_,.§¥..,.....w.ida. ‘ .n V. . a ,
, . . gag p . . _ my

-.
gulf V . . 2‘
. . . .

Jr.
‘3‘.“
we .1
, i‘
i 3 i‘l: ‘ ,
‘ 3%.}...qu
V . A. . ‘ .
5c 3, v a :s .4
‘ w... , . , 514.11%
. . e

 

5.? ,

fixia
_ 2

9‘... .d.......::....
.oh-rn.‘
. .223
i.

 

1353(-

ll» LIBRARY
300+ Michigan §tate
Universtty

This is to certify that the
dissertation entitled

VITAMIN E FUNCTIONS IN PHOTOSYNTHETIC ORGANISMS

presented by

Hiroshi Maeda

has been accepted towards fulfillment
of the requirements for the

 

 

 

 

 

PhD. degree in Cell and Molecular Biology
VZ/Zf/Jg "I A‘—
VW‘ ajor Professor’s Signature
///L #Oé
/ I
Date

MSU is an Affirmative Action/Equal Opportunity Institution

_ _. .u-I-u-Q-o-n-I-.-u-n-o-n-o-o-u-I-I-I-a-- -

 

PLACE IN RETURN BOX to remove this checkout from your record.
To AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2/05 p:/C|RC/DateDue.indd-p.1

VITAMIN E FUNCTIONS IN PHOTOSYNTHETIC ORGANISMS

By

Hiroshi Maeda

A DISSERTATION

Submitted to
Michigan State University
In partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY
Cell and Molecular Biology Program

2006

ABSTRACT
VITAMIN E FUNCTIONS IN PHOTOSYNTHETIC ORGANISMS
By

Hiroshi Maeda

Tocopherols (vitamin E) are the major class of lipid-soluble antioxidants in biological
membranes and produced only by photosynthetic organisms, yet tocopherol functions
remain elusive in these organisms. In this study, tocopherol-deficient mutants of
Arabidopsis thaliana and Synechocystis sp. PCC 6803, a model higher plant and
cyanobacterium, respectively, have been used to investigate the physiological roles and
functional mechanisms of tocopherols in these organisms.

To test a long held assumption that tocopherols are essential for protecting
photosynthetic organisms against photooxidative stress, Arabidopsis and Synechocystis
tocopherol-deficient mutants were subjected to high intensity light (HL) stress.
Surprisingly, the phenotypic and photosynthetic responses of wild-type and
tocopherol-deficient mutants were indistinguishable during HL stress in both Arabidopsis
and Synechocystis. The tocopherol-deficient Synechocystis mutants became more
sensitive than wild-type only when HL stress was combined with treatments of
polyunsaturated fatty acids (PUFAs) which induce lipid peroxidation, or norflurazon, a
carotenoid biosynthesis inhibitor. These results suggest that tocopherols are indispensable
only under extreme lipid peroxidation-induced conditions but not under HL stress alone
likely due to an overlapping fimctionality of tocopherols and carotenoids.

In contrast, the Arabidopsis tocopherol-deficient mutants exhibited dramatic

phenotypes in response to non-freezing low temperature (75°C); in comparison to
wild-type the mutants grew more slowly, accumulated more anthocyanins in mature
leaves, and produced less seed. Significantly, these changes were independent of light
and occurred in the absence of photoinhibition or detectable lipid peroxidation,
suggesting the mechanisms involved are independent of any photo‘protective function Of
tocopherols. Further analyses revealed that the mutants exhibit rapid reduction in
photoassimilate transport from source leaves coincident with callose deposition
exclusively in phloem parenchyma transfer cells, potential bottlenecks of photoassimilate
transport. Interestingly, the mutant exhibited distinct composition of PUFAs derived from
the endoplasmic-reticulum (ER) pathway, which was temporarily and spatially associated
with the vasculature specific callose deposition. Finally, these chilling-induced
phenotypes were suppressed by the introduction of fadZ (an ER (0-6 fatty acid desaturase
mutation) in the background of the tocopherol-deficient mutant. These results uncovered
new roles for tocopherols in phloem loading and chilling adaptation in Arabidopsis and
demonstrated that it is mediated through the modulation of extra-plastidic

pathway-derived PUFAs.

ACKNOWLEDGEMENT

This thesis is the result of five and half years of my work in close collaboration with a
number of people in DellaPenna’s and other laboratories. During this study I have been
accompanied and supported by many people and now I would like to try my best to
express my gratitude for their excellent guidance, invaluable support, and warm
friendship.

First of all and foremost, I would like to deeply thank my mentor, Dr. Dean
DellaPenna for his continuous support, encouragement, and inspiration. I remember when
I first talked to him, I did not understand more than half of what he said but I was very
impressed by his tremendous knowledge and confidence. I don’t know how much closer I
could get to his level but now I am able to at least educate myself. This self-teaching skill
that he installed in me gives me confidence to try anything new in the future. Perhaps I
will be able to handle the most difficult but exciting part of my life, a marriage life.

I am grateful for four undergraduate students, Bill Pasutti, Brooke Dennison,
Matt VanderHoek, and Chris Kloss, who worked with me at different times of my study.
I learned a lot from working with them and sometime from supervising them. Of course,
their technical supports helped many aspects of my study and often motivated me to start
more experiments.

I enjoyed working and sharing many stimulating ideas with Dr. Scott Sattler, a
senior colleague sitting behind me during the first four years in DellaPenna’s lab. I was
also lucky to have Wan Song as a rotation student who helped me to complete a large set
of sugar analyses described in Chapter 3. It has been pleasure to work closely with them

on this exciting tocopherol project in DellaPenna’s lab. I would also like to thank all

current and past members of DellaPenna’s lab for a wonderful time I had in the lab. It
always felt very comfortable and enjoyable being with them.

I am greatly indebted to all of my collaborators, Dr. Donald A. Bryant and Dr.
Yumiko Sakuragi at Pennsylvania State University, Dr. Tammy L. Sage at University Of
Toronto, and Dr. Ruth Welti and Mary Roth at the Lipidomics Research Center in Kansas
State University. Don and Yumiko trained me how to work with Synechocystis PCC6803
during my ten-day visit to Pennsylvania State University. Tammy has been a wonderful
collaborator who carried out all TEM study presented in Chapter 3. Ruth and Mary have
generated enormous amounts of lipid profiling data, which gave us a clue as to how and
where tocopherols potentially function. Besides these productive collaborations, I always
enjoyed very stimulating scientific discussions we had over the phone and email and
during conferences.

I would like to thank five guidance committees, Dr. Christoph Benning, Dr. John
Ohlrogge, Dr. Michael Thomashow, Dr. John LaPres and Dr. Lee MacIntosh for their
critical comments and suggestions, that provided a broad spectrum of ideas and kept my
project on the right track.

I am also thankful to three of my previous supervisors from Osaka University,
Dr. Akio Kobayashi, Dr. Eiichiro Fukusaki, and Dr. Atsushi Okazawa, who taught me
many basic knowledge and skills of science and also gave me a chance to work
independently during my master course. Without them I could not even start this Ph.D
study.

The first two years of my tuition and stipend were provided from the Michigan

State University—Department of Energy Plant Research Laboratory. The remainder of my

tuition and stipend has been supported by a grant (MCB-023529) to Dr. Dean DellePenna
from the US National Science Foundation. I hope I can pay back by contributing to the
society with useful scientific discoveries in the future.

Although I spent a lot of time working in the laboratory, I also appreciated many
things outside the lab and I have been very lucky to meet many good friends here in
Michigan. Many of them have already left Michigan but I would like to give my warm
thanks to all of them. In particular, I thank Harrie van Erp, whom I spent probably the
longest time during the past five years and sheared many fun and important moments Of
our graduate life with always a beer in our hand.

I would also like to thank my father, Takeru Maeda and my mother, Kazuko
Maeda, for their continuous support during the past twenty-nine years. Many things I
have learned from them provided the foundation for this study. They taught me to think,
plan, study, and then have fun. I hope I can teach the same to my children.

Lastly, and most importantly, I would like to give my special thanks to my wife,
Junko Maeda, who has been supporting me so much from Japan during the last five and
half years and under the same roof during the past three weeks. I could not have

accomplished this Ph.D. study without her continuous encouragement and love.

Hiroshi Maeda

November 30‘“, 2006

vi

TABLE OF CONTENTS

ABSTRACT ...... . ................................................................................................. I I
ACKNOWLEDGEMENT .................................................................................. IV
TABLE OF CONTENTS .................................................................................. VII
LIST OF TABLES ............................................................................................... X
LIST OF FIGURES ........................................................................................... XI
KEY TO ABBREVIATIONS ............................................................................ XV
CHAPTER 1: LITERATURE REVIEW ............................................................... 1
PROTECTIVE AND ACCLIMATION MECHANISMS OF PLANTS TO ENVIRONMENTAL
STRESS .............................................................................................................. 2
Protective Mechanisms against High light (HL) Stress ............................. 2
Cold Tolerance, Adaptation and Acclima tion Mechanisms ........................ 5
REACTIVE OXYGEN SPECIES AND ANTIOXIDANTS ............................................... 8
Reactive Oxygen Species .............................................................................. 8
Wa ter-Soluble Antiom'dan ts ....................................................................... 10
Lipid 'Soluble An tioxidan ts ........................................................................ 1 1
TOCOPHEROLS (VITAMIN E) ............................................................................. 12
Chemical Structure and Characteristics of Tocopherols .......................... 12
Tocopherols in Animals .............................................................................. 13
Tocopherols in Photosynthetic Organisms ................................................ 16'
AIM OF THIS STUDY ......................................................................................... 23
REFERENCES ............................................................................................... 25
FIGURES ....................................................................................................... 42
CHAPTER 2: TOCOPHEROLS PROTECT SYNECHOCYSTIS SP. STRAIN PCC
6803 FROM LIPID PEROXIDATION ................................................................ 45
ABSTRACT .................................................................................................... 46
INTRODUCTION .......................................................................................... 46
RESULTS ....................................................................................................... 49
DISCUSSION ................................................................................................. 60
MATERIALS AND METHODS ..................................................................... 67
REFERENCES ............................................................................................... 71
FIGURES ....................................................................................................... 76

CHAPTER 3: TOCOPHEROLS PLAY A CRUCIAL ROLE IN LOW
TEMPERATURE ADAPTATION AND PHLOEM LOADING IN ARABIDOPSIS.
......................................................................................................................... 86

ABSTRACT .................................................................................................... 87

vii

INTRODUCTION .......................................................................................... 87

RESULTS ....................................................................................................... 92
DISCUSSION ............................................................................................... 107
METHODS ................................................................................................... 1 18
REFERENCES ............................................................................................. 124
FIGURES AND TABLES ............................................................................ 131

CHAPTER 4: TOCOPHEROLS MODULATE POLYUNSATURATED FATTY
ACIDS DERIVED FROM THE EXTRA PLASTIDIC-PATHWAY DURING

CHILLING ADAPTATION 0F ARABIDOPSIS. ............................................. 158
ABSTRACT .................................................................................................. 159
INTRODUCTION ........................................................................................ 160
RESULTS ..................................................................................................... 163
DISCUSSION ............................................................................................... 171
MATERIAL AND METHOD ....................................................................... 175
ACKNOWLEDGEMENTS .......................................................................... 178
REFERENCES ............................................................................................. 179
FIGURES AND TABLES ............................................................................ 185

CHAPTER 5: SUMMARY AND FUTURE PROSPECTS ................................. 194
TOCOPHEROLS HAVE A LIMITED ROLE IN PHOTOPROTECTION. ...................... 195
NOVEL ROLES FOR TOCOPHEROLS IN CHILLING ADAPTATION. ....................... 197
REFERENCES ............................... ’ .............................................................. 203

APPENDICES ................................................................................................. 206
A- 1: PRELIMINARY ANALYSES OF THE HIGH LIGHT RESPONSES OF ARABIDOPSIS
VTEMUTANTS. ............................................................................................... 207

REFERENCES ......................................................................................... 211
FIGURES .................................................................................................. 212
A2 MAP BASED CLONING OF TOCOPHEROL METHYLTRANSFERASE GENE
(VTEt?) IN ARABIDOPSIS. ............................................................................... 218
ABSTRACT. .............................................................................................. 21.9
INTRODUCTION. .................................................................................... 220
RESULTS ................................................................................................. 224
DISCUSSION ........................................................................................... 235
METHODS ............................................................................................... 241
REFERENCES ......................................................................................... 247
TABLESAJW? FIGURES ......................................................................... 251
A-3= CHARACTERIZATION OF GLUCOSE-SENSITIVE PHENOTYPE OF TOCOPHEROL
MUTANTS IN SYNECHOCYSTIS. ....................................................................... 261
ABSTRACT. .............................................................................................. 262
INTRODUCTION. .................................................................................... 263
RESULTS ................................................................................................. 265
DISCUSSION ........................................................................................... 276
METHODS ............................................................................................... 282

viii

REFERENCES ......................................................................................... 288
TABLES AlVD HG URES ......................................................................... 294

ix

LIST OF TABLES

Table 3.1. Tocopherol and DMPBQ Content in Leaves of Wild Types and Tocopherol
Biosynthetic Mutants Grown Under Permissive Conditions. ............................... 131

Table 3.2. Content of Photosynthetic Pigments and Tocopherols of C01 and the vte2 and
vtel Mutants After HL1800 Treatment at 22°C. ............................................. 132

Table 3.3. Yields and Abortion Rates of Seed Produced During Low Temperature
(75°C) Treatment. ................................................................................ 133

Supplemental Table 3.8]. Content of Photosynthetic Pigments and Tocopherols of Col
and the vte2 and We] Mutants Grown at Permissive condition. ............................ 134

Supplemental Table 3.82. Content of Individual Photosynthetic Pigments of C01 and the
vte2 Mutant During Low Temperature (75°C) Treatment. ................................. 135

Table 4.1. Fatty Acid Composition of Total Lipid Extracts from vte2 and Col during 14
days of Cold Treatment. .......................................................................... 185

Table A2.1. Analysis of Prenyllipids in Wild-Type and vte3 Arabidopsis Leaf Tissue and
Synechocystis Cell Culture. ...................................................................... 251
Table A2.2. Analysis of Seed Toc0pherols in the Wild Type and vte3 Mutants. ........ 252
Table A2.3. Pair-Wise Comparison of Cyanobacteria- and VTE3-Type MPBQ/MSBQ
MTs. ................................................................................................. 253
Table A3.1. Tocopherol Content of Wild Type and Newly Isolated Tocopherol Mutants.

........................................................................................................ 294
Table A3.2. Oxygen Evolution Activities of Wild Type and the Tocopherol Mutants
Grown Under Photoautotrophic and Photomixotrophic Conditions for 24 h at 3% C02

(v/v), 50 umol Photons m'zs'l, 32°C in B-HEPES Medium. ................................ 295

Table A3.3. Relative Sugar Content of the Wild Type and slrl 736 and pmgA Mutants.
....................................................................................................... 296

LIST OF FIGURES

Figure 1.1. Oxydation of Polyundaturated Fatty Acids and Lipid Peroxy Radical
Scavenging by Tocopherols. ...................................................................... 42

Figure 1.2. The Structures of Tocopherols and Tocotrienols. .............................. 43
Figure 1.3. Tocopherol Biosynthetic Pathway and Mutants in Arabidopsis thaliana and
Synechocystis Sp. PCC6803. ...................................................................... 44
Figure 2.1. Tocopherol Biosynthetic Pathway and Locations of Mutations in

Synechocystis Sp. Strain PCC 6803. ............................................................. 76

Figure 2.2. Growth Curves of Wild Type (WT) and the Tocopherol-Deficient slr1736
and slrl 73 7 Mutants under Different Stress and Chemical Treatments. .................... 77

Figure 2.3. Growth Curves and Medium Peroxide Levels of WT and the Tocopherol
Deficient sIrI 736 Mutant under HL with Various Chemical Treatments. .................. 78

Figure 2.4. Fatty Acid Composition of Total Membrane Lipid Extracts fiom WT and the
Tocopherol-Deficient slr1736 Mutant afier 4 h of Polyunsaturated Fatty Acid (PUFA)
Treatment. ........................................................................................... 80

Figure 2.5. Total Carotenoid, Chlorophyll, and Tocopherol Contents in WT and the
Tocopherol-Deficient slrl 736 Mutant during HL and 18:3/HL Treatments. ............... 81

Figure 2.6. Levels of Individual Carotenoids in WT and the Tocopherol-Deficient
slr1736 Mutant during HL and 18:3/HL Treatments. .......................................... 82

Figure 2.7. Growth of WT and the Tocopherol-Deficient slrI 73 6 Mutant in the Presence
of Norflurazon (NF) in HL. ....................................................................... 83

Figure 2.8. Changes in Total Carotenoids and Chlorophyll a Contents in the WT and the
Tocopherol-Deficient sIrI 736 Mutant during Norflurazon (NF )/I-IL Treatment. ......... 84

Figure 2.9. Changes in Individual Carotenoids in WT and the Tocopherol-Deficient
slr1736 Mutant During Norflurazon (NF )/HL Treatment. .................................... 85

Figure 3.1. Tocopherol Biosynthetic Pathway and We Mutations in Arabidopsis thaliana.
......................................................................................................... 137

Figure 3.2. Phenotypic and Photosynthetic Responses of C01 and the vte2 and We]
Mutants to HL stress. ............................................................................. 138

xi

Figure 3.3. Visible Phenotype of We Mutants During Extended Low Temperature
Treatment. .......................................................................................... 140

Figure 3.4. Tocopherol, Lipid Peroxide, Anthocyanin, and Photosynthetic Pigment

Content of C01 and the vte2 Mutant During Four Weeks of Low Temperature Treatment.
........................................................................................................ 141

Figure 3.5. Photosynthetic Status of C01 and the vte2 Mutant During Four Weeks of
Low Temperature Treatment. ................................................................... 142

Figure 3.6. Changes in Starch and Soluble Sugar levels in Co] and the vte2 Mutant
During Four Weeks of Low Temperature Treatment. ........................................ 143

Figure 3.7. Diurnal Changes in Starch and Soluble Sugar levels in Col and the vte2
Mutant During the First Four Days of Low Temperature Treatment. ...................... 144

Figure 3.8. Biochemical Phenotypes in Mature and Young Leaves of C01, and the vte2
and vtel Mutants Afier Four Weeks of Low Temperature Treatment. ..................... 145

Figure 3.9. Translocation and Export of 14C Labeled Photoassimilates in Low
Temperature-Treated Col and the vte2 and We] Mutants. ................................... 146

Figure 3.10. Aniline Blue Positive Fluorescence in Leaves of C01 and the vte2 Mutant
During Low Temperature Treatment. .......................................................... 148

Figure 3.11. Aniline Blue Positive Fluorescence in Leaves of the vte2 Mutant at Various
Light Intensities under Permissive and Low Temperature Conditions. .................. 150

Figure 3.12. Cellular Structure and Immunodetection of Callose in C01 and vte2-I Before
and After 14 Days of Low Temperature Treatment. ......................................... 151

Figure 3.13. Cellular Structure and Immunodetection of Callose in vte2-I After 3 Days
of Low Temperature Treatment. ................................................................ 153

Supplemental Figure 3.81. Phenotypes of the vte2 Mutant and Col During HL, Drought
and Salinity Stress. ................................................................................ 154

Supplemental Figure 3.82. Phenotypic and Photosynthetic Responses of C01 and the
vte2 and vtel Mutants to HL stress. ............................................................ 155

Supplemental Figure 3.83. Aniline Blue Positive Fluorescence in Leaves of the vte2
and vtel Mutant During Low Temperature Treatment. ...................................... 157

Figure 4.1. A Proposed Time Course of Events Occurring in the cold-treated vte2 Mutant
and Suppression by the fad2 Mutation. ......................................................... 186

xii

Figure 4.2. Callose Deposition, Visible Phenotype, l4C-Labeled Photoassimilate Export
Capacity, and Soluble Sugar Accumulation of Col, gsl5, vte2 and vte2gsl5 afier Low
Temperature Treatment. ......................................................................... 187

Figure 4.3. Lipid Profiling of C01 and vte2 before and after 14 Days of Cold Treatment.
....................................................................................................... 188

Figure 4.4. 18:3/ 18:2 Ratio and Callose Deposition at Petioles and the Middle of Leaves
of Col and vte2 during 14 days of Cold Treatment. .......................................... 190

Figure 4.5. Visible Phenotype of Col, vte2 and a Series of fad and vte2fad Mutants afier
Two Weeks of Cold Treatment. ................................................................. 191

Figure 4.6. Soluble Sugar Contents and l4C-Labeled Photoassimilate Export Capacity of
Cold-Treated Col, vte2 and a Series of fad and vte2fad Mutants. .......................... 192

Figure 4.7. Aniline Blue-Positive Fluorescence in Leaves of Col, vte2 and a Series of
fad and vterad Mutants after 3 and 7 days of Cold Treatment. ............................ 193
Figure A1.1. Visible Phenotype of Arabidopsis Tocopherol-Deficient vte Mutants under

Permissive Growth Conditions. .................................................................. 212

Figure Al.2. Visible Phenotype of C01 and the vte2 Mutant after 3 Days of HL stress
with Varied Light Intensities. ................................................................... 213

Figure Al.3. Photosynthetic Pigment Contents and Composition of Wild Type and
Tocopherol-Deficient Mutants during HL Stress. ............................................ 214

Figure A1.4. Changes in Maximum PSII Photosynthetic Efficiency (FV/Frn) during HL
Stress. ............................................................................................... 215

Figure A1.5. Light Dependent-Quantum Yield of PSII ((DPSII) and Non-Photochemical
Quenching (NPQ) and NPQ kinetics of Col and Tocopherol-Deficient Mutants. ....... 216

Figure A1.6. The Scheme of a Large-Scale HL Experiment Conducted in the Chapter 3.
........................................................................................................ 217

Figure A2.1. The Tocopherol Biosynthetic Pathway in Plants and Cyanobacteria and the
PQ Biosynthetic Pathway in Plants. ............................................................ 254

Figure A2.2. Phylogeny of Selected Methyltransferases from Photosynthetic Organisms.
....................................................................................................... 255

xiii

Figure A2.3. Positional Cloning of VTE3 and Phenotypes of the vte3 Mutants. ........ 256

Figure A2.4. HPLC Analysis of PO and Its Precursor MSBQ in Leaves of the Wild Type
and Homozygous vte3-1 and vte3-2 Mutants. ................................................ 257

Figure A2.5. Substrate Specificity Assays of Synechocystis sp PCC6803 MPBQ/MSBQ
MT, the Cyanobacteria-Type C. reinhardtii Enzyme, and Arabidopsis VTE3. .......... 258

Figure A2.6. Alignment of Cyanobacteria- and VTE3-Type MPBQ/MSBQ MTs. ..... 259
Figure A3.1. Biosynthetic Pathway for a-Tocopherol in Synechocystis sp. PCC 6803.

........................................................................................................ 297
Figure A3.2. Isolation and Growth Characterization of Tocopherol Mutants. ........... 298

Figure A3.3. Thin-Section Electron Micrographs of Synechocystis sp. PCC 6803 Strains.
....................................................................................................... 299

Figure A3.4. Glc Sensitivity in the Tocopherol Mutants is Independent of Light Levels
and Is Not Likely to Be Due to Elevated Oxidative Stress. ................................. 300

Figure A3.5. pH-Dependent Glc-Sensitive Phenotype of the Tocopherol Mutants. .. . .302

Figure A3.6. PBP Content in the Wild Type and Tocopherol Mutants. .................. 303
Figure A3.7. Time-Course RT-PCR Analysis of Metabolic Genes in the Wild Type and
slrl 736 Mutant Grown at pH 7.0. ............................................................... 304
Figure A3.8. Growth Analysis of the pmgA Mutant. ........................................ 305

*Images in this dissertation are presented in color.

xiv

KEY TO ABBREVIATIONS

I 8: 1

l 8 :2

1 8 :3

l 8 :4
20:3
102
3cm
A
A+Z/A+Z+V
ABA
aos
AOX
APX
Asc
a-T
AVED
BHT
B—T
Col
DGDG
DHAR
DMPBQ,
8-T
ELIPS
ER
fad
FOX assay
Fru
Fv/Fm
GGDP
GGDR
Glc
GR
GSH
gsl5
y-T
H202
HGA,
HL
HPAEC
HPP
HPPD
HPT
JA

oleic acid

linoleic acid

linolenic acid

stearidonic acid

eicosatrienoic acid

singlet oxygen

triplet state chlorophylls
antheraxanthin

de-epoxidation state of xanthophyll cycle carotenoids
abscisic acid

aIIene oxide synthase

alternative oxidase

ascorbate peroxidase

ascorbate

a-tocopherol

ataxia with isolated vitamin E deficiency
butylated hydroxytoluene

B-tocopherol

Columbia wild-type
digalactosyldiacylglycerol
dehydroascorbate reductase
2,3-dimethyl-6-phytyl- 1 ,4-benzoquinol
8-tocopherol

early light-induced proteins
endoplasmic-reticulum

fatty acid desaturase

ferrous oxidation-xylenol orange assay
fructose

maximum photosynthetic efficiency
geranylgeranyl-diphosphate

GGDP reductase

glucose

glutathione reductase

glutathione

glucan synthase like 5

y-tocopherol

hydrogen peroxide

homogentisic acid

high light

high-pH anion exchange chromatography
hydroxyphenylpyruvate

HPP dioxygenase

HGA phytyltransferase

jasmonic acid

XV

L-
LHC
LOH
LOO-
LOOH
MDA
MDAR
MEP
MGDG
MPBQ.
MSBQ
MT

NF
NPQ
02-
OH-
OPDA
PAM fluorometer
paraquat
PC
PDP
PE
PFD
Pgr5
PLAMS
pmr4
PQ

Prx Q
PSII
PT OX
PUFA

ROS
3110418
slr0089
slrl 73 6
slrl 73 7
SOD
Suc
sxdl
t-BOOH
TC
TEM

V

lipid radicals

light harvesting complexes

lipid hydroxides

lipid peroxyl radicals

lipid hydroperoxides
malondialdehyde
monodehydroascorbate reductase
2-C-methyl-D-erythritol-4-phosphate
monogalactosyldiacylglycerol
2-methyl-6-phytyl-1 ,4-benzoquinol
2-methyl-6-solanylbenzoquinone
MPBQ methyltransferase
norflurazon

non-photochemical quenching
superoxide

hydroxyl radical
lZ-oxophytodienoic acid

pulse amplitude modulation fluorometer
methyl viologen
phosphatidylcholine
phytyl-diphosphate
phosphatidylethanolamine

photo flux density

proton gradient regulation 5
PLastid Associated membranes
powdery mildew resistant 4
plastoquinone

peroxiredoxins Q

photosystem II

plastid terminal oxidase
polyunsaturated fatty acid
ApH-dependent quenching
photoinhibitory quenching

state transition

reactive oxygen species
Synechocystis MT mutant
Synechocystis y-TMT mutant
Synechocystis HPT mutant
Synechocystis TC mutant
superoxide dismutase

sucrose

sucrose export defective l
tert-butyl hydroperoxide
tocopherol cyclase

transmission electron microscope
violaxanthin

xvi

VLDL
vtel ,
vte2
vte3
vte4
Ws

a-TTP
y-TMT,
‘Ppsu

very low density lipoprotein
Arabidopsis TC mutant
Arabidopsis HPT mutant
Arabidopsis MT mutant
Arabidopsis y-TMT mutant
Wassilewskija wild-type
zeaxanthin

III-tocopherol transfer protein
y-tocopherol methyltransferase
quantum yield of PSII

xvii

CHAPTER 1: LITERATURE REVIEW

Protective and Acclimation Mechanisms of Plants to Environmental Stress

Because plants are sessile, they are continuously subjected to a variety of environmental
stresses, including high intensity light, drought, salinity and low temperatures. These
abiOtic stresses adversely affect plant growth and development and therefore limit the
productivity and geographical distribution Of plants. TO survive and acquire fitness under

such conditions, plants have evolved sophisticated mechanisms to respond, tolerate and

adapt to the constantly changing environment.

Protective Mechanisms against High light (HL) Stress

Light is essential for photosynthesis to generate ATP and NADPH, which are required for
CO; fixation. Under HL stress condition, however, plants absorb more photons than can
be utilized for metabolism. This “energy imbalance” between the photosynthetic light
reaction and the downstream metabolism causes the accumulation of excessive energy in
the photosystems (Huner et al., 1998). Failure to dissipate this excessive energy leads to
the generation of reactive oxygen species (ROS) and photooxidative damage to the
Photosynthetic apparatus (e.g., photoinhibition), which is often manifested as photo-
bleaching of leaves (Mullineaux and Karpinski, 2002). To avoid such detrimental effects
0f HL stress, plants induce various protective mechanisms that minimize the amount of
absorbed light, dissipate excessive energy, or detoxify the ROS generated.
T0 Ininimize the amount of absorbed light, plants strategically move both their
leaves and chloroplasts (Wada et al., 2003), accumulate UV—absorbing compounds such
as flavonoids (Li et al., 1993; Winkel—Shirley, 2002), and adjust the size of light

ha -
I‘Vestmg Complexes (LHC) (Anderson, 1986). However, these processes are often not

on a timeframe that can cope with the rapidity of light fluctuations and, as a result,
excessive photons are absorbed by the photosystems.

Upon light absorption, ground state chlorophylls are excited to Singlet state
chlorophylls (lChl’l‘), which transfer energy to photosystem 11 (P811) reaction centers to
drive photosynthesis. Under HL stress, excitation energy is accumulated in the P811 light
harvesting complexes and excess lChl’k can be converted to triplet state chlorophylls
(3Chl*). 3Chl* is a long lived molecular species and can transfer energy to ground state
oxygen (02) and generate singlet oxygen (‘02), a highly reactive ROS (Niyogi, 2000). To
protect PSII from HL stress, plants induce a mechanism called non-photochemical
quenching (NPQ), which quenches lChl* and prevents the generation of 3Chl* and hence
102 (Asada, 1999; Muller et al., 2001). NPQ consists of three components: ApI-I—
dependent quenching (qE), state transition (qT) and photoinhibitory quenching (qI). qE
accounts for most NPQ (~80%) and is rapidly induced (within seconds) in response to a
buildup of thylakoid ApH. The PSbS protein and zeaxanthin, a part of LHCII complex
and one of xanthophyll cycle carotenoids, respectively, are critical components of qE
(Muller et al., 2001; Holt et al., 2004; SzabO et al., 2005). Arabidopsis gon-

QhOtochemical Quenching I and 4 (npql and npq4) mutants are unable to induce NPQ,
because 12qu is defective in Violaxanthin de-epoxidase, which converts Violaxanthin to
zeaxanthin in response to HL, and npq4 is deficient in PsbS (Niyogi et al., 1998; Li et al.,
2000; Li et al., 2002). Both mutants showed reduced fitness in fluctuating HL conditions
and increased sensitivity to a short-term HL stress, whereas their response to a long-term

h‘ .
lgh llght Stress was indistinguishable from wild type (Havaux and Niyogi, 1999; Havaux

et al., 2000; Kulheim et al., 2002). These results indicate that NPQ plays a critical role in
short—term photosynthetic regulation.

When the linear photosynthetic electron flow exceeds the capacity of C02 fixation,
the water-water cycle, chlororespiration and photorespiration serve as alternative electron
sinks, all of which use 02 as an electron acceptor (Ort and Baker, 2002). The water-water
cycle reduces 02 to H20 at the reducing side of PSI via superoxide (02‘) and hydrogen
peroxide (H202) by using the electrons provided through ferredoxin or NADPH (Asada,
1999). The plastid terminal oxidase (PT OX), which is homologous to the mitochondrial
alternative oxidase (AOX), has been proposed to be involved in chlororespiration (Joet et
al., 2002; Peltier and Coumac, 2002; Kuntz, 2004). PTOX re-oxidizes plastoquinol to
plastoquinone and reduces O2 to H2O, avoiding over-reduction Of the plastoquinone pool.
Photorespiration results from an oxygenation reaction catalyzed by ribulose-l,5-
bisphosphate carboxylase/oxygenase (Rubisco), which ultimately produces CO2 and NH3
and consumes ATP and NAD(P)H through a pathway that includes chloroplasts,
Peroxisomes, and mitochondria (Wingler et al., 2000; Noctor et al., 2002; Bauwe and
Kolukisaoglu, 2003).

CyClic electron flow around PSI also plays an essential role in photosynthetic
regulation under HL stress (Munekage et al., 2002; Kramer et al., 2004; Munekaga et al.,
2004; Cruz et al., 2005). Electrons reaching the PSI acceptor side are recycled back to
p laSt(’Cllliflone through at least two parallel pathways, NAD(P)H dehydrogenase (NDH)-
Or ferredoxin-dependent pathways. Both pathways generate thylakoid ApH, which
induces CIE (ApH-dependent NPQ) and ATP synthesis without NADPH accumulation and

thu -
s aVOIds over-reduction of the PSI acceptor side (Burrows et al., 1998; Shikanai et al.,

 

1998; Munekage et al., 2002). The Arabidopsis proton gradient regulation 5 (pgr5)
mutant, which is defective in the ferredoxin-dependent pathway, exhibited an increased
PSI sensitivity to HL stress (Mullineaux and Karpinski, 2002), while inactivation of the
NDH-dependent pathway by disruption of the nth gene in tobacco plants resulted in
increased PSII sensitivity under C02 limitation (Horvath et al., 2000). The simultaneous
disruption of both pathways in Arabidopsis resulted in reduced growth rate and
chlorophyll content even under normal conditions, suggesting that the PSI cyclic electron

flow is a fundamentally essential mechanism for the regulation of photosynthesis

(Munekaga et al., 2004).

Cold Tolerance, Adaptation and Acclimation Mechanisms

When plants are shifted to chilling temperatures (2 to 12 °C), tropical and subtropical
plants, such as cotton and cucumber, exhibit symptoms of chilling injury, including
inhibition of photosynthesis, chlorosis, necrosis and growth cessation (Lyons, 1973). By
Contrast, cold-hardy species such as Arabidopsis, Spinach and wheat are able to survive at
chilling temperatures. Despite several attempts to isolate and characterize chilling
sensitive mutants of Arabidopsis, the mechanistic basis of the chilling sensitivity or
tolerance remains uncertain (Schneider et al., 1995; Tokuhisa et al., 1997; Tokuhisa et al.,
1 998; Provart et al., 2003). Interestingly, these cold-tolerant plants also acquire resistance
t0 freezing temperatures by a prior exposure to nonfreezing low temperatures (2 to 8 °C).
This Process is called cold acclimation (Thomashow, 1999).

Low temperature negatively impacts the activity of Calvin cycle enzymes, which

1‘ esul ' . . . .
ts In an energy Imbalance between the light and dark reactions, and hence Increases

excitation pressure in the photosystems (Huner et al., 1998). To avoid the generation of

excessive energy and ROS, low temperature-treated plants induce various energy

dissipation mechanisms similar to what are induced during HL Stress (e.g. NPQ and PS1

cyclic electron flow; Huner et al., 1998; Foyer et al., 2002; Oquist and Huner, 2003). A

rapid down shift of temperature also inhibits export and synthesis of photosynthetic

endproducts such as sucrose, which leads to the accumulation of phosphorylated
intermediates and subsequently a limitation of free phosphate (Pi) (Krapp and Stitt, 1995;
Stitt and Hurry, 2002). This reduced Pi in turn feedback-inhibits photosynthesis and
limits the carbon supply for growth and also for the production of osmoprotectants that
are required for freezing tolerance (Stitt and Hurry, 2002). In order to restore
photosynthesis and continue to supply fixed carbon for growth, plants re-activate Calvin-
Cycle enzymes and sucrose phosphate synthase (Strand et al., 1997; Strand et al., 1999)
and also up-regulate the expression of sucrose transporters involved in phloem loading
(Lundmark et al., 2006).

In addition to the dramatic changes in photosynthesis and metabolism, membrane
Properties are also strongly impacted by low temperatures. Temperature reduction
generally rigidifies membranes, whereas freezing—induced dehydration destabilizes
membranes through the lamellar-to-hexagonal 11 phase transition (Steponkus, 1984). To
compensate for cold-induced membrane rigidification, plants increase membrane fatty
acid unsaturation, which also prevents hexagonal 11 phase formation and enhances
rnellerane cryostability (Uemura et al., 1995; Nishida and Murata, 1996; Sakamoto and

IVIurEtta, 2002). Also, in response to cold, the levels of non-bilayer lipids such as

InonOgalactosyldiacylglycerol (MGDG) are decreased and bilayer lipids such as

digalactosyldiacylglycerol (DGDG) are correspondingly increased in the plastid
membranes (Uemura and Steponkus, 1997). A variety of membrane-localized peptides
and proteins, which include COR15a, lectins, dehydrins, and cryoprotectin, are also
produced in response to low temperatures (Thomashow, 1999; Hincha, 2002; Charron et
al., 2005). Overexpression of COR15a increased the freezing tolerance of Arabidopsis
protoplasts due to a reduced incidence Of the lamella-to-hexagonal II‘phase transition
(Steponkus et al., 1998). The overexpression Of dehydrins also enhanced freezing
tolerance of Arabidopsis plants (Puhakainen et al., 2004).

These adaptive responses to low temperatures are regulated through complex
transcriptional networks, which include transcription factors such as the C-
repeat/dehydration-responsive element-binding factors (CBF/DREB), ZAT12 and the
inducer of CBF expression 1 (ICEl) (Stockinger et al., 1997; Liu et al., 1998;
Thomashow, 1999; Shinozaki and Yamaguchi-Shinozaki, 2000; Chinnusamy et al., 2003).
Global transcript profiling studies further revealed that these transcription factors regulate
a large set Of genes related to the aforementioned biochemical changes and also ROS
Scavenging, hormonal signaling and cell wall modification, etc (Seki et al., 2001; Fowler
and Thomashow, 2002; Hannah et al., 2005; Lee et al., 2005; Vogel et al., 2005).

In contrast to the extensively studied transcriptional changes, the initial cold sensing
mechanisms and early signals that lead to these transcriptional responses are not as well
undel‘stood. Membranes have been proposed to be the site of low temperature sensing and

Signal production. Membrane-localized calcium channels and two-component response
reg ulators have been implicated to play a role in these processes (Plieth et al., 1999;

S
uzuki et al., 2000; Browse and Xin, 2001; Mikami and Murata, 2003). Other membrane

components, such as phosphatidic acids and lysolipids, have also been proposed to play
important roles in both the early response and longer-term adaptation to low temperatures
(Ruelland et al., 2002; Welti et al., 2002; Gomez-Merino et al., 2004). However, low
temperatures also directly affect the stability of RNA and DNA secondary structures and

the activity of enzymes, and thus any or combination Of these changes can become the

source of low temperature signals.

Reactive Oxygen Species and Antioxidants

Reactive Oxygen Species

Reactive oxygen species (R08) are the partially reduced forms of molecular oxygen (02)
and by-products of aerobic metabolic pathways that are localized in different cellular
Compartments, such as mitochondria, peroxisomes, and chloroplasts. The chloroplast is
One of the major site of ROS production during abiotic stress in plants. Over-reduction of
the photosynthetic electron transport chain results in the formation of chlorophyll triplets
(3Chl*), which transfer energy to O2 and generate singlet oxygen (102) at PSII (Niyogi,
2000). Excessive electrons are also transferred to 02 at the PSI acceptor side, creating
suPeroxide anion (02'), hydrogen peroxide (H202), and hydroxyl radical (OH-) (Apel and
Hi“. 2004; Laloi et al., 2004). Under C02 limitation, the oxygenation reaction of Rubisco
releases glycolate from chloroplasts to peroxisomes, where H202 is produced upon
ConVersion of glycolate to glyoxylate by glycolate oxidase (Wingler et al., 2000; Noctor
er al-, 2002). When the mitochondrial electron transport chain is over-reduced such as
Under low temperature, excess electrons are transferred to O2, generating 02', H202 and

OH- (Maxwell et al., 1999; Moller, 2001; Rhoads et al., 2006). R08 can also be

 

generated by several oxidases, such as plasma membrane localized NAD(P)H oxidases
and cell wall peroxidases in the apoplastic spaces (Lamb and Dixon, 1997; WOjtaszek,
1997; Apel and Hirt, 2004).
Uncontrolled ROS production triggers unrestricted oxidation Of various cellular
components and causes enzyme inhibition, lipid peroxidation and DNA and RNA
damage (Mittler, 2002; Shulaev and Oliver, 2006). In the presence Of transition metal
ions such as iron (Fe), ferric iron (Fe3+) is reduced to ferrous iron (Fey) that reacts with
H202 to form OH-. This highly destructive OH° can oxidize both amino acid side chains
and peptide backbones, resulting in protein-protein cross linkages and protein
fragmentation (Garrison, 1987; Berlett and Stadtman, 1997). 0H0 can also trigger lipid
peroxidation by abstracting allylic hydrogens from polyunsaturated fatty acid (PUFA)-
COntaining lipids and producing lipid radicals (L-), that immediately react with 02 to
form lipid peroxyl radicals (LOO') (Figure 1.1; Tappel, 1972; Bramley et al., 2000;
SChneider, 2005). L000 can subsequently attack another PUFA generating a second
LOO. and propagating a chain reaction of lipid peroxidation that perturbs membrane
structures and functions. 0H0 also attacks deoxyribose bases such as guanine to forms 8-
0x0~guanine, which can cause mismatching with adenine during replication.
IVIalOndialdehyde (MDA), an end product of lipid peroxidation, also reacts with
deoxyribose bases to form a variety of MDA-DNA adducts (Wang and Liehr, 1995;
Marneu, 1999).
In addition to the detrimental effect of ROS, these highly reactive ROS molecules
also function as signals and regulate various cellular processes (Apel and Hirt, 2004;

M1 ttl er et al., 2004). The oxidative burst is a rapid accumulation of 02‘ and H202 and a

 

characteristic early response leading to ozone- and pathogen-induced cell death (Lamb
and Dixon, 1997; Torres et al., 2002; Overmyer et al., 2003; Torres and Dangl, 2005).
H202 accumulated in growing root hairs and induced by abscisic acid (ABA) during
drought stress activates calcium channels and leads to cell expansion and stomata closure,
respectively (McAinsh et al., 1996; Pei et al., 2000; Foreman et al., 2003; Jiang et al.,
2003). Recently, 102 has been implicated as another type of ROS signal that regulates
programmed cell death in plants via a pathway mediated through Excecuterl, a novel

protein localized in the chloroplasts (op den Camp et al., 2003; Wagner et al., 2004; Laloi

et al., 2006).

Water-Soluble Antioxidants

In order to protect cellular components from ROS attack and also tightly regulate the
levels of ROS signals, plants have evolved a variety of ROS detoxification mechanisms
(Mittler, 2002; Mittler et al., 2004; Foyer and Noctor, 2005). 02' generated from the
mitochondria and chloroplast electron transport is reduced to H202 by superoxide
diSmutases (SODS), which use different metals as co-factors (Alscher et al., 2002). H202
is fUrther reduced to H20 by the ascorbate-glutathione system, which composed of two
Water—soluble antioxidants, ascorbate (Asc, Vitamin C) and glutathione (GSH), and a

nuIl’lber of enzymes that use Asc and GSH as cosubstrates. These enzymes include

aSCOI‘bate peroxidase (APX), monodehydroascorbate reductase (MDAR),

dehydroascorbate reductase (DHAR), glutathione reductase (GR) (Noctor and Foyer,

1998 ‘ Chew et al., 2003). Oxidized Asc and GSH are regenerated to their reduced forms

’

b . . . . .
y I‘eactions usmg ferredoxm and NAD(P)H as reductants. Peroxrredoxms are also

10

 

reported to play roles in the H202 detoxification in both mitochondria and chloroplasts
(Broin et al., 2002; Konig et al., 2002; Dietz, 2003; Dietz et al., 2006). Peroxisomes

contain SOD, catalase and APX for detoxification of H202 produced during

photorespiration (Igamberdiev and Lea, 2002).

Lipid-Soluble Antioxidants

In contrast to the well-studied ROS detoxification mechanisms for water-soluble
compartments, however, the mechanisms preventing or limiting membrane oxidation are
less clear. Because membranes of chloroplasts and cyanobacteria contain high levels Of
PUFAs and the photosynthetic apparatus, a potential ROS generator, photosynthetic
membranes must have extensive mechanisms to protect PUFAs from oxidation. Several
peroxiredoxins have been implicated in reducing lipid hydroperoxides (LOOH) to the
less toxic lipid hydroxides (LOH) in both plants and cyanobacteria (Gaber et al., 2001;
Dietz, 2003). In Arabidopsis thaliana and Chlamydomonas reinhardtii, specific
Carotenoids play roles in limiting lipid peroxidation, presumably by directly scavenging
L000 in the plastid membranes (Havaux and Niyogi, 1999; Baroli et al., 2003; Baroli et
31-. 2004). Tocopherols, a major class of lipid-soluble antioxidants in photosynthetic
membranes, are also thought to play important roles in preventing lipid peroxidation
(F ry er, 1992; Munne-Bosch and Alegre, 2002). However, while plausible, there is little

dlrect in vivo evidence supporting such functions for tocopherols in photosynthetic

o .
I.‘garusms.

11

Tocopherols (Vitamin E)

Chemical Structure and Characteristics of Tocopherols

Tocopherols are amphipathic molecules that consist of a polar chromanol head group
attached to a hydrophobic phytyl tail. There are four different forms of tocopherols
(or, B, y, and 8-tocopherols) based on the substitution patterns of methyl groups attached
to the C5, C7 and C8 positions of the chromanol ring (Figure 1.2; Fernholz, 1938;
Kamal-Eldin and Appelqvist, 1996; Bramley et al., 2000; Schneider, 2005). Tocopherols
have three chiral centers at the C2, C4’ and C8’ positions and only 2R, 4 ’R, 8’R-
tOCOpherols (RRR-tocopherols) are synthesized in nature. Tocotrienols (or, B, y, and
5—tocotrienols) have an unsaturated isoprenoid side chain with double bonds at the C3’,
C7’, and C1 1’ positions and thus contain only one chiral center at the C2 position (Figure
l .2, Kamal-Eldin and Appelqvist, 1996; Bramley et al., 2000; Schneider, 2005). These
Bight naturally occurring forms, four tocopherols and four tocotrienols, are collectively
termed vitamin E.

The hydrophobic phytyl tail allows tocopherols to reside in membranes with the
hydroxyl group of the chromanol ring being located near the membrane surface (Niki et
31-. 1985; Bramley et al., 2000). Methyl groups at position C4’ and C8’ of the tocopherol

phytyl chain fit into a pocket created by the cis double bonds of PUFAS, thus allowing
tOCOpherols to tightly associate with PUFAS or PUFA-containing lipids in membranes
(Diplock and Lucy, 1973; Erin et al., 1984; Stillwell et al., 1996). These tocopherol-
PUFA complexes may reduce membrane permeability, increase membrane protein
stability and/or protect membranes against hydrolytic enzymes such as phospholipase A2

(LuCy, 1972; Kagan, 1989; Grau and Ortiz, 1998; Wang and Quinn, 2000)-

12

Based on in vitro studies using organic solutions, liposome and animal cell-
derived membranes, tocopherols can both physically and chemically quench lO2 (Grams
and Eskins, 1972; Fahrenholtz et al., 1974; Littarru et al., 1984; Fukuzawa et al., 1998).
Although tocopherols are 50 to 100-fold less efficient quenchers than carotenoids, one
molecule of (II-tocopherol can deactivate roughly 100 molecules of 102 before being
destroyed (Fahrenholtz et al., 1974; Kamal-Eldin and Appelqvist, 1996; Fukuzawa et al.,
1998). Tocopherols also efficiently scavenge various radicals, particularly L000. The
hydroxyl group attached to the C6 position Of the chromanol ring can transfer a hydrogen
atom to L00-, yielding LOOH and the tocopheroxyl radical and thereby terminating the

lipid peroxidation chain reaction (Figure 1.1; Tappel, 1962, 1972; Burton and Ingold,
1981; Liebler and Burr, 1992; Ham and Liebler, 1995). The tocopheroxyl radical can be
recycled back to the corresponding tocopherol by interaction with other antioxidants such
as ascorbate or coenzyme Q in animals (Stoyanovsky et al., 1995; May et al., 1998). It is
not yet known if and how such recycling of the tocopherol radical takes place in plants.
Alternatively, the tocopheroxyl radical can further react with a second L000 to form a
nOn-radical product, tocopherol quinonone ( Figure 1.1; Liebler and Burr, 1992; Kamal-

Eldin and Appelqvist, 1996).

TOCOpherols in Animals

Toe()pherols were first discovered as the substances that prevented embryo resorption
duri 11g gestation in female rats (Evans and Bishop, 1922). Subsequently, it was found that
dietary vitamin E deficiency in different mammals, such as rat and chicken, also causes

male sterility, encephalomalacia (brain softening), and various neurological disfunctions

l3

(Machlin et al., 1977; Shih et al., 1977; Burton, 1994; Brigelius-Flohe et al., 2002). These
results clearly indicate that vitamin E is an essential nutrient in mammals.

In mammals, all forms Of tocopherols are equally absorbed in the small intestine
together with lipids, packaged into large circulating lipoprotein particles named
chylomicrons, and transported to the liver (Kayden 1993). In the liver, a-tocopherol is
selectively recognized by (It-tocopherol transfer protein (a-TTP) and preferentially
secreted into very low density lipoprotein (VLDL) for export to the plasma (Kayden and
Traber, 1993; Traber et al., 1994; Brigelius-Flohe and Traber, 1999). Mutations in the
human a-TI‘P gene cause a neurodegenerative disease called Ataxia with isolated
Vitamin _E Deficiency (AVED; Bramley et al., 2000). Likewise,0t-TTP deficiency in mice
resulted in neurological disfunction (Yokota et al., 2001) and also in the death of embryos
at mid-gestation stage (Jishage et al., 2001). These results support an essential role for a-
TTP in the transport of (II-tocopherol. a-TTP has significantly lower affinity for other
forms of tocopherols than (It-tocopherol (or-tocopherol, 100%; B-tocopherol, 38%; y-
tocopherol, 9%; 5-tocopherol, 2%; Hosomi et al., 1997). This a-TTP selectivity is likely
the molecular basis for the differences in the Vitamin E activity of the different
tOCOpherols. The unrecognized tocopherols are subjected to their side-chain degradation

Via co—hydroxylation and B-oxidation and are excreted by urine (Brigelius—Flohe et al.,
2002)

Because in vitro Studies demonstrated that a-tocopherol is one of the most
efficient lipid-soluble antioxidants in nature (Burton and Ingold, 1981; Kamal-Eldin and
APpelqvist, 1996), the essential nutritional roles of vitamin E in mammals are most likely

associated with its lipid-soluble antioxidant properties (Tappel, 1962; Burton, 1994;

14

Kamal-Eldin and Appelqvist, 1996). Consistent with this thesis, vitamin E
supplementation suppressed tert-butyl-hydroperoxide-induced lipid peroxidation in the
rat liver and also significantly reduced atherosclerotic lesions and the generation of
isoprostanes, oxidation products of arachidonic acid, in the apolipoprotein E deficient
mouse (Ham and Liebler, 1997; Pratico et al., 1998). The vitamin E deficient symptoms,
such as ataxia in the a-TTP knockout mouse and muscular dystrophy in the vitamin E
deficient chicken, are also coincident with elevated oxidative stress (Shih et al., 1977;
Awad et al., 1994; Yokota et al., 2001). Some epidemiological studies have shown that
vitamin E supplementation has beneficial effects on diseases associated with oxidative
stress, such as atherosclerosis and cancer, while other studies found that Vitamin E
supplementation has no significant impacts (Brigelius-Flohe and Traber, 1999; Bramley
et al., 2000; Brigelius-Flohe et al., 2002).
Recent studies have also suggested that a specific form of tocopherols in animals
also can have “non-antioxidant” functions. For instance, Ot-tocopherol inhibits protein
kinase C activity via protein phosphatase 2A activation (Ricciarelli et al., 1998) and also
inhibits phospholipase A2 activity and suppresses the synthesis Of arachidonic acid
(Pentland et al., 1992; Chandra et al., 2002; Takeda et al., 2004). y-Tocopherol and its
metabolites inhibit cyclooxygenase activity and hence prostaglandin E2 synthesis (Jiang
et al-, 2000; Jiang and Ames, 2003). Moreover, a-tocotrienol was proposed to modulate
12-lipoxygenase and suppress glutamate-induced neuronal cell death (Sen et al., 2000;
Khanna et al., 2003). Although the underlying mechanisms have not been elucidated,
these enzyme activities are differentially modulated by the specific type of tocopherols

(e.g. only (it-tocopherol but not y-tocopherol), leading to the hypothesis that tocopherols

15

also function independently from their antioxidant properties (Rimbach et al., 2002;

Schneider, 2005).

Tocopherols in Photosynthetic Organisms

Tocopherol Biosynthesis

Tocopherols (and tocotrienols) are synthesized only in photosynthetic organisms,
including all plants and algae, and most cyanobacteria (Powls and Redfearn, 1967;
Skinner and Sturm, 1968; Dasilva and Jensen, 1971; Horvath et al., 2006). With the
combination of biochemical, genetic and genomic approaches, the tocopherol
biosynthetic pathway has recently been fully elucidated in Arabidopsis thaliana and
Synechocystis sp. PCC 6803, a model higher plant and cyanobacterium, respectively
(Figure 1.3) (Shintani and DellaPenna, 1998; Collakova and DellaPenna, 2001; Shintani
et al., 2002; Cheng et al., 2003; Sattler et al., 2003). The plastidic 2-C-methyl-D-
erythritol-4-phosphate (MEP) pathway provides phytyl-diphosphate (PDP), the phytyl
tail precursor of tocopherols (and also chloroplylls; Lichtenthaler, 1998). Four
isopentenyl phosphate (IPP) are combined to produce geranylgeranyI-diphosphate
(GGDP) and then converted to PDP by geranylgeranyl-diphosphate reductase (GGDR)
(Addlesee et al., 1996; Tanaka et al., 1999). Homogentisate (HGA), the aromatic
Precursor Of tocopherols (and also plastoquinone in plants), is synthesized Via the
Plastidic shikimate pathway and cytosolic tyrosine metabolism (Whistanc and Threlfal,
197O). p-Hydroxyphenyl pyruvate (HPP) produced from L-tyrosine degradation is
CenVerted to HGA by cytosolic p-hydroxyphenyl pyruvate dioxygenase (HPPD) (Garcia

et al., 1997; Norris et al., 1998; Dahnhardt et al., 2002; Rippert et al., 2004).

16

Homogentisate phytyltransferase (HPT) catalyzes the committed Step in tocopherol
synthesis by condensing HGA and PDP to produce 2-methyl-6-phytyl-l,4-benzoquinol
(MPBQ) in the plastids (8011 et al., 1980; Collakova and DellaPenna, 2001; Schledz et al.,
2001; Savidge et al., 2002). MPBQ is then converted to 2,3-dimethyl-6-phytyl-1,4-
benzoquinol (DMPBQ) by MPBQ methyltransferase (MPBQ MT) (8011 et al., 1980,
1985; Shintani et al., 2002; Cheng et al., 2003). Both MPBQ and DMPBQ are substrates
for tocopherol cyclase (TC) to produce 5- and y-tocopherols, respectively (8011 et al.,

1985; Porfirova et al., 2002; Sattler et al., 2003), which are then converted to B- and 0L—

tocopherols by y-tocopherol methyltransferase (y-TMT) (Dharlingue and Camara, 1985;
Shintani and DellaPenna, 1998). The last four steps Of tocopherol synthesis occur at the
inner envelope of the chloroplasts and presumably other plastids of non-photosynthetic
tissues (8011 et al., 1980, 1985). Recent studies using proteomics approaches, however,
revealed that TC is also present in plastoglobuli, a lipid monolayer subcompartment

extended from the thylakoid membranes (Austin et al., 2006; Vidi et al., 2006; Ytterberg

et al., 2006).

Distributions of Tocopherols among Photosynthetic Organisms.

As far as is known, all plants so far investigated produce tocopherols and/or tocotrienols
(Sheppard et al., 1993; Horvath et al., 2006). Photosynthetic tissues such as leaves
accumulate predominantly Ot-tocopherol. Non-photosynthetic tissues such as dry seeds,
r OOIS. flower petals tend to accumulate more y—tocopherol than Ot-tocopherol but there are
many exceptions such as sunflower and safflower seeds, which accumulate (Jr-tocopherol

as their major form (>95%) (Furuya et al., 1987; Sheppard et al., 1993). Tocotrienols are

17

(1'

 

found in seeds of various plants, particularly cereals, but generally not in photosynthetic
tissues (Sheppard et al., 1993; Horvath et al., 2006). Like photosynthetic tissues of plants,
algae and cyanobacteria usually accumulate a-tocopherol as their major constituent, with
a few exceptions such as Anabeana variabilis accumulating both OL- and B-tocopherols
(Carr and Hallaway, 1965; Powls and Redfearn, 1967; Skinner and Sturm, 1968;
Whistanc.Gr and Threlfal.Dr, 1970; Dasilva and Jensen, 1971). The freshwater
unicellular cyanobacteria Synechococcus elongatus PCC7942 (Anacystis nidulans) is one
exceptional cyanobacterium in which no tocopherols were detected (Powls and Redfearn,
1967; Dasilva and Jensen, 1971). Although it is unclear why this particular
Synechococcus strain does not require tocopherols, the hydroxylated vitamin K1, 5-
hydroxyphylloquinone, accumulated in this cyanobacterium was suggested to
complement for the lack of tocopherols (Powls and Redfearn, 1967; Whistanc and
Threlfal, 1970). It is also interesting to note that the membranes of Synechococcus
elongatus PCC7942 do not contain any dienoic or trienoic fatty acids (Wada et al., 1990;
Gombos et al., 1997), which may be the alternative reason why tocopherols are not

required in this cyanobacterium.

Subcellular Localization of Tocopherols in Photosynthetic Tissues.

With the exception of tocopherols accumulated in oil bodies, the majority of tocopherols
are localized in the plastids (Bucke, 1968; Yamauchi and Matsushita, 1976; Wise and
Naylor, 1987). In spinach chloroplasts, 2.8 pg tocopherols per mg protein were detected
in envelopes, while 1.1 pg per mg protein were present in thylakoids (Lichtenthaler et al.,

1981). Considering the lower protein concentration of the envelopes (protein/polar lipid

l8

ratio of 0.65) relative to the thylakoids (protein/polar lipid ratio of 2.0; Heber and Heldt,
1981), 45% Of tocopherols are localized in the envelopes and the remaining 55% are in
the thylakoids. Within the envelopes, the outer membrane contains slightly more
tocopherols (60%) than the inner membrane (40%) (8011 et al., 1985). Within the
thylakoids, one tOCOpherol molecule is present for every sixty to eighty chlorophyll
molecules [calculated from the data of (Bucke, 1968; Lichtenthaler et al., 1981; Wise and
Naylor, 1987)]. Tocopherols were also detected in the plastoglobuli of old spinach leaves
(Lichtenthaler et al., 1981). It is noteworthy that Janiszowska and Korczak (1980)
reported that 9 and 6% of total tocopherols were found in the mitochondria and
microsome fractions isolated from Calendula oflicinalis leaves, respectively. This could
be due to the contamination by chloroplasts as indicated by the presence of some
chlorophyll (0.5 to 3%) in these fractions (Janiszowska and Korczak, 1980). Nevertheless,
the possible localization of tocopherols outside the chloroplasts needs to be further
investigated from different plants under different developmental and environmental

conditions.

Proposed Tocopherol Functions in Photosynthetic Organisms.

In photosynthetic organisms, tocopherol levels increase in response to various abiotic
Stresses. Especially during HL stress, the levels of tocopherols are dramatically elevated
in both plants and cyanobacteria (Havaux et al., 2000; Collakova and DellaPenna, 2003;

Maeda et al., 2005). Low temperature and drought stress also lead to a 5-fold increase in
total tocopherol content (Munne-Bosch et al., 1999; Bergmuller et al., 2003), while salt

Stress. increases tocopherol levels only slightly (20%; K6168 and 011061, 2002)-

l9

Tocopherol levels are also increased during senescence, a developmental process which
involves oxidative stress (Rise et al., 1989; Thompson et al., 1998). Based on i) the
elevated accumulation of tocopherols in response to stress, ii) the evolutional
conservation Of tocopherol synthesis among oxygenic photosynthetic organisms, iii) the
localization of most tocopherols in the plastids, and iv) the chemical characteristics Of
tocopherols as lipid-soluble antioxidants, it has long been assumed that a primary
function of tocopherols is to protect photosynthetic membranes from oxidative stress by
acting as lipid—soluble antioxidants (Fryer, 1992; Munne-Bosch and Alegre, 2002). While
compelling, such hypotheses are based primarily on correlative and circumstantial
evidence and have yet to be rigorously tested in vivo.

To address the possible photoprotective role of tocopherols in photosynthetic
organisms, Trebst et a1. (2002) used an herbicide pyrazolynate, which inhibits HPPD
enzyme activity in Chlamydomonas rein/zardtii and assessed the impact Of reduced
tocopherol content on HL stress tolerance. The treatment of Chlar-nydomonas with
pyrazolynate at 1500 umole photons m'?’ 5’1 reduced tocopherol levels to 20% of controls
and induced concomitant degradation of the D1 protein, consistent with the thesis that
tOCOpherols protect PSII against photooxidative stress (Trebst et al., 2002). However,
pyrazolynate also inhibits the synthesis of plastoquinone, an essential electron carrier of
Photosynthesis, but the level of plastoquinone was not quantified in this study. Tanaka et
a1. (1999) generated antisense tobacco lines for GGDR, which had reduced tocopherol

levels to 15 % of wild type. These plants showed delayed growth and pale phenotype
under normal condition, and increased sensitivity and elevated lipid peroxidation during

HL Stress (Tanaka et al., 1999; Grasses et al., 2001; Havaux et al., 2003). However, the

20

downregulation Of GGDR also converted 60 % of chlorophyll phytyl tails to
geranylgeranyl tails (Tanaka et al., 1999), which dramatically alters the structure and
photochemistry of the photosystems. Thus, again one cannot exclude that the observed
phenotypes in the GGDR-antisense plants are caused by the dramatic changes in the
composition Of chlorophylls, the major pigments of light harvesting complexes and PS

reaction centers, and that impacts on tocopherol levels, lipid peroxidation and

photosynthesis are pleiotropic.

Tocopherol Biosynthetic Mutants.
During studies Of the tocopherol biosynthetic pathway, mutants disrupting each
biosynthetic enzyme have been isolated in both Arabidopsis and Synechocystis (Figure
1.3; Shintani and DellaPenna, 1998; Collakova and DellaPenna, 2001; Schledz et al.,
2001; Porfirova et al., 2002; Shintani et al., 2002; Cheng et al., 2003; Sattler et al., 2003).
These mutants only affect tocopherol synthesis and therefore provide ideal systems to
directly and specifically investigate tocopherol functions in photosynthetic organisms.
The Arabidopsis yitamin g 2 (vte2) mutant and Synechocytis slr1736 are defective in the
HPT enzyme and lack all tocopherols and the pathway intermediates (Figure 1.3;
Collakova and DellaPenna, 2001; Sattler et al., 2004). The vte2 mutants are severely
impaired in seed longevity and early seedling development due to the massive and
Uncontrolled peroxidation of storage lipids (Sattler et al., 2004). This lipid-soluble
antioxidant function of tocopherols during seed storage and early seedling development
has provided a strong selection pressure for tocopherol biosynthesis during the evolution

of Seed plants (Sattler et al., 2004). Interestingly, the vte2 mutants that do survive early

21

seedling development are virtually indistinguishable from wild type under Standard
growth conditions, suggesting that tocopherols are dispensable in mature plants in the
absence of stress (Sattler et al., 2004). Similarly, the growth and photosynthetic 02
evolution rates Of the Synechocystis slrl 736 mutant were also similar to wild type under
standard photoautotrophic growth condition (Collakova and DellaPenna, 2001). These
data suggest that a primary function Of tocopherols in plants is to control non-enzymatic
lipid oxidation during seed storage and early germination and that the absence of
tocopherols has no major impact on the growth of photosynthetic cells and tissues under
normal conditions.

The vtel and slr1737 mutants of Arabidopsis and Synechocystis, respectively, are
defective in the tocopherol cyclase enzyme, deficient in all tocopherols but, unlike vte2,
accumulate the redox active biosynthetic intermediate 2,3-dimethyl-6-phytyl-l,4-
benzoquinol (DMPBQ) (Figure 1.3; Porfirova et al., 2002; Sattler et al., 2003). The
Arabidopsis vtel mutant is virtually identical to the wild type under standard growth
condition and also in response to short-term cold or heat stresses (Porfirova et al., 2002;
Bergmuller et al., 2003; Sattler et al., 2004). Under moderate HL stress (850 nmol
photons m‘2 s"), We] showed a slight reduction in chlorophyll content and P811 quantum
yield (Porfirova et al., 2002). Interestingly, the dramatic vte2 seedling phenotype was
Completely attenuated in vtel, indicating that the DMPBQ accumulated by vte] fully

COmpensates for tocopherols in seedlings (Sattler et al., 2004). This compensation by
DMPBQ in the vtel mutant also suggested that the vte] and vte2 phenotypes have to be
Cal'efully assessed in order to differentiate between effects caused specifically by the

abSence of tOCOpherols from those due to the accumulation of DMPBQ.

22

A maize tocopherol cyclase mutant (sxdl , sucrose egrport defective l) was identified
several years prior to Arabidopsis We] not due to its impact on toc0pherol synthesis but
as a dwarf mutant accumulating carbohydrates and anthocyanins in source leaves. The
formation Of aberrant plasmodesmata between bundle sheath and vascular parenchyma
cells in the mutant suggested blockage in symplastic photoassimilate translocation leads
to an impaired sugar export from source leaves (Russin et al., 1996). Cloning of the
SXDI locus only implicated that the encoded protein is involved in a chloroplast-to-
nucleus Signaling required for plasmodesmata development (Provencher et al., 2001). It
was retrospectively demonstrated that SXDI encodes tocopherol cyclase and the maize
sde mutant is indeed tocopherol deficient (Sattler et al., 2003). The sxdl carbohydrate
accumulation phenotype is intriguing as it suggests an unexpected link between the
tocopherol pathway and primary carbohydrate metabolism, though the mechanism
involved is unknown. Interestingly, this carbohydrate phenotype did not occur in the
orthologous Arabidopsis vteI mutant (Sattler et al., 2003) but was Observed in VTEI

RNAi potato lines (Hofius et al., 2004).

Aim of This Study

In contrast to the extensively studied functions of tocopherols in animals, tocopherol
functions in photosynthetic organisms have been elusive, with the exception of defining
the lipid-soluble antioxidant function of tocopherols in seed longevity and early seedling
development. The purpose of this thesis study is to understand tocopherol functions in the
PhOtosynthetic tissues including plant leaves and cyanobacteria. To test the long-held

aSSUmption that tocopherols protect PUFA-enriched photosynthetic membranes from

23

oxidative stress, orthologous tocopherol biosynthetic mutants of Arabidopsis and
Synechocystis were subjected to a variety of abiotic stress and ROS—generating or lipid
peroxidation-inducing chemical stresses. Detailed phenotypic, biochemical and
ultrastructural characterization Of the responses uncovered unexpected roles for

tocopherols in photosynthetic tissues.

24

REFERENCES

Addlesee HA, Gibson LCD, Jensen PE, Hunter CN (1996) Cloning, sequencing and
functional assignment of the chlorophyll biosynthesis gene, chlP, of Synechocystis
sp PCC 6803. FEBS Lett 389: 126-130

Alscher RG, Erturk N, Heath LS (2002) Role of superoxide dismutases (SODs) in
controlling oxidative stress in plants. J Exp Bot 53: 1331-1341

Anderson JM (1986) Photoregulation of the composition, function, and structure of
thylakoid membranes. Annu Rev Plant Physiol Plant Mol Biol 37: 93-136

Apel K, Hirt H (2004) Reactive oxygen species: Metabolism, oxidative stress, and signal
transduction. Annu Rev Plant Biol 55: 373-399

Asada K (1999) The water-water cycle in chloroplasts: Scavenging Of active oxygens
and dissipation of excess photons. Annu Rev Plant Physiol Plant Mol Biol 50: 601-
639

Austin JR, Frost E, Vidi PA, Kessler F, Staehelin LA (2006) Plastoglobules are
lipoprotein subcompartments of the chloroplast that are permanently coupled to
thylakoid membranes and contain biosynthetic enzymes. Plant Cell 18: 1693-1703

Awad JA, Morrow JD, Hill KE, Roberts LJ, Burk RF (1994) Detection and
localization of lipid-peroxidation in selenium-deficient and Vitamin-E-deficient rats
using F-2-Isoprostanes. J Nutr 124: 810-816

Baroli I, Do AD, Yamane T, Niyogi KK (2003) Zeaxanthin accumulation in the absence
of a functional xanthophyll cycle protects Chlamydomonas reinhardtii from
photooxidative stress. Plant Cell 15: 992-1008

Baroli I, Gutman BL, Ledford HK, Shin JW, Chin BL, Havaux M, Niyogi KK
(2004) Photo-oxidative stress in a xanthophyll-deficient mutant of Chlamydomonas.
J Biol Chem 279: 6337-6344

Bauwe H, Kolukisaoglu U (2003) Genetic manipulation of glycine decarboxylation. J
Exp Bot 54: 1523-1535

Bergmuller E, Porfirova S, Dormann P (2003) Characterization of an Arabidopsis
mutant deficient in gamma-tocopherol methyltransferase. Plant Mol Biol 52: 1181-

1190

Berlett BS, Stadtman ER (1997) Protein oxidation in aging, disease, and oxidative
stress. J Biol Chem 272: 20313-20316

25

Bramley PM, Elmadfa I, Kafatos A, Kelly FJ, Manios Y, Roxborough HE, Schuch
W, Sheehy PJA, Wagner KH (2000) Vitamin E. J Sci Food Agric 80: 913-938

Brigelius-Flohe R, Kelly FJ, Salonen JT, Neuzil J, Zingg JM, Azzi A (2002) The
European perspective on Vitamin E: current knowledge and future research. Am J
Clin Nutr 76: 703-716.

Brigelius-Flohe R, Traber MG (1999) Vitamin E: function and metabolism. FASEB J
13: 1145-1155.

Broin M, Cuine S, Eymery F, Rey P (2002) The plastidic 2-cysteine peroxiredoxin is a
target for a thioredoxin involved in the protection of the photosynthetic apparatus
against oxidative damage. Plant Cell 14: 1417-1432

Browse J, Xin ZG (2001) Temperature sensing and cold acclimation. Curr Opin Plant
Biol 4: 241-246

Bucke C (1968) Distribution and stability of alpha-tocopherol in subcellular fractions of
broad bean leaves. Phytochemistry 7: 693-700

Burrows PA, Sazanov LA, Svab Z, Maliga P, Nixon PJ (1998) Identification of a
functional respiratory complex in chloroplasts through analysis of tobacco mutants
containing disrupted plastid ndh genes. EMBO J 17: 868-876

Burton GW (1994) Vitamin-E - Molecular and biological function. Proc Nutr Soc 53:
251-262

Burton GW, Ingold KU (1981) Autoxidation of biological molecules .1. The antioxidant

activity Of Vitamin-E and related chain-breaking phenolic antioxidants in Vitro. J Am
Chem Soc 103: 6472-6477

Carr NG, Hallaway M (1965) Presence Of alpha-tocopherolquinone in blue-green algae.
Biochem J 97: C9-&

Chandra V, Jasti J, Kaur P, Betzel C, Srinivasan A, Singh TP (2002) First structural
evidence of a specific inhibition of phospholipase A2 by alpha-tocopherol (vitamin
E) and its implications in inflammation: Crystal structure of the complex formed

between phospholipase A(2) and alpha-tocopherol at 1.8 angstrom resolution. J Mol
Biol 320: 215-222

Charron JBF, Ouellet F, Pelletier M, Danyluk J, Chauve C, Sarhan F (2005)
Identification, expression, and evolutionary analyses of plant lipocalins. Plant

Physiol 139: 2017-2028

Cheng ZG, Sattler S, Maeda H, Sakuragi Y, Bryant DA, DellaPennaa D (2003)
Highly divergent methyltransferases catalyze a conserved reaction in tocopherol and

26

plastoquinone synthesis in cyanobacteria and photosynthetic eukaryotes. Plant Cell
15: 2343-2356

Chew 0, Whelan J, Millar AH (2003) Molecular definition of the ascorbate-glutathione
cycle in Arabidopsis mitochondria reveals dual targeting of antioxidant defenses in
plants. J Biol Chem 278: 46869-46877

Chinnusamy V, Ohta M, Kanrar 8, Lee BH, Hong XH, Agarwal M, Zhu JK (2003)
ICEl: a regulator of cold-induced transcriptome and freezing tolerance in
Arabidopsis. Gene Dev 17 : 1043-1054

Collakova E, DellaPenna D (2001) Isolation and functional analysis of homogentisate
phytyltransferase from Synechocystis sp. PCC 6803 and Arabidopsis. Plant Physiol
127: 1113-1124

Collakova E, DellaPenna D (2003) The role Of homogentisate phytyltransferase and
other tocopherol pathway enzymes in the regulation of tocopherol synthesis during
abiotic stress. Plant Physiol 133: 930-940

Cruz JA, Avenson TJ, Kanazawa A, Takizawa K, Edwards GE, Kramer DM (2005)
Plasticity in light reactions of photosynthesis for energy production and
photoprotection. J Exp Bot 56: 395-406

Dahnhardt D, Falk J, Appel J, van der Kooij TAW, Schulz-Friedrich R, Krupinska
K (2002) The hydroxyphenylpyruvate dioxygenase from Synechocystis sp PCC
6803 is not required for plastoquinone biosynthesis. FEBS Lett 523: 177-181

Dasilva EJ, Jensen A (1971) Content of alpha-tocopherol in some blue-green algae.
Biochim Biophys Acta 239: 345-&

Dharlingue A, Camara B (1985) Plastid enzymes of terpenoid biosynthesis -
Purification and characterization of gamma-tocopherol methyltransferase from
Capsicum chromoplasts. J Biol Chem 260: 5200-5203

Dietz KJ (2003) Plant peroxiredoxins. Annu Rev Plant Biol 54: 93-107
Dietz KJ, Jacob S, Oelze ML, Laxa M, Tognetti V, dc Miranda SMN, Baier M,
Finkemeier I (2006) The function of peroxiredoxins in plant organelle redox

metabolism. J Exp Bot 57: 1697-1709

Diplock AT, Lucy JA (1973) Biochemical modes of action of vitamin-E and selenium -
hypothesis. FEBS Lett 29: 205-210

Erin AN, Spirin MM, Tabidze LV, Kagan VE (1984) Formation of alpha-tocopherol

complexes with fatty-acids - a hypothetical mechanism of stabilization of
biomembranes by Vitamin-E. Biochim Biophys Acta 774: 96-102

27

Evans HM, Bishop KS (1922) On the existence of a hitherto unrecognized dietary factor
essential for reproduction. Science 56: 650-651

Fahrenholtz SR, Doleiden FH, Trozzolo AM, Lamola AA (1974) Quenching Of singlet
oxygen by alpha-toc0pherol. Photochem Photobiol 20: 505-509

F ernholz E (1938) On the constitution of alpha-tocopherol. J Am Chem Soc 60: 700-705
Foreman J, Demidchik V, Bothwell JHF, Mylona P, Miedema H, Torres MA,
Linstead P, Costa 8, Brownlee C, Jones JDG, Davies JM, Dolan L (2003)

Reactive oxygen species produced by NADPH oxidase regulate plant cell growth.
Nature 422: 442-446

Fowler 8, Thomashow MF (2002) Arabidopsis transcriptome profiling indicates that
multiple regulatory pathways are activated during cold acclimation in addition to the
CBF cold response pathway. Plant Cell 14: 1675-1690

Foyer CH, Noctor G (2005) Redox homeostasis and antioxidant signaling: A metabolic
interface between stress perception and physiological responses. Plant Cell 17:
1866-1875

Foyer CH, Vanacker H, Gomez LD, Harbinson J (2002) Regulation of photosynthesis
and antioxidant metabolism in maize leaves at optimal and chilling temperatures:
review. Plant Physiol Bioch 40: 659-668

Fryer MJ (1992) The antioxidant effects of thylakoid vitamin-E (alpha- tocopherol).
Plant Cell Environ 15: 381-392

Fukuzawa K, Inokami Y, Tokumura A, Terao J, Suzuki A (1998) Rate constants for
quenching singlet oxygen and activities for inhibiting lipid peroxidation of
carotenoids and alpha-tocopherol in liposomes. Lipids 33: 751-756

Furuya T, Yoshikaw‘a T, Kimura T, Kaneko H (1987) Studies on plant-tissue
cultures .49. production of tocopherols by cell-culture of safflower. Phytochemistry
26: 2741-2747

Gaber A, Tamoi M, Takeda T, Nakano Y, Shigeoka S (2001) NADPH-dependent
glutathione peroxidase-like proteins (pr-l, pr-2) reduce unsaturated fatty acid
hydroperoxides in Synechocystis PCC 6803. FEBS Lett 499: 32-36

Garcia 1, Rodgers M, Lenne C, Rolland A, Sailland A, Matringe M (1997)
Subcellular localization and purification of a p-hydroxyphenylpyruvate dioxygenase
from cultured carrot cells and characterization of the corresponding cDNA. Biochem

J 325: 761-769

28

Garrison WM (1987) Reaction-mechanisms in the radiolysis of peptides, polypeptides,
and proteins. Chem Rev 87: 381-398

Gombos Z, Kanervo E, Tsvetkova N, Sakamoto T, Aro EM, Murata N (1997)
Genetic enhancement of the ability to tolerate photoinhibition by introduction of
unsaturated bonds into membrane glycerolipids. Plant Physiol 115: 551-559

Gomez-Merino FC, Brearley CA, Ornatowska M, Abdel-Haliem MEF, Zanor MI,
Mueller-Roeber B (2004) AtDGK2, a novel diacylglycerol kinase from Arabidopsis
thaliana, phosphorylates 1-stearoyl-2-arachidonoyl-sn-glycerol and 1,2-dioleoyl-sn-
glycerol and exhibits cold-inducible gene expression. J Biol Chem 279: 8230-8241

Grams GW, Eskins K (1972) Dye-sensitized photooxidation of tocopherols -

Correlation between singlet oxygen reactivity and Vitamin-E activity. Biochemistry
11: 606-&

Grasses T, Grimm B, Koroleva 0, Jahns P (2001) Loss of alpha-tocopherol in tobacco
plants with decreased geranylgeranyl reductase activity does not modify
photosynthesis in optimal growth conditions but increases sensitivity to high-light
stress. Planta 213: 620-628

Grau A, Ortiz A (1998) Dissimilar protection of tocopherol isomers against membrane
hydrolysis by phospholipase A2. Chem Phys Lipids 91: 109-118

Ham AJL, Liebler DC (1995) Vitamin-E oxidation in rat-liver mitochondria.
Biochemistry 34: 5754-5761

Ham AJL, Liebler DC (1997) Antioxidant reactions of vitamin E in the perfused rat

liver: Product distribution and effect of dietary vitamin E supplementation. Arch
Biochem Biophys 339: 157-164

Hannah MA, Heyer AG, Hincha DK (2005) A global survey of gene regulation during
cold acclimation in Arabidopsis thaliana. PLos Genet 1: 179-196

Havaux M, Bonfils JP, Lutz C, Niyogi KK (2000) Photodamage of the photosynthetic
apparatus and its dependence on the leaf developmental stage in the npql
Arabidopsis mutant deficient in the xanthophyll cycle enzyme Violaxanthin de—
epoxidase. Plant Physiol 124: 273-284

Havaux M, Lutz C, Grimm B (2003) Chloroplast membrane photostability in chlP
transgenic tobacco plants deficient in tocopherols. Plant Physiol 132: 300-310

Havaux M, Niyogi KK (1999) The Violaxanthin cycle protects plants from

photooxidative damage by more than one mechanism. Proc Natl Acad Sci USA 96:
8762-8767

29

Heber U, Heldt HW (1981) The chloroplast envelope - Structure, function, and role in
leaf metabolism. Annu Rev Plant Physiol Plant Mol Biol 32: 139-168

Hincha DK (2002) Cryoprotectin: a plant lipid-transfer protein homologue that stabilizes
membranes during freezing. Philos Trans Royal Soc London 357: 909-915

Hofius D, Hajirezaei MR, Geiger M, Tschiersch H, Melzer M, Sonnewald U (2004)
RNAi-mediated tocopherol deficiency impairs photoassimilate export in transgenic
potato plants. Plant Physiol 135: 1256-1268

Holt NE, Fleming GR, Niyogi KK (2004) Toward an understanding of the mechanism
of nonphotochemical quenching in green plants. Biochemistry 43: 8281-8289

Horvath EM, Peter 80, J oet T, Rumeau D, Cournac L, Horvath GV, Kavanagh TA,
Schafer C, Peltier G, Medgyesy P (2000) Targeted inactivation of the plastid nth
gene in tobacco results in an enhanced sensitivity of photosynthesis to moderate
stomata] closure. Plant Physiol 123: 1337-1349

Horvath G, Wessjohann L, Bigirimana J, Jansen M, Guisez Y, Caubergs R,
Horemans N (2006) Differential distribution Of tocopherols and tocotrienols in
photosynthetic and non-photosynthetic tissues. Phytochemistry 67: 1185-1195

Hosomi A, Arita M, Sato Y, Kiyose C, Ueda T, Igarashi 0, Arai H, Inoue K (1997)
Affinity for alpha-tocopherol transfer protein as a determinant of the biological
activities of vitamin E analogs. FEBS Lett 409: 105- 108

Huner NPA, Oquist G, Sarhan F (1998) Energy balance and acclimation to light and
cold. Trends Plant Sci 3: 224-230

Igamberdiev AU, Lea PJ (2002) The role of peroxisomes in the integration of
metabolism and evolutionary diversity of photosynthetic organisms. Phytochemistry
60: 651-674

Janiszowska W, Korczak G (1980) The intracellular-distribution of tocopherols in
calendula-officinalis leaves. Phytochemistry 19: 1391-1392

Jiang K, Meng YL, Feldman LJ (2003) Quiescent center formation in maize roots is

associated with an auxin-regulated oxidizing environment. Development 130: 1429-
1438

Jiang Q, Ames BN (2003) Gamma-tocopherol, but not alpha-tocopherol, decreases
proinflammatory eicosanoids and inflammation damage in rats. FASEB Journal 17:
816-822

30

Jiang Q, Elson-Schwab I, Courtemanche C, Ames BN (2000) Gamma-tocopherol and
its major metabolite, in contrast to alpha-tocopherol, inhibit cyclooxygenase activity
in macrophages and epithelial cells. Proc Natl Acad Sci USA 97: 11494-11499

Jishage K, Arita M, Igarashi K, Iwata T, Watanabe M, Ogawa M, Ueda 0, Kamada
N, Inoue K, Arai H, Suzuki H (2001) alpha-tocopherol transfer protein is important

for the normal development of placental labyrinthine trophoblasts in mice. J Biol
Chem 276: 1669-1672

Joet T, Genty B, Josse EM, Kuntz M, Cournac L, Peltier G (2002) Involvement of a
plastid terminal oxidase in plastoquinone oxidation as evidenced by expression of
the Arabidopsis thaliana enzyme in tobacco. J Biol Chem 277: 31623-31630

Kagan VE (1989) Tocopherol stabilizes membrane against phospholipase-a, free fatty-
acids, and lysophospholipids. Ann NY Acad Sci 570: 121-135

KamaI-Eldin A, Appelqvist LA (1996) The chemistry and antioxidant properties of
tocopherols and tocotrienols. Lipids 31: 671-701

Kayden HJ, Traber MG (1993) Absorption, lipoprotein transport, and regulation of
plasma-concentrations of vitamin-E in humans. J Lipid Res 34: 343-358

Keles Y, Once] I (2002) Response of antioxidative defence system to temperature and
water stress combinations in wheat seedlings. Plant Sci 163: 783-790

Khanna S, Roy S, Ryu H, Bahadduri P, Swaan PW, Ratan RR, Sen CK (2003)
Molecular basis of Vitamin E action - Tocotrienol modulates lZ-lipoxygenase, a key
mediator of glutamate-induced neurodegeneration. J Biol Chem 278: 43508-43515

Konig J, Baier M, Horling F, Kahmann U, Harris G, Schurmann P, Dietz KJ (2002)
The plant-specific function of 2-Cys peroxiredoxin-mediated detoxification of

peroxides in the redox-hierarchy of photosynthetic electron flux. Proc Natl Acad Sci
USA 99: 5738-5743

Kramer DM, Avenson TJ, Edwards GE (2004) Dynamic flexibility in the light
reactions of photosynthesis governed by both electron and proton reactions. Trends
Plant Sci 9: 349-357

Krapp A, Stitt M (1995) An Evaluation of direct and indirect mechanisms for the sink-
regulation of photosynthesis in spinach - changes in gas-exchange, carbohydrates,

metabolites, enzyme-activities and steady-state transcript levels after cold-girdling
source leaves. Planta 195: 313-323

Kulheim C, Agren J, Jansson S (2002) Rapid regulation of light harvesting and plant
fitness in the field. Science 297: 91-93

31

Kuntz M (2004) Plastid terminal oxidase and its biological significance. Planta 218:
896-899

Laloi C, Apel K, Danon A (2004) Reactive oxygen signalling: the latest news. Curr
Opin Plant Biol 7: 323-328

Laloi C, Przybyla D, Apel K (2006) A genetic approach towards elucidating the
biological activity of different reactive oxygen species in Arabidopsis thaliana. J Exp
Bot57: 1719-1724

Lamb C, Dixon RA (1997) The oxidative burst in plant disease resistance. Annu Rev
Plant Physiol Plant Mol Biol 48: 251-275

Lee BH, Henderson DA, Zhu JK (2005) The Arabidopsis cold-responsive
transcriptome and its regulation by lCEl. Plant Cell 17: 3155-3175

Li JY, Oulee TM, Raba R, Amundson RG, Last RL (1993) Arabidopsis flavonoid
mutants are hypersensitive to UV-B irradiation. Plant Cell 5: 171-179

Li XP, Bjorkman 0, Shih C, Grossman AR, Rosenquist M, Jansson 8, Niyogi KK
(2000) A pigment-binding protein essential for regulation of photosynthetic light
harvesting. Nature 403: 391-395

Li XP, Muller-Moule P, Gilmore AM, Niyogi KK (2002) PsbS-dependent
enhancement of feedback de-excitation protects photosystem II from photoinhibition.
Proc Natl Acad Sci USA 99: 15222-15227

Lichtenthaler HK (1998) The plants' l-deoxy-D-xylulose-S-phosphate pathway for
biosynthesis of isoprenoids. Fett-Lipid 100: 128-138

Lichtenthaler HK, Prenzel U, Douce R, Joyard J (1981) Localization of
prenquuinones in the envelope of spinach-chloroplasts. Biochim Biophys Acta 641:
99-105

Liebler DC, Burr JA (1992) Oxidation of vitamin-E during iron-catalyzed lipid-
peroxidation - evidence for electron-transfer reactions of the tocopheroxyl radical.
Biochemistry 31: 8278-8284

Littarru GP, Lippa S, Desole P, Oradei A, Dallatorre F, Macri M (1984) Quenching
of singlet oxygen by D-alpha-tocopherol in human-granulocytes. Biochem Biophys
Res Corn 119: 1056-1061

Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, Yamaguchi-Shinozaki K, Shinozaki

K (1998) Two transcription factors, DREBl and DREB2, with an EREBP/AP2
DNA binding domain separate two cellular signal transduction pathways in drought-

32

and low-temperature-responsive gene expression, respectively, in Arabidopsis. Plant
Cell 10: 1391-1406

Lucy JA (1972) Functional and Structural aspects of biological-membranes - Suggested

structural role for vitamin-E in control of membrane-permeability and stability. Ann
NY Acad Sci 203: 4-11

Lundmark M, Cavaco AM, Trevanion S, Hurry V (2006) Carbon partitioning and
export in transgenic Arabidopsis thaliana with altered capacity for sucrose synthesis

grown at low temperature: a role for metabolite transporters. Plant Cell Environ 29:
1703-1714

Lyons JM (1973) Chilling Injury in Plants. Annu Rev Plant Physiol Plant Mol Biol 24:
445-466

Machlin LJ, Filipski R, Nelson J, Horn LR, Brin M (1977) Effects of a prolonged
vitamin-E-deficiency in rat. J Nutr 107: 1200-1208

Maeda H, Sakuragi Y, Bryant DA, DellaPenna D (2005) Tocopherols protect
Synechocystis sp strain PCC 6803 from lipid peroxidation. Plant Physiol 138: 1422-
1435

Marnett LJ (1999) Lipid peroxidation - DNA damage by malondialdehyde. Mutat Res-
Fund Mol M 424: 83-95

Maxwell DP, Wang Y, McIntosh L (1999) The alternative oxidase lowers
mitochondrial reactive oxygen production in plant cells. Proc Natl Acad Sci USA
96: 8271-8276

May JM, Qu ZC, Mendiratta S (1998) Protection and recycling of alpha-tocopherol in
human erythrocytes by intracellular ascorbic acid. Arch Biochem Biophys 349: 281-
289.

McAinsh MR, Clayton H, Mansfield TA, Hetherington AM (1996) Changes in
stomatal behavior and guard cell cytosolic free calcium in response to oxidative

stress. Plant Physiol 111: 1031-1042

Mikami K, Murata N (2003) Membrane fluidity and the perception of environmental
signals in cyanobacteria and plants. Prog Lipid Res 42: 527-543

Mittler R (2002) Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci 7:
405-410

Mittler R, Vanderauwera S, Gollery M, Van Breusegem F (2004) Reactive oxygen
gene network of plants. Trends Plant Sci 9: 490-498

33

Moller IM (2001) Plant mitochondria and oxidative stress: Electron transport, NADPH

turnover, and metabolism of reactive oxygen species. Annu Rev Plant Physiol Plant
Mol Biol 52: 561-591

Muller P, Li XP, Niyogi KK (2001) Non-photochemical quenching. A response to
excess light energy. Plant Physiol 125: 1558-1566.

Mullineaux P, Karpinski S (2002) Signal transduction in response to excess light:
getting out of the chloroplast. Curr Opin Plant Biol 5: 43-48.

Munekaga Y, Hashimoto M, Miyaka C, Tomizawa KI, Endo T, Tasaka M, Shikanai
T (2004) Cyclic electron flow around photosystem I is essential for photosynthesis.
Nature 429: 579-582

Munekage Y, Hojo M, Meurer J, Endo T, Tasaka M, Shikanai T (2002) PGRS is
involved in cyclic electron flow around photosystem I and is essential for
photoprotection in Arabidopsis. Cell 110: 361-371

Munne-Bosch S, Alegre L (2002) The function of tocopherols and tocotrienols in plants.
Crit Rev Plant Sci 21: 31-57

Munne-Bosch S, Schwarz K, Alegre L (1999) Enhanced formation of alpha-tocopherol
and highly oxidized abietane diterpenes in water-stressed rosemary plants. Plant
Physi01121: 1047-1052

Niki E, Kawakami A, Saito M, Yamamoto Y, Tsuchiya J, Kamiya Y (1985)
Oxidation of lipids .10. Effect of phytyl side-chain of vitamin-E on its antioxidant
activity. J Biol Chem 260: 2191-2196

Nishida I, Murata N (1996) Chilling sensitivity in plants and cyanobacteria: The crucial
contribution of membrane lipids. Annu Rev Plant Physiol Plant Mol Biol 47: 541-
568

Niyogi KK (2000) Safety valves for photosynthesis. Curr Opin Plant Biol 3: 455-460.
Niyogi KK, Grossman AR, Bjorkman 0 (1998) Arabidopsis mutants define a central
role for the xanthophyll cycle in the regulation of photosynthetic energy conversion.

Plant Cell 10: 1121-1134

Noctor G, Foyer CH (1998) Ascorbate and glutathione: Keeping active oxygen under
control. Annu Rev Plant Physiol Plant Mol Biol 49: 249-279

Noctor G, Veljovic-Jovanovic S, Driscoll S, Novitskaya L, Foyer CH (2002) Drought

and oxidative load in the leaves Of C-3 plants: a predominant role for
photorespiration? Ann Bot-London 89: 841-850

34

Norris SR, Shen XH, DellaPenna D (1998) Complementation of the Arabidopsis pdsl
mutation with the gene encoding p-hydroxyphenylpyruvate dioxygenase. Plant
Physiol 117: 1317-1323

op den Camp RGL, Przybyla D, Ochsenbein C, Laloi C, Kim CH, Danon A,
Wagner D, Hideg E, Gobel C, Feussner I, Nater M, Apel K (2003) Rapid
induction of distinct stress responses after the release of singlet oxygen in
arabidopsis. Plant Cell 15: 2320-2332

Oquist G, Huner NPA (2003) Photosynthesis of overwintering evergreen plants. Annu
Rev Plant Biol 54: 329-355

Ort DR, Baker NR (2002) A photoprotective role for 0(2) as an alternative electron sink
in photosynthesis? Curr Opin Plant Biol 5: 193-198.

Overmyer K, Brosche M, Kangasjarvi J (2003) Reactive oxygen species and hormonal
control of cell death. Trends Plant Sci 8: 335-342

Pei ZM, Murata Y, Benning G, Thomine S, Klusener B, Allen GJ, Grill E,
Schroeder JI (2000) Calcium channels activated by hydrogen peroxide mediate
abscisic acid signalling in guard cells. Nature 406: 731-734

Peltier G, Cournac L (2002) Chlororespiration. Annu Rev Plant Biol 53: 523-550

Pentland AP, Morrison AR, Jacobs 8C, Hruza LL, Hebert J8, Packer L (1992)
Tocopherol analogs suppress arachidonic-acid metabolism via phospholipase
inhibition. J Biol Chem 267: 15578-15584

Plieth C, Hansen UP, Knight H, Knight MR (1999) Temperature sensing by plants: the
primary characteristics of signal perception and calcium response. Plant Journal 18:
491-497

Porfirova S, Bergmuller E, Tropf S, Lemke R, Dormann P (2002) Isolation of an
Arabidopsis mutant lacking Vitamin E and identification of a cyclase essential for all
tocopherol biosynthesis. Proc Natl Acad Sci USA 99: 12495-12500

Powls R, Redfearn ER (1967) Tocopherols of blue-green algae. Biochem J 104: C24-&

Pratico D, Tangirala RK, Rader DJ, Rokach J, FitzGerald GA (1998) Vitamin E
suppresses isoprostane generation in vivo and reduces atherosclerosis in ApoE-
deficient mice. Nat Med 4: 1189-1192

Provart NJ, Gil P, Chen WQ, Han B, Chang HS, Wang X, Zhu T (2003) Gene

expression phenotypes of Arabidopsis associated with sensitivity to low
temperatures. Plant Physiol 132: 893-906

35

Provencher LM, Miao L, Sinha N, Lucas WJ (2001) Sucrose export defectivel
encodes a novel protein implicated in chloroplast-to-nucleus signaling. Plant Cell
13: 1127-1141

Puhakainen T, Hess MW, Makela P, Svensson J, Heino P, Palva ET (2004)
Overexpression of multiple dehydrin genes enhances tolerance to freezing stress in
Arabidopsis. Plant Mol Biol 54: 743-753

Rhoads DM, Umbach AL, Subbaiah CC, Siedow JN (2006) Mitochondrial reactive
oxygen species. Contribution to oxidative stress and interorganellar signaling. Plant
Physiol 141: 357-366

Ricciarelli R, Tasinato A, Clement S, Ozer NK, Boscoboinik D, Azzi A (1998) alpha-
Tocopherol specifically inactivates cellular protein kinase C alpha by changing its
phosphorylation state. Biochem J 334: 243-249

Rimbach G, Minihane AM, Majewicz J, Fischer A, Pallauf J, Virgli F, Weinberg PD
(2002) Regulation of cell signalling by Vitamin E. Proc Nutr Soc 61: 415-425

Rippert P, Scimemi C, Dubald M, Matringe M (2004) Engineering plant shikimate

pathway for production of tocotrienol and improving herbicide resistance. Plant
Physiol 134: 92-100

Rise M, Cojocaru M, Gottlieb HE, Goldschmidt EE (1989) Accumulation of alpha-
tocopherol in senescing organs as related to chlorophyll degradation. Plant Physiol
89: 1028-1030

Ruelland E, Cantrel C, Gawer M, Kader JC, Zachowski A (2002) Activation of
phospholipases C and D is an early response to a cold exposure in Arabidopsis
suspension cells. Plant Physiol 130: 999-1007

Russin WA, Evert RF, Vanderveer PJ, Sharkey TD, Briggs SP (1996) Modification
of a specific class of plasmodesmata and loss of sucrose export ability in the sucrose
export defectivel maize mutant. Plant Cell 8: 645-658

Sakamoto T, Murata N (2002) Regulation of the desaturation of fatty acids and its role
in tolerance to cold and salt stress. Curr Opin Microbiol 5: 206-210

Sattler SE, Cahoon EB, Coughlan SJ, DellaPenna D (2003) Characterization of

tocopherol cyclases from higher plants and cyanobacteria. Evolutionary implications
for tocopherol synthesis and function. Plant Physiol 132: 2184-2195

Sattler SE, Gilliland LU, Magallanes-Lundback M, Pollard M, DellaPenna D (2004)

Vitamin E is essential for seed longevity, and for preventing lipid peroxidation
during germination. Plant Cell 16: 1419-1432

36

Savidge B, Weiss JD, Wong YHH, Lassner MW, Mitsky TA, Shewmaker CK, Post-
Beittenmiller D, Valentin HE (2002) Isolation and characterization of
homogentisate phytyltransferase genes from Synechocystis Sp PCC 6803 and
Arabidopsis. Plant Physiol 129: 321-332

Schledz M, Seidler A, Beyer P, Neuhaus G (2001) A novel phytyltransferase from
Synechocystis sp PCC 6803 involved in tocopherol biosynthesis. FEBS Lett 499:
15-20

Schneider C (2005) Chemistry and biology of vitamin E. Mol Nutr Food Res 49: 7-30
Schneider J C, Nielsen E, Somerville C (1995) A chilling-sensitive mutant of

Arabidopsis is deficient in chloroplast protein accumulation at low-temperature.
Plant Cell Environ 18: 23-31

Seki M, Narusaka M, Abe H, Kasuga M, Yamaguchi-Shinozaki K, Carninci P,
Hayashizaki Y, Shinozaki K (2001) Monitoring the expression pattern of 1300
Arabidopsis genes under drought and cold stresses by using a full-length cDNA
microarray. Plant Cell 13: 61-72

Sen CK, Khanna 8, Roy S, Packer L (2000) Molecular basis of vitamin E action -
Tocotrienol potently inhibits glutamate-induced pp60(c-Src) kinase activation and
death of HT4 neuronal cells. J Biol Chem 275: 13049-13055

Sheppard AJ, Pennington JAT, Weihrauch JL (1993) Analysis and distribution of
Vitamin E in vegetable Oils and foods. In L Packer, J Fuchs, eds, Vitamin E in health
and disease. Marcel Dekker, Inc., New York, Basel and Hong Kong, pp 9-31

Shih JCH, Jonas RH, Scott ML (1977) Oxidative deterioration of muscle proteins
during nutritional muscular-dystrophy in chicks. J Nutr 107: 1786-1791

Shikanai T, Endo T, Hashimoto T, Yamada Y, Asada K, Yokota A (1998) Directed
disruption of the tobacco nth gene impairs cyclic electron flow around
photosystem 1. Proc Natl Acad Sci USA 95: 9705-9709

Shinozaki K, Yamaguchi-Shinozaki K (2000) Molecular responses to dehydration and
low temperature: differences and cross-talk between two stress signaling pathways.
Curr Opin Plant Biol 3: 217-223

Shintani D, DellaPenna D (1998) Elevating the vitamin E content of plants through
metabolic engineering. Science 282: 2098-2100.

Shintani DK, Cheng Z, DellaPenna D (2002) The role of 2-methyl-6-
phytylbenzoquinone methyltransferase in determining tocopherol composition in
Synechocystis sp. PCC6803. FEBS Lett 511: 1-5.

37

Shulaev V, Oliver DJ (2006) Metabolic and proteomic markers for oxidative stress. New
tools for reactive oxygen species research. Plant Physiol 141: 367-372

Skinner WA, Sturm PA (1968) Investigation of algae and yeast for alpha-tocopherol
and alpha-tocopherolquinone content. Phytochemistry 7: 1893-&

8011 J, Douce R, Schultz G (1980) Site of biosynthesis of alpha-tocopherol in spinach-
chloroplasts. FEBS Lett 112: 243-246

8011 J, Kemmerling M, Schultz G (1980) Tocopherol and plastoquinone synthesis in
spinach-chloroplasts subfractions. Arch Biochem Biophys 204: 544-550

8011 J, Schultz G, Joyard J, Douce R, Block MA (1985) Localization and synthesis of
prenquuinones in isolated outer and inner envelope membranes from spinach-
chloroplasts. Arch Biochem Biophys 238: 290-299

Steponkus PL (1984) Role of the plasma-membrane in freezing-injury and cold-
acclimation. Annu Rev Plant Physiol Plant Mol Biol 35: 543-584

Steponkus PL, Uemura M, Joseph RA, Gilmour SJ, Thomashow MF (1998) Mode of
action of the COR15a gene on the freezing tolerance of Arabidopsis thaliana. Proc
Natl Acad Sci USA 95: 14570-14575

Stillwell W, Dallman T, Dumaual AC, Crump FT, Jenski LJ (1996) Cholesterol
versus alpha-tocopherol: Effects on properties of bilayers made from heteroacid
phosphatidylcholines. Biochemistry 35: 13353-13362

Stitt M, Hurry V (2002) A plant for all seasons: alterations in photosynthetic carbon
metabolism during cold acclimation in Arabidopsis. Curr Opin Plant Biol 5: 199-206.

Stockinger EJ, Gilmour SJ, Thomashow MF (1997) Arabidopsis thaliana CBFl
encodes an AP2 domain-containing transcriptional activator that binds to the C-
repeat/DRE, a cis-acting DNA regulatory element that stimulates transcription in

response to low temperature and water deficit. Proc Natl Acad Sci USA 94: 1035-
1040

Stoyanovsky DA, Osipov AN, Quinn PJ, Kagan VB (1995) Ubiquinone-dependent
recycling of vitamin-E radicals by superoxide. Arch Biochem Biophys 323: 343-351

Strand A, Hurry V, Gustafsson P, Gardestrom P (1997) Development of Arabidopsis
thaliana leaves at low temperatures releases the suppression of photosynthesis and

photosynthetic gene expression despite the accumulation of soluble carbohydrates.
Plant J 12: 605-614.

Strand A, Hurry V, Henkes S, Huner N, Gustafsson P, Gardestrom P, Stitt M (1999)
Acclimation of Arabidopsis leaves developing at low temperatures. Increasing

38

cytoplasmic volume accompanies increased activities of enzymes in the Calvin cycle
and in the sucrose-biosynthesis pathway. Plant Physiol 119: 1387-1398.

Suzuki 1, Los DA, Kanesaki Y, Mikami K, Murata N (2000) The pathway for
perception and transduction of low-temperature signals in Synechocystis. EMBO J
19: 1327-1334

Szabo I, Bergantino E, Giacometti GM (2005) Light and oxygenic photosynthesis:
energy dissipation as a protection mechanism against photo-oxidation. EMBO Rep
6: 629-634

Takeda AAS, dos Santos JI, Marcussi S, Silveira LB, Soares AM, Fontes MRM
(2004) Crystallization and preliminary X-ray diffraction analysis of an acidic
phospholipase A(2) complexed with p-bromophenacyl bromide and alpha-
tocopherol inhibitors at 1.9-and 1.45-A resolution. Biochim Biophys Acta 1699:
281-284

Tanaka R, Oster U, Kruse E, Rudiger W, Grimm B (1999) Reduced activity of
geranylgeranyl reductase leads to loss of chlorophyll and tocopherol and to partially
geranylgeranylated chlorophyll in transgenic tobacco plants expressing antisense
RNA for geranylgeranyl reductase. Plant Physiol 120: 695-704

Tappel AL (1962) Vitamin-E as the biological lipid antioxidant. Vitam Horm 20: 493-
510

Tappel AL (1972) Vitamin-E and free-radical peroxidation of lipids. Ann NY Acad Sci
203: 12-28

Thomashow MF (1999) Plant cold acclimation: Freezing tolerance genes and regulatory
mechanisms. Annu Rev Plant Physiol Plant Mol Biol 50: 571-599

Thompson JE, Froese CD, Madey E, Smith MD, Hong YW (1998) Lipid metabolism
during plant senescence. Prog Lipid Res 37 : 119-141

Tokuhisa JG, Feldmann KA, LaBrie ST, Browse J (1997) Mutational analysis of
chilling tolerance in plants. Plant Cell Environ 20: 1391-1400

Tokuhisa JG, Vijayan P, Feldmann KA, Browse JA (1998) Chloroplast development
at low temperatures requires a homolog of DIMl, a yeast gene encoding the 188
rRNA dimethylase. Plant Cell 10: 699-711

Torres MA, Dang] JL (2005) Functions of the respiratory burst oxidase in biotic
interactions, abiotic stress and development. Curr Opin Plant Biol 8: 397-403

39

Torres MA, Dangl JL, Jones JDG (2002) Arabidopsis gp91(phox) homologues
AtrbohD and Atrbth are required for accumulation of reactive oxygen

intermediates in the plant defense response. Proc Natl Acad Sci USA 99: 517-522

Traber MG, Ramakrishnan R, Kayden HJ (1994) Human plasma vitamin-E kinetics

demonstrate rapid recycling of plasma RRR-alpha-tocopherol. Proc Natl Acad Sci
USA 91: 10005-10008

Trebst A, Depka B, Hollander-Czytko H (2002) A specific role for tocopherol and of
chemical singlet oxygen quenchers in the maintenance of photosystem 11 structure
and function in Chlamydomonas reinhardtii. FEBS Lett 516: 156-160

Uemura M, Joseph RA, Steponkus PL (1995) Cold-acclimation of Arabidopsis-
thaliana - Effect on plasma-membrane lipid-composition and freeze-induced lesions.
Plant Physiol 109: 15-30

Uemura M, Steponkus PL (1997) Effect of cold acclimation on the lipid composition of
the inner and outer membrane of the chloroplast envelope isolated from rye leaves.
Plant Physiol 114: 1493-1500

Vidi PA, Kanwischer M, Baginsky 8, Austin JR, Csucs G, Dormann P, Kessler F,
Brehelin C (2006) Tocopherol cyclase (VTEl) localization and vitamin E

accumulation in chloroplast plastoglobule lipoprotein particles. J Biol Chem 281:
11225-11234

Vogel JT, Zarka DG, Van Buskirk HA, Fowler 8G, Thomashow MF (2005) Roles of

the CBF2 and ZAT12 transcription factors in configuring the low temperature
transcriptome of Arabidopsis. Plant J 41: 195-211

Wada H, Gombos Z, Murata N (1990) Enhancement of chilling tolerance of a
Cyanobacterium by genetic manipulation of fatty-acid desaturation. Nature 347:
200-203

Wada M, Kagawa T, Sato Y (2003) Chloroplast movement. Annu Rev Plant Biol: 455-
468

Wagner D, Przybyla D, Camp ROD, Kim C, Landgraf F, Lee KP, Wursch M, Laloi
C, Nater M, Hideg E, Apel K (2004) The genetic basis of singlet oxygen-induced
stress responses of Arabidopsis thaliana. Science 306: 1183-1185

Wang MY, Liehr JG (1995) Lipid hydroperoxide-induced endogenous DNA-adducts in
hamsters - Possible mechanism of lipid hydroperoxide-mediated carcinogenesis.
Arch Biochem Biophys 316: 38-46

Wang XY, Quinn PJ (2000) The location and function of vitamin E in membranes
(review). Mol Membr Biol 17: 143-156

40

Welti R, Li WQ, Li MY, Sang YM, Biesiada H, Zhou HE, Rajashekar CB, Williams
TD, Wang XM (2002) Profiling membrane lipids in plant stress responses - Role of
phospholipase D alpha in freezing-induced lipid changes in Arabidopsis. J Biol
Chem 277 : 31994-32002

Whistanc GR, Threlfal DR (1970) Biosynthesis Of phytoquinones - Homogentisic Acid
- a precursor of plastoquinones, tocopherols and alpha-tocopherolquinone in higher
plants, geen agae and bue-geen agae. Biochem J 117: 593-&

Wingler A, Lea PJ, Quick WP, Leegood RC (2000) Photorespiration: metabolic
pathways and their role in stress protection. Philos Trans Royal Soc London 355:
1517-1529

Winkel-Shirley B (2002) Biosynthesis of flavonoids and effects Of stress. Curr Opin
Plant Biol 5: 218-223

Wise RR, Naylor AW (1987) Chilling-enhanced photooxidation - Evidence for the role
of singlet oxygen and superoxide in the breakdown of pigments and endogenous
antioxidants. Plant Physiol 83: 278-282

Wojtaszek P (1997) Oxidative burst: An early plant response to pathogen infection.
Biochem J 322: 681-692

Yamauchi R, Matsushita S (1976) Quantitative changes in tocopherols and their
intracellular distribution in cotyledons accompanying with soybean germination. J
Agr Chem Soc Japan 50: 525-529

Yokota T, Igarashi K, Uchihara T, Jishage K, Tomita H, Inaba A, Li Y, Arita M,
Suzuki H, Mizusawa H, Arai H (2001) Delayed-onset ataxia in mice lacking alpha
-tocopherol transfer protein: model for neuronal degeneration caused by chronic
oxidative stress. Proc Natl Acad Sci USA 98: 15185-15190

Ytterberg AJ, Peltier JB, van Wijk KJ (2006) Protein profiling of plastoglobules in

chloroplasts and chromoplasts. A surprising site for differential accumulation of
metabolic enzymes. Plant Physiol 140: 984-997

41

FIGURES

 

      

 

 

 

 

 

H H isoprostanes
m R: I 1 ,R2 phytoprostanes
_ _ _ etc.
Fez” Fe3+ _o t I d'
5 pros ag an ms
”202% CH. L00 ‘5 E jasmonic acid
reaction 3. 5.
2. g .9
S g 95'
- s
o C -\
3 6"
‘0 or
ID
02 g R \ R2
R, H O-O
LOO' - \ .—
00
C H
O
a-tocopherol \E‘E
<
9.
o 75'
H D
O
3
(It-tocopheroxyl radical
H
0 OH 3
R1 H 0
LOOH — \ "" a-tocopherolquinone
OOH

Figure 1.1. Oxydation of Polyundaturated Fatty Acids and Lipid Peroxy Radical

Scavenging by Tocopherols.
PUFA, polyunsaturated fatty acid; H202, hydrogen peroxide; Fez”: ferrous iron; Fe“,

ferric iron; OH', hydroxy radical L', lipid radical; LOO', lipid peroxy radical; LOOH,
lipid hydroperoxide.

42

  
    

tocopherol]
tocotrienol R1 R2

Figure 1.2. The Structures of Tocopherols and Tocotrienols.
The table indicates the number and position of methyl groups present in a-, B-, y, or 8-

tocopherols/tocotrienols.

43

Shikimate pathway

1 MEP pathway
L-tyrosine 1
l l
HPP GGDP

FF? @133

f HGA PDP \
|_..... vteZ/slr1 73 6 cm

HO / H HO / H
WW3 m W3
MPBQ 0” DMPBQ

$ |-—-- vte1/slr1737Ho——:@
8-tocopherol ‘ y-tocopherol
om |——-3 vte4/sir0089 —-|

HO HO
O H o H
3 3

can-tocopherol

 

B-tocopherol

Figure 1.3. Tocopherol Biosynthetic Pathway and Mutants in Arabidopsis thaliana and
S ynechocystis sp. PCC6803.

Enzymes are indicated by black boxes and mutations by gray letters and lines. Bold arrows show
the primary biosynthetic route in wild type Arabidopsis leaves and Synechocystis. HPP,
hydroxyphenylpyruvate; GGDP, geranylgeranyl-diphosphate; PDP, phytyl-diphosphate; HGA,
homogentisic acid; MPBQ, 2-methyl-6-phytyl-1,4-benzoquinol; DMPBQ, 2,3-dimethyl-6-phytyl-
1,4—benzoquinol; MEP, 2-C-methyl-D-erythritol-4-phosphate ; HPPD, HPP dioxygenase; GGDR,
GGDP reductase; HPT, HGA phytyltransferase; TC, tocopherol cyclase; MT, MPBQ
methyltransferase; y-TMT, y-tocopherol methyltransferase; vtel, vte2 and vte4, mutants of TC,
HPT and y-TMT in Arabidopsis, respectively. slr1736, slr1737 and slr0089, mutants of TC, HPT

and y- TMT in Synechocystis,respectively.

44

CHAPTER 2: TOCOPHEROLS PROTECT S YNECHOC YSTIS SP. STRAIN PCC 6803

FROM LIPID PEROXIDATION.

The work presented in this chapter has been published:

Hiroshi Maeda, Yumiko Sakuragi, Donald A. Bryant and Dean DellaPenna (2005)

Plant Physiology 138, 1422-1435

Author’s contributions:

Yumiko Sakuragi generated the slr1736 mutant, participated in the initial growth
experiments and helped with manuscript review. Hiroshi Maeda conducted the remainder
Of the research and wrote the manuscript. Donald A. Bryant was involved in project

development and helped with manuscript review. Dean DellaPenna supervised the entire

project and was involved in all aspects of manuscript writing.

45

ABSTRACT

Tocopherols (Vitamin E) are lipid-soluble antioxidants only synthesized by
photosynthetic eukaryotes and some cyanobacteria, and have been assumed to play
important roles in protecting photosynthetic membranes from oxidative stress. To test this
hypothesis, tocopherol-deficient mutants of Synechocystis sp. strain PCC 6803 (slrl 736
and slrI737 mutants) were challenged with a series of reactive oxygen species (ROS)-
generating and lipid peroxidation-inducing chemicals in combination with high-light
(HL) intensity stress. The tocopherol-deficient mutants and wild type were
indistinguishable in their growth responses to BL in the presence and absence of
superoxide and singlet oxygen-generating chemicals. However, the mutants showed
enhanced sensitivity to linoleic or linolenic acid treatments in combination with HL,
consistent with tocopherols playing a crucial role in protecting Synechocystis sp. strain
PCC 6803 cells from lipid peroxidation. The tocopherol-deficient mutants were also more
susceptible to HL treatment in the presence of sub-lethal levels of norflurazon, an
inhibitor of carotenoid synthesis, suggesting carotenoids and tocopherols functionally
interact or have complementary or overlapping roles in protecting Synechocystis sp. strain

PCC 6803 from lipid peroxidation and HL stress.

INTRODUCTION

Oxygenic photosynthetic organisms continuously produce oxygen in the presence of light
and as such cellular damage from various reactive oxygen species (ROS), including
singlet oxygen ('02), superoxide (02'), hydrogen peroxide (H202), and the hydroxyl

radical (OH-), is a constant threat. Photosynthetic organisms have therefore evolved

46

extensive detoxifying and protective mechanisms, which both limit the production of and
potential damage by R08. Examples include superoxide dismutase (SOD) which reduces
02‘ to H202, ascorbate peroxidase which reduces H202 to H20, and non-photochemical
quenching (NPQ) that quenches singlet state chlorophylls (1Ch1*) and harmlessly
dissipates excessive excitation energy as heat, thereby reducing 102 production (Asada,

1999; Muller et al., 2001).

R08, such as OH-, can trigger a lipid peroxidation chain reaction by abstracting
an allylic hydrogen from polyunsaturated fatty acid (PUFA)-containing lipids producing
lipid radicals (L-) that are converted to lipid peroxyl radicals (LOO-) upon 02 addition.
LOO- can subsequently attack another PUFA generating a second LOO- and propagating
a chain reaction of lipid peroxidation that perturbs membrane structure and function
(Porter, 1986). Given the susceptibility of PUFAS to ROS damage, it seems counter-
intuitive that the PUFA-enriched thylakoid membranes would house the photosynthetic
machinery, a potential ROS generator. In contrast to the well-studied mechanisms Of
water-soluble ROS detoxification in photosynthetic organisms (Asada, 1999), the
mechanisms preventing or limiting oxidative damage in photosynthetic membranes are
less well understood. Several peroxiredoxins have been implicated in reducing lipid
hydroperoxides (LOOH) to the less toxic lipid hydroxides (LOH) in both plants and

C.‘i’anobacteria (Gaber et al., 2001; Dietz, 2003; Gaber et al., 2004). In Arabidopsis
thaliana and Chlamydomonas reinhardtii specific carotenoids have also been shown to
Play roles in limiting lipid peroxidation, presumably by direct scavenging of free radicals
(Havaux and Niyogi, 1999; Baroli et al., 2004). Tocopherols, a second major class of

lipid-soluble antioxidants in photosynthetic membranes, are also believed to play

47

important roles in this process (Fryer, 1992; Munne-Bosch and Alegre, 2002). However,
there is surprisingly little direct experimental evidence supporting such functions for

tocopherols in photosynthetic organisms.

Tocopherols consist of a polar chromanol head group attached to a hydrophobic
phytyl tail, both of which are critical to their roles as lipid-soluble antioxidants. Based on
studies in artificial and animal cell-derived membranes, tocopherols can efficiently
quench 1O2 and scavenge various radicals (Bramley et al., 2000). The chromanol ring of
tocopherols can reduce radicals by the donation of a single electron, resulting in the
formation of a relatively stable tocopheroxyl radical, which in animals can be recycled
back to the corresponding tocopherol by other antioxidants such as ascorbate or
coenzyme Q (Stoyanovsky et al., 1995; May et al., 1998). Subsequent donation Of a
second electron from the tocopheroxyl radical forms the non-radical product, tocopherol

quinone.

The tocopherol biosynthetic pathway has recently been fully elucidated in
Synechocystis sp. PCC 6803 (Figure 2.1) (Shintani and DellaPenna, 1998; Collakova and
DellaPenna, 2001; Schledz et al., 2001; Shintani et al., 2002; Cheng et al., 2003; Sattler et
al., 2003). Homogentisate phytyltransferase (HPT) catalyzes the committed step in
tocopherol synthesis by condensing homogentisate (HGA) and phytyl-diphosphate (PDP)
to produce 2-methy1-6-phytyl-1,4-benzoquinol (MPBQ). HGA is produced from
hydroxyphenylpyruvate (HPP) by HPP dioxygenase (HPPD). MPBQ is converted to 2,3-
dimethyl-6-phyty1-1,4-benzoquinol (DMPBQ) by MPBQ methyltransferase (MPBQ MT).
Both MPBQ and DMPBQ are substrates for tocopherol cyclase (TC) to produce 5- and y-

tocopherols, respectively, which are then converted to B- and Ot-tocopherols by y-

48

tocopherol methyltransferase (y-TMT). During analysis of the biosynthetic pathway in
Synechocystis Sp. PCC 6803, mutants disrupting each biosynthetic enzyme have been
isolated and characterized (Shintani and DellaPenna, 1998; Collakova and DellaPenna,
2001; Schledz et al., 2001; Shintani et al., 2002; Cheng et al., 2003; Sattler et al., 2003).
The tocopherol cyclase (slr1737) mutant lacks tocopherols entirely but accumulates the
quinonol intermediate, DMPBQ, whereas the HPT (slr1736) mutant lacks all tocopherols
and pathway intermediates (Figure 2.1) (Collakova and DellaPenna, 2001; Schledz et al.,

2001; Sattler et al., 2003).

We have utilized the slr1736 and slr1737 mutants to assess the roles that
tocopherols play in ROS homeostasis, membrane protection and how tocopherols are
functionally integrated into the antioxidant network. In the current study, these mutants
were challenged with combinations of chemicals and/or abiotic stresses to induce the
formation of different types of ROS, and the ability of the mutants to withstand these
stresses was evaluated. The increased sensitivity of tocopherol-deficient mutants to
specific treatments indicates that tocopherols play a crucial role in limiting lipid

peroxidation in Synechocystis sp. PCC 6803 in viva.

RESULTS
Growth of Tocopherol-Deficient Mutants under High Intensity Light and ROS-

Generating Conditions

The previously reported tocopherol-deficient Synechocystis sp. PCC 6803 mutants

containing gene disruptions in homogentisate phytyltransferase (slrl 736) and tocopherol

49

cyclase (slr1737) were originally isolated and maintained under photomixotrophic
conditions, i.e. on glucose-containing media (Collakova and DellaPenna, 2001; Sattler et
al., 2003). As described in the accompanying manuscript (Sakuragi et al., 2005), we now
know that photomixotrophic selection is lethal for both mutant lines due to a glucose-
sensitive phenotype that is a consequence of tocopherol deficiency. Thus, the original
slr1736 and slr1737 mutant lines isolated had varying genotypes and physiologies
presumably due to the unintentional selection of additional secondary suppressors of this
glucose-sensitive phenotype. When the aphII-containing kanamycin-resistance DNA
cartridge was reinserted into the slr1736 and slrl 73 7 genes of wild-type Synechocystis sp.
PCC 6803 and mutant selection was performed under photoautotrophic conditions, fully
segregated populations were Obtained that were genotypically and physiologically
homogenous (Sakuragi et al., 2005). These authentic, photoautotrophically-isolated
slr1736::aphII and slrl 737::aphII mutants were used under photoautotrophic conditions

for all experiments in the current study.

To test the susceptibility of tocopherol-deficient mutants to high-light (HL)
intensity stress, wild type (WT) and the slr1736 and slrl 737 mutants were initially grown
at a relatively low-light (LL) intensity for Synechocystis sp. PCC 6803 (15 11E m'2 s"),
the cells diluted to an appropriate density and transferred to HL (300 IE m'2 s"). As
shown in Figure 2.2A, HL had little impact on growth of the mutant lines in comparison

to WT, indicating tocopherols are dispensable under the HL stress conditions tested.

To investigate further the susceptibility Of tocopherol-deficient mutants to
additional oxidative stresses, various ROS-generating and stress-inducing chemicals were

applied in combination with HL treatment. Paraquat (methyl viologen) causes generation

50

of 02- by transferring electrons from the PSI iron-sulfur clusters to O2 (Fujii et al., 1990).

Treatment with 2 11M paraquat/HL (paraquat in combination with 300 1113 m'2 3’1 HL
treatment) slowed the growth of WT and the slr1736 and slr1737 mutants to the same
degree, while 5 uM paraquat/HL completely inhibited growth of all lines (Figure 2.28).
Similarly, treatment with a sub-lethal concentration (3 11M) of Rose Bengal, a 102-
generating photosensitizer, in HL also inhibited growth of WT and the slrI 736 mutant to
similar degrees (data not shown). These data suggest that tocopherols do not play an
essential role in detoxifying or tolerating the damage of 02' and 1O2 in Synechocystis sp.

PCC 6803, or that other compounds or enzymes can compensate for the lack of

tocopherols in this regard.

Sensitivity of Tocopherol-Deficient Mutants to Compounds that Enhance Lipid

Peroxidation

Tocopherols are known to play a crucial role in protecting animal cells from lipid
peroxidation (Ham and Liebler, 1995, 1997) and have been proposed to perform a similar
function in photosynthetic organisms (Fryer, 1992; Munne-Bosch and Alegre, 2002). To
test this hypothesis, a variety of chemicals were used to induce lipid peroxidation in WT
and the tocopherol deficient mutants. PUFAS, which are known to generate LOOH and
L000 by autoxidation reactions in the presence of oxygen (Porter, 1986), have been used
to induce lipid peroxidation in yeast (Do et al., 1996) and cyanobacteria (Sakamoto et al.,
1998). Linoleic acid (18:2A9’12) and linolenic acid (18:3A9'12'15), hereafter referred to as

18:2 and 18:3 respectively, were applied in combination with HL stress to WT and the

51

slrl 736 and slrl 737 mutants. In the presence of 10 11M 18:2/HL, growth of the slrl 736
mutant ceased after 20 h, whereas WT and the slrl 737 mutant were able to grow as well
as untreated controls (Figure 2.2C). Treatment with 10 11M 18:3/11L slowed the growth of
all strains similarly during the initial 20 h of growth. At later time points, WT growth
rates fully recovered, the slrl736 mutant ceased to grow while the slrl737 mutant
showed an intermediate growth rate (Figure 2.2D). These data indicate that the
tocopherol-deficient mutants are more susceptible to PUFA treatments than WT and that
in Synechocystis sp. PCC 6803 tocopherols play critical roles in protecting cells from
PUFA-induced stress. The intermediate phenotype of the slrl737 mutant, which lacks
tocopherols but accumulates the redox-active pathway intermediate DMPBQ, suggests
that DMPBQ can partially compensate for the absence of tocopherols under these

conditions.

Only the WT and slrl 736 mutant strains were used for subsequent analyses, and
the initial OD730 for growth experiments was increased from 0.05 OD730 to 0.5 0D730 in
order to Obtain sufficient cells for biochemical analyses. Dose-response curves indicated
the ten-fold increase in initial cell concentration required a corresponding increase in
PUFA treatment levels to impact growth Similarly (data not shown). Treatment of 0.5
0D730 cultures with 100 RM 18:3/HL slowed the growth of both the WT and slrl736
mutant Strains in the initial 20 h, while at later time points the slr1736 mutant ceased to
grow and growth of the WT recovered in a fashion similar to that observed in treating
0.05 OD730 cultures with 10 11M 18:3/11L (compare Figures 2.2D and 2.3C). The
monounsaturated fatty acid, oleic acid (1821”), hereafter refer to as 18:1, was used to test

whether the toxicity of 18:3 to the slrl 736 mutant was due to the presence of any free

52

fatty acid in the media (a “detergent effect”) or was specific to PUFAS. Both the WT and
slrl736 mutant strains were unaffected by treatment with 100 11M 18:1/HL (data not
shown) and were able to grow unaffectedly even in the presence of 500 uM 18:1/HL
(Figure 2.3E). These data indicate that the differential effects of 18:3 and 18:2 treatments
on the growth of the WT and slrl 736 mutant strains are due to the polyunsaturation of
these fatty acids. To test whether other PUFAS can also cause growth inhibition,

3AH‘M‘”), hereafter referred to as 20:3, was applied at 100 IIM, the

eicosatrienoic acid (20:
same concentration of 18:3 that impacted growth of the slrl 736 mutant. Surprisingly, 100
11M 20:3/11L did not show a toxic effect on either the WT or the slrl 736 mutant (Figure

2.3G). These data suggest that factors in addition to the degree of polyunsaturation

determine the toxicity of different PUFAS in the tocopherol-deficient mutants.

tert-Butyl hydroperoxide (t-BOOH) is a lipid-soluble hydroperoxide that has
been used to induce lipid peroxidation in yeast and animal cells (Masaki et al., 1989;
Pereira et al., 2003). Dose-response curves indicated growth Of both the WT and slrl 736
mutant strains were negatively impacted at 150 RM t-BOOH/HL while 200 MM was
lethal (data not Shown). Growth of the WT and the slrl 736 mutant strains in 150 11M t-
BOOH/HL was initially inhibited but both recovered rapidly to a similar extent (Figure
2.31), indicating that tocopherols are not essential for acclimation to t-BOOH induced

811688.

53

PUFA Treatments Increase Peroxides in the Growth Media

Because PUFA treatment has previously been shown to cause accumulation Of lipid
peroxides in yeast (Do et al., 1996) and the cyanobacterium Synechococcus sp. PCC 7002
(Sakamoto et al., 1998), the level of total peroxides in the growth media of WT and
slrl736 mutant strains during different treatments were measured using the ferrous
oxidation-xylenol orange (FOX) assay (Griffiths et al., 2000; Sattler et al., 2004) and
correlated with growth rates. LL, HL, and 18:1/HL treatments did not differentially affect
growth of the WT and slrl 736 mutant strains (Figures 2.3A and E) and did not increase
the peroxide levels of the media above background levels (Figures 2.3B and F). t-
BOOH/HL, 18:3/HL and 20:3/11L treatments all resulted in high levels of peroxides in
the media but had different impacts on growth. Media-peroxide levels in t-BOOH/HL
treated WT and slrl 736 mutant cells were elevated at 30 min, returned to background
levels by 4 h, but were much lower than in the absence of cells at all time points (Figure
23]). Therefore, it appears that both WT and the slrl 736 mutant can rapidly reduce t-
BOOH, which would explain the limited and similar impact of t-BOOH treatment on cell

growth of both lines (Figure 2.31).

Media-peroxide levels in cells treated with 18:3/HL and 20:3/11L were near
background levels at 30 min, increased to their highest levels by 4 or 8 h, and decreased
thereafter. In the absence of cells, media peroxide levels increased linearly in treatments
with both 18:3/11L and 20:3/HL (Figures 2.3D and H). The media peroxides produced
during the 18:3/11L treatment were separated into water and lipid phases and more than
90% of the total peroxides were found in the lipid phase (data not shown), indicating the

peroxides detected in the media are mainly lipid-derived peroxides. The media peroxide

54

levels of slrl 736 mutant cells treated with 18:3/11L and 20:3/HL were always equivalent
or higher than the levels in treated WT cells. However, despite the apparent correlation of
higher medium peroxide levels, especially at early time points, with more severe growth
inhibition in slrl 736 mutant cells treated with 18:3/HL, it is clear that media peroxide
levels are not the root cause of growth inhibition. Indeed, cells of the WT and the slrl 736
mutant treated with 20:3/HL had media peroxide profiles and levels similar to 18:3/HL
treated cells (Figure 2.3H); however, there was no impact on growth of either genotype
by 20:3 treatment (Figure 2.30). This suggests that other processes within the PUFA
treated cells, such as the differential incorporation and/or the oxidation of specific fatty

acids in membranes contribute to the observed growth inhibition of the slrl 736 mutant.

Incorporation of 18:3 and 20:3 Fatty Acids into Membrane Lipids

The possibility that the toxicity of 18:3/HL may associated with more efficient
uptake/incorporation of 18:3 into membranes in comparison to 20:3 was examined by
analyzing the esterified fatty acid composition of membrane lipids after 4 h of 18:3/HL
and 20:3/11L treatments. 18:3/HL and 20:3/11L treatments both resulted in increased
levels of esterified 18:3 and 2023, respectively, in both WT and the slrl736 mutant
relative to HL controls, though the increase from the 18:3/11L treatment was about three-
fold greater than that of 20:3/HL treatment (Figure 2.4). Some incorporated 18:3 also

appeared to be further desaturated to stearidonic acid (18:4‘36‘9‘12'15

) or elongated to 20:3.
As a consequence of the increased incorporation of 18:3 relative to 20:3, the total

membrane PUFA content in cells of both the WT and slrl736 mutant strains was

increased significantly by 18:3/11L treatment but only slightly by 20:3/11L treatment

55

relative to HL controls (Figure 2.4). These results suggest that differential lethality of
18:3/11L and 20:3/HL treatments in the slrl 736 mutant are associated with the more
efficient uptake/incorporation of 18:3 relative to 20:3. Because of carry over of
exogenously-applied free PUFAS in washed cell pellets, we were unable to assess the

relative free PUFA pool sizes of 18:3 and 20:3 treated WT and slrl 736 mutant cells.

Attempts were made to assess the cellular levels of lipid peroxidation by-
products, LOOH and LOH, in 18:3/HL-treated cells of the WT and slrl736 mutant
strains using the FOX assay (Griffiths et al., 2000) and HPLC analysis (Sattler et al.,
2004), respectively, but the results were inconclusive. LOOH and LOH levels in washed
cell pellets did increase several-fold in response to 18:3 and 20:3 treatments, but these
increases were highly variable and in all cases paralleled the LOOH and LOH levels
detected in the media. Therefore, as with analysis of cellular free PUFA levels, it appears
that the high background level of LOOH and LOH in the media of PUFA-treated cells
precludes distinguishing and quantifying lipid peroxidatiOn products that were

specifically generated in cells or cell membranes.

Changes in Carotenoids, Chlorophyll a, and Tocopherols during HL and 18:3/HL

Treatments

The effect of HL and 18:3/11L treatments on photosynthetic pigment composition
(carotenoids and chlorophyll a) and tocopherols were analyzed by HPLC. In the absence
of any treatment (LL grown cells), the total carotenoid and chlorophyll contents of the

WT and slrl 736 mutant strains were identical (Figures 2.5A and C at 0 h). Individual

56

carotenoid levels were also nearly identical with the exception of myxoxanthophyll and
zeaxanthin, which were slightly lower and higher, respectively in the slrl 736 mutant in
comparison to WT (Figure 2.6 A and C at 0 h). The total carotenoid content of HL treated
WT cells was unchanged during the first 20 b (Figure 2.5A) but there was a significant
increase in myxoxanthophyll and a corresponding decrease in zeaxanthin and echinenone
levels (Figures 2.6A, C and B). By 45 h the total carotenoid content of HL treated WT
had increased 20%, mostly due to an increase in myxoxanthophyll content (Figure 2.6A).
When WT was subjected to 18:3/HL treatment, the total carotenoid content decreased
slightly at 3 h (Figure 2.5A) due to small but significant decreases in myxoxanthophyll
and zeaxanthin (Figures 2.6B and D). Total carotenoid levels then increased at 20 h and
were 67 % higher by 45 b (Figure 2.58) due to a large increase in myxoxanthophyll
levels and smaller increases in zeaxanthin and beta-carotene (Figures 2.68, D and H).
These data indicate that carotenoid synthesis in WT is up-regulated in response to both

HL and 18:3/11L treatments.

The total carotenoid level of slrl 736 mutant cells treated with HL and 18:3/HL
were similar to WT for the initial 3 h of treatment and transiently increased at 20 h before
decreasing to approximately 80 % of the initial control level by 45 h (Figures 2.5A and
B). The decrease in total carotenoid levels in the slrl 736 mutant during HL treatment was
due almost entirely to a precipitous drop in myxoxanthophyll levels by 45 h (Figure
2.6A). This drop also occurred in the 18:3/11L treated slrl 736 mutant along with a severe
decrease in zeaxanthin levels (Figures 2.68 and D). This reduction in individual and total

carotenoid levels in HL-and 18:3/HL-treated slrI 736 mutant cells sharply contrasts with

57

WT and suggests that in the absence of tocopherols, specific carotenoids in the slrl 736

mutant cells undergo more rapid turnover/degradation than in WT cells.

The chlorophyll a contents of the WT and slrl 736 mutant cells during HL
treatment were very similar with the exception of 20 h, where the slrl 736 mutant showed
a transient increase (Figure 2.5C). This similarity in chlorophyll content is consistent with
the growth of WT and the slrl 736 mutant being indistinguishable in HL (Figure 2.3A).
When WT was subjected to 18:3/11L treatment, chlorophyll levels initially decreased
before recovering by 45 h, in parallel with the increase in total carotenoids (Figures 2.5B
and D). In contrast, the chlorophyll content of 18:3/HL-treated slrl736 mutant cells
continuously decreased at all time points to 46 % of the initial value by 45 b (Figure
2.5D), suggesting that impaired growth of the slrl736 mutant (Figure 2.3C) was
coincident with the loss of photosynthetic capacity as reflected by the lower chlorophyll

content.

The total tocopherol content was also measured in WT and slrl 736 mutant cells
subjected to HL and 18:3/HL treatment (Figures 2.5E and F). No tocopherols were
detected in the slrl 736 mutant cells at any time point or treatment, consistent with the
nature of the mutation. The tocopherol content of HL-treated WT was reduced
approximately 20 % at 3 and 20 h before recovering by 45 b. When WT cells were
subjected to 18:3/11L treatment, a more severe reduction in tocopherols was observed
after 3 h followed by a sharp increase at 20 and 45 h to twice the initial level. This initial
decrease followed by accelerated accumulation of tocopherols during 18:3/11L treatment
of WT suggests tocopherols play a key role in the response of Synechocystis sp. PCC

6803 to 18:3-induced oxidative stress.

58

Norflurazon/HL Treatment

The experiments described above (Figure 2.5A) further suggested a possible functional
interaction between carotenoids and tocopherols in Synechocystis sp. PCC 6803. To
assess any potential interaction, carotenoid synthesis was inhibited with norflurazon (NF),
a herbicide that specifically inhibits phytoene desaturase (Breitenbach et al., 2001; He et
al., 2001). Dose-response experiments indicated that grOwth of the slrl736 mutant was
much more sensitive to inhibition of carotenoid synthesis at levels as low as 5 IIM NF/HL
(Figure 2.7A). During treatment with 25 11M NF/HL, WT grew more slowly than HL
treatment alone but was still Viable, while growth of the slrl 736 mutant was completely
abolished after 30 b (Figure 278). Under LL conditions, treatments with 25 11M or 100
11M NF did not affect the growth of either WT or the slrl 736 mutant relative to untreated
cells (data not shown). These results indicate that, when Synechocystis sp. PCC 6803
cells are subjected to HL-stress, the simultaneous inhibition of both carotenoid and

tocopherol synthesis is more deleterious than inhibition of either pathway alone.

Pigment analyses during NF/HL treatment revealed that total carotenoid levels
decreased much faster in the slrl 736 mutant cells compared to WT cells (Figure 2.8A).
While both WT and the slrl 736 mutant reached a lower steady-state carotenoid level by
20 h of NF/HL treatment, the steady-state carotenoid level in the slrl736 mutant cells
was less than half that of WT cells. Chlorophyll levels were similar in the slrl 736 mutant
and WT up to 30 h (Figure 2.8B), but by 45 h the slrl 736 mutant had lost almost all

carotenoids and chlorophyll, while WT cells maintained a constant level of both. Because

59

carotenoid synthesis is presumably inhibited to the same degree by 25 11M NF treatment
in WT and the slrl 736 mutant, these results suggest that carotenoids were degraded more
rapidly during the NF/HL treatment in the absence of tocopherols; this loss of carotenoids
in turn led to bleaching and eventual death of the slrl 736 mutant cells. When individual
carotenoids were analyzed during NF/HL treatment all were found to decrease in both
WT and the slrl 736 mutant but myxoxanthophyll and beta-carotene decreased to lower
levels in the slrl 736 mutant than in WT (Figure 2.9). The combined results of NF/HL
treatment on growth and photosynthetic pigments demonstrate that tocopherols and

carotenoids play important and complementary roles in protecting Synechocystis sp. PCC

6803 cells from HL stress.

DISCUSSION

In contrast to the well-established roles of tocopherols in animals (Brigelius-Flohe and
Traber, 1999; Ricciarelli et al., 2002), assessing tocopherol functions in photosynthetic
organisms has only recently become experimentally approachable as a result of the
complete molecular dissection of the biosynthetic pathway and isolation of mutants in
cyanobacteria and plants (Shintani and DellaPenna, 1998; Collakova and DellaPenna,
2001; Schledz et al., 2001; Porfirova et al., 2002; Shintani et al., 2002; Cheng et al.,
2003; Sattler et al., 2003). The evolutionary conservation of tocopherol synthesis in
oxygenic phototrophs, the localization of tocopherols in photosynthetic membranes, and
the increased tocopherol accumulation in response to a variety of stresses suggest a key

role for tocopherols in photosynthetic organisms during stress (Munne-Bosch and Alegre,

60

2002; Collakova and DellaPenna, 2003). However, such lines of evidence are

circumstantial, and this hypothesis has not yet been rigorously tested.

Light is required for photosynthesis but light intensity in excess of that required
for photosynthesis can also create ROS resulting in oxidative damage to the photosystems.
Somewhat surprisingly, HL treatment did not differentially affect the growth (Figures
2.2A and 3A), membrane lipid fatty acid composition (Figure 2.4), or chlorophyll a
content (Figure 2.5C) of the tocopherol-deficient mutants and WT. The only observed
differences were total carotenoid levels, which, unlike WT, did not remain elevated in the
HL-treated cells of the slrl 736 mutant, primarily due to a severe drop in
myxoxanthophyll levels at 45 h (Figures 2.5A and 6A). The results are consistent with
those of another tocopherol-deficient mutant in Synechocystis sp. PCC 6803
(slr0090.°:aphII, disrupted mutant in the HPPD enzyme) which when grown at 500 11E m'
2 s'1 was also indistinguishable from WT (Dahnhardt et. al., 2002). These combined data
indicate that tocopherols are not essential for tolerating/acclimating to moderate (<500

11E m'2 s'l) HL conditions in Synechocystis sp. PCC 6803.

One could argue that the similar responses of HL-treated cells of the WT and the
tocopherol mutants are because the light intensity used (300 11E m'2 s") was not
sufficiently high to require tocopherol function(s), as treatment of Chlamydomonas
reinhardtii at 1500 RE m'2 s’1 with an herbicide that inhibits HPPD enzyme activity
reduced tocopherol levels to 20% of controls and induced concomitant degradation of the
D1 protein (Trebst et al., 2002). However, 300 IIE m'2 s'1 is three times the level needed

to saturate photosynthesis in Synechocystis sp. PCC 6803, and this condition has

61

previously been shown to up-regulate both high light-responsive and oxidative stress-
related genes (e.g. high-light-inducible proteins, SOD, and glutathione peroxidase)
(Hihara et al., 2001; Huang et al., 2002). Another plausible explanation is that other
components of the antioxidant network may mitigate ROS damage or compensate for the
lack of tocopherols in mutants under the conditions tested. Indeed, like most
photosynthetic organisms, Synechocystis sp. PCC 6803 contains multiple layers of ROS
defenses, including carotenoids, peroxiredoxins, SOD, and catalase-peroxidase (Kaneko
et al., 1996), some or all of which may mitigate any damage caused by the lack of
tocopherols under the HL conditions tested in this study. Future studies utilizing light
intensities approaching full sunlight (2000 11E m'2 3") may provide additional insights

into tocopherol functions in photosynthetic organisms.

In order to test the hypothesis that tocopherols play a critical role in tolerance to
specific types of ROS or ROS-induced damage, the tocopherol-deficient mutants and WT
were subjected to chemical treatments in combination with HL stress to generate different
types of ROS. WT and the tocopherol-deficient slrl 736 mutant did not show differential
sensitivity to treatment with the 1O2 generating compound Rose Bengal (data not shown).
Similarly, paraquat, a 02' generator, did not cause differential effects on the growth of
WT and tocopherol-deficient mutants (Figure 2.28). A Synechococcus sp. PCC 7942

mutant deficient in SOD showed enhanced sensitivity to paraquat at 100 1113 m'2 s",

demonstrating that SOD is essential for 02' detoxification at moderate light levels
(Thomas et al., 1998). These combined data suggest that tocopherols are not crucial for

02' or 102 detoxification/tolerance in Synechocystis sp. PCC 6803 under the conditions

tested.

62

Tocopherols have long been assumed to protect the membranes of oxygenic
phototrophs from oxidative stress. To assess this proposed function, the tocopherol-
deficient mutants and WT were subjected to treatments known to induce lipid
peroxidation. t-BOOH is an alkyl peroxide routinely used to induce lipid peroxidation in
other systems (Masaki et al., 1989; Pereira et al., 2003). Surprisingly, t-BOOH did not
differentially impact the slrl 736 mutant and WT (Figure 2.31), suggesting tocopherols
might not be essential in protecting Synechocystis sp. PCC 6803 cells from lipid
peroxidation. As the role of tocopherols as lipid peroxidation chain reaction terminators
is well established in vitro and in animal systems (Brigelius-Flohe and Traber, 1999;
Wang and Quinn, 2000), this would be most unexpected. The similar and extremely rapid
turnover of t-BOOH in the media of WT and the slrl 736 mutant (Figure 2.3J) instead
suggests that components other than tocopherols function very efficiently in both
genotypes to rapidly reduce t-BOOH levels in vivo. Five peroxiredoxins have been
characterized in Synechocystis sp. PCC 6803, and four of them, 8110755, Slrll7l,
Slr1992 and 8111621, have been shown to reduce t-BOOH efficiently in vitro when
expressed in Escherichia coli (Yamamoto et al., 1999; Gaber et al., 2001; Hosoya-
Matsuda et al., 2005). The expression of slrl I 71 and slr1992 are also induced in response
to HL (Huang et al., 2002), and it is likely that these peroxiredoxins confer the similar

resistance of WT and the slrl 736 mutant to t-BOOH treatment.

Unlike t-BOOH, the tocopherol-deficient mutants did Show enhanced sensitivity
to treatments with specific PUFAS. Treatment with 18:3 caused more severe growth
inhibition than 18:2, while 18:1 was non-toxic (Figures 2.2C, 2D, 3C, and 3E). These

results indicate that the extent of toxicity for eighteen-carbon fatty acids depends on the

63

degree of polyunsaturation. The results of growth curves and lipid peroxide analyses of
the growth media further suggested that oxidation of 18:2 and 18:3 in the medium might
be associated with their toxicity. However, in comparing the results from 18:3 and 20:3
treatments, which cause similar levels of lipid peroxides in the medium but have opposite
effects on growth (Figures 2.3C, D, G, and H), it is clear that lipid peroxide levels in the
medium per se are not the primary cause of 18:3 toxicity. The enhanced
uptake/incorporation of 18:3 fatty acids into cell membranes relative to 20:3 (Figure 2.4)
implies that the 18:3 treatment results in more severe lipid peroxidation inside the cell.
This could occur due to elevated levels of free or esterified PUFAS in membranes, either
of which could initiate or participate in enhanced auto-catalytic lipid peroxidation in the
mutants. Unfortunately, PUFA treatments resulted in such high background levels of free
PUFAS and lipid peroxides in media and cell pellets that it was not possible to
reproducibly quantify the levels of free PUFAS and esterified or non-esterified lipid
peroxidation by-products in PUFA-treated cells. As a consequence we were unable to
directly determine whether non-enzymatic or enzyme-mediated lipid oxidation (e.g.
lipoxygenases) was enhanced in membranes of tocopherol deficient mutants. Despite
these analytical limitations our results are consistent with the hypothesis that tocopherols

are critical in protecting Synechocystis sp. PCC 6803 from lipid peroxidation.

If tocopherols are crucial for protecting Synechocystis sp. PCC 6803 from lipid
peroxidation, why is the slrl 737 mutant less sensitive to PUFA/HL treatment than the
slrl 736 mutant (Figure 2.2), when both are deficient in tocopherols? The Arabidopsis
We] and vte2 mutants (equivalent to the slrl 73 7 and slrl 736 mutants, respectively) both

had reduced seed longevity but only vte2 exhibited early seedling developmental defects

64

and a greater than 100-fold increase in lipid peroxidation during germination (Sattler et
al., 2004). The attenuated phenotype of vte] relative to vte2 is consistent with the
attenuated phenotype of PUFA-treated slrl 737 relative to slrl 736 mutants (Figure 2.2)
and suggests that the quinol intermediate, DMPBQ, that accumulates in the vte] and
slrl737, but not in the vte2 and slrl736 mutants, functionally compensates for the
absence of tocopherols in many regards, most likely by acting as an alternative lipid-
soluble antioxidant. In this regard it is interesting to note that the Arabidopsis vtel mutant
accumulates slightly but significantly increased levels of glutathione and ascorbate even
in the absence of stress (Kanwischer et. al., 2005). Whether these water-soluble

antioxidants may also play a role in the attenuated phenotype of the We] is as yet unclear.

Carotenoids are the second major group of lipid-soluble antioxidants in
photosynthetic membranes and have been shown to play important roles in protecting
plant and green algae during photooxidative stress (Havaux and Niyogi, 1999; Baroli et
al., 2003; Baroli et al., 2004). However, with the exception of their structural roles in
photosystems, little work has been done to assess other physiological roles of carotenoids
in Synechocystis sp. PCC 6803. Prior studies have shown that two carotenoid biosynthetic
genes (slr1254 and slr0940) are up-regulated during HL stress in WT Synechocystis sp.
PCC 6803 (Huang et al., 2002), which is consistent with the Observed increase in the
levels of total and specific carotenoid (myxoxanthophyll being the most prominent) in
WT in response to HL (Figures 2.5A and 6 A, G). In contrast, the slrl 736 mutant did not
Show corresponding increases in total or specific carotenoids during HL and 18:3/11L

treatments. These data indirectly but strongly suggest that carotenoids, most likely

65

myxoxanthophyll, are involved in the adaptation/tolerance of Synechocystis sp. PCC

6803 to HL stress and functionally interact with or complement tocopherols.

To assess further the role of carotenoids in adapting to HL stress and any
functional interactions between tocopherols and carotenoids, carotenoid synthesis was
partially inhibited in WT and the tocopherol-deficient slrl 736 mutant by treatment with
NF/HL. Phytoene desaturase (Slr1254), one of two carotenoid biosynthetic enzymes
induced in response to HL (Huang et al., 2002), is the enzymatic target of NF
(Breitenbach et al., 2001). Treatment with 25 11M NF in HL slowed the growth of WT but
had a much more severe impact on growth of the tocopherol-deficient slrl 736 mutant
(Figure 2.78). NF-treated slrl736 mutant cells also had a steady-state level of
carotenoids half that of WT (Figure 2.8A), mainly due to lower levels of
myxoxanthophyll and beta-carotene (Figure 2.9). Assuming NF inhibits carotenoid
synthesis to a similar degree in both mutant and WT, the higher steady-state level of total
carotenoids and better growth rate of WT during NF treatment is due to the presence of
tocopherols. These data clearly demonstrate that carotenoids are a key component
compensating for the absence of tocopherols during HL stress in the mutant cells.
Introduction of other mutations that affect the levels of individual carotenoid species
(FemandezGonzalez et al., 1997; Lagarde and Verrnaas, 1997; Mohamed and Verrnaas,
2004) into the tocopherol-deficient mutant background will further clarify the role(s) of
individual carotenoids in the adaptation/tolerance of Synechocystis sp. PCC 6803 to HL

stress in the absence of tocopherols.

In summary, the enhanced sensitivity of tocopherol-deficient mutants of

Synechocystis sp. PCC 6803 to specific PUFAS provides physiological and biochemical

66

evidence that tocopherols are crucial in protecting oxygenic phototrophs from lipid
peroxidation in vivo. These data are consistent with a recent study of tocopherol-deficient
mutants of Arabidopsis, which have reduced seed longevity and early seedling
developmental defects due to greatly increased lipid peroxidation during germination in
the absence of tocopherols (Sattler et al., 2004). From the combined studies in these two
model photosynthetic organisms, it can be concluded that a primary function of
tocopherols in both eukaryotic and prokaryotic oxygenic photosynthetic organisms is to
protect cells from lipid peroxidation. Simultaneous inhibition of carotenoid and
tocopherol biosynthesis in Synechocystis sp. PCC 6803 clearly demonstrated the two
classes of lipid-soluble antioxidants functionally interact or have complementary roles
during HL stress. The overlapping functionality of tocopherols and carotenoids in
Synechocystis sp. PCC 6803 may explain why tocopherols appear to be dispensable
during moderate HL stress (up to 500 “E m'2 s'l) (Figures 2.2A and 3A) (Dahnhardt et al.,
2002). However, under extreme and specific stress conditions, such as during PUFA-
induced lipid peroxidation in HL, the absence of tocopherols can not be fully
compensated by carotenoids, and both lipid-soluble antioxidants are required for survival

of Synechocystis sp. PCC 6803.

MATERIALS AND METHODS

Chemicals

Oleic acid (181”), linoleic acid 082””), linolenic acid (18:3A9'12‘15), eicosatrienoic
acid (20:3A11’l4’17), tert-butyl hydroperoxide (t-BOOH), paraquat (methyl viologen), Rose

Bengal. butylated hydroxytoluene (BHT), and xylenol orange [o-cresolsulfonephthalein-

67

3,3’-bis(methylimino-diacetic acid)sodium salt] were purchased from Sigma (St. Louis).
Ferrous ammonium sulfate hexahydrate [Fe(NH4)2(SO4)2'6H20] was from Aldrich

(Germany). Norflurazon was from Chem Service Inc. (California).

Growth Conditions and Chemical Treatments

The construction, photoautotrophic selection and molecular and physiological
characterization of authentic slrl 736 and slrl 73 7 mutants of Synechocystis sp. strain PCC
6803 are described in detail in the accompanying manuscript (Sakuragi et al., 2005). WT
and mutant strains of Synechocystis sp. strain PCC 6803 were grown
photoautotrophically in liquid B-HEPES medium, which is BG-ll (Williams, 1988)
supplemented with 4.6 mM of HEPES (pH 8.0) and 18 mg L'1 ferric ammonium citrate.
Growth was at 32 °C with 1% (v/v) CO2 in air under constant illumination from cool-
white fluorescent lamps at 15 11E m'2 s’1 (low-light, LL) or 300 “E In2 S'1 (high-light,
HL). Light intensity was measured by a LI-250 Light meter (LI-COR Inc., Nebraska).
Cell growth was monitored by the optical density at 730 nm (OD730). For growth and
treatments in HL, exponentially growing LL cultures (OD730 = 0.7 to 1.0) were diluted to
0.05 or 0.5 of OD730 with fresh B-HEPES medium and transferred to the HL condition

described above.

Peroxide Analysis

The peroxide contents in media and cell pellets were measured using the ferrous

oxidation-xylenol orange (FOX) assay (Griffiths et al., 2000). Aliquots of cultures (500

68

III to 1 ml) were collected at different time points and centrifuged at 15,000 g for 5 min.
The supematants (60 III) were mixed with 540 III of FOX reagent [90% (v/v) methanol, 4
mM BHT, 25 mM sulfuric acid, 250 1.1M Fe(NH4)2(SO4)2, 100 pM xylenol orange], and
incubated for 20 min in darkness, and the A560 was measured. The peroxide content was

calculated based on a standard curve created by known concentrations of hydrogen

peroxide (J. T. Baker, New Jersey).

Lipid Composition Analysis

Cells were collected by centrifugation at 3,500 g for 15 min and lipid extracts were
prepared as previously described (Hara and Radin, 1978). Esterified fatty acids were
selectively methyl-esterified by KOH-catalyzed transesterification as described (Ichihara
et al., 1996). Fatty acid methyl esters (FAME) were quantified by gas-liquid
chromatography (GLC) using pentadecanoic acid (Sigma, St. Louis) as an internal

standard (Rossak et al., 1997).

Carotenoid, Chlorophyll a, and Tocopherol Analyses

The amount of cells equivalent to 10 ml of OD730 = 1.0 culture were collected by
centrifugation at 8,000 g for 5 min and washed twice with 25 mM HEPES buffer, pH 7.0.
Carotenoids and tocopherols were extracted in 500 111 of methanol with 1 mg ml’1 BHT at
4 °C. After centrifugation and filtration, one hundred microliters was subjected to HPLC
(Agilent 1100 series, Agilent, Wilmington, DE) on a Spherisorb ODS-2 5 pm, 250 x 4.6

mm reverse phase column (Column Engineering, Ontario, CA) using a 30 min gradient of

69

isopropanol (0-10 min, 0%; 10-20 min, 0 to 80%; 20-25 min, 80%; 25-30 min, 80 to 0%)
in methanol at a flow rate of 0.75 ml min'l. Photodiode array detection was used to
identify each carotenoid species and chlorophyll a by their characteristic absorption
spectra and their retention times relative to standards. Individual carotenoids and
chlorophyll a were quantified against a standard equation derived by injection of known
amounts of each purified compound. Tocopherols were detected by fluorescence using

290 nm excitation and 325 nm emission and quantified against standard curves generated

by commercially available tocopherols (ACROS ORGANICS, NJ).

ACKNOWLEDGMENTS

We thank Dr. Mike Pollard for his critical advice with the lipid analysis and members of

the Dr. DellaPenna laboratory for reviewing the manuscript.

70

REFERENCES

Asada K (1999) The water-water cycle in chloroplasts: Scavenging of active oxygens
and dissipation of excess photons. Annu Rev Plant Phys 50: 601-639

Baroli I, Do AD, Yamane T, Niyogi KK (2003) Zeaxanthin accumulation in the absence
of a functional xanthophyll cycle protects Chlamydomonas reinhardtii from
photooxidative stress. Plant Cell 15: 992-1008

Baroli I, Gutman BL, Ledford HK, Shin JW, Chin BL, Havaux M, Niyogi KK
(2004) Photo-oxidative stress in a xanthophyll-deficient mutant of Chlamydomonas.
J Biol Chem 279: 6337-6344

Bramley PM, Elmadfa I, Kafatos A, Kelly FJ, Manios Y, Roxborough HE, Schuch
W, Sheehy PJA, Wagner KH (2000) Vitamin E. J Sci Food Agric 80: 913-938

Breitenbach J, Zhu CF, Sandmann G (2001) Bleaching herbicide norflurazon inhibits
phytoene desaturase by competition with the cofactors. J Agr Food Chem 49: 5270-
5272

Brigelius-Flohe R, Traber MG (1999) Vitamin E: function and metabolism. FASEB J
13: 1145-1155

Cheng ZG, Sattler S, Maeda H, Sakuragi Y, Bryant DA, DellaPennaa D (2003)
Highly divergent methyltransferases catalyze a conserved reaction in tocopherol and

plastoquinone synthesis in cyanobacteria and photosynthetic eukaryotes. Plant Cell
15: 2343-2356

Collakova E, DellaPenna D (2001) Isolation and functional analysis of homogentisate
phytyltransferase from Synechocystis sp. PCC 6803 and Arabidopsis. Plant Physiol
127:1113-1124

Collakova E, DellaPenna D (2003) The role of homogentisate phytyltransferase and
other tocopherol pathway enzymes in the regulation of tocopherol synthesis during
abiotic stress. Plant Physiol 133: 930-940

Dahnhardt D, Falk J, Appel J, van der Kooij TAW, Schulz-Friedrich R, Krupinska
K (2002) The hydroxyphenylpyruvate dioxygenase from Synechocystis sp PCC 6803
is not required for plastoquinone biosynthesis. FEBS Lett 523: 177-181

Dietz KJ (2003) Plant peroxiredoxins. Annu Rev Plant Biol 54: 93-107

Do TQ, Shultz JR, Clarke CF (1996) Enhanced sensitivity of ubiquinone-deficient

mutants of Saccharomyces cerevisiae to products of autoxidized polyunsaturated
fatty acids. Proc Natl Acad Sci USA 93: 7534-7539

71

FernandezGonzalez B, Sandmann G, Vioque A (1997) A new type of asymmetrically
acting beta-carotene ketolase is required for the synthesis of echinenone in the
cyanobacterium Synechocystis sp. PCC 6803. J Biol Chem 272: 9728-9733

Fryer MJ (1992) The antioxidant effects of thylakoid vitamin-E (alpha-tocopherol).
Plant Cell Environ 15: 381-392

Fujii T, Yokoyama E, Inoue K, Sakurai H (1990) The sites of electron donation of
photosystem-I to methyl viologen. Biochim BiOphys Acta 1015: 41-48

Gaber A, Tamoi M, Takeda T, Nakano Y, Shigeoka S (2001) NADPH-dependent
glutathione peroxidase-like proteins (pr-l, pr-2) reduce unsaturated fatty acid
hydroperoxides in Synechocystis PCC 6803. FEBS Lett 499: 32-36

Gaber A, Yoshimura K, Tamoi M, Takeda T, Nakano Y, Shigeoka 8 (2004)
Induction and functional analysis of two reduced nicotinamide adenine dinucleotide
phosphate-dependent glutathione peroxidase-like proteins in Synechocystis PCC
6803 during the progression of oxidative stress. Plant Physiol 136: 2855-2861

Griffiths G, Leverentz M, Silkowski H, Gill N, Sanchez-Serrano JJ (2000) Lipid
hydroperoxide levels in plant tissues. J Exp Bot 51: 1363-1370.

Ham AJL, Liebler DC (1995) Vitamin-E oxidation in rat-liver mitochondria.
Biochemistry 34: 5754-5761

Ham AJL, Liebler DC (1997) Antioxidant reactions of Vitamin E in the perfused rat
liver: Product distribution and effect of dietary vitamin E supplementation. Arch
Biochem BiOphy 339: 157-164

Hara A, Radin NS (1978) Lipid extraction of tissues with a low-toxicity solvent. Anal
Biochem 90: 420-426

Havaux M, Niyogi KK (1999) The Violaxanthin cycle protects plants from
photooxidative damage by more than one mechanism. Proc Natl Acad Sci USA 96:
8762-8767

He QF, Dolganov N, Bjorkman 0, Grossman AR (2001) The high light-inducible
polypeptides in Synechocystis PCC6803 - Expression and function in high light. J
Biol Chem 276: 306-314

Hihara Y, Kamei A, Kanehisa M, Kaplan A, Ikeuchi M (2001) DNA microarray
analysis of cyanobacterial gene expression during acclimation to high light. Plant

Cell 13: 793-806

Hosoya-Matsuda N, Motohashi K, Yoshimura H, Nozaki A, Inoue K, Ohmori M,
Hisabori T (2005) Anti-oxidative stress system in cyanobacteria: Significance of

72

type II peroxiredoxin and the role of l-Cys peroxiredoxin in Synechocystis sp. strain
PCC 6803. J Biol Chem 280: 840-846

Huang LX, McCluskey MP, Ni H, LaRossa RA (2002) Global gene expression profiles
of the cyanobacterium Synechocystis Sp strain PCC 6803 in response to irradiation
with UV-B and white light. J Bacteriol 184: 6845-6858

Ichihara K, Shibahara A, Yamamoto K, Nakayama T (1996) An improved method
for rapid analysis of the fatty acids of glycerolipids. Lipids 31: 535-539

Kaneko T, Sato S, Kotani H, Tanaka A, Asamizu E, Nakamura Y, Miyajima N,
Hirosawa M, Sugiura M, Sasamoto 8, Kimura T, Hosouchi T, Matsuno A,
Muraki A, Nakazaki N, Naruo K, Okumura S, Shimpo S, Takeuchi C, Wada T,
Watanabe A, Yamada M, Yasuda M, Tabata S (1996) Sequence analysis of the
genome of the unicellular cyanobacterium Synechocystis sp. strain PCC6803. 11.
Sequence determination of the entire genome and assignment of potential protein-
coding regions. DNA Res 3: 109-136

Kanwischer M, Porfirova S, Bergmuller E, Dormann P (2005) Alterations in
tocopherol cyclase activity in transgenic and mutant plants of Arabidopsis affect
tocopherol content, tocopherol composition, and oxidative stress. Plant Physiol 137:
713-723

Lagarde D, Vermaas W (1997) The zeaxanthin biosynthesis enzyme beta-carotene
hydroxylase is involved in myxoxanthophyll synthesis in Synechocystis sp. PCC
6803. FEBS Lett 454: 247-251

Masaki N, Kyle ME, Farber JL (1989) Tert-butyl hydroperoxide kills cultured-
hepatocytes by peroxidizing membrane-lipids. Arch Biochem BiOphy 269: 390-399

May JM, Qu ZC, Mendiratta S (1998) Protection and recycling of alpha-tocopherol in
human erythrocytes by intracellular ascorbic acid. Arch Biochem BiOphy 349: 281-
289

Mohamed HE, Vermaas W (2004) Slr1293 in Synechocystis sp. strain PCC 6803 is the
C-3 ',4 ' desaturase (CrtD) involved in myxoxanthophyll biosynthesis. J Bacteriol
186: 5621-5628

Muller P, Li XP, Niyogi KK (2001) Non-photochemical quenching. A response to
excess light energy. Plant Physiol 125: 1558-1566

Munne-Bosch S, Alegre L (2002) The function of tocopherols and tocotrienols in plants.
Crit Rev Plant Sci 21: 31-57

Pereira MD, Herdeiro RS, Fernandes PN, Eleutherio ECA, Panek AD (2003) Targets
of oxidative stress in yeast sod mutants. Biochim Biophys Acta 1620: 245-251

73

Porfirova S, Bergmuller E, Tropf S, Lemke R, Dormann P (2002) Isolation of an
Arabidopsis mutant lacking vitamin E and identification of a cyclase essential for all
tocopherol biosynthesis. Proc Natl Acad Sci USA 99: 12495-12500

Porter NA (1986) Mechanisms for the autoxidation of polyunsaturated lipids. Acc Chem
Res 19: 262-268

Ricciarelli R, Zingg JM, Azzi A (2002) The 80th anniversary of Vitamin E: beyond its
antioxidant properties. Biol Chem 383: 457-465

Rossak M, Schafer A, Xu NX, Gage DA, Benning C (1997) Accumulation of
sulfoquinovosyl-l-O-dihydroxyacetone in a sulfolipid-deficient mutant of
Rhodobacter sphaeroides inactivated in squ. Arch Biochem Biophy 340: 219-230

Sakamoto T, Delgaizo VB, Bryant DA (1998) Growth on urea can trigger death and
peroxidation of the Cyanobacterium Synechococcus sp. strain PCC 7002. Appl
Environ Microb 64: 2361-2366

Sattler SE, Cahoon EB, Coughlan SJ, DellaPenna D (2003) Characterization of
tocopherol cyclases from higher plants and cyanobacteria. Evolutionary implications
for tocopherol synthesis and function. Plant Physiol 132: 2184-2195

Sattler SE, Gilliland LU, Magallanes-Lundback M, Pollard M, DellaPenna D (2004)
Vitamin E is essential for seed longevity, and for preventing lipid peroxidation
during germination. Plant Cell 16: 1419-1432

Schledz M, Seidler A, Beyer P, Neuhaus G, (2001) A novel phytyltransferase from
Synechocystis sp. PCC 6803 involved in tocopherol biosynthesis. FEBS Lett 499:
15-20

Shintani D, DellaPenna D (1998) Elevating the vitamin E content of plants through
metabolic engineering. Science 282: 2098-2100

Shintani DK, Cheng Z, DellaPenna D (2002) The role of 2-methyl-6-
phytylbenzoquinone methyltransferase in determining tocopherol composition in
Synechocystis Sp. PCC6803. FEBS Lett 511: 1-5

Stoyanovsky DA, Osipov AN, Quinn PJ, Kagan VE (1995) Ubiquinone-dependent
recycling of vitamin-E radicals by superoxide. Arch Biochem Biophy 323: 343-351

Thomas DJ, Avenson TJ, Thomas JB, Herbert SK (1998) A cyanobacterium lacking
iron superoxide dismutase is sensitized to oxidative stress induced with methyl

viologen but is not sensitized to oxidative stress induced with norflurazon. Plant
Physiol 116: 1593-1602

74

Tichy M, Vermaas W (1999) In Vivo role of catalase-peroxidase in Synechocystis Sp.
strain PCC 6803. J Bacteriol 181: 1875-1882

Trebst A, Depka B, Hollander-Czytko H (2002) A specific role for tocopherol and of
chemical singlet oxygen quenchers in the maintenance of photosystem 11 structure
and function in Chlamydomonas reinhardtii. FEBS Lett 516: 156-160

Wang XY, Quinn PJ (2000) The location and function of vitamin E in membranes
(review). Mol Membr Biol 17: 143-156

Williams JGK (1988) Construction of Specific Mutations in Photosystem II
Photosynthetic Reaction Center by Genetic Engineering Methods in Synechocystis
6803. Method Enzymol 167: 766-778

Yamamoto H, Miyake C, Dietz KJ, Tomizawa KI, Murata N, Yokota A (1999)

Thioredoxin peroxidase in the Cyanobacterium Synechocystis sp. PCC 6803. FEBS
Lett 447: 269-273

75

FIGURES

HPP GGDP

HGA PDP
Ir—slr1736::aphll

H In / H P
= «m» =
MPBQ

$I—slr1737::aphll——|
y-tocophenol
8-tocopherol 3 3

B-tocopherol :1 ii

Figure 2.1. Tocopherol Biosynthetic Pathway and Locations of Mutations in Synechocystis

sp. Strain PCC 6803.

HPP, hydroxyphenylpyruvate; GGDP, geranylgeranyl-diphosphate; PDP, phytyl-diphosphate;

HGA, homogentisic acid; MPBQ, 2-methyl-6-phytyl-1,4-benzoquinol; DMPBQ,

2,3-dimethyl-6-phytyl-1,4-benzoquinol; HPPD, HPP dioxygenase; GGDR, GGDP reductase; HPT,
HGA phytyltransferase; TC, tocopherol cyclase; MT, NIPBQ methyltransferase; y-TMT,
y-tocopherol methyltransferase; slrl 736::aph11 and slrl 737::aph11, disrupted mutants of HPT and
TC, respectively. Bold arrows show the primary biosynthetic route in viva; or-tocopherol is the
major tocopherol in Synechocystis sp. strain PCC 6803.

76

A HL ,0 , B Paraquat/HL

 

 

 

 

10 .
1 .
8
N
a
O
0.1 d
0.01 . T . .
0 20 40 60

 

 

 

 

 

0 20 40 60 0 20 40 60
time (hours) time (hours)

Figure 2.2. Growth Curves of Wild Type (WT) and the Tocopherol-Deficient slrl 736 and
slrl 737 Mutants under Different Stress and Chemical Treatments.

WT (circles), slrl 736 mutant (triangles) and slrl 737 mutants (squares) were grown at 32 °C, 1 %
(v/v) CO2 in air under A. HL; B. HL with 2 11M (solid lines) and 5 11M (dotted lines) paraquat; C.
HI. with 10 pM 18:2; D. HL with 10 M 18:3. A and B Show representative results of at least three
independent experiments, while data in C and D are the means i SD (n = 4). SD in C and D are
shown only when larger than symbols. In B, C, and D the HL WT growth curve is shown as a gray
dotted line with no symbol for reference.

77

A 1... B

 

 

101 3
2 80-
_l 3
_J 8 g 601
'0 h v
D
s 31‘ .2
_J '5 40‘
:r: 2
3 20.
01. v 0 y f .

 

 

_J
E
C”)
CO
‘—

 

peroxldes (nmoliml media)

 

 

 

 

 

 

 

peroxides (nmollml moat.)

 

001 I U U I U U U V V V

Figure 2.3. Growth Curves and Medium Peroxide Levels of WT and the Tocopherol
Deficient slrl 736 Mutant under HL with Various Chemical Treatments.

78

 

peroxides (nmollml rnedla)

 

 

 

 

 

    

 

 

 

 

3 250
- 200
a; i
:CEJ f 150
o .2 ..
m x
c. 2
3 so
0-1 r I I m I I o I I A;
0 10 20 30 40 50 0 5 10 15 20
time (hours) time (hours)
Figure 2.3. (Continued)

WT (circles) and slrl 736 mutant (triangles) were grown at 32 °C, 1 % (v/v) CO2 in air under HL. A
and B, control (HL, open marks; LL, filled marks); C and D, HL with 100 pM 18:3; E and F, HL
with 500 pM 18:1; G and H, HL with 100 M 20:3; 1 and J, HL with 150 M t-BOOH. A, C, E, G,
and I are 45 h growth curves while B, D, F, H, and J are the respective medium peroxide levels
during the first 20 h. Peroxide levels before addition of chemicals are shown at 0 h (B, D, F, H, and
J). The Y-axis scale of J is different from B, D, F and H. The gray dotted line in C, E, G, and I is the
growth curve of HI. treated WT from A for reference. Crossed marks in D, F, H, and J are media
peroxide levels in the absence of cells. The data shown are the means :t SD of cultures grown in
triplicate, except the LL media peroxide levels, which is representative of three independent
experiments (B). The SD is shown only when it is larger than the symbols except for the LL media
peroxide levels in B.

79

6O

IHL wr
5° :1 HL slr1736::aphll
arazer-IL wr
4o 13mm. slr1736::aphll

I20:3IHL wr

El 20:3IHL slr1 736::aphll

)1 .
. I ' ‘ e
IIIIIIIIIIIIllllllllllllllll

llllll !||l‘||llll‘.lll

llllllll:

N
0
ll 1 lllllllllllll llllllllll llll
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII

15‘“ "v.In"!!!kuuvflfli'i'r-é'...

10 SEE lgsg
0 I : § . ... LI EE 3E}: I' 3 _ : :33 g
o co co co co co as c IL
1- 1- 1- 1- 1.- ..- 1- N D
>- a E
.5.

Figure 2.4. Fatty Acid Composition of Total Membrane Lipid Extracts from WT and the
Tocopherol-Deficient slr1 736 Mutant after 4 h of Polyunsaturated Fatty Acid (PUFA)
Treatment.

The molar percentage of each fatty acid species esterified to membrane lipids is indicated. Total
PUFA levels were calculated as sums of 18:2, y-linolenic acid (y-18:3), or-linolenic acid (or-18:3),
stearidonic acid (18:4) and 20:3 in each genotype. Data shown are the means :1: SD (n = 4). SD is
shown only when it is larger than symbols.

80

IHL WT 318:3/HL WT

 

 

 

 

 

   

   

 

 

['1 HL slr1 736::aphll E 18:3/HL slr1 736::aphll
2' 2-
% %
51.5- D
Q Q
a 1 a
tn . m
2 e
O
C C
.305- .3 .
8 8
0.
0h 3h 20h 45h
A 4. A
_ ' E
E835 ,8
g 3' 8
32.5- E
m 2‘ tn
:>.1.5- :>.
<3 1- 3
‘3’ 0.5- E
O O
0.
0h 3h 20h 45h
c 35‘ 2 35-
E330-! E5 30.
8 25- 8 25-
g 20- g 20.
315' :8 15- g
210- 2 10. E E
8 § E E
.8 5' .9 5' E E
0- 0.. T _
0h 3h 20h 45h 0h 3h 20h 45h

Figure 2.5. Total Carotenoid, Chlorophyll, and Tocopherol Contents in WT and the
Tocopherol-Deficient slr1 736 Mutant during HL and 18:3/BL Treatments.

Total carotenoid (A and B), chlorophyll a (C and D), and tocopherol (E and F) levels were
measured at 0, 3, 20 and 45 h of HL (A, C, and E) and 100 pM 18:3/HL (B, D, and F) treatments
at 32 °C, 1 % (v/v) C02 in air. Tocopherol was not detected in the slrl736 mutant in any
experiments. Data shown are the means 5: SD (n = 3).

81

IHL WT i1823/HL WT
[3 HL slr1736::aphl/ E 1 8:3/HL slr1 736::aphll

0.7 . A Myxoxanthophyll 0‘7 - B Myxoxanthophyll
0.6 - 0.6 -
0.5 - 0.5 1
0.4 I 0.4 .
0.3 - 0.3 -
0.2 - 0.2 -

carotenoid (pg/ODmml)

0.1 ' 0.1 I

 

C Zeaxanthin D Zeaxanthin
0.7 - 0.7 -

0.6 . 0-5 ‘
0.5 -
0.4 -
0.3 -
0.2 -
0.1 -

0 -

carotenoid (pg/ODmmI)

 

0.7 ., E Echinenone F Echinenone

0.6 I
0.5 I
0.4 I
0.3 <
0.2 I

OI

G beta-Carotene

carotenoid (pg/007ml)

 

0.7 I
0.6 I
0.5 I
0.4 I
0.3 I
0.2 I
0.1 I

carotenoid (pg/COMM)

 

 

Oh 3h 20h 45 h
Figure 2.6. Levels of Individual Carotenoids in WT and the Tocopherol-Deficient slr1 736
Mutant during HL and 18:3/11L Treatments.

Myxoxanthophyll (A and B), zeaxanthin (C and D), echinenone (E and F) and beta-carotene (G and
H) were measured at 0, 3, 20 and 45 h of BL (A, C, E and G) and 100 pM 18:3/HL (B, D, F and H)
treatments at 32 °C, 1 % (v/v) C02 in air. Data shown are the means i SD (n = 3).

82

Norflurazon concentration

5uM 15uM 25uM 30uM
_——_

  
   

” h'.’
if“, ."

‘ l

IllldEJ-‘Qu Ms 3 1 ’

 

nudensu Ms fl}.

Hilde-'59s; Ms

 

- - - HL WT
—O—-NF/HL WT
- - a - - NFIHL slr1736::aphll

0.1 I I T I

 

 

0 20 40 60 80
time (hours)

Figure 2.7. Growth of WT and the Tocopherol-Deficient slr1 736 Mutant in the Presence of
Norflurazon (NF) in HL.

A. WT and the slr1 736 mutant were grown at the indicated concentration of NF for 90 h under HL
at 32 °C, 1 % (v/v) C02 in air. B. Growth curves of WT (circles) and the slr1 736 mutant (triangles)
during 25, pM NF/HL treatment. Data shown are the means :1: SD (n = 4). SD is shown only when it
is larger than the symbols. The growth curve for the WT under HL was shown as a gray dotted line.

83

1.4

'5' 1.2

O

2

o 1

Q

g 0.8-!
g 0.6-
8

g 0-4‘
'5 0.2-
0

0 i V I I I

 

 

O 1 0 20 30 40 50

chlorophyll a (pg/00mm”

 

 

 

o I U i T j

0 1o 20 30 4o 50
time (hours)

Figure 2.8. Changes in Total Carotenoids and Chlorophyll a Contents in the WT and the
Tocopherol-Deficient slr1 736 Mutant during Norflurazon (NE/EL Treatment.

A. Total carotenoids and B. chlorophyll a levels of WT (circles) and the slr1 736 mutant (triangles)
were measured during 25 p.M NF/HL treatment at 32 °C, 1 % (v/v) C02 in air. These data are
representative of two independent experiments.

84

A Myxoxanthophyll 06 B Zeaxanthin

.0
O)
n

0.5

p
0'.
l

0.4

.0
hi
1

 

0.3

.0
N

0.2

.0
.3

0.1 «i

carotenold (pglODmm')
S
carotenold (pg/Obnoml)

n 4.)

 

 

O
I

 

U U fi ' 1 0 ' i

0 1 O 20 30 40 50 0 1 O 20 30 40 50

C Echinenone D beta-Carotene

 

.0
O)
n

O
0'!
n

O
A
I

 

carotenold (pg/00730!!!”

. .0 .0 . .
N w

carotenoid (ngODmml)

 

 

0 I I V
0 10 20 30 4O 50

time (hours) time (hours)

 

 

Figure 2.9. Changes in Individual Carotenoids in WT and the Tocopherol-Deficient slr1 736
Mutant During Norflurazon (NF)/HL Treatment.
MYXOxanthophyll (A), zeaxanthin (B), echinenone (C) and beta-carotene (D) were measured

(luring 25 MM NF/HL treatment at 32 °C, 1 % (v/v) C02 in air. These data are representative of two
1ndeIX’l'ldent experiments.

85

 

CHAPTER 3: TOCOPHEROLS PLAY A CRUCIAL ROLE IN LOW TEMPERATURE

ADAPTATION AND PHLOEM LOADING IN ARABIDOPSIS.

The work presented in this chapter has been published:

Hiroshi Maeda, Wan Song, Tammy L. Sage and Dean DellaPenna

(2006) Plant Cell 18: 2710-2732

Author’s contributions:

Hiroshi Maeda conducted all the research with the exceptions of the diurnal carbohydrate
anal3’ses and TEM analyses performed by Wan Song and Tammy L. Sage, respectively.
Tamm)’ L. Sage also contributed to writing the microscopy portions of the manuscript.

Dean DellaPenna supervised the entire project and involved in all aspects of manuscript

Writing.

86

 

ABSTRACT

To test whether tocopherols (vitamin E) are essential in protection against oxidative stress
in plants, a series of Arabidopsis ngamin 1:; (vte) biosynthetic mutants that accumulate
different types and levels of tocopherols and pathway intermediates were analyzed under
abiotic stress. Surprisingly subtle differences were observed between the tocopherol-
deficient vteZ mutant and wild type during high light, salinity and drought stresses.
However, vte2, and to a lesser extent vte], exhibited dramatic phenotypes under low
temperature, i.e., elevated anthocyanin levels and reduced growth and seed production.
That these changes were independent of light level and occurred in the absence of
photoinhibition or lipid peroxidation suggests the mechanisms involved are independent
of tocopherol functions in photoprotection. Compared to wild-type, vte] and vteZ had
reduced rates of photoassimilate export as early as 6 h into low temperature treatment,
elevated soluble sugar levels by 60 h, and increased starch and reduced photosynthetic
electron transport rate by 14 days. The rapid reduction in photoassimilate export in vte2
coincides with callose deposition exclusively in phloem parenchyma transfer cell walls
adjacent to the companion cell/sieve element complex. Together these results indicate
that toc0pherols have a more limited role in photoprotection than previously assumed but

play crucial roles in low temperature adaptation and phloem loading.

INTRODUCTION

TOCOPherols are the best-studied class of lipid soluble antioxidants and are produced only
by PhOtosynthetic organisms including all plants and algae, and some cyanobacteria.

Structurally, all four tocopherols (a, [3, y and 8-tocopherols) consist of a chromanol head

87

group attached to a phytyl tail and differ only in the number and positions of methyl
groups on the chromanol ring (Figure 3.1). Tocopherols are amphiphatic molecules and
in vitro studies using artificial membranes have shown that tocopherols form complexes
with specific lipid constituents and physically stabilize membranes (Wassall et al., 1986;
Stillwell et al., 1996; Wang and Quinn, 2000; Bradford et al., 2003). Tocopherols can
efficiently quench singlet oxygen, scavenge various radicals, particularly lipid peroxy
radicals, and thereby terminate lipid peroxidation chain reactions (Liebler and Burr,
1992; Bramley et al., 2000; Schneider, 2005). In animals, vitamin E deficiency results in
muscular weakness and neurological dysfunction, which often coincide with elevated
lipid peroxidation (Machlin et al., 1977; Yokota et al., 2001). Recent studies have shown
that tocopherols also have functions in animals unrelated to their antioxidant activity,
such as modulation of cell signaling and transcriptional regulation (Ricciarelli et al.,
1998; J iang et al., 2000; Rimbach et al., 2002; Kempna et al., 2004).

In contrast to the extensive studies of tocopherol functions in animals, we are only
beginning to understand tocopherol functions in the photosynthetic organisms in which
they are produced. In plants, tocopherols are synthesized and localized in plastid
membranes that are also highly enriched in polyunsaturated fatty acids (PUFA) (Bucke,
1968; 8011 et al., 1980; Lichtenthaler et al., 1981; 8011 et al., 1985; $011, 1987; Vidi et al.,
2006) and increased tocopherol content has been correlated in the response of
phOtOSynthetic tissues to a variety of abiotic stresses, including high intensity light (HL),
Salinity, drought and low temperatures (Munne-Bosch et al., 1999; Keles and Oncel,
2002; Bergmuller et al., 2003; Collakova and DellaPenna, 2003). Such data, together

w' . . . .
1th the evolutionary conservation of tocopherol syntheSIS among photosynthetic

88

 

organisms, has led to the assumption that a primary function of tocopherols is to protect
photosynthetic membranes from oxidative stresses by acting as lipid-soluble antioxidants
(Fryer et al., 1992; Munne-Bosch and Alegre, 2002). While plausible, such hypotheses
are based primarily on correlations and circumstantial evidence and have yet to be
rigorously tested in planta. The isolation of Arabidopsis mutants disrupting steps of the
tocopherol biosynthetic pathway provide powerful tools to directly investigate tocopherol
functions in plants (Figure 3.1) (Shintani and DellaPenna, 1998; Collakova and
DellaPenna, 2001; Porfirova et al., 2002; Cheng et al., 2003; Sattler et al., 2003;
DellaPenna and Pogson, 2006).

The vteZ (yigamin E 2) mutant is defective in homogentisate phytyl transferase
(HPT) and lacks all tocopherols and pathway intermediates (Figure 3.1, Table 3.1). vte2
mutants are severely impaired in seed longevity and early seedling development due to
the massive and uncontrolled peroxidation of storage lipids (Sattler et al., 2004; SE.
Sattler, L. Mene-Saffrane, E.E. Farmer, M. Krischke, M.J. Mueller, and D. DellaPenna,
unpublished data), consistent with loss of the lipid-soluble antioxidant functions of
tocopherols (Ham and Liebler, 1995, 1997). Interestingly, the vte2 mutants that do
survive early seedling development become virtually indistinguishable from wild type
under standard growth conditions (Sattler et al., 2004 and current study), suggesting that
unlike seed longevity and germination, tocopherols are dispensable in mature plants in
the absence of stress. Consistent with this, constitutive over-expression of VTEZ in
Arabidopsis increased total leaf tocopherols 4.5-fold but had no discernible effect relative
to wild type on plant growth or chlorophyll and carotenoid content in the absence of

stress or under combined nutrient and HL stress (Collakova and DellaPenna, 2003).

89

The vte] mutant is defective in tocopherol cyclase activity and deficient in all
tocopherols but unlike vte2, accumulates the redox active biosynthetic intermediate 2,3-
dimethyl-6-phytyl-l,4-benzoquinol (DMPBQ) (Figure 3.1, Table 3.1, Sattler et al., 2003).
When grown at 100 to 120 umol photon m‘2 s'1 vte] plants are virtually identical to wild
type at all developmental stages (Porfirova et al., 2002; Sattler et al., 2003; 2004). The
lipid peroxidation phenotype observed in germinating vteZ seedlings was not observed in
We] indicating the DMPBQ can fully compensate for tocopherols as a lipid-soluble
antioxidant in seedlings (Sattler et al., 2004). Under HL stress (5 days at 850 umol

2 s"; Porfirova et al., 2002) or a combination of low temperature and HL stress

photon m’
(5 days at 6 to 8°C and 1100 umol photon tn2 3"; Havaux et al., 2005), vte] was nearly
identical to wild type for all parameters measured, including lipid peroxidation, with the
exception of a slight decrease in maximum photosynthetic efficiency (Fv/Fm). Only
under extreme conditions (24 h at 3°C and continuous 1500-1600 umol photon m‘2 s’l)
did vte] show a more rapid induction of lipid peroxidation than wild type, although this
difference was transient and after 48 h of treatment lipid peroxidation was similarly
elevated in vte] and wild type (Havaux et al., 2005). These studies with vte] and vte2
mutants suggest that a primary function of tocopherols is to control non-enzymatic lipid
oxidation, especially during seed storage and early germination, and also probably in
photosynthetic tissues but only under the most extreme of combined HL and low
temperature stress.

Interestingly, a maize tocopherol cyclase mutant (sde, sucrose export (_lefective I)

was identified several years prior to the identification of Arabidopsis vte], not due to its

impact on tocopherol synthesis, but because of accumulation of carbohydrates and

90

anthocyanins in sxd] source leaves, which coincided with aberrant plasmodesmata
between the bundle sheath and vascular parenchyma cells (Russin et al., 1996). Cloning
of the SXDI locus did not provide insight into the biochemical activity of the nuclear-
encoded chloroplast-localized protein (Provencher et al., 2001) and it is only in retrospect
that SXDI has been demonstrated to have tocopherol cyclase activity (Sattler et al., 2003).
The maize sde carbohydrate accumulation phenotype was intriguing as it suggested an
unexpected link between the tocopherol pathway and primary carbohydrate metabolism,
though the mechanism involved was unclear. A similar carbohydrate phenotype did not
occur in the orthologous Arabidopsis vte] mutant (Sattler et al., 2003) but was observed
in VTEI RNAi knock-down lines in potato (Hofius et al., 2004).

In the current study, we further define and clarify the physiological role(s) of
tocopherols in photosynthetic plant tissues by subjecting and analyzing the response of a
suite of Arabidopsis tocopherol mutants to a variety of abiotic stresses. We report that in
contrast to long-held assumptions about tocopherol functions in plants, tocopherol-
deficient mutants are remarkably similar to wild type in their response to most abiotic
stresses with the notable exception being an increased sensitivity to non-freezing low
temperatures. Detailed physiological, biochemical and ultrastructural data demonstrate
that the earliest impact of tocopherol deficiency during low temperature treatment is an
inhibition of photoassimilate transport associated with dramatic structural changes in
phloem parenchyma transfer cells, a bottleneck for photoassimilate transport. The
resulting accumulation of carbohydrates in source leaves impacts the physiology and

response of the entire plant to low temperatures.

91

RESULTS

Tocopherol Biosynthetic (vte) Mutants Used in This Study

vteI-I, vteI—Z and vte2-1 are previously isolated and characterized ethyl
methanesulfonate mutants in the Columbia (Col) ecotype that are deficient in the
tocopherol cyclase (vteI -1 and vte1-2) and HPT (vte2-I) enzymes (Sattler et al., 2003;
2004, Figure 3.1). vte2-2 and vte4-3 are T-DNA insertion mutants in the Wassilewskija
(Ws) ecotype in genes encoding HPT and y-tocopherol methyltransferase (y-TMT),
respectively. Leaves of all mutants, vte2-1, vte2-2, vteI-I, vte1-2 and vte4-3, lack (1-
tocopherol, the major tocopherol in wild type Arabidopsis leaves (Figure 3.1, Table 3.1,
Sattler et al., 2003). vte2-1 and vte2-2 lack all tocopherols and pathway intermediates.
vteI-I and vteI-Z lack all tocopherols but accumulate the biosynthetic pathway
intermediate DMPBQ at a level comparable to a-tocopherol in C01. The vte4-3 mutant
accumulates y-tocopherol at an equivalent or slightly higher level than (at-tocopherol in
Ws. Three to five-week-old plants of all mutant genotypes grown under permissive
conditions (12 h 120 umol photon rn‘2 5'1 light at 22°C / 12 h darkness at 18°C) were
virtually identical to their respective wild type backgrounds, consistent with previous
reports that mutations disrupting tocopherol synthesis have little impact on the normal
growth of mature plants (Porfirova et al., 2002; Bergmuller et al., 2003; Sattler et al.,

2003; 2004).
The Response of Tocopherol-Deficient Mutants to High Intensity Light Stress

High intensity light (HL) stress results in excessive excitation of chlorophyll and

consequently generates reactive oxygen species (ROS), which in turn attack various

92

biochemical targets in the cell including PUFA-enriched photosynthetic membranes.
Tocopherols are most abundant in these photosynthetic membranes (Bucke, 1968;
Lichtenthaler et al., 1981; 8011 et al., 1985) and leaf tocopherol levels increase up to 18-
fold during HL stress in Arabidopsis (Collakova and DellaPenna, 2003). Therefore, it has
been presumed that the elimination of tocopherols from photosynthetic membranes would
have dramatic impacts on plant survival during HL stress. To test this hypothesis, Col,
vte2-I, We] -1, and vte1-2 were grown for four weeks under permissive conditions and
then subjected to two levels of BL stress, 1000 and 1800 umol photon m'2 s'1 16 h light] 8
h darkness at 22°C (hereafter referred to as HL1000 and HL1800, respectively). HLIOOO
did not result in differential visible or biochemical phenotypes between vte2-I and Col
(Supplemental Figure 3.81). When Col, vte2-1, vteI-I and vteI-Z were subjected to
HL1800, which approaches the intensity of full sunlight, this led to bleaching of some
mature leaves in all genotypes. vte2-1 had a slight tendency toward more bleached leaves
than Col but this was not reproducible or significant, while vteI-I and vteI-Z
reproducibly had as many or more bleached mature leaves than Col or vte2-I (Figure
3.2A and Supplemental Figure 3.82). vte2-2 and vte4-3 subjected to HL1800 responded
similarly to Ws, the corresponding wild type (data not shown).

To assess changes in photosynthetic pigment and tocopherol levels in response to
HL stress, the 7th to 9th oldest leaves were harvested before and after 4 days of HL1800
for HPLC analysis. Before HL1800 all levels were similar between genotypes except for
slightly lower B-carotene content in vte2-I and vteI-I relative to C01 and the absence of
tocopherols in all vte genotypes (Supplemental Table 3.81). After 4 days of HL1800, the

vte mutants generally had lower total and individual chlorophyll levels than Col but these

93

differences were not significant in all cases after 4 days of HL1800, even with n = 19
(Figure 3.23, Table 3.2, Supplemental Figure 3.82). Total carotenoids were consistently
and significantly lower than C01 in vteI-I and vte1-2, but not always in vte2-1 after 4
days of HL1800. Neoxanthin and Violaxanthin were significantly lower in all vte mutants,
while lutein was significantly lower only in We] -1 and vte1-2. Interestingly, zeaxanthin
was 70 % higher than C01 in vte2-1 but unchanged relative to C01 in both We] alleles
(Table 3.2).

In vivo chlorophyll a fluorescence was also analyzed to assess photosystem 11
(P811) function during HL stress. Typically, when plants are under oxidative stress, P811
is inactivated due to enhanced turnover of the D1 protein, a process termed
photoinhibition, and maximum photosynthetic efficiency (Fv/Fm) decreases (Bjorkman
and Demmig, 1987; Maxwell and Johnson, 2000). Four-week-old Col, vte2-1, vteI-I and
vteI—Z plants grown under permissive conditions had identical Fv/Fm values of between
0.8 and 0.85, typical values for healthy leaves (Bjorkman and Demmig, 1987; Maxwell
and Johnson, 2000, data not shown). After 24 h of HL1800 (8 h HL1800, 8h darkness,
and 8h HL1800), a few vte2-1 leaves showed a dramatic reduction in Fv/Fm (< 0.5), but
the majority had values similar to C01 and the average Fv/Fm of vte2-1 was not
significantly different from Col, even with n = 30 (Figure 3.2D, Supplemental Figure
3.82). In contrast, vte] -1 and vte1-2 both had more leaves with Fv/Fm < 0.5 and average
Fv/Fm values that were significantly lower than Col (Figure 3.2D, Supplemental Figure
3.82).

These combined results indicate that the elimination of tocopherols in vte2 has

surprisingly little impact on the response of the photosynthetic apparatus to HL stress in

94

comparison to C01, with the exception of altered xanthophyll cycle carotenoids. Equally
surprising is the fact that though the vte2 and vte] genotypes are identical with regard to
their tocopherol deficiencies, vteI alleles are slightly more susceptible to HL1800 than
vte2. As the primary biochemical difference between these two genotypes is that vte]
mutants accumulate the redox active intermediate DMPBQ while vte2 mutants do not, the
presence of DMPBQ in vte] may have negative impacts on HL stress tolerance in

Arabidopsis.

Tocopherol-Deficient Mutants Exhibit a Low Temperature Sensitive Phenotype.

In searching for a condition that more obviously impacts wild type and the tocopherol-
deficient mutants in a differential fashion, vte2-1 and Col plants were subjected to abiotic
stress treatments other than HL, including salinity (100, 150 and 200 mM NaCl), drought,
and various low temperature treatments. Like HL stress, the salinity and drought stress
conditions used also did not result in obvious phenotypic differences between vte2-1 and
Col (Supplemental Figure 3.81) and further analyses will be required to determine any
consequences of tocopherol-deficiency during these stresses. However, when plants were
transferred from permissive conditions to non-freezing low temperature conditions, both
vte2-I and vte2-2 grew more slowly than their respective wild types, C01 and Ws, and
their mature leaves changed color to purple (Figure 3.3). These phenotypic differences
were consistently observed in conditions ranging from 3 to 12°C and light intensities
from 15 to 200 umol photon m’2 5'1 (data not shown). Differences were most obvious and

consistent under 75°C, 12 h 75 umol photon rn'2 5'1 light/ 12h darkness (Figure 3.3) and

95

this low temperature regime (hereafter termed 7.5°C-treated) was used for all subsequent

experiments.

Following transfer to 75°C, vte2-I and Col did not differ in time to bolting (53 i 4
and 51 i 3 days, respectively, after transfer to 75°C) or number of leaves produced at the
start of bolting (32 i 3 and 31 t 2 leaves, respectively), indicating that the process of
vernalization was not affected by the lack of tocopherols. However, after prolonged
growth at 75°C vte2-1 siliques were shorter, produced significantly fewer seeds per
silique and per plant compared to C01, and 35 % of the seeds in vte2-1 siliques were
aborted compared to less than 1 % in C01 siliques (Figure 3.3E, Table 3.3). These results

indicate tocopherols play a crucial role in low temperature adaptation in Arabidopsis.

Subjecting vteI-I to 75°C treatment resulted in a phenotype intermediate between
vte2-1 and C01 in terms of overall growth, mature leaf color, silique size, number of
seeds/silique, percentage of aborted seed, and seed yield per plant (Figure 3.3, Table 3.3).
These phenotypes in 7.5°C-treated vte4-3 were virtually indistinguishable from wild type
(Ws) (Figures 3.3A, B and C). These results indicate that during low temperature
adaptation in Arabidopsis the quinol biosynthetic intermediate DMPBQ partially
compensates for the lack of tocopherols in vte] -1 while the y-tocopherol accumulated in

vte4-3 leaves can functionally replace a-tocopherol in this regard.

Photooxidative Damage Is Not Associated with the vte2 Low Temperature Phenotype.
To further examine changes during the time course of 7.5°C treatment, vte2-I and Col

were subject to detailed comparative biochemical analyses. Plants grown for four weeks

96

at permissive conditions were transferred to 7.5°C conditions and the 7‘h to 9‘h oldest
fully expanded rosette leaves were harvested at various time points for analyses. The
tocopherol content in C01 started to increase after 3 days of 7.5°C treatment reaching
levels five-fold higher than initial levels by 28 days, while vte2-I lacked tocopherols at
all time points (Figure 3.4A).

Consistent with the purple color of mature leaves of 7.5°C-treated vte2 mutants
(Figure 3.38), vte2-1 accumulated significantly higher level of anthocyanins than Col
after 14 days of 7.5°C (Figure 3.4D). In Col anthocyanins were detected only at 7 days.
Because anthocyanin accumulation is often associated with plant responses to stress
(Leyva et al., 1995; Chalker-Scott, 1999) and tocopherols are well-characterized lipid-
soluble antioxidants in animals (Ham and Liebler, 1995, 1997), it seemed plausible that
elevated lipid peroxidation might be occurring in vte2-I during low temperature
treatment. However, the lipid peroxide levels of vte2-1 and Col analyzed by the ferrous
oxidation xylenol orange (FOX) assay were found to be similar and near background
levels at all time points (Figure 3.43), indicating that the observed phenotypic differences
between 7.5°C-treated vte2-I and Col are not associated with a detectable increase in
lipid peroxidation.

Given the reported localization of tocopherols and tocopherol biosynthetic
enzymes to plastids (Bucke, 1968; 8011 et al., 1980; Lichtenthaler et al., 1981; 8011 et al.,
1985; 8011, 1987), it seems reasonable to hypothesize that tocopherol deficiency might
affect the components and function of the photosynthetic apparatus during 7.5°C

treatment. Under permissive growth conditions, the levels of individual and total

Photosynthetic pigments (chlorophylls and carotenoids) were nearly identical in vte2-1

97

and Col (Figures 3.4C and E, Supplemental Table 3.82 at 0 day). The chlorophyll and
carotenoid content of both vte2-1 and Col changed in parallel during the first two weeks
of 7.5°C treatment and became significantly different only at 28 days (Figures 3.4C and
E, Supplemental Table 3.82). It is especially noteworthy that zeaxanthin, a xanthophyll
cycle carotenoid that accumulates under HL stress (Muller et al., 2001, Table 3.2), was
not detectable at any time point in 7.5°C-treated C01 and vte2-1 (Supplemental Table
3.82), suggesting that the plants were not experiencing photooxidative stress under the
low temperature conditions used.

To assess the response of the photosynthetic apparatus to 7.5°C, changes in
photosynthetic parameters were analyzed. Fv/Fm was unchanged in both C01 and vte2-I
at any time point (Figure 3.5A), indicating that photoinhibition is not occurring in either
genotype during permissive or 7.5°C conditions. The quantum yield of PSII ((Dpsu) was
also identical between C01 and vte2-1 under permissive growth conditions (Figure 3.5B at
0 day), suggesting that tocopherol deficiency also does not affect the efficiency of
electron transport via P811 in the absence of stress (Genty et al., 1989). During the first 7
days of 7.5°C treatment, (Dpsn responded identically in C01 and vte2-1 : (Dpsn—decreased
sharply during the first day followed by a gradual recovery by 7 days. However, at 14
days the vte2-I (bpsn was significantly lower than C01 and declined further by 28 days,

while the (Dpsn of Col remained stable from day 14 and onward (Figure 3.5B).

98

Tocopherol-Deficient Mutants Accumulate Carbohydrates During Low Temperature
Treatment

The reduced (bpsu in vte2-1 after 14 days could result from feedback inhibition of
photosynthesis due to the accumulation of downstream carbon metabolites (Goldschmidt
and Huber, 1992; Koch, 1996; Paul and Foyer, 2001; Paul and Peliny, 2003). To assess
this possibility, starch, glucose, fructose and sucrose contents were analyzed during the
time course of 7.5°C treatment. Starch represents the main plastidic carbohydrate storage
pool, sucrose and fructose are cytosolic pools, while glucose is present in both subcellular
compartments. C01 and vte2-I had identical carbohydrate contents at the end of the light
period under permissive growth conditions (Figure 3.6 at 0 day). During the first 7 days
of 7.5°C treatment starch content increased similarly in both C01 and vte2-1 to
approximately 120 umol glucose equivalents/g FW. After 7 days vte2-I starch content
steadily increased to 680 umol glucose equivalents/g FW while Col starch levels
decreased to near initial levels (Figure 3.6A). Likewise, the glucose, fructose and sucrose
content of C01 and vte2-1 increased similarly during the first 3 days of low temperature
treatment (Figures 3.6B, C and D), likely as a component of the well-documented cold
acclimation response(s) in Arabidopsis (Wanner and Junttila, 1999; Taji et al., 2002).
After 3 days, Col soluble sugar levels decreased, while vte2-1 continued to rise reaching
35, 43 and 255 times the initial levels of glucose, fructose and sucrose, respectively, after
28 days of low temperature treatment. The timing of the increase and accumulation of
carbohydrates in vte2-I is consistent with this being the root cause of the reduction in

(DPSH observed after 14 days at 7.5°C (Figure 3.5B).

99

To further investigate any differences in carbohydrate accumulation between vte2—
] and Col during the initial 5 days of low temperature treatment, diurnal changes in
carbohydrate content were analyzed one hour before the end of the light and dark cycles.
During the 25 h prior to low temperature treatment (Figure 3.7; -25 h, -13 h and -1 h,
with 0 h being the transfer of plants to low temperature at the start of the light cycle),
starch, glucose, fructose and sucrose content were almost identical in vte2-1 and Col.
These data indicate the lack of tocopherols does not have a significant impact on
carbohydrate metabolism under permissive growth conditions. Following transfer to low
temperature the soluble sugar content increased similarly in vte2-I and Col for the first
two diurnal cycles with significant differences first being observed between genotypes at
the end of the third low temperature light period (59 h in Figures 3.7B, C and D). In
contrast, starch levels did not become significantly different between genotypes until 14
days of low temperature treatment (Figures 3.6A and 7A). The differential elevation of
soluble sugars prior to starch accumulation in vte2-1 indicates that the increase in
cytosolic soluble sugars precedes starch accumulation in the chloroplast and that soluble

sugars are not being efficiently metabolized or mobilized in 7.5°C-treated vte2-1.

The vte2 and vtel Cold Sensitive Phenotypes Are Attenuated in Young Leaves

Mature (7‘h to 9th oldest) and young (13‘h to 16‘h oldest) leaves of vte2-I and vtel-1
mutants showed obvious visible differences in their responses to low temperature; young
leaves of vte2-1 and vteI-I did not change their color to purple even after two months of
7.5°C treatment (Figure 3.3C).-Consistent with this visual observations, mature leaves of

vteI-I had an anthocyanin content 10 % that of vte2-I but still higher than Col, while

100

young vte2-1 and vteI—I leaves accumulated much less anthocyanins compared to their
respective mature leaves after 28 days of 7.5°C treatment (Figure 3.8A). Fv/Frn was
above 0.8 in all cases, indicating that photoinhibition was not occurring in either young or
mature leaves of any genotype (data not shown). The (Dpsu of mature vte2-1 leaves was
reduced to 70 % of mature Col leaves, consistent with Figure 3.5, while the (bpst of
mature vteI—I leaves was only slightly decreased relative to mature Col leaves. However,
the (bpsu of mature and young Col leaves and young vte2-1 and vtel-I leaves were not
significantly different (Figure 3.8B). Levels of all carbohydrates in mature vte2-I leaves
were greatly elevated in comparison to C01, consistent with Figure 3.6. Mature vte] -1
leaves contained intermediate levels of starch, glucose, fructose and sucrose (51, 53, 68
and 58 % of vte2-1 levels, respectively) (Figures 3.8C to F). Young vte2-I and vte] -1
leaves contained substantially reduced starch, glucose, and sucrose levels compared to
their respective mature leaves. These results indicate that the initiation and development
of young vte2-1 and vte] -1 leaves under 7.5°C conditions attenuates the biochemical
phenotypes observed in mature leaves of both genotypes and that the DMPBQ
accumulated in vte] -1 further suppresses these biochemical phenotypes in both mature

and young leaves.

Tocopherol-Deficient Mutants Have Reduced Source Leaf Photoassimilate Export
Capacity at Low Temperatures

The reduced seed yield (Table 3.3) and attenuated carbohydrate accumulation in young
leaves relative to mature leaves (Figure 3.8) in 7.5°C-treated vte2-1 suggested impaired

translocation of photoassimilates from mature source tissues to young sink tissues. To

101

test this possibility l4C02 labeling experiments were conducted. C01 and vte2-1 were
grown on plates under permissive conditions for three weeks and then transferred to
7.5°C for an additional 7 days. Whole plants were labeled with 14C02 at 7.5°C,
transferred to high humidity in darkness at 7.5°C for 2 h to allow for photoassimilate
transport and subsequently exposed to a phosphor screen to visualize the movement of
14C labeled photoassimilate. Immediately after labeling >99% of the 14CO; incorporated
was present in leaf tissue (data not shown). C01 and vte2-I incorporated similar amounts
of 14C02 into photosynthate suggesting their carbon fixation rates do not differ, consistent
with the similar (bpsu within the first 7 days at 7.5°C (data not shown and Figure 3.5B).
Following the 2 h dark period Col had translocated 13.2 % of the 14c labeled
photoassimilate fixed in leaves to roots, whereas only 2.7 % was translocated in vte2-I
(Figure 3.9A). These results demonstrate that vte2-I translocates significantly less
photoassimilate from source to sink than Col after 7 days of 7.5°C-treatment.

Impaired photoassimilate translocation in 7.5°C-treated vte2-I could be due to
reduced sink strength or impaired photoassimilate export from source leaves (Gottwald
2000, Stitt 1996, Herbers and Sonnewald 1998). To address these possibilities, phloem
exudation experiments were conducted (King and Zeevaart 1974). C01 and vte2-I were
grown for four weeks at permissive conditions and transferred to 7.5°C for an additional
0, 1, 3, or 7 days. Mature (7‘h to 9‘h oldest) leaves were excised from plants and labeled
with 14C02. The petioles of labeled leaves were then transferred to an EDTA solution to
induce phloem exudation and radioactivity in the EDTA solution was determined at
various time points (King and Zeevart, 1974). Again, total l4C02 fixed in mature leaves

were similar in all genotypes at each time point (Figure 3.9C). Prior to 7.5°C treatment (0

102

day), Col, vtel-I and vte2-I leaves exuded similar amounts of labeled photoassimilates,
accounting for approximately 34 % of the total ”COZ fixed in each genotype. During
7.5°C treatment, the percent exudation by Col slightly decreased after 3 and 7 days (to 27
and 31 % of the total l4COz fixed, respectively), whereas that of vte2-1 was greatly
reduced (to 11% and 4% at 3 and 7 days, respectively). Even more intriguingly,
exudation in vte2-1 was significantly lower than Col during the first day of 7.5°C
treatment, which corresponds to only 6 h at 7.5°C treatment. The vtel-1 mutant exuded
17 and 15 % of the total l4C02 fixed after 3 and 7 days at 7.5°C, respectively, levels
intermediate between C01 and vte2-1 (Figure 3.9C).

In apoplastic loaders like Arabidopsis sucrose is almost the exclusive translocated
photoassimilate (Vanbel, 1993). To assess the chemical nature of the labeled compounds
exuded from C01 and vte2-I, phloem exudates were collected and separated by anion-
exchange chromatography together with sugar standards. As shown in Figure 3.9B,
approximately 85 % of the label in C01 and vte2-1 exudates comigrated with the sucrose
standard and 10 % with glucose/fructose standards. The high proportion of sucrose
indicates that the label collected is almost entirely from phloem exudate rather than
sugars from the cytosol of damaged cells.

Overall, the results obtained from l4C02 labeling experiments indicate that
tocopherol deficiency in both vte] -1 and vte2-1 results in dramatically reduced capacity
of photoassimilate export from source leaves in response to 7.5°C treatment. The rapidity
of the reduction in photoassimilate export in 7.5°C-treated vte2-I strongly suggests that
impairment of photoassimilate export is the root cause of the sugar accumulation

phenotype observed in mature leaves of 7.5°C-treated tocopherol-deficient mutants.

103

Structural Changes in Low Temperature-Treated Tocopherol-Deficient Mutants

Previously, callose was reported to accumulate at the bundle sheath/vascular parenchyma
interface of the maize sde mutant and in vascular tissue of potato VTEI-RNAi lines,
both of which are defective in tocopherol cyclase (Botha et al., 2000; Hofius et al., 2004).
To determine whether callose deposition also occurs in C01, vte2-I and vtel-1, leaves
were harvested at 0, 1, 3 and 13 days of 7.5°C treatment and aniline blue-positive
fluorescence assessed. Under permissive conditions, aniline blue-positive fluorescence
was absent or sporadic and no significant differences were observed in any genotypes.
Aniline blue-positive fluorescence was also not altered in C01 during the entire 7.5°C
treatment period (e.g., 13 days at 7.5°C, Figure 3.10C). In contrast, aniline blue-positive
fluorescence strongly increased in the vascular tissue of 7.5°C-treated vte2-1 (Figure
3.10), and to a slightly lesser extent vtel-1 (Supplemental Figure 3.83). In both vte2-1
and vteI-I, fluorescence initially appeared in a limited number of vascular cells in the
petiole as early as 6 h after transfer to 7.5°C conditions (Figures 3.10D and F,
Supplemental Figures 3.83A and B). The number of aniline blue fluorescing cells in the
vasculature and their fluorescent intensity subsequently increased in an acropetal fashion
in both vte2-I and vteI-I during the course of 7.5°C treatment (Figure 3.10,
Supplemental Figure 3.83). Intriguingly, the induction, intensity and acropetal spread of
vasculature-specific aniline blue positive fluorescence in vte2-I at 7.5°C was unaffected
by light levels ranging from 1 to 800 umol photon tn2 3'1 (Figures 3.11A to F). Aniline

blue positive fluorescence was not observed in the vasculature of Col at any light level at

104

7.5°C (data not shown) and was also absent from the vasculature of both C01 and vte2-I
subjected to HL1800 at 22°C for up to 4 days (Figures 3.11G and H and data not shown).

To confirm whether or not aniline blue-positive fluorescence was cell specific and
could be attributed to callose deposition, serial sections of 0 and 14 day 7.5°C-treated C01
and vte2-I vascular tissue were examined at the level of the transmission electron
microscope (TEM). The spatial organization of cells and types of cells comprising the
phloem and xylem of both C01 and vte2-1 were identical to what has been previously
described for Arabidopsis (Haritatos et al., 2000, data not shown). Notably, at day 0
phloem vascular parenchyma cells of both C01 and vte2-I contained transfer cell wall
ingrowths adjacent to sieve elements and companion cells (e.g. Figure 3.12A). 7.5°C-
treatment of Col for 14 days did not result in obvious ultrastructural changes in any
vascular cell type except for a noticeable increase in phloem parenchyma transfer cell
differentiation and transfer cell wall deposition exclusively adjacent to sieve elements
and companion cells in all vascular tissue (Figure 3123) although to a lesser degree in
the midvein.

During the same time course of 7.5°C-treatment in vte2-I, changes in cell fine
structure occurred exclusively within the phloem parenchyma transfer cells of all
vascular traces. Phloem parenchyma transfer cells in 14 day-treated vte2-1 exhibited
irregularly thickened cell wall depositions with ultrastructural features characteristic of
callose (Nishimura et al., 2003; Figures 3.12C to F). Large callosic-like masses that
dissected the cell lumen corresponded in shape to aniline blue-positive fluorescent
regions (compare Figures 3.12C and E to Figures 3.10F, I and L). The callosic-like wall

material also formed a sheath around the cells (Figure 3.12D), was deposited over

105

transfer cell wall ingrowths (Figure 3.12F) and between the end walls of adjoining
transfer cells including plasmodesmata (data not shown). Immunolocalization using
monoclonal antibodies against callose confirmed the presence of callose at each location
(Figures 3.12G to J) and at plasmodesmata between the phloem parenchyma transfer cells
and bundle sheath (Figure 3.12K). No immunolabelling was present in controls using
secondary antibody only (Figures 3.12D to F) and immunolabelling was rare to absent in
all cell types of untreated C01 and vte2-1 and in 14-day 7.5°C-treated Col, including
phloem parenchyma transfer cells (e. g. Figure 3.12L).

Serial sections of vascular tissue from C01 and vte2-1 treated at 7.5°C for 3 and 7
days were subsequently examined at the level of the TEM to determine the spatial and
temporal development of callose deposition within phloem parenchyma cells. At 3 days,
phloem parenchyma transfer cell wall deposition in C01 was confined to the sieve
element or companion cell boundary (data not shown) but in vte2-1 wall deposition was
present around the entire transfer cell periphery (Figure 3.13A). Cell wall deposition in 3
day-treated vte2-1 resulted in abnormally thickened and irregular shaped ingrowths with
callose-like depositions adjacent to sieve elements and companion cells (Figure 3.13A)
that grew increasingly prominent by day 7 (data not shown). In 3-day 7.5°C-treated vte2-
] positive immunolocalization with monoclonal antibodies to callose was present
exclusively at the phloem parenchyma transfer cell wall-sieve element boundary (Figure
3138) and included phloem parenchyma transfer cell-sieve element plasmodesmatal
connections (Figure 3.13C). In contrast to 14 days, plasmodesmata between bundle
sheath and phloem vascular parenchyma cells in 3 day 7.5°C-treated vte2-1 were

continuous and immunonegative for callose (compare Figure 3.12K and 13D).

106

DISCUSSION
The chemistry of tocopherols as lipid soluble antioxidants and terminators of PUFA free
radical chain reactions has been well established from analyses in artificial membranes
and animal-derived membrane systems (Liebler and Burr, 1992; Ham and Liebler, 1995).
It has long been assumed that similar chemistry occurs in the tocopherol-containing
PUFA—enriched membranes of photosynthetic organisms, and this assumption has
recently been supported by studies of tocopherol deficient photosynthetic organisms
(Sattler et al., 2004; Havaux et al., 2005; Maeda et al., 2005). During the first several
days of germination, a period of high oxidative metabolism, Arabidopsis vte2 seedlings
contain levels of oxidized lipids >100-fold higher than wild type or vte], which were
indistinguishable (Sattler et al., 2004; SE. Sattler, L. Mene-Saffrane, E.E. Farmer, M.
Krischke, M.J. Mueller, and D. DellaPenna, unpublished data). Thus, a chemical role for
tocopherols (or DMPBQ in vteI) in limiting lipid peroxidation appears to be conserved
between photosynthetic organisms and animals. By 18 days of growth the lipid peroxide
levels of vte2 seedlings had decreased to near that of wild type and We] (Sattler et al.,
2004) and became indistinguishable from wild type and vte] after four weeks of growth
(Figure 3.4B), consistent with tocopherols being dispensable in mature photosynthetic
tissues in the absence of stress (Porfirova et al., 2002; Sattler et al., 2003; 2004).

While a chemical role for tocopherols in controlling lipid peroxidation at specific
points of the plant life cycle now seems clear, the physiological roles of tocopherols
during plant stresses do not. In the current study, we have utilized a suite of Arabidopsis

vte mutants that accumulate different types and levels of tocopherols and pathway

107

intermediates (Table 3.1) to directly assess tocopherol specific functions in

photosynthetic tissues in planta in response to abiotic stress treatments.

A Limited Role for Tocopherols in Protecting Arabidopsis Plants from High Intensity
Light Stress.

Tocopherols have long been assumed to play crucial roles in HL protection presumably
by acting as singlet oxygen quenchers and lipid peroxy radical scavengers (Fryer, 1992;
Munne-Bosch and Alegre, 2002; Trebst et al., 2002). In the current study the biochemical
and photosynthetic responses of the tocopherol-deficient vte2 mutant exposed to HL1000
and HL1800 at 22°C for up to eleven days was surprisingly similar to wild type (Figure
3.2, Supplemental Figures 3.81 and 82). Likewise, the mutation corresponding to
Arabidopsis vte2 in the cyanobacterium Synechocystis sp. PCC6803 (slr1736) had a
similarly limited impact on growth and photosynthesis under permissive growth
conditions and during HL stress (Collakova and DellaPenna, 2001; Maeda et al., 2005).
In both organisms it is only when HL stress has been combined with other stresses, in
combination with lipid peroxidation inducing chemicals in the Synechocystis slr1736
mutant (Maeda et al., 2005) or in combination with low temperatures (2-3°C) in
Arabidopsis vte2 and vtel mutants that differential impacts on photosynthetic parameters
or lipid oxidation are observed (Havaux et al., 2005). These combined data indicate that
tocopherols are not essential for adaptation and tolerance of photosynthetic tissues
subjected to HL stress alone. Such a conclusion runs counter to long-held presumptions
that a primary function of tocopherols is to protect photosynthetic tissues against HL

stress (Fryer, 1992; Munne-Bosch and Alegre, 2002).

108

One possible explanation for this surprisingly limited role of tocopherols during
HL stress is that other mechanisms compensate for their absence. The zeaxanthin level of
HL1800 vte2 was nearly twice that of Col (Table 3.2). vte2 (and vteI) also had a higher
xanthophyll de—epoxidation state (A+Z/A+Z+V) after HL1800 treatment (Table 3.2), as
did vtel during HL stress combined with low or high temperatures (Havaux et al., 2005).
Growth of a tocopherol-deficient Synechocystis mutant was also much more susceptible
than wild type to treatment with a biosynthetic inhibitor of carotenoid synthesis during
HL stress (Maeda et al., 2005). Similarly, a double mutant of vte] and nqu (non-
photochemical guenching I), which cannot accumulate zeaxanthin in response to HL and
hence cannot induce non-photochemical quenching (Niyogi et al., 1998), was reported
more susceptible than either single mutant to the combination of HL and low temperature
stress (Havaux et al., 2005). Conversely, the young nqu leaves were also tolerant to
short and long term HL stress (up to HL1800) and accumulated higher level of
tocopherols than wild type (Havaux et al., 2000; Golan et al., 2006). These data suggest
that tocopherols and carotenoids, particularly zeaxanthin, have overlapping functions in
protecting photosynthetic organisms against HL stress.

In prior studies it was demonstrated that, although vtel and vte2 are both
tocopherol deficient, the two genotypes behaved quite differently during early seedling
development: vte2 exhibited a >100 fold increase in non-enzymatic lipid peroxidation
during germination, whereas lipid peroxidation in vte] was identical to wild type (Sattler
et al., 2004; SE. Sattler, L. Mene-Saffrane, E.E. Farmer, M. Krischke, M.J. Mueller, and
D. DellaPenna, unpublished data). In the current study vte] was again found to behave

differently from vte2. In response to HL1800 stress vte] had a slightly, but reproducibly,

109

higher degree of photoinhibition and higher level of photobleaching than either vte2 or
wild type (Figure 3.2, Table 3.2 and Supplemental Figure 3.82), suggesting the vte]
mutation negatively impacts HL stress tolerance beyond its tocopherol deficiency. Why
would vte] respond so differently from vte2 during germination and HL1800 given that
both mutant genotypes are tocopherol deficient? The most likely explanation resides in
the singularly unique biochemical feature of vte]: it accumulates the redox active quinol
biosynthetic intermediate DMPBQ in place of tocopherols. DMPBQ is absent from vte2
and Col (Table 3.1 and Sattler et al., 2003) and its presence in We] can clearly have
significant, unintended experimental consequences that are independent of the tocopherol
deficiency in vte]. Thus, when attempting to define tocopherol functions based on vte
mutant phenotypes one must be careful to delineate genuine tocopherol functions, which
would occur in both We] and vte2, from potentially confounding artifacts due to the
presence of DMPBQ, which would only occur in vtel. Such DMPBQ-dependent artifacts
can have negative (HL1800), positive (seedling germination) or partially positive (low
temperature adaptation) consequences depending on the treatment condition and

phenotype assessed. These concerns are not relevant for vte2.

Arabidopsis Tocopherol-Deficient Mutants Exhibit a Cold Sensitive Phenotype
Independent of Photooxidative Damage.

In contrast to the equivocal results of HL, salinity and drought stress treatments with
tocopherol-deficient photosynthetic organisms (Figure 3.2, Supplemental Figures 3.81
and S2, Porfirova et al., 2002; Havaux et al., 2005; Maeda et al., 2005), both tocopherol-

deficient vte] and vte2 genotypes were found susceptible to non-freezing low temperature

110

treatments in comparison to their respective wild types (Figure 3.3). These results clearly
indicate that tocopherols play a critical role in the responses of mature Arabidopsis plants
to non-freezing low temperatures. Given the well-defined role of tocopherols as lipid
soluble antioxidants, we initially hypothesized that tocopherol-deficiency at low
temperature would result in increased photooxidative damage relative to wild type and
that this might lead to the low temperature sensitive phenotype observed in vte2.
However, the hallmarks of photooxidative stress and photoinhibition: decreased Fv/Fm
and chlorophyll levels and increased zeaxanthin accumulation and lipid peroxidation
(Havaux and Niyogi, 1999; Maxwell and Johnson, 2000; Broin and Rey, 2003) were not
observed during the first two weeks of low temperature treatment (Figures 3.4B, 4C, 5A,
and Supplemental Table 3.82), the timeframe during which the vte2 carbohydrate
accumulation phenotype fully develops (Figures 3.6 and 7). Likewise, (bpsn, though
altered by low temperature, was identical between wild type and vte2 during the first
week of low temperature treatment (Figure 3.5B). These data indicate that the tocopherol-
deficiency has no discemable impact on photosynthesis under the low temperature
conditions used and that the low temperature sensitive phenotype of vte2 is not associated
with increased photooxidative damage or photoinhibition due to the absence of

tocopherols.

Tocopherols Are Required for Photoassimilate Export from Source Leaves During
Low Temperature Adaptation
A well-documented response of plants to low temperatures is the accumulation of soluble

sugars and other osmoprotectants, which are critical components for the process of cold

111

acclimation leading to freezing tolerance (Wanner and Junttila, 1999; Gilmour et al.,
2000). The subsequent recovery of photosynthesis and sucrose metabolism is an
important component of low temperature adaptation in that it provides carbon to sustain
growth under low temperatures (Strand et al., 1997; Strand et al., 1999). During the first
two days of low temperature treatment, soluble sugar levels increased similarly in both
vte2 and wild type (Figure 3.7), suggesting tocopherols have little impact on the initial
accumulation of soluble sugars in response to low temperature. However, the
accumulation of sucrose and other soluble sugars was much higher in vte2 than wild type
after 60 h of low temperature treatment (Figures 3.7B-D), although the rates of
photosynthesis and carbon fixation were indistinguishable between the two genotypes
until 14 days at low temperature (Figures 3.4B and 9C). vte2 also reduced soluble sugar
levels more slowly at night than wild type after 3 days of low temperature treatment
(Figures 3.7B-D). These results suggest that tocopherol deficiency affects carbohydrate
utilization/mobilization rather than the supply of fixed carbon from photosynthesis during
low temperature adaptation.

14COz-labeling experiments demonstrated that in comparison to wild type, low
temperature-treated vte2 translocated significantly less l4C-labeled photoassimilates from
leaves (source tissue) to roots (sink tissue, Figure 3.9A). The long distance transport of
photoassimilates occurs through phloem and the transport rate is determined either by the
rate of export from source leaves to phloem (loading) or by removal into sink tissues
(unloading) (Vanbel, 1993; Stitt, 1996; Herbers and Sonnewald, 1998). Phloem exudation
experiments with excised leaves showed that vte2 source leaves exported significantly

less l4C labeled photoassimilates than wild type as early as 6 h following transfer to low

112

temperature (Figure 3.9C). The rapidity of this reduction in photoassimilate export in
comparison to the elevated sugar accumulation in vte2 starting at 60 h (compare Figure
3.9 and 7) indicates that impaired photoassimilate export is an early, upstream event in
the vte2 low temperature phenotype and the likely root cause of the elevated sugar
accumulation in low temperature-treated vte2. Taken together, these analyses
demonstrate that tocopherols are required for proper regulation of photoassimilate export
from source leaves and thereby play a critical role in low temperature adaptation in
Arabidopsis.

Previous studies of the maize sxd] mutant and potato VTEI-RNAi lines (both
affecting tocopherol cyclase activity) had suggested a linkage between carbohydrate
metabolism and tocopherol biosynthesis, as in both cases carbohydrates accumulated to
high levels in mature leaves at normal growth temperatures (19 to 30°C, Russin et al.,
1996; Provencher et al., 2001; Hofius et al., 2004). The absence of this phenotype in
Arabidopsis vte] and vte2 at 22°C raised questions of the universality of any interaction
between tocopherol synthesis and carbohydrate metabolism (Sattler et al., 2003, Figures
3.6 and 7 at 0 day). We now know that tocopherol-deficient Arabidopsis mutants do
indeed exhibit a phenotype that is analogous to sxdl but which is inducible only at low
temperatures. Thus, the linkage between tocopherol biosynthesis and carbohydrate
metabolism is conserved among all tocopherol-deficient mutants identified in higher
plants to date (maize sde, potato VTEI-RNAi and low temperature-treated Arabidopsis

vtel and vte2).

Although the maize sde mutant and potato VTEI-RNAi line suggested

tocopherol chromanol ring cyclization was somehow related to regulation of

113

carbohydrate metabolism, it was unclear whether the phenotype was due to the lack of
tocopherols or accumulation of the redox active quinol intermediate DMPBQ (Sattler et
al., 2003; Hofius et al., 2004). Analysis of the full suite of Arabidopsis vte mutants now
allows a conclusive answer to this question. Given that vte2 lacks DMPBQ (Table 3.1)
and exhibits a more severe carbohydrate accumulation phenotype than vte] (Figure 3.8),
we can conclude that it is the absence of tocopherols rather than accumulation of
DMPBQ that causes the carbohydrate accumulation phenotype. The reduced severity of
the carbohydrate accumulation phenotype in vte] suggests that DMPBQ partially

suppresses the low temperature-inducible vte2 carbohydrate accumulation phenotype.

Tocopherol Deficiency Results in a Cell Specific Response by Phloem Parenchyma
Transfer Cells at Low Temperature

The carbohydrate accumulation phenotype of maize sde was reported to be associated
with altered structural features within vascular tissue. Plasmodesmata at the sde bundle
sheath/vascular parenchyma boundary were reported occluded by wall materials (Russin
et al., 1996; Provencher et al., 2001) and subsequently suggested to correspond to aniline
blue-positive fluorescence (Botha et al., 2000). This structural aberration in sde
plasmodesmata was posited to be the basis of the sxd] carbohydrate accumulation
phenotype because it would lead to a block in the symplastic movement of
photoassimilate. Callose was also observed in vascular tissue of potato VTEI-RNAi
plants by light microscopy with monoclonal antibodies against B-1,3 glucan (Hofius et al.,
2004). In the absence of high-resolution microscopy, Hofius et al. (2004) also suggested

this vascular-associated callose somehow interrupts photoassimilate tranSport. However,

114

t;

.123

in both the sde and potato VTEI-RNAi studies it was impossible to determine whether
callose deposition was a cause or effect of carbohydrate accumulation. A critical
observation from the present study is that the low temperature-inducible photoassimilate
export defect in Arabidopsis toc0pherol-deficient mutants is temporally associated with
callose deposition in a specific vascular tissue cell type (compare Figures 3.9C and 10).
These results are significant as they provide a direct link between defective
photoassimilate export and callose deposition (or events tightly associated with callose
deposition) in tocopherol-deficient mutants and exclude the possibility that callose
deposition is a secondary effect caused by carbohydrate accumulation.

The low temperature-inducible callose deposition in Arabidopsis vte2 selectively
occurred in phloem parenchyma transfer cells (Figures 3.12 and 13). Importantly, initial
callose deposition was site specific within these cells and resulted in a callose boundary
between the phloem parenchyma transfer cell and sieve element/companion cell complex
where transfer cell wall ingrowths occur (Figure 3.13). We saw no evidence of callose
deposition or occlusion of plasmodesmata at the bundle sheath-vascular parenchyma
boundary during induction of the export defective phenotype in vte2 (e.g., 3 days of low
temperature treatment, Figure 3.13D). However, by 14 days of low temperature treatment,
when vte2 contains high levels of starch and anthocyanins (Figures 3.4D and 6A) and
more closely resembles the phenotype of maize sde, the entire parenchyma transfer cell
became encased in a callose sheath associated with abnormally shaped transfer cell wall
ingrowths and it is at this point that callose deposition is also observed in vte2
plasmodesmata at the bundle sheath-vascular parenchyma boundary (Figure 3.12K).

When one compares the development, polarity and morphology of transfer cell walls in

115

7.5°C-treated vte2 with C01 (e.g. compare Figure 3.12G and L), it becomes clear that
tocopherols play an important role in transfer cell wall synthesis at low temperatures.
Results from previous structural studies on the minor vein structure of
Arabidopsis have suggested that phloem parenchyma transfer cells are the site of
apoplastic unloading of photoassimilates arriving symplastically from bundle sheath cells
(Haritatos et al., 2000). The coincidence in reduction of photoassimilate export with
callose deposition in these spatially distinct subcellular sites in the vte2 mutant during
low temperature treatment (Figures 3.9, 10 and 13) provides direct support for the role of
transfer cells in photoassimilate export from source leaves via delivery to the phloem
apoplast. This callose deposition (or events associated with the callose deposition) in
phloem parenchyma transfer cells of 7.5°C-treated vte2 would form a barrier to symplast-
to-apoplast but not symplast-to—symplast transport. The limited export that still occurs in
7.5°C-treated vte2 source leaves (Figure 3.9) may be due to apoplastic unloading from
bundle sheath cells and subsequent loading to the sieve element/companion cell complex
(Haritatos et al., 2000). The special characteristics of phloem parenchyma transfer cells
that lead them, in comparison to other cell types in the leaf, to be so specifically and
differentially impacted by tocopherol-deficiency during low temperature treatment

remains to be determined.

Tocopherol Functions in Plant Stress Physiology

In the current study the tocopherol-deficient vte2 mutant was found to be remarkably
similar to wild type in its response to most abiotic stresses with the notable exception of

non-freezing low temperature treatments. Tocopherol-deficiency specifically results in

116

abnormal phloem parenchyma transfer cell wall development at low temperature. This
leads to rapid impairment of photoassimilate export that profoundly impacts cellular
metabolism and whole plant physiology during both short and long term low temperature
treatments. That this occurs in both vte2 and vte] strongly argues that tocopherols play a
crucial, previously unrecognized role in low temperature adaptation, specifically in
phloem loading. Several studies have suggested that vascular tissues, including vascular
parenchyma, are metabolically distinct, sensitive to changing environmental conditions
and hence critical sites for stress responses (Orozco—Cardenas et al., 2001; Hibberd and
Quick, 2002; Fryer et al., 2003; Koiwai et al., 2004; Narvaez-Vasquez and Ryan, 2004).
Our data are consistent with this thesis and suggest tocopherols have important
function(s) in regulating the response of these specific cell types to environmental stress,

such as low temperatures.

Our findings that photooxidative damage and photoinhibition are not associated
with the vte2 low temperature phenotype and that HL1800 (which approaches full
sunlight) at 22°C has little impact on vte2 compared to wild type suggest a more limited
role for tocopherols in protecting plants from photooxidative stress than has been
assumed. This seems in direct contradiction with a recent report using Arabidopsis vte
mutants that concluded tocopherols protect Arabidopsis against photoinhibition and
photooxidative stress (Havaux et al., 2005). However, the conclusions of this prior work
were based entirely on the differential responses of wild type and vte mutants exposed to
low temperatures (2-8°C) in combination with HL (1000 to 1600 umol photon tn2 3") for
durations of up to seven days. We now know that such low temperature treatments would

rapidly block photoassimilate export in tocopherol-deficient genotypes, but not in wild

117

type, independent of any light regime imposed (Figures 3.9 to 11) and likely confound
any interpretations with respect to previously proposed HL—specific tocopherol functions.
Thus, the photoprotective functions of tocopherols in plants remain an open question and

a critical reassessment is needed to clarify this issue.

METHODS

Growth Conditions and HL and Low Temperature Treatment

Seeds were stratified for four to seven days (4°C), planted in a vermiculite and soil
mixture fertilized with l X Hoagland solution, and grown in a chamber under permissive
conditions: 12h, 120 umol photon m"2 3'1 light at 22°C/ 12h darkness at 18°C with 70 %
relative humidity. Plants were watered every other day and with 0.5 x Hoagland solution
once a week. For HL treatments, four-week-old plants were transferred in the middle of
the light cycle to 1800 umol photon rn'2 5'1 16h light / 8h darkness at 22°C. For low
temperature treatments, three to four-week-old plants were transferred at the beginning of

light cycle to 12h 75 umol photon m'2 5" light/ 12h darkness at 7.5°C (e < 3°C).

Tocopherol, Anthocyanin, Chlorophyll and Carotenoid Analyses

Leaf samples (12-15 mg) were harvested directly into liquid nitrogen at the end of the
light cycle and lipids extracted in the presence of 0.01 % (w/v) butylated hydroxytoluene
(BHT) using tocol as an internal standard as described (Collakova and DellaPenna, 2001).
After phase separation, the aqueous phase was transferred to a new tube, acidified by
adding an equal volume of 1N HCl and anthocyanin content measured

spectrophotometrically at 520 nm as described (Merzlyak and Chivkunova, 2000). The

118

lipid phase was used for reverse-phase HPLC analyses to identify and quantify each
tocopherol, chlorophyll and carotenoid species as described previously (Collakova and

DellaPenna, 2001; Tian and DellaPenna, 2001).

Lipid Peroxide Analysis

Lipid peroxide content was measured using the ferrous oxidation-xylenol orange (FOX)
assay as previously described (DeLong et al., 2002; Sattler et al., 2004) with the
following modifications. Leaf samples (25-30 mg) harvested at the end of light cycle
were immediately extracted with 200 uL of methanol containing 0.01 % (w/v) BHT, 200
uL of dichloromethane, and 50 uL of 150 mM acetic acid using three 3-mm glass beads
and a commercial paint shaker. After shaking for 4 min, 100 uL of water and 100 uL of
dichloromethane were added for phase separation. Half of the organic phase was
incubated with an equal volume of 50 mM triphenyl phosphine in methanol for 30 min to
reduce lipid peroxides and half was incubated with an equal volume of methanol for 30
min. The triphenyl phosphine-treated and untreated samples (100 uL) were incubated
with 900 uL of FOX reagent [90% (v/v) methanol, 4 mM BHT, 25 mM sulfuric acid, 250
uM ferrous ammonium sulfate, 100 uM xylenol orange] at room temperature for exactly
20 min and A560 was measured. Lipid peroxide content was calculated based on a

standard curve of hydrogen peroxide as previously described (DeLong et al., 2002).

Chlorophyll Fluorescence Measurements
In vivo chlorophyll a fluorescence was measured in the middle of the light cycle using a

Pulse amplitude modulation (PAM) fluorometer FMS2 (PP Systems, Haverhill, MA).

119

Attached leaves were dark adapted for atleast 15 minutes prior to measurements and
fluorescence parameters were determined according to Maxwell and Johnson (2000).
Quantum yield of PSII ($135”) was calculated as (F’m-Ft)/F’m, where F’m and Ft are

maximum fluorescence and steady state fluorescence in the light, respectively.

Carbohydrate Analyses

Soluble sugar (glucose, fructose and sucrose) and starch levels of leaves were quantified
as described (Jones et al., 1977; Lin et al., 1988) with minor modifications. Unshaded
leaf tissue (<50mg) was harvested, immediately frozen in liquid nitrogen and extracted
twice with 700 uL of 80% ethanol at 80°C. The ethanol extract was evaporated and
redissolved in 200 uL of distilled water (Jones et al., 1977). For starch analysis, the
extracted leaf residue was ground in 200 uL 0.2N KOH and boiled at 95°C for 45 min.
After cooling, the sample was neutralized to pH 5 with 50 uL of 1N acetic acid,
centrifuged and 50 uL of supernatant mixed with 492.5 uL of 0.2 M sodium acetate (pH
4.8), 150 uL of H20, 4 uL of a-amylase (4 units) and 3.5 uL of amyloglucosidase (2
units) and incubated at 37°C overnight. Glucose, fructose and sucrose levels in the
soluble sugar extract and the glucose level of the digested starch extract were determined

enzymatically (Jones et al., 1977).

”C02 Labeling Experiments
For phloem exudation experiments, approximately 20 mature leaves (7‘h to 9‘h oldest)
were detached in the middle of the day, 0.5 cm of petiole was re-cut under water, the

petiole of each leaf was submerged in water and placed in a tightly sealed 10 L glass

120

chamber. 14CO; was generated in the chamber by adding 3 mL of 0.25 N H2804 to 0.1
mCi (7 umol) NaH14CO3 and unlabeled 93 mo] NaHCO3 to give a carbon dioxide
concentration of 522 ppm. After labeling for 30 min at 120 umol photon m'2 s", the
petiole of each leaf was submerged in 0.45 mL of 20 mM disodium-
ethylenediaminetetraacetic acid (EDTA) (pH 7.0) and kept in the dark with high humidity
to induce phloem exudation (King and Zeevart 1974). All of the aforementioned
procedures were performed at 7.5°C for low temperature-treated leaf samples. Exudation
of radiolabel into the EDTA solution was then periodically measured over the course of
10 h by liquid scintillation counting (Tri-Carb 2800TR; PerkinElmer, Wellesley, MA,
USA). After 10 h of exudation, radiolabel remaining in the leaves was determined by
liquid scintillation counting. Total radiolabel fixed per leaf was calculated by adding total
radiolabel exuded and remaining in each leaf.

For analyzing translocation of radiolabeled photoassimilates in whole plants,
plants were grown on 1/2 M8 plates under permissive conditions for 3 weeks and
transferred to low temperature conditions for seven days with lids partially ajar to supply
atmospheric C02. Whole plants were labeled at 7.5°C for 40 min as described above,
placed in darkness at 7.5°C and high humidity for 2 h to allow for translocation. Roots
were excised from leaves and both exposed to a phosphor screen to visualize the location
of radioactivity (Storm; GE Healthcare, UK).

Carbohydrate analysis of phloem exudate was performed by high-pH anion
exchange chromatography (HPAEC). Excised leaves were treated as described for
phloem exudation experiments except at the end of the initial 2 h exudation period the

petiole of each leaf was transferred to 0.45 mL water for 4 h to collect exudates for

121

analysis. The water exudates were dried under vacuum, dissolved in 50 uL water and 20
uL of the sample was mixed with 5 uL of standards (25 nmol glucose, 50 nmol fructose,
125 nmol sucrose and 100 nmol raffinose) and injected onto the HPAEC. The mixtures
were separated on a CarboPac PA-lO column (DIONEX, Sunnyvale, CA, USA) using a
30 min linear gradient of 20 to 140 mM NaOH with a flow rate of 1 mL min'l. One mL
fractions were collected and radioactivity was determined by liquid scintillation counting,

while sugar standards were detected by pulsed amperometric detection.

Fluorescence and Transmission Electron Microscopy

Leaves were prepared for aniline blue fluorescence microscopy (n = 2 leaves/plant, 4-6
plants/sample time; Martin, 1959) and transmission electron microscopy (TEM; n = 1
leaf/plant, 2-3 plants/sample time; Sage and Williams, 1995) at the same sampling times
as above for export studies. The presence or absence of callose was determined using
immunolocalization at the level of the TEM as described by Lam et al. (2001) with
monoclonal antibodies to [3-1, 3 glucan (Biosupplies, Australia). Primary and secondary
(anti-mouse IgG gold conjugate 18 nm, Jackson Immunoresearch, West Grove, PA,
USA) antibody dilutions were 1: 100 and 1:20 respectively. Incubation time in the 1°
and 2° antibodies were 2 and l h, respectively. Controls were run by omitting 1°
antibody. Images were captured on the Leica M2 16F fluorescence microscope (Wetzlar,
Germany) and the Phillips 201 TEM equipped with an Advantage HR Camera System

(Advanced Microscopy Techniques Corp. Danvers, MA, USA).

122

Statistical Analysis

One-way ANOVA was used for the data in Table 3.2 and Figure 3.2 using genotype as a
factor. Two-way ANOVA was used for the data in Figure 3.9C using days of cold
treatment and genotype as factors. When significance was observed (P < 0.05), pair-wise
comparison of least square means was evaluated. SAS software was used for these
analyses (SAS Institute, Cary, NC, USA). Student t test was used for the rest of the data
to compare statistical significance of mutants relative to C01 (P < 0.05) using Microsoft

Excel.

Accession Numbers

Sequence data for the Arabidopsis thaliana tocopherol biosynthetic enzymes described in
this article can be found in the GenBank nucleotide sequence database under the
following accession numbers: VTEI (At4g32770), NM119430; VTE2 (At2g18950),

NM179653;VTE4(At1g64970), NM105171.

ACKNOWLEDGMENTS

We thank Maria Magallanes-Lundback for isolation of the vte4-3 allele, Kathy Sault for
technical assistance with microscopy, Ashok Ragavendran at Michigan State University
College of Agriculture and Natural Resources Biometry Group for assistance with
statistical analyses and Andreas Weber, Lars V011 and members of the DellaPenna lab for
their critical advice, discussions and manuscript review. This work was supported by
NSF grant MCB-023529 to D.D.P. and a Connaught Award and NSERC of Canada

Discovery Grant to T.L.S.

123

REF ERENCES

Bergmuller, E., Porfirova, 8., and Dormann, P. (2003). Characterization of an
Arabidopsis mutant deficient in gamma-tocopherol methyltransferase. Plant Mol.

Biol. 52,1181-1190.

Bjorkman, O. and Demmig B. (1987). Photon yield of Oz evolution and chlorophyll

fluorescence characteristics at 77 K among vascular plants of diverse origins. Planta
170, 489-504.

Botha, C.E.J., Cross, R.H.M., van Bel, A.J.E., and Peter, C.I. (2000). Phloem loading
in the sucrose-export-defective (SXD-I) mutant maize is limited by callose
deposition at plasmodesmata in bundle sheath-vascular parenchyma interface.
Protoplasma 214, 65-72.

Bradford, A., Atkinson, J ., Fuller, N., and Rand, RP. (2003). The effect of vitamin E
on the structure of membrane lipid assemblies. J. Lipid Res. 44, 1940-1945.

Bramley, P.M., Elmadfa, 1., Kafatos, A., Kelly, F.J., Manios, Y., Roxborough, H.E.,
Schuch, W., Sheehy, P.J.A., and Wagner, KB. (2000). Vitamin E. J. Sci. Food
Agric. 80, 913-938.

Broin, M., and Rey, P. (2003). Potato plants lacking the CDSP32 plastidic thioredoxin
exhibit overoxidation of the BASl 2-cysteine peroxiredoxin and increased lipid
peroxidation in thylakoids under photooxidative stress. Plant Physiol. 132, 1335-

1343.

Bucke, C. (1968). Distribution and stability of alpha-tocopherol in subcellular fractions
of broad bean leaves. Phytochemistry 7, 693-700.

Chalker-Scott, L. (1999). Environmental significance of anthocyanins in plant stress
responses. Photochem. Photobiol. 70, 1-9.

Cheng, Z.G., Sattler, S., Maeda, H., Sakuragi, Y., Bryant, D.A., and DellaPennaa, D.
(2003). Highly divergent methyltransferases catalyze a conserved reaction in
tocopherol and plastoquinone synthesis in cyanobacteria and photosynthetic
eukaryotes. Plant Cell 15, 2343—2356.

Collakova, E., and DellaPenna, D. (2001). Isolation and functional analysis of
homogentisate phytyltransferase from Synechocystis sp. PCC 6803 and Arabidopsis.
Plant Physiol. 127, 1113-1124.

Collakova, E., and DellaPenna, D. (2003). The role of homogentisate phytyltransferase
and other tocopherol pathway enzymes in the regulation of toc0pherol synthesis
during abiotic stress. Plant Physiol. 133, 930-940.

124

DellaPenna, D., and Pogson, B. (2006). Vitamin synthesis in plants: tocopherols and
carotenoids. Annu. Rev. Plant Biol. 57, 71 1-738.

DeLong, J.M., Prange, R.K., Hodges, D.M., Forney, C.F., Bishop, M.C., and
Quilliam, M. (2002). Using a modified ferrous oxidation-xylenol orange (FOX)

assay for detection of lipid hydroperoxides in plant tissue. J. Agr. Food Chem. 50,
248-254.

Fryer, M.J. (1992). The antioxidant effects of thylakoid vitamin-E (alpha- tocopherol).
Plant Cell Environ. 15, 381-392.

Fryer, M.J., Ball, L., Oxborough, K., Karpinski, 8., Mullineaux, P.M., and Baker,
N.R. (2003). Control of Ascorbate Peroxidase 2 expression by hydrogen peroxide
and leaf water status during excess light stress reveals a functional organisation of
Arabidopsis leaves. Plant J. 33, 691 -705.

Genty, B., Briantais, J.M., and Baker, N.R. (1989). The Relationship between the

quantum yield of photosynthetic electron-transport and quenching of chlorophyll
fluorescence. Biochim. Biophys. Acta 990, 87-92.

Gihnour, S.J., Sebolt, A.M., Salazar, M.P., Everard, J.D., and Thomashow, M.F.
(2000). Overexpression of the Arabidopsis CBF3 transcriptional activator mimics

multiple biochemical changes associated with cold acclimation. Plant Physiol. 124,
1854-1865.

Golan, T., Muller-Moule P., and Niyogi K.K. (2006). Photoprotection mutants of
Arabidopsis thaliana acclimate to high light by increasing photosynthesis and
specific antioxidants. Plant Cell Environ. 29, 879-887.

Goldschmidt, E.E., and Huber, SC. (1992). Regulation of photosynthesis by end—
product accumulation in leaves of plants storing starch, sucrose, and hexose sugars.
Plant Physiol. 99, 1443-1448.

Gottwald, J.R., Krysan, F.J., Young, J.C., Evert, RR, and Sussman,M.R. (2000).
Genetic evidence for the in planta role of phloem-specific plasma membrane sucrose
transporters. Proc. Natl. Acad. Sci. USA 97, 13979—13984.

Ham, A.J.L., and Liebler, D.C. (1995). Vitamin-E oxidation in rat-liver mitochondria.
Biochemistry 34, 5754-5761.

Ham, A.J.L., and Liebler, D.C. (1997). Antioxidant reactions of vitamin E in the
perfused rat liver: Product distribution and effect of dietary vitamin E

supplementation. Arch. Biochem. Biophys. 339, 157-164.

Haritatos, E., Medville, R., and Turgeon, R. (2000). Minor vein structure and sugar
transport in Arabidopsis thaliana. Planta 211, 105—111.

125

Havaux, M., Bonfils J.P., Lutz C., and Niyogi K.K. (2000). Photodamage of the
photosynthetic apparatus and its dependence on the leaf developmental stage in the

npql Arabidopsis mutant deficient in the xanthophyll cycle enzyme Violaxanthin de-
epoxidase. Plant Physiol. 124, 273-284.

Havaux, M., and Niyogi, K.K. (1999). The Violaxanthin cycle protects plants from
photooxidative damage by more than one mechanism. Proc. Natl. Acad. Sci. USA 96,
8762-8767.

Havaux, M., Eymery, F., Porfirova, S., Rey, P., and Dormann, P. (2005). Vitamin E
protects against photoinhibition and photooxidative stress in Arabidopsis thaliana.
Plant Cell 17, 3451-3469.

Herbers, K., and Sonnewald, U. (1998). Molecular determinants of sink strength. Curr.
Opin. Plant Biol. 1, 207-216.

Hibberd, J.M., and Quick, W.P. (2002). Characteristics of C-4 photosynthesis in stems
and petioles of C-3 flowering plants. Nature 415, 451-454.

Hofius, D., Hajirezaei, M.R., Geiger, M., Tschiersch, H., Melzer, M., and Sonnewald,

U. (2004). RNAi-mediated tocopherol deficiency impairs photoassimilate export in
transgenic potato plants. Plant Physiol. 135, 1256-1268.

Jiang, Q., Elson-Schwab, I., Courtemanche, C., and Ames, EN. (2000). gamma-
Tocopherol and its major metabolite, in contrast to alpha-tocopherol, inhibit

cyclooxygenase activity in macrophages and epithelial cells. Proc. Natl. Acad. Sci.
USA 97, 11494-11499.

Jones, M.G.K., Outlaw, W.H., and Lowry, OH. (1977). Enzymic assay of 10’7 to 10’14
moles of sucrose in plant-tissues. Plant Physiol. 60, 379-383.

Keles, Y., and Oncel, I. (2002). Response of antioxidative defence system to
temperature and water stress combinations in wheat seedlings. Plant Sci. 163, 783-
790.

Kempna, P., Reiter, E., Arock, M., Azzi, A., and Zingg, J.M. (2004). Inhibition of
HMC-l mast cell proliferation by vitamin E - Involvement of the protein kinase B

pathway. J. Biol. Chem. 279, 50700-50709.

King, R.W., and Zeevaart, J.A. (1974). Enhancement of phloem exudation from cut
petioles by chelating agents. Plant Physiol. 53, 96—103.

Koch, K.E. (1996). Carbohydrate-modulated gene expression in plants. Annu. Rev. Plant
Physiol. Plant Mol. Biol. 47, 509-540.

126

Koiwai, H., Nakaminami, K., Seo, M., Mitsuhashi, W., Toyomasu, T., and Koshiba,
T. (2004). Tissue-specific localization of an abscisic acid biosynthetic enzyme,
AAO3, in Arabidopsis. Plant Physiol. 134, 1697-1707.

Lam, B.C.H., Sage, T.L., Bianchi, F., and Blumwald, E. (2001). Role of SH3 domain-
containing proteins in clathrin-mediated vesicle trafficking in Arabidopsis. Plant Cell
13, 2499-2512.

Leyva, A., Jarillo, J.A., Salinas, J., and Martinezzapater, J.M. (1995). Low-
temperature induces the accumulation of phenylalanine ammonia-lyase and chalcone

synthase messenger-RNAs of Arabidopsis-thaliana in a light-dependent manner.
Plant Physiol. 108, 39-46.

Lichtenthaler, H.K., Prenzel, U., Douce, R., and Joyard, J. (1981). Localization of
prenquuinones in the envelope of spinach-chloroplasts. Biochim. Biophys. Acta.
641, 99-105.

Liebler, D.C., and Burr, J.A. (1992). Oxidation of vitamin-E during iron-catalyzed
lipid-peroxidation - evidence for electron-transfer reactions of the tocopheroxyl
radical. Biochemistry 31, 8278-8284.

Lin, T.P., Caspar, T., Somerville, C., and Preiss, J. (1988). Isolation and
characterization of a starchless mutant of Arabidopsis-thaliana (L) Heynh lacking
ADP-glucose pyrophosphorylase activity. Plant Physiol. 86, 1131-1135.

Machlin, L.J., Filipski, R., Nelson, J., Horn, L.R., and Brin, M. (1977). Effects of a
prolonged vitamin-E-deficiency in rat. J. Nutri. 107, 1200-1208.

Maeda, H., Sakuragi, Y., Bryant, D.A., and DellaPenna, D. (2005). Tocopherols
protect Synechocystis sp strain PCC 6803 from lipid peroxidation. Plant Physiol. 138,
1422-1435.

Martin, F.W. (1959). Staining and observing pollen tubes in the style by means of
fluorescence. Stain Technol. 34, 125-128.

Maxwell, K., and Johnson, G.N. (2000). Chlorophyll fluorescence - a practical guide. J.
Exp. Bot. 51, 659-668.

Merzlyak, M.N., and Chivkunova, 0.8. (2000). Light-stress-induced pigment changes
and evidence for anthocyanin photoprotection in apples. J. Photochem. Photobiol. B

55, 155-163.

Muller, P., Li, X.P., and Niyogi, K.K. (2001). Non-photochemical quenching. A
response to excess light energy. Plant Physiol. 125, 1558-1566.

127

Munne-Bosch, 8., and Alegre, L. (2002). The function of tocopherols and tocotrienols
in plants. Crit. Rev. Plant Sci. 21, 31-57.

Munne-Bosch, 8., Schwarz, K., and Alegre, L. (1999). Enhanced formation of alpha-
toc0pherol and highly oxidized abietane diterpenes in water-stressed rosemary plants.
Plant Physiol. 121, 1047-1052.

Narvaez-Vasquez, J ., and Ryan, C.A. (2004). The cellular localization of prosystemin:
a functional role for phloem parenchyma in systemic wound signaling. Planta 218,
360-369.

Nishimura, M.T., Stein, M., Hou, B.H., Vogel, J.P., Edwards, H., and Somerville,
SC. (2003). Loss of a callose synthase results in salicylic acid-dependent disease
resistance. Science 301, 969-972.

Niyogi, K.K., Grossman, A.R., and Bjorkman, O. (1998). Arabidopsis mutants define
a central role for the xanthophyll cycle in the regulation of photosynthetic energy
conversion. Plant Cell 10, 1121-1134.

Orozco-Cardenas, M.L., Narvaez-Vasquez, J., and Ryan, C.A. (2001). Hydrogen
peroxide acts as a second messenger for the induction of defense genes in tomato
plants in response to wounding, systemin, and methyl jasmonate. Plant Cell 13, 179-
191.

Paul, M.J., and Foyer, CH. (2001). Sink regulation of photosynthesis. J. Exp. Bot. 52,
1383-1400.

Paul, M.J., and Peliny, T.K. (2003). Carbon metabolite feedback regulation of leaf
photosynthesis and development. J. Exp. Bot. 54, 539-547.

Porfirova, S., Bergmuller, E., Tropf, 8., Lemke, R., and Dormann, P. (2002).
Isolation of an Arabidopsis mutant lacking vitamin E and identification of a cyclase
essential for all tocopherol biosynthesis. Proc. Natl. Acad. Sci. USA 99, 12495-
12500.

Provencher, L.M., Miao, L., Sinha, N., and Lucas, W.J. (2001). Sucrose export
defective] encodes a novel protein implicated in chloroplast-to-nucleus signaling.
Plant Cell 13, 1127-1141.

Ricciarelli, R., Tasinato, A., Clement, 8., Ozer, N.K., Boscoboinik, D., and Azzi, A.
(1998). alpha-Tocopherol specifically inactivates cellular protein kinase C alpha by
changing its phosphorylation state. Biochem. J. 334, 243-249.

Rimbach, G., Minihane, A.M., Majewicz, J ., Fischer, A., Pallauf, J ., Virgli, F., and

Weinberg, RD. (2002). Regulation of cell signalling by vitamin B. Proc. Nutr. Soc.
61, 415-425.

128

Russin, W.A., Evert, R.F., Vanderveer, P.J., Sharkey, T.D., and Briggs, S.P. (1996).
Modification of a specific class of plasmodesmata and loss of sucrose export ability
in the sucrose export defective] maize mutant. Plant Cell 8, 645-658.

Sage, T.L., and Williams, EC. (1995). Structure, ultrastructure, and histochemistry of
the pollen-tube pathway in the Milkweed Asclepias-Exaltata L. Sex. Plant Reprod. 8,
257-265.

Sattler, S.E., Cahoon, E.B., Coughlan, S.J., and DellaPenna, D. (2003).
Characterization of tocopherol cyclases from higher plants and cyanobacteria.

Evolutionary implications for tocopherol synthesis and function. Plant Physiol. 132,
2184-2195.

Sattler, S.E., Gilliland, L.U., Magallanes-Lundback, M., Pollard, M., and
DellaPenna, D. (2004). Vitamin E is essential for seed longevity, and for preventing
lipid peroxidation during germination. Plant Cell 16, 1419-1432.

Sattler, S.E., Mene-Saffrane, L., Farmer, E.E., Krischke, M., Mueller, M.J., and
DellaPenna D. (2006). Non-enzymatic lipid peroxidation reprograms gene

expression and activates defense markers in tocopherol deficient mutants. Submitted
to Plant Cell.

Schneider, C. (2005). Chemistry and biology of vitamin E. Mol. Nutr. Food Res. 49, 7-
30.

Shintani, D., and DellaPenna, D. (1998). Elevating the vitamin E content of plants
through metabolic engineering. Science 282, 2098-2100.

8011, J. (1987). Alpha-tocopherol and plastoquinone synthesis in chloroplast Membranes.
Method Enzymol. 148, 383—392.

8011, J., Douce, R., and Schultz, G. (1980). Site of biosynthesis of alpha-tocopherol in
spinach-chloroplasts. FEBS Lett. 112, 243-246.

8011, J., Schultz, G., Joyard, J., Douce, R., and Block, M.A. (1985). Localization and
synthesis of prenquuinones in isolated outer and inner envelope membranes from
spinach-chloroplasts. Arch. Biochem. Biophys. 238, 290-299.

Stillwell, W., Dallman, T., Dumaual, A.C., Crump, F.T., and Jenski, LJ. (1996).
Cholesterol versus alpha-tocopherol: Effects on properties of bilayers made from
heteroacid phosphatidylcholines. Biochemistry 35, 13353-13362.

Stitt, M. (1996). Plasmodesmata play an essential role in sucrose export from leaves: A

step toward an integration of metabolic biochemistry and cell biology. Plant Cell 8,
565-571.

129

Strand, A., Hurry, V., Gustafsson, P., and Gardestrom, P. (1997). Development of
Arabidopsis thaliana leaves at low temperatures releases the suppression of
photosynthesis and photosynthetic gene expression despite the accumulation of

soluble carbohydrates. Plant J. 12, 605-614.

Strand, A., Hurry, V., Henkes, 8., Huner, N., Gustafsson, P., Gardestrom, P., and
Stitt, M. (1999). Acclimation of Arabidopsis leaves deve10ping at low temperatures.
Increasing cytoplasmic volume accompanies increased activities of enzymes in the
Calvin cycle and in the sucrose-biosynthesis pathway. Plant Physiol. 119, 1387-1398.

Taji, T., Ohsumi, C., Seki, M., Iuchi, 8., Yamaguchi-Shinozaki, K., and Shinozaki, K.
(2002). Important roles of drought- and cold-inducible genes for galactinol synthase
in stress tolerance in Arabidopsis thaliana. Plant Cell Physiol. 43, 8233-8233.

Tian, L., and DellaPenna, D. (2001). Characterization of a second carotenoid beta-
hydroxylase gene from Arabidopsis and its relationship to the LUTl locus. Plant
Mol. Biol. 47, 379-388.

Trebst, A., Depka, B., and Hollander-Czytko, H. (2002). A specific role for tocopherol
and of chemical singlet oxygen quenchers in the maintenance of photosystem 11
structure and function in Chlamydomonas reinhardtii. FEBS Lett. 516, 156-160.

Vanbel, A.J.E. (1993). Strategies of Phloem Loading. Annu. Rev. Plant Physiol. Plant
Mol. Biol. 44, 253-281.

Vidi, P.A., Kanwischer, M., Baginsky, 8., Austin, J.R., Csucs, G., Dormann, P.,
Kessler, F., and Brehelin, C. (2006). Tocopherol cyclase (VTEl) localization and
vitamin E accumulation in chloroplast plastoglobule lipoprotein particles. J. Biol.
Chem. 281, 11225-11234.

Wang, X.Y., and Quinn, PJ. (2000). The location and function of vitamin E in
membranes (review). Mol. Membr. Biol. 17, 143-156.

Wanner, L.A., and Junttila, O. (1999). Cold-induced freezing tolerance in Arabidopsis.
Plant Physiol. 120, 391-399.

Wassall, S.R., Thewalt, J.L., Wong, L., Gorrissen, H., and Cushley, R.J. ( 1986).
Deuterium NMR-study of the interaction of alpha-toc0pherol with a phospholipid
model membrane. Biochemistry 25, 319-326.

Yokota, T., Igarashi, K., Uchihara, T., Jishage, K., Tomita, H., Inaba, A., Li, Y.,
Arita, M., Suzuki, H., Mizusawa, H., and Arai, H. (2001). Delayed-onset ataxia in
mice lacking alpha -tocopherol transfer protein: model for neuronal degeneration
caused by chronic oxidative stress. Proc. Natl. Acad. Sci. USA 98, 15185-15190.

130

FIGURES AND TABLES

Table 3.1. Tocopherol and DMPBQ Content in Leaves of Wild Types and Tocopherol
Biosynthetic Mutants Grown Under Permissive Conditions.

 

total DMPBQ

 

01° [3 y 8

Col 15.6 :1: 3.0 o” 0.6 e 0.1 o 16.2 e 3.0 o
vte2-1° o o o o o o
vte1-1° o o o o o 19.6 e 1.3
vte1-2° o o o o o 17.3 e 1.8

Ws 12.3 :1: 2.2 o o o 12.3 e 2.2 o
vte2-2" o o o o o o
vte4-3" o o 17.7 :1: 1.2 o 17.7 e 1.2 o

 

Plants were grown for four weeks under permissive conditions and mature leaves were harvested
for analysis. Data are means i SD (n = 3 or 4) and are expressed as pmol/mg FW.

0 a, B, y and 8 indicate a, B, y and 8-tocopherol, respectively.
b 0 indicates the compound was below detection (typically 5 0.1 pmol/mg FW).
c Col background.

d Ws background.

131

Table 3.2. Content of Photosynthetic Pigments and Tocopherols of C01 and the vte2 and vte]
Mutants After 111.1800 Treatment at 22°C.

 

 

 

 

 

After HL1800
Col vte2-1 vte1-1 vte1-2
m" 1.56 1 025° 0 1 0° 0 1 0° 0 1 0°
tococpherols
Total
cMomphyns 17.26 1 1.01 16.60 1 1.37 16.51 1 1.64 16.21 1 2.05
Chla 12.25 1 0.67 11.69 1 1.04 11.61 1 1.36 11.52 1 1.58
Chlb 5.02 1 0.26 4.90 1 0.35 4.90 1 0.51 4.69 1 0.50
ChlalChlb 2.44 1 0.16 2.36 1 0.09 2.37 1 0.13 2.45 1 0.14
Total 8 b b o
carotenoids 5.37 1 0.35 4.96 1 0.36 4.65 1 0.54 4.75 1 0.70
p-ear 0.66 1 0.08 0.64 1 0.07 0.63 1 0.09 0.64 1 0.11
lutein 2.45 1 0.14a 2.39 1 015°° 2.26 1 022°° 2.20 1 027°
N 0.57 1 0.03a 0.51 1 004° 0.51 1 006° 0.50 1 007°
v 1.01 1 012° 0.57 1 010° 0.76 1 017° 0.77 1 022°
A 0.39 1 004°° 0.39 1 0.04a 0.36 1 004°° 0.36 1 004°
z 0.26 1 005° 0.46 1 006° 0.30 1 006° 0.29 1 003°
A+Z+V 1.69 1 013° 1.44 1 012° 1.44 1 016° 1.42 1 026°
A+ZIA+Z+V 0.40 1 005° 0.61 1 005° 046 1 007° 0.47 1 007°

 

Plants were grown for four weeks under permissive growth conditions (120 nmol photon In2 6‘)
and pigment contents were analyzed after 4 days of HL (1800 nmol photon m’2 s") treatment. Data
are means i SD (ug/cmz, n = 19). When significance is observed between genotypes (ANOVA, P <
0.05), pair-wise comparison of least square means is evaluated and non-significant groups are
indicated by a, b or c with a being the highest group. N, neoxanthin; B-car, B-carotene; V,
Violaxanthin; A, antheraxanthin; Z, zeaxanthin; Chlb, chlorophyll b; Chla, chlorophyll a.

132

Table 3.3. Yields and Abortion Rates of Seed Produced During Low Temperature (7.5°C)
Treatment.

 

 

Col vteZ-1 vte1-1
seeds! silique 31.1 1 1.6 19.5 1 3.4“ 27.3 1 2.5*
aborted seeds I sillique 0.1 :1 0.4 6.8 1 2.4** 2.0110"
percentage abortion (%) 0.4 34.6" 73*
yield (mg seeds I plant) 373 1 77 87 :1: 27** 22:36'

 

Data are means d: SD (n = 3 for yields, n = 7 for aborted seed). Student’s t tests relative to C01 (*P
< 0.05, "P < 0.01).

a An average of duplicate plants (225.7 and 219.4 mg seeds/plant)

133

Supplemental Table 3.81. Content of Photosynthetic Pigments and Tocopherols of C01 and
the vte2 and vtel Mutants Grown at Permissive condition.

 

 

 

Before HL1800
Col vte2-1 vte1-1 vte1-2
“‘3' 0.11 1 001° 0 1 0° 0 1 0° 0 1 0°
tococpherols
"’3' 21.901114 205111.70 201511.12 21.261119
chlorophylls
Chla 15.26 1 0.77 14.25 1 1.16 14.02 1 0.79 14.76 1 0.84
0th 6.64 1 0.37 6.25 1 0.53 6.13 1 0.33 6.49 1 0.35
ChlalChlb 2.30 1 0.03 2.26 1 0.02 2.29 1 0.01 2.26 1 0.02
Tm". 3.56 1 0.23 3.32 1 0.28 3.26 1 0.18 3.44 1 0.22
carotenonds
B-car 0.61 1 005° 0.57 1 003° 0.55 1 003° 0.59 1 005°°
lutein 1.651013 1.721016 1.701010 1.791012
N 0.59 1 0.03 0.55 1 0.05 0.54 1 0.03 0.57 1 0.03
v 0.51 1 0.04 0.48 1 0.05 0.49 1 0.03 0.50 1 0.03
A 0 1 0 0 1 0 0 1 0 0 1 0
z 0 1 0 o 1 0 0 1 0 0 1 0
A+z+v 0.51 1 0.04 0.46 1 0.05 0.49 1 0.03 0.50 1 0.03
A+ZIA+Z+V 010 010 010 010

 

Plants were grown for four weeks under permissive grth conditions (22°C, 120 umol photon m'2
s") and mature leaves were analyzed. Data are means i SD (ug/cmz, n = 7). When significance is
observed between genotypes (ANOVA, P < 0.05), pair-wise comparison of least square means is
evaluated and non-significant groups are indicated by a or b with a being the highest group. N,
neoxanthin; B-car, B-carotene; V, Violaxanthin; A, antheraxanthin; Z, zeaxanthin; Chlb,
chlorophyll b; Chla, chlorophyll a.

134

Supplemental Table 3.82. Content of Individual Photosynthetic Pigments of C01 and the vte2
Mutant During Low Temperature (7.5°C) Treatment.

 

 

 

 

Days lutein B-car N total Car

in cold Col vte2-1 Col vte2-1 Col vte2-1 Col vte2-1
0 154116 165110 66110 7916 431:3 4612 301132 330121
1 14817 167121 65:4 73:14 39:12 4516 283:1:14 319143
2 15417 17018 641:7 72:8 42:2 4313 297118 329119
5 16718 16819 63:13 6614 40:1 42:3 319114 327118
7 160111 160111 5814 5814 4213 421:3 309125 309125
14 159113 146126 6113 54113 4512 401:9 313123 286154
28 184114 10519“ 86:13 4817” 551:3 2715“ 374130 213119“
Days V A Z ChlalChlb

in cold Col vteZ-t Col vte2-1 Col vte2-1 Col vte2-1
0 371:3 4013 1:0 11:0 0:0 0:0 2.321006 2.401004
1 271:3 3115 4:11 412 01:0 01:0 2.371003 2.381003
2 34:2 411:3 3:10 21:1 01:0 0:10 2.391007 2.491003
5 461:3 50:3 212 211 010 010 2.301002 2.341005
7 4618 4618 411 411 0:0 0:0 2.281003 2.281003
14 4614 40:6 2:2 51:2 01:0 01:0 2.321003 2.391002
28 4613 301:1" 211 3:1 0:10 01:0 2.391012 2.601018”

 

135

Supplemental Table 3.S2. (continued)

 

 

Days Chlb Chla total Chl
in cold Col vte2-1 Col vt92-1 Col vt92-1
0 363123 388118 842175 931148 1205198 1319165
1 320111 359141 759134 8541107 1079145 12121148
2 31616 317130 753138 790168 1069144 1107198
5 25817 262116 593118 613130 851 124 875146
7 246 1 17 246 1 17 559 1 32 559 1 32 805 1 49 805 1 49
14 251 1 9 209 1 39 581 1 18 499 1 95 832 1 26 708 1 134
28 304 1 27 138 1 21“ 729 1 89 357 1 49” 1033 1 114 495 1 69“

 

Values are expressed as pmol/mg FW. Data are means :1: SD (n = 4 or 5). Student’s t tests of vteZ-I
relative to C01 (* P < 0.05, ** P < 0.01). N, neoxanthin; B-car, B-carotene; V, Violaxanthin; A,

antheraxanthin; Z, zeaxanthin; total Car, total carotenoids; Chlb, chlorophyll b; Chla, chlorophyll
a; total Chl, total chlorophylls.

136

HPP GGDP

HGA PDP
thez
I'D H FD / H WPBQ
W: iii-D mrdv‘l
MPBQ H

@h—vte1——-l

y-tocop hero!
8-tocophemmr W3"

Wh— vte4 —-I

W a-tocop hero!
H
B-toco pherol 3 0 r

Figure 3.1. Tocopherol Biosynthetic Pathway and vte Mutations in Arabidopsis thaliana.
Enzymes are indicated by black boxes and mutations by gray letters and lines. Bold arrows show
the primary biosynthetic route in wild type leaves. HPP, hydroxyphenylpyruvate; GGDP,
geranylgeranyl-diphosphate; PDP, phytyl-diphosphate; HGA, homogentisic acid; MPBQ,
2-methyl-6-phytyl-1,4-benzoquinol; DMPBQ, 2,3-dimethy1-6-phytyl-1 ,4-benzoquinol; HPPD,
HPP dioxygenase; GGDR, GGDP reductase; HPT, HGA phytyltransferase; TC, tocopherol cyclase;
MT, MPBQ methyltransferase; y-TMT, y-tocopherol methyltransferase; vte] , vteZ and vte4,
mutants of TC, HPT and y-TMT, respectively.

137

 

Figure 3.2. Phenotypic and Photosynthetic Responses of C01 and the vte2 and vtel
Mutants to BL stress.

Plants were grown under permissive conditions for four weeks and then transferred to HL stress in
the middle of the day. When significance is observed between genotypes (ANOVA, P < 0.05),
pair-wise comparison of least square means is evaluated and non-significant groups are indicated
by a, b or c with a being the highest group.

(A) Six representative plants after 3 days of HL1800. Bars = 2 cm.

(B) and (C) Individual values of total chlorophyll (B) and carotenoid (C) contents from 19 leaves
after 4 days of HL1800.

(D) Individual values of Fv/Fm from 30 leaves after 24 h of HL1800.

138

U

 

 

 

“‘1'
“CO 3
3
“‘7
mo 0 3
'S
g“
.00 o c'a
O
3
mm) “’3
o
«B. .:_ 5. «'v . o'o. 4! l. 5
O O O O O O O O
u|:|Il\:l
°“.'
0 moo o E
'9‘-
m E
“h
cum 9;;
E
(0—
0
00mm 0
.1 S .3 J: J» :1. .1 é
(zinc/6d) spgoueimeo mo;
‘1‘
0100000 ‘5
E
‘7
oamcooo ‘5
E
‘.'
m ‘3
E
'3
«mo 0
a .3 a .3 a

I
In
N

(two/6d) sullqdmomo mo;

139

Figure 3.2. (continued)

vteZ-y Krill-3

9,." '4’

 

Figure 3.3. Visible Phenotype of vte Mutants During Extended Low Temperature
Treatment.

Plants were grown under permissive conditions for three weeks and then subjected to 7.5°C
treatment for the indicated time periods.

(A) to (D) Representative plants of three-week—old wild type (C01 and W5), vtel-1 and vte2-1 (Col
background), vte2-2 and vte4-3 (Ws background) afier 0 day (A), one month (B), two months (C)
and four months (D) of 7.5°C treatment. Bars = 2 cm.

(E) Representative siliques from Col, vteI-I and vte2-1 plants after five months of low temperature
treatment. Bar = 0.2 cm. Arrows denote aborted seeds in vtel-1 and vte--I siliques.

140

 

 

 

 

 

 

  
 

 

 

 

 

 

E 5'
E a
D
E = 4a
2
.5. I; 31
2 8
0 '§ 2d
3 2
.C
=- 8.
§ 2 1W ...... i ...
a . .
h j 0' It i I U r I
0 5 10 15 20 25 30
1.5 C D
f E 3' ..
a a
g 1‘ $2.5
E ° 2. .
é ......... “ 21.54 **
€051 "Q 5 1-
g §O.51 x"
a: 5 -
° 0 . . . . . . 2 0M f . o-.
0 5 10 15 20 25 30 0 5 1O 15 20 25 30
Days of 7.5‘C treatment
E .
é
o .
E
E.
I
3 .
c
501‘
8 .
8 0 I U fi U U I

 

 

0 5 10 15 20 25 30

Days of 7.5°C treatment
Figure 3.4. Tocopherol, Lipid Peroxide, Anthocyanin, and Photosynthetic Pigment
Content of Col and the vte2 Mutant During Four Weeks of Low Temperature Treatment.
Col (closed circles) and vte2-I (open squares) were grown under permissive conditions for four
weeks and then transferred to 7.5°C conditions at the beginning of the light cycle for the indicated
time. Data are means 1 SD (n = 3 or 4). Student’s t tests of vte2-1 relative to C01 at each time point
(*P < 0.05, "P < 0.01).
(A) Total tocopherols
(B) Lipid peroxides
(C) Total chlorophylls
(D) Anthocyanins
(E) Total carotenoids

141

 

 

 

 

 

 

 

P
mhmééém
“60606“:
O O O O

a: ““CD
p.
“I. -
3c:
0:
+0

L

a'o. .: «a.
O O O
"HIM

 

20 25 30
Days of 7.5 °C treatment

15

10

20 25 30
Days of 7.5 °C treatment

15

10

142

Figure 3.5. Photosynthetic Status
of Col and the vte2 Mutant During
Four Weeks of Low Temperature
Treatment.

Col (closed circles) and vte2-1 (open
squares) were grown under permissive
conditions for four weeks and then
transferred to 7.5°C conditions at the
beginning of the light cycle for the
indicated time. Analysis was conducted
in the middle of the light cycle. Data are
means 1 SD (n = 4). Student’s t tests of
vte2-I relative to C01 at each time point
(*P < 0.05).

(A) Maximum photosynthetic
efficiency (Fv/Fm)

(B) Quantum yield of PSII ((Dpsn)

Fructose (pmolIgFW) Glucose (nmol/917W) 31876“ (pmol O'UIQFW)

Sucrose (pmolIgFW)

1

 

 

 

 

 

 

 

 

 

 

 

 

0 5 10 15 20 25
Days of 7.5°C treatment

143

30

Figure 3.6. Changes in Starch
and Soluble Sugar levels in Col
and the vte2 Mutant During Four
Weeks of Low Temperature
Treatment.

Col (closed circles) and vte2-I (open
squares) were grown under
permissive conditions for four
weeks and then transferred to 7.5°C
conditions at the beginning of the
light cycle for the indicated time.
Samples were harvested at the end
of light cycles. 0 days of cold
treatment indicates the end of the
light cycle of the day prior to
initiating 7.5°C treatment. Starch is
expressed as nmol glucose
equivalents / g FW. Data are means
1 SD (n = 3 or 4). Student’s t tests of
vte2-1 relative to C01 at each time
point (*P < 0.05, **P < 0.01).

(A) Starch

(B) Glucose

(C) Fructose

(D) Sucrose

Fructose (pmolIgFW) Glucose (pmolIgFW) Starch (nmol quIgFW)

Sucrose (pmolIgFW)

:3
P
6.
N
0|
0"

3.35

E3

 

-25 -13
80-

 

 

 

-1

 

  
 

 

11 23 35 47 59 71 83 95 107

.. .. E.

i"

      

**

.1

*1'

i

 

   

       

V V V

11 23 35 47 59 71 83

V

 

V

95 107

*‘h

 

 

 

 

.31

1 23 35 47 59 71 83

Hours of 7.5°C treatment

144

95 107

Figure 3.7. Diurnal Changes in
Starch and Soluble Sugar levels in
C01 and the vte2 Mutant During
the First Four Days of Low
Temperature Treatment.

Col (closed circles) and vte2-I (open
squares) were grown under
permissive conditions for four weeks
and then transferred to 7.5°C
conditions at the beginning of the
light cycle for the indicated time.
Samples were harvested at the end of
dark and light cycles. Gray shadows
indicate 12 h dark cycles. 0 h of cold
treatment indicates the beginning of
the first light cycle of low
temperature treatment. Starch is
expressed as nmol glucose
equivalents / g FW. Data are means 1
SD (n = 5). Student’s t tests of vte2-I
relative to C01 at each time point (*P
< 0.05, "P < 0.01).

(A) Starch

(B) Glucose

(C) Fructose

(D) Sucrose

  
   

A B C

2 0.7 300 n
E Imature 0‘6 * E
g 1.5 Dyoung 05 am g, 600
E - Ta
5 1 50-4 g ‘00 1*
.5 0,3
5 f ..
§o.5 0.2 2 200
g 0.1 5 1
( o 0

Col vte2-1 vte1-1 Col vte2-1 vte1-1 Col vte2-1 vte1-1

U
lTl
m

 

14o ** A140 140
E120 E 120 u_ 120
a
1:100 " =0 100 1: 100
g so i so u g 80
3 so 3 so “ ** ° 60
8 8 §
2 40 g 40 g 40
‘5 20 “- 20 , "’ 20
o o 0
Col vte2-1 vte1-1 Col vte2-1 vte1-1 Col vte2-1 vte1-1

Figure 3.8. Biochemical Phenotypes in Mature and Young Leaves of C01, and the vte2 and
vte] Mutants After Four Weeks of Low Temperature Treatment.

Col, vte2-1 and vteI-I mutants were grown under permissive conditions for four weeks and then
transferred to 7.5°C conditions at the beginning of the light cycle for an additional four weeks.
Mature leaves (7th to 9th oldest, black bars) and young leaves (13th to 16th oldest, white bars) were
harvested at the end of the light cycle for analyses in (A), (C), (D), (E) and (F).—Photosynthetic
parameter in (B) was measured in the middle of the light cycle. Data are means 1 SD (n = 4 or 5).
Student’s t tests of mutant leaves relative to corresponding Col young or mature leaves are
indicated (*P < 0.05; **P < 0.01)

(A) Anthocyanin content

(B) Quantum yield of PSH ((Dpsu)

(C) Starch content expressed as nmol glucose equivalents / g FW

(D) to (F) Glucose, fructose and sucrose content, respectively

145

A
Col vte2-1

86.8 1 2.4 ‘15 97.3 1 0.8 %"

m w

 

J

 

 

 

1 5
I f 1‘
1‘ 1
1 :3 A.
13.2 1 2.4 at - 2.7 1 0.8 w
B Glu-I-Fru Suc
11.0 1 2.8 85.8 1 4.0
Col (96 dpm)
vte2-1 8.9 1 5.1 83.2 1 9.8
10000 .
60
3 .—
90001 a :
800° ' S E + Col 350
c 7000 - t { _D- 17192-1 :
o 5'-‘: r“°
"" 0000 q .' :- o . a
E 8 :30“
J: 50001 .
~ .
E 4000 -
a
'U 3000 .
2000 -
1ooo -
0 a

 

 

0 5 1o 15 20 25 30
elution (min)

Figure 3.9. Translocation and Export of 1"C Labeled Photoassimilates in Low
Temperature-Treated C01 and the vte2 and vtel Mutants.

(A) 14C labeled photoassimilate translocation of C01 and vte2-I treated for 7 days at 7.5°C. Percent
label detected in leaves (top) and roots (bottom) are indicated as means 1 SD (n = 3). Student’s t
tests relative to C01 (*P < 0.05, **P < 0.01).

(B) HPLC analysis of phloem exudates collected from mature leaves of C01 and vte2-1 treated for
10 days at 7.5°C. The HPLC trace of sugar standards is shown as dotted grey lines. The percentage
of label detected in the glucose/fructose or sucrose fractions are indicated as means 1 SD (n = 3).
Glu, glucose; Fru, fi'uctose; Suc, sucrose; Raf, raflinose.

146

 
  
    

 

 

 
   
  
    

 

 

 

 

 

 

   
  
  
  

 

 

 

 

~52
1:
IQ
.. 3 858
> I I «1 co
m —N‘~ ,cg +1414!
-— O G x “ah
" O 3' ,3 202
N we; 1031»
111 =
«:2
§ § :5. 2 °°
Q 0 .o
:
DGDG
3 :0
(t 5 «an
'0 '6 3383
v
m ' g 888
1:0];
5'2 5 13 é .°
1:: 0 1°
pm;
a §§.
"-3 :31“-
.. Z
we as
= a:
D“;
. - - - .Jo
9 8 8 9 °
-2
mg 513
>‘ Ewe-v-
»Q «n+1
0 ”#3 figs?
3 EFF!-
3 a
D032 3
§ § :5. é ° Gogg
0 uonepnxe‘x. :9

Figure 3.9. (continued)

(C) Phloem exudation of 14C labeled photoassimilates from C01 and vte2-I and vtel-1 mature
leaves dtu'ing 7 days of 7.5°C treatment. Total 14C fixed per mg fresh weight of each sample at the
indicated time following transfer to 7.5°C is shown below each graph. Data are means 1 SD (n = 6
to 8). Two-factor ANOVA using end points (values at 10 h of exudation) indicates interactions are
significant (P < 0.05, days of 7.5°C treatment and genotype as factors). The pair-wise comparisons
of least square means between genotypes at l, 3 and 7 days of 7.5°C treatment are indicated as a, b
or c, while 0 day is not significant. N.A., data not available.

147

 

Figure 3.10. Aniline Blue Positive Fluorescence in Leaves of C01 and the vte2 Mutant During
Low Temperature Treatment.

148

Figure 3.10. (Continued)

Col (C) and vteZ-I (all panels except C) were grown under permissive conditions for four weeks
and then transferred to 7.5°C at the beginning of the light cycle. Leaves were harvested in the
middle of the day before 7.5°C treatment (0 day; A and B) and afier 1 day (6 h; D to F), 3 days (G to
I) and 13 days (C and J to L) of 7.5°C treatment and aniline blue positive fluorescence were
observed at leaf petioles (A, D, G and J), the lower half of leaves (B, C, E, H and K) and vein
junctions (F, I and L). Arrows in (D and F) denote highly fluorescent spots that initially appear in
side veins of vte2-1 petioles after 6 h of 7.5°C treatment. Bars = 50 pm for F, I and L and 500 pm for
all other panels.

149

 

Figure 3.11. Aniline Blue Positive Fluorescence in Leaves of the vte2 Mutant at Various
Light Intensities under Permissive and Low Temperature Conditions.

vte2-1 were grown under permissive conditions for four weeks and then transferred at the
beginning of the light cycle to 7.5°C 12h light/ 12 h darkness at the indicated light levels (A to F)
and in the middle of the day to HL1800 at 22°C (G and H). Leaves were harvested in the middle of
the day. Aniline blue positive fluorescence was observed at leaf petioles (A, C, E and G) and the
lower half of leaves (B, D, F and H). Bars = 500 pm.

(A) and (B) 7.5°C at 1 nmol photon m'2 s'1 for 3 days (54h).

(C) and (D) 7.5°C at 75 pmol photon m'2 s'1 for 2 days (30 h).

(E) and (F) 7.5°C at 800 pmol photon m'2 s'1 for 2 days (30h).

(G) and (H) 22°C at 1800 pmol photon m‘2 s'1 for 4 days (72h).

150

.14...

r‘
g .

cc.

 

Figure 3.12. Cellular Structure and Immunodetection of Callose in Col and vte2-I Before

and After 14 Days of Low Temperature Treatment.

151

Figure 3.12. (Continued)

(G) to (L) are immunolabeled with anti-[34,3 glucan antibody. (D) to (F) are controls with only 2°
antibody. Single arrows denote phloem parenchyma transfer cell wall ingrowths. Double arrows
denote abnormal thickening of phloem parenchyma transfer cell wall ingrowths. Single asterisks
(*) mark massive wall ingrowths of phloem parenchyma transfer cells. Double asterisks (**) mark
wall ingrowths immunolabeled with anti-04,3 glucan. Paradermal (C and G) and transverse (E and
1) sections show entire phloem parenchyma transfer cell occluded with callose. Paradermal (C and
G) and transverse (D and H) sections show the peripheral callose sheath of phloem parenchyma
transfer cells. Note callose at boundary between phloem parenchyma transfer cell and sieve
element (F and J). Plasmodesmata between bundle sheath (upper cell) and phloem parenchyma
transfer cell immunolabeled with anti-[14,3 glucan (K). b, bundle sheath; c, companion cell; 5,
sieve element; v, vascular parenchyma transfer cell. Bars = 1 pm (all panels except C) and 5 pm (C)
(A) vte2-1 before 7.5°C treatment.

(B) to (L) vte2-I (C to K) and Col (B and L) after 14 days of 7.5°C treatment.

152

 

Figure 3.13. Cellular Structure and Immunodetection of Callose in vte2-I After 3 Days of
Low Temperature Treatment.

(B) to (D) are immunolabeled with anti-[34,3 glucan antibody. Single arrows denote phloem
parenchyma transfer cell wall ingrowths adjacent to bundle sheath. Double arrows denote abnormal
thickening of phloem parenchyma transfer cell wall ingrowths adjacent to companion cell. Note
that transfer cell wall ingrowths are present around the entire phloem parenchyma transfer cell (A).
Transverse section of wall ingrowths immunolabeled with anti-[34,3 glucan at phloem parenchyma
transfer cell and sieve element boundary (B) and plasmodesmata between phloem parenchyma
transfer cell (upper cell) and sieve element (C). Plasmodesmata between bundle sheath (upper cell)
and phloem parenchyma cell are continuous, lack callose-like wall depositions and are
immunonegative for anti-[34,3 glucan (D). b, bundle sheath; 0, companion cell; s, sieve element; v,
vascular parenchyma transfer cell. Bars = 0.5 pm

153

Clcontrol (12011E)
I 10001;E for 24h

 

vte2-1 vte2-1

Supplemental Figure 3.81. Phenotypes of the vte2 Mutant and Col During I-IL, Drought
and Salinity Stress.

The vte2 mutant and Col were grown at permissive conditions for four to five weeks prior to the
indicated stress treatments.

(A) Four-week-old plants were grown under permissive conditions and then transferred to HL1000
stress (16 h 1000 nmol photon m"2 s" light/8h darkness at 22°C) in the middle of the day. The graph
shows the Fv/Fm of C01 and vte2-1 grown under permissive conditions or after 24 h of HL1000.
The image shows representative plants of C01 and vte2-I after 11 days of HL1000.

(B) F ive-week-old plants grown under permissive conditions were subjected to drought stress. The
image shows representative plants of C01 and vte2—1 that had water withheld for 10 days.

(C) Four-week-old plants grown under permissive conditions were subjected to salinity stress. The
image shows representative C01 and vte2-1 plants that were watered with 200 mM NaCl every other
day for three weeks.

154

 

Supplemental Figure 3.82. Phenotypic and Photosynthetic Responses of C01 and the vte2
and vtel Mutants to BL stress.

Plants were grown under permissive conditions for four weeks and then transferred to HL stress in
the middle of the day. When significance is observed between genotypes (ANOVA, P < 0.05),
pair-wise comparison of least square means is evaluated and non-significant groups are indicated
by a, b or c with a being the highest group.

(A) Six representative plants afier 3 days of HL1800. Bars = 2 cm.

(B) and (C) Individual values of total chlorophyll (B) and carotenoid (C) contents from 19 leaves
after 4 days of HL1800.

(D) Individual values of Fv/Fm from 19 leaves afier 24 h of HL1800.

155

b
2

 

 

0 «mom 0 o o ‘6
g Supplemental Figure 3.82. -
a: (continued)
0000 cc an 00 00 g
“‘7
W0 1;
E
oommocroo o “g
a .1 a .5, s, a s. .1, 1
O O O O O O O O
Q “HIM
°“.‘
0mm 00 o o B
’5'
“F.
00000 moo o o g
“'7
«to (mm o 3::
“’3
0mm 0
.3 I. «3 8. .1 7:
0 (auto/6d) spgoueiomo lerol
3°:
«30:01:00 03 o o g.
”T
00000 00000 0 o ‘1‘.
t
3':
00 com o o 1;;
‘5‘
“’3
00mm 0

 

V V V V V V V V

V
2 V N O 0 CO V N O

m (gum/5d) sumdmomo 12101

156

vte2-1vte1- 1

Aniline Blue Positive Fluorescence in Leaves of the vte2 and

1 day (6 h)

 

2 day

3 day

   

Supplemental Figure 3.83.
vte] Mutant During Low Temperature Treatment.

vte2-I (A, C and E) and vtel-1 (B, D and F) were grown under permissive conditions for four
weeks and then transferred to 7.5°C at the beginning of the light cycle. Leaves were harvested in
the middle of the day after 1 day (6 h) (A and B), 2 days (C and D) and 3 days (E and F) of 7.5°C
treatment and aniline blue positive fluorescence were observed at leaf petioles (A and B), the lower
half of leaves (C to F). Arrows in (A and B) denote fluorescence spots initially appeared at side

veins of petioles. Bars = 500 pm.

157

CHAPTER 4: TOCOPHEROLS MODULATE POLYUNSATURATED FATTY ACIDS

DERIVED FROM THE EXTRA PLASTIDIC-PATHWAY DURING CHILLING

ADAPTATION OF ARABIDOPSIS.

158

ABSTRACT

Tocopherols (vitamin E) are the major class of lipid-soluble antioxidants in biological
membranes and are produced by all plants and algae, and most cyanobacteria, yet their
functions in photosynthetic organisms are not well understood. We have previously
reported that the vitamin E deficient 2 (vte2) mutant of Arabidopsis thaliana is chilling
sensitive due to impaired photoassimilate export, which temporally correlated with
callose deposition in phloem parenchyma cells. In this study, we found that the
introduction of glucan synthase like 5 (gsl5) to the vte2 background dramatically reduced
the callose deposition but did not affect the photoassimilate export phenotype of cold-
treated vte2, suggesting that the GSLS-dependent vasculature specific callose deposition
is not a root cause of the impaired photoassimilate export phenotype. By contrast, the
introduction of fatty acid desaturase 2 (fadZ), an endoplasmic-reticulum (ER) w-6 fatty
acid desaturase mutation, to the vte2 background suppressed nearly all vte2-chilling
phenotypes, which included both impaired photoassimilate export and vasculature
specific callose deposition. Furthermore, in response to low temperature, the vte2 mutant,
in comparison to wild type, exhibited a distinct composition of polyunsaturated fatty
acids (PUFAS) (i.e. decreased 18:3 and increased 18:2), which coincided temporally and
spatially with the vasculature specific callose deposition. These PUFA alterations
occurred primarily in the PUFAS esterified to lipids derived from the ER pathway.
Together these results suggest that tocopherols modulate extra-plastidic pathway-derived
PUFAS and thereby play a crucial role in phloem loading and chilling adaptation in

Arabidopsis.

159

INTRODUCTION

Toc0pherols were first discovered as essential nutrients in mammals and together with
tocotrienols are collectively known as vitamin E (Evans and Bishop, 1922; Bramley et al.,
2000; Schneider, 2005). Tocopherols are well-studied lipid—soluble antioxidants, which
quench singlet oxygen and scavenge lipid peroxyl radicals and hence terminate the
autocatalytic chain reaction of lipid peroxidation (Tappel, 1972; Fahrenholtz et al., 1974;
Burton and Ingold, 1981; Liebler and Burr, 1992; Kamal-Eldin and Appelqvist, 1996).
These lipid-soluble molecules are localized in biological membranes and associated with
highly unsaturated fatty acids, and thus may also affect membrane properties, such as
permeability and stability of membranes (Erin et al., 1984; Kagan, 1989; Stillwell et al.,
1996; Wang and Quinn, 2000). Recent studies in mammals have prOposed that a specific
form of tocopherols (e.g. a-tocopherol but not y-tocopherol) also has functions unrelated
to its antioxidant properties, which include modulation of signaling pathways and
regulation of gene expression (Pentland et al., 1992; Ricciarelli et al., 1998; Jiang et al.,
2000; Ricciarelli et al., 2002; Rimbach et al., 2002).

Despite the fact that tocopherols are synthesized only in photosynthetic organisms,
including all plants and algae, and some cyanobacteria, tocopherol functions in these
organisms are not well understood. The tocopherol-deficient vte2 @igamin g 2) mutant of
Arabidopsis thaliana is defective in homogentisate phytyl transferase (HPT), the first
committed enzyme of the pathway, and lacks all tocopherols and pathway intermediates
(Collakova and DellaPenna, 2001; Savidge et al., 2002; Sattler et al., 2004). The vte2
mutant exhibited reduced seed viability and defective seedling development associated

with an elevated lipid peroxidation (Sattler et al., 2004), indicating that toc0pherols play

160

an essential role for seed longevity and early seedling development as lipid-soluble
antioxidants. This tocopherol function in seed and seedlings has provided strong selection
pressure for the retention of tocopherol biosynthesis during the evolution of seed plants
(Sattler et al., 2004).

In contrast to the dramatic vte2 seedling phenotype, the vte2 mutants that do
survive early seedling development become virtually indistinguishable from wild type
under standard growth conditions (Sattler et al., 2004; Maeda et al., 2006), suggesting
that tocopherols are dispensable in mature plants in the absence of stress. In leaves,
tocopherols are localized in chloroplast membranes and tocopherol levels are elevated in
response to a variety of stresses, such as high light, salinity, drought and low
temperatures (Munne—Bosch et al., 1999; Collakova and DellaPenna, 2003; Maeda et al.,
2006). Based on such correlative and circumstantial evidence together with the
evolutionary conservation of tocopherol biosynthesis among photosynthetic organisms,
tocopherols had long been assumed to play an essential role in protecting photosynthetic
membranes from oxidative stress (Fryer, 1992; Munne-Bosch and Alegre, 2002).
Consistent with this hypothesis, the Arabidopsis vteI mutant, which is defective in
tocopherol cyclase (TC) and lacks all tocopherols but accumulates the redox active
pathway intermediates DMPBQ (Porfirova et al., 2002; Sattler et al., 2003), was reported
to be more susceptible to a combination of high light and low temperature stress (Havaux
et al., 2005). However, a subsequent report demonstrated that the Arabidopsis
tocopherol-deficient mutants are almost indistinguishable to wild type during high light
stress at permissive temperatures but are much more sensitive than wild type to low

temperatures (Maeda et al., 2006). Thus, tocopherols are not necessary for

161

photoprotection but are required for low temperature adaptation in Arabidopsis. This low
temperature phenotype was independent of light level and was not associated with
symptoms of photooxidative stress (i.e. photoinhibition, photobleaching, accumulation of
zeaxanthin or lipid peroxides), indicating that the low temperature function of
tocopherols is independent of any photoprotective roles of tocopherols (Maeda et al.,
2006).

Further analysis of the low temperature responses illustrated that, after transfer
to low temperature, tocopherol deficiency initially results in an impairment of
photoassimilate export in the vte2 mature leaves as early as 6 hours after cold treatment.
At the same time, unusual deposition of cell wall materials (i.e. callose) occur exclusively
in phloem vascular parenchyma cells, possibly creating a bottleneck for photoassimilate
transport. The reduced photoassimilate export subsequently leads to carbohydrate and
anthocyanin accumulation, feedback inhibition of photosynthesis and growth inhibition
of whole plants at low temperature (Maeda et al., 2006). Thus, toc0pherols play a crucial
role in phloem loading and thereby chilling adaptation in Arabidopsis leaves.

The carbohydrate accumulation phenotype of cold-treated vte2 mature leaves
resembled previously reported phenotypes of maize sucrose export defective I (sde) and
potato SXDI-RNAi lines, which are also tocopherol deficient and accumulate
carbohydrates without cold treatment (Russin et al., 1996; Provencher et al., 2001; Sattler
et al., 2003; Hofius et al., 2004). A recent study found that tocopherol-deficient mutants
of Synechocystis sp. PCC 6803, a unicellular cyanobacterium, also accumulate glycogen,
a glucose polymer that is the functional equivalent of starch. Exposure of the

Synechocystis mutant to external glucose is lethal (Sakuragi et al., 2006). These

162

combined studies imply that a role for tocopherols in carbohydrate metabolism may be
conserved among photosynthetic organisms and it is of great interest to understand the
underlying mechanisms. The cold-inducibility of Arabidopsis vte2 mutant phenotype
provides a useful tool to dissect this mechanism.

The aim of this study is to further understand upstream events leading to reduced
photoassimilate export in cold-treated vte2. A series of mutations affecting callose
synthesis and fatty acid desaturation were introduced into the vte2 background and
phenotypic and biochemical responses of the resulting double and triple homozygous
mutants were analyzed during low temperature treatment. These results suggest that the
vascular specific callose deposition is not a cause of the reduced photoassimilate export
and that tocopherol deficiency in vte2 alters membrane PUFAS derived from the extra-
plastidic-pathway, leading to both callose deposition and impaired photoassimilate export

at low temperature (Figure 4.1).

RESULTS

gsl5 Attenuates Callose Deposition in vte2 without Suppressing a Photoassimilate
Export Phenotype.

To test whether the vasculature specific callose deposition of cold-treated vte2 causes
impaired photoassimilate export, we attempted to genetically eliminate callose deposition
by introducing a mutation affecting a callose synthase gene. Arabidopsis has 12 putative
glucan synthase-like (GSL) genes encoding callose synthases (Hong et al., 2001; Jacobs
et al., 2003). GSLS is the best-characterized callose synthase and is responsible for

wounding— and pathogen-responsive callose deposition (Jacobs et al., 2003; Nishimura et

163

al., 2003). We suspected that GSLS might also play a role in the cold-induced vte2
callose deposition. The GSLS gene was inactivated in the vte2 mutant background by
introducing the gsl5 mutation, which was originally reported as powdery mildew [esistant
4 (pmr4) (Vogel and Somerville, 2000; Nishimura et al., 2003). The resulting vte2gsl§
double mutant showed visible phenotype similar to Col, gslS and vte2 under permissive
conditions (12h, 120 nmol photon m'2 3'1 light at 22°C / 12h darkness at 18°C, data not
shown). When 4 week-old plants were subjected to 7 days of low temperature treatment
(12h 75 nmol photon m'2 s'1 light / 12h darkness at 7.5°C), vte2 exhibited expected
vasculature-specific callose deposition detected by aniline-blue fluorescence, while no
fluorescence signal was detected in the vasculatures of C01 and gslS (Figure 4.2A).
Interestingly, the vasculature of the vte2gsl§ double mutant had a substantially reduced
level of fluorescence intensity, although a few weak fluorescence spots were still present
(Figure 4.2A). This dramatic reduction in vte2gsl5 callose deposition relative to vte2
suggests that GSLS is largely responsible for the cold-induced vte2 callose deposition.
Given that the level of callose is substantially reduced in vte2gsl§ relative to vte2,
one would expect that the impaired photoassimilate transport phenotype of cold-treated
vte2 would be also be attenuated by the gsl5 mutation. Surprisingly, however, vteZgSIS
still showed a reduced photoassimilate export capacity comparable to that in vte2 (Figure
4.2C). Likewise, vte2gsl5 and vte2 showed similarly elevated accumulation of soluble
sugars and chilling sensitive phenotypes (Figures 2B, and D). These results indicate that
the level of callose does not correlate with the capacity of photoassimilate export and the

chilling sensitive phenotype of cold-treated vte2 and suggest that the GSLS-dependent

164

vascular-specific callose deposition is not a root cause of the impaired photoassimilate

export.

vte2 and Col Exhibit Distinct Changes in 18:2 and 18:3 at Low Temperature.

Given the well-characterized chemical nature of tocopherols as lipid-soluble antioxidants
(Tappel, 1972; Liebler and Burr, 1992; Kamal-Eldin and Appelqvist, 1996) and their
localization in PUFA-enriched chloroplast membranes (Bucke, 1968; Wise and Naylor,
1987), we hypothesized that tocopherol deficiency in vte2 might impact membrane fatty
acid composition. vte2 and Col were grown under permissive conditions for four weeks,
transferred to low temperature conditions and the fatty acid composition of total lipid
extracts analyzed from the middle part of the 7th to 9th oldest fully expanded rosette
leaves, where all biochemical analyses were previously described (Maeda et al., 2006).
Before low temperature treatment, C01 and vte2 had identical total fatty acid composition
(0 day in Table 4.1), indicating tocopherol deficiency per se does not impact membrane
fatty acid composition under permissive growth condition. After transfer to low
temperature, however, vte2 and Col showed distinct changes to their fatty acid
compositions. Col gradually increased the molar ratio of a-linolenic acid (18:3), whereas
vte2 increased linoleic acid (18:2) but not 18:3, which gradually decreased in the cold
(Table 4.1). As a result, vte2, in comparison to C01, showed a significant decrease in the
ratio of 18:3/18:2 by as early as 7 days of 7.5°C treatment. Interestingly, the double bond
index, an estimation of the total membrane unsaturation level (Falcone et al., 2004), did

not differ significantly between genotypes until 14 days of cold treatment (Table 4.1).

165

Tocopherol Deficiency Reduces 18:3 and Increases 18:2 Derived from the ER Pathway
at Low Temperature.

To further examine in which lipid species of the fatty acid composition is affected by the
vte2 mutation at low temperatures, the levels of individual membrane lipid molecules
were analyzed using electrospray ionization tandem mass spectrometry (Brugger et al.,
1997; Welti et al., 2002; Welti and Wang, 2004). Before low temperature treatment, vte2
and Col had almost identical lipid species contents and fatty acid composition of each (Oh
at Figure 4.3A and B). After 14 days of low temperature treatment, the molar ratio of
monogalactosyldiacylglycerol (MGDG) decreased and phosphatidylcholine (PC) and
phosphatidylethanolamine (PE) increased relative to zero days, but these changes
occurred similarly in both vte2 and Col.

In contrast, the fatty acid compositions of each lipid species exhibited distinct
changes in vte2 and C01. C01 increased 36:6 and 34:3 molecular species and
correspondingly decreased 36:4 and 34:2 molecular species of PC, PE, and
phosphatidylinositol (PI). These changes were not observed in vte2 and, as a result, vte2
PC and PE had lower 36:6 and 34:3 and higher 36:4 and 34:2 than Col (Figure 4.3A).
According to previous reports (Marechal et al., 1997; Welti et al., 2002), the 36:6, 36:4,
34:3 and 34:2 species mainly consist of the fatty acid pairs of 18:3 (here after indicated as
18:3-18:3), 18:2-18:2, 1620-1823 and 1620-18z2, respectively. Therefore, the decrease in
36:6 (18:3-18:3) and 34:3 (16:0-18z3) and corresponding increase in 36:4 (18:2-18:2) and
34:2 (16:0-18:2) observed in vte2 phospholipids in comparison to Col are strongly
correlated with the 18:3 decrease and 18:2 increase in total fatty acid composition of vte2

relative to Co] (compare Figure 4.3B and Table 4.1). While the level of 36:6 (18:3-18:3)

166

in the digalactosyldiacylglycerol (DGDG) of Col increased and 3423 (1620-183)
decreased during cold treatment, these changes failed to occur in vte2 and, as a result,
DGDG in vte2 had lower 3626 (1823-1823) and higher 34:6 (1620-1813) levels than Col
(Figure 4.3B). Likewise, the MGDG in vte2 had lower 3626 (1823-1823) and higher 34:6
(1623-1823) than Col. As summarized in Figure 4.3C, after transfer to low temperatures,
the vte2 mutant in comparison to C01 decreased the level of 1823 derived from the ER
pathway (i.e. 18:3-18:3 of PC, PE, MGDG and DGDG, l6:0-l8:3 of PC, PE) and
correspondingly increased the level of ER pathway-derived 18:2 (i.e. 16:0-18:2 and 18:2-
18:2 of PC and PE). Also, the plastid pathway-derived 18:3 (i.e. 1620-1823 of DGDG,
1620-1823 of MGDG) were increased in vte2 relative to Col. These results indicate that
tocopherol deficiency significantly impacts the level of PUFAS derived from not only the

plastid pathways but also from the ER pathway in response to low temperature.

Distinct PUFA Changes in vte2 Are Temporally and Spatially Associated with
Vascular Specific Callose Deposition.

To assess if the observed PUFA changes in vte2 are related to the vasculature specific
callose deposition, tissues from the petiole and the middle of rosette leaves were
harvested after 0, 3, 7 and 14 days of cold treatment and total fatty acid composition and
aniline blue-positive fluorescence were compared. Consistent with the results from Table
4.1, the middle of vte2 leaves showed lower 1823, higher 18:2 levels relative to C01 and,
as a result, significantly lower 1823/ 18:2 ratio after 7 days of cold treatment (Figure 4.4A).
The middle of vte2 leaves also showed detectable callose deposition as early as 7 days of

cold treatment (Maeda et al., 2006; Figure 4.4A). Thus, the timing of the PUFA changes

167

appeared temporally correlated with callose deposition in vte2 during low temperature
treatment. When 18:2 and 18:3 levels were analyzed from the petioles of vte2 and Col,
significant difference in 18:3/18:2 ratio was observed even before cold treatment (0 day
at Figures 4.4B), whereas the petioles of vte2 exhibited callose deposition at 3 days of
cold treatment (Maeda et al., 2006; Figure 4.48). These results suggest that the distinct
PUFA changes (i.e. decreased 18:3 and increased 18:2) in vte2 may be early events
leading to the previously reported vte2 chilling phenotypes including the vasculature

specific callose deposition.

Two w6-Fatty Acid Desaturase Mutations, fad2 and fad6, Suppress the vte2 Chilling
Phenotype.

To determine if altered PUFA composition in vte2 relative to C01 is an upstream event
leading to the vte2 chilling phenotype, a series of mutations affecting membrane fatty
acid desaturation were introduced to the vte2 background and impacts on the vte2 chilling
phenotypes assessed. The fad2 (fatty acid desaturase 2) and fad3 mutants are defective in
the ER-w6 and w3-fatty acid desaturase enzymes, respectively, and reduce PUFA content
predominantly in phospholipids, the major lipid components of extra-plastidic
membranes (Miquel and Browse, 1992; Browse et al., 1993; Okuley et al., 1994). The
fad6 and fad7fad8 mutants are defective in the plastidic-co6 and co3-fatty acid desaturase
enzymes, respectively, and have reduced PUFAS predominantly in galactolipids and
sulfolipids, the major lipid components of plastidic membranes (Browse et al., 1989;
Falcone et al., 1994; Mcconn et al., 1994). The selected double or triple homozygous

lines containing these fad mutations in the vte2 background allow us to compare the

168

effects of altering plastidic and extra-plastidic PUFA content on the vte2 chilling
phenotypes.

Under permissive growth conditions, the visible phenotype of all double and triple
mutants was virtually indistinguishable from corresponding single or double desaturase
mutants (data not shown). When four-week-old plants grown under permissive conditions
were subjected to low temperature, the fad2, fad3, fad6 and fad7fad8 mutants also
behaved similarly to Co] (Figure 4.5). Although the fadZ and fad6 mutants are known to
be chilling sensitive, our results are consistent with prior reports that fad6 only shows a
low temperature phenotype when plants younger than 13 days are transferred to
temperatures lower than 5°C, while the fadZ-I allele used in this study lacks any low
temperature phenotype regardless of plant age due to the leaky nature of this allele under
low temperatures (Hugly and Somerville, 1992; Miquel et al., 1993). vte2 showed the
expected chilling sensitive phenotype and accumulated anthocyanins in mature leaves
(Figure 4.5; Maeda et al., 2006). vte2fad3 and vte2fad7fad8 also similarly accumulated
anthocyanins in mature leaves, suggesting the introduction of the fad3 and fad7fad8
mutations had little impact on the vte2 chilling phenotype. Interestingly, low temperature-
treated vte2fad2, and to a lesser extent vte2fad6, showed less anthocyanin accumulation

than vte2 (Figures 4.5).

fad2 and fad6 Suppress the Elevated Soluble Sugar and Reduced Photoassimilate
Export Phenotypes of Cold- Treated vte2.
To determine whether fad2 and fad6 suppression of the vte2 visible phenotype is

extended to the vte2 photoassimilate export phenotype (Figure 4.1; Maeda et al., 2006),

169

soluble sugar levels and the photoassimilate export capacity of the various cold-treated
mutant genotypes were analyzed. The vte2 mutant accumulated elevated levels of soluble
sugars compared to C01 after 14 days of low temperature treatment consistent with our
previous observations (Figure 4.6A; Maeda et al., 2006). vte2fad3 and vte2fad7fad8
accumulated elevated levels of soluble sugars equivalent to the level of vte2, while the
soluble sugar content of fad2, fad3, fad6 and fad7fad8 was similar to C01 (Figure 4.6A).
The vte2fad6 double mutant had higher soluble sugar content than Col or fad6 but was
significantly lower than that of vte2. The soluble sugar content of vte2fad2 was much less
than the vte2 level and approached the levels in C01 (Figures 6A).

The photoassimilate export capacity of the different genotypes was negatively
correlated to their soluble sugar levels (Figure 4.6). The photoassimilate export capacity
of fad2, fad3, fad6 and fad7fad8 was similar to C01 after 7 days of low temperature
treatment, with the exceptions of slightly but significantly lower levels in fad3 and
fad7fad8 (Figure 4.6B). vte2 as well as vte2fad3 and vte2fad7fad8 had dramatically
reduced photoassimilate export capacity compared to Co]. The vte2fad6 and vte2fad2
double mutants showed significantly higher export capacity than vte2 with the vte2fad2
level approaching Col (Figure 4.6B). These results indicate that the introduction of fad2,
and to a lesser extent fad6, but not fad3 or fad7fad8, into the vte2 background suppress

the impaired photoassimilate export phenotype of vte2.

fad2 Suppresses the Vasculature Specific Callose Deposition of Cold- Treated vte2.

To test if introduction of the fad mutations also affects the vasculature specific callose

deposition in cold-treated vte2 (Figure 4.1; Maeda et al., 2006), O, 3, and 7 day-cold-

170

treated plants were harvested and aniline blue positive fluorescence was analyzed.
Neither Col nor any of the fad mutants (fad2, fad3, fad6 and fad7fad8) showed
vasculature associated aniline blue-positive fluorescence at any time points (Figure 4.7,
data not shown). In contrast, aniline blue positive fluorescence appeared at vasculatures
of the bottom half of vte2 leaves at 3 days and spread through the entire leaf at 7 days, as
previously reported (Figure 4.7; Maeda et al., 2006). vte2fad3, vte2fad6 and vte2fad7fad8
showed very similar patterns of aniline blue positive fluorescence to that of vte2 (first
apparent at 3 days in the petioles and then encompassing the entire leaf by 7 days).
Interestingly, vte2fad2 had much less fluorescence than vte2 at both 3 and 7 days of low
temperature treatments and only a few weak fluorescence dots were observed at 7 days
(Figure 4.7). These results indicate that fad2, but not fad3, fad6 or fad7fad8, suppress

vasculature specific callose deposition observed in the cold-treated vte2.

DISCUSSION

Tocopherols were previously found to play a crucial role in chilling adaptation and
phloem loading in Arabidopsis (Maeda et. al., 2006). To obtain a better understanding of
the tocopherol function in chilling adaptation, we investigated the early low temperature
responses leading to an impaired photoassimilate export in the tocopherol-deficient vte2
mutant. We first assessed the molecular nature of vasculature specific callose deposition
observed in cold—treated vte2 and its impact on the photoassimilate export phenotype. The
introduction of the gsl5 mutation to the vte2 background eliminated the majority of
callose detected in cold-treated vte2 (Figure 4.2A), indicating that the vte2 callose

deposition is largely GSLS dependent (Figure 4.1). Because GSLS is responsible for

171

callose deposition in response to wounding (Jacobs et al., 2003), tocopherol deficiency
may affect the wound response pathway leading to the activation of the GSL5 enzyme.
However, C01 and vte2 showed similar level of wound-induced callose deposition (data
not shown), suggesting that tocopherols do not directly influence the wound-signaling
pathway leading to the GSL5 activation. Unexpectedly, the elimination of the majority of
cold-inducible callose deposition by introduction of the gsl5 mutation into the vte2
background did not impact any of vte2 chilling phenotypes (Figures 4.2). Although the
few weak fluorescent signals observed at the vasculature of vte2gsl§ may still be related,
these results indicate that the level of callose does not impact the vte2 photoassimilate
export phenotype and suggest that the GSL5—dependent callose deposition is likely an
independent or a downstream event of the impaired photoassimilate export (Figure 4.1).
Interestingly, fatty acid compositions were identical between vte2 and wild type at
permissive growth conditions but tocopherol deficiency in vte2 resulted in a fatty acid
composition distinct from Col at low temperature. Cold-treated vte2 had a reduced 1823
and increased 1822 in comparison to C01 (Table 4.1), indicating that the vte2 PUFA
changes are low temperature inducible at least in the middle of leaves. Chronologically,
within both the petioles and the middle of vte2 leaves, the vte2 PUFA changes are
temporally correlated with the vasculature specific callose deposition which was, together
with the impaired photoassimilate export phenotype, the earliest detectable phenotype
found in our previous study (Figure 4.4; Maeda et al., 2006). It is especially noteworthy
that the 18:3/18:2 ratio was lower in the petioles of vte2 than Col even before cold
treatment (0 days in Figure 4.4B), suggesting that the constitutive PUFA changes at

petioles may be an immediate consequence of tocopherol deficiency. Furthermore, the

172

alteration of membrane PUFAS by introducing fadZ and fad6 into the vte2 background
suppressed chilling-induced vte2 phenotypes, including impaired photoassimilate
transport and elevated sugar accumulation (Figures 4 and 5). These data provided
biochemical and genetic evidence supporting the conclusion that the distinct changes in
vte2 PUFA composition relative to wild-type are upstream events leading to impaired
photoassimilate export phenotype during low temperature treatment (Figure 4.1).

This finding raises two interesting questions regarding the function of tocopherols
in photoassimilate export and chilling adaptation. The first question relates to the nature
of these compositional PUFA changes that lead to impaired photoassimilate export.
Based on the comparison of total fatty acid composition between cold-treated vte2 and
Col (Table 4.1), either a decrease in 1823 or an increase in 18:2 or both are likely key
event(s) leading to impairment in photoassimilate export. w6—Fatty acid desaturase
mutations (fad2 and fad6), which remove both trienoic and dienoic fatty acids (e.g. both
18:3 and 18:2; Browse et al., 1989; Miquel and Browse, 1992; Falcone et al., 1994;
Okuley et al., 1994), partially or fullly suppress the vte2 phenotype (Figures 4, 5 and 6).
On the other hand, w3-fatty acid desaturase mutations (fad3 and fad7fad8), which
eliminate only trienoic fatty acids (e.g. 18:3; Browse et al., 1993; Mcconn et al., 1994),
do not impact the vte2 chilling phenotypes (Figures 4, 5 and 6). These results suggest that
the changes in 1822 or both 18:2 and 1823 levels are likely responsible. When global lipid
profiles were compared between cold-treated vte2 and Col, the 18:2 changes occurred
only in 3624 (18:2-18:2) and 34:4 (16:0-1822) of phospholipids, that were increased in

vte2 relative to C01 (Figure 4.3). Taken together, these biochemical and genetic data

173

suggest that the alteration in PUFAS derived from the ER pathway may be a key event
leading to the photoassimilate export and chilling phenotypes of cold-treated vte2.

The second question concerns how tocopherol-deficiency influences membrane
PUFA compositions (i.e. increased 18:2 and decreased 18:3). Because tocopherols are the
major class of lipid-soluble antioxidants in plastid membranes, the absence of tocopherols
in vte2 may result in increased oxidation/degradation of 18:3 in the plastid membranes
and negatively impact photoassimilate export and chilling adaptation of vte2. However,
lipid profiling analyses showed that the levels of the plastid-pathway-derived 18:3 in
cold-treated vte2 were similar to or even higher than wild type. Although 1823 of
phospholipids were decreased in vte2 relative to wild type (Figure 4.38), the degree of
total membrane unsaturation estimated by the double bond index (Falcone et al., 2004)
was not significantly different between vte2 and wild type up to 7 days of cold treatment
(Table 4.1). Finally, our previous study failed to detect elevated levels of lipid peroxides
during low temperature treatment in both vte2 and wild type (Maeda et al., 2006). These
combined results suggest that membrane oxidation is not occurring in the vte2 mutant
during low temperature treatment and that tocopherol functions in chilling adaptation are
not by the protection of membrane PUFAS from oxidation.

On the other hand, we found that the characteristic vte2 PUFA change (i.e. 18:3
decrease and corresponding 1822 increase) occurred predominantly in the ER-pathway-
derived PUFAS (Figure 4.3), indicating that tocopherols affect the composition of PUFAS
derived from the ER-pathway. Because the majority of tocopherols are localized in the
plastid membranes (Bucke, 1968; Wise and Naylor, 1987), tocopherols may indirectly

affect FAD3 activity, which is responsible for the conversion of 18:2 to 18:3 in the ER

174

membrane (Browse et al., 1993). The most recent study demonstrated that ER membrane
has PLastid Associated membranes (PLAMS, Andersson et al., 2006) and tocopherols
may be translocated from plastids to ER or tocopherols in the plastid membranes may
directly affect activity of enzymes in the ER membrane through the PLAMS.
Alternatively, tocopherols may be required for the efficient incorporation of the ER-
pathway-derived PUFAS, especially 1823, into the outer membrane of the plastids. Based
on in vitro studies, tocopherols have higher affinity to fatty acids with increased levels of
unsaturation (Diplock and Lucy, 1973; Erin et al., 1984; Stillwell et al., 1996; Wang and
Quinn, 2000). Thus, tocopherol deficient membranes may prefer incorporating 18:2 than
1823, although they still have to maintain wild type level of total membrane unsaturation
in order to acclimate to low temperature (Table 4.1). Plants increase PUFA levels in
response to a reduced temperature in orderto compensate for the rigidification of
membranes (Uemura et al., 1995; Nishida and Murata, 1996; Sakamoto and Murata,
2002) and tocopherols may become important during the process where the PUFA
synthesis is elevated. One cyanobacterium which does not produce any tocopherols also
does not contain any membrane PUFAS and thus is also extremely chilling sensitive
(Powls and Redfearn, 1967; Dasilva and Jensen, 1971; Wada et al., 1990; Gombos et al.,
1997). Although the exact mechanism needs to be further investigated, this tocopherol
function in the modulation of membrane PUFAS during chilling adaptation may be a

fundamental function conserved among photosynthetic organisms.

MATERIAL AND METHOD

Plant Materials and Construction of Double and Triple Homozygous lines

175

The pmr4-1, fadZ-I, fad3-I, fad6-1 , and fad7-Ifad8-I mutants were obtained from the
Arabidopsis Biological Resource Center (ABRC). The vte2-I mutant was previously
isolated from ethyl methanesulfonate-mutagenized population and backcrossed to the Col
wild type three times (Sattler et al., 2004). All genotypes are in the Col background. The
vte2-1 pmr4-I, vte2-1fad2-1, vte2-Ifad3-I, vte2-Ifad6-I double and vte2-Ifad7-Ifad8-I
triple mutants were selected from crosses of the respective single or double mutant
parents. F2 progeny homozygous for the vte2-1 mutation were identified based on their
tocopherol deficiency by reverse-phase HPLC (Sattler et al., 2004) and confirmed by
genotyping with vte2-I CAPS marker, 5'- TTTCACTGGCATC’ITGGAGGTAATG -3'
and 5'- AAGTGGCAACTGTTTGTAGTAGAAG -3’, which generates a 632-bp PCR
product with SacI site for the vte2-1 allele. Plants homozygous for pmr4-1 were similarly
identified based on CAPS maker genotyping (Nishimura et al., 2003). F2 progeny
homozygous for respective fad mutation were identified by fatty acid methyl ester
analysis using gas-liquid chromatography as described previously (Browse et al., 1986).
The total fatty acid composition of fad2, fad3, fad6 and fad7fad8 were almost identical to
that of vte2fad2, vte2fad3, vte2fad6 and vte2fad7fad8, respectively, indicating that the
presence of the vte2 mutation has almost no impact on the fatty acid composition of any

fad mutant backgrounds (data not shown).

Growth Conditions and Low Temperature Treatment

Seeds were stratified for four to seven days (4°C), planted in a vermiculite and soil
mixture fertilized with l x Hoagland solution, and grown in a chamber under permissive

conditions: 12h, 120 nmol photon m2 3'1 light at 22°C / 12h darkness at 18°C with 70 %

176

relative humidity. Plants were watered every other day and with 0.5 X Hoagland solution
once a week. For low temperature treatments, three to four-week-old plants were
transferred at the beginning of light cycle to 12h 75 nmol photon m'2 8'1 light / 12h

darkness at 7.5°C (i < 3°C).

Carbohydrate Analyses

Soluble sugar (glucose, fructose and sucrose) levels of leaves were quantified as
described (Jones et al., 1977; Lin et al., 1988). Unshaded leaf tissue (<50mg) was
harvested, immediately frozen in liquid nitrogen and extracted twice with 700 uL of 80%
ethanol at 80°C. The ethanol extract was evaporated and redissolved in 200 [LL of
distilled water (Jones et al., 1977). Glucose, fructose and sucrose levels in the ethanol
extract and the glucose level of the digested starch extract were determined enzymatically

(Jones et al., 1977).

Phloem Exudation Experiments

Phloem exudation experiments were conducted according to Maeda et al., (2006) with
slight modifications. Seventh and ninth oldest leaves were detached in the middle of the
day at the neck of petiole, 0.5 cm of petiole was re-cut under water, the petiole of each
leaf was submerged in water and placed in a tightly sealed 10 L glass chamber. l4C02
was generated in the chamber by adding 3 mL of 0.25 N H280; to 0.05 mCi (3 nmol)
NaHMCOg and unlabeled 97 nmol NaHCO3 to give a carbon dioxide concentration of
522 ppm. After labeling for 30 min at 120 nmol photon m'2 s", the petiole of each leaf

was submerged in 0.3 mL of 10 mM disodium-ethylenediaminetetraacetic acid (EDTA)

177

(pH 7.0) and kept in the dark with high humidity for 5 hours to induce phloem exudation
(King and Zeevaart, 1974). All of the aforementioned procedures were performed at
7.5°C. The radiolabel exuded into the EDTA solution and also remained in the leaves
after 5 h were separately measured by liquid scintillation counting (Tri-Carb 2800TR;

PerkinElmer, Wellesley, MA, USA).

Fluorescence Microscopy
Leaves were prepared for aniline blue fluorescence microscopy (n = 2 leaves/plant, 4-6
plants/sample time; Martin, 1959) at the same sampling times as above for export studies.

Images were captured on the Leica MZ 16F fluorescence microscope (Wetzlar, Germany).

ACKNOWLEDGEMENTS

We thank Scott Sattler for the vte2fad3 double mutant seeds, William Pasutti for assistant
in the vte2fad6 double mutant screening and members of the DellaPenna lab for their
critical advice, discussions and manuscript review. We thank also the Kansas Lipidomics
Research Center Analytical Laboratory supported by National Science Foundation's
EPSCoR program (BPS-0236913), the State of Kansas through Kansas Technology
Enterprise Corporation and Kansas State University for lipid profiling analysis. This

work was supported by NSF grant MCB-023529 to D.D.P.

178

REFERENCES

Andersson MX, Goksor M, Sandelius AS (2006) Optical manipulation reveals strong
attracting forces at membrane contact sites between endoplasmic reticulum and
chloroplasts. J Biol Chem in press.

Bramley PM, Elmadfa I, Kafatos A, Kelly FJ, Manios Y, Roxborough HE, Schuch
W, Sheehy PJA, Wagner KB (2000) Vitamin E. J Sci Food Agric 80: 913-938

Browse J, Kunst L, Anderson S, Hugly S, Somerville C (1989) A mutant of
Arabidopsis deficient in the chloroplast 16-1/18—1 desaturase. Plant Physiol 90: 522-
529

Browse J, Mcconn M, James D, Miquel M (1993) Mutants of Arabidopsis deficient in
the synthesis of alpha-linolenate - biochemical and genetic-characterization of the
endoplasmic-reticulum linoleoyl desaturase. J Biol Chem 268: 16345-16351

Browse J, Mccourt PJ, Somerville CR (1986) Fatty-acid composition of leaf lipids
determined after combined digestion and fatty-acid methyl—ester formation from
fresh tissue. Anal Biochem 152: 141-145

Brugger B, Erben G, Sandhoff R, Wieland FT, Lehmann WD (1997) Quantitative
analysis of biological membrane lipids at the low picomole level by nano-
electrospray ionization tandem mass spectrometry. Proc Natl Acad Sci USA 94:
2339-2344

Bucke C (1968) Distribution and stability of alpha-tocopherol in subcellular fractions of
broad bean leaves. Phytochemistry 7: 693-700

Burton GW, Ingold KU (1981) Autoxidation of biological molecules .1. The antioxidant
activity of vitamin-E and related chain-breaking phenolic antioxidants in vitro. J Am
Chem Soc 103: 6472-6477

Chandra V, Jasti J, Kaur P, Betzel C, Srinivasan A, Singh TP (2002) First structural
evidence of a specific inhibition of phospholipase A(2) by alpha-tocopherol (vitamin
E) and its implications in inflammation: Crystal structure of the complex formed
between phospholipase A(2) and alpha-tocopherol at 1.8 angstrom resolution. J Mol
Biol 320: 215-222

Collakova E, DellaPenna D (2001) Isolation and functional analysis of homogentisate
phytyltransferase from Synechocystis sp. PCC 6803 and Arabidopsis. Plant Physiol
127:1113-1124.

Collakova E, DellaPenna D (2003) The role of homogentisate phytyltransferase and

other tocopherol pathway enzymes in the regulation of tocopherol synthesis during
abiotic stress. Plant Physiol 133: 930-940

179

Dasilva EJ, Jensen A (1971) Content of alpha-tocopherol in some blue-green algae.
Biochim Biophys Acta 239: 345-&

Diplock AT, Lucy JA (1973) Biochemical modes of action of vitamin-E and selenium -
hypothesis. FEBS Lett 29: 205-210

Erin AN, Spirin MM, Tabidze LV, Kagan VB (1984) Formation of alpha-tocopherol
complexes with fatty-acids - a hypothetical mechanism of stabilization of
biomembranes by vitamin-E. Biochim Biophys Acta 774: 96—102

Evans HM, Bishop KS (1922) On the existence of a hitherto unrecognized dietary factor
essential for reproduction. Science 56: 650-651

F ahrenholtz SR, Doleiden FH, Trozzolo AM, Lamola AA (1974) Quenching of singlet
oxygen by alpha-tocopherol. Photochem Photobiol 20: 505-509

Falcone D, Ogas J, Somerville CR (2004) Regulation of membrane fatty acid
composition by temperature in mutants of Arabidopsis with alterations in membrane
lipid composition. BMC Plant Biol 4: 17

Falcone DL, Gibson S, Lemieux B, Somerville C (1994) Identification of a gene that
complements an Arabidopsis mutant deficient in chloroplast omega-6 desaturase
activity. Plant Physiol 106: 1453-1459

Fryer MJ (1992) The antioxidant effects of thylakoid vitamin-E (alpha- tocopherol).
Plant Cell Environ 15: 381-392

Gombos Z, Kanervo E, Tsvetkova N, Sakamoto T, Aro EM, Murata N (1997)
Genetic enhancement of the ability to tolerate photoinhibition by introduction of
unsaturated bonds into membrane glycerolipids. Plant Physiol 115: 551-559

Havaux M, Eymery F, Porfirova S, Rey P, Dormann P (2005) Vitamin E protects
against photoinhibition and photooxidative stress in Arabidopsis thaliana. Plant Cell
17 : 3451-3469

Hofius D, Hajirezaei MR, Geiger M, Tschiersch H, Melzer M, Sonnewald U (2004)
RNAi-mediated tocopherol deficiency impairs photoassimilate export in transgenic
potato plants. Plant Physiol 135: 1256-1268

Hong ZL, Delauney AJ, Verma DPS (2001) A cell plate specific callose synthase and
its interaction with phragmoplastin. Plant Cell 13: 755-768

Hugly S, Somerville C (1992) A role for membrane lipid polyunsaturation in chloroplast
biogenesis at low-temperature. Plant Physiol 99: 197-202

180

Jacobs AK, Lipka V, Burton RA, Panstruga R, Strizhov N, Schulze-Lefert P,
F incher GB (2003) An Arabidopsis callose synthase, GSL5, is required for wound
and papillary callose formation. Plant Cell 15: 2503-2513

Jiang Q, Elson-Schwab I, Courtemanche C, Ames BN (2000) Gamma-tocopherol and
its major metabolite, in contrast to alpha-tocopherol, inhibit cyclooxygenase activity
in macrophages and epithelial cells. Proc Natl Acad Sci USA 97 : 11494-11499

Jones MGK, Outlaw WH, Lowry OH (1977) Enzymic assay of 10-7 to 10-14 moles of
sucrose in plant-tissues. Plant Physiol 60: 379-383

Kagan VE (1989) Tocopherol stabilizes membrane against phospholipase-a, free fatty-
acids, and lysophospholipids. Ann NY Acad Sci 570: 121-135

Kamal-Eldin A, Appelqvist LA (1996) The chemistry and antioxidant properties of
tocopherols and tocotrienols. Lipids 31: 671-701

King RW, Zeevaart JA (1974) Enhancement of phloem exudation from out petioles by
chelating-agents. Plant Physiol 53: 96-103

Liebler DC, Burr JA (1992) Oxidation of vitamin-E during iron-catalyzed lipid-
peroxidation - evidence for electron-transfer reactions of the tocopheroxyl radical.
Biochemistry 31: 8278-8284

Lin TP, Caspar T, Somerville C, Preiss J (1988) Isolation and characterization of a
starchless mutant of Arabidopsis-thaliana (L) Heynh lacking ADP-glucose
pyrophosphorylase activity. Plant Physiol 86: 1 131-1 135

Maeda H, Wang S, L. ST, DellaPenna D (2006) Tocopherols play a crucial role in low-
temperature adaptation and phloem loading in Arabidopsis. Plant Cell 18: 2710-2732.

Marechal E, Block MA, Dorne AJ, Douce R, Joyard J (1997) Lipid synthesis and
metabolism in the plastid envelope. Physiol Plantarum 100: 65-77

Martin F W (1959) Staining and Observing Pollen Tubes in the Style by Means of
Fluorescence. Stain Technol 34: 125-128

Mcconn M, Hugly S, Browse J, Somerville C (1994) A mutation at the fad8 locus of
Arabidopsis identifies a 2nd chloroplast omega-3 desaturase. Plant Physiol 106:
1609-1614

Miquel M, Browse J (1992) Arabidopsis mutants deficient in polyunsaturated fatty-acid

synthesis - biochemical and genetic-characterization of a plant oleoyl-
phosphatidylcholine desaturase. J Biol Chem 267: 1502-1509

181

Miquel M, James D, Dooner H, Browse J (1993) Arabidopsis requires polyunsaturated
lipids for low-temperature survival. Proc Natl Acad Sci USA 90: 6208-6212

Munne-Bosch S, Alegre L (2002) The function of tocopherols and tocotrienols in plants.
Crit Rev Plant Sci 21: 31-57

Munne-Bosch S, Schwarz K, Alegre L (1999) Enhanced formation of alpha-tocopherol
and highly oxidized abietane diterpenes in water-stressed rosemary plants. Plant
Physiol 121: 1047-1052

Nishida I, Murata N (1996) Chilling sensitivity in plants and cyanobacteria: The crucial
contribution of membrane lipids. Annu Rev Plant Physiol 47: 541-568

Nishimura MT, Stein M, Hou BH, Vogel JP, Edwards H, Somerville SC (2003) Loss
of a callose synthase results in salicylic acid-dependent disease resistance. Science
301: 969-972

Okuley J, Lightner J, Feldmann K, Yadav N, Lark E, Browse J (1994) Arabidopsis
FAD2 gene encodes the enzyme that is essential for polyunsaturated lipid-synthesis.
Plant Cell 6: 147-158

Pentland AP, Morrison AR, Jacobs SC, Hruza LL, Hebert J S, Packer L (1992)
Tocopherol analogs suppress arachidonic-acid metabolism via phospholipase
inhibition. J Biol Chem 267: 15578-15584

Porfirova S, Bergmuller E, Tropf S, Lemke R, Dormann P (2002) Isolation of an
Arabidopsis mutant lacking vitamin E and identification of a cyclase essential for all
tocopherol biosynthesis. Proc Natl Acad Sci USA 99: 12495-12500

Powls R, Redfearn ER (1967) Tocopherols of blue-green algae. Biochem J 104: C24-&
Provencher LM, Miao L, Sinha N, Lucas WJ (2001) Sucrose export defectivel

encodes a novel protein implicated in chloroplast-to-nucleus signaling. Plant Cell
13: 1127-1141

Ricciarelli R, Tasinato A, Clement S, Ozer NK, Boscoboinik D, Azzi A (1998) alpha-
Tocopherol specifically inactivates cellular protein kinase C alpha by changing its

phosphorylation state. Biochem J 334: 243-249

Ricciarelli R, Zingg JM, Azzi A (2002) The 80th anniversary of vitamin E: beyond its
antioxidant properties. Biol Chem 383: 457-465.

Rimbach G, Minihane AM, Majewicz J, Fischer A, Pallauf J, Virgli F, Weinberg PD
(2002) Regulation of cell signalling by vitamin B. Proc Nutr Soc 61: 415-425

182

Russin WA, Evert RF, Vanderveer PJ, Sharkey TD, Briggs SP (1996) Modification
of a specific class of plasmodesmata and loss of sucrose export ability in the sucrose
export defectivel maize mutant. Plant Cell 8: 645-658

Sakamoto T, Murata N (2002) Regulation of the desaturation of fatty acids and its role
in tolerance to cold and salt stress. Curr Opin Microbiol 5: 206-210

Sakuragi Y, Maeda H, DellaPenna D, Bryant DA (2006) alpha-tocopherol plays a role
in photosynthesis and macronutrient homeostasis of the cyanobacterium
Synechocystis sp PCC 6803 that is independent of its antioxidant function. Plant
Physiol 141: 508-521

Sattler SE, Cahoon EB, Coughlan SJ, DellaPenna D (2003) Characterization of
tocopherol cyclases from higher plants and cyanobacteria. Evolutionary implications
for tocopherol synthesis and function. Plant Physiol 132: 2184-2195

Sattler SE, Gilliland LU, Magallanes-Lundback M, Pollard M, DellaPenna D (2004)
Vitamin E is essential for seed longevity, and for preventing lipid peroxidation
during germination. Plant Cell 16: 1419-1432

Savidge B, Weiss JD, Wong YHH, Lassner MW, Mitsky TA, Shewmaker CK, Post-
Beittenmiller D, Valentin HE (2002) Isolation and characterization of
homogentisate phytyltransferase genes from Synechocystis sp PCC 6803 and
Arabidopsis. Plant Physiol 129: 321-332

Schneider C (2005) Chemistry and biology of vitamin E. Mol Nutr Food Res 49: 7-30

Stillwell W, Dallman T, Dumaual AC, Crump FT, Jenski LJ (1996) Cholesterol
versus alpha-tocopherol: Effects on properties of bilayers made from heteroacid
phosphatidylcholines. Biochemistry 35 : 13353-13362

Takeda AAS, dos Santos J I, Marcussi S, Silveira LB, Soares AM, Fontes MRM
(2004) Crystallization and preliminary X-ray diffraction analysis of an acidic
phospholipase A(2) complexed with p-bromophenacyl bromide and alpha-
tocopherol inhibitors at 1.9-and 1.45-A resolution. Biochim Biophys Acta 1699:
281-284

Tappel AL (1972) Vitamin-E and free-radical peroxidation of lipids. Ann NY Acad Sci
203: 12-28

Uemura M, Joseph RA, Steponkus PL (1995) Cold-acclimation of Arabidopsis-
thaliana - Effect on plasma-membrane lipid-composition and freeze—induced lesions.

Plant Physiol 109: 15-30

Vogel J, Somerville S (2000) Isolation and characterization of powdery mildew-resistant
Arabidopsis mutants. Proc Natl Acad Sci USA 97: 1897-1902

183

Wada H, Gombos Z, Murata N (1990) Enhancement of chilling tolerance of a
Cyanobacterium by genetic manipulation of fatty-acid desaturation. Nature 347:
200-203

Wang XY, Quinn PJ (2000) The location and function of vitamin E in membranes
(review). Mol Membr Biol 17: 143-156

Welti R, Li WQ, Li MY, Sang YM, Biesiada H, Zhou HE, Rajashekar CB, Williams
TD, Wang XM (2002) Profiling membrane lipids in plant stress responses - Role of
phospholipase D alpha in freezing-induced lipid changes in Arabidopsis. J Biol
Chem 277 : 31994-32002

Welti R, Wang XM (2004) Lipid species profiling: a high-throughput approach to
identify lipid compositional changes and determine the function of genes involved in
lipid metabolism and signaling. Curr Opin Plant Biol 7: 337—344

Wise R, Naylor AW (1987) Chilling-enhanced photooxidation - Evidence for the role

of singlet oxygen and superoxide in the breakdown of pigments and endogenous
antioxidants. Plant Physiol 83: 278-282

184

2.30:3 3:39.932. 3 2522 033.82.
aubozmm 9599.22. 0. 02.28 3385.:

 

 

fin 50m «33:33.33
.389 8959.359 3.8 .o 98.. 3.8.33.5 08.528 a a. .89.. econ 05:8 as...
A 563...: .modX... no... .9 .oo .o .8... 9.525 62.2 .598 3.9: 8 38998 on 8:_a>

 

 
 

 

185

FIGURES AND TABLES

 

 

: to « v.3 : to a 3 z o... a 5» to a a.» S. n 3 t 2. u 3 . ad a a... to a 3 . c «a:

to a a... no « ad hm « 23 3 « v.3 no u 3 to a a... no a to. o... a a... to « ed 3 a «.3 .oo
:8 5 98 t

w... « 2: .. to a a... . m... « 0.3 . . 9c « 3 3 u 3 5 a u.» S. a 2. no « ed 3 u 93 «o...

to a a... to a 3 3 a «.3 ad a can. no u a... to a a... a... a a.» 2. a a... «.o a a." 3 u can. .8
n8 s 28 u

no a 5. No « 3 3 a can no a 3. 3 « 3 Z a N.» ed a 3. no a 9n 3 « ads «8..

ad a a... to a 3 3 a 5n 3 « Ru .3 n a.» a... a 3 m... H 3 to « a... no « tn 3 « 3a .00
D8 2.. 98b V

no u 3.. 3 « o.“ em « 93 a... a 98 3 a a... to u 3 no u 3 o... « a... No a o.» 3 « 98 «a:

m... a a: to a 3 v.» a 5n 3 a has a... a a... to a 3 3 a o... o... a o... v... a a.» 3 « mg .8
«as: 8&8 an. n8 5 .8 o

.82.. «"3369 nap «.3 :3 93 ~qu «6.. :9. 93
2.3 29.8

.5532. 28 .o 95.. 3 9:50 .00 new we... EB. «89.5 23. .30. .0 5:32.88 Eon 5.3 . 9.? 293.

vteZ
PUFA :---toco$§erols

  

3 ER-18221/1823i '
3
3
"6
g callose}
as: {sugars
:
f anthocyanin

Figure 4.1. A Proposed Time Course of Events Occurring in the cold-treated vte2 Mutant
and Suppression by the fad2 Mutation.

After transfer to cold, the vte2 mutant alters PUFA compositions (i.e. increase and decrease in the
ER-18:2 and 18:3, respectively), leading to callose deposition in phloem vascular parenchyma (6
hours) and a reduction in photoassimilate export capacity (6 hours) followed by the accumulation
of soluble sugars (3 days) and anthocyanins (14 days) in the source mature leaves. The presence of
tocopherols in wild type or the introduction of the fad2 mutation into vte2 attenuates the increased
level of ER-18:2 and thus suppresses the rest of the vte2 chilling phenotypes. PUFA,
polyunsaturated fatty acid; ER-1822 and 18:3, ER pathway-derived linoleic and linolenic acids,
respectively; GSL5, glucan synthase-like 5.

186

 

 

COI ”9298/5
”8295/5

   

 

 

 

 

so - 350 -
25. a E 300 < b b
g a 250 - DSucrose
. =
“a an 0 IFructose
a E 200
'g 154 a DGlucom
g g 150 -
I!
a! 10 - b b g 100 -
m
5 ' so - a a
0 o l l l *l
_ In N In - In N In
0 ~ w ~ 0 ‘ 0 s
In In m
U u ‘5' g: o u 3 é
a: o
E '5

Figure 4.2. Callose Deposition, Whole Plant Phenotypes, l‘C-Labeled Photoassimilate Export
Capacity, and Soluble Sugar Accumulation of Col, gslS, vte2 and vte2g315 after Low
Temperature Treatment.

All genotypes were grown under standard growth conditions for four weeks and transferred to low
temperature (7.5°C) conditions. Aniline-blue positive fluorescence at the lower half of leaves (A)
and visible phenotype (B) were observed afier one and two weeks of low temperature (7.5°C)
treatment, respectively. (C) After one week of 7.5°C treatment, the percent exudation of MC-labeled
photoassimilates was analyzed from mature leaves in the middle of the day. (D) Afier two weeks of
7.5°C treatment, mature leaves were harvested at the end of light cycle and glucose, fructose and
sucrose content analyzed. Data are means d: SD (n = 5). Nonsignificant groups are indicated by a
and b (P < 0.05).

187

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

N H ‘

DGDG
MGDG
PG
PC
PE
IOday Col
P' Douay m2
I14daysCol
PS Duchy: vte2
PA
40 60 80
B mol%
IOday Col
.0- noday m2 DGDG
:3 40- l14daysCol
3 D14days m2
E go.
0"——V'=-‘1fl-|i ILlfl-ll i I I I- f l
°°‘ MGDG
:3 80‘
3
E 3H
o — I“! T j
PC
”—1
=3
g 10- T
0-1 T
,0. PE
ES 20‘ il [ll
0
E 104
0? T n T l——I
'9 .. .. .. .. .. .. ..

Figure 4.3. Lipid Profiling of Col and vte2 before and after 14 Days of Cold Treatment.

Col (solid bars) and vte2 (open bars) were grown under standard growth conditions for four weeks
and transferred to low temperature (7.5°C) conditions. Mature leaves were harvested in the middle
of the day and total lipids were immediately extracted before (gray bars) and after (black bars) 14
days of cold treatment. Data are means i SD (n = 5). (A) Mol% of each lipid. (B) Mol% of
individual fatty acid pairs within each lipid. (C) A diagram summarizing changes in compositions
of each lipid species of vteZ relative to C01 after 14 days of cold treatment.

188

Figure 4.3. (continued)

DGDG, digalactosyldiacylglycerol; MGDG, monogalactosyldiacylglycerol; PG,
phosphatidylglycerol; PC, phosphatidylcholine; PE, phosphatidylethanolamine; PI,
phoshatidylinositol; PS, phosphatidylserine; PA, phosphatidic acid; LysoPG,
lysophosphatidylglycerol; LysoPC, lysophosphatidylcholine; LysoPE,
lysophosphatidylethanolamine; FAD, fatty acid desaturase.

189

 

A B

Middle of leaf
:

 
     

 

 

 

 

94 " é
a ...... .
a " ..
u t
2 1 d
+Col
...g.. vte2
o r l o I I
0 7 14 0 7 14
Days of 7.90 “current

3d 7d

   

Figure 4.4. 18:3/18:2 Ratio and Callose Deposition at Petioles and the Middle of Leaves of
C01 and vte2 during 14 days of Cold Treatment.

Col (closed circles) and vte2 (open squares) were grown under standard growth conditions for four
weeks and transferred to low temperature conditions for the indicated times. Fatty acid composition
of total lipid extracts were analyzed from petioles (B) and the middle of leaves (A). Data are means
d: SD (n = 4). * P < 0.05, ** P < 0.01 by Student’s t test of vte2 relative to C01 at each time point.
The bottom pictures show aniline-blue staining of petioles (B) and the middle of leaves (A) of vte2
for callose visualization at corresponding time points.

190

fad7/8

k’ “‘9

vte2fad2 vterad3 vte2fad6 vte2fad2/8

.’r“

9

 

Figure 4.5. Visible Phenotype of Col, vte2 and a Series of fad and vte2fad Mutants after Two
Weeks of Cold Treatment.

Plants were grown under permissive conditions for four weeks and then transferred to low
temperature (7.5°C) conditions for an additional two weeks. Bar = 2 cm.

191

 

 

 

 

 

 

    
 

A 140‘ aSucrose
120‘ lFructose
‘3‘, UGlucose
3100‘ ----------------------
g we
8
3: am
:3
to
o\° ‘0‘
c
20 c c c c
.. .. e .. a
8 3': E s s. i i s E
S "‘ '5 N N N
a g '3 g 'E
m
E
B 1401
_120‘
o
glwi- """""""""""" a'
'4’
: so-
0
=3
'8 601
3
x
0 40‘
=3
20- d d d
0d

 

 

fad3
fad6
fad2
m2

'5 g
0

§
3

fad7fad8
m2fad7fad8
vteradG
vteradZ

Figure 4.6. Soluble Sugar Content and l‘C—Labeled Photoassimilate Export Capacity of
Cold-Treated Col, vte2 and a Series of fad and vte2fad Mutants.

Plants were grown under permissive conditions for four weeks and then transferred to low
temperature condition (7.5°C). (A) After two weeks of cold treatment, the mature leaves were
harvested at the end of the light cycle and glucose, fructose and sucrose content analyzed. Values
are expressed as a percentage of vte2. (B) After one week of cold treatment, the capacity of phloem
exudation of 14C-labeled photoassimilates was analyzed in the middle of the day. Values were
expressed as percent Col. Data are means i SD (n = 5). Nonsignificant groups are indicated by a, b,
c and d, with a being the highest group (P < 0.05).

192

 

  
   
  
   

fad7fad8
vte2fad2 vterad3 vteradG vterad7fad8

COI fad7fad8
vteradZ vte2fad3 vte2fad6 vterad7fad8

Figure 4.7. Aniline Blue-Positive Fluorescence in Leaves of Col, vte2 and a Series of fad and
vte2fad Mutants after 3 and 7 days of Cold Treatment.

3 days at 7.5°C

 
 
 

7 days at 7.5°C

Plants were grown under permissive conditions for four weeks and then transferred to low
temperature (7.5°C) for additional 3 and 7 days. Leaves were harvested in the middle of the day.
Aniline blue-positive fluorescence was observed at the lower half of leaves.

193

CHAPTER 5: SUMMARY AND FUTURE PROSPECTS

194

Prior to the initiation of the study in this thesis, tocopherol functions in photosynthetic
organisms were only speculative due to the lack of tools to directly address this issue. A
suite of tocopherol biosynthetic mutants, which produce different levels and types of
tocopherols, were isolated in both Arabidopsis and Synechocystis during the gene
identification for tocopherol biosynthesis (Shintani and DellaPenna, 1998; Collakova and
DellaPenna, 2001; Schledz et al., 2001; Porfirova et al., 2002; Shintani et al., 2002;
Cheng et al., 2003; Sattler et al., 2003; Sattler et al., 2004). The use of these tocopherol
mutants uncovered unexpected roles for tocopherols in photosynthetic organisms, which
has led to a better understanding of tocopherol functions and raised many interesting

questions.

Tocopherols Have a Limited Role in Photoprotection.

It has long been assumed that tocopherols have an essential role in protecting
photosynthetic organisms from photooxidative stress (Fryer, 1992; Munne-Bosch and
Alegre, 2002). In the experiments described in Chapters 2 and 3 it si detemonstrated that
the elimination of tocopherols by orthologous mutations in both Arabidopsis and
Synechocystis PCC6803 have surprisingly subtle impacts on tolerance and adaptation to
HL stress. It was only under extreme lipid peroxidation stress conditions, such as PUFA-
induced lipid peroxidation stress (Chapter 2) and during early seedling development
(Sattler et al., 2004) that these tocopherol-deficient mutants became more susceptible
than wild type to oxidative stress. These results suggest that tocopherols are not essential
during HL stress under laboratory conditions tested and their function appears limited to

the extreme of lipid peroxidation stress.

195

The early light-induced proteins (ELIPS) or peroxiredoxins Q (Prx Q) have also
been proposed to play an important role in HL protection. However, the elimination of
ELIPS and Prx Q in Arabidopsis did not lead to a whole plant phenotype during HL stress,
likely due to an elevated induction of other compensatory mechanisms (Lamkemeyer et
al., 2006; Rossini et al., 2006). Similarly, the lack of tocopherols may also be
compensated for by other mechanisms during HL stress. Indeed, a Synechocystis
tocopherol-deficient mutant was more susceptible than wild-type to HL stress in the
presence of norflurazon, an inhibitor of carotenoid biosynthesis (Figure 2.7). Also, in
response to HL stress, Arabidopsis tocopherol-deficient mutants accumulated elevated
levels of zeaxanthin, a xanthophyll cycle carotenoid involved in NPQ (Table 3.2; Niyogi
et al., 1998; Muller et al., 2001; Holt et al., 2004). These results suggest that enhanced
induction(s) of carotenoids or mechanisms that involve carotenoids (e.g. NPQ)
compensate for the lack of tocopherols in the mutants. To test this hypothesis further, I
have generated Arabidopsis vteanqI and vteanq4 double mutants, which are deficient
in both tocopherols and zeaxanthin (Niyogi et al., 1998) or PsbS (Li et al., 2000),
respectively. Preliminary results showed that the HL susceptibility of these double
mutants was similar to the respective npq single mutants, suggesting that carotenoids or
NPQ do not have overlapping functions with tocopherols or that additional compensatory
mechanisms exist in Arabidopsis. The results presented in this thesis uncovered highly
versatile mechanisms protecting photosynthetic organisms from HL stress, and suggested
that roles of tocopherols in photoprotection have to be investigated as a component of the

highly redundant photoprotective mechanisms in the future.

196

Novel Roles for Tocopherols in Chilling Adaptation.

In contrast to the limited role of tocopherols during HL stress, the dramatic chilling
sensitive phenotypes of Arabidopsis tocopherol-deficient mutants indicated that
tocopherols play a crucial role in chilling adaptation. Obviously, this tocopherol function
cannot be compensated for by other mechanisms. Detailed phenotypic, biochemical and
ultrastructural characterization of the chilling phenotype illustrated that tocopherol
deficiency results in distinct compositions of PUFAS derived from the ER pathway,
leading to both impaired photoassimilate transport and callose deposition specifically at
phloem parenchyma cells. Ultimately, tocopherol-deficient mutants accumulate abnormal
levels of carbohydrates in source leaves and reduce their sink growth (Figure 4.1). While
it became clear that tocopherols have previously unrecognized roles independent of their
photoprotective functions, a number of questions remain to be answered in order to

further understand tocopherol functions in chilling adaptation.

Are the ultrastructural alterations of the phloem parenchyma a cause or result of
impaired photoassimilate export?

Although the callose deposition at the interface between phloem parenchyma and sieve
element/companion cell complexes is likely to be intimately associated with impaired
photoassimilate export, analyses of vtengl5 indicated that the majority of callose
deposited does not impact the vte2 export phenotype and thus GSL5-dependent callose
deposition in cold-treated vte2 vasculature is likely an independent or downstream event
of the export phenotype (Figure 4.1). However, vte2gsl5 still accumulated residual

callose, which is GSL5-independent and clearly produced by other callose synthase(s),

197

and this may be sufficient to block photoassimilate export in vtenglS. This possibility
can be evaluated by using 2-deoxy-glucose, an inhibitor for callose synthases (Jaffe and
Leopold, 1984; Yun et al., 2006), which would inhibit all callose synthases
simultaneously and completely eliminate callose. Ultrastructural analyses of the vte2
mutant treated with 2-deoxy-glucose and also the vte2gsl5 double mutant will help us to
further determine a cause and effect relationship between the phloem parenchyma
specific ultrastructural alteration (i.e. callose deposition) and the impaired

photoassimilate export observed in cold-treated vteZ.

How do the distinct PUFA changes in vte2 lead to impaired photoassimilate export?

Based on the reduced level of 18:3 observed in cold-treated vte2 relative to wild type, we
initially hypothesized that tocopherol deficiency may lead to elevated 18:3 degradation in
chloroplasts and hence an increase in 18:3-derived oxidation products and signals, such
as jasmonic acid (JA). However, we saw no evidence that membrane oxidation is
occurring in vte2 during chilling adaptation; Lipid peroxides were not accumulated and
the degree of total membrane unsaturation remained constant in vte2 during at least the
initial one week of low temperature treatment (Figure 3.4 and Table 4.1). Preliminary
analysis also failed to detect any increased level of JA, lZ-oxophytodienoic acid (OPDA)
and other oxidized lipid species (e.g. phytoprostanes, data not shown). Moreover, the
introduction of the fad3 and fad7fad8 mutations, which eliminate 18:3 synthesis, into the
vte2 background did not suppress any of the vteZ chilling phenotypes. Thus, it is unlikely
that 18:3-derived products are involved in the vte2 chilling phenotypes. To further

confirm this conclusion, the vteZaos (aos, gllene oxide synthase) and vterad3fad7fad8

198

mutants, which do not produce any JA and/or 18:3 (McConn and Browse, 1996; Park et
al., 2002), will be subjected to low temperature treatment and the vte2 chilling
phenotypes will be tested. If vteZaos and vte2fad3fad7fad8 still show a chilling sensitive
phenotype similar to vteZ, we can eliminate an involvement of 18:3-derived signals
including J A, OPDA and phytoprostanes in the chilling phenotypes of vte2.

Lipid profiling data and the suppression of the vteZ phenotypes by fad2 and to a
lesser extent fad6 raised the possibility that alteration in PUFAS derived from the ER
pathway may be a key event leading to the vte2 chilling phenotype. Consistent with this
thesis, fad3 and fad7fad8, which constitutively have an increased level of 18:2 and a
decreased level of 18:3 compared Col (Browse et al., 1993; McConn et al., 1994), also
exhibited a significantly lower capacity of photoassimilate export than Col at low
temperatures (Figure 4.6). To further test this hypothesis, lipid profiling analyses for
vte2fad2, vte2fad6, and vte2fad3 together with respective single mutants will be
conducted to assess if there is an inverse correlation between the accumulation of ER-
pathway-derived 18:2 and the capacity of photoassimilate export at low temperature.
Although it is not clear how the accumulation of the ER-pathway-derived 18:2 negatively
impact photoassimilate export from phloem parenchyma cells, activities of membrane
proteins, such as sucrose transporters, may be affected by unusual PUFA compositions in

cold-treated vte2.

How do tocopherols influence PUFAS derived from the ER pathway?

The results presented in Chapter 4 were unexpected and indicated that tocopherols

influence the composition of PUFAS derived from the ER pathway during chilling

199

adaptation. As discussed in Chapter 4, tocopherols may either indirectly affect the
activity of FAD3 or be required for efficient incorporation of highly unsaturated fatty
acids (e.g. 18:3) into membranes. Because the level of FAD3 expression correlates with
the FAD3 activity in leaves (Shah et al., 1997; Hamada et al., 1998), it is interesting to
test if FAD3 expression is affected in vteZ relative to C01 during low temperature
treatment. To investigate the later possibility, wild type and vteZ will be subjected to
treatments that increase PUFA synthesis, such as transferring plants from high to normal
temperatures (e.g. 35°C to 22°C, ref). If vte2 exhibits a lower 18:3/18:2 ratio and
photoassimilate export capacity than wild type without being subjected to chilling
temperature, it would suggest that tocopherols are required for increased PUFA synthesis
rather than low temperature adaptation per se.

Alternatively, tocopherols may be translocated to the extra-plastidic membranes
and exert their functions outside plastids. Although most previous studies have shown
that tocopherols are exclusively localized in the plastid membranes (Bucke, 1968; Wise
and Naylor, 1987), the current study revealed that tocopherols affect event(s) occurring
outside of the plastids. The most recent study demonstrated that ER membrane has
PLastid Associated membranes (PLAMS, Andersson et al., 2006) and tocopherols may be
translocated from plastids to ER or tocopherols in the plastid membranes may directly
affect activity of enzymes in the ER membrane through the PLAMS. Thus, tocopherol
function(s) should not be restricted only in the plastids and we may have to reevaluate the
precise localization of tocopherols from different tissues under various environmental

conditions.

200

Is toc0pherol function in the modulation of membrane PUFAS conserved among
photosynthetic organisms?

Until now, tocopherol-deficient mutants have been reported in four different
photosynthetic organisms, which include Arabidopsis, maize, potato, and Synechocystis.
Intriguingly, all of these lines exhibited an elevated carbohydrate accumulation
phenotype (Russin et al., 1996; Provencher et al., 2001; Hofius et al., 2004; Sakuragi et
al., 2006; Chapters 3 and 4, Appendix 3). However, there are a few differences between
their carbohydrate phenotypes. For example, Arabidopsis tocopherol-deficient mutants
accumulate carbohydrates only under low temperatures (Chapters 3 and 4), whereas
maize, potato and Synechocystis mutants exhibit such phenotypes under permissive
growth conditions (Russin et al., 1996; Provencher et al., 2001; Hofius et al., 2004;
Sakuragi et al., 2006; Appendix 3). It is unclear at this point why the Arabidopsis
carbohydrate phenotypes are low temperature inducible. However, PUFA compositions
were already altered in the petioles of Arabidopsis tocopherol-deficient mutants under
permissive temperatures (Figure 4.4) and it may be that low temperature exacerbates
already existing PUFA phenotypes to a threshold level which leads to impaired
photoassimilate export and carbohydrate accumulation.

To address such an unanswered question, we have to further understand the
mechanisms leading to the carbohydrate accumulation phenotype in these photosynthetic
organisms. It is interesting to test if the carbohydrate phenotypes of maize, potato and
Synechocystis tocopherol-deficient mutants can be also suppressed by altering PUFA
compositions. These experiments will not only provide additional tools to further uncover

the underlying mechanisms of tocopherol functions in the PUFA modulation and

201

carbohydrate metabolism but also address the universality of potentially a novel

tocopherol function of photosynthetic organisms.

202

REFERENCES

Andersson MX, Goksor M, Sandelius AS (2006) Optical manipulation reveals strong
attracting forces at membrane contact sites between endoplasmic reticulum and
chloroplasts. J Biol Chem in press.

Browse J, Mcconn M, James D, Miquel M (1993) Mutants of Arabidopsis deficient in
the synthesis of alpha-linolenate - biochemical and genetic-characterization of the
endoplasmic—reticulum linoleoyl desaturase. J Biol Chem 268: 16345-16351

Bucke C (1968) Distribution and stability of alpha-tocopherol in subcellular fractions of
broad bean leaves. Phytochemistry 7: 693-700

Cheng ZG, Sattler S, Maeda H, Sakuragi Y, Bryant DA, DellaPennaa D (2003)
Highly divergent methyltransferases catalyze a conserved reaction in tocopherol and
plastoquinone synthesis in cyanobacteria and photosynthetic eukaryotes. Plant Cell

15: 2343-2356

Collakova E, DellaPenna D (2001) Isolation and functional analysis of homogentisate
phytyltransferase from Synechocystis sp. PCC 6803 and Arabidopsis. Plant Physiol
127:1113-1124.

Fryer MJ (1992) The antioxidant effects of thylakoid vitamin-E (alpha- tocopherol).
Plant Cell Environ 15: 381—392

Hamada T, Kodama H, Takeshita K, Utsumi H, Iba K (1998) Characterization of
transgenic tobacco with an increased alpha-linolenic acid level. Plant Physiol 118:
591-598

Hofius D, Hajirezaei MR, Geiger M, Tschiersch H, Melzer M, Sonnewald U (2004)
RNAi-mediated tocopherol deficiency impairs photoassimilate export in transgenic
potato plants. Plant Physiol 135: 1256-1268

Holt NE, Fleming GR, Niyogi KK (2004) Toward an understanding of the mechanism
of nonphotochemical quenching in green plants. Biochemistry 43: 8281-8289

J affe MJ, Leopold AC (1984) Callose Deposition During Gravitropism of Zea-Mays
and Pisum-Sativum and Its Inhibition by 2-Deoxy-D-Glucose. Planta 161: 20-26

Lamkemeyer P, Laxa M, Collin V, Li W, Finkemeier I, Schottler MA, Holtkamp V,
Tognetti VB, Issakidis-Bourguet E, Kandlbinder A, Weis E, Miginiac-Maslow
M, Dietz KJ (2006) Peroxiredoxin Q of Arabidopsis thaliana is attached to the
thylakoids and functions in context of photosynthesis. Plant Journal 45: 968-981

203

Li XP, Bjorkman 0, Shih C, Grossman AR, Rosenquist M, Jansson S, Niyogi KK
(2000) A pigment-binding protein essential for regulation of photosynthetic light
harvesting. Nature 403: 391-395

McConn M, Browse J (1996) The critical requirement for linolenic acid is pollen
development, not photosynthesis, in an arabidopsis mutant. Plant Cell 8: 403-416

McConn M, Hugly S, Browse J, Somerville C (1994) A mutation at the fad8 locus of
Arabidopsis identifies a 2nd chloroplast omega—3 desaturase. Plant Physiol 106:
1609-1614

Muller P, Li XP, Niyogi KK (2001) N on-photochemical quenching. A response to
excess light energy. Plant Physiol 125: 1558-1566

Munne-Bosch S, Alegre L (2002) The function of tocopherols and tocotrienols in plants.
Crit Rev Plant Sci 21: 31-57

Niyogi KK, Grossman AR, Bjorkman O (1998) Arabidopsis mutants define a central
role for the xanthophyll cycle in the regulation of photosynthetic energy conversion.
Plant Cell 10: 1121-1134

Park J H, Halitschke R, Kim HB, Baldwin IT, Feldmann KA, Feyereisen R (2002) A
knock-out mutation in allene oxide synthase results in male sterility and defective
wound signal transduction in Arabidopsis due to a block in jasmonic acid
biosynthesis. Plant Journal 31: 1-12

Porfirova S, Bergmuller E, Tropf S, Lemke R, Dormann P (2002) Isolation of an
Arabidopsis mutant lacking vitamin E and identification of a cyclase essential for all
tocopherol biosynthesis. P Natl Acad Sci USA 99: 12495-12500

Provencher LM, Miao L, Sinha N, Lucas WJ (2001) Sucrose export defectivel
encodes a novel protein implicated in chloroplast-to-nucleus signaling. Plant Cell
13: 1127-1141

Rossini S, Casazza AP, Engelmann ECM, Havaux M, Jennings RC, Soave C (2006)
Suppression of both ELIPl and ELIP2 in Arabidopsis does not affect tolerance to
photoinhibition and photooxidative stress. Plant Physiol 141: 1264-1273

Russin WA, Evert RF, Vanderveer PJ, Sharkey TD, Briggs SP (1996) Modification
of a specific class of plasmodesmata and loss of sucrose export ability in the sucrose
export defectivel maize mutant. Plant Cell 8: 645-658

Sakuragi Y, Maeda H, DellaPenna D, Bryant DA (2006) alpha-tocopherol plays a role
in photosynthesis and macronutrient homeostasis of the cyanobacterium
Synechocystis sp PCC 6803 that is independent of its antioxidant function. Plant
Physiol 141: 508-521

204

Sattler SE, Cahoon EB, Coughlan SJ, DellaPenna D (2003) Characterization of
tocopherol cyclases from higher plants and cyanobacteria. Evolutionary implications
for tocopherol synthesis and function. Plant Physiol 132: 2184-2195

Sattler SE, Gilliland LU, Magallanes-Lundback M, Pollard M, DellaPenna D (2004)
Vitamin E is essential for seed longevity, and for preventing lipid peroxidation
during germination. Plant Cell 16: 1419-1432

Schledz M, Seidler A, Beyer P, Neuhaus G (2001) A novel phytyltransferase from
Synechocystis sp PCC 6803 involved in tocopherol biosynthesis. Febs Letters 499:
15-20

Shah S, Xin ZG, Browse J (1997) Overexpression of the FAD3 desaturase gene in a
mutant of Arabidopsis. Plant Physiol 114: 1533-1539

Shintani D, DellaPenna D (1998) Elevating the vitamin E content of plants through
metabolic engineering. Science 282: 2098-2100.

Shintani DK, Cheng Z, DellaPenna D (2002) The role of 2-methyl-6-
phytylbenzoquinone methyltransferase in determining tocopherol composition in
Synechocystis sp. PCC6803. FEBS Lett 511: 1-5.

Wise R, Naylor AW (1987) Chilling-enhanced photooxidation - Evidence for the role
of singlet oxygen and superoxide in the breakdown of pigments and endogenous
antioxidants. Plant Physiol 83: 278-282

Yun MH, Torres PS, El Oirdi M, Rigano LA, Gonzalez-Lamothe R, Marano MR,

Castagnaro AP, Dankert MA, Bouarab K, Vojnov AA (2006) Xanthan induces
plant susceptibility by suppressing callose deposition. Plant Physiol 141: 178-187

205

APPENDICES

206

A-l: Preliminary Analyses of the High Light Responses of Arabidopsis vte Mutants.

This section presents detailed analyses of the phenotypic and photosynthetic responses of
Arabidopsis vte mutants to HL stress. The obtained results allowed us to determine the
light condition and the time course of HL stress used for the large-scale experiments

presented in the Chapter 3.

Visible Phenotype under varied light intensities.

To assess if tocopherol deficiency impacts whole plant survival during HL stress, wild
type and tocopherol-deficient mutants were grown for 4 weeks under standard growth
conditions (12h, 120 nmol photon m'2 3'1 light at 22°C / 12h darkness at 18°C) and then
transferred to various HL conditions with light intensities ranging from 1000 to 2000
umol photon m'2 s'1 (hereafter refer to HL1000 or HL2000). Before HL treatment, the
obvious phenotypic differences were not observed among Col, vte2-I, vtel-1, and vtel-2
with the exception of vte] -1 having slightly thinner leaves and longer petioles than other
genotypes (Figure A1.1). Similar to the results obtained during HL1000 (Supplemental
Figure 3.81), when C01 and vte2-I were subjected to HL1500, their leaves changed color
to purple after about 48 hours of treatment (data not shown) but no obvious phenotypic
difference was observed between genotypes (Figure A1.2). Under HL1800, both C01 and
vte2-1 started to show bleached leaves after 24 hours of treatment. Under HL2000, these
symptoms appeared earlier and were more severe (Figure A1.2). vte2-I had slight
tendency towards more bleached leaves than Col but the trend was not reproducible. The

degree of these HL symptoms were highly variable between experiments (e.g. compare

207

Figure 3.2 and Supplemental Figure 3.82), which is likely caused by environmental
factors, such as slight difference in the growth condition before HL treatment (e.g. light
intensity, water status). Nevertheless, all genotypes were grown and treated side by side,

and thus all HL responses are comparable between genotypes within each experiment.

Time Course Pigment Analyses

To examine changes in photosynthetic pigment contents in response to HL stress, 7th and
9h oldest fully expanded mature leaves were harvested during 5-days time course of
HL1600. During HL treatment, total chlorophyll and carotenoid contents were gradually
decreased and increased, respectively. However, no obvious genotypic difference was
observed (Figure A13). The epoxidation state of xanthophyll cycle carotenoids
(A+Z/A+Z+V), which reflects the degree of NPQ induction (Niyogi et al., 1998; Muller
et al., 2001), was increased from 0.05 to 0.8 during the first day of HL1600 and gradually
decreased thereafter. Interestingly, vte2-I sustained higher A+Z/A+Z+V value than Col
after 3 days of HL1600, suggesting NPQ is being induced in vte2-I at higher degree than

Col.

Time Course F v/F m Measurements

Maximum photosynthetic efficiency (Fv/Fm) was also analyzed during 3 days of HL1600
treatment. All genotypes had Fv/Fm values around 0.8, indicating photosystem II (P811)
is not damaged under standard growth conditions (Figure A1.4). After HL1600, Fv/Fm
decreased from 0.8 to around 0.6 during the first day and gradually recovered to 0.7 after

3 days (Figure A1.4A). The Fv/Fm values of all three tocopherol-deficient mutants (vte2-

208

I, vtel-I, and vtel-2) were slightly lower than Col (1 test, P < 0.05) at the end of the ISI
day of HL1600 (8h HL1600) but became similar to C01 after 2 and 3 days (Figure
A1.4A). To examine initial photosynthetic responses, Fv/Fm was analyzed in C01 and
vte2-1 during the first 7 hours of HL1800. Both genotypes showed biphasic reductions in
Fv/Fm during the first 2 hours and after 6 hours of treatment. However, these changes in

Fv/Fm were almost identical between C01 and vte2-I (Figure A1.4B).

Quantum yield of PSII ((DPSII) and non-photochemical quenching (NPQ).

In order to assess photosynthetic efficiency of wild type and tocopherol-deficient mutants,
photo flux density (PFD)-dependent quantum yield of PSII ((DPSII) was analyzed. (DPSII
measures the proportion of absorbed light energy used for photochemistry and hence
reflect the efficiency of photosynthetic electron transport from PSII (Genty et al., 1989;
Maxwell and Johnson, 2000). Mature leaves of four-weeks-old normally grown plants

were illuminated with 100, 500, 1000, and 1500 pmol photon m‘2 s"

of actinic light
provided by a pulse amplitude modulated (PAM) fluorometer and (DPSII at each light
intensity was analyzed. As shown in Figure A1.5A, (DPSII values were decreased as PFD
increased, suggesting that less proportion of absorbed light energy was transferred to
photosynthetic linear electron transport as PFD increased. However, these values were
not different among genotypes under any PFD, suggesting the presence and absence of
tocopherols does not impact the efficiency of photosynthesis.

The degree of NPQ induction was also measured under the same condition. In a

reciprocal manner to (DPSII, NPQ increased as PFD increased (Figure A1.5B), indicating

excess energy which could not be used for photosynthetic linear electron transport are

209

dissipated as heat via NPQ (Maxwell and Johnson, 2000; Moller, 2001). vte2-1 showed
slightly higher NPQ at 1000 and 1500 umol photon m’2 s'1 in some experiments (Figure
A1.5B) but the differences were not significant. The kinetics of NPQ induction was also
analyzed in C01 and vte2-I during the first 8 and 10 min of 800 and 1500 umol photon m'
2

s’1 illuminations, respectively. Both C01 and vte2-I rapidly induced NPQ within a

minute of HL treatments but the genotypic differences were not detected (Figure A1.5C).

Based on these preliminary analyses using different light intensities and durations of HL
treatment, it became clear that the genotypic differences between wild type and
tocopherol-deficient mutants are, if any, very marginal and may be masked by a large
variation caused by environmental factors. Thus, large-scale experiments using higher
number of replicates were needed to distinguish the genotypic differences from
environmental variations. Because a large number of plant samples limit the number of
time points and conditions tested, I determined the following conditions for further large-
scale analyses as depicted in Figure A1.6. Four-weeks-old plants grown under standard
conditions are transferred to HL1800 (16h HL1800/8h dark) in the middle of the day.
Fv/Fm is analyzed at the end of the first day (8 h HL) and also in the middle of the
second day (8 h HL/8 h dark/8 h HL). Then visible phenotypes are pictured in the middle
of the third day when anthocyanin accumulation and any chlorosis become visible. In the
middle of the fourth day, photosynthetic pigment and tocopherol contents are analyzed.
As described in the Chapter 3, these analyses provided evidence that tocopherols has a
limited role under HL stress and other protective mechanisms such as zeaxanthin

accumulation may compensate for the lack of tocopherols under HL stress.

210

REFERENCES

Genty B, Briantais JM, Baker NR (1989) The relationship between the quantum yield
of photosynthetic electron-transport and quenching of chlorophyll fluorescence.
Biochim Biophys Acta 990: 87-92

Maxwell K, Johnson GN (2000) Chlorophyll fluorescence - a practical guide. J Exp Bot
51: 659-668

Moller IM (2001) Plant mitochondria and oxidative stress: Electron transport, NADPH

turnover, and metabolism of reactive oxygen species. Annu Rev Plant Physiol Plant
Mol Biol 52: 561-591

Muller P, Li XP, Niyogi KK (2001) Non-photochemical quenching. A response to
excess light energy. Plant Physiol 125: 1558-1566

Niyogi KK, Grossman AR, Bjorkman O (1998) Arabidopsis mutants define a central
role for the xanthophyll cycle in the regulation of photosynthetic energy conversion.
Plant Cell 10: 1121-1134

211

FIGURES

Col yteZ vte1-1 vte1-g,

 

Figure A1.1. Visible Phenotype of Arabidopsis Tocopherol-Deficient vte Mutants under
Permissive Growth Conditions.

Plants were grown under permissive growth conditions for four weeks and visible phenotype was
pictured.

212

    
   
  

1500
pmol photon m‘2 3'1

1800

umol photon m'2 s‘1

2000
pmol photon m'2 s‘1

Figure A1.2. Visible Phenotype of C01 and the vte2 Mutant after 3 Days of BL stress with
Varied Light Intensities.

Plants were grown under permissive growth conditions for four weeks and then transferred to
1500, 1800, and 2000 umol photon m‘2 s'1 of HL stress for 3 days.

213

Total chlorophylls (pglcmz) Total carotenoids (pglcmz)

A+ZIA+Z+V

 

 

 

 

 

 

 

 

 

o I I I I I I
0 1 2 3 4 5
Day(s) of HL

214

Figure A1 .3. Photosynthetic Pigment
Contents and Composition of Wild Type
and Tocopherol-Deficient Mutants during
HI. Stress.

Plants were grown under permissive growth
conditions for four weeks and then
transferred to HL stress (16h, 1600 pmol
photon rn'2 s'1/8h dark) at the beginning of
light cycle. Photosynthetic pigments were
analyzed at the end of the lst, 2nd, 3rd and
5th light cycles. Data are means i SD (n = 4).
A+Z+V, antheraxanthin + zeaxanthin +
Violaxanthin.

 

 

 

E
E
>
I.I.
0.4 . -----A Wet-1
- - -<> - - vte1-2
0.3 , , .
0 1 2 3
Days of HL treatment

B 0.8
0.7 k

0.64 Mill] E. E]

E 0.5- .Q
% 0.4- fl
"- 03- El'vte2

0-2- 0 Col

0.1 -

 

 

0 I I I l I I I

0 60 120 180 240 300 360 420

Time (min) of HL treatment

Figure A1.4. Changes in Maximum PSII Photosynthetic Efficiency (Fv/Fm) during HL
Stress.

Plants were grown under permissive growth conditions for four weeks and then transferred to HL
stress (16h, 1800 umol photon rn'2 s'1/8h dark) in the middle of light cycle. Fv/Fm was analyzed
at the indicated time points. Data in (A) are means i SD (n = 12).

215

 
 
  
   

 

 

 

 

 

0'8 + Col
—Cl-— vte2-1
= 0.6. "-A'" vte1-1
2 ---<>-- vte1-2
e, 0.4 .
0.2 .
o , . '
0 500 1000 1500 0 500 1000 1500
P F D (nmol photon m”2 5“) PFD (pmol photon or2 s")
3 .

NPQ

 

 

o . . . . , _ ,
o 2 4 a a 10 12 14

 

Time (min)

Figure ALS. Light Dependent-Quantum Yield of PSII ((DPSII) and Non-Photochemical
Quenching (NPQ) and NPQ kinetics of C01 and Tocopherol-Deficient Mutants.
Four-weeks-old plants grown under permissive growth conditions were dark-adapted at least 15
min before photosynthetic measurements. (DPSII (A) and NPQ (B) were measured after 7 min
illumination of 100, 500, 1000, and 1500 pmol photon m2 s'1 actinic light according to (Maxwell
and Johnson, 2000). (C) The Kinetics of NPQ induction was measured during the illumination of
800 and 1500 umol photon m'2 s’1 actinic light. Data are means :t SD [n = 4 for (A) and (B), n = 5
for (C)]

216

Tran for to Ht,

 

8 8 8
120uE122"C e ,«2 {a 1890ii5122°C7 V
> A h
a g :5 e a
o o N: n V
i
& Fv/Fm (photoinhibition) m

Pigment alldlySIS

Figure A1.6. The Scheme of a Large-Scale HL Experiment Conducted in the Chapter 3.

Plants were grown under permissive conditions (12h, 120 nmol photon m'2 s'1/12h dark) for 28
days and then transferred to HL stress (16h, 1800 umol photon m'2 s‘l/8h dark) in the middle of
the light cycle. Fv/Fm was measured after 8h and 24b of HL stress. Then, visible phenotype was

documented after 3days and tissues were harvested for pigment analysis after 4 days.

217

A-2: Map Based Cloning of Tocopherol Methyltransferase Gene (VTE3) in

Arabidopsis.

The work presented in this section has been published:

Zigang Cheng, Scott Sattler, Hiroshi Maeda, Yumiko Sakuragi, Donald A. Bryant,
and DellaPenna, D. (2003) Highly Divergent Methyltransferases Catalyze a Conserved
Reaction in Tocopherol and Plastoquinone Synethesis in Cyanobacteria and

Photosynthetic Eukaryotes. Plant Cell 15, 2343—2356

Author’s contributions:

Scott Sattler and Hiroshi Maeda carried out the genetic mapping of the VTE3 locus in
Arabidopsis. Hiroshi Maeda also performed quantitation of tocopherols from
Synechocystis. Yumiko Sakuragi generated the Synechocystis 5110418 mutant. Zigang
Cheng conducted the rest of the research and wrote the manuscript. Donald A. Bryant
was involved in project development. Dean DellaPenna supervised the entire project and

. was involved in all aspects of manuscript writing.

218

ABSTRACT

Tocopherols are lipid-soluble compounds synthesized only by photosynthetic eukaryotes
and oxygenic cyanobacteria. The pathway and enzymes for tocopherol synthesis are
homologous in cyanobacteria and plants except for 2-methyl—6-phytyl-l,4-
benzoquinone/2-methyl-6-solanyl-l,4-benzoquinone methyltransferase (MPBQ/MSBQ
MT), which catalyzes a key methylation step in both tocopherol and plastoquinone (PQ)
synthesis. Using a combined genomic, genetic, and biochemical approach, we isolated
and characterized the VTE3 (vitamin E defective) locus, which encodes MPBQ/MSBQ

MT in Arabidopsis. The phenotypes of vte3 mutants are consistent with the disruption of

MPBQ/MSBQ MT activity to varying extents. The ethyl methanesulfonate- derived

vte3-I allele alters tocopherol composition but has little impact on PQ levels, whereas the
null vte3-2 allele is deficient in PQ and a- and y-tocopherols. In vitro enzyme assays
confirmed that VTE3 is the plant functional equivalent of the previously characterized
MPBQ/MSBQ MT (8110418) from Synechocystis sp PCC6803, although the two proteins
are highly divergent in primary sequence. 8110418 orthologs are present in all fully
sequenced cyanobacterial genomes, Chlamydomonas reinhardtii, and the diatom
Thalassiosira pseudonana but absent from vascular and nonvascular plant databases.
VTE3 orthologs are present in all vascular and nonvascular plant databases and in C.
reinhardtii but absent from cyanobacterial genomes. Intriguingly, the only prokaryotic
genomes that contain VTE3-like sequences are those of two species of archea, suggesting
that, in contrast to all other enzymes of the plant tocopherol pathway, the evolutionary
origin of VTE3 may have been archeal rather than cyanobacterial. In vivo analyses of

vte3 mutants and the corresponding homozygous Synechocystis sp PCC6803

219

sllO418::aphII mutant revealed important differences in enzyme redundancy, the
regulation of tocopherol synthesis, and the integration of tocopherol and PQ biosynthesis

in cyanobacteria and plants.

INTRODUCTION

Tocopherols, collectively termed vitamin E, are a class of lipid-soluble compounds that
are synthesized only by oxygenic photosynthetic organisms. All tocopherols are
amphipathic molecules with polar head groups exposed to the membrane surface and
hydrophobic tails that interact with the acyl groups of membrane lipids. Four types of
tocopherols (0t-, B-, y-, and 5-tocopherols [Ot-, B-, y-, and 8-T, respectively]) are
synthesized naturally and differ only in the number and position of methyl substituents on
the chromanol ring (Figure A2.1). Tocopherols are essential dietary components for
humans and other mammals; as a result, most of our understanding of tocopherol function
has been derived from studies in these systems (for reviews, see Hanck, 1985; Brigelius-
Flohe and Traber, 1999; Valk and Homstra, 2000; Brigelius-Flohe et al., 2002; Ricciarelli
et al., 2002). Studies in mammals, animal cell cultures, and artificial membranes have
shown that tocopherols help maintain membrane structure and integrity (Srivastava et al.,
1989), act as antioxidants and free radical scavengers (Tappel, 1962; Jialal and Fuller,
1993; Jialal et al., 2001; Behl and Moosmann, 2002), and perform other nonantioxidant
functions related to signaling and transcriptional regulation (Azzi et al., 1995; Grau and
Ortiz, 1998; Ricciarelli et al., 2002). The functions of tocopherols in photosynthetic
organisms have yet to be determined, but they are likely to include unique functions in

addition to those reported in animals (Noctor and Foyer, 1998; Grasses et al., 2001;

220

Reverberi et al., 2001). Mutant and transgenic approaches in Arabidopsis and
Synechocystis sp PCC6803 that eliminate tocopherols (Collakova and DellaPenna, 2001;
Schledz et al., 2001), replace tocopherols with biosynthetic intermediates (Porfirova et al.,
2002; Sattler et al., 2003), or increase tocopherol levels (Collakova and DellaPenna,
2001; Savidge et al., 2002) are beginning to provide insight into tocopherol functions in
photosynthetic organisms.

Tocopherols are synthesized by a pathway that is conserved between
cyanobacteria and plants (Figure A21) (8011 et al., 1980, 1985; Lichtenthaler et al., 1981;
Norris et al., 1995, 1998). The conversion of p-hydroxyphenylpyruvate (HPP) to
homogentisic acid (HGA) by HPP dioxygenase (HPPD) yields the aromatic head group
for both tocopherol and plastoquinone biosynthesis in plants (Norris et al., 1998). The
committed step in tocopherol synthesis is the condensation of HGA and
phytyldiphosphate by homogentisate phytyltransferase (HPT) to produce the first
tocopherol intermediate, 2-methyl-6-phytylbenzoquinone (MPBQ) (Collakova and
DellaPenna, 2001; Schledz et al., 2001; Savidge et al., 2002). Biochemical analyses have
shown that the steps leading from MPBQ to a-tocopherol are as follows: (1) ring
methylation of MPBQ by 2-methyl-6-phytyl-l,4-benzoquinone/2-methyl-6—solanyl-l,4-
benzoquinone methyltransferase (MPBQ/MSBQ MT) to yield 2,3-dimethyl-5-
phytylbenzoquinone (DMPBQ) (8011 et al., 1985); (2) ring cyclization of DMPBQ by
tocopherol cyclase (TC) to yield y-T (8011 et al., 1985; Arango and Heise, 1998; Porfirova
et al., 2002; Sattler et al., 2003); and (3) a second ring methylation by y-tocopherol

methyltransferase (y—TMT) to yield Ot-T (8011 et al., 1980; d'Harlingue and Camara, 1985;

Shintani and DellaPenna, 1998). Alternatively, MPBQ can be cyclized to form 5-T and

221

then methylated by y-TMT to yield B-T. All enzymatic activities for tocopherol synthesis
in plants have been localized to the inner chloroplast envelope except HPPD, which is
cytosolic (Soll etal., 1980, 1985).

In plants, the lipid-soluble, plastid-localized electron carrier plastoquinone (PQ) is
synthesized by the pathway shown in Figure A2.1. As in tocopherol synthesis, the
committed step in PQ synthesis is condensation of the aromatic compound HGA with a
prenyldiphosphate, solanyldiphosphate, to yield 2-methyl-6-solanylbenzoquinone
(MSBQ) by homogentisate solanyltransferase, an activity distinct from HPT (Norris et al.,
1995; Collakova and DellaPenna, 2001). MSBQ then is methylated at the same ring
position as MPBQ to yield PQ. The similarity of the MPBQ and MSBQ structures has led
to the proposal that a single enzyme performs the methylation of both compounds. This
has been demonstrated for MPBQ/MSBQ methyltransferase (MPBQ/MSBQ MT) from
the cyanobacterium Synechocystis PCC6803, which, when cloned and assayed in
Escherichia coli, was capable of using both MPBQ and MSBQ as substrates (Shintani et
al., 2002). Whether such a multifunctional activity exists in plants is unclear.

Although the plant tocopherol and PQ biosynthetic pathways were elucidated in
labeling studies during the 19803 (d'Harlingue and Camara, 1985; Marshall et al., 1985;
8011 et al., 1985), the membrane association and low specific activity of most pathway
enzymes have hindered their isolation and characterization. Most tocopherol pathway
enzymes have been isolated only recently by combining genetic and genomic approaches
in Synechocystis sp PCC6803 and Arabidopsis, in which the isolation of an enzyme from
one organism has facilitated the isolation of the respective ortholog from the other.

Sequencing of the Synechocystis sp PCC6803 and Arabidopsis genomes has greatly

222

facilitated this process, so that now, HPPD, HPT, TC, and y-TMT have been cloned and
characterized from both organisms (Norris et al., 1998; Shintani and DellaPenna, 1998;
Collakova and DellaPenna, 2001; Shintani et al., 2002; Porfirova et al., 2002; Sattler et
al., 2003). Although these studies have shown that these four pathway steps and enzymes
are conserved between cyanobacteria and plants, other studies have provided evidence
that portions of the tocopherol and PQ pathways are not identical in the two organisms.

One such example is the different requirement of HGA for PQ synthesis in
cyanobacteria and higher plants. Although the Synechocystis sp PCC6803 and
Arabidopsis genomes both encode HPPD enzymes, disruption of HPPD activity in the
two organisms yields drastically different phenotypes. A null Arabidopsis HPPD mutant
is deficient in both tocopherol and PQ and is seedling lethal (Norris et al., 1998), whereas
the orthologous Synechocystis sp PCC6803 mutant is viable and lacks tocopherols only
(Dahnhardt et al., 2002). This finding suggests that, unlike in plants, the aromatic head
group for PQ synthesis in Synechocystis sp PCC6803 is not derived from HGA or that
there is an alternative route for HGA synthesis in this organism. The different phenotypes
of HPPD-deficient Arabidopsis and Synechocystis sp PCC6803 mutants indicate that the
mere presence of functional orthologs in cyanobacteria and plants does not necessarily
equal identical biosynthetic pathways.

The only tocopherol pathway enzyme that has not yet been cloned from plants is
MPBQ/MSBQ MT. MPBQ/MSBQ MT activity has been demonstrated in spinach
chloroplasts (Soll et al., 1985), and maize and sunflower mutants have been identified
with phenotypes consistent with the disruption of MPBQ/MSBQ MT activity (Cook and

Miles, 1992; Demurin et al., 1996). MPBQ/MSBQ MT has been cloned and characterized

223

from Synechocystis sp PCC6803 (Shintani et al., 2002), but despite the high degree of
evolutionary conservation between plants and cyanobacteria for other tocopherol
pathway enzymes, no obvious orthologs could be identified in the completed Arabidopsis
and rice genomes and numerous plant EST databases. This finding suggests that,
analogous to the different routes to PQ head group synthesis in Synechocystis sp
PCC6803 and Arabidopsis (Norris et al., 1998; Dahnhardt et al., 2002), MPBQ/MSBQ
MT also may differ between cyanobacteria and plants. Here, we report the identification
and characterization of a novel MPBQ/MSBQ MT from Arabidopsis that has orthologs in
all plant, but not cyanobacterial, databases. The low sequence identity between the
cyanobacterial and plant MPBQ/MSBQ MTs suggests that they are nonorthologous,
functionally equivalent enzymes that arose independently during the evolution of plants

and cyanobacteria.

RESULTS

Search for an Arabidopsis Homolog of Synechocystis sp PCC6803 MPBQ/MSBQ MT
Using Genome-Based Approaches

(To better understand tocopherol synthesis in plants, we attempted to identify an
Arabidopsis ortholog of Synechocystis sp PCC6803 MPBQ/MSBQ MT, which had been
identified previously as open reading frame (ORF) sllO4I8 (Shintani et al., 2002).
8110418 orthologs were identified using tBLASTn (Basic Local Alignment Search Tool;
P < 1081) in the fully sequenced cyanobacterial genomes of Anabaena sp PCC7120,
Thermosynechococcus elongatus, Prochlorococcus marinas M1T9313 and MED4, and

Synechococcus sp WH8102, in the partially sequenced cyanobacterial genomes of

224

Synechococcus sp PCC7002 and Trichodesmium erythraem IMSlOl, in the genome and
EST databases of the green alga Chlamydomonas reinhardtii, and in the raw genome
sequence data of the diatom Thalassiosira pseudonana (Figure A2.2). However,
exhaustive searches of public DNA databases for vascular and nonvascular plants,
including the complete Arabidopsis and rice genomes, failed to identify a convincing
ortholog of Synechocystis sp PCC6803 $110418. The two proteins in the Arabidopsis
genome with the greatest similarity to $110418 are y—TMT (P < 1037), which is not active
toward MPBQ when assayed in vitro (data not shown), and SMTl (P < 1018), a sterol
methyltransferase that is not targeted to the chloroplast (Diener et al., 2000).

In a parallel approach, 93 predicted proteins in the Arabidopsis genome were
identified that contain motifs characteristic of conserved S-adenosylmethionine binding
domains in methyltransferases (Kagan and Clarke, 1994). Eleven of these proteins, one of
which was y—TMT, also were predicted to be targeted to the chloroplast, the known
subcellular location of plant MPBQ/MSBQ MT activity (S011 et al., 1985). The protein
sequences of these putative chloroplast-targeted methyltransferases were aligned with
methyltransferases of known functions, including previously characterized
methyltransferases involved in tocopherol synthesis (Figure A22). The resulting
phylogenetic tree indicated that none of the Arabidopsis sequences clustered with the
Synechocystis sp PCC6803 MPBQ/MSBQ MT clade (Figure A2.2). Given that plant
chloroplasts are known to contain MPBQ/MSBQ MT activity (Soll et al., 1985), these
combined data suggest that, unlike the other enzymes of the tocopherol pathway,
Arabidopsis and Synechocystis sp PCC6803 MPBQ/MSBQ MTs share little identity at

the level of the primary amino acid sequence.

225

Identification of Arabidopsis MPBQ/MSBQ MT Mutants and Cloning of the VTE3
Locus

A genetic approach was used concurrently with genomic approaches to identify the
MPBQ/MSBQ MT locus in Arabidopsis. A rapid HPLC-based screen of Arabidopsis leaf
tissue was developed to identify mutants with altered leaf tocopherol profiles (Sattler et
al., 2003). The screening of an ethyl methanesulfonate—mutagenized Arabidopsis
population (ecotype Columbia) yielded one mutant line that, compared with the wild type,
had reduced levels of OL-T and y-T and greatly increased levels of B-T and 5-T (Table
A2.1). This is a biochemical phenotype consistent with a reduction in MPBQ/MSBQ MT
activity (Figure A21). The mutant was designated vte3-1 (vitamin E defective).

A map-based cloning approach was used to isolate the VTE3 locus. vte3-1 was
crossed to wild-type Landsberg erecta, and an F2 population was screened by HPLC for
the vte3-I phenotype. Seventy-two of 276 F2 plants were identified as vte3-1
homozygotes, indicating that vte3-I is recessive (x2 = 0.168). vte3-I was mapped to an
~2—Mb interval at the bottom of chromosome 111 using simple sequence length
polymorphism markers (Figure A2.3A). Two simple sequence length polymorphism
markers on BACs T15C9 and T17J13 identified 13 and 2 recombination events for vte3-1,
respectively, indicating that the VTE3 locus was located to the right of BAC T17J13
(Figure A2.3A). In the 398-kb interval from T17] 13 to the telomere, there are two
predicted methyltransferases, At3g63250 and At3g63410. At3g63250 encodes a
previously cloned and characterized homocysteine S-methyltransferase (Ranocha et al.,

2000). At3g63410 encodes a 338—amino acid (37.9 kD) protein of unknown function that

226

contains conserved S-adenosylmethionine binding motifs and a predicted 58—amino acid
chloroplast transit peptide.

To determine whether the At3g63410 locus encodes VTE3, the corresponding
wild-type and vte3-I genes were amplified and sequenced. At3g63410 in vte3-I contains
a C-to-T conversion at nucleotide 281 of the ORF that results in the mutation of Thr-94 to
Ile-94 (Figure A2.3B). A second mutant allele, vte3-2, was identified from the Salk T-
DNA insertion population. vte3-2 contains a T-DNA insertion in the first exon of
At3g63410 at nucleotide 163 of the ORF (Figure A2.3B) and is predicted to result in a

complete loss of enzyme activity.

Whole-Plant Phenotypes of vte3-1 and vte3-2
Young vte3-I seedlings were slightly smaller than wild—type seedlings (Figure A2.3C)
but otherwise were healthy and indistinguishable from the wild type. By contrast, vte3-2
seedlings were pale green and did not survive beyond 7 days in soil. Therefore, the vte3-2
allele was maintained as a heterozygote. Progeny from VTE3-2/vte3-2 germinated fully
and segregated at a 3:1 ratio (wild type:mutant; x2 = 0.172). Seeds produced from vte3-
1/vte3-I and VTE3-2/vte3-2 were indistinguishable from wild-type seeds in size, shape,
and germination rates (data not shown), suggesting that the partial or total loss of VTE3
activity does not affect embryo growth and development.

vte3-2 seedlings grown on sterile medium supplemented with 1% sucrose were
pale but, unlike soil-grown plants, survived for several weeks and produced sufficient
tissue for biochemical analyses. The phenotype of plate-grown vte3-2 seedlings ranged

from albino to those that had pale green newly emerging leaves with older leaves that

227

were progressively bleached (Figure A2.3C). These observations suggest that, unlike the
missense vte3-1 point mutation, a null mutation of the At3g63410 locus inhibits

photosystem assembly/function and causes severe photobleaching.

Analysis of Tocopherols in Leaves and Seeds of vte3 Mutants
Homozygous vte3-2 mutants are soil lethal. To directly compare the effects of vte3
mutations on tocopherol synthesis, wild-type and mutant plants were grown on media
supplemented with 1% sucrose. The tocopherol profile of wild-type leaves consists of on-
T, y—T, and B-T in an ~90:8:2 ratio (Table A2.1). In vte3-1 leaves, total tocopherol levels
were increased slightly but significantly relative to the wild type, and OL-T and y-T levels
were decreased to 33 and 3%, whereas B-T and S-T were increased to 42 and 22% of total
tocopherols, respectively (Table A2.1). These results indicate that the vte3-I mutation
leads to a >60% reduction in the methylation of MPBQ, which instead is cyclized to 5-T,
the majority of which then is methylated further by y-TMT to yield B—T (Figure A2.1).
Leaf tissue from homozygous vte3-2 mutants accumulated B-T and 5-T only
(Table A2.1), a phenotype consistent with a complete lack of MPBQ/MSBQ MT activity.
The absence of 0t-T and y-T in vte3-2 indicates that no redundant MPBQ/MSBQ MT
activities exist in Arabidopsis and that the ethyl methanesulfonate—derived vte3-I allele is
leaky. The total tocopherol level in pale/bleached vte3-2 leaf tissue was reduced by >50%
relative to the wild type, most likely as a result of the reduced flux through the tocopherol
pathway or accelerated tocopherol degradation as a result of the severe photobleaching in

vte3-2. Unlike vte3-I, vte3-2 was found to be semidominant, because leaves of soil-

228

grown VTE3-2/vte3-2 plants accumulated significantly increased levels of B-T compared
with wild-type leaves (Table A2.1).

In addition to leaves, seeds also accumulate tocopherols. The total tocopherol
level of wild-type Arabidopsis seeds was >20—fold higher than that of unstressed soil-
grown leaves on a fresh weight basis and was composed of 92% y-T, 3% oc-T, and 5% 5-
T (Table A2.2). Seeds of vte3-I mutants showed a lS-fold increase in 5-T content,
whereas y-T levels decreased by 31% relative to the wild type (Table A2.2). These data
indicate that, as in leaf tissue, the majority of MPBQ in vte3-I seeds is not methylated by
MPBQ/MSBQ MT but instead undergoes cyclization to produce B-T. B-T was not
detected in the mutant because of the low y-TMT activity in seeds (Shintani and
DellaPenna, 1998).

Because homozygous vte3-2 mutants are seedling lethal in soil, the effects of the
mutation on seed tocopherol synthesis could be determined only in seeds from VTE3-
2/vte3-2 plants. Although only 25% of the seeds obtained from VTE3-2/vte3-2 plants
were homozygous for the vte3-2 locus, there was an increase in S-T similar to that seen in
homozygous vte3-I seeds (Table A2.2). Because vte3-2 is semidominant in leaf tissue
(Table A2.1), we could not determine whether the 5—T produced is only from vte3-2/vte3-
2 seeds or whether VTE3-2/vte3-2 seeds also contribute to the phenotype. It also is
important that not only was seed tocopherol composition altered by the vte3-I and vte3-2
mutations but the levels of total tocopherols in both mutant alleles were increased
significantly (P S 0.01), 38 and 30%, respectively, relative to those in the wild type

(Table A2.2). This finding suggests that changes in tocopherol composition caused by

229

altered MPBQ/MSBQ MT activity affect tocopherol levels either as a result of increased

flux through the pathway or as decreased turnover of tocopherols in seeds.

PQ Synthesis Also Is Disrupted in Homozygous vte3-2 Plants

The dramatic difference in the whole-plant phenotypes of vte3-1 and vte3-2 (Figure
A2.3C), coupled with the fact that plant tocopherol and PQ synthesis are related
biochemically (Figure A2.1), prompted us to determine whether PQ synthesis is affected
differentially in these mutants. vte3-1 leaf tissue showed a small (17%) but significant
decrease in PQ relative to the wild type (Table A2.1) with a trace amount of MSBQ, the
immediate biosynthetic precursor of PQ and substrate for MPBQ/MSBQ MT (Figure
A2.4). Leaves of vte3-2 plants completely lacked PQ and accumulated high levels MSBQ
(Table A2.1, Figure A24). The small peak at 12.10 min in the vte3-2 HPLC trace has a
spectrum unlike that of any PQ pathway intermediates and is an unrelated compound of
low abundance that migrates as a small shoulder of the large PQ peak in the wild type
(Figure A2.4, inset).

The combined data from vte3-1 and vte3-2 provide genetic evidence that VTE3 is
involved in both tocopherol and PQ synthesis in vivo. The severe photobleaching
phenotype of vte3-2 is caused by the PQ deficiency and/or accumulation of MSBQ, rather
than by altered tocopherol composition. This finding is in agreement with studies of
tocopherol cyclase mutants of Arabidopsis that lack tocopherols and accumulate the
biosynthetic intermediate DMPBQ but are phenotypically similar to wild-type plants
(Porfirova et al., 2002; Sattler et al., 2003). Finally, the absence of PQ in vte3-2 indicates

that, as with tocopherol synthesis, Arabidopsis does not contain other functionally

230

redundant activities that catalyze the methylation of MSBQ to form PQ. VTE3-2/vte3-2
plants accumulated PQ at a level similar to wild-type plants (Table A2.1) with no
detectable MSBQ (data not shown), indicating that, unlike the vte3-2 tocopherol
phenotype, vte3-2 is recessive for the PQ phenotype. While this article was under review,
a Ds-tagged VTE3 allele was reported from a large-scale screen for apg (albino or pale
green) mutants in Arabidopsis (Motohashi et al., 2003). Although tocopherols were not
analyzed in that study, the Ds-tagged VTE3 allele also was found to be deficient in PQ

(Motohashi et al., 2003).

VTE3 Uses Both MPBQ and MSBQ as Substrates in Vitro

Genetic evidence strongly suggests that VTE3 encodes both MPBQ MT and MSBQ MT
activities. To determine the activity of VTE3 against various potential substrates, the full-
length VTE3 protein-coding region was amplified from an Arabidopsis EST clone and
engineered for expression in E. coli. Activity assays against various substrates
demonstrated that, like Synechocystis sp PCC6803 MPBQ/MSBQ MT, VTE3 uses both
MPBQ and MSBQ, intermediates in tocopherol and PQ synthesis, respectively, as
methylation substrates in vitro (Figure A2.5). Neither Synechocystis sp PCC6803
MPBQ/MSBQ MT (Shintani et al., 2002) nor VTE3 (data not shown) used B-T or 5-T as
a methylation substrate in vitro. These data demonstrate conclusively that Arabidopsis

VTE3 is the functional equivalent of Synechocystis sp PCC6803 MPBQ/MSBQ MT.

231

Analysis of MPBQ/MSBQ MT Activity in Synechocystis sp PCC6803

The sllO418 ORF in Synechocystis sp PCC6803 was shown previously by gene disruption
and in vitro enzyme assays to encode a protein with MPBQ/MSBQ MT activity (Shintani
et al., 2002). Complete segregation of the mutant locus could not be achieved under
mixotrophic growth conditions (glucose-containing medium in the light), suggesting that
the total loss of $110418 activity was lethal. The merodiploid 31104 I 8/s11041 8::aphII strain
showed a reduced OL-T level and a small amount of B-T accumulation, which confirmed a
role for 8110418 in tocopherol synthesis in Synechocystis sp PCC6803 in vivo. We have
now isolated the homozygous 311041 8::aphII mutant by selection under photoautotrophic
conditions. Apparently, the inability to isolate a homozygous mutant under mixotrophic
conditions is the result of a glucose-dependent lethality associated with the disruption of
5110418. A complete description of the homozygous Synechocystis sp PCC6803
311041 8::aphII mutant and the accompanying phenotype of tocopherol-deficient mutants
will be published elsewhere (Y. Sakuragi, H. Maeda, D. DellaPenna, and DA. Bryant,
unpublished data).

The tocopherol content of the homozygous sllO418::aphII mutant did not differ
significantly from that of the previously described merodiploid strain (Shintani et al.,
2002). The homozygous sllO418::aphlI strain contains 35% of the wild-type tocopherol
level and consists primarily of OL-T with a small amount of B-T (Table A21). The PQ
content of the homozygous sllO418::aphII strain also is reduced to 70% of wild-type
levels, and MSBQ is not detectable (data not shown). These observations are highly
significant because they demonstrate the presence of one or more partially redundant

MPBQ/MSBQ MT activities in Synechocystis sp PCC6803 or the presence of an

232

alternative biosynthetic route(s) to oc-T and PQ. The homozygous s110418::aph11 mutant
phenotype is in sharp contrast to the corresponding homozygous Arabidopsis vte3-2

mutant, in which both OL-T and PQ synthesis are fully disrupted.

VTE3 and Synechocystis sp PCC6803 MPBQ/MSBQ MT Are Highly Divergent in
Primary Sequence

Although VTE3 and Synechocystis sp PCC6803 MPBQ/MSBQ MT have conserved
enzymatic activities (Figure A2.5), the two proteins are highly divergent in their primary
amino acid sequences, with an overall identity of 18% (Table A23). The primary regions
of significant similarity are in the S—adenosylmethionine binding motifs I, II, and 111,
domains involved in the binding of the methyl donor (Figure A2.6) (Kagan and Clarke,
1994; Joshi and Chiang, 1998). In addition to a low overall similarity, Synechocystis sp
PCC6803 MPBQ/MSBQ MT and VTE3 have numerous gaps in their alignment (Figure
A2.6). Thus, the VTE3— and Synechocystis sp PCC6803-type MPBQ/MSBQ MTs appear
to represent nonorthologous, functionally equivalent activities that have evolved
independently in the two organisms.

To gain insight into the prevalence of Synechocystis sp PCC6803— and VTE3-
type MPBQ/MSBQ MTs in nature and their possible evolutionary origins, we expanded
our database searches beyond vascular plants and oxygenic cyanobacteria. Orthologs of
Synechocystis sp PCC6803 MPBQ/MSBQ MT are present in all oxygenic cyanobacterial
genome databases but absent from databases representing nonoxygenic phototrophs,
nonphotosynthetic eukaryotes, eubacteria, and most photosynthetic eukaryotes, with the

exception of C. reinhardtii and T. pseudonana. The C. reinhardtii and T. pseudonana

233

proteins share 45 and 48% identity, respectively, with Synechocystis sp PCC6803 S110418
(Table A2.3, Figure A26). The full-length C. reinhardtii MPBQ/MSBQ MT coding
region was amplified from a cDNA library, sequenced, and engineered for the expression
and assay of activity in E. coli. As with VTE3 and Synechocystis sp PCC6803
MPBQ/MSBQ MT, the C. reinhardtii cyanobacteria-type enzyme was found to use both

MPBQ and MSBQ (Figure A2.5) as substrates in vitro but not B-T or S—T (results not
shown). The T. pseudonana protein could not be assayed, because cDNA libraries are not

readily available for this organism.

Arabidopsis VTE3 appears to represent a highly conserved gene in vascular plants. The
sequences shown in Table A23 and Figure A2.6 are representative of the numerous
orthologs found in vascular plant databases. Furthermore, VTE3 orthologs also were
identified in EST databases of two nonvascular plants, Physcomitrella patens and
Marchantia polymorpha, and in the genome and EST databases of the green alga C.
reinhardtii, making the latter the only organism that encodes both types of MPBQ/MSBQ
MTs. C. reinhardtii VTE3 is 70% identical to Arabidopsis VTE3 (Table A2.3). Attempts
to engineer C. reinhardtii VTE3 for expression and assay of activity in E. coli have been
unsuccessful to date. Expanding the search for VTE3 homology beyond the plant
kingdom failed to identify VTE3 orthologs in mammalian, fungal, cyanobacterial, or
other eubacterial databases. However, apparent orthologs to Arabidopsis VTE3 were
identified in two archeal species, Archaeoglobus fulgidus and Halobacterium sp NRC-1
(Table A2.3). These two archeal "VTE3-like" proteins are ~40% identical to VTE3

proteins from throughout the plant kingdom (Table A2.3, Figure A2.6). However,

234

although this similarity extends throughout the predicted archeal protein sequences, both
archeal VTE3-like proteins lack an ~60—amino acid C-terminal extension that is highly
conserved in plants and corresponds to the third exon of the Arabidopsis and rice VTE3
genes (Figure A2.6). BLAST searches using the protein sequence encoded by the third
exon of Arabidopsis VTE3 as a query indicated that this protein domain is unique to

eukaryotic VTE3 sequences.

DISCUSSION
In this study, we have reported the identification and characterization of the Arabidopsis
VTE3 locus, which encodes the nonorthologous functional equivalent of Synechocystis sp
PCC6803 MPBQ/MSBQ MT, a key enzymatic activity in the synthesis of tocopherols
and PQ in photosynthetic organisms. Both the Arabidopsis (VTE3-type) and
Synechocystis sp PCC6803 (cyanobacterial-type) MPBQ/MSBQ MT enzymes have
similar in vitro activities toward the tocopherol and PQ biosynthetic intermediates MPBQ
and MSBQ, respectively. Despite the striking similarity in their activities, the
corresponding proteins in the two organisms are highly divergent in primary sequence
and appear to have arisen independently during the evolution of cyanobacteria and plants.
Thus, unlike all other tocopherol pathway enzymes in plants, it was not possible to
identify Arabidopsis MPBQ/MSBQ MT based on similarity with its cyanobacterial
counterpart; instead, a genetic approach was required.

Two Arabidopsis mutants were identified that had phenotypes consistent with a
partial or total disruption of MPBQ/MSBQ MT activity. The ethyl methanesulfonate—

derived vte3-I allele was used to isolate the corresponding VTE3 locus by positional

235

cloning. The recessive vte3-1 mutation substitutes Ile-94 for Thr-94, a residue conserved
in all vascular and nonvascular plant VTE3 orthologs (Figure A26 and data not shown).
vte3-1 preferentially impairs the methylation of tocopherol substrates in planta and has
little effect on the methylation of MSBQ to PQ. Despite the 58% reduction in Ot-T in
vte3-I leaves, no significant impact on plant growth and development was observed.
vte3-2 is a null, T-DNA insertion allele that, when homozygous, completely disrupts both
MPBQ and MSBQ MT activity in vivo; this results in the absence of a-T in leaves and y-
T in seeds and the accumulation of high levels of B-T and S-T in each tissue, respectively.
Unlike vte3-1, vte3-2 seedlings also lack PQ, accumulate the immediate precursor MSBQ,
and are seedling lethal in soil as a result of severe photobleaching. Interestingly, in leaf
tissue, vte3-2 is semidominant for the tocopherol phenotype but recessive for the PQ
phenotype.

The Arabidopsis vte3 mutants do not appear to be the first such mutations
identified in plants. Maize and sunflower mutants have been reported previously that, in
retrospect, are consistent with the disruption of VTE3 activity in these organisms. Two
allelic Mutator transposon-derived, high-chlor0phyll-fluorescence maize mutants have
been reported that were pale green and seedling lethal (Cook and Miles, 1992). These
mutants lacked PQ and OL-T in leaves, accumulated what was presumed to be biosynthetic
precursors, and had a phenotype strikingly similar to Arabidopsis vte3-2. In sunflower,
which predominantly accumulates oc-T in its seeds, an apparently viable mutant (tphI)
was identified that accumulated B-T to as much as 40% of total seed tocopherols

(Demurin et al., 1996). tphI likely contains a mutation in the sunflower VTE3 ortholog

236

that preferentially affects tocopherol methylation in a manner similar to the Arabidopsis
vte3-I allele.

Orthologs with high identity to Arabidopsis VTE3 are present in all plant genome
and EST databases. Most notably, the spinach VTE3 ortholog had been cloned previously
and characterized as an abundant 37-kD chloroplast inner envelope protein (named E37)
of unknown function that contained three S-adenosylmethionine binding motifs (Teyssier
et al., 1996). A substrate for E37 could not be determined, but the protein was
immunologically detectable in both photosynthetic and nonphotosynthetic spinach tissues
and in a number of other plant species (Teyssier et al., 1996). Given the facts that the
inner envelope is the subcellular site of tocopherol biosynthesis in plants (8011 et al., 1980,
1985) and that spinach E37 is 84% identical to Arabidopsis VTE3 (Table A2.3), it now
seems clear that spinach E37 encodes MPBQ/MSBQ MT. The widespread presence of
VTE3 orthologs in plant databases and the isolation of maize and sunflower mutants with
phenotypes similar to specific Arabidopsis vte3 alleles suggest that this reaction in
tocopherol and PQ synthesis is catalyzed by an enzyme that is highly conserved in both

structure and function in dicots and monocots.

New Insights into the Synthesis and Regulation of Tocopherols and PQ

Previous studies have demonstrated that tocopherol biosynthetic enzymes are remarkably
conserved in both primary sequence and activity in cyanobacteria and plants (Norris et al.,
1998; Shintani and DellaPenna, 1998; Collakova and DellaPenna, 2001; Porfirova et al.,
2002; Shintani et al., 2002; Sattler et al., 2003). In this regard, the low sequence identity

of MPBQ/MSBQ MT in Arabidopsis and Synechocystis sp PCC6803 stands in stark

237

contrast to other pathway enzymes and suggests that although similar, fundamental
differences exist in tocopherol and PQ synthesis in cyanobacteria and plants. Several
lines of evidence support this hypothesis. The null vte3-2 mutant lacks a-T and PQ and is
seedling lethal, indicating that VTE3 is essential for the synthesis of both compounds in
Arabidopsis. By contrast, the analogous Synechocystis sp PCC6803 sllO418::aphII
mutant is viable and has only reduced levels of tocopherols and PQ (Table A2.1). This
finding indicates that, unlike Arabidopsis, functional redundancy exists for
MPBQ/MSBQ MT in Synechocystis sp PCC6803 and that this step in tocopherol and PQ
synthesis has diverged significantly in cyanobacteria and plants.

Additional divergence of the two pathways is evident from the phenotypes of
HPPD mutants in cyanobacteria and plants. As with VTE3, a null mutation of
Arabidopsis HPPD disrupts both tocopherol and PQ synthesis and is seedling lethal
(Norris et al., 1998), indicating that the synthesis of both compounds is HGA dependent
in plants (Figure A2. 1). By contrast, a null HPPD mutation in Synechocystis sp PCC6803
results in viable cells that are tocopherol deficient but contain wild-type levels of PQ,
indicating that PQ synthesis is HGA independent in Synechocystis sp PCC6803
(Dahnhardt et al., 2002). These data demonstrate that although the PQ produced in plants
and cyanobacteria is chemically identical, the PQ biosynthetic pathways differ in the two
organisms, at least at the steps of aromatic head group synthesis and ring methylation.
Therefore, the PQ pathway shown in Figure A21 is valid only for photosynthetic
eukaryotes, and PQ biosynthesis in cyanobacteria must be reassessed.

Enzymes of the tocopherol pathway often are grouped into two categories: those

that contribute to tocopherol flux/accumulation (e.g., HPPD and HPT) and those that

238

define the tocopherol composition of a tissue (e.g., y-TMT and TC). Consistent with this
classification scheme, overexpression of HPPD (Tsegaye et al., 2002) or HPT (Savidge et
al., 2002; Collakova and DellaPenna, 2003) increased total seed tocopherol levels by up
to 30 and 75%, respectively, whereas y-TMT overexpression resulted in the conversion of
the large pool of y-T in seeds to OL-T without affecting total seed tocopherol levels
(Shintani and DellaPenna, 1998). From these previous studies, one would predict that
altering VTE3 activity would affect tocopherol composition without positively affecting
total tocopherol flux/accumulation. Therefore, it was quite unexpected to observe, in
addition to altered tocopherol composition, a highly significant (P S 0.01) 31 to 38%
increase in total tocopherol levels in vte3 mutant seeds (Table A2.2). This phenotype
suggests the presence of a previously unknown mechanism regulating tocopherol flux or
accumulation in wild-type seeds that is disrupted by the vte3 mutations.

The nature of this regulatory mechanism is unclear and theoretically could occur
at any time between gene expression and the modulation of enzyme activities in the
pathway, but it likely involves the generation or removal of an effector by the vte3
mutations. Because MPBQ and DMPBQ are undetectable in both the wild type and vte3
mutants, these compounds can be excluded as possible effectors. Likewise, y—T and 0t-T
also can be excluded because altering the seed y—T: Ot-T ratio by 80-fold as a result of y-
TMT overexpression did not affect total seed tocopherol levels (Shintani and DellaPenna,

1998). The most likely candidate effector molecule is 5-T, which is undetectable in wild-

type seeds and increased in vte3 seeds. Whether S-T mediates regulation by affecting the
kinetic properties of other pathway enzymes or serves as a signal that results in the

altered expression of pathway genes remains to be determined. What is clear from the

239

phenotype of seeds containing vte3 mutations is that the tocopherol composition of a
tissue plays a previously unsuspected role in regulating tocopherol flux and/or

accumulation.

The Evolution of VTE3- and Cyanobacteria-Type MPBQ/MSBQ M Ts

The low sequence identity of cyanobacteria- and VTE3-type MPBQ/MSBQ MTs
suggests that the two classes of enzymes are the result of convergent evolution. The
presence of VTE3 orthologs in all angiosperms, in the nonvascular plants P. patens and
M. polymorpha, and in the green alga C. reinhardtii suggests that photosynthetic
eukaryotes acquired the VTE3-type enzyme before the divergence of green algae and
plants some 800 million years ago (O'Kelly, 1992; Lemieux et al., 2000). The absence of
VTE3 orthologs from eubacteria (including cyanobacteria) and the presence of VTE3-
like orthologs in two archeal species suggest that VTE3 was present in a common
ancestor of archea and plants but subsequently was lost from most archeal lineages.
Cyanobacteria-type MPBQ/MSBQ MT orthologs are present in all cyanobacterial
genomes and in the genomes of two unicellular photosynthetic eukaryotes, C. reinhardtii
and the diatom T. pseudonana. C. reinhardtii is unique in being the only organism
currently known to encode both cyanobacteria- and VTE3-type MPBQ/MSBQ MTs,
suggesting that the common ancestor of green algae and plants had both types of enzymes
and that plants subsequently lost the cyanobacteria-type enzyme early in their evolution.
T. pseudonana also is unique in being the only photosynthetic eukaryote known that does
not encode a VTE3-type enzyme in its genome. Whether the common ancestor of plants,

green algae, and diatoms contained both types of enzymes and VTE3 was lost in the

240

diatom lineage will require the sequencing of additional genomes representing early
branches of photosynthetic eukaryote evolution.

In summary, we have isolated and characterized an Arabidopsis MPBQ/MSBQ
MT that is the nonorthologous functional equivalent of its cyanobacterial counterpart.
The Arabidopsis VTE3 gene encodes a protein and activity in tocopherol and PQ
biosynthesis that are highly conserved in photosynthetic eukaryotes. An intriguing
question remains regarding when and how this plant enzyme evolved from archea, the
third domain of life, whereas all other steps of the plant tocopherol biosynthetic pathway
appear to have originated from an endosymbiotic event with a cyanobacterium.
Understanding the origin of VTE3 during the evolution of plants will provide new insight
into the transfer of genetic information among the three domains of life during the

emergence and evolution of the fundamental biological process of photosynthesis.

METHODS

Plant Materials and Growth Conditions

Ethyl methanesulfonate—mutagenized Arabidopsis thaliana seeds were obtained from
Lehle Seeds (Round Rock, TX). The vte3-2 T-DNA insertional line was identified by
searching the SIGNAL database World Wide Web site (http://signal.salk.edu/cgi-
bin/tdnaexpress) at the Salk Institute for Biological Studies (La Jolla, CA). Seeds
containing the vte3-2 mutation were obtained from the ABRC at Ohio State University
(http://www.biosci.ohio-state.edu/plantbio/Facilities/abrc/abrchome.htm). Soil-grown

plants were kept at 22°C under a 16-h photoperiod. Tissue culture—grown seedlings were

241

grown at 22/19°C (day/night) with a 12-h photoperiod on 1x Murashige and Skoog

(1962) salts (Gibco BRL), pH 5.7, with 1% (w/v) sucrose and 1% (w/v) phytagar.

Identification and Map-Based Cloning of vte3-1

Ethyl methanesulfonate—mutagenized M2 seeds were grown in soil in a 96-well format
for 3 to 4 weeks. Total lipids were extracted from leaf tissues according to Collakova and
DellaPenna (2001) and subjected to HPLC (1100 series; Agilent, Wilmington, DE) on a
Spherisorb ODS-2 5-um, 250- x 4.6-mm reverse-phase column (Column Engineering,
Ontario, CA) using the solvent system described by Sattler et al. (2003). The original
vte3-1 mutant line was backcrossed to wild-type Columbia two times. For mapping
purposes, vte3-I (in the Columbia background) was crossed to wild-type Landsberg
erecta, and the resulting F2 population was screened using reverse-phase HPLC for the
vte3-I phenotype. Simple sequence length polymorphism markers for BAC clones
T15C9 and T17] 13 were described by Bell and Ecker (1994). DNA was isolated using

Plant DNAZOL (Invitrogen, Carlsbad, CA) and used in a 20-aL PCR.

Analysis of Prenquuinones

Quantitative analyses of tocopherols and plastoquinone (PQ) were performed using
normal-phase HPLC. Total lipids were extracted from 65 to 75 mg of tissue culture—
grown plants or from 20 mg of dry seeds according to Collakova and DellaPenna (2001).
Total lipids were separated on a ReliaSil silica 250- x 4.6-mm normal-phase column
(Column Engineering) at 30°C with 1 mL/min hexane and dioxane using the following

gradient program: 0 to 15 min, 0.2 to 2% dioxane; 15 to 25 min, 2 to 4% dioxane; 25 to

242

35 min, dioxane held at 4%; 35 to 40 min, 4 to 0.2% dioxane; and 40 to 60 min, dioxane
held at 0.2%. Absorption spectra (190 to 800 nm) and fluorescence signals (excitation at
290 nm, emission at 330 nm) were collected. PQ and tocopherol standard curves were

prepared using the same method.

Expression and Assay of 2-Methyl-6-Phytyl-1,4-Benzoquinone/ 2-Methyl-6-Solanyl-
1,4-Benzoquinone Methyltransferase in Escherichia coli

Synechocystis sp PCC6803 2-methyl-6-phytyl-1,4-benzoquinone/Z-methyl—6-solanyl-1,4-
benzoquinone methyltransferase (MPBQ/MSBQ MT) was engineered and expressed in E.
coli as described by Shintani et a1. (2002). Arabidopsis VTE3 was amplified by PCR from
an Arabidopsis leaf cDNA library using Pwo DNA polymerase (Roche Applied Science,
Indianapolis, IN), a forward primer engineered with an Ndel site (underlined) to generate
an in-frame ATG (5'-CGGCATATGGCCTCTITGATGCTCAAC-3'), and a reverse
primer (5'-CGGTCAGATGGGTTGGTC’I'I‘TGGG—3'). Chlamydomonas reinhardtii
MPBQ/MSBQ MT (Synechocystis type) was amplified from a C. reinhardtii cDNA
library (Davies et al., 1996) using Pwo DNA polymerase, a forward primer engineered
with an Ndel site (underlined) to generate an in-frame ATG (5'-
CATATGCTTGGGCAATCCCTGC-3'), and a reverse primer (5'-
GCACCCGCTCCTTAC'I'I‘CA-3'). The amplified fragments were ligated to the EcoRV
site of pBluescript KS(+) (Stratagene). Inserts were excised with Ndel and BamHI,
inserted into the pET30A expression vector digested previously with the same enzymes

(Novagen, Madison, WI), and transformed into BL21DE3 (Novagen).

243

Growth, induction, cell harvesting, and extraction of engineered proteins in E. coli
were performed as described by Shintani et al. (2002). Cells carrying an empty pET30A
vector also were induced as a negative control. To determine the optimal conditions for
the solubilization and activity of each enzyme, each induced protein was solubilized in 50
mM Tris-Cl, pH 8.0, 5 mM DTT, and 1 mM phenylmethylsulfonyl fluoride containing
1% (v/v) of one of the following detergents: Triton X—100, Tween 20, 3-[(3-
cholamidopropyl)dimethylammonio]-1-propanesulfonic acid (CHAPS), and B-D-dodecyl
maltoside. After centrifugation at 12,000 rpm, the supernatant was collected, the protein
concentration was measured with the Coomassie Protein Assay Reagent (Pierce,
Rockford, IL), and aliquots were stored at -80°C until assay.

Enzyme assays were performed as described by Peddibhotla et al. (2002), except
that the incubation time for Arabidopsis VTE3 was extended to 6 to 12 h. Enzymes were
assayed at detergent concentrations ranging from 0.01 to 0.1% (v/v) final concentration,
and the optimal type and concentration of detergent for each solubilized protein were
detemiined by comparing the yield of the radiolabeled products. The optimal detergents
and final concentrations for the assays of Synechocystis sp PCC6803 MPBQ/MSBQ MT,
its ortholog from C. reinhardtii, and Arabidopsis VTE3 were 0.1% (v/v) Tween 20, 0.1%
(v/v) B-D-dodecyl maltoside. and 0.1% (v/v) CHAPS, respectively. Chemical synthesis
and purification of 2—methyl-6-phytylbenzoquinone substrate were as reported by
Peddibhotla et al. (2002). 2-Methyl-6-solanylbenzoquinone substrate was extracted and

purified from iris bulbs as described by Henry et al. (1987).

244

Phylogenetic Analysis

Sequence alignments were performed with CLUSTAL W (MacVector; Genetics
Computer Group, Madison, WI) using the BLOSUM 30 protein matrix (for Figure A22),
the identity protein matrix (for Figure A26), and default parameters for gap penalties.
The phylogenetic tree was generated using the neighbor-joining method. Ties in the tree
are treated randomly, with distances uncorrected and gaps distributed proportionally.

Bootstrap measurements were conducted with 1000 iterations.

Accession Numbers

Unless indicated otherwise, all gene accession numbers are from National Center for
Biotechnology Information. Rat Gly N-MT, 800112; C. reinhardtii VTE3, AY333781;
rice VTE3 (TIGR), TC105417; spinach VTE3, X56963; Halobacterium sp NRC-l
VTE3-like protein, NP_280804; A. fulgidus VTE3-like protein, NP_069348; yeast ERG6,
CAA89944; maize C-24 sterol methyltransferase, AAB70886; Arabidopsis y-TMT
(MIPS; www.mips.biochem.mpg.de), NM_105171; Arabidopsis SMTl, NM_121374;
Synechocystis sp PCC6803 y-TMT, ORF Slr0089 (Cyanobase;
www.kazusa.or.jp/cyano/cyano.html), BAA10562; Nostoc punctiforme y-TMT,
ZP_00110362; C. reinhardtii cyanobacteria-type MPBQ/MSBQ MT, AY293576;
Synechocystis sp PCC6803 MPBQ/MSBQ MT, ORF 8110418 (Cyanobase), BAA18485;
T. elongatus, BAC09278; Nostoc sp PCC7120 cyanobacterial MPBQ/MSBQ MT (Joint
Genomic Institute [JGI]; http://genome.jgi-
psf.org/draft_microbes/nospu/nospu.home.html), contig651; Trichodesmium erythraem,

ZP_00074879; P. marinas MED4, ZP_00105453; Synechococcus sp WH8102,

245

ZP_00116290; P. marinas strain MIT9313, ZP_00114022; alfalfa COMT, lFPQA; and T.
pseudonana cyanobacteria-type MPBQ/MSBQ MT, assembled from JGI diatom raw
genome data (httpzllgenomejgi-psf.org/thapsO/thapsOhome.html) using the following
sequences: PQI43478.x1, TEU52932.y1, SXZZ8761.x1, TEU29767.x1, PQI75058.y1,
PQIl34681.x1, TEU44005.y1, PQJ3077.x2, PQ120677.xl, PQ1107604.yl,
PQ1127568.y1, PQI22068.y1, and PQIll7660.yl. The coding region of the T.
pseudonana consensus sequence was predicted by GENSCAN

(httpzl/genes.mit.edu/GENSCAN.html).

246

REFERENCES

Arango, Y., and Heise, K.P. (1998). Tocopherol synthesis from homogentisate in
Capsicum annuum L. (yellow pepper) chromoplast membranes: Evidence for
tocopherol cyclase. Biochem. J. 336, 531-533.

Azzi, A., Boscoboinik, D., Marilley, D., Ozer, N.K., Stauble, B., and Tasinato, A.
(1995). Vitamin E: A sensor and an information transducer of the cell oxidation state.
Am. J. Clin. Nutr. 62, 13378-13468.

Behl, C., and Moosmann, B. (2002). Oxidative nerve cell death in Alzheimer's disease
and stroke: Antioxidants as neuroprotective compounds. Biol. Chem. 383, 521—536.

Bell, C.J., and Ecker, JR. (1994). Assignment of 30 microsatellite loci to the linkage
map of Arabidopsis. Genomics 19, 137-144.

Brigelius-Flohe, R., Kelly, F.J., Salonen, J.T., Neuzil, J., Zingg, J.M., and Azzi, A.
(2002). The European perspective on vitamin E: Current knowledge and future
research. Am. J. Clin. Nutr. 76, 703-716.

Brigelius-Flohe, R., and Traber, M.G. (1999). Vitamin E: Function and metabolism.
FASEB J. 13, 1145-1155.

Collakova, E., and DellaPenna, D. (2001). Isolation and functional analysis of
homogentisate phytyltransferase from Synechocystis sp. PCC 6803 and Arabidopsis.
Plant Physiol. 127, 1113—1124.

Collakova, E., and DellaPenna, D. (2003). Homogentisate phytyltransferase activity is
limiting for tocopherol biosynthesis in Arabidopsis. Plant Physiol. 131, 632-642.

Cook, W., and Miles, D. (1992). Nuclear mutations affecting plastoquinone
accumulation in maize. Photosynth. Res. 31, 99-1 1 1.

Dahnhardt, D., Falk, J., Appel, J., van der Kooij, T.A., Schulz-Friedrich, R., and
Krupinska, K. (2002). The hydroxyphenylpyruvate dioxygenase from
Synechocystis sp. PCC 6803 is not required for plastoquinone biosynthesis. FEBS
Lett. 523, 177-181.

Davies, J.D., Yildiz, RH, and Grossman, A. (1996). Sac], a putative regulator that is

critical for survival of Chlamydomonas reinhardtii during sulfur deprivation. EMBO
J. 15, 2150-2159.

Demurin, Y., Skoric, D., and Karlovic, D. (1996). Genetic variability of tocopherol
composition in sunflower seeds as a basis of breeding for improved oil quality. Plant
Breed. 115, 33-36.

247

d'Harlingue, A., and Camara, B. (1985). Plastid enzymes of terpenoid biosynthesis:
Purification and characterization of y-tocopherol methyltransferase from Capsicum
chromoplasts. J. Biol. Chem. 260, 15200- 15203.

Diener, A.C., Li, H., Zhou, W., Whoriskey, W.J., Nes, W.D., and Fink, GR. (2000).
Sterol methyltransferase 1 controls the level of cholesterol in plants. Plant Cell 12,
853-870.

Grasses, T., Grimm, B., Koroleva, 0., and Jahns, P. (2001). Loss of u-tocopherol in
tobacco plants with decreased geranylgeranyl reductase activity does not modify
photosynthesis in optimal growth conditions but increases sensitivity to high-light
stress. Planta 213, 620-628.

Grau, A., and Ortiz, A. (1998). Dissimilar protection of tocopherol isomers against
membrane hydrolysis by phospholipase A2. Chem. Physiol. Lipids 91, 109-118.
Hanck, A. (1985). The biochemical and physiological role of vitamins A and E and their

interactions. Acta Vitaminol. Enzymol. 7, 5-11.

Henry, A., Powls, R., and Pennock, J.F. (1987). Intermediates of tocopherol
biosynthesis in the unicellular alga Scenedesmus obliquus: The presence of three
isomeric methylphytylbenzoquinones. Biochem. J. 242, 367-373.

Jialal, I., Devaraj, S., and Kaul, N. (2001). The effect of tt-tocopherol on monocyte
proatherogenic activity. J. Nutr. 131, 3898-394S.

Jialal, I., and Fuller, C.J. (1993). Oxidized LDL and antioxidants. Clin. Cardiol. 16, 16-
I9.

Joshi, C., and Chiang, V. (1998). Conserved sequence motifs in plant S-adenosyl-L-
methionine-dependent methyltransferases. Plant Mol. Biol. 37, 663-674.

Kagan, R., and Clarke, S. (1994). Widespread occurrence of three sequence motifs in
diverse S-adenosylmethionine-dependent methyltransferases suggests a common
structure for these enzymes. Arch. Biochem. Biophys. 310, 417-427.

Lemieux, C., Otis, C., and Turmel, M. (2000). Ancestral chloroplast genome in
Mesostigma viride reveals an early branch of green plant evolution. Nature 403, 649-
652.

Lichtenthaler, H.K., Prenzel, U., Douce, R., and Joyard, J. (1981). Localization of
prenquuinones in the envelope of spinach chloroplasts. Biochim. Biophys. Acta 641,
99-105.

Marshall, P.S., Morris, S.R., and Threlfall, DR. (1985). Biosynthesis of tocopherols:

A re-examination of the biosynthesis and metabolism of 2-methyl-6-phytyl-l,4-
benzoquinol. Phytochemistry 24, 1705-1711.

248

Motohashi, R., Ito, T., Kobayashi, M., Taji, T., Nagata, N., Asami, T., Yoshida, S.,
Yamaguchi-Shinozaki, K., and Shinozaki, K. (2003). Functional analysis of the
37kDa inner envelope membrane polypeptide in chloroplast biogenesis using a Ds-
tagged Arabidopsis pale-green mutant. Plant J. 34, 719-731.

Murashige, T., and Skoog, F. (1962). A revised medium for rapid growth and bioassays
with tobacco tissue culture. Physiol. Plant. 15, 473-497.

Noctor, G., and Foyer, C. (1998). Ascorbate and glutathione: Keeping active oxygen
under control. Annu. Rev. Plant Physiol. Plant Mol. Biol. 49, 249-279.

Norris, S.R., Barrette, T.R., and DellaPenna, D. (1995). Genetic dissection of
carotenoid synthesis in Arabidopsis defines plastoquinone as an essential component
of phytoene desaturation. Plant Cell 7, 2139-2149.

Norris, S.R., Shen, X., and DellaPenna, D. (1998). Complementation of the
Arabidopsis pdsl mutation with the gene encoding p-hydroxyphenylpyruvate
dioxygenase. Plant Physiol. 117, 1317-1323.

O'Kelly, C.J. (1992). Flagellar apparatus architecture and the phylogeny of "green"
algae: Chlorophytes, euglenoids, glaucophytes. In The Cytoskeleton of the Algae, D.
Menzel, ed (Boca Raton, FL: CRC Publishers), pp. 315-345.

Peddibhotla, S., Cheng, Z., DellaPenna, D., and Tepe, JJ. (2002). Efficient two-step
synthesis of methylphytylbenzoquinones: Precursor intermediates in the biosynthesis
of vitamin E. Tetrahedron Lett. 44, 237-239.

Porfirova, S., Bergmuller, E., Tropf, S., Lemke, R., and Dormann, P. (2002).
Isolation of an Arabidopsis mutant lacking vitamin E and identification of a cyclase
essential for all tocopherol biosynthesis. Proc. Natl. Acad. Sci. USA 99, 12495-
12500.

Ranocha, P., Bourgis, F., Ziemak, M.J., Rhodes, D., Gage, D.A., and Hanson, AD.
(2000). Characterization and functional expression of cDNAs encoding methionine-
sensitive and -insensitive homocysteine S-methyltransferases from Arabidopsis. J.
Biol. Chem. 275, 15962-15968.

Reverberi, M., Picardo, M., Ricelli, A., Camera, E., F anelli, C., and Fabbri, A.A.
(2001). Oxidative stress, growth factor production and budding in potato tubers
during cold storage. Free Radical Res. 35, 833-841.

Ricciarelli, R., Zingg, J.M., and Azzi, A. (2002). The 80th anniversary of vitamin E:
Beyond its antioxidant properties. Biol. Chem. 383, 457-465.

249

Sattler, S.E., Cahoon, E.B., Coughlan, S.J., and DellaPenna, D. (2003).
Characterization of tocopherol cyclases from higher plants and cyanobacteria:

Evolutionary implications for tocopherol synthesis and function. Plant Physiol. 132,
2184-2195.

Savidge, B., Weiss, J.D., Wong, Y.H., Lassner, M.W., Mitsky, T.A., Shewmaker,
C.K., Post-Beittenmiller, D., and Valentin, HE. (2002). Isolation and
characterization of homogentisate phytyltransferase genes from Synechocystis sp.
PCC 6803 and Arabidopsis. Plant Physiol. 129, 321-332.

Schledz, M., Seidler, A., Beyer, P., and Neuhaus, G. (2001). A novel phytyltransferase
from Synechocystis sp. PCC 6803 involved in tocopherol biosynthesis. FEBS Lett.
499, 15—20.

Shintani, D., and DellaPenna, D. (1998). Elevating the vitamin E content of plants
through metabolic engineering. Science 282, 2098-2100.

Shintani, D.K., Cheng, Z., and DellaPenna, D. (2002). The role of 2-methy1-6-
phytylbenzoquinone methyltransferase in determining tocopherol composition in
Synechocystis sp. PCC6803. FEBS Lett. 511, 1-5.

$011, J., Kemmerling, M., and Schultz, G. (1980). Tocopherol and plastoquinone
synthesis in spinach chloroplast subfractions. Arch. Biochem. Biophys. 204, 544-550.

8011, J., Schultz, G., Joyard, J., Douce, R., and Block, M. (1985). Localization and
synthesis of prenquuinones in isolated outer and inner envelope membranes from
spinach chloroplasts. Arch. Biochem. Biophys. 238, 290-299.

Srivastava, S., Phadke, R.S., and Govil, G. (1989). Effect of incorporation of drugs,
vitamins and peptides on the structure and dynamics of lipid assemblies. Mol. Cell.
Biochem. 91, 99-109.

Tappel, A.L. (1962). Vitamin E as the biological lipid antioxidant. Vitam. Horm. 20,
493-510.

Teyssier, E., Block, M.A., Douce, R., and Joyard, J. (1996). Is E37, a major
polypeptide of the inner membrane from plastid envelope, an S-adenosyl
methionine-dependent methyltransferase? Plant J. 10, 903-912.

Tsegaye, Y., Shintani, D., and DellaPenna, D. (2002). Over-expression of the enzyme
p-hydroxyphenolpyruvate dioxygenase in Arabidopsis and its relation to tocopherol
biosynthesis. Plant Physiol. Biochem. 40, 913-920.

Valk, E.E., and Hornstra, G. (2000). Relationship between vitamin E requirement and
polyunsaturated fatty acid intake in man: A review. Int. J. Vitam. Nutr. Res. 70, 31-
42.

250

FIGURES

Table A2.]. Analysis of Prenyllipids 1n Wild-Type and vte3 Arabidopsis Leaf Tissue and

Synechocystis Cell Culture.

 

.T..E.Tofloo._och no 880..on 2e mcmxoocooexw .2 82¢) .38 .92 05 c. 68389
.3365 co co 89828 2: Soups 8858.8 5 eoessz .oxoeocoo :3 w a 03:8 .23 63 w a case E 385:. so 2228 3:88
to. 2 028.2 woococotfi E03203 2.8.6:an can .poFcotoa no? 68 a 55qu .2390; 50: 95.9.8 c: ow H momzaca 2832030 co can
L26 05 8 008298 2a 82.3 .8522» 9 3:22 305E860 2c; 0a 9.3 299382 3:929... .0 m255§0 05 can 6.5.... 32935.6: .3
3230.. So? 85:20 =00 ongoocoocxm 82950. no 353. 2302993 c5363 2048?? 3 £536» x0027m 80.: 38228 mp6: .80...

 

 

33 33c 33 389
o .wd H o; :o H No .Ld H R :Qm H Emu .F H o: 23?
38v 3&9 39.: 3.39
o m... H Qm o o H 98 as H 08 cm H mmw 233m.
35305005...”
38V 33 see same
o v.0 H m; :vd H «N Wm H mém o H Qmw .o.m H 53. Néotxwém...)
38: $3 38$ same
:06 H mm .md H 5 :fio H od :3 H Em .m.« H méw .Nm H Qmm Twas: two:
38V 33 32» same
o md H a; no H md Nu H tam «em H 95 md H Que $33M;
$505 :3 $300392
Laws 33 3.03 §9
:N H mm ta ta H 9 :o :m H we to NéoENtmok
3&8 308 333 A808
:m H R .L H m :w H E ..m H 9. :m H «9 .m H at 793:?
3%: $9 3% 389
o FHm _.Hm vam 0H3. 3 H05 mm§xmm§
c266 063 $8028?
6638.3 623.39 6.5233 683683 6.86:3 663653 295»
_ocozaooohé .9388?» _oconaoghtu _ococaooohé 6.9380... .30... 2.053935

 

251

Table A2.2. Analysis of Seed Tocopherols in the Wild Type and vte3 Mutants.

 

.38 .82 05 E 290389 3303.2. .0 83:029. 05 98
.65 03058.8 c. 23.52 22.28 :8... w a. canon .93 .8... m a. 0.9.... .3 8.8.2. so 8058...“. .833.» 2.8.5.8.» .93 .928 m...
2 9.6.0. Doctoroa 83 $0: $5va .9563 EU 9.50:5 c: ow H 82:93 2832830 .0 09:03 05 8 0082on 20 82a> $9628»
2 2.5.2 E.E.osn 2o; 222a8o. 3222.8. .0 8.583 o... .23 6...: 08:9.an: .3 02.82 22s 38» an 22. 8.085 8.2. .88

 

 

3..va 38m. 33.

:3 H wt. .c H «8 .v H 9 .mm H ow: Néc§\w.mm§
33m. 3%... .93:

:n H vac :v H 5m 2; H 9. :9. H om: 7m032$o§
3mm. .88. $9

m H 5 3 H was r H mm 3. H «mm «WEEKS

_o.ocaooo.7w _o5zaooo..-r 6.288%: 3.0.3000... .90.. 259.00

 

252

Table A2.3. Pair-Wise Comparison of Cyanobacteria- and VTE3-Type MPBQ/MSBQ MTs.

 

 

 

Qanobacteria Type VTE3 Type
Species S.sp C.r. (I) T.p. H.sp A.fu. C.r.(ll) 8.0. 0.5.
A.t. 18/27 18/28 18/28 39/55 40/56 70/79 85/93 81/89
0.5. 17/27 17/29 18/28 40/56 43/60 65/75 74/83
8.0. 18/27 16/28 17/28 41/56 41/58 62/71
C.r. (ll) 16/31 16/28 16/27 42/58 40/60
A.tu. 19/33 21/43 21/36 42/59
H.sp. 20/31 22/36 20/33
T.p. 48/66 54/67
C.r. (I) 45/62

 

Pair-wise comparisons of predicted mature proteins (as predicted by
PSORT) were performed using CLUSTAL W. Values indicate the per-
centage identity/similarity in the shorter sequence of each pair. A.tu., A.
fulgidus VTE3-like protein; A.t., Arabidopsis VTE3; C.r. (I), C. reinhardtii
cyanobacteria-type ortholog; C.r. (II), C. reinhardtii VTE3-type ortholog:
H.sp, Halobacten‘um sp NRC-1 VTE3-like protein; 0.5., Oryza sativa
VTE3; S.o., Spinacia oleracea VTE3; S.sp, Synechocystis sp P006803;
T.p., T. pseudonana SII0418.

 

253

HPP

<§

OH

“OOCHzc Salami-DP

HGA
CO: + PPI 00, + PPI
H H0 H
570;“) 3
OH OH OH
MPBQ DMPBQ ”$30

$3 sm
2”“ if“ 13:

O O

B-tocophorol can-tocopherol

Figure A2.]. The Tocopherol Biosynthetic Pathway in Plants and Cyanobacteria and the PQ
Biosynthetic Pathway in Plants.

Boldface arrows represent the steps leading to a-tocopherol, the most abundant tocopherol
produced in wild-type Arabidopsis leaves and Synechocystis sp PCC6803. DMPBQ,

2,3 -dimethyl-5 -phytyl-1 ,4-benzoquinone; HGA, homogentisic acid; HPP,
p-hydroxyphenylpyruvate; MPBQ, 2-methy1-6-phyty1-1,4-benzoquinone; MSBQ,
2-methyl-6-solanyl-l,4-benzoquinone; phytyl-DP, phytyldiphosphate; SAM,

S-adenosylmethionine; solanyl-DP, solanyldiphosphate. Enzymes are indicated by circled
numbers: 1, HPP dioxygenase (HPPD); 2, homogentisate phytyltransferase (HPT); 3,
homogentisate solanyltransferase (HST); 4, MPBQ/MSBQ methyltransferase; 5, tocopherol
cyclase (TC); and 6, y-tocopherol methyltransferase (y-TMT).

254

0.213

 

0.213

rat glyclne N-MT

0.103

0.09

 

 

 

 

02“ C. reinhardtii

0‘53 O. sativa

 

0.061

 

 

 

—i:‘f‘:"’°°’“°
0.039 0429 S. oleracea

 

 

 

 

 

 

 

 

 

 

 

 

 
 

 

 

 

02" H. sp. NRC-1 “VTE3“
4 “92 A. fulgidus “was"
0.151 0253 S. c. ERGG
0.141 x—Qi—W— Arabidopsis sum
L—MS— 1 may: c-24 SM‘I'
L 0.08 0.276 Arabidopsis
00,, I °"5 3. sp. P606803
°‘15 N. punctifonne
T. elongatus BP-1
0.077“ 3. sp. Pccssoa
9,082 N. sp. PCC7120
T. erythmem
022’ P. m. MED4

 

 

Lmq—M’ 5. sp. WH8102
°°“" P. m. MIT9313

0.305

 

 

 

 

 

0.1
+——+

 

 

 

 

 

 

 

 

 

 

 

 

 

_{ C. reinhardtii

0.342 T. pseudonana
“53 At5953920

“‘5 M. sum
0.451 At3920650
{ 0.451 Al3956330
~ “5 At5917660
0.451 At3905100

‘l “‘2 N1901860

“35 At3913180

“37 N5949020
“‘7 Angzsaeo

 

y-TMT SMT VTE3

Synechocystis -type
MPBQ/MSBQ MT

O-MT/ unknown

Figure A2.2. Phylogeny of Selected Methyltransferases from Photosynthetic Organisms.

Rat Gly N-methyltransferase (N-MT) is included as an outgroup. Boldface lettering indicates that
the activity of the encoded protein has been demonstrated biochemically. Known or predicted
functions for individual clades are indicated at right. A. fidgidus, Archaeoglobus fidgidus;
At3g63410, Arabidopsis VTE3; H. sp NRC-l, Halobacterium sp NRC-l; M. sativa, alfalfa
chalcone O-methyltransferase (O-MT); N. sp PCC7120, Nostoc sp. PCC7120; P. m. MED4,
Prochlorococcus marinas MED4; P. m. MIT9313, Prochlorococcus marinas MIT9313; S. C.,
Saccharomyces cerevisiae; SMT, sterol methyltransferase; S. sp PCC6803, Synechocystis sp
PCC6803; S. sp WH8102, Synechococcus sp WH8102; 7? elongatus BP-l, T hermosynechococcus
elongatus BP—l; T erythraem, Trichodesmium erythraem IMS 101; y-TMT, y-tocopherol
methyltransferase; VTE3, plant-type MPBQ/MSBQ MT. All Arabidopsis gene numbers follow

the standard genomic nomenclature: At#g#####.

255

 

200 kb
Chr 3 76¢" — TGII
l ,
l 1 I
T1 509 T1 7J1 3 I
ROCOITIbIMI‘Ib 13l72 2’72 mom1o
(VTE3)

vte3-1 ace —> ATG
Thr“ —> ll.M

 

Figure A2.3. Positional Cloning of VTE3 and Phenotypes of the vte3 Mutants.

(A) Diagram of chromosome 111 from ~76 centimorgan (cM) to the telomere (TEL). The number
of recombination events is indicated under the markers on BACs T15C9 and T17] 13. The VTE3
locus was delineated further as At3g63410, as described in the text.

(B) Diagram of the VTE3 genomic clone and the vte3-I and vte3-2 mutations. Black bars
represent exons. Thin lines represent untranslated regions and introns. The conversion of Thr-94
to Ile-94 in vte3-I is indicated.

(C) Whole-plant phenotypes of plate-grown wild-type and homozygous vte3-I and vte3-2 mutant
plants. Col, Columbia wild type. Bars = 2 mm.

256

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

CD 200
—— Col PQ
--- vte3-1
150* ......... "03.2
E
C
fi :
€100“ :
3 .
E i
.'
5‘“ : ®
a .' MSBQ
i I [Lg ‘ k
A I -: | :fi
04-—--—¢I ------- I, §--":‘~‘.{- —————————————— 4":u—cn—u’! -------
l l l j T l l l
10 11 12 13 14 15 15

Figure A2.4. HPLC Analysis of PQ and Its Precursor MSBQ in Leaves of the Wild Type and

Homozygous vte3-1 and vte3-2 Mutants.
Total lipids extracted from leaves of plate-grown wild-type and vte3 mutant plants were subjected

to normal-phase HPLC analysis. The inset shows spectra of the three indicated compounds in the
wild type and vte3-2. Peak 1, plastoquinone-9 (PQ); peak 2, unknown peak at 12.10 min; peak 3,

MSBQ.

257

PO —>
DMPBQ —> .

 

Synechocystis C. reinhardtii Arabidopsis Vector

Figure A2.5. Substrate Specificity Assays of Synechocystis sp PCC6803 MPBQ/MSBQ MT,
the Cyanobacteria-Type C. reinhardtii Enzyme, and Arabidopsis VTE3.

The three proteins and an empty vector control were expressed 1n E. coli, solubilized 1n Tween 20,
B- D- -dodecy1-maltoside, 3- -[(3-cholamidopropyl)dimethylammonio]- l-propanesulfonic acid, and
Triton X- 100, respectively, and assayed for activity with MPBQ (lanes 1, 3, 5, and 7) or MSBQ
(lanes 2, 4, 6, and 8) as substrates 1n the presence of ”C. met!“ _,'1 S "1-....- J ' Reaction
products were extracted and separated by thin layer chromatography. Radiolabeled products were
detected by phosphorimaging. Reaction products are indicated by arrows.

258

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

éatéé-z-s-tt
IIOI‘DOO‘.

aggséaaéé aaéaaaaéé
"' fidiéiédii
Figure A2.6. Alignment of Cyanobacteria- and VTE3-Type MPBQ/MSBQ MTs.

roniuéodl

éiiééééii
pond-coa-

259

Figure A2.6. (continued)

The transit peptide or signal sequence (as appropriate) was predicted by PSORT for each protein
and removed before alignment using CLUSTAL W. The locations of three S-adenosylmethionine
(SAM I to SAM III) binding domains are indicated by solid bars below the alignment. The
asterisk above the alignment indicates the position of Thr-94 in Arabidopsis VTE3, which is
mutated to Ile-94 in vte3-1. Dashed lines indicate gaps in the alignment. Arrowheads indicate the
positions of conserved intronzexon junctions in the Arabidopsis and rice VTE3 genes. Background
highlighting is as follows: black, identical in at least seven sequences; red, identical in both
archeal VTE3-like proteins and, where indicated, also in other sequences; blue, identical in all
cyanobacteria-type MPBQ/MSBQ MT sequences and, where indicated, also in other sequences;
yellow, identical in cyanobacteria-type and archeal VTE3-like enzymes only. Red lettering
indicates residues identical in at least three eukaryotic VTE3-type MPBQ/MSBQ MT orthologs
and, where indicated, also in other sequences. A.fi.l. "VTE3," A. fiilgidus VTE3-like protein; A.t.
VTE3, Arabidopsis VTE3; C.r. "$110418," C. reinhardtii ortholog of Synechocystis sp PCC6803
$110418; C.r. VTE3, C. reinhardtii VTE3; H.sp. "VTE3," Halobacterium sp NRC-1 VTE3-like
protein; 0.5. VTE3, Oryza sativa VTE3; S.o. VTE3, Spinacia oleracea VTE3; S.sp. $110418,
Synechocystis sp PCC6803 MPBQ/MSBQ MT; T.p. "$110418," Ihalassiosira pseudonana
ortholog of Synechocystis sp PCC6803 8110418.

260

A-3: Characterization of Glucose-Sensitive Phenotype of Tocopherol Mutants in

Synechocystis.

The work presented in this section has been published:

Sakuragi, Y., Maeda, H., DellaPenna, D. and Bryant, D.A. (2006) a-Tocopherol Plays
a Role in Photosynthesis and Macronutrient Homeostasis of the Cyanobacterium

Synechocystis sp. PCC 6803 That is Independent of its Antioxidant Function. Plant

Physiology, 141, 508-521.

Author’s contributions:

Hiroshi Maeda conducted quantitation of tocopherols and helped with manuscript
revision. Yumiko Sakuragi conducted the rest of the research and wrote the manuscript.
Dean DellaPenna was involved in project development and helped with manuscript

revision. Donald A. Bryant supervised the entire project and edited the final manuscript.

261

ABSTRACT

a-Tocopherol is synthesized exclusively in oxygenic phototrophs and is known to
function as a lipid-soluble antioxidant. Here, we report that a-tocopherol also has a novel
function independent of its antioxidant properties in the cyanobacterium Synechocystis sp.
PCC 6803. The photoautotrophic growth rates of wild type and mutants impaired in u-
tocopherol biosynthesis are identical, but the mutants exhibit elevated photosynthetic
activities and glycogen levels. When grown photomixotrophically with glucose (Glc),
however, these mutants cease growth within 24 h and exhibit a global macronutrient
starvation response associated with nitrogen, sulfur, and carbon, as shown by decreased
phycobiliprotein content (35% of the wild-type level) and accumulation of the anAI-
nblAZ, spr, sigB, sigE, and sigH transcripts. Photosystem II activity and carboxysome
synthesis are lost in the tocopherol mutants within 24 h of photomixotrophic growth, and
the abundance of carboxysome gene (rbcL, cchI, ccmL) and nth4 transcripts
decreases to undetectable levels. These results suggest that a-tocopherol plays an
important role in optimizing photosynthetic activity and macronutrient homeostasis in
Synechocystis sp. PCC 6803. Several lines of evidence indicate that increased oxidative
stress in the tocopherol mutants is unlikely to be the underlying cause of photosystem II
inactivation and Glc-induced lethality. Interestingly, insertional inactivation of the pmgA
gene, which encodes a putative serine-threonine kinase similar to Ris and Rst in
Bacillus subtilis, results in a similar increase in glycogen and Glc-induced lethality.
Based on these results, we propose that u-tocopherol plays a nonantioxidant regulatory
role in photosynthesis and macronutrient homeostasis through a signal transduction

pathway that also involves ngA.

262

INTRODUCTION

(l-TOCOphCI‘Ol (vitamin E) is a lipid-soluble, organic molecule that is only synthesized by
oxygen-evolving phototrophs, including some cyanobacteria and all green algae and
plants (Threlfall and Whistance, 1971; Collins and Jones, 1981; Sakuragi and Bryant,
2006). The conservation of a-tocopherol synthesis during the evolution of oxygenic
photosynthetic organisms suggests that this molecule performs one or more critical
functions. Because (it-tocopherol is also an essential dietary component, most of our
knowledge of tocopherol functions has been obtained from studies in animals, animal cell
cultures, and artificial membranes. Studies in these systems have shown that tocopherols
scavenge and quench various reactive oxygen species and lipid oxidation by-products,
which would otherwise propagate lipid peroxidation chain reactions in membranes
(Kamal-Eldin and Appelqvist, 1996). In addition to these antioxidant functions, several
other functions have been reported in mammals. These functions, which are independent
of the antioxidant activity of tocopherols and are termed nonantioxidant functions,
include transcriptional regulation and modulation of signaling pathways (Chan et al.,
2001; Azzi et al., 2002; Ricciarelli et al., 2002; Rimbach et al., 2002).

Tocopherol functions have not yet been clearly defined in oxygenic phototrophs,
but it is believed that they likely include some or all of the functions reported in animals,
as well as other functions possibly specific to photosynthetic organisms. For example,
recent studies with tocopherol-deficient mutants of Arabidopsis (Arabidopsis thaliana)
demonstrated that tocopherols provide protection against propagation of lipid

peroxidation in dormant and germinating seeds and thus are essential for seed longevity

263

and seedling development (Sattler et al., 2004). a-Tocopherol has been proposed to
protect PSII under high light-induced oxidative stress conditions in the green alga
Chlamydomonas reinhardtii (Trebst et al., 2002). Furthermore, we have previously
demonstrated that tocopherol-deficient mutants of Synechocystis sp. PCC 6803 grow
poorly when challenged with oxidative stress induced by the combination of
polyunsaturated fatty acids and high light illumination (Maeda et al., 2005). Therefore, it
seems clear that an antioxidant role of a-tocopherol is conserved among the oxygenic
phototrophs.

The biosynthesis of a-tocopherol in cyanobacteria occurs as shown in Figure A3.1.
Insertional inactivation of the genes encoding each enzyme of the pathway has resulted in
a series of mutants in which the content and composition of tocopherol species vary. For
example, the slr0089 mutant accumulates only y-tocopherol (Shintani and DellaPenna,
1998), the 3110418 mutant accumulates 30% of the wild-type level of a-tocopherol and a
small amount of B-tocopherol (Shintani et al., 2002; Cheng et al., 2003), whereas the
slr1 736 mutant lacks all tocopherols (Collakova and DellaPenna, 2001). In light of the
established antioxidant activity of u-tocopherol, one would expect that a loss or reduction
of a-tocopherol would lead to an obvious phenotypic difference between the wild-type
and mutant strains. Intriguingly, however, the tocopherol-deficient slr1736 mutant was
reported to grow similarly to the wild type under both photoautotrophic and
photomixotrophic conditions (Collakova and DellaPenna, 2001). These results suggest
that a-tocopherol is dispensable for the survival of Synechocystis sp. PCC 6803 under the

conditions tested (Collakova and DellaPenna, 2001).

264

In contrast to the results of these previous studies, by reconstructing a series of
tocopherol mutants in an isogenic wild-type background, we show here that a-tocopherol
is essential for the normal physiology of the cyanobacterium Synechocystis sp. PCC 6803.
Tocopherol mutants exhibited enhanced photosynthetic activities when grown under
photoautotrophic conditions, whereas they lost photosynthetic activity after 24 h and
were unable to grow under photomixotrophic conditions (in Glc-containing media).
These results demonstrate that u-tocopherol is essential for the survival of Synechocystis
sp. PCC 6803 under photomixotrophic conditions and suggest a role for a-tocopherol in
the regulation of photosynthesis in this cyanobacterium. Further analyses led to the
conclusion that oxidative stress is not the major cause of the lethality in cells grown
photomixotrophically and that a-tocopherol plays a regulatory role in photosynthesis and
macronutrient metabolism in Synechocystis sp. PCC 6803 that is independent of its

antioxidant properties.

RESULTS

Isolation and Characterization of Isogenic Tocopherol Mutants under
Photoautotrophic Conditions

Isogenic mutants deficient in tocopherol biosynthesis were constructed in our laboratory
wild-type strain (see "Materials and Methods"). Genomic DNAs extracted from each of
the previously isolated tocopherol-deficient mutants (Shintani and DellaPenna, 1998;
Collakova and DellaPenna, 2001; Shintani et al., 2002) were used for transformation, and
the resulting mutants were selected under photoautotrophic growth conditions on the

basis of their resistance to kanamycin. Complete segregation of each mutant allele was

265

confirmed by PCR analysis (Figure A3.2A). Table A3.1 shows the tocopherol content of
each homozygous mutant. The tocopherol content of the mutants was similar to that
reported previously and further confirmed the targeted gene inactivations (Shintani and
DellaPenna, 1998; Collakova and DellaPenna, 2001; Cheng et al., 2003). The growth
rates of the wild type and mutants were indistinguishable under photoautotrophic growth
conditions in liquid B-HEPES medium with 3% (v/v) C02 at various light intensities

2 s"; S 5 and 300 nmol photons m"2 3", data not

(Figure A3.2B, 50 nmol photons m"
shown). The data demonstrate that a-tocopherol is not required for the growth of
Synechocystis sp. PCC 6803 under photoautotrophic conditions, which is consistent with
previous studies (Collakova and DellaPenna, 2001; Dahnhardt et al., 2002; Maeda et al.,
2005).

The impact of tocopherol deficiency on photosynthesis was investigated in cells
grown under photoautotrophic conditions. The oxygen evolution rates for whole cells
were measured to assess the P811 activities of the wild-type and tocopherol mutant strains.
Each mutant showed an elevated oxygen evolution rate, which was 17% to 32% higher
than that of the wild type (Table A3.2). Analyses of the total cellular sugar content of
cells, including all sugar residues found in, for example, lipopolysaccharides, nucleic
acids, glycoproteins, and glycogen, revealed that the slr1736 mutant contained 160% of
the total sugar level of the wild type when cells were grown photoautotrophically (Table
A3.3). In thin-section electron micrographs examined by transmission electron
microscopy, the space between thylakoid membranes appeared electron dense and, at

most, very small glycogen granules were present in wild-type cells grown under

photoautotrophic conditions (Figure A3.3A). In contrast, the spaces between the

266

thylakoid membranes of the slr1736 mutant under photoautotrophic conditions were
filled with very large glycogen granules (large, electron-transparent oval objects; Figure
A3.3B). These results demonstrate that the tocopherol mutants possess elevated
photosynthetic activities and accumulate elevated amounts of fixed carbon as glycogen

when grown under photoautotrophic conditions.

Tocopherol Mutants Are Sensitive to Glc

Cells grown under photoautotrophic conditions were diluted into fresh B-HEPES medium
containing 5 mM Glc, and growth was monitored under photomixotrophic conditions.
The mutants grew similarly to the wild type during the initial 12 to 24 h, but all mutants
stopped growing after about 24 h in the presence of Glc (Figure A3.2, C and D). After 72
h, the mutants had completely lost viability and could not form colonies even on Glc-free
medium (data not shown). The ultrastructure of the slr1736 mutant cells was dramatically
different from that of the wild type when both were grown photomixotrophically. The
thylakoid membrane surfaces of the mutant appeared smoother than those of the wild
type, and numerous electron-dense oval objects, whose biochemical nature is not yet
known, can be seen between thylakoid membranes (compare Figure A3.3, C and D).
Under these conditions, the P311 activity in the mutant cells was completely lost by 24 h,
whereas the wild type maintained similar PSII activity during the course of measurements
(Table A3.2). Furthermore, in the slr1736 mutant grown under photomixotrophic
conditions, no carboxysomes were detectable in thin-section micrographs (see example in

Figure A3.3D). These results demonstrate that a-tocopherol is essential for survival as

267

well as for maintenance of PSII activity and carboxysomes in Synechocystis sp. PCC

6803 under photomixotrophic conditions.

Oxidative Stress Is Unlikely to Be the Cause of Glc Lethality in Towpherol Mutants

Light-dependent inactivation of photosynthesis, termed photoinhibition, is often observed
under a variety of environmental stresses, including high-intensity light (Allakhverdiev et
al., 1999; Hideg et al., 2000; Trebst et al., 2002; for review, see Aro et al., 1993, and refs.
therein). Under such conditions, the PsbA protein, a polypeptide that forms a subunit of
the P311 core complexes, is rapidly degraded and P811 activity is lost. Given the
established role of a-tocopherol as an antioxidant and the report that it protects PSII from
photoinhibition in C. reinhardtii (Trebst et al., 2002), we hypothesized that the altered
photosynthetic activities and growth capacities in the tocopherol mutants under
photomixotrophic conditions resulted from elevated oxidative stress due to the loss of a-
tocopherol. However, immunologically detectable PsbA protein levels were essentially
identical for the wild type and mutants grown both photoautotrophically and
photomixotrophically (Figure A3.4A). Furthermore, the level of immunologically
detectable Pst, a 33-kD protein closely associated with the tetra-manganese cluster of
the P811 oxygen evolution complex (Ferreira et al., 2004), was also essentially identical
for the wild-type and mutant cells grown both photoautotrophically and
photomixotrophically (Figure A3.4A). These results indicate that inactivation of P811 in
the tocopherol mutants is not due to damage and degradation of the PsbA and Pst

proteins.

268

Expression of the sodB gene, encoding superoxide dismutase, is known to
increase severalfold in response to the presence of various reactive oxygen species, and
sodB transcripts or SodB are often used as markers for oxidative stress (Hihara et al.,
2001; Huang et al., 2002; Ushimaru et al., 2002). Similar and low levels of sodB
transcripts were detected in the wild-type and slr1736 mutant cells grown
photoautotrophically (Figure A3.4B, 0 h). Following a shift to photomixotrophic growth
conditions, sodB transcript levels increased gradually and similarly in both the wild type
and the slr1736 mutant (Figure A3.4B, at 4—24 h). These results indicate that the slr1736
mutant is unlikely to be experiencing oxidative stress beyond that which occurs in wild-
type cells. Furthermore, as shown in Figure A3.4, C and D, the cessation of growth
observed for the tocopherol mutants under photomixotrophic conditions occurs
independently of light intensity within the range from approximately 5 nmol photons rn’2

2 5". Taken together, these results are not consistent with the

s'1 to 300 nmol photons m—
hypothesis that oxidative stress causes the inactivation of P811 and growth inhibition

observed for the tocopherol mutants under photomixotrophic conditions.

Effect of pH on Glc-Induced Lethality

It is noteworthy that the effect of Glc was dependent on the pH value of the growth
medium. The pH in standard B-HEPES medium typically shifted within 48 h from a
value of 8.0 to a value between 7.0 and 7.3 due to the supply of 3% C02 (v/v). Therefore,
the possibility that pH influences the Glc-induced lethality was tested using a modified
B-HEPES medium (B-HEPES40, containing 40 mM HEPES) that maintained the pH of

the culture within :0.1 pH units for the duration of the growth experiment. Under

269

photoautotrophic conditions, the mutants grew similarly to the wild type at all pH values,
indicating that the pH shift has little impact on mutants under these conditions (Figure
A3.5A). Under photomixotrophic conditions, however, the mutants grew similarly to the
wild type at pH 8.0 and 7.6, whereas their growth stopped after 24 h at pH 7.2 and below
(Figure A3.5A). The P811 activity of the slr1736 mutant was higher than the wild type at
all pH values under photoautotrophic growth conditions, consistent with the results
presented in Table A3.2. In contrast, under photomixotrophic conditions, PSII activity
was pH dependent and completely lost at pH 7.0 and below (Figure A3.5B). These results
demonstrate that Glc sensitivity and P811 inactivation of tocopherol mutants are pH
dependent and occur at approximately pH 7.2 and below.

Glc metabolism leads to the production of NAD(P)H, which feeds electrons into
the membrane electron transport chains, driving generation of the membrane
electrochemical potential and, as a result, ATP synthesis. This is accompanied by an
alkalization of the cytoplasm (Ryu et al., 2004). It has been reported that the cytoplasmic
pH value of Synechocystis sp. PCC 6803 is neutral or slightly alkaline (pH 6.9—7.5),
depending on growth conditions (Katoh et al., 1996). Therefore, it was hypothesized that
the combination of the neutral medium pH and increased intracellular pH due to Glc
import and metabolism led to a compromised membrane electrochemical potential,
thereby abating ATP synthesis and growth in the tocopherol mutant. This possibility was
tested by using electron transport chain inhibitors to disrupt electron transport and hence
the development of the membrane electrochemical potential. 3-(3',4'-Dichlorophenyl)-
1,1-dimethylurea blocks the input of electrons into the photosynthetic electron transport

chain by inhibiting PSII activity; methyl viologen withdraws electrons from the

270

membrane electron transport chain on the acceptor side of PSI, whereas cyanide inhibits
cytochrome c oxidase. Regardless of the inhibitors used, the slr1736 mutant showed
similar Glc-induced lethality as observed in the absence of the inhibitors (data not shown).
These results suggest that Glc toxicity is probably not associated with increased electron

flux through the electron transport chain or with an altered membrane potential.

Altered Macronutrient Metabolism in Tocopherol Mutants

How does Glc cause the death of the tocopherol mutants if not by means of oxidative
stress or by a modification of electron flux through the electron transport chain? As
shown above, under photoautotrophic conditions, the tocopherol mutants exhibited an
enhanced photosynthetic activity and elevated total sugar content (Figure A3.3B; Table
A3.3). We hypothesized that such elevation of the intracellular carbon flux would alter
the balance between carbon and other macronutrients and that Glc metabolism would
exacerbate this metabolic imbalance, perhaps to a level that could impair growth.

It is noteworthy that the tocopherol mutants appeared pale and chlorotic
(greenish-yellow) when grown under photomixotrophic conditions. In cyanobacteria,
chlorosis is often associated with macronutrient deprivation, such as nitrogen, carbon,
sulfur, iron, and phosphate starvation, because of a rapid degradation of phycobiliproteins
(PBPs), light-harvesting antenna proteins that can serve as a reserve of fixed carbon and
nitrogen (for review, see Grossman et al., 1994). Analysis of the PBP content revealed
that tocopherol mutants contained only 35% of the wild-type level of PBPs after 24 h

under photomixotrophic conditions (Figure A3.6). Under these conditions, the abundance

271

of the cpcA transcript, which encodes the u-subunit of phycocyanin, also decreased to
undetectable levels (Figure A3.7A).

The anA operon, which comprises the nblAI and anAZ genes, encodes proteins
essential for the regulation of PBP degradation (Baier et al., 2004), whereas the spr
transcript encodes an inducible high-affinity, periplasmic sulfate-binding protein
(Laudenbach and Grossman, 1991). The anA and spr transcripts have previously been
shown to accumulate in response to nitrogen and sulfate limitation, respectively, in
Synechocystis sp. PCC 6803 (Laudenbach and Grossman, 1991; Collier and Grossman,
1994; Richaud et al., 2001). Under photoautotrophic growth conditions, the slr1736
mutant accumulated slightly higher levels of these transcripts in comparison to the wild
type (Figure A3.7A). Under photomixotrophic growth conditions, the slr1736 mutant
accumulated substantially higher levels of the anA and spr transcripts after 4 h (Figure
A3.7A). These data suggest that the slr1736 mutant is sensing and responding to
macronutrient stress and that this stress is greatly accentuated under photomixotrophic
conditions. One response is increased PBP degradation in the slr1736 mutant under
photomixotrophic conditions.

It is known that the expression of alternative sigma factors is induced in response
to various stresses, including macronutrient limitation for carbon (sigB and sigH; Caslake
et al., 1997; Wang et al., 2004) and nitrogen (sigE; Muro-Pastor et al., 2001). As shown
in Figure A3.7B, the transcript levels of these sigma factors were indeed altered in the
slr1736 mutant. For example, the transcript levels of sigB, sigC, and sigE in the slr1736
mutant appeared slightly higher than those of the wild-type control under

photoautotrophic growth conditions, and they increased further (by 4 h) in response to

272

Glc treatment (Figure A3.7B). These results suggest that the tocopherol mutants are
experiencing and transcriptionally responding subtly to macronutrient starvation under
photoautotrophic growth conditions and indicate that they are experiencing severe
macronutrient starvation related to carbon and nitrogen under photomixotrophic growth
conditions. The transcript level for sigl in the slr1736 mutant did not vary significantly
from the wild-type control, whereas sigD transcript levels for the mutant and the wild
type were highly variable and not reliably reproducible. Interestingly, transcript levels of
sigA and sigG in the slr1736 mutant gradually decreased to undetectable levels under
photomixotrophic growth conditions. sigA and sigG have been shown to be essential for
the survival of this cyanobacterium (Caslake and Bryant, 1996; Huckauf et al., 2000).
Therefore, these results indicate that the substantial reduction in the sigA and sigG
transcripts combined with the severe macronutrient starvation response led to the
cessation of growth in the tocopherol mutants under photomixotrophic growth conditions

at pH 7.0.

Transcript Levels of Inorganic Carbon Metabolism Genes '

Given the dramatic differences in carbon assimilation between the tocopherol mutants
and wild type under both photoautotrophic and photomixotrophic conditions (Figure
A3.3; Table A3.3), the abundance of genes involved in inorganic carbon (Ci) metabolism
was also investigated by reverse transcription (RT)-PCR. In the slr1736 mutant, the
transcript levels of carboxysome genes, including rbcL, cch1, and ccmL (encoding the
large subunit of Rubisco [Pierce et al., 1989] and carboxysome shell proteins [Price et al.,

1993], respectively), were identical to those in the wild type under photoautotrophic

273

growth conditions. In contrast, these transcripts gradually decreased to undetectable
levels in the slr1736 mutant under photomixotrophic growth conditions, whereas those in
the wild type were unaffected (Figure A3.7C). As shown by electron micrographs (Figure
A3.3D), these results are consistent with the loss of carboxysomes in the slr1736 mutant
under photomixotrophic growth conditions in the slr1736 mutant. Similarly, the transcript
levels of nth4, encoding a subunit of the constitutive low-affinity C02 uptake
transporter (Shibata et al., 2001), were not affected under photoautotrophic growth
conditions, whereas they gradually decreased to undetectable levels under
photomixotrophic conditions in the slr1736 mutant. nth3, nth, and sbtA encode a
subunit of the low C02-inducible high-affinity C02 uptake complex, a repressor of nth3,
and the sodium-dependent bicarbonate transporter, respectively (Klughammer et al.,
1999; Shibata et al., 2001, 2002). The transcript levels of these genes were constitutively
lower in the slr1736 mutant as compared to the wild type under both photoautotrophic
and photomixotrophic growth conditions (Figure A3.7D). These results demonstrate that
the abundance of Ci gene transcripts is differentially regulated in the slr1736 mutant as

compared with the wild type.

A pmgA Mutant Also Shows pH-Dependent Lethality under Photomixotrophic Growth
Conditions

A previous study identified the pmgA gene as a locus responsible for the survival of
Synechocystis sp. PCC 6803 under photomixotrophic growth conditions (Hihara and
Ikeuchi, 1997). Although the underlying mechanism is not completely understood, pmgA

has been suggested to play a role in the regulation of Glc metabolism and photosynthesis

274

in Synechocystis sp. PCC 6803 (Hihara and Ikeuchi, 1997). Therefore, a pnng mutant
was constructed in the same wild-type genetic background as the tocopherol mutants (see
"Materials and Methods"), and the growth of this mutant was compared to the wild type
and the slr1736 mutant under photoautotrophic and photomixotrophic growth conditions
at both pH 7.0 and 8.0. Under photoautotrophic conditions at both pH values, the pmgA
mutant grew similarly to both the wild type and the slr1736 mutant (Figure A3.8A).
Under photomixotrophic growth conditions at pH 7.0, growth of the pmgA mutant ceased
by 24 h, whereas it continued to grow at pH 8.0 (Figure A3.8B). This pH-dependent
growth defect was identical to that observed for the slr1736 mutant under
photomixotrophic conditions (Figure A388). Previously, the pmgA mutant was also
shown to have higher photosynthetic activity under photoautotrophic conditions (Hihara
and Ikeuchi, 1998), suggesting that, like the slr1736 mutant, the pmgA mutant possesses
enhanced photosynthetic capacity under photoautotrophic conditions. Therefore, total
sugar content of the pmgA mutant was measured under photoautotrophic and
photomixotrophic conditions. The pmgA mutant accumulated twice as much total sugar
as the wild type under both photoautotrophic and photomixotrophic growth conditions
(Table A3.3), which is very similar to the results observed for the slr1736 mutant (Table
A3.3; see above). The striking similarities between the slr1736 and pmgA mutants lead us
to pr0pose that u-tocopherol and ngA may function in the same signal transduction
pathway and participate in the regulation of the photosynthetic activity and macronutrient

homeostasis in Synechocystis sp. PCC 6803.

275

DISCUSSION
In this study, we have demonstrated that tocopherol mutants are sensitive to Glc at pH
values below approximately 7.4 and are unable to grow under photomixotrophic
conditions after 24 h (Figure A3.2, C and D). These results are markedly different from
the results reported in a previous study in which the tocopherol mutants grew similarly to
the parental wild-type strain under both photoautotrophic and photomixotrophic
conditions (Collakova and DellaPenna, 2001). We observed that all of the previously
isolated tocopherol mutants (Shintani and DellaPenna, 1998; Collakova and DellaPenna,
2001; Shintani et al., 2002) showed colony morphologies that are highly variable with
respect to their size and pigmentation when grown under photomixotrophic conditions
(data not shown). Inhomogeneous colony morphology typically indicates genotypic
heterogeneity within a given population. It is important to note that these mutants were
originally isolated and maintained under photomixotrophic conditions (Shintani and
DellaPenna, 1998; Collakova and DellaPenna, 2001; Shintani et al., 2002), which we
now know to be lethal for tocopherol biosynthetic mutants. Therefore, it is highly
plausible that the previously isolated populations of tocopherol mutants contain
secondary suppressor mutations that were selected for under continuous
photomixotrophic conditions. We conclude that the authentic tocopherol mutants
described here are Glc sensitive and that (Jr-tocopherol is essential for survival of
Synechocystis sp. PCC 6803 under photomixotrophic growth conditions at pH values
below approximately 7.4.

Due to its antioxidant properties in biological membranes, functions of d-

tocopherol are typically discussed in connection with oxidative stress (Kamal-Eldin and

276

Appelqvist, 1996). Interestingly, in C. reinhardtii, an 80% reduction in (Jr—tocopherol
levels, due to combined herbicide and high light treatments (1,500 umol photon m“2 5"),
resulted in the complete loss of PSII activity with concomitant degradation of the D1
(PsbA) protein (Trebst et al., 2002). This suggests that a-tocopherol plays an antioxidant
role in protecting the structural integrity of PSII during oxidative stress in this green alga.
Thus, we initially hypothesized that PSII inactivation in tocopherol mutants under
photomixotrophic growth conditions was also related to oxidative stress. However,
several lines of evidence indicate that this is not the case. First, the PsbA protein level in
tocopherol mutants was not altered, although PSII activity was completely lost (Figure
A3.4A). Second, the Glc-sensitive phenotype of tocopherol mutants was light
independent and occurred at a wide range of light intensities (approximately 5—300 umol
photons m’2 s"; Figure A3.4, C and D). Third, sodB transcript levels, an oxidative stress
marker, were identical between the slr1736 and wild type under both photoautotrophic
and photomixotrophic growth conditions (Figure A3. 48). Last, the deleterious effects of
Glc on the slr1736, 3110418, and slr0089 mutants were virtually indistinguishable despite
the varying compositions and amounts of tocopherols accumulated in each mutant (Table
A3.]; Figures A3.2, C and D, and 5A). Should a-tocopherol function solely as a bulk
antioxidant, an inverse correlation of susceptibility to Glc and tocopherol content would
reasonably be expected. This was not observed, however, and therefore we conclude that
Glc-induced PSII inactivation and growth inhibition of tocopherol mutants are not
associated with oxidative stress or Dl-mediated photoinhibition. Instead, we propose that,

in addition to protecting Synechocystis sp. PCC 6803 membranes from peroxidation

277

(Maeda et al., 2005), u-tocopherol also plays a nonantioxidant role in the survival of
Synechocystis sp. PCC 6803 under photomixotrophic growth conditions at pH 7.0.

Nonantioxidant roles of u-tocopherol are not without precedent. Studies in animal
systems have demonstrated nonantioxidant roles for a-tocopherol, including modulation
of signaling pathways and transcriptional regulation (Chan et al., 2001; Azzi et al., 2002;
Ricciarelli et al., 2002). For example, a-tocopherol has been shown to modulate the
phosphorylation state of protein kinase Ca in rat smooth-muscle cells by influencing
protein phosphatase 2A activity (Ricciarelli et al., 1998). It has also been demonstrated
that (it-tocopherol affects the expression of genes encoding liver collagen a1, u-tocopherol
transfer protein, and a-tropomyosin collagenase (Yamaguchi et al., 2001; Azzi et al.,
2002; Rimbach et al., 2002). Similarly, the loss of tit-tocopherol in the slr1736 mutant
constitutively or conditionally altered the abundance of several transcripts, including
those encoding components of Ci, nitrogen, and sulfur metabolism (Figure A3.7). Loss of
u-tocopherol also resulted in elevated photosynthetic activity in cells grown
photoautotrophically as shown by increased PSII activity and total sugar and glycogen
content (Tables A32 and 3; Figures A3.3B and 5B). These data are consistent with u-
tocopherol playing a role in the regulation of photosynthesis and macronutrient
metabolism—a role that is independent of its antioxidant properties in Synechocystis sp.
PCC 6803.

What is the underling mechanism by which a-tocopherol, a small secondary
metabolite, could affect such cellular processes on a global scale? In searching for an
answer, we focused on the pmgA gene, which was previously shown to be essential for

the survival of Synechocystis sp. PCC 6803 under photomixotrophic growth conditions

278

(Hihara and Ikeuchi, 1997). An analysis of conserved domains
(http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) revealed that the primary
structure of ngA is similar to that of Ris/Rst in Bacillus subtilis (E value = 6 x e“
25), which is a Ser-Thr kinase that acts in the signal transduction cascade that regulates
the activity of SigB, a stress-responsive sigma factor in this bacterium (Price, 2000). The
pmgA mutant showed remarkable similarity to the slr1736 mutant under both
photoautotrophic and photomixotrophic conditions. These included increased levels of
total cellular sugars under both growth conditions (Table A3.3), higher oxygen evolution
activity than the wild type under photoautotrophic conditions (Hihara and Ikeuchi, 1998),
and nearly identical pH-dependent sensitivity to the presence of Glc (Figure A3.8). These
combined results demonstrate that both (I-tOCOpherOl and ngA are required for the
appropriate regulation of photosynthesis and carbon homeostasis in Synechocystis sp.
PCC 6803. One possibility is that (Jr-tocopherol and ngA are both necessary components
of a not yet fully characterized signal transduction cascade whose disruption leads to Glc
lethality in Synechocystis sp. PCC 6803. Recent studies have shown that the His kinase
Hik31 is involved in Glc sensing and Glc-induced lethality (Kahlon et al., 2006), whereas
the His kinase Hik8 is involved in Glc metabolism and heterotrophic growth in
Synechocystis sp. PCC 6803 (Singh and Sherman, 2005). Alternatively, (Jr-tocopherol may
indirectly influence the activities and functions of the regulatory proteins or proteins
involved in Glc metabolism, particularly those associated with the membranes, by
affecting membrane integrity (Wang and Quinn, 2000). These possibilities remain to be

examined in future studies.

279

Such a control mechanism for optimal activity of photosynthesis is essential for
the normal physiology of Synechocystis sp. PCC 6803. We showed here that the slr1736
mutant accumulated the anAI-nblAZ and spr transcripts slightly higher than the wild
type even under photoautotrophic conditions (Figure A3.7A), suggesting that the mutant
is already perceiving a macronutrient stress response related to nitrogen and sulfur under
photoautotrophic conditions. It is important to note that this did not affect the growth
rates or the PBP content of the tocopherol mutants, perhaps because this level of stress is
moderate and thus tolerated under photoautotrophic conditions. After transfer to
photomixotrophic growth conditions, the intracellular carbon flux increased further as
exemplified by the increased total sugar content in the tocopherol mutants (Table A3.3).
One could imagine this would inevitably exacerbate the altered macronutrient
homeostasis in the slr1736 mutant. Indeed, under these conditions, the nblA1-2, spr,
and sigE transcript levels increased dramatically (Figure A3.7, A and B), which parallels
the decrease in PBP content and the cpcA transcript level (Figures A3.6 and 7A). As a
result, the tocopherol mutants showed severe chlorosis and growth defects under these
conditions (Figure A3.2, C and D).

Interestingly, the elevated photosynthetic rate observed for the tocopherol mutants
eventually ceased after cells were transferred to photomixotrophic growth conditions.
PSII activity was completely lost, no carboxysomes were detectable, and rbcL and other
Ci gene transcript levels decreased substantially by 24 h under these conditions (Table
A3.2; Figures A3.3D and 7C). It is well documented in higher plants that the activity of
photosynthesis is negatively regulated by the accumulation of carbohydrates. One aspect

of such regulation is triggered by hexoses and their metabolites, which function as

280

signaling molecules and regulate photosynthetic gene expression (for review, see Koch,
1996; Sheen et al., 1999; and refs. therein). Specifically, in Chenopodium and maize (Zea
mays), the addition of Glc induces a large transcriptional down-regulation of rch
(encoding the small subunit of Rubisco; Krapp et al., 1993; Jang and Sheen, 1994),
whereas in Arabidopsis the level of the 0E33 transcript, encoding the 33-kD oxygen-
evolving protein, is subject to Glc repression (Zhou et al., 1998). Therefore, it is plausible
that a functionally analogous sugar repression mechanism exists and regulates Ci gene
transcription in Synechocystis sp. PCC 6803. Consistent with these ideas, a Glc-sensitive
mutant lacking Hik3l has recently been shown to lack glucokinase activity and,
correspondingly, a glucokinase mutant cannot grow in the presence of Glc (Kahlon et al.,
2006).

In summary, our efforts in reisolating and characterizing tocopherol mutants
under photoautotrophic conditions have yielded new insights into the roles and functions
for a-tocopherol in Synechocystis sp. PCC 6803. The results described here demonstrate
that a-tocopherol is essential for the normal physiology of Synechocystis sp. PCC 6803
and suggest that, in addition to its role as an antioxidant, (it-tocopherol plays a role in
regulating photosynthesis and macronutrient homeostasis that is independent of this
antioxidant activity. It is important to note that maize and potato (Solanum tuberosum)
plants, which are defective in tocopherol cyclase activity and are thus tocopherol
deficient, also exhibit large alterations in carbohydrate homeostasis due to impaired sugar
metabolism/transport (Provencher et al., 2001; Hofius et al., 2004). Although no

biochemical or mechanistic explanation exists for this common phenotype between plants

281

and cyanobacteria, it seems plausible that a function for a-tocopherol in the regulation of

macronutrient homeostasis is conserved between the two groups of oxygenic phototrophs.

METHODS

Growth Conditions and Strains

Isolation of the original slr1736, sllO418, and slr0089 mutants under photomixotrophic
growth conditions has been described previously (Shintani and DellaPenna, 1998;
Collakova and DellaPenna, 2001; Shintani et al., 2002). A Glc-tolerant wild-type strain of
Synechocystis sp. PCC 6803 (Williams, 1988) was used in this study for transformation
and isolation of the tocopherol mutants in the absence of Glc (see "Results"). B-HEPES
medium, pH 8.0, was used for selection, maintenance, and growth measurements of the
wild type and mutants. This medium was prepared by supplementing BG-ll medium
(Stanier et al., 1971) with 4.6 mM HEPES-KOH and 18 mg L"1 ferric ammonium citrate.
B-HEPES40 medium, a modified B-HEPES medium containing 40 mM HEPES to
provide greater buffering strength, was used in some experiments that require greater
control of the medium pH during growth. The wild type was maintained on solid B-
HEPES medium containing 1.5% (w/v) agar and 5 mM Glc, and the photoautotrophically
selected tocopherol mutants were maintained on solid B-HEPES medium containing
1.5% (w/v) agar, 50 pg kanamycin mL'l, and, importantly, no Glc. For determination of
growth characteristics, late-exponential phase cultures were diluted into fresh liquid B-
HEPES medium to OD730 m = approximately 0.05 cm“. The diluted cultures were grown
at 32°C with continuous bubbling with air containing 1% or 3% (v/v) C02. The OD730 nm

was monitored to measure growth. The medium was supplemented with 5 mM Glc for

282

photomixotrophic growth conditions. The growth light intensity was 50 nmol photons m'

2 5’1, unless otherwise specified.

Construction and Isolation of Mutants

The wild type was transformed with genomic DNA extracted from the previously isolated
slr1736, sllO418, and slr0089 mutants (see above). Segregation of mutant alleles from
wild-type alleles was carried out in the absence of Glc and in the presence of 50 ug
kanamycin mL'l. Segregation was verified by PCR analysis. Oligonucleotide primers
used for PCR analysis were as follows: slr1736 forward primer (5'-
GGCTTCTCCTACCCGGAA'I'TCTACTTCCTG-3'), slr1736 reverse primer (5'-
GCTTTCTAAGTGTACATCTAGACTCCGCCA-3'), sllO4I8 forward primer (5'-
ATGCCCGAGTATTTGCTTCTGCC-3 '), 311041 8 reverse primer (5 '-
GCACTGCTTTGAACATACCGAAG-3'), slr0089 forward primer (5'-
TCTACCGGAAA'I'I‘GCCAACTACCA-3'), and slr0089 reverse primer (5'-
CCTAGGAGATTGTGGACTTCAA-3'). The pmgA gene was amplified by PCR using
forward primer (5'-TTCTCTGTGCCGAAAGCTTCTATG-3') and reverse primer (5'-
CACCATGGTGGCGAATTCAGCC-3'). The amplified DNA fragments were digested
with HindIII and EcoRI and ligated with pUC19 that had been digested with the same
enzymes. An XbaI fragment of pM8266, containing the aacCI gene that confers
gentamicin resistance, was inserted into the unique Spel site within the pmgA coding
region. The resulting plasmid construct was linearized after digestion with EcoRI and
used to transform wild-type Synechocystis sp. PCC 6803 cells. Transformants were

selected on solid medium B-HEPES at pH 8.0 in the presence of 20 [lg mL‘l gentamicin

283

 

at room temperature under moderate light intensity (approximately 50 pH m"2 5"). PCR

analyses of the transforrnants were performed with the same primer pairs described above.

Oxygen Evolution Measurements

Cells grown under photoautotrophic or photomixotrophic conditions for 24 h were
harvested by centrifugation at 8,000g at room temperature and resuspended in a 25 mM
HEPES buffer, pH 7.0, to obtain an OD730 m = 1.0 cm'l. Oxygen evolution was measured
immediately after the addition of 1 mM 1,4-benzoquinone and 0.8 mM K3Fe(CN)6 to the
cell suspension. The excitation light intensity was approximately 3 mmol photons m"2 s".
The oxygen concentration was measured polarographically with a Clark-type electrode as

described previously (Sakamoto and Bryant, 1998).

Estimation of Relative PBP Content

The relative PBP content of cells was determined by a minor modification of the method
of Zhao and Brand (1989). Cells were harvested by centrifugation at 8,000g for 6 min
and pellets were resuspended in 25 mM HEPES buffer, pH 7.0, to obtain cell suspensions
(2 mL) with OD730 m = 0.5 cm'l. These suspensions (1.0 mL) were heated at 100°C for 1
min. The OD635 nm and OD730 nm were recorded for unheated and heated samples, and the
values were then inserted into the following equation: relative PBP content = (AOD635 nm

— A()I)730 nm)/OD730 nm'unheated, Where AOD indicates ODunheated sample — ODheated sample-

284

SDS-PA GE and Immunoblotting

Cells were grown under photoautotrophic conditions to the midexponential phase or
under photomixotrophic conditions for 24 h, harvested as described above, and
resuspended in 25 mM HEPES buffer, pH 7.0, to achieve OD730 m = 100 cm‘l. Cells
were disrupted using an equal volume of glass beads and a home-built bead beater; cold
cell suspensions were vigorously shaken four times for 30 s, interrupted by 30-s intervals
on ice. An aliquot (10 uL) of each sample was mixed with an equal volume of loading
buffer; the mixture was incubated at 65°C for 20 min and applied onto a discontinuous
SDS-polyacrylamide gel with 10% (w/v) acrylarnide in the separating gel as described
(Schiigger and van Jagow, 1987). Prof. Eva-Mari Aro kindly provided antibodies raised
against amino acids 234 to 242 of the PsbA protein of Synechocystis sp. PCC 6803. Prof.
Robert Bumap kindly provided antibodies raised against the Pst protein of
Synechocystis sp. PCC 6803. After electrophoresis, proteins were transferred to a
nitrocellulose membrane. Proteins were detected by immunoblotting by using enhanced
chemiluminescence (Amersham Biosciences), according to the manufacturer's

specifications.

Isolation of Total RNA and RT-PCR Analyses

Total RNA was isolated and purified from cells using the mini-to-midi RNA isolation kit
(Invitrogen). The RNA samples were purified again after DNase digestion. The RNAs
obtained were adjusted to a final concentration of 50 ng RNA [J.L’l and stored at —80°C
until used. Transcripts were amplified and detected by using the one-step RT-PCR kit

(Qiagen) in the presence of the RNase inhibitor RNAsin (Promega) with target-specific

285

 

Oligonucleotide primers. The sequences of the primers used for each of the indicated

genes will be made available upon request.

Transmission Electron Microscopy

Cells grown under photoautotrophic and photomixotrOphic conditions for 24 h were
harvested and immediately fixed overnight at 4°C in a 2.5% (v/v) glutaraldehyde solution
prepared in 0.1 M cacodylate buffer, pH 7.4. After secondary fixation in a 1% (w/v)
osmium tetroxide solution in the cacodylate buffer, the cells were stained with uranyl
acetate (2% w/v), followed by dehydration in the following concentrations of ethanol:
50% (v/v), 70% (v/v), 90% (v/v), 95% (v/v) ethanol in water followed by two washes in
100% (v/v) ethanol. The samples were then embedded in Spurr's resin and polymerized
overnight at 60°C. Thin sections (approximately 50- to 60-nm thickness) were stained
with 2% (v/v) uranyl acetate before examination under a IBM 1200 EXII transmission

electron microscope (JEOL).

Total Sugar Assay

Cells were harvested as described above and washed and resuspended in distilled water to
achieve the same OD730 nm. The total sugar content of each cell suspension was
determined by a previously described colorimetric assay (Dubois et al., 1956). The total
sugar content was calculated relative to the A435 nm for the wild-type cells grown under

photoautotrophic and photomixotrophic conditions.

286

Analysis of Tocopherol Content
The toc0pherol content of the wild-type and mutant strains was analyzed as described

previously (Cheng et al., 2003).

287

REFERENCES

Allakhverdiev SI, Nishiyama Y, Suzuki 1, Tasaka Y, Murata N (1999) Genetic
engineering of the unsaturation of fatty acids in membrane lipids alters the tolerance
of Synechocystis to salt stress. Proc Natl Acad Sci USA 96: 5862-5867

Aro E-M, Girgin T, Andersson B (1993) Photoinhibition of Photosystem II.
Inactivation, protein damage and turn over. Biochim Biophys Acta 1143: 113-134

Azzi A, Ricciarelli R, Zingg JM (2002) Non-antioxidant molecular functions of ._,._
tocopherol (vitamin E). FEBS Lett 519: 8-10

Baier K, Lehmann H, Stephan DP, Lockau W (2004) NblA is essential for
phycobilisome degradation in Anabaena sp. strain PCC 7120 but not for
development of functional heterocysts. Microbiology 150: 2739-2749

Caslake L, Bryant DA (1996) The sigA gene encoding the major sigma factor of RNA
polymerase from the marine cyanobacterium Synechococcus sp. strain PCC 7002:
cloning and characterization. Microbiology 142: 347~357

Caslake L, Gruber TM, Bryant DA (1997) Expression of two alternative sigma factors
of Synechococcus sp. PCC 7002 is modulated by carbon and nitrogen stress.
Microbiology 143: 3807-3818

Chan SS, Monteiro HP, Schindler F, Stern A, Junqueira VB (2001) a-Tocopherol
modulates tyrosine phosphorylation in human neutrophils by inhibition of protein

kinase C activity and activation of tyrosine phosphatases. Free Radic Res 35: 843-
856

Cheng Z, Sattler S, Maeda H, Sakuragi Y, Bryant DA, DellaPenna D (2003) Highly
divergent methyltransferases catalyze a conserved reaction in tocopherol and

plastoquinone synthesis in cyanobacteria and photosynthetic eukaryotes. Plant Cell
15: 2343-2356

Collakova E, DellaPenna D (2001) Isolation and functional analysis of homogentisate
phytyltransferase from Synechocystis sp. PCC 6803 and Arabidopsis. Plant Physiol
127: 1113-1124

Collier JL, Grossman AR (1994) A small polypeptide triggers complete degradation of
light-harvesting phycobiliproteins in nutrient-deprived cyanobacteria. EMBO J 13:
1039-1047

Collins MD, Jones D (1981) Distribution of isoprenoid quinone structural types in
bacteria and their taxonomic implications. Microbiol Rev 45: 316-354

288

Dahnhardt D, Falk J, Appel J, van der Kooij TAW, Schulz-Friedrich R, Krupinska
K (2002) The hydroxyphenylpyruvate dioxygenase from Synechocystis sp. PCC
6803 is not required for plastoquinone biosynthesis. FEBS Lett 523: 177-181

Dubois M, Gilles KA, Hamilton J K, Rebers PA, Smith F (1956) Colorimetric method
for determination of sugars and related substances. Anal Chem 28: 350-356

Ferreira KN, Iverson TM, Maghlaoui K, Barber J, Iwata S (2004) Architecture of the
photosynthetic oxygen-evolving center. Science 303: 1831-1838

Grossman AR, Schaefer MR, Chiang GG, Collier JL (1994) The responses of
cyanobacteria to environmental conditions, light and nutritions. In DA Bryant, ed,
The Molecular Biology of Cyanobacteria. Kluwer Academic Publishers, Dordrecht,
The Netherlands, pp 641-675

Hideg E, Kalai T, Hideg K, Vass I (2000) Do oxidative stress conditions impairing
photosynthesis in the light manifest as photoinhibition? Philos Trans R Soc Lond B
Biol Sci 355: 1511-1516

Hihara Y, Ikeuchi M (1997) Mutation in a novel gene required for photomixotrophic
growth leads to enhanced photoautotrophic growth of Synechocystis sp. PCC 6803.
Photosynth Res 53: 243-252

Hihara Y, Ikeuchi M (1998) A novel gene, pmgA, specifically regulates photosystem
stoichiometry in the cyanobacterium Synechocystis sp. PCC 6803 in response to high
light. Plant Physiol 117: 1205-1216

Hihara Y, Kamei A, Kanehisa M, Kaplan A, Ikeuchi M (2001) DNA microarray
analysis of cyanobacterial gene expression during acclimation to high light. Plant
Cell 13: 793-806

Hofius D, Hajirezaei MR, Geiger M, Tschiersch M, Melzer M, Sonnewald U (2004)
RNAi-mediated tocopherol deficiency impairs photoassimilate export in transgenic
potato plants. Plant Physiol 135: 1256-1268

Huang L, McCluskey MP, Ni H, LaRossa RA (2002) Global gene expression profiles
of the cyanobacterium Synechocystis sp. PCC 6803 in response to irradiation with
UV-B and white light. J Bacteriol 184: 6845-6858

Huckauf J, Nomura C, Forchhammer K, Hagemann M (2000) Stress responses of
Synechocystis sp. strain PCC 6803 mutants impaired in genes encoding putative

alternative sigma factors. Microbiology 146: 2877-2889

Jang J C, Sheen J (1994) Sugar sensing in higher plants. Plant Cell 6: 1665-1679

289

Kahlon S, Beeri K, Ohkawa H, Hihara Y, Murik 0, Suzuki 1, Ogawa T, Kaplan A
(2006) A putative sensor kinase, Hik3l, is involved in the response of Synechocystis

sp. strain PCC 6803 to the presence of glucose. Microbiology 152: 647-655

Kamal-Eldin A, Appelqvist L (1996) The chemistry and antioxidant properties of
tocopherols and tocotrienols. Lipids 31: 671-701

Katoh A, Sonoda M, Katoh H, Ogawa T (1996) Absence of light-induced proton
extrusion in a cotA-less mutant of Synechocystis sp. strain PCC 6803. J Bacteriol
178: 5452-5455

Klughammer B, Siiltemeyer D, Badger MR, Price GD (1999) The involvement of
NAD(P)H dehydrogenase subunits, Nth3 and Nth3, in high-affinity CO2 uptake
in Synechococcus sp. PCC 7002 gives evidence for multiple NHD-l complexes with
specific roles in cyanobacteria. Mol Microbiol 32: 1305-1315

Koch KE (1996) Carbohydrate-modulated gene expression in plants. Annu Rev Plant
Physiol Plant Mol Biol 47 : 509-540

Krapp A, Hofmann B, Schafer C, Stitt M (1993) Regulation of the expression of rch
and other photosynthetic genes by carbohydrates: a mechanism for the "sink
regulation" of photosynthesis? Plant J 3: 817-828

Laudenbach DE, Grossman AR (1991) Characterization and mutagenesis of sulfur-

regulated genes in a cyanobacterium: evidence for function in sulfate transport. J
Bacteriol 173: 2739-2750

Maeda H, Sakuragi Y, Bryant DA, DellaPenna D (2005) Tocopherols protect
Synechocystis sp. strain PCC 6803 from lipid peroxidation. Plant Physiol 138: 1422-
1435

Mum-Pastor AM, Herrero A, Flores E (2001) N itrogen-regulated group 2 sigma factor
from Synechocystis sp. strain PCC 6803 involved in survival under nitrogen stress. J
Bacteriol 183: 1090-1095

Pierce J, Carlson TJ, Williams JG (1989) A cyanobacterial mutant requiring the
expression of ribulose bisphosphate carboxylase from a photosynthetic anaerobe.
Proc Natl Acad Sci USA 86: 5753-5757

Price CW (2000) Protective function and regulation of the general stress response in
Bacillus subtilis and related Gram-positive bacteria. In G Storz, R Hengge-Aronis,
eds, Bacterial Stress Response. ASM Press, Washington, DC, pp 179-197

Price GD, Howitt SM, Harrison K, Badger MR (1993) Analysis of a genomic DNA

region from the cyanobacterium Synechococcus sp. strain PCC7942 involved in
carboxysome assembly and function. J Bacteriol 175: 2871-2879

290

Provencher LM, Miao L, Sinha N, Lucas WJ (2001) Sucrose export defectivel
encodes a novel protein implicated in chloroplast-to-nucleus signaling. Plant Cell
13: 1127-1141

Ricciarelli R, Tasinato A, Clément S, Ozer NK, Boscoboinik D, Azzi A (1998) c.-
Tocopherol specifically inactivates cellular protein kinase Ca by changing its
phosphorylation state. Biochem J 334: 243-249

Ricciarelli R, Zingg JM, Azzi A (2002) The 80‘h anniversary of vitamin E: beyond its
antioxidant properties. Biol Chem 383: 457-465

Richaud C, Zabulon G, Joderr A, Thomas JC (2001) Nitrogen and sulfur starvation
differentially affects phycobilisomes degradation and expression of the anA gene in
Synechocystis strain PCC 6803. J Bacteriol 183: 2989-2994

Rimbach G, Minihane AM, Majewicz J, Fischer A, Pallauf J, Virgli F, Weinberg PD
(2002) Regulation of cell signaling by vitamin E. Proc Nutr Soc 61: 415-425

Ryu J, Song JY, Lee JM, Jeong SM, Chow WS, Choi S, Pogson BJ, Park Y (2004)
Glucose-induced expression of carotenoid biosynthesis genes in the dark is mediated

by cytosolic pH in the cyanobacterium Synechocystis sp. PCC 6803. J Biol Chem
279: 25320-25325

Sakamoto T, Bryant DA (1998) Growth at low temperature causes nitrogen limitation in
the cyanobacterium Synechococcus sp. PCC 7002. Arch Microbiol 169: 10-19

Sakuragi Y, Bryant DA (2006) Genetic manipulation of quinone biosynthesis in
cyanobacteria. In JH Golbeck, ed, Photosystem I: The PlastocyaninzFerredoxin
Oxidoreductase. Advances in Photosynthesis and Respiration, Vol 24. Springer,
Dordrecht, The Netherlands, pp 205-222

Sattler SE, Gilliland LU, Magallanes-Lundback M, Pollard M, DellaPenna D (2004)
Vitamin E is essential for seed longevity and for preventing lipid peroxidation during
germination. Plant Cell 16: 1419-1432

Schiigger H, van Jagow G (1987) Tricine-sodium dodecyl sulfate-polyacrylamide gel
electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal
Biochem 166: 368-379

Sheen J, Zhou L, Jang J (1999) Sugars as signaling molecules. Curr Opin Plant Biol 2:
410-419

Shibata M, Katoh H, Sonoda M, Ohkawa H, Shimoyama M, Fukuzawa H, Kaplan

A, Ogawa T (2002) Genes essential to sodium-dependent bicarbonate transport in
cyanobacteria. J Biol Chem 277: 18658-18664

291

Shibata M, Ohkawa H, Kaneko T, Fukuzawa H, Tabata S, Kaplan A, Ogawa T
(2001) Distinct constitutive and low-CO2-induced CO2 uptake systems in
cyanobacteria: genes involved in and their phylogenetic relationship with
homologous genes in other organisms. Proc Natl Acad Sci USA 98: 11789-11794

Shintani D, Cheng Z, DellaPenna D (2002) The role of 2-methyl-6-phytyl-
benzoquinone methyltransferase in determining tocopherol composition in
Synechocystis sp. PCC 6803. FEBS Lett 511: 1-5

Shintani D, DellaPenna D (1998) Elevating the vitamin E content of plants through
metabolic engineering. Science 282: 2098-2100

Singh AK, Sherman LA (2005) Pleiotropic effect of a histidine kinase on carbohydrate
metabolism in Synechocystis sp. strain PCC 6803 and its requirement for
heterotrophic growth. J Bacteriol 187: 2368-2376

Stanier RY, Kunisawa R, Mandel M, Cohen-Bazire G (1971) Purification and
properties of unicellular blue-green algae (order Chroococcales). Bacteriol Rev 35:
171-205

Threlfal] DR, Whistance GR (1971) Biosynthesis of isoprenoid quinones and
chromanols. In TW Goodwin, ed, Aspects of Terpenoid Chemistry and Biochemistry.
Academic Press, London, pp 357-404

Trebst A, Depka B, Hiillander-Czytko H (2002) A specific role for tocopherol and of
chemical singlet oxygen quenchers in the maintenance of photosystem 11 structure
and function in Chlamydomonas reinhardtii. FEBS Lett 516: 156-160

Ushimaru T, Nishiyama Y, Hayashi H, Murata N (2002) No coordinated
transcriptional regulation of the sod-kat antioxidative system in Synechocystis sp.
PCC 6803. J Plant Physiol 159: 805-807

Wang HL, Postier BL, Burnap RL (2004) Alterations in global patterns of gene

expression in Synechocystis sp. PCC 6803 in response to inorganic carbon limitation
and the inactivation of nth, a LysR family regulator. J Biol Chem 279: 5739-5751

Wang X, Quinn PJ (2000) The location and function of vitamin E in membranes
(review). Mol Membr Biol 17: 143-156

Williams JGK (1988) Construction of specific mutations in photosystem-II

photosynthetic reaction center by genetic engineering methods in Synechocystis
6803. Methods Enzymol 167: 766-778

292

Yamaguchi J, Iwamoto T, Kida S, Masushige S, Yamada K, Esashi T (2001)
Tocopherol-associated protein is a ligand-dependent transcriptional activator.
Biochem Biophys Res Commun 285: 295-299

Zhao J, Brand JJ (1989) Specific bleaching of phycobiliproteins from cyanobacteria
and red algae at high temperature in vivo. Arch Microbiol 152: 447-452

Zhou L, Jang JC, Jones T, Sheen J (1998) Glucose and ethylene signal transduction

crosstalk revealed by an Arabidopsis glucose-insensitive mutant. Proc Natl Acad Sci
USA 95: 10294-10299

293

FIGURES AND TABLES

Table A3.]. Tocopherol Content of Wild Type and Newly Isolated Tocopherol Mutants.

 

o .92 .02 d.z d.z .o.z Smut:
mm 2. a mdm .o.z no a 3 to H No 3 H NR 058%
3 an .92 an .02 .02 883m
2: am a new .o.z I ...+. 3.. od H _d as a... new 8.: 25>

L... .. m8 3%

 

c\e .20... _Eocaoghé Peacock-» _Eozaooofin _ocecaoucohé

 

25:50 3.9188.

 

.mEmUmEU woZ ..D.Z Asses
mm oak 2:5 2 @2228 832me one 83.? Ax; EoEmSmmoE Ewes m :0 women 9m 8:73 of £653 .8
mecca? cow Eooxm .mEoEEammmE EmacmdoUE oEE 3?: “a .5» 3m pcm rummage 2m c265 $2? =<

294

Table A3.2. Oxygen Evolution Activities of Wild Type and the Tocopherol Mutants Grown
Under Photoautotrophic and Photomixotrophic Conditions for 24 h at 3% CO; (v/v), 50
pmol Photons m'zs'1, 32°C in B-HEPES Medium.

All values shown are averages and SES for at least four independent
measurements. N.D., Not detectable.

 

02 Evolution

 

Photoautotrophic Photomixotrophic
Conditions Conditions

 

I‘M 02 if, 007301 nm

Wild type 875 i 146 1,096 i 12
slr0089‘ 1,158 i 129 ND.
SII04l8_ 1,027 i 80 ND.
slrl736" 1,065 i 45 ND.

 

295

Table A3.3. Relative Sugar Content of the Wild Type and slr1 736 and pmgA Mutants.

Cells were grown in the absence and in the presence of Glc for 24 h
at 3% CO2 (WV), 50 nmol photons m‘2 s", 32°C in B-HEPES medium.
Equal cell numbers were used for the sugar analysis as described in
”Materials and Methods.” All values shown are averages of three
independent measurements and are expressed as relative to the average
value obtained for the wild type under photoautotrophic conditions.

 

 

Photoautotrophic Photomixotrophic
Conditions Conditions
Wild type 1.00 : 0.0761 2.23 i 0.342
slrl736" 1.60 i 0.134 5.07 :t 0.168
pmgA’ 2.18 i 0.465 4.34 i 0.189

 

296

HO-.’CH200COOH

 

4-Hydroxyphenylpyruvate
HPPD (Slr0090) l
H
OH O
CHzCOOH 0
HPT (Slr1736) L
0 H3O PW
Homogentisic acid OH
OH MPBQ 2-methyl-6-phytyl-1 ,4-benzoquinol

methyltransfeV W151” 737)
(SlIO418)
OH HO
o
H
0 ° 3

H3C PW CH;
CH 5-tooopherol
2.3—dimethyI-6-phytyl-1 ,4-benzoquinol
y-TMT (surooes)
TC (Slr1737)
CH3
HO HO
O H O H
CH3 CH3
y-tooopherol B‘t°°°ph°'°'
TMT surooaa
r- ( 1 CH3
HO
O .
H30 0 3
CH3 a-tOOOpl'lOl’Ol

Figure A3.1. Biosynthetic pathway for a-tocopherol in Synechocystis sp. PCC 6803.

HPPD, 4-hydroxyphenylpyruvate dioxygenase; HPT, homogentisate phytyltransferase; MPBQ
MT, 2-methyl-6-phytyl-l,4-benzoquinone methyltransferase; TC, tocopherol cyclase; y-TMT,
y-tocopherol methyltransferase.

297

(kbp) (kbp) (W)

2.3
2.5

2.7

 

       

 

 

 

Time(h)
C I D t
I 11
1— -1
I 7.
- 5..
6- 5..
5.
4- 5 ‘-
8 3- g 3‘
d‘ o
O 2. O 2-
0'1? 0.1—-
a: 7:
5- 811-1IlllllllllIllllllT'llI'll'l
0 10 20 30 40 5O 0 10 20 30 40 50
Time (h) Time (11)

Figure A3.2. Isolation and growth characterization of tocopherol mutants.

A, PCR analysis of the genomic DNA extracted from newly isolated tocopherol mutants selected
in the absence of Glc. Lanes 1 and 2 in each image show PCR products amplified from the
wild-type and mutant genomic DNA templates, respectively. The DNA fragments amplified from
the mutant templates using Oligonucleotide primers to slr0089 (a), s11041 8 (b), and slr1736 (c)
loci (see "Materials and Methods") are 1.3 kb longer than those from the wild-type template
because of the insertion of the aphII cassette encoding resistance to kanamycin. B, Growth curves
of the wild type and tocopherol mutants at 50 ,umol photons rn‘2 5‘1 under photoautotrophic
conditions. C and D, Grth curves of the wild type and tocopherol mutants at 50 nmol photons
rn‘2 s"l under photomixotrophic conditions. Black circles indicate the wild-type strain; white
squares, triangles, and circles indicate the authentic slr1736, s11041 8, and slr0089 mutant strains,
respectively. The data shown for each strain are averages of three independent cultures; SE bars
are shown.

298

 

Figure A3.3. Thin-section electron micrographs of Synechocystis sp. PCC 6803 strains.

A, Synechocystis sp. PCC 6803 wild type. B, slr1736 mutant grown under photoautotrophic
conditions. C, Wild type. D, slr1736 mutant grown under photomixotrophic conditions for 24 h.
Letters C, P, and g indicate carboxysomes, poly—B-hydroxybutyrate, and glycogen granules,
respectively. Cells were grown in B-HEPES40 medium, pH 7.0, at 1% (v/v) CO2 and 50 pmol

photons m' 2 s‘ '.

299

E 2::

 

 

 

0

O
m
m

 

 

emu Km 5

 

ililllllt

 

 

_1111’3372

82s» 23% 88% ts 82% 28% 88% ts
ozaoaoxEBoga 25985885.

 

 

<

Figure A3.4. Glc sensitivity in the tocopherol mutants is independent of light levels and is

not likely to be due to elevated oxidative stress.

300

Figure A3.4. (continued)

A, Immunoblotting analysis for the PsbA (D1) and Pst proteins. B, Time-course RT-PCR
analysis of the sodB transcript in whole cells of wild type and tocopherol mutants grown under
photoautotrophic (0 h) and photomixotrophic (4—24 h) conditions at 32°C, 50 pmol photons rn‘2 s
", with 3% (v/v) CO2. C and D, Growth curves under photomixotrophic conditions (C) under
high light (300 ,umol photons m’2 s“) and (D) low light conditions (approximately 5 nmol
photons m“2 s"). Black and white symbols indicate the wild type and the slr1736 mutant,
respectively. Proteins from equal amounts of cells (10 pL of cell suspension with OD73o mm = 100)
were loaded for each lane (A). Equal amounts of RNA were used as templates for RT-PCR (B).
RT-PCR amplification of the housekeeping ran RNA was used as the positive control. PCR
amplification of the mp3 transcripts without the reverse transcription step did not result in
product formation (data not shown).

301

A WT s_lr1736 sllO418 slr0089
pH 8.0 7.8 7.2 7.0 6.8 8.0 7.6 7.2 7.0 6.8 8.0 7.2 7.0 8.0 7.2 7.0

*0

  

    

    

 

 

 

 

 

'1?

g 1500 -
d‘
O
5

5 1000-
3
E
:L

m .1

0 ‘—E l U I l 1 I
6.8 7 72 7.4 7.6 8
pH

Figure A3.5. pH-dependent Glc-sensitive phenotype of the tocopherol mutants.

A, Cultures of the indicated strains were grown under photoautotrophic and photomixotrophic
conditions at 1% C02 (v/v), 50 ,umol photons 111‘2 s", 32°C in B-HEPES40 medium (see
"Materials and Methods"). B, PSH-dependent oxygen evolution rates in the wild-type (black
symbols) and slr1736 mutant (white symbols) cells grown under photoautotrophic (circles) and
photomixotrophic (squares) conditions.

302

 

1.2“

0.8 ‘

0.4 a

Relative phycobiliprotein content

 

 

 

   

 

 

 

       

slr1 736 sII041 8 slr0089

Figure A3.6. PBP content in the wild type and tocopherol mutants.

The wild type and slr1736, 511041 8, and slr0089 mutants were grown for 24 h under
photoautotrophic (black columns) and photomixotrophic (white colunms) conditions at 1% (v/v)
CO2, 32°C, pH 7.0, and 50 nmol photons rn'2 s". The data shown for each strain are averages of
six independent measurements; SE bars are shown.

303

A WT slr1736
T1me(h)o 4 8 24 o 4 8 24

cpcA
anA
spr

 

 

T1me(h) o 4

co
'3!
O
&
O
’3:

saw —

.190 m 1...... m Time—come

.- E 33:13:: “W “M’s“ °‘ ”W“

9 genes in the wild type and
Cells were grown under
and photomixotrophic conditions

32°C, pH 7.0, and 50 nmol
photons m‘2 5".

“me 0!) o 4
rbcL

on
N
A
O
&
on
N
h

ccmk1

ccmL

nth4

 

D
Time (h) o 4

nth3

nth - - - -
sbtA

O
N
b
O
A
O
M
A

 

Tlme(h) o 4 a

N
A
O
b
on
N
A

l

mp8

304

 

 

9
"3
8
31
‘2’
8i:
‘3
O
S
P
-8
l-
l-
~81:
" 3
- 2
b
o
~$g
- l-
h
—8

 

 

r'IIIIII F
“0075050“ F) N

O
'TiTVIVVV'UITIV
P
O

< “Woo

Figure A3.8. Growth analysis of the pmgA mutant.

Growth curves (A) determined under photoautotrophic conditions at pH 7 .0 and (B) under
photomixotrophic conditions at pH 7.0 (black symbols with solid lines) and pH 8.0 (white
symbols with dotted lines) are shown. Squares, circles, and triangles represent the wild type,
slrl 736, and pmgA mutants, respectively. The growth curves recorded at pH 8.0 in the absence of
Glc coincided with those at pH 7.0 (data not shown). Cells were grown in B-HEPES4O medium,
pH 7.0, 1% (v/v) CO2, 32° C, 50 pmol photons m' 2 s' ', at 32° C. The data shown for each
strain are averages of three independent cultures; SE bars are shown.

305

 

lfiljljijlllljjfllll