 

 

 

 

 

 

 

. .
. “New"?! ..
2.? :ﬂwld‘.

. .nﬂmui a. .
C . i .

; a. .
.

i:

4 if. . .
. ‘V t !

. .nudvd

5.3.. u. «E.
. . ...... . .5,
. . . . t . .25....
. ., ﬁtuﬂmmnﬁ ...W®‘WMWWMM%R.

“(w-.1333 .1 2 ”I

unﬁt... Wm“.

doc: 28.. ‘ .3. . ...
-. .- 5W... gﬁmwmmﬂ:
.aLal-éuw ‘v‘ h." s”: 61 5

gamma . ,w... sﬁgrmwrnsn

I1..t o
. III!!-

Véuﬂl- .h...’ 3.
. I l ‘0‘ II

.I 1“
- it.- :u
‘«x ~(4‘Klbnl-
an 7 v}... 2

.l.

 

f.
(2...
ﬁll I.
ukubum
...
3,“ 3..
42.. .l!
. gt .
~ .QaHo. a ti.
IEPHWFW‘ o
. .9.
KM? . .
31.2;
I. .1

\NJI‘
hi‘K. . .nrhrfl...‘\.t
1.1%».th huh... . . 1.95“.“
, |
I a]! .3.
any." n y

‘1

V .. . .
linwﬂnﬁ...
-9... 7 :2..-

1““

 

L. to . . , I. . .
- a £33.13 ..............._s....--- --

 

9001

 

LIBRARY
Michigan State
University

 

 

 

This is to certify that the
dissertation entitled

WHOLE-CELL PHYSIOLOGY AND GENE EXPRESSION
PATTERNS IN THE CO-METABOLISM OF AND
TOLERANCE TO PCBS BY BURKHOLDERIA
XENOVORANS LB400.

presented by

John Jacob Parnell

has been accepted towards fulfillment
of the requirements for the

Doctoral degree in Crop 8: Soil Science
Center fol Microbial Ecology

 

o,

 

7 Major Pﬁfesso s Sigbfature
5/4 a 7

Date

 

MSU is an afﬁmvative-aaion, equal-opportunity employer

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DAIEDUE

DATEDUE

DAIEDUE

 

“59 535* 350W

 

 

 

 

 

 

 

 

 

 

 

 

 

6/07 p:/ClRC/DateDue.indd-p.1

 

WHOLE-CELL PHYSIOLOGY AND GENE EXPRESSION PATTERNS IN THE
CO-METABOLISM OF AND TOLERANCE TO PCBS BY BURKHOLDERIA
XENO VORANS LB400.

By

John Jacob Parnell

A DISSERTATION

Submitted to
Michigan State University
in partial ﬁJlﬁllment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY
Department of Crop and Soil Sciences

2007

ABSTRACT
WHOLE-CELL PHYSIOLOGY AND GENE EXPRESSION PATTERNS IN THE
CO-METABOLISM OF AND TOLERANCE TO PCBS BY BURKHOLDERM
XENOVORANS LB400.
By
John Jacob Parnell
Aerobic biodegradation of polychlorinated biphenyls (PCBS) occurs gratuitously

via the biphenyl (bph) pathway. Although many PCB-degrading bacteria exhibit similar
degradation proﬁles, I have found a wide range of sensitivity to PCBS and hypothesize
involvement of genes outside the bph pathway in efﬁcient degradation. To date, little
information is available on mechanisms beyond the bph pathway that bestow PCB
tolerance to microorganisms or increase degradation efficiency. This work combines
physiological information on the reponse of Burkholderia xenovorans LB4OO (LB400)
with microarray techniques to investigate the transcriptomic response to growth substrate
and growth phase on the degradation of PCBS. I report the induction of the bph and
(chloro)catechol pathways during PCB degradation, however during growth on simple
carbon sources, such as succinate, PCBS inhibit the bph pathway. Importantly, among
the putative genes induced on degradation of PCBS, a putative chloroacetaldehyde
dehydrogenase exibited 83% (amino acid) identity to a homolog responsible for rapid
conversion of the highly toxic chlroroacetaldehyde intermediate in dichloroethane (DCE)
degraders. The statistical analysis of genome-wide expression patterns of 11 different
treatments reveals a close relationship in expression of the acetaldehyde dehydrogenase
in the lower biphenyl pathway (BphJ) and chloroacetaldehyde dehydrogenase, suggesting

a similar role. In addition, transcriptional proﬁling indicates very limited expression

response to PCB degradation compared with changes in growth rate and substrate and
identiﬁes several candidate genes, such as transporters and regulators that may be
involved in the degradation of biphenyl. Resting-cell assays of LB400 show a dymanic
change in degradation proﬁles as a result of culture conditions (carbon source and grth
phase). Microarray analyses indicate several pathways associate with PCB degradation
are inﬂuenced by sigma-54 (054). Subsequent Q-RT-PCR analysis of both 054 factors in
the LB400 genome indicate the involvement of only one (located on the mini
chromosome) associated with the degradation of biphenyl. lFurther Q-RT-PCR analyses
of the response of the biphenyl pathway to carbon source competition and growth phase
reveals inhibition of the biphenyl pathway by PCBS. Metabolic footprinting of knockout
mutants of the Cl pathway (LB4OOAxoxF and LB400AﬂhAfdhAmtdB) in LB400 indicates
the involvement of this pathway in detoxiﬁcation of formaldehyde that accumulates
during growth on biphenyl and degradation of PCBS that has not been reported
previously. Although I Show that the affect of PCBS on gene expression proﬁles is
minimal, several auxiliary mechanisms involved in PCB degradation have been
identiﬁed. This work has outlined several factors, such as biotoxicity (detoxiﬁcation),
carbon source competition, and regulation and transport that are essential to the

degradation of PCBS in an environmental context.

Copyright by
JOHN JACOB PARNELL
2007

 

I' dedicate the work I have done over the past ﬁve years to all of those that have
allowed me to stand on their shoulders in order to keep my head above water. Primarily,
I dedicate this to my wife, Kara and the kids. Their patience with me alone Should earn
them credit for much of the success of this work. Field trips have been cancelled and
vacations postponed all in the name of science. Their endurance has been exemplary and

without them, none of this would mean anything.

ACKNOWLEDGEMENTS

Throughout the course of work for the fulﬁllment of the requirements for this
degree, I have received help and support from many sources. Looking back on the
progress I have had, I owe much to the faith I have in Heavenly Father. Following that
source of guidance, I have to give thanks to my family and the support that they have
offered, especially Kara, for being patient while I rolled out of bed in the middle of the
night for growth curve readings or came in on weekends or holidays to ﬁnish
experiments. My immediate family (including in—laws) was always there to bail me out
and help when I needed it most. I especially thank Judy, Chuck, and Heidi Schurman for
being our family in Michigan.

_ I gratefully acknowledge Ewa Daniellewicz and Alicia Pastor for their help with
electron microscopy and A. Daniel Jones for his help with LC-MS analysis. Jeff
Landgraff was instrumental in both analysis of gene expression patterns and Q-RT«PCR
advice. I was greatly guided in experimental design and research strategies by Vincent
Denef, Tamara Tsoi, Joon Park, Peter Bergholz, Stephen Callister, among others in the
lab and of course Dr. Tiedje for always being available to meet with me and his input on
the eventual manuscript products from this work. I also need to acknowledge Shannon
Hinsa for her follow—up work with LB400 that will build on what Ihave accomplished. I
never would have made it through all of the hurdles associated with forms and general
requirements without the help of Rita House and Lisa Pline and have learned never to
underestimate the value of good secretaries.

This researchwds funded by a grant from the National Institute of Envrironmental

l-Iealth Sciences.

vi

TABLE OF CONTENTS

LISTOFTABLES ................................ '1x
LIST OF FIGURES ......................... ' ......... .......................... xi
CHAPTER 1: INTRODUCTION AND RATIONALE.
Background ............. , .............................. . ................... 1
Signiﬁcance ....................................................... - ......... 4
Objectives of this study ............................................... 5
References ............. . ....... . .......................................... 7

CHAPTER 2: I ITERATURE REVIEW

Microbial degradation of PC Bs ................................... 13
The polychlorinated biphenyl degradation pathway .................. l7
Biotoxicity of PCBS ...................................................... 22
Burkholderia xenovorans LB400 ... ....... ' .......................... 24
Microarray technology ............... .. ............................. 29
Summary ............................................................... 30
References ....................... . ....................................... 3 1

CHAPTER 3: COPIN G WITH PCB TOXICITY: THE PHYSIOLOGICAL AND
GENOME- WIDE RESPONSE OF Burkholderia xenovorans LB400 TO PCB
(POLYCHLORINATED BIPHENYL)-MEDIATED STRESS.

Abstract ............................................................... 45
Introduction ................................ , .............................. 46
Materials and methods . ............................................ 48
Results ....................... . ....... . ............................... 52
Discussion ............................................................... 64
References ............................................................... 70

CHAPTER 4: SUPPORTING CAST OF PCB DEGRADATION:

USING TRANSCRIPTION AL PROFILING TO IDENTIFY GENES INVOLVED
IN (POLYCHLORINATED) BIPHENYL DEGRADATION IN Burkholderia
xenovorans I B400.

Abstract ..................................... 1.... . .................... 76
Introduction ..................................... . ......... .. ............... 77
Materials and methods ............ ' ....... ' ........ 79
Results ...... . ...................................... , ................. 81
Discussion ......................... .......... ............. 83
References .. .. ........................................................... 92

CHAPTER 5: ENVIRONMENTALLY RELEVANT PARAMETERS AF FECTING
PCB DEGRADATION: INVESTIGATION OF THE EXPRESSION OF THE

vii

BIPHENYL PATHWAY AND ASSOCIATED GENES IN Burkholderia xenovorans
LB400

Abstract ............................................. . ................. 96

. Introduction ............................ . .................................. 97
. Materials and methods ............................................. 101
Results ........................................................ ' ....... 105
Discussion ............................................................... 117
References .............................. ' ................................. 125

CHAPTER 6: ACCUMULATION AND DETOXIFICATION OF
F ORMALDEHYDE IN Burkolderia xenovorans LB400 DURING
(POLYCHLORINATED) BIPHENYL DEGRADATION.

Abstract ............................................................... 129
Introduction ............... .. .................................... ' ........... 130
Materials and methods ............................................. 131
Results ........................................ '. ...................... 132
.Discussion ............................................................... 133
References ............................................................... 1 39

CHAPTER 7: SUMMARY AND FUTURE PERSPECTIVES.
Major conclusions ...................................................... 141
Future perspectives ................. - ............. ' ........................ 1 45

viii

LIST OF TABLES

Table 1.1. Industrial usage in pounds and percent total of
PCBS in the United States to 1977. ................................... 3

Table 3.1. Tolerance of potential PCB-degrading strains to

500 ppm Aroclor 1242 in Luria Bertani medium. Tolerance

(relative growth) was determined by comparing the maximum

growth rate (n max) and maximum biomass (Max OD at 600

nm) in the presence and absence of PCBS. ................................................ 49

Table 3.2. PCBs (ppm) extracted from two Burkholderia

xenovorans strains incapable of PCB degradation after

incubation with Aroclor 1242. Cultures and control were

ﬁltered using sterile glass wool to remove insoluble PCBs

prior to centrifugation (i standard deviation). ........ . .................................. 56

Table 3.3. Morphological measurements of the smallest

quartile of LB400 cells grown on different carbon sources

on exposure to 500 ppm Aroclor 1242 as calculated by

CMEIAS (i standard deviation). Statistically signiﬁcant

groups are indicated by different letters (determined by _

t-test p<0.05). ................................................ ......... > ....................... 59

Table 3.4. Up-regulated genes of LB400 grown on biphenyl
with PCBS with growth on biphenyl as the reference.
Expression reported as the ratio. ................................ ~ ............................ 63

Table 3.5. Down-regulated genes of LB400 grown on biphenyl
with PCBS with growth on biphenyl as the reference.
Expression reported as the ratio. ........... . ................................... . .......... 65

Table 5.1. Treatment matrix of carbon competition (row) and
growth phase (column) involved in this study. Check marks
indicate samples harvested for Q-RT-PCR analysis. .................................... 102

Table 5.2. Primers used for Q—RT-PCR analysis in this study
including biphenyl pathway elements detoxification pathway
genes sigma-70 and both sigma-54 factors (sc = small

chromosome BxeBl 172, c = large chromosome BxeA4122). .......................... 106

Table 5.3. Percent degradation of PCB congeners from resting
cell assays of LB400 harvested during exponential-phase (ML)
. growth and transition to stationary-phase (TP). .......................................... 109

Table 5.4. Genes identified through genome-wide microarray

1x

analyses commonly induced during growth on biphenyl transition

to stationary-phase (T P) and exposure to PCBS during mid—log

(ML PCBS) divergent from genes induced during growth 'on

biphenyl alone (ML). Highlighted genes indicate previously

identiﬁed detoxiﬁcation pathways that may be involved in

PCB degradation. ............... . ............................................................. 112

Table 5.5. Expression values from quantitative RT-PCR

analysis demonstrating the effect of different carbon sources

[succinate (Succ), biphenyl (Bph), and polychlorinated

biphenyls (PCB)] and different growth phases [Mid-

Logarithmic (ML) and Transition to stationary-phase (TP)] on

biphenyl pathway components, regulatory elements, and

. detoxiﬁcation genes potentially involved in biphenyl degradation.

Expression values are reported relative to succinate—grown

Burkholderia xenovorans LB400 harvested from mid-logarithmic

growth (Succ ML). ........................................................................... 115

Table 5.6. Correlation matrix of R2 values from regression

analysis of the expression of components of the biphenyl

pathway, its potential regulators, and detoxiﬁcation pathway

genes possibly associated with biphenyl degradation in

Burkholderia xenovorans LB400. Quantitative RT-PCR

expression data were converted to Log; values prior to regression

analysis. Signiﬁcant p-values (<0.05) are bold. ................ . ...................... ...116

LIST OF FIGURES

Figure 1.1. Estimated world-wide cumulative usage of PCBS
in tons (from Brevik et a1. 2002) ............................................................. 2

Figure 2.1. Gas chromatograms indicating reductive

dechlorination of PCBS by anaerobic bacteria. Reductive

dechorination removes chlorine from highly- chlorinated

congeners resulting in lesser-chlorinated congeners, but does

not eliminate PCBS. (from www.ct.ornl.gov/eds/rtg) .................................... 14

Figure 2.2. PCB~degradative competence of environmental
isolates (from Bedard 1986). ................................................................ 16

Figure 2.3. Biphenyl upper pathway encoded by the bph

locus of Burkholderia xenovorans LB400. (Chloro)biphenyl (l)

is converted to (chloro)biphenyl—2,3-dihydrodiol (2) by biphenyl

dioxygenase (BphAEFG). (2) is converted to (chloro)2,3-

dihydroxybiphenyl (3) by biphenyl-2,3-dihyddrodiol-2,3-

dehydrogenase (BphB). (3) is converted to (chloro)2-hydroxy—6-—
oxo-6-phenylhexa-2,4-denoic acid (4) by 2,3-dihydroxybiphenyl-

1,2-dioxygenase (BphC). (4) is cleaved to form 2—hydroxypenta-

2,4-dienoic acid (5a) and (chloro)benzoic acid (5b) by 2-hydroxy-
6.-oxo-phenylhexa-2,4-dienoate hydrolase (BphD). ..................................... 18

Figure 2.4. Correlation of the partition coefﬁcient of
hydrophobic compounds with their ability to partition into the
cellular membrane (modiﬁed from Sikkema, et a1. 1995) ............................... 25

Figure 2.5. Electron micrograph of Burkholderia xenovorans
LB400 grown on lg/L of succinate in Kl mineral medium ............................. 27

Figure 2.6. Genome of LB400 (from Chain, et al. 2006) .............................. 28

Figure 3.1. Growth curves of LB400 and RHAl on biphenyl
(3g/L) as carbon source with and without 500 ppm Aroclor
1242 (PCBs) in K1 medium. ............................................................... 55

Figure 3.2. Percent degradation of lower-chlorinated PCB

congeners (500 ppm Aroclor 1242) by LB400 harvested during

exponential~phase growth on benzoate (Ben), succinate (Succ),

_ and biphenyl (Bph) with PCBS. 57

Figure 3.3. Electron micrographs of LB400 grown on succinate
with and without PCBs: TEM image of exponential-phase cells
with PCBS (A), and without PCBS (B), SEM of late exponential-

xi

_ phase cells with PCBS (C) and without PCBS (D). ....................................... 60

Figure 3.4. Fatty acid analysis of LB400 during growth on

carbon sources with different octanol-water coefﬁcients (Kow)

in the presence (striped) and absence (solid) of PCBS. Fatty acids

were grouped as unsaturated (light), saturated (gray) and cyclic

(dark) ............................................................................................. 61

Figure 3.5. Logarithmic scale plots of spot intensities (arbitrary

units). Transcriptional proﬁles from mid-log growth on succinate

versus succinate with PCBs (A), benzoate versus benzoate with

PCBS (B), and biphenyl versus biphenyl with PCBs (C). Each

represents dye swap of biological replicates with Lowess

normalization. Diagonal lines represent two-fold change in

gene expression ................................................................................ 62

Figure 4.1. Schematic of treatments and comparisons used in

this study. All were harvested from mid-logarithmic phase

growth unless speciﬁed (T.P. indicates transition to early

stationary phase). .............................................................................. 85

Figure 4.2. Pricipal component analysis of the genome-wide
expression pattern of all treatments used in this study .................................... 86

Figure 4.3. Cluster analysis of the total genome-wide
expression patterns of all treatments used in this study ..................... . ............. 87

Figure 4.4. Expression proﬁle (y axis) of the biphenyl pathway
across all treatments (x axis) (top) and clustered according to
their expression proﬁle (bottom) ............................................................ 88

Figure 4.5. Clade containing the expression proﬁles for the genes

in the upper biphenyl pathway along with other genes that may

be involved in (polychlorinated) biphenyl degradation by cluster

analysis. Expression of genes in each treatment (x axis) relative

to succinate ML. Light = up-regulated, Black = No change

in expression ................................................................................... 90

Figure 4.6. The Expression proﬁle for the acetaldehyde

dehydrogenase (BphJ) gene in the lower biphenyl pathway

clusters with other genes that may be involved in (polychlorinated)

biphenyl degradation. Expression of genes in each treatment

(x axis) relative to succinate ML. Light = up-regulated, Black =

No change in expression ..................................................................... 91

Figure 5.]. Regulatory model for the biphenyl pathway in

xii

Burkholderia xenovorans LB400. Adapted from Denef,
. V.J., 2005...... .................................................................................. 100

Figure 5.2. Diagram demonstrating sample collection points for

growth-phase studies. Mid-logarithmic phase samples (ML) were

collected at 0.3-0.4 OD600 nm. Early stationary phase samples

(TP) were collected at 0.8—1.0 OD600 nm .................................................. 103

Figure 5.3. Percent degradation of PCBS during growth on
succinate (y axis). Speciﬁc PCB congeners degraded (x axis)
throughout different growth phases (2 axis) ............................................... 107

Figure 5.4. Venn diagram of up-regulated genes from

Burkholderia xenovorans LB400 grown on biphenyl (A)

harvested during ML growth, (B) harvested during TP growth,

and (C) grown with biphenyl and 500 ppm Aroclor 1242 and

harvested during ML growth (all relative to succinate ML

growth). Bold indicates genes induced during conditions most

favorable for PCB degradation. ............................................................ 110

Figure 5.5. Growth curves of Burkholderia xenovorans LB400

grown with succinate (1 g/L), biphenyl (3 gfL) and PCBS (500

ppm vzv Aroclor 1242) in K1 mineral medium. Succinate was

added to biphenyl-grown culture during mid-logarithmic growth. ..................... 118

Figure 5.6. Expression of genes (bphAi and bphD) and the

regulator (bthI ) involved in the biphenyl degradation

pathway relative to succinate mid-log growth (columns) and

growth curves (ODéoonm) of LB400 grown on biphenyl to

mid-log growth (blue) and amended with succinate (green)

(lines). Data collected at 0 min (A), 5 min (B), 30 min (C)

and 1h (D) following addition of succinate ................................................ 120

Figure 6.1. Functional redundance of three formaldehyde

detoxiﬁcation pathways in Burkholderia xenovorans LB400

(from Marx, et al. 2004). Formaldehyde is produced by XoxF

and channeled into three pathways. Knockout mutations used in

this study are designated LB400AxoxF (+) and

LB400AﬂhAfdhAmtdB (*). ................................................................. 135

Figure 6.2. LC-MS proﬁle of LB400wt grown on biphenyl with

and without PCBS harvested from mid-logarithmic (ML) and

early stationary phase growth (ES). The retention time for

modiﬁed formaldehyde is highlighted .................................................... 136

Figure 6.3. LC-MS proﬁle of LB400AﬂhA fdhA mtdB grown on

xiii

biphenyl and harvested during early stationary phase (ES) and
mid logarithmic phase (ML) with PCBS. The retention time for .
. modiﬁed formaldehyde is highlighted ...................................................... 137

Figure 6.4. LC-MS proﬁle of LB400Ax0xF grown on biphenyl

and harvested during early stationary phase (ES) and mid

logarithmic phase (ML) with PCBs. The retention time for

modiﬁed formaldehyde is highlighted ...................................................... 138

xiv

CHAPTER 1
INTRODUCTION AND RATIONALE

Background

Polychlorinated biphenyls (PCBS) are among the most important environmental
pollutants (Quensen, et al. 1998). PCBS are composed of a biphenyl nucleus with one to
ten substituted chlorines; each different type of substitution is referred to as a congener.
PCBS are generally found in industrial mixtures that contain 60 to 100 of the 209
different possible congeners and were produced commercially under the names Clophen
(Bayer, Germany), Aroclor (Monsanto, USA), Kanechlor (Kanegafuchi, Japan),
Santother (Mitsubishi, Japan), Phenoclor, and Pyralene (Prodolec, France). The degree
of chlorination of each mixture is indicated by a number, the ﬁrst indicating the number
of carbon atoms and the latter denoting the percent chlorine by weight, thus Aroclor 1242
consists of 12 carbons and is 42% chlorine by weight. The persistence of PCBS in the
environment increases with the extent of substitution as well as the position of chlorine
atoms around the biphenyl nucleus and is generally associated with their aqueous
solubility (Otto and Moon, 1996). Until their ban in 1977, more than 1.5 billion pounds
of PCBS were manufactured in the United States alone (USEPA). Their industrial
purposes varied greatly and included electric ﬂuids in transformers and capacitors, wax
and pesticide extenders, adhesives, de-dusting agents, cutting and compressor oils, ﬂame
retardants, heat transfer and dielectric ﬂuids, hydraulic lubricants, electromagnets,
ﬂuorescent light ballasts, sealants, paints, inks, dyes and carbonless copy paper (Table

1.1)(Mondello, et al. 1997).

 

 

 

 

 

Figure 1.1. Estimated world-wide cumulative usage of PCBS in tons (from Brevik et al.

2002).

Table 1.1. Industrial usage in pounds and percent total of PCBs in the United States to

1977.

 

 

Pounds Percentage

PCB Use (millions) of Total
Capacitors 755 50%
Transformers 400 26%
Placticizer uses 138 9%
Hydraulics and lubricants 100 6%
Carbonless copy paper 54 3%
Heat transfer ﬂuids 24 1%
Petroleum additives 2 0.1%
Miscellaneous industrial uses 33 2%

TOTAL 1,506 97.1%

 

Ironically, the physicochemical characteristics that originally made PCBS so valuable—
low vapor pressure and aqueous solubility, excellent dielectric

properties, stability, inertness and persistence—are now the source of greatest
environmental concern. Due to their low aqueous solubility, low volatility, and high
octanol/water partitioning coefﬁcients, PCBS readily become concentrated on sediment
and soil surfaces (Chiou, 2002). Many of the physicochemical properties of PCBs also
elicit negative effects in organisms. Because PCBS are very insoluble, they tend to
accumulate in lipids of organisms (Chiou, 2002). The environmental dispersal of PCBS
is pervasive due to the extent of commercial production, widespread industrial

application, and persistence.

Significance

Health concerns with PCBS stem from their ability to bioaccumulate in the higher
trophic levels (Kidd et al., 1998). The toxic effects of PCBS on eukaryotic organisms has
been well documented and include oxidative stress and altered morphology of tissues that
can lead to cell death (Stalker, et a1. 1991; Livingstone, et al. 1991). In response to
PCBS, aquatic organisms increase antioxidant defenses (Schlezinger, et al. 2000), such as
superoxide dismutase, carotenoids, peroxidases, and glutathione (Leitao, et al. 2003).
Because of the lipophilic properties of PCBS, they tend to partition into and concentrate
in the lipid tissues of all organisms (Chiou, 2002), including humans (Pelletier et al.,
2003), where they may alter immune functions (Grasman & Fox 2001; Smithwick et al.,

2003) and cause neurological (Seegal 1996), developmental (Patandin et al., 1999),

respiratory (Swanson et al., 1995), and reproductive problems as well as some types of
cancer due to estrogenic activity (Demers, et a1. 2002). Numerous studies have focused
on health concerns that demonstrate biotoxicity of elevated concentrations of PCBS over
a wide variety of higher organisms. However, until now, the physiological response to
PCB exposure has almost entirely focused on eukaryotic organisms. The characterization
of the physiological response of bacteria to PCBS is essential as they play a major role in
the food web where their exposure to PCBs is potentially greatest (soil/sediment surfaces)
and they have the ability to degrade some congeners.

The most attractive solution to the problem of PCBS in the environment entails
their complete in Situ mineralization by microorganisms. While studies on the enzyme
kinetics (Amett, et al. 2000; Barriault, et al. 1998, 1999, 2004; Broadus and Haddock,
1998; Dai, et al. 2002; Furukawa 1982; Haddock, et al. 1993, 1995, 1997; ) and
characterization of PCB-degrading pathways (Asturias and Timmis, 1992; Barriault, et al.
2004; Bedard, et al. 1987; Brenner, et al. 1994; F urukawa 1982; Masai, et al. 1995) are
extensive, predicting the fate of microbiologically mediated PCB destruction in the
environment is hindered by complex environmental variables and limited knowledge of

environmental rates or ecological performance.

Objectives of this study.

The main focus of this research is to gain insight into the ecology of PCB

degradation by analyzing mechanisms of tolerance and co-metabolism of polychlorinated

biphenyls by aerobic biodegradative microorganisms using Burkholderia xenovorans

LB400 as a model organism. To determine the extent of tolerance and breadth of co-

metabolism of PCBS the following objectives were investigated:

Objective 1. Determine the sensitivity or tolerance of potential PCB-degrading

strains to a commercial mixture of PCBS (Aroclor 1242).

Objective 2. Characterize the whole-cell physiological responses to LB400 following

exposure to PCBS.

Objective 3. Analyze gene expression patterns involved in the response of LB400

following exposure to PCBs.

Objective 4. Compare transcriptional profiles of LB400 following growth on

different carbon sources, growth phase and PCB exposure.

Objective 5. Examine the role of C1 compounds in PCB degradation by LB400.

REFERENCES

Abramowicz, D.A., M.J. Brennan, H.M. Van Dort, and F.L. Gallagher. 1993.
Factors inﬂuencing the rate of polychlorinated biphenyl degradation in Hudson
River sediments. Environ. Sci. Technol. 27:1125—1131

Ahmed M., and D.D. F ocht. 1973. Degradation of polychlorinated biphenyls by
two species of Achromobacter. Can J Microbiol. 19:47—52.

Arnett, C. M., J. V. Parales, and J. D. Haddock. 2000. Inﬂuence of chlorine
substituents on rates of oxidation of chlorinated biphenyls by the BPDO of
Burkholderia sp. strain LB400. Appl. Environ. Microbiol. 66:2928-2933.

Asturias, J.A., and K.N. Timmis. 1993. Three different 2,3-dihydroxybiphenyl-
1,2-dioxygenase genes in the gram-positive polychlorobiphenyl-degrading
bacterium Rhodococcus globerulus P6. J Bacteriol. 175:4631-40.

Barriault, D., J. Durand, H. Maaroufi, L.D. Eltis, and M. Sylvestre. 1998.
Degradation of polychlorinated biphenyl metabolites by naphthalene-catabolizing
enzymes. Appl. Environ. Microbiol. 64:4637-4642.

Barriault, D., and M. Sylvestre. 1993. Factors affecting PCB degradation by an
implanted bacterial strain in soil microcosms. Can J. Microbiol. 39:594-602.

Barriault, D., M. Vedadi, J. Powlowski, and M. Sylvestre. 1999. cis-2,3-
Dihydro-2,3-dihydroxybiphenyl dehydrogenase and cis- 1 ,2-dihydro-1 ,2-
dihydroxynaphthalene dehydrogenase catalyze dehydrogenation of the same
range of substrates. Biochem. Biophys. Res. Commun. 260:181-187.

Barriault, D., F. Lepine, M. Mohammadi, S. Milot, N. Leberre, and M.
Sylvestre. 2004. Revisiting the regiospeciﬁcity of Burkholderia xenovorans
LB400 biphenyl dioxygenase toward 2,2’-dichlorobiphenyl and 2,3,2',3'—
tetrachlorobiphenyl. J. Biol. Chem. 279:47489-47496.

Bedard, D. L., and J. F. Quensen, III. 1995. Microbial reductive dechlorination
of polychlorinated biphenyls, p. 127-216. In L. Y. Young, and C. Cemiglia (ed.),
Microbial transformation and degradation of toxic organic chemicals. Wiley-Liss
Division, John Wiley & Sons, Inc., New York, NY.

Bedard, D.L., M.L. Haberl, R.J. May, and M.J. Brennan. 1987. Evidence for
novel mechanisms of polychlorinated biphenyl metabolism in Alcaligenes
eutrophus H850. Appl. Environ. Microbiol. 53:1103—1 1 12.

Bedard, D.L., R. Unterman, L.H. Bopp, M.J. Brennan, M.L. Haberl, and C.
Johnson. 1986. Rapid assay for screening and characterizing microorganisms for

the ability to degrade polychlorinated biphenyls. Appl. Environ. Microbiol.
51:761—768.

Bedard, D.L., RE. Wagner, M.J. Brennan, M.L. Haber], and J.F. Brown Jr.
1987. Extensive degradation of Aroclors and environmentally transformed
polychlorinated biphenyls by Alcaligenes eutrophus H850. Appl. Environ.
Microbiol. 53: 1094—1 102

Bopp L H. Degradation of highly chlorinated PCBS by Pseudomonas strain
LB400. J Ind Microbiol 1986;]:23—29.

Brenner, V., J.J. Arensdorf, and D.D. Focht. 1994. Genetic construction of
PCB degraders. Biodegradation 5:359—3 77

Brevik, K., A. Sweetman, J. Pacyna, and K. Jones. 2002. Towards a global
historical emission inventory for selected PCB congeners—A mass balance
approach. The Science of the Total Environment. 290: 181-198.

Broadus R.M., and JD. Haddock. 1998. Puriﬁcation and characterization of
the NADHzferredoxianH oxidoreductase component of biphenyl 2,3-dioxygenase
from Pseudomonas sp. strain LB400. Arch. Microbiol. 170:106—112.

Butler C.S., and JR. Mason. 1996. Structure-function analysis of the bacterial
aromatic ring hydroxylating dioxygenases Adv. Microb. Physio]. 38:47-84.

Chain, P.S.G., V.J. Denef, K. Konstantinidis, L.M. Vergez, L. Agullo, V.L.
Reyes, L. Hauser, M. Cordova, L. Gomez, M. Gonzalez, M. Land, V. Lao, F.
Larimer, J.J. LiPuma, E. Mahenthiralingam, S.A. Malfatti, C.J. Marx, J.J.
Parnell, A. Ramette, P. Richardson, M. Seeger, D. Smith, T. Spilker, W-J.
Sn], T.V. Tsoi, L.E. Ulrich, LB. Zhulin, J.M. Tiedje. 2006. Burkholderia
xenovorans LB400 harbors a multi-replicon, 9.7 M bp genome shaped for
versatility. Proc. Nat]. Acad. Sci. (Submitted).

Chiou, C.T., 2002, Partition and adsorption of organic contaminants in
environmental systems: New York, John Wiley & Sons

Dai, S., F .H.Vaillancourt, H. Maarouﬁ, N.M. Drouin, D.B. Neau, V.
Snieckus, J.T. Bolin, and L.D. Eltis. 2002. Identiﬁcation and analysis of a
bottleneck in PCB biodegradation. Nat. Struct. Biol. 9:934-939.

Demers, A. P. Ayotte, J. Brisson, S. Dodin, J. Robert, and E. Dewailly. 2002.
Plasma Concentrations of Polychlorinated Biphenyls and the Risk of Breast
Cancer: A Congener-speciﬁc Analysis. Am. J. Epidemiol., 155(7):629 - 635.

Eltis, L. D., B. Hofmann, H. J. Hecht, H. Lunsdorf, and K. N. Timmis. 1993.
Puriﬁcation and crystallization of 2,3-dihydroxybipheny] 1,2-dioxygenase. J.
Biol. Chem. 268:2727-2732.

Furukawa, K. 1982. Microbial degradation of polychlorinated biphenyls
(PCBS). In: Chakrabarty A M. , editor; Chakrabarty A M. , editor. Biodegradation
and detoxiﬁcation of environmental pollutants. Boca Raton, Fla: CRC Press; pp.
33—56.

Furukawa K, and T. Miyazaki. 1986. Cloning of gene cluster encoding
biphenyl and chlorobipheny] degradation in Pseudomonas pseudoalcaligenes. J
Bacteriol 166:392-398.

Gibson, D. T., D. L. Cruden, J. D. Haddock, G. J. Zylstra, and J. M. Brand.
1993. Oxidation of polychlorinated biphenyls by Pseudomonas sp. strain LB400
and Pseudomonas pseudoalcaligenes KF 707. J. Bacteriol. 175:4561-4564.

Grasman K.A., and G.A. Fox. 200]. Associations between altered immune
function and organochlorine contamination in young Caspian terns (Sterna
caspia) from Lake Huron, 1997-1999. Ecotoxicology 10:101-114.

Haddock J.D., and D.T. Gibson. 1995. Puriﬁcation and characterization of the
oxygenase component of biphenyl 2,3-dioxygenase from Pseudomonas sp. strain
LB400. J Bacteriol. 177:5834—5839.

Haddock J.D., J.R. Horton, and D.T. Gibson D.T. 1995. Dihydroxylation and
dechlorination of chlorinated biphenyls by puriﬁed biphenyl 2,3-dioxygenase
from Pseudomonas sp. strain LB400. J Bacteriol. 177:20—26.

Haddock J.D., L.M. Nadim, and D.T. Gibson. 1993. Oxidation of biphenyl by a
multicomponent enzyme system from Pseudomonas sp. strain LB400. J Bacteriol.
175:395—400.

Haddock J.D., D.A. Pelletier, and D.T. Gibson. 1997. Puriﬁcation and
properties of ferredoxianH, a component of biphenyl 2,3-dioxygenase of
Pseudomonas sp. strain LB400. J Ind Microbiol Biotechnol. 19:355—359.

Heaton S.N., S.J. Bursian, J.P. Giesy, D.E. Tillit, J.A. Render, lP.D. Jones,
D.A. Verbrugge, T.J. Kubiak, and R.J. Aulerich. 1995. Dietary exposure of
mink to carp from Saginaw Bay, Michigan. 1. Effects on reproduction and

survival, and the potential risks to wild mink populations. Arch Environ Contam
Toxicol. 28:334—343.

Hernandez B.S., J.J. Arensdorf, and D.D. F ocht. 1995. Catabolic
characteristics of biphenyl-utilizing isolates which cometabolize PCBS.
Biodegradation. 6:75—82.

Hirose, J., A. Suyama, S. Hayashida, and K. Furukawa. 1994. Construction of
hybrid biphenyl (bph) and toluene (tad) genes for functional analysis of aromatic
ring dioxygenase. Gene 138 27—33.

Hooper S.W., C.A. Pettigrew, and GS. Sayler. 1990. Ecological fate, effects
and prospects for the elimination of environmental polychlorinated biphenyls
(PCBS). Environ Toxicol Chem. 9:655—667.

Hrywna, Y., T.V. Tsoi, O.V. Maltseva, J.F. Quensen, III, and J.M. Tiedje.
1999. Construction and Characterization of Two Recombinant Bacteria That
Grow on ortho- and para-Substituted Chlorobiphenyls. Appl. Environ.
Microbiol. 65: 2163-2169.

Kidd, K.A., D.W. Schindler, R.A. Hesslein, and D.C.G. Muir. 1998. Effects of
trophic position and lipid on organochlorine concentrations in ﬁshes from

subarctic lakes in Yukon Territory. Canadian Jouma] of Fisheries and Aquatic
Sciences 55:869-881.

Kimura, N., A. Nishi, M.Goto, and K. Furukawa. 1997. Functional analyses
of a variety of chimeric dioxygenases constructed from two biphenyl

dioxygenases that are similar structurally but different functionally. J. Bacteriol.
179: 3936-3943.

Leitao, M.A.S., K.H.M. Cardozo, E. Pinto, and P. Colepicolo. 2003. PCB-
Induced oxidative stress in the unicellular marine dinoﬂagellate Lingulodinium
polyedrum Arch. Environ. Contam. Toxicol. 45:59-65

Livingstone, D.R., J.K. Chipman, D.M. Lowe, C. Minier, R.K. Pipe . 2000.
Development of biomarkers to detect the effects of organic pollution on aquatic
invertebrates: recent molecular, genotoxic, cellular and immunological studies on

the common mussel (Mytilus edulis L.) and other mytilids. Int]. J. Environ. Poll.
13:56—91.

Masai, E., A. Yamada, J.M. Healy, T. Hatta, K. Kimbara, M. F ukuda, and
K. Yano. 1995. Characterization of biphenyl catabolic genes of gram-positive

polychlorinated biphenyl degrader Rhodococcus sp. strain RHA1.Appl Environ
Microbiol. 61:2079-85.

Massé R, F. Messier, L. Péloquin, C. Ayotte, and M. Sylvestre. 1984.
Microbial biodegradation of 4-chlorobiphenyl, a model compound of chlorinated
biphenyls. Appl Environ Microbiol. 47:947—951.

McFarland, V.A., and J.U. Clarke. 1989. Environmental occurrence,
abundance, and potential toxicity of polychlorinated biphenyl congeners:
considerations for a congener—speciﬁc analysis. Environ. Health Perspect.
81:225—239.

McKay, D. B., M. Seeger, M. Zielinski, B. Hofer, and K. N. Timmis. 1997.
Heterologous expression of biphenyl dioxygenase-encoding genes from a gram-
positive broad-spectrum polychlorinated biphenyl degrader and characterization
of chlorobiphenyl oxidation by the gene products. J. Bacteriol. 179:1924-1930.

10

Mondello, F.J. 1989. Cloning and expression in Escherichia coli of
Pseudomonas strain LB400 genes encoding polychlorinated biphenyl degradation.
J Bacteriol. 171:1725-1732.

Otto, D.M.E., and T.W. Moon. 1996. Phase 1 and II enzymes and antioxidant
responses in different tissues of brown bullheads from relatively polluted and
non-polluted systems. Arch. Environ. Contam. Toxicol. 31:141-147.

Patandin, S., P.C. Dagnelie, P.G.H. Mulder, E. Op de Coul, J.E. van der
Veen, N. Weisglas-Kuperus, and P.J.J. Sauer. 1999. Dietary exposure to
polychlorinated biphenyls and dioxins from infancy until adulthood: A
comparison between breast-feeding, toddler, and long-term exposure. Environ.

Health Persp. 107:45-51.

Pelletier, C., P. Imbeault, and A. Tremblay. 2003. Energy balance and
pollution by organochlorines and polychlorinated biphenyls. Obesity Rev. 4: 17-
24

Schlezinger, J.J., and J.J. Stegeman. 2001. Induction and suppression of
cytochrome P450 1A by 3,3',4,4',5- pentachlorobipheny] and its relationship to
oxidative stress in the marine ﬁsh scup (Stenotomus chrysops). Aquat Toxicol
52:101-115.

Seegal, R,F,. and S. L. Schantz. 1994. Neurochemica] and Behavioral Sequelae
of Exposure to Dioxins and PCBs. In Dioxins and Health, A. Schecter, (ed.),
Plenum Press, New York, pages 409-447.

Seeger, M., K.N. Timmis, and B. Hofer. 1995. Conversion of chlorobiphenyls
into phenylhexadienoates and benzoates by the enzymes of the upper pathway for
polychlorobipheny] degradation encoded by the bph locus of Pseudomonas sp.
strain LB400. Appl Environ Microbiol. 61:2654—2658.

Smithwick, L.A., A. Smith, J.F. Quensen III, A. Stack, L. London, F.J.
Morris. 2003. Inhibition of LPS-induced splenocyte proliferation by ortho-
substituted polychlorinated biphenyl congeners. Toxicology 188:319-333.

Stalker, M.J., G.B. Kirby, T.E. Kocal, I.R. Smith, and M.A.Hayes. 1991. Loss
of glutathione S-transferases in pollution-associated liver neoplasms in white

suckers (Catostomus commersoni) from Lake Ontario. Carcinogenesis 12:2221-
2226.

Swanson, G. M., H. E. Ratcliffe and L. J. Fischer. 1995. Human exposure to

polychlorinated biphenyls (PCBS): A critical assessment of the evidence for
adverse health effects. Regulatory Toxicology and Pharmacology 21: 136-150.

11

Taira, K., J. Hirose, S. Hayashida, and K. Furukawa. 1992. Analysis of bph
operon from the polychlorinated biphenyl-degrading strain of Pseudomonas
pseudoalcaligenes KF 707. J Biol Chem 267 :4844-4853.

van der Meer, J.R., W.M. DeVos, S. Harayama, and A.J.B. Zehnder. 1992.

Molecular mechanisms of genetic adaptation of xenobiotic compounds.
Microbiological Reviews, 56:677-694.

12

CHAPTER 2

LITERATURE REVIEW

Microbial Biodegradation of PCBS.

The slow biodegradation of compounds in the natural environment may be caused
by unfavorable physicochemical conditions (such as temperature, pH, redox potential,
salinity, and oxygen concentration) or may be affected by the availablility of other
nutrients, the accessibility of the substrates (solubility, dissociation from adsorbed
materials), or predation. On the other hand, the low biodegradability may be due to the
inability of microorganisms to effectively metabolize pollutants with uncommon man-
made chemical structures or properties generally termed xenobiotics (van der Meer
1992). However, often the close structural resemblance of these compounds to
nonxenobiotic analogs makes them very suitable for use in studies of metabolic
adaptation. For instance, a general comparison of the major pathways for catabolism of
aromatic compounds in bacteria has revealed that the initial conversion steps are carried
out by different enzymes but that the compounds are transformed to a limited number of
central intermediates such as protocatechuate and (substituted) catechols (van der Meer
1992; Chain et al. 2006). In the case of PCBS, microorganisms have extended their
substrate range by developing peripheral enzymes, which are able to transform initial
substrates into one of the central intermediates (Furukawa 1982; van der Meer 1995),

making the microbial degradation of PCBS a realistic goal.

l3

 

 

 

rm trl

13 15 17 19 21 23 25 27
Gas Chomatograph Retention Time (min)

 

 

 

 

 

ML I

13 15 17 19 21 23 25 27
Gas Chromatograph Retention Time (min)

 

Figure 2.1. Gas chromatograms indicating reductive dechlorination of PCBS by
anaerobic bacteria. Reductive dechorination removes chlorine from highly- chlorinated
congeners resulting in lesser-chlorinated congeners, but does not eliminate PCBS. (from

www.ct.oml.gov/eds/rtg)

14

The scheme with most promise for remediation of PCB mixtures requires a
sequential treatment of anaerobic reductive dechlorination followed by co-metabolism by
aerobic bacteria (Abramowicz 1990). Microorganisms found in anaerobic sediments
have been found to reductively dechlorinate higher chlorinated congeners (Alder, et al.
1993; Bedard, et a]. 1995; Quensen, et a]. 1998, 1990; Rhee eta]. 1993a, 1993b, 1994;
Sokol, et al. 1994; Ye, et a]. 1995) accumulating congeners with fewer chlorines, usually
found on ortho and ortho +para positions (Fish and Principe, 1994; Hrwyna et a]. 1999).
Unfortunately, reductive dechlorination does not reduce the amount of PCBS in
sediments, and eventually reaches a plateau (Kim and Rhee, 1997). Anaerobic bacteria
can reductively dechlorinate highly chlorinated congeners, but cannot complete the
process and accumulate congeners with fewer chlorines (Figure 2.1) (Bedard, et a1. 1995;
Maltseva, et al. 1999; Rodrigues, et a]. 2001).

The burden of PCB degradation (or destruction) lies with aerobic co-metabolism of the
products of reductive dechlorination, by biphenyl- and chlorobenzoate-degrading
organisms (Hrywna, et a1 1999; Maltseva, et a] 1999; Rodrigues, et a]. 2001). Generally,
aerobic PCB-degrading bacteria are only able to attack mono-, di-, tri-, and some
tetrachlorobiphenyls using 2,3-dioxygenase and meta cleavage; the more chlorinated
biphenyls have much lower rates of degradation, hence the importance of reductive
dechlorination. Degradation of mono-, di-, and tri-chlorinated biphenyls is relatively
common (Figure 2.1); only a few strains are capable of degrading PCBs with more than 4

chlorines (Bedard, et a], 1986) (Figure 2.2).

15

BACTERIAL STRAINS

oome
ommI
mwmﬁm
OmmI
Fm<c
meI
mrm
omv:
mNFI
vaxm
mmmI
Nrm
mFI
voeﬁm
mmu
mam
vmﬂa
ram
VQDQ
omeI
NONI
wONI
mmmﬁ_
mQEQ
vome

PCB
Congener

 

2,3

2,4’
2,5,4'
22’
2,3,2',3'
2,5,2”

2,3,2',5'

2,4,5,2',3’
2,5,3',4'

2,3,4,2',5’

4,4'
2,4,4:
2,4,3',4'

2,4,2'.4‘

KEY:

3,4,3',4’

2,5,2’,5'

% Degradation

- 20—39 0 60-79
0 40-59 . 80-100

2,4,5,2’,5’

2,4,5,2’,4',5'

Figure 2.2. PC B-degradative competence of environmental isolates (from Bedard 1986).

16

Through a combination of anaerobic/aerobic phases of degradation, reductive
dechlorination provides lower-chlorinated PCBS that are more susceptible to aerobic
attack and consequent degradation. Recently a sequential anaerobic-aerobic process was
shown in laboratory scale to remove over 50% of Aroclor 1242 from river sediments

(Rodrigues, et a]. 2006).

(Polychlorinated) biphenyl degradation pathway

Aerobic degradation of PCBS occurs via oxidation by pathways normally
responsible for metabolism of aromatic hydrocarbons such as naphthalene (Barriault,
1998; Fortin 2005) and biphenyl (Furukawa 1982; Gibson 1993). However, PCB
degradation via the biphenyl pathway has thus far proven limited due to enzyme
speciﬁcity of dioxygenases and other bph-pathway enzymes—such as hydrolases—and
biotoxicity of PCBs and their metabolic intermediates. The pursuit of a PCB-degrading
pathway has generally been narrowed to the biphenyl pathway because of its higher
activity toward PCBS (Pellizari et al., 1996).

The DNA region encoding biphenyl dioxygenase (BphA), the ﬁrst enzyme in the
biphenyl-polychlorinated biphenyl degradation pathway, has been sequenced and well
characterized (Erickson and Mondello 1992). BphA is a Resike-type, three-component
enzyme, composed of a terminal dioxygenase and an electron transfer chain (Butler and
Mason 1997; Mason and Cammack 1992). The ﬁrst protein of the upper biphenyl

pathway in LB400 is composed of six coding sequences for orf 0, bphA (or bphAl),

17

5b
13

H
/ H / l \ on ‘ coon
BphAEFG \ x-ou \ l« BphC go BphD +
H
l

BphB
cz> c:>,"c::.>o

OH

2 3 4 5a 00°”

Figure 2.3. Biphenyl upper pathway encoded by the bph locus of Burkholderz'a
xenovorans LB400. (Chloro)biphenyl (1) is converted to (chloro)biphenyl-2,3-
dihydrodiol (2) by biphenyl dioxygenase (BphAEFG). (2) is converted to (chloro)2,3-
dihydroxybiphenyl (3) by biphenyl-2,3-dihyddrodiol-2,3-dehydrogenase (BphB). (3) is
converted to (chloro)2-hydroxy-6-oxo-6-phenylhexa-2,4-denoic acid (4) by 2,3-
dihydroxybiphenyl-l ,2-dioxygenase (BphC). (4) is cleaved to form 2-hydroxypenta-2,4-
dienoic acid (5a) and (chloro)benzoic acid (5b) by 2-hydroxy-6-oxo-phenylhexa-2,4-

dienoate hydrolase (BphD).

18

bphE (bphA2), orf 1, bphF (bphA3 ), and bth (bphA4). The bphA and bphE genes
encode encode a large and a small subunit of the terminal dioxygenase associating as an
(13133 heterohexamer (Broadus and Haddock 1988; and Maeda, et al. 2001), bphF encodes
ferredoxin, and bth encodes ferredoxin reductase involved in electron transfer from
NADH to reduce the terminal dioxygenase (Erickson, and Mondello 1992). BphA
introduces molecular oxygen into the biphenyl molecule at the ortho- and meta- position
to yield a 2,3-dihydro-2,3-diol (F urukawa and Miyazaki 1986; Masai, et a1. 1995; Taira,
et al. 1992). Following the introduction of oxygen into biphenyl by BphA, the 2,3-
dihydro-2,3-diol is dehydrogenated to 2,3-dihydroxybiphenyl by dihydrodiol
dehydrogenase (BphB). The second dioxygenase, 2,3-dihydroxybiphenyl dioxygenase
(BphC), does not require any external reductant and cleaves the 2,3- dihydroxylated ring
between carbon atoms 1 and 2 to produce 2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoic
acid (HOPDA, the ring meta-cleavage product)(Eltis 1993), which is then hydrolyzed to
benzoic acid and 2-hydroxypenta-2,4-dienoate by a hydrolase (BphD).

Several studies have demonstrated limitation in the degradation of PCBS as BphA
is a critical determinant in the substrate speciﬁcity for the degradation of PCB congeners
(Barriault, et a1. 2001; Erickson and Mondello 1993; F ortin, et a]. 2005; Kimura, et a].
1997; McKay, et a]. 1997, 2003; Seeger, et a1. 1999; Zielinski, et a]. 2002). The number
of chlorines (Bedard, 1986, 1987a,b) as well as the substitution pattern on biphenyl
(Amett, 2000, Bedard 1990, F urukawa, et a1. 1978) are the prevailing factors that
inﬂuence the substrate speciﬁcity of BphA and consequent degradation of PCBs
(Barriault, et a]. 1993). The genetic difference in the biphenyl dioxygenase from
environmental isolates accounts for much of the variation in their PCB degradation

proﬁles.

19

The signiﬁcance of substrate speciﬁcity of BphA has led to many studies
targeting PCB-degrading strains for identiﬁcation (Bedard 1986, Pellizari, 1997) and
subsequent characterization of congeners degraded. (Bedard 1986, 1987; Bopp 1986). To
date, two different modes of attack have been characterized for the BphA enzyme; a 2,3-
dioxygenase attack on open 2,3 carbons via meta-cleavage, producing benzoate, and a
3,4-dioxygenase attack, forming a cis-dihydrodiol (Bedard, et a]. 1987). The ability of
the biphenyl dioxygenase to attack different positions results in a different degradation
proﬁle; 2,3-dioxygenase can degrade 4,4'-dichlorobiphenyl (para- substituted) via 2,3-
dioxygenation (Masse, et a]; Bedard 1986) and 3,4-dioxygenase allows degradation of
2,5,4'-trichlorobiphenyl and 2,5,2’,5'-tetrachlorobiphenyl (ortho- and meta- substituted)
via 3,4-dioxygenation (Bedard 1986, 1987). Several bacterial strains from the genera,
Pseudomonas, Vibrio, Aeromonas, Micrococcus, Acinetobacter, Bacillus, Rhodococcus
and Streptomyces can degrade mono-, di-, tri-, and some tetrachlorinated PCBS by meta-
cleavage of unchlorinated 2,3-carbons (Bedard, et a] 1986). Some strains, such as
Burkholderia xeovorans LB400 (Bopp 1986), Ralstonia eutropha H850 (Bedard 1986),
and Rhodococcus globerulus P6 (Asturias 1993) are exceptional PCB degraders capable
of degrading up to hexa-chlorinated congeners (Bopp, 1986; Gibson, et a]. 1993;
Mondello, et al. 1997).

Recently the focus improving PCB degradation has turned to expanding the
substrate speciﬁcity of BphA through genetic modiﬁcation. In-depth studies of the
protein structure of BphA and its interaction with substrate congeners have identiﬁed
speciﬁc regions and amino acid residues key to degradation (Barriault 2004; Erickson
1993; Zielinski, 2002, 2003). With this in mind, research has shifted to exploit

differences in the substrate speciﬁcity of different biphenyl dioxygenases via site-directed

20

mutagenesis (Erickson 1993) and directed evolution to create chimeras with improved
PCB-degradation capabilities (Barriault 2001, 2002, 2004; Bruhlman 1999; Chebrou
1999; Furukawa 2004; Kimura 1997; Kumamaru 1998; Meyer 2002; Fuenaga 1999,
2001a,b).

Aside from the limitations of PCB degradation due to substrate speiciﬁcity,
chlorinated metabolites produced on degradation of speciﬁc congeners can be
problematic. The third critical step of PCB degradation involves a 2,3-
dihydroxybiphenyl 1,2-dioxygenase that catalyzes ring cleavage (BphC) (Mondello
1989). Ortho-chlorinated PCB products can strongly inhibit BphC and promote its
suicide inactivation effectively blocking the degradation of other compounds (Dai, et al.
2002; Vaillancourt, et a]. 2002). Additionally, the following step, catalyzed by a serine
hydrolase (BphD) to split the HOPDA molecule, is inhibited by a chlorine substitution on
the dienoate moiety (Seah, et a]. 2000, 2001). Consequently, co-metabolic oxidation of
PCB often yields intermediates that can block the bph pathway and effect toxic stress to
cells (Blasco et al. 1997; Maltseva et a]. 1999; Dai, et a]. 2002; Seah, et al. 2000;
Vaillancourt, et a]. 1998; Vaillancourt, et al. 2002; Hiraoka & Kimbara, 2002; Hiraoka, et
al. 2002). Similar to BphA, genetic modiﬁcation of downstream components of the
biphenyl pathway have been attempted to alleviate toxicity posed by chlorinated
metabolites of PCB degradation (Fortin, et al. 2005a,b).

Despite years of research on PCB degradation pathways, very little is known
about the whole-cell physiology or genetic expression involved in PCB degradation,
including stress responses induced by PCBS or their intermediates. Two of the most
effective aerobic PCB degrading bacteria, Burkholderia xenovorans strain LB400 and

Rhodococcus sp. RHA] , vary greatly in their PCB toxicity resistance (Seto, et a]. 1996),

2]

yet the sources of this difference are unknown. Indeed recent studies of PCB-tolerant
LB400 (Denef, et al. 2004, 2005a, 2005b) suggest that cell systems other than the

biphenyl pathway contribute to efﬁcient degradation of biphenyl and of PCBS.

Biotoxicity of PCBS

Due to the lipophilic properties of PCBS, they tend to partition into the lipids of
organisms, including biodegrading bacteria (Figure 2.4) (Chiou, 2002; Ramos, et a].
1997, 2002, 2004; Sikkemma, et a]. 1995). The afﬁnity of compounds such as PCBS with
a high log K0,, value to membrane lipids causes them to accumulate in the lipid bilayer of
bacteria altering ﬂuidity and disrupting membrane function (Ramos, et a]. 1997; Sikkema
et a]. 1995). Several studies have suggested that this membrane associated stress
involved with PCBS can disrupt cellular functions including oxidative phosphorylation
(Donato, et al. 1997; Kim, et a] 2001; Sikkema, et a]. 1995, Ramos, et al. 1997, 2004).
The effects of membrane stress by PCBS could greatly inﬂuence the physiology and gene
expression patterns of bacteria. Tolerance to aromatic hydrocarbons often results from
different strategies employed by microorganisms including: (i) degradation of toxic
compounds to benign materials; (ii) change in the composition of the membrane to
prevent intrusion of toxic compounds; (iii) alteration of the extracellular surface
characteristics to decrease cell permeability; (iv) active efﬂux of the toxic compound; and

(v) removal of toxic compounds via vesicle formation (Ramos, et a]. 2004).

An increase in the saturated fatty acid content is a well-documented response to
environmental stresses (Hamamoto, et al. 1994; Loffeld, et a]. 1996) and has been

observed in E. coli in the presence of long-chain alcohols and aromatic compounds

22

(Ingram 1977). In adition, a rigidity in the cell membrane is often accomplished by rapid
transformation of the fatty acid cis-9,10-methylene hexadecanoic acid
(C17zcyclopropane) to unsaturated 9-cis-hexadecenoic acid (C16:1,9 cis) and subsequent
transformation to the trans isomer (Ramos, et a]. 2002). Kim, et a] (2001) measured the
effects of both a PCB congener (2,2’,5,5’-tetrachlorobiphenyl) and biphenyl on the
cytoplasmic membrane of Ralstonia eutropha H850 using ﬂuorescence polarization.
They suggest that the fatty acid proﬁle shifts from unsaturated to saturated fatty acids on
exposure to biphenyl and that the membrane modiﬁcation during growth on biphenyl
involves less of a ﬂuidizing effect of PCBS on the membrane in those cells (Kim, et a].
2001). While the effect of membrane stress from compounds with properties similar to
PCBs such as biphenyl (Kim, et a]. 2001), chlorobenzoate (Sikkema, et al. 1995), and
DDT (Donato, et a1. 1997) have been investigated, there has yet been no direct analysis of
the effects of PCBS themselves on membrane composition or adaptations in actively

degrading cells.

Aside from the potential (local) toxicity of LB400 to PCB-degrading enzymes
mentioned previously (Dai, et al. 2002; Seah, et a1. 2000; Vaillancourt, et al. 1998, 2002)
are global effects of potential intermediates of the biphenyl pathway. Blasco, et al (1997)
found a toxic response to microorganisms growing with 4-chlorobiphenyl as a result of
incomplete metabolism and accumulation of protoanemonin shown to be a toxic to
microbes. Sondossi, et a1 (1992) also indicated the inhibition of PCB degradation due to
the accumulation of dead-end chlorobenzoate metabolites, speciﬁcally 3-chlorobenzoate.
In addition 2- and 4-chlorobenzoate inhibits the growth rate and induces global stress-

response genes (Seeger, ND). Dihydrodiols and dihydroxybiphenyls are very toxic

23

metabolites that can accumulate and diminish cell viability. Camara et a] (2004)
demonstrated that the dihydrodiol or dihydroxybiphenyl derived from transformed 2-
chlorobipheny] damages the cell causing lysis. They also observed reduced viability
from exposure to 2,3-dihydroxybiphenyl (Camara, et al. 2004). Similarly, Hiraoka et al
(2002) found that the accumulation of 2- and 3- hydroxybiphenyl, produced through
blocking bphB, inhibit bacterial cell separation during late-log growth. Additionally,
hydroxylated metabolites like catechols formed within cells have shown toxic effects
(Schweigert, et a]. 2001). Finally, degradation of chlorinated compounds often produces
a degradation-dependent stress caused by chlorinated aliphatic compounds which results
in the reduction of cellular growth, viability, and respiratory activity (Alvarez-Cohen and
McCarty 1991; Ensign, et a]. 1992; Park, et al. 2002; Rasche, et a]. 1991; van lHylckama
Vlieg, et a]. 1997; Yeager, et al. 2001). The build up of metabolic intermediates in vivo

would resemble physiological conditions of bacteria in a bioremediation process.

Although some of the genes in the lower biphenyl pathway have shown
degradative capability and in some cases dechlorinate the products of the upper biphenyl
pathway (Hofer, eta]. 1994; Kikuchi, et a]. 1994), namely benzoic acid and
pentadienoate, there is limited information regarding the downstream pathways
responsible for degradation of chlorinated constituents from PCB degradation, while
proven to be important (Seah, et a]. 2000, 2001). In order to investigate the degradation
intermediate-mediated toxicity, it is important to distinguish the effects membrane stress

imposed by the accumulation of PCBs from co-metabolism.

24

1 0000

 

E 1000
a)
C
‘3
E
a, 100
2
"E
.9
.9
g 10
O
o
C
.9
E 1
(U
0.
0.1

 

 

1 10 100 1000 10000
Partition Coefficient OctanollWater

Figure 2.4. Correlation of the partition coefﬁcient of hydrophobic compounds with their

ability to partition into the cellular membrane (modiﬁed from Sikkema, et al. 1995).

25

Burkholderia xenovorans LB400

Thirty years ago Burkholderia xenovorans LB400 (Figure 2.5) was isolated from a PCB
contaminated landﬁll in New York state (Bopp 1986; Goris, et a1. 2004) and has since
emerged as a model organism for aerobic degradation of PCBS. The success of LB400 as
a PCB degrading microorganisms originate from the extremely wide range of congeners
oxidized as well as its ability to grow on orth0+meta-congeners (Bopp 1986; Gibson, et
a]. 1993; Maltseva et al. 1999; Mondello et al. 1997).

Complete sequencing of the polychromosomal genome of the outstanding PCB
dechlorinating and degrading Burkholderia xenovorans strain LB400
(http://genome.oml.gov/microbial/bfun), and development of full-genome DNA
microchips in collaboration with Xeotron (Invitrogen) XeochipTM allow
genomics-enabled investigation of the biology of chlorinated PAH degradation. The ~9.7
Mbp genome of LB400 contains 8989 predicted open reading frames (ORFs) in two
chromosomes and one megaplasmid, and is the largest prokaryotic genome closed to date
(Figure 2.6). The size of the LB400 genome, along with high catabolic versatility (Chain,
et a] 2006), makes this an ideal model for biodegradation studies.

Using genomic and proteomic techniques, Denef et al. (2005a, 2005b, 2006)
investigated substrate- and phase- dependent expression of pathways involved in the
degradation of PCBs in LB400. They found that genes directly involved in biphenyl
degradation were up-regulated when grown on biphenyl in comparison to succinate-
grown cells. In addition, three functional benzoate-catabolizing pathways: a catechol
ortho-cleavage (ben-cat) pathway and two benzoyl~CoA pathways, were identiﬁed and

shown to be dependent on growth substrate and growth phase. Subsequent deletion of

26

 

Figure 2.5. Electron micrograph of Burkholderia xenovorans LB400 grown on 1 g/L of

succinate in K] mineral medium.

27

 

                        

 

...... {Eff . E... .
5.3.. L: .2...

19.3.3}... . a. as? ...

., is
. .ﬁéé...

   

1’"
I'

11'

i

    

ll

    

\

In

'1
j, iff‘lifl
,i

1
l
l

           
                 

  
      

”I!' '1...
5r,
.

\
.~‘\

   

1\
,9

0

\ ‘.
,_ x, .

‘x

l
l
. I

I’ll/I ‘

' |
’ ."l‘" I"!
I]. l

. k \.\....\\M\~. {xv \ _ wémakziw

.. \ sows-m... C.,...“ a. .2»... :5. .2 .- a.
. ... .... x: . . #9.“. r,

. . mti¢fsﬁni M 3. L». f

. a
__ 5.3%. 4.

 

     

Figure 2.6. Genome of LB400 (from Chain, et a1. 2006)

28

the ben-cat pathway demonstrated that the redundancy of the benzoate-degradation
pathway does not directly contribute to PCB-degrading ability. Finally, they link the
induction of the benzoyl~CoA pathway to reduced oxygen concentrations. Work on the
gene expression of pathways involved in the degradation of biphenyl (and benzoate) sets

the conceptual stage to study the effects of PCB degradation on LB400.

Microarray technology

Recent advances in high throughput genomic technologies have signiﬁcantly
expanded my abilities to explore transcriptional changes on a genomewide scale in
response to natural or artiﬁcial stresses stimulus (Schena, et al. 1995, 1996; Lander,
1999; Lockhart, et a1 .1996; Fodor, et al. 1991; DeRisi, et al. 1997). After the completion
of the genome sequence, predicted gene-coding sequences can be analyzed for the
relative changes in mRN A of thousands of genes simultaneously (referred to as genome
expression pattern) to environmental changes. The potential for this technology clearly
extends to the degradation of xenobiotic compounds during bioremediation (Beliaev, et
al. 2002; Denef, et al. 2004, 2005, 2006). To date, over a thousand studies have reported
the expression patterns of dozens of whole genomes of various microorganisms
(Wodicka, et a1. 1997; Cho, et a]. 1998; Hecker and Engelmann 2000; Hinchliffe, et a].
2003)

Each genome microarray is capable of producing thousands to tens of thousands
of data points describing the transcriptional expression patterns due to variations in
environmental conditions. The current challenge is to extract biologically relevant
information from an abundance of gene expression data. Cluster analysis is commonly

used since genes that have similar expression proﬁles over various conditions or

29

experiments group together reducing the complexity of data and indicating prominent
patterns in the data (Autio, et a]. 2003; Eisen, et al. 1998; Laws, et al. 2003; Sherlock
2000; Xia and Xie 2001; Zhao, eta]. 2001). One of the most widely-used clustering
techniques is the agglomerative, or bottom-up approach whereby single expression
proﬁles are joined to form nodes, which are successively joined until all individual
proﬁles and nodes have been joined to form a single hierarchical tree (Eisen, et al. 1998;
Sherlock 2000). The advantage of this approach is that it is simple, and the end result can
be easily visualized, from which coordinately regulated patterns can be relatively easily

discerned by eye (Sherlock 2000).

Summary

The biodegradation of PCBS by aerobic bacteria is the keystone to in situ
microbial remediation. To this point, the biphenyl pathway, responsible for the
degradation of PCBS, has been extensively studied. However, a fundamental factor in
successful PCB degradation, the tolerance and global changes involved, have been
underrepresented. In order to achieve the highest leves of degradation possible, the
biodegrading bacteria must be able to cope with conditions involved in PCB degradation
including the effect of PCBS themselves on bacteria as well as the escalation of
deleterious metabolites during degradation. By using the groundwork previously
established by Chain, et a1. (2006) and Denef, et a]. (2004, 2005a, 2005b, 2006) involving
sequencing of Burkholderia xenovorans LB400 genome and initial microarray
optimization, I analyze the expression patterns involved in PCB degradation in

conjunction with physiological changes.

30

REFERENCES

Abramowicz, D. A. 1990. Aerobic and anaerobic biodegradation of PCBs: a
review. Crit. Rev. Biotechnol. 10:241-248.

Abramowicz, D.A., M.J. Brennan, H.M. Van Dort, and F .L. Gallagher. 1993.
Factors inﬂuencing the rate of polychlorinated biphenyl degradation in Hudson
River sediments. Environ. Sci. Technol. 27 :1 125—1 131

Agullo, L., B. Camara, M. Hernandez, V. Latorre, and M. Seeger. 2006.
Response to (chloro)biphenyls of the polychlorobiphenyl-degrader Burkholderia
xenovorans LB400 involves stress proteins also induced by heat shock and
oxidative stress. FEMS Microbiol. Lett. Epub 2006 Dec. 8.

Ahmed M., and D.D. Focht. 1973. Degradation of polychlorinated biphenyls by
two species of Achromobacter. Can J Microbiol. 19:47—52.

Alder A.C., M.M. Haggblom, S.R. Oppenheimer, and L.Y. Young. 1993.
Reductive dechlorination of polychlorinated biphenyls in anaerobic sediments.
Envrion. Sci. and Techno]. 27:530-538

Alvarez-Cohen, L., and P. L. McCarty. 1991. Effects of toxicity, aeration, and
reductant supply on trichloroethylene transformation by a mixed methanotrophic
culture. Appl. Environ. Microbiol. 57:228-235.

Arnett, C. M., J. V. Parales, and J. D. Haddock. 2000. Inﬂuence of chlorine
substituents on rates of oxidation of chlorinated biphenyls by the BPDO of
Burkholderia sp. strain LB400. Appl. Environ. Microbiol. 66:2928-2933.

Asturias, J.A., and K.N. T immis. 1993. Three different 2,3-dihydroxybiphenyl-
1,2-dioxygenase genes in the gram-positive polychlorobiphenyl-degrading
bacterium Rhodococcus globerulus P6. J Bacteriol. 175:4631-40.

Barriault, D., J. Durand, H. Maaroufi, L.D. Eltis, and M. Sylvestre. 1998.
Degradation of polychlorinated biphenyl metabolites by naphthalene-catabolizing
enzymes. Appl. Environ. Microbiol. 64:4637-4642.

Barriault, D., M-M. Plante, and M. Sylvestre. 2002. Family shufﬂing of a
targeted bphA region to engineer biphenyl dioxygenase. J Bacteriol. 184:3794-
3800

Barriault, D., and M. Sylvestre. 1993. Factors affecting PCB degradation by an
implanted bacterial strain in soil microcosms. Can J. Microbiol. 39:594-602.

Barriault, D., C. Simard, H. Chatel, and, M. Sylvestre. 2001. Characterization
of hybrid biphenyl dioxygenases obtained by recombining Burkholderia sp. strain

31

LB400 bphA with the homologous gene of Comamonas testosteroni strain B-356.
Can. J. Microbiol. 47:1025-1032.

Barriault, D., M. Vedadi, J. Powlowski, and M. Sylvestre. 1999. cis-2,3-
Dihydro-2,3-dihydroxybiphenyl dehydrogenase and cis-1,2-dihydro-1,2-
dihydroxynaphthalene dehydrogenase catalyze dehydrogenation of the same
range of substrates. Biochem. Biophys. Res. Commun. 260:181-187.

Barriault, D., F. Lepine, M. Mohammadi, S. Milot, N. Leberre, and M.
Sylvestre. 2004. Revisiting the regiospeciﬁcity of Burkholderia xenovorans
LB400 biphenyl dioxygenase toward 2,2'-dichlorobiphenyl and 2,3,2',3'-
tetrachlorobiphenyl. J. Biol. Chem. 279:47489-47496.

Barriault, D., and M. Sylvestre. 2004. Evolution of the biphenyl dioxygenase
BphA from Burkholderia xenovorans LB400 by random mutagenesis of multiple
sites in region 111. J. Biol. Chem. 279:47480-47488.

Beckering, C.L., L. Stei], M.H.W. Weber, U. Vr’ilker, and M.A. Marahie].
2002. Genomewide Transcriptional Analysis of the Cold Shock Response in
Bacillus subtilis. J Bacteriol. 184:6395—6402.

Bedard, D. L., and J. F. Quensen, III. 1995. Microbial reductive dechlorination
of polychlorinated biphenyls, p. 127-216. In L. Y. Young, and C. Cemiglia (ed.),
Microbial transformation and degradation of toxic organic chemicals. Wiley-Liss
Division, John Wiley & Sons, Inc., New York, NY.

Bedard, D.L., and M.L. Haber]. 1990. Inﬂuence of chlorine substitution pattern

on the degradation of polychlorinated biphenyls by eight bacterial strains. Microb.
Ecol. 20:87—102.

Bedard, D.L., M.L. Haberl, R.J. May, and M.J. Brennan. 1987. Evidence for
novel mechanisms of polychlorinated biphenyl metabolism in Alcaligenes
eutrophus H850. Appl. Environ. Microbiol. 53:1103—11 12.

Bedard, D.L., R. Unterman, L.H. Bopp, M.J. Brennan, M.L. Haber], and C.
Johnson. 1986. Rapid assay for screening and characterizing microorganisms for

the ability to degrade polychlorinated biphenyls. Appl. Environ. Microbiol.
51:761—768.

Bedard, D.L., RE. Wagner, M.J. Brennan, M.L. Haber], and J.F. Brown Jr.
1987. Extensive degradation of Aroclors and environmentally transformed

polychlorinated biphenyls by Alcaligenes eutrophus H850. Appl. Environ.
Microbiol. 53: 1094—1 102

Blasco, R., M. Mallavarapu, R-M. Wittich, K.N. Timmis, and DH. Pieper.
1997. Evidence that formation of protoanemonin from metabolites of 4-

32

chlorobiphenyl degradation negatively affects the survival of 4-chlorobiphenyl-
cometabolizing microorganisms. Appl. Environ. Microbio. 63:427-434.

Bopp L H. Degradation of highly chlorinated PCBS by Pseudomonas strain
LB400. J Ind Microbio] 1986;]:23—29.

Brenner, V., J.J. Arensdorf, and D.D. Focht. 1994. Genetic construction of
PCB degraders. Biodegradation 5:359—377

Brevik, K., A. Sweetman, J. Pacyna, and K. Jones. 2002. Towards a global
historical emission inventory for selected PCB congeners—A mass balance
approach. The Science of the Total Environment. 290:181-198.

Broadus R.M., and JD. Haddock. 1998. Puriﬁcation and characterization of
the NADHzferredoxianH oxidoreductase component of biphenyl 2,3-dioxygenase
from Pseudomonas sp. strain LB400. Arch. Microbiol. 170:106—112.

Brown, J.F. Jr, D.L. Bedard, M.J. Brennan, J.C. Carnahan, H. Feng, and
R.E.Wagner. 1987. Polychlorinated biphenyl dechlorination in aquatic
sediments. Science 236:709—7 1 2

Brown, J.F. Jr, RE. Wagner, H. Feng, D.L. Bedard, M.J. Brennan, J.C.
Carnahan, and R.J. May. 1987. Environmental dechlorination of PCBS.
Environ. Toxicol. Chem. 5:579—593

Briihlmann, F., and W. Chen. 1999. Tuning biphenyl dioxygenase for extended
substrate speciﬁcity. Biotechnol. Bioeng. 63:544-551.

Butler C.S., and J.R. Mason. 1996. Structure-function analysis of the bacterial
aromatic ring hydroxylating dioxygenases Adv. Microb. Physio]. 38:47-84.

Camara, B., C. Herrera, M. Gonzalez, E. Couve, B. Hofer, and M. Seeger.
2004. From PCBS to highly toxic metabolites by the biphenyl pathway. Environ.
Microb. 62842-850.

Chain, P.S.G., V.J. Denef, K. Konstantinidis, L.M. Vergez, L. Agullo, V.L.
Reyes, L. Hauser, M. Cordova, L. Gomez, M. Gonzalez, M. Land, V. Lao, F.
Larimer, J.J. LiPuma, E. Mahenthiralingam, S.A. Malfatti, C.J. Marx, J.J.
Parnell, A. Ramette, P. Richardson, M. Seeger, D. Smith, T. Spilker, W-J.
Su], T.V. Tsoi, L.E. Ulrich, I.B. Zhulin, J.M. Tiedje. 2006. Burkholderia
xenovorans LB400 harbors a multi-replicon, 9.7 M bp genome shaped for
versatility. Proc. Natl. Acad. Sci. (Submitted).

Chebrou, H., Y. Hurtubise, D. Barriault, and M. Sylvestre. 1999.
Heterologous expression and characterization of the puriﬁed oxygenase

component of Rhodococcus globerulus P6 biphenyl dioxygenase and of chimeras
derived from it. J. Bacteriol. 181:4805-4811.

33

Chiou, C.T., 2002, Partition and adsorption of organic contaminants in
environmental systems: New York, John Wiley & Sons

Dai, S., F.H.Vaillancourt, H. Maaroufi, N.M. Drouin, D.B. Neau, V.
Snieckus, J.T. Bolin, and L.D. Eltis. 2002. Identiﬁcation and analysis of a
bottleneck in PCB biodegradation. Nat. Struct. Biol. 9:934-939.

Demers, A. P. Ayotte, J. Brisson, S. Dodin, J. Robert, and E. Dewailly. 2002.
Plasma Concentrations of Polychlorinated Biphenyls and the Risk of Breast
Cancer: A Congener-speciﬁc Analysis. Am. J. Epidemiol., 155(7):629 - 635.

Denef, V.J., J. Park, J.L. Rodrigues, T.V. Tsoi, S.A. Hashsham and J.M.
Tiedje. 2003. Validation of a more sensitive method for using spotted
oligonucleotide DNA microarrays for functional genomics studies on bacterial
communities. Environ. Microbiol. 5(10):933—43.

Denef, V.J., J. Park, T.V. Tsoi, J.-M. Rouillard, H. Zhang, J.A.
Wibbenmeyer, W. Verstraete, E. Gulari, S.A. Hashsham, and J.M. Tiedje.
2004. Biphenyl and benzoate metabolism in a genomic context: Outlining

genome-wide metabolic networks in Burkholderia xenovorans LB400. Appl.
Environ. Microbiol. 70:4961-4970.

Denef, V.J. M.A. Patrauchan, C. Florizone, J. Park, T.V. Tsoi, W. Verstraete,
J.M.Tiedje, and L.D. Eltis. 2005. Growth substrate- and phase-speciﬁc
expression of biphenyl, benzoate, and C1 metabolic pathways in Burkholderia
xenovorans LB400. J. Bacteriol. 187:7996-8005.

Denef, V.J. J.A. Klappenbach, M.A. Patrauchan, C. Florizone, J.L.M.
Rodrigues, T.V. Tsoi, W. Verstraete, L.D. Eltis, and J.M. Tiedje. 2006.
Genetic and genomic insights into the role of benzoate-catabolic pathway
redundancy in Burkholderia xenovorans LB400. Appl. Environ. Microbiol. 72:
585-595.

DeRisi J.L., V.R. Iyer, and P.O. Brown. 1997 Exploring the metabolic and
genetic control of gene expression on a genomic scale. Science. 278:680—686.

Donato MM, Jurado AS, Antunes-Madeira MC, Madeira VM. 1997.
Comparative study of the toxic actions of 2,2-bis(p-chlorophenyl)-l,1,1-
trichloroethane and 2,2-bis(p-chlorophenyl)-1,1-dichloroethylene on the growth

and respiratory activity of a microorganism used as a model. Appl. Environ.
Microbiol. 63:4948-51 .

Eltis, L. D., B. Hofmann, H. J. Hecht, H. Lunsdorf, and K. N. Timmis. 1993.

Puriﬁcation and crystallization of 2,3-dihydroxybiphenyl 1,2-dioxygenase. J.
Biol. Chem. 268:2727-2732.

34

Ensign, S. A., M. R. Hyman, and D. J. Arp. 1992. Cometabolic degradation of
chlorinated alkenes by alkene monooxygenase in a propylene-grown
Xanthobacter strain. Appl. Environ. Microbiol. 58:3038-3046.

Erickson, B. D., and F. J. Mondello. 1993. Enhanced biodegradation of
polychlorinated biphenyls after site-directed mutagenesis of a biphenyl
dioxygenase gene. Appl. Environ. Microbiol. 59:3858-3862.

Fish, K.M., and J.M. Principe. 1994. Biotransformations of Aroclor 1242 in
Hudson River test tube microcosms. Appl. Environ. Microbiol. 60:4289-4296

Fodor, S.P.A., J.L. Read, M.C. Pirrung, L. Stryer, A.T. Lu, and D. Solas.
1991. Light-directed, spatially addressable parallel chemical synthesis. Science.
251:767—773.

Fortin, P.D., I. MacPherson, D.B. Neau, J.T. Bolin, and L.D. Eltis. 2005.
Directed evolution of a ring-cleaving dioxygenase for polychlorinated biphenyl
degradation. J. Biol. Chem. 280:42307-42314

Fortin, P.D., A.T.-F. Lo, M-A Haro, S. R. Kaschabek, W. Reineke, and L.D.
Eltis. 2005. Evolutionarily divergent extradiol dioxygenases possess higher
speciﬁcities for polychlorinated biphenyl metabolites. J. Bacteriol. 187:415-421.

Furukawa, K., H. Suenaga, and M. Goto. 2004. Biphenyl dioxygenases:
functional versatilities and directed evolution. J. Bacteriol. 186:5189-5196.

Furukawa, K. 1982. Microbial degradation of polychlorinated biphenyls
(PCBs). In: Chakrabarty A M. , editor; Chakrabarty A M. , editor. Biodegradation
and detoxiﬁcation of environmental pollutants. Boca Raton, Fla: CRC Press; pp.
33—56.

Furukawa K., K. Tonomura, and A. Kamibayashi. 1978. Effect of chlorine
substitution on the biodegradability of polychlorinated biphenyls. Appl Environ
Microbiol. 35:223—227.

Furukawa K., and T. Miyazaki. 1986. Cloning of gene cluster encoding
biphenyl and chlorobiphenyl degradation in Pseudomonas pseudoalcaligenes. J
Bacteriol 166:392-398.

Furukawa, K., and A.M. Chakrabarty. 1982. Involvement of plasmids in total
degradation of chlorinated biphenyls. Appl. Environ. Microbiol. 44:619-626

Gibson, D. T., D. L. Cruden, J. D. Haddock, G. J. Zylstra, and J. M. Brand.

1993. Oxidation of polychlorinated biphenyls by Pseudomonas sp. strain LB400
and Pseudomonas pseudoalcaligenes KF707. J. Bacteriol. 175:4561-4564.

35

Grasman K.A., and G.A. Fox. 200]. Associations between altered immune
function and organochlorine contamination in young Caspian terns (Sterna
caspia) from Lake Huron, 1997-1999. Ecotoxicology 10:101-114.

Haddock J.D., and D.T. Gibson. 1995. Puriﬁcation and characterization of the
oxygenase component of biphenyl 2,3-dioxygenase from Pseudomonas sp. strain
LB400. J Bacteriol. 177:5834—5839.

Haddock J.D., J.R. Horton, and D.T. Gibson D.T. 1995. Dihydroxylation and
dechlorination of chlorinated biphenyls by puriﬁed biphenyl 2,3-dioxygenase
from Pseudomonas sp. strain LB400. J Bacteriol. 177 :20—26.

Haddock J.D., L.M. Nadim, and D.T. Gibson. 1993. Oxidation of biphenyl by a
multicomponent enzyme system from Pseudomonas sp. strain LB400. J Bacteriol.
175:395—400.

Haddock J.D., D.A. Pelletier, and D.T. Gibson. 1997. Puriﬁcation and
properties of ferredoxianH, a component of biphenyl 2,3-dioxygenase of
Pseudomonas sp. strain LB400. J Ind Microbiol Biotechnol. 19:355—359.

Hamamoto, T., N. Takata, T. Kudo, and K. Horikoshi K. 1994. Effect of
temperature and growth phase on fatty acid composition of the psychrophilic
Vibrio sp. strain no. 5710. FEMS Microbiol. Lett. 119:77— 81.

Heaton S.N., S.J. Bursian, J.P. Giesy, D.E. Tillit, J.A. Render, P.D. Jones,
D.A. Verbrugge, T.J. Kubiak, and R.J. Aulerich. 1995. Dietary exposure of
mink to carp from Saginaw Bay, Michigan. 1. Effects on reproduction and

survival, and the potential risks to wild mink populations. Arch Environ Contam
Toxicol. 28:334—343.

Hernandez B.S., J.J. Arensdorf, and D.D. Focht. 1995. Catabolic
characteristics of biphenyl-utilizing isolates which cometabolize PCBS.
Biodegradation. 6:75—82.

Hiraoka, Y., Yamada, T., Tone, K., F utaesaku, Y., and Kimbara, K. 2002.
Flow cytometry analysis of changes in the DNA content of the polychlorinated
biphenyl degrader Comamonas testosteroni TK102: Effect of metabolites on cell-
cell separation. Appl Environ Microbiol 68: 5104-5112.

Hirose, J., A. Suyama, S. Hayashida, and K. Furukawa. 1994. Construction of
hybrid biphenyl (bph) and toluene (tad) genes for functional analysis of aromatic
ring dioxygenase. Gene 138 27-33.

Hofer, B., S. Backhaus, and K. N. Timmis. 1994. The biphenyl/polychlorinated

biphenyl-degradation locus (bph) of Pseudomonas sp. LB400 encodes four
additional metabolic enzymes. Gene 144:9-16.

36

Hooper S.W., C.A. Pettigrew, and GS. Sayler. 1990. Ecological fate, effects
and prospects for the elimination of environmental polychlorinated biphenyls
(PCBS). Environ Toxicol Chem. 9:655—667.

Hrywna, Y., T.V. Tsoi, O.V. Maltseva, J.F. Quensen, III, and J.M. Tiedje.
1999. Construction and Characterization of Two Recombinant Bacteria That

Grow on ortho- and para-Substituted Chlorobiphenyls. Appl. Environ.
Microbiol. 65: 2163-2169.

Ingram, L.O. 1977. Changes in lipid composition of Escherichia coli resulting
from growth with organic solvents and with food additives. Appl. Environ.
Microbiol. 33:1233— 36.

Kidd, K.A., D.W. Schindler, R.A. Hesslein, and D.C.G. Muir. 1998. Effects of
trophic position and lipid on organochlorine concentrations in ﬁshes from

subarctic lakes in Yukon Territory. Canadian Journal of Fisheries and Aquatic
Sciences 55:869-881.

Kimura, N., A. Nishi, M.Goto, and K. Furukawa. 1997. Functional analyses
of a variety of chimeric dioxygenases constructed from two biphenyl

dioxygenases that are similar structurally but different functionally. J. Bacteriol.
179: 3936-3943.

Kim, J., and G. Rhee. 1997 Population Dynamics of Polychlorinated Biphenyl-
Dechlorinating Microorganisms in Contaminated Sediments. Appl. Environ.
Microbiol. 63: 1771-1776.

Kikuchi, Y., Y. Yasukoshi, Y. Nagata, M. F ukuda, and M. Takagi. 1994.
Nucleotide sequence and functional analysis of the meta-cleavage pathway

involved in biphenyl and polychlorinated biphenyl degradation in Psudomonas sp.
strain KKSIOZ. J. Bacteriol. 176:4269-4276.

Kitagawa, W., K. Miyauchi, E. Masai, and M. Fukuda. 2001. Cloning and
Characterization of Benzoate Catabolic Genes in the Gram-Positive

Polychlorinated Biphenyl Degrader Rhodococcus sp. Strain RHAl. J. Bacteriol.
183: 6598-6606.

Kumamaru, T., H. Suenaga, M. Mitsuoka, T. Watanabe, and K. Furukawa.
1998. Enhanced degradation of polychlorinated biphenyls by directed evolution of
biphenyl dioxygenase. Nat. Biotechnol. 16:663-666.

Lander, ES. 1999. Array of hope. Nat. Genet. Suppl. 2123—4.

Leitao, M.A.S., K.H.M. Cardozo, E. Pinto, and P. Colepicolo. 2003. PCB-

Induced oxidative stress in the unicellular marine dinoﬂagellate Lingulodinium
polyedrum Arch. Environ. Contam. Toxicol. 45:59-65

37

Livingstone, D.R., J.K. Chipman, D.M. Lowe, C. Minier, R.K. Pipe . 2000.
Development of biomarkers to detect the effects of organic pollution on aquatic
invertebrates: recent molecular, genotoxic, cellular and immunological studies on
the common mussel (Mytilus edulis L.) and other mytilids. Int]. J. Environ. Poll.
13:56-91.

Loffeld, B., and H. Keweloh. 1996. Cis/trans isomerization of unsaturated fatty
acids as possible control mechanism of membrane ﬂuidity in Pseudomonas putida
P8. Lipids 31:811— 15

Maltseva, O.V., T.V. Tsoi, J.F. Quensen III, M. Fukuda, and J.M. Tiedje.
1999. Degradation of anaerobic reductive dechlorination products of Aroclor
1242 by four aerobic bacteria. Biodegradation. 10:363-371.

Masai, E., A. Yamada, J.M. Healy, T. Hatta, K. Kimbara, M. Fukuda, and
K. Yano. 1995. Characterization of biphenyl catabolic genes of gram-positive
polychlorinated biphenyl degrader Rhodococcus sp. strain RHA1.Appl Environ
Microbiol. 61:2079-85.

Massé R, F. Messier, L. Péloquin, C. Ayotte, and] M. Sylvestre. 1984.
Microbial biodegradation of 4-chlorobiphenyl, a model compound of chlorinated
biphenyls. Appl Environ Microbiol. 47:947—951.

McFarland, V.A., and J.U. Clarke. 1989. Environmental occurrence,
abundance, and potential toxicity of polychlorinated biphenyl congeners:

considerations for a congener-speciﬁc analysis. Environ. Health Perspect.
81:225—239.

McKay, D. B., M. Seeger, M. Zielinski, B. Hofer, and K. N. Timmis. 1997.
Heterologous expression of biphenyl dioxygenase-encoding genes from a gram-
positive broad-spectrum polychlorinated biphenyl degrader and characterization
of chlorobiphenyl oxidation by the gene products. J. Bacteriol. 179: 1924-1930.

Meyer, A., A. Schmid, M. Held, A. H. Westphal, M. Rothlisberger, H. P. E.
Kohler, W. J. H. van Berke], and B. Witholt. 2002. Changing the substrate
reactivity of 2-hydroxybiphenyl 3-monooxygenase from Pseudomonas azelaica
HBPl by directed evolution. J. Biol. Chem. 277:5575-5582.

Mondello, F.J. 1989. Cloning and expression in Escherichia coli of
Pseudomonas strain LB400 genes encoding polychlorinated biphenyl degradation.
J Bacteriol. 171:1725-1732.

Mondello, F.J., M.P. Turcich, J.H. Lobos, and B.D. Erickson. 1997.
Identiﬁcation and modiﬁcation of biphenyl dioxygenase sequences that determine

the speciﬁcity of polychlorinated biphenyl degradation. Appl. Environ. Microbiol.
63: 3096-3103.

38

Oh, M.-K., L. Rohlin, K. C. Kao, and J. C. Liao. 2002. Global Expression
Proﬁling of Acetate-grown Escherichia coli. J. Biol. Chem. 277:13175 - 13183.

Otto, D.M.E., and T.W. Moon. 1996. Phase I and II enzymes and antioxidant
responses in different tissues of brown bullheads from relatively polluted and
non-polluted systems. Arch. Environ. Contam. Toxicol. 31: 141-147.

Park, J., Y.-M. Chen, J. J. Kukor, and L. M. Abriola. 2002. Inﬂuence of
substrate exposure history on biodegradation in a porous medium. J. Contam.
Hydro]. 51:233-256.

Patandin, S., P.C. Dagnelie, P.G.H. Mulder, E. Op de Coul, J.E. van der
Veen, N. Weisglas-Kuperus, and P.J.J. Sauer. 1999. Dietary exposure to
polychlorinated biphenyls and dioxins from infancy until adulthood: A
comparison between breast-feeding, toddler, and long-terrn exposure. Environ.

Health Persp. 107:45-51.

Pelletier, C., P. Imbeault, and A. Tremblay. 2003. Energy balance and
pollution by organochlorines and polychlorinated biphenyls. Obesity Rev. 4: 17-
24

Phadtare, S., Kato, I. and Inouye, M. 2002. DNA microarray analysis of the
expression proﬁle of Escherichia coli in response to treatment with 4,5-
Dihydroxy-2-Cyclopenten-1-One. J. Bacteriol. 84:6725-6729.

Polen, T., D. Rittmann, V. F. Wendisch, and H. Sahm. 2003. DNA microarray
analyses of the long-terrn adaptive response of Escherichia coli to acetate and
propionate. Appl. Environ. Microbiol. 69: 1759-1774.

Quackenbush J. 2001. Computational analysis of microarray data. Nat Rev
Genet 2:418—427.

Quensen, J.F., III, J.M. Tiedje and S.A. Boyd. 1988. Reductive dechlorination
of polychlorinated biphenyls by anaerobic microorganisms from sediment.
Science 242:752-754.

Quensen, J.F., III, S.A. Boyd and J.M. Tiedje. 1990. Dechlorination of four
commercial polychlorinated biphenyl mixtures (Aroclors) by anaerobic
microorganisms from sediments. Appl. Environ. Microbiol. 56:2360-2369.

Ramos, J. L., E. Duque, J-J. Rodriguez-Herva, P. Godoy, P., A. Haidour, F.
Reyes, and A. Fernandez-Barrero. 1997. Mechanisms for solvent tolerance in
bacteria. J. Biol. Chem 272:3887-3890.

Ramos, J.L., E. Duque, M-T Gallegos, P. Godoy, M.I. Ramos-Gonzalez, A.

Rojas, W. Teran, and A. Segura. 2002. Mechanisms of solvent tolerance in
Gram negative bacteria. Ann. Rev. Microbiol. 56:743-768.

39

Rasche, M. E., M. R. Hyman, and D. J. Arp. 1991. Factors limiting aliphatic
chlorocarbon degradation by Nitrosomonas europaea: cometabolic inactivation of

ammonia monooxygenase and substrate speciﬁcity. Appl. Environ. Microbiol.
57:2986-2994.

Rhee, G.Y., R.C. Sokol, B. Bush, and CM. Bethoney. 1993. Long-term study
of the anaerobic dechlorination of Aroclor 1254 with and without biphenyl
enrichment. Environ. Sci. Technol. 27:714-719.

Rhee, G.Y., R.C. Sokol, C.M. Bethoney, and B. Bush. 1993. A long-term study
of anaerobic dechlorination of PCB congeners by sediment microorganisms:
pathways and mass balance. Environ. toxicol. chem. 12: 1829-1 834.

Rodrigues, J.L.M., O.V. Maltseva, T.V. Tsoi, R.R. Helton, J.F. Quensen, III,
M. Fukuda and J.M. Tiedje. 2001. Development of a Rhodococcus recombinant

strain for degradation of products from anaerobic dechlorination of PCBS.
Environ Sci and Techno] 35:663-668.

Rodrigues, J.L.M., C.A. Kachel, M.R. Aiello, J.F. Quensen, O.V. Maltseva,
T.V. Tsoi, and J.M. Tiedje. 2006. Degradation of Aroclor 1242 dechlorination

products in sediments by Burkholderia xenovorans LB400(ohb) and Rhodococcus
sp. strain RHA1(fcb). Appl Environ Microbiol 72:2476-2482

Schena, M., D. Shalon, R.W. Davis, and P.O. Brown. 1995. Quantitative
monitoring of gene expression patterns with a complementary DNA microarray.
Science. 270:467—470.

Schena, M., D. Shalon, R. Heller, A. Chai, P.O. Brown, and R.W. Davis.
1996. Parallel human genome analysis: microarray-based expression monitoring
of 1000 genes. Proc Natl Acad Sci 93:10614—10619.

Schlezinger, J.J., and J.J. Stegeman. 2001. Induction and suppression of
cytochrome P450 1A by 3,3',4,4',5- pentachlorobiphenyl and its relationship to
oxidative stress in the marine ﬁsh scup (Stenotomus chrysops). Aquat Toxicol
52:101-115.

Seah, S. Y. K., G. Labbe, S. R. Kaschabek, F. Reifenrath, W. Reineke, and L.
D. Eltis. 2001. Comparative speciﬁcities of two evolutionarily divergent

hydrolases involved in microbial degradation of polychlorinated biphenyls. J.
Bacteriol. 183:1511-1516

Seah, S. Y. K., G. Labbe, S. Nerdinger, M. R. Johnson, V. Snieckus, and L.
D. Eltis. 2000. Identiﬁcation of a serine hydrolase as a key determinant in the

microbial degradation of polychlorinated biphenyls. J. Biol. Chem. 275:15701-
15708

40

Seegal, R,F,. and S. L. Schantz. 1994. Neurochemical and Behavioral Sequelae
of Exposure to Dioxins and PCBS. In Dioxins and Health, A. Schecter, (ed.),
Plenum Press, New York, pages 409-447.

Seeger, M., K.N. Timmis, and B. Hofer. 1995. Conversion of chlorobiphenyls
into phenylhexadienoates and benzoates by the enzymes of the upper pathway for
polychlorobiphenyl degradation encoded by the bph locus of Pseudomonas sp.
strain LB400. Appl Environ Microbiol. 61:2654—2658.

Seeger, M., K.N. Timmis, and B. Hofer. 1995. Degradation of chlorobiphenyls
catalyzed by the bph-encoded biphenyl-2,3-dioxygenase and biphenyl-2,3-
dihydrodiol-2,3-dehydrogenase of Pseudomonas sp. LB400. FEMS Microbiol
Lett. 133:259—264.

Seeger, M., M. Zielinski, K.N. Timmis, and B. Hofer. 1999. Regiospeciﬁcity of
dioxygenation of di- to pentachlorobiphenyls and their degradation to
chlorobenzoates by the bph-encoded catabolic pathway of Burkholderia sp. strain
LB400. Appl Environ Microbiol. 65:3614—3621.

Sherlock, G. 2000. Analysis of large-scale gene expression data. Curr Opin
Immunol. 12:201—205.

Sikkema, J., J. A. M. de Bont, and B. Poolman. 1995. Mechanisms of
membrane toxicity of hydrocarbons. Microbiol. Rev. 59:20] -222.

Smithwick, L.A., A. Smith, J.F. Quensen III, A. Stack, L. London, P.J.
Morris. 2003. Inhibition of LPS-induced splenocyte proliferation by ortho-
substituted polychlorinated biphenyl congeners. Toxicology 188:319-333.

Sondossi M, Sylvestre M, Ahmad I). 1992. Effects of chlorobenzoate
transformation on the Pseudomonas tesosteroni biphenyl and chlorobiphenyl
degradation pathway. Appl Environ Microbiol 1992;58:485—495.

Sokol, R.C., O-S Kwon, C.M. Bethoney, and G-Y. Rhee. 1994. Reductive
dechlorination of polychlorinated biphenyls (PCBS) in St. Lawrence River

sediments and variations in dechlorination characteristics. Environ. Sci. and
Techno]. 28:2054-2064.

Stalker, M.J., G.B. Kirby, T.E. Kocal, LR. Smith, and M.A.Hayes. 1991. Loss
of glutathione S-transferases in pollution-associated liver neoplasms in white

suckers (Catostomus commersoni) from Lake Ontario. Carcinogenesis 12:2221—
2226.

Suenaga, H., A. Nishi, T. Watanabe, M. Sakai, and K. Furukawa. 1999.

Engineering a hybrid pseudomonad to acquire 3,4-dioxygenase activity for
polychlorinated biphenyls. J. Biosci. Bioeng. 87:430-435.

41

Suenaga, H., M. Mitsuoka, Y. Ura, T. Watanabe, and K. Furukawa. 2001.
Directed evolution of biphenyl dioxygenase: emergence of enhanced degradation
capacity for benzene, toluene, and alkylbenzenes. J. Bacteriol. 183:5441-5444.

Suenaga, H., M. Goto, and K. Furukawa. 2001. Emergence of multifunctional
oxygenase activities by random priming recombination. J. Biol. Chem.
276:22500-22506.

Suutari, M., and S. Laakso. 1994. Microbial fatty—acids and thenna] adaptation.
Crit. Rev. Microbiol. 20:129— 37.

Swanson, G. M., H. E. Ratcliffe and L. J. Fischer. 1995. Human exposure to
polychlorinated biphenyls (PCBS): A critical assessment of the evidence for
adverse health effects. Regulatory Toxicology and Pharmacology 21: 136-150.

Taira, K., J. Hirose, S. Hayashida, and K. Furukawa. 1992. Analysis of bph
operon from the polychlorinated biphenyl-degrading strain of Pseudomonas
pseudoalcaligenes KF707. J Biol Chem 267:4844-4853.

Vaillancourt, F .H., G. Labbe, N. M Drouin, PD. Fortin, and L.D. Eltis. 2002.
The mechanism-based inactivation of 2,3-dihydroxybiphenyl 1,2-dioxygenase by
catecholic substrates. J. Biol. Chem. 277:2019-2027.

van der Meer, J.R., W.M. DeVos, S. Harayama, and A.J.B. Zehnder. 1992.
Molecular mechanisms of genetic adaptation of xenobiotic compounds.
Microbiological Reviews, 56:677-694.

van Hylckama Vlieg, J. E. T., W. de Koning, and D. B. Janssen. 1997. Effect
of chlorinated ethene conversion on viability and activity of Methylosinus
trichosporium OB3b. Appl. Environ. Microbiol. 63:4961-4964.

Yeager, C. M., P. J. Bottomley, and D. J. Arp. 2001. Cytotoxicity associated

with trichloroethylene oxidation in Burkholderia cepacia G4. Appl. Environ.
Microbiol. 67:2107-21 15. '

Ye, D., J.F. Quensen III, J.M. Tiedje, and S.A. Boyd. 1995. Evidence for para
dechlorination of polychlorobiphenyls (PCBS) by methanogenic bacteria. Appl.
Environ. Microbiol. 61:2166-217] .

Zhao, L.P., R. Prentice, and L. Breeden. 2001. Statistical modeling of large

microarray data sets to identify stimulus-response proﬁles. Proc Nat] Acad Sci
98:5631—5636.

Zielinski, M., S. Backhaus, and B. Hofer. 2002. The principal determinants for

the structure of the substrate-binding pocket are located within a central core of a
biphenyl dioxygenase {alpha} subunit. Microbiology 148:2439-2448.

42

Zielinski, M., S. Kahl, H.-J. Hecht, and B. Hofer. 2003. Pinpointing biphenyl
dioxygenase residues that are crucial for substrate interaction. J. Bacteriol.
185:6976-6980.

Zielinski, M., S. Kahl, C. Standfuss-Gabisch, B. Camara, M. Seeger, and B.
Hofer. 2006. Generation of novel-substrate-accepting biphenyl dioxygenases
through segmental random mutagenesis and identiﬁcation of residues involved in
enzyme speciﬁcity. Appl. Environ. Microbiol. 72:2191-2199.

43

CHAPTER 3

Parnell, J. Jacob, Joonhong Park, Vincent Denef, Tamara Tsoi, and James M. Tiedje.
2006. Coping with PCB toxicity: The physiological and genome-wide response of

Burkholderia xenovorans LB400 to PCB (polychlorinated biphenyl)-mediated stress.
Applied and Environmental Microbiology. 72:6607-6614.

44

ABSTRACT

The biodegradation of polychlorinated biphenyls (PCBS) relies on the ability of
aerobic microorganisms such as Burkholderia xenovorans sp. LB400 to tolerate two
potential modes of toxicity presented by PCB degradation: passive toxicity as
hydrophobic PCBs potentially disrupt membrane and protein function, and degradation-
dependent toxicity from intermediates of incomplete degradation. 1 monitored
physiological characteristics and genome-wide expression patterns of LB400 in response
to the presence of Aroclor 1242 (500 ppm) under low expression of the structural
biphenyl pathway (succinate and benzoate growth) and under induction by biphenyl. I
found no inhibition of growth or change in fatty acid proﬁle due to PCBs under non-
degrading conditions. Moreover, I observed no differential gene expression due to PCBS
themselves. However, PCBs did have a slight effect on the biosurface area of LB400
cells and caused slight membrane separation. On activation of the biphenyl pathway, 1
found growth inhibition from PCBS beginning after exponential phase growth suggestive
of accumulation of toxic compounds. Genome-wide expression proﬁling revealed 47
(0.56% of all genes) differentially expressed genes under these conditions. The biphenyl
and catechol pathways were induced as expected, but the quinoprotein methanol
metabolic pathway and a putative chloroacetaldehyde dehydrogenase were also highly
expressed. As the latter protein is essential to conversion of toxic metabolites in
dichloroethane degradation, they may play a similar role in degradation of chlorinated

aliphatic compounds resulting from PCB degradation.

45

INTRODUCTION

Polychlorinated biphenyls (PCBS) are organic chemicals belonging to a class of
hydrocarbons that are among the most important environmental contaminants, as their
physicochemical properties allow them to persist in the environment and bioaccumulate
(34). PCBS accumulate in lipid-rich tissues of all organisms, including humans, where
they alter immune functions (43), and cause neurological (40), developmental (31),
respiratory (45), and reproductive problems as well as cancer due to estrogenic activity
(12). These health concerns prioritize PCBS as major targets for environmental clean-up.

The bioremediation strategy with highest potential for destruction of PCB
mixtures is a sequential anaerobic-aerobic process (1). Anaerobic bacteria can
reductively dechlorinate highly chlorinated congeners, but cannot complete the process
and accumulate congeners with fewer chlorines (4, 22, 35). The burden of PCB
degradation lies with aerobic co-metabolism of the products of reductive dechlorination,
by biphenyl- and chlorobenzoate-degrading organisms (22, 38). Recently a sequential
anaerobic-aerobic process was shown in laboratory scale to remove over 50% of Aroclor
1242 from river sediments (39).

Two of the most effective aerobic PCB degrading bacteria, Burkholderia
xenovorans strain LB400 and Rhodococcus sp. RHAl , vary greatly in their PCB toxicity
resistance (41), yet the sources of this difference are unknown. Indeed recent studies of
PCB-tolerant LB400 (13-15) suggest that cell systems other than the biphenyl pathway
contribute to efﬁcient degradation of biphenyl and PCBS. Although the biphenyl
pathway has been extensively studied, the role of auxiliary mechanisms, which may

provide tolerance to PCBS, has been lightly investigated and information on the

46

biological effects of PCBs (25) and their degradation products to bacteria is scarce (10,
21).

Complete sequencing of the LB400 genome
(http://genome.oml.gov/microbial/bfun; 11) led us to undertake genomics-enabled
investigation of the biology of PCB degradation. The ~9.7 Mbp genome of LB400
contains 8958 predicted protein-coding genes (CDSs) in two chromosomes and one
megaplasmid, and is among the largest prokaryotic genomes closed to date. Using
genomic and proteomic approaches, an outline of genome-wide responses to a range of
carbon and cell development conditions has been reported (13-15), establishing the
groundwork for genomic analysis of PCB degradation.

As PCBS have been insinuated to impair microbial growth (25, 42), viability (10)
and degradation (7, 44, 47, 48), successful remediation should also consider the
physiological and genetic responses limiting or overcoming these toxic effects. In this
study I investigate physiological and genome-wide cell responses and defenses against
the toxicity posed by PCBS. To that end, I compare PCB tolerance levels of LB400 and
other potential PCB-degrading bacteria and outline genome-wide gene expression
patterns in response to different toxicity modes posed by PCBS. I further analyze LB400
differential gene expression patterns in response to PCBS with and without degradation. 1
ﬁnd that LB400 is unusually tolerant to PCB degradation and suggest that some auxiliary

pathways may remove toxic chlorinated intermediates.

47

MATERIALS AND METHODS
Bacteria, media and growth conditions. I determined the degree of sensitivity of 18
strains isolated on biphenyl and naphthalene from Brazil, Puerto Rico, Japan and USA (9,
28) to 100 ppm (low) and 500 ppm (high) concentrations of the commercial PCB mixture
Aroclor 1242 (Table 1). Sixteen strains previously characterized by Pellizari, et al. (28)
as potential PCB degraders and two well-studied PCB degraders, Burkholderia
xenovorans LB400 (7) and Rhodococcus sp. RHAl (26), were included in this study. To
determine the effect ofPCBs on growth, cultures of each strain were grown in triplicate
on Luria—Bertani (LB) broth containing 0, 100, and 500 ppm Aroclor 1242 (Monsanto
Co., St. Louis, M0.) at 29 :t 10 C in 125 ml ﬂasks agitated at 200 rpm. The percent
growth, maximum optical density and estimated lag time was noted for PCB-containing
cultures and compared with control medium that contained no PCBS. The maximum
growth rate (umax) was calculated using OD values during logarithmic growth.
Maximum biomass was measured as cultures reached stationary-phase growth.
For studies in deﬁned medium (13), batch cultures (25 mL) were prepared in 125-mL
Wheaton® ﬂasks and sealed with Teﬂon-lined lids. Succinate lg/L (~10 mM) and
benzoate 1 g/L (~5 mM) were added to the medium prior to autoclaving. Sterile biphenyl
3 g/L (~20 mM) was added directly to the sterilized medium in each ﬂask. The PCB-
containing medium was allowed to equilibrate for at least 24 h prior to addition of

inoculum from a freshly-grown, biphenyl- adapted culture. Triplicates were prepared

48

Table 3.1. Tolerance of potential PCB-degrading strains to 500 ppm Aroclor 1242 in
Luria Bertani medium. Tolerance (relative growth) was determined by comparing the
maximum growth rate (n max) and maximum biomass (Max OD at 600 nm) in the
presence and absence of PCBS.

 

Strain* G+/G-E n max (h'l) Max OD Re] gowthiL
Tolerant

C. testosteroni VP44 G- 1.07i0.03 0.98i0.01 1.05

B. xenovorans LB400 G- 0.93zt0.04 0.9932003 0.92

Moderately tolerant

Unidentiﬁed strain PR4 G- 0.81:1:0.06 0.94:1:0.01 0.76
S. warnerii VP73 G+ 0.87i0.22 0.832t0.06 0.73
A. xylosoxidans VP98 G- 0.75d:0.06 095220.01 0.71
X. maltophilia VP48 G- 0.73:1:0.02 0.94i0.01 0.69
P. gladioli VP86 G- 0.68i0.13 1.00i0.01 0.68
Unidentiﬁed strain PR2 G- 0.743c0.05 08710.0] 0.65
X. maltophilia VP90 G- 0.71i0.07 0.891002 0.63
R. erythropolis NY05 G+ 0.57i0.06 0.991002 0.57

Moderately seﬁnsitive

X maltophilia VP] 1 G- 0.68:]:0.14 0.78i0.04 0.53
Unidentiﬁed strain VP69 G- 0.67i0.03 0.68:]:0.13 0.46
P. gladioli VP87 G- 0.58i0.12 0.79i0.03 0.46
P. gladioli VP49 G- 0.64i0.08 0.65i0.02 0.42
A. xylosoxidans PR5 G- 0.47i0.16 0.811002 0.38
Rhodococcus sp. RHA] G+ 0.55i0.08 0.56i0.04 0.31
Sensitive

P. gladioli VP71 G- 0.38i0.05 0.26i0.02 0.10
Unidentiﬁed strain VP103 G- 0.29i0.06 0.11:]:0.01 0.03

 

(:tstandard error = standard deviation/Vn)

*Strains designated VP and PR are from Pellizari et a], (32).

EGram Positive/ Negative

lRelative growth is calculated by multiplying h max and max OD (relative to
PCB- controls).

49

for each growth condition. Microbial growth was monitored spectrophotometrically by
measuring absorbance at 600 nm. To account for any effect of the (in)solubility of
biphenyl or PCBS on absorbance, CFU counts were conducted by plating serial dilutions

on plates with R2A agar.

Distribution of PCBs. Association of PCBS with bacteria was demonstrated by
growing two strains incapable of PCB degradation (Burkholderia xenovorans, LMG
27120 and LMG 16229 (19)), in 25 ml of K1 with succinate and 500 ppm PCBs.
Following growth to stationary phase (OD600 1.2 and 1.0, respectively), the cultures were
ﬁltered using sterile glass wool and centrifuged at 4000 rpm for 10 min. A control of
medium with PCBs but no cells was also ﬁltered using glass wool, centriﬁiged, and
analyzed as a reference for the distribution of PCBs without cells. The supernatant and
cell fraction were separated and PCBS were extracted with octachloronaphthalene added
as an internal standard.

PCB degradation by LB400 was measured in triplicate by disappearance of PCBs
from cultures harvested at mid-logarithmic phase on each of the three carbon sources.
Due to the difference in the growth rate on each carbon source, harvesting of LB400
varied from 12-24 h following inoculation, on reaching mid-logarithmic growth. Each
PCB-containing culture was extracted three times using an equal volume of 1:1
hexane:acetone by shaking for 30 min and analyzed by gas chromatography as described
previously (28). Percent degradation was calculated by determining the difference

between the PCB concentration in experimental cultures and in non-inoculated controls.

50

Physiological adaptation to PCBS. To determine membrane adaptation of
LB400 and RHA] to PCBS, cells were grown in the presence or absence of PCBS and the
fatty acid composition was analyzed as per the MIDI protocol (Microbial ID, Newark,
DE). 1 also compared the morphology of LB400 grown in the presence and absence of
PCBS by analyzing scanning electron micrograph preparations. SEM ﬁxation was
performed as previously described (26). Multiple ﬁelds (at least ﬁve) with multiple cells
(>10) from two biological replicates were subsequently analyzed using the CMEIAS
image analysis software (27, http://cme.msu.edu/cmeias). Due to the elongation of cells
prior to cell division, I analyzed the smallest 25 percentile of the bacteria captured on
electron micrographs for dimensional analysis. For transmission electron micrographs,
cells were pelleted and the pellet resuspended in ﬁxative (2.5% glutaraldehyde and 2.0%
paraformaldehyde in 0.1M cacodylate buffer) overnight at 4°C. After ﬁxation, cells were
pelleted and the pellet was embedded in 2% agarose for post ﬁxation with osmium
tetroxide. Following postﬁxation, cells were dehydrated in acetone series and embedded
in Spurr's resin. Sections were stained with uranyl acetate and lead citrate for

examination on a JEOL 100CX transmission electron microscope.

Gene expression analysis. The genome-wide response to PCB stress was
analyzed using a genomic microarray [XeochipTM (13)] that contained 8,429 of the 8,989
total CDSs (93.8%) reported in the closed genome sequence of LB400
(http://genome.oml.gov/microbial/bfun). LB400 cells were grown in succinate, benzoate,
and biphenyl media in duplicate each with parallel cultures containing 500 ppm Aroclor
1242. After three serial transfers in the same medium, bacterial cells were harvested by

centrifugation from the exponential phase (OD600 nm 03-04) at 4000 rpm for 10 min at

51

4°C. The culture was stored in RNAlater (Ambion) to protect against RNA degradation.
Total RNA was extracted using an RNeasy mini kit (Qiagen), and the contaminant DNA
was degraded by using DNase I (Roche). The RNA was quantiﬁed
spectrophotometrically, and the quality was veriﬁed by gel analysis. RNA was labeled
by arnino-allyl dUTP (Sigma) and hybridized as before (13) using Cy5 and Cy3
ﬂuorophores (Amersham). Two biological replicates were hybridized with at least 100
pmol of labeled material per Xeochip with dyes swapped. Hybridized chips were
scanned with an Axon 4000B laser scanner and the data extracted using Genepix Pro 5.0
(Axon laboratories). Median expression data for each channel (Cy5 and Cy3) were
imported into GeneSpring 7.2 (Silicon Genetics) and normalized using Lowess intensity-
dependent normalization (13). Biological reproducibility was determined by calculating

the coefﬁcient of variation. Data were analyzed using GeneSpring soﬁware.

RESULTS

Tolerance to Aroclor 1242. I analyzed the degree of sensitivity or tolerance of
potential PCB-degrading strains by determining the inhibition of growth due to addition
of Aroclor 1242 (Table 3.1) to LB broth. Of the 18 potential PCB-degrading strains
tested, only Comamonas lestosteroni VP44 and Burkholderia xenovorans LB400
demonstrated tolerance to high concentrations of Aroclor. In contrast, both the growth
rate and biomass production were decreased in Rhodococcus RHAl with exposure to
PCBS. Several strains, including A. xylosoxidans, exhibited extreme sensitivity to PCBS
with diminished biomass, extremely slow growth rates and greater lag time. As expected,
the ability to tolerate PCBS was better illustrated with 500 ppm than 100 ppm in the

medium (data not shown). The length of lag-period prior growth in the presence of high

52

concentrations of PCBS appears to be consistent with the bacterial tolerance to PCBS.
Due to its PCB tolerance and availability of genomics-enabled approaches, 1 selected
LB400 for detailed elucidation of PCB toxicity and tolerance responses.

We monitored the effect of PCBS on growth when the biphenyl pathway
expression was low (minimal to no degradation of PCBS) in succinate- and benzoate-
grown cells. Regardless of the presence of PCBS, RHAl was unable to grow on
succinate in K] medium. Growth of RHAl on benzoate was not inhibited in the PCB-
containing treatments (0.48 h'l +/- .05) compared with controls (0.42 h'l +/- .03).
Likewise LB400 growth rates on both succinate (0.40 h'1 +/- .02) and benzoate (0.27 h'1
+/- .02) were not inhibited by PCBs (0.39 hr”l +/- .02 and 0.28 hr"l +/- .03 respectively).
Plate counts conﬁrmed this observation.

On expression of the biphenyl pathway during growth on biphenyl and
subsequent PCB degradation, the growth of both RHA] and LB400 was inhibited (Figure
3.1). No growth of RHA] was observed in batch cultures containing biphenyl and PCBS
(0.10 h'1 +/- .01 vs. 0.01 h'1 +/- .01). On the contrary, LB400 maintained growth rates

similar to control cultures until mid-exponential phase before inhibition became apparent.

Cell-associated PCBS. Since PCBS have very low water solubility, I analyzed
the amount of PCBS that partitioned to the biomass of two Burkholderia xenovorans
strains incapable of PCB degradation after growth on succinate + PCBs in K] medium.
Virtually all of the PCBS recovered were found in the biomass fraction (Table 3.2).

Based on previous measurements of membrane content of cells (30), this amount of PCBS
corresponds to roughly 9.5 % of membrane weight if all cell- associated PCBS were

localized in the membrane.

53

PCB fate under degrading and non-degrading conditions. Insigniﬁcant
disappearance of PCBS by LB400 growing on either benzoate or succinate during
exponential growth indicated that PCBs were not degraded on these carbon sources
(Figure 3.2). However, during the transition to stationary phase, under carbon limited
conditions, some degradation did occur (not shown). Although RHAI did not grow on
succinate, it grew well on benzoate and similar to LB400 showed no degradation of
PCBs. When the bph-pathway was induced in LB400, I found signiﬁcant disappearance
of lesser- and ortho-chlorinated congeners such as 2-chlorobiphenyl and 2,3-
dichlorobiphenyl, the more persistent congeners present in Aroclor 1242.

Morphological changes of LB400 due to PCBs. Morphological effects of PCBs
on LB400 were analyzed using scanning electron micrographs of cells from exponential-
phase growth of each of the treatments. Image analysis revealed a statistically signiﬁcant
reduction in the biosurface area caused biy'PCBs in succinate (14%) and benzoate (9%)
grown cultures (Table 3.3). When LB400 was grown with biphenyl as the growth
substrate, no signiﬁcant reduction was detected in the biosurface area due to PCBs;
however both biphenyl-grown treatments were signiﬁcantly reduced (by 31%) compared
with succinate and benzoate grown cells. Transmission electron micrographs from
exponential phase LB400 grown on succinate with PCBs revealed pervasive separation of
the inner and outer membrane (Figure 3.3A) compared to succinate alone (Figure 3.3B).
Scanning electron micrographs of early stationary phase succinate + PCB grown cells
show the formation of large membrane vesicles (Figure 3.3 C) that are absent in control

samples (Figure 3.3D). Nearly every micrograph collected from early stationary phase

54

1U- ..............................................

 

 

E
= 1 .. ............................................
g l‘" +LB400 Bph
2. / + LB400 Bph + PCBS
E / +RHA1Bph
2 0'1 I """"""" - """"""""""""""""""" —I—RHA1Bph+PCBs .-
o /
D
73 :1 [.34
E; 0.01 , ,' -- ---------------------------------------------
O
0.001 r 1 i
0 50 100

Time in)

Figure 3.1. Growth curves of LB400 and RHAl on biphenyl (3 g/L) as carbon source

with and without 500 ppm Aroclor 1242 (PCBS) in K] medium.

55

Table 3.2. PCBS (ppm) extracted from two Burkholderia xenovorans strains
incapable of PCB degradation after incubation with Aroclor 1242. Cultures and control
were ﬁltered using sterile glass wool to remove insoluble PCBS prior to centrifugation (i

standard deviation).

 

Culture treatment Supernatant (ppm) Cell pellet (ppm)
Uninoculated medium* 4.0i0.1 5.1i0.1
LMG27120 2.9:t0.1 75i5
LMGl 6229 3.3i0.3 5715

 

*Control medium without bacterial inoculation.

56

Percent degraded

 

Figure 3.2. Percent degradation of lower-chlorinated PCB congeners (500 ppm Aroclor
1242) by LB400 harvested during exponential-phase growth on benzoate (Ben), succinate

(Succ), and biphenyl (Bph) with PCBS.

57

cells with PCBS contained evidence of vesicles at a ratio of approximately 3:4

(vesicles:cell).

Fatty acid changes due to PCBS. The change in fatty acid composition of
LB400 varied slightly for each carbon source. As general trends, unsaturated fatty acids,
predominantly 18:1 and 16:1, decreased with increasing K0w of C source (Figure 3.4).
Succinate has the lowest KOW (0.35) followed by benzoate (1.87) with biphenyl highest
(3.90). Cyclic fatty acids (17:0 and 19:0) tended to increase with increasing K0w of C
source. On degradation of PCBS (induction by biphenyl), there was a signiﬁcant shift

from saturated fatty acids to cyclic fatty acids.

Gene expression in response to PCBS. No signiﬁcant differential gene
expression was found between benzoate or succinate control cultures and PCB-containing
cultures (Figure 3.5A,B). The CVs for dye-swapped biological replicates were 9.5% for
succinate + PCBS with succinate as reference and 5.4% for benzoate + PCBS with
benzoate as reference.

Gene expression patterns measured from PCB-degrading conditions vs biphenyl
growth indicate that relatively few genes, only 47 of 8429 CDSs are differentially
expressed greater than 2-fold. Several of the structural genes in the upper biphenyl
pathway were slightly more induced on degradation of PCBS as were several genes
involved in (chloro)benzoate degradation via hydroxylation and CoA activation (Table
3.4). I also found genes induced that may play an ancillary role such as a cluster of genes

involved in acetylacetone cleavage that contained a putative short chain alcohol

58

Table 3.3. Morphological measurements of the smallest quartile of LB400 cells grown
on different carbon sources (succ = succinate, ben = benzoate, bph = biphenyl) on
exposure to 500 ppm Aroclor 1242 as calculated by CMEIAS (:t standard deviation).

Statistically signiﬁcant groups are indicated by different letters (determined by t-test

 

p<0.05).
Mean Mean Mean

Growth length width biosurface

conditions (me (um) area (pmz) n Grouping
Succ 1.86i0.19 0.47i0.04 3.2i0.4 27 A
Succ + PCBS 1.65i0.16 0.44i0.02 2.7i0.2 23 B
Ben 1.75101 1 0.48i0.03 3.2i0.2 17 A
Ben + PCBS 1.61i0.15 0.49i0.04 2.9i0.2 23 B
Bph 1.41i0.14 0.41:0.06 21:04 17 C
Bph + PCBS 1.36i0.16 0.42i0.05 2.2i0.3 19 C

 

59

 

Figure 3.3. Electron micrographs of LB400 grown on succinate with and without PCBS:

TEM image of exponential-phase cells with PCBS (A), and without PCBS (B), SEM of

late exponential-phase cells with PCBS (C) and without PCBS (D).

60

 

60“

 

          

 

50 -
E: 40 _ .............................. ..................
3 ___________
5 30 ' i“
'0
g , ............ .
< _________ .44.;

10 '

succinate (0.35) benzoate (1.87) biphenyl (3.9)
Growth Substrate (Kow)

Figure 3.4. Fatty acid analysis of LB400 during growth on carbon sources with different
octanol-water coefﬁcients (Kow) in the presence (striped) and absence (solid) of PCBS.

Fatty acids were grouped as unsaturated (light), saturated (gray) and cyclic (dark).

61

.223288 25m E omcmno 28-93 388%: 8:: Ecomﬁm .cosmwzgco: $0304 53»
880:9: Eﬂmo—oﬁ mo 92% 0% 35358 50mm .Cv mmom £3» 18235 mama? 35:39 25 Am...
mmUm 2:3 088:3 .0589, 88553 A<v mmum £3» 03583 mama; 89:88 so £38m moEzE

80¢ .8an Ecouatomgﬁ its: .9223di $5385 8% mo 32m 28m BEEEmoA .m.m charm

oooor coo? oow or oooov ooow ooF or coco? oooF 00?

or

 

 

 
 
 

 

 

oow

000?

0000?

 

62

Table 3.4. Up-regulated genes of LB400 grown on biphenyl with PCBS with growth on

biphenyl as the reference. Expression reported as the ratio.

 

Gene ID Annotation Expression
BxeAl 129 Chloromuconate cycloisomerase 2.7
BxeAl 130 Chlorocatechol- 1 ,2-dioxygenase 3 .2
BxeA1329 Sugar ABC transporter, periplasmic binding protein 2.7
BxeA1427 Amidase, hydantoinase/carbamoylase 2.1
BxeA2109 Catechol 1,2-dioxygenase 4.7
BxeA2876 Acetylacetone-cleaving enzyme 2.9
BxeA2877 Hypothetical protein 3.5
BxeA2878 Putative short-chain dehydrogenase/reductase 2.1
BxeA3675 ABC sugar transporter, ATPase subunit 2.5
BxeA4207 ABC nitrate/sulfonate/bicarbonate family transporter 2.1
BxeA444l Chloroacetaldehyde dehydrogenase 4.9
BxeA4442 Hypothetical protein 2.4
BxeA4478 Putative exported protein precursor 3.1
BxeB1279 Glycogen synthase 1.9
BxeB1637 Cytochrome o ubiquinol oxidase subunit ll precursor 1.9
Bxe82286 Unknown 1 .7
BxeB2426 Cytochrome c-555 precursorb 5.4
BxeB2427 Methanol dehydrogenase large subunit-like proteinb 9.3
BxeB2436 Formaldehyde activating enzyme 16.0
BxeB2437 Hypothetical proteinb 5.5
BxeB2469 Coenzyme PQQ synthesis Db 2.6
BxeB2473 TonB-dependent receptorb 3.0
BxeB2474 Hypothetical proteinb 3 .2
BxeC1082 Lipopolysaccharide biosynthesis protein 2.4
BxeC1187 4-hydroxy-2-oxovalerate aldolase” 1.4
BxeC1190 Glutathione S-transferase" 1.4
BxeCl 191 2,3-Dihydroxybiphenyl dioxygenase“ 1 .5
BxeC1192 Cis-2,3-dihydrobiphenyl-2,3-diol dehydrogenase“ 1.5
BxeCl 196 Biphenyl dioxygenase small subunit“ 1.7

 

0 indicates CDSs associated with the biphenyl pathway.
b indicates CDSs associated with Cl metabolism.

63

dehydrogenase as well as a group of genes that contained a putative chloroacetaldehyde
dehydrogenase. Additionally, on degradation of PCBs, gene expression patterns indicate
an induction of genes potentially involved in methanol utilization including a methanol
dehydrogenase-like protein, and formaldehyde activating enzyme as well as genes
responsible for co-factors involved in C1 metabolism. Down-regulated genes (Table 3.5)
include several membrane proteins, an oxidoreductase that is similar to formate
dehydrogenase (BxeC0084), a cyclohexanone monooxygenase (BxeA3588), and a cluster
of genes possibly involved in lysine biosynthesis (BxeBl798, BxeB1802 and BxeB1806).
The CV for the biological replicates of PCB-degrading conditions (biphenyl + PCBS vs

biphenyl) was 15.3% (Figure 3.5C).

DISCUSSION
The physiological and genome-wide response of B. xenovorans LB400 to PCBS enabled
us to conﬁne the source of toxicity to the byproducts of PCB degradation. Although both
LB400 and RHAl are considered model organisms for the study of PCB degradation, my
data indicate that LB400 is much more tolerant to PCB-degradation dependent toxicity
(Figure 3.1). In fact, LB400 is among the most tolerant PCB degraders identiﬁed in this
study (Table 3.1). In both cases, PCBS per se did not affect the growth rate, viability or
fatty acid proﬁle and LB400 demonstrated no change in gene expression in the absence
of degradation. Thus, toxicity of PCBS to RHAl and LB400 was a direct result of the
production of deleterious metabolites during co-metabolism. The difference in growth
rates of LB400 and RHAI during PCB degradation may indicate mechanisms beyond the
biphenyl pathway that contribute to tolerance. LB400 gene expression data under

biphenyl-grown, PCB-degrading conditions indicate that the biphenyl,
ll.

64

Table 3.5. Down-regulated genes of LB400 grown on biphenyl with PCBs with growth

on biphenyl as the reference. Expression reported as the ratio.

 

Gene ID Annotation Expression
BxeA0676 Putative membrane protein 0.54
BxeA1007 16S rRNA processing protein 0.54
BxeAl 178 Hypothetical protein 0.69
BxeA174l RND efﬂux system, outer membrane lipoprotein 0.73
BxeA1939 Putative permease from ABC transporter 0.54
BxeA2187 Cytochrome c, class I precursor 0.58
BxeA3048 Putative bacteriophage protein GP46 0.35
BxeA3185 Putative enoyl-CoA hydratase 0.34
BxeA3588 Cyclohexanone monooxygenase 0.52
BxeA3722 Acetyl transferase 0.62
BxeB0560 Putative ADP-heptose--LPS heptosyltransferase 0.40
BxeBl 798 TRAP dicarboxylate transporter-DctP subunit 0.49
BxeB1802 Dihydrodipicolinate synthetase 0.18
BxeB1806 MFS transporter, phthalate permease family 0.38
BxeB2010 Acriﬂavin resistance protein precursor 0.69
BxeB2l46 Putative membrane protein precursor 0.15
BxeB2160 D-lactate dehydrogenase 0.38
BxeB2536 Putative LysR-family transcriptional regulator 0.30
BxeC0084 Formate dehydrogenase 0.55

 

65

3-chlorocatechol and catechol pathways are further induced on degradation of PCBS.
The present data also indicate the induction of a putative chloroacetaldehyde
dehydrogenase and components of the C1 metabolism pathway that may be involved in
PCB product degradation.

Microorganisms responsible for the biodegradation of hydrophobic compounds
such as PCBs are subject to membrane effects such as ﬂuidity disruption and interference
with protein function (16, 42). Previous studies concerned with the adverse physiological
responses to PCBS have attributed toxicity to PCBS themselves as well as to the products
of their degradation (10, 21). While I conﬁrmed that PCBS partition to the cell fraction of
cultures (Table 3.2), this association did not correspond to a decrease in growth rate or
viability in either the PCB-tolerant LB400 or -sensitive RHAl. Additionally, PCBS
apparently do not interact with proteins that are responsible for cellular respiration as
seen for other chlorinated aromatic compounds (16).

Recent studies suggest that PCB degradation does not occur when LB400 is
grown with simple carbon sources such as glucose and succinate (6, 13). I found that
PCBS were not degraded (Figure 3.2) and mechanisms involved in PCB degradation were
not induced by PCBS during exponential-phase growth on succinate or benzoate (Figure
3.5A, B). Therefore, any physiological or genome-wide expression changes detected in
succinate- 0r benzoate-grown LB400 cannot be attributed to degradation products of
PCBS, but rather to interaction with PCBs themselves, effectively allowing us to decouple
and evaluate the potential sources of PCB toxicity.

One physiological response to membrane stress caused by lipophilic compounds

involves altered fatty acid chain length or composition (36, 37, 42). Although the fatty

66

acid composition of PCB-degrading Ralstonia eutropha HP850 shifts from saturated to
unsaturated fatty acids during growth on biphenyl (25), the effect of PCBS themselves on
membrane composition has not been documented. LB400 demonstrated no change in the
fatty acid proﬁle when grown on simple carbon sources (succinate or benzoate) with
PCBS (Figure 3.4). However, LB400 may be similar to pseudomonads that do not alter
their saturated-to—unsaturated fatty acid proﬁle on exposure to lipophilic compounds
(37). The only physiological changes I observed due to PCBs in non-degrading
conditions appeared in electron micrographs of LB400 that indicate a reduction in the
biosurface area of LB400 (Table 3.3). I also found frequent membrane aberrations
caused by growth with PCBs (Figure 3.3B, D). Similar membrane separation caused by
PCBs has been noted (10), and such membrane aberrations are often indicative of
stressed conditions (5).

Although I found morphological evidence of PCB-membrane interactions in
LB400, I found no differential gene expression (>2-fold) by microarray analysis in any of
the 8429 CDSs tested in either succinate or benzoate treatments with PCBS relative to no-
PCB treatments (Figure 3.5A & B). These analyses indicate that PCBs themselves do
little to alter the composition of the membrane of LB400 and RHA]. Although PCBS do
not affect growth rate or viability, the reduction in biosurface area and separation of inner
and outer membrane do constitute a response to PCBs. However, dynamic
morphological changes don’t always elicit a change in gene expression (3). Either the
responses reported here stem from gene expression changes below the sensitivity of
microarray analysis or this is a direct physical effect of PCBs on membranes.

Past studies involved in the degradation of PCBS have focused exclusively on the

biphenyl and chlorobenzoate pathways responsible for much of the degradation of simple

67

congeners (4, 17-19, 22, 28, 38), and as expected these pathways (biphenyl, catechol and
chlorocatechol) were induced on degradation (Table 3.4). Although chlorinated aliphatic
compounds derived from chlorinated pentadienoates may play an important role in PCB
degradation, their fate and effect have been neglected. Potential metabolic derivatives of
chlorinated pentadienoates have proven lethal to biodegrading microorganisms (2, 50,
51). Bacteria that are more capable of degrading or tolerating chlorinated aliphatic
compounds would have a distinct advantage in environmental scenarios containing a
mixture of PCB congeners. Among the putative genes induced on degradation of PCBS
was an acetaldehyde dehydrogenase that is 83% (amino acid) identical to the
chloroacetaldehyde dehydrogenase found in Xanthobacter autotrophicus GJ10, a known
dichloroethane (DCE) degrader (24). Chloroacetaldehyde dehydrogenase is responsible
for rapid conversion of the highly toxic chloroacetaldehyde intermediate, an essential step
in DCE metabolism (24, 49). The alcohol dehydrogenase involved in DCE degradation
is the same as the quinoprotein methanol dehydrogenase in methanol oxidation by Gram-
negative methylotrophs (24, 33). The chloroacetaldehyde dehydrogenase genes and
methanol oxidation pathway (and co-factors) were the most differentially expressed
genes induced by PCB degradation.

Down-regulated genes demonstrate equally signiﬁcant characteristics associated
with the degradation of PCBs (Table 3.5). In agreement with the change in fatty acid
proﬁle on degradation of PCBs (Figure 3.4), a putative enoyl-CoA hydratase involved in
fatty acid metabolism (29) is repressed. Although lysine biosynthesis has been shown to
have an indirect association with fatty acid beta-oxidation in oxidative stress (8), the
speciﬁc role of lysine repression in this case is unknown. Finally, the down-regulation of

oxygen-dependent proteins may be indicative of oxygen limited conditions.

68

Although many of the mechanisms and components presented here may be
involved in a general toxic response, such as oxygen limitation, some genes that are
differentially expressed are almost certainly involved in minimizing the effects of toxic
metabolites produced during degradation of PCBS. Unexpectedly, I found no growth
inhibition or notable physiological response to PCBs under non-degrading conditions.
Hence, factors beyond the upper biphenyl and benzoate degradation pathways contribute
to successful PCB degradation. While RHAl oxidizes a wide range of PCBs in resting
cell assays (following growth on biphenyl) (27), it grew poorly on biphenyl in the
presence of 500 ppm Aroclor 1242. Further comparison with other potential
biodegrading bacteria, such as RHA] , shows that LB400 is extremely tolerant to the toxic
metabolites that are created as a result of PCB degradation, possibly due to its superior
ability to oxidize chlorinated aliphatic compounds. As LB400 is one of the bacteria most
tolerant to PCB toxicity and has speciﬁcity to degrade a broad range of congeners, (it
becomes a model system for studying PCB degradation and its effects on bacteria,
particularly for in situ biodegradation. Understanding the cell’s responses to PCBS
revealed in this study may provide information on the modes of toxicity and effective
counter responses, eventually leading to development of more efﬁcient PCB amelioration

strategies.

69

10.

11.

REFERENCES

Abramowicz, D. A. 1990. Aerobic and anaerobic biodegradation of PCBs: a
review. Crit. Rev. Biotechnol. 10:241-248.

Alvarez-Cohen, L., and P. L. McCarty. 1991. Effects of toxicity, aeration, and
reductant supply on trichloroethylene transformation by a mixed methanotrophic
culture. Appl. Environ. Microbiol. 57:228-235.

Arends, S.J.R., and D. S. Weiss. 2003. Inhibiting cell division in Escherichia
coli has little if any effect on gene expression. J. Bacteriol. 186:880-884.

Bedard, D. L., and J. F. Quensen, III. 1995. Microbial reductive dechlorination
of polychlorinated biphenyls, p. 127-216. In L. Y. Young, and C. Cemiglia (ed.),
Microbial transformation and degradation of toxic organic chemicals. Wiley-Liss
Division, John Wiley & Sons, Inc., New York, NY.

Beveridge, T.J. 1999. Structures of Gram-negative cell walls and their derived
membrane vesicles. J. Bacteriol. 181:4725-4733.

Billingsley K A, Backus S M, Juneson C, Ward 0 P. 1999. Comparison of the
degradation patterns of polychlorinated biphenyl congeners in Aroclors by

Pseudomonas strain LB400 after growth on various carbon sources. Can J
Microbiol 1997;43:1 172—1 179.

Blasco, R., M. Mallavarapu, R-M. Wittich, K.N. Timmis, and D.H. Pieper.
1997. Evidence that formation of protoanemonin from metabolites of 4-
chlorobiphenyl degradation negatively affects the survival of 4-chlorobiphenyl-
cometabolizing microorganisms. Appl. Environ. Microbio. 63:427-434.

Bopp L H. 1986. Degradation of highly chlorinated PCBS by Pseudomonas strain
LB400. J Ind Microbiol. 1:23—29.

Breitling, R., O. Sharif, M.L. Hartman, and S.K. Krisans. 2002. Loss of
compartmentalization causes misregulation of lysine biosynthesis in peroxisome-
deﬁcient yeast cells. Eukaryot Cell. 6:978-986.

Camara, B., C. Herrera, M. Gonzalez, E. Couve, B. Hofer, and M. Seeger.
2004. From PCBS to highly toxic metabolites by the biphenyl pathway. Environ.
Microb. 62842-850.

Chain, P.S.G., V.J. Denef, K. Konstantinidis, L.M. Vergez, L. Agullo, V.L.
Reyes, L. Hauser, M. Cordova, L. Gomez, M. Gonzalez, M. Land, V. Lao, F.
Larimer, J.J. LiPuma, E. Mahenthiralingam, S.A. Malfatti, C.J. Marx, J.J.
Parnell, A. Ramette, P. Richardson, M. Seeger, D. Smith, T. Spilker, W-J.
Sul, T.V. Tsoi, L.E. Ulrich, I.B. Zhulin, J.M. Tiedje. 2006. Burkholderia

70

12.

13.

14.

15.

16.

17.

18.

19.

20.

xenovorans LB400 harbors a multi-replicon, 9.7 M bp genome shaped for
versatility. Proc. Natl. Acad. Sci. (Submitted).

Demers, A. P. Ayotte, J. Brisson, S. Dodin, J. Robert, and E. Dewailly. 2002.
Plasma concentrations of polychlorinated biphenyls and the risk of breast cancer:
A congener-speciﬁc analysis. Am. J. Epidemiol., 155(7):629 - 635.

Denef, V.J., J. Park, T.V. Tsoi, J.-M. Rouillard, H. Zhang, J.A.
Wibbenmeyer, W. Verstraete, E. Gulari, S.A. Hashsham, and J.M. Tiedje.
2004. Biphenyl and benzoate metabolism in a genomic context: Outlining

genome-wide metabolic networks in Burkholderia xenovorans LB400. Appl.
Environ. Microbiol. 70:4961-4970.

Denef, V.J. M.A. Patrauchan, C. Florizone, J. Park, T.V. Tsoi, W. Verstraete,
J.M.Tiedje, and L.D. Eltis. 2005. Growth substrate- and phase-speciﬁc

expression of biphenyl, benzoate, and C. metabolic pathways in Burkholderia
xenovorans LB400. J. Bacteriol. 187:7996-8005.

Denef, V.J. J.A. Klappenbach, M.A. Patrauchan, C. Florizone, J.L.M.
Rodrigues, T.V. Tsoi, W. Verstraete, L.D. Eltis, and J.M. Tiedje. 2006.
Genetic and genomic insights into the role of benzoate-catabolic pathway

redundancy in Burkholderia xenovorans LB400. Appl. Environ. Microbiol. 72:
585-595.

Donato MM, Jurado AS, Antunes-Madeira MC, Madeira VM. 1997.
Comparative study of the toxic actions of 2,2-bis(p-chlorophenyl)-1 ,1,1-
trichloroethane and 2,2-bis(p-chlorophenyl)-1,1-dichloroethylene on the growth

and respiratory activity of a microorganism used as a model. Appl. Environ.
Microbiol. 63:4948-51.

Erickson, B. D., and F. J. Mondello. 1993. Enhanced biodegradation of
polychlorinated biphenyls after site-directed mutagenesis of a biphenyl
dioxygenase gene. Appl. Environ. Microbiol. 59:3858-3862.

Furukawa, K. J.R. Simon, and A.M. Chakrabarty. 1983. Common Induction
and regulation of biphenyl, xylene/toluene, and salicylate catabolism in
Pseudomonas paucimobilis. J. Bacteriol. 154: 1356-1 362.

Gibson, D. T., D. L. Cruden, J. D. Haddock, G. J. Zylstra, and J. M. Brand.
1993. Oxidation of polychlorinated biphenyls by Pseudomonas sp. strain LB400
and Pseudomonas pseudoalcaligenes KF 707. J. Bacteriol. 175:4561-4564.

Goris, J., P. De Vos, J. Caballero-Mellado, J. Park, E. Falsen, J.F. Quensen
III, J.M. Tiedje, and P. Vandamme. 2004. Classiﬁcation of the PCB-and
biphenyl degrading strain LB400 and relatives as Burkholderia xenovorans sp.

nov. Int J Syst Evol Microbiol 54:1677-1681.

71

21.

22.

23.

24.

25.

26.

27.

28.

29.

30

31.

Hiraoka, Y., Yamada, T., Tone, K., Futaesaku, Y., and Kimbara, K. 2002.
Flow cytometry analysis of changes in the DNA content of the polychlorinated
biphenyl degrader C omamonas testosteroni TK102: Effect of metabolites on cell-
cell separation. Appl Environ Microbiol 68: 5104-5112.

Hrywna, Y., Tsoi, T.V., Maltseva, O.V., Quensen, III, J.F., and Tiedje, J.M.
1999. Construction and characterization of two recombinant bacteria that grow

on ortho- and para-substituted chlorobiphenyls. Appl Environ Microbiol 65:
2163-2169.

Imbeault, N.Y.R., J.B. Powlowski, C.L. Colbert, J.T. Bolin, and L.D. Eltis.
2000. Steady-state kinetic characterization and crystallization of a PCB-
transforrning dioxygenase. J Biol Chem 275:12430-12437.

Janssen, D.B., A. Scheper, and B. Witholt. 1984. Biodegradation of 2-
chloroethanol and 1,2-dichloroethane by pure bacterial cultures, p 169-178. In
E.H. Houwink and RR. van der Meer (eds.), Innovations in biotechnology.
Elsevier. Amsterdam

Kim, 1.8., H. Lee, and J.T. Trevors. 2001 . Effects of 2,2’,5,5’-
tetrachlorobiphenyl and biphenyl on cell membranes of Ralstonia eutropha H850.
FEMS Microbiol Let 200: 1 7-24.

Klomparens, K., F legler, S.L., and Hooper, G.R. 1986. Procedures for
transmission and scanning electron microscopy for biological and medical
science. Burlington, VT. Ladd Research Industries.

Lui, J., EB. Dazzo, O. Glagoleva, B. Yu, and A.K Jain. 2001. CMEIAS: a
computer aided system for the image analysis of bacterial morphotypes in
microbial communities. Microb Ecol 41:173-194.

Maltseva, O.V., T.V. Tsoi, J.F. Quensen III, M. Fukuda, and J.M. Tiedje.
1999. Degradation of anaerobic reductive dechlorination products of Aroclor
1242 by four aerobic bacteria. Biodegradation. 10:363-371.

Muller-Newen G, and W. Stoffel. 1991. Mitochondrial 3-2trans-Enoyl-COA
isomerase. Puriﬁcation, cloning, expression, and mitochondrial import of the key

enzyme of unsaturated fatty acid beta-oxidation. Biol Chem Hoppe Seyler.
372:613-24.

Neidhardt, F.C., J.L. lngraham, and M. Schaechter. 1990. Physiology of the
bacterial cell. Sinauer Associates, Inc., Sunderland, MA

Patandin, S., P.C. Dagnelie, P.G.H. Mulder, E. Op de Coul, J.E. van der
Veen, N. Weisglas-Kuperus, and P.J.J. Sauer. 1999. Dietary exposure to
polychlorinated biphenyls and dioxins from infancy until adulthood: A

72

32.

33.

34.

35.

36.

37.

38.

39

40.

41.

comparison between breast-feeding, toddler, and long-term exposure. Environ.
Health Persp. 107:45-51.

Pellizari, V. H., S. Bezborodnikov, J. F. Quensen III, and J. M. Tiedje. 1996.
Evaluation of strains isolated by growth on naphthalene and biphenyl for
hybridization of genes to dioxygenase probes and polychlorinated biphenyl-
degrading ability. Appl. Environ. Microbiol. 62:2053-2058

Poelarends, G.J. 2001. Genetic adaptation of bacteria to halogenated aliphatic
compounds : the recruitment and distribution of dehalogenase genes.
Dissertation, University of Groningen.

Quensen, J.F., III, J.M. Tiedje and S.A. Boyd. 1988. Reductive dechlorination
of polychlorinated biphenyls by anaerobic microorganisms from sediment.
Science 242:752-754.

Quensen, J.F., III, S.A. Boyd and J.M. Tiedje. 1990. Dechlorination of four
commercial polychlorinated biphenyl mixtures (Aroclors) by anaerobic
microorganisms from sediments. Appl. Environ. Microbiol. 56:2360-2369.

Ramos, J. L., E. Duque, J-J. Rodriguez-Herva, P. Godoy, P., A. Haidour, F.
Reyes, and A. Femandez-Barrero. 1997. Mechanisms for solvent tolerance in
bacteria. J. Biol. Chem. 272:3887-3890.

Ramos, J.L., E. Duque, M-T Gallegos, P. Godoy, M.I. Ramos-Gonzalez, A.
Rojas, W. Teran, and A. Segura. 2002. Mechanisms of solvent tolerance in
Gram negative bacteria. Ann. Rev. Microbiol. 56:743-768.

Rodrigues, J.L.M., O.V. Maltseva, T.V. Tsoi, R.R. Helton, J.F. Quensen, III,
M. Fukuda and J.M. Tiedje. 2001. Development of a Rhodococcus recombinant

strain for degradation of products from anaerobic dechlorination of PCBS.
Environ Sci and Techno] 35:663-668.

Rodrigues, J.L.M., C.A. Kachel, M.R. Aiello, J.F. Quensen, O.V. Maltseva,
T.V. Tsoi, and J.M. Tiedje. 2006. Degradation of Aroclor 1242 deChlorination

products in sediments by Burkholderia xenovorans LB400(0hb) and Rhodococcus
sp. strain RHA1(fcb). Appl Environ Microbiol 72:2476-2482

Seegal R,F,. and S. L. Schantz. 1994. Neurochemical and behavioral sequelae
of exposure to dioxins and PCBS. In Dioxins and Health, A. Schecter, (ed.),
Plenum Press, New York, pages 409-447.

Seto, M., N. Okita, K. Sugiyama, E. Masai, and M. Fukuda. 1996. Growth

inhibition of Rhodococcus sp. strain RHAl in the course of PCB transformation.
Biotechnol. Lett. 18:1193-1198.

73

42.

43.

44.

45.

46.

47.

48.

49.

50.

51.

Sikkema, J., J. A. M. de Bont, and B. Poolman. 1995. Mechanisms of
membrane toxicity of hydrocarbons. Microbiol. Rev. 59:201-222.

Smithwick, L.A., A. Smith, J.F. Quensen III, A. Stack, L. London, P.J.
Morris. 2003. Inhibition of LPS-induced splenocyte proliferation by ortho-
substituted polychlorinated biphenyl congeners. Toxicology 188:319-333.

Sondossi M, Sylvestre M, Ahmad D. 1992. Effects of chlorobenzoate
transformation on the Pseudomonas resosteroni biphenyl and chlorobiphenyl
degradation pathway. Appl Environ Microbiol 1992;58:485—495.

Swanson, G. M., H. E. Ratcliffe and L. J. Fischer. 1995. Human exposure to
polychlorinated biphenyls (PCBS): A critical assessment of the evidence for
adverse health effects. Regulatory Toxicology and Pharmacology 21: 136-150.

Tsoi, T. V., E.G. Plotnikova, J.R. Cole, W.F. Guerin, M. Bagdasarian, and
J.M. Tiedje. 1999. Cloning, expression and nucleotide sequence of the
Pseudomonas aeruginosa strain 142 ohb genes coding for oxygenolytic ortho-

dehalogenation of halobenzoates. App]. and Environ. Microbiol. 65(5):2151-
2162.

Vaillancourt, F .H., S. Han, P.D. Fortin, J.T. Bolin and L.D. Eltis. 1998.
Molecular basis for the stabilization and inhibition of 2,3-dihydroxybiphenyl 1,2-
dioxygenase by t-butanol. J .Biol. Chem. 273:34887-34895.

Vaillancourt, F.H., G. Labbe, N. M Drouin, P.D. F ortin, and L.D. Eltis. 2002.
The mechanism-based inactivation of 2,3-dihydroxybiphenyl 1,2-dioxygenase by
catecholic substrates. J. Biol. Chem. 277:2019-2027.

Van der Ploeg, J. M.P. Smidt, A.S. Landa, and DB. Janssen. 1994.
Identiﬁcation of chloroacetaldehyde dehydrogenase ivolved in 1,2-dichloroethane
degradation. Appl. Environ. Microbiol. 60: 1 599-1605.

van Hylckama Vlieg, J. E. T., W. de Koning, and D. B. Janssen. 1997. Effect
of chlorinated ethene conversion on viability and activity of Methylosinus
trichosporium OB3b. Appl. Environ. Microbiol. 63:4961-4964.

Yeager, C. M., P. J. Bottomley, and D. J. Arp. 2001. Cytotoxicity associated

with trichloroethylene oxidation in Burkholderia cepacia G4. Appl. Environ.
Microbiol. 67:2107-21 15.

74

CHAPTER 4
SUPPORTING CAST OF PCB DEGRADATION:
USING TRANSCRIPTIONAL PROFILING TO IDENTIFY GENES
INVOLVED IN (POLYCHLORINATED) BIPHENYL DEGRADATION IN

Burkholderia xenovorans LB400.

75

ABSTRACT

Over the past three decades, polychlorinated biphenyl (PCB) degradation by
aerobic microorganisms has focused almost exclusively on the molecular structure and
regulation of the biphenyl pathway. However, efﬁcient degradation relies on more than
the biphenyl pathway alone; detoxiﬁcation of deleterious compounds, secondary
regulation and transport of biphenyl are necessary components of optimal PCB
degradation. The complete genome sequencing of Burkholderia xenovorans LB400 and
subsequent transcriptional analyses have provided groundwork for more comprehensive
investigation of PCB degradation. This study examines the transcriptional proﬁle of 11
conditions involving three carbon sources, two growth phases and the presence of PCBs.
Cluster analysis of transcriptional proﬁles successfully groups the upper and lower
biphenyl pathway including ORFO, a regulator of the lower biphenyl pathway.
Additionally, several transport-associated genes and regulatory elements cluster tightly
with the biphenyl pathway implicating them in efﬁcient biphenyl degradation. The
acetaldehyde dehydrogenase BphJ, responsible for channeling acetaldehyde to pyruvate
degradation clusters with a chloroacetaldehyde dehydrogenase, indicating similar
function. This study expands (polychlorinated)biphenyl degradation beyond the biphenyl
pathway identifying several candidate genes involved in improving efﬁciency of

degradation.

76

INTRODUCTION

Polychlorinated biphenyls (PCBS) are xenobiotic compounds that have been
widely used as industrial products. As a consequence of their physicochemical stability,
PCBS have become one of the most important environmental contaminants. Since their
ban by the Enrionmental Protection Agency three decades ago, several microorganisms
capable of PCB degradation have been isolated and the biodegradation pathways
involved have subsequently been characterized (Ahmed, et al. 1990; Furukawa, et a].
1982; Mondello 1989). Most studies have been directed toward organisms that degrade
PCBS via the biphenyol pathway. One of the most studied PCB degraders is
Burkholderia xenovorans LB400 (LB400) because of its ability to degrade highly
chlorinated PCB congeners (Bopp 1986; Gibson, et a]. 1993; Maltseva et a]. 1999;
Mondello et al. 1997) and its tolerance to high concentrations of PCBS (Parnell, et a].
2006).

Recent studies (Denef, et al. 2004, 2005, 2006; Parnell, et al.2006) have shifted
away from inspection of the biphenyl pathway in favor of a panoramic View of PCB
degradation including auxiliary pathways and mechanisms involved in the improving
efﬁciency of the degradation of biphenyl and PCBs by LB400. PCB degradation has
consequently been found to be a dynamic process with variations due to carbon source
(Billingsley, et al. 1997) as well as growth phase (Kohler, et al. 1988). While the
contributions involving mechanisms and pathways outside the biphenyl pathway have
improved my understanding of PCB degradation, conclusions from studies on global
physiology, gene and protein expression continue to evolve.

Complete sequencing of the genome of the outstanding PCB dechlorinating and

degrading LB400 (http://genome.om1.gov/microbial/bfun) led us to undertake genomics-

77

enabled investigation of the biology of PCB degradation. The ~9.7 Mbp genome of
LB400 contains 8989 predicted open reading frames (ORFs) in two chromosomes and
one megaplasmid, and is among the largest prokaryotic genomes closed to date (Chain, et
al. 2006). Using genomic and proteomic approaches, an outline of genome-wide
responses to a range of carbon and cell development conditions has been reported (Denef,
et al. 2004, 2005, 2006; Parnell, et a]. 2006), establishing the groundwork for large-scale
genomic analysis of PCB degradation.

As biodegrading microorganisms such as LB400 induce PCB degrading pathways
on transition to early stationary phase (due to carbon limitation) expression of genes
common to PCB degradation during growth (induced by biphenyl) can be examined. The
most vigorous applications of expression analysis over a wide range of conditions is
through transcriptional proﬁling, which entails the analysis of patterns of gene expression
encompassing various experiments that examine a broad range of responses to different
treatments (Quackenbush 2001). Statistical organization of gene expression patterns
(Eisen, et al. 1998) has been used successfully to provide useful information outlining
metabolism and global stress responses in other microorganisms (Oh, et al. 2001;
Phadtare, et al. 2002; Polen, et a]. 2003; Zheng, et al. 2001).

The aim of this study is to analyze gene expression patterns of different carbon
sources (benzoate, biphenyl and succinate) and different growth phases [log-phase (ML)
and transition phase (TP)] to provide a comprehensive overview of genes involved in
PCB degradation and its regulation. By comparing these data with transcriptional data
from the degradation of PCBS due to growth in the presence of biphenyl, I present a more

comprehensive view of the degradation of PCBS.

78

MATERIALS AND METHODS
Bacterial strain and genome sequence. The annotated genome sequence of
Burkholderia xenovorans LB400, originally isolated from a PCB-contaminated landﬁll
(Bopp 1986; Goris, et al. 2004), was produced via a collaborative effort by the
Department of Energy’s Joint Genome Institute and Oak Ridge National Laboratory’s
Computational Genomics Group (Chain, et a]. 2006). The ﬁnal draft sequence is publicly

available at http://genome.Lgi-psf.org/ﬁnished_microbes/burfu/burfu.home.html.

Media and growth conditions. LB400 was grown in deﬁned Kl medium
(Denef, et a]. 2004) in batch cultures supplemented with different carbon sources with
and without 500 ppm (vzv) of Aroclor 1242. Batch cultures (25 mL) were prepared in
acetone washed, sterilized 125-mL Wheaton® ﬂasks and sealed with Teﬂon-lined lids.
Succinate lg/L (~10 mM) and benzoate 1 g/L (~5 mM) were added to the medium as
indicated previously (pamell; denef). Sterile biphenyl 3 g/L (~20 mM) was added directly
to the sterilized medium in each ﬂask. The PCB-containing cultures were allowed to
equilibrate for at least 24 h prior to addition of bacterial inoculum. Batch cultures were
inoculated from freshly grown biphenyl adapted culture. Cultures were incubated at 30° C
on a rotary shaker at 200 rpm. Growth was monitored spectrophotometrically at OD600
nm. Two biological replicates for each treatment (C source, +/- PCBS) were harvested
during exponential-phase growth (ML) (at an OD of 0.3-0.4) and during transtition to
stationary-phase growth (TP) (OD 0.8-1.0). The experimental setup for the effect of

growth substrate and growth phase on PCB degradation is illustrated in Figure 4.1.

79

RNA extraction and labeling and hybridization. Bacterial cells were harvested
by centrifugation at 5000 x g for 10 min at 4° C and resuspended in RNAlater (Ambion)
to protect RNA against degradation. RNA was extracted using RNeasy extraction kit
(Qiagen), and remaining DNA was removed by 30 min incubation at ~25° C with 1.5 U
DnaseI/ug nucleic acid (Roche). The quality of RNA and removal of DNA was veriﬁed
by 1.2 % agarose gel electrophoresis. For direct incorporation (succinate vs. early
stationary phase biphenyl), RNA was labeled as indicated previously (Denef, et a1. 2004).
All other hybridization experiments were performed using amino-ally] labeling (Denef, et
a]. 2004). All solutions were ﬁltered (0.22 pm) for removal of particulate matter from
microarray channels. All hybridizations were were performed as described previously

(Denef, et a]. 2004; Parnell, et al. 2006).

Data analysis. Median signals for each channel (Cy5 and Cy3) were imported
into GeneSpring 7.2 (Silicon Genetics) and normalized using Lowess intensity-dependent
normalization. Data from treatments benzoate + PCBS vs benzoate and biphenyl + PCBs
vs biphenyl (Parnell, et al. 2006) were transformed using treatments benzoate vs
succinate and biphenyl vs succinate (Denef, et al. 2004), respectively, in order to
reference all treatments to succinate. Error propagation due to data transformation was

calculated using the following equation:

Herei-

P-values were calculated using GeneSpring’s cross gene error model. Principal

 

component analysis was performed on the ten treatments to determine sources of

variance. Genes and treatments were clustered using Genespring’s hierarchical clustering

80

algorithm with the similarity metric set for the standard error. Genes were further

clustered according to treatments (ie growth phase, carbon source).

RESULTS

Transcriptome analysis of PCB degradation dependent on carbon source and
growth phase. 1 have used whole-genome DNA microarrays with the goal of identifying
the genes and pathways in Burkholderia xenovorans LB400 involved in PCB
degradation. By this method, the reference treatment mRNA levels (cells harvested from
succinate ML) and different carbon source, growth phase and PCB degradation were
determined for each of the 8429 out of a total of 8989 (94%) genes in LB400. The results
from my microarray analyses are'expressed as ratios of treatmentzreference mRNA
levels. My microarray analyses include two components: ﬁrst, to determine the effect of
carbon source on the expression of the biphenyl pathway, and consequent PCB
degradation, 1 included the transcriptional proﬁle of succinate, benzoate and biphenyl
(Denef, et a]. 2004) for comparison with identical treatments with PCBS (Parnell, et a].
2006) and second, to determine the transition to PCB degradation on consumption of
exogenous carbon sources, I analyzed the effect of growth phase (carbon limitation) on
PCB degradation (Figure 4.1).

Principal component analysis indicated that nearly 72% of the variance
encountered in the treatments was explained by four variables (component 1 = 44.23%,
component 2 = 14.78% and component 3 = 12.86%). Subsequent plotting of treatments
on a 3-dimensional grid indicates the strongest inﬂuence of growth phase, and carbon

source on gene expression patterns (Figure 4.2). Hierarchical analysis also indicates that

81

treatments cluster by growth phase and carbon source rather than presence/absence of

PCBS (Figure 4.3).

Clustering of the biphenyl pathway. Microarray analysis and degradation
proﬁles of succinate-grown LB400 with PCBS shows no induction of the biphenyl
pathway by PCBs during ML growth. Similarly, benzoate-grown LB400 with PCBS
show no induction of the biphenyl pathway compared with benzoate without PCBs.
However, on transition to stationary phase, the biphenyl pathway is induced by the PCBS
present in the media and degradation does occur (Furukawa, et al. 1983).

The upper biphenyl pathway groups very tightly in hierarchical clustering
analysis. BphA, E, F, G, B, C, and D all show similar expression proﬁles over the 10
treatments (Figure 4.4). Bph J and I, considered lower biphenyl pathway, do not cluster
within this group. However, BphJ—an acetaldehyde dehydrogenase in the lower
pathway—clusters with a putative chloroacetaldehyde dehydrogenase mentioned in the

previous chapter.

DISCUSSION
DNA microarray technology is a useful tool in studying global expression
patterns in response to a number of different growth conditions; here, I examine the
response of Burkholderia xenovorans LB400 to growth substrate- and phase-dependent
PCB degradation. This study provides the ﬁrst information on global expression patterns
associated with PCB degradation under growing and carbon-limited conditions (Figure

4.1). Degradation and transcriptional proﬁles indicate that the regulation of the biphenyl

82

pathway is controlled by growth substrate (Figures 4.2 and 4.3). In addition,
transcriptional proﬁling across all treatments suggests differential regulation of the upper
and lower biphenyl pathway (Figure 4.4). In this study, the combination of
transcriptional proﬁling over a range of treatments has provided a productive approach to
obtain a more complete holistic picture of the biodegradation process of PCBS.

Cluster analysis of gene expression patterns allowed us to group genes by
function (Eisen, et al 1998). A good indication of the ability of genes to cluster according
to function is the tight grouping of the upper biphenyl pathway. The upper biphenyl
pathway clustered tightly together and was dissimilar to the expression of the lower
biphenyl pathway across the conditions tested (Figure 4.4). While components of the
lower biphenyl pathway (Bphl and BphJ) are close to the upper biphenyl pathway cluster,
the distance suggests differential regulation of the upper and lower pathways as noted
previously (Denef, et a1 2004). The gene product of bthI (previously ORFO) clustered
more closely with the lower biphenyl pathway than with the upper pathway (Figure 4.4).
Watanabe, et al. (2003) demonstrate that the bth1 gene product in Pseudomonas
pseudoalcaligenes KF707 is identiﬁed as a transcriptional regulator for itself as well as
genes in the lower biphenyl pathway. Within the upper biphenyl expression proﬁle
cluster are several genes that may inﬂuence the biphenyl pathway including
transcriptional regulators and several membrane transport proteins as well as genes with
unknown function (Figure 4.5). A recent report has indicated that LB400 may utilize
active transport in biphenyl catabolism (Master, et a]. 2005). The highest expression of
the lower biphenyl pathway is during ES growth on biphenyl and ES growth on succinate
with PCBS. Close clustering of the acetaldehyde dehydrogenase (BphJ) involved in

biphenyl degradation with a putative chloroacetaldehyde dehydrogenase identiﬁed

83

previously (Figure 4.6) (Parnell, et al. 2006) suggests involvement of chloroacetaldehyde
dehydrogenase during biphenyl and PCB degradation. Furthermore, the transcriptional
proﬁles of both dehydrogenases are similar to components involved in a PQQ containing

alcohol dehydrogenase pathway.

84

 

I Benz PCB

y.

 

 

 

I

Succ TP PCB [ Benzoate l Succinate PCB

 

 

 

 

 

 

 

 

 

 

 

 

Succ TP -——- Succinate -——- Benz TP PCB

 

 

 

 

 

 

 

 

 

. l
Biphenyl TP Biphenyl Benz TP

1

I Biphenyl PCB

 

 

 

 

 

 

 

 

 

 

 

 

 

Figure 4.1. Schematic of treatments and comparisons used in this study. All were
harvested from mid-logarithmic phase growth unless speciﬁed (T.P. indicates transition

to early stationary phase).

85

 

Bph ML P033
Bph ML .
M P e: ,9“ Bph TP
; Succ L C’ST. SBenML . 7‘ .1
SUOC TP . ' 86" MI. PCBS ‘
' . Ben TP PCBS

--_."x

 

Figure 4.2. Pricipal component analysis of the genome-wide expression pattern of all

treatments used in this study.

86

 

 

 

 

 

 

 

 

 

”Ll

 

 

Succinate ML PCBs

Succinate ES PCBS

Succinate ES

Biphenyl ML PCBs

Biphenyl ML

Biphenyl ES

Benzoate ES PCBs

Benzoate ES

Benzoate ML PCBs

Benzoate ML

Figure 4.3. Cluster analysis of the total genome-wide expression patterns of all

treatments used in this study.

87

..x
C
o

“...._,_-__..k.____ . -.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

35
(U
0
U)
_8_’ 10 .’
E .. l
a
if; 1 ..I
C .
3 s
S i
”-3 0.1 l
g 3th
z 0.01 E BphC
1 BphB
\$’ o, 9 Q; V % ‘39 9% a" 99 B F
@ Q0 ‘09 Q0 (‘1‘ Q0 $9 Q0 (598/ Q0 I: ph
0., x. 0% ‘9 o v as v o ‘4 a
06" 4}“ 6" 4, 08° 4% \6“ (9“ 09 (53’ me
Q 90° 9° Qei“ 6‘ 9Q 9 99° 9° 96 .... Bth
""N ‘ om
{E
BphA
, r 3"”
--\\—-{ 1 Bph-J
Bth‘l

 

Figure 4.4. Expression proﬁle (y axis) of the biphenyl pathway across all treatments (x

axis) (top) and clustered according to their expression proﬁle (bottom).

88

Figure 4.5. Clade containing the expression proﬁles for the genes in the upper biphenyl
pathway along with other genes that may be involved in (polychlorinated) biphenyl
degradation by cluster analysis. Expression of genes in each treatment (x axis) relative to

succinate ML. Light = up-regulated, Black = No change in expression.

89

“—IIIIIIIIII
IIIIIIIIII

IIIIIIIII
IIIIIIIIII
-—IIIIIIIIII
L-IIIIIIIIII
---IIIIIIIIII

 

 

 

 

 

IlIllIllII
‘ MSF permease-
' like protein
Putative trans-

‘ membrane
lllllllll
lllllllll

ll'lllllll G3P repressor
-----llllllllll

 

 

Illlllllll

Benzoate ML
Benz ML PCBs
Benzoate ES
Benz ES PCBs
Biphenyl ML
Bph ML PCBS
Biphenyl ES
Succ ML PCBs
Succ ES

Succ ES PCBS

IIIIIIIIva- "......
Ilrrll 3"]??°'““’“"’
o y ro nu.
, Hypottiofizol
III_IIIII
III I

I LysR-Typo
Regulator

——IIIIIIIIII ....-.
———IIIIIIIIII ...... ......
——I!ll IIII mats?“

 

 

Benzoate ML
Benzoate ML PCB
Benzoate ES
Benzoate ES PCB:
Biphenyl ES
Bbheny] ML
Succ’nato ES

Succinate ES PCB
Succrnate ML PCB

.1
2
‘8
E
Figure 4.6. The Expression proﬁle for the acetaldehyde dehydrogenase (BphJ) gene in
the lower biphenyl pathway clusters with other genes that may be involved in

(polychlorinated) biphenyl degradation. Expression of genes in each treatment (x axis)

relative to succinate ML. Light = up-regulated, Black = No change in expression.

91

REFERENCES

Ahmed M., and D.D. Focht. 1973. Degradation of polychlorinated biphenyls by
two species of A chromobacter. Can J Microbiol. 19:47—52.

Billingsley K A, Backus S M, Juneson C, Ward 0 P. 1997. Comparison of the
degradation patterns of polychlorinated biphenyl congeners in Aroclors by

Pseudomonas strain LB400 after growth on various carbon sources. Can. J.
Microbiol. 43:1 172—] 179.

Bopp L H. Degradation of highly chlorinated PCBs by Pseudomonas strain
LB400. J Ind Microbio] 1986;1223—29.

Chain, P.S.G., V.J. Denef, K. Konstantinidis, L.M. Vergez, L. Agullo, V.L.
Reyes, L. Hauser, M. Cordova, L. Gomez, M. Gonzalez, M. Land, V. Lao, F.
Larimer, J.J. LiPuma, E. Mahenthiralingam, S.A. Malfatti, C.J. Marx, J.J.
Parnell, A. Ramette, P. Richardson, M. Seeger, D. Smith, T. Spilker, W-J.
Sul, T.V. Tsoi, L.E. Ulrich, LB. Zhulin, J.M. Tiedje. 2006. Burkholderia
xenovorans LB400 harbors a multi-replicon, 9.7 M bp genome shaped for
versatility. Proc. Natl. Acad. Sci. (Submitted).

Denef, V.J., J. Park, J.L. Rodrigues, T.V. Tsoi, S.A. Hashsham and J.M.
Tiedje. 2003. Validation of a more sensitive method for using spotted
oligonucleotide DNA microarrays for functional genomics studies on bacterial
communities. Environ. Microbiol. 5(10):933-43.

Denef, V.J., J. Park, T.V. Tsoi, J.-M. Rouillard, H. Zhang, J.A.
Wibbenmeyer, W. Verstraete, E. Gulari, S.A. Hashsham, and J.M. Tiedje.
2004. Biphenyl and benzoate metabolism in a genomic context: Outlining

genome-wide metabolic networks in Burkholderia xenovorans LB400. Appl.
Environ. Microbiol. 70:4961-4970.

Denef, V.J. M.A. Patrauchan, C. Florizone, J. Park, T.V. Tsoi, W. Verstraete,
J.M.Tiedje, and L.D. Eltis. 2005. Growth substrate- and phase-speciﬁc
expression of biphenyl, benzoate, and C1 metabolic pathways in Burkholderia
xenovorans LB400. J. Bacteriol. 187:7996-8005.

Denef, V.J. J.A. Klappenbach, M.A. Patrauchan, C. Florizone, J.L.M.
Rodrigues, T.V. Tsoi, W. Verstraete, L.D. Eltis, and J.M. Tiedje. 2006.
Genetic and genomic insights into the role of benzoate-catabolic pathway
redundancy in Burkholderia xenovorans LB400. Appl. Environ. Microbiol. 72:

585-595.

92

Eisen, M.B., P. T. Spellman, P. 0. Brown and D. Botstein. 1998. Cluster
analysis and display of genome-wide expression patterns. Proc. Natl. Acad. Sci.
95:14863-14868.

Furukawa, K. J.R. Simon, and A.M. Chakrabarty. 1983. Common Induction
and regulation of biphenyl, xylene/toluene, and salicylate catabolism in
Pseudomonas paucimobilis. J. Bacteriol. 154:1356-1362.

Furukawa, K. 1982. Microbial degradation of polychlorinated biphenyls
(PCBS). In: Chakrabarty A M. , editor; Chakrabarty A M. , editor. Biodegradation
and detoxiﬁcation of environmental pollutants. Boca Raton, Fla: CRC Press; pp.
33—56.

Gibson, D. T., D. L. Cruden, J. D. Haddock, G. J. Zylstra, and J. M. Brand.
1993. Oxidation of polychlorinated biphenyls by Pseudomonas sp. strain LB400
and Pseudomonas pseudoalcaligenes KF707. J. Bacteriol. 175:4561-4564.

Goris, J., P. De Vos, J. Caballero-Mellado, J. Park, E. Falsen, J.F. Quensen
III, J.M. Tiedje, and P. Vandamme. 2004. Classiﬁcation of the PCB-and
biphenyl degrading strain LB400 and relatives as Burkholderia xenovorans sp.

nov. Int J Syst Evol Microbiol 54:1677-1681.

Kohler, H.-P.E., D. Kohler-Staub, and D.D. Focht. 1988. Cometabolism of
polychlorinated biphenyls: Enhanced transformation of Aroclor 1254 by growing
bacterial cells. Appl. Environ. Microbiol. 54:1940-1945.

Maltseva, O.V., T.V. Tsoi, J.F. Quensen III, M. F ukuda, and J.M. Tiedje.
1999. Degradation of anaerobic reductive dechlorination products of Aroclor
1242 by four aerobic bacteria. Biodegradation. 10:363-371.

Mondello, F.J. 1989. Cloning and expression in Escherichia coli of
Pseudomonas strain LB400 genes encoding polychlorinated biphenyl degradation.
J Bacteriol. 171:1725—1732.

Mondello, F.J., M.P. Turcich, J.H. Lobos, and B.D. Erickson. 1997.
Identiﬁcation and modiﬁcation of biphenyl dioxygenase sequences that determine

the speciﬁcity of polychlorinated biphenyl degradation. Appl. Environ. Microbiol.
63: 3096-3103.

Oh, M.-K., L. Rohlin, K. C. Kao, and J. C. Liao. 2002. Global Expression
Proﬁling of Acetate-grown Escherichia coli. J. Biol. Chem. 277:13175 - 13183.

Phadtare, S., Kato, I. and Inouye, M. 2002. DNA microarray analysis of the

expression proﬁle of Escherichia coli in response to treatment with 4,5-
Dihydroxy-2-Cyclopenten-1-One. J. Bacteriol. 84:6725-6729.

93

Polen, T., D. Rittmann, V. F. Wendisch, and H. Sahm. 2003. DNA microarray

analyses of the long-term adaptive response of Escherichia coli to acetate and
propionate. Appl. Environ. Microbiol. 69:1759-1774.

Quackenbush J. 2001. Computational analysis of microarray data. Nat Rev
Genet 2:418—427.

Watanabe, T., H. Fujihara, and K. Furukawa. 2003. Characterization of the
second Lythype regulator in the biphenyl-catabolic gene cluster of Pseudomonas
pseudoalcaligenes KF707. J. Bacteriol. 185: 3575-3582.

Zheng, M., X. Wang, L.J. Templeton, D.R. Smulski, R.A. LaRossa, and G.

Storz. 2001. DNA microarray-mediated transcriptional proﬁling of the
Escherichia coli response to hydrogen peroxide. J. Bacteriol. 183: 4562-4570.

94

CHAPTER 5

ENVIRONMENTALLY RELEVANT PARAMETERS AFFECTING PCB

DEGRADATION: INVESTIGATION OF THE EXPRESSION OF THE

BIPHENYL PATHWAY AND ASSOCIATED GENES IN Burkholderia xenovorans

LB400

95

ABSTRACT

The principal means for microbial degradation of polychlorinated biphenyls
(PCBS) is through the biphenyl pathway. Although molecular aspects of the regulation of
the biphenyl pathway have been studied, information on environmental facets such as the
effect of alternative carbon sources on (polychlorinated) biphenyl degradation is limited.
The variation in resting cell PCB degradation proﬁles of Burkholderia xenovorans
LB400 in relation to conditions prior to PCB exposure (carbon source and growth phase)
led us to examine these factors. Genome-wide expression patterns reveals 25 genes
commonly up-regulated during PCB degradation and growth on biphenyl in transition to
stationary phase including detoxiﬁcation pathways and nutrient-scavenging systems
potentially regulated by sigma factor 54 (054). While previous studies have revealed
inactivation of the biphenyl pathway on exposure to simple carbon sources and
association with 054, this effect has not been studied in detail until now. Q-RT-PCR
analysis of the response of genes in the upper biphenyl pathway (bphA, bphD, and
bthI), 054 and detoxiﬁcation genes in the LB400 genome indicate similarities between
the biphenyl pathway, 0’54 and chloroacetaldehyde dehydrogenase. The response of
genes in the upper biphenyl pathway to carbon source competition and growth phase
reveals inhibition of the biphenyl pathway by PCBS. Expression data suggest induction
of the biphenyl pathway during growth on succinate without degradation, indicating
involvement of post-transcriptional regulation or transport of biphenyl. This information
is crucial to understanding PCB degradation in an environmental context as biodegrading

bacteria experience a range of carbon sources and growth phases.

96

INTRODUCTION

Over the past three decades, microbial biodegradation of polychlorinated
biphenyls (PCBs) has focused primarily on the molecular regulation and gene structure of
the biphenyl pathway fortuitously responsible for the co-metabolism of lower-chlorinated
congeners (Ahmed and Focht, 1973). In order for successful in situ microbial
biodegradation of PCBS to occur; PCBS must be available to biodegrading
microorganisms, and PCB-degrading pathways in aerobic bacteria need to be induced
(reviewed by Ohtsubo, et al. 2004). The biphenyl degradation pathway responsible for
the degradation of PCBs has been analyzed and several studies have identiﬁed molecular
components key to the regulation of the biphenyl pathway. BphS is a GntR-type
repressor (Muoz, et al. 1999) shown in Pseudomonas sp. KKS102 to negatively affect the
biphenyl pathway (Ohtsubo, et al. 2000). ORFO is another regulator belonging to the
GntR family and was identiﬁed as a positive regulator for itself and the biphenyl pathway
in Pseudomonas pseudoalcaligenes KF 707 (Watanabe, et a]. 2003) and as a regulator for
bphA] in Burkholderia xenovorans LB400 (Beltrametti, et a]. 2001; Denef, et al. 2004,
Erickson and Mondello, 1993). In addition to local regulation of the biphenyl pathway
by BphS and ORFO, sigma factor 54 (0'54), associated with global regulation in response
to various physiological states such as carbon and nitrogen limitation (Kim, et a] 1995;
Merrick and Stewart, 1985) as well as degradative pathways (Cases and deLorenzo 2000;
Cases, et al. 1996; Ehrt, et al. 1994; Sze, et al. 1996), has been indirectly linked to
transposon-associated biphenyl degradation in Ralstonia metallidurans CH34 (Muoz, et
a]. 2001).

Burkholderia xenovorans LB400 (LB400) (Chain, et al. 2006; Goris, et a]. 2004)

has become a model organism to study the aerobic biodegradation of PCBs because of

97

the extremely wide range of congeners oxidized as well as its ability to grow on
orth0+meIa-congeners (Bopp, 1986; Gibson, et a]. 1993; Maltseva, et a]. 1999; Mondello,
et al. 1997). While LB400 has no homolog for BphS, regulation of the biphenyl pathway
in LB400 involves Bthl (formerly ORFO) (Beltrametti, et a]. 2001, Denef, et a]. 2004;
Watanabe, et al. 2003). Bth1 is a positive regulator of the biphenyl pathway in LB400
through a promoter localized upstream of bphA and has been identiﬁed as a biphenyl-
inducible regulator of bphA (Beltrametti, et a]. 2001, Denef, et a]. 2004; Erickson and
Mondello, 1993), and possibly bphD (Denef, et a]. 2004) (Figure 1).

Although molecular mechanisms involved in the regulation of the biphenyl
pathway have been described, information on environmental factors affecting PCB
degradation is limited. Previous results indicate that the degradation of PCBS does not
occur during exponential-phase growth with simple carbon compounds such as glucose,
succinate and benzoate (Billingsley, et a]. 1997; F urukawa, et a1 1983; Parnell, et a].
2006). However, following removal of simple carbon sources (either artiﬁcially, as in
resting cell conditions, or by natural consumption), PCBs are capable of inducing the
biphenyl pathway (Abramowicz, et al. 1993; Ahmed and Focht 1973; Barriault, et al.
1998; Bedard and Quensen 1995; Bedard, et al. 1986, 1987; Gibson, et a]. 1993; Seeger,
et a1. 1995). Although the effect of carbon source on PCB degradation has been studied
(Billingsley, et al. 1997), details have been limited to overall degradation proﬁles.

Most environmental settings where in situ bioremediation of PCBS by
microorganisms would be most advantageous contain a wide range of naturally-occurring
carbon sources at different concentrations and a varied physiological state of the bacteria.
This investigation focuses on the expression of the biphenyl pathway and several genes

suggested to be co-regulated based on transcriptomic studies from an ecological context

98

Figure 5.1. Regulatory model for the biphenyl pathway in Burkholderia xenovorans

LB400. Adapted from Denef, V.J., 2005.

99

 

 

298835 bougzamm 4....

83:05:. I 298% gamma: mm 0058 c098 03.2w

mgm .5sz:—
EEEEEE. ummoaoi O

‘mmu

c2238. Baéaov Eﬁm

8....

 

 

mam 5sz5 .mcozatomcmﬁ .

 

 

WOO-I-

 

 

 

 

 

 

 

 

Lr
‘

O

0

AV t . 4‘
lo a x O 0 TI...

L
m
m
m
a
o
O
EARS A ES A128 v33 A28 A935 $.48 AEQQACLMANES Amﬁﬂlgl

 

 

Ab Al Al Al

0:
AL

 

 

 

 

 

 

100

of competing carbon sources (succinate, biphenyl and PCBS). Furthermore, we examine
the effect of different physiological states (growth phase) on the biphenyl pathway of

LB400 and resting cell degradation proﬁles.

MATERIALS AND METHODS

Media and growth conditions. Growth curve experiments allowed us to
determine the effects of simple carbon sources and growth phase (carbon starvation) on
the biphenyl pathway in Burkholderia xenovorans LB400. We grew triplicate cultures of
LB400 in 25 ml mineral medium (K1) with combinations of biphenyl (3 g/L), succinate
(1 g/L) and Aroclor 1242 (500 ppm) as described previously (Denef, et al. 2004, Parnell,
et al. 2006). Cultures were grown in 125 ml Wheaton® ﬂasks and incubated on an orbital
shaker (200 rpm) at 30i2°C. A matrix of all conditions tested is displayed in Table 5.1.
The growth rate of LB400 was determined by measuring the maximum slope during
logarithmic growth. Cell cultures were harvested at different growth phases—either mid-
]ogarithmic (ML) or transition to stationary-phase (TP) growth—for further analysis
(Figure 5.2).

For carbon source utilization, LB400 was grown on biphenyl until early
logarithmic growth (OD 0.3 5) and amended with succinate. Following the addition of

succinate, samples were harvested at 5min, 30 min, and 1h for further study.

Degradation of PCBS. Growing cell assays of PCB degradation by LB400 were
measured as described previously (Parnell, et al. 2006) in triplicate by disappearance of

PCBs from succinate cultures harvested at mid-log (ML), late log, and transition to

101

Table 5.1. Treatment matrix of carbon competition (row) and growth phase (column)

involved in this study. Check marks indicate samples harvested for Q-RT-PCR analysis.

 

Carbon Sources ML“ ML+5min ML+30min ML+1h TP°
Biphenyl J J J J J
Biphenyl with Succinate. J J J J
Biphenyl with PCBS J J
Succinate J J
Succinate with PCBs J J
Succinate with Biphenyl J J

 

* Succinate added to culture grown on biphenyl to mid-log phase.

”'ML= Mid-10g phase growth (or) 600 nm 0.30.4)

OTP= Transition to stationary phase growth (OD 600 nm 08-10)

102

n.-.r—-~---n.--~~-—----~—------- on. an...—

  
 
 

Transition to Early Stationary (TP)
0.1 ‘I """"""""""" R ---------------------------------------------

Mid-logarithmic growth (ML)

 

 

0.01 ...............................................................
Time h
0.001 1 , r f I ( )I
0 5 10 15 20 25

Figure 5.2. Diagram demonstrating sample collection points for growth-phase studies.
Mid-logarithmic phase samples (ML) were collected at 03-04 ODboo nm. Early

stationary phase samples (TP) were collected at 0.8-1.0 OD600 nm.

103

stationary phase (TP) (0.4, 0.7 and 1.0 ODboo, respectively). Each PCB-containing
treatment was extracted three times using an equal volume of 1 :1 hexane:acetone solution
by shaking for 30 min. and analyzed by gas chromatography as described previously
(Quensen, et al. 1990). Controls were performed by extraction from uninoculated media.
Percent degradation was calculated as described earlier (Parnell, et a]. 2006).

Resting cell PCB degradation proﬁles by LB400 were determined from cultures
grown on succinate and biphenyl harvested from ML and from TP by centrifugation and
rinsed to remove exogenous carbon. Resting cell assays were measured in triplicate
using traditional methods described previously (Barriault, et al. 1998), except for growth
phase. Each chlorobiphenyl congener used in resting cell assays was at a ﬁnal
concentration of 2 ppm and a control consisting of heat-inactivated cells was run in

parallel.

cDNA preparation. RNAlater (Ambion) was added in a 1:1 ratio to the culture to
protect RNA against degradation. Bacterial cells were harvested by centrifugation at 5000
x g for 10 min at 4 °C. RNA was extracted using RNeasy RNA extraction kit (Qiagen),
and remaining DNA was removed by 30 min incubation at room temperature with 1.5 U
DnaseI/ug nucleic acid (Roche, 10 U/ul). Integrity of RNA and absence of DNA was
veriﬁed by 1.2 % agarose gel electrophoresis. 2 ug of total RNA was incubated
overnight at 45 °C using 6 ug random primers (Invitrogen), and Superscript II reverse
transcriptase (Invitrogen). Puriﬁcation was performed using the QiaQuick PCR
puriﬁcation kit (Qiagen). Total cDNA concentration was determined

spectrophotometrically (Nanodrop® Wilmington, DE).

104

Q-RT-PCR analysis. Primers for bphA, bphD, bth1 and two potential 054
transcripts were designed using Primer Express software (Applied Biosystems, Foster
City, CA). Triplicate Q-RT-PCR runs were performed for bphA, bphD, bth1, and each
054. One ng of cDNA from each condition was utilized in triplicate for 40 cycle, two step
PCR in an ABI 7900HT (Applied Biosystems, Foster City, CA) using SYBR Green
Master Mix (Applied Biosystems, Foster City, CA) and 125 nM of each primer (Table
5.2). Amplicon size (80-100 bps) and reaction speciﬁcity were conﬁrmed by agarose gel
electrophoresis and product dissociation curves. The number of target copies in each
sample was interpolated from its detection threshold (CT) value using a puriﬁed PCR
product standard curve. 168 rRNA expression was measured as internal control, and the
measured internal control signal was used to normalize variations due to different reverse
transcription efﬁciency (Denef, et al. 2004). In addition, Q-RT-PCR of the 0'70 transcript
was used for relative comparison to 054. All conditions were normalized to succinate-

grown cells harvested during ML growth.

RESULTS

Effect of growth phase on PCB degradation. Growing cell assays for PCB degradation

of LB400 with succinate demonstrate a growth phase-dependent shiﬁ to PCB degradation

(Figure 5.3). Early growth (0.4 OD) indicates little degradation of

105

Table 5.2. Primers used for Q-RT-PCR analysis in this study including biphenyl pathway

elements detoxiﬁcation pathway genes sigma-70 and both sigma-54 factors (so = small

chromosome BxeB1172, c = large chromosome BxeA4122).

 

Primer Sequence
bphA-f ggctacgtgggtacaaggc
bphA-r tagccgacgttgccagg
bphD-f cgcactcaccgaaagttctac
bphD-r ttacccgcctcgttgtagtg
bth1-f gtcagttcgtatcaccggc
bth1-r ccactgattgaacaagtgaacc
o7°-f gccagatccaacaggaagc
o7°-r ttccgaacaccgttggagg
oy-sc-f tcgcgaaatatcgtgaagc
054-sc-r cttgcgcaggttgactgcc
cﬁ-c-f tcgcggacagtgtcgatctc
054-c-r accagcaactcgtcttcggtc
CIAc-f atcgccaagattgcgtttac
CIAc-r gtacacacctcgccctgatt
xoxF-f aaggcaggtgaaaccaacac
xoxF-r catacgtcgtcgtcttgtcg
F ae-f aacaaggtcaccatcaaggg
Fae-r ggaccgaacatctgcacc

 

106

Percent degradation

 

 

 

Congener N “'

Figure 5.3. Percent degradation of PCBs during growth on Succinate (y axis). Speciﬁc

PCB congeners degraded (x axis) throughout different growth phases in the growth curve

(2 axis).

107

 

PCBs; primarily degradation consists of congeners with a chlorine-free ring. Although
some degradation of higher chlorinated PCBS are evident in later logarithmic phase (0.7
OD), the greatest amount of PCB degradation occurs as the initial growth substrate is
consumed on transition to stationary phase (1.0 OD) where cells are still growing, but
likely in a state of carbon limitation.

Based on resting cell PCB degradation assays, the most signiﬁcant change in
degradation proﬁle was revealed in LB400 harvested from TP biphenyl-grown cells. The
increased degradation was generally observed for di-para substituted PCBS (Table 5.3).
Ortho substituted congeners appear readily degraded on removal of exogenous carbon
consistent with growing cell data while highly chlorinated para-substituted congeners

such as 2,4,6,2’4’6’-hexachlorobiphenyl show no indication of degradation.

Transcriptional profile comparison. Using genome-wide expression data from
earlier studies (Denef, et al. 2004; Parnell, et al. 2006), a comparison of the gene
expression patterns from biphenyl transition-phase and degradation of PCBS during
growth on biphenyl indicate the induction of several common genes and pathways
(Figure 5.4). Of the 114 genes up-regulated during PCB degradation (ML growth on
biphenyl with PCBs) with reference to succinate ML, 49 (43%) were also induced during
TP growth on biphenyl. Of the 49 genes commonly induced during PCB degradation and
TP growth on biphenyl, 25 were unique relative to biphenyl ML growth (Table 5.4),
including several genes involved in C. degradation and a putative chloroacetaldehyde

dehydrogenase. Several of the genes induced with

108

 

Table 5.3. Percent degradation of PCB congeners from resting cell assays of LB400

harvested during exponential-phase (ML) growth and transition into stationary-phase

 

(TP).

PCB Succinate Succinate Biphenyl Biphenyl
Congener ML TP ML TP
23- 100 95 100 100
2-4- 100 100 100 100
2-2- 1 00 98 100 100
4-4- 1 1 1 ND 44
24-4- 24 3 1 3 85
25-2- 100 97 100 100
25-4- 100 95 100 100
25-25- 100 100 100 99
23-25- 1 00 99 98 99
23-23- 98 97 99 96
24-24- 2 ND 24 89
25-34- 91 85 96 100
24-34- 1 1 3 ND 55
34-34- ND ND ND 8
245-23- 21 5 1 61
245-245- ND ND ND 29
246-246- ND ND ND ND
245-25- 85 80 91 98
234-25- 46 23 45 95
245-245- 7 3 4 33

 

ND- No degradation detected

109

 

 

Figure 5.4. Venn diagram of up-regulated genes from Burkholderia xenovorans LB400
grown on biphenyl (A) harvested during ML growth, (B) harvested during TP growth,
and (C) grown with biphenyl and 500 ppm Aroclor 1242 and harvested during ML
growth (all relative to succinate ML growth). Bold indicates genes induced during

conditions most favorable for PCB degradation.

110

Table 5.4. Genes identiﬁed through genome-wide microarray analyses commonly
induced during growth on biphenyl transition to stationary-phase (TP) and exposure to
PCBS during mid-log (ML PCBs) divergent from genes induced during growth on
biphenyl alone (ML). Highlighted genes indicate previously identiﬁed detoxiﬁcation
pathways that may be involved in PCB degradation.

3 Expression ratio is reported relative to LB400 grown on succinate and harvested during
ML growth.

b Data from Parnell, et al. 2006.

c Data from Denef, et al. 2004.

c Formaldehyde detoxiﬁcation pathway characterized by Marx, et al. 2004.

111

 

Expression Ratioa

 

Associated ML
Gene ID Annotation Function MLc PCBS” TP°

Hemerythrin-like metal

BxeCO962 binding protein Unknown 1.6 2.5 5.3
(BphJ) Semialdehyde

BxeC1188 dehydrogenase Biphenyl Pathway 1.8 2.2 6
Putative transport-

BxeB1679 associated protein Unknown 1.5 2.8 12.9
anJ-Iike solute Formaldenyde

Bxeez425 binding protein Detoxiﬁcation" 1.4 2.3 12
Cytochrome c-555 Formaldenyde

Bxe82426 precursor Detoxification 1 4.8 42.3
(XoxF) Methanol
dehydrogenase-like Formaldenyde

Bxe82427 protein Detoxification 0.9 8 47.1
(Fae) Formaldehyde Formaldenyde

Bxe32436 activating enzyme Detoxification 1.3 20.7 160.3
Conserved hypothetical Formaldenyde

Bxe82437 protein Detoxification 1.1 5.8 66.8
Coenzyme PQQ Formaldenyde

Bxe32470 synthesis protein E Detoxification 1.2 2.2 7
TonB-dependent Formaldenyde

BxeBZ473 receptor precursor Detoxification 0.9 2.8 14.8
Conserved hypothetical Formaldenyde

Bxe82474 protein Detoxification 0.9 3 22
Coenzyme PQQ Formaldenyde

BxeBZ469 synthesis protein D Detoxification 1.1 2.6 9.7
Conserved hypothetical

BxeA0355 protein Unknown 1.1 2.1 5.9

BxeA1028 Putative exported protein Unknown 2 2.7 4
Chloromuconate Chlorobenzoate

BxeA1129 cycloisomerase Degradation 1 2.6 2.2
Chlorocatechol 1,2- Chlorobenzoate

BxeA1130 dioxygenase Degradation 1.1 3.1 4.6
Putative sugar ABC
transport, substrate-

BxeA1629 binding protein Unknown 1.8 6.7 2.3
Putative Cyd operon

BxeA1994 protein ngT Unknown 1.3 2.2 2.3

BxeA2773 Regulatory protein, TetR Unknown 1.6 2.6 4.3
Putative peptidase A24A,

BxeA2801 prepilin type IV precursor Unknown 1.7 2.1 3.8
Conserved hypothetical

BxeA2944 protein Unknown 1.4 2.6 2.9
Putative membrane

BxeA3322 protein Unknown 1.8 2.2 2.7
(Chloro)actetaldehyde Chloroacetaldehy

BxeA4441 dehydrogenase de Detoxification 1.8 8.1 34.3
Conserved hypothetical Chloroacetaldehy

BxeA4442 protein de Detoxiﬁcation 1 2.2 7.3
Conserved hypothetical

BxeA4478 protein Unknown 1.2 3.5 39.1

 

112

 

PCB degradation and TP biphenyl-grown conditions were hypothesized regulated by 0'54

(Denef, et al. 2004).

Q-RT-PCR expression analysis. Samples harvested from various points along
the growth curve give a representation of the induction of the biphenyl pathway
according to carbon source competition as well as growth stage. During growth on
succinate with PCBS, the bphA and bphD are down-regulated compared to growth on
succinate alone (0.6i0.2 and O.3i0.2, respectively). LB400 grown with succinate and
biphenyl concurrently demonstrate an increased expression in the biphenyl pathway as
compared to succinate alone during both ML- and TP-growth as bphA expression is
4.3:18- and 9.7i1.8-fold increased and bphD is 2.8i1.7- and 4.0i2.l-fold increased
(Table 5.5).

Regression analysis of the expression patterns gives an indication of the
association of different genes with carbon source and growth phase. As expected, the
biphenyl pathway elements (bphA, bphD and bth 1) are all statistically correlated. In
addition, 0'70, the 0'54 located on the chromosome (654C) and the putative
chloroacetaldehyde dehydrogenase gene (ClAc) are correlated with the biphenyl pathway

(Table 5.6).

Carbon source competition. Growth rates of LB400 on a combination of carbon
sources indicate primary substrate utilization. Maximum growth rates were calculated

for growth on succinate (0.42i0.03 cell divisions/h), succinate and biphenyl (0.41:0.02

cell divisions/h), succinate and PCBS (0.42i0.05 cell

113

Table 5.5. Expression values from quantitative RT-PCR analysis demonstrating the
effect of different carbon sources [succinate (Succ), biphenyl (Bph), and polychlorinated
biphenyls (PCB)] and different growth phases [Mid-Logarithmic (ML) and Transition to
stationary-phase (TP)] on biphenyl pathway components, regulatory elements, and
detoxiﬁcation genes potentially involved in biphenyl degradation. Expression values are
reported relative to succinate-grown Burkholderia xenovorans LB400 harvested from

mid-logarithmic growth (Succ ML).

114

 

 

33% can; N. 84:: Show n. can non: emcee 38.8 344.: E. mom in
«98% non}. canoe not... a. 2,3 eon; Eon: N.,..nosm 3.4.8 ..2 moo 8m
3:88 2434; 8.34.8 «on; non: Shem Zoo. : canton 38.9 5...: Em
0339. o. so.» when: eon: o. recto. eons.” $8.2 $8.8 38.9 528...: Em
838 28o n. 3% gonna 8.48.0 Show 38.: 34.8 34.3 $552 5m
4. :8. a wooed 543 33... 3.3.0 eon? 3&8 cacao m. :3 £35. 8.6 8m
4.28.8 8.08.0 cocoa 38.0 «on; no”? eonmo Eco: wont... eeomjz 8.6 8m
023:. 4.03.0 0. $3 388 «on? 34.3 e. :3.» «$0.8 .842: 5.532 85 8m
No.43. ease 33.2 Shea 8.9.3 «on? 4. sec 33... a. $3 n: 8m 8.6
38.2 e. We.” o. :2 38.0 38.. non: h. 3.4 e. :3 a. $3. ...2 Em 8:8
Rome 0. snow owns nonoo nonno can? «.043 can: 0. $2.. ...: moo 8%
no“? no»? 38.0 Nonno 4.043 343 ton: Noon... .338 ...2 mon 83m
wooed «on? «some no.3 4.9.3 o. in. 3.6.0 .... $3 0. en? E 83w
930 $2 eon cs c 8.. e 2e “$8 053 38 scene:

115

Table 5.6. Correlation matrix of R2 values from regression analysis of the expression of
components of the biphenyl pathway, its potential regulators, and detoxiﬁcation pathway
genes possibly associated with biphenyl degradation in Burkholderia xenovorans LB400.
Quantitative RT-PCR expression data were converted to Logz values prior to regression
analysis. Signiﬁcant p-values (<0.05) are bold.

bphA bphD bth1 o7“ o5‘sc 054C Fae xoxF ClAc

 

bphA - 0.84 0.84 0.48 0.25 0.36 0.30 0.27 0.85
bphD - 0.77 0.44 0.20 0.30 0.31 0.19 0.82
bth1 - 0.58 0.25 0.27 0.23 0.26 0.84
cm - 0.33 0.06 0.02 0.08 0.55
6 54so - 0.16 0.02 0.36 0.22
o 54c - 0.46 0.54 0.21
Fae - 0.57 0.60
xoxF - 0.19

116

 

divisions/h), biphenyl (0.221.001 cell divisions/h), and biphenyl with PCBS (0.20i0.02
cell divisions/h). In addition, the growth rate of LB400 grown on biphenyl to ML
following the addition of succinate was calculated (0.37i0.02 cell divisions/h) (Figure
5.5).

Within 5min of addition of succinate to biphenyl-grown culture during ML phase,
the expression of bphD decreases signiﬁcantly (from 32.31-25- to 20.0:4.2-fold
induction relative to succinate ML). Similarly, bthI expression decreases signiﬁcantly
(from 14.5i0.5- to 8.9i1.6-fold induction) within 5 min of succinate addition. The
expression level of bphA does not show signiﬁcant decrease until within 30 min of

succinate addition (1 2.5i5.5- to 5.6i0.2-fold induction) (Figure 5.6).

DISCUSSION

This study places (polychlorinated) biphenyl degradation in a context relevant to
environmental scenarios by studying factors such as carbon source competition and
growth phase effects on expression of the biphenyl pathway in LB400. Billingsley, et al.
(1997) reported that LB400 conditioned to biphenyl growth results in more efﬁcient PCB
degradation than LB400 grown on other sources (Billingsley, et a]. 1997). These results
are somewhat expected as the physiological state of LB400 grown on biphenyl is more
comparable to PCB-degrading conditions. As co-metabolism of PCBS relies on removal
of all exogenous carbon, energy becomes a limiting factor and dynamic changes in gene
expression patterns (such as a switch from a dissimilar growth substrate like succinate)

require energy that could otherwise be allocated to PCB degradation.

117

 

Succinate added

‘ \
W—t

 

 

 

S
\
‘\\
\

OD (600nm)

— -Succinate

- - -Succinate Biphenyl
Succinate PCBs
— - - Biphenyl

- _ Biphenyl Succinate
- - - - Biphenyl PCBS

 

 

 

T I I

20 25 30

 

Figure 5.5. Growth curves of Burkholderia xenovorans LB400 grown with succinate
(1. g/L), biphenyl (3 g/L) and PCBS (500 ppm v:v Aroclor 1242) in K1 mineral medium.

Succinate was added to biphenyl-grown culture during mid-logarithmic growth.

118

 

Figure 5.6. Expression of genes (bphA and bphD) and the regulator (bthI) involved in
the biphenyl degradation pathway relative to succinate mid-log growth (columns) and
growth curves (ODéoonm) of LB400 grown on biphenyl to mid-log growth (blue) and
amended with succinate (green) (lines). Data collected at 0 min (A), 5 min (B), 30 min

(C) and 1h (D) following addition of succinate.

119

EV o5:

 

  
    

 

 

 

 

 

 

 

 

        

 

N3 2. 9: Qt. 4.5. «.5 5 mg.
. h a n P P - N.o
Eeom <ﬁm oﬁm o 528 <58 93m Eﬁm Sam oﬁm
o
2 2
. md
...occnuA-nuio.-ou Iona... ON ......o.-c ON
on ...vrnnnucn.con-.....ocue: on
Ilal-Oﬁllll-I’ll-.IlOlhﬁll-onnon 0v
............................... . v.0
om
r m.o
\ 4
x .4 social . o o
R \ \ umucoEm 99:85 .01 ...... — ov
............ on
e 3

 

(wu 009 GO) Misuep Ieoudo

120

The effect of energy availability on PCB degradation was demonstrated by Kohler, et a].
(1988) by comparing growing cell assays with resting cell assays (both grown on
biphenyl). Not only did they ﬁnd an increase in the magnitude of PCB degradation, but
the range of congeners degraded also increased in growing cells (Kohler, et al. 1988).
They concluded that PCB degradation during growth on biphenyl affords more
physiological stability leading to more active cells (Kohler, et al. 1988). Similarly,
resting cell assays presented here of cells harvested from different carbon sources
(succinate and biphenyl) and growth phases (ML and TP) demonstrate a physiologically-
mediated range in PCB degradation (Table 5.2). These ﬁndings in conjunction with
recent genomic (Denef, et a]. 2004, Parnell, et al. 2006) and proteomic analyses (Denef,
et al. 2005) suggest the activation of mechanisms beyond the biphenyl pathway that
provide stability to LB400 and improve PCB degradation during TP growth on biphenyl.
Transcriptional analysis of active PCB degradation (during growth on biphenyl)
and of TP biphenyl cells (condition harvested for resting cells that included greatest PCB
degradation) identiﬁed 25 potential genes involved in efﬁcient degradation of PCBS
(Table 5.3). Many of those genes such as motility-associated genes (Jagannathan, et a].
200]) oxygen scavenging and C. pathway genes are potentially subject to regulation by
054 (Denef, et al. 2004). In addition, two pathways induced during PCB degradation and
biphenyl TP growth have potential for detoxiﬁcation of damaging compounds. Marx, et
a] (2004) identiﬁed the C1 pathway in LB400 as responsible for removal of formaldehyde
(27). Additionally, chloroacetaldehyde dehydrogenase may eliminate toxic products of
incomplete PCB degradation (Parnell, et a1. 2006). Induction of these pathways prior to

exposure to increased levels of forrnaldehyde- or chloroacetaldehyde-like compounds

12]

 

would impart an enormous advantage toward physiological stability of resting cell
conditions and improve PCB degradation.

In order to determine the association of both of the 054 factor homologs in LB400
and the chloroacetaldehyde and formaldehyde degradation pathways with biphenyl
degradation, we examined expression of these pathways across a range of carbon sources
and growth phases. Of the two 0'54 homologs in LB400, one (BxeB1172) is located on
the small chromosome (0‘54SC) while the other (BxeA4122) is found on the large
chromosome (654C); only the 654C was found in an operon structure similar to previous
documentation (Powell, et al. 1995). Regression analysis of the expression patterns
indicate that the expression of 070, the (554C, and the chloroacetaldehyde dehydrogenase
are all signiﬁcantly correlated to expression of the biphenyl pathway. Conversely, the
expression of elements of the C1 pathway (XoxF and Fae) is not strongly correlated to the
induction of biphenyl pathway genes, although Fae and bphD expression is signiﬁcant
(Table 5.6).

Despite previous studies indicating that the biphenyl pathway (degradation of
PCBS) is not induced (and possibly repressed) during growth on simple carbon
compounds (Billinglsley, et a]. 1997, Denef, et al. 2004, 2005; Furukawa, et a]. 1983;
Parnell, et al. 2006), information on the effect of simple carbon sources on the induction
of the biphenyl pathway is cursory. Carbon source utilization analysis indicates that
despite an extended lag phase for adaptation, the eventual maximum growth rate for
LB400 grown on both succinate and biphenyl is identical to growth on succinate alone.
Addition of succinate to biphenyl-grown ML cultures changes the growth rate of LB400

from biphenyl- to succinate-like growth rates, suggesting a switch to succinate as carbon

122

 

source and possible catabolite repression (Figure 5.6). In addition, compared to biphenyl
treatments, the expression of bphD and bth1 in succinate amended treatments declines
signiﬁcantly (within 5 min). By 30 minutes, expression of bphA has decreased
signiﬁcantly in succinate amended treatments (Figure 5.6). By 1h (Bph Succ ML+1h),
the expression level of all three components of the biphenyl pathway examined have
diminished to levels similar to succinate with biphenyl (Succ Bph ES) (Table 5.6). This
information indicates that succinate does play a role in repression or inactivation of the Ll

biphenyl pathway. Additional evidence presented in this study, in effect suggests that

 

arr-Lu,

PCB degradation does not occur during growth on succinate until transition to stationary-

‘1

phase growth where succinate becomes limited (Figure 5.3).

On the surface, this evidence appears to contradict previous work by Master and
Mohn (2001) indicating constitutive expression of the biphenyl pathway in LB400 during
growth on simple carbon sources (Master and Mohn, 2001). However, this study clariﬁes
this paradox by evaluating the expression of the biphenyl pathway during growth on
multiple carbon compounds and during different physiological states using Q-RT-PCR
analysis. Q-RT-PCR analyses indicate that genes in the biphenyl pathway (bphA, bphD
and bth1) are induced during growth on succinate with biphenyl (Table 5.5) as
compared to succinate only. In addition, during growth on succinate with PCBS, the
biphenyl pathway is down-regulated indicating some level of expression of the biphenyl
pathway during growth on succinate and repression of the biphenyl pathway by PCBS.
Although the biphenyl pathway is expressed during growth on simpler carbon
compounds such as succinate, little degradation occurs. This data suggests additional

elements possibly involved post-transcriptional regulation or that the active transport of

123

 

biphenyl in LB400 as reported by Master, et al. (2005) play a more crucial role in
biphenyl degradation than previously thought (Master, et al. 2005).

This work has shown for the ﬁrst time a repression of the biphenyl pathway in
LB400 by PCBS during growth with a simple carbon source such as succinate. As many
environmental sites contaminated with PCBS contain a range of carbon sources, this
becomes an important concern for in situ PCB degradation. Furthermore, although
biphenyl appears not to be utilized during growth on succinate with biphenyl, the
biphenyl pathway is expressed, suggesting post-transcriptional regulation or active
transport involved in biphenyl degradation (Master, et a]. 2005). While LB400 has two
054 factor homologs (0'54SC and 654C), only the (554C is associated with expression of the
biphenyl pathway. Additionally, the expression of the chloroacetaldehyde
dehydrogenase correlates to expression of the biphenyl pathway in LB400, suggesting
peripheral involvement of the chloroacetaldehyde dehydrogenase in biphenyl (and PCB)
degradation. This work identiﬁes genes associated with the biphenyl pathway in
imparting stability to LB400 during PCB degradation and ﬁlls a gap in the knowledge of
the activation of the biphenyl pathway under competing carbon sources and the effect

PCBS may have on the biphenyl pathway in environmental scenarios.

124

REFERENCES

Abramowicz, D.A., M.J. Brennan, H.M. Van Dort, and F.L. Gallagher. 1993.
Factors inﬂuencing the rate of polychlorinated biphenyl degradation in Hudson
River sediments. Environ. Sci. Technol. 27 :1 125—1 131

Ahmed M., and D.D. Focht. 1973. Degradation of polychlorinated biphenyls by
two species of Achromobacter. Can. J. Microbiol. 19:47—52.

Barriault, D., J. Durand, H. Maarouﬁ, L.D. Eltis, and M. Sylvestre. 1998.
Degradation of polychlorinated biphenyl metabolites by naphthalene-catabolizing
enzymes. Appl. Environ. Microbiol. 64:4637-4642.

Bedard, D. L., and J. F. Quensen, III. 1995. Microbial reductive dechlorination
of polychlorinated biphenyls, p. 127-216. In L. Y. Young, and C. Cemiglia (ed.),
Microbial transformation and degradation of toxic organic chemicals. Wiley-Liss
Division, John Wiley & Sons, Inc., New York, NY.

Bedard, D.L., M.L. Haberl, R.J. May, and M.J. Brennan. 1987. Evidence for
novel mechanisms of polychlorinated biphenyl metabolism in Alcaligenes
eutrophus H850. Appl. Environ. Microbiol. 53:1 103-11 12.

Bedard, D.L., R. Unterman, L.H. Bopp, M.J. Brennan, M.L. Haber], and C.
Johnson. 1986. Rapid assay for screening and characterizing microorganisms for

the ability to degrade polychlorinated biphenyls. Appl. Environ. Microbiol.
51:761—768.

Beltrametti, F., D. Reniero, S. Backhaus, and B. Hofer. 2001. Analysis of
transcription of the bph locus of Burkholderia sp. strain LB400 and evidence that

the ORFO gene product acts as a regulator of the bphA] promotor. Microbiology
147: 2169-2182.

Billingsley K A, Backus S M, Juneson C, Ward 0 P. 1997. Comparison of the
degradation patterns of polychlorinated biphenyl congeners in Aroclors by

Pseudomonas strain LB400 after growth on various carbon sources. Can. J.
Microbiol. 43:1 172—] 179.

Bopp L H. Degradation of highly chlorinated PCBs by Pseudomonas strain
LB400. J. Ind. Microbiol. 1986;1123—29.

Cases, 1., and V. dc Lorenzo. 2000. Genetic evidence of distinct physiological

regulation mechanisms in the 0'54 Pu promoter of Pseudomonas putida. J.
Bacteriol. 182:956-960.

125

Cases, 1., J. Perez-Martin, and V. dc Lorenzo. 1996. Involvement of 054 in

exponential silencing of the Pseudomonas putida TOL plasmid Pu promoter.
Mol. Microbiol. 19:7-17.

Chain, P.S.G., V.J. Denef, K. Konstantinidis, L.M. Vergez, L. Agullé, V.L.
Reyes, L. Hauser, M. Cérdova, L. Gomez, M. Gonzalez, M. Land, V. Lao, F.
Larimer, J.J. LiPuma, E. Mahenthiralingam, S.A. Malfatti, C.J. Marx, J.J.
Parnell, A. Ramette, P. Richardson, M. Seeger, D. Smith, T. Spilker, W-J.
Su], T.V. Tsoi, L.E. Ulrich, I.B. Zhulin, J.M. Tiedje. 2006. Burkholderia
xenovorans LB400 harbors a multi-replicon, 9.7 M bp genome shaped for
versatility. Proc. Nat]. Acad. Sci. 103:15280-15287.

Denef, V.J., J. Park, T.V. Tsoi, J.-M. Rouillard, H. Zhang, J.A.
Wibbenmeyer, W. Verstraete, E. Gulari, S.A. Hashsham, and J.M. Tiedje.
2004. Biphenyl and benzoate metabolism in a genomic context: Outlining
genome-wide metabolic networks in Burkholderia xenovorans LB400. Appl.

Environ. Microbiol. 70:4961-4970.

Denef, V.J. M.A. Patrauchan, C. Florizone, J. Park, T.V. Tsoi, W. Verstraete,
J.M.Tiedje, and L.D. Eltis. 2005. Growth substrate- and phase-speciﬁc

expression of biphenyl, benzoate, and C. metabolic pathways in Burkholderia
xenovorans LB400. J. Bacteriol. 187:7996-8005.

Denef, V.J. 2005. A functional genomics approach to elucidate the biphenyl and
benzoate metabolic network integration in Burkholderia xenovorans LB400.
Dissertation in Applied and Biological Sciences. Faculty of bioscience
engineering, Universiteit Gent.

Ehrt, S., L. N. Omston, and W. Hillen. I994. RpoN (054) is required for
conversion of phenol to catechol in A cinetobacter calcoaceticus. J. Bacteriol.
176:3493-3499.

Erickson, B. D., and F. J. Mondello. 1993. Enhanced biodegradation of
polychlorinated biphenyls after site—directed mutagenesis of a biphenyl
dioxygenase gene. Appl. Environ. Microbiol. 59:3858-3 862.

Furukawa, K. J.R. Simon, and A.M. Chakrabarty. 1983. Common Induction
and regulation of biphenyl, xylene/toluene, and salicylate catabolism in
Pseudomonas paucimobilis. J. Bacteriol. 154:1356-1362.

Gibson, D. T., D. L. Cruden, J. D. Haddock, G. J. Zylstra, and J. M. Brand.
1993. Oxidation of polychlorinated biphenyls by Pseudomonas sp. strain LB400
and Pseudomonas pseudoalcaligenes KF707. J. Bacteriol. 175:4561-4564.

Goris, J., P. De Vos, J. Caballero-Mellado, J. Park, E. Falsen, J.F. Quensen
III, J.M. Tiedje, and P. Vandamme. 2004. Classiﬁcation of the PCB-and

126

biphenyl degrading strain LB400 and relatives as Burkholderia xenovorans sp.
nov. Int J Syst Evol Microbi015421677-1681.

Hernandez, B. S., J. J. Arensdorf, and D. D. Focht. 1995. Catabolic
characteristics of biphenyl-utilizing isolates which cometabolize PCBS.
Biodegradation 6:75-82.

Hugouvieux-Cotte-Pattat, N., T. Kohler, M. Rekik, and S. Harayama. 1990.
Growth-phase-dependent expression of the Pseudomonas putida TOL plasmid
pWWO catabolic genes. J. Bacteriol. 172:6651-6660.

Jagannathan, A., C. Coinstantinidou, and C. W. Penn. 2001. Roles of rpoN,
ﬂiA, and ﬂgR in expression of ﬂagella in Campylobacterjejuni. J. Bacteriol.
183:2937-2942.

Kim, Y., L.S. Watrud, and A. Matin. 1995. A carbon starvation survival gene
of Pseudomonas putida is regulated by 054. J. Bacteriol. 177: 1 850-1 859.

Kohler, H.-P.E., D. Kohler—Staub, and D.D. Focht. 1988. Cometabolism of
polychlorinated biphenyls: Enhanced transformation of Aroclor 1254 by growing
bacterial cells. Appl. Environ. Microbiol. 54:1940-1945.

Maltseva, O.V., T.V. Tsoi, J.F. Quensen III, M. Fukuda, and J.M. Tiedje.
1999. Degradation of anaerobic reductive dechlorination products of Aroclor
1242 by four aerobic bacteria. Biodegradation. 10:363-371.

Marx, C.J., J.A. Miller, L. Chistoserdova, and ME. Lidstrom. 2004.
Multiple formaldehyde oxidation/detoxiﬁcation pathways in Burkholderia
fungorum LB400. J. Bacteriol. 186:2173-2178.

Master, ER, and W.W. Mohn. 2001. Induction of bphA, encoding biphenyl
dioxygenase, in two polychlorinated biphenyl-degrading bacteria, psychrotolerant

Pseudomonasstrain Cam-1 and mesophilic Burkholderia strain LB400. Appl.
Environ. Microbiol. 67: 2669-2676.

Master, E.R., J.J. McKinlay, G.R. Stewart, and W.W. Mohn. 2005. Biphenyl
uptake by psychrotolerant Pseudomonas sp. strain Cam-1 and mesophilic
Burkholderia sp. strain LB400. Can. J. Microbiol. 51:399—404.

Merrick, M.J., and W.D.P. Stewart. 1985. Studies on the regulation and
function of the Klebsiella pneumoniae ntrA gene. Gene. 35:297-303.

Mondello, F.J., M.P. Turcich, J.H. Lobos, and B.D. Erickson. 1997.
Identiﬁcation and modiﬁcation of biphenyl dioxygenase sequences that determine

the speciﬁcity of polychlorinated biphenyl degradation. Appl. Environ. Microbiol.
63: 3096-3103.

127

Mouz, S., C. Merlin, D. Springael, and A. Toussaint. 1999. A GntR-like
negative regulator of the biphenyl degradation genes of the transposon Tn4371.
Mol. Gen. Genet. 262:790-799.

Mouz, S., E. Coursange, and A. Toussaint. 2001. Ralstonia metallidurans
CH34 RpoN sigma factor and the control of nitrogen metabolism and biphenyl
utilization. Microbiology 147:1947-1954.

Ohtsubo, Y., T. Kudo, M. Tsuda, and Y. Nagata. 2004. Strategies for
bioremediation of polychlorinated biphenyls. Appl. Microbiol. Biotechnol.
65:250-258.

Ohtsubo, Y., Y. Nagata, K. Kimbara, M. Takagi, M., and A. Ohta. 2000.
Expression of the bph genes involved in biphenyl/PCB degradation in
Pseudomonas sp KKSIO2 induced by the biphenyl degradation intermediate, 2-
hydroxy-6-oxo-6-phenylhexa-2,4-dienoic acid. Gene 256: 223-228.

Parnell, J.J., J. Park, V. Denef, T. Tsoi, S. Hashsham, J. Quensen III, and
J.M. Tiedje. 2006. Coping with PCB toxicity: The physiological and genome-
wide response of Burkholderia xenovorans LB400 to PCB (polychlorinated
biphenyl)-mediated stress. Appl. Environ. Microbiol. 72:6607-6614.

Powell, B.S., D.L. Court, T. Inada, Y. Nakamura, V. Michotey, X. Cui, A.
Reizer, M.H. Saier Jr., and J Reizer. 1995. Novel proteins of the
phosphotransferase system encoded within the rpoN operon of E. coli. Enzyme

IIANtr affects growth on organic nitrogen and the conditional lethality of an erats
mutant. J. Biol. Chem. 270:4822-4839

Quensen, J.F., III, S.A. Boyd and J.M. Tiedje. 1990. Dechlorination of four
commercial polychlorinated biphenyl mixtures (Aroclors) by anaerobic
microorganisms from sediments. Appl. Environ. Microbiol. 56:2360-2369.

Seeger, M., K.N. Timmis, and B. Hofer. 1995. Conversion of chlorobiphenyls
into phenylhexadienoates and benzoates by the enzymes of the upper pathway for
polychlorobiphenyl degradation encoded by the bph locus of Pseudomonas sp.
strain LB400. Appl. Environ. Microbiol. 61:2654—2658.

Sze, C.C., T. Moore, and V. Shingler. 1996. Growth-phase dependent
transcription of the 054-dependent Po promoter controlling the Pseudomonas-
derived (methyl)phenol dmp operon of pV1150. J. Bacteriol. 178:3727-3735.

Watanabe, T., H. Fujihara, and K. F urukawa. 2003. Characterization of the

second Lythype regulator in the biphenyl-catabolic gene cluster of Pseudomonas
pseudoalcaligenes KF707. J. Bacteriol. 185: 3575-3582.

128

CHAPTER 6.
ACCUMULATION AND DETOXIFICATION OF F ORMALDEHYDE IN
Burkolderia xenovorans LB400 DURING (POLYCHLORINATED) BIPHENYL

DEGRADATION.

ABSTRACT

The biphenyl pathway responsible for the degradation of polychlorinated
biphenyls has been well-documented over the past few decades including enzymes and
metabolic products. Induction of Cl pathway genes in Burkholderia xenovorans LB400
during growth on biphenyl and PCB degradation prompted this study to examine the
metabolic footprint of biphenyl and PCB degradation. 1 analyzed low molecular-weight
aldehydes that accumulate during growth on biphenyl and degradation of PCBs for
LB400 wild type and two knockout mutations of the C1 pathway (LB400Ax0xF and
LB400AflhA fdhA mtdB). I found an accumulation of formaldehyde on degradation of
biphenyl and PCBs that is diminished with expression of the C1 pathway. In addition, I
found that XoxF is responsible for the accumulation of formaldehyde. This work is the
ﬁrst to associate formaldehyde accumulation with the degradation of biphenyl. Although
the source of formaldehyde (substrate for XoxF) is unknown, the role of the C1 pathway

in LB400 is clear.

129

INTRODUCTION

Over the past thirty years, Burkholderia xenovorans LB400 has been extensively
studied due to the wide range of polychlorinated biphenyl (PCB) congeners degraded via
the biphenyl pathway (Bopp 1986, Ericson and Mondello 1992). Nonetheless, most of
the studies of LB400 had been reductionist in nature, focused primarily on the biphenyl
pathway. Completion of the genome sequence reveals a diverse network of often
redundant metabolic pathways that provide clues to ecological niches and function
(Chain, et a]. 2006). Recently, several studies have expanded beyond the scope of the
biphenyl pathway describing functional redundancy of benzoate (Denef 2004, 2005,
2006) and C. degradation pathways (Marx 2004). However the explicit role of many of
these pathways in an ecological context and in PCB degradation remains unclear.

Earlier studies focusing on the ecology of PCB degradation indicate a relationship
between methylotrophy and PCB degraders, however details with regards to this
relationship are lacking. Recent whole genome expression studies by Denef, et al. (2004)
indicate a signiﬁcant induction of the C. pathway during growth on biphenyl as LB400
transitions into stationary phase. F ollow-up studies indicate that some of the C. genes
may be induced due to the formation of formate on degradation of benzoate via CoA
oxidation (Denef, et al. 2005; Zaar, et al. 2001, 2004), though they also point out that
formate detoxiﬁcation genes are only a subset of the C. genes induced in transition phase
(Denef, et al. 2004). Additionally, the C. pathway is induced during degradation of PCBs
with no evidence of up-regulation of CoA oxidation genes (Parnell, et al. 2006); the C.

genes are independent of benzoate CoA during degradation of PCBS.

130

Although the C. utilization pathway in LB400 is homologous to that of the well-
studied methanol-degrading Methylobacterium extorquens AM-l (Amaratunga, et al.
1997), LB400 is incapable of growth on methanol or other C. compounds (Marx, et al.
2004), possibly a result of an incomplete methanol dehydrogenase. While Marx et al.
(2004) establish the C. pathway in LB400 as formaldehyde detoxiﬁcation involved in
choline degradation (Figure 1), other work has demonstrated the formation of
formaldehyde in other Burkholderia during growth on methylated aromatic compounds
(Singer, et a1. 2003); however, the presence of these compounds, and hence induction of
the C. pathway is not expected in either biphenyl or PCB degradation.

In this study I use metabolic footprinting (metabolomics) to place the C. pathway
of LB400 in an ecological context in PCB degradation (Kell, et a]. 2005). I examine the
metabolic proﬁle of simple carbon compounds on deletion of key genes involved in the

C. pathway (Marx, et a]. 2004).
MATERIALS AND METHODS

Bacterial strains and growth conditions. Throughout this study I used three
strains of Burkholderia xenovorans LB400: LB400 wild type (wt), LB400Ax0xF, and
LB400AﬂhA fdhA mtdB (Marx, et a]. 2004). Growth curve experiments allowed us to
determine the effects of the C. pathway on the degradation of biphenyl and PCBS. I grew
triplicate cultures of LB400 in 25 ml mineral medium (K1) and biphenyl (3 g/L) with and
without Aroclor 1242 (500 ppm) as described previously (Denef, et a]. 2004; Parnell, et
a]. 2006). Cultures were grown in 125 ml Wheaton® ﬂasks and incubated on an orbital

shaker (200 rpm) at 30i2°C.

131

Metabolic fingerprinting. Aliquots (5 ml) were harvested in triplicate from
biphenyl mid-logarithmic phase (OD 600 nm 0.4) and early stationary phase growth (OD
600 nm 0.8) for treatments with and without PCBs. Each aliquot was ﬁltered through a
0.22 micron ﬁlter (Microcon) preparatory for LC-MS analysis. In order to detect

aldehydes, samples were derivitized prior to LC-MS injection.

RESULTS
Growth effects of C. pathway knockouts. In order to determine the effects of
the C. pathway knockouts on growth of LB400 on biphenyl with and without PCBS, I
analyzed the growth curves and compared with LB400wt. I found no difference in
growth rate, indicating no fatal phenotypes and that the C. pathway is not essential to

LB400 during growth on biphenyl or PCBs.

Metabolic fingerprint of LB400wt, LB400AxoxF, and LB400AﬂhAfdhA
mtdB. The metabolic proﬁle of all three LB400 strains was analyzed with particular
focus on low molecular weight aldehydes that accumulate during biphenyl and PCB
degradation. The retention time for modiﬁed formaldehyde was calculated at
approximately 1.34 min. LB400wt harvested from mid-logarithmic (ML) phase growth
exhibited increased levels of formaldehyde. In addition, biphenyl grown ML LB400wt
with PCBS shows slight elevation in formaldehyde, as does LB400wt early stationary-
phase (TP) growth (Figure 6.2). The triple knockout of all three redundant formaldehyde
detoxiﬁcation pathways (LB400AﬂhA fdhA mIdB) harvested from transition to stationary

phase (TP) growth indicated little, if any accumulation of formaldehyde. However,

132

LB400AfIhA fdhA mta'B harvested from ML phase with PCBS indicates an accumulation
of formaldehyde (Figure 6.3). Finally, LB400Ax0xF revealed no accumulation of

formaldehyde harvested from transition to stationary phase (TP) growth or from ML

phase with PCBS.

DISCUSSION

The role of the C. pathway proven enigmatic in LB400 as it is unable to grow on
simple carbon compounds like homolog-bearing Methylobacterium extorquens AM-l
(Amaratunga, et a]. 1997; Marx, et al. 2004). The role has become increasingly bafﬂing
as components are highly expressed in both biphenyl (Denef, et al. 2004) and PCB
degradation (Parnell, et al. 2006). Metabolic ﬁngerprinting of selected knockout
mutations of LB400 (LB400Ax0xF and LB400AﬂhA fdhA mtdB) in this study have
helped to clarify the role of the C. pathway in LB400, but not in (polychlorinated)
biphenyl degradation.

Formaldehyde is formed by the methanol dehydrogenase-like XoxF in LB400.
The formaldehyde can then be routed through any one of three redundant pathways, a
glutathione-S transferase, NAD-linked pathway (F lhA), an NAD-linked, glutathione-S
transferase independent pathway (FdhA), and and NAD(P)-linked methylene H..MPT
pathway (see Figure 1).

During logarithmic-phase growth of LB400wt on biphenyl, regardless of the
presence of PCBS, I found an accumulation of formaldehyde. The highest accumulation
was in biphenyl during mid-log growth (Figure 2). Previous studies (Denef, et a]. 2004;

Parnell, et a]. 2006) noted an induction in the C. pathway that may explain a lower

133

accumulation in both transition to stationary phase, grown on biphenyl, and PCB
degradation.

The elimination of all three modes of formaldehyde detoxiﬁcation (LB400AﬂhA
fdhA mtdB) should lead to a marked accumulation of formaldehyde. During PCB
degradation (growth on biphenyl and harvested in logarithmic growth), I found a high
accumulation of formaldehyde (higher than the same treatment for LB400wt). However,
formaldehyde accumulation was much lower in transition to stationary phase growth on
biphenyl (Figure 6.3).

As XoxF is similar to methanol dehydrogenase (anF), but shows no afﬁnity for
methanol or other C. compounds (Marx, et a]. 2004). In the homologous pathway in
AM-l , the methanol dehydrogenase is responsible for the production of formaldehyde.
In LB400 I would expect to see no accumulation of formaldehyde in any of the
treatments. Indeed, I found no accumulation of formaldehyde in either of the treatments
(Figure 6.4), indicating that XoxF is responsible for the formation of formaldehyde.

This study demonstrates a previously undocumented accumulation of
formaldehyde during (polychlorinated) biphenyl degradation caused by XoxF in LB400.
While this explains the role of the C. pathway in LB400 (formaldehyde detoxiﬁcation),
the role of the C. pathway in biphenyl and PCB degradation remains a mystery. In
addition, though I have found the product of XoxF to be formaldehyde, the substrate is

still unclear.

134

FlhA*
CH20H-GSH —-> CHO-GSH

 

thA
XoxF+ FdhA*
? —> Formaldehyde > HCOOH —> C02
Fae ic
MtdB" Mch

CH2=H4MPT —> CH=H4MPT—> CHO-H4MPT

Figure 6.1. Functional redundance of three formaldehyde detoxiﬁcation pathways in
Burkholderia xenovorans LB400 (from Marx, et al. 2004). Formaldehyde is produced by
XoxF and channeled into three pathways. Knockout mutations used in this study are

designated LB400AxoxF (+) and LB400AﬂhAfdhAmtdB (*).

135

Biphenyl TP

100
0| a I. .l a a , a &

Biphenyl ML
100 l I‘
O . V A...
Biphenyl ML PCBs

100
0| 5 E a . , n a: gal

0.25 0.50 0.75 1.00 1.25 1.50

 

Figure 6.2. LC-MS proﬁle of LB400wt grown on biphenyl with and without PCBS
harvested from mid—logarithmic (ML) and early stationary phase growth (ES). The

retention time for modiﬁed formaldehyde is highlighted.

136

Biphenyl TP

 

 

Figure 6.3. LC-MS proﬁle of LB400AﬂhA fdhA mtdB grown on biphenyl and harvested
during early stationary phase (ES) and mid logarithmic phase (ML) with PCBS. The

retention time for modiﬁed formaldehyde is highlighted.

137

Biphenyl TP

100 I
0

Biphenyl ML PCBs

100 I
0

0.25 0.50 0.75 1.00 1.25 1.50

Figure 6.4. LC-MS profile of LB4OOAx0xF grown on biphenyl and harvested during
early stationary phase (ES) and mid logarithmic phase (ML) with PCBS. The retention

time for modiﬁed formaldehyde is highlighted.

138

 

REFERENCES

Amaratunga, K. P.M. Goodwin, C.D. O’Connor, and C. Anthony. 1997. The
methanol oxidation genes mxaFJGIR(S)ACKLD in Methylobacterium extorquens.
FEMS Microb. Lett. 146:31-38.

Bopp L H. Degradation of highly chlorinated PCBS by Pseudomonas strain
LB400. J Ind Microbiol 1986;1123—29.

Chain, P.S.G., V.J. Denef, K. Konstantinidis, L.M. Vergez, L. Agullr'), V.L.
Reyes, L. Hauser, M. C6rdova, L. Gamez, M. Gonzalez, M. Land, V. Lao, F.
Larimer, J.J. LiPuma, E. Mahenthiralingam, S.A. Malfatti, C.J. Marx, J.J.
Parnell, A. Ramette, P. Richardson, M. Seeger, D. Smith, T. Spilker, W-J.
Sul, T.V. Tsoi, L.E. Ulrich, I.B. Zhulin, J.M. Tiedje. 2006. Burkholderia
xenovorans LB400 harbors a multi-replicon, 9.7 M bp genome shaped for
versatility. Proc. Nat]. Acad. Sci. 103:15280-15287.

 

Denef, V.J., J. Park, T.V. Tsoi, J.-M. Rouillard, H. Zhang, J.A.
Wibbenmeyer, W. Verstraete, E. Gulari, S.A. Hashsham, and J.M. Tiedje.
2004. Biphenyl and benzoate metabolism in a genomic context: Outlining

genome-wide metabolic networks in Burkholderia xenovorans LB400. Appl.
Environ. Microbiol. 70:4961-4970.

Denef, V.J. M.A. Patrauchan, C. Florizone, J. Park, T.V. Tsoi, W. Verstraete,
J.M.Tiedje, and L.D. Eltis. 2005. Growth substrate- and phase-speciﬁc
expression of biphenyl, benzoate, and C. metabolic pathways in Burkholderia
xenovorans LB400. J. Bacteriol. 187:7996-8005.

Denef, V.J. J.A. Klappenbach, M.A. Patrauchan, C. Florizone, J.L.M.
Rodrigues, T.V. Tsoi, W. Verstraete, L.D. Eltis, and J.M. Tiedje. 2006.
Genetic and genomic insights into the role of benzoate-catabolic pathway

redundancy in Burkholderia xenovorans LB400. Appl. Environ. Microbiol. 72:
585-595.

Erickson, B. D., and F. J. Mondello. 1993. Enhanced biodegradation of
polychlorinated biphenyls after site-directed mutagenesis of a biphenyl
dioxygenase gene. Appl. Environ. Microbiol. 59:3858-3862.

Kell, D.B., M. Brown, H.M. Davey, W.B. Dunn, I. Spasic, and S.G. Oliver.
2005. Metabolic footprinting and systems biology: the medium is the message.
Nat. Rev. Microbiol. 3:557-565

Marx, C.J., J.A. Miller, L. Chistoserdova, and M.E. Lidstrom. 2004.

Multiple formaldehyde oxidation/detoxiﬁcation pathways in Burkholderia
fungorum LB400. J. Bacteriol. 186:2173-2178.

139

Parnell, J.J., J. Park, V. Denef, T. Tsoi, S. Hashsham, J. Quensen III, and
J.M. Tiedje. 2006. Coping with PCB toxicity: The physiological and genome-
wide response of Burkholderia xenovorans LB400 to PCB (polychlorinated
biphenyl)-mediated stress. Appl. Environ. Microbiol. 72:6607-6614.

Singer, A. C., D. E. Crowley, and l. P. Thompson. 2003. Secondary plant
metabolites in phytoremediation and biotransformation. Trends Biotechnol.
21:123-130.

Zaar, A., W. Eisenreich, A. Bacher, and G. Fuchs. 2001. A novel pathway of
aerobic benzoate catabolism in the bacteria Azoarcus evansii and Bacillus
stearothermophilus. J. Biol. Chem. 276: 24997-25004.

Zaar, A., J. Gescher, W. Eisenreich, A. Bacher, and G. Fuchs. 2004. New

enzymes involved in aerobic benzoate metabolism in Azoarcus evansii. Mol.
Microbiol. 54: 223-238.

140

 

CHAPTER 7

SUMMARY AND FUTURE PERSPECTIVES.

MAJOR CONCLUSIONS

The main focus of this research is to gain insight into the mechanisms of tolerance
and co-metabolism of polychlorinated biphenyls by aerobic biodegradative
microorganisms using Burkholderia xenovorans LB400 as a model organism. To
determine the extent of tolerance and breadth of co-metabolism of PCBS, I ﬁrst
determined the sensitivity or tolerance of potential PCB-degrading strains to a
commercial mixture of PCBS (Aroclor 1242).

In comparing 18 different bacterial strains with PCB-degrading potential, I found
a wide range in sensitivity to PCBS. Burkholderia xenovorans LB400 is one of the most
tolerant to high concentrations of PCBs and because of the completion of the'genome
sequence and the availability of microarray techniques, this became a model organism for
the study of tolerance as well as investigations into additional mechanisms involved in
co-metabolism of PCBS and efﬁcient biphenyl degradation. Moreover, the range of
physiological characteristics associated with the bacteria selected for this study allow
further focus of the source of PCB tolerance. In order to design a successful in-situ PCB
biodegradation scheme, the physiological and environmental context under which PCBS
are degraded by aerobic microorganisms must be determined.

One such context is the biotoxicity of PCBs to biodegrading microorganisms. In
Chapter 3, I characterize the whole-cell physiological responses to LB400 following

exposure to PCBS. As PCBs become associated with lipids of organisms, they have the

141

tendency to accumulate in the membrane of biodegrading bacteria such as LB400. The
physiological changes induced by the presence of PCB can provide information regarding
environmental conditions present in the medium. This knowledge can eventually lead to
better understanding of mechanisms responsible for tolerance and their exploitation in
environmental settings. I found that LB400 does not degrade PCBS during mid-
logarithmic phase growth on simple carbon sources such as succinate and benzoate.
These treatments served to demonstrate the innate toxicity of PCBS to bacteria in an
environemtal context. This work was the ﬁrst to demonstrate that PCBS themselves have
no signiﬁcant physiological effect on biodegrading bacteria.

Aside from PCBS themselves, biodegrading bacteria are faced with the potential
toxic effects of degradation products. A characterization of the whole-cell physiological
response to PCBs, due to both PCBS and the products of their degradation (biphenyl
pathway induced by growth on biphenyl), clarify the effect of PCB degradation on
microorganisms. In order to determine the mechanisms involved in tolerance to PCB
degradation, 1 analyzed gene expression patterns involved in the response of LB400
following exposure to PCBS. The advent of bacterial genome sequencing has ushered an
era of large-scale discovery involving the response of bacteria to a broad range of
conditions. Until now, the majority of studies on PCB degradation have focused
primarily on the PCB-degrading biphenyl pathway; little consideration has been given to
peripheral pathways or mechanisms involved in whole-cell responses to PCBS and the
products of their degradation. In order to design a successful in-situ PCB biodegradation
scheme, the environmental and ecological context under which PCBs are degraded by
aerobic microorganisms must be determined, including global gene expression responses.

While other genes are certainly involved in PCB degradation, no information has been

142

reported on the global expression patterns involved in PCB degradation. Degradation of
PCBS by LB400 (biphenyl with PCBs vs biphenyl) induces pathways involved in PCB
degradation (biphenyl, and (chloro)catechol degradation pathways) as well as several
other pathways that may be associated with detoxiﬁcation of deleterious metabolites from
incomplete PCB degradation. The C1 pathway is up-regulated during degradation of
PCBs, although the basis of its induction is unknown. The chloroacetaldehyde
dehydrogenase that is induced is very similar to the chloroacetaldehyde involved in the
detoxiﬁcation of chlorinated aldehydes produced on degradation of DCE. BphI is
responsible for cleaving 4-hydroxy-2-0xovalerate into pyruvate and acetaldehyde.
However a chlorinated substrate may lead to a chloroacetaldehyde that would be toxic for
biodegrading bacteria. Further evidence for the formation of chloroacetaldehyde is the
similar clustering of BphJ, which funnels acetaldehyde into pyruvate metabolism and the
chloroacetaldehyde dehydrogenase in transcriptional proﬁling (Chapter 4).

The most vigorous applications of transcriptional proﬁling entail the analysis of
patterns of gene expression encompassing various experiments that examine a broad
range of responses to different treatments. I analyzed the gene expression patterns 11
different conditions involving different carbon sources (benzoate, biphenyl and succinate)
different growth phases (log-phase and early stationary phase) and presence/absence of
PCBS to provide a comprehensive overview of genes involved in PCB degradation and its
regulation. Statistical analysis of gene expression patterns clustered the upper biphenyl
tightly separate from the lower biphenyl pathway, indicating the value of transcriptional
proﬁling. Many of the genes grouped in the same cluster of the upper biphenyl pathway

have no known association with biphenyl degradation and serve as viable candidates for

143

future study. In addition, BphJ clustered tightly with the chloroacetaldehyde
dehydrogenase mentioned previously, suggesting similar function.

PCB degradation has traditionally been reported using resting cell assays that
induce the biphenyl pathway following removal of other available carbon sources. While
this technique has obvious advantages in detecting PCB degradation and characterizing
congener speciﬁcity, LB400 harvested from different growth phases leads to different
PCB degradation patterns. The most profound difference in PCB degradation proﬁle was
in early stationary phase LB400 grown on biphenyl. Transcriptional proﬁles of PCB
degradation and early stationary phase LB400 grown on biphenyl identify 25 genes that
are induced in both conditions that may impart stability during PCB degradation. Among
the genes induced is the pathway responsible for formaldehyde detoxiﬁcation (C1), BphJ,
chloroacetaldehyde dehydrogenase, and ﬁmbrial-associated proteins. Many of the genes
are potentially regulated by sigma-54 (formaldehyde detoxiﬁcation and ﬁmbrial-
associated genes). LB400 contains two potential sigma-54 genes that were examined via
Q-RT-PCR during different conditions leading to a range in PCB degradation. I found
that the expression of one of the sigma-54 genes (located on the chromosome) correlates
with expression of the biphenyl pathway, as does sigma-70, and the chloroacetaldehyde
dehydrogenase.

The effect of carbon source on biphenyl degradation has long been known. PCB
degradation does not occur in the presence of simple carbon sources. While the
molecular mechanisms for the regulation of the biphenyl pathway have been studied, the
environmental aspects, such as the role of competing carbon sources have not been
documented. 1 tested the effect of a simple carbon source (succinate) on the expression

of the biphenyl pathway using Q-RT-PCR. This is the ﬁrst indication that the biphenyl

144

 

pathway is induced by biphenyl when LB400 is grown with succinate. However, I found
no evidence of degradation of biphenyl, suggesting either post-transcriptional factors or
transport limited availability of biphenyl. Furthermore, I found that PCBS in the presence
of simple carbon sources represses the biphenyl pathway. These are crucial factors
involved in environmental scenarios as PCB-contarninated sediments often contain
additional carbon sources.

I found induction of the C1 metabolic pathway in LB400 in response to the
degradation of PCBs. Using knockout mutations of the C1 pathway, 1 performed
metabolic footprinting focusing primarily on low molecular-weight acetaldehydes. I
found for the ﬁrst time that formaldehyde is produced during degradation of biphenyl and
PCBS. I also report that XoxF, a methanol dehydrogenase-like protein is involved in the
production of formaldehyde and the downstream C1 elements are responsible for
detoxiﬁcation of formaldehyde.

This work has focused on (polychlorinated) biphenyl external to the biphenyl
pathway such as toxicity, regulation, and other mechanisms possibly involved in
increasing efﬁciency of degradation. Understanding these factors and treating PCB
degradation as a whole-cell process is crucial to placing biphenyl and PCB degradation in

an ecological context.

FUTURE PERSPECTIVES

This work has revealed the importance of factors external to the biphenyl pathway
involved in efﬁcient and successful degradation of PCBS and biphenyl. Some of these

factors impart tolerance to LB400 to high concentrations of PCBS where other potential

145

PCB degraders are sensitive. Although I implicate the chloroacetaldehyde
dehydrogenase as a key component to tolerance, more detailed study of the speciﬁc role
of chloroacetaldehyde dehydrogenase in the degradation of PCBs. In addition,
information on the occurrence of membrane vesicles on exposure to PCBS (mentioned in
chapter 3) should be pursued as this may be a defense mechanism to minimize PCB-
membrane interaction or a general response to stress. Finally, physiological information
on the toxicity of PCBS to LB400 indicates some expression changes that are below the
detection for traditional microarray studies and require more sensitive methods to
determine effect.

Transcriptional proﬁling has identiﬁed several genes that may be involved in
biphenyl degradation including regulators and membrane-associated proteins. Further
characterization of these proteins via knockout mutation could determine the function and
role of these genes in biphenyl degradation.

In addition, LB400 has two sigma-54 factors; the ﬁrst, chromosomally localized
factor appears to be associated with PCB degradation. While In addition, sigma general
nutrient starvation, and the second seems to be associated with the degradation of
biphenyl. Future studies on the speciﬁc involvement of the latter sigma factor, such as
knockout mutation, could indicate how much association is involved between the

biphenyl pathway and sigma-54 activity.

146

 

llllllllllllllllllllll