.
$41....

r.‘ {47.3%}.

:J. G. .

h .

..

,iwmhhu

Le... x I:

i‘zu‘...

. acts-3:3”

.3 Fr...

(3...!
.1? Al.
553...}...3 1....
1:11.", ‘ VF

, 1.: I.
. . 1" i.
3...
5.1.54.

2.»

i“ &
3%».

.3...
a}

in.) .3
S.‘......4.¢.. ..
int:

..
.{ .!
Wag}. . s

3.37.. ,...n.

t

.h. a ‘ ..
MI ’32 . 1'.
)n .HHAHII... $.41“ .5‘
1.9.. .LJ...‘ .75.: R.
“(0:15! ‘ .Iihfl x b
9...: 3.7. 3, Rh.
7 x...u....,.a 1...: niggzo.
41.. S a 2.?! :3
«$5,... .. :1...» fix,

 

 

 

iii]. .51)
vii-1‘! 3!:
3231‘

 

 

gawaiywu. . _

1
9. ...

. Jill-(«41"

s #3.?»

 

a???

3%.

3| .

This is to certify that the
dissertation entitled

IDENTIFICATION AND ANALYSIS OF INDUCED GENES FROM
ERWINIA AMYLOVORA AND MALUS X DOMESTICA DURING
FIRE BLIGHT INFECTION

presented by

 

Sara E. Blumer—Schuette

has been accepted towards fulfillment
of the requirements for the

Ph.D. degree in Plant Pathology

 

 

W’—

 

Major Professor’s Signature

Dan. [5' 200C

Date

MSU is an Affirmative Action/Equal Opportunity Institution

unq-—.—.-.-.—.—.-.—-.--.-.—-.-.-.-.-.-.-.-.--.-.-.----.-.-.-.g.-.---.--.-.-.-.--.-.-.-.-.-.-----.--.-v--.-

 

 

LIBRARY
Michigan State
University

 

 

 

 

PLACE IN RETURN BOX to remove this checkout from your record.
To AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

“@103 9099

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2/05 pleIRC/DateDuejnddpJ

 

IDENTIFICATION AND ANALYSIS OF INDUCED GENES FROM ER WINIA
AMYLOVORA AND MAL US X DOMESTICA DURING FIRE BLIGHT INFECTION

By

Sara E. Blumer—Schuette

A DISSERTATION

Submitted to
Michigan State University
in partial fitlfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY
Department of Plant Pathology

2006

ABSTRACT

IDENTIFICATION AND ANALYSIS OF INDUCED GENES FROM ER WINIA
AMYLOVORA AND MALUS X DOMESTICA DURING FIRE BLIGHT INFECTION

By

Sara E. Blumer-Schuette

Fire blight, caused by the bacterial pathogen Erwim‘a amylovora, is a difficult disease to
manage due to the virulent nature of the pathogen, disease susceptibility of most popular
apple varieties, and the lack of known resistance genes in Malus spp. The goals of my
research are to identify and characterize genes fi‘om E. amylovora that are induced during
infection and to identify genes in Malus spp. that are associated with disease resistance. I
utilized an in viva expression technology screen to identify in planta upregulated E.
amylovora genes, two of which had homology to pseudopilins from a type II secretion
operon and an endo-polygalacturonase (peh). Deletion mutants of both the peh gene and
outhA were constructed to flirther analyze the contribution of type II secretion to the E.
amylovora-Malus spp. interaction. This work resulted in the first report of a
polygalacturonase enzyme influencing virulence of E. amylovora. Some apple cultivars,
such as Red Delicious, exhibit tolerance to fire blight. Because resistance to fire blight
appears to be a quantitative trait in apple, I chose to identify genes associated with
resistance using suppressive subtractive hybridization. I generated 183 unique expressed
sequence tags (ESTs) fiom cultivar Red Delicious during infection that are absent or
repressed in the fire blight sensitive cultivar Gala. Temporal expression analysis
identified 21 of the ESTs which are induced in Red Delicious of which eight show

differential expression in other apple cultivars of varying resistance to fire blight. Further

functional characterization of these genes will shed new light on signaling cascades that
lead to a successful resistance response; in addition these genes can be converted into
molecular markers for mapping onto linkage maps of apple for use in marker assisted

selection of E. amylovora resistance in apple breeding projects.

Copyright by
SARA E. BLUMER-SCHUETTE
2006

To my husband Eric, who never stopped smiling.

ACKNOWLEDGMENTS

I first need to acknowledge my major advisor Dr. George Sundin for his effort, patience
and support during my graduate studies. I appreciate and admire the continual optimism
and adventurous attitude that George brings to the Sundin lab. I thank my committee
members, Dr. Dennis Fulbright, Dr. Sheng Yang He and Dr. Steve vanNocker for their
suggestions and input on my research and also for their comments and reviews for my
dissertation.

I would like to thank Dr. Youfu Zhao for collaborating with me on the first chapter of my
dissertation, and for the discussions and help during my studies as well. I thank Gayle
McGhee for kindly donated the gus-reporter strain, pGCMO used in chapters one and two
and is always willing to talk about life, MUG and pears. I would like to thank Gail Ehret
for always managing to find the apple trees we needed and for taking me out into the
field. Even though the trips were as much about the Blue Bird as they were about work, I
learned a great deal fiom Gail about plant pathology while out in the field. I also want to
thank the other students from the Sundin lab past and present: Lisa Renick, Andrea
Cogal, Lindsay Tripplett, Jessica Koczan, Mike Weigand, Erin Lizotte and Matt Berry for
their camaraderie, research discussions and general mayhem when appropriate.

None of this would have been possible if it wasn’t for my parents Ronald and Susan
Blumer who have supported and encouraged me throughout my studies and have
patiently waited ten years to see this day. I also am lucky to have supportive in-laws,

Ernest and Sandra Schuette who opened their home to me.

vi

TABLE OF CONTENTS

LIST OF FIGURES .................................................................................. ix

LIST OF TABLES .................................................................................... x

LITERATURE REVIEW ............................................................................ 1
Epidemiology of fire blight ..................................................................... 2
Molecular mechanisms of E. amylovora pathogenicity ..................................... 4
Virulence factors of E. amylovora ................................................................................. 6
Type H secretion in phytopathogenic bacteria ................................................ 8
Exoproteins secreted by type II secretion ................................................... 11
Host response to fire blight infection ......................................................... 13
Using plant genomics to complement genetic analysis of resistance loci ............... 16
Resistance gene analogues ..................................................................... 19
Candidate gene analysis with crop-specific RGAs ......................................... 20
Comparative genomics for R gene discovery ............................................... 23
Candidate gene analysis using crop-specific EST data .................................... 24
Synthesis of genomic and genetic data: Broad spectrum disease resistance. . . . . ....25
Concluding Remarks ........................................................................... 26

CHAPTER 1

Identification of Erwinia amylovora genes induced during infection of immature pear

tissue .................................................................................................. 28
Abstract .......................................................................................... 29
Introduction ...................................................................................... 30
Materials and Methods ......................................................................... 34
Results ............................................................................................ 43
Discussion ....................................................................................... 64

CHAPTER 2

Taking a page from macerogenic bacteria: Functional characterization of an Erwinia

amylovora endo-polygalacturonase and its effect on virulence .............................. 72
Abstract .......................................................................................... 73
Introduction ...................................................................................... 74
Materials and Methods ......................................................................... 78
Results ............................................................................................ 88
Discussion ...................................................................................... 1 05

CHAPTER 3

Genetic response of resistance-related genes to E. amylovora infection in Malus X

domestica cultivars with varying levels of resistance ......................................... 111
Abstract ......................................................................................... 1 12
Materials and Methods ....................................................................... 117

vii

Results .......................................................................................... 124

Discussion ...................................................................................... 141
APPENDIX ........................................................................................ 147
REFERENCES .................................................................................... 1 5 5

viii

LIST OF FIGURES

Figure 1: Overview of the IV ET screen for E. amylovora genes induced during infection
of immature pear discs .............................................................................. 45

Figure 2: Symptoms and bacterial growth of Erwinia amylovora WT strains and hrpA
and dspE mutants in immature pear ............................................................... 48

Figure 3: Symptoms and growth of Erwinz’a amylovora WT Ea1189 and corresponding
hothngA and mltEEA mutants in immature pear ............................................... 64

Figure 4: Alignment of type H secretion systems from Y. enterocolitica (ytsl) and E.

amylovora (outga) ................................................................................... 89
Figure 5: Areas of necrosis on inoculated immature pears ..................................... 95
Figure 6: Ruthenium red stain for polygalacturonase activity ............................... 102
Figure 7: Western blot ofEa1189(pSEB31) subcellular fractions .......................... 102
Figure 8: Supernatant proteins separated out on SDS-polyacrylamide gel ................ 104
Figure 9: Representation of the suppression subtractive hybridization library

construction ......................................................................................... 119
Figure 10: Representative radiographs of differentially screened EST clones ............ 126
Figure 11: Representative cDNA nylon macroarray hybridization ......................... 129

Figure 12: Semi-quantitative RT-PCR with cultivars Empire, Fuji and Red
Delicious ................................................. i .......................................... 138

Figure 13: PCR amplifying gene fragments corresponding to the EST of the 14-3-3 and
unknown gene with genomic DNA of Empire, Fuji, Gala and Red Delicious ............ 140

ix

LIST OF TABLES

TABLE 1. Bacterial strains, plasmids and primers used in this study ........................ 35
TABLE 2. Selected list of Erwim'a amylovora genes induced during infection of
immature pear tissue ................................................................................ 52
TABLE 3. Expression of NET clones after inoculation of immature pear fi'uit ........... 63
TABLE 4. Bacterial strains, plasmids and primers ............................................. 80
TABLE 5. Protein homology of E. amylovora Out operon .................................... 91
TABLE 6. Fold induction of promoter-uidA fusion constructs inoculated in minimal
medium ............................................................................................... 97
TABLE 7. Fold induction of promoters upon infection of apple cultivar ‘Gala’ ......... 100
TABLE 8. Oligonucleotide primers used in this study ....................................... 123

TABLE 9. Classification of ESTs recovered from an SSH experiment subtracting cDNA
of apple cultivar Gala fi'om Red Delicious following inoculation with E. amylovora.... 125

TABLE 10. Red Delicious ESTs with two-fold or higher induction after inoculation with
E. amylovora ........................................................................................ 128

TABLE 11. ESTs that are induced to higher levels in apple cultivar Red Delicious versus
Empire following inoculation with E. amylovora .............................................. 132

TABLE 12. ESTs that are induced to higher levels in apple cultivar Red Delicious versus
Fuji following inoculation with E. amylovora ................................................. 133

TABLE 13. Constitutively expressed ESTs of apple cultivar Red Delicious and analysis
of expression of these genes in the cultivars Empire and Fuji ................................ 136

TABLE 14. Complete list of sequenced BSTs fi'om an SSH library constructed by
subtracting cDNA pools from the apple cultivars Red Delicious and Gala after
inoculation with E. amylovora ................................................................... 147

LITERATURE REVIEW

Fire blight is a necrogenic disease of rosaceous plants caused by the gram
negative bacterium, Erwinia amylovora. In the United States, fire blight can be a
devastating disease on non-native hosts such as domestic apple, pear and quince due to
the lack of resistance in popular cultivars and limited control options. Due to the limited
amount of control options available, there is interest in the molecular mechanisms of fire
blight in order to generate novel control measures. Initial genetic research of the
pathogen E. amylovora has identified major pathogenicity factors such as the secreted
effector protein DspE, a type III secretion system and production of the
exopolysaccharide amylovoran (18, 21, 26, 82, 127). The discovery of these
pathogenicity factors relied mainly on the creation and mapping of non-pathogenic
mutants using phage insertional mutagenesis (239). Research investigating the host
response to fire blight infection has demonstrated the induction of known pathogenesis
related (PR), antioxidant and phenylpropanoid pathway genes (31, 35, 153, 248, 249).
Currently, no resistance genes for fire blight have been identified; however absolute
resistance does exist in Malus species related to domestic apple and certain cultivars of
domestic apple show elevated levels of resistance to fire blight. Due to the increased ease
and availability of genomic and genetic techniques, I chose to look at the fire blight
pathosystem on a larger genomic scale in order to identify additional virulence factors
from E. amylovora and resistance response genes from Malus X domestica cultivar Red

Delicious.

Epidemiology and control of fire blight

Fire blight was first described on rosaceous fruit trees in New York around 1780,
and is thought to be indigenous to North America. The disease moved westward along
with the movement of European settlers bringing nursery stock from the eastern United
States, until fire blight was present throughout the entire United States and part of
Canada. As apple and pear nursery stock were exported from the United States, fire
blight spread worldwide to Europe, the Middle East, and New Zealand (32).

Fire blight is disseminated in orchards by either insects or wind and by the use of
contaminated tools and epidemics can develop when both humidity and temperature are
high during bloom. In late spring to early summer, over-wintering cankers will start to
exude bacterial ooze produced by E. amylovora that can be spread to flowering trees by
pollinating insects such as bees or by wind and or rain. Once E. amylovora is transferred
to a blossom, the bacteria can survive briefly as epiphytes, multiplying on the surface of
stigmas (241). Afier this brief epiphytic phase, E. amylovora enters the plant through
nectarthodes located in the floral cup. The blossom typically becomes necrotic at this
point, and this mode of infection is referred to as blossom blight. Bacteria that enter
through the nectarthodes may also infect immature fruit that develop from an infected
blossom, creating secondary sources of inoculum as bacterial ooze exudes from the
infected fruit (119). Again, wind and rain can carry droplets of ooze that contain
embedded E. amylovora to wounds on stems and leaves created by wind or mechanical
damage. Infection through the stems and leaves results in the movement of E. amylovora

to the vascular tissue, where surrounding parenchyma tissue collapses and disrupts water

and solute transport. The disruption of the vascular system contributes to the formation
of shoot blight which is typified by a shepard’s crook that quickly becomes necrotic and
also may exude bacterial ooze (241). Movement of E. amylovora through the vascular
system can continue down into the rootstock, killing the vascular system in a susceptible
rootstock which will eventually kill the entire tree, this is commonly referred to as
rootstock blight (168). Shoot blight will typically form cankers in woody stem tissue that
are the primary source of over-wintering inoculum mentioned above. There are also
cases of E. amylovora surviving in budwood that could also act as primary sources of
inoculum (241).

Control of fire blight is often through the use of cultural practices, copper sprays
and antibiotics. Cultural practices are comprised of the selection of resistant rootstocks
and scions, reduction of inoculum by pruning of diseased tissue and cankers from the
orchard and sanitation of tools used for pruning. In respect to chemical control, the
application of copper sprays can only be used before leaf set, due to phytotoxicity, which
limits copper sprays to only controlling primary E. amylovora populations in the early
summer (182). Streptomycin is the most commonly used antibiotic for fire blight control,
which is used to control blossom blight and to reduce inoculum levels after violent rain
storms that cause tissue damage (157). Development of streptomycin resistance has
reduced the effectiveness of streptomycin applications for controlling fire blight.

Streptomycin resistance in E. amylovora populations has developed through two
independent means. The first report of streptomycin resistant E. amylovora in California
was due to a single point mutation in the streptomycin binding site of ribosomal protein

812 (48). In addition to the isolation of ribosomal point mutations, some streptomycin

resistant E. amylovora populations in Califomia carry plasmid pEa8.7 that contains the
streptomycin resistance genes strA-strB. Streptomycin resistance in Michigan however
has arisen due to the horizontal transfer of plasmid pEA34 which harbors the transposon
Tn5393 that expresses the streptomycin resistance genes strA-strB under the control of a
promoter located in the insertion element 181133 (49). The transposon Tn5393 has also
jumped to the ubiquitous plasmid pEa29 and to the chromosome of some field isolates
and as a result, fewer streptomycin resistant E. amylovora are found that harbor the

plasmid pEa34 (155, 158).

Molecular mechanisms of E. amylovora pathogenicity

As mentioned before, three major pathogenicity factors have been identified for
E. amylovora. First is the capability to secrete effector proteins using the type III
secretion system. Type III secretion utilizes a needle-like structure to translocate proteins
across the bacterial inner and outer membranes into the host cell. This secretion system
is highly conserved among both animal and plant pathogenic bacteria and is independent
of Sec-mediated protein secretion (39). In E. amylovora the type III secretion system is
organized into hip (hypersensitive response and pathogencity) operons (27, 127, 253).

Regulation of the hrp operons ensures that the type III secretion machinery is only
expressed during conditions that mimic the apoplast of the host such as low nutrient
content and low pH. The two-component sensor hrpXY locus is responsible for the first
known signaling step for hip expression. The sensor protein, HrpX is theorized to be
anchored to the inner membrane and responds to favorable hrp-inducing stimuli by

phosphorylating Her. Activated response regulator protein Her contains a helix-tum-

helix motif that is then able to bind upstream of the hrpL gene to induce transcription
along with sigma factor 54 and another enhancer protein HrpS (252). HrpL is the main
activator of transcription of the structural hrp operons and effector protein genes that
contain hrp boxes upstream of the gene (125). Interestingly enough, recent evidence
suggests that HrpL downregulates flagellar biosynthesis due to the observed increased
motility and flagella formation in hrpL mutants (44)

All bacteria that posses functional type III secretion systems share a core set of
nine conserved hrp genes that were renamed as hrc (hypersensitive response and
gonserved) genes. This includes hrcC which encodes the outer membrane pore forming
protein, hch which encodes a lipoprotein, five hrc genes encoding inner membrane
proteins, an ATPase homologue hrcN and the gene hch that encodes a protein that may
be secreted (125). Another hm gene that are known to form the type III secretion
apparatus in E. amylovora is hipA which was demonstrated to encode the pilin that forms
the type 1H secretion pilus in E. amylovora, mutants in hrpA were non-pathogenic and
known type III secreted proteins remained in the cytoplasm (118).

Besides the type III secretion system, a secreted effector protein, DspE is the
second pathogenicity factor of E. amylovora. Originally, dspE mutants were observed as
disease specific mutations, with no effect on the HR when the mutants were inoculated
on tobacco (193). It was later demonstrated that dspE mutants could elicit an HR on
tobacco especially in highly virulent strains of E. amylovora and also on soybean leaves.
In addition, the transfer of the dspEF locus to Pseudomonas syringae pv. glycinea
rendered it avirulent on soybean (26). DspE was demonstrated to rely on its chaperone

DspF for secretion and that secretion was of DspE used type III secretion (25, 82). Later

studies determined that the chaperone DspF interacts with and protects DspE from
degradation (83). Genetic analysis determined that the upstream sequence of dspE
contains a hrp box, and expression of dspE is HrpL-dependant and coordinated with
expression of the neighboring hrp operons (82).

Amylovoran, the main exopolysaccharide produced by E. amylovora is the third
major pathogenicity factor. Biosynthetic genes for amylovoran production are organized
into the ams operon that consists of 12 genes. Regulation of the ams operon is by a two-
component regulatory system RcsB/C (2, 19, 123), and the global regulator protein H-NS
which inhibits the production of both amylovoran and levan (103). Amylovoran is
comprised mainly of a repeating galactose backbone with galactose and glucuronic acid
side chains (84). The composition of sugar monomers in amylovoran can change
amongst E. amylovora isolates from differing host tissues, such as E. amylovora isolates
from Rubus spp. that are unable to infect apple or pear (148). Mutants in key genes of the
amylovoran biosynthetic operon were non-pathogenic and unable to move or increase
cell numbers in planta (18, 28). This exopolysaccharide is thought to obstruct the host
vascular tissue, have a protective role for E. amylovora from oxidative burst and
desiccation and also a possible role for masking outer membrane proteins from the host

(84,128,148)

Virulence factors of E. amylovora

Virulence factors also contribute to infection by E. amylovora including
additional effector proteins HrpN and AerptZEA (253, 268), the iron-binding

siderophore desferrioxamine (60), and genes required for metabolism of sorbitol (3),

sucrose (29) and galactose (161). The effector protein HrpN was the first type III
secreted protein from E. amylovora to be described and insertional mutants were non-
pathogenic on immature pear fruit (253). Irnmunogold labelling of HrpN protein

demonstrated that HrpN is secreted into the host apoplast, but not delivered into the host
cells (193). Recently, HrpN3937 from Erwinia chrysanthemi was determined to act as an

aggregation factor and is required for the successful formation of the pellicle (262). It
remains to be determined if HrpN from E. amylovora is involved in the formation of a

biofilm in planta.

Recently AerptZEA, an additional effector protein contributing to virulence was
described by Zhao et al. (267). Deletion mutagenesis of aerptZEA affected virulence

and bacterial cell count in immature pear fruits. Additionally, the transfer of aerptZEA
to Pseudomonas syringae pv. tomato DC3000 increased its ability to infect Arabidopsis
rpsZ mutants, indicating that AerptZEA is recognized by RPS2 (267).

The ability to scavenge for iron in nutrient-lirniting environments is also required
for E. amylovora virulence under certain conditions. The siderophore desferrioxamine is
secreted into the extracellular milieu to complex iron for uptake by the ferrioxamine
receptor FoxR. Siderophores are also important for protection of bacterial cells against
the host oxidative burst (73). Insertional mutants of desferrioxamine dfoA and
ferrioxamine receptor foxR were hindered in growth under iron limiting conditions. In
addition, both mutants were reduced in their ability to colonize and infect apple blossoms
(60).

Erwim'a amylovora also secretes other virulence factors that affect its interaction

with host plants. A metalloprotease (PrtA) which is accompanied by its own type I

secretion machinery was identified in the supernatant fi'action from a highly proteolytic
strain of E. amylovora (E8). Although this metalloprotease did not contribute greatly to
virulence of E. amylovora, the ability of prtA mutants to escape out of xylem vessels and
into xylem parenchyma and movement through parenchyma was reduced (265). Another
component of E. amylovora exopolysaccharide is levan, a 6-2, 6-fructan produced by the
secreted enzyme levansucrase. Upon secretion to the extracellular milieu, levansucrase
produces levan from extracellular sucrose and releases glucose as a by-product. Mutants
that do not produce levan are not significantly altered in virulence, although one mutant
exhibited reduced virulence under high sucrose conditions (20, 85). Levansucrase is not
modified in any manner for its secretion and a putative porin downstream of the lsc gene

is thought to have a role in its secretion (69).

Type II secretion in phytopathogenic bacteria

E. amylovora also possesses a full sec transport system which supports other
secretion systems such as type II, type IV and type V (auto-transporter) secretion (188,
238, 266). Type II secretion (T28) is an important virulence factor in Gram-negative
animal pathogens and phytopatho gens such as Pectobacterium carotovorum, E.
chrysanthemi, Ralstonia solanacearum, and Xanthomonas campestris. The T28 operon
was identified first from Klebsiella oxytoca by transferring a plasmid encoding the T28
operon from K. oxytoca to Escherichia coli to demonstrate that T28 proteins were
required for the secretion of the enzyme pullulanase (215). Transfer of a cosmid
containing the T28 from E. chrysanthemi to E. coli was also used to demonstrate the

ability of the T 28 to secrete various extracellular enzymes (138). Genome sequencing

has made it possible to identify the presence of T28 genes in many gram negative
bacteria other than pathogenic bacteria (50). However, the comparison of known
functional T28 systems highlights 12 to 15 proteins expressed from the operon are
required for secretion across the outer membrane (215, 219, 220). Although the gene
naming convention has differed slightly amongst species possessing a T28 system, the
majority of the gene products follow the Klebsiella gene designation as A through 0 plus
8 (50, 219, 220), with proteins CDEFGHIJKLMNO acting as the core of 12 essential
T28 components (50). Here the general nomenclature of the T28 operon, “general
secretion pathway” (Gsp) will be followed

Overall, the core T28 proteins are used to facilitate the transport of folded
proteins from the periplasm across the outer membrane. The T28 protein GspD is a
member of the secretin protein family, which includes proteins fiom T388 and type IV
pilus generation. This group of related proteins function to form pores in the outer
membrane for protein secretion (238). In some cases where a GspS homologue is present
in the T28 operon, an extension of the GspD C-terminus is required for GspS interaction,
stabilizing GspD multirners in the outer membrane (54, 183, 228). Electron microscopy
analysis of K. oxytoca GspD (PulD) multirners with and without Gsp8 (PulS) show a
stacked complex with an apparent occlusion in the center of the complex, which is
hypothesized to be the N-terminal of GspD (183, 184). This evidence, combined with the
observed channel activity of multimeric GspD/ GspS complexes after the application of
an electrical current now indicates that GspD may act as a voltage-induced gated channel
rather than a passive pore for protein transport (183). There are examples, however, of

species that do not posses a GspS homologue in their T28 operon, such as Pseudomonas

aeruginosa and X. campestris, where their GspD homologue is still able to localize to the
outer membrane (228), however the absence of a GspS homologue does not mean that a
pilot protein coordinating the insertion of GspD multimers into the outer membrane does
not exist (219).

A likely source for energy in the secreton is GspE, a T28 protein theorized to be
localized in the cytoplasm and demonstrated to act as an ATPase in Vibrio cholerae (43).
GspE has been demonstrated to interact with the inner membrane bound GspL in V.
cholerae (EpsL) and E. chrysanthemi (OutLEch) (221), and that conformational changes
occur with both OutEEch and OutLEc}l in E. Chrysanthemi (198). GspL has also been
shown to interact with another inner membrane bound protein, GspM, through
immunoprecipitation experiments and GspE-GspL-GspM tripartite complexes are
thought to involved in the assembly of the entire secreton or just the transport and
assembly of a T28 pilus that would bring T28 secreted proteins to the GspD/GspS
complex for secretion (43, 198).

Other critical components of T28 are inner membrane bound with some degree of
periplasmic domains, such as the major pseudopilin, GspG and minor pseudopilins
GspH-J, named for their homology to type IV pilins. Pseudopilins are processed by
GspO and are capable of forming protein-protein interactions amongst each other in vitro
(67, 145). GspG homologues are able to form pilus-like structures when overexpressed
(70, 106, 223); this has led to speculations of pseudopilins forming a pilus that

polymerizes to push secreted enzymes through the GspD pore (220).

10

Exoproteins secreted by type II secretion

Specificity of exoproteins secreted through the T28 has been observed in K.
oxytoca, P. carotovorum and E. chrysanthemi. In all three systems, mutations of GspC or
GspD could not be complemented by homologous proteins from other systems (173, 197,
228). This led to the hypothesis that they determine the specificity of secreted proteins.
The N—terminus of OutDEch from E. chrysanthemi was determined through a protein
deletion series to interact with secreted endogenous proteins, and was not able to interact
with T28 secreted proteins from P. carotovorum (228). In the system of K. oxytoca,
however, the N-terminal of OutDEch from E. chrysanthemi fused to a truncated PulD
protein was still able to secrete pullulanase, indicating that the requirements for secretion
specificity may differ fiom species to species (95).

Therefore, the contribution of GspC to secretion specificity must not be
overlooked. GspC and its homologues are inner membrane bound proteins with large
periplasm-associated domains (34). Based on amino acid sequence analysis of GspC

homologues, a PDZ motif is present near the C-terminal of GspC homologues from K.
oxytoca (PulC), P. carotovorum (OutCEca) and E. chrysanthemi (OutCEch). Certain

mutations of the PDZ motif of PulC with the addition or deletion of amino acids closest

to the C-teminus rendered the T28 secreton non-fimctional (196). When domains from
OutCEca and OutCEch were swapped to form fusion proteins, the PDZ motif was shown to

be involved in the secretion of species specific exoproteins in E. chrysanthemi (34).
The search for a type II secretion signal in exoproteins has had some success, with

regions responsible for secretion across the outer membrane determined for pullulanase

11

of K. oxytoca, PelC of E. chrysanthemi and PehA of P. carotovorum (76, 137, 190).
Recent work with PehA from P. carotovorum indicates that the secretion signal needed
for species dependant secretion is a three-dimensional motif (1 89). No easily identifiable
T28 signal has been determined by amino acid sequence comparisons as of yet.

Exoproteins secreted by phytopathogenic bacteria include proteinases, amylase,
pectinases, cellulases and polygalacturonases (50). Polygalacturonases present in
phytopathogenic bacteria fall into two categories, endo- and exo-polygalacturonases. The
former catalyze the random hydrolysis of pectic acid forming oligogalacturonates while
the latter catalyze the terminal hydrolysis of pectic acid forming galacturonic acid
monomers (115). While endo-polygalacturonase activity has not been detected in E.
chrysanthemi (109), endo-polygalacturonase activity is a known virulence factor in P.
carotovorum (216), R. solanacearum (61, 107) and Agrobacterium vitis (210).

Analysis of the secretome of E. chrysanthemi identified 14 T28 secreted proteins,
including 11 pectinases, cellulase, rhamnogalacturonan lyase, a novel esterase and a
novel Avr-like protein (122). Sequence analysis of Ralstonia solanacearum has
identified 6 exoproteins including three polygalacturonases, a pectin methylesterase, and
two cellulases (139). Previously, E. amylovora was described not to possess any cell
wall degradation abilities (226); however, recent studies have described the presence of a
type II secretion gene, outF, based on Southern hybridization to an outFEca homologue

and weak CelA activity (207).

12

Host response to fire blight infection

Interest in the genetic mechanisms of the host response to fire blight infection has
increased due to the limited control options available to growers. Venisse et al.
demonstrated that wild type E. amylovora and an ams mutant were capable of inducing
the oxidative burst in pear and a susceptible apple cultivar’s leaves, whereas the type HI
secretion mutant was unable to induce an oxidative burst (248, 249). Furthermore, in
another study, Venisse et al. were able to link the secretion of two effector proteins,
HrpN and DspE to the elicitation of the oxidative burst of pear (247). When the levels of
expression of phenylpropanoid genes were observed in a resistant and susceptible cultivar
of apple, it appeared that effector proteins were also down-regulating some of the
flavanol biosynthesis genes in the susceptible cultivar (249). Based on these studies, the
elicitation of an oxidative burst by the host appears to aid infection by E. amylovora, and
the lack of down-regulation of flavanol biosynthesis genes appears to be related to
resistance (248, 249).

Other studies concentrated on pathogenesis-related (PR) genes and their
expression after chemical elicitation or infection in apple. Use of a salicylic acid
analogue, acibenzolar-S-methyl (ASM) was demonstrated to induce PR-I, PR-2, PR-8 in
cultivar Jonathan, PR-Z and PR-IO isoforrns in cultivar Golden Delicious (35, 153, 269).
When apple cultivar Gala was treated with ASM, there was no noticeable induction of
PR—Ia, PR-2, PR-5 or PR-8, the authors explain that this may be because in the previous
studies, apple seedlings were used compared to the use of shoots on woody tissue for the
Gala experiment. The induction of PR-Z, PR-5 and PR-8 were the strongest however

after inoculation with E. amylovora 48 and 96 hours post inoculation (31).

13

Plant proteins interacting with the effector protein DspE have been identified
fi'om Malus X domestica using a yeast two-hybrid system. Four of the proteins, DIPM 1
to 4 are serine threonine kinases with a leucine rich repeat (LRR) motif (159). This is
similar to other receptor-like kinase (RLK)-LRR resistance (R) genes such as Xa21 fi'om
rice, rng from barley and FLSZ from Arabidopsis (37, 55, 134). The site of interaction
between DIPMs and DspE is the intercellular RLK domain, in contrast to other RLK-
LRR family members where the interacting site is the extracellular LRR domain. The
RLK-LRR DIPMs were present in all hosts of fire blight tested, both resistant and
susceptible, alluding that the DIPM proteins are not R genes that lead to a successful
resistance response (159).

Cloning and mapping of RGAs fi'om apple species is another way to identify
resistance-related genes. Classic resistance genes encode proteins with a nucleotide
binding site (NBS) and a LRR domain that participates in protein-protein interactions
(13). These resistance genes are now hypothesized to be guard proteins that monitor
changes to other proteins that are the true targets of pathogen effectors (181). Resistance
gene analogues from apple in two studies were cloned from sequences amplified based
on degenerate primers in the nucleotide binding site (NBS) (14, 135). In one study, after
the cloning of 27 sequences from RGAs, 18 of those sequences were successfully
converted into molecular markers and mapped the locations of the RGAs on linkage
maps (14). The technique NBS-profiling was proven useful by identifying and mapping
of 23 RGAs at the same time in F1 progeny, adding to the number of RGA markers

available for mapping (42). In a recent study, expressed sequence tags (ESTs)

14

homologous to RGAs were converted into expressed sequence tagged site (E-STS)
markers, facilitating the mapping of ESTs onto linkage maps (175).

Groups have also sought to map quantitative trait loci (QTLs) in apple and pear
for fire blight resistance, to aid in breeding efforts. The first QTLs identified for fire
blight resistance were located in a resistant cultivar of European pear. Four QTLs were
identified, two on linkage group two, one on linkage group four and another on linkage
group nine. Two molecular makers, one co-localizing with the QTL on linkage group
two-b and the other co-localizing with linkage group four are resistance gene analogue
markers, indicating that nucleotide binding site (NBS) type resistance genes may be
involved in fire blight resistance (65). Calenge et al. were able to identify a major QTL
in apple that accounts for 34.3 to 46.6 % of the resistance phenotype. This QTL was
located on linkage group seven, with no RGA markers co-localizing with the QTL (41).
This indicates a high probability that the main genetic component of fire blight resistance
is not R gene mediated. Khan et al. also identified a major QTL for fire blight resistance
on linkage group seven that accounted for 37.5% to 38.6% of the resistance phenotype.
Both QTLs identified on linkage group seven were in roughly the same area and were
observed using two different strains of E. amylovora for infected, therefore this QTL is
likely to be a major fire blight resistance locus (41, 124). Furthermore, areas of the pear
QTLs on linkage groups two and nine were determined to be involved in digenic
interactions with other linkage groups, thus in apple, the contribution of the pear QTLs
are in combination with other loci (41, 65).

Although a major QTL for fire blight resistance has been determined, the exact

nature of that resistance is still unknown. Since no currently cloned RGAs are located in

15

that region of linkage group seven, there are no mapped candidate genes for resistance in
apple. The identification of the DspE interacting apple proteins is an insight into the
potential innate immunity response of Rosaceous plants, however RLK-LRR proteins are
unlikely to be involved in resistance to fire blight, either. In order to identify other genes
involved in the resistance response to fire blight, attention should be given to genes other

than the traditional R gene types.

Using plant genomics to complement genetic analysis of resistance loci

Major food crops such as rice, wheat, barley, maize, potatoes and soybeans still
suffer losses due to plant pathogens on a global scale, despite the best efforts of breeding
programs and the availability of pesticides (108, 235). The search for durable resistance
is not a novel concept in plant biology and the overall goal of disease resistance breeding
programs is to identify chromosomal regions conferring this type of resistance (121, 163).
Identification of useful disease resistance QTLs are further complicated by rapid
evolution of some pathogens, by overcoming released resistant cultivars in a matter of
years (163, 233). In the search for the ultimate resistance gene, a great wealth of
genomic material pertaining to plant pathogen interactions has been generated for
pathogens and plants in model and crop species.

Currently, there are four complete plant genome sequences available. The first
plant genome sequence to be released was the model plant Arabidopsis thaliana in 2000
(110), followed by the genome sequence of two rice types (Oryza sativa L ssp. indica and
0. sativa L ssp. japonica) in 2002 (89, 263) and most recently, the genome of the model

tree Papulus trichocarpa (245). These genome sequences are invaluable for establishing

l6

areas of synteny with other related plants and using the genome sequences for molecular
marker development and choosing candidate genes from the collinear area. With
increased ability to obtain large scale expression profiling of pathogen-induced genes,
more studies are also seeking to identify the global gene expression response of crop
species to various pathogens. Expressed sequence tag libraries are available for rice
infected with rice blast (Magnaporthe grisea), potato leaves infected with late blight
(Phytophthora infestans), wheat infected with Fusarium head blight (F usarium
graminearum), apple infected with apple scab (Venturia inaequalis) and nodule tissues of
the legume model species Lotus japonicus (10, 114, 178, 213). In addition, there are a
great deal of subtractive libraries produced from infected tissue, aimed at identifying
ESTs in infected tissue that are only involved in the resistance response in: rice (144,
258), wheat (94, 129, 146), potato (242), barley (177), tomato (87), apple (58) and coffee
(74).

Resistance (R) genes were first described by Flor in his seminal work that
established the gene for gene theory where an incompatible response (disease resistance)
occurs when an R gene “recognizes” an avirulence gene fi'om a pathogen (reviewed in
55). More recently, a “guard hypothesis” has been proposed where the R genes are
monitoring the status of a particular protein, and upon a change to that protein mediated
by a pathogen effector protein, the R gene initiates a signaling cascade (55).

The identification of a large number of R genes involved in gene for gene
interactions has allowed for the classification of types of R genes and their conserved
motifs. The most common R genes were those with a nucleotide-binding site (NBS) and

leucine rich repeats (LRR) that are split into two types, those with coiled coil (CC)

17

domains at their N-terminal or those with the animal-like 1011 and interleukin receptors
(TIR). The conservation of motifs in the NBS-LRR regions of these R genes has allowed
researchers to clone resistance gene analogues (RGAs) from numerous plant species
(156).

In addition to the identification of R genes, characterization of disease response
genes in the model system, A. thaliana, is useful for a reference point in which to identify
similar mechanisms in crop species. The majority of the disease-related (DR) genes from
Arabidopsis are involved in the signaling pathways that coordinate defense and were
identified by mutant analysis (97). Defense signaling pathways are classified into
defense against biotrophs or necrotrophs for simplicity, although the true picture of how a
plant perceives a pathogen is assuredly more complicated (88). Very briefly, signaling
cascades for defense against biotrophic pathogens typically occur through CC-NBS-LRR
or TIR-NBS-LRR R genes that initiate an oxidative burst, activate MAP kinases, induce
salicylic acid production and the induction of PR gene expression through NPR] (97).
Detection of a necrotroph will initiate jasmonic acid and ethylene responsive pathways
that induce gene expression through ethylene and jasmonic acid induced transcription
factor ERFl, and jasmonic acid induced transcription factors RAP2.6 and JIN 1. In
addition, host detection of a necrotroph will also activate a MAP kinase pathway that
leads to the downregulation of the salicylic response (88, 97).

As useful as genetic and genomic data are for assessing the molecular pathways
and interactions leading up to a resistance response, the question of how that information
can be applied is not often answered. Bridging gaps in between basic lmowledge of plant

pathogen interactions and applied knowledge of resistance phenotypes in available

18

gerrnplasm is vital to identifying genes that coordinate durable resistance. In this
literature review I will examine the coordination of large scale genomics projects and
resistance phenotype analysis and the promise of these methods in yielding crops with

durable resistance.

Resistance gene analogues

Approximately 149 NBS-LRR gene homologues were identified from
Arabidopsis after the genome sequence was released. A physical map of the locations of
these RGAs shows areas of 43 RGA clusters on the chromosomes, the result of localized
gene duplication (162). While evolutionary insights leading to the duplication and
distribution of RGAs are critical for the understanding of the development and
maintenance of disease resistance in plants, the function of the majority of RGAs is
unknown; function has only been determined for twelve NBS-LRR genes (105). As
such, once an RGA is found to contribute to disease resistance, it is then known as an R
gene. The mapping of RGAs to areas of QTL localization for disease resistance could
help to identify the potential function of these genes. Mapping of RGAs to QTL regions
has also been conducted in major crops such as rice, soybean, potato, rapeseed, and
barley (reviewed in 195). RGAs are also currently being used as candidate genes in
disease resistance QTL analysis in rice (202, 255, 256), potato (108, 233), and crucifers

(231,236)

19

Candidate gene analysis with crop-specific RGAs

Candidate gene analysis involves the identification of previously characterized
defense-related genes, such as those identified already in Arabidopsis (13, 55), or the
identification of RGAs before disease resistance QTL analysis. The candidate genes are
then converted into molecular markers for use in the QTL analysis and for placement
onto the genetic map. Those candidate genes that co-localize with the disease resistance
QTLs can be firrther analyzed without the need for map based cloning (reviewed in 195).

In addition to the potential for an RGA to be identified as a ftmctional R gene,
RGAs may also be used as molecular markers for other resistance loci, since RGA
clusters have mapped to resistance loci as is the case with Arabidopsis (l, 234).
Therefore, caution must be exercised on assumptions from co-localizing candidate genes
and the function of the candidate gene and phenotype must be confirmed using other
methods such as Northern analysis or the use of transgenic plants for phenotype analysis.
In the case of the Rng resistance gene to stem rust in barley, RGAs mapped near Rng,
but attempts to use synteny with rice failed to identify any candidate genes in that area
(12) and a non-traditional R gene, Rng was later cloned using positional cloning and
was confirmed as being absent in the rice genome (37).

RGAs were used in the identification and cloning of a resistance gene RB from
Solanum bulbocasta after other R genes that were bred into domestic potato (Solanum
tuberosum) failed (233). Cloning of the RB resistance gene from S. bulbocasta used both
traditional map-based cloning techniques, along with long-range PCR targeting the
identified candidate gene RGAs from genomic DNA of resistant S. bulbocasta. The

BAC carrying the RB allele was unstable in E. coli; therefore the complete RB gene was

20

 

 

amplified from genomic DNA and cloned into a binary vector for plant transformation
and validation as the gene conferring resistance in previous QTL analysis (174).
Insertion of RB as a transgene into a late blight-susceptible potato variety conferred
resistance to all races of P. infestans, including one race that had overcome all previous R
genes (233).

In maize, a combination of RGA mapping and transposon mutational analysis was
used to clone a resistance gene from the 1p] locus. RGAs had previously been mapped to
the maize physical map and one RGA, PIC20 had mapped to the rpI locus which is
responsible for maize resistance to common rust (Puccinia sorghi). The detection of an
insertion into the R gene RpI-D was detected by the PIC20 probe, and led to the
subsequent cloning and characterization of RpI-D (53).

Candidate gene analysis in rice has been useful for the identification of rice RGAs
and defense-related genes that co-localize with QTLs for bacterial blight resistance
(Xanthomonas oryzae pv. oryzae) and rice blast (Magnaprothe grisea). One study
compiled a group of 118 molecular markers based on RGAs and previously determined
defense-related (DR) genes (202). In total, six of the candidate gene markers co-
localized with QTLs for bacterial blight resistance: five were RGAs and one was a
defense-related gene, oxalate oxidase. A higher number of candidate genes with
functional characterization co-localized with previously determined blast resistance QTLs
(202). Due to the low number of defense-related markers associating with the bacterial
blast resistance QTLs, caution must be exercised with choosing potential candidate genes

for screening, the higher number of DR markers that associated with the fungal (blast)

21

resistance QTLs suggests that the authors selected genes that were more likely to be
involved in fungal, not bacterial disease resistance in rice.

A second candidate gene approach to QTL analysis determined which RGAs and
defense-related genes co-localized with rice blast resistance QTL in advanced backcross
populations of the rice cultivar Vandana (256). Advanced backcross populations were
used so that lines with promising resistance already possessed the positive agronomic
traits from the susceptible parent, and could be released with minimal further selection
and breeding (237). Seven markers were associated with blast resistance when a single
blast isolate was used for infection; including two candidate genes and one RGA. A
higher number of candidate genes were associated with resistance when multiple blast
isolates were used for inoculation; there were four candidate genes and two RGAs. In
addition, one of the candidate genes, a NBS-LRR gene, was also determined to have a
digenic effect with two other NBS-LRR genes and the RGA homologue (256). The
increased number of candidate genes identified as being significant to resistance during
multiple isolate pressures is interesting, since this more closely mimics natural field
conditions that new cultivars face. Particularly since there were digenic effects detected
between NBS-LRR genes, supporting the hypothesis that R gene diversity is driven in
part, by pathogen diversity (105). Overall, the localization of the RGAs with rice
resistance QTLs is interesting; however it requires further characterization of the RGAs

to determine their involvement in the resistance response.

22

Comparative genomics for R gene discovery

Comparative genomics is also a potentially useful method to identify collinear
resistance genes between two related species where the fimction of the R gene is known
in one of the species. The identification of an R gene in tomato; the model Solanaceous
plant, against Fusarium wilt was used to identify the potato homologue based on
extensive synteny between the genetic maps of tomato and potato. By aligning the
genetic maps of the 12 resistance locus from tomato and the R3 resistance locus from
potato, the identification of the collinear R gene, R3a was determined in potato (108).
This was the first known report of an R gene being cloned based on synteny.

Since Arabidopsis is also a crucifer, RGAs derived from the Arabidopsis genome
are of interest to groups working with agriculturally important crucifers. Because no R
genes have been cloned from Brassica napus or its progenitors, Brassica rapa and
Brassica oleracea, previously identified RGAs from Arabidopsis (33) were selected as R-
EST clones and mapped onto a B. napus genetic linkage map in order to determine areas
of collinearity, which were found to exhibit conserved gene content and order (231).
Similarly, for B. rapa, markers based on known open reading frames (ORFs) from
Arabidopsis were used to map areas of collinearity between clubroot (Plasmodiophora
brassicae) resistance QTLs and the corresponding segment of an A. thaliana
chromosome that is known to have R gene clusters (236). Overall for B. napus, the
inheritance of R genes on chromosomal segments from the Brassica progenitors have
contributed to R gene duplication, however these areas are still collinear to Arabidopsis.

Once areas are identified in B. napus as being related to resistance and in the case of B.

23

 

 

 

rapa QTLs, researchers can take advantage of the genomic data from Arabidopsis to
identify candidate genes (231, 236).

The areas of synteny determined above for B. napus were used for comparative
mapping with Arabidopsis against the Lle QTL for blackleg (Leptosphaeria maculans)
(154). Lle had previously been mapped so as to narrow the QTL down to a locus,
however the identity of the gene is unknown; using EST markers that co-localize with
this locus has helped narrow the candidate genes down to seven possible RGAs. The
EST markers that the Lle locus co-segregates with are a WD-40 repeat family protein
and a nucleoporin family protein (154). Even though the WD-4O repeat family protein
wasn’t considered a candidate gene, coincidentally one of the QTLs for clubroot
resistance in B. rapa also encompasses a WD-40 repeat family protein sequence (236).
Even though there are no reports of WD-4O proteins being involved in resistance, this

would be a potential candidate gene based on position.

Candidate gene analysis using crop-specific EST data

Attempts at using comparative genomic analysis for the identification of
resistance genes against Fusarium head blight (FHB) proved difficult for wheat, due in
part to a lack of collinearity between the QTL in wheat and the corresponding area in
rice. The breakdown of synteny at that region was due to rearrangements of the
chromosomes in wheat and rice (140). As such, a previous attempt at using synteny
between wheat and rice to identify candidate R genes or DR genes failed, in part because
there were no annotated R or DR genes present in that chromosomal area of rice. A new

approach to find candidate genes for the F HB resistance QTL utilized the vast amount of

24

EST sequences available for wheat that are mapped onto chromosomes. A low
stringency tBLASTx search returned three ESTs with homology to R genes from other
cereal species. One of the ESTs; homologous to a barley R gene firnctional against rust,
was found to be polymorphic between parents used for analysis, and is a good candidate

for the R gene responsible for the QTL (227).

Synthesis of genomic and genetic data: broad spectrum disease resistance

Overall synthesis of existing information on disease resistance QTLs, cDNA
libraries and the genome sequence can also yield positional candidates for disease
resistance. By combining QTL data for resistance to firngal, bacterial and viral pathogens
against a genomic map, areas of multiple QTL congregation and RGA clustering are
hypothesized to be involved in broad spectrum resistance (255). RGAs were identified
by nucleotide homology to other known NBS-LRR sequences and amino acid similarity
to a conserved domain. In addition to mapping QTLs, RGAs and known R genes, a
digital Northern approach was used to analyze the occurrence of ESTs fiom inoculated
leaf tissue by using full length cDNAs to perform BLASTn searches against the EST
libraries. Full length cDNA with significantly different numbers of EST matches were
placed on the genomic map in order to determine if they also co-localize with broad
spectrum disease resistance regions. Four chromosomal areas were identified by the
concurrent mapping of QTLs along with other genetic and genomic data. Positional
candidate genes from each of these areas were determined based on homology to

annotated Arabidopsis proteins with homology to the translated cDNA sequences from

25

that particular chromosomal segment (255). Further narrowing of the areas on the
chromosome that QTLs encompass is still required for better introgression of these broad
spectrum disease resistance areas into new cultivars, but this was a first important step in

the melding of current breeding and genomic data for rice for disease resistance.

Concluding Remarks

Since the majority of the molecular mechanisms of E. amylovora virulence are
still elucidated by mutational analysis, I chose to use an in vivo expression technology
(IVET) approach to identify genes upregulated in E. amylovora during colonization and
virulence. This work is reported on in chapter one and pertains to the diversity of
upregulated genes in E. amylovora that are required for cellular processes during
virulence beyond just plant-microbe interactions. In the NET screen, genes from a type
II secretion operon and an endo-polygalacturonase were identified. Since type II
secretion was previously though not to be important for E. amylovora virulence, I chose
to characterize both the type II operon and endo-polygalacturonase and to determine their
contribution to virulence in chapter two. Finally, with the increased amount of genomic
data available for plant systems, scientists are able to apply knowledge about disease
response in model plant systems to crop plant systems. The use of RGAs and defense
related genes as molecular markers and candidate genes for QTL analysis is helping to
identify new introgressible R genes for agricultural use. However, in a slow growing
crop species such as apple, the ability to identify resistance loci from QTLs is not easy
and is time consuming. In order to identify discrete genes that are involved in the

resistance response to E. amylovora, I chose to use a suppression subtractive

26

hybridization library combined with expression analysis with cDNA macroarrays.
Chapter three concerns these genes that are upregulated in the moderately resistance

cultivar Red Delicious, and are part of the resistance response.

27

CHAPTER 1

Identification of Erwinia amylovora Genes Induced During Infection of Immature

Pear Tissue

28

ABSTRACT

I used a modified in vivo expression technology (IVET) system to identify E. amylovora
genes that are activated during infection of immature pear tissue, and identified 394
unique pear fruit-induced (pfi) genes on the basis of sequence similarity to known genes.
Known virulence genes, including hrp/hrc components of the type HI secretion system,
the major effector gene dspE, type H secretion, levansucrase lsc, and regulators of
levansucrase and amylovoran biosynthesis were upregulated during pear tissue infection.
Known virulence factors previously identified in E. (Pectobacterium) carotovora and
Pseudomonas syringae were identified for the first time in E. amylovora and included
HecA hemagglutin family adhesion, Peh polygalacturonase, new effector HothoCEA,
and membrane-bound lytic murein transglycosylase MltEEA. An insertional mutation
within hothoCEA did not result in reduced virulence; however, an mltEgA knockout

mutant was reduced in virulence and growth in immature pears.

29

 

 

INTRODUCTION

Erwinia amylovora is the causative agent of fire blight, a devastating necrotic
disease affecting apple, pear and other rosaceous plants. Entry of the bacterium into
plants can occur via flower blossoms, actively growing young shoots or through wounds.
Upon entry, the fire blight pathogen moves through intercellular spaces towards the
xylem, and also the cortical parenchyma (247). Symptoms often appear as water-soaked
tissue that rapidly wilts and becomes necrotic, leading to the characteristic “shepherd’s
crook”. As a member of the Enterobacteriaceae, E. amylovora is related to many
important human and animal pathogens such as Escherichia coli, Yersinia pestis, Y.
enterocolitica, Salmonella enterica and Shigellaflexneri.

Like many other Gram-negative plant pathogenic bacteria, E. amylovora produces
a type IH Hrp secretion (TT88) apparatus that delivers effector proteins into host plants
(125). The TTSS in E. amylovora controls the ability of E. amylovora to cause disease in
susceptible host plants and to elicit the hypersensitive response (HR) in resistant and non-
host plants. Most hrp genes have been found to encode proteins involved in gene
regulation or in assembly of the TTSS apparatus (4, 99, 125).

The TTSS of E. amylovora secretes several virulence proteins, including HrpA,
HrpN, HrpW and disease-specific protein DspA/E (hereafter referred to as DspE) (25, 26,
82, 125, 126, 251, 252). The HrpA protein is the major structural protein of a pilus called
the Hrp pilus, which is the extracellular part of the TTSS (117). DspE, HrpN, and HrpW
proteins are effector proteins of the TTSS and are believed to be injected directly into

host cells (25, 26).

3O

Additional E. amylovora virulence factors that contribute to pathogenesis and
plant colonization include the exopolysaccharides amylovoran and levan, iron-
scavenging siderophore desferrioxamine, metalloprotease PrtA, multidrug efflux pump
AcrAB, and carbohydrate metabolism genes specifically involved in the utilization of
sorbitol, sucrose and galactose (3, 29, 38, 161, 264). Transcriptional regulators of the
amylovoran and levan biosynthetic operons have also been identified (22, 51, 264) and
are required for the expression of the biosynthetic machinery for the exopolysaccharides
(19, 68, 123, 264). E. amylovora pathogenesis is also subject to global regulation by the
small regulatory RNA rsmB which functions by titrating and countering the activity of
the repressor protein RsmA; this system is reported to positively regulate
exopolysaccharide production, motility and pathogenicity (147). In addition, E.
amylovora strains contain a ubiquitous nonconjugative plasmid of 28-30 kb designated
pEA29; laboratory-derived plasmid-cured strains exhibit a reduction in virulence (155).
pEA29 encodes several potential virulence genes including a thiamine-biosynthetic
operon that is proposed to influence amylovoran production (155).

Genetic analysis of virulence genes in E. amylovora have been performed mostly
through the production and screening of mutants. Additionally, most of the genes
discovered so far have been identified from mutant screening under controlled conditions.
However, it is not feasible to mimic all of the nutrient and defense conditions in vitro to
characterize all the genes from E. amylovora required for infection and colonization of
plants. There is a need then, for a hi gh-throughput method of screening for genes that are

involved in virulence and grth in planta of E. amylovora.

31

 

 

 

In the last decade, many gene expression technologies including in vivo
expression technology (IVET) have been developed to identify gene expression profiles
of organisms during interactions with various host environments (8, 101, 150). IVET
screening theoretically scans the entire genome, and through the use of appropriate
environmental conditions and different strategies, can yield large numbers of potentially
important genes (201). IV ET screens have identified genes upregulated upon infection
with enteric human and animal pathogens such as Salmonella enterica, Shigella flexneri,
and Y. enterocolitica (15, 150, 171, 261). IVET systems have also been used to identify
genes expressed during plant infection by Xanthomonas campestris, E. chrysanthemi,
Pseudomonas syringae and Ralstonia solanacearum (24, 36, 96, 172, 187, 254),
phyllosphere colonization by P. syringae (151), and saprophytic colonization by P.
fluorescens (200, 225).

Like many plant pathogenic bacteria, E. amylovora can infect different host
tissues at different stages of disease development. E. amylovora not only infects
blossoms, leaves, and succulent shoots, but also immature finits of susceptible hosts. The
bacterium also grows epiphytically on stigmas and endophytically inside plant tissue. The
maintenance of large numbers of apple trees for study of E. amylovora pathogenesis is
quite difficult due to the extensive greenhouse and growth chamber space required. As
an alternative, many researchers have utilized immature pear fruits to study E. amylovora
infection (19, 26, 85). Immature pear infection is initiated through a wound inoculation;
wound colonization is a frequently-utilized mechanism of E. amylovora infection in

nature (247). Immature pear assays, either using intact pear fruits or pear slices, have

32

 

 

been used successfully to analyze virulence effects of several E. amylovora genes (26, 85,
125)

Although key virulence factors contributing to fire blight have been identified,
little knowledge is available of the global host-regulated genes of E. amylovora during
infection. To gain a better understanding of the molecular mechanism governing E.
amylovora—host plant interactions, we undertook a comprehensive genome-wide
examination of gene expression patterns during host infection to uncover pathogenesis
strategies of the organism and to lay the groundwork for future studies examining the
expression and function of critical virulence genes during infection of different host
tissues and survival within the host. Several known virulence and pathogenesis factors
were identified using this modified IVET screen, along with new potential virulence
genes that were previously only described in other bacterial pathosystems. We also
confirmed that infection of immature pear tissue by E. amylovora required the major

pathogenicity factors of the bacterium.

33

MATERIALS AND METHODS

Bacterial strains and plasmids. The bacterial strains and plasmids utilized in this study
are listed in Table 1. Erwinia amylovora wild type (WT) and mutant strains and E. coli
strains were grown in Luria Bertani (LB) medium at 28°C and 37°C, respectively.
Antibiotics were added to the culture medium at the following concentrations: rifampicin,
100 ug/ml; kanamycin, 30 rig/ml; gentamicin, long/ml and arnpicillin, 100 rig/ml.
Oligonucleotide primers used for polymerase chain reaction (PCR) and sequencing in this

study are also listed in Table 1.

DNA manipulation and sequence analysis. Plasmid DNA purification, PCR
amplification of genes, isolation of fiagments from agarose gels, restriction enzyme
digestion, T4 DNA ligation, and Southern hybridization were performed using standard
molecular procedures (217). Chromosomal DNA was isolated using a genomic DNA
purification kit (Qiagen, Valencia, CA). TAIL-PCR was performed using the degenerate
primers ADl, AD2 and AD3 as described previously (142) and PCR products from
secondary and tertiary nested PCR were used for sequencing. DNA sequencing was
performed at the Genomic Technology Support Facility at Michigan State University.
The Oligonucleotide primer Aj1585 corresponding to the 5’ end of uidA gene was used
for sequencing fiagment inserts cloned into the pGCMO plasmid. Sequence management
and contig assembly were conducted using DNAStar sofiware (DNAStar Inc., Madison,
WI, USA). Database searches were conducted using the BLAST programs at NCBI

(www.ncbi.nlm.nih.gov/BLAST). Percent similarity was also calculated using the

34

BLAST program (7). Amino acid alignments were done with ClustalW, v. 1.83

(European Bioinformatics Institute, Cambridge, UK).

TABLE 1. Bacterial strains, plasmids and primers used in this study

 

Strains, plasmids,

primers

Relevant characters or sequences (5’—3 ’)"

Reference or source

 

Erwinia amylovora

EallO
EallO'

Eal 189
CFBPl43O
M52 (Ea dspA)
Ea l 10 hrpA
ZY C 1 -3

(Ba hothoCEA)

ZYE3-l l
E. coli
DHlOB

817-1

817-1 2. pir
Plasmids

pBluescript II
SK(+)

pGem32f+

pCAMl40

pCAM140-MC8

le9l8GT
pBSL15

pGCMO

Wild type, isolated from apple
Eal 10, cured of pEA29

Wild type, isolated from apple

Wild type, isolated fiom Crataegus
CFBP1430, dspA::uidA-l<rn, Km R

Eal 10 AhrpA KmR

hothoC::Km; partial deletion and KmR—
insertional mutant of hothoCEA of Eal 189,
Km R

mltE::Km; partial deletion and KmR—
insertional mutant of mItEEA of Eal 189, Km R

F mcrA A(mrr-hstMS-mchC)
<I>801acZAM15 AlacX74 recAl endAl
araAl39 A(ara, leu)7697 galU galK A. - rpsL
(StrR) nqu

recA pro hst RP4-2-Tc::Mu-Km::Tn7

it -pir lysogen of 817-1

ApR, cloning vector

ApR, cloning vector

SmR, SpR, ApR, R6k origin, an588gusA4O
ApR, R6K origin, pCAM140 derivative without
mini-TnS, contains the multiple cloning site of
pBluescript II SK (+)

xylE-GmR fusion cassettes-containing plasmid
flanked by inverted repeats of the pUC19 MCS
Km cassette flanked by inverted repeats of the
pUC18 MCS

GmR cassette with downstream transcriptional
terminator and gusA with upstream
translational stop codons in pGem32f+

(155)
(155)

(38)
(82)
(82)
(l 17)
This study

This study

Invitrogen

(253)
(253)

Stratagene
Promega
(253)
(3 8)
(224)

(8)

This study

 

35

 

 

TABLE 1 (con’t)

 

Strains, plasmids, Relevant characters or sequences (5 ’—3’)“ Reference or source

 

primers

pZYFZ 570 bp dspE promoter in opposite orientation This study
relative to uidA in pGCMO

pZYF 8 570 bp dspE promoter in correct orientation This study
relative to uidA in pGCMO

Primersb

Aj 1388 CCCAAGCTTGGTGCGCCAGGAGAGTTGTTG (Hind HI)

Aj 1389 AAAACTGCAGTGATTGATTGACGGACCAGTATTATTATC
(PstI)

Aj 1390 CCGGAATTCCGAATTGACATAAGCCTGTTCGG (EcoRI)

Aj 1391 CGGGGTACCTGGACGCGGCCGATCACCTGGCCG'ITG (Kpnl)

Aj 15 85 GATAATAATACTGGTCCGTCAATC

Aj 1565 CGGTI'I‘ACAAGCATAAAGCTGGGCAACGGCC

DspEl TCCCCCGGGCAGTGAGGGGGGGCAGACTTITI’I‘TTAACC
(Smal)

DspE2 TCCCCCGGGTATCTTCGCCGCTGCCACCTTTCACCATTG
(SmaI)

PtoCl TCCCCGCGGGCGGGCTGTTGGTC’IT GCT CT (SacII)

PtoC2 TGCT CT AGACTCT GGCAAAATTCAACTGA (XbaI)

PtoC3 CCGGAA'ITCCATGGCAGGGACCCGCAGTTTG (EcoRI)

PtoC4 CCGCTCGAGGGCTGATGGCGGGTTAGTCTGTCG (Xhol)

MltEl TCCCCGCGGTGAATAGTGCGTGGCGTGATGTGC (SacII)

MltE2 TGCT CT AGATTAATCATTGCAATCGCCT CGTC (XbaI)

MltE3 CCGGAATTCTI‘ACCAGCACGTGCAGACAAAACA (EcoRI)

MltE4 CCGCTCGAGCCGGATGGATCTGGTGAGGGGCGC (Xhol)

ADl NTCGASTWTSGWGTT

AD2 NGTCGASWGANAWGAA

AD3 WGTGNAGWAN CAN AGA

 

R R R R . . . . . . . .
0 Km , Ap , Gm , SpR , Sm = kanamycrn, amprcrlhn, gentarrucrn, spectmomycrn, and
streptomycin resistance, respectively.

Underlined nucleotides are restriction sites added and the restriction enzymes are indicated
at the end of primers. Mixed nucleotides: 8 = C+G; W = A+T; N = A+T+C+G.

Immature pear infection assays. Immature pears are routinely used to examine the
pathogenicity of naturally-occurring isolates or bacterial mutants of E. amylovora (26). In
order to confirm that infection of immature pear required major pathogenicity factors as
previously reported (26), we inoculated wounded immature pear fruits with E. amylovora
M52 (CFBP143O dspE) and Eal 10 hrpA mutants and monitored for symptom

development and in planta bacterial growth. Bacterial suspensions of all strains were

36

 

 

grown overnight in LB broth , harvested by centrifugation, and resuspended in 0.5X
sterile phosphate buffered-saline (PBS) with the cells adjusted to approximately 1 x 104
colony-forming units (CFU)/ul (OD600 = 0.1 and then diluted 100 times) in PBS.
Immature pears (Pyms communis L. cv. ‘Bartlett’) were surface sterilized with 10%
bleach and pricked with a sterile needle as described previously (155). Wounded pears
were inoculated with 2 ul of cell suspensions and incubated in a humidified chamber at
28°C. Symptoms were recorded at 2, 4, 6, and 8 days post inoculation. For bacterial
population studies, the pear tissue surrounding the inoculation site was excised by using a
#4 cork borer as described previously (26) and homogenized in 0.5 ml of 0.5 X PBS.
Bacterial growth within the pear tissue was monitored by dilution-plating of the ground
material on LB medium amended with the appropriate antibiotics. For each strain tested,

fruits were assayed in triplicate, and each experiment was repeated.

Construction of the genomic library of transcriptional fusions to uidA. We used E.
amylovora Ea110' (cured of the ubiquitous plasmid pEA29) as the source of
chromosomal DNA for the IV ET experiments. We excluded pEA29 genes from this
study because an analysis of the expression of pEA29-encoded genes during infection
will be presented in a separate report (McGhee and Sundin; unpublished). To create a
library of transcriptional fusions, chromosomal DNA from E. amylovora Eal 10' was
partially digested with HaeIII, and fiagments between 800 bp and 2 kb in length were
separated by electrophoresis and gel-purified. The purified fragments were ligated into
pGCMO prepared by SmaI digestion and transformed into WT E. amylovora Eal 10

(containing pEA29) by electroporation. The use of WT strain Eal 10 was necessary

37

because the ubiquitous pEA29 plasmid contributes to E. amylovora virulence (155).

The 6.2-kb pGCMO reporter vector was constructed by cloning the aacCI gene
(confening resistance to gentamicin) into the EcoRI and KpnI sites and the promoter-less
uidA (B-glucuronidase) reporter gene into PstI and HindIII sites of pGem3zf through
multiple cloning steps (Figure 1A). The aacCI gene was amplified from plasmid
pX1918GT by PCR using the primer pair Aj1390 and Aj139l, whereas the promoter-less
uidA gene was amplified from plasmid pCAMl4O using the primer pair Aj1388 and
Aj1389. A transcriptional terminator sequence, also from pX1918G, was located
immediately downstream of the aacCI gene, and we added translational termination
codons in all three reading flames upstream of the uidA gene. The pGCMO vector was
first digested with SmaI and the ends were dephosphorylated with calf intestinal alkaline
phosphatase (CIAP) and checked for self-ligation before ligation with E. amylovora
chromosomal DNA fragments. After ligation, DNA was introduced into Eal 10 by
electroporation, and transformants growing on LB medium amended with gentamicin and
arnpicillin were randomly collected and plasmids were recovered. The randomness of the
inserts in the IV ET collection was confirmed by checking insert size from 30 random
colonies through restriction digestion and PCR (data not shown). I

As a control, we cloned a 570-bp fiagment containing the dspE promoter into
pGCMO. The fragment was amplified by PCR from strain Ea110 using the primer pair
DspEl and DspE2. The resulting 570-bp product was cleaved with SmaI and ligated into
pGCMO in both orientations. The resulting plasmids were designated as pZYF2
(dspE'wzszCMO, dspE promoter in opposite orientation to uidA) and pZYF8

(dspEf°’::pGCMO, dspE promoter in correct orientation to uidA), respectively, and each

38

plasmid was introduced into strain Ea110 by electroporation.

Screening of the E. amylovora IVET library using a GUS-based microtiter plate
assay. An in vivo microtiter plate assay was developed for screening of the E. amylovora
IVET library (Figure 13). Briefly, approximately 19,200 transformants in strain EallO
were randomly collected and initially screened for GUS activity on LB plates containing
5-bromo-4-chloro-3-indolyl-B-D-glucuronide (Xgluc). After incubation at 25 °C for 48
h, bacteria were transferred individually using a 48-pin colony transfer apparatus and
inoculated onto immature pear discs (3mm) in 96-well microtiter plates. Intact pears were
surface sterilized using 10% bleach for 10 min and rinsed three times with sterile water.
Discs were cut from pears using a #2 cork borer and immediately immersed into
microtiter plate wells containing 25 ul 0.5X PBS buffer to avoid oxidation. The
microtiter plates were then covered with AirPore tape (Qiagen, Valencia, CA) after
inoculation and incubated in a humidity chamber at 25 °C for 48h. After incubation, a
qualitative GUS assay was performed as described below. Transformants showing GUS
activity on pear tissue but not on LB plates were selected and re-screened on LB plates
containing Xgluc and re-inoculated onto pear discs in 96-well microtiter plates.
Confirmed differentially-expressing transformants were again selected and stored at -70
°C in glycerol stocks for firrther analysis. Plasmids were isolated from the consistent
differentially expressed transformants and were end sequenced to identify the genes or
promoter regions. Transformants showing GUS activities on both LB plates and on pear

tissues were assumed to contain constitutively expressed firsions and were not analyzed

further in this study.

39

 

 

r]
y
:1

 

 

Construction of hothaCEA and mltEEA mutants. For the construction of hothoCEA
and mltEEA mutants, the sequences of the putative ORFs defined by the corresponding
clones were determined and used to design primers to amplify fragments of the genes and
its upstream and downstream sequences. Primer pairs PtoCl and PtoC2, PtoC3 and
PtoC4 were used to amplify 590 bp and 670 bp fragments from E. amylovora strain
Eal 189 corresponding to the upstream and downstream of hothoCEA gene, respectively.
Primer pairs M1031 and MltE2, MltE3 and MltE4 were used to amplify 700 bp and 560
bp fragments from E. amylovora strain Eal 189 corresponding to the upstream and
downstream of mltEEA gene, respectively. The two fragments for each ORF were cloned
into pBluescript-H SK(+ ) through multiple cloning steps with corresponding restriction
enzyme digestion (SacII and XbaI; EcoRI and Xhol, respectively). The whole fragment
was excised using SacII and Xhol, gel purified and cloned into the suicide vector pCAM-
MCS (38) digested with the same enzymes. The resulting plasmids were digested with
SmaI and ligated with a 1.2 kb fragment of the aph gene (conferring kanamycin
resistance) released from plasmid pBSL15. The final plasmids were designated as pZYC8
and pZYE8, respectively and introduced into E. amylovora strain Eal 189 by
electroporation. Transconjugants resistant to kanamycin (Km) were selected. To further
exclude mutants resulting from single crossover events, transformants were selected on
LB plates supplemented with Km and onto LB with arnpicillin (Ap). Km-resistant and
Ap-sensitive colonies were selected and their genotypes were confirmed by hybridization

or PCR analysis.

40

GUS Assays. The B-glucuronidase (GUS) reporter gene (uidA) on pGCMO was used to
monitor promoter activity of IVET clones both in vitro and in viva. Qualitative GUS
activity of IVET clones was monitored visually by the development of a blue color within
48 h of cells on LB medium containing 1 mM Xgluc. Qualitative GUS activity of IVET
clones grown on pear slices in microtiter plates after 48 h at 25 °C was also monitored
visually by adding 10 ul of 20mM Xgluc into the wells followed by incubation for 30
min at 37 °C. The development of a blue color indicated GUS activity.

To monitor the expression of IVET clones in pear tissue, quantitative GUS
activity of bacteria in either culture or in pear tissue was determined as described
previously (26, 116) using 4-methylumbelliferyl-B-D-glucuronide (MUG) as a substrate
and 0.2 M Na2CO3 as stop buffer. Briefly, E. amylovora strains containing the IVET
clones were grown on LB medium, resuspended in 0.5 X PBS, and inoculated in
immature pear fi'uits as described above. At 0, 24, and 48 h post inoculation, the pear
tissue surrounding the inoculation site was excised using a #4 cork borer and
homogenized in 0.5 ml 0.5 x PBS. Forty microliters of homogenate was mixed with 160
pl of GUS extraction buffer. Reactions were stopped by NazCO3 addition and
fluorescence was measured using a SAFIRE fluorometer (TECAN Boston, Medford,
MA). Bacterial cell numbers in the sample were estimated by dilution plating, and GUS
activity (umol of 4-methylumbelliferone (MU) produced per min) was normalized per
109 CPU (26). Three replicate fi'uits for each strain were tested and the experiment was

repeated.

GenBank Accession numbers. Nucleotide sequence data reported for the hothngA

41

and mltEEA genes were deposited in the GenBank database under the accession no.

AY887538 and AY887539.

42

RESULTS

Development of an I VET system and identification of E. amylovora upregulated genes
during immature pear infection

Our immature pear infection results clearly demonstrated that infection of
immature pear by E. amylovora required major pathogenicity factors (Figure 2). At 48 h
afier inoculation, E. amylovora strains CFBP 1430 and Eal 10 produced water-soaking
symptoms in pears with visible bacterial ooze (data not shown). Two different strains
were used in this initial experiment because of the availability of mutants of these strains.
This work also confirmed that growth and symptom development of WT strains
CFBP1430 and EallO were similar during immature pear inoculation (Figure 2). Four
days after inoculation, inoculated immature pears showed necrotic lesions and bacterial
ooze formation (Figure 2A). Afier eight days, the entire pears showed necrosis, turning
black with copious ooze production at the inoculation site (Figure 2A). In contrast,
disease symptoms were not observed on immature pears inoculated with either the E.
amylovora hrpA or dspE mutants (Figure 2A). Disease symptoms caused by WT strains
on immature pear were correlated with high levels of bacterial growth in pear tissue
during the four days post inoculation (Figure 2B); however, the CF BP1430 dspE mutant
M52 grew only slightly in pears, representing an approximately 105-fold reduction
relative to the WT CFBP1430 strain. Populations of the hrp/t mutant declined quickly
after inoculation, indicating that the hrpA mutant was not able to survive in immature
pear (Figure 2B).

Verification that infection of immature pear required major pathogenicity factors

43

 

 

of E. amylovora facilitated the development of a simple, high-throughput IVET system to
identify E. amylovora genes induced during colonization and infection. We used cores of
immature pear tissue in a microtiter plate format, a system that was conducive to
handling large numbers of samples.

To develop an immature pear fruit assay, we used the B-glucuronidase gene uidA
as a reporter (116) in the vector pGCMO which was constructed as described in Materials
and Methods (Figure 1A). The vector was verified with a control construct containing the
dspE promoter in both orientations (Table l). The dspE promoter was previously reported
to be strongly induced during immature pear infection (26). GUS activity was not
observed after two days gowth in LB medium for either Ea110(pZYF8) (dspE promoter
in correct orientation to uidA) or Ea110(pZYF2) (dspE promoter in opposite orientation
to uidA). However, GUS activity was observed for strain Eal 10(pZYF 8) in qualitative
assays two days following inoculation onto immature pear discs but not following
inoculation of strain Eal'10(pZYF2) (data not shown). GUS activity was not observed for
the WT Ea110 strain containing the empty pGCMO vector on either LB medium or in
pear discs.

To identify E. amylovora genes expressed during colonization and infection of pear discs,
we constructed a library of 0.8 to 2-kb fragnents of genomic DNA of Eal 10' (cured of
PEA29) in pGCMO and introduced the library into WT Ea110 by electroporation. In
order to screen for differentially-expressed promoter fusions, we developed an in-planta
pear disc microtiter plate assay (Figure 13). Strain Eal 10' containing library clones were

first gown on LB/Xgluc medium for two days, visually

 

 

 

 

pGCMO
I. Ligate Ea110- DNA laacC uidA I
into pGCMO
Sma l
v
2. Transform library 0 0
directly into Ea 110 O O
V
3. Screen transformants
on LB media for GUS
activity
4. lnoculate all
clones on immature
pear disks
5. After 2—day
incubation, screen
transformants again
for GUS activity

FIGURE 1. Overview of the IV ET screen for E. amylovora genes induced during
infection of immature pear discs. (A) Schematic map of the IVET vector pGCMO. The
6.2-kb pGCMO vector was constructed by cloning the aacCI gene (conferring resistance
to gentamicin) into the EcoRI and KpnI sites and the promoter-less uidA (B-
glucuronidase) reporter gene into PstI and HindIII sites of pGem32f through multiple
cloning steps. The (D symbol represents translational terminator codons in all three
reading frames upstream of the uidA gene; and the symbol 0 represents a transcriptional
terminator sequence immediately downstream of the aacCI gene. The Smal site was used
for ligation of random chromosomal inserts. (B) A library (19,200 clones) of Smal
chromosomal DNA fragments (0.8 to 2 kb) from E. amylovora was constructed in
pGCMO, transformed into E. amylovora Eal 10 and screened individually for GUS
activity on LB medium amended with Xgluc. A 96-well microplate containing slices of
pear tissue was inoculated with EalOO containing random IV ET fusion clones and
incubated for 48h at 25°C. Clones exhibiting GUS activity on pear discs but not on
LB+Xgluc medium were selected and the plasmids were recovered for further analysis.

45

monitored for GUS activity, and then inoculated onto pear discs in nricrotiter plates
(Figure 1B). GUS activity was qualitatively detected after two days of incubation at 25°C .
Only clones that showed high GUS activity in pear discs but no GUS activity on LB
plates were recognized as pear-upregulated clones. Those differentially-expressed clones
were screened again on LB/Xgluc plates and pear discs to confirm the results. A total of
19,200 transcriptional fusion clones were screened on both LB/Xgluc medium and pear
discs, and 498 clones (2.5%) were repeatedly found to differentially express GUS activity

on pear discs in this qualitative assay.

Sequence analysis of E. amylovora genes upregulated in immature pear tissue.

We determined the sequence of the inserts from the 498 clones and identified the
putative genes induced following BLAST searches of the non-redundant GenBank
database. Of the 498 inserts sequenced, a total of 55 genes were identified two or more
times and 12 clones contained either an intragenic sequence or with the putative gene
present in the incorrect orientation. Although it is possible that these 12 clones may
contain cryptic promoter sequences as has been shown in a previous study with P.
fluorescens (66), we separated the clones from the others in the current study and did not
subject them to further analysis. Thus, a total of 394 unique putative pear-inducible genes
were identified, and these pear fruit-induced (pfi) genes could be divided into nine
putative functional goups, including host-microbe interactions (3.8%), stress response
(5.3%), regulatory (11.9%), cell surface (8.9%), transport (13.5%), mobile elements -
phage (1.0%), metabolism (20.3%), nutrient acquisition and synthesis (15.5%), and

unknown or hypothetical proteins (19.8%).

46

Figure 2. Symptoms and bacterial gowth of Erwinia amylovora WT strains and hrpA
and dspE mutants in immature pear. (A) Symptoms caused by Erwinia amylovora Eal 10,
CFBP1430 and corresponding hrpA and dspE mutants in immature pear. DPI: days post
inoculation. (B) Bacterial gowth of Erwinia amylovora WT EAllO, CFBP1430 and
hrpA and dspE mutants during infection of immature pears. The gowth of bacterial
strains was monitored at 0, 1, 2, 3, 4 days after inoculation. Data points represent the
means of three replicates i SE. Similar results were obtained in a second independent
experiment.

47

    

Log CFU/ g tissue

CFBP1430 dspE'

4 DPI 8 DPI
Eal 10 hrp/1' Eal 10 hrpA'

i
CFBP1430 dspE

 

  

  

 

 

11

10‘

9.

8‘ +Ea11_0
+hrpA

7‘ +CFBP1430
—l—- dspE

6<

5.

4| _.

3.

1.

0 1 2 3

Days post inoculation

48

 

The majority of the putative gene-products identified as inducible during infection
of pear tissue shared high amino acid similarity with that of proteins from Yersinia spp.,
Salmonella spp., E. coli, Shigella spp., and Erwinia spp. (Table 2). Several known
virulence factors previously reported in E. amylovora such as the TTSS genes hrpGF,
hrpL, hrpX and genes encoding known or new effector proteins DspE and HothoCEA
were upregulated during pear infection (Table 2). Other known E. amylovora virulence
genes identified as upregulated in this study were levansucrase (lsc), regulator of
levansucrase (rlsA), amylovoran regulator (rcsA), and zinc-binding metalloprotease
(prtA) (Table 2). In addition, genes encoding polygalacturonase (peh), a hemaggulatinin-
farnily adhesion (hecA), and membrane-bound lytic murein transglycosylase (mltE) were
identified for the first time in E. amylovora Eal 10 (Table 2). Peh and HecA are important
virulence factors in E. chrysanthemi (205), and MltE plays a role in the virulence of P.
syringae (24). A total of 54 upregulated genes identified were homologs of genes
identified in IVET studies performed with other bacterial plant or animal pathogens
(Table 2).

Type H secretion system (T288) genes similar to Yersinia enterocolitica ytsIIJ
(112), a known virulence factor, and one of five major protein secretion systems in many
pathogenic bacteria, were identified for the first time in E. amylovora. YtsllJ are known
type 4 pilin-like proteins (pseudopilins). Interestingly, the type H secretion system is
dependent on the general secretory pathway (GSP), i. e. the Sec secretion pathway (112).
In our study, the major preprotein translocase SecA (ATPase), molecular chaperone SecB
and membrane proteins SecDF of the GSP were also induced during infection of pears

along with the T288 (Table 2). Furthermore, the peh gene, encoding an enzyme that is

49

known to be secreted by the T288, was also up-regulated (Table 2), indicating that a
functional T288 is present in E. amylovora and to a geater extent could contribute to the
virulence of this pathogen.

Transport genes (pfi 16 to 51) including general, ion, sugar, amino acid, peptide,
and nucleotide transport proteins were induced in pear tissues (Table 2). Some of the
transporters may belong to the type I secretion system that is known to be involved in
secreting toxins, proteases and lipases and are potential virulence factors in E. amylovora.
Cell surface proteins including inner, periplasmic, and outer membrane proteins,
lipoproteins, flagella and polysaccharide proteins were also induced during pear tissue
infection (pfi 52 to 72; Table 2). These membrane proteins may be involved in protein
secretion and membrane maintenance. The sensor component (envZ, pfi 94) of a two-
component regulatory system and cogiate outer membrane protein genes that this system
regulates ompA (pfi 65) and ompC (pfi 64) were also differentially expressed in pears
compared to LB medium.

Under unfavorable conditions such as nutritional stress or exposure to a host
defense response, bacterial pathogens respond by over-expressing stress response genes.
Several stress response genes (pfi 75 to 90) were identified in our screen (Table 2). These
genes included DNA repair or protection (mutS, recA, sulA), carbon starvation, heat or
phage shock and antioxidant genes (such as grpE and ahpC). These results suggest that
pear tissue at least initially is not a favorable habitat for E. amylovora gowth and /or that
DNA damage and the neutralization of plant-derived reactive oxygen species are
involved in virulence and in planta gowth.

The sensor component of a two component regulatory system, grrS (pfi 93), was

50

identified as upregulated in this study. GrrS is a homolog of GacS which, along with
GacA, globally regulate a network of virulence functions in E. carotovora, including the
production of quorum-sensing sigraling molecules (72). Besides amylovoran and
levansucrase regulators (rcsA and rlsA), and genes encoding sensor component of a two-
component regulatory system (grrS and envZ), our screen identified fliZ, a positive
regulator of the flagellar biosynthetic operon in enterobacteria, as upregulated. Other
regulatory genes (pfi 96 to 126) and genes involved in sequence mobilility (pfi 73 to 74)
and metabolism and nutrient scavenging (pfi 127 to 157) were identified in our screen
and listed in Table 2. We recovered several metabolic genes that are potential precursors
for the siderophore desferrioxamine biosynthesis in this study (pfi 153 to 157). It is
probable that under unfavorable conditions, the bacterium itself adjusts and overcomes
nutrient and iron deficiencies.

The large number of unknown or hypothetical proteins identified in this IV ET
screen (78 genes, 19.8%) indicates the firture possibilities of characterizing novel
virulence traits in E. amylovora and assigring functions to these proteins. A complete
genome sequence of E. amylovora is expected soon. When an annotated genome
sequence is released, we will make a listing available upon request of the gene numbers

of the unknown or hypothetical proteins identified in this study.

51

 

 

Ga .88 8381.2 8:88.. EC. 538538 888.5% m8 8
mNmooclmZ A5085 amp—Sm :0: :3 Etta.“ urban—9030 Emma £5.98» 8.x 2
2»: 5m mug—Gee omfifiamofiS—oaoxm 8882833» 882.8% x&& w—
Nvmoovlmz 888qu 889? ton—meg 839.39 93845 Emma 55me $3 5

champ—ab com
:83 aom 5341.2 2.8983 cocoa magi: 8:828 cm< 8:88 8322 So 2
team—3.: «2822:. .E2. 2:5: came. .8. £2239
mnwmvmad 83852—808 wamvfintoEN 888188 SEEM .. SLR n—
?NV .3; Namovflmz emu—xmoobwmeflu 5238 our cgcnocfinEo—Z Marni 8338» “.38 3
an 5.x ”2325. <8: eseo oxzéeaawaeoéeoboeom 88888 858.8 woo: 2
Ge .oom 5292 ea_oeoa\=§.=_wm§o€oo€o oases :8 58.888 88‘ 2
3.893 8.8.63. .85: .3 38.88 2— 3 5755— 2:895
$8 .me ~mv§<<m Aomaaobzofiawbomv :om 8388888 Eatoaogoaoom «on I
~3~m<<0 omfioamegoq 88838 .m .23 @—
.omv ”comma“ mmOme<O ESEQ 2 E; 82808 = 09C. 88:8228 £82m: EEK o
mmNh. .3 630.88 2:39:— 23 am”: 550.88 E on;
vomofldz moom seen 885-585 .8... 88.888 .88 x
8m 3 .E< $88th ”Boom 5088 28582: tonxoémoaocm 3me 8.8.28» .198“. \t
3831; <oom 88228. 58835 £888.38 8:88:43. ._ .83. e
3mg .3353 550.68 .auoaoO
$8 in 332.1% Define: houoobo 5 09C. 8888 .8‘ mowetah. mecefichaonm Define: n
$38.2 x9: 8888 E 25 29.88.. .m .83 a.
N330: 492 3.8a— 838 E 093. 8883.8 .m 8.18 m
:8 do ms 355. $09: 8:28. E 85 89.888 .m .83 N
:83 aom c348: ass éoaowoeoemooc Bosses 882m 8%... _
888:0 can $2.: 55983. :— can.
88:88 .o: .8... 1 .8
33255 Eng—00 ofitmom came—m 8.5.8836 aozmb NE

 

scam: Eon 0.53:8: mo 838.2: mega c352: moeow 8.88898 SEEM? a: Race—om .N mama;

52

 

 

mmmom hum Z 88383858588 88>Exa:u:=8> .888 838.8888m .. V38 mv
on— Swizz 5 88:58:33 3288-883»; magma 8.8.3.88. One .8
E852 885388-38 .88 .8 .885 8
33 .on 588.82 5228 888388 8:888. RE 28 822 888 8:88.. 828.: an
$32.18 Z 888qu 85836593 ~8888§8-8w3w $5 mm
£2 :32 2 529a 8582: 83% .888: 8:88: .88 88.5888 3588 R
529?.
ton—mug Um< Boa 9:88 520685538885
888.82 888.888 853985888582 3858-85 888 588: 838 on
5895 wfiufin
o2 Sela—Z -omontAH egg—atom cor—88mg 0% 83.;— 88888~8M8 88888883883 mm? mm
and .E Swaoslmm 38.8.88 8228.8 8.36 8:8 888:5.— 858: 888288 .8228; cm
Nwmam<<< 838.53 2585 in 828888” 238% mm
3235 .888 858528.. 8878.582 952:: 8.88288 888882 8% mm
.98 88%“ § 5.82 m 5228 8.582 952:2 .88 588888 8:8 R
3H— 5qu £888 ton—28b oEmSoflawAEHoE 58.285383 8288888” 8 EMS cm
mvvchIm Z 83538 8.28on 89858453 Eatafiimb 828.88%. 388% am
$38an 888:8 828-8 53.88-85 8.888 85.8; 9.8 mm
*6.vach 828355 82:0 888E888 8.88888888l 3.8 um
82?? 9888.88,: 885988
22: 32 -1— 358in 8 889:8 85858-8? 88 28.8888 888888 8
Ga .88 828182 8883 323283.28? 83838388 8888838 :83 2
mnmnmwlmz £205 mnxm teams“: BEA—892m 88.2888 8-8888~8m M38 vm
E89?
82 SoocImN tong Baconuafiéoficobsmbugfi 995-0% 888888885885 888888D 2.3886 mm
83o3<< tame“: .8: Eu 8882 285888 8880 888888888 8.838% N88 mm
$8832 5888 85838-92 82.88 888.28 8.58 88 88.5888 .58 s
888.882 .0: .oo< .o:
b95385 455800 Emmomlfimflm 88.8830 88.88% Km

 

383 N 39:.

53

 

 

2&meth 280V 8088 285808 $80 2885 8.228 33.88%. _._ V88 3
:33 69:0 53% 0 522a 8882. 530 :8 38:38 05% E
mmmocVImZ 356.68 .33 8208 28.5808 385 02:85 53.235388 SBEVEBM Fix mo
Ge .5 $8232 528 0833ch 3:58 53.23538 8%st .3 85m 8
38 and $83th 8088 28.5808 8:8 98.85 8.288 Sfincéum _. “NEE S
gob 88 Sou. 5m?
honmwofiu $80828 8088 235808 888 8088 Eek 8858398 583% 52 00
NM 333m Z 8208 883808 888 829$ .888 BE EEEEESO 58838” 38 am
3 2:32 5205 BE?» 263.: .688 3:28 3:6,: mm
A $3 .fim 828...? 53.8 08538 025.5 583538 £828 E? S
208 .8m 3: Sela—Z 8808 8898o8 9885 8288 38:285. #18 em
8% .8m ommwmvflmz 8088 235808 o_£o=v=_-own88-<zn 8.288 338.58% “8.5 mm
@va .oom Emma 8088 ton—xv 8888338 2380 :8 uiutuauam 083 cm
v 8898 many—.5
GS dam flowoclmz -EEoanEmawuggxofiao o:8£a-fl-_8a_a-m 88K Efiflmx M88 mm
63 .88 2 S _ «dz 8-52883: :8 55:35 . E: 2
088808895 88 38...; :8 3.88m:
wk. 33in? 8808 .8988 9885 53235388 $3853”. #83 3
389.88“ 883:.
8me<<0 8088 8683 8928.53 8088 8:83 8803 8228888 3.8.38» 58: Cm
832$ 538 :38“: mass; 0833ch 2:38 €88 35%: as? 3
30 .94”. _ 533.1% 880.8 0:898u8 88888 0m< 3885 53.235218 58888 388 we
33 6mm omoccvflmz 88088 85:? 888988 Um? 383.5 53.2353“? 33.88% $3 3
8809.2 885—2883 8338.88 82.38» 152‘ 3.
woonnVImZ 888a mama—842880 05836282052 388.38% an 9.
R $3.1m Z 8808 888.58 889$ 80988 octgowzo 88% £8.38» U88 3.
seem maven
smacolmz 088—888 ”80:88.8 Um? 0282885 88& 8.58» V88 9.
N.8228 .8 .8< I .8
380.505 #8950 oxamom flan—m 8&5»ch £286 . Q

 

0.83 N Mimi.

54

 

3 ENG: m 5229 x85 own—E 82:80.83» 3595. {Quad mm
888:2 522: 8:85-28 2:5: ”:8: 558: 8:: 8
32m 5395
Ge .me 888.? :88 .85 €38 own—m5 522g :80 88855: 83383:: m8: 8
38de m 522: 058858333 8:8: 555. SE 3
cos .5: 833.? .888 8:532 58:85 53.23538: 38888 :8: 8
88:32 88:8 2:33 53.23238 38853: 5:: 3
$82.? _ €33. 83:5 3583: o 25:85 :8 38.588: .30 S
cafixousv
wo— ~Mmlnmz. ugnzm =«Em .omflosvou ects.—0906:»: TO=< mnwuwmtmfié «SVQSKLSS‘Q *UQQQ —w
88268
88:52 22": v 522: 885-8828 2&3 :8 582:8: i8: 8
mnameIAZ £3ch cowatflm Gone—«U Qumxm~§ SNEBENQM. V2.0 an
35:04}: €va 5805 55.33% 9:56 couooaoa <29 388985 33.2mm at w:
c—ooNU 25w :O—Swou mOm .uoznfi ”5636 :00 wmtmwckmu kmaufickmufimw TEE. hm.
an : 5% Ecovnmz 528: <8: 8:8: 55,8: .82 2
E : .8> 58,92 ms: 538: :82 8.9:”? SE :8: 52.28: as: p
8.8%?— 39.5
88232 83%: NEE 828$ :8 58:88: Q2: 2.
mfimmvdz 888:: 82: 2885 8.228 $8853: .825: Q
can...— - 8.3529 2392
hmi‘wNImZ E205 gown—3.5% 033:5 :8 339.2393 amok Nb
Emvfidz SE 532: :25” 888 8:08.: :8 58.58:: 8% K
585-? 0:". .885 8:8 888 8:82,: t2§§8m§ Di 2
Eammlmz 2»; .888 $855 2.8“: .85»: 58:3: 2% 8
383-? <8: see: wagsouéfim :3. :8 5:38:98: 52: we
mmevov1m 2 H858:— 5 833.5 3.8% 852m: .. 53 no
wovgdz => 88.2: .3 an 532.. 88:88. 830 :8 £8,238: _. 5:: co
:uotoao: .o: .oo< I .o:
39530.5 x5980 gummamom Ema—m =55»ch :m2mb : &

 

9.8“: N 5mg

55

 

 

mace“; Z zd £8qu @22st cowobmz 2:an £32m» MEM as.
8531? 58ch >83st actuate“ BEE Ea BEE—am :8 uSutmfinm .E\ wo—
egmoeumz $8562 “285:5 233$ seen rename; ”can :3me .289: 8.
$38.? 508a rename 2:55 nag «ES; em 8% 2:
$281.2 5065 E332 383822“ bfiééfi ”.53 552.: #38”: 8.
mnmmahlmz Baa—:3“ .aaotatomaab bun—um Much @328. SR 3??? Qacsohammm E nabsmmfi X:
23 .fim c8852 «m3 8.2:? 389388“ 2653 :8 sfitmfifi $33 8.
882 833? 38358.3 25-5: 3&52 £238: «35 N2
$821.2 6:5 .22st 383585 Efiéufimsm 9% z:
Smammlmz 52.5 9.332 25-05. ”ESE :8 35.23% .22 2:
once—51ml 83052 :0 «3:8— omfia 8m 2.28% 8385 tmauukuammim v3: 3
:3st 05:250.: 05 mo EmmoEoSEo—z
22.31% £88m >53:on :03w8 82v 83052 82 388:3»: naheufsoal ENE ma
SmmelmZ Samoan.— =ohoqc omcntaxouE zoom 8.28:» 532255; «8% 3
ohmmeImZ .8329: 9:30 5.58:5: Bacon—w 822$ §m§§§w «3% ca
wovmovflmz £8qu >85:on 38am «Ema 335:2? 033:5 3me 8.:me Na 3
Co; 5m 3331A? 5205 833 bra—cfimoREmBmaafl 05235 Mama £5.28. *Nhs a
a3; 3<< 08:3 888 8.52:? 3:38“ Eco—w 258$ cuiuasbm 3.29:3; .. ”EM mo
< 3889
w~wm¢< 553.8 $35583 8338 Eon 2:200 9833.5» 52.32% _. 5.2 Na
cave—<15 onEo: mm». 38ch <mE EQSNAEQ SEEM Va? 5
gun—away—
:es .fim 82232 2665 $58.23 m=n300~-_§oz §§s§3 §u§§m .E 8
2 .25: 0 53¢:— v—oofi owaam 3333.63» 55me DAR aw
acetone“ .0: .oo< I .8
3325.5 Magma—BO uzwumom flaw—m :55»wa emzmw NE.

 

shag N 5%?

56

 

 

Gm 88262 ocgamOoEwEgaznm—booa
.VNV umfiomm mw_v~<<< -2459 omSochoExO :8 uSotmfium .mLaE mm—
GNV 5mm Nwooflnmz 820352202 afi%29738=6 =8 $9.235 ER N2
63 6mm Nngdz asauzoc 28 2535356922. SEE gages“; ms: 5
AGNV .5m .3st 85538 2833a \ 352: agarose 5835 552m E3 5
69 6mm 323MHz 835m 886039;:me 38,8553 ”3331823 «OMS am—
GNV dam £32-? 820.28amonuofimofiougx :8 usutgam Liam NN.
QNV .3 28332 E 0355 358.20% ”can 55%: .3. E
win-3.38 325:: can SEE—.32
an»; :<< 255% owns—ma SEES—on <72 mauLmEQMMu 88.6% QcE cm—
GS 63— mmmocm 88¢ vméfiwa 8885—3 SAM 33958.3 SEENQ >33 mm—
anocnmz 38:3 <5 .8208?&< £3 35$» . is: a.
30 5mm NNNNE <35 88:2. a$=§¢¢< :8 sfiEfifi 35 NN_
Navmvwlm Z £88m 8E8“: Eugene—Ymmcoh gums?» nuzosomohi Sums NS
ONSNSOINN 2:5. 8223: £822 2&5 seomésksofigé @2395 _N_
mwbmoocoN—N omniv— anoa cacaofitoctom §=a~m5> .SBBSQNV waVS>V om—
Scmovdz mfitomafix 053083 a 25 958.5 $2.3 SSEQ 330%» a:
NNwoNodz 82: 35.5 fig 352“: . an? N:
homemmlmz 2.53 833w“: emu—cameraman.“ Egan—oi ameSMEma 9.395638% R NNVm >2

96M 55 8893
©334<< EOE—smog 28888-05 5 3:2st 09.38% 5:23:3So 332°st MQE 0:
£33th commmoaxu 28m 82 .3 “Sn—swag 03325 9.28:» SENSE?” .. 335;. m:
ONNVNéufi seen 55.. m5— 835 §§§§m 235m 3.
N. .332 85% we 3.. saamom .55»: £35 .22: N:
383152 ESSA .8568 Ema—9:0: 258nm Magma 852m» MAE N:
fiwmmVIAZ 3:268 .agmatomuab :82? 95 3.225 £3.85?” Ema :—
vaowmlmz 528a boa—swag 839. 235302 :8 Sautmfinm $3.: a:
$5953» .0: .oo< I .o:
bmsoSoi x5980 utmumom 5.35 22.2836 amzmw NE

 

9.8"; N 339

57

 

 

m _ «womlmz N 8535983 2:93 :8 uSutmfiam $3.6m mm _

movmcv1mz 82.23330 Sgaq—oaooaamonm Eatagfig czmzcgum SEQ cm—

w 53‘an omgowofimsow 8398:9668030 Manna Ssrmx E mm—

Nmaacclmz ommaowoéxzov oafiamonqééfinoga «2me 352m» 3% v2

oSEImz omaéamofifigawosam :8 asutmfifi Ex 3

chfiumz 9F: usufia 033on fig 33%: 329: N2

mg hwowlmz ommcowofizgoc Sma 028226 3.58.5 «bank 35me 1K NNOnE G—

mmmmovflwz omfiommcg SEEM 03.3on Mani £5».me *QNVNQai on _

caged—Z £88m mung—>85 aficiounbo—z “68% SEEN» Dues 9;

SmNV .cm mvmanImZ U 5805 £35585 “Bowman ”Santa—o2 8.22:» uzchEm. #032: mi
mmaoclmz omfiomagafiofi 89.2320 Mama 55me x23 5:

an .oommwm ”851.2 8805:“ 825:6 Mean esrfi _. ER 9:
63 5mm £8932 z 88.53%; Eurasia sagas» 2&3 n:
so: 50> £03.32 aeaégbog 28558< ”can 552“: Es 3:
69 6mm wemmhlmz 520 8:80 .E 322:»? <29 :8 pingam .93» m:
an .8: NESME 33m: “Ease“--fia 322% EU 82%» §~§§£ 33$ N:
$832 89:5 E cowoqfigeoge: §§53§ sagessm as»: :2

woficeumz seen 95. ”ER 5:23. 9% o:

Avmv in 8331.? E8388 5 08536306 88,3?— uotSzm §m=c£~cm Mme: m2
Ava .2 232$ €33 gauge»; 25.5 fig :3me 95 ”2
$3 .2 38.32 aéugées 2653 “53 35$» 229: 5
$3 .2 356.32 aefiagzseoaea $5.5 Etafiib §§§§ NE 92
cé ,2 3832 8283: £825 €0-38 2653 mean 35$: 38% 9:
as as. mama was 32.5 3:338 «ENE §.§§8§ .931 v2
aversion .o: .oo< I .o:
$325.5 Ema—00 92:“QO 535 :5:qu0 ewzmb E

 

383 N 35¢

58

“Hypothetical and unknown genes were not listed.

bGene name designations were based on originally-reported gene products that shared high
similarity to pfi clone sequences. Asterisks afier the gene name indicated that two or more
clones were identified for the same gene in the experiment.

cPredicted proteins or functions based on similar proteins identified using BlastX searches.

Genes identified to be induced in other bacteria-plant or animal systems using similar
IVET screen or other in vivo expression systems. Rso: Ralstonia solanacearum;
Ech: Erwinia Chrysanthemi; Pst: Pseudomonas syringae pv. tomato; Pfl: Pseudomonas
fluorescens; Sen: Salmonella enterica; Sty: Salmonella typhimurium; Sau: Staphylococcus
aureus, Apl: Actinobacillus pleuropneumoniae, Vch: Vibrio cholerae, Eco: Escherichia coli.
Number indicated the reference.

59

Quantitative expression analysis of selected pear up-regulated genes

To verify that the pear-upregulated gene promoters identified using the qualitative
IV ET assay are induced in pear, quantitative GUS activity for six strains containing pfi
promoter constructs and for promoter constructs containing the dspE promoter (in both
directions) was monitored 24 and 48 hours after infection of immature pear. The positive
control dspE f“ promoter in pZYF 8 was highly induced in pear after infection at both 24
and 48 hr post inoculation (Table 3), whereas the negative control dspE" promoter in
pZYF2 showed very low GUS expression (Table 3). Most of the pfi clones tested showed
varying degrees of induction of promoter activity at 24 h and 48 h after infection of
immature pear (Table 3). The pfi 43 clone (oppA) was found to be highly induced at both
24 and 48 h after inoculation; whereas pfi 5 (hothoCEA), pfi 9 (ytsIIJ), pfi 91 (rlsA), and
pfi 93 (grrS) were only induced at 48 h post inoculation. The clone containing
hypothetical protein (sav2932), on the other hand, was strongly induced at 24 h post

inoculation with expression tailing off at 48 h (Table 3).

6O

TABLE 3. Expression of IV ET clones afier inoculation of immature pear fi'uit

pfi clone Gene 0 hpi" 24 hpi" 48 hpi"
or strain homolog

 

 

 

GUS GUS Fold GUS Fold

activityb activityb inductionc activityb inductionc
PZYF2 dspE r" d u.l.f u.l.f O u.l.f O
pZYF8 dspE for e 1.0 i 2.1 282.0 :1: 145.5 282.0 118.3 :t 18.4 118.3
pfi5 hothoC 10.8 :t 6.7 11.8 :1: 4.4 1.1 90.1 i 43.3 8.4
pfi9 ytsIIJ 37.1 d: 2.0 74.7 :1: 34.9 2.0 128.0 d: 48.8 3.5
pfi43 oppA 1.0 d: 0.9 91.4 :t 27.4 91.4 138.9 :1: 25.2 138.9
pfi9I rlsA 1.0 a 1.3 11.1." o 19.2 :1: 12.6 19.2
pfi93 grrS 77.7 i 2.3 30.2 i 7.0 0.4 106.3 i 35.8 2.4

sav2932g 107.4 :1: 3.5 852.2 d: 380.3 7.9 86.2 i 40.4 0.8

“Hours post inoculation (hpi).

bGUS activity is shown in mol of 4-methylumbelliferyl produced min1 109 CFU".

Data represented the mean of three measurements i standard error. Similar results
were obtained in a second independent experiment.

CF old induction is shown as GUS activity at 24 or 48 hpi/GUS activity at 0 hpi.
ddspE promoter in opposite direction of uidA gene.

edspE promoter in correct direction of uidA gene.

u.l.: Under detection limit of vector control.

gsav2932 encodes a hypothetical protein and is not listed in Table 2.

Construction and analysis of knockout mutants

Although the IVET experiments were conducted in the E. amylovora Eal 10'
background and an Ea110 hrpA mutant was available, we were unsuccessful in
subsequent attempts to construct chromosomal knockout mutants in this strain. Thus we
utilized the strain Ea1189 for mutant construction. Although the similarity of genetic
backgrounds of these strains is currently unknown, the virulence of the two strains is
similar (data not shown) and the overall genome diversity of E. amylovora is relatively
low and therefore, we hypothesize that the expression of promoters identified as
upregulated in Ea110 would be comparable to that in Ea1189. We chose the hothoCEA

and mltEEA genes as candidates for insertional mutagenesis using allele marker exchange

61

to investigate the potential roles of those genes in virulence. The full sequences of these
genes and their corresponding upstream and downstream sequences were obtained by
various methods including fully sequencing available clone inserts or by recovering
additional flanking DNA sequences using thermal asymmetric interlaced (TAIL-) PCR.
Sequence analysis showed that the deduced amino acid sequence of the hothngA gene
shared 77% similarity with that of hothonsr gene from P. syringae pv. tomato (data not
shown). The deduced amino acid sequence of E. amylovora mltEgA gene showed 75%
similarity with that of mltEyp gene from Yersinia pestis (data not shown). As described in
Materials and Methods, we were able to generate insertional mutants for hothngA and
mltEgA genes and tested the effect of these mutations on pathogenesis and bacterial
growth in immature pear.

The hothoCEA mutant ZYC1-3 was fully virulent like the WT Ea1189 strain
upon infection of immature pear (Figure 3A). The symptoms caused by the hothngA
mutant also progressed similarly to the wild type strain and caused typical symptoms, i. e.
necrotic lesions and the production of bacterial ooze (Figure 3A). In addition, we were
unable to detect significant difference in bacterial grth upon infection of immature
pear for the hothngA mutant (Figure 3B). In contrast, the mltEEA knockout mutant
(ZYE3-11) was slightly reduced in virulence and bacterial growth (Figure 3A and 33).
Although the mutant caused similar symptoms as the wild type strain, symptom
progression was slightly reduced (Figure 3A). There was no difference for bacterial
growth of the mltEEA mutant compared to that of the wild type strain two days after
inoculation, however, cell counts of the mltEgA mutant were 5 to 10 fold less than that of

the WT strain at three and four days afier inoculation (Figure 3B).

62

 

 

WT ZYC1-3

fi

ZYE3-ll W

       

 

 

 

 

B
12
11‘
10‘ i
0 9‘
a —o—E31189
.3 81 —-—zvc1-3
an . +ZYE3-11
D 7
in
U 6‘
M
6
1-3 5‘
4
3 v r x
0 1 2 3 4

Days post-inoculation

Figure 3. Symptoms and growth of Erwinia amylovora WT Ea1189 and corresponding
hothoCEA and mltEEA mutants in immature pear. (A) Symptoms caused by Erwinia
amylovora Ea1189 and hothoCEA (ZYC1-3) and mltEEA (ZYE3-11) mutants in immature
pear. WT: Wild type strain; W: water control. DPI: days post inoculation. (B) Bacterial
growth of Erwinia amylovora WT Ea1189, and hothoCEA (ZYC1-3) and mltEEA (ZYE3-
ll) mutants during infection of immature pears. The growth of strains was monitored at
0, 1, 2, 3, 4 days afier inoculation. Data points represent the means of three replicates 1-
SE. Similar results were obtained in a second independent experiment.

63

DISCUSSION

We utilized a simplified qualitative IVET approach to scan the E. amylovora
genome and recovered 394 miique chromosomal genes with increased expression during
infection of pear fruit tissue. As expected, this study highlighted the importance of type
III secretion in E. amylovora pathogenesis with the recovery of genes encoding
regulatory and structural components of the Hrp type III secretion system and effector
proteins. While we did not recover all of the currently known hrp-regulated genes in E.
amylovora, our results are similar to those of other IVET studies with plant pathogenic
bacteria. For example, IVET studies of E. chrysanthemi and P. syringae pv. tomato
identified two and eight hrp-regulated genes, respectively (24, 261). These findings
validated our approach and suggested that a detailed analysis of the genes recovered in
this study would further reveal additional determinants involved in the pathogenesis of
the fire blight bacterium.

The dspEF operon, encoding the major effector and pathogenicity factor DspE
and its cognate chaperone DspF, was recovered multiple times in our analysis and shown
by quantitative expression analysis to be highly expressed during pear infection (Table
3). The importance of DspE and its homologs to plant pathogenesis is well known in a
number of pathosystems (26, 77, 143, 170, 243) although the elucidation of the
function(s) of this large protein remains unknown. DspE was recently shown to
contribute to the suppression of salicylic-acid-mediated basal immunity (57); effector
suppression of the host defense response is rapidly becoming recognized as an important

strategy of bacterial plant pathogenesis (5). We identified a new putative effector

64

HothoCEA in this study, an ortholog of HothoC from P. syringae pv. tomato (224). As
with many effectors from P. syringae, a knockout mutant of HothoCEA in E. amylovora
Ea1189 was not reduced in virulence presumably due to functional redundancy with other
effectors in the E. amylovora genome. The other known E. amylovora effectors HrpN
and HrpW were not identified as upregulated in this study; although the roles of hrpN and
hrpW in the pathogenicity of E. amylovora were reported to differ during infection of
immature pear fruit (126, 252). It is tempting to speculate that additional effector
proteins may exist in the genome of E. amylovora and contribute to the virulence of the
bacterium.

The importance of type H secretion in E. amylovora pathogenesis was also
highlighted with the identification of the upregulation of genes of the ytsIIJ operon and
components of the general secretion pathway. Type H secretion is a c00perative process
initially dependent upon the secretion of enzymes into the periplasm by the general
secretion pathway followed by targeted secretion through the type II apparatus (9, 220).
In Y. enterocolitica, the Ytsl protein secretion apparatus is unique to highly pathogenic
species, is important for virulence in a mouse model, and shares homology with type II
secretion clusters from E. chrysanthemi and E. carotovora (17, 112). Peh
(polygalacturonase), an enzyme thought to be secreted by the TZSS, was also upregulated
and recovered in our IV ET screen (122). While the importance of polygalacturonase to
virulence in soft-rotting Erwinia spp. is well known (122), the role of cell wall degrading
enzymes in E. amylovora pathogenesis is currently still unknown. In addition, the
upregulation of MltE, a specialized cell-wall-degrading enzyme was interesting in that

the function of this enzyme is to generate localized openings of the bacterial

65

peptidoglycan envelope for export of bulky materials including possibly toxins and
fimbrial proteins and to allow the efficient assembly and anchoring of supramolecular
transport complexes such as T2SS and TTSS in the cell envelope (63, 130). As in P.
syringae (24), we found that E. amylovora MltE made a small contribution to virulence.

We identified three additional upregulated enzymes in our IV ET assay that are
potentially secreted from the cell including levansucrase Lsc and the adhesin-like protein
HecA which belongs to a class of external virulence factors that is widely distributed
among plant and animal pathogens. HecA from E. chrysanthemi contributes to
attachment, aggregation, and epidermal cell killing and is thought to be involved in the
earliest stages of E. chrysanthemi pathogenesis (212). Levansucrase, an enzyme that
directs the synthesis of levan from sucrose, has a known effect on the virulence of E.
amylovora during pear seedling infection (85). The PrtA metalloprotease contributes to
E. amylovora virulence in an apple leaf infection assay and is apparently dependent upon
the type I Prt machinery for secretion (122, 265). These results demonstrate the
importance of TTSS, T2SS and of other external virulence factors in E. amylovora
infection of fruit tissue.

A total of 5.3% of the IVET genes identified were placed in the functional
category of stress response including genes involved in the response to reactive oxygen
species, both heat and cold shock, and carbon and sulfate starvation. E. amylovora
apparently induces an initial host defense response early after infection (247, 248); the
bacterium is capable of surviving this plant oxidative burst with the initial plant cell death
and nutrient leakage thought to provide the impetus for fiirther spreading of the pathogen

within the plant. The role of individual proteins in oxidative stress survival is currently

66

unlmown in E. amylovora, however, the alkyl hydroperoxide reductase AhpC is a known
virulence factor in several plant pathogenic bacteria contributing to protection from
oxidative stress from an active plant defense response (169).

We recovered a multitude of transporters frmctioning in the uptake of iron, sugars,
amino acids, and inorganic ions. The induction of these systems during infection
indicates that E. amylovora elaborates various factors as needed to colonize host tissues.
Iron availability is critical to most bacterial pathogens and the siderophore
desferrioxamine is a virulence factor in E. amylovora (73). We recovered three
upregulated proteins involved in iron transport or storage. It is probable that under
unfavorable conditions, the bacterium itself adjusts and overcomes nutrient and iron
deficiencies. Several upregulated transport proteins recovered were ABC transporters
which is potentially significant because ABC transporters both directly and indirectly
affect virulence of bacterial pathogens (80). While most of the transporters were
involved in uptake, the multidrug resistance proteins EmrB (pfi 31) was also upregulated
and presumably functions in the efflux of plant-derived toxins encountered during
infection. The role of the AcrAB efflux pump in E. amylovora virulence and tolerance of
phytoalexins including phloretin, naringenin, and quercetin was recently reported (3 8).
Thus, it is possible that many of these ABC transporters are involved in the virulence of
E. amylovora. In conjunction with the number of upregulated transporters found, a large
proportion of the genes identified in this study were involved in metabolism (20.3%) and
nutrient acquisition (16%). These fi'equencies may be associated with the host tissue

(immature pear fruit) chosen for study; however, a number of genes we identified were

67

also identified in other IVET studies involving E. coli, P. fluorescens, P. syringae, R.
solanacearum, and V. cholerae (Table 2; 24, 36, 150, 261).

About 12% of the genes identified in this study were involved in regulation,
which is a similar ratio to that identified in an IVET examination of E. chrysanthemi
infection (261). Previously-known E. amylovora transcription factors that were
upregulated included RcsA, an activator (along with RcsB) of amylovoran production
(251) and RlsA, an activator of levan production (264) along with the capsular
polysaccharide export protein KpsC. This further confirms that the production of both
amylovoran and levan in E. amylovora is induced during infection. Another important
regulator, GrrS (global response regulator sensor in a two-component regulatory system),
is a homolog of GacS which, along with GacA, globally regulate a network that controls
exoenzyme and secondary metabolite (toxin) production in Pseudomonas spp., virulence
functions in E. carotovora, and also regulates the production of quorum-sensing
signalling molecules (45, 72, 203). GacA/GacS-regulated networks also function by
positively controlling the transcription of small regulatory RNAs, transcriptional
activators, and alternative sigma factors such as HrpL (45, 100). In E. amylovora, the
small regulatory RNA rsmB titrates the repressor RsmA in a system that affects
exopolysaccharide production and therefore, pathogenicity (147).

EnvZ is the sensor component of the OmpR/EnvZ two component regulatory
system that is very important in regulating various cellular components such as outer
memberane proteins OmpC and OmpA, which is also upregulated in this study. In
Salmonella spp., OmpR-EnvZ regulates another two component system SsrA-SsrB that in

turn regulates the type III secretion system produced by Salmonella pathogenicity island

68

2 (Spi-2; 133). EnvZ is a transmembrane sensor that predominantly responds to acidic
pH conditions and subsequently phosphorylates OmpR which functions as a
transcriptional activator in the expression of the ssrAB genes (79). SsrA is second sensor
protein that is responsive to acidic pH and also detects low osmolarity conditions and the
absence of Ca2+ ions, all environmental conditions within macrophages where the Spi-2
type III secretion system is exclusively expressed (79). In E. amylovora, the structural
components of the TTSS encoded by the Hrp regulon are regulated by the two component
system HrpX and Her, which direct the expression of the GSA-dependent, enhancer-
binding protein HrpS (251). Both Her and HrpS function in activating the expression
of the alternate sigma factor HrpL, thereby regulating the various genes and operons of
the Hrp regulon which contains HrpL-dependent promoter sequences (251). The
expression of HrpX and HrpS is regulated by low pH, low nutrients, and low temperature
conditions, mimicking the plant apoplast, but also representing conditions that suggest a
two component regulatory system such as OmpR-EnvZ could further regulate the hrpXY
operon despite no direct evidence to support this claim. Interestingly, both hrpX and
hrpL, along with EnvZ were found to be upregulated during infection of immature pear in
this study (Table 2).

Among the bacterial cell surface and transmembrane upregulated proteins, three
flagellar proteins FliG, FliM, and FlgN were upregulated. The trait of motility is not
required for E. amylovora pathogenesis, however, motility does increase blossom
infectivity, particularly at lower cell concentrations (16). Furthermore, a homolog of Y.
pestis FliZ, a positive regulator for the flagellar biosynthetic operon and an alternative

sigma factor, was also found to be upregulated in our study. In Salmonella enterica

69

serovar Typhimurium, F liZ upregulates HilA, which in turn activates production of
several invasion proteins encoded within the Salmonella pathogenicity island 1 (113).
Finally, the contribution of cell shape to virulence was also highlighted by the recovery
of an E. coli RodA homolog; E. amylovora mutants with TnPhoA insertions within the
rodA-ppr operon were previously reported to be avirulent (165).

In summary, our IVET screen successfully identified a variety of genes
upregulated during fruit infection by E. amylovora. We utilized a modified IVET method
in this study which is different from many other IVET studies in that we did not impose a
rigorous selection step, i.e. one that necessitates rescue of an essential phenotype, in our
gene identification work. An advantage of our approach is that we screened clones
individually which would remove potential competition among firsion clones in vivo if
inoculated as a pool. The successful identification of a large number of known virulence
genes of E. amylovora in this study further validated our approach. However, because of
the qualitative nature of the gene identification step, through B-glucoronidase staining
and visualization of gene expression on pear slices and agar medium, it is possible that
this methodology may have resulted in some artifacts. Nevertheless, the main goal of this
work, as in other IV ET analyses, was to identify potentially important genes in the E.
amylovora infection process that could be subjected to further detailed studies to clearly

delineate the role of these genes in pathogenesis.

70

We further confirmed that the TTSS and its major effector protein DspE are
essential for full virulence in E. amylovora during infection of immature pear. We also
found a complete and functional T2SS and its potential secreted proteins in E. amylovora
for the first time. We identified a new putative effector, external virulence factors such as
HecA which were previously unknown in E. amylovora, and discovered a number of
putative regulatory proteins that may influence the regulation of virulence factors on a
global level and eventually contribute to the virulence of the bacterium. We can now ask
questions concerning the comparative regulation of critical genes identified in this study
during infection of other host tissues, particularly blossoms and shoots. It is possible that
E. amylovora the pathogen may utilize differential virulence strategies depending upon
the host tissue encountered. Of interest to us also is the expression profile of these same

genes during infection of highly susceptible versus fire blight-tolerant apple varieties.

71

CHAPTER 2

Taking a page from macerogenic bacteria: Functional characterization of an

Erwinia amylovora endo—polygalacturonase and its effect on virulence

72

ABSTRACT

In a previous in vivo expression technology (IVET) screen of induced Erwinia amylovora
genes during infection (Chapter 1), two genes associated with type II secretion (T2SS),
the pseudopilins outIJ and an endo-polygalacturonase peh were identified. Here I
describe the contribution of TZSS to virulence, using deletion mutants of outDEA and peh.
In particular, E. amylovora peh was reduced in virulence during apple leaf inoculations
when cells were not introduced into the main vascular tissue of leaves. The activity of
both the T2SS operon promoter and peh promoters were also determined under differing
conditions using flourometric methods. Additionally, the peh gene was confirmed to
encode a protein with polygalacturonase activity. His-tagged polygalactuonase was
present in the supernatant of E. amylovora, demonstrating secretion to the extracellular
milleu. Overall, this is the first report of a polygalacturonase enzyme influencing

virulence of E. amyolvora.

73

 

 

INTRODUCTION

Erwinia amylovora is a Gram-negative phytopathogenic bacterium that infects
members of the Rosaceae family. This necrogenic pathogen causes tissue necrosis and
additional symptoms including water soaking, wilt, and cankers. Infection can occur
either by entry through nectarthodes in the base of flowers, or through wounds on young,
actively growing tissue. Entry into the plant via wounding is followed by multiplication
in the cortical parenchyma, and the expression of disease promoting genes (246).
Ultrastructural analyses have shown bacteria-dependent plasmolysis by 24 hours post
infection, of xylem parenchyma. As the infection progressed, the extensive plasmolysis
appeared to lower the turgor pressure around xylem vessels resulting in the bursting of
cells (90). Later studies have demonstrated that infection and symptom development
depends on the secretion of extracellular proteins from E. amylovora.

Major pathogenicity factors of E. amylovora include a type III secretion system
(T3SS), the type 1H effector DspA/E, and the exopolysaccharide amylovoran (11, 18, 26,
27, 82, 127, 239). Secretion and translocation of DspE and an additional effector HrpN
through the T3SS causes tissue collapse in susceptible hosts, and a hypersensitive
response in resistant hosts and nonhosts (246). Amylovoran is hypothesized to protect E.
amylovora from the oxidative burst in host tissues and also to mask the presence of E.
amylovora from its host (128).

Virulence factors also contribute to infection by E. amylovora including the iron-
binding siderophore desferrioxamine (60) and genes conferring the utilization of sorbitol,

the major sugar present in apple (3), galactose (161) and sucrose (29). E. amylovora also

74

secretes other virulence factors that affect interaction with its host, including the recently-
described type III effector AerptZEa (267), metalloprotease (PrtA) (265) and the levan
biosynthetic enzyme levansucrase (20, 85). E. amylovora also possesses a full sec
transport system which supports other secretion systems such as type II, type IV and type
V (auto-transporter) secretion (188, 238, 266).

Type H secretion (T28) is an important virulence factor in gram negative animal
pathogens and phytopathogens such as Pectobacterium carotovorum, Erwinia
chrysanthemi, Ralstonia solanacearum, and Xanthomonas campestris. The TZS operon
was identified first from Klebsiella oxytoca by transferring a plasmid encoding the T28
operon from K. oxytoca to Escherichia coli to demonstrate that T2S proteins were
required for the secretion of the enzyme pullulanase (215). Transfer of a cosmid
containing the T2S from E. chrysanthemi to E. coli was also used to demonstrate the
ability of the T2S to secrete various extracellular enzymes (138). Genome sequencing
has made it possible to identify the presence of T28 genes in many gram negative
bacteria other than pathogenic bacteria (50). However, the comparison of known
functional T28 systems highlights 12 to 15 proteins expressed from the operon are
required for secretion across the outer membrane (215, 219, 220). Although the gene
naming convention has differed slightly amongst species possessing a T2S system, the
majority of the gene products follow the Klebsiella gene designation as A through 0 plus
S (50, 219, 220), with proteins CDEFGHUKLMNO acting as the core of 13 essential
T28 components (50). Here the general nomenclature of the T28 operon, “general

secretion pathway” (Gsp) will be followed.

75

Exoproteins secreted by phytopathogenic bacteria include proteinases, amylase,
pectinases, cellulases and polygalacturonases (50). Polygalacturonases present in
phytopathogenic bacteria fall into two categories, endo- and exo-polygalacturonases. The
former catalyze the random hydrolysis of pectic acid forming oligogalacturonates while
the latter catalyze the terminal hydrolysis of pectic acid forming galacturonic acid
monomers (115). While endo-polygalacturonase activity has not been detected in E.
chrysanthemi (109), endo-polygalacturonase activity is a known virulence factor in P.
carotovorum (216), R. solanacearum (61, 107) and Agrobacerium vitis (210).

Analysis of the secretome of E. chrysanthemi identified 14 T28 secreted proteins,
including 11 pectinases, cellulase, rhamnogalacturonan lyase, a novel esterase and a
novel Avr-like protein (122). Sequence analysis of Ralstonia solanacearum has
identified 6 exoproteins including three polygalacturonases, a pectin methylesterase, and
two cellulases (139). Previously, E. amylovora was described not to possess any cell
wall degradation abilities (226); however, recent studies have described the presence of a
type II secretion gene, outF, based on Southern hybridization to an outhca homologue
and weak CelA activity (207).

We have previously described the upregulation of outIJEA and peh expression
upon colonization and infection of immature pear tissue (266). The pseudopilins outIJEA
share the highest homology to ytsIIJ from the human pathogen Yersinia enterocolitica.
In addition, the identification of peh, an endopolygalacturonase, indicates that E.
amylovora may use a polysaccharide degrading enzyme during host infection. In order to
determine the contribution of T2SS to virulence, deletion mutants of the porin gene

outDEA and polygalacturonase peh were created. Additionally, the expression of uidA

76

fused to the T2SS operon promoter and peh promoter was determined under differing

conditions.

77

METHODS AND MATERIALS

Bacterial strains and plasmids. The bacterial strains and plasmids used in this study are
listed in Table 4. E. amylovora and E. coli were cultured on Luria-Bertani (LB) medium
at 28°C and 37°C, respectively, unless otherwise indicated. Minimal media was
comprised of 1XM9 salts according to Sambrook et al. (217) with the addition of
thiamine (0.02% w/v), niacin (0.02% w/v), and 2% (w/v) of one of the following:
fructose, galactose, glucose, sorbitol or sucrose or 0.25% (w/v) pectin derived from apple
fruit (82, 155). Liquid SOC medium used for transformed cell recovery was made
according to Sambrook et al. (217). Antibiotics were used at the following concentrations
in medium: ampicillin (Ap), 100 rig/m1; carbenicillin (Cb), 50 ug/ml; chlorarnphenicol
(Cm), 25 [Lg/ml; gentimicin (Gm), 10 jig/ml and kanamycin (Kn) 25 jig/m1.
Oligonucleotide primers used for PCR were purchased from Invitrogen (Carlsbad, CA)

and are listed in Table 4.

Molecular biology techniques. Genomic and plasmid DNA isolation, gel purification of
DNA, and PCR fragment clean up were performed using Qiagen kits (Qiagen Inc.,
Valencia, CA) according to manufacture’s recommendations. PCR amplification,
restriction enzyme digestion, T4 DNA ligation, and cloning were all performed according
to standard molecular biology protocols (217). Sequencing of DNA was performed by
the Research Technology Support Facility (RTSF) at Michigan State University.
Database searches were conducted using BLAST programs (7) at the National Center for

Biotechnology Information (NCBI) and the E. amylovora genome sequence at the Sanger

78

Institute (http://www.sanger.ac.uk/Projects/E_arnylovora/). Amino acid alignments were
conducted using ClustalW (v1.83) from the European Bioinforrnatics Institute
(http://www.ebi.ac.uk/services/index.html). Signal peptide determination was done by
the SignalP v3.0 program (http://www.cbs.dtu.dk/services/SignalP/) using both neural

networks and hidden Markov model predictors of signal peptides (71).

Construction of the peh and outD deletion mutants. Construction of stable E.
amylovora mutants was as previously described (267) using the A phage Red recombinase
system (56). Eall89(pKD46) was grown up overnight and diluted 1/10 in fresh LB
medium supplemented with ampicillin and 10 mM L-arabinose and grown to an ODwo of
~ 0.6. The cells were then pelleted (5,000X g) and washed three times in 10% glycerol at
4°C. After the final wash, the cells were resuspended in l/ 100 volume. The primer sets
OutDmut-F/ OutDmut-R and Pehmut-F/ Pehmut-R were used to generate PCR fiagments
that were transformed into 100 pl of competent Ea1189(pKD46). Cells were resuspended
in 500 pl of SOC medium without antibiotics and allowed to recover overnight at 28°C.
Transformants were then plated on solid LB medium supplemented with Cm and Ap.
Colonies that were resistant to both Cm and Ap were selected for PCR screening using
primer pairs that amplified from the cat cassette to the up and downstream sequences of
outD (le/outD-F and Cm2/outD-R) or peh (le/peh-F and Cm2/peh-R). The primer
pairs outD-F/outD-R or peh-F/peh-R were used to confirm the insertion of the cat

cassette.

79

TABLE 4. Bacterial strains, plasmids and primers

 

 

Strains, plasmids Source or
and primers reference
Erwinia
amylovora
Eal 10 Wild type, isolated from apple
Ea1189 Wild type, isolated from apple (3 8)
8B] As Ea1189 but also outD::Cmr This study
SB2 As Ea1189 but also peh::Cmr This study
Escherichia coli
DHlOB F mcrA A(mrr-hstMS-mchC) <I>801acZAM15 Invitrogen
AlacX74 recAl endAl araA139 A(ara, leu)7697 galU
galK 7t - rpsL (Str') nqu
TGl Stratagene
Plasrrrids
pBluescriptII(+) Ap’, cloning vector Invitrogen
pGEMT-easy Ap’, PCR cloning vector Promega
pQE60 Ap’, Qiagen
pBBRl ~MCS2 Km', cloning vector derived from pBBRlMCS (131)
pKD46 Ap’, PBAD gam bet exo pSClOl oriTS
pKD3 Ap’, FRT cat FRT PSI PS2 oriR6K rng
pGCMO GrnR cassette with downstream transcriptional terminator (266)
and gusA with upstream translational stop codons in
pGem32f+
pZYF2 570bp region of dspEF promoter in SmaI site of pGCMO, (266)
in opposite orientation relative to uidA
pZYF 8 570bp region of dspEF promoter in SmaI site of pGCMO, (266)
in correct orientation relative to uidA
pSEB28 863bp region of outD“ promoter cloned upstream of uidA This study
in pGCMO
pSEB29 546bp region of peh promoter cloned upstream of uidA in This study
pGCMO
pSEB30 477bp region of IS] 133 promoter cloned upstream of uidA This study
in pGCMO
pSEB3l 1248bp NcoI/ BglII fragment of peh ORF in pQE60 This study
pSEB36 1251bp SacII/XhoI peh ORF in pBBRl-MCS2 This study
pSEB37 193 8bp SacII/Xhol outD ORF in pBBRl-MCSZ This study
Primers
OutDmut-F ATGAAGAAGAGATCCCCCCAATCCGCTACCAGCATCCGGCGGCT
GTTACC GCGA TT GT GT A GGCT GGA GCT
OutDmut-R TTACGCT’I'ITIT CCGGTAGAAATCAGCGATGTGCTT CT GTATTTC
CACCA CCA T GGT CCA TA T GAA TA T CCT CC
Pehmut-F ATGACTATTCTAACCAATTGTITATTAAGGTTT'ITATACCTCGGA
ATATC GCGA TT GT GT A GGCT GGA GCT
Pehmut-R TTAC'ITATCGAT'I‘TGAACGTTGTTAACGTTATAT'I'I‘TGTCGCAGG
ATCAA CCA T GGT CCA TA T GAA TA TCCT CC
outD-F CAACGGATCATCATTCGTCACC
outD-R GCACGTI'ATGCTGTTGTACC
peh-F GCCCCCTGTTAAACCCGTACTCAATAAC

80

 

 

 

 

 

TABLE 4 @on’t)

 

 

Strains, plasmids Source or

and primers reference
peh-R CCTGGCCACGGTGATAGAAG'I‘TTTG
le TTATACGCAAGGCGACAAGG
Cm2 GATCTTCCGTCACAGGTAGG
Orflprom-F GTCT CCGGTACCTTGCGGATAATACCTACCGCAACCT G (Kpnl)
Orflprom-RZ CGCACTGCAGTTTCTTTGITCCTTATGATGTCTCCG (PstI)
Pehprom-F GTCTCCGGTACCCCGCCATTGGCCGTCTTITAATCGCCG (KpnI)
Pehprom-R2 CGCACT GCAGTTGAGATCCT CT GTGTAACT GG (PstI)
dspEF-F TCCCCCGGGCAGTGAGGGGGGGCAGACTTTITI'ITAACC (SmaI)
dspEF-R TCCCCCGGGTATCI'TCGCCGCTGCCACCT'ITCACCATTG (SmaI)
ISl l33-F CCGGTACCCGTCGCGTGA'ITGGCTGG (Kpnl)
Aj 1655 CGCACT GCAGGAAGCGCGGAGGTGGCT C (PstI)
PehpQE-F CATGCCATGGATGACTATTCTAACCAA’ITGT'ITATTAAGG (NcoI)
PehpQE-R GAAGATCTCTTATCGATI'TGAACGITGTTAACG (BglII)
PehMCSZ-F ACT GATCCGCGGATGACTA'ITCT AACCAATTGTITATTAAGG

(SacII)

PehMCSZ-R TCTCGAGTTACI'I‘ATCGA'I'ITGAACG’ITGTTAACG (XhoI)
OutDMCSZ-F ACTGATCCGCGGATGAAGAAGAGATCCCCCCAATCCGCTACC

(SacII)
OutDMCSZ-R TCTCG_1_A§TTACGCTI‘TI'ITCCGGTAGAAATCAGCGATGTGC (XhoI)

 

 

Creation of uidA reporter strains. Fusions of the putative type H out operon promoter,
peh promoter and dspEF promoter to the uidA gene were constructed using pGCMO. The
PCR primer pairs Orflprom-F/Orfl prom-R, Pehprom-F/ Pehprom-R and 181133-
F/ajl655 were used to amplify the upstream sequence fi'om the type II operon, peh and
IS1133 respectively. Purified upstream sequences were inserted into the KpnI and PstI
sites in pGCMO and ligated overnight at 14°C overnight using T4 ligase fiom Invitrogen
(Carlsbad, CA). Promoter constructs were transformed into chemically competent E. coli
DHlOB, for screening using PCR and restriction enzyme analysis. Confirmed
orflpzszCMO, pehp::pGCMO and IS1133p::pGCMO were named pSEB28, pSEB29 and

pSEB30, respectively. Positive colonies were stored in LB plus 10% glycerol at -80°C,

81

and the respective promoter fusion constructs were transformed into electrocompetent
Ea1189.

Fluorometric assays with promoter fusion constructs. The activity of the promoters
fused in front of the uidA gene was measured using the fluorescent substrate 4-
methylumbelliferyl-B-D-glucuronide (MUG) as was done for the E. amylovora IVET
screen (266). The promoter fusion constructs pSEB28, 29 and 30 and pZYF2 and 8 were
grown in l><M9 minimal salts media as described above. A total of six sugars were used
as carbon sources: fi'uctose, galactose, glucose, sorbitol, sucrose and pectin. LB medium
was used as a non-induced control. In addition, the activity of the promoter fusion
constructs was measured in planta during infection of apple cultivar ‘Gala’. For all
MUG assays, E. amylovora Ea1189 harboring the promoter fusions were grown
overnight in liquid LB medium. The bacteria were then harvested by centrifuging at
5,000 X g and washing with 0.5XPBS twice. After the second wash, the bacteria were
either added to 1><M9 minimal media at 1/ 100 (v/v) or used to inoculate young leaves at
full strength. Samples were taken from liquid media/inoculated leaves at 24, 48 and 72
hours post-inoculation (h.p.i). The zero time point used was the bacteria suspended in
0.5)< PBS. For all time points, 1.5 ml bacteria or a disrupted leaf disk were centrifuged at
13,000 rpm and the pellet resuspended in 0.5 ml GUS assay buffer. All solutions were
kept on ice and centrifuge steps were at 4°C. Resuspended bacteria were then sonicated
on ice using a microtip at 30% power (Branson Sonifier 250a, Branson Inc., Danbuy, CT)
for 15 seconds followed by 20 seconds rest three times. The homogenate was added to
GUS reaction buffer amended with lOmM MUG at a ratio of 1:4 and the reaction was

allowed to proceed for 30 minutes at 37°C after which it was stopped with the addition of

82

4 volumes of Na2C03. Fluorescence of the completed reactions were read in a SAP IRE
fluorometer (TECAN Boston, Medford, MA). Bacterial counts were estimated by
dilution plating and promoter activity was reported as mo] of 4-methy1umbelliferone

(MU) produced per min after normalizing to 109 CFU.

Complementation of deletion mutants. Construction of complementation plasmids,
pSEB36 and pSEB37 (see Table 4) used the pBBRlMCS-2 cloning vector (131). The
full length ORF for outDEA and peh were amplified using PCR from the Eal 189 genome
using the primer pairs, OutDMCS2-F/OutDMCS2-R and PehMCS2—F/PehMCSZ-R,
respectively. The 1938 bp outD ORF, 1251 bp peh ORF and were inserted into the SacII
and XhoI sites of pBBRlMCS-2. Confirmed outDEAzzpBBRlMCS-Z and
peh::pBBR1MCS-2 were named pSEB37 and pSEB36 and transformed into
electrocompetent outD mutant SBl and peh mutant SB2, respectively. SB1(pSEB37)

and SB2(pSEB36) were stored in LB freezing medium at -80 C.

Infection Assays. Wild type Ea1189, the outD mutant SBl and peh mutant SB2 plus
complemented mutants, SB1(pSEB37) and SB2(pSEB36) were used in infection assays
to determine contributions of the T2SS and polygalacturonase to E. amylovora virulence.
The initial infection assays were performed using apple cultivar Pacific Gala trees
incubated under controlled relative humidity (99%) and temperature (25°C). E.
amylovora cultures used for infection were grown overnight on solid LB medium at 28°C
and resuspended in 0.5x PBS, and diluted to an ODsoo of 0.8 in 0.5X PBS and then

serially diluted (1:10) three times. This suspension (~5><106 CFU/ml) was then used to

83

dip sterile scissors into and cut either across the midrib or roughly 1 cm into interveinal
tissue of the second emerged leaf.

Pear infection assays used immature pear (Pyrus communis L. cv. ‘Bartlett’)
according to previous studies for the analysis of E. amylovora mutants (26, 155, 267).
Immature pears of similar size were sterilized in 10% bleach solution for 15 minutes and
washed three times with sterile dHZO. After drying in a sterile flow hood, the pears were
pricked with a sterile 30 1/2-gauge needle and 3 ul of ~5><105 CFU/ml E. amylovora was
pipetted onto the wound. Infected pears were kept on sterile wet paper towels in sealed
containers in a 28°C incubation chamber.

For statistical analysis of aggressiveness of the E. amylovora outD mutant SBl,
peh mutant SB2 and wild type Ea1189 the method of Cabrefiga and Montesinos was used
(40). E. amylovora cultures used for inoculation were grown overnight in liquid LB
medium supplemented with the appropriate antibiotics. Cultures were then spun down at
5000 x g and washed with 0.5x PBS twice and diluted to an 013600 of 0.8 (~5x109
CFU/ml). Cultures were then serially diluted 1/ 10 in 0.5>< PBS to obtain cultures that
were logro 7.5, 6.5, 5.5, 4.5, 3.5, 2.5 and 1.5. Six immature pears were inoculated 4 times
opposite of each other for each concentration by pipetting 1011.1 of the bacterial dilution
on each wounding site. The presence or absence of necrosis and/or ooze was recorded
for each inoculation site every day following inoculation at approximately the same time
as inoculations. These experiments were repeated three times. For the calculation of the
median effective dose, the hyperbolic equation as described by Cabrefiga and Montesinos

(40) was applied:

y=ymax(x/(X+Kx)) (1)

84

where y is the incidence of infections, ymx is the maximum of infection incidence, x is

the concentration of the culture and K, is the median effective dose (EDso). For the

cultures used, the EDso was solved for using data collected on day 3 of infection.
Aggressiveness of the E. amylovora cultures was determined using a modified Gompertz

equation (40):
y = K — exp(-Bg° exr)[-rg(t - to)]) (2)
where K is the curve asymptote signifying the maximum incidence of disease, 38,

accounts for the origin of the curve, and to is days of delay until symptoms are observed.

For the calculation of aggressiveness, data from all days post inoculation were used for
the culture diluted to 5><103 CFU/ml. The statistical program IMP version 6.0 (SAS
Institue, Inc., Cary, NC) was used to fit the data collected to the hyperbolic and modified

Gompertz equations.

Protein expression of Peh. Protein expression constructs were built to express Peh with
a carboxyl-terminal 6x histidine tag. The primer set PehpQE-F/ PehpQE-R was used to
PCR amplify a 1251 bp fragment of peh, which is missing the stop codon. The peh
fragment was inserted into the NcoI and BglII sites of pQE6O and transformed into E. coli
TGl for screening using PCR amplification and restriction enzyme digestion. Confirmed
peh::pQE6O constructs were named pSEB3l and transformed into Ea1189, both
TGl(pSEB31) and Eal 189(pSEB31) were stored in LB freezing medium and stored at
-80°C.

A fast mini-preparation of protein fractions was prepared according to (52) and

used for subsequent Western blots. Eall89(pSEB31) and TG1(pSEB3l) overnight

85

cultures were diluted 1:5 into fresh LB medium supplemented with 50 jig/ml carbenicillin
and allowed to recover for one hour, after which IPTG was added to a final concentration
of 1mM. Cells were harvested 48 hours post-induction, and centrifuged at 13,000 rpm to
separate the supernatant from cells. The pellet was used for a fast fractionation protocol

(52) and separated into periplasmic and cytoplasmic/membrane fractions.

Purification of E. amylovora Supernatant Protein. For the visualization of E.
amylovora secreted proteins and the ruthenium red staining assay, supernatant was
harvested fiom cultures grown on solid l><M9 minimal medium supplemented with 2%
(w/v) galactose (81). Cultures were allowed to grow on solid medium for 36 hours at
28°C, after which the cells were resuspended in 0.5x PBS treated with a mini Complete
protease inhibitor cocktail (Roche Applied Science, Indianapolis, IN). These suspensions
were centrifuged twice in a 4°C centrifuge at 13,000 rpm for 15 minutes. After the
second centrifugation step, the supernatant was concentrated in a lOkDa cutoff Centricon
(YM-lO) concentrator according to manufacturers recommendations (Millipore, Billerica,

MA).

Ruthenium red staining for polygalacturonase activity. Ruthenium red staining was a
modified method of the ultra-thin pectate—agaroase gel overlay method (206). Here,
either crude lysate fi‘om E. coli TG1(pSEB3l) or E. amylovora Eall89(pSEB3l) or
supernatant fi'om E. amylovora Ea1189, SBl, SB2 or Eal 189(pSEB31) was used for the
assay. Crude lysate was harvested from LB grown cultures, and supernatant was

harvested from strains as described above. A pectate-agarose gel (50mM potassium

86

acetate, pH5.5; 1% (w/v) agarose and 0.1% (w/v) polygalacturonic acid) was used for
ruthenium red staining of polygalacturonase activity. Six ml of molten pectate-agarose
gel was poured in a 80mm diameter culture plate. To this, 2011.1 of crude lysate or
supernatant was added and the plate was incubated at 28°C for two hours. After
incubation, the lysate or supernatant was washed off of the plate, and a 0.05% (w/v)
solution of ruthenium red was applied to the pectate-agarose plate for 30 minutes at room
temperature. Visualization of the zones of activity was by repeated washing of the
pectate-agarose plate with dH20, and then air-drying of the plate. Results were recorded

using a photo scanner.

Detection of His-tagged Proteins. Detection of His-tagged proteins the SuperSignal®
West HisProbeTM Kit (Pierce Biotechnology, Inc., Rockford, IL) according to the
manufacturer’s protocol, except that the ratio of HisProbeTM-HRP to tris buffered saline
Tween®-20 (TBST) was increased from 1:5,000 to 1:1,000. A 6><His protein ladder

(Qiagen Inc., Valencia, CA) was used for molecular mass estimation.

87

RESULTS

Sequence and genetic analysis of type II operon and endo-polygalacturonase

Both the pseudopilin, out], and endopolygalactuonase, peh, were identified
previously as being upregulated during colonization and infection of immature pear tissue
(266). To obtain the full length sequence of out! and peh, thermal asymmetric interlaced
(TAIL)-PCR was used to sequence upstream and downstream of the original IVET clone
(data not shown). Upon sequencing outIJK and 1.4kb of peh, the E. amylovora sequence
was queried to identify the entire outga operon and full length peh sequence
(http://www.sanger.ac.uk/Projects/E_amylovora/).

Overall, the outEa operon (Figure 4) follows the general gene organization of the
yts] operon from Y. enterocolitica (112). The out operon lacks an 011] homologue, and
instead starts with an 0212 homologue; in addition, no discemable gspM homologue could
be identified in between outL and outO using either BLASTp, tBLASTx or tBLASTn (7).
The lack of an identifiable gspM homologue in the T2S operon is similar to the T28
operon from Yersinia pestis, the causative agent of bubonic plague that, much like E.
amylovora, is not known for any T2S secreted exoproteins (220). E. amylovora does
posses the T2S lipoprotein OutS, which is commonly only observed from the T28 operon

from Enterobacteriaceae (219).

88

 

orf1 C D E F GHIJK L MOSChiY

 

oerCD E FGHIJKL OSchiY

Figure 4: Alignment of type II secretion systems from Y. enterocolitica (ytsI) and E.
amylovora (outga).

Using putative translated sequences, the highest amino acid identity is 76 % between
OutG and PulG of Yersinia mollaretti (see Table 5), followed by 62% between OutE and
Ytle fi'om Y. enterocolitica, and 58% for both OutF and PulF and OutI and YtslI.

Yersinia molaretii is a recently sequenced member of the Yersinia genus that is thought
to be non-pathogenic. Typically, the percentage of identity for genes E, F and G are the
highest in the T2S operon, and that appears to be the case with respect to the amino acid
sequences (220).

The core T28 operon (outC~outS) is 10.6 kb, with an 83-bp gap between the
predicted stop codon of orjM and the start codon of outO and a 118 bp gap between auto
and outS (see Table 6). Similar to Y. enterocolitica, outS is transcribed in the reverse
orientation with respect to the remaider of the T28 operon, from its own promoter. It is
of interest that Ori2 has homology to a DNA-binding protein, possibly a transcription
factor that could co-ordinate the transcription of outS along with the rest of the operon.

Since the far 5’ and 3’ regions of the T2S operons are where rearrangement of gene order

89

often occurs, this may explain the lack of an identifiable gspM homologue. In addition,
the only gene that is not homologous to a Yersinia species is outS which is homologous to
outS from Pectobacterium atrosepticum.

Searches (using Blastp and Blastx) for other potential TZSS operons in E.
amylovora returned two putative T2SS proteins, the first of which is a GspD homologue
that is homologous to a putative T2SS GspD protein from P. atrosepticum (E = 4e-112,
57% identities, 75% similarities) and Hon from Yersinia intermedia (E =le-105, 55%
identities, 73% similarities). The promoter sequence of this GspD homologue was found
to be active under low temperature conditions (18°C) by Goyer and Ullrich (92).
Theoretical open reading frames inferred by ORF finder (NCBI) for sequence upstream
and downstream of this protein were identified using Blastp as being a shikimate kinase
upstream and a hypothetical protein downstream. Even though this protein is a GspD
homologue, it only shares 22% amino acid identities with OutD.

Other putative type II secretion genes found in the genome of E. amylovora were
found downstream of the chiY gene. This included a GspF homologue, most similar to
PulF fiom Y. mollaretti (E = 8e-97, 46% identities). The other two genes directly
downstream and thought to be transcribed off of a common promoter sequence with the
pulF homologue are two type IV pilin genes, pilB and pilA. This may indicate that the
pulF homologue may indeed be a part of the type IV pilus genes and not a putative type
II secretion gene, since the both T2SS and type IV pili are structurally related (23 8).

The full length ORF of peh is 1251 bp, with a putative translated amino acid
sequence of 416 anrino acids. Using this putative translated sequence, homology to an

endopolygalaturonase pehA from Pectobacterium atrosepticum (E = 7e-117; 59%

90

TABLE 5. Protein homology of E. amylovora out operon.

 

 

Gene“ BLASTp_BestHitb Organism Identity/Similarityc Reference
or]? Hypothetical protein Y. enterocolitica 56/74 (112)
outC Ytle Y. enterocolitica 32/53 (112)
outD Ytle Y. enterocolitica 58/74 (112)
outE Ytle Y. enterocolitica 62/76 (112)
outF PulF Y. mollaretti 58/74 NRd
outG PulG Y. mollaretti 76/87 NR
outH PulG Y. mollaretti 35/55 NR
out] YtslI Y. enterocolitica 58/77 (112)
out] Yle Y. enterocolitica 41/58 (112)
outK PulK Y. mollaretti 31/48 NR
outL Ytle Y. enterocolitica 28/41 (112)
071M Unknown

outO PulO Y. mollaretti 56/69 NR
outS OutSpa P. atrosepticum 35/51 (17)

 

a Gene designation in E. amylovora T2S operon

b BLASTp used to search for similar proteins based on putative translated gene
sequence

6 Identity is without amino acid substitutions and similarity allows for conservative
amino acid substitutions in the BLASTp search

d No reference (NR) available

identities and 74% similarities) and peh-1 from Pectobacterium carotovorum (E = 2e-
116, 60% identities and 74% similarities) was determined querying the Genbank database
with Blastp (17, 141). Unlike peh-1, peh does not have a pectate lyase upstream of its
ORF, nor does it share any similar promoter motifs, such as a Kng box, as determined
by CREDO analysis which searches for shared motifs between promoter sequences
(http://mips.gs£de/cgi-bin/proj/regulomips/submission.cgi). The predicted amino acid
sequence has three protein motifs predicted by InterProScan (http://www.ebi.ac.uk/cgi-
bin/iprscan); the first is from the family 28 glycoside hydrolases, which includes

polygalacturonases; other predicted motifs are a polygalatucturonase motif and a pectin

lyase fold motif. In addition a signal peptide at the N-terminus of the protein was also

91

predicted based on the amount of hydrophobic residues present. In contrast, SignalP 3.0
(http://www.cbs.dtu.dk/services/Signa1P/), which is used to identify type signal peptides,
predicts a 40% chance that the N-terminus possesses a functional signal peptide (71).
According to two predictive programs used in SignalP: hidden Markov models and neural
networks, Peh is considered non-secretory. When a plot of hydrophilicity is made for the
entire Peh amino acid sequence, there are two main areas of hydrOphobicity in the first 40
arrrino acids of Peh, corresponding with the two putative sites for signal peptide cleavage
by SignalP 3.0. The first is between residues 22 and 23, the second is between residues
39 and 40. When a ClustalW alignment (Fig. l) is made between Peh, PehA and Peh-1,
the first residue of the mature endo-polygalacturonase protein is conserved amongst all
three sequences (Fig. 2), thus if E. amylovora Peh is recognized by the sec transport
system, it is likely that the site of signal peptide cleavage is between residues 39 and 40.
When the 39 amino acids are subtracted from the predicted amino acid sequence, the
molecular mass of the mature Peh protein is 40.1kDa, although if the secondary predicted
site is cut at residue 22, then the alternate mature Peh protein would have a molecular
mass of 41.7 kDa. When the preliminary genome sequence of E. amylovora was
searched for other polygalacturonases or pectin lyases, no other pectin degradation
enzymes were found. The only other potential T2S secreted cell wall degradation

enzyme is a cellulase that was observed by Riekki et al. (207).

Creation of deletion mutants of outD and peh in E. amylovora

In order to determine the contribution of T28 and the enzyme Peh to E.

amylovora virulence, two deletion mutants were constructed. The outD gene from the

92

T2S operon was selected for deletion, because it is the outer membrane pore-forming
protein, and in other systems, mutations of the gspD gene render the T2S secreton non-
firnctional (98). First, single deletion mutants of outD and peh were constructed using the
Red recombinase system (56) that allows for the use of linear targets for recombination
into the genome. The areas of homology used for recombination were 50bp at the start

and the end of outD and peh ORFs.

Apple cultivar ‘Gala ’ shoot infection assay

Infection assays with the deletion mutants and complemented mutant strains were
conducted in two different tissue types. Because of the expression of the T2S and the
polygalacturonase in the IVET system described before, the potential for a phenotype in
actively growing apple shoots exist. Young Gala apple trees kept in a controlled
environment chamber were used for the shoot inoculations. The youngest unfolded leaf
from actively growing shoots was inoculated across the midvein for all strains tested.
Overall, the mutants appeared to behave like wild type when inoculated directly into the
midvein (data not shown). There was a slight delay of symptoms with the peh mutant,
SB2, but it was still able to form disease symptoms over 10 days. Since inoculating the
mutants directly into the rrridvein appeared to have no effect, inoculations into the
interveinal areas of leaf tissue were also conducted. This was to determine if the
presence of a T2S operon and peh gene is for movement through leaf tissue. There were
some differences noted with this method of inoculation, indicating the potential for the

polygalacturonase to be used as a mechanism for movement through intercellular regions.

93

Immature pear tissue infection assay

In some cases, the phenotype observed from inoculations with mutants is different
in shoot tissue than in immature pear tissue. So to better ascertain the impact of the peh
deletion mutation in E. amylovora, strains Ea1189, SB1, SB2 and complemented outD
mutant, SBl(pSEB37) and complemented peh mutant SB2(pSEB36) were used to
inoculate immature pears from cultivar ‘Bartlett’ (Figure 5). The degree of necrosis
around the infection site for SB2 is less at day 4 (Figure 5B) and 6 (Figure 5C) than either
wild type or SBl. When the mean area of necrotic tissue is calculated at day 8 (Figure
5D) post inoculation from an independent inoculation assay the area was 3.3 d: 0.1 cm2
for SB2 and 3.4 dc 0.2 cm2 for complemented SB2(pSEB36); these areas were slightly
lower than those from E31189 or the outD mutant. The areas were 3.6 :1: 0.3 cm2 for
Ea1189, 3.4 :1: 0.2 cm2 for SBl and 3.9 :1: 0.4 cm2 for complemented SBl(pSEB37).
Strain SBl phenotypically looks like Ea1189, and combined with the apple shoot
inoculation data, type H secretion may not be used in virulence of E. amylovora on apple
shoots or immature pear tissue. Even though virulence appears not to be compromised
with the outD mutant, the complemented outD mutant does have a slightly higher area of
necrosis than Ea1189, so there may be some contribution of the type II secretion system
that can enhance disease when over expressed. Since there was a difference in necrosis
caused by Ea1189 versus peh mutant SB2, the Peh protein may not be secreted through

the type II apparatus during infection and may be released in another manner.

94

L)

    

00

Figure 5: Areas of necrosis on inoculated immature pears. (A) 2 days post inoculation;
(left to right) SB2, SBl and Ea1189. (B) 4 days post inoculation; (left to right) SB2, SBl
and Ea1189. (C) 6 days post inoculation; (lefi to right) SB2, SBl and Ea1189. (D) 8 days
post inoculation; (lefi to right) SB2, SB1, Ea1189, SB2(pSEB36), and SBl(pSEB37).

Aggressiveness of E. amylovora mutants

To better quantify the effects of the deletion of either outD or peh on infectivity, a
measure of aggressiveness was calculated for both mutants and Ea1189 using the method
of Cabrefiga and Montesios (40). Overall, the median effective dose (ED50) calculated
for the peh mutant SB2 (6.7 ><103 CFU/ml) was more than twice the calculated EDso for
E31189 (2.6 X103 CFU/ml). Data used for calculating the ED50 was collected at day 3,
due to the highly virulent nature of Ea1189, where the incidence of infection was 100%
for most concentrations at day 5. In addition, the incubation temperature used for
development of symptoms was 28°C versus 21°C that was used in the previous study by
Cabrefiga and Montesinos (40). For the kinetics of infection, the incidence of infection
was calculated for days 1 through 10 at an inoculum level of 5 X102 CFU/ml. Overall,

the peh deletion mutant, SB2 exhibited a lower rate of infection (rg = 0.75), curve

95

asymptote (K = 0.82) and a higher delay to disease symptoms (to = 5.16) than the other
strains used. The outD mutant, SBl had similar values (rg = 1.12, K = 0.98, to = 3.19) as

wild type Ea1189 (rg = 1.8, K = 0.95, to = 2.66). This statistical method for determination

of aggressiveness is useful for showing small, but significant differences between

mutants and their parental strain.

F luorometric GUS assay with promoter-uidA fusion contructs

The method used to determine the activity of the T28 operon promoter and peh
promoter was a fluorometric GUS assay. In order to clone the putative full length
promoters for both genes, the sequence between the last predicted ORF and the start
codon of both oer and peh were cloned. Liquid minimal media that is known to induce
type III secretion in E. amylovora was used to screen both promoters for activity. Six
different sugars were used to supplement this minimal media to determine if the in vitro
conditions for activating the expression of the TTSS are the same for the activation of
expression of the TZSS and peh.

Overall fold induction of the T2S operon promoter was the highest at 306.6-fold
in minimal medium amended with glucose (MM-glc) at 48 hours post induction (hpi;
Table 6). The effector protein, DspE, appears to have a high level of promoter induction
in MM-glc at all three time points collected (279.3 to 361.3—fold). The effect of glucose
on the constitutive promoter from the ISII33 insertion element was not different than
that of LB medium. Induction of the peh promoter was also highest with MM-glc,
however peak induction of 746.9-fold did not occur until 72 hpi. Ifmature Peh protein is

secreted through the T2S, than the delay of peh promoter activity may delay protein

96

82025588.: 8:: .«o magma—co 8.8888 30:20:33 95 no: US$228 coho cum—8288 85 28 8.8852282 E 882822

V

newest—2 .82 852— o 8.5 20.5265 .82 825: Nb 8 we .3 8 85.83— c

.58an mum“: 05 85an mg: .85 m2 EH .5520 22:35 58.: 222282
05 8528: cmmmma .38an 28a 2: 8.82.8: mmmmma .58an we. 05 85232 mammmm don: 325828 20.3 583358an 05 S 8282 25828—
2528 BEBE not a 88 com: 883 m4 8:538 goon 06 E @8865 magma xv. 2: .«o 52:0 5.5 8228822228 2562: 28:25.: 22 a

 

a

 

8.8: 8.3. 2 .8: 8.8. 8.88: 8.888. 2%: 8.3 8.88: 8.288 2.8: 8.888 8.8: 8.88. 8%?
2.88: 8.8. 8.8: 8.88 8.888: 8.8882 8.88: 2.8 8.3: «.888 8.88: 8.8% A .2: 8.82 828.8
8.8888 8.2:882 8858.88 88:88: 8.88: 8.88 88.88.88 82:32 82:8
85%.

88:8 88:8,? 8.38.88 2:32 8.: 8.8 88:88 8.: 8.: 8:8?
2.8: 8.8 8.8: 8.8 8.8: 8.8 8.8: 4.2 8.: 8.8 8.2: 8.8N 8.: 8.2 8.28.8
8.: 3 8.88.: 8.98.8 2.38.: 8.: 8.8 8.38.8 28:8 8:38
88228..

88:38 8.58.82 82:88. 2.83 8.88: 8.8: 83:38 8.88: 8.8%” 828?
2.: 8.8~ 8.2: 8.2 8.8: 8.88 8.8: 4.8 8.9.: :8 8.88: 8.va 82 2 : 8.82 828:.
8.: 8.8 2.: 8.8 8.: 2: 2.8: 8.8 8.8: 2.8 8.8: :8 2:: 8.8 8:38
8828..

2.: 8.8 8.88.8 88:28 858.: 88:88. 8.58.84 88:8: 823.
8.8 8.8 8.38.: 8.2.3888 28:32 8.288.888 8.38.: 88:5 828?
8.8: S. 8:88 8:88 8.98.8 8888.3. 8.3.8 2.8.8: 8.2 825:8
8828..

m4 owobsm Sachem 228m @8820 6888—80 08902.5 828885

 

88322: 8:25.: E 292285 885.5828 208:: YEPBBEQE mo 2283.5 Eon .c mammal

97

production until after a functional secreton is assembled. Even though the highest level
of induction for the peh promoter is in MM-glc, its activity relative to the activity of the
dspE and T2S promoters is weaker.

Second highest induction of both the T2S operon and peh promoter was in
minimal medium amended with galactose (MM-gal). The use of the simple sugar
galactose is common in TTSS-inducing minimal media, and also is known to increase the
amount of exopolysaccharide (amylovoran) produced. Although MM-gal is the second
best condition met for T2S promoter induction, the preference for glucose is apparent by
the fold induction for each sugar, 306.6-fold with glucose, compared to 77.8-fold for
galactose at 48 hpi (Table 6). This is in contrast with the dspE promoter, which is highly
induced in MM-gal starting at 24 hpi with 923.3—fold induction and tapers off to 300.7-
fold induction at 72 hpi.

Surprisingly, the peh promoter was not induced by minimal media amended with
pectin (MM-pee (Table 6). Upon examination of the levels of induction for the other
promoters used in the GUS activity assays, it further appears that the peh promoter may
be inhibited by the presence of pectin in the medium. Although the main sugar present in
apple shoots and immature pear fruit is sorbitol, only the dspE promoter was highly
induced (up to 1545.6-fold at 24 hpi; Table 6) in minimal medium amended with sorbitol
(MM-sor). In addition, the insertion element ISII33 promoter is also expressed at its
highest levels (68.5-fold) in MM-sor. Both the T28 promoter and peh promoter had
relatively low levels of induction; 38.6 and 34.6 hpi respectively in MM-sor, highlighting
the differing sugar requirements for the induction of TTSS-related promoters and T2S-

related promoters.

98

Actively growing apple shoots (cultivar ‘Gala’) were also used for fluorometric
GUS assays to look at levels of promoter activity in viva. Young leaves from Gala were
inoculated across the midrib, and tissue was harvested at similar time points as with the
minimal medium experiment. As seen with the liquid minimal media GUS assays, the
dspE promoter is highly induced compared to both the T28 and peh promoter (Table 7).
However, even though both the T2S and peh promoters were only minimally induced
when grown in MM-sor and repressed in the case of the peh promoter with MM-pec, both
promoters were also highly induced upon infection. In addition, when the level of
induction of the T2S and peh promoters were compared for MM-glc, the peh promoter
was noted to lag behind the T2S promoter by 24 hours. This is not the case for promoter
induction during infection of apple tissue. At 24 and 48 hpi, the peh promoter is more
highly induced and activity of the promoter is higher than that of the T28 promoter.
Even the moderate promoter fi'om insertion element ISII33 was induced to high levels

during infection.

Expression of Peh in E. coli and E. amylovora

To determine whether or not the peh gene identified fi'om E. amylovora encodes a
fiinctional polygalacturonase, an expression vector was used to express peh (pSEB31,
Table 4) in E. coli and activity of the peh gene product was determined by ruthenium red
staining. of pectin amended agarose. Expression of pSEB31 in the E. coli TGl
background stained for the breakdown of polygalacturonic acid, indicating

polygalacturonase activity (Fig. 6A). In order to determine that the activity was due to

99

a: 8 88 8.388 825 a: 88 85 88. .88 .8 88,888 88 8.82.8.8 288 8

73:0 80— 758 282682 .botzonfifizfiofié 8o 88 23.8%: 8_ 53:88 mDO a

9&5 2288—285 883 828: e

 

 

 

8888:8888 2.28.: 8.28 8.858888 8.: 8.8 8.8: 8.888 8.828588 8&8
8.888: 8.882 8-88.:2888 2828:8882 22.88.82.888 88: 8.88 8-28:3: 882288
8.88.: 8.8888 2888:8288 2888:8882 8-8.5722 8.3:888 8-88.8823 8828288
2288: 8.8882 8288:7888 8.88: 8.888 828.882-8288 8.8: 2.8.. 8888:8228 882288
238265 85 228265 2288285
8... 88588 8 88383.. 820
28,8 . . <82: 282 . . < 8:: 28,8 8 8.88885
88 88 288 8.. 8288 88

 

.3880. 83:3 298 :0 2288.822 22.: 8820an no 228268: Son .8 mimic?

100

the processed mature Peh protein, pSEBBl was also expressed in the E. amylovora

Ea1189 background, which gave the same result (Figure 6B). Attempts at observing a
polygalacturonase phenotype fi'om the supernatant of wild type Ea1189, outD mutant
SBl or peh mutant SB2 after induction in MM-gal medium were inconclusive (data not
shown). However, E31189 harboring pSEB31 did have detectable polygalacturonase
activity in the supernatant collected (Figure 6C). Although the peh gene product does
appear to be a polygalacturonase that is present in the supernatant of Ea1189, its wild

type expression in liquid media is below the detection limit of ruthenium red staining.

Detection of expressed Peh protein in E. amylovora

In addition to determining that Peh exhibits polygalacturonase activity, the rough
sub-cellular location of Peh expressed from plasmid pSEB3l was also investigated. The
vector used to create plasmid pSEB3l (Table 4) adds a 6Xhis tag to the C-terminus of the
expressed protein. This 6Xhis tag was used to detect Peh using a modified Western blot
technique. Peh was detected in the whole cell lyasate, the periplasmic fraction and the
cytoplasmic/ membrane fraction. A single protein band was detected in the periplasmic
fraction, whereas the whole cell and cytoplasmic/ membrane fraction showed multiple
detected bands.

In addition to detecting Peh protein from Eal 189(pSEB31), an attempt was made
to detect endogenous Peh protein. Supematant from Ea1189(pKD46), ZY3, SB] and
SBZ was loaded on a 12% SDS-polyacrylamide gel. One prominent band in Ea1189
(control), outD mutant $31 and type HI operon knock out mutant ZY3 is not present in

the peh mutant SB2. Because the band is located at 40.1kDa, it is very likely that this is

101

Figure 6: Ruthenium red stain for polygalacturonase activity. Photos were inverted from
original tones, so clearing of the stain appears dark in the figure. (A) Whole cell lysate
from E. coli TGl (pSEB31) induced with IPTG. (B) Whole cell lysate of E. amylovora
Eall89(pSEB31) grown in LB. (C) Supematent from E. amylovora Ea1189 (pSEB3l)
grown in M9 minimal media.

L12345

.8. 9".

Figure 7: Western blot of Eal 189(pSEB31) subcellular fractions. Eal 189(pSEB31) was
inoculated in LB medium for induction of the expression plasmid. A his-labeled ladder
(L) was used as the molecular weight standard, SOkDa marker (*) is shown. Whole cell
(lane 1), periplasmic (lanes 2 and 5) and cytoplasmic/membrane-bound (CM) fractions
were extracted and loaded on a 10% SDS-polyacrylamide gel. Lanes 4 and 5 are as lanes
2 and 3, except twice as much protein was loaded.

 

102

the Peh protein. Qualitatively, Peh appears to be present in nearly equal amounts in the
supernatant of Ea1189, SBl and ZY 3; making it more likely that Peh is inefficiently
secreted by the type H secreton, and released by rupturing cells to the extracellular
milieu. Interestingly, the secretion of DspE appears to be hampered in the peh mutant,
SB2. When SOOng of supernatant protein is loaded (Fig. 8A), a faint band corresponding
to DspE is observed, however at a significantly lower level than that of Ea1189 and the
outD mutant, SBl. When lug of supernatant protein was loaded, the DspE protein is
visible as a distinct band (Figure 8B). Another feature of the supernatant of SB2 is that it
appears to lack the characteristic smear of LPS at the lower portion of the gel. This was
observed at both levels of supernatant loaded. It was further noted after the creation of
the peh mutant, that $32 colonies appeared more mucoid than wild type or the outD

mutant.

103

 

 

 

 

AL1234 B

 

Figure 8: Supernatant proteins separated out on SDS-polyacrylamide gel. (A) 500 ng of
supernatant protein loaded on 12% SDS-polyacrylamide gel. Molecular weight standard
(L); Ea1189 (lanel), outD mutant SBl (lane 2), peh mutant SBZ (lane 3), type III operon
knock out mutant ZY 3 (lane 4). (B) lug of supernatant protein from SB2 loaded on 10%
SDS-polyacrylamide gel. Band corresponding to DspE is denoted by an asterisk.

104

DISCUSSION

Pectinases and other type H secreted cell wall degrading enzymes (CWDE) are
commonly associated with the macerating phytopathogenic bacteria such as P.
atrosepticum, P. carotovorum, Erwinia chrysanthemi and Ralstonia solanacearum (243).
Even though it is characterized as a necrogen (246), E. amylovora possesses a type II
secretion system (Table 5) and a fimctional polygalacturonase (Fig. 1). Both were
identified during a previous IVET screen (267) by promoter activation upon infection and
colonization of immature pear tissue. This study sought to discover the contribution of
type II secretion and a polygalacturonase to E. amylovora virulence. This was achieved
through the creation of deletion mutants for outD and peh, and a more in-depth analysis
of T2SS and peh promoter activity and expression of the Peh protein.

The type H system from E. amylovora shows homology to type II system proteins
from Y. enterocolitica and Y. mollaretii. Y. enterocolitica is a human pathogen that is
classified into either non-pathogenic, low pathogenic or highly pathogenic strains. Y.
enterocolitica strains harbor a ubiquitous T2SS operon noted as ytsZ, that is similar to the
annotated putative TZSS operon from Y. pestis both in amino acid sequence and gene
order (112, 191). It is unkown if ytsZ operon is functional, like the E. amylovora out
operon, it lacks an identifiable GspM homologue, and instead a hypothetical protein
occupies the position between GspL and GspO. The Y. enterocolitica strains that are
considered high-pathogenicity harbor the ytsI T2SS operon, in addition to the ytsZ T2SS
operon, and other virulence related genes that contribute to the high-pathogenicity

phenotype. Interestingly, the high-pathogenicity group is more often found in North

105

 

 

 

 

America and known as a “new world” isolate (111). E. amylovora also is thought to be
indigenous to North America; the possession of a related TZSS operon could either
indicate a common predecessor with Y. enterocolitica or a potential horizontal transfer
event. Many genes upregulated in the IV ET screen of E. amylovora had homologous
counterparts in human pathogenic bacteria; therefore obtaining a T2SS fiom a common
ancestor is most likely. In addition, analysis of the upstream and downstream sequence
of the E. amylovora out operon did not reveal any potential transfer genes. The upstream
sequence did posses a PulF, PilB and PilA protein homologues, and downstream
sequence analysis exhibited a secA gene.

The only protein in the T288 operon of E. amylovora that wasn’t highly

homologous to either of the Yersinia species was OutS, which had stronger homology to

OutS from P. atrosepticum (Table 5). The position of the lipoprotein, outS in the outEa
operon is different than that of the outpa operon; it is at the end of the outga operon

between outO and chi Y, whereas in the outpa operon it is located in front of outB. The 5’

and 3’ regions of T2SS are subject to some gene rearrangement (219), and in the case of
E. amylovora, it appears to have potentially swapped the outS gene from the TZSS of the
common ancestor with outS fi'om P. atrosepticum.

Although previous studies determined that E. amylovora did not posses any
pectolytic activity (226), and thus as a result did not harbor any CWDEs, two studies
have now described the presence of CDWE genes fi'om E. amylovora using genetic
techniques (207, 266). The polygalacturonase from E. amylovora is homologous to
endo-polygalactuonases pehA and peh-1 from P. atrosepticum and P. carotovorum. Its

N-terminus predicted signal peptide is highly divergent from those of pehA or peh-I (Fig.

106

1); and the program SignalP predicts that Peh is non-secretory (i.e. not recognized by Sec
machinery); however it is present in the periplasm of E. amylovora (Fig. 7). It is also
curious that a protein that is unique to plant pathogens and plants would theoretically be
secreted through a T2SS that evolved from human pathogens. Specificity of proteins
secreted by type II secretion is noted in numerous species, due to interactions with both
proteins C and D from the secreton (34, 54, 228). However the Peh protein of E.
amylovora may be divergent enough from Pectobacterium polygalacturonase so that the
T2SS signaling motif is recognizable by the T288 secreton.

Mutation analysis of peh and outD determined a small but noticeable effect on
virulence and aggression when peh was deleted (Fig. 4B and C). However, when a
deletion mutant of outD was created it was no less pathogenic than wild type. If Peh is
secreted through the T2SS secreton, it would be assumed that an outD deletion mutant
would have the same or less virulent phenotype as the peh deletion mutant. One
possibility is that Peh is not secreted efficiently through the T2SS. This is plausible
because the signal peptide is not expected to be recognized by Sec machinery and there is
no identifiable OutM protein homologue, thus potentially destabilizing the T2SS
secreton. However, his-labeled Peh was detected in the periplasm of E. amylovora
Ea1189(pSEB31) (Fig. 7). Since the signal peptide is recognized by the Sec machinery
than the observation of active Peh in the supernatant of E. amylovora (Fig. 6C) could due
to its escape from the periplasm of disrupted cells. Therefore the Peh protein either isn’t
recognized by the TZSS, or it is inefficiently secreted by the TZSS secreton. This is the
case for other polygalacturonases, such as PehA from Agrobaterium vitis which was

shown to be mostly located in the periplasm by enzyme activity analysis of the

107

cytoplasm, periplasm and supernatant. Observation of PehA activity in the supernatant
was attributed to either release of PehA from older cells or inefficient secretion (102).
Another polygalacturonase, Pth from E. chrysanthemi is also inefficiently secreted into
the extracellular milieu, although when it is highly expressed, Pth is secreted by the
TZSS, as determined by mutational analysis (122).

Both temporal and extracellular conditions under which the promoters of peh and
the T2SS operon were most active were different than those of a type HI secreted
effector, DspE. For the T2SS operon, the sugars glucose and galactose induced the
highest fold induction of promoter activity at 48 hpi. The highest T2SS promoter activity
was in MM-glc, where at 48 hpi the promoter activity was almost as high as the dspE
promoter. In contrast, the highest fold induction of the dspE promoter was in MM-sor
(Table 6). High expression of a type III secreted effector in the presence of sorbitol is not
surprising, considering that sorbitol is one of the main transport sugars present in
rosaceous plants. The peh promoter was most highly induced also in MM-glc, like the
TZSS promoter, although its activity was observed to be highest at 72 hpi. The 24 hour
delay of activity between the TZSS Operon promoter and peh promoter may be so that a
functional T2SS is present in order to secrete the Peh protein. There are other factors that
induce the promoters, however, because activity of the T2S operon promoter, peh
promoter and dspE promoter were highest in ‘Gala’ leaf tissue (Table 4). Such factors
could include the presence of oxygen radicals (60, 128), contact with a solid surface
(176) and plant-derived secondary metabolites (3 8).

In addition, the lack of high induction of the type II operon promoter when

exposed to sorbitol or sucrose indicates that type H secretion is not induced by

108

transported sugars present in the shoots and fi'uit of the host. The high levels of promoter
activity in MM-glu indicate that glucose is potentially an inducer of type H secretion and
peh production. Glucose is the sole component of cellulose (B-l,4-glucan) which is
second most abundant compound in plants and callose (B-l,3-glucan) which is
synthesized at wounding sites. One possibility is that free glucose released fiom either
compound during infection is sensed by E. amylovora. Another possibility is that the
bacterial enzyme levansucrase releases glucose as a byproduct of forming levan (20).
The sensing of increased levansucrase activity could also activate the transcription of the
T2SS operon and peh.

The Peh protein is secreted in some manner to the extracellular milieu, and is
functional when extracted as a supernatant protein of E. amylovora (Fig. 6C). The
detection of Peh protein in the supernatant of E. amylovora could be a result of the
overexpression of the protein, much like how overexpression of Pth led to its secretion
by the T288 of E. chrysanthemi (122). Since Peh appears to be a lone example of a
pectolytic enzyme in E. amylovora, its function appears not to be related to the
degradation of pectin which is a component of primary cell walls. A potential role for
Peh in disease is to degrade polygalacturonic acid which is a major component of the
middle lamella (115). A previous study on the ultrastructural changes in apple leaf tissue
during E. amylovora infection showed a dissolution of cell walls and the middle lamella
48 hours post infection (90). The authors then hypothesized that plant-derived CWDEs
were responsible for the effect, in light of the 1976 (226) study that did not detect any
pectolytic activity from E. amylovora. Since this study has shown that E. amylovora

does posses a functional polygalacturonase, and that a peh deletion mutant is less

109

aggressive than wild type, is quite possible that Peh from E. amylovora plays a role in the
previously observed dissolution of the middle lamella (90), and would explain the
presence of only a sole polygalacturonase in the genome.

Overall, I have determined a subtle but interesting contribution of an endo-
polygalacturonase from E. amylovora during infection. Previous studies have focused on
the contributions of type III secretion and the effector protein DspE (25, 26, 82) and the
exopolysaccharide amylovoran (reviewed in 246) to pathogenicity of E. amylovora.
There are now many reports of other mechanisms having an effect on virulence, such as
the siderophore desferrioxamine (60), levansucrase, sucrose and sorbitol metabolism
(29), the multidrug efflux pump AcrAB (38), and regulatory RNA species RsmA and
rsmB (147). Now that type III secretion has been described in sofi rot phytopathogens
such as E. chrysanthemi, P. atrosepticum and P. carotovorum (104, 204, 212, 260), it is
also plausible that a necrogen such as E. amylovora uses type II secretion for a subtle use
in virulence, namely the degradation of the contents of the middle lamella to facilitate

intercellular movement.

110

CHAPTER 3

Genetic response of resistance-related genes to Erwinia amylovora infection in

Malus X domestica cultivars with varying levels of resistance

111

ABSTRACT

Suppression subtractive hybridization (SSH) libraries are usefirl for the identification of
both rare and abundantly-expressed genes unique to a tissue type or species. In this
work, the SSH method was applied to identify genes in the apple cultivar Red Delicious
expressed in response to infection by the fire blight pathogen Erwinia amylovora. Over
150 unique expressed sequence tags (ESTs) were identified in a library population by
subtracting cDNA fiom E. amylovora-inoculated susceptible cultivar Gala from
moderately resistant cultivar Red Delicious. Temporal expression patterns for the
corresponding genes were determined using cDNA macroarrays were determined in
apple cultivars with varying resistance. Twenty one genes were detennined to be
upregulated in cultivar Red Delicious, with eight of those ESTs also highly expressed in
Red Delicious when relative to Empire or Fuji. The genes identified in this analysis can
be used as candidate genes for QTL analysis and marker assisted selection for the

development of fire blight resistant apple cultivars.

112

INTRODUCTION

Domesticated apple (Malus >< domestica) is an important host of the pathogen
Erwinia amylovora, the causal agent of the devastating disease fire blight. E. amylovora
can infect apple through nectarthodes during bloom or through wounds during the
growing season. Both modes of infection lead to collapse of the vascular tissues, wilt,
extrusion of bacterial ooze, necrosis, and in severe cases, eventual death of the tree (241).
Chemical control for E. amylovora in the United States predominantly consists of
applications of the antibiotic streptomycin during bloom and following damaging wind
storms or hail (182). The emergence of streptomycin-resistant E. amylovora has
complicated control options as other chemical and biological alternatives do not provide
commercially-acceptable control (157).

Commercial apple cultivars vary widely in inherent susceptibility to fire blight
(240); of importance is the observation that most of the popular newer varieties are highly
susceptible to this disease. Knowledge of the genetics underlying susceptibility or
resistance to fire blight in apple and pear is limited althoughwork is increasing in this
area. Cloning and mapping of resistance gene analogs (RGAs) from apple species is one
way to identify resistance-related genes. Classic plant disease resistance genes encode
proteins with a nucleotide binding site (NBS) and a leucine rich repeat (LRR) domain
that participates in protein-protein interactions (13). These resistance genes are now
hypothesized to act as guard proteins that monitor changes to other proteins that are the
true targets of pathogen effectors (180). RGAs from apple in two studies have been

identified by amplification based on degenerate primers in the nucleotide binding site

113

(NBS) (14, 136). In one study, after the cloning of 27 amplified NBS sequences, 18 of
those sequences were successfiilly converted into molecular markers and the locations of
the NBS domain RGAs were mapped (14). The technique of NBS-profiling was proven
useful by identification and mapping of 23 RGAs simultaneously in F l progeny, adding
to the number of RGA markers available for mapping (42). In a recent study, expressed
sequence tags (ESTs) homologous to RGAs were converted into expressed sequence
tagged site (E-STS) markers, facilitating the mapping of ESTs (175).

Groups have also attempted to map quantitative trait loci (QTLs) in apple and
pear for fire blight resistance, to aid in breeding efforts. Four QTLs identified for fire
blight resistance were mapped in a resistant cultivar of European pear. Two RGA
molecular markers, co-localize with QTLs on linkage groups 2b and 4 indicating that
nucleotide binding site (NBS) type resistance genes may be involved in fire blight
resistance (64). However, two independent QTL analyses of fire blight resistance in
apple identified a major QTL that accounts for roughly 35% of the resistance phenotype
on linkage group 7 that does not co-localize with any known RGAs (41, 124). This
indicates that the main genetic component of fire blight resistance is not likely to be R
gene mediated.

There is a real need for the identification of resistance-related genes for fire blight
in apple. Although the identification of a major QTL for fire blight resistance in apple is
promising, it sheds no light on the ftmction of disease resistance in this species. Analysis
of expressed genes in response to E. amylovora infection could identify resistance-related
genes. Suppression subtractive hybridization (SSH) is a molecular method used to

examine differences in genes expressed by resistant or susceptible plant hosts following

114

pathogen infection. The SSH approach involves the construction of cDNA libraries fi'om
both plant hosts following inoculation and then the selective acquisition of ESTs unique
to the resistant plant host. In this approach, both low and high abundance transcripts are
normalized, making it easier to identify rare mRNA species (62). Use of SSH libraries to
identify resistance-related genes has been successful with tomato, wheat, rice, barley,
coffee, potato and apple (59, 75, 86, 94, 129, 149, 177, 242, 259). In one SSH study
examining an apple cultivar resistant to apple scab, 21 resistance-related genes were
found to be constitutively expressed before infection occurs in the apple scab resistant
cultivar when compared to the susceptible cultivar (59). Another SSH. library created
from susceptible cultivar Gala subtracted mock-inoculated cDNA from E. amylovora-
inoculated cDNA (30). This library was the first report of global expression profiling of
an apple cultivar during fire blight infection. In this study, genes identified, while
interesting from a physiological response, are not likely to be associated with resistance
since cultivar Gala is susceptible (240).

The objective of our study was to identify genes from the apple cultivar Red
Delicious that are associated with the phenotype of moderate resistance to fire blight
exhibited by this cultivar. Since no genes for resistance or tolerance to fire blight have
been cloned, a SSH library was designed subtracting E. amylovora-inoculated susceptible
Gala cDNA fi'om E. amylovora-inoculated moderately resistant Red Delicious cDNA.
The resistance-related ESTs were analyzed for temporal expression patterns over five
time points during infection. Our hypothesis is that ESTs recovered that are unique or
highly expressed in the Red Delicious transcriptome are related to resistance to this

pathogen. In addition, two cultivars with Red Delicious as a parent and possessing

115

varying resistance to E. amylovora were used to screen resistance-related genes in order
to identify genes that are expressed similar to and different from the resistant parent Red

Delicious.

116

MATERIALS AND METHODS

Bacterial strains and plant material. E. amylovora strain Ea273 was used for
inoculation of apple tissue in this study. E. amylovora was grown on Luria-Bertani (LB)
medium at 28°C. The apple cultivars Gale Gala, a sport of Royal Gala and Scarlet Spur,
a sport of Red Delicious were used in the initial SSH library production. For cDNA
macroarray analysis the following cultivars were used: Schlect Spur (sport of Red
Delicious) on G.3O rootstock, Royal Empire (a sport of Empire) on EMLA.26 rootstock
and September Wonder Fuji (a whole tree mutation of Red Fuji) on Bud.9 rootstock
(C&O Nursery, Wenatchee, WA). All tree stems were 0.95 cm diameter and maintained
in 10.2 cm by 35.6 cm Tall Treepots (Stewe and Sons, Inc., Corvalis, OR). Trees were
maintained in the greenhouse until they broke dormancy, after which they were moved to

a growth chamber (99% relative humidity, 25°C) for inoculation experiments.

Plant inoculation and tissue harvesting. All trees used were inoculated by cutting the
first three leaves across the midvein using sterile scissors that were dipped into a 5 X 106
CFU/ml suspension of E. amylovora strain Ea273 in 0.5x PBS buffer. Inoculated tissue
was harvested 0, 6, 12, 24, 48 and 72 hours post inoculation and flash frozen in liquid
nitrogen. Leaf tissue for each time point was harvested from three trees. Tissue was
maintained at -80°C until RNA extraction.

Nucleic acid isolation and analysis. Apple genomic DNA was extracted using a CTAB-

based method previously described by Tsai et al. (244). The quality of the DNA was

117

Figure 9: Representation of the suppression subtractive hybridization library
construction. (A) Apple leaves inoculated with Ea273 are deemed the “tester”, leaves
mock-inoculated with 0.5 x PBS are deemed the “driver” in library construction. Tissue
is harvested from 6, 12, 24, 48 and 72 hpi and total RNA is extracted from each time
point separately. For isolation of polyA+ RNA, all time points are pooled together for first
and second strand reverse transcription of tester and driver cDNA. (B) Tester and driver
cDNA are cut with RsaI restriction enzyme and digested tester cDNA is ligated to two
adaptors provided with the kit (light and dark circles). The tester cDNA is then
hybridized to the driver cDNA twice. The first hybridization is between each adapter
pool and driver cDNA, for the second hybridization, the adapter populations are
combined along with fresh driver cDNA. (C) PCR amplification of the second
hybridization products uses primers specific to the adapters. Only the cDNA that
hybridized between the two populations of adapters are amplified. This in effect
normalizes the representation of each cDNA in the population so that rare cDNAs are just
as prevalent in the PCR product.

118

 

 

 

 

 

 

 

 

A L
r \ r N
t l l O l l t t l l
6 12 24 48 72 6 12 24 48 72
\hpi hpi hpi hpi 1'1le khpi hpi hpi hpi thI
~ '~
~ N N ~~ - ~ N
N N N N N
~ ~ ~ ~ N
B
o— o— __ — — _ -. -. d:
‘ 1r ”Hybridization‘ v J
°'=o _ _ 0:.
o—- — _— 0—
o= — —_"'- _ 0=
C L
.'. .
Hybridization
0:.
0:8
8: _ 0:
°= —
C PCR Amplification
H M b M
o—. 0—0 o—.
o—o q: o——o

119

assessed on a 0.8% agarose gel using sodium-borate electrophoresis buffer and 1/ 10000
volume of GelStar for visualization of DNA (Cambrex Bio Science Rockland, Inc.,
Rockland, MB). Total RNA was extracted from ~O.3 g of leaf tissue using the
RNAqueous Midi kit (Ambion Inc., Austin, TX) according to the manufacturer’s
instructions with the following minor modifications. Tissue was disrupted with liquid
nitrogen and by grinding using a mortar and pestle. Eighteen volumes of lysis buffer was
added to the leaf tissue and Plant RNA isolation aid (Ambion Inc.) was added at 1/10
volume of the lysis buffer. After the addition of the lysis buffer, samples were sonicated
three times at 40% power for 10 seconds each (Branson Sonifier 250a, Branson Inc.,
Danbuy, CT). For elution of total RNA, three times 500 [1.1 of boiling elution buffer was
pooled together for the first elution and two times 500 pl of boiling elution buffer was
pooled together for the second elution. The quality of the RNA was assessed by loading
denatured RNA on a 1.2% formaldehyde agarose gel (217). RNA precipitations used an
equal volume of isopropanol, 1/10 volume ammonium acetate and 1 ul (20mg/ml)
glycogen (Roche Diagnostics GmbH, Mannheim, Germany) at -20°C overnight.

Poly(A)+ RNA was isolated using the PolyATtract mRNA isolation system III
(Promega, Madison, WI) according to the manufacturer’s instructions with 500 pg of
total RNA from the combined time points of 6, 12, 24, 48 and 72 hpi. Isolated poly(A)+
RNA was precipitated as described above, and resuspended in 5 [1.1 of elution buffer
(Ambion Inc.).

Suppression subtractive hybridization library construction and differential
screening. A suppression subtractive hybridization library was created based on the

method of Diatchenko et al. (62) using the BD PCR-Select cDNA subtraction kit (ED

120

Biosciences — Clontech, Palo Alto, CA). The cDNA pool was generated by reverse
transcription using mRNA pooled from samples collected at 6, 12, 24, 48 and 72 hours
post infection (Fig. l). The initial quantity of polyA+ RNA for each treatment (Red
Delicious inoculated, Gala inoculated) was 1500 ng. SSH library construction followed
the manufacturer’s instructions, except that a primer set that amplify apple actin (see
Table 8) were used for checking efficiency of adapter ligation; the first PCR
amplification afler hybridization was lengthened to 30 cycles using 66°C for the
annealing temperature and the second PCR amplification was increased to 11 cycles.
Clonetech Advantage cDNA polymerase (BD Biosciences-Clontech,) was used for PCR
amplification of the cDNA after hybridization. Two [11 of the secondary PCR was cloned
using the pGEM-T easy T/A cloning vector (Promega).

A total of 960 clones were selected and arrayed into LB freezing buffer in 96-well
microplates. In addition, colonies were also printed by hand onto nitrocellulose
membranes using a 48-pin tool. These membranes were denatured in a solution of 1.5M
NaCl, 0.5M NaOH, neutralized in 1.5M NaCl, 1.5M Tris-Cl pH7.6 and washed in 2XSSC
for 5 minutes at each step (217). DNA was fixed to the membranes by UV crosslinking,
after which the membranes were stored at -20°C. For differential screening, 50 ng of
probe was prepared using a random priming kit (Invitrogen, Carlsbad, CA) and labeled
with 32P-dATP. Hybridization and post-hybridization washes were done using standard
techniques (47). After washing, membranes were exposed to BioMax MS fihn for three
hours (Eastman Kodak Co., New Haven, CT). Selected clones were then sent to the
Research Technology Support Facility (RTSF) and Michigan State University for

sequencing and Blastx analysis of the EST sequences (7).

121

cDNA macroarray construction and hybridization. Inserts fiom SSH library clones
were amplified using M13 forward and M13 reverse primer binding sites on the pGEMT
Easy cloning vectors, and ESTs were printed onto nylon membranes using a Biomek
2000 robot (Beckman Coulter, Inc., Fullerton, CA) in a quadruplicate, square pattern.
The membranes were denatured as described previously after printing, UV crosslinked
and stored at -20°C.

Total RNA from the apple cultivars Red Delicious, Empire and Fuji isolated at 0,
6, 12, 24 and 48 hours post inoculation was used for 32P-labelled first strand cDNA
synthesis using the SuperScript HI first-strand synthesis system for RT-PCR (Invitrogen,
Carlsbad, CA). Hybridizations were performed as described above, except that
hybridization was at 68°C. Hybridized membranes were exposed to phosphorimaging
cassettes (Bio-Rad, Richmond, CA) and scanned using the Personal Molecular Irnager®
(Bio-Rad). Quantity One sofiware (v 4.6.1, Bio-Rad) was used to determine signal
intensity as volume units, and all clones on the cDNA macroarray were normalized to the
volume units of actin and reported as normalized volumes (nVol). Hybridizations were
determined from two independent hybridizations to cDNA macroarrays representing
inoculations from two separate experiments for Red Delicious and one hybridization

representing one experiment for Empire and Fuji.
Semi quantitative reverse transcription-PCR. Total RNA (10 pg) fiom Red Delicious,

Empire and Fuji at 6, 12, 24 and 48 hours post inoculation were treated with DNA-free

(Ambion, Inc.) according to manufacturers instructions for rigorous DNase treatment.

122

DNase treated total RNA (4 ug) was reverse transcribed using the SuperScript III first-
strand synthesis system for RT-PCR (Invitrogen). Primers for semi quantitative RT-PCR
(Table 8) were designed using Lasergene software (v 6.0, DnaStar, Madison, WI). All
genes were amplified for 27 cycles of 94°C for 30 sec, 59°C for 30 sec and 72°C for 45
sec. PCR products were run on a 1.5% agarose gel with 1/ 10,000 volume GelStar
(Cambrex Bio Science Rockland, Inc., Rockland, ME). Gels were directly read by a
Flour-S MultiImager (Bio-Rad, Richmond, CA). Normalized volume units are calculated

as described above.

TABLE 8. Oligonucleotide primers used in this study.

 

Primer Name

Primer Sequence (5’ to 3’)

 

Actinl Forward
Actinl Reverse
Primer la

Nested primer la
Nested primer 2R0
14-3-3u Forward
14-3-3p Reverse
Hsf8 Forward
Hsf8 Reverse
PlP2-1 Forward
PIPZ-l Reverse
PR3 Forward

PR3 Reverse

Call Forward
Call Reverse
PP2C Forward
PP2C Reverse
Actin RT Forward
Actin RT Reverse

GACCITGCWGGTCGTG
GATGGTTGGAAGAGGACTT CT GG
CT AATACGACT CACT ATAGGGC

TCGAGCGGCCGCCCGGGCAGGT
AGCGTGGTCGCGGCCGAGGT

CATACGAGACT GCCACCACCACT G
ATGMCGCCTGAAT'ITTGTCTAAC
CAGTGAGGCCAAAAGAGAAGGAAGAGTCGG
GCCCACT CAGTATCT GCTT GTGCT GCI'T C

CT ACAGTTCCACCGCCC’I'I‘ CAAATTTCT CC
CAACCCTGCTAGGAG'I'ITTGGAGCTGCTGTC
CAGCT'I‘AAACGAT'TCCCTCATGAGGAATCC
GAGTGGCGGAGCT GTCCCT CCAGCTT GCT G
GCCAAACGCT CT CAACGATGGCCGATCAGC
G'ITGATCTGCCCATCACCATCCACATCAGC
CT CATACTT GCATCT GATGGGCT GTGG
GCAGGTACAAGCTGACGGTTCACCGGAGTTC
CCTAAGGCCAACAGAGAAAAGATG
AGCGGATGCAAGGGTGGAC

 

0 Primers provided in Clontech PR-Select cDNA subtraction kit (BD Bioscience-Clontech, Palo Alto, CA)

123

RESULTS

Creation of a suppression subtractive hybridization library representing resistance-
associated genes specific to Red Delicious

To identify genes that are uniquely expressed in Red Delicious during E.
amylovora infection we subtracted cDNA from E. amylovora-infected cultivar Gala from
cDNA from E. amylovora-infected cultivar Red Delicious at 6, 12, 24, 48 and 72 hours
post infection. These time points were selected to correspond with the oxidative burst of
apple in response to E. amylovora infection (249). Genes responding to wounding by the
inoculation are expected to be genes expressed similarly in both cultivars and would be
subtracted and not recovered (47 ).

960 clones fiom the SSH library were analyzed fiirther. These clones were
subjected to differential screening by arraying and hybridization. Clones that hybridized
to the subtracted Red Delicious cDNA and hybridized weakly or not at all to unsubtracted
Gala cDNA were selected for sequencing and further study. Thus, the clones selected by
differential screening were more strongly expressed in Red Delicious relative to Gala
following infection with E. amylovora (Figure 10A and B). Following this hybridization
screening, 265 clones were selected for sequencing and gene identification, of these 183
representing had significant matches in GenBank, of which 168 unique ESTs were
assigned and divided into functional classification categories (214). Overall, the ESTs
were separated into 17 categories including subcellular localization (7.5%), metabolism

(5.8%), signal transduction (4.0%), proteins with binding fiinction (4.9%) and cell

124

TABLE 9. Classification of ESTs recovered from an SSH experiment subtracting cDNA of apple
cultivar Gala from Red Delicious following inoculation with E. amylovora. The EST sequence

classification is based on homologya to Arabidopsis proteins.

 

 

. . . . Subtracted b
Protein F unctronal Classrfication Population (%) Apple NRs (%)
01 Metabolism 5.8 16.2
02 Energy 3.1 3.2
10 Cell Cycle and DNA Processing 1.3 2.7
11 Transcription 1.8 4.9
12 Protein Synthesis 2.7 3.0
14 Protein Fate 3.1 6.8
16 Protein with Binding Function 4.9 3.1
18 Protein Activity Regulation 0.9 0.04
20 Cellular Transport 4.0 2.3
30 Signal Transduction Mechanism 4.0 5.9
32 Cell Rescue, Defense and Virulence 2.2 3.7
34 Interaction with Cellular Environment 2.2 1.8
40 Cell Fate 0.9 3.4
41 Development 1.8 0.9
42 Biogenesis of Cellular Components 2.7 2.9
70 Subcellular Localization 7.5 19.4
99 Unclassified Proteins 51.4 9.4

 

a Functional homology of ESTs determined using Blastx algorithm
b Apple NRs percentages are as reported in Newcombe et al. (179)

defense (2.2%) (Table 9). The largest category was unknown function (51%), which
contained ESTs with translated sequence homologous to proteins that were not
functionally characterized. This is in contrast to the classification of apple ESTs
identified by Newcombe et al. (179), that only identified 9.4% unknowns from their EST
libraries (Table 9). This could indicate the presence of novel resistance response genes in

apple that are uncharacterized as of yet.

125

  

it ‘9»!!mlfaa.
‘3 I I! fix ‘ I § ‘ V . ‘
a s I!» if w! *5 n 1 i?

, . ,. . g g;

i. .1 ,,, I- Q ~': ‘.

 

Figure 10: Representative radiographs of differentially screened EST clones. (A) Red
Delicious SSH clones hybridized to Red Delicious SSH probe. (B) Same Red Delicious
SSH clones hybridized to Gala probe. An example of a clone that was selected for
hybridization to the Red Delicious SSH probe but not to the Gala probe is circled. An
example of a clone that hybridized strongly to the Red Delicious SSH probe but weakly
to the Gala probe is enclosed by a box.

Expression analysis of EST s from Red Delicious in cultivars Red Delicious, Empire and
Fuji

For further expression analysis of the 183 Red Delicious genes, we arrayed cDNA
macroarrays and hybridized the arrays to labeled first strand cDNA from O, 6, 12, 24 and
48 hours post infection. Total RNA from two independent experiments with Red
Delicious and one experiment with Fuji and Empire was labeled and hybridized to the
cDNA macroarrays (Figure 11). Total RNA from only one experiment with Fuji and
Empire was used to identify potential gene candidates that would be used for further
analysis using semi quantitative RT-PCR. In theory, ESTs that are expressed at higher
levels in Red Delicious over less resistant cultivars are potentially involved in the

resistance response. Hybridization signals from the cDNA macroarray hybridization

126

experiments were normalized to an internal control gene (actin) on the macroarray.
cDNAs selected for further analyses were induced over two-fold at either 6, 12 24 or 48
hours post inoculation (hpi) with respect to the zero hpi expression levels (Table 10). In
addition, cDNAs that were two-fold more strongly expressed in Red Delicious relative to
cultivars with differing resistance, Empire or Fuji are also identified as potential

resistance-related genes.

Induced expression of Red Delicious ES Ts

When gene expression was quantified using cDNA macroarrays, 21 Red
Delicious ESTs were induced two-fold or higher over basal levels during infection (Table
10). The peak of fold induction for the majority of genes was at 12 hpi, after which the
levels returned to near basal levels (Table 10). Rapid accumulation of transcripts
involved in the resistance response was also observed by Venisse et al., in another
resistant cultivar, Evereste (249). Almost a third of the upregulated ESTs are theoretical

proteins with no homology to proteins of known function (Table 10).

127

TABLE 10. Red Delicious ESTs with two-fold or higher induction after inoculation with E.

 

 

 

amylovora.
. b
, 0 Fold Induction
EST Blastx Best Hit 6 hpic 12 hpi 24 hpi 48 hpi
RGGlAlO Oxoglutarate dehydrogenase 1.6 2.0 0.8 0.9
RGG1B07 Expressed protein 1.3 2.0 0.7 0.8
RGGlB 10 Unknown protein 1.5 2.0 0.8 0.9
RGG1C08 Plasma membrane intrinsic protein 2-1 1.6 7.9 0.7 1.0
RGGlDll Heat shock factor protein 8 1.6 2.8 0.8 0.8
RGGlEll Myosin heavy chain 3.8 1.3 0.7 0.9
RGG2B04 Protein kinase family protein 1.6 2.0 0.8 1.1
RGGZB 10 Unknown protein 4.9 3.5 0.9 0.7
RGG2C09 Unnamed protein product 2.0 2.6 0.8 0.8
RGG2DO6 Salicylic acid carboxyl methyltransferase 2.1 1.2 1.0 1.0
RGGZD08 Cell differentiation protein, RCDl 2.4 1.5 1.0 0.9
RGGZD09 Cell differentiation protein, RCDl 1.7 2.6 0.8 0.9
RGGZDlO 14-3-3 protein 2.1 8.0 0.8 0.9
RGG2E02 Expressed protein 1.3 1.2 2.0 1.0
RGG2G03 Glycyl tRNA synthetase 2.2 1.0 0.7 1.0
RGG3A07 Curly leaf protein 1 (polycomb-group) 1.3 2.4 1.0 1.0
RGG3BO6 Protein phosphatase 2C homolog 2.3 1.6 1.3 1.0
RGG3D04 6OS ribosomal protein L18 1.6 2.1 0.7 1.0
RGGBEO7 Expressed protein 1.2 2.5 0.6 0.8
RGG3FO9 Pod-specific dehydrogenase SAC25 1.8 2.4 0.8 0.9
RGG3F10 Calrnodulin 1 1.5 3.8 0.9 0.9

 

a Blastx best bit are homologous proteins to putative translations of the ESTs (E > 1 X 1005)
b Fold induction is reported as nVol at 6, 12, 24 and 48 hpi over nVol at 0 hpi for Red Delicious
6 hpi, hours post inoculation

Of the remainder, none are classic NBS-domain type resistance genes. This is not
surprising, since a gene-for-gene interaction between apple and E. amylovora has not
been discovered as of yet. Four identified genes corresponded to proteins involved in
modification of protein activity: a protein kinase family protein (RGG2BO4), a 14-3-3
protein (RGG2D10), protein phosphatase 2C (RGG3B06) and calrnodulin 1 (RGG3F10),
and thus are potentially involved in the signaling response to infection. The protein
phosphatase 2C family is involved in diverse aspects of cellular signaling including

abscisic acid (ABA), receptor-like kinase and mitogen-activated protein kinase signaling

cascades (211).

128

 

 

 

Eh: I
D.
It
I can a
I I
e in an:-
8 : I
a. C! I
' B
I a
"- .i .u I
.. t: I I
” I II a.

 

 

a a... z: I

 

Figure 1 1: Representative cDNA nylon macroarray hybridization. Top membrane is
hybridized to labeled, inoculated Red Delicious cDNA 6 hours post inoculation. Middle
membrane is hybridized to labeled, inoculated Red Delicious cDNA at 12 hours post
inoculation. Bottom membrane is hybridized to labeled, inoculated Red Delicious cDNA
at 24 hours post inoculation. The EST identified as a Mal (1 1m protein is enclosed by the
square.

14-3-3 proteins constitute a family of proteins that include up to 15 isoforrns which
modulate different signaling pathways by protein-protein interactions (208, 257).
Calmodulins are well studied proteins involved in calcium-monitoring signaling
pathways, which are often involved in abiotic and biotic stress signal transduction

pathways (6).

129

Three ESTs were homologous to other stress-related genes such as the aquaporin
plasma membrane intrinsic protein 2-1 (RGG1C08), heat shock factor 8 (RGGlDl l) and
salicylic acid carboxyl methyltransferase (RGG2DO6). Aquaporins are a diverse family
of proteins that facilitate the movement of water through lipid membranes in cells. There
are four subfamilies of aquaporins, and the plasma membrane intrinsic proteins (PIPs)
facilitate the movement of water and neutral solutes through the plasma membrane. The
PlPs are fiirther classified into two groups, the PIPl and PIP2 groups and the PIP
identified in this study is of the latter group, which is are more involved in the movement
of water to maintain turgor pressure (46). Heat stress transcription factors (I-Isfs) are
involved in binding to promoter areas of inducible genes either activating or repressing
them; this EST from the subtracted library has highest homology to an Hsf8-1ike protein
fi‘om Arabidopsis. Originally, hsz was identified in Lycopersicon peruvianum as being a
strong activator of transcription during heat stress (164, 185). Salicylic acid carboxyl
methyltransferase (SAMT) methylates available salicylic acid in plant tissues to form the
volatile derivative, methyl salicylic acid (MeSA) which has previously been
demonstrated to act as an airborne signal during pathogen infection by tobacco plants
(229).

Other genes that were upregulated upon infection were involved in protein
translation, organ development and cytoskeletal movement. Two ESTs are homologous
to protein translation related genes, glycyl tRNA synthetase (RGG2G03) and the 60S L18
ribosomal protein (RGG3D04). The polycomb-group curly leaf protein (RGG3A07)
(CLF) is a repressor of homeotic genes that determine cell fate (91). Another potential

gene involved in cellular fate is rch (RGG2DO9) which is involved in nitrogen

130

starvation induced sexual development of the yeast Schizosaccharomyces pombe (186).
Its role in plant cellular development is still unknown, even though rcdl homologues are
present in plant genomes.

Energy and metabolism genes were also among the upregulated genes such as the
tricarboxylic-acid pathway protein oxoglutarate dehydrogenase (RGG1A10) and a pod-
specific dehydrogenase (RGG3FO9). Oxoglutarate dehydrogenase accumulates upon low
sugar conditions, including darkness and senescence and it is important for respiration by
catabolism of branched-chain amino acids (208). Short chain dehydrogenase (SDR)
proteins, such as the pod-specific dehydrogenase (SAC25) are a part of an extremely
large enzyme family, with over 1000 types of enzymes (194). Homology of RGG3F 9 to
the Arabidopsis SAC25 gene only determines that a SDR motif is present; the function of

this putative protein is unknown.

Comparison of expression levels for Red Delicious EST 3 versus Empire and Fuji

The apple cultivar Empire is the progeny of a cross between McIntosh and Red
Delicious, and is intermediate in its resistance to E. amylovora (240). When comparing
the level of expression of the subtracted library ESTs from E. amylovora-inoculated Red
Delicious with respect to E. amylovora-inoculated Empire transcripts, genes that are
highly expressed in Red Delicious stand out as potential resistance-related genes. For
this study, genes that were expressed two-fold or more in Red Delicious versus Empire at
either 6, 12, 24 or 48 hours hpi are listed in Table 11. Most genes listed in Table 11 are
also noted as being inducible in Table 10, with the exception of three added genes: a

fibrillarin-like (RGG1A08), putative protein kinase (RGG1C09), and an unknown protein

131

TABLE 11. ESTs that are induced to higher levels in apple cultivar Red Delicious versus Empire
following inoculation with E. amylovora.

 

 

 

. b
_ 0 Fold Induction
EST Elam Be” H" 6 hpi“ 12 hpi 24 hpi 48 hpi
RGG1A08 Fibrillarin 1 1.1 2.0 0.4 0.4
RGG1A10 Oxoglutarate dehydrogenase 1.1 2.3 0.5 0.5
RGG1B07 Expressed protein 1.2 2.3 0.3 0.7
RGG1C08 Plasma membrane intrinsic protein 2-1 1.3 10.8 0.5 0.5
RGG1C09 Putative protein kinase 0.8 2.0 0.7 0.6
RGGlDll Heat shock factor protein 8 1.0 2.0 0.3 0.4
RGG2B10 Unknown protein 2.7 1.6 0.4 0.5
RGG2C09 Unnamed protein product 1.5 3.1 0.4 0.7
RGG2DO9 Cell differentiation protein, RCDl 1.4 3.0 0.5 0.6
RGG2D10 14-3-3 protein D 1.3 9.4 0.5 0.5
RGG3A09 At3g57420 2.7 1.5 0.8 1.0
RGG3A07 Curly leaf protein 1 (polycomb—group) 0.9 2.0 0.6 0.5
RGG3DO4 60S ribosomal protein L18 1.0 2.3 0.5 0.5
RGG3E07 Expressed protein 1.0 2.5 0.2 0.6
RGGBF09 Pod-specific dehydrogenase SAC25 0.8 2.6 0.5 0.4
RGG3F10 Calrnodulin 1 1.0 2.7 0.4 0.5

 

a Blastx best bit are homologous proteins to putative translations of the ESTs (E > 1 X 1005)

b Fold induction is reported as Empire nVol at 6, 12, 24 or 48 hpi over Red Delicious nVol at 6, 12, 24 or
48 hpi

C . . .
hpi, hours post inoculation

(RGG3A09). Fold induction of the majority of Red Delicious transcripts were highest
with respect to Empire transcripts at 12 hpi with expression sharply reduced at 24 hpi
(Table 11). Two unknown genes (RGG2B10 and RGG3AO9) were highly expressed in
Red Delicious versus Empire at six hpi indicating that the peak expression of these ESTs
mostly occurred at 24 hpi for Empire, suggesting a delayed response to pathogen
infection (Table 11).

The apple cultivar Fuji is the progeny of a cross between Ralls Janet and
Delicious; however, the severity of fire blight on inoculated trees is similar to that of the
susceptible cultivar Gala (240). One could speculate that the susceptibility was inherited

from Ralls Janet, or that less resistance response genes were passed on from both parents.

132

TABLE 12. ESTs that are induced to higher levels in apple cultivar Red Delicious versus Fuji
following inoculation with E. amylovora.

 

 

 

. b
EST Blastx Best Hita Foldgnduction. . .
6 hpi 12 hpi 24 hpi 48 hpi
RGG1AO3 Unknown protein 1.7 2.1 1.2 0.5
RGG1A06 Unknown protein 1.0 2.0 0.7 0.6
RGGIBO6 Hypothetical protein 1.4 2.1 0.9 0.9
RGGIBO7 Expressed protein 1.6 3.5 1.4 1.0
RGGIC06 Plasma membrane intrinsic protein 2-2 1.2 2.4 1.7 0.6
RGG1C08 Plasma membrane intrinsic protein 2-1 1.8 7.8 0.7 0.8
RGGlDll Heat shock factor protein 8 1.2 2.3 0.7 0.6
RGG1FO7 Unknown protein 1.9 2.3 1.3 1.8
RGGlH08 At2g18850 1.0 0.7 2.0 1.2
RGGZCO6 LHCII type III chlorophyll a/b binding protein 1.4 2.5 1.0 1.5
RGG2CO9 Unnamed protein product 1.8 2.8 0.8 1.0
RGG2DO9 Cell differentiation protein, RCDl 1.4 2.1 0.8 0.6
RGGZDlO 14-3-3 protein D 1.7 6.0 0.7 0.5
RGG2E02 Unknown protein 0.9 1.0 2.4 0.5
RGGZGll 40S ribosomal protein S9 1.0 2.7 1.8 1.8
RGGZHO7 GSK—3-1ike protein 1.3 0.6 3.0 1.1
RGG3AO7 Curly leaf protein 1 (polycomb-group) 1.2 2.1 1.0 0.9
RGG3AO9 At3 g5 7420 3.3 1.6 1.4 1.7
RGG3BO6 Protein phosphatase 2C 2.3 1.3 1.4 0.7
RGG3C09 Unknown protein 1.3 2.3 0.9 0.9
RGG3DO4 60S ribosomal protein L18 1.3 2.0 0.6 0.6
RGG3D05 Mal (1 1m 1.2 3.0 1.4 1.0
RGG3EO7 Expressed protein 1.5 4.0 1.4 0.8
RGG3F10 Calmodulin 1 1.1 3.1 0.8 0.6

 

a Blastx best hit are homologous proteins to putative translations of the ESTs (E > 1 x 10-05)

b Fold induction is reported as Fuji nVol at 6, 12, 24 or 48 hpi over Red Delicious nVol at 6, 12, 24 or 48
hpi

C . . .
hpi, hours post inoculation

Genes that are highly expressed in Red Delicious and Empire when compared to
expression levels in Fuji are very likely to be associated with a resistance genotype, since
Fuji is susceptible to E. amylovora infection. Of 24 genes that are highly expressed in
Red Delicious compared to Fuji, nine are not listed in Table 10 as being highly induced
in Red Delicious with respect to zero hpi (Table 12). Six of the nine genes are of
unknown fiinction (RGG1AO3, RGG1AO6, RGG1BO6, RGG1FO7, RGG3A09,

RGG3CO9) and the remaining three are a light harvesting complex H (LHC H) type III

133

chlorophyll a/b binding protein (RGG2CO6), a glycogen synthase kinase 3 protein
(RGG2HO7) and a Mal dl-like protein (RGG3D05). Glycogen synthase kinase 3 (GSK-
3) proteins are present in both animals and plants. There are multiple GSK-3
homologues in plant genomes, and these homologues have been demonstrated to be
involved in NaCl stress signaling, wounding response, flower development and
brassinosteroid signaling pathways (120). The Mal d 1 (PR-10) protein family in apple is
thought to have at least 15 different isoforms, with 12 of them represented in Royal Gala.
The Mal d 1 EST fi'om this subtractive library is most homologous to Mal (1 1m, which
was only observed in ripening fruit EST libraries from Royal Gala (23).

Overall, comparison of the ESTs that were upregulated in Red Delicious to basal
levels of transcription or to Empire and Fuji following inoculation (Tables 10, 11 and 12)
yielded a list of three ESTs that are about equally expressed in Red Delicious in
comparison to expression in the other cultivars. This includes two unknown proteins
(RGG1B10 and RGG2B10), protein kinase family protein, myosin heavy chain, SAMT
and the glycyl tRNA synthetase. These genes are unlikely to have important roles in the
resistance response. However, the expression of SAMT was 1.9 times higher in Red
Delicious than Fuji at six hpi, therefore, it may still have a role in E. amylovora
resistance. Although these genes may have an impact overall on disease resistance, they
are most likely not involved with modulation of a complete resistance phenotype. Two
genes that were highly expressed in Red Delicious when compared to Empire,
oxoglutarate dehydrogenase and fibrillarin 1 were not highly expressed relative to

transcript levels in Fuji and are also suspect in their role in disease resistance.

134

Constitutively expressed Red Delicious EST s in Red Delicious, Empire and Fuji

Other genes that may be of interest are ones that were determined to be
constitutively expressed in Red Delicious, where gene expression did not reach over two-
fold relative levels compared to basal expression at zero hpi (Table 13). These ESTs
were selected based on nVol intensity of 2.0 or higher. Twenty ESTs fit this criterion,
five of which were also noted to be more highly expressed in Red Delicious versus Fuji
by a margin of two-fold or more. Another plasma membrane intrinsic protein detected in
the subtractive library is expressed constitutively, PIP 2-2. Four genes listed are involved
in metabolism, including a member of the glycine decarboxylase complex, H-protein
(RGGlGOl) which acts as a methyl carrier for the conversion of glycine to serine (66).
Other metabolic genes include triosephosphate isomerase (RGG2DO7) and the oxygen
evolving complex 33kDa subunit (RGG3H07). The oxygen evolving complex 33kDa
subunit (OEC 33) is interesting because it has been implicated in basal resistance to
viruses in Nicotiana benthamiana (192). Three genes are involved in signaling cascades
such as an inositol 1, 3, 4-trisphosphate 5/6-kinase protein (RGG2HO3) and transparent
testa glabra l-like (TTG-l-like, RGG3B01). Arabidopsis inositol 1, 3, 4-trisphosphate
5/6-kinase (5/6 kinase) was demonstrated to interact with the COP9 signalosome,
affecting growth under red light (199). The TTG-l protein is a WD-4O repeat protein that
is implicated in trichome development and anthocyanin biosynthesis regulation (250). A
WD-40 repeat protein has also been reported as being upregulated in potato leaves using
microarray analysis following infection with Phytophthora infestans (242). Five listed
genes are involved in protein synthesis and fate including: eIF-2 (RGG2HO4), signal

peptidase complex 25 kDa subunit (SPC 25, RGG2C10), Rerlb (RGG3CO3) and the

135

nous—=85 «won 950: mg @283.— Ba 88.: E“ o

.53 08.5 35 no.“ £92 :38 9 team—«ES: Agata: <ZQo Eot arm—ow owns: 05 a _o>:

 

 
 

 

 

 

 

Fox: x a A m: mkmm 2: ac accusing 358.6 8 mEBEQ Bone—08o: 2a «.3 .89 damn—m M

md _ d md d6 m4 vd v... ad ed and ad _d «d 3. dd 3:53 «Ge—mm .5758 5230-5 x0 BEGUM
_d a._ vd ad 2 vd Ev 2 ad a; vd a; _.m vd ed ennui—85b 5:23-50 BamOOm
ed a; 2 ad 1 ad 2. Md d6 od ed ed 2 dd nd 8.: Te 32 nonOOM
_.m m; md od 3 vd fin ad md a._ od _d 9. md _d mica .5085 3532 .mm moOMOOm
vd mg _.m ed 2 ad ed _d ad dd mm M: w; wd md £085 8:.-. Eng—w Sma. EBKESH 838m
dd o _ ad _d d._ ad we dd 5 a; md .d . M: ed dd 33a .5055 com—Adam SINOOm
ed 0 a ad ad 3 ad md md ad ad ad dd md vd md 3805 3.538%: 8me0&
B: n v _.a 9m. 2 m6 Wm 06 d4. ad ad dd dd o6 ed 5035 3E5 Nut... vomdocm
06 ed 0... ad mg vi Tm ed ad ad dd 3 Z. dd md £22.”— ommzfléh eagamofimmbéd; 6E2: momdoom
a.“ a _ w; vd mg m... a6 aé 3. w; n». _.m a... ma mm am 5880* 3:8th mow :OdOOm
Wm _.m od dd mg 3. 0... ad wd ad ad md md ad ad 532a 32352:: Sodoom
ed a a dd dd d._ Wm _.v ed md o; _d 5; ad ad ad $2080£ oaaaamcaaomoth aonOOM
02 5m 00 v.0 md \id~ a.a_ _.: d.a dd 0.2 o.m a.o_ ad. Ya «Essa a9— md .3388 0333a 35% EUNOOM
ms mg». hm m.» Md d._ _ fin. ha Q: o6 Q: hm v.1 od_ 3: 588a mic—an £5 =EaSoEo E 03:031— 880va
ad mg vd ed v; ad ad ad md a; ad ad vd ad md £085 850815 ao<dOOM
Md w _ ed md wd v... .2. 9m ed _.m Wm md od 3 ed Bum—mm .85-— wEuEn 95 2.52222 8500M
_d 9. ad md 2 Wm _.m «H. a; e; md _d w; dd _d 528a commohaxm won—00m
Q: o6 wd_ Md 2 Wm ma 3 v.0 fin od md ad Wm ed 5889: 5.200%
9: 9m 3 Wm a; nd_ a._d od. d? On a.o dd ES 3: wd dd 3085 28.55 05582: «Ema—m coo—00M
in ad ad _.m 2 ed 0! 1m ad ad _.m d4. md_ ed d6 522a commouaxm mom—00m
a. «N S o c we «N 2 e c me E 2 a .o “E “em 52% 5m

:5: E5 :5: 236m s_o>= 256:8 8m a
:5 ea 2&5

figs—so 05 5 85m 32: mo cofimoaxo mo mien—28 98 m=o_o=oQ com 32:30 can“ we mbmm @8855 33:35.80 .2 mam/E.

136

GPI-anchor transamidase (RGG3DO7). Proteins SPC 25 and RerlB are involved in the
translocation across the ER membrane and capture by the ER, respectively (93, 222).
The EB-l-like protein (RGG1HO9), was demonstrated to associate with and stabilize the
ends of microtubules as well as associating with stabilized microtubules and the
endomembrane (152).

When the ESTs highlighted in Tables 3, 4, 5 and 6 were searched for homology
against available EST libraries, seven were also identified in an E. amylovora inoculated
Red Delicious EST library (Mdfb) available from GenBank
(http://www.ncbi.nlrn.nih.gov/dbEST). Three of the ESTs, PIP2-l, unknown protein
(RGGZBIO), and SAMT were demonstrated to be induced in Red Delicious in this study
(Table 10). A putative protein kinase and unknown protein that were expressed higher in
Red Delicious compared to Empire (Table 11) and a LHCII type III cholorophyll a/b
binding protein and Mal d 1m that were expressed higher in Red Delicious compared to

Fuji (Table 12) were also in the Mdfb EST library.

Semi-quantitative reverse transcriptase PCR of selected induced genes

Semi quantitative reverse transcriptase PCR was used to confirm the expression
patterns of selected ESTs. ESTs selected for fiirther analysis were the 14-3-3 gene, pipZ-
I, hsz, pp2C, pr-3 and call. The intensity of the actin band at each time point per
cultivar was used as a reference for normalization of the PCR band intensities. Similar to
the patterns of expression observed using cDNA macroarrays, expression of the 14-3-3
gene was at higher levels than both Empire and Fuji and remains a strong candidate for a

resistance-related gene based on its expression levels and also that it participates in

137

signaling events (Figure 12). When genomic DNA was used in PCR using the same 14-
3-3 RT-PCR primers, different banding patterns were observed between Gala, Red

Delicious, Empire and Fuji (Figure 13).

Hours Post Inoculation
6122448 6122448 6122448

.- - to Irv-- IQ“ 14-3-3”
1.7 2.1 1.7 2.3 2.2 1.5 1.0 3.1 4.5 4.4 3.9 5.4

PIP2-1
1.1 1.21.714 1.31.7 0.81.5 2.01.613 0.6

. . Hsz
1.6 1.7 1.5 2.2 2.1 1.4 0.8 2.3 2.4 2.7 2.4 2.7
PP2C
2.5 2.5 2.2 3.0 3.0 1.8 1.0 2.9 3.6 4.0 3.3 3.3
F: .. m II. p g. g; m at» I... a. PR-3
3.6 3.2 3.2 4.9 5.8 3.7 2.0 7.1 6.8 7.0 6.1 6.9
..... .. .- .. u - ~- .. Cal1
2.1 1.9 2.2 2.8 2.6 2.5 1.1 2.4 2.9 2.9 2.2 2.4
. . :4 o ..' 0“ “ ACtin

Figure 12: Semi-quantitative RT-PCR with cultivars Empire, Fuji and Red Delicious.
cDNA from 6, 12, 24 and 48 hpi were reverse transcribed and used in RT-PCR.
Numbers beneath lanes represent nVol which are the density of the band normalized to
the density of actin at that time point. Numbers in bold are those where the nVol of Red
Delicious was two-fold and higher compared to either Empire or Fuji.

138

Since the 14-3-3 protein family is large in plants, this may be the result of other
homologous 14-3-3 genes in apple, or the possibility of polymorphisms within intron
regions. Regardless, the RT-PCR product for the 14-3-3 primers was a single band at
around 450 bp.Another protein involved in signaling events, protein phosphatase 2C, was
upregulated in Red Delicious higher than Fuji for 12 and 24 hpi, and also remains a
strong candidate as a resistance-related gene. Upregulation of the transcription factor
hsz was higher in Red Delicious compared to Fuji at 12 and 24 hours and at 6, 12, and
24 hours for Empire. The levels of fold higher expression were not as high as observed
in the cDNA macroarrays between Red Delicious and Empire at 12 hours (Figure 12,
Table 11); however they were higher at 6 and 12 hours between Red Delicious and Fuji
(Figure 12, Table 12). Heat shock factor 8 thus remains an interesting candidate for a
resistance response in Red Delicious. Expression of the aquaporin pipZ—I was not higher
in Red Delicious than Empire or Fuji in the PCR assay, therefore its contribution to
disease resistance is unclear. Another gene, cal], did not have as high of expression
levels in Red Delicious based on comparison of expression levels in Empire and Fuji,

thus the contribution of the Call protein in Red Delicious resistance is ambiguous.

139

 

figure 13: PCR amplifying gene fragments corresponding to the EST of the 14-3-3 and
unknown gene with genomic DNA of Empire, Fuji, Gala and Red Delicious. PCR
products were loaded onto a 1.0% agarose gel in 0.5x TBE buffer. Lanes 1 and 10 are 1
kb plus DNA ladder. Lanes 3, 5, 7 and 9 are Empire, Fuji, Gala and Red Delicious PCR
fragments amplified from genomic DNA with the 14-3-3uF/R primer set. The main band
amplified 14-3-3u band is around 2,000 bp Lanes 2, 4, 6, and 8 are Empire, Fuji, Gala
and Red Delicious PCR fragments amplified from genomic DNA with the RGG2CO9R/F
primer set.

140

DISCUSSION

In this study, we constructed a SSH library to identify resistance-related genes
that are differentially expressed between the apple cultivars, Gala and Red Delicious, that
are moderately susceptible and resistant, respectively to fire blight disease. Suppression
subtractive hybridization was used to isolate an EST library due to the ability for low
abundance transcripts to be isolated in addition to high abundance transcripts. A total of
213 ESTs were identified using the Blastx algorithm of which 21 genes were induced by
infection in Red Delicious (7). Using the FunCat protein classification scheme, around
50% of the ESTs are of unknown function, which is similar to amount of unknown EST 3
that were isolated in another SSH that used two apple cultivars of differing resistance to
Venturia inaequalis (59).

The goal of using two cultivars with differing resistance to E. amylovora was to
determine the heritability of resistance-related gene expression. Since fire blight
resistance is likely by additive gene effects based on loci interactions determined during
QTL analysis, the accumulation of one or more induced resistance-related genes in
relation to the cultivar’s resistance to E. amylovora may indicate the importance of those
genes. Of 21 induced genes in Red Delicious, nine were highly expressed when
compared to expression in Empire and Fuji. These proteins included the 14-3-3 protein,
Hsf8, Call, Rcdl, CLFl, PIP2-1, 608 L18 and two unknown proteins (Tables 10, 11 and
12). Since Empire and Fuji did not inherit the expression profile of these genes from Red
Delicious, they make good candidate resistance-related genes. In addition, two genes

were highly expressed in Red Delicious and Empire when compared to Fuji, an unknown

141

protein (RGG3EO2) and PP2C. Protein phosphatase 2C is also a candidate resistance-
related gene based on a high abundance of transcript in Red Delicious and Empire when
compared to Fuji.

The majority of the Red Delicious induced ESTs with functional homology to
known proteins were homologous to protein activity regulation genes (Table 10). This
included a 14—3-3 protein that was also expressed at higher levels in Red Delicious
compared to Empire (Table 11) and Fuji (Table 12). In addition, semi-quantitative RT-
PCR confirmed this pattern of transcript abundance in Red Delicious (Figure 12). 14-3-3
proteins have gained interest as being involved in a response to pathogen infection in
barley, Arabidopsis, tomato, soybean and cotton (209). This EST clone had homology to
an Arabidopsis 14-3-3p. cDNA clone that is an e-like isoform. It is theorized that based
on the homology between mammalian, plant and yeast e-like isoforms they are the most
ancient isoforms of 14-3-3 proteins (257). Currently all that can be deduced about the
Red Delicious 14-3-3u protein is that it is likely to be an ancient isoforrn with well
defined activity and that it binds proteins with either phosphoserine or phosphothreonine
thus modulating the phosphorylated protein’s activity. If this Red Delicious is an ancient
14-3-3 is it curious that it would be different enough from 14-3-3 transcripts in Gala as to
be isolated in a SSH library. There are two possibilities, the first being that the 14-3-3u
gene is expressed earlier and at higher levels in Red Delicious than in Gala. This is
entirely possible based on the semi-quantitative RT-PCR data that shows a greater
abundance of 14-3-3u transcript in Red Delicious than either Empire or Fuji (Figure 12).
Another possibility is that there has been further gene duplication event of e-like isoforms

in domestic apple cultivars and that the 14-3-3u transcript present in Red Delicious is

142

divergent from the 14-3-3u transcript in Gala. Potential evidence for this is the presence
of multiple bands for both Red Delicious and Gala when the primer set used for semi-
quantitative RT-PCR was used to amplify genomic gene fi'agments (Figure 13).

Protein phosphatase 2C which dephosphorylates phosphoserine and
phosphothreonine was also isolated in the Red Delicious SSH library. Protein
phosphatase 2C-like sequences identified in Arabidopsis negatively regulate abscisic acid
signaling pathways, a MAP kinase signaling pathway and a receptor-like kinase signaling
pathway (211). Protein phosphatase 2C ESTs have been reported from two different
wheat infection-response cDNA libraries (94, 132). In addition, Sanchez-Torres and
Gonzalez-Candelas isolated a differentially expressed PP2C homologue from Penicillium
expansum-infected Golden Delicious fruit (218). In this study, the Red Delicious EST
was homologous to a Mesembryanthemum crystallinum PP2C that was cloned from roots
under salt stress. M. crystallinum has a large family of PP2C-like proteins that are
involved in salt and drought stress signaling and developmental cues (167). This study
now highlights the potential for a disease responsive PP2C in apple leaves, possibly
turning off a signaling pathway that is not needed during a defense response. When
comparing PP2C expression levels, Red Delicious only had a higher abundance of PP2C
transcript compared to Fuji, whereas expression levels in Empire were the same to only
slightly lower than Red Delicious (Table 12, Figure 12). Since the levels of PP2C in
Empire are similar to Red Delicious it is likely that the PP2C inherited from the Delicious
parent is contributing to intermediate resistance in Empire. It will be interesting to
determine which protein(s) this PP2C is dephosphorylating in response to E. amylovora

infection.

143

Another gene of interest fiom the SSH library is a heat shock factor, hsz. This
EST was found also to be induced (Table 10) and upregulated in Red Delicious when
compared to Empire (Table 11) and Fuji (Table 12). Further confirmation with semi-
quantitative RT-PCR showed a higher accumulation of 12sz transcript in Red Delicious
compared to Fuji at 12 and 24 hours and a slightly higher accumulation of transcript
when compared to Empire at 6, 12, and 24 hours. The Hsf8 protein belongs to the class
A heat shock factor family that acts as transcriptional activators, and was identified as the
main initial heat stress regulator in tomato (LpHszl) (164). Although the main function
of the LpHszl protein is to modulate the response to increased temperatures, no other
main regulator of heat stress has been discovered for other plant species (166). Even
though the Red Delicious EST has homology to the major thermotolerance regulator for
L. peruvianum, other related heat shock factors from Arabidopsis respond to bacterial
infection (164). This transcription factor could potentially be responsible for enhancing
further transcriptional responses of genes carrying heat shock elements in their promoter
areas upon recognition of E. amylovora.

Overall, this SSH library was significant in highlighting genes other than the
typical genes associated with the apple response to E. amylovora. Previous studies have
focused on E. amylovora resistance by identifying resistance gene analogues (RGAs) and
quantitative trait loci (QTLs) and by monitoring the induction of antioxidant genes,
phenylpropanoid genes and pathogenesis-related genes (31, 41, 42, 153, 249). One study
of upregulated genes in Gala in response to E. amylovora infection reported genes from
unenriched and enriched (SSH library) pools of EST clones (30). While useful for

determining the response of a susceptible host to E. amylovora, this study did not

144

highlight potential resistance-related genes because of the susceptibility of the Gala
cultivar.

In the previously constructed Gala SSH library by another group, two genes
identified corresponded with upregulated genes in Red Delicious during infection:
myosin heavy chain and an oxygen evolving complex subunit (30). In order for these
genes to be identified in this Red Delicious SSH library, the levels of both transcripts
were higher in Red Delicious between 6 and 72 hpi compared to that of Gala. However,
the contribution of myosin heavy chain to resistance was discounted based on the relative
levels of expression for Red Delicious compared to Empire and Fuji; namely that the
levels of expression in both cultivars were near equal to that of Red Delicious (data not
shown). The contribution of the oxygen evolving complex subunit to the resistance
response will require further characterization; it appears to be a higher expressed gene in
Red Delicious and Empire and induced in Fuji. Perhaps the higher expression levels at
time zero for Red Delicious and Empire help to mount a faster oxidative burst compared
to that of Fuji (Table 11).

A major QTL for E. amylovora resistance has been discovered in apple using the
cultivars Fiesta, Discovery and Prima. The major QTL was found on linkage group
seven, with no known RGAs mapped near this QTL, thus lowering the chances that the
major determinant of E. amylovora resistance is based on a classic nucleotide binding site
(NBS) resistance gene (41). Linkage group 16 also appeared multiple times in
statistically determined interactions, and the area of this linkage group implicating in the
interactions co-localizes with a Mal 1 d gene cluster (41, 78). There was one Mal l d

isoform identified in the Red Delicious SSH library, and it was expressed higher in Red

145

Delicious when compared to Empire and is also represented in the Mdfb EST library
(Table 12). Considering this and the implication of Mal l (1 genes being involved in an
additive effect for E. amylovora resistance, this is a good candidate gene for resistance as
well as the aforementioned signaling-related genes.

In summary, this Red Delicious SSH library was successful in identifying new
candidate resistance-related genes from the moderately resistant cultivar Red Delicious
responding to E. amylovora infection. This library was significant both in the genes
identified and also from those not included such as RGAs, oxidative stress genes and the
majority of the PR genes. Three signaling-related genes were highlighted for their high
level of expression compared to cultivars with varying resistance using both a cDNA
macroarray and semi-quantitative RT-PCR. Further functional characterization of these
genes will shed new light on signaling cascades that lead to a successfirl resistance
response and the identification of up and downstream protein interactors. Furthermore,
the genes identified in this study could be mapped onto linkage maps of apple to
determine their proximity to previously identified QTLs, as well as the conversion of
these ESTs into useful molecular markers for use in marker assisted selection of E.

amylovora resistance in apple breeding projects.

146

 

- - - 958 SE oz EUmOOm

- - - 958 SE 02 mommowm

- - - 958 SE oz commoom

- - - ESE SE 02 dommoum

- - - ESE SE oz dc<moom

- - - 958 SE 02 dozdoom

- - - 958 SE oz Sodom;

- - - ESE SE oz 896va

- - - 258 SE oz voodoom

- - - ESE SE oz Smdoom

- - - 958 SE oz :deom

X - - - 3.8.“ SE oz donOOm
m - - - was.“ SE oz woodoom
N - - - 288 SE oz moUdOOM
m - - - case SE 02 doudcom
M - - - 258 SE oz Sodoox
- - - ESE SE oz :mNOOM

- - - 2:8,. SE 02 d ENOOM

- - - 958 SE e2 8500”—

- - - ESE SE oz 298%

- - - 958 SE oz :9me

- - - cane SE oz 80—09—

- - - 958 SE oz mom—00M

- - - 958 SE oz mom—00m

- - - 283 SE oz dam—8m

- - - 256.. SE 02 858%

- - - 956.. SE oz 830va
o=_m>-m 88m :m 5895 x: “mom Ema—m Hmm

 

.EQSKEQ .M 53» coax—soocm coca «:5 can £56on BM

855—3 03% 05 88a Econ <Zflo wcuombnsm .3 389588 ESE: :mm 5 Eat mhmm @8538 mo 3: 303800 .3 mam»;

147

 

:28: a: a5:2: 33:58: - Saga: 8 52882885 __.a3$o<<_:m_;w:$w~_a 805::
3:? SN E5888 33.: 3 see: 285.: 82:58: ESE __.mzovmgfigdvaowvma: 8050:
demo: 8: was: mseuaaeaa see: :60 3:48:23»: 582:: 8050:
tuned a €8a-§:_8 8:895 Ea... are 322%: __.aRmE<<_:w_§~mz a: 805::
2:3 :3 282:2: 38:38:: see: gaggeaaeo: xm: _:.S::E<<_::_8:m3~_a 2:60.:
mums: :2 33:5: 85: 522: Backstage»: _Ema_o<<_:w_8§mmm_a :98:
8:3 :8 raga: afififii £28: 855:: _..:a~o~2<<_:w_m833~_a 2:50:
8:3 8 €35.88 gangs»: 88: 83:85: 353:»: __.c8$<<o_:§_$mom:_a 8:50:
2:3 Q 5%,: 38:32: :38: 332%: Smog:umz:2_m$$§_a 8:59:
3:3 N: 5%.: 38:35: 522: 2:5: 8:2 ”2238:2852: _:.Ev~o<<_:w_8w~m~m__w 8:60:
2:3 we. :83“: 3:832: §<0S8m§oem5 _:.o:~av%<<_:m_85§£a 8:50:
3-3: S _ Hausa: 38:38: .268: :22: 883:: __.o$8m<m_.3:_$~§2 a: 8:50:
8:3 2: @2558 x 2:3,: mm: 82:: __.:~R8<<_:w_o§ma~__w 8:50:
2:3 4: Hazewééao 8:895 «Ea «sea :28: .5225 __.wm8$i:x:a_ 538% 238:
8:3 :A 33:: SE 522: 3:88.: mesa: __.a88m<<_:m_ _ 8224:: :58:
came: 5 Esaéfia _:vmgSimxcei838:: 2300:
883:0 «>35: «Nb—2 £553 1: 6353830.: Saunas—waxed PEEP:
87:3 3m 5:888 __.mmoflimfigsmemia 2260:
x SEE): Evans—05c =3: 03% mag: @0883: 3:533: £085
:18: NS 75:5: bananas: _ 53:5: __.mmcwaz<<_:w_m8§-_a 8500:
8:3 mm Esoaééao 8:33 a6:... 8:0: ~35ng _:mmnmovdxcgoodsaoaa 8500:
Mama.— :N 328:: 23:an aaofixoa: ES mwm<<_:w_~§€~m_a 8300:
8-:o.~ a mafia: 38:32: .533: _:.mm8:2<<_:w_83m2~_a 3:.50:
8:3 mm zaaeméfia 822:: gas «are. :28: Ease: _Ensefimxcgfiew88:: 8500:
- - - :5: :2 oz 2080:
- - - :55: :2 oz 808::
- - - :55: a: 0z 8080:
- - - :55: 9:: :2 8:89.
- - - :55: :3 oz Samoa:
o:_:>-m 22% :m 5085 a: Smom scam—m Hmm

 

9.83 E 39:.

148

 

2:3 :: 355:: 5:55.52: __.~mm:::<<_::_~:: 5:5 3:55:
528: w£=_S=Oo-£mEov 3:33-528: 0:28—23 028030
5:3 3 2:55.525 8:55: 5:5 5:5: 3:2 55:52:52 _:.::~Gm<:_5:_:3:3__: 8:50:
3:3 3:: 55:5: 555.55: 9:55: .555 :25: 55:2 5835-35:39521:: _ :60:
5:3 8: 5:55:55 58:55:83: 555:: 555:: 5555: :3 _ 33055555815 2:63
2:3 N: 55:5: 55:55: 555:: 522: 5555: __.m::o:<:_5:_o::m:~:_:: 8:60:
5:3 3: 55:5: 55:55:: 558: 55.55555: 50.55555: __.:§:2<<_::_:::~::3:: 5:50:
8:3 3: 2:55-555: 8555.: _:553355533525 8:50:
«>3: «NCOH mica 5:85 3532 52:03:: 0383335 03:35.:

2 7:3 8: 55:5: 555.52: 555:: 5555: _:.o:~$o<:_.5:_o:3:3_5 8: _ 00:
3:3 :: 7555.5 55:552. 3:32 558: 5:555: _:3333;553:5315 8:65:
2:3 5 2:55.555 8:55.: 5,5: 5:5: 555:: 53555: _:.:NS::::2_:2_:E:3_5 3:60:
3:3 :2 55:5: 55:55: 555:: 35558555: m: _m.32:_|:z:2_:2::8:_: 8:50:
55:3 3: 55:5: 5:55:53 :5: 555:: 555: :85 :5: 355: __.::::::<<_::_3:82_:: :98:
5:3 :3 55:5: 5:555: 55:5: 535.585 __.~§:2<<_::_ 533:: 8:50:

:5: 55:38 55:5: 5555:: 5:5: 555:0 552: 3-:
5:3 3 2:58: _:.S§:l:z:2_5283_5 8:60:
-5323 8qu:3 «>3: «BCE _ 0:555»: 058:? 2252.: 03.8.5
8:3 5: H 55:5: 5:55:53 3:55: 555:5: 5555:: e 55:55 553 __.::S::<o_553:§_5 898:
3:3 3 55.55: 55:: 2:3 555:: :55:-5§< __.::83<<_::_::::8_:: 8:50:
3:3 .3 355.5555 __.:8o$s:x:e_3:§:__: 8900:
8583.0 «>3: 3&0“ 530:: 353.: 5508an 8532-55,: 338?:
2:3 :5 55:5: 55:52: 555:: 552:5: __.:o~$2<<_::_:2:5 : :5 3:80:
8:: .m R 8555:5555: 5:552:53 __.o::.:8u:>:2_:m:o::~m_:: 8:50:
5:3 3 55:5: 55:55: :32: 2:855 55:5 55: :.:3::<<_::_::R§m__: 8:59:
3:3 5: 55:5: 55553 352555555555 33:89:55. 2: 23:: 206::
-Z 255:: :3:— ::::owzxo\o::_>xo€:o 25:98:35 m.~-o:o_:£m
5:3 3 35:5: 5:55:23 555: 552: 2:55: 33235555: : 8:: 588::
5:3 3 555558 55:: 3 555:: 5:555 55:55: 55:: _:.§o:.:<:_.5:_:m3§_5 5050:
03.9fm 0.50m “mm 5805 um: «mom Ema—m Hmm

 

:58: S :52:

149

 

:18: :2 55:3: 3:832: 338: 33°53: :az No:<<_::_mmw _ 35:: 8:60:
6:3 a: 2:85.53? 538:5: 5:55 5302 83:8: 0.20m 3:53: __.83:_:-:z:2_:8m§m__w 8:60:
87:3 8: 535.: 35:53:23 .535 5::5 332: 33:38-: 5:55:56 __.§_om<m_3:_%:m:~:_5 .260:
6:3 mm: 35:3: E:§:EE 5533:: __.t E§<<zm§oms§w 8300:
2:3 mm: 3555 355:. 338: EBB-:5 :28520 _:.m:$~<<:_.3:_~$§~_5 32:00:
6:3 N: 55:3: 3:63:55 328: wags-<2: :25»? 3:33: _fiafivzizgafiwema 32:00:
8-8.: e: 35:55 33:35.58: 332: 2:33: __.::§m<0_:eo_:~mm$:__m 3300:
6:3 :2 35:3, :33 35:3, 35:. a: 3.93: __.:m§~0<0_:§_:8$85: 32:00:
8-8.: 3 E86528 538:5: 5:55 5300. 338: 5233:: _:.Emm$.:x:e_::238:3 3260:
87:3 8: 55:3: E:§:EE 83.: 332: 363:: __:::~6<:_.3:_~::SEN__: N360:
£38.: 3 5:33: 3:53:53 332: 3:2 mm 338: 33855-33383: :: :82<<_::_Smm% 3:: 8:60:
2:3 5 55:3: 33:35:38: 8332: __.~§w><<_::_$:58m_5 8:60:
~28: NR 5333: 885:: 53.3 0:39:82 55:2 53.0383 :95 5632:3221: 8:60:
2:3 :3 335:3 3:9: _ 322: 3:53.55 35:6 5: __.§~:0<<_:w_:83:m_5 8:60:
:33: :2 55:3: 3§§EE 332: 832:3: __.::§m<<_:w_:~:mt€_5 2060:
$38.: 8: 535:5 335:: 9:: 53:: 338: :dwmguézegmosvg _ :w 8060:
$-32 EN 2:85-5:55 538:5: _2333-33222«8:5 8060:
«>33 «ECO: omfiommngSmog—w anoagbwnomgfiwiaD 033:5—
S-mo.~ :2 35:3: 3.3%:323 2:34: mm 332: 353-55 HE:- __.:N:_ m:<<_::_m§:8m__w 8060:
3:3 8: 55:3: 33:83:35 2:53: 55535:: <2: 5::5:%-<z: __._:~:E<<_:w_~mmwkw__m 8060:
6:3 :3 5:525 35:82: 3323:8528: < 9:: __.§$<<0_:§_§e_5 8060:
:38: SN 33:3 5.33:: 332: : __.:8€<<0_:§_RBN__: 8060:
:15: a: 3522: 33358882: < 53.58%: _:.vao:<<_::_~§8:m_a 2:60:
8:3: mm 2:85-53:25 538:5: 3:55 5300: N 332: 3:55.363 3:53: __.n:~:2.:x:2_%%:§_a 2:60:
6:3: 2 35:3: 35:55.52: 3:55: __.v§:2<<_:w_:_ 33%: or: 00:
2:3 8 :33: 85:0: 6:56 5382: 5385::V .m 3.35: zm>0mnm::_::wv:0_:5_$83353 8:60:
«maps: 2: 35:3: 3:53:25 332: 5.8.3:: __.8Rm:<<_::_::mm~8m__w 8:60:
82:3: 3 35:25 5335:5550: _~.mn~w6<<_:m_§2:£_a 8:60:
a 88.6% .mh 5803 5805 wagon-EgovAzotéEv-ofi—3.3-S
025?: 88m :m :38: :m 5:: 53:: 5mm

 

ch80 3 3:5

150

 

RE: 2 N :.8 Dig wéawacovésgfi 2 3:86 __.o8mwo<<_nm_2 33%» a888,:
3m? 2: 33:2. 3332 5 508a 565?: __._§E<<3w_33om~m__w ”883
2.8a 3 :gaoaééao 8633 E5 3&2 __.EfioéfigwflSana 2589.
5205 53:85 888$ ems. 8.3.58 own—$3.80 83%0:%B-8£3.&
Rama.” 0: 3&3. E8383 __.8m:2<<3w_m:%8~__m @389.
FEES: 3283353 :553 boas—smog 088885 mom gang—S
8.9: § 22235 9.23323 52.5 38052:: __.wfio8<<_nw_mmm§~__a 8m88m
3m: 3 E88558 8:23 2.3 «So. 2.8m83m __68832:»;Navawxzm 888m
22%.". 3 7022350: 3.38 x sang Samoa 522.. Béameéxé :s _ S~2<<3w§§ 8% 882
3-9% SN 78.: 8329 a 7:985 55-8%: :awmgmig _ E53 2989.
3m? m: 5335 E83353 Sum __.w$8m<m_.§_8$o8_a 8383
«33 E H3855 x «Saga umeoefi efiqsfiaofi __.:8£<<_nw_88§__w 2583
$-92 as $2.55: m_.o§__§m_ :.§m8<o_n§_ _ 323% £589.
omfioumcmbfimfiufi 3x328 Eon 330:8“osfiomfioEJ-—>mocoua-m
3-9: § 233.528 :égvdxcgmgmcgna nan—88m
8:830 «>33 «NOE 83.5“ Read wauhamagioaoo 933:5
~33 we 5&5 image: 2.552. .882 £38m _..Savmdzce_w$§cm__m x589.
283 g 33:2: EQQEEE €35-53 30mm 52.5 Eaves. 8.3.5 __.3m_vz<<3w_wn8m$~__m 8983
3&3 S Eggs Engage: seen 3.5 8n 022 265E :.§$‘_<<_nw_m§§$ 5m 8983
~33 8m .8235 383%ng aeoa 925:: __.;$§<<_aw_o8§2__m :08me
8-8.» 3 H283 __.§c~2<<_nw_§$3~__m 2088a
$383353 328:9 £553 «9— mm Santana 3:»? 358832
sum: :2 75:2: $3383 .885 538a 8685 __.8§m<m_.§_ 832% 8083
3.3. 2: Face 2&2 52% manage“ 3.8820 E 25 =05 __.R§8<<_nw_8§§_m 8088a
3mg SN 838 86:8. 852%,..3 22 :62: ~<<o_n§_m§ $9» 3083
:-mo.~ : 35:2. Engage: Ease: __.So32<<_nm_m8§_~_a N583
guns... 2 m Egg Eggs: aeoa gases :éw 32<<3wam$m _ 8:» c583
o~-mo.~ z: 33:2: E88323 cease: _aomfiozfizmgomszzw 2588a
Smog we 75888 3525 .5225 __.m88m<o_n§_wo~_~£__w 2583
91m? 2: _§=§ 383383 528a 08883 522m :3: azizmagammzm 2589.
03.38 88m :m 532m a: ~QO 535 Em

 

c.83 E 339

151

 

 

8:: m: @0585: x was): 6332: :32: 5:5: 2:5 __.§c::.<<_::_::::€%__w 2288:
2:3 m: 33: «583:: c: :32: 805.30: :3: _ m:<<_::_::§$__w 3:88:
m :3 R 333: 88:32: 528: 32:53:: __.§m~8<<_:w_m :58: 2288:
3-8.: mm: 3:35 3:835: 528: :5389598: 23 :222-3853321: 8<88:
8:3 :2 3:388 __.R:::<<8_:§_~32v_a 2:88:
: EEEH 8:28: omaqowxxobmflzxofiao oafimmosmmBfimeo—nna
5:3 3: 3E3: 25:: 3:6: 55:8“: 83:: 2.3.3:: __.N2:~2<<_::_m~:$2~__w 8:88:
2:3 mm: 3:: $832: 3:: 522: ::_-m-:m8 __._:n$z<<_::_ _ : 52:3 8:88:
5:3 :2 Ease 38:32: :38: 3353:: :3: _ 8:23:22 2:: 8:88:
8:3 mm @335 ESE_.:zc2_mR$§3 3:88:
$38355 5288 33:: N 88:.“ 83:25 nova—:53 839683”:
3:3 2: 333: E8333 see: 05:32:-8: 22:8::§-v .m ._ 3:8: 3:2 _::<8_:§_§$fi3 8:88:
:35: 5 33:5 38:52:: :32: 30358:: ::_£:__::_o§$mm__w 8:88:
3:3. :2 _§=§ E3323 92:: :32: 3:83: :2. __.m882<<_::_:::82N3 :888:
: 7:3 3 33:3: £38.52: - 8.8: r: 528: 38:53:: __.:::~::<8_:§_§:~m:_a 8888:
8:; :m Ezewééso “2.5%.: «>3: 88. 3:23.: 38:85:828 :.:::::.:x::: $383 8888:
3:3. :2 .828 «BEBE 83:28: 25:3 __.3:£8<83§_m822:3 8888:
2:9: 3 5:3: 3:832: 033:: 632:9: <2: 3E8 __...:§2<<_::_m§:2~__: 8888:
8:2 :2 335.88 8:30:83: 528: 8:8 :35: 8:382 3:: 93m __::~v:<<8_:§_8%£_w 8888:
2:3 o: 2 :33: 38:35:: 522: 5E8 2,38: __.N2:o:<<_::_:82:2_:: 2:88:
8:3 :2 78:3: 883:8: 2,35: .88.: \ Bass: .528: 032:8: :2 53:23.3:388: 3:88:
8:9: mm :33. 838:: 52:2: 8388:: __.::2:<<8_:eo_mm§v_a 8:88:
9:9: E 238:.328 83:6 __.Nm:m$u:xce_:~:3:o:__: 8:88:
26:: «NEE “3.5:: 093 omfiflgnou own—83888:: 038:5
3:3 :2 .8328: x 332. m u a: 528: 5:88: 2:: E: 5:53 8.32 _2.:3o::<<_::_:n::m:Om__w 8:88:
8:8 :m 5:3: 38:52: 3:222 __.::$~:<<_::_: 383:: 8:88:
8:3 2: $535 E§E€i 23:: .0828: :3: :s _ 8:2<<_::_§8:~__: 8:88:
2:3 :2 2:85-383: 838:3 23 88: 2.5:: 3:38:45: 23:: __._ S:$::xce_:-2:ow_:: 2:88:
3:9: :2 73:: €388: ::8 __.m28<<:_.3:_:8m$__: ::88:
8:3 :2 $8.22: 385:: 8:38.: 52:82:: .: 33:: 22:83: 2:882 85-8958:83:88:: 2:88:
83,: 28m 2: 582: z: :8: 5:2: .5:

 

283 E 55?

152

153

 

91mg 5 32505 506. seen 83682 223222 __338638323.2% £589.
248.. a 78235 3&3?ng £085 832me Wag.lazceafimocomzm Smmoom
3m? 9: Ezewééa 8233 9.58 SEE 2 among 338% 255.5 __.Somcvdxcefosgna 8309.
mn-mo.~ 2N H8235 fiafifii 8.2%? __.omwomo<<_nw_838§w Emmoom
3-mo.~ 5 ~ m .2235 Emosfii seen .532: :32 n2<<zw§8nga mommoom
Samoa. 8. Ease 33:38: _2Eezfizgefimflmzw SE09.
£88m omEoEOmtomnaochEoc 2805306»: 809m 3.58:3”
3&3 2: .2235 ”€838: seen 3:5 32553855 :2 somdzceiozvfifi 8989.
:vmos as 5235 3&3?ka seen 8329a. __.o8~3<<_pw_we~8mm__w Mammog—
:_-mo._ 3.. Ease E§§E3 383.358 8.35.30 3:35 __.mnm~vo<m_.3c_§8m$~_a 8303
3.8.» w _ m 3:858 x 332. 9:2 w 32 __.~88m<<_nm_~3m~m§_m 8309.
NE: SN 5&2. ”snags: w 5 52% 3:88: m8 963.5 _Smsa<<zwzm§$=w 258cm
ow-mo.~ c2 52% aafises £55 2 8:2.QO use? __.wm25<<_nw_§$~v_a 8980a
3m? SN .8335 afififii Ease: :dmoszfizwismm ~ mm 8089.
8-3; mg Engage; 93825 €53 m 3:3 <za __.m§om<<_pw_m8:8m__w 8089—
mw-mo.~ Sm Egg ”Eggs: seen 3:53 __.wam~§<u_n§_$m£mz__w 8080:
NEE 3 25:2. ”Eggs: 32-53% 85808 $259332 __.e8_cm<m_.§_m8§8__m 808mm
3mg 2: Ezewéfie 8E8“: :dsmmamgémflmna 8089a
«>33 «EOE mica 580a 3558 833:2 ougmuaocao 3.58.5

3-3m 0% was 8339 035 E Swoaaaeaeem _fl.wvm§<<m_§_wc$wmv__w N883
~53 E 52.3 Emfifii m 38: £78382 asaowobnau £28m _<E8§<<3§§RE§ 8089.
a £3 E. Esaééso 825%: is 3&2 8222.2E 3:93 _280%.;chRagga ammo?—
2-mo._ ma EsoaéEEo 8335 $.58 «58 538““ gases :éooémzfimgtomem 2582
$4.3. 8N Esazsmbu genesbneaué 3.88: UN assasfl 538m :2: Sigmsogw @883
Sana.» 8 75:2: gauze: 522a .aouoao&m _aflfieofizwfwozia Samoan
:-mc.m E 332:8 x 33): 508a yawac‘ _fiaflfifizmgwmmifi 8309.
8-3a g 33:2: fi§§2$ 8:33 _~.mmma:<<_nw_$£~wmw_a 2289—
8-8; 3 78235 3%353 3:33 63038.38: _3&3fimzceamSNNn—zw @389.
”33 N2 332 x “saga Edam __5353955:8me 2283
8:32". 28m :m £22m a: mom 535 BE

 

9.83 3 BB?

 

 

3:3 :2 €385 «5:822: : . §€<<us§§§gw 8:88:
: 58388:“— .«0 vac—9:8 9.328.883 no nutmeg—on «a mm

m :3 E 3:3 are 5.382: 522:8»: 38%: 2:35 __.Eacvdxcezaomaoaa 8:80:
: _:o._ 3 €258“ 328 528: my: 253:: :3 afimézeortwofizm 8:80:
2-8: :N :39: E338: 3:82 .588: is: 3:: 3:35 __.§~3<<_:m_§momm~__w 8880:
E _:o._ m _ v 32% 85:: 8 522: :85 so: __.8m$z<<_:m_%§$~_a 8088:
87:3 m3 €333 85:32: <3 see: .9885 __.mm$8<<_nw_m§§m_a 3088:
2:3 SN 723:2: £332: 532.. is: wanes 38> __.o~w8n-:zce_m~§§Em N880:
_m:o.N E 8: SE“: - Base: E can 522: ”53.59% =E§ozo 2:22: :vofiziammmvfizw 8088:
3:3 :8 32855 owseoé _ £3888 __.8~;2<<_&_£~m§ a: 2:88:
2:3 a 3:35 E§§E$ 20% 88:23:»: oasameaoésa z.§$E<<zwa~§2~=w 8:88:
8:3 2 7:3: essguuqs 32.5050 .852 :2: m5<<3w§~mwkm=w 8:88:
8:3 3 :33. «who: 3:23: 2:55 _.éfiovdxceagsaomzw 8:80:
3:3 9: 38.5888 x 33E see: oééaoéésoz :33883: 3 332:: 8:80:
2:3 5 H822: Engage: 528: .5052: __.%:.3<<_:m_m§;2__w 8:80:
3:3 mm 33% Engage: see: ea-asafisfimzésoe: __._882<<3m5822~=w 8: 80:
83>: 28m a: £88: a: .8: 52:: pm:

 

Argos E 339

154

10.

REFERENCES

Aarts, M. G. M., B. te Lintel Hekkert, E. Holub, J. L. Beynon, W. J.
Stiekema, and A. Pereira. 1998. Identification of R-gene homologous DNA
fragments genetically linked to disease resistance loci in Arabidopsis thaliana.
Mol. Plant-Microbe. Interact. 11 :25 1-258.

Aldridge, P., F. Bernhard, P. Bugert, D. L. Coplin, and K. Geider. 1998.
Characterization of a gene locus from Erwinia amylovora with regulatory

functions in exopolysaccharide synthesis of Erwinia spp. Can. J. Microbiol.
44:657-666.

Aldridge, P., M. Metzger, and K. Geider. 1997. Genetics of sorbitol
metabolism in Erwinia amylovora and its influence on bacterial virulence. Mol.
Gen. Genet. 256:611-619.

Alexeyev, M. F. 1995. Three kanamycin resistance gene cassettes with different
polylinkers. Biotechniques 18:52-54.

Alfano, J. R., and A. Collmer. 2004. Type HI secretion system effector proteins:
double agents in bacterial disease and plant defense. Annu. Rev. Phytopathol.
42:385-414.

Ali, G. S., V. S. Reddy, P. B. Lindgren, J. L. Jakobek, and A. S. N. Reddy.
2003. Differential expression of genes encoding calmodulin-binding proteins in

response to bacterial pathogens and inducers of defense responses. Plant. Mol.
Biol. 51:803-815.

Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller,
and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs. Nucleic Acids Res. 25:3389-3402.

Angelichio, M. J ., and A. Carnilli. 2002.112 viva expression technology. Infect.
Immun. 70:6518-6523.

Arrieta, J. G., M. Sotolongo, C. Menendez, D. Alfonso, L. E. Trujillo, M.
Soto, R. Ramirez, and L. Hernandez. 2004. A type H protein secretory pathway

required for levansucrase secretion by Gluconacetobacter diazotrophicus. J.
Bacteriol. 186:5031-9.

Asamizu, E., Y. N akamura, S. Sato, and S. Tabata. 2004. Characteristics of the
Lotus japonicus gene repertoire deduced from large-scale expressed sequence tag
(EST) analysis. Plant. Mol. Biol. 54:405-414.

155

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

Ayers, A. R., S. B. Ayers, and R. N. Goodman. 1979. Extracellular
polysaccharide of Erwinia amylovora: a correlation with virulence. Appl.
Environ. Microbiol. 38:659-666.

Ayliffe, M. A., and E. S. Lagudah. 2004. Molecular genetics of disease
resistance in cereals. Annal. Bot. 94:765-773.

Baker, B., P. Zambryski, B. Staskawicz, and S. P. Dinesh-Kumar. 1997.
Signaling in plant-microbe interactions. Science 276:726-33.

Baldi, P., A. Patocchi, E. Zini, C. Toller, R. Velasco, and M. Komjanc. 2004.
Cloning and linkage mapping of resistance gene homologues in apple. Theor.
Appl. Genet. 109:231-9.

Bartoleschi, C., M. C. Pardini, C. Scaringi, M. C. Martino, C. Pazzani, and
M. L. Bernardini. 2002. Selection of Shigellaflexneri candidate virulence genes

specifically induced in bacteria resident in host cell cytoplasm. Cell. Microbiol.
4:61 3 -626.

Bayot, R. G., and S. M. Ries. 1986. Role of motility in apple blossom infection
by Erwinia amylovora and studies of fire blight control with attractant and
repellent compounds. Phytopathology 76:441-445.

Bell, K. S., M. Sebaihia, L. Pritchard, M. T. G. Holden, L. J. Hyman, M. C.
Holeva, N. R. Thomson, S. D. Bentley, L. J. C. Churcher, K. Mungall, R.
Atkin, N. Bason, K. Brooks, T. Chillingworth, K. Clark, J. Doggett, A.
Fraser, Z. Hance, H. Hauser, K. J agels, S. Moule, H. Norbertczak, D.
Ormond, C. Price, M. A. Quail, M. Sanders, D. Walker, S. Whitehead, G. P.
C. Salmond, P. R. J. Birch, J. Parkhill, and I. K. Toth. 2004. Genome
sequence of the enterobacterial phytopatho gen Erwinia carotovora subsp

atroseptica and characterization of virulence factors. Proc. Natl. Acad. Sci. USA
101:11105-11110.

Bellemann, P., and K. Geider. 1992. Localization of transposon insertions in

pathogenicity mutants of Erwinia amylovora and their biochemical
characterization. J. Gen. Microbiol. 138:931-940.

Bereswill, S., and K. Geider. 1997. Characterization of the rcsB gene from
Erwinia amylovora and its influence on exopolysaccharide synthesis and
virulence of the fire blight pathogen. J. Bacteriol. 179:1354-1361.

Bereswill, S., S. Jock, P. Aldridge, J. D. Janse, and K. Geider. 1997. Molecular

characterization of natural Erwinia amylovora strains deficient in levan synthesis.
Physiol. Mol. Plant Pathol. 51:215-225.

156

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

Bernhard, F., D. L. Coplin, and K. Geider. 1993. A gene cluster for
amylovoran synthesis in Erwinia amylovora: characterization and relationship to
cps genes in Erwinia sterwartii. Mol. Gen. Gene.t 239:158-168.

Bernhard, F., K. Poetter, K. Geider, and D. L. Coplin. 1990. The rcsA gene
fi'om Erwinia amylovora - identification, nucleotide sequence, and regulation of
exopolysaccharide biosynthesis. Mo]. Plant—Microbe Interact. 3:429-43 7.

Beuning, L., J. Bowen, H. Persson, D. Barraclough, S. Bulley, and E. Macrae.
2004. Characterisation of Mal d 1-re1ated genes in Malus. Plant Mol. Biol.
55:369-88.

Boch, J., V. Joardar, L. Gao, T. L. Robertson, M. Lim, and B. N. Kunkel.
2002. Identification of Pseudomonas syringae pv. tomato genes induced during
infection of Arabidopsis thaliana. Mol. Microbiol. 44:73-88.

Bogdanove, A. J., D. W. Bauer, and S. V. Beer. 1998. Erwinia amylovora
secretes DspE, a pathogenicity factor and fimctional Aer homolog, through the
hip (type III secretion) pathway. J. Bacteriol. 180:2244-2247.

Bogdanove, A. J., J. F. Kim, Z. M. Wei, P. Kolchinsky, A. O. Charkowski, A.
K. Conlin, A. Collmer, and S. V. Beer. 1998. Homology and functional
similarity of an hrp-linked pathogenicity locus, dspEF, of Erwinia amylovora and

the avirulence locus aer of Pseudomonas syringae pathovar tomato. Proc. Natl.
Acad. Sci. USA 95:1325-1330.

Bogdanove, A. J., Z. M. Wei, L. P. Zhao, and S. V. Beer. 1996. Erwinia
amylovora secretes harpin via a type III pathway and contains a homolog of yopN
of Yersinia spp. J. Bacteriol. 178:1720—1730.

Bogs, J., I. Bruchmuller, C. Erbar, and K. Geider. 1998. Colonization of host
plants by the fire blight pathogen Erwinia amylovora marked with genes for
bioluminescence and fluorescence. Phytopathology 88:416-421.

Bogs, J., and K. Geider. 2000. Molecular analysis of sucrose metabolism of

Erwinia amylovora and influence on bacterial virulence. J. Bacteriol. 182:5351-
5358.

Bonasera, J. M., and S. V. Beer. 2002. Gene Expression in apple in response to
inoculation with Erwinia amylovora. Acta Hort. 590:469-475.

Bonasera, J. M., J. F. Kim, and S. V. Beer. 2006. PR genes of apple:

identification and expression in response to elicitors and inoculation with Erwin ia
amylovora. BMC Plant Biol. 6:23-35.

157

32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

42.

Bonn, W. G., and T. Van der Zwet. 2000. Distribution and economic
importance of fire blight, p. 37-53. In J. L. Vanneste (ed.), Fire Blight: the disease
and its causitive agent, Erwinia amylovora. CABI Publishing, New York.

Botella, M. A., M. J. Coleman, D. E. Hughes, M. T. Nishimura, J. D. G.
Jones, and S. C. Somerville. 1997. Map positions of 47 Arabidopsis sequences
with sequence similarity to disease resistance genes. Plant J. 12:1197-1211.

Bouley, J., G. Condemine, and V. E. Shevchik. 2001. The PDZ domain of OutC
and the N-terminal region of OutD determine the secretion specificity of the type
H out pathway of Erwinia chrysanthemi. J. Mol. Biol. 308:205-219.

Brisset, M. N., S. Cesbron, S. V. Thomson, and J. P. Paulin. 2000.
Acibenzolar-S-methyl induces the accumulation of defense— related enzymes in
apple and protects from fire blight. Eur. J. Plant Pathol. 106:529-536.

Brown, D. G., and C. Allen. 2004. Ralstonia solanacearum genes induced
during growth in tomato: an inside view of bacterial wilt. Mol. Microbiol.
53:1641-1660.

Brueggeman, R., N. Rostoks, D. Kudrna, A. Kilian, F. Han, J. Chen, A.
Druka, B. Steffenson, and A. Kleinhofs. 2002. The barley stem rust-resistance

gene Rpgl is a novel disease-resistance gene with homology to receptor kinases.
Proc. Natl. Acad. Sci. USA 99:9328-9333.

Burse, A., H. Weingart, and M. S. Ullrich. 2004. The phytoalexin-inducible
multidrug efflux pump AcrAB contributes to virulence in the fire blight pathogen,
Erwinia amylovora. Mol. Plant-Microbe Interact. 17:43-54.

Buttner, D., and U. Bonas. 2006. Who comes first? How plant pathogenic
bacteria orchestrate type III secretion. Curr. Op. Microbiol. 9:193-200.

Cabrefiga, J., and E. Montesino. 2005. Analysis of aggressiveness of Erwinia
amylovora using disease-dose and time relationships. Phytopathology 95: 1430-
1437.

Calenge, F., D. Drouet, C. Denance, E. Van de Weg, M. N. Brisset, J. P.
Paulin, and C. E. Durel. 2005. Identification of a major QTL together with
several minor additive or epistatic QTLs for resistance to fire blight in apple in
two related progenies. Theor. Appl. Genet. 11 1: 128-135.

Calenge, F., C. G. Van der Linden, E. Van de Weg, H. J. Schouten, G. Van
Arkel, C. Denance, and C. E. Durel. 2005. Resistance gene analogues identified
through the NBS-profiling method map close to major genes and QTL for disease
resistance in apple. Theor. Appl. Genet. 110:660-8.

158

43.

45.

46.

47.

48.

49.

50.

51.

52.

53.

Camberg, J. L., and M. Sandkvist. 2005. Molecular analysis of the Vibrio
cholerae type II secretion ATPase EpsE. J Bacteriol 187 :249-256.

Cesbron, S., J.-P. Paulin, M. Tharaud, M.-A. Barny, and M.-N. Brisset. 2006.
The alternative sigma factor HrpL negatively modulates the flagellar system in
the phytopathogenic bacterium Erwinia amylovora under hrp-inducing

conditions. FEMS Microbiol. Lett. 257 :221-227.

Chatterjee, A., Y. Y. Cui, H. L. Yang, A. Collmer, J. R. Alfano, and A. K.
Chatterjee. 2003. GacA, the response regulator of a two-component system, acts
as a master regulator in Pseudomonas syringae pv. tomato DC3000 by controlling

regulatory RNA, transcriptional activators, and alternate sigma factors. Mol.
Plant-Microbe Interact. 16:1 106-1 1 17 .

Chaumont, F., M. Moshelion, and M. J. Daniels. 2005. Regulation of plant
aquaporin activity. Biol. Cell 97:749-764.

Cheong, Y. H., H. S. Chang, R. Gupta, X. Wang, T. Zhu, and S. Luan. 2002.
Transcriptional profiling reveals novel interactions between wounding, pathogen,
abiotic stress, and hormonal responses in Arabidopsis. Plant Physiol. 129:661-
677.

Chiou, C. S., and A. L. Jones. 1995. Molecular analysis of high level
streptomycin resistance in Erwinia amylovora. Phytopathology 85:324-328.

Chiou, C. S., and A. L. Jones. 1993. Nucleotide sequence analysis of a
transposon (Tn5393) carrying streptomycin resistance genes in Erwinia
amylovora and other gram-negative bacteria. J. Bacteriol. 175:732-740.

Cianciotto, N. P. 2005. Type H secretion: a protein secretion system for all
seasons. Trends Microbiol. 13:581-588.

Coleman, M., R. Pearce, E. Hitchin, F. Busfield, J. W. Mansfield, and I. S.
Roberts. 1990. Molecular cloning, expression and nucleotide sequence of the
rcsA gene of Erwinia amylovora, encoding a positive regulator of capsule

expression: evidence for a family of related capsule activator proteins. J .Gen.
Microbiol. 136: 1799-1806.

Coligan, J. E., B. M. Dunn, D. W. Speicher, and P. T. Wingfield. 2003. Short
Protocols in Protein Science. John Wiley and Sons, Inc., Indianapolis.

Collins, N., J. Drake, M. Ayliffe, Q. Sun, J. Ellis, S. Hulbert, and T. Pryor.

1999. Molecular characterization of the maize Rpl-D rust resistance haplotype
and its mutants. Plant Cell 11:1365-1376.

159

54.

55.

56.

57.

58.

59.

60.

61.

62.

63.

Daefler, S., I. Guilvout, K. R. Hardie, A. P. Pugsley, and M. Russel. 1997. The
C-terminal domain of the secretin PulD contains the binding site for its cognate
chaperone, PulS, and confers PulS dependence on pIVfI function. Mol. Microbiol.
24:465-475.

Dangl, J. L., and J. D. Jones. 2001. Plant pathogens and integrated defence
responses to infection. Nature 411 :826-33.

Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of
chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl.
Acad. Sci. USA 97 :6640-6645.

DebRoy, S., R. Thilmony, Y. B. Kwack, K. Nomura, and S. Y. He. 2004. A
family of conserved bacterial effectors inhibits salicylic acid-mediated basal

immunity and promotes disease necrosis in plants. Proc. Natl. Acad. Sci. USA
101:9927-9932.

Degenhardt, J., A. N. Al-Masri, S. Kurkcuoglu, I. Szankowski, and A. E.
Gau. 2005. Characterization by suppression subtractive hybridization of
transcripts that are differentially expressed in leaves of apple scab-resistant and
susceptible cultivars of Malus domestica. Mol. Gen. Genomics 273:326-335.

Degenhardt, J ., A. N. Al-Masri, S. Kurkcuoglu, I. Szankowski, and A. E.
Gau. 2005. Characterization by suppression subtractive hybridization of
transcripts that are differentially expressed in leaves of apple scab-resistant and
susceptible cultivars of Malus domestica. Mol. Gen. Genomics 273:326-335.

Dellagi, A., M. N. Brisset, J. P. Paulin, and D. Expert. 1998. Dual role of
desferrioxamine in Erwinia amylovora pathogenicity. Mol. Plant-Microbe
Interact. 11:734-742.

Denny, T. P., B. F. Carney, and M. A. Schell. 1990. Inactivation of multiple
virulence genes reduces the ability of Pseudomonas solanacearum to cause wilt
symptoms. Mol. Plant-Microbe Interact. 3:293-300.

Diatchenko, L., Y. F. C. Lau, A. P. Campbell, A. Chenchik, F. Moqadam, B.
Huang, S. Lukyanav, K. Lukyanav, N. Gurskaya, E. D. Sverdlov, and P. D.
Siebert. 1999. Supression subtractive hybridization: a method for generating
differentially regulated or tissue-specific cDNA probes and libraries. Proc. Natl.
Acad. Sci. USA 93:6025-6030.

Dijkstra, A. J., and W. Keck. 1996. Peptidoglycan as a barrier to transenvelope
transport. J. Bacteriol. 178:5555-5562.

160

64.

65.

66.

67.

68.

69.

70.

71.

72.

73.

74.

75.

Dondini, L., L. Pierantoni, F. Gaiotti, R. Chiodini, S. Tartarini, C. Bazzi, and
S. Sansavini. 2004. Identifying QTLs for fire-blight resistance via a European
pear (Pyms communis L.) genetic linkage map. Mol. Breeding 14:407-418.

Dondini, L., L. Pierantoni, F. Gaiotti, R. Chiodini, S. Tartarini, C. Bazzi, and
S. Sansavini. 2004. Identifying QTLs for fire-blight resistance via a European
pear (Pyrus communis L.) genetic linkage map. Mol. Breeding 14:407-418.

Douce, R., J. Bourguignon, M. Neuburger, and F. Rebeille. 2001. The glycine
decarboxylase system: a fascinating complex. Trends Plant Sci. 6:167-176.

Douet, V., L. Loiseau, F. Barras, and B. Py. 2004. Systematic analysis, by the
yeast two-hybrid, of protein interaction between components of the type H
secretory machinery of Erwinia chrysanthemi. Res. Microbiol. 155:71—75.

Du, Z., and K. Geider. 2002. Characterization of an activator gene upstream of
lsc, involved in levan synthesis of Erwinia amylovora. Physiol. Mol. Plant Pathol.
60:9-17.

Du, Z., V. J akovljevic, H. Salm, and K. Geider. 2004. Creation and genetic
restoration of Erwinia amylovora strains with low levan synthesis. Physiol. Mol.
Plant Pathol. 65:1 15.

Durand, E., A. Bernadac, G. Ball, A. Lazdunski, J. N. Sturgis, and A. Filloux.
2003. Type II protein secretion in Pseudomonas aeruginosa: the pseudopilus is a
multifibrillar and adhesive structure. J. Bacteriol. 185:2749-2758.

Dyrlov Bendtsen, J., H. Nielsen, G. von Heijne, and S. Brunak. 2004.
Improved prediction of signal peptides: SignalP 3.0. J. Mol. Biol. 340:783.

Ericksson, A. R., R. A. Andersson, M. Pirhonen, and E. T. Palva. 1998. Two-
component regulators involved in the global control of virulence in Erwinia
carotovora subsp. carotovora. Mol. Plant-Microbe Interact. 11:743-752.

Expert, D. 1999. Withholding and exchanging iron: interactions between Erwinia
spp. and their plant hosts. Annu. Rev. Phytopathol. 37 :307-334.

Fernandez, D., P. Santos, C. Agostini, M. C. Bon, A. S. Petitot, M. C. Silva, L.
Gerra-Guimaraes, A. Ribeiro, X. Argout, and M. Nicole. 2004. Coffee (Cofiea
arabica L.) genes early expressed during infectio by the rust fungus (Hemileia
vastatrix). Mol. Plant Pathol. 5:527-536.

Fernandez, D., P. Santos, C. Agostini, M. C. Bon, A. S. Petitot, M. C. Silva, L.
Gerra-Guimaraes, A. Ribeiro, X. Argout, and M. Nicole. 2004. Coffee (Coflea

arabica L.) genes early expressed during infection by the rust fimgus (Hemileia
vastatrix). Mol. Plant Pathol. 5:527-536.

161

76.

77.

78.

79.

80.

81.

82.

83.

84.

85.

Francetic, 0., and A. P. Pugsley. 2005. Towards the identification of type II
secretion signals in a nonacylated variant of pullulanase from Klebsiella oxytoca.
J. Bacteriol. 187 :7045-7055.

Frederick, R. D., M. Ahmad, D. R. Majerczak, A. S. Arroyo-Rodriguez, S.
Manulis, and D. L. Coplin. 2001. Genetic organization of the Pantoea stewartii
subsp stewartii hrp gene cluster and sequence analysis of the hrpA, hrpC, hrpN,
and wtsE operons. Mol. Plant-Microbe Interact. 14: 1213-1222.

Gao, Z. S., W. E. van de Weg, J. G. Schaart, H. J. Schouten, D. H. Tran, L. P.
Kodde, I. M. van der Meer, A. H. M. van der Geest, J. Kodde, H.
Breiteneder, K. Hoffmann-Sommergruber, D. Bosch, and L. J. W. J.
Gilissen. 2005. Genomic cloning and linkage mapping of the Mal d 1 (PR-10)
gene family in apple (Malus domestica). Theor. Appl. Genet. 111:171-183.

Garmendia, J., C. R. Beuzon, J. Ruiz-Albert, and D. W. Holden. 2003. The
roles of SsrA-SsrB and OmpR-EnvZ in the regulation of genes encoding the
Salmonella typhimurium SPI—2 type HI secretion system. Microbiol. 149:2385-
2396.

Garmory, H. S., and R. W. Titball. 2004. ATP-binding cassette transporters are
targets for the development of antibacterial vaccines and therapies. Infection And
Immunity 72:6757-6763.

Gaudriault, S., M. N. Brisset, and M. A. Barny. 1998. HrpW ofErwinia
amylovora, a new Hrp-secreted protein. FEBS Lett. 428:224-228.

Gaudriault, S., L. Malandrin, J. P. Paulin, and M. A. Barny. 1997. DspA, an
essential pathogenicity factor of Erwinia amylovora showing homology with
Aer of Pseudomonas syringae, is secreted via the Hrp secretion pathway in a
DspB-dependent way. Mol. Microbiol. 26: 1057-1069.

Gaudriault, S., J. P. Paulin, and M. A. Barny. 2002. The DspB/F protein of
Erwinia amylovora is a type III secretion chaperone ensuring efficient
intrabacterial production of the Hrp-secreted DspA/E pathogenicity factor. Mol.
Plant Pathol. 3:313-320.

Geider, K. 2000. Exopolysaccharides of Erwinia amylovora: structure,
biosynthesis, regulation, role in pathogenicity of amylovoran and levan, p. 117-
140. In J. L. Vanneste (ed.), Fire blight: the disease and its causative agent. CABI
Publishing, New York.

Geier, G., and K. Geider. 1993. Characterization and influence on virulence of
the levansucrase gene from the fireblight pathogen Erwinia amylovora. Physiol.
Mol. Plant Path. 42:387-404.

162

86.

87.

88.

89.

90.

91.

92.

93.

94.

Gibly, A., A. Bonshtien, V. Balaji, P. Debbie, G. B. Martin, and G. Sessa.
2004. Identification and expression profiling of tomato genes differentially
regulated during a resistance responce to Xanthmonas campestris pv. vesicatoria.
Mol. Plant-Microbe Interact. 17 :1212-1222.

Gibly, A., A. Bonshtien, V. Balaji, P. Debbie, G. B. Martin, and G. Sessa.
2004. Identification and expression profiling of tomato genes differentially

regulated during a resistance responce to Xanthmonas campestris pv. vesicatoria.
Mol Plant Microbe Interact 17: 1212-1222.

Glazebrook, J. 2005. Contrasting mechanisms of defense against biotrophic and
necrotrophic pathogens. Annu. Rev. Phytopathol. 43:205-227.

Goff, S. A., D. Ricke, T. H. Lan, G. Presting, R. L. Wang, M. Dunn, J.
Glazebrook, A. Sessions, P. Oeller, H. Varma, D. Hadley, D. Hutchinson, C.
Martin, F. Katagiri, B. M. Lange, T. Moughamer, Y. Xia, P. Budworth, J. P.
Zhong, T. Miguel, U. Paszkowski, S. P. Zhang, M. Colbert, W. L. Sun, L. L.
Chen, B. Cooper, S. Park, T. C. Wood, L. Mao, P. Quail, R. Wing, R. Dean,
Y. S. Yu, A. Zharkikh, R. Shen, S. Sahasrabudhe, A. Thomas, R. Cannings,
A. Gutin, D. Pruss, J. Reid, S. Tavtigian, J. Mitchell, G. Eldredge, T. Scholl,
R. M. Miller, S. Bhatnagar, N. Adey, T. Rubano, N. Tusneem, R. Robinson,
J. Feldhaus, T. Macalma, A. Oliphant, and S. Briggs. 2002. A draft sequence
of the rice genome (Oryza sativa L. sspjaponica). Science 296:92-100.

Goodman, R. N ., and J. A. White. 1981. Xylem parenchyma plasmolysis and
vessel wall disorientation caused by Erwinia amylovora. Phytopthology 71 :844-
852.

Goodrich, J., P. Puangsomlee, M. Martin, D. Long, E. M. Meyerowitz, and
G. Coupland. 1997. A polycomb-group gene regulates homeotic gene expression
in Arabidopsis. Nature 386:44-51.

Goyer, C., and M. S. Ullrich. 2006. Identification of low-temperature-regulated
genes in the fire blight pathogen Erwinia amylovora. Can. J. Microbiol. 52:468-
475.

Greenburg, G., and G. Blobel. 1994. cDNA-derived primary structure of the 25-

kDa subunit of canine microsomal signal peptidase complex. J. Biol. Chem.
269:25354-25358.

Guilleroux, M., and A. Osbourn. 2004. Gene expression during infection of
wheat roots by the 'take-all' fungus Gaeumannomyces graminis. Mol. Plant
Pathol. 5:203-216.

163

95.

96.

97.

98.

99.

100.

101.

102.

103.

104.

105.

Guilvout, 1., K. R. Hardie, N. Sauvonnet, and A. P. Pugsley. 1999. Genetic
dissection o the outer membrane secretin PulD: are there distinct domains for
multirnerization and secretion specificity? J. Bacteriol. 181 :7212-7220.

Guttman, D. S., B. A. Vinatzer, S. F. Sarkar, M. V. Ranall, G. Kettler, and J.
T. Greenberg. 2002. A functional screen for the type III (Hrp) secretome of the
plant pathogen Pseudomonas syringae. Science 295: 1722-1 726.

Hammond-Kosack, K. E., and J. E. Parker. 2003. Deciphering plant—pathogen
communication: fresh perspectives for molecular resistance breeding. Curr. Op.
Biotech. 14:177-193.

He, S. Y., M. Lindeberg, A. K. Chatterjee, and A. Collmer. 1991. Cloned
Erwinia chrysnathemi out genes enable Escherichia coli to selectively secret a

diverse family of heterologous proteins to its milieu. Proc. Natl. Acad. Sci. USA
88:1079-1083.

He, S. Y., K. Nomura, and T. S. Whittam. 2004. Type III protein secretion
mechanism in mammalian and plant pathogens. Biochim. Biophys. Acta
1694:181-206.

Heeb, S., C. Blumer, and D. Haas. 2002. Regulatory RNA as mediator in
GacA/RsmA-dependent global control of exoproduct formation in Pseudomonas
fluorescens CHAO. J. Bacteriol. 184:1046-1056.

Heithoff, D. M., R. L. Sinsheimer, D. A. Low, and M. J. Mahan. 2000. In vivo
gene expression and the adaptive response: from pathogenesis to vaccines and
antimicrobials. Phil. Trans. R.Soc. Of Lond. B 355:633-642.

Herlache, T. C., A. T. Hotchkiss, T. J. Burr, and A. Collmer. 1997.
Characterization of the Agrobacterium vitis pehA gene and comparison of the
encoded polygalacturonase with the homologous enzymes from Erwinia
carotovora and Ralstonia solanacearum. Appl. Environ. Microbiol. 63:338-346.

Hildebrand, M., P. Aldridge, and K. Geider. 2006. Characterization of hns
genes from Erwinia amylovora. Mol. Genet. Genomics 275:310-9.

Holeva, M. C., K. S. Bell, L. J. Hyman, A. 0. Avrova, S. C. Whisson, P. R. J.
Birch, and I. K. Toth. 2004. Use of a pooled transposon mutation grid to
demonstrate roles in disease development for Erwinia carotovora subsp
atroseptica putative type III secreted effector (DspE/A) and helper (HrpN)
proteins. Mol. Plant-Microbe Interact. 17:943-950.

Holub, E. B. 2001. The arms race is ancient history in Arabidopsis, the
wildflower. Nature Rev. Genet. 2:516-527.

164

106.

107.

108.

109.

110.

111.

112.

113.

114.

115.

116.

117.

Hu, N. T., W. M. Leu, M. S. Lee, A. Chen, S. C. Chen, Y. L. Song, and L. Y.
Chen. 2002. XpsG, the major pseudopilin in Xanthomonas campestris pv.
campestris, forms a pilus-like structure between cytoplasmic and outer
membranes. Biochem. J. 365:205-211.

Huang, Q., and C. Allen. 2000. Polygalacturonases are required for rapid
colonization and full virulence of Ralstonia solanacearum on tomato plants.
Physiol. Mol. Plant Path. 57:77-83.

Huang, S., E. A. G. van der Vossen, H. Kuang, V. G. A. A. Vleeshouwers, N.
Zhang, T. J. A. Borm, H. J. van Eek, B. Baker, E. Jacobsen, and R. G. F.
Visser. 2005. Comparative genomics enabled the isolation of the R3a late blight
resistance gene in potato. Plant J 42:251-261.

Hugouvieux—Cotte-Pattat, N., G. Condemine, W. Nasser, and S. Reverchon.
1996. Regulation of pectinolysis in Erwinia chrysanthemi. Annu. Rev. Microbiol.
50:213-257.

Initiative, T. A. G. 2000. Analysis of the genome sequence of the flowering plant
Arabidopsis thaliana. Nature 408:796-815.

Iwobi, A. 2003. Uncovering novel pathogenicity-associated loci among Yersinia
enterocolitica species by subtractive hybridization. Dissertation. Ludwig-
Maximilians-Universitat Miinchen, Munich.

Iwobi, A., J. Heesemann, E. Garcia, E. Igwe, C. Noelting, and A. Rakin. 2003.
Novel virulence-associated type H secretion system unique to high-pathogenicity
Yersinia enterocolitica. Infect. Immun. 71 :1872-1 879.

Iyoda, S., T. Kamidoi, K. Hirose, K. Kutsukake, and H. Watanabe. 2001. A
flagellar gene fliZ regulates the expression of invasion genes and virulence

phenotype in Salmonella enterica serovar T yphimurium. Microb. Pathog. 30:81-
90.

Jantasuriyarat, C., M. Gowda, K. Haller, J. Hatfield, G. Lu, E. Stahlberg, B.
Zhou, H. Li, H. Kim, Y. Yu, R. A. Dean, R. A. Wing, C. Soderlund, and G.-L.
Wang. 2005. Large-scale identification of expressed sequence tags involved in
rice and rice blast fungus interaction. Plant Physiol 138:105-115.

Jayani, R. S., S. Saxena, and R. Gupta. 2005. Microbial pectinolytic enzymes:
A review. Process Biochem. 40:2931-2944.

Jefferson, R. A. 1987. Assaying chimeric genes in plants: the GUS gene fusion
system. Plant Mol. Biol. Rep. 5:387-405.

Jin, Q., W. Hu, 1. Brown, G. McGhee, P. Hart, A. L. Jones, and S. Y. He.
2001 . Visualization of secreted Hrp and Avr proteins along the Hrp pilus during

165

118.

119.

120.

121.

122.

123.

124.

125.

126.

127.

128.

type III secretion in Erwinia amylovora and Pseudomonas syringae. Mol.
Microbiol. 40:1 129-39.

Jin, Q., W. Hu, 1. Brown, G. McGhee, P. Hart, A. L. Jones, and S. Y. He.
2001. Visualization of secreted Hrp and Avr proteins along the Hrp pilus during

type III secretion in Erwinia amylovora and Pseudomonas syringae. Mol.
Microbiol. 40: 1 129-1 139.

Johnson, K. B., and V. O. Stockwell. 1998. Management of fire blight: A case
study in microbial ecology. Annu. Rev. Phytopathol. 36:227-248.

Jonak, C., and H. Hirt. 2002. Glycogen synthase kinase 3/ SHAGGY-like
kinases in plants: an emerging family with novel functions. Trends Plant Sci.
7:457-461.

Kang, L., J. Li, T. Zhao, F. Xiao, X. Tang, R. Thilmony, S. He, and J. M.
Zhou. 2003. Interplay of the Arabidopsis nonhost resistance gene NHOl with
bacterial virulence. Proc Natl Acad Sci U S A 100:3519-24.

Kazemi-Pour, N., G. Condemine, and N. Hugouvieux-Cotte-Pattat. 2004. The
secretome of the plant pathogenic bacterium Erwinia chrysanthemi. Proteomics
4:3177-3186.

Kelm, 0., C. Kiecker, K. Geider, and F. Bernhard. 1997. Interaction of the
regulator proteins RcsA and RcsB with the promoter of the operon for
amylovoran biosynthesis in Erwinia amylovora. Mol. Gen. Genet. 256:72-83.

Khan, M. A., B. Duffy, C. Gessler, and A. Patocchi. 2006. QTL mapping of fire
blight resistance in apple. Mol. Breeding 17:299-306.

Kim, J. F., and S. V. Beer. 2000. hrp genes and harpins of Erwinia amylovora: a
decade of discovery, p. 141-161. In J. L. Vanneste (ed.), Fire blight: the disease
and its causative agent, Erwinia amylovora. CABI Publishing, New York.

Kim, J. F., and S. V. Beer. 1998. HrpW of Erwinia amylovora, a new harpin that
contains a domain homologous to pectate lyases of a distinct class. J. Bacteriol.
180:5203-5210.

Kim, J. E, Z. M. Wei, and S. V. Beer. 1997. The hrpA and hrpC operons of
Erwinia amylovora encode components of a type IH pathway that secretes harpin.
J. Bacteriol. 179:1690-1697.

Kiraly, Z., H. M. ElZahaby, and Z. Klement. 1997. Role of extracellular

polysaccharide (BPS) slime of plant pathogenic bacteria in protecting cells to
reactive oxygen species. J. Phytopathol.-Phytopathol. Z. 145:59-68.

166

129.

130.

131.

132.

133.

134.

135.

136.

137.

138.

139.

Kong, L., J. M. Anderson, and H. W. Ohm. 2005. Induction of wheat defense
and stress-related genes in response to F usarium graminearum. Genome 48:29-
40.

Koraimann, G. 2003. Lytic transglycosylases in macromolecular transport
systems of Gram-negative bacteria. Cell.Mol. Life Sci. 60:2371-2388.

Kovach, M. E., P. H. Elzer, D. S. Hill, G. T. Robertson, M. A. Farris, R. M.
Roop, and K. M. Peterson. 1995. Four new derivatives of the broad-host-range
cloning vector pBBRlMCS, carrying different antibiotic-resistance cassettes.
Gene 166:175-176.

Kruger, W. M., C. Pritsch, S. Chao, and G. J. Muehlbauer. 2005. Functional
and comparative analysis of expressed genes from wheat spikes infected with

F usarium graminearum. M01. Plant-Microbe Interact. 15:445-455.

Lee, A. K., C. S. Detweiler, and S. Falkow. 2000. OmpR regulates the two-
component system SsrA-SsrB in Salmonella pathogenicity island 2. J. Bacteriol.
182:771-781.

Lee, S.-W., S.-W. Han, L. E. Bartley, and P. C. Ronald. 2006. From the
academy: colloquium review: unique characteristics of Xanthomonas oryzae pv.

oryzae Avaa21 and implications for plant innate immunity. Proc. Natl. Acad.
Sci. USA 103:18395-18400.

Lee, S. Y., J. S. Seo, M. Rodriguez-Lanetty, and D. H. Lee. 2003. Comparative
analysis of superfamilies of NBS-encoding disease resistance gene analogs in
cultivated and wild apple species. Mol. Genet. Genomics 269:101-108.

Lee, S. Y., J. S. Seo, M. Rodriguez-Lanetty, and D. H. Lee. 2003. Comparative
analysis of superfamilies of NBS-encoding disease resistance gene analogs in
cultivated and wild apple species. Mol. Genet. Genomics 269:101-108.

Lindeberg, M., C. M. Boyd, N. T. Keen, and A. Collmer. 1998. External loops
at the C terminus of Erwinia chrysanthemi pectate lyase C are required for

species-specific secretion through the out type H pathway. J. Bacteriol. 180: 143 l -
1437.

Lindeberg, M., and A. Collmer. 1992. Analysis of eight out genes in a cluster
required for pection enzyme secretion by Erwinia chrysanthemi: sequence

comparison with secretion genes fiom other gram-negative bacteria. J. Bacteriol.
174:7385-7397.

Liu, H., S. Zhang, M. A. Schell, and T. P. Denny. 2005. Pyramiding unmarked
deletions in Ralstonia solanacearum shows that secreted proteins in addition to

plant cell-wall-degrading enzymes contribute to virulence. Mol. Plant-Microbe
Interact. 18: 1296-1305.

167

140.

141.

142.

143.

144.

145.

146.

147.

148.

Liu, S., and J. A. Anderson. 2003. Targeted molecular mapping of a major
wheat QTL for F usarium head blight resistance using wheat ESTs and synteny
with rice. Genome 46:817-823.

Liu, Y., A. Chatterjee, and A. K. Chatterjee. 1994. Nucleotide sequence and
expression of a novel pectate lyase gene (pel-3) and a closely linked

endopolygalacturonase gene (peh-1) of Erwinia carotovora subsp. carotovora 71.
Appl. Environ. Microbiol. 60:2545-2552.

Liu, Y. G., and R. F. Whittier. 1995. Thermal Asymmetric Interlaced Pcr -
Automatable Amplification And Sequencing Of Insert End Fragments From P1
And Yac Clones For Chromosome Walking. Genomics 25:674-681.

Lorang, J. M., and N. T. Keen. 1995. Characterization Of Avre From
Pseudomonas-Syringae Pv Tomato - A Hrp-Linked Avirulence Locus Consisting
Of At Least 2 Transcriptional Units. Mol. Plant-Microbe Interact. 8:49-57.

Lu, G., C. J antasuriyarat, B. Zhou, and G.-L. Wang. 2004. Isolation and
characterization of novel defense response genes involved in compatible and

incompatible interactions between rice and Magnaporthe grisea. Theor. Appl.
Genet. 108:525-534.

Lu, H. M., S. T. Motley, and S. Lory. 1997. Interactions of the components of
the general secretion pathway: role of Pseudomonas aeruginosa type IV pilin
subunits in complex formation and extracellular protein secretion. Mol.

Microbiol. 25:247-259.

Lu, Z.-X., D. A. Gaudet, M. Frick, B. Puchalski, B. Genswein, and A.
Laroche. 2005. Identification and characterization of genes differentially
expressed in the resistance reaction in wheat infected with T illetia tritici, the
common bunt pathogen. J. Biochem. Mol. Biol. 38:420-431.

Ma, W., Y. Cui, Y. Liu, C. K. Dumenyo, A. Mukherjee, and A. K. Chatterjee.
2001. Molecular characterization of global regulatory RNA species that control
pathogenicity factors in Erwinia amylovora and Erwinia herbicola pv.
gypsophilae. J. Bacteriol. 183:1870—80.

Maes, M., K. Orye, S. Bobev, B. Devreese, J. Van Beeumen, A. De Bruyn, R.
Busson, P. Herdewijn, K. Morreel, and E. Messens. 2001. Influence of
amylovoran production on virulence of Erwinia amylovora and a different

amylovoran structure in E. amylovora isolates from Rubus. Eur. J. Plant Pathol.
107:839-844.

168

149.

150.

151.

152.

153.

154.

155.

156.

157.

158.

159.

160.

Mahalingam, R., A. Gomez-Buitrago, N. Eckardt, N. Shah, A. Guevara-
Garcia, P. Day, R. Raina, and N. V. Fedoroff. 2003. Characterizing the
stress/defense transcriptome of Arabidopsis. Genome Biol. 4.

Mahan, M. J., D. M. Heithoff, R. L. Sinsheimer, and D. A. Low. 2000.
Assessment of bacterial pathogenesis by analysis of gene expression in the host.
Annu.Rev. Genet. 34: 139-164.

Marco, M. L., J. Legac, and S. E. Lindow. 2003. Conditional survival as a
selection strategy to identify plant-inducible genes of Pseudomonas syringae.
Appl. Environ. Microbiol. 69:5793-5801.

Mathur, J., N. Mathur, B. Kernebeck, B. P. Srinivas, and M. Hulskamp.
2003. A novel localization pattern for an EBl-like protein links microtubule
dynamics to endomembrane organization. Curr. Biol. 13:1991-1997.

Maxson-Stein, K., S. Y. He, R. Hammerschmidt, and A. L. Jones. 2002. Effect
of treating apple trees with acibenzolar-S-methyl on fire blight and expression of
pathogenesis-related protein genes. Plant Dis. 86:785-790.

Mayerhofer, R., K. Wilde, M. Mayerhofer, D. Lydiate, V. K. Bansal, A. G.
Good, and I. A. P. Parkin. 2005. Complexities of chromosome lansing in a
highly duplicated genome: toward map-based cloning of a gene controlling
blackleg resistance in Brassica napus. Genetics 171 : 1977-1 988.

McGhee, G. C., and A. L. Jones. 2000. Complete nucleotide sequence of
ubiquitous plasmid pEA29 from Erwinia amylovora strain Ea88: gene
organization and intraspecies variation. Appl. Environ. Microbiol. 66:4897-4907.

McHale, L., X. Tan, P. Koehl, and R. W. Michelmore. 2006. Plant NBS-LRR
proteins; adaptable guards. Genome Biol 7:212.

McManus, P. S., and A. L. Jones. 1994. Epidemiology and genetic analysis of
streptomycin resistant Erwinia amylovora fi'om Michigan and evaluation of
oxytetracycline for control. Phytopathology 84:627-633.

McManus, P. S., V. O. Stockwell, G. W. Sundin, and A. L. Jones. 2002.
Antibiotic use in plant agriculture. Annu. Rev. Phytopathol. 40:443-465.

Meng, X., J. M. Bonasera, J. F. Kim, R. M. Nissinen, and S. V. Beer. 2006.
Apple proteins that interact with DspA/E, a pathogenicity effector of Erwinia
amylovora, the fire blight pathogen. Mol. Plant-Microbe Interact. 19:53-61.

Merrell, D. S., and A. Camilli. 2000. Detection and analysis of gene expression

during infection by in vivo expression technology. Phil. Trans. R. Soc. Lond. B
355:587-599.

169

161.

162.

163.

164.

165.

166.

167.

168.

169.

170.

171.

Metzger, M., P. Bellemann, P. Bugert, and K. Geider. 1994. Genetics of
galactose metabolism of Erwinia amylovora and it influence on polysaccharide
synthesis and virulence of the fire blight pathogen. J. Bacteriol. 176:450-459.

Meyers, B. C., A. Kozik, A. Griego, H. Kuang, and R. W. Michelmore. 2003.
Genome-wide analysis of NBS-LRR-encoding genes in Arabidopsis. Plant Cell
15:809-34.

Michelmore, R. W. 2003. The impact zone: genomics and breeding for durable
disease resistance. Curr Opin Plant Biol 6:397-404.

Miller, G., and R. Mittler. 2006. Could heat shock transcription factors fimction
as hydrogen peroxide sensors in plants? Annal. Bot. 98:279-288.

Milner, J. S., D. Dymock, R. M. Cooper, and I. S. Roberts. 1993. Penicillin-
binding proteins fiom Erwinia amylovora: mutants lacking PBP2 are avirulent. J.
Bacteriol. 175:6082-6088.

Mishra, S. K., J. Tripp, S. Winkelhaus, B. Tschiersch, K. Theres, L. Nover,
and K. D. Scharf. 2002. In the complex family of heat stress transcription

factors, Hszl has a unique role as a master regulator of thermotolerance in
tomato. Genes Dev. 16:1555-1567.

Miyazaki, S., R. Koga, H. J. Bohnert, and T. Fukuhara. 1999. Tissue- and
environmental response-specific expression of 10 PP2C transcripts in
Mesembryanthemum crystallinum. Mol. Gen. Genet. 261:307-316.

Momol, M. T., J. L. Norelli, D. E. Piccioni, E. A. Momol, H. L. Gustafson, J.
N. Cummins, and H. S. Aldwinckle. 1998. Internal movement of Erwinia

amylovora through symptomless apple scion tissues into the rootstock. Plant Dis.
82:646-650.

Mongkolsuk, S., W. Whangsuk, P. Vattanaviboon, S. Loprasert, and M.
Fuangthong. 2000. A Xanthomonas alkyl hydroperoxide reductase subunit C
(ahpC) mutant showed an altered peroxide stress response and complex regulation

of the compensatory response of peroxide detoxification enzymes. J. Bacteriol.
182:6845-6849.

Mor, H., S. Manulis, M. Zuck, R. Nizan, D. L. Coplin, and I. Barash. 2001.
Genetic organization of the hrp gene cluster and dspAE/BF operon in Erwinia
herbicola pv. gypsophilae. Mol. Plant-Microbe Interact. 14:431-436.

Morgan, E., J. D. Campbell, S. C. Rowe, J. Bispham, M. P. Stevens, A. J.
Bowen, P. A. Barrow, D. J. Maskell, and T. S. Wallis. 2004. Identification of

170

172.

173.

174.

175.

176.

177.

178.

179.

180.

181.

host-specific colonization factors of Salmonella enterica serovar Typhimurium.
Mol. Microbiol. 54:994-1010.

Mukaihara, T., N. Tamura, Y. Murata, and M. Iwabuchi. 2004. Genetic
screening of Hrp type III-related pathogenicity genes controlled by the HrpB
transcriptional activator in Ralstonia solanacearum. Mol. Microbiol. 54:863-875.

Murata, H., M. Fons, A. Chatterjee, A. Collmer, and A. K. Chatterjee. 1990.
Characterization of transposon insertion Out' mutants of Erwinia carotovora
subsp. carotovora defective in enzyme export and of a DNA segment that
complements out mutations in E. carotovora subsp. carotovora, E. carotocora
subsp. atroseptica, and Erwinia chrysanthemi. J Bacteriol 172:2970—2978.

Naess, S. K., J. M. Bradeen, S. M. Wielgus, G. T. Haberlach, J. M. McGrath,
and J. P. Helgeson. 2000. Resistance to late blight in Solanum bulbocastanum is
mapped to chromosome 8. Theor. Appl. Genet. V101 :697.

Naik, S., C. Hampson, K. Gasic, G. Bakkeren, and S. S. Korban. 2006.
Development and linkage mapping of E—STS and RGA markers for functional
gene homologues in apple. Genome 49:959-968.

Nasser, W., S. Reverchon, R. Vedel, and M. Boccara. 2005. PecS and PecT
coregulate the synthesis of HrpN and pectate lyases, two virulence determinants
in Erwinia chrysanthemi 3937. Mol. Plant-Microbe Interact. 18:1205-1214.

Neu, C., B. Keller, and C. Feuillet. 2003. Cytological and molecular analysis of

the Hordeum vulgare—Puccinia triticina nonhost interaction. Mol. Plant-Microbe
Interact. 16:626-633.

Newcomb, R. D., R. N. Crowhurst, A. P. Gleave, E. H. A. Rikkerink, A. C.
Allan, L. L. Beuning, J. H. Bowen, E. Gera, K. R. J amieson, B. J. Janssen, W.
A. Laing, S. McArtney, B. Nain, G. S. Ross, K. C. Snowden, E. J. F. Souleyre,
E. F. Walton, and Y.-K. Yank. 2006. Analyses of expressed sequence tags from
apple. Plant Physiol 141:147-166.

Newcomb, R. D., R. N. Crowhurst, A. P. Gleave, E. H. A. Rikkerink, A. C.
Allan, L. L. Beuning, J. H. Bowen, E. Gera, K. R. J amieson, B. J. J anssen, W.
A. Laing, S. McArtney, B. Nain, G. S. Ross, K. C. Snowden, E. J. F. Souleyre,
E. F. Walton, and Y.-K. Yauk. 2006. Analyses of expressed sequence tags fi'om
apple. Plant Physiol. 141:147-166.

Nimchuk, Z., T. Eulgem, B. F. Holt, and J. L. Dangl. 2003. Recognition and
response in the plant immune system. Annu. Rev. Genet. 37:579-609.

Nimchuk, Z., T. Eulgem, B. F. Holt, and J. L. Dangl. 2003. Recognition and
response in the plant immune system. Annu Rev Genet 37 :579-609.

171

 

 

 

182.

183.

184.

185.

186.

187.

188.

189.

190.

191.

192.

Norelli, J. L., A. L. Jones, and H. S. Aldwinkle. 2003. Fire blight management
in the twenty-first century: using new technologies that enhance host resistance in
apple. Plant Dis. 87:756-765.

Nouwen, N., N. Ranson, H. Saibil, B. Wolpensinger, A. Engel, A. Ghazi, and
A. P. Pugsley. 1999. Secretin PulD: association with pilot PulS, structure, and
ion-conduction channel formation. Proc Natl Acad Sci U S A 96:8173-8177.

Nouwen, N., H. Stahlberg, A. P. Pugsley, and A. Engel. 2000. Domain
structure of secretion PulD revealed by limited proteolysis and electron
microscopy. EMBO J 19:2229-2236.

Nover, L., K. Bharti, P. Doring, S. K. Mishra, G. Ganguli, and K. D. Scharf.
2001. Arabidopsis and the heat stress transcription factor world: how many heat
stress transcription factors do we need? Cell Stress Chap. 6:177-189.

Okazaki, N., K. Okazaki, Y. Watanabe, M. Kato-Hayashi, M. Yamamoto,
and H. Okayama. 1998. Novel factor highly conserved among eukaryotes
controls sexual development in fission yeast. Mol. Cell Biol. 18:887-895.

Osbourn, A. E., C. E. Barber, and M. J. Daniels. 1987. Identification of plant-
induced genes of the bacterial pathogen Xanthomonas campestris pathovar
campestris using a promoter probe plasmid. Embo J. 6:23-28.

Pallen, M. J., R. R. Chaudhuri, and I. R. Henderson. 2003. Genomic analysis
of secretion systems. Curr. Opin. Microbiol. 6:519-527.

Palomaki, T., R. Pickersgill, R. Riekki, M. Romantschuk, and H. Saarilahti.
2002. A putative three-dimensional targeting motif of polygalacturonase (PehA),
a protein secreted through the type II (GSP) pathway in Erwinia carotovora. Mol
Microbiol 43:585-596.

Palomaki, T., and H. Saarilahti. 1997. Isolation and characterization of new C-
terminal substitution mutations affection secretion of polygalacturonase in
Erwinina carotovora ssp. carotovora. FEBS Lett 400: 122-126.

Parkhill, J., B. W. Wren, N. R. Thomson, R. W. Titball, M. T. G. Holden, M.
B. Prentice, M. Sebaihia, K. D. James, C. Churcher, K. L. Mungall, S. Baker,
D. Basham, S. D. Bentley, K. Brooks, A. M. Cerdeno—Tarraga, T.
Chillingworth, A. Cronin, R. M. Davies, P. Davis, G. Dougan, T. Feltwell, N.
Hamlin, S. Holroyd, K. J agels, A. V. Karlyshev, S. Leather, S. Moule, P. C. F.
Oyston, M. Quail, K. Rutherford, M. Simmonds, J. Skelton, K. Stevens, S.
Whitehead, and B. G. Barrel]. 2001. Genome sequence of Yersinia pestis, the
causative agent of plague. Nature 413:523.

Perez-Bueno, M. L., J. Rahoutei, C. Sajnani, I. Garcia-Luque, and M. Baron.
2004. Proteomic analysis of the oxygen-evolving comples in photosytem II under

172

193.

194.

195.

196.

197.

198.

199.

200.

201.

202.

biotec stress: studies on Nicotiana benthamiana infected with tobarnoviruses.
Proteomics 4:418-425.

Perino, C., S. Gaudriault, B. Vian, and M. A. Barny. 1999. Visualization of
harpin secretion in planta during infection of apple seedlings by Erwinia
amylovora. Cell. Microbiol. 1:131-141.

Persson, B., Y. Kallberg, U. Oppermann, and H. J ornvall. 2003. Coenzyme-
based functional assignments of short-chain dehydrogenases/reductases (SDRs).
Chem. Biol. Interact 143-144:271-278.

Pflieger, S., V. Lefebvre, and M. Causse. 2001. The candidate gene approach in
plant genetics: a review. Mol Breeding 7:275-291.

Possot, O. M., M. Gerard-Vincent, and A. P. Pugsley. 1999. Membrane
association and multimerization of secreton component PulC. J Bacteriol
181:4004-401 1.

Possot, O. M., G. Vignon, N. Bomchil, F. Ebel, and A. P. Pugsley. 2000.
Multiple interactions between pullulanase secreton components involved in

stabilization and cytoplasmic membrane association of PulE. J Bacteriol
182:2142-2152.

Py, B., L. Loiseau, and F. Barras. 1999. Assembly of the type H machinery of
Erwinia chrysanthemi: direct interaction and associated conformational change

between OutE, the putative ATP-binding component and the membrane protein
OutL. J Mol Biol 289:659-670.

Qin, Z. X., Q. J. Chen, Z. Tong, and X. C. Wang. 2005. The Arabidopsis
inositol 1,3,4-trisphosphate 5/6 kinase, AtItpk-l, is involved in plant
photomorphogenesis under red light conditions, possibly via interaction with
COP9 signalsome. Plant Physiol. Biochem. 43:947-954.

Rainey, P. B. 1999. Adaptation of Pseudomonas fluorescens to the plant
rhizosphere. Environ. Microbiol. 1:243-257.

Rainey, P. B., and G. M. Preston. 2000. In vivo expression technology
strategies: valuable tools for biotechnology. Curr. Op. Biotechnol. 1 1:440-444.

Ramalingam, J., C. M. Vera Cruz, K. Kukreja, J. M. Chittoor, J.-L. Wu, S.
W. Lee, M. Baraoidan, M. L. George, M. B. Cohen, S. H. Hulbert, J. E.
Leach, and H. Leung. 2003. Candidate defense genes from rice, barley, and
maize and the association with qualitative and quantitative resistance in rice. Mol.
Plant-Microbe Interact. 1 6: 14-24.

173

 

 

 

 

203.

204.

205.

206.

207.

208.

209.

210.

211.

212.

213.

Ramos-Gonzalez, M. 1., M. J. Campos, and J. L. Ramos. 2005. Analysis of
Pseudomonas putida KT2440 gene expression in the maize rhizosphere: In vitro
expression technology capture and identification of root-activated promoters. J.
Bacteriol. 187:4033-4041.

Rantakari, A., O. Virtaharju, S. Vahamiko, S. Taira, E. T. Palva, H. T.
Saarilahti, and M. Romantschuk. 2001. Type HI secretion contributes to the
pathogenesis of the soft-rot pathogen Erwinia carotovora: Partial characterization
of the hrp gene cluster. Mol. Plant-Microbe Interact. 14:962-968.

Reimmann, C., M. Beyeler, A. Latifi, H. Winteler, M. Foglino, A. Lazdunski,
and D. Haas. 1997. The global activator GacA of Pseudomonas aeruginosa PAO
positively controls the production of the autoinducer N-butyryl-homoserine

lactone and the formation of the virulence factors pyocyanin, cyanide, and lipase.
Mol. Microbiol. 24:309-319.

Ried, J. L., and A. Collmer. 1985. Activity stain for rapid characterization of
pectic enzymes in isoelectric-focusing and sodium dodecyl sulfate-
polyacrylamide gels. Appl. Environ. Microbiol. 50:615-622.

Riekki, R., T. Palomaki, O. Virtaharju, H. Kokko, M. Romantschuk, and H.
T. Saarilahti. 2000. Members of the amylovora group of Erwinia are cellulolytic

and possess genes homologous to the type H secretion pathway. Mol. Gen. Genet.
263:1031-1037.

Roberts, M. R. 2003. 14-3-3 proteins find new partners in plant cell signalling.
Trends Plant Sci. 8:218-223.

Roberts, M. R., J. Salinas, and D. B. Collinge. 2002. 14—3-3 proteins and the
response to abiotic and biotic stress. Plant Mol. Biol. 1031:1031-1'039.

Rodfiguez-Palenzuela, P., T. J. Burr, and A. Collmer. 1991. Polygalacturonase
is a virulence factor in Agrobacterium tumefaciens biovar 3. J. Bacteriol.
173:6547-6552.

Rodriguez, P. L. 1998. Protein phosphatase 2C (PP2C) function in higher plants.
Plant Mol. Biol. 38:919-927.

Rojas, C. M., J. H. Ham, L. M. Schechter, J. F. Kim, S. V. Beer, and A.
Collmer. 2004. The Erwinia chrysanthemi EC16 hrp/hrc gene cluster encodes an
active hrp type III secretion system that is flanked by virulence genes functionally
unrelated to the hrp system. Mol. Plant-Microbe Interact. 17 :644-653.

Ronning, C. M., S. S. Stegalkina, R. A. Ascenzi, O. Bougri, A. L. Hart, T. R.
Utterbach, S. E. Vanaken, S. B. Riedmuller, J. A. White, J. Cho, G. M.
Pertea, Y. Lee, S. Karamycheva, R. Sultana, J. Tsai, J. Quackenbush, H. M.
Griffiths, S. Restrepo, C. D. Smart, W. E. Fry, R. van der Hoeven, S.

174

214.

215.

216.

217.

218.

219.

220.

221.

222.

223.

224.

Tanksley, P. Zhang, H. Jin, M. L. Yamamoto, B. L. Baker, and C. R. Buell.
2003. Comparative analyses of potato expressed sequence tag libraries. Plant
Physiol 131:419-429.

Ruepp, A., A. Zollmer, D. Maier, K. Albermann, J. Hani, M. Mokrejs, I.
Tetko, U. Guldener, G. Mannhaupt, M. Munsterkotter, and H. W. Mewes.
2004. The FunCat, a functional annotation scheme for systematic classification of
proteins from whole genomes. Nucleic Acids Res. 32:5539-5545.

Russel, M. 1998. Macromolecular assembly and secretion across the bacterial cell
envelope: type II protein secretion systems. J. Mol. Biol. 279:485-499.

Saarilahti, H., M. Pirhonen, M.-B. Karlsson, D. Flego, and E. T. Palva. 1992.
Expression of pehA-bla fusions in Eriwinia carotovora ssp. carotovora and

isolation of regulatory mutants affecting polygalacturonase production. Mol. Gen.
Genet. 234:81-88.

Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: a
laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, New York.

Sanchez-Torres, P., and L. Gonzalez-Candelas. 2003. Isolation and

characterization of genes differentially expressed during the interaction between
apple fi'uit and Pencillium expansum. Mol. Plant Pathol. 4:447-457.

Sandkvist, M. 2001. Biology of type II secretion. Mol Microbiol 40:271-283.

Sandkvist, M. 2001. Type II secretion and pathogenesis. Infect Irnmun 69:3 523-
3535.

Sandkvist, M., J. M. Keith, M. Bagdasarian, and S. P. Howard. 2000. Two
regions of EpsL involved in species-specific protein-protein interactions with

EpsE and EpsM of the general secretion pathway in Vibrio cholerae. J. Bacteriol.
182:742-748.

Sato, K., T. Ueda, and A. Nakano. 1999. The Arabidopsis thaliana RERI gene
family: its potential role in the endoplasmic retuculum localization of membrane
proteins. Plant Mol. Biol. 41:815-824.

Sauvonnet, N., G. Vignon, A. P. Pugsley, and P. Gounon. 2000. Pilus
formation and protein secretion by the same machinery in Escherichia coli.
EMBO J 19:2221-2228.

Schechter, L. M., K. A. Roberts, Y. J amir, J. R. Alfano, and A. Collmer.

2004. Pseudomonas sytingae type III secretion system targeting signals and novel
effectors studied with a Cya translocation reporter. J. Bacteriol. 186:543-555.

175

225.

226.

227.

228.

229.

230.

231.

232.

233.

234.

235.

236.

Schweizer, H. P., and T. T. Hoang. 1995. An improved system for gene
replacement and xylE fusion analysis in Pseudomonas aeruginosa. Gene 158:15-
22.

Seemuller, E. A., and S. V. Beer. 1976. Absence of cell wall polysaccharide
degradation by Erwinia amylovora. Phytopathology 66:433-436.

Shen, X., M. G. Francki, and H. W. Ohm. 2006. A resistance-like gene
identified by EST mapping and its association with a QTL controlling Fusarium
head blight infection on wheat chromosome 3BS. Genome 49:631-635.

Shevchik, V. E., J. Robert-Baudouy, and G. Condemine. 1997. Specific
interaction between OutD, an Erwinia chrysanthemi outer membrane protein of
the general secretion pathway, and secreted proteins. EMBO J 16:3007-3016.

Shulaev, V., P. Silverman, and I. Raskin. 1997. Airborne signalling by methyl
salicylate in plant pathogen resistance. Nature 385:718—721.

Silby, M. W., and S. B. Levy. 2004. Use of in vivo expression technology to
identify genes important in grth and survival of Pseudomonas fluorescens PfO-
l in soil: Discovery of expressed sequences with novel genetic organization. J.
Bacteriol. 186:7411-7419.

Sillito, D., I. A. P. Parkin, R. Mayerhofer, D. J. Lydiate, and A. G. Good.
2000. Arabidopsis thaliana: A source of candidate disease-resistance genes for
Brassica napus.

Snyder, J. A., B. J. Haugen, E. L. Buckles, C. V. Lockatell, D. E. Johnson, M.
S. Donnenberg, R. A. Welch, and H. L. T. Mobley. 2004. Transcriptome of

uropathogenic Eschetichia coli during urinary tract infection. Infection And
Immunity 72:6373-6381.

Song, J., J. M. Bradeen, S. K. Naess, J. A. Raasch, S. M. Wielgus, G. T.
Haberlach, J. Liu, H. Kuang, S. Austin-Phillips, C. R. Buell, J. P. Helgeson,
and J. Jiang. 2003. Gene RB cloned from Solanum bulbocastanum confers broad
spectrum resistance to potato late blight. Proc Natl Acad Sci U S A 100:9128-33.
Speulman, E., D. Bouchez, E. B. Holub, and J. L. Beynon. 1998. Disease
resistance gene homologs correlate with disease resistance loci of Arabidopsis
thaliana. Plant J. 14:467-474.

Strange, R. N ., and P. R. Scott. 2005. Plant Disease: A Threat to Global Food
Security. Annu. Rev. Phytopathol. 43:83-116.

Suwabe, K., H. Tsukazaki, H. Iketani, K. Hatakeyama, M. Kondo, H.

Fujimura, T. Nunome, H. Fukuoka, M. Hirai, and S. Matsumoto. 2006.
Simple sequence repeat-based comparative genomics between Brassica rapa and

176

237.

238.

239.

240.

241.

242.

243.

244.

245.

Arabidopsis thaliana: The genetic origin of clubroot resistance. Genetics
173:309-319.

Tanksley, S. D., and J. C. Nelson. 1996. Advanced backcross QTL analysis: a
method for the simultaneous discovery and transfer of valuable QTLs from
unadapted gerrnplasm into elite breeding lines. Theor. Appl. Genet. V92:191.

Thanassi, D. G., and S. J. Hultgren. 2000. Multiple pathways allow protein
secretion across the bacterial outer membrane. Curr. Opin. Cell. Biol. 12:420-430.

Tharaud, M., M. Menggad, J. P. Paulin, and J. Laurent. 1994. Virulence,
growth, and surface characteristics of Erwinia amylovora mutants with altered
pathogenicity. Microbiol. 140:659-669.

Thomas, T. M., and A. L. Jones. 1992. Severity of fire blight on apple culitvars
and strains in Michigan. Plant Dis. 76:1049-1052.

Thomson, S. V. 2000. Epidemiology of fire blight, p. 9-36. In J. L. Vanneste
(ed.), Fire blight: the disease and its causative agent, Erwinia amylovora. CABI
Publishing, New York.

Tian, Z. D., J. Lin, B. L. Wang, and C. H. Xie. 2006. Screening and expression
analysis of Phytophthora infestans induced genes in potato leaves with horizontal
resistance. Plant Cell Rep. 25: 1094-1 103.

Toth, I. K., K. S. Bell, M. C. Holeva, and P. R. J. Birch. 2003. Sofi rot
erwiniae: from genes to genomes. Mol. Plant Pathol. 4:17-30.

Tsai, C. J., G. K. Podilla, and V. L. Chaing. 1994. Agrobacterium-mediated
transformation of quaking aspen (Populus tremuloides) and regeneration of
transgenic plants. Plant Cell Rep. 14:94-97.

Tuskan, G. A., S. DiFazio, S. Jansson, J. Bohlmann, I. Grigoriev, U. Hellsten,
N. Putnam, S. Ralph, S. Rombauts, A. Salamov, J. Schein, L. Sterck, A.
Aerts, R. R. Bhalerao, R. P. Bhalerao, D. Blaudez, W. Boerjan, A. Brun, A.
Brunner, V. Busov, M. Campbell, J. Carlson, M. Chalot, J. Chapman, G. L.
Chen, D. Cooper, P. M. Coutinho, J. Couturier, S. Covert, Q. Cronk, R.
Cunningham, J. Davis, S. Degroeve, A. Dejardin, C. Depamphilis, J. Detter,
B. Dirks, I. Dubchak, S. Duplessis, J. Ehlting, B. Ellis, K. Gendler, D.
Goodstein, M. Gribskov, J. Grimwood, A. Groover, L. Gunter, B.
Hamberger, B. Heinze, Y. Helariutta, B. Henrissat, D. Holligan, R. Holt, W.
Huang, N. Islam-Faridi, S. Jones, M. Jones-Rhoades, R. Jorgensen, C. Joshi,
J. Kangasjarvi, J. Karlsson, C. Kelleher, R. Kirkpatrick, M. Kirst, A.
Kohler, U. Kalluri, F. Larimer, J. Leebens-Mack, J. C. Leple, P. Locascio, Y.
Lou, S. Lucas, F. Martin, B. Montanini, C. Napoli, D. R. Nelson, C. Nelson,
K. Nieminen, O. Nilsson, V. Pereda, G. Peter, R. Philippe, G. Pilate, A.

177

4111111111111

 

 

246.

247.

248.

249.

250.

251.

252.

253.

254.

Poliakov, J. Razumovskaya, P. Richardson, C. Rinaldi, K. Ritland, P. Rouze,
D. Ryaboy, J. Schmutz, J. Schrader, B. Segerman, H. Shin, A. Siddiqui, F.
Sterky, A. Terry, C. J. Tsai, E. Uberbacher, P. Unneberg, et a1. 2006. The
genome of black cottonwood, Populus trichocarpa (Torr. & Gray). Science
313:1596-1604.

Vanneste, J. L. 1995. Erwinia amylovora, p. 21-46. In U. S. Singh, R. P. Singh,
and K. Kohmoto (ed.), Pathogenesis and host specificity in plant diseases, vol. 1.
Elsevier Science Ltd, Tarrytown, NY.

Venisse, J. S., M. A. Barny, J. P. Paulin, and M. N. Brisset. 2003. Involvement
of three pathogenicity factors of Erwinia amylovora in the oxidative stress
associated with compatible interaction in pear. FEBS Lett 537:198-202.

Venisse, J. S., G. Gullner, and M. N. Brisset. 2001. Evidence for the
involvement of an oxidative stress in the initiation of infection of pear by Erwinia
amylovora. Plant Physiol 125:2164-72.

Venisse, J. S., M. Malnoy, M. Faize, J. P. Paulin, and M. N. Brisset. 2002.
Modulation of defense responces of Malus spp. during compatible and

incompatible interactions with Erwinia amylovora. Mol. Plant-Microbe Interact.
15:1204-1212.

Walker, A. R., P. A. Davidson, A. C. Bolognesi-Winfield, C. M. James, N.
Srinivasan, T. L. Blundell, J. J. Esch, M. D. Marks, and J. C. Gray. 1999. The
TRANSPARENT T ESTA GLABRAI locus, which regulates trichome
differentiation and anthocyanin biosynthesis in Arabidopsis, encodes a WD40
repeat protein. Plant Cell 11:1337-1349.

Wehland, M., C. Kiecker, D. L. Coplin, O. Kelm, W. Saenger, and F.
Bernhard. 1999. Identification of an RcsA/RcsB recognition motif in the
promoters of exopolysaccharide biosynthetic operons from Erwinia amylovora
and Pantoea stewartii subspecies stewartii. J. Biol. Chem. 274:3300-3307.

Wei, Z. M., J. F. Kim, and S. V. Beer. 2000. Regulation of hrp genes and type
111 protein secretion in Erwinia amylovora by HrpX/Her, a novel two-
component system, and HrpS. Mol. Plant-Microbe Interact. 13:1251-1262.

Wei, Z. M., R. J. Laby, C. H. Zumoff, D. W. Bauer, S. Y. He, A. Collmer, and
S. V. Beer. 1992. Harpin, elicitor of the hypersensitiveresponse produced by the
plant pathogen Erwinia amylovora. Science 257 :85-88.

Wilson, K. J., A. Sessitsch, J. C. Corbo, K. E. Giller, A. D. L. Akkermans,
and R. A. Jefferson. 1995. Beta-Glucuronidase (gus) Transposons for ecological

and genetic studies of rhizobia and other Gram-negative bacteria. Microbiol.
141:1691-1705.

178

255.

256.

257.

258.

259.

260.

261.

262.

263.

Wisser, R. J., Q. Sun, S. H. Hulbert, S. Kresovich, and R. J. Nelson. 2005 .
Identification and characterization of regions of the rice genome associated with

broad-spectrum, quantitative disease resistance. Genetics 169:2277-2293.

Wu, J.-L., P. K. Sinha, M. Variar, K.-L. Zheng, J. E. Leach, B. Courtois, and
H. Leung. 2004. Association between molecular markers and blast resistance in
an advanced backcross population of rice. Theor. Appl. Genet. 108:1024-1032.

Wu, K., M. F. Rooney, and R. J. Ferl. 1997. The Arabidopsis 14-3-3 multigene
family. Plant Physiol. 1 14: 1421-1431.

Xiong, L., M. W. Lee, M. Qi, and Y. Yang. 2001. Identification of defense-
related rice genes by suppression subtractive hybridization and differential
screening. Mo.lP1ant-Microbe Interact. 14:685-92.

Xiong, L., M. W. Lee, M. Qi, and Y. Yang. 2001. Identification of defense-
related rice genes by suppression subtractive hybridization and differential
screening. Mol. Plant-Microbe Interact. 14:685-92.

Yang, C. H., M. Gavilanes-Ruiz, Y. Okinaka, R. Vedel, I. Berthuy, M.
Boccara, J. W. T. Chen, N. T. Perna, and N. T. Keen. 2002. hrp genes of
Erwinia chrysanthemi 3937 are important virulence factors. Mol. Plant-Microbe
Interact. 15:472-480.

Yang, S. H., N. T. Perna, D. A. Cooksey, Y. Okinaka, S. E. Lindow, A. M.
Ibekwe, N. T. Keen, and C. H. Yang. 2004. Genome-wide identification of
plant-upregulated genes of Erwinia chrysanthemi 3937 using a GFP-Based IVET
leaf array. Molecular Plant-Microbe Interactions 17:999-1008.

Yap, M. N., C. M. Rojas, C. H. Yang, and A. O. Charkowski. 2006. Harpin
mediates cell aggregation in Erwinia chrysanthemi 3937. J. Bacteriol. 188:2280-
2284.

Yu, J., S. N. Hu, J. Wang, G. K. S. Wong, S. G. Li, B. Lin, Y. J. Deng, L. Dai,
Y. Zhou, X. Q. Zhang, M. L. Cao, J. Liu, J. D. Sun, J. B. Tang, Y. J. Chen, X.
B. Huang, W. Lin, C. Ye, W. Tong, L. J. Cong, J. N. Geng, Y. J. Han, L. Li,
W. Li, G. Q. Hu, X. G. Huang, W. J. Li, J. Li, Z. W. Liu, L. Li, J. P. Liu, Q.
H. Qi, J. S. Liu, L. Li, T. Li, X. G. Wang, H. Lu, T. T. Wu, M. Zhu, P. X. Ni,
H. Han, W. Dong, X. Y. Ren, X. L. Feng, P. Cui, X. R. Li, H. Wang, X. Xu,
W. X. Zhai, Z. Xu, J. S. Zhang, S. J. He, J. G. Zhang, J. C. Xu, K. L. Zhang,
X. W. Zheng, J. H. Dong, W. Y. Zeng, L. Tao, J. Ye, J. Tan, X. D. Ren, X. W.
Chen, J. He, D. F. Liu, W. Tian, C. G. Tian, H. G. Xia, Q. Y. Bao, G. Li, H.
Gao, T. Cao, J. Wang, W. M. Zhao, P. Li, W. Chen, X. D. Wang, Y. Zhang, J.
F. Hu, J. Wang, S. Liu, J. Yang, G. Y. Zhang, Y. Q. Xiong, Z. J. Li, L. Mao,
C. S. Zhou, Z. Zhu, R. S. Chen, B. L. Hao, W. M. Zheng, S. Y. Chen, W. Guo,
G. J. Li, S. Q. Liu, M. Tao, J. Wang, L. H. Zhu, L. P. Yuan, and H. M. Yang.

179

 

264.

265.

266.

267.

268.

2002. A draft sequence of the rice genome (Oryza sativa L. ssp indica). Science
296:79-92.

Zhang, Y., and K. Geider. 1999. Molecular analysis of the rlsA gene regulating
levan production by the fireblight pathogen Erwinia amylovora. Physiological and
Molecular Plant Pathology 54:187-201.

Zhang, Y. X., D. D. Bak, H. Heid, and K. Geider. 1999. Molecular
characterization of a protease secreted by Erwinia amylovora. J. Mol. Biol.
289:1239-1251.

Zhao, Y., S. E. Blumer, and G. W. Sundin. 2005. Identification of Erwinia
amylovora genes inducted during infection of immature pear tissue. J. Bacteriol.
187:8088-8103.

Zhao, Y., S. Y. He, and G. W. Sundin. 2006. The Erwinia amylovora aerptZEA
gene contributes to virulence on pear and AerptZEA is recognized by

Arabidopsis RPS2 when expressed in Pseudomonas syringae. Mol. Plant-Microbe
Interact. 19:644-654.

Ziadi, S., P. Poupard, M. N. Brisset, J. P. Paulin, and P. Simoneau. 2001.
Characterization in apple leaves of two subclasses of PR-lO transcripts inducible

by acibenzolar-S-methyl, a functional analogue of salicylic acid. Physiol. Mol.
Plant Pathol. 59:33-43.

180

 

 

 

 

AAAAAAAAAAAAAAAAAAAAAAAAAAA

llIlulllljlllIlyllllmlllllm