 

:V" ‘m . 2.
‘--l" ‘5 “|"

_ .m‘ '
-‘a‘u‘

—;

L.

‘5’

"WELL.

‘ _
n
I: t-

M
(“r-nu v.

“44:33!
“$5,934,,
i ‘ ’ r

lid-7v Ii'
“.34. i
‘6» a
,1"! ~ 39.34.,“
51' ~ I
' )2 £191”.

1 ,.
l
I

55::
i ~‘

I': .;

v A, ‘ I :3 '3‘ I I‘ ~' oi...

i‘::‘¢i§i‘55. a“: ..; r13: "ﬁizwgii’é’ 9‘ ' '“gﬁﬁ-‘ﬁﬁf”;

f: §f3’§;.51i£5g,f‘5§”3*flgg l {Egg hi‘éﬁi' 3f {fit-fig:

Maw-{w- Mi ‘3‘: 9:... :F'z-

WW; 4! g = .‘1 “ ’.- , « ,w’ﬂ'ﬁé ,

. ,3 1 > ,- i:- in;
”Ki! 1'- 33; *3”’§‘"§

. Ii

13:: 5‘”

. tr.
-—-. ,
w}?;;-"o¢ ﬁr:-

.' ﬂu.)
9'3. £3 may“
3

 

:52

IE
I
,2 2
(94' . ' .. '
.f; , . ,5
O

 

THESE

.1 3;)";-

This is to certify that the
dissertation entitled

ENGINEERING INVITRO CELLULAR
MICROENVIRONMENTS USING POLYELECTROLYTE
MULTILAYER FILMS TO CONTROL CELL ADHESION AND
FOR DRUG DELIVERY APPLICATIONS

presented by

SRIVATSAN KIDAMBI

has been accepted towards fulﬁllment
of the requirements for the

Ph.D. degree in Chemical Engineering

 

 

("t/m a 6%» / /¢//4,

Major Profeségﬂs/SigrEtUFe
0 3 / 0 2/ o 3}

 

Date

MSU is an afﬁrmative-action, equal-opportunity employer

o.-.-.-o-o-o-u-o-o-I-u-o-OQI-oCI-I-v-0-o-.---o-u-a-o-o-o--q-.- .n-o-n-I-l-‘-I-I-'-O-I-a-l--I-I-I- ---—--o--

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

6/07 p:/ClRC/DateDue.indd-p.1

ENGINEERING INVITRO CELLULAR MICROENVIRONMENT USING
POLYELECTROLYTE MULTILAYER FILMS TO CONTROL CELL
ADHESION AND FOR DRUG DELIVERY APPLICATIONS
By

SRIVATSAN KIDAMBI

A DISSERTATION

Submitted to
Michigan State University
in partial fulﬁllment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY
Department of Chemical Engineering and Materials Science

2007

ABSTRACT
ENGINEERING INVITRO CELLULAR MICROENVIRONMENT USING
POLYELECTROLYTE MULTILAYER FILMS TO CONTROL CELL ADHESION
AND FOR DRUG DELIVERY APPLICATIONS
By

SRIVATSAN KIDAMBI

Over the past decades, the development of new methods for fabricating thin ﬁhns that
provide precise control of the three-dimensional topography and cell adhesion has
generated lots of interest. These ﬁlms could lead to signiﬁcant advances in the ﬁelds of
tissue engineering, drug delivery and biosensors which have become increasingly
germane areas of research in the ﬁeld of chemical engineering. The ionic layer-by-layer
(LbL) assembly technique called “Polyelectrolyte Multilayers (PEMs)”, introduced by
Decher in 1991, has emerged as a versatile and inexpensive method of constructing
polymeric thin ﬁlms, with nanometer—scale control of ionized species. PEMS have long
been utilized in such applications as sensors, eletrochromics, and nanomechanical thin
ﬁlms but recently they have also been shown to be excellent candidates for biomaterial
applications. In this thesis, we engineered these highly customizable PEM thin ﬁlms to
engineer in vitro cellular microenvironments to control cell adhesion and for drug
delivery applications.

PEM ﬁlms were engineered to control the adhesion of primary hepatocytes and
primary neurons without the aid of adhesive proteins/ligands. We capitalized upon the
differential cell attachment and spreading of primary hepatocytes and neurons on

poly(diallyldimethylammoniumchloride) (PDAC) and sulfonated polystyrene (SPS)

surfaces to make patterned co-cultures of primary hepatocytes/ﬁbroblasts and primary
neurons /astrocytes on the PEM surfaces. In addition, we developed self-assembled
monolayer (SAM) patterns of m-d-poly(ethylene glycol) (m-dPEG) acid molecules onto
PEMs. The created m-dPEG acid monolayer patterns on PEMS acted as resistive
templates, and thus prevented mnher deposits of consecutive poly(anion)/poly(cation)
pairs of charged particles and resulted in the formation of three-dimensional (3-D)
patterned PEM ﬁlms or selective particle depositions atop the original multilayer thin
ﬁlms. These new patterned and structured surfaces have potential applications in
microelectronic devices and electro-optical and biochemical sensors. The PEG patterns
developed are tunable at certain salt conditions and be removed from the PEM surface
without affecting the PEM layers underneath the patterns. These removable surfaces
provide an alternative method to form patterns of multiple particles, proteins and cells.
This new approach provides an environmentally ﬁ'iendly and biocompatible route to
designing versatile salt tunable surfaces. Finally, we illustrate the Use of PEM ﬁlms to

engineer aptamer and siRNA based drug delivery systems.

C0pyﬁght by
SRIVATSAN KIDAMBI

2007

TO MY FAMILY

ACKNOWLEDGMENTS

I would like to express my deepest appreciation to my advisors Prof. Kris Chan
and Prof. Ilsoon Lee, for their insight, guidance and invaluable assistance, without which
this thesis would not have been possible. Co-advised projects can easily become
nightmares, bogged down in conﬂicts and with the student struggling in the middle. Kris
and Ilsoon have a wonderful working relationship, which allowed me to capitalize
immensely on the synergies between the two research programs. I appreciate the freedom
and space they gave me and their tolerance of my independent streak in pursuing the
thesis both during times when the research was in its difﬁcult stages and when it was
sailing smoothly.

I would also like to thank the members of my Ph.D. committee, Dr. Greg Baker
and Dr. Robert Ofoli, in particular for Dr.Ofoli’s always insightful comments when I see
him in the department hall way and Greg’s critical reading of my theSis.

I am also thankful to my group members in the Chan and Lee groups whom I
learned a great deal from and who made coming to lab worthwhile. From the Chan group:
Shireesh, Zheng, Sachin, Lufang, Xuerei, Linxia, Yifei and Sumit; From the Lee group:
Neeraj, Troy and Devesh; for making my Ph.D. a pleasant experience. In particular, I
thank Shireesh for helping me get started with the assays and cell experiments, Lufang
and Yifei for the numerous primary hepatocyte isolations, Deebika for the primary
neurons and astrocytes isolation and also for feeding my cells when I was lazy.

Particularly due to this thesis’s interdisciplinary character, I also beneﬁted greatly
from collaborative environment. Sharing lab with Pat’s and Dr. Worden’s group made it

interesting work in the lab day in and day out without bothering about the numerous

vi

failed experiments. Special mentions deﬁnitely goes to Brian “The” Hassler, Aaron aka
michsweetswinger, Angelines aka lab mamasita, Joe the big guy, Hemant aka Jay.
Thanks to JoAnne, Jennifer, Jen, Nancy, Eunice for their administrative support and
putting up with me whenever I walked over to the ofﬁce when I felt like doing nothing
but slack off.

It would be an understatement to say that my stay in MSU has been memorable
experience that it has because of my friends; Kundi, Bil, Skanth, Manjai, Sharad, Tutu,
Maddy, Geeta, Charles, Carina, Johnny, Krishnan, Gaurav, Srini, Sunder, et al. I owe a
good many lunch treats, numerous time pass chit chats to Tutu, Shireesh and Sharad; To
Sridhar for endless discussions of Seinfeld and stupid Vivek comedy, trips to the Diary
Store, and many other things small and large, that contributed to my Ph.D., often in
unpredictable ways.

And to my family I owe the maximum gratitude, for years of their unﬂinching
support, patience and understanding. They provided me with the impetus to ﬁnish with
their generous encouragement (“when are you going to ﬁnish?”; “will you ﬁnish before
your sister (younger)?”). To all of them, Amma, Appa, Srikanth (Annathey), Manni,
Srividhya (Akka), Patti, Mamas, Mamis, all the kuttis and many many others I owe my
heartfelt thanks for always being there for me even when I was making stupid decisions
(like turning down job offers). Eventually I would like to thank Manjai one more time

from whose dissertation portions of this acknowledgement have been shamelessly lifted.

vii

TABLE OF CONTENTS

 

 

 

 

 

 

 

 

 

 

 

LIST OF TABLES- - -- -- ........... -- - ........................... - xi
LIST OF FIGURES - - - - _- -- ........... - - - _ - xii
LIST OF ACRONYMS -- -- - xvii
CHAPTER 1 INTRODUCTION - ......... l
1.1 OVERVIEW AND SIGNIFICANCE OF PROBLEM
1.2 BACKGROUND - - - - -- 2
1.2.] Need for New Biomaterials to Control Cell Adhesion ...................................... 2
1.2.2 Polyelectrolyte Multilayers (PEMs) .................................................................. 3
1.2.3 Micropatteming and Cell Culture ...................................................................... 5
1.2.4 Aptamers and Short Interfering RNAs (siRNAs) .............................................. 6
1.3 THESIS OUTLINE .............. - _- - - - _ 8
CHAPTER 2 CONTROLLING PRIMARY CELL (HEPATOCYTES/NEURONS)
ADHESION ON POLYELECTROLYTE MULTILAYER FILMS 10
2.1 INTRODUCTION - - _ - 10
2.2 METHODS AND MATERIALS ..... - - - ....................... 14
2.2.1 Materials .......................................................................................................... 14
2.2.2 Preparation of Polyelectrolyte Multilayers ...................................................... 15
2.2.3 Preparation ofPDMS Stamps ............................ 15
2.2.4 Animals and Hepatocyte Isolation ................................................................... 16
2.2.5 Hepatocyte Culture System .............................................................................. 16
2.2.6 Primary Neuron Culture System ...................................................................... 17
2.2.7 Biochemical Assays ......................................................................................... 19
2.2.8 Immunostaining of Primary Neurons ............................................................... 19
2.3 RESULTS AND DISCUSSION - - - . -- - _ 19
2.3.1 Primary Hepatocyte Adhesion on PEMs ......................................................... 20
2.3.2 Primary Neuron Adhesion on PEMs ................................................................ 26
2.3.3 Fabrication of PEM Coated PDMS Substrate .................................................. 28
2.3.4 Primary Hepatocyte Adhesion on PEM Coated PDMS Surfaces .................... 30
2.3.5 Fibroblast Adhesion on PEM Coated PDMS Surfaces .................................... 32
2.3.6 Potential Explanation of the Observed Effect of Topography on Cell
Attachment ................................................................................................................ 35
2.4 CONCLUSIONS ...... - - -_ _ ,_ -- - ............. 37

 

CHAPTER 3 PATTERNED CO-CULTURE OF PRIMARY
HEPATOCYTES/FIBROBLASTS AND PRIMARY NEURONS/ASTROCYTES
USING PEM FILMS -- -- -- _ -- 39

3.1 INTRODUCTION - - _ 39

 

 

viii

3.2 METHODS AND MATERIALS - 42

 

 

 

3.2.1 Materials .......................................................................................................... 42
3.2.2 Preparation of Polyelectrolyte Multilayers ...................................................... 43
3. 2. 3 Primary Hepatocyte/Fibroblast Co-Culture on PEM Surfaces ........................ 43
3. 2. 4 Primary Neuron/Astrocyte Co- Culture on PEM Surfaces ....................... 44
3.2.5 Cell ﬂuorescent staining .................................................................................. 44
3. 2. 6 Irnmunostaining of Primary Neurons and Astrocytes ...................................... 45
3.2.7 Biochemical Assays ......................................................................................... 45
3.2.8 Determination of the number of cells on the projected area ............................ 46
3.2.9 Reactive Oxygen Species (ROS) Studies ........................................................ 46
3. 3 RESULTS .......... - 47
3.3.1 Patterned Culture of Primary Hepatocytes on PEMs ....................................... 47
3. 3. 2 Patterned Co- Cultures of Primary Hepatocytes with Fibroblasts .................... 49
3.3.3 Function of Primary Hepatocytes in Patterned Co-Cultures ............................ 50
3.3.4 Patterned Co-Cultures of Primary Neurons with Astrocytes ........................... 52
3.3.5 Reactive Oxygen Species (ROS) Studies on Co-culture Systems ................... 54
3. 4 DISCUSSIONS 57
3. 4.1 Advantages of our Culture System over other Hepatocyte Culture Systems. 57
3. 4. 2 Advantages of our Culture System over other Neuron Culture Systems ......... 58

 

3.5 CONCLUSIONS - 59

CHAPTER 4 SELECTIVE DEPOSITIONS ON POLYELECLECTROLYTE
MULTILAYER FILMS: SAMS OF m-dPEG ACID AS MOLECULAR

 

 

 

 

TEMPLATE - - 60
4.1. INTRODUCTION - - - - - - - ' - -- 60
4.2 METHODS AND MATERIALS - - - - -- 64

4.2.1 Materials .......................................................................................................... 64
4.2.2 Preparation of Polyelectrolyte Multilayer Thin Films ..................................... 65
4.2.3 Preparation of PDMS Stamps .......................................................................... 66
4.2.4 Stamping of m-dPEG acid ............................................................................... 66
4.2.5 Characterization ............................................................................................... 67
4.3 RESULTS AND DISCUSSION - - 68
4.3.1 Patterning m-dPEG SAMS on Polyelectrolyte Multilayers ............................. 68
4.4 CONCLUSIONS - ........... - - 74

 

CHAPTER 5 SALT TUNABLE m-dPEG ACID PATTERNS ON
POLYELECTROLYTE MULTILAYERS: TEMPLATES FOR DIRECTED

 

 

 

DEPOSITION OF MACROMOLECULES- - - - -- -- - - - ..... 76
5.1 INTRODUCTION--- - ------ - - 76
5.2 METHODS AND MATERIALS -- - - - - 79

5.2.1 Materials .......................................................................................................... 79
5.2.2 Preparation of Polyelectrolyte Multilayers ...................................................... 80
5.2.3 Preparation of PDMS Stamps .......................................................................... 81

ix

5.2.4 Stamping of m-dPEG Acid .............................................................................. 81

 

 

 

 

 

 

 

 

 

 

 

 

5.2.5 Characterization ............................................................................................... 81
5.2.6 Ellrpsometry ........................................ 82
5.3 RESULTS AND DISCUSSION -- - - - - 82
5.3.1. Directed Assembly of Macromolecules .............. ~ ............................................ 82
5.3.2 Directed Assembly of Cells ............................................................................. 85
5.3.3 Salt tunable PEG SAMS ................................................................................... 85
5.3.4 Patterned Array of Multiple Particles on PEG Patterns ................................... 87
5.3.5 Patterned Array of Multiple Proteins on PEG Patterns ................................... 88
5.3.6 Patterned Array of Multiple Cells on PEG Patterns ........................................ 90
5.4 CONCLUSIONS 92
CHAPTER 6 APTAMER AND siRNA BASED DRUG DELIVERY SYSTEM
USING POLYELECTROLYTE MULTILAYERS 93
6.1 INTRODUCTION 93
6.2 METHODS AND MATERIALS - - 96
6.2.1 Materials .......................................................................................................... 96
6.2.2 Preparation of Polyelectrolyte Multilayers ...................................................... 97
6.2.3 Preparation of PDMS Stamps .......................................................................... 98
6.2.4 Cell Culture ...................................................................................................... 99
6.2.5 Characterization ............................................................................................. 100
6.2.6 UV-Vis Spectroscopy and Ellispometry Of PEM Films ................................ 101
6.3 Results and Discussion 101
6.3.1 Surface Immobilization of Nuclei Acids on PEMs .............. . .......................... 102
6.3.2 Activity of Aptamer in PEM Film ................................................................. 102
6.3.3 Monitoring of PEM Deposition Process ........................................................ 104
6.3.4 Deconstruction of the PEM Films .................................................................. 107
6.3.5 Cell Uptake of Released Nucleic Acids from PEM Films ............................. 109
6.4 Conclusions 110
CHAPTER 7 CONCLUSIONS--- - -- -- -- - 112
APPENDIX 1: Deﬁnitions - - 115
A. SELEX 115
B. Advantages of Aptamers- - 116
LIST OF PUBLICATIONS - 118
BIBLIOGRAPHY - 120

 

LIST OF TABLES

Table 2.1 Primary hepatocyte cell numbers on the projected area on the different surfaces
used in the study after 1 day, 3 days and 5 days. Student’s t-test was used for analyzing
the differences between the cell adhesion on various surfaces (’ p<0.05 compared with
primary hepatocyte adhesion on collagen coated TCPS control) ............................ 22

Table 2.2 Primary neurons and astrocytes cell numbers on the projected area on the
different surfaces used in the study after 7 days in culture. Student’s t-test was used for
analyzing the differences between the cell number on the various surfaces (a p<0.05
compared with cell adhesion on poly(lysine) (PLL) coated TCPS control) ............... 27

Table 2.3 Dimensions of the different surface topographies used in the study ............ 28

Table 2.4 Cell numbers on the projected area on the different surfaces used in the study
after 8h, 24h and 3 days. Student’s t-test was used for analyzing the differences between

the cell adhesion on various surfaces (a'c p<0.05 compared with primary hepatocyte
adhesion on TCPS, I” p<0.05 compared with ﬁbroblast adhesion on TCPS) ............. 31

Table 3.1 Comparison of maximum achievable levels of hepatic-speciﬁc function (urea

and albumin secreted) in various hepatocyte culture systems. Urea and albumin secreted
per 1 x 106 cells were approximated from experimental data and available literature....52

xi

LIST OF FIGURES

Figure 2.1. (A) Schematic diagram illustrates the method for treating the PDMS surfaces
with PEMs and culturing cells on the surfaces with different topographies. PEMs
(PDAC/SPS)“; are built on top of the PDMS surface and cells are then seeded. (B)
Illustration of the overlap of a cell and a ﬂat area between the circle patterns. The
diameter ((1) changes while the center to center distance (a) remains constant for the
features: a=18um. Region 1 represents the area between any six adjacent patterns
(features). Region 2 represents a cell attached between the patterns. Region 3 is the cell
nucleus ................................................................................................. 12

Figure 2.2. Optical micrographs of primary rat hepatocytes after 3 days for in culture on
PEM surfaces. A) (PDAC/SPS)Io.5 B) (PDAC/SPS)Io C) TCPS-Control D) PDAC
patterns on SPS. The magniﬁcation is 10X ...................................................... 21

Figure 2.3. Structure formulae of the sulfonic acid polymers ................................ 22

Figure 2.4. Optical micrographs of primary rat hepatocytes after 3 days in culture on
PEM surfaces. A) (LPEI/SPS)10.5 B) (SPS/LPEDIO C) (BPEI/SPS)10.5 D)
(SPS/BPEDIo,5 ....................................................................................... 23

Figure 2.5. Metabolic function of primary hepatocytes on PEM surfaces. A) Total urea
production per day. B) Total albumin secretion per day (n=6) ............................... 25

Figure 2.6. Phase contrast images of primary neurons and astrocytes aﬁer 7 days in
culture on PEM surfaces. Primary neurons on (A) (PDAC/SPS)10,5 - PDAC topmost
surface (B) (PDAC/SPS)10 - SPS topmost surface (C) poly(lysine) (PLL)-control
surfaces. Astrocytes on (D) (PDAC/SPS)10,5 - PDAC topmost surface (E) (PDAC/SPS)”,
- SPS topmost surface (F) poly(lysine)-control surfaces. (Scale bars- A-C: 50pm, D-F:
250nm) ............................................................................................... 27

Figure 2.7. Phase contrast microscope images of circle patterns on PDMS surfaces of
varying diameter (A) P1, diameter = 1.25pm, (B) P2, diameter = 2.0um, (C) P3, diameter
= 3.0um, (D) P4, diameter = 4.0um, (E) P5, diameter = 5.0um, (F) P6, diameter = 6.0p.m,
(G) P7, diameter = 7.0um, (H) P8, diameter = 8.0um, (I) P9, diameter = 9.0pm. All the
patterns have constant pitch distance (center to center) of 18pm and height of 2.5Itm
(Scale bar, 50 pm) .................................................................................. 29

Figure 2.8. Optical micrographs of primary rat hepatocytes after 3 days in culture on
various surfaces: (A) TCPS (B) PEM coated smooth PDMS surfaces (C) P1, (D) P5 (E)
P9 (Scale bar, 50 pm) .............................................................................. 30

Figure 2.9. Fluorescence micrographs of focal adhesion and actin cytoskeleton in
ﬁbroblasts revealed with triple labeling using TRITC-conjugated Phalloidin (staining F -
actin), anti-Vinculin (focal contacts) and DAPI (nuclei) after 3 days in culture on various

xii

surfaces: (A) TCPS (B) PEM coated smooth PDMS surfaces (C) P1, (D) P5 (E) P9 (Scale
bar, 50 um) .......................................................................................... 33

Figure 2.10. Proliferation of ﬁbroblasts on various surfaces at 8h, 24h and 72h after cell
seeding. Data represents mean :|: SE. of three independent experiments ("‘ p<0.05
compared with control TCPS surfaces) .......................................................... 34

Figure 3.1. Schematic diagram illustrates the approach to patterning co-culture of
primary cells on PEM surfaces. First, (PDAC/SPS)10 PEMS were built on top of the
TCPS surfaces with SPS as the topmost surface. Second, patterns of PDAC were formed
on PEM surfaces by microcontact printing (uCP) PDAC onto the PEM surfaces. Third,
patterns of primary hepatocytes/neurons were formed by capitalizing on the preferential
attachment of primary cells to SPS surfaces. Fourth, since ﬁbroblast/astrocytes, unlike the
primary cells, attached to both surfaces, astrocytes were subsequently seeded onto the
patterns of primary cells and attached onto the open PDAC regions and resulted in
patterned co-cultures of primary hepatocytes/ﬁbroblast or primary
neurons/astrocytes ................................................................................... 41

Figure 3.2. Phase contrast microscope images of primary hepatocyte cells seeded at
0.5x106 cells/ml on days 1 and 5 post seeding on patterned PEM surfaces. (A) and (B)
primary hepatocytes on PDAC patterns on days 1 and 5, respectively. (C) and (D)
primary hepatocytes on SPS patterns on days 1 and 5, respectively. PDMS stamp with
IOOOum square patterns separated by 250nm width were used. (Scale bar, 100

um) .................................................................................................... 48

Figure 3.3. Patterned co-cultures of primary hepatocytes with ﬁbroblasts. (A) phase
contrast and (B) ﬂuorescent images of patterned primary hepatocytes (red) on PDAC
patterns on day 1, phase contrast image of co-culture of primary hepatocytes with
ﬁbroblasts on (C) day 6 (D) day 19. PDMS stamp with 250nm square patterns separated
by 250nm width were used. (Scale bar, 100 um) ............................................... 49

Figure 3.4. Liver-speciﬁc function of primary hepatocytes on PEM surfaces. (A) Urea
synthesis of patterned hepatocytes and patterned co-cultures. (B) Albumin synthesis of
patterned hepatocytes and patterned co-cultures (n=6). Data represents mean :1: SE. of six
independent experiments. (* p<0.05 compared with patterned single hepatocyte
culture) ................................................................................................ 51

Figure 3.5. Fluorescent images of primary neurons and astrocytes co-culture on SPS
surfaces (A) Random neuron monocultures (green) after 7 days in culture, (B) Random
co-culture of neurons (green) and astrocytes (red) after seeding astrocytes. (C) Patterned
primary neurons on SPS patterns after 7 days in culture (D) Patterned co-culture of
neurons (green) and astrocytes (red) after seeding astrocytes (Scale bars- 200

pm) ..................................................................................................... 53

xiii

Figure 3.6. Intracellular accumulation of ROS in neurons. Astrocytes were treated for
12 h with (A) 5% BSA (control) and (B) 0.2 mM of PA, followed by transfer of the
astrocytes-conditioned media to neurons for 24 h treatment. Patterned neuron-astrocytes
co-culture were treated for 12h with (C) 5% BSA (control) and (D) 0.2 mM of palmitate
(PA). (Scale bars— A-C: 50pm, D: 100nm) ...................................................... 54

Figure 3.7. Quantiﬁcation of intracellular accumulation of ROS in neurons. Data
represents mean i SE. of three independent experiments (* p<0.05 compared with 12h

treatment of monocultures of neurons) ........................................................... 56
Figure 4.1. Chemical structure of PEG acid molecule (m-dPEG acid) ..................... 61
Figure 4.2. An illustration of patterned SAMS on PEM ...................................... 62

Figure 4.3. Diagram illustrating the stamping process of m-dPEG acid on a PDAC/SPS
multilayer platform ................................................................................. 63

Figure 4.4. Defects occurring under non-optimized stamping conditions: (a) Rimming
occurs in areas of the stamp that were insufﬁciently inked (bare regions were also
observed). (b) Streaking due to uneven application of the m-dPEG acid ink solution on
the PDMS surface. All the images are ﬂuorescence images and the bars represent

20pm .................................................................................................. 69

Figure 4.5. Effect of pH of m-dPEG acid “ink” on the patterns on top of (PDAC/SPS)10_5
(a) pH=6.5; (b) pH=4.5; (c) pH=3.5; (d) pH=2.0. The green regions are the PEM ﬁlms
and the black regions are the m-dPEG acid surface. The m-dPEG acid ink solution was
evaluated at pH of 2.0, 3.5, 4.5, and 6.5. When the pH is less than the pKa of the
molecule (4.27:0.20), the acid group does not completely ionize leading to incomplete
transfer of the patterns onto the multilayer ﬁlms when compared to solutions with pH
greater than the pKa value. At pH of 4.5 and 6.5, uniform patterns are obtained due to the
complete ionization of m-dPEG acid, resulting in stronger electrostatic attraction between
the PDAC layer and the m-dPEG acid molecule. All the images are ﬂuorescence images
and the bars represent 20pm ....................................................................... 71

Figure 4.6. Optical microscope Image of the m-dPEG acid patterns and dark ﬁeld and
ﬂuorescent images of complex microstructures built atop the m-dPEG acid patterns (a)
m-dPEG acid was stamped on (PDAC/SPS)10,5 as a resisting pattern using a blank stamp
and carboxylated polystyrene beads (D=4.1 pm) were deposited on the outside regions
of the m-dPEG self-assembled monolayer patterned surfaces. The leﬁ region, where there
are no colloidal particles, is the m-dPEG acid region while the right region with the
colloidal particles is the PEM region (b) Dark ﬁeld optical images of complex
microstructures formed by building PDAC/SPS atop the PEG patterns. The white regions
are the PEM ﬁlms and the black regions are the m-dPEG acid surface ..................... 72

xiv

Figure 4.7. AFM images and topography of complex microstructures with different
number of bilayers of PDAC/SPS built atop the m-dPEG acid patterns. (a) 10 bilayers
(b) 20 bilayers and (c) 40 bilayers ................................................................ 74

Figure 5.1. Diagram Illustrating the Formation of Salt Tunable m-dPEG Acid SAMS on a
PDAC/SPS Multilayer Platform Scheme (A) PEMs (PDAC/SPS)10,5 build on top of the
substrates (B) Patterned PEG SAMS on PEMs (C) Directed assembly of molecules due to
the presence of resistive PEG SAMS (D) PEG SAMS are removed by treating it with salt
giving rise to new active regions (E) The new active regions are ﬁlled with new set of
molecules. The chemical structure of m-dPEG acid molecule ................................ 78

Figure 5.2. Optical microscope images of directed deposition of macromolecules on PEG
patterns (A) 0.5um colloid particles (brown lines). (B) Alexa Fluoro tagged sADH (C)
Carboxyﬂuorescein (D) FITC tagged nucleic acid The dark lines represent the m-dPEG
acid regions .......................................................................................... 83

Figure 5.3. Optical microscope images of directed deposition of cells on PEG patterns
(A) primary hepatocytes (B) ﬁbroblast (C) primary neurons ................................. 84

Figure 5.4. Fluorescent Images of PEG patterns (A) before and (B) after salt treatment
(C) Ellipsometric data on the PEG patterns before and after salt treatment ................. 86

Figure 5.5. Phase constrast images of colloidal particles on PEG patterns before and after
salt treatment (A) particles (D=0.5 pm) on the m-dPEG acid patterns before salt
treatment (B) particles (D=0.2 urn) added onto surface A after salt treatment ............. 88

Figure 5.6. Fluorescent images of sADH protein attachment on PEG patterns before and
after salt treatment (A,B) sADH tagged with Alexa-Fluoro on the m-dPEG acid patterns
before salt treatment (C,D) sADH tagged with FITC added onto surface A after salt
treatment. A, C are pictures taken using the red channel while B, D are taken using the
green channel ........................................................................................ 89

Figure 5.7. Optical microscope images of HeLa cells on PEG patterns before and after
salt treatment. (A) HeLa cells labeled red on the m-dPEG acid patterns before salt
treatment (B) second batch of HeLa cells were seeded onto surface A after salt
treatment ............................................................................................. 91

Figure 6.1 Scheme of the DNA oligonucleotides and the presumed form of the G-quartet
structure. (A) 15mer oligonucleotide of DNA aptamer for thrombin. (B) aptamer for
HA ..................................................................................................... 96

Figure 6.2. Scheme for making nucleic acid patterns on PEM surfaces (A) PEMs are

built atop the substrate (B) Nucleic acids attached onto the PEM ﬁlms via electrostatic
interaction (C) Cells attached ﬂuoresce due to uptake of the nucleic acid ................. 101

XV

Figure 6.3. Fluorescent images of patterned F ITC labeled nucleic acids on PEM surfaces
(A) FITC tagged HA aptamer patterns and (B) FITC tagged siRNA patterns on
(PEI/SPS)10.5 ....................................................................................... 102

Figure 6.4. Fluorescent images of aptamer immobilized on PEM ﬁhns (A) Scheme of the
aptamer patterns on the PEM ﬁlms. Circle represents HA aptamer and triangles

represents thrombin aptamer (B) FITC tagged thrombin and (C) FITC tagged HA added
on top of the aptamer patterns ................................................................... 103

Figure 6.5 (A) UV-absorption spectra of (PLL/thrombin aptamer) multilayer coatings,
and (B) plots of absorbance at 260nm. The UV-absorption spectra were monitored using
quartz substrates after the deposition of 1-10 bilayers ........................................ 104

Figure 6.6 (A) Plots of UV-Vis absorbance at 260nm of (PLL/HA aptamer) multilayer
coatings. The UV-absorption spectra were monitored using quartz substrates after the
deposition of 1-10 bilayers The thickness of multilayered ﬁlms increased as a function of
number of bilayers as measured by ellipsometry. Values are given as mean d: standard
deviation (n=3) ...................................................................................... 106

Figure 6.7 The schematic construction and deconstruction of PLL/DNA PEM ﬁlms via
layer-by—layer as aptamer/siRNA delivery system. (A) Construction of the ﬁlms by layer-
by-layer deposition of PLL and nucleic acid, and (B) deconstruction of the ﬁlms ....... 107

Figure 6.8 The thickness of multilayered ﬁlms decreased as a ﬁrnction of degradation
time. Values are given as mean 3: standard deviation (n=3) ................................. 108

Figure 6.9. Fluorescent images of released FITC tagged HA aptamer binding onto
patterns of (HA) and (B) thrombin .............................................................. 109

Figure 6.10. In vitro ﬂuroescence microscope images of cells on PEM surfaces with
immobilized ﬂuroescent oligos. Leﬁ panels show the ﬂuorescent images and the rigth
panels show the merged image of phases contrast and ﬂuorescent images of (A,B)
ﬁbroblast and (C,D) primary hepatocytes ...................................................... 110

xvi

LIST OF ACRONYMS

CLSM: Confocal Laser Scanning Microscopy
DMEM: Dulbecco’s Modiﬁed Eagle Medium
DNA: Deoxyribonucleic acid

LbL: Layer-by-Layer

PDAC: Poly(diallyldimethylammoniumchloride)
PDMS: Poly(dimethylsiloxane)

PEG: Poly(ethylene glycol)

PEI: Poly(ethyleneimine)

PEM: Polyelectrolyte Multilayers

PLL: Poly(L-lysine)

RNA: Ribonucleic acid

SAMs: Self assembled Monolayers

SELEX: Systematic Evolution of Ligands by Exponential Ampliﬁcation
siRNA: Short Interfering Ribonucleic Acids
SPS: Poly(sodium 4-styrenesulfonate)

TCPS: Tissue culture polystyrene

XPS: X-ray Photoelectron Spectroscopy

xvii

CHAPTER 1 INTRODUCTION

1.1 OVERVIEW AND SIGNIFICANCE OF PROBLEM

The ability to engineer the interactions of cells with surfaces is an important albeit
demanding task in medicine and biotechnology. Proteins and cells generally attach
randomly onto medical implant surfaces, which may ultimately lead to undesirable
ﬁbrous encapsulation, detrimental clinical complications, an increased risk of infection,
and poor device performance. Consequently, controlled attachment may be achieved by
generating so-called bioinert materials that ﬁrst reduce any nonspeciﬁc physiological
responses and then creating a biofunctional surface by reintroducing the attachment of
only desired cells. This is achieved in a predictable fashion by using speciﬁc cell
signaling molecules or adhesion ligands, often presented in precisely engineered
geometries. Polymeric or oligomeric ethylene glycol (PEO, PEG, or o-EG) is often used
as the bioinert background material for such approaches." 2 Typically, self-assembled
monolayers (SAMS), chemical grafting and polymerization methods have been employed
to present these resistant materials onto a desired surface.3’ 4 However, potential problems
with incomplete, nonuniform surface coverage, multiple synthetic steps and the
restriction of SAMS to silicon or gold substrates greatly limit the use of these techniques
to create bioinert coatings.

The ability to engineer surface properties such as hydrophobicity, charge, and
adhesion at the micrometer scale are critical to the success of emerging technologies
(e.g., bio-sensors, optical technologies and tissue engineering). SAMS have been

extensively used to modify and control properties of gold and silicon surfaces.S Patterned

alkanethiol SAM surfaces have been created using microcontact printing6 and UV
photopatteming techniques,7 however, the intricacy of surface patterns that can be created
with established approaches are limited. Methods to control both the reactivity and
surface properties after self-assembly are required to create more complex patterned
surfaces. Existing techniques to control the reversibility and reactivity of the surfaces
include SOphisticated methods, such as, light and UV-induced, and electrochemical
surface modiﬁcations.8'10 These methods are not compatible when extended to biological
systems involving cells and also tend to affect the morphology and properties of the
surfaces underneath the SAMS. Thus, there is a need for a novel surface tuning procedure
which is biocompatible and does not affect the biological systems on the surface.

In drug delivery applications, there is a need for the ability to deliver multiple
biomolecules, e. g., proteins, genes, antibody, complement or drugs, to a targeted site of
interest. Many delivery systems typically deliver one type of biomolecule at a time, e.g.,
one protein or one gene. For example, cellular processes such as opSinization, coating of
a bacterium or cell with antibody and/or complement that leads to enhanced
phagocytosis, require multiple complements to be present in order for phagocytosis to

occur.

1.2 BACKGROUND

1.2.1 Need for New Biomaterials to Control Cell Adhesion

Advances in biotechnology Often require new materials to help elucidate complex
biological phenomena and to develop novel biomedical tools and devices. Since most

biological processes are controlled at the molecular level, materials that can be

manipulated at the molecular level are ideally suited. Therefore, control of surface and
interface properties are particularly important characteristics for bioactive or
bioresponsive materials. The presence of micro- or nanostructures on a surface permits
the manipulation of cell-substrate and cell-cell interactions to better control cellular
function and behavior. Typically, proteins and cells randomly attach onto medical
implant surfaces, which may ultimately lead to undesirable effects and poor device
performance)" ‘2 Consequently, controlling the surface activity by ﬁrst generating
bioinert surfaces reduces any nonspeciﬁc physiological responses and then reintroducing
the attachment of only desired cells in a predictable fashion by using speciﬁc cell
signaling molecules or adhesion ligandsl3 would eliminate undesired, random effects.
There is an increasing interest in developing new coatings to improve
biocompatibility and to resist or enhance cellular adhesion by mimicking extracellular
matrix components. The fabrication of ultrathin polymer ﬁlms to improve surface
characteristics is important to various scientiﬁc and biomedical applications. These
surfaces are typically exposed to varying environments. The study of surfaces and
materials for the purpose of growing cells is important in the ﬁeld of tissue engineering.
Protein adsorption and cellular adhesion are affected by different parameters, such as
hydrophobicity and hydrophilicity, surface charge, roughness, and ﬁ'ee energy. Chemical
modiﬁcation of biomaterial surfaces poses a major challenge in medical applications,

such as implant and tissue engineering.

1.2.2 Polyelectrolyte Multilayers (PEMs)

PEMs have received much attention recently as a model system for biological

applications such as biomaterials for engineering tissue constructs as well as potential

drug carriers. These multilayers can be easily constructed through layer-by-layer (LbL)
assembly, in which a substrate is alternately dipped in solutions of polycations and
polyanions. Such an approach offers unprecedented nanoscale control over the thin ﬁlm
architecture and properties, including ﬁhn thickness, composition, conformation, degree
of interchain ionic bonding, roughness, and wettability. The resulting ﬁlms can conform
to more easily coat substrate materials of any type, size, or shape (including implants
with complex geometries and textures, e.g., stents and crimped blood vessel prostheses).
Furthermore, a variety of materials, including synthetic polyions, biopolymers such as
deoxyribonucleic acid (DNA) and enzymes, viruses, dendrimers, colloids, inorganic
particles, and dyes, may be readily incorporated into the multilayers.

During the LbL assembly, functional third-party molecules can be embedded into
the multilayers. The multilayer construct can be designed such that the incorporated
functional molecules are either permanently embedded (e.g., for sensor or electrochromic
application) or gradually released via diffusion through the ﬁlms or by degradation of the
ﬁlm itself. Both scenarios can be used to develop novel drug delivery systems. A major
advantage of LbL assemblies is that these multilayers can be deposited on surfaces of
virtually any geometry, thus one can easily functionalize medical appliances, such as
stents, sutures, and wound dressings. In addition, by a prudent selection of
polyelectrolytes, the multilayers can degrade completely into safe biocompatible
products, eliminating the need for surgical removal. Last but not least, drug delivery
devices based on LbL assembly are simple and inexpensive to construct; this contrasts
with microchip delivery devices, which, although capable of delivering multiple drugs

l4, l5
1.

with great temporal and dosage contro require tedious microfabrication.

1.2.3 Micropatteming and Cell Culture

Signiﬁcant advances have been made in cell culture and microfabrication
technologies. Integrating these two technologies has contributed to advances in cell and
biological-based systems, such as diagnostics, biosensors, and prosthetics. The
advantages of microfabrication and microﬂuidics technologies are their ability to produce
miniature systems, multiple assays on one array, and multiple processes integrated on one
chip.”’ 16 Advances in microfabrication and microﬂuidics have allowed for highly
controlled cellular micropatteming, high density sample characterization using
individually addressable array elements, and multiple experiments on one array. The
cellular micropatteming techniques have been employed to understand ﬁrndamental cell
biology such as cell-cell, cell-surface, and cell-medium interactions. '7’ '8

Recent progress in cell culture and microfabrication technologies have
contributed to the development of cell-based biosensors for functional characterization
and detection of drugs, pathogens, toxicants, odorants, and other chemicals. In the ﬁelds
of toxicology and drug testing, in vivo studies have an advantage over in vitro studies in
that it takes into account the entire biological system in determining the time-dependent
response to a chemical challenge. However, it is Often not easy to perform in vivo
chemical toxicity studies with human subjects. Therefore, the development of a
microscale cell culture analogue that can mimic an in vivo system is another promising
area that capitalizes upon cell culture and microfabrication technologies.19 In addition,
cell-based systems have been used as prosthetics, especially neural protheses. Further,
various macroscale techniques such as polymerase chain reaction (PCR), DNA and

protein analysis, cell sorting, and cell culture have been miniaturized to the microscale

level using microfabrication techniques, and this miniaturization facilitates the integration
with living cells.2°’ 21 Here, we used microcontact printing to make PEM surfaces. The
PEMS were used to construct patterns that ultimately would mimic tissues and organs that

may be used to study in vivo mechanisms.

1.2.4 Aptamers and Short Interfering RNAS (siRNAs)

The development of drug delivery system with the ability to deliver multiple drug
molecules could lead to important advances in treating a wide range of diseases and also
to increase the efﬁcacy of the drug molecules.22 Typically delivery systems deliver only
one type of biomolecule at a time, e.g., one protein or one gene. It is thus important to
develop a method that can be used to incorporate a wide variety of molecules of different
chemistry on virtually any surface including stents, sutures, and wound dressings. The
delivery system should also have the ability to tune the dosage of drugs released in a
time-dependent manner which would further be useful in understanding the mechanism
involved in the behavior of these drug molecules. The PEM ﬁlms are ideally suited for
such drug delivery applications because it allows for absolute control over the order in
which multiple functional molecules are incorporated into a growing ﬁlm.23 PEMS can be
deposited rapidly and economically atop large area surfaces of any geometry while
allowing nanometer-scale control over a range of physical properties.24 Furthermore, the
all-aqueous processing of PEM ﬁlms allows for incorporation of sensitive biomolecules
such as proteins and nucleic acids.”27

Aptamers are ribonucleic acid (RNA) or DNA oligonucleotides that fold by

intramolecular interaction into unique three-dimensional conformations capable of

binding to target antigens with high afﬁnity and speciﬁcity. Aptamers are

6

macromolecules composed of nucleic acid, such as RNA or DNA that bind tightly to a
speciﬁc molecular target. Like all nucleic acids, a particular aptamer may be described by
a linear sequence of nucleotides (A, U or T, C and G), typically 15-60 letters long,
however, the chain of nucleotides forms intramolecular interactions that fold the
molecule into a complex three-dimensional shape. The shape of the aptamer allows it to
bind tightly against the surface of its target molecule. The term “aptamer” derives ﬁ'om
the Latin aptus, “to ﬁt”, and was chosen to emphasize this lock-and-key relationship
between aptamers and their binding partners. Aptamers may be obtained for a wide array
of molecular targets, including most proteins and many small molecules. These novel
molecules have many potential uses in medicine. Aptamers are generally produced
through the SELEX Method (refer to appendix 1 for details). Considering the many
favorable characteristics of aptamers (refer to appendix 1 for advantages of aptamers),
including their small size, lack of immunogenicity, and ease of isolation, which together
has resulted in their application in clinical trials.28 Therefore, we} propose to evaluate
them as potential targeted drug delivery systems.

siRNAs has rapidly become a widely used tool for silencing gene function and
validating potential therapeutic targets both in cell culture and in vivo. Protein production
inside the cell involves a number of steps, beginning with the reading of the gene in the
nucleus by a process called transcription. This process generates a messenger RNA
(mRN A), which is then translated into protein in the cytoplasm. RNAi-based therapeutics
speciﬁcally target and degrade mRNA using a naturally occurring cellular mechanism
that regulates the expression of genes. With the recent progress in RNAi research, siRNA

is poised to become a new generation of rationally designed drugs. Many diseases

develop from the undesired production of proteins. siRNA's technologies provide a way
to halt this problem at the source. By utilizing the cellular mechanisms that already exist,
drugs created with siRNA technology has the potential to halt or even cure diseases.
Degrading mRNA, that is to be translated into a speciﬁc protein, results in a profound
reduction in the level of that protein without directly altering the original genetic material
(DNA). RNAi is a highly promising therapeutic approach for those diseases where
aberrant protein production is a problem. Finally, RNAi can be applied to inhibit the
expression or replication of pathogenic viruses, such as human immunodeﬁciency virus
(HIV) and hepatitis C virus.29’ 30 However, the delivery of aptamers and siRNAs to

targeted cells and tissues remains a challenge.

1.3 THESIS OUTLINE

This thesis focuses on engineering polyelectrolyte multilayer ﬁlms to control cell
adhesion and for drug delivery applications and is subdivided as follows: Chapter 2
describes the engineering of PEM ﬁlms to control the adhesion of primary cells (primary
hepatocytes and neurons) without the help of adhesive ligands/proteins and ﬁrrther
formed patterns of these cells using microcontact printing. Chapter 3 discusses the
engineering of patterned co-cultures of hepatocyte/ﬁbroblast and neurons/astrocytes and
the effect of the second cell type on the function and viability of the primary cells.
Chapter 4 describes the development of novel SAM patterns of m—d—poly(ethylene
glycol) (m-dPEG) acid molecules onto PEMS. The created m-dPEG acid monolayer
patterns on PEMS acted as resistive templates, and thus prevented further deposits of
consecutive poly(anion)/poly(cation) pairs of charged particles and resulted in the

formation of three-dimensional (3-D) patterned PEM ﬁlms or selective particle

8

depositions atop the original multilayer thin ﬁlms. Chapter 5 discusses the salt tunable
properties of these PEG patterns developed that can be removed from the PEM surface
without affecting the PEM layers underneath the patterns. These removable surfaces
provide an alternative method to form patterns of multiple particles, proteins and cells.
Chapter 6 describes the use of multilayers to engineer aptamer and siRNA based drug
delivery systems, and Chapter 7 concludes the thesis and suggests some future research

directions.

CHAPTER 2 CONTROLLING PRIMARY CELL
(HEPATOCYTES/NEURONS) ADHESION ON
POLYELECTROLYTE MULTILAYER FILMS

2.1 INTRODUCTION

The ionic LbL assembly technique, introduced by Decher in 1991”, forms ﬁlms
by electrostatic interactions between oppositely charged poly-ion species. The alternating
layers of sequentially adsorbed poly-ions are called “Polyelectrolyte Multilayers
(PEMs)”. PEMS have become excellent candidates for biomaterial applications due to 1)
their biocompatibility and bioinertness,3 1'33 2) the ability to incorporate biological

26' 34 and 3) the high degree of molecular control of the ﬁlm

molecules, such as proteins,
structure and thickness providing a much simpler approach to construct complex 3D
surfaces as compared with photolithography.35 The biodegradability of PEMS have been
demonstrated by Lynn and co-workers.36 Thus far, the suitability of these ﬁlms for
biomedical applications have been illustrated predominantly with immortalized cell lines,
such as ﬁbroblast, osteoblast and endothelial cells.31 Rubner and co-workers have
recently developed PEM surfaces using weak polyelectrolyte system that were
cytophobic and cytophilic to ﬁbroblast attachment.33

Fibroblasts and astrocytes can attach to many surfaces due to its robustness and
ability to secrete their own extra-cellular matrix proteins and thus provide a mechanism
by which they can promote their own attachment to surfaces. On the other hand primary
hepatocytes and primary neurons, unlike many other cell types, exhibit more selective

behavior in vitro, preferentially attaching and spreading on tissue culture dishes or

surfaces containing adhesive ligands such as collagen, poly(lysine) and ﬁbronectin.37

10

Primary hepatocytes and primary neurons are anchorage dependent and must attach to
maintain their differentiated function. A stationary suspension culture of isolated
hepatocytes typically loses their differentiated function within hours. Primary hepatocytes
maintain their viability in tissue culture for up to 2 weeks; nevertheless, they lose their
differentiated function within a few days. To address this limitation, approaches such as
overlaying the hepatocytes with a collagen gel or using cylindrical collagen gel
entrapment have extended the differentiated functions in vitro for at least 5-6 weeks.37’ 38
Studies also show that random, dissociated primary neurons in culture develop

physiological responses to neurotransmitters 39’ 40

and self-organize into neuronal
networks, 4043 however, they lack the structure normally present within the nervous
system, where the neurons reside in speciﬁc regions with numerous network
connectivity. The advantage of patterned neurons is that it allowed for precise control of
both the direction of neurite extension and degree of contact between the neurons, unlike
the random neuron monoculture system, which is important for repair and regeneration of
the nervous systems."4 It has also been demonstrated by Wheeler and co—workers that
patterned neurons synapse with each other, release neurotransmitters and develop
electrical activity 4547. Furthermore, restricting neurons to patterns has been shown to
enhance the cellular activity such as glutarnine secretion and electrical activity as

compared to the random monocultures of neurons.“ 49

In this chapter, we demonstrate controlling cell adhesion using PEM films by
varying the surface chemistry and the surface topography. We report culturing primary
hepatocytes and primary neurons on a protein free synthetic SPS surface; these cultured

cells maintain a level of differentiated ﬁrnction similar to tissue culture polystyrene

ll

A Mask w: t”

Plrotor'esist = PDMS Stamp
A. Pllotolitlrographyl E' Seed cells I
m
PDMS Stamp

B. Pour PDMS over Masterl .
Cure at 65“ C for 411 D' Bmld PEMS I

PDMS atop PDM S
' PDMS Stem
C_"'",.,,.,.,.,,,, P

the Master

 

Figure 2.1. (A) Schematic diagram illustrates the method for treating the PDMS surfaces with PEMS and
culturing cells on the surfaces with different topographies. PEMS (PDAC/SPS)Io are built on top of the
PDMS surface and cells are then seeded. (B) Illustration of the overlap of a cell and a ﬂat area between the
circle patterns. The diameter (d) changes while the center to center distance (a) remains constant for the
features: a=18um. Region 1 represents the area between any six adjacent patterns (features). Region 2
represents a cell attached between the patterns. Region 3 is the cell nucleus.

surface (TCPS). The advantage of PEM surfaces is its ability to construct three
dimensional structures with controlled cell-cell and cell-surface interactions. On method
to produce 3D structures is with the use of PDMS surfaces. Unfortunately, PDMS
surfaces are known to be resistant to cell attachment. PDMS has been used extensively to
study cell-substrate interactions, in medical implants and biomedical devices because of
its biocompatibility,50'53 low toxicity,51’54’55 and high oxidative and thermal stability.“’ 57
Despite the many advantages of PDMS, its applications in microﬂuidics and medicine
have been problematic because PDMS is highly hydrophobic. Even when the surface is
made hydrophilic, PDMS gradually reverts to its hydrophobic state due to surface
rearrangements. As a result, it is rather difﬁcult to maintain long-term culture of cells on
PDMS, due to the difﬁculty in irreversibly modifying PDMS surfaces to have a stable
cell-adhesive layer.58 Building a polyelectrolyte multilayer (PEM) ﬁhn coating on top of
the PDMS surface increases surface wettability and imparts lasting hydrophilicity thereby
improving adhesion and proliferation of cells on PDMS surfaces.” 59’ 60Nevertheless, we
noted that PEM-coated PDMS surfaces of different topographies affect the attachment,
spreading and even proliferation of three types of mammalian cell, transformed 3T3
ﬁbroblasts (3T3s), HeLa (transformed epithelial) cells and primary hepatocytes. The
PEMS were built using LbL assembly of polyelectrolytes PDAC and SPS, as shown in
the scheme in Figure 2.1 (A). The PDMS stamps consisted of circles with varying
diameters with pitch distances of 18pm and pattern heights of 2.5m as illustrated in
Figure 2.1 B. Following cell seeding, we observed differences in the cell attachment and
spreading depending on the groves and patterns on the PDMS surfaces. The cell

morphology and attachment varied depending on the pattern geometries. Using imaging

13

techniques, we show that changes in the surface topographical features alter the
attachment and spreading of cells, suggesting a physical means of controlling the

interaction between the cell and its environment.

2.2 METHODS AND MATERIALS

2.2.1 Materials

Poly(diallyldimethylammoniumchloride) (PDAC) (Mw~100,000-200,000) as a 20 wt %
solution, sulfonated poly(styrene), sodium salt (SPS) (Mw~70,000), linear
polyethyleneimine (LPEI), branched polyethyleneimine (BPEI), poly(anetholesulfonic
acid) (PAS), poly(vinylsulfonic acid) (PVS), ﬂuorosilanes and sodium chloride were
purchased from Aldrich (Milwaukee, WI). All polymers were used without ﬁrrther
puriﬁcation. Poly(dimethylsiloxane) (PDMS) from the Sylgard 184 silicone elastomer kit
(Dow Corning, Midland, MI) was used to prepare stamps. The PDMS stamps were used
for microcontact printing. 9

Dulbecco’s Modiﬁed Eagle Medium (DMEM) with 4.5 g/l glucose, 10X DMEM, fetal
bovine serum (FBS), penicillin and streptomycin were purchased from Life Technologies
(Gaithersburg, MD). Insulin and glucagon were purchased from Eli Lilly and Co.
(Indianapolis, IN), epidermal growth factor from Sigma Chemical (St. Louis, MO). Type
I collagen suspension (1.2 mg/ml in 1 mM HCl) was prepared from Lewis rat tail tendons
as described by Dunn and co-workers.(’1 Puriﬁed rat albumin was purchased from Cappel
Laboratories (Aurora, OH). Urea assay was purchased from Sigma Chemical (St. Louis,

MO).

14

2.2.2 Preparation of Polyelectrolyte Multilayers

PDAC and SPS polymer solutions were prepared with deionized (DI) water at
concentrations of 0.02M and 0.01M respectively, (based on the repeating unit molecular
weight) with the addition of 0.1M NaCl salt. Polyelectrolyte dipping solutions were
prepared with DI water supplied by a Bamstead Nanopure-UV 4 stage puriﬁer (Bamstead
International Dubuque, Iowa), equipped with a UV source and ﬁnal 0.2 pm ﬁlter.
Solutions were ﬁltered with a 0.45 pm Acrodisc syringe ﬁlter (Pall Corporation) to
remove particulates. The tissue culture polystyrene (TCPS) surfaces were subjected to a
Harrick plasma cleaner (Harrick Scientiﬁc Corporation, Broading Ossining, NY) for 10
min at 0.15 Torr and 50 sccm ﬂow of Oz in a plasma chamber. The layer-by-layer process
was carried out in an automatic dipping machine (HMS programmable slide stainer from
Zeiss Inc.). To form the ﬁrst bilayer, the TCPS were immersed for 20 min in a polycation
solution. Following two sets of 5 min rinses with agitation, the TCPS were subsequently
placed in a poylanion solution and allowed to deposit for 20 min. Afterwards, the 6 well
plates were rinsed twice for 5 min each. The samples were cleaned for 3 min in an
ultrasonic cleaning bath after depositing a layer of polycation/polyanion pair. The
sonication step removed weakly bounded polyelectrolytes on the substrate, forming
uniform bilayers. This process was repeated to build multiple layers. All experiments

were performed using ten (i.e., 20 layers) or ten and half bilayers (i.e., 21 layers).

2.2.3 Preparation of PDMS Stamps

An elastomeric stamp was made by curing PDMS on a microfabricated silicon master,
which acts as a mold, to allow the surface topology of the stamp to form a negative

replica of the master.62 The PDMS stamps were made by pouring a 10:1 solution of

15

elastomer and initiator over a prepared silicon master.63 The silicon master was pretreated
with ﬂuorosilanes to facilitate the removal of the PDMS stamps from the silicon master.
The mixture was allowed to cure overnight at 60°C. The masters were prepared in the
BioMEMS facilities at MGH East and consisted of variotrs features (squares and lines).
The polyelectrolytes were stamped onto the multilayer system using the polymer-on-

polymer stamping process developed by Hammond and co-workers.35

2.2.4 Animals and Hepatocyte Isolation

Primary rat hepatocytes were isolated from adult female Lewis rats (Charles River
Laboratories, Boston, MA) weighing 75-125 g, according to a two-step collagenase

perfusion technique described by Seglen64 and modiﬁed by Dunn.61 The liver isolations

yielded 150-300 x 106 hepatocytes. Using trypan blue exclusion the viability ranged from

90 to 98 %.

2.2.5 Hepatocyte Culture System

Hepatocytes were cultured on PEM coated 6-well tissue culture polystyrene surfaces
(TCPS). All the multilayer coated TCPS were sterilized by spraying with 70 % ethanol
and exposing them to UV light before culturing the cells onto these surfaces. The cell
culture experiments on the PEM surfaces were performed without coating the surfaces
with any adhesive proteins. Collagen coated TCPS and uncoated TCPS were used as
controls in these studies. The collagen gelling solution was prepared by mixing 9 parts of
the 1.2 mg/ml collagen suspension in 1 mM HCl with 1 part of concentrated (10X)
DMEM at 4°C. The control wells were coated with 0.5 ml of this collagen gelling

solution and the coated plates were incubated at 37°C for 1 hour. Freshly isolated

16

hepatocytes were seeded at a density of 4x105 cells per well for 7 days. The standard
hepatocyte culture medium consisted of DMEM supplemented with 10% PBS, 14 ng/ml
glucagon, 20 ng/ml epidermal growth factor, 7.5 jig/ml hydrocortisone, 200 rig/ml
streptomycin (10,000 rig/ml) — penicillin ( 10,000 U/ml) Solution, and 0.5 U/ml insulin.
One ml of fresh medium was supplied daily to the cultures after removal of the
supernatant. Samples were kept in the incubator where the temperature and humidity
were properly controlled. A Leica inverted phase contrast microscope with Soft RT 3.5
software was used to capture images of cell density, morphology, and spreading on the

multilayer surfaces.

2.2.6 Primary Neuron Culture System

Primary cerebellar neurons were prepared from 8-day-Old Sprague—Dawley rat pups
(Charles River, Sulzfeld, Germany) as described previously.65 Cells were dissociated
from freshly dissected cerebella by mechanical disruption in the presence of trypsin and
DNase and then plated in poly l-lysine-precoated or PEM-coated six-well plates. Cells
were seeded at a density of l><106 cells/cm2 in DMEM supplemented with 10% fetal calf
serum, 2 mm glutamine, and 20 ug/mL gentamycin. Three days after incubation (37 °C,
5% C02), the medium was subsequently replaced with 2 ml of cerebellum medium
supplemented with 5 uM Arac to arrest the growth of non-neuronal cells. After 2 days,
the neuronal culture was switched back to cerebellum meditun without Ara-C. The
experiments were performed on 6- to 7-day-old culture. Cultures generated by this
method have been shown to contain > 95% cerebellar granule neurons.66 Astrocytes were
prepared from 7-day-old Sprague—Dawley rat pups as described previously.67 The cells

were seeded in poly l-lysine—precoated or PEM-coated six-well plates (3XI05/well) in

17

culture medium (90% DMEM, 10% FCS, 20 U/mL penicillin and 20 ug/mL
streptomycin sulfate), and cultivated in an incubator (humidiﬁed, 10% C02). The
cerebellum neurons were used in co-culture studies.

Primary cortical neurons were isolated from one-dayeold Sprague—Dawley rat pups
and cultured according to the published methods as described in Chandler et al.68 The
cells were plated on poly-d-lysine-coated (control) or PEM coated, six-well plates at a
concentration of 2><106 cells per well in fresh cortical medium (DMEM supplemented
with 10% horse serum, 25 mM glucose, 10mM HEPES, 2 mM glutamine, 100 IU/ml
penicillin, and 0.1 mg/ml streptomycine). Three days after incubation (37 °C, 5% C02),
the medium was subsequently replaced with 2 ml of cortical medium supplemented with
5 pM Arac. After 2 days, the neuronal culture was switched back to cortical medium
without Ara-C. The experiments were performed on 6- to 7-day-old culture. To obtain
primary cultures of astroglial cells, the cortical cells from one-day-old Sprague—Dawley
rat pups were cultured in DMEM/Ham's F12 medium (1:1), 10% fetal bovine serum
(Biomeda, CA, USA), 100 IU/ml penicillin, and 0.1 mg/ml streptomycine. The cells were
plated on poly-d-lysine or PEM coated, 6-well plates at a concentration of 2 X 106 cells
per well. Cells were grown for 8—10 days (37 °C, 5% C02) and culture medium was
changed every 2 days. Twenty-four hours prior to treatment with fatty acids, the medium
was changed to neuronal cell culture medium. The cortical neurons were used in co-
culture and ROS studies. Primary cortical neurons were used for the ROS studies as the
oxidative stress-induced effects are higher in the affected regions (cortex and

hippocampus) as compared to the unaffected areas (cerebellum).69

l8

2.2.7 Biochemical Assays

The biochemical assays were performed on the collected medium supernatant. Albumin
concentration was determined by an enzyme-linked immunosorbent assay described
previously using a polyclonal antibody to rat albumin.61 A standard curve was derived
using chromatographically puriﬁed rat albumin dissolved in medium. Urea levels were
measured with commercially available kits based upon its speciﬁc reaction with diacetyl

monoxime.

2.2.8 Immunostaining of Primary Neurons

To perform confocal immunoﬂuorescence microscopic study, neurons cultures were
ﬁxed for 20 min in 4% paraformaldehyde and permeabilized with 0.1% Triton X-100 and
5% goat serum (Invitrogen) in PBS. Cells were then labeled overnight at 4 °C with
appropriate primary antibodies (1:50 neuroﬁlament for neurons) in 5% goat serum in
PBS. After three PBS washes, primary antibodies were detected with Fluorescein
conjugated conjugated secondary antibodies for neurons. The cells were visualized with

Leica ﬂuorescent microscope.

2.3 RESULTS AND DISCUSSION

The aim of this study is to characterize the attachment, spreading and function of
primary rat hepatocytes and primary neurons cultured on various PEM surfaces. In our
study, we used synthetic polymers namely poly(diallyldimethylarnmoniumchloride)
(PDAC) and SPS as the polycation and polyanion, respectively, to build the multilayers.
We compared the attachment and spreading of primary hepatocytes and primary neurons

on PEM ﬁlms, with either PDAC or SPS as the top most surface, to TCPS surfaces

19

coated with adhesive proteins, as the control. The PEM surfaces used for the cell

adhesion studies were not coated with collagen or other adhesive proteins.

2.3.1 Primary Hepatocyte Adhesion on PEMS

Figure 2.2 compares the morphology of primary hepatocytes on PEM surfaces
with collagen coated TCPS obtained with phase contrast microscopy. Primary
hepatocytes attached and spread on PEM ﬁlms with SPS as the topmost surface. In
contrast, the attached cells did not spread on PEM ﬁlms with PDAC as the topmost
surface and eventually lifted off the surface.

The difference in the projected cell area for primary hepatocytes on the different
surfaces is shown in Table 2.1. The number of primary hepatocyes that attached on the
SPS surfaces on Day 1 and 5 (204 and 189 cells/mm2 respectively), was comparable to
the number of hepatocytes that attached on the collagen coated TCPS control surfaces on
Day 1 and Day 5 (210 and 185 cells/mmz), see Table 2.1. In contrast, fewer cells attached
and spread on PEM ﬁlms with PDAC as the topmost surface on Day 1 and Day 5 (110
and 15 cells/mmz, respectively). Primary hepatocytes attached and spread on SPS
surfaces and the morphology of the cells were comparable to the control. On day 1, some
cells (110 cells/mmz) attached on the PDAC surface but did not spread. By day 5 most of
the primary hepatocytes (15 cells/mm2) lifted off the PDAC surfaces. We capitalized
upon this cell adhesive/resistive property of SPS and PDAC, respectively, to make
patterns of primary hepatocytes. SPS patterns were formed on PEM surfaces either by

microcontact printing SPS onto PDAC surfaces or vice-versa using the polymer-on-

20

   
   
 

  
 
 

      
    
 
   

  
  

“- ; .~,'§..,""'5"

.. warm

"I" ---.?.s.§rrié;r
., 12:33? ,
“(It

t' 5" - VS
.r y‘ft .igig -' i-

. . new

  
       

Figure 2.2. Optical micrographs of primary rat hepatocytes after 3 days for in culture on PEM surfaces. A)
(PDAC/SPS)m.5 B) (PDAC/SPS)“, C) TCPS-Control D) PDAC patterns on SPS. The magniﬁcation is 10X.
Scale bar = 50 um

polymer stamping technique developed by Hammond and co-workers.35 Primary
hepatocytes adhered and spread only on SPS surfaces resulting in primary hepatocyte cell
patterns (Figure 2.2 D) whereas ﬁbroblasts readily attached to a variety of surfaces
including both PDAC and SPS. This enabled the use of this system as a template for
patterned co-culture of ﬁbroblast and primary hepatocytes on synthetic PEM surfaces
without adhesive proteins (Chapter 3). To investigate the long term effects of PEM ﬁlms
on cell viability and function, we assessed the morphology and maintenance of liver-

speciﬁc ﬁmctions over 7 days of continuous culture.

21

Table 2.1. Primary hepatocyte cell numbers on the projected area on the
different surfaces used in the study after 1 day, 3 days and 5 days.
Student’s t-test was used for analyzing the differences between the cell
adhesion on various surfaces (‘ p<0.05 compared with primary hepatocyte
adhesion on collagen coated TCPS control)

 

Primary Hepatocytes (#cells/mmz)

 

 

 

 

 

 

 

 

 

Surfaces (4x105/substrate initial concentration)
1 day 3 days 5 days
Collagen coated TCPS control 210 :h 21 193 :l: 18 185 :I: 17
PDAC ““19. 38:1:8‘ 15:”.
SPS 204 :I:16 192 :t 20 189 :l: 21
03Na .
SOgNa 00%
SPS PAS PVS

Figure 2.3. Structure formulae of the sulfonic acid polymers

One of the major challenges in studying the mechanism of cell-substrate

interaction on synthetic surfaces is discerning the relative role of the chemical functional

groups on this interaction. Therefore, we evaluated several synthetic sulfonic acid

polymers with distinct chemical structures and molecular mass for this purpose. Figure

22

 

2.3 shows the chemical structure of three different sulfonic acid polymers, namely SPS,
poly(anetholesulfonic acid) (PAS), and poly(vinylsulfonic acid) (PVS), used to build
PEM ﬁlms for the primary hepatocytes studies. The PAS polymer has a similar structure
to SPS but contains a hydrophobic ether group in the. benzene ring while the PVS
polymer has no benzene ring. These polymers were chosen to determine the ﬁmctional
group responsible for the Observed cellullar behavior on the PEM surfaces. Primary
hepatocytes attached and spread on PEM ﬁlms with all three sulfonic acid polymers as
the topmost surface. The similarity in the results suggests that the sulfonate group was
likely responsible for the primary hepatocyte attachment and spreading on the PEM
surface. The morphology observed on SPS and other sulfonate surfaces were consistent
with cells demonstrating afﬁnity towards the surface. Similar behavior was not observed

when hepatocytes were cultured on PDAC surfaces.

 

Figure 2.4. Optical micrographs of primary rat hepatocytes after 3 days in culture on PEM surfaces. A)
(LPEI/SPS)IO_5 B) (SPS/LPEI)m C) (BPEI/SPS).0_5 D) (SPS/BPEI).0,5. Scale bar = 100 um

23

Next, experiments were performed to determine whether the observed preferential
adhesion to SPS was due to charge effect. Figure 2.4 compares the morphology of
primary hepatocytes on two positively charged surfaces: (LPEI/SPS)Io.5 and
(BPEI/SPS)10_5. Primary hepatocytes were grown on positive (LPEI/SPS)10,5 and
(BPEI/SPS)10,5 surfaces to observe the importance of charge effects on cell adhesion and
spreading. Unlike the PDAC surfaces, primary hepatocytes attached and spread on
positively charged LPEI and BPEI surfaces with similar morphology to that seen on the
SPS surfaces, suggesting that charge effect was not likely the mechanism for cell
adhesion. The functional group likely involved in enhancing cell adhesion on the LPEI
and BPEI surfaces are the primary and secondary amine groups. PDAC was shown to be
cell resisting for smooth muscle cells and neuronal cells by McShane and co-workers70
and we also observe similar adhesion effect on primary hepatocytes. PEI has also been
used instead of polylysine as a surface which supports attachment and grth of primary
neurons.7|

The long term metabolic response of continuous hepatocyte culture on PEM ﬁlms
was compared with collagen coated surfaces as shown in Figure 2.5. Figure 2.5 (A and B)
illustrate the rate of albumin and urea production, respectively, for cultures up to one
week. The daily production of both albumin and urea on PEM surfaces were comparable
to cells cultured on collagen coated tissue culture dish. By day 7, the liver speciﬁc
functions approach zero for PEM ﬁlms with PDAC as the top most surface. This is likely

due to the fact that the cells were unable to maintain attachment to the PDAC surfaces

24

 

 

 

  
 
 
 

 

 

 

 

 

 

 

 

 

120 —Control I
g —SPS
-:x:
.5. 60* + + -

'5’

g 40 .

o.

m 20 a

2

D .5

0 a + I M—
Day 1 Day 3 Day 5 Day 7

 

I1:
:3

 

w
a:

Albumin Production (pg/ml)
0|

w h
1

.AN

 

 

 

 

 

O
1
.ﬁ

Day 1 Day 3 Day 5 Day 7

Figure 2.5. Metabolic ﬁrnction of primary hepatocytes on PEM surfaces. A) Total urea production per day.
B) Total albumin secretion per day (n=6).

25

and had completely lifted from the surface by day 7. In contrast, PEM ﬁlms with the
sulfonated groups as the topmost surface had comparable urea and albumin production to
the collagen coated TCPS surface. The urea and albumin secreted by the primary
hepatocytes on the PDAC surfaces decreased to zero by day 7 indicating that the primary
hepatocytes do not attach on the PDAC surfaces. The urea secreted by the primary
hepatocytes on the SPS surfaces decreased from day 1 (112.24 :t 2.81 ug /lx106
cells/day) to day 7 (22.55 i 1.30 pg /1x106 cells/day) suggesting that the cells were de-

differentiating.

2.3.2 Primary Neuron Adhesion on PEMS

Figure 2.6 and Table 2.2 compare the adhesion of primary neurons and astrocytes
on PEM surfaces to PLL coated TCPS control. The difference in the projected cell area
for primary neurons and astrocytes on the different surfaces is shown in Table 2.2. The
number of primary neurons that attached on the SPS surfaces on Day 7 (234 cells/mm2)
was comparable to the number of neurons that attached on the PLL coated TCPS control
surfaces on Day 7 (250 cells/m2), see Figure 2.6 and Table 2.2. In contrast, fewer cells
attached and spread on PEM ﬁlms with PDAC as the topmost surface. By day 7 most of
the primary neurons (10 cells/mm2) lifted off the PDAC surfaces. Primary neurons
attached and spread on SPS surfaces and the morphology of the cells were comparable to
the control, see Figure 2.5 (B, C). Astrocytes attached to both PDAC and SPS surfaces as
shown in Figure 2.5 (D-F). The number of astrocytes attached to both PDAC (178
cells/mmz) and SPS surfaces (183 cells/mmz) were comparable to the control surfaces

(192 cells/mmz), see Figure 2.5 (D-F) and Table 2.2.

26

Table 2.2. Primary neurons and astrocytes cell numbers on the projected
area on the different surfaces used in the study after 7 days in culture.
Student’s t-test was used for analyzing the differences between the cell
number on the various surfaces (a p<0. 05 compared with cell adhesion on
poly(lysine) (PLL) coated TCPS control)

 

Primary Neurons Astrocytes
Surfaces (# of cells Immz) (# of cells /mm2)
(4x105/substrate initial conc) (4x105/substrate initial conc)

 

 

 

PLL coated TCPS 250 :L- 19 192 :h 19
PDAC 105:2a 178:I:20
SPS 234 :l: 18 183 :I: 17

 

 

 

 

 

 

Figure 2. 6. Phase contrast images of primary neurons and astrocytes after 7 days in culture on PEM
surfaces. Primary neurons on (A) (PDAC/SPS)“ - PDAC topmost surface (B) (PDAC/SPS)Io - SPS
topmost surface (C) poly(lysine) (PLL)-control surfaces. Astrocytes on (D) (PDAC/SPS)Io.s - PDAC
topmost surface (E) (PDAC/SPS)“, — SPS topmost surface (F) poly(lysine)-control surfaces. (Scale bars-
250nm).

27

2.3.3 Fabrication of PEM Coated PDMS Substrate

Table 2.3. Dimensions of the different surface topographies used in the

 

 

 

 

 

 

 

 

 

 

study
Surface Diameter Pitch-Center to (a-d), um Area between 6
(d), um Center (a), um adjacent features (umz)
Pl 1.25 18 16.75 603 :I: 10
P2 2 18 16 576 :h 11
P3 3 18 15 540 :I: 8
P4 4 18 14 504 :I: 10
P5 5 18 13 468 :I: 6
P6 6 18 12 432 :I: 9
P7 7 18 11 396 :I: 9
P8 8 18 10 360 :I: 11
P9 9 18 9 324 :I: 10

 

 

 

 

 

 

 

To evaluate the effect of substrate physical properties (i.e., periodic
microstructures) on cell attachment and morphology, we compared the response of
several cell types (ﬁbroblasts and primary hepatocytes) cultured on various
polydimethylsiloxane (PDMS) patterns. The dimensions and the topography of the
patterns on the PDMS surfaces are shown in Figure 2.1B, Figure 2.7 and Table 2.3. The
circle patterns have a pitch distance (center to center) of l8p.m while the diameter of the
circle patterns ranges from 1.25pm to 9am. The height of the patterns was 2.5um. The
PDMS patterns were coated with PEMs (PDAC/SPS)10 with SPS as the topmost surface,

thus keeping the surface chemistry the same while changing the surface topography. In

28

the previous section, we observed the variation in cell adhesion depended on the surface
chemistry. In contrast, here we studied the effect of surface topography on cell

attachment while maintaining the same surface chemistry.

d=1.25pm d=2.0um

           

(A) (B)

 

(G) (H) (I)

Figure 2.7. Phase contrast microscope images of circle patterns on PDMS surfaces of varying diameter (A)
Pl, diameter = 1.25pm, (B) P2, diameter = 2.0um, (C) P3, diameter = 3.0um, (D) P4, diameter = 4.0um,
(E) P5, diameter = 5.0um, (F) P6, diameter = 6.0um, (G) P7, diameter = 7.011111, (H) P8, diameter = 8.0pm,
(1) P9, diameter = 9.0um. All the patterns have constant pitch distance (center to center) of 18pm and
height of 2.5IIm (Scale bar, 50 um).

29

2.3.4 Primary Hepatocyte Adhesion on PEM Coated PDMS Surfaces

 

Figure 2.8. Optical micrographs of primary rat hepatocytes after 3 days in culture on various surfaces: (A)
TCPS (B) PEM coated smooth PDMS surfaces (C) P1, (D) P5 (E) P9 (Scale bar, 50 um).

30

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Lanna owamu enae— 9:2 auﬂwu «Sam: 9—

..Snuem can": emﬂma aqua n—«em «Sane: w.—

.mznme ommaaw wanna— uhavm aNﬂmv aa—«N: E

GEES. sagas: ‘72." can”: nvﬁam «Seam: w.—
Czamﬁ 02am: emamn acumen Paame Seaﬁ m.—
..m—«umm oSEwﬁ evawv scape swamp Sauﬁ E

3 ﬂ Cw m_ u." N: _ a rm 5 a m3 3 a a: :N H :2 m.— M
2 Emma a «dud «ﬂue 3 have m— «a: w— a SN N.—

ﬁahg I ammN _ “new cause: an";— 3 um ZN :—

3 a man a a «mu m a me 3 a :3 3 a 3N mm a 9% mean: 18.39 Sam

CT: «Nana can": 97mm .2”: «Sang @29—

mn a mg 3 a man N u_" an Nu a 3m mm “m cma 5N a emu $58

when m new .5 was“. m awn an 83.2.5

3335:8an RES .339 Anozabeooeoo .53.: «2:me

Ans—.538 me E emu—nehﬁm ANEEEEOLE Swansea—o: mus—5.5
Ammo... :o 560:? H3388.“ 55 @2358 3.on .mmoh no 228:?

.76

8.3836: begun 5L3 Guangzhou modva 3V mooﬂSm 25:? co communes =8 05 50339 moocoeobme o5 maﬁa—«SW c8 com:
me? 38¢ 9:535 .33 m 98 :3 .nm Loam beam 05 5 com: Suﬁsm EthB 05 so «one @88on 05 :o 8698:: :00 .v.~ 033—.

The primary hepatocytes displayed different attachment preferences and morphologies
depending on the pattern size and topography as shown in Figure 2.8. The difference in
the projected cell area for primary hepatocytes on the different topographies is shown in
Table 2.4. There was a general trend of decreasing cell number with increasing diameter
of the circular patterns and decreasing a—d distance. The number of primary hepatocyes
that attached on the P1 (211 — 176 cells/m2), P2 (201 — 164 cells/mmz), and P3 (191 —
155 cells/mmz) surfaces was comparable to the TCPS control (250 — 210 cells/mmz) and
the PEM coated PDMS surfaces (245 — 200 cells/mmz), see Figure 2.8 and Table 2.4.
Cells on the P4-P9 surfaces showed more limited cell attachment, similar to the uncoated
PDMS surfaces (98 — 5 cells/mmz), see Table 2.4. The cells on the (P4-P9) patterns did
not spread and started to lift off over time resulting in a lower density of cells. From our
previous studies we showed that primary hepatocytes attached and spread onto SPS
surfaces without the need of adhesive proteins.72 Hence the observed behavior in this
study is independent of the surface chemistry of the substrate and is due to the effect of
topography and thus provides an alternative approach to modulating the attachment of

primary hepatocytes.

2.3.5 Fibroblast Adhesion on PEM Coated PDMS Surfaces

The observations were similar when these micro-patterned PDMS surface
topographies were cultured with ﬁbroblasts. The cells display varying attachment
preferences and morphologies depending on the pattern size and topography as shown in
Figure 2.9. Fibroblasts showed varying cell adhesion depending on the diameter of the
circle patterns and the a-d distance. On smooth PEM coated PDMS surfaces the

morphologies and attachment patterns of the cells were similar to those on TCPS

32

—.

 

Figure 2.9. Fluorescence micrographs of focal adhesion and actin cytoskeleton in ﬁbroblasts revealed with
triple labeling using TRITC—conjugated Phalloidin (staining F-actin), anti-Vinculin (focal contacts) and
DAPI (nuclei) after 3 days in culture on various surfaces: (A) TCPS (B) PEM coated smooth PDMS
surfaces (C) P1, (D) P5 (E) P9 (Scale bar. 50 um).

surfaces. On patterned PDMS surfaces, the cell attachment varied as the diameter of the
circular patterns and the a-d distance changed. The cells attached preferentially on the
smaller diameter patterns (P1, P2, P3), which had a correspondingly higher a—d distance,
as compared to the patterns with the larger diameters and smaller a-d distance. On the P4-

P9 surfaces where

 

Fibroblast Adhesion on Surfaces

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

1400 3h
-0—
N +2“
5 1200 -
+72]!
5
3 1000
.n M
g 800 -
c \
E 600
a \
o
O I v I v I ' I
TCPS PEM P1 P2
0" Surfaces
PDMS

 

Figure 2.10. Proliferation of ﬁbroblasts on various surfaces at 8h, 24h and 72h after cell seeding. Data
represents mean 2+: S.E. of three independent experiments (* p<0.05 compared with control TCPS surfaces).

the cells detached, the cells appeared more rounded. The number of ﬁbroblast cells that
attached on the P1 (66 — 877 cells/ml), P2 (62 — 865 cens/mmz), and P3 (57 — 841
cells/mmz) surfaces was comparable to the TCPS control (72 — 928 cells/mmz) and the
PEM coated PDMS surfaces (69 — 893 cells/mmz), see Figure 2.9 and Table 2.4. Hence,
these PDMS topographies can be used to culture 3T3 ﬁbroblasts, whereas PDMS
surfaces P4-P9 were cytophobic to the ﬁbroblast. Very few cells attached onto the

uncoated PDMS surfaces (16 — 7 cells/mmz), see Figure 2.10 and Table 2.4.
34

Fibroblast cells are present in almost all tissue types and organs and they play a central
role in the support and repair of tissues and organs. When a tissue is injured or a device is
implanted, the nearby ﬁbroblasts proliferate and migrate into the affected area, and
produce a large amount of collagenous matrix, which helps to isolate and repair the
affected tissue.73 On the other hand, overgrowth and overspreading of ﬁbroblasts can

74’ 75 Thus surfaces

cause diseases such as liver cirrhosis and non-functional scar tissues.
that can modulate ﬁbroblast growth and spreading can be useful in preventing conditions,
such as scar tissue formation associated with implanted medical devices or engineered

tissue constructs.

2.3.6 Potential Explanation of the Observed Effect of Topography on Cell

Attachment

Previous studies have shown a similar effect of topography as seen on the PDMS
surface topographies, namely, the spacing and diameter of the features was critical to the
attachment and spreading of the cells.76 As seen from the data, the smaller diameter
(1.25-3um) P1-P3 surfaces appeared to have higher cell proliferation rate when compared
to the larger diameter (4-9um) P4-P9 surfaces. A possible explanation for the varying
attachment and proliferation of the cells on the different topographies (Pl-P9 surfaces)
may be attributed to the difference in the area between the features. Figure 2.13 is a
schematic illustrating the overlap of a cell and a ﬂat area between the circle patterns
(features). Using the Soft RT 3.5 software on the phase contrast images of the cells we
determined the average area occupied by primary hepatocytes or mouse 3T3 cell (see
Table 2.3). We observed that the area between the six adjacent circle patterns (features)

decreased from 603 i 10 pm2 for the P1 surface to 324 i 10 um2 for the P9 surface. The

35

average area occupied by a HeLa or mouse 3T3 cell was measured to be 521 d: 15 um2
(Region 2 in Figure 2.18).

The ﬁbroblast cells proliferated on the P1-P3 surfaces where the surface area
between any six adjacent features (Region 1 in Figure 2.1B) ranged from 603 i 10 um2
for the P1 surface to 540 d: 8 pm2 for the P3 surface. The P4 surface, on the other hand,
has a surface area of 504 i 10 um2 which is on par with the size of an average cell. Even
though the cells proliferated on the P4 surfaces, they proliferated signiﬁcantly slower
than on the control TCPS surfaces likely due to fewer cells being able to attach initially.
The cells did not proliferate extensively on the P5-P9 surfaces where the surface area
ranged from 468 :1: 6 pm2 for the P5 surface to 324 :l: 10 um2 for the P9 surface, which are
less than the average size of a cell. The cells proliferated on surfaces where the surface
area between the features were larger than the size of an average cell (Pl-P3), while the
proliferation was slower on surfaces where the area between the features was on par with
the size of the cells (P4) and did not proliferate extensively on surfaces where the area
between the features was smaller than the average size of a cell (PS-P9). The results
suggest the quantity of surface area between the features may affect the ability of the
cells to attach, as well as the proliferation rate of the cells on the various topographies.
Therefore, controlling the surface topography provides an alternative approach for
modulating the cell attachment and proliferation for tissue engineering applications.

PDMS is a useful material for cell biology studies because it can be easily
manipulated into different sizes, shapes, and dimensions with soft-lithographic
techniques. We found that differences in physical environment, e.g. the surface micro-

topography on the PDMS surfaces, inﬂuenced the attachment and growth of the cells.

36

Therefore, depending on the application requirements, the surface topography may be
used as an alternative approach to chemical properties for controlling the attachment and
growth of cells. These PDMS surfaces with varying topographies may be used, for
example, to modulate ﬁbroblast growth and spreading, which can be desirable in
preventing conditions associated with ﬁbroblast overproduction and overspreading.
Overall, there are many advantages to fabricating devices made of PDMS, e.g., their low
cost and ease of fabrication, and their biocompatability and permeability to gas. Finally,
as demonstrated in this study, PDMS when appropriately modiﬁed can be a suitable

substrate for culturing and controlling the adhesion of various types of mammalian cells.

2.4 CONCLUSIONS

In conclusion, the present work outlines a method for controlling cell-surface
interactions by varying the surface chemistry and surface topography with the help of
PEMS. PEMS were used to produce deﬁned cell-resistant and cell-adhesive properties
depending on the topmost surface and the type of cells used. We have shown using both
biochemical studies and direct microscopy imaging of live cells that primary hepatocytes
and neurons attach, spread and function on PEM ﬁlms without the aid of adhesive
proteins. These results demonstrate the feasibility of attaching primary hepatocytes and
neurons directly on PEMS. We also demonstrated that patterns of primary hepatocytes
and primary neurons can be formed using this layer-by-layer deposition of ionic
polymers, which can be used as a template for patterned cell co-cultures. Further, PEM
ﬁlms permit precise control of the three dimensional topography at micro and nanometer
scales. We demonstrated that the hydrophobic and cell resistant PDMS surfaces can be

made to be cell adhesive surfaces by coating with PEM ﬁlms. We also demonstrated that

37

the addition of topographical features on the PEM coated surfaces provided an alternative
approach to chemistry for controlling the attachment of primary cells (hepatocyes) and
the attachment and growth of transformed cells (3T3 ﬁbroblasts and HeLa cells).Taken
together, this technique may be a useful tool for fabricating controlled co-cultures with
speciﬁed cell-cell and cell-surface interactions, thus providing ﬂexibility in designing

cell-speciﬁc surfaces for tissue engineering applications.

38

CHAPTER 3 PATTERNED CO-CULTURE OF PRIMARY
HEPATOCYTES/FIBROBLASTS AND PRIMARY
NEURONS/ASTROCYTES USING PEM FILMS

3.1 INTRODUCTION

Tissue formation and function in vivo are inﬂuenced by many factors, including
cytokines, cell-matrix interactions, topology, mechanical forces, and cell-cell
interactions. An important aspect in tissue formation and function is the interaction
between the multiple types of cells within the tissue.77 Cell-cell interactions are central to
the function of many tissues, e.g., blood vessels form when endothelial cells are allowed
to interact with smooth muscle cells78 and nervous system function depends upon proper
interactions between neuronal and glia cells.79 Cell-cell communication between primary
neurons and astrocytes is crucial for the development and repair of neuronal systems.80
Astrocytes are glial cells that are in close proximity to the neurons and play multiple roles
in the functioning of the brain. They can sense neuronal activity through neurotransmitter
receptors81 and provide direct neurotrophic factors to support the neurons.82 Previous
studies have shown that astrocytes mediate both positive and negative responses in
neuronal cells. Primary neurons co-cultured randomly with astrocytes showed reduced
toxicity to ammonia83 but an increased sensitivity to the toxicity of glutamate84 as
compared to pure neuronal cultures.

Primary hepatocytes are anchorage-dependent liver cells and, therefore, require a
substratum to survive and function. Primary hepatocytes, unlike many other cell types,

exhibit more selective behavior in vitro, preferentially attaching and spreading on tissue

culture dishes or surfaces containing collagen. The cells, however, eventually de-

39

differentiate and lose their hepato-speciﬁc function. To engineer liver tissues that
maintain hepatic ﬁmctions in vitro require co-cultivation of primary hepatocytes with a
variety of nonparenchymal cells such as ﬁbroblasts,85 epithelial cells,86 stellate cells87 and
liver epithelial cells.”90 The ability to mimic such interactions in vitro is important in
cell biology studies as well as tissue engineering applications. Mimicking in vitro this
complexity and function is difﬁcult using traditional co-culture techniques, wherein
multiple cell types are seeded randomly. Therefore, regenerating or replacing damaged
tissue using in vitro strategies has primarily focused on manipulating the cellular
environment by modulating the cell-extracellular matrix (ECM) and cell-cell
interactions.91 A challenge in engineering in vitro liver and brain tissue is identifying a
set of minimal environmental signals required to maintain function for extended
periods.92 A limitation of traditional co—culture systems is their inability to control cell
placement and manipulate cell-surface and cell-cell interactions.

Different approaches have been used to create spatially deﬁned co-cultures of two
different cell types.9" 93 However, these techniques have certain limitations. They I)
typically require adhesive proteins for cell attachment,91 2) are limited to speciﬁc parallel
geometries deﬁned by laminar ﬂow pattems,93 and 3) have been used predominantly with
cell lines rather than primary cells due to the difﬁculties involved in attaching primary
cells onto synthetic surfaces.61’77’94’95 PEMS have been shown to be excellent candidates
for biomaterial applications” 33 and provide ﬂexibility in building complex three-
dimensional architectures.96 The PEM surfaces also provide an ability to control the
arrangement of multiple cell types with subcellular resolution.94’ 97 We previously

reported that primary hepatocytes attached and spread on PEM ﬁlms.72 This chapter

40

describes the engineering of patterned co-cultures of primary hepatocytes/ﬁbroblast and

primary neurons/astrocytes on polyelectrolyte multilayer (PEM) ﬁlms without the aid of

adhesive proteins/ligands.

 
 

 
 
       

.3 ﬂ .\ i '
" o- "‘:¢"~ “"1
tug: '5 L‘s—1.». an.-

        

 

 

 

Alwrr' 'ti";"'~' ' ' A'l‘vrr' 4%: (0 ya x .-
on!«-t)u."a“vzim*“ an) .1. v.1?

 

 

 

Figure 3.1. Schematic diagram illustrates the approach to patterning co-culture of primary cells on PEM
surfaces. First, (PDAC/SPS).0 PEMS were built on top of the TCPS surfaces with SPS as the topmost
surface. Second, patterns of PDAC were formed on PEM surfaces by rrricrocontact printing (uCP) PDAC
onto the PEM surfaces. Third. patterns of primary hepatocytes/neurons were formed by capitalizing on the
preferential attachment of primary cells to SPS surfaces. Fourth, since ﬁbroblast/astrocytes, unlike the
primary cells. attached to both surfaces, astrocytes were subsequently seeded onto the patterns of primary
cells and attached onto the open PDAC regions and resulted in patterned co-cultures of primary
hepatocytes/ ﬁbroblast or primary neurons/astrocytes.

We demonstrated that patterns of primary hepatocytes/neurons and patterned cell
co-cultures can be formed without the aid of adhesive proteins using the layer-by—layer
deposition of synthetic ionic polymers. Primary hepatocytes and primary neurons
attached and spread preferentially on SPS surfaces over PDAC surfaces. We capitalized
upon this differential cell attachment and spreading of primary hepatocytes and neurons
on PDAC and SPS surfaces to make patterned co-cultures of primary
hepatocytes/ﬁbroblasts and primary neurons/astrocytes on the PEM surfaces. PDAC (or
SPS) was patterned on the (PDAC/SPS)”, surfaces by using a polymer-on-polymer
stamping (POPS) process developed by Hammond and co-workers.35‘ 98 Primary

41

hepatocytes/primary neurons were then seeded and attached preferentially attached onto
the SPS surfaces. We then seeded the second cell type (ﬁbroblasts or astrocytes) on the
PDAC surface, resulting in patterned co-culture (Figure 3.1). We evaluated the cell
morphology and function with an inverted microscope and biochemical assays,

respectively.

3.2 METHODS AND MATERIALS

3.2.1 Materials

Poly(diallyldimethylammonium chloride) (PDAC) (Mw~lO0,000-200,000) as a 20 wt %
solution, sulfonated poly(styrene), sodium salt (SPS) (Mw~70,000), ﬂuorosilanes and
sodium chloride were purchased from Aldrich (Milwaukee, WI). Poly(dimethylsiloxane)
(PDMS) from the Sylgard 184 silicone elastomer kit (Dow Corning, Midland, MI) was
used to prepare stamps. The PDMS stamps were used for microcontact printing.9
Dulbecco’s Modiﬁed Eagle Medium (DMEM) with 4.5 g/l glucose, 10X DMEM, fetal
bovine serum (FBS), penicillin and streptomycin were purchased from Life Technologies
(Gaithersburg, MD). Insulin and glucagon were purchased from Eli Lilly and Co.
(Indianapolis, IN), epidermal growth factor from Sigma Chemical (St. Louis, MO).
Puriﬁed rat albumin was purchased from Cappel Laboratories (Aurora, OH). Urea assay
was purchased from Sigma Chemical (St. Louis, MO). Carboxylated polystyrene latex
particles (4 pm diameter) purchased from Polysciences, were used for colloidal
adsorption study on patterned polyelectrolyte multilayer ﬁlms.
Chloromethylbenzoylaminotetramethyl rhodarnine (CMTMR) and

chloromethylﬂuorescein diacetate (CMFDA) were purchased from Molecular Probes for

42

double immunoﬂuorescent staining. Adult female Sprague-Dawley rats were obtained

from Charles River Laboratories (Boston, MA).

3.2.2 Preparation of Polyelectrolyte Multilayers

The PEMS were prepared as described in Chapter 2. Brieﬂy, PDAC and SPS polymer
solutions were prepared with deionized (DI) water at concentrations of 0.02M and
0.01M, respectively, (based on the repeating unit molecular weight) with the addition of
0.1M NaCl salt. TCPS plates were subjected to a Hanick plasma cleaner (Hanick
Scientiﬁc Corporation, Broading Ossining, NY) for 10 min at 0.15 torr and 50 sccm ﬂow
of Oz in a plasma chamber. A Carl Zeiss slide stainer equipped with a custom-designed
ultrasonic bath was connected to a computer to perform layer-by-layer assembly. TCPS
plates were immersed for 20 min in a polycation solution, followed by two sets of 5 min
rinses with agitation. TCPS plates were subsequently placed in a polyanion solution and
allowed to deposit for 20 min, followed by two sets of 5 min rinses with agitation. The
samples were cleaned for 3 min in an ultrasonic cleaning bath after depositing a layer of
polycation/polyanion pair. The sonication step removed weakly bounded polyelectrolytes
on the substrate, forming uniform bilayers. This process was repeated to build multiple
layers. All experiments were performed using ten (i.e., 20 layers) or ten and half bilayers

(i.e., 21 layers).

3.2.3 Primary Hepatocyte/Fibroblast Co—Culture on PEM Surfaces

Six-well plates were coated with PEM surfaces and rinsed in sterile water and sterilized
under UV light overnight. Primary hepatocytes were seeded onto the PEM surfaces at a

cell density of 1.0X106/well in a serum-free media for 36 h at 37°C, 10% C02, balance

43

air. The substrate was then rinsed three times with PBS by pipetting. On the hepatocyte-
containing substrates, NIH 3T3 cells were seeded at a density of O.5><106 cells/well and
incubated in primary hepatocyte media at 37°C. The ﬁbroblast/hepatocyte ratio used in
this study was 0.5:1 which is the approximate physiologic ratio of stromalzparenchymal
cells in the liver.99 The reusability of these patterns was also examined. The cells were
removed from the patterns with trypsin-EDTA and washed with PBS to ensure that the
cells were completely removed from the patterned surfaces. A fresh batch of primary
hepatocytes was subsequently seeded onto the re-used patterns. A Leica inverted phase
contrast microscope with Soft RT 3.5 software was used to capture images of cell

density, morphology, and spreading on the multilayer surfaces.

3.2.4 Primary N euron/Astrocyte Co—Culture on PEM Surfaces

Primary neurons and astrocytes were cultured on PEM coated 6-well tissue culture
polystyrene surfaces (TCPS). All the multilayer coated TCPS were sterilized by spraying
with 70 % ethanol and exposing them to UV light before cultruing the cells onto these
surfaces. Poly-d-lysine-coated TCPS were used as controls in these studies. Samples
were kept in the incubator where the temperature and humidity were properly controlled.
A Leica inverted phase contrast microscope with Soft RT 3.5 software was used to

capture images of cell density, morphology, and spreading on the multilayer surfaces.

3.2.5 Cell ﬂuorescent staining

The patterned co-cultures of primary hepatocytes and ﬁbroblast were observed with a
double immunoﬂuorescent staining method. The attached primary hepatocytes were

rinsed three times with 1X PBS. The cells were incubated with lmL of IOuM CMTMR

44

orange dye (dilution of 1:1000 in serum free media) for 45 min at 37°C. The cells were
then washed three times with PBS and followed by media addition. Three hours after
staining the primary hepatocytes, ﬁbroblast cells were seeded onto the stained
hepatocytes. The co-cultures were washed with PBS three times and fed hepatocyte
media. Cell morphology was observed using a phase contrast and ﬂuorescent microscope

(Leica inverted microscope).

3.2.6 Immunostaining of Primary Neurons and Astrocytes

To perform confocal immunoﬂuorescence microscopic study, neurons and astrocytes
cultures were ﬁxed for 20 min in 4% paraformaldehyde and permeabilized with 0.1%
Triton X-100 and 5% goat serum (Invitrogen) in PBS. Cells were then labeled overnight
at 4 °C with appropriate primary antibodies [1:50 neuroﬁlament for neurons and 1:1000
glial ﬁbrillary acidic protein (GFAP) for astrocytes) in 5% goat serum in PBS. After three
PBS washes, primary antibodies were detected with Fluorescein conjugated and
rhodamine conjugated secondary antibodies for neurons and astrocytes, respectively. The

cells were visualized with Leica ﬂuorescent microscope.

3.2.7 Biochemical Assays

Albumin synthesis is a widely accepted marker of hepatocyte synthetic function and urea
production is an indicator of intact nitrogen metabolism and detoxiﬁcation. The
biochemical assays were performed on the collected supernatant. Albumin concentration
was determined by an enzyme-linked immunosorbent assay described previously using a
polyclonal antibody to rat albumin“. A standard curve was derived using

chromatographically puriﬁed rat albumin dissolved in medium. Urea levels were

45

measured with commercially available kits based upon its speciﬁc reaction with diacetyl
monoxime. The urea and albumin secretions were normalized to the cell number seeded
on the surface (per 1 x 106 cells per day). Statistics was performed using the Student’s t-

test. A p value of 0.05 or lower was considered to be signiﬁcant.

3.2.8 Determination of the number of cells on the projected area

The number of cells on the projected cell area on the different surfaces was measured
using the Image J software. The projected cell area refers to the area occupied by the cells
as seen under the microscope. Statistics was performed using the Student’s t-test. A p

value of 0.05 or lower was considered to be signiﬁcant.

3.2.9 Reactive Oxygen Species (ROS) Studies

Intracellular reactive oxygen species (ROS) were detected by staining with the oxidant-
sensitive dye CM-HZDCFDA. HZDCFDA is cleaved of the ester groups by intracellular
esterases and converted into membrane impermeable, nonﬂuorescent derivative HZDCF.
Oxidation of HzDCF by ROS results in highly ﬂuorescent 2,7-dichloroﬂuorescein
(DCF).100 The cells were incubated for 30 min at 37 °C with 2 uM CM-HzDCFDA in
Hanks’ Balanced Salt Solution without phenol red (Invitrogen, CA, USA). The cells were
then washed three times with PBS and analyzed with Leica ﬂuorescent microscopy. To
quantify the ﬂuorescence level in neurons, we used Adobe Photoshop 7.0 software
(Adobe Systems). We ﬁrst delineated regions of individual primary neurons from the
ﬂuorescent image, and we then chose the image -‘ histogram menu, which graphed the
number of pixels at each color intensity level, and obtained the mean of green

ﬂuorescence intensity in those regions. The ﬂuorescence intensity was measured using all

46

the cells in ﬁve different areas and repeated on three different substrates and then
averaged for each surface. Statistics was performed using the Student’s t-test. A p value

of 0.05 or lower was considered to be signiﬁcant.

3.3 RESULTS

We demonstrate that patterns of primary cells (primary hepatocytes and primary
neurons) and co-cultures can be formed using the LbL deposition of ionic polymers
without the aid of adhesive proteins. In this study, we used synthetic polymers, PDAC
and SPS as the polycation and polyanion, respectively, to build the PEMS. SPS patterns
were formed on PEM surfaces either by microcontact printing SPS onto PDAC surfaces
or vice-versa. When primary cells were seeded on top of the patterned PEM surfaces,
they attached and spread predominantly on the SPS surfaces resulting in primary cell
patterns. Once the primary cells attached, the second cell type (ﬁbroblasts/astrocytes)
were subsequently seeded and attached to the PDAC surfaces. As a result, co-culture
patterns were obtained on synthetic PEM surfaces. The morphology of the cell co-
cultures was characterized using phase contrast and ﬂuorescence microscopy and their

hepatic-speciﬁc function were determined by urea and albumin synthesis.

3.3.1 Patterned Culture of Primary Hepatocytes on PEMs

We capitalized upon the cell adhesive/resistive property of SPS and PDAC,
respectively, to make patterns of primary hepatocytes. The technique of POPS makes the
task of micropatteming polyelectrolyte multilayers a simpler process.” For POPS, a
polyelectrolyte applied to a patterned stamp is transferred toia polyelectrolyte multilayer

surface of the opposite charge. In our study, SPS patterns were formed on PEM surfaces

47

either by uCP SPS onto (PDAC/SPS)10.5 surface or uCP PDAC onto (PDAC/SPS)”,
surface using the POPS technique. Figure 3.2 illustrates the attachment of primary
hepatocytes on PDAC and SPS patterns after one and ﬁve days of culture. When
presented with the micropattemed surface, primary hepatocytes adhered only to the SPS
regions resulting in patterns of hepatocytes. On day 1, primary hepatocytes attached and
preferentially on the SPS regions resulting in cell patterns irrespective of whether PDAC

or SPS was stamped on top of the PEM surface (Figure 3.2 A, C). The hepatocyte

Figure 3.2. Phase contrast microscope images of primary hepatocyte cells seeded at 0.5x10‘ cells/ml on
days 1 and 5 post seeding on patterned PEM surfaces. (A) and (B) primary hepatocytes on PDAC patterns
on days 1 and 5, respectively. (C) and (D) primary hepatocytes on SPS patterns on days 1 and 5,
respectively. PDMS stamp with 1000um square patterns separated by 250nm width were used. (Scale bar,
100 um).

 

patterns attached and maintained their differentiated morphology for the ﬁrst few days
but by day 5 began to detach from the PEM surfaces. Few hepatocytes remain attached to

the patterns by day 6 (Figure 3.2 B, D).We also examined the reusability of these

48

patterns. The cells were removed ﬁ'om the patterns with trypsin-EDTA and washed with
PBS to ensure that the cells were completely removed from the patterned surfaces. A
fresh batch of primary hepatocytes was subsequently seeded onto the re-used patterns.
The patterns were reused 4 times and maintained their pattern design upon each re-use

(data not shown).

3.3.2 Patterned Co—Cultures of Primary Hepatocytes with Fibroblasts

("'0'
- .
8.. r

.,_ ' «a- u
a t
_ ﬂ 3’ ' . :
g g." I
. _ . _ .7
. I I
r ‘ r
y

 

Figure 3.3. Patterned co-cultures of primary hepatocytes with ﬁbroblasts. (A) phase contrast and (B)
ﬂuorescent images of patterned primary hepatocytes (red) on PDAC patterns on day 1, phase contrast
image of co-culture of primary hepatocytes with ﬁbroblasts on (C) day 6 (D) day 19. PDMS stamp with
250nm square patterns separated by 250nm width were used. (Scale bar, 100 um).

Co—cultures of primary hepatocytes with nonparenchymal cells such as ﬁbroblasts
have been shown to maintain hepatic functions in vitro for up to 5 weeks.85 The

ﬁbroblast/hepatocyte ratio used in the present study is 0.521 which is the approximate

49

physiologic ratio of stromal:parenchymal cells in the liver.99 Figure 3.3 illustrates
patterned co-cultures of primary hepatocytes with ﬁbroblast on PEM surfaces. The
preferential attachment of primary hepatocytes to SPS surfaces enabled the use of this
system as a template for patterned co-cultures with. ﬁbroblasts on synthetic PEM
surfaces. Primary hepatocytes remained attached (Figure 3.3 C, D) on the patterned co-

culture system for up to 3 weeks.

3.3.3 Function of Primary Hepatocytes in Patterned Co-Cultures

To assess liver-speciﬁc function, we measured the levels of urea and albumin
synthesis for the patterned single culture and co-cultures for up to 7 days, shown in
Figure 3.4. The metabolic response of the single and co-cultures of hepatocytes on
patterned PEM ﬁlms were compared. Panels A and B illustrate the rate of urea and
albumin production, respectively, for cultures up to one week. By day 7, liver-speciﬁc
functions for the patterned co-culture (60 ug/ 1x106 cells/day of urea and 20 rig/1x106
cells/day of albumin) were much higher than the patterned single cultures (28.3 ug/ 1x106
cells/day of urea and 2.7 rig/1x106 cells/day of albumin). The urea and albumin secreted
by our patterned co-culture system was also comparable to levels secreted in the culture
system developed by Bhatia et a1. (80 rig/1x106 cells/day of urea and 15 rig/1x106
cells/day of albumin)99 for a similar ﬁbroblast and hepatocyte culture ratio (0.521),

although different pattern sizes and shapes were used in these two studies.

50

 

 

 

 

  

 

 

 

 

 

 

 

 

 

 

 

 

l Urea Assay

‘ 120
g +Patterned Hepatocyte
% i 100 t:-—i‘atta...cd Co-culture A
E |
g :80 ._
a E
e .. *
,. :60 ~———— ﬁg
.- 8
a 5 l A
a ‘ 40 T’ v V \1
g i 20 7 I
a l

l

l 0 . . r r

i o 1 2 3 Days 4 5 6 7
B)

Albumin * ‘
20 -

 

 

 

 

 

44 Albumin (pg/ 1 x 106 cells] day)
3

Days

i
l
l
l
I

Figure 3.4. Liver-speciﬁc function of primary hepatocytes on PEM surfaces. (A) Urea synthesis of
patterned hepatocytes and patterned co-cultures. (B) Albumin synthesis of patterned hepatocytes and
patterned co-cultures (n=6). Data represents mean at S.E. of six independent experiments. (* p<0.05
compared with patterned single hepatocyte culture)

51

Table 3.1. Comparison of maximum achievable levels of hepatic-specific
function (urea and albumin secreted) in various hepatocyte culture
systems. Urea and albumin secreted per 1 x 10° cells were approximated
from experimental data and available literature

 

Hepatocyte Culture Systems Urea Secreted Albumin Secreted
ﬂ/lxlO‘cells /h) (pg /1x106cells /h)

 

 

 

Human liver in viva " 5—8 2-3.3
Single collagen gel b 1.2-2.0 0.1-0.3
Sandwich gel ° 3-4 1-2

 

Random co-culture of
hepatocytes and fibroblast in 2-3.5 0.25-0.4
0.5:] ratio d

 

Patterned co-culture of
hepatocytes/fibroblast in 4-5 1-2
0.5:] ratio (Bhatia et al) ‘

 

 

 

 

 

3.3.4 Patterned Co-Cultures of Primary Neurons with Astrocytes

Figure 3.5 illustrates the random and patterned primary neuron monoculture and
co-culture of primary neurons and astrocytes. Figure 3.5 (A, B) shows the ﬂuorescent
images of mono-culture of primary neurons and random co—culture, respectively, on top
of non-pattemed SPS surfaces. Figure 3.5 (C, D) illustrates the ﬂuorescent images of
patterned primary neurons and patterned co-culture of neurons and astrocytes. PDAC
patterns were formed on SPS surfaces (or vice-versa) and subsequently seeded with
neuronal cells. Primary neurons preferentially attached on the SPS patterns when they
were seeded on top of PEM surfaces (Figure 3.5 C). Astrocytes were subsequently seeded

52

onto the patterns of neurons and the cells attached onto the open PDAC regions and

resulted in patterned co-cultures of neurons and astrocytes (Figure 3.5 D).

A B

 

Figure 3.5. Fluorescent images of primary neurons and astrocytes co-culture on SPS surfaces (A) Random
neuron monocultures (green) after 7 days in culture, (B) Random co-culture of neurons (green) and
astrocytes (red) after seeding astrocytes. (C) Patterned primary neurons on SPS pattems after 7 days in
culture (D) Patterned co-culture of neurons (green) and astrocytes (red) after seeding astrocytes (Scale bars-
200 um).

Studies show that random, dissociated neurons in culture develop physiological

39. 40 40—43

responses to neurotransmitters and self—organize into neuronal networks,
however, they lack the structure normally present within the nervous system, where the
neurons reside in speciﬁc regions with numerous network connectivity. The advantage of
patterned co-cultures of neurons and astrocytes is that it allowed for precise control of

both the direction of neurite extension and degree of contact between the neurons and

astrocytes, unlike the random co-culture, which is important for repair and regeneration

53

of the nervous systems.44 It has also been demonstrated by Wheeler and co-workers that

patterned neurons synapse with each other, release neurotransmitters and develop

45—47

electrical activity . Furthermore, restricting neurons to patterns has been shown to

enhance the cellular activity such as glutamine secretion and electrical activity as
compared to the random monocultures of neurons.“ 49

3.3.5 Reactive Oxygen Species (ROS) Studies on Co—culture Systems
A B
— _‘
C D
- -'

Figure 3.6. Intracellular accumulation of ROS in neurons. Astrocytes were treated for 12 h with (A) 5%
BSA (control) and (B) 0.2 mM of PA, followed by transfer of the astrocytes-conditioned media to neurons

for 24 h treatment. Patterned neuron-astrocytes co—culture were treated for 12h with (C) 5% BSA (control)
and (D) 0.2 mM ofpalmitate (PA). (Scale bars- A-C: 50pm, D: lOOum)

   

 

ROS is a widely accepted marker of oxidative stress and the results indicated that

elevated levels of FFAs induced astrocyte-mediated oxidative stress in the neurons.

54

Previously, it was shown that intracellular levels of ROS were elevated when the neurons
were cultured with conditioned media from astrocytes treated with palmitic acid (PA) as
compared to controls (i.e., cultured with conditioned media from astrocytes treated with

‘0' Here, we compared the astrocyte-mediated

5% bovine serum albumin (BSA) media).
response of neurons in the present patterned co-culture system with the previous, more
common, method of culture.

The earlier study used random neuronal monocultures to evaluate the effect of F FAs
on primary neuronslm’ ‘02 As shown in Figure 3.6 (A,B), the intracellular levels of ROS
were elevated in the neurons cultured in conditioned media from astrocytes treated with
PA (Figure 3.6B) as compared to the controls (Figure 3.6A). The astrocytes were treated
with 0.2 mM PA for 12 h prior to transfer of the conditioned media to neuronal cultures
for 24h (Figure 3.6B). By contrast, random monocultures of neurons treated directly with
PA did not show oxidative stress-induced effects in the neurons.'°1’ ‘02 We also exposed
the co-culture system of neurons and astrocytes to elevated levels of FFAs. When the co-
culture system was treated with BSA, an elevation in ROS was not observed (Figure
3.6C). In Figure 3.6D, we treated the co-culture system with 0.2 mM PA for 12 h and
then performed the ROS measurements. The patterned neuron-astrocyte co-culture
systems treated with fatty acids for 12h had comparable levels of ROS (Figure 3.6D) to
the neurons cultured for 24h with conditioned media from astrocytes treated with fatty
acids (separated monoculture system). The neuronal cells were seeded at the same

density on the random monoculture (Figure 3.6A and 3.6B) and patterned co-culture

systems(Figure 3.6C and 3.6D). The level of ROS was further quantiﬁed by measuring

55

the green ﬂuorescence intensity of DCF from microscopic images using Photoshop

software (Adobe Systems, Mountain View, CA) as shown in Figure 3.7.

 

 

 

 

 

DCF ﬂuorescence
(pixel intensity)

 

 

 

1 2h 24h patterned

 

 

 

Figure 3.7. Quantiﬁcation of intracellular accumulation of ROS in neurons. Data represents mean i S.E. of
three independent experiments (* p<0.05 compared with 12h treatment of monocultures of neurons).

The level of ROS on the patterned neuron-astrocyte co-culture system treated with fatty
acids for 12h was comparable to the random neuronal monoculture neurons systems
treated in conditioned media ﬁ'om astrocytes treated with fatty acids for 24h. In the co-
culture system, since both the astrocytes and the neuronal cells were on the same surface,
the elevation in the ROS levels was observed earlier than in the separated monoculture
system. This earlier response (i.e., the rapid elevation of ROS production in the co-
culture) may be because 1) both types of cells were in the same culture media, which
allowed the neuronal cells to response to soluble factors, such as oxidative-stress
inducing cytokines or intermediate metabolites, as they were secreted by the astrocytes,

or 2) the co-culture system allowed for direct contact between neurons and astrocytes.

56

3.4 DISCUSSIONS

In this study, we demonstrated an alternative approach to engineer patterned
cell co-culture of primary hepatocytes and ﬁbroblast without the aid of adhesive proteins
using the PEM ﬁlms. In Table 3.1, we compared the maximum achievable levels of
hepatic-speciﬁc function in our co-culture system to in vivo and other in vitro hepatocyte
co-culture systems studied, namely, the collagen double gel and the co-culture system
studied by Bhatia and co-workers. By comparison, the human liver in viva, consisting of
150-250 X 109 hepatocytes, secretes approximately 5-8 ug /1x106cells /h of urea and 2-
3.3 ug /1x106cells /h of albumin.103 The hepatic-speciﬁc function obtained on the PEM
ﬁlms was comparable to the collagen coated tissue-culture polystyrene (TCPS) surfaces,
the collagen double gel, the co-culture system and the in viva human liver. Primary
hepatocytes cultured using previously well established techniques are stable, but there are

certain disadvantages associated with each of these methods.

3.4.1 Advantages of our Culture System over other Hepatocyte Culture

Systems

Collagen sandwich (double gel) cultures preclude direct cell-cell interaction
between the sandwiched hepatocytes and other cells types that may be cultured atop the
collagen sandwich. Donato et al used transwells to form co-cultures, therefore the cells
were not in direct contact with each other.104 This culture system imposed an artiﬁcial
boundary that precluded cell-cell interactions. Shimaoka and co-workers developed a
method whereby hepatocytes were cultured onto cover slips and the cover slips were

subsequently added to the center of a conﬂuent culture of ﬁbroblastms This method

57

resulted in signiﬁcant cell death underneath the cover slip. Furthermore, signiﬁcant
topological variations in the culture existed which caused variations in the degree of cell-
cell interactions. Bhatia et a1. developed a patterned co-culture system using
photolithography.99 This method was very effective in controlling cell contact and
adhesion, but the lithographic technique used has a number of limitations when applied to
curved, nonplanar surfaces and involved multiple and cell-unﬁiendly processing steps to
create the patterns. Furthermore, collagen must be added to the patterns in order for the
primary hepatocytes to adhere onto the surface.

In the present study we used uCP which has several advantages over the method
used by Bhatia et al. The advantages include its high ﬁdelity, ease of duplication, ability
to print a variety of molecules with nanometer resolution and without the need for dust-
free environments and harsh chemical treatments.”' 63’ '06 In addition, we were able to
achieve primary hepatocytes adhesion without the need of collagen or other adhesive

proteins.

3.4.2 Advantages of our Culture System over other Neuron Culture Systems

Numerous studies use monocultures of neurons and astrocytes to study neuronal
systems, however, monocultures of neurons and astrocytes do not accurately capture the
diverse biological responses of living brain tissue.107 Transwells or neurons cultured onto
cover slips that were subsequently added to the center of a conﬂuent culture of astrocytes
are the most common forms of co-cultures of neurons and astrocytes!“ ‘09 However,
these culture systems imposed an artiﬁcial boundary that precluded cell-cell interactions.
In the present study, we developed patterned neuron-astrocyte co-culture system using

PEM ﬁlms and uCP which has several advantages over the methods generally used for

58

patterning surfaces for co-cultures. The advantages include its high ﬁdelity, ease of
duplication, ability to print a variety of molecules with nanometer resolution and without
the need for dust-free environments and harsh chemical treatmentsls’ 63' ‘06 In addition,
we were able to achieve primary neuron-astrocyte interactions without adhesive proteins,

which was not possible with the other methods.94’ “0

3.5 CONCLUSIONS

In conclusion, the present work outlined a method for controlling cell-surface
interactions using polyions and PEMS. PEMS were used to produce deﬁned cell-resistant
and cell-adhesive properties depending on the topmost surface and the type of cells. We
demonstrated using both biochemical studies and direct microscopy images of live cells
that primary hepatocytes and primary neurons attached and spread onto PEM ﬁlms with
SPS as the top most surface. We also demonstrated that the layer-by-layer deposition and
uCP of ionic polymers can be used as a template for patterned. co-cultures of primary
hepatocytes/ﬁbroblasts and primary neurons/astrocytes. The patterned co-cultures of
primary hepatocytes and ﬁbroblasts maintained hepato-speciﬁc function much longer
than the patterned single culture of primary hepatocytes. The patterned co-culture system
where the neurons are in direct contact with the astrocytes responded quicker to elevated
levels of F FAs than the separated neuronal monoculture system. Taken together, this
technique provides a useful tool for engineering neuronal and hepatocyte co—culture
systems, which may more accurately capture liver and neuronal function and metabolism

in normal versus diseased states.

59

CHAPTER 4 SELECTIVE DEPOSITIONS ON
POLYELECLECTROLYTE MULTILAYER FILMS: SAMS
OF m-dPEG ACID AS MOLECULAR TEMPLATE

4.1 INTRODUCTION

In recent years, organic thin ﬁhns have attracted a great deal of attention ﬁ'om
researchers in many ﬁelds due to their light-weight, ﬂexibility, ease of functionalization
and application. The ionic layer-by-layer (LBL) assembly technique, introduced by
Decher in 1991,'”’ ”2 is among the most exciting recent developments in this area. Fihns
formed by electrostatic interactions between oppositely charged poly-ion species to create
alternating layers of sequentially adsorbed poly-ions are called “Polyelectrolyte
Multilayers (PEMs)”. PEMsl 12"” are effective and economical approaches to depositing

organic ultrathin organized ﬁlms and have been further extended to functional

116 117, 118 119-121 122, 123

polymers,l 15’ organic dyes, colloids, inorganic nanoparticles,

124,125 6

biomaterials, and selective electroless metal depositions.12

The use of organic thin ﬁlms in integrated optics, microelectronic devices, sensors
and optical memory devices requires a means of patterning and controlling the device
architecture. Photolithography is the conventional patterning technique of choice but
lithographic techniques have limitations when applied to curved, nonplanar surfaces and
involves multiple processing steps to create three dimensional, functional, and multiple-
level microstructures. Microcontact printing (uCP), introduced by Whitesides and co-

'8' 63 provides a versatile method of chemically and molecularly patterning

workers,
surfaces at the submicrometer scale. This technique is attractive due to its high ﬁdelity

and ease of duplication. uCP uses an elastomeric stamp to print a variety of molecules

60

with submicrometer resolution and without the need for dust-free environments and harsh
chemical treatments.“ 63’ '06 The stamp is coated with the desired molecules, and the
molecules residing on the raised regions of the stamp are brought in contact with the host
substrate when the stamp is printed. The transfer efﬁciency of the molecules from the
stamp to the substrate depends on the relative strength of the interaction of these

molecules with the substrate versus with the stamp.

,,,0/\/°\/\0/\/°\/\[(°H

RIW = 236.26

Figure 4.1. Chemical structure of PEG acid molecule (m—dPEG acid).

On the basis of the uCP and the LBL assembly techniques, Hammond and co-
workers developed a polymer-on-polymer stamping (POPS) process using charged graft
and diblock copolymers or polyelectrolytes as the ink.”’ 98 They achieved selective
deposition by introducing alternating regions of different chemical functionalities on a
surface: one promoted adsorption and another effectively resisted adsorption of poly-ions
onto the surface. We are exploring a similar approach where m-dPEG molecule with an
activated carboxylic acid group at the end can be stamped directly onto multilayer ﬁlms
to form patterned monolayers of SAMS, by carefully selecting their surface chemistry and
taking advantage of electrostatic interaction between the top surface of the multilayer

ﬁlm and the stamped molecule. Chemical patterning of the topmost surface of the

61

multilayer ﬁlms provides a new non-lithographic approach to building and controlling

device architectures.

m-dPEG acid SAMS

 

Substrate-Glass Slide

 

Figure 4.2. An illustration of patterned SAMS on PEM.

In this study, we describe the process of creating chemically patterned and
physically structured surfaces by stamping molecules of m-dPEG acid (shown in Figure
4.1) activated with carboxylic acid at one end. Note that this is the ﬁrst time patterned
SAMS were created on PEMS (illustrated in Figure 4.2), as oppose to on gold or silicon
substrates. The activated carboxylate functional group ionically binds to the topmost
positive surface of the PEM surfaces and the other end (PEG units) resists the deposit of
subsequent polymer (polyelectrolyte) layers. To create surfaces which can act as
templates for selective layer-by-layer deposition, it is necessary to form surface regions
that resist poly-ionic adsorption. To this end, poly(ethylene glycol) (PEG) and its
oligomeric derivatives have thus far been the most effective materials to resist
nonspeciﬁc adsorption of polyelectrolytes, charged particles and proteins onto surfaces
from aqueous solutionm'132 PEG is a technologically important polymer used in
numerous applicationsm'145 We capitalized upon ionic interactions to deposit thin,

uniform PEG self-assembled monolayer patterns atop PEM ﬁhns and evaluated the

62

factors that inﬂuence the effective transfer of m-dPEG acid molecules onto the multilayer
ﬁlms as illustrated in Figure 4.3. Our motivation for exploring the m-dPEG acid molecule
as the molecular template for selective deposition is that it is a small molecule compared

to other polymers with the PEG backbone used in other similar studies. As a result, it will

   

}/.(PDAOSPS)

' }-—DGlass sire.-

 

 

 

Patterns of 1 Remove stamp after 15 min
PEGa molecule

 

 

 

‘1'"- ; tr , a; >3}: 3

 

New polyelectrolyte multilayers
adsorption onto patterned platform

 

33.1” ‘. Esr- 3”,}PEMS

 

 

 

Figure 4.3. Diagram illustrating the stamping process of m—dPEG acid on a PDAC/SPS multilayer platform

63

provide us with better control in the pattern transfer onto the PEM surface. In addition, it
can self-assemble to form monolayers on PEMS. The patterned SAMS on PEMS are
possible like alkanethiol and alkanesilane SAMS that have been formed on gold or silicon
wafers. We demonstrate that the PEG molecules create areas of selective adsorption on
the multilayer ﬁlms and be used in the subsequent generation of 3-D microstructure
ﬁlms. The pattemed ﬁlms were characterized by optical microscopy and atomic force

microscopy (AFM).

4.2 METHODS AND MATERIALS

4.2.1 Materials

Sulfonated poly(styrene), sodium salt (SPS) (Mw ~70 000),
poly(diallyldimethylarnmoniumchloride) (PDAC) (Mw ~ 100 000-200 000) as a 20 wt %
solution and sodium chloride were purchased from Aldrich Chemical, Milwaukee, WI.
The m-dPEG acid molecule (Mw=236) was obtained from Quanta biodesigrr.
Poly(dimethylsiloxane) (PDMS) from the Sylgard 184 silicone elastomer kit (Dow
Corning, Midland, MI) was used to prepare stamps. The ﬂuorosilanes was purchased
from Aldrich Chemical. These PDMS stamps were used for microcontact printing.9 Glass
slides (Corning Glass Works, Corning, NY), used for making the polyelectrolyte
multilayer ﬁlms, were cleaned using a Bransonic ultrasonic cleaner (Bransonic Ultrasonic
Corporation, Danbury, CT). Carboxyﬂuorescein (6—CF), ﬂuorescence dye, was purchased
and used as received from Sigma. Carboxylated polystyrene latex particles (4 pm
diameter) purchased from Polysciences, were used for colloidal adsorption study on m-

dPEG self-assembled monolayer patterned polyelectrolyte templates.

64

4.2.2 Preparation of Polyelectrolyte Multilayer Thin Films

The strong polyelectrolytes SPS and PDAC were used to fabricate multilayer platforms
using glass slides as the substrates. A Carl Zeiss slide stainer equipped with a custom-
designed ultrasonic bath was connected to a computer to perform layer-by-layer
assembly. Polyelectrolyte dipping solutions were prepared with DI water supplied by a
Bamstead Nanopure-UV 4 stage puriﬁer (Bamstead International Dubuque, Iowa),
equipped with a UV source and ﬁnal 0.2 pm ﬁlter. The concentration of SPS was 0.01 M
and the concentration of PDAC solution was 0.02 M as based on the molecular repeat
unit of the polymer and all polyelectrolyte solutions contained 0.1M NaCl. Solutions
were ﬁltered with a 0.45 pm Acrodisc syringe ﬁlter (Pall Corporation) to remove any
particulates. The glass slides were cleaned with a dilute Lysol water mixture in a
sonicator. These slides were then dried under N2 gas and were further cleaned using
Harrick plasma cleaner (Hanick Scientiﬁc Corporation, Broading Ossining, NY) for 10
min at 0.15 Torr and 50 sccm ﬂow of Oz in a plasma chamber. To form the ﬁrst bilayer,
the slides were immersed for 20 min in a PDAC solution. Following two sets of 5 min
rinse with agitation, the slides were subsequently placed in a SPS solution and allowed to
deposit for 20 min. They were rinsed twice for 5 min each. The samples were cleaned for
3 min in an ultrasonic cleaning bath after depositing a layer of polycation/polyanion
pair.‘28 The sonication step removes weakly bounded polyelectrolytes on the substrate,
forming uniform bilayers. This process was repeated to build multiple layers. All
experiments were performed using ten and half bilayers (i.e., 21 layers) and the topmost

surface being PDAC (positive surface).

65

4.2.3 Preparation of PDMS Stamps

An elastomeric stamp is made by curing poly(dimethylsiloxane) (PDMS) on a
microfabricated silicon master, which acts as a mold, to allow the surface topology of the
stamp to form a negative replica of the master. The poly(dimethylsiloxane) (PDMS)
stamps were made by pouring a 10:1 solution of elastomer and initiator over a prepared
silicon master."3 The silicon master was pretreated with ﬂuorosilanes to facilitate the
removal of the PDMS stamps from the silicon masters. The mixture was allowed to cure
overnight at 60°C. The masters were prepared in the Microsystems Technology Lab at

MIT and consisted of features (parallel lines and circles) from 1 run to 10 um.

4.2.4 Stamping of m-dPEG acid

The stamping conditions were varied to optimize the microcontact printing of the m-
dPEG acid. PDMS stamps with and without plasma treatment were tested to stamp the
ink. Ethanol/water mixtures were used as inks. Five solvents of this type were tried: pure
ethanol, 75 % ethanol, 50 % ethanol, 25 % ethanol and pure water. The m-dPEG acid
inks made with these solvents had concentrations of IOuM, lOOuM and lOOOuM. After
solvent evaporation, the PDMS stamp was brieﬂy dried under a N2 stream and brought
into contact with the substrate for 10-15 min at room temperature. Three different
methods were used to ink the PDMS stamps: spin-inking, cotton swab-inking and dip-
inking. For spin-inking the stamp was covered with ink and spun at 3,000 RPM for 20 s.
For the cotton swab-inking, a cotton swab was soaked in ink and rubbed over the surface
of the stamp. The stamp was then dried with nitrogen. Using the dip-inking the stamp
was soaked in ink, typically for 10 minutes, and dried with nitrogen. ”6 In this study, the

stamping times were varied systematically from a few seconds to an hour and the pH of

66

the m-dPEG acid ink solution was varied from 2.0, 3.5, 4.5 to 6.5. Following the
stamping process, the patterned surface was rinsed thoroughly with ethanol to remove
unbound or loosely bound excess molecules to prepare self-assembled monolayer
patterns. The stamped regions were designed to act as resists to adsorption as the
oligoethylene glycol graft chains of PEG did.98 In the procedure of creating complex 3-D
microstructures, m-dPEG acid was stamped onto PEM surface (PDAC surface) followed
by sequential adsorption layer-by-layer deposition process to build additional pattemed

polyelectrolyte multilayers outside the stamped region.

4.2.5 Characterization

Nikon Eclipse ME 600 optical microscope (Nikon, Melville, NY) was used to obtain dark
ﬁeld images of the m-dPEG acid patterns and the additional microfabricated PEMS.
Nikon Eclipse E 400 microscope was used to obtain the ﬂuorescence images. The 6-
carboxyﬂuorescein (6-CF) dye was used to visualize the m-dPEG SAM patterns on PEM
following the stamping and rinsing processes. The dye was dissolved directly in 0.1 M
NaOH; samples were imaged by dipping the substrates into the dye solution. The dye,
which is negatively charged, preferentially stained the positively charged PDAC surface.
The dyed regions appear green when viewed with the ﬂuorescence optical micros00pe,
using a FITC ﬁlter.I47 Images were captured with a digital camera and processed on a
Pentium computer running camera software. After the polymers were stamped atop the
multilayer platform, the topography of the stamped polyelectrolyte layer was observed by
atomic force microscope (AFM) images. The AFM images were obtained with a
Nanoscale IV controller (Digital Instruments, Santa Barbara, CA) equipped with Tapping

Mode Etched Silicon Probes and was operated in tapping mode.

67

4.3 RESULTS AND DISCUSSION

For the ﬁrst time, we demonstrate that the creation of patterned SAMS on PEMS,
using PEG acid molecules, can be achieved, as alkanethiol and alkanesilane molecules
can form SAMS on gold or silicon wafers. In addition, we present approaches to
fabricate complex 3-D microstructured functional ﬁlms by incorporating the created m-
dPEG SAMS on PEM surfaces. Using m-dPEG acid molecules with an activated
carboxylic group facilitated the attachment of the m-dPEG acid molecules onto the
topmost positive surface (PDAC) of the PEM surfaces (PDAC/SPS)10,5 via ionic bonding.
The SAM patterns of m-dPEG acid molecule act as a resistive template by resisting the
addition of polyelectrolytes on the stamped regions. This helps to achieve complex 3-D
microstructures atop the original set of PEMS by permitting selective building of
subsequent PEMS outside the m-dPEG SAM patterns. The patterns were characterized

using AF M, optical and ﬂuorescence microscopy.

4.3.1 Patterning m-dPEG SAMs on Polyelectrolyte Multilayers

In this study, we stamped m-dPEG acid molecule directly onto an outermost

PDAC layer of a PDAC/SPS multilayer ﬁlm to form patterned m-dPEG SAMS on PEMS.
To enhance the transfer of the m-dPEG SAM patterns and the subsequent building of

complex microstructures, the stamping process required optimized conditions.

68

4.3.1.1 Optimization of Stamping Process

A

   

Figure 4.4. Defects occurring under non-optimized stamping conditions: (a) Rimming occurs in areas of
the stamp that were insufﬁciently inked (bare regions were also observed). (b) Streaking due to uneven
application of the m-dPEG acid ink solution on the PDMS surface. All the images are ﬂuorescence images
and the bars represent 20pm.

Figure 4.4 illustrates the various defects that occurred when m-dPEG acid
molecules were stamped under non-optimized conditions. For example, rimming (Figure
4.4a) or streaking (Figure 4.4b) in the stamped areas may arise when insufﬁciently or
uneven application of the m-dPEG acid ink solution on the PDMS surface occurs.
Determining the optimal conditions is important in achieving uniform and efﬁcient
transfer of m-dPEG acid molecules to fortn patterned SAMS on PEMS, which in turn
affects the integrity of the device architecture for further applications. Various factors
were evaluated in optimizing the stamping process, such as the plasma treatment of the
PDMS stamps, the type and concentration of the solvents used in making the ink solution
and the contact times. The PDMS stamps were not treated with oxygen plasma since it
was experimentally determined that untreated PDMS stamps resulted in more complete
transfer of patterns when compared to the stamps treated with plasma. 75% (v/v)
ethanol/water solvent gave the best results in terms of the effective transfer of the ink

solution ﬁom the PDMS stamps onto the surface and thus was used for the rest of the

69

experiments. This optimal ethanol/water composition of the ink solvent was
corresponded to the previous results reported by the Hammond group.35 Three different
methods were used to ink the PDMS stamps: spin-inking, cotton swab-inking and dip-
inking. It was experimentally determined that the dip-inking method resulted in the most
efﬁcient transfer of the ink onto the PEM surface. The contact times were also varied
from a few seconds to 30 min. The best pattern transfer resulted with a 15 min contact
time. Based upon the variables discussed above, the optimal stamping condition for m-
dPEG acid was determined to be a solution of 100 M of m-dPEG acid in a 75/25
ethanol-water mixture, stamped for 15 min using the dip-inking method of inking the

PDMS stamps.

4.3.1.2 Effect of pH

Among the variables, the pH of m-dPEG acid ink solution played the most
important role in the transfer efﬁciency of the patterns onto the multilayer ﬁlms. Figure
4.5 illustrates the effect of pH of the m-dPEG acid “ink” on the patterns of PEG SAM
formed atop (PDAC/SPS).0,5 using ﬂuorescent microscopy. The ﬂuorescence dye used
stained the PDAC surface due to ionic interaction. The presence of an alternating
positive/m-dPEG SAM pattern is made clear by the presence of the negatively charged
green dye on the positive PDAC regions. The dark regions represent the m-dPEG acid
patterns, which are not stained by the dye due to the lack of ionic interaction between the
dye and m-dPEG acid surface. The carboxylic group of m-dPEG acid is responsible for
the ionic interaction between m-dPEG SAM and the PDAC surface of the PEM. The
extent of ionization of the acid group affects the strength of the ionic bond between the

two ions and thus the extent of the pattern transfer. The ionization of m-dPEG acid, in

70

turn, depends on the pH of the solution. It is apparent from Figure 4.5 that the

micropattem transferred cleanly at pH of 4.5 and 6.5 and in case of pH values less than

the pKa the transfer was not efﬁcient.
- -
- -
Figure 4.5. Effect of pH of m-dPEG acid “ink" on the patterns on top of (PDAC/SPS).0,5 (a) pH=6.5; (b)
pH=4.5; (c) pH=3.5; (d) pH=2.0. The green regions are the PEM ﬁlms and the black regions are the m-
dPEG acid surface. The m-dPEG acid ink solution was evaluated at pH of 2.0, 3.5, 4.5, and 6.5. When the
pH is less than the pKa of the molecule (4.27i0.20), the acid group does not completely ionize leading to
incomplete transfer of the patterns onto the multilayer ﬁlms when compared to solutions with pH greater
than the pKa value. At pH of 4.5 and 6.5, uniform patterns are obtained due to the complete ionization of

m—dPEG acid, resulting in stronger electrostatic attraction between the PDAC layer and the m-dPEG acid
molecule. All the images are ﬂuorescence images and the bars represent 20pm.

 

71

4.3.2 3-D Microstructures Fabricated on PEMS

PDAC/SPS

.. In
it. ﬁt
C.

(J

:5.

‘ it}???

O“-

r

.3."

‘ ”7..

it". ~ 5 I
i) y- s

‘D
. vs

"I"

L“.

 

Figure 4.6. Optical microscope Image of the m—dPEG acid patterns and dark ﬁeld and ﬂuorescent images
of corrrplex microstructures built atop the m—dPEG acid patterns (a) m-dPEG acid was stamped on
(PDAC/SPS).0_5 as a resisting pattern using a blank starrrp and carboxylated polystyrene beads (D=4.l um)
were deposited on the outside regions of the m—dPEG self-assembled monolayer patterned surfaces. The
leﬁ region, where there are no colloidal particles, is the m—dPEG acid region while the right region with the
colloidal particles is the PEM region (b) Dark ﬁeld optical images of complex microstructures formed by
building PDAC/SPS atop the PEG patterns. The white regions are the PEM ﬁlms and the black regions are
the m-dPEG acid surface.

The fabrication of 3-D microstructures on PEMS using m-dPEG acid monolayer
patterns as molecular resisting area is illustrated in Figure 4.6. PEG is known to be an
effective polyelectrolyte that resists attachment of polymeric functional groups.148 One of
the goals in this work is to fabricate PEG self-assembled monolayer patterns onto PEMS
by capitalizing upon ionic interactions at one end of the m-dPEG acid molecule and its
resistance properties at the other end. As a further proof for the existence of m-dPEG
monolayer patterns on the PEM surface, negatively charged carboxylated polystyrene PS
particles (Diameter = 4 pm) were used. m-dPEG acid molecules were stamped on top of
the (PDAC/SPS)10,5 using a blank stamp (i.e., stamp with no patterns) as shown in Figure
4a and the colloidal particles deposited selectively over the positive (PDAC/SPS)10.5
surface (right) but not on the m-dPEG self-assembled monolayer regions (left). We were

able to construct complex 3-D microstructures on top of the PEG monolayer patterned

72

PEMs, for a variety of applications. After transfening m-dPEG monolayer patterns onto
the PEM surfaces, subsequent depositing of PEMS resulted in 3—D heterostructures on the
non-m-dPEG acid regions. Dark ﬁeld optical microscopy and ﬂuorescence microscopy
were used to image the complex microstructures. Figure4.6 B illustrates dark ﬁeld image
of the PEMS built on top of the m-dPEG acid patterns. The black regions represent the m-
dPEG acid surfaces and the white regions represent the subsequent PEM ﬁhns built on
top of the m-dPEG SAM patterns. The white images of the patterned multilayers are due
to the loopy and wavy deposits of the PEMS on the conﬁned region (outside of the m-
dPEG monolayer patterns).

To provide further conﬁrmation of the presence of the microstructures, Figure 4.7
illustrates the corresponding AFM images of the PDAC/SPS multilayer ﬁhns built atop
the stamped m-dPEG acid molecules. These images show the topography and the height
variations of the PEM patterns deposited on the outside regions of the m-dPEG SAM
patterns (i.e. the exposed PDAC area). The AFM images were taken for different number
of layers of 3-D patterned PEMS namely, 10, 20 and 40 bilayers. The height and the
width of the patterns were determined using the AFM images. The height of the 3-D
micropattemed PEMS (PDAC/SPS) linearly increased with the number of (PDAC/SPS)
bilayers built on the outside region of the m-dPEG patterned SAM area. The heights of
the 3-D microfabricated PEMS were determined by the AFM images and found to be 32-
37mm for 10 bilayers, 62-67mm for 20 bilayers and 142-146nm for 40 bilayers. From
these values, the average height of a pair of PDAC/SPS ﬁlm was determined to be
approximately 3.28-3.57 nm. This value agreed quiet well with the literature value of

3.4nm for similar deposition condition. 128

73

 

Helght=32-37nm
m r l‘ll
.J‘th WWW i 'l ri'

 

 

 

 

 

till t=62-67nm
kftjtjt

- Ht=142-146nm

"HK W 'l,
th t lk

 

 

 

 

 

 

 

 

 

(C) '

Figure 4.7. AFM images and topography of complex microstructures with different number of bilayers of
PDAC/SPS built atop the m-dPEG acid patterns. (a) 10 bilayers (b) 20 bilayers and (c) 40 bilayers.

4.4 CONCLUSIONS

Micropatteming of the m-dPEG self-assembled monolayers has been
demonstrated on PEM ﬁlms as well as the building of subsequent 3-D micropattemed
PEM structures on top of PEMS. Microfabrication of the functional and structured
surfaces and interfaces were made using electrostatic interactions at the layered
interfaces. In this work, the micropatterrring of small PEG modiﬁed molecules, m-dPEG
acid on polymer surfaces (PEM ﬁlms) were achieved purely by electrostatic interactions.
The stamping process was optimized by evaluating various conditions such as the inking
method, the concentration, the contact times and the need for plasma treatment of the

74

stamps. Our results indicate that the strength of the ionic interactions between the acid
and amine groups was the determining variable during the stamping process. This
variable was controlled mainly by the pH of the ink solution and the contact time. Strong
polyelectrolytes such as PDAC and SPS are highly ionized over all or most of the pH
range. On the other hand, the m-dPEG acid molecule undergo ionic interaction with
PDAC when its acid group is completely ionized, which depends on the pH of the m-
dPEG acid ink solution. Clean pattern transfer occurred for pH greater than the pKa value
of m-dPEG acid. By patterning an initial set of multilayer ﬁlms with a resistant molecule
followed by subsequent deposition of multilayer ﬁlms, permitted the building of complex
3-D microstructures. These new patterned and structured surfaces have potential
applications in microelectronic devices, electro-optical and biochemical sensors. Finally,
possibilities also exist in a variety other areas that capitalize upon the formation of
patterns and complex microstructures, including biotechnological and biomedical

applications.

75

CHAPTER 5 SALT TUNABLE m-dPEG ACID PATTERNS
ON POLYELECTROLYTE MULTILAYERS: TEMPLATES
FOR DIRECTED DEPOSITION OF MACROMOLECULES

5.1 INTRODUCTION

Over the past decades, the development of new methods for fabricating thin ﬁhns
that provide precise control of the three-dimensional topography and cell adhesion has
generated lots of interest. These ﬁhns could lead to signiﬁcant advances in the ﬁelds of
tissue engineering, drug delivery and biosensors which have become increasingly
germane applications in the ﬁeld of chemical engineering. The ability to engineer surface
properties such as hydrophobicity, charge, and adhesion at the micrometer scale are
critical to the success of emerging technologies (e.g., bio-sensors, optical technologies
and tissue engineering). Self-assembled monolayers (SAMS) have been extensively used
to modify and control properties of gold and silicon surfaces.5 Patterned alkanethiol SAM
surfaces have been created using microcontact printing6 and UV photopatteming
techniques,7 however, the intricacy of surface patterns that can be created with
established approaches are limited. Methods to control both the reactivity and surface
properties after self-assembly are required to create more complex patterned surfaces.
Existing techniques to control the reversibility and reactivity of the surfaces include
sophisticated methods, such as, light and UV-induced, and electrochemical surface
modiﬁcations.8'lo These methods tend to affect the morphology and properties of the
surfaces underneath the SAMS and are not compatible when extended to biological

systems involving cells and proteins.

76

The ionic layer-by-layer (LBL) assembly technique, introduced by Decher in
1991,23 has emerged as a versatile and inexpensive method of constructing polymeric thin
ﬁlms, with nanometer-scale control of ionized species. Films formed by electrostatic
interactions between oppositely charged poly-ion species to create alternating layers of
sequentially adsorbed poly-ions are called “Polyelectrolyte Multilayers (PEMs)”. PEMs
have long been utilized in such applications as sensors, eletrochromics, and
nanomechanical thin ﬁlms but more recently they have also been shown to be excellent
candidates for biomaterial applications due to 1) their biocompatibility and
bioinertnessf"33 2) the ability to incorporate biological molecules, such as proteins,26’ 34
and 3) the high degree of molecular control of the ﬁlm structure and thickness providing
a much simpler approach to construct complex 3D surfaces as compared with
photolithography.35’ ”9 We, as well as others including Hammond et al, have
demonstrated the ability of this layer by layer technology to readily construct complex
3D surfaces.96’ ‘27 This is particularly relevant in tissue engineering where ultimately the
material must have the potential to rebuild a whole organ. In addition, the
biodegradability of PEMS for tissue engineering and implantable device applications have
been demonstrated by Lynn and co-workers36 which is very useful in drug delivery
applications.

Poly(ethylene glycol) (PEG) can serve as an excellent coating materials to
augment the biocompatibility of biomaterials as it is a water soluble, nontoxic,
nonantigenic and nonimmunogenic polymer, attaches to surface with very little effect on

bulk properties and reduces protein adsorption and cell adhesionm'132 Surface

modiﬁcation with PEG can either be effected through physical adsorption or covalent

77

immobilization such as grafting and chemical coupling.'50'152 In this work, we
demonstrate an alternative, dynamic approach that can switch surface properties from
resistive to active by treating with high salt solutions. We have engineered this new class
of salt responsive PEG patterns PEM ﬁlms by ﬁrst deVeloping resistive patterns of m-d-
poly(ethylene glycol) (m-dPEG) acid molecules onto PEMS and subsequently removing
the SAMS from the PEM surface by treating with salt solutions creating a new active
surface. Unlike other approaches, our approach is biocompatible and does not affect the

properties of cells, proteins or other biological systems attached on the surface.

 

 

 

 

 
 
 
   

    
 

‘x. ’4'

l “v ~
"L #73 '1”; ‘ c K. .
«ELL..- - tjr Iii-1:1 515:1 «

. '5’"

' .3 -.v I, s _
Al—w:¢ 0V1}: 3'11 ,2 .-. 4.
3mg}. ‘ ' :71 ' —-“§'*‘-

  
  
 

   

 

 

 

    
  

.3 v ‘VKA’ \r ‘1‘ ‘~:.:‘
93.2753... Macaw. ..

   

‘.‘“.‘
3‘ I
:L\:E\‘ ‘7

’ l
'1‘.
Air —Vrrr: Kiri-'3 32:1- ‘
"um-1: _)~i‘ .ﬁ"

 

 

 

Figure 5.1. Diagram Illustrating the Formation of Salt Tunable m—dPEG Acid SAMS on a PDAC/SPS
Multilayer Platform Scheme (A) PEMs (PDAC/SPS)10_5 build on top of the substrates (B) Patterned PEG
SAMS on PEMs (C) Directed assembly of molecules due to the presence of resistive PEG SAMs (D) PEG
SAMS are removed by treating it with salt giving rise to new active regions (E) The new active regions are
ﬁlled with new set of molecules. The chemical structure of m—dPEG acid molecule.

In this chapter, we describe the process of creating chemically patterned and
physically structured surfaces by stamping molecules of m-dPEG acid (scheme shown in
Figure 5.1) with activated carboxylic acid group at one end. The activated carboxylate

functional group ionically binds to the topmost positive surface of the PEM surfaces and

78

the other end (PEG units) resists the deposit of subsequent polymer (polyelectrolyte)
layers. This poly-ionic adsorption enables the development of complex surface structures
and templates for selective layer-by-layer deposition. In addition to the generation of
complex 3-D microstructure ﬁlms, 96 the PEG molecules can be used to create areas of
selective adsorption on the multilayer ﬁlms. PEG and its oligomeric derivatives have thus
far been the most effective molecules to resist nonspeciﬁc adsorption of polyelectrolytes,
charged particles, proteins and cells onto surfaces from aqueous solution.96’ 127’ ”0"” We
capitalized upon the ionic interactions to deposit thin, uniform SAM patterns of PEG atop
the PEM ﬁlms and evaluated the factors that inﬂuence the effective transfer of m-dPEG
acid molecules on and off the multilayer ﬁlms. The advantages of exploring the m-dPEG
acid molecule as the removable molecular template for selective deposition are i) PEG
molecules can self-assemble to form resistive monolayers on PEMS, and ii) the tunable
interaction between the PEG molecules and the PEM ﬁlms permits the removal of the
SAMS from the surface without compromising the underlying ﬁlms or damaging the
biological systems attached to the PEM surface. The patterned ﬁlms were characterized
by optical microscopy and atomic force microscopy (AFM). The effects of pH and salt on
the PEG SAMS were investigated by optical microscopy, reﬂectance-absorption infrared
spectroscopy, and spectroscopic ellipsometry. The PEG patterns were removed from the
PEM surface at certain pH and salt conditions without affecting the PEM ﬁlms

underneath the SAMS. The removal of the PEG SAMS and the stability of the PEM ﬁlms

underneath it were investigated via ellipsometry and optical microscopy.

5.2 METHODS AND MATERIALS

5.2.1 Materials

79

Sulfonated poly(styrene), sodium salt (SPS) (Mw = 70000),
poly(diallyldimethylarnmonium chloride) (PDAC) (MW =100000-200000) as a 20 wt %
solution, and sodium chloride were purchased from Aldrich Chemical, Milwaukee, WI.
The m-dPEG acid molecule (MW = 236) was obtained from Quanta Biodesign.
Poly(dimethylsiloxane) (PDMS) from the Sylgard 184 silicone elastomer kit (Dow
Corning, Midland, MI) was used to prepare stamps. The ﬂuorosilanes was purchased
from Aldrich Chemical. These PDMS stamps were used for microcontact printing.Glass
slides (Corning Glass Works, Corning, NY), used for making the polyelectrolyte
multilayer ﬁlms, were cleaned using a Bransonic ultrasonic cleaner (Bransonic Ultrasonic
Corporation, Danbury, CT). Carboxyﬂuorescein (6-CF), ﬂuorescence dye, was purchased
and used as received from Sigma. Carboxylated polystyrene latex particles (4 pm
diameter), purchased from Polysciences, were used for colloidal adsorption study on m—
dPEG self-assembled monolayer patterned polyelectrolyte templates.

5.2.2 Preparation of Polyelectrolyte Multilayers

PDAC and SPS polymer solutions were prepared with deionized (DI) water at
concentrations of 0.02M and 0.01M, respectively, (based on the repeating unit molecular
weight) with the addition of 0.1M NaCl salt. A Carl Zeiss slide stainer equipped with a
custom-designed ultrasonic bath was connected to a computer to perform layer-by-layer
assembly. To form the ﬁrst bilayer, the tissue culture polystyrene (TCPS) plates were
immersed for 20 min in a polycation solution. Following two sets of 5 min rinses with
agitation, the TCPS plates were subsequently placed in a poylanion solution and allowed

to deposit for 20 min. Afterwards, the 6 well plates were rinsed twice for 5 min each.

80

This process was repeated to build multiple layers. All experiments were performed using
ten (i.e., 20 layers) or ten and half bilayers (i.e., 21 layers).

5.2.3 Preparation of PDMS Stamps

An elastomeric stamp is made by curing poly(dimethylsiloxane) (PDMS) on a
microfabricated silicon master, which acts as a mold, to allow the surface topology of the
stamp to form a negative replica of the master. The poly(dimethylsiloxane) (PDMS)
stamps were made by pouring a 10:] solution of elastomer and initiator over a prepared
silicon master.17 The silicon master was pretreated with ﬂuorosilanes to facilitate the
removal of the PDMS stamps from the silicon masters. The mixture was allowed to cure
overnight at 60°C.

5.2.4 Stamping of m-dPEG Acid

The stamping conditions were varied to optimize the microcontact printing of the m-
dPEG acid. PDMS stamps with and without plasma treatment were tested to stamp the
ink. The optimized conditions, as determined by us in our previOus work, were used for
making PEG patterns.96 The stamped regions were designed to act as resists to adsorption
as the oligoethylene glycol graft chains of PEG did.20 In the procedure of creating
complex 3-D microstructures, m-dPEG acid was stamped onto the PEM surface (PDAC
surface) followed by sequential adsorption layer-by-layer deposition process to build

additional patterned polyelectrolyte multilayers outside the stamped region.

5.2.5 Characterization

A Nikon Eclipse ME 600 optical microscope (Nikon, Melville, NY) was used to obtain
dark ﬁeld images of the m-dPEG acid patterns and the additional microfabricated PEMS.
A Nikon Eclipse E 400 micrOSCOpe was used to obtain the ﬂuorescence images. The 6-

81

carboxyﬂuorescein (6-CF) dye was used to visualize the m-dPEG SAM patterns on PEM
following the stamping and rinsing processes. The dye was dissolved directly in 0.1 M
NaOH; samples were imaged by dipping the substrates into the dye solution. The dye,
which is negatively charged, preferentially stained the positively charged PDAC surface.
The dyed regions appear green when viewed with the ﬂuorescence optical microscope,
using a FITC ﬁlter. Images were captured with a digital camera and processed on a

Pentium computer running camera software.

5.2.6 Ellipsometry

Ellipsometric measurements were obtained with a rotating analyzer ellipsometer (model
M-44; J .A. Woollam) using WVASE32 software. Substrate parameters (11 and k) were
measured after absorption of MPA. This ensures that any changes in substrate reﬂectivity
due to Au-S bonds will not affect subsequent measurements. The angle of incidence was
75 ° for all experiments. The thickness values for PEM ﬁlms were determined using 44

wavelengths between 414.0 and 736.1 nm.

5.3 RESULTS AND DISCUSSION

5.3.1. Directed Assembly of Macromolecules

The resistive nature of the PEG SAMS was demonstrated with various kinds of
macromolecules such as colloid particles, proteins, nucleic acids and formation of
subsequent multilayers over the PEG SAMS. We demonstrated that the PEG molecules
created areas of selective adsorption on the multilayer ﬁlms and be used in the
subsequent generation of 3-D microstructure ﬁlms. The patterned ﬁlms were

characterized by optical microscopy and atomic force microscopy (AF M).

82

 

Figure 5.2. Optical microscope images of directed deposition of macromolecules on PEG pattems (A)
0.5um colloid particles (brown lines). (B) Alexa Fluoro tagged sADH (C) Carboxyﬂuorescein (D) FITC
tagged nucleic acid The dark lines represent the m-dPEG acid regions.

The PEG patterns resulted in the directed deposition of a wide range of
macromolecules including colloidal particles, proteins, polymers such as dyes and nucleic
acids as illustrated in Figure 5.2. When the negatively charged carboxylated polystyrene
PS particles (Diameter = 0.5 um) were added on top of the m-dPEG acid patterns on top
of the (PDAC/SPS)I0_5, the particles attached on the PEM surface and did not attach on
the PEG region resulting in the formation of patterns of particles as shown in Figure 5.2

A.

83

- .537
as" m -

K '. ..'I . a
wwgmw:

   
      

Figure 5.3. Optical microscope images of directed deposition of cells on PEG patterns (A) primary
hepatocytes (B) ﬁbroblast (C) primary neurons.

We also added alexa-ﬂuoro tagged secondary alcohol dehydrogenase (sADH), negatively

charged carboxyﬂuorescein dye and FITC—tagged nucleic acids on top of the PEG

patterns and it resulted in the directed deposition of these macromolecules due to the

presence of the PEG patems as shown in Figure 5.2 (B-D).

5.3.2 Directed Assembly of Cells

PEG molecules are also known to reduce cell adhesion and commonly used in
biomaterials to resist cell adhesion.19 Our PEG patterns directed the deposition of a wide
variety of cells including primary hepatocytes, primary neurons and ﬁbroblasts as seen in
Figure 5.3. can serve as an excellent coating materials to augment the biocompatibility of
biomaterials as it is a water soluble, nontoxic, nonantigenic and nonimmunogenic
polymer, attaches to surface with very little effect on bulk properties and reduces protein

adsorption and cell adhesion.

5.3.3 Salt tunable PEG SAMs

m-dPEG acid patterns are formed on PEM ﬁlms using microcontact printing and
visualized with ﬂuorescence microscopy using a dye speciﬁc to positive surfaces. As
shown in Figure 5.4A, the dye (carboxyﬂuorescein) attaches selectively to the positive
poly(diallyldimethylammoniumchloride) (PDAC) surface and results in patterns of green
(PDAC) and dark (PEG) regions, thereby indicating the resistive property of the PEG
patterns . When this surface is exposed to a salt solution, the PEG patterns are removed
from the surface exposing the active PDAC surfaces underneath the SAMS (data not
shown). As a proof-of-concept of the removable characteristic of the PEG ﬁlms, a layer
of SPS are added on top of the PEG patterns and due to the resistive nature of the PEG
SAMS, the SPS preferentially formed a layer on the non-PEG (PDAC) surfaces resulting

in alternating regions of PEG and SPS surfaces. When this surface are treated with salt,

85

the PEG patterns are removed from the surface resulting in alternating regions of PDAC

(green) and SPS (dark) as shown in Figure 5.4 B. Further evidence of the removed PEG

SAMS is obtained through ellipsometer experiments. The ellipsometric data in Figure

A B

 

O

h-hUIU'IC!
OMOMO

 

Thickness (A)

00
0|

(spstAcp (SPSIPDAciz-PEG Salttreatnd
(SPSPDAC)2-PEG

Figure 5.4. Fluorescent Images of PEG patterns (A) before and (B) after salt treatment (C) Ellipsometric
data on the PEG patterns before and after salt treatment

5.4 C suggests an increase of about 13-15 A in thickness when PEG SAMS are attached
on the PEM ﬁlms and upon exposure to salt the thickness of the ﬁlms decreased to the

original thickness.

86

5.3.4 Patterned Array of Multiple Particles on PEG Patterns

We evaluated the potential applications for these removable PEG patterns by
attaching various molecules before and after salt treatment to demonstrate the versatility
of these surfaces. The resistive nature of the PEG patterns is used to achieve directed
assembly of a wide range of macromolecules such as colloid particles, proteins and
formation of complex polyelectrolyte multilayer structures. As proof of the applicability
of m-dPEG monolayer patterns on the PEM surface as a template for directed assembly
of molecules, negatively charged carboxylated polystyrene PS particles (Diameter = 0.5
mm) were used. m-dPEG acid molecules are stamped on top of the (PDAC/SPS)10,5 as
shown in Figure 5.5 A and the colloidal particles deposited selectively over the positive
(PDAC/SPS)10,5 surface but not on the m-dPEG self-assembled monolayer regions. When
the particle-deposited surfaces were treated with salt, the particles remained attached and
intact while the PEG SAMS are removed exposing the underlying active PDAC surface.

Next particles of 0.2um diameter are deposited over the exposed surfaces
resulting in a two particle system as shown in Figure 5.5 B. This effective method
provides a ﬂexible and versatile approach to the fabrication of composite colloidal
structures and the technique can be adapted utilizing different shaped patterned surfaces
and other monodisperse colloidal particles such as silica and metal-doped particles of
varying size and surface ﬁmctionality, and using functionalized spheres modiﬁed with
PEMs to obtain electroluminescent, conducting and other properties. This approach has
potential application in electronic and optical devices, direct colloid assembly, plastic

electronics and thin ﬁlm power devices.

87

 

Figure 5.5. Phase constrast images of colloidal particles on PEG patterns before and after salt treatment
(A) particles (D=0.5 um) on the m—dPEG acid patterns before salt treatment (B) particles (D=0.2 um)
added onto surface A aﬁer salt treatment.

5.3.5 Patterned Array of Multiple Proteins on PEG Patterns

The applicability of removable resisting SAMs for biological applications is also
evaluated using proteins and cells. Protein immobilization in micron and nano-scale
patterns has importance for drug delivery, bioengineering, biosensors, and fundamental
studies of cell biology, 19’ 153’ ‘54 but it is made challenging by the fragile structure of

proteins and their tendency for nonspeciﬁc binding to surfaces. Several techniques such

l55, 156 19.157

as photolithography, soft lithography, photochemical methods,158 and dip-pen
nanolithography”9 have been developed, which have primarily focused on the
immobilization of one protein in deﬁned regions surrounded by a "background" that lacks
protein (and may be additionally resistant to the adsorption of other proteins from
solution). However, to mimic complex cell-cell and cell—extracellular matrix interactions
for studying problems in immunology, patterned surfaces comprising multiple functional
protein regions on cellular and subcellular length scales would be useful. Few methods
have been reported that allow patterning of multiple proteins on surfaces, and these may

160-162

have limitations in spatial resolution, in patterning fragile proteins that cannot

88

"’3‘ 164 or exposure to organic solvents.165 The removable PEG

withstand dehydration,
surfaces we developed provide a template for designing multiple regions of different
proteins onto deﬁned regions of a surface without exposing the proteins to irradiation,
organic solvents or dehydration. An advantage of this approach is that it exposes the

proteins to conditions within the narrow range of physiological pH, ionic strength and

temperature where their stability is greatest.
- -
- I

Figure 5.6. Fluorescent images of sADH protein attachment on PEG patterns before and after salt
treatment (A,B) sADH tagged with Alexa-Fluoro on the m—dPEG acid patterns before salt treatment (C,D)

sADH tagged with FITC added onto surface A after salt treatment. A, C are pictures taken using the red
channel while B, D are taken using the green channel.

 
 

As shown in Figure 5.6, the same protein with different ﬂuorescent tags are
attached onto the PEG patterns before and after salt treatment indicating that the salt

treatment did not affect the proteins that are attached to the PEM surface. Figure 5.6 (A,

89

B) shows the ﬂuorescence images of the directed assembly of proteins on top of the PEG
patterns in the red and green channel respectively before salt treatment. The red regions
demonstrate the directed attachment of the sADH proteins to the PEMS and away from
the resistive m-dPEG monolayer regions (black regions) while there is no proteins
observed when imaged using the green channel. Alexa-Fluoro tagged sADH protein
deposited selectively over the positive (PDAC/SPS)10.5 surface but not on the m-dPEG
self-assembled monolayer regions. When the protein-deposited surfaces were treated with
salt, the proteins remained attached and intact while the PEG SAMS are removed
exposing the underlying active PDAC surface. Next FITC-tagged sADH are deposited

over the exposed surfaces resulting in a two protein array as shown in Figure 5.6 (C, D).

5.3.6 Patterned Array of Multiple Cells on PEG Patterns

Tissue formation and cellular function in vivo are regulated by diverse biological
factors including cell-cell communication, cell—matrix interactions, and soluble factors.
The ability to recreate such interactions in vitro may lead to advances in diverse ﬁelds,
ranging from cell biology to tissue engineering. Approaches to manipulate the cell
microenvironment, based on a number of fabrication strategies such as photolithography,
microcontact printing, micromolding, inkjet printing and dip-pen spotting,” 72’ 159’ '66
have been conducted on micropattemed surfaces. In most approaches, the cells have been
localized to adhesive regions on a substrate, thus limiting their use to one cell type. More
recently, approaches have been developed to pattern two or more cell types in spatially
deﬁned co-cultures.l7 Many initial studies on patterned co-cultures have involved the

selective adhesion of one cell type as compared to the adhesion of the other cell type. The

removable PEG SAMS we developed provides surfaces that can be switched from cell-

90

repulsive to cell-adhesive using cell friendly conditions. This approach is advantageous
since they can be used to form pattemed co-cultures irrespective of the cell types or
seeding order. In addition, this approach exposes the cells to conditions within the narrow
physiological range of pH, ionic strength and temperature. As shown in Figure 5.7, the
same cells with different ﬂuorescence tags are attached onto the PEG patterns before and
after salt treatment indicating that the salt treatment did not affect the cells that are

attached to the PEM surface.

 

Figure 5.7. Optical microscope images of HeLa cells on PEG patterns before and after salt treatment.
Phase contrast (A) and ﬂuorescent images (B) of HeLa cells labeled red on the m—dPEG acid patterns
before salt treatment. Phase contrast (C) and ﬂuorescent images (D) of HeLa cells seeded onto the surface
after salt treatment. Scale bar = 400 um

91

5.4 CONCLUSIONS

In conclusion, we have shown that these PEG patterns can be removed using salt
conditions that do not compromise the underlying polymers, charged particles and
biological molecules, including living cells, deposited on the surface. These salt
responsive PEG SAMS are ideal for optical technologies such as electroluminescent and
conducting surfaces, where templates of multi-component particle arrays on PEMS are
required. We have also shown that these removable surfaces can be used to form patterns
of multiple proteins and cells, which may have applicability in drug delivery and tissue
engineering applications. Removable surfaces provide a template for designing multiple
regions of different protein, which is useful in immunology where complex cell-cell, cell-
extracellular matrix interactions play important roles. Our approach avoids exposing the
proteins to conditions outside the narrow range of physiological pH, ionic strength and
temperature and thus maintains the stability of the proteins. This new approach provides
an environmentally friendly and biocompatible route to designing versatile salt tunable
surfaces. The template can be used to form arrays of nucleic acids, proteins and other
biological molecules which have applications as biosensors and basic biological studies.
The strategy presented here for the preparation of removable resistive SAMS provides a

template to design various surfaces that can be used in a wide variety of applications.

92

CHAPTER 6 APTAMER AND siRNA BASED DRUG
DELIVERY SYSTEM USING POLYELECTROLYTE
MULTILAYERS

6.1 INTRODUCTION

For drug delivery applications, there is a need for the ability to deliver multiple
biomolecules, e.g., proteins, genes, antibody, or drugs, to a targeted site of interest. Many
delivery systems typically deliver one type of biomolecule at a time, e.g., one protein or
one gene. The combination of targeted delivery and controlled drug release'67 is useful in
treating various diseases where a cytotoxic dose of drug is required to be delivered to the
unhealthy or cancerous cells over an extended period of time while leaving the
surrounding healthy tissue alone. Polyelectrolyte multilayer (PEMS) are potential
substrates for tissue engineering, drug delivery and implantable device applications. In
this chapter, we propose using highly customizable PEM thin ﬁlms to engineer surfaces
for targeted drug delivery applications by integrating nucleic acid with PEM technology.
The PEM technique has been applied successfully using DNA as a polyanionic building
block'68‘ '69. Interestingly, electrostatic interactions with positively charged
polyelectrolytes have been demonstrated to protect DNA from degradation by nucleolytic
activityno. This chapter deals with the fabrication of a novel targeted drug delivery
system that attaches aptamers and small interfering RNA (siRNAs) onto PEM ﬁlms.

Nucleic acid ligands, also called aptamers,m’ ‘72 have emerged as a novel class of
ligands that rival antibodies in their potential for therapeutic and diagnostic
applications.173 ’ ”4 Aptamers are oligonucleotides that have high affinity and selectivity

for various target compounds ranging from small molecules, such as drugs and dyes, to

93

complex biological molecules such as enzymes, peptides, and proteinsm'177 These
artiﬁcial receptors are selected from combinatorial oligonucleotide libraries for the target
compound by an in vitro iterative process called SELEX (systematic evolution of ligands
by exponential ampliﬁcation).m’ '72 Use of aptamers for protein recognition instead of
antibodies is of particular interest for assay developments, because the speciﬁcity and
afﬁnity of aptamers are equal or superior to those of antibodiesm’ '79 In addition,
aptamers have a number of advantages as compared to antibodies, such as increased heat
stability, tolerance to wide ranges of pH and salt concentrations, and ease of synthetic
modiﬁcation or immobilization.178 Furthermore, unlike antibodies, aptamers are capable
of being reversibly denatured, which facilitates capture and release of target compounds
in reusable applications.‘80 Currently, methods are being developed for aptamer
immobilization onto solid surfaces for applications in protein capture, biosensors, and

chromatographic separations. I 8 l '1 84

Inﬂuenza infections remain an important cause of morbidity and mortality,
particularly in the elderly population, and carry the risk of pandemics; they also impose a
considerable economic burden worldwide. The recently developed anti-inﬂuenza speciﬁc
drug consisting of neuraminidase inhibitors, comprising of analogues of N-
acetylneuraminic acid (e. g. oseltamivir and zanarnivir), provide limited beneﬁcial effect,
reducing the duration of infection by 1 day, from 7 to 6 days.185 ' ‘86 The inﬂuenza virus
envelope carries two major immunogenic surface glycoproteins: hemagglutinin (HA)187
and neuraminidase. HA plays a key role in initiating viral infection by binding to the sialic

acid-containing receptors on host cells and mediating the subsequent viral entry and

membrane fusion.'88"90 Infection by the inﬂuenza virus is initiated by the binding of the

94

virus to the host cell receptors via HA. Thus the approach taken in our present study is to
incorporate the HA aptamer within the PEM ﬁlms, which upon release from the ﬁlms
would bind directly to the HA protein on the virus neutralizing its ability to bind to their
receptors on host cells. This would prevent the interaction of HA with the host cells, and

thus infection by the virus.

siRNAs have emerged as a new and very efﬁcient tool to downregulate gene

expression in humans, animals and plants.I91

Many diseases develop from the undesired
production of certain proteins. siRNA is a highly promising therapeutic approach for
diseases resulting from aberrant protein production. siRNA has the potential of being a
new universal drug therapy to treat a variety of human diseases such as cancer,
rheumatoid arthritis, brain diseases, human immunodeﬁciency virus (HIV) and hepatitis
C. However, the delivery of aptamers and siRNAs to targeted cells and tissues remains a
challenge. There are many favorable characteristics of aptamers and siRNAs, including
their small size, lack of immunogenicity, and ease of isolation, and have resulted in their
application in clinical trials.” '92 Therefore, in this chapter we demonstrate the
fabrication of aptamer and siRNA based targeted drug delivery systems using PEM ﬁlms.

We have engineered aptamer and siRNA based targeted drug delivery systems
using PEM ﬁlms by capitalizing on electrostatic interaction between the polycations and
the negatively charged nucleic acids. Nucleic acid patterns on PEMS were created by
ionic interactions using microcontact printing (uCP). In this study, we chose a DNA
aptamer that binds to thrombin as a model for integrating PEM and nucleic acid

technologies. We selected a 15mer aptamer that forms a G-quartet for thrombin (Figure

6.1A) because it has already been screened by SELEX and has shown thrombin-

95

inhibiting activity.193 This aptamer is one of the most well studied; its structure has

(1194'196 and the effect of its loop sequence on the G-quartet

already been determine
structure has also been investigated.'97 Extensive work to identify the binding site has
been performedm'200 Additionally, the application of this thrombin-inhibiting aptamer as
a drug to inhibit clot formation in vivo,2(”'203 has been investigated along with its stability

. . 204 . . 2
m vrtro and m vzvo. 0'

A
5'- GGT TGG TTT GGT TGG -3'

B
5'-AATTAACCCTCACTAAAGGGCTGAG

TCTCAAAACCGCAATACACTGGTTGT
ATGGTCGAATAAGTTAA-3'

Figure 6.1 Structure of aptamers used in the study (A) 15mer oligonucleotide of DNA aptamer for
thrombin. (B) aptamer for HA

6.2 METHODS AND MATERIALS

6.2.1 Materials

Poly(diallyldimethylammonium chloride) (PDAC) (Mw~100,000-200,000) as a 20 wt %
solution, sulfonated poly(styrene), sodium salt (SPS) (Mw~70,000), poly-L-lysine (PLL),
ﬂuorosilanes and sodium chloride were purchased from Aldrich (Milwaukee, WI).
Poly(dimethylsiloxane) (PDMS) from the Sylgard 184 silicone elastomer kit (Dow
Corning, Midland, MI) was used to prepare stamps. The PDMS stamps were used for
microcontact printing.9 Dulbecco’s Modiﬁed Eagle Medium (DMEM) with 4.5 g/l

glucose, 10X DMEM, fetal bovine serum (FBS), penicillin and streptomycin were

96

purchased from Life Technologies (Gaithersburg, MD). Insulin and glucagon were
purchased from Eli Lilly and Co. (Indianapolis, IN), epidermal growth factor, thrombin
from Sigma Chemical (St. Louis, MO). Puriﬁed rat albumin was purchased from Cappel
Laboratories (Aurora, OH). Adult female Sprague-Dawley rats were obtained from
Charles River Laboratories (Boston, MA). DNA aptamer for thrombin (5'— GGT TGG
TTT GGT TGG-3'), non-aptamer for thrombin (5'—GGT GGT GGT TGT GGT -3'),
aptamer for Hemagglutinin (A22:5'-AAT TAA CCC TCA CTA AAG GGC TGA GTC
TCA AAA CCG CAA TAC ACT GGT TGT ATG GTC GAA TAA GTT AA-3') and
(A21 :5'-AAT TAA CCC TCA CTA AAG GGC GCT TAT TTG TTC AGG TTG GGT
CTT CCT ATT ATG GTC GAA TAA GTT AA-3') were obtained from Invitrogen

(Carlsbad, California).

6.2.2 Preparation of Polyelectrolyte Multilayers

PDAC and SPS polymer solutions were prepared with deionized (DI) water at
concentrations of 0.02M and 0.01M, respectively, (based on the repeating unit molecular
weight) with the addition of 0.1M NaCl salt. A Carl Zeiss slide stainer equipped with a
custom-designed ultrasonic bath was connected to a computer to perform layer-by-layer
assembly. Polyelectrolyte dipping solutions were prepared with DI water supplied by a
Bamstead Nanopure-UV 4 stage puriﬁer (Bamstead International Dubuque, Iowa),
equipped with a UV source and ﬁnal 0.2 urn ﬁlter. Solutions were ﬁltered with a 0.45 pm
Acrodisc syringe ﬁlter (Pall Corporation) to remove particulates. TCPS plates were
subjected to a Harrick plasma cleaner (Harrick Scientiﬁc Corporation, Broading
Ossining, NY) for 10 min at 0.15 torr and 50 sccrn ﬂow of 02 in a plasma chamber. To

form the ﬁrst bilayer, the TCPS plates were immersed for 20 min in a polycation

97

solution. Following two sets of 5 min rinses with agitation, the TCPS plates were
subsequently placed in a polyanion solution and allowed to deposit for 20 min.
Afterwards, the 6 well plates were rinsed twice for 5 min each. The samples were cleaned
for 3 min in an ultrasonic cleaning bath after depositing a layer of polycation/polyanion
pair. The sonication step removed weakly bounded polyelectrolytes on the substrate,
forming uniform bilayers. This process was repeated to build multiple layers.

Alternating layers of PLL/nucleic acid multilayered ﬁlms were assembled onto
quartz slides, TCPS and gold slides depending on the experiments. The ﬁrst layer of PLL
was adsorbed onto the substrates by immersing them in 0.5mg/ml PLL solution for
10min. The PLL coated substrates were then washed with DI water and the nucleic acid
was attached to the PLL layer by immersing the substrate in 200 ug/ml nucleic acid for
10 min. The process was alternately repeated until a desired number of bilayers were
deposited.

6.2.3 Preparation of PDMS Stamps

An elastomeric stamp was made by curing PDMS on a microfabricated silicon master,
which acts as a mold, to allow the surface topology of the stamp to form a negative

”3 The PDMS stamps were made by pouring a 10:1 solution of

replica of the master.
elastomer and initiator over a prepared silicon master. The silicon master was pretreated
with ﬂuorosilanes to facilitate the removal of the PDMS stamps from the silicon master.

The mixture was allowed to cure overnight at 60°C. The masters were prepared in the

BioMEMS facilities at MGH East and consisted of various features (squares and lines).

6.2.4 Cell Culture

Hepatocyte Isolation

98

Primary rat hepatocytes were isolated from 2 months old adult female Sprague-Dawley
rats (Charles River Laboratories, Boston, MA), according to a two-step collagenase

perfusion technique described by Seglen 64 and modiﬁed by Dunn“. The liver isolations

yielded 150-300 x 106 hepatocytes. Using trypan blue exclusion the viability ranged from
90 to 98 %. Primary hepatocyte culture medium consisted of DMEM supplemented with
10% PBS, 14 ng/ml glucagon, 20 ng/ml epidermal growth factor, 7.5pg/ml
hydrocortisone, 200 ug/ml streptomycin (10,000 ug/ml) - penicillin (10,000 U/ml)
solution, and 0.5 U/ml insulin.

Hepatocyte Culture

The cells were seeded under sterile tissue culture hoods and maintained at 37°C in a
humidiﬁed air/C02 incubator (90/10 vol %). Primary hepatocytes were cultured on PEM
coated 6-well TCPS. The multilayer coated TCPS plates were sterilized by spraying with
70 % ethanol and exposing them to UV light before seeding the cells onto these surfaces.
The cell culture experiments were performed on PEM surfaces without adhesive proteins.
Collagen coated TCPS and uncoated TCPS were used as controls in these studies. A
collagen gel solution was prepared by mixing 9 parts of the 1.2 mg/ml collagen
suspension in 1 mM HCl with 1 part of concentrated (10X) DMEM at 4°C. The control
wells were coated with 0.5 ml of this collagen gel solution and the coated plates were
incubated at 37°C for 1 hour. Freshly isolated hepatocytes were seeded at a density of
4x105 cells per well for 7 days. One ml of fresh meditun was supplied daily to the
cultures after removal of the supernatant. Samples were kept in a temperature and

humidity controlled incubator.

NIH 3 T3 Culture

99

NIH 3T3 ﬁbroblast cell lines were purchased from American Tissue Type Collection.
Cells grown to 70% conﬂuence were trypsinized in 0.01% trypsin (ICN Biomedicals)
solution in PBS for 10 min and re-suspended in 25mL media. Approximately 10% of the
cells were seeded into a fresh tissue culture ﬂask and the rest of the cells were used for
the co-culture experiments. Fibroblast medium consisted of DlVﬂEM with high glucose,
supplemented with 10% bovine calf serum and 200U/mL penicillin and 200ug/mL

streptomycin.

6.2.5 Characterization

A Nikon Eclipse ME 600 optical microscope (Nikon, Melville, NY) was used to obtain
dark ﬁeld images of the m-dPEG acid patterns and the additional microfabricated PEMS.
A Nikon Eclipse E 400 microscope was used to obtain the ﬂuorescence images. The 6-
carboxyﬂuoresceinl(6-CF) dye was used to visualize the m-dPEG SAM patterns on PEM
following the stamping and rinsing processes. The dye was dissolved directly in 0.1 M
NaOH; samples were imaged by dipping the substrates into the dye solution. The dye,
which is negatively charged, preferentially stained the positively charged PDAC surface.
The dyed regions appear green when viewed with the ﬂuorescence optical microscope,
using a FITC ﬁlter. Images were captured with a digital camera and processed on a
Pentium computer running camera software. A Leica inverted phase contrast microscope
with Soft RT 3.5 software was used to capture images of cell density, morphology, and

spreading on the multilayer surfaces.

100

6.2.6 UV-Vis Spectroscopy and Ellispometry of PEM Films

The progressive build-up of the multilayered nucleic acid-coatings onto quartz substrates
was monitored using a using a Perkin-Elmer UV/V is (model Lambda 40)
spectrophotometer. Measurements were taken after each successive layer. Growth of the
multilayered nucleic acid-coatings was monitored by their incremental increases at
260 nm, the absorbance maximum of the nucleic base chromophores. All measurements
were repeated three times. Ellipsometric thicknesses of ﬁlms on gold-coated wafers (200
nm of Au sputtered on 20 nm of Cr on Si(100)) were determined using a rotating analyzer

ellipsometer (model M-44, J. A. Woollam), assuming a ﬁlm refractive index of 1.5.

6.3 Results and Discussion

 

 

 

 

 

 

 

 

 

Figure 6.2. Scheme for making nucleic acid patterns on PEM surfaces (A) PEMS are built atop the
substrate (B) Nucleic acids attached onto the PEM ﬁlms via electrostatic interaction (C) Cells attached
ﬂuoresce due to uptake of the nucleic acid.

We capitalized upon the net negative charge of the nucleic acids of the aptamers
and siRNAs to attach these nucleic acids onto positively charged PEM ﬁlms.
Electrostatic interactions with the positively charged polyelectrolytes have been

demonstrated to protect the nucleic acids from degradation by nucleolytic activity,‘70

101

suggesting that this is a viable method of maintaining the activity of these molecules after

surface immobilization. The overall scheme of the methodology is shown in Figure 6.2.

6.3.] Surface Immobilization of Nuclei Acids on PEMS

The presence of nucleic acid molecules (siRNA and aptamer) on the PEM
surfaces were characterized using FITC labeled oligos and with the help of uCP. We
successfully immobilized and patterned nucleic acids on PEM ﬁlms using electrostatic
interaction of nucleic acids on top of the PEM thin ﬁlms. These oligo molecules were

imaged using ﬂuorescent microscopy. We observed patterns of nucleic acids on the PEM

ﬁlms as shown in Figure 6.3.

A B

Figure 6.3. Fluorescent images of patterned FITC labeled nucleic acids on PEM surfaces (A) FITC taged
HA aptamer patterns and (B) FITC tagged siRNA patterns on (PEI/SPS)”;

   

6.3.2 Activity of Aptamer in PEM Film

To determine whether the aptamer are stable and functional upon surface
immobilization, we evaluated the ability of the protein to recognize its aptamer as well as
the speciﬁcity of the nucleic acids for its protein. The PEM ﬁlms were uCP with patterns
of thrombin and HA aptamers on the same surface (Figure 6.4A), upon which various

proteins were subsequently added to the aptamer patterns to determine whether the

102

 

AOOOOOOOOAAAAAAAA
ooooooooAAAAAAAA
ooooooooAAAAAAAA
ooooooooAAAAAAAA

 

 

 

 

 

Figure 6.4. Fluorescent images of aptamer immobilized on PEM ﬁlms (A) Scheme of the aptamer patterns
on the PEM ﬁlms. Circles represents HA aptamer and triangles represents thrombin aptamer (B) FITC
tagged thrombin and (C) FITC tagged HA added on top of the aptamer patterns

immobilized aptamers maintained their speciﬁcity for their proteins, in this case the
thrombin protein. Fig. 6.4 (B, C) represents typical ﬂuorescence images of aptamer
microarrays when they are incubated with a single individual analyte. Both HA and
thrombin aptamers immobilized on the PEM surfaces yielded a highly speciﬁc response
to their corresponding target protein and showed no cross-reactivity with the other
proteins. As shown in Figure 6.4 (B,C), F ITC tagged HA did not bind to the thrombin
aptamer patterns and the FITC tagged thrombin did not bind to the HA aptamer patterns

and the tagged proteins attached preferentially onto the corresponding aptamer regions as

103

demonstrated in Figure 6.4 (B,C). This study provides a proof of concept that the
aptamers are still active after surface immobilization and binds speciﬁcally to its target

protein.

6.3.3 Monitoring of PEM Deposition Process

(A)

 

 

 

Absorba nce [a.u.]

 

 

 

 

 

.0

 

.03 l I I ' ' T I I I
200 220 240 260 280 300 320 340 360 380 400
Wavelength (A nm)

 

 

(B)

 

0.08

 

 

 

 

 

 

 

 

:3

53'. 0.06 /

3 0.04 - ‘

g /

e 0.02

g /

.9 0 r 1 I l l

< 0 02 9 2 4 6 8 AD
Number of Bilayers

 

 

 

Figure 6.5 (A) UV-absorption spectra of (PLL/thrombin aptamer) multilayer coatings, and (B) plots of
absorbance at 260nm. The UV-absorption spectra were monitored using quartz substrates after the
deposition of 1-10 bilayers.

104

The build-up of multilayered nucleic acid-coatings on quartz substrates via UV-
Vis spectrophotometry could be easily monitored using the DNA base chromophores
(absorbance maximum at 260 nm). As illustrated in Figure 6.5, multilayered thrombin
aptamer-coatings showed an increase in UV-absorbance spectrum with every successive
double-layer addition. DNA contributes a characteristic absorption band at 260 nm. Two
points are worth noting. First, the absorbance plot at 260 nm shows an increase with the
bilayer ntunber, suggesting that DNA molecules have been successively incorporated into
the ﬁlm. Second, a linear increase in the UV—vis absorbance. of the ﬁlms is observed with
the addition of each layer (Figure 6.5 B). These observations indicate that the aptamers
are being incorporated within the PEM ﬁlms and the multilayers are formed due to the
negative charge of the nucleic acids, i.e. acting as a polyanion. Similar experiments were
performed with aptamers for the HA antigenic proteins present on the inﬂuenza virus.
The build up of the ﬁlms was followed by UV-Vis and ellipsometry and the change in
thickness was measured after each bilayer addition. As shown in Figure 6.6, the
absorbance intensity and thickness of the ﬁlms increased linearly with the increase in the
number of bilayers which indicates the incorporation of the HA aptamer within the PEM

ﬁlms.

105

 

0.08

0.06

 

 

 

0.04

 

0.02

 

 

Absorbance

 

 

 

O I I I I
0 2 4 6 8 10
Bilayers

 

 

 

 

.3
#GQO
COCO

 

 

 

N
O

 

 

Thickness (nm)

 

O

I I r I I . I I

3 4 5 6 7 8 9 1O
#ofBilayers

O
.3
N

Figure 6.6 (A) Plots of UV-Vis absorbance at 260nm of (PLL/HA aptamer) multilayer coatings. The UV-
absorption spectra were monitored using quartz substrates after the deposition of 1-10 bilayers The
thickness of multilayered ﬁlms increased as a function of number of bilayers as measured by ellipsometry.
Values are given as mean i standard deviation (n=3).

106

6.3.4 Deconstruction of the PEM Films

 

 

PLL 0 DNA _ ‘
- ' ”3.9.16;
........................... l (A) 1‘“ 4 gill-.2”: sauna“

 

 

PLUNucleic acid PEM ﬁlms

(8) Salt pH, enzymes

." “..'— ‘0
. ( Vg. '_

1'" , W I“
'ﬁ 51W}, «3’ 3:,“ if;

1 '1‘ e 1' w...) 1*
n ‘ .‘§~;~

. s14;
AW

 

 

Figure 6.7 The schematic construction and deconstruction of PLL/DNA PEM ﬁlms via layer-by-layer as
aptamer/siRNA delivery system. (A) Construction of the ﬁlms by layer-by-layer deposition of PLL and
nucleic acid, and (B) deconstruction of the ﬁlms

Numerous studies have shown that PEM ﬁlms can be degraded under
physiological conditions under enzymes, pH or changing ionic strengths.2°5'207 We
demonstrated that the nucleic acid encapsulated multilayer ﬁlms can be deconstructed by
controlling the ionic strength in the solution. The aptamers/siRNA can be released under
physiological conditions, schematically illustrated in Figure 6.7. UV—Vis and ellipsometer
were used to monitor the deconstruction of the PEM ﬁlms and the loss of the nucleic
acids embedded within the ﬁlms. As seen in Figure 6.8, the ﬁlm was deconstructed or
dissociated after incubating the DNA aptamer/PEM ﬁlms in 0.5M NaCl solution. During

the construction of the ﬁlms, the PLL/nucleic acid complexes or PLL/nucleic acid

segment ion pairs formed, which stabilized the ﬁlms.207' 208 When the ﬁlms are incubated

107

in concentrated salt solution, the salt ions attach to the complexes or the ion pairs. This
weakens or breaks the interaction between the PLL and nucleic acid molecules and
results in the loss of the nucleic acid molecules. Dubas and co-workers have
demonstrated salt-induced deconstruction of (PAA/PDAC) multilayer ﬁlms.209 The
kinetics of the salt induced deconstruction of PEM ﬁlms varied with the NaCl
concentration. Increasing the NaCl concentration increased the extent and rate of the ﬁlm

deconstruction.

 

.3
O
O

 

 

 

 

 

havoc
OOOOO
l

 

Thickness (nm)
N

 

 

 

O 3 6 9 12 24 27 3O 33
Time (b)

Figure 6.8 The thickness of multilayered ﬁlms decreased as a function of degradation time. Values are
given as mean i standard deviation (n=3).

To further examine the stability of the released aptamers, multilayer ﬁlms were
constructed by incorporating F ITC tagged HA aptamer within the PEM ﬁlms. The PEM
ﬁlms were then treated with 0.25M salt solution resulting in the release of aptamers due
to the deconstruction of the PEM ﬁlms. The released aptamers were then added to the
surface with HA and thrombin patterns. As illustrated in Figure 6.9, the released FITC
tagged HA aptamers bound only to the HA peptide on the surface did not bind to the

surface immobilized with thrombin surface, thereby indicating that the aptamer was

108

active and retained its speciﬁcity for its corresponding protein upon released from the

PEM ﬁlms when treated with salt.

A

 

Figure 6.9. Fluorescent images of released FITC tagged HA aptamer binding onto patterns of (A) HA and
(B) thrombin.

6.3.5 Cell Uptake of Released Nucleic Acids from PEM Films

In vitro experiments demonstrating the uptake by cells of nucleic acids
immobilized on the PEM surfaces was performed with block-iTTM ﬂuorescent oligo.
These oligo molecules are ﬂuorescein-labeled, double stranded RNA duplex with the
same length, charge and conﬁguration as standard siRNAs. When the cells take up this
RNA, they begin to ﬂuoresce as shown in Figure 6.9. We examined the cell uptake of the
nucleic acids immobilized on the PEM surfaces using two types of mammalian cells:
transformed 3T3 ﬁbroblasts (3T3s) and primary hepatocytes. The cells started to
ﬂuoresce after 6 days which demonstrated the possibility that this effect may be extended

to aptamers and siRNA molecules immobilized on PEM surfaces.

109

 

Figure 6.10. In vitro ﬂuroescence microscope images of cells on PEM surfaces with immobilized
ﬂuroescent oligos. Leﬁ panels show the ﬂuorescent images and the rigth panels show the merged image of
phases contrast and fluorescent images of (A,B) ﬁbroblast and (C,D) primary hepatocytes.

6.4 Conclusions

In this chapter we demonstrated that PEM thin ﬁlms can be a template for
aptamer and siRNA molecules for drug delivery applications. Our preliminary studies
indicated that the FITC labeled RNAS immobilized on PEM surfaces were taken up by
ﬁbroblasts and primary hepatocytes suggesting this effect may be extended to aptamers
and siRNA molecules immobilized on PEM surface. Future studies will focus on
targeting a speciﬁc biomolecule with aptamer or siRNA molecules attached on PEM

surfaces. A comparative study with several cell types, such as cell lines and primary cells,

will be performed to determine the delivery efﬁciency of DNA vs RNA molecules to the

different cell types.

111

CHAPTER 7 CONCLUSIONS

This thesis has shown that PEMS are extremely versatile thin ﬁlm assemblies for
engineering surfaces to control cell adhesion and for drug delivery applications. The
multilayers are chemically rich matrices in which molecules such as proteins, nucleic
acids and cells can interact with the thin ﬁlms. Moreover, the physical structure and
chemical architecture of the multilayers are tunable and customizable by simple means
such as assembly solution conditions (e.g., pH, salt) and choice of polyelectrolytes. PEMS
ﬁlms are excellent candidates for biomaterial applications, provide ﬂexibility in building
complex three-dimensional architectures and also provide an ability to control the
arrangement of multiple cell types with subcellular resolution.

Chapter 2 demonstrated the ability of PEM ﬁlms to control the adhesion of
primary cells (primary hepatocytes and neurons) without the help of adhesive
ligands/proteins and further formed patterns of these cells using microcontact printing.
The primary cells attached preferentially on PEM ﬁlms with SPS as the topmost surface.
We capitalized upon this differential cell attachment and spreading of primary
hepatocytes and neurons on PDAC and SPS surfaces to control the adhesion of the
primary cells and form patterns of the cells. The cell patterns were achieved without the
help of adhesive proteins/ligands. We demonstrated that the hydrophobic and cell
resistant PDMS surfaces can be made to be cell adhesive surfaces by coating with PEM
ﬁlms. We also demonstrated that the addition of topographical features on the PEM
coated surfaces provided an alternative approach to chemistry for controlling the
attachment of primary cells (hepatocyes) and the attachment and grth of transformed

cells (3T3 ﬁbroblasts and HeLa cells). We further used these ﬁlms as templates for

112

patterned co-cultures of primary hepatocytes/ﬁbroblasts and primary neurons lastrocytes
on the PEM surfaces as described in Chapter 3. The patterned co-cultures enhanced the
function and viability of the primary cells for extended time period in vitro. This
technique we developed provides a useful tool for engineering neuronal and hepatocyte
co-culture systems, which may more accurately capture liver and neuronal cell function
and metabolism in normal versus diseased states.

Chapter 4 described the development of novel self-assembled monolayer (SAM)
patterns of m-d-poly(ethylene glycol) (m-dPEG) acid molecules onto PEMS. The created
m-dPEG acid monolayer patterns on PEMS acted as resistive templates, and thus
prevented further deposits of consecutive poly(anion)/poly(cation) pairs of charged
particles and resulted in the formation of three-dimensional (3-D) patterned PEM ﬁlms or
selective particle depositions atop the original multilayer thin ﬁlms. These new patterned
and structured surfaces have potential applications in microelectronic devices and electro-
optical and biochemical sensors. Chapter 5 demonstrated that the PEG patterns developed
are tunable at certain salt conditions and can be removed from the PEM surface without
affecting the PEM layers underneath the patterns. These removable surfaces provide an
alternative method to form patterns of multiple particles, proteins and cells. This new
approach provides an environmentally friendly and biocompatible route to designing
versatile salt tunable surfaces.

Chapter 6 described the use of multilayers to engineer aptamer and siRNA based
drug delivery systems. We capitalized on the negative charge of aptamer and siRNA
molecules to attach these molecules on PEMs by electrostatic interaction. We

demonstrated the successful immobilization and patterning of aptamers and siRNAs on

113

PEM ﬁlms using electrostatic interaction of nucleic acids on top of the thin ﬁlms. These
ﬁlms were degraded under biocompatible conditions and the nucleic acids were released
to the cell culture. The cell uptake of these molecules also showed the proof of concept
that these ﬁlms can be designed to release a wide range of molecules after incorporating
them into these ﬁlms.

This thesis has laid the foundation to explore in detail the ability of PEM ﬁhns to
control cell adhesion for a variety of cells and also for the delivery of a wide variety of
drug molecules. We found PEMS are compatible with a wide variety of cells including
primary hepatocytes and primary neurons which have difﬁculty adhering in vitro. We
developed PEG patterns which act as a universal resist group for a wide variety of cells
and can be extended to form co—cultures without requiring a tunable adhesive/resistive
surface that is cell-speciﬁc. Future work will focus on using this removable PEG surface
to create patterned co-cultures of different cell combinations critical for the function of
tissues in vivo. The tunable PEG patterns can be extended to develop targeted delivery
systems that can simultaneously immobilize multiple drugs and to form arrays of proteins
and nucleic acids for biosensors. The PEM ﬁlms can also be used to encapsulate multiple
siRNA and aptamer molecules within the ﬁlms to target multiple genes for a variety of
diseases. PEM ﬁlms provide us with the ability to incorporate multiple drugs or
biomolecules which may increase the efﬁciency of the delivery system and help prolong

the efﬁcacy of the drug molecules.

114

APPENDIX 1: Deﬁnitions

A. SELEX

In vitro selection, or SELEX, is a technique that allows the simultaneous screening of
highly diverse pools of different RNA or DNA (dsDNA or ssDNA) molecules for a
particular feature. In 1990, the laboratories of G. F. Joyce (La Jolla), J.W. Szostak
(Boston), and L. Gold (Boulder) independently developed a technique which allows the
simultaneous screening of more than 1015 individual nucleic acid molecules for different
functionalities. This method is commonly known as "in vitro selection", "in vitro
evolution" or "SELEX" (systematic evolution of ligands by exponential enrichment).
With the in vitro selection-technique large random pools of nucleic acids can be screened
for a particular functionality, such as the binding to small organic molecules, large
proteins or the alteration or de novo generation of ribozyme-catalysis. Functional
molecules ("aptarners" a linguistic chimaera composed of the latin aptus = to ﬁt and the
greek sufﬁx -mer) are selected from the mainly non-functional pool of RNA or DNA by
column chromatography or other selection techniques that are suitable for the enrichment
of any desired property. The method is conceptually straightforward: in a standard DNA-
oligonucleotide synthesizer a starting pool is generated. The machine synthesizes an
oligonucleotide with a completely random base-sequence which is ﬂanked by deﬁned
primer binding sites. In this way, up to 1015 different DNA molecules can be synthesized
at once. The immense complexity of the generated pool justiﬁes the assumption that it
contains a few molecules with the correct receptor structure or with tertiary structures

which lead to catalytic activity; these are selected, for example by afﬁnity

115

chromatography or ﬁlter binding. Because a pool of such high complexity can be
expected to contain only a very small ﬁ'action of functional molecules, several
puriﬁcation steps are usually required. Therefore, the very rare active molecules are
ampliﬁed by the polymerase chain reaction (PCR) or in a transcription-based step. In this
way, iterative cycles of selection can be carried out. Successive selection and
ampliﬁcation cycles result in an exponential increase in the abundance of functional
sequences, until they dominate the population. The method has been applied to a number
of different applications; for example, in vitro selection has proven to be extremely
efﬁcient for the identiﬁcation of bases which cannot be changed without loss of function
and are important in ribozymes, or in a protein binding site in a (ds or ss)DNA or RNA
molecule. Recently, in vitro selection has been used for the de novo isolation of catalytic
RNAS. These include ribozymes with ligation activity, isomerases and ribozymes which
catalyze the ATP-dependent phosphorylation of RNA oligonucleotides. The basis for the
latter two ribozymes was the isolation of RNAs for speciﬁc binding to small substrate
molecules, for which several examples exist. RNA- and DNA-aptamers have been
isolated, which not only bind tightly to proteins, but also are able to inhibit their

biological activity.

B. Advantages of Aptamers

o are chemically stable to all but the harshest environmental conditions and can be
boiled or frozen without loss of activity.
0 may be produced on the benchtop using standard molecular biological techniques

or they may be chemically synthesized at micrograrn to kilogram scales.

116

As synthetic molecules, they are amenable to a nearly inﬁnite variety of
modiﬁcations designed to optimize their properties for a speciﬁc application.

They may be circularized, linked together in pairs, or clustered onto the surface of
a fat globule.

For in vivo applications, aptamers can be modiﬁed to dramatically reduce their
sensitivity to degradation by enzymes in the blood.

Other chemical appendages can alter their biodistribution or plasma residence
time following intravenous injection. This plasticity is a distinct advantage of
aptamers over other types of molecular ligands, such as monoclonal antibodies,
where chemical modiﬁcation is often variable, difﬁcult to control, and may harm

the function of the molecule.

117

LIST OF PUBLICATIONS

The following publications were made as a direct result of the research carried out for
this project.
Published and accepted journal articles:

1) “Selective Depositions on Polyelectrolyte Multilayers: Self-Assembled
Monolayers of m-dPEG Acid as Molecular Templates” Srivatsan Kidambi,
Christina Chan, Ilsoon Lee. J. Am. Chem. Soc. 126, 4697-4703, 2004.

2) “Controlling Primary Hepatocyte Adhesion and Spreading on Protein Free
Polyelectrolyte Multilayer Films” Srivatsan Kidambi, Ilsoon Lee, Christina
Chan. J. Am. Chem. Soc. 126 (50), 16286 ~16287, 2004.

3) “Cell Adhesion on Polyelectrolyte Multilayer coated PDMS Surfaces with
Varying Topographies” Srivatsan Kidambi, Natasha Udpa, Stacey Schroeder,
Ilsoon Lee, Christina Chan. Tissue Engineering (in press), 2006.

4) “Selective Adhesion of Primary Hepatocytes on Polyelectrolyte Multilayers:
Template for Patterned Cell Co-culture” Srivatsan Kidambi, Lufang Sheng,
Mehmet Toner, Martin Yarmush, Ilsoon Lee, Christina Chan. Macromol Biosci
(in press), 2006.

Journal articles submitted for review or in preparation:

1) “Patterned Co-culture of Neurons and Astrocytes on Polyelectrolyte Multilayer
Films for Studying Astrocyte Mediated Oxidative Stress in Neurons” Srivatsan
Kidambi, Ilsoon Lee, Christina Chan. submitted to Advanced Functional

Materials, 2006.

118

2)

3)

4)

“Salt Responsive m-dPEG Acid Self Assembled Monolayers on Polyelectrolyte
Multilayers” Srivatsan Kidambi, Christina Chan, Ilsoon Lee., in preparation,
Nature Materials, 2007.

“Construction and degradation of multilayerd PLL/Aptamer ﬁlms” Srivatsan
Kidambi, Ilsoon Lee, Christina Chan., in preparation, Nature Chemical Biology,
2007.

“Cell Targeted Delivery of siRNAs using Polyelectrolyte Multilayer Templates”
Srivatsan Kidambi, Ilsoon Lee, Christina Chan, in preparation, Nature

Chemical Biology, 2006.

119

BIBLIOGRAPHY

1. Amiji, M.; Park, K., Prevention of protein adsorption and platelet adhesion on
surfaces by PEO/PPO/PEO triblock copolymers. Biomaterials 1992, 13, ( 10), 682-92.

2. Harris, J. M.; Dust, J. M.; McGill, R. A.; Harris, P. A.; Edgell, M. J.; Sedaghat-
Herati, R. M.; Karr, L. J.; Donnelly, D. L., New polyethylene glycols for biomedical
applications. ACS Symposium Series 1991, 467, (Water-Soluble Polym.), 418-29.

3. Singhvi, R.; Kumar, A.; Lopez, G. P.; Stephanopoulos, G. N.; Wang, D. 1.;
Whitesides, G. M.; lngber, D. E., Engineering cell shape and function. Science 1994, 264,
(5159), 696-8.

4. Chen, C. S.; Mrksich, M.; Huang, 8.; Whitesides, G. M.; lngber, D. E., Geometric
control of cell life and death. Science 1997, 276, (5317), 1425-1428.

5. Ulman, A., An Introduction to Ultrathin Organic Films. An Introduction to
Ultrathin Organic Films 1991, Academic: Newyork.

6. Kumar, A.; Whitesides, G. M., Patterned condensation ﬁgures as optical
diffraction gratings. Science 1994, 263, (5143), 60-2.

7. Huang, J .; Dahlgren, D. A.; Hemminger, J. C., Photopatterning of Self-Assembled
Alkanethiolate Monolayers on Gold: A Simple Monolayer Photoresist Utilizing Aqueous
Chemistry. Langmuir 1994, 10, (3), 626-8.

8. Huang, J. Y.; Dahlgren, D. A.; Hemminger, J. C., Photopatterning of Self-
Assembled Alkanethiolate Monolayers on Gold - a Simple Monolayer Photoresist
Utilizing Aqueous Chemistry. Langmuir 1994, 10, (3), 626-628.

9. Kumar, A.; Biebuyck, H. A.; Whitesides, G. M., Patterning Self-Assembled
Monolayers: Applications in Materials Science. Langmuir 1994, 10, (5), 1498-511.

10. Bain, C. D.; Whitesides, G. M., Molecular-Level Control over Surface Order in
Self-Assembled Monolayer Films of Thiols on Gold. Science 1988, 240, (4848), 62-63.

11. Ratner, B. D., New ideas in biomaterials science. A path to engineered
biomaterials. Journal of Biomedical Materials Research 1993, 27, (7), 837-50.

120

12. Anderson, J. M., Biological responses to materials. Annual Review of Materials
Research 2001, 31, 81-110.

13. Hubbell, J. A., Bioactive biomaterials. Current Opinion in Biotechnology 1999,
10, (2), 123-129.

14. Santini, J. T.; Cima, M. J.; Langer, R., A controlled-release microchip. Nature
1999, 397, (6717), 335-338.

15. Tao, S. L.; Desai, T. A., Microfabricated drug delivery systems: from particles to
pores. Advanced Drug Delivery Reviews 2003, 55, (3), 315-328.

16. Grayson, A. C. R.; Choi, I. 8.; Tyler, B. M.; Wang, P. P.; Brem, H.; Cima, M. J.;
Langer, R., Multi-pulse drug delivery from a resorbable polymeric microchip device.
Nature Materials 2003, 2, (l 1), 767-772.

17. Bhatia, S. N.; Balis, U. J.; Yarrnush, M. L.; Toner, M., Effect of cell-cell
interactions in preservation of cellular phenotype: cocultivation of hepatocytes and
nonparenchymal cells. FASEB journal 1999, 13, ( 14), 1883-900.

18. Xia, Y.; Whitesides, G. M, Soﬁ lithography. Angewandte Chemie, International
Edition 1998, 37, (5), 550- 575.

19. Whitesides, G. M.; Ostuni, E.; Takayarna, S.; Jiang, X.; lngber, D. E., Soft
lithography in biology and biochemistry. Annual Review of Biomedical Engineering
2001, 3, 335-373.

20. Mitchell, P., Microﬂuidics - downsizing large-scale biology. Nature
Biotechnology 2001, 19, (8), 717-721.

21. Walker, G. M.; Zeringue, H. C.; Beebe, D. J., Microenvironment design
considerations for cellular scale studies. Lab on a Chip 2004, 4, (2), 91-97.

22. Khademhosseini, A.; Langer, R., Nanobiotechnology: drug delivery and tissue
engineering. Chemical Engineering Progress 2006, 102, (2), 38-42.

23. Decher, G., Fuzzy nanoassemblies: toward layered polymeric multicomposites.
Science 1997, 277, (5330), 1232-1237.

121

24. Thierry, B.; Kujawa, P.; Tkaczyk, C.; Winnik, F. M.; Bilodeau, L.; Tabrizian, M.,
Delivery Platform for Hydrophobic Drugs: Prodrug Approach Combined with Self-
Assembled Multilayers. Journal of the American Chemical Society 2005, 127, (6), 1626-
1627.

25. LaVan, D. A.; Lynn, D. M.; Langer, R., MoVing smaller in drug discovery and
delivery. Nature Reviews Drug Discovery 2002, 1, (1), 77-84.

26. Lvov, Y.; Ariga, K.; Ichinose, 1.; Kunitake, T., Assembly of Multicomponent
Protein Films by Means of Electrostatic Layer-by-Layer Adsorption. Journal of the
American Chemical Society 1995, 117, (22), 6117-23.

27. Jesse], N.; Atalar, F.; Lavalle, P.; Mutterer, J.; Decher, G.; Schaaf, P.; Voegel, J.-
C.; Ogier, J., Bioactive coatings based on a polyelectrolyte multilayer architecture
functionalized by embedded proteins. Advanced Materials (Weinheim, Germany) 2003,
15, (9), 692-695.

28. Vinores, S. A., Technology evaluation: pegaptanib, Eyetech/Pﬁzer. Current
Opinion in Molecular Therapeutics 2003, 5, (6), 673-679.

29. Xia, H. B.; Mao, Q. W.; Paulson, H. L.; Davidson, B. L., siRNA-mediated gene
silencing in vitro and in vivo. Nature Biotechnology 2002, 20, (10), 1006-1010.

30. Flemming, A., Infectious disease - Topical microbicide based on siRNA. Nature
Reviews Drug Discovery 2006, 5, (1), 19-19.

31. Richert, L.; Lavalle, P.; Vautier, D.; Senger, B.; Stoltz, J. F.; Schaaf, P.; Voegel,
J. C.; Picart, C., Cell interactions with polyelectrolyte multilayer ﬁlms.
Biomacromolecules 2002, 3, (6), 1170-1178.

32. Elbert, D. L.; Herbert, C. B.; Hubbell, J. A., Thin Polymer Layers Formed by
Polyelectrolyte Multilayer Techniques on Biological Surfaces. Langmuir 1999, 15, (16),
5355-5362.

33. Mendelsohn, J. D.; Yang, S. Y.; Hiller, J.; Hochbaum, A. 1.; Rubner, M. F.,
Rational design of cytophilic and cytophobic polyelectrolyte multilayer thin ﬁlms.
Biomacromolecules 2003, 4, (1), 96-106.

122

34. Decher, G.; Lehr, B.; Lowack, K.; Lvov, Y.; Schmitt, J., New nanocomposite
ﬁlms for biosensors: layer-by-layer adsorbed ﬁlms of polyelectrolytes, proteins or DNA.
Biosensors & Bioelectronics 1994, 9, (9/ 10), 677-84.

35. Jiang, X.; Zheng, H.; Gourdin, 8.; Hammond, P. T., Polymer-on-Polymer
Stamping: Universal Approaches to Chemically Patterned Surfaces. Langmuir 2002, 18,
(7), 2607-2615.

36. Vazquez, E.; Dewitt, D. M.; Hammond, P. T.; Lynn, D. M., Construction of
Hydrolytically-Degradable Thin Films via Layer-by-Layer Deposition of Degradable
Polyelectrolytes. Journal of the American Chemical Society 2002, 124, (47), 13992-
13993.

37. Berthiaume, F.; Moghe, P. V.; Toner, M.; Yarrnush, M. L., Effect of extracellular
matrix topology on cell structure, function, and physiological responsiveness:
hepatocytes cultured in a sandwich conﬁguration. FASEB Journal 1996, 10, (13), 1471-
1484.

38. Grant, M. H.; Anderson, K.; McKay, G.; Wills, M.; Henderson, C.; MacDonald,
C., Manipulation of the phenotype of immortalized rat hepatocytes by different culture
conﬁgurations and by dimethyl sulfoxide. Human & Experimental Toxicology 2000, 19,

(5), 309-317.

39. Gramowski, A.; Schiffmann, D.; Gross, G. W., Quantiﬁcation of acute neurotoxic
effects of trimethyltin using neuronal networks cultured on microelectrode arrays.
Neurotoxicology 2000, 21, (3), 331-342.

40. Gross, R. A.; Uhler, M. D.; Macdonald, R. L., The Reduction of Neuronal
Calcium Currents by Atp-Gamma-S Is Mediated by a G-Protein and Occurs
Independently of Cyclic Amp-Dependent Protein-Kinase. Brain Research 1990, 535, (2),
214-220.

41. Kamioka, H.; Maeda, E.; Jimbo, Y.; Robinson, H. P. C.; Kawana, A.,
Spontaneous periodic synchronized bursting during formation of mature patterns of
connections in cortical cultures. Neuroscience Letters 1996, 206, (2-3), 109-112.

42. Jimbo, Y.; Robinson, H. P. C.; Kawana, A., Strengthening of synchronized
activity by tetanic stimulation in cortical cultures: Application of planar electrode arrays.
Ieee Transactions on Biomedical Engineering 1998, 45, (11), 1297-1304.

123

43. Shahaf, G.; Marom, 8., Learning in networks of cortical neurons. Journal of
Neuroscience 2001, 21, (22), 8782-8788.

44. Corey, J. M.; Feldman, E. L., Substrate patterning: an emerging technology for
the study of neuronal behavior. Experimental Neurology 2003, 184, 889-896.

45. Ravenscroft, M. S.; Bateman, K. E.; Shaffer, K. M.; Schessler, H. M.; Jung, D.
R.; Schneider, T. W.; Montgomery, C. B.; Custer, T. L.; Schaffner, A. E.; Liu, Q. Y.; Li,
Y. X.; Barker, J. L.; Hickman, J. J., Developmental neurobiology implications from

fabrication and analysis of hippocampal neuronal networks on patterned silane-modiﬁed
surfaces. Journal of the American Chemical Society 1998, 120, (47), 12169-12177.

46. Liu, Q. Y.; Coulombe, M.; Dumm, J.; Shaffer, K. M.; Schaffner, A. E.; Barker, J.
L.; Pancrazio, J. J.; Stenger, D. A.; Ma, W., Synaptic connectivity in hippocampal
neuronal networks cultured on micropattemed surfaces. Developmental Brain Research
2000, 120, (2), 223-231.

47. Ma, W.; Liu, Q. Y.; Jung, D.; Manos, P.; Pancrazio, J. J.; Schafﬁier, A. E.;
Barker, J. L.; Stenger, D. A., Central neuronal synapse formation on micropattemed
surfaces. Developmental Brain Research 1998, 111, (2), 231-243.

48. Chang, J. C.; Brewer, G. J.; Wheeler, B. C., Modulation of neural network
activity by patterning. Biosensors & Bioelectronics 2001, 16, (7-8), 527-533.

49. Chang, J. C .; Brewer, G. J .; Wheeler, B. C., A modiﬁed microstamping technique
enhances polylysine transfer and neuronal cell patterning. Biomaterials 2003, 24, (17),
2863-2870.

50. Marois, Y.; Sigot-Luizard, M.-F.; Guidoin, R., Endothelial cell behavior on
vascular prosthetic grafts: effect of polymer chemistry, surface structure, and surface
treatment. ASAIO Journal 1999, 45, (4), 272-280.

51. Bordenave, L.; Bareille, R.; Lefebvre, F .; Caix, J .; Baquey, C., Cytocompatibility
study of NHLBI primary reference materials using human endothelial cells. Journal of
Biomaterials Science, Polymer Edition 1992, 3, (6), 409-16.

52. Park, J. H.; Park, K. D.; Bae, Y. H., PDMS-based polyurethanes with MPEG
grafts: synthesis, characterization and platelet adhesion study. Biomaterials 1999, 20,
(10), 943-953.

124

53. Sherman, M. A.; Kennedy, J. P.; Ely, D. L.; Smith, D., Novel
polyisobutylene/polydimethyl siloxane bicomponent networks: 111. Tissue compatibility.
Journal of Biomaterials Science, Polymer Edition 1999, 10, (3), 259-269.

54. van Kooten, T. G.; Whitesides, J. F.; von Recum, A. F., Inﬂuence of silicone
(PDMS) surface texture on human skin ﬁbroblast proliferation as determined by cell
cycle analysis. Journal of Biomedical Materials Research 1998, 43, (1), 1-14.

55. Ertel, S. 1.; Ratner, B. D.; Kaul, A.; Schway, M. B.; Horbett, T. A., In vitro study
of the intrinsic toxicity of synthetic surfaces to cells. Journal of Biomedical Materials
Research 1994, 28, (6), 667-75.

56. Dahrouch, M.; Schmidt, A.; Leemans, L.; Linssen, H.; Goetz, H., Synthesis and
properties of poly(butylene terephthalate)-poly(ethylene oxide)-poly(dimethylsiloxane)

block copolymers. Macromolecular Symposia 2003, 199, (Polycondensation 2002), 147-
162.

57. Interrante, L. V.; Shen, Q.; Li, J., Poly(dimethylsilylenemethylene-co-
dimethylsiloxane): A Regularly Alternating Copolymer of Poly(dimethylsiloxane) and
Poly(dimethylsilylenemethylene). Macromolecules 2001, 34, (6), 1545-1547.

58. Cunningham, J. J .; Nikolovski, J.; Lindennan, J. J .; Mooney, D. J ., Quantiﬁcation
of ﬁbronectin adsorption to silicone-rubber cell culture substrates. BioTechniques 2002,
32, (4), 876,878,880,882,884,886-887.

59. Makamba, H; Hsieh, Y. Y.; Sung, W. C.; Chen, S. H., Stable permanently
hydrophilic protein-resistant thin-ﬁlm coatings on poly(dimethylsiloxane) substrates by
electrostatic self-assembly and chemical cross-linking. Analytical Chemistry 2005, 77,
(13), 3971-3978. ‘

60. Ai, H.; Lvov, Y. M.; Mills, D. K.; Jennings, M.; Alexander, J. S.; Jones, S. A.,
Coating and selective deposition of nanoﬁlm on silicone rubber for cell adhesion and
growth. Cell Biochemistry and Biophysics 2003, 38, (2), 103-114.

61. Dunn, J. C.; Tompkins, R. G.; Yarrnush, M. L., Long-term in vitro function of
adult hepatocytes in a collagen sandwich conﬁguration. Biotechnology Progress 1991, 7,
(3), 237-45.

125

62. Decher, G.; Lvov, Y.; Schmitt, J., Proof of Multilayer Structural Organization in
Self-Assembled Polycation Polyanion Molecular Films. Thin Solid Films 1994, 244, (1-
2), 772-777.

63. Kumar, A.; Whitesides, G. M., Features of gold having micrometer to centimeter
dimensions can be formed through a combination of stamping with an elastomeric stamp
and an alkanethiol \"ink\" followed by chemical etching. Applied Physics Letters 1993,
63, (14), 2002-4.

64. Seglen, P. 0., Preparation of isolated rat liver cells. Methods in Cell Biology
1976, 13, 29-83.

65. Marini, A. M.; Paul, S. M., N-Methyl-D-aspartate receptor-mediated
neuroprotection in cerebellar granule cells requires new RNA and protein synthesis.
Proceedings of the National Academy of Sciences of the United States of America 1992,
89, (14), 6555-9.

66. Nicoletti, F.; Wroblewski, J. T.; Novelli, A.; Alho, H.; Guidotti, A.; Costa, E.,
The activation of inositol phospholipid metabolism as a signal-transducing system for

excitatory amino acids in primary cultures of cerebellar granule cells. Journal of
Neuroscience 1986, 6, (7), 1905-11.

67. Hamprecht, B; Loefﬂer, F., Primary glial cultures as a model for studying
hormone action. Methods in Enzymology 1985, 109, (Horm. Action, Pt. 1), 341-5.

68. Chandler, L. J .; Newsom, H.; Summers, C.; Crews, F., Chronic ethanol exposure
potentiates NMDA excitotoxicity in cerebral cortical neurons. Journal of Neurochemistry
1993, 60, (4), 1578-81.

69. Cutler, R. G.; Kelly, J .; Storie, K.; Pedersen, W. A.; Tammara, A.; Hatanpaa, K.;
Troncoso, J. C.; Mattson, M. P., Involvement of oxidative stress-induced abnormalities in
ceramide and cholesterol metabolism in brain aging and Alzheimer's disease.
Proceedings Of The National Academy Of Sciences Of The United States Of America
2004, 101, (7), 2070-2075.

70. Mohammed, J. S.; DeCoster, M. A.; McShane, M. J., Micropatteming of
nanoengineered surfaces to study neuronal cell attachment in vitro. Biomacromolecules
2004, 5, (5), 1745-1755.

126

71. Ruegg, U.; Hefti, F., Growth of Dissociated Neurons in Culture Dishes Coated
with Synthetic Polymeric Amines. Neuroscience Letters 1984, 49, (3), 319-324.

72. Kidambi, S.; Lee, 1.; Chan, C., Controlling primary hepatocyte adhesion and
spreading on protein-free polyelectrolyte multilayer ﬁlms. Journal of the American
Chemical Society 2004, 126, (50), 16286-16287.

73. Alberts, B.; Alexander, J.; Lewis, J .; Raff, M.; Roberts, K.; Walter, P., Molecular
Biology of the Cell, 4th Edition. 2004; p 2000 pp.

74. McCaughan, G. W.; Gorrell, M. D.; Bishop, G. A.; Abbott, C. A.; Shackel, N. A.;
McGuinness, P. H.; Levy, M. T.; Sharland, A. F.; Bowen, D. G.; Yu, D.; Slaitini, L.;
Church, W. B.; Napoli, J., Molecular pathogenesis of liver disease: an approach to

hepatic inﬂammation, cirrhosis and liver transplant tolerance. Immunological Reviews
2000, 174, 172-191.

75. Frangogiannis, N. G.; Smith, C. W.; Entrnan, M. L., The inﬂammatory response
in myocardial infarction. Cardiovascular Research 2002, 53, (1), 31-47.

76. Curtis, A. S. G.; Wilkinson, C. D. W., Reactions of cells to topography. Journal
of Biomaterials Science, Polymer Edition 1998, 9, (12), 1313-1329.

77. Langer, R.; Vacanti, J ., Tissue Engineering. Science 1993, 260, (5110), 920-926.

78. van Breemen, C.; Skarsgard, P.; Laher, 1.; McManus, B.; Wang, X., Endothelium-
smooth muscle interactions in blood vessels. Clin Exp Pharmacol Physiol 1997, 24, (12),
989-92.

79. Schmidt, C.; Leach, J., Neural tissue engineering: Strategies for repair and
regeneration. Annual Review of Biomedical Engineering 2003, 5, 293-347.

80. Feng, Y.; Walsh, C. A., Protein-protein interactions, cytoskeletal regulation and
neuronal migration. Nature Reviews Neuroscience 2001, 2, (6), 408-416.

81. Haydon, P. G., Glia: listening and talking to the synapse. Nature Reviews
Neuroscience 2001, 2, (3), 185-193.

127

82. Martin, E. D.; Araque, A.; Buno, W., Synaptic regulation of the slow Ca2+-

activated K+ current in hippocampal CA1 pyramidal neurons: Implication in
epileptogenesis. Journal of Neurophysiology 2001, 86, (6), 2878-2886.

83. Rao, K. V. R.; Panickar, K.; Jayakumar, A. R.; Norenberg, M. D., Astrocytes
protect neurons from ammonia toxicity. Neurochemical Research 2005, 30, (10), 1311-
1318.

84. Brown, D. R., Neurons Depend on Astrocytes in a Coculture System for
Protection from Glutamate Toxicity. Molecular and Cellular Neuroscience 1999, 13, (5),
379-389.

85. Donato, M. T.; Gomez-Lechon, M. J.; Castell, J. V., Drug metabolizing enzymes
in rat hepatocytes co-cultured with cell lines. In Vitro Cellular & Developmental Biology
1990, 26, (11), 1057-62.

86. Agius, L., Metabolic Interactions Of Parenchymal Hepatocytes And Dividing
Epithelial-Cells In Co-Culture. Biochemical Journal 1988, 252, (1), 23-28.

87. Menzeleev, R.; Bozhkov, A.; Zvonkova, E.; Krasnopolskyii, Y.; Shvets, V.,
Enhancement of Liver-Cell Proliferation by Gm(3) Ganglioside. Bullentin of
Experimental Biology and Medicine 1995, 1 19, (4), 414-417.

88. Guguen-Guillouzo, C.; Clement, B.; Baffet, G.; Beaumont, C.; Morel-Chany, E.;
Glaise, D.; Guillouzo, A., Maintenance and reversibility of active albumin secretion by

adult rat hepatocytes cocultured with another liver epithelial cell type. Experimental Cell
Research 1983, 143, (1), 47-54.

89. Harimoto, M.; Yamato, M.; Hirose, M.; Takahashi, C.; Isoi, Y.; Kikuchi, A.;
Okano, T., Novel approach for achieving double-layered cell sheets co-culture:
overlaying endothelial cell sheets onto monolayer hepatocytes utilizing temperature-
responsive culture dishes. Journal of Biomedical Materials Research 2002, 62, (3), 464-
470.

90. Nandkumar, M. A.; Yamato, M.; Kushida, A.; Konno, C.; Hirose, M.; Kikuchi,
A.; Okano, T., Two-dimensional cell sheet manipulation of heterotypically co-cultured
lung cells utilizing temperature-responsive culture dishes results in long-terrn
maintenance of differentiated epithelial cell functions. Biomaterials 2002, 23, (4), 1121-
1130.

128

91. Bhatia, S. N.; Yarmush, M. L.; Toner, M., Controlling cell interactions by
micropatteming in co—cultures: hepatocytes and 3T3 ﬁbroblasts. Journal of Biomedical
Materials Research 1997, 34, (2), 189-99.

92. Bhandari, R.; Riccalton, L.; Lewis, A.; Fry, J.; Hammond, A.; Tendler, S.;
Shakesheff, K., Liver tissue engineering: A role for co-culture systems in modifying
hepatocyte function and viability. Tissue Engineering 2001, 7, (3), 345-357.

93. Takayama, S.; McDonald, J. C.; Ostuni, E.; Liang, M. N.; Kenis, P. J. A.;
Ismagilov, R. F.; Whitesides, G. M., Patterning cells and their environments using
multiple laminar ﬂuid ﬂows in capillary networks. Proceedings of the National Academy
of Sciences of the United States of America

1999, 96, (10), 5545-5548.

94. Yang, 1. H.; Co, C. C.; Ho, C. C., Spatially controlled co-culture of neurons and
glial cells. Journal of Biomedical Materials Research PartA 2005, 75A, (4), 976-984.

95. Reyes, D. R.; Perruccio, E. M.; Becerra, S. P.; Locascio, L. E.; Gaitan, M.,
Micropatteming neuronal cells on polyelectrolyte multilayers. Langmuir 2004, 20, (20),
8805-8811.

96. Kidambi, 8.; Chan, C.; Lee, I., Selective Depositions on Polyelectrolyte

Multilayers: Self-Assembled Monolayers of m-dPEG Acid as Molecular Templates.
Journal of the American Chemical Society 2004, 126, (14), 4697-4703.

97. Khademhosseini, A.; Suh Kahp, Y.; Yang Jen, M.; Eng, G.; Yeh, J.; Levenberg,
S.; Langer, R., Layer-by-layer deposition of hyaluronic acid and poly-L-lysine for
patterned cell co-cultures. Biomaterials 2004, 25, (17), 3583-92.

98. Jiang, X.; Hammond, P. T., Selective Deposition in Layer-by-Layer Assembly:
Functional Graft Copolymers as Molecular Templates. Langmuir 2000, 16, (22), 8501-
8509.

99. Bhatia, S. N.; Balis, U. J.; Yarmush, M. L.; Toner, M., Probing heterotypic cell
interactions: hepatocyte function in microfabricated co-cultures. Journal of Biomaterials
Science-Polymer Edition 1998, 9, (11), 1137-60.

100. Sauer, H.; Klimm, B.; Hescheler, J .; Wartenberg, M., Activation of p90RSK and
grth stimulation of multicellular tumor spheroids are dependent on reactive oxygen

129

species generated after purinergic receptor stimulation by ATP. FASEB Journal 2001, 15,
(13), 2539-2541, 10 1096/tj 01-0360ﬁe.

101. Patil, S.; Chan, C., Palmitic and stearic fatty acids induce Alzheimer-like
hyperphosphorylation of tau in primary rat cortical neurons. Neuroscience Letters 2005,
384, (3), 288-293.

102. Blazquez, C.; Galve-Roperh, 1.; Guzman, M., De novo-synthesized ceramide
signals apoptosis in astrocytes via extracellular signal-regulated kinase. FASEB Journal
2000, 14, (14), 2315-2322.

103. Rozga, J.; Williams, F.; Ro, M. S.; Neuzil, D. F.; Giorgio, T. D.; Backﬁsch, G.;
Moscioni, A. D.; Hakim, R.; Demetriou, A. A., Development of a Bioartiﬁcial Liver -
Properties and Function of a Hollow-Fiber Module Inoculated with Liver-Cells.

Hepatology 1993, 17, (2), 258-265.

104. Donato, M. T.; Castell, J. V.; Gomez-Lechon, M. J ., Co-cultures of hepatocytes
with epithelial-like cell lines: expression of drug-biotransformation activities by
hepatocytes. Cell Biology and Toxicology 1991, 7, (1), 1-14.

105. Shimaoka, S.; Nakamura, T.; Ichihara, A., Stimulation of Grth of Primary
Cultured Adult-Rat Hepatocytes without Growth-F actors by Coculture with
Nonparenchymal Liver-Cells. Experimental Cell Research 1987, 172, (1), 228-242.

106. Quake, S. R.; Scherer, A., From micro- to nanofabrication with soﬁ materials.
Science 2000, 290, (5496), 1536-1540.

107. Araque, A.; Carmignoto, G.; Haydon, P. G., Dynamic signaling between
astrocytes and neurons. Annual Review Of Physiology 2001, 63, 795-813.

108. Park, L. C.; Zhang, H.; Gibson, G. E., Co-culture with astrocytes or microglia
protects metabolically impaired neurons. Mechanisms of ageing and development 2001,
123, (1), 21-7.

109. Chen, Y.; Vartiainen, N. E.; Ying, W.; Chan, P. H.; Koistinaho, J.; Swanson, R.
A., Astrocytes protect neurons from nitric oxide toxicity by a glutathione-dependent
mechanism. Journal of Neurochemistry 2001, 77, (6), 1601-1610.

130

110. F ukuda, J.; Khademhosseini, A.; Yeh, J.; Eng, G.; Cheng, J.; Farokhzad, O. C.;

Langer, R., Micropattemed cell co-cultures using layer-by-layer deposition of
extracellular matrix components. Biomaterials 2006, 27, (8), 1479-1486.

111. Decher, G.; Hong, J. D., Buildup of ultrathin multilayer ﬁlms by a self-assembly
process. 1. Consecutive adsorption of anionic and cationic bipolar amphiphiles on
charged surfaces. Makromolekulare Chemie, Macromolecular Symposia 1991, 46, (Eur.
Conf. Organ. Org. Thin Films, 3rd, 1990), 321-7.

112. Decher, G.; Hong, J. D., Buildup of ultrathin multilayer ﬁlms by a self-assembly
process: 11. Consecutive adsorption of anionic and cationic bipolar amphiphiles and
polyelectrolytes on charged surfaces. Berichte der Bunsen-Gesellschaft 1991, 95, (11),
1430-4.

113. Decher, G.; Lvov, Y.; Schmitt, J., Proof of multilayer structural organization in
self-assembled polycation-polyanion molecular ﬁlms. Thin Solid Films 1994, 244, (1-2),
772-7.

114. Decher, G.; Schmitt, J., Fine-tuning of the ﬁlm thickness of ultrathin multilayer
ﬁlms composed of consecutively alternating layers of anionic and cationic
polyelectrolytes. Progress in Colloid & Polymer Science 1992, 89, (Trends Colloid
Interface Sci. VI), 160-4.

115. Fou, A. C.; Rubner, M. F ., Molecular-Level Processing of Conjugated Polymers.
2. Layer-by-Layer Manipulation of In-Situ Polymerized p-Type Doped Conducting
Polymers. Macromolecules 1995, 28, (21), 7115-20.

116. Fou, A. C.; Onitsuka, O.; Ferreira, M.; Rubner, M. F.; Hsieh, B. R., Fabrication
and properties of light-emitting diodes based on self-assembled multilayers of

poly(phenylene vinylene). Journal of Applied Physics
1996, 79, (10), 7501-7509.

117. Ariga, K.; Lvov, Y.; Kunitake, T., Assembling Alternate Dye-Polyion Molecular
Films by Electrostatic Layer-by-Layer Adsorption. Journal of the American Chemical
Society 1997, 119, (9), 2224-2231.

118. Zheng, H.; Zhang, R.; Wu, Y.; Shen, J., Blue-green light emission from self-
assembled bipyridinium thin ﬁlms. Chemistry Letters 1998, (9), 909-910.

131

119. Kotov, N. A.; Dekany, 1.; Fendler, J. H., Ultrathin graphite oxide-polyelectrolyte
composites prepared by self-assembly. Transition between conductive and non-
conductive states. Advanced Materials 1996, 8, (8), 637-641.

120. Lee, 1.; Zheng, H. P.; Rubner, M. F .; Hammond, P. T., Controlled cluster size in
patterned particle arrays via directed adsorption on conﬁned surfaces. Advanced
Materials 2002, 14, (8), 572-577.

121. Zheng, H. R; Lee, 1.; Rubner, M. F.; Hammond, P. T., Two component particle
arrays on patterned polyelectrolyte multilayer templates. Advanced Materials 2002, 14,
(8), 569-572.

122. Liu, Y.; Wang, A.; Claus, R. O., Layer-by-layer electrostatic self-assembly of
nanoscale Fe304 particles and polyimide precursor on silicon and silica surfaces. Applied
Physics Letters 1997, 71, (16), 2265-2267.

123. Lvov, Y.; Ariga, K.; Onda, M.; Ichinose, 1.; Kunitake, T., Alternate Assembly of
Ordered Multilayers of Si02 and Other Nanoparticles and Polyions. Langmuir 1997, 13,
(23), 6195-6203.

124. Lvov, Y.; Ariga, K.; Ichinose, 1.; Kunitake, T., Layer-by-layer architectures of
concanavalin A by means of electrostatic and biospeciﬁc interactions. Journal of the
Chemical Society, Chemical Communications 1995, (22), 2313-14.

125. Ichinose, 1.; Fujiyoshi, K.; Mizuki, S.; Lvov, Y.; Kunitake, T., Layer-by-layer
assembly of aqueous bilayer membranes on charged surfaces. Chemistry Letters 1996,
(4), 257-8.

126. Lee, 1.; Hammond, P. T.; Rubner, M. F ., Selective Electroless Nickel Plating of
Particle Arrays on Polyelectrolyte Multilayers. Chemistry of Materials 2003 (in press).

127. Clark, S. L.; Montague, M.; Hammond, P. T., Selective deposition in multilayer
assembly: SAMS as molecular templates. Supramolecular Science 1997, 4, (1-2), 141-
146.

128. Clark, S. L.; Montague, M. F.; Hammond, P. T., Ionic Effects of Sodium Chloride
on the Templated Deposition of Polyelectrolytes Using Layer-by-Layer Ionic Assembly.
Macromolecules 1997, 30, (23), 7237-7244.

132

129. Geissler, M.; Wolf, H.; Stutz, R.; Delamarche, E.; Grummt, U. W.; Michel, B.;
Bietsch, A., Fabrication of metal nanowires using microcontact printing. Langmuir 2003,
19, (15), 6301-6311.

130. Ghosh, P.; Lackowski, W. M.; Crooks, R. M., Two new approaches for patterning
polymer ﬁlms using templates prepared by microcontact printing. Macromolecules 2001,
34, (5), 1230-1236.

131. Papra, A.; Bernard, A.; Juncker, D.; Larsen, N. B.; Michel, B.; Delamarche, E.,
Microﬂuidic networks made of poly(dimethylsiloxane), Si, and Au coated with

polyethylene glycol for patterning proteins onto surfaces. Langmuir 2001, 17, (13), 4090-
4095.

132. Delamarche, E.; Geissler, M.; Bernard, A.; Wolf, H.; Michel, B.; Hilbom, J.;
Donzel, C., Hydrophilic poly (dimethylsloxane) stamps for microcontact printing.
Advanced Materials 2001, 13, (15), ll64-+.

133. Kaneko, Y.; Sakai, K.; Okano, T., Temperature-responsive hydrogels as
intelligent materials. Biorelated Polymers and Gels 1998, 29-69.

134. Henry, C. M., Chem. Eng. News. Chem. Eng. News 2000, 78, 49.

135. M.N. Mar, B. D. R., 8.8. Yee, An intrinsically protein-resistant surface plasmon
resonance biosensor based upon a RF-plasma-deposited thin ﬁlm. Sensors Actuators B

1999, 54, 125.

136. Patel, N.; Padera, R.; Sanders, G. H. W.; Cannizzaro, S. M.; Davies, M. C.;
Langer, R.; Roberts, C. J .; Tendler, S. J. B.; Williams, P. M.; Shakesheff, K. M., Spatially

controlled cell engineering on biodegradable polymer surfaces. FASEB Journal 1998, 12,
(14), 1447-1454.

137. Vansteenkiste, S. O.; Comeillie, S. 1.; Schacht, E. H.; Chen, X.; Davies, M. C.;
Moens, M.; Van Vaeck, L., Direct Measurement of Protein Adhesion at Biomaterial
Surfaces by Scanning Force Microscopy. Langmuir 2000, 16, (7), 3330-3336.

138. Favia, P.; d'Agostino, R., Plasma treatments and plasma deposition of polymers
for biomedical applications. Surface and Coatings Technology 1998, 98, (1-3), 1102-
1106.

133

139. Merrill, E. W.; Salzman, E. W., Polyethylene oxide as a biomaterial. ASAIO
Journal 1983, 6, (2), 60-4.

140. Sa Da Costa, V.; Brier-Russell, D.; Salzman, E. W.; Merrill, E. W., ESCA studies
of polyurethanes: blood platelet activation in relation to surface composition. Journal of
Colloid and Interface Science 1981, 80, (2), 445-52.

141. Sa da Costa, V.; Brier-Russell, D.; Trudel, G., 111; Waugh, D. F .; Salzman, E. W.;
Merrill, E. W., Polyether-polyurethane surfaces: thrombin adsorption, platelet adsorption,
and ESCA scanning. Journal of Colloid and Interface Science 1980, 76, (2), 594-6.

142. Cuvelier, D.; Rossier, O.; Bassereau, P.; Nassoy, P., Micropattemed
"adherent/repellent" glass surfaces for studying the spreading kinetics of individual red

blood cells onto protein-decorated substrates. European Biophysics Journal with
Biophysics Letters 2003, 32, (4), 342-354.

143. Csucs, G.; Michel, R.; Lussi, J. W.; Textor, M.; Danuser, G., Microcontact
printing of novel co-polymers in combination with proteins for cell-biological
applications. Biomaterials 2003, 24, (10), 1713-1720.

144. Ahn, D. J.; Jin, J. J.; Lee, G. S.; Kwon, G.; Pak, J. J.; Kim, J.; Lee, K. J.,
Hippocampal neuronal network directed geometrically by sub-pattems of microcontact
printing (mu CP). Journal of Industrial and Engineering Chemistry 2003, 9, (1), 25-30.

145. Lu, L. C.; Nyalakonda, K.; Kam, L.; Bizios, R.; Gopferich, A.; Mikos, A. G.,
Retinal pigment epithelial cell adhesion on novel micropattemed surfaces fabricated from
synthetic biodegradable polymers. Biomaterials 2001, 22, (3), 291-297.

146. Berg, M. C.; Choi, J.; Hammond, P. T.; Rubner, M. F., Tailored Micropattems
through Weak Polyelectrolyte Stamping. Langmuir 2003, 19, (6), 2231-2237.

147. Caruso, F.; Lichtenfeld, H.; Donath, E.; Moehwald, H., Investigation of
Electrostatic Interactions in Polyelectrolyte Multilayer Films: Binding of Anionic
Fluorescent Probes to Layers Assembled onto Colloids. Macromolecules 1999, 32, (7),
2317-2328.

148. Prime, K. L.; Whitesides, G. M., Adsorption of proteins onto surfaces containing
end-attached oligo(ethylene oxide): a model system using self-assembled monolayers.
Journal of the American Chemical Society 1993, 115, (23), 10714-21.

134

149. Jiang, X. P.; Hammond, P. T., Routes to dimensional structures: Polymer-on-
polymer stamping and polyion surface sorting. Abstracts of Papers of the American
Chemical Society 2001, 221, U372-U372.

150. Koh, W. G.; Revzin, A.; Pishko, M. V., Poly(ethylene glycol) hydrogel
microstructures encapsulating living cells. Langmuir 2002, 18, (7), 2459-62.

151. Popat, K. C.; Johnson, R. W.; Desai, T. A., Characterization of vapor deposited
poly (ethylene glycol) ﬁlms on silicon surfaces for surface modiﬁcation of microﬂuidic
systems. Journal of Vacuum Science & Technology B 2003, 21, (2), 645-654.

152. Zhang, M.; Desai, T.; Ferrari, M., Proteins and cells on PEG immobilized silicon
surfaces. Biomaterials 1998, 19, (10), 953-960.

153. F olch, A.; Toner, M., Microengineering of cellular interactions. Annual Review of
Biomedical Engineering 2000, 2, 227-256.

154. Ito, Y., Surface micropatteming to regulate cell functions. Biomaterials 1999, 20,
(23/24), 2333-2342.

155. Orth, R. N.; Clark, T. G.; Craighead, H. G., Biosensors: Avidin-biotin
micropatteming methods for biosensor applications. BiomediCal Microdevices 2003, 5,
(1), 29-34.

156. Nicolau, D. V.; Taguchi, T.; Taniguchi, H.; Yoshikawa, S., Microsize Protein
Patterning on Diazonaphthoquinone/Novolak Thin Polymeric Films. Langmuir 1998, 14,
(7), 1927-1936.

157. Yang, 2.; Chilkoti, A., Microstamping of a biological ligand onto an activated
polymer surface. Advanced Materials 2000, 12, (6), 413-417.

158. Willner, 1.; Katz, E., Integration of layered redox proteins and conductive
supports for bioelectronic applications. Angewandte Chemie, International Edition 2000,
39, (7), 1181-1218.

159. Lee, K.-B.; Park, S.-J.; Mirkin, C. A.; Smith, J. C.; Mrksich, M., Protein
nanoarrays generated by dip-pen nanolithography. Science 2002, 295, (5560), 1702-1705.

135

160. Holden, M. A.; Cremer, P. 8., Light Activated Patterning of Dye-Labeled
Molecules on Surfaces. Journal of the American Chemical Society 2003, 125, (27), 8074-
8075.

161. Blawas, A. 8.; Oliver, T. F .; Pirrung, M. C.; Reichert, W. M., Step-and-Repeat
Photopatterning of Protein Features Using Caged-Biotin—BSA: Characterization and
Resolution. Langmuir 1998, 14, ( 15), 4243-4250.

162. Doh, J .; Irvine, D. J., Photogenerated polyelectrolyte bilayers from an aqueous-
processible photoresist for multicomponent protein patterning. Journal of the American
Chemical Society 2004, 126, (30), 9170-9171.

163. Lee, K.-B.; Lim, J.-H.; Mirkin, C. A., Protein nanostructures formed via direct-

write dip-pen nanolithography. Journal of the American Chemical Society 2003, 125,
(19), 5588-5589.

164. Tien, J .; Nelson, C. M.; Chen, C. 8., Fabrication of aligned microstructures with a
single elastomeric stamp. Proceedings of the National Academy of Sciences of the United
States of America 2002, 99, (4), 1758-1762.

165. Sorribas, H.; Padeste, C.; Tiefenauer, L., Photolithographic generation of protein
micropattems for neuron culture applications. Biomaterials 2001, 23, (3), 893-900.

166. Lemmo, A. V.; Rose, D. J.; Tisone, T. C., Inkjet dispensing technology:
applications in drug discovery. Current Opinion in Biotechnology 1998, 9, (6), 615-617.

167. Langer, R., Drug delivery and targeting. Nature 1998, 392, (6679), 5-10.

168. Luo, L. Q.; Liu, J. Y.; Wang, Z. X.; Yang, X. R.; Dong, S. J.; Wang, E. K.,
Fabrication of layer-by-layer deposited multilayer ﬁlms containing DNA and its
interaction with methyl green. Biophysical Chemistry 2001, 94, (1-2), 11-22.

169. Lvov, Y.; Decher, G.; Sukhorukov, 0., Assembly Of Thin-Films By Means Of
Successive Deposition Of Alternate Layers Of Dna And Poly(Allylamine).
Macromolecules 1993, 26, (20), 5396-5399.

170. Hill, I. R. C.; Garnett, M. C.; Bignotti, F.; Davis, S. S., Determination of
protection from serum nuclease activity by DNA-polyelectrolyte complexes using an
electrophoretic method. Analytical Biochemistry 2001, 291, (1), 62-68.

136

171. Tuerk, 0; Gold, L., Systematic evolution of ligands by exponential enrichment:
RNA ligands to bacteriophage T4 DNA polymerase. Science (Washington, DC, United
States) 1990, 249, (4968), 505-10.

172. Ellington, A. D.; Szostak, J. W., In vitro selection of RNA molecules that bind
speciﬁc ligands. Nature (London, United Kingdom) 1990, 346, (6287), 818-22.

173. lshida, S.; Usui, T.; Yamashiro, K.; Kaji, Y.; Amano, S.; Ogura, Y.; Hida, T.;
Oguchi, Y.; Ambati, J.; Miller, J. W.; Gragoudas, E. S.; Ng, Y.-S.; D'Amore, P. A.;
Shima, D. T.; Adamis, A. P., VEGFl64-mediated inﬂammation is required for
pathological, but not physiological, ischemia-induced retinal neovascularization. Journal
of Experimental Medicine 2003, 198, (3), 483-489.

174. Brody, E. N.; Gold, L., Aptamers as therapeutic and diagnostic agents. Reviews in
Molecular Biotechnology 2000, 74, (1), 5-13.

175. Gold, L.; Polisky, B.; Uhlenbeck, O.; Yarus, M., Diversity of oligonucleotide
functions. Annual Review of Biochemistry 1995, 64, 763-97.

176. Wilson, D. S.; Szostak, J. W., In vitro selection of functional nucleic acids.
Annual Review of Biochemistry 1999, 68, 611-647.

177. Hesselberth, J.; Robertson, M. P.; Jhaveri, S.; Ellington, A. D., In vitro selection
of nucleic acids for diagnostic applications. Reviews in Molecular Biotechnology 2000,
74, (1), 15-25.

178. Jayasena, S. D., Aptamers: an emerging class of molecules that rival antibodies in
diagnostics. Clinical Chemistry (Washington, D. C.) 1999, 45, (9), 1628-1650.

179. Stadtherr, K.; Wolf, H.; Lindner, P., An aptamer-based protein biochip. Analytical
Chemistry 2005, 77, (11), 3437-3443.

180. Kirby, R.; Cho, E. J .; Gehrke, B.; Bayer, T.; Park, Y. S.; Neikirk, D. P.; McDevitt,
J. T.; Ellington, A. D., Aptamer-based sensor arrays for the detection and quantitation of
proteins. Analytical Chemistry 2004, 76, (14), 4066-4075.

181. Potyrailo, R. A.; Conrad, R. C.; Ellington, A. D.; Hieftje, G. M., Adapting
Selected Nucleic Acid Ligands (Aptamers) to Biosensors. Analytical Chemistry 1998, 70,
(16), 3419-3425.

137

182. Liss, M.; Petersen, B.; Wolf, H.; Prohaska, E., An aptamer-based quartz crystal
protein biosensor. Analytical Chemistry 2002, 74, (l 7), 4488-4495.

183. Xiao, Y.; Piorek, B. D.; Plaxco, K. W.; Heeger, A. J., A Reagentless Signal-On
Architecture for Electronic, Aptamer-Based Sensors via Target-Induced Strand
Displacement. Journal of the American Chemical Society 2005, 127, (51), 17990-17991.

184. McCarley, R. L.; Vaidya, B.; Wei, S.; Smith, A. F.; Patel, A. B.; Feng, J.;
Murphy, M. C.; Soper, S. A., Resist-Free Patterning of Surface Architectures in Polymer-
Based Microanalytical Devices. Journal of the American Chemical Society 2005, 127,
(3), 842-843.

185. Couch, R. B., Prevention and treatment of inﬂuenza. New England Journal of
Medicine 2000, 343, (24), 1778-1787.

186. Cooper, N. J.; Sutton, A. J .; Abrams, K. R.; Wailoo, A.; Turner, D. A.; Nicholson,
K. G., Effectiveness of neuraminidase inhibitors in treatment and prevention of inﬂuenza
A and B: systematic review and meta-analyses of randomized controlled trials. BMJ
[British Medical Journal] 2003, 326, (7401), 1235-1239.

187. Demicheli, V.; Jefferson, T.; Rivetti, D.; Deeks, J., Prevention and early treatment
of inﬂuenza in healthy adults. Vaccine FIELD Full Journal Title: Vaccine 2000, 18, (11-
12), 957-1030.

188. Skehel, J. J.; Wiley, D. C., Receptor binding and membrane fusion in virus entry:
the inﬂuenza hemagglutinin. Annual Review of Biochemistry 2000, 69, 531-569.

189. Skehel, J. J.; Cross, K.; Steinhauer, D.; Wiley, D. C., Inﬂuenza fusion peptides.
Biochemical Society Transactions 2001, 29, (4), 623-626.

190. Wilson, I. A.; Skehel, J. J.; Wiley, D. C., Structure of the hemagglutinin
membrane glycoprotein of inﬂuenza virus at 3.ANG. resolution. Nature (London, United
Kingdom) 1981, 289, (5796), 366-73.

191. Brummelkamp, T. R.; Bemards, R., Innovation - New tools for functional
mammalian cancer genetics. Nature Reviews Cancer 2003, 3, (10), 781-789.

192. Ameyar-Zazoua, M.; Guasconi, V.; Ait-Si-Ali, S., siRNA as a route to new cancer
therapies. Expert Opinion on Biological Therapy 2005, 5, (2), 221-224.

138

193. Bock, L. C.; Grifﬁn, L. C.; Latham, J. A.; Vermaas, E. H.; Toole, J. J., Selection
of single-stranded DNA molecules that bind and inhibit human thrombin. Nature
(London, United Kingdom) 1992, 355, (6360), 564-6.

194. Macaya, R. F.; Schultze, P.; Smith, F. W.; Roe, J. A.; Feigon, J., Thrombin-
Binding DNA Aptamer Forms a Unimolecular Quadruplex Structure in Solution.
Proceedings of the National Academy of Sciences of the United States of America 1993,
90, (8), 3745-3749.

195. Schultze, P.; Macaya, R. F.; Feigon, J., 3-Dimensional Solution Structure of the
Thrombin-Binding DNA Aptamer D(thtggtgtggttgg). Journal of Molecular Biology
1994, 235, (5), 1532-1547.

196. Kuryavyi, V.; Majumdar, A.; Shallop, A.; Chemichenko, N.; Skripkin, E.; Jones,
R.; Patel, D. J., A double chain reversal loop and two diagonal loops deﬁne the
architecture of a unimolecular DNA quadruplex containing a pair of stacked G(syn)center
dot G(syn)center dot G(anti)center dot G(anti) tetrads ﬂanked by a G center dot(T-T)
triad and a T center dot T center dot T triple. Journal of Molecular Biology 2001, 310,
(1), 181-194.

197. Smimov, 1.; Shafer, R. H., Effect of loop sequence and size on DNA aptamer
stability. Biochemistry 2000, 39, (6), 1462-1468.

198. Paborsky, L. R.; Mccurdy, S. N.; Grifﬁn, L. C.; Toole, J. J.; Leung, L. L. K., The
Single-Stranded-DNA Aptamer-Binding Site of Human Thrombin. Journal of Biological
Chemistry 1993, 268, (28), 20808-20811.

199. Tsiang, M.; Gibbs, C. S.; Grifﬁn, L. C.; Dunn, K. E.; Leung, L. L. K., Selection of
a Suppressor Mutation That Restores Affinity of an Oligonucleotide Inhibitor for
Thrombin Using in-Vitro Genetics. Journal of Biological Chemistry 1995, 270, (33),
19370-19376.

200. Tsiang, M.; Jain, A. K.; Dunn, K. E.; Rojas, M. E.; Leung, L. L. K.; Gibbs, C. 8.,
Functional Mapping of the Surface Residues of Human Thrombin. Journal of Biological
Chemistry 1995, 270, (28), 16854-16863.

201. Grifﬁn, L. C.; Tidmarsh. George, F .; Bock, L. C.; Toole, J. J .; Leung, L. L. K., In
vivo anticoagulant properties of a novel nucleotide-based thrombin inhibitor and
demonstration of regional anticoagulation in extracorporeal circuits. Blood 1993, 81,
(12), 3271-6.

139

202. Li, W. X.; Kaplan, A. V.; Grant, G. W.; Toole, J. J.; Leung, L. L. K., A novel
nucleotide-based thrombin inhibitor inhibits clot-bound thrombin and reduces arterial
platelet thrombus formation. Blood 1994, 83, (3), 677-82.

203. Coutre, S. E.; Grifﬁn, L. C.; Moon, M. R.; .Deanda, A.; Law, V. S.; Leung, L. L.
K.; Miller, D. C., Thrombin Aptamer as an Anticoagulant for Canine Cardiopulmonary
Bypass. Thrombosis and Haemostasis 1993, 69, (6), 540-540. '

204. Shaw, J.-P.; Fishback, J. A.; Cundy, K. C.; Lee, W. A., A novel
oligodeoxynucleotide inhibitor of thrombin. I. In vitro metabolic stability in plasma and
serum. Pharmaceutical Research 1995, 12, (12), 1937-42.

205. Dubas, S. T.; Schlenoff, J. B., Polyelectrolyte multilayers containing a weak
polyacid: Construction and deconstruction. Macromolecules 2001, 34, (11), 3736-3740.

206. Wood, K. C.; Boedicker, J. Q.; Lynn, D. M.; Hammon, P. T., Tunable drug
release from hydrolytically degradable layer-by-layer thin ﬁlms. Langmuir 2005, 21, (4),
1603-1609.

207. Ren, K. F.; Ji, J.; Shen, J. C., Construction and enzymatic degradation of
multilayered poly-L-lysine/DNA ﬁlms. Biomaterials 2006, 27, (7), 1152-1159.

208. Putnam, D.; Gentry, C. A.; Pack, D. W.; Langer, R., Polymer-based gene delivery
with low cytotoxicity by a unique balance of side-chain termini. Proceedings of the
National Academy of Sciences of the United States of America 2001, 98, (3), 1200-+.

209. Dubas, S. T.; Farhat, T. R.; Schlenoff, J. B., Multiple membranes from "true"
polyelectrolyte multilayers. Journal of the American Chemical Society 2001, 123, (22),
5368-5369.

140

         
 

       

11111111 1111111

2 45 9075