r a... IV‘IIL‘ Awflfll'wfiflf

 

A”, "I

\Ermiv 54h

 

 

P
a;

.
y

k

[Rm

2825 . -‘
‘§)£

I
a}?

1“}? 1:4

\mufl. -’

 

\3
3
'\

~k

«E

This is to certify that the
dissertation entitled

THE ROLE OF SPROUTY-2 IN THE MALIGNANT
TRANSFORMATION OF HUMAN FIBROBLASTS BY HRAS
ONCOGENE

presented by

Piro Lito

has been accepted towards fulfillment
of the requirements for the

PhD degree in Biochemistry and Molecular

 

 

Biology
7
\Xmlé ~~ /Z((/{1\;/{M

Major Professor’ 3 Signature
§ / 8’ /04.

Date

 

MSU is an Affirmative Action/Equal Opportunity Institution

 

 

 

 

LIBRARY

Michigan State

University

 

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE

DATE DUE

DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

6/07 p:/C|RC/DaleDue.indd-p.1

THE ROLE OF SPROUTY-Z IN THE MALIGNANT TRANSFORMATION OF
HUMAN FIBROBLASTS BY HRAS ONCOGENE

By

Piro Lito

A DISSERTATION

Submitted to
Michigan State Univerisity
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Biochemistry and Molecular Biology

2006

Abstract

THE ROLE OF SPROUTY-2 IN THE MALIGNANT TRANSFORMATION OF
HUMAN FIBROBLASTS BY HRAS ONCOGENE

By

Piro Lito

Sprouty-2 (Spry2) plays a regulatory role in the signaling pathways induced by a
number of growth factor receptors. One aspect of the function of Spry2 is to
prevent the c-Cbl-induced degradation of epidermal growth factor receptor
(EGFR). I found that a human fibroblast cell strain, malignantly transformed by
HRasWZ, exhibited an increase in the expression of Spry2, compared to its
parental cell strain. This correlated with an increase in the level of EGFR protein
in HRas-transformed cells compared to their parental cells. EGFR activity was
required if HRas-transformed cells were to exhibit growth factor independence.
To determine whether Spry2 plays a role in HRas-transformation, l down-
regulated the expression of Spry2 using Spry2-specific shRNA. The cell strains
with down-regulated Spry2 exhibited not only decreased levels of EGFR, but also
decreased levels of ERK activation. I also demonstrated that HRas and Spry2
interact in HRas-transformed fibroblasts, and that HRas interacts with c-Cbl and
CIN85 in a Spry2-dependent fashion, suggesting that HRas regulates the
turnover of EGFR through Spry2. HRas-transformed cells with down-regulated
levels of Spry2 failed to form tumors when injected into athymic mice. Expression

V12

of Spry2 in immortalized human fibroblasts independently of HRas , was not

sufficient to induce the malignant transformation of these cells, suggesting that

 

the role of Spry2 in cancer formation is dependent on HRas oncogene. Ras is
reported to reduce the sensitivity of cells to DNA damage-induced apoptosis. In
the HRas-transformed cell strain that expresses high levels of Spry2, the ability
of HRas to prevent UV-induced apoptosis was dependent on intact Pl3K- and
Rac1-activity. By comparing HRas-transformed cells with endogenous levels of
Spry2 to HRas-transformed cells with down-regulated Spry2, I found that Spry2
sustained the activation of PI3K and Akt. Furthermore, I demonstrated that Spry2
sustained the activation of Rac1 by HRas, in part by modulating the interaction
between HRas and Tiam1, a GDP-releasing factor for R301. Consistent with
these findings, the down-regulation of Spry2 in HRas-transformed cells resulted
in increased levels of UV-induced apoptosis. The down-regulation of Spry2, also,
resulted in an increase in the level of p53, paralleled by a decrease in the level of
MDM2 phosphorylated at Ser166, an Akt specific site. Expression of Spry2 in
immortalized human fibroblasts resulted in a decrease in the level of UV-induced
apoptosis, and in a decrease in the level of p53 protein. Taken together these
results indicate that Spry2 facilitates the regulation of EGFR by HRas, and is
necessary for the malignant transformation of human fibroblasts by HRas
oncogene. The data also suggest that Spry2 is an important mediator of survival
signals in HRas-transformed cells, because it inhibits DNA-damage induced-

apoptosis through the regulation of the p53/MDM2 pathway.

Dedicated to Alex, Zana and Melina

“Science and everyday life cannot and should not be separated. Science, for me,
gives a partial explanation to life. In so far as it goes, it is based on fact,
experience and experiment”. Rosalind Franklin, in a letter to her father, 1940

Acknowledgements

I wish to thank Dr. Justin McCormick, my thesis advisor, and Dr. Veronica Maher,
the co-director of the Carcinogenesis Laboratory, for their constant support and
guidance. I will never forget their passion for research, their endurance and
perseverance in addressing scientific questions, as well as their readiness to
help others overcome their problems. In addition, I have benefited greatly by the
experience and dedication that they bring to the Medical Scientist Training

Program.

I wish to thank the members of my guidance committee, Dr. Kathleen Gallo, Dr.
William Henry and Dr. Donald Jump, for their advice through the years. I would
like to particularly thank Dr. Henry, who has been a source of support and advice

for me since the days of undergraduate biochemistry classes.

I sincerely thank past and current members of the Carcinogenesis Laboratory for
their assistance: Dr. Michele Battle, Dr. Zhenjun Lou, Dr. ZiQiang Li, Dr. Jackie
Dao, Terry McManus, Yun Wang, Dr. Igor Zlatkin, Clarissa Dallas, Jessica
Apostol, Jie Zhang, Rick Tobby, Suzanne Kohler, Bethany Heinlen and Katherine
Bergdol. I thank Dr. Susanne Kleff for her help in getting this project started, Dr.
Sandra O’Reilly for her help with the tumor studies, and Dr. Katheryn Meek for
her advice on my work and manuscript preparation. I thank Dr. Kristin McNally

and Dan Appledom for their friendship and helpful scientific discussions. I will not

 

forget our escapes form the lab and our adventures in East Lansing. I would also
like to thank the various undergraduate students that have helped me with my
dissertation research. In particular, I would like to acknowledge Bryan Mets for
his dedication, determination and hard work. He has been very important to my

research and I sincerely hope that Bryan pursues a career in science.

I thank my parents from the bottom of my heart. Their experiences in life so far
have taught me that nothing is out of reach. If anything that I do in life has value,
it is because of them. I thank my sister for being the happy person that she is,
and for making me smile in times of stress. Finally, I thank my grandparents for

inspiring in me the love of research and medicine.

vi

TABLE OF CONTENTS

LIST OF FIGURES .............................................................................................. x
LIST OF TABLES .............................................................................................. xii
ABBREVIATIONS ............................................................................................ xiii
INTRODUCTION .................................................................................................. 1
REFERENCES ...................................................................................................... 7
CHAPTER I: REVIEW OF LITERATURE .......................................................... 10
CANCER AS A GENETIC DISORDER ....................................................................... 1O
Cancer-related genes .................................................................................. 10
Characteristics of cancer cells ..................................................................... 14
Uncontrolled proliferation ......................................................................... 15
Aberrant cell cycle regulation ................................................................... 19
Limitless replication potential .................................................................... 23
Evasion of apoptosis ................................................................................ 24
Inefficient DNA repair mechanisms .......................................................... 27
Genetic instability ..................................................................................... 29
Angiogenesis ............................................................................................ 3O
Invasion and metastasis ........................................................................... 32
MSU-1 LINEAGE AS MODEL SYSTEM TO STUDY MALIGNANT TRANSFORMATION ........ 34
RAS GTPASE .................................................................................................... 44
Catalytic function ......................................................................................... 45
Regulation of Ras activity ............................................................................ 46
GEFS and activation of Ras ...................................................................... 49
GAPS and inactivation of Ras ................................................................... 51
Posttranslational regulation ...................................................................... 51

Res Effectors ............................................................................................... 52
Ref ............................................................................................................ 53

PI3K ......................................................................................................... 57
Tiam1 ....................................................................................................... 59
RaIGEFs ................................................................................................... 60
MEKK1 ..................................................................................................... 61

Rin1 .......................................................................................................... 61

AF-6 ......................................................................................................... 62
RASSF ..................................................................................................... 62
Cellular functions mediated by Ras ............................................................. 62
Regulation of cell cycle and proliferation .................................................. 62
Regulation of protein synthesis ................................................................ 64
Regulation of apoptosis ............................................................................ 65
Regulation of the actin cytoskeleton ......................................................... 66
Regulation of cellular migration ................................................................ 67
Regulation of invasion and metastasis ..................................................... 68
SPROUTY .......................................................................................................... 69
Sprouty structure ......................................................................................... 70

vii

Sprouty expression ...................................................................................... 74

Sprouty localization ...................................................................................... 76
Regulation of Sprouty .................................................................................. 78
Phosphorylation of the N-terminus of Sprouty .......................................... 78
Sprouty-2 kinase ...................................................................................... 81
Sprouty-2 phosphatase ............................................................................ 81
Sprouty-2 ubiquitination ............................................................................ 82
Phosphorylation of the C-terminus of Sprouty-2 ....................................... 83
Cellular functions of Sprouty ........................................................................ 84
Inhibition of receptor tyrosine kinase signaling ......................................... 84
Activation of epidermal growth factor receptor signaling .......................... 90
Regulation of integrin-mediated cell spreading by Sprouty-4 ................... 94
Regulation of cell migration by Sprouty .................................................... 94
Sprouty deficient mice ............................................................................. 95
Sprouty-1" ............................................................................................ 95
Sprouty-2" ............................................................................................ 96
Sprouty proteins in cancer ........................................................................ 98
REFERENCES .................................................................................................. 101
CHAPTER II. SPROUTY 2 IS NECESSARY FOR TUMOR FORMATION BY
HRAS ONCOGENE-TRANSFORMED HUMAN FIBROBLASTS ................... 134
ABSTRACT ...................................................................................................... 1 35
INTRODUCTION ................................................................................................ 1 36
RESULTS ........................................................................................................ 1 38
Determination of the Expression of Spry2 in HRas-transformed Cells. ..... 138
Effect of Spry2 on Tumor Formation by HRas-transformed Cells. ............. 141
Effect of HRas-transformation on the Level of E GFR protein. ................... 145
Effect of Depletion of Spry2 Protein on the Level of EGFR. ...................... 149
Interaction of Spry2 with HRas. ................................................................. 152

Interaction of HRas with c-Cbl and CIN85 in a Spry2-dependent Fashion. 155
Interaction of HRas with c-Cbl and CIN85 in a Spry2-dependent Fashion. 155

Effect of Spry2 Expression in Immortalized Human Fibroblasts. ............... 155
DISCUSSION .................................................................................................... 161
MATERIALS AND METHODS ............................................................................... 164

Cells and Cell Culture. ............................................................................... 164

Northern Blot Analysis. .............................................................................. 164

Western Blot Analysis. ............................................................................... 164

Preparation of Spry2-shRNA Constructs. .................................................. 165

Stable Infection. ......................................................................................... 166

AG1478 Inhibitor Study .............................................................................. 167

lmmunoprecipitation Reactions. ................................................................ 167

Anchorage independence assay. .............................................................. 167

Tumorigenicity Assay ................................................................................. 168

Ras Activation Assay. ................................................................................ 168
ACKNOWLEDGEMENTS ..................................................................................... 1 69
REFERENCES .................................................................................................. 1 70

viii

CHAPTER III: SPROUTY-2 PREVENTS APOPTOSIS IN HRAS-

TRANSFORMED HUMAN FIBROBLASTS ..................................................... 174
ABSTRACT ...................................................................................................... 175
INTRODUCTION ................................................................................................ 1 76
RESULTS ........................................................................................................ 1 79

Effect of HRas oncogene-transformation on DNA-damage induced apoptosis
.................................................................................................................. 1 79
Effect of Spry2 on the activation of the PI3K pathway in HRas-transformed
cells ........................................................................................................... 183
Effect of Spry2 on the activation of Rac1 in HRas-transformed cells ......... 186
Effect of Spry2 on the induction of apoptosis in response to DNA-damage190
Effect of Spry2 on the MDM2/p53 pathway ............................................... 193
DISCUSSION .................................................................................................... 197
MATERIAL AND METHODS ................................................................................. 200
Cells and Cell Culture. ............................................................................... 200
Apoptosis assay ........................................................................................ 200
Western blotting ......................................................................................... 201
Rac1 activation .......................................................................................... 201
Staining for stress fibers ............................................................................ 202
lmmunoprecipitation Reactions. ................................................................ 202
REFERENCES .................................................................................................. 203

APPENDIX A: ANALYSIS OF EXPRESSIONAL CHANGES BETWEEN MSU-

1.0, MSU-1.1 AND PH3MT CELLS ................................................................. 208
INTRODUCTION ................................................................................................ 209
RESULTS ........................................................................................................ 212

Comparison of the RNA expression profiles of MSU 1.0, MSU 1.1 and
PH3MT cells .............................................................................................. 212
Northern blot analysis and confirmation of the gene chip data .................. 219
DISCUSSION .................................................................................................... 226
MATERIALS AND METHODS ............................................................................... 229
Total RNA extraction .................................................................................. 229
Gene Chip Analysis ................................................................................... 229
Data analysis ............................................................................................. 230
REFERENCES .................................................................................................. 232

APPENDIX B: THE ROLE OF SPROUTY-2 IN THE MALIGNANT PHENOTYPE

OF PATIENT DERIVED FIBROSARCOMA CELL LINES ............................... 234
INTRODUCTION ................................................................................................ 235
RESULTS ........................................................................................................ 236

The role of Spry2 in the malignant phenotype of patient derived fibrosarcoma
cell lines ..................................................................................................... 236
Effect of Spry2 on E GF-induced cell cycle progression ............................. 241
DISCUSSION .................................................................................................... 243
MATERIAL AND METHODS ................................................................................. 246
Cell cycle analysis ..................................................................................... 246

List of Figures

Chapter I

Figure 1. MSU 1 lineage of human fibroblasts ................................................... 35
Figure 2. MSU 1 lineage as a tool to study malignant transformation ................ 39
Figure 3. Res GTPase as molecular switch ....................................................... 47
Figure 4. Res effector pathways ......................................................................... 54
Figure 5. Structure of Spry2 ............................................................................... 71
Figure 6. Regulation of RTK signaling by Spry ................................................... 85
Chapter II

Figure 1. Expression profile of Spry2 in RaS-transtormed cells and in patient
derived cancer cells. ......................................................................................... 139
Figure 2. Effect of Spry2 on the anchorage independent growth of HRas-
transforrned fibroblasts ...................................................................................... 142
Figure 3. Effect of HRas-transformation on the level of EGFR .......................... 147
Figure 4. Effect of Spry2 depletion on the level of EGFR in HRas-transformed
cells ................................................................................................................... 150

Figure 5. Interaction of HRas with Spry2 and Spry2 binding-partners c-Cbl and

CIN85 ................................................................................................................ 153
Figure 6. Effect of Spry2 expression in immortalized human fibroblasts ........... 156
Chapter III

Figure 1. Effect of HRas-transformation on UV-induced apoptosis .................. 180

Figure 2. Effect of Spry2 on PI3K signaling in HRas-transformed cells ............ 184

Figure 3. Effect of Spry2 on the activation Rac1 in HRas-transformed cells ....187

Figure 4. Effect of Spr2 on UV-induced apoptosis ........................................... 191
Figure 5. Effect of Spry2 on the MDM2/p53 pathway ....................................... 194
Appendix A

Figure 1. Gene Chip comparison of MSU1.1 and PH3MT cells to MSU-1.0 cells 213
Figure 2. K-means clustering ............................................................................ 217
Figure 3. Northern analysis that validates the gene chip data for Spry2, on, fib5

and s.jag1 ........................................................................................................ 224

Appendix B

Figure 1. Down regulation of Spry2 in fibrosarcomas with wild type Ras or
NRasQ59 expression ......................................................................................... 237
Figure 2. Down regulation of Spry2 in VleFT cells delays progression through

the cell cycle ..................................................................................................... 244

xi

List of Tables

Chapter II

Table l Tumorigenicity of the cell strains with down-regulated Spry2 ............... 146
Table II Tumorigenicity of the cell strains expressing Spry2 ............................ 160
Appendix A

Table I Grouping of differentially expressed genes according to their function .220

Appendix B

Table | Tumorigenicity of HT1080 cell lines with down-regulated Spry2 .......... 240

Table II Tumorigenicity of VleFT cell lines with down-regulated Spry2 ........... 242

xii

Abbreviations

Rb ................................................................................................. Retinoblastoma
APC ............................................................................ Adanomatus Polyposis Coli
EGF ................................................................................ Epidermal Growth Factor
PDGF .................................................................... Platelet-derived Growth Factor
EGFR ............................................................................................... EGF-receptor
PDGFR .......................................................................................... PDGF-receptor
RTK ............................................................................. Receptor Tyrosine Kinases
SOS ........................................................................................... Son of Sevenless
GTP ........................................ , ........................................... Guanine Triphosphate
GDP .................................................................................... Guanine Diphosphate
ERK ............................................................ Extracellular signal-Regulated Kinase
TGFoc ...................................................................... Transforming Growth Factor a
NFKB ........................................................................... Nuclear Factor kappa Beta
STAT ................................................ Signal Transducer Activator of Transcription
elF .............................................................................................. Elongation Factor
CDK ............................................................................ Cyclin Ddependent Kinase
ATM ........................................................................... Ataxia telangectasla mutant
MDM2 ............................................................................... Murine double mutant-2
ALT ............................................................... Alternative lengthening of telomeres
TNF ..................................................................................... Tumor necrosis facotr
IAP ......................................................................... Inhibitor of Apoptosis Proteins
XP ................................................................................. Xeroderma Pigmentosum

xiii

VEGF ............................................................... Vascular endothelial growth factor

HIF1 ............................................................................. Hypoxia inducible factor-1
vHL ........................................................................................... Von-Hippel Lindau
FAK .................................................................................... Focal adhesion kinase
ECM ........................................................................................ Extracellular Matrix
MMP .................................................................................. Matrix Metalloprotease
BPDE ...................................................................... Benzo-A-pyrene—diol-epoxide
ENU ......................................................................................... Ethyl-nitrosourea a
HGF ............................................................................... Hepatocyte growth factor
GEF ............................................................. Guanine nucleotide exchange factors
GDI ......................................................... Guanine nucleotide dissociation inhibitor
GAP ............................................................................ GTPase activating proteins
DH .................................................................................................... Dbl homology
PH .......................................................................................... Pleckstrin homology
IGFR ....................................................................... Insulin growth factor receptor
PIP ...................................................................... Phosphatidyl inositol phosphate
RBD ...................................................................................... Ras binding domain
RA ................................................................................................ Ras association
CR .............................................................................................. conserved region
MAPK ................................................................. mitogen-activated protein kinase
MAPKK ................................................... mitogen-activated protein kinase Kinase
MAPKKK .................................... mitogen-activated protein kinase Kinase Kinase
PI3K ...................................................................... Phosphatidyl inositol-3-kinase

xiv

mTOR ............................................................ Mammalian inhibitior of rapamyocin

Spry ........................................................................................................... Sprouty
SH2 ............................................................................................... Src homology-2
SH3 ............................................................................................... Src homology-3
WT1 ............................................................................................... Wilm’s tumor-1
FGF ................................................................................ Fibroblasts growth factor
NGF ....................................................................................... Nerve growth factor
PTP1 B ................................................................ Protien tyrosine phosphatase-1 B
GDNF ...................................................................................... Glial derived growth factor

XV

Introduction

Cancer is a genetic disorder that results from the accumulation of genetic and/or
epigenetic changes. Such changes uncouple cellular functions form their
regulatory mechanisms, and lead to the emergence of a population of cells that
has acquired the necessary characteristics to form a cancer. Although distinct
types of cancers exhibit specific characteristics, there are several traits that are
commonly observed in various types of cancers. These traits include uncontrolled
proliferation, deregulated cell cycle, limitless replicative potential, evasion of
apoptosis, inefficient DNA repair mechanisms, genetic instability, angiogenesis

and invasion and metastasis [1].

As cancer results from Changes at the genomic level, a great effort has been
placed to determine which genes play a role in cancer formation. In a broad
sense, cancer-related genes are classified as oncogenes and tumor suppressor
genes, which are altered through gain-of-function or loss-of-function genetic
events, respectively [2-4]. These events include mutations, epigenetic regulation,

chromosomal translocations and expressional changes [5].

The process of carcinogenesis progresses through distinct intermediate clonal
populations of cels, which may have accumulated some of the characteristics of
cancer cells, even though such populations of cells are not malignant. The

isolation of such intermediate populations from human tumors in vivo has been

successful for colorectal cancer [6], but has proven difficult other types of cancer.
To overcome this problem, a number of systems have been generated in order to
mimic the process of cancer formation. One such system is the MSU-1 lineage of
human fibroblasts [7, 8]. This system consists of isogenic cell strains, which have
acquired specific genetic changes in a sequential order, and display a
progressive accumulation of traits related to cancer. This lineage originates form
a normal fibroblast cell line, and culminates in a cell strain capable of forming
tumors in athymic mice. Within these extremes, there are a series of isogenic cell
strains with an intermediate status. These characteristics make this lineage an
efficient model system to the study genetic elements that play a role at the

various stages of carcinogenesis.

The Ras GTPase binds to and hydrolyzes GTP to GDP. Ras functions as a
critical molecular switch that regulates a number of cellular signaling pathways
important for cellular proliferation, survival, and organization of the actin
cytoskeleton [9, 10]. Binding to GTP induces a conformational change within Ras
that results in Ras activation [11, 12]. Active Ras binds to, and activates a number
of effector proteins, including Raf, PI3K and Ral. When GTP is dissociated to
GDP, Ras assumes an inactive conformation. This results in the dissociation of
effector proteins from Ras and the activation of effector-mediated pathways by
Ras is attenuated. Ras, a proto-oncogene, is activated to its oncogenic form in
approximately 30% of human tumors [13]. The oncogenic activation of Ras is the

result of mutations in several codons, including codons 12 and 59. These

P

mutations abrogate the ability of Ras to hydrolyze GTP, stabilizing the active
conformation of Res [14]. The role of Ras oncogenes in cancer formation is
mediated by the same effectors that mediate the effect of Ras proto-oncogenes
under normal cellular conditions (i.e. Raf, Pl3K, Ral etc.) [15-17]. The difference
with oncogenic Ras, however, is that the activation of effector pathways by Ras is
constitutive, resulting in unrestrained proliferation and in the inactivation of

apoptotic programs.

Sprouty (Spry) was identified in Drosophila melanogaster, as an inhibitor of
receptor tyrosine kinase (RTK) signaling [18-20]. This function of Spry is
important for normal development of several organs including the tracheal system
and the eye. Mammalian cells express four Spry proteins, which, like the

Drosophila homolog, retain the ability to suppress RTK signaling [18].

The expression of Spry is prominent in locations where fibroblast growth factor
(FGF) and epidermal growth factor (EGF) are prominent. In mammals, Spry acts
in a negative feedback fashion to repress signaling form these growth factors.
This function of Spry is important in several developmental processes including

the development of the kidney, the vestibular apparatus and the bone [21-23].

In Drosophila Spry is a general inhibitor of RTK signaling [19]. In mammalian

cells, however, Spry proteins, particularly Spry2, sustain RTK signaling induced

by EGF [24—26]. The cellular functions that are mediated by this ability of Spry

remain uncharacterized.

Spry proteins may play a role in cancer formation, as several recent studies found
that the expression of Spry proteins is altered in some types of cancer. Spry1 and
Spry2 are expressed at lower levels in breast and pancreatic tumors [27, 28].
Moreover, Spry2 suppresses tumor formation upon expression in breast cancer
cells [29]. This ability is consistent with the function of Spry as an inhibitor of RTK
signaling. Spry2 is also expressed at higher levels in melanomas [30, 31].
Although this finding correlates with the ability of Spry2 to sustain epidermal
growth factor receptor Signaling, the role of Spry2 in the formation of these tumors

remains unknown.

The interest of our laboratory in the study of Spry was sparked by a gene
expression analysis comparing the expression profiles of cells in the MSU 1
lineage. In particular, this study compared the expression profiles of MSU-1.0, an
immortalized diploid human fibroblast cell strain, MSU-1.1, a cell strain derived
from MSU-1.0 cells, and PH3MT, a tumor derived cell strain originating from the
malignant transformation of MSU-1.1 cell with the HRasV’z-oncogene. Spry2 was
identified as one of the genes that were increased in expression in MSU—1.1 and
PH3MT cells, when compared to MSU-1.0 cells. This finding led to the hypothesis
that Spry2 promotes tumor formation in HRas-transformed cells, the proof of

which is the scope of this dissertation.

Chapter I will provide a broad review of the literature in the field of cancer
research, then proceed with more depth to the review of the function of Res, and
finally address in detail the functions of Spry proteins, with an emphasis placed

on Spry2.

Chapter II will describe the role of Spry2 in the transformation of immortalized
human fibroblasts by oncogenic HRas. This study found that Spry2 is necessary
for the ability of HRas transformed fibroblasts to form tumors in athymic mice.
Furthermore, this study demonstrated that HRas interacts with Spry2 and two

Spry2-binding partners c-Cbl and CIN85.

Chapter III will describe the role of Spry2 in the ability of HRas to induce survival
pathways that desensitize human fibroblasts to DNA damage-induced apoptosis.
This study found that Spry2 is necessary to protect Res-transformed cells from
UV-induced apoptosis. In this context, Spry2 sustained the activation of enzymes
involved in survival pathways, including phosphatidyl inositol-3 kinase (Pl3K), Akt,
and Rac1, while maintaining a low level of the pro-apoptotic tumor suppressor

p53.

Appendix A will describe the gene expression study that compared the
expression profiles of MSU-1.0, MSU-1.1 and PH3MT cells. In addition to the

identification of Spry2 with a possible role in cancer formation, this study also

found a number of other genes differentially expressed between malignant and

pre-malignant cells.

Appendix B will describe research in progress to determine the role of Spry2 in
the ability of human patient-derived fibrosarcoma cell lines to form tumors in
athymic mice. Two cell lines, HT1080 and VIP:FT, which contain oncogenic
NRastg and wild type Ras respectively, express high levels of Spry2. This study
found that Spry2 contributes to the malignant phenotype of VleFT cells, and, at a
lesser extent, to the malignant phenotype of HT1080 cells, suggesting that Spry2

contributes to tumor formation in a context-specific fashion.

References

10.

11.

12.

13.

Hanahan, D. and Weinberg, RA, The hallmarks of cancer. Cell, 2000.
100(1): p. 57-70.

Ponder, B.A., Cancer genetics. Nature, 2001. 411(6835): p. 336-341.

Todd, R. and Wong, D.T., Oncogenes. Anticancer Res, 1999. 19(6A): p.
4729-4746.

Macleod, K., Tumor suppressor genes. Curr Opin Genet Dev, 2000. 10(1):
p. 81-93.

Macaluso, M., Paggi, MG. and Giordano, A., Genetic and epigenetic
alterations as hallmarks of the intricate road to cancer. Oncogene, 2003.
22(42): p. 6472-6478.

Kinzler, K.W. and Vogelstein, 3., Lessons from hereditary colorectal
cancer. Cell, 1996. 87(2): p. 159-170.

McCormick, J.J. and Maher, V.M., Analysis of the multistep process of
carcinogenesis using human fibroblasts. Risk Anal, 1994. 14(3): p. 257-
263.

McCormick, J.J., Fry, D.G., Hurlin, P.J., Morgan, TL, Wilson, D.M. and
Maher, V.M., Malignant transformation of human fibroblasts by oncogene
transfection or carcinogen treatment. Prog Clin Biol Res, 1990. 3400: p.
195-205.

Coleman, M.L., Marshall, OJ. and Olson, M.F., RAS and RHO GTPases in
G1-phase cell-cycle regulation. Nat Rev Mol Cell Biol, 2004. 5(5): p. 355-
366.

Downward, J., Targeting RAS signalling pathways in cancer therapy. Nat
Rev Cancer, 2003. 3(1): p. 11-22.

Colicelli, J., Human RAS superfamily proteins and related GTPases. Sci
STKE, 2004. 2004(250): p. RE13.

Milbum, M.V., Tong, L., deVos, A.M., Brunger, A., Yamaizumi, Z.,
Nishimura, S. and Kim, S.H., Molecular switch for signal transduction:
structural differences between active and inactive forms of protooncogenic
ras proteins. Science, 1990. 247(4945): p. 939-945.

803, J.L., ras oncogenes in human cancer: a review. Cancer Res, 1989.
49(17): p. 4682-4689.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

Bollag, G. and McCormick, F., Regulators and effectors of res proteins.
Annu Rev Cell Biol, 1991. 7: p. 601-632.

Repasky, G.A., Chenette, E.J. and Der, C.J., Renewing the conspiracy
theory debate: does Raf function alone to mediate Ras oncogenesis?
Trends Cell Biol, 2004. 14(11): p. 639-647.

Shields, J.M., Pruitt, K., McFall, A., Shaub, A. and Der, C.J.,
Understanding Ras: 'it ain't over til it's over'. Trends Cell Biol, 2000. 10(4):
p. 147-154.

Campbell, S.L., Khosravi-Far, R., Rossman, K.L., Clark, G.J. and Der,
C.J., Increasing complexity of Ras signaling. Oncogene, 1998. 17(11
Reviews): p. 1395-1413.

Casci, T., Vinos, J. and Freeman, M., Sprouty, an intracellular inhibitor of
Ras signaling. Cell, 1999. 96(5): p. 655-665.

Reich, A., Sapir, A. and Shilo, B., Sprouty is a general inhibitor of receptor
tyrosine kinase signaling. Development, 1999. 126(18): p. 4139-4147.

Hacohen, N., Kramer, S., Sutherland, D., Hiromi, Y. and Krasnow, M.A.,
Sprouty encodes a novel antagonist of FGF signaling that patterns apical
branching of the Drosophila airways. Cell, 1998. 92(2): p. 253-263.

Kim, H.J. and Bar-Sagi, D., Modulation of signalling by Sprouty: a
developing story. Nat Rev Mol Cell Biol, 2004. 5(6): p. 441-450.

Guy, G.R., Wong, E.S., Yusoff, P., Chandramouli, 8., Lo, T.L., Lim, J. and
Fong, C.W., Sprouty: how does the branch manager work? J Cell Sci,
2003. 116(Pt 15): p. 3061-3068.

Christofori, G., Split personalities: the agonistic antagonist Sprouty. Nat
Cell Biol, 2003. 5(5): p. 377-379.

Egan, J.E., Hall, A.B., Yatsula, BA. and Bar-Sagi, D., The bimodal
regulation of epidermal growth factor signaling by human Sprouty proteins.
Proc Natl Acad Sci U S A, 2002. 99(9): p. 6041-6046.

Rubin, C., Litvak, V., Medvedovsky, H., Zwang, Y., Lev, S. and Yarden, Y.,
Sprouty fine-tunes E GF signaling through interlinked positive and negative
feedback loops. Curr Biol, 2003. 13(4): p. 297-307.

Wong, E.S., Fong, C.W., Lim, J., Yusoff, P., Low, 8.0., Langdon, W.Y. and
Guy, G.R., Sprouty2 attenuates epidermal growth factor receptor
ubiquity/ation and endocytosis, and consequently enhances Ras/ERK
signalling. Embo J, 2002. 21(18): p. 4796-4808.

27.

28.

29.

30.

31.

Kwabi-Addo, B., Ozen, M. and Ittmann, M., The role of fibroblast growth
factors and their receptors in prostate cancer. Endocr Relat Cancer, 2004.
11(4): p. 709-724.

McKie, A.B., Douglas, D.A., Olijslagers, 8., Graham, J., Omar, M.M., Heer,
R., Gnanapragasam, V.J., Robson, ON. and Leung, H.Y., Epigenetic
inactivation of the human Sprouty2 (hSPRY2) homologue in prostate
cancer. Oncogene, 2005. 24(13): p. 2166-2174.

Lo, T.L., Yusoff, P., Fong, C.W., Guo, K., McCaw, B.J., Phillips, W.A.,
Yang, H., Wong, E.S., Leong, H.F., Zeng, Q., Putti, TC. and Guy, G.R.,
The res/mitogen-activated protein kinase pathway inhibitor and likely tumor
suppressor proteins, Sprouty 1 and Sprouty 2 are deregulated in breast
cancer. Cancer Res, 2004. 64(17): p. 6127-6136.

Abe, M. and Naski, M.C., Regulation of Sprouty expression by PLCgamma
and calcium-dependent signals. Biochem Biophys Res Commun, 2004.
323(3): p. 1040-1047.

Tsavachidou, 0., Coleman, M.L., Athanasiadis, G., Li, S., Licht, J.D.,
Olson, M.F. and Weber, B.L., SPRY2 is an inhibitor of the ras/extracellular
signal-regulated kinase pathway in melanocytes and melanoma cells with
wild-type BRAF but not with the V599E mutant. Cancer Res, 2004. 64(16):
p. 5556-5559.

Chapter I: Review of Literature

Cancer as a genetic disorder

The American cancer society estimates that cancer caused approximately
556,000 deaths in 2003, accounting for nearly 23% of deaths in the United States
[1]. Worldwide, 10 million new cases were reported in 2000, and 6 million people
died from cancer [2]. Cancer is a complex pathologic disorder that is a result of
multiple changes in normal physiology. Initially, change(s) within a cell result in
unregulated cellular growth, leading to an abnormal accumulation of cells and the
formation of a tumor at a particular location, which represents the primary tumor
site or tumor origin. In some cases, tumors infiltrate the tissue surrounding the
primary site and invade lymph and/or blood vessels, a process known as
invasion. In addition, tumors that invade can implant to a secondary location, a
process known as metastasis. Tumors that invade and metastasize are defined
as malignant tumors, and constitute a cancer. In contrast tumors that are
restricted to the site of origin and exhibit no evidence of invasion are defined as
benign tumors. These are often precursors of malignant tumors, but benign

tumors themselves do not constitute a cancer [3].

Cancer-related genes

Cancers arise by the sequential acquisition of genetic and/or epigenetic changes,

which ultimately modify the activity of proteins encoded by the affected genes [4].

IO

Many of these changes confer upon a cell some selective advantage that allows
the expansion of a clonal population. By reiteration of this pattern over a period of
years, a single cell emerges that has acquired all the necessary changes to form
a cancer [5, 6]. Based on epidemiological evidence on the frequency of cancer
incidence, Renan predicted that a normal cell requires between four to seven

Changes to form a cancer [7].

A great deal of effort has been made to determine which cellular genes are
involved in cancer formation. Such genes can be classified into two groups:
oncogenes, which are activated by gain-of—function genetic events and tumor

suppressor genes, which inactivated by loss-of—function genetic events [8-10].

In an attempt to elucidate the origins of cancer, early studies found that injection
of several RNA viruses in some animals resulted in cancer formation [8, 11].
These viruses were also found to induce cellular transformation in culture.
Cellular transformation refers to the acquisition of some of the characteristics of
tumor cells (e.g. morphological change or limitless replicative potential), without
including malignant tumor formation. The transforming ability sUch viruses is
mediated by single genetic elements (eg. v-Src and v-Myc), which are
homologous to genes found in normal cells [8, 12, 13]. The cellular counterparts
of these genes (e.g. c-Src and c-Myc) are important for maintaining normal cell
growth and differentiation, and play a causal role in cancer when they are

activated [14, 15].

ll

Genes that lead to cancer formation upon their activation are defined as
oncogenes, while the cellular genes form which they are derived are defined as
proto-oncogenes. Oncogenes act in a dominant fashion, implying that the
activation of a single genetic allele suffices for their activation. Oncogene

activation, results from point mutations (e.g. Rasv’z

in pancreatic carcinomas [16],
[17]), amplified expression (e.g. Her2/Neu in breast cancers [18, 19]), and
chromosomal translocations (e.g. c-Myc in Burkitts lymphoma and c—Abl in

chronic myelogenous leukemia [20, 21]).

Tumor suppressor genes also play an important role in cancer formation. The
cancer in which the role of tumor suppressors became evident is Retinoblastoma.
This condition is characterized by unilateral or bilateral retinal tumors that afflict
young children [22, 23]. Knudson [24] hypothesized that Retinoblastoma resulted
from inactivating mutations in a gene encoding a growth inhibitory protein. In light
of the fact that some children develop unilateral lesions, whereas others develop
bilateral lesions, Knudson postulated that when tumors were found in both eyes,
this was a consequence of a single inactivating mutation, which was inherited,
and a second mutation acquired independently as retinal cells divided to form the
retina. The gene responsible for this condition, designated retinoblastoma (Rb),
was the first tumor suppressor gene to be identified [25-27]. Normally, Rb serves
to repress cellular proliferation by inhibiting cell cycle progression (discussed

below), thus suppressing uncontrolled proliferation of cells. In Retinoblastoma,

12

this gene is inactivated by loss-of-function mutations, and therefore the ability of
Rb to inhibit cell cycle progression is lost [28]. Since the discovery of Rb, a
number of other tumor suppressor genes have been identified, which regulate

diverse cellular functions and protect cells form malignant transformation [29].

Inactivation of a single allele of a tumor suppressor gene is not sufficient for tumor
formation, as the other allele of the gene remains intact and can provide enough
wild type protein to maintain a normal phenotype. Therefore, both copies of the
gene must be inactivated in order for the function of the tumor suppressor gene to

be lost. This is commonly known as the “two hit hypothesis” [30].

Tumor suppressor genes have been further classified as gatekeepers or as
caretakers [31]. Vogelstein and colleagues discovered that APC, a tumor
suppressor gene, is inactivated in a type of colon cancer known as Familial
Adenomatus Coli [32, 33]. Biallelic inactivation of APC is the rate limiting step for
the formation of these tumors. Genes with this property in cancer formation are
designated gatekeepers. Another subset of colon cancers, known as Hereditary
Nonpolyposis Colorectal Cancer, arises form mutations in DNA mismatch repair
genes [34, 35]. Because these genes are important in repairing damaged DNA,
their inactivation increases the mutation rate and chromosomal instability, which
facilitate cancer formation [36]. Tumor suppressor genes that act in this fashion
are designated as caretaker genes, i.e. genes whose inactivation accelerates

malignant transformation.

13

Mutations are the most important cause for the alteration of normal cellular genes
in the process of tumor formation. Nevertheless, epigenetic events, such as
imprinting and hypermethylation have also proven to be important in inducing the
necessary changes for cancer formation. Epigenetlc regulation refers to the
control of gene expression through modifications of chromatin structure in the
gene promoter region [37]. These modifications facilitate (e.g. acetylation), or
impede (e.g. methylation) transcription from a particular gene promoter, resulting
in alterations in gene expression. Disruption of epigenetic regulation can also
contribute to cancer formation. For example, loss of imprinting facilitates the
formation of Wilm's tumor [18] and hypermethylation of the p21 promoter results

in the loss of expression of p21 in various tumors [38].

Characteristics of cancer cells

The family of cancer consists of a large number of distinct types, each displaying
some unique characteristics, particularly in regards to the cell of origin.
Nevertheless, there are also characteristics that are commonly found in various
cancer subtypes [39]. Such common traits include: (1) enhanced or uncontrolled
proliferation, (2) aberrant cell cycle control, (3) limitless replication potential, (4)
evasion of apoptosis, (5) inefficient DNA repair mechanisms, (6) genomic

instability, (7) angiogenesis and (8) invasion and metastasis.

I4

Uncontrolled proliferation

Under normal conditions, a cell requires mitogenic growth signals for proliferation.
Cancer cells, however, have acquired the ability of autonomous proliferation, i.e.
they can replicate in the absence of exogenous growth factors. This autonomy is
acquired as a result of changes that enable cancer cells to uncouple normal

proliferation pathways from their regulatory mechanisms.

With this in mind, it is important to describe the process responsible for the
regulation of proliferation in normal cells, before describing how cancer cells
acquire their proliferative autonomy. Of the several pathways that regulate cellular
proliferation within a cell, the pathways induced by growth factors are the most
important. Extracellular protein growth factors, such as epidermal growth factor
(EGF) and platelet-derived growth factor (PDGF), bind to and activate
transmembrane receptors, such as the EGF-receptor (EGFR) and the PDGF-
receptor (PDGFR), respectively. These receptors belong to a wider family, known

as receptor tyrosine kinases (RTK).

Growth factors bind to these receptors and induced their dimerization. This
process leads to autophosphorylation of the receptors on their cytoplasmic
domains, and this leads to receptor activation [40]. The phosphorylation sites on
RTKs, serve as docking sites for numerous effectors, including the adaptor
protein Grb2 [41]. Grb2 contains a Src homology 2 (SH2) domain, which binds to

phospho-tyrosine residues and guides the migration of Grb2 to the

15

phosphotyrosine residues on the cytoplasmic tail of the RTK [42]. In this fashion,
growth factors stimulate the translocation of Grb2 from its cytosolic localization to
the plasma membrane. Grb2 forms a complex with son of sevenless (SOS),
leading to the translocation of SOS to the plasma membrane alongside Grb2 [43,
44]. At the plasma membrane SOS activates Ras GTPases, which are embedded
in the plasma membrane by farnesylation [45]. In this fashion, the extracellular
ligand-induced activation of receptor tyrosine kinases results in the activation of
R33 GTPases. These GTPases catalyze the hydrolysis of GTP into GDP, and
serve as a molecular switch for the activation of many intracellular pathways [46,
47]. In normal cells, Ras oscillates between an active, GTP-bound state and an
inactive, GDP-bound state [48]. The Grb2:SOS-mediated activation of Ras in
response to growth factor stimulation is a critical event in the regulation of
proliferation. This is mainly because active Ras regulates the Raf/MEK/ERK
pathway [49]. Activation of this pathway directly regulates the expression of many
genes that are important for cell cycle progression and proliferation (e.g. cyclin D)

[50-52].

One mechanism by which cancer cells hijack this regulatory pathway is the
production of endogenous growth factors. For example, glioblastomas and
sarcomas have been frequently found to produce PDGF and TGFa respectively
[39, 53, 54]. Upon secretion, these growth factors act in an autocrine fashion to
stimulate RTK signaling and proliferation of cancer cells in the absence of

exogenous growth factors.

16

Cancer cells may also exhibit an increased level of RTK activity, because of
mutations that result in constitutive activation of the receptor, or amplification of
the receptor. For example, c-Kit receptor tyrosine kinase, is activated in
gastrointestinal stromal tumors by a point mutation, which results in the
constitutive dimerization of this receptor [55]. Growth factors activate RTKS by
inducing their dimerization. Upon growth factor withdrawal, the receptors revert to
a monomeric state. Thus, constitutively dimerized receptors are active even in the
absence of growth factor stimulation, which results in uncontrolled signaling
activity. Alternatively, and more commonly, growth factor receptors are
overexpressed in cancer cells, as is the case in brain, breast and stomach
tumors, which overexpress the tyrosine kinase receptor EGFR [56]. This also
results in sustained activity from the receptor, and a sustained drive for cellular

proliferation.

Proliferative autonomy in cancer is most often acquired via the constitutive
activation of proto-oncogenes, such as Ras in colon and pancreatic cancers [57]
and Abl in chronic myelogenous leukemia [58]. Activation of the Ras proto-
oncogene is a result of point mutations in codons 12, 13, 59 and 61 [59-61].
These mutations diminish the GTPase activity of Ras, which results in higher
levels of active, GTP-bound Res, and lead to sustained proliferative signaling
from Ras. Abl is a non receptor tyrosine kinase that also functions in signaling

pathways that regulate cell growth [62]. In chronic myelogenous leukemia Abl is

17

activated through reciprocal translocation between chromosomes 9 and 22,
resulting in the formation of the “Philadelphia chromosome”, which contains a
fusion of Abl with BCR [63]. Although the exact mechanism by which BCR-Abl
affects cancer formation remains under investigation, one mechanism appears to
be an increase in the kinase activity of Abl [64, 65]. This increase results in part

because an inhibitory region on the N-terminus of Abl is lost upon fusion of Abl

with BCR [66].

The modulation of transcription factor activity also contributes to the higher rate of
proliferation observed in most cancer cells. The transcription factors that play a
role in cancer can be generalized into three groups [67, 68], including steroid
re(lealzbtors, such as estrogen and androgen receptors, nuclear transcription
faCto rs, such as c-Myc and c-Jun, and cytoplasmic factors, such as NFKB and
STATS. Expressional amplification, or constitutive activation of these transcription
fac>‘|Z<)rs not only contributes to the unrestrained growth of cancer cells, but is also
important for the acquisition of other characteristics of cancer cells, such as
eVasion of apoptosis and deregulation of the cell cycle. The c-Myc transcription
factor is of particular importance, given that c-Myc proto-oncogene is involved in
the formation of many cancers, including those of the prostate, breast and skin
[69‘71]. c-Myc encodes a basic helix-loop-helix-zipper transcription factor, which
Specifically binds to E-box sequences in the DNA, upon heterodimerization with

'ts binding partner MAX [12]. As part of this complex, c-Myc activates a diverse

grc) Up of genes, including cell cycle regulators (e.g. cyclin D2 and CDK2) and

18

translation initiation factors (e.g. elF2 and eIF4). Functionally, c-Myc drives

cell ular proliferation, inhibits differentiation, and induces apoptosis [72-74].

Abe rrant cell cycle regulation

In somatic cells, the normal cell cycle consists of a resting stage, Go, in which the
cel I is not dividing, and four stages, G1, S, G2 and M, which are present in
divi ding cells. S is the stage during which DNA synthesis take places, while M is
the stage of mitosis, were cell division occurs. G1 is a gap phase between M and
S . whereas G2 is a gap phase between S and M. These gaps allow the cell to

pre Dare for the ensuing stage, as well as to repair DNA damage [75].

The cell cycle is regulated by an array of proteins, including cyclins (A, B and D),
CYCI in-dependent kinases (CDK1-4) and CDK inhibitors (CKI, e.g. p21 and p27)
[76 . 77]. In broad terms, a Specific cyclin binds to a specific CDK, and leads to
CDK activation. This CDK, in turn, phosphorylates and regulates enzymes that
are responsible for progression through the different stages of the cells cycle. In
this fashion, cyclin/CDK complexes promote cell cycle progression. lmportantly,
the progression through a particular phase of the cell cycle is regulated by a
Specific cyclin/CDK complex. CDK inhibitors bind to cyclin/CDK complexes and

In“ 5 bit their activity. Consequently, these inhibitors arrest progression through the

Ce l l cycle [76, 78. 79]-

19

The transition through G1 to S is of particular importance, because it is the part of
the cell cycle where many intracellular signaling pathways exert their control on
cell cycle progression. This transition is mainly regulated by the E2F family of
transcription factors. E2F regulates a number of genes that are involved in
me i ntaining S phase, such as DNA polymerases and cyclin E [80]. In quiescent
cel ls, E2F is repressed by the Rb tumor suppressor, when the latter is in a
hYIDOphosphorylated form. Growth stimulation by mitogenic signals activates the
Re s/MAPK cascade, resulting in transcriptional activation of cyclin D. Cyclin D
inte racts with CDK4, and the cyclinD/CDK4 complex hyperphosphorylates Rb,
promoting the release of E2F from RB. Active E2F transcriptionally activates

Qe hes that are necessary for progression from G1 to S [81, 82].

Aberrations in the mechanisms that regulate this transition through the cell cycle
OCCUr frequently in human cancers, and include inactivation of Rb (e.g.
Retinoblastoma), as well as overexpression of cyclin 01, which is commonly

Observed in breast, lung and colon cancers [83. 84].

The S phase is maintained predominantly by the cyclin ElCDK2 complex [85, 86].
The cyclin E/CDK2 complex also activates E2F [87]. Activation of E2F, at this
De l‘iod of the cell cycle, induces cyclin A expression. Cyclin A, is responsible for
the transition from G2 to M, which leads the cells into the stage of division [88].
c3)’<:Iin A also regulates the first half of mitosis, whereas cyclin B, in complex with

CDK‘I, is responsible for regulation of the second half of mitosis [3].

20

 

CDK inhibitors include members of the ClP/KIP family (p21, p27 and p57) and the
INK 4a locus (p16'NK4a and p14ARF). p21 and p27 inhibit the function of cyclin/CDK
complexes, and therefore, they prevent progression through 8 and G2 phases
[89] - p16lNK4al inhibits the cyclin D/CDK interaction, thereby inactivating E2F,

whereas p14ARF prevents cell cycle progression by inhibiting the ubiquitinylation

and degradation of p53 by MDM2 [90].

In addition to the regulatory programs described above, there exists another level
Of Control, termed cell cycle checkpoint control, which is responsible for ensuring
the integrity of the genome as the cell progresses through the different phases of
the cell cycle [91]. Regulation at this level involves sensor, transducer, and
effector proteins, and is divided into the G1/S checkpoint, the S-phase
chefizzkpoint, and the GZ/M checkpoint. Such checkpoints prevent cells with
Ciat‘haged DNA from entering S-phase (G1/S), prevent the start of replication in
the case of genotoxic insults (S-phase), or prevent cells with aberrant DNA
replication from entering mitosis (G2lM) [92—94]. In the absence, or in the

ihaCtivation of these checkpoints, damaged DNA is replicated, leading to a higher

freq uency of mutations, thus increasing the risk of cancer formation.
The sensors of DNA damage, is. the factors that initiate checkpoint control

'nVO Ive mainly ATM and ATR. The former is instantaneously activated by DNA

es i(Dr‘rs, whereas the latter is activated by stalling of the replication fork. ATM and

21

 

ATR activate signaling transducers, such as CHK proteins, which then recruit and

activate effectors including p53 [91].

The tumor suppressor gene p53 plays an important role in cell cycle regulation
and cancer formation. p53 is found to be mutated in approximately 50% of human
ca hcers. p53 encodes for a transcription factor that acts as a homotetramer to
reg ulate cell cycle arrest, apoptosis and DNA repair [95-97]. Under physiological
CO hditions, the levels of p53 are maintained at a low level by MDM2, which is an

E3 ubiquitin ligase enzyme [98]. MDM2 ubiquitinates p53 and promotes its

d e9 radation by the proteasome [99].

The transcriptional activity of p53 is activated in response to cellular stresses that
ind Lice DNA damage. Upon DNA damage, the ubiquitination of p53 by MDM2 is
abOlished, and p53 translocates to the nucleus, where it induces the transcription
0f genes such as p21, Bax, and Gadd5 [100]. This results in the activation of the
92 ’1 CKl, which, as described above, arrests the cell cycle by inhibiting
c:yczlin/CDK complexes [101]. The consequence of this arrest is to allow more time
for the repair of DNA damage. If the damage is not repaired, p53 may induce

apoptosis via the transcriptional activation of BAX, a pro-apoptotic factor that

in h i bits the anti-apoptotic factor Bcl-2 [102].

22

Limitless replication potential

In 1 961, Hayflick suggested that human cells in culture have a limited lifespan
[1 O 3]. Fibroblasts, for example, can replicate for 60-80 cell doublings, after which
they stop the progression through the cell cycle and enter a metabolically active
state termed senescence. Senescent fibroblasts are enlarged and exhibit a flat
mo rphology, and can persist for many years in this state. The cell cycle arrest
d u ring senescence is dependent on the activities of the p53 and Rb tumor
3” Dpressors [39]. Upon inhibition of these pathways, cells can propagate beyond
11"‘Ieir normal life span in culture. Nevertheless, within a limited number of
DO pulation doublings, such cells enter a state termed crisis that is characterized
by massive apoptosis. In some instances, cells survive this state and emerge with

a limitless replicative potential [104].

Cell replication in culture is limited by the shortening of telomeric ends of
Ch r0 mosomes. Telomeres consist of tandem repeats of the sequence TTAGGG
[1 0 5]. These repeats are limited in number, and they are consecutively shortened
d Uri ng the replication of chromosome [106]. In this way, the length of telomeres
Se Wes as a molecular timer that counts down with every cell replication. When
the telomeric repeats fall below a critical number, terminal parts of chromosomal
DNA are lost during DNA synthesis. This process triggers the cellular programs
that bring on senescence, although the exact mechanism is not fully understood
[1 07]. If the cell continues to divide the progressive loss of chromosomal ends

I
eads to genomic instability, which is responsible for the induction of crisis.

23

Cancer cells in culture typically exhibit limitless replicative potential, suggesting
that this characteristic is acquired during tumor progression [108]. In some
malignant cells, proliferation is paralleled by widespread apoptosis, suggesting
that the limited lifespan of somatic cells needs to be surpassed for cancers to
fo m [39]. Telomere maintenance is present in the majority of cancer cells [109].

This is mainly attributed to the up regulation of telomerase expression, an

enzyme responsible for the synthesis of telomeres [110]. Not surprisingly,
expression of telomerase is sufficient to bypass senescence and crisis, conferring
“mitless replicative potential to cells [111]. It should be noted that there is a
telOmerase-independent mechanism for telomere maintenance. This mechanism

ir‘\/c>lves recombination and is referred to as alternative lengthening of telomeres
[1 1 2].

E\'i.=ls.ion of apoptosis

ADthosis is regulated by two distinct pathways. One is mediated by death
re(T-eptors in response to extracellular signals and is termed the ‘extrinsic
pathway’. The other is mediated by the mitochondria in response to internal cues,

i"(3| uding DNA damage, and is referred to as the ‘intrinsic pathway’ [113, 114].

In the extrinsic pathway, death receptors, such as CD95 and TRAIL-R1, are
acti\rated through their interaction with various ligands that belong to the TNF

f . .
a "h Ily of secreted proteins [115]. This interaction induces receptor clustering, and

24

leads to the recruitment of caspase-8 and caspase-10 to the receptor, via the
adaptor protein FADD [116]. Caspases are cysteine proteases that are
synthesized as inactive zymogens. Most caspases are activated by proteolytic
cleavage, usually induced by another active caspase [117]. After their recruitment
to the death receptor, both caspase-8 and caspase-10 are cleaved into their
active forms [118]. c-FLIP negatively regulates the extrinsic apoptotic pathway by
inhibiting caspase-8 activation by the death receptor-FADD complex [119].
Activation of caspase-8 leads to the step wise activation of a cascade of

Ca 8 pases culminating in the activation of caspase-3.

In the intrinsic pathway, DNA damage results in the secretion of cytochrome c
fro m the mitochondria [120]. Cytochrome c release from mitochondria is regulated
by pro-apoptotic (BAX, BID, BAD) and anti-apoptotic (BCL2, BCL-XL) factors, and
the net outcome results from an imbalance between the two types of factors. In
the cytosol, cytochrome c interacts with Apaf-1 and caspase-9, resulting in the
for l'1r1ation of the “apoptosome” [121]. The ‘apoptosome’ activates caspase-3, a
prOczess that is antagonized by inhibitor of apoptosis proteins (IAP), which in turns

are inactivated by Smac/DIABLO [122]. Therefore the intrinsic and extrinsic

p"athways converge at the activation of caspase-3, an important effector caspase

that targets critical cellular enzymes resulting in apoptosis.

The cellular phenotype associated with apoptosis results form the proteolysis of

v - . .
e""<>us cellular substrates. Proteolysrs of substrates such as nuclear lamrns

25

results in nuclear condensation, proteolysis of DNase inhibitor ICAD, activates an

endonuclease that fragmentates DNA, whereas proteolysis of cytoskeletal

proteins results in cell fragmentation [114].

Apo ptosis acts as a potent control to prevent malignant transformation. As noted
above, cancers arise as a result of genetic alterations (e.g. oncogene activation),
and subsequent clonal expansion of the cells. Activation of apoptotic pathways
aCts to prevent clonal expansion, and thus limit the chance for full blown
neOplasm formation. Interestingly, the activation of some oncogenes (e.g.

OVe rexpression of c-Myc and E2F), in itself sensitizes cells to apoptosis, thus

prevanting malignant transformation [73].

Apoptosis can also be initiated in response to extensive DNA damage. This is

mediated by the function of p53, which “senses” DNA damage and activates the

intl"i nsic apoptotic pathway through the induction of BAX [102].

The treatment of cancers by radiation or chemotherapy also relies on the
ihd LlCtiOl'I of apoptosis. Inactivation of pro-apoptotic pathways in cancer cells
compromises the efficacy of such treatments. For example, malignant

rT‘lelanomas that have lost expression of APAF1 become resistant to

ch e motherapy [123].

26

The importance of apoptosis in slowing cancer progression is also apparent in
that almost all of the factors involved in the regulation of apoptosis are affected in
human cancers. For example, the anti-apoptotic factors BCL2 and BCL-XL are
overexpressed in myeloid leukemia and in acute lymphoblastic leukemia,
respectively. Also, the pro-apoptotic factor BAX has been found to be down-
regulated in colon cancer. Furthermore, additional apoptotic regulators, such as
FLIP, soluble death ligands, IAPs, p53, Pl3K, AKT and PTEN are reported to be

deregulated in tumors [114].

Inefficient DNA repair mechanisms

DNA damage is especially important for cancer formation, because it causes
mutations in replicating cells. As indicated above, mutations may result in the loss
of function of tumor suppressor genes, as well as in the activation of oncogenes.
These events are sufficient to initiate and maintain the process of malignant

transformation [124].

DNA damage is as a result of exogenous or endogenous chemicals that form
adducts with DNA bases directly, or indirectly, through their metabolites.
Furthermore, DNA damage is a result of physical agents such as UV and ionizing
irradiation. In order to maintain the information encoded in the DNA unaltered,
cells have developed mechanisms to repair such damage, which results in a low
frequency of mutation. The repertoire of the cell’s DNA repair machinery includes

base excision repair, nucleotide excision repair and mismatch repair, as well as

27

homologous recombination and nonhomologous and joining [125]. What is more,
there exists a “damage tolerance" pathway, in which specialized polymerases (Y-
Family polymerases) bypass lesions that stall the major replication polymerase

(POI 5) [126].

Furthermore, as cells progress through the cell cycle, the cells must pass through
several checkpoints, which are regulated by distinct cellular enzymes, such as
p53 and ATM. These enzymes are responsible for arresting cell cycle
progression, and inducing programmed cell death, thus preventing cells with

damaged DNA from propagating.

Deficiencies in the DNA-repair machinery enhance mutation frequency and are
detrimental for normal cell function. Paradigmatically, mismatch repair genes are
inactivated in human hereditary colorectal cancer, a common malignancy of the
colon [31, 34, 35]. Mismatch repair genes (e.g. MSH2) act as caretaker genes
and their inactivation enhances the mutation frequency, which can lead to cancer
formation. In this setting, oncogenes and tumor suppressor genes are more likely

to be activated and suppressed, respectively.

Xeroderma Pigmentosum (XP) is a syndrome that renders patients susceptible to
skin cancer [127]. The cells of these patients are deficient in nucleotide excision
repair, resulting in a higher frequency of sunlight-induced mutations in these cells

[128, 129]. A subset of XP patients has a normal nucleotide excision repair

28

 

mechanism, yet the frequency of UV-induced mutations in cells derived from
these patients is also high. This condition, designated Xeroderma Pigmentosum
Variant is characterized by defects in polymerase eta, an error-free specialized

polymerase involved in translesion synthesis [130].

Genetic instability

Genetic instability, a feature of many cancer cells, refers to the consistent failure
to transmit an accurate copy of a complete genome from one cell to its two
daughter cells. This can be subdivided into microsatellite and chromosomal
instability [131]. Microsatellite instability is a result of mutations or inactivation of
DNA-mismatch-repair genes, such as MSH2. Chromosomal instability can be
further subdivided into instability in chromosome structure and instability in
chromosome number. Instability in chromosome structure involves deletions,
inversions, translocations and insertions of small sequences of DNA. In tumor
cells, this type of instability often results from the inactivation of DNA-damage
checkpoint genes, such as ATM and p53, as well as from deficiencies in genes
involved in double strand break repair like DNA-PK. Instability in chromosome
number is a product of abnormal centrosome duplication with multipolar mitoses,
and arises form deficiencies in BRCA1 and spindle checkpoint genes (MAD1).
Chromosomal instability leads to an enhanced rate of loss of heterozygosity,

which is an important mechanism of inactivating tumor suppressor genes [132].

29

Angiogenesis

Cells within a tissue require the delivery of oxygen and nutrients for their growth
and proliferation. To achieve this, cells are generally located within 100-200 pm
from blood vessels [3]. With this in mind, organismal growth requires that new
blood vessels are formed, so that the new cells are constantly being perfused.
The process by which new vessels are formed is defined as angiogenesis. This
process is strictly regulated by a plethora of factors, which either stimulate or
inhibit the formation of new blood vessels. In normal tissue, the tendency of the
pro-angiogenic factor to stimulate angiogenesis is balanced by that of the anti-

angiogenic factors [133, 134].

In solid tumors, growth is frequently limited by the hypoxic condition at the center
of the tumor, and by the sparsity of blood vessels to deliver oxygen and nutrients
to the tumor site. Therefore, a tumor cannot grow beyond a critical size
(estimated at 200 um) unless the tumor receives sufficient blood perfusion to
support its own metabolic needs. Tumors can remain in this stage for a period of
months to years [3]. When the balance between pro- and anti- angiogenic factors
is shifted to promote the formation of new vessels, a process referred to as
“angiogenic switch”, tumor growth resumes, as oxygen and nutrients are being

delivered to the tumor site [135, 136].

Typically, angiogenesis is initiated and carried out by endothelial cells lining up

existing blood vessels [137, 138]. Endothelial cells express receptors for pro-

30

angiogenic factors that are secreted in the interstitial fluid, or that are incorporated
in the extracellular matrix. Upon binding to their ligands, these receptors become
active and they turn on endothelial angiogenic programs [139]. In addition, upon
their stimulation to neovascularize, endothelial cells secrete matrix proteases that
degrade the extracellular matrix and allow the endothelial cells to proliferate
towards the source of their stimulus [140]. Furthermore, angiogenesis also
involves the arrangement of endothelial cells into tubular structures, their

canalization and their intussusceptions into existing vessels [138, 141, 142].

Vascular endothelium growth factor (VEGF) is the best characterized regulator of
angiogenesis. VEGF is secreted by the tumor cells or by the tumor stroma, and
is critically important for the ‘de novo’ formation of angiogenesis [143-145]. The
secretion of VEGF is regulated by the transcription factor HIF1, as a response to
hypoxic stress in the tumor microenvironment [146]. When oxygen is abundant in
the microenvironment, non-heme iron dependent oxygeneases hydroxylate HIF1
on specific residues, mediating an interaction between HIF1 and the vHL E3
ubiquitin ligase. This process results in the ubiquitinylation and subsequent
degradation of HIF1. Upon hypoxic conditions, the oxygenases responsible for
HIF hydroxylation remain in an inactive state, thereby failing to induce the post-
translational down regulation of HIF1 [147]. This failure results in a transcriptional
activation of HIF1 inducible genes, which include the angiogenic stimulator

VEGF. The VEGF receptor, belongs to the class of RTKS, and transduces the

31

VEGF angiogenic Signal through a number of effector proteins including FAK,

PI3K and Ras-dependent pathways [148, 149].

Invasion and metastasis

Malignant tumors are characterized by their ability to invade surrounding tissues
and as a result to metastasize into other locations in the body. The metastatic
process involves detachment of the tumor from its primary site, degradation of its
extracellular matrix (ECM), invasion into the blood vessel, and transplantation to a

secondary site [3].

The initial stages in the metastatic process are regulated by cell adhesion
molecules and integrins [150, 151]. E-cadherin, a transmembrane glycoprotein, is
an important factor for epithelial cell adhesion. Some carcinomas express
reduced levels of E-cadherin, resulting in loose attachment between the epithelial
cells, thereby enhancing their potential for metastasis. Alternatively, carcinomas
with normal levels of E-cadherin, contain inactivated catenin, which is an

intracellular effector of E-cadherin [152].

To infiltrate through the ECM, tumor cells first bind to the components of the ECM
via transmembrane proteins of the integrin family and laminin family [151, 153].
These proteins, which are expressed in normal cells as well, are frequently
amplified in cancer cells. In particular, cancer cells express integrins that are not

specific for the type of tissue were the cancer originated from. This enables

32

invading cells to attach to new locations giving rise to new foci of tumor growth
[151]. Once bound to ECM, the tumor cell secretes specific proteases, such as
matrix metalloproteases (MMP2 and 9), which degrade ECM to facilitate the

infiltration of tumor cells [154, 155].

In the process of invading adjacent tissue, cancer cells may invade into blood
vessels. Once in the blood vessel, the tumor cells evade the immune system by
homotypic adhesion (i.e. aggregation of tumor cells with each other) or
heterotypic adhesions (aggregation between tumor and blood cells) [156]. The
site of extravasation is dependent in part on the anatomical location of the
primary tumor. Extravasation and transplantation of the tumor cells involves the
attachment of tumor cells into a new tissue type, a process that is facilitated by
laminin receptors and integrins, which bind to ligands embedded in the ECM of
the metastatic site [157]. In addition, chemokines and their receptors also play a
role in determining the target site for metastasis, particularly in breast cancer cells

[158].

33

MSU-1 lineage as model system to study malignant
transformation

To study the process of malignant transformation, McCormick and Maher
developed the MSU-1 lineage of human fibroblasts (Fig. 1), as a model system
that mimics the process by which normal cells become malignant [159-163]. This
lineage originates from the transfection of normal foreskin-derived human
fibroblasts with a vector encoding the v-Myc oncogene and a neomycin
resistance marker [164]. As neomycin resistant clones were being propagated in
culture, they underwent senescence, and the majority of the clones succumbed to
crisis. Nevertheless, it became apparent that several clones had survived this
process. Because cells that escape senescence and crisis spontaneously acquire
an immortal life span [104, 165], the v-Myc-expressing clones were propagated in
culture for many cell doublings to determine if exhibited extended lifespan. It was
found that the cells from these clones were indeed immortal, and they were

designated MSU-1.0.

Experiments conducted later showed that MSU-1.0 cells express telomerase, a
gene known to immortalize to cells (McCormick, unpublished data). Myc confers
immortality to cells by inducing the expression of telomerase [166-169], yet in our
system it is unlikely that Myc alone is responsible for the immortalization of MSU-
1.0 cells. This is because all but one of the Myc expressing clones succumbed to
crisis, just like the mock transfected clones. What is more, MSU-1.0 cells also

express elevated levels of the transcription factor Sp1, when compared to their

34

Figure 1. MSU 1 lineage of human fibroblasts. The MSU 1 lineage consists of
isogenic cell strains which have been derived from the same normal cell line, and
have progressively increasing malignant characteristics. Some characteristics of
each cell line, as well as the known genetic modification(s) that are responsible

for its formation are indicated.

35

F 0.59".

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

36

 

 

 

 

oocmuconou:_
mo> Bi :2th oz 02 oz .308 526.0
88863:. nmEcocmcmc. wm> 02 oz 02 635E555;
mo> mo> we> mm; 02 oz fitoEE.
moEOmoEoEo
mo> mo> mm; 02 oz 02 59:22
2me2 2.82 .2802 mm; wo> wo> 2035
Qaaum
wm> wm> wo> mo> >=mEomoEoEo
20.:
._<S_mOZ
r . .
002.3... ODE. ocououco Beacon—muconw OAS:—
EoEsh O_E>5a 5 not:

.5306?

precursor cells. Sp1 has been shown to cooperate with Myc in the induction of
telomerase expression [170, 171], suggesting that Myc and Sp1 are most likely
responsible for telomerase expression in MSU-1.0 cells (McCormick, unpublished

data).

Apart from being immortal, MSU-1.0 cells exhibit the usual characteristics of
normal fibroblasts, i.e., they are diploid, chromosomally stable, require normal
levels of growth factors for proliferation, do not form foci or colonies in agar, and
they fail to form tumors upon injection in athymic mice. Furthermore, expression
of oncogenes such as, and v-sis in these cells, as well as treatment with benzo-A-
pyrene-diol-epoxide (BPDE) and focus selection alone, or treatment with BPDE,

V12

focus selection and subsequent expression of the HRas oncogene, did not

malignantly transformed these cells.

A cell in the MSU-1.0 population spontaneously undenivent two chromosomal
translocations, giving rise to a variant clonal population, designated MSU-1.1.
MSU-1.1 cells are chromosomally stable, and nearly diploid, i.e., they consist of
45 chromosomes, including two characteristic chromosome markers, M1 and M2
along with a monosomy of chromosomes 11, 12 and 15 [164]. M1 resulted from
the translocation of chromosome 11 (11p15-)qter) to chromosome 1 at p11,
whereas M2 resulted from translocation of chromosome 12 (12qter->12q11) to
chromosome 15 (15p11-)15qter). Fingerprint analysis, and analysis of the v-myc

integration site by southern blotting, showed that MSU-1.0 and MSU-1.1 cells

37

were both derived from LG1 cells, and MSU-1.1 cells must have been derived

form MSU-1.0 cells, respectively.

MSU-1.1 cells exhibit an immortal life span in culture, but they do not form foci,
colonies in agar, or tumors upon injection in athymic mice. Nevertheless, unlike
their precursor cells, MSU-1.1 cells exhibit partial growth factor independence,
and can be malignantly transformed by the expression of various oncogenes, or
by carcinogen treatment followed by focus selection.

Expression of oncogenes, such as HRasV’Z, NRastg

and v-sis at expression
levels similar to the expression of the respective proto-oncogenes, results in
transformation of MSU-1.1 cells (Fig. 2A) [172-174]. MSU-1.1 cells expressing
these oncogenes form foci and colonies in agarose at higher rates that the
parental MSU-1.1 cells. These cells, however, are not malignant, i.e., they do not
form tumors when injected in athymic mice. However, overexpression of the
HRaswz, NRaswz, v-KRas and KRasV’2 oncogenes, results in malignant
transformation of these cells, i.e., MSU-1.1 cells expressing these oncogenes
form malignant tumors in athymic mice [173-177]. These results suggest that
more than one genetic change is required for the malignant transformation of
MSU-1.1 cells. Consistently, sequential expression of two oncogenes, each of
which is expressed at levels similar to its endogenous level, followed by clonal

selection after each expression, results in the malignant transformation of MSU-

1.1 cells. In this way, the coexpression of either HRasWZ or NRasQ59 with v-fes, or

38

Figure 2. MSU 1 lineage as a tool for the study of malignant transformation. The
MSU 1 lineage has been used to study the role of many genes in malignant
transformation. (A) Unlike their precursor cells, MSU-1.1 cells are malignantly
transformed by the overexpression of a single oncogene, or consecutive
expression of two cooperative oncogenes. Expression of Ras oncogenes at a
high level is sufficient for malignant transformation of MSU-1.1 cells. Instead,
expression of Ras or sis (PDGF) oncogenes at a low level is insufficient to
malignantly transform MSU-1.1 cells. Nevertheless, consecutive expression of a
cooperative oncogene in cells expressing Ras or sis oncogenes results in
malignant transformation of MSU-1.1 cells, suggesting that MSU-1.1 cells are at
least two genetic changes short of being malignant. Interestingly, application of
the same genetic changes that malignantly transform MSU-1.1 cells in MSU-1.0
cells fails to malignantly transform these cells. (B) Cells derived from tumors
resulting form the malignant transformation of MSU-1.1 cells (MSU-1.1
derivative) have also been used to study genes that are involved in cancer.
When the expression of the indicated genes is altered, the malignant MSU-1

derivatives exhibit a reduction in their ability to form tumors in athymic mice.

39

N 0.59...
2 05082650
went:
QTESQE
:o_mmo.axo._o>o

 

    

 

o_com_._oE3-coz

 

UmZBULoEJH

 

2:82ch Toms.
co=a_:a$-cioo

 

FQM. .
morhms m
NVOBU
FUNK
NSMMKX
$3me
«EMMKI «Swat:

 

:ofiwEango

     

   

2:82.60 Swim—ESE

  

 
 

accuse 9:22.000 co_mme.axm

Mai. mOQl
wmknx. ~F>wmml .<
$0312

40

coexpression of v-sis with v-fes, in MSU-1.1 cells, results in their malignant
transformation (Lin et al., 1995; Lin et al., 1994). The viral oncogene v-sis
encodes for platelet derived growth factor (PDGF), while v-fes encodes an active
form of the soluble tyrosine kinase c-fes. The cooperativity between v-sis, v-fes
and Ras oncogenes in the malignant transformation of MSU-1.1 cells is evident in
the fact that these enzymes are involved in receptor tyrosine signaling. Growth
factors (such as PDGF) induce the activation of RTK signaling, which results in
the activation of intracellular effectors such as Res and Src [178, 179]. Soluble
tyrosine kinases (such as c-fes) partially mediate the functions of activated RTKS.
In addition, soluble tyrosine kinases, especially Src and c-fes, can also activate

Ras [180-182].

As indicated above, MSU-1.1 can be malignantly transformed by carcinogen
treatment followed by focus selection. Treatment of MSU-1.1 cells with a number
of carcinogens, including BPDE, ethyl-nitrosourea (ENU) and gamma-irradiation,
results in the malignant transformation of these cells [183-185]. In these cases,
the resulting malignant cells exhibit inactivation of the p53 tumor suppressor

pathway and are chromosomally unstable (McCormick, unpublished data).

The cells derived from the tumors formed by the malignantly transformed MSU-
1.1 cells have been studied to determine genes that are important for this process
(Fig. 28). Expression of dominant negative forms of Rho GTPases Rac1 and

Cdc42 in HRasVIz-transformed MSU-1.1 cells results in a decrease in the ability

41

of HRas-transformed cells to form tumors in athymic mice, indicating that Rac1
and Cdc42 are necessary for Res-transformation in human cells (Appledom and

VIA, and in

McCormick, unpublished data). Also, down-regulation of Sp1 in HRas
gamma irradiation-transformed MSU-1.1 cells, abrogates tumor-forming ability,
suggesting an oncogenic function for Sp1 in these contexts[186]. Furthermore, c-
Met and HGF, are both necessary for the malignant phenotype of gamma
irradiation-transformed MSU-1.1 cells [187]. The activation of the HGF/c—Met
pathway results in the induction of Sp1 expression [187], suggesting that Sp1
mediates the effect of HGF and c-Met in malignant transformation. Finally,
expression of Fibulin-1D, an extracellular matrix protein, in BPDE-transformed
MSU-1.1 cells abrogates the ability of these cells to form tumors in athymic mice,

indicating the importance of extracellular matrix in the transformation of

immortalized human fibroblasts [188].

The fact that the cells of the MSU-1 lineage are isogenic, i.e. they are derived
from the same precursor, has allowed the study of genetic changes that occur
early in the transformation process and predispose the cells to malignant
transformation. Understanding the reason behind the ability of MSU-1.1 cells to
be malignantly transformed by certain oncogenes, while their precursor MSU-1.0
cells fail to do so, is important in fully understanding the mechanism by which

malignant transformation occurs.

42

The marker chromosomes that are present in MSU-1.1 cells may play a role in
predisposing MSU-1.1 cells to malignant transformation by the oncogenes
indicated above. Insertion of chromosome 15 in MSU-1.1 cells prevented their

transforrnability by overexpression of HRasV12

, and also the expression of the
same chromosome in cells derived from tumors formed by HRasVIz-transformed
MSU-1.1 cells, abrogated their tumor forming potential. Chromosomes 1, 11 and
12 did not have an effect, when studied similarly, suggesting that alteration of

chromosome 15 is important for predisposing cells to HRas-transformation

(Kaplan et al. manuscript in preparation).

43

Ras GTPase

Ras genes, including HRas, KRas and NRas, are prototypical examples of
oncogenes [189]. Approximately 30% of human tumors, particularly pancreatic
carcinomas, adenocarcinomas of the lung, myeloblastomas and colorectal
carcinomas contain activated Ras genes [57, 190, 191]. HRas and KRas were
discovered thirty years ago, when mouse leukemia viruses were injected in rats
giving rise to soft tissue sarcomas [192, 193]. These viruses encode for
oncogenic forms of HRas and KRas cellular genes. The same oncogenic forms of
Ras genes, encoded by the transforming viruses, were also found to be
expressed in human tumors. [194, 195] The expression of Ras oncogenes is a
causal factor for the ability of leukemia viruses to transform cells, as well as for
the malignant phenotype of human tumors. The other member of the Ras family,
NRas, was discovered in a human tumor of neural origin and plays an oncogenic

role in tumor formation as well [194-197].

The oncogenic form of Ras differs by a single point mutation, when compared to
the respective Ras proto-oncogene [198]. Although only one amino acid is
affected, this mutation is critical for the function of Ras. This is because the
protein that is encoded by the oncogenic form of Ras has the ability to evade
normal regulation and exhibits increased activity [198-200]. This increased
activity mediates a number of cellular functions, including enhanced proliferation

and survival, which are necessary for cancer formation.

44

Catalytic function

The members of the Ras family of genes encode for small G proteins. Unlike the
classic heterotrimeric G proteins, small G proteins lack the regulatory B and 7
subunits, and consist only of the catalytic a subunit [201]. Small G proteins,

including Ras family members, are GTPases, i.e., they can bind to, and hydrolyze

GTP to GDP [46, 47, 202].

This activity is mediated by six structural components of Ras that are conserved
among the family members and can be categorized into “G box” sequences[189,
203]. The G1 box, [aaaanxxxGK(S/T); a: L/lN/M, x: any amino acid] mediates
purine nucleotide binding, whereas the G3 box, [blbbexGl; b: hydrophobic, I:
hydrophilic] binds to Mg”. The G4 box, [bbbb(N/T)(K/Q)xD], forms hydrogen
bonds with the guanine ring, thus conferring specificity over binding to adenine.
The G5 box, [bbE(A/C/S/T)SA(K/L)], interacts indirectly with guanine nucleotides

and is less conserved among the family members.

The catalytic activity of Ras is cyclic over time, la, the hydrolysis of a GTP
molecule to GDP, is followed by the dissociation of GDP and the association of a
new GTP molecule, leading to a new cycle of hydrolysis [204]. Consequently, Ras
exists in two states (conformations): in one state, Ras is bound to GTP and in the
other, Ras is bound to GDP [205]. When Ras is bound to GTP, it interacts with its
effector proteins, a process that results in the activation of these effectors, which

then mediate the cellular functions of Ras [203, 206]. Structurally, this is mediated

45

by the 62 box, [Y DPTIEDSY], which adopts an orientation that has a high affinity
for Ras effectors, when Ras is in a GTP-bound state. This is due to
conformational changes on two loop regions on Ras, referred to as switch 1 and
switch 2 [205]. These changes are induced when GTP binds Ras. Upon
hydrolysis of GTP to GDP, the G2 box adopts an inactive conformation, and the
activation of Ras effectors is attenuated. The fact that Ras oscillates between an
active, GTP-bound conformation and an inactive, GDP-bound conformation,

enables this protein to function as a molecular switch to regulate cellular activity.

Regulation of Ras activity

Because Ras functions as a molecular switch, it is important that Ras is strictly
regulated in order to maintain normal cellular function (Fig. 3). The regulation of
Ras is based on two kinetic parameters that characterize Res-mediated catalysis:
(i) the dissociation of GDP from Ras is rate limiting, and (ii) the intrinsic GTPase
activity is low [207]. The dissociation of GDP is catalyzed by guanine nucleotide
exchange factors (GEFS) [204]. This process enables Ras to bind another GTP
molecule, which enhances its ability to activate its effectors. Furthermore,
guanine nucleotide dissociation inhibitors (GDls) bind Specifically to GDP-bound
Res and inhibit the dissociation of GDP, thus prolonging the inactive state[45,
208-210]. The hydrolysis of GTP to GDP is catalyzed by GTPase activating
proteins (GAPS). These enhance the rate of GTP-hydrolysis by Ras, leading to

the inactivation of Ras [211-213]. The point mutations present in the oncogenic

46

Figure 3. Res GTPase as a molecular switch. The ability of Ras GTPases to
hydrolyze GTP to GDP is associated with two distinct Ras conformations: an
active conformation, when Ras is GTP-bound, and an inactive conformation,
when R35 is GDP-bound. In normal cells, Ras oscillates between the inactive to
the active conformation and back. This is regulated by guanine nucleotide
exchange factors, including 808 and RasGEF, which catalyze the release of
GDP, and enhance Ras activation. Instead, GTPase activating proteins, such as
p120GAP enhance the intrinsic ability of Ras to hydrolyze GTP to GDP, 3 process

that leads to Ras inactivation.

47

93* Integrins

 

p120GAP

Figure 3

forms of Ras, e.g., at codons 12 or 61, render Ras resistant to GAP activity,
thereby prolonging the active state of Res, and leading to tumor formation [191,

214].

GEFS and activation of Ras

GEFS, including SOS, RasGEF and RasGRP, mediate the activation of small
GTPases. These GEFS are activated in a signal-specific manner, and each

displays specificity for the type of Rae-family GTPase that it activates.

SOS is the best studied Ras specific GEF. Structurally, SOS comprises of a
Cdc25 domain, a Dbl homology (DH), and a pleckstrin homology (PH) domain
[215]. The Cdc25 domain catalyzes the dissociation of GDP from Res, and is
conserved in Ras-specific GEFS. In addition, the C-terminus of SOS contains a
proline-rich region, which binds to the SH3 domain of the Grb2 adaptor protein.
This adaptor also contains an SH2 domain that is recruited to phospho-tyrosine
residues of proteins localized at the plasma membrane (e.g. transmembrane
receptors, or other adaptors). As Grb2 is bound to SOS, the recruitment of Grb2
to the plasma membrane facilitates the translocation of SOS to the plasma

membrane, where it activates Res [216].

This mechanism of SOS activation is responsible for mediating Ras activation by
several upstream receptors including RTKS, Integrins and G-protein coupled

receptors (GPCR). Upon binding to their ligands, tyrosine kinase receptors, like

49

the epidermal growth factor receptor (EGFR), dimerize and autophosphorylate
their own intracellular domains on tyrosine residues. These residues act as
docking sites for the SH2 domain of Grb2 and recruit the Grb2:SOS complex to
the plasma membrane [40, 217]. Other RTKS, notably the insulin growth factor
receptor (IGFR), recruit and phosphorylate adaptors, such as Shc, which then
become docking sites for Grb2:SOS [218]. In a similar fashion, Shc acts as a
docking platform for Grb2:SOS during the activation of Ras by integrins or by
heterotrimeric G-proteins. Upon binding to the extracellular matrix, integrins
dimerize and activate focal adhesion kinase (FAK), which in turn phosphorylates
Shc, thus potentiating the recruitment of Grb2:SOS to Shc [151]. Heterotrimeric
G proteins can activate Ras through their By subunit, in a process involving the
activation of Src, and Shp-mediated recruitment of Grb2:SOS to the plasma

membrane [219, 220].

In addition to the interaction with Grb2, the activity of SOS is also regulated by
phosphorylation. Extracellular-signal related kinase (ERK) and its effector
p90RSK, both phosphorylate and inactivate SOS in a negative feedback fashion
[221]. Furthermore, phosphatidyl inositols (i.e. PIP2) interact with the PH domain

of SOS to inhibit its activity [222].

The RasGEF family consists of the same structural domains (i.e., DH, PH and

Cd025) as the SOS family [223]. Their signal specificity, however, differs from that

of the SOS family. RasGEF are mediators of calcium induced-Res activation

50

[204]. These GEFS also contain an IQ motif, which binds to the calcium-
calmodulin complex leading to the activation of RasGEF [224]. The RasGRP
family is not only regulated by calcium, but its function also depends on

diaglycerol [223].

GAPS and inactivation of Ras

The ability of GAPS to inactivate Ras lies on their ability to interact with Ras and
enhance the rate of GTP hydrolysis by Ras [213]This activity is crucial for the
cycling of Ras between “on” and “off” states. The study of GTPase activating

0GAP and Neurofibromatosis-1 (NF1)) has been focused

proteins (including p12
mainly on p12OGAP, which consists of a C-teminal catalytic domain, two N-terminal
SH2 domains flanking and SH3 domain, a PH domain, as well as a lipid binding
domain[212]. The exact mechanism by which the activity of p120GAP is regulated

is still under investigation, but it seem that maximal activity is dependent not only

on the catalytic domain, but also on the SH2 and SH3 domains of p1206AP [225].

Posttranslational regulation

Although synthesized as a cytosolic protein, Ras is subjected to posttranslational
processing. This results in the dynamic interaction of Ras with cellular
membranes, including the plasma membrane, endosomes, and other intracellular
membranes [226-228]. This process is directed by the CAAX motif at the carboxy-

terminal of Ras. Initially, the cysteine residue of this motif is famesylated by a

SI

famesyl transferase [229]. Subsequently, an endopeptidase cleaves off the AAX
tripeptide [230], followed by methylation of the or-carboxy group of the
famesylated cysteine [231]. At this point, the processing of Ras proteins can
follow two distinct pathways, in an isoform specific fashion. HRas and NRaS
become palmitoylated on a cysteine residue on the amino terminal Side of the
famesylated residue, and are trafficked through the Golgi system to reach the
plasma membrane. In contrast, KRas lacks this cysteine residue and reaches the

plasma membrane in Golgi-independent mechanism[232].

Ras Effectors

Ras plays a central role in intracellular signal transduction, not only because
signaling pathways induced by various transmembrane receptors converge at the
level of Ras GTPase, but also, because, Ras regulates a number of diverging
signaling pathways that regulate many cellular functions. In this fashion, Ras acts
as a gearbox that guides cellular function in a particular environment. This
function of Ras relies on its ability to activate a number of effectors, including Raf,
Pl3K, Tiam1, RalGDS, Rin1, AF-6, RASSF1 and others. Based on their catalytic
functions such effectors can be classified into distinct groups consisting of: 1)
serine/threonine kinases (Raf), 2) phosphoinositide-3-kinases (Pl3K), 3) GEFS
(RalGDS, Tiam1 and Rin1), 4) lipases (PLCy), 5) adaptors (AF-6 and RASSF1)

and 6) RasGAPs (p120GAP and NF1) [233].

A Ras effector is defined as a protein that interacts specifically with the effector

domain of Ras, when Ras is in its GTP-bound form [233]. Effector proteins are

52

typically characterized by a domain that interacts with Ras. Three such domains
have been identified to date; the RBD domain of Raf and Tiam1, the RBD domain
found in the isoforms of the p110 subunit of Pl(3)K family and the Ras association
domain, such as the one present in RalGDS, Rin1, AF6 and others [233, 234].
Even though these Res-binding regions are different in their amino acid
sequences, their three dimensional conformations are similar. This is not
surprising, since all these regions interact with the effector-binding domain of Ras
(G2 box), and therefore, they need to have a structural conformation that fits that
of the G2 box of Ras. This review will focus on effectors of Ras, which have
critical and established functions in RaS signaling, as well as on a few additional
effectors that have been studied to a lesser extent, but may have a significant role

in Ras function (Fig. 4).

Raf

The Raf serine/threonine kinase is the best characterized effector of Ras. From a
structural perspective, Raf consists of three conserved regions CR1, CR2 and
CR3, which contains the catalytic domain [235]. Although the exact mechanism
by which Raf is activated is still under investigation, Ras interacts with two
domains, i.e., RBD and CR0 in the CR1 region of Rat [236, 237]. This association
results in the recruitment of Raf to the plasma membrane, and represents the

initial step in the activation of Rat [238]. The activation of Raf is also potentiated

53

Figure 4. Res effector pathways. The conformational change that is associated
with Ras activation enables Ras to interact with a number of effector proteins,

leading to the activation of many intracellular pathways and the regulation of

diverse cellular functions.

54

 

 

by additional factors such as 14-3-3, phosphatidyl serine, Hsp90 and

serine/threonine kinases [239].

Through the activation of Rat, Ras can activate the mitogen-activated protein
kinase (MAPK)-cascade. This cascade functions as a phosphorelay system, in
which kinases phosphorylate other kinases resulting in their activation in a
sequential fashion. This system is organized in MAPK kinase kinases (MAPKKK),

which activate MAPK kinases (MAPKK), and these in turn activate MAPKS [240].

Active Raf acts as a MAPKKK to activate MEK proteins by phosphorylation on
two serine residues (8217 and 8221 in MEK1). MEK proteins are dual-specificity
MAPKKS that phosphorylate ERK1 and ERK2 on threonine and tyrosine residues
(T202 and Y204 in ERK1), resulting in ERK activation [235, 241]. ERK proteins,
which are serine/threonine MAPKS, translocate to the nucleus when activated. In
the nucleus, ERKS phosphorylate and activate transcription factors (e.g. Elk1)
[242]. ERKS also activate cytoplasmic substrates, including kinases MSK1 and
p90RSk. Upon ERK phsohorylation, MSK1 and p90RSk translocate to the nucleus
where they activate other transcription factors (e.g. Fos, SRF), histones (e.g. H3)
and transcriptional regulators (e.g. CREB) [242]. In this fashion, Ras, through the
Raf/MEK/ERK pathway regulates gene expression at the transcription factor

level.

56

PI3K

Pl3Ks are lipid kinases that phosphorylate phosphoinositides on the 3’ position of
the inositol ring [243, 244]. P|3K consists of two subunits; a regulatory p85
subunit and a catalytic p110 subunit. The regulatory subunit consists of two SH2
domains which interact with phosphorylated tyrosine residues on activated growth
factor receptors [245, 246]. Since the region between the two SH2 domains is
tightly bound to the p110 catalytic subunit, the association of p85 with activated
growth factor receptors recruits the catalytic subunit to the plasma membrane,
were it can phosphorylate phosphoinositides. Furthermore, the p110 catalytic
subunit of PI3K interacts with Ras, when Ras is GTP-bound [247]. This
interaction is synergistic with the function of the p85 subunit to yield optimal

activation of PI3K in response to growth factors.

Activated PI3K converts Pl(4,5)P2 into Pl(3,4,5)P3, an important secondary
messenger that mediates its effects through its binding to plextrin homology (PH)
and FYVE domains [248, 249]. Therefore, proteins containing the PH domain,
including Akt, PDK, and Tiam1 are critical mediators of PI3K signaling. Akt, a
serine/threonine kinase, is the best studied effector of PI3K signaling. Through its
PH domain, Akt translocates to the plasma membrane and binds to PI(3,4,5)P3.
This results in a conformational change within Akt, which exposes two main
phosphorylation sites (T308 and S473) [250]. Subsequently, PDK
phosphorylates Akt, leading to the stabilization of its active conformation,

resulting in enhanced signaling activity by Akt.

57

The ability of Ras to promote cellular survival is mediated in part by the activation
of the Pl3K/Akt pathway. Akt, in particular, is important because it exerts a direct
effect on many pathways that regulate survival [251]. One of the substrates of
Akt, BAD, is a pro-apoptotic protein that binds to Bcl-2 and Bcl-X and inhibits their
anti-apoptotic potential. Phosphorylation of BAD on Ser136 by Akt results in loss

of inhibition of Bcl-2 and Bcl-X [252].

IKK, a serine/threonine kinase, is activated upon phosphorylation by Akt.
Subsequently, IKK phosphorylates the NFKB inhibitor IKB, which is then
ubiquitinated and targeted for degradation by the proteasome pathway. This
results in the activation of the NFKB transcription factor, which translocates to the

nucleus and transactivates a number of pro-survival genes[253].

Another important Akt substrate is the Forkhead family of transcription factors
(FoxO), which regulate the expression of apoptosis inducing factors, such as Fas,
TRAIL and TRADD [254]. Akt phosphorylation inhibits the function of FoxO

transcription factors, thus enhancing the survival potential of the cell.

MDM2 is an ubiquitin ligase that targets p53 for proteosomal degradation. Akt
phosphorylates MDM2 on two serine residues, which sustains its ubiquitin ligase
activity. This decreases the ability of p53 to induce cell cycle arrest and apoptosis

[255, 256].

58

Finally, GSK3 is primarily involved in regulating the conversion of glucose to
glycogen, although it has additional functions, including a role in B-catenin
signaling, as well as in cell cycle regulation[257]. GSK3 phosphorylation by Akt

results in the inhibition of GSK3 function[258].

Tiam1

Like Ras, Rho GTPases are molecular switches that regulate a number of cellular
functions [259]. The Rho family, which includes Rac1, Cdc42 and Rho, plays an
important role in mediating the functions of active Ras, particularly in the
regulation of the actin cytoskeleton and cellular migration. Nevertheless, the
mechanism by which Ras recruits this family has not been fully elucidated. One
possible mechanism involves PI3K and the production of the secondary
messenger PIP3. As noted above, PI3K interacts with proteins containing PH
domains and recruits them to the plasma membrane. Rho GRES have of PH
domains, and thus can be recruited to the plasma membrane by PIP3, a fact that
enhances the activation of Rho GTPases. Alternatively, RhoGAPs can be

regulated by Ral and p120GAP (see below).

An important step in determining the mechanism of Rho activation by Ras was
made by the discovery that Tiam1, a GEF for R301, is a direct effector of Res
[260]. Tiam1 contains a Raf-like RBD domain through which it interacts with Ras,

when the latter is in a GTP-bound state. In addition, Tiam1 consists of a catalytic

59

DH/PH domain, characteristic of RhoGEFs, as well as a N-terminal PH domain,
which can bind to PIP3. The presence of a PH domain on Tiam1 indicates that, in
addition to Ras, Tiam1 can be activated by PI3K [261]. Tiam1 requires membrane
localization and threonine phosphorylation for maximal function [262, 263],
suggesting that these are necessary regulatory steps in Tiam1 activation. In
addition, Tiam1 is regulated by an autoinhibitory region and a PEST domain, both
of which are located on its N-terminus. The PEST domain targets Tiam1 for
degradation, a process that results in the cleavage of the autoinhibitory region
and increased activity of Tiam1 [264]. Although the interaction of Ras with Tiam1
enhances the translocation of Tiam1 to the plasma membrane, whether Ras has

an effect on the other aspects of Tiam1 activation remains unknown.

RalGEFs

The RalGEF family members, including RalGEF, le and Rgl, catalyze guanine
nucleotide exchange for Ral GTPases. RalGEFs interact directly with Ras, in a
GTP-dependent manner [265]. This interaction is dependent on the RA region of
RalGEFs, which is very Similar in structure to the RBD of Raf1 [266]. The
interaction with Ras causes the redistribution of RalGEFs to the plasma

membrane, where they can activate Ral GTPase [267].

Ral has a number of targets that appear to mediate its activity. Ral interacts with
PLD1 and Arf, suggesting that Ral plays a role in vesicular tansport [268]. RaIBP1

is a putative effector of Ral that interacts with tyrosine phosphorylated proteins

60

(Pob1 and Reps1), which complex with EGFR and are homologous to proteins
that regulate receptor endocytosis [269]. Furthermore, RalBP1 has GAP activity,
which is Specific for Rac1 and Cdc42 GTPases, an ability that implicates Ral in

the regulation of Rho GTPases [270].

MEKK1

MEKK1 interacts with GTP-bound Ras through its C-teminal region, [271].
MEKK1 is a serine/threonine kinase MAPKKK, which regulates a Similar MAPK-
cascade to that regulated by Raf. MEKK1 activates MKKs, which then activate
p38 or JNK [272]. Active p38 and JNK translocate to the nucleus where they
activate transcription factors and regulate gene expression. It is important to note
that although these MAPKS function primarily in the nucleus, they also regulate

cytoplasmic enzymes.

Rin1

Ras interacts with Rin1 in a GTP-dependent manner, through its effector-binding
domain. Rin1 is a GEF for Rab5 GTPase, which is involved in receptor-mediated
endocytosis [273]. This process may be facilitated by the ability of Rin1 to interact
with tyrosine phosphorylated receptors through its SH2 domain [274]. In addition
to Rab5, Rin1 interacts with Abl tyrosine kinase to enhance its catalytic activity
[275]. The interaction with Ras enhances the ability of Rin1 to activate the Rab5

GTPase, as well as the ability of Rin1 to activate Abl [273].

61

AF-6

AF-6 is another protein that interacts with Ras in its GTP-bound state [276]. Ras
interacts with the RA region of AF-6, an interaction that interferes with the binding
of Raf to Ras. Although the function of AF-6 in the cell remains unknown, this
protein interacts with the Rap1 GTPase, profilin, and with Eph receptors [277-

279] and may be involved in signal transduction at cell-cell junctions [279].

RASSF

RASSF proteins (including NORE1 and RASSF1), interact with GTP-bound Ras
through their RA region [280]. Interestingly, the expression of these proteins is
lost in several tumors [281, 282]. In addition, in vitro and in vivo studies propose
that these protein have anti-proliferative functions, thereby acting to suppress
Ras-transforrnation. lmportantly, RASSF1 and NORE heterodimerize, and form a
complex with Mst1, a serine/threonine kinase that enhances caspase-3 activation.
Ras associates with this complex, and induces apoptosis by means of caspase-3

activation [283].

Cellular functions mediated by Ras

Regulation of cell cycle and proliferation

One of the most important cellular effects induced by active Ras is the

progression through cell cycle, leading to cellular replication. Expression of a

62

dominant negative form of Ras inhibits G1-)S cell cycle progression, whereas

progression is enhanced upon expression of oncogenic Res [284].

G1->S progression is regulated mainly by the activity of the Rb protein, which is
normally in a hypophosphorylated form. In this form Rb sequesters and inhibits
the function of E2F transcription factor. Rb phosphorylation is regulated by
cyclinzCDK complexes. The cyclin D:CDK4 complex, in particular,
hyperphosphorylates Rb, a process that attenuates the inhibition of E2F by Rb.
This results in the transcriptional activation a number of E2F-dependent genes

that are important for cellular proliferation.

The primary regulatory function of Ras at this stage of the cell cycle is to
inactivate the suppression of E2F by Rb [285]. The activation of Raf/MEK/ERK
pathway by Ras, induces the expression of cyclin D1, which as described leads to
the activation of E2F [286]. The activation of additional Res-effector mediated
pathways, including those mediated by PI3K and Rac1/Cdc42 are also important
in mediating the inactivation of Rb by Res [287, 288]. PI3K regulates the
expression of cyclin D1 through GSK3. GSK3 phosphorylates cyclin D1 and this
initiates the degradation of cyclin D1 through the proteasomal pathway. Pl3K, by
means of an Akt-dependent function, inhibits the activity of GSK3, thus sustaining
the levels and activity of cyclin D [289]. Rac1 is also important in inducing cyclin D

accumulation, in a process that is dependent on the activation of NFKB [290].

63

In addition to the regulation of Rb, Ras can also regulate cell cycle inhibitors,
such as p21 and p27, to promote G198 transition. Through the Raf/MEK/ERK
pathway, Ras can decrease p27 levels both transcriptionally and through
proteosomal degradation [50, 291]. What is more, activation of PI3K by Ras
results in the inactivation of FoxO-dependent transcription, including the
transcription of p27 [292]. Also, the activation of Rho induces the formation of
cyclin E:CDK2 complex, which phosphorylates p27, and provides a signal for the

ubiquitination and degradation of p27 [293].

Ras may also inhibit cell cycle progression depending on the context of its
activation. Expression of Ras oncogene in primary fibroblasts leads to INK4a and
p53-dependent cellular senescence, whereas inactivation of these proteins
results in evasion of the senescent phenotype [294]. Downstream of Ras, even
Raf can have different outcomes on cell fate. Whereas moderate levels of Rat
activation result in enhanced proliferation, through the cyclin D pathway, high

levels of Raf activation result in p21-mediated cell cycle arrest [295].

Regulation of protein synthesis

Ras can regulate protein synthesis through the Pl3K/Akt pathway. In addition to
its other functions, Akt also exerts control over the Rheb/mTOR pathway by
phosphorylating and inactivating TSC1/2 proteins [296]. TSC1/2 proteins act as
GAPS for Rheb GTPase, which activates the mammalian target of rapamycin

protein (mTOR) [297], and this in turn activates p7086K and 4EBP1 [298, 299].

64

p7086K phosphorylates the S6 ribosomal protein. This results in the translation of
enzymes that make up the protein synthesis apparatus. Normally, 4EBP1 inhibits
translation by sequestering the translation elongation factor elF4E. mTOR
phosphorylates 4EBP1 and induces the release of elF4E, facilitating the initiation

of translation [300].

Regulation of apoptosis

In addition to its role in cell proliferation and cell cycle progression, Ras can also
regulate cellular programs that control apoptosis. Several of the effectors that are
activated by Ras are important in mediating this function of Res, and their
outcomes, with respect to apoptosis, depend on the particular effector that is
activated. For example, activation of PI3K by Ras activates survival pathways,
whereas activation of RASSF1 leads to activation of cell death pathways. In some
cases the activation of the same effector may lead to distinct apoptotic fates

within the same cells, as is the case with the activation of Raf.

The activation of survival pathways by the Ras effector PI3K is mediated by the
activation of Akt. As indicated above, the ability of Akt to prevent programmed cell
death is in turn mediated by a number of Akt effector substrates. Akt can inhibit
BAD, thus preventing Bcl-2 and Bcl-X induced cytochrome c release from
mitochondria [301]. In addition, Akt can regulate apoptosis by regulating
transcription factors as NFKB and FoxO, which regulate cellular fates via the

transactivation of anti- and pro- apoptotic genes, respectively. Akt can intercept

65

the p53 apoptotic pathway at the level of MDM2, thus protecting the cell from
DNA-damage induced apoptosis [302]. What is more, Ras can promote survival

via Rac1-dependent activation of NFI<B [303]. Thus, it appears that Ras activation

of NFKB requires synergistic signaling from both Rac1 and Pl3K/Akt pathways.

Whereas P|3K and Rac1 activation promotes survival pathways, the
Raf/MEK/ERK pathway can either enhance or inhibit apoptosis, in a context-
Specific manner. In fibroblasts deprived of serum, Ras induces apoptosis in a
Raf/MEK/ERK-dependent fashion [304]. In other systems, Raf can induce
apoptosis in a MEK/ERK-independent fashion, suggesting that other effectors
may mediate the pro-apoptotic function of Raf [305, 306]. Despite this pro-
apoptotic function, Raf can enhance cellular resistance to p53-mediated
apoptosis. In Ras-transfonned fibroblasts, activation of Raf/MEK/ERK elevates
the expression of MDM2, which acts to degrade p53, thus facilitating cellular

survival [307].

Regulation of the actin cytoskeleton

The actin cytoskeleton plays a crucial role in cellular morphology and function.
The cytoskeleton is regulated in a dynamic manner through the synergistic
function of Res and Rho GTPases (Rho, Rac1 and Cdc42). In particular, Rho
GTPase is important for stress fiber formation and focal adhesion formation, Rac1
mediates cellular ruffling and lamelipodial protrusion, and Cdc42 is involved in

filopodial formation and actin microspike formation [308]. R33 can activate R301

66

directly, through the interaction of Ras with Tiam1, or indirectly, through PI3K and
the elevation of PIP3, which then binds to the PH domain of Rho GEFS leading to
their membrane localization and their subsequent activation [309]. How Ras
regulates Rho and Cdc42 function is not clearly understood, but it may involve
Pl3K/PlP3-dependent, p1 ZOGAP-dependent or Ral/RalBP1-dependent

mechanisms.

Regulation of cellular migration

Rho GTPases play an important role in the regulation of cellular migration. Rac1
is necessary for the initiation of cellular movement in fibroblasts and epithelial
cells [310, 311]. Cdc42 mediates the polarity signals needed for unidirectional
movement toward a stimulus [312]. In addition, Rho is required in order to
maintain cell adhesion during movement [310-313]. Ras itself is involved in the
regulation of cellular migration, in a cell type-specific mechanism [314]. In
endothelial cells, the effect of Ras in migration is mediated by ERK. Through the
phosphorylation of MLCK, ERK increases the level of phosphorylated myosin,
therefore increasing cellular contractility [315]. In fibroblasts, the effect of Ras is

p
OGA

mediated by decreasing the activity of Rho, though p12 , which, in addition to

serving a GAP activity for Ras, acts as an effector of Ras function as well. In

OGAP ORhoGAP

particular, p12 interacts with p19 , which regulates the activity of Rho

proteins [316, 317].

67

Regulation of invasion and metastasis

The processes of invasion and metastasis are in part regulated by matrix
metalloproteinases (MMP). These enzymes are involved in the turnover of
extracellular matrix through proteolytic degradation, and are commonly expressed
by tumor cells resulting in the degradation of the surrounding matrix, and
facilitating tumor invasion and metastasis. Constitutively active Ras signaling
induces the expression of MMP proteins in a cell type specific manner [318, 319].
This induction is mediated in part by Ets and AP1 transcription factors that can be
activated by Ras in a MAPK-dependent manner[320], and also by the NFKB
transcription factor [321]. Ras has also been implicated in tumor metastasis, a
property that may be dependent on the induction of Met expression by oncogenic

Ras [322, 323].

68

Sprouty

Sprouty was identified as a repressor of tracheal morphogenesis in Drosophila
melanogaster (D.m.) [324]. This process is under the regulation of fibroblast
growth factor (FGF) signaling, which acts through the FGF receptor (FGFR) to
induce secondary branches near the tips of the primary branches of the
Drosophila’s tracheal tube [325, 326]. Spry mutants exhibit overactive FGF
signaling and develop ectopic branches on the stalks of primary branches[324]. In
addition, D. m. Spry plays a role in eye development, a process that is regulated
by epidermal growth factor receptor (EGFR) signaling. Loss-of-function Spry
mutants have excess photoreceptors, cone cells and pigment cells [327]. Further

studies showed that Spry is a general inhibitor of RTK signaling in D. m. [328].

Mammals express four Spry isoforms, which also repress RTK signaling [329-
332]. Mammalian Spry proteins regulate additional developmental programs,

including bone development [333], oogenesis [334] and angiogenesis [335].

Spry has emerged as an important repressor of RTK signaling and a great deal of
effort has been placed in determining the specific functions of Spry, as well as the
regulatory machinery by which these functions of Spry are controlled.
Understanding the function of Spry, has been complicated recently, given that
some mammalian Sprys can also potentate RTK signaling, particularly in
response to EGF stimulation. This review will provide a summary of the function

and regulation of Spry in mammalian cells, focusing on Spry2, which, in addition

69

to being the best characterized Spry isoform, exhibits a dual activity, both as an

activator, as well as a repressor of RTK signaling.

Sprouty structure

The first member of the Spry family to be identified, i.e., the D. m. Spry, encodes
a 63 kDa protein containing a unique 143 cysteine-rich region on its C-terminus
[324, 327]. Mammalian cells express four Spry isoforms (Spry1-4) that are
considerably smaller than the Drosophila ortholog (approximately 30-40 kDa).
These isoforms exhibit a significant homology on the C-terminal half of the
protein, including the cys-rich region, which spans almost the entire C-terminus of
mammalian Spry proteins. The N-teminal region of mammalian Sprys differs

significantly among isoforms [334, 336, 337].

Studies have identified several structural elements that are necessary for Spry
function (Fig. 5). Although exhibiting differences among Spry isoforms, the N-
terrninus of Spry proteins contain a small conserved amino acid region with a
tyrosine residue (Y55 on Spry2). This residue becomes phosphorylated upon
growth factor stimulation [338-340], and serves as a docking site for the SH2
domains of Grb2 [340] or c-Cbl [338, 339]. Despite relying on the same structural
element, these interactions have distinct consequences on cellular function as it

will be described below.

70

Figure 5. Structure of Spry. (A) Spry proteins contain a conserved cysteine-rich
C-terminus and a variable N-terminus. Several important Spry2 structural
elements are shown in this figure. The tyrosine residue on position 55 becomes
phosphorylated upon growth factor stimulation, creating docking Site for the SH2
domains of Grb2 and c-Cbl. Spry2 contains three proline rich motifs (PxxPR) that
act as docking Sites for the SH3 domains of CIN85. Upon growth factor
stimulation, Spry2 translocates to the plasma membrane, a process mediated by
a unique translocation domain on Spry2. This domain targets Spry2 to
phosphatidyl inositol (4,5) bisphosphate (Ptdlns(4,5)P2). R252 is indispensable
for this process. Finally, the region spanning amino acids 208-239 on Spry2 has
been implicated in the interaction between Spry2 and Raf, as well as in the ability
of Spry proteins to form dimmers. (B) The alignment of several structural
elements between Spry members is shown. The numbers in bold represent

positions on the Spry2 sequence.

71

 

 

 

 

 

 

 

 

 

 

 

 

 

SH2 Diiig
Docking Translocation -
AL. A
190 265
9 9 c Spry2
Y55 97 142 178 Y227 R252 315
Raf-Binding/ Ptdlns(4.5)P2,
Dimerization Binding

 

B.

SH2 Docking Site

Spry1 GHHET‘ a
Spry2 NTIIEI
Spry4 VENT)? IDIIP
Spry3 A II I'IJEIYIP

51 *:* . E13

 

 

Ser-rich Region

Spry1 STSTGSAASSO----SNSSASSEOCLLGRSPPTRPVPGHRSERAIRTQPK
Spry2 SIST SSGSRSSTRTSTSSSSSEQRLLGSSFSSGPVADG-——-IIRVQPK
Spry4 eve ———————————— TSSDQRLLDHMAEP- PVADQA SPPAVRIQPK
Sprv3n SIASS --------- HSHSTTASDQRLLASITPS— ESGQS———-IIRTQFG

ll:::l:l In. l> 15:1155

Translocation Domain' Raf-Bindin Re ion

 

Spry1 GECTAPR‘TLFSCLACIIRQCLCSAESI‘I‘vv‘EYGTCi-ICIVR GIT” CSN
Spry2 KECTYPRPLPSDUICDPZQCLCSRQNVIDYGTCVCC FPGLE' HCSN
591‘94 ifECASE‘ RTLPSCU'JCNQECLCSRC ITL‘J tI'I’GTCtICL'v'QCI r ESHCTN
Spry1; V PCT RE LPDCULCNQI‘ CLCSHESLLDYGTCLCCV “iiE‘GL' CST

I; ’ll‘l I1; lllll: .::lIII:N 16:16

Spry1 DDECDSYSDIIPCSCSQSHCCflLCIIGAIvISLFLPCLLCYPPRiCGCLI-(I.
Spry2 DDE-DNCADIIPCSCSQSHCC [1’.9314IIG’JItSLFLPCLIJCYLPAi-(CCLKI.
Spry4 EDDEGSCADHi-"(I‘EICSR'C IICCAT ISFIICA LS‘.’VLPCLLCYLPATGCVKL
Spry3 DDE— DIICADEPCSCGPSSCF'sz. ’AllSLISLFLPCLCCYLE‘THGCLHL

:l III-HI :- lr Ir ;~;-n~1 ‘1 II; nr3;1278

'héll'

  
  

FMum5

72

Additional regulatory elements, which have been studied to a lesser extent than
the N—terminal phosphorylation site of Spry, reside within the conserved cys-rich
region. The region encompassed by amino acids 178-315 on Spry2 has been
defined as the Spry translocation domain[341] and regulates the localization of

Spry to plasma membrane upon growth factor stimulation.

Spry proteins form homo- and hetero-dimmers with other isoforms. The structural
element important for this function is located in a region spanning position 209-

238 on mSpry1 [340].

Spry proteins interact with Raf kinase through a Raf binding domain spanning
residues 209-240 on Spry2. Surprisingly, the region important in Raf binding

spans the same residues as does the region important for Spry dimerization.

Recently a novel growth factor-specific tyrosine phosphorylation site was

discovered on the C-terminus (Y227) of Spry2 [342]. Phosphorylation at this site

appears to regulate if Spry inhibits or potentates RTK signaling.

Finally, Spry2 contains three PxxPR motifs on positions 64, 72 and 309, which act

as biding sites for the SH3 domains of CIN85 [343].

73

Sprouty expression

In Drosophila, Spry is expressed during tracheal [324] and eye development
[327], as well as in midline glia [344], in wing veins and in ovarian follicle cells
[344, 345]. These developmental processes are under the control of FGF or EGF
[328], and loss-of-function mutations in Spry mimic the loss of expression of these

growth factors in these tissues.

In vertebrate embryos, such as the mouse and chick embryo, Spry protein
expression is induced by FGF, and not surprisingly, it is more prominent in the
locations where FGF signaling predominates [346]. These include the primitive
streak, the forebrain and the hindbrain. It is important to note, however, that the
expression of Spry genes in these tissues occurs in an isoform-specific fashion.
For example, Spry2 and Spry4 are expressed in the primitive streak, whereas
Spry1 is not, and Spry1 and Spry2 are expressed in the midbrain region, whereas

Spry4 is not [333].

In the mouse, Spry genes are also expressed during organogenesis of the
cochlea and semicircular canals, the teeth, the lungs, the digestive track, and the
kidneys [347]. In the semicircular canal and the teeth, Spry1 and Spry2 are
expressed in the epithelium, whereas Spry4 is expressed in mesenchymal or
neuronal tissue. In the lung, Spry1, Spry2 and Spry4 are all expressed in

epithelial tissue. In the kidney, Spry1 is expressed in the ureteric bud, whereas

74

Spry2 and Spry4 are expressed in the ureteric bud, mesenchyme and

glomerulus.

In the adult tissue, Spry1 is expressed in the heart, lung and kidney [348], Spry2
is expressed in the brain, heart, lung and kidney [349] and Spry4 is expressed in
liver, skeletal muscle, heart, lung, kidney, spleen, plaCenta and small intestine

[350].

Consistent with the observations described above, the expression of Spry in
cultured fibroblasts or endothelial cells is induced by growth factor stimulation
[351]. At a molecular level, this is in part dependent on ERK activation, as
selective inhibitors of MEK abrogates FGF-induced Spry2 and Spry4 expression
[351]. Alternatively, FGF may induce the expression of Spry1 and Spry2, in an
ERK-independent fashion, through the activation of PLCy and calcium-dependent
signaling, as demonstrated in a study were calcium chelation and PLCy inhibition

abrogated the induction of Spry by FGF in a mouse chondogenic cell line [352].

At the transcriptional regulation level, the expression of Spry genes, particularly
the expression of Spry1, is regulated by the WT1 transcription factor. WT1
directly associates with, and activates the Spry1 promoter. Also, expression of
wild type, but not of catalytically inactive mutant WT1, induces the expression of
Spry1 in osteosarcoma cells [348]. Furthermore, analysis of the promoter region

of Spry2 revealed the presence of several cis-activng elements for AP2, CREB,

75

ETS and Sp1, leading to the hypothesis that the expression of Spry2 may be

regulated by these transcription factors/regulators [353].

Sprouty localization

Initial studies on the localization of Spry in Drosophila m. showed that Spry is
associated with the inner leaf of the plasma membrane [327]. In mammalian cells,
however, the attempt to determine the exact localization of Spry proteins has lead
to several findings. In human embryonic kidney cells, Spry2 localizes to
membrane ruffles upon stimulation with EGF [341, 354]. In the absence of
stimulation, Spry proteins attain a diffusely cytoplasmic localization, while Spry2
co-localizes with microtubules [341]. Other studies have found that in Chinese
hamster ovary cells, Spry2 is associated with vesicular structures resembling
endosomes upon EGF-stimulation. These same structures become loaded with
EGFR, under the same stimulation [338, 339]. It may be that Spry2 localizes in
both of these structures, in a cell-type specific matter, given that in mouse
fibroblasts, Spry2 translocates both to vesicular structures, as well as to the

plasma membrane, upon EGF stimulation [355].

In endothelial cells, Spry1 and Spry2 are located in the perinuclear region and in
vesicular structures, under serum starvation conditions. Upon growth factor
stimulation, they translocate to the lamelipodia at the leading edge of the plasma
membrane [356]. In this system, Spry proteins directly interact and co-localize

with calveolin-1, but do not localize in lipid rafts [356].

76

The translocation of Spry protein to the plasma membrane is necessary for their
activity, because it facilitates the phosphorylation and subsequent activation of
the proteins [340]. One possible mechanism employed by Spry proteins in order
to attain their membrane localization is the use of a unique translocation domain
(SpryTD) located in the C-terminal region [341]. Deletion of the region spanning
residues 178-221 in Spry2 abolishes the EGF-induced translocation of Spry2 to
the plasma membrane [341]. The translocation of SpryTD to the plasma
membrane is downstream of active Rac1. Rac1N17 (a dominant negative mutant)
inhibits the translocation of SpryTD [341, 354]. A later study found that the
SpryTD specifically interacts with Ple [354]. This was demonstrated by the co-
localization of SpryTD with the PH domain of PLCS, which interacts with Ple at
the plasma membrane, as well as by the direct association of SpryTD with Ple-
bound lipid vesicles. The importance of the association between SpryTD and PIP2
was evaluated with a Spry2 mutant (Spry2R2520), which fails to interact with Ple.
This mutant Spry2 is incapable of repressing MAPK activation in response to FGF
stimulation, unlike wild type Spry2, which localizes to PIP2 and inhibits MAPK

activation [354].

Alternatively, Spry proteins are targeted to the plasma membrane through
palmitoylation. Evidence for this modification comes from a study were
radiolabeled palmitate was incorporated in Spry, which was ectopically expressed

in endothelial cells [356]. Nevertheless, the palmitoylating enzyme, the position

77

on Spry, and whether it takes place in additional cell types, are questions that

remain to be answered.

Regulation of Sprouty

Spry proteins function in a negative feedback fashion to repress RTK-dependent
MAPK activation induced by FGF, PDGF, VEGF and HGF/Met. Surprisingly, in
EGF-induced signaling, Spry is involved in a positive feedback loop, sustaining
EGFR and MAPK activity. The involvement of Spry proteins in both negative and
feedback loops, in a signal signal-specific fashion, suggest an important role for
Spry in the regulation of RTK signaling. With this in mind, it is important to

consider several mechanisms that regulate the function of Spry.

Phosphorylation of the N-terminus of Sprouty

The activity of Spry proteins is mainly regulated by the phosphorylation of a
conserved tyrosine residue on the N-terminus of Spry (Y53 and Y55 in the case
of Spry1 and Spry2, respectively) [338-340]. This phosphorylation has been
observed in various cellular contexts, including fibroblasts and endothelial cells of
both human and murine origin. The phosphorylation of Spry is induced by
stimulation of the cells with growth factors such as EGF, FGF and PDGF [334,
336, 337, 357]. Spry isoforms exhibit different propensities for phosphorylation in
response to different growth factors [355]. Spry1 is more likely to become

phosphorylated upon stimulation of fibroblasts by FGF and PDGF whereas Spry2

78

is more likely to be phosphorylated in response to EGF and FGF. Furthermore,
the kinetics of Spry phosphorylation may differ in a growth factor-specific manner.
For example, Spry2 exhibits a relatively transient tyrosine phosphorylation in
response to EGF stimulation, whereas in response to FGF signaling, the tyrosine

phosphorylation of Spry2 exhibits a sustained profile [355].

The phosphorylation of Spry is necessary for the ability of Spry to regulate MAPK
activation in response to growth factor stimulation. Spry mutants that are
incapable of becoming phosphorylated on this conserved tyrosine residue (e.g.

2”“), fall to repress ERK activation in response to FGF, contrary to the

Spry
ability of wild type Spry proteins [340]. Given that these mutants can still
translocate to the plasma membrane, it has been proposed that they have a

dominant negative function [340, 358].

Unlike the wild type protein, Spry2Y55A fails to sustain EGF signaling as well,
suggesting that phosphorylation of Y55 is also important for the ability of Spry2 to
sustain EGFR signaling [338]. These findings suggest that the ability of Spry2 to
repress RTK signaling, as well as the ability of Spry2 to sustain EGFR signaling,

rely, in part, on the same molecular mechanism, i.e. the phosphorylation of Y55.
The phosphorylation of Spry on Y53/55 (Spry1/2) has several implications, which

attest dependence of Spry2 function on phosphorylation. One of the first studies

to identify the phosphorylation of Spry1 and Spry2, demonstrated that in mouse

79

myoblast cells this phsophotyrosine residue serves as a docking site for the SH2
domain of Grb2. Grb2 mutants with a defective SH2-domain fail to interact with
Spry1 or Spry2 [340]. In addition, this interaction is abrogated by mutations in the
amino acids adjacent to the phosphotyrosine residue (T56l and E570 in Spry2),
indicating that these residues are also necessary for the interaction between

Spry2 and Grb2.

The tyrosine phosphorylation of Spry2 on residue 55 is important for the
interaction between Spry2 and the E3 ubiquitin ligase c-Cbl [359, 360]. Normally,
c-Cbl ubiquitinates EGFR and targets this receptor for degradation. c-Cbl
contains an atypical SH2 domain through which it interacts with phosphotyrosine
residues on its substrates, such as EGFR and Zap70 [361]. Upon growth factor
stimulation, Spry2 becomes phosphorylated on Y55, a site that then acts as a
docking site for c-Cbl’s SH2 domain [338, 339]. In this fashion, Spry2 competes
with EGFR for binding to c-Cbl, a process that prevents the degradation of EGFR.
The region flanking Y55 on Spry2 is highly conserved among Spry isoforms, and
several amino acids in this region (i.e. N53, P59 and G58) are also important for
the Spry2-c-Cbl interaction. Consistently, mutations in these residues abrogate
the Spry2-c-Cbl complex, regardless of the fact that Y55 phosphorylation is
unaffected [362]. It should be noted that Spry2 interacts with c-Cbl even in the
absence of growth factor stimulation, albeit this occurs at low levels [338, 339,
362]. This interaction may be attributed to the ability of Spry2 to interact with the

RING finger of c-Cbl [363].

80

Sprouty-2 kinase

In view of the importance of the phosphorylation of Spry2 on Y55, efforts have
been made to identify the kinase that phosphorylates Spry2. A recent study
proposes that Src, activated by FGFR in a FRSZ-dependent fashion,
phosphorylates Spry2 on Y55. The same study demonstrated that Spry2 is a

direct substrate for Src in vivo and in vitro [364].

Another study suggests that EGFR phosphorylates Spry2 on Y55, in response to
EGF stimulation [338]. Although a direct complex formation was not shown,
EGFR was found to coimmunoprecipitate with Spry2, and immunoprecipitated

EGFR was found to phosphorylate recombinant Spry2.

Sprouty-2 phosphatase

Phosphorylation frequently serves as a molecular switch to regulate protein
activity. In many cases, including Spry2, phosphorylation leads to the activation of
the protein function. In order to maintain normal cellular function, proteins that are
activated by phosphorylation must be inactivated. This process is accomplished,
in part, via the de-phosphorylation of proteins by phosphatases. In the case of
Spry2, recent evidence implicates Shp2 as the phosphatase responsible for the
inactivation of Spry2 [365]. Shp2 is a widely expressed protein-tyrosine

phosphatase that mediates MAPK activation in response to growth factor

81

stimulation [366]. Shp2, through its SH2 domain is recruited to phosphotyrosine
residues on RTK, where it dephosphorylates the receptor. Alternatively, Shp2 can
function as a molecular adaptor for cellular proteins such as Grb2 [367].
Expression of Shp2 in murine myogenic cells decreases the phosphorylation of
Spry2, and recombinant Shp2 reduces the level of phosphorylation on
immunoprecipitated Spry2. Dephosphorylation of Spry2 by Shp2 results in the

dissociation of Spry2 from Grb2, and decreases the inhibition of FGF signaling by

Spry2.

Sprouty-2 ubiquitination

Another regulatory mechanism for Spry2 involves ubiquitination and proteosomal
degradation. Stimulation with either EGF or FGF stimulation results in the
ubiquitination of Spry2, followed by a decrease in the levels of Spry2 protein. The
ubiquitination of Spry2 is attributed to its interaction with c-Cbl. Co-expression of
Spry2 with c-Cbl results in ubiquitination of Spry2, while co—expression of Spry2
with c-Cbl mutants that are defective in their ability to ubiquitinate does not lead to
ubiquitination of Spry2 [338, 339]. Also, expression of a Spry2 mutant that cannot
interact with c-Cbl (Spry2Y55A) in cells with high levels of endogenous c-Cbl, does

not result in ubiquitination and degradation of Spry2 following EGF-stimulation.

82

Phosphorylation of the C-terminus of Sprouty-2

An important characteristic of Spry2 is that it can sustain EGF-induced signaling,
while also inhibiting FGF- induced signaling. A recent study by Rubin et al. [342]
has made an important effort in explaining the molecular mechanism underlying
this function. As noted above, Spry2 is phosphorylated on its N-terminus (Y55) in
response to EGF or FGF stimulation. Nevertheless, Spry2 also becomes
phosphorylated on several tyrosine residues located on its C—terminus. These
sites are specifically phosphorylated in response to FGF stimulation, and they are
necessary for maximal inhibitory function of Spry2 in FGF-induced signaling.
Among the C-terminal tyrosine phosphorylation sites, residue Y227 is the most
important for the efficient inhibition of FGFR signaling by Spry2 [342]. Thus, the
inhibitory function Spry2 in RTK signaling appears to be a response to signals
that stimulate phosphorylation of both the N-terminal Y55 and the C-terminal
Y227 residues, whereas the function of Spry2 as an activator of RTK signaling

may be a response to phosphorylation of Y55 alone.

83

Cellular functions of Sprouty

Inhibition of receptor tyrosine kinase signaling

The cellular function of Spry proteins that is conserved among different species,
is the ability of Spry proteins to inhibit receptor tyrosine kinase signaling (Fig. 6A)
[334]. To date, Spry proteins repress RTK signals induced by growth factors,
including FGF, PDGF, VEGF and HGF/Met, and therefore play an important role
in regulating the biological processes mediated by these signals [329, 340, 356,

368].

RTK signaling is initiated by an extracellular ligand that activates a
transmembrane receptor, which undergoes dimerization and
autophosphorylation, leading to the recruitment of adaptor and effector proteins,
which engage a number of diverse intracellular pathways [40]. Nonetheless, Spry
proteins appear to inhibit specific RTK-induced intracellular pathways, which
results mainly in the activation of the MAPK-cascade leading to ERK. It does not,
however, appear to regulate JNK and p38 MAPKS, at least in response to FGFR
activation [369]. In some cases, Spry2 inhibits Akt activation [368, 370], although
the mechanism and the consequence of this function have not been fully

elucidated.

The exact location along the RTK-Ras-Raf/MEK/ERK cascade where Spry exerts

its inhibitory role remains under investigation. It appears that Spry acts in a signal

84

Figure 6. Regulation of RTK signaling by Spry. (A) Spry inhibits FGFR-mediated
signaling. In the absence of Spry, binding of FGF to its receptor leads to tyrosine
phosphorylation of the receptor and the scaffold protein FRSZ, producing docking
sites for the Grb2:SOS complex. Recruitment of this complex to the localization
of the receptor leads to the activation of Ras, which in turn activates the
Raf/MEK/ERK cascade through the direct activation of Raf. When Spry is
present, it interacts with Grb2 and prevents Grb2:SOS from being recruited to
FGFR, leading to diminished activation of ERK in response to FGF. (B) Spry
inhibits VEGFR-mediated signaling, through a different mechanism than that
involved in the regulation of FGFR. In this context, Spry is involved in the
regulation of Ras-lndependent Raf activation. In the absence of Spry, the
activation of VEGFR results in the activation of PKC, in a PLCy-mediated
pathway. PK05 activates the Raf/MEK/ERK pathway through the phosphorylation
and activation of Raf. Spry interacts with Raf and prevents the activation of Raf
by PKCé, inhibiting ERK activation in response to VEGF stimulation. (C) The
activation of EGFR induces a signaling pathway that is similar to that induced by
FGFR. EGFR is regulated by a number of mechanisms, one of which involves c-
Cbl and CIN85. c-Cbl, an E3 ubiquitin ligase, ubiquitinates EGFR and targets it
for degradation. CIN85 is involved in receptor endocytosis and facilitates the
function of c-Cbl. These functions result in the silencing of receptor mediated
signaling. Spry2 interacts with c-Cbl and CIN85, and prevents the degradation of
EGFR. This results in sustained signaling activity from this receptor, culminating

in enhanced activation of ERK.

85

 

 

86

specific and/or in a cellular context-specific manner. The conclusion that emerges
from studies in different cellular systems is that Spry’s inhibition on RTK signaling
occurs somewhere between the level of the receptor and Ras/Raf activation. The

evidence leading to this conclusion is presented in the following paragraphs.

One mechanism to explain the repression of FGF signaling by Spry focuses on
the interaction of Spry with Grb2. In mouse myoblast cells (CZC12) this
interaction is induced by growth factor stimulation, and results in the juxtaposition
of the tyrosine phosphorylated Spry with the SH2 domain of Grb2. The
consequence of this interaction in FGF signaling is to diminish the association of
Grb2:SOS with FGFR adaptors like FRSZ and Shp2, which in turn diminishes the
activation of Ras and Raf/MEK/ERK pathway [340]. It should be noted, however,
that inducible expression of Spry in mouse fibroblasts (NIH3T3) showed that Spry
had no effect on the formation of the FRSZ-Grb2:SOS complex, yet Spry still
diminished the activation of Ras. Taken together, these results suggest that Spry
may have cellular context-specific mechanism for preventing Ras activation in

FGFR signaling [329].

Coexpression of Spry with constitutively active forms of Ras, Raf and MEK, in

human embryonic kidney (HEK293) cells, found that Spry inhibits FGF signaling

at the level of Raf activation [369].

87

The ability of Spry to intercept RTK signaling at the level of Raf activation is also
observed in human endothelial cells, where VEGF activates ERK in a Ras-
independent fashion (Fig. 6B) [371]. In this system VEGFR, through its effector
PLCy, activates PKCS and this in turn activates the Raf/MAPK cascade.
Expression of Spry4 in this system prevents the Res-independent activation of
ERK induced by VEGF, without affecting Ras-dependent ERK activation induced
by EGF. Spry4 interacts with Raf, though its carboxy—teminal region. This
interaction is necessary for its inhibitory function. Spry2 can also interact with Raf

[371], suggesting that Spry2 has a similar effect in this pathway.

The interaction between Spry and Raf has is also evident in melanoma cell lines
[372]. In melanomas expressing wild type BRaf, both Spry2 and Spry4 interact
with BRaf. In melanoma cells with BRaf mutations (V599E, V5990, L596V and
K6OOE), however, neither of the two Sprys was able to complex with BRaf. This
finding suggest that these residues on BRaf are important for the interaction

between Raf and Spry2.

Furthermore, transient down regulation of Spry2 by using Spry2-specific siRNA
resulted in an increase in the activation of ERK in melanomas with wild type
BRaf, whereas no effect was observed in melanomas with mutated BRaf. This
suggests that mutant BRaf can bypass the inhibitory effect of Spry2 [372]. The
latter may be an important mechanism by which BRaf escapes normal regulatory

mechanism and induces malignant transformation.

88

Another proposed mechanism by which Spry inhibits RTK signaling involves an
interaction between D. m. Spry and Drk, the 0m. homolog of RasGAP1 [327].
Through this interaction Spry facilitates the recruitment of GAP1 at Ras signaling

complexes, thereby promoting the inactivation of Ras.

A final line of evidence to support the contention that Spry inhibits RTK signaling
upstream of Ras/Raf originates from a study with murine lung epithelial cells,
where ectopic Spry2 complexes with Grb2, FRSZ, Raf, Shp2, GAP1, FGFR2b
and SOS [331]. FGF stimulation enhanced the interactions of Spry2 with Grb2,
Raf, and FRSZ while diminishing the interaction between Spry2 and Shp2 or
GAP1. Ectopic Spry2 decreased MAPK activation in response to FGF stimulation,
suggesting that the inhibitory role of Spry2 is a result of its ability to differentially

interact with key components upstream of MAPK [331].

Although Spry inhibits RTK signaling through distinct mechanisms, the biological
phenotype resulting from this activity includes a decrease in growth factor-
induced proliferation, differentiation and angiogenesis [329, 356, 373]. The
inhibitory effect of Spry on cellular proliferation is mediated not only by the ability
of Spry to inhibit ERK activation, but also, by its ability to represses SRE- and Elk-
mediated transcription [329, 340]. Moreover, ectopic expression of Spry proteins
ectopic expression of Spry proteins represses the ability of fibroblasts and

leiomyoma cells to form colonies in soft agar, an observation that is consistent

89

with the ability to repress MAPK activation and cellular proliferation [329, 368]. In
addition, Spry attenuates the differentiation of rat phaeochromocytoma (P012)
cells induced by FGF [329], consistent with the fact that Spry proteins inhibit FGF
signaling. Spry also inhibits the branching and sprouting of small vessels during

angiogenesis [335].

Activation of epidermal growth factor receptor signaling

EGFR is a key mediator of signal transmission in response to extracellular cues.
EGFR regulates many cellular functions including proliferation, differentiation and
survival [374]. As such, EGFR must be strictly regulated in order to ensure normal
cellular function. Uncontrolled function of EGFR can lead to enhanced
proliferation, which may lead to cancer formation. Although there are a number of
mechanisms to turn off the signaling activity of EGFR, the one that is affected by
the function of Spry involves receptor ubiquitination and proteosomal/lysosomal

degradation.

The necessity to turn off EGFR signaling following ligand activation is met in part
by c-Cbl, an E3 ubiquitin ligase enzyme that catalyzes the poly-ubiquitination of
EGFR. The consequence of EGFR ubiquitination is apparent upon the
internalization of the ligand-bound receptor. When the receptor is not
ubiquitinated it is endocytosed and recycled back to the plasma membrane
following the disruption of the ligand-receptor complex (i.e. the inactivation of the

receptor). Instead, when the receptor is poly-ubiquitinated it is targeted for

90

degradation by the proteasomal/lysosomal pathway. The function of c-Cbl is
mediated through distinct domains including an atypical SH2 domain that
interacts with phosphotyrosine residues located on c-Cbl’s substrates. c-Cbl, also
contains a RING-finger domain, which is critical for ubiquitination, because it
interacts with E2 ubiquitin conjugating enzymes, thus recruiting such factors to
the location of the substrate [361]. There, E2 enzymes catalyze the ubiquitination
of the substrate. In certain situation more than one ubiquitin moiety is added to
the substrate, a modification that targets the substrate for degradation by the

proteasome.

Upon EGF stimulation, Spry2 can sustain RTK signaling, leading to sustained
activation of ERK. Mechanistically this is attributed to the ability of Spry2 to
interact with c-Cbl and inhibit the c-Cbl-induced degradation of EGFR [360, 363].
The interaction between Spry and c-Cbl reduces the level of EGFR ubiquitination
by c-Cbl, and thus Spry can sustain EGFR levels and signaling activity. The later
has been demonstrated in PC12 cells, which have been paradigmatically used to
study the effects of RTK signaling on cell fate, given the fact that they can be
induced to proliferate or differentiate, depending on the duration of RTK signaling
[375]. In PC12 cells, some growth factors, such as EGF, induce transient
activation of MAPK and promote cellular proliferation, whereas other growth
factors, such as nerve growth factor (NGF) or FGF, induce sustained ERK
activation leading to differentiation and neurite outgrowth. However, when PC12

cells expressing Spry2 are stimulated with EGF, they display sustained ERK

91

activation and undergo differentiation, consistent with the ability of Spry2 to

prevent EGFR degradation induced by c-Cbl [363].

The ability of Spry proteins to interact with c-Cbl is conserved in D. m. Spry and
mammalian Spry1 and Spry2. Nevertheless, this function has almost exclusively
been studied in the context of Spry2. Spry4 fails to interact with c-Cbl and cannot
inhibit EGFR degradation induced by c-Cbl [360]. As described above, the
interaction between Spry2 and c-Cbl, involves Spry2 phosphotyrosine residue on
position 55 and c-Cbl’s SH2 domain [334]. Furthermore, amino acids flanking Y55
on Spry2 are also important for this interaction [355, 362]. Structural differences
in this region between Spry2 and Spry4 may account for their different ability to
regulate EGFR degradation. In fact, mutation of the Spry2 residues surrounding
Y55 to the amino acids present in the same region of Spry4, abrogates the ability

of Spry2 to bind c-Cbl [355].

In addition to preventing EGFR degradation, Spry2 can also diminish EGFR
endocytosis at an early stage of the lntemalization/trafficking process [363, 376].
In the absence of Spry2, EGFR localizes in endocytotic vesicles upon EGF-
stimulation, whereas upon expression of Spry2, EGFR remains at the plasma

membrane.

The role of Spry2 in the regulation of EGFR endocytosis is also supported by

recent evidence that Spry2 can interact in vivo and in vitro with CIN85 [343].

92

CIN85 is part of an endocytotic complex that assists endocytosis by c-Cbl. It has
been proposed that CIN85 leads to clustering of c-Cbl, facilitating c-CbI-induced
EGFR endocytosis and degradation. CIN85 contains three SH3 domains (A, B
and C).through which it interacts with proline rich regions (PxxxPR). Spry2
contains two such motif on positions 64 and 309, which interact with the SH3A
domain of CIN85. In addition, Spry2 contains another similar motif (xxPxPR) on

position 72, which interacts with the SH3C domain of CIN85.

These proline-rich motifs are also present in Spry1, thus enabling this Spry to
interact with CIN85. D. m. Spry and Spry4, however, lack such motifs and cannot

interact with CIN85 [343].

The interaction of Spry2 with CIN85 is important for the inhibition of c-Cbl induced
degradation of EGFR, because a Spry2 mutant that cannot interact with CIN85

2R64'72'309A) fails to inhibit EGFR degradation, regardless of the presence of

($er
wild type Y55 residue (i.e., this mutant Spry2 retains an intact ability for c-Cbl
interaction). Finally, Spry2 associates with both c-Cbl and CIN85 to form a ternary

complex that is necessary for inhibition of EGFR degradation and promotion of

neurite outgrowth in PC12 cells [343].

The ability of Spry2 to inhibit c-Cbl induced degradation of EGFR implies that

Spry may prevent the degradation of additional c-Cbl substrates. However, this

function of Spry2 may be restricted only to EGFR, because although c-Cbl targets

93

FGFR and FRSZ for degradation, Spry2 doesn’t seem to have an inhibitory effect

under these circumstances [362].

Regulation of integrin-mediated cell spreading by Sprouty-4

The ability of Spry to regulate cell spreading has been studied only in the context
of Spry4. Spry4 interacts with TESK1 through its carboxy-terminal region [377].
TESK1 is a serine/threonine kinase that phosphorylates cofilin, an actin binding
protein that is involved in actin depolymerization and severance of actin stress
fibers [378, 379]. TESK1 phosphorylation inhibits cofilin, and cofilin-induced actin
disassembly. Also, TESK1 plays an important role in integrin-mediated actin
remodeling and cell spreading. The interaction between Spry4 and TESK results
in the inhibition of the kinase activity of TESK1 in vitro, as well as in the decrease
in the levels of phosphorylated cofilin [380]. Thus, Spry4 negatively regulates cell
spreading through the inhibition of TESK1, which results in sustained cofilin
activity. Phosphorylation of the conserve tyrosine residue on the N-terrninal of
Spry4 (Y75) is not necessary for its interaction with TESK1, or for its ability to

suppress cell spreading [380].

Regulation of cell migration by Sprouty

Spry proteins inhibit cell migration during Xenopus embryogenesis [332], as well
as in wound healing assays with mammalian cells [373]. In the latter case, Spry1,

Spry2 and Spry4 antagonize growth factor stimulated cellular migration. This

94

ability of Spry is dependent on its cysteine rich carboxy-terminal [373], and
appears to be mediated in part by PTP1B and p130Cas [381, 382]. These studies,
in which Spry2 protein was transduced in HeLa cells, demonstrated an increase
in the levels and activity of PTP1B phosphatase in the soluble fraction. p1300‘as, a
substrate for PTP1B, exhibits reduced levels of phosphorylation following
transduction of Spry2, a finding that is consistent with the increase in the activity
of PTP1B by Spry2. What’s more expression of p130Gas attenuates Spry2’s

inhibition of growth factor induced cellular migration [381].

Furthermore, Spry2 represses the activation of R301 in wound healing assays,
suggesting that the regulation of cellular migration by Spry2 is dependent of its
effect of Rac1 activity. Expression of constitutively active Rac1 attenuates the
inhibition of migration by Spry2 [382]. Instead, constitutive active Rac1 had no
effect on the inhibitory function of Spry2 in cellular proliferation [381], suggesting
that Spry can engage specific pathways to carry through its effect on cellular

function.

Sprouty deficient mice

Recently, Basson et al [383], Shim et al [384],. and Taketomi et al. [370]
successfully generated knockout mice models for Spry1 and Spry2. These
models have elucidated important roles of Spry genes in mammalian

development

Sprouty-14'

95

Homozygous Spry1“ mice, which were born at expected Mendelian ratios,
display reduced post-natal viability [383]. A small subset (21%) of Spry1-l— mice
die within 48 hrs, whereas another population (71%) die within five months. The

surviving animals have significant kidney malformations.

Normal kidney development involves the outgrowth of a single ureteric bud from
the Wolfian duct during early development [385]. Glial derived growth factor
(GDNF), and its tyrosine kinase receptor c-Ret are part of a signaling pathway
that is important for ureteric bud formation[386-388]. Spry1-/- mice develop
supemumerary ureteric buds from the Wolfian duct, which results in multiple
ureters and a multiplex kidney [383]. An important characteristic of Spry1-/- mice
is their sensitivity to GDNF signaling. This is indicated by the levels of active ERK
in ectopic sites, as well as by the expression of Wnt11. Normally, Wnt11 is
expressed at the tips of ureteric buds [389], where Ret signaling is active, but in
Spry1'/' mice Wnt11 expression is extended to more anterior sites and in discrete
ectopic sites suggesting an overactive c-Ret signaling pathway [383, 390]. The
phenotype of Spry1'/' mice is mediated by the GDNF sensitization of kidney
tissue, because reduction of GDNF gene dosage, as a result of crossing Spry1"‘
with Gdnfi” (Spry1"';Gan/') mice, reverts the phenotype of Spry1'/' mice.
Together, these findings suggest that Spry1 regulates normal ureteric bud and

kidney development, through suppression of GDNF/Ret signaling.

Sprouty-2"

96

Half of the Spry2" mice die within six weeks after birth, while the rest can survive
for at least six months. These animals are smaller in size compared to litterrnates
[370]. Notably, the surviving Spry2" mice are characterized by hearing
impairment [384], as well as neuronal hyperplasia and esophageal achalasia

(constriction of the lower part of the esophagus) [370].

The sense of hearing involves the conversion of the sound waves into vibrational
energy at the tympanic membrane and the transmission through the middle ear to
the organ of Corti in the inner ear, where vibrational energy is converted into
electrical impulses that are transmitted into the brain. The hearing impairment in
Spry2"' mice reflects a disruption in the architecture of the organ of Corti [384].
While this organ normally consists of three rows of longitudinal outer hair cells,
the organ of Corti in Spry2" mice consists of four rows. In addition, Spry2"
contained an ectopic pillar cell, leading to the formation of an ectopic Corti-like

tunneL

The normal development of the organ of Corti is dependent in part on FGF8,
which is secreted by inner hair cells and acts on the FGFR3 receptors, which are
located on the outer hair cells and the pillar cells [384, 391, 392]. It is possible
that in Spry2" mice, FGFR signaling is overactive, resulting in the noted
malformations in the organ of Corti. Indeed, reduction of FGF8 gene dosage in
Spry2 null mice, achieved by crossing these mice with FGF8“ mice (Spry2‘/'

;Fgf8+/') prevents the extra pillar formation and partially reverts the hearing loss

97

phenotype of Spry2”‘ mice. This suggests that Spry2 suppresses FGF8 signaling

in the organ of Corti and promotes normal development of this organ [384].

Phenotypically, Spry2" mice are also characterized by abnormal intestinal motility
and esophageal achalasia, due to lower esophageal sphincter (LES)
hypercontraction [370]. Spry2" mice demonstrate hyperplasticity in the enteric
nervous plexus (ENS) and have elevated levels of muscarinic (M2)-acetylcholine
receptors in the neuro-muscular junctions of esophagus, which may be
responsible for the hypercontraction of LES. GDNF/Ret signaling, which is
necessary for the survival of ENS [386] is increased in neuronal cells of Spry2/‘
mice, suggesting that the ability of Spry2 to repress GDNF signaling is important
for preventing ENS hyperplasia, and esophageal achalasia. In fact, anti-GDNF
antibodies can correct ENS hyperplasia and reduce the esophageal dilation in

Spry2” mice [370].

Sprouty proteins in cancer

The ability of Spry proteins to regulate RTK makes them good candidates as
cancer genes. The expression of Spry2 gene is altered in several types of cancer.
Spry1 and Spry2 are down regulated in breast cancer [393], and expression of
Spry2 in the breast cancer cells (MCF7) reduces the ability of these cells to form

2Y5“, a mutant that cannot repress growth factor

tumors in athymic mice. Spry
induced ERK activation, fails to abrogate the tumor forming ability of MCF7 cells

[393].

98

Spry1 and Spry2 are also down regulated in prostate cancer. Spry1 was found to
be decreased in 40% of prostate cancers, when these were compared with
matched normal prostate [394]. Spry2 expression is decreased in invasive
prostate cancer and clinical prostate cancer, when these were compared to
benign prostatic hyperplasia (BPH) [395]. This reduced expression is attributed to
epigenetic inactivation, through hypermethylation of the Spry2 promoter. The
Spry2 gene contains a large CpG island spanning positions ~500 and +950
relative to the putative transcription start site. This region is hypermethylated in
the high grade clinical prostate cancers, whereas in BPH this region is relatively

non-methylated [395].

Interestingly, Spry2 expression is elevated in melanomas with BRafVSOOE

061R

mutations or in melanomas with NRas mutations, compared to cells without

mutations [396]. An independent study found that Spry2 was expressed at higher

fV599E

levels in melanomas with BRa compared to melanomas with wild type BRaf

and normal melanocytes [372].

Although additional studies are needed to determine the precise role of Spry in
cancer, initial evidence supports the hypothesis that Spry proteins repress
malignant transformation, through their ability to repress RTK signaling.

Nevertheless the increased expression of Spry2 in some types of cancer, as well

99

as its ability to sustain EGFR signaling, suggests that Spry2 promotes cancer

progression. Whether this is true remains to be seen.

100

References

10.
11.

12.

13.

14.

Jemal, A., Murray, T., Samuels, A., Ghafoor, A., Ward, E. and Thun, M.J.,
Cancer statistics, 2003. CA Cancer J Clin, 2003. 53(1): p. 5-26.

Parkin, D.M., Global cancer statistics in the year 2000. Lancet Oncol,
2001 . 2(9): p. 533-543.

Kumar, V., Abbas, A. and Fausto, N., Robbins and Cotran Pathologic
Basis of Disease. 7th Edition. 2005: Elsevier Saunders. 269-342.

Macaluso, M., Paggi, MG. and Giordano, A., Genetic and epigenetic
alterations as hallmarks of the intricate road to cancer. Oncogene, 2003.
22(42): p. 6472-6478.

Nowell, P.C., The clonal evolution of tumor cell populations. Science,
1976. 194(4260): p. 23-28.

Fearon, ER. and Vogelstein, B., A genetic model for colorectal
tumorigenesis. Cell, 1990. 61(5): p. 759-767.

Renan, M.J., How many mutations are required for tumorigenesis?
Implications from human cancer data. Mol Carcinog, 1993. 7(3): p. 139-
146.

Bishop, J.M., Enemies within: the genesis of retrovirus oncogenes. Cell,
1981. 23(1): p. 5-6.

Weinberg, R.A., Tumor suppressor genes. Science, 1991. 254(5035): p.
1 138-1 146.

Ponder, B.A., Cancer genetics. Nature, 2001. 411(6835): p. 336-341.

Parker, R.C., Varmus, HE. and Bishop, J.M., Cellular homologue (c-src) of
the transforming gene of Rous sarcoma virus: isolation, mapping, and
transcriptional analysis of c-src and flanking regions. Proc Natl Acad Sci U
S A, 1981. 78(9): p. 5842-5846.

Pelengaris, S., Khan, M. and Evan, G., c-MYC: more than just a matter of
life and death. Nat Rev Cancer, 2002. 2(10): p. 764-776.

Yeatman, T.J., A renaissance for SRC. Nat Rev Cancer, 2004. 4(6): p.
470-480.

Prober, DA. and Edgar, B.A., Growth regulation by oncogenes-mew
insights from model organisms. Curr Opin Genet Dev, 2001. 11(1): p. 19-
26.

101

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

Todd, R. and Wong, D.T., Oncogenes. Anticancer Res, 1999. 19(6A): p.
4729-4746.

Anderson, M.W., Reynolds, S.H., You, M. and Maronpot, R.M., Role of
proto-oncogene activation in carcinogenesis. Environ Health Perspect,
1992. 98: p. 13-24.

Parada, L.F., Tabin, C.J., Shih, C. and Weinberg, R.A., Human EJ bladder
carcinoma oncogene is homologue of Harvey sarcoma virus ras gene.
Nature, 1982. 297(5866): p. 474-478.

Feinberg, AP, The epigenetics of cancer etiology. Semin Cancer Biol,
2004. 14(6): p. 427-432.

Alitalo, K., Amplification of cellular oncogenes in cancer cells. Med Biol,
1984. 62(6): p. 304-317.

Ren, R., Mechanisms of BCR-ABL in the pathogenesis of chronic
myelogenous leukaemia. Nat Rev Cancer, 2005. 5(3): p. 172-183.

Spencer, CA. and Groudine, M., Control of c-myc regulation in normal and
neoplastic cells. Adv Cancer Res, 1991. 56: p. 1-48.

Cowell, J.K., One hundred years of retinoblastoma research. From the
clinic to the gene and back again. Ophthalmic Paediatr Genet, 1989. 10(2):
p. 75-88.

Gennett, IN. and Cavenee, W.K., Molecular genetics in the pathology and
diagnosis of retinoblastoma. Brain Pathol, 1990. 1(1): p. 25-32.

Knudson, A.G., Jr., Mutation and cancer: statistical study of
retinoblastoma. Proc Natl Acad Sci U S A, 1971. 68(4): p. 820-823.

Friend, S.H., Bemards, R., Rogelj, 8., Weinberg, R.A., Rapaport, J.M.,
Albert, D.M. and Dryja, TR, A human DNA segment with properties of the
gene that predisposes to retinoblastoma and osteosarcoma. Nature, 1986.
323(6089): p. 643-646.

Fung, Y.K., Murphree, A.L., T'Ang, A., Qian, J., Hinrichs, SH. and
Benedict, W.F., Structural evidence for the authenticity of the human
retinoblastoma gene. Science, 1987. 236(4809): p. 1657-1661.

Lee, W.H., Shew, J.Y., Hong, F.D., Sery, T.W., Donoso, L.A., Young, L.J.,
Bookstein, R. and Lee, E.Y., The retinoblastoma susceptibility gene
encodes a nuclear phosphoprotein associated with DNA binding activity.
Nature, 1987. 329(6140): p. 642-645.

102

28.

29.

30.

31.

32.

33.

34.

35.

36.

37.

38.

39.

40.

Classon, M. and Harlow, E., The retinoblastoma tumour suppressor in
development and cancer. Nat Rev Cancer, 2002. 2( 12): p. 910-917.

Macleod, K., Tumor suppressor genes. Curr Opin Genet Dev, 2000. 10(1):
p. 81-93.

Knudson, A.G., Two genetic hits (more or less) to cancer. Nat Rev Cancer,
2001. 1(2): p. 157-162.

Kinzler, K.W. and Vogelstein, 8., Lessons from hereditary colorectal
cancer. Cell, 1996. 87(2): p. 159-170.

Fodde, R., The multiple functions of tumour suppressors: it's all in APC.
Nat Cell Biol, 2003. 5(3): p. 190-192.

Powell, S.M., Zilz, N., Beazer-Barclay, Y., Bryan, T.M., Hamilton, S.R.,
Thibodeau, S.N., Vogelstein, B. and Kinzler, K.W., APC mutations occur
early during colorectal tumorigenesis. Nature, 1992. 359(6392): p. 235-
237.

Bronner, C.E., Baker, S.M., Morrison, P.T., Warren, G., Smith, L.G.,
Lescoe, M.K., Kane, M., Earabino, C., Lipford, J., Lindblom, A. and et al.,
Mutation in the DNA mismatch repair gene homologue hMLH1 is
associated with hereditary non-polyposis colon cancer. Nature, 1994.
368(6468): p. 258-261.

Fishel, R., Lescoe, M.K., Rao, M.R., Copeland, N.G., Jenkins, N.A.,
Garber, J., Kane, M. and Kolodner, R., The human mutator gene homolog
MSH2 and its association with hereditary nonpolyposis colon cancer. Cell,
1993. 75(5): p. 1027-1038.

Lengauer, C., Kinzler, K.W. and Vogelstein, 3., Genetic instability in
colorectal cancers. Nature, 1997. 386(6625): p. 623-627.

Egger, G., Liang, G., Aparicio, A. and Jones, P.A., Epigenetics in human
disease and prospects for epigenetic therapy. Nature, 2004. 429(6990): p.
457-463.

Claus, R. and Lubbert, M., Epigenetlc targets in hematopoietic
malignancies. Oncogene, 2003. 22(42): p. 6489-6496.

Hanahan, D. and Weinberg, RA, The hallmarks of cancer. Cell, 2000.
100(1): p. 57-70.

Schlessinger, J., Cell signaling by receptor tyrosine kinases. Cell, 2000.
103(2): p. 211-225.

103

41.

42.

43.

44.

45.

46.

47.

48.

49.

50.

51.

52.

53.

Tari, AM. and Lopez-Berestein, G., GRBZ: a pivotal protein in signal
transduction. Semin Oncol, 2001. 28(5 Suppl 16): p. 142-147.

Birge, RB. and Hanafusa, H., Closing in on SH2 specificity. Science,
1993. 262(5139): p. 1522-1524.

‘Avruch, J., Khokhlatchev, A., Kyriakis, J.M., Luo, Z., Tzivion, G., Vawas,

D. and Zhang, X.F., Ras activation of the Raf kinase: tyrosine kinase
recruitment of the MAP kinase cascade. Recent Prog Horm Res, 2001. 56:
p. 127-155.

Margolis, B. and Skolnik, E.Y., Activation of Ras by receptor tyrosine
kinases. J Am Soc Nephrol, 1994. 5(6): p. 1288-1299.

Chardin, P., Camonis, J.H., Gale, N.W., van Aelst, L., Schlessinger, J.,
Wigler, M.H. and Bar-Sagi, D., Human 8031: a guanine nucleotide
exchange factor for Ras that binds to GRBZ. Science, 1993. 260(5112): p.
1338-1343.

Gibbs, J.B., Sigal, l.S., Poe, M. and Scolnick, E.M., Intrinsic GTPase
activity distinguishes normal and oncogenic ras p21 molecules. Proc Natl
Acad Sci U S A, 1984. 81(18): p. 5704-5708.

Sweet, R.W., Yokoyama, S., Kamata, T., Feramisco, J.R., Rosenberg, M.
and Gross, M., The product of ras is a GTPase and the T24 oncogenic
mutant is deficient in this activity. Nature, 1984. 311(5983): p. 273-275.

Satoh, T., Nakafuku, M. and Kaziro, Y., Function of Ras as a molecular
switch in signal transduction. J Biol Chem, 1992. 267(34): p. 24149-24152.

Vojtek, AB. and Der, C.J., Increasing complexity of the Ras signaling
pathway. J Biol Chem, 1998. 273(32): p. 19925-19928.

Aktas, H., Cai, H. and Cooper, G.M., Ras links growth factor signaling to
the cell cycle machinery via regulation of cyclin D1 and the Cdk inhibitor
p27KlP1. Mol Cell Biol, 1997. 17(7): p. 3850-3857.

Chambers, AF. and Tuck, A.B., Ras-responsive genes and tumor
metastasis. Crit Rev Oncog, 1993. 4(2): p. 95-114.

Giehl, K., Oncogenic Ras in tumour progression and metastasis. Biol
Chem, 2005. 386(3): p. 193-205.

Pantazis, P., Pelicci, P.G., Dalla-Favera, R. and Antoniades, H.N.,
Synthesis and secretion of proteins resembling platelet-derived growth
factor by human glioblastoma and fibrosarcoma cells in culture. Proc Natl
Acad Sci U S A, 1985. 82(8): p. 2404-2408.

104

54.

55.

56.

57.

58.

59.

60.

61.

62.

63.

64.

65.

Suzuki, K. and Yamada, S., Ascites sarcoma 180, a tumor associated with
hypercalcemia, secretes potent bone-resorbing factors including
transforming growth factor alpha, interleukin-1 alpha and interleukin-6.
Bone Miner, 1994. 27(3): p. 219-233.

Koh, J.S., Trent, J., Chen, L., El-Naggar, A., Hunt, K., Pollock, R. and
Zhang, W., Gastrointestinal stromal tumors: overview of pathologic
features, molecular biology, and therapy with imatinib mesylate. Histol
Histopathol, 2004. 19(2): p. 565-574.

Yarden, Y. and Ullrich, A., Growth factor receptor tyrosine kinases. Annu
Rev Biochem, 1988. 57: p. 443-478.

803, J.L., ras oncogenes in human cancer: a review. Cancer Res, 1989.
49(17): p. 4682-4689.

Melo, J.V., The molecular biology of chronic myeloid leukaemia. Leukemia,
1996. 10(5): p. 751-756.

Krengel, U., Schlichting, L., Scherer, A., Schumann, R., Frech, M., John,
J., Kabsch, W., Pal, BF. and Wittinghofer, A., Three-dimensional
structures of H-ras p21 mutants: molecular basis for their inability to
function as signal switch molecules. Cell, 1990. 62(3): p. 539-548.

Macaluso, M., Russo, G., Cinti, C., Bazan, V., Gebbia, N. and Russo, A.,
Ras family genes: an interesting link between cell cycle and cancer. J Cell
Physiol, 2002. 192(2): p. 125-130.

Tong, L., Milbum, M.V., de Vos, AM. and Kim, S.H., Structure of ras
proteins. Science, 1989. 245(4915): p. 244.

Van Etten, R.A., Cycling, stressed—out and nervous: cellular functions of c-
Abl. Trends Cell Biol, 1999. 9(5): p. 179-186.

Shtivelman, E., Lifshitz, B., Gale, RP. and Canaani, E., Fused transcript of
abl and bcr genes in chronic myelogenous leukaemia. Nature, 1985.
315(6020): p. 550-554.

Muller, A.J., Young, J.C., Pendergast, A.M., Pondel, M., Landau, N.R.,
Littman, DR. and Witte, O.N., BCR first exon sequences specifically
activate the BCR/ABL tyrosine kinase oncogene of Philadelphia
chromosome-positive human leukemias. Mol Cell Biol, 1991. 11(4): p.
1785-1792.

Ren, S.Y., Xue, F., Feng, J. and Skorski, T., Intrinsic regulation of the
interactions between the SH3 domain of p85 subunit of
phosphatidylinositol-3 kinase and the protein network of BCR/ABL
oncogenic tyrosine kinase. Exp Hematol, 2005. 33(10): p. 1222-1228.

105

66.

67.

68.

69.

70.

71.

72.

73.

74.

75.

76.

77.

78.

Pluk, H., Dorey, K. and Superti-Furga, G., Autoinhibition of c—Abl. Cell,
2002. 108(2): p. 247-259.

Darnell, J.E., Jr., Transcription factors as targets for cancer therapy. Nat
Rev Cancer, 2002. 2(10): p. 740-749.

Nebert, D.W., Transcription factors and cancer: an overview. Toxicology,
2002. 181-182: p. 131-141.

Jenkins, R.B., Qian, J., Lieber, MM. and Bostwick, D.G., Detection of c-
myc oncogene amplification and chromosomal anomalies in metastatic
prostatic carcinoma by fluorescence in situ hybridization. Cancer Res,
1997. 57(3): p. 524-531.

Mimori, K., Mori, M., Shiraishi, T., Tanaka, S., Haraguchi, M., er, H.,
Shirasaka, C. and Akiyoshi, T., Expression of ornithine decarboxylase
mRNA and c-myc mRNA in breast tumours. Int J Oncol, 1998. 12(3): p.
597-601.

Schlagbauer—Wadl, H., Griffioen, M., van Elsas, A., Schrier, P.l., Pustelnik,
T., Eichler, H.G., Wolff, K., Pehamberger, H. and Jansen, 8., Influence of
increased c-Myc expression on the growth characteristics of human
melanoma. J Invest Dermatol, 1999. 112(3): p. 332-336.

Elend, M. and Eilers, M., Cell growth: downstream of Myc - to grow or to
cycle? Curr Biol, 1999. 9(24): p. R936-938.

Evan, G.l., Wyllie, A.H., Gilbert, C.S., Littlewood, T.D., Land, H., Brooks,
M., Waters, C.M., Penn, L2. and Hancock, D.G., Induction of apoptosis in
fibroblasts by c-myc protein. Cell, 1992. 69(1): p. 119-128.

La Rocca, S.A., Crouch, DH. and Gillespie, D.A., c-Myc inhibits myogenic
differentiation and myoD expression by a mechanism which can be
dissociated from cell transformation. Oncogene, 1994. 9(12): p. 3499-
3508.

Massague, J., G1 cell-cycle control and cancer. Nature, 2004. 432(7015):
p. 298-306.

Hartwell, L.H. and Kastan, M.B., Cell cycle control and cancer. Science,
1994. 266(5192): p. 1821-1828.

Murray, A.W., Recycling the cell cycle: cyclins revisited. Cell, 2004. 116(2):
p. 221-234.

Morgan, 0.0., Principles of CDK regulation. Nature, 1995. 374(6518): p.
131-134.

106

79.

80.

81.

82.

83.

84.

85.

86.

87.

88.

89.

90.

91.

92.

93.

Schwartz, G.K., CDK inhibitors: cell cycle arrest versus apoptosis. Cell
Cycle, 2002. 1(2): p. 122-123.

Trimarchi, J.M. and Lees, J.A., Sibling rivalry in the E2F family. Nat Rev
Mol Cell Biol, 2002. 3(1): p. 11-20.

Ohtani, K., Implication of transcription factor E2F in regulation of DNA
replication. Front Biosci, 1999. 4: p. D793-804.

Seville, L.L., Shah, N., Westwell, AD. and Chan, W.C., Modulation of
pRB/E2F functions in the regulation of cell cycle and in cancer. Curr
Cancer Drug Targets, 2005. 5(3): p. 159-170.

Bates, S. and Peters, G., Cyclin D1 as a cellular proto-oncogene. Semin
Cancer Biol, 1995. 6(2): p. 73-82.

Hosokawa, Y. and Arnold, A., Mechanism of cyclin D1 (CCND1, PRAD1)
overexpression in human cancer cells: analysis of allele-specific
expression. Genes Chromosomes Cancer, 1998. 22(1): p. 66-71.

Moroy, T. and Geisen, C., Cyclin E. Int J Biochem Cell Biol, 2004. 36(8): p.
1424-1439.

Sauer, K. and Lehner, CF, The role of cyclin E in the regulation of entry
into S phase. Prog Cell Cycle Res, 1995. 1: p. 125-139.

Morris, L., Allen, KB and La Thangue, N.B., Regulation of E2F
transcription by cyclin E-Cdk2 kinase mediated through p300/CBP co-
activators. Nat Cell Biol, 2000. 2(4): p. 232-239.

Yam, C.H., Fung, T.K. and Poon, R.Y., Cyclin A in cell cycle control and
cancer. Cell Mol Life Sci, 2002. 59(8): p. 1317-1326.

Pei, X.H. and Xiong, Y., Biochemical and cellular mechanisms of
mammalian CDK inhibitors: a few unresolved issues. Oncogene, 2005.
24(17): p. 2787-2795.

Sherr, C.J., The lNK4a/ARF network in tumour suppression. Nat Rev Mol
Cell Biol, 2001. 2(10): p. 731-737.

Kastan, MB. and Bartek, J., Cell-cycle checkpoints and cancer. Nature,
2004. 432(7015): p. 316-323.

Gottifredi, V. and Prives, C., The S phase checkpoint: when the crowd
meets at the fork. Semin Cell Dev Biol, 2005. 16(3): p. 355-368.

O'Connell, M.J., Walworth, NC. and Carr, A.M., The GZ-phase DNA-
damage checkpoint. Trends Cell Biol, 2000. 10(7): p. 296-303.

107

94.

95.

96.

97.

98.

99.

100.

101.

102.

103.

104.

105.

106.

Peeper, D.S., van der Eb, A.J. and Zantema, A., The G1/S cell-cycle
checkpoint in eukaryotic cells. Biochim Biophys Acta, 1994. 1198(2-3): p.
215-230.

Hicks, G.G., Egan, S.E., Greenberg, AH. and Mowat, M., Mutant p53
tumor suppressor alleles release ras-induced cell cycle growth arrest. Mol
Cell Biol, 1991. 11(3): p. 1344-1352.

Shaw, P., Bovey, R., Tardy, S., Sahli, R., Sordat, B. and Costa, J.,
Induction of apoptosis by wild-type p53 in a human colon tumor-derived
cell line. Proc Natl Acad Sci U S A, 1992. 89(10): p. 4495-4499.

Marx, J., New link found between p53 and DNA repair. Science, 1994.
266(5189): p. 1321-1322.

Levine, A.J., p53, the cellular gatekeeper for growth and division. Cell,
1997. 88(3): p. 323-331.

Midgley, CA. and Lane, D.P., p53 protein stability in tumour cells is not
determined by mutation but is dependent on Mdm2 binding. Oncogene,
1997. 15(10): p. 1179-1189.

Vousden, K.H. and Lu, X., Live or let die: the cell's response to p53. Nat
Rev Cancer, 2002. 2(8): p. 594-604.

Li, Y., Jenkins, C.W., Nichols, MA. and Xiong, Y., Cell cycle expression
and p53 regulation of the cyclin-dependent kinase inhibitor p21.
Oncogene, 1994. 9(8): p. 2261-2268.

el-Deiry, W.S., Harper, J.W., O'Connor, P.M., Velculescu, V.E., Canman,
C.E., Jackman, J., Pietenpol, J.A., Burrell, M., Hill, D.E., Wang, Y. and et
al., WAF1/ClP1 is induced in p53-mediated G1 arrest and apoptosis.
Cancer Res, 1994. 54(5): p. 1169-1174.

Hayflick, L. and Moorhead, PS, The serial cultivation of human diploid cell
strains. Exp Cell Res, 1961. 25: p. 585-621.

Wright, W.E., Pereira-Smith, OM. and Shay, J.W., Reversible cellular
senescence: implications for immortalization of normal human diploid
fibroblasts. Mol Cell Biol, 1989. 9(7): p. 3088-3092.

Collins, K., Mammalian telomeres and telomerase. Curr Opin Cell Biol,
2000. 12(3): p. 378-383.

Harley, C.B., Futcher, AB. and Greider, C.W., Telomeres shorten during
ageing of human fibroblasts. Nature, 1990. 345(6274): p. 458-460.

108

107.

108.

109.

110.

111.

112.

113.

114.

115.

116.

117.

118.

119.

Mathon, N.F. and Lloyd, A.C., Cell senescence and cancer. Nat Rev
Cancer, 2001. 1(3): p. 203-213.

Hayflick, L., Mortality and immortality at the cellular level. A review.
Biochemistry (Mosc), 1997. 62(11): p. 1180-1190.

Shay, J.W. and Bacchetti, S., A survey of telomerase activity in human
cancer. Eur J Cancer, 1997. 33(5): p. 787-791.

Bryan, TM. and Cech, T.R., Telomerase and the maintenance of
chromosome ends. Curr Opin Cell Biol, 1999. 11(3): p. 318-324.

Vaziri, H. and Benchimol, S., Reconstitution of telomerase activity in
normal human cells leads to elongation of telomeres and extended
replicative life span. Curr Biol, 1998. 8(5): p. 279-282.

Henson, J.D., Neumann, A.A., Yeager, TR. and Reddel, R.R., Alternative
lengthening of telomeres in mammalian cells. Oncogene, 2002. 21(4): p.
598-610.

Hengartner, MO, The biochemistry of apoptosis. Nature, 2000.
407(6805): p. 770-776.

lgney, PH. and Krammer, P.H., Death and anti-death: tumour resistance
to apoptosis. Nat Rev Cancer, 2002. 2(4): p. 277-288.

Schmitz, l., Kirchhoff, S. and Krammer, P.H., Regulation of death receptor-
mediated apoptosis pathways. Int J Biochem Cell Biol, 2000. 32(11-12): p.
1 123-1 136.

Sprick, M.R., Weigand, M.A., Rieser, E., Rauch, C.T., Juo, P., Blenis, J.,
Krammer, PH. and Walczak, H., FADD/MORT1 and caspase-8 are
recruited to TRAIL receptors 1 and 2 and are essential for apoptosis
mediated by TRAIL receptor 2. Immunity, 2000. 12(6): p. 599-609.

Thornberry, NA, The caspase family of cysteine proteases. Br Med Bull,
1997. 53(3): p. 478-490.

Kischkel, F.C., Hellbardt, S., Behnnann, l., Gerrner, M., Pawlita, M.,
Krammer, PH. and Peter, M.E., Cytotoxicity-dependent APO-1
(Fas/CDQ5)-associated proteins form a death-inducing signaling complex
(DISC) with the receptor. Embo J, 1995. 14(22): p. 5579-5588.

lrmler, M., Thome, M., Hahne, M., Schneider, P., Hofmann, K., Steiner, V.,
Bodmer, J.L., Schroter, M., Burns, K., Mattmann, C., Rimoldi, 0., French,
LE. and Tschopp, J., Inhibition of death receptor signals by cellular FLIP.
Nature, 1997. 388(6638): p. 190-195.

109

120.

121.

122.

123.

124.

125.

126.

127.

128.

129.

130.

131.

132.

Rich, T., Allen, R.L. and Wyllie, A.H., Defying death after DNA damage.
Nature, 2000. 407(6805): p. 777-783.

Martinou, JC. and Green, D.R., Breaking the mitochondrial barrier. Nat
Rev Mol Cell Biol, 2001. 2(1): p. 63-67.

Verhagen, A.M., Ekert, P.G., Pakusch, M., Silke, J., Connolly, L.M., Reid,
G.E., Moritz, R.L., Simpson, R.J. and Vaux, D.L., Identification of DlABLO,
a mammalian protein that promotes apoptosis by binding to and
antagonizing IAP proteins. Cell, 2000. 102(1): p. 43-53.

Soengas, M.S., Capodieci, P., Polsky, D., Mora, J., Esteller, M., Opitz-
Araya, X., McCombie, R., Herman, J.G., Gerald, W.L., Lazebnik, Y.A.,
Cordon-Cardo, C. and Lowe, S.W., Inactivation of the apoptosis effector
Apaf—1 in malignant melanoma. Nature, 2001. 409(6817): p. 207-211.

Bertram, J.S., The molecular biology of cancer. Mol Aspects Med, 2000.
21(6): p. 167-223.

Risinger, MA. and Groden, J., Cross/inks and crosstalk: human cancer
syndromes and DNA repair defects. Cancer Cell, 2004. 6(6): p. 539-545.

Fleck, O. and Schar, P., Translesion DNA synthesis: little fingers teach
tolerance. Curr Biol, 2004. 14(10): p. R389-391.

Robbins, J.H., Kraemer, K.H. and Flaxman, B.A., DNA repair in tumor cells
from the variant form of xeroderma pigmentosum. J Invest Dermatol, 1975.
64(3): p. 150-155.

Berneburg, M. and Lehmann, A.R., Xeroderma pigmentosum and related
disorders: defects in DNA repair and transcription. Adv Genet, 2001. 43: p.
71-102.

Maher, V.M., Rowan, L.A., Silinskas, K.C., Kateley, SA. and McCormick,
J.J., Frequency of UV-induced neoplastic transformation of diploid human
fibroblasts is higher in xeroderma pigmentosum cells than in normal cells.
Proc Natl Acad Sci U S A, 1982. 79(8): p. 2613-2617.

Masutani, C., Kusumoto, R., Yamada, A., Dohmae, N., Yokoi, M., Yuasa,
M., Araki, M., lwai, S., Takio, K. and Hanaoka, F., The XPV (xeroderma
pigmentosum variant) gene encodes human DNA polymerase eta. Nature,
1999. 399(6737): p. 700-704.

Zhivotovsky, B. and Kroemer, G., Apoptosis and genomic instability. Nat
Rev Mol Cell Biol, 2004. 5(9): p. 752-762.

Michor, F., Chromosomal instability and human cancer. Philos Trans R
Soc Lond B Biol Sci, 2005. 360(1455): p. 631-635.

110

133.

134.

135.

136.

137.

138.

139.

140.

141.

142.

143.

144.

145.

146.

Hanahan, D. and Folkman, J., Patterns and emerging mechanisms of the
angiogenic switch during tumorigenesis. Cell, 1996. 86(3): p. 353-364.

Hanahan, D., Christofori, G., Naik, P. and Arbeit, J., Transgenic mouse
models of tumour angiogenesis: the angiogenic switch, its molecular
controls, and prospects for preclinical therapeutic models. Eur J Cancer,
1996. 32A(14): p. 2386-2393.

Dameron, K.M., Volpert, O.V., Tainsky, MA. and Bouck, N., Control of
angiogenesis in fibroblasts by p53 regulation of thrombospondin-1.
Science, 1994. 265(5178): p. 1582-1584.

Volpert, O.V., Dameron, KM. and Bouck, N., Sequential development of
an angiogenic phenotype by human fibroblasts progressing to
tumorigenicity. Oncogene, 1997. 14(12): p. 1495-1502.

Webb, CF. and Vande Woude, G.F., Genes that regulate metastasis and
angiogenesis. J Neurooncol, 2000. 50(1-2): p. 71-87.

Beck, L., Jr. and D'Amore, P.A., Vascular development: cellular and
molecular regulation. Faseb J, 1997. 11(5): p. 365-373.

Veikkola, T. and Alitalo, K., VEGFs, receptors and angiogenesis. Semin
Cancer Biol, 1999. 9(3): p. 211-220.

Rundhaug, J.E., Matrix metalloproteinases and angiogenesis. J Cell Mol
Med, 2005. 9(2): p. 267-285.

Hicklin, D.J. and Ellis, L.M., Role of the vascular endothelial growth factor
pathway in tumor growth and angiogenesis. J Clin Oncol, 2005. 23(5): p.
1011-1027.

Risau, W., Angiogenesis and endothelial cell function.
Arzneimittelforschung, 1994. 44(3A): p. 416-417.

Dvorak, H.F., VPF/VEGF and the angiogenic response. Semin Perinatol,
2000. 24(1): p. 75-78.

McMahon, G., VEGF receptor signaling in tumor angiogenesis. Oncologist,
2000. 5 Suppl 1: p. 3-10.

Norrby, K., Vascular endothelial growth factor and de novo mammalian
angiogenesis. Microvasc Res, 1996. 51(2): p. 153-163.

Dery, M.A., Michaud, MD. and Richard, D.E., Hypoxia-inducible factor 1:
regulation by hypoxic and non-hypoxic activators. Int J Biochem Cell Biol,
2005. 37(3): p. 535-540.

111

147.

148.

149.

150.

151.

152.

153.

154.

155.

156.

157.

158.

159.

Maynard, MA. and Ohh, M., Von Hippel-Lindau tumor suppressor protein
and hypoxia-inducible factor in kidney cancer. Am J Nephrol, 2004. 24(1):
p. 1-13.

Kliche, S. and Waltenberger, J., VEGF receptor signaling and endothelial
function. lUBMB Life, 2001. 52(1-2): p. 61-66.

Matsumoto, T. and Claesson-Welsh, L., VEGF receptor signal
transduction. Sci STKE, 2001. 2001(112): p. RE21.

Cairns, R.A., Khokha, R. and Hill, R.P., Molecular mechanisms of tumor
invasion and metastasis: an integrated view. Curr Mol Med, 2003. 3(7): p.
659-671.

Hood, JD. and Cheresh, D.A., Role of integrins in cell invasion and
migration. Nat Rev Cancer, 2002. 2(2): p. 91-100.

Bracke, M.E., Van Roy, PM. and Mareel, M.M., The E-cadherin/catenin
complex in invasion and metastasis. Curr Top Microbiol Immunol, 1996.
213 (PH): p. 123-161.

Ziober, B.L., Lin, CS. and Kramer, R.H., Laminin-binding integrins in tumor
progression and metastasis. Semin Cancer Biol, 1996. 7(3): p. 119-128.

Rudek, M.A., Venitz, J. and Figg. W.D., Matrix metalloproteinase inhibitors:
do they have a place in anticancer therapy? Pharmacotherapy. 2002.
22(6): p. 705-720.

Bissell, M.J. and Radisky, D., Putting tumours in context. Nat Rev Cancer,
2001. 1(1): p. 46-54.

Mareel, M.M., Van Roy, PM. and Bracke, M.E., How and when do tumor
cells metastasize? Crit Rev Oncog, 1993. 4(5): p. 559-594.

Ruoslahti, E., Specialization of tumour vasculature. Nat Rev Cancer, 2002.
2(2): p. 83-90.

Muller, A., Homey, 3., Soto, H., Ge, N., Catron, D., Buchanan, M.E.,
McClanahan, T., Murphy, E., Yuan, W., Wagner, S.N., Barrera, J.L.,
Mohar, A., Verastegui, E. and Zlotnik, A., Involvement of chemokine
receptors in breast cancer metastasis. Nature, 2001. 410(6824): p. 50-56.

McCormick, J.J. and Maher, V.M., Towards an understanding of the
malignant transformation of diploid human fibroblasts. Mutat Res, 1988.
199(2): p. 273-291.

112

160.

161.

162.

163.

164.

165.

166.

167.

168.

169.

170.

McCormick, J.J. and Maher, V.M., Malignant transformation of mammalian
cells in culture, including human cells. Environ Mol Mutagen, 1989. 14
Suppl 16: p. 105-113.

McCormick, J.J. and Maher, V.M., Analysis of the multistep process of
carcinogenesis using human fibroblasts. Risk Anal, 1994. 14(3): p. 257-
263.

Ryan, P.A., Maher, V.M. and McCormick, J.J., Failure of infinite life span
human cells from different immortality complementation groups to yield
finite life span hybrids. J Cell Physiol, 1994. 159(1): p. 151-160.

McCormick, J.J., Fry, D.G., Hurlin, P.J., Morgan, T.L., Wilson, D.M. and
Maher, V.M., Malignant transformation of human fibroblasts by oncogene
transfection or carcinogen treatment. Prog Clin Biol Res, 1990. 3400: p.
195-205.

Morgan, T.L., Yang, D.J., Fry, D.G., Hurlin, P.J., Kohler, S.K., Maher, V.M.
and McCormick, J.J., Characteristics of an infinite life span diploid human
fibroblast cell strain and a near-diploid strain arising from a clone of cells
expressing a transfected v-myc oncogene. Exp Cell Res, 1991. 197(1): p.
125-136.

Hahn, WC. and Weinberg, R.A., Modelling the molecular circuitry of
cancer. Nat Rev Cancer, 2002. 2(5): p. 331-341.

Cerni, C., Telomeres, telomerase, and myc. An update. Mutat Res, 2000.
462(1): p. 31-47.

Gil, J., Kerai, P., Lleonart, M., Bernard, 0., Cigudosa, J.C., Peters, G.,
Camero, A. and Beach, 0., lmmortalization of primary human prostate
epithelial cells by c-Myc. Cancer Res, 2005. 65(6): p. 2179-2185.

Kim, H.S., Shin, J.Y., Yun, J.Y., Ahn, UK and Le, J.Y., lmmortalization of
human embryonic fibroblasts by overexpression of c-myc and simian virus
40 large Tantigen. Exp Mol Med, 2001. 33(4): p. 293-298.

Wu, K.J., Grandori, C., Amacker, M., Simon-Vermot, N., Polack, A.,
Lingner, J. and Dalla-Favera, R., Direct activation of TERT transcription by
c-MYC. Nat Genet, 1999. 21(2): p. 220-224.

Kyo, S., Takakura, M., Taira, T., Kanaya, T., Itoh, H., Yutsudo, M., Ariga,
H. and lnoue, M., Sp1 cooperates with c-Myc to activate transcription of
the human telomerase reverse transcriptase gene (h TERT). Nucleic Acids
Res, 2000. 28(3): p. 669-677.

113

171.

172.

173.

174.

175.

176.

177.

178.

179.

180.

181.

182.

Park, N.H., Guo, W., Kim, H.R., Kang, MK. and Park, N.H., c-Myc and
Sp 1/3 are required for transactivation of hamster telomerase catalytic
subunit gene promoter. Int J Oncol, 2001. 19(4): p. 755-761.

Yang, 0., Kohler, S.K., Maher, V.M. and McCormick, J.J., v-sis oncogene-
induced transformation of human fibroblasts into cells capable of forming
benign tumors. Carcinogenesis, 1994. 15(10): p. 2167-2175.

Wilson, D.M., Yang, D.J., Dillberger, J.E., Dietrich, S.E., Maher, V.M. and
McCormick, J.J., Malignant transformation of human fibroblasts by a
transfected N-ras oncogene. Cancer Res, 1990. 50(17): p. 5587-5593.

Hurlin, P.J., Maher, V.M. and McCormick, J.J., Malignant transformation of
human fibroblasts caused by expression of a transfected T24 HRAS
oncogene. Proc Natl Acad Sci U S A, 1989. 86(1): p. 187-191.

Lin, C., Maher, V.M. and McCormick, J.J., Malignant transformation of
human fibroblast strain MSU-1.1 by v-fes requires an additional genetic
Change. Int J Cancer, 1995. 63(1): p. 140-147.

Fry, D.G., Milam, L.D., Dillberger, J.E., Maher, V.M. and McCormick, J.J.,
Malignant transformation of an infinite life span human fibroblast cell strain
by transfection with v-Ki-ras. Oncogene, 1990. 5(9): p. 1415-1418.

Lin, C., Wang, Q., Maher, V.M. and McCormick, J.J., Malignant
transformation of a human fibroblast cell strain by transfection of a v-fes
oncogene but not by transfection of a gag-human c-fes construct. Cell
Growth Differ, 1994. 5(12): p. 1381-1387.

Benito, M. and Lorenzo, M., Platelet derived growth factor/tyrosine kinase
receptor mediated proliferation. Growth Regul, 1993. 3(3): p. 172-179.

Stice, L.L., Vaziri, C. and Faller, D.V., Regulation of platelet-derived growth
factor signaling by activated p21Ras. Front Biosci, 1999. 4: p. 072-86.

Dikic, l. and Blaukat, A., Protein tyrosine kinase-mediated pathways in G
protein-coupled receptor signaling. Cell Biochem Biophys, 1999. 30(3): p.
369-387.

Lennartsson, J., Blume-Jensen, P., Herrnanson, M., Ponten, E., Carlberg,
M. and Ronnstrand, L., Phosphorylation of Shc by Src family kinases is
necessary for stem cell factor receptor/c-kit mediated activation of the
Ras/MAP kinase pathway and c-fos induction. Oncogene, 1999. 18(40): p.
5546-5553.

Li, J. and Smithgall, T.E., Co-expression with BCR induces activation of

the FES tyrosine kinase and phosphorylation of specific N-terminal BCR
tyrosine residues. J Biol Chem, 1996. 271(51): p. 32930-32936.

114

183.

184.

185.

186.

187.

188.

189.

190.

191.

192.

193.

Boley, S.E., McManus, T.P., Maher, V.M. and McCormick, J.J., Malignant
transformation of human fibroblast cell strain MSU-1.1 by N-methyl-N-
nitrosourea: evidence of elimination of p53 by homologous recombination.
Cancer Res, 2000. 60(15): p. 4105-4111.

O'Reilly, 8., Walicka, M., Kohler, S.K., Dunstan, R., Maher, V.M. and
McCormick, J.J., Dose-dependent transformation of cells of human
fibroblast cell strain MSU-1.1 by cobalt-60 gamma radiation and
characterization of the transformed cells. Radiat Res, 1998. 150(5): p. 577-
584.

Yang, 0., Louden, C., Reinhold, D.S., Kohler, S.K., Maher, V.M. and
McCormick, J.J., Malignant transformation of human fibroblast cell strain
MSU-1.1 by (+-)-7 beta,8 alpha-dihydroxy-Q alpha,10 alpha-epoxy-
7,8,9,10-tetrahydrobenzo [a]pyrene. Proc Natl Acad Sci U S A, 1992.
89(6): p. 2237-2241.

Lou, Z., O'Reilly, S., Liang, H., Maher, V.M., Sleight, SD. and McCormick,
J.J., Down-regulation of overexpressed sp1 protein in human fibrosarcoma
cell lines inhibits tumor formation. Cancer Res, 2005. 65(3): p. 1007-1017.

Liang, H., O'Reilly, 8., Liu, Y., Abounader, R., Laterra, J., Maher, V.M. and
McCormick, J.J., Sp1 regulates expression of MET, and ribozyme-induced
down-regulation of MET in fibrosarcoma-derived human cells reduces or
eliminates their tumorigenicity. Int J Oncol, 2004. 24(5): p. 1057-1067.

Qing, J., Maher, V.M., Tran, H., Argraves, W.S., Dunstan, R.W. and
McCormick, J.J., Suppression of anchorage-independent growth and
matrigel invasion and delayed tumor formation by elevated expression of
fibulin-1D in human fibrosarcoma-derived cell lines. Oncogene, 1997.
15(18): p. 2159-2168.

Colicelli, J., Human RAS superfamily proteins and related GTPases. Sci
STKE, 2004. 2004(250): p. RE13.

Rodenhuis, S., ras and human tumors. Semin Cancer Biol, 1992. 3(4): p.
241-247.

Malumbres, M. and Pellicer, A., RAS pathways to cell cycle control and cell
transformation. Front Biosci, 1998. 3: p. d887-912.

Harvey, J.J., An Unidentified Virus Which Causes The Rapid Production Of
Tumours In Mice. Nature, 1964. 204: p. 1104-1105.

Hall, A., Marshall, C.J., Spurr, MK and Weiss, R.A., Identification of
transforming gene in two human sarcoma cell lines as a new member of
the ras gene family located on chromosome 1. Nature, 1983. 303(5916): p.
396-400.

115

194.

195.

196.

197.

198.

199.

200.

201.

202.

203.

204.

Der, C.J., Krontiris, TC. and Cooper, G.M., Transforming genes of human
bladder and lung carcinoma cell lines are homologous to the ras genes of
Harvey and Kirsten sarcoma viruses. Proc Natl Acad Sci U S A, 1982.
79(1 1 ): p. 3637-3640.

Parada, L.F. and Weinberg, R.A., Presence of a Kirsten murine sarcoma
virus ras oncogene in cells transformed by 3-methylcholanthrene. Mol Cell
Biol, 1983. 3(12): p. 2298-2301.

Scolnick, E.M., Rands, E., Williams, D. and Parks, W.P., Studies on the
nucleic acid sequences of Kirsten sarcoma virus: a model for formation of
a mammalian RNA-containing sarcoma virus. J Virol, 1973. 12(3): p. 458-
463.

Santos, E., Tronick, S.R., Aaronson, S.A., Pulciani, S. and Barbacid, M.,
T24 human bladder carcinoma oncogene is an activated form of the
normal human homologue of BALB- and Harvey-MSV transforming genes.
Nature, 1982. 298(5872): p. 343-347.

Reddy, E.P., Reynolds, R.K., Santos, E. and Barbacid, M., A point
mutation is responsible for the acquisition of transforming properties by the
T24 human bladder carcinoma oncogene. Nature, 1982. 300(5888): p.
149-152.

Tabin, C.J., Bradley, S.M., Bargmann, C.|., Weinberg, R.A., Papageorge,
A.G., Scolnick, E.M., Dhar, R., Lowy, DR. and Chang, E.H., Mechanism of
activation ofa human oncogene. Nature, 1982. 300(5888): p. 143-149.

Taparowsky, E., Suard, Y., Fasano, 0., Shimizu, K., Goldfarb, M. and
Wigler, M., Activation of the T24 bladder carcinoma transforming gene is
linked to a single amino acid change. Nature, 1982. 300(5894): p. 762-765.

Hurley, J.B., Simon, M.|., Teplow, D.B., Robishaw, JD. and Gilman, A.G.,
Homologies between signal transducing G proteins and ras gene products.
Science, 1984. 226(4676): p. 860-862.

McCormick, F., Coupling of ras p21 signalling and GTP hydrolysis by
GTPase activating proteins. Philos Trans R Soc Lond B Biol Sci, 1992.
336( 1276): p. 43-47; discussion 47-48.

Boume, H.R., Sanders, DA. and McCormick, F., The GTPase superfamily:
conserved structure and molecular mechanism. Nature, 1991. 349(6305):
p. 117-127.

Perez-Sela, D. and Rebollo, A., Novel aspects of Ras proteins biology:
regulation and implications. Cell Death Differ, 1999. 6(8): p. 722-728.

116

205.

206.

207.

208.

209.

210.

211.

212.

213.

214.

215.

216.

Milbum, M.V., Tong, L., deVos, A.M., Brunger, A., Yamaizumi, Z.,
Nishimura, S. and Kim, S.H., Molecular switch for signal transduction:
structural differences between active and inactive forms of protooncogenic
ras proteins. Science, 1990. 247(4945): p. 939-945.

Herrrnann, C., Horn, G., Spaargaren, M. and Wittinghofer, A., Differential
interaction of the ras family GTP-binding proteins H-Ras, Rap 1A, and R-
Ras with the putative effector molecules Raf kinase and Ral-guanine
nucleotide exchange factor. J Biol Chem, 1996. 271(12): p. 6794-6800.

Neal, S.E., Eccleston, J.F., Hall, A. and Webb, M.R., Kinetic analysis of the
hydrolysis of GTP by p21N-ras. The basal GTPase mechanism. J Biol
Chem, 1988. 263(36): p. 19718-19722.

Quilliam, L.A., Rebhun, J.F. and Castro, A.F., A growing family of guanine
nucleotide exchange factors is responsible for activation of Ras-family
GTPases. Prog Nucleic Acid Res Mol Biol, 2002. 71: p. 391-444.

Feig, LA. and Cooper, G.M., Inhibition of NIH 3T3 cell proliferation by a
mutant ras protein with preferential affinity for GDP. Mol Cell Biol, 1988.
8(8): p. 3235-3243.

Chen, S.Y., Huff, S.Y., Lai, C.C., Der, OJ. and Powers, 8., Ras-15A
protein shares highly similar dominant-negative biological properties with
Ras-17N and forms a stable, guanine-nucleotide resistant complex with
CDCZ5 exchange factor. Oncogene, 1994. 9(9): p. 2691-2698.

Boguski, MS. and McCormick, F., Proteins regulating Ras and its
relatives. Nature, 1993. 366(6456): p. 643-654.

Donovan, 8., Shannon, KM. and Bollag, G., GTPase activating proteins:
critical regulators of intracellular signaling. Biochim Biophys Acta, 2002.
1602(1): p. 23-45.

Scheffzek, K., Ahmadian, MR. and Wittinghofer, A., GTPase-activating
proteins: helping hands to complement an active site. Trends Biochem Sci,
1998. 23(7): p. 257-262.

Bollag, G. and McCormick, F., Regulators and effectors of ras proteins.
Annu Rev Cell Biol, 1991. 7: p. 601-632.

Nimnual, A. and Bar-Sagi, D., The two hats of SOS. Sci STKE, 2002.
2002(145): p. PE36.

Buday, L. and Downward, J., Epidermal growth factor regulates p21ras

through the formation of a complex of receptor, Grb2 adapter protein, and
803 nucleotide exchange factor. Cell, 1993. 73(3): p. 611-620.

117

217.

218.

219.

220.

221.

222.

223.

224.

225.

226.

227.

228.

Cadena, D.L. and Gill, G.N., Receptor tyrosine kinases. Faseb J, 1992.
6(6): p. 2332-2337.

Ceresa, BR and Pessin, J.E., Insulin regulation of the Ras
activation/inactivation cycle. Mol Cell Biochem, 1998. 182(1-2): p. 23-29.

Crespo, P., Xu, N., Simonds, W.F. and Gutkind, J.S., Ras-dependent
activation of MAP kinase pathway mediated by G-protein beta gamma
subunits. Nature, 1994. 369(6479): p. 418-420.

Luttrell, L.M., Hawes, B.E., van Biesen, T., Luttrell, D.K., Lansing, T.J. and
Lefkowitz, R.J., Role of c-Src tyrosine kinase in G protein-coupled
receptor- and Gbetagamma subunit-mediated activation of mitogen-
activated protein kinases. J Biol Chem, 1996. 271(32): p. 19443-19450.

Douville, E. and Downward, J., EGF induced SOS phosphorylation in
PC12 cells involves P90 RSK-2. Oncogene, 1997. 15(4): p. 373-383.

Jefferson, A. B., Klippel, A. and Williams, L. T. Inhibition of mSOS-activity
by binding of phosphatidylinositol 4, 5-P2 to the mSOS pleckstrin homology
domain. Oncogene, 1998. 16(18): p. 2303- 2310.

Cullen, P.J. and Lockyer, P.J., Integration of calcium and Ras signalling.
Nat Rev Mol Cell Biol, 2002. 3(5): p. 339-348.

Famsworth, C.L., Freshney, N.W., Rosen, L.B., Ghosh, A., Greenberg,
ME. and Feig, L.A., Calcium activation of Ras mediated by neuronal
exchange factor Ras-GRF. Nature, 1995. 376(6540): p. 524-527.

Gideon, P., John, J., Frech, M., Lautwein, A., Clark, R., Scheffler, J.E. and
Wittinghofer, A., Mutational and kinetic analyses of the GTPase-activating
protein (GAP)-p21 interaction: the C-terminal domain of GAP is not
sufficient for full activity. Mol Cell Biol, 1992. 12(5): p. 2050-2056.

Willumsen, B.M., Christensen, A., Hubbert, N.L., Papageorge, AG. and
Lowy, D.R., The p21 ras C-terminus is required for transformation and
membrane association. Nature, 1984. 310(5978): p. 583-586.

Niv, H., Gutman, O., Kloog, Y. and Henis, Y.|., Activated K-Ras and H-Ras
display different interactions with saturable nonraft sites at the surface of
live cells. J Cell Biol, 2002. 157(5): p. 865-872.

Prior, l.A., Muncke, C., Patton, RC. and Hancock, J.F., Direct visualization

of Ras proteins in spatially distinct cell surface microdomains. J Cell Biol,
2003. 160(2): p. 165-170.

118

229.

230.

231.

232.

233.

234.

235.

236.

237.

238.

239.

240.

241.

Reiss, Y., Goldstein, J.L., Seabra, M.C., Casey, P.J. and Brown, M.S.,
Inhibition of purified p21ras farnesylsprotein transferase by Cys-AAX
tetrapeptides. Cell, 1990. 62(1): p. 81-88.

Boyartchuk, V.L., Ashby, MN. and Rine, J., Modulation of Ras and a-factor
function by carboxyl-terminal proteolysis. Science, 1997. 275(5307): p.
1796-1800.

Dai, Q., Choy, E., Chiu, V., Romano, J., Slivka, S.R., Steitz, S.A.,
Michaelis, S. and Philips, M.R., Mammalian prenylcysteine carboxyl
methyltransferase is in the endoplasmic reticulum. J Biol Chem, 1998.
273(24): p. 15030-15034.

Apolloni, A., Prior, l.A., Lindsay, M., Parton, R.G. and Hancock, J.F., H-ras
but not K-ras traffics to the plasma membrane through the exocytic
pathway. Mol Cell Biol, 2000. 20(7): p. 2475-2487.

Repasky, G.A., Chenette, E.J. and Der, C.J., Renewing the conspiracy
theory debate: does Raf function alone to mediate Ras oncogenesis?
Trends Cell Biol, 2004. 14(11): p. 639-647.

Herrmann, C., Ras-effector interactions: after one decade. Curr Opin
Struct Biol, 2003. 13(1): p. 122-129.

Wellbrock, C., Karasarides, M. and Marais, R., The RAF proteins take
centre stage. Nat Rev Mol Cell Biol, 2004. 5(11): p. 875-885.

Wittinghofer, A. and Nassar, N., How Ras-related proteins talk to their
effectors. Trends Biochem Sci, 1996. 21(12): p. 488-491.

Drugan, J.K., Khosravi-Far, R., White, M.A., Der, C.J., Sung, Y.J., Hwang,
Y.W. and Campbell, S.L., Ras interaction with two distinct binding domains
in Raf-1 may be required for Ras transformation. J Biol Chem, 1996.
271(1): p. 233-237.

Stokoe, D., Macdonald, S.G., Cadwallader, K., Symons, M. and Hancock,
J.F., Activation of Raf as a result of recruitment to the plasma membrane.
Science, 1994. 264(5164): p. 1463-1467.

Morrison, OK. and Cutler, R.E., The complexity of Raf-1 regulation. Curr
Opin Cell Biol, 1997. 9(2): p. 174-179.

Johnson, G.L. and Lapadat, R., Mitogen-activated protein kinase pathways
mediated by ERK, JNK, and p38 protein kinases. Science, 2002.
298(5600): p. 1911-1912.

Hilger, R.A., Scheulen, ME. and Strumberg, D., The Ras-Raf-MEK-ERK
pathway in the treatment of cancer. Onkologie, 2002. 25(6): p. 51 1-518.

119

242.

243.

244.

245.

246.

247.

248.

249.

250.

251.

252.

253.

254.

Hazzalin, CA. and Mahadevan, L.C., MAPK-regulated transcription: a
continuously variable gene switch? Nat Rev Mol Cell Biol, 2002. 3(1): p.
30-40.

Carpenter, CL. and Cantley, L.C., Phosphoinositide 3-kinase and the
regulation of cell growth. Biochim Biophys Acta, 1996. 1288(1): p. M11-16.

Franke, T.F., Kaplan, DR. and Cantley, L.C., PI3K: downstream AKTion
blocks apoptosis. Cell, 1997. 88(4): p. 435-437.

Okkenhaug, K. and Vanhaesebroeck, B., New responsibilities for the PI3K
regulatory subunit p85 alpha. Sci STKE, 2001. 2001(65): p. PE1.

Otsu, M., Hiles, l., Gout, |., Fry, M.J., Ruiz-Larrea, F., Panayotou, G.,
Thompson, A., Dhand, R., Hsuan, J., Totty, N. and et al., Characterization
of two 85 kd proteins that associate with receptor tyrosine kinases, middle-
T/pp60c-src complexes, and Pl3-kinase. Cell, 1991. 65(1): p. 91-104.

Rodriguez-Viciana, P., Wame, P.H., Vanhaesebroeck, B., Waterfield, MD.
and Downward, J., Activation of phosphoinositide 3-kinase by interaction
with Ras and by point mutation. Embo J, 1996. 15(10): p. 2442-2451.

Maffucci, T. and Falasca, M., Specificity in pleckstrin homology (PH)
domain membrane targeting: a role for a phosphoinositide-protein co-
operative mechanism. FEBS Lett, 2001. 506(3): p. 173-179.

Gillooly, D.J., Simonsen, A. and Stenmark, H., Cellular functions of
phosphatidylinositol 3-phosphate and FYVE domain proteins. Biochem J,
2001. 355(Pt 2): p. 249-258.

Alessi, D.R., Andjelkovic, M., Caudwell, B., Cron, P., Morrice, N., Cohen,
P. and Hemmings, B.A., Mechanism of activation of protein kinase B by
insulin and IGF-1. Embo J, 1996. 15(23): p. 6541-6551.

Datta, S.R., Brunet, A. and Greenberg, M.E., Cellular survival: a play in
three Akts. Genes Dev, 1999. 13(22): p. 2905-2927.

Datta, S.R., Dudek, H., Tao, X., Masters, 8., Fu, H., Gotoh, Y. and
Greenberg, M.E., Akt phosphorylation of BAD coup/es survival signals to
the cell-intrinsic death machinery. Cell, 1997. 91(2): p. 231-241.

Kane, L.P., Shapiro, V.S., Stokoe, D. and Weiss, A., Induction of NF-
kappaB by the Akt/PKB kinase. Curr Biol, 1999. 9(11): p. 601-604.

Burgering, 8M. and Medema, R.H., Decisions on life and death: FOXO
Forkhead transcription factors are in command when PKB/Akt is off duty. J
Leukoc Biol, 2003. 73(6): p. 689-701.

120

255.

256.

257.

258.

259.

260.

261.

262.

263.

264.

265.

266.

267.

Mayo, L.D., Dixon, J.E., Durden, D.L., Tonks, MK. and Donner, D.B.,
PTEN protects p53 from Mdm2 and sensitizes cancer cells to
chemotherapy. J Biol Chem, 2002. 277(7): p. 5484-5489.

Mayo, LD. and Donner, D.B., A phosphatidylinositol 3-kinase/Akt pathway
promotes translocation of Mdm2 from the cytoplasm to the nucleus. Proc
Natl Acad Sci U S A, 2001. 98(20): p. 11598-11603.

Doble, SW. and Woodgett, J.R., GSK-3: tricks of the trade for a multi-
tasking kinase. J Cell Sci, 2003. 116(Pt 7): p. 1175-1186.

Cross, D.A., Alessi, D.R., Cohen, R, Andjelkovich, M. and Hemmings,
B.A., Inhibition of glycogen synthase kinase-3 by insulin mediated by
protein kinase 8. Nature, 1995. 378(6559): p. 785-789.

Bar-Sagi, D. and Hall, A., Rae and Rho GTPases: a family reunion. Cell,
2000. 103(2): p. 227-238.

Lambert, J.M., Lambert, Q.T., Reuther, G.W., Malliri, A., Siderovski, D.P.,
Sondek, J., Collard, J.G. and Der, C.J., Tiam1 mediates Ras activation of
Rac by a Pl(3)K-independent mechanism. Nat Cell Biol, 2002. 4(8): p. 621-
625.

Welch, H.C., Coadwell, W.J., Stephens, LR. and Hawkins, P.T.,
Phosphoinositide 3-kinase-dependent activation of Rac. FEBS Lett, 2003.
546(1): p. 93-97.

Michiels, F., Habets, G.G., Stam, J.C., van der Kammen, RA. and Collard,
J.G., A role for Rac in Tiam1-induced membrane ruffling and invasion.
Nature, 1995. 375(6529): p. 338-340.

Fleming, |.N., Elliott, C.M., Buchanan, F.G., Downes, GP. and Exton, J.H.,
Ca2+/calmodulin-dependent protein kinase II regulates Tiam1 by
reversible protein phosphorylation. J Biol Chem, 1999. 274(18): p. 12753-
12758.

Mertens, A.E., Roovers, RC. and Collard, J.G., Regulation of Tiam1-Rac
signalling. FEBS Lett, 2003. 546(1): p. 11-16.

Feig, L.A., Urano, T. and Cantor, 8., Evidence for a Ras/Ral signaling
cascade. Trends Biochem Sci, 1996. 21(11): p. 438-441.

Geyer, M., Herrmann, C., Wohlgemuth, S., Wittinghofer, A. and Kalbitzer,
H.R., Structure of the Ras-binding domain of RalGEF and implications for
Ras binding and signalling. Nat Struct Biol, 1997. 4(9): p. 694-699.

Wolthuis, RM. and 303, J.L., Ras caught in another affair: the exchange
factors for Ral. Curr Opin Genet Dev, 1999. 9(1): p. 112-117.

121

268.

269.

270.

271.

272.

273.

274.

275.

276.

277.

278.

Voss, M., Weemink, P.A., Haupenthal, S., Moller, U., Cool, R.H., Bauer,
8., Camonis, J.H., Jakobs, K.H. and Schmidt, M., Phospholipase D
stimulation by receptor tyrosine kinases mediated by protein kinase C and
a Ras/Ral signaling cascade. J Biol Chem, 1999. 274(49): p. 34691-34698.

Cantor, S.B., Urano, T. and Feig, L.A., Identification and characterization
of Ral-binding protein 1, a potential downstream target of Ral GTPases.
Mol Cell Biol, 1995. 15(8): p. 4578-4584.

Jullien-Flores, V., Dorseuil, O., Romero, F., Letourneur, F., Saragosti, S.,
Berger, R., Tavitian, A., Gacon, G. and Camonis, J.H., Bridging Ral
GTPase to Rho pathways. RLIP76, a Ral effector with CDC42/Rac
GTPase-activating protein activity. J Biol Chem, 1995. 270(38): p. 22473-
22477.

Russell, M., Lange-Carter, CA. and Johnson, G.L., Direct interaction
between Ras and the kinase domain of mitogen-activated protein kinase
kinase kinase (MEKK1). J Biol Chem, 1995. 270(20): p. 11757-11760.

Uhlik, M.T., Abell, A.N., Cuevas, B.D., Nakamura, K. and Johnson, G.L.,
Wiring diagrams of MAPK regulation by MEKK 1, 2, and 3. Biochem Cell
Biol, 2004. 82(6): p. 658-663.

Tall, G.G., Barbieri, M.A., Stahl, PD. and Horazdovsky, B.F., Ras-
activated endocytosis is mediated by the Rab5 guanine nucleotide
exchange activity of RIN1. Dev Cell, 2001. 1(1): p. 73-82.

Barbieri, M.A., Kong, C., Chen, P.l., Horazdovsky, BF. and Stahl, P.D.,
The SRC homology 2 domain of Rin1 mediates its binding to the epidermal
growth factor receptor and regulates receptor endocytosis. J Biol Chem,
2003. 278(34): p. 32027-32036.

Hu, H., Bliss, J.M., Wang, Y. and Colicelli, J., RIN1 is an ABL tyrosine
kinase activator and a regulator of epithelial-cell adhesion and migration.
Curr Biol, 2005. 15(9): p. 815-823.

Kuriyama, M., Harada, N., Kuroda, S., Yamamoto, T., Nakafuku, M.,
Iwamatsu, A., Yamamoto, D., Prasad, R., Croce, C., Canaani, E. and
Kaibuchi, K., Identification of AF-6 and canoe as putative targets for Ras. J
Biol Chem, 1996. 271(2): p. 607-610.

Radziwill, G., Erdmann, R.A., Margelisch, U. and Moelling, K., The Bcr
kinase downregulates Ras signaling by phosphorylating AF-6 and binding
to its PDZ domain. Mol Cell Biol, 2003. 23(13): p. 4663-4672.

Boettner, B., Harjes, P., lshimaru, S., Heke, M., Fan, H.Q., Qin, Y., Van
Aelst, L. and Gaul, U., The AF-6 homolog canoe acts as a Rap1 effector

122

279.

280.

281.

282.

283.

284.

285.

286.

287.

288.

during dorsal closure of the Drosophila embryo. Genetics, 2003. 165(1): p.
1 59-169.

Su, L., Hattori, M., Moriyama, M., Murata, N., Harazaki, M., Kaibuchi, K.
and Minato, N., AF-6 controls integrin-mediated cell adhesion by regulating
Rap1 activation through the specific recruitment of Rap1GTP and SPA-1. J
Biol Chem, 2003. 278(17): p. 15232-15238.

Aoyama, Y., Avruch, J. and Zhang, X.F., Nore1 inhibits tumor cell growth
independent of Ras or the MST1/2 kinases. Oncogene, 2004. 23(19): p.
3426-3433.

Hesson, L., Bieche, |., Krex, D., Criniere, E., Hoang-Xuan, K., Maher, ER.
and Latif, F., Frequent epigenetic inactivation of RASSF 1A and BLU genes
located within the critical 3p21.3 region in gliomas. Oncogene, 2004.
23(13): p. 2408-2419.

Li, Z., Zhang, H., McManus, T.P., McCormick, J.J., Lawrence, CW. and
Maher, V.M., hRE V3 is essential for error-prone translesion synthesis past
UV or benzo[a]pyrene diol epoxide-induced DNA lesions in human
fibroblasts. Mutat Res, 2002. 510(1-2): p. 71-80.

Khokhlatchev, A., Rabizadeh, 8., Xavier, R., Nedwidek, M., Chen, T.,
Zhang, X.F., Seed, B. and Avruch, J., Identification of a novel Ras-
regulated proapoptotic pathway. Curr Biol, 2002. 12(4): p. 253-265.

Mulcahy, L.S., Smith, MR. and Stacey, D.W., Requirement for ras proto-
oncogene function during serum-stimulated growth of NIH 3T3 cells.
Nature, 1985. 313(5999): p. 241-243.

Peeper, D.S., Upton, T.M., Ladha, M.H., Neuman, E., Zalvide, J.,
Bemards, R., DeCaprio, J.A. and Ewen, M.E., Ras signalling linked to the
cell-cycle machinery by the retinoblastoma protein. Nature, 1997.
386(6621): p. 177-181.

Filmus, J., Robles, A.l., Shi, W., Wong, M.J., Colombo, LL. and Conti,
C.J., Induction of cyclin D1 overexpression by activated ras. Oncogene,
1994. 9(12): p. 3627-3633.

Westwick, J.K., Lambert, Q.T., Clark, G.J., Symons, M., Van Aelst, L.,
Pestell, R.G. and Der, C.J., Rac regulation of transformation, gene
expression, and actin organization by multiple, PAK-independent
pathways. Mol Cell Biol, 1997. 17(3): p. 1324-1335.

Muise-Helmericks, R.C., Grimes, H.L., Bellacosa, A., Malstrom, S.E.,
Tsichlis, RN. and Rosen, N., Cyclin D expression is controlled post-
transcriptionally via a phosphatidylinositol 3-kinase/Akt-dependent
pathway. J Biol Chem, 1998. 273(45): p. 29864-29872.

123

289.

290.

291.

292.

293.

294.

295.

296.

297.

298.

Diehl, J.A., Cheng, M., Roussel, M.F. and Sherr, C.J., Glycogen synthase
kinase-3beta regulates cyclin D1 proteolysis and subcel/ular localization.
Genes Dev, 1998. 12(22): p. 3499-3511.

Joyce, D., Bouzahzah, B., Fu, M., Albanese, C., D'Amico, M., Steer, J.,
Klein, J.U., Lee, R.J., Segall, J.E., Westwick, J.K., Der, OJ. and Pestell,
R.G., Integration of Rac-dependent regulation of cyclin D1 transcription
through a nuclear factor-kappaB-dependent pathway. J Biol Chem, 1999.
274(36): p. 25245-25249.

Delmas, C., Manenti, S., Boudjelal, A., Peyssonnaux, C., Eychene, A. and
Darbon, J.M., The p42/p44 mitogen-activated protein kinase activation
triggers p27Kip1 degradation independently of CDK2/cyc/in E in NIH 3T3
cells. J Biol Chem, 2001. 276(37): p. 34958-34965.

Kops, G.J., de Ruiter, N.D., De Vries-Smits, A.M., Powell, D.R., Bos, J.L.
and Burgering, B.M., Direct control of the Forkhead transcription factor
AFX by protein kinase 8. Nature, 1999. 398(6728): p. 630-634.

Weber, J.D., Hu, W., Jefcoat, S.G., Jr., Raben, D.M. and Baldassare, J.J.,
Ras-stimulated extracellular signal-related kinase 1 and RhoA activities
coordinate platelet-derived growth factor-induced G1 progression through
the independent regulation of cyclin D1 and p27. J Biol Chem, 1997.
272(52): p. 32966-32971.

Serrano, M., Lin, A.W., McCurrach, M.E., Beach, D. and Lowe, S.W.,
Oncogenic ras provokes premature cell senescence associated with
accumulation of p53 and p16INK4a. Cell, 1997. 88(5): p. 593-602.

Woods, D., Pan'y, D., Chervvinski, H., Bosch, E., Lees, E. and McMahon,
M., Raf-induced proliferation or cell cycle arrest is determined by the level
of Raf activity with arrest mediated by p21Cip1. Mol Cell Biol, 1997. 17(9):
p. 5598-5611.

Aoki, M., Blazek, E. and Vogt, P.K., A role of the kinase mTOR in cellular
transformation induced by the oncoproteins P3k and Akt. Proc Natl Acad
Sci U S A, 2001. 98(1): p. 136-141.

Aspuria, P.J. and Tamanoi, F., The Rheb family of GTP-binding proteins.
Cell Signal, 2004. 16(10): p. 1105-1112.

Garami, A., Zwartkruis, F.J., Nobukuni, T., Joaquin, M., Roccio, M.,
Stocker, H., Kozma, S.C., Hafen, E., Bos, J.L. and Thomas, G., Insulin
activation of Rheb, a mediator of mTOR/S6K/4E-BP signaling, is inhibited
by T801 and 2. Mol Cell, 2003. 11(6): p. 1457-1466.

124

299.

300.

301.

302.

303.

304.

305.

306.

307.

308.

309.

Fingar, D.C., Salama, S., Tsou, C., Harlow, E. and Blenis, J., Mammalian
cell size is controlled by mTOR and its downstream targets S6K1 and
4EBP1/elF4E. Genes Dev, 2002. 16(12): p. 1472-1487.

Tee, AR. and Blenis, J., mTOR, translational control and human disease.
Semin Cell Dev Biol, 2005. 16(1): p. 29-37.

Sen, P., Mukherjee, 8., Ray, D. and Raha, S., Involvement of the Akt/PKB
signaling pathway with disease processes. Mol Cell Biochem, 2003. 253(1-
2): p. 241-246.

Chang, F., Lee, J.T., Navolanic, P.M., Steelman, L.S., Shelton, J.G.,
Blalock, W.L., Franklin, RA. and McCubrey, J.A., Involvement of Pl3K/Akt
pathway in cell cycle progression, apoptosis, and neoplastic
transformation: a target for cancer chemotherapy. Leukemia, 2003. 17(3):
p. 590-603.

Sulciner, D.J., Irani, K., Yu, Z.X., Ferrans, V.J., Goldschmidt-Clermont, P.
and Finkel, T., rac1 regulates a cytokine-stimulated, redox-dependent
pathway necessary for NF-kappaB activation. Mol Cell Biol, 1996. 16(12):
p. 7115-7121.

Kauffmann-Zeh, A., Rodriguez-Viciana, P., Ulrich, E., Gilbert, C., Coffer,
P., Downward, J. and Evan, G., Suppression of c-Myc-induced apoptosis
by Ras signalling through Pl(3)K and PKB. Nature, 1997. 385(6616): p.
544-548.

Chang, F., Steelman, L.S., Shelton, J.G., Lee, J.T., Navolanic, P.M.,
Blalock, W.L., Franklin, R. and McCubrey, J.A., Regulation of cell cycle
progression and apoptosis by the Ras/RaIVMEK/ERK pathway (Review).
Int J Oncol, 2003. 22(3): p. 469-480.

Troppmair, J. and Rapp. U.R., Raf and the road to cell survival: a tale of
bad spells, ring bearers and detours. Biochem Pharmacol, 2003. 66(8): p.
1341-1345.

Ries, 8., Biederer, C., Woods, 0., Shifman, O., Shirasawa, S., Sasazuki,
T., McMahon, M., Oren, M. and McCormick, F., Opposing effects of Ras
on p53: transcriptional activation of mdm2 and induction of p19ARF. Cell,
2000. 103(2): p. 321-330.

Burridge, K. and Wennerberg, K., Rho and Rac take center stage. Cell,
2004. 116(2): p. 167-179.

Shields, J.M., Pruitt, K., McFall, A., Shaub, A. and Der, C.J.,
Understanding Ras: 'it ain't over 'til it’s over'. Trends Cell Biol, 2000. 10(4):
p. 147-154.

125

310.

311.

312.

313.

314.

315.

316.

317.

318.

319.

320.

321.

Allen, W.E., Zicha, D., Ridley, A.J. and Jones, G.E., A role for Cdc42 in
macrophage chemotaxis. J Cell Biol, 1998. 141(5): p. 1147-1157.

Banyard, J., Anand-Apte, B., Symons, M. and Zetter, B.R., Motility and
invasion are differentially modulated by Rho family GTPases. Oncogene,
2000. 19(4): p. 580-591.

Doanes, A.M., Irani, K., Goldschmidt-Clermont, P.J. and Finkel, T., A
requirement for rac1 in the PDGF-stimulated migration of fibroblasts and
vascular smooth cells. Biochem Mol Biol Int, 1998. 45(2): p. 279-287.

Nobes, CD. and Hall, A., Rho GTPases control polarity, protrusion, and
adhesion during cell movement. J Cell Biol, 1999. 144(6): p. 1235-1244.

Fox, P.L., Sa, 6., Dobrowolski, SF. and Stacey, D.W., The regulation of
endothelial cell motility by p21 ras. Oncogene, 1994. 9(12): p. 3519-3526.

Cheresh, D.A., Leng, J. and Klemke, R.L., Regulation of cell contraction
and membrane ruffling by distinct signals in migratory cells. J Cell Biol,
1999. 146(5): p. 1107-1116.

McGlade, J., Brunkhorst, B., Anderson, D., Mbamalu, G., Settleman, J.,
Dedhar, S., Rozakis-Adcock, M., Chen, LB. and Pawson, T., The N-
terminal region of GAP regulates cytoskeletal structure and cell adhesion.
Embo J, 1993. 12(8): p. 3073-3081.

Kulkami, S.V., Gish, G., van der Geer, P., Henkemeyer, M. and Pawson,
T., Role of p120 Ras-GAP in directed cell movement. J Cell Biol, 2000.
149(2): p. 457-470.

Kranenburg, O., Gebbink, M.F. and Voest, E.E., Stimulation of
angiogenesis by Ras proteins. Biochim Biophys Acta, 2004. 1654(1): p.
23-37.

Collier, I.E., Wilhelm, S.M., Eisen, A.Z., Mariner, B.L., Grant, G.A., Seltzer,
J.L., Kronberger, A., He, C.S., Bauer, EA. and Goldberg, G.l., H-ras
oncogene-transformed human bronchial epithelial cells ( TBE- 1) secrete a

single metalloprotease capable of degrading basement membrane
collagen. J Biol Chem, 1988. 263(14): p. 6579-6587.

Westermarck, J., Li, S.P., Kallunki, T., Han, J. and Kahari, V.M., p38
mitogen-activated protein kinase—dependent activation of protein
phosphatases 1 and 2A inhibits MEK1 and MEK2 activity and collagenase
1 (MMP-1) gene expression. Mol Cell Biol, 2001. 21(7): p. 2373-2383.

Yang, J.Q., Zhao, W., Duan, H., Robbins, M.E., Buettner, G.R., Oberley,
L.W. and Domann, F .E., v-Ha-RaS oncogene upregu/ates the 92-kDa type

126

322.

323.

324.

325.

326.

327.

328.

329.

330.

331.

332.

IV collagenase (MMP-9) gene by increasing cellular superoxide production
and activating NF-kappaB. Free Radic Biol Med, 2001. 31(4): p. 520-529.

Furge, K.A., Kiewlich, D., Le, P., Vo, M.N., Faure, M., Howlett, A.R.,
Lipson, K.E., Woude, GP. and Webb, C.P., Suppression of Ras-mediated
tumorigenicity and metastasis through inhibition of the Met receptor
tyrosine kinase. Proc Natl Acad Sci U S A, 2001. 98(19): p. 10722-10727.

Webb, CR, Taylor, G.A., Jeffers, M., Fiscella, M., Oskarsson, M., Resau,
J.H. and Vande Woude, G.F., Evidence for a role of Met-HGF/SF during
Ras-mediated tumorigenesis/metastasis. Oncogene, 1998. 17(16): p.
2019-2025.

Hacohen, N., Kramer, S., Sutherland, D., Hiromi, Y. and Krasnow, M.A.,
sprouty encodes a novel antagonist of FGF signaling that patterns apical
branching of the Drosophila airways. Cell, 1998. 92(2): p. 253-263.

Warburton, D., Schwarz, M., Tefft, D., Flores-Delgado, G., Anderson, KB.
and Cardoso, W.V., The molecular basis of lung morphogenesis. Mech
Dev, 2000. 92(1): p. 55-81.

Placzek, M. and Skaer, H., Airway patterning: A paradigm for restricted
signalling. Curr Biol, 1999. 9(14): p. R506-510.

Casci, T., Vinos, J. and Freeman, M., Sprouty, an intracellular inhibitor of
Ras signaling. Cell, 1999. 96(5): p. 655-665.

Reich, A., Sapir, A. and Shilo, B., Sprouty is a general inhibitor of receptor
tyrosine kinase signaling. Development, 1999. 126(18): p. 4139-4147.

Gross, |., Bassit, B., Benezra, M. and Licht, J.D., Mammalian sprouty
proteins inhibit cell growth and differentiation by preventing ras activation.
J Biol Chem, 2001. 276(49): p. 46460-46468.

Mailleux, A.A., Tefft, D., Ndiaye, D., Itoh, N., Thiery, J.P., Warburton, D.
and Bellusci, 8., Evidence that SPROUTY2 functions as an inhibitor of
mouse embryonic lung growth and morphogenesis. Mech Dev, 2001.
102(1-2): p. 81-94.

Tefft, D., Lee, M., Smith, 8., Crowe, D.L., Bellusci, S. and Warburton, D.,
mSprouty2 inhibits FGF10-activated MAP kinase by differentially binding to
upstream target proteins. Am J Physiol Lung Cell Mol Physiol, 2002.
283(4): p. L700-706.

Nutt, S.L., Dingwell, K.S., Holt, CE. and Amaya, E., Xenopus Sprouty2
inhibits FGF-mediated gastrulation movements but does not affect
mesoderm induction and patterning. Genes Dev, 2001. 15(9): p. 1152-
1166.

127

333.

334.

335.

336.

337.

338.

339.

340.

341.

342.

343.

344.

Minowada, G., Jarvis, L.A., Chi, C.L., Neubuser, A., Sun, X., Hacohen, N.,
Krasnow, MA. and Martin, G.R., Vertebrate Sprouty genes are induced by
FGF signaling and can cause chondrodysplasia when overexpressed.
Development, 1999. 126(20): p. 4465-4475.

Kim, H.J. and Bar-Sagi, D., Modulation of signalling by Sprouty: a
developing story. Nat Rev Mol Cell Biol, 2004. 5(6): p. 441-450.

Lee, S.H., Schloss, D.J., Jarvis, L., Krasnow, MA. and Swain, J.L.,
Inhibition of angiogenesis by a mouse sprouty protein. J Biol Chem, 2001.
276(6): p. 4128-4133.

Guy, G.R., Wong, E.S., Yusoff, P., Chandramouli, 8., Lo, T.L., Lim, J. and
Fong, C.W., Sprouty: how does the branch manager work? J Cell Sci,
2003. 116(Pt 15): p. 3061-3068.

Christofori, G., Split personalities: the agonistic antagonist Sprouty. Nat
Cell Biol, 2003. 5(5): p. 377-379.

Rubin, C., Litvak, V., Medvedovsky, H., Zwang, Y., Lev, S. and Yarden, Y.,
Sprouty fine-tunes EGF signaling through interlinked positive and negative
feedback loops. Curr Biol, 2003. 13(4): p. 297-307.

Hall, A.B., Jura, N., DaSilva, J., Jang, Y.J., Gong, D. and Bar-Sagi, D.,
hSpry2 is targeted to the ubiquitin-dependent proteasome pathway by c-
Cbl. Curr Biol, 2003. 13(4): p. 308-314.

Hanafusa, H., Torii, S., Yasunaga, T. and Nishida, E., Sprouty1 and
SproutyZ provide a control mechanism for the Ras/MAPK signalling
pathway. Nat Cell Biol, 2002. 4(11): p. 850-858.

Lim, J., Wong, E.S., Ong, S.H., Yusoff, P., Low, 3.0. and Guy, G.R.,
Sprouty proteins are targeted to membrane ruffles upon growth factor
receptor tyrosine kinase activation. Identification of a novel translocation
domain. J Biol Chem, 2000. 275(42): p. 32837-32845.

Rubin, C., Zwang, Y., Vaisman, N., Ron, D. and Yarden, Y.,
Phosphorylation of carboxyl-terminal tyrosines modulates the specificity of
Sprouty-2 inhibition of different signaling pathways. J Biol Chem, 2005.
280(10): p. 9735-9744.

Haglund, K., Schmidt, M.H., Wong, E.S., Guy, GR. and Dikic, l., Sprouty2
acts at the CbI/CIN85 interface to inhibit epidermal growth factor receptor
downregulation. EMBO Rep, 2005. 6(7): p. 635-641.

Kramer, 8., Okabe, M., Hacohen, N., Krasnow, MA. and Hiromi, Y.,

Sprouty: a common antagonist of FGF and EGF signaling pathways in
Drosophila. Development, 1999. 126(11): p. 2515-2525.

128

345.

346.

347.

348.

349.

350.

351.

352.

353.

354.

355.

Robert, C., Gagne, D., Bousquet, D., Barnes, F.L. and Sirard, M.A.,
Differential display and suppressive subtractive hybridization used to
identify granulosa cell messenger rna associated with bovine oocyte
developmental competence. Biol Reprod, 2001. 64(6): p. 1812-1820.

Chambers, D. and Mason, 1., Expression of sprouty2 during early
development of the chick embryo is coincident with known sites of FGF
signalling. Mech Dev, 2000. 91(1-2): p. 361-364.

Zhang, 8., Lin, Y., ltaranta, P., Yagi, A. and Vainio, 8., Expression of
Sprouty genes 1, 2 and 4 during mouse organogenesis. Mech Dev, 2001.
109(2): p. 367-370.

Gross, |., Morrison, D.J., Hyink, D.P., Georgas, K., English, M.A.,
Mericskay, M., Hosono, S., Sassoon, D., Wilson, P.D., Little, M. and Licht,
J.D., The receptor tyrosine kinase regulator Sprouty1 is a target of the
tumor suppressor WT1 and important for kidney development. J Biol
Chem, 2003. 278(42): p. 41420-41430.

Tefft, J.D., Lee, M., Smith, S., Leinwand, M., Zhao, J., Bringas, P., Jr.,
Crowe, D.L. and Warburton, D., Conserved function of mSpry-2, a murine
homolog of Drosophila sprouty, which negatively modulates respiratory
organogenesis. Curr Biol, 1999. 9(4): p. 219-222.

Liu, H., Chen, J.Z., Gu, S.H., Dai, J.L., Zhao, E.P., Huang, L., Xu, W.X.,
Xie, Y. and Mao, Y.M., Assignment of human sprouty 4 gene to
chromosome segment 5q32 approximately 33 and analysis of its pattern of
expression. J Genet, 2003. 82(1-2): p. 23-26.

Ozaki, K., Kadomoto, R., Asato, K., Tanimura, S., Itoh, N. and Kohno, M.,
ERK pathway positively regulates the expression of Sprouty genes.
Biochem Biophys Res Commun, 2001. 285(5): p. 1084-1088.

Abe, M. and Naski, M.C., Regulation of sprouty expression by PLCgamma
and calcium-dependent signals. Biochem Biophys Res Commun, 2004.
323(3): p. 1040-1047.

Ding, W., Bellusci, S., Shi, W. and Warburton, D., Functional analysis of
the human Sprouty2 gene promoter. Gene, 2003. 322: p. 175-185.

Lim, J., Yusoff, P., Wong, E.S., Chandramouli, S., Lao, D.H., Fong, CW.
and Guy, G.R., The cysteine-rich sprouty translocation domain targets
mitogen-activated protein kinase inhibitory proteins to phosphatidylinositol
4,5-bisphosphate in plasma membranes. Mol Cell Biol, 2002. 22(22): p.
7953-7966.

Mason, J.M., Morrison, D.J., Bassit, B., Dimri, M., Band, H., Licht, JD. and
Gross, l., Tyrosine phosphorylation of Sprouty proteins regulates their

129

356.

357.

358.

359.

360.

361.

362.

363.

364.

365.

ability to inhibit growth factor signaling: a dual feedback loop. Mol Biol Cell,
2004. 15(5): p. 2176-2188.

lmpagnatiello, M.A., Weitzer, S., Gannon, G., Compagni, A., Cotten, M.
and Christofori, G., Mammalian sprouty-1 and -2 are membrane-anchored
phosphoprotein inhibitors of growth factor signaling in endothelial cells. J
Cell Biol, 2001. 152(5): p. 1087-1098.

Cabrita, MA. and Christofori, G., Sprouty proteins: antagonists of
endothelial cell signaling and more. Thromb Haemost, 2003. 90(4): p. 586-
590.

Sasaki, A., Taketomi, T., Wakioka, T., Kato, R. and Yoshimura, A.,
Identification of a dominant negative mutant of Sprouty that potentiates
fibroblast growth factor- but not epidermal growth factor-induced ERK
activation. J Biol Chem, 2001. 276(39): p. 36804-36808.

Egan, J.E., Hall, A.B., Yatsula, BA. and Bar-Sagi, D., The bimodal
regulation of epidermal growth factor signaling by human Sprouty proteins.
Proc Natl Acad Sci U S A, 2002. 99(9): p. 6041-6046.

Wong, E.S., Lim, J., Low, B.C., Chen, Q. and Guy, G.R., Evidence for
direct interaction between Sprouty and Cbl. J Biol Chem, 2001. 276(8): p.
5866-5875.

Thien, CB. and Langdon, W.Y., Cbl: many adaptations to regulate protein
tyrosine kinases. Nat Rev Mol Cell Biol, 2001. 2(4): p. 294-307.

Fong, C.W., Leong, H.F., Wong, E.S., Lim, J., Yusoff, P. and Guy, G.R.,
Tyrosine phosphorylation of Sprouty2 enhances its interaction with c-Cbl
and is crucial for its function. J Biol Chem, 2003. 278(35): p. 33456-33464.

Wong, E.S., Fong, C.W., Lim, J., Yusoff, P., Low, B.C., Langdon, W.Y. and
Guy, G.R., Sprouty2 attenuates epidermal growth factor receptor
ubiquity/ation and endocytosis, and consequently enhances Ras/ERK
signalling. Embo J, 2002. 21(18): p. 4796-4808.

Li, X., Brunton, V.G., Burgar, H.R., Wheldon, L.M. and Heath, J.K., FRSZ-
dependent SRC activation is required for fibroblast growth factor receptor-
induced phosphorylation of Sprouty and suppression of ERK activity. J Cell
Sci, 2004. 117(Pt 25): p. 6007-6017. '

Hanafusa, H., Torii, S., Yasunaga, T., Matsumoto, K. and Nishida, E.,
Shp2, an SH2-containing protein-tyrosine phosphatase, positively
regulates receptor tyrosine kinase signaling by dephosphorylating and
inactivating the inhibitor Sprouty. J Biol Chem, 2004. 279(22): p. 22992-
22995.

130

366.

367.

368.

369.

370.

371.

372.

373.

374.

375.

Xiao, 8., Rose, D.W., Sasaoka, T., Maegawa, H., Burke, T.R., Jr., Roller,
P.P., Shoelson, SE. and Olefsky, J.M., Syp (SH-PTP2) is a positive
mediator of growth factor-stimulated mitogenic signal transduction. J Biol
Chem, 1994. 269(33): p. 21244-21248.

Neel, B.G., Gu, H. and Pao, L., The 'Shp’ing news: SH2 domain-containing
tyrosine phosphatases in cell signaling. Trends Biochem Sci, 2003. 28(6):
p. 284-293.

Lee, 00., Putnam, A.J., Miranti, C.K., Gustafson, M., Wang, L.M., Vande
Woude, GP. and Gao, C.F., Overexpression of sprouty 2 inhibits HGF/SF-
mediated cell growth, invasion, migration, and cytokinesis. Oncogene,
2004. 23(30): p. 5193-5202.

Yusoff, P., Lao, D.H., Ong, S.H., Wong, E.S., Lim, J., Lo, T.L., Leong, H.F.,
Fong, CW. and Guy, G.R., Sprouty2 inhibits the Ras/MAP kinase pathway
by inhibiting the activation of Raf. J Biol Chem, 2002. 277(5): p. 3195-
3201.

Taketomi, T., Yoshiga, D., Taniguchi, K., Kobayashi, T., Nonami, A., Kato,
R., Sasaki, M., Sasaki, A., lshibashi, H., Moriyama, M., Nakamura, K.l.,
Nishimura, J. and Yoshimura, A., Loss of mammalian Sprouty2 leads to
enteric neuronal hyperplasia and esophageal achalasia. Nat Neurosci,
2005.

Sasaki, A., Taketomi, T., Kato, R., Saeki, K., Nonami, A., Sasaki, M.,
Kuriyama, M., Saito, N., Shibuya, M. and Yoshimura, A., Mammalian
Sprouty4 suppresses Ras-independent ERK activation by binding to Raf1.
Nat Cell Biol, 2003. 5(5): p. 427-432.

Tsavachidou, D., Coleman, M.L., Athanasiadis, G., Li, S., Licht, J.D.,
Olson, M.F. and Weber, B.L., SPRY2 is an inhibitor of the ras/extracellular
signal-regulated kinase pathway in melanocytes and melanoma cells with
wild-type BRAF but not with the V599E mutant. Cancer Res, 2004. 64(16):
p. 5556-5559.

Yigzaw, Y., Cartin, L., Pierre, 8., Scholich, K. and Patel, T.B., The C
terminus of sprouty is important for modulation of cellular migration and
proliferation. J Biol Chem, 2001. 276(25): p. 22742-22747.

Yarden, Y. and Sliwkowski, M.X., Untangling the ErbB signalling network.
Nat Rev Mol Cell Biol, 2001. 2(2): p. 127-137.

Vaudry, D., Stork, P.J., Lazarovici, P. and Eiden, L.E., Signaling pathways

for PC12 cell differentiation: making the right connections. Science, 2002.
296(5573): p. 1648-1649.

131

376.

377.

378.

379.

380.

381.

382.

383.

384.

385.

386.

Stang, E., Blystad, F.D., Kazazic, M., Bertelsen, V., Brodahl, T., Raiborg,
C., Stenmark, H. and Madshus, |.H., Obi-dependent ubiquitination is
required for progression of E GF receptors into clathrin-coated pits. Mol Biol
Cell, 2004. 15(8): p. 3591-3604.

Leeksma, O.C., Van Achterberg, T.A., Tsumura, Y., Toshima, J., Eldering,
E., Kroes, W.G., Mellink, C., Spaargaren, M., Mizuno, K., Pannekoek, H.
and de Vries, C.J., Human sprouty 4, a new ras antagonist on 5q31,
interacts with the dual specificity kinase TESK1. Eur J Biochem, 2002.
269(10): p. 2546-2556.

Bamburg, J.R., Proteins of the ADF/cofi/in family: essential regulators of
actin dynamics. Annu Rev Cell Dev Biol, 1999. 15: p. 185-230.

Toshima, J., Toshima, J.Y., Amano, T., Yang, N., Narumiya, S. and
Mizuno, K., Cofilin phosphorylation by protein kinase testicular protein
kinase 1 and its role in integrin-mediated actin reorganization and focal
adhesion formation. Mol Biol Cell, 2001. 12(4): p. 1131-1145.

Tsumura, Y., Toshima, J., Leeksma, O.C., Ohashi, K. and Mizuno, K.,
Sprouty-4 negatively regulates cell spreading by inhibiting the kinase
activity of testicular protein kinase. Biochem J, 2005. 387(Pt 3): p. 627-
637.

Yigzaw, Y., Poppleton, H.M., Sreejayan, N., Hassid, A. and Patel, T.B.,
Protein-tyrosine phosphatase-1B (PTP1B) mediates the anti-migratory
actions of Sprouty. J Biol Chem, 2003. 278(1): p. 284-288.

Poppleton, H.M., Edwin, F., Jaggar, L., Ray, R., Johnson, LR. and Patel,
T.B., Sprouty regulates cell migration by inhibiting the activation of Rac1
GTPase. Biochem Biophys Res Commun, 2004. 323(1): p. 98-103.

Basson, M.A., Akbulut, S., Watson-Johnson, J., Simon, R., Carroll, T.J.,
Shakya, R., Gross, 1., Martin, G.R., Lufkin, T., McMahon, A.P., Wilson,
P.D., Costantini, F.D., Mason, l.J. and Licht, J.D., Sprouty1 is a critical
regulator of GDNF/RET-mediated kidney induction. Dev Cell, 2005. 8(2): p.
229-239.

Shim, K., Minowada, G., Coling, DE. and Martin, G.R., Sprouty2, a mouse
deafness gene, regulates cell fate decisions in the auditory sensory
epithelium by antagonizing FGF signaling. Dev Cell, 2005. 8(4): p. 553-
564.

Saxen, L. and Sariola, H., Early organogenesis of the kidney. Pediatr
Nephrol, 1987. 1(3): p. 385-392.

Moore, M.W., Klein, R.D., Farinas, |., Sauer, H., Arrnanini, M., Phillips, H.,
Reichardt, L.F., Ryan, A.M., Carver-Moore, K. and Rosenthal, A., Renal

132

387.

388.

389.

390.

391.

392.

393.

394.

395.

396.

and neuronal abnormalities in mice lacking GDNF. Nature, 1996.
382(6586): p. 76-79.

Vainio, S. and Lin, Y., Coordinating early kidney development: lessons
from gene targeting. Nat Rev Genet, 2002. 3(7): p. 533-543.

Takahashi, M., The GDNF/RET signaling pathway and human diseases.
Cytokine Growth Factor Rev, 2001. 12(4): p. 361-373.

Majumdar, A., Vainio, S., Kispert, A., McMahon, J. and McMahon, A.P.,
Wnt11 and Ret/Gdnf pathways cooperate in regulating ureteric branching
during metanephric kidney development. Development, 2003. 130(14): p.
3175-3185.

Chi, L., Zhang, 8., Lin, Y., Prunskaite-Hyyrylainen, R., Vuolteenaho, R.,
ltaranta, P. and Vainio, S., Sprouty proteins regulate ureteric branching by
coordinating reciprocal epithelial Wnt11, mesenchymal Gdnf and stromal
Fgf7 signalling during kidney development. Development, 2004. 131(14):
p. 3345-3356.

Pirvola, U., Ylikoski, J., Trokovic, R., Hebert, J.M., McConnell, SK. and
Partanen, J., FGFR1 is required for the development of the auditory
sensory epithelium. Neuron, 2002. 35(4): p. 671-680.

Colvin, J.S., Bohne, B.A., Harding, G.W., McEwen, DO. and Omitz, D.M.,
Skeletal overgrowth and deafness in mice lacking fibroblast growth factor
receptor 3. Nat Genet, 1996. 12(4): p. 390-397.

Lo, T.L., Yusoff, P., Fong, C.W., Guo, K., McCaw, B.J., Phillips, W.A.,
Yang, H., Wong, E.S., Leong, H.F., Zeng, Q., Putti, TC. and Guy, G.R.,
The ras/mitogen-activated protein kinase pathway inhibitor and likely tumor
suppressor proteins, sprouty 1 and sprouty 2 are deregulated in breast
cancer. Cancer Res, 2004. 64(17): p. 6127-6136.

Kwabi-Addo, B., Wang, J., Erdem, H., Vaid, A., Castro, R, Ayala, G. and
Ittmann, M., The expression of Sprouty1, an inhibitor of fibroblast growth
factor signal transduction, is decreased in human prostate cancer. Cancer
Res, 2004. 64(14): p. 4728-4735.

McKie, A.B., Douglas, D.A., Olijslagers, 8., Graham, J., Omar, M.M., Heer,
R., Gnanapragasam, V.J., Robson, ON. and Leung, H.Y., Epigenetic
inactivation of the human sprouty2 (hSPRY2) homologue in prostate
cancer. Oncogene, 2005. 24(13): p. 2166-2174.

Bloethner, S., Chen, 8., Hemminki, K., Muller-Berghaus, J., Ugurel, S.,
Schadendorf, D. and Kumar, R., Effect of common B-RAF and N-RAS
mutations on global gene expression in melanoma cell lines.
Carcinogenesis, 2005. 26(7): p. 1224-1232.

133

Chapter II. Sprouty 2 is necessary for tumor formation by

HRas oncogene-transformed human fibroblasts

Running title: Spry2 is necessary for HRas-transformation

Piro Lito, Bryan D. Mets, Sandra O’Reilly, Veronica M. Maher and J. Justin

McCormick'

Carcinogenesis Laboratory, Department of Microbiology & Molecular Genetics
and Department of Biochemistry & Molecular Biology, Michigan State University,

East Lansing, Michigan 48824-1302, USA.

*Correspondence: J. Justin McCormick, Carcinogenesis Laboratory, Food Safety
and Toxicology Bldg., Michigan State University, East Lansing, MI 48824-1302,
USA; Ph: (517) 353-7785; Fax: (517) 353-9004.

E-mail address: mccormi1@msu.edu

Keywords: Sprouty; HRas oncogene; malignant transformation; epidermal growth

factor receptor

134

Abstract

Sprouty 2 (Spry2) plays a regulatory role in the signaling pathways induced by a number
of growth factors. One aspect of the function of Spry2 is to prevent the c-Cbl-induced
degradation of epidermal growth factor receptor (EGFR). We report that human
fibroblasts malignantly transformed by HRas"12 oncogene, exhibited an increase in the
expression of Spry2, compared to the parental cells. To determine whether Spry2 plays
a role in HRas-transformation, we down-regulated the expression of Spry2 using Spry2-
specific shRNA. HRas-transformed cells with down-regulated levels of Spry2 failed to
form tumors when injected into athymic mice, indicating that Spry2 in necessary for
tumor formation by HRas-transformed cells. In cells expressing oncogenic HRas, Spry2
sustained not only the level of EGFR, but also the activation of ERK. What is more,
HRas interacted with Spry2 in HRas-transformed cells, and HRas interacted with c-Cbl
and CIN85 in a Spry2-dependent fashion, suggesting that HRas regulates the turnover
of EGFR through Spry2. We also found that expression of Spry2 in immortalized human
fibroblasts, did not affect EGFR levels, while it inhibited HRas and ERK activation. The
effect on ERK was diminished when Spry2 was expressed at a higher level. These data
show that Spry2 has distinct functions in pre-malignant and in malignant fibroblasts
transformed by HRas. While in the former Spry2 can inhibit EGF signaling, in the latter,
the inhibitory function of Spry2 is bypassed and the ability of Spry2 to sustain EGFR

takes center stage.

135

Introduction

Carcinogenesis is a multistep process by which cells acquire neoplastic characteristics
through a series of genetic and/or epigenetic changes. To study this process,
McCormick and colleagues developed a model system which mimics the pattern by
which normal human fibroblasts become malignant [1]. In these experiments, normal
foreskin-derived human skin fibroblasts were transfected with a v-Myc oncogene, giving
rise to a clonal population of cells, which spontaneously acquired an infinite life span in
culture [2]. This cell strain, which has a normal diploid karyotype, was designated MSU-
1.0. As MSU-1.0 cells were being propagated in culture, one cell underwent two
chromosomal translocations, giving rise to a cell strain that is chromosomally stable,
near-diploid, and partially growth factor independent [2]. This cell strain, designated,
MSU-1.1, has been malignantly transformed by the overexpression of Ras oncogenes
[2-5] or by exposure to a carcinogen, followed by selection of focus-forming cells [6, 7].

V12

When MSU-1.1 cells expressing high levels of HRas oncoprotein are injected
subcutaneously into athymic mice, they form fibrosarcomas within three weeks. A
malignant cell strain derived from such tumors, designated PH3MT, is completely growth

factor independent and exhibits anchorage independent growth [4].

Sprouty was first identified in Drosophila as an inhibitor of fibroblast growth factor (FGF)-
induced tracheal branching [8] and epidermal growth factor (EGF)—induced eye
development [9]. Mammalian species express four isoforms of Sprouty (Spry1-4) [8, 10,
11], which act as inhibitors of growth factor-induced cellular differentiation, migration,

and proliferation [12-15].

In addition to its inhibitory function, Spry2 also sustains the EGFR signaling [16-21]. This

136

function is mainly the result of the interaction of Spry2 with c-Cbl, an E3 ubiquitin ligase
that catalyzes the ubiquitination of EGFR, targeting this receptor for lysosomal
degradation [22]. By binding to c-Cbl, Spry2 prevents the interaction between c-Cbl and
EGFR, and this interference blocks the degradation of the receptor. This in turn leads to

sustained EGFR-induced ERK activity [23-26].

The expression of Spry2 gene is altered in several types of cancer. Spry2 is down -
regulated in breast cancer [27], and expression of Spry2 in breast cancer cells (MCF7)
reduces the ability of these cells to form tumors in athymic mice [27]. Spry2 is also down-
regulated in prostate cancer, which is attributed to epigenetic inactivation, through hyper-
methylation of the Spry2 promoter [28]. Spry2 expression is also elevated in some
cancer subtypes, including melanomas that express activated Ras signaling pathways
[29, 30], suggesting that Spry2 contributes to the malignant phenotype in cells

expressing oncogenic Ras.

The present study was designed to investigate the role of Spry2 in tumor formation in
malignant cells with activated Ras signaling. We found that HRas-transformed human
fibroblasts (PH3MT) expressed a higher level of Spry2 protein than that found in their
parental cells (MSU-1.1). When we stably down-regulated the expression of Spry2 in
PH3MT cells, we observed a complete loss of tumor-forming ability by these cells. In
PH3MT cells Spry2 sustained the level of EGFR and ERK activation. Interestingly,
independent expression of Spry2 in MSU-1.1 cells resulted in the inhibition of EGF

signaling and was insufficient to malignantly transform these cells.

137

Results

Determination of the Expression of Spry2 in HRas-transformed Cells.

To detetermine the effect of HRas-transformation on the expression of Spry2 we
examined the cells of the MSU lineage by Northern and Western blotting (Fig. 1A
and B). Although compared to MSU-1.0 cells, MSU-1.1 cells exhibit only a
modest increase in Spry2 expression, the cells malignantly transformed by
HRasWZ oncogene (PH3MT) exhibit a significant increase in Spry2 expression.
An independent HRas-transformed cell strain (PH2MT) was found to have the
same high expression of Spry2 (Fig. 1C). These data suggest that oncogenic
HRas is responsible for the high level of Spry2 protein found in PH3MT cells. To
determine if the same was true for oncogenic NRas, we examined the levels of
expression of Spry2 protein in MSU-1.1 cell strains malignantly transformed by
the NRasV’Z oncogene, i.e., N-Ras-2T and N-Ras-3T [5]. NRas-transformed cells
expressed Spry2 at a level similar to that present in the HRas-transformed cells,

i.e., PH2MT and PH3MT (Fig. 10).

We also examined the level of expression of Spry2 in a four patient-derived
fibrosarcoma and seven patient-derived pancreatic carcinoma cell lines. As
shown in Fig. 10, all four fibrosarcoma-derived cell lines expressed high levels of
Spry2, compared to normal foreskin-derived fibroblasts. Of seven pancreatic

carcinoma-derived cell lines analyzed for expression of Spry2, three cell lines

138

Figure 1. Expression profile of Spry2 in Ras-transformed cells and in patient derived
cancer cells. Northern (A) and Western (B) blots showing the expression of Spry2 in
immortalized human fibroblasts strains MSU-1.0 and MSU-1.1, and in MSU-1.1 cells
malignantly transformed by the HRas oncogene (PH3MT). (C) The expression of Spry2
protein in MSU-1.1 cells malignantly transformed by HRas and NRas oncogenes. Cell
strains that were derived by the malignant transformation of MSU-1.1 cells with HRas
(PH2MT and PH3MT) or NRas (NRasZT and NRas3T) oncogenes, were analyzed by
Western blotting with the indicated antibodies. (D) The expression of Spry2 protein in
patient-derived fibrosarcoma cell lines and in normal, foreskin-derived, fibroblast cell
lines (SL68 and SL89). (E) The expression of Spry2 protein in pancreatic carcinoma cell

lines and in an infinite life span, pancreatic cell line (ps-1).

139

Spry2

 

._._>_mIn_
w. 7322
o. rims.

511
“mm

 

 

u —-—-. KUBO

 

 

 

._._>_mIn_
F. 7392
o. Tam—2

 

 

flu Spry2

u .d GAPDH

 

 

 

 

 

_.O<n_n_0
won—m6.
NmONQSE

'a 4 Spry2

 

 

 

 

 

 

Two

 

Pan-Ras

 

--

Hm-mwm-z
._.N-mmm-2

 

 

 

E:

._._>_mIn_
._._2NT_n_

I...

 

 

 

 

 

 

 

c. F. Tam:

 

 

D.

Spry2

 

_OZ 1
._.n_i_>
owe—FT. T
O<Im
owAm

w©._m

 

69:34.3

 

 

 

" F.” Ku80

Figure 1

140

expressed high levels of Spry2 protein compared to a normal infinite life span

pancreatic cell line (Fig. 1E).

Effect of Spry2 on Tumor Formation by HRas-transformed Cells.

In order to study its role we down-regulated Spry2 in PH3MT cells, by using short
hairpin RNA (shRNA). The shRNA molecules were designed to target position
399 or position 492 of the Spry2 coding region. A scrambled shRNA molecule
that does not target Spry2 was included as a control (Fig. 2A). Cell stains
expressing a vector without a shRNA molecule (PH3MT-VG), or a vector
encoding the scrambled shRNA molecule (PH3MT-SC), were used as controls.
We identified two cell strains expressing the Spry2-specific shRNA molecule that
targets position 399 (PH3MT-2A3 and PH3MT-289), as well as a cell strain
expressing the Spry2-specific shRNA molecule that targets position 492
(PH3MT-5A3). The cell strains expressing shRNA specific for either position of
the Spry2 coding region were found to express lower levels of the Spry2 protein,

compared to the level in the control cell strains (Fig. 28).

To determine the role of Spry2 in HRas-transformation we first examined the
effect of Spry2 depletion on the anchorage independent growth of PH3MT cells.
Depletion of Spry2 resulted in fewer and smaller colonies in agarose compared

to control cells (Fig.20).

141

Figure 2. Effect of Spry2 on the anchorage independent growth of HRas-transformed
fibroblasts. (A) A schematic diagram of the positions targeted by the Spry2-specific
shRNA constructs. Spry2-shRNA-2 targets position 399, whereas Spry2-shRNA-5
targets position 492 of the Spry2 coding region. A nonspecific shRNA molecule,
designated scrambled-shRNA, was also constructed. These constructs were stably
expressed in PH3MT cells as described in the Material and Methods section. (B) PH3MT
cell strains stably expressing the indicated constructs were analyzed by Western blotting
to determine the expression of Spry2. The PH3MT-2A3 and PH3MT-289 cell strains
were infected with Spry2-shRNA-2, whereas the PH3MT-5A3 cell strain was infected
with Spry2-shRNA-5. (C) The indicated cell lines were grown in agarose, in the presence
of 10% serum (+ Serum) or 2.5% serum (- Serum) in the culture medium as described in
the Material and Methods section. This graph represents the number of colonies with a
diameter greater than 120 pm in each of the analyzed cell strains. A representative of at
least two experiments with each of the two control clones and each of the three clones
with down-regulated Spry2 is shown. (D) Whole cell lysates from the indicated cell lines
were pulled down with RafRBD conjugated beads as described in Materials and
Methods. The total amount of Ras in the whole cell lysate (WCL) was determined using

a Pan-Ras-specific antibody.

142

A.

Spry2-shRNA-5 4:"
E— Scrambled-shRNA

 

 

 

 

 

 

_l ‘ ‘ Spry2 mRNA
4:1— Spry2-shRNA-2
B. PH3MT
+ - - - - Vector
- - - - + Scrambled shRNA
- + + + ‘ Spry2-sh RNA
1 Spry2
. .. 1.. .- Ku80

 

 

 

VC 2A3 5A3 239 SC

Figure 2

143

Number of colonies

200

 

 

 

150 . ’fL-‘ffij?’
‘x i“ \

 

b ,
100 ' '“"“”

l" . .I

F . t

1- * :

 

 

 

' - serum

T335: + serum

 

S

 

 

F

 

 

 

 

 

“than

PD: Raf-RBD

 

 

 

 

 

WCL

Figure 2 (Cont’)

£331ng r m 1

PH3MT-2A3 PH3MT-5A3

HRas

43,; fi_._,_ Pan-R33

144

PH3MT-239

 

These same cell strains were tested for their ability to form tumors in athymic
mice (Table l). The control cell strains formed 0.5 cm3 tumors in 21 days. In
contrast, the three cell strains with down-regulated expression of Spry2 failed to
form tumors of any size, indicating that Spry2 is necessary for the malignant
phenotype of, HRas-transformed, PH3MT cells. Given the significant effect that
the down-regulation of Spry2 had on HRasV12 transformed cells, we investigated
whether this down-regulation reduced the level of activated HRas by using a
Ras-activation assay. Down-regulation of Spry2 had no effect on the levels of
active HRas (Fig. 2D), suggesting that Spry2 acts downstream of HRas

oncogene to regulate HRas-induced malignant transformation.

Effect of HRas-transformation on the Level of EGFR protein.

Several studies have demonstrated that Ras regulates the signaling activity and
endocytosis of EGFR through its effector proteins [31-35]. We found that

V12 was associated

transformation of immortalized human fibroblasts with HRas
with an increase in the levels of EGFR. As shown in Fig. 3A, stimulation of
immortalized human fibroblasts (MSU-1.1) with EGF resulted in a decrease in the
level of EGFR protein. Even though a similar effect was observed in MSU-1.1
cells malignantly transformed by HRas oncogene (PH3MT cells), these cells

exhibited increased and sustained levels of EGFR compared to their parental

cells (Fig. 3A).

145

Table l The tumorigenicity of the cell strains with down-regulated Spry2

 

Days for tumor to

 

Cell Spry2- Tumor reach 0.5 cm3
strain HRasV12 shRNA incidencea volume
MSU-1.1 - - 0ch -
PH3MT ++ - 6/6 21
PH3MT-VG ++ - ‘12/1 2 21
PH3MT-SC ++ - 12/12 21
PH3MT-2A3 ++ + 0/12 -
PH3MT-5A3 ++ + 0/1 2 -
PH3MT-289 ++ + 0/12 -

 

1Ratio of tumors formed to the number of sites injected
subcutaneously. If no tumors arose 6 months after the injection the
mice were sacrificed.

bTen million MSU-1.1 cells were injected in each site. The rest of the
cell strains were injected at one million cells per site

146

Figure 3. Effect of HRas-transformation on the level of EGFR. (A) Immortalized human
fibroblasts (MSU-1.1) and their HRasm-transformed derivatives (PH3MT) were serum
deprived for 12 h. and then stimulated with EGF (100 ng/mL) for the indicated time
points (shown in minutes). (B) MSU-1.1 and PH3MT cells were grown in media with
0.1% serum in the presence (open triangles and squares, respectively) or absence
(closed triangles and squares, respectively) of the selective EGFR inhibitor AG1478 (6
uM). The effect of AG1478 in the growth of PH3MT cells was greater than the effect of
the same inhibitor in MSU-1.1 cells (p<0.001). One of three independent experimental

repeats (N=4) is shown.

147

MSU-1.1 PH3MT

0 10 3O 60 0 10 30 60 EGF
[ , ........... ----- -- -----|Ku80

 

 

 

 

 

30,000

25,000 -

20,000 ~

15,000

Cell number

10,000 —

 

 

 

5,000

 

Figure 3

148

The ability of HRas oncoprotein to induce growth factor independence is an
important property in cancer formation. To determine if the activity of EGFR is
necessary for the growth factor independence of HRas-transformed fibroblasts,
we measured the ability of PH3MT cells to grow in the presence of AG1478, a
selective inhibitor of EGFR tyrosine kinase activity [36]. The inhibition of EGFR
activity by AG1478 resulted in a decrease in the ability of HRas-transformed cells
to grow in medium with reduced serum. This decrease was significantly higher
than the corresponding change observed in MSU-1.1 cells (Fig. 3B). These data
suggest that EGFR activity is required for the ability of PH3MT cells to grow in

the absence of exogenous growth factors.

Effect of Depletion of Spry2 Protein on the Level of EGFR.

To determine if Spry2 sustains EGFR levels in HRas-transformed human
fibroblasts, we compared the cell strains with down-regulated Spry2 with their
control cell strains for the level of EGFR. Consistent with previous studies [23-26,
37, 38], our results showed that, even after 10 minutes of EGF-stimulation, the
level of EGFR was decreased in all three cell strains with down-regulated Spry2
(data not shown). In contrast, the control cells did not show a decrease in EGFR
under the same conditions (data not shown). We also examined the time course
of EGFR decrease in control cells and in cells with down-regulated Spry2 (Fig.
4A). The cells with down-regulated Spry2 exhibited a more pronounced decrease
in the level of EGFR compared to control cells, indicating that Spry2 expression

is necessary for the ability of HRas oncoprotein to sustain the level of EGFR.

149

Figure 4. Effect of Spry2 down-regulation on the level of EGFR in HRas-transformed

cells. (A) The indicated cell strains were analyzed as in Fig. 3A. (B) The indicated cell
strains were grown in media with 0.1% serum. One of two experimental repeats (N=4) is

shown.

150

wed
cell

ll is

PH3MT-SC PH3MT-2A3

010 30 60 010 30 60 EGF
E " ‘ ~ WEGFR

I" " -~-~---—--—--——-——--—-—1Ku80

.6 - -""’ p-ERK

 

 

 

 

 

 

 

 

 

Mmumwmuflmg ERK

 

 

4:1— P H3M T-2A 3 /. [F

/
/
f
[I

50,000 ~

Cell number

30,000 - I"? \

 

 

%
10,000 L21 .

 

Figure 4

151

To determine whether the expression of Spry2 in HRas-transformed cells was
associated with an increase in activation of the MAPK cascade, we examined the
EGF-induced activation of ERK. As shown in Fig. 4A, the cell strain with down-
regulated Spry2 level had decreased levels of activated ERK compared to the

level found in the control cell strain.

We also examined whether depletion of Spry2 had an effect on the growth factor
independence of PH3MT cells. We found that HRas-transformed cells with
decreased levels of Spry2 protein exhibited a decrease in their ability to grow in

media with reduced serum compared to control HRas-transformed cells (Fig. 4B).

Interaction of Spry2 with HRas.

To determine how Spry2 mediated the effect of HRas on EGFR levels we
examined whether Spry2 forms a complex with HRas in HRas-transformed cells
(PH3MT) by using co-immunoprecipitation experiments. We found that
endogenous Spry2 co-immunoprecipitated with HRas, suggesting that Spry2
interacts with HRas in vivo (Fig. 4A). The interaction between Spry2 and HRas

was enhanced upon stimulation of cells with EGF (data not shown).

152

Figure 5. Interaction of HRas with Spry2 and Spry2 binding-partners c-Cbl and CIN85.
(A) Whole cell lysates from HRas-transformed cells (PH3MT) were immunoprecipitated
with an antibody specific to HRas or a nonspecific lgG and immunoblotted with the
indicated antibodies. (B, C) Whole cell lysates form control cells (PH3MT-SC), as well as
cells with down-regulated Spry2 (PH3MT-2A3) were immunoprecipitated with anti-HRas

and immunobloted with the indicated antibodies.

153

A. B.
PH3MT

+ _ HRas
- + IQG

 

~ Spry2
m HRas
lP:HRas/lgG

 

 

 

 

 

 

Spry2

 

 

HRas

 

 

 

WCL

PH3MT
SC 2A3

 

 

CIN85

m fin. HRas

 

 

 

 

 

 

., ..._,, .... CIN85
HRas

 

 

 

 

 

WCL

Figure 5

154

PH3MT

 

SC 2A3

 

 

 

 

 

 

lP:HRas

 

 

 

 

 

 

. “Vi,

 

 

WCL

c-Cbl
HRas

c-Cbl

Spry2
HRas

Interaction of HRas with c-Cbl and CIN85 in a Spry2-dependent

Fashion.

Because in PH3MT cells Spry2 interacts with both HRas and c-Cbl (data not
shown), we hypothesized that Spry2 mediates an association between HRas and
c-Cbl. By means of co-immunoprecipitations we found not only that endogenous
c-Cbl was bound to HRas, but also, that this interaction was abolished in HRas-

transforrned cells in which Spry2 has been down-regulated (Fig. 48).

Recent evidence indicates that in addition to c-Cbl, Spry2 interacts with CIN85
[39]. In particular, Spry2, c-Cbl and CIN85 form a tertiary complex, resulting in
the inhibition of EGFR-degradation by the lysosome. With this in mind we sought
to determine whether HRas also associates with CIN85 in HRas-transformed
cells. We found that endogenous CIN85 co-immunoprecipitated with HRas in
cells expressing Spry2, but not in cells with down-regulated Spry2 (Fig. 4C).
These findings suggest that HRas interacts with c-Cbl and CIN85 in a Spry2-
dependent manner and that HRas regulates the turnover of EGFR at the level of

the Spry2/c-Cbl/CIN85 complex.

Effect of Spry2 Expression in Immortalized Human Fibroblasts.

To determine the role of Spry2 in EGF signaling and cancer formation in the absence of
activated HRas signaling, we stably expressed Spry2 in MSU-1.1 cells (Fig. 6A). MSU-
1.1 cells expressing a low level of Spry2-V5 (MSU-1.1841) exhibited a decrease in EGF-

induced ERK activation, when compared to the control cells (MSU-1.1VC) (Fig. 5B).

155

Figure 6. Effect of Spry2 expression in immortalized human fibroblasts. (A) MSU-1.1
cells were stably transfected with an empty vector (MSU-1.1-VC), or a vector encoding
V5-tagged Spry2 (MSU-1.1841 and 862). Whole cell lysates from the indicated cell
strains were analyzed by Western blotting to determine the expression of Spry2. (BC)
The indicated cells lines were analyzed as in Fig. 3A. (D) Whole cell lysates from the
indicated cell lines were analyzed as in Fig. 2D. (E) The indicated cell strains were

grown in media with 0.1% serum. One of two experimental repeats (N=4) is shown.

156

+ - - Vector
- + + Spry2-V5
““1 1 ‘1 Spry2

l ' 1 Ku80
vc 841 862

 

 

 

 

 

B. MSU-1.1-VC MSU-1.1841

O 10 30 60 010 30 60 EGF

‘ ’ ERK
"W .- Lu
.. = '- an! L14.- ...:.a- an...» --- u- ..—-a-

 

 

 

 

 

 

 

C. MSU-1.1-VC MSU-1.1862
010 30 60 010 30 60 EGF

 

 

 

 

 

 

 

 

 

 

 

 

 

 

1“” "" "" we“ -- EGFR

MW“‘““’*‘"*" ‘7' Ku80

" .. ......... ..' m... ERK
Figure 6

157

MSU-1.1
VC S41 S62

 

 

 

W HRas
PDzRaf-RBD

 

 

--- m HRas

 

 

 

 

40,000 1 .0. MSU-1.1-VC
—o- MSU-1.1-841
—-— MSU-1.1-862

 

I
A" I
,l
./ I
I h [I] [I]
. ’1',
I

Cell number

20,000 - y/i/\

/' ./ \~
A1 / fl
.q/
,411/
10,000 "4:1“;- 1 F
0

1 2 3 4

 

 

 

Figure 6 (Cont’)

158

Interestingly, this inhibitory function of Spry2 was less pronounced in MSU-1.1 cells
expressing higher levels of Spry2-V5 (MSU-1.1862), which exhibited an ERK activation
profile similar to that of control cells (Fig. SC). In MSU-1.1862 cells, Spry2 did not have
an effect on the level of EGFR (Fig. 5C). The level of Spry2-V5 expression in MSU-
1.1862 cells was similar to the level of endogenous Spry2 expression in PH3MT cells
(data not shown). Exogenous Spry2 inhibited HRas activation in MSU-1.1 cells, an effect
that was diminished when at higher levels of Spry2 expression (Fig. 5D). Consistent with
these findings, low levels of exogenous Spry2 expression resulted in a decrease in the
ability of MSU-1.1 cells to grow in the absence of growth factors (Fig. 5E, MSU-1.1841).
This inhibitory effect was not observed in cells expressing higher levels of Spry2 (Fig. 5E,
MSU-1.1862). Consistent with these results, control cells and cells expressing low or
high levels of exogenous Spry2 failed to form tumors upon injection in athymic mice

(Table II).

159

Table II The tumorigenicity of the cell strains expressing Spry2

 

Days for tumor to

 

Cell Tumor reach 0.5 cm3
strain HRasV12 Spry2 incidence1 volume
MSU-1.1 - - 0ch -
MSU-1.1VCA1 - - (:1/6c -
MSU-1.1VCA6 - - 0/6 c -
MSU-1.1841 - + 0/6 c -
MSU-1.1862 - ++ 0/6 c -
MSU-1 .1 L98 + - 0/3 -
PH3MT ++ ++d 6/6 21

 

1Ratio of tumors formed to the number of sites injected
subcutaneously. If no tumors arose 6 months after the injection the
mice were sacrificed.

IDMSU-1.1 derivatives were injected at ten million cells per site.
PH3MT cells were injected at one million cells per site.

cData reflect a period of 3 months

dRepresents endogenous level of Spry2

160

Discussion

Our study also shows that Spry2 makes distinct contributions to the regulation of
the EGFR signaling pathway in pre-malignant (MSU-1.1), and in malignant
human fibroblasts with active Ras signaling (PH3MT). We found that PH3MT
cells have elevated levels of EGFR compared to its parental cell strain and that
intact EGFR is necessary for growth factor independence and anchorage
independence (data not shown) in these cells. This is consistent with studies
showing that EGFR signaling is necessary for HRas-induced cell transformation

[31-35].

The elevated level of EGFR in PH3MT cells is dependent on Spry2. Spry2
interacts with HRas, suggesting that Spry2 acts as an effector of HRas, at least
in the context of cells overexpressing HRasV”. Because Spry2 interacts with
several proteins involved in Ras signaling, including Raf [30, 40, 41], it is possible
that the interaction between Spry2 and Ras is indirect. Nevertheless, Spry2
facilitates an interaction between HRas, and Spry2-binding partners, c-Cbl and
CIN85, which act at the level of EGFR to regulate its endocytosis and
degradation [42, 43]. The established function of Spry2 is to inhibit EGFR
endocytosis and lysosomal degradation induced by c-Cbl and CIN85 [39].
Although Spry2 was able to sustain EGFR in HRas-transformed cells, Spry2 was
unable to do so when expressed at similar levels in their parental cells,
suggesting that HRas regulates the ability of Spry2 to prevent EGFR

degradation.

161

In MSU-1.1 cells Spry2 appears to inhibit ERK, whereas in PH3MT cells Spry2 sustains
ERK activation. However, the inhibitory function of Spry2 in MSU-1.1 cells was
diminished, when Spry2 was expressed at a similar level as the endogenous level in
PH3MT cells. This suggests that inhibitory function of Spry2 is dependent on the amount
of Spry2 protein within cells. In addition, while in PH3MT cells Spry2 acted downstream
of HRas, in MSU-1.1 cells Spry2 acted downstream of EGFR and upstream of HRas.
The latter suggests that the inhibitory function of Spry 2 in M8U1.1 cells is mediated by

the ability of Spry2 to inhibit RTK signaling at the level of Grb2:SOS.

Based on these findings, we propose that in malignant cells expressing oncogenic HRas
(PH3MT), activated Ras signaling is responsible for switching the function of Spry2 form
inhibitory to activating. First, the inhibitory role of Spry2 at the level of Grb2:SOS complex
is bypassed in cells with constitutively active Ras. In addition, HRas induces a high
expressional level of Spry2, at which levels the inhibitory activity of Spry2 is diminished
when Spry2 is expressed independently of HRasV‘Z. Finally, the interaction between
HRas and Spry2 may be the additional regulatory element required if Spry2 is to sustain
the activation of EGF signaling, and contribute to tumor formation, rather that play an

inhibitory role.

Spry2 negatively regulates RTK signaling [44-46], and is down regulated in
breast and prostate cancer [27, 28, 47]. Spry2 has a tumor suppressive function
in the MCF-7 breast cancer cell line [48] and in a leiomyosarcoma cell line [49].
Our data show that, although Spry2 cannot by itself malignantly transform human

fibroblasts, Spry2 expression is necessary for the malignant phenotype of HRas-

162

transformed fibroblasts. Spry2 appears to be a significant mediator of HRas-
transfonnation, because even though the levels of active Ras were unaltered,

down-regulation of Spry2 abrogated tumor formation by HRas-transformed cells.

To our knowledge, the role of Spry2 in cancer has not been examined in the context of
cells with activated Ras signaling. It is noteworthy that Spry2 is up-regulated in
melanoma cell lines with BRaf- and/or NRas-activating mutations [50], a finding that is
consistent with our observation that HRas- and NRas-transformed fibroblasts exhibit a
high level of Spry2 protein expression. Because these melanoma cell lines resemble
PH3MT cells, in that they contain activated Ras signaling, it would be interesting to

determine if Spry2 promotes tumor formation by these cancer cells.

163

Materials and methods

Cells and Cell Culture.

The derivation of the cells of the MSU lineage has been described [2, 4]. The SL68 and
SL89 cell lines are normal neonatal foreskin-derived fibroblasts. SHAC, HT1080, VleFT
and NCI cells are derived from fibrosarcoma patients [51]. The immortalized pancreatic
cell ps-1 was provided by Dr. C. C. Chang (Michigan State University). Pancreatic
carcinoma cell lines MlAPaCa-2, AsPc1 and CFPAC1 were obtained from the American
Type Culture Collection (Manassas, VA). The cells were cultured in Eagle’s MEM,
supplemented with L-aspartic acid (0.2 mmol), L-serine (0.2 mmol), pyruvate (1 mmol)
and 10% supplemented calf serum (Hyclone, Logan, UT), penicillin (100 unitsImL), and
streptomycin (100 ug/mL, culture medium) at 37°C in a humidified incubator with 5%

C02.

Northern Blot Analysis.

Total RNA was extracted from cells with RNA-Zol reagent from Tel-Test
(Friendswood, TX) according to the manufacturer’s protocol. Northern blotting
was performed according to standard procedures. A Spry2-specifc probe was
used for the detection of Spry2. Equal loading was determined with a probe

specific for GAPDH.

Western Blot Analysis.

Whole cell lysates were prepared as described [52]. The protein content was quantified

with Coomasie protein reagent from Pierce (Rockford, IL). Whole cell lysate (50 pg) was

164

separated by SDS-PAGE. The protein was transferred to polyvinylidene fluoride
membrane (Millipore, Billerca, MA), and immunoblotting was carried out using standard
techniques. The signal was detected with the Super Signal reagent (Pierce). Antibodies
against EGFR, ERK, pERK, c-Cbl and HRas were purchased form Santa Cruz (Santa
Cruz, CA); Spry2 from Calbiochem (San Diego, CA); Pan-Ras from Cytoskeleton
(Denver, CO) and Ku80 from Serotec (Raleigh, NC). Ku80 protein expression was used

as a loading control.

Preparation of Spry2-shRNA Constructs.

The down regulation of Spry2 in PH3MT cells was carried out with the
p8uper.retro system by Oligoengine (Seattle, WA). The shRNA constructs were
designed according to the manufacturer’s protocol. Briefly, the coding region of
Spry2 was analyzed with Oligoengine’s RNAi design tool and two 19-nucleotide
long regions centered on positions 399 and 492 of the Spry2 coding region were
selected as target sites. For each of these target sites, a 65-base pair, double-
stranded oligonucleotide was synthesized, which encoded the sense and
antisense orientations of the Spry2 target site separated by a hairpin sequence of
nine base pairs. The double stranded oligonucleotides were synthesized to
contain Bglll and Hindlll overhangs. The sequences for the oligonucleotides
targeting positions 399 and 492 on the Spry2 coding region are:
5’GATCCCCGAGACTGCTAGGATCATCCTTCAAGAGAGGAGTGATCCTAGCA

GCTCTTl'TTGGAAA and 5’GATCCCCGCCA
CTGAGCAAGGAAGATTTCAAGAGAATCTTCCTTGCTCAGTGGCTTI'TTGGAA

A, respectively. In addition to the two Spry2-specific oligonucleotides, we also

165

synthesized a nonspecific oligonucleotide in which the sense and antisense
sequences were scrambled. Following their synthesis, the double stranded

oligonucleotides were ligated into the pSuper.retro vector.

Stable Infection.

The pSuper.retro vectors encoding the spry2-specifc or the nonspecific shRNA
constructs were transiently transfected into the Phoenix packaging cell line by
using Lipofectamine 2000 from Invitrogen (Carlsbad, California) according to the
manufacturer’s directions. In each case, we used five micrograms of DNA and a
1:4 DNA to Lipofectamine ratio. Forty-eight hours post-transfection the medium
was collected, centrifuged at 1,500 rpm for five min and the retrovirus-containing
supernatant was collected. One milliliter of retrovirus-containing medium was
mixed with 4 pg ImL polybrene and was added to PH3MT cells which had been
plated at a density of 200,000 cells per 60 mm dish, 24 h prior to infection. The
retrovirus-containing medium was removed after 18 h and the cells were allowed
to recover for 30 h. Forty-eight hours post-infection the cells were passaged into
100 mm-diameter dishes at a 1:10 dilution, and 24 h latter the infected cells were
selected with puromycin (20 pg ImL). Puromycin-resistant clones were isolated
and screened by Western blotting for down-regulation of Spry2. The three
independent clones with down-regulated Spry2 that were used in this study have
been screened multiple times, after being in culture for different time periods,
ranging from days to months. The expression of Spry2 in these cells was down-

regulated compared to the control cells in every case.

166

AG1478 Inhibitor Study.

Cells were plated at a density of 5,000 cells per 60 mm-diameter dish in medium
with 0.1% serum, and allowed to grow in the presence or absence of AG1478 at a
concentration of 6 pM. Cell growth was monitored by measuring the number of
cells every two days. Three independent experiments were performed. Each

experimental repeat included at least two replicates for each cell strain analyzed.

lmmunoprecipitation Reactions.

Briefly, whole cell lysates (250-500 pg) were precleared with an appropriate lgG
anbtibody for 30 min., and thenincubated with an antibody specific to HRas for 2
hrs, followed by incubation with protein-G for 1hr. to overnight at 4°. In the case
when a HRas agarose conjugate was used (Ras-chl/CIN85), the lysates were
incubated with the agarose conjugate 3 hrs to overnight. The immunoprecipitated
fraction was washed several times with lysis buffer and assayed by Western
blotting. This experiment was repeated 3-4 times for the Ras-Spry2 and Ras-c-

Cbl interactions, and two times for the Ras-CIN85 interaction.

Anchorage independence assay.

Cells were assayed for their ability to form colonies in agarose as described [52].
Briefly, 5,000 cells were plated in 60-mm-diameter dishes with 0.33% top agarose

and 2% bottom agarose. The cells were overlaid with 2.5 mL of culture medium,

167

which was replaced weekly. After 3 weeks the cells were fixed with 2.5 %
gluteraldehyde, and colonies in random fields were analyzed using the NIH Image
1.62 software. The number and the size of the each colony was determined with
the Quantity One software by Bio-Rad (Hercules, CA). This experiment was
repeated at least twice for each of the two control cell strains and the three cells
strains with down-regulated Spry2. Each experimental repeat was performed

using two to three replicates for each cell strain.

Tumorigenicity Assay.

Cells were assayed for their ability to form tumors in athymic mice as described
[52]. The mice were examined weekly for tumor growth, and the tumors were
removed when they reached a volume of 0.5 cm3. In the absence of tumor
formation six months after the injection, the mice were sacrificed. For the study of

the MSU-1.1 derivatives, one week prior to injection of cells, the mice were implanted
subcutaneously with an absorbable gelatin sponge (1cm3) from Pharrnacia (Kalamazoo,

MI).

Ras Activation Assay.

Whole cell lysates (2 mg) were pulled down with Raf-Ras binding domain (RBD)
conjugated beads from Cytoskeleton (Denver, CO) according to the

manufacturer’s instructions. The pulled down fractions were immunoblotted with a

168

HRas specific antibody to determine the level of active HRas. Three experimental

repeats were performed.

Acknowledgements

We wish to thank Dr. S. Kleff for her help in starting this project. We also thank
Dr. K. Meek for her critical review of the manuscript and Dr. G. Guy for providing
us with a vector expressing Spry2. This research was supported by the United
States Department of Health and Human Services NIH Grant CA098305 (J.J.M.),
and by a Research Assistantship from the College of Human Medicine at

Michigan State University (PL).

169

References

10.

11.

McCormick, J.J. and V.M. Maher, Analysis of the multistep process of
carcinogenesis using human fibroblasts. Risk analysis: an official publication of
the Society for Risk Analysis, 1994. 14((3)): p. 257-63.

Morgan, T.L., et al., Characteristics of an infinite life span diploid human
fibroblast cell strain and a near-diploid strain arising from a clone of cells
expressing a transfected v-myc oncogene. Experimental cell research, 1991.
197((1)): p. 125-36.

Fry, D.G., et al., Malignant transformation of an infinite life span human fibroblast
cell strain by transfection with v-Ki-ras. Oncogene, 1990. 5((9)): p. 1415-8.

Hurlin, P.J., V.M. Maher, and J.J. McCormick, Malignant transformation of human
fibroblasts caused by expression of a transfected T24 HRAS oncogene.
Proceedings of the National Academy of Sciences of the United States of
America, 1989. 86((1)): p. 187-91.

Wilson, D.M., et al., Malignant transformation of human fibroblasts by a
transfected N-ras oncogene. Cancer research, 1990. 50((17)): p. 5587-93.

Boley, S.E., et al., Malignant transformation of human fibroblast cell strain MSU-
1.1 by N-methyl-N-nitrosourea: evidence of elimination of p53 by homologous
recombination. Cancer research, 2000. 60((15)): p. 4105-11.

O'Reilly, 8., et al., Dose—dependent transformation of cells of human fibroblast
cell strain MSU-1.1 by cobalt-60 gamma radiation and characterization of the
transformed cells. Radiation research, 1998. 150((5)): p. 577-84.

Hacohen, N., et al., sprouty encodes a novel antagonist of FGF signaling that
patterns apical branching of the Drosophila airways. Cell, 1998. 92((2)): p. 253-
63.

Casci, T., J. Vinéos, and M. Freeman, Sprouty, an intracellular inhibitor of Ras
signaling. Cell, 1999. 96((5)): p. 655-65.

de Maximy, A.A., et al., Cloning and expression pattern of a mouse homologue of
drosophila sprouty in the mouse embryo. Mechanisms of development, 1999.
81((1-2)): p. 213-6.

Minowada, G., et al., Vertebrate Sprouty genes are induced by FGF signaling

and can cause chondrodysplasia when overexpressed. Development
(Cambridge, England), 1999. 126((20)): p. 4465-75.

170

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

Gross, l., et al., Mammalian sprouty proteins inhibit cell growth and differentiation
by preventing ras activation. The Journal of biological chemistry, 2001. 276((49)):
p. 46460-8.

Hanafusa, H., et al., Sprouty1 and Sprouty2 provide a control mechanism for the
Ras/MAPK signalling pathway. Nature cell biology, 2002. 4((11)): p. 850-8.

lmpagnatiello, MA, et al., Mammalian sprouty-1 and -2 are membrane-anchored
phosphoprotein inhibitors of growth factor signaling in endothelial cells. The
Journal of cell biology, 2001. 152(5): p. 1087-98.

Yigzaw, Y., et al., The C terminus of sprouty is important for modulation of
cellular migration and proliferation. The Journal of biological chemistry, 2001.
276((25)): p. 22742-7.

Egan, J.E., et al., The bimodal regulation of epidermal growth factor signaling by
human Sprouty proteins. Proc Natl Acad Sci U S A, 2002. 99(9): p. 6041-6.

Fong, C.W., et al., Tyrosine phosphorylation of Sprouty2 enhances its interaction
with c-Cbl and is crucial for its function. J Biol Chem, 2003. 278(35): p. 33456-64.

Mason, J .M., et al., Tyrosine phosphorylation of Sprouty proteins regulates their
ability to inhibit growth factor signaling: a dual feedback loop. Mol Biol Cell, 2004.
15(5): p. 2176-88.

Rubin, C., et al., Sprouty fine-tunes EGF signaling through interlinked positive
and negative feedback loops. Curr Biol, 2003. 13(4): p. 297-307.

Wong, E.S., et al., Sprouty2 attenuates epidermal growth factor receptor
ubiquity/ation and endocytosis, and consequently enhances Ras/ERK signalling.
Embo J, 2002. 21(18): p. 4796-808.

Wong, E.S., et al., Evidence for direct interaction between Sprouty and Cbl. J
Biol Chem, 2001. 276(8): p. 5866-75.

Thien, CB. and W.Y. Langdon, Cbl: many adaptations to regulate protein
tyrosine kinases. Nature reviews, Molecular cell biology, 2001. 2((4)): p. 294-307.

Egan, J.E., et al., The bimodal regulation of epidermal growth factor signaling by
human Sprouty proteins. Proceedings of the National Academy of Sciences of
the United States of America, 2002. 99((9)): p. 6041-6.

Rubin, C., et al., Sprouty fine-tunes EGF signaling through interlinked positive
and negative feedback loops. Current biology: CB., 2003. 13((4)): p. 297-307.

Wong, E.S., et al., Sprouty2 attenuates epidermal growth factor receptor
ubiquity/ation and endocytosis, and consequently enhances Ras/ERK signalling.
The EMBO journal., 2002. 21((18)): p. 4796-808.

Wong, E.S., et al., Evidence for direct interaction between Sprouty and Cbl. The
Journal of biological chemistry, 2001. 276((8)): p. 5866-75.

171

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

37.

38.

39.

40.

Lo, T.L., et al., The ras/mitogen-activated protein kinase pathway inhibitor and
likely tumor suppressor proteins, sprouty 1 and sprouty 2 are deregulated in
breast cancer. Cancer Res, 2004. 64(17): p. 6127-36.

McKie, A.B., et al., Epigenetic inactivation of the human sprouty2 (hSPRY2)
homologue in prostate cancer. Oncogene, 2005. 24(13): p. 2166-74.

Bloethner, 8., et al., Effect of common B-RAF and N-RAS mutations on global
gene expression in melanoma cell lines. Carcinogenesis, 2005. 26(7): p. 1224-
1232.

Tsavachidou, D., et al., SPRY2 is an inhibitor of the ras/extracellular signal-
regulated kinase pathway in melanocytes and melanoma cells with wild-type
BRAF but not with the V599E mutant. Cancer Res, 2004. 64(16): p. 5556-9.

Casanova, M.L., et al., A critical role for ras-mediated, epidermal growth factor
receptor-dependent angiogenesis in mouse skin carcinogenesis. Cancer
research, 2002. 62((12)): p. 3402-7.

Hamilton, M. and A. Wolfman, Oncogenic Ha-Ras-dependent mitogen-activated
protein kinase activity requires signaling through the epidermal growth factor
receptor. The Journal of biological chemistry, 1998. 273((43)): p. 28155-62.

Gangarosa, L.M., et al., A ref-independent epidermal growth factor receptor
autocrine loop is necessary for Ras transformation of rat intestinal epithelial cells.
The Journal of biological chemistry, 1997. 272((30)): p. 18926-31.

Martéinez-Lacaci, l., et al., RAS transformation causes sustained activation of
epidermal growth factor receptor and elevation of mitogen-activated protein
kinase in human mammary epithelial cells. International journal of cancer.
Journal international du cancer, 2000. 88(( 1)): p. 44-52.

Sibilia, M., et al., The EGF receptor provides an essential survival signal for
SOS-dependent skin tumor development. Cell, 2000. 102((2)): p. 211-20.

Levitzki, A. and A. Gazit, Tyrosine kinase inhibition: an approach to drug
development. Science, 1995. 267((5205)): p. 1782-8.

Fong, C.W., et al., Tyrosine phosphorylation of Sprouty2 enhances its interaction
with c-Cbl and is crucial for its function. The Journal of biological chemistry,
2003. 278((35)): p. 33456-64.

Mason, J.M., et al., Tyrosine phosphorylation of Sprouty proteins regulates their
ability to inhibit growth factor signaling: a dual feedback loop. Molecular biology
of the cell, 2004. 15((5)): p. 2176-88.

Haglund, K., et al., Sprouty2 acts at the Cbl/CIN85 interface to inhibit epidermal
growth factor receptor downregulation. EMBO Rep, 2005. 6(7): p. 635-41.

Kim, H.J. and D. Bar-Sagi, Modulation of signalling by Sprouty: a developing
story. Nat Rev Mol Cell Biol, 2004. 5(6): p. 441-50.

172

41.

42.

43.

44.

45.

46.

47.

48.

49.

50.

51.

52.

Sasaki, A., et al., Mammalian Sprouty4 suppresses Ras-independent ERK
activation by binding to Raf1. Nat Cell Biol, 2003. 5(5): p. 427-32.

Dikic, l., CIN85/OMS family of adaptor molecules. FEBS Lett, 2002. 529(1): p.
110-5.

Thien, CB. and W.Y. Langdon, Cbl: many adaptations to regulate protein
tyrosine kinases. Nat Rev Mol Cell Biol, 2001. 2(4): p. 294-307.

Christofori, G., Split personalities: the agonistic antagonist Sprouty. Nature cell
biology, 2003. 5((5)): p. 377-9.

Guy, G.R., et al., Sprouty: how does the branch manager work? Journal of cell
science, 2003. 116((Pt) 15): p. 3061-8.

Kim, H.J. and D. Bar-Sagi, Modulation of signalling by Sprouty: a developing
story. Nature reviews- Molecular cell biology, 2004. 5((6)): p. 441-50.

Kwabi-Addo, B., M. Ozen, and M. Ittmann, The role of fibroblast growth factors
and their receptors in prostate cancer. Endocr Relat Cancer, 2004. 11(4): p. 709-
24.

Lo, T.L., et al., The ras/mitogen-activated protein kinase pathway inhibitor and
likely tumor suppressor proteins, sprouty 1 and sprouty 2 are deregulated in
breast cancer. Cancer research, 2004. 64((17)): p. 6127-36.

Lee, C.C., et al., Overexpression of sprouty 2 inhibits HGF/SF-mediated cell
growth, invasion, migration, and cytokinesis. Oncogene, 2004. 23((30)): p. 5193-
202.

Bloethner, 8., et al., Effect of common B-RAF and N-RAS mutations on global
gene expression in melanoma cell lines. Carcinogenesis, 2005. Advance
access.

Qing, J., et al., Cloning and characterization of a novel gene encoding a putative
transmembrane protein with altered expression in some human transformed and
tumor-derived cell lines. Oncogene, 1999. 18((2)): p. 335-42.

Lou, Z., et al., Down-regulation of overexpressed sp1 protein in human

fibrosarcoma cell lines inhibits tumor formation. Cancer research, 2005. 65((3)):
p. 1007-17.

173

Chapter III: Sprouty-2 prevents apoptosis in HRas-
transformed human fibroblasts

Running title: Spry2 prevents apoptosis

Piro Lito, Bryan D. Mets, Daniel M. Appledom, Veronica M. Maher and J. Justin

McCormick.

Carcinogenesis Laboratory, Department of Microbiology & Molecular Genetics
and Department of Biochemistry & Molecular Biology, Michigan State University,

East Lansing, Michigan 48824-1302, U. S.A.

*Correspondence: J. Justin McCormick, Carcinogenesis Laboratory, Food Safety
and Toxicology Bldg, Michigan State University, East Lansing, MI 48824-1302,
USA; Ph: (517) 353-7785; Fax: (517) 353-9004.

E-mail address: mccormi1@msu.edu

Keywords: Sprouty; H-Ras oncogene; DNA damage induced apoptosis;

174

Abstract

Sprouty-2 (Spry2) has been reported to prevent epidermal growth factor receptor
(EGFR) degradation, which results in sustained signaling activity form this
receptor. We have previously shown that Spry2 interacts with HRas and that
Spry2 is necessary for the ability of HRaswz-transformed fibroblasts to form
tumors. Because Ras is reported to reduce the sensitivity of cells to DNA
damage-induced apoptosis, we hypothesized that Spry2 plays a role in this
process. In a cell strain of HRas-transformed human fibroblasts, which express
high levels of Spry2, the ability of HRas to prevent UV-induced apoptosis is
dependent on intact P|3K- and Rac1-activity. By comparing HRas-transformed
cells with endogenous levels of Spry2 to HRas-transformed cells in which Spry2
has been down-regulated, we found that Spry2 enhanced the level of active PI3K
and Akt. Also, Spry2 enhanced the level of active Rac1 in HRas-transformed
cells, in part by modulating the interaction between HRas and Tiam1, a GDP-
releasing factor for R301. Consistent with these findings, the down-regulation of
Spry2 resulted in increased levels of UV-induced apoptosis. What is more, down-
regulation of Spry2 resulted in an increase in the level of p53, paralleled by a
decrease in the level of MDM2 phosphorylated at Ser166, a site that is reported
to be phosphorylated by Akt. Expression of Spry2 in immortalized human
fibroblasts resulted in a decrease in the level of UV-induced apoptosis, and in a
decrease in the level of p53 protein. Taken together these findings suggest that

Spry2 is an important mediator of survival signals induced by oncogenic HRas.

175

Introduction

The Ras proto-oncogenes HRas, NRas and KRas are important regulators of
cellular functions, such as proliferation and survival [1, 2]. Ras is a small GTPase
that oscillates between an active conformation, which is GTP-bound, and an
inactive conformation, which is GDP-bound. Ras serves as a molecular switch to
regulate a number of intracellular signaling pathways, including those mediated
by Raf, PI3K and Ral [3]. Thirty percent of human tumors contain activating
mutations within Ras genes, suggesting that these oncogenes play a causal role
in the formation of various types of cancer [4]. These mutations give rise to a
constitutively active form of Ras, leading to constitutive activation of Res-effector
pathways [5]. Although initial evidence indicated that Raf is the main effector that
mediates Rae-transformation, especially in mouse fibroblasts, more recent
studies have indicated the importance of Ras effectors PI3K and Ral in the

transformation of human cells [6, 7].

Pl3K is a lipid kinase that phosphorylates phosphoinositides on the 3’ position of
the inositol ring [8, 9]. PI3K consists of two subunits; a regulatory subunit, p85
and a catalytic subunit, p110. The regulatory subunit interacts with
phosphorylated tyrosine residues on activated growth factor receptors[10, 11].
This association of p85 with activated growth factor receptors recruits the catalytic
subunit to the plasma membrane, were it can phosphorylate phosphoinositides.
The p110 catalytic subunit of PI3K interacts with GTP-bound Ras, a process that

also results in the activation of PI3K [12]. Activated PI3K converts PI(4,5)P2 into

176

Pl(3,4,5)P3, which activates several effector proteins, including the
serine/threonine kinase Akt [13]. Akt phopshorylates a number of substrates,
which regulate cellular survival pathways. Akt substrates include BAD, NFKB and

Mdm2 [14-17].

Rac1, a member of the Rho family of GTPases, plays an important role in the
transformation of fibroblasts by Ras [18]. The activation of Rac1 by Ras occurs
either indirectly, through Pl3K, or directly, through the activation of Tiam1, a GDP-
releasing factor for Rac1 [19, 20]. Rac1 is mainly involved in the regulation of
migration, adhesion and division [21]. However, a number of studies, also

implicate Rac1 in the regulation of apoptosis [18, 22-25].

p53 functions as a homotetrameric transcription factor, and regulates cell cycle
arrest, apoptosis and DNA repair [26-28]. Under physiological conditions, p53 is
maintained at a low level by Mdm2, an E3 ubiquitin ligase. MDM2 ubiquitinates
p53, targeting it for degradation by the proteasome [29]. The transcriptional
activity of p53 is activated in response to cellular stresses that induce DNA
damage. Upon DNA damage, the ubiquitination of p53 by Mdm2 is abolished, and
p53 translocates to the nucleus, where it induces the transcriptional activation of
genes, such as p21 and Bax [30]. Active p21 arrests the cell cycle by inhibiting
Cyclin/CDK complexes [31], thus allowing more time for the repair of DNA
damage. If the damage is not repaired, p53 induces apoptosis via the activation

of BAX, a pro-apoptotic factor that inhibits the anti-apoptotic factor Bcl-2 [32].

177

Sprouty Sprouty was identified as a repressor of RTK signaling in Drosophila
melanogaster (D.m.) [33-35]. Mammalian cells express four Spry isoforms
(Spry1-4) that are considerably smaller than the Drosophila ortholog [36-38].
Mammalian Spry proteins also exert an inhibitory function in RTK signaling.
Hiwver, Spry2 also potentates RTK signaling, particularly in response to EGF
stimulation [39-41]. This function is the result of the interaction of Spry2 with c-Cbl
[42], an E3 ubiquitin ligase that catalyzes the ubiquitination of EGFR, targeting
this receptor for proteasomal degradation [43]. In addition, Spry2 binds to CIN85,
which is part of an endocytotic complex that assists in the activity of c-Cbl [44].
By binding to c-Cbl and CIN85, Spry2 prevents the interaction between c-Cbl and
EGFR, and this interference blocks the degradation of the receptor. This in turn

leads to sustained EGFR-induced signaling.

In a previous study (Lito et al., manuscript in preparation) we found that Spry2
interacts with HRas and is necessary for tumor formation by HRas-transformed
fibroblasts. In the present study we determined the function of Spry2 in the
regulation of apoptotic pathways in response to UV damage. We found that a
HRas-transformed cell strain (PH3MT), which expresses high levels of Spry2,
exhibited a decrease in the level of UV-induced apoptosis compared to their
parental cell strain (MSU-1.1). This process was dependent on intact PI3K and
Rac1 activity. Spry2 sustained both the level of active P|3K and the level of active

Rac1, in HRas-transformed cells. In the same cellular context, Spry2 contributed

178

to a low level of p53 protein and was necessary for the ability of HRas to inhibit
UV-induced apoptosis. Finally, expression of Spry2 in a cell strain of
immortalized human fibroblasts resulted in a decrease in the level of p53 and a
decrease in UV-induced apoptosis. These findings suggest that Spry2 has an anti
apoptotic function, through the activation of cellular pathways that suppress the

level of p53 protein.

Results

Effect of HRas oncogene-transformation on DNA-damage induced
apoptosis

Ries et al. have demonstrated that Ras protects NIH3T3 fibroblasts from DNA-
damage induced apoptosis [45]. Before we determined the role of Spry2 in this
process we verified whether this effect could be reproduced in a HRas-
trasnfonned cell strain (PH3MT), which has a higher expression of Spry2
compared to its parental cell strain (MSU-1.1) cells (Fig. 1A). To this end, we
exposed both MSU-1.1 and PH3MT cells to UV radiation and measured the
percentage of cells undergoing apoptosis by staining the cells with AnnexinV-
FITC and analyzing the stained cells by flow cytometry. Consistent with the
findings of Reis et al., we found that oncogenic HRas de-sensitized immortalized
human fibroblasts to early apoptotic events induced by DNA-damage (Fig. 18).
What is more, a cell strain derived from the transformation of MSU-1.1 cells with

NRas oncogene, which expresses high levels of Spry2, was also resistant to UV-

179

Figure 1. Effect of HRas-transformation on UV-induced apoptosis. (A) Expression
levels of Spry2 and HRas in immortalized human fibroblasts (MSU-1.1) and in
their HRas oncogene-transformed derivatives (PH3MT). (B) The indicated cell
lines were plated at a density of 200,000 cells per dish and allowed to grow
overnight. The cells were stimulated with UV and allowed to grow under normal
conditions for four hours. The cells were stained with Annexin V and analyzed by
flow cytometry. Live cells are represented in the lower left quadrant. Early
apoptotic cells are represented in the lower right quadrant. Late apoptotic and
necotic cells are represented in the upper right quadrant. Dead cells are
represented in the upper left quadrant. (C) HRas-transformed cells (PH3MT) were
analyzed as in B, in the presence or absence of Wortmannin (50nM). (D) HRas-
transforrned fibroblasts (PH3MT) were stably transfected with an empty vector or
a vector encoding a Myc-tagged, dominant negative form of Rac1 (Rac1N17).
Whole cell lysates from the stable clones were analyzed by Western blotting to
determine the expression of dominant negative Rac1. (E) PH3MT cells
expressing an empty vector (PH3MT-VC) and PH3MT cells expressing Rac1N17

(PH3MT-RC1) were analyzed as in B.

180

9'31
ma.

1 by

15))
c8

MSU-1.1
+ PH3MT

 

t:

 

 

 

 

 

 

I 0‘

 

PH3MT

+ -

- +

 

 

 

 

VC RC1

Figure 1

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

MSU-1 .1
"4.3% 4.5%
E
V12
HRas ,3»; 30%]
3911/2 Annexin
HRas
Ku80
C- PH3MT
(- Wortmannin)
9.7% 1.7%
E
2.7%
Annexin
Vector
Myc-Rac1N17
Myc
Actin
PH3MT-VC
10% 5.7%
$2 0.6%

 

 

181

PI

PI

PH3MT

 

9.7%

1.7%

 

 

 

 

2.7%.

 

Annexin

PH3MT

(+ Wortmannin)

 

23%

1111‘
7'“
MI

10%

 

 

 

 

8.3%

 

Annexin

PH3MT-RC1

 

5.6%

8.3%

 

 

 

 

1:11 .__ _-
' Wm.»- - 24%

 

induced apoptosis, suggesting that the ability to suppress this type of apoptosis

process is shared among these Ras isoforms (data not shown).

Because P|3K activity is necessary for the activation of survival pathways
downstream of R33, as well as for the transformation of human cells by Ras
oncogene [46], we determined whether PI3K activity is also necessary for the
resistance of HRas-transformed cells to DNA damage induced apoptosis. To
determine this, we measured UV-induced apoptosis in HRas-transformed cells in
the presence or absence of Wortmannin, an inhibitor of PI3K. In the absence of
Wortmannin treatment, only a small percentage of HRas-transformed cells
underwent DNA-damage induced apoptosis (Fig 1C). In the presence of
Wortmannin treatment, however, the percentage of cells undergoing apoptosis
was increased (Fig 1C). This suggests that the ability of HRas to protect human
fibroblasts from UV-induced apoptosis is at least in part dependent on PI3K
activity. Treatment with AG1478, a selective inhibitor of EGFR, also increased the
number of Ras-transformed cells undergoing apoptosis in response to UV
radiation (data not shown), suggesting that EGFR signaling is also important for

the ability of HRas to protect cells from UV-induced apoptosis.

The transformation of MSU-1.1 immortalized fibroblasts by HRas oncogene is
dependent in part on intact Rac1 activity (Appledom and McCormick, manuscript
in preparation). Because Rac1 can also have a protective effect against UV-

induced apoptosis [47], we determined if Rac1 activity was necessary for the

182

inhibition of UV-induced apoptosis in HRas-transformed cells (PH3MT). Two
PH3MT-derrived cell lines, PH3MT-RC1, expressing a dominant negative form of
R301 (Rac1N17), and PH3MT-VC, expressing an empty vector (Fig. 10), were
analyzed for induction of apoptosis under the same conditions as above. The cell
line expressing Rac1N17 displayed enhanced apoptosis compared to the control
cell line (Fig. 1E). This finding suggests that Rac1 is also necessary for the

resistance of HRas-transformed cells to UV-induced apoptosis.

Effect of Spry2 on the activation of the PI3K pathway in HRas-

transformed cells

PI3K activation involves its recruitment to phospho-tyrosine residues on the
cytoplasmic tail of activated RTKs, a process that is mediated by the SH2 domain
of the p85 subunit [10]. Because in HRas-transformed cells Spry2 sustains the
levels of EGFR, which activates PI3K [48-52], we hypothesized that Spry2
contributes to the activation of Pl3K. To test this hypothesis we analyzed a
PH3MT-derived cell strain in which Spry2 has been down-regulated by the
expression of a spry2-specific shRNA (PH3MT-2A3), and a control PH3MT cell
strain expressing a scrambled shRNA (PH3MT-SC)(Fig. 2A). We determined the
level of phosphorylated p85 in control cells and in cells with down regulated
Spry2, because the activation of PI3K correlates with the level of p85
phosphorylation [53-55]. We found that down-regulation of Spry2 in HRas-

transforrned cells resulted in a decrease in the level of p85 phosphorylation (Fig.

183

Figure 2. Effect of Spry2 on Pl3K signaling in HRas-transformed cells. (A) HRas-
transfonned cells (PH3MT) were stably infected with a vector encoding a
scrambled shRNA (PH3MT-SC), or a vector encoding a Spry2-specific shRNA.
Whole cell lysates from the stable clones generated were analyzed by Western
blotting to determine the expression of Spry2. (B) Control cells (PH3MT-SC) and
cells with down-regulated Spry2 (PH3MT-2A3) were analyzed by Western
blotting with the indicated antibodies. (C) Non tumorigenic, immortalized human
fibroblasts (MSU-1.1) were stably transfected with an empty vector (MSU-1.1-
VC) or a vector encoding V5-tagged Spry2 (MSU-11862). Whole cell lysates

were analyzed by Western blotting to determine the expression level of Spry2.

184

PH3MT

+ - Scrambled shRNA
- + Spry2-shRNA

 

Spry2

Spry1
Ku80

SC 2A3

 

 

 

MSU-1.1

+ - Vector
- + Spry2-V5

 

 

Spry2

Ku80
VC S62

 

 

Figure 2

185

PH3MT
SC 2A3

was
I: p85

pAkt
Akt

28), a finding that is consistent with the ability of Spry2 to sustain EGFR

signaling.

Because Spry2 sustains the activation of Pl3K we examined the effect of Spry2
down-regulation in the activation of Akt, a downstream effector of Pl3K. We
found that cells expressing Spry2 had higher levels of phosphorylated Akt
compared to the cells with down-regulated Spry2 (Fig. 28), suggesting that Spry2

sustains the activation of the Pl3K/Akt pathway in HRas-transformed cells.

Effect of Spry2 on the activation of Rac1 in HRas-transformed cells

To determine if Spry2 plays a role in the activation of Rac1, we carried out a Rac1
activation assay to determine the level of activated Rac1 in control HRas-
transforrned cells (PH3MT-SC) and in HRas-transformed cells with down
regulated Spry2 (PH3MT-2A3). The HRas-transformed cell strain with
endogenous levels of Spry2, contained a significantly higher level of active Rac1,

compared to cell strain with down-regulated Spry2 expression (Fig. 3A).

One function of Rac1 is to inhibit stress fiber formation [21]. To further validate
the hypothesis that Spry2 contributes to Rac1 activation in HRas-transformed
cells, we determined the level of stress fibers in control cells (PH3MT-SC) and in
cells with down-regulated Spry2 (PH3MT-2A3). These cells with decreased Spry2

expression contained more pronounced stress fibers compared to cells with

186

Figure 3. Effect of Spry2 on the activation Rac1 in HRas-transformed cells. (A)
Whole cell lysates from control cells (PH3MT-SC) and cells with down-regulated
Spry2 (PH3MT-2A3) were pulled down with PAK-CRIB (Cdc42- and Rac1-
interacting domain) conjugated beads. The amount of Rac1 that was bound to
the beads, as well as the amount of Rac1 present in whole cell lysates (WCL) is
shown. (B) The indicated cell stains were stained with Alexa-fluor 488-conjugated
Phalloidin stain, to detect actin-stress fiber formation. (C) A MSU-1.1 cell strain
expressing exogenous Spry2 (MSU-1.1-862), and a MSU-1.1 cell strain
expressing an empty vector (MSU-1.1-VC) were analyzed as in A. (D) Whole cell
lysates from the indicated cell strains were immunoprecipitated with an antibody

specific to HRas, and then immunobloted with the inbdicated antibodies.

187

PH3MT
SC 2A3

E Rac1

PDzPAK-CRIB

S Rac1

WCL

 

MSU-1.1
VC $62

Rac1

PDIPAK-CRIB

E Rac1

WCL

Figure 3

188

endogenous levels of Spry2, consistent with the lower level of R301 activation in

these cells (Fig. 3B).

To determine if Spry2 has an effect on Rac1 activation independently of Ras, we
generated a stable cell strain of immortalized human fibroblasts expressing V5-
tagged Spry2 (MSU-1.1-S62) (Fig. 2C). MSU-1.1 cells are the same precursor
cells used to generate the HRas-transformed cells in study. Spry2 expression in
these cells did not have a significant effect on Rac1 activation (Fig. BC),
suggesting that Spry2 cannot activate Rac1 independently of HRas-

transformation.

To determine the role of Spry2 in the activation of Rac1 by HRas, we focused at
the level of Ras-Tiam1 interaction. Tiam1 is a guanine nucleotide releasing factor
for Rac1, which has been shown to interact with Ras, a process that leads to
Rac1 activation [19]. To determine the role of Spry2 in this interaction we carried
out co-immunoprecipitation experiments between HRas and Tiam1, in control
cells (PH3MT-SC) and in cells with down-regulated Spry2 (PH3MT-2A3). The
amount of endogenous Tiam1 that co-immunoprecipitated with HRas was
reduced in the in the cells with down-regulated Spry2 expression, compared to

control cells (Fig. 3D).

189

Effect of Spry2 on the induction of apoptosis in response to DNA-

damage

Because we found that Spry2 contributes to the activation of Pl3K and Rac1, both
of which are responsible for the ability of HRas to inhibit apoptosis in response to
DNA damage in PH3MT cells, we hypothesized that Spry2 itself is required for
such activity. To test this hypothesis, we compared HRas-transformed cells in
which Spry2 has been down-regulated (PH3MT-2A3) with control H-Ras-
transformed cells (PH3MT-SC). The cells with down regulated Spry2 exhibited an
increase in the percentage of cells undergoing apoptosis in response to UV
damage, suggesting that Spry2 is necessary for the ability of HRasV12 to protect
the cells from UV-induced apoptosis (Fig. 4A). It should be noted that the down-
regulation of Spry2 had no effect on the induction of apoptosis when the cells

were cultured at normal conditions (data not shown).

To determine whether Spry2 plays a role in the regulation of apoptosis
independently of HRas-transformation, we also examined the level of apoptosis
induced by UV-stimulation in MSU-1.1-derived cell strains expressing either
exogenous Spry2-V5 (MSU-1.1-862) or an empty vector (MSU-1.1-VC).
Consistent with the role of Spry2 in HRas-transformed cells, expression of Spry2
in immortalized human fibroblasts (MSU-1.1-862) diminished the ability of these
cells to undergo apoptosis in response to UV-induced DNA damage (Fig. 4B).
This is the same type of response induced by expression of HRas oncogene in

the same cell line (see Fig. 1B).

190

Figure 4. Effect of Spr2 on UV-induced apoptosis. Control HRas-transformed
cells (PH3MT-SC), as well as HRas-transformed cells with down regulated Spry2
(PH3MT-2A3) were analyzed as in Fig. 1B. (8) Control immortalized fibroblasts
(MSU-1.1-VC) and immortalized fibroblasts expressing Spry2-V5 (MSU-1.1-S62)

were analyzed as in Fig 1B.

191

PH3MT-SC PH3MT-2A3
30% 8.5% 60%

 

 

   

 

 

 

 

 

 

 

w.
1 1 5‘
0.. , Q "51“..
. H --
u ‘ ' n:'
3 - : 1 ‘1’, ...":
Vat: ° ,8}; “'7":
u“ o 9.. I. 11'. ‘9 .I :0 o
A.E' , 2.5 /o ifikt’fl.‘ 10/o

 

 

 

Annexin Annexin

- MSU-1.1-VC _ MSU-1.1-862

L14% 15%
’ '2' ' I ‘11”1'1'7‘1."
-.-.15~:.-1,-;;.'39.n£t: '

16%

 

 

  

13% 5.0%

PI
PI

 

 

 

 

  

X '5
I "¢

. I.
.z'..|A-’.

 
 

 

 

 

10%

 

 

An nexin Annexin

Figure 4

192

Effect of Spry2 on the MDM2/p53 pathway

The MDM2/p53 pathway plays a critical role in UV-induced apoptosis [56]. Akt
phosphorylates MDM2 on serine residue 166, resulting in the stabilization of
MDM2 [57]. This enhances the ubiquitination of p53 by MDM2, which is followed
by degradation of the p53. Because Spry2 prevents UV-induced apoptosis, while
sustaining the activation of Akt in HRas-transformed fibroblasts, it is likely that
Spry2 promotes the Akt-mediated stabilization of Mdm2 and subsequent
decrease in the level of p53 protein. To test this hypothesis, we determined the
amount of MDM2 phosphorylated at Ser166, in the cell strain with down regulated
Spry2 (PH3MT-2A3) and in the contol cell strain (PH3MT-SC). We found that the
cell strain with down-regulated Spry2 exhibited a decrease in the amount of
MDM2 that is phosphorylated at Ser166 (Fig.5A), which correlates with the
decreased in the level of activated Akt in these cells. We also found that the
levels of p53 were increased in the cell strain with down-regulated Spry2 (Fig.

5A).

We next determined the stability of MDM2 and p53 in control cells and in cells
with decreased expression of Spry2. The cells were radiated with UV and
assayed to determine the protein expression levels of MDM2 and p53. We found
that HRas-trasnformed cells with down-regualted Spry2 (PH3MT-2A3) exhibited a

decrease in the level of MDM2 following UV treatment, when compared to control

193

Figure 5. Effect of Spry2 on the MDM2/p53 pathway. (A) Control HRas-
transforrned cells (PH3MT-SC) and HRas-transformed cells with down-regulated
Spry2 (PH3MT-2A3) were analyzed by Western blotting with the indicated
antibodies. (8) The same cell strains were treated with UV and allowed to grow
under normal conditions for the indicated time periods following UV treatment.
Whole cell lyses prepared following this treatment were analyzed by Western
blotting. (C) Immortalized fibroblasts expressing either an empty vector (MSU-
1.1-VC) or Spry2-V5 (MSU-1.1-S62) were analyzed to determine the level of
MDM2 and p53. (D) HRas-transformed cells with down-regulated Spry2 (PH3MT-
2A3) were stably transfected with a vector encoding GFP-Rac1V12 (2A3-R1) or
with a vector encoding GFP alone (2A3-VG). Whole cell lysates form these cells

were analyzed by Western blotting with the indicated antibodies.

194

‘1 11113}
9911311:
ndicaie;
10 gm],
Balmeri
1193191
I {1131-

level 37'
PH3MT-
3-R1: 0.!

:1.
359 C81:

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

195

 

 

 

 

 

 

 

 

 

 

A PH3MT
1 PMDM2
m (Ser166)
11m 11 MDM2
'7' r353
M Actin
B
PH3MT-SC PH3MT-2A3
012 4 012 4 PostUV
412$ng If? MDM2
+ + Spry2-shRNA
% 1 ' GFP
:1 MDM2 ' + GFP-RaC1V12
p m
:1 p53 w W MDM2
Actin .. .. p53
—:
GFP

HRas transformed cells (PH3MT-SC) (Fig. 58). This finding is in agreement with
the decrease in the activation of Akt, and the decrease in the phosphorylation that
stabilizes MDM2, in the cell strain with down-regualted Spry2. The level of p53
was higher in the cell strain with down-regulated Spry2, compared to the control
cell strain, even though both cell strains exhibited an increase in the amount of
p53 in response to UV stimulation (Fig. 58). These findings are consistent with

the ability of Spry2 to inhibit UV-induced apoptosis in HRas-transformed cells.

Because we found that Spry2 prevented UV-induced apoptosis upon expression
in immortalized human fibroblasts (MSU-1.1) (see Fig. 48), we determined if
expression of Spry2 in these cells had an effect on the level of p53. Consistent
with the function of Spry2 in HRas-transformed cells, the MSU-1.1 cell strain
expressing Spry2 (MSU-1.1-862) exhibited a decrease in the level of p53, when

compared to the control cell line (MSU-1.1-VC) (Fig. 5C).

We also determined whether Rac1 plays a role in the ability of Spry2 to regulate
the MDM2/p53 pathway in HRas-transformed cells. Since the down regulation of
Spry2 in HRas-transformed cells resulted in a decrease in the level of active
Rac1, we stably expressed GFP-tagged, constitutively active Rac1 (Rac1V12) in
the cell strain with down-regulated Spry2 (PH3MT-2A3). When compared to a cell
strain expressing GFP alone (2A3-VC), the cell stain expressing GFP-Rac1V12
(2A3-R1) did not exhibit a difference in the level of MDM2 or p53, both under

normal culture conditions (Fig. 5D), as well as following UV-treatment of the cells

196

(data not shown). This suggests that the effect of Spry2 on the MDM2/p53

pathway is independent of Rac1.

Discussion

In the present study we report that Spry2 contributes to the ability of HRas-
transforrned cells to evade apoptosis in response to DNA damaging agents, such
as UV. The ability of R33 to inhibit apoptosis and promote cellular survival is well
documented [58]. This process is mediated not only by Ras-effector pathways
including Raf, Pl3K and Rac1 signaling [13, 25, 45, 59], but also by the
MDM2/p53 pathway. Consistent with these findings, the ability of a HRas-
transforrned cell strain (PH3MT) to resist DNA-damage induced apoptosis was
dependent on intact Pl3K and Rac1. In this cell strain Spry2 contributes not only
to the activation of Pl3K/Akt- and Rac1- pathways, but also, Spry2 sustains the
stabilization of MDM2 resulting in a decrease in the level of p53. This suggests
that Spry2 functions through these pathways to regulate DNA damage induced

apoptosis in HRas-transformed cells.

Some Ras effector pathways converge at the regulation of MDM2/p53. Activation
of the Raf/MAPK pathway results in the transcriptional activation of MDM2 [45].
Activation of the Pl3K/Akt pathway, results in a decrease in the interaction
between Arf and MDM2, thereby stabilizing MDM2 [60] and enhancing the
ubiquitination of p53 by MDM2 [17, 57]. Because Spry2 interacts with HRas (Lito

et al. manuscript in preparation) it is possible that Spry2 is also a mediator of the

197

ability of HRas to regulate MDM2 and p53. The ability of Spry2 to regulate
MDM2/p53 independently of HRas-transformation, adds more significance to the
effect of Spry2 in the regulation of apoptotic pathways. Our data suggest that the
effect of Spry2 on MDM2/p53 is mediated by the P|3K/Akt pathway and not by the
Rac1 pathway. This is consistent with a report showing that the activation of Rac1

promotes cellular survival through the activation of NFKB [25].

Spry2 sustains the levels and signaling activity of EGFR [36]. This function of
Spry2 is observed in HRas-transformed cells as well (Lito et al., manuscript in
preparation). RTK activation results not only in the recruitment of the p85 subunit
of PI3K, but also in its phosphorylation. Because Spry2 sustained the level of
phosphoryaltion of p85 it is possible that Spry2 acts through EGFR to sustain the
activation of PI3K. Activation of EGFR reduces UV-induced apoptosis, in a
P|3K/Akt dependent pathway [52, 60], a finding that is consistent with the function

of Spry2 in HRas-transformed cells.

Spry2 has been found to inhibit Rac1 during wound healing, a property that is
necessary for the inhibition of cellular migration by Spry2 [61]. We found that
Spry2 sustains the activation of Rac1 in HRas-transformed cells, when these cells
are at log-phase growth under normal conditions. A decrease in Spry2 expression
enhances stress fiber formation, a process that is consistent with loss of Rac1
activity. In addition Rac1 contributed to VEGF and uPA secretion in PH3MT cells

(Appledom et al Manuscript in preparation) as well as in other HRas-transformed

198

cells [62-64]. Down-regulation of Spry2 in PH3MT cells resulted in a decrease in
the amount of VEGF and uPA secreted by these cells (data not shown), a finding
that supports our conclusion that Spry2 contributes to Rac1 activation in HRas-
transforrned cells. Because we found that Spry2 does not have a significant
effect on the activation of Rac1 independently of HRas-transformation, it is likely
that Spry2 only mediates the activation of Rac1 by HRas, a possibility that is in
agreement with the contribution of Spry2 to Ras-Tiam1 interaction, a step that is
critical for the direct activation of Rac1 by Ras. Alternatively, Spry2 may
contribute to the activation of Rac1 indirectly, because Spry2 sustains Pl3K
activation, and Rac1 can be activated by P|3K, a process that is also mediated by

Tiam1 [20].

The treatment of cancers by radiation or chemotherapy relies strongly on the
induction of apoptosis. Inactivation of pro-apoptotic pathways in cancer cells, as
observed during the transformation of cells by HRas, compromises the efficacy of
such treatments. Spry2, best known for its negative regulation of RTK signaling,
sustains the activation of Ras effector pathways that mediate cellular survival.
Through this contribution, Spry2 provides a protective signal during UV-induced
apoptosis, and plays a role in the resistance of immortalized and HRas-
transforrned fibroblasts to this biological process. In light of our findings, targeting
the expression and/or function of Spry2 in cancer cells may enhance their

responsiveness to chemotherapeutic treatments.

199

Material and Methods

Cells and Cell Culture.

The derivation of the human fibroblast cell line MSU-1.1 has been described [65,
66]. The PH3MT cell strain was derived from tumors formed in athymic mice by
the injection of MSU-1.1 cells malignantly transformed by an overexpressed
HRas oncogene [65]. The cells were cultured in Eagle’s MEM, supplemented
with L-aspartic acid (0.2 mmol), L-serine (0.2 mmol), pyruvate (1 mmol) and 10%
supplemented calf serum (Hyclone, Logan, UT), penicillin (100 units/mL), and
streptomycin (100 pg/mL, culture medium) at 37°C in a humidified incubator with

5% C02.

Apoptosis assay

Apoptosis was detected by staining the cells with AnnexinV-FITC (BD
Biosciences, San Jose, CA) according to manufacturer’s recommendations.
Briefly, cells were plated at a density of 200,000 cells per 60 mm-dish. Sixteen
hours later, the cells were irradiated with UV at a dose of 30-60 Jlm2 and
incubated at 370 under normal growing conditions for varying time periods.
Subsequently, the cells were collected, washed twice with AnnexinV binding
buffer and incubated with AnnexinV-FITC at room temperature for 15 min. The
cells were also stained with propidium iodide (PI) to distinguish between live and
dead cells. AnnexinV-FITC positive cells were determined by flow cytometry

under standard conditions. Only the cells that stained positive for AnnexinV, and

200

not those that were positive for both annexinV and PI, were considered apoptotic.

All experiments were repeated at least three times.

Western blotting

Whole cell lysates were prepared as described [67]. The protein content was
quantified with Coomasie protein reagent from Pierce (Rockford, IL). Whole cell
lysate (50 pg) was separated by SDS-PAGE. The protein was transferred to
polyvinylidene fluoride membrane (Millipore, Billerca, MA), and immunoblotting
was carried out using standard techniques. The signal was detected with the
Super Signal reagent (Pierce, Rockford, IL). Antibodies against pp85, p85, c-Cbl,
Mdm2, p53 and H-Ras were purchased form Santa Cruz (Santa Cruz, CA); Spry2
from Calbiochem (San Diego, CA); pAkt and Akt from Cell Signaling (Danver,
MA) and Ku80 from Serotec (Raleigh, NC). Ku80 protein expression was used as

a loading control.

Rac1 activation

Whole cell lysates (2 mg) were pulled down with PAK-Cdc42/Rac1 interacting
region (CRIB)—conjugated beads from Cytoskeleton (Denver, CO) according to
the manufacturer’s instructions. The pulled down fractions were immunoblotted
with a Rac1 specific antibody to determine the level of active H-Ras. this
experiemtn was repreated three times in HRas-transforemd cells and twice in

immortalized fibroblasts.

201

Staining for stress fibers

Stress fibers were detected with Alexa-fluor 488 conjugated Phalloidin stain from
Invitrogen (Carlsbad, CA) according to the manufacturer’s instructions. Briefly,
cells at log phase growth were fixed in 10% normal buffered formalin solution, for
10 min., they were washed twice in phosphate buffered saline (PBS), and then
they were treated with 0.1 Triton X-100 in PBS for 3-5 min. at room temperature.
Subsequently, the cells were incubated with blocking solution (1% BSA in PBS)
for 20 min. at room temperature. Finally, the cells were incubated with Phalloidin

stain for 30 min. and analyzed by fluorescent microscopy.

lmmunoprecipitation Reactions.

Briefly, whole cell lysates (250-500 pg) were precleared with an appropriate lgG
anbtibody for 30 min., and then incubated with an antibody specific to HRas for 2
hrs, followed by incubation with protein-G for 1hr. to overnight at 4°. In the case
when a HRas agarose conjugate was used, the lysates were incubated with the
agarose conjugate 3 hrs to overnight. The immunoprecipitated fraction was
washed several times with lysis buffer and assayed by Western blotting. This

experiment was repeated three times.

202

References

10.

11.

12.

13.

Coleman, M.L., C.J. Marshall, and M.F. Olson, RAS and RHO GTPases in
G1-phase cell-cycle regulation. Nat Rev Mol Cell Biol, 2004. 5(5): p. 355-
66.

Downward, J., Targeting RAS signalling pathways in cancer therapy. Nat
Rev Cancer, 2003. 3(1): p. 11-22.

Campbell, S.L., et al., Increasing complexity of Ras signaling. Oncogene,
1998. 17(11 Reviews): p. 1395-413.

805, J.L., ras oncogenes in human cancer: a review. Cancer Res, 1989.
49(17): p. 4682-9.

Bollag, G. and F. McCormick, Regulators and effectors of ras proteins.
Annu Rev Cell Biol, 1991. 7: p. 601—32.

Khosravi-Far, R., et al., Oncogenic Ras activation of Raf/mitogen-
activated protein kinase-independent pathways is sufficient to cause
tumorigenic transformation. Mol Cell Biol, 1996. 16(7): p. 3923-33.

Rangarajan, A., et al., Species- and cell type-specific requirements for
cellular transformation. Cancer Cell, 2004. 6(2): p. 171-83.

Carpenter, CL. and LC. Cantley, Phosphoinositide 3-kinase and the
regulation of cell growth. Biochim Biophys Acta, 1996. 1288(1): p. M11-6.

Franke, T.F., D.R. Kaplan, and LC. Cantley, Pl3K: downstream AKTion
blocks apoptosis. Cell, 1997. 88(4): p. 435-7.

Okkenhaug, K. and B. Vanhaesebroeck, New responsibilities for the Pl3K
regulatory subunit p85 alpha. Sci STKE, 2001. 2001(65): p. PE1.

Otsu, M., et al., Characterization of two 85 kd proteins that associate with
receptor tyrosine kinases, middle- T/pp600-src complexes, and Pl3-kinase.
Cell, 1991. 65(1): p. 91-104.

Rodriguez-Viciana, P., et al., Activation of phosphoinositide 3-kinase by
interaction with Ras and by point mutation. Embo J, 1996. 15(10): p. 2442-
51.

Alessi, D.R., et al., Mechanism of activation of protein kinase B by insulin
and lGF-1. Embo J, 1996. 15(23): p. 6541-51.

203

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

Datta, S.R., A. Brunet, and ME. Greenberg, Cellular survival: a play in
three Akts. Genes Dev, 1999. 13(22): p. 2905-27.

Datta, S.R., et al., Akt phosphorylation of BAD couples survival signals to
the cell-intrinsic death machinery. Cell, 1997. 91(2): p. 231-41.

Kane, L.P., et al., Induction of NF-kappaB by the Akt/PKB kinase. Curr
Biol, 1999. 9(11): p. 601-4.

Mayo, L.D. and DB. Donner, A phosphatidylinositol 3-kinase/Akt pathway
promotes translocation of Mdm2 from the cytoplasm to the nucleus. Proc
Natl Acad Sci U S A, 2001. 98(20): p. 11598-603.

Qiu, R.G., et al., An essential role for Rac in Ras transformation. Nature,
1995. 374(6521): p. 457-9.

Lambert, J.M., et al., Tiam1 mediates Ras activation of Rac by a Pl(3)K-
independent mechanism. Nat Cell Biol, 2002. 4(8): p. 621-5.

Welch, H.C., et al., Phosphoinositide 3-kinase-dependent activation of
Rac. FEBS Lett, 2003. 546(1): p. 93-7.

Burridge, K. and K. Wennerberg, Rho and Rac take center stage. Cell,
2004. 116(2): p. 167-79.

Perona, R., et al., Activation of the nuclear factor-kappaB by Rho, 00042,
and Rac-1 proteins. Genes Dev, 1997. 11(4): p. 463-75.

Mayr, M., et al., Mechanical stress-induced DNA damage and rac-
p38MAPK signal pathways mediate p53-dependent apoptosis in vascular
smooth muscle cells. Faseb J, 2002. 16(11): p. 1423-5.

Eom, Y.W., et al., Implication of the small GTPase Rac1 in the apoptosis
induced by UV in Rat-2 fibroblasts. Biochem Biophys Res Commun, 2001.
285(3): p. 825-9.

Sulciner, D.J., et al., rac1 regulates a cytokine-stimulated, redox-
dependent pathway necessary for NF-kappaB activation. Mol Cell Biol,
1996. 16(12): p. 7115-21.

Hicks, G.G., et al., Mutant p53 tumor suppressor alleles release ras-
induced cell cycle growth arrest. Mol Cell Biol, 1991. 11(3): p. 1344-52.

Marx, J., New link found between p53 and DNA repair. Science, 1994.
266(5189): p. 1321-2.

Shaw, P., et al., Induction of apoptosis by wild-type p53 in a human colon
tumor-derived cell line. Proc Natl Acad Sci U S A, 1992. 89(10): p. 4495-9.

204

29.

30.

31.

32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

42.

Midgley, CA. and DP. Lane, p53 protein stability in tumour cells is not
determined by mutation but is dependent on Mdm2 binding. Oncogene,
1997. 15(10): p. 1179-89.

Vousden, K.H. and X. Lu, Live or let die: the cell's response to p53. Nat
Rev Cancer, 2002. 2(8): p. 594-604.

Xiong, Y., et al., p21 is a universal inhibitor of cyclin kinases. Nature,
1993. 366(6456): p. 701-4.

el-Deiry, W.S., et al., WAF1/CIP1 is induced in p53-mediated G1 arrest
and apoptosis. Cancer Res, 1994. 54(5): p. 1169-74.

Casci, T., J. Vinos, and M. Freeman, Sprouty, an intracellular inhibitor of
Ras signaling. Cell, 1999. 96(5): p. 655-65.

Reich, A., A. Sapir, and B. Shilo, Sprouty is a general inhibitor of receptor
tyrosine kinase signaling. Development, 1999. 126(18): p. 4139-47.

Hacohen, N., et al., sprouty encodes a novel antagonist of FGF signaling
that patterns apical branching of the Drosophila airways. Cell, 1998. 92(2):
p. 253-63.

Kim, H.J. and D. Bar-Sagi, Modulation of signalling by Sprouty: a
developing story. Nat Rev Mol Cell Biol, 2004. 5(6): p. 441 -50.

Guy, G.R., et al., Sprouty: how does the branch manager work? J Cell Sci,
2003. 116(Pt 15): p. 3061-8.

Christofori, G., Split personalities: the agonistic antagonist Sprouty. Nat
Cell Biol, 2003. 5(5): p. 377-9.

Egan, J.E., et al., The bimodal regulation of epidermal growth factor
signaling by human Sprouty proteins. Proc Natl Acad Sci U S A, 2002.
99(9): p. 6041-6.

Rubin, C., et al., Sprouty fine-tunes EGF signaling through interlinked
positive and negative feedback loops. Curr Biol, 2003. 13(4): p. 297-307.

Wong, E.S., et al., Sprouty2 attenuates epidermal grth factor receptor
ubiquity/ation and endocytosis, and consequently enhances Ras/ERK
signalling. Embo J, 2002. 21(18): p. 4796-808.

Wong, E.S., et al., Evidence for direct interaction between Sprouty and
Cbl. J Biol Chem, 2001. 276(8): p. 5866-75.

205

43.

44.

45.

46.

47.

48.

49.

50.

51.

52.

53.

54.

55.

Thien, CB. and W.Y. Langdon, Cbl: many adaptations to regulate protein
tyrosine kinases. Nature reviews, Molecular cell biology, 2001. 2((4)): p.
294-307.

Haglund, K., et al., Sprouty2 acts at the Cbl/CIN85 interface to inhibit
epidermal growth factor receptor downregulation. EMBO Rep, 2005. 6(7):
p. 635-41.

Ries, 8., et al., Opposing effects of Ras on p53: transcriptional activation
of mdm2 and induction ofp19ARF. Cell, 2000. 103(2): p. 321 -30.

Franke, T.F., et al., Pl3K/Akt and apoptosis: size matters. Oncogene,
2003. 22(56): p. 8983-98.

Murga, C., et al., Rac1 and RhoG promote cell survival by the activation of
PI3K and Akt, independently of their ability to stimulate JNK and NF-
kappaB. Oncogene, 2002. 21(2): p. 207-16.

Miller, W.E., H.S. Earp, and N. Raab-Traub, The Epstein-Barr virus latent
membrane protein 1 induces expression of the epidermal growth factor
receptor. J Virol, 1995. 69(7): p. 4390-8.

Okano, J., et al., Akt/protein kinase B isoforms are differentially regulated
by epidermal growth factor stimulation. J Biol Chem, 2000. 275(40): p.
30934-42.

Sithanandam, G., et al., Alternate paths from epidermal growth factor
receptor to Akt in malignant versus nontransformed lung epithelial cells:
ErbB3 versus Gab1. Am J Respir Cell Mol Biol, 2005. 33(5): p. 490-9.

Stein, RC. and MD. Waterfield, PI3-kinase inhibition: a target for drug
development? Mol Med Today, 2000. 6(9): p. 347-57.

Wang, H.Q., et al., Epidermal growth factor receptor-dependent, NF-
kappaB-independent activation of the phosphatidylinositol 3-kinase/Akt
pathway inhibits ultraviolet irradiation-induced caspases-3, -8, and -9 in
human keratinocytes. J Biol Chem, 2003. 278(46): p. 45737-45.

Chen, X. and MD. Resh, Activation of mitogen-activated protein kinase by
membrane-targeted Raf chimeras is independent of raft localization. J Biol
Chem, 2001. 276(37): p. 34617-23.

Pleiman, C.M., W.M. Hertz, and JC Cambier, Activation of
phosphatidylinositol-3' kinase by Src-family kinase SH3 binding to the p85
subunit. Science, 1994. 263(5153): p. 1609-12.

Tiganis, T., B.E. Kemp, and MK. Tonks, The protein-tyrosine phosphatase
TCPTP regulates epidermal growth factor receptor-mediated and

206

56.

57.

58.

59.

60.

61.

62.

63.

64.

65.

66.

67.

phosphatidylinositol 3-kinase-dependent signaling. J Biol Chem, 1999.
274(39): p. 27768-75.

Lakin, ND. and SP. Jackson, Regulation of p53 in response to DNA
damage. Oncogene, 1999. 18(53): p. 7644-55.

Ogawara, Y., et al., Akt enhances Mdm2-mediated ubiquitination and
degradation of p53. J Biol Chem, 2002. 277(24): p. 21843-50.

Cox, AD. and OJ. Der, The dark side of Ras: regulation of apoptosis.
Oncogene, 2003. 22(56): p. 8999-9006.

Kauffmann-Zeh, A., et al., Suppression of c-Myc-induced apoptosis by
Ras signalling through Pl(3)K and PKB. Nature, 1997. 385(6616): p. 544-
8.

Zhou, B.P., et al., HER-2/neu induces p53 ubiquitination via Akt-mediated
MDM2 phosphorylation. Nat Cell Biol, 2001. 3(11): p. 973-82.

Poppleton, H.M., et al., Sprouty regulates cell migration by inhibiting the
activation of Rac1 GTPase. Biochem Biophys Res Commun, 2004.
323(1): p. 98-103.

Saniger, M.L., et al., c-Jun kinase mediates expression of VEGF induced
at transcriptional level by Rac1 and Cdc42Hs but not by RhoA. J Cell
Biochem, 2006.

Xue, Y., et al., Inhibition of endothelial cell proliferation by targeting Rac1
GTPase with small interference RNA in tumor cells. Biochem Biophys Res
Commun, 2004. 320(4): p. 1309-1315.

Han, 0., et al., Rac1-MKK3-p38—MAPKAPK2 pathway promotes urokinase
plasminogen activator mRNA stability in invasive breast cancer cells. J
Biol Chem, 2002. 277(50): p. 48379-85.

Hurlin, P.J., V.M. Maher, and J.J. McCormick, Malignant transformation of
human fibroblasts caused by expression of a transfected T24 HRAS
oncogene. Proceedings of the National Academy of Sciences of the
United States of America, 1989. 86((1)): p. 187-91.

Morgan, T.L., et al., Characteristics of an infinite life span diploid human
fibroblast cell strain and a near-diploid strain arising from a clone of cells
expressing a transfected v-myc oncogene. Experimental cell research,
1991. 197((1)): p. 125-36.

Lou, 2., et al., Down-regulation of overexpressed sp1 protein in human

fibrosarcoma cell lines inhibits tumor formation. Cancer research, 2005.
65((3)): p. 1007-17.

207

Appendix A: Analysis of expressional changes between

MSU-1.0, MSU-1.1 and PH3MT cells

Piro Lito, Suzana Kleff, Veronica M. Maher and J. Justin McCormick
Carcinogenesis Laboratory, Department of Microbiology & Molecular Genetics

and Department of Biochemistry & Molecular Biology. Michigan State University,

East Lansing, Michigan 48824-1302, U. SA.

208

Introduction

Carcinogenesis is now recognized as a multistep process during which cells
acquire neoplastic characteristics through a series of genetic and/or epigenetic
changes. Initially, such changes confer to a normal cell some advantage, leading
to its clonal expansion and the emergence of a new population of progeny cells
with a more malignant status. By means of the reiteration of this pattern, a single

cell can emerge that has acquired all of the changes requiredto form a cancer.

In order to study the process of carcinogenesis in fibroblastic malignancies,
McCormick and colleagues established the human fibroblast MSU-1 cell lineage
as a model system [1-3]. This system is comprised of cell strains with either
normal, intermediate pre-malignant, or malignant phenotypes. Given that all of
these cell strains originate from the same normal parental fibroblastic cell line,
this model system provides a fertile ground for the investigation of the genetic

changes that convert normal cells into cancer cells.

To develop this system, normal human skin fibroblasts (LG1) were transfected
with the v-Myc oncogene. A clonal population of cells expressing v-Myc was
propagated in culture, and after several months the cells became senescent.
Nonetheless, a small number of cells developed an endogenous mechanism to
evade senescence, and continued to divide, giving rise to a new cell strain named
MSU-1.0. MSU-1.0, just like its parental strain, expresses the v-Myc oncogene, is

diploid, and is karyotypically stable [2]. In addition, the MSU-1.0 cells

209

endogenously expresses the telomerase gene, expression of which has been

reported to immortalize cells [4].

As the MSU-1.0 cells were grown continuously in culture to determine whether
they had infinite life spans, a variant clonal derivative arose spontaneously. This
cell strain, named MSU-1.1, is chromosomally stable, nearly diploid and also
expresses the v-Myc oncogene, which was integrated in the same chromosomal
site as it was in the parental MSU-1.0 cells. However, MSU-1.1 cells contain two
marker chromosomes that distinguish them from their progenitors. These marker
chromosomes were formed from a fusion between the q arm of chromosome 1
and chromosome 11 (Marker 1), and a fusion between the p arm of chromosome

15 and the q arm of chromosome 12 (Marker 2) [2].

The MSU-1.1 cell strain has a more rapid growth rate compared to its precursor.
Also, it is partially growth factor independent, and can grow better in media

containing reduced Ca2+ concentrations in comparison to the MSU 1.0 cell strain

[5].

The growth characteristics of MSU-1.1 cells suggested that they might be able to
be transformed into malignant cells. Indeed, when MSU-1.1 cells were
transfected with the HRas oncogene, they were able to form tumors in athymic
mice with a latency of only few weeks [3]. The cells derived from these tumors

(PH3MT) had the same chromosomal structure as MSU-1.1 cells, including the

210

two marker chromosomes. In addition, MSU-1.1 cells have been malignantly
transformed by ionizing radiation [6, 7] or by chemical carcinogen treatment [8], to
form tumors in athymic mice. Interestingly, MSU-1.0 cells have never been
malignantly transformed into tumor cells, regardless of many attempts, similar to

those used to transform MSU-1.1 cells.

In this study, we used the MSU-1 lineage of human fibroblasts as a model system
to identify novel genes that are involved in fibrosarcomas. To accomplish this
goal, we relied on the Affymetrix Gene Chip technology, and performed a
comparative analysis of the expression profiles of MSU-1.0, MSU-1.1 and PH3MT

cells.

When we focused our attention on the significant gene changes, we found that 62
genes were up regulated, while 45 genes were down regulated in MSU-1.1 cells,
compared to MSU-1.0 cells. These genes retained their type of change in the
tumorigenic PH3MT cells. The changes for several of these genes were validated
using Northern blotting. From the pool of genes with elevated expression in MSU-
1.1 and PH3MT cells (i.e genes that could act as oncogenes), we selected
Sprouty-2 (Spry2) for further analysis. Fibulin-5 (Fib5), which belonged to the
group of genes with down regulated expression in MSU-1.1 and PH3MT cells (i.e.
genes that could acts as tumor suppressors), was also selected for further
studies. The products of these two genes will be analyzed to determine if they act

as oncogenes or as tumor suppressor genes.

211

Results

Comparison of the RNA expression profiles of MSU 1.0, MSU 1.1 and

PH3MT cells

The expression profiles of MSU-1.1 and PH3MT cells were each compared to
that of MSU-1.0 cells. The fold-changes reported for each gene represent those
comparisons. Although in this study we placed an emphasis on the difference
between MSU-1.0 and MSU-1.1 cells, both the MSU-1.1 vs. MSU-1.0 and the
PH3MT vs. MSU-1.0 comparisons were used to determine important genes. The
reason for this choice was our assumption that, if the change in expression for a
particular gene in MSU-1.1 cells, is retained, at a similar or a more pronounced
level, in PH3MT cells, then that gene would be more likely to play a causal role in
cancer formation. The comparison between MSU-1.1 and MSU-1.0 cells yielded
108 genes with a 3-fold or more change between these two cell lines.
Interestingly, all but one gene retained at least a 2-fold change when PH3MT
cells were compared to MSU-1.0 cells. These genes exhibited fold-changes at the
95% confidence interval. Of the differentially expressed genes, 62 were up
regulated, and 45 were down regulated in MSU-1.1 and PH3MT cells, with

respect to MSU-1.0 cells. To determine which of these genes exhibit similar

212

Figure 1. Gene chip comparison of MSU1.1 and PH3MT cells to MSU-1.0 cells.
Hierarchical clustering of the statistically significant gene changes (107 genes). Genes
with an elevated expression levels in MSU-1.1 and PH3MT cells, compared to MSU-1.1
cells are shown in (A), whereas genes with a decreased expression level in MSU-1.1
and PH3MT cells compared to MSU-1.1 are shown in (8). Abbreviations: 1.0: MSU-1.0,
1.1: MSU-1.1, 3MT: PH3MT. To obtain the full name of the gene from the abbreviation or

the accession numbers used here refer to the table that follows and/or consult

Affymetrixcom.

213

.3>
1.0
1.1/1.0
PH3MT/1 0

 

1611313'3

of £33.31

U37139
88203476
086978
L25931
88014458
X64229
8L080146
88019987
88004770
U96131
026361
8F011468
U97067
Y00971
8L050353
L07493
014657
L07541
8F067656
X54942
U65410
”87339
080008
8F053641
U14518
8F025441
017517
88926959
L25876
X56597
"68520
8J236876
X51688
038551
U30872
8F017790
L19183
084557
080000
L47276
J04031
88024704
8F047473
U94319
031885
"15796
X62534
8F047472
M31303
X51688
028423
X01060
"30448
8F039656
HT3165
K02581
J04988
013748
X57351
X02308
8F039843

Figure 1

 

 

 

 

 

 

 

 

 

 

 

 

 

6 .032

214

01064

6.095

1 1/1 0
FIGHT/1.0

°.
r1

 

 

 

 

 

 

 

 

 

 

 

 

Figure 1 (Cont’)

215

patterns of change, we used the EPCLUSTER software1 to perform hierarchical,

as well as K- means clustering of these genes. (Fig. 1 and 2).

Differentially expressed genes were grouped together according to their
functional characteristics (Table I). This was done in order to obtain a global view
of the genotypic changes that take place as cell stains in the MSU-1 lineage
became malignantly transformed. For a broader picture, some genes with
marginal (less than 3-fold) changes between MSU 1.1 and MSU-1.0 cells were
also included. The examination of these groups revealed some noteworthy traits.
First, all of the genes that encode transcription factors or chromatin remodeling
enzymes were up regulated in MSU-1.1 and PH3MT cells. Second, the type of
change for the majority of the genes involved in cell cycle control supports a
faster G1-S transition, and therefore a faster growth rate in the MSU-1.1 and
PH3MT cell strains. This is consistent with prior studies that report the MSU-1.0
cell strain having a slovVer growth rate compared to the cell strains derived from it.
Third, the majority of the genes encoding extracellular matrix (ECM) proteins, or
proteins involved in cell adhesion and motility, were found to be down regulated in
MSU-1.1 and PH3MT cells. Finally, genes involved in calcium signaling, or genes
with calcium-binding domains, were down regulated in MSU-1.1 and PH3MT

cells.

 

‘ This is available for use at the European Bioinformatics lnstitute’s web site:
http:/lep.ebi.ac.uk/EP/

216

Figure 2. K-means clustering of the differentially expressed genes. The y-axis
represents the logarithmic fold-change in gene expression from the MSU-1.1 vs. MSU-
1.0 comparison (first point of discontinuity), and the PH3MT vs. MSU-1.0 comparison
(second point of discontinuity). Each line in the graphs represents a gene. Red indicates
an increase, while green indicates a decrease in gene expression compared to MSU-1.0

cells. Each graph shows genes with similar patterns of change.

217

N 0.59...

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

:15
‘15 11:1].

he 1" L.

89.86 2 86- Sufi: 2 86- 828 8963.2 86-
6m... . 8..- .9 8...- 8..-
. ammmhz_ .
Mom”. . OO.HI 04>: . 8..“l XND : S.HI
Duo 6 238: $02:
8%“ 25.23 2356
. 2... . 8.5 .
<28 II\ 8 a :4on82. . 8 6 Km: \ 8 6
FIND; . 8.N Uw.~zm._.200 . 8.N Nm 230>0 oo.N
.wpzmezoo . 2 . 6228
.. 8 6 . 8 6 6.23200 86
39.83 .. 861 anon? . 861 «~03? . 86..
. E . - 3.8 .
i . 8 T wmpm . 8 N 82528 8 ~1
. 86- 3 . 86- .05. 22 . .
Nfiflm 2m“. 82.2 8 a
obs: ~<z_%mw flap.
230. . 86 I \ r 86 a .. 86
92828 23.2“ 5 2:96
86 n: . 86 EB 86
2 “2.2m..— 200 ”we 25.200 2
.. 86 .. 86 2. 86
«9.5». 8.9. mug? . 8.01 “"0262 861
. 86.- .. .. 86- . 86-
. 8.? 5m .. 86.. \/ 2. 86-
SE 5m flew.
”2.2m... 200 . to; .60 . Uwbzmhzoo
2. 8 H ”mhzwhsnu . 8 H . 8.."
I1 . 86 . 86 86
2 86 . 86 .86
PH. .8“ ”AM
m m

218

 

Other investigators have shown that some of the genes reported here are
important for cancer formation. Genes like p21 and tsp12, whose protein levels
were indeed down regulated in MSU-1.1 and PH3MT cells (data not shown), are
known tumor suppressor genes. Similarly, axl and tyro are both members of a
novel family of receptor tyrosine kinases (RTK) that can transform fibroblasts
when expressed [9, 10]. The genes for tfr, and sema3C have also been reported
to be up regulated in different types of cancer, while igfbp3 has been reported to
be decreased in cancer cells [11]. To some extent, these findings validate the
integrity of our gene chip data, and the effectiveness of the MSU-1 lineage of

cells as a model system to study the formation of fibroblastic tumors.

Northern blot analysis and confirmation of the gene chip data

We began the validation of the gene chip data by focusing on genes that were
functionally related to the phenotypic characteristics of the MSU-1.1 cells, which
differentiate them from MSU-1.0 cells. Characteristics such as the faster growth
rate of MSU-1.1 cells, as well as their ability to grow in media with reduced
calcium, prompted us into assigning a high priority for analysis to genes involved
in growth factor signaling pathways (e.g. spry2, axl, tk1, igfbp3 etc.) and/or exhibit
their functions in a calcium dependent manner (e.g. s.jag1, fib5 etc.). Based on
the fact that MSU 1.1 and PH3MT cells contain two marker chromosomes, we

also wanted to focus on genes that are located in the chromosomal regions that

 

2 Abbreviations: tsp1: thrombospondin-1, tfr: transferrin receptor, sema3C: semaphorin-3C,
igfbp3: insulin like growth factor-3, spry2: sprouty-2, tk1: thymidine kinase, s.jag1: soluble jagged-
1, fib5: fibulin-5, lox: lysyl oxidase.

219

TABLE I. Grouping of differentially expressed genes according to their function

 

 

 

 

 

 

 

Gene name Acc# Fold change Description‘

1.1/1.0 3MT/1.0
Apoptosis
Bcl1 M73554 -5.3 -6.5 pro apoptotic
CDK inhibitor 1A (p21, Cip1) U03106 -3.3 -5.1 regulates CDK:cyclin association
Serine proteinase inhibitor 82 Y00630 -3.2 -2.3
Immediate early response 3 881914 -3.2 -1.3 involved in TNF induced apoptosis
Caspase 8 X98172 2.3 3.1 protease
ADP-ribosyltransferase-like 2 AJ236876 3.1 3.3 protein ADP-ribosylation; DNA repair
catenin alpha-like 1 U97067 3.6 4.7
Chromosome segregation 1-like AF053641 3.7 4.1 involved in TNF induced apoptosis
Gene expression and chromatin control
high-mobility group box 2 X62534 5.2 4.4 transcriptional activator
[I3 endonexin U37139 4.0 5.9 coactivator for nuclear receptors
DEK oncogene X64229 3.9 4.6 changes DNA topology
v-myb -like 1 X66087 3.3 1.4 transcriptional activator
pituitary tumor-transforming 1 AA203476 3.0 4.6 inibits p53 transcriptional activity
TRIP13 U96131 2.9 3.2 thyroid hormone receptorsignaling
high mobility group AT-hook 1 (HMGA1) L17131 2.7 5.0 enhanceosome assembly
Cell Cycle control
PRAD M73554 -5.3 -6.5 G1/S transition,
CDK inhibitor 1A (p21, Cip1) U03106 -3.3 -5.1 G1IS transition,
CDK 2 M68520 2.9 2.7 G2/M transition
BUB3 AF047472 3.0 2.7 mitotic checkpoint
cyclin A2 X51688 3.1 2.8 G1IS and GZ/M progression
Mitotic arrest deficient-like 1 U65410 3.3 3.5 mitotic checkpoint
CDC28 protein kinase 2 X54942 3.3 3.6 regulation of CDK activity
cyclin 82 AL080146 3.7 4.3 mitosis
PCNA M15796 4.3 3.4 DNA binding
CDK inhibitor 3 L25876 4.6 4.5 G1/S transition, cell cycle arrest
MCM6 D84557 4.3 3.7 DNA replication liscencing factor
Transmembrane proteins
Lamin 8 receptor L25931 3.1 4.5 Iamin and chromatin binding
AXL receptor tyrosine kinase M76125 3.2 2.3 RTK
TYR03 protein tyrosine kinase 017517 3.4 3.6 RTK
Transferrin receptor (p90, CD71) X01060 3.6 2.7 binds transferrin; iron transport
Protein Degradation
Cathepsin K (pycnodysostosis) X82153 3.0 cysteine-type peptidase
Ubiquitin specific protease 1 ABO14458 4.9 5.7 cysteine-type protease

220

TABLE I. Grouping of differentially expressed genes according to their function (Cont’)

 

 

 

 

 

Gene name Acc# Fold change Description"

1.1/1.0 3MTI1.0
Extracellular Matrix and Cytoskeleton
Collagen, type IV, alpha 1 M26576 -8.4 -29.4 binds integrins
Insulin-like growth factor binding protein 3 M35878 -7.4 -14.7 binds IGF
Collagen, type XI, alpha 1 J04177 -6.2 -107.6 binds integrins
Collagen, type IV, alpha 2 X05610 -6.1 -9.0 binds integrins
Thrombospondin 1 X14787 -4.2 -7.7 interacts with ECM; integrin ligand
Fibronectin 1 X02761 -3.8 -22.9 binds integrins, collagen
Integrin, alpha 1 X68742 -3.6 -7.1 collagen receptor
TGF [t-induced, 68kDa M77349 -3.6 -1.6 ligand for integrin receptor
Lysyl oxidase L16895 -3.4 -30.5 collagen crosslinking enzyme
Serine proteinase inhibitor 82 Y00630 -3.2 -2.3 inhibits plasminogen activators
Lumican U21128 -3.2 -32.0 interacts with collagen
Fibulin 5 AF093118 -3.0 -38.1 interacts with integrins
Semaphorin 3C A8000220 2.6 ligand for plexin receptor
lntegrin [5 3 binding protein U37139 4.0 5.9
Ca2+ Signaling and Ca2+ Binding Proteins
Jagged 1. soluble U77914 -5.7 -3.4
Thrombospondin 1 X14787 -4.2 -7.7
Myosin light polypeptide kinase U48959 -3.5 -6.1 binds calcium-calmodulin
Myosin, light polypeptide 9, regulatory J02854 -3.6 -13.9
Fibulin 5 AF093118 -3.0 -38.1
Signal Transduction
Insulin-like growth factor binding protein 3 M35878 -7.4 -14.7 comlexes with IGF1 and IGF2
TGF B-induced, 68kDa M77349 -3.6 -1.6
Myosin light polypeptide kinase U48959 -3.5 -6.1 phosphorylates myosin light chain
CDK inhibitor 1A (p21, Cip1) U03106 -3.3 -5.1
Fibulin 5 AF093118 -3.0 -38.1
Guanylate kinase 1 L76200 -2.8 -2.5 phosphorylates GMP
Sprouty 2 AF039843 2.0 5.9 interacts with Cbl2, Grb2
MAPKAP3 U09578 2.6 5.4 activatesCREB
Thymidine kinase , soluble K02581 2.8 2.2 phosphorylates thymidine
CDK2 M68520 2.9 2.7 binds cyclins
Casein kinase 28 M30448 3.1 2.5 phosphorylates p53; binds AP2
AXL receptor tyrosine kinase M76125 3.2 2.3 RTK; binds GA86
TYR03 protein tyrosine kinase D17517 3.4 3.6 RTK; binds PROSI
Transferrin receptor (p90, CD71) X01060 3.6 2.7 binds transferrin; iron transport
CSE1 chromosome segregation 1-like AF053641 3.7 4.1 importin alpha export receptor
Serine/threonine kinase 6 AF011468 4.5 6.4
CDK inhibitor 3 L25876 4.6 4.5

Abbreviations: Acc#: accession number, 1.0: MSU-1.0, 1.1: MSU1.1, 3MT: PH3MT

(') Although some of these genes may have more that one function,

only the function which relates to the group that they are part of is indicated here

221

were involved in the formation of the marker chromosomes (e.g. lox, tsp1 etc.).
Finally, genes with high fold-changes in expression (e.g. hmg2, zwint, etc.) were

considered to be important as well.

One will notice that sprouty-2 (spry2), a gene that we assigned with a high priority
for analysis, exhibits only a two-fold change between MSU-1.1 and MSU-1.0
cells. The reason for this assignment was the fact that the gene chip data was
initially analyzed with older software (MAS4.0, from Affymetrix). According to that
analysis, spry2 exhibited a 3-fold change between MSU-1.1 and MSU-1.0 cells.
Recently, a new software (MAS5.0) has been developed that employs a different
analytical algorithm. When this software was used to reanalyze the data, we
found that the change in expression of spry2 between MSU-1.1 and MSU-1.0
cells was only 2-fold. The change in PH3MT cells was high in both analyses.

Regardless of this discrepancy, we still pursued the study of Spry2.

In subsequent analyses, which were performed to validate the gene chip data for
our genes of interest, we have also included several other malignant cell lines. Of
these, some have been generated from the transformation of MSU-1.1 cells either
by Ras-oncogene expression (PH2MT), by chemical carcinogen treatment
(6A/SB1) or by gamma irradiation (MW7.3 and MW16); or they are human

patient-derived fibrosarcoma cell lines (SHAC, HT1080, VleFT, NCI and 8387).

222

 

To date we have been able to confirm the gene chip data for spry2, lysyl oxidase
(on), fibulin-5 (fib5) and soluble jagged-1 (s.jag1) (Fig. 3). MSU-1.1 cells show
only a modest increase in the level of spry2. However, Ras-transformed
fibroblasts, as well as patient-derived fibrosarcoma cells, express pronounced
levels of this transcript. In an independent study, dominant negative Cdc42 and
Rac1 were expressed into PH3MTcausing a significant decrease in the
tumorigenicity of those cells. The spry2 level in those cells was down regulated
(Dao et al., unpublished results). This offers an additional clue that Spry2 might
have a role in the transformation of cells in the MSU-1 lineage. Since SHAC and
HT1080 fibroblasts both carry Ras-activating mutations, we also examined the
expression of spry2 in VleFT and 8387 fibroblasts, which do not carry such
mutations. The spry2 level in those cells was as elevated as that in SHAC and

HT1080 cells (data not shown).

The fib5 level in MSU-1.1 and PH3MT cells was down regulated, when compared
to MSU-1.0 cells, consistent with the gene chip data. Fibrosarcoma-derived cells,
regardless of whether they carried Res-activating mutations, had an undetectable
level of this transcript (Fig. 3 and data not shown). Carcinogen transformed cells,
however, showed elevated levels of this gene, which suggests that fib5 might

have a transformation-type specific role.

The analysis of lox expression showed a very similar profile to that of fib5,

consistent with the gene chip data and the fact that these two genes clustered

223

 

Figure 3. Northern blot analysis that validates the gene chip data for spry2, on, fib5 and

s.jag1. GAPDH was used as a loading control.

224

.mEoohmmoBE
82.3-2525“.

3.2.0.628...
-cemoEoEo

62:58:22.
.82....

one E...—

2.35.
”.522
me20
PENIm

 

._.s_m_._n_
v._.-:m_2
o. Tam—2
v0.—

 

U<Im .

 

 

 

r19 . fi spry2

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

‘Did .l ..d M GAPDH

 

 

 

 

m
1
9 P
5

1...
. I
u 5% ... . I
_ .......... C
. - i
I I
I
a
u u . Q. a...
. u . I

 

 

 

 

 

 

 

 

 

Figure 3

225

together functionally, as well as statistically. Finally, the down regulation of s.jag1
in MSU-1.1 and PH3MT cells was also confirmed. However, the level of s.jag1 in
SHAC and HT1080 fibroblasts was elevated compared to the malignant cells

derived from MSU-1.1 cells (Fig. 3).

Discussion

In this study we used a gene chip analysis to compare the expression profiles of
MSU-1.1 and PH3MT cells, to that of MSU-1.0 cells. The analysis of the gene
chip data revealed that 62 genes were significantly up regulated and 45 genes

were significantly down regulated, in MSU-1.1 and PH3MT cells.

Based on the phenotypic differences between the cell lines examined, we
selected several genes for further analysis by Northern blotting. Additional cells
lines, derived from different types of tumors, were used to determine if these
genes’ expression was altered during malignant transformation in general. This
showed that spry2 was up regulated in MSU-1.1 cells, in Ras- and carcinogen-
transfonned MSU-1.1-derivatives, as well as in human patient-derived
fibrosarcoma cells, when these cells were compared to the normal MSU-1.0 cells.
fib5, on and s.jag1 were down regulated in MSU-1.1 and PH3MT cells. Although,
fib5 and lox transcripts were decreased in patient-derived fibrosarcoma cells, they
were present in a substantial amount in carcinogen-transformed MSU-1.1 cells. In
contrast, while maintaining a reduced expression in carcinogen-transformed cells,

s.jag1 was up regulated in patient-derived fibrosarcoma cells.

226

As mentioned earlier, cancer usually arises from genetic changes that affect gene
expression or gene function. The gene chip analysis used in this study, cannot
assess the mutational status of genes in the cells under study. It can only
determine the expression level of a particular transcript. However, while genes
with oncogenic or tumor suppressive potential, may not show a change in
expression between normal and neoplastic phenotypes, they may have mutations
that alter their functions. With this in mind, we are aware of the possibility that
some of the genes excluded during the gene chip data analysis, might be
important in cancer. Nevertheless, we believe that the genes, which we found to
exhibit significant changes in expression, between the cells in our model system,
are strong candidates for a role in cancer. Indeed, a number of them have already

been reported to play a role in this disease.

In relation to these genes, we found that the majority of genes encoding for
extracellular matrix proteins were significantly down regulated in MSU-1.1 and
PH3MT cells, when these cells were compared to MSU-1.0 cells. In particular,
these genes encoded ligands of integrin receptors. Integrins have been shown to
regulate many cellular functions such as adhesion, motility, proliferation and
differentiation. Interestingly, the adhesiveness of MSU-1.0 cells to tissue culture
dishes is significantly higher that that of MSU—1 .1 and PH3MT cells. Additionally,
MSU-1.1 and particularly PH3MT cells, display a more rounded morphology
compared to their parental strain. These phenotypic changes could be a response

to the decreased expression of ECM ligands (e.g. fibronectin, collagen etc.) in

227

 

MSU-1.1 and PH3MT cells. These ligands serve as anchors of cells to their
stratum, as well as activators of many intracellular signaling molecules that are
responsible for the determination of cell shape and attachment (e.g. FAK3,

Cdc42, Rac1 and others) [12, 13].

Another observation regarding the gene chip data was that a number of genes
encode proteins involved in growth control, a finding that is consistent with the
differences in growth that have been observed between MSU-1.0, MSU-1.1 and

PH3MT cells.

To conclude this chapter we ought to say that some of the genetic differences
represented here are very likely to contribute to the phonotypical differences of
MSU-1.0, MSU-1.1 and PH3MT cells. Such genetic changes may also be
responsible for the ability of MSU-1.1 cells to be malignantly transformed by
HRas oncogene expression, whereas their precursors, MSU-1.0 cells, are unable

to be malignantly transformed by the same oncogene.

 

3 Abbreviation: FAK: focal adhesion kinase

228

 

Materials and Methods

Total RNA extraction

The total RNA extraction was performed with the RNA Bee reagent according to
the manufacturer’s instructions. The RNA, at all times, was extracted from cells

growing at a logarithmic rate (approximately 60% confluent).

Gene Chip Analysis

The RNA isolated from MSU-1.0, MSU-1.1 and PH3MT cells was subjected to a
reverse transcription reaction to produce double stranded cDNA. The first strand
synthesis was performed with the Superscript II RTase (Invitrogen), and an oligo-
dT primer, which also contained the core promoter region recognized by the T7
RNA polymerase (RNAP). The second strand synthesis was performed, as
recommended by Affymetrix, by using DNA polymerase I, RNaseH, and DNA
ligase. The double-stranded cDNA (containing the T7 RNAP promoter), was then
used as substrate in an in vitro transcription reaction, with T7 RNAP and biotin-
labeled nucleotides. The product of this reaction (biotin-labeled cRNA) was
fragmented into smaller fragments, which were subsequently used to hybridize a
U95 Human GeneChip®, purchased from Affymetix. The hybridized chip was
then washed, stained and scanned to determine the amount of transcripts present

in the cells under study.

229

 

The U95 GeneChip® contains 12625 probe sets, each of which recognizes a
specific transcript. A probe set is comprised of 32 probe cells, 16 that are called
perfect match cells (PM), and 16 that are called mismatch (MM) cells. Each of the
probe cells contains 25-mer oligonucleotides that are complementary to different
regions of the target. While PM cells contain oligonucleotides that perfectly
complement with the transcript, the MM cells contain a mutation on the 13th

nucleotide of the 25-mer oligonucleotide.

Data analysis

We first determined which transcripts were present in the cells examined. To this
end we analyzed each cell line independently, by using the detection algorithm of
Microarray Suite 5.0 (MAS 5.0). The presence of the transcript was determined
from the p-value and the detection call, which is a user-defined parameter that
was set at 0.04. Transcripts with detection p-values greater than 0.04, were

considered to be absent from the cells in study.

The next step in the data analysis was the determination of the signal intensity
(i.e. the relative abundance of a transcript). This was done by taking the sum of

the logarithm (logz) of the difference between PM and MM intensities.

Two independent gene chip experiments were performed for MSU-1.0 cells, while
MSU—1.1 and PH3MT cells were each examined three times. For each cell line,

each experimental repeat was individually analyzed as described.

230

In order to determine the changes in gene expression between two cell lines, we
relied on the change algorithm of MAS 5.0. Each MSU-1.1 experimental repeat
was compared to each of the MSU-1.0 experimental repeats. This produced six
comparisons between MSU-1.1 and MSU-1.0 cells (1.1 vs. 1.0). In each
comparison, the MSU-1.0 array was set to be the baseline. The signal log-ratio
(i.e. the change in gene expression) was determined by taking the logz of the ratio
of the signal intensity of a gene in the experimental array (which in this case
represents MSU-1.1 repeats) to the signal intensity of that gene in the baseline
array (MSU-1.0 repeats). The statistical significance of the change, was
calculated form the change p-value and the change call, a user defined
parameter that was set to 0.0025. In this study, we focused only on genes that
were increased or decreased within this statistical margin in all comparisons. To
determine the fold-change in expression for a particular transcript between MSU-
1.1 and MSU-1.0 cells, we averaged the signal Iogz ratios from the six
comparisons made between these two cells. The same method was followed to
determine the fold-change in the expression of a gene, between PH3MT and
MSU-1.0 cells (3MT vs. 1.0). Understandably, the logarithmic fold-change in
expression for a gene in MSU-1.0 cells was zero. In this study, only the gene
changes that were equal to, or greater than 3-fold in the 1.1 vs. 1.0 comparison,
and only the gene changes that were equal to, or greater than 2-fold in the 3MT

vs. 1.0 comparison, were considered to be significant

231

References

1. McCormick, J.J. and Maher, V.M., Analysis of the multistep process of
carcinogenesis using human fibroblasts. Risk Anal, 1994. 14(3): p. 257-
263.

2. Morgan, T.L., Yang, D.J., Fry, D.G., Hurlin, P.J., Kohler, S.K., Maher, V.M.
and McCormick, J.J., Characteristics of an infinite life span diploid human
fibroblast cell strain and a near-diploid strain arising from a clone of cells
expressing a transfected v-myc oncogene. Exp Cell Res, 1991. 197(1): p.
125-136.

3. Hurlin, P.J., Maher, V.M. and McCormick, J.J., Malignant transformation of
human fibroblasts caused by expression of a transfected T24 HRAS
oncogene. Proc Natl Acad Sci U S A, 1989. 86(1): p. 187-191.

4. Bodnar, A.G., Ouellette, M., Frolkis, M., Holt, S.E., Chiu, C.P., Morin, G.B.,
Harley, C.B., Shay, J.W., Lichtsteiner, S. and Wright, W.E., Extension of
life-span by introduction of telomerase into normal human cells. Science,
1998. 279(5349): p. 349-352.

5. Huang, 8., Maher, V.M. and McCormick, J.J., Extracellular Ca2+
stimulates the activation of mitogen-activated protein kinase and cell
growth in human fibroblasts. Biochem J, 1995. 310 (Pt 3): p. 881-885.

6. O'Reilly, 8., Walicka, M., Kohler, S.K., Dunstan, R., Maher, V.M. and
McCormick, J.J., Dose-dependent transformation of cells of human
fibroblast cell strain MSU-1.1 by cobalt-60 gamma radiation and
characterization of the transformed cells. Radiat Res, 1998. 150(5): p. 577-
584.

7. Reinhold, D.S., Walicka, M., Elkassaby, M., Milam, L.D., Kohler, S.K.,
Dunstan, R.W. and McCormick, J.J., Malignant transformation of human
fibroblasts by ionizing radiation. Int J Radiat Biol, 1996. 69(6): p. 707-715.

8. Zhang, H., Tsujimura, T., Bhattacharyya, N.P., Maher, V.M. and

McCormick, J.J., O6-methy/guanine induces intrachromosomal
homologous recombination in human cells. Carcinogenesis, 1996. 17(10):
p. 2229-2235.

9. Ito, M., Nakashima, M., Nakayama, T., Ohtsuru, A., Nagayama, Y.,
Takamura, N., Demedchik, E.P., Sekine, l. and Yamashita, 8., Expression

232

10.

11.

12.

13.

of receptor-type tyrosine kinase, Axl, and its ligand, Gas6, in pediatric
thyroid carcinomas around Chernobyl. Thyroid, 2002. 12(11): p. 971-975.

Lai, C., Gore, M. and Lemke, G., Structure, expression, and activity of Tyro
3, a neural adhesion-related receptor tyrosine kinase. Oncogene, 1994.
9(9): p. 2567-2578.

Trusolino, L. and Comoglio, P.M., Scatter-factor and semaphorin
receptors: cell signalling for invasive growth. Nat Rev Cancer, 2002. 2(4):
p. 289-300.

Hood, JD. and Cheresh, D.A., Role of integrins in cell invasion and
migration. Nat Rev Cancer, 2002. 2(2): p. 91-100.

Hynes, R.C., Integrins: bidirectional, allosteric signaling machines. Cell,
2002. 110(6): p. 673-687.

233

Appendix B: The role of Sprouty-2 in the malignant
phenotype of patient derived fibrosarcoma cell lines

Piro Lito, Bryan D. Mets, Veronica M. Maher and J. Justin McCormick'

Carcinogenesis Laboratory, Department of Microbiology & Molecular Genetics
and Department of Biochemistry & Molecular Biology. Michigan State University,

East Lansing, Michigan 48824-1302, U. S.A.

*Correspondence: J. Justin McCormick, Carcinogenesis Laboratory, Food Safety
and Toxicology Bldg., Michigan State University, East Lansing, MI 48824-1302,
USA; Ph: (517) 353-7785; Fax: (517) 353-9004.

E-mail address: mccormi1@msu.edu

Keywords: Sprouty; H-Ras oncogene; malignant transformation; epidermal

growth factor receptor

234

Introduction

As described in the previous chapters Spry2 is up regulated in HRas-transformed
cells and is necessary for the ability of these cells to form tumors in athymic mice.
In addition, we found that HRas interacts with Spry2 and c-Cbl suggesting a role

for HRas in the regulation of EGFR degradation by c-Cbl.

The expression of Spry proteins is deregulated in a number of human tumors. In
particular, Spry1 and Spry2 are down regulated in breast cancer and prostate
cancer. In the context of breast cancer, Spry2 functions to suppress tumor
formation, consistent with the inhibitory function of this protein in RTK signaling.
Interestingly, Spry2 is up regulated in melanomas containing NRasQ59 or BRafV599
mutations. The role that Spry2 plays in the malignancy of these tumors remains

unanswered.

In addition to being up regulated in cell strains derived by the transformation of

V12 and

immortalized human fibroblasts by the Ras oncogenes, (i.e. HRas
NRasV’Z), the expression of Spry2 is also increased in several fibrosarcoma cells
including, HT1080 which expresses oncogenic NRasQ59, and VIP:FT, which

expresses wild type Ras.

To determine the role of Spry2 in the malignant phenotype these cells, we
generated stable cell strains with down regulated Spry2 expression and analyzed

their ability to form tumors in athymic mice.

235

 

 

 

Results

The role of Spry2 in the malignant phenotype of patient derived

fibrosarcoma cell lines

We have previously found that Spry2 is necessary for the ability of HRas V12-
transfon'ned fibroblasts to form tumors in athymic mice suggesting that Spry2
promotes cancer formation. To determine if Spry2 has a broader role in cancer
formation we determined the role of Spry2 in HT1080 and VleFT cells, two
patient-derived fibrosarcoma cell lines expressing oncogenic NRasQS9, or wild
type Ras isoforms, respectively. We first determined if the presence of oncogenic
NRas in HT1080 cells corresponded to higher levels of active Ras in these cells
compared to normal fibroblasts. To this end HT1080 and VIPzFT cells were
analyzed with a Ras activation assay. Consistent with the status of R33
mutations, the HT1080 cell line contained higher levels of active Ras, compared

to both VleFT cells and normal fibroblasts (Fig. 1A).

To determine the role of Spry2 in the malignant phenotype of these cells, we
down regulated the expression of Spry2 in these cells by stably expressing a
vector encoding a Spry2-specific shRNA as described in Chapter II. A vector
encoding a scrambled shRNA molecule was used as a control. Stable expression
of the Spry2-specific shRNA in HT1080 (Fig. 18), as well as in VleFT cells (Fig.
1C), resulted in the down regulation of Spry2. The levels of Spry2 expression

were unaltered in the cells expressing the scrambled shRNA (control cells).

236

Figure 1. Down regulation of Spry2 in fibrosarcomas with wild type Ras or NRas"59

expression. (A) Whole cell lysates form normal foreskin-derived fibroblasts (SL68 and
SL89) and human-patient derived fibrosarcoma cell lines (HT1080 and VIPFT) were
pulled down with RafRBD conjugated beads to determine the level of active Ras in each
cell line. The total amount of Ras in the whole cell lysate (WCL) was determined using a
Pan—Ras-specific isoform. (B, C) Down regulation of Spry2 expression in fibrosarcoma

cell lines expressing NRas059

(HT1080, A) and in fibrosarcoma cells expressing wild
type Ras (VleFT, B). In both cases, stable cell lines were generated by infection of the
parental cells with a retrovirus expressing either a Spry2-specific or a scrambled shRNA.
(D, E) The indicated cell lines were serum starved and stimulated with EGF (100ng/mL)

for the indicated time points. WCL were analyzed by western blotting to determine the

expression of the indicated proteins.

237

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HT1080-SC HT1080-010

 

010 30 60 010 30 60 EGF

 

l EGFR

 

 

mfi-¢*hfl

p-ERK

 

 

 

 

ERK

 

VIPIFT-SC VleFT-Bl

 

010 3060 010 3060

EGF

 

.Ai

EGFR

 

. A O
' .0 c» 8 E
ES 3 i e
“' co a) I >
Pan-Ras
’ "‘ PDzRaf-RBD
“"- .. 4 Pan-Ras
WCL
' B D
latte HT1080
vc so C10 C12 [.......
I:- ‘ Spry2
C E
VleFT
VC SC B1
I- ~ 4 Spry2

 

 

l - It I'. \ -‘.0 ',l41—r '3‘ Ir“. - I.‘ a“ "J Ku 80

 

Figure 1

 

p-ERK

 

 

 

“Mm

fluwflm“

ERK

 

 

238

Control cells and cells with down regulated Spry2 were then analyzed for their
ability to form tumors in athymic mice. Parental HT1080 cells consistently form
sarcomas in athymic mice (100 tumors/100 injected sites) with a latency of three
to four weeks. HT1080 cells expressing the scrambled shRNA, formed tumors at
a similar ratio as did the parental cells, i.e. 7 tumor/8 sites. HT1080 cells with

down regulated Spry2 formed fewer tumors, i.e. 6 tumors/10 sites (Table l).

Parental VleFT cells also form tumors in athymic mice with the same
consistency as do parental VleFT cells (37 tumors/37 injected sites), although
they exhibit a longer latency (approximately five weeks). VIP:FT cells expressing
the scrambled shRNA formed tumors at a ratio resembling that of the parental cell
line, i.e., 4 tumors/6 sites, with a latency of approximately five weeks. VleFT cells
with down regulated Spry2, however, formed significantly fewer tumors upon
injection in athymic mice, i.e. 6 tumors/16 sites. The latency of the tumors formed

was the same as in the parental and control cells (Table II).

These preliminary results suggest that both in the presence of wild type as well as
in the presence of mutant Ras, Spry2 contributes to the ability of cells to form
tumors in athymic mice. According to these findings, Spry2 plays a more
prominent role in the tumorgenicity of VIPzFT cells (wild type Ras), than it does in
HT1080 cells (NRasQSQ). In addition to expressing NRastQ, HT1080 cells, also
overexpress PDGF. The latter may contribute significantly to the malignancy of

these cells. Interestingly, Spry2 inhibits ERK activation and proliferation in

239

Table l The tumorigenicity of the HT1080 cell lines with
down-regulated Spry2

 

Days for tumor to

Cell Tumor reach 0.5 cm3
strain shRNA incidence" volume
HT1080 - 100/100 21 -28
HT1080-SC scrambled 7/8 (87.5%) 35-63
HT1080-C10 spry2 6/10 (60%) 35-63

 

* Ratio of tumors formed to the number of sites injected subcutaneously. The
mice were examined for tumor formation for at least 6 months after injection

240

 

response to PDGF stimulation, while it sustains ERK activation and growth in soft
agar in HRas oncogene-transformed cells. These findings lend the preliminary
hypothesis that in HT1080 cells, the ability of Spry2 to sustain RTK signaling in
cells with activated Ras may be balanced, to some extent, by its ability to inhibit
the same pathway in response to PDGF-stimulation, resulting in a diminished

effect in tumor formation.

Effect of Spry2 on EGF-induced cell cycle progression

We have previously shown that Spry2 sustains the levels of EGFR and the
signaling activity from this receptor, in fibrosarcomas containing HRasV12
mutations. To determine if Spry2 has a similar function in fibrosarcomas
expressing mutant or wild type Ras, we examined the expression of EGFR
following EGF-stimulation in the presence and absence of Spry2 expression in
HT1080 and VIPFT cells. As expected, the levels of EGFR and the levels of
active ERK were decreased in both HT1080 and VleFT cells with down

regulated Spry2, compared to control cells (Fig. 1D and 1E).

Since the down regulation of Spry2 in VIPzFT cells resulted in a more prominent
decrease in tumorigenicity, compared to the effect of Spry2 down regulation in
HT1080 cells, we focused our attention on function of Spry2 in these cells.
Growth factor induced activation of ERK is an important step for cell cycle
progression. To determine if the decrease in the activation of ERK, observed in

the fibrosarcomas with down regulated Spry2, was associated with changes in

241

 

Table II The tumorigenicity of the VleFT cell lines with down-
regulated Spry2

 

Days for tumor to

Cell Tumor reach 0.5 cm3
strain shRNA incidence* volume
VIPzFI' - 37/37 28-35
VleFT-SC scrambled 4/6 (60%)“ 28-84
VlP:FT—B1 spry2 6/16 (37.5%) 28-84

 

* Ratio of tumors formed to the number of sites injected subcutaneously. The
mice were examined for tumor formation for at least 6 months after injection
“The remaining 2/6 injections formed tumors that regressed to normal

242

cell cycle progression we examined the cell cycle distribution of VleFT cells
expressing the scrambled shRNA to the distribution of VIP:FT cells expressing
Spry2 shRNA. The cells were serum starved for a period of 60 hrs, and then
stimulated with EGF to induced cell cycle progression. As soon as 2hrs after
EGF stimulation, the proportion of control VleFT cells in G1 decreased, while the
proportion in 8 increased, indicating progress from G1 to S phase (Fig. 2).
Instead, in VIPzFT cells with down regulated Spry2, the proportion of cells in G1
remained unaltered 2 hrs after EGF stimulation, suggesting a delay in S phase
entry. Furthermore, the population of control VleFT cells at G2 was prominent
after ten hours of EGF-stimulation. We were unable to detect a significant
population of VleFT cells with down regulated Spry2 that were at G2 at least until
after 15 hrs of EGF stimulation. The proportion of cells at S phase was similar
between the two cell strains. Importantly, the proportion of cells with DNA content

below 2n, possibly apoptotic cells, was increased in the cells with down regulated

Spry2.

Discussion

The data presented here suggest that Spry2 promotes tumor formation in human
patient-derived fibrosarcoma cell lines, consistent with the role of Spry2 in
PH3MT cells. Also, the ability of Spry2 to promote tumor formation by these cells
is independent of the presence of activating Ras mutations. It should be noted
that several months after their generation, the cell lines with down regulated

Spry2 had regained expression of Spry2, most likely due to loss of expression of

243

 

Figure 2. Down regulation of Spry2 in VleFT cells delays progression through the cell
cycle. VleFT cells expressing either scrambled shRNA or Spry2-specific shRNA were

analyzed as described in Materials and Methods.

244

Will the at

ShRNA WE

VIPZFT Scrambled shRNA

    

VIPZFT Spry2 shRNA

 

Figure 2

245

the spry2-specific shRNA. This may account for the lesser effect that Spry2 had
in the tumor forming ability of HT1080 and VIP:FT cellc compared to the effect of
Spry2 on the tumor forming ability of PH3MT cells. Alternatively, Spry2 may have
a more pronounced effect in HRas-transformed cells, because Spry2 may play a

Ras isoform specific function.

Material and methods

Cell cycle analysis

Cells plated at a density of 200,000 per 10cm-dish, were serum deprived for 48 to
72 hrs., and then stimulated with EGF (300 ng/mL) for varying time periods. After
the period of stimulation was over, the cells were collected and fixed in 80%
ethanol solution. FiXed cells were stained with propidium iodide (50 ng/mL) for 1
hr. at room temperature. The cell cycle analysis was performed by using FACS,

using standard sttings.

246

   

llglljjglljjjljljjlljl