51%”. b - -’.'. ‘L 55:37; I '3’ 1-. mu}; m»; 1 EJL'Z'EJ LIBRARY ? Michigan State University This is to certify that the dissertation entitled SYNTHESIS AND EVALUATION OF PRECURSORS TO THE AMINO- AND ARCHAEAL SHIKIMATE PATHWAYS presented by Heather A. Stueben T has been accepted towards fulfillment of the requirements for the PhD. degree in Chemistry v . x 1/ Li, J \// ”LU / Major Professor’ 3 Signature 04-26-2006 Date MSU is an Affirmative Action/Equal Opportunity Institution PLACE IN RETURN BOX to remove this checkout from your record. TO AVOID FINES return on or before date due. MAY BE RECALLED with earlier due date if requested. DAIEDUE DATEDUE DATEDUE 6/07 p:/CIRC/DateDue.indd-p.1 SYNTHESIS AND EVALUATION OF PRECURSORS TO THE AMINO- AND ARCHAEAL SHIKIMATE PATHWAYS By Heather A. Stueben A DISSERTATION Submitted to Michigan State University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Department of Chemistry 2006 ABSTRACT SYNTHESIS AND EVALUATION OF PRECURSORS TO THE AMINO- AND ARCHAEAL SHIKIMATE PATHWAYS By Heather A. Stueben Some organisms, in preparation of select metabolites, use variations of the shikimate pathway, an essential metabolic route by which microorganisms and plants synthesize the aromatic amino acids. One such variant, the aminoshikimate pathway, produces 3-amino-5-hydroxybenzoate required for the biosynthesis of the ansamycins and the mitomycins. Another variant, an archaeal shikimate pathway, has been proposed to feature a unique biosynthesis of the intermediate 3-dehydroquinate. The aminoshikimate pathway of Amycolatopsis mediterranei (ATCC 21789) and Bacillus pumilus proceeds from the 3-amino derivative of glucose, kanosamine. It has been proposed that the biosynthesis of kanosamine proceeds from uridine 5’-diphospho- D-glucose (UDPG) through the subsequent intermediacy of uridine 5’—diphospho-3-keto- D-glucose (3-ketoUDPG) and uridine 5’-diphospho-D-kanosamine (UDPK). This thesis establishes the intermediacy of 3-ketoUDPG in kanosamine biosynthesis leading to the aminoshikimate pathway. The cell-free lysates of A. mediterranei and B. pumilus were used to prepare kanosamine from 3-ketoUDPG. RifL from A. mediterranei, was established as the dehydrogenase responsible for the oxidation of UDPG to 3-ketoUDPG. It was that RifK from A. mediterranei can catalyze the transamination of 3-ketoUDPG to UDPK. The source of nitrogen for the RifK catalyzed transamination of 3-ketoUDPG was established as the a-amine of either glutamine or glutamic acid. It has been proposed that the archaeal shikimate pathway of Methanococcus jannaschii proceeds from an alternative biosynthesis of the second common shikimate pathway intermediate, 3-dehydroquinic acid (DHQ). This thesis details research performed to provide evidence for a proposed DHQ precursor, 2—amino-2,3,7—trideoxy-6- oxo—4,5-D-thre0-heptanoic acid (ATTH). The condensation of the proposed precursors to ATTH, 6—deoxy-5-ketofructose 1—phosphate (DKFP) and L-aspartate semialdehyde (ASA), by the proposed aldolase M10400 was investigated. Also, this thesis details several routes used in attempts to synthesize ATTH. Copyright by Heather A. Stueben 2006 To my family For always believing in me ACKNOWLEDGEMENTS First, I would like to thank Prof. John Frost for his guidance and encouragement throughout my graduate career. I would also like to thank the members of my graduate committee, Prof. Babak Borhan, Prof. James Geiger, and Prof. Mitch Smith, for their input in both the preparation of this thesis and at other times during my stay as a graduate student. I would like to thank Dr. Karen Frost for all here advice and encouragement. I would like to express thanks to past members of my research group, including Dr. Chad Hansen, Dr. Dave Knop, and Dr. Padmesh Venkitasubramanian for their patience and guidance during the early stages of my graduate career. I am also grateful to other past group members Dr. Wei Niu, Dr. Jian Yi, and Dr. Mapitso Molefe, and Dr. Jihane Achkar for their invaluable input and advice. I would like to show my gratitude to Dr. Jiantao Guo for his input and advice throughout my work on the aminoshikimate project. I am thankful as well to the remaining present Frost Group members, Dr. Ninqing Ran, Wengsheng Li, ManKit Lau, Justas lancauskas, Jinsong Yang, and Brad Cox for their friendship and support. I would also like to express gratitude to my family. Their perseverance in life’s trials, while providing unending love, support, and encouragement, has been invaluable to me throughout my life as well as my graduate career. vi TABLE OF CONTENTS LIST OF TABLES ........................................................................................................ XI LIST OF FIGURES .................................................................................................... XIII LIST OF ABBREVIATIONS .................................................................................... XVII CHAPTER ONE ............................................................................................................. I INTRODUCTION ........................................................................................................... 1 The Aminoshikimate Pathway and Ansamycin Biosynthesis .................................... 3 Archaeal Aromatic Amino Acid Biosynthesis ........................................................ 15 Archaea: an overview ........................................................................................ 15 Ribose biosynthesis and the shikimate pathway of archaeal methanogens .......... 17 The “missing” genes of archaeal aromatic amino acid biosynthesis .................... 24 CHAPTER TWO .......................................................................................................... 31 UDP—3-KETOGLUCOSE INTERMEDIACY IN KANOSAMINE BIOSYNTHESIS ...31 Introduction ........................................................................................................... 3 1 Synthesis of 3-ketoUDPG ...................................................................................... 36 Overview ........................................................................................................... 36 Synthesis of 3-ketoUDPG using partially purified glucoside—3-dehydrogenase...38 Synthesis of 3-ketoglucose-l-phosphate using A. tumefaciens standing cells ...... 40 Synthesis of 3-ketoUDPG from 3—ketoglucose-l-phosphate ............................... 41 Synthesis of 3-ketoUDPG from UDPG using the standing cells of A. tumefaciens .......................................................................................................................... 42 Reaction of 3-ketoUDPG with the cell-free extract of A. mediterranei ............... 43 Role of NAD in A. mediterranei kanosamine biosynthesis ..................................... 44 Overview ........................................................................................................... 44 Synthesis of [3-H2J-glucose ................................................................................ 45 Synthesis of [3-H2l-UDPG ................................................................................. 46 Reaction of [3-H21-UDPG with A. mediterranei cell-free lysate ......................... 48 NADH “trapping” .............................................................................................. 49 Expression and Analysis of RifL and RifK ............................................................ 51 Overview ........................................................................................................... 51 Reaction of UDPG and 3-ketoUDPG with the cells free-lysates of RifL‘ and RifK' A. mediterranei mutants ..................................................................................... 53 Heterologous expression and purification of RifL .............................................. 55 Specific activity of RifL ..................................................................................... 58 Initial attempts to produce UDPK using RifK or a combination of RifK/RifL ....60 Optimization of RifK expression in E. coli ......................................................... 65 Specific activity of RifK .................................................................................... 68 The source of nitrogen in A. mediterranei kanosamine biosynthesis ....................... 69 Overview ........................................................................................................... 69 Investigation of the kanosamine biosynthetic nitrogen source using 3-ketoUDPG and heterologously expressed RifK .................................................................... 70 vii Kanosamine biosynthesis through 3-ketoUDPG by B. pumilus .............................. 73 Discussion ............................................................................................................. 75 CHAPTER THREE ....................................................................................................... 93 3-DEHYDROQUINATE BIOSYNTHESIS VIA THE ARCHAEAL SHIKIMATE PATHWAY OF METHANOCALDOCOCCUS JANNASCHII .................................... 93 Introduction ........................................................................................................... 93 L-Aspartate semialdehyde intermediacy ................................................................. 97 Preparation of ASA ............................................................................................ 98 Preparation of DKFP ....................................................................................... 100 Preparation of MJ0400. .................................................................................... 101 Reaction of ASA and DKFP with MJ0400. ...................................................... 102 Expression of hdhl and thrA ............................................................................. 104 Expression of mj1602 ...................................................................................... 106 Expression of mj1249 ...................................................................................... 107 ATTH intermediacy ............................................................................................. 108 Overview ......................................................................................................... 108 Synthesis of ATTH from N-Cbz-Aspartic acid ................................................. 109 Synthesis of ATTH from N-Boc-Asp(Obz)-OH ............................................... 120 Synthesis of ATTH from D-tartaric acid through deoxy-xylose intermediacy... 124 Discussion ........................................................................................................... 126 CHAPTER FOUR ....................................................................................................... 137 EXPERIMENTA LS .................................................................................................... 137 GENERAL METHODS ....................................................................................... 137 General Chemistry ........................................................................................... 137 Chromatography .............................................................................................. 1 38 Spectroscopic measurements ............................................................................ 139 Chemical Assays .............................................................................................. 141 Organic and Inorganic Phosphate Assay ..................................................... 141 Ninhydrin assay ......................................................................................... 142 Bacterial Strains and Plasmids ......................................................................... 143 Storage of Bacterial Strains and Plasmids ........................................................ 143 Culture Medium ............................................................................................... 144 Analysis of culture supernatant ........................................................................ 14S Genetic Manipulations ..................................................................................... 146 General procedures .................................................................................... 146 Determination of DNA concentration ......................................................... 147 Large scale purification of plasmid DNA ................................................... 147 Small scale purification of plasmid DNA ................................................... 149 Restriction enzyme digest of DNA ............................................................. 150 Agarose gel electrophoresis ........................................................................ 151 Isolation of DNA from agarose .................................................................. 151 Treatment of vector DNA with calf intestinal alkaline phosphatase (CIAP) 152 Ligation of DNA ........................................................................................ 152 Preparation and transformation of E. coli competent cells .......................... 152 viii General Enzymology ....................................................................................... 154 General information ................................................................................... 154 E. coli UGPase (GalU) assay ...................................................................... 155 A. tumefaciens glucoside-3-dehydrogenase activity assay ........................... 155 A. mediterranei UDPG dehydrogenase (RifL) assay ................................... 156 Assay Condition #1: DCIP/PMS assay ................................................. 156 Assay Condition #2: HPLC assay ......................................................... 156 A. mediterranei transaminase (RifK) assay ................................................. 157 A. mediterranei AHBA synthase (RifK) activity ........................................ 158 SDS—PAGE protein gel .............................................................................. 158 CHAPTER TWO ................................................................................................. 160 Synthetic preparations ...................................................................................... 160 Synthesis of [3-2H]-glucose ........................................................................ 160 Uridine 5’-diphospho-[3-2HJ-D-glucose ..................................................... 162 Genetic manipulations ..................................................................................... 164 Plasmid pHS3.244 ...................................................................................... 164 Enzyme purifications ....................................................................................... 164 Overexpressed E. coli gal U-encoded UGPase. ........................................... 164 A. tumefaciens glucoside 3-dehydrogenase. ................................................ 16S Recombinant RifK ..................................................................................... 167 BL21 Codon Plus RP/pJG7.259 ........................................................... 167 JM109/pJG7.259 .................................................................................. 168 In vivo enzymatic reactions .............................................................................. 169 Oxidation of glucosides to 3-ketoglucosides by A. tumefaciens Whole Cells .................................................................................................................. 169 Cell—free lysate preparations ............................................................................. 170 Cell-free lysate of A. medierranei ............................................................... 170 Cell—free lysate of A. mediterranei RM01 and HGF003. ............................. 171 Cell-free lysate of B. pumilus ..................................................................... 171 JM109/pJG7.275 and JMlO9/pJG7.259a Cell-free Lysate. ......................... 172 BL21(DE3)/pRM030 cell-free lysate .......................................................... 172 Preparation of BL21 Codon Plus RP/pJG7.275 Cell-free Lysate (RifL) ...... 173 Preparation of BL21 Codon Plus RP/pJG7.259 cell-free lysate (RifK) ....... 173 In vitro enzymatic reactions ............................................................................. 174 Kanosamine Biosynthesis from UDPG ....................................................... 174 Kanosamine biosynthesis from 3-ketoUDPG ............................................. 174 Kanosamine biosynthesis from [3-2H]-UDPG ............................................ 175 Kanosamine biosynthesis from UDPG in the presence of NAD and NADH176 Oxidation of UDPG to 3-ketoUDPG by heterologously expressed RifL ..... 176 NAD cofactor ....................................................................................... 176 DCIP/PMS cofactor .............................................................................. 176 UDPG from 3-ketoUDPG by heterologously expressed RifL ..................... 177 UDPK from 3-ketoUDPG. ......................................................................... 177 Heterologously expressed RifK andRifL .............................................. 177 Heterologously expressed RifK ............................................................ 178 Chromatography .............................................................................................. 179 ix HPLC paired-ion chromatography Analysis of UDP-glucosides ................. 179 CHAPTER THREE ............................................................................................. 179 Synthetic Preparations ..................................................................................... 179 Synthesis of L-aspartate semialdehyde ....................................................... 179 Preparation of DKFP .................................................................................. 182 Preparation of ATTH from N—Cbz-L-aspartic acid ...................................... 183 Preparation of ATTH from N-tert-butoxycarbonyl-L-aspartic acid B-benzyl ester ........................................................................................................... 185 ATTH from D-tartaric acid ........................................................................ 196 Genetic manipulations ..................................................................................... 201 pHS7.098. .................................................................................................. 201 pHSS.080. .................................................................................................. 201 pH88.216. .................................................................................................. 202 pHS8.240. .................................................................................................. 202 pHSS.243. .................................................................................................. 203 pH88.101. .................................................................................................. 203 Enzyme Purifications ....................................................................................... 203 E. coli aspartate semialdhyde dehdrogenase (ASADH) .............................. 203 Enzyme Assays ................................................................................................ 205 ASADH specific activity assay .................................................................. 205 In vitro enzyme reactions ................................................................................. 206 Condensation of ASA and DKFP by MJ0400 ............................................. 206 GC-MS analysis ............................................................................................... 207 Analysis of MJ0400 catalyzed condensation of ASA and DKFP. ............... 207 REFERENCES ............................................................................................................ 208 LIST OF TABLES Table 1. Proposed functions of rif biosynthetic gene products ........................................ 11 Table 2. Purification of g1ucoside-3-dehydrogenase ....................................................... 39 Table 3. Methods used to purify [3-H2]-UDPG. ............................................................ 48 Table 4. Reactions of UDPG and 3-ketoUDPG with the cell-free lysate of A. mediterranei mutants lacking rzfl. and rifK. ........................................................... 55 Table 5. Arginine and proline codon frequencies of E. coli, A. mediterranei, and rifL....57 Table 6. Specific activity determinations of RifL. .......................................................... 59 Table 7. Reactions of 3-ketoUDPG with heterologously expressed RifK from JM109/pJG7.259a. ................................................................................................. 61 Table 8. Reactions of 3—ketoUDPG with RifK obtained from BL21 C+ RP/pJG7.259a..62 Table 9. Optimization of RifK transamination of 3-ketoUDPG. ..................................... 66 Table 10. Optimization of RifK transamination of 3-ketoUDPG. ................................... 67 Table 11. Screening for RifK reducing equivalents. ....................................................... 68 Table 12. 15N enrichments in kanosamine produced using A. mediterranei cell-free lysate and in UPDK produced using BL21 C+ RP/pJG7.259a cell-free lysate. .................. 71 Table 13. Nitrogen source and PLP dependence of the RifK catalyzed transamination of 3-ketoUPDG. ......................................................................................................... 73 Table 14. Reaction of [3-2H]-UDPG with B. pumilus cell—free lysate. ............................ 74 Table 15. B. pumilus NADH trapping experiments. ..................................................... 75 Table 16. Varying conditions used to prepare compound A as an intermediate to the N- Cbz-oxazolidine aldehyde. ................................................................................... 110 Table 17. Optimization of oxazolidine aldehyde preparation ....................................... 112 Table 18. Condensation of oxazolidine aldehyde with TPP to produce the enone ........ 115 xi Table 19. Dihydroxylation of the enone. ..................................................................... 117 Table 20. Optimization of enone dihydroxylation. ...................................................... 119 Table 21. Protection of protected ATTH in an attempt to separate the diol diastereomers. ............................................................................................................................ 122 xii LIST OF FIGURES Figure 1. The shikimate pathway. .................................................................................... 6 Figure 2. Labeling patterns of shikimate, 3-amino-5-hydroxybenzoate, and rifamycin from l3C-labeled glucose and glycerate. ................................................................... 7 Figure 3. Labeling pattern of mitomycin C from labeled D-erythrose and pyruvic acid. ..9 Figure 4. Rifamycin biosynthetic gene cluster of A. mediterranei S699 and proposed enzyme functions. .................................................................................................. 10 Figure 5. The proposed aminoshikimate pathway. ........................................................ 12 Figure 6. Proposed pathway for kanosamine biosynthesis. ............................................. 15 Figure 7. Non-oxidative Pentose Phosphate Cycle. ........................................................ 18 Figure 8. Observed l3C labeling patterns of tyrosine and tryptophan from acetate and pyruvate added to the growing culture of M. thermoautotrophicum ........................ 20 Figure 9. Observed 13C labeling patterns of pyruvate, hexoses, pentoses, and tetroses from, 13C enriched acetate and pyruvate. ................................................................ 21 Figure 10. Alternative DHQ precursors as suggested by Frost. ..................................... 27 Figure 11. Alternative DHQ precursors as proposed by White. ..................................... 28 Figure 12. Proposed archaeal shikimate pathway. ......................................................... 30 Figure 13. Aminoshikimate pathway. ............................................................................ 32 Figure 14. Proposed route for kanosamine biosynthesis from UDPG. ............................ 34 Figure 15. Mechanism for the oxidation of sucrose to 3-ketosucrose by the glucoside—3- dehydrogenase from A. tumefaciens. ...................................................................... 37 Figure 16. Preparation of 3-ketoglucose-l-phosphate using the standing cells of A. tumefaciens. ........................................................................................................... 41 Figure 17. Preparation of 3—ketoUDPG from 3-ketoglucose—1-phosphate ....................... 42 Figure 18. Preparation of 3-ketoUDPG from UDPG using the standing cells of A. tumefaciens ............................................................................................................ 43 Figure 19. Synthesis of [3-H2l-glucose from glucose. .................................................... 46 xiii Figure 20. One—pot enzymatic synthesis of [3-H2]-UDPG from [3-HZJ-glucose. ............. 47 Figure 21. Reaction of [3-H2]-UDPG with the cell-free lysate of A. mediterranei. ......... 49 Figure 22. Co-factors for the in situ regeneration of NAD from NADH ........................ 50 Figure 23. Reaction of UDPG with DCIP, PMS, and the cell-free lysate of JM109/pJG7.275 .................................................................................................... 56 Figure 24. Preparation of UDPK and the reaction of UDPK with BL21 C+ RP/pJG7.259a to produce 3-ketoUDPG ......................................................................................... 64 Figure 25. Preparation of DHMP. .................................................................................. 68 Figure 26. 1H NMR spectrum of 3-ketoUDPG produced by the oxidation of UDPG by A. tumefaciens ............................................................................................................ 80 Figure 27. 13C NMR spectrum of 3-ketoUDPG produced through the oxidation of UDPG by A. tumefaciens. ................................................................................................. 81 Figure 28. 2D-COSY spectrum of 3—ketoUDPG produced by A. tumefaciens. ............... 82 Figure 29. Standard 1H NMR spectrum of UDPG. ........................................................ 83 Figure 30. 1H N MR spectrum of [3-2H]-UDPG. ............................................................ 84 Figure 31. 1H NMR spectrum of kanosamine. ............................................................... 85 Figure 32. 1H NMR spectrum of [3-2H]-kanosamine. ................................................... 86 Figure 33. 1H NMR spectrum of UDPK ......................................................................... 87 Figure 34. 1H NMR of the crude product mixture obtained upon the RifK catalyzed transamination of 3-ketoUDPG. ............................................................................. 88 Figure 35. Mass Spectrum of UDPK produced from the RifK catalyzed transamination of 3-ketoUDPG in the presence of L-glutamine .......................................................... 89 Figure 36. Mass Spectrum of UDPK produced from the RifK catalyzed transamination of 3-ketoUDPG in the presence of [amide-15N]-L-glutamine ..................................... 90 Figure 37. Mass Spectrum of UDPK produced upon the RifK catalyzed transamination of 3-ketoUDPG in the presence of [alpha-15N]—L-glutamine ...................................... 91 Figure 38. HPLC analysis of UDPK produced by the RifK catalyzed transamination of 3- ketoUDPG. ............................................................................................................ 92 xiv Figure 39. Early proposal by Frost for alternate DHQ biosynthetic precursors. .............. 94 Figure 40. Predicted 13C labeling patterns of tyrosine and phenylalanine from acetate and pyruvate through the DHQ biosynthetic route proposed by Frost. .......................... 95 Figure 41. Hypothetical M. jannaschii biosynthetic route to DHQ proposed by White. ..97 Figure 42. Preparation of ASA from racemic allyl glycine ............................................. 98 Figure 43. Ozonolysis of Protected allyl glycine. .......................................................... 99 Figure 44. ASADH activity assay. ............................................................................... 100 Figure 45. Preparation of DKFP. ................................................................................ 101 Figure 46. Reaction of DKFP and ASA with M10400 as proposed by White. .............. 103 Figure 47. Reactions catalyzed by homoserine dehydrogenase and aspartate kinase.... 105 Figure 48. Division of thrA into different gene segments for individual expression or recombination to produce new bifunctional enzymes. .......................................... 106 Figure 49. Presumed aminotransfer catalyzed by MJ 1249 to produce the ketoacid DDTH. ................................................................................................................ 107 Figure 50. Preparation of the oxazolidine aldehyde ...................................................... 109 Figure 51. Optimized of oxazolidine aldehyde preparation from the acid chloride. ..... 113 Figure 52. Synthetic strategy for enone preparation from the oxazolidine aldehyde. 114 Figure 53. Simultaneous removal of Cbz group and cleavage of oxazolidine ring. ...... 118 Figure 54. Possible alternate dihydroxylation products. .............................................. 120 Figure 55. Synthesis of ATTH from N, N-diboc-Asp-OtBu ......................................... 121 Figure 56. ATTH from N—boc-Asp-OBn-OtBu. .......................................................... 123 Figure 57. ATTH synthesis from D-tartaric acid through 2-deoxy-xylose intermediacy. ............................................................................................................................ 126 Figure 58. GC spectrum obtained from the M10400 catalyzed condensation of ASA and DKFP. ................................................................................................................. 129 XV Figure 59. Example of a mass spectrum obtained from the GC-MS analysis of the MJ0400 catalyzed condensation of ASA and DKFP ............................................. 130 Figure 60. 1H NMR spectrum of (4S)-3-carbobenzyloxy-S-oxo-4—(4-oxo-pent-2-enyl)- oxazolidine. ......................................................................................................... 131 Figure 61. IH N MR spectrum of the product mixture produced upon asymmetric dihydroxylation of (4S)-3-carbobenzyloxy-5-oxo-4-(4-oxo-pent—2-enyl)-oxazolidine. ............................................................................................................................ 132 Figure 62. 1H NMR spectrum of the diol mixture obtained upon Sharpless asymmetric dihydroxylation of N,N-Bis(tert-Butoxycarbonyl)amino-6-oxo-hept-4—enoic acid tert-butyl ester. .................................................................................................... 133 Figure 63. 1H NMR spectrum of diol mixture produced upon Sharpless asymmetric dihydroxylation of N-teit-Butoxycarbonylamino-6-oxo-hept-4-enoic acid tert—butyl ester. .................................................................................................................... 134 Figure 64. 1H NMR spectrum of compound A isolated upon benzoylation of the mono- boc protected diol mixture. .................................................................................. 135 Figure 65. lH NMR spectrum of compound B isolated upon the benzoylation of the mono-boc protected diol mixture. ........................................................................ 136 xvi 3-ketoUDPG A AczO AcOH ADP AHBA AminoDAHP AminoDHQ AminoDHS AminoF6P AMINOSA Amp ASADH ATP ATTH Bis-Tris propane BnBr BoczO BOP reagent BSA LIST OF ABBREVIATIONS Uridine 5’—diphospho-3-keto—D—glucose Absorbance Acetic anhydride Acetic acid Adenine 5’-diphosphate 3-amino-5-hydroxybenzoic acid 3,4-dideoxy-4—amino-D-arabino-heptulosonic acid 7-phosphate 5—deoxy—5-amino-3-dehydroquinic acid 5-deoxy-5-amino-dehydroshikimic acid 3-amino-3—deoxy-fructose 6-phosphate 3-DEOXY—3—AMINO—SHIKIMIC ACID Ampicillin L-aspartate semialdehyde dehydrogenase Adenosine 5’-triphosphate 2-amino-2,3,7—trideoxy-6-oxo-4,5—D—thre0—heptanoic acid 1,3-BislTris(hydroxymethyl)methylamino]propane Benzyl bromide tert-butyloxycarbonyl anhydride (Benzotriazol—1-yloxy)Tris(dimethylamino)phosphoniurn hexafluorophosphate Bovine serum albumin xvii BzCl DAHP DCC DCIP DDTH DEAE DHA DHAP DHMP DHS (DHQD)2PHAL DIAD DIBAL DKFP DMAP DMF DMPCA DMSO DTT E4P EDTA EPPS (HEPPS) EtZO Benzoyl chloride 3-deoxy-D-arabino-heptulosonic acid 7-phosphate Dicyclohexycarbodiimide 2,6-dichloroindolphenol 3,7—dideoxy—D-thre0-heptulo-2,6-diulosonic acid diethylaminoethyl Dihydroxy acetone Dihydroxyacetone phosphate 5,10-dihydro-5-methyl phenazine 3-dehydroshikimic acid Hydroquinidine 1,4—phthalazinediyl diether Diisopropyl azo dicarboxylate Diisobutyl aluminum hydride 6-deoxy-5-ketofructose l-phosphate N,N-Dimethylamino pyridine Dimethyl formamide 4,5-dihydroxy-6-methyl-piperidine-2-carboxylic acid Dimethyl sulfoxide Dithiothreitol Erythrose 4—phosphate Ethylene diamine tetraacetic acid 4—(2-Hydroxyethyl)- 1 -piperazinepropanesulfonic acid Diethyl ether xviii EtOH ETP EtSH FAD FADH2 FMN G3DH GC GK HEPES HK HRMS IMINOE4P IPTG K6P ASA LB Mel MeOH MOPS NAD NADH NADP Ethyl alcohol Electron transport pathway Ethanethiol Flavin adenine dinucleotide Flavin adenine dinucleotide reduced FLAVIN MONONUCLEOTIDE Glucoside 3-dehydrogenase Gas chromatography Glycerol kinase N—(2-Hydroxyethyl)piperazine-N—(2-ethanesulfonic acid) Hexokinase HI-RES MASS SPECTRAL ANALYSIS 1 -deoxy-1-imino-D-erythrose 4—phosphate Isopropyl B-D- l -thiogalactopyranoside Kanosamine 6-phosphate L-aspartate semialdehyde Luria-Burtani broth Methyl iodide Methyl alcohol 3-(N—Morpholino)propanesulfonic acid Nicotinamide adenine dinucleotide Nicotinamide adenine dinucleotide reduced N icotinamide adenine dinucleotide phosphate xix NADPH NaOAc n-BuLi NTA NMO NMR OD PCR PDC PEP PGM PhMe Pi PIPES PK PLP PMP PMS PMSF PPase PPh3 PPi stOH Nicotinamide adenine dinucleotide phosphate reduced Sodium acetate n—butyl lithium Nitrilotriacetic acid N—methylmorpholine N—oxide Nuclear magnetic resonance Optical density Polymerase chain reaction Pyridinium dichromate Phosphoenolpyruvate Phosphoglucomutase Toluene Inorganic phosphate l,4—Piperazinediethanesulfonic acid Pyruvate kinase Pyridoxal 5-phosphate Pyridoxamine 5—phosphate Phenazine methosulfate Phenyl methyl sulfonyl fluoride Inorganic pyrophosphatase Triphenylphosphine Inorganic pyrophosphate p-toluenesulfonic acid XX Pyr QA Quant. R5P RAMA S7P SA SDS-PAGE TBAF TBAHC TBAHS TBDMS TBDMSCI tBuOH TEA TEAB THF TMSI TPAP TPP Tris U UDP Pyridine Quinic acid Quantitative Ribose 5-phosphate Rabbit muscle aldolase Sedoheptulose 7-phosphate Shikimic acid Sodium dodecyl sulfate polyacrylamide gel electrophoresis Tetrabutylammonium fluoride Tetrabutyl ammonium hydrogen carbonate Tetrabutyl ammonium hydrogen sulfate tert-butyl dimethylsilyl tert—butyl dimethylsilyl chloride tert—butyl alcohol Triethylamine Triethylammonium bicarbonate Tetrahydrofuran Trimethylsilyl iodide Tetrapropylammonium perruthenate Triphenylphosphoranyl 2-propanone Tris(hydroxymethyl)aminomethane Units Uridine 5’-diphosphate xxi UDPG UDPK UGPase UMP UTP YMG YT Uridine 5 ’-diphospho—D-glucose Uridine 5’-diphospho-3-amino-3-deoxy-D-glucose or uridine 5’diphospho—kanosamine Uridine 5’—diphosphoglucose pyrophosphorylase Uridine 5’-monophosphate Uridine 5’-triphosphate Yeast malt glucose media Yeast tryptone broth xxii CHAPTER ONE INTRODUCTION The shikimate pathway is an essential metabolic route by which microorganisms and plants synthesize the aromatic amino acids phenylalanine, tyrosine, and tryptophan, 1 The absence of in addition to a variety of primary metabolites required to sustain life. this pathway in animals makes it an attractive target for metabolic intervention in the development of chemotherapeutic agents as well as herbicides. The shikimate pathway is also a source of a wide array of secondary metabolites utilized by both plants and microorganisms to maintain a position in the ecological environment. The majority of these metabolites are produced from the end products of the shikimate pathway, the aromatic amino acids. However, a select few metabolites are produced from variants of the shikimate pathway. These variations can consist of a branching off from any of the main pathway intermediates, a chemical modification of the pathway precursors, or the absence or replacement of common intermediary steps.2 The work performed prior to the preparation of this thesis focused on elaborating key intermediates leading to two variations of the shikimate pathway. One such variant, the aminoshikimate pathway, along which the typical intermediates of the shikimate pathway contain an amino group at C-4, produces 3—amino-S-hydroxybenzoate required for the biosynthesis of the ansamycins and the mitomycins. The other variant to be addressed here is an archaeal shikimate pathway featuring a unique biosynthesis of 3- dehydroquinate, which appears to lack the typical requirement of erythrose 4-phosphate 1 and 3-deoxy-D-arabino—heptulosonate 7-phosphate. As well as resolving fundamental biosynthetic questions there are practical incentives to advancing the knowledge of the molecular aspects associated with these two pathway variations. For example, elaboration of the aminoshikimate pathway could lead to the design of strains genetically modified to synthesize medicinally important compounds or analogs in higher than natural concentrations and yields. Through genetic manipulation, the unusual aminoshikimate pathway intermediates could be isolated and used as unique starting points to the synthesis or biosynthesis of novel compounds with intriguing medicinal properties. S—Amino-S—deoxy—shikimate, which could be produced and isolated through the genetic manipulation of the aminoshikimate pathway, may be a useful starting material for the production of medicinal agents including the neuraminidase inhibitor, Tamiflu, produced currently from shikimate by Roche. Elaboration of the archaeal shikimate pathway could provide an innovative route to the shikimate pathway intermediates. Cells keep the steady-state concentration of erythrose 4-phosphate to a minimum in response to the molecule’s inherent instability and propensity towards polymerization. Through genetic manipulation, strains could be designed to produce higher concentrations of shikimate pathway intermediates using the archaeal pathway enzymes. Chapter One will present an overview of the aminoshikimate pathway and ansamycin biosynthesis as well as an overview of archaeal aromatic amino acid biosynthesis. Chapter Two describes research performed to elaborate the biosynthetic intermediates involved in kanosamine biosynthesis, a short pathway preceding the aminoshikimate pathway during which the famed amine moiety is introduced. Chapter Three of this manuscript details efforts to delineate the intermediates involved in DHQ biosynthesis by the archaeal shikimate pathway. In order to study these two shikimate pathway variants the putative biosynthetic intermediates were prepared either biosynthetically or chemically. Once prepared the intermediates were incubated with the cell-free lysate of A. mediterranei or the alleged enzymes of the pathways heterologously expressed in E. coli. The lysate was then analyzed for the formation of the expected products or intermediates. The Aminoshikimate Pathway and Ansamycin Biosynthesis As a class of medicinally significant natural products, each of the ansamycins portray alone or in combination antibacterial, anitumor, and/or antifungal activities.3 The ansamycins were named for their characteristic structure, which includes an aromatic chromophore joined at two positions with an aliphatic (ansa) polyketide chain.4 The aromatic chromophore contains an amine moiety at which the polyketide chain is connected through an amide linkage. The chromophore is also known to form a quinone- hydroquinone structure in most of the known ansamycins discovered to date (120 naturally—occurring).5 The ansamycins are divided into two distinct categories based on the aromatic chromophore they contain: naphthalenoid or benzenoid.3 Of the naphthelenoid ansamycins, the most well known are actamycin, ansathiazin, awamycin, halomycin, naphthomycin, rifamycin, streptovaricin, and tolypomycin. Ansamytocin, ansatrienin, geldanamycin, and the maytansines are some of the more commonly known benzenoid ansamycins. Produced by Amycolatopsis mediterranei, the rifamycins were first isolated by Lepetit Research Laboratories as a mixture containing five distinct structures denoted rifamycin B, G, L, S, and SV.6 Notably, the rifamycins were the first antibiotics identified whose antibiotic activity was linked to a selective inhibition of RNA synthesis through binding to bacterial RNA polymerase.7 Due to its stability, ease of isolation, solubility at physiological pH, and spontaneous transformation into the more active rifamycin S, rifamycin B was chosen for development. Rifampicin, a synthetically modified form of rifamycin Bg, has been used since the 1960’s and remains one of the most important treatments of tuberculosis and mycobacterial infections.9 The carbon skeletons of the ansamycins share a resemblance with erythromycin- type macrolide antibiotics as the ansa chain contains alternating methyl and hydroxyl groups. This feature indicates the ansa moiety is produced from a polyketide chain formed via the condensation of methylmalonate units and intermittent malonate units.10 The biosynthesis of ansamycins began with the study of rifamycin S formation. The formation of rifamycin S was studied through the incorporation of 14C— and 3H-labeled precursors. Analysis of the radioactivity of different fragments of the molecule, obtained by chemical degradation, established that propionate and acetate were incorporated head to tail, which is in agreement with the general pattern of a polyketide chain 11 biosynthesis. Through the assimilation of ”C-enriched precursors followed by 13C NMR analysis, the biosynthetic origin of the carbon atoms incorporated into the ansa chain of rifamycin S was established.” Other ansamycins, including geldanamycin,l3 naphthomycin,l4 actamycin,15 and streptovaricin,16 have also been used to study ansa chain formation. 11,12 According to the above labeling studies, seven carbon atoms (C-l to C-7,) of rifamycin S were not derived from propionate and acetate. These seven carbon atoms formed a substituted aromatic chromophore, which appeared to act as the initiator of polyketide synthases in ansa chain biosynthesis.l7 This aromatic unit also serves as the biosynthetic precursor of the mitomycin family. Its structure resembles an unusual meta- substituted aminobenzoate, as previously known natural aminobenzoates, such as anthranilic acid and p-aminobenzoate, are ortho or para substituted. Several research groups worked to identify the biosynthetic precursor of this aromatic chromophore. Based on the results of geneticl8 and specific feeding experiments,” the biosynthetic precursor of this unique aromatic chromophore was identified as 3-amino-5-hydroxybenzoate (AHBA). Upon addition of AHBA, rifamycin B production was restored in a rifamycin B deficient mutant of A. mediterranei.18 Using ”C—enriched AHBA, it was determined C-1 of AHBA corresponds to the quinone carbonyl carbon of streptovaricin.'9a Using [l-”C]-AHBA the C—1 of AHBA was also found to correspond to the benzyl methylene of ansamitocin'9b and the aromatic methyl group of porfiromycin.19c f OH OH H203PO\}\i/§O HO,. CO2H HO,. COZH O .\OH OH 8 O b 2, s 0“ Eip i , OH 1. o 5 OH HO OH COZH PI HZOSPO OH ‘3' OH H203Pol§ DAHP DHQ PEP COZH COZH COZH COzH c d NH2 0 s OH HO‘ 5 0H 5 O COZH H20 OH OH OH DHS SA chorismic acid \ L-phenylalanine ll 002H NH2 COZH \ NH2 3 L-tryptophan OH L-tyrosine Figure l. The shikimate pathway. (a) DAHP synthase; (b) 3-dehydroquinate synthase; (c) 3-dehydroquinate dehydratase; (d) shikimate dehydrogenase. Abbreviations: PEP, phosphoenolpyruvate; E4P, D- erythrose 4-phosphate; DAHP, 3-deoxy-D-arabin0-heptulosonic acid 7 -phosphate; DHQ, 3-dehydroquinate; DHS, 3-dehydroshikimate. Once AHBA was identified as the biosynthetic precursor of the ansamycin and mitomycin aromatic chromophores, the process of defining AHBA biosynthesis began. Using ”C-labeled precursors (Figure 2), it was determined AHBA was prepared biosynthetically via the shikimate pathway (Figure 1). Via the shikimate pathway, C-1 of glucose corresponds to C-3 of phosphoenolpyruvate, while C-6 corresponds to C-4 of D- erythrose 4—phosphate, which represent C-3 and C—7 of Shikimic acid. Upon addition of [l-”C]-D-glucose and [6—”C]-D—glucose, the rifamycin B produced contained ”C enrichment at C-1- and C-10 of the chromophore. The C-l position of glycerate provides biosynthetically C-1 of phosphoenolpyruvate as well as C-2 of E4P, which subsequently represent C-1 and C-5 of shikimate. Upon addition of [1-”C]-D-glycerate, ”C enrichment was observed at O3 and C-8 of the rifamycin B chromophore (Figure 2). These data were consistent with a shikimate pathway origin of the chromophore.20 Figure 2. Labeling patterns of shikimate, 3-amino-5-hydroxybenzoate, and rifamycin from l3C-Iabeled glucose and glycerate. OH OH H203PO\/v\_/§O . HzoaPovKg/so OH OH 0 OH COZH 5H \ OH .\ o o E4P —> ° ° . <— E4P HOVKlorOH o 1 H06 at O“ “O - ”“2 - 0 \ COZH AHBA C02H glycerate 9'“°°‘°’e H203PO ° H203PO PEP PEP C02H O O O COzH HO“. , OH . OH Ho“ i OH OH shikimate shikimate rifamycin B Although the above labeling experiments implicate the shikimate pathway as the origin of AHBA biosynthesis, further studies indicated that siiiitimattefoa‘c'z1 quinate,22 and 3-dehydroquinate20d were not precursors to AHBA. These results led to the hypothesis that AHBA biosynthesis must branch from the traditional shikimate pathway prior to DHQ biosynthesis. This hypothesis was further exemplified when Gygax and coworkers observed rifamycin production was not effected using A. mediterranei A10, a DHQ synthase deficient strain. Transketolase is necessary for the production of DAHP, the immediate shikimate pathway precursor of DHQ. However a transketolase-deficient mutant, A. mediterranei A8, produced no aromatic amino acids and much less rifamycin B relative to the parent strain. This result led Ghisalba and co-workers to suggest AHBA biosynthesis branches from the shikimate pathway prior to DAHP formation.23 Hornemann and coworkers, while studying the biosynthesis of mitomycin C, made another important discovery of AHBA biosynthesis (Figure 3).24 Because the C-3 carbons of DHQ and DHS (Figure l) are carbonyl carbons, it was hypothesized that the nitrogen might be introduced at C—3 of a shikimate pathway intermediate by a transamination reaction.20a Typically C-4 of E4P corresponds to C-2 of DHQ and the other shikimate pathway intermediates. If the amino analogs of DHQ and DHS were prepared via transamination at C-3 then C-4 of E4P would correspond to C-4 of mitomycin C. However, analysis of the labeling pattern of mitomycin C derived from D— [4-‘4C]-erythrose and pyruvic acid showed l4C enrichment at C-2 of mitomycin C as opposed to C-4 (Figure 3). This result indicated that the amine nitrogen of AHBA was incorporated at the C4 carbon atom of DAHP to afford 4—amino-3,4—dideoxy-D—arabino- heptulosonic acid 7-phosphate (aminoDAHP) before the formation of 5-amino-5-deoxy— 3-dehydroquinate (aminoDHQ, Figure 3). The results led to a hypothesis that aminoDAHP or a closely related molecule was an early precursor in the biosynthesis of AHBA.24 .OH Ho,_ c02H Ho,_ COZH HO”. 4 + OTCOZH O . ‘ ——> —> Ho“ ‘ H ' : NH2 0 .:. NH2 O H203PO OH OH D-erythrose pyruvic aicd aminoDAHP aminoDHO OyNHZ COZH O 0 -~ I: --> 6 ———-> —-—> HO NH2 H30 4 N NH O AHBA mitomycin C Figure 3. Labeling pattern of mitomycin C from labeled D-erythrose and pyruvic acid. Floss later confirmed aminoDAHP was a precursor of AHBA.25 Floss synthesized aminoDAHP, 5-amino—5-deoxy—3-dehydroquinate (aminoDHQ), and 5- amino-S-deoxy-3-dehydroshikimate (aminoDHS) and demonstrated that each of these substrates could be used to prepare AHBA with the cell-free lysate of the rifamycin B producer A. medz‘terranei.253 Floss and coworkers then isolated and sequenced the AHBA synthase protein from A. mediterranei. They further identified the AHBA synthase as the gene product of rifK.26 The rzjK gene was then used to identify the rif biosynthetic gene cluster, a 95-kb region of DNA surrounding rin, required for AHBA biosynthesis from in A. mediterranei S699 (Figure 4).27 Figure 4. Rifamycin biosynthetic gene cluster of A. mediterranei S699 and proposed enzyme functions. 1 95 kb I A L J A A —[ )L )[ fl 'x_,)c__,):,'): rifA rifB rifC rifD NYE rifF I r \‘ rifG rifH rifl rifK rifL rifM rifN orf9 on‘ 15 n‘fJ : //—<:l-// 71— J 7' The putative function of each gene in the cluster was identified through sequence homology with known enzymes (Table 1). Located immediately upstream of rifK three genes, rifG, rifH, and rifl, showed high sequence homology to shikimate pathway genes (Figure 1) encoding DHQ synthase (entry 1, Table 1), a plant-like DAHP synthase (entry 2, Table l), and shikimate dehydrogenase (entry 3, Table 1), respectively. No gene was found nearby which might encode DHQ dehydratase homology. The closest gene with high sequence homology to a type II DHQ dehydratase (entry 4, Table l) is rifJ, located about 30-kb downstream of rsz.27 Using an A. mediterranei mutant with a deactivated rifJ gene, Floss and coworkers showed rifamycin B formation was reduced to 10% of wild type levels. However, upon supplementing the culture with AHBA, rifamycin B production by the A. mediterranei rifJ mutant was restored. Inactivation experiments also showed the rifH—encoded DAHP synthase and rifG-encoded 3-dehydroquinate synthase are essential for rifamycin B biosynthesis. However, inactivation of rifl had no notable effect on rifamycin B production. 28 10 Table 1. Proposed functions of nf biosynthetic gene products. rif biosynthetic sequence homology Entry gene products (species, homology%lidentity%) proposed function“ 1 RifG AroB (E. coli, 49/33) aminoDHQ synthase 2 RifH AroG (L. esculentum, 54/34) aminoDAHP synthase 3 Rifl AroE (Synechocystis sp. 56/29) 36?;Zifgekligzte 4 Rifl AroD (A. pleuropneumoniae, 63/41) 33:33:31? 5 RifK AHBAS (S. collinus, 86/70) AHBA synthase 6 RifL PurlO (S. alboniger, 55/29) Oxidoreductase 7 RifM CbbzP (R. eutropha, 55/32) Phosphatase 8 RifN Xle (Synechocystis sp. 52/29) Kinase 9 Orf9 YokM (B. subtilis, 58/30) Transaminase 10 Orf 15 TktA (E. coli, 58/32) Transketolase (a) Abbreviations: aminoshikimate, 5-amino-5-deoxyshikimate; aminoDHQ, S-amino-S- deoxy-3-dehydroquinate; aminoDAHP, 4-amino—3,4-dideoxy-D-arabino-heptulosonic acid 7-phosphate; AHBA, 3-amino-S-hydroxybenzoate. Located downstream from the rifK gene are five additional genes. The rifl. gene (Figure 4), annotated as an oxidoreductase (entry 6, Table 1), is translationally coupled to rifK. In the same transcription unit with rifK and rifL are two additional genes, nflll and NW (Figure 4), which were annotated as a phosphatase (entry 7, Table l) and a glucose specific kinase (entry 8, Table 1), respectively.27 The gene products of rifL, rifM, and riflV were found to be necessary for rifamycin B production since the inactivation of ri'jL, rsz, and riflV produced mutants incapable of Rifamycin B formation without AHBA 11 supplementation.28 AHBA was produced upon heterologous co-expression of rifG, rifH, rifK, rifL, rifM, rifN, and rifJ in Streptomyces coelicolor YU105, which further indicated these seven genes are required for AHBA production. 28 Based on the results described above and on a report from the laboratory of Jiao that the amide nitrogen of glutamine is the best source of nitrogen in rifamycin biosynthesis,29 Floss and co-workers proposed the AHBA biosynthetic pathway shown in Figure 5, which they titled the aminoshikimate pathway. The gene product of rifH would catalyze the condensation of iminoE4P with phosphoenolpyruvate to provide aminoDAHP. AminoDAHP would then be cyclized to aminoDHQ, by the action of the rifG gene product.25 The heterologously expressed RifG from S. lividans 1326 was found to utilize both DAHP and aminoDAHP as substrates.30 The rifJ-encoded aminoDHQ dehydratase would catalyze the dehydration of aminoDHQ to give aminoDHS, which would be converted into AHBA by dehydration and enolization.25 The enzymatic activity of RifJ has been demonstrated,31 as well as the AHBA synthase activity of RifK.26 COZH H203PO/\ Pi HO, COzH Pi HO, C02H H 0 W2 H20 mzH PEP { o 2' O:-L> 2 C; + OH a 5'. NH2 b NH20 0 NHZd NH2 H203PO\/K/§NH HZOSPO OH OH aminoDAHP aminoDHQ aminoDHS AHBA iminoE4P Figure 5. The proposed aminoshikimate pathway. Enzymes (encoding genes): (a) aminoDAHP synthase, rifH; (b) 5-amino-5-deoxy-3- dehydroquinate synthase, rifG; (c) 5-amino-5-deoxy-3-dehydroquinate dehydratase, rifJ; (d) 3-amino-5-hydroxybenzoate synthase, rifK. l2 When expressed in E. coli, rifH-encoded DAHP synthase can catalyze the synthesis of DAHP from E4P and phosphoenolpyruvate. However, no aminoDAHP was formed when D-erythrose 4—phosphate, phosphoenolpyruvate, and nitrogen sources were incubated with rifH-encoded DAHP synthase. Floss suggested that rin-encoded DAHP synthase must combine with another protein in order to synthesize aminoDAHP. 32 However, Frost and Guo suggested transamination of E4P to provide iminoE4P would be unrealistic33 based on the known chemistry of E4P in solution“. They suggested iminoE4P could be prepared biosynthetically from 3-amino—3-deoxy-fructose 6— phosphate (aminoF6P) by the action of a transketolase. Frost and Guo prepared aminoF6P from glucose. They then showed aminoDAHP could be prepared by the action of A. mediterranei rifH from aminoF6P in the presence of ribose 5-phosphate (R5P), PEP, and E. coli transketolase.33 Upon demonstrating aminoDAHP formation from aminoF6P, efforts by Frost and Guo turned toward delineating the biosynthetic precursor of F6P. They suggested the 3- amino derivative of glucose, kanosamine, could be used by A. mediterranei to produce aminoF6P. Kanosamine 6—phosphate was prepared and treated with yeast isomerase, E. coli transketolase, and A. mediterranei RifH in the presence of R5P and PEP to produce aminoDAHP. AminoDAHP production was also demonstrated from kanosamine 6- phosphate using the cell-free lysate of A. mediterranei. Quantifiable levels of neither aminoDAHP nor DAHP could be observed when kanosamine 6-phosphate was replaced 35 with kanosamine.~ However, Floss and coworkers reported the production of kanosamine from kanosamine 6-phosphate by the gene product of rifN36, originally 13 annotated as a glucokinase (entry 8, Table 1).27 These results indicated kanosamine is the precursor to the aminoshikimate pathway and subsequently to AHBA. With the establishment of kanosamine as the precursor to AHBA biosynthesis, efforts turned towards delineating kanosamine biosynthesis in A. mediterranei.35 Kanosamine biosynthesis was first observed and studied in Bacillus pumilus in the 1960’s. It was observed that incubation of UDP—[U-“Cl-glucose in B. pumilus cell-free lysate in the presence of NAD and L-glutamine led to the formation of kanosmane.37 Frost and Guo have demonstrated [6,6’-2H2]-kanosamine could be produced from UDP- [6,6’-2H2]-glucose by A. mediterranei cell-free lysate in the presence of NAD, and L- . 3 glutamine. 5 The other gene products that are absolutely necessary for AHBA biosynthesis are rifL-encoded oxidoreductase, and rifM-encoded phosphatase. The functions of these gene products are based on sequence homology with the genetic sequences encoding known enzyme activities.27 Their actual enzymatic activities have not been experimentally established with enzyme assays. Since they are not required for AHBA biosynthesis after the formation of aminoDAHP according to the proposed aminoshikimate pathway (Figure 5), the enzymes encoded by these genes were originally suggested to be associated with the formation of aminoDAHP by Floss,28 however they were later suggested to play a role in kanosamine biosynthesis.”36 The roles of RifL or RifM in kanosamine biosynthesis had not been demonstrated prior to the initiation of research discussed in this thesis. l4 glutamine HO NAD HO NADH “0 HO 0 a o b o C o HOI" «nouop R; How -IOUDP KY HOI" -'IOUDP ——> HO» OH HO 6H NADH 0 ’OH ItNADt H2N OH H2N ’OH UDPG ketoUDPG guamae aminoUDPG kanosamine Figure 6. Proposed pathway for kanosamine biosynthesis. Enzymes (encoding genes): (a) Oxidoreductase, rifL; (b) transaminase, rifK; (c) phosphatase, rifM. Abbreviations: UDPG, UDP-glucose; 3—ketoUDPG, UDP-3—keto- glucose; UDPK, UDP-3-amino-3-deoxy-glucose. Archaeal Aromatic Amino Acid Bios nthesis Archaea: an overview Before addressing archaeal amino acid biosynthesis it seems pertinent to give a brief discussion of the Archaea, including several differences and similarities between Archaea and the other two domains, Bacteria and Eukarya. For over five decades, scientists were confident in the belief that two basic kinds of organisms existed, eubacteria and eukaryotes. This belief was shattered in 1977 when Woese and co- workers revealed that life consisted of three distinct groups of organisms, eukaryotes and two kinds of prokaryotes, eubacteria and archaeabacteria.38 In 1990 the bipartite view of life was replaced with a tripartite design to include Archaea as a domain separate from Bacteria and Eukarya.39 Several arguments have been made, however, against this 4 tripartite view of life, especially by Mayr40, Margulis and Guerrero 1, and Cavalier- Smith42. This controversy has resulted in a complex coexistence of old and new terminology. For the sake of simplicity only the older terminology will be used in this report. According to rRNA phylogenetic trees there are two groups of Archaea. The kingdom Crenarchaeota consists of hyperthermophiles and thermoacidophiles such as 15 Sulfolobus, Desulfurococcus, Pyrodictium, Thermoproteus, and Thermofilum. The second kindom, Euryarchaeota, covers a broader ecological range to include hyperthermophiles (some are Pyrococcus and Thermococcus), methanogens (such as Methanosarcina), halophiles (e.g. Halobacterium and Haloferax), and thermophilic methanogens (such as Methanothermus, Methanobacterium, and Methanococcus).43 Several cellular and biochemical features which distinguish Archaea from Bacteria and Eukarya have been identified The features unique to Archaea include isoprenyl ether lipids, flagellar shaft of acid-insoluble glycoproteins related to pilin, modified tRNA molecules, RNA polymerase A split into two proteins, and DNA-binding protein 10b.“ Other features or combinations of features illustrate the evolutionary relationship between Archaea and either Bacteria or Eukarya. Archaea and Bacteria share similar general cell sizes, the lack of a nuclear membrane and organelles, and the presence of a large circular chromosome intermittently complemented by one or more small circular plasmids.43 Although Archaea and Bacteria look to be very similar based on general genome organization, many archaeal genes display a higher similarity to eukaryotic homologs. Early studies on antibiotic resistance hinted of genetic homology between eukaryotes and archaebacteria as both are resistant to streptomycin (an anti-70S ribosome inhibitor to which eubacteria are sensitive) and sensitive to some anti—808 ribosome inhibitors (such as anisomycin) as well as aphidocolin (a DNA polymerase inhibitor). Later studies revealed significant similarities between archaeal and eukaryotic DNA replication, transcriptional, and translational enzymes. More similarities between Archaea and the other two domains have been reported more extensively elsewhere.43 16 Ribose biosynthesis and the shikimate pathway of archaeal methanogens Archaeal methanogens typically use H2 and CO2 as sole energy and carbon sources, however some require the exogenous presence of acetate or varying amino acids. They can be autotrophic or heterotrophic and have a wide range of optimal growth temperatures (4°C to 85°C). This diversity among the archaeal methanogens is further represented by the variations of common biosynthetic pathways utilized by these organisms. Early studies, performed mainly with Methanobacterium thermoautotrophicum, indicated that the serine, hexulose phosphate, and the reductive pentose phosphate pathways are not utilized by the archaeal methanogens. This suggestion was based on the absence of key biosynthetic enzymes and inconsistencies in the early intermediates formed from one—carbon substrates.45 The autotrophy of methanogens was investigated and explained by the synthesis of acetate from two CO2 molecules”, which was then linked to an incomplete, acyclic tricarboxylic acid (TCA) cycle. In some archaeal methanogens this non-cyclic TCA cycle produces or-ketoglutarate in the reductive direction. In M. thermoautotrophicum, which uses this reductive non—cyclic TCA cycle, all of the oxidoreductases, with the exception of isocitrate dehydrogenase, have been identified.47 Other members of the archaeal methanogens, such as Methanosarcina barkeri, use an oxidative direction to synthesis (ii-ketoglutarate.48 Although the common pathway for aromatic amino acid biosynthesis has been well defined in prokaryotes and eukaryotes, among the archaeal methanogens this pathway is less clear. A series of ”C labeling studies were reported examining the amino acid biosynthesis by Methanospirillum hungatei, Methanothrix concilii, and 17 Methanococcus voltae. All three methanogens are mesophilic anaerobes, which grow at 35°C under an atmosphere of 4:1 Hz-COZ. All require exogenous acetate as an additional . 4 . . . . 5 carbon source With C02, 9 however M. voltae also requires leucme and isoleucme. 0 Treatment of [l-”C]-acetate, [2-”C]-acetate, and ”CO2 with the cell-free lysate of M. hungatei produced phenylalanine and tyrosine with 13C labeling patterns consistent with 1 Treatment of [1—”C]-acetate, [2-”C]-acetate, and ”C02 with the shikimate pathway.5 the cell-free lysate of M. concilii or M. voltae also provided labeling patterns of phenylalanine and tyrosine which were consistent with the results found using M. himgataei.49 HO OH O O OH HZOSPOM ’ m0P03H2 a l H203PO H HO 3 OH 0 0 HO OH / ribose-S-phosphate gcheraldehyde-3-phosphate fructose-G-phosphate HO O H203POMOH C d OH ribulose-S-phosphate \b‘ HO 0 HO 9H HO HZOSPOMOH HOWOPOSHZ i ‘0 OH O HO OH H203PO OH xylulose-S-phosphate sedoheptulose-7-phosphate D-erythrose-4—phosphate c O O OH \I m0P03H2 HZOSPO HO OH HO OH gcheraldehyde-S-phosphate fructose-B-phosphate Figure 7. Non-oxidative Pentose Phosphate Cycle. Enzymes: (a) ribulose-S-phosphate isomerase; (b) ribulose-S-phosphate 3-epimerase; (c) transketolase; (d) transaldolase. Methanobacterium thermoautotrophicum is an autotrophic, thermophilic methanogen, which utilizes CO2 and H2 as the sole carbon and energy sources.52 Bacher and co-workers added [1-”C]—acetate, [2—”C]—acetate, and [1-”C]-pyruvate to growing cultures of M. thermoautotrophicum to study the biosynthesis of nucleotide, flavin, and deazaflavin coenzymes by the archaeal methanogen. Aside from these coenzymes, several amino acids, including phenylalanine and tyrosine, were isolated and their respective l3C labeling patterns analyzed. The labeling patterns of both phenylalanine and tyrosine were identical within experimental limits and were consistent with biosynthesis by the shikimate pathway”, as had been seen earlier using M. hungatei, M. concilii, and 49 M. voltae. However, it was noted that only the C—7 ring atom of tyrosine and phenylalanine was enriched with ”C when [l-”C]-pyruvate was added to the bacterial culture (Figure 8). This result implies only C-2 of erythrose 4—phosphate contained the 13C label, not C-1 and C-2 as would be consistent with the biosynthesis of erythrose 4- phosphate from [l—”C]-pyruvate by the pentose phosphate cycle. To explain these labeling results, Bacher and Eisenreich suggested M. thermoautotrophicum could prepare erythrose 4-phosphate via the carboxylation of pyruvate.53 l9 cozH ct- ° + —> ° O’LLCOZH 1'; OH OH H203PO\/!,\V§O chorismic acid . .1 OH E4P L-tyrosine Figure 8. Observed l3C labeling patterns of tyrosine and tryptophan from acetate and pyruvate added to the growing culture of M. thermoautotrophicum. Enrichment Key: (*), [1-”CJ-pyruvate; (0), [l-”C]—acetate; (O), [2-”C]-acetate. Recognizing a need to further investigate the biosynthesis of different metabolites and especially erythrose 4-phosphate in M. thermoautotrophicum, Bacher and Eisenreich performed a systematic comparison between the labeling patterns of varying amino acids and metabolites. To reconstruct the ”C labeling patterns of central metabolites, Eisenreich and Bacher calculated the average enrichment of carbon atoms supplied to the various downstream metabolites from a specific l3C-labeled atom position of the respective fundamental precursor. The labeling pattern of pyruvate was calculated from the average labeling patterns of alanine, serine, glycine, and the side chains of phenylalanine and tyrosine. When M. thermoautotrophicum was grown with [1,2-”C2J- acetate only C-2 and C-3 of pyruvate were labeled. Enrichment of l3C was observed at C-1 of pyruvate only when [1-”C]-pyruvate was added to the growing culture (Figure 9).54 These findings lent credence to an earlier study by Fuchs and Stupperich suggesting some archaeal methanogens form pyruvate by the reductive carboxylation of acetate.55 The labeling pattern of pentoses was calculated from the labeling patterns of the ribose 20 moieties in each of the four RNA nucleosides. Only C-1, C-3, and C-5 were labeled when [1,2-”C2]-acetate was added to the growing culture of M. thermoautotrophicum, while C-2 and C-3 were enriched with ”C when [1-”C]—pyruvate was added (Figure 9). These results were consistent with pentose formation by the head-to-head dimerization of two trioses followed by oxidative decarboxylation.54 These results indicate a tetrose, such as erythrose 4-phosphate, derived from the hexose pool via the pentose phosphate cycle should contain ”C enrichment at C-1 and C—2 upon addition of [1-”C]-pyruvate to the growing culture of M. thermoautotrophicum (Figure 9).54 This result was not consistent with the earlier observation that phenylalanine and tyrosine formation from [1- ”C]-pyruvate appeared to indicate that only C-2 through C-4 of erythrose 4-phosphate originated from the hexose pool, whereas C-l seemed originate from CO2 (Figure 8).53 OHO o l H203POW° OH OH 0 0 OH OH OH / —> __. —> . pentose t OH * OH —> O a g . 0 OH . o .I 0 H203PO * 0| O O O OH OH O OH acetate pyruvate glyoxalate hexose o o . HzoaPo’N/‘fi OH O tetrose Figure 9. Observed l"C labeling patterns of pyruvate, hexoses, pentoses, and tetroses from, ”C enriched acetate and pyruvate. Enrichment Key: (*), [l-”C]-pyruvate; (0), [1-”C]-acetate; (O), [2—”C]-acetate. Due to the inherent symmetry of benzene rings, the chemical shifts of C-6 and C- 8 of tyrosine and phenylalanine, which represent C-1 and C-3 of erythrose 4—phosphate, degenerate. To further establish the origin of C-1 of erythrose 4-phosphate Bacher and Eisenreich isolated tryptophan produced by the growing culture of M. thermoautotrophicum upon addition of [1-”C]-acetate, [2—”C]—acetate, [1,2-”C2]-acetate, 21 and [l-”Cl-pyruvate. No ”C enrichment was observed at C-7 of tryptophan produced upon the addition of labeled acetate or pyruvate (Figure 8). Had erythrose 4-phosphate been produced via the typical pentose phosphate pathway C-7 of tryptophan should have contained ”C enrichment. These results further indicate that G] of erythrose 4- phosphate did not correspond to C-3 of the hexose pool as would be expected if erythrose 4-phosphate were produced via the pentose phosphate pathway.54 Patel and coworkers examined amino acid biosynthesis using yet another archaeal methanogen, Methanococcus jannaschii. M. jannaschii, originally isolated from a white smoker chimney, is an autotrophic hyperthermophile (optimal growth temperature of 83°C), which utilizes CO2 and H2 as sole carbon and energy sources. Unlike the archaeal methanogens discussed thus far, M. jannaschii does not adequately uptake acetate from the culture media. As such, Patel and coworkers analyzed amino acid biosynthesis through the addition of exogenous pyruvate enriched with ”C at C—1, C—2, or G3. Enrichment at C—6 of phenylalanine and tyrosine was observed when [2-‘3C]-pyruvate was added to the M. jannaschii culture, and likewise OS was enriched when [3—”C]— pyruvate was added.56 Unlike the previous studies with M. thermoautotrophicum,53‘54 Patel and coworkers observed ”C enrichment at both the C-7 and C-8 ring atoms of phenylalanine and tyrosine when [1-”C]-pyruvate was added to the cell culture of M. jannaschii. The relative intensity of the enrichment at C—7 and CS was much lower than was observed at positions labeled using [2-”C]-pyruvate and [3-”C]-pyruvate, which led Patel and coworkers to suggest ”C scrambling had occured.56 In a later study Choquet and coworkers re-examined this labeling result through the careful comparison of natural abundance spectra, and observed that as with M. thermoautotrophicum only the C-7 ring 22 atom of phenylalanine and tyrosine was enriched with ”C when [pl-”CJ-pyruvate was added to the M. jannaschii culture.57 In the process of studying glycogen biosynthesis by M. maripaludis, an autotroph capable of utilizing either H2 or formate as an electron donor, Yu and coworkers assayed for the specific activities of enzymes responsible for pentose biosynthesis. High specific activities were observed for transketolase, transaldolase, D—ribose-S-phosphate 3- epimerase, and D—ribulose—S—phosphate isomerase in the cell-free extract of M. maripaludis. Fructose-6—phosphate and glyceraldehyde-3-phosphate, intermediates in the Embden-Meyerhoff—Parnas pathway, reacted with transketolase to form xylulose-S— phosphate and erythrose 4—phosphate (Figure 7). Transketolase was also able to catalyze the conversion of xylulose—S-phosphate and ribose-S-phosphate to sedoheptulose—7— phosphate and g1yceraldehyde-3-phosphate (Figure 7). Specific activities of glucose-6- phosphate dehydrogenase and 6-phosphogluconate dehydrogenase, however, were not detected in the cell-free lysate of M. maripaludis. The high levels of these pentose- biosynthetic enzymes led Yu and coworkers to suggest pentose biosynthesis occurs through a nonoxidative pentose phosphate pathway.58 However, this suggestion contradicts the earlier ”C labeling studies of M. thermoautotrophicum,53'54 M. jannaschii,57 and M. hungatei,5| which all indicated the preferential enrichment only at C-7 (not both C-7 and C-8) following labeling with [1-”C]-pyruvate. Due to the above conflicting results, it has been proposed that the biosynthesis of erythrose 4—phosphate by archaeal methanogens may occur via the carboxylation of a triose sugar as opposed to the nonoxidative pentose phosphate pathway (Figure 7).58 Tumbula and coworkers, however, suggested erythrose 4-phosphate might not be the 23 precursor of the aromatic amino acids among these archaeal methanogens. The nonoxidative pentose phosphate pathway predicts 66.7% or more of the carbon at the ribose C-l will originate from the C-2 of acetate. Therefore if erythrose 4-phosphate is not diverted from the pathway for aromatic amino acid biosynthesis, exactly 2/3 of the carbon at the C-1 position of cytidine or uridine would come from the C-2 of acetate. If erythrose 4-phosphate was diverted for aromatic amino acid biosynthesis this fraction would increase. However, if erythrose 4—phosphate was produced by carboxylation of a triose, 50% of the ribose C-l would be derived from the C-2 of acetate. Using an acetate auxotroph of M. maripaludis grown on [2-”C]-acetate, the 13C enrichments of cytidine and uridine were determined. Analysis using ”C NMR determined the C-1’ of cytidine contained a 66.6% enrichment of the ”C label from the C-2 of acetate. A similar result of 65.3% was observed for the C-1’ of uridine. These results were confirmed by mass spectral analysis. Two possibilities could explain these results and the previous results obtained with the aromatic amino acids. One is that erythrose 4-phosphate is biosynthesized from both the nonoxidative pentose phosphate pathway and the carboxylation of a triose. The second, considered to be more probable by Tumbula et al., was that erythrose 4—phosphate is produced only from the pentose phosphate pathway and is not used for aromatic amino acid biosynthesis.59 The “missing” genes of archaeal aromatic amino acid biosynthesis Examination of the ribose biosynthetic products as well as the aromatic amino 5153545759 has acids produced by several archaeal methanogens led to the suggestion that in archaeal methanogens, erythroseA-phospate may not be the precursor to the shikimate 24 pathway.59 If erythrose 4—phosphate is not the precursor to aromatic amino acid biosynthesis by these archaeal methanogens several possibilities exist. One explanation is that the enzyme typically responsible for catalyzing the first step of the shikimate pathway, DAHP synthase, exhibits a high degree of substrate ambiguity. This would be similar to the DS-Co isozyme identified in Spinacia oleracea, a DAHP synthase found in the cytosol compartment of the cell. DS-Co from Spinacia oleracea is capable of condensing a diose (glycoaldehyde), triose (D-glyceraldehyde, L-glyceraldehyde, and DL- glyceraldehyde phosphate), tetrose (D-erythrose, L-erythrose, D-erythrose 4—phosphate, D- threose, and L-threose) or pentose (D-ribose 5-phosphate, and D—arabinose 5-phosphate) with phosphoenolpyruvate to form the corresponding 2-keto-3-deoxy-sugar acids. Specific activities were not reported for the varying substrates.60 Another possibility is that the enzyme(s) responsible for the early steps of the shikimate pathway is (are) not present in some archaeal methanogens, causing these microbes to utilize novel enzymes or substrates for the biosynthesis of the aromatic amino acids. This seems to be the case in the halophilic methanogen Methanohalophilus mahii. Attempts were made to obtain specific activities for several key shikimate pathway enzymes (DAHP synthase, shikimate dehydrogenase, chorismate mutase, prephenate dehydrogenase, arogenate dehydrogenase, prephenate dehydratase, and arogenate dehydratase). However, after carrying out an extensive series of extract preparation and assays procedures a specific activity for DAHP synthase could not be found.61 The first complete genome sequence of an archaeal methanogen was reported for M. jannaschii in 1996 at which time only four of the genes required for chorismate biosynthesis were identified.62 After several other archaeabacterial genomes were 25 reported Huguchi and coworkers specifically compared the pathways for amino acid biosynthesis though the identification of genes based on their DNA sequence. To perform this comparison they obtained the genomic sequences of seven archaea: M. jannaschii, M. thermoautotrophicum, Archaeoglobus fulgidus, Pyrococcus abyssi, Pyrococcus sp. OT3, Thermoplasma volcanium, and Aeropyrum pernix. Of the enzymes expected to mediate aromatic amino acid biosynthesis, 14 were not identified in at least one of the archaea. The two autotrophs, M. jannaschii and M. thermoautotrophicum, which would be required to synthesize all 20 amino acids were “missing” only three enzymes expected for aromatic amino acid biosynthesis. DAHP synthase and DHQ synthase were not identified in either of the two autotrophs, A. fulgidus, or P. sp. OT3. Shikimate kinase was not identified in any of the seven archaea,63 however a novel shikimate kinase, belonging to the GHMP-kinase superfamily, as opposed to the structurally unrelated NMP—kinase superfamily, was later identified in M. janrzaschii.64 The apparent absence of genes encoding both DAHP synthase and DHQ synthase in four of the seven archaeal genomes studied would suggest these genes are not required for the biosynthesis of DHQ, or that they are encoded by low-similarity, novel, or “analogous” genes.65 In order to determine whether this unique shikimate pathway proceeds from alternate precursors or utilizes a novel DAHP synthase further study was required. Using GC-MS analysis White observed that the reaction of DAHP with the cell-free lysate of M. jannaschii did not produce either DHQ or DHS. However, incubation of DHQ with M. jannaschii cell-free extract produced DHS quantitatively. These experiments suggested that after DHQ biosynthesis the archaeal shikimate pathway continues as 26 normal.66 The inability of M. jannaschii cell-free extract to produce DHQ from DAHP in combination with the inability of Fischer and coworkers to detect DAHP synthase activity in M. mahii cell free extracts63 seems to suggest this novel archaeal shikimate pathway proceeds without E4P. The suggestion that E4P is not a precursor to aromatic amino acid biosynthesis via this archaeal pathway led to the proposition of a variety of alternatives. Frost proposed 3,7-dideoxy-2,6-dioxo-4,5-D-threo-heptanoic acid (DDTH) could serve as the immediate precursor of DHQ (Figure 10).67 DDTH was originally proposed as the first intermediate of the shikimate pathway in E. coli until DAHP was identified, and has been prepared synthetically from 2-deoxy-glucose by Sprinson. In solution at physiological pH, DDTH cyclizes spontaneously to DHQ.”8 Frost suggested DDTH could be biosynthesized through the aldol condensation of hydroxyacetone and oxaloacetaldehyde, which would be followed by the cyclization of DDTH to form DHQ.67 On the other hand, White suggested the formation of an isomer of DAHP, 3-deoxy-D-rib0- heptulosonic acid 7-phosphate (DRHP) might be the precursor to archaeal amino acid biosynthesis. Figure 10. Alternative DHQ precursors as suggested by Frost. HO, CO H - O O O O OH O 2 tyrosrne /U\,OH + WOH —’ _ ' OH —’ —> phenylalanine O OH tryptophan hydroxyacetone oxaloacetaldehyde DDTH DCI-iQ If this archaeal biosynthetic pathway proceeds via different precursors the precursors as well as the enzymes responsible for DHQ biosynthesis needed to be 27 identified. Using genetic analysis White identified two novel enzymes, M10400 and M11249, based on their association with other genes required for aromatic amino acid biosynthesis. Both genes were annotated as aldolases. White reacted pyruvate and PAP with the heterologously expressed M10400 in an attempt to produce DAHP, however the GC-MS spectra did not correspond to DAHP. Based on this observation he proposed the condensation of pyruvate and E4P produced DRHP (Figure 11). Upon treatment of the presumed DRHP with the cell-free extract of M. jannaschii no DHQ or DHS was observed in the product mixture, excluding this condensation product as the DAHP substitute.66 Figure 11. Alternative DHQ precursors as proposed by White. HO,‘ COQH HO,. COZH tyrosine O OH O )KWOH + H203PO \ ——-> . a» -—->' phenylalanine i O s ’OH O ; OH 0 OH H203PO OH OH tryptophan pyruvic acid E4P DRHP DHO To further establish the actual precursors of the archaeal shikimate pathway White performed a series of experiments using the cell-free extract of M. jannaschii and the proposed enzymes M10400 and M11249. White observed no DHQ or DHS was produced upon reacting E4P with pyruvate, oxaloacetaldehyde, or PEP in the presence or absence of coenzymes (F420, Zn”, and NAD) while using either the cell-free extract of M. jannaschii or M10400 expressed from E. coli. White used these results to eliminate PEP, pyruvate, and E4P as precursors of archaeal amino acid biosynthesis. He then considered the C-3 unit of the condensation to form DHQ might come from glucose 6—phosphate, while the C—4 unit might be derived from homoserine or its possible derivatives.66 28 To test his hypothesis that glucose 6-phosphate and another 04 unit were the precursors to DHQ biosynthesis by archaeal methanogens, White performed another series of experiments using the cell-free extract of M. jannaschii. As the 03 unit precursor White chose dihydroxyacetone, fructose 1,6-diphosphate, glucose 6-phosphate, glycerol phosphate, dihydroxyacetone phosphate, hydroxyacetone, and 6-deoxy-5- ketofructose l-phosphate (DKFP). He used pyruvate, homoserine, and aspartate semialdehyde as the C—4 precursors. From the production of DHS and epi—shikimate produced from a variety of combinations of these C-3 and C-4 units, White deduced the C-3 unit might be derived from glucose 6-phosphate (most likely DKFP), while the C-4 unit might be derived from homoserine (most likely aspartate semialdehyde) (Figure 12).66 To confirm his suspicions, White further examined the condensation of DKFP with aspartate semialdehyde in the presence of one or both enzyme, M10400 and M11249, and a variety of coenzymes. The highest level of DHQ production achieved was through the condensation of DKFP and aspartate semialdehyde in the presence of both M10400 and M11249 and NAD. White also observed the production of what he presumed to be 4,5-dihydroxy-6-methylpipecolinic acid upon sodium borohydride reduction of the product mixture obtained when DKFP and aspartate semialdehyde were reacted with M10400 alone. These results led White to the conclusion that DKFP and aspartate semialdehyde were the precursors to the shikimate pathway in M. jannaschii (Figure 12). 29 O OH + HO O O ”“30 ———»" Y'YYCOZ— J\ll/\ H203PO)H—OS—< + ‘OgCMH + H o OPO3H2 0 OH 5H, DKFP L-aspartate semialdehyde ATTH 2-0x0-propionaldehyde 3-phosphate NADHj NAD a / L NAD 07 002- NADH, NH3 HOMNHQ co; HO L-homoserine I“: CC; a 9“ 0 OH 0 OH DDTH NaBH4 1c? co; HN HO, CO; phenylalanine g OH —’____, tyrosine OH O OH OH tryptophan DHO Figure 12. Proposed archaeal shikimate pathway. Enzymes (genes): (a) homoserine dehydrogenase, mj1602; (b) aldolase, ij400; (c) transaminase, mj1249. 30 CHAPTER TWO UDP-3-KETOGLUCOSE INTERMEDIACY IN KAN OSAMINE BIOSYN THESIS Introduction Many biologically active natural products, such as the rifamycin, ansamytocin, and mitomycin antibiotics, are derived from a common precursor, 3-amino-5- hydroxybenzoic acid (AHBA). The biosynthesis of AHBA has been studied in a variety of organisms, which produce ansamycin69 and mitomycin70 antibiotics. Through labeling studies using ”C— and l4C-glucose, glycerate, and other precursors it was hypothesized that AHBA was synthesized via the shikimate pathway.28 However, studies attempting to incorporate labeled shikimate pathway intermediates (such as Shikimic acid (SA), quinic acid (QA), 3~dehydroshikimic acid (DHS)) and 3—deoxy-D-arabino-heptulosonate 7— phosphate (DAHP) failed to yield AHBA.20 Floss and co-workers proposed an alternative pathway analogous to the early steps of the shikimate pathway, but where a nitrogen atom is incorporated during the first biosynthetic step to produce an amino analog of DAHP (Figure 13). The proposed intermediates aminoDAHP, aminoDHQ, and aminoDHS were synthesized and shown to be precursors to AHBA biosynthesis in Amycolatopsis mediterranei S699 cell-free extract.71 31 HO HO H203PO O O O OH O H HO"' "'OUDP _>___, HO"' OH ___> -.,,/OH <— H203PO\/K./J§NH \‘n HO ’OH HZN ’OH HO NH2 OH UDPG kanosamine aminoF6P iminoE4P C02H 002” NADPH H 0 PO " 2 3 Ho, COZH pi Ho,_ COZH COzH 0‘ 5H NH2 PEP ' a O .4, _Z_> Ob‘fi eNADP aminoSA S a NH2 b O NH2 0 l aminoDAHP aminoDHQ aminoDHS COZH H20 : / HO NH2 nfamycmB / AHBA Figure 13. Aminoshikimate pathway. Enzymes (gene designation): (3) DAHP synthase, rifH; (b) DHQ synthase, rifG; (c) DHQ dehydratase, rifJ; shikimate/quinate dehydrogenase, rifl; (e) AHBA synthase, rifK. It was originally suggested transamination of E4P could introduce a nitrogen atom to form iminoE4P, which upon condensation with PEP would provide aminoDAHP.71 However, prone to dimerization, trimerization, and polymerization in solution, nature is forced to keep the steady state concentration of E4P as low as possible.34 Transamination of E4P then seemed unlikely. Frost and Guo suggested an alternative route for amino introduction where the condensation of aminoF6P with ribose 5-phosphate R5P by transketolase would produce iminoE4P and S7P.33 AminoF6P was synthesized and treated under varying conditions with E. coli transketolase and A. mediterranei cell—free extract to produce aminoDAHP and AHBA. Since aminoF6P could be used as a biosynthetic precursor to aminoDAHP, it can be inferred that iminoE4P is an intermediate in this step and aminoF6P is its precursor (Figure 13).33 32 With the establishment of aminoF6P as the precursor to iminoE4P, attention turned toward the origin of aminoF6P. Since F6P is generally prepared biosynthetically via the isomerization of glucose 6-phosphate,1 it was suggested that a natural product, 3- amino~3-deoxy-D—glucose 6-phosphate (kanosamine 6-phosphate), could act as the precursor to aminoF6P.35 The phosphorylation of kanosamine by the action of a specific kinase would provide kanosamine 6-phoshate. Kanosamine biosynthesis was first detected and studied in the 1960’s.72 Since the original discovery of kanosamine, various microbes have been found to produce kanosamine as a biosynthetic end product or as an intermediate en route to other natural products,73 such as kanamycin in Bacillus aminoglucosidicus (now known as Bacillus pumilus). It was believed that A. mediterranei might also make use of kanosamine as a biosynthetic intermediate and possibly as the means for supplying the nitrogen atom into the aminoshikimate pathway. Using both the cell-free lysate of A. mediterranei as well as the putative aminoDAHP synthase from A. mediterranei, RifH, aminoDAHP was prepared from kanosamine 6-phosphate (K6P). AHBA was also produced when K6P was treated with A. mediterranei cell-free lysate. When K6P was replaced with G6P, however, no AHBA was observed.35 Among the genes of the rif biosynthetic gene cluster, riflV, encodes an enzyme sharing sequence homology with a glucose kinase from Streptomyces coelicolor A.28 Floss and coworkers have shown the gene product of rifN is a specific kinase capable of producing K6P from kanosamine in the presence of ATP.36 These results in combination with the production of aminoDAHP from K6P by the action of RifH indicates 33 kanosamine is the biosynthetic precursor and nitrogen source of the aminoshikimate pathway (Figure 13). HO HO O cell-tree extract 0 HOW MOUDP , —> HOW OH . glutamine, NAD , HO ’OH HZN ’OH UDPG kanosamine NAD 1 a C NADH HO b HO O glutamine O HO"' ' 'OUDP 7X» HO'" "'OUDP 0 ’OH NADH AD H2N ’OH ketoUDPG UDPK Figure 14. Proposed route for kanosamine biosynthesis from UDPG. Reaction enzymes: (a) oxidoreductase, rifL; (b) transaminase, rifK, (c) pyrophosphorylase, rifM. Abbreviations: UDPG, uridine 5’-diphospho-a—D-glucose; 3- ketoUDPG, uridine 5’~diphospho-3-keto-0t-D-glucose; NAD, nicotinamide adenine dinucleotide; NADH nicotinamide adenine dinucleotide reduced; UDPK, uridine 5’diphospho-a-D-kanosamine. With the establishment that kanosamine is the source of the amine nitrogen for AHBA biosynthesis, interest shifted to the biosynthesis of kanosamine and the amine nitrogen incorporation. The biosynthesis of kanosamine was originally studied using Bacillus pumilus through experiments with 1“C labeled glucose, pyruvate, glycerol, and sodium acetate.72 It was found that all of the carbons of glucose were present in the kanosamine produced. In B. pumilus, kanosamine biosynthesis was found to require glutamine, UTP, NAD, MgClz, and ATP. From these results, two biosynthetic pathways were proposed. One pathway involved the phosphorylation of glucose to glucose 1- phosphate, followed by pyrophosphorylation to UDPG. The UDPG would then be oxidized to UDP-3-keto-D-glucose (3-ketoUDPG), which would be transformed into 34 UDP—3—amino-D-glucose or UDP-kanosamine (UDPK). The UDP would be cleaved finally to yield kanosamine (Figure 14). The second pathway entailed the oxidation of glucose to 3-keto—D-glucose followed by kanosamine production through transamination of this keto-intermediate. However, the second pathway was eliminated after kanosamine was not produced upon incubation of 3-keto—D-glucose with the cell—free lysate of B. pumilus.72 In order to show kanosamine is produced from UDPG, UDP- |6,6-2H2|-glucose was prepared and treated separately with both the cell—free lysate of A. mediterranei and B. pumilus. In both cases [6,6-2Hzl-kanosamine was produced suggesting that nitrogen incorporation occurs biosynthetically in this step.35 Among the enzymes belonging to the rif biosynthetic gene cluster are those proposed to catalyze the biosynthesis of kanosamine. By sequence homology, the gene product of rifl. was found to be similar to a class of oxidoreductases implicated in the interconversion of hydroxyl and carbonyl groups.28 Specifically, RifL has homology to the gene product of par/0 found in Streptomyces alboniger puromycin biosynthesis, which selectively oxidizes the 3’-hydroxyl group of ATP to a ketone in the presence of NAD.74 This similarity indicates RifL may be the oxidoreductase responsible for the proposed oxidation of UDPG to 3-ketoUDPG during kanosamine biosynthesis. The gene product of rifK has been identified as AHBA synthase responsible for the catalysis of AHBA from aminoDHS.26 Database screening using the protein sequence of RifK showed homology to genes implicated in transamination or dehydration/deoxygenation reactions in deoxyhexose biosynthesis as well as those with PLP/PMP dependency. These results led to the proposition of RifK holding a dual role in 35 AHBA biosynthesis as both AHBA synthase and possibly the aminotransferase catalyzing the production of UDPK from 3-ketoUDPG in kanosamine biosynthesis.26 This chapter will focus on the preparation of 3-ketoUDPG as well as its evaluation as a biosynthetic intermediate from UDPG to kanosamine in both A. mediterranei and B. pumilus. The conversion of 3-ketoUDPG and [3-H2]-UDPG to kanosamine was examined using the cell-free extracts of A. mediterranei and B. pumilus under varying reaction conditions. The oxidation of UDPG to 3-ketoUDPG was examined using the putative oxidoreductase from A. mediterranei, RifL. The transamination of 3-ketoUDPG by the putative aminotransferase from A. mediterranei, RifK, to produce UDPK was also studied. Finally this chapter will address the source of nitrogen incorporated into kanosamine during its biosynthesis. Synthesis of 3-ketoUDPG Overview In order to investigate kanosamine biosynthesis and the origin of kanosamine’s nitrogen atom, it was determined the intermediates 3-ketoUDPG and UDPK needed to be prepared. Chemoselective modification of carbohydrates tends to be difficult and laborious due to the presence of multiple nearly equivalent hydroxyl groups.75 The probable instability of the desired 3-ketoUDPG poses another obstacle to chemical synthesis, as elimination of UDP would likely occur under basic conditions. An enzymatic synthesis offered several advantages including regioselectivity and the ability to perform reactions in aqueous media. 36 Agrobacterium tumefaciens, a microbe that induces tumor formation and crown gall disease in plants,76 has been studied extensively to understand its unique metabolism of polysaccharides, more specifically sucrose (Figure 15). Using this microorganism, Bernaerts and De Ley described the first microbial formation of 3-ketoglycosides.77 Different groups applying growing bacteria, resting cells of A. tumefaciens, or the purified enzyme expanded the use of this microbial oxidation reaction to a variety of sugars.78 Van Beeuman and De Ley identified the flavin adenine dinucleotide-dependent inducible enzyme responsible for this oxidation reaction as hexopyranoside cytochrome c: oxidoreductase.79 Hayano and Fukui later proposed use of the simpler name D— glucoside 3—dehydrogenase.80 GBDH Ho" 0-»«0u ‘OH > HO" O-vuoI- \OH FAD OH HO OH HO FADH2 H20 1/2 02 Figure 15. Mechanism for the oxidation of sucrose to 3-ketosucrose by the glucoside- 3-dehydrogenase from A. tumefaciens. Abbreviations: G3DH, glucoside-3-dehydrogenase; ETP, electron transport pathway. Fukui, using both the purified enzyme and the standing cells of A. tumefaciens, reported the oxidation of glucose-l-phosphate to 3-ketoglucose-1-phosphate.8| Fukui also identified and reported the whole-cell oxidation was composed of three processes: 1) entry of the substrate into the cells by an active transport mechanism; 2) conversion of the substrate to the product by D-glucoside—3-dehydrogenase; 3) exit of the product into 37 the reaction media. Fukui also observed the accumulation of phosphate in the culture media as the microbe metabolized 3—ketoglucose-1-phosphate.81 In order to improve 3- ketoglucose-l-phosphate production Fukui derived a mutant, A. tumefaciens M-24, unable to grow on glucose—l-phosphate.82 The inability of the mutant to utilize glucose- 1-phosphate as a carbon source was linked to the inability of the standing cells to degrade 3-ketoglucose-1-phosphate, thus, effectively increasing the levels of 3-ketoglucose-l- phosphate concentrations expelled into the culture media.82 This mutant was then used to oxidize UDPG to the corresponding 3—ketoUDPG. 83 Synthesis of 3-ketoUDPG using partially purified glucoside-S-dehydrogenase When Fukui originally oxidized UDPG to 3-ketoUDPG there was no mention of attempting the oxidation with the native strain of A. tumefaciens.83 Without access to the mutant strain, it was believed that performing the oxidation using the purified enzyme might be more successful. However, the literature purification was lengthy and required a large quantity of cells to provide a small amount of the desired protein.84 Cells from 4 L of A. tumefaciens NCPPB 396 culture were combined and resuspended in 30 mL of a 0.03 M phosphate buffer at pH 7.0. The cells were lysed by two passes through a French pressure cell, and the insoluble, cellular debris was removed by centrifugation. The glucoside-3-dehydrogenase was precipitated at 70% ammonium sulfate saturation. The precipitate was then resuspended in a buffer containing 0.05 M phosphate and 0.01 M sucrose, and absorbed onto a DEAE column pre-equilibrated with 0.01 M phosphate buffer (pH 7.0). Glucoside—3-dehydrogenase was eluted with a linear gradient of 0 — 0.2 M KCl in 0.01 M phosphate/ 0.01 M sucrose buffer. After concentration and dialysis, 1.9 38 mL of protein solution contained 2.3 units of glucoside—3-dehydrogenase (Table 2). An SDS—PAGE gel of the protein solution contained a band consistent with the literature reported molecular weight of glucose—3-dehydrogenase (68 kDa).84 The glucoside-3-dehydrogenase activity was measured using an alkali assay.35 A known concentration of sucrose was treated with the enzyme solution at 27°C in a phosphate buffer. At 30 minute intervals, 100 yL aliquots were removed and added to 3 mL of 0.1 N NaOH solution. After 3 minutes at room temperature, the absorbance of 1 mL of the solution was measured at 340 nm. Table 2. Purification of glucoside-3-dehydrogenase. Tot. Prot. Sp. act.a Tot. Act. Purification step Vol. (mL) Yield (%) (mg) (units/mg) (units) Crude 38 1330 0.03 36 100 Ammonium Sulfate 6.0 120 0.10 10 27 DEAE-cellulose l .9 8.6 0.28 2.3 6.4 (a) units = ymol/min-mg Using 2,6-dichloroindolphenol as an electron acceptor, attempts were made to oxidize UDPG to 3-ketoUDPG using the partially purified glucoside-3-dehydrogenase. However, attempts to isolate the desired product failed, and only UDPG was observed. The failure of the reaction to provide 3-ketoUDPG was presumed to be due to the low amount of glucoside—3-dehydrogenase obtained after partial purification from A. tumefaciens NCPPB 396. 39 Synthesis of 3-ketoglucose-l-phosphate using A. tumefaciens standing cells Although Fukui did not report the preparation of 3-ketoUDPG using the wild- type strain of A. tumefaciens, 3-ketoglucose-1~phosphate was isolated from the oxidation of glucose l-phosphate.81 It was hypothesized that 3—keto—glucose l-phosphate, produced from A. tumefaciens cells from glucose l-phosphate, could be condensed with UTP to form 3-ketoUDPG using UDPG pyrophosphorylase (UGPase) in the presence of inorganic pyrophosphatase. Cultures of A. tumefaciens NCPPB 396 were grown on a minimal salts medium (200 mL) containing sucrose as both carbon source and inducer of glucoside-3- dehydrogenase production. The cells were harvested by centrifugation, rinsed with 5 mM Tris-HCl at pH 8.2, and resuspended in 20 ml. of the same buffer. Glucose-l—phosphate was added to the suspension and the reaction was incubated in a shaker at 28°C and 250 rpm. Aliquots were removed periodically and analyzed by assay to determine if 3— ketoglucose-l-phosphate was produced. Upon removal of the cells, the product was isolated by ethanol precipitation. 3—Ketog1ucose-1-phosphate was identified in the crude product mixture by both 1H and 31P NMR. However, purification of the product caused the B-elimination of the phosphate to produce an endiolone (Figure 16), (+)-(2R,3R)—3,5- dihydroxy-2-hydroxymethyl-2,3—dihydro-4H-pyran-4-one. When the purification step was eliminated, the 3-ketoglucose-l-phosphate obtained was still contaminated with the enediolone. Later it was realized that the Tris salts from the oxidation reaction buffer could be catalyzing the B-elimination upon lyophilization. To remove Tris salts, the product solution was absorbed onto a plug of Dowex 50 (H+ form) followed by elution of the product with water. The pH of the eluant was adjusted to 4 with NaOH solution and lyophilized to yield 3-ketoglucose-l-phosphate free of the endiolone (Figure .16). HO HO HO O a O b O HO“. "'OPOSHa ____.. HO'" "'OF’03H2 _, HO": / ’ ’ 6H HO OH O OH O HO HO HO O a O O HO'“ "'OPOSHZ —_’ HO"' "‘OP03H2 + H0." / HO >0H 0 6H 0 "OH HO HO O C O HO'" "'OP03H2 "——'> HO.” "' 0P03H2 HO "0H 0 6H Figure 16. Preparation of 3-ketoglucose-l-phosphate using the standing cells of A. tumefaciens. Reaction Conditions: (a) A. tumefaciens cells, 5 mM Tris-HCl pH 8.2; (b) Anion exchange column (AG1-X8) followed by cation exchange (Dowex 50 (H+ form)); (c) i. A. tumefaciens cells, 5 mM Tris-HCI pH 8.2; ii. Cation exchange column to remove Tris salts (Dowex 50 (Hi form)). Synthesis of 3-ketoUDPG from 3-ketoglucose-l-phosphate UDPG is prepared from glucose-l-phosphate in several different ways (Figure 17). One method is to treat glucose—l—phosphate with UDPG pyrophosphorylase in the presence of UTP and inorganic pyrophosphatase.86 The inorganic pyrophosphatase is required in the reaction to convert inorganic pyrophosphate formed into inorganic phosphate. This drives the equilibrium of the reaction toward the formation of UDPG and restricts the reformation of glucose-l-phosphate. However, any attempt to produce 3-ketoUDPG from 3-ketog1ucose-l-phosphate under these conditions failed. Presumably, the pyrophosphorylase cannot utilize the keto substrate. 41 HO HO o a o HOH- -'IOPO3H2 —» HOW «cum 0 OH O OH HO O H HO 0 o’\\ Q 0 Y“ o b 0 HO... «IQPQ3H2 + \\/N.P"OA(—7‘NJ ——-> HOII- . .aIOUDP .’ HO ,. . I O OH HO‘ [OH O OH Figure 17. Preparation of 3-ketoUDPG from 3-ketog1ucose-l-phosphate. Reaction conditions: (a) UGPase, UTP, PPase, MgClz, no reaction; (b) DMF, pyr, trace product. - The condensation of glucose- 1 -phosphate with uridine 5’- monophosphomorpholidate in the presence of base is another method used to prepare UDPG. The morpholidate is first repeatedly azeotroped with dry pyridine to remove any water. Upon addition of the morpholidate in pyridine to the 3-ketoglucose-1-phosphate, dry DMF was added and the reaction allowed to continue at room temperature. After 6 days, only traces of 3—ketoUDPG were observed, making this route undesirable (Figure 17). Synthesis of 3-ketoUDPG from UDPG using the standing cells of A. tumefaciens It was originally presumed that 3-ketoUDPG could not be prepared using the wild type strain of A. tumefaciens. Fukui used the mutant strain M—24 with no indication whether an attempt was made using the native strain.83 Similar to the oxidation of glucose—l-phosphate, the treatment of UDPG by the standing cells of A. tumefaciens originally resulted in B-elimination of UDP to form the endiolone (Figure 18). However removal of the Tris salts with cation exchange resin followed by lyophilization provided 3-ketoUDPG in 40% yield (Figure 18). The 3-ketoUDPG was characterized by 1H NMR, 13C NMR, GCOSY 2D NMR, and mass spec electrospray analysis. The final product 42 contained several impurities later confirmed by HPLC analysis to be uridine, UMP, and UDP. These impurities were presumably produced upon degradation of 3-ketoUDPG by the standing cells of A. tumefaciens. The 3-ketoUDPG produced was not purified beyond the removal of the Tris buffer for fear the desired product would not survive the purification. HO Ho 0 a 0 HO» MOUDP —> How / HO OH 0 OH HO HO O b O HON- “IOUDP —> HOn- "IOUDP HO .’OH 0 6H Figure 18. Preparation of 3-ketoUDPG from UDPG using the standing cells of A. tumefaciens. Reaction conditions: (a) A. tumefaciens cells, 5 mM Tris-HCI, pH 8.2; (b) i. A. tumefaciens cells, 5 mM Tris-HCl, pH 8.2; ii. Dowex 50 (H+ form). Reaction of 3-ketoUDPG with the cell-free extract of A. mediterranei The analysis of 3-ketoUDPG intermediacy in the production of kanosamine by A. mediterranei required the preparation of A. mediterranei cell—free extract. A 4 L culture of A. mediterranei cells was grown on YMG medium for 2 days. The cells were harvested by centrifugation and resuspended in a 50 mM Tris-HCl buffer at pH 7.5 containing 20% glycerol and 1 mM PMSF. The cells were harvested by centrifugation and resuspended in 5 mL of the same buffer per gram of wet cells. The cells were lysed by two passes through a French pressure cell and the cellular debris was removed by centrifugation. The lysate was then dialyzed six times by repeated dilution and concentration using a 300 mL Amicon ultrafiltration system at 4°C. The lysate was then used directly for the cell-free reactions. 43 The prepared 3-ketoUDPG was treated with the cell-free lysate of A. mediterranei in the presence of NADH, glutamine, and MgCl2 at 28°C for 6 h. The protein was then removed by ultrafiltration. The supernatant was treated with ethanol to precipitate the product and remove the glycerol. The pellet was rinsed with ethanol and resuspended in d.d. H20. Kanosamine was produced in 6% yield as determined by 1H NMR analysis and the use of a calibration curve based on the or-carbon. An interesting point with this reaction is that no 3-ketoUDPG was observed in the product mixture of this reaction. However UDPG and another product later identified as UDP-galactose were observed. As a positive control UDPG was reacted with NAD, MgClz, and glutamine using a portion of the same cell-free lysate to produce kanosamine in 8% yield. Role of NAD in A. mediterranei kanosamine biosynthesis Overview It has been presumed that during kanosamine biosynthesis the NADH cofactor produced upon oxidation of UDPG to 3-ketoUDPG by the oxidoreductase (presumably RifL) is used as a reducing factor during the transamination of 3-ketoUDPG to UDPK.72 In doing so, the organism would be using a biosynthetic mechanism similar to that used by DHQ synthase during the isomerization of DAHP to DHQ in E. coli.87 It has also been proposed that the two enzymes thought to be responsible for the oxidation and transamination steps, RifL and RifK, might form a complex,36 which would further suggest a mechanism similar to that used by DHQ synthase. A strategy was developed to determine if the oxidation/transamination reactions PCrformed by A. mediterranei cell-free lysate utilize a DHQ synthase-type mechanism 44 through the incorporation of a 2H label into the starting UDPG. The oxidation of [3—2HJ- UDPG by the oxidoreductase would cause the 2H to be transferred to the NAD cofactor to form [ZHJ—NADH. If NADH is used as a reducing equivalent in the transamination of 3— ketoUDPG the 2H should be reincorporated into the product on some level. Also, the presence of 2H in the product kanosamine would lend some credence to the suggestion of a RifL/RifK complex in vivo. Synthesis of [3-H2]-glucose To prepare [3-2H]-UDPG a chemical synthesis was first employed to prepare [3— 2H]-glucose from glucose (Figure 19). The collective protection of the C-1, C-2, C-4, and C-6 alcohols of glucose was accomplished through the treatment of glucose with acetone, zinc, and 85 % 1H3PO4 to produce diisopropylidene glucose in 60% yield. The free hydroxyl group at C-3 was then oxidized with PDC to produce the ketone in 91% yield. The ketone was then reduced back to the alcohol in 60% yield with NaBD4 to incorporate a 2H label at C-3. Since the reduction of 3-ketoglucosides with NaBH4 gives the allo- configuration instead of the desired gluco—, the reduction was followed by a Mitsonobu reaction using DIAD to give the inverted alcohol in 44% yield. The 2H- labeled diisopropylidene glucose was then deprotected with 2N HCl to provide [3-H2]- glucose in quantitative yield. The [3-H2]-glucose was produced in 14% overall yield. The product was characterized by 1H, 13C NMR, and mass spec. 45 HO o O O o a )< )< C A O HObOH —-> O O "'O L O O "'O ——> O "'0 —d> HO 'OH HO "0* 0 "OT 0 EH70 )(0 HO O O OLE—Juno .9... HobOH H0 1370* HO 5 "OH Figure 19. Synthesis of [3-H2]-glucose from glucose. Reaction conditions: (a) acetone, ZnClz, 85% H3PO4, r.t., 60%; (b) PDC, CH2C12.AczO, reflux, 91%; (c) NaBD4, EtOHszO (9:1), 60%; (d) i. DIAD, Ph3P, benzoic acid, benzene, ii. 1% NaOH/MeOH, 44%; (e) 2 N HCl, quant. Synthesis of [3-H2]-UDPG Starting from glucose, a one-pot reaction can be used to prepare UDPG. The glucose is first phosphorylated to glucose—6-phosphate with hexokinase and UTP. The UDP produced in the phosphorylation is then recycled back to UTP with PEP by pyruvate kinase. The glucose-6-phosphate is then isomerized to glucose-l-phosphate using phosphoglucomutase. The glucose-l-phosphate is then converted to UDPG with UTP and UDPG pyrophosphorylase while the inorganic pyrophosphate produced in the reaction is converted to inorganic phosphate with inorganic pyrophosphorylase. At the time of the study UDPG pyrophosphorylase (UGPase) was not commercially available as it was backordered and would not be available for some time. When purchased, the UGPase was expensive and the enzyme was provided in a powdered form, which made accurate unit calculation difficult. Overexpression of gal U, the gene that encodes UGPase in E. coli, provided a solution to these problems. The gene gal U was inserted into pJG7.248 (T5, lacO, lacO, 6 x his, lacl", Amp’), derived from pQE30 (T5, lacO, lacO, 6 x his, Amp’), to form pHS3.244 (T5, lacO, lacO, 6 x his, gal U, lacl", Amp'). E. coli DHSa was transformed with pHS3.244 and gal U was expressed by 46 the addition of IPI‘ G. UGPase was purified from the cell-free lysate using Ni2*-NTA resin. The specific activity was measured to be 64 U/mg (where one unit indicated the formation of NADH in ymol/minmg). :Zb H203PO Ho 0 OH 7: Hgbmc -——> HobopoaHzfl Hob-'IOUDP Ob ’OH ”O [3 ’OH UTP UDP “0 ’ ’o UTP PPi “0 E) ’OH >9< l: Pyruvate PEP 2Pi Figure 20. One-pot enzymatic synthesis of [3-H2]-UDPG from [3-H2]-glucose. Enzymes: (a) Hexokinase; (b) Pyruvate kinase; (c) Phosphoglucomutase; (d) UDPase; (e) PPase. Abbreviations: UTP, uridine 5’-triphosphate; UDP, uridine 5’-diphosphate; PEP, phosphoenolpyruvate; PPi, inorganic pyrophosphate; Pi, inorganic phosphate. [3-HZJ-glucose was treated in one pot with hexokinase, pyruvate kinase, phosphoglucomutase, UGPase, PPase, UTP, and PEP to produce [3-H2]—UDPG (Figure 20). Initial attempts to purify the final product using an anion exchange resin failed to yield a clean product. The impurities were identified as UMP and UDP. To avoid producing the UMP and UDP it was thought the reaction might be run in stages where [3— HZJ-glucose-6-phosphate could be prepared first from l3-2H]-g1ucose, purified, and then converted to [3-H2]-UDPG using the remaining enzymes and UTP. Unfortunately UGPase activity is inhibited by a large concentration of glucose 6-phosphate and the reaction failed. 86 Using the original one-pot procedure with unlabeled glucose, a variety of purification methods were attempted to remove the contaminating UMP and UDP (Table 3). All of the methods using anion exchange resin failed to provide pure product. Silica gel radial chromatography did provide clean UDPG, however the method was difficult to repeat as the amount of water in the eluant often caused the silica gel to break away from 47 the base plate. Paired ion chromatography using reverse phase HPLC did provide clean material after the salts (NaHCO3 and tetrabutylammonium hydrogen carbonate (TBAHC)) were removed by treatment with Dowex 50 (H* form). The [3-H2]-UDPG was prepared in 75% yield after purification with 86% H2 incorporation at C—3. The product was characterized using 1H and 13C NMR, 2D NMR analysis, and mass spec. Table 3. Methods used to purify [3-H2]-UDPG. Entry Purification media Eluant 1 AGl-X8 (HCO3' form) 0 - l M TEAB pH 7.0 2 AGl-X8 (CH3C02' form) 0 — 4 M NaOAc pH 7.0 3 Dowex1x2—200 (HCO3' form) 0 — 1 M NaHCO3 pH 7.0 4 Dowex1x2-200 (HCO3' form) 0.5 — 1 M NaHCO3 pH 7.0 5 Silica gel radial chromatography 1:4 H202EtOH 6 HPLC C-18 reverse phase 123021;; EEHCO” 2'5 mM TBAHC’ Reaction of [3-H2]-UDPG with A. mediterranei cell-free lysate A. mediterranei cell-free lysate was prepared as previously described. The [3- HZJ-UDPG was treated with the cell-free lysate in the presence of NAD, MgClz, and glutamine. The protein was removed by ultrafiltration after 6 h of stirring at 28°C. The supernatant was diluted with EtOH and the precipitate collected by ultrafiltration. The precipitate was rinsed with EtOH, dried, and dissolved in d.d. H20. The solution was absorbed onto a 10 mL column of Dowex 50 (H+ form) resin. The resin was washed with d.d. H20, and the product was eluted with a linear gradient of 0-2 N HCl. The fractions were assayed for amine content using a ninhydrin assay. The kanosamine produced in 48 the reaction was characterized by 1H NMR and mass spec analysis. The kanosamine was produced in 9% yield and contained 86% H2 incorporation. Since the substrate [3-H21- UDPG contained 86% H2 incorporation the [3-H2]—kansosamine produced essentially retaining 100% of the label. Figure 21. Reaction of [3-H2]-UDPG with the cell-free lysate of A. mediterranei. HO HO O A. mediterranei 0 HOW --IOUDP cell-free extract HO» OH ; > NAD, Gln r ; ', HO D OH H2N D OH 86% D 9% 86% D In order to better understand the enzymes performing the oxidation and transamination steps of kanosamine biosynthesis, [3-H2]-UDPG was treated with A. mediterranei cell-free lysate in the presence of glutamine, MgClz, and a 1:1 ratio of NAD and NADH. If the enzymes form a complex as Floss and co-workers have indicated, the [2H]-NADH formed during the oxidation might not be released into the reaction media, thereby giving the same H2 incorporation observed when no NADH was added to the reaction. However, if the [2H]-NADH is released into the reaction supernatant, the H2 incorporation should be lower than that observed when no NADH is added to the reaction. However, the reaction yielded no kanosamine. The lack of kanosamine production was presumably due to inhibition by NADH of one of the proceeding enzymatic steps. NADH “trapping” Another possible way to elucidate the mechanism of conversion of UDPG to UDPK through 3-ketoUDPG is through a “trapping” experiment.88 If the mechanism 49 involves an enzyme complex, no NADH would be released during the course of reactions. However, if the enzymes perform the reactions separately, NADH would be released. The released NADH could then be “trapped,” and kanosamine would theoretically not be produced. In this case 3—ketoUDPG should be observed in the reaction mixture. In order to “trap” any NADH that might be produced in the reaction, two methods of NADH regeneration to NAD were employed (Figure 22). The first method attempted was the addition of diaphorase and methylene blue to the cell-free experiments. Upon treatment of UDPG, glutamine, NAD, and methylene blue with A. mediterranei cell-free extract and diaphorase; neither 3-ketoUDPG nor kanosamine was observed. To ensure that the lack of product produced with the A. mediterranei cell-free extract was not due to inhibition by methylene blue, a second regeneration technique using glutamate dehydrogenase, 2-oxoglutarate, and NH4OH was used. Still no kanosamine or 3-ketoUDPG was observed in the reaction mixture with A. mediterranei cell-free extract. In conclusion it appears NADH is required for the transamination- reduction of 3-ketoUDPG to UDPK by enzymes in the cell-free lysate of A. mediterranei. Figure 22. Co-factors for the in situ regeneration of N AD from NADH OH O DialF’horase Glutamate Dehydrogenase HJ‘R R H A: N o _ «O I) , 0M0 |\|l ’ S N O O N AD N ADH methylene blue 2-oxoglutarate - H >< AH. I: :I N I: :| 'owHa o- ‘ N s N ’ m AH A | | L-glutamate 50 Expression and Analysis of RifL and RifK Overview Purification of AHBA synthase, which aromatizes aminoDHS to form AHBA, and subsequent cloning of the encoding gene, rifK, by reverse genetics led the way for Floss and co-workers to clone, sequence, and analyze the 95 kb rif biosynthetic gene cluster responsible for rifamycin biosynthesis in A. mediterranei.26 Further studies by Floss and co-workers identified seven genes of the rifamycin biosynthetic gene cluster, rifG, -H, -J, -K, -L, -M, and —N, which were involved in AHBA biosynthesis. Of those three, rifG, -H, and —J, encode homologs to shikimate pathway enzymes identified as aminoDHQ synthase, aminoDAHP synthase, and aminoDHQ dehydratase respectively.28 The gene product of riflV was later identified by Floss as a kanosamine-specific kinase catalyzing the production of kanosamine-6-phosphate. The gene product of rifM shares sequence homology to phosphatases among the CBBY family and has been found to catalyze the specific cleavage of UDPK and kanosamine l-phosphate to kanosamine.36 The remaining enzyme along the rif biosynthetic gene cluster, rifL, was found to be necessary for AHBA production in A. mediterranei. The gene product of rifL shares homology with a class of oxidoreductases that have been linked to the interconversion of hydroxyl and carbonyl groups.36 This class of enzymes includes glucose-fructose oxidoreductase from Zymomonas mobilis and the gene product of purl 0 in Streptomyces alboniger puromycin biosynthesis. The gene product of purl 0 was found to be an NAD- dependent ATP dehydrogenase.74 The subsequent amino transfer to the oxidized ATP, 51 presumably by the gene product of pur4, mirrors the presumed oxidation and transamination of UDPG to produce UDPK. To confirm the remaining step in kanosamine biosynthesis requires the identification of the transaminase. Of the genes along the rif biosynthetic gene cluster two shared sequence homology to aminotransferases, rifK and orf9. The gene product of 0rf9 shares sequence homology to the gene product of yokM from B. subtilis. However, orf9 was excluded from expressing the required transaminase activity for kanosamine biosynthesis. The inactivation of 0er from the A. mediterranei genome did not have an effect on rifamycin production by intact cells and as such it was determined that orf9 was not necessary for either AHBA or kanosamine production.36 On the other hand, the gene product of rifK was found to be a credible candidate for the desired transaminase. Although RifK has already been found to catalyze the isomerization of aminoDHS to AHBA, its homology to aminotransferases suggests a dual enzymatic role.26 One homolog is the gene product of stsC from the streptomycin producer Streptomyces griseus, which catalyzes the aminotransfer between glutamate and scyllo-inosose to produce scyllo-inosamine and a-keto-glutaramate, which cyclizes readily to 2-pyrrolidone-S-hydroxy-5—carboxylic acid.89 Another homolog of RifK is ArnB involved in the modification of the lipid A moiety of the outer-membrane lipopolysaccharide in a polymyxin-resistant mutant of E. coli W3110. ArnB catalyzes the PLP and glutamate dependent transamination of 4-keto-UDP-L-arabinose to 4—amino- 4-deoxy-UDP-L—arabinose prior to lipid A modification.90 Other incidental indications that RifK is the transaminase responsible for the introduction of the amine in kanosamine biosynthesis include the close proximity of rifK to rifL along the rif gene cluster, the 52 existence of two homologs of rifK in the asm gene cluster, the combination of rifK and rifL homologs positioned identically in every AHBA biosynthetic gene cluster suggesting a close functional interaction, and the ability of RifK to bind both PMP and PLP equally well.37 Reaction of UDPG and 3-ketoUDPG with the cells free-lysates of RifL‘ and RifK‘ A. mediterranei mutants It was determined that reaction of A. mediterranei mutants lacking the ability to express rifL and rifK with UDPG and 3-ketoUDPG could help to elucidate the roles of these proteins in kanosamine biosynthesis. Floss and coworkers developed mutants of A. mediterranei where various genes among the rif gene cluster were disrupted through the deletion of fragments from the individual genes.28 To prepare a rifL-inactivated A. mediterranei mutant, the 1.6 kb EcoRl—Xhol and 1.65 kb Xhol-BamHl fragments containing the N and C termini of rifL were ligated and cloning into the plasmid pHGF008 to create the mutant pRM04 providing a rifL gene missing a 624-bp Xhoil fragment. A suicide vector, pRMOS, was then created by the insertion of a 1.7-kb Kpnl fragment carrying a hygromycin resistance gene from pIJS607 into pRM04 pre-treated with Kpnl. This suicide vector was then transformed via electroporation into A. mediterranei S699 electrocompetent cells, which were plated onto YMG plates containing hygromycin. Colonies were screened using selective and non- selective plates to gain colonies resulting from several crossover recombination events while retaining hygromycin resistance. The genomic DNA was isolated and analyzed to 53 determine if the native rifL gene had been replaced with the inactivated rifL. The mutants containing an inactivated rifL were termed RM01.28 To prepare a rifK inactivated mutant of A. mediterranei the rifK gene was initially disrupted using a marker-replacement suicide vector, pSK-lAHBAZ. This vector was prepared by inserting a hygromycin resistance gene into the 2.3 kb Xhol fragment of pSK-lAHBAl at the only Bglll site. Through electroporation pSK-/AHBA2 was transformed into A. mediterranei S699 competent cells. Through several screenings mutants were identified which could not produce rifamycin B. Through genetic analysis it was determined all of these mutants, HGF003, contained disrupted rifK in lieu of the native rifK.26 Both the RM01 and HGF003 mutants were obtained from Floss and their respective cell-free lysates were prepared according to the same method used to prepared A. mediterranei cell-free lysate. As expected, when UDPG was reacted with the cell-free lysate of A. mediterranei RM01 (rifL) in the presence of NAD and glutamine, neither kanosamine nor 3-ketoUDPG was observed in the product mixture (Entry 1, Table 4). When 3-ketoUDPG was treated with the cell-free lysate of A. mediterranei RM01 (rifL-) in the presence of NADH and glutamine, surprisingly no kanosamine was observed (Entry 2, Table 4). When the same experiments were repeated with the cell—free lysate of A. mediterranei HGF003 (rifK-) no kanosamine was observed (Entries 34, Table 4). 54 P4: Table 4. Reactions of UDPG and 3-ketoUDPG with the cell-free lysate of A. mediterranei mutants lacking rifL and rifK. . . . Yield Entry Substrate Reaction CODdlthflS Kanosamine (%) A. mediterranei RM01 (rifL-) cell-free lysate, l UDPG L-glutamine, NAD O 2 UDPG A. mediterranei HGF003 (rifK-) cell-free 0 lysate, L-glutanune, NAD 3 3-ketoUDPG A. mediterranei RM01 (rifL) cell-free lysate, 0 L-glutamine, NADH 4 3—ketoUDPG A. mediterranei HGF003 (rifK-) cell-free 0 lysate, L-glutamine, NADH Heterologous expression and purification of RifL Two plasmids were obtained to express RifL heterologously in E. coli. The first plasmid, pRM030 (T7, 6xhis, rifL, Amp', lacI") derived from pRSET (T7, 6xhis, Amp'), was obtained from Heinz Floss. The second plasmid, pJG7.275 (Pm, rifL, laCIQ, Amp'), rifL, Amp', lacIQ), was prepared previously by Jiantao Guo IUC’ derived from pJF118EH (P i in this research group. Due to the T7 promoter pRM030 was transformed into BL21(DE3) while pJG7.275 was transformed into JM109. Both strains were cultured in LB/Amp media until the OD600 at 37°C until the OD600 reached 0.6. At which time IPT G was added to 1 mM. The cultures were incubated another 4 h in a 37°C shaker before the cells were harvested by centrifugation at 4°C. The cell pellets obtained upon centrifugation were resuspended in 50 mM Tris-HCI at pH 7.5 and lysed by two passes through a French pressure cell. The cell-free lysates were obtained after the cellular debris was removed by centrifugation. Once the cell-free lysates were prepared, they were used in an attempt to prepare 3-ketoUDPG from UDPG. UDPG and NAD were incubated with the cell-free lysates of BL21(DE3)/pRM030 and JM109/pJG7.275 at 28°C for 6 hr. No 3-ketoUDPG was 55 observed in either case. When 3-ketoUDPG was treated with the cell-free lysate of JM109/pJG7.275 in the presence of NADH, UDPG was produced in 3% yield. However, the same reaction run with BL21 (DE3)/pRM030 cell-free lysate failed to yield any UDPG. As a control, 3-ketoUDPG was treated with the cell—free lysate of JM109 in the presence of NADH and no UDPG was observed. Since the oxidation of UDPG by JM109/pJG7.275 cell-free lysate in the presence of NAD did not yield high levels of 3-ketoUDPG, alternative reaction conditions were considered. UDPG was reacted with the cell-free extract of J M109/pJG7.275 using 2,6- dichloroindolphenol (DCIP) and phenazine methosulfate (PMS) as cofactors (Figure 23). Under these conditions, PMS acts as an intermediate electron carrier and the decrease in the optical density at 600 nm as DCIP acts as the terminal electron acceptor can be followed. Initially, no 3-ketoUDPG was produced. However, when the incubation of the JM109/pJG7.275 cells after IPTG addition was extended from 4 to 18-24 h 3-ketoUDPG was produced in 8% yield. No 3-ketoUDPG was produced when the cell-free lysate of JM109 was used in place of JM109/pJG7.275. HO JM109/pJG7.275 HO O cell-tree lysate O HOH- “IOUDP = HOh- -'|OUDP -. DCIP, PMS -, Ho OH 0 OH 8% c: N 9 O=C>=N—C>—0Na (:1: 3:) o=s-0Me N 0. Cl DCIP PMS Figure 23. Reaction of UDPG with DCIP, PMS, and the cell-free lysate of JM109/pJG7.275. Abbreviations: DCIP, 2,6-dichloroindolphenol; PMS, phenazine methosulfate. 56 An attempt was made to purify RifL from the cell-free lysate of JM109/pJG7.275 using an FPLC. Presumably, the purification would eliminate any background activity related to the reduction of 3—ketoUDPG with NADH and enhance the activity from the oxidation of UDPG to 3-ketoUDPG. The cell-free lysate was applied to a MonoQ column and eluted with a linear gradient from 0-600 mM NaCl in 20 mM Tris-HCl buffer at pH 7.5. Using a DCIP/PMS assay for oxidoreductase activity using UDPG as the substrate, no active fractions were observed. The lack of activity could indicate the activity of the expressed RifL was lost or that no active RifL had been produced after all. Taking into account the preferred GC-rich codon usage of organisms like A. mediterranei and Streptomyces in comparison to E. coli, the GC content of rifL was calculated. The gene of interest rifL had a higher incidence of arginine (CCC) and proline codons (CGG) per 1000 amino acids than either A. mediterranei or E. coli (Table 5). Due to the high GC content of rifl, pJG7.275 was transformed into BL21 Codon Plus RP (E. coli B F, ompT, hsds(rB' mB'), dcm“, Tet’, gal, endA, the, [argU, proL, Cm’D, which contains overexpressed tRNA synthetase genes for proline and arginine to provide the GC excess required to effectively express rifL. Again attempts to purify RifL by FPLC from the cell—free lysate of BL21 Codon Plus RP failed to yield active enzyme. Table 5. Arginine and proline codon frequencies of E. coli, A. mediterranei, and nfl. Entry DNA sequence CCCa CGGa 1 E. coli K12 genomic DNA 5.5 5.4 2 A. mediterranei genomic DNA 15.9 36.5 3 A. mediterranei rifL 22.2 44.3 (a) Frequency of codon usage per 1000 amino acids of the analyzed DNA sequence. 3-ketoUDPG was produced in 16% yield when UDPG was reacted with the cell- free extract of BL21 Codon Plus RP/pJG7.275 in the presence of DCIP, PMS, and 57 MgClz. Later, it was found that when preparing the cell-free lysate of BL21 Codon Plus RP, incubation of the cells for 12 h after IPT G induction instead of 18—20 h provided 3- ketoUDPG in 48% yield with no remaining UDPG. An attempt to reduce 3-ketoUDPG to UDPG in the presence of NADH using BL21 Codon Plus RP/pJG7.275 cell-free lysate failed, contradicting an earlier result with JM109/pJG7.275 cell-free lysate. Specific activity of RifL Several assays were used to gauge the specific activity of RifL. The first method using the cell-free lysate of JM109/pJG7.275 followed the NADH loss and formation. To measure the specific activity of the RifL oxidation of UDPG to produce 3-ketoUDPG the absorbance at 340 nm was followed over one minute. Unfortunately the slope of NADH formation was not linear using either JM109/pJG7.275 or JM109 cell-free lysate. The loss of NADH was also followed as 3-ketoUDPG was reduced to UDPG by the cell- free lysate of both JM109 and JM109/pJG7.275. Using JM109/pJG7.275 cell-free lysate the specific activity of 3-ketoUDPG reduction was measured to be 0.057 U/mg where one unit is equal to ymol NADH produced per minute per mg of protein. The background activity using JM109 cell-free lysate was measured to be 0.037 U/mg leaving a RifL specific activity of 3-ketoUDPG reduction of 0.02 U/mg (Entry 1, Table 6). The second method used to determine the specific activity of RifL followed the change in absorbance at 600 nm when UDPG is oxidized in the presence of DCIP, PMS, and the cell-free lysate of BL21 Codon Plus RP/pJG7.275. This method was used in the hopes of eliminating any reversibility of RifL. Using these conditions the specific activity of UDPG oxidation by RifL was calculated to be 0.012 U/mg (Entry 2, Table 6). 58 Lastly the specific activity of the RifL oxidation of UDPG to 3-ketoUDPG was determined by following the production of 3-ketoUDPG. 3-ketoUDPG was incubated with the cell-free lysate of BL21 Codon Plus RP in the presence of DCIP, PMS, MgClz, and p-hydroxybenzoic acid to act as an internal standard. At 15-minute increments 400 pL of the reaction mixture was removed and quenched with 100 pL 10% TCA solution. The precipitated protein was removed by centrifugation and a portion of the supernatant was diluted by 13 to prepare a 1 mL solution. A 10 yL portion of the diluted sample was then injected onto a Zorbax Bonus RP (amide-C14) analytical HPLC column. The sample was eluted with a linear gradient of eluant A (50 mM KH2m4/2.5 mM TBAHS in water, pH 6.9) and eluant B (50 mM KHZPO4/2.5 mM TBAHS in CH3CNzHZO (1:1), pH 6.9) and analyzed at 254 nm. A response factor prepared with UDPG was used to calculate the ymol of 3-ketoUDPG produced over time. Using this assay the specific activity of the RifL oxidation of UDPG was measured to be 0.015 U/mg after 60 min with a slight drop to 0.012 U/mg after 120 min (Entry 3, Table 6). Table 6. Specific activity determinations of RifL. Entry RifL Assay Conditions Sp. Act (U/mg)a 1 Loss of NADH during 3-ketoUDPG reduction 0.02 2 DCIP reduction during UDPG oxidation to 3-ketoUDPG 0.012 3 3-ketoUDPG formation followed by HPLC 0.015 (a) One Unit refers to ymol conversion per min. The results of all three methods used to assay RifL activity are presented in Table 6. Of the three assays used to determine RifL activity the assays using BL21 Codon Plus RP/pJG7.275 cell-free lysate to follow both DCIP reduction and 3-ketoUDPG formation are the most accurate. These results were much more consistent and the expression of RifL using BL21 Codon Plus RP provided more active enzyme. 59 Initial attempts to produce UDPK using RifK or a combination of RifK/RifL In the rif biosynthetic gene cluster, two genes, rifK and 0rf9, were found by Blast analysis to have sequence homology to known aminotransferase genes.26‘28 RifK is known to be the 3-amino-5-hydroxybenzoic acid synthase, but is homologous to other aminotransferase enzymes, which utilize pyridoxal 5’—phosphate as a cofactor. Another possible aminotransferase could be encoded by 0rf9, however gene inactivation experiments indicated that orf9 was not necessary for AHBA production, and RifK was proposed to act both as the aminotransferase converting 3-ketoUDPG to UDPK and as the AHBA synthase. The plasmid pJG7.259a (T5, rifK, 6xhis, ApR, lacl") was obtained and transformed into E. coli JM109. RifK was expressed by the addition of IPTG using the same conditions as for RifL. 3-ketoUDPG was treated with the cell-free extract of JM109/pJG7.259a in the presence of glutamine, pyridoxal 5’-phosphate and NAD or NADH. No UDPK was produced. When RifK purified by Ni2°—NT A resin was used in place of JM109/pJG7.259A cell-free extract with the addition of MgClz, no UDPK was produced. Upon addition of JM109/pJG7.275 cell-free extract to the above reactions in the presence of NADH, 3—ketoUDPG was reduced to UDPG. A summary of the reactions incubating 3-ketoUDPG with heterologously expressed RifK is shown in Table 7. 60 Table 7. Reactions of 3-ketoUDPG with heterologously expressed RifK from JM109/pJG7.259a. Entry Substrate Reaction conditionsa Yield UDPK (%) J M109/pJG7.259a cell—free lysate, PLP, l 3-ketoUDPG NADH, L-glutamine O .I M 109/ pJ G7.259a cell-free lysate, PLP, 2 3'ketOUDPG NAD, L-glutamine 0 3 3-ketoUDPG RifK, PLP, NADH, MgClz, L—glutamine 0 4 3-ketoUDPG- RifK, PLP, NAD, MgClz, L-glutamine 0 JM109/pJG7.275 cell-free lysate, RifK, 5 3‘ke‘0UDPG NADH, PLP, MgClz, L-glutamine O JM109/pJG7.275 cell-free lysate, RifK, 6 3'ket0UDPG NAD, PLP, MgClz, L-glutamine 0 7 UDPG JM109/pJG7.275 and JM109/pJG7.259a 0 cell—free lysates, PMS, DCIP, L—glutamine JM109/pJG7.275 and JM109/pJG7.259a 8 UDPG cell-free lysates, DCIP, PMS, PLP, L- 0 glutamine JM109/pJG7.275 and JM109/pJG7.259a 9 UDPG cell-free lysates, NAD, PLP, DCIP, PMS, L- 0 glutamine 10 UDPG JM109/pJG7.259a cell-free lysate, leK, O PLP, DCIP, PMS, L-glutamine (a) RifK was purified from JM109/pJG7.259. When UDPG was treated with both the cell-free extracts of JM109/PJG7.275 (RifL) and J M109/pJG7.259a in the presence of DCIP, PMS, and glutamine, the presence of 3-ketoUDPG was not observed, however whether UDPK was produced was inconclusive as the anomeric proton of UDPK appears at approximately the same position as that of UDPgalactose. Attempts to use HPLC paired ion chromatography to 61 determine whether UDPK was produced were also inconclusive. The same was found when UDPG was treated with JM109/pJG7.275 cell-free extract and RifK in the presence of DCIP, PMS, and glutamine. Table 8. Reactions of 3-ketoUDPG with RifK obtained from BL21 C+ RP/pJG7.259a. Entry Reaction Conditionsa “6'30:pr l BL21 C” RP/pJG7.259a cell-free lysate, PLP, NADH, MgClz, 5 L-glutamine 2 BL21 C+ RP cell-free lysate, PLP, NADH, MgClz, L- 0 glutamine 3 RifK, PLP, NADH, L—glutamine, MgCl2 1 4 RifK, L-glutamine, NADH, MgCl2 0 5 BL21 C+ RP/pJG7.259a cell-free lysate, NADH, L-glutamine, 1 MgCl2 6 BL21 C+ RP cell-free lysate, NADH, L-glutamine, MgCl2 0 (a) All reactions were run at 30°C in 50 mM Tris-HCl buffer at pH 7.5 containing 20% glycerol. RifK was purified from JM109/pJG7.259. Due to the high GC content of the A. mediterranei genome in comparison to E. coli, pJG7.259a (T5, [(160, 1060, rifK, 6xhis, lacl", ApR) was transformed into BL21Codon Plus RP, which contains additional arginine and proline codons. Treatment of 3-ketoUDPG with the cell-free extract of BL21CRP/pJG7.259a in the presence of NADH, L-glutamine, pyridoxal 5-phosphate (PLP), and MgCl2 yielded UDPK in 8% yield. The same experiment performed with the cell-free extract of BL21 C RP without pJG7.259a did not yield any UDPK. Performing the transamination reaction as above in the absence of PLP gave a 1% yield of UDPK with BL21 C“ RP/pJG7.259a cell-free extract, and no UDPK with BL21 C” RP cell-free extract. (Table 8) 62 RifK was purified using Ni2°—NTA resin by stepwise elution with increasing concentrations of imidazole. An attempt was made to measure the specific activity of the RifK transamination of 3-ketoUDPG by following the loss of NADH, however the measured activity was extremely low. Upon treatment of 3-ketoUDPG with RifK in the presence of NADH, PLP, Mg“, and glutamine, UDPK was produced in 1% (trace) yield. No UDPK was produced when PLP was omitted from the reaction. Due to the purified enzyme’s instability and subsequently lower observed yield, cell-free extract was used for the remaining experiments. In order to securely identify the product produced in the above reaction as UDPK, the 1H NMR evidence needed to be verified, and a second line of evidence needed to be established. To verify that the peak in the NMR presumed to represent the anomeric proton of UDPK was correct, a standard sample of UDPK, synthesized by Xiaofie Jia, was added to an NMR sample of a reaction thought to produce UDPK. No new peaks appeared in the NMR spectrum, however the presumed peak did not increase significantly since the amount of UDPK added was only ~1 mg. Since the cell-free reactions to produce UDPK yield a complex mixture of products, a direct mass spectrum analysis of the crude reaction could not be obtained and the second line of evidence chosen was HPLC. The reaction sample was first partially purified by HPLC using a semi-preparative reverse phase HPLC column. The product was eluted using paired-ion chromatography with phosphate buffer and tetrabutyl ammonium hydrogen sulfate (TBAHS) as the paired ion.91 Under these conditions the UDPK elutes from the column with an a value of 0.4 or essentially within the first 3 min after the UV indicates sample is eluting from the column. The partially purified sample 63 was then injected onto an analytical Zorbax Bonus RP column (amide-C 14 instead of C18 backbone) and eluted again with the same paired-ion buffers. Co—injection of the semi-purified sample with standard UDPK indicates UDPK is being produced in the cell- free reactions. Also, a small amount of this product was collected and analyzed by 1H NMR. The NMR coincided with a standard UDPK 1H NMR sample. In order to determine if the reverse reaction from UDPK to 3-ketoUDPG might give a higher yield, UDPK was synthesized from kanosamine l—phosphate using UDPG pyrophosphorylase purified from DHSa/pHS3.244 and inorganic pyrophosphorylase. The purified UDPK was obtained in 15% yield (Figure 24), with the low yield being due to loss of product during work-up. The UDPK was then treated with BL21 C RP/pJG7.259a cell-free extract in the presence of PLP, NAD, MgClz, and 2-oxoglutarate in an attempt to produce 3-ketoUDPG (Figure 24). No 3—ketoUDPG was produced. It is possible this reaction needs to be repeated using glutamate instead of 2-oxoglutarate. Figure 24. Preparation of UDPK and the reaction of UDPK with BL21 C+ RP/pJ G7 .259a to produce 3-ketoUDPG. Ho 0 UTP UGP Ho 0 HON- '"OPOaHz \\ as: Ho--- «00013 PPase HZN OH PPi 2Pi H2N OH 15% BL21 0* RP/ HO pJG7.259a HO O cell-free extract 0 HOI" MOUDP = HON- -'|OUDP > PLP, Mga”, NAD , H2N OH 2-oxo-glutarate O OH 0% Optimization of RifK expression in E. coli A series of experiments were performed to increase the yield of UDPK from 3- ketoUDPG using BL21 C+ RP/pJG7.259a cell-free extract. In these experiments a variety of variables were tested: buffer, stabilizing agent, growth media, temperature, and pH (Table 9). Unfortunately, the yield was not significantly increased by more than a factor of 2 for any of the conditions tested. However, one experiment not shown (Table 9) was to omit NADH from the reaction mixture. This was done along side a control (containing NADH) at pH 8.5 and a temperature of 37°C. The reaction without NADH yielded a slightly higher yield of UDPK, 9%. This was an interesting result, which could indicate that NADH is not the reducing factor needed for the transamination catalyzed by RifK. 65 Table 9. Optimization of RifK transamination of 3-ketoUDPG. Temp. Entrya pH (.0 Media Reaction Buffer Additiveb % UDPK 1 7.5 30 LB phosphate PMSF 6 2 7.5 30 LB MOPS PMSF 11 3 7.5 30 LB HEPES PMSF 8 4 7.5 30 LB Bis-Tris propane PMSF 4 5 7.5 30 LB EPPS (HEPPS) PMSF 13 6 7.5 30 LB Tris-HCl PMSF 9 7 7.5 30 LB PIPES PMSF 7 8 7.5 30 LB triethanolamine PMSF 16 9 7.5 30 LB triethanolamine PMSF, EDTA 2 10 7.5 30 LB triethanolamine PMSF, DTT 12 11 7 .5 30 LB triethanolamine PMSF, BSA 14 12 7.5 30 LB triethanolamine EAT/[TFBEETA’ 2 13 7.5 30 TB MOPS PMSF 5 14 7.5 30 YT MOPS PMSF 13 15 7.5 30 NZCYM MOPS PMSF 12 16 8.5 37 LB triethanolamine PMSF 6 17c 8.5 37 LB triethanolamine PMSF 9 (a) Reaction conditions: 3-ketoUDPG, BL21 C+ RP/pJG7.259a cell-free lysate, NADH, MgClz, PLP, L-glutamine; (b) Additives were added to help stabilize enzymes in the cell- free lysate; ° No NADH was added to this reaction To further optimize the reaction conditions and improve the reaction yield, the temperature and pH were adjusted in varying combinations. According to Floss the 66 optimal assay conditions for heterologously expressed RifK are pH 8.5 and 37°C. Changing these conditions did not improve the reaction yield. The cofactor was also changed from PLP to PMP in an attempt to improve the yield. This also did not provide a significant improvement (Table 10). Table 10. Optimization of RifK transamination of 3-ketoUDPG. Entrya pH Temp. (°C) Cofactor Yield UDPK (%) l 7.5 30 PLP 24 2 7.5 37 PLP 21 3 8.5 30 PLP l7 4 7.5 30 PMP 22 5b 7.5 30 PMP 30 (a) All reactions contained BL21 C+ RP/pJG7.259a cell-free lysate (cells cultured in YT medium), 3-ketoUDPG, RifK, MgClz. Entries 1-4 contain glutamine; b Glutamine was omitted from this reaction. Since it was discovered that NADH was not necessary for the conversion of 3- ketoUDPG to UDPK efforts were made to explore whether an alternative reducing agent could be used instead. It was thought that since NADH wasn’t acting as a reducing agent there may be some other cofactor involved. Since phenazine methosulfate was a better oxidant than NAD for the oxidation of UDPG to 3—ketoUDPG, 5,10-dihydro-5-methyl phenazine (DHMP) (Figure 25) was synthesized to act as the reducing equivalent. DHMP was synthesized from phenazine by first reduction with sodium dithionite, followed by methylation with methyl iodide and n—BuLi with an overall yield of 78%. DHMP did not prove to be a useful reducing agent in the conversion of 3-ketoUDPG to UDPK as the yield decreased slightly (Figure 25). 67 Figure 25. Preparation of DHMP. H Me [:E N0 sodium dithionite O N I) 1) Mel. ”BU” CE N D NI N 2) sodium dithionite N H H 90% 87% Sodium dithionite can be used in vitro to reduce FADH- to FADHZ. Since the purified RifK is bright yellow in color it was thought that RifK might be an FAD requiring enzyme. In case RifK needs activation, sodium dithionite was added to the reaction (Table 11), however no increase in yield was observed. Adding either FAD or FMN with sodium dithionite also made no effect. Since PLP utilizing transaminases don’t always require a reducing equivalent, it was determined at this point that a reducing equivalent may not being needed for this transamination. Table 11. Screening for RifK reducing equivalents. Entrya Cofactors Yield UDPK (%) l PLP, DHMP l3 2 PLP, Na,s,o, 17 3 PLP, 1x12125204, FAD 16 4 PLP, Na,s,o,, FMN 17 (a) Each reaction contained 3-ketoUDPG, MgClz, L-glutamine, and BL21 C+ RP/pJG7.259a cell-free lysate in 50 mM triethanolamine buffer at pH 7.5 containing 1 mM PMSF and 10% w/v glycerol. Each reaction was run at 30°C for 8 h. Specific activity of RifK The specific activity of heterologously expressed RifK was calculated using two separate assays. The first assay was used to measure the AHBA synthase activity of the heterologously expressed RifK and compare that activity with that reported by Floss. The generation of AHBA was followed over 60 min by measuring the absorbance at 296 nm when aminoSA was treated with the cell-free lysate of BL21 Codon Plus RP/pJG7.259a cells grown on YT medium. The measured AHBA synthase specific 68 activity was 0.0051 umol/min-mg, which coincides with the reported crude AHBA synthase activity reported by Floss of 0.0052 umol/min-mg. The second assay was used to determine the transaminase activity of the heterologously expressed RifK. The specific activity was determined by following the formation of UDPK and the subsequent loss of 3-ketoUDPG using the same assay conditions used to measure the RifL specific activity. The measured transaminase specific activity of the crude cell-free extract, calculated over 120 min, was 0.0054 umol/min-mg as determined for production of UDPK and 0.0051 umol/min-mg as determined for the loss of 3-ketoUDPG. The source of nitrogen in A. mediterranei kanosamine biosynthesis Overview Upon demonstrating iminoE4P is derived via kanosamine biosynthesis and establishing a connection between kanosamine biosynthesis and the aminoshikimate pathway, attention turned toward elaborating the source of the aminoshikimate pathway’s nitrogen atom. A previous report investigating the nitrogen source for rifamycin biosynthesis in Nocardia mediterranei U-32 indicated the amide nitrogen of glutamine would likely act as the donor. However, other PLP-dependent aminotransferases sharing homology with RifK and catalyzing similar reactions have been found to utilize L- glutamate as the nitrogen source.89°90'92 Through an experiment performed by another group member, the major components of the product mixture produced when UDPG was treated with dialyzed A. mediterranei cell-free lysate in the presence of NAD and L-glutamine were identified. 69 The byproducts of L-glutamine were found to be L-glutamic acid, a-ketoglutaric acid and a—ketoglutaramic acid. This would suggest the original theory was correct to indicate the amide nitrogen as the source.93 To further confirm the amide nitrogen as the source of nitrogen in the aminoshikimate pathway a series of 15N labeling experiments were performed by Jiantao Guo. Again using the dialyzed A. mediterranei cell-free lysate, UPDG was incubated with NAD in the presence of either [amine-‘5N]-L-glutamine or [amide-ISN]-L-glutamine. The kanosamine produced was isolated, purified, and analyzed by HRMS to determine the enrichment of 15N. When [amine-‘5N]—L-glutamine was used as the nitrogen source the kanosamine produced contained a 15N enrichment of 12%. When [amide-‘5N]-L- glutamine was used as the nitrogen source the kanosamine produced contained 89% 15N enrichment (Table 12).94 Investigation of the kanosamine biosynthetic nitrogen source using 3-ketoUDPG and heterologously expressed RifK With access to 3-ketoUDPG and the transaminase, RifK, the labeling study was repeated to help confirm that the nitrogen source was the amide nitrogen. 3-ketoUDPG was reacted with either [amide-”NLL—glutamine or [amine-‘5N]-L-glutamine in the presence of PLP with the cell-free lysate of BL21 Codon Plus RP/pJG7.259a. The UDPK produced was analyzed by HRMS to determine the 15N incorporation. When ['amide-‘SNJ-L—glutamine was used, as the nitrogen source the UDPK produced contained no 15N. When [amine-‘SNl-L-glutamine was used as the nitrogen source, the UDPK contained 35% 15N incorporation (Table 12). 70 Table 12. 15N enrichments in kanosamine produced using A. mediterranei cell-free lysate and in UPDK produced using BL21 C+ RP/pJ G7 .2593 cell-free lysate. 15N Enrichment in 15N Enrichment in E t N ' n ry itrogen Source Kanosamine (%)a’c UDPK (%)b’c 1 [amine-'SNj-L-glutamine 12 35 2 [amide-'SN]-L-glutamine 89 0 (a) Reaction conditions: UDPG, [3—NAD, nitrogen source, A. mediterranei cell-free lysate pH 6.8 (after 6 cycles of dialysis); (b) Reaction conditions: 3-ketoUDPG, PLP, nitrogen source, MgClz, BL21 C° RP/pJG7.259a cell-free lysate, pH 6.8; (c) 15N enrichments were determined by electrospray mass spectrometry. Due to the seemingly contradictory results between the different labeling experiments a series of experiments were performed to investigate the nitrogen source required for kanosamine biosynthesis using RifK as the aminotransferase. According to the previous results using A. mediterranei cell-free lysate when L—glutamine was replaced with L-glutamic acid, no UDPK should have been produced. However, UDPK was produced in 16% yield when 3-ketoUDPG was reacted with the cell-free lysate of E. coli BL21 Codon Plus RP/pJG7.259 cell-free lysate in the presence of PLP and L—glutamate (entry 2, Table 13). This result using L-glutamate as the nitrogen source was essentially equivalent to that produced when L-glutamineiwas used as the nitrogen source. When PLP was excluded from the reaction, the yield of UDPK dropped slightly to 12% (entry 3, Table 13). This is not necessarily surprising considering RifK is known to contain 0.6 mol PLP per mol of protein, and as such RifK should be able to catalyze the transamination without the addition of PLP. The yield of UDPK dropped significantly to 2% when neither nitrogen source was added. When neither nitrogen source nor PLP was added to the reaction the yield of UDPK again dropped to 2% (entries 4 and 5, Table 13. When the BL21 Codon Plus RP/pJG7.259 cell-free lysate was replaced with RifK 71 (purified from BL21 Codon Plus RP/pJG7.259) UDPK was produced in 8% yield in the presence of L-glutamic acid and PLP (Entry 6, Table 13). However, when L—glutamic acid was omitted the yield of UDPK dropped to 0% (Entry 7, Table 13). The production of small amounts of UDPK when no nitrogen source was added to the reaction is presumably due to incomplete rinsing of the bacterial cells before lysis. Taken as a whole it appears RifK utilizes the a-amine of glutamine, not the amide, in the transamination of 3-ketoUDPG to UDPK. This data is actually more consistent with that of other PLP-dependent transaminases sharing homology with RifK and catalyzing similar conversions. The above results using heterologously expressed RifK seem to contradict those generated with the cell-free lysate of A. mediterranei. This contradiction may suggest another enzyme exists in the cell-free lysate of A. mediterranei that can also catalyze the transamination of 3-ketoUDPG to UDPK. The results with A. mediterranei cell-free lysate indicate this alternate transaminase could be acting as the dominant species catalyzing the transformation. This dominance could be the result of naturally higher aminotransferase specific activity or it could be that during extensive dialysis of the A. mediterranei cell-free lysate the specific activity of RifK drops significantly enough to limit its role in the transamination. Therefore, although RifK appears to use the a-amine nitrogen of L-glutamine or L-glutamate, A. mediterranei can utilize either the amide or or- amine nitrogen in the transamination of 3-ketoUDPG. 72 Table 13. Nitrogen source and PLP dependence of the RifK catalyzed transamination of 3-ketoUPDG. Entry‘"b Nitrogen sourcec PLPd Yield UDPK (%) 1 L-glutamine - 12 2 L-glutamic acid + 16 3 L-glutamic acid - 12 4 . — + 2 5 - — 2 6c L—glutamic acid + 8 7c - + O (a) Reaction conditions: 3-ketoUDPG, MgClz, nitrogen source (if added), PLP (if added), BL21 C+ RP/pJG7.259a cell-free lysate; (b) bacterial cells were rinsed with 0.9% NaCl solution prior to lysis to remove contaminating nitrogen sources; (c) (-) indicates no nitrogen source was added to the reaction; (d) (+) indicates PLP was added to the reaction, (-) indicates PLP was omitted from the reaction. (e) Reactions were performed with RifK purified from BL21 C“ RP/pJG7.259 cell-free lysate by Ni-NTA affinity chromatography. Kanosamine biosynthesis through 3-ketoUDPG by B. pumilus The B. pumilus cell-free lysate was prepared immediately prior to incubation of 3- ketoUDPG. B. pumilus cells were grown from a single colony at 28°C for 2 days with shaking in 4 L of a rich media containing peanut meal. Initially attempts were made to recover the bacterial cells by gentle centrifugation followed by scraping the cells carefully from the surface of the pellet. Later the process was improved by first filtering the cell culture through 5 layers of cheesecloth. The cell suspension obtained was then centrifuged to pellet the cells and any remaining peanut meal. The cells could be isolated easier as the cheesecloth removed the majority of the peanut meal. The collected cells were resuspended in a 50 mM Tris-HCl buffer at pH 7.5 containing 1 mM PMSF and 10% w/v glycerol. The cells were lysed by two passes through French pressure cell followed by centrifugation to remove cellular debris. The supernatant was used immediately for cell-free experiments. 73 When UDPG was treated with the cell—free lysate of B. pumilus in the presence of NAD and L-glutamine, kanosamine was produced in 7% yield. Kanosamine was produced in 3% yield when 3-ketoUDPG was treated with B. pumilus cell-free lysate in the presence of NADH, MgClz, and L-glutamine. Unlike the reaction performed with A. mediterranei cell-free lysate the remaining 3-ketoUDPG was not reduced back to UDPG. Table 14. Reaction of [3-2H]-UDPG with B. pumilus cell-free lysate. Entrya Co-factor Yield Kanosamine (%) % 2H in Product 1 N AD 5 1 1 2 1:1 NAD/NADH 7 15 (a) Reaction conditions: [3-2HJ-UDPG, L-glutamine, B. pumilus cell-free lyate. As with A. mediterranei it was determined that treatment of [3-2H]-UDPG with the cell-free lysate of B. pumilus could aid in elucidating the mechanism of UDPG oxidation to 3-ketoUDPG. When [3-2Hl-UDPG was incubated with NAD, L-glutamine, and B. pumilus cell-free lysate kanosamine was produced in 5% yield with a 2H incorporation of 11% as determined by HRMS (Entry 1, Table 14). When [3-2H]—UDPG was treated with B. pumilus cell-free lysate in the presence of L-glutamine and a 1:1 mixture of NAD and NADH, kanosamine was produced in 7% yield containing 15% 2H incorporation (Entry 2, Table 14). These results were quite the opposite of that obtained with A. mediterranei cell-free lysate. As with A. mediterranei NADH trapping experiments were performed with B. pumilus cell-free lysate in an attempt to further determine the mechanism in which kanosamine is biosynthesized from UDPG. When UDPG was treated with B. pumilus cell-free lysate in the presence of NAD, L-glutamine, diaphorase and methylene blue, kanosamine was produced in 11% yield (Entry 3, Table 15). When UDPG was reacted 74 with B. pumilus cell-free lysate in the presence of NAD, L-glutamine, NH4OH, and 2- oxo-glutarate the yield of kanosamine produced increased to 19% (Entry 4, Table 15). Table 15. B. pumilus NADH trapping experiments. Entry Reaction Conditionsa Yield Kanosamine (%) 1 NAD 7 2 NAD/NADH (1:1) 15 3 NAD, diaphorase, methylene blue 11 NAD, glutamate dehydrogenase, NH4OH, 2- 4 19 oxoglutarate (a) Reaction conditions: B. pumilus cell-free lysate, UDPG, L-glutamine. Discussion In this chapter the intermediacy of 3-ketoUDPG during kanosamine biosynthesis from UPDG by both A. mediterranei and B. pumilus was investigated. The direct oxidation of UDPG at C-3 by A. tumefaciens provided 3-ketoUDPG. It has been demonstrated that both the cell-free lysate of A. mediterranei, and that of B. pumilus can produce kanosamine from 3-ketoUDPG. The role of NAD in kanosamine biosynthesis was investigated for both A. mediterranei and B. pumilus. It was hypothesized that the NADH produced during the oxidation of UDPG to 3-ketoUDPG would be utilized as a reducing equivalent during the subsequent transamination to UDPK. The complete incorporation of 2H into the kanosamine produced from [3-2Hl—UDPG by the cell-free lysate of A. mediterranei suggested NADH is used during the transamination to form UDPK. This suggestion was elaborated by the lack of kanosamine produced during the NADH trapping experiments. 75 However later experiments using heterologously expressed RifL and RifK contradict this assumption. The RifL catalyzed oxidation of UDPG was found to utilize cofactors typically associated with FAD-dependent dehydrogenases such as G3DH from A. tumefaciens. The RifK catalyzed transamination of 3-ketoUDPG to UDPK did not require and was actually inhibited by the presence of NADH. The reason for this contradiction was not immediately apparent. Unlike A. mediterranei, when the 2H labeling experiments were performed using the cell-free lysate of B. pumilus very little 2H was incorporated into the kanosamine produced. This result indicated that NADH is not utilized during the transamination of 3- ketoUDPG by the B. pumilus enzyme. This conclusion was further supported by the lack of effect on the yield of kanosamine when a 1:1 mixture of NAD/NADH was used in the reaction. The NADH trapping reagents also had no effect on the yield of kanosamine which lends further credence to the idea that B. pumilus does not directly recycle the NADH produced during the oxidation of UDPG. The isolation and sequencing of the B. pumilus dehydrogenase thought to be responsible for the oxidation of UDPG to 3- ketoUDPG by Jiantao Guo provided further clues to this process. The dehydrogenase itself was found to be FAD-dependent, not NAD-dependent. The NAD may be required as a cofactor for another enzyme utilized by the microbe to recycle the FADH2 produced during the oxidation back to FAD in order to regenerate the dehydrogenase. This process would actually mirror the process used by G3DH from A. tumefaciens. Analyses of the enzymes, RifL and RifK, thought to be responsible for the oxidation of UDPG to 3-ketoUDPG and its subsequent transamination to UDPK were performed through their respective heterologous expression in E. coli. Using the E. coli 76 cell-free lysate containing RifL, it was found that RifL did catalyze the oxidation of UDPG to 3-ketoUDPG in the presence of DCIP and PMS. It was found also that heterologously expressed RifK was capable of catalyzing the transamination of 3- ketoUDPG to UDPK. It was found that RifK could catalyze the transamination in the presence of PLP or PMP, but did not require the exogenous addition of either. This result is understandable considering the report by Floss that RifK contains 0.6 mol of PLP per mol of enzyme. Once it was confirmed that RifK could act as the enzyme responsible for the transamination of 3—ketoUDPG to UDPK efforts turned toward identifying the source of the A. mediterranei aminoshikimate pathway’s nitrogen atom. Previous results obtained with the cell-free lysate of A. mediterranei suggested the amide nitrogen of L-glutamine was incorporated into the kanosamine produced. '5N labeling experiments with heterologously expressed RifK displayed a slight preference for incorporation of the OL- amine nitrogen of L-glutamine into the produced kanosamine. The finding that RifK could utilize L-glutamate as a nitrogen source further implicated the a-amine as the nitrogen source, not the amide of L—glutamine. Clearly the experiments performed using the cell-free lysate of A. mediterranei indicate the amide nitrogen of L-glutamine as the source for the aminoshikimate pathway’s amine nitrogen, while the experiments with heterologously expressed RifK implicate the a—amine nitrogen of L—glutamine or L-glutamate as the source. This apparent contradiction mirrors the contradiction introduced when the earlier 2H labeling results using [3-2H]—UDPG indicated [2H]-NADH was used by A. mediterranei for the transamination of 3-ketoUDPG resulting in [3-2H]-kanosamine. It was later realized 77 RifK does not require and is inhibited by the presence of NADH. Another possible contradiction was found seeing that Floss insinuated RifL and RifK might form a complex in viva while experiments performed by Jiantao Guo using a Bacteriomatch- two-hybrid system indicate no interaction between these two proteins. Taken as a whole, it seems the contradiction is likely due to a difference in the systems involved. RifK catalyzes both the transamination of 3-ketoUDPG to UDPK and the isomerization of aminoDHS to AHBA. The RifK-catalyzed transamination requires a nitrogen source, L- glutamate or L-glutamine, but does not require NADH or complex formation with RifL. The most probable explanation for the opposite results obtained using the dialyzed cell-free lysate of A. mediterranei and the heterologously expressed RifK is that at least one other enzyme exists within the A. mediterranei cell, which can catalyze this transamination. Through extensive dialysis of the A. mediterranei cell-free lysate, RifK is most likely deactivated to some degree thereby allowing the characteristics of another transaminase to surface in the experimental results. A possible candidate for the other transaminase is the gene product of 0rf9, which is homologous to the transaminase YokM from B. subtilis (Table 1). The gene product of orf9 was originally eliminated as a candidate for involvement in kanosamine biosynthesis due to the gene deactivation experiments performed by Floss and coworkers, which indicated that the deactivation of orf9 had no effect on AHBA production. It should be taken into consideration that the gene deactivation experiments were performed by analyzing the level of AHBA observed in the culture supernatant of A. mediterranei mutants grown on a rich media. Also, we now know that RifK can act as the aminotransferase catalyzing the production of UDPK from 3—ketoUDPG, so deactivation of one aminotransferase in the presence of another 78 would quite reasonably have no effect on the production of AHBA, especially under rich conditions when any necessary co-factors should be present. This is especially logical since these whole cell experiments could not indicate whether RifK is necessary for the transamination of 3-ketoUDPG as RifK is known to catalyze the formation of AHBA, a later step in AHBA biosynthesis. Because Floss and co-workers were analyzing AHBA production, any lack of AHBA formation using a mutant of A. mediterranei where rifK is deactivated only indicates RifK is required for AHBA biosynthesis. This method does not indicate whether or not RifK is required at any step earlier than the production of AHBA from aminoDHS. 79 ppm Figure 26. 1H NMR spectrum of 3-ketoUDPG produced by the oxidation of UDPG by A. tumefaciens. 80 220 200 180 160 140 120 100 80 60 DD“ Figure 27. 13C NMR spectrum of 3-ketoUDPG produced through the oxidation of UDPG by A. tumefaciens. 81 _..___ ' a a 5‘ l ? i L i _ l __ _;=£f | . ° 9 l ! E~ 4.0 4.2 4.4 4.6 4.8 5.0 5.2 5.4 5.6 5.8 6.0 ppm Willi Figure 28. 2D-COSY spectrum of 3-ketoUDPG produced by A. tumefaciens. 82 Figure 29. Standard 1H NMR spectrum of UDPG. 83 ,1 61 ,i A ll 1 J.__.........wu........... ..........—..—J l I l I I 8.0 6.0 Figure 30. 1H NMR spectrum of [3-2H]-UDPG. 84 Figure 31. 'H NMR spectrum of kanosamine. 85 11 ii :i , .i i a: i .3”. ,. . ,i i . ,~, -.,~, ___../ _ “J "vvv J ~“. ' lw: 3‘ I‘. ' l ' | ' ' | ' l | ' l | 5 4 5 2 4.0 3 8 3 6 3.4 3.2 ppm Figure 32. lH NMR spectrum of [3-2H]-kanosamine. 86 . . i I i, l .' , .. l iii ll m l {H‘M‘ ‘1“ l‘ hill .a‘,‘ H mum-WW WWW WIN ‘ My W“ ‘4' ‘ml‘w T i l l | l 8.0 6.0 4.0 Figure 33. 'H NMR spectrum of UDPK. 87 f. 1313'“ s 9.0 LA Figure 34. 1H NMR of the crude product mixture obtained upon the RifK catalyzed transamination of 3-ketoUDPG. 88 WAN-2004 TOF Ms ES+ 417 095 ' ‘ ml: 700 878 682 888 Oils 670 691 509605 613 ”2733333545 65.,” HAS-1m ) 51m :96-1032 6'72 ‘ i . 500510520530MOSSOWSTOSMSQOMMOMGMMOGSOMO‘IOMM HAsmo so (2.134) Sm (so. mono); Cm (56 523 Figure 35. Mass Spectrum of UDPK produced from the RifK catalyzed transamination of 3-ketoUDPG in the presence of L-glutamine. 89 gas 32 s at: g g». 55 5 5 $1 53' g . s 5 g gee g s s; s 5 i- a5 ‘5' 3 a 9. 3 ,5 is. . r - Figure 36. Mass Spectrum of UDPK produced from the RifK catalyzed transamination of 3-ketoUDPG in the presence of [amide-'le-L-glutamine. ES+ I 683 ml: 700 WAN- TOF MS 637 611 ‘ 667 d. 589 5005105205w5405505805705KJ590600610620630640650860.070680690 M31 13 139 (5.345) Sm (56. 1:10.00); Cm(139:192-37:58) ‘001 91.- | l Figure 37. Mass Spectrum of UDPK produced upon the RifK catalyzed transamination of 3-ketoUDPG in the presence of [alpha-'SN]-L-glutamine. 91 mAU « mu 1 2500- ; aminoUDPG 7°01 J a) ‘ : b) ”001' 000; « I amlnoUDPG 5004 ' 1 1500« j , 400-1 I 1 1000-4 m: t 1 J « j 200‘ 500— j °_._____.J\_J % . A A 0‘: T v r I v v v v I f j I ‘ fi 0 5 10 11 s 10 WW 4‘ I c) 4 700—- aminoUOPG 000« i 5004 400- 1 1 300d 200« 100; 1 w 0.. V I W V I V Y V V l V W o 5 1o Figure 38. HPLC analysis of UDPK produced by the RifK catalyzed transamination of 3-ketoUDPG. a) Standard: synthesized UDPK (3.5 min).; b) Sample taken from the reaction of 3- ketoUDPG with BL21 Codon Plus RP/pJG7.259 cell-free lysate in the presence of PLP and L-glutamine.; (c) Co-injection of standard UDPK sample and a sample from the same reaction as shown in B. All three samples were eluted by the increase in CH3CN using a 50 mM NazHPO4 buffer (pH 6.9) containing TBAHS as a paired ion. In B and C p- hydroxybenzoic acid (8.0 min) was added to the reaction sample as an internal standard for quantification. 92 CHAPTER THREE 3-DEHYDROQUINATE BIOSYNTHESIS VIA THE ARCHAEAL SHIKIMATE PATHWAY OF METHANOCALDOCOCCUS J AN NASCHII Introduction The common pathway of aromatic amino acid biosynthesis, termed the shikimate pathway (Figure 1), in eukarya and eubacteria is well known where the genes, enzymes, and intermediates have been studied extensively.1 In archaeal methanogens, however, this pathway is not fully understood. Early l3C labeling experiments indicate E4P may not be a precursor to aromatic amino acid biosynthesis by some Archaea.95 This suggestion was further supported by the discovery that among some archaeal methanogens, several shikimate pathway enzymes could not be identified.63 In Methanocaldococcus jannaschii the first two enzymes of the pathway, DAHP synthase ,, 59 and DHQ synthase, are “missing . DAHP synthase catalyzes the condensation of E4P and PEP to form DAHP. The DAHP is then isomerized to DHQ by the action of DHQ synthase (Figure 1). Although DHQ has been identified as an intermediate in the archaeal shikimate pathway of M. jannaschii, several common intermediates, including DAHP, E4P, PEP, and pyruvate, were eliminated as precursors of DHQ biosynthesis by M. jannaschii.66 These discoveries all promote a theory that the early steps of the shikimate pathway in these archaeal methanogens may vary utilizing different precursors and enzymes. 93 During early studies of the shikimate pathway in Eukarya, DDTH was considered as a possible precursor to DHQ.68 Although DDTH was eliminated as a precursor in the common shikimate pathway, Frost proposed that DDTH could be the precursor to DHQ biosynthesis by the novel archaeal shikimate pathway. He suggested DDTH could be produced by the condensation of hydroxyacetone and oxaloacetaldehyde. The DDTH produced could then cyclize either spontaneously or enzymatically to form DHQ (Figure 39). Another possible source of DHQ would be through the condensation of L-aspartate semialdehyde (ASA) and either hydroxyacetone or some other precursor to form ATTH, which could then be converted to DDTH through transamination (Figure 41). O '3'"? a O Ema” b O NH3+ HOMO —> HzoSPOJWO —> H,u\/\'rOH O O O aspartate 3-aspartyl phosphate 3283:1213), de HO, COZH C o o d 0 OH 0 9 A —> OH )Wklrm ———> “M171“ ( é o , OH O O OH O OH oxaloacetaldehyde _ . . (3-formyl pyruvate) /u\/OH DDTH 3 deglzz‘3509”'n'c hydroxyacetone Figure 39. Early proposal by Frost for alternate DHQ biosynthetic precursors. Enzymes: (a) aspartate kinase; (b) aspartate semialdehyde dehydrogenase; (c) amino acid aminotransferase; (d) putative aldolase MJ0400; (e) putative aldolase M11249. It is important to note how the above biosynthetic route proposed by Frost would relate to the '3C labeling patterns of the aromatic amino acids observed using various archaeal methanogens (Figure 40). First, aspartic acid or oxaloacetaldehyde would likely be prepared biosynthetically from oxaloacetate. As is the case of some archaeal methanogens oxaloacetate would be produced via a reductive, incomplete TCA cycle. 94 By the reductive TCA cycle, pyruvate is produced from the condensation of CO2 and acetyl CoA (acetate). Pyruvate is then condensed with CO2 to form oxaloacetate. Hydroxyacetone would likely be prepared by the cleavage of a hexose or the reduction of pyruvate. Based on the probable biosynthesis of oxaloacetate and hydroxyacetone from [1-‘3C]-pyruvate, [l-‘3C]-acetate, and [2-‘3C1-acetate, the expected labeling patterns of the intermediate DDTH, DHQ, and the aromatic amino acids L—tyrosine and L-tryptophan were predicted as seen in Figure 40. An important point of this prediction is that the predicted labeling patterns of the aromatic amino acids via Frost’s proposed route mirror the labeling patterns observed using varying archaeal methanogens. O o)i\*/OH C02 C02 hydroxyacetone O S O l O O O O E “/E‘OH .MOH HOWOH —>' HWOH O O O acetate pyruvate oxaloacetate oxaloacetaldehyde Ho, 'ozH 0902H O OH O . '0 . o o o . e ' c 0 OH —> '0 —>’ 0 O 0 5H 0 i OH i 0 ° 902H 0 OH OH \ DDTH DHQ chorismic acnd \ 000214 7 OH L-tyrosine Figure 40. Predicted l3C labeling patterns of tyrosine and phenylalanine from acetate and pyruvate through the DHQ biosynthetic route proposed by Frost. The indicated labeling patterns were predicted based on the known biosynthesis of oxaloacetate, pyruvate, and hexoses from acetate and pyruvate by archaeal methanogens. Label key: (*), [1-‘3C]-pyruvate; (0), [1-‘3C1-acetate; (O), [2-‘3C]-acetate. 95 In order to establish the precursors to this archaeal shikimate pathway, White performed a series of experiments with M. jannaschii cell-free lysate as well as two novel aldolases, M10400 and M11249.66 M10400 and M11249 were identified by their genetic proximity to shikimate biosynthetic enzymes. The results of these experiments led White to propose a hypothetical pathway for DHQ biosynthesis in M. jannaschii (Figure 41). White proposed DHQ biosynthesis occurs through first the condensation of L-aspartate semialdehyde (ASA) and another intermediate, 6-deoxy-5-ketofructose l-phosphate (DKFP), to form the amino acid intermediate ATTH by M10400. This condensation would be followed by the M11249 catalyzed reductive transamination of ATTH to form DDTH. Also under the influence of M11249, DDTH was proposed to cyclize producing DHQ (Figure 41). Prior to the start of research toward this thesis the condensation of ASA and DKFP as described by White had not been confirmed. Also the intermediate ATTH had not been synthesized or demonstrated to be a precursor to DDTH biosynthesis by MJ1249. The possible intermediacy of oxaloacetaldehyde also has not been explored. 96 (361° 0 HJ|\((‘OIDO;,H2 o a? [I NAD 09H c OQH'SHZ \.d OQHO WOPOSHZ W002!" WCOZH OH 0 OH DKFP ATTH NADH' NH3 0+dDTH O NH2 HJV‘COZH 1d ASA HO) COZH phenylalanine (NADH ———’—> tyrosine b O , OH NAD OH tryptophan [\JHz DHQ HOMCOZH homoserine Figure 41. Hypothetical M. jannaschii biosynthetic route to DHQ proposed by White. Enzymes: (a) M11055; (b) M11602; (c) M10400; ((1) M11249. Abbreviations: G6P, glucose-6-phosphate; DKFP, 6-deoxy-5-ketofructose l-phosphate; ASA, L-aspartate semialdehyde; ATTH, 2-amino-2,3,7-trideoxy-6-oxo-4,5-D-threo-heptanoic acid; DDTH, 3,7-dideoxy-D-thre0-hepto-2,6-diulosonic acid; DHQ, 3—dehydroquinic acid. This chapter will address attempts to verify the likelihood that DHQ biosynthesis by M. jannaschii proceeds through the intermediacy of ASA/DKFP and ATTH. The preparation of ASA and its subsequent reaction with DKFP in the presence of M10400 will be discussed first. A discussion of various attempts to prepare the proposed intermediate ATTH with follow. L-Aspartate semialdehyde intermediacy Early attempts to provide evidence for or against White’s proposal for DHQ biosynthesis centered on the condensation of DKFP and ASA using M10400. Since 97 neither compound is commercially available, each needed to be prepared synthetically or enzymatically from available materials. Once prepared attempts were made to condense DKFP and ASA using M10400 (heterologously expressed from E. coli), and identify any products produced. Preparation of ASA Several syntheses of ASA from aspartic acid and other materials have been reported,96 the ozonolysis of L-allyl glycine appears to be the most popular method of ASA preparation. L—Allyl glycine is unfortunately prohibitively expensive, so it was determined the L-form could be isolated from the much less expensive DL-allyl glycine. Racemic allyl glycine was purchased and reacted with acetic anhydride and sodium hydroxide to produce N-acyl allyl glycine in 90% yield. The L-allyl glycine was then isolated in 39% yield by selective deacylation of the N—acetyl-L-allyl glycine with porcine kidney acylase (Figure 42). The prepared L-allyl glycine was then oxidized to ASA through ozonolysis at 0°C in 1 N HCl (Figure 42). ASA is known to be very unstable and could not be isolated or analyzed by 1H NMR analysis. To analyze ASA the reaction was performed in 1 N HCl in D20 to avoid destruction of the ASA upon reaction work—up, however no ASA was observed in the product mixture. NH3+ NHAc NH3+ o NH3+ /\/‘\ a b T c ’U\/-\ / co; —> / COZH j NCO; —’ H co; Figure 42. Preparation of ASA from racemic allyl glycine. Reaction Conditions: (a) ACZO, NaOH, 0°C, 90%; (b) porcine kidney acylase, pH 7.9, 37°C, 36% L-form; (c) 03, l N HCl, 0°C. 98 Since ozonolysis using the free L-allyl glycine could not be confirmed, it was thought ozonolysis of a protected derivative might provide an indication of whether the aldehyde was being formed. Ozonolysis of the N-acetyl-DL-allyl glycine also failed to yield stable material for 1H NMR analysis. The N—acetyl—DL-allyl glycine was protected further using diazomethane at 0°C to yield the methyl ester in quantitative yield. Ozonolysis of this fully protected olefin followed by dimethyl sulfide quench provided a 1:1.8 mixture of the aldehyde and the dimethyl acetal respectively. Attempts to cleave the dimethyl acetal and recover the aldehyde using either IR-120 (H+ form) cation exchange resin or p-toluenesulfonic acid failed. NHAc a NHAc b O NHAc MeO NHAc / COZH —’ Ncone —’ H COzMe + MeO’K/kCOZMe Figure 43. Ozonolysis of Protected allyl glycine. Reaction conditions: (a) CHZNZ, EtOAc, EtQO, 0°C, 96%; (b) i. 03, CHzClz/MeOH (4: 1), - 78°C, ii. (CH3)ZS. Since it was determined the ozonolysis reaction was working efforts again turned toward the preparation of the unprotected aldehyde. The reaction of L-allyl glycine was attempted again using EtOH as the solvent instead of water so the reaction could be cooled to —78°C instead of 0°C. The reaction was quenched by the addition of zinc powder and acetic acid. Again the product could not be isolated for spectral confirmation, so an attempt was made to prepare the dinitrophenyl hydrazone. The ozonolysis product was treated with dinitrophenyl hydrazine, however none of the desired hydrazone was observed. Another method, which could confirm the production of ASA upon ozonolysis of L-allyl glycine, was to assay for aspartate semialdehyde dehydrogenase (ASADH) 99 activity. The assay would also provide a method for quantifying the concentration of ASA in the product mixture. ASADH catalyzes the conversion of L-aspartyl phosphate to ASA and phosphate in the presence of NADH.97 The gene encoding ASADH, asd, was amplified by PCR from E. coli W3110 genomic DNA and inserted into pJG7.246 (T5, lacO, lacO, 6 x his, lacl", Amp') to provide the plasmid pHS7.098 (T5, lacO, lacO, 6 x his, asd, lac)”, Amp'). The plasmid pHS7.098 was transformed into DHSa competent cells. The production of ASADH was induced by the addition of IPTG to 0.1 mM at 0D,,00 = 0.6. The ASADH was purified by affinity chromatography using Ni2*—NT A resin. The presence of ASADH was verified by SDS-PAGE analysis. Using ASA produced from the ozonolysis of L-allyl glycine, the ASADH activity was determined by following the increase in NADI-I concentration at A340 in the presence of phosphate. The specific activity of ASADH was measured to be 1.0 U/mg, where one unit was equivalent to .1 ymol NADH produced per minute. The ASADH produced was stored at —20°C in 200 yL aliquots to be thawed and used as needed. Figure 44. ASADH activity assay. 0 13H; PO ASADH O NH? - Na H ' HJK/‘COE' + 2 ° 7 pH9 K H203POJK/\COZ_ NAD NADH Preparation of DKFP DKFP was prepared by Jiantao Guo through the condensation of DHAP and methylglyoxal. DHAP was first prepared as described by Whitesides through the enzymatic phosphorylation of DHA by glycerol kinase (GK) in the presence of ATP. In order to shift the reaction equilibrium toward product formation the ADP produced during the phosphorylation was recycled back to ATP by the action of pyruvate kinase 100 (PK) in the presence of PEP to form pyruvate.98 DKFP was then prepared following the method of Kuchel where DHAP was condensed with methylglyoxal using RAMA.99 The DKFP was isolated after purification by anion exchange chromatography. The yield of 20% was estimated based on 1H NMR resonances. O OH O a O c H O PO 7 HO\)l\/OH "‘"’ HOJbOPOaHz 7'" 2 3 M O OH 0 DHA DHAP HJ‘rK DKFP O methyglyoxal Figure 45. Preparation of DKFP. Reaction conditions: (a) glycerol kinase, pyruvate kinase, ATP, PEP, 73%; (b) Rabbit muscle aldolase, methyl glyoxal, 20%. Preparation of MJ0400. M10400 was obtained through the heterologous expression of mj0400 in E. coli. The desired plasmid, pM10400 (T7, ij400, Amp’), was obtained from White. The plasmid, M10400, was then transformed into BL21 Codon Plus (DE3) RIL competent cells obtained from Strategene. BL21 Codon Plus (DE3) RIL cells contain additional tRNA codons to compensate for the higher percentage of A and T in the M. jannaschii genome over that of E. coli. Expression of ij400 was induced by the addition of lactose at OD600 = 1.0. After induction the cells were incubated at 28°C an additional 6 h, before being harvested by centrifugation. The cells were resuspended in degassed 50 mM phosphate buffer at pH 7.0 and lysed by two passes through a French pressure cell. After removal of cellular debris by centrifugation the majority of the E. coli enzymes were removed by heating the cell-free lysate at 60°C for 20 min followed by centrifugation. The production of M10400 was confirmed by SDS-PAGE analysis. 101 Reaction of ASA and DKFP with MJ0400. The prepared ASA and DKFP were then reacted with M10400 at 70°C and pH 7 .0 for 30 minutes. An attempt to assay for the byproduct 2-oxo—propionaldehyde 3- phosphate (OPP) using glyceraldehyde 3-phosphate dehydrogenase in the presence of NADH failed. Attempts to isolate the product and determine through 1H NMR analysis if the desired amino acid, ATTH, was formed also failed. White reported that upon condensation of ASA and DKFP with M10400, the prOposed product ATTH cyclizes spontaneously to form a cyclic imine.66 White reported NaBH4 treatment of the condensation product mixture obtained provided a cyclic amine, 4,5—dihydroxy-6-methyl-piperidine-2-carboxylic acid (DMPCA) (Figure 46). In preparation of GC-MS analysis the reduced product mixture was derivatized by treatment with trifluoroacetic anhydride in methanol and dichloromethane. White observed four GC peaks, which he determined represented four stereoisomers of derivatized DCMPA. All four GC peaks yielded MS peaks of 477, 446, 418, 336, 276, and 190 m/z.66 In an attempt to repeat White’s results, ASA and DKFP were reacted with M10400 under the same reaction conditions. The product mixture was subjected to NaBH4 reduction followed by derivatization to the presumed tri-trifluoroacetate methyl ester derivative. GC-MS analysis of the product mixture did yield four GC peaks at 6.73, 7.20, 7.43, and 7.68 min, which all produced peaks at 418, 336, 276, and 190 m/z in the MS spectra. Attempts to purify the product either before or after derivatization did not provide better GC-MS results. Attempts to obtain a hi gh-resolution MS spectra for the product mixture also failed, presumably due to the instability of the trifluoroacetate groups. None of the further attempts obtained contained the two highest two mass peaks (477 and 446). The 102 yield of DMPCA produced overall from the condensation of ASA and DKFP could not be determined without standard material, nor did White report a yield. The production of DCMPA through the M10400 condensation of ASA and DKFP also could not be confirmed using a second line of evidence. It was then hypothesized that the replacement of ASA with a more stable derivative might allow for the acquisition of more definitive evidence for the production of ATTH. ASA was thus replaced in the M10400 condensation reaction with N-acetyl- ASA. However, analysis of the GC-MS spectra produced by this product mixture did not provide the expected product peak at 633 m/z or any other peaks that might be formed by fragmentation of the desired product. O OH WOPOaHZ OH 0 CO2 052 fie; " =11 —»“ 5O . . + M002— 1. OH . OH O NH OH OH OH 7 3 ATTH HMCOZ 0 - - DMPCA HJYOPoaHz ASA O OPP Figure 46. Reaction of DKFP and ASA with M10400 as proposed by White. Reaction Conditions: (a) M10400, 70°C, pH 7.0; (b) NaBH4. Abbreviations: DKFP, 6- deoxy-5-ketofructose l-phosphate; ASA, L-aspartate semialdehyde; OPP, 2—oxo- propionaldehyde 3-phosphate; ATTH, 2-amino-2,3,7-trideoxy-6-oxo-4,5-D-threo- heptanoic acid; DMPCA, 4,5-dihydroxy-6-methyl-piperidine-2-carboxylic acid. One reason for lack of discernable evidence substantiating the presence of DMPCA is the yield was small. A small yield of DMPCA might have been obtained due to a low production of ASA either because of inadequate resolving of the L—allyl glycine with porcine kidney acylase, or due to the instability of product and decomposition during reaction work-up. When the ozonolysis was performed on racemic allyl glycine 103 purchased from sigma, the concentration of ASA was found to be 0.3 mM by enzyme assay (a yield of 60%). When the same assay was used to determine the amount of ASA from L-allyl glycine, the yield of ASA was 4%. Expression of hth and thrA It was presumed that the apparently low production of ATTH was due in part to a low production of ASA, so it was hypothesized the oxidation of homoserine to generate ASA might provide a better result. By the oxidation of homoserine with homoserine dehydrogenase the ASA could be produced separately or in situ. In E. coli there are two bifunctional enzymes which contain homoserine dehydrogenase activity, ThrA and MetL (Figure 47). Recently, Viola and James, in an effort to generate new bifunctional enzymes by domain swapping, independently cloned and expressed the homoserine dehydrogenase portion of the thrA gene along with an interface region (hth), which lies between the regions responsible for aspartokinase and homoserine dehydrogenase activities (Figure 48).100 The homoserine dehydrogenase activity of the newly formed monofunctional enzyme (HDHF) displayed a 10-fold increase in km, (3.30 s"), a 2-fold increase in Km (0.68 mM), and a 20-fold increase in k, le (4.9 x 103 M"s“) over that of the native bifunctional enzyme (kg, = 0.24 3"; Km = 1.2 mM; km/Km = 2.1 x 102 M"s"). Due to the increased activity of this monofunctional enzyme and the possibility of avoiding possible problems posed by the aspartokinase activity of the native bifunctional enzyme, an attempt was made to clone and express the homoserine dehydrogenase portion of the thrA along with the interface region from E. coli W3110 genomic DNA. 104 O a O b O C _ 0 “0M6 ‘7': “N5 7K®OYYK5 77 0N5 NH3 O NH3 ADP ATP + O pH, 0 pH, NADP+ NADPH NADP" NADPH L-homoserine +H ASA +H+ saggy; L-aspartate Figure 47 . Reactions catalyzed by homoserine dehydrogenase and aspartate kinase. Enzymes (gene): (a) homoserine dehydrogenase I and 11, mm, metL; (b) aspartate semialdehyde dehydrogenase, asd; (c) aspartate kinase, thrA, metL, lysC. To prepare the monofunctional homoserine dehydrogenase, the desired region of E. coli genomic DNA was PCR amplified. The DNA fragment produced was then inserted into pJG7.246 (T5, lacO, lacO, 6xhis, laclq, Amp’) to form pHS8.080 (T5, lacO, lacO, 6xhis, hdhl", laclq, Amp’) (figure 2). The resulting plasmid was transformed into DH501 competent cells. Expression of HDHI+ (+ stands for the interface region) by the addition of 0.1 mM IPTG did not yield any of the desired protein. Expression was also attempted by the addition of 28 mM lactose, however none of the desired protein was produced again. It is interesting to note that upon induction the cells essentially stopped growing and acquired a white color and chunky consistency upon harvesting. Owing to the possible toxicity of the modified enzyme to the DH501 cells, the plasmid was transformed into BL21 and 1M109 competent cells and attempts were made to express the protein again. When JM109 was used, again the cells stopped growing upon induction and no HDHI+ production was observed. In the case of BL21, the cells grew very well on induction, but still did not produce observable quantities of the desired protein. 105 E. coil ihrA QM Interface region MM 1 Ch”! Interface region Interface region hdhl 1 ”WA hdhl Figure 48. Division of mm into different gene segments for individual expression or recombination to produce new bifunctional enzymes. Instead of immediately pursuing additional cloning of hdhl“, it was decided an attempt should be made to over-express the native ThrA protein. The thrA gene was PCR amplified from E. coli W3110 genomic DNA and inserted into pET-15b (T7, lacO, 6xhis, [061“, Amp”) to form pHS8216 (T7, lacO, 6xhis, thrA, laclq, Amp”). Expression of ij 602 Along with the cloning and expression of the E. coli homoserine dehydrogenase enzymes, it was thought it might be useful to heterologously express the putative homoserine dehydrogenase from M. jannaschii, M11602. The expression of this enzyme would help determine whether or not it is actually acting as a homoserine dehydrogenase and since it would be thermally stable could be used to produce ASA in situ from homoserine. The PCR amplification of mj1602 proved difficult, but was finally accomplished and the resulting DNA fragment was inserted into pET-15b to produce pHS8.240 (77, lacO, 6xhis, ij 602, lacl“, Amp’). 106 Expression of mj1249 While attempts were being made to amplify and express the various homoserine dehydrogenase-encoding genes, efforts were also made to heterologously express M11249, the putaive oxidase/aminotransferase proposed to be responsible for the transamination of the amino acid ATTH to the keto-acid DDTH (Figure 49). Figure 49. Presumed aminotransfer catalyzed by M11249 to produce the ketoacid DDTH. 0 OH (Si-(3+ NAD NADH,NH3 O OH 0 M00? Li WOO; 0“ MJ1249? OH 2-amino-2,3,7-trideoxy- 3,7-dideoxy-D-threo-hepto- 6-oxo-4,5-D-threo- 2,6-diulosonic acid (DDTH) heptanoic acid (ATTH) The gene, ij 249, was PCR amplified from M. jannaschii genomic DNA and inserted into two vectors, pJG7.246 (T5, lacO, lacO, 6xhis, lacl“, Amp') and pET—le (T7, lacO, 6xhis, lacl“, Amp’), to form pH88.072 and pHS8101. Both plasmids were transformed into BL21 Codon Plus strains to account for a high percentage of A and T content within the gene. Attempts to express M11249 from BL21 Codon Plus RIL/pHS8.072 upon the addition of 0.1, 0.5, or 1.0 mM IPTG did not produce observable levels of the desired protein when the cells were grown at 37°C or 28°C. Also, production of M11249 could not be observed when gene expression was induced by the addition of 28 mM lactose at 37°C or 28°C. Expression of the mj1249 gene product from BL21 Codon Plus (DE3)/pHS8101 was attempted by induction with 0.1, 0.5, 1.0 mM IPTG and 28 mM lactose at both 37°C and 28°C. Initial experiments failed to yield any of the desired M11249. Upon transformation of BL21 Codon Plus (DE3) competent cells with pHS8101, two distinctly different size colonies formed upon overnight incubation of agar plates. Analysis of a 107 random selection of the colonies showed that all contained the correct plasmid and additional control experiments showed no contamination was occurring. It was found that only the smaller colonies could produce the desired M11249 when induced with IPTG (0.2 mM), however the levels produced were quite low. In an attempt to improve the levels of expression of M11249, the gene was ligated into pT7-7 (T7, lacO, Amp', ColEI) to form pHS8.243 (T7, lacO, mj1249, Amp’, ColEI) where the start of the gene is now much closer to the promoter along the sequence. The choice of pT7-7 as the vector was motivated by this vector’s use in the construction of pM10400 designed by White. ATTH intermediacy Overview The condensation of ASA and DKFP was proposed to form the amino acid intermediate ATTH by White. However, the only evidence to suggest this intermediate was GC-MS spectra, which could not adequately be reproduced in this lab using the same reaction conditions. Also, no secondary evidence to support the intermediacy of ATTH was presented by White, nor could any be obtained from the M10400 catalyzed condensation in this lab. Clearly further work was required to gain either further support for or against White’s claim of ATTH intermediacy. One solution to this problem was to prepare the proposed intermediates, ATT H and DDTH. Synthesis of ATTH, apart from the enzyme catalyzed condensation of ASA and DKFP, seemed especially pertinent. Once prepared, the proposed cyclization of the amino acid to the cyclic imine could be investigated. Also, a standard GC-MS spectrum could be obtained for comparison with the results obtained via the condensation of ASA 108 and DKFP by M10400. With the molecule in hand a second method of analysis, such as NMR or HPLC, could be used to determine if ATTH is a product of the M10400 catalyzed condensation. Also, with access to ATTH the proposed conversion of ATTH to DDTH by M11249 could be addressed. Two synthetic routes were applied toward the preparation of ATTH. One route took advantage of the structurally intact amino acid moiety of aspartic acid, which would be condensed with another 3-carbon unit. The second route from D-tartaric acid would utilize the given diol stereochemistry of a 2-deoxy-xylose intermediate to avoid the use of a stereoselective aldol or dihydroxylation reaction. Synthesis of ATTH from N-Cbz-Aspartic acid 0 O O O O OH b CszNI'-<‘ —a-—> (NI 0 ——> A ——> (NI 0 OH Obi 9’40H Obi 9’4“ N-Cbz-aspartate Figure 50. Preparation of the oxazolidine aldehyde. Reaction conditions: (a) paraformaldehyde, pTSA, PhCH3, reflux, 88%; (b) see Table 16. The Ot-carboxylic acid group of N-Cbz-L-aspartic acid was first selectively converted to the oxazolidinone acid in 88% yield in the presence of para-formaldehyde and p-toluenesulfonic acid in toluene with the azeotropic removal of water (Figure 50). Several conditions were then applied to convert the free carboxyl group of the oxazolidine acid into a desirable intermediate for reduction to the aldehyde. Both and acid chlorides and a Weinreb amides are known to form aldehyde under reducing conditions, while a primary alcohol can be selectively oxidized to the aldehyde. The oxazolidine acid chloride was produced in 90% crude yield by treating the oxazolidine acid with distilled oxalyl chloride in dichloromethane with catalytic addition of DMF 109 (entry 1, Table 16). Attempts to produce the primary alcohol resulted in complex mixtures of products presumably due to side reactions involving reduction of the ester in the oxazolidine ring (entry 2 and 3, Table 16). In order to use this route a bulkier protecting group would be required, therefore the reduction/oxidation route was abandoned. The Weinreb amide was successfully produced in 70% yield by treating the oxazolidine acid with (N, O)-dimethyl hydroxylamine, triethylamine, and BOP reagent (entry 4, Table 16). Table 16. Varying conditions used to prepare compound A as an intermediate to the N -Cbz-oxazolidine aldehyde. entry reaction conditions product A yield (%) (o o 1 oxalyl chloride, DMF, CHzCl2 111:? 90° CbZ CI 0 2 NaBH4, AcOH, MeOH (Pig-"km complex mixture Cbz o 3 BH3°THF, -5°C 313k complex mixture N OH Cbz (ofoo b 4 HN(OMe)Me, BOP'PF6, NEt3 CD.“ "94 o 70 Z N’ I \ (a) crude yield; (b) yield after flash column purification Once the acid chloride and the Weinreb amide were prepared attempts were made to convert both to the aldehyde under varying hydrogenation conditions (Table 17). 01 in the Attempts to reduce the acid chloride via a modified Rosemund reduction1 presence of 5% Pd/BaSO4 and 2,6-lutidine in dry THF and 50 psi H2 failed to yield the desired aldehyde. Although the acid chloride was no longer present at the end of the reaction, an examination of the 1H NMR spectra of the product revealed no aldehyde 110 hydrogen was present. Performing this hydrogenation at atmospheric pressures of hydrogen initially failed to produce the aldehyde as well, however, when the reaction was run with freshly purchased catalyst the aldehyde was produced. This suggests the original catalyst was somehow poisoned or inactivated. The previous, yet unidentified, product of the reduction was also present so the success of the reaction was gauged by the H,,/Hb ratio (Table 17). Under atmospheric pressure of H2 the modified Rosemund reduction gave a Ha/Hb ratio of 0.38, however further attempts to perform the reduction indicated that the ratio was not consistently reproducible. The Hale ratio was smaller upon each subsequent run of the reaction. Changing the catalyst to Pd/C failed to yield any aldehyde product. Also attempting to reduce the acid chloride with Li(OtBu)3AlH failed to produce the desired aldehyde. The last set of conditions attempted to reduce the acid chloride involved refluxing the acid chloride in toluene with Pd/BaSO4 under a constant stream of hydrogen. The desired aldehyde was produced with a Ha/Hb ratio of 0.53 (entry 5, Table 17). Under these conditions again the undesired compound was visible in the 1H NMR, however the results were reproducible. The higher success of this reaction over the modified Rosemund reduction is presumably due the removal of HCl by the hydrogen stream, which would protect the catalyst from poisoning. Attempts to reduce the Weinreb amide to the aldehyde either gave trace yields or resulted in no reaction so this route was abandoned. 111 Table 17. Optimization of oxazolidine aldehyde preparation. O A ..___. f O .N 5 Hb Cb ' O z Y Ha 1H NMR . . Entry A Conditions peak at 9.6 Integrat‘on ””0 (Ha/Hb) PPm o o 1 (NJ: ,1? 5% Pd/BaSO4, 2,6-lutidine, N/A Obi ' 01 THF, 50 psi, H2 None 2 5% Pd/BaSO4, 2,6—lutidine, “ THF, H2, atmos Yes 0.38 ,, 10% Pd/C, 2,6—lutidine, 3 THF, atmos None N/A 4 L1(OtBu)3A1H, THF, rt Ncne N/A 5 5% Pd/BaSO4, toluene, “ reflux, H2 stream Yes 0.53 o o 6 $.11)? DIBAL, THF/Hexanes, Cbz [N'O\ -78°C Yes Trace 7 Li(OtBu)3AlH, THF, “ -78°C-rt None, NR N/A NR = No reaction; N/A = Not attempted Although the reduction of the acid chloride in toluene at reflux provided a higher yield of the aldehyde, the consistency was still not at an acceptable level. Also, the presence of a contaminating byproduct might cause difficulties in later synthetic steps. It was considered that drying the acid chloride under vacuum may not have been capable of removing contaminating HCl. Several attempts were made to distill the acid chloride under vacuum as a means to remove any possible HCl, however only decomposition 112 occurred. The contaminating HCl was removed through resuspension of the acid chloride in solvent (CHzCl2 or CHCl3 (alcohol free)) followed by washing the organic layer with a dilute solution of sodium bicarbonate. The yield of acid chloride from the oxazolidine suffered lowering to 64%, however the Hale ratio of the aldehyde produced from the washed acid chloride was on average 0.75 or higher (Figure 51). Also, the undesired and unknown contaminating product of the hydrogenation was no longer produced leaving mainly aldehyde to be used for the next step of the synthesis. 0 O O O O O (Io —a—» (Io —”——» 1.7:, Cbz‘ "’I(OH coz' ’40, 002' ifo Ha H,/H.,=o.75 Figure 51. Optimized of oxazolidine aldehyde preparation from the acid chloride. Reaction conditions: (a) i. oxalyl chloride, DMF, CHzClz, ii. dilute NaHCO3 wash, 64%; (b) H2, 5% Pd/BaSO4, toluene, reflux. The next step of the synthesis required the condensation of the oxazolidine aldehyde with another species through an aldol condensation or an Homer—Wadsworth Emmons or cross-metathesis reaction to form an 01,[3-unsaturated ketone. The majority of selective aldol reactions in the literature either would not produce the correct stereochemistry of the diol, or require the preparation of additional intermediates. An attempt to condense the oxazolidine aldehyde with dihydroxyacetone phosphate using rabbit muscle aldolase failed, presumably due to the insolubility of the product in water. The other option considered was to form an 01,8-unsaturated ketone via an Homer-Wadsworth Emmons condensation or a cross-metathesis reaction. The cross- metathesis reaction would require the condensation of the oxazolidine aldehyde first with a Wittig reagent to provide protected allyl glycine. The allyl glycine would then be 113 condensed with but—3-en-2-one via a cross—metathesis reaction with Grubb’s second generation catalyst. A second method involved the formation of the enone in a single step by condensing the aldehyde with triphenylphosphoranyl-2-propanone (T PP). Since the latter route required the least number of reaction steps, it was attempted first (Figure 52). Figure 52. Synthetic strategy for enone preparation from the oxazolidine aldehyde. CH3PPhSBr (0340 __. N J/ KN(TMS)2 Ooz' , (ofo O O .N ,,l( M Cbz H Grubb's 2"d CHzclz, reflux 0 C132. 299m. 0 EH0 —» / . Early attempts to perform the condensation of the aldehyde with TPP at room tempterature failed, so a test reaction was run to save starting material, and ensure the reaction was being performed correctly. Benzaldehyde was reacted with TPP at reflux, producing the desired enone in 95%. However, when the oxazolidine N-Cbz-aspartate semialdehyde was reacted with TPP at reflux the yield was a meager 7% (entry 1, Table 18). The temperature was then lowered in steps to 90, 60, and 40°C in an attempt to improve the yield. Running the condensation at 60°C gave the highest yield of 51% from the acid chloride (entries 2, 3, and 4, Table 18). It was a concern that the condensation might not produce exclusively the trans double bond so further reactions were performed to ensure the stereoselectivity for the trans double bond. Several conditions of Homer- Wadsworth Emmons condensations utilizing the phosphonate shown below (Table 18) have been reported for the selective preparation of the trans double bond.102 However, 114 several conditions attempted failed to produce any of the enone product (entries 5, 6, and 7, Table 18). Table 18. Condensation of oxazolidine aldehyde with TPP to produce the enone. o O Cbz. ( f O O 1:140 CbiN 'II/«H M Entry Reaction Conditions % Yield Enonea l TPP, toluene, reflux 7 2 TPP, toluene, 90°C 10 3 TPP, toluene, 60°C 51 4 TPP, toluene, 40°C 27 5 Phosphonate, Ba(OH)2, THF/H20 0 6 Phosphonate, LiCl, DBU, dry CH3CN 0 7 Phosphonate, LiCl, NEt3, dry CHlCN 0 (a) yield calculated based on mmol acid chloride used for hydrogenation O O O uOMe )VPPha /U\/b~OMe TPP phosphonate The next step of the synthesis required the syn-dihydroxylation of the enone to produce the vicinal diol with 4R, 5S stereochemistry. The route utilized most often in the literature is the Sharpless asymmetric dihydroxylation using the (DHQD)2PHAL ligand and 0804. However, the dihydroxylation tends to be more difficult with (LB-unsaturated carbonyl compounds due to cleavage of the double bond and/or the deactivated double bond being unreactive towards dihydroxylation.103 One reference reported the standard dihydroxylation conditions did not work and reported an alternative method using stoichiometric quantities of the ligand and 0304 followed by treatment with HCl/MeOH to cleave the osmate ester produced in the reaction.104 Attempts to perform the dihydroxylation under these conditions with subsequent HCl/MeOH treatment (at room temperature or at reflux) failed to yield any product (entries 1 and 2, Table 19). A variety of procedures and conditions are reported for performing the dihydroxylation so attempts 115 were made to repeat as many of those conditions as possible. The treatment of the enone with AD-mix-B at 0°C in tBuOHzHZO (1:1) failed to yield the diol (entry 3, Table 19). Adding the components of the AD-mix separately also failed (entry 5, Table 19). It has been reported by Sharpless that enones require buffering to avoid cleavage of the double bond. Attempting those conditions at 0 or 4°C failed to produce the diol using 0304 (entry 5 and 6, Table 19). Exchanging the Osmium catalyst to the more stable and easy to handle KZOsO4°2HzO resulted in a recovery of starting material when run under an inert atmosphere (entry 8, Table 19). Omitting the added KzOsO4°2HzO under inert conditions also led to a recovery of starting material (entry 9, Table 19). When buffered Sharpless conditions were used with the KzOsO4°2HZO in air the reaction yielded a 4% yield of a product presumed to be the diol (entry 10, Table 19). This yield, however, is not useful for the continuation of the synthesis so still more conditions were attempted. It was thought that lowering the temperature of the reaction might help to deter cleavage of the double bond, however running the reaction in either tBuOHszO or CHZCI2 at -20°C resulted in a recovery of starting material (entries 11 and 12, Table 19). Several groups have reported RuO4 complexes formed in situ from RuCl3 and NaIO4 can catalyze the syn dihydroxylation, however these conditions again failed to produce the desired diol (entry 13, Table 19). Changing the co-oxidant from 1(3Fe(CN)6 to NMO improved the yield of the presumed diol 10 fold (entry 14, Table 19), however the reaction produced a mixture of products which were not separable using a standard flash column. When the chiral ligand was added a mixture of products was again obtained (entry 15, Table 19) and the yield suffered slightly. 116 Table 19. Dihydroxylation of the enone. Cbz\ O CbzyflO ‘ O S OH 134 ' 7 , (R (S) w OH 0 Entry Reaction Conditions Yield Diol (%) 1 i. 0304, (DHQD)2PHAL,CH2C12/Et20, -20°C-rt 0 ii. HCl/MeOH, rt 2 i. OsO,,(DHQD),PHAL,CH2C12/Et,o, -20°C-rt 0 ii. HCl/MeOH, reflux 3 AD—mix—B, tBuOHzHZO (1:1), 0°C 0 4 Oso,, K3Fe(CN)6, K,co,, (DI-IQD)2PHAL, tBuOHzHZO (1: 1) 0 5 AD—mix-B, OsO4, NaHCO3, MeSO4NH2, tBuOH:H,O (1: 1), 4°C 0 6 AD-mix-B, MeSO4NH2, NaHCO3, tBuOHszO (1: 1), 0°C 0 7 AD-mix-B, Oso,, MeSO4NH2, Ncho,, tBuOH:H,O (1:1), 0°C 0 8 AD-mix-B, K,Oso,-2H,o, Meso,NH,, NaHCO3, tBuOHzHZO . NR (1:1), 0 c, Ar 9 AD-mix-B, MeSO4NH2, NaHCO3, tBuOH:HzO (1:1), 0°C, Ar NR 10 AD-mix-B, KzOsO4°2HzO, MeSO4NH2, NaHCO3, tBuOHszO 4 (1:1), 0°C 11 AD-mix-B, KZOsO4°2HZO, MeSO4NH2, NaHCO3, tBuOHzHZO NR (1:1), —20 to 0°C ‘2 AD-mix-B K,OsO,-2H,O, MeSO4NH2, NaHCO3, CH,C1,, -20°c NR 13 RuCl3°HzO, H20, NaIO4, EtOAc:CH3CN:HZO (3:3: 1), 0°C 0 ‘4 NMO, K,Oso,o2H,o, THthBuOHzHZO, 0°C-rt 44a 15 NMO, K,Oso,-2H,O, (DHQD)2PHAL, THF:tBuOH:HzO, 0°C- 27, I1: (a) Added enone all at once, product after chromatography was a mixture of diastereomers. NR = No reaction. With the presumed diol in hand the next step of the synthesis involved removal of the oxazolidine ring and Cbz group. It has been reported that BCl3 (5 eq) can remove both the Cbz group and open the oxazolidine ring to produce the free amino acid at room 117 temperature (Figure 53).105 However, all attempts using these conditions resulted in decomposition of the product/starting material. Figure 53. Simultaneous removal of Cbz group and cleavage of oxazolidine ring. Cbz, O OH N’\ Seq 30's O OH NH3+ 7 7 o —» T 7 O‘ 0H,,oi2 , rt OH O OH 0 Throughout the synthesis the NMR spectra contained broad undefined peaks. Possible problems which were proposed that might have caused the poor spectra included the contamination of metals, which could be chelating to the synthetic or poor solubility of the intermediates in the NMR solvent. In order to remove any possible metal containation, the oxazolidine acid was passed through small columns of cation exchange resins (Dowex 50 (H+ form) or IR-120 (H+ form)). However, the spectra did not improve. In an attempt to solve the possible issue of solubility, the oxazolidine acid was analyzed by 1H NMR in a variety of NMR solvents, including CDCI3, CD3OD, DMSO-d6, and acetone-d6. Again little improvement of the NMR spectra was observed. Increasing the temperature of the NMR analysis when the oxazolidine acid was dissolved in acetone-d6 did, however, improve the spectra significantly. The temperature was first raised to 40°C followed by 50°C (the instrument maximum allowable limit). Since 50°C gave the best result, all subsequent spectra were taken in acetone-d6 at 50°C. All intermediates preceding the diol gave good spectra under these conditions. The diol however again gave poor spectra. Further attempts were made to improve the selectivity of the dihydroxylation of the enone in the hopes of obtaining a cleaner product mixture. The substrate was added slowly over 12 to 18 h using a syringe pump in order to keep the concentration of the 118 substrate low enough to avoid reaction of osmium without the presence of the ligand. The equivalent of ligand was increased from 0.01 eq to 0.25 eq with no effect on the composition of the product mixture, however the yield decreased as the ligand equivalents increased (Table 20). Cooling the reaction to 0°C or running the reaction under an inert atmosphere also did not make a difference in the yield or product mixture composition. Table 20. Optimization of enone dihydroxylation. Entry Li ganda $332181; Atmos. Temp. (°C) ”0:11:13 % ) 1 0.01 12 air r.t. 48 2 0.01 12 argon r.t. 42 3 0.01 12 air 0 45 4 0.02 18 air r.t. 25 5 0.25 12 air r.t. 1 1 (a) Equivalent of the ligand added to the reaction. The product mixture was purified by HPLC using a C18 reverse phase column. The purified product was analyzed by mass spectral analysis and was found to have the mass expected for the diol product. However, the 1H NMR spectra did not contain a peak expected for the oxazolidine methylene. This raised the question of whether the desired product was actually formed. Attempts were made to protect the presumed diol as a way of confirming the diol was present as expected. However preparation of the BBA protected diol failed to yield the desired product and instead produced a methyl ester. An attempt at preparing the benzyl diether also failed. It was thought perhaps the oxazolidine ring was opening during the dihydroxylation reaction to produce a cyclic product as seen in Figure 54. 119 Figure 54. Possible alternate dihydroxylation products. O OH Cbz“ {Or/(O WHY? Cbz N - N HQ —/ , O O \—- OH ’OH O Synthesis of ATTH from N-Boc-Asp(Obz)-OH With the realization the oxazolidine ring might be opening it was thought changing the protecting group on the alpha acid may provide a better result to the dihydroxylation. The mono boc and benzyl protected aspartate was purchased and the alpha ester protected as a t-butyl ester in 90% yield. A t-butyl ester was used since this protecting group is bulky and not highly susceptible to base catalyzed cleavage. In order to avoid any possible problems associated with the free hydrogen the amine group was protected with a second Boc group. The protection was attempted using Boc20 and NaH at reflux in THF, however the reaction yield was only 41%. When the conditions were changed to use DMAP as the base in CH3CN at room temperature the yield increased to 64%. The benzyl ester was then deprotected quantitatively using H2 gas in the presence of 0.01 mol % Pd/C in MeOH at room temperature. An attempt to produce the acid chloride under the same conditions as the previous oxazolidine synthesis failed, presumably due to the acid sensitivity of the Boc carbamate and the t-butyl ester. As an alternative the carboxylic acid was treated with N, O-dimethylhydroxylamine, TEA, and BOP reagent to give the Weinreb amide in 75% yield. The amide was reduced to the aldehyde in 86% yield with DIBAL at —78°C followed by condensation of the aldehyde with TPP to produce the protected enone in 77% yield. The asymmetric dihydroxylation of the enone was attempted first using 0304, NMO, and (DHQD)2PHAL ligand in a 3: 1: 1.7 tBuOH-HzO-THF solution. The dihydroxylation gave a clear 1:1 mixture of diol 120 diastereomers in 34% yield. The presence of two separate isomers was established using a 2D TOCSY experiment. There was no evidence of the loss of the protecting groups as witnessed previously with the oxazolidine-protected amino acid. The Sharpless conditions using AD—mix-fi, K20304, and methylsulfonamide with sodium bicarbonate as buffer were attempted to improve the stereoselectivity of the dihydroxylation. While the yield improved to 67%, the diastereoselectivity of the reaction was not improved. Attempts to purify the mixture into independent diastereomers by flash column chromatography failed. On all attempts the two compounds ran together. Boc O H'SBOC a O HN'BOC b O N800 c BnOMOH BnO’u\/\n’o\l/ ’ BnOJK/Kn/OX ' O O Q Boc _. O N. BOC ClJK/YO X 0 OBOCN BOG OBOC N'BO 0C —* EVER“ HMO—W Boc Boc Boc O N'BOC h 0 OH r11.Boc O OH ”Boc / . /u\/\/\n/ X : X K O OH O OH 0 Figure 55. Synthesis of ATTH from N, N-diboc-Asp-OtBu. Reaction conditions: (a) tBuOH, DMAP, DCC, CHZCIZ, 0°C — r.t. 90%; (b) BoczO, DMAP, CH3CN, 64%; (c) H2, Pd/C, MeOH, r.t., quant.; (d) oxalyl chloride, DMF, CH2C12, r.t.; (e) BOP-PF6, HN(OMe)Me, TEA, CH2C12, 75%; (f) DIBAL, THF/Hexanes, -88°C, 86%; (g) TPP, toluene, reflux, 77%; (h) AD-mix-B, KzOsO4°2HzO, NaHCO3, HZNSOzMe, tBuOH-HZO (1:1), 67% In an attempt to both confirm diol production as well as find a method to purify the diastereomers, the diol product was subjected to varying protection conditions (Table 121 I 21). Any attempts to create the dibenzyl ethers failed. The diacetate diastereomers were produced in 84% yield, but still could not be separated. The isopropylidene and dibenzoyl ester diastereomers also could not be separated. The diol mixture was treated with trifluoroacetic acid to remove the boc and t-butyl groups. The product however did not resemble the expected amino acid. Table 21. Protection of protected ATTH in an attempt to separate the diol diastereomers. M6 We °°°LB°° o 33°05“ OH OH O )KO/HVY OR 0 Entry Reaction Conditions R— Yield (%) 1 AczO, pyr, r.t. Ac- 84 2 BnBr, Bu4NI, NaH, 0°C- r.t. Bn- 0 3 BnBr, NaH, THF, 0°C - r.t. Bn- 0 4 2,2—dimethoxypropane, pTSA isopropylidene 0 5 BzCl, pyr, r.t. 82- 38 In an attempt to reduce the steric hindrance during the dihydroxylation caused by the bulky boc groups, the synthesis of ATTH was performed without the second boc group. The exclusion of the second boc group would also allow the use of milder deprotection conditions at the end of the synthesis. The yields of several of the synthetic steps dropped slightly with this alteration and unfortunately there was no observed improvement in the selectivity of the dihydroxylation of the enone. Again the diastereomers were inseparable. Upon benzoylation of the diol product mixture however the two diastereomers could be separated easily using silica gel. 122 0 Off NH O 8%; '3“ Boc I O O\|/ 0 O HC‘NH ' 0+ 0 882 NH O OH O 082 O A Figure 56. ATTH from N-boc-Asp-OBn-OtBu. (3) H2, Pd/C. MeOH, quant.; (b) BOP'PFG, HN(OMe)Me, TEA, CHzClz, 49%; (c) DIBAL, THF, -88°C, 68%; (d) TPP, toluene, 90°C, 57%; (e) AD-mix—B, KzOsO4°2HzO, HZNSOzMe, NaHCO3. tBuOHszO (1:1), 0°C, 48%; (f) BzCl, pyr, CHZCIZ, r.t., 72%. In an attempt to determine which isomer was isolated from the asymmetric dihydroxylation of the mono-Boc protected enone, the reaction was performed using AD- mix-a. The reasoning being the ligand in AD-mix—a should have produced a diol with the opposite stereochemistry as the desired product. Thus a discernable excess of one diastereomer over the other would indicate that isomer contained the wrong stereochemistry. When AD-mix-Bwas replaced with AD-mix-a, the product mixture contained a 2.7:] A:B ratio suggesting B was the desired isomer. Attempts to deprotect the desired dibenzol ester to form the free amino acid using trifluoroacetic acid resulted in decomposition of the starting material. A variety of conditions were employed to remove the benzoyl esters, including the use of sodium methoxide and sodium bicarbonate, however the desired diol product was not obtained. In an attempt to avoid keto-enol tautomerization of the hydroxyl group adjacent to the carbonyl, an attempt was made to convert the ketone into a cyclic ketal with ethylene 123 glycol and pTSA in refluxing benzene. Unfortunately, the benzoyl groups proved too sensitive for these conditions, and again product decomposition occurred. The ketal could be formed by reacting the protected 01,13-unsaturated ketone under the same reaction conditions. By protecting the carbonyl at this earlier stage of the synthesis the olefin would likely be more reactive toward the dihydroxylation conditions, and possibly better stereoselectivity could be obtained. Synthesis of ATTH from D-tartaric acid through deoxy-xylose intermediacy A second synthetic route explored to produce ATTH utilized the built-in stereochemistry of 2-deoxyxylose. Two possible routes could be used to obtain the 2- deoxyxylose intermediate: synthetic from D-tartaric acid or chemo-enzymatic from glucose utilizing the 2-deoxyxylose producer SP1.1/pPV4.230. The chemo-enzymatic route would yield 2—deoxyxylose in amounts of 16 g/L, which would unfortunately be contaminated with as much as 2 g/L of 2-C-methylerythrose. Since the synthetic route starting from D-tartaric acid could be performed on a large scale giving clean, protected 2-deoxyxylose in approximately the same amount of time it was thought the synthetic route might be preferable. The D-tartaric acid was first treated with 2,2-dimethoxy propane, pTSA, methanol, and cyclohexane with azeotropic removal of acetone to provide the isopropylidene dimethyl ester of D-tartaric acid in 76% yield. The dimethyl ester was then cautiously treated with LiAlH4 in diethyl ether to provide the isopropylidene diol in 59% yield. Using 1 equivalent of TBDMSCI provided the mono-TBDMS ether in 86% yield. The remaining alcohol was oxidized under Swern conditions to the aldehyde in 85% yield, which was immediately treated with the MeMgBr to give the secondary 124 alcohol in 48% yield. The secondary alcohol produced was then oxidized to the ketone in the presence of NMO, TPAP, and crushed, activated 4 A molecular sieves in 88% yield. The preparation of the ketal however failed to produce the fully protected 2-deoxyxylose. The TBDMS group was apparently not able to survive the reaction conditions required to protect the ketone either using ethylene glycol or 1,3-propanedithiol. The replacement of the TBDMS group with a triisopropylsilyl or diphenylmethylsilyl group could alleviate this problem. However the isopropylidene could not survive the dithiane protection conditions. When the primary alcohol was protected as the TIPS ether the yield of the protection dropped to 23%. The subsequent oxidation of the second alcohol to the aldehyde under Swern conditions also experienced a yield decrease to 44%. The oxidation was followed by the Grignard reaction to provide the secondary alcohol in 19% yield. 125 :Aon —»>A—»>A ~sz TBDMSO TBDMSO f‘\ O 0mg 0mg 0 O >< " f 0],. 9 Ole. h Oh- i —> ——> —> —> 0'? MC ><0§ > OH O 0 0 O O O\ OH O 7Q \ 78 I N\ o ALNIY 1 Figure 57. ATTH synthesis from D-tartaric acid through 2-deoxy-xylose intermediacy. Reaction conditions: (a) 2,2-dimethoxypropane, MeOH, pTSA, cyclohexane, reflux, 76%; (b) i. LiAlH4, EtZO ii. H20, NaOH, 59%; (c) TBDMSCI, NaH, THF, 0°C — r.t., 86%; (d) i. DMSO, oxalyl chloride, TEA, -78°C — r.t., 85%, ii. MeMgBr, THF, —78°C — r.t. 48%; (e) NMO, TPAP, CH2C12, 4 A MS, 88%; (f) ethylene glycol, pTSA, benzene, reflux; no product; (g) TBAF, THF, r.t.; (h) PBr3; (i) n-BuLi, 1; (j) 0.25 N HCl; k. TMSI Discussion The work presented in this chapter sought to provide evidence for the intermediacy of ATTH in the biosynthesis of DHQ by M. jannaschii. The work can be divided into two routes. The first route attempted was the examination of the product mixture obtained upon reaction of ASA and DKFP by M10400. The second route entailed the synthesis of the proposed intermediate ATTH to be used as both a standard for spectral analysis and a substrate for the enzymes in question (M10400 and M11249). 126 Unfortunately the attempt to condense ASA with DKFP using the heterologously expressed ATTH was not successful. The only evidence obtained which might lend credence to White’s claim that ATTH was produced from this condensation was the GC- MS spectrum. However this spectrum did not contain all of the mass peaks reported by White and no further evidence could be obtained which might suggest this intermediate was being produced. Several points can be made which may explain these poor results. Both the substrates and products are relatively unstable and could decompose under the reaction conditions. This decomposition would decrease the concentration of the desired ATTH in the product mixture making spectral analysis difficult. Another point to consider is the unmeasured specific activity of M10400. The possibility remains that the specific activity of heterologously expressed M10400 may be low under these reaction conditions. Low activity may be due to a variety of factors. Since no activity assay has been developed and the product cannot be adequately quantified, there is no way to determine the optimum temperature, pH, buffer, or other stabilizing cofactors. Another possible reason for a low activity of this enzyme could be substrate specificity. Oxaloacetaldehyde was never eliminated as a precursor to DHQ biosynthesis. White reported the preparation of DHQ from ASA and DKFP by the action of both M11249 and M10400, but no evidence has been reported to establish that M11249 does catalyze the transamination of ATTH. The transamination could occur prior to the condensation, preparing oxaloacetaldehyde from ASA. Thus the possibility remains that the condensation of DKFP and oxaloacetaldehyde by M10400 could lead to the synthesis of DDTH, which would then cyclize to DHQ. 127 Upon failing to provide adequate evidence for the production of ATTH by the M10400 catalyzed condensation of ASA and DKFP, it was determined the preparation of ATTH was required to be used as a standard or a substrate for the transamination by M11249. Unfortunately the synthetic efforts failed to provide the desired ATTH. The protected ATTH was produced from aspartic acid, however once prepared the protecting groups could not be removed without product decomposition. The synthesis starting from D-tartaric acid also failed to provide the desired product. Further synthetic efforts will need to be made to prepare the proposed intermediate. 128 a mod on ma no . ex .anx f “an? 32.33 ex . a I .2: N mefiwzfi ulomhvuPCOESvaS— anyone even wzioo “to—mu can 23m Dene—meow Hw¢mlm¢A a: Figure 58. GC spectrum obtained from the M10400 catalyzed condensation of ASA 1 2 9 and DKFP. Q 7 8 O .9. w it t: +1 B 2 2 +1 £0) 0: +11— to 31 0) 6 +1 I! 1: A . 0—1 1* A 3 s e ., E .. :- . (0' g w——-. :2 .1 .3 TL 33:1" .‘c’ m N 0. VJ A g «a O .. 2 <9 3 ‘01 82°13; 12.. "a ‘ a. E a 9. {A Figure 59. Example of a mass spectrum obtained from the GC-MS analysis of the M10400 catalyzed condensation of ASA and DKFP. 130 . I‘ lII "I'Il, AH II 1 I I 1!! .1, "A II ppm Figure 60. 1H NMR spectrum of (4S)-3-carbobenzyloxy-5-oxo-4-(4-oxo-pent-2-enyl)- oxazolidine. 131 I}. i l l 11. .': . l fri' ‘ .‘ ”i 1' 1: : ‘ L1H}. p" a {1' F ’ 1 ] Q K M] t ‘LVJ ”‘4' v Li JV K / L4 ‘\_._..__....._. l l I I l ' | I I I 8.0 7.0 5.0 4.0 3.0 ppm Figure 61. ‘H NMR spectrum of the product mixture produced upon asymmetric dihydroxylation of (4S)-3-carbobenzyloxy-5-oxo-4-(4-oxo-pent-2-enyl)-oxazolidine. 132 _ M; f, v W m 4mg ____,_A “14»; _U _A. i T I r i i I T ' I ' i 5.0 4.5 4.0 2.5 2.0 1.5 1.0 Figure 62. 1H NMR spectrum of the diol mixture obtained upon Sharpless asymmetric dihydroxylation of N ,N-Bis(tert-Butoxycarbonyl)amino-6-oxo-hept-4- enoic acid tert-butyl ester. 133 __—_ __ .—-_——— V 44"- r: _——— Figure 63. 'H N MR spectrum of diol mixture produced upon Sharpless asymmetric dihydroxylation of N-tert-Butoxycarbonylamino-6-oxo-hept-4-enoic acid tert-butyl ester. 134 I T I ‘ I I I I ‘ I F I I I I 9.0 8.0 7.0 6.0 5.0 4.0 3.0 2.0 1.0 Figure 64. 'H NMR spectrum of compound A isolated upon benzoylation of the mono-boc protected diol mixture. 135 __II__MMWMW I I I I I I I I I T I I 8.0 7.0 6.0 5.0 4.0 2.0 1.0 Figure 65. 1H NMR spectrum of compound B isolated upon the benzoylation of the mono-boc protected diol mixture. 136 CHAPTER FOUR EXPERIMENTALS GENERAL METHODS General Chemistry All reactions sensitive to air and moisture were carried out in flame-dried glassware under a positive atmosphere of argon. Air or moisture sensitive reagents and solvents were transferred to reaction flasks fitted with rubber septa via oven-dried syringes or cannula. Unless otherwise specified, all reactions were carried out at room temperature. Solvents were removed using either a Biichi rotary evaporator at water aspirator pressure or under high vacuum (0.5 mm Hg). Acetone was dried over anhydrous ZnClz. CHZCIZ, Et3N, and pyridine were distilled from calcium hydride under argon. Tetrahydrofuran was distilled under argon from sodium/benzophenone. Methanol, ethyl ether, acetonitrile and toluene were distilled over sodium. Acetic anhydride was distilled over P205. Oxalyl chloride and 2,6- lutidine were distilled prior to use. Water used in synthesis was glass-distilled and deionized. All other reagents and solvents were used as available from commercial sources. Organic solutions of products were dried over anhydrous NazSO4 or MgSO4. The sodium salt of 3-(tn'methylsilyl)propionic-2, 2, 3, 3-d4 acid (TSP) was purchased from Lancaster Synthesis Inc. [Amine-ISNLL-glutamine and [amide-'5N1-L-glutamine, were obtained from Cambridge Isotope Laboratories, Inc. [3-2H]-glucose was purchased from Omicron Biochemicals Inc. N—Cbz-L-aspartic acid was purchased from EMD Biosciences, Inc. N-Boc-L—aspartic acid B-benzyl ester was purchased from Chem-Impex 137 International, Inc. All other reagents were purchased from Sigma-Aldrich or the MSU Chemistry stockroom. Chromatography HPLC analysis was preformed on an Agilent 1100 series HPLC with ChemStation acquisition software (Rev. A.08.03). Columns used include Agilent ZORBAX C-18 reverse phase analytical column (4.6 mm x 150mm), Agilent ZORBAX Bonus RP amide C-14 reverse phase analytical column (Agilent, 4.6 mm x 150 mm), Alltech C-18 reverse phase semi-prep column (22 mm x 250 mm), AXpak WA-624 weak anion exchange column (Showa Denko, 6 mm x 150 mm), and sugar KS-80l strong cation exchange column (Showa Denko, 8 mm x 300 mm). Solvents and samples were routinely filtered through 0.22-um membranes (Gelman Science). Analytes were detected at 254 nm. Protein purification utilized an AKTA Purifier FPLC system with Unicorn acquisition software 4.10 (Amersham Biosciences). Columns used include HiPrep DEAE FF column (16 mm x 100 mm, 16 mL), a Resource Q column (6.4 mm x 30 mm, 1 mL and 16 mm x 30 mm, 6 mL), HiLoad Superdex 200 (prep grade) column (16 mm x 600 mm). All the columns were purchased from Amersham Biosciences. Solvents were routinely filtered through 0.22-pm membranes (Gelman Science) and degassed under reduced pressure for 30 min prior to use. Proteins were detected at 260 nm. AGl-X8 (acetate form and chloride form) was purchased from Bio-Rad. Ni-NTA resin was purchased from Qiagen. Dowex 1 (ZOO-400 mesh, chloride form) and Dowex 50 (ZOO-400 mesh, H“) were purchased from Si gma-Aldrich. 138 Radial chromatography was performed on a Harrison Associates Chromatotron (model 7924), using 1, 2 or 4 mm layers of silica gel 60 PF254 containing gypsum (E. Merck). Silica gel 60 (40-63 um, E. Merck) was used for flash chromatography. Analytical thin-layer chromatography (TLC) utilized precoated glass plates of silica gel 60 F-254 (0.25 mm, Whatman). TLC plates were visualized by UV or by immersion in anisaldehyde stain (by volume: 93% ethanol, 3.5% sulfuric acid, 1% acetic acid, and 2.5% anisaldehyde) or phosphomolybdic acid stain (10% phosphomolybdic acid in absolute ethanol, w/v) followed by heating. Spectroscopic measurements 1H NMR and 13C NMR spectra were recorded on a Varian VX-300 FT-NMR or a Varian VX-SOO FT-NMR spectrometer. Chemical shifts for IH NMR spectra are reported (in parts per million) relative to internal tetramethylsilane (Me4Si, 6 = 0.0 ppm) with CDCl3 as solvent and to sodium 3-(trimethylsilyl)propionate-2,2,3,3-a’4 (TSP, 6 = 0.0 ppm) when D20 was the solvent. When DMSO or acetone were used as the solvent the chemical shifts were reported relative to the solvent peaks. The following abbreviations are used to describe spin multiplicity: s (singlet), d (doublet), t (triplet), q (quartet), m (unresolved multiplet), dd (doublet of doublets), b (broad). ”C NMR spectra were recorded at 125 MHz. Chemical shifts for 13C NMR spectra are reported (in parts per million) relative to internal tetramethylsilane (Me4Si, 6 = 0.0 ppm) with CDC]3 as solvent and to sodium 3-(trimethylsilyl)propionate-2,2,3,3-d4 (TSP, 6 = 0.0 ppm) when D20 was the solvent, or the solvent peak for acetone—d6. 31P NMR spectra were recorded on a 121 MHz Varian spectrometer and chemical shifts are reported (in parts per million) 139 relative to external 85% phosphoric acid (0.0 ppm). UV and visible measurements were recorded on a Perkin-Elmer Lambda 3b UV—Vis spectrophotometer or on a Hewlett Packard 8452A Diode Array Spectrophotometer equipped with HP 89532A UV-Visible Operating Software. Fast atom bombardment (FAB) mass spectra were obtained on a double focusing Kratos M850 mass spectrometer at Michigan State University and electrospray ionization (ES) mass spectra were obtained on a direct infusion electrospray mass spectrometer at Department of Chemistry and Biochemistry at University of South Carolina. Concentrations of culture and cell-free reaction products were determined by comparison of the integrals corresponding to each compound with the integral corresponding to TSP (6:0.00 ppm) in the 1H NMR. Compounds were quantified using the following resonances: kanosamine (6 5.27, d, 0.45 H), UDPG (6 5.55, dd, 1.0 H), 3- ketoUDPG (6 4.49, dd, 1.0 H). UDPK (6 5.67, dd, 1.0 H). Concentrations of above compounds derived from their respective 1H NMR integral values tended to be overestimated and their precise concentrations were calculated by application of the following formulas: [kanosamine (mM)],,C,um = 0.78 x [kanosamine (mM)]NMR + 0.15; [UDP-glucose (mM)],,ctual = 0.93 x [UDP-glucose (mM)]NMR + 0.10; [3-ketoUDPG (}4M)]actual = 1.01 x [3—ketoUDPG (}4M)]NMR — 0.96. The formula for UDPG was used for UDPK. These equations were obtained as follows: A known quantity of each compound was dissolved in 10 mL of D20 to obtain a stock solution. Various known volumes of the stock solution of each compound were concentrated under reduced pressure and redissolved in 1 mL of D20 containing 10 mM TSP and their 1H NMR spectra were recorded. The solute concentration in each sample that was estimated for 1H NMR was 140 plotted against the calculated concentration for that sample resulting in the calibration curve. The equation for 3-ketoUDPG was obtained as follows: Samples of known concentration of UDPG were prepared and injected on the HPLC. A calibration curve was generated by plotting the peak area against the sample concentration. Several NMR samples containing different concentrations of 3—ketoUDPG were then injected onto the HPLC. Using the calibration curve generation for UDPG the sample concentrations were calculated. The HPLC generated concentrations of 3-ketoUDPG were then plotted against the concentrations calculated by 'H NMR to create a calibration curve. Chemical Assays Organic and Inorganic Phosphate Assay Reagents used to quantify both organic phosphate and inorganic phosphate include 10 % Mg(NO3)2 (w/v, dissolved in ethanol), 0.5 M HCl, 10% ascorbic acid (w/v, dissolved in H20), and 0.42% (NH4)2MoO4 (w/v, dissolved in 1 M H2304). The assay solution (freshly mixed) consists of one volume of 10% ascorbic acid and six volumes of 0.42% (NH4)2MoO4. To assay for organic phosphate, 100 uL of 10% Mg(NO3)2 was added to a test tube (13 mm x 100 mm) containing 100 ML of sample. The resulting mixture was then evaporated to dryness over a flame, leaving a white solid. To this test tube was added 600 uL of 0.5 M HCl. After the white solid was dissolved, the solution was heated at 100 °C for 15 min in a boiling water bath. Assay solution (1400 uL, described above) was added to the cooled sample and the resulting mixture was kept at 45 °C for 20 min. If the 141 original sample contains either inorganic phosphate or any organic phosphate, a blue color will develop. To assay for inorganic phosphate, 600 uL of 0.5 M HCl and 1400 uL of assay solution were directly added to a test tube containing 100 uL of sample. The resulting reaction mixture was then heated at 45 °C for 20 min. Blue color is developed if sample contains inorganic phosphate. The phosphate concentration of a sample was quantified by comparing the absorbance at 820 nm of the sample to a standard curve that is prepared using a phosphorous standard solution (0.65 mM in 0.05 M HCl, Sigma 661-9). Ninhydrin assay The ninhydrin reagent contains NaOAc (15%, w/v), sulfolane (40%, v/v), ninhydrin (2%, w/v), and hydrindantin (0.36%, w/v) in H20. The pH of the reagent was adjusted to 2.5 with glacial acetic acid and the reagent was then filtered through filter paper An aliquot (50 uL) of the sample was added to a test tube (13 mm x 100 mm) containing 500 uL of ninhydrin reagent. The resulting mixture was heated at 100 °C for 5 min. A purple color develops if the sample contains free amino group. The concentration of amino group containing compound in a sample was quantified by comparing the absorbance at 570 nm of the sample to a standard curve that is prepared using glycine as the standard. 142 Bacterial Strains and Plasmids E. coli DHSa [F’ endAI hstI7(r‘Km+K) supE44 thi-I recAI gyrA relAl ¢801acZAMI5 A(lacZYA-argF)U,69] and JM109 [eI4-(McrA-) recAI endAI gyrA96 thi-I hstI7(r‘Km+K) supE44 relAI A(lac-pr0AB) [F’ traD36 proAB lacIQDMISH were obtained previously by this laboratory. Amycolatopsis mediterranei (ATCC 21789) and B. pumilus (ATCC 21143) were purchased from the American Type Culture Collection (ATCC). A. tumefaciens (NCPPB 396) was obtained from the National Collection of Plant Pathogenic Bacteria (NCPPB). A. mediterranei RM01 (RifL') and A. mediterranei HGF003 (RifK’) were obtained previously from Professor Heinz G. Floss (University of Washington). Plasmid constructions were carried out in E. coli DHSa. BL21 Codon Plus RP (F ompT hst(rB' ms) (1ch Tetr gal endA Hte [argU proL CamI]), BL21 (DE3) Codon Plus RIL (F ompT hst(rB' mB') dcm+ Tetr gal MDE3) endA Hte [argU ileY leuW Cam'] ), and BL21 Codon Plus RIL (F ompT hst(rB‘ m3") dcm” Tetr gal endA Hte [argU ileY leuW Cam']) were obtained from Stratagene. Agrobacterium tumefaciens NCPPB 396 was obtained from the National Collection of Plant Pathogenic Bacteria. The plasmid pMJ0400 was obtained from Prof. Robert H. White. The plasmids pJG7.259 (T5, lacO, lacO, 6xhis, rifK, lac/Q, Amp'), pJG7.275 (Pm, rifL, lacl", Amp’), and pJG7.246 (T5, lacO, lacO, 6xhis, lacIQ, Amp’) were obtained from Jiantao Guo. The plasmid pRM030 had previously been obtained from Prof. Heinz G. Floss. Storage of Bacterial Strains and Plasmids All bacterial strains were stored at -78 °C in glycerol. Plasmids were transformed into E. coli DHSa for long-tenn storage. Glycerol samples were prepared by adding 0.75 143 mL of an overnight culture to a sterile vial containing 0.25 mL of 80% (v/v) glycerol. The solution was mixed, left at room temperature for 1h, and then stored at -78 °C. Culture Medium Bacto tryptone, Bacto tryptone peptone, Bacto yeast extract, Bacto malt extract, agar, and soytone were purchased from Difco. Casein enzyme hydrolysate was obtained from Sigma. Meat extract was obtained from Fluka. Soy flour and peanut meal were purchased from ICN Bioscience. Nutrient agar was purchased from Oxoid. All solutions were prepared in distilled, deionized water. LB medium106 (1 L) contained Bacto tryptone (10 g), Bacto yeast extract (5 g), and NaCl (10 g). Terrific Broth (1 L) contained Bacto tryptone (12 g), Bacto yeast extract (24 g), glycerol (4 mL), KHZPO4 (2.31 g), and KZHPO4 (12.54 g). YT medium (1L) contained Bacto tryptone (16 g), Bacto yeast extract (10 g), NaCl (5 g). NZCYM medium (1 L) contained NZ amine (10 g), NaCl (5 g), Bacto yeast extract (5 g), CAS amino acids (1 g), MgSO4 - 7HzO (2 g). Both YT and NZCYM media were adjused to pH 7.0 with 50 FL 10 N NaOH solution before autoclaving. Antibiotics were added where required to the following final concentrations: chloramphenicol (Cm), 34 ug/mL; ampicillin (Ap), 50 ug/mL; kanamycin (Kan), 50 ug/mL. Isopropyl B-D-thiogalactopyranoside (IPTG) or lactose was added to the culture medium of strains containing inducible promoters including P P77, lac, or P“. Inorganic salts, D-glucose, and MgSO4 solutions were autoclaved separately while antibiotics and IPTG were sterilized by passage through a 0.22-pm membrane. Solid medium was prepared by the addition of 1.5% (w/v) agar to the liquid medium. 144 A. mediterranei was grown in YMG or vegetative medium. YMG medium (1 L) contained Bacto yeast extract (4 g), Bacto malt extract (10 g), and glucose (4 g). Vegetative medium107 (1 L) contained meat extract (5 g), Bacto tryptone peptone (5 g), Bacto yeast extract (5 g), casein enzyme hydrolysate (2.5 g), glucose (20 g), and NaCl (1.5 g). Solid YMG was prepared by the addition of 1.5% (w/v) agar to the liquid medium. I B. pumilus was grown either on solid nutrient agar or in liquid SSNG medium. Nutrient agar plates were prepared by the addition of 2.8% (w/v) nutrient agar to H20. SSNG medium108 (1 L) contained soy flour (15 g), soytone (1 g), NaCl (6 g), and glucose (10 g). D-Glucose (20% w/v) was autoclaved separately. A. tumefaciens was grown on solid MP medium or in liquid AB/sucrose medium. MP medium (1 L) contained Bacto peptone (5 g) and meat extract (3 g). AB sucrose medium (1 L) contained KH2P04 (5.4 g), Bacto yeast extract (0.5 g), NazHPO4 - 2HZO (10.8 g), and sucrose (20 g). After the medium cooled 10 mL of urea solution (0.9 g), and 10 mL of trace element solution containing MgSO4 - 7HZO (0.15 g), CaCl2 - ZHZO (0.025 g), FeSO4 - 7HZO (0.01 g), and citric acid (0.16 g) at pH 7.0 were added. Sucrose (20% w/v) was autoclaved separately. Solid MP medium was prepared by the addition of 1.5% (w/v) agar to the liquid medium. Analysis of culture supernatant Samples (1 mL) of the culture were taken at timed intervals and the cells were removed by microcentrifugation. Cell densities of E. coli were determined by 145 measurement of absorption at 600 nm (OD600) after dilution if necessary. Cell densities of A. mediterranei and B. pumilus were not measured. Solute concentrations in the cell-free culture supernatant were determined by III N MR. Solutions were concentrated to dryness under reduced pressure, concentrated to dryness an additional time from D20, and then redissolved in D20 containing a known concentration of the sodium salt of 3-(trimethylsilyl)propionic-2,2,3,3-d4 acid (TSP). Concentrations were determined by comparison of the integrals corresponding to each compound with the integral corresponding to TSP (6:0.00 ppm) in the 1H NMR. Compounds were quantified using the following resonances: kanosamine (6 5.27, d, 0.45 H), UDPG (6 5.55, dd, 1.0 H), and 3-ketoUDPG (6 4.49, dd, 1.0 H). The concentrations of UDPG, 3-ketoUDPG, and kanosamine were calculated by application of the previously described calibration formulae. Genetic Manipulations General procedures Standard protocols were used for construction, purification, and analysis of plasmid DNA. E. coli DHS was used as the host strain for plasmid manipulations. dNTP’s, and agarose (electrophoresis grade) were purchased from Invitrogen. Pfu turbo DNA polymerase and pfu DNA polymerase reaction buffer were purchased from Stratagene. Fastlink DNA ligase was purchased from Epicentre. Restriction enzymes were purchased from Invitrogen or New England Biolabs. Calf intestinal alkaline phosphatase was purchased from New England Biolabs. PCR amplifications were Error! Bookmark not defined. performed as described by Sambrook. Each reaction (0.50 mL) 146 contained 2.5 yL of pfu DNA polmerase reaction buffer (10X concentration), dATP (0.2 mM), dCT P (0.2 mM), dGTP (0.2 mM), dTTP (0.2 mM), template DNA (0.02 ug or 1 pg), 0.5 ”M of each primer, 0.5 units of pfu Turbo polymerase, and 2 FL DMSO. Primers were synthesized by the Macromolecular Structure Facility at Michigan State University. SEVAG is a mixture of chloroform and isoamyl alcohol (24:1 v/v). TE buffer contained 10 mM Tris-HCl (pH 8.0) and 1 mM disodium EDTA (pH 8.0). Endostop solution (10X concentration) contained 50% glycerol (v/v), 0.1 M disodium EDTA (pH 7.5), 1% sodium dodecyl sulfate (SDS) (w/v), 0.1% bromophenol blue (w/v), and 0.1% xylene cyanole FF (w/v) and was stored at 4 °C. Prior to use, 0.12 mL of DNase-free RNase was added to 1 mL of 10X Endostop solution. Determination of DNA concentration The concentration of DNA in a sample was determined as follows: an aliquot (10 uL) of the DNA solution was diluted to 1 mL in TE and the absorbance at 260 nm was measured relative to the absorbance of TE. An absorbance of 1.0 at 260 nm corresponds to 50 ug/mL of double stranded DNA. Large scale purification of plasmid DNA Plasmid DNA was purified on a large scale using a modified lysis method as Error! Bookmark not defined. described by Sambrook et al. In a 2 L Erlenmeyer flask, 500 mL of LB medium containing the appropriate antibiotic was inoculated from a single colony, and the culture was incubated at 37 °C (E. coli strains harboring plasmids used for two- 147 hybrid experiments were grown at 30 °C) for approximately 12 h (24 h if culturing at 30 °C) with agitation at 250 rpm. In cases where the plasmid did not possess an antibiotic marker, 500 mL of M9 minimal medium was used and the culture was shaken (250 rpm) at 37°C for 24 h. Cells were harvested by centrifugation (4000g, 5 min, 4 °C) and then resuspended in 10 mL of cold solution 1 (50 mM glucose, 20 M Tris-HCI, pH 8.0, 10 mM EDTA, pH 8.0) into which lysozyme (5 mg/mL) had been added immediately before use. The suspension was stored at room temperature for 5 min. Addition of 20 mL of solution 2 (1% SDS (w/v) in 0.2 N NaOH) was followed by gentle mixing and storage on ice for 15 min. Fifteen milliliters of ice cold solution 3 (prepared by mixing 60 mL of 5 M KOAc, 11.5 mL of glacial acetic acid, and 28.5 mL of water) was added. Vigorous shaking resulted in formation of a white precipitate. After the suspension was stored on ice for 10 min, the cellular debris was removed by centrifugation (48000g, 20 min, 4 °C). The supernatant was transferred to two centrifuge bottles and isopropanol (0.6 volumes) was added to precipitate the DNA. After the samples were left at room temperature for 15 min, the DNA was recovered by centrifugation (20000g, 20 min, 4 °C). The DNA pellet was rinsed with 70% ethanol and dried. The isolated DNA was dissolved in TE (3 mL) and transferred to a Corex tube. Cold 5 M LiCl (3 mL) was added and the solution was gently mixed. The sample was centrifuged (12000g, 10 min, 4 °C) to remove high molecular weight RNA. The clear supernatant was transferred to a Corex tube and isopropanol (6 mL) was added followed by gentle mixing. The precipitated DNA was collected by centrifugation (12000g, 10 min, 4°C). The DNA was then rinsed with 70% ethanol and dried. After redissolving the DNA in 0.5 mL of TE containing 20 ug/mL of RNase, the solution was transferred to a 148 1.5 mL microcentrifuge tube and stored at rt for 30 min. DNA was precipitated from the solution upon addition of 500 uL of 1.6 M NaCl containing 13% PEG-8000 (w/v). The solution was mixed and microcentrifuged (10 min, 4 °C) to recover the precipitated DNA. The supernatant was removed and the DNA was then redissolved in 400 uL of TE. The sample was extracted sequentially with phenol (400 uL), phenol and SEVAG (400 uL each), and finally SEVAG (400 uL). Ammonium acetate (10 M, 100 uL) was added to the aqueous DNA solution. After thorough mixing, 95% ethanol (1 mL) was added to precipitate the DNA. The sample was left at rt for 5 min and then microcentrifuged for 5 min at 4 °C. The DNA was rinsed with 70% ethanol, dried, and then redissolved in 250-500 ML of TE. Large scale purifications of plasmid DNA were also performed by using the Maxi Kit (Qiagen) following the protocol supplied by the manufacturer. Small scale purification of plasmid DNA An overnight culture (5 mL) of the plasmid-containing strain was grown in LB medium containing the appropriate antibiotics. In cases where nutritional pressure was used to maintain plasmid, 5 mL of M9 minimal medium was used and the culture grown for 24 h. Cells from 3 mL of the culture were collected in a 1.5 mL microcentrifuge tube by microcentrifugation. The harvested cells were resuspended in 0.1 mL of cold solution 1 into which lysozyme (5 mg mL'I) was added immediately before use. The suspension was incubated on ice for 10 min and then treated with solution 2. The mixture was shaken gently and kept on ice for 5-10 min. To this sample was added 0.15 mL of cold solution 3, and the mixture was shaken vigorously, resulting in formation of a thick white 149 precipitate. The sample was stored on ice for 5 min, after which the precipitate was removed by microcentrifugation (15 min, 4°C). The supernatant was transferred to another microcentrifuge tube and extracted with equal volumes of phenol and SEVAG (0.2 mL each). The aqueous phase (approximately 0.5 mL) was transferred to a microfuge tube and the DNA was precipitated by addition of 95% ethanol (1 mL). The sample was left at room temperature for 5 min before microcentrifugation (15 min, rt) to isolate the DNA. The DNA pellet was rinsed with 70% ethanol, dried, and redissolved in 50-100 uL TE. DNA isolated from this method was used for restriction enzyme analysis. Restriction enzyme digest of DNA A typical digest (10 uL) contained approximately 7.5 uL of DNA (0.1 ug/uL in TE), 1 uL of restriction enzyme buffer (10X concentration), 1 uL of restriction enzyme, and 0.5 uL of bovine serum albumin (BSA, 2 mg/mL). Reactions were incubated at 37 °C for I h. Digests were terminated by addition of 1 uL of Endostop solution (10X concentration) and subsequently analyzed by agarose gel electrophoresis. When DNA was required for subsequent cloning, restriction digests were terminated by addition of 1. uL of 0.5 M EDTA (pH 8.0) followed by extraction of the DNA with equal volumes of phenol and SEVAG and precipitation of the DNA. DNA was precipitated by addition of 0.1 volume of 3 M NaOAc (pH 5.2) followed by thorough mixing and the addition of 3 volumes of 95% ethanol. Samples were stored for at least 1 h at -78 °C. Precipitated DNA was recovered by microcentrifugation (15 min, 4 °C). Ethanol (70%) was added and the sample was microcentrifuged for 10 min at 4°C. Ethanol was then discarded, and the DNA was air dried and redissolved in TE. 150 Alternatively, the DNA was isolated from the reaction mixture using Zymoclean DNA Clean and Concentrate Kit (Zymo Research). Agarose gel electrophoresis Agarose gels were run in TAE buffer containing 40 mM Tris-acetate and 2 mM EDTA (pH 8.0). Gels typically contained 0.7% agarose (w/v) in TAE buffer. Lower concentrations of agarose (0.3%) were used to resolve genomic DNA and electrophoresis was conducted at 4 °C instead of rt. Ethidium bromide (0.5 rig/ml) was added to the agarose to allow visualization of DNA fragments under a UV lamp. The size of the DNA fragments were determined by comparison to DNA fragments contained in the following: 1. DNA digested with HindIII (23.1-kb, 9.4-kb, 6.6-kb, 4.4-kb, 2.3-kb, 2.0-kb, and 0.6- kb) and A DNA digested with EcoRI and HindIII (21.2—kb, 5.1-kb, 5.0-kb, 4.3-kb, 3.5-kb, 2.0-kb, 1.9—kb, 1.6-kb, 1.4-kb, 0.9-kb, 0.8-kb, and 0.6-kb). Isolation of DNA from agarose Zymoclean DNA Isolation Kit (Zymo Research) was used to isolate DNA from agarose. The band of agarose containing the DNA of interest was excised from the gel with a razor and transferred to a 1.5 mL microfuge tube. Three volumes of agarose dissolving buffer was added to each volume of agarose gel and the resulting suspension was incubated at 42°C with intermittent vortexing until the gel was completely dissolved. DNA in the dissolved agarose solution was subsequently purified using a Zymo-Spin Column. 151 Treatment of vector DNA with calf intestinal alkaline phosphatase (CIAP) Following restriction enzyme digestion, vectors were dephosphorylated to prevent self-ligation. Digested vector DNA was dissolved in TE (88 uL). To this sample was added 10 uL of dephosphorylation buffer (10X concentration) and 2 uL of calf intestinal alkaline phosphatase (2 units). The reaction was incubated at 37 °C for 1 h. Phosphatase was inactivated by the addition of 1 uL of 0.5 M EDTA (pH 8.0) followed by heat treatment (65 °C, 20 min). The sample was extracted with phenol and SEVAG (100 uL each) to remove the protein, and the DNA was precipitated as previously described and redissolved in TE. Alternatively, the DNA was isolated from the reaction mixture by using Zymoclean DNA Clean and Concentrator Kit. Ligation of DNA DNA ligations were designed so that the molar ratio of insert DNA to vector DNA was 3 to l. A typical ligation reaction contained 0.03 to 0.1 ug of vector DNA and 0.05 to 0.2 ug of insert DNA in a combined volume of 7 uL. To this sample, 2 uL of ligation buffer (5X concentration) and 1 ML of T4 DNA ligase (2 units) were added. The reaction was incubated at 16 °C for at least 4 h and then was used to transform competent cells. In an alternative method, the Fast-link DNA Ligation Kit (Epicentre) was used according to the manufacturer’s protocol. Preparation and transformation of E. coli competent cells Competent cells were prepared using a procedure modified from Sambrook et al. A single colony was inoculated into 5 mL of LB containing the necessary antibiotics. 152 After overnight growth, an aliquot (1 mL) of the culture was transferred to a 500 mL Erlenmeyer flask containing 100 mL of LB containing the necessary antibiotics. The cells were cultured at 37 °C with shaking at 250 rpm until an OD600 of 0.4-0.6 was reached. The entire culture was transferred to a centrifuge bottle that was sterilized with bleach and rinsed exhaustively with sterile water. The cells were harvested by centrifugation (4000g, 4 °C, 5 min) and the culture medium was discarded. All manipulations were carried out on ice during the remainder of the procedure. Harvested cells were resuspended in 100 mL of ice cold 0.9% NaCl. After centrifugation at 4000g and 4 °C for 5 min, the cells were resuspended in ice cold 100 mM CaCl2 (50 mL) and stored on ice for 30 min. The cells were then collected by centrifugation (4000g, 5 min, 4 °C) and resuspended in 4 mL of ice cold 100 mM CaCl2 containing 15% glycerol (v/v). Aliquots (0.25 mL) of competent cells were transferred to 1.5 mL microfuge tubes, frozen in liquid nitrogen, and stored at -78 °C. In order to perform a transformation, frozen competent cells were thawed on ice for 5 min prior to use. A small aliquot (1 to 10 mL) of plasmid DNA or a ligation reaction was added to the thawed competent cells (0.1 mL). The solution was gently mixed and stored on ice for 30 min. The cells were then heat shocked at 42 °C for 2 min and then placed on ice for 2 min. LB (0.5 mL) was added to the cells, and the sample was incubated at 37 °C for 1 I1 (or 30 °C for 1.5 h with agitation). After incubation, cells were collected by microcentrifugation. If the transformation was to be plated onto LB plates, 0.5 mL of the culture supernatant was removed. The cells was then resuspended in the remaining 0.1 mL of LB and spread onto LB plates containing the appropriate antibiotics. If the transformation was to be plated onto minimal medium plates, all the 153 culture supernatant was removed. The cells were washed with 0.5 mL of M9 salts and collected by microcentrifugation. After removal of all the supernatant, the cells were resuspended in 0.1 mL of M9 salts and spread onto the appropriate plates. A sample of competent cells with no DNA added was also Carried through the transformation procedure as a control. These cells were used to check the viability of the competent cells and to verify the absence of growth on selective medium. General Enzymology General information E. coli and B. pumilus cells were harvested at 4000g for 5 min at 4°C and A. mediterranei were harvested at 11000g for 5 min at 4°C. Cells lysis was achieved by two passages through a French pressure cell (SLM Aminco) at 16,000 psi. Cellular debris was removed from the lysate by centrifugation (30000g, 30 min, 4 °C). Protein solutions were concentrated by ultrafiltration using either Millipore PM-lO membranes (10,000 MWCO) or Centricon concentrators (Amicon). Protein concentrations were determined using the Bradford dye-binding procedure109 using protein assay solution purchased from Bio-Rad. The assay solution was prepared by diluting 20 mL of the Bio-Rad concentrate to 100 mL with water followed by gravity filtration of the resulting solution. Assay solution (5 mL) was added to an aliquot of protein containing solution (diluted to 0.1 mL) and the sample was vortexed. After allowing the color to develop for 5 min, the absorbance at 595 nm of the solution was measured. Protein concentrations were determined by comparison to a standard curve prepared using bovine serum albumin 154 Protein solutions were concentrated by ultrafiltration using Millipore PM-10 membranes. This type of membrane was also used to remove proteins from reaction mixtures. Cell lysis was achieved by two passes through a French pressure cell (SLM Amico) at 16000 psi. Cellular debris was separated from the lysate by centrifugation at 48 000g for 20 min at 4 °C. Protein concentrations were quantified using the Bradford dye—binding procedure with the assay solution from Bio-Rad. The presence of heterologously expressed proteins was confirmed by SDS—PAGE analysis. AHBA synthase activity was measured by using the procedure reported by Floss. E. coli UGPase (GalU) assay The UGPase specific activity was measured using a coupled enzyme assay at r.t. by monitoring the production of NADH at 340 nm. A typical assay solution contained 100 mM Triethanolamine HCl buffer (pH 8.0), NAD (1.4 mM), MgCl2 - 6 H20 (4 mM), UDPG (1 mM), PPi (1.8 mM), glucose—6-phosphate dehydrogenase (3 units), phosphoglucomutase (3 units), and an appropriate amount of UGPase. The final assay volume was 1 mL. The increase in absorbance was monitored for 1 min. One unit of activity was defined as the amount necessary to produce 1 ymol of NADH per min at r.t. and pH 8.0. A molar extinction coefficient of 3440 L mol'l cm‘1 was used for activity calculations. A. tumefaciens glucoside-3-dehydrogenase activity assay UDP-3-keto—D-glucose dehydrogenase activity was measured at rt by monitoring the reduction of 2,6-dichloroindophenol (DCIP) at 600 nm in the presence of phenazine 155 methosulfate (PMS).110 A typical reaction mixture contained 10 mM phosphate buffer (pH 7.0), 60 uM 2,6-dichloroindophenol, 1 mM phenazine methosulfate, 1.5 mM UDP- glucose, and an appropriate amount of enzyme. The final assay volume was 1 mL. The decrease in absorbance at 340 nm was monitored for several minutes. One unit of enzyme activity was defined as the amount necessary to reduce 1 umol of 2,6- dichloroindophenol per min at 25°C and pH 7 .0. A molar extinction coefficient for 2,6- dichloroindophenol of 21,000 L mol'1 cm"1 was used for activity calculations.111 A. mediterranei UDPG dehydrogenase (RifL) assay Assay Condition #1: DCIP/PMS assay UDP-3-keto-D-glucose dehydrogenase activity was measured at rt by monitoring the reduction of 2,6-dichloroindophenol (DCIP) at 600 nm in the presence of phenazine methosulfate (PMS).II2 A typical reaction mixture contained 10 mM phosphate buffer (pH 7.0), 60 uM 2,6-dichloroindophenol, 1 mM phenazine methosulfate, 1.5 mM UDP- glucose, and an appropriate amount of enzyme. The final assay volume was 1 mL. The decrease in absorbance at 340 nm was monitored for severaI minutes. One unit of enzyme activity was defined as the amount necessary to reduce 1 umol of 2,6- dichloroindophenol per min at 25°C and pH 7.0. A molar extinction coefficient for 2,6- dichloroindophenol of 21,000 L mol'l cm'1 was used for activity calculations.”3 Assay Condition #2: HPLC assay UDP-glucose (0.054 g, 89 ymol) was incubated with 10 mL BL21 Codon Plus RP/pJG7.275 cell-free lysate in the presence of DCIP ( 0.003 g, 9 pmol), PMS (0.038 g, 156 124 pmol), MgClz-6HZO (0.012 g, 64 amol), and p-hydroxy benzoic acid (0.02 g, 144 pmol) at 30°C for 2 h. The p-hydroxy benzoic acid (PHBA) was added as an internal reference. 400 yL samples were removed every 15 min for 1 h and quenched with 50 aL 10% TCA. The samples were vortexed and the precipitated proteins were removed by centrifugation (14000g, 1 min). 300 pL supernatant were diluted to 640 yL with distilled deionized H20. 200 yL were then diluted again to 1 mL with distilled deionized H20. The samples were filtered through 0.22 am filters and 10 yL were injected onto the HPLC. The specific activity was measured by following the formation of 3—ketoUDPG over time. One unit of specific activity was defined as the amount necessary to produce 1 jumol of 3-ketoUDPG per min at 30°C and pH 7.5. A. mediterranei transaminase (RifK) assay UDP-3-keto-glucose (0.026 mg, 46 ymol) was incubated with 10 mL BL21 Codon Plus RP/pJG7.259 cell-free lysate in the presence of PLP (0.008 mg, 32 pmol), L- glutamine (0.013 g, 89 ymol), MgClz-6HZO (0.01 g, 49 pmol) at 30°C for 2 h. 250yL aliquots were removed every 30 minutes and quenched with 50aL 10% TCA. After removal of the proteins by centrifugation (14000g, 1 min), 200 pL supernatant was diluted with 300 aL distilled deionized H20 and 100 yL PHBA solution (1.2 mg/mL). After filtration 20 pL of each sample was injected onto the HPLC. The specific activity was measured by following both the formation of UDPK and the loss of 3—ketoUDPG over time at 254 nm. A unit of specific activity was defined as the amount necessary to convert 1 ymol of 3-ketoUDPG to UDPK per min at 30°C and pH 7.5. 157 A. mediterranei AHBA synthase (RifK) activity The AHBA synthase activity was measured at 30°C by monitoring the production of AHBA. A typical reaction contained 50 mM Tris-HCI (pH 7.5), 0.5 mM PMSF, 0.5 mM DTT, 5% w/v glycerol, 25 mM KCl, 0.3 mM aminoDHS, and an appropriate amount of BL21 Codon Plus RP/pJG7.259 cell-free lysate. The final reaction volume was 1 mL. The sample was incubated at 30°C for 1 h before the addition of 200 aL 10% (w/v) TCA solution. The protein was removed by microcentrifugation, and the absorbance of the solution was measured at 296 nm. One unit of enzyme activity was defined as the amount necessary to produce 1 ymol AHBA per min at 30°C and pH 7.5. A molar extinction coefficient for AHBA of 1891 L mol'I cm'1 was used for calculations. SDS-PAGE protein gel SDS-PAGE analysis was followed the procedure described by Harris et al.114 The separating gel was prepared by mixing 3.33 mL of 30% acrylamide stock solution (w/v in H20), 2.5 mL of 1.5 M Tris-HCI (pH 8.8), and 4 mL of distilled deionized water. After degassing the solution using a water aspirator for 20 min, 0.1 mL of 10% ammonium persulfate (w/v in H20), 0.1 mL 10% SDS (w/v in H20), and 0.005 mL of N, N, N’, N’- tetramethylethylenediamine (TEMED) was added. After mixing gently, the separating gel was poured into the gel cassette to about 1.5 cm below the top of the gel cassette. t- Amyl alcohol was overlaid on the top of the solution and the gel was allowed to polymerize for 1 h at rt. The stacking gel was prepared by mixing 1.7 mL of 30% acrylamide stock solution, 2.5 mL of 0.5 M Tris-HCl (pH 6.8), and 5.55 mL of distilled deionized water. After degassing for 20 min, 0.1 mL of 10% ammonium persulfate, 0.1 158 mL 10% SDS, and 0.01 mL of TEMED was added, and the solution was mixed gently. t- Amyl alcohol was removed from the top of the gel cassette, which was subsequently rinsed with water and wiped dry. After insertion of the comb, the gel cassette was filled with stacking gel solution, and the stacking gel was allowed to polymerize for l h at rt. After removal of the comb, the gel cassette was installed into the electrophoresis apparatus. The electrode chamber was then filled with electrophoresis buffer containing 192 mM glycine, 25 mM Tris base, and 0.1% SDS. Each protein sample (10 uL) was diluted with Laemmli sample buffer”5 (10 uL, Sigma S-3401) consisting of 4% SDS, 20% glycerol, 10% 2-mercaptoethanol, 0.004% bromophenol blue, and 125 mM Tris- HCl (pH 6.8). Samples and markers (MW—SDS-200, Sigma) were loaded into the sample well and the gel was run under constant current at 30 mA when the blue tracking dye (bromophenol blue) was within stacking gel. After the blue tracking dye reached the separating gel, a higher current (50 mA) was applied to the gel. At the completion of electrophoresis (blue tracking dye reaches the bottom of the gel), the gels were removed from the cassettes and fixed in a solution of 10% (w/v) aqueous trichloroacetic acid for 30 min. After staining in a solution containing 0.1% (w/v) Coomassie Brilliant Blue R, 45% (v/v) MeOH, 10% (v/v) HOAc in H20 for 3 h, the protein gels were destained in a solution of 45% (v/v) MeOH, 10% (v/v) HOAc in H20. The gels were then sealed in a sheet protector. 159 CHAPTER TWO Synthetic preparations Synthesis of [3-2H]-glucose 1,2:5,6-Di-O-isopropylidene-a-D-glucofuranose. To a solution of D-glucose (20 g, 111 mmol) in dry acetone (200 mL) was added ZnCl2 (16 g, 117 mmol) and 85% H3PO4 (0.6 mL). The reaction was stirred at r.t. for 40 h. The reaction mixture then filtered through Celite and the filtrate was adjusted to pH 7.0 with NaOH. The solvent was removed by rotary evaporation and the residue was extracted with in CHZCI2 (3 x 50 mL). The organic layer was washed with H20 (2 x 50 mL) and the organic layer was dried over NaZSO4. The solution was filtered and the CHZCI2 was removed by rotary evaporation to provide a white solid. The solid was recrystallized from EtOAc and hexanes to afford 1,2:5,6—Di-0—isopropylidene-a—D-glucofuranose (17.3 g, 60%). 1H NMR (CDCI3): 6 5.90 (d, J = 3.5 Hz, 1 H), 4.49 (d, J = 3.5 Hz, 1 H), 4.29 (m, 2 H), 4.13 (dd, J = 8.5, 6 Hz, 1 H), 4.03 (dd, J = 8, 3 Hz, 1 H), 3.95 (dd, J = 8.5, 5 Hz, 1 H), 2.57(d, J = 4 Hz, 1 H), 1.46 (s, 3 H), 1.41 (s, 3 H), 1.34 (s, 3 H), 1.29 (s, 3 H). 13C NMR (CDCl3): 6 111.9, 109.7, 105.3, 85.1, 81.2, 75.3, 73.5 67.7, 26.9, 26.8, 26.2, 25.2. 1,2:5,6-Di-O-isopropylidene-3-keto-a-D-glucofuranose. Acetic anhydride (23 mL, 209 mmol) was added to pyridinium dichromate (28 g, 74.4 mmol) in dry CHZCI2 (200 mL). l,2:5,6-Di-0-isopropylidene-a-D-glucofuranose (19 g, 72.9 mmol) in 50 mL of CH2C12 was added via canula to the reaction and the mixture was heated in an oil bath at 75°C for 6 h. After the completion of the reaction, the mixture was diluted with EtOAc (500 mL) and the precipitate was filtered. After evaporation of the solvent, 160 diethyl ether was added (250 mL) and the mixture was filtered again. Drying and concentration gave a yellow oil. Purification by flash chromatography (EtOAc/hexane, 1: 1, v/v) afforded the ketone as a colorless oil (14.7 g, 91%). 1H NMR (CDC13): 6 6.14 (d, J = 4.5 Hz, 1 H), 4.39 (d, J = 4.5 Hz, 1 H), 4.35—4.38 (m, 2 H), 4.01-4.03 (m, 2 H), 1.46 (s, 3 H), 1.43 (s, 3 H), 1.34 (s, 6 H). 13C NMR (CDCI3): 6 208.8, 114.3, 110.4, 103.1, 79.0, 77.3, 76.4, 64.3, 27.6, 27.2, 26.0, 25.3. l,2:5,6-Di-0-isopropylidene-[3-2H]-a-D-allofuranose. The 1,2:5,6-di—0- isopropylidene-3-keto-a-D-glucofuranose (5.0 g, 19.4 mmol) was dissolved in 31 mL of 90% EtOH. NaBD4 (2.0 g, 50 mmol) was added and the mixture was stirred at r.t. for 1 h. After destroying unreacted borohydride by addition of an excess of NH4CI, the mixture was extracted with CHZCI2 (3 x 25 mL). The extracts were combined and washed with water (2 x 10 mL). Drying and concentration gave a yellow oil. Purification by flash chromatography (EtOAc/hexane, 1:2, v/v) afforded the 1,2:5,6-di-0- isopropylidene-[3-2H]-a-D-allofuranose as a white solid (3.0 g, 60%). IH NMR (CDC13): 6 5.82 (d, J = 4 Hz, 1 H), 4.61 (dd, J = 5, 4 Hz, 1 H), 4.3 (m, 1 H), 4.00410 (m, 3 H), 3.82 (dd, J = 6.5, 5 Hz, 1 H), 2.56 (d, J = 8 Hz, 1 H), 1.58 (s, 3 H), 1.47 (s, 3 H), 1.39 (s, 3 H), 1.37 (s, 3 H). 13C NMR (CDCl3): 6 112.9, 109.9, 104.0, 79.9, 79.0, 75.7, 72.6, 66.0, 26.6, 26.5, 26.3, 25.3. 1,2:5,6-Di-0-isopropylidene-[3-2H]-a-D-glucofuranose. DIAD (0.26 g, 1.3 mmol) in 4 mL benzene was added via cannula to a solution of 1,2:5,6-di-0- isopropylidene-[3-2H]-a-D-allofuranose (0.30 g, 1.1 mmol) and PPh3 (0.33 g, 1.3 mmol) 161 in 8 mL of benzene under argon. After the reaction was stirred for 2 min, benzoic acid (0.15 g, 1.3 mmol) in 4 mL of benzene was added. The reaction was stirred overnight at r.t.. The solvent was removed by rotary evaporation and the product was passed through a flash column (1:2 EtOAc/Hex). The fractions containing the desired product were combined and the solvent was removed. The residue was resuspended in 5 mL 1% NaOH/MeOH and stirred at r.t. for 1 h. Water (10 mL) was added to the solution and the aqueous layer was extracted with EtOAc (3 x 5 mL). The organic layer was dried with NaZSO4 and the solvent was removed by rotary evaporation. The residue was purified by flash chromatography (1:2 EtOAc/Hex) to yield 1,2:5,6-di-0-isopropylidene-[3-2H]—a-D- glucofuranose (0.13 g, 44%). [3-2H]-D-glucose. 1,2:5,6-Di-0-isopropylidene-[3-2H]-a-D-glucofuranose (0.14 g, 0.52 mmol) was treated with 2 N HCl (10 mL) for 20 min at r.t. The solvent was removed by hi-vacuum rotary evaporation to yield [3-2H]-glucose (0.13 g, 100%). IH NMR (D20): 6 5.23 (d, 10.7 Hz, 0.4 H), 4.64 (d, 8.8 Hz, 0.6H), 3.81 (m, 70 Hz, 5 H), 3.46 (m, 47.6 Hz, 4 H), 3.24 (d, 7.9 Hz, 1 H). 13C NMR: 6 97.0, 93.2, 77.0, 76.9, 75.3, 73.9, 72.6, 70.8, 61.9, 61.8. Uridine 5’-diphospho-[3-2H]-D-glucose A 60 mL solution of 100mM triethanolamine buffer (pH 8.0) was degassed with argon over 30 min. [3-2H]—glucose (0.02 g, 0.11 mmol), UTP (0.06 g, 0.11 mmol), PEP (0.025 g, 0.12 mmol), glucose 1,6-bisphosphate (0.001 g, 0.002 mmol), MgC12-6HZO (0.049 g, 0.24 mmol), B-mercaptoethanol (0.042 mL), hexokinase (100 Units), pyruvate 162 kinase (200 units), phosphoglucomutase (100 Units), UDP—glucose pyrophosphorylase (200 Units), and inorganic pyrophosphatase (200 Units) were added to the buffer. The reaction was gently stirred at room temperature until UTP could no longer be detected by TLC. Additional [3-2Hl-glucose (0.02 g), UTP (0.06 g), and PEP (0.025 g) were added to the reaction. The reaction was allowed to stir at room temperature overnight. The reaction solution was absorbed onto a Dowex 1-X200 (HCO3‘ form) column (50 mL) and the column was washed with 100 mL d.d. H20. The UDP—[3-2Hl-glucose was eluted with a linear gradient (250 mL x 250 mL) 0-1 M NaHCO3, followed by an additional 150 mL of 1 M NaHCO3. Fractions containing UDP-[3-2H]-glucose were pooled and treated with Dowex 50 (HI form) at 4 °C until bubbling ceased. Upon removal of the resin, the supernatant was concentrated, adjusted to pH 7, and lyophilized to yield 110 mg of UDP- [3-2H]-glucose in 89% yield. 1H NMR (D20): 6 7.596 (d, J = 8.1 Hz, 1H, H-S”), 6 5.99 (d, 1H, H-l’), 6 5.95 (d, 1H, H-6”), 6 5.61 (dd, J = 7.1, 3.5 Hz, 1H, H-l), 6 4.38 (m, 2H, H-2’,3’), 6 4.29 (m, 1H, H-4’), 6 4.23 (m, 2H, H-S’), 6 3.91 (ddd, J = 14, 4.3, 2.3 Hz, 1H, H-S), 6 3.87 (dd, J = 12, 2.4 Hz, 1H, H-6), 6 3.79 (dd, J = 12, 4.6 Hz, 1H, H-6), 6 3.54 (dd, J = 6.4, 3.4 Hz, 1H, H-4), 6 3.47 (d, J = 10 Hz, 1H, H-2). 13C NMR: 6 169.1, 154.7, 144.5, 105.5, 98.4 (d, J = 6.2 Hz), 91.3, 86.1 (d, J = 9.2), 76.6, 75.7, 74.4, 74.3, 72.5, 71.9, 67.8 (d, J = 5.7 Hz), 63.2. HRMS (ES) calcd for CISHZZDNZOWP2 (M-H): 566.0535. Found: 566.0544. 163 Genetic manipulations Plasmid pHS3.244. The galU locus was amplified by PCR from E. coli W3110 genomic DNA using the following primers containing BamHI terminal recognition sequences: 5’- CGGGATCCATGGCTGCCATTAATACGAAA and 5’- CGGGATCCT TACT TCT TAATGCCCATCT C. The amplified 0.9 kb PCR fragment was digested with BamHI and ligated into the BamHI site of pJG7.246 (T5, lacO, lacO, 6xhz's, lan, Amp') to create plasmid pHS3.244 (T5, lacO, lacO, 6xhis, galU, lacIQ, Amp’) in which the galU gene is oriented in the same directions as the T5 promoter. Enzyme purifications Overexpressed E. coli galU-encoded UGPase. The plasmid pHS3.244 was transformed into DHSa competent cells. DHSa/pHS3.244 was grown on LB/Ap agar 8-10 h at 37°C. A single colony was then used to inoculate 5 mL LB/Ap medium and the culture was incubated at 37°C overnight in a shaker. The 5 mL culture was then used to inoculate 100 mL LB/Ap. The culture was incubated at 37°C in a shaker at 250 rpm for 45 min until the OD600 was 0.7 at which time IPTG was added to 1 mM. The culture was incubated an additional 5 h at 37°C and 250 rpm. The cells were harvested by centrifugation (4800 g, 4°C, 5 min) and the supernatant was poured away. The cells were resuspended in 3 mL binding buffer (20 mM Tris-HCl (pH 8.0) containg 5 mM imidazole and 500 mM NaCl). The cells were lysed by two passes through a french pressure cell, and the cellular debris was removed by centrifugation 164 (48000 g, 4°C, 20 min). NiZI-NTA resin (1 mL) was added to the supernatant, and the mixture was stirred at 4°C for 1 h. The supernatant was then eluted from the resin. The resin was washed with 3 mL binding buffer, followed by 6 mL of washing buffer (20 mM Tris-HCl (pH 8.0) containing 20 mM imidazole and 500 mM NaCl). The GalU protein was then eluted with 3 mL of eluting buffer (20 mM Tris-HCI (pH 8.0) containing 100 mM imidazole and 500 mM NaCl). The resulting solution was dialyzed against 20 mM Tris-HCl (1 L) to remove imidazole and assayed. The presence of GalU was confirmed by SDS-PAGE analysis (MW 38,000 kDa). The final protein concentration was 1.1 mg/mL with a specific activity of 57 U/mg. A. tumefaciens glucoside 3-dehydrogenase. A. tumefaciens was grown on MP agar at 28°C for 24 h. A single colony was used to inoculate 5 mL AB/sucrose medium and incubated at 30°C at 250 rpm overnight (12 h). A portion (2 mL) of the overnight culture was used to inoculate 100 mL AB/sucrose. The 100 mL culture was incubated at 28°C and 250 rpm for 10 h. The 100 mL culture was then used to inoculate 1 L AB/sucrose, which was incubated at 28°C and 250 rpm until OD600 of 2.5. The cells were harvested by centrifugation (4800 g, 4°C, 10 min) and the supernatant was poured away. The cells were washed with 0.05 M phosphate buffer (pH 7.0) and resuspended in of the same buffer (1 mL per gram cells). The cells were lysed by two passes through a french pressure cell. The cellular debris was removed by centrifugation (48,000 g, 4°C, 20 min). 165 The supernatant was retained, and powdered NH4SO4 was added slowly at 4°C over 30 min to 50% saturation. The precipitate as removed by centrifugation (48,000 g, 4°C, 50 min). The supernatant was retained, and powdered NH4SO4 was added slowly at 4°C over 30 min to 85% saturation. The suspension was allowed to stir at 4°C for 6 h before the precipitate was removed by centrifugation (48,000 g, 4°C, 50 min). The supernatant was poured away, and the precipitate was resuspended in 0.05 M phosphate buffer (pH 7) containing 0.01 M sucrose (13 mL). The solution then was dialyzed against 2 L 0.005 M phosphate buffer (pH 7.0) containing 0.01 M sucrose over a period of 2 days. The protein solution was then applied to a column of DEAE cellulose resin (10 mL) pre-equilibrated with 0.005 M phosphate buffer (pH 7.0) containing 0.01 M sucrose. The protein was then eluted with a linear gradient (200 mL x 200 mL) from Buffer l (0.01 M phosphate (pH 7.0) containing 0.01 M sucrose) to Buffer l (0.01 M phosphate (pH 7 .0) containing 0.01 M sucrose and 0.15 M KCI). The column was then eluted with and additional 250 mL Buffer 2. Fractions (5 mL) were collected and assayed for G3DH activity. The fractions displaying G3DH activity were pooled and concentrated to 7 mL using an Amicon ultrafiltration apparatus (300 mL). The protein solution was then dialyzed at 4°C against 0.005 M phosphate buffer (pH 7.0) containing 0.01 M sucrose (4 L total). The protein solution was concentrated finally to 3 mL. The presence of G3DH was verified by SDS-PAGE analysis (MW 85,000 kDa). The final protein concentration was 1.5 mg/mL and the specific activity was 0.75 U/mg. 166 Recombinant RifK BL21 Codon Plus RP/pJG7 .259 The plasmid pJG7.259 was transformed into BL21 Codon Plus RP competent cells and grown on LB/Ap/Cm agar at 37°C overnight (12 h). A single colony was used to inoculate 5 mL of LB/Ap/Cm media, and the culture was incubated at 37°C and 250 rpm overnight (12 h). An aliquot (2 mL) of the overnight culture was used to inoculate 2 L LB/Ap/Cm. The culture was incubated at 30°C and 250 rpm until the OD600 reached 0.6. IPTG was added to 1 mM and the culture was incubated overnight (13 h) at 30°C and 250 rpm. The cells were harvested by centrifugation (4800 g, 4°C, 10 min). The supernatant was poured away and the cells were resuspended in 30 mL binding buffer (20 mM Tris-HCI (pH 8.0), containing 10 mM imidazole and 300 mM NaCl. The cells were lysed by two passes through a french pressure cell, and the cellular debris was removed by centrifugation (48,000 g, 4°C, 20 min). NiZI-NTA resin (5 mL) was added to the supernatant (50 mL), and the mixture was stirred at 4°C for 1 h. The supernatant was eluted from the resin. The resin was washed with six column volumes binding buffer followed by eight column volumes of washing buffer (20 mM Tris-HCI (pH 8.0) containing 20 mM imidazole and 300 mM NaCl). The protein was eluted from the resin with two column volume of eluting buffer (20 mM Tris-HCI (pH 8.0) containing 100 mM imidazole and 300 mM NaCl). The resulting protein solution was dialyzed against 1 L dialysis buffer (50 mM triethanolamine buffer (pH 7.5) containing 10% (w/v) glycerol) by repeated dilution and concentration using an Amicon ultrafiltrator (300 mL). The protein solution was concentrated to a final volume of 17 mL. The presence of RifK was 167 confirmed by SDS-PAGE analysis (MW 44,000 kDa). The final protein concentration was 13mg/mL. JM109/pJG7.259 The plasmid pJG7.259 was transformed JM109 competent cells and grown on LB/Ap agar at 37 °C overnight (12 h). A single colony was used to inoculate 5 mL of LB/Ap, and the culture was incubated at 37°C and 250 rpm overnight (12 h). An aliquot (2 mL) of the overnight culture was used to inoculate 2 L LB/Ap/Cm. The culture was incubated at 28°C and 250 rpm until the OD600 reached 0.6. IPTG was added to 1 mM and the culture was incubated overnight (20 h) at 30°C and 250 rpm. The cells were harvested by centrifugation (4800 g, 4°C, 10 min). The supernatant was poured away and the cells were resuspended in 5 mL binding buffer (20 mM Tris-HCI (pH 7.0), containing 10 mM imidazole and 500 mM KCI). The cells were lysed by two passes through a french pressure cell, and the cellular debris was removed by centrifugation (48,000 g, 4°C, 20 min). NiZI-NTA resin (1.5 mL) was added to the supernatant, and the mixture was stirred at 4°C for 1 h. The supernatant was eluted from the resin. The resin was washed with six column volumes of binding buffer followed by twelve column volumes washing buffer (20 mM Tris-HCI (pH 7.0) containing 60 mM imidazole and 500 mM KCI). The protein was eluted from the resin with six column volumes of eluting buffer (20 mM Tris-HCI (pH 7.0) containing 130 mM imidazole and 500 mM KCI). The resulting protein solution was dialyzed against 1 L dialysis buffer (20 mM Tris-HCl (pH 7.5) containing 10% (w/v) glycerol) by repeated dilution and concentration using an Amicon ultrafiltrator (300 mL). The protein solution was 168 concentrated to a final volume of 17 mL. The presence of RifK was confirmed by SDS- PAGE analysis (MW 44,000 kDa). The final protein concentration was 23 mg/mL. In vivo enzymatic reactions Oxidation of glucosides to 3-ketoglucosides by A. tumefaciens Whole Cells A. tumefaciens NCPPB 396 was grown on MP agar plates at 28°C for 1 day. A single colony was used to inoculate 5 mL AB/sucrose medium. The culture was incubated at 30°C, 250 rpm overnight (~18 h). 500 mL of AB/sucrose was inoculated with the overnight culture. The culture was incubated in 2L baffled culture flask at 30°C, 250 rpm until OD600 ~2-3 (8 h). The cells were harvested by centrifugation at 6000g at 4°C for 10 min. The supernatant was carefully poured away and the cells were resuspended gently in 20 mL 5 mM Tris HCl (pH 8.2). The desired glucoside (1.0 g) was added and the suspension shaken at 30°C until the glucoside was no longer detected by 1H NMR. The cells were removed by centrifugation (48000g, 4°C, 10 min). When 3- ketoglucose l-phosphate and 3-ketoUDPG were used as substrates, the supernatant was absorbed onto a 10 mL Dowex 50 (HI form) column and the column was washed with 20 column volumes of d.d. H20. The resulting solution was degassed, adjusted to pH 4 with NaOH and lyophilized to yield the desired 3-ketoglucoside. 3-keto-UDPG was isolated as a yellow solid (0.40 g, 40% yield). 1H NMR (D20): 6 7.95 (d, J: 8.2 Hz, 1H, H-6”), 6 6.0 (d, J = 4.6 Hz, 1H, H-l’), 6 5.98 (d, J = 8.2 Hz, 1H, H-S”), 6 5.96 (dd, J = 7.3, 4.2 Hz, 1H, H-l), 6 4.64 (m, 1H, H-2), 6 4.49 (dd, J = 10, 1.5 Hz, 1H, H-4), 6 4.38 (m, 2H, H—2’, 3’), 6 4.29 (m, 1H, H-4’), 6 4.21 (m, 2H, H-S’), 6 4.1 169 (ddd, J = 10, 3.8, 2 Hz, 1H, H-S), 6 3.97 (dd, J = 13, 2.1 Hz, 1H, H-6), 6 3.88 (dd, J = 13, 3.7 Hz, 1H, H6). 13C NMR (D20): 6 210.0, 169.1, 154.7, 144.5, 105.6, 100.8 (d, J = 6.3 Hz), 91.3, 86.1 (d, J = 8.9 Hz), 78.7, 77.3 (d, J = 8.2 Hz), 76.6, 74.4, 72.5, 67.9 (d, J = 5.4 Hz), 63.2. HRMS (ES) calcd for CISHZINZOWP2 (M-H“): 563.0315. Found 563.0306. 3-ketoglucose 1-phosphate was isolated as a yellow solid (0.36 g, 36%). 1H NMR (D20): Cell-free lysate preparations Cell-free lysate of A. medierranei. A. mediterranei was first grown2521 on a YMG plate at 28°C for 4 days. This plate culture of A. mediterranei was then used to inoculate vegetative medium. A 50 mL vegetative culture was grown in a 500 mL flask with baffles for two days at 28°C and 250 rpm and then a portion of this vegetative culture (5 mL) was used to inoculate 50 mL of production medium in 500 mL flask with baffles. The synthesis of rifamycin B was checked by spectrophotometry”6 after 4 days of incubation at 28°C and 280 rpm. The culture that showed the highest synthesis of rifamycin B was used to inoculate 500 mL YMG medium. After 3 days of incubation at 28°C and 300 rpm, the mycelia were harvested by centrifugation (8600g, 4°C, 5 min). After washing the mycelia with 50 mM Tris-HCl buffer (pH 7.5), the cells were harvested by centrifugation (11000g, 4°C, 5 min). The mycelia were resuspended in Tris-HCl buffer (pH 7.5) (5 mL/g of wet cells) containing 1 mM PMSF and glycerol (20% (w/v)). Cells were then disrupted by two passages through a French press (16000 psi). The cell debris was removed by centrifugation (48000g, 4 °C, 25 min) and the supernatant was used directly in most of 170 the cell-free reactions. Dialysis were carried out after centrifugation. Dialysis was performed using a Millipore PM-10 membrane and an Aminco stirred cell (300 mL). The cell lysate (about 30 mL) was first diluted to 300 mL followed by concentration (to about 25 mL). More buffer (225 mL) was added to the concentrator. The sample was concentrated to 25 mL again and the process was repeated until the concentration of the micro solute was sufficiently reduced. Typically, 3 to 6 cycles were performed to remove most of initial salt content. Finally, the lysate was concentrated to about 30 mL. Cell-free lysate of A. mediterranei RM01 and HGF003. Same procedure as described for A. mediterranei. Cell-free lysate of B. pumilus B. pumilus was first grow on a nutrient agar plate at 37 °C for 18-24 h. A single colony from the plate was used to inoculate SSNG medium. A 100 mL culture was grown in a 500 mL flask with baffles for 1.5 to 2 days at 30°C and 250 rpm. The whole 100 mL culture was then transferred to a 4 L flask with baffles containing 1 L of the same medium. After 2 days of incubation at 30°C and 250 rpm, cells were collected by first passing through four layers of cheesecloth followed by centrifugation (6400g, 4°C, 10 min) of the filtrate. After washing the cells with 50 mM Tris-HCl buffer (pH 7.5), the cells were harvested by centrifugation (6400g, 4°C, 10 min). The cells were resuspended in 2 mL of 50 mM phosphate buffer (pH 7.0) per 1 g of wet cells and were disrupted by two passages through a French press (16000 psi). The cell debris was removed by centrifugation (48000g, 4°C, 25 min). 171 J M109/pJG7.275 and JM109/pJG7.259a Cell-free Lysate. JM109 competent cells were transformed with either pJG7.275 or pJG7.259, and incubated overnight on LB/Ap agar at 37°C. LB/Ap (5 mL) was inoculated with a single colony of the strain of interest. The culture was incubated at 37°C overnight (12 h). Inoculated 1 L LB/Ap with 1.0 mL overnight culture and incubated at 28°C until the OD,>00 reached 0.6. Added IPTG to 0.1 mM and incubated an additional 20 h. The cells were harvested by centrifugation (6400g, 4°C, 10 min) and resuspended in 10 mL buffer (50 mM Tris HCl, 20% glycerol, pH 7.0). The cells were lysed by two passes through a french pressure cell and the cellular debris was removed by centrifugation (48,000g, 4°C, 20 min). The cell-free lysate was used immediately for cell-free experiments. BL21(DE3)/pRM030 cell-free lysate BL21(DE3) competent cells were transformed with pRM030, and incubated overnight at 37°C on LB/Ap agar plates. A single colony was used to inoculate 5 mL LB/Ap. The culture was incubated at 37°C overnight (12 h). Inoculated 1 L LB/Ap with 1.0 mL overnight culture and incubated at 28°C until the OD600 reached 0.6. Added IPT G to 0.1 mM and incubated an additional 20 h. The cells were harvested by centrifugation (6400g, 4°C, 10 min) and resuspended in 10 mL buffer (50 mM Tris HCl, 20% glycerol, pH 7.0). The cells were lysed by two passes through a french pressure cell and the cellular debris was removed by centrifugation (48,000g, 4°C, 20 min). The cell-free lysate was used immediately for cell-free experiments. 172 Preparation of BL21 Codon Plus RP/pJG7.275 Cell-free Lysate (RifL) Inoculated 5 mL LB/Ap/Cm with a single colony of BL21 Codon Plus RP/pJG7.275. Incubated at 37°C overnight until turbid. Inoculated 1 L LB/Ap/Cm with the overnight culture and incubated at 28°C until the OD600 reached 0.6. IPT G was added to 0.1 mM, and the culture was incubated at 28°C for an additional 20 h. The cells were harvested by centrifugation (6400g, 4°C, 10 min), resuspended in 20 mL buffer (50 mM Tris-HCl, 20% glycerol, pH 7). The cells were lysed and the cellular debris was removed by centrifugation (48,000g, 4°C, 20 min). The supernatant was used directly for the cell- free experiments. Preparation of BL21 Codon Plus RP/pJG7.259 cell-free lysate (RifK) Inoculated 5 mL YT/Ap/Cm with a single colony of BL21 Codon Plus RP/pJG7.259. Incubated at 37°C overnight. Inoculated 1 L YT/Ap/Cm with 1 mL of the overnight culture. Incubated at 28°C until the OD600 reached 1.0. Added IPT G to 0.1 mM and incubated overnight (14 h). The cells were harvested by centrifugation (6400g, 4°C, 10 min) and rinsed with 100 mL cold 0.9% NaCl solution. The cells pellet was resuspended in 50 mL buffer (50 mM triethanolamine, 1 mM PMSF, 10 % glycerol, pH 7.5) and lysed. The cellular debris was removed by centrifugation (48,000g, 4°C, 20 min) and the supernatant was used directly for the cell-free experiments. 173 In vitro enzymatic reactions Kanosamine Biosynthesis from UDPG UDP-D-glucose (54 mg, 0.096 mmol), L—glutamine (14 mg, 0.096 mmol), and [3- NAD (132 mg, 0.192 mmol) were incubated in 10 mL of A. mediterranei, A. mediterranei RM01, A. mediterranei HGF003, or B. pumilus cell—free lysate at 28°C for 6 h. When required diaphorase (100 U), methylene blue (45 mg, 0.12 mmol), glutamate dehydrogenase (112 U), a-ketoglutarate (28 mg, 0.198 mmol), and NH4OH (2 drops) were added. Protein was subsequently removed by ultrafiltration and the protein-free solution was applied to Dowex 50 (HI) strong cation exchange resin (10 mL). The column was washed with water (75 mL) and eluted with a linear gradient (120 mL + 120 mL, 0-1 M) of HCI. Organic phosphate and ninhydrin assays were used to identify fractions. The products were quantified by 1H NMR. 1HNMR (D20): 6 5.27 (d, J = 3.5 Hz, 0.4 H), 6 4.72 (d, J = 8 Hz, 0.6 H), 6 3.89 (m, 1H), 6 3.74—3.87 (m, 2H), 6 3.67 (ddd, J = 10, 10 Hz, 0.5H), 6 3.57 (ddd, J = 7.5, 5.5, 2, 0.5H), 6 3.45 (dd, J = 10, 8 Hz, 0.5H), 6 3.41 (dd, J = 10, 10 Hz, 0.5H), ), 6 3.25 (dd, J = 10, 10 Hz, 0.5H). 13C NMR (D20): 6 99.0, 94.1, 79.9, 74.3, 73.4, 71.0, 68.9, 68.8, 63.2, 63.0, 58.1. HSMS (FAB) calcd for C,H,,N0,(M+H+): 180.0872. Found: 180.0868. Kanosamine biosynthesis from 3-ketoUDPG 3-ketoUDPG (54 mg, 0.096 mmol), B-NADH (142 mg, 0.192 mmol), and L- glutamine (14 mg, 0.096 mmol) were incubated with A. mediterranei, A. mediterranei RM01, A. mediterranei HGF003, or B. pumilus cell-free lysate (10 mL) containing 50 mM Tris-HCl, 1 mM DTT, 1 mM PMSF, and 20% w/v glycerol for 6 hr at 30°C. The 174 proteins were removed by ultrafiltration and the filtrate concentrated to 2 mL. To the resulting syrup was added 40 mL 100% EtOH, and the precipitate was collected by centrifugation (20000g, 4°C, 30 min). The pellet was rinsed twice with EtOH and dissolved in water. The solution was applied to a Dowex 50 (H+ form) column (30 mL, 2.5 cm x 6 cm). The column was eluted with dd H20 (60 mL) followed by 1 N HCl (60 mL). Kanosamine was produced was confirmed by IH NMR and HRMS. Yields were calculated by from 1H NMR integration in comparison with the TSP standard and response factors generated from known compounds. Kanosamine biosynthesis from [3-2H]-UDPG [3-2HJ-UDPG (48 mg, 0.085 mmol), L-glutamine (14 mg, 0.0.096 mmol), and [3- NAD (0.132 mg, 0.192 mmol) were incubated in 10 mL of A. mediterranei or B. pumilus cell-free lysate at 28°C for 6 h. Protein was subsequently removed by ultrafiltration and the protein-free solution was applied to Dowex 50 (HI) strong cation exchange resin (10 mL). The column was washed with water (75 mL) and eluted with a linear gradient (120 mL + 120 mL, 0-1 M) of HCl. Organic phosphate and ninhydrin assays were used to identify fractions. The products were quantified by 1H NMR. 3-2HJ-Kanosamine. 1H NMR (D20): 6 5.27 (d, J = 3.5 Hz, 0.5 H), 6 4.71 (d, J = 10 Hz, 1H), 6 3.90 (m, 1H), 6 3.74-3.87 (m, 2H), 6 3.67 (dd, J = 8.1, 1.8 Hz, 1H), 6 3.57 (ddd, J = 9.8, 5.7, 2.1, 0.5H), 6 3.43 (d, J = 7.7 Hz, 0.5H). HRMS: calcd for C,,H,2DNO5 (M+H+): 181.0935. Found:181.0868. 175 Kanosamine biosynthesis from UDPG in the presence of NAD and NADH [3-2Hl—UDPG (48 mg, 0.085 mmol), L—glutamine (14 mg, 0.0.096 mmol), B-NAD (70 mg, 0.10 mmol), and B-NADH (70 mg, 0.098 mmol) were incubated in 10 mL of A. mediterranei or B. pumilus cell-free lysate at 28°C for 6 h. Protein was subsequently removed by ultrafiltration and the protein-free solution was applied to Dowex 50 (HI) strong cation exchange resin (10 mL). The column was washed with water (75 mL) and eluted with a linear gradient (120 mL + 120 mL, 0-1 M) of HCl. Organic phosphate and ninhydrin assays were used to identify fractions. The products were quantified by 1H NMR. Oxidation of UDPG to 3-ketoUDPG by heterologously expressed RifL NAD cofactor UDP-glucose (54 mg, 0.089 mmol) was incubated with B-NAD (136 mg, 0.198 mmol), MgClz°6HzO (0.012 g, 0.064 mmol), and 10 mL of JM109/pJG7.275 or BL21 Codon Plus RP/pJG7.275 cell-free lysate at 30 °C for 6 h. The protein was removed by ultrafiltration and the filtrate was concentrated to 2 mL. EtOH (40 mL) was added and the precipitate was collected by centrifugation (48000g, 4°C, 20 min). The pellet was rinsed with EtOH and dried. The sample analyzed by 1H NMR. DCIP/PMS cofactor UDP-glucose (0.054 g, 0.089 mmol) was incubated with DCIP (0.003 g, 0.009 mmol), PMS (0.038 g, 0.124 mmol), MgClz-6HZO (0.012 g, 0.064 mmol), and 10 mL of cell-free lysate (JM109/pJG7.275, BL21(DE3)/pJG7.275, or BL21 Codon Plus 176 RP/pJG7 .275) at 30 °C for 5 h. The protein was removed by ultrafiltration and the filtrate was concentrated to 2 mL. EtOH (40 mL) was added and the precipitate was collected by centrifugation (48000g, 4°C, 20 min). The pellet was rinsed with EtOH and dried. The sample analyzed by 1H NMR and HPLC in comparison to UDP-3-keto-glucose produced by A. tumefaciens. UDPG from 3-ketoUDPG by heterologously expressed RifL UDP-glucose (25 mg, 0.041 mmol) was incubated with B-NADH (68 mg, 0.095 mmol), MgC12-6HZO (0.012 g, 0.064 mmol), and 10 mL of cell-free lysate (JM109/pJG7.275, BL21(DE3)/pJG7.275, or BL21 Codon Plus RP/pJG7.275) at 28 °C for 6 h. The protein was removed by ultrafiltration and the filtrate was concentrated to 2 mL. EtOH (40 mL) was added and the precipitate was collected by centrifugation (48000g, 4°C, 20 min). The pellet was rinsed with EtOH and dried. The sample analyzed by 1H NMR. UDPK from 3-ketoUDPG. Heterologously expressed RifK andRifL 3-ketoUDPG (0.03 g, 0.053 mmol) was incubated with 5 mL cell-free lysate (BL21 Codon Plus RP/pJG7.259 or JM109/pJG7.259) or RifK solution and 5 mL cell- free Iysate (J M109/pJG7.275, BL21(DE3)/pJG7.275, or BL21 Codon Plus RP/pJG7.275) containing 0.4 mM MgC12-6HZO at 28°C. Varying combinations of B-NADH (0.035 g, 0.049 mmol), PLP (0.005 g, 0.020 mmol), L-glutamine (0.008 g, 0.054 mmol) or L- glutamic acid (0.008 g, 0.0054 mmol) were added as needed. After 6 h the protein was 177 removed and the supernatant concentrated to 2 mL. The solution was diluted with EtOH (100%) and the precipitate was collected by centrifugation. The pellet was rinsed with EtOH, dried, and analyzed by 1H NMR and HPLC in comparison to synthesized UDP- kanosamine. In the cases where [amine-ISN] and [amine-ISN]-glutamine were used the samples were analyzed additionally by HRMS and compared to a sample prepared with non-labeled glutamine. Heterologously expressed RifK 3-ketoUDPG (0.03 g, 0.053 mmol) was incubated with 10 mL cell-free lysate (BL21 Codon Plus RP/pJG7.259 or JM109/pJG7.259) or 10 mL diluted RifK solution containing 0.4 mM MgClz-6H20 at 28°C. Varying combinations of B-NADH (0.035 g, 0.049 mmol), PLP (0.005 g, 0.020 mmol), L-glutamine (0.008 g, 0.054 mmol) or L- glutamic acid (0.008 g, 0.0054 mmol) were added as needed. After 6 h the protein was removed and the supernatant concentrated to 2 mL. The solution was diluted with EtOH (100%) and the precipitate was collected by centrifugation. The pellet was rinsed with EtOH, dried, and analyzed by IH NMR and HPLC in comparison to synthesized UDP- kanosamine. In the cases where [amine-ISN] and [amine-ISN]-glutamine were used the samples were analyzed additionally by HRMS and compared to a sample prepared with non-labeled glutamine. 178 Chromatography HPLC paired-ion chromatography Analysis of UDP-glucosides The UDP-glucosides were effectively separately by paired-ion chromatography on a Zorbax Bonus RP (amide C—14) analytical column. The respective UDP-glucosides were eluted using a linear gradient from 97.5% eluant A to 70% eluant A over 15 min. Eluant A was an aqueous solution containing 50 mM KHZPO4 and 2.5 mM TBAHS at pH 6.9. Eluant B contained 50 mM KH2P04 and 2.5 mM TBAHS at pH 6.9 in a 1:1 solution of HzO/CH3CN. The UDP-glucosides were detected by UV light at 254 nm and their concentrations were calculated based on calibration curves generated from known samples. W Synthetic Preparations Synthesis of L-aspartate semialdehyde N-acetyl-DL-allyl glycine. Acetic anhydride (6.25 mL) was added in portions to a solution of DL-allyl glycine (5 g, 43.4 mmol) in 2 N NaOH (22 mL) over a time period of 1 h. 10 M NaOH (0.7 mL) was added periodically to keep the pH above 9. After 2 h of stirring at r. t., 16 mL of HCl (conc.) was added to the solution. The aqueous solution was extracted with EtOAc (6 x 50 mL). The organic layer was dried with N82304, filtered, and concentrated by rotary evaporation. The resulting solid was recrystallized from hot acetone by the addition of petroleum ether. The resulting crystals were collected by vacuum filtration and dried to yield N—acetyl-DL-allyl glycine (6.1 g, 90%). MP:106-110°C. 1H NMR (D20): 6 5.79 (m, 1H), 5.17 (m, 2H), 4.42 (dd, 1H), 2.60 (m, 179 1H), 2.51 (m, 1H), 2.02 (s, 3H), 13C NMR (D20): 6 178.3, 177.1, 135.6, 121.7, 55.6, 37.8, 24.5. N-acetyl-L-allyl glycine. N -acetyl-DL-allyl glycine (l g, 6.4 mmol) was dissolved in H20 (64 mL) and freshly prepared LiOH solution was added dropwise until the pH of the solution was 7.9. Hog kidney acylase (10 mg, 5530U) was added and the reaction was incubated in a shaker at 37°C and 250 rpm for 15 h. The pH was adjusted to 3 with glacial acetic acid and charcoak (0.5 g) was added. The solution was filtered and the solution was concentrated to 10 mL by hi-vacuum rotary evaporation. Absolute EtOH as added to the solution and the precipitate was isolated by vacuum filtration and dried to yield N-acetyl-L-allyl glycine (0.27 g, 73%). MP: >270°C. 1H NMR (D20): 6 5.77 (m, 1H), 5.28 (m, 2H), 3.81 (dd, 1H), 2.65 (m, 2H), Aspartate semialdehyde. Allyl glycine (66 mg, 0.57 mmol) was suspended in l M HCl (0.3 mL) and cooled to 0°C. Ozone was bubbled through the solution for 3 h at 0°C, then argon was used to displace the ozone. Powdered zinc was added and the reaction was allowed to warm to r.t.. After 4 h the suspension as filtered to remove the zinc, and the filtrate was concentrated on the hi-vacuum rotary evaporator. The solution was used directly for reactions. Diazomethane. A solution of Diazald (5.2 g, 24 mmol) in EtzO (50 mL) was added dropwise via an addition funnel to a refluxing suspension of KOH (24 mmol), 2’— (2-ethoxy)-ethoxy ethanol (8.4 mL), and EtzO (20 mL). The CHZNZ/EtzO solution was 180 distilled and collected into a chilled (0°C) flask until the distillate as colorless. An additional 30 mL of EtzO were added and the distillation continued until the distillate was colorless. The solution of CH2N2/EtQO was chilled on ice and used immediately. N-acetyl allyl glycine methyl ester. A freshly prepared solution of CHZN2 in Et20 was added dropwise to a stirred, chilled (0°C) solution of N—acetyl allyl glycine (1.5 g) in EtOAc (15 mL) until an yellow color persisted. Several drops of acetic acid were then added to quench any remaining CHZNZ. The solvent was removed by rotary evaporator to yield N—acetyl allyl glycine methyl ester (1.6 g, quant.) 1H NMR (CDCI3): 6.06 (d, 1H), 5.64 (m, 1H), 5.10 (m, 2H), 5.67 (m, 1H), 3.72 (s, 3H), 2.52 (m, 2H), 1.99 (s, 3H). 13C NMR (CDCI3): 172.0, 169.5, 132.4, 119.2, 52.2, 51.4, 36.3, 22.9. N-acetyl aspartate semialdehyde methyl ester. N -Acetyl allyl glycine methyl ester (0.33 g, 1.9 mmol) was dissolved in 50 mL 4:1 CH2C12/MeOH and chilled to —78°C. Ozone was bubbled through the solution until a blue color persisted. Dimethyl sulfide (3.0 mL, 41 mmol) was added, and the reaction was allowed to warm to r.t.. The reaction was stirred at r.t. overnight and the solvent was removed by rotary evaporation. The product mixture was purified by flash chromatography (EtOAc). Fractions were pooled and concentrated by rotary evaporation. The colorless syrup was dried to yield a 1:5 ratio of the desired aldehyde and the dimethyl acetal of the aldehyde. 181 Preparation of DKFP Dihydroxyacetone phosphate. Dihydroxyacetone (0.9 g, 10 mmol), ATP (55 mg, 0.1 mmol), MgClz-6HZO (51 mg, 0.25 mmol), and PEP (2.06 g, 10 mmol) were dissolved in 50 mL H20. The pH was adjusted to 7.0 with 10 N NaOH and the solution was degassed with argon for 30 min. Glycerol kinase (2 mg, 180 U) and pyruvate kinase (0.] mL, 1800 U) were added and the solution was stirred under argon at r.t. for 72 h. The protein was removed by ultrafiltration and activated charcoal was added. The solution was filtered through celite to remove the charcoal. The filtrate was adjusted to pH < 4 with Dowex-50 (HI form). The resin was removed and 800 mL of EtOH was added to the solution. The precipitate was collected by centrifugation (48,000 rpm, 4°C, 20 min) and resuspended in 5 mL of H20. The solution was filtered and lyophilized overnight. NMR spectra consistent with literature reported data.117 6-Deoxy-2-ketofructose l-phosphate. Rabbit muscle aldolase (1 mL) was added to a solution of dihydroxyacetone phosphate (80 mg, 0.38 mmol) in 10 mL 50 mM Tris- HCl (pH 7.6). A 40% (w/v) solution was methyl glyoxal (0.12 mL, 0.76 mmol) was then added and the pH of the reaction solution was adjusted to 7.2 with NaOH. Throughout the reaction 0.5 M NaOH was added to maintain a pH of 6.8—7 .2. Upon completion of the reaction, the protein was removed by ultrafiltration. The solution was applied to a column of Dowex-1 anion exchange resin (10 mL) and the column was washed with H20. The product was eluted with a linear gradient (0 — 1 M) of NaHCO3 solution (pH 7.6). The solution was concentrated by rotary evaporation to yield a solution of 6-deoxy- 2-ketofructose 1-phosphate (19%). The concentration and yield were determined by 1H 182 NMR analysis of the reaction solution, and were not adjusted using a calibration curve. The solution was filtered and lyophilized overnight. NMR spectra consistent with literature reported data. I 18 Preparation of ATTH from N-Cbz-L-aspartic acid. (4S)-3-Carbobenzyloxy-S-oxo-4-oxazolidineacetic acid. Paraformaldehyde (7.3 g, 243 mmol) and pTSA (0.77 g, 4.5 mmol) were added to a suspension of N-Cbz-L- aspartic acid (10.3 g, 38.5 mmol) in 750 mL of toluene. The suspension was heated to reflux with a Dean Stark trap to remove H20. The reaction was heated at reflux for 3 h, and then cooled slightly. The cooled solution was applied to a plug of silica gel. The silica gel was washed with toluene, and the product was eluted to with Et20. The solvent was removed by rotary evaporation to yield a light yellow syrup which crystallized on standing to provide (4S)-N-carbobenzyloxy-5-oxo-4—oxazolidineacetic acid (10.6 g, 99%). 1H NMR (Acetone-d6, 50°C): 6 7.33-7.42 (m, 5H), 5.34—5.51 (br, 2 H), 5.14-5.25 (m, 2H), 4.38 (br, 1 H), 3.06-3.40 (m, 2H). HRMS calculated for C‘3H13NO6 (M-H): 278.0665. Found: 278.0669. (4S)-3-Carbobenzyloxy-4-(2-chloro-2-oxoethyl)-5-oxo-oxazolidine. Freshly distilled oxalyl chloride (2 mL, 22.4 mmol) was added to a solution of (4S)-N- carbobenzyloxy-S—oxo-4—oxazolidineacetic acid (4.3 g, 15 mmol) in 15 mL dry CHzClz. One drop of DMF was added and the reaction was stirred at r.t. until the reaction was complete (TLC). The solvent was removed by rotary evaporation to yield a red-orange syrup. The syrup was redissolved in CHZCI2 and washed with dilute NaHCO3. The 183 organic layer was dried with NazSO4 and filtered. The solvent was removed by rotary evaporation to yield (4S)-N-carbobenzyloxy-4-(2-chloro-2-oxoethyl)-5-oxo-oxazolidine (2.7 g, 60%). 1H NMR (acetone-d6, 50°C): 13C NMR (CDCI3): 6 198.2, 171.3, 152.0, 137.3, 134.9, 128.7, 128.4, 128.3, 127.96, 127.93, 124.9, 77.9, 67.5, 49.4, 43.9, 42.9, 21.0. HRMS calculated for C13H12C1NOS(M): 297.0404. Found: 297.0405. (4S)-3-Carbobenzyloxy-S-oxo-4-(2-oxo-ethyl)-oxazolidine. To a solution of oxazolidine acid chloride (2 g, 6.7 mmol) in 40 mL dry toluene under argon was added Pd/BaSO4 (5% (w/v)), 0.85 g). The solution was heated to reflux under a flow of H2. The excess szas bubbled through H20. When the reaction was complete (TLC), the H2 was replaced with argon and the reaction cooled. The suspension was filtered through celite and the solvent removed by rotary evaporation to yield the aldehyde as a syrup (1.4 g). 1H NMR (acetone-d6, 50°C): 6 9.69 (dd, 1H), 7.73 (m, 5H), 5.53 (d, 1H), 5.17 (s, 2H), 4.50 (dd, 1H), 3.38 (dd, 1H), 3.08 (dd, 1H). 13C NMR (CDCl,): 6 198.3, 171.4, 152.2, 137.5, 128.7, 128.0, 127.9, 77.9, 67.6, 51.2, 49.5, 42.9, 43.0. HRMS calculated for C,,H,,No, (M): 263.0794. Found: 263.0793. (4S)-3-Carbobenzyloxy-5-oxo-4-(4-oxo-pent-2-enyl)-oxazolidine. To a solution of the oxazolidine aldehyde (1.4 g) in toluene (40 mL) was added 1- (triphenylphosphoranylidene)-2-propanone (T PP) (1.5 g, 4.7 mmol). The suspension was heated to 60°C under argon. After 18 h the reaction was complete, and the reaction was concentrated by rotary evaporation. EtQO was added to the suspension, and the precipitate was removed by vacuum filtration. The solvent was removed and the 184 resulting syrup was purified by flash chromatography (1:1 EtOAc-hexanes) to yield the enone as a syrup (0.64 g, 62% from acid chloride). IH NMR (acetone-d6, 50°C): 6 7.38 (m, 5H), 6.76 (ddd, 1H), 6.09 (dd, 1H), 5.53 (d, 1H), 5.30 (d, 1H), 5.21 (s, 2H), 4.56 (dd, 1H), 2.96 (m, 1H), 2.77 (m, 1H). 13C NMR (CDC13): 6 197.9, 171.0, 152.8, 139.5, 139.4, 135.4, 128.3, 128.0, 97.8, 68.0, 54.1, 33.9, 33.5, 27.3. HRMS calculated for CmHnNO5 (M): 303.1107. Found: 303.1094. (4S)-3-Carbobenzyloxy4-(2,3-dihydroxy-4-oxo-pentyl)-5-oxo-oxazolidine. The oxazolidine enone (0.6 g, 2 mmol) was added over 12 h to a suspension of NMO (0.3 g, 2.6 mmol), (DHQD)2PHAL ligand (16 mg, 0.02 mmol), and OsO4 (2.5% (w/v) in tBuOH, 0.2 mL) in a solution of tBuOH/HZO (3:1) at r.t.. The reaction was stirred no enone remaineed (TLC). EtOAc was added and the reaction was washed with l M HCl, followed by brine. The organic layer was dried with NazSO4 and the concentrated by rotary evaporation. The product was purified by flash chromatography (3:7:2:0.5 EtOAc- hexanes-CHzClz-MeOH) (0.3 g, 48%). 1H NMR (acetone-d6, 50°C): HRMS calculated for CmngNO7 (M-H): 336.1084. Found: 336.1090. Preparation of ATTH from N-tert-butoxycarbonyl-L-aspartic acid B-benzyl ester N-tert-butoxycarbonyl-L-aspartic acid a-tert-butyl B-benzyl ester. To stirred a solution of N—tert-butoxycarbonyl—L-aspartic acid B-benzyl ester (16 g, 50 mmol), DMAP (0.5 g, 4.1 mmol), and tBuOH (5.1 mL, 55 mmol) in 250 mL CHzCl2 at 0°C was added DCC (12.4 g, 60 mmol). The reaction was stirred at 0°C for 2 h, warmed to r.t. and allowed to stir at r.t. overnight. The suspension was filtered and the filtrate diluted with 185 400 mL EtQO. The organic layer was washed with 1 M HCl (2 x 100 mL), sat. NaHCO3 (2 x 100 mL), and finally H20 (2 x 100 mL). The organic layer was dried with Na2S04 and concentrated by rotary evaporation. The resulting syrup was purified by flash chromatography (7:3 EtOAc—hexanes) to yield a colorless syrup which crystallized on standing (17 g, 90%). MP 53-56°C. 1H NMR (CDCI3): 6 7.33 (m, 5H), 5.43 (d, 1H), 5.11 (dd, 2H), 4.44 (m, 1H), 2.98-2.91 (ddd, 2H), 1.42 (s, 9H), 1.41 (s, 9H). 13C NMR (CDC13): 6 170.8, 169.9, 155.4, 135.5, 128.5, 128.3, 128.2, 82.3, 79.8, 66.6, 50.5, 37.0, 28.3, 27.8. HRMS calculated for C201129NO6 (M+H): 380.2073. Found: 380.2078. N ,N-Bis(tert-butoxycarbonyl)-L-aspartic acid a-tert-butyl B-benzyl ester. To a solution of N—tert—butoxycarbonyl-L-aspartic acid a-tert-butyl B-benzyl ester (17.5 g, 46 mmol) in dry CH3CN (20 mL) under argon at r. t. was added 80020 (16 g, 83 mmol), and DMAP (0.4 g, 3.3 mmol). The reaction was stirred at r. t. overnight (12 h) before concentration by rotary evaporation. The resulting syrup was purified by flash chromatography (19:1 hexanes-EtOAc) to yield the desired amino acid (17.1 g, 77%). IN NMR (CDC13): 6 7.31 (br, 5H), 5.34 (dd, 1H), 5.11 (dd, 2H), 3.25 (dd, 1H), 2.70 (dd, , 1H), 1.47 (s, 18H), 1.41 (s, 9H). 13C NMR (CDC13): 6 170.7, 168.6, 151.9, 128.5, 128.2, 128.1, 83.2, 81.9, 66.5, 55.5, 35.6, 27.9, 27.8. HRMS calculated for C25H37N08 (M+H): 502.2417. Found: 502.2411. N ,N-Bis(tert-butoxycarbonyl)-L-aspartic acid a-tert-butyl ester. To a solution of the benzyl ester (0.43 g, 0.89 mmol) under argon in 10 mL MeOH was added 10% (w/v) Pd/C (9 mg, 8.9 pmol). The argon was replaced by H2 and the reaction was stirred 186 under atmospheric H2 until complete (TLC). The H2 was then replaced with argon, and the suspension filtered through celite to remove the catalyst. The filtrate was concentrated by rotary evaporation to yield the acid (0.35 g, quant.). MP 104—107°C. 1H NMR (CDC13): 5.27 (dd, 1H), 3.25 (dd, 1H), 2.72 (dd, 1H), 1.49 (s, 18H), 1.43 (s, 9H). 13C NMR: 6 175.7, 168.6, 151.9, 83.2, 82.2, 55.4, 35.2, 27.9, 27.8. HRMS calculated for C,8H3,NO8 (M+H): 412.1947. Found: 412.1939. N-tert-Butoxycarbonyl-L-aspartic acid a-tert-butyl ester. To a solution of the benzyl ester (2.5 g, 6.6 mmol) under argon in 70 mL MeOH was added 10% (w/v) Pd/C (63 mg). The argon was replaced by H2 and the reaction was stirred under atmospheric H2 until complete (TLC). The H2 was then replaced with argon, and the suspension filtered through celite to remove the catalyst. The filtrate was concentrated by rotary evaportation to yield the acid (1.9 g, quant.). 1H NMR (CDCl3): 6 5.48 (d, 1H), 4.42 (m, 1H), 2.97 (dd, 1H), 2.76 (dd, 1H), 1.42 (s, 18H). HRMS calculated for C,;,H23NO6 (M+H): 312.1423. Found: 312.1432. N ,N-Bis(tert-butoxycarbonyl)-L-aspartic acid (a-tert-butyl ester) N-methoxy- N-methylamide. To a solution of N,N-bis(tert-butoxycarbonyl)-L—aspartic acid a-tert- butyl ester (3.2 g, 8.2 mmol) and TEA (1.3 mL, 9.3 mmol) in 85 mL CHzCl2 under argon at r.t. was added BOP reagent (4.1 g, 9.3 mmol). The reaction was allowed to stir for 20 min before the addition of TEA (1.3 mL, 9.3 mmol) and N, 0- dimethylhydroxylamine-HCI (0.94 g, 9.6 mmol). The reaction was stirred for an additional 6 h before washing with 1 N HCI (3 x 100 mL), sat. NaHCO3 (2 x 100 mL), 187 and brine. The organic layer was dried with NazSO4, and the solvent was removed by rotary evaporation. The resulting syrup was purified by flash chromatography (7:3 Hexanes-EtOAc) to yield the wienreb amide (2.6 g, 73%). MP 63-67°C. 1H NMR (CDCl3): 6 5.41 (dd, 1H), 3.67 (s, 3H), 3.38 (dd, 1H), 3.13 (s, 3H), 2.70 (dd, 1H), 1.48 (s, 18H), 1.41 (s, 9H). 13C NMR (CDC13): 6 169.0, 151.9, 83.0, 81.3, 61.0, 55.4, 33.5, 28.0, 27.8. HRMS calculated for C20H36N208 (M+H): 455.2369. Found: 455.2359. N-tert-butoxycarbonyl-L-aspartic acid (a-tert-butyl ester) N-methoxy-N- methylamide. To a solution of N-tert-butoxycarbonyl—L-aspartic acid a-tert-butyl ester (4.8 g, 16.5 mmol) and TEA (4 mL, 28.5 mmol) in 170 mL CHZCI2 under argon at r.t. was added BOP reagent (8 g, 18 mmol). The reaction was allowed to stir for 20 min before the addition of TEA (4 mL, 28.7 mmol) and N, O-dimethylhydroxylamine-HCl (1.9 g, 19.8 mmol). The reaction was stirred for an additional 6 h before washing with 1 N HCl (3 x 50 mL), sat. NaHCO3 (2 x 50 mL), and brine. The organic layer was dried with NazSO4, and the solvent was removed by rotary evaporation. The resulting syrup was purified by flash chromatography (7:3 Hexanes-EtOAc) to yield the wienreb amide (3.6 g, 67%). 'H NMR (CDCl3): 6 5.63 ((1, NH), 4.41 (ddd, 1H), 3.66 (s, 3H), 3.13 (s, 3H), 3.10 (dd, 1H), 2.84 (dd, 1H), 1.42 (s 9H), 1.41 (s, 9H). 13C NMR (CDC13): 6 170.5, 155.7, 81.7, 79.4, 61.1, 50.3, 34.2, 28.3, 27.8. HRMS calculated for C,,H,8N,o, (M+H): 333.2025. Found: 333.2025. N ,N-Bis(tert-butoxycarbonyl)-L-aspartate semialdehyde a-tert-butyl ester. To a solution of the weinreb amide (0.63 g, 1.5 mmol) in 6 mL dry THF at —90°C was 188 added dropwise 2.2 mL of DIBAL (1 M in hexanes). After 2.5 h at —90°C the reaction was quenched by the addition of 0.35 M NaHSO4, and partitioned between NaHSO4 solution and EtzO. The aqueous layer was extracted with Eth (2 x 10 mL). The combined ether extracts were washed with 1 N HCl (10 mL), sat. NaHCO3 (3 x 10 mL), and finally brine. The organic layer was dried with MgSO4 and concentrated by rotary evaporation to yield the aldehyde (0.5 g, 92%). 1H NMR (CDCI3): 6 9.76 (dd, 1H), 5.27 (dd, 1H), 3.31 (dd, 1H), 2.73 (dd, 1H), 1.49 (s, 18H), 1.42 (s, 9H). 13C NMR (CDCl_,): 6 200.6, 172.0 155.5, 73.2, 70.6, 47.1, 42.2, 28.0, 27.7. N-tert-butoxycarbonyl-L-aspartate semialdehyde a-tert-butyl ester. To a solution of the weinreb amide (3.6 g, 11 mmol) in 45 mL dry THF at —90°C was added dropwise 17 mL of DIBAL (1 M in hexanes). After 3.5 h at —90°C the reaction was quenched by the addition of 0.35 M NaHSO4, and partitioned between NaHSO4 solution and EtZO. The aqueous layer was extracted with 3,0 (2 x 10 mL). The combined ether extracts were washed with 1 N HCl (10 mL), sat. NaHCO3 (3 x 10 mL), and finally brine. The organic layer was dried with MgSO4 and concentrated by rotary evaporation. The residue was purified by flash chromatography (4:1 hexanes-EtOAc) to yield the aldehyde (1.5 g, 51%). 'H NMR (CDCl3): 6 9.72 (dd, 1H); 5.32 (d, 1H); 4.45 (m, 1H); 2.95 (ddd, 2H), 1.43 (s, 9H), 1.41 (s, 9H). 13C NMR (CDC13): 6 200.5, 172.0, 157.5, 73.2, 70.6, 49.6, 45.0, 29.0, 28.7. HRMS calculated for CBHBNO5 (M+H): 274.1654. Found: 274.1658. N ,N-Bis(tert-Butoxycarbonyl)amino-6-oxo-hept-4-enoic acid tart-butyl ester. To a solution of N,N-bis(tert—butoxycarbonyl)-L-aspartate semialdehyde a-tert-butyl ester 189 (0.69 g, 1.8 mmol) in 35 mL dry toluene under argon was added 1- (triphenylphosphoranylidene)-2-propanone (TPP) (0.85 g, 2.5 mmol). The suspension was heated at reflux for 8 h and cooled to r. t.. The reaction was concentrated by rotary evaporation. EtzO was added to the suspension, and the precipitate was removed by vacuum filtration. The solvent was removed and the resulting syrup was purified by flash chromatography (1:1 EtOAc—hexanes) to yield the enone as a syrup (0.59 g, 78%). 1H NMR (CDC13): 6 6.71 (m, 1H), 6.01 (d, 1H), 4.86 (dd, 1H), 2.94 (m, 1H), 2.76 (m, 1H), 2.17 (s, 3H), 1.44 (s, 18H), 1.40 (s, 9H). 13C NMR (CDC13): 6 196.5, 172.0, 155.4, 141.9, 129.3, 73.1, 70.7, 54.6, 31.1, 28.1, 27.8, 26.4. HRMS calculated for C21H35NO7 (M+Na): 436.2311. Found: 436.2313. N -tert-Butoxycarbonylamino-6-oxo-hept-4-enoic acid tert-butyl ester. To a solution of N-tert-butoxycarbonyl-L-aspartate semialdehyde a-tert-butyl ester (1.4 g, 5.1 mmol) in 100 mL dry toluene under argon was added 1-(triphenylphosphoranylidene)-2- propanone (TPP) (2.6 g, 8.2 mmol). The suspension was heated at reflux for 8 h and cooled to r. t.. The reaction was concentrated by rotary evaporation. EtZO was added to the suspension, and the precipitate was removed by vacuum filtration. The solvent was removed and the resulting syrup was purified by flash chromatography (4:1 EtOAc- hexanes) to yield the enone as a syrup (1.3 g, 81%). 1H NMR (CDC13): 6 6.67 (m, 1H), 6.08 (d, 1H), 5.11 ((1, NH), 4.32 (m, 1H), 2.72 (m, 1H), 2.55 (m, 1H), 2.21 (s, 3H), 1.44 (s, 9H), 1.42 (s, 9H). 13C NMR (CDC13): 6 198.0, 170.3, 155.0, 142.0, 134.0, 82.6, 79.9, 52.9, 36.2, 28.2, 27.9, 26.6. HRMS calculated for C16H27NO5 (M+H): 314.1967. Found: 314.1972. 190 N ,N-Bis(tert-ButoxycarbonyDamino-(4S,5R)-4,5-dihydroxy-G-oxo-heptanoic acid tart-butyl ester and N ,N-Bis(tert-butoxycarbonyl)amino-(4R,SS)-4,5-dihydroxy 6-oxo-heptanoic acid tert-butyl ester. Combined AD-mix [3 (0.98 g), KZOsO4-2H20 (4.2 mg, 1.1 pmol), NaHCO3 (0.176 g, 2.1 mmol), and HZNSO4Me (66 mg, 0.7 mmol) in 7 mL tBuOH/HzO (1:1). The suspension was stirred at r.t. for 5 min, then chilled to 0°C. N,N—bis(tert-butoxycarbonyl)amino-6-oxo-hept-4—enoic acid ten-butyl ester (0.29 g, 0.7 mmol) in CHzCl2 was added and the solution stirred at 0°C overnight (12 b). Upon completion of the reaction (TLC), the reaction was quenched by the addition of sat. NaZSZO4. The reaction was stirred for an additional 20 min, then extracted with EtOAc (3 x 10 mL). The combined organic fractions were washed with 0.5 N HCl, 1 M NaHCO3, H20, and brine. The organic layer was dried with Na2S04 and concentrated by rotary evaporation. The resulting syrup was purified by flash chromatography (3.5:6:2.5:0.5 EtOAC-hexanes-CHzClz-MeOH) to yield a 1:1 mixture of diol diastereomers A and B (0.21 g, 67%). 1H NMR (CDCl3): 6 4.92 (dd, 1H), 4.83 (dd, 1H), 4.24 (ddd, 1H), 4.12 (d, 1H), 4.05 (d, 1H), 3.96 (ddd, 1H), 2.55 (m, 1H), 3.39 (m, 1H), 2.24 (s, 3H), 2.23 (s, 3H), 1.99 (m, 1H), 1.92 (m, 1H), 1.45 (s, 36H), 1.39 (s, 18H). 13C NMR (CDC13): 6208.3, 207.9, 170.0, 169.7, 152.6, 152.4, 83.4, 83.1, 81.9, 81.5, 79.5, 79.0, 69.5, 69.3, 56.7, 55.7, 35.6, 33.8, 27.97, 27.93, 27.86, 27.81, 25.9, 25.1. HRMS calculated for CMH37N09 (M+Na): 470.2366. Found: 470.2354. N-tert-Butoxycarbonylamino-(4S,5R)-4,5-dihydroxy-6-oxo-heptanoic acid tert-butyl ester and N-tert-butoxycarbonylamino-(4R,SS)-4,S-dihydroxy-6-oxo- 191 heptanoic acid tert-butyl ester. Combined AD-mix B (4.4 g), KZOsO4-2H20 (20 mg), NaHCO3 (0.8 g), and HZNSO4Me (0.3 g) in 70 mL tBuOH/HZO (1:1). The suspension was stirred at r.t. for 5 min, then chilled to 0°C. N-tert-butoxycarbonylamino-6—oxo-hept- 4-enoic acid tert-butyl ester (1.0 g, 3.2 mmol) in CH2C12 was added and the solution stirred at 0°C overnight (12 h). Upon completion of the reaction (TLC), the reaction was quenched by the addition of sat. NaZSZO4. The reaction was stirred for an additional 20 min, then extracted with EtOAc (3 x 10 mL). The combined organic fractions were washed with 0.5 N HCl, 1 M NaHCO3, H20, and brine. The organic layer was dried with NaZSO4 and concentrated by rotary evaporation. The resulting syrup was purified by flash chromatography (3.5:6:2.5:0.5 EtOAC-Hex-CHzClz-MeOH) to yield a 1:1 mixture of diol diastereomers (0.46 g, 41%). 1H NMR (CDC13): 6 5.46 (m, 2H), 4.36 (m, 2H), 4.26 (m, 2H), 4.22 (dd, 1 H), 4.07 (m, 2H), 3.76 (br, 1H), 2.29 (s, 3H), 2.28 (s, 3H), 2.24- 2.15 (m, 2H), 2.00-1.92 (m, 2H), 1.48 (s, 3H), 1.47 (s, 9H), 1.47 (s, 9H), 1.454 (s, 9H), 1.451 (s, 9H). HRMS calculated for C16H29NO7 (M+H): 348.2022. Found: 348.2037. N-tert-Butoxycarbonylamino-(4S,SR)-4,5-dihydroxy-6-oxo-heptanoic acid tert-butyll ester and N-tert-butoxycarbonylamino-(4R,SS)-4,5-dihydroxy-6-oxo- heptanoic acid tert-butyl ester. Combined AD-mix a (0.9 g), KzOsO4-2H20 (4 mg), NaHCO3 (0.16 g), and HZNSO4Me (60 mg) in 14 mL tBuOH/HZO (1:1). The suspension was stirred at r.t. for 5 min, then chilled to 0°C. N—tert-butoxycarbonylamino-6—oxo—hept- 4—enoic acid tert—butyl ester (0.2 g, 0.6 mmol) in CHZCI2 was added and the solution stirred at 0°C overnight (12 h). Upon completion of the reaction (TLC), the reaction was quenched by the addition of sat. NaQSZO4. The reaction was stirred for an additional 20 192 min, then extracted with EtOAc (3 x 10 mL). The combined organic fractions were washed with 0.5 N HCl, 1 M NaHCO3, H20, and brine. The organic layer was dried with NaZSO4 and concentrated by rotary evaporation. The resulting syrup was purified by flash chromatography (3.5:6:2.5:0.5 EtOAC-Hex-CHZClz-MeOH) to yield a 3:1 mixture of diol diastereomers (20 mg, 20%). Spectra same as found using AD-mix B. (4S,SR)-4,5-Diacetoxy-N,N-Bis(tert-butoxycarbonyl)amino-6-oxo-heptanoic acid tert-butyl ester and (4R,SS)-4,5-diacetoxy-N,N-bis(tert-butoxycarbonyl)amino- 6-oxo-heptanoic acid tert-butyl ester. Pyridine (1.6 mL) was added to a solution of the diol mixture (0.21 g, 0.47 mmol) in Ac20 (2.2 mL). The reaction was stirred overnight at r.t.. The solvent was removed by rotary evaporation and the resulting residue was azeotroped with EtOH (3 x). The resulting residue was purified by flash chromatography to provide an inseparable mixture of the two diastereomers (0.21 g, 84%). 1H NMR (CDCI3): 6 5.52 (ddd, 1H), 5.24 (ddd, 1H), 5.23 (d, 1H), 4.98 (d, 1H), 4.89 (d, 1H), 4.72 (dd, 1H), 2.176 (s, 3H), 2.171 (s, 3H), 2.615 (s, 3H), 2.41(m, 3H), 2.21 (m, 1H), 2.11 (m, 1H), 2.02 (s 3H), 2.00 (s, 3H), 1.46 (s, 18H), 1.45 (s, 18H), 1.39 (s, 9H), 1.38 (s, 9H). HRMS calculated for C25H41NO” (M+Na): 554.2577. Found: 554.2568. (4S,5R)-4,5-Bis-benzoyloxy-NJV-Bis(tert-butoxycarbonyl)amino-6-oxo- heptanoic acid tert-butyl ester and (4R,SS)-4,5-bis-benzoyloxy-N,N-bis(tert- butoxycarbonyl)amino-6-oxo-heptanoic acid tert-butyl ester. The diol mixture (70 mg, 0.16 mmol) was dissolved in pyridine (0.2 mL) and CHZCI2 (0.2 mL). Benzoyl chloride (50 pL) was added dropwise, and the reaction was stirred at r. t. for 24 h. The 193 pH of the reaction was adjusted to 8.0 by the addition of NaOH. The solution was then extracted with EtOAc (3 x 5 mL). The pooled organic fractions were washed with H20 (3 x 5 mL) followed by brine (l x 5 mL). The organic layer was dried with Nast4 and the solvent was removed by rotary evaporation. The resulting residue was purified by flash chromatography (5:1 hexanes-EtOAc) to yield an inseparable mixture diastereomers (38 mg, 36%). 1H NMR (CDCI3): 6 8.12-7.99 (m, 8H), 7.61—7.39 (m, 12H), 5.86 (ddd, 1H), 5.67 (ddd, 1H), 5.61 (d, 1H), 5.37 (d, 1H), 5.02 (dd, 1H), 4.89 (dd, 1H), 2.75-2.67 (m, 2H), 2.50 (ddd, 1H), 2.35 (ddd, 1H), 2.255 (s, 3H), 2.249 (s, 3H), 1.424 (s, 18H), 1.412 (s, 18H), 1.406 (s, 18H), 1.389 (s, 18H). (4S,5R)-4,5-Bis-benzoyloxy-N-tert-butoxycarbonylamino-6-oxo-heptanoic acid tart-butyl ester and (4R,SS)-4,5-bis-benzoyloxy-N-tert-butoxycarbonylamino-6- oxo-heptanoic acid tert-butyl ester. The diol mixture produced using AD-mix B (0.44 g, 1.2 mmol) was dissolved in pyridine (1.5 mL) and CH2C12 (1.5 mL). Benzoyl chloride (0.4 mL) was added dropwise, and the reaction was stirred at r. t. for 24 h. The pH of the reaction was adjusted to 8.0 by the addition of NaOH. The solution was then extracted with EtOAc (3 x 5 mL). The pooled organic fractions were washed with H20 (3 x 5 mL) followed by brine (1 x 5 mL). The organic layer was dried with NaZSO4 and the solvent was removed by rotary evaporation. The resulting residue was purified by flash chromatography (5:1 hexanes-EtOAc) to yield two diastereomers A (0.2 g, 30%)) and B (0.28 g, 42%). Product A 1H NMR (CDCI3): 6 8.14 (d, 2H), 7.99 (dd, 2H), 7.57 (ddd, 2H), 7.44 (ddd, 4H), 5.87 (d, 1H), 5.85 (dd, 1H), 5.34 (d, 1H), 4.31 (m, 1H), 2.37 (m, 1H), 2.25 (s, 194 3H), 2.15 (m, 1H), 1.42 (s, 9H), 1.28 (s, 9H). 13C NMR (CDCI3): 6 201.2, 170.2, 165.3, 165.2, 155.4, 133.3, 133.2, 129.7, 129.6, 129.0, 128.8, 128.3, 128.2, 82.3, 79.8, 77.9, 69.5, 50.6, 34.3, 27.9, 27.6, 27.5, 26.4. HRMS calculated for C30H37NO9 (M+Na): 578.2366. Found: 578.2357. Product B 1H NMR (CDCI3): 6 8.09 (d, 2H), 8.01 (d, 2H), 7.57 (ddd, 2H), 7.44 (m, 4H), 5.81 (m, 1H), 5.44 (d, 1H), 5.11 (d, 1H), 4.24 (m, 1H), 2.39 (m, 1H), 2.26 (s, 3H), 2.17 (m, 1H), 1.46 (s, 9H), 1.32 (s, 9H). 13C NMR (CDCI3): 6 202.0, 170.6, 165.7, 165.4, 133.6, 133.5, 130.3, 129.9, 129.7, 128.53, 128.47, 82.7, 79.9, 78.8, 69.4, 53.5, 51.1, 33.6, 28.2, 28.1, 27.9, 27.1. HRMS calculated for C30H37NO9 (M+Na): 578.2366. Found: 578.2363. (4S,5R)-4,5-Bis-benzoyloxy-N-tert-butoxycarbonylamino-G-oxo-heptanoic acid tart-butyl ester and (4R,SS)-4,5-bis-benzoyloxy-N-tert-butoxycarbonylamino-6- oxo-heptanoic acid tart-butyl ester. The diol mixture produced using AD-mix 01 (20 mg, 6 ymol) was dissolved in pyridine (70 14L) and CH2C12 (70 FL). Benzoyl chloride (20 14L) was added dropwise, and the reaction was stirred at r. t. for 24 h. The pH of the reaction was adjusted to 8.0 by the addition of NaOH. The solution was then extracted with EtOAc (3 x). The pooled organic fractions were washed with H20 (3 x) followed by brine (1 x). The organic layer was dried with NaZSO4 and the solvent was removed by rotary evaporation. The resulting residue was purified by flash chromatography (5:1 hexanes-EtOAc) to yield two diastereomers A (4 mg, 13%)) and B ( 12 mg, 38%). Same spectra as above. 195 ATTH from D-tartaric acid [4S,SS]-2,2-Dimethyl-[1,3]dioxolane-4,5-dicarboxylic acid dimethyl ester. A solution containing D-tartaric acid (50 g, 333 mmol), 2,2-dimethoxy propane (95 mL, 770 mmol), and p-toluenesulfonic acid (0.2 g, 1.05 mmol) in 20 mL of MeOH was heated to reflux under argon for 1.5 h. Cyclohexane (225 mL) and additional 2,2- dimethoxypropane (48 mL, 385 mmol) were added. A vigreux column and a variable reflux distilling head were affixed and MeOH and acetone were azeotroped with cyclohexane over 2 days. The reaction was allowed to cool and NaHCO3 was added slowly until a yellow color persisted. Any volatile components were removed by rotary evaportation. The residue was then distilled under vacuum (b.p. 120°C under vacuum) to yield the desired [4S,SS]-2,2-dimethyl-[1,3]dioxolane-4,5-dicarboxylic acid dimethyl ester as a yellow oil (55 g, 76%). 1H NMR (CDCI3): 6 4.79 (s, 2H), 3.60 (s, 6H), 1.49 (s, 6H). ”C NMR (CDCI3): 170.1, 113.9, 77.0, 52.8, 26.3. HRMS calculated for C9H1506 (M+H): 219.0869. Found: 219.0865. [2R,3R]-2,3-O-Isopropylidene-D-threitol. A suspension of LiAlH4 (16 g, 424 mmol) in dry E90 (270 mL) was refluxed under a stream of argon for 45 min, then the heating mantle was removed. [4S,SS]-2,2-Dimethy1-[l,3]dioxolane-4,5-dicarboxylic acid dimethyl ester (55g, 252 mmol) in Eth (130 mL) was added over 2 h via an addition funnel. The suspension was heated to reflux under argon for 5 h, then cooled to —5°C with an ice/acetone bath. Water (15 mL) was added carefully, followed by 15 mL 4 N NaOH solution. An additional 50 mL of water was then added and the suspension was stirred at r. t. until the gray color was gone. The suspension was filtered by vacuum 196 filtration, and the solid collected was washed with 8,0. The inorganic solid was extracted over 2 days with THF using a sohxlet apparatus. The combined organic extracts were combined and dried with MgSO4. The solvents were removed by rotary evaporation and the residue distilled under vacuum (1 mm Hg) to yield [2R,3R]-2,3-O- isopropylidene-D-threitol (b.p. 124°C) (24 g, 59%). 1H NMR (CDCI3): 6 3.99 (m, 2H), 3.72 (dd, 4H), 2.17 (br, 2H), 1.40 (s, 6H). ”C NMR (CDCI3): 6 101.6, 81.7, 62.5, 28.6. HRMS calculated for C7H,SO4 (M+H): 164.0490. Found: 163.0970. [2R,3R]-2,3-O-Isopropylidene-D-threitol 4-tert-butyl dimethyl silyl ether. |2R,3R]-2,3-O-Isopropylidene-D-threitol (24 g, 148 mmol) in THF (130 mL) was addd to a stirred suspension of NaH (60% immersion in oil) (6 g, 150 mmol) in 270 mL THF under argon at 0°C. The suspension was stirred for 10 min at 0°C before warming to r.t. and stirring for an additional 45 min. TBDMSCI (23 g, 150 mmol) in 130 mL THF was added over 20 min, and the suspension was stirred at r.t. an additional 3 h. The suspension was then poured into 300 mL sat. NaHCO3 solution, and the organic phase was separated. The aqueous phase was extracted with EtOAc (3 x 200 mL). The organic fractions were combined and dried with MgSO4. The solvent was removed by rotary evaporation to yield [2R,3R]-2,3-O-isopropylidene-D-threitol 4-tert-butyl dimethyl silyl ether (35 g, 86%) as a yellow oil. 1H NMR (CDCI3): 6 3.79 (m, 6H), 1.39 (s, 3H), 1.38 (s, 3H), 0.87 (s, 9H), 0.06 (s, 6H). ”C NMR (CDCI3): 6 109.0, 80.1, 78.1, 63.6, 62.7, 26.9, 26.8, 25.8, 18.2, —5.5. HRMS calculated for C,3H2804Si (M+H): 277.1835. Found: 277.1841. 197 [2R,3R]-2,3-O-Isopropylidene-D-threitol 4-triisopropyl silyl ether. [2R,3R]- 2,3-O-Isopropylidene-D-threitol (1.0 g, 5.9 mmol) in THF (3 mL) was addd to a stirred suspension of NaH (60% immersion in oil) (0.3 g, 6.5 mmol) in 12 mL THF under argon at 0°C. The suspension was stirred for 10 min at 0°C before warming to r.t. and stirring for an additional 45 min. TlPSCl (1.3 mL, 6.2 mmol) was added over 15 min, and the suspension was stirred at r.t. an additional 3 h. The suspension was then poured into mL sat. NaHCO3 solution, and the organic phase was separated. The aqueous phase was extracted with EtOAc (3 x 200 mL). The organic fractions were combined and dried with MgSO4. The solvent was removed by rotary evaporation to yield [2R,3R]-2,3-O- isopropylidene-D-threitol 4—tert—butyl dimethyl silyl ether (35 g, 86%) as a yellow oil. IH NMR (CDCI3): 6 3.86 (m, 4H), 2.36 (s, 1H), 1.40 (s, 3H), 1.38 (s, 3H), 1.05 (s, 18H), 1.04 (s, 3H). ”C NMR (CDCI3): 6 109.3, 80.7, 78.4, 64.4, 63.0, 27.2, 27.1, 18.1, 12.0. [2R,3R]-5-(tert-Butyl-dimethyl-silanyloxymethyl)-2,2-dimethyl- [1,3]dioxolane-4-carbaldehyde. DMSO (8 mL, 109 mmol) in CHZCI2 (212 mL) was added via an addition funnel to a stirred solution of oxalyl chloride (4.8 mL, 55 mmol) in 120 mL CH2C12 at —88°C under argon. The solution was allowed to stir at —88°C for several minutes before the addition of [2R,3Rl-2,3-O-isopropylidene-D-threitol 4—tert- butyl dimethyl silyl ether (11.6 g, 42 mmol) in 60 mL CHZCI2 via cannula. The solution was stirred at —88°C an additional 20 min before TEA (30 mL 210 mmol) was added. The reaction was allowed to warm to r.t. and stirred for an additional 1 h. H20 (100 mL) was added and the organic layer was dried with NazSO4. The solvent was removed by rotary evaporation, and the resulting syrup was resuspended in 1:1 EtOAc-hexanes. The 198 solution was passed through a plug of silica gel plug. The solute was concentrated by rotary evaporation to yield the aldehyde (9.8 g, 85%). 1H NMR (CDCI3): 6 9.75 (d, 1H), 4.31 (dd, 1H), 4.09 (m, 2H), 3.78 (d, 4H), 1.45 (s, 3H), 1.40 (s, 3H), 0.88 (s, 9H), 0.06 (s, 6H). [2R,3R]-5-(triisopropyl-silanyloxymethyl)-2,2-dimethyl-[1,3]dioxolane-4- carbaldehyde. DMSO (0.24 mL, 3.4 mmol) in CH2C12 (1 mL) was added to a stirred solution of oxalyl chloride (0.15 mL) in 7 mL CHZCI2 at -88°C under argon. The solution was allowed to stir at —88°C for several minutes before the addition of [2R,3R]— 2,3-O-isopropylidene-D-threitol 4-triisopropylsilyl ether (0.4 g, 1.3 mmol) in 2 mL CHZCIZ. The solution was stirred at —88°C an additional 20 min before TEA (0.9 mL) was added. The reaction was allowed to warm to r.t. and stirred for an additional 1 h. H20 was added and the organic layer was dried with NaZSO4. The solvent was removed by rotary evaporation, and the resulting syrup was resuspended in 1:1 EtOAc-hexanes. The solution was passed through a plug of silica gel plug. The solute was concentrated by rotary evaporation to yield the aldehyde (0.18 g, 44%). 1H NMR (CDCI3): 6 9.76 (d, 1H), 4.38 (dd, 1H), 4.11 (m, 1H), 3.86 (dd, 2H), 1.44 (s, 3H), 1.38 (s, 3H), 1.04 (s, 18H), 1.03 (s, 3H). [2R,3R]-l-[5-(tert-Butyl-dimethyl-silanyloxymethyl)-2,2-dimethyl- [1,3]dioxolan-4-yl]-ethanol. Methyl magnesium bromide (3 M in hexanes, 35 mL, 105 mmol) was added to a solution of aldehyde (9.8 g, 35 mmol) in 350 mL THF at —78°C under argon. The solution was stirred at —78°C for 2 h, then warmed to r.t. and stirring 199 continued until the reaction was complete. The reaction was quenched by the addition of 100 mL of sat. N H4Cl. The aqueous layer was extracted with Eth (3 x 100 mL). The organiclayers were combined and dried with MgSO4. The solvent was removed by rotary evaporation and the residue was purified by flash chromatography (1:9 EtOAc- hexanes) to yield the alcohol (5.9 g, 48%). lH NMR (CDCI3): 4.29 (d, 1H), 4.03 (m, 1H), 3.79 (dd, 2H), 2.25 (s, 3H), 1.43 (s, 3 H), 1.40 (s, 3H), 0.86 (s, 9 H), 0.05 (s, 6H). [2R,3R]-1-[5-(triisopropylsilyloxy)-2,2-dimethyl-[1,3]dioxolan-4-yl]-ethanol. Methyl magnesium bromide (2.5 M in hexanes, 0.5 mL, 1.25 mmol) was added to a solution of aldehyde (0.18 g, 0.57 mmol) in 4 mL THF at —78°C under argon. The solution was stirred at —78°C for 2 h, then warmed to r.t., and stirring continued until the reaction was complete. The reaction was quenched by the addition of sat. NH4C1. The aqueous layer was extracted with Et20 (3 x 2 mL). The organic layers were combined and dried with MgSO4. The solvent was removed by rotary evaporation and the residue was purified by flash chromatography (1:9 EtOAc-hexanes) to yield the alcohol (35 mg, 19%). 1H NMR(CDC13): 6 3.79 (m, 5H), 3.35 (s, 1H), 1.38 (s, 3H), 1.37 (s, 3H), 1.25 (d, 3H), 1.07 (s, 18H), 1.05 (s, 3H). ”C NMR (CDCI3): 6 84.3, 79.4, 68.1, 64.5, 26.9, 26.7, 19.4, 17.8, 11.7. 1-[5-(tert-Butyl-dimethyl-silanyloxymethyl)-2,2-dimethyl-[l,3]dioxolan-4-yl]- ethanone. To a solution of alcohol (5.9 g, 20 mmol) in CHZCI2 (65 mL) was added NMO (3.3 g, 28 mmol), crushed, activated 4A molecular sieves (6.5 g), and TPAP (0.32 g, 1 mmol). The suspension was stirred at r.t. under argon for 2 h. The suspension was 200 concentrated by rotary evaporation. The resulting syrup was purified by flash chromatography (19:1 hexanes-EtOAc). The fractions containing the desired product were pooled and concetrated to yield the ketone (5.2 g, 88%) as a syrup. IH NMR (CDCI3): 4.29 (d, 1H), 4.03 (m, 1H), 3.79 (dd, 2H), 2.25 (s, 3H), 1.43 (s, 3 H), 1.40 (s, 3H), 0.86 (s, 9 H), 0.05 (s, 6H). HRMS calculated for C14H2804Si (M+H): 289.1835. Found: 289.1826. Genetic manipulations pHS7.098. The asd locus was amplified by PCR from E. coli W3110 genomic DNA using the following primers containing BamHl terminal recognition sequences: 5’- CGGGATCCATGAAAAATGTTGGTTTTATC and 5’- CGGGATCCTTACGCCAGTTGACGAAGCAT. The amplified 1.1 kb PCR fragment was digested with BamHI and ligated into the BamHI site of pJG7.246 (T5, lacO, lacO, 6xhis, lan, Amp’) to create plasmid pHS7.098 (T5, lacO, lacO, 6xhis, asd, lac/Q, Amp') in which the asd gene is oriented in the same directions as the T5 promoter. pHSS.080. The hdhl locus was amplified by PCR from E. coli W3110 genomic DNA using the following primers containing BamHI terminal recognition sequences: 5’- CGCGGATCCGTGATGAAGACGAATTACC and 5’- CGCGGATCCTCAGACTCCTAACTTCCATG The amplified 1.5 kb PCR fragment was digested with BamHI and ligated into the BamHI site of pJG7.246 (T5, lacO, lacO, 201 6xhis, lan, Amp’) to create plasmid pHS8.080 (T5, lacO, lacO, 6xhis, hdhl, lac/Q, Amp’) in which the hdhl gene is oriented in the same directions as the T5 promoter. pHS8.216. The thrA locus was amplified by PCR from E. coli W3110 genomic DNA using the following primers containing BamHI and Ndel terminal recognition sequences: 5’- GGAATTCATATGGAGTGTTGAAGTTCGGCG and 5’- CCGGATCCGACTCCTAACTTCCATGAGAGG. The amplified 2.46 kb PCR fragment was digested with BamHI and Ndel and ligated into the BamHI/Ndel sites of pET-le (T7, lacO, rbs, 6xhis, Amp', lale) to create plasmid pHS8.216 (T 7, lacO, rbs, 6xhis, thrA, Amp') in which the thrA gene is oriented in the same directions as the T7 promoter. pHSS.240. The ij 602 locus was amplified by PCR from M. jannaschii genomic DNA using the following primers containing BamHI terminal recognition sequences: 5’- CGGGATCCATATAATTATAGTAGGATTTG and 5’- CGGGATCCTTATTTTTTAGTAGAATTGTA.' The amplified 1.0 kb PCR fragment was digested with BamHI and ligated into the BamHI site of pET-15b (T7, lacO, rbs, 6xhis, Amp', lac/Q) to create plasmid pHS8.240 (T7, lacO, rbs, 6xhis, mj1602, Amp', [61619) in which the mj1602 gene is oriented in the same directions as the T7 promoter. 202 pHSS.243. The mj0400 locus was amplified by PCR from pMJ0400 using the following primers containing B a m HI terminal recognition sequences: 5’- CGCGGATCCGAATTATTTAAAGACATAAAG and 5’- CGCGGATCCT TATTTCT TCCT AATCT CI‘T T. The amplified 0.8 kb PCR fragment was digested with BamHI and ligated into the BamHI site of pET-le (T7, lacO, rbs, 6xhis, Amp', lacIQ) to create plasmid pH88.101 (T7, lacO, rbs, 6xhis, mj0400, Amp', lale) in which the mj0400 gene is oriented in the same directions as the T7 promoter. pHS8.101. The mj1249 locus was amplified by PCR from M. jannaschii genomic DNA using the following primers containing BamHI terminal recognition sequences: 5’- CGCGGATCCGGATGGGTTAATGTTATTGGA and 5’- CGCGGATCCT CACF TTTCAATAATCGTCF C. The amplified 0.9 kb PCR fragment was digested with BamHI and ligated into the BamHI site of pET-15b (T7, lacO, rbs, 6xhis, Amp’, lacIQ) to create plasmid pH88.101 (T7, lacO, rbs, 6xhis, mj1249, Amp", lale) in which the ij 249 gene is oriented in the same directions as the T7 promoter. Enzyme Purifications E. coli aspartate semialdhyde dehdrogenase (ASADH) DHSa/pHS7.098 was grown on LB/Amp agar plates at 37°C overnight. A single colony was used to inoculate 5 mL LB/Amp media, and the cultures were grown at 37°C in a shaker overnight. A 1 mL aliquot of the 5 mL overnight culture was used to 203 inoculate 500 mL of LB/Amp media. The 500 mL culture was incubated in a shaker at 37°C and 250 rpm until the OD600 reached ~1. IPTG was added to a concentration of 0.1 mM, and the culture was incubated at 37°C and 250 rpm for an additional 12. The culture cells were harvested by centrifugation (6400 g, 4°C, 5 min), and the supernatant was discarded. The cells were resuspended in 10 mL of binding buffer (20 mM Tris-HCI (pH 8.0) containing 10 mM imidazole and 300 mM NaCl). The cells were lysed by two passes through a french pressure cell and the cellular debris was removed by centrifugation (48,000g, 4°C, 30 min). NiZI-NTA resin (1 mL) was added to the supernatant. The suspension was stirred at 4°C for 1 h, and the supernatant was eluted from the resin. The resin was washed with 5 column volumes of binding buffer, followed by 5 column volumes of wash buffer #1 (20 mM Tris-HCI (pH 8.0) containing 20 mM imidazole and 300 mM NaCl) and wash buffer #2 (20 mM Tris-HCI (pH 8.0) containing 100 mM imidazole and 300 mM NaCl). The desired ASADH was eluted with 5 column volumes of eluting buffer (20 mM Tris-HCl (pH 8.0) containing 200 mM imidazole and 300 mM NaCl). The presence of ASADH was determined by SDS—PAGE (MW 77.5 kDa, dimer), and fractions containing the desired protein were dialyzed against 20 mM Tris-HCl (pH 7.5) overnight. The final protein concentration was 7.9 mg/mL. The specific activity of the ASADH produced was measured to be 0.48 U/mg. MJ0400 from BL21 Codon Plus RIL/lpMJ0400. The plasmid pMJO400 was transformed into BL21 Codon Plus RIL competent cells, and the construct was grown at 37°C overnight on LB/Amp/Cm agar plates. A 204 single colony was used to inoculate 5 mL LB/Amp/Cm media. The 5 mL culture was incubated at 37°C in a shaker overnight. The 5 mL culture was used to inoculate 1 L LB/Amp/Cm media, and this culture was incubated at 37°C and 250 rpm until the OD600 reached ~1. Lactose was added to 28 mM to induce M10400 expression. The culture was incubated an additional 3 h at 37°C before the cells were harvested by centrifugation (6400g, 4°C, 5 min). The supernatant was discarded and the cells were resuspended in 15 mL of 20 mM Bis-Tris—HCI (pH 6.5). The cells were lysed by two passed through a french pressure cell and the cellular debris was removed by centrifugation (48,000g, 4°C, 25 min). The supernatant was heated at 70°C for 30 min and the precipitated proteins were removed by centrifugation (48,000g, 4°C, 20 min). The supernatant was dialyzed against 1 L 20 mM Tris-HCl (pH 7.5) overnight. The protein solution was concentrated to 2 mL containing 20 mg/mL protein. The presence of M10400 was determined by SDS-PAGE (29.7 kDa). Enzyme Assays ASADH specific activity assay A solution of 1 M phosphate (pH 9.0) (10 yL) was diluted with 940 yL d.d. H20. To this solution was added 10 pL NADP solution (6 mg/mL) and 20 14L ASA solution produced through the ozonolysis of L-allyl glycine. Upon addition of 10 FL ASADH solution the increase in the absorbance at 340 nm at r.t. was observed. An extinction coefficient of 6220 was used for specific activity calculations. 205 In vitro enzyme reactions Condensation of ASA and DKFP by MJ0400. A solution containing ASA (6 mg, 51 amol), DKFP (18 mg, 71 pmol), MgClz-ZHZO (17 mg, 84 mmol), 20 mM potassium phosphate buffer (degassed) (5 mL), and d.d. H20 (4.4 mL) was prepared and degassed with argon. A solution of MJ0400 (1 mL, 20 mg protein) was added, and the solution was stirred at 60°C for 30 min. NaBH4 (0.5 mL of a 5.3 M solution in H20) was added, and the reaction was stirred for an additional 1.5 h at r.t.. The reaction was acidified by the addition of HCl solution and the protein was removed by centrifugation. The solvent was removed by rotary evaporation, and the residue was azeotroped three times with MeOH. The residue was resuspended in H20 and absorbed onto a column of Dowex 50 (HI form) (1 mL). The column was washed with d.d. H20 (15 column volumes) and the product was eluted with 1 N HCl (15 column volumes. The solvent was removed by rotary evaporation. The resulting residue was treated with l N HCl in MeOH overnight at r.t.. The solvent was removed by rotary evaporation, and the residue was resuspended in a 1:1 solution of trifluoroacetic anhydride-CHZCIZ. The reaction was stirred at r.t. for 2 h and the solvent was removed under a stream of argon. The resulting residue was resuspended in methyl acetate (250 yL). The product was analyzed by GC-MS analysis. GC peaks identified: 6.73, 7.20, 7.43, and 7.68 min. 206 GC-MS analysis Analysis of MJ 0400 catalyzed condensation of ASA and DKFP. A 5 FL aliquot of the product solution in methyl acetate was injected onto a GC- MS column at 95°C. The temperature was increased by 10°C per min to provide a linear gradient from 95 to 280°C. The samples were analyzed at 70 eV. 207 REFERENCES Pittard, A.J., Biosynthesis of Aromatic Amino Acids, in Escherichia coli and Salmonella Cellular and Molecular Biology, F.C. Neidhardt, Editor. 1996, ASM Press: Washington DC. p. 458-484.; Bult. C. J.; et. A1. Science 1996, 273, 1058- 1073. Floss, H.G. Natural Product Reports 1997, I 4(5), 433-452. Rinehart, K. L.; Shield, L. S. Forstchr. Chem. Org. Naturst. 1976, 33, 231-307. Prelog, V.; Oppolzer, W. Helv. Chim. Acta 1973, 56, 2279-2287. Funayama, S.; Cordell, G. A. Stud. Nat. Prod. Chem. 2000, 23, 61—106. Sensi, P.; Greco, A. M.; Ballotta, G. Antibiot. Annu. 1959, 262-270. Wehrli, W.; Knusel, F.; Nuesch, J.; Staehelin, M. Proc. Natl. Acad. Sci. USA 1968, 61, 667-673. (a) Ganguly, A. K.; J. Chromatogr. Libr. 1978, 15, 39-68. (b) Mustaev, A.; Zaychikov, E.; Severinov, K.; Kashlev, M.; Polyakov, A.; Nikiforov, V.; Goldfarb, A. Proc. Nat. Acad. Sci. USA 1994, 91, 12036-12040. (c) Wehrli, W., Rev. Infect. Dis. 1983, 5, $407-$411. ((1) Wegrzyn, A.; Szalewska-Palasz, A.; Blaszczak, A.; Liberek, K.; Wegrzyn, G. FEBS Lett. 1998, 440, 172-174. (e) Pfannschmidt, T.; Link, G. Mol. Gen. Genet. 1997, 257, 35-44. (e) Sodeik, B.; Griffiths, G.; Ericsson, M.; Moss, 3.; Doms, R. W. J. Virol. 1994, 68, 1103-1114. (f) Tomiyama, T.; Asano, S.; Suwa, Y.; Morita, T.; Kataoka, K.-I.; Mori, H.; Endo, N. Biochem. Biophys. Res. Comm. 1994, 204, 76—83. Sepkowitz, K. A.; Raffalli, J.; Riley, L.; Kiehn, T. E.; Armstrong, D. Clin. Microbiol. Rev. 1995, 8, 180-199. Corcoran, J. W.; Chick, M.; in Biosynthesis of Antibiotics; Academic Press: London, New York, 1966; Vol. 1; 159. (a) Ghisalba, O.; Auden, J. A. Schupp, T.; Nuesch, J. in Biotechnology of industrial Antibiotics Vandamme, E. 1., Ed; 1984, Vol 22, 281. (b) Allen, M. S.; McDonald, 1. A.; Rickards, R. W. Tetrahedron Lett. 1981, 1145-1148. (c) White, R. J .; Martinelli, E.; Lancini, G. Proc. Natl. Acad. Sci. USA 1974, 71, 3260-3264. (d) Milavetz, B.; Kakinuma, K.; Rinehart, K. L.; Rolls, J. P.; Haak, W. J. J. Am. Chem. Soc. 1973, 95, 5793-5795. (e) Sugita, M.; Sasaki, T.; Furihata, K.; Seto, H.; Otake, N. J. Antibiot. 208 13 20 21 22 1982, 35, 1467-1473. (f) Johnson, R. D.; Haber, A.; Rinehart, K. L. J. Am. Chem. Soc. 1974, 96, 3316-3317. Brufani, M.; Kluepfel, D.; Lancini, G. C.; Leitich, J.; Mesentseu, A. S.; Prelog, V.; Schmook, F. P.; Sensi, P. Helv. Chim. Acta. 1973, 56, 2315-2323. (a) Johnson, R. D.; Haber, A.; Rinehart, K. L. J. Am. Chem. Soc. 1974, 96, 3316- 3317. (b) Haber, A.; Johnson, R. D.; Rinehart, K. L. J. Am. Chem. Soc. 1977, 99, 3541-3544. Lee, J. P.; Tsao. S.-W.; Chang, C. J.; Floss, H. G. Can. J. Chem. 1994, 72, 182-187. (a) Allen, M. S.; McDonald, 1. A.; Rickards, R. W. Tetrahedron lett. 1981, 1145- 1148. (b) McDonald, 1. A.; Rickards, R. W. Tetrahedron lett. 1981, 1149-1152. Milavetz, B.; Kakinuma, K.; Rinehart, K. L.; Roll, J. P.; Haak, W. J. J. Am. Chem. Soc. 1973, 95, 5793-5795. Lancini, G.; Grandi, M. In Antibiotics, Corcoran, J. W., Eds.; New York: Springer- Verlag, 1981, vol 4 (Biosynthesis), p12—40. Ghisalba, O.; Nuesch, J. J. Antibiot. 1981, 34, 64—71. (a) Staley, A. L.; Rinehart, K. L. J. Antibiot. 1991, 44, 218-224. (b) Hatano, K.; Akiyama, S.; Asai, M.; Richards, R. W. J. Antibiot. 1982, 35, 1415—1417. (c) Anderson, M. G.; Kibby, J. J.; Rickards, R. W.; Rothschild, J. M. J. Chem. Soc., Chem. Commun 1980, 1277-1278. ((1) Herlt, A. J.; Kibby, J. J.; Rickards, R. W. Aust. J. Chem. 1981, 34, 1319-1324. (a) Karlsson, A.; Sartori, G.; White, R. J. Eur. J. Biochem. 1974, 47, 251-256. (b) Haber, A.; Johnson, R. D.; Rinehart, K. L. J. Am. Chem. Soc. 1977, 99, 3541-3544. (c) Hornemann, U.; Kehrer, J. P.; Eggert, J. H. J. Chem. Soc., Chem. Commun. 1974, 1045-1046. ((1) Hornemann, U.; Eggert, J. H.; Honor, D. P. J. Chem. Soc., Chem. Commun. 1980, 11-13. a) Bezanson, G. S.; Vining, L. C. Can. J. Biochem. 1971, 49, 911-918. b) Casati, R.; Beale, J. M.; Floss, H. G. J. Am. Chem. Soc. 1987, 109, 8102-8104. Meier, R. M.; Tamm, C. J. Antibiot. 1992, 45, 400-410. 209 23 24 25 26 27 29 30 31 33 34 35 36 a) Ghisalba, O.; Nuesch, J. J. Antibiot. 1978, 31, 202-214. b) Ghisalba, O.; Fuhrer, H.; Richter, W. J.; Moss, J. J. Antibiot. 1981, 34, 58-63. c) Gygax, D.; Ghisalba, O; Treichler, H; Nuesch, J. J. Antibiot. 1990, 43, 324-326. Hornemann, U.; Kehrer, J. P.; Eggert, J. H. J. Chem. Soc., Chem. Commun. 1974, 1045-1046. (a) Kim, C.-G.; Kirschning, A.; Bergon, P.; Zhou, R; Su, E.; Sauerbrei, B.; Ning, S.; Ahn, Y.; Breuer, M.; Leistner, E.; Floss, H. G. J. Am. Chem. Soc. 1996, 118, 7486- 7491. (b) Kim, C.-G.; Kirschning, A.; Bergon, P.; Ahn, Y.; Wang, J. J.; Shibuya, M.; Floss, H. G. J. Am. Chem. Soc. 1992, 114, 4941-4943. Kim, C.-G.; Yu, T.-W.; Fryhle, C. B.; Handa, S.; Floss, H. G. J. Biol.Chem. 1998, 272, 6030-6040. August, P. R.; tang, L.; Yoon, Y. J.; Ning, S.; Muller, R.; Yu, T. -W.; Taylor, M.; Hoffmann, D.; Kim, C. -G.; Zhang, X.; Hutchinson, C. R.; Floss, H. G. Chem. & Biol. 1998, 5, 69—79. Yu, T.-W.; Muller, R.; Muller, M.; Zhang, X.; Draeger, G.; Kim, C.G.; Leistner, E.; Floss, H. G. J. Biol. Chem. 2001, 276, 12546-12555 Jiao, R.; Liu, C.; Jin, Z.; Zhang, X.; Ni, L.; Lu, Z. Sci. Sin. Ser. B (engl. Ed.) 1984, 27, 380-390. Muller, R.; Floss, H. G. unpublished results. Personal communication with the Floss group at University of Washington. (a) Muller, M.; Floss, H. G. unpublished results. (b) Guo, J.; Frost, J. W. unpublished results. Guo, J.; Frost, J. F. J. Am. Chem. Soc. 2001, 124(4), 528-529. a) Blackmore, P. F.; Williams, J. F.; MacLeod, J. K. FEBS Lett. 1976, 64, 222. b) Duke, C. C.; MacLeod, J. K.; Williams, J. F. Carbohydr. Res. 1981, 95, 1. Guo, J.; Frost, J. F. J. Am. Chem. Soc. 2002, 124(36), 10642-10643. Arakawa, K.; Miiller, R.; Mahmud, T.; Yu, T-W.; Floss, H. G. J. Am. Chem. Soc. 2002, 124(36), 1064410645. 210 37 38 39 41 42 43 45 47 49 50 51 52 a) Umezawa, S.; Umino, K.; Shibahara, S.; Hamasa, M.; Omoto, S. J. Antibiot. 1967, 20, 355. b) Umezawa, S.; Umino, K.; Shibahara, S.; Omoto, 8. Bull. Chem. Soc. Japan 1967, 40, 2419. c) Umezawa, S.; Shibahara, S.; Omoto, S.; Takeuchi, T.; Umezawa, H. J. Antibiot. 1968, 21, 485. Woese, C. R.; Fox, G. E. Proc. Natl. Acad. Sci. USA 1977, 74(11), 5088-5090. Woese, C. R.; Kandler, 0.; Wheelis, M. L. Proc. Natl. Acad. Sci. USA 1990, 87, 4576-4579. Mayr, E. Nature 1990, 348, 491. Margulis, L.; Guerreo, R. New Sci. 1991, 348, 491. Cavalier-Smith, T. Nature 1992, 356, 570. Brown, J. R.; Doolittle, W. F. Microbial. Mol. Biol. Rev. 1997, 61(4), 456-502. Cavalier-Smith, T. J. Syst. Evol. Microbiol. 2002, 52, 7-76. Daniels, L. Zeikus, J. G. J. Bateriol. 1978, 136, 75-84. Stupperich, E.; Fuchs, G. Arch. Microbial. 1984, 139, 8-13. a) Zeikus, J. G.; Fuchs, G.; Kenealy, W.; Thauer, R. K. J. Bacterial. 1977, 132(2), 604—613. b) Fuchs, G.; Stupperich, E. Arch. Microbial. 1978, 121, 121-125. a) Weimer, P. J.; Zeikus, J. G. J. Bacterial. 1979, 137(1), 332-339. b) Ekiel, 1.; Sprott, G. D.; Patel, G. B. J. Bacterial. 1985, 162(3), 905-908. a) Ekiel, 1.; Smith, I. C.; Sprott, G. D. J. Bacteriol. 1983, 156(1), 316-326. b) Ekiel, 1.; Jarrell, K. F.; Sprott, G. D. Eur. J. Biochem. 1985, 149, 437-444. c) Ekiel, I.; Sprott, G. D.; Patel, G. B. J. Bacterial. 1985, 163(3), 905-908. Ekiel, 1.; Jarrell, K. F.; Sprott, G. D. Eur. J. Biochem. 1985, 149, 437-444. Ekiel, 1.; Smith, I. C.; Sprott, G. D. J. Bacterial. 1983, 156(1), 316-326. Zeikus, J. G.; Wolfe, R. S. J. Bacterial. 1972, 109, 707-713. 211 53 54 55 56 57 58 59 60 61 62 63 65 Eisenreich, W.; Schwarzkopf, B.; Bacher, A. J. Biol. Chem. 1991, 266(15), 9622- 9631. Eisenreich, W.; Bacher, A. J. Biol. Chem. 1991, 266(35), 23840-23849. Fuchs, G.; Stupperich, E. Arch. Microbiol. 1980, 127, 267-272. Sprott, G. D.; Ekiel, 1.; Patel, G. B. Appl. Environ. Microbial. 1993, 59(4), 1092- 1098. Choquet, C. G.; Richards, J. C.; Patel, G. B.; Sprott, G. D. Arch. Microbial. 1994, 161, 481-488. Yu, J. P.; Ladapo, J .; Whitman, W. B. J. Bacterial, 1993, 176(2), 325-332. Tumbula, D. L.; Teng, 0.; Bartlett, M. G.; Whitman, W. B. J. Bacterial. 1997, 179(19), 6010—6013. Doong, R. L.; Gander, J. E.; Ganson, R. J.; Jensen, R. A. Physiol. Plant. 1992, 84, 352-360. Fischer, R. S.; Bonner, C. A.; Jensen, R. A. Arch. Microbial. 1993, 160, 440—446. Bult, C. J.; White, 0.; Olsen, G. J.; Zhou, L.; Fleischmann, R. D.; Sutton, G. G.; Blake, J. A.; Fitzgerald, L. M.; Clayton, R. A.; Gocayne, J. D.; Kerlavage, A. R.; Dougherty, B. A.; Tomb, J .-F.; Adams, M. D.; Reich, C. 1.; Overbeek, R.; Kirkness, E. F.; Weinstock, K. J.; Merrick, J. M.; Glodek, A.; Scott, J. L.; Geoghagen, N. S. M.; Weidman, J. F.; Fuhrman, J. L.; Nguyen, D.; Utterback, T. R.; Kelley, J. M.; Pererson, J. M.; Sadow, P. W.; Hanna, M. 0; Cotton, M. D.; Roberts, K. M.; Hurst, M. A.; Kaine, B. P.; Borodovsky, M.; Klenk, H.-P.; Fraser, C. M.; Smith, H. 0.; Woese, C. R.; Venter, J. C. Science 1996, 273, 1058-1073. Higuchi, S.; Kawashima, T.; Suzuki, M. Proc. Japan Acad. Ser. B. 1999, 75, 241- 245. Daugherty, M.; Vonstein, V.; Overbeek, R.; Osterrnan, A. J. Bacterial. 2001, 183(1), 292-300. Woodard, R. W. Biaarg. Chem. 2004, 32, 309-315. White, R. H. Biochemistry 2004, 43, 7618-7627. 212 67 69 70 71 72 73 74 75 76 77 78 John Frost, personal communication Adlersberg, M.; Sprinson, D. B. Biochemistry 1964, 3(12), 1855-1806. (a) Brufani, M.; Fedeli, W.; Giacomello, G.; Vaciago, A. Experientia 1964, 20, 339- 342. (b) Oppolzer, W.; Prelog, V. Helv. Chim. Acta 1973, 56, 2287-2314. (c) Higashide, B.; Asai, M.; Ootsu, K.; Tanida, S.; Kozai, Y.; Hagesawa, T.; Kishi. T.; Sugino, Y.; Yoneda, M. Nature 1977, 270, 712-722. ((1) Asai, M.; Mizuta, E.; Izawa, M.; Haibara, K.; Kishi, T. Tetrahedron 1979, 35, 1079-1085. Webb, J. S.; Cosulich, D. B.; Mowat, J. H.; Patrick, J. B.; Broschard, R. W.; Meyer, W. E.; Williams, R. P.; Wolf, C. F.; Fulmor, W.; Pidacks, C.; Lancaster, J. E. J. Am. Chem. Soc. 1962, 84, 3183-3184. Kim, C.—G.; Kirschning P.; Bergen, P.; Ahn, B. Y.; Wang, J. J.; Shibuya, M.; Floss, H. G. J. Am. Chem. Soc. 1992, 114(12), 4941-4943. (a) Umezawa, S.; Umino, K.; Shibahara, S.; Omoto, S. Bull. Chem. Soc. Japan 1967, 40, 2419-2421. (b) Umezawa, S.; Shibahara, S.; Omoto, S. J. Antibiot. 1968, 21(8), 485-491. (a) Dolak, L. A.; Castle, T. M.; Dietz, A.; Laborde, A. L. J. Antibiot. 1980, 33(8), 900-901. (b) Tsuno, T.; Ikeda, C.; Numata, K.; Tomita, K.; Konishi, M.; Kawaguchi, H. J. Antibiot. 1986, 39, 1001-1003. (c) Fusetani, N.; Ejima, D.; Matsunaga, S.; Hashimoto, K.; Itagaki, K.; Akagi, Y.; Taga, N.; Suzuki, K. Experientia 1987, 43, 464—465. ((1) Milner, J. L.; Silo-Suh, L.; Lee, J. C.; He, H.; Clardy, J.; Handelsman, J. Appl. Environ. Microbial. 1996, 62, 3061-3065. Tercero, J. A.; Espinosa, J. C.; Lacalles, R. A.; Jiménez, A. J. Biol. Chem. 1996, 271(3), 1579-1590. Pietsch, M.; Walter, M.; Buchholz, K. Carb. Res. 1994, 254, 183—194. Drummond, M. Nature 1979, 281(4), 343-347. Bernaerts, M. J .; De Ley, J. Antonie Van Leeuwenkoek, J. Microbial. Serol. 1967, 27, 247-256. a) Fukui, S. Biochem. Biophys. Res. Commun. 1965, 18(2), 186-191. b) Van Beeuman, J.; De Ley, J. Eur. J. Biochem. 1968, 6, 331-343. c) Fukui, S. J. Bacterial. 1969, 97(2), 793-798. (1) Hayano, K.; Fukui, S. J. Bacterial. 1970, 101(1), 692-697. 213 79 80 81 82 83 85 88 89 90 91 92 93 95 Van Beeuman, J.; De Ley, J. Eur. J. Biochem. 1968, 6, 331—343. Hayano, K.; Fukui, S. J. Bacterial. 1970, 101 (1), 692-697. Fukui, S. J. Bacterial. 1969, 97(2), 793-798. Miyairi, A.; Fukui, S. J. Bacterial. 1973, 113(2), 658-665. Fukui, S. Agr. Biol. Chem. 1970, 34(2), 321—324. Chem, C.-K.; Fukui, S. Agr. Biol. Chem. 1974, 38(10), 2039-2040. Fukui, S.; Hayano, K. Agr. Biol. Chem. 1969, 33(7), 1013—1017. Ma, X.; St6ckigt, J. Carb. Res. 2001, 333, 159-163. Rotenberg, S.; Sprinson, D. B. J. Biol. Chem. 1978, 253(7), 2210-2215. Lee, L. G.; Whitesides, G. J. Am. Chem. Soc. 1985, 107(24), 6999. Ahlert, J .; Distler, J.; Mansouri, K.; Piepersberg, W. Arch. Microbial. 1997, 168, 102- 1 13. Breazeale, S. D.; Ribeiro, A. A.; Raetz, C. R. H. J. Biol. Chem. 2003, 278(27), 24731- 24739. Meynial, 1.; Paquet, V.; Combes, D. Anal. Chem. 1995, 67, 1627-1631. Chem, 11.; Yeung, S-M.; Que, N. L. S.; Miiller, T.; Schmidt, R. R.; Liu, H. J. Am. Chem. Soc. 1999, 121, 7166-7167. Unpublished results by Jiantao Guo Unpublished results by Jiantao Guo a) Zeikus, J. G.; Fuchs, G.; Kenealy, W.; Thauer, R. K. J. Bacterial. 1977, 132(2), 604—613. b) Fuchs, G.; Stupperich, E. Arch. Microbial. 1978, 121, 121-125. c) Ekiel, 1.; Smith, I. C.; Sprott, G. D. J. Bacterial. 1983, 156(1), 316—326. (1) Ekiel, 1.; Jarrell, K. F.; Sprott, G. D. Eur. J. Biochem. 1985, 149, 437-444. e) Ekiel, 1.; Sprott, G. D.; Patel, G. B. J. Bacterial. 1985, 163(3), 905-908. 214 97 98 101 102 103 104 l 05 106 107 l 08 109 110 111 a) Liisch, H.; Uzar, H. C. Tetradedran: Asymmetry 2000, 11, 4965-4973. b) Paris, M.; Pothion, C.; Heitz, A.; Martinez, J.; Fehrentz, J.-A. Tetrahedron letters 1998, 39, 1341-1344. c) Roberts, S. J.; Morris, J. C.; Renwick, C. J.; Gerrard, J. A. Biaarg. Med. Chem. Lett. 2003, 13, 265-267. (1) Black, S.; Wright, N. G. J. Biol. Chem. 1955, 213, 39-50. Hegeman, G. D.; Cohen, G. N .; Morgan, R. Methods in Enzymology 1970, 17A, 708- 713. Wong, C. H.; Whitesides, G. M. J. Org. Chem. 1983, 48, 3199-3205. Bubb, W. A.; Kuchel, P. W. J. Biol. Chem. 1992, 267(14), 9713-9717. James, C.; Viola, R. E. Biochemistry 2002, 41, 3720-3725. Burgstahler, A. W.; Wei gel, L. 0.; Shaefer, C. G. Synth. Commun. 1976, 767-768. a) Blanchette, M. A.; Choy, W.; Davis, J.; Essenfeld, A. P.; Roush, W. R.; Sakai, T. Tetrahedron Letters 1984, 25(21), 2183-2186.; b) Ghosh, A. K.; Gong, G. J. Am. Chem. Soc. 2004, 126, 3704—3705. Walsh, P. J .; Sharpless, K. B. Synlett 1993, 605-606. Cox, R.; de Andres-Gomez, A.; Godfrey, C. R. A. Org. Biomal. Chem. 2003, 1, 3171- 3177. Allevi, P.; Cribiu, R.; Anastasia, M. Tetrahedron: Asymmetry 2004, 15, 1355-1358. Miller, J. H. Experiments in Molecular Gentics; Cold Spring Harbor Laboratory: Cold Spring Harbor, NY, 1972. Lancini, G. In Biotechnology; Rehm, H.-J., Reed, 0., Eds.; VCH Verlagsgesellschaft: Weinheim, 1986; Vol. 4, Chapter 14. Guo, J .; Frost, J. W. unpublished results. Bradford, M. M. Anal. Biochem. 1976, 72, 248-254. Singer, T. P. Methods Biochem. Anal. 1974, 22, 123-175. Allen, R. G.; Keogh, B. P.; Tresini, M.; Gerhard, G. S.; Volker, C.; Pignolo, R. J.; Horton, J .; Cristofalo, V. J. J. Biol. Chem. 1997, 272, 24805-24812. 215 ”2 Singer, T. P. Methods Biochem. Anal. 1974,22,123—175. I” Allen, R. G.; Keogh, B. P.; Tresini, M.; Gerhard, G. S.; Volker, C.; Pignolo, R. J.; Horton, J .; Cristofalo, V. J. J. Biol. Chem. 1997, 272, 24805-24812. ”4 Harris, E. L. V.; Angal, S. In Protein Purification Methods: A Practical Apprach; Oxford University Express: Oxford, New York, Tokyo, 1989. “5 Laemmli, U. K. Nature 1970, 227, 680-685. “6 Pasqualucci, C. R.; Vigevani, A.; Radaelli, P.; Gallo, G. G. J. Pharm. Sci. 1970, 59, 685-687. ”7 Rae, C.; Bubb, w. A.; Kuchel, P. w. J. Biol. Chem. 1992, 267(14), 9713—9717. "8 Rae, C.; Bubb, w. A.; Kuchel, P. w. J. Biol. Chem. 1992, 267(14),9713-9717. 216 IIIIIIIIIILIIIIIIIIIIIIIIIIIIIIIIII