, and the presence of bacteria. It is likely that, in some
cases, the plant may perceive conflicting signals necessitating a prioritization of the
stomatal response. How guard cells prioritize input signals is not known, but is of
significant relevance to plant-bacteriurn interactions. Severe outbreaks of bacterial
disease in plants are often associated with conditions of rain or high humidity. It is
possible that these conditions favor opening of stomata and allow more bacteria to enter
leaf tissues, promoting infection. A thorough understanding of the response of stomata to
numerous environmental inputs may facilitate the development of new strategies to

control outbreaks of bacterial disease in crop plants.

188

Chapter 4 summarizes my work to characterize the virulence function of the Pst
DC3000 TTSS effector HopD2 in Arabidopsis. HopD2 contains a conserved protein
tyrosine phosphatase (PTP) catalytic motif and previous studies have shown that HopD2
possesses tyrosine phosphatase activity in vitro (Bretz et al., 2003; Espinoza et al., 2003).
Additionally, the results of these studies suggested that HopD2 may promote bacterial
virulence by blocking or delaying activation of the hypersensitive response (HR).
However, I found that transgenic expression of HopD2 in Arabidopsis did not affect the
timing or severity of the HR elicited by several P. syringae avr proteins. This result
suggests that the virulence function of HopD2 in Arabidopsis is not related to suppression
of the HR. Instead, I found that transgenic expression of HopD2 resulted in the
suppression of defense responses associated with PAMP-induced innate immunity.
Transgenic expression of HopD2 suppressed flg22-induced resistance to Pst DC3000,
reduced papilla-associated callose deposition in response to inoculation with the Pst
DC3000 hrpA mutant, and promoted significant multiplication of the normally non-
pathogenic hrpA mutant bacteria. I also created transgenic Arabidopsis lines expressing

the catalytically inactive HopD2C3788

and found that the effects of HopD2 were dependent
on an intact phosphatase catalytic site.

Interestingly, transgenic expression of HopD2C3785 had a dominant-negative effect
on wild-type HopD2 delivered from Pst DC3000, suggesting that the catalytically

inactive HopD2C3788

may form unproductive complexes with host virulence targets of
HopD2. PTPs in yeast and mammalian cells are often found to be involved in regulation
of signal transduction pathways through the dephosphorylation of targets such as

mitogen-activated protein kinases (MAPKs). We tested the ability of HopD2 to block

189

activation of the Arabidopsis MAPKs AtMPK3 and AtMPK6, which are known to be
involved in signaling initiated by the FLS2 flagellin receptor (Asai et al., 2002). Contrary
to our expection, activation of AtMPK3 and AtMPK6 was enhanced in HopD2 transgenic
plants. Additionally, global gene expression profiling by microarray analyses revealed
that HopD2 does not effect gene expression in Arabidopsis. These results suggest that
HopD2 does not block signal transduction or gene expression changes leading to the
activation of innate immunity, but likely acts downstream of these events at a later stage
to block basal defenses.

Some PTPs, specifically those of the myotubularin family, have been shown to act
on phosphotidylinositol lipid species (Robinson and Dixon, 2006). Phosphoinositides
(PIs) are involved in numerous cell signaling and regulatory processes including the
regulation of targeted vesicle trafficking events (Di Paolo et al., 2004; Wenk and Camilli,
2004). To determine if HopD2 targets Arabidopsis PIs, I analyzed the PI lipid content of
the HopD2 transgenic plants by tandem mass spectrometry. The results of these analyses
show that HopD2 does not act on mono- or di-phosphorylated PIs, however, the effect of
HopD2 on tri-phosphorylated PIs has not yet been determined.

The next step toward understanding the virulence function of HopD2 will be the
identification of the Arabidopsis target(s) that are dephosphorylated by this effector.
Several approaches have already been pursued to identify physical interactors of HopD2

20785 as bait (Jin and He,

including yeast-two-hybrid analyses using HopD2 or HopD
unpublished) and co-immunoprecipitation experiments using the polyclonal HopD2
antibody (Underwood and He, unpublished). Thus far, our attempts to identify HopD2-

interacting Arabidopsis proteins have not been successful. However, the observation that

190

 

HopDZC3788 has a dominant-negative effect on HopD2 fimction suggests that this
catalytically-inactive protein may form unproductive complexes with host targets. The
Yersinia enterocolitica TTSS effector YopH is also a PTP and a catalytically-inactive
variant of YopH was found to trap substrates in unproductive complexes, allowing the
identification of virulence targets by Co-IP (Black and Bliska, 1997). Further attempts at
Co-IP, potentially using affinity-tagged versions of HopD2C3788, may facilitate the
identification of the virulence target(s) of HopD2. Additionally, DEX induction of the
HopD2 transgene in Arabidopsis seedlings results in lethality. This seedling-lethal
phenotype could be used as the basis for a suppressor screen to identify genetic
interactors of HopD2. However, this approach assumes that the seedling-lethal phenotype
is directly related to the virulence function of HopD2.

Our observation that HopD2 does not affect gene expression changes resulting
from activation of basal defenses as a result of perception of the Pst DC3000 hrpA
mutant suggests that HopD2 acts at a late stage to block PAMP-induced innate immunity.
Relatively little is known about the molecular events leading to the activation of basal
defense or the specific components of innate immunity that antagonize bacterial
proliferation. Because HopD2 is likely to act at a late stage to block PAMP-induced
innate immunity, identifying the virulence target(s) of HopD2 and their role in basal

defenses may shed light on the cellular components mediating innate immunity in plants.

191

References

Asai, T., Tena, G., Plotnikova, J ., Willmann, M.R., Chiu, W.L., Gomez-Gomez, L.,
Boller, T., Ausubel, F .M., and Sheen, J. (2002) MAP kinase signaling cascade in
Arabidopsis innate immunity. Nature, 415, 977-983.

Black, D.S., and Bliska, J .B. (1997) Identification of p130cas as a substrate of Yersinia
YopH (Yop51), a bacterial protein tyrosine phosphatase that translocates into mammalian
cells and targets focal adhesions. EMBOJ. 16, 2730-2744.

Blatt, M.R., Grabov, A., Brearley, J., Hammond-Kosack, K., and Jones, J .D. (1999) K+
channels of Cf-9 transgenic tobacco guard cells as targets for Cladasporiumfulvum Avr9
elicitor-dependent signal transduction. Plant J. 19, 453-462.

Bretz, J .R., Mock, N.M., Charity, J .C., Zeyad, S., Baker, C.J., and Hutcheson, SW.
(2003) A translocated protein tyrosine phosphatase of Pseudomonas syringae pv. tomato
DC3000 modulates plant defence response to infection. Mol. Microbiol. 49, 389-400.

Di Paolo, G., Moskowitz, H.S., Gipson, K., Wenk, M.R., Voronov, S., Obayashi, M.,
Flavell, R., F itzsimonds, R.M., Ryan, T.A., and De Camilli, P. (2004) Impaired

PtdIns(4,5)P2 synthesis in nerve terminals produces defects in synaptic vesicle
trafficking. Nature, 431, 415-422.

Elias, M., Drdova, E., Ziak, D., Bavlnka, B., Hala, M., Cvrckova, F., Soukupova, H., and
Zarsky, V. (2003) The exocyst complex in plants. Cell Biol. Int. 27, 199-201.

Espinosa, A., Guo, M., Tam, V.C., Fu, Z.Q., and Alfano, J .R. (2003) The Pseudomonas
syringae type III-secreted protein HothoD2 possesses protein tyrosine phosphatase
activity and suppresses programmed cell death in plants. Mal. Microbial. 49, 377-3 87.

Felix, G., Duran, J .D., Volko, S., and Boller, T. (1999) Plants have a sensitive perception
system for the most conserved domain of bacterial flagellin. Plant J. 18, 265-276.

Food and Agriculture Organization (1993) Production year book, FAO, Rome.

Gomez-Gomez, L., and Boller, T. (2000) FLSZ: An LRR receptor-like kinase involved in
the perception of the bacterial elicitor flagellin in Arabidopsis. Mol. Cell, 5, 1003-1011.

Kunze, G., Zipfel, C., Robatzek, S., Niehaus, K., Boller, T., and Felix, G. (2004) The N
terminus of bacterial elongation factor Tu elicits innate immunity in Arabidopsis plants.
Plant Cell, 16, 3496-3507.

Lee, S., Choi, H., Suh, S., Doo, I.S., Oh, K.Y., Choi, E.J., Taylor, A.T.S., Low, PS, and
Lee, Y. (1999) Oligogalacturonic acid and chitosan reduce stomatal aperture by inducing

192

the evolution of reactive oxygen species from guard cells of tomato and Commelina
cammunis. Plant Physiol. 121, 147-152.

Robinson, F.L., and Dixon, J .E. (2006) Myotubularin phosphatases: policing 3-
phosphoinositides. Trends Cell Biol. 16, 403-412.

Synek, L., Schlager, N., Elias, M., Quentin, M., Hauser, M.T., and Zarsky, V. (2006)
AtEXO70A1, a member of a family of putative exocyst subunits specifically expanded in
land plants, is important for polar growth and plant development. Plant J. 48, 54-72.

Wang, S., and Hsu, SC. (2006) The molecular mechanisms of the mammalian exocyst
complex in exocytosis. Biochem. Soc. Trans. 34, 687-690.

Wenk, M.R., and De Camilli, P. (2004) Protein-lipid interactions and phosphoinositide

metabolism in membrane traffic: Insights from vesicle recycling in nerve terminals. Proc.
Natl. Acad. Sci. USA, 101, 8262-8269.

Zeidler, D., Zé’thringer, U., Gerber, I., Dubery, I., Hartung, T., Bors, W., Hutzler, P., and
Durner, J. (2004) Innate immunity in Arabidopsis thaliana: Lipopolysaccharides activate
nitric oxide synthase (NOS) and induce defense genes. Proc. Natl. Acad. Sci. USA, 101,
15811-15816.

193

Appendix A

This appendix contains supplementary information for Chapter 2

I would like to acknowledge Dr. Roger Thilmony for contribution of figures A-l, A-4, A-
5, A-6, and A-7.

194

Average Fold Change

 

Amy
Element h A COR‘ hrpS E. coll

 

V267165_at At2937710 lectin protein kinase putative ,. p 1.70 2.89 1.70 -2.76
261836 at At116090 AtWAKL7 WAK-Iike kinase

 

267436_at At2919190 AtFRK1 Flagellin-induced receptor-like kinase 9.40 4.19 5.53 -1.10
266203_at At2902230 putative phloem-specific lectin _ g 3.32 2.89 3.10 -1.10
256181_at At1951820 leucine-rich repeat protein kinase. putative 9.40 3.25 5.53 -1.07

246373 at

          

At1951860 receptor-like urotein kinase. cutative ‘ 4.29 3.48 4.70 -1.05
. . F . ‘ . . . , A . "‘7 9 ~ ‘ .

263232_at At1gO5700 putative light repressible receptor protein kinase 6.35 7.29 7.13 1.32
254271_at At4923150 serine/threonlne kinase - like protein 2.00 3.40 1.91 1.35
255340_ at Al4gO4490 putative receptor-like protein kinase 2.52 2.89 1.95 1.41
247145 at A15965600_ receptor protein kinase- like Lrotein 8.19 4 92 ___2. 6__4__ 1 45
. -—, *z—r - —

 

24595326 ell-5425.440!- mateiilkmiefamomein an» at. " i- .14:—..ér1xZ§.-: ' 2:41 ‘ w 1.59.:

195

254660 at At4-_81250 receator serine/threonine kinase-like erotein 1 _3. 56 _ 3. 91 _ 2.14 _ 1.48

 

   

 

  
 

 

 

 

’11-"- -- Wmmmmm 1.: 1m MINI—m Iflhml .-. -k - ‘_
. ‘ leucine- rich repeat family protein/protein kinase family ‘ .
.256981_at At3g133804 protein 4 7 7 ., _ _ 1.95 2.89 2.19 1.70
29159.12: 461.192.8399- .argtgin uqmmmogin" _. __ __ _ -_ _ 3.82 1.91 3.10 1.70
‘251063_at At5gO1850 protein kinase. putative 1.45 2.35 -1.35 1.74
.-I.‘ ,7 .c' 1 6. .- . , ,,_., .- ,_.: , , . . _f . .. .__ _ .7 .. . . . W , ' ’
_ - :' , . .- c - - 3'1“‘J.'_‘3‘ '1": .22 .42.: :2 ’2' . : -32" , 4 ' » ’ '
I254410_at At4921410 serine thneonine kinase - like protein; 7 5.28 2.58 4.09 2.46
259640 _at A_t_5go715_0 leucine-rich repeat kinase far_n_ilyprotein_ _ _ _. ,_ 1 2.14 6.65 1.95 2.64
252511123. A13946280 protein kinase-related 8 19 4. 92 6.06 3.17
' ‘1'. J T ' Us“ l-i' " ' .E‘Q‘W ’.
mmmmm‘... 2:: 2.... .2... .... .2... 219m . '
248381_at At5951830 pike-type carbohydrate kinase family protein 2.76 2.70 1.87 6.50
248090_at_ At5955990 putative protein; similar to NP_K1__ related protein kinase 7.82 3.03 5.53 14.59

Table A-1: Known and predicted kinases induced by PAMP perception. Line within
table denotes cutoff for PAMP-induced genes that are repressed or not significantly
induced (less than 1.5-fold) by Pst DC3000. Genes below the line are PAMP- and Pst
DC3000-induced. Grey shading indicates genes previously identified as induced by the
bacterial PAMP flagellin.

196

Figure A-l

7.1

7.5

489

40

27

0.43

0.93

o
m
_L
m

In
d”
a)
N
A
u

. a:

_
a:
_I
N
_h
mt»
N
a.
w
a:
:-
o
c
3
'2

 

   
   
 
 
 
 
 
  
 
 
  
 
 
  

At4927410
R026 ANAC072 Transcription FactOI

At3945140
Lipoxygenase 2

A11 962660
Beta-Fructofuranosidase 3

M391 6390
jacalin-like lectin

 

 

At1943160
. RAP2.6 transcription factor

ANACO19 transcription factor

At2917500
Auxin efflux carrier

At1g1QS70
CLH1/CORI1 Chlorophyllase

 

 
  
  

A1391 6370
Proline Rich Protein

if“ At2919860
,- Hexokinese2

At2941940
ZFP8 Zinc Finger Protein

At5961 590
ERF Transcription Factor

At1933240
_' GTL2 Trihelix Transcription Factor

A139 1 3920
eif4A constitutive

197

4.5

4.1

39

0.14

0.24

0.19

2.2

25

39

0.25

0.36

 

Pst hrpS

Pst DC3000 Pst COR
0 12 24 36

12 24 12 24 36 hoursPl

   

 

   

  
   
 

 
  

At5926340
M881 Hexose Transporter

' A149023BO
(321

w ' . At4902940
v." Oxidoreductase

. 1‘ At2924850
Tyrosine Aminotransferase

At5924780
vsp1

 

 

 

 
 
 
 
 
 
 
 
 
 
  

At1g72610
Gennin Like Protein 1

At2938540
‘ Lipid Transfer Protein 1

An 9 1 2090
Extensin Like Protein

Lipase/hydrolase

At291 0940
Praline-rich protein

..a”h~.‘0
It... . ...'.‘

  

e
I

Figure A-l: RNA blot analysis of differentially expressed genes identified by
microarray analysis. (A) Samples were harvested from uninoculated, Pst hrpS and Pst
DC3000 inoculated tissues 6, 12, 18, 24 and 36 hours after infiltration with 1x106
bacteria/mL. The results for 8 induced genes, 5 repressed genes, and a constitutively
expressed control is shown. The average microarray ratio for a similar comparison is
shown on the lefi. (B) Samples were harvested from uninoculated, Pst hrpS, Pst DC3000
and Pst DC31 l8 COR" inoculated tissues 12, 24 and 36 hours afler infiltration with 1x106
bacteria/mL. The average microarray ratio for the Pst DC3000 vs Pst COR'hrpS and Pst
DC3000 vs Pst COR' comparison is shown on the left. The AGI identifier and gene
annotation is listed on the right.

198

  

I'm” a. . at.

armrm ‘ 3 . 13g13920
eff-IA

 
 

 

Figure A-2: RNA blot analysis of the PAMP-responsive gene F lageIlin-Induced
Receptor Kinase 1 (FRKI). RNA samples were isolated from leaf tissues harvested at 0,
2, 7, 10, and 24 hours after inoculation with the following. A. Mock inoculum; B. Pst
hrpA, 108 cfu/ml; C. Pst COR hrpS, 106 cfu/ml; D. Pst COR hrpS, 5x107 cfu/;ml E. Pst
DC3000, 106 cfu/ml; F. Pst DC3000, 108 cfu/ml. No 24 hour sample was collected for
treatment F as tissue collapse had begun to occur by this time point. Please note that at 2
HPI, FRKI is induced in all treated tissues, presumably due to the vacuum-infiltration
procedure.

199

 

 

 

 

 

 

 

  

7
I PstDC3000

5 .
I PstDCBOOOfIIC

5 I PstDC3000hrpA

4 I PstDC3000 hrpA/flIC

3..

Bacterial number [Iog(CFUIcm’)]

 

 

 

0 2 4

days post inoculation

 

 

 

Figure A-3: In planta multiplication of bacterial flagellin mutants. Arabidopsis Col-0
leaves were vacuum infiltrated with 1x106 bacteria/mL suspensions of Pst DC3000
(black), the Pst DC3000fliC mutant (green), the Pst DC3000 hrpA mutant (red), or the
Pst DC3000 hrpA fliC (blue) double mutant bacteria. Bacterial numbers per cm2 leaf
tissue was determined 0, 2, and 4 days after inoculation.

200

 

 

Non-MVA pathway Shikimatie pathway

.

c
'5'
u 3

Te Ienoida
TocoI erol

Fl

 

\

 

 

 

Sim ole henols

l

 

Sulfur containin»

 

 

 

Figure A-4: COR toxin induces genes involved in secondary metabolism and TTSS
effectors repress genes involved in photosynthesis. The average fold change (of the 3
biological replicates) is shown as illustrated in the fold change color bar in each panel.
(A) The MapMan ‘Secondary Metabolism’ display created using the 944 COR toxin-
regulated genes identified from the Pst DC3000 vs Pst COR' comparison (24 HPI, 1x106

bacteria/mL) is shown.

201

 

Figure A-5: Pst regulates the gene expression of enzymes in the tryptophan,
glucosinolate and related biosynthetic pathways. A. The expression profile of the genes
for 7 enzymes and the regulatory transcription factors ATRI and AT R2 following Pst
inoculation is shown. B. The expression profiles of 7 other genes which encode enzymes
within the pathways displayed in C are shown. Treatments: A- E. coli v mock; B- hrpA v
mock; C- DC3000 v mock; D— DC3000 v hrpA; E- corhrpS v mock; F- car v mock; G-
cor v corhrpS; H- corhrpS v mock; 1- car v mock; J - cor v corhrpS; K- DC3000 v cor; L-
DC3000 v mock; M- DC3000 v hrpA. C. The enzymes encoded by the genes displayed in
A and B are placed on their corresponding biosynthetic pathways. See Figure 2-1 legend
for a description of the gene expression display.

202

 

Figure A-5

8E 052.28% 3.935 E: _ma<

3:58 cease 5:839 8233

ow: 05283.3 3:35 BE 28%?
025.5 2292.2 9833-285 E2 83.95%
as 025:5 553a? 8255 23mm?
2% 025:5 553.5 25223 $3.33.
ugcomgazzmontozamoi 8238528 #4.; catwflax

m 3.232 E2 8353.

0359086 «5238 888=_woxo-~ EO< ouomowvsx
8E 2828.5 295559.50 83:» :<
83 8:98.95 43.222 2.5.. 8883.
820882 035.553.392.885 «Eng: 9:832
8E 852525 89.2.6 38%?

can 05259.9 89.25 883.2

83 035:5 32:55:. Nmm<:mm< can» .2
fizaaémeeznscofimofi 22:52.5 $2.03.
Sea 8:98:82 55 95. 834mg

72%.. oaaim 32225.2 1%.... 3.8839.
.252 oasim 03:555. 23. 8.2.8»?

 

88 ON WEI OFWHIMVNIBIOVBI

 

 

 

2

A

M a

=an .2:

H I O n— m D U m

:55? Bum ___—3.89 ac:—

<

<

203

Figure A-5 (cont’d).

chon'smate
ASA1 ASB1/ASBZ camilexin
anthran'late :
| ?: PAD3
PAT PAH T381 CYP7982 :

° PAIZI IGPi indoie-3- TSA . TSBZ CYP7983 MGM NIT .
ho honbos
p arft‘firanilatey‘. cerolphospha'lfi-‘k"lame--’tryptOphan _'acetalgoxime _p 4 GU30" 0AA)

Y

CYP79F1 '

. . CYP79F2 3-methylthio CY'383A13-methylthio ADP? .
homomethIonIne —"propanaldoxime —I> hydroximate —> —> —> _.p glucosInolates

204

J

 

Figure A-6: Bacterial inoculation alters auxin-related gene expression. The expression
profile of 44 auxin-related genes is shown. See Figure 2-1 legend for a description of the
gene expression display. Treatments: A- E. coli v mock; B- hrpA v mock; C- DC3000 v
mock; D- DC3000 v hrpA; E- corhrpS v mock; F- cor v mock; G- car v corhrpS; H-
corhrpS v mock; 1- car v mock; J- cor v corhrpS; K- DC3000 v cor; L- DC3000 v mock;
M- DC3000 v hrpA.

205

 

   

At4g38840 SAUR-14 small auxin up-regulated RNA
At4g38860 SAUR-16 small auxin upregulated RNA
At1929460 SAUR-65 small auxin up—regulated RNA
At2921200 SAUR-7 smdl auxin up—regulated RNA
A11929440 SAUR-63 small auxin upregulated RNA. GH3-lite
ABg53250 SAUR-57 small auxin up-regulated RNA
At4g12980 AlR12 Anion-Induced in Root cultures 12

   
   
  
 
  
 
 
  
  
  
  
  
  
  
  
  
 

At4g34770 SAUR-1 smdl auxin upregulated RNA

Angoauo SAUR-27 small auxin up-regulated RNA
A11929500 SAUR-66 snail auxin Lip-regulated RNA
At1929450 SAUR-64 snnll aIxin up-regulated RNA
At192951o SAUR-67 small auxin upregulated RNA
A11929430 SAUR-62 small andn upregulated RNA
At5918060 SAUR-23 small auxin up-regulated RNA

 

N4936110 SAUR- 9 small auxin up-regulated RNA
Atig75580 SAUR- 51 small auxin upregulated RNA

A6953590 $AUR—30 small auxin upregulated RNA

206

 

Figure A-7: Pst alters host cytokinin-related gene expression. Seven type A response
regulator genes, one type B response regulator (ARR14) and 1PT3, a cytokinin synthase
are repressed following Pst inoculation. Two cytokinin oxidase genes (CKX4 and CKX5)
are induced. See Figure 2-1 legend for a description of the gene expression display.
Treatments: A- E. coli v mock; B- hrpA v mock; C- DC3000 v mock; D- DC3000 v
hrpA; E- corhrpS v mock; F- cor v mock; G- car v corhrpS; H- corhrpS v mock; 1- car v
mock; J- car v corhrpS; K- DC3000 v cor; L- DC3000 v mock; M- DC3000 v hrpA.

207

Figure A-7

no.5 Sahara
320 859.2
$E< §§fl<
E 93383
”E. are;
E 2.83%
E 89%

 

E A M _.

___—Eco ea:—

 

: o mi
.559 .2

m D
xm

 

 

O m <

:550 .3:

208

 

 

     

MICHIGAN STATE UNIVERSITY LIBRARIES

ill/WI!ill/llllill/lill/Il/llllllll/l

3 1293 02845 57