a;

a}.
1...
5.. x

a
.
2.
.4. .

.2...

31.9
Q

t.
w . .
2 ”mm...“
.1 a n .
. . . .341...
. $9.59...."
“‘5

«am»... ﬁzﬁfg
auéwmnsvﬁﬁwqa$s
3 . ....§m(.....m....e......u....z.,

z .
hr... 3.5
. a 4.... .

. 1
«RM

I

.adiﬂﬂ.

”1.01.3...

.t I
331%.;
a 1’33:
. {a a . wi’i. .
\ . z 53:
v3

..
try...” .433». ﬂu... . ,
2...... i. “1%..
u!“ .

I13.
.3qu . 31p.
c.1319». 3.! .29.]:
x . , ail-$4.1.
. Lﬂﬂhicaaavrtf
5 «a... I.

5;. Lanna as...
$.43

J: 1.3....

.. 2L...

2

i. 2,:
1.2.1; .

 

 

 

 

uh.

£3...

at . y 2..
wﬁﬁwﬁ . $7.53,}?

A 5: c: l. . n11

kuwgﬂiﬁw

2...? .3 :

 

Wis

This is to certify that the
dissertation entitled

SIGNAL TRANSDUCTION PATHWAYS INVOLVED IN THE
UPREGULATION OF CYCLOOXYGENASE-Z BY 2,2’,4,4’-
TETRACHLOROBIPHENYL

presented by

STEVEN ARTHUR BEZDECNY

has been accepted towards fulﬁllment
of the requirements for the

Doctoral degree in Pharmacolggy and Toxicology

 

' Maﬂ' Projéssor’g Signature

IJI/g/o a
Date

MSU is an Afﬁrmative Action/Equal Opportunity Institution

 

LIBRARY
Michigan- State
University

 

 

 

.—¢-.---o-o-o-o-o-
.--O-o-.-O-C‘U-o-a-O-I---D-l-0-0-C-o-o-o-I-O-I-O-C-0-0-o-Q-o-o-I-I’D-I-I-0-0—O--o-I-o-o-o-o-¢-n-u-o-o-o-I-

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2/05 p:lC|RC/0aIeDue.indd-p.1

 

SIGNAL TRANSDUCTION PATHWAYS INVOLVED IN THE
UPREGULATION OF CYCLOOXYGENASE-z BY 2,2',4,4'-
TETRACHLOROBIPHENYL
By

STEVEN ARTHUR BEZDECNY

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY
Department of Pharmacology and Toxicology

2006

ABSTRACT

SIGNAL TRANSDUCTION PATHWAYS INVOLVED IN THE
UPREGULATION OF CYCLOOXYGENASE—Z BY 2,2',4,4'-
TETRACHLOROBIPHENYL

By

STEVEN ARTHUR BEZDECNY

Polychlorinated biphenyls (PCBs) are ubiquitous, persistent environmental
contaminants that affect a number of cellular systems, including neutrophils.
PCBs can be divided into two broad classes based on the presence or absence of
chlorine atoms in the ortho- position. Congeners that lack chlorines in the ortho-
positions are coplanar and bind with high affinity to the aryl hydrocarbon
receptor to induce changes in cellular function. Congeners containing chlorines
substituted at the ortho- positions cannot attain a coplanar conﬁguration and are,
in general, poor ligands for the aryl hydrocarbon receptor. Among the effects
caused by noncoplanar PCBs is the alteration in ﬁmction of polymorphonuclear
neutrophils. These alterations include increases in superoxide anion production,
activation of phospholipase A2 and subsequent release of arachidonic acid (AA).
Accordingly, the overall goal of the work outlined in this dissertation was to test
the hypothesis that 2,2',4,4',-tetrachlorobiphenyl (2244-TCB) increases COX-2
expression in granulocytic HL-60 cells, and that this increase depends on
activation of intracellular signaling pathways including arachidonic acid release,
superoxide anion production and activation of the p38 mitogen-activated protein

(MAP) kinase. 2244-TCB increased superoxide anion production, AA release

and levels of COX-2 mRNA, protein and enzyme activity. Neither superoxide
anion nor free AA was involved in the 2244-TCB-mediated increase in COX-2
mRNA. Nonetheless, the increases in AA occur at the same time as the
increases in COX-2 protein, raising the possibility that the AA may be used by
the enzyme for eicosanoid production. The 2244-TCB-mediated increases in
COX-2 mRN A, protein and enzyme activity were prevented by pretreatment
with inhibitors of p38 mitogen-activated protein (MAP) kinase. 2244-TCB also
caused the nuclear levels of NF-KB and C/EBP beta to increase. These increases
were also prevented by inhibition of p38 MAP kinase. Additionally, inhibition
of NF-KB prevented the 2244-TCB-mediated increase in COX-2 mRN A.
Inhibition of transcription with actinomycin D reduced the 2244-TCB-mediated
increase in COX-2 mRNA. Taken together, these results suggest that the 2244-
TCB-mediated upregulation of COX-2 involves increased transcription of the

COX-2 gene via a pathway requiring p38 MAP kinase and NF-KB.

Copyright by Steven Bezdecny

2006

To my wonderful wife Kaye
to my son Andrew

to all the friends and family who have made this possible

Acknowledgements

I would love to give thanks to the following people and institutions:

Dr. Patricia Ganey, my professor and mentor
My thesis committee:

Dr. Robert Roth

Dr. Norbert Kaminski

Dr. John Lapres

Lab People: John Buchweitz, John Bunka, Dr. Bryan Copple, Shawn Deng,
Dr. Umesh Hanumegowda, Mary Kinser, Dr. Jim Luyendyk, Dr. Jane Maddox,
Sandy Newport, John Phipps, Rohan Pradha, Cathy Rondelli, Pat Shaw, Erika

Sparkenbaugh, Dr. Francis Tukov, Dr. Steve Yee

The Department of Pharmacology and Toxicology and the Center for

Integrative Toxicology of Michigan State University

Colorado State University, both the school and the football team

Dr. Zakia Alavi, for helping me understand myself

All the men and women of Alcoholics Anonymous, “One day at a time”
All my friends and family for getting me here

My wife and son, who make every day worth ﬁghting for

vi

Table of Contents

LIST OF FIGURES x
Chapter I
INTRODUCTION .................................................................. 1
1.1. Preface .................................................................... 2
1.2.Polychlorinated biphenyls .............................................. 4
1.2.A Occurrence and exposure ................................... 4
1.2.8 Chemistry and structure ..................................... 6
1.2.C Biological effects ............................................. 10
I.2.C.l General Effects .................................... 10
I.2.C.2 Effects in neutrophils .............................. 13
1.3 Neutrophils: Physiological function .................................... 14
1.4 Neutrophils: Activation ................................................... 15
1.5 The HL-60 cell line ....................................................................... 17
1.6 Markers of neutrophil activity ....................................................... 20
I.6.A Degranulation. ............................................................... 20
I.6.B Oxidative burst ............................................................... 20
I.6.C Arachidonic acid release and the
eicosanoid cascade .................................................................. 21
I.6.D Cyclooxygenases ........................................................... 24
I.6.D.1 Cyclooxygenase Function. ............................. 24
I.6.D.2 Cyclooxygenase-2 Regulation ........................ 26
1.7 Summary ....................................................................................... 29
Chapter 2

EFFECTS OF 2,2',4,4'-TETRACHLOROBIPHENYL ON
GRANULOCYTIC HL-6O CELL FUNCTION AND

EXPRESSION OF CYCLOOXYGENASE-2 ............................................ 32
11.1 Summary ................................................................................... 33
11.2 Introduction ............................................................................... 34
11.3. Materials and Methods ............................................................. 37

II.3.A. Chemicals .................................................................... 37
II.3.B. HL-60 cells .................................................................. 37
II.3.C. Exposure to polychlorinated biphenyls ....................... 38
11.3. D. Cellular degranulation ................................................ 38
II.3.B. Superoxide anion production ....................................... 39
II.3.F. Labeling of HL-60 cells with 3H-arachidonic

acid .............................................................................. 39
11.3.G. Determination of arachidonic acid release

from HL-60 cells ......................................................... 40
II.3.H. Determination of COX-2 mRNA ................................. 4O

vii

11.3.1. COX-2 western blotting ............................................... 41

11.3.J . Cyclooxygenase activity assay ..................................... 42
II.3.K. Statistical analysis ....................................................... 43
11.4 Results ....................................................................................... 43
11.4.A. Degranulation of HL-60 cells ...................................... 43
II.4.B. Superoxide anion production ....................................... 46
II.4.C. 3H-AA release .............................................................. 46
11.4.D. Effects of PCBs on COX-2 mRNA expression ........... 46
II.4.E. Effects of PCBs on COX-2 protein expression ............ 51
II.5.F. Effects of PCBs on COX-2 activity .............................. 51
11.6 Discussion ......................................................................... 54

Chapter III
SIGNAL TRANSDUCTION PATHWAYS INVOLVED IN
THE INDUCTION OF CYCLOOXYGENASE-2 BY 2,2',4,4'-

TETRACHLOROBIPHENYL IN HL-6O CELLS ......................................... 58
111.1. Summary .................................................................................... 59
111.2. Introduction ................................................................................ 60
111.3. Materials and Methods ............................................................... 62

111.3.A. Chemicals ................................................................... 62
111.33. HL-60 cells ................................................................. 62
111.3.C. Exposure to inhibitors ................................................. 63
111.3.D. Determination of COX-2 mRNA levels ..................... 63
111.3.E. Western blotting for COX-2 and p38 ......................... 64
111.3.F. Measurement of phospho-p38 and
phospho-ERK .............................................................. 65
111.3.L. Statistical analysis ....................................................... 66
111.4. Results ........................................................................................ 66
111.4.A. Effects of signal transduction inhibitors
on 2244-TCB-mediated 3H-AA release ....................... 66

111.4.B. p38 MAP kinase protein phosphorylation

in the presence of 2244-TCB and signal

transduction inhibitors ................................................. 68
111.4.C. Effects of signal transduction inhibitors

on 2244-TCB-mediated changes in COX-2

mRNA, protein and activity ......................................... 68
111.4.D. Effects of inhibitors on p38 and ERK

phosphorylation ............................................................ 71
111.4.E. Effects of ERK inhibitors on 2244-TCB-

mediated COX-2 mRN A expression ........................... 76

111.4.F. Effect of inhibitors of superoxide anion

production on 2244-TCB-induced changes in

COX-2 mRNA expression .......................................... 76
111.5. Discussion ....................................................................... 79

viii

Chapter IV

2,2’,4,4'-TETRACHLOROBIPHENYL UPREGULATES
CYCLOOXYGENASE-2 1N HL-60 CELLS VIA P38 MITOGEN-

ACTIVATED PROTEIN KINASE AND NF-ch ....................................... 86
NJ Summary ..................................................................................... 87
IV.2 Introduction ................................................................................. 88
IV.3 Materials and Methods ................................................................ 9O

IV.3.A. Chemicals ................................................................... 90
IV.3.B. Exposure to inhibitors ................................................. 91
IV.3.C. Preparation of nuclear extracts ................................... 91
IV.3.D. Determination of nuclear C/EBP and NF-ch ............. 91
IV.3.B. COX-2 mRNA stability assay ..................................... 92
IV.3.F. Statistical analysis ........................................................ 92
IV.4 Results .......................................................................................... 93

IV.4.A. Effects of 2244-TCB on nuclear
C/EBP-beta in the presence and absence

of MAP kinase inhibitors ......................................................... 93
IV.4.B. Effects of 2244-TCB on nuclear NF-ch ..................... 93
IV.4.C. Effects of NF-ch inhibitors on 2244-
TCB-mediated COX-2 mRNA expression .................. 97
IV.4.D. Effect of 2244-TCB on COX-2 mRNA stability ........ 97
IV.5. Discussion ................................................................................. 101
Chapter V
SUMMARY ................................................................................................ 106
BIBLIOGRAPHY ........................................................................................ 1 14

ix

LIST OF FIGURES

Page
Figure 1.1. Structure of the biphenyl ring of a PCB
with attachment points for chlorine molecules indicated ............... 7
Figure 1.2. Steps in the synthesis of eicosanoids
from arachidonic acid ......................................................................... 23
Figure 11.1. Time course for PCB-induced degranulation ........................... 44
Figure 11.2. Concentration-response relationship
for PCB-induced degranulation .......................................................... 45
Figure 11.3. Superoxide anion production in PCB-treated cells ................... 47
Figure 11.4. Time course for 3H-AA release in PCB-treated
cells ..................................................................................................... 48
Figure 11.5. Concentration-response relationship for
3H-AA release in PCB-treated cells .................................................... 49
Figure 11.6. Time course for the expression of COX-2
mRNA and protein in PCB-treated cells ............................................. 50
Figure 11.7. Dose-response relationship for PCB-induced
increases in COX-2 mRNA and protein .............................................. 52
Figure 11.8. COX activity in PCB-treated HL-60 cells ................................. 53
Figure 111.1. 2244-TCB-mediated 3H-AA release in the
presence of signal transduction inhibitors ........................................... 67

Figure 111.2. 2244-TCB-mediated activation of p38 in
the presence of signal transduction inhibitors ..................................... 69

Figure 111.3. 2244-TCB-mediated COX-2 mRNA expression
in the presence of signal transduction inhibitors ................................. 70

Figure 111.4. 2244-TCB-mediated activation of COX-2 in the

presence of signal transduction inhibitors ........................................... 72
Figure 111.5. Effects of inhibitors on ERK phosphorylation ......................... 73
Figure 111.6. Effects of inhibitors on p38 phosphorylation ........................... 74
Figure 111.7. Nuclear JNK is not affected by 2244-TCB .............................. 75

Figure 111.8. Effects of ERK inhibitors on 2244-TCB-mediated
COX-2 mRNA expression ................................................................... 77

Figure 111.9. Lack of effect of reactive oxygen species
inhibition on 2244-TCB-induced upregulation of
COX-2 mRNA expression ................................................................... 78

Figure 111.10. 2244-TCB-mediated 3H-AA release in
the presence of ROS inhibitors ............................................................ 80

Figure 111.11. Proposed mechanism by which 2244-TCB
exposure leads to upregulation of the COX-2 gene ...................................... 85

Figure 1V. 1. 2244-TCB increases nuclear C/EBP-beta ................................ 94

Figure IV.2. The 2244-TCB-mediated increase in
nuclear C/EBP-beta is reduced by p38 inhibitors,
but not by ERK inhibitors .................................................................... 95

xi

Figure IV.3. 2244-TCB increases nuclear NF-ch ........................................ 96

Figure IV.4. The 2244-TCB-mediated increase in nuclear
NF-ch is reduced by p38 inhibitors, but not by ERK
inhibitors .............................................................................................. 98

Figure IV.5. NF-KB inhibitors attenuate the 2244-TCB-
mediated increase in COX-2 mRNA expression ................................. 99

Figure 1V .6. Effects of inhibition of transcription on
2244-TCB-mediated COX-2 mRNA expression ................................ 100

Figure V. 1. Signal transduction pathways involved in
the 2244-TCB-mediated upregulation of COX-2 in
granulocytic HL-60 cells ..................................................................... 111

xii

2244-TCB
3344-TCB
33445-PCB

fMLP
HBSS
IL-1
IL-8
1P3
iPLAz ,
JNK
LPS
MAP
MEK
MPO
NF-KB
OP
NSAID
PCB
PG

LIST OF ABBREVIATIONS

2,2',4,4',-tetrachlorobiphenyl
3,3',4,4'-tetrachlorobiphenyl
3,3’,4,4',5-pentachlorobiphenyl
[3H-5,6,8,9,11,14,15]-Arachidonic acid
Arachidonic acid

Actinomycin D

Aryl hydrocarbon

Bromoenol lactone
CCAAT/enhancer binding proteins
Cyclooxygenase
N,N'-dimethylformamide
Dimethylsulfoxide

Extracellular signal-regulated kinase
formyl-methionyl-leucyl-phenylalanine
Hank’s Balanced Salt Solution
Interleukin-1

Interleukin-8

inositol-l ,4,5-triphosphate
Ca2+-independent PLA;

c-Jun N-terrninal kinase
Lipopolysaccharide
Mitogen-activated protein

MAP kinase kinases
Myeloperoxidase

nuclear factor-kappaB

oleyloxyethyl phosphorylcholine
nonsteroidal anti-inﬂammatory drug
Polychlorinated Biphenyl
Prostaglandin

xiii

PKC
PLAz
PLC
PLD
ROS
SB 1
SB2
SER
SOD
TCDD
TEMPO

TNF-a
Tx

Protein kinase C

Phospholipase A2

Phospholipase C

Phospholipase D

Reactive oxygen species
SB-20219O

SB—203580

Smooth endoplasmic reticulum
superoxide dismutase
2,3,7,8-tetrachlorodibenzo-p-dioxin
4-hydroxy-2,2,6,6-tetramethylpiperidin-1 -
oxyl

tumor necrosis factor-a
Thromboxane

xiv

Chapter I

Introduction

1.1 Preface

Polychlorinated biphenyls (PCBs) are toxic, environmental contaminants
that elicit a wide range of biological effects in mammals. PCBs cause dermal
and ocular effects, hepatotoxicity, neurotoxicity, and endocrine effects, effects
on the reproductive system and effects on both the speciﬁc and non-speciﬁc
branches of the immune system (Safe, 1994; Van den Berg et al, 2006).

PCBs can be divided into two classes based on the presence or absence of
chlorine in the ortho- position. Congeners that lack chlorines in the ortho-
positions are coplanar and bind with high afﬁnity to the aryl hydrocarbon (Ah)
receptor to induce changes in cellular function. Congeners containing chlorines
substituted at the ortho- positions are not coplanar (noncoplanar) and are, in
general, poor ligands for the Ah receptor. The mechanisms by which PCBs in
this latter group cause functional changes in cells are not well understood.

Among the effects caused by ortho-substituted, noncoplanar PCB
congeners is the alteration in function of polymorphonuclear neutrophils
(Brown and Ganey, 1995; Kristoffersen et al, 2002; Olivero and Ganey, 2001;
Olivero-Verbel and Ganey, 1998; Voie et al, 2000), one of the key cells of the
non-speciﬁc immune system. The primary role of neutrophils is to attack and
destroy invading microorganisms. They are normally quiescent and exhibit their
biological activity when activated. Alteration in neutrophil function can have
serious consequences for the organism. Failure of neutrophils to activate results
in compromise of the innate immune system, leading to increased risk of

infection. At the other end of the spectrum, inappropriate activation of

neutrophils can lead to inﬂammatory disease states and injury to host tissue
(Repo, 1987).

Noncoplanar PCBs cause many changes in function of primary rat
neutrophils including stimulation of degranulation, production of reactive
oxygen species (ROS) such as superoxide anion, release of arachidonic acid
(AA), changes in gene regulation, including upregulation of cyclooxygenase-2
(COX-2), and altered response to subsequent stimulation with other agents
(Bezdecny et al, 2005; Brown and Ganey, 1995; Ganey et al, 1993; Olivero and
Ganey, 2001; Tithof et al, 1998).

As mentioned above, the mechanisms by which noncoplanar PCBs
cause toxicity is unknown. By seeking to understand the mechanisms by which
noncoplanar PCBs evoke functional changes in a human, neutrophil-like cell
line, we may be able to predict potential toxicity from these and similar
xenobiotics as well as gain a better understanding of the functioning of human
neutrophils. Accordingly, the overall goal of the work outlined in this
dissertation was. to test the hypothesis that 2,2',4,4',-tetrachlorobiphenyl (2244-
TCB) increases COX-2 expression in granulocytic HL-60 cells, and that this
increase depends on activation of intracellular signaling pathways including AA
release, superoxide anion production and activation of the p38 MAP kinase.

To provide the background and rationale for these studies, in the
remainder of this Introduction what is known about PCBs, especially
noncoplanar PCBs, their chemistry and toxicity, and their effects on neutrophil

and HL-60 cell function will be presented. In addition, what is known about

neutrophils and granulocytic HL-60 cells, with particular emphasis on markers
of activation, will be reviewed. The function and regulation of the

cyclooxygenase gene in neutrophils and HL-60 cells will also be discussed.

1.2 Polychlorinated biphenyls

1.2.A Occurrence and exposure

PCBs are ubiquitous, man-made, environmental contaminants
that affect a number of cellular systems. PCBs were widely used for over 40
years due their heat-resistant properties, low conductivity and chemical
inertness. These properties made PCBs a very useful component of safety ﬂuids
used to insulate and cool heavy electrical equipment such as transformers and
capacitors (Hutzinger et al, 1974). PCBs as a class display a wide range of
chemical properties, some of which include low vapor pressure, low water
solubility and a relatively high resistance to chemical transformation (Shiu and
Mackey, 1986). However the very same properties that made PCBs attractive
for use in electrical equipment, i.e. their low water solubility and chemical
inertness, allow PCBs to bioaccumulate and biomagnify in the food chain
(Kannan et al, 1998).

There are no natural sources of PCBs; they only result from human
activities. Between 1929 and 1977 over 700,000 tons of PCBs were produced in
the United States by Monsanto Chemical Company (St. Louis, MO), according
to the US. Environmental Protection Agency (U SEPA, 1999). PCB production

in the US. was halted in 1977 as the toxicity of PCBs began to be appreciated;

however an estimated one and a half million tons of PCBs have been released
into the environment worldwide (Tanabe, 1987). Currently, PCBs can be found
far from production sites due to their extensive use, persistence and wide
distribution (Armitage et al, 2006; Subramanian et al, 1983). Remote sites
where PCBs have been found include Antarctica (Kallenbom et al, 1998; Sobek
et al, 2006), Alaska (Rubin et al, 2006) and lake water in Nepal (Galassi, 1997).

There are three current sources of PCBs in the environment. Many PCB-
containing items produced before the ban on PCB production, particularly
transformers and capacitors, are still in use around the world. As these items age
the possibility for leakage of PCBs is increased. In addition, PCBs can be
produced as an inadvertent byproduct in any industrial process that involves
chlorine, carbon and high temperatures. Finally, the majority of PCBs that were
disposed of before the production ban in 1977 were sent to landﬁlls and other
storage and disposal facilities that were not adequate to prevent release of PCBs
into the environment. These facilities represent another source of environmental
PCB contamination (U SEPA, 1999).

PCBs are found environmentally as mixtures, the sources of which are
commercial preparations (Tanabe et al, 1987). Commercially available PCB
preparations comprise several congeners, both coplanar and noncoplanar, and
these mixtures are labeled based on the total chorine content. For example,
Aroclor 1254 consists of a mixture of PCB congeners that is approximately 54%

chlorine by weight.

Due to the ubiquitous nature of PCBs, detectable levels of PCBs have
been found in human blood, milk (Giesy and Kannan, 1998) and other tissues,
such as adipose and placental tissue (Laden et al, 1999). The majority of human
exposures are due to consumption of contaminated foods, particularly seafood
(De Roos et al, 2005; Kostyniak et al, 2005), though occupational exposures

also occur (Bosetti and Weerasinghe, 2003).

1.2.8 Chemistry and structure

PCBs consist of a biphenyl ring with one to ten chlorine atoms
attached (Figure 1.1). There are 209 possible PCB congeners, depending on the
number and position of the chlorine atoms (Safe at al, 1985). Approximately
130 possible congeners have been identiﬁed in commercially available PCB
preparations (Giesy and Kannan, 1998). The metabolism, toxicity and
mechanism of action vary among PCB congeners (Seegal, 1996). Generally
PCBs exist as oily liquids or solids. They are colorless to light yellow in color
and have no known smell or taste (ATSDR, 2001).

PCBs can be divided into two broad categories based on the chemical
structure. PCB congeners that do not contain chlorine atoms at the ortho-
positions (2, 2', 6 or 6') of the biphenyl ring can rotate freely around the central
bond. These congeners can achieve a ﬂat or “coplanar” conformation, in which
both phenyl rings lie in the same plane. “Noncoplanar” PCB congeners do
contain chlorine atoms substituted at the ortho- positions. The presence of these

chlorine atoms causes steric hindrance that limits rotation around the central

5 6 6' 5'
4 O O 4'
3 2 2' 3'

Figure 1.1. Structure of the biphenyl ring of a PCB with attachment points
for chlorine molecules indicated.

bond. This prevents both phenyl rings from lying in the same plane, forcing the
molecule into a noncoplanar conformation. Coplanar and noncoplanar PCB
congeners can cause different effects and act via different mechanisms (Safe et
al, 1985).

In mammals, cytochrome P450 enzymes, including the 1A1, 1A2, 23]
and 2B2 enzyme isoforrns, can metabolize PCBs to intermediate arene oxides.
These oxides are further metabolized into hydroxyl or methyl sulphone
metabolites that are then converted into sulphate or glucuronide conjugates and
excreted from the organism (Bergman er al, 1994). Metabolism of PCBs to
more polar compounds is required for proper clearance; however rates of PCB
metabolism vary greatly with species and with the degree and positions of
chlorination. The most readily metabolized congeners have adjacent
unsubstituted carbon atoms at the 34 positions. Congeners that lack these
unsubstituted carbon atoms are metabolized very slowly and therefore cleared
very slowly. PCBs that are not readily cleared tend to concentrate in adipose
tissue (Matthews and Dedlick, 1984; Minh et al, 2006). The highly unstable
arene oxides also react to form dihydrodiols, various hydroxyl metabolites as
well as covalently bound protein, RNA and DNA adducts. These metabolites
are generally less toxic then their parent compounds but still evince a variety of
biological activities, including mitochondrial uncoupling, inhibition of various
P450-dependent enzyme activities. Furthermore, they can interfere with proper
hormone function, both by mimicking hormones such as estrogen, or binding to

proteins involved in hormone transport and binding, such as prealbumin, a

major serum thyroxine-binding protein (Ahmad et al, 2003; Ghisari and
Bonesﬁeld-Jorgenson, 2005; Patterson et al, 1994; Safe, 1994; You et al, 2006).

Many toxicology studies have been performed using the seven different
Aroclors that were produced commercially (ATSDR, 2001). The information
derived from these studies, while useful, is limited in terms of understanding the
speciﬁc mechanisms by which PCBs act, as percentages of speciﬁc congeners
can vary among different lots of the same Aroclor mixture. Also, little is known
about how individual PCB congeners in a mixture may interact to potentially
cause synergistic or inhibitory biological effects.

Coplanar and noncoplanar PCBs are degraded in nature to differing
extents. Coplanar PCBs tend to have shorter half-lives and are removed from
the environment more rapidly than are noncoplanar congeners (Patterson et al,
1994). This leads to the enrichment of noncoplanar PCB congeners in the
environment when compared to the commercially produced mixtures (J ohansen
et al, 1996). This enrichment of noncoplanar PCBs in the environment, coupled
with the generally poor understanding of how these congeners mediate their
effects, warrants further investigation into the speciﬁc mechanisms by which

noncoplanar PCBs mediate their effects.

1.2.C Biological effects
I.2.C.l General Effects

PCBs exhibit a wide range of biological effects in
animals. PCBs are considered by the US. to be probable human carcinogens
(Cogliano, 1998) and have been demonstrated to cause a number of non-cancer
effects including dermal lesions and ocular effects (Nakayama, 1999), changes
in hepatic glutathione regulation and hepatotoxicity (Twaroski et al, 2001;
Sanderson et al, 1996) and endocrine effects including alterations in rat brain
thyroid hormone status and reductions in progesterone levels (Augustowska et
al, 2001; Morse er al, 1996; Safe, 2004). In addition PCBs have effects on the
male rat reproductive system including reduced sperm production and increased
numbers of abnormal sperm, as well as increased testicular and prostate weights
(Faqi et al, 1998). Effects on the nervous system caused by PCB exposure
include poorer gross motor function, poorer infant visual recognition memory
and general cognitive deﬁcits (Jacobson and Jacobson, 1997). Impaired
cardiovascular function (Carpenter, 2006; Warshaw et al, 1979) and modulation
of both the speciﬁc and nonspeciﬁc branches of the immune system also occur
due to PCB exposure (Bezdecny et al, 2005; Carpenter, 2006; V08 and Van

Loveren, 1998).
Coplanar and noncoplanar PCB congeners cause different effects via
different mechanisms. Coplanar PCBs are good ligands for the Ah receptor and
can cause gene induction via an Ah receptor—dependent mechanism (Safe et a1,

1985). Indeed, the structure and toxic effects of coplanar congeners are similar

10

to those of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), the prototypical ligand
for the Ah receptor (Kafaﬁ et al, 1993). For example, like TCDD, 3,3',4,4',5-
pentachlorobiphenyl (33445-PCB), one of the best studied PCB congeners,
induces hepatic enzymes involved in xenobiotic metabolism, such as aryl
hydrocarbon hydroxylase (Sanderson et al, 1996), and promotes hepatotoxicity
by reducing hepatic levels of glutathione and glutathione-related enzymes
(Twaroski et al, 2001). 33445-PCB has also been implicated in endocrine
disruption, including decreases in progesterone levels (Augustowska et al,
2001) and increases in thyroid hormone metabolism (Van Birgelen et al, 1995).
In addition, 33445-PCB causes behavioral effects and learning deﬁcits in rats
(Rice, 1996). Immunosuppression, a hallmark of PCB exposure, has also been
linked to 33445-PCB exposures. Speciﬁcally, reductions in the antibody
response (Regala et al, 2001) and thymic atrophy with decreases in CD4 and
CD8 T-cell levels (Grasman and Whitacre, 2001; Fox and Grasman, 1999) have
been demonstrated. These effects are all mediated via activation of the Ah
receptor, and TCDD exposure causes similar effects (Bimbaurn and Tuomisto,
2000; Camacho et al, 2004; Fujimaki et al, 2002; Kakeyama and Tohyama,
2003; Kim and Yang, 2005; Viluksela et al, 2000; Watanabc et al, 2004)

In contrast to coplanar PCBs, noncoplanar PCBs do not make good
ligands for the Ah receptor due to their inability to form the ﬂat, coplanar
conformation required to bind to the receptor. Because of this fact, the toxicity
of noncoplanar PCBs has been considered secondary to that of the coplanar

congeners for many years. It has now been shown that noncoplanar PCBs can

11

cause a number of effects on biological systems, including effects on the
nervous, endocrine, reproductive, and immune systems (Fischer et al, 1998;
Loch-Caruso, 2002). Some studies have suggested that noncoplanar PCBs can
interact directly with cellular receptors (Angus and Contreras, 1995; Pessah et
al, 2006; Wong et al, 1997); however a receptor-mediated mechanism of action
for the toxicity of noncoplanar PCBs has yet to be elucidated. The effects
noncoplanar PCBs have on tissues and organs include increased release and
decreased synthesis of insulin in rat insulinoma cells (Fischer et al, 1996),
changes in the concentrations and distribution of dopamine and 5-
hydroxytryptamine in female rat brains (Chu et al, 1996), increases in rat liver
weight (Lecavalier et al, 1997), reduced phagocytosis by neutrophils and
monocytes in marine mammals (Levin et al, 2004), and modulation of
superoxide anion production in rat neutrophils (Brown and Ganey, 1995).

On a cellular level there are many effects of exposure to noncoplanar
PCBs. One such effect is an increase in intracellular free Ca2+ levels. Two
distinct pathways have been described whereby noncoplanar PCBs increase
intracellular Ca2+ concentrations. The ﬁrst pathway involves activation of
phospholipase C (PLC), leading to increased production of inositol-1,4,5-
triphosphate (1P3). 1P3 then interacts with 1P3 receptors on the smooth
endoplasmic reticulum (SER), causing the release of Ca2+ from intracellular
stores (Tithof et a1, 1995). The second route by which intracellular Ca2+ can be
increased by noncoplanar PCBs involves stabilization of ryanodine receptors by

an immunophilin F KBPlZ-dependent mechanism. Exposure to noncoplanar

12

PCBs facilitates interaction between FKBP12 and ryanodine receptors, leading
to conformational changes in the ryanodine receptor. These conformational
changes cause an increased probability of the ryanodine receptor being in an
open conﬁguration; leading to increased release of calcium from SER stores
(Wong and Pessah, 1997).

Alterations in Ca2+ homeostasis caused by exposure to PCBs have
been demonstrated in neutrophils (Brown and Ganey, 1995), in cerebellar
granule cells (Kodavanti et al, 1993), in uterine tissue (Bae et al, 1999; Loch-
Caruso, 2002) and in mammalian brain (Wong and Pessah, 1997). Changes in
Ca2+ homeostasis induced by noncoplanar PCBs have been shown to alter the
synthesis and release of insulin in a cultured cell line (Fischer et al, 1996) as

well as to change dopamine levels in areas of the brain (Seegal et a1, 1990).

I.2.C.2 Effects in neutrophils

The focus of this dissertation is to better understand the
impact of exposure to noncoplanar PCBs on neutrophil function. Exposure to
noncoplanar PCBs causes increased kinase activity, activation of phospholipase
A2 (PLA2), increased superoxide anion production, modulation of degranulation
and increased production of inositol phosphates in rat neutrophils (Brown et al,
1998; Brown and Ganey, 1995; Olivero and Ganey, 2000; Tithof et al, 1997;
Tithof et a1, 1996; Tithof et al, 1995). Additionally, in neutrophils isolated from
marine mammals, such as beluga whales and bottlenose dolphins, PCB

exposure decreased phagocytosis (Levin et al, 2004). Interestingly, the same

13

PCB exposure did not affect neutrophil phagocytosis in mice (Levin et al,
2005). In human neutrophils, PCB exposure caused increased activation of
NADPH oxidase and subsequent increases in superoxide anion production
(Fonnum et al, 2006) as well as modulation of leukotriene production in
neutmphils stimulated with other agents (Raulf and Konig, 1991).

Human exposure to PCBs can result in increased risk of disease due to
PCB-mediated suppression of the immune system (Aoki, 2001; Carpenter,
2006; Levin et al, 2005). Human exposure to PCBs causes suppression of the
delayed-type skin response to bacterial proteins (Chang et al, 1982), decreased
phagocytosis in leukocytes (Levin et al, 2005) and decreased immune response
to allergens (Noakes et al, 2006). Additionally, PCBs decrease overall antibody
levels (Nakanishi et al, 1985), but increase the levels of autoantibodies,
increasing the risk of autoimmune disease (Schoenroth et al, 2004). PCBs also
increase the carcinogenic effects of other chemicals, increasing the risk of tumor
formation (Carpenter, 2006).

To understand the mechanisms by which noncoplanar PCBs affect
function of neutrophils, it is important to understand neutrophil function under

physiologic conditions.

1.3 Neutrophils: Physiological function
Neutrophils are the predominant white blood cell in the human
circulatory system and are one of the most important cells of the innate immune

system. The primary role of neutrophils is to attack and destroy invading

14

microorganisms. They exhibit the most rapid response to tissue injury of any
immune cell. Neutrophils are also one of the major cell types involved in the
inﬂammatory response. During tissue injury neutrophils are recruited from the
bloodstream to the site of damage. This recruitment involves activation of both
neutrophils and vascular endothelial cells, leading to expression of cellular
adhesion molecules on both cell types. E- and P-selectins expressed by
endothelial cells weakly interact with mucin-like or sialyl Lewis adhesion
molecules on the neutrophil, leading to the neutrophil rolling along the
endothelial cell lining of the blood vessel. During rolling the neutrophil
typically becomes activated by chemoattractant factors, leading to increased
interaction between neutrophil integrin molecules and Ig-superfamily adhesion
molecules on the endothelium. This interaction stabilizes the neutrophil on the
endothelium, and it then migrates through the vessel wall into the tissue
(Tonnesen, 1989). Once at the site of injury, neutrophils can destroy invading
microorganisms by releasing cytotoxic enzymes and stored mediators from
intracellular granules, as well as by phagocytosis of microorganisms and
production of reactive oxygen species. This process is referred to as neutrophil

“activation” (Clark, 1990; Cohen, 1976; McDonald, 2004).

1.4 Neutrophils: Activation
Neutrophils are normally quiescent, only exhibiting their biological
activity when activated. Given the role of neutrophils in host defense and the

requirement for activation, the mechanisms by which neutrophils become

15

activated are of great importance. Failure of neutrophils to activate results in
severe compromise of the immune system, leading to increased risk of infection.
At the other end of the spectrum, inappropriate activation of neutrophils can
lead to inﬂammatory disease states, as the activated neutrophils damage host
tissue (Kulberg et a1, 1999). Neutrophils can be activated by inﬂammatory
stimuli such as interleukin-1 (IL-1), interleukin-8 (IL-8) and tumor necrosis
factor-a (TN F-a) as well as by products released by bacteria such as
lipopolysaccharide (LPS) and formyl-methionyl peptides (Ellis and Beaman,
2004; Wilson, 1985). Activation of neutrophils involves a series of intracellular
biochemical events in response to exposure to activating stimuli. These events
are responsible for the changes observed in neutrophil function following
activation, such as degranulation and production of superoxide anion. The end
result of this activation is the migration of neutrophils to sites of inﬂammation
and production of mediators that can degrade and destroy invading
microorganisms (Becker, 1976; Haag-Weber et a1, 1989). Gaining a better
understanding of neutrophil function is a critical step in understanding the
mechanisms by which neutrophils participate in both host defense and
inﬂammation.

Of the variety of stimuli that can activate neutrophils the peptidyl agent
formyl-methionyl-leucyl-phenylalanine (fMLP) is the most widely studied and
understood and serves to illustrate the biochemical processes involved in
neutrophil activation. The agent fMLP activates neutrophils, leading to ROS

production and degranulation. fMLP is also a total degranulation stimulus; that

16

is, exposure to fMLP induces degranulation of all three classes of neutrophil
granules (see section 1.6.A). As such, fMLP is useful in demonstrating the
biochemical processes involved in neutrophil activation.

The process of fMLP-induced activation is mediated via a membrane G-
protein-coupled receptor, which leads to Ca2+ mobilization (Lad et al, 1985)
and activation of second messengers such as PLC, tyrosine kinases, protein

kinase C (PKC), phospholipase D (PLD) and PLAz (Krause et al, 1985).

1.5 The HL-60 cell line

Due to the difficulty in obtaining and using human neutrophils, human
cell culture lines are often used as a substitute in experimental procedures. HL-
60 cells are one such cell line. The HL-60 cell line is a human, promyelocytic
leukemia cell line. HL-60 cells are predominately promyelocytes and exhibit
distinct morphological and histochemical myeloid characteristics (Collins et a1,
1979). HL-60 cells, especially those under passage 60, display spontaneous
differentiation, which can be increased by exposure to polar-planar agents, like
dimethylsulfoxide (DMSO) or other agents such as retinoic acid (Breitrnan et al,
1980; Collins et al, 1978). HL-60 cells can be differentiated into four general
types of cells: these are (a) granulocytes, (b) monocytes, (c) macrophage-like
cells and (d) eosinophils (Collins, 1987). These categories are somewhat
arbitrary, as certain differentiating agents give rise to cells that exhibit
characteristics from multiple categories. In this Introduction 1 will focus on the

granulocyte differentiation used in this dissertation research.

17

_ . - , . -3..—
e- -. .. .a=;f‘—_j‘:§".. -

Several compounds can be used to induce granulocytic differentiation. In
addition to polar-planar compounds and retinoic acid, actinomycin D (ActD),
hypoxanthine, tunicamycin, 6-thioguanine and L-ethionine can induce
granulocytic differentiation of HL-60 cells (Collins, 1987). Different inducing
compounds act via different mechanisms and can cause differing degrees of
cellular maturation (Dufer et al, 1989). Of the compounds that induce
granulocytic differentiation in HL-60 cells, DMSO is the most widely used. As
little as 8-18 hours of exposure to DMSO is enough to induce terminal
differentiation of a signiﬁcant subset of the HL-60 cells exposed to the
treatment (Tsiﬁsoglou, 1985). Initiation of differentiation leads to a dramatic
decrease in cell proliferation; cell division comes almost to a halt after three
days of exposure to DMSO (Brackman et a1, 1995) and differentiated cells die
via apoptosis within two weeks (Martin et al, 1990). While differentiation can
be initiated in as little as 8 hours, HL-60 cells are typically treated with DMSO
for 5-7 days. After this period of treatment the majority of the treated cells have
differentiated into morphologically mature myelocytes, metamyelocytes and
banded or segmented neutrophils (Collins, 1978).

Being that these differentiated cells have their origin in an immortalized
cell line, they are not identical to true human neutrophils. In fact by several
standards granulocytic differentiation of HL-60 cells is deﬁcient. They have
decreased numbers of secondary granules; they are predominantly
metamyelocytes and banded neutrophils as opposed to fully differentiated,

multilobed neutrophils; and their LDH isoenzyme proﬁle differs quantitatively

18

from true human neutrophils, all of which are consistent with incomplete
differentiation (Collins, 1987). However, despite their leukemic origin and
karyotypic abnormalities (Collins et al, 1977), differentiated HL-60 cells
display the ftmctional characteristics commonly associated with normal human
blood granulocytes, including chemoattractant responses, phagocytosis,
superoxide anion production, microorganism killing and expression of cell
surface receptors (Collins, 1987; Newburger et al, 1979; Collins et al, 1978).
Additionally, differentiated HL-60 cells produce a number of eicosanoids upon
activation. These eicosanoids include PGEz, PGFla, PGFZQ” PGD2 and
thromboxane B2 (Sadler and Badwey, 1988; Sanduja et al, 1988). All these
properties are either absent in undifferentiated HL-60 cells, or are greatly
reduced in comparison to granulocytically differentiated cells. Granulocytic HL-
60 cells are not, however, as efﬁcacious in these functions as are normal human
granulocytes. The maximal performance of each of these functions in HL-60
granulocytes is 50-100% compared to a normal neutrophil (Newburger et al,
1979).

While HL-60 cells have some differences from true human neutrophils,
they remain very similar functionally and can serve as a useﬁll model to study
human neutrophil function. HL-60 cells undergo activation events similar to
those in neutrophils such as oxidative burst, degranulation and the
cyclooxygenase/arachidonic acid cascade. As these activation events are

relevant to this thesis, they will be discussed here.

19

1.6 Markers of neutrophﬂ activity

1.6.A Degranulation

The degranulation response in neutrophils can be triggered by
chemical factors such as fMLP and the complement protein CSa (Henson et al,
1978) and is one of the most studied cellular processes that neutrophils undergo.
It involves the exocytosis of three types of intracellular vesicles, or granules,
which contain hydrolytic enzymes such as elastase, B—glucuronidase, lysozyme
and myeloperoxidase (MPO). Different types of granules contain different
components and exhibit different kinetics of degranulation.

Primary azurophillic granules contain MPO, lysozyme and the
membrane protein CD63 (Kuijpers et al, 1991). MPO generates hypochlorous
acid and other halogenated agents as a host defense mechanism. However these
compounds can also cause host tissue injury (Hazen et al, 1996). Secondary
granules, also called secretory vesicles, are more easily mobilized than are the
primary azurophillic granules. Secondary granules contain cytochrome B553 and
the CD11b/CD18 heterodimeric glycoprotein (Calafat er al, 1993). Tertiary
granules store gelatinase, and release of these granules has been implicated in
the upregulation of the CD11b/CD18 complex on the plasma membrane (Lacal

et al, 1988).

I.6.B Oxidative burst

Neutrophils phagocytose invading microorganisms, and

phagocytosis leads to increased oxygen consumption by the cell, due to ROS

20

production. ROS then destroy the phagocytosed microorganism. The main
enzyme involved in ROS production in neutrophils is NADPH oxidase. For
NADPH oxidase to function properly, both cytoplasmic as well as membrane-
associated proteins have to be assembled into a membrane-bound complex.
Once assembled this complex converts molecular oxygen into superoxide anion.
A variety of factors facilitate assembly of the NADPH oxidase complex in
neutrophils, including linoleic acid and AA (Bouzidi and Doussiere, 2004;
Henderson et al, 1993) which increase the number of assembled NADPH
oxidase complexes as well as the affinity of these complexes for molecular
oxygen. Eicosanoids, such as leukotriene B promotes p47phox phosphorylation
and translocation (Serezani et al, 2005), and homocysteine which increases
translocation of p47phox and p67phox subunits of NADPH oxidase to the
plasma membrane (Alvarez-Maqueda et al, 2004). In addition, diacylglycerol
and phoshpatidic acid interact directly with NADPH oxidase components

(Palicz et al, 2001).

1.6.C Arachidonic acid release and the eicosanoid cascade

AA is a fatty acid that plays a very important role in the
neutrophil, both as a second messenger and as a substrate for eicosanoid
production. In resting cells, AA is stored within the cell membrane, esteriﬁed to
glycerol in phospholipids. A receptor-dependent event, requiring a transducing
G protein, initiates phospholipid hydrolysis and releases the fatty acid into the

intracellular medium. Three enzymes are capable of mediating this deacylation

21

 

 

reaction: PLA2, PLC, and PLD. PLAz catalyzes the hydrolysis of phospholipids
at the sn (stereospeciﬁc numbering)-2 position. Therefore, this enzyme can
release AA in a single-step reaction. By contrast, PLC and PLD do not release
free arachidonic acid directly. Rather, they generate lipid products containing
AA (diacylglycerol and phosphatidic acid, respectively), which can be released
subsequently by diacylglycerol- and monoacylglycerol-lipases (Dennis et al,
1991)

Once released, free AA has three possible fates: reincorporation into
phospholipids, diffusion outside the cell, and metabolism into eicosanoids.
Metabolism is carried out by three distinct enzyme pathways expressed in
neural cells: cyclooxygenase, lipoxygenases, and cytochrome P450 (Figure 1.2.).
Several products of these pathways act within cells to modulate the activities of
ion channels, protein kinases, ion pumps, and neurotransmitter uptake systems.
The newly formed eicosanoids may also exit the cell of origin and act at a
distance, by binding to G-protein-coupled receptors present on nearby cells.
Finally, the actions of the eicosanoids are terminated by diffusion, uptake into
phospholipids, or enzymatic degradation (Bos et al, 2004).

Examples of eicosanoids include the prostaglandins (PGs),
thromboxanes, leukotrienes, and epoxyeicosatrienoic acids. They play roles in
inﬂammation, fever, regulation of blood pressure, blood clotting, control of
reproductive processes and tissue growth, and regulation of the sleep/wake

cycle (Abramson and Weissmann, 1989; B05 et al, 2004; Dennis et a1, 1991).

22

 

 

Arachidonic Acid
COX-1, COX-2 5-Lipoxygenase
PGH2 S-HPETE
ii I?
PGIZ, PGan, PGDZ, PGEZ, TXA2 LTA4

1.113,, ch,, LTD4, LTE,

Figure 1.2. Steps in the synthesis of eicosanoids from arachidonic acid.

23

AA can also act alone as a second messenger upon release. Free AA modulates
the activity of a number of cellular components, including increasing PKC
activation (Chalimoniuk et al, 2004). Release of calcium from intracellular
stores (Peppiatt et al, 2004) is also caused by free AA. In addition
downregulation of nitric oxide formation (Palomba et al, 2004), mediation of
muscarinic inhibition and enhancement of N-type calcium current in
sympathetic neurons (Liu and Rittenhouse, 2003) as well as activation of p42

MAP kinase, c-Jun kinase, and p38 MAP kinase (Hernandez et al, 1998).

I.6.D chooxygenases ‘
I.6.D.1 Cyclooxygenase Function
COX-1 and COX-2 are important enzymes that catalyze
the committed step in the synthesis of prostaglandins and thromboxancs.
Cyclooxygenases are particularly important, as they are the main targets of
nonsteroidal anti-inﬂammatory drugs (N SAIDS) such as aspirin, ibuprofen and
COX-2-speciﬁc inhibitors like celecoxib. Inhibition of cyclooxygenases acutely
reduces inﬂammation, pain and fever. Cyclooxygenases have also been
implicated in fatal thrombotic events, as well as in the development of
Alzheimer’s disease and several types of cancers (Smith et al, 2000).
The ﬁrst step catalyzed by cyclooxygenases involves the oxidation of
AA to hydroperoxy endoperoxide PGGz by means of the cyclooxygenase
activity of the COX enzyme. The second step is the reduction of this

intermediate into hydroxy endoperoxide PGH2 by means of the peroxidase

24

activity of the COX enzyme. PGHZ can then be transformed by a wide range of
enzymatic and non-enzymatic mechanisms into the primary prostanoids, which
include PGEz, PGan, PGDz, PGIz and TxAz (Smith et al, 2000; Vane et al,
1998). These products then exit the cell via a carrier-mediated process (Chan et
al, 1998) where they can act on G protein-linked prostanoid receptors, or in
some cases these products may act on nuclear receptors.

COX-1 and COX-2, while arising from different genes, are very similar
both in structure and in their catalytic activity and can be co-expressed in the
same cell. COX-1 activity is found in most cells of the body but is of particular
importance in cells of the gastrointestinal tract, the kidney, in platelets and in
regions of the CNS, notably in the forebrain. COX-1 resides in the endoplasmic
reticulum, and its activity is constitutive and is typically found at constant levels
(Vane et al, 1998; Smith et al, 1996). Products of COX-1 act as “local”
hormones (Smith et al, 1996).

COX-2 activity is typically present at low to negligible levels in normal
cells; however, it is strongly induced by a variety of pro-inﬂammatory stimuli,
such as TNF-a, IL-l, IL-2 and LPS. COX-2 is an immediate early gene: protein
levels can increase and decrease within hours aﬂer exposure to a single stimulus
(Smith et al, 2000; Vane et a1, 1998). Both de novo synthesis and post-
transcriptional regulation have been shown to contribute to the magnitude and
duration of COX-2 mRNA expression (Smith et al, 1996). COX-2 activity is
most commonly observed in inﬂammatory cells and is also constitutively

present in several regions of the central nervous system (cortex, hippocampus,

25

hypothalamus, spinal cord) where its products appear to mediate fever and pain
responses. COX-2 is considered to serve two roles in cells where it is expressed.
The ﬁrst is to augment the activity of COX-1 in the endoplasmic reticulum or to
substitute for COX-l in cells that do not express it. The second role for COX-2
takes place on the lumenal surface of the inner membrane of the nuclear
envelope. Prostanoids synthesized here do not get exported from the cell, but
instead act on nucleoplasmic or nuclear membrane targets. It is thought these

prostanoids play a role in cell differentiation and replication (Smith et al, 2000).

I.6.D.2 Cyclooxygenase-2 Regulation
A number of studies have been performed to determine
the mechanisms by which COX-2 is induced, and from these some general
conclusions can be drawn about regulation of this gene. The most commonly
elevated growth factors and mediators of inﬂammation, such as IL-l, TNF-a,
and LPS, are the factors to which the COX-2 gene is most responsive (Smith et
al, 2000; Vane et al, 1998). A number of shared or convergent pathways have
been described that are likely involved in transcriptional regulation of COX-2 in
response to inﬂammatory mediators. These include pathways involving nuclear
factor-kappaB (N F-ch) and the CCAAT/enhancer binding proteins (C/EBP;
Poli, 1998; Ghosh et al, 1998). In addition, one or more of three MAP kinase
pathways may be involved (Su and Karin, 1996).
In mammalian cells activity of NF- K3 is regulated by its association with

its inhibitory subunit, Ich. NF -x3 is activated by many of the same agents that

26

activate neutrophils, such as IL-1 , TNF-a and endotoxin. Whereas the initial
steps involved in NF-ch activation vary among cell types these compounds
ultimately activate kinases that phosphorylate the Ich subunit, causing it to
dissociate from NF-xB. NF-ch is then translocated into the nucleus where it
binds to transcriptional response elements (Wulczyn et al, 1996). There are four
NF «B binding sites on the COX-2 promoter and NF- KB has been repeatedly
shown to play an important role in the regulation of COX-2, particularly in
neutrophils and granulocytic HL-60 cells (Han et al, 2005; Keum et al, 2003;
Takada and Aggarwal, 2004).

C/EBP is a family of transcription factors containing six known members.
In neutrophils C/EBPs play an important role in cellular maturation. The
regulation of C/EBPs seems to involve transcription of both full-length and
truncated isoforms of the speciﬁc C/EBP. The full-length isoforms bind to and
activate C/EBP binding domains in the nucleus, changing gene transcription.
The truncated isoforms bind to the DNA, but lack the transactivation domain
required for their transcriptional activity, both failing to change gene
transcription as well as preventing “active”, full-length C/EBP from binding
(Lekstrom-Himes, 2001). C/EBP activation in regulation of the COX-2 gene has
been shown in murine macrophages (Chen et al, 2004), human endometrial
stromal cells (Tamura et al, 2003), human T-cells (Barat and Tremblay, 2003)
as well as osteoblastic MC3T3-E1 cells (Harrison et al, 2000).

MAP kinase pathways have also been implicated in COX-2 regulation.

There are three major families of MAP kinases: the p38 kinase family, the

27

extracellular signal-regulated kinase (ERK) family and the c—Jun N-terminal
kinase (JN K) family. All three of these regulate COX-2 expression. MAP kinase
signaling cascades can be activated by a variety of different cellular stimuli and
mediate a wide range of responses (Chang and Karin, 2001). The ERK-pathway
is activated in response to cytokines and growth factors and primarily mediates
mitogenic and anti-apoptotic signals. The p38 family of MAP kinases is
primarily activated by stress stimuli and also by the activation of some cytokine
receptors. The p38 MAP kinase family is involved in the regulation of apoptosis
and cell cycle arrest, induction of cellular differentiation, cytokine production
and inﬂammation. The JNK MAP kinase family is also activated in response to
stress and growth factors and mediates signals regulating apoptosis, cytokine
production and cell cycle progression (Kyriakis and Avruch, 1996).

Activation of MAP kinases requires a dual phosphorylation on threonine
and tyrosine residues found in specific motifs for each kinase family. The
phosphorylation of each MAP kinase group is regulated by upstream kinases
called MAP kinase kinases (MEKs) which are relatively speciﬁc for their target
MAPK. MEKI and 2 act on the ERK family, MEK3, 4 and 6 act on the p38
family and MEK4 and 7 act on the JNK family of kinases. Activation of MEK
is regulated by another upstream group of serine/threonine kinases, called MEK
kinases, which phosphorylate MEKs on speciﬁc serine residues. Some of the
MEK kinases that have been identiﬁed include the Raf family of kinases, Mos

and Tp12, which are speciﬁc for ERK activation, and the mixed-lineage kinases,

28

Mekk kinases, Takl, Ask] and Ask2, which act on both the p38 and JNK
families of kinases (Platanias, 2003).

MAP kinase-dependent regulation of COX-2 expression has been shown
in numerous systems, involving all three MAP kinase cascades. The p38 MAP
kinase regulates COX-2 transcription as well as mRNA stability in human
monocytes (Dean et al, 1999) and Hela cells (Lasa et al, 2000). In addition p38
activation is required for increased COX-2 expression in human chondrocytes
(Nieminen et al, 2005), ciliary and intestinal epithelial cells (Rosch et al, 2005;
Shafer and Slice, 2005), as well as in human synovial ﬁbroblasts and
macrophages (Faour et al, 2003). Activation of the ERK cascade leads to
upregulation of COX-2 in human colon and prostate cancer cell lines (Wang et
al, 2005), human keratinocytes (Kanda et al, 2005), intestinal epithelial cells
(Slice et al, 2004), rat cortical astrocytes (Brambilla et al, 2002) and in RAW
264.7 cells (Moon and Pestka, 2002). JNK activation is also involved in the
regulation of COX-2 in a wide variety of systems, including RAW 264.7 cells
(Uto et al, 2005; Wadleigh et al, 2000), human keratinocytes (Cho et al, 2005),
human synoviocytes (Crofford et al, 2005), in a mouse model of Parkinson’s
disease (Hunot et al, 2004), in bronchial epithelial cells (Mizumura et a1, 2003)

and in HeLa cells and human ﬁbroblasts (Holzberg et al, 2003).

1.7 Summary

In summary, noncoplanar PCBs are highly toxic compounds that impact

neutrophil function via poorly understood mechanisms. One major effect that

29

noncoplanar PCBs have upon neutrophil ﬁrnction is the upregulation of the
inﬂammatory gene COX-2 (see below). Accordingly, studies have been
undertaken to elucidate the signal transduction pathways involved in
noncoplanar PCB-mediated changes in regulation of the COX-2 gene. These
studies were performed using the HL-60 cell line as a model of the human
neutrophil and are described in detail in the following chapters. The overall
hypothesis tested in these studies was that 2244-TCB increases COX-2
expression in granulocytic HL-60 cells and this increase depends on activation
of intracellular signaling pathways including arachidonic acid release,
superoxide anion production and activation of the p38 MAP kinase. To test this
hypothesis, the following speciﬁc aims were addressed:

1) To determine the effects PCBs have on the transcription, translation
and function of the COX-2 gene. This aim was addressed by determining the
levels of COX-2 mRN A, the levels of COX-2 protein and the activity of COX-2
protein present in differentiated HL-60 cells treated with PCBs. These results
will be discussed in chapters 2 and 3 of this dissertation.

2) To determine the signaling pathway(s) involved in the elevation of
COX-2 mRNA in PCB-exposed HL-60 cells. This aim was addressed by
assessing expression of COX-2 mRNA, protein and function in differentiated
HL-60 cells treated with or without PCBs in the presence of pharmacological
inhibitors of speciﬁc pathways of interest. These results will be discussed in

chapters 3 and 4.

30

3) To determine if PCB-induced production of reactive oxygen species
is linked causally to changes in COX-2 mRNA levels in differentiated HL-60
cells. This aim was addressed by measuring production of superoxide anion in
differentiated cells treated with PCBs in the presence or absence of superoxide
dismutase and examining whether inhibition of superoxide anion by the
inhibitors apocynin and S-hydroxy TEMPO affects COX-2 mRNA levels. These

results will be discussed in chapter 3.

31

Chapter 11

Effects of 2,2',4,4'-Tetrachlorobiphenyl on Granulocytic HL-60 cell

Function and Expression of Cyclooxygenase-2

32

[1.1 Summary

PCBs are persistent environmental contaminants that affect a number of
cellular systems, including neutrophils. It has been demonstrated that
noncoplanar PCBs alter function of primary rat neutrophils. The objectives of
these experiments were to determine if responses in a human, neutrophil-like
cell line exposed to PCBs were similar to those reported for rat neutrophils and
to explore further PCB-mediated alterations in neutrophil function. The human
promyelocytic leukemia cell line (BL-60) was differentiated with DMSO to a
neutrophil-like phenotype. Treatment of differentiated HL-60 cells with 2244-
TCB, a noncoplanar, ortho-substituted PCB congener, caused an increase in
fMLP-induced degranulation, as measured by release of MPO. Treatment with
the coplanar, non-ortho-substituted congener 3,3',4,4'-tetrachlorobiphenyl
(3344-TCB) had no effect on MPO release. 2244-TCB caused a time- and
concentration-dependent release of [3H]-arachidonic acid (3H-AA). A
signiﬁcant increase in 3H-AA release was observed after 60 minutes of
exposure, and concentrations of 10 pM or greater increased 3H-AA release. In
contrast, 3344-TCB had no effect on 3H-AA release. The effect of PCBs on
mRNA levels for COX-2 was examined using semiquantitative RT-PCR. COX-
2 mRNA was signiﬁcantly elevated in response to 2244-TCB in a
concentration-dependent manner. COX-2 expression was maximal by 30
minutes of exposure to 2244-TCB. COX-2 protein and activity were also
increased after exposure to 2244-TCB; COX-1 protein and activity were

unaffected. 3344-TCB did not increase COX-2 mRNA levels. These results

33

demonstrate that a noncoplanar PCB alters the functional status of granulocytic
HL-60 cells, causing enhanced degranulation and upregulation of COX-2,
whereas a coplanar PCB lacks this activity. These data suggest that noncoplanar
PCBs alter HL-60 cell function and COX-2 expression via an Ah-receptor-

independent mechanism.

11.2 Introduction

PCBs are ubiquitous, man-made, environmental contaminants that have
been shown to affect a number of cellular systems. PCBs were used widely for
over 40 years due to their heat resistant properties, low conductivity and
chemical inertness. These properties made PCBs a very useful component of
safety ﬂuids used to insulate and cool heavy electrical equipment such as
transformers and capacitors (Hutzinger et al, 1974). The lipophilic nature of
PCBs and their resistance to chemical transformation allow them to
bioaccumulate in the food chain (Kannan et al, 1998). This has led to exposures
of humans and wildlife to PCBs. PCBs have been detected in human blood,
milk, adipose tissue and placental tissue (Giesy and Kannan, 1998; Laden et al,
1999).

PCBs exhibit a wide range of biological effects in animals. They are
probable human carcinogens (Cogliano, 1998) and cause a number of non-
cancer effects, including dermal lesions and ocular effects in humans, and
hepatotoxicity and endocrine effects in rats (Morse et al, 1996; Takamatsu et al,

1985; Twaroski et al, 2001). In addition, PCBs have effects on the reproductive

34

system (Faqi et a1, 1998), nervous system (Jacobson and Jacobson, 1997),
cardiovascular system (Warshaw et al, 1979) and both the speciﬁc and non-
speciﬁc branches of the immune system (V 05 and Loveren, 1998).

The speciﬁc effects PCBs produce are related to their structure. PCBs
can be divided into two broad classes based on the presence or absence of
chlorine atoms in the ortho- position. Congeners that lack chlorines in the ortho-
positions are coplanar and bind with high afﬁnity to the aryl hydrocarbon (Ah)
receptor to induce changes in cellular function. Congeners containing chlorines
substituted at the ortho- positions cannot attain a coplanar conﬁguration and are,
in general, poor ligands for the Ah receptor. The mechanisms by which these
noncoplanar PCBs cause functional changes in cells are not well understood
(Bandiera et al, 1982).

Among the effects caused by ortho-substituted, noncoplanar PCB
congeners is the alteration in function of polymorphonuclear neutrophils
(Brown and Ganey, 1995; Kristoffersen et al, 2002; Olivero and Ganey, 2001;
Olivero-Verbel and Ganey, 1998; Voie et al, 2000). The primary role of
neutrophils is to attack and destroy invading microorganisms. They are
normally quiescent and exhibit their biological activity when activated.
Alteration in neutrophil function can have serious consequences for the
organism. Failure of neutrophils to activate results in compromise of the innate
immune system, leading to increased risk of infection. At the other end of the
spectrum, inappropriate activation of neutrophils can lead to inﬂammatory

disease states and injury to host tissue. Noncoplanar PCBs cause many changes

35

in the function of primary rat neutrophils including stimulation of degranulation,
production of ROS such as superoxide anion, release of AA and altered
response to subsequent stimulation with other agents (Brown and Ganey, 1995;
Ganey et al, 1993; Olivero and Ganey, 2001; Tithof et al, 1998). Given the role
of neutrophils in host defense and the requirement for activation, understanding
the mechanisms by which neutrophils become activated in response to exposure
to PCBs is important.

One fate of AA released in response to PCB exposure is that it may
serve as a precursor for eicosanoid synthesis, which is catalyzed by the
cyclooxygenase enzymes. One isoform of cyclooxygenase, COX-2, is present in
negligible amounts in quiescent neutrophils but can be induced by a variety of
inﬂammatory stimuli (Smith et al, 2000; Vane et al, 1998). It was of interest to
determine whether COX-2 expression is affected by PCBs. In this work we used
the human, promyelocytic leukemia cell line, HL-60, to examine the effect of in
vitro exposure to PCBs on COX-2 mRNA levels. HL-60 cells have the capacity
to differentiate to a number of different, functionally and morphologically
distinct, forms (Collins, 1987) including a neutrophil-like phenotype, and
differentiated HL-60 cells have been a useful model with which to study

neutrophil responses (Arroyo et al, 2002; Mullick et al, 2004).

36

11.3. Materials and Methods
II.3.A. Chemicals.
2,2',4,4'-Tetrachlorobiphenyl (>99% pure) and 3,3',4,4'-
tetrachlorobiphenyl (>99% pure) were purchased from ChemService (West
Chester, PA). fMLP was purchased from Sigma Chemical Co. (St. Louis, MO).
3H-AA (180-240 Ci/mmol) was purchased from DuPont (Boston, MA). All

other chemicals were of the highest grade commercially available.

II.3.B. HL-60 cells.

HL—60 cells were obtained from American Type Culture
Collection (Manassas, VA). Cells between passage 20 and 45 were grown in
Iscove’s Modiﬁed Dulbecco’s Medium supplemented with 10% fetal bovine
serum (Atlanta Biologicals, Lawrenceville, GA), 0.1% gentamicin and 0.9%
antibiotic-antimycotic (Invitrogen Corporation, Carlsbad, CA). Cultures were
maintained in a humidiﬁed incubator at 37°C in a controlled atmosphere of 5%
C02. Cells were induced to differentiate along the granulocyte pathway by
culturing in the presence of 1.25% DMSO for 5 days. Cells were then
maintained an additional two days in the absence of DMSO. After this
procedure, approximately 80% of the cells had nuclear appearance characteristic
of neutrophils. In addition, these cells reduced nitro blue tetrazolium, a

functional marker of differentiation to a granulocytic phenotype (Hua et al,

2000).

37

II.3.C. Exposure to polychlorinated biphenyls.

Stock solutions of the PCBs were prepared by dissolution in
N,N'-dimethy1formamide (DMF). The differentiated HL-60 cells were
suspended in HBSS in 12 x 75 mm borosilicate glass test tubes (V WR, Chicago,
IL), and l uL of the stock solution was added per mL of cells to achieve the
desired concentration. Control cells received 1 11L of DMF per mL of cells.
Exposure to vehicle had no signiﬁcant effects. The concentrations of PCBs used
in the current study were selected based on their previously described activity in

neutrophils and their minimal cytotoxicities (Olivero et al, 2002).

11.3. D. Cellular degranulation.

Degranulation was measured by the release of the enzyme MPO.
Differentiated HL-60 cells (2 x 106) were suspended in Hank’s Balanced Salt
Solution (HBSS) and exposed to PCBs at 37°C for 30, 60, 90 or 120 minutes.
fMLP (10 nM) was added for the ﬁnal 30 minutes of treatment to stimulate
degranulation. Immediately after treatment, cells were centrifuged for 10
minutes at 4000 g. The cell-free supernatant ﬂuids were collected, and MPO
activity was measured according to the method of Henson et a1. (1978). Release
of MPO in the medium was expressed as the percentage of total MPO activity
that was present in an equivalent number of cells lysed with 10 uL of Triton X-

100 and ultrasonication.

38

II.3.E. Superoxide anion production.

Superoxide anion generation by HL-60 cells was measured as the
reduction of cytochrome c in the presence or absence of superoxide dismutase
(SOD; Babior et al, 1976). Differentiated HL-60 cells were suspended in Ca2+-
and Mg”-containing HBSS in the presence of cytochrome c (10 mg/mL) and of
PCB or vehicle. Experiments were performed in 96-well plates, and for every
sample two wells were incubated: one to which SOD (840 U/mL) was added
and one to which an equal volume of vehicle was added. The amount of
superoxide anion produced was estimated from the amount of cytochrome c
reduced as determined from the difference in absorbancc between the two wells,

using an extinction coefﬁcient of 18.5 cm'l mM".

II.3.F. Labeling of HL-60 cells with 3H-arachidonic acid.

Differentiated HL-60 cells (10 x 106/mL) were suspended in
HBSS containing 0.1% bovine serum albumin (BSA) and incubated for 120
minutes at 37°C with 0.5 uCi/mL 3H-AA. At the end of the labeling period,
cells were washed twice and resuspended in HBSS containing 0.1% BSA. At
the end of the incubation period, radioactivity in an aliquot of cells was
determined in a scintillation counter to determine cellular uptake of radiolabel.

Uptake was routinely ~70% of added 3II-AA.

39

11.3.G. Determination of arachidonic acid release.

Cumulative release of 3H-AA was measured in HL-60 cells (2 x
106) exposed for 30, 60, 90 or 120 minutes at 37°C to PCBs. At the end of the
incubations, samples were placed on ice and centrifuged, and radioactivity in
the cell-free supernatant ﬂuids was determined by liquid scintillation counting.
Release is expressed as a percentage of the total radioactivity in the labeled

cells.

II.3.H. Determination of COX-2 mRNA.

Differentiated HL-60 cells (5 x 10°) were suspended in HBSS
and treated at 37°C for 30, 60, 90 or 120 minutes with 3344-TCB or 2244-TCB
at the concentrations indicated in the ﬁgure legends. At the end of the
incubation period, total cellular RNA was isolated using Tri-Reagent (Sigma
Chemical Co., St. Louis, MO). Concentration of isolated RNA was determined
spectrophotometrically by measuring absorbance at 260 nm. cDNA was
synthesized by reverse transcription at 42°C for 45 minutes in a 20 11L reaction
mixture containing 1 pg total RNA and 100 units MMLV reverse transcriptase
(Promega Corp., Madison, WI). After heating at 99°C for 5 minutes for
denaturing, followed by cooling at 5°C, the cDNA was used for ampliﬁcation.
For PCR reactions, 5 11L of denatured cDNA was ampliﬁed in a 25-uL ﬁnal
volume with 2.5 units of T aq DNA polymerase (Invitrogen Corp., Carlsbad,
CA) lmM of each primer and Taq polymerase buffer containing 25mM Mng

with 2mM of each dNTP (dATP, dCTP, dGTP and dTTP; Promega Corp.). PCR

40

was performed in a thermal cycler (GeneAmp 9700, Applied Biosystems, Foster
City, CA), using a program of 35 cycles at 94°C for 1 minute, 60°C for 1
minute, and 72°C for 1 minute, followed by a lO-minute extension at 72°C. The
ampliﬁed products were subjected to electrophoresis on a 1.5% agarose gel and
detected and photographed under UV light. Densitometry on detected bands was
performed using Bio-Rad Quantity One software (Bio-Rad Laboratories Inc.,
Hercules, CA).

The following primers were used for COX-2: 5'-
TTCAAATGAGATTGTGGGAAAATTGCT-3' (forward primer), 5’-
AGATCATCTCTGCCTGAGTATCTT-3' (reverse primer). The predicted size
of the fragment was 301 base pairs.

For B-actin, the primers were 5'-GACGAGGCCCAGAGCAAGAGAG-3'
(forward primer), 5'—ACGTACATGGCTGGGGTGTTG-3' (reverse primer).

The predicted size of the fragment was 284 base pairs (V ergne et al, 1998).

11.3.1. COX-2 Western blotting.

Differentiated HL-60 cells (50 x 106) were suspended in HBSS
and treated at 37°C for 30, 60, 90 or 120 minutes with 2244-TCB at the
concentrations indicated in the ﬁgure legends. Immediately after treatment, cells
were centrifuged for 10 minutes at 4000 g. Supernatant was discarded and the
cell pellet was lysed with 100 pL of 2% SDS. Proteins (30 uL) were separated
on 10% Bis-Tris polyacrylamide gels (NuPAGE, Invitrogen Corporation,

Carlsbad, CA) and electrophoretically transferred onto polyvinylidene

41

diﬂuoride membranes (Bio-Rad Laboratories, Hercules, CA). After blocking,
the membranes were incubated with a primary anti-human COX-2 monoclonal
antibody (1:1000 dilution; Cayman Chemical, Ann Arbor, MI) and then a
secondary antibody (peroxidase-conjugated goat anti-human IgG; 1:1000
dilution; Santa Cruz biotechnology, Santa Cruz, CA). The blots were developed
using an ECL detection kit (Amersham Biosciences, Little Chalfont, UK). The
blots were stripped and successively reprobed with an anti-human B-actin
monoclonal antibody (Sigma Chemical Co. St. Louis, MO) then with a
corresponding secondary antibody. The levels of COX-2 bands were measured
densitometrically as described above and corrected using levels of B-actin as an

internal standard.

II.3.J. Cyclooxygenase activity assay.

Differentiated HL-60 cells (15 x 106) were suspended in HBSS
and treated at 37°C for 30, 60, 90 or 120 minutes with 2244-TCB at the
concentrations indicated in the ﬁgure legends. Immediately after treatment, cells
were centrifuged for 10 minutes at 4000 g. Supernatant was discarded and the
cell pellet was resuspended in 200 pL then lysed via sonication. COX activity
was then measured using a COX activity assay (Cayman Chemical, Ann Arbor,
MI) according to manufacturer’s instructions. This assay utilizes the peroxidase
component of cyclooxygenase. The peroxidase activity is assayed
colorimetrically by monitoring the appearance of oxidized N,N,N',N'-

tetramethyl-p-phenylenediamine at 590 nm. Activities of COX-1 and COX-2

42

were differentiated using the isoforrn-speciﬁc inhibitors DuP-697 and SC-560

according to manufacturer’s instructions.

II.3.K. Statistical analysis.

Data are expressed as mean 3: SEM. Results were analyzed by
one-way analysis of variance. Group means for the superoxide anion production
results were compared using Dunnett’s post hoc test; all other data were
compared using Tukey’s post hoc test. Appropriate transformations were
performed on all data that did not follow a normal distribution (e.g., percent

data). For all studies, the criterion for statistical signiﬁcance was p < 0.05.

11.4 Results

11.4.A. Degranulation of HL-60 cells.

In the absence of PCB exposure differentiated HL-60 cells
released ~27% of total MPO in response to fMLP, a peptide that activates
neutrophils. Exposure to the noncoplanar PCB congener 2244-TCB resulted in
an increase in degranulation that was signiﬁcant by 90 minutes (Figure 11.1).
2244-TCB concentrations greater than 3 M were required to affect increases in
degranulation (Figure 11.2). 3344-TCB did not affect fMLP-induced

degranulation at any time or dose examined (Figures 11.] and 11.2).

43

% MPO release

 

5° I :1 Vehicle

m 2244-TCB
1:33 3344-TCB

 

 

 

30

1

20'

 

 

 

 

 

 

 

 

 

30 min 60 min 90 min 120 min
Duration of Exposure to PCBs

Figure 11.1. Time course for PCB-induced degranulation. Diﬂ‘erentiated HL-
60 cells (1x106 cells/mL) were treated with 30 hM 2244-TCB, 30 1M 3344-
TCB or vehicle (DMF) for 30, 60, 90 or 120 minutes. The degranulation
stimulus fMLP was added for the last 30 minutes of treatment. Degranulation
was estimated by determining percent of total cellular myeloperoxidase (MPO)
released into culture medium. N = 5 separate experiments. a = Signiﬁcantly
different from all other treatments at that time.

 

 

    

OOOCOOOO
0.0 O...
VOOOOOOOO

 

 

 

      

    

   

O
.00....

O
O
O

J

0
.0 O
o
O

 

       

D O
.0. O...
0..

C
y... .0 o

   

 

m 2244-TCB
m 3344-TCB

 

 

   

O O 9....
D O 0,.

 

 

 

q qi‘ ‘ J + ‘4 Jl ‘liUllq ‘1 ‘ I 4 r- ‘ ‘

o o
6 5 3

ODGO-p. on: .3.

0

30

PCB Concentration (M)

l, 3, 10 or 30

3344—TCB or vehicle (DMF) for 60 minutes, then MP was
added and cells were incubated for an additional 30 minutes. Degranulation was

estimated as the percent oftotal cellular MPO released into culture medium.

for PCB-induced
wi

treated

6 cells/mL) were

degranulation. HL-60 cells (1x10

ttM 2244-TCB

Concentration-response relationship

“smell-2

different from 3344-TCB- or vehicle-treated cells

vehicle released 27% :l: 3.5% MPO. N = 5 separate

. a = signiﬁcantly

Cells exposed to
experiments
at the same concentration.

45

11.4.B. Superoxide anion production.

In the absence of PCB exposure, differentiated HL-60 cells
produced < 5 nmol of superoxide per 106 cells (Figure 11.3). Exposure to 2244-
TCB resulted in a signiﬁcant increase in superoxide anion production. The
coplanar PCB congener 3344-TCB did not affect superoxide anion production

(Figure 11.3).

II.4.C. sH-AA release.

In the absence of PCB exposure, HL-60 cells released ~10% of
total 3H-AA (Figure 11.4) after two hours. Exposure of differentiated HL-60
cells to 2244-TCB resulted in an increase in the release of 3H-AA. Statistically
signiﬁcant increases in 3H-AA release were observed in cells exposed to 2244-
TCB for longer than 60 minutes (Figure 11.4). Concentrations of 2244-TCB
greater than 3 uM produced a signiﬁcant increase in 3H-AA release from HL-60
cells (Figure 11.5). Exposure to 3344-TCB did not cause statistically signiﬁcant

changes in 3H-AA release at any time or concentration examined (Figure 11.4

and 11.5).

11. 4. D. Effects of PCBs on COX-2 mRNA expression.
COX-2 mRNA levels did not change over two hours in vehicle-
treated HL-60 cells. A signiﬁcant increase in the level of COX-2 mRNA was

observed after 30 or 60 minutes exposure to 2244-TCB (Figure [1.6.A). In cells

46

Superoxide anion (nmol/10° cells)

or
O

N
0'!

N
O

.3
0|

.3
9

0|

 

Veh 2244-TCB 3344-TCB

Figure 11.3. Superoxide anion production in PCB-treated cells.
Differentiated HL-60 cells (1 x10“) were exposed to 30 Mi! 2244-TCB, 30 11M
3344~TCB or vehicle (DMF) for 30 minutes, and superoxide anion production
was determined as described in Materials and Methods. N=3-6 separate
experiments. a = Signiﬁcantly diﬂ‘erent from vehicle control.

47

% 3H arachidonic acid release

501

 

 

 

 

 

 

    

 

 

 

CZZJVehicle

— 2244-rce
4o . m 3344-rce
30 -
20 «
10 ‘ 33;;35; g5???

. . 5:22.

o S IN IS IN

30 min 60 min 90 min 120 min

Duration of exposure to PCBs

Figure 11.4. Time course for 3I-I-AA release in PCB-treated cells.
Diﬂ’erentiated HL-60 cells were labeled with 3H-AA as described in Materials
and Methods. Labeled cells (1x10° cells/mL) were treated with 30 MA 2244-
TCB, 30 am 3344-TCB or vehicle (DMF) for 30, 60, 90 or 120 minutes. 3H-AA
release is presented as the percent of total cellular 3H-AA released into culture
medium. N = 3 separate experiments. a = signiﬁcantly different from other
treatments at same time.

48

% 3H arachidonic acid release

 

um 2244-TCB
35 " m 3344-TCB

 

 

 

 

 

 

PCB Concentration (uM)

Figure 11.5. Concentration-response relationship for 3H-AA release in PCB-
treated cells. Differentiated HL-60 cells were labeled with 3H-AA as described
in Materials and Methods. Labeled cells (1x10‘5 cells/mL) were treated with l,
3, 10 or 30 uM 2244-TCB, 30 uM 3344-TCB or vehicle for 90 minutes. 3H-AA
release is presented as the percent of total cellular 3H-AA released into culture
medium. Cells exposed to vehicle released 16% i 0.3% 3H-AA. N = 3 separate
experiments. a = signiﬁcantly different from 3344-TCB- or vehicle-treated cells
at the same concentration.

49

A

B

 

-e— Vehicle

—o— 2244-1'03

-v— 3344-TCB
0.5 1 7

 

0.5 -
0.4 t
0.3 4

02*
I

 

0.1 '1

Ratio of COX-2 to Beta-actln

 

 

0111111 30111111 00min 00min 120‘uln
Duration of exposure to PCBs

COX-2 . a--. . .. ‘ nu.

B-actin H

 

Duration of 0 30 60 90 120
exposure to PCB

COX-ZIB- 0.22 0.50 0.74 0.69 0.42
actin

Figure 11.6. Time course for the expression of COX-2 mRNA and protein in
PCB-treated tens. A) cox-2 mRNA was determined in HL-60 cells (5 x106)
treated with 30 M 2244-TCB, 30 11M 3344-TCB or vehicle for 0, 30, 60, 90 or
120 minutes as described in Materials and Methods. B-actin was used as a
loading control. N = 5 separate experiments. a = Signiﬁcantly different from the
same treatment at time 0. B) COX-2 protein was determined in HL-60 cells (50
x106) treated with 30 11M 2244-TCB for o, 30, 60, 90 or 120 minutes as
described in Materials and Methods. B-actin was used as a loading control.

COX-2/B-actin ratios were determined by densitometry.

50

treated longer then 60 minutes, expression of COX-2 mRNA returned to
baseline. This effect was observed with 10 M or 30 uM 2244-TCB (Figure
11.7.A). 3344-TCB had no statistically signiﬁcant effect on COX-2 mRNA

levels at any time or concentration examined.

11. 4. E. Effects of PCBs on COX-2 protein expression.

COX-2 protein levels remained undetectable over two hours in
vehicle-treated HL-60 cells. COX-2 protein was increased after 30, 60 or 90
minutes exposure to 2244-TCB. After 120 minutes exposure to 2244-TCB,
protein levels were decreased compared to previous time points, but still
elevated compared to untreated cells (Figure 11.6.B). This effect was only

observed with 30 11M 2244-TCB (Figure 11.7.B).

11. 5. F. Effects of PCBs on COX-2 activity.

The activity of the peroxidase component of COX was used as a
measure of total COX activity. Activity of COX-2 was undetectable over two
hours in vehicle-treated HL-60 cells. An increase in the levels of COX activity
was observed after 60, 90 or 120 minutes exposure to 2244-TCB (Figure
11.8.A). This effect was only observed with 30 uM 2244-TCB (Figure 11.88).

Activity of COX-1 did not change at any concentration of 2244-TCB examined.

51

 

0.50 -
-O— 2244-TCB a
o 45 . + 33445108 3

 

 

 

0.40 r
0.35 4
0.30 i
0.25 f
0.20 i

Ratio of COX-2 to Beta-actin

 

 

0.15 I I j I I
Control 1 3 10 30

Concentration PCB (M)

B cox-2 ..,..

B-actin w

.uM 2244-TCB control 1 3 10 30

COX-ZIB-actin 0.20 0.27 0.25 0.30 0.68

Figure 11.7. Dose-response relationship for PCB-induced increases in COX-
2 mRNA and protein. A) COX-2 mRNA was determined in HL-60 cells (5
x106) treated with vehicle, 1, 3, 10 or 30 M 2244-TCB or 3344-TCB for 30
minutes as described in Materials and Methods. B-actin was used as a loading
control. N = 5 separate experiments. a = Signiﬁcantly different from vehicle-
treated control. B) cox-2 protein was determined in HL-60 cells (so x106)
treated with vehicle, 1, 3, 10 or 30 M 2244-TCB for 30 minutes as described in
Materials and Methods. B—actin was used as a loading control. COX-2/B-actin
ratios were determined by densitometry.

52

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

A —o—COX-1activlty
....o... cox_2 activity
50 .
A ..... .0...
.1 . .......
g 45 .-° .....
.. 40 ‘ ' "o
t
E 35 ‘
5
3o .
25
e
0 2° '
15 . . - . . . T .
0 20 40 60 80 100 120 140
Time
2 5°”
E ,0.
E
=
2
s. 3‘" _
5‘
20
g f T‘—
<
qr 10-
x
O
0 o . . a . .
Vehicle 1 3 10 30
ZZM-TCB concentration (all)

Figure 11.8. COX activity in PCB-treated HL-60 cells. A) COX activity was
determined in HL-60 cells (15 x106) treated with 30 11M 2244-TCB for 0, 30,
60, 90 or 120 minutes. COX activity was measured as described in Materials
and Methods. B) cox activity was determined in HL-60 cells (15 x106) treated
with vehicle, 1, 3, 10 or 30 M 2244-TCB for 60 minutes. COX activity was
measured as described in Materials and Methods.

53

11. 6 Discussion

In the present study, the function of a human cell line differentiated to a
neutrophil-like phenotype was affected by exposure to the noncoplanar
congener 2244-TCB, but not by the coplanar congener 3344-TCB. These results
have not been previously described in the human neutrophillic HL—60 cell line.
2244-TCB caused a time- and concentration-dependent increase in cellular
degranulation and induced superoxide anion production (Figures 11.1, 11.2 and
11.3). These results are similar to previous observations of the effects of PCBs
on primary rat neutrophils, in which several mono- or di-ortho-substituted PCBs
stimulated superoxide anion production and/or increased superoxide anion
generation in response to phorbol myristate acetate (Brown et al, 1998; Ganey
et al, 1993). None of a variety of coplanar PCBs, including 3344-TCB, affected
the function of rat neutrophils (Brown et al, 1998; Brown and Ganey, 1995). In
primary human neutrophils noncoplanar PCB congeners, including 2244-TCB,
increased oxidative burst (Voie et al, 1998; Voie et al, 2000) conﬁrming that
differentiated HL-60 cells respond similarly to primary human neutrophils.
2244-TCB and 2,3,4,5-TCB increase degranulation in rat neutrophils (Brown
and Ganey, 1995), but changes in degranulation caused by PCBs have not been
reported previously in human cells. Thus, with respect to oxidative burst and
degranulation, responses in granulocytic HL-60 cells, a human model of the
neutrophil, are similar to those observed in rat neutrophils as well as in PCB-

treated primary human neutrophils.

54

Several potential mediators of PCB-induced superoxide anion production
have been described, including increased intracellular Ca2+ with subsequent
activation of Ca2+dependent proteins such as calmodulin (Olivero and Ganey,
2001) and release of AA due to activation of phospholipases (Tithof et al,
1998). In the present study, the noncoplanar PCB congener 2244-TCB, but not
the coplanar congener 3344-TCB, increased the release of 3H-AA in a time- and
concentration-dependent manner (Figures 11.4 and 11.5). Similar time- and
concentration-dependent increases in 3H-AA release have been reported in
primary rat neutrophils, but not in human cells, treated with Aroclor 1242 as
well as with individual, noncoplanar PCB congeners (Olivero et al, 2001;
Olivero and Ganey, 2001; Tithof et al, 1998). Release of 3H-AA, similar to that
observed in PCB-treated HL-60 cells, has also been observed in rat uterine
strips (Bae er al, 1999) and in cerebellar granule cells treated with Aroclor
mixtures (Kodavanti and Derr-Yellin, 2002; Kodavanti and Tilson, 2000).

One major fate of released AA is its conversion into eicosanoids, such as
prostaglandins and thromboxanes, by cyclooxygenases or cytochrome P450
monooxygenases. 1n neutrophils, the eicosanoids produced by COX-2 play an
important modulatory role in inﬂammation. COX-2 is an immediate early gene
that is present in negligible amounts in quiescent neutrophils. Upon activation
of the cell, COX-2 is rapidly upregulated. In the present study 2244-TCB
rapidly and transiently increased levels of COX-2 mRNA and protein in a time-
and concentration-dependent manner (Figures 11.6 and 11.7). Additionally, time-

and concentration-dependent increases in COX activity were observed (Figure

55

11.8), and these were greatly inhibited by the COX-2-speciﬁc inhibitor DuP-697.
Previously observed effects of PCBs on COX-2 regulation have involved
activation of the Ah receptor (Kietz and Fischer, 2003; Kwon et al, 2002). As
2244-TCB, a poor ligand for the Ah receptor, caused changes in COX-2
whereas 3344-TCB, a more potent Ah receptor ligand, did not, it is unlikely that
Ah receptor activation is involved in the increases in COX-2 observed in the
present study. In mast cells, another immune cell critical in the initiation of
inﬂammatory responses, COX-2 mRNA was markedly induced after exposure
to the noncoplanar PCB congener 2,2',4,4',5,5'-hexachlorobiphenyl (Kwon et al,
2002). A similar induction of COX-2 mRNA was observed in rabbit blastocysts
that were exposed to a mixture of 7 different noncoplanar PCB congeners (Kietz
and Fischer, 2003). Interestingly, COX-2 mRNA was also elevated in rabbit
blastocysts by treatment with a mixture of three coplanar PCB congeners. This
was not the case in differentiated HL-60 cells exposed to 3344-TCB, indicating
differences in COX-2 regulation between HL-60 cells and rabbit blastocysts.

In summary, exposure to a noncoplanar PCB in vitro alters the function
of granulocytic HL-60 cells in several ways. Exposing differentiated HL-60
cells to the noncoplanar PCB congener 2244-TCB increased degranulation and
superoxide anion production, stimulated the release of 3l-I-AA, and induced
COX-2 mRNA, protein and activity. Exposure to 3344-TCB had no effect on
any of these endpoints in HL-60 cells. These effects mirror those seen with
other noncoplanar PCB congeners in a variety of cell systems. Neutrophils play

a vital role in the immune response as well as in inﬂammation, and any

56

alterations in neutrophil function can have dire implications, either leading to
increased susceptibility to infection, or contributing to destruction of healthy
host cells.

Based on these observations, studies were undertaken to evaluate the
mechanisms and signaling pathways involved in these responses. These are

described in the following chapters.

57

Chapter III

Signal Transduction Pathways Involved in the Induction of

Cyclooxygenase-2 by 2,2’,4,4'-Tetrachlorobiphenyl in HL-60 cells

58

111.1. Summary

PCBs are ubiquitous, persistent environmental contaminants that affect a
number of cellular systems including neutrophils. Effects in neutrophils are
mediated by ortho-substituted, noncoplanar PCBs like 2244-TCB. These effects
include changes in the expression of inﬂammatory genes such as COX-2. The
objective of this study was to determine the signal transduction pathways
involved in 2244-TCB-mediated upregulation of COX-2 in neutrophilic HL-60
cells. Treatment of HL-60 cells with 2244-TCB led to increased expression of
COX-2 mRNA. This was associated with release of 3H-AA, increased
superoxide anion production and phosphorylation of p38 and ERK MAP
kinases. Bromoenol lactone (BEL), an inhibitor of the Ca2+-independent FLA;
(iPLAz), reduced 3H-AA release but had no effect on COX-2 mRNA, protein or
activity. Pretreatment with SB-202190 or SB-203580, inhibitors of the p38
MAP kinase pathway, prevented the 2244~TCB-mediated induction of COX-2
and phosphorylation of p38 and ERK MAP kinases. These inhibitors did not
alter 3H-AA release. Treatment with PD 98059 or U 0126, inhibitors of the ERK
MAP kinase pathway, prevented the 2244-TCB-mediated activation of ERK but
had no effect on COX-2 induction or p38 phosphorylation. 2244-TCB treatment
did not affect JN K phosphorylation. 2244-TCB-mediated increases in
superoxide anion were prevented by the NADPH oxidase inhibitor apocynin or
the free radical scavenger 4-hydroxy TEMPO, but neither of these inhibitors
affected the PCB-induced changes in COX-2 mRNA levels or 3H-AA release.

Taken together these data suggest that activation of the p38 MAP kinase

59

pathway is involved in the 2244-TCB-mediated upregulation of COX-2 mRNA.

111.2. Introduction

PCBs are persistent, widespread environmental contaminants associated
with functional changes in a variety of cellular systems. They are probable
human carcinogens (Cogliano, 1998) and cause a nmnber of non-cancer effects,
including dermal lesions and ocular dysfunction in humans and hepatotoxicity
and endocrine disruption in rats (Morse et al, 1996; Takarnatsu et al, 1985;
Twaroski et al, 2001). In addition, PCBs have effects on the reproductive
system (Faqi et al, 1998), nervous system (Jacobson and Jacobson, 1997),
cardiovascular system (Warshaw et al, 1979) and both the speciﬁc and
nonspeciﬁc branches of the immune system (V 03 and Loveren, 1998).

PCBs exist as 209 different congeners based on the number and
distribution of chlorine atoms on the biphenyl rings. Noncoplanar PCBs that
contain ortho- substituted chlorines alter cellular function through effects on
signal transduction pathways, including alterations of kinases and
phospholipases, disturbance of Ca2+ homeostasis and modulation of gene
expression (Tilson and Kodavanti, 1997; Brown et al, 1998; Fischer et al, 1998;
Oakley et al, 2001). In polymorphonuclear neutrophils, which are important in
host defense against invading microorganisms, noncoplanar PCBs stimulate
degranulation and release of AA (Brown and Ganey, 1995; Kristoffersen et al,
2002; Olivero and Ganey, 2001; Olivero-Verbel and Ganey, 1998; Voie et a1,

2000). In addition, exposure to PCBs results in altered responses to subsequent

60

stimulation with other agents (Brown and Ganey, 1995; Ganey et a1, 1993;
Olivero and Ganey, 2001; Tithof et al, 1998). These alterations have been linked
to changes in signal transduction, such as kinase activation (Olivero and Ganey,
2000; Tithof et al, 1997), increased phospholipase activity (Bezdecny et al,
2005; Tithof et al, 2000; Tithof et al, 1996), changes in regulation of calcium
and calcium-dependent proteins (Olivero and Ganey, 2001) and changes in the
expression of genes, such as COX-2 (Bezdecny et al, 2005).

COX enzymes catalyze the conversion of arachidonic acid to
prostaglandins and thromboxane, and some of these lipid mediators have
immunomodulatory effects. The isoform COX-I is constitutively expressed and
primarily plays a cytoprotective role. The COX-2 isoform is generally found in
negligible amounts in normal cells, such as quiescent neutrophils, but
expression of its gene is induced by a wide variety of inﬂammatory stimuli. In
activated neutrophils, COX-2 expression is an important component of the
inﬂammatory response (Smith et al, 2000; Vane et a1, 1998). Given the
observation that PCBs increase COX-2 expression (Bezdecny et al, 2005), it
was of interest to determine the signal transduction pathways involved in this
alteration. A number of pathways were examined, including a pathway
involving ROS; a pathway involving activated PLAz and its product, free AA;
and three MAP kinase systems, p38, ERK and JNK. Each of these pathways has
been implicated previously in the upregulation of COX-2 in other cell systems
(Amma et al, 2005; Dean et al, 1999; Lasa et al, 2000; Moon and Pestka, 2002;

Pawliczak et al, 2004; Steer et al, 2006).

61

111.3. Materials and Methods
111.3.A. Chemicals.
PD 98059 and U 0126 were purchased from Calbiochem (San
Diego, CA). SB-202190 (SBl), SB-203580 (SB2), oleyloxyethyl
phosphorylcholine (DP) and BEL were purchased from Biomol (Plymouth
Meeting, PA). 4-hydroxy-2,2,6,6-tetramethylpiperidin-l-oxyl (TEMPO) and
apocynin were purchased from Sigma Chemical Co. (St. Louis, MO). All other

chemicals were of the highest grade commercially available.

111.3.B. HL-60 cells.

HL-60 cells were obtained from American Type Culture
Collection (Manassas, VA). Cells between passage 20 and 50 were grown in
Iscove’s Modiﬁed Dulbecco’s Medium supplemented with 10% Cosmic Calf
Serum (HyClone; Logan, UT), 0.1% gentamicin and 0.9% antibiotic-
antimycotic. Cultures were maintained in a humidiﬁed incubator at 37°C in a
controlled atmosphere of 5% C02/95% air. Cells were induced to differentiate
along the granulocyte pathway by culturing in the presence of 1.25% DMSO for
5 days. Cells were then maintained an additional two days in the absence of
DMSO. After this procedure, approximately 80% of the cells had nuclear
appearance characteristic of neutrophils. In addition, they reduced nitroblue
tetrazolium, a functional marker of differentiation to a neutrophilic phenotype

(Hua et al, 2000).

62

111.3.C. Exposure to inhibitors.

Stock solutions of inhibitors were prepared by dissolution in
DMSO, and 1 pL/mL of the stock solution was added to the cells to achieve the
desired concentration. Control cells received 1 pL/mL of DMSO. Exposure to
vehicle had no signiﬁcant effects. The concentrations of inhibitors used in the
current study were selected based on their IC50 values and previously described
activities (Ackerrnann et a1, 1995; Lee et al, 1994; Magolda and Galbraith,

1989)

111.3.D. Determination of COX-2 mRNA levels.

Differentiated HL-60 cells (5 x 106) were suspended in HBSS
and pretreated with the appropriate inhibitor or vehicle for 30 minutes. They
were then treated with vehicle or 30 uM 2244-TCB for 30 minutes. Previous
studies indicated a signiﬁcant increase in COX-2 mRNA levels after 30 minutes
of exposure to 2244-TCB (Bezdecny et al, 2005). At the end of the incubation
period, total cellular RNA was isolated using Tri-Reagent (Sigma Chemical Co.,
St. Louis, MO). The concentration of isolated RNA was determined by
spectrophotometry at 260 nm using a Beckman DU 640 spectrophotometer
(Beckman Coulter Inc., Fullertom, CA.). cDNA was synthesized by reverse
transcription at 42°C for 45 minutes in a 20 11L reaction mixture containing 1 pg
total RNA and 100 units MMLV reverse transcriptase (Promega Corp.,
Madison, WI). After heating at 99°C for 5 minutes for denaturing, followed by

cooling at 5°C, the cDNA was used for ampliﬁcation. For PCR reactions, 3 uL

63

of denatured cDNA was ampliﬁed in a ﬁnal volume of 30 11L with 0.75 units of
AmpliTaq Gold (Applied Biosystems, Foster City, CA), luM of each primer
and Sybr green PCR buffer containing 25mM MgClz with lOmM of each dNTP
(dATP, dCTP, dGTP and dTTP; Applied Biosystems, Foster City, CA). Primers
were constructed using primer express. The following primers were used for
COX-2 5'-TGATCCCCAGGGCTCAAAC -3' (forward primer), 5’-
AGCTGGCCCTCGCTTATGAT -3' (reverse primer). For B-actin, the primers
were 5'- TCACCCACACTGTGCCCATCTACGA -3' (forward primer), 5'-
GGATGCCACAGGATTCCATACCCA -3' (reverse primer). PCR was
performed in a thermal cycler (Applied Biosystems 7500) using a program of
50°C for 2 minutes, 95°C for 5 minutes and 40 cycles at 95°C for 15 seconds,
60°C for 1 minute. Results were analyzed using the program ABI 5700 SDS
(Applied Biosystems, Foster City, CA). All results were compared to B-actin

and expressed as fold induction versus vehicle control.

111.3.E. Western blotting for COX-2 and p38.

Differentiated HL-60 cells (50 x 10°) were suspended in HBSS
and pretreated at 37°C with the appropriate inhibitor or vehicle for the indicated
time, then exposed to 30 uM 2244-TCB or vehicle for 60 or 90 minutes.
Immediately after treatment, cells were centrifuged for 10 minutes at 4000 g.
Supernatant was discarded, and the cell pellet was lysed with 100 uL of 2%
SDS. Proteins (30 uL) were separated on 10% Bis-Tris polyacrylamide gels

(NuPAGE, Invitrogen Corporation, Carlsbad, CA) and electrophoretically

transferred onto polyvinylidene diﬂuoride membranes (Bio-Rad Laboratories,
Hercules, CA). After blocking, the membranes were incubated with a primary
anti-human COX-2 monoclonal antibody (1:1000 dilution; Cayman Chemical,
Ann Arbor, M1), or a primary anti-human phospho-p38 monoclonal antibody
(1:1000 dilution for each; both from Cell Signaling Technology, Beverly, MA)
and then a secondary antibody (peroxidase-conj ugated goat anti-mouse IgG;
1:1000 dilution; Santa Cruz Biotechnology, Santa Cruz, CA). The blots were
developed using an ECL detection kit (Amersham Biosciences, Little Chalfont,
UK). The blots were stripped and successively reprobed with an anti-human B-
actin monoclonal antibody (Sigma Chemical Co. St. Louis, MO) then with a
corresponding secondary antibody. The intensities of bands of interest were
measured densitometrically and corrected using Scion Image software (Scion

Corporation, Frederick, MD). [3 -actin was used as an internal standard.

111.3.F. Measurement of phospho-p38 and phospho-ERK.

Levels of phosphorylated and total p38 and ERK were
determined using FACE cell-based ELISAs from Active Motif (Carlsbad, CA).
Differentiated HL-60 cells (20 x 10°) were suspended in HBSS and pretreated at
37°C with the appropriate inhibitor or vehicle for 30 minutes. For determination
of levels of phospho-ERK cells were then treated for 45 minutes with vehicle or
30 11M 2244-TCB. For determination of levels of phospho-p38 cells were

treated for 90 minutes with vehicle or 30 uM 2244-TCB. Levels of total and

65

phospho-ERK and p38 were then determined according to manufacturer’s

instructions and presented as a ratio of phospho-protein to total protein.

[11.3.G. Statistical analysis.

Data are expressed as mean 5: SEM. Results for RT-PCR studies
were analyzed by two-way repeated measures analysis of variance. All other
results were analyzed by one-way analysis of variance. Group means for all data
were compared using Tukey’s post hoc test. Appropriate transformations were
performed on all data that did not follow a normal distribution. For all studies,
the criterion for statistical signiﬁcance was p < 0.05. For Materials and Methods
for exposure to PCBs, labeling with 3H-AA, measurement of AA release,
measurement of COX activity and production of superoxide anion see Chapter

11.

111.4. Results

111.4.A. Effects of signal transduction inhibitors on 2244-

TCB-mediated ’H-AA release.

In the absence of PCB exposure, HL-60 cells released ~5% of
total 3H-AA after 90 minutes. Exposure to 2244-TCB produced a signiﬁcant
increase in 3H-AA release (Figure 111.1). BEL, an inhibitor of iPLAz
(Ackermann et al, 1995), attenuated the 2244-TCB-mediated increase in 3H-AA

release. Incubation with either OP, an inhibitor of the cytosolic and secretory

66

 

.A
N
a:

- Vehicle
881
_ OF

[222 BEL

 
    

A
O

   
 

 

 

 

     

     

 

(% of Total)

 

[3H] Arachidonic Acid Release
W'
WW- I»

W
W

    

 

0 1 3 10 30
2244-TCB Concentration (1.1M)

Figure III..1 2244-TCB-mediated 3H-AA release In the presence of 3signal
transduction inhibitors. Differentiated HL-60 cells were labeled With 3H-AA
as described in Materials and Methods. Labeled cells (1x106 cells/mL) were
pretreated with vehicle, 5 pM SBI,15 uM OP, or 25 11M BEL. They were then
treated with vehicle (DMF) or 1,3,10 or 30 11M 2244-TCB for 90 minutes. 311-
AA release is presented as the percent of total cellular 3H-AA released into
culture medium. N = 3 separate experiments. a= signiﬁcantly different ﬁ'orn
respective group in the absence of PCB; b= signiﬁcantly different ﬁ'om the
same PCB concentration in the absence of inhibitor.

67

isoforms of PLA2 (Magolda and Galbraith, 1989), or 831, an inhibitor of p38

MAP kinase (Lee et al, 1994) had no effect on 2244-TCB-induced 3H-AA

release.

111.4.B. p38 MAP kinase protein phosphorylation in the

presence of 2244-TCB and signal transduction inhibitors.

Total levels of p38 protein were similar in untreated cells and
2244-TCB-treated cells and were unaffected by $31, SBZ, OP or BEL. In
untreated cells, levels of phosphorylated (active) p38 were negligible. Levels of
phospho-p38 increased after 60 or 90 minutes of exposure to 2244-TCB. The
p38 MAPK inhibitors 881 and SB2 attenuated this increase. Phospho-p38

protein levels were not affected by exposure to OP or BEL (Figure 111.2).

111.4.C. Effects of signal transduction inhibitors on 2244-

TCB—mediated changes in COX-2 mRNA, protein and

activity. .

Exposure to 2244-TCB increased COX-2 mRNA as compared to
control (Figure 111.3.A). Incubation with either SBl or SBZ signiﬁcantly
reduced this increase. Neither OP nor BEL treatment affected the 2244-TCB-
mediated increase in COX-2 mRNA. COX-2 protein was not detectable in
untreated cells. By 60 or 90 minutes of exposure to 2244-TCB, COX-2 protein

was increased to detectable levels (Figure 111.3.B). This increase was prevented

68

 

.a.
O

— Vehicle
831

* 832
12221 OP
_ BEL

0.8 -

     

 

 

 

. e t . . . . e . . . . .
. . . . . . . . I . , . . . . . . .
. . . - ~ . . . v . o . . . . . . . .

\\‘

‘

Phospho-p38 Protein/Beta-actin

. . . . . . . . 4 o e . . e . . . . . .
. . o . . e . . . o . . r r . e t . u
. . . . . . . . . . . n - . . . . e .

- 'TXL"?
a 4). ‘15. n

i. -

 

 

I???
Z
4

 

 

60 minutes 90 minutes

Duration of PCB Exposure

Figure [11.2. 2244-TCB-mediated activation of p38 in the presence of signal
transduction inhibitors. Levels of active, phospho- 38 protein were
determined by Western analysis in HL-60 cells (50 x10 pretreated for 30
minutes With vehicle, 5 uM SB], 15 M SBZ, 15 11M OP or 25 uM BEL, then
treated with 30 M 2244-TCB for 60 or 90 minutes as described in Materials
and Methods. B—actin was used as a loading control. Phospho-p3 8/0-actin ratios
were determined by densitometry. N = 3 separate experiments. a= signiﬁcantly
different from 2244-TCB in the absence of inhibitor at the respective time.

69

D>

 

9°
or

 

 

 

 

 

 

 

  
   

— Vehicle
831
g 3.0 " - $82 a
0 A :2: OP .
£5 2'5‘ III-BEL ?
8 3 2.0- ’1
:2 a
a: E 1.5 t f ,.
E a I
3v 1.0a f =
0 ﬂ
0 0.5 ‘ g
0.0 ‘1
Vehicle 2244-TCB
Treatment
B
.E 1.2 '
$ 1.0- ,
i
0.8 ‘
i 7 i
g 0.64 a a
. I 2
“,1 0.4 I I
a i 5
o 0.2« a a

 

 

0.0 - 7‘7 — ——
60 minutes 90 minutes

Duration of PCB Exposure

Figure 111.3. 2244—TCB-mediated COX-2 mRNA expression in the presence
of signal transduction inhibitors. HL-60 cells (A: 5 x106; B: 50 x106) were
pretreated for 30 minutes with vehicle, 5 11M SB], 15 11M SB2, 15 uM OP or 25
uM BEL, then treated with vehicle or 30 uM 2244-TCB. A) COX-2 mRNA
was determined by RT-PCR as described in Materials and Methods after 30
minutes exposure to 2244-TCB. B) COX-2 protein was determined after 60 or
90 minutes exposure to 2244-TCB as described in Materials and Methods. B-
actin was used as a loading control. N= 5 separate experiments. a= significantly
different from respective group in the absence of 2244-TCB; b= signiﬁcantly
different from 2244-TCB in the absence of inhibitor.

 

70

by incubation of the cells with 831 or SB2. The 2244-TCB-mediated increase
in COX-2 protein was unchanged by exposure to OP or BEL.

COX-2 activity in untreated HL-60 cells was ~10 units/mL (Figure 111.4).
Treatment with 2244-TCB for 90 minutes increased COX-2 activity
approximately 4-fold. Pretreatment with 881 signiﬁcantly decreased 2244-
TCB-stimulated COX-2 activity. Neither OP nor BEL had a signiﬁcant effect

on COX-2 activity.

111.4.D. Effects of inhibitors on p38 and ERK

phosphorylation.

In untreated cells, the ratio of phospho-ERK to total ERK was
small. Treatment with 2244-TCB caused a signiﬁcant increase in phospho-ERK
(Figure 111.5). Pretreatment with either ERK inhibitor, PD 98059 or U 0126,
signiﬁcantly decreased 2244—TCB-stimulated phosphorylation of ERK (Figure
111.5.A). Additionally, pretreatment with either p38 inhibitor signiﬁcantly
decreased 2244-TCB-stimulated phosphorylation of ERK (Figure 11.5.B). None
of these inhibitors affected phosphorylation of ERK in the absence of 2244-
TCB. The ratio of phospho-p38 to total p38 was increased by exposure to 2244-
TCB (Figure 111.6). ERK inhibitors did not affect phosphorylation of p38 in the
absence or presence of 2244-TCB. Phosphorylation of IN K was not affected by

2244-TCB (Figure 111.7).

71

 

Vehicle
m 2244—TCB

 

 

a,
G

 

W \V

g C
U
a

COX-2 Activity (Ulm L)
8 8

 

 

 

////////2
°W

O
«7

NT Veh B1 BEL

Figure [11.4. 2244-TCB-mediated activation of COX-2 in the presence of
signal transduction inhibitors. COX-2 activity was determined in HL-60 cells
(15 x106) pretreated for 30 minutes with vehicle, 5 pM SB], 15 pM GP or 25
pM BEL, then treated with 30 M 2244—TCB for 90 minutes. COX activity was
measured as described in Materials and Methods. N= 3 separate experiments.
NT= no treatment. a= signiﬁcantly different ﬁem untreated cells. b=
signiﬁcantly different ﬁ'om 2244-TCB-treated cells in the absence of inhibitor
(i.e. vehicle-treated).

72

>

 

 

 

 

 

 

 

       

 

 

 

 

 

 

 

 

 

 

 

1.0 .
_ Vehicle
E 1:: PD 98059 a
m 0.8 .. - U 0126
ii
5 0.6 t
a:
u.) 0 4 - b b
O ' I I
.c
O.
8 0.2 t
.c
0.
0.0 -r- -r
B Vehicle 2244-TCB
1.0 -
— Vehicle
E :1 $31 a
m 08 — 882
g ,
5 0 at i b
M I
'i' 04
O n ‘l
.s:
it
0 0.2 r
4:
D.
0.0 w-
Vehicle 2244-TCB

Figure 111.5. Effects of inhibitors on ERK phosphorylation. Phosphorylated
and total ERK were determined by ELISA in HL-60 cells (20 x 10‘) pretreated
for 30 minutes with vehicle, 10 11M PD 98059, 5 uM U 0126, 5 uM 881 or 15
11M S82 then treated with vehicle or 30 uM 2244-TCB for 45 minutes. N = 3
separate experiments. a= signiﬁcantly different from respective group in the
absence of 2244-TCB; b= signiﬁcantly diﬂ‘erent from 2244-TCB in the absence
of inhibitor.

73

Phospho-p38lTotal p38

 

 

 

 

 

 

 

 

 

 

 

 

1.2 7
— Vehicle a
1.0 . C: PD 98059 a
— U 0126 l
0.8 -
0.6 -
0.4 -
0.2 -
0.0 'I' 1'
Vehicle 2244-TCB

Figure [11.6. Effects of inhibitors on p38 phosphorylation. Phosphorylated
and total p38 was determined by ELISA in HL-60 cells (20 x 10‘) pretreated for
30 minutes with vehicle, 10 nM PD 98059 or 5 1.1M U 0126 then treated with
vehicle or 30 uM 2244-TCB for 90 minutes. N = 3 separate experiments. a=
signiﬁcantly different from respective group in the absence of 2244-TCB.

74

Ratio of Phospho-JNKI

 

1_4 1 — Vehicle
[:1 2244-TCB

1.2 ‘ *

 

 

1.0 ~

 

0.8 -

 

 

06*
I

Total JNK

0.4 -

     

0.2 4

 

 

 

 

 

 

 

 

0 15 30 45 60 75 90
Time of Exposure (min)

Figure [11.7. N uclenr JNK is not affected by 2244-TCB. P horylated and
total JNK was determined by ELISA in HL-60 cells (20 x 10 treated with
vehicle or 2244-TCB for 0, 15, 30, 45, 60, 75 or 90 minutes. N = 3 separate

experiments.

75

111.4.E. Effects of ERK inhibitors on 2244-TCB-

mediated COX-2 mRNA expression.

COX-2 mRNA expression was low in vehicle-treated cells
and was unaffected by exposure to either PD 98059 or U 0126 (Figure 111.8). As
noted above, 2244-TCB increased COX-2 mRNA as compared to control.
Pretreatment with either PD 98059 or U 0126 did not affect 2244-TCB-

mediated increases in COX-2 mRNA.

111.4.F. Effect of inhibitors of superoxide anion
production on 2244-TCB-induced changes in COX-2
mRNA expression.
In differentiated HL-60 cells, exposure to 2244-TCB causes
a time- and concentration-dependent increase in superoxide anion production
(Bezdecny et al, 2005). In the absence of 2244-TCB, cells produced ~3OO
nmol/min/million cells of superoxide anion. 2244-TCB increased superoxide
production relative to control (Figure III.9.A), and pretreatment with either the
NADPH oxidase inhibitor apocynin or the intracellular free radical scavenger
TEMPO prevented the 2244-TCB-mediated increase in superoxide anion
concentration.
2244-TCB increased COX-2 mRN A levels approximately fourfold after
30 minutes of exposure (Figure III.9.B). Neither apocynin nor TEMPO

pretreatment affected the 2244-TCB-mediated increase in COX-2 mRN A.

76

OI

 

— Vehicle a
[:3 PD 98059
— U 0126 a

.5

 

 

 

w

 

N

COX-2 mRNA/Beta-actin
(Fold Induction)

 

 

 

 

 

 

 

0 'l‘ -|-
Vehicle 2244-TCB

Figure [11.8. Eﬂects of ERK inhibitors on 2244-TCB-mediated COX-2
mRNA expression. COX-2 mRNA was determined by RT-PCR in HL-60 cells
(5 x106) pretreated for 30 minutes with vehicle, 10 uM PD 98059 or 5 M U
0126, then treated with 30 uM 2244-TCB for 30 minutes. B-actin was used as a
loading control. N= 4 separate experiments. a= signiﬁcantly different from
respective group in the absence of 2244~TCB.

77

>

g A
O §
1 1

l

W

200 4

 

 

 

§§

Vehicle Apocynin TEMPO

 

 

 

 

B Treatment
5 — Vehicle
22: mace b
5 - b
4 b

COX-2 mRNNBeta-actin
(Fold induction)
(to

  

 

 

 

 

W

 

A _

Veh Apo TEMPO Veh Ape TEMPO

 

Figure [11.9. Lack of eﬂ'ect of reactive oxygen species inhibition on 2244-
TCB-indueed upregulation of COX-2 mRNA expression. (A) HL-60 cells
(1x106) were pretreated with vehicle, lmM apocynin (30 minutes) or 200 [AM
TEMPO (10 minutes) then exposed to 30 M 2244—TCB for 30 minutes after
which superoxide anion production was determined. (B) HL-60 cells were
pnetreated with vehicle, apocynin or TEMPO as described, then with vehicle or
2244-TCB for 30 minutes. mRNA was collected for determination of COX-2
mRNA levels. practin was used as a loading control. N = 3 separate
experiments. a= signiﬁcantly different ﬁ'om 2244—TCB-treated cells in the
absence of inhibitor (i.e. vehicle-treated). b= signiﬁcantly different from
respective group in the absence of 2244-TCB.

78

Inhibition of ROS production also did not affect release of 3H-AA (Figure

111.10).

111.5. Discussion

In the present study, three signal transduction pathways were
investigated for potential involvement in 2244-TCB-mediated upregulation of
COX-2 in differentiated HL-60 cells. One signal transduction pathway that was
investigated is the PLAz pathway that leads to release of AA. AA acts as both
the substrate for COX-mediated eicosanoid production as well as a cell
signaling molecule. 2244-TCB increased 3H-AA release, and this response was
attenuated by pretreatment with BEL, an inhibitor of iPLAz, but not by OP, an
inhibitor of cytosolic and secretory PLAz (Figure 111.1). Similar iPLAz-mediated
increases in 3H-AA release and associated increases in eicosanoid production
have been reported in primary rat neutrophils treated with Aroclor 1242 as well
as with individual, noncoplanar PCB congeners (Olivero and Ganey, 2001;
Tithof et a7, 1998). Thus, rat neutrophils and human-derived HL-60 cells appear
to share a common pathway to PCB-stimulated AA release, i.e. one mediated
via iPLAz.

Activation of PLA2 contributed to upregulation of COX-2 in murine
macrophages and human lung cells (Balsinde et al, 1999; Pawliczak et al, 2002,
2004). Furthermore, free AA activates a variety of proteins involved in the
regulation of COX-2 expression, including p38 MAP kinase (Hii et a1, 1998),

peroxisome proliferator-activated receptor 7 (Pawliczak et al, 2002, 2004) and

79

 

.r§\\\\\\e.
V\\\\\\\\\\.
.E.
/////%
//
/////////////

cap» ._e E
33.3. Eu< 3:02:32 "IL

 

 

 

 

 

laPo Veh Apo TEMPO

   

    

 

 

Veh Apo

m 2244—TCB

 

 

Vehicle

  

I

 

10-
8

of ROS

signiﬁcantly

They were then treated with vehicle (DMF) or 30 11M 2244~TCB for 90
minutes. 3H-AA release is presented as the percent of total cellular 3H-AA

released into culture medium. N = 3 separate experiments. a=

vehicle, lmM apocynin for 30 minutes or 200 11M TEMPO for 10 minutes.
different from respective group in the absence of PCB.

inhibitors. Differentiated ru-eo cells were labeled with 3H-AA as described in
Materials and Methods. Labeled cells (1x106 cells/mL) were pretreated with

Figure 111.10. 2244-TCB—mediated ’H-AA release in the presence

80

phosphoinositide 3-kinase (Monick et al, 2002). Interestingly, expression of
COX-2 was decreased in brains of PLAz-deﬁcient mice relative to wild type
mice (Bosetti and Weerasinghe, 2003). These reports suggest that PLA2 or free
AA can contribute to increased expression of COX-2. Despite this possibility,
this pathway does not appear to be involved in the 2244-TCB-mediated
upregulation of COX-2 in HL-60 cells because treatment with BEL, which
inhibited release of 3H-AA, had no effect on COX-2 mRNA, protein or enzyme
activity (Figures 111.3 and 111.4).

The link between p38 activity and changes in COX-2 expression has
been well established in a variety of systems, including rat hepatic macrophages
(Ahmad et al, 2002), the HeLa cell line (Lasa et al, 2000), human airway
myocytes (Singer et al, 2003) and human monocytes (Dean et al, 1999). p38
regulates COX-2 expression both at the transcriptional level, by activating
transcription factors, as well as at the level of RNA stability, by activating
cytoplasmic proteins that increase the half life of COX-2 mRNA (Dean et al,
1999; Lasa et al, 2000; Singer et al, 2003). In the present study, 2244-TCB
exposure increased levels of phosphorylated, active p38 (Figure 111.2).
Activation of p38 MAP kinase was associated with increased levels of COX-2
protein in cells treated with 2244-TCB for similar times (Figure 111.3.B).
Treatment with the p38 MAP kinase inhibitors SB] and SB2 reduced levels of
phospho-p38 as well as mRNA levels, protein and enzyme activity of COX-2

(Figures 111.2, 111.3 and 111.4). These results suggest that 2244-TCB exposure

81

leads to activation of the p38 MAP kinase system, and that this activation is
required for the 2244-TCB-mediated induction of COX-2.

Exposure of neutrophils to PCBs leads to increased production of P65
and Tx (Tithof et al, 1998). Two components are necessary for generation of
P65 and Tx: availability of free AA as substrate and COX activity. 2244-TCB
provides both of these components by apparently independent pathways.
Release of 3H-AA was diminished by an inhibitor of iPLAz, BEL (Figure 111.1),
but this inhibitor did not affect the 2244-TCB-mediated increase in COX-2
mRNA (Figure 111.3.A). Conversely, activation of iPLA2 and subsequent release
of 3H-AA was not affected by inhibitors of p38 MAP kinase (Figure 111.1),
which did reduce the 2244-TCB-mediated upregulation of COX-2 mRN A,
protein and activity (Figure [11.3).

p38 is not the only MAP kinase reported to be involved in induction of
COX-2. Activation of ERK and INK regulates COX-2 expression in several cell
types, including mouse macrophages and RAW-264.7 cells (Moon and Pestka,
2002; Steer et al, 2006), cardiac myocytes (Wu et al, 2006), the HeLa cell line
(Holzberg et al, 2003) and glomerular epithelial cells (T akano et al, 2001). Both
ERK and JNK regulate COX-2 expression at the transcriptional level by
activating transcription factors, but unlike p3 8, do not appear to regulate COX-2
mRNA stability (Holzberg et al, 2003; Moon and Pestka, 2002; Steer et al,
2006; Takano et al, 2001). In the present study, 2244-TCB exposure had no
effect on JNK activation at any time up to 90 minutes after exposure (Figure

111.7). 2244-TCB increased levels of phosphorylated ERK, and this increase was

82

prevented by pretreatment with the p38 inhibitors SB] and SB2, as well as by
the ERK inhibitors PD 98059 and U 0126 (Figure 111.5). However, pretreatment
with PD 98059 or U 0126 had no effect on the 2244-TCB-mediated increase in
COX-2 mRNA (Figure 111.8). These data suggest that ERK is activated by p38
in response to 2244-TCB exposure, but it is not involved in the 2244-TCB-
mediated induction of COX-2.

Another pathway examined involved production of ROS. ROS, such as
superoxide anion, contribute to changes in COX-2 gene regulation induced by a
number of different stimuli in a variety of cell systems. For example, in human
mesangial cells exposed to high glucose, in human monocytes undergoing
differentiation, and in human ﬁbroblasts subjected to cyclic stretch stimuli,
increased COX-2 expression was dependent on generation of ROS (Amma et al,
2005; Barbieri et al, 2003; Kiritoshi et al, 2003). These changes occurred
through activation of p38 MAP kinase and a variety of transcription factors
including NF-ch (Amma et al, 2005; Kim et al, 2005; Singer et al, 2003). In the
present study, 2244-TCB caused an increase in superoxide anion concentration.
This increase was prevented by apocynin, an inhibitor of NADPH oxidase, as
well as by TEMPO, an intracellular free radical scavenger (Figure III.9.A).
However, treatment with apocynin or TEMPO did not affect 2244-TCB-
mediated upregulation of COX-2 mRNA (Figure III.9.B), suggesting that ROS
do not play a critical role in this response in HL-60 cells.

In summary, several different signal transduction pathways are affected

by exposure to 2244-TCB; however, not all of these pathways play a role in

83

2244-TCB-mediated upregulation of COX-2 mRNA. Neither reactive oxygen
species, PLAz nor free AA appear to be involved in increased expression of
COX-2 by 2244-TCB, though increased levels of free AA can still serve as a
substrate for eicosanoid production (Figure 111.11). ERK was activated in
response to 2244-TCB exposure but this activation is not needed for the
upregulation of COX-2. In contrast, increased COX-2 mRNA, protein and
activity were associated with phosphorylation of p38 MAP kinase in 2244-TCB
treated HL-60 cells, and these effects were attenuated by pretreatment with p38
MAP kinase inhibitors. Taken together, these results support a working
hypothesis in which activation of neutrophils by 2244-TCB enhances
prostaglandin production by increasing p38 MAP kinase-dependent biosynthesis
of COX-2 enzyme and by activating iPLAz to provide AA as substrate for

prostaglandin synthesis.

84

ea an 6e 25 $80 an escape en 8a as can;

.<< 3b we omen—2 06 3 memes»: 6ng ,2: «mm .«o «guinea .8353 a .3 23.: Bungee
mobeemm .8233 a .eeeee pee accede size 380 a cease 3 aces eeeeaeee

£5. 68:? .22 wmq mo 9:558 98 eouﬂbonamonn $.33 8:398 mUHrvaN deem ”NOD
2: ac coca—=93: 8 e33— osnenuo 8.73"" some.» he Emma—£35 632—9..— .35— «._.—mg

       
       

ogxoaaé 0330.— <<
maeeeﬁﬁmoa 4mm

5805 ernOU

  

«Beam/one

2&8 38%| VgA.\/:

Nmm Hmm

 

mohrvemm

85

Chapter IV

2,2',4,4'-Tetrachlorobiphenyl Upregulates Cyclooxygenase-2 in HL-60 cells via p38

Mitogen-Activated Protein Kinase and NF-xB

86

IV.1 Summary

PCBs are persistent environmental contaminants that affect a number of
cellular systems, including neutrophils. The objective of this study was to
explore the roles that NF-ch and C/EBP play in the 2244-TCB-mediated
upregulation of COX-2 and to evaluate the relationship of MAP kinase
pathways to 2244-TCB-mediated changes. Treatment of granulocytic HL-60
cells with 2244-TCB increased the amount of nuclear C/EBP beta and NF-ch.
These increases were prevented by pretreatment with either of the p38 MAP
kinase inhibitors, 33] or SB2, but not by pretreatment with either of the ERK
MAP kinase inhibitors, PD 98059 or U 0126. Pretreatment with Bay 11-7082 or
helenalin, inhibitors of NF-KB, prevented the 2244-TCB-mediated induction of
COX-2 mRN A. Exposure to the transcriptional inhibitor ActD after 10 or 20
minutes exposure to 2244-TCB reduced the 2244-TCB-mediated increase in
COX-2 mRN A. However, exposure to ActD after 30 minutes exposure had no
effect upon COX-2 mRNA levels, indicating that transcription of the COX-2
gene occurs rapidly after exposure to 2244-TCB but is no longer signiﬁcant
after 30 minutes exposure. Taken together, these results suggest that p38 is
involved in the increased transcription of the COX-2 gene via an NF-KB-

dependent pathway.

87

IV.2 Introduction

PCBs are persistent, man-made pollutants that are widespread in the
environment. Food is the main source of human exposure, and although PCB
levels are declining due to legislation and preventive measures, people are still
exposed (Turyk et al, 2006). The 209 PCB congeners differ with regard to the
number and the location of the chlorine atoms on the two benzene rings. In the
present study, we focused on 2244-TCB, a noncoplanar congener. Noncoplanar
PCBs are generally considered to be less toxic than coplanar or dioxin-like
PCBs, but occur in the environment in larger concentrations than the dioxin-like
PCBs (WHO, 2003).

PCBs cause a variety of adverse effects, including alterations of the
reproductive, nervous and cardiovascular systems (Faqi et al, 1998; Lamb et al,
2006; Pessah et al, 2006; Warshaw et al, 1976). In addition, they are probable
human carcinogens (Cogliano, 1998) and cause a number of non-cancer effects,
including dermal lesions and ocular toxicity in humans, and hepatotoxicity and
endocrine effects in rats (Morse et al, 1996; Takarnatsu et al, 1985; Twaroski et
al, 2001; Vondracek et al, 2005). PCBs also affect the regulation of a number of
genes, including cytochromes P450 in rat livers and COX-2 in a neutrophil-like
cell line (Bezdecny et al, 2005; Chubb et al, 2004).

COX-2 is generally found in negligible amounts in normal cells, such as
quiescent neutrophils, but is induced by a wide variety of inﬂammatory stimuli
(Smith et al, 2000; Vane et al, 1998). COX-2 catalyzes the committed step in

the synthesis of prostaglandins and thromboxanes. Once produced, these

88

mediators can cause a wide range of immunomodulatory effects by acting on G
protein-linked prostanoid receptors or, in some cases, on nuclear receptors
(Louis et al, 2005).

A number of shared or convergent pathways have been described that are
involved in transcriptional regulation of COX-2 in response to inﬂammatory
mediators. These include NF 46 and C/EBP, two signaling pathways commonly
activated in an inﬂammatory response (Poli, 1998; Ghosh et al, 1998). In
addition, elements of the MAP kinase cascades regulate COX-2 expression.
These pathways are the ERK1/2, JNK and p38 pathways (Su and Karin, 1996).
Both the p38 and ERK pathways are activated in HL-60 cells in response to
2244-TCB exposure, and inhibition of p38 prevents 2244-TCB-mediated
upregulation of COX-2 (Figure 111.3, 111.4).

In mammalian cells, activity of NF-KB is regulated by its association with
the inhibitory subunit, Ich. NF-ch is activated by many of the same agents that
activate neutrophils, such as IL-1, TNF-u and endotoxin. Whereas the initial
steps involved in NF -l<B activation vary among cell types, pathways converge
on kinases which, when activated, phosphorylate the 1x3 subunit, causing it to
dissociate from NF -l<B. NF-ch then translocates into the nucleus where it binds
to transcriptional response elements (Wulczyn et al, 1996). One pathway that
can activate NF-ch is the p38 MAP kinase system. For example, p38 activates
NF -i(B in endotoxin-treated human neutrophils (Cloutier et al, 2006), in human
lung epithelium exposed to Legionella pneumophilia (N ’Guessan et al, 2006)

and in human dendritic cells exposed to CpG DNA (Osawa et al, 2006).

89

C/EBPs comprise a family of transcription factors containing six known
members. In neutrophils, C/EBPs play an important role in cellular maturation.
The regulation of C/EBPs involves transcription of both full-length and
truncated isoforms of the protein. The full-length isoforms activate C/EBP
binding domains in the nucleus. The truncated isoforms also bind to DNA but
lack the transactivation domain required for transcriptional activity (Lekstrom-
Himes, 2001). Like NF-ch, C/EBP is activated by p38 MAP kinase. p38-
dependent activation of C/EBP occurs in proliferating cardiomyocytes
(Ambrosino et al, 2006), mammary epithelial cells (Seymour et al, 2006) and
murine macrophages (Chen et al, 2004). Given the observation that 2244-TCB
increases COX-2 expression by a p38 MAP kinase-dependent mechanism
(Bezdecny et al, 2005; Chapter III) and that both NF-ch and C/EBP-beta are
activated by p38, it was of interest to determine the roles that NF-ch and C/EBP

play in the 2244-TCB-mediated upregulation of COX-2 mRNA.

IV.3 Materials and Methods
IV .3.A. Chemicals
Bay 11-7082 and helanalin were purchased from Biomol
(Plymouth Meeting, PA). Actinomycin D was purchased from Invitrogen
(Carlsbad, CA). All other chemicals were of the highest grade commercially

available.

90

IV.3.B. Exposure to inhibitors.

Stock solutions of inhibitors were prepared by dissolution in
DMSO, and l uL/mL of the stock solution was added to the cells to achieve the
desired concentration. Control cells received 1 uL/mL of DMSO. Exposure to
vehicle caused no signiﬁcant effects. The concentrations of inhibitors used in
the current study were selected based on their ICSO values and previously
described activities (Ackerman et al, 1995; Hsieh et al, 2006; Lee et al, 1994;

Lee et al, 2006; Magolda and Galbraith, 1985).

IV .3.C. Preparation of nuclear extracts.

Differentiated HL-60 cells (5 x 106) were suspended in HBSS
and pretreated with the appropriate inhibitor or vehicle for 30 minutes. They
were then treated with vehicle or 30 uM 2244-TCB. After 30 minutes, nuclear
protein was isolated using a nuclear extract kit (Active Motif, Carlsbad, CA)

according to manufacturer’s instructions.

IV.3.D. Determination of nuclear C/EBP and NF-KB.

For time course studies differentiated HL-60 cells (10 x 106)
were suspended in HBSS and treated with vehicle or 2244-TCB. Nuclear
protein was isolated after 0, 15, 30, 45, 60, 75 or 90 minutes. For inhibitor
studies, differentiated HL-60 cells (10 x 106) were suspended in HBSS and
pretreated with the appropriate inhibitor or its vehicle. 30 minutes later they

were treated with vehicle or 30 uM 2244-TCB for 30 minutes, after which

91

nuclear protein was isolated. Amounts of nuclear C/EBP-beta or NF-ch were
measured using TransAM C/EBP-beta or TransAM NF-KB ELISA kits (Active

Motif, Carlsbad, CA) according to manufacturer’s instructions.

IV.3.E. COX-2 mRNA stability assay.

Differentiated HL-60 cells (5 x 106) were suspended in HBSS
and treated with 30 11M 2244-TCB for 10, 20 or 30 minutes at 37°C. Samples
were then exposed to 10 ug/mL ActD or vehicle. Samples were collected 0, 10,
20, 30, 40, 50 and 60 minutes after exposure to ActD and centrifuged for 10
minutes at 4000 g. RNA was collected, and real-time RT-PCR was performed

on the samples as described above.

IV.3.F. Statistical analysis.

Data are expressed as mean :t SEM. Results were analyzed by
two-way repeated measures analysis of variance. Group means for all data were
compared using Tukey’s post hoc test. Appropriate transformations were
performed on all data that did not follow a normal distribution. For all studies,
the criterion for statistical signiﬁcance was p < 0.05. For information on
exposure to 2244-TCB, see Chapter II. For information on HL-60 cells and

determination of COX-2 mRN A, see Chapter 111.

92

IV.4 Results

IV.4.A. Effects of 2244-TCB on nuclear C/EBP-beta in the

presence and absence of MAP kinase inhibitors.

In the absence of 2244-TCB, the amount of nuclear C/EBP-beta
increased approximately 1.2 fold after 30 minutes of exposure to vehicle and
remained at this value through 90 minutes. Exposure to 30 uM 2244-TCB
caused the amount of nuclear C/EBP-beta to increase approximately 1.6 fold
after 15 minutes of exposure. The amount of nuclear C/EBP-beta remained
greater than values in the vehicle-treated group through 75 minutes of exposure
(Figure IV.1). Pretreatment with either 831 or SBZ, inhibitors of the p38 MAP
kinase pathway, prevented the 2244-TCB-mediated increase in nuclear C/EBP-
beta (Figure IV.2.A). The inhibitors had no effect on the amount of nuclear
C/EBP-beta in the absence of 2244-TCB. Pretreatment with either PD 98059 or
U 0126, inhibitors of the ERK MAP kinase pathway, did not affect the amount

of nuclear C/EBP-beta in the absence or presence of 2244-TCB (Figure IV.2.B).

IV.4.B. Effects of 2244-TCB on nuclear NF-KB.

In the absence of 2244-TCB, the amount of nuclear NF-ch
increased approximately 1.2 fold aﬁer 30 minutes of exposure to vehicle and
remained at this amount through 90 minutes. Exposure to 2244-TCB increased
the amount of NF-KB approximately 1.7 fold after 15 minutes of exposure. The
amount remained greater than the vehicle-treated value for 75 minutes (Figure

IV.3). Pretreatment with either SBl or $82 prevented the 2244-TCB-mediated

93

Fold Increase in
Nuclear CIEBP-beta

 

— Vehicle
:21 2244-TCB

 

 

2.0 1

 

at
U'
.1”
5'

1.8
aib Ft a,b I
1.6 - a,b

 

 

1.4 ~

1.2 -

 

1.01

 

 

 

 

 

 

 

 

0.8 -
0 15 30 45 60 75 90
Time
Figure IV.l. 2244-TCB increases nuclear ClEBP-beta. Nuclear C/EBP-beta
was determined in HL-60 cells (10 x 10") treated with vehicle or 30 and 2244-
TCB for 0, 15, 30, 45, 60, 75 or 90 rrrinutes. N = 3 separate experiments. a=

signiﬁcantly different from group treated for the same time in the absence of
2244—TCB; b= signiﬁcantly different from respective group at time 0.

94

>

Fold Increase In
Nuclear CIEBP-beta

Fold Increase of
Nuclear CIEBP-beta

CO

1.8 '

1.61

1.4 r

1.2 <

1.0J

 

— Vehicle a
E 831

— $82

 

 

 

 

0.8

1.8 ~

1.6 .

1.4 -

1.2 -

1.0 ‘

 

Vehicle 2244-TCB
Treatment

 

— Vehicle
1: PD 98059
_ U 0126

 

 

 

0.8

Vehicle 2244—TCB
Treatment

Figure IV.2. The 2244-TCB-mediated increase in nuclear CIEBP-beta is
reduced by p38 inhibitors, but not by ERK inhibitors. Nuclear C/EBP-beta
was determined in HL-60 cells (10 x 10‘) pretreated with vehicle, 5 uM SBl or
15 11M SB2 (A) or 10 uM PD 98059 or 5 uM U 0126 (B) for 30 minutes, then
treated with 30 uM 2244—TCB for 30 minutes. N = 3 separate experiments. a=
signiﬁcantly different from respective group in the absence of 2244-TCB; b=
signiﬁcantly different from respective group in the absence of inhibitor.

95

 

 

Fold Increase in
Nuclear NF-kappaB

 

.N
to

 

 

 

 

 

 

— Vehicle

2,0 . l: 2244-TCB a,b

1.8 r 34., ab I

13 4 a,b a,b
1.4 .

1.2 -

1.0 1

0.8 ~

 

 

 

 

 

 

 

 

 

o 15 so 45 so 75 90
Time (min)

Figure 1V .3. 2244-TCB increases nuclear NF-er. The amount of nuclear NF-
KB was determined in HL-60 cells (10 x 10‘) treated with vehicle or 2244-TCB
for 0, 15, 30, 45, 60, 75 or 90 minutes. N = 3 separate experiments. a=
signiﬁcantly different ﬁ'om group treated for the same time in the absence of
2244-TCB; b= signiﬁcantly different ﬁom respective group at time 0.

increase in nuclear NF-ch (Figure IV.4.A). Neither SBI nor SBZ affected
nuclear NF-ch in the absence of 2244-TCB. Pretreatment with either PD 98059
or U 0126 did not affect the 2244-TCB-mediated increase in nuclear NF-ch or

the amount of nuclear NF-ch in vehicle-treated cells (Figure IV.4.B).

IV.4.C. Effects of NF-KB inhibitors on 2244-TCB-mediated

COX-2 mRNA expression.

2244-TCB caused an approximately four-fold increase in COX-2
mRNA as compared to control after 30 minutes of exposure (Fig. 1V.5),
conﬁrming previous results (Bezdecny et al, 2005). Incubation with either BAY
11-7082 or helenalin, inhibitors of NF-ch activity, significantly reduced the
2244-TCB-mediated increase in cox-2 mRNA. Inhibition of NF-ch did not

affect the expression of COX-2 mRNA in the absence of 2244-TCB.

IV.4.D. Effect of 2244-TCB on COX-2 mRNA stability.

2244-TCB caused an approximately four-fold increase in COX-2
mRNA, conﬁrming previous results. Inhibition of transcription with ActD
attenuated this increase in cells exposed to 2244-TCB for 10 or 20 minutes, but

not in cells exposed for 30 minutes (Figure 1V.6).

97

CD

 

1°
0

— Vehicle I

12:1 881
_ $32

A

a

N
k

 

 

 

d

a

or
1

Fold increase of
Nuclear NF-kappaB
h

 

 

 

 

 

 

 

 

1.2 T
1.0 4
0.8
Vehicle 2244-TCB
B Treatment
2.2 - Vehicle '
l 1:! PD 98059
2.0 4 - U 0126
1: lg '
E g 1.8 .
a x. ,
5% 1.6
.5 a. 1.4 t
2 3
12 g 1.2 .
z
1.0 l
0.8
Vehicle ZZM—TCB
Treatment

Figure IV.4. The 2244-TCB-mediated increase in nuclear NF-xB is reduced
by p38 inhibitors, but not by ERK inhibitors. Nuclear NF-ch was
determined in HL-60 cells (10 x lo‘) pretreated with vehicle, 5 uM 8B] or 15
11M SB2 (A) or 10 uM PD 98059 or 5 uM U 0126 for 30 minutes, then treated
with 30 M 2244-TCB for 30 minutes. N = 3 separate experiments. a=
signiﬁcantly different ﬁ'om respective group in the absence of 2244-TCB; b=
signiﬁcantly different from respective group in the absence of inhibitor.

98

 

 

 

 

4.5 l
— Vehicle a
4-0 i :21 Bay 11-7082
"5 g 3“,, ﬂ — Helenalln
5 e
2: .3 3.0 -
3 r;
E g 2.5 -
'5 X 2.0 -
'6 o
”' o 1.5-
1.0 -

 

 

 

Vehicle 2244-TCB
Treatment

Figure IV .5. NF-KB inhibitors attenuate the 2244-TCB-mediated increase
in COX-2 mRNA expression. COX-2 mRNA was determined in HL-60 cells
(5 x106) pretreated with vehicle, 10 pM Bay 11-7082 or 10 pM helenalin for 30
minutes, then treated with 30 uM 2244-TCB for 30 minutes. mRNA was
quantiﬁed using real-time RT-PCR as described in Materials and Methods. 8-
actin was used as a loading control. N= 4 separate experiments. a= signiﬁcantly
diﬂ'erent ﬁom respective group in the absence of 2244-TCB. b= signiﬁcantly
different ﬁom respective group in the absence of inhibitor.

99

11>

Fold induction of
COX-2 vs. Beta-Aotin

Fold induction of
COX-2 vs. Beta-actin

 

 

 

 

 

51 B s'-e-Vehlt:le
+Vehicie
+.... .
5‘ 3%5‘
4« 52M
g8
3- 393-
5g
2‘ “#2'
3x
1- “'81 a
o . . . . r . . o . . . . . . .
otozosowsosoro 10203040500070”
Minutes After 2244-TCB Minutes After 2244-TCB

6 ‘ —e— Vehicle
-a— ActD

 

 

rosorosoeoroeosoroo
Minutes after 2244~TCB

Figure 1V.6. Effects of inhibition of transcription on 2244-TCB-mediated
COX-2 mRNA expression. Differentiated HL—60 cells (5 x 106) were treated
with DMSO as vehicle or with 30 11M 2244—TCB for 10 (A), 20 (B) or 30 (C)
minutes. Cells were then treated with 10 ug/mL of the transcriptional inhibitor
actinomycin D, and samples were collected every 10 minutes. COX-2 mRNA
levels were determined by Sybr Green RT-PCR as described in Materials and
Methods. All data were normalized to B—actin. N= 4 separate experiments. a=
signiﬁcantly different from vehicle-treated groups.

IV.5. Discussion

In the present study, the role of the transcription factors NF-KB and
C/EBP in the 2244-TCB-mediated upregulation of COX-2 were examined, as
was the effect that inhibition of the p38 and ERK MAP kinase pathways have
upon these pathways. Each of these transcription factors has been implicated in
the regulation of COX-2 in different cell systems. For example, NF-KB is
involved in the upregulation of COX-2 in response to infection by Legionella
bacteria in the lung and the parasite Coptosporidium in the heart (Asaad and
Sadek, 2006; N’Guessan et al, 2006). Additionally, NF-ch regulates COX-2
transcription in insulin-treated ﬁbroblasts (Kitazawa et al, 2006),
lipopolysaccharide-treated RAW 264.7 cells (Chen et al, 2006) and triptolide-
treated astrocytes. C/EBP-beta is involved in the regulation of COX-2 in gastric
tumors (Regalo et al, 2006), the human amnion (Lee et al, 2006) and in
collagen-treated RAW 264.7 cells (Cho et al, 2004). 2244-TCB increased
nuclear levels of C/EBP-beta in a time—dependent manner (Figure IV.1),
suggesting increased transcriptional activity of C/EBP-beta. Levels of nuclear
C/EBP-beta were increased after 15 minutes of exposure to 2244-TCB and this
increase was maintained up to 75 minutes after exposure. COX-2 mRN A was
also increased in response to 2244-TCB exposure shortly aﬁer the increase in
nuclear C/EBP-beta was observed (Bezdecny et al, 2005). Taken together, this
suggests that increased nuclear C/EBP-beta might play a role in the 2244-TCB-

mediated upregulation of COX-2 mRN A.

101

p38 MAP kinase regulates activation and nuclear translocation of
C/EBP-beta in proliferating cardiomyocytes (Ambrosino et al, 2006) and
mammary epithelial cells (Seymour et al, 2006). In addition, p3 8-dependent
activation of C/EBP-beta participates in the upregulation of COX-2 in murine
macrophages (Chen et a1, 2004). Similarly, the 2244-TCB-induced increase in
nuclear translocation of C/EBP-beta was prevented by pretreatment with SBI or
SB2, indicating that activation of p38 is required for this response (Figure
IV.2.A). SB2 was used to conﬁrm the results of SBI, as SBI may affect the
JNK MAP kinase pathway, whereas SBZ is more selective for p38 MAP kinase
inhibition (Cuenda et al, 1995).

ERK can also regulate the activation and translocation of C/EBP-beta.
This has been demonstrated in differentiating HL-60 cells (Marcinkowska et al,
2006), in ceramide-treated rat hepatocytes (Giltiay et al, 2005) and in mouse
ﬁbroblasts (Park et al, 2004). However, ERK does not appear to be involved in
the 2244-TCB-mediated activation and nuclear translocation of C/EBP-beta in
HL-60 cells, as pretreatment with either PD 98059 or U 0126 had no effect on
levels of nuclear C/EBP-beta (Figure IV.2.B).

Activation of NF-ch is important in the regulation of COX-2 in human
adherent monocytes (Barbieri et al, 2004), in gastric ulcer healing in rats
(Takahashi et al, 2001) and in rats challenged with lipopolysaccharide (Liu et
al, 1999). In addition, NF -ch is critical to the regulation of COX-2 in HL-60
cells treated with andrographolide (Hidalgo et al, 2005) and in human

neutrophils exposed to water-soluble bacterial proteins (Kim et al, 2001). In the

102

 

 

 

 

 

 

present study, exposure to 2244-TCB caused a timerdependent increase in
nuclear NF-ch levels (Figure IV.3) suggesting activation of this transcription
factor. Additionally, nuclear levels of NF-ch were elevated at the same times
that 2244-TCB-mediated increases in COX-2 mRNA were observed, suggesting
a link between NF-KB activation and increases in COX-2 mRN A.

As observed for C/EBP-beta, inhibition of p38 reduced the 2244-TCB-
mediated increase in nuclear NF-ch (Figure IV .4.A). p38 MAP kinase is
involved in the phosphorylation of Ich, the inhibitory subunit of NF-ch,
leading to the subsequent activation and nuclear translocation of NF «B
(Sweeney and Firestein, 2004). Activation of p38 and its subsequent activation
of NF-ch regulates COX-2 expression in linoleic acid-treated mouse skin
(Hwang, et al, 2006), in RAW 264.7 cells treated with dipyridarnole (Chen et
al, 2006) and in human tracheal smooth muscle cells treated with interleukin-
lbeta (Lin et al, 2004). Interestingly, in human pulmonary epithelial cells
treated with phorbol 12-myristate 13-acetate, ERK and NF -ch, but not p38
MAP kinase were required for upregulation of COX-2 (Chang et al, 2005). In
contrast to p38, ERK inhibitors did not affect the amount of nuclear NF-ch
(Figure IV.4.B). Activation of ERK and subsequent activation and nuclear
translocation of NF-ch regulates COX-2 expression in resveratrol-treated
mouse skin (Kundu et al, 2006), in RAW 264.7 cells exposed to Mycobacterium
avium proteins (Pathak et al, 2004) and in human pulmonary epithelial cells
(Chang et al, 2005). However, results presented here suggest that ERK does not

participate in the 2244-TCB-mediated activation of NF -l(B.

103

Taken together, the results suggest that 2244-TCB activates NF-ch and
C/EBP-beta in a p3 8-dependent manner. How do these events relate to 2244-
TCB-mediated increased expression of COX-2? Previously we demonstrated
that p38 is critical to 2244-TCB-mediated upregulation of COX-2 (see Chapter
111). Here we present data suggesting that NF-ch is also important in this
response (Figure IV.5). Accordingly, the results suggest that activation of NF-
ch by p38 is an important component in the 2244-TCB-mediated upregulation
of COX-2. The link between p38 activity and regulation of COX-2 has been
demonstrated in rat hepatic macrophages (Ahmad et a1, 2002), the HeLa cell
line (Lasa et al, 2000), human airway myocytes (Singer et al, 2003) and human
monocytes (Dean et al, 1999).

p38 regulates the transcription of the COX-2 gene as well as stability of
COX-2 mRNA. The latter effect is mediated by activation of cytoplasmic
proteins, such as the mRNA stabilization factor HuR, that increase the half life
of COX-2 mRNA (Dean et a1, 1999; Dixon et al, 2001; Lasa et al, 2000; Singer
et al, 2003). It seems likely that 2244-TCB regulates COX-2 at the level of
transcription, since NF -l<B was required for this upregulation, but the critical
role of p38 raised the possibility that stabilization of mRNA also contributed to
increases in COX-2. Inhibition of transcription with ActD reduced COX-2
mRNA levels in cells exposed to 2244-TCB for 10 or 20 minutes, but not in
cells exposed to 2244-TCB for 30 minutes. These results suggest that p38 might
regulate COX-2 mRN A levels both by activating transcription factors including

NF-ch and C/EBP-beta rapidly upon exposure to 2244-TCB (Figure 1V.6).

104

 

 

There is also the possibility that activation of p38 may contribute to increases in
COX-2 mRNA by increasing the stability of existing COX-2 mRN A.

In summary, exposure to 2244-TCB upregulates COX-2 expression via a
p38 MAP kinase-dependent mechanism. Activation of p38 leads to increases in
nuclear levels of C/EBP-beta and NF -KB, and inhibition of NF-KB prevents
2244-TCB-induced upregulation of COX-2. Taken together, the results of these
studies suggest that p38 is involved in the increased transcription of the COX-2

gene via an NF-ch-dependent pathway.

105

Chapter V

Summary

106

Neutrophils are the predominant white blood cell in the human circulatory
system and are one of the most important cells of the innate immune system.
The primary role of neutrophils is to attack and destroy invading
microorganisms. They exhibit the most rapid response to tissue injury of any
immune cell. Neutrophils are also one of the major cell types involved in the
inﬂammatory response. Neutrophils are normally quiescent, only exhibiting
their biological activity when activated. Given the role of neutrophils in host
defense and the requirement for activation, the mechanisms by which
neutrophils become activated are of great importance. Failure of neutrophils to
activate results in severe compromise of the immune system, leading to
increased risk of infection. At the other end of the spectrum, inappropriate
activation of neutrophils can lead to inﬂammatory disease states, as the
activated neutrophils damage host tissue. A number of cellular changes
accompany neutrophil activation, including changes in cell surface proteins,
increased chemotaxis, activation of cell signaling pathways and increased
transcription of inﬂammatory genes such as COX-2.

Neutrophil function can be affected by a wide range of toxic compounds,
including bacterial components such as endotoxin, naturally occurring
compounds such as monocrotaline and man-made chemicals such as PCBs and
other organochlorine compounds. These compounds cause numerous effects
such as impairment of neutrophil function, impaired or inappropriate neutrophil
activation and changes in cell signaling pathways. The effect of PCBs is

particularly well studied in the rat neutrophil. In these cells PCB exposure

107

caused activation of NADPH oxidase and increased production of superoxide
anion, activation of iPLAz and release of AA as well as activation of other
signal transduction pathways.

Many of the responses seen in PCB-exposed rat neutrophils have also
been observed in other cell types, notably human neutrophils and as presented in
the preceding chapters, granulocytic HL-60 cells. All three of these cell types
show increased oxidative burst and production of superoxide anion in response
to PCB exposure. Far more work has been done in rat neutrophils and
granulocytic HL-60 cells. Work presented in this dissertation demonstrates that
rat neutrophils and granulocytic HL-60 cells respond similarly to PCB exposure.
Both cell types show activation of iPLAz and subsequent release of free AA.
Additionally, activation of protein kinases, changes in intracellular Ca2+ and
induction of degranulation occur in both rat neutrophils and granulocytic HL-60
cells exposed to PCBs. These ﬁndings are important, as they demonstrate that
neutrophils from different species, as well as a neutrophil-like human cell line,
share common responses to PCB exposure.

As mentioned above, COX-2 is an important component of the
inﬂammatory response. COX-2 is the key enzyme required for the conversion
of AA to PGs and Tx. Once produced, these mediators can cause a wide range
of immunomodulatory effects on multiple cell types by acting on G protein-
linked prostanoid receptors, or in some cases these products may act on nuclear
receptors. Some effects these mediators have upon the inﬂammatory response

include increased vascular permeability and vascular dilation, as well as acting

108

as chemotactic factors for neutrophils. COX-2 activity is typically present at
low to negligible levels in quiescent neutrophils. However, the COX-2 gene is
strongly inducible by a variety of pro-inﬂammatory stimuli, such as TNF-a, IL-
1, IL-2 and LPS. Inappropriate induction of COX-2 can have serious
consequences, particularly on preexisting inﬂammatory states. Induction of
COX-2, with the attendant increase in prostaglandin and thromboxane
production, may lead to increased recruitment and activation of inﬂammatory
cells such as neutrophils, increasing the severity of existing inﬂammatory
conditions.

The goal of this thesis was to test the hypothesis that 2244-TCB increases
cyclooxygenase-2 expression in granulocytic HL-60 cells, and that this increase
depends on activation of intracellular signaling pathways such as AA release,
superoxide anion production and activation of the p38 mitogen-activated protein
kinase. Results presented in the previous chapters led to the working hypothesis
presented in Figure V.l. 2244-TCB caused a time- and concentration-
dependent increase in COX-2 mRN A, protein and enzyme activity as well as
increased phosphorylation and activation of the p38 MAP kinase. These
increases were prevented by inhibition of p38 MAP kinase. The 2244-TCB-
mediated increase in COX-2 mRNA involved activation and nuclear
translocation of the transcription factors NF-KB and C/EBP-beta by a p38 MAP
kinase-dependent mechanism.

While the speciﬁc mechanism by which 2244-TCB causes these effects is

unknown, several hypotheses have been put forth. One such hypothesis suggests

109

 

.I. til. I .. llll/illl/ilill/llli. «illitll 114

 

that 2244-TCB directly interacts with the enzymes involved. Another is that
PCB exposure causes stress to the cellular membranes, leading to the activation
of stress response mechanisms. However, this is unlikely as noncoplanar PCBs
and not coplanar PCBs cause these effects and both types of PCBs would be
expected to cause the same degree of cellular stress.

2244-TCB exposure also caused increased production of superoxide
anion. This increase was caused by the activation of NADPH oxidase by free
AA. While increased levels of ROS can lead to changes in gene expression via
the activation of ROS-dependent kinases, ROS generation does not play a role
in the 2244-TCB-dependent upregulation of COX-2 mRN A.

Additionally, 2244-TCB exposure caused increases in free AA. This
release was mediated by iPLAz. However, release of AA was not involved in
the 2244-TCB-mediated upregulation of COX-2 mRNA. Despite not
contributing to regulation of COX-2 in the presence of 2244-TCB, the increased
levels of free AA might still be used as substrate for COX-Z-mediated
production of PGs and Tx, as signiﬁcant increases of free AA occur at the same
time as the 2244-TCB-mediated increases in COX-2 protein and activity.

Noncoplanar PCBs such as 2244-TCB are generally considered to be less
toxic than coplanar or dioxin-like PCBs but are on the other hand detected at
greater concentrations and are generally more persistent in the environment than

the dioxin-like PCBs. Despite this fact little is known about the signal

110

.aoe 8..E subspace e. «*8 as
sees—amends cascade—oases" 2.. s eases... eases. eeeoeease .saam ._..» enema

emmExo

 

N
TEQSA - O
unease—885 ﬂ ll ammo—8 <<
mﬁeﬁEﬁmoa U/aerea can it —
:8 ca -
. u m NOD madam
mmmco a a a
mermz sill. mm ran/mo: ﬂ
kgA . e
<5? ~-xooeL mm

 

mohrgmm

111

transduction pathways by which noncoplanar PCBs mediate their toxicity. As
human exposure to PCBs, particularly noncoplanar PCBs will continue to be
signiﬁcant for decades to come, a better understanding of the effects
noncoplanar PCBs have upon cell signaling pathways is needed. This thesis
elucidates one such pathway by which a noncoplanar PCB changes neutrophil
function by activating speciﬁc cell signaling mechanisms to cause changes in
the expression of COX-2, a enzyme of critical importance in the inﬂammatory
response and in overall neutrophil function. These results demonstrate several
components of cell signaling are activated by 2244-TCB in HL-60 cells. These
components, particularly the p38 MAP kinase pathway and the transcription
factor NF-ltB, are present in all mammalian cells. Therefore these noncoplanar
PCBs can potentially affect the function of any cell type by interacting with
these common pathways. p38 is important in responding to cellular stress while
NF-ch is involved in the regulation of many inﬂammatory genes in addition to
COX-2. Changes in the proper function of either of these components would
cause serious consequences to cell function and survival. By understanding the
mechanisms by which noncoplanar PCBs mediate their toxic effects a better
knowledge of the potential toxicity of PCBs and other similar compounds can

be reached.

112

 

BIBLIOGRAPHY

113

BIBLIOGRAPHY

Abramson SB, Weissmann G. (1989). The mechanisms of action of
nonsteroidal antiinﬂammatory drugs. Arthritis Rheum. 32, 1—9.

Ackermann EJ, Conde—Frieboes K, Dennis EA. (1995). Inhibition of
macrophage Ca(2+)-independent phospholipase A2 by bromoenol lactone and
triﬂuoromethyl ketones. J Biol Chem. 270, 445-50.

Ahmad SU, Tariq S, Jalali S, Ahmad MM. (2003). Environmental pollutant
Aroclor 1242 (PCB) disrupts reproduction in adult male rhesus monkeys
(Macaca mulatta). Environ Res. 93, 272-8.

Ahmad N, Chen LC, Gordon MA, Laskin JD, Laskin DL. (2002).
Regulation of cyclooxygenase-2 by nitric oxide in activated hepatic
macrophages during acute endotoxemia. J Leukoc Biol. 71, 1005-11.

Alvarez-Maqueda M, El Bekay R, Monteseirin J, Alba G, Chacon P, Vega
A, Santa Maria C, Tejedo JR, Martin-Nieto J, Bedoya FJ, Pintado E,
Sobrino F. (2004). Homocysteine enhances superoxide anion release and
NADPH oxidase assembly by human neutrophils. Effects on MAPK activation
and neutrophil migration. Atherosclerosis. 2172, 229-38.

Ambrosino C, Iwata T, Scafogiio C, Mallardo M, Klein R, Nebreda AR.
(2006). TEF-l and C/EBPbeta are major p38alpha MAPK-regulated
transcription factors in proliferating cardiomyocytes. Biochem J. 396, 163-72.

Amma H, Naruse K, Ishiguro N, Sokabe M. (2005). Involvement of reactive
oxygen species in cyclic stretch-induced NF-kappaB activation in human
ﬁbroblast cells. Br J Pharmacol. 145, 364-73.

Angus WG, Contreras ML. (1995). Aroclor 1254 alters the binding of 1251-
labeled nerve grth factor in PC12 cells. Neurosci. Lett. 191, 23-6.

114

Aoki Y. (2001). Polychlorinated biphenyls, polychlorinated dibenzo-p-dioxins,
and polychlorinated dibenzofurans as endocrine disrupters--what we have
learned from Yusho disease. Environ Res. 86, 2-11.

Armitage JM, Hanson M, Axelman J, Cousins IT. (2006). Levels and
vertical distribution of PCBs in agricultural and natural soils from Sweden. Sci
Total Environ. 371, 344-52.

Arroyo A, Modriansky M, Serinkan FB, Bello RI, Matsura T, Jiang J,
Tyurin VA, Tyurina YY, Fadeei B, Kagan VE. (2002). NADPH oxidase-
dependent oxidation and extemalization of phosphatidylserine during apoptosis
in MeZSO-differentiated HL-60 cells. Role in phagocytic clearance. J Biol
Chem. 277, 49965-75.

Asaad NY, Sadek GS. (2006). Pulmonary cryptosporidiosis: role of COX2 and
NF-kB. APMIS. 114, 682-9.

Augustowska K, Wojtowicz A, Kajta M, Ropstad E, Gregoraszczuk EL.
(2001). Polichlorinated biphenyls (PCB126 and PCB 153) action on
proliferation and progesterone secretion by cultured in vitro porcine luteal cells.
Exp. Clin Endocrinol. Diabetes 109, 416-8.

Babior BM, Curnutte JT, McMurrich BJ. (1976). The particulate
superoxide-forming system from human neutrophils. Properties of the system

and further evidence supporting its participation in the respiratory burst. J Clin
Invest. 58, 989-96.

Bae J, Stuenkel EL, Loch-Caruso R. (1999). Stimulation of oscillatory uterine
contraction by the PCB mixture Aroclor 1242 may involve increased [Ca2+]i
through voltage-operated calcium channels. Toxicol Appl Pharmacol. 155, 261-
72.

Balsinde J, Shinohara H, Lefkowitz LJ, Johnson CA, Balboa MA, Dennis
EA. (1999). Group V phospholipase A(2)-dependent induction of
cyclooxygenase-2 in macrophages. J Biol Chem. 274, 25967-70.

115

Bandiera S, Safe S, Okey AB. (1982). Binding of polychlorinated biphenyls
classiﬁed as either phenobarbitone-, 3-methylcholanthrene- or mixed-type
inducers to cytosolic Ah receptor. Chem Biol Interact. 39, 259-77.

Barat C, Tremblay MJ. (2003). Treatment of human T cells with
bisperoxovanadium phosphotyrosyl phosphatase inhibitors leads to activation of
cyclooxygenase-2 gene. J Biol Chem. 278, 6992-7000.

Barbieri SS, Cavalca V, Eligini S, Brambilla M, Caiani A, Tremoli E, Colli
S. (2004). Apocynin prevents cyclooxygenase 2 expression in human
monocytes through NADPH oxidase and glutathione redox-dependent
mechanisms. Free Radic Biol Med. 37, 156-65.

Barbieri SS, Eligini S, Brambilla M, Tremoli E, Colli S. (2003). Reactive
oxygen species mediate cyclooxygenase-2 induction during monocyte to
macrophage differentiation: critical role of NADPH oxidase. Cardiovasc Res.
60, 187-97.

Becker EL. (1976). Some interrelations of neutrophil chemotaxis, lysosomal

enzyme secretion, and phagocytosis as revealed by synthetic peptides. Am J
Pathol. 85, 385-94.

Bergman A, Klasson-Wehler E, Kuroki H. (1994). Selective retention of
hydroxylated PCB metabolites in blood. Environ. Health Perspect. 102, 464-9.

Bezdecny SA, Roth RA, Ganey PE. (2005). Effects of 2,2',4,4'-
tetrachlorobiphenyl on granulocytic HL-6O cell function and expression of
cyclooxygenase-2. Toxicol Sci. 84, 328-34.

Bimbaum LS, Tuomisto J. (2000). Non-carcinogenic effects of TCDD in
animals. Food Addit Contam 17, 275-88.

Bos CL, Richel DJ, Ritsema T, Peppelenbosch MP, Versteeg HH. (2004).
Prostanoids and prostanoid receptors in signal transduction. Int J Biochem Cell
Biol. 36, 1187-205.

116

Bosetti F, Weerasinghe GR. (2003). The expression of brain cyclooxygenase-2
is down-regulated in the cytosolic phospholipase A2 knockout mouse. J
Neurochem. 87, 1471-7.

Bouzidi F, Doussiere J. (2004). Binding of arachidonic acid to myeloid-related
proteins (8100A8/A9) enhances phagocytic NADPH oxidase activation.
Biochem Biophys Res Commun. 325, 1060-5.

Brambilla R, Neary JT, Cattabeni F, Cottini L, D'Ippolito G, Schiller PC,
Abbracchio MP. (2002). Induction of COX-2 and reactive gliosis by P2Y
receptors in rat cortical astrocytes is dependent on ERKl/2 but independent of
calcium signalling. J Neurochem. 83, 1285-96.

Brackman D, Lund-Johansen F, Aarskog D. (1995). Expression of leukocyte
differentiation antigens during the differentiation of HL-60 cells induced by
1,25-dihydroxyvitamin D3: comparison with the maturation of normal
monocytic and granulocytic bone marrow cells. J. Leukoc. Biol. 58, 547-55.

Breitman TR, Selonick SE, Collins SJ. (1980). Induction of differentiation of
the human promyelocytic leukemia cell line (HL-60) by retinoic acid. Proc.
Natl. Acad. Sci. U S A 77, 2936-40.

Brown AP, Olivero-Verbel J, Holdan WL, Ganey PE. (1998). Neutrophil

activation by polychlorinated biphenyls: structure-activity relationship. Toxicol
Sci. 46, 308-16.

Brown AP, Ganey PE. (1995). Neutrophil degranulation and superoxide
production induced by polychlorinated biphenyls are calcium dependent.
Toxicol Appl Pharmacol. 131, 198-205.

Calafat J, Kuijpers TW, Janssen H, Borregaard N, Verhoeven AJ, Roos D.
(1993). Evidence for small intracellular vesicles in human blood phagocytes
containing cytochrome b558 and the adhesion molecule CD11b/CD18. Blood
81, 3122-9.

Camacho IA, Nagarkatti M, Nagarkatti PS. (2004). Effect of 2,3,7,8-
tetrachlorodibenzo-p-dioxin (TCDD) on maternal immune response during
pregnancy. Arch Toxicol. 78, 290-300.

117

Carpenter DO. (2006). Polychlorinated biphenyls (PCBs): routes of exposure
and effects on human health. Rev Environ Health. 21, 1-23.

Chalimoniuk M, King-Pospisil K, Pedersen WA, Malecki A, Wylegala E,
Mattson MP, Hennig B, Toborek M. (2004). Arachidonic acid increases
choline acetyltransferase activity in spinal cord neurons through a protein kinase
C-mediated mechanism. J Neurochem. 90, 629-36.

Chan BS, Satriano JA, Pucci M, Schuster VL. (1998). Mechanism of
prostaglandin E2 transport across the plasma membrane of HeLa cells and

Xenopus oocytes expressing the prostaglandin transporter "PGT". J. Biol.
Chem. 273, 6689-97.

Chang MS, Chen BC, Yu MT, Sheu JR, Chen TF, Lin CH. (2005). Phorbol
12-myristate 13-acetate upregulates cyclooxygenase-2 expression in human
pulmonary epithelial cells via Ras, Raf-1, ERK, and NF-kappaB, but not p38
MAPK, pathways. Cell Signal. 17, 299-310.

Chang L, Karin M. (2001). Mammalian MAP kinase signaling cascades.
Nature 410, 37-40.

Chang KJ, Hsieh KH, Tang SY, Tung TC, Lee TP. (1982). Immunologic
evaluation of patients with polychlorinated biphenyl poisoning: evaluation of

delayed-type skin hypersensitive response and its relation to clinical studies. J
Toxicol Environ Health. 19, 217-23.

Chen CH, Sheu MT, Chen TF, Wang YC, Hou WC, Lin DZ, Chung TC,
Liang YC. (2006). Suppression of endotoxin-induced proinﬂammatory
responses by citrus pectin through blocking LPS signaling pathways. Biochem
Pharmacol. 72, 1001-9.

Chen TH, Kao YC, Chen BC, Chen CH, Chan P, Lee HM. (2006).
Dipyridamole activation of mitogen-activated protein kinase phosphatase-1

mediates inhibition of lipopolysaccharide-induced cyclooxygenase-2 expression
in RAW 264.7 cells. Eur J Pharmacol. 541, 138-46.

118

Chen JC, Huang KC, Wingerd B, Wu WT, Lin WW. (2004). HMG-CoA
reductase inhibitors induce COX-2 gene expression in murine macrophages:
role of MAPK cascades and promoter elements for CREB and C/EBPbeta. Exp
Cell Res. 301, 305-19.

Cho JW, Park K, Kweon GR, Jang BC, Back WK, th MH, Kim CW, Lee
KS, Suh SI. (2005). Curcumin inhibits the expression of COX-2 in UVB-
irradiated human keratinocytes (HaCaT) by inhibiting activation of AP-l: p38
MAP kinase and JNK as potential upstream targets. Exp Mol Med. 37, 86-92.

Cho MK, Cho YH, Lee GH, Kim SG. (2004). Induction of cyclooxygenase-2
by bovine type I collagen in macrophages via C/EBP and CREB activation by
multiple cell signaling pathways. Biochem Pharmacol. 67, 2239-50.

Chu I, Villenenve DC, Yagminas A, Lecavalier P, Poon R, Feeley M,
Kennedy SW, Seegal RF, Hakansson H, Ahlborg UG, Valli VE, Bergman
A. (1996). Toxicity of 2,2',4,4',5,5'-hexachlorobiphenyl in rats: effects following
90-day oral exposure. J Appl Toxicol. 16, 121-8.

Chubb LS, Andersen ME, Broccardo CJ, Legare ME, Billings RE, Dean
CE, Hanneman WH. (2004). Regional induction of CYP1A1 in rat liver
following treatment with mixtures of PCB 126 and PCB 153. Toxicol Pathol.
32, 467-73

Clark RA. (1990). The human neutrophil respiratory burst oxidase. J Infect Dis.
161, 1140-7.

Cloutier A, Ear T, Blais-Charron E, Dnbois CM, McDonald PP. (2006).
Differential involvement of NF-{kappa}B and MAP kinase pathways in the

generation of inﬂammatory cytokines by human neutrophils. J Leukoc Biol.
Epub ahead of print

Cogliano VJ. (1998). Assessing the cancer risk from environmental PCBs.
Environ Health Perspect. 106, 317-23.

Cohen S. (1976). Cell mediated immunity and the inﬂammatory system. Hum
Pathol. 7, 249-64.

119

Collins SJ. (1987). The HL-60 promyelocytic leukemia cell line: proliferation,
differentiation, and cellular oncogene expression. Blood. 70, 1233-44.

Collins SJ, Ruscetti FW, Gallagher RE, Gallo RC. (1979). Normal functional
characteristics of cultured human promyelocytic leukemia cells (HL-60) after
induction of differentiation by dimethylsulfoxide. J. Exp. Med. 149, 969-74.

Collins SJ, Ruscetti FW, Gallagher RE, Gallo RC. (1978). Terminal
differentiation of human promyelocytic leukemia cells induced by dimethyl
sulfoxide and other polar compounds. Proc. Natl. Acad. Sci. U SA 75, 2458-62.

Crofford LJ, McDonagh KT, Guo S, Mehta H, Bian H, Petrnzelli LM,
Roessler BJ. (2005). Adenovirus binding to cultured synoviocytes triggers

signaling through MAPK pathways and induces expression of cyclooxygenase-
2. J Gene Med. 7, 288-96.

Cnenda A, Rouse J, Doza YN, Meier R, Cohen P, Gallagher TF, Young PR,
Lee JC. (1995). SB 203580 is a specific inhibitor of a MAP kinase homologue
which is stimulated by cellular stresses and interleukin-1. FEBS Lett. 364, 229-
33.

Dean JL, Brook M, Clark AR, Saklatvala J. (1999). p38 mitogen-activated
protein kinase regulates cyclooxygenase-2 mRN A stability and transcription in
lipopolysaccharide-treated human monocytes. J Biol Chem. 274, 264-9.

Dennis EA, Rhee SG, Billah MM, Hannnn YA. (1991). Role of

phospholipase in generating lipid second messengers in signal transduction.
FASEBJ. 5, 2068-77.

De Roos AJ, Hartge P, Lubin JH, Colt JS, Davis S, Cerhan JR, Severson
RK, Cozen W, Patterson DG Jr, Needham LL, Rothman N. (2005).
Persistent organochlorine chemicals in plasma and risk of non-Hodgkin's
lymphoma. Cancer Res. 65, 11214-26.

120

Dixon DA, Tolley ND, King PH, Nabors LB, McIntyre TM, Zimmerman
GA, Prescott SM. (2001). Altered expression of the mRNA stability factor

HuR promotes cyclooxygenase-2 expression in colon cancer cells. J Clin Invest.
108, 1657-65.

Dufer J, Biakon D, Joly P, Benoist H, Carpentier Y, Desplaces A. (1989).
Quantitative morphological aspects of granulocytic differentiation induced in
HL-60 cells by dimethylsulfoxide and retinoic acid. Leulc Res. 13, 621-7.

Ellis TN, Beaman BL. (2004). Interferon-gamma activation of
polymorphonuclear neutrophil function. Immunology. 2112, 2-12.

Faqi AS, Dalsenter PR, Merker HJ, Chahond I. (1998). Effects on
developmental landmarks and reproductive capability of 3,3',4,4'-
tetrachlorobiphenyl and 3,3',4,4',5-pentachlorobiphenyl in offspring of rats
exposed during pregnancy. Hum Exp Toxicol. 17, 365-72.

Faonr WH, Mancini A, He QW, Di Battista JA. (2003). T-cell-derived
interleukin-17 regulates the level and stability of cyclooxygenase-2 (COX-2)
mRN A through restricted activation of the p38 mitogen-activated protein kinase
cascade: role of distal sequences in the 3'—untranslated region of COX-2 mRNA.
J Biol Chem. 278, 26897-907.

Fischer LJ, Seegal RF, Ganey PE, Pessah IN, Kodavanti PR. (1998).
Symposium overview: toxicity of non-coplanar PCBs. Toxicol. Sci. 41, 49-61.

Fischer LJ, Zhou HR, Wagner MA. (1996). Polychlorinated biphenyls release
insulin from RINmSF cells. Life Sci. 59, 2041-9.

Fox LL, Grasman KA. (1999). Effects of PCB 126 on primary immune organ
development in chicken embryos. J. Toxicol. Environ. Health A. 58, 233-44.

Fujimaki H, Nohara K, Kobayashi T, Suzuki K, Egnchi-Kasai K, Tsnkumo
S, Kijima M, Tohyama C. (2002). Effect of a single oral dose of 2,3,7,8-
tetrachlorodibenzo-p-dioxin on immune function in male NC/Nga mice. Toxicol
Sci. 66, 117-24.

121

Galassi, S., Valsecchi, S., and Tartari, G. (1997). The distribution of PCBs

and chlorinated pesticides in two connected Himalayan lakes. Water, Air, Soil
Poll. 99, 717-725.

Ganey PE, Sirois JE, Denison M, Robinson JP, Roth RA. (1993). Neutrophil
function after exposure to polychlorinated biphenyls in vitro. Environ Health
Perspect. 101, 430-4.

Ghisari M, Bonefeild-Jorgensen EC. (2005). Impact of environmental
chemicals on the thyroid hormone function in pituitary rat GH3 cells. Mol Cell
Endocrinol. 244, 31-41.

Ghosh S, May MJ, Kopp EB. (1998). NF-kappa B and Rel proteins:
evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol.
16, 225-60.

Giesy JP, Kannan K. (1998). Dioxin-like and non-dioxin-like toxic effects of
polychlorinated biphenyls (PCBs): implications for risk assessment. Crit Rev
Toxicol. 28, 511-69.

Giltiay NV, Karakashian AA, Alimov AP, Ligthle S, Nikolova-Karakashian
MN. (2005). Ceramide- and ERK-dependent pathway for the activation of
CCAAT/enhancer binding protein by interleukin- lbeta in hepatocytes. J Lipid
Res. 46, 2497-505.

Grasman KA, Whitacre LL. (2001). Effects Of PCB 126 on thymocyte surface
marker expression and immune organ development in chicken embryos. J.
Toxicol. Environ. Health A. 62, 191-206.

Hang-Weber M, Schollmeyer P, Horl WH. (1989). Beta-2-microglobulin and
main granulocyte components in hemodialysis patients. Artif Organs. 13, 92-6.

Han SS, Kim K, Hahm ER, Park CH, Kimler BF, Lee SJ, Lee SH, Kim
WS, Jung CW, Park K, Kim J, Yoon SS, Lee JH, Park S. (2005). Arsenic
trioxide represses constitutive activation of NF-kappaB and COX-2 expression
in human acute myeloid leukemia, HL-60. J Cell Biochem. 94, 695-707.

122

 

Harrison JR, Kelly PL, Pilbeam CC. (2000). Involvement of CCAAT
enhancer binding protein transcription factors in the regulation of prostaglandin
G/H synthase 2 expression by interleukin-1 in osteoblastic MC3T3-El cells. J
Bone Miner Res. 15, 1138-46.

Hazen SL, Hsu FF, Mueller DM, Crowley JR, Heinecke JW. (1996). Human
neutrophils employ chlorine gas as an oxidant during phagocytosis. J. Clin.
Invest. 15, 1283-9.

Henderson LM, Monle SK, Chappell JB. (1993). The immediate activator of
the NADPH oxidase is arachidonate not phosphorylation. Eur. J. Biochem. 211,
157-62.

Henson PM, Zanolari B, Schwartzman NA, Hong SR. (1978). Intracellular
control of human neutrophil secretion. 1. CSa-induced stimulus-speciﬁc
desensitization and the effects of cytochalasin B. J Immunol. 121, 851-5.

Hernandez M, Burillo SL, Crespo MS, Nieto ML. (1998). Secretory
phospholipase A2 activates the cascade of mitogen-activated protein kinases
and cytosolic phospholipase A2 in the human astrocytoma cell line 1321N1. J
Biol Chem. 273, 606-12.

Hidalgo MA, Romero A, Figueroa J, Cortes P, Concha II, Hancke JL,
Burgos RA. (2005). Andrographolide interferes with binding of nuclear factor-
kappaB to DNA in HL-60-derived neutrophilic cells. Br J Pharmacol. 144, 680-
6.

Hii CS, Huang ZH, Bilney A, Costabile M, Murray AW, Rathjen DA, Der
CJ, Ferrante A. (1998). Stimulation of p38 phosphorylation and activity by
arachidonic acid in HeLa cells, HL6O promyelocytic leukemic cells, and human
neutrophils. Evidence for cell type-speciﬁc activation of mitogen-activated
protein kinases. J. Biol. Chem. 273, 19277-82.

Holzberg D, Knight CG, Dittrich-Breiholz O, Schneider H, Dorrie A,
Hoﬂ'mann E, Resch K, Kracht M. (2003). Disruption of the c-JUN-JNK
complex by a cell-permeable peptide containing the c-JUN delta domain
induces apoptosis and affects a distinct set of interleukin-l-induced
inﬂammatory genes. J Biol Chem. 278, 40213-23.

123

Hsieh HL, Wu CY, Hwang TL, Yen MH, Parker P, Yang CM. (2006). BK-
induced cytosolic phospholipase A2 expression via sequential PKC-delta,
p42/p44 MAPK, and NF-kappaB activation in rat brain astrocytes. J Cell
Physiol. 206, 246-54.

Hna J, Hasebe T, Someya A, Nakamnra S, Sngimoto K, Nagaoka I. (2000).
Evaluation of the expression of NADPH oxidase components during maturation
of HL-60 cells to neutrophil lineage. J Leukoc Biol. 68, 216-24.

Hunot S, Vila M, Teismann P, Davis RJ, Hirsch EC, Przedborski S, Rakic
P, Flavell RA. (2004). JNK-mediated induction of cyclooxygenase 2 is required
for neurodegeneration in a mouse model of Parkinson's disease. Proc Natl Acad
Sci U SA. 101, 665-70.

Hntzinger O, Jamieson WD, Safe S, Panlmann L, Ammon R. (1974).
Identiﬁcation of metabolic dechlorination of highly chlorinated biphenyl in
rabbit. Nature. 252, 698-9.

Hwang DM, Kundn JK, Shin JW, Lee HJ, Snrh YJ. (2006). cis-9,trans-1 l-
Conjugated linoleic acid down-regulates phorbol ester-induced NF-{kappa}B
activation and subsequent COX-2 expression in hairless mouse skin by targeting
I{kappa}B kinase and PI3K-Akt. Carcinogenesis. Aug 31; [Epub ahead of
print]

Jacobson JL, Jacobson SW. (1997). Evidence for PCBs as
neurodevelopmental toxicants in humans. Neurotoxicology. 18, 415-24.

Johansen HR, Alexander J, Rossland OJ, Planting S, Lovik M, Gaarder PI,
Gdynia W, Bjerve KS, Becher G. (1996). PCDDs, PCDFs, and PCBs in
human blood in relation to consumption of crabs from a contaminated Fjord
area in Norway. Environ, Health Perspect. 104, 756-64.

Kafaﬁ SA, Afeefy HY, Ali AH, Said HK, Kafaﬁ AG. (1993). Binding of
polychlorinated biphenyls to the aryl hydrocarbon receptor. Environ. Health
Perspect. 101, 422-8.

124

Kakeyama M, Tohyama C. (2003). Developmental neurotoxicity of dioxin
and its related compounds. Ind Health. 41, 215-30.

Kallenborn, R., Oehme, M., Williams, D., Schlabach, M., and Harris, J.
(1998). Ambient air levels and atmospheric long-range transport of persistent
organochlorines to Signy Island, Antarctica. Sci. Tot. Environ. 220, 167-180.

Kanda N, Koike S, Watanabe S. (2005). IL-17 suppresses TNF-alpha-induced
CCL27 production through induction of COX-2 in human keratinocytes. J
Allergy Clin Immunol. 116, 1144-50.

Kannan K, Villeneuve DL, Blankenship AL, Giesy JP. (1998). Interaction of
tributyltin with 3,3',4,4',5-pentachlorobiphenyl-induced ethoxyresoruﬁn O-
deethylase activity in rat hepatoma cells. J Toxicol Environ Health A. 55, 373-
84.

Kenm YS, Han SS, Chnn KS, Park KK, Park JH, Lee SK, Snrh YJ. (2003).
Inhibitory effects of the ginsenoside Rg3 on phorbol ester-induced

cyclooxygenase-2 expression, NF-kappaB activation and tumor promotion.
Mutat Res. 523-524, 75-85.

Kietz S, Fischer B. (2003). Polychlorinated biphenyls affect gene expression in
the rabbit preimplantation embryo. Mol Reprod Dev. 64, 251-60.

Kim H, Rhee SH, Kokkoton E, Na X, Savidge T, Moyer MP, Pothonlakis C,
LaMont JT. (2005). Clostridium difﬁcile toxin A regulates inducible
cyclooxygenase-2 and prostaglandin E2 synthesis in colonocytes via reactive
oxygen species and activation of p38 MAPK. J Biol Chem. 280, 21237-45.

Kim SY, Yang JH. (2005). Neurotoxic effects of 2,3,7,8-tetrachlorodibenzo-p-
dioxin in cerebellar granule cells. Exp Mol Med 37, 58-64.

Kim JS, Kim JM, Jung HC, Song IS. (2001). Expression of cyclooxygenase-2
in human neutrophils activated by Helicobacter pylori water-soluble proteins:
possible involvement of NF-kappaB and MAP kinase signaling pathway. Dig
Dis Sci. 46, 2277-84.

125

Kiritoshi S, Nishikawa T, Sonoda K, Kukidome D, Senokuchi T, Matsno T,
Matsumura T, Toknnaga H, Brownlee M, Araki E. (2003). Reactive oxygen
species from mitochondria induce cyclooxygenase-2 gene expression in human
mesangial cells: potential role in diabetic nephropathy. Diabetes. 52, 2570-7.

Kitazawa M, Shibata Y, Hashimoto S, Ohiznmi Y, Yamakuni T. (2006).
Proinsulin C-peptide stimulates a PKC/IkappaB/NF-kappaB signaling pathway
to activate COX-2 gene transcription in Swiss 3T3 ﬁbroblasts. J Biochem
(Tokyo). 139, 1083-8.

Kodavanti PR, Derr-Yellin EC. (2002). Differential effects of polybrominated
diphenyl ethers and polychlorinated biphenyls on [3H]arachidonic acid release
in rat cerebellar granule neurons. Toxicol Sci. 68, 451-7.

Kodavanti PR, Tilson HA. (2000). Neurochemical effects of environmental
chemicals: in vitro and in vivo correlations on second messenger pathways. Ann
N Y Acad Sci. 919, 97-105.

Kodavanti PR, Shin DS, Tilson HA, Harry GJ. (1993). Comparative effects
of two polychlorinated biphenyl congeners on calcium homeostasis in rat
cerebellar granule cells. Toxicol. Appl. Pharmacol. 123, 97-106.

Kostyniak PJ, Hansen LG, Widholm JJ, Fitzpatrick RD, Olson JR,
Helferich JL, Kim KH, Sable HJ, Seegal RF, Pessah IN, Schantz SL.
(2005). Formulation and characterization of an experimental PCB mixture

designed to mimic human exposure from contaminated ﬁsh. T oxicol Sci. 88,
400-11. ‘

Kranse KH, Schlegel W, Wollheim CB, Andersson T, Waldvogel FA, Lew
PD. (1985). Chemotactic peptide activation of human neutrophils and HL-60
cells. Pertussis toxin reveals correlation between inositol trisphosphate

generation, calcium ion transients, and cellular activation. J Clin Invest. 76,
1348-54.

Kristoffersen A, Voie 0A, Fonnnm F. (2002). Ortho-substituted

polybrominated biphenyls activate respiratory burst in granulocytes from
humans. Toxicol Lett. 129, 161-6.

126

Kuijpers TW, Tool AT, van der Schoot CE, Ginsel LA, 0nderwater JJ,
Roos D, Verhoeven AJ. (1991). Membrane surface antigen expression on

neutrophils: a reappraisal of the use of surface markers for neutrophil activation.
Blood 15, 1105-11.

Knlberg AY. (1999). Immunoglobulins and Antibodies. Russ J Immunol. 4,
241-242.

Kundn JK, Shin YK, Snrh YJ. (2006). Resveratrol modulates phorbol ester-
induced pro-inﬂammatory signal transduction pathways in mouse skin in vivo:
NF-kappaB and AP-l as prime targets. Biochem Pharmacol. 72, 1506-15.

Kwon 0, Lee E, Moon TC, Jung H, Lin CX, Nam KS, Baek SH, Min HK,
Chang HW. (2002). Expression of cyclooxygenase-2 and pro-inﬂammatory
cytokines induced by 2,2',4,4',5,5'-hexachlorobiphenyl (PCB 153) in human
mast cells requires NF-kappa B activation. Biol Pharm Bull. 25, 1165-8.

Kyriakis JM, Avrnch J. (1996). Sounding the alarm: protein kinase cascades
activated by stress and inﬂammation. J. Biol. Chem. 271, 24313-6.

Lacal P, Pnlido R, Sanchez-Madrid F, Mollinedo F. (1988). Intracellular
location of T200 and M01 glycoproteins in human neutrophils. J. Biol. Chem.
263, 9946-51.

Lad PM, Olson CV, Grewal IS, Scott SJ. (1985). A pertussis toxin-sensitive
GTP-binding protein in the human neutrophil regulates multiple receptors,
calcium mobilization, and lectin-induced capping. Proc. Natl. Acad. Sci. U S A
82, 8643-7.

Laden F, Neas LM, Spiegelman D, Hankinson SE, Willett WC, Ireland K,
Wolff MS, Hunter DJ. (1999). Predictors of plasma concentrations of DDE
and PCBs in a group of US. women. Environ Health Perspect. 107, 75-81.

Lamb MR, Taylor S, Lin X, Wolff MS, Borrell L, Matte TD, Snsser ES,
Factor-Litvak P. (2006). Prenatal exposure to polychlorinated biphenyls and
postnatal growth: a structural analysis. Environ Health Perspect. 114, 79-85.

127

Lasa M, Mahtani KR, Finch A, Brewer G, Saklatvala J, Clark AR. (2000).
Regulation of cyclooxygenase 2 mRN A stability by the mitogen-activated
protein kinase p38 signaling cascade. Mol Cell Biol. 20, 4265-74.

Lawrence BP, Kerkvliet NI. (1998). Role of altered arachidonic acid
metabolism in 2,3,7, 8-tetrachlorodibenzo-p—dioxin-induced immune
suppression in C57Bl/6 mice. T oxicol Sci. 42, 13-22.

Lecavalier P, Chu I, Yagminas A, Villeneuve DC, Poon R, Feeley M,
Hakansson H, Ahlborg UG, Valli VE, Bergman A, Seegal RF, Kennedy
SW. (1997). Subchronic toxicity of 2,2',3,3',4,4'-hexachlorobiphenyl in rats. J
Toxicol Environ Health. 51, 265-77.

Lee GC, Yi HA, Lee CH. (2006). Stimulation of interferon-beta gene
expression by human cytomegalovirus via nuclear factor kappa B and
phosphatidylinositol 3-kinase pathway. Virus Res. 117, 209-14.

Lee JC, Laydon JT, McDonnell PC, Gallagher TF, Knmar S, Green D,
McNulty D, Blnmenthal MJ, Heys JR, Landvatter SW, et al. (1994). A
protein kinase involved in the regulation of inﬂammatory cytokine biosynthesis.
Nature. 372, 739-46.

Lekstrom-Himes JA. (2001). The role of C/EBP(epsilon) in the terminal stages
of granulocyte differentiation. Stem Cells 19, 125-33.

Levin M, Morsey B, Mori C, Nambiar PR, De Guise S. (2005). Non-coplanar
PCB-mediated modulation of human leukocyte phagocytosis: a new mechanism for
immunotoxicity. J T oxicol Environ Health A. 68, 1977-93.

Levin M, Morsey B, Mori C, Guise S. (2004). Speciﬁc non-coplanar PCB-
mediated modulation of bottlenose dolphin and beluga whale phagocytosis upon
in vitro exposure. J Toxicol Environ Health A. 67, 1517-35.

Lin CC, Sun CC, Luo SF, T sai AC, Chien CS, Hsiao LD, Lee CW, Hsieh
JT, Yang CM. (2004). Induction of cyclooxygenase-2 expression in human
tracheal smooth muscle cells by interleukin-lbeta: involvement of p42/p44 and

p38 mitogen-activated protein kinases and nuclear factor-kappaB. J Biomed Sci.
11, 377-90.

128

Liu L, Rittenhouse AR. (2003). Arachidonic acid mediates muscarinic
inhibition and enhancement of N-type Ca2+ current in sympathetic neurons.
Proc Natl Acad Sci U S A. 100, 295-300.

Liu SF, Ye X, Malik AB. (1999). Inhibition of NF-kappaB activation by
pyrrolidine dithiocarbamate prevents In vivo expression of proinﬂarnmatory
genes. Circulation. 100, 1330-7.

Lin Y, Levy GN, Weber W. (1997). Induction of human prostaglandin
endoperoxide H synthase-2 (PHS-2) mRNA by TCDD. Prostaglandins. 53, 1-
10.

Loch-Caruso R. (2002). Uterine muscle as a potential target of polychlorinated
biphenyls during pregnancy. Int J Hyg Environ Health. 205, 121-30.

Louis NA, Hamilton KE, Colgan SP. (2005). Lipid mediator networks and
leukocyte transmigration. Prostaglandins Leukot Essent Fatty Acids. 73, 197-
202.

Magolda RL, Galbraith W. (1989). Design and synthesis of conformationally
restricted phospholipids as phospholipase A2 inhibitors. J Cell Biochem. 40,
371 -86.

Marcinkowska E, Garay E, Gocek E, Chrobak A, Wang X, Stndzinski GP.
(2006). Regulation of C/EBPbeta isoforms by MAPK pathways in HL60 cells
induced to differentiate by 1,25-dihydroxyvitamin D3. Exp Cell Res. 312, 2054-
65.

Martin SJ, Bradley JG, Cotter TG. (1990). HL-60 cells induced to
differentiate towards neutrophils subsequently die via apoptosis. Clin. Exp.
Immunol. 79, 448-53.

Matthews HB, Dedrick RL. (1984). Pharrnacokinetics of PCBs. Annu Rev
Pharmacol Toxicol. 24, 85-103.

129

McDonald PP. (2004). Transcriptional regulation in neutrophils: teaching old
cells new tricks. Adv Immunol. 82, l-48.

Minh TB, Watanabe M, Kajiwara N, Iwata H, Takahashi S, Subramanian
A, Tanabe S, Watanabe S, Yamada T, Hata J. (2006). Human blood
monitoring program in Japan: contamination and bioaccumulation of persistent

organochlorines in Japanese residents. Arch Environ Contam Toxicol. 51, 296-
313.

Miznmura K, Hashimoto S, Marnoka S, Gon Y, Kitamura N, Matsumoto
K, Hayashi S, Shimizu K, Horie T. (2003). Role of mitogen-activated protein
kinases in inﬂuenza virus induction of prostaglandin E2 from arachidonic acid
in bronchial epithelial cells. Clin Exp Allergy. 33, 1244-51.

Mizuyachi K, Son DS, Rozman KK, Terranova PF. (2002). Alteration in
ovarian gene expression in response to 2,3,7,8-tetrachlorodibenzo-p-dioxin:
reduction of cyclooxygenase-2 in the blockage of ovulation. Reprod Toxicol. 16,
299-307.

Moon Y, Pestka JJ. (2002). Vomitoxin-induced cyclooxygenase-2 gene
expression in macrophages mediated by activation of ERK and p38 but not JN K
mitogen-activated protein kinases. Toxicol Sci. 69, 373-82.

Monick MM, Robeff PK, Butler NS, Flaherty DM, Carter AB, Peterson
MW, Hunninghake GW. (2002). Phosphatidylinositol 3-kinase activity
negatively regulates stability of cyclooxygenase 2 mRNA. J. Biol. Chem. 277,
32992-3000.

Morse DC, Wehler EK, Wesseling W, Koeman JH, Bronwer A. (1996).
Alterations in rat brain thyroid hormone status following pre- and postnatal

exposure to polychlorinated biphenyls (Aroclor 1254). Toxicol Appl Pharmacol.
136, 269-79.

Mullick A, Elias M, Harakidas P, Marcil A, Whiteway M, Ge B, Hudson
TJ, Caron AW, Bonrget L, Picard S, Jovcevski O, Massie B, Thomas DY.
(2004). Gene expression in HL60 granulocytoids and human
polymorphonuclear leukocytes exposed to Candida albicans. Infect Immun. 72,
414-29.

130

Nakanishi Y, Shigematsn N, Knrita Y, Matsuba K, Kanegae H, Ishimarn S,
Kawazoe Y. (1985). Respiratory involvement and immune status in yusho
patients. Environ Health Perspect. 59, 31-6.

Nakayama J, Toshitani S, Asahi M, Furne M. (1999). Evaluation of
dermatological symptoms of Yusho patients in the annual examination in 1997-
1998. Fukuoka Igaku Zasshi 90, 143-6.

Newburger PE, Chovaniec ME, Greenberger J S, Cohen HJ. (1979).
Functional changes in human leukemic cell line HL-60. A model for myeloid
differentiation. J. Cell Biol. 82, 315-22.

N'guessan PD, Etonem MO, Schmeck B, Hocke AC, Scharf' S, Vardarova
K, Opitz B, Flieger A, Suttorp N, Hippenstiel S. (2006). LEGIONELLA
PNEUMOPHILA-INDUCED PKC{alpha}-, MAPK- AND NF-{kappa}B -
DEPENDENT COX-2 EXPRESSION IN HUMAN LUNG EPITHELIUM. Am
J Physiol Lung Cell Mol Physiol. [Epub ahead of print]

Nieminen R, Leinonen S, Lahti A, Vuolteenaho K, Jalonen U,
Kankaanranta H, Goldring MB, Moilanen E. (2005). Inhibitors of mitogen-
activated protein kinases downregulate COX-2 expression inhuman
chondrocytes. Mediators Inflamm. 2005, 249-55.

Noakes PS, Taylor P, Wilkinson S, Prescott SL. (2006). The relationship
between persistent organic pollutants in maternal and neonatal tissues and

immune responses to allergens: A novel exploratory study. Chemosphere. 63,
1304-11.

Oakley GG, Roe AL, Blonin RA, Twaroski TP, Ganguly TC, Vore M,
Lehmler HJ, Robertson LW. (2001). 2,4,4'-trichlorobiphenyl increases
STATS transcriptional activity. Mol Carcinog. Apr. 199-208.

Olnes MJ, Verma M, Knrl RN. (1996). 2,3,7,8-tetrachlorodibenzo-p-dioxin
modulates expression of the prostaglandin G/H synthase-2 gene in rat
thymocytes. J Pharmacol Exp Ther. 279, 1566-73.

131

Olivero J, Bezdecny SA, Ganey PE. (2001). A molecular motif required for
the activation of rat neutrophil phospholipase Am by organochlorine
compounds. Chem Res Toxicol. 15, 153-9.

Olivero J, Ganey PE. (2001). Participation of Ca2+/calmodulin during
activation of rat neutrophils by polychlorinated biphenyls. Biochem Pharmacol.
62, 1125-32.

Olivero J, Ganey PE. (2000). Role of protein phosphorylation in activation of
phospholipase A2 by the polychlorinated biphenyl mixture Aroclor 1242.
T oxicol Appl Pharmacol. 163, 9-16.

Olivero-Verbel J, Ganey PE. (1998). Effect of three polychlorinated biphenyls

on f-met-leu-phe-induced degranulation in rat neutrophils. Toxicol Lett. 98, 195-
202.

Osawa Y, [be S, Takanji R, Takatsnka H, Yamamoto S, T akahashi T,
Horiguchi S, Urasaki Y, Matsuki T, Fujieda S. (2006). Collaborative action
of NF-kappaB and p38 MAPK is involved in CpG DNA-induced IFN-alpha and
chemokine production in human plasmacytoid dendritic cells. J Immunol. 177,
4841-52.

Palicz A, Foubert TR, Jesaitis AJ, Marodi L, McPhail LC. (2001).
Phosphatidic acid and diacylglycerol directly activate NADPH oxidase by
interacting with enzyme components. J Biol Chem. 276, 3090-7.

Park BH, Qiang L, Farmer SR. (2004). Phosphorylation of C/EBPbeta at a
consensus extracellular signal-regulated kinase/ glycogen synthase kinase 3 site
is required for the induction of adiponectin gene expression during the
differentiation of mouse ﬁbroblasts into adipocytes. Mol Cell Biol. 24, 8671-80.

Pathak SK, Bhattacharyya A, Pathak S, Basak C, Mandal D, Kundn M,
Basu J. (2004). Toll-like receptor 2 and mitogen- and stress-activated kinase 1

are effectors of Mycobacterium avium-induced cyclooxygenase-2 expression in
macrophages. J Biol Chem. 279, 55127-36.

132

Patterson DG Jr, Todd GD, Turner WE, Maggie V, Alexander LR,
Needham LL. (1994). Levels of non-ortho-substituted (coplanar), mono- and
di-ortho-substituted polychlorinated biphenyls, dibenzo-p-dioxins, and
dibenzofurans in human serum and adipose tissue. Environ. Health. Perspect.
102 Suppl 1, 195-204.

Pawliczak R, Huang XL, Nanavaty UB, Lawrence M, Madara P,
Shelhamer JH. (2002). Oxidative stress induces arachidonate release from
human lung cells through the epithelial growth factor receptor pathway. Am J
Respir Cell Mol Biol. 27, 722-31.

Pawliczak R, Logun C, Madara P, Lawrence M, Woszczek G, Ptasinska A,
Kowalski ML, Wu T, Shelhamer JH. (2004). Cytosolic phospholipase A2
Group IValpha but not secreted phospholipase A2 Group IIA, V, or X induces
interleukin-8 and cyclooxygenase-2 gene and protein expression through

peroxisome proliferator-activated receptors gamma 1 and 2 in human lung cells.
J Biol Chem. 279, 48550-61.

Palomba L, Persichini T, Mazzone V, Colasanti M, Cantoni O. (2004).
Inhibition of nitric-oxide synthase-I (NOS-l)-dependent nitric oxide production
by lipopolysaccharide plus interferon-gamma is mediated by arachidonic acid.
Effects on NFkappaB activation and late inducible NOS expression. J Biol
Chem. 279, 29895-901 .

Peppiatt CM, Holmes AM, See JT, Bootman MD, Collins TJ, McDonald F,
Roderick HL. (2004). Calmidazolium and arachidonate activate a calcium
entry pathway that is distinct from store-operated calcium inﬂux in HeLa cells.
Biochem J. 381(Pt 3), 929-39. ‘

Pessah IN, Hansen LG, Albertson TE, Garner CE, Ta TA, Do Z, Kim KH,
Wong PW. (2006). Structure-activity relationship for noncoplanar
polychlorinated biphenyl congeners toward the ryanodine receptor-Ca2+
channel complex type 1 (Rle). Chem Res Toxicol. 19, 92-101.

Poli V. (1998). The role of C/EBP isoforms in the control of inﬂammatory and
native immunity functions. J. Biol. Chem. 273, 29279-82.

Platanias LC. (2003). Map kinase signaling pathways and hematologic
malignancies. Blood Pharmacol Ther. 98, 129-42.

133

Repo H. (1987). Polymorphonuclear leukocyte defects in infections. Proc Finn
Dent Soc. 83, 105-9.

Regala RP, Rice CD, Schwedler TE, Dorociak IR. (2001). The effects of
tributyltin (TBT) and 3,3',4,4',5-pentachlorobiphenyl (PCB-126) mixtures on
antibody responses and phagocyte oxidative burst activity in channel catﬁsh,
Ictalurus punctatus. Arch. Environ. Contam. Toxicol. 40, 386-91.

Regalo G, Canedo P, Suriano G, Resende C, Campos M, Oliveira M,
Figueiredo C, Rodrignes-Pereira P, Blin N, Seruca R, Carneiro F, Machado
J. (2006). C/EBPbeta is over-expressed in gastric carcinogenesis and is
associated with COX-2 expression. 1. J Pathol. Sep 18; [Epub ahead of print]

Rice DC. (1996). PCBs and behavioral impairment: are there lessons we can
learn from lead? Neurotoxicol Teratol. 18, 229-32

Rosch S, Ramer R, Brune K, Hinz B. (2005). (+)-methanandamide and other
cannabinoids induce the expression of cyclooxygenase-2 and matrix

metalloproteinases in human nonpigrnented ciliary epithelial cells. J Pharmacol
Exp Ther. 316, 1219-28.

Rubin CH, Lanier A, Kieszak S, Brock JW, Koller KR, Strosnider H,
Needham L, Zahm S, Harpster A. (2006). Breast cancer among Alaska Native

women potentially exposed to environmental organochlorine chemicals. Int J
Circumpolar Health. 65, 18-27.

Sadler KL, Badwey JA. (1988). Second messengers involved in superoxide
production by neutrophils. Function and metabolism. Hematol Oncol Clin North
Am. 2, 185-200.

Safe SH. (1994). Polychlorinated biphenyls (PCBs): environmental impact,
biochemical and toxic responses, and implications for risk assessment. Crit Rev
Toxicol. 24, 87-149. -

Safe S. (2004). Endocrine disruptors and human health: is there a problem.
Toxicology. 205, 3-10.

134

Safe S, Bandiera S, Sawyer T, Robertson L, Safe L, Parkinson A, Thomas
PE, Ryan DE, Reik LM, Levin W, et al (1985). PCBs: structure-function
relationships and mechanism of action. Environ Health Perspect 60, 47-56.

Sanderson JT, Aarts JM, Bronwer A, Froese KL, Denison MS, Giesy JP.
(1996). Comparison of Ah receptor-mediated luciferase and ethoxyresoruﬁn-O-
deethylase induction in H4IIE cells: implications for their use as bioanalytical
tools for the detection of polyhalogenated aromatic hydrocarbons. Toxicol.
Appl. Pharmacol. 137, 316-25.

Sanduja SK, Trial J, Hall ER. (1988). Prostaglandin production by human
promyelocytic leukemia (HL-60) cells. Biomed Biochim Acta. 47, 383-93.

Schoenroth L, Chan S, Fritzler M. (2004). Autoantibodies and levels of
polychlorinated biphenyls in persons living near a hazardous waste treatment
facility. J Investig Med. 52, 70-6.

Seegal RF. (1996). Epidemiological and laboratory evidence of PCB-induced
neurotoxicity. Crit. Rev. Toxicol. 26, 709-37.

Seegal RF, Bush B, Shain W. (1990). Lightly chlorinated ortho-substituted
PCB congeners decrease dopamine in nonhuman primate brain and in tissue
culture. T oxicol. Appl. Pharmacol. 106, 136-44.

Sermni CH, Aronoff DM, Jancar S, Mancnso P, Peters-Golden M. (2005).
Leukotrienes enhance the bactericidal activity of alveolar macrophages against
Klebsiella pneumoniae through the activation of NADPH oxidase. Blood. 106,
1067-75.

Seymour KJ, Roberts LE, Fini MA, Parmley LA, Onstitch TL, Wright RM.
(2006). Stress activation of mammary epithelial cell xanthine oxidoreductase is
mediated by p38 MAPK and CCAAT/enhancer-binding protein-beta. J Biol
Chem. 281, 8545-58.

135

Shafer LM, Slice LW. (2005). Biochim Biophys Acta. Anisomycin induces
COX-2 mRNA expression through p38(MAPK) and CREB independent of
small GTPases in intestinal epithelial cells. 1745, 393-400.

Shin HJ, Gye MH, Chung KH, Yoo BS. (2002). Activity of protein kinase C
modulates the apoptosis induced by polychlorinated biphenyls in human
leukemic HL-60 cells. Toxicol Lett. 135, 25-31.

Shin, W., and Mackay, D. (1986). A critical review of aqueous solubilities,
vapor pressure, Henry’s law constants, and octanol-water partition coefficients
of the polychlorinated biphenyls. J. Phys. Chem. Ref Data. 15, 911-929 .

Singer CA, Baker KJ, McCaffrey A, AnCoin DP, Dechert MA, Gerthoffer
WT. (2003). p38 MAPK and NF-kappaB mediate COX-2 expression in human
airway myocytes. Am J Physio] Lung Cell Mol Physiol. 285, L1087-98.

Slice LW, Chin T, Rozengurt E. (2004). Angiotensin II and epidermal growth
factor induce cyclooxygenase-2 expression in intestinal epithelial cells through
small GTPases using distinct signaling pathways.

Smith WL, DeWitt DL, Garavito RM. (2000). Cyclooxygenases: structural,
cellular, and molecular biology. Annu Rev Biochem. 69, 145-82.

Smith WL, Garavito RM, DeWitt DL. (1996). Prostaglandin endoperoxide H
synthases (cyclooxygenases)-1 and -2. J. Biol. Chem. 271, 33157-60.

Sobek A, 0111 K, Gnstafsson O. (2006). On the relative signiﬁcance of bacteria
for the distribution of polychlorinated biphenyls in Arctic Ocean surface waters.
Environ Sci Technol. 40, 2586-93.

Steer SA, Moran JM, Christmann BS, Maggi LB Jr, Corbett JA. (2006).
Role of MAPK in the regulation of double-stranded RNA- and
encephalomyocarditis virus-induced cyclooxygenase-2 expression by
macrophages. J Immunol. 177, 3413-20.

Sn B, Karin M. (1996). Mitogen-activated protein kinase cascades and
regulation of gene expression. Curr. Opin. Immunol. 8, 402-11.

136

Subramanian B., Tanade, S., Hidaka, H., and Tatsnkawa, R. (1983). DDT
and PCB isomers and congeners in Antarctic ﬁsh. Arch. Environ. Contam.
Toxicol. 12, 621-626.

Sweeney SE, Firestein GS. (2004). Signal transduction in rheumatoid arthritis.
Curr Opin Rheumatol. 216, 231-7.

Takada Y, Aggarwal BB. (2004). TNF activates Syk protein tyrosine kinase
leading to TNF-induced MAPK activation, NF-kappaB activation, and
apoptosis. J Immunol. 173, 1066-77.

Takahashi S, Fujita T, Yamamoto A. (2001). Role of nuclear factor-kappaB
in gastric ulcer healing in rats. Am J Physiol Gastrointest Liver Physiol. 280,
61296-304.

Takamatsn M, Oki M, Maeda K, Inone Y, Hirayama H, Yoshiznka K.
(1985). Surveys of workers occupationally exposed to PCBs and of yusho
patients. Environ Health Perspect. 59, 91-7.

Takano T, Cybnlsky AV, Yang X, Aondjit L. (2001). Complement C5b-9
induces cyclooxygenase-2 gene transcription in glomerular epithelial cells. Am J
Physio] Renal Physiol. 281, F841-50.

Tamnra M, Sebastian S, Yang S, Gnrates B, Fang Z, Okamura K, Bnlun
SE. (2003). Induction of cyclooxygenase-2 in human endometrial stromal cells
by malignant endometrial epithelial cells: evidence for the involvement of

extracellularly regulated kinases and CCAAT/enhancer binding proteins. J Mol
Endocrinol. 31, 95-104.

Tanabe, S., Kannan, N., Subramanian, A., Watanabe, S., and
Tatsnkawa,R. (1987). Highly toxic coplanar PCBs: occurrence, source,
persistency and toxic implications to wildlife and humans. Environ. Pollut. 47,
147-163.

Tilson HA, Kodavanti PR. (1997). Neurochemical effects of polychlorinated
biphenyls: an overview and identiﬁcation of research needs. Neurotoxicology.
18, 727-43.

137

Tithof PK, Contreras ML, Ganey PE. (1995). Aroclor 1242 stimulates the
production of inositol phosphates in polymorphonuclear neutrophils. Toxicol.
Appl. Pharmacol. 131, 136-43.

Tithof PK, Schiamberg E, Peters-Golden M, Ganey PE. (1996).
Phospholipase A2 is involved in the mechanism of activation of neutrophils by
polychlorinated biphenyls. Environ Health Perspect. 104, 52-8.

Tithof PK, Watts S, Ganey PE. (1997). Protein tyrosine kinase involvement in
the production of superoxide anion by neutrophils exposed to Aroclor 1242, a
mixture of polychlorinated biphenyls. Biochem. Pharmacol. 53, 1833-42.

Tithof PK, Peters-Golden M, Ganey PE. (1998). Distinct phospholipases A2
regulate the release of arachidonic acid for eicosanoid production and
superoxide anion generation in neutrophils. J Immunol. 160, 953-60.

Tithof PK, Olivero J, Ruehle K, Ganey PE. (2000). Activation of neutrophil
calcium-dependent and -independent phospholipases A2 by organochlorine
compounds. Toxicol. Sci. 53, 40-7.

Tonnesen MG. (1989). Neutrophil-endothelial cell interactions: mechanisms of
neutrophil adherence to vascular endothelium. J Invest Dermatol. 93, 538-588.

Tsiftsoglou AS, Wong W, Hyman R, Minden M, Robinson SH. (1985).
Analysis of commitment of human leukemia HL-60 cells to terminal
granulocytic maturation.

anyk M, Anderson HA, Hanrahan LP, Falk C, Steenport DN, Needham
LL, Patterson DG Jr, Freels S, Persky V; Great Lakes Consortium. (2006).
Relationship of serum levels of individual PCB, dioxin, and furan congeners
and DDE with Great Lakes sport-caught ﬁsh consmnption. Environ Res. 100,
173-83.

Twaroski TP, O'Brien ML, Robertson LW. (2001). Effects of selected
polychlorinated biphenyl (PCB) congeners on hepatic glutathione, glutathione-

related enzymes, and selenium status: implications for oxidative stress.
Biochem. Pharmacol. 62, 273-81.

138

Uto T, Fujii M, Hon DX. (2005). Inhibition of lipopolysaccharide-induced
cyclooxygenase-2 transcription by 6-(methylsulﬁny1) hexyl isothiocyanate, a
chemopreventive compound from Wasabia japonica (Miq.) Matsumura, in
mouse macrophages. Biochem Pharmacol. 70, 1772-84.

Van Birgelen AP, Smit EA, Kampen IM, Groeneveld CN, Fase KM, Van
der Kolk J, Poiger H, Van den Berg M, Koeman JH, Bronwer A. (1995).
Subchronic effects of 2,3,7,8-TCDD or PCBs on thyroid hormone metabolism:
use in risk assessment Eur. J. Pharmacol. 293, 77-85.

Van den Berg M, Birnbanm LS, Denison M, De Vito M, Farland W, Feeley
M, Fiedler H, Hakansson H, Hanberg A, Haws L, Rose M, Safe S, Schrenk
D, Tohyama C, Tritscher A, Tuomisto J, Tysklind M, Walker N, Peterson
RE. (2006). The 2005 World Health Organization reevaluation of human and
Mammalian toxic equivalency factors for dioxins and dioxin-like compounds.
Toxicol Sci. 93, 223-41.

Vane JR, Bakhle YS, Betting RM. (1998). Cyclooxygenases l and 2. Annu.
Rev. Pharmacol. Toxicol. 38, 97-120.

Vergne P, Liagre B, Bertin P, Cook-Moreau J, Treves R, Beneytout JL,
Rigand M. (1998). Methotrexate and cyclooxygenase metabolism in cultured
hmnan rheumatoid synoviocytes. J Rheumatol. 25, 433-40.

Viluksela M, Bager Y, Tuomisto JT, Scheu G, Unkila M, Pohjanvirta R,
Flodstrom S, Kosma VM, Maki-Paakkanen J, Vartiainen T, Klimm C,
Schramm KW, Warngard L, Tuomisto J. (2000). Liver tumor-promoting
activity of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in TCDD-sensitive and
TCDD-resistant rat strains. Cancer Res. 60, 6911-20.

Voie OA, Tysklind M, Andersson PL, Fonnnm F. (2000). Activation of

respiratory burst in human granulocytes by polychlorinated biphenyls: A
structure-activity study. Toxicol. Appl. Pharmacol. 167, 118-24.

Voie OA, Wiik P, Fonnnm F. (1998). Ortho-substituted polychlorinated
biphenyls activate respiratory burst measured as luminol-arnpliﬁed

chemoluminescence in human granulocytes. Toxicol Appl Pharmacol. 150, 369-
75.

139

Vogel C, Boerboom AM, Baechle C, El-Bahay C, Kahl R, Degen GH, Abel
J. (2000). Regulation of prostaglandin endoperoxide H synthase-2 induction by
dioxin in rat hepatocytes: possible c-Src-mediated pathway. Carcinogenesis. 21,
2267-74.

Vondracek J, Machala M, Bryja V, Chramostova K, Krcmar P, Dietrich C,
Hampl A, Kozubik A. (2005). Aryl hydrocarbon receptor-activating
polychlorinated biphenyls and their hydroxylated metabolites induce cell
proliferation in contact-inhibited rat liver epithelial cells. Toxicol Sci. 83, 53-63.

Vos JG, Van Loveren H. (1998). Experimental studies on irnmunosuppression:
how do they predict for man? Toxicology 129, 13-26.

Wadleigh DJ, Reddy ST, Kopp E, Ghosh S, Herschman HR. (2000).
Transcriptional activation of the cyclooxygenase-2 gene in endotoxin-treated
RAW 264.7 macrophages. J Biol Chem. 275, 6259-66.

Wang BC, Guo CQ, Sun C, Sun QL, Lin GY, Li DG. (2005). Mechanism
and clinical signiﬁcance of cyclooxygenase-2 expression in gastric cancer.
World J Gastroenterol. l 1, 3240-4.

Watanabc H, Suzuki A, Goto M, Ohsako S, Tohyama C, Handa H, Iguchi
T. (2004). Comparative uterine gene expression analysis after dioxin and
estradiol administration. J Mol Endocrinol. 33, 763-71.

Warshaw R, Fischbein A, Thornton J, Miller A, Selikoff IJ. (1979).
Decrease in vital capacity in PCB-exposed workers in a capacitor
manufacturing facility. Ann N. Y. Acad. Sci. 320, 277-83.

Wilson ME. (1985). Effects of bacterial endotoxins on neutrophil function. Rev
Infect Dis. 7, 404-18.

Wolﬂe D. (2003). Enhancement of carcinogen-induced malignant cell
transformation by prostaglandin F(2 alpha). Toxicology. 188, 139-47.

Wong PW, Pessah IN. (1997). Noncoplanar PCB 95 alters microsomal calcium
transport by an immunophilin F KBPlZ-dependent mechanism. Mol. Pharmacol.
51, 693-702.

140

Wu G, Lno J, Rana JS, Laham R, Sellke FW, Li J. (2006). Involvement of
COX-2 in VEGF-induced angiogenesis via P38 and JNK pathways in vascular
endothelial cells. Cardiovasc Res. 69, 512-9.

Wnlczyn FG, Krappmann D, Scheidereit C. (1996). The NF-kappa B/Rel and
I kappa B gene families: mediators of immune response and inﬂammation. J.
Mo]. Med. 74, 749-69.

You SH, Gauger KJ, Bansal R, Zoeller RT. (2006). 4-Hydroxy-PCBIO6 acts
as a direct thyroid hormone receptor agonist in rat GH3 cells. Mo] Cell
Endocrinol. 257-258, 26-34.

141