. Ina? Emma sfi A :31 ... ”yummy“. . ".6. I hhufl..... nu... Mm“... .apaflmwflm Que: vain}... . 2. .62.. Emanfiuuu. ... _ . _. , V V , V . . . . . V . , . . , . . V ., . V H. , . .,. V .V. V , , fl... ”hmmnu‘ . V . , . . V V. . . ,4? “x... T39. , . . V v . . : L E 2... . 3+ . V ...::X . u.711;i1§ ,ro raw-x ' "1114359.; "UV“ fl... ( V -V . r .i..6.,k.uV¢\...nnl.~ .H nuwuxwmnmxfimwpxx . V V V .233. V , V I - Ill! , . . V... ...... . . . , . than... £41.. 7,221» V . . V V . . A V, . . . Il' Kl. V V . . . V V , V. awfimmmrdrca? Wikammmikmv. 909‘) This is to certify that the dissertation entitled ANALYSIS OF THREE NEGATIVE EFFECTS IN THE MOTHER CELL REGULATORY NETWORK OF SPORULATING BACILLUS SUBTILIS presented by Lijuan Wang LIBRARY Michigan State University has been accepted towards fulfillment of the requirements for the Ph. D. degree in Microbiology and Molecular Genetics 5312351501 t Major Professor’s Signature 8 ! lSJI o ‘l Date MSU is an afl‘lnnafivo-acfion, equal—opportunity employer -.-v--.-ian.-.--.---A-.-.-.-A—.-.-.-—.—-n-:----.--n----'24-‘-v--.-.-.-.— - PLACE IN RETURN BOX to remove this checkout from your record. To AVOID FINES return on or before date due. MAY BE RECALLED with earlier due date if requested. DATE DUE DATE DUE DATE DUE 6/07 p:/CIRC/DateDue.indd-p.1 ANALYSIS OF THREE NEGATIVE EFFECTS IN THE MOTHER CELL REGULATORY NETWORK OF SPORULATING BACILLUS SUBTILIS By Lijuan Wang A DISSERTATION Submitted to Michigan State University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Department of Microbiology and Molecular Genetics 2007 ABSTRACT ANALYSIS OF THREE NEGATIVE EFFECTS IN THE MOTHER CELL REGULATORY NETWORK OF SPORULATING BACILLUS SUBTILIS By Lijuan Wang During sporulation of Bacillus subtilis, four regulatory factors act in the order of 05, SpoIIID, ox, and GerE, to temporally control gene expression in the mother cell. SpoIIID and GerE are small sequence-specific DNA-binding proteins that activate or repress transcription of many genes. There are three negative regulatory links between different components, adding complexity to the network. First, transcriptionally active 0K RNA polymerase inhibits early gene transcription, reducing SpoIIID late in sporulation. Second, GerE down—regulates 0K by binding to the sigK promoter. Third, repression by SpoIIID causes cotC to be expressed at least one hour later than other cot genes, such as cotB and cotD. In this study, to understand the importance of the negative effects in the mother cell regulatory network of sporulating B. subtilis, we showed that by maintaining SpoIIID at a higher level late in sporulation, less heat- and lysozyme-resistant spores are produced. Transmission electron microscopy showed structural defects in the spore coat. Reporter fiisions to the (Ix-dependent gerE, cotD, and cotC promoters showed altered expression patterns. Interestingly, the expression patterns and spore resistance properties were restored when GerE negative regulation of sigK was simultaneously eliminated. On the other hand, eliminating only GerE negative regulation of sigK (without maintaining SpoIIID at a higher level late in sporulation) caused no defect in spore resistance properties, and a different pattern of altered reporter filSlOIl expression. A strain engineered to express cotC two hours earlier than normal during sporulation showed no defect in spore resistance properties. These results demonstrate that the B. subtilis mother cell regulatory network was robust to the perturbations we tested in terms of the number of resistant spores produced, although maintaining SpoIIID at a higher level late in sporulation caused a defect that was reversed by eliminating GerE negative regulation of sigK. The mechanism of this suppression can be rationalized in terms of the opposing effects of OK RNA polymerase and SpoIIID on expression of genes late in sporulation. Spore coat protein analysis revealed no significant differences between the strains that are constructed for the study of negative effects and wild-type B. subtilis, although some of the engineered strains showed defects in spore resistance prOperties. This implies that structural, not compositional, differences cause the spore defects. In order to elucidate the mechanism by which 0K RNA polymerase negatively feeds back on earlier gene expression, a genetic screen was carried out to identify possible intermediate genes. Eleven candidates were identified. Among them, 168 rRNA was identified twice by independent transposition events. Most of the candidate genes affect metabolic pathways, implying a connecting between the regulation of SpoIIID expression by the 6K RNA polymerase negative feedback loop and metabolism of the sporulating cell. A preliminary study revealed that the level of aconitase, which can bind to gerE mRNA for GerE and affect GerE synthesis, is different when cells are induced to sporulate by resuspension in starvation medium rather than by nutrient exhaustion in growth medium. This may explain the observation that the spore defect caused by persistence of SpoIIID late during sporulation can only be observed when cells are induced to sporulate by resuspension, but not by nutrient exhaustion. T 0 my husband, Zhiwei, my parents, Junsheng Wang and Shuqing Li, and my son, Evan, with love. iv ACKNOWLEDGENIENTS When it was time for me to wrap up and look back at the many years that I spent in East Lansing, MI, pursuing my PhD degree, I sincerely felt lucky to get support from so many wonderful people. Without them, I would not have been able to fulfill this task. I want to especially thank Dr. Lee Kroos, mentor of my PhD study, for his insightful guidance, spiritual support and great patience. He not only taught me the way to perform scientific research, but also showed me how to be a good scientist. What I have learned from him will surely guide me my whole life. I also want to thank my committee members: Dr. Cindy Arvidson, Dr. John Wang, Dr. Robert Britton, and Dr. Loren Snyder. They gave me important suggestions on my research project and always supported me during my PhD study. Thank you also goes to members of the Kroos laboratory. Working together with my colleagues for many years, I am so glad that I have learned a lot of new techniques, as well as different cultures. I want to thank Dr. Ruanbao Zhou, who has been a constant technical consultant and mind-opener for me. I also thank Paul Himes for his many useful suggestions on experimental protocols. I also want to thank other members current and past of the Kroos lab: John Perpich, Heather Prince, Dr. Pooma Viswanathan, Dr. Deborah Yoder—Himes, Dr. Daisuke Irnamura, Sheenu Mittal and Christina Cusumono for useful advice and creating a good working enviromnent for scientific research. My thanks also go to many of my wonderful friends who have been encouraging and helping me during my stay in East Lansing. They are: Lingxia Sun, Xiangrong Guo, David and Ada Kid, John and Bonnie Bankson. I thank my parents, Junsheng Wang and Shuqing Li, for their selfless love and constant support. I could not have finished my project in a timely manner without their help. Being a parent by myself lets me understand the greatness of every parent, especially mine. I would also thank my brothers for their support all these years. Finally, I want to give thanks to my husband, Zhiwei Cen, for his love, understanding, encouragement and support. I could not have reached this point without his support. His attitudes of doing things as early as possible and as well as possible have influenced me greatly. Together with him and our son, Evan, I believe I can achieve any goal that I set for my career and my life. TABLE OF CONTENTS LIST OF TABLES ................................................................................... x LIST OF FIGURES .................................................................................. xi LIST OF ABBREVIATIONS ..................................................................... xiii INTRODUCTION .................................................................................... 1 CHAPTERI: LiteratureReview.....................' ............................................... 5 Overview of Morphological Stages of Sporulation and Cell-specific 6 Factors .................................................................. 6 Initiation of Sporulation .................................................................... 10 Asymmetric Division of the Cell and Segregation of the Chromosome ......................................................................... 11 Activation and the Role of o: m the Forespore .......................................... 12 Activation and the Role of (SE in the Mother Cell ........................................ l6 Engulfment of the ForesporeG ............................................................... 19 Activation and the Role of 06 in the Forespore .......................................... 20 Activation and the Role of OK ............................................................. 22 Transcriptional Regulatory Network in the Mother Cell ofSporulatingB. subtilis..................... ........................................ 25 Appearance and The Role of SpoIIID .............................................. 26 Appearance and the Role of GerE ................................................... 28 Negative Links 1n the Mother Cell Regulatory Network ......................... 28 Structure and Properties of the Spore ...................................................... 30 Development Transcription Regulatory Network ....................................... 31 CHAPTER II: Maintaining the Transcriptional Factor SpoHID Level Late during Sporulation Causes Spore Defects in Bacillus subtilis ABSTRACT ................................................................................. 34 INTRODUCTION .......................................................................... 35 MATERIALS AND METHODS ......................................................... 40 RESULTS Engineering B. subtilis to maintain the SpoHID level late during sporulation .......................................................... 44 Pro-oK and 6K levels are unchanged in B. subtilis that maintain the SpoIIID level late during sporulation ........................... 44 Maintaining the SpoIIID level late during sporulation alters gene expression ................................................................ 52 Persistent SpoIIID expression affects certain spore resistance properties .................................................................. 53 Maintaining the SpoIIID level late during sporulation does not impair spore germination .................................................. 56 Persistent SpoIIID expression causes a defect in spore coat structure .......... 56 DISCUSSION .............................................................................. 62 ACKNOWLEDGMENTS ................................................................. 68 CHAPTER III: One Perturbation of the Mother Cell Gene Regulatory Network Suppresses the Effects of Another During Sporulation of Bacillus subtilis ABSTRACT ................................................................................. 70 INTRODUCTION .......................................................................... 72 MATERIALS AND METHODS ......................................................... 77 RESULTS .................................................................................... 84 Engineering B. subtilis to circumvent GerE; repression of sigK .................. 84 Effects of circumventing GerE repression of sigK ................................. 87 Circumventing GerE repression of sigK compensate for persistent SpoIIID expression ..................................................... 87 Effects of circumventing the delay in CotC production ........................... 95 DISCUSSION ................................................................................ 98 ACKNOWLEDGMENTS ................................................................ 108 CHAPTER IV: A Genetic Screen to Identify Possible Intermediates That Carry Out the 0K RNAP Negative Feedback in B. subtilis ABSTRACT ................................................................................ l 13 INTRODUCTION ............................................................... l 14 MATERLALS AND METHODS ....................................................... 115 RESULTS .................................................................................. 1 18 Thirty one candidate strains were identified by color indications on X- gal containing plates .................................... 118 Candidates were narrowed down to 11 by B-galactosidase assays ............ 119 Identification of genes interrupted in the strains with elevated spoIIID-lacZ expression ................................................. 1 19 DISCUSSION ............................................................................ 125 ACKNOWLEDGMENTS ............................................................... 129 APPENDD( I ....................................................................................... 130 APPENDD( II ....................................................................................... 137 APPENDIX III ...................................................................................... 144 SUMMARY AND PERSPECTIVES ............................................................ 151 REFERENCES ...................................................................................... 156 Table 3.1. Table 4.1. Table 4.2. Table 1. LIST OF TABLES List of B. subtilis strains used in the study ..................................... 79 Origin of candidate strains from genetic screen .............................. 119 Identification of genes interrupted by mini-Tnl O mutagenesis ............. 124 List of B. subtilis strains used in the study .................................... 133 Fig. 1.1. Fig. 1.2. Fig. 1.3. Fig. 1.4. Fig. 2.1. Fig. 2.2. Fig. 2.3. Fig. 2.4. Fig. 2.5. Fig. 2.6. Fig. 2.7. Fig. 3.1. Fig. 3.2. Fig. 3.3. Fig. 3.4. Fig. 3.5. Fig. 3.6. Fig. 3.7. Fig. 3.8. LIST OF FIGURES The morphological stages during sporulation of B. subtilis .......................... 8 Activation of (SF ........................................................................... 13 The processing of pro-oE ................................................................ 17 The processing of pro-csK ................................................................ 23 Gene regulatory network in the MC during sporulation of B. subtilis ............. 38 Level of SpoIIID during sporulation ................................................... 45 Pro—oK and 0K levels during sporulation ............................................... 47 Effects on gene expression .............................................................. 49 Resistance properties of spores ......................................................... 54 Spore germination ........................................................................ 57 Thin-section electron microscopic analysis of spores ................................ 59 Gene regulatory network in the MC during sporulation of B. subtilis. ..... . ......74 Mutation made in the GerE binding site in the sigK promoter region ............. 80 Levels of pro-oK and (5K during sporulation .......................................... 85 Levels of SpoIIID during sporulation .................................................. 88 Effects on gene expression .............................................................. 91 Resistance properties of spores ......................................................... 96 Spore germination ........................................................................ 99 Levels of CotC during sporulation ................................................... 102 Fig. 3S. Alignment of predicted sigK promoter regions of Bacillus species and comparison with the GerE binding site in Fig 4.1. Fig. I. Fig. II. Fig. III. the B. subtilis sigK promoter region ................................................. 109 Analysis of B-galactosidase activity .................................................. 120 Coat profiles .............................................................................. 134 Levels of aconitase by DSM and resuspension sporulation ........................ 141 Level of pro-(rE and E .............................. ‘ .................................... 147 Ap DNA DSM DTT FS LB ONPG ORF PAGE PCR MC mRNA SASP SM TSS LIST OF ABBREVIATIONS arnpicillin deoxyribonucleic acid Difco sporulation medium dithiothreitol forespore kanamycin Luria-Bertani media ortho-nitrophenyl-beta-D-galactopyranoside open reading frame polyacrylamide gel electrophoresis polymerase chain reaction mother cell messenger ribonucleic acid RNA polymerase small acid-soluble proteins sporulation medium transcription start site INTRODUCTION The gram-positive bacterium Bacillus subtilis undergoes a process called sporulation in order to survive during nutrient limitation. During sporulation, two compartments, a larger mother cell compartment and a smaller forespore compartment, are formed. Each compartment contains a complete copy of chromosomal DNA. In the mother cell of sporulating B. subtilis, a regulatory network controls sequential gene expression. Four regulatory factors, in the order 65, SpoIIID, 0K and lastly GerE, are major players in this network. Three negative links exist in this regulatory network and their importance was unknown. Chapter I provides a literature review of the relevant background regarding the process of sporulation, properties of the spore formed after sporulation, theory and studies on developmental transcriptional regulatory networks. Chapter 11 presents the results of a study designed to understand the significance of one of the negative links in the sporulating mother cell, that is, the importance of OK RNA polymerase (RNAP) negative feedback on earlier gene expression. This negative effect results in reduced accumulation of SpoHlD late during sporulation. A strain in which the SpoIIID level is maintained late during sporulation was constructed by fusing SpoIIID to the OK-CODII‘OIIOCI gerE promoter on a multicopy plasmid. This strain showed spore defects in heat- and lysozyme-resistance. Reporter fusions to gerE, cotC and cotD, which are expressed late in the mother cell, showed altered expression patterns compared to wild type and control strains. Although a quantitative gemiination assay showed no significant defect of the spores formed by the strain with SpoIIID maintained late during sporulation, thin- section transmission electron microscopy revealed structural defects of the spores. These results suggest that oK RNAP negative feedback at least partially relies on fine-tuning of the SpoIIID level in order to allow normal spore formation. Chapter III discusses a perturbation study of the mother cell regulatory network, in which one or two negative links were removed at the same time during sporulation. GerE represses sigK transcription. A strain with site-directed mutations in the sigK promoter eliminated this GerE negative feedback. This strain did not show spore resistance or germination defects. However, when a strain was constructed that both maintained SpoIIID late during sporulation and eliminated the GerE negative feedback, it sporulated normally, demonstrating suppression of the spore resistance defects caused by only maintaining the SpoIIID level late during sporulation. Reporter assays showed opposing effects of these two perturbations, suggesting that one change to the mother cell regulatory system can be compensated for by a second perturbation. Chapter IV presents the results of a genetic screen designed to identify intermediates in the 0K RNAP negative feedback loop. Eleven candidates were identified. Among them, 168 rRNA seems to be most interesting and firrther investigation is proposed. Appendix I document the results of spore coat protein analysis of all the strains studied in Chapter H and Chapter 1H. No significant difference was found between any of the strains and wild-type B. subtilis. Appendix II shows that the level of aconitase when cells are induced to sporulate by resuspension in SM medium than by nutrient exhaustion in DSM. This result provides a possible explanation for the observation in Chapter H that strain with late persistence of SpoIIID exhibits spore defects upon induction by resuspension, but not by DSM. Appendix HI shows that in a B. subtilis strain containing nyl-sigE, whether the sigE expression is successfully induced or not is inconclusive based on western blot analyses. The summary and perspectives summarizes the significance of the results and sheds light on future directions toward a better understanding of the mother cell regulatory network during sporulation of B. subtilis. CHAPTER I: Literature Review In developmental biology, questions of how cells generate distinct cell types by utilizing different gene expression programs and how different cells communicate with each other to ensure proper development are of fundamental significance. As one of the best-studied gram-positive organisms, B. subtilis provides an ideal model system to address these questions experimentally. Also, the transcriptional regulatory network, which responds to stimuli during sporulation of B. subtilis provides a powerful model for studies of signal transduction and gene regulation (Kroos. 2007; Piggot and Hilbert. 2004). Therefore, sporulation of B. subtilis has been intensively studied during the last several decades. When sensing nutrient limitation, such as carbon or nitrogen depletion (White. 1999), B. subtilis, at a high enough cell density, will initiate a developmental process called spomlation that culminates in the formation of a dormant spore (Dawes and Mandelstam. 1970; Coote. 1972; Burbulys, et al. 1991; Lazazzera and Grossman. 1998). The spore is resistant to many kinds of extreme environments suCh as heat, UV light, lysozyme, and chemicals. As a result, the spore can survive in harsh environments, preserving the ability to germinate when nutrients are available, and resume as a vegetative cell. Overview of Morphological Stages of Sporulation and Cell-specific 0 Factors The morphological stages of sporulation are illustrated schematically in Figure 1.1. Successive stages are identified by Roman numerals. The vegetative cell of B. subtilis is designated as Stage 0. The first morphological change after the initiation of sporulation is the formation of an axial filament of chromatin, which is designated as Stage I. Dming this stage, two copies of the chromosome from the last round of DNA replication condense and elongate to form a filament that spans across the cell’s long axis, with the origin of each chromosome near to one pole of the rod-shape cell. A DNA replication checkpoint ensures that two copies of the chromosome are present before cell division (Burkholder, et al. 2001). Stage II of sporulation is designated as the completion of septation. The cell is divided asymmetrically by a structure called the septum, resulting in a larger compartment called the mother cell and a small compartment called the forespore. Approximately one- third of One copy of the chromosome is present in the forespore, while the other two-thirds are quickly pumped into the forespore by a DNA translocase, SpoIIIE. oF is activated in the forespore shortly after the completion of the asymmetric cell division. A (IF-controlled signal from the forespore triggers the activation of GB in the mother cell. Stage H1 is defined as the completion of engulfinent of the forespore. During this stage, the asymmetric septum undergoes septal thinning, migrates around both sides of the forespore and engulfs the forespore. When the migration is complete, the forespore is pinched off and released into the mother cell as a free-floating protoplast. Two membranes are surrounding the forespore, each derived from one of the two cells. 60 is activated in the forespore after the completion of engulfment. Then (IG and (SF dependent signals from the forespore trigger the activation of OK in the mother cell. Stage IV is complete when two peptidoglycan layers are deposited in between the two membranes surrounding the forespore, forming the germ cell wall and cell-wall-like material called cortex. The cortex renders the spore heat-resistant since it attains and also maintains the dehydrated state of the spore. During Stage V and VI, more than 60 spore coat proteins are synthesized and deposited onto the outside surface of the forespore. Maturation of the spore is achieved by gaining resistance to UV light and high temperature. UV resistance is due to the coating of the chromosomal DNA with a Fig. 1.1. The morphological stages during sporulation of B. subtilis. The stages are designated by Roman numerals. The wavy circles represent chromosomal DNA. The sporangia are surrounded by cytOplasmic membrane (inner thinner circle) and cell wall (outer thicker circle). The cortex is indicated by the gray color in stages IV-VII and the spore coat by black in stages V-VII. Four sporulation-specific sigma factors become to be active in the mother cell or the forespore during different stages of sporulation as shown. Adapted from the Dissertation of H. Ichikawa, 2000. See text for references. Chromosomes l POIar septum @ __> GE @ » 1‘- its...” + t a a .11. \x ml@ mi.@ 1.. / ,erx (W1 0th m W. w N group of small acid-soluble proteins (SASP) and condensing the genome into a doughnut— like structure. Finally, at Stage VII, the mother cell lyses and releases the mature spore into the environment. The whole process of sporulation takes about six to ten hours in laboratory situations. The complex morphological changes during sporulation are accurately controlled by different 6 factors, which bind to core RNAP sequentially during sporulation (Haldenwang. 1995; Stragier and Losick. 1996; Piggot and Hilbert. 2004). Initiation of Sporulation Factors that trigger sporulation include nutrient starvation, such as carbon or nitrogen resource linritation, DNA damage, high cell density, and the Krebs cycle (Trach and Hoch. 1993; Burkholder and Grossman. 2000; Perego and Hoch. 2002). SpoOA is the master regulator that controls entry into sporulation. Activation of SpoOA involves a phosphorelay, a more complex version of a two-component signal transduction system (Burbulys, et al. 1991). At least five kinases, KinA through KinE, are involved in the phosphorelay process. In response to unknown stimuli, the kinases first autophosphorylate themselves and then transfer the phosphate groups to SpoOF. SpoOF is an intermediate that donates its phosphate group to SpoOA, in a reaction catalyzed by a phosphetransferase SpoOB. KinA and KinB are the two primary kinases that are responsible for the phosphorelay. Negative effects from SpoOE and Rap protein regulators exist. They dephosphorylate SpoOA to regulate the initiation of sporulation. SpoOA-PO4 activates genes whose products are responsible for H axial filament formation and for asymmetric division. 0" and o are required for transcription of relevant genes at the initiation of sporulation (Hilbert and Pi ggot. 2004). 10 Efficient sporulation requires extracellular conditions such as high cell density and nutrient starvation. Blocking of the initiation or elongation of DNA replication, executed by a suppressor of dnaA, Sda, prevents initiation of sporulation (Burkholder, et al. 2001). Approximately 121 genes are directly controlled by the activation of SpoOA through phosphorelay. Of them, about one-third are positively regulated and the remaining are negatively regulated. Twenty-five of them are transcription factors, so SpoOA also plays an role in transcriptional changes at the initiation of sporulation (Hilbert and Piggot. 2004). Asymmetric Division of the Cell and Segregation of the Chromosome One characteristic that distinguishes sporulation from vegetative cell division is the formation of an axial filament, which was identified first by electron microscopy (Aronson and Fitz-James. 1976) and then by fluorescence microscopy (Bylund, et al. 1993). The fact that a mutant failing to form an axial filament does not start asymmetric division suggests a checkpoint on cell division at the level of axial filament formation (Graumann and Losick. 2001). DileA (Graumann and Losick. 2001; Thomaides, et al. 2001), RacA (Ben- Yehuda, et al. 2003; Wu and Errington. 2003) and Soj (Ben-Yehuda, et al. 2003; Wu and Errington. 2003) are reported to be involved in axial filament formation. Once the axial filament is formed, asymmetric division is triggered by the relocation of the chromosomal origins to the poles of the cell. During asymmetric cell division, a prokaryotic tubulin homologue FtsZ forms a Z-ring that locates initially at mid-cell. The Z-ring is then redeployed to each pole of the cell through an intermediate helical structure (Ben-Yehuda and Losick. 2002). However, a complete septum is normally formed at only one pole of the cell. The prevention of a secondary polar septum is accomplished by the oE-controlled proteins SpoIID, SpoIIM and SpoIIP (Pogliano, et al. 1999; Eichenberger, et al. 2001). The 11 determination of which end of the cell forms the polar septum seems to be related to the age of the cell poles. Almost all forespores are formed at the older pole of the cell, but this can be disturbed by centrifirgation at about 5,000 g and with 25 mM Mg“ (Dunn. 1977). When the asymmetric septum is formed in a sporulating B. subtilis cell, it only traps about one-third of the origin-containing part of the chromosome in the forespore compartment, leaving approximately two-thirds in the mother cell (Wu and Errington. 1998). This genetic asymmetry is important for transient spatial gene expression in the forespore (Frandserr, et al. 1999; Dworkin and Losick. 2001). The origin-distal two-thirds of the chromosome left in the mother cell is transported by a DNA translocase, SpoIIIE (Wu and Enington. 1998). The question of why DNA is only translocated from the mother cell to the forespore, but not the reverse direction, remains unaddressed. Activation and the Role of CF in the Forespore After the asymmetric cell division during sporulation, both the mother cell and the forespore contain a complete copy of the chromosomal DNA. Different programs control gene expression in each compartment but communication between the mother cell and the forespore enable successive 0 factor activation and couple gene expression in the mother cell and forespore. Asymmetric division triggers the activation of 0", which is the first 0 factor that becomes active in a specific compartment. 6': is synthesized earlier, but it is held inactive by the anti-o factor SpoIIAB until the completion of the polar septum formation, although it becomes active before the complete partitioning of a chromosome into the forespore(Wu and Errington. 1994; Frandserr, et al. 1999). The inhibition of active oF by SpoIIAB is released by the anti-anti-o factor SpoIIAA. Activation of SpoIIAA is controlled 12 Fig. 1.2. Activation of CF. Shown is the network that regulates the activation of GP. Molecules in ovals are the three key determinants for 0F activation: the ratio of SpoIIAA- PO4 to SpoIIAA, which is determined by the SpoIIE phosphatase; the concentration of long-lived SpoIIAA:SpoIIABADp complex, which acts as a “sink” for SpoIIAA and SpoIIAB; and unstable SpoIIAB combined with transient genetic asymmetry. Adapted from (Kroos. 2007). See text for details and references. 13 IIAAzllAlB\ ADP by its phosphorylation state: it is active when dephosphorylated by SpoIIE and inactive when phosphorylated by SpoIIAB, which works both as a kinase as well as an anti-o factor. The activation of (SF is coupled with asymmetric cell division and only occurs in the forespore. The mechanism is still under investigation. SpoIIE is proposed as the sensor of asymmetric cell division and in response activates oF. Several SpoIIE mutants have been isolated, which are able to activate 0'}: independent of asymmetric cell division, but impair sporulation (Feucht, et al. 2002; Hilbert and Piggot. 2003; Carrriol, et a1. 2004). Dephosphorylated SpoIIAA is believed to be sequestered in an inactive complex, called a “sink”, with SpoIIAB and ADP. The “sink” plays important roles in 0’}: activation: it inhibits the activation of 0': by sequestering dephosphorylated SpoIIAA before cell division (Carrriol, et al. 2004); it may also promote oF activation in the forespore by sequestering SpoIIAB (Lee, et al. 2001; Clarkson, et al. 2004). Structural studies reveal that two molecules of SpoHAB form a complex with (IE, but only one SpoIIAB molecule binds to (SF directly. SpoIIAA interacts with the other SpoIIAB molecule that does not bind to CF and releases it by steric displacement (H0, at al. 2003). The concentration of dephosporylated SpoIIAA is believed to be pivotal. Only when it reaches a threshold in the forespore is oF activated (Carniol, et al. 2004; Clarkson, et al. 2004).There are three factors in the forespore contributing to the activation of GP: the ratio of SpoIIE:SpoIIAA (Carrriol, et al. 2004); and the instability of SpoHAB (Pan, et al. 2001; Dworkin. 2003). The pathway that regulates the activation of (IF is illustrated in Fig. 1.2. Once activated, 0F facilitates RNAP to transcribe many genes, including spoIIR and spoIIIG. spoIIR encodes a signal protein that is required for oE activation (Karow and Piggot. 1995; Londono-Vallejo and Stragier. 1995). spoIIIG encodes the late forespore- 15 specific transcriptional factor oG (Sun, et al. 1989; Sun, et al. 1991). Activation of 06, the second specialized sigma factor in the forespore, does not occur until the completion of engulfinent (Errington, et al. 1992; Kellner, et al. 1996). The CF regulon encodes at least three classes of genes involved in sporulation (Kannazyn-Campelli, et al. 1989), germination (Paidhungat. 2002), and in protection of the spore from DNA damage (F ajardo-Cavazos and Nicholson. 2000). In particular, oG RNAP transcribes spoI VB, whose product is a serine protease that mediates cleavage of SpoIVFA to provide intracellular signals for pro-oK processing in the mother cell (Dong and Cutting. 2003; Zhou and Kroos. 2005; Campo and Rudner. 2006). cc RNAP also transcribes bofC, whose product is a negative regulator of SpoIVB (Gomez and Cutting. 1997; Wakeley, et al. 2000). Activation and the Role of CE in the Mother Cell . (IE is the first sigma factor that is activated in the mother cell compartment afier asymmetric cell division. The SpoIIG Operon encodes two genes that are involved in GE formation: spoIIGA and spoIIGB. spoIIGA encodes SpoIIGA, the processing enzyme for the proteolytic cleavage of pro-GE. spoIIGB encodes pro-GE, (Kenney and Moran. 1987; Jonas, et al. 1988) the precursor of 65, which is expressed preferentially in the mother cell (Arabolaza, et al. 2003; Fujita and Losick. 2003) and degraded in the forespore (Ju, et al. 1997; Ju, et al. 1998; Fujita and Losick. 2002). Pro-oE is subjected to proteolytic cleavage to remove 27 residues at its amino-terminal end to release the active 05 (LaBell, et al. 1987; Stragier, et al. 1988). Time of activation of (SE in the mother cell is closely linked to the activation of CF in the forespore. The trigger of processing is (IF-controlled SpoIIR in the forespore (Karow and Piggot. 1995; Londono-Vallejo and Stragier. 1995). A strain that expresses SpoIIR in the predivisional cell rather than the forespore only shows a mild effect 16 Fig. 1.3. The processing of pro—0E. Shown is a sporangiurn with a larger mother cell compartment and a smaller forespore compartment at stage II, just after polar septation. Pro-oE and SpoIIGA are thought to be associated with both septal membranes. Active 0': RNAP in the forespore transcribes SpoIIR, which encodes a signal protein that triggers the activation of a putative protease, SpoIIGA, resulting in processing of pro-oE to active 05 in the mother cell. The gene for pro-oE and SpoIIGA are not as highly expressed in the forespore (Fujita and Losick. 2002) and (5E made there appears to be degraded by an unknown enzyme (McBride, et al. 2005). Adapted from (Kroos, et al. 1999). 17 K mother cell K 0 pro- OE . SpoIIGA 18 on spore formation (Zhang, et al. 1996). However, premature expression of spoII G from a constitutive promoter instead of its native promoter, together with constitutive expression of SpoIIR, results in early processing of pro-oE and poor sporulation (Fujita and Losick. 2002). The pathway that regulates the activation of GE is illustrated in Fig. 1.3. The oE regulon contains 272 genes that are organized in 171 transcription units. Among them, 262 genes in 163 transcription units are activated by (SE in the absence of SpoIIID, a small mother cell specific transcription factor. Fourteen genes in 10 transcriptional units in the GE regulon are repressed by GerR, a recently discovered DNA-binding protein firnctioning as a transcriptional factor (Eichenberger, et al. 2004). There are some important genes in the of3 regulon. The SpoIID, spoIIM and spoIIP genes are important for engulfment and to prevent a second asymmetric cell division in the mother cell (Rong, et al. 1986; Smith, et al. 1993; Smith and Youngman. 1993; Frandsen and Stragier. 1995; Pogliano, et al. 1999; Eichenberger, et al. 2001). The spoIIIA operon is required for the activation of the late forespore-specific sigma factor as (Illing and Enington. 1991; Kellner, et al. 1996). The sigK gene encodes the precursor of the late mother cell-specific sigma factor 0" (Stragier, et al. 1989; Kunkel, et al. 1990). The spoIVCA gene encodes the recombinase that generates sigK through a chromosomal rearrangement (Kunkel, et al. 1990; Popham and Stragier. 1992; Sato, et al. 1994). The SpoIIID encodes a small transcription factor important for mother cell gene expression during sporulation (see below). Finally, gerR encodes another transcription factor that was recently discovered (Eichenberger, et al. 2004). Engulfment of the Forespore 19 The important morphological event that follows the activation of CF and (IE activation is engulfinent of the forespore by the mother cell. First, the cell wall material of the septtun is lost by an autolytic process. Then, the points where the septal membrane is attached to the peripheral cell membrane start to migrate toward the forespore pole. Finally, the forespore is completely engulfed into the mother cell, resulting in a free-floating protoplast (Fig. 1.1) (Illing and Errington. 1991; Londono-Vallejo, et al. 1997). Proteins that are either forespore-specific or mother cell-specific are required for engulfinent. The spoIID (Abanes-De Mello, et al. 2002), spoIIP (Frandsen and Stragier. 1995; Abanes-De Mello, et al. 2002), spoIIM(Smith. et al. 1993), and spoIIQ (Londono-Vallejo, et al. 1997) mutants display defects during engulfment and are thought to be involved in the completion of engulfinent. Activation and the Role of 06 in the Forespore Completion of engulfinent of the forespore by the mother cell triggers the activation of new compartment-specific sigma factors: 00 in the forespore and (3K in the mother cell. 06 is encoded by the spoIIIG gene, which is transcribed initially by (SF RNAP and later, after 00 activation, by oG RNAP. The spell] G gene is located right after the spoII G operon in the genome and is transcribed by both the spoIIIG promoter as well as the spoIIG promoter. However, the fact that moving spoIII G to an ectopic locus does not impair sporulation suggests that read-through transcription from the spoIIG promoter is not critical for (5G expression (Sun, et al. 1991). Several factors prevent the activation of 00 despite read- tlrrough transcription. First, the comparison of B-galactosidase activities between a transcriptional and a translational firsion of spoIIIG-lacZ indicates that very few spoIIIG have been translated into oG (Sun, et al. 1991). Secondly, SpoIIAB functions as an inhibitor 20 of 0‘3 activity in vivo and SpoIIAB binds to 06 in vitro (Kirchman, et al. 1993; Kellner, et al. 1996; Serrano, et al. 2004). A B. subtilis strain with mutant oG showed increased 00 activity only in the mother cell, but not in the forespore. The mutant oG firnctions normally . except it cannot bind to SpoIIAB (Kellner, et al. 1996; Serrano, et al. 2004). This result suggests that SpoIIAB prevents CG activation in the mother cell. Transcription of spoIIIG requires the activation of oE in the mother cell, suggesting a possible signaling pathway fi‘om the mother cell to the forespore (Partridge and Enington. 1993). The expression of spoIIIG also depends on the expression of spoIIQ in the forespore (Sun, et al. 2000), due to the relationship between engulfinent and activation of 00. Finally, 00, when it becomes active, also directs its own transcription (Sun, et al. 1991). This necessitates tight control of 0G activation. The mechanism of CG activation is unclear to date. The activation of oG is subject to post-translational regulation, which is evident in that both the SpoIIIJ gene and the spoIIIA operon are required for 60 activation (Errington, et al. 1992; Kellner, et al. 1996; Illing and Enington. 1991). Amino-tenninal sequencing confirmed that the active form 00 does not undergo proteolytic processing like pro-GE, suggesting that an unknown negative regulator holds 00 inactive in the forespore. It is speculated that (SE-controlled SpoIIIJ modulates the insertion of membrane proteins such as SpoIHAE, one of the eight products of the spoIIIA operon, into the forespore membrane, where it functions (Serrano, et al. 2004). All eight protein products of the spoIIIA operon are required for 00 activation. They are speculated to be located in the membranes separating the mother cell and the forespore, possibly forming a protein complex to translocate unidentified signals from the mother cell to the 21 intermembrane space of the forespore. The signals would then release inhibition by the putative negative regulator of 00. The (5(3 regulon contains at least 95 genes, including a few regulatory genes and mostly structural genes for spore formation. A few genes in the CG regulon encode metabolic enzymes (Steil, et al. 2005; Wang, et al. 2006). The metabolic enzymes help in glucose uptake, glycolysis, or glycine metabolism, although it is believed that most of the energy and materials required for spore formation at this stage come form the mother cell. Activation and the Role of UK The production of active OK, the last mother cell-specific sigma factor during sporulation, requires a developmental chromosomal DNA rearrangement, forespore signals coming from 00 controlled genes, and processing of pro-0K. A chromosomal DNA rearrangement event happens when B. subtilis cells are induced to sporulate. An approximately 48 kb DNA fiagment, called the skin element, is located between spoIVCB and spoIIIC and is excised by SpoIVCB, which is a Hin family site- specific recombinase (Popham and Stragier. 1992). The resulting single, composite gene, sigK, encodes the precursor of OK, pro-oK (Stragier, et al. 1989). Transcription of sigK into pro-oK by oE RNAP in the mother cell starts from about 3 h after the initiation of sporulation and absolutely depends on SpoIIID (Kunkel, et al. 1988; Kroos, et al. 1989) . The sigK gene product, pro-0K, is subject to regulated intrarnembrane proteolysis (RIP) to generate active (3" (Kroos, et a1. 1989; Stragier, et a1. 1989) (Yu and Kroos. 2000) (Rudner, et al. 1999; Zhou and Kroos. 2005). Initiation of RIP requires oG-controlled SpoIVB coming from the forespore (Gomez, et al. 1995). SpoIV B contains a peptidase domain and a PDZ domain for protein-protein interaction; both are important for RIP of 22 Fig. 1.4. The processing of pro-6K. (A) The upper part shows a mother cell with a sporangium engulfed into the cytosol. Black ovals represent a protein complex that spans the double membranes of the forespore and is responsible for pro-oK processing. The lower part shows an enlarged view of the region including the protein complex (not all components are shown) that spans from the inner forespore membrane (IFM) to the outer forespore-membrane (OFM). SpoIVB, a serine protease is made in the forespore first under the control of Up but its level must be boosted by 06 RNAP. SpoIVB is believed to be secreted into the space between the IFM and the OFM. It cleaves the C-terrninal part of SpoIVFA, a protector of BofA. (B) BofA exposed after the cleavage of SpoIVFA is subjected to cleavage by Cth, a serine protease that is made in the mother cell under the control of GE and in the forespore under the control of 06. (C) SpoIVFB, after loss of BofA, cleaves the N-terminal of pro-0K, releasing O'K into the mother cell. Adapted from (Kroos. 2007). See text for references. 23 _ji - - SpoIVFA ‘ BofA j“ \p ['0' 0' K .1 c 24 pro-oK (Wakeley, et al. 2000; Hoa, et al. 2001). The SpoIVB-mediated signal transduction pathway is called “the 0K checkpoint”, which is critical for efficient sporulation (Cutting et al. 1990). oG-controlled bofC encodes an inhibitor that inhibits SpoIVB autoproteolysis and thus pro—oK processing (Gomez and Cutting. 1997). In the mother cell, three loci are important for pro-oK processing: the oF and GE- controlled cth, and the GE-COHII’OIICCI spoIVF bicistronic operon and bofA. The two genes in the spa] VF operon are: SpoIVFA, which encodes a target protein of SpoIVB; and SpoIVFB, which encodes a membrane—embedded metalloprotease that carries out RIP of pro-0K. The bofA gene encodes an inhibitor of SpoIVFB. The cth gene encodes a serine protease with a PDZ domain, like SpoIVB, and cleaves BofA to release its inhibition of SpoIVFB (Zhou and Kroos. 2005). It is proposed that RIP of pro-oK involves a three-step proteolytic cascade in which SpoIVB first cleaves SpoIVFA, Cth then cleaves BofA, and finally SpoIVFB cleaves pro- oK (Zhou and Kroos. 2005). The process of RIP of pro-oK is schematically illustrated in Fig. 1.4. 0", as the last mother cell-specific sigma factor, acts during stage IV (deposit of cortex) and stage V (coat formation) of sporulation. 0K RNAP transcribes 144 genes that are located in 94 transcription units. Among them, 33 genes in 23 transcription units are transcribed by both UK RNAP and 6E RNAP (Eichenberger, et al. 2004). o'K RNAP transcribes many cot genes such as cotA, cotD, and cotH. It also transcribes gerE, which encodes the last mother cell specific transcription factor during sporulation (Eichenberger, et al. 2004). Transcriptional Regulatory Network in the Mother Cell of Sporulating B. subtilis 25 Sporulation is an elaborate process in which gene expression is temporally and spatially controlled to form a spore. In the mother cell of sporulating B. subtilis, a hierarchical cascade of four transcription factors, oE, SpoIIID, 0K, and lastly, GerE, sequentially control compartrnental gene expression. Negative effects exist in the sporulating mother cell, adding complexity to the regulatory cascade and forming a regulatory network. The significance of these negative links to sporulation was unknown, leading to the research interests in Chapter II and Chapter III of this Dissertation. Since oE, SpoIIID and 0K have been discussed above, below I introduce the other two important regulatory factors in the mother cell transcriptional regulatory network, SpoIIID and GerE. @pearance and The Role of SpoIIID SpoIIID is a small sequence-specific DNA binding protein that binds to DNA sequences resembling WWRRACAR-Y (W is A or T, R is purine, and Y is pyrimidine) (Halberg and Kroos. 1994; Zhang, et al. 1997; IchikaWa and Kroos. 2000). The SpoIIID protein contains 93 amino acids and has a molecular weight of approximately 10.8 kDa (de Lencastre and Piggot. 1979; Tatti, et al. 1991). Translation of the mRNA encoding SpoIIID depends on the translation of a small upstream open reading frame (usd), which is located in between the promoter and the coding sequence of spoIIID (Decatur, et al. 1997). The mRNA for usd-spoIIID contains an inverted repeat sequence and is predicted to form a stem-loop structure. The synthesis of SpoIIID is proposed to require interruption of the stem-loop by translation through the upstream open reading fi'arne (Decatur, et al. 1997). Production of SpoHID starts at approximately 3 h after the initiation of sporulation, peaks at about 5 h into sporulation, and drops sharply thereafter (Halberg and Kroos. 1992). The decrease of SpoIIID after its peak is believed to be the consequence of active 0K RNAP- 26 mediated negative feedback on early gene expression (Zhang and Kroos. 1997) (see below). SpoIIID is predicted to be in the it phage cI superfarnily of helix-tum-helix proteins (Hirnes and Kroos). After spoIIID is transcribed by oE RNAP, SpoIIID works in conjunction with GE RNAP, and later on oK RNAP, as both a repressor and an activator to regulate gene expression in the mother cell of sporulating B. subtilis. As many as 62 transcription units are down-regulated and as least 8 transcription units, including spoIIID (an autoregulation loop) and sigK, are up-regulated by SpoIIID (Eichenberger, et al. 2004). SpoIIID regulates the appearance of CK, the last mother cell-specific sigma factor, by at least two mechanisms. First, SpoHID is required for the chromosomal rearrangement to generate the composite gene (sigK) that encodes pro-o“K (Stragier, et al. 1989; Kunkel, et al. 1990). Second, transcription of sigK absolutely depends on SpoIIID (Kunkel, et al. 1988; Kroos, et al. 1989). Other genes that are regulated by SpoIIID could have important roles in sporulation. For example, SpoIIID negatively regulates a (IE—controlled polysaccharide deacetylase gene homologue (pdaB), which, when mutated, is deficient in spore formation (Fukushima, et al. 2004). The gene encoding an unusual small protein SpoVM (spoVM) is activated by SpoIIID and transcribed by oE RNAP. SpoVM is required for the asymmetric cell division and completion of forespore engulfinent since it is involved in the formation of the “Z-ring”. A possible mechanism is that SpoVM, as a substrate of FtsH, can save FtsZ from degradation by FtsH allowing formation of the “Z-ring” (Srinivasan, et al. 2007; Zhang et al. 1997). Potential impact of SpoIIID on sporulation could also be influenced by the combined action of SpoIIID and GerE on regulation of some cot genes, such as cotC and cotX (Ichikawa and Kroos. 2000). 27 Appem 3ch the Role of GerE GerE is encoded by gerE and is transcribed by GK RNAP at about 4 h after the initiation of sporulation. It works as both an activator and a repressor to regulate the mother cell gene expression. Approximately 36 transcriptional units are down-regulated by GerE, including the sigK gene. At least 27 transcriptional units are up-regulated by GerE, including the cotC and cotD genes (Eichenberger, et al. 2004). GerE binds to the promoter region of sigK and negatively regulates the production of oK (see below). As a consequence, genes in the 0K regulon are generally affected by GerE appearance. It has been shown that SpoIIID and GerE compete for binding sites on promoter regions of some genes, such as cotC (Ichikawa and Kroos. 2000), implying interactions between transcriptional regulators in the mother cell. Negative Links in the Mother Cell Regulatory Network Control of mother cell gene expression in sporulating B. subtilis is accomplished by a cascade of regulators in the order oE-SpoIIID-oK-GerE. A second layer of control, known as negative feed-forward or feedback effects, connects different components of the cascade, increasing complexity of the network. One example of negative feedback is that from UK RNAP on early sporulation genes. Transcriptionally active oK RNAP inhibits the transcription of the sigE operon, resulting in the reduced accumulation of spoIIID mRNA since oE RNAP transcribes spoIIID (Zhang et al. 1999). Two different pathways of 0’" repression of early gene expression have been described. When (7" is made one hour earlier than normal, it appears to exert its negative effect through the SpoOA-P-stimulated transcriptional activation of the sigE operon. When ex is expressed at the normal time, it affects the activity of (5A RNAP, which transcribes the 28 sigE operon (Zhang, et al. 1999). This conclusion is supported by the observation that another early sporulation gene ald is also inhibited when UK is expressed normally (Zhang et al. 1999). ald encodes an alanine dehydrogenase and is also transcribed by oA RNAP. A second example of a negative feedback loop in the mother cell is provided by GerE, which, after its gene is transcribed by GK RNAP, can down-regulate UK by repressing sigK (Ichikawa, et al. 1999). GerE has been shown to inhibit sigK transcription in vitro (Zheng et al. 1992). A gerE mutant shows a two-fold increase in expression of sigK during late sporulation when compared to a strain containing wild-type GerE (Ichikawa, et al. 1999). A third example of negative control is exerted by SpoIIID on cotC expression. The combined action of SpoIIID and GerE regulates the expression of several cot genes (Ichikawa and Kroos. 2000). GerE activates 0K RNAP to transcribe cotC, cotB and cotX by binding to two sites in each promoter region. Meanwhile, SpoIIID provides another level of control on these genes by binding to these promoter regions to repress transcription. An in vitro transcription assay showed that cotC is repressed by a low level of SpoIIID. DNase I footprinting experiments revealed two high-affinity SpoHID binding sites in the cotC promoter region (Ichikawa and Kroos. 2000). These SpoIIID binding sites overlap the binding sites of GerE and 0K RNAP, suggesting that competition for the binding sites regulates cotC transcription. Expression of cotC—lacZ is delayed one hour compared with that of cotB-lacZ. The mRNA of cotC reaches its peak two hours later than the peak time of cotB mRNA (Ichikawa and Kroos. 2000). The difference is believed to be that cotC, but not cotB, is repressed by SpoIIID. The importance of these negative links in the mother cell regulatory network is the question that we address in Chapters H and III of this dissertation. 29 Structure and Properties of the Spore A mature spore is composed of three substructures that play different roles in protection of the spore: the core, the cortex, and the coat. The core is defined as the interior compartment of the spore and houses small acid-soluble proteins (SASP) (Setlow. 1995) that are associated with condensed DNA. The condensed DNA structure is resistant to UV light. The core is surrounded by a cross-linked peptidoglycan layer called cortex. Small molecules such as water can pass through this woven-fabric like structure. However, the core remains dry largely because the cortex constricts the core (Driks. 2003). Finally, at least 60 proteins assemble the multilayer coat of a spore outside the membrane surrounding cortex. Two layers of the coat have been identified by thin-section microscopy: a lightly stained, fine striated inner coat and a darkly stained, coarsely layered outer coat. The resistance properties of a spore are closely related to the physical structure of it. A series of assays have been developed to define spore defects. The heat resistance assay tests the dehydrated state of the spore. The heat-resistant property primarily depends on the maintenance of the cortex and to a lesser extent the coat of the spore (Popham, et al. 1996). The cortex also provides resistance against organic solvents. The lysozyme resistance property is due to the coat (Zheng, et al. 1988). The germination assay tests the permeability of the coat and the sieved-structure of the cortex to germinants (sugar molecules, arrrino acid molecules, etc.). Complementary to these assays are other techniques such as electron microscopy (Cutting et al. 1991; Margolis, et al. 1993) and spore coat protein analysis (Henriques, et al. 1995). A spore morphogenetic mutant may not exhibit defects in all assays. For example, although a cotG mutant showed no strong effects when examined by heat resistance and germination assays, the spore of a cotG 30 mutant shows a significant defect when examined by electron microscopy (Henriques. 1998) Development Transcription Regulatory Network There are two types of transcriptional regulatory networks: the sensory transcription networks, which respond to external stress or nutrients, and the developmental transcription network, which guide differentiation events (Alon. 2003). Interactions within the former happen rapidly and usually are reversible, while interactions within the latter are slow and irreversible (Alon. 2003). The transcriptional regulatory network in the mother cell of sporulating B. subtilis belongs to the developmental transcription network and therefore shares some common characteristics of it. First of all, all transcriptional regulatory networks are built by a set of recuning regulation patterns, called “motifs”. Each motif can carry out certain functions. For example, a negative autoregulation motif can speed up the time of response for a genetic circuit and reduce cell-cell variation in protein level (Alon. 2007). In developmental transcription networks, the following types of motifs are often seen: negative autoregulation, feedforward loop, feedback loop, transcription cascade, single-input modules, and dense overlapping regulons (Alon. 2007). Another common feature of developmental transcription networks is robustness to component tolerances (Alon. 2003). The notion of “robustness” in biology was first brought out by Michael A. Savageau in 1971(Savageau. 1971) and has been widely applied thereafter. Robustness is defined as the ability of a system to maintain performance or phenotypic stability in the face of diverse perturbations and uncertainty such as environmental changes, stochastic events, and genetic variation (Stelling, et al. 2004). 31 Feedback and feedforward controls are common elements in a robust circuit and are thought to be necessary for a robust implementation of exact adaptation. A study in Saccharomyces cerevisiae suggested that in a global network, a topological structure favors robustness (Maslov and Sneppen. 2002). This type of topology has a small number of nodes with very high connectivity, while most nodes have low connectivity. Connections between highly connected nodes are systematically suppressed, whereas connections between highly connected nodes and low-connected nodes are favored. This topology decreases the likelihood of crosstalk between different modules in the network and therefore enhances the overall robustness of the network by localizing perturbation effects (Maslov and Sneppen. 2002). On the other hand, no transcriptional network can tolerate all changes. Sensitivity is required for a transcriptional network to maintain its function. The balance between robustness and sensitivity optimizes the function of a transcriptional network. In this dissertation, we explored the properties of the developmental transcription network in the mother cell of sporulating B. subtilis, by perturbing key nodes within this network. The system showed typical behavior of a transcription network: when a node with high connectivity, SpoIIID in our study, was engineered to maintain the SpoIIID level late during sporulation, this perturbation went beyond the capacity of the system and caused a spore defect. On the other hand, perturbation of another important node, by elimination of GerE negative feedback on sigK, was tolerated, demonstrating robustness of the network. 32 CHAPTER II: Maintaining the Transcriptional Factor SpoIIID Level Late during Sporulation Causes Spore Defects in Bacillus subtilis 33 ABSTRACT During sporulation of Bacillus subtilis, four regulatory proteins act in the order oE, SpoIIID, 0K, and GerE to temporally control gene expression in the mother cell. (IE and 0K work sequentially with core RNA polymerase to transcribe different sets of genes with certain overlapping. SpoIIID and GerE are small, sequence-specific DNA-binding proteins that activate or repress transcription of many genes. Previous studies showed that transcriptionally active 0K RNA polymerase inhibits early mother cell gene expression, reducing accumulation of SpoIIID late in sporulation. Here, the effects of perturbing the mother cell gene regulatory network by maintaining the SpoIIID level late during sporulation are reported. Persistent expression was obtained by fusing spoIIID to the 0K— controlled gerE promoter on a multicopy plasmid. Fewer heat- and lysozyme-resistant spores were produced by the strain with persistent spoIIID expression, but the number of spores resistant to organic solvents was unchanged, as was their germination ability. Transmission electron microscopy showed structural defects in the spore coat. Reporter fusions to oK-dependent promoters showed lower expression of gerE and cotC, and higher expression of cotD. Altered expression of cat genes, which encode spore coat proteins, may account for the spore structural defects. These results suggest that one role of negative feedback by GK RNA polymerase on early mother cell gene expression, is to lower the level of SpoIIID late during sporulation, in order to allow normal expression of genes in the (5K regulon. 34 INTRODUCTION Upon sensing nutrient limitation, the Gram-positive bacterium Bacillus subtilis initiates an adaptive process called sporulation that culminates in the formation of a dormant spore (reviewed in Driks. 2002; Kroos. 2007). During sporulation, B. subtilis undergoes an asymmetric division, forming a larger mother cell (MC) compartment and a smaller forespore (F S) compartment. Different genes are expressed in each compartment. Signaling between MC and the FS ensures precise temporal and spatial control of gene expression. The products of genes expressed in the two cell types cause further morphological changes. The FS is engulfed by the MC membrane, surrounding the F S with two membranes and pinching it off as a protoplast within the MC. Then, cell wall-like material called cortex is deposited between the two membranes of the FS. Next, the spore coat is assembled on the surface of the FS and its interior or core is dehydrated. The mature spore, which is resistant to environmental insults such as heat, ultraviolet light, lytic enzymes, and chemicals, is released by lysis of the MC. Under favorable environmental conditions, the dormant spore gerrninates and forms a growing vegetative cell. In the MC, a hierarchical cascade of four regulatory factors, 05, SpoIIID, 0K and lastly GerE, governs gene expression during sporulation (Zheng and Losick. 1990; Eichenberger, et al. 2004) (Fig. 2.1). The sigE gene is transcribed by 0” RNA polymerase (RNAP) , the major form of RNAP in growing cells, prior to asymmetric division, but initiation of transcription at the promoter of the spoII G operon, which includes sigE, requires phosphorylated SpoOA (SpoOA-P), a key transcription factor that governs entry into the sporulation process (reviewed in Haldenwang. 1995). After formation of the asymmetric septum, SpoOA-P persists in the MC and the product of sigE, pro-GE, accumulates primarily 35 in the MC (Fujita and Losick. 2002; Fujita and Losick. 2003). Pro-oE is cleaved in response to a signal from the FS (Hofrneister, et al. 1995; Karow, et al. 1995; Iondono-Vallejo and Stragier. 1995), fonning active 05 RNAP in the MC, where it transcribes more than 260 genes, including those that encode SpoIIID and pro-oK (Eichenberger, et al. 2004) (Fig. 2.1). SpoIIID is a small sequence-specific DNA-binding protein (Halberg and Kroos. 1994) that positively regulates as least eight transcription units in the OE regulon, including the sigK gene (Fig. 2.1), and negatively regulates at least 62 transcription units (Eichenberger, et al. 2004). SpoIIID also negatively regulates genes in the 0K regulon, including cotC and cotD (Kroos, et al. 1989; Halberg and Kroos. 1994; Ichikawa and Kroos. 2000) (Fig. 2.1), which encode spore coat proteins (Donovan, et al. 1987). The sigK gene encodes pro-oK (Stragier, et al. 1989). Like pro-GE, pro-oK is activated by proteolytic cleavage in response to a FS signal (Cutting et a1. 1990; Lu, et al. 1990), although the mechanisms of signaling and proteolysis are different (reviewed in Kroos. 2007). 0K RNAP transcribes more than 100 genes, including many cot genes that encodes spore coat proteins, and the gene encoding GerE (Eichenberger, et al. 2004) (Fig. 2.1). Like SpoIIID, GerE is a small sequence-specific DNA-binding protein (Zheng et al. 1992). It positively regulates at least 27 transcription units, including the cotC and cotD genes, and negatively regulates at least 36 transcription units (Eichenberger, et al. 2004), including the sigK gene (Zheng et al. 1992; Ichikawa, et al. 1999) (Fig. 2.1). All of the regulatory interactions depicted in Figure 1 are direct effects based on in vitro studies, with one exception. The negative feedback loop fi'om OK to (5A is inferred from in vivo studies (Halberg and Kroos. 1992; Zhang and Kroos. 1997; Zhang, et al. 1999). Transcriptionally active oK RNAP inhibits early MC gene expression, including 36 transcription of sigE by o“A RNAP (Zhang et al. 1999). This results in reduced accumulation of GE and SpoIIID late during sporulation (Halberg and Kroos. 1992; Zhang and Kroos. 1997). Neither the mechanism nor the significance of this negative feedback loop is known. To access its significance, we engineered ectopic expression of spoIIID, such that the SpoHID level was maintained late during sporulation. This resulted in fewer heat- and lysozyme-resistant spores being produced, and most of the spores exhibited a structural change in their coat. Perturbing the MC gene regulatory network in this way also uncovered a novel connection that was unexpected from in vitro studies; persistent spoIIID expression lowered expression of a gerE-lacZ fusion. These results demonstrate the importance of lowering the SpoIIID level late during sporulation, which is one consequence of the (SK-dependent negative feedback loop. 37 Fig. 2.]. Gene regulatory network in the MC during sporulation of B. subtilis. Dashed arrows indicate gene to protein relationships. Solid arrows or lines with barred ends represent positive or negative regulation, respectively. Numbers 1, 2, and 3 represent three negative regulatory loops, respectively. See text for references. 38 A 0A 0E 0K \ ‘l \ll \\’cotD sigE’l spoIIID sigK gerE cotC /' ii/Ki/ SpoOA-P SpoIIID GerE 3 39 MATERIALS AND METHODS Construction of plasmids. A DNA fragment containing the gerE promoter region was synthesized by the polymerase chain reaction (PCR) using primers 5'—GGGAATTCCTGGACGGATGAGGAGAAAG—3' and 5'-GGGAAGCTTGCGAATCAGAAACGAATGG—3', which contain EcoRI and HindIII restriction sites (underlined), respectively. This fragment spans from -96 bp to +33 bp relative to the transcriptional start site of gerE and does not include the ribosomal binding site (Cutting et al. 1989). The PCR product was digested with EcoRI and Hindlll, and ligated into EcoRI-HindIII-digested pDG364 (Karmazyn—Campelli, et al. 1989), resulting in plasmid pRBl (Burri and Kroos.). The sequence of this insert was determined by the Research Technology Support Facility at Michigan State University in order to ensure that no errors occurred during the PCR. A DNA fi'agment containing the spoIIID gene, from +145 to +463 relative to the transcriptional start site of spoIIID (Tatti, et al. 1991), including the ribosomal binding site and the entire coding region, was amplified by PCR using primers 5'-GGAAGCTTAGGGAGGTCGAGTGGTGTG—3' and 5'—CGGATCCCAAGAAGGCAATGCCAGG—3', which contain HindIII and BamHI restriction sites (underlined), respectively. The PCR product was digested with HindIII and BamHI, and ligated with HindHI—BamHI-digested pRBl, resulting in pRB2 (Burri and Kroos). The sequence of the entire PMs-spoIIID firsion in pRB2 was determined as described above. Next, pRB2 was digested with EcoRI and BamHI, the Pgag-spoIIID fragment was purified, and it was ligated with a 6.6-kb fi'agment of EcoRI (partial digestion)-BamHI-digested pDG148 (Stragier, et al. 1988), resulting in pJPl. To construct a control plasmid containing only Pgerg, pJPl was digested with BamHI and HindHI to 40 remove the spoIIID insert. The resulting 6.7-kb fragment was treated with the Klenow fragment of DNA polymerase I and the blunt ends were ligated by T4 DNA ligase, resulting in pJP2. Bacterial strains. Escherichia coli strain AGl 15 [araD139 A(ara,leu) 7697 AlacX 74 gal U galK hsr hsm+ strA (F ' proAB lacFZ::Tn5)] was obtained fiom A. Grossman (Massachusetts Institute of Technology), and used for construction and maintenance of plasmids. Luria-Bertani medium (LB) (Sambrook, et al. 1989) was used to grow E. coli and B. subtilis, and was supplemented with appropriate antibiotics. PY79 (Spo+ prototroph) (Y oungrnan, et al. 1984), BK556 (spoIVCBZ3) (Kunkel, et al. 1989), and OR825 (PY79 SPB::cotC-lacZ ) (Crater, et al. 2002) were provided by R. Losick (Harvard University). EUDC9901 (trpCZ pheAI gerEzzkan) (Crater and Moran. 2002) was provided by C. Moran (Emory University). pJPl was transformed into PY79 and OR825 as described (Harwood and Cutting. 1990), with selection by addition of kanarnycin sulfate (5 rig/ml) to the medium, generating strains BJPl and BJP3, respectively. Sirrrilarly, pJP2 was transformed into PY79 and OR825 to generate strains BJP2 and BJP4, respectively. SPflzzcotD-lacZ and SPB::gerE-lacZ have been described (Cutting et al. 1989; Cutting et al. 1990). Specialized transduction was used to move lacZ firsions into BJPl, BJP2, and PY79 as described (Harwood and Cutting. 1990). Transductants were selected on LB agar containing chlorarnphenicol (5 ug/ml). In each case, at least 10 candidates were toothpicked onto a DSM agar (Harwood and Cutting. 1990) plate with 5-bromo-4-chloro-3-indolyl-B-D- galactopyranoside (40 ug/ml). Three or more isolates with average blue color were saved for firrther analysis, excluding occasional isolates with abnormally high or low 8- galactosidase activity. 41 Cell growth and sporulation. Sporulation was induced by resuspension of cells in SM medium as described (Harwood and Cutting. 1990). The time of resuspension is defined as the onset of sporulation (To). Western blot analysis. Starting at 3 h into sporulation (T3) and at hourly intervals thereafter until T9, 0.5 ml samples were subjected to centrifugation (14,000 g for 1 min), the supematants were removed and cell pellets were stored at -70°C. Preparation of whole- cell extracts, electrophoresis, and electroblotting were as described (Lu, et al. 1990; Halberg and Kroos. 1992). The membranes were probed with anti-SpoIIID antiserum diluted 1:10,000 (Halberg and Kroos. 1992) or polyclonal anti-pro-oK antiserum diluted 1210,000 (Lu, et al. 1990). Irnmunodetection of primary antibodies was as described (Kroos, et al. 2002). Analysis of fl-galactosidase activity. Samples were collected during sporulation as described above. Cell pellets were stored at -70°C prior to the assay. Cells were resuspended, then treated with lysozyme and perrneabilized by toluene as described (Miller. 1972). The B-galactosidase specific activity was determined as described (Miller. 1972) using o-nitrophenol-B-D-galactopyranoside (ONPG) as the substrate. One unit of the enzyme hydrolyzed l umol of substrate per minute per unit of initial culture optical density at 595 nm. Spore purification, and germination and resistance assays. Spores were harvested at T24 by centrifugation at 7,000 g for 10 rrrin, washed with 4°C water, and stored at 4°C overnight. The next day, spores were purified on a step gradient of 20% to 50% RenoCal- 76 (Bracco Diagnostics Inc.) as described (Henriques, et al. 1995). Purity of the spores was verified by microscopy. The germination assay was performed with purified spores using 42 L-alanine (10 mM) as the gerrninant as described (Naclerio, et al. 1996). Assays for resistance to heat, lysozyme, and organic solvents were performed at T24 without spore purification, as described (Harwood and Cutting. 1990). Transmission electron microscopy of spores. Spores were harvested at T24, washed with water, and immediately fixed as described (McPherson, et al. 2005). 43 RESULTS Engineering B. subtilis to maintain the SpoIIID level late during sporulation. In wild-type PY79, the level of SpoIIID reaches a maximum at 5 h into sporulation and decreases thereafter (Halberg and Kroos. 1992) (Fig. 2.2A). To test whether the SpoIIID decrease is important, we initially constructed a B. subtilis strain with a single copy of a PMs—spoIIID fusion integrated at the amyE locus in the chromosome. Unlike the native spoIIID promoter, which is under 0E RNAP control, the gerE promoter is under control of the later-acting oK RNAP (Fig. 2.1). However, at single copy, the PgerpspoIIID fusion had no apparent effect on the level of SpoIIID during sporulation (Burri and Kroos). Therefore, we constructed pJPl, a multicopy plasmid bearing the ngE-spoIIID fusion. pJPl was transformed into PY79, resulting in B. subtilis BJPl. As a control, a plasmid with only Pgag, pJP2, was also transformed into PY79, resulting in strain BJP2. During sporulation, the SpoIIID level in BJP2 decreased after 5 h (Fig. 2.2C), as observed for PY79 (Fig. 2.2A), but in BJPl the level of SpoIIID remained about the same at least until 9 h into sporulation (Fig. 2.2B). We conclude that BJPl maintains the level of SpoIIID late during sporulation. Pro-oK and 0K levels are unchanged in B. subtilis that maintain the SpoIIID level late during sporulation. SpoHID activates or represses many genes in the MC (Halberg and Kroos. 1994; Halberg, et al. 1995; Eichenberger, et al. 2004). One key gene that it activates is sigK (Fig. 2.1), which encodes pro-oK (Stragier, et al. 1989). SpoIIID activates sigK transcription by RNAP containing either oE or ex (Halberg and Kroos. 1994). Hence, maintaining the SpoIIID level late during sporulation might elevate the pro-oK and/or 0K Fig. 2.2. Level of SpoIIID during sporulation. (A) B. subtilis wild-type (WT) PY79, (B) BJPl bearing pJPl with the Pgerg-spoIIID insert, and (C) BJP2 bearing pJP2 with the ngg insert were induced to sporulate by resuspension in SM medium and samples are collected at hourly intervals beginning at 3 h after the onset of sporulation. Equal volumes (5 ul) of whole Cell lysates were fractionated on SDS 14% polyacrlamide gels and subjected to Western blot analysis with anti-SpoIIID antiserum. 45 Time of sporulation (h) 3456789 . ‘MQ/l‘" P -spOIIID WW “'1‘“ "" T“ W ...... SPOHID gerE gerE 46 Fig. 2.3. Pro-oK and 6K levels during sporulation. (A) B. subtilis wild-type (WT) PY79, (B) BJPl , and (C) BJP2 were induce to sporulate and samples were subjected to Western blot analysis as described in the Fig. 2.2 legend except with anti-pro-oK serum. 47 Time of sporulation (h) 3 4 5 6 7 8 9 ,_ V. _ w , pro-CIK WT ...“... «all. will“ \O'K K rim-y, w ‘ “a”. V i . _/ prO'O PgerE'SPOIIID ' " :2 ans.- .1“.— ..V. \CK Pgerg _ e- 8 -- ‘- t" R OK 48 Fig. 2.4. Effects on gene expression. B-galactosidase activity during sporulation after resuspension in SM medium was measured for B. subtilis containing lacZ fused to the (A) gerE, (B) cotC, or (C) cotD promoter in wild-type PY79 (O) or strains bearing multicopy PgaE-spOIIID (I) or Pgerg ( A). Each point is the average of three determinations and error bars show 1 standard deviation of the data. 49 A B-galactosidase activity I 120 ~ A l I oo o i 8 B N O i O (10 ‘ " .d __ __ __ -—-n— -— B-galactosidase activity 4 5 6 7 8 9 Time of sporulation (h) l I -h UT 0) V O o O O r lrf 1 ‘ l 301 N O 1 3 4 5 6 7 8 9 Time of sporulation (h) 50 Fig. 2.4 (continued) 300 r C 250-< I 200 - I 150 e 100 - 5O - B-galactosidase activity Time of sporulation (h) 51 level at late times, if SpoIIID is limiting for transcription of sigK and/or for processing of pro-cK to 0". The levels ofpro-oK and a“ were indistinguishable in PY79, BJPl, and BJP2 (Fig. 2.3). This result indicates that SpoHID is not the limiting factor for pro—oK or oK production late during sporulation. Negative feedback loops in the MC network (Fig. 2.1) may limit 0E and o’K production late during sporulation, counteracting potential activation by SpoIIID of sigK transcription. Maintaining the SpoIIID level late during sporulation alters gene expression. SpoIIID strongly represses transcription of cotD (Halberg and Kroos. 1994; Halberg et al. 1995) and cotC (Ichikawa and Kroos. 2000) by 0" RNAP in vitro, and weakly activates transcription of gerE by (JK RNAP in vitro (Halberg, et al. 1995). Using lacZ reporter fusions to these three promoters, we examined the effect of persistent spoIIID expression late during sporulation. Surprisingly, gerE-lacZ expression was reduced in the strain that maintains the SpoIIID level late during sporulation, as compared with wild type or the control strain with multicopy Pgerg, which were indistinguishable (Fig. 2.4A). This result was unanticipated from the in vitro study (Halberg et al. 1995). It suggests that SpoIIID can directly or indirectly inhibit gerE expression. Since SpoIIID represses cotC transcription by GK RNAP in vitro (Ichikawa and Kroos. 2000), it was not surprising that cotC-lacZ expression was lower in the strain with multicopy Pge,E-spoIIID than in wild type or the control strain bearing multicopy Pgerg (Fig. 2.48). Moreover, GerE activates cotC transcription by GK RNAP in vitro (Zheng et al. 1992), so diminished gerE expression in the Pgerg—spolIID strain (Fig. 2.4A) may also contribute to its diminished cotC-lacZ expression (F i g. 2.4B). Expression of cotD-lacZ 52 rose earlier and reached a higher level in the PgerE-SPOIIID strain than in wild type or the Pgerg control strain (Fig. 2.4C). This may not be surprising in light of the diminished gerE expression in the ngpspoIIID strain (Fig. 4A), because a low level of GerE activates cotD transcription by GK RNAP in vitro, but at a higher level GerE represses (Ichikawa, et al. 1999). Although SpoIIID strongly represses transcription of cotD by oK RNAP in vitro (Halberg and Kroos. 1994; Halberg. et al. 1995), the SpoIIID level in the PgerpspoIIID strain may not be high enough for repression to be the dominant effect. We conclude that maintaining the SpoIIID level late during sporulation lowers gerE- lacZ expression and alters the expression of other genes in the (5K regulon, increasing or decreasing their expression depending on the effects of SpoHID and GerE at particular promoters. Persistent spoIIID expression affects certain spore resistance properties. The effects of maintaining the SpoIIID level late during sporulation on the numbers of heat-, lysozyme-, phenol-, ethanol-, and chloroform-resistant spores were measured. B. subtilis strain BK556 (spoIVCBZ3), which fails to make 0K (Lu, et al. 1990), served as a negative control. In each assay, BK556 produced at least 105 less resistant spores (data not shown) than wild type (PY79 in Fig. 2.5). About 70% of the viable cells for wild-type PY79 and the multicopy Pgerg control strain BJP2 at 24 h after the onset of sporulation were heat-resistant (Fig. 2.5). However, for the multicopy ngpspoIIID strain BJPl , only about 30% of the viable cells were heat-resistant. Statistical analysis of the data indicated no significant difference between PY79 and BJP2, but the differences between these two strains and BJPl were significant (p-values of less 53 Fig. 2.5. Resistance properties of spores. The ratio of colony-forming units after the indicated treatments to before the treatments was determined for B. subtilis wild-type PY79 (white bars), strain BJPl bearing multicopy PgergspolllD (gray bars), and strain BJP2 bearing multiCOpy Pg”); (black bars), at 24 h after resuspension in SM medium. Bars show the average of three determinations and error bars show 1 standard deviation of the data. Asterisks indicate p < 0.05 in the comparison between BJPl, and both PY79 and BJP2. 54 1'79 011' Ratio of Resistance 9.0.0.0 N45000— #— i—i— ei~efie4 O 55 Phenol Ethanol Chloroform than 0.05 in Student t—tests). About 80% of viable PY79 and BJP2 cells were lysozyme- resistant at 24 h after the onset of sporulation, while the number was only about 50% for BJPl (Fig. 2.5). Again, statistical analysis indicated a significant difference (p-values of less than 0.05 in Student t-tests) between BJPl and either PY79 or BJP2, but no significant difference between the two control strains. Resistance to three types of organic solvents was tested: the water-immiscible solvent chloroform, the water-miscible solvent ethanol, and the organic acid phenol. On average, BJPl exhibited slightly less resistance than the two control strains for each treatment (Fig. 2.5), but these differences were not considered statistically significant because no pairwise comparison between the data obtained for two strains treated with the same organic solvent yielded a p-value of less than 0.05 in Student t—tests. Maintaining the SpoIIID level late during sporulation does not impair spore germination. Spores were harvested 24 h after the onset of sporulation and purified. Germination was assayed as the change in absorbance at 580 nm over time after exposure to the germinant L-alanine. A genuination mutant, B. subtilis EUDC9901 (gerE), showed very little change in absorbance even after 55 min (Fig. 2.6). In contrast, the absorbance of wild-type PY7 9 spores decreased rapidly after exposure to L-alanine, and similar results were observed for strains bearing multicopy Pgerg-spoIIID or Pgag. We conclude that spores produced by a strain with persistent spoIIID expression gemrinate normally. Persistent spoIIID expression causes a defect in spore coat structure. To assess the consequences of persistent spoIIID expression on the assembly of cellular structures, we carried out thin-section transmission electron microscopy of spores. Spores from the wild- type (data not shown) and the control strain with multic0py Pgerg (Fig. 2.7A) were 56 Fig. 2.6. Spore germination. B. subtilis wild-type PY79 (:1), strain BJPl bearing multicopy Pgerg-spoIIID (0), strain BJP2 bearing multicopy Pgerg (O), and a gerE mutant EUDC9901 (I) were induced to sporulate by resuspension in SM medium, samples were collected after 24 h, spores were purified, and quantitative germination assays were performed. Each point is the average of three determinations and error bars show 1 standard deviation of the data. 57 ,4 x .. L. .\.\ . _ I 1 “N ‘3 1. _ _ _ _ a _ O O O 0 same ass a 23 20 10 Time (min) 58 Fig. 2.7. Thin-section electron microscopic analysis of spores. Spores fi'om B. subtilis BJP2 bearing multicopy PWE (A) or BJPl bearing multicopy Pgag-spoIIID (B) were harvested 24 h after resuspension in SM medium, washed, and immediately fixed before further processing. The difference in shape of the two spores is insignificant (i.e., both strains, like wild-type PY79, showed a mixture of spherical and ovoid sections). The core (Cr), cortex (Cx), inner coat (IC), outer coat (OC) and ridges (R) are indicated. The bar indicates 200 nm. 59 tbrilis retort 60 indistinguishable. As is characteristic of mature spores, the core, cortex, and inner and outer coat layers, as well as ridges, were readily identified. Approximately 10% of the spores from the strain with multicopy PMs—spoIIID resembled wild-type spores (data not shown). The remaining 90% showed a significant defect in coat assembly. While structures resembling the inner and outer coat layers were present, these were thinner and disorganized (Fig. 2.7B). Additionally, the coat was no longer in close apposition to the cortex and ridges were less evident. 61 DISCUSSION Our results demonstrate that maintaining the SpoIIID level late during sporulation alters expression of genes in the 0K regulon, lowers the number of heat- and lysozyme—resistant spores produced, and causes a defect in spore coat assembly. Clearly, it is important that the SpoIIID level decreases in order for spore formation to proceed normally during the late stages. One contributor to the SpoHID decrease is a negative feedback loop initiated by GK RNAP that inhibits early gene expression in the MC (Halberg and Kroos. 1992; Zhang and Kroos. 1997; Zhang et al. 1999). Our finding that a single copy of the ngpspoIIID fusion was insufficient to detectably boost the SpoIIID level late during sporulation was surprising, as was the possibly related observation that SpoIIID can negatively regulate gerE expression. While multiple copies of Pgag-spoIIID did allow the SpoIIID level to be maintained late during sporulation, the levels of pro-oK and UK were unchanged, indicating that the MC regulatory network is somewhat resistant to perturbation. Such robustness is a common feature of regulatory networks (Alon. 2003; Stelling et al. 2004). Our results reveal elements of both robustness and susceptibility to perturbation in the MC regulatory network. It was surprising that a single copy of PgerrspoIIID did not result in perceptibly higher accumulation of SpoIIID late during sporulation. We chose the gerE promoter because it is strongly transcribed by GK RNAP in vitro (Zheng et al. 1992) with little effect of SpoIIID (Halberg et al. 1995). However, we discovered that in cells bearing multicopy Pg”; spoIIID, the level of SpoIIID is elevated late during sporulation (Fig. 2.2) and gerE-lacZ expression is reduced (Fig. 2. 4A). Hence, SpoIIID might negatively autoregulate Pgerp spoIIID expression, necessitating a high copy number to maintain the SpoIIID level late 62 during sporulation. Alternatively or in addition, one or more post-transcriptional mechanisms might inhibit SpoIIID accumulation late during sporulation. If so, such a mechanism(s) would presumably contribute to the decrease in SpoIIID level observed in wild-type cells late during sporulation (Halberg and Kroos. 1992). Multicopy Pgag exhibited none of the effects of multicopy Pge,g-spoIIID. Both plasmids were derived from pUBl 10, which is maintained at about 50 copies/cell (Maciag et al. 1988). Most of these copies would presumably be in the MC (owing to its larger size) after polar septation. Considering that oK RNAP transcribes approximately 71 genes or operons in the MC during sporulation (Eichenberger, et al. 2004), the Pgerycontaining plasmid is expected to significantly increase the number of (SK-dependent promoters in the MC. Yet, the strain containing this plasmid showed no differences from wild type in any of our assays. Moreover, a multicopy ngpcotC fusion did not lower the number of heat- and lysozyme-resistant spores produced (Wang et al.), as did multicopy ngE-spoIIID (Fig. 2.5). We conclude that neither Pgerg nor Pgerg-cotC titrates 0K RNAP or other cellular resources sufficiently to inhibit sporulation. An earlier study showed that when 0" is produced at a much lower level than normal, it is sufficient for considerable (SK-dependent gene expression and sporulation (Lu and Kroos. 1994). Taken together with our results, it appears that UK is normally made in excess during sporulation. Our results also suggest that the regulatory network resists elevating the levels of pro- 0K and 0K late during sporulation. Transcription of sigK depends absolutely on SpoIIID (Kunkel, et al. 1988). However, maintaining the SpoIIID level late during sporulation did K not elevate the pro-o or UK level (Fig. 2.3). This suggests that some other factor limits sigK expression late during sporulation. By that time, the level of GE is decreased due to 63 negative feedback by GK RNAP (Zhang and Kroos. 1997), so only 0K RNAP can transcribe sigK. One factor known to limit sigK transcription is GerE (Zheng et al. 1992; Ichikawa, et al. 1999). In a gerE mutant, sigK expression is elevated about twofold (Ichikawa, et al. 1999). A mutation in the GerE binding site in the sigK promoter region elevates the pro-oK and 0K levels approximately twofold during sporulation (Wang et al.). However, no further K or oK level was observed when multicopy Pgerg-spoIIID was enhancement of the pro-o introduced into the binding site mutant (Wang et al.). Under these conditions, neither SpoIIID (acting positively) nor GerE (acting negatively) should limit sigK expression late during sporulation. Perhaps under these conditions, the ability to process pro-oK to active cK becomes the limiting factor. Given the unchanged level of OK in cells engineered to maintain the SpoIIID level late during sporulation, we would not have predicted the observed decrease in gerE-lacZ expression (Fig. 2.4A), because 0“ RNAP transcribes gerE and SpoHID has little effect, based on in vitro studies (Halberg et al. 1995). The same gerE-promoter-contairring fragment (-96 to +170) used in the in vitro study was used to create the gerE-lacZ translational firsion used here, so it is unlikely that the gerE-lacZ fusion has an additional SpoIIID binding site. Nevertheless, further experiments are warranted to test whether maintaining the SpoIIID level late during sporulation inhibits gerE expression (e.g., by measuring gerE mRNA and GerE protein levels), since this appears to be a previously unknown connection in the MC regulatory network, coordinating the disappearance of SpoIIID with the appearance of GerE. Maintaining the SpoIIID level late during sporulation decreased expression of cotC- lacZ (Fig. 2.4B) and increased that of cotD-lacZ (Fig. 2.4C). These effects can be 64 understood from the effects of SpoIIID and GerE on transcription of cotC (Zheng et al. 1992; Ichikawa and Kroos. 2000) and cotD (Halberg and Kroos. 1994; Halberg et al. 1995; Ichikawa, et al. 1999) by GK RNAP in vitro. We predict that expression of other genes in the 0K regulon, whose transcription is influenced by SpoIIID and/or GerE, is also altered in cells engineered to maintain the SpoIIID level late during sporulation. Only 4 genes in the o”K regulon have been shown to be influenced by SpoIIID (Halberg and Kroos. 1994; Ichikawa and Kroos. 2000), but 53 genes or operons have been shown to be positively or negatively regulated by GerE, based on genome-wide DNA microarray expression profiling experiments (Eichenberger, et al. 2004). Altered expression of genes in the OK regulon presumably causes the altered spore resistance properties (Fig. 2.5) and the spore coat structural defects (Fig. 2.7B) observed for spores derived from cells with persistent spoIIID expression. Interestingly, the coat protein composition of these spores is not detectably altered, as determined by SDS-PAGE analysis of SDS-extractable coat proteins (data not shown). We interpret this as evidence that proper assembly of the coat layers depends on proper regulation of coat protein synthesis, not just on the final protein composition. Most likely, the normal changes in the levels of SpoIIID and GerE regulate coat protein levels such that pathological interactions are suppressed. In this view, when the SpoHID level is maintained late during sporulation, coat proteins that would not normally be present simultaneously at significant levels are able to interact inappropriately, with pathological consequences. Therefore, while a small subset of critical coat proteins play a predominant role in the assembly of the coat layers (as is argued by the current models for coat assembly) (Driks. 2002; Kirrr, et al. 2006), pr0per regulation of other coat proteins is also required for proper coat organization. 65 The nature of the spore defect caused by maintaining the SpoIIID level late during sporulation is intriguing. Resistance of the spore to environmental insults is due both to the complex structure of its cortex and coat, and to the unique physiological state of the core (reviewed in Driks. 2002; Chada, et al. 2003). It is believed that the cortex confines the core of the spore by forming a woven fabric-like structure, producing a highly dehydrated state that is resistant to heat. On the other hand, lysozyme resistance is largely due to the coat, which shields the cortex from the enzyme. The defect in lysozyme resistance of spores derived from cells with persistent spoIIID expression (Fig. 2.5) might be explained by their defect in spore coat structure (Fig. 2.78). Although gross cortex and core defects were not evident by electron microscopic analysis of these spores, subtle defects are implied since more than half lost their ability to resist the heat treatment (Fig. 2.5). The electron microscopic analysis of spores derived from cells with persistent spoIIID expression revealed that typically much of the coat did not contact the cortex and that ridges were less evident than for wild-type spores (Fig. 2.7). These observations suggest an inability of the coat to maintain the folded, contracted state that appears to be responsible for the ridges (Chada, et al. 2003; Driks. 2004; Plomp, et al. 2005; Plomp, et al. 2005; Plomp, et al. 2005). Previous work implicated CotE (possibly indirectly) in coat folding (Chada, et al. 2003). The present study suggests that improper regulation of coat protein levels can disrupt folding and that this phenomenon is not simply due to the presence or absence of a single protein. The impact of maintaining the SpoIIID level late during sporulation depends to some extent on the conditions used to initiate the sporulation process. In the experiments documented in the Results, sporulation was initiated by centrifugal collection of growing 66 cells followed by resuspension in SM medium lacking nutrients. When sporulation was instead initiated by growth in DS medium followed by nutrient exhaustion (Harwood and Cutting. 1990), similar results as shown in Figures 2-4 were observed, but the effects of persistent spoIIID expression on spore resistance properties were diminished such that none of the differences were statistically significant by the criterion (p-value of less than 0.05 in a Student t-test) we used (data not shown). These results indicate that the method of sporulation initiation influences susceptibility to perturbation of the SpoIIID level late during sporulation, at least in terms of spore resistance properties. A connection between the method of sporulation initiation and expression of cotC late during sporulation was observed previously (Zheng and Losick. 1990). Recently, aconitase, a Krebs cycle enzyme, was shown to be required for efficient late-sporulation gene expression, apparently because it binds to the 3' untranslated region of gerE mRNA, facilitating its accumulation (Serio, et al. 2006). Aconitase provides a plausible link between early and late events during sporulation since the citB gene, which encodes aconitase, is induced during late exponential phase in nutrient-exhausted medium (Dingman, et al. 1987). Obviously, the MC gene regulatory network is more complex than depicted in Figure 1 and much remains to be learned about how entry into sporulation influences network characteristics and output. 67 ACKNOWLEDGMENTS We thank R. Burri for constructing pRBl and pRB2, and conducting preliminary studies with PMs-spoIIID at single copy. We also thank R. Losick, A. Grossman, and C. Moran for providing bacterial strains. This work was supported by NIH Grant GM435 85 and by the Michigan Agricultural Experiment Station. 68 CHAPTER HI: One Perturbation of the Mother Cell Gene Regulatory Network Suppresses the Effects of Another During Sporulation of Bacillus subtilis 69 ABSTRACT In the mother cell of sporulating Bacillus subtilis, a regulatory network functions to control gene expression. Four transcription factors act sequentially in the order O'E, SpoIIID, OK, then GerE. (SE and 0K direct RNA polymerase to transcribe different regulons. SpoHID and GerE are small sequence-specific DNA-binding proteins that activate or repress transcription of many genes in the GE and 0K regulons, respectively. Several negative regulatory loops add complexity to the network. First, transcriptionally active 0K RNA polymerase inhibits early sporulation gene expression, resulting in reduced accumulation of (IE and SpoIIID late during sporulation. Second, GerE represses sigK transcription, reducing oK accumulation about twofold. Third, SpoIIID represses cotC, which encodes a spore coat protein, delaying its transcription by oK RNA polymerase. Circumventing the first regulatory loop by engineering cells to maintain the SpoIIID level late during sporulation causes spore defects (Chapter 11). Here, the results of circumventing the second regulatory loop by mutating the GerE binding sites in the sigK promoter region are reported. Accumulation of pro-oK and (1K increased but this did not cause a detectable spore defect. It did alter expression of (SK-dependent reporter fusions, increasing that of gerE-lacZ and cotC-lacZ, and decreasing that of cotD-lacZ. Because these effects on gene expression were the opposite of those observed when SpoIIID was maintained late during sporulation, cells were engineered to simultaneously circumvent both regulatory loops. This restored expression of (SK-dependent reporters to wild-type levels and suppressed the spore defects observed when only the first regulatory loop was circumvented. Circumventing the third regulatory loop by engineering cells to express cotC about 2 h earlier than normal did not cause a spore defect. This is not surprising since cotC is one of many targets of the mother 70 cell regulatory network. On the other hand, GE, SpoIIID, 0K, and GerE are network nodes, each affecting the expression of many target genes. Circumventing the second regulatory loop impacted two nodes ((5K and GerE) but did not detectably alter network output (spores). Yet, this perturbation compensated for the effects of perturbing the first regulatory loop in a way that impacts two nodes (SpoIIID and GerE) and causes spore defects. By feeding information back into the network, the first and second negative regulatory loops appear to optimize target gene expression and increase network robustness. 71 INTRODUCTION When starved, the Gram-positive bacterium Bacillus subtilis initiates a process called sporulation in order to form a dormant spore (Driks. 2002; Kroos. 2007). Sporulation is a complex developmental process in which morphological changes are coupled to temporal ' and spatial regulation of gene expression. An early morphological change is the formation of an asymmetrically-positioned septum that divides the cell into a larger mother cell (MC) compartment and a smaller forespore (F S) compartment. Completion of DNA replication ensures that a copy of the chromosome is available for each compartment. The MC engulfs the F S, pinching it off as a protoplast within the MC. Cortex, a modified peptidoglycan, is synthesized between the two membranes that surround to F S after engulfinent. Proteins assemble on the surface of the F S, producing the coat. Eventually, the mature spore is released by lysis of the MC. The spore is resistant to harsh conditions such as high temperature and exposure to UV light, lytic enzymes and chemicals. The spore will germinate in the presence of nutrients and grow vegetatively. Distinct temporal pro grams of gene expression occur in the two compartments, but signaling pathways between the compartments coordinate the two programs and morphogenesis. In the MC, a regulatory network controls gene expression during sporulation (reviewed in Kroos. 2007). The backbone of network consists of a cascade of four regulatory factors (0E, SpoHID, ox, and GerE) (Zheng and Losick. 1990), but several loops are also present in the network (Fig. 3.1). Synthesis of GE requires O'K RNA polymerase (RNAP), the major form of RNAP in growing cells, and phosphorylated SpoOA (SpoOA-P), a response regulator that governs initiation of sporulation (reviewed in Haldenwang. 1995). The initial product of sigE is inactive pro-0E. It is cleaved to active GE 72 in response to a signal from the FS (Hofineister, et al. 1995; Karow, et al. 1995; Londono- Vallejo and Stragier. 1995). GE RNAP transcribes many genes, including spoIIID and sigK (Fig. 3.1), and others whose products contribute to engulfinent and synthesis of the spore cortex and coat (Eichenberger, et al. 2004; Steil, et al. 2005). SpoIIID is a DNA-binding protein that activates transcription of sigK by oE RNAP and 0K RNAP (Halberg and Kroos. 1994; Kroos, et al. 1989) (Fig. 3.1). SpoIIID also positively regulates at least 7 other transcription units and negatively regulates at least 62 transcription units in the GE regulon (Eichenberger, et al. 2004). Also, SpoIIID negatively regulates certain genes in the 0K regulon, such as cotC and cotD (Kroos, et al. 1989; Halberg, et al. 1995; Ichikawa and Kroos. 2000) (Fig. 3.1), which encode spore coat proteins (Donovan, et al. 1987). 01‘, like 05, is first made as an inactive precursor protein that is cleaved in response to a signal from the FS (Cutting et al. 1990; Lu, et al. 1990; reviewed in Kroos. 2007). 0K RNAP transcribes many genes, including gerE (Fig. 3.1), and others whose products contribute to synthesis of the spore cortex and coat (Eichenberger, et al. 2004; Steil, et al. 2005). Like SpoIIID, GerE is a DNA-binding protein, but it activates transcription of certain cot genes, such as cotC and cotD (Zheng et al. 1992), having the opposite effect as SpoIIID (Fig. 3.1). In addition, GerE positively regulates at least 25 other transcription units in the 0K regulon, and negatively regulates at least 36 transcription units (Eichenberger, et al. 2004), including sigK (Zheng et al. 1992; Ichikawa, et al. 1999) (Fig. 3.1). Three negative regulatory loops in the MC network are shown in Fig. 3.1. First, transcriptionally active (SK RNAP inhibits early gene expression under oA control, resulting in reduced accumulation of GE and SpoHID late during sporulation (Halberg and Kroos. 1992; Zhang and Kroos. 1997; Zhang et al. 1999). Second, GerE represses sigK 73 Fig. 3.1. Gene regulatory network in the MC during sporulation of B. subtilis. Dashed arrows indicate gene to protein relationships. Solid arrows or lines with barred ends represent positive or negative regulation, respectively. Numbers 1, 2, and 3 represent three negative regulatory loops, respectively. See text for references. 74 A CA 0E 0K shed \ l \ ll \\‘cotD sigE ’/ spoIIID sigK gerE cotC / ii/xi/ V SpoOA-P SpoII Ge'rE 3 75 transcription, lowering the UK level about twofold (Ichikawa, et al. 1999). Third, SpoIIID represses cotC transcription, delaying its expression by at least one hour compared with other genes under positive control of OK RNAP and GerE (Ichikawa and Kroos. 2000) How important are the three negative regulatory loops for sporulation? To begin to address this question, we previously engineered B. subtilis to circumvent the decrease in the level of spoIIID late during sporulation, which is normally brought about by the first negative regulatory loop involving 0K RNAP (Chapter II). We found that maintaining that SpoIIID level late during sporulation resulted in altered expression of (SK-dependent genes, lower numbers of resistant spores, and a structural defect in the coat of most spores that were produced. Here, we report the effect of mutating the GerE binding site in the sigK promoter, which eliminates the second negative regulatory loop, GerE repression of sigK transcription (Fig. 3.1). Expression of (SK-dependent genes was altered, but the effects were opposite those observed when the SpoIIID level was maintained late during sporulation. Elimination of GerE negative feedback on sigK transcription did not cause detectable spore defects. Interestingly though, it suppressed the defects caused by maintaining SpoIIID level late during sporulation. In the strain with both perturbations, expression of oK-dependent genes was restored to wild-type levels. We also engineered B. subtilis to circumvent the third negative regulatory loop, SpoIIID repression of cotC (Fig. 3.1). Expressing cotC approximately 2 hours earlier than normal did not cause detectable spore defects. Taken together, these results suggest that the second and third negative regulatory loops are less important for sporulation than the first, but that the first and second loops exert opposing effects, fine-tuning expression of target genes in order to optimize spore formation. 76 MATERIALS AND METHODS Site-directed mutagenesis and construction of plasmids. A plasmid bearing the sigK promoter (starting at -108) and the entire coding region was constructed in several steps. First, pRG2 (Prince et a1 2005) was digested with BamHI and annealed oligonucleotides (5’-GATCCCACCACCACCACCACCACTAA-3’ and 5’- GATCTTAGTGGTGGTGGTGGTGGTGG-3’) were inserted in the orientation that preserved the BamHI site at the 3’ end of sigK, generating pHPl. Second, the QuikChange Site-Directed Mutagenesis Kit (Stratagene) was used with primers 5’- GGCTTTTGCCTACA_A_GCTTTTGTGGAGGTGACG-3’ and 5’- CGTCACCTCCACAAAAGC_T'TGTAGGCAAAAGCC-3’ (mutant nucleotides are underlined), and pHPl as template, to introduce a HindIII site between the sigK promoter and ribosome binding site, generating pHP12, for which the sigK sequence was verified. Third, site-directed mutagenesis was likewise performed with primers 5’- CCCGAAAAGTGCCACCTGGIGTCTAAGAAACCB ’ and 5 ’- GGTTTCTTAGACACCAGGTGGCACTTTTCGGG-T, using pDG364 as template to eliminate its AatII site, generating pHP13. Finally, the sigK-containing EcoRI-BamHI fragment from pI-IP12 was gel-purified and ligated into EcoRI-BamHI-digested pHPl3, generating pHP14, which due to the BamHI site and vector adds four codons (specifying the amino acids GSPA) to the 3’ end of sigK. This sigK allele is flanked by the 5’ and 3’ ends of amyE and it complements a sigK mutant when it replaces the normal amyE gene in the B. subtilis chromosome (see below). The plasmid pHP14 was the template for site- directed mutagenesis designed to eliminate the GerE binding site in the sigK promoter 77 region. . Four nucleotide changes, GG to CC at +4 and +5, and CC to GG at +12 and +13 were made using primers 5'-CCGGTCACATACATTTACATATAC_C_CTTTTG_G_GTAC ATACTTTTGTGGAGG—3' and 5' —CCTCCACAAAAGTATGTAQCCAAAAGG_GTA TATGTAAATGTATGTGACCGG—3'. The resulting allele in pJP16 was designated sigKmut and was sequenced to confirm the presence of only the desired mutations. In order to express cotC earlier than normal, we used the gerE promoter to drive expression of the cotC gene. A DNA fragment that containing the entire cotC gene from slightly upstream of the cotC ribosomal binding site to slightly downstream of the stop codon, was synthesized using polymerase chain reaction (PCR) and primers 5'—CGAAGCTTTAAAGGAGGAGTATATATGGGTTATTAC—3' and 5'—GCGGATCCACCCGGCAATAGCCGG—3', which contain HindIII and BamHI restriction sites (underlined), respectively, with chromosomal DNA from B. subtilis PY79 as the template. The PCR products were digested with HindIII- BamHI, and ligated with HindIII-BamI-II digested pJPl (Chapter H). The sequence of the entire Pgerg-cotC fusion was determined to ensure that no errors occurred during the PCR. Bacterial strains. Escherichia coli strain AG115 [araD139 A(ara,leu)7697 AlacX74 galU galK hsr hstr strA (F ' proAB lacqu::Tn5)] was obtained from A. Grossman (Massachusetts Institute of Technology). It was used for construction and maintenance of plasmids. Luria—Bertani medium (LB) (Sambrook, et al. 1989) was used to grow E. coli and B. subtilis, and was supplemented with appropriate antibiotics as needed. B. subtilis strains used in this study are listed in Table 3.1. The plasmid pJP4 was transformed into PY79 with selection on LB agar containing kanarnycin sulfate (5 rig/ml) to generate strain BJP3. Plasmids pJPl4 and pJP16 bearing wild-type sigK and the sigKmut allele, 78 Table 3.1. List of B. subtilis strains used in the study Strain Genotype or derivation Source or reference + (Y oungrnarr, PY79 Spo prototroph e t a l. 1984) .. , (Crater, et al. OR825 SPO..cotC—lacZ/Cm 2002) .. r (Crater and EUDC9901 trpCtheAl gerE..kan/Km Moran. 2002) (Kunkel, et BK556 spoIVCBZ3 a l. 1989) .. , (Donovan, et BD071 c0tC..cat/Cm . a l. 1987) BJPl PY79 transformed with pJPl (PgerpspollIDmer Chapter H BJP2 PY79 transformed with pJP2(Pg,,,E)/Kmr Chapter II BJP3 PY79 transformed with pJP4(Pg.,,E-cotC)/Kmr This study BLWl BKS 56 transformed with pHP6(amyE::sigK)/Cmr This study BLW2 BK556 transformed with pJP16(amyE::sigKmut)/Cmr This study BLW3 BLWl transformed with pJPl/Km'Cmr This study BLW4 BLW2 transformed with pJPl/Km’Cmr This study BLWS BLWl transformed with pCm::Sp/Spr This study BLW6 BLW2 transformed with pCm::Sp/Spr This study BLW7 BLW3 transformed with pCm::Sp/Km'ISpr This study BLW8 BLW4 transformed with pCm::Sp/Km'Spr This study 79 Fig. 3.2. Mutation made in the GerE binding site in the sigK promoter region. The top line shows the consensus sequence for GerE binding (Zhang et al. 1994) in which R means A or G, W means A or T, Y means C or T, and N means A, G, C, or T. The bottom line shows the sequence in the sigK promoter region where GerE binds, as defined by DNase I footprinting (Henriques, et al. 1995). Numbering is relative to the T83. The rightward arrow indicates a perfect match to the consensus. The leftward arrow indicates a 9 out of 12 match to the consensus on the strand not shown. The downward arrows show the 4 changes in the sigKmut allele. 8O lire top rich R bottom had by SS. The dicaies i ws Show Consensus: RWWTRGGYNNYY -2 +1 +4 +12 Sng: ACATATAGGCAI I I I'GCQTACATAC I I I CC G6 81 respectively, were transformed into BK556 with selection on LB agar containing chloramphenicol (Sag/ml). Strains in which amyE was replaced by sigK (BLWl) or sigKmut (BLW2) were identified as described (Cutting and Horn. 1990). pJPl (a multicopy plasmid with a PgergspoIIID fusion, Chapter II) was transformed into BLWl and BLW2 with selection on LB agar containing chloramphenicol (5 jig/ml) and kanamycin sulfate (5 jig/ml) to generate strains BLW3 and BLW4, respectively. The chloramphenicol resistance gene of BLWl, BLW2, BLW3 and BLW4 was replaced with the spectinomycin resistance gene of pCm::Sp as described (Steinmetz and Richter. 1994), generating strain BLW5, BLW6, BLW7 and BLW8, respectively. A lysate containing SPB::cotC—lacZ was obtained by heat induction of strain OR825 as described (Cutting and Horn. 1990). SPB::cotD-IacZ and SPfizzgerE-lacZ have been described (Cutting et al. 1989; Cutting et al. 1990). Specialized transduction was used to move lacZ fusions into BLW5, BLW6, BLW7 and BLW8 as described (Harwood and Cutting. 1990). Transductants were selected on LB agar containing chloramphenicol (5 jig/ml). In each case, at least 10 candidates of isolates were transferred onto a DSM agar (Harwood and Cutting. 1990) plate with 5-bromo-4- chloro-3-indolyl-B-D-galactopyranoside (40 ug/ml). Three or more isolates with average blue color were saved for further analysis, excluding occasional isolates with abnormally high or low B-galactosidase activity. Cell growth and sporulation. Sporulation was induced by resuspension of cells in SM medium as described (Harwood and Cutting. 1990). The time of resuspension is defined as the onset of sporulation (To). Western blot analysis. Starting at 3 h into sporulation (T3) and at hourly intervals thereafter until T9, 0.5 ml samples were subjected to centrifugation (14,000 g for 1 min), 82 the supematants were removed and cell pellets were stored at —70°C. Preparation of whole- cell extracts, electrophoresis, and electroblotting were as described (Lu, et al. 1990; Halberg and Kroos. 1992). The blots were probed with polyclonal anti-SpoIIID antisenrm diluted 1:10,000 (Halberg and Kroos. 1992), polyclonal anti-pro-o'K antiserum diluted 1:10,000 (Lu, et al. 1990), or polyclonal anti-CotC antibodies diluted 1:10,000 (Isticato, et al. 2004). Irnmunodetection of primary antibodies was as described (Kroos, et al. 2002). Analysis of fl-galactosidase activity. Samples were collected during sporulation as described above. Cell pellets were stored at -70°C prior to the assay. Cells were resuspended, then treated with lysozyme and perrneabilized by toluene as described (Miller. 1972). The B-galactosidase specific activity was determined as described (Miller. 1972) using o-nitrophenol—B-D-galactopyranoside as the substrate. One unit of the enzyme hydrolyzed 1 mo] of substrate per minute per unit of initial culture optical density at 595 nm. Spore purification, and germination and resistance assays. Spores were harvested at T24 by centrifugation at 7,000 g for 10 min, washed with 4°C water once, and stored at 4°C overnight. The next day, spores were purified on a step gradient of 20% to 50% RenoCal- 76 (Bracco Diagnostics Inc.) as described (Henriques, et al. 1995). Purity of the spores was verified by microscopy. The genrrination assay was performed with purified spores using L-alanine (10 mM) as the germinant as described (Naclerio, et al. 1996). Assays for resistance to heat, lysozyme, and organic solvents were performed at T24 without spore purification, as described (Harwood and Cutting. 1990). Transmission electron microscopy of spores. Spores were harvested at T24, washed with water, and immediately fixed as described (McPherson, et al. 2005). 83 RESULTS Engineering B. subtilis to circumvent GerE repression of sigK. GerE binds to a site overlapping the sigK TSS and represses sigK transcription about twofold (Ichikawa, et al. 1999). Within the GerE binding site are two sequences that match the consensus sequence for GerE binding (Fig. 3.2). To assess the importance of sigK repression by GerE, we mutated two nucleotides in each GerE binding site in sigK promoter region (Fig. 3.2). A previous study showed that changing GG to TT near the center of the GerE binding site in the cotH promoter region impaired GerE repression of cotH transcription (Baccigalupi, et al. 2004). We changed GG at +4 and +5 to CC, and CC at +12 and +13 to GG in the sigK promoter region (Fig. 3.2). This mutant allele of sigK, including the promoter and the entire coding region, was integrated at the amyE locus of sigK mutant B. subtilis BK556, creating BLW2 (sigK amyEzzsigKmut). As a control, a wild type sigK allele was integrated at the amyE locus of the sigK mutant, creating BLWl (sigK amyE::sigK). BLWl and BLW2 were grown and induced to sporulate along with B. subtilis wild type PY79 as an additional control. Samples were collected during sporulation and whole-cell extracts were subjected to Western blot analysis to detect pro-oK and 0K. The levels of pro—oK and (5K were higher in the sigK amyE::sigKmut strain than in either control strain, starting at 5 h into sporulation (Fig. 3.3A-C). The pro-oK and 0K levels were sirrrilar in the two control strains. The effect of the sigKmut allele on sigK expression was similar to the effect of a gerE null mutation (Ichikawa, et al. 1999), suggesting that GerE repression of sigK is eliminated in BLW2. 84 Fig. 3.3. Levels of pro-cK and 0" during sporulation. B. subtilis wild-type (WT) PY79, BLWl (sigK amyE::sigK), BLW2 (sigK amyE::sigKmut), BLW3 (sigK amyE::sigK Pgerg- spoIIID), and BLW4 (sigK amyE::sigKmut ngE—spoIIID) were sporulated by resuspension in SM medium. Samples were collected at hourly intervals beginning at 3 h after the initiation of sporulation. Equal volumes (5 ul) of whole-cell lysates were fractionated on SDS 14% polyacrlamide gels and subjected to Western blot analysis with anti-pro-oK antiserum. 85 Time of sporulation (h) 3 4 5 6 7 8 9 V V , g . Jpro-o K . .....- ...... ...... _/ pro-o K sigK amyE::sng , * ...... - m. ...... ~ \0 K . . . - . ~ , _ , _ _/pro-o K sng amyE::sngmut ...-«.- t“ “as... m \C K - .. - ...... ...... V, -. _ ‘ _/pro-o K sng amyE..sng PgerE-spOIIID m air. ...-.... ...... O K V (K , _ x sigK amyE::sigKmut Pgerg-spoIIID ' ' a “My... .... <8? 0 86 Effects of circumventing GerE repression of sigK. Because 0K acts after SpoIIID in the MC gene regulatory network (Fig. 3.1), we did not expect the SpoIIID level during sporulation to be altered in the sigK amyE::sigKmut strain. Indeed, it was indistinguishable from that in wild type and the sigK amyE::sigK strain (Fig. 3.4). To test whether expression of (SK-dependent genes was affected by the elevated level of OK in BLW2, we measured B—galactosidase activity fiom lacZ fusions to gerE, cotC and cotD during sporulation. In order to introduce lacZ fusions with associated Cmr markers into strains BLW2 and BLWl, we replaced their Cmr cassettes with Spr cassettes, creating BLW6 and BLW5, respectively (Table 3.1). Expression from gerE-lacZ and cotC-lacZ was elevated in BLW6 relative to the BLW5 and PY79 control strains (Fig. 3.5A—B). Apparently, elevated 0K in sporulating cells can increase transcription of (Ix-dependent genes. Interestingly, expression from cotD-lacZ was reduced in BLW6 relative to the control strains (Fig. 3.5C). This might be due to an elevated level of GerE since a high level of GerE repressed cotD transcription by oK RNAP in vitro (Ichikawa, et al. 1999). Circumventing GerE repression of sigK compensates for persistent spoIIID expression. The effects on expression of the three oK-dependent reporters (Fig. 3.5) were the opposite of the effects observed previously when cells were engineered to maintain the SpoIIID level late during sporulation (Chapter II). In that study, SpoIIID was expressed ectopically from a multicopy plasmid bearing a Pgerg-spoIIID fusion. Introduction of multicopy PgerES‘DOIIID into the sigK amyE::sigKmut background (creating BLW4 initially, then replacing its Cmr cassette with a Spr cassette to create BLW8 for introduction of lacZ fusions; Table 3.1) restored expression of gerE-lacZ, cotC-lacZ, and cotD-lacZ to 87 Fig. 3.4. Levels of SpoIIID during sporulation. B. subtilis wild—type (WT) PY79, BLWl (sigK amyE::sigK), BLW2 (sigK amyE::sigKmut), BLW3 (sigK amyE::sigK ngg—spOIIID), and BLW4 (sigK amyE::sigKmut Pyle-spoIIID) were sporulated by resuspension in SM medium. Samples were collected and subjected to Western blot analysis as described in the Fig. 3.3 legend except anti-SpoHID antiserum was used. Numbers indicate the h into sporulation. 88 Time of sporulation (h) 3 4 5 6 7 8 9 _r sigK amyE::sigK ”an a“ altar, .. :~. sigK amyE::sigKmut w * an en... -.. __ SpoIIID -Sp0[IID M“*““ ...-t... _ gerE gerE-spoIIID w w WWW m._ sigK amyE::sigK P sigK amyE::sigKmut P 89 Fig. 3.4. Levels of SpoIIID during sporulation. B. subtilis wild-type (WT) PY79, BLWl (sigK amyE::sigK), BLW2 (sigK amyE::sigKmut), BLW3 (sigK amyE::sigK PgerpspolIID), and BLW4 (sigK amyE::sigKmut Pgerg-spoIIID) were sporulated by resuspension in SM medium. Samples were collected and subjected to Western blot analysis as described in the Fig. 3.3 legend except anti-SpoIIID antiserum was used. Numbers indicate the h into sporulation. 88 Time of sporulation (h) 3 4 5 6 7 8 9 sigK amyE::sigK “W i“ 2* 393i: “a. -- . > _4 sigK amyE::sigKmut “m * “’fi M --— SpoIIID sigK amyE::sigK PgerE-spOIIIDWflIwfl-rmm s... —— sigK amyE::sigKmut Pgerg-spoIIID ‘y W “mm «was -— 89 the levels observed in the wild-type PY79 and sigK amyE::sigK BLW5 control strains (Fig. 3.5). In contrast, introduction of multicopy ngg-spOIIID into the sigK amyE::sigK background (creating BLW3 initially, then replacing its Cmr cassette with a Sp‘r cassette to create BLW7 for introduction of lacZ fusions; Table 1) decreased expression of gerE-lacZ and cotC-lacZ, and increased that of cotD-lacZ (Fig. 3.5), similar to the effects of multicopy PMs-spoIIID in an otherwise wild-type background (Chapter H). As expected, both BLW3 and BLW4 exhibited a higher level of SpoIIID late during sporulation than strains without Pgag-spoIIID (Fig. 3.4). Also as expected, the levels of pro-oK and UK were higher starting at 5 h into sporulation in BLW4 and BLW8 than in strains without amyE::sigKmut (Fig. 3.3). Elevated UK in BLW4 appears to compensate for elevated SpoIIID, restoring gerE, cotC, and cotD expression to wild-type levels. Does circumventing GerE repression of sigK with the sigKmut allele compensate for the other effects of persistent spoIIID expression from PgeryspoIIID, which includes defects in spore resistance properties and coat assembly (Chapter II)? Figure 3.6 shows that BLW4 produced heat- and lysozyme-resistant spores as efficiently as wild-type. These spores germinated normally in response to L—alanine (Fig. 3.7) and were indistinguishable from wild-type PY79 spores when examined by thin-section transmission electron microscopy (data not shown). By the criteria we tested, elevated 0K in BLW4 appeared to fully suppress the sporulation defects caused by maintaining the SpoIIH) level during the late stages. In contrast to strain BLW4 and as expected from our previous study (Chapter II), strain BLW3 in which the SpoIIID level was maintained late during sporulation without elevated 90 Fig. 3.5. Effects on gene expression. B—galactosidase activity during spomlation after resuspension in SM medium was measured for B. subtilis containing lacZ fused to the (A) gerE, (B) cotC, or (C) cotD promoter in wild-type PY79 (A), BLW5 (sigK amyE::sigK) (9 ), BLW6 (sigK amyE::sigKmut) (I), BLW7 (sigK amyE::sigK Pgerg-spoIIID) (o), and BLW8 (sigK amyEx sigKmut Pgerg-spoIIID) ([3). Each point is the average of three determinations and error bars show 1 standard deviation of the data. 91 180 - _ O 6 1|. 5 ‘4 _ p p — 0 0 O 0 O 0 _ 0 4 8642 120 r l 1 5333.. canvases—«Gun 3 Time (h) into sporulation 92 B Fig. 3.5 (continued) 0 \I 00 O C C If I 1 y N W O O l l ‘ fl-galactosidase activity A O y—e O 2 3 4 5 6 7 8 Time (h) into sporulation 93 Fig. 3.5 (continued) Time (h) into spomlation 94 0K produced significantly less heat- and lysozyme-resistant spores (Fig. 3.6). Also as expected (Chapter H), these spores exhibited similar defects in coat assembly as strain BJPI (containing Pgwg-spoIIID in an otherwise wild-type background; data not shown), but nevertheless germinated normally (Fig. 3.7). Despite elevated 0K (Fig. 3.3) and altered expression of (SK-dependent genes (Fig. 3.5), strain BLW2 produced heat- and lysozyme-resistant spores as efficiently as the control strain BLWl and wild-type PY79 (Fig. 3.6). The spores from all three strains germinated similarly (Fig. 3.7) and were indistinguishable when examined by electron microscopy (data not shown). We also measured the ability of strains BLWl, BLW2, BLW3, and BLW4 to produce spores resistant to phenol, ethanol, and chloroform. None of the strains differed significantly (p-value of less than 0.05 by a Student t-test) from wild-type PY79 (data not shown). Effects of circumventing the delay in CotC production. Expression of cotC-lacZ is delayed by 2 h relative to gerE-lacZ expression during sporulation (Fig. 3.5). To determine whether the delay is important for sporulation, we fused expression of cotC to the gerE promoter in a plasmid that can be maintained in B. subtilis in multiple copies. The plasmid was transformed into B. subtilis wild-type PY79, creating BJP4 with multicopy PgapcotC. As a control, a plasmid with Pg”; but lacking cotC was transformed into PY79, creating BJP2. Western blot analysis of whole-cell extracts from sporulating cells showed that in BJP4, CotC accumulates to a low level at 2-4 h into sporulation, perhaps due to read- through transcription from a constitutive promoter on the plasmid, and the level of 95 Fig. 3.6. Resistance properties of spores. The ratio of colony-forming units after the indicated treatments to before the treatments was determined for B. subtilis wild-type PY79 (white), BLWl (sigK amyE::sigK) (Grey), BLW2 (sigK amyE::sigKmut) (Black), BLW3 (sigK amyE::sigK PMs-spoIIID) (stripes), and BLW4 (sigK amyE::sigKmut PMs-SpoIIID) (dots), at 24 h after resuspension in SM medium. Bars show the average of three detenninations and error bars show 1 standard deviation of the data. Asterisks indicate p < 0.05 in the comparison between BLW3, and both PY79 and BLW4. 96 Ratio of Resistance 1.2 — Heat Lysozyme 97 CotC raises beginning at 5 h into sporulation, presumably due to transcription from Pgerg (Fig. 3.8). As expected, the CotC level began to rise about 2 h later, at 7 h into sporulation, in BJP2 and PY79. These results demonstrate that multicopy Pgerg-cotC in BJP4 circumvents the 2-h delay in CotC accumulation. We measured the ability of strains BJP4 and BJP2 to produce Spores resistant to heat, lysozyme, phenol, ethanol, and chloroform. Neither strain differed significantly (p-value of less than 0.05 by a Student t-test) from wild-type PY79 (data not shown). Also, the germination kinetics in response to L-alanine was similar for spores produced by strains BJP4 and BJP2 as compared to PY79 (data not shown). We conclude that accumulating CotC 2 h earlier than normal did not detectably alter spore resistance or germination properties. DISCUSSION Our study resulted in two novel findings about a negative regulatory loop in the MC gene regulatory network. First, circumventing GerE repression of sigK elevated the 0K level and probably the GerE level (since expression of a gerE-lacZ translational firsion increased) but this did not detectably alter spore resistance, germination, or structure. This reveals robustness in the network. Second, circumventing GerE repression of sigK suppressed the effects on sporulation of persistent spoIIID expression. This suggests that negative regulatory loops with opposing effects enhance network robustness and presumably optimize target gene expression. The results of a previous study (Baccigalupi, et al. 2004) aided our effort to circumvent GerE repression of sigK . Initially, we deleted from +5 to +15 relative to the sigK 98 Fig. 3.7. Spore germination. B. subtilis wild-type PY79 (I), BLWI (sigK amyE::sigK) (0), BLW2 (sigK amyE::sigKmut) (A), BLW3 (sigK amyE::sigK PgergvmoIIID) (0), BLW4 (sigK amyE: sigKmut ngE-spoIIID) (El), and EUDC9901(gerE) (A) were induced to sporulate by resuspension in SM medium, samples were collected after 24 h, spores were purified, and quantitative germination assays were performed. Each point is the average of three determinations and error bars show 1 stande deviation of the data. 99 H; .5 ...... +44 J_ 15 20 25 30 35 40 45 50 A .5. - s , NS. - § , \s - V\. , 1.2 ammo 3:5 3 23m 5 10 0 Time (min) 100 transcriptional start site but this did not result in elevated pro-oK and OK levels (data not shown), perhaps due to interference with promoter utilization by RNAP. After learning that a mutation in the GG sequence within the GerE binding site in the cotH promoter region increased cotH-lacZ expression (Baccigalupi, et a1. 2004), we made the sigKmut allele shown in Figure 2. This allele resulted in similar levels of pro-oK and 0K accumulation as observed previously in a gerE null mutant, which accumulated about twofold more total pro-ch/crK than wild type (Ichikawa, et al. 1999). What limits total pro-oK/csK accumulation to about twofold more than in wild type? SpoIIID activates sigK transcription by GE RNAP (Halberg and Kroos. 1994) or UK RNAP (Kroos, et al. 1989). Late in sporulation, the SpoHID and GE levels decrease due to negative feedback by csK RNAP (Halberg and Kroos. 1992; Zhang and Kroos. 1997; Zhang, et al. 1999). This suggested that SpoIIID might become limiting for sigK transcription by GK RNAP; however, this is not the case because introduction of PgaE-spoIIID into the sigK amyE::sigKmut background did not change its pro-<5K or (3“ level (Fig. 3.3). Perhaps processing of pro-oK to active 0K, or degradation of OK, limits accumulation of sigK products under these conditions. Such posttranslational mechanisms would contribute to network robustness by limiting sigK autoregulation in the event that negative regulatory loops (i.e., GerE repression and loss of the SpoIIID activator) that operate at the transcriptional level fail. The elevated 0K level due to the sigKmut allele did not detectably alter the final product of the MC gene regulatory network, the spores. Elevated 0K did not significantly alter the number of heat-, lysozyme-, phenol-, ethanol-, or chloroform-resistant spores produced 101 Fig. 3.8. Levels of CotC during sporulation. B. subtilis wild-type (WT) PY79, BJP2 (Pgmg), BD071 (cotC), and BJP4 (PgergcotC ) were sporulated by resuspension in SM medium. Samples were collected and subjected to Western blot analysis as described in the Fig. 3.3 except anti-CotC antiserum was used. Numbers indicate the h into sporulation. 102 WT P c0tC::cat Pg erE-cotC gerE 45678945678978923456789 ......“ .. ...... M CotC 103 (Fig. 3.6 and data not shown), nor did it alter spore germination kinetics in response to L- alanine (Fig. 3.7). Moreover, we detected no difference in spore structure as compared to wild type upon examination of thin sections by electron microscopy. By these criteria, the network is robust to elevated OK in terms of its output. On the other hand, expression of all three (SK-dependent genes tested was altered (Fig. 3.5). Increased expression of gerE and cotC can be understood in terms of their dependence on oK RNAP and, in the case of cotC, activation by GerE (Zheng et al. 1992). Transcription of cotD also depends on OK RNAP (Kroos, et al. 1989), but a high level of GerE represses cotD transcription in vitro (Ichikawa, et al. 1999), so elevated GerE in the strain with elevated 0K might account for the observed decrease in cotD expression (Fig. 3.5C). Based on these three genes, it seems likely that expression of many of the 108 other genes in the UK regulon (Eichenberger, et al. 2004) is altered by elevated oK. In terms of gene expression, the network seems quite susceptible to perturbation of the negative regulatory loop involving GerE repression of sigK. This provides one rationale for retention of the regulatory loop during evolution; mutations in loop components may subtly alter MC gene expression, optimizing it for a particular ecological niche. A second rationale for evolutionary retention of GerE repression of sigK in B. subtilis is its ability to suppress sporulation defects caused by persistent spoIIID expression. Preliminary results suggest that transposon insertion mutations in several genes elevate expression of a spoIIID-lacZ fiision (Chapter II). Hence, the MC gene regulatory network appears to be quite susceptible to mutational perturbation leading to elevated SpoIIID, which results in spore defects (Chapter II). We have shown here that mutating the GerE binding site in the sigK promoter elevates the 0K level and probably the GerE level (since 104 expression of a gerE-lacZ translational fusion increased), compensating for persistent spoIIID expression by restoring MC gene expression (including that of gerE-lacZ) and formation of spores with normal resistance properties and coat structure. Undoubtedly, other mutations could elevate the 0K level as well, but the negative regulatory loop involving GerE repression of sigK increases network robustness by providing additional targets for mutations that can compensate for changes in the SpoIIID level. Is GerE repression of sigK likely present in sporeformers related to B. subtilis? A search for orthologs of MC transcription factors revealed that UK is present among Bacillus and Clostridium species, but GerE is absent from Clostridium (Eichenberger, et al. 2004). Among Bacillus species, we searched for a GerE binding site in the sigK promoter region. As shown in Supplemental Fig. 38A, Bacillus licheniformis differed from B. subtilis at only one position, which did not affect either match to the GerE consensus binding sequence (Fig. 3.2). However, most strains of Bacillus cereus, Bacillus weihenstephanensis, all strains of Bacillus anthracis, and one strain of Bacillus thuringiensis have two changes that create mismatches to the TRGGY core of the GerE consensus binding sequence (Supplemental Fig. 38B). One of these changes is a G to A transition at a position predicted to interact with Lys4l in B. subtilis GerE (Ducros, et al. 2001). This Lys residue is perfectly conserved among GerE homologs of the organisms shown in Supplemental Fig. 38. Moreover, the strains in Supplemental Fig. 38B do not exhibit a second match to the GerE consensus binding sequence, as does B. subtilis (Fig. 3.2). Therefore, GerE is likely to bind more weakly, if at all, to the corresponding position in the sigK promoter region of the strains in Supplemental Fig. 388. For the strains in Supplemental Fig. 3SC, it seems even less likely that GerE represses sigK transcription. 105 On the other hand, the strains in Supplemental Fig. 3SD retain more characteristics of the GerE binding site in the B. subtilis sigK promoter region, suggesting that GerE represses sigK transcription in these species. We speculate that about half of the distinct species shown in Supplemental Fig. 38 have GerE repression of sigK transcription as a negative feedback loop in their MC gene regulatory network. Elevated OK in the B. subtilis sigKmut strain did not detectably hasten the decrease in the level of SpoIIID during sporulation (Fig. 3.4). We infer from this result that UK is not the rate limiting factor in the regulatory loop by which 0K RNAP leads to a decrease in the SpoIIID level (Halberg and Kroos. 1992; Zhang and Kroos. 1997; Zhang. et a1. 1999). As depicted in Figure 3.1, the evidence suggests that one or more genes transcribed by GK RNAP inhibit activity of (IA RNAP, decreasing transcription of sigE and other early genes, including spoIIID, but the mechanism of inhibition remains a mystery. Expression of cotC 2 h earlier than normal, from the heterologous gerE promoter, did not detectably alter spore resistance or germination properties. Why, then, is cotC expression normally delayed? Perhaps repression of cotC by SpoIIID prevents wasteful expression before CotC can assemble into the spore coat. CotH is required for assembly of CotC into the outer coat (Naclerio, et al. 1996; Isticato, et al. 2004). The cotH gene is expressed by 5 h into sporulation (Baccigalupi, et al. 2004) and CotH accumulates by 6 h (Zilhao, et al. 1999), but earlier times have not been examined. Under our conditions, cotC-lacZ was expressed by 7 h into sporulation (Fig. 3.5B) and CotC began to accumulate at that time (Fig. 3.8). Earlier expression of cotC from ngg-cotC on a multicopy plasmid may be inconsequential because CotH availability limits CotC assembly. Interestingly, GerE represses cotH expression, but circumventing this negative regulatory loop by 106 mutating the GerE binding site in the cotH promoter region had no detectable effect on spore structure or fimction, although it did allow accumulation of CotC in the MC (Baccigalupi, et al. 2004). Normally, CotC does not accumulate in the MC, probably because it assembles immediately into the spore coat (Isticato, et al. 2004). In cells with GerE-independent expression of cotH, elevated CotH appears to stabilize CotC in the MC, suggesting that the spore has a limited capacity to incorporate CotC (Baccigalupi, et al. 2004) In summary, circumventing GerE repression of sigK elevated the OK level and probably the GerE level, two nodes in the MC gene regulatory network, likely altering expression of many genes in the 0K regulon but not detectably changing spore resistance, germination, or structure. However, this perturbation compensated for the effects of persistent spoIIID expression, which also appears to alter two nodes in the network, maintaining the SpoIIID level late during sporulation (when it normally decreases) and probably reducing the GerE level (since expression of a gerE-lacZ translational fiision is diminished) (Chapter H). We infer that the decrease in SpoIIID normally brought about, at least in part, by an unknown mechanism that requires 0K RNAP activity (Zhang, et al. 1999), promotes gerE expression. In contrast, GerE repression of sigK normally inhibits further gerE expression because less (5" RNAP is produced. It appears that two negative feedback loops with opposing effects on gerE expression, and different effects on other nodes [cK RNAP activity reduces 0E as well as SpoIIID (Halberg and Kroos. 1992; Zhang and Kroos. 1997; Zhang et al. 1999) and GerE reduces 0K (Ichikawa, et al. 1999) (Fig. 3)], enhance robustness of the MC network and optimize expression of target genes. 107 ACKNOWLEDGEMENTS We thank Prince H. for constructing pI-IP14. We thank R. Losick, A. Grossman, C. Moran for providing bacterial strains. We also thank E. Ricca for communicating results prior to publication and for providing us anti-CotC antibodies. This work was supported by NIH Grant GM43585 and by the Michigan Agricultural Experiment Station. 108 Supplemental Figure Fig. BS. Alignment of predicted sigK promoter regions of Bacillus species and comparison with the GerE binding site in the B. subtilis sigK promoter region. (A) The top line shows the sigK promoter -35 and -10 region consensus sequences followed by the GerE consensus binding sequence (Eichenberger, et al. 2004). The italicized gg sequence is predicted to interact with Lys41 of GerE. The second line shows the B. subtilis sigK promoter (Kunkel, et al. 1988) followed by a gap introduced to facilitate aligiment with sequences below. The gap is followed by the GerE binding site, based on DNase I footprinting (Ichikawa, et al. 1999), which is aligned with the GerE consensus binding sequence above and in which the bold sequence indicates the match on the complementary strand (not shown) to the TRGGY core of the GerE consensus binding sequence. This is followed by the number of nucleotides to the ATG translational start codon of sigK. Subsequent lines show predicted sigK promoters from other Bacillus species, followed by a gap where necessary to facilitate the alignment with the GerE consensus binding sequence. (B-D) Underlined nucleotides indicate mismatches to the GerE consensus binding sequence. In panels B and C, no match to the TRGGY core of the GerE consensus is evident on the complementary strand, whereas in panel D, the match is shown in bold with mismatches underlined. 109 88 3 88:2: gmgbva. 88 3 888: 8888mmoznmon8880 3 >60 FREE «82.5. 88 a 888: 8888mmozofi8888o No >HQ mantra 88:883.” .560 3me 88 3 8888 8m8m8mmo808nnmmomm B :0 manure. 88$ muur m8 3 8882 8%mmmmmo808n3mmomm um >HQ whom?“ 885. 033 m8 3 8888 8%8mmoomo822mmomm Z :0 manure. 8me 86%. 8‘88me 2: ”$73 88 a 8888 ”888808088808 N GHQ mantra 88$ >HOO 73.3 88 3 8888 ”mammwmmoomonmanmmomm Z :0 FREE. Smszhmfigamzua. gawk— 88 5 8883 8m8m8mmo8o8§mmomm N GHQ want?“ 8832.9. 3. BEN 88 3 8889 Hmfimmmmmoomonmgmmomm 3 .36 $555 8882..” 3.. >83 88 5 8888 8m8m8mmo808§mmomm S :0 mantra 8838,. m? mfioao 88 a 8889 8388080832808 2 :0 manure. 823.3%.me 8888. Kong»: 3. 3-3 0 08 gm o®8®fim mmmfimemmnmmofimzfimo 3 >HO mean?” 885. >600 303 88 5 88:8 8888888328888” No >HQ want?“ Salzmmmaa. m? E H.888 88 3 88:8 88888883088» mm .56 @8282 8:188:88 838188833. >HOO “Gag 88 3 8888 ~8oomnozmfimmmmmnmmmfi fl >60 mama?“ 185.2. szzna 88 E 8888 88888882888» 5 GHQ wants... 88833 0-5m 88 5 888m" mammmfimmmgmmfinnnnumflmo mm :0 08808328 $8.88” $.31“me 88 mm 88mm88mm88mmo8Hmmmn08m8 5 >HQ wank?“ mu. ZWEL @305 m8 5 8888 H8mmm8mmomm38mnonfim B >HQ Q8828.” 8§8hi~§ $3..»me 88 5 8888 "mommfimmmmommaoomnonfim B .56 Q8825.” «880833385 208$ 110 me um AmounwsCmmv $888828mflmflmmnnmmomfimawommuomo8.088808m8mm888888mm880m89 mmnomflmmmmmflmmfimfiomfim want?» 88885. 0-5m 88mo80mo8oommwoom88888288m88mm8o8oo8moo8mfimnmo8888888 axonmnmmmmmfimmmonxram ESE?” n88: 57.290 :mmummfimammmnafimmfimmwgmfimo888888888888888 808%8mgomo8§mmommmmflm8mfigo waning 823.3%.me 83.5w 83888 3. 3-3 ”ammunfimammmzam88889m80mmmomo8mm80388888880288 880808388mmwmmdmmmmmmfigm mantra. 8832..» m? M880 8H82mm8mfimnmmmnzwfi8fl89m80mmmowommmo8028888880802888 mwoomofimanmmommmmmfimmmmmmam SENSE 82:52..” m? >38 ~8m8§882mm8m~mammmfiafi88889988880880803888888 80388888monmnfiammommmmmamwmmmmfigm mantra 8832..” 3. >85 8888858888.888%fioooo§88m88nom8888888§o§82£8~ 38088888a28>fi0 $8sz Qualzmmmaa. 835:. QmemeuMm >.HOO 3on :m8838888manofimmfimflmmmo858885888838888 888~8£8082283828888888888228560 mantra. $215858 3. >_ $888 111 CHAPTER IV: A Genetic Screen to Identify Possible Components of the 0K RNAP Negative Feedback Loop in B. subtilis 112 ABSTRACT In sporulating Bacillus subtilis, a regulatory network controls gene expression temporally in the mother cell. Several negative regulatory loops exist between different components of the network. Among them, transcriptionally active 0K RNAP negatively regulates early gene expression during sporulation, including that of sigE and spoIIID. The mechanism of this 0K RNAP negative feedback loop was investigated using a genetic screen to identify its putative components. Random mutagenesis with mini-TnlO was followed by screening for elevated spoIIID-lacZ expression as an indicator of interrupted 0K RNAP negative feedback. Eleven candidates were identified with spoIIID-lacZ expression higher than the wild-type. Four insertions were at the same location in a 16S rRNA gene and one insertion was at a different location in a 16S rRNA gene. The six other insertions were in genes encoding: N-acetylglucosamine 6-P deacetylase (nagA); a protein functioning in DNA mismatch repair (mutL), a nucleoside diphosphate kinase (ndk), an hypothetical protein (yka), a 654 family-specific transcriptional regulator (levR), and a serine protease, belonging to the heat-shock family of proteins (yd/(A). Further studies are needed to confirm that null mutations in these genes elevate spoIIID-lacZ expression and investigate the mechanisms involved. 113 INTRODUCTION Sporulation is a process that is initiated by the gram-positive soil bacterium Bacillus subtilis when it encounters starvation. Four regulators function in the order GE, SpoIIID, csK and GerE, form a regulatory cascade that controls gene expression in the mother cell of sporulating B. subtilis. Several negative regulatory loops have been discovered in the mother cell gene regulatory network. One of these involves 0K RNAP negative feedback on early gene expression. The ald gene, which encodes alanine dehydrogenase, and sigE, which encodes 05, are both over-expressed in a sigK mutant, suggesting that 0K negatively regulates genes in the o" regulon (Zhang and Kroos. 1997; Zhang et al. 1999). The spoIIID gene is also overexpressed in a sigK mutant, presumably due to the higher concentration of GE RNAP, which transcribes spoIIID (Halberg and Kroos. 1992; Zhang and Kroos. 1997; Zhang et al. 1999). It is particularly interesting that transcriptional activity of OK RNAP is required to carry out this negative effect. A single amino acid substitution in OK, C109R in subregion 2.4, allows the mutated 0K to bind to the core RNAP, but fails to direct gerE-lacZ expression (Zhang, et al. 1999). When fractionated by gel filtration chromatography, 0’“:le is co-eluted with core RNAP (Zhang, et al. 1999). Expression of ald-lacZ and sigE-lacZ is higher late during sporulation in the sigKC109R mutant than in wild type (Zhang et al. 1999), suggesting loss of the negative effect on early gene expression in the sigKC109R mutant. It is possible that wild-type 0K RNAP transcribes genes whose products function in the negative feedback loop. Alternatively, limitation of resources (e.g., nucleotides) during sporulation might cause the negative effect through transcriptional active 0K RNAP. To elucidate the mechanism by which GK RNAP negatively feeds back on early gene expression during sporulation, we carried out a genetic 114 screen experiment designed to identify genes involved. Eleven transposon insertion mutants were identified and found to be inserted in 7 different genes. Each insertion elevates spoIIID-lacZ expression, mimicking the effect of interrupting the 0K RNAP negative feedback loop. MATERIALS AND METHODS Bacterial strains. BK533 (spo+ SPB::spoIIID-lacZ/Cm’), a B. subtilis strain that is isogenic with wild-type strain PY79, and contains a translational fusion of spoIIID-lacZ (Kunkel, et al. 1989), was transformed with pCm::Sp (Steinmetz and Richter. 1994) in order to replace the cat gene with a gene encoding spectinomycin (spc) resistant. Six transformants were streaked to obtain single colonies and these were transferred with toothpicks to DSM plates containing 40 ug/ml X-gal. The transformant with the most consistent blue color, BLWl 10, was used as the recipient strain for the genetic screen. A cell lysate containing the phage SPB:: spoIIID-lacZ was obtained fiom BK533 as described (Cutting and Horn. 1990). Transduction of SPB2: spoIIID-lacZ into a B. subtilis strain BK556 (spoIVCBZ3) (Kunkel, et al. 1989) was as described (Cutting and Horn. 1990). The resulting strain, BLWlOO, was used as a control to mimic the effect of interruption of the 0K RNAP negative feedback loop. Preparation of mini-Tnlo mutated chromosomal DNA library. Both the suicide plasmid pHV1249 (Petit, et al. 1990), which carries the mini-TnlO transposon, and the recipient strain, BLWl 10, carry an erythromycin—resistance gene. To avoid undesired homologous recombination between the BLWl 10’s chromosome and pHV 1249, TnlO mutagenesis was first performed in the B. subtilis wild-type strain PY79 as described (Petit, et al. 1990). A pilot experiment showed that approximately 20% of the colonies that 115 were selected by adding chloromphenicol (5 ul/ml) at 51°C were also erythromycin— resistant and should still contain pHV1249. The other 80% of colonies were chloramphenicol-resistant and erythromycin-sensitive, as expected for transposition of mini-TnlO into PY79’s chromosome. Serial dilutions of the mixture resulting from the mutagenesis procedure were made to generate plates with approximately 1000 Cmr colonies each. Fifteen of these plates were grown ovemight at 51°C. Colonies from each plate were collected by scraping and a separate chromosomal DNA library was prepared from each plate as described (Cutting and Horn. 1990). Transformation of the mini-Tn10 libraries into B. subtilis with the spoIIID—lacZ reporter. The mini-TnlO mutagenized chromosomal DNA libraries were transformed into BLWllO as described (Cutting and Horn. 1990), with selection for resistance to spectinomycin (100 ug/ml) and chloromphenicol (5 ug/ml) on LB agar plates. After 37 °C overnight incubation, transformants were picked onto DSM agar containing 40 ug/ml X- gal. BLWlOO and BLWl 10 were picked onto the same plate as controls. Colonies with blue color significantly darker than BLWl 10 and similar to BLWlOO, were cultured in LB liquid with appropriate antibiotics and made into frozen stocks. Analysis of B—galactosidase activity. A single colony of each candidate strain and three isolates of BLW110 were induced to sporulate by resuspension in SM medium (10 candidates except for BLWZOO) or DS medium (BLWZOO and BLWl 10 only) as described (Sterlini and Mandelstam. 1969). The onset of sporulation (To) is defined as the time of resuspension for cultures in SM medium and the point of departure from exponential growth for culture in DS medium. One ml samples were collected at 4 h and 5 h into sporulation. Pellets of cells were stored at -70 °C prior to the B-galactosidase activity assay. 116 Before the assay, cells were permeabilized with toluene and treated with lysozyme (Miller. 1972). The B-galactosidase specific activity was determined by as described (Miller. 1972) using o—nitrophenol-B-D-galactopyranoside (ONPG) as the substrate. One unit is defined as the amount of enzyme needed to hydrolyze 1 mol of substrate per rrrinute per unit of initial cell optical density at 595 nm. Candidates with a specific activity higher than that of BLW110 plus two standard deviations of the data (generated from three replicates of BLWl 10) were selected for fiirther analysis. Preparation of ultra-pure genomic DNA. Candidates that were selected after the B- galactosidase activity assay were grown in 14 ml LB containing spectinomycin (100 rig/ml) and chloromphenicol (5 rig/ml). Cells were harvested when the OD600 reached 2.0. Chromosomal DNA from these strains was prepared using the genomic-tip 500/G kit (QIAGEN), eluted to a final volume of 500 pl. Chromosomal DNA was then subjected to a second purification. First, 250 111 of phenol and 250 111 of chloroform were added to the chromosomal DNA, mixed gently and centrifuged at 4,000 rpm for 10 minutes at 4 °C. Second, an equal volume of chloroform was added to the aqueous phase from the first preps, then mixed gently and centrifuged in the same way. To the aqueous phase, 1/9 volume of 3 M sodium acetate was added and mixed by inverting the tube, then 2.5 volumes of ice cold 100% ethanol were added, mixed by inversion, and the sample was incubated at -20 °C for at least 1 hour (or overnight) to participate DNA. Samples were centrifirged at 12,000 rpm for 10 rrrinutes and pellets were air-dried at room temperature for 5 minutes, then resuspended in 100 ul of distilled water, and stored at -20°C. Identification of mini-Tn10 interrupted genes. Direct sequencing of ultra-pure genomic DNA was used to identify the gene interrupted for 10 out of 11 of the candidate 117 strains (except BLW224). Primer 1, 5’-ccgttagttgaagaaggtttt-3’, which matches a sequence downstream of the cat gene but upstream of the inverted repeat of the mini-TnlO in pHV1249, was used for genomic DNA sequencing. The primer (3.2 pmol) and chromosomal DNA (2 ug) in 12 ul total volume were subjected to sequencing using a BigDye3.1 Kit (ABI Prism) and an ABI Prism 310 sequencer at the Research Technology Support Facility of Michigan State University. An inverse PCR was used to amplify the DNA fragment that contains the mini-TnIO and adjacent interrupted gene in BLW224. Chromosomal DNA from BLW224 was digested with HindHI and ligated with T4 DNA ligase. Primer 1 and primer 2, 5’- gagcgtagcgaaaaatcct-3 ’, which matches a sequence upstream of cat gene but downstream of the inverted repeat in the mini-TnlO in pHV1249, were used to amplify the ligated BLW224 chromosomal DNA. A 1.5 kb DNA fragment was amplified and was used as the template for sequencing with primer 1 to identify the gene interrupted in BLW224. RESULTS Thirty-one candidates were identified by screening on X—gal-containing plates. Approximately 4000 transfonnants were obtained by transforming mini-TnlO mutagenized chromosomal DNA from B. subtilis PY79 into B. subtilis strain BLW110, which has the SPfizzspoIIID-lacZ translational fusion as a reporter. Transformants, along with BLW110 and BLW100, a sigK (spoIVCBZ3) mutant bearing SPB::spOIIID-lacZ in order to mimic the effect of interrupting of the 0K RNAP negative feedback loop, were inoculated onto DSM plates containing 40 ug/ml X-gal. Colonies with deeper blue color than BLW110 and similar color as BLWlOO were identified for further study. Thirty-one such candidates were 118 Table 4.1. Origin of candidate strains from genetic screen No. of mini- . TnlO library 8m name 1 BLW 200, 201, 202, 203, 204 2 BLW 205, 206, 207, 208, 224, 225, 227 3 BLW 209, 210 4 BLW 229, 230 5 BLW 220, 221, 222, 223 6 BLW216,217,218,219 7 BLW 226, 228 8 BLW211,212,213,214,215 identified and named BLW200 to BLW230. The origins of these strains from the different mini-Tn10 chromosomal DNA libraries are described in Table 4. 1. Candidates were narrowed down to 11 by fl-galactosidase assays. To further test for higher spoIIID-lacZ expression in the candidate strains identified on X-gal-containing plates, B-galactosidase assays were performed to quantify spoIIID-lacZ expression. The expression of spoIIID-lacZ in BLW200 peaked at 5 hours into sporulation in D8 medium (Fig. 4.1 A). The other 30 candidates were induced to sporulate in SM medium. Expression peaked at 4 or 5 hours into sporulation. Eleven of these candidates showed significantly elevated expression at T4 (Fig. 4.1B) or T5 (Fig. 4.1C). Expression was more than the average of three isolates of the recipient strain BLW110 plus two standard deviations (significantly elevated expression at the 95% confidence level). Therefore, 12 candidates were confirmed as having significantly higher expression than the recipient. Identification of genes interrupted in the strains with elevated spoIIID-lacZ expression. Direct sequencing of genomic DNA identified 10 out of 12 interrupted genes. The gene interrupted by mini-TnlO in BLW224 was identified by sequencing a PCR product derived from genomic DNA that had been digested with HindIII and ligated. Gene interrupted in BLW214 was accidentally missed for sequencing. The results of DNA 119 Fig 4.1. Analysis of B-galactosidase activity. (A) B. subtilis strains BLW200 (I) and BLW110 (A) were sporulated by DSM method. B-galactosidase activities from both strains were analyzed. Standard deviation is generated from three biological replicated of each strain. (B) B. subtilis strains BLW201 to BLW230 (numbered as 1 to 30 in the Y axis) were sporulated by resuspension in SM medium and B—galactosidase activities fiom each strain was analyzed fiom samples at 4 h into sporulation. B. subtilis strain BLW110, which is wild type B. subtilis with the same spoIIID-lacZ firsion was used as negative control. Numbers above zero indicates a B-galactosidase activity that is higher than BLW110 plus two standard deviations. (C) The same experiment as in (B) except for those samples were collected at 5 h into sporulation. 120 (A) 180 ~ 160 140 120 100 B—galactosidase activity o8888 1 2 3 4 5 6 Time into DSM sporulation (h) 121 Fig 4.1 (continued) ( B ) 3 O ' "‘Hi‘. 29 -_ 28 i3§flfii 27 fififlflflflt 26 24 a; 23 22 smmai 2 1 - . 20 1 9 18 mm? l-riflfiwwa 16 iii 15 _ufl, 14 . 1 3 m 12 'Wmfiwfi: 17]. re smarts fl ...—A if? 31% 4 if: z 51 ".2 A "a. j S 7, ,5; THNWAMONQOOO l I f 1 j -1000 -500 0 500 1000 1500 2000 Specific activity - (recipient +2 standard deviations) 122 Fig 4.1 (continued) ‘0’ :3 E 28 27 “m 26 :35; 24 23 22 2 1 am 20 19 1 8 m 17 fiat? 16 15 iEEEi 14 Inn; 13 war 12 .1. 91 12 sunms h‘ H 2‘ ‘* 1! 4- " S ' ? 1‘ y. ‘- .- m . '1' .1 H ‘3 h i. b 1 'I' ‘. '20! 'I F- . -.\ I??? at; 3 1 V'IJ 1:1: ..g ‘- k H .1 v ’ "\— 9 s p E r"; a if? fiwNWLMQQOOND 1 1 T 1 r 1 -1000 0 1000 2000 3000 4000 5000 Specific activity - (recipient +2 standard deviations) 123 Table 4.2. Identification of enes interrupted bxmini-Tnlo muta genesis . Sequence Gene . Matched Insertion Strain uali t Y“ m ed Annotation length (% osition" ‘1 app identical) P BLW200 120 nagA N—acetylglucosamine 238(86%) 329/461 6-P deacetylase BLW204 9O 16S rRNA Ribosomal RNA-16S 302 (95%) 840/1555 BLW206 516 168 rRNAb Ribosomal RNA-16S 271(100%) 830/1555 BLW207 355 16S rRNAb Ribosomal RNA-16S 136(100%) 830/1555 BLW210 80 mutL DNA mismatch 93(88%) 78/628 repair BLW211 586 ndk Nucleoside 320(100%) 54/150 diphosphate kinase BLW220 654 yka Unknown. Similar to 408(100%) 131/832 pyruvate, water dikinase BLW223 517 levR Transcriptional 302(100%) 777/957 regulator LevR of Bacillus subtilis has domains homelogous to both sigma 54- and phosphotransferase system-dependent regulators BLW224 723 16S rRNAb Ribosomal RNA-16S 415(100%) 830/ 1555 BLW227 639 16S rRNAb Ribosomal RNA-16S 341(100%) 830/ 1555 BLW228 740 htrA Serine protease Do 450(100%) 88/450 (yde) (heat shock protein) “ Sequence quality of the number of continuous nucleotides identified with high confidence by the ABI Prism 310 sequencer. b The mini-TnIO is at the same location in a 16S rRNA gene in four strains. ° Codon into with mini-TnlO inserted/total codons for protein-encoding genes or nucleotide into with mini-TnlO inserted/total nucleotides for 16S rRNA. sequencing are indicated in Table 4.2. DNA fragments with good qualities are indicated by “trimmed length”, which provides the number of nucleotides that have been identified with 124 good confidence by the ABI Prism 310 sequencer. Junctions between mini-TnlO and the interrupted genes were identified and all were located within the region of high quality sequence except for BLW210. Three strains, BLW200, BLW214, and BLW210, showed less than 100% identity to a B. subtilis gene, perhaps due to lower sequence quality. The poor sequence quality seemed to be strain-dependent. For example, for BLW210, chromosomal DNA was extracted three times and sent for sequencing in parallel with a positive control. The positive control yielded high quality sequence each time but BLW210 chromosomal DNA never gave high quality sequence. Also, except for BLW224, chromosomal DNA from the other 10 strains could not be successfully digested with HindIII and ligated to generate a PCR product for sequencing. DISCUSSION A gene for 16S rRNA was interrupted in five strains (Table 4.2). Four of these have mini-TnlO inserted at exactly the same location in a 168 rRNA gene. There are 10 copies of 16S rRNA in the genomes of B. subtilis. Due to the limited lengths of good sequence and high similarity of the 168 rRNA genes, our data do not identify which 16S rRNA gene has been interrupted. The four strains with mini-T n10 at the same location in a 16S rRNA gene might represent a single transposition event since all four strains arose from transformation with chromosomal DNA library 2 (Table 4.1). On the other hand, BLW214 represents an independent transposition event since this strain arose from transformation with a different chromosomal DNA library (Table 4.1) and mini-TnlO is inserted at a slightly different location within a 16S rRNA gene. The identification of at least two independent insertions in one or more genes for 16S rRNA implies an important role for rRNA synthesis in the level of spoIIID expression during sporulation. 125 We speculate that disruption of an operon for rRNA frees 0A RNAP and nucleotides for expression of other genes. In wild type, the 0K RNAP negative feedback loop might, at least in part, reflect competition between 0" and the earlier-acting mother cell sigma factors, GA and GB, for nucleotides and engagement of core RNAP in transcription of their regulons. Disruption of a highly transcribed rRNA operon might relieve the competition, resulting in higher spoIIID expression. Deletion of multiple rRNA operons might result in even higher spoIIID expression. Deletion of one rRNA operon occurs spontaneously with little or no effect on viability (Gottlieb, et al. 1985; Loughney, et al. 1983) but it is unlcnown whether additional rRNA operons can be deleted. This would be a possible direction of future studies, but first it would be important to verify that the mini-TnlO causes the observed increase in spoIIID-lacZ expression by isolating chromosomal DNA from an insertion strain and transforming the original recipient strain BLW110. Among the other genes interrupted by mini-TnlO, only levR encodes a transcription factor (Table 4.2). However, levR is a transcriptional activator of the levanase operon, which encodes a fructose-specific phosphotransferase system and the extracellular enzyme levanase that hydrolyzes fructose polymers and sucrose (Martin-Verstraete, et al. 1998) LevR has an N-terminal domain similar to (SM-dependent activator proteins and a C- tenninal domain similar to anti-terminator proteins like BglG and LicT. It seems unlikely the LevR is a direct repressor of spoIIID transcription. How disruption of levR increases spoIIID expression during sporulation (assuming this result is confirmed) is a mystery. The same can be said for the other mini-Tn10 insertions. Like LevR, NagA is involved in carbohydrate catabolism. It is N-acetylglucosamine-6-phosphate deacetylase, which catalyzes the conversion of GlcNAc6P to glucosamine-6-phosphate (GlcN6P) 126 (Barnhart, et al. 2006). The nagA gene is likely in an operon with nagB (also involved in GlcN6P utilization) and possibly yvoA, a GntR family transcriptional regulator. Conceivably, the mini-TnlO in nagA has a polar effect on yvoA, and YvoA is a repressor of spoIIID. This hypothesis could be tested by making a mutation in yvoA. Alternatively, elevated spoIIID expression might be an indirect effect of elevated intracellular GlcN6P due to nagA disruption, as deletion of nagA alters transcription from the curli-specific promoters of the csgBA and csgDEF G operons in E. coli (Bamhart, et al. 2006). Two mini-TnlO insertions interrupted genes whose products appear to be involved in nucleotide metabolism. Ndk is nucleoside diphosphate kinase, which catalyzes reactions that convert NDP to NTP (N could be A, T, G, C). YvKC is similar to pyruvate, water dikinase. This enzyme catalyzes the following reaction: ATP + pyruvate + H20 = AMP + phosphoenolpyruvate + phosphate. Disruption of yka might increase the ATP level; increasing spoIIID transcription, but disruption of ndk would be expected to decrease NTP levels, so it is unclear how this could cause increased spoIIID transcription. As yka is likely in an operon with yka, which encodes a TetR/Ach family transcriptional regulator, the possibility of a polar effect exists as described above for the insertion in nagA. On the other hand, ndk appears to be followed by a transcriptional terminator, so a polar effect is unlikely. The htrA gene also appears to be followed by a transcriptional terminator. It encodes a serine protease induced by heat shock or secretion stress, and is probably involved in processing of extracellular enzymes (Noone, et al. 2001). Conceivably, its disruption stabilizes the spoIIID-B-galactosidase chimera produced from the spoIIID-lacZ fusion. 127 The interrupted gene in BLW210 was not identified with confidence due to low sequence quality (Table 4.2). Genomic DNA of BLW210 was prepared in parallel with other strains that yielded high quality sequence. The OD26o/230 of the BLW210 DNA suggested high purity. The reason for difficulty in sequencing is unknown. The junction between the mini-TnlO and the interrupted gene is not located within the good sequence. However, a short stretch of mutL could be identified, although there were some mismatches (Table 4.2). MutL fiinctions in DNA mismatch repair. Without proper DNA mismatch repair, the genome is prone to mutagenesis. The very high spoIIID-lacZ expression in BLW210 (Fig. 4.1 B and C) might be due to one or more mutations in the spoIIID promoter region. This hypothesis predicts that the mini-TnlO in BLW210 will not result in high-level spoIIID-lacZ expression upon transformation into BLW110. Obviously, this study is incomplete. As mentioned above, each mini-TnlO must first be transformed into the original recipient strain BLW110 to test whether the mini-TnlO insertion is responsible for elevated spoIIID-lacZ expression. Some additional ideas for further studies are also mentioned above. These studies might reveal the mechanistic basis of the 0K RNAP negative feedback loop, However, the preliminary results presented here suggest that mutations in many genes can cause increased spoIIID-lacZ expression during sporulation. In terms of this single-gene output, the regulatory network seems quite susceptible to perturbation. It would be interesting to see whether any of the mini-TnlO insertions perturb other network outputs, such as heat-resistant spore formation. We hoped to identify one or more genes under UK control whose products carry out the negative feedback loop. Several genes were identified, but none of these have been reported to be under UK control. This suggests that UK RNAP negative feedback on early 128 gene expression during sporulation might stem from competition between different sigma factors for nucleotides and engagement of core RNAP in transcription of their regulon. ACKNOWLEDGEMENTS We thank Dr. Richard Losick for providing the strain BK533 (PY79 SPBxspoIIID—lacZ). We also thank Dr. Stefan Roos and Dr. Robert Britten for providing the protocol for direct sequencing of highly purified genomic DNA of B. subtilis. This work was supported by NIH Grant GM43585 and by the Michigan Agricultural Experiment Station. 129 APPENDIX I Title: SDS-PAGE of Spore Coat Proteins form B. subtilis Strains with Perturbations in the Mother Cell Regulatory Network 130 ABSTRACT Chapters 11 and III of this thesis describes B. subtilis strains that were constructed and studied in order to understand the importance of several negative regulatory loops in the mother cell network of gene expression during sporulation. Spores from a strain with SpoIIID maintained late during sporulation showed heat- and lysozyme-resistance defects. A strain in which GerE negative feedback on sigK was eliminated did not show spore defect, but expression of at least two spore cot genes (cotC and cotD) was altered. These and other strains in Chapters 11 and III were examined by SDS-PAGE to compare their spore coat proteins. None of the strains differed significantly difference from wild-type B. subtilis. This result suggests that structural, rather than compositional, differences cause the spore defects in the strain with persistent spoIIID expression. INTRODUCTION In the mother cell of sporulating B. subtilis, a regulatory network controls gene expression. Four transcriptional regulators, in the order oE-SpoIIID-oK-GerE, form a cascade of gene expression in which each regulator controls expression of the next regulator. Three negative regulatory effects, 0K RNAP inhibition of early gene expression, GerE repression of sigK transcription, and SpoIIID repression of cotC transcription were studied (Chapters 11 and III). Strains that circumvent one or two of these negative regulatory 100ps were constructed. Here, the strains were induced to form spores and the composition of the spore coat was analyzed by SDS-PAGE. Such analysis can reveal gross changes in spore coat composition. For example, when cotE, encoding a protein that coordinates assembly of the inner and the outer coats, was expressed at a different time 131 than normal, the composition of total coat protein was altered (Little and Driks. 2001). Coat protein analysis displayed by SDS-PADE electrophoresis gels showed alternative pattern than that of the wild—type B. subtilis. Applying the same analysis to the strains described in Chapters H and HI showed no significant differences from wild-type B. subtilis PY79. MATERIALS AND METHODS Bacterial strains. Strains used in this assay are listed in Table 1. Cell growth and sporulation. Sporulation was induced by resuspension of cells in SM medium as described (Cutting and Horn. 1990). The time of resuspension is defined as the onset of sporulation (To). Spores were harvested at T24 by centrifiigation at 7,000 g for 10 min, washed with 4°C water once, and stored at 4°C. Spores were purified on a step gradient of 20% to 50% RenoCal-76 (Bracco Diagnostics Inc.) as described (Henriques, et al. 1995) SDS-PAGE of spore coat proteins. Coat proteins were extracted from purified spores as described (Henriques, et al. 1995). 25 ul of solubilized spore coat proteins were subjected to SDS-PAGE as described (Henriques, et al. 1995). RESULTS AND DISCUSSION A representative result fiom several experiments is shown in Fig. I. The pattern of spore coat protein bands for wild type is similar to that observed in a previous study, but some of the band intensities are slightly different (Henriques, et al. 1997). Only one band was observed with a molecular weight of about 60 kDa, which might be CotA and/or CotB. A previous study showed two bands in this region of the gel (Henriques, et al. 1997). The 132 Table 1. List of B. subtilis strains used in the study Strain Genotype or derivation Source or reference PY79 Spo+ prototroph $21.11!}??? BJPl PY79 transformed with pJP1(Pger;5~spoIIID)/Kmr Chapter H BJP2 PY79 transformed with pJP2(Pge,E)/K.mr Chapter II BJP3 PY79 transformed with pJP4(Pgerg-cotC)/Kmr Chapter III BLWl BK556 transformed with pI-IP6(amyE::sigK)/Cmr Chapter HI BLW2 BK556 transformed with pJP16(amyE : :sigKmut)/Cmr Chapter HI BLW3 BLWl transformed with pJPl/Km'Cmr Chapter HI BLW4 BLW2 transformed witthJPl/Kermr Chapter III reason for only one band on my gel might be the shorter length of the gel, or possibly degradation of CotA or Cot B. Similar explanations might apply for the band labeled CotC and/or CotD. The other strains showed a similar pattern of bands as wild type. The intensity of bands for wild type and BJP2 (ngg) appears to be less than for the other strains in Fig. I but this was not observed consistently in several experiments. Rather, the pattern and abundance of spore coat proteins appeared to be similar for all the strains. Two of the strains analyzed in Fig. I showed altered patterns of spore coat gene expression that nevertheless did not detectably change the composition of the spore coat. BJPl (Pge,g-spoIIID) exhibited lower expression of cotC-lacZ and higher expression of cotD-lacZ (Chapter II). Because CotC and CotD were not resolved by SDS-PAGE (Fig. I), it is possible that BJPl spore coats contain less CotC and more CotD than wild type spore coats. However, given the differences in resistance properties and spore structure (Chapter II), it was surprising that other differences in the spore coat protein profile were not observed (Fig. I). This suggests that structural, rather than compositional, differences in the spore coat primarily account for the observed defects in BJPl spores. Perhaps altered spore coat gene expression impairs assembly of the spore coat. In contrast, BLW2 (sigK 133 Fig. I. Spore coat proteins. B. subtilis wild-type (WT) PY79, BJP1(Pge,E»spoIIID), BJP2 (Pgerg), BJP3 (PgerpcotC), BLWl (sigK amyE::sigK), BLW2 (sigK amyE::sigKmut), BLW3 (sigK amyE::sigK Pgerg-SPOIIID), and BLW4 (sigK amyE::sigKmut ngrspolllD) were inducted to sporulate by resuspension in SM medium. Spores were collected at 24 h after the initiation of sporulation. Spores were purified and spore coat proteins were extracted. Coat proteins from equal amounts of spores were fractionated on SDS 15% SDS polyacrylamide gels and subjected to Coommassie staining. Assignment of coat protein identification is based on comparison of the pattern of bands with previous SDS-PAGE analysis (Henriques, et al. 1997). 134 a 98mg; QSOQmmasn. XanmSEm v3.5 Qquwutan. SEXanMAEm v3.5 SEXanmAEm x9e XanmAEm v3.6 ._.>> meann— oaaaoqmmsn. kDa CotB .<— CotE CotC and/or CotD 135 amyE::sigKmut) exhibited higher cotC-lacZ expression and lower cotD-lacZ expression than wild type but no difference in spore resistance or structure by electron microscopy (Chapter HI). As for BIPl spores, we cannot rule out a difference in the amounts of CotC and CotD in BLW2 spore coats, since these proteins were not resolved (Fig. I), but if there is a difference, it appears to have little or no effect on assembly and function of the spore coat. Further investigation of spore coat composition could be done using High Performance Liquid Chromatography (HPLC), which can provide higher resolution and better quantification. 136 APPENDIX II Title: The level of Aconitase in Sporulating B. subtilis Depends on the Method of Starvation 137 ABSTRACT A strain with persistent spoIIID expression yielded spores with heat- and lysozyme- resistance defects (Chapter H). However, these defects were only observed when cells are induced to sporulate by resuspension in starvation medium, not when cells where induced to sponrlate by nutrient exhaustion in DSM. We hypothesized that this difference might be due to a difference in the GerE and aconitase levels, depending on the method of sporulation induction. Aconitase is an enzyme whose C-terminal domain has been reported to enhance accumulation of the gerE mRNA and GerE protein. To begin to investigate our hypothesis, we measured aconitase levels by western blot analysis of B. subtilis induced to sporulate by the two methods. The level of aconitase is significantly higher during sporulation when cells are induced to sporulate by nutrient exhaustion than when cells are induced to sporulate by resuspension. We speculate that the lower aconitase during sporulation by resuspension leads to a lower level of GerE, which is insufficient for normal spore formation when SpoHH) level is maintained late during sporulation. Further, the higher aconitase and presumably GerE levels during sporulation by nutrient exhaustion might compensate for detrimental effects of persistent SpoHH). INTRODUCTION In the mother cell of sporulating B. subtilis, GerE is an important transcription factor that temporally governs gene expression. It functions as the last regulator in a cascade in the order oE-SpoIHD-oK-GerE. GerE is both a repressor (55 genes) and an activator (36 genes) of genes in the 0K regulon (Eichenberger, et al. 2004). Recently, a connection between GerE and aconitase was elucidated (Serio, et al. 2006). Aconitase, which is 138 encoded by the citB gene, is an enzyme that catalyzes the reversible isomerization of citrate and isocitrate in the tricarboxylic acid cycle. The structure of B. subtilis aconitase is similar to that of eukaryotic IRP-1(iron regulatory protein 1). IRP-l is a mRNA binding protein that regulates the expression of iron receptor, utilization, and storage proteins post- transcriptionally (Basilion, et al. 1994) (Gray, et al. 1993). The structural similarity between aconitase and [RP-1 implied that aconitase might bind to mRNA. Indeed, the C- terminal domain of B. subtilis aconitase binds to the 3’-intranslated region of gerE mRNA (Serio, et al. 2006). This appears to allow efficient GerE synthesis since mutations in the C- terrninal region of the citB gene product delayed accumulation of gerE mRNA and GerE production, and caused defective sporulation. In Chapter H we reported that the strain BJPl, which contains multicopy Pg“;- spoIIID insertion, produces spores with heat- and lysozyme-resistance defects when induced to sporulate by resuspension but not when induced to sporulate by nutrient exhaustion. We hypothesized that this difference might be due to a difference in the GerE and aconitase levels. In this appendix, we show that in BJPl, the level of aconitase is significantly higher when cell were induced into sporulation by nutrient exhaustion in DSM than when cells are induced to sporulate by resuspension in SM medium. This result provides a possible explanation for the absence of detectable spore defects when BJPl is induced to sporulate by nutrient exhaustion. MATERIALS AND METHODS Bacterial strains. B. subtilis strain BJPl was obtained by transformation of the wild- type PY79 with a multicopy plasmid bearing Pgerg-spoIIID. This strain was used in the 139 experiments in Chapters H and HI. MAB160 (trpC2 pheAI QcitB::spc) (Craig et al. 1997) was used as a negative control in order to identify the aconitase bands in Western blots. Cell growth and sporulation. Sporulation was induced by resuspension of cells in SM medium as described (Cutting and Horn. 1990). The time of resuspension is defined as the onset of sporulation (To). Strains were also induced to sporulate by nutrient exhaustion in DSM (Cutting and Horn. 1990). Onset of sporulation is defined as the time when cells enter into stationary phase. Samples (0.5 ml) were collected at 2, 4, 6 and 8 h into sporulation for BJPl and at 4 h into sporulation for MAB160. Samples were subjected to centrifugation (14,000 g for 1 min), the supematants were removed and cell pellets were stored at -70°C. Western blot analysis. Preparation of whole—cell extracts, electrophoresis, and electroblotting were as described (Halberg and Kroos. 1992; Lu, et al. 1990), except that SDS 8% polyacrylamide gels were used for electrophoresis. Also the MAB160 sample was prepared by boiling cells in SDS sample buffer. Blots were probed with anti—aconitase antibodies (kindly provided by A. Sonenshein, Tufts University) diluted 1:3000. Irnmunodetection of primary antibodies was as described (Kroos, et al. 2002). RESULTS AND DISCUSSION A representative result of the Western blot analysis is shown in Fig. H. Aconitase migrated between 105 and 78 kDa marker proteins (Invitrogen SeeBlueZ), faster than expected (120 kDa) from a previous study (Serio and Sonenshein. 2006). The difference could be due to the gel system, the marker proteins, and/or degradation of aconitase. 140 Fig. H. Levels of aconitase during sporulation by different methods. B. subtilis strain BJPl (PgaE—spoIIID) was induced to sporulate by resuspension or by nutrient exhaustion in DSM. Samples were collected at 2, 4, 6, and 8 h into sporulation. B. subtilis MABl6O (cithzspc) was induced to sporulate by resuspension and a sample was collected at 4 h into sporulation as a negative control. Equal amounts (10 ug) of BJPl samples and 5 ul of MAB160 sample were loaded on SDS 8%-polyacrylamide gels and subjected to Western blot analysis with anti-aconitase antibodies. The positions of marker proteins, aconitase, and a putative breakdown product are indicated. 141 Resuspension Nutrient exhaustion Time of sporulation (h) "2 46,58 2&4’6 8 ‘ l-«Breakdown ' product 142 A putative breakdown product of aconitase was seen at about 70 kDa. The intensity of band increases at 6 and 8 h both for resuspension and DSM-induced sporulation. Neither the putative aconitase breakdown product nor the band we think corresponds to intact aconitase is observed in the citB mutant, although cross-reacting bands are more intense, indicating that an adequate amount of protein was loaded. Except at 2 h, the level of aconitase in BJPl samples was higher for cells induced to sporulate in DSM than by resuspension. For resuspension, the level of aconitase decreased from 2 to 8 h, whereas for DSM, the level increased. The lower level of aconitase in resuspension samples of BJPl as compared to DSM samples suggests a possible reason for the spore defect of this strain only being observed by resuspension sporulation. Since aconitase has the ability of enhance GerE accumulation, the lower level of aconitase by resuspension may result in a lower level of GerE. Under this condition, the strain may be more sensitive to perturbation of the SpoHH) late during sporulation. GerE and SpoHHD are known to compete for binding to overlapping sites at some promoter, such as cotC (Ichikawa and Kroos. 2000). To extend this study, the level of GerE should be compared in cells induced to sporulate by the two different methods. 143 APPENDIX IH Title: A Strain with nyl—proless-sigE Showed Inconclusive Results for sigE Induction 144 ABSTRACT A B. subtilis strain bearing a plasmid containing a nyr—proless-sz'gE fusion was induced with xylose 1 hour after cells were induced to sporulate by nutrient exhaustion in DSM. The levels of pro-oE from the native sigE locus and 0E were examined by Western blot analysis. The results were inconclusive in terms of sigE induction from the plasmid since some of the isolates showed a higher level of GE after induction while others not. Further experiments need to be done to evaluate whether this strain is useful for maintaining the GE level late during sporulation. INTRODUCTION In sporulating B. subtilis, the second sigma factor that becomes active in the mother cell is ex. Transcriptionally active 0K negatively regulates early gene expression. Two different pathways of OK inhibition of early gene expression have been described. When UK is made one hour earlier than normal, it appears to exert its negative effect through SpoOA-P, which activates transcription of the sigE operon (Halberg and Kroos. 1992; Zhang and Kroos. 1997; Zhang et al. 1999). When UK is expressed at the normal time, it affects the activity of 0A RNAP, which transcribes the sigE operon. This conclusion is supported by the observation that expression of another early sporulation gene, ald, is also inhibited when 0K becomes active (Halberg and Kroos. 1992; Zhang and Kroos. 1997; Zhang et al. 1999). The ald gene encodes alanine dehydrogenase and ald is also transcribed by GA RNAP. Why does a negative feedback loop from OK exist? This question has been at least partially answered by the study in Chapter II of this thesis. When O'K RNAP negatively regulates early gene expression, the level of SpoIHD goes down late during sporulation. 145 This decrease of SpoHID is important for sporulation since a strain engineered to maintain SpoHID late during sporulation exhibits spore defects. However, if 0K RNAP negatively affects 0A RNAP, expression of many early genes in addition to spoIIID is expected to be reduced late during sporulation. As mentioned above, this is indeed the case for sigE and ald. Is it important to turn down sigE expression late during sporulation? In order to answer this question, we made an effort to try to express sigE late during sporulation. If sporulation were more defective than for the strain with persistent spoIIID expression, it would indicate that turning down other (SE-controlled genes in addition to spoIIID is important for sporulation. A B. subtilis strain with nyl-proless-sigE was obtained and induced by adding xylose afier cells had been induced to sporulate by nutrient exhaustion in DSM. Western blot analysis failed to show conclusive evidence of increasing 0'5 accumulation late during sporulation. MATERIAL AND METHODS Strain, sporulation and induction. A B. subtilis strain (amyE::pMFZOzzproless- sigE/Cm') was obtained from Dr. Tsutomu Sato (Tokyo University of Agriculture and Technology). The portion of pMF20 containing the xylose-inducible nyr promoter fused to sigE lacking the region encoding the pro-sequence (amino acid 2-27 of pro-GE) was used to replace the amyE gene in the chromosome of otherwise wild-type B. subtilis. The strain was induced to sporulate by nutrient exhaustion in DSM twice. Each time three medium- sized colonies from freshly grown overnight DSM plates were selected. Each colony was 146 Fig. 111. Level of pro-oE and 0E. B. subtilis strain (amyE::pMFZO::proless-sigE/Cm') was induced to sporulate by nutrient exhaustion in DSM and the nyl promoter was induced by adding xylose (0.1%) at 1 hour into sporulation (T1). Samples collected at the indicated times during sporulation were subjected to Western blot analysis to detect pro-oE and GE. (A) A representative isolate from the first experiment. (B) A representative isolate from the second experiment. 147 (A) Time of sporulation (h) 1 2 3 4 5 3 7 it " ' ”_/pro-OE . oE + xylose ‘ ‘ E n " - ' “V pro-0' - XYlose 2,, ” fl ,...,Q-v\o-B (3) Time of sporulation (h) 1 2 3 4 5 6 7 8 9 CE y ...... mm ...—... ---- «Us E H 1 Jim at “a“ Mm *"W'" pro-O 148 inoculated into two flasks containing DSM liquid. One flask of each pair was induced by adding 0.1 ml of 10% xylose to the 10 ml DSM culture at 1 hour into sporulation. The other flask received no xylose addition as a control. 0.5 m1 aliquots were collected every hour into sporulation. Samples were centrifuged (1 min at 14,000 g) and cell pellets were stored at -70 °C. Western blot analysis. Preparation of whole-cell extracts, electrophoresis, and electroblotting were as described (Lu, et al. 1990; Halberg and Kroos. 1992). Samples (5 pl) were electrophoresed on SDS 14%—polyacrylamide gels. The blots were probed with anti-pro—oE antiserum diluted 1:1000. Irnmunodetection of primary antibodies was as described (Kroos, et al. 2002). RESULT AND DISCUSSION Representative Western blots from the two experiments shown in Fig. IH. Panel A shows one isolate from the first experiment. This isolate appeared to have a higher level of (SE when xylose was added. However, the pro-oE level also appeared to be higher in those samples, suggesting that protein extraction might have been more efficient for those samples. Two-out-of-three isolates fiom the first experiment showed this result. The other isolate showed similar pro-oE and 05 levels at all time regardless of xylose addition, as did all three isolates from the second experiment (One is shown in Fig. IH, panel B). Although I believe that I treated all the isolates the same way, inconsistent results were generated. For further investigation, I think it might be worthwhile to sporulate the cells by resuspension in SM medium and load an equal amount of protein form each sample. Also, testing different xylose concentrations might be worthwhile. It is possible that the nyl promoter 149 cannot be induced well after cells have been induced to sporulate. Dr. Daisuke Imamura, who created this strain, said that he had only induced 0’13 production in this strain during vegetative growth, not during sporulation previously (personal communication). 150 SUMMARY AND PERSPECTIVES 151 Gene expression in the mother cell of sporulating B. subtilis is controlled by a regulatory network, consisting of a major cascade of four regulatory factors, in the order oE-SpoHHD- (SK-GerE, and several feed back and feed forward loops between different components of the network. In this thesis, experiments have been performed in order to understand the importance of several negative links in the regulatory network. These negative effects are: transcriptionally active O'K RNAP negatively regulates early gene expression, GerE represses sigK expression, and SpoHH) represses cotC expression. Finally, a genetic screen was performed in order to understand the mechanism by which transcriptionally active 0K RNAP negatively regulates early gene expression. To circumvent the 0K RNAP negative feedback loop, which causes a decrease in SpoHID accumulation late during sporulation, a B. subtilis strain was constructed that bears a multicopy plasmid containing a PgerESPOIIID fusion (Chapter H). This strain showed persistent expression of SpoHID late during sporulation. Spores formed from this strain showed heat- and lysozyme-resistance defects in comparison to wild-type B. subtilis and a control strain with multicopy Pgerg. Thin-section microscopy revealed a defective coat structure of spores from the strain with PgerpspoIIID. This strain also exhibited altered expression of lacZ reporters; lower gerE-lacZ, lower cotC-lacZ and higher cotD-lacZ expression than wild type or the control strain during sporulation. The lower gerE-lacZ expression observed in the strain with persistent SpoIHD late during sporulation revealed a novel regulatory interaction. It would be interesting to perform gel mobility shift assay in vitro in order to test whether SpoIHD directly affects gerE expression. The fact that maintaining SpoHID late during sporulation caused spore defects suggests that at least one 152 important reason for UK RNAP negative feedback on early gene expression is to fine-tune spoIIID expression in order to form normal spores. To circumvent GerE repression of sigK transcription, site-directed mutagenesis of the GerE binding site in sigK promoter region was performed and this mutant sigK allele was integrated in the amyE locus of a B. subtilis strain with a null mutation at its native sigK locus (Chapter 1H). GerE negative feedback on sigK was eliminated in this strain. The strain exhibits higher expression of gerE-lacZ and cotC-lacZ, and lower expression of cotD-lacZ, which is exactly opposite of that observed in the strain bearing the ngpspOIIID fusion (Chapter H). Although the strain with the mutant sigK allele does not exhibit spore defects, this allele suppressed the heat- and lysozyme-resistance defects caused by the PgerrspOIIID firsion. In the strain with the mutant sigK allele and ngpspOIIID, the gerE- lacZ, cotC-lacZ and cotD-lacZ reporters showed similar levels of expression as in wild- type B. subtilis. One perturbation in the mother cell regulatory network appeared to compensate for the other perturbation. A strain engineered to express cotC at least 2 hours earlier than normal showed no spore defects in heat-, lysozyme, or organic solvent- resistance assays, or in a quantitative germination assay. These results suggest a balance between sensitivity and robustness in the mother cell regulatory network of sporulating B. subtilis. The network can resist certain perturbations without detectable change in the overall output, a resistant spore. However, other perturbations, such as maintaining SpoIHD late during sporulation, exceed network tolerance and result in spore resistance defects. Messenger RNA of individual genes appears to be more susceptible to perturbation than the overall output. For example, the strain with the mutant sigK allele exhibited altered gene expression but normal spores. Also, many different mutations caused increased spoIIID- 153 lacZ expression during sporulation (Chapter IV). These strains have yet to be tested for spore defects. We screened for transposon insertions that increase spoIIID-lacZ expression during development in order to understand the mechanism by which transcriptional active 0K RNAP negatively feeds back on early gene expression (Chapter IV). We hoped to identify one or more genes under 0" control whose products carry out the negative feedback loop. Sever genes were identified, but none of these have been reported to be under UK control. At least two independent insertions occurred in one or more of the 10 genes for 16S rRNA. As these genes are the first in rRNA operons that are highly transcribed by GA RNAP, the insertions might free nucleotides and/or core RNAP for utilization by (SE in transcription of spoIIID-lacZ. This hypothesis suggests that UK RNAP negative feedback on early gene expression during sporulation might stem from competition between different sigma factors for nucleotides and engagement of core RNAP in transcription of their regulon. The other six insertions were in protein-encoding genes with no known connection to sporulation. The next step in analysis of all the insertions is to test whether the insertion is responsible for increased spoIIID—lacZ expression. If so, subsequent analysis for several of the insertions would involve testing whether the effect is due to a polar effect on expression of a downstream transcription factor. Another question for subsequent analysis would be whether the effect is specific for spoIIID-lacZ expression, or whether expression of other early sporulation genes is also elevated. Interestingly, the variety of insertions obtained hint at connections between cellular metabolism and the mother cell regulatory network. Ultimately, one would like to understand the molecular mechanisms of these connections, as this aspect of developmental regulatory networks is under explored. 154 Among them the 16S rRNA has been identified twice. Asides from the hypothetical gene yka, which might function similarly to pyruvate and water dikinase, none of other genes has been reported to show direct effects on sporulation. However, the functions of some gene products such as nucleoside diphosphate kinase, encoded by ndk, and 16S rRNA seems to point to the direction of cellular resource utilization and power supply during sporulation. N-acetylglucosarnine 6-P deacetylase, encoded by nagA, and the serine protease Do, a family member of heat shock proteins which is encoded by yde, both seem to have something to do with the initiation of sporulation. In the firture study, it would be interesting to understand the mechanisms of how these gene products affect sporulation, in particular, how to affect the 0K RNAP negative feedback. 155 REFERENCES 156 Abanes-De Mello, A., Y. L. Sun, S. Aung and K. Pogliano. (2002). A cytoskeleton-like role for the bacterial cell wall during engulfment of the Bacillus subtilis forespore. Genes Dev. 16: 3253- 3264. Alon, U. (2003). Biological networks: the tinkerer as an engineer. Science 301: 1866-1867. Alon, U. (2007). Network motifs: theory and experimental approaches. Nat Rev Genet 8: 450-61. Arabolaza, A. L., A. Nakamura, M. E. Pedrido, L. Martelotto, L. Orsaria and R. R. Grau. (2003). Characterization of a novel inhibitory feedback of the anti-anti-sigma SpoHAA on SpoOA activation during development in Bacillus subtilis. Mol. Microbiol. 47: 1251-1263. Aronson, A. I. and Fitz-James. (1976). Structure and morphogenesis of the bacterial spore coat. Bacteriol. Rev. 40: 360-402. Baccigalupi, L., G. Castaldo, G. Cangiano, R. Isticato, R. Marasco, M. De Felice and E. Ricca. (2004). GerE-independent expression of cotH leads to CotC accumulation in the mother cell compartment during Bacillus subtilis sporulation. Microbiology 150: 3441-9. Barnhart, M. M., J. Lynem and M. R. Chapman. (2006). GlcNAc-6P levels modulate the expression of Curli fibers by Escherichia coli. J Bacteriol 188: 5212-9. Basilion, J. P., T. A. Rouault, C. M. Massinople, R. D. Klausner and W. H. Burgess. (1994). The iron-responsive element—binding protein: localization of the RNA-binding site to the aconitase active-site cleft. Proc Natl Acad Sci U S A 91: 574-8. ‘ Ben-Yehuda, S. and R. Losick. (2002). Asymmetric cell division in B. subtilis involves a spiral- like intermediate of the cytokinetic protein FtsZ. $3ng 109: 25 7-266. Ben-Yehuda, S., D. Z. Rudner and R. Losick. (2003). RacA, a bacterial protein that anchors chromosomes to the cell poles. Science 299: 532-6. Burbulys, D., K. A. Trach and J. A. Hoch. (1991). Initiation of sporulation in B. subtilis is controlled by a multicomponent phosphorelay. £311 64: 545-5 52. Burkholder, W. F., I. Kurtser and A. D. Grossman. (2001). Replication initiation proteins regulate a developmental checkpoint in Bacillus subtilis. Qgfl 104: 269-279. Burri, R. and L. Kroos. Unpublished data. Bylund, J. E., M. A. Haines, P. J. Piggot and M. L. Higgins. (1993). Axial filament formation in Bacillus subtilis: induction of nucleoids of increasing length after addition of chloramphenicol to exponential-phase culttues approaching stationary phase. J Bacteriol 175: 1886-90. Campo, N. and D. Z. Rudner. (2006). A branched pathway governing the activation of a developmental transcription factor by regulated intrarnembrane proteolysis. Mol Cell 23: 25-35. 157 Carniol, K., P. Eichenberger and R. Losick. (2004). A threshold mechanism governing activation of the developmental regulatory protein o‘F in Bacillus subtilis. J. Biol. Chem. 279: 14860-14870. Chada, V. G., E. A. Sanstad, R. Wang and A. Driks. (2003). Morphogenesis of Bacillus spore surfaces. J. Bacteriol. 185: 6255-6261. Clarkson, J., J. C. Shu, D. A. Harris, I. D. Campbell and M. D. Yudkin. (2004). Fluorescence and kinetic analysis of the SpoHAB phosphorylation reaction, a key regulator of sporulation in Bacillus subtilis. Biochemisgy 43: 3120-3128. Clarkson, J., J. C. Shu, D. A. Harris, I. D. Campbell and M. D. Yudkin. (2004). Fluorescence and kinetic analysis of the SpoHAB phosphorylation reaction, a key regulator of sporulation in Bacillus subtilis. Biochemisgy 43: 3120-8. Coote, J. G. (1972). Sporulation in Bacillus subtlis. Characterization of oligosporogenous mutants and comparison of their phenotypes with those of asporogenous mutants. J. Gen. Microbiol. 71: l- l 5. Craig, J. E., M. J. Ford, D. C. Blaydon and A. L. Sonenshein. (1997). A null mutation in the Bacillus subtilis aconitase gene causes a block in SpoOA-phosphate-dependent gene expression. J Bacteriol 179: 7351-9. Crater, D. L. and C. P. Moran, Jr. (2002). Two regions of GerE required for promoter activation in Bacillus subtilis. J. Bacteriol. 184: 241-249. Crater, D. L., K. H. Wade, 0. Resnekov, H. T. Ichikawa, L. Kroos, J. A. Brannigan and C. P. Moran, Jr. (2002). A mutation in GerE that affects cotC promoter activation in Bacillus subtilis. Biochim. Biophys. Acta 1576: 30-38. Cutting, S., S. Panzer and R. Losick. (1989). Regulatory studies on the promoter for a gene governing synthesis and assembly of the spore coat in Bacillus subtilis. J. Mol. Biol. 207: 393-404. Cutting, S., V. Oke, A. Driks, R. Losick, S. Lu and L. Kroos. (1990). A forespore checlqroint for mother-cell gene expression during development in Bacillus subtilis. Gill 62: 239-250. Cutting, S., V. Oke, A. Driks, R. Losick, S. Lu and L. Kroos. (1990). A forespore checlqroint for mother cell gene expression during development in B. subtilis. Gill 62: 239-50. Cutting, S., A. Driks, R. Schmidt, B. Kunkel and R. Losick. (1991). Forespore-specific transcription of a gene in the signal transduction pathway that governs pro-c:K processing in Bacillus subtilis. Genes Dev. 5: 456-466. Dawes, I. W. and J. Mandelstam. (1970). Sporulation of Bacillus subtilis in continuous culture. J, Bacteriol. 103: 529-535. de Lencastre, H. and P. J. Piggot. (1979). Identification of different sites of expression for spo loci by transformation of Bacillus subtilis. J Gen Microbiol 114: 377-89. Decatur, A., M. T. McMurry, B. N. Kunkel and R. Losick. (1997). Translation of the mRNA for the sporulation gene spoHH) of Bacillus subtilis is dependent upon translation of a small upstream open reading fi'ame. J Bacteriol 179: 1324-8. 158 Dingman, D. W., M. S. Rosenkrantz and A. L. Sonenshein. (1987). Relationship between aconitase gene expression and sporulation in Bacillus subtilis. J. Bacteriol. 169: 3068-3075. Dong, T. C. and S. M. Cutting. (2003). SpoIVB-mediated cleavage of SpoIVFA could provide the intercellular signal to activate processing of Pro-sigmaK in Bacillus subtilis. Mol Microbiol 49: 1425-34. Donovan, W., L. Zheng, K. Sandman and R. Losick. (1987). Genes encoding spore coat polypeptides fi'om Bacillus subtilis. J. Mol. Biol. 196: 1-10. Driks, A. (2002). Maximum shields: the assembly and function of the bacterial spore coat. Trends Microbiol. 10: 251-254. Driks, A. (2003). The dynamic spore. Proc Natl Acad Sci U S A 100: 3007-9. Driks, A. (2004). From rings to layers: surprising patterns of protein deposition during bacterial spore assembly. J. Bacteriol. 186: 4423-4426. Ducros, V. M., R. J. Lewis, C. S. Verma, E. J. Dodson, G. Leonard, J. P. Turkenburg, G. N. Murshudov, A. J. Wilkinson and J. A. Brannigan. (2001). Crystal structure of GerE, the ultimate transcriptional regulator of spore formation in Bacillus subtilis. J. Mol. Biol. 306: 759-771. Dunn, G., and J. Mandelstam. (1977). Cell polarity in Bacillus subtilis: effects of growth conditions on spore positions in sister cells. J. Gen. Microbiol. 103: 201-205. Dworkin, J. and R. Losick. (2001). Differential gene expression governed by chromosomal spatial asymmetry. CLll 107: 339-46. Dworkin, J. (2003). Transient genetic asymmetry and cell fate in a bacterium. Trends Genet. 19: 107-112. Eichenberger, P., P. Fawcett and R. Losick. (2001). A three-protein inhibitor of polar septation during sporulation in Bacillus subtilis. Mol. Microbiol. 42: 1 147-1 162. Eichenberger, P., M. Fujita, S. T. Jensen, E. M. Conlon, D. Z. Rudner, S. T. Wang, C. Ferguson, K. Haga, T. Sato, J. S. Liu and R. Losick. (2004). The program of gene transcription for a single differentiating cell type during sporulation in Bacillus subtilis. PLoS Biol. 2: 1664- 1683. Errington, J ., L. Appleby, R. A. Daniel, H. Goodfellow, S. R. Partridge and M. D. Yudkin. (1992). Structure and function of the SpoIIIJ gene of Bacillus subtilis: a vegetatively expressed gene that is essential for 0'0 activity at an intermediate stage of sporulation. J. Gen. Microbiol. 138: 2609- 261 8. Fajardo-Cavazos, P. and W. L. Nicholson. (2000). The TRAP-like SplA protein is a trans-acting negative regulator of spore photoproduct lyase synthesis during Bacillus subtilis sporulation. J Bacteriol 182: 555-60. 159 Feucht, A., L. Abbotts and J. Errington. (2002). The cell differentiation protein SpoHE contains a regulatory site that controls its phosphatase activity in response to asymmetric septation. Mol. Microbiol. 45: 1119-1130. Frandsen, N. and P. Stragier. (1995). Identification and characterization of the Bacillus subtilis spoIIP locus. J. Bacteriol. 177: 716-722. Frandsen, N., I. Barak, C. Karmazyn-Campelli and P. Stragier. (1999). Transient gene asymmetry during sporulation and establishment of cell specificity in Bacillus subtilis. Genes Dev 13: 394-399. Fujita, M. and R. Losick. (2002). An investigation into the compartrnentalization of the sporulation transcription factor 0'5 in Bacillus subtilis. Mol. Microbiol. 43: 27-38. Fujita, M. and R. Losick. (2003). The master regulator for entry into sporulation in Bacillus subtilis becomes a cell-specific transcription factor after asymmetric division. Genes Dev. 17: 1166- 1174. Fukushima, T., T. Tanabe, H. Yamamoto, S. Hosoya, T. Sato, H. Yoshikawa and J. Sekiguchi. (2004). Characterization of a polysaccharide deacetylase gene homologue (pdaB) on sporulation of Bacillus subtilis. J Biochem (T 019/9) 136: 283-91. Gomez, M., S. Cutting and P. Stragier. (1995). Transcription of spoIVB is the only role of 0'6 that is essential for pro-0'" processing during spore formation in Bacillus subtilis. J. Bacteriol. 177: 4825 -4827. Gomez, M. and S. M. Cutting. (1997). bofC encodes a putative forespore regulator of the Bacillus subtilis cK checkpoint. Microbiol. 143: 157-170. Gottlieb, P., G. LaFauci and R. Rudner. (1985). Alterations in the number of rRNA operons within the Bacillus subtilis genome. Gene 33: 259-68. Graumann, P. L. and R. Losick. (2001). Coupling of asymmetric division to polar placement of replication origin regions in Bacillus subtilis. J Bacteriol 183: 4052-60. Gray, N. K., S. Quick, B. Goossen, A. Constable, H. Hirling, L. C. Kuhn and M. W. Hentze. (1993). Recombinant iron-regulatory factor fimctions as an iron-responsive-element-binding protein, a translational repressor and an aconitase. A functional assay for translational repression and direct demonstration of the iron switch. Eur J Biochem 218: 65 7-67. Halberg, R. and L. Kroos. (1992). Fate of the SpoHID switch protein during Bacillus subtilis sporulation depends on the mother-cell sigma factor, 0". J. Mol. Biol. 228: 840-849. Halberg, R. and L. Kroos. (1994). Sporulation regulatory protein SpoIHD from Bacillus subtilis activates and represses transcription by both mother-cell-specific forms of RNA polymerase. L M01. Biol. 243: 425-436. Halberg, R., V. Oke and L. Kroos. (1995). Effects of Bacillus subtilis sporulation regulatory protein SpoIHD on transctiption by GK RNA polymerase in vivo and in vitro. J. Bacteriol. 177: 1888-1891. 160 Haldenwang, W. G. (1995). The sigma factors of Bacillus subtilis. Microbiol. Rev. 59: 1-30. Henriques, A. O., B. W. Beall, K. Roland and C. P. Moran. (1995). Characterization of cotJ, a oE-controlled operon affecting the polypeptide composition of the coat of Bacillus subtilis spores. J Bacteriol 177: 3394-3406. Henriques, A. O., B. W. Beall and C. P. Moran. (1997). CotM of Bacillus subtilis, a member of the alpha-crystallin family of stress proteins, is induced during development and participates in spore outer coat formation. J Bacteriol 179: 1887-1897. Henriques, A. O., L. R. Melsen, and C. P. Moran, Jr. (1998). Involvement of superoxide disrnutase in spore coat assembly in Bacillus subtilis. J. Bacteriol. 180: 2285-2291. Hilbert, D. W. and P. J. Piggot. (2003). Novel spoIIE mutation that causes uncompartmentalizcd O'F activation in Bacillus subtilis. J. Bacteriol. 185: 1590-1598. Hilbert, D. W. and P. J. Piggot. (2004). Compartrnentalization of gene expression during Bacillus subtilis spore formation. Microbiol. Mol. Biol. Rev. 68: 234-262. Himes, P. R. and L. Kroos. Unpublished data. Ho, M. S., K. Carniol and R. Losick. (2003). Evidence in support of a docking model for the release of the transcription factor 0'F from the antisigma factor SpoHAB in Bacillus subtilis. J. Biol. Chem. 278: 20898-20905. Hoa, N. T., J. A. Brannigan and S. M. Cutting. (2001). The PDZ domain of the SpoIVB serine peptidase facilitates multiple functions. J. Bacteriol. 183: 4364-73. Hofmeister, A. E. M., A. Londono-Vallejo, E. Harry, P. Stragier and R. Losick. (1995). Extracellular signal protein triggering the proteolytic activation of a developmental transcription factor in B. subtilis. _Ce_ll 83: 219-226. Ichikawa, H., R. Halberg and L. Kroos. (1999). Negative regulation by the Bacillus subtilis GerE protein. J. Biol. Chem. 274: 8322-8327. Ichikawa, H. and L. Kroos. (2000). Combined action of two transcription factors regulates genes encoding spore coat proteins of Bacillus subtilis. J. Biol. Chem. 275: 13849-13855. Ichikawa, H. (2000). Dissertation. Hling, N. and J. Errington. (1991). Genetic regulation of morphogenesis in Bacillus subtilis: roles of cE and J in prespore engulfinent. J. Bacteriol. 173: 3159-3169. Hling, N. and J. Errington. (1991). The spa/[IA operon of Bacillus subtilis defines a new temporal class of mother-cell-specific sporulation genes under the control of the OE form of RNA polymerase. Mol. Microbiol. 5: 1927-1940. 161 Isticato, R., G. Esposito, R. Zilhao, S. Nolasco, G. Cangiano, M. De Felice, A. O. Henriques and E. Ricca. (2004). Assembly of multiple CotC forms into the Bacillus subtilis spore coat. J Bacteriol 186: 1129-35. Jonas, R. M., E. A. Weaver, T. J. Kenney, C. P. Moran, Jr. and W. G. Haldenwang. (1988). The Bacillus subtilis spoIIG operon encodes both 0'3 and a gene necessary for GE activation. L Bacteriol. 170: 507-511. Ju, J., T. Luo and W. Haldenwang. (1997). Bacillus subtilis pro-csE firsion protein localizes to the forespore septum and fails to be processed when synthesized in the forespore. J. Bacteriol. 179: 4888-4893. Ju, J., T. Luo and W. Haldenwang. (1998). Forespore expression and processing of the SigE transcription factor in wild-type and mutant Bacillus subtilis. J. Bacteriol. 180: 1673-1681. Karmazyn-Campelli, C., C. Bonamy, B. Savelli and P. Stragier. (1989). Tandem genes encoding o-factors for consecutive steps of development in Bacillus subtilis. Genes & Dev. 3: 150- 157. Karow, M. L., P. Glaser and P. J. Piggot. (1995). Identification of a gene, SpoIIR, that links the activation of GE to the transcriptional activity of UP during sporulation in Bacillus subtilis. Proc. Natl. Acad. Sci. USA 92: 2012-2016. Karow, M. L. and P. J. Piggot. (1995). Construction of gusA transcriptional fusion vectors for Bacillus subtilis and their utilization for studies of spore formation. Gene 163: 69-74. Kellner, E. M., A. Decatur and C. P. Moran, Jr. (1996). Two-stage regulation of an anti-sigrna factor determines developmental fate during bacterial endospore formation. Mol. Microbiol. 21: 913-924. Kenney, T. J. and C. P. Moran. (1987). Organization and regulation of an operon that encodes a sporulation-essential sigma factor in Bacillus subtilis. J. Bacteriol. 169: 3329-3339. Kim, H., M. Hahn, P. Grabowski, D. C. McPherson, M. M. Otte, R. Wang, C. C. Ferguson, P. Eichenberger and A. Driks. (2006). The Bacillus subtilis spore coat protein interaction network. Mol. Microbiol. 59: 487-502. Kirchman, P. A., H. DeGrazia, E. M. Kellner and C. P. Moran, Jr. (1993). Forespore-specific disappearance of the sigma-factor antagonist SpoIIAB: implications for its role in determination of cell fate in Bacillus subtilis. Mol. Microbiol. 8: 663 -671. Kroos, L., B. Kunkel and R. Losick. (1989). Switch protein alters specificity of RNA polymerase containing a compartment-specific sigma factor. Science 243: 526-529. Kroos, L., B. Zhang, H. Ichikawa and Y.-T. N. Yu. (1999). Control of 0 factor activity during Bacillus subtilis sporulation. Mol. Microbiol. 31: 1285-1294. Kroos, L., Y. T. Yu, D. Mills and S. Ferguson-Miller. (2002). Forespore signaling is necessary for pro-csK processing during Bacillus subtilis sporulation despite the loss of SpoIVFA upon translational arrest. J. Bacteriol. 184: 5393-5401. 162 Kroos, L. (2007). The Bacillus and Myxococcus developmental networks and their transcriptional regulators. Annu. Rev. Genet. in press. Kunkel, B., K. Sandman, S. Panzer, P. Youngman and R. Losick. (1988). The promoter for a sporulation gene in the spoIV C locus of Bacillus subtilis and its use in studies of temporal and spatial control of gene expression. J. Bacteriol. 170: 3513-3522. Kunkel, B., L. Kroos, H. Poth, P. Youngman and R. Losick. (1989). Temporal and spatial control of the mother-cell regulatory gene spoIIID of Bacillus subtilis. Genes Dev. 3: 1735-1744. Kunkel, B., R. Losick and P. Stragier. (1990). The Bacillus subtilis gene for the development transcription factor sigma K is generated by excision of a dispensable DNA element containing a sporulation recombinase gene. Genes Dev 4: 525-35. LaBell, T. L., J. E. Trempy and W. G. Haldenwang. (1987). Sporulation-specific sigma factor, 029, of Bacillus subtilis is synthesized from a precursor protein, P“. Proc. Nat. Acgfi. Sci. USA 84: 1784-1788. Lazazzera, B. A. and A. D. Grossman. (1998). The ins and outs of peptide signaling. Trends Microbiol. 6: 288-294. Lee, C. S., J. Clarkson, J. C. Shu, I. D. Campbell and M. D. Yudkin. (2001). Bacillus subtilis mutations that alter the pathway of phosphorylation of the anti-anti-sigmaF factor SpoHAA lead to a Spo- phenotype. Mol Microbiol 40: 9-19. Little, S. and A. Driks. (2001). Functional analysis of the Bacillus subtilis morphogenetic spore coat protein CotE. M01 Microbiol 42: 1107-20. Londono-Vallejo, J. A. and P. Stragier. (1995). Cell-cell signaling pathway activating a developmental transcription factor in Bacillus subtilis. Genes Dev. 9: 503-508. Londono-Vallejo, J. A., C. Frehel and P. Stragier. (1997). SpoHQ, a forespore-expressed gene required for engulfment in Bacillus subtilis. Mol. Microbiol. 24: 29-39. Loughney, K., E. Lund and J. E. Dahlberg. (1983). Deletion of an rRNA gene set in Bacillus subtilis. J Bacteriol 154: $29-32. Lu, S., R. Halberg and L. Kroos. (1990). Processing of the mother-cell 0 factor, 0", may depend on events occurring in the forespore during Bacillus subtilis development. Proc. Natl. Acad. Sci. USA 87: 9722-9726. Lu, S. and L. Kroos. (1994). Overproducing the Bacillus subtilis mother-cell sigma factor precursor, pro-0K, uncouples (SK-dependent gene expression from dependence on intercompartmental communication. J. Bacteriol. 176: 3936-3943. Maciag, I. E., J. F. Viret and J. C. Alonso. (1988). Replication and incompatibility properties of plasmid pUBl 10 in Bacillus subtilis. Mol. Gen. Genet. 212: 232-240. Margolis, P. S., A. Driks and R. Losick. (1993). Sporulation gene spoIIB from Bacillus subtilis. L Bacteriol. 175: 528-540. 163 Martin-Verstraete, 1., V. Charrier, J. Stulke, A. Galinier, B. Erni, G. Rapoport and J. Deutscher. (1998). Antagonistic effects of dual PTS-catalysed phosphorylation on the Bacillus subtilis transcriptional activator LevR. Mol Microbiol 28: 293-303. Maslov, S. and K. Sneppen. (2002). Specificity and stability in topology of protein networks. Science 296: 910-3. McBride, S. M., A. Rubio, L. Wang and W. G. Haldenwang. (2005). Contributions of protein structtn'e and gene position to the compartrnentalization of the regulatory proteins 0'5 and SpoHE in sporulating Bacillus subtilis. Mol. Microbiol. 57: 434-451. McPherson, D., Kim, H., Hahn, M., Wang, R., Grabowski, P., Eichenberger, P., and Driks, A. (2005). Characterization of the Bacillus subtilis spore morphogenetic coat protein CotO. L Bacteriol. 187: 8278-8290. Naclerio, G., L. Baccigalupi, R. Zilhao, M. De Felice and E. Ricca. (1996). Bacillus subtilis spore coat assembly requires cotH gene expression. J. Bacteriol. 178: 43 75-43 80. Noone, D., A. Howell, R. Collery and K. M. Devine. (2001). kaA and thA, HtrA-like serine proteases in Bacillus subtilis, engage in negative autoregulation and reciprocal cross-regulation of yde and yvtA gene expression. J Bacteriol 183: 654-63. Paidhungat, M., and P. Setlow. (2002). Spore germination and outgrowth, p. 537-548. In A. L. Sonenshein, J. A. Hoch, and R. Losick (ed), Bacillus subtilis and its closest relatives: from genes to cells. American Society for Microbiology, Washington, DC. Pan, Q., D. A. Garsin and R. Losick. (2001). Self-reinforcing activation of a cell-specific transcription factor by proteolysis of an anti-sigma factor in B. subtilis. Mol. Cell 8: 873-883. Partridge, S. R. and J. Errington. (1993). Importance of morphological events and intercellular interactions in the regulation of prespore-specific gene expression during sporulation in Bacillus subtilis. Mol. Microbiol. 8: 945-955. Petit, M. A., C. Bruand, L. Janniere and S. D. Ehrlich. (1990). TnIO-derived transposons active in Bacillus subtilis. J Bacteriol 172: 6736-6740. Piggot, P. J. and D. W. Hilbert. (2004). Sporulation of Bacillus subtilis. Curr. Opin. Microbiol. 7: 579-586. Piggot, T. A. and M. J. Black. (1974). Letter: Importance of not damaging the volar digital arteries when using the zig-zag incision on a finger. Plast Reconstr Surg 53: 80-1. Plomp, M., T. J. Leighton, K. E. Wheeler and A. J. Malkin. (2005). The high-resolution architecture and structural dynamics of Bacillus spores. Biophys. J. 88: 603-608. Plomp, M., T. J. Leighton, K. E. Wheeler and A. J. Malkin. (2005). Architecture and high- resolution structure of Bacillus thuringiensis and Bacillus cereus spore coat surfaces. Langmuir 21: 7892-7898. 164 Plomp, M., T. J. Leighton, K. E. Wheeler, M. E. Pitesky and A. J. Malkin. (2005). Bacillus atrophaeus outer spore coat assembly and ultrastructure. Langn_ruir 21: 10710-10716. Pogliano, J ., N. Osborne, M. D. Sharp, A. Abanes-De Mello, A. Perez, Y. L. Sun and K. Pogliano. (1999). A vital stain for studying membrane dynamics in bacteria: a novel mechanism controlling septation during Bacillus subtilis sporulation. Mol. Microbiol. 31: 1149-1159. Popham, D. L. and P. Stragier. (1992). Binding of the Bacillus subtilis spoIVCA product to the recombination sites of the element interrupting the oK-encoding gene. Proc. Natl. Acad. Sci. USA 89: 5991-5995. Popham, D. L., J. Helin, C. E. Costello and P. Setlow. (1996). Analysis of the peptidoglycan sn'ucture of Bacillus subtilis endospores. J Bacteriol 178: 6451-8. Rong, S., M. S. Rosenkrantz and A. L. Sonenshein. (1986). Transcriptional control of the Bacillus subtilis spoIID gene. J. Bacteriol. 165: 771-779. Rudner, D., P. Fawcett and R. Losick. (1999). A family of membrane-embedded metalloproteases involved in regulated proteolysis of membrane-associated transcription factors. Proc. Natl. Acad. Sci. USA 96: 14765-14770. Sato, T., K. Harada, Y. Ohta and Y. Kobayashi. (1994). Expression of the Bacillus subtilis spoIVCA gene, which encodes a site-specific recombinase, depends on the spollGB product. L Bacteriol. 176: 935-937. Savageau, M. A. (1971). Parameter sensitivity as a criterion for evaluating and comparing the performance of biochemical systems. Nature 229: 542-4. Serio, A. W., K. B. Pechter and A. L. Sonenshein. (2006). Bacillus subtilis aconitase is required for efficient late-sporulation gene expression. J. Bacteriol. 188: 6396-6405. Serio, A. W. and A. L. Sonenshein. (2006). Expression of yeast mitochondrial aconitase in Bacillus subtilis. J Bacteriol 188: 6406-10. Serrano, M., A. Neves, C. M. Soares, C. P. Moran, Jr. and A. O. Henriques. (2004). Role of the anti-sigma factor SpoHAB in regulation of 06 during Bacillus subtilis sporulation. J. Bacteriol. 186: 4000-40 1 3. Setlow, P. (1995). Mechanisms of prevention of damage to the DNA in spores of Bacillus species. Annu Rev Microbiol 49: 29-54. Smith, K., M. E. Bayer and P. Youngman. (1993). Physical and functional characterization of the Bacillus subtilis spoHM gene. J Bacteriol 175: 3607-17. Smith, K. and P. Youngman. (1993). Evidence that the spoHM gene of Bacillus subtilis is transcribed by RNA polymerase associated with sigma E. J Bacteriol 175: 3618-27. Srinivasan, R., H. Rajeswari, B. N. Bhatt, S. Indi and P. Ajitkumar. (2007). GTP/GDP binding stabilizes bacterial cell division protein FtsZ against degradation by FtsH protease in vitro. Biochem Biophys Res Commun. 165 Steil, L., M. Serrano, A. O. Henriques and U. Volker. (2005). Genome-wide analysis of temporally regulated and compartment-specific gene expression in sporulating cells of Bacillus subtilis. Microbiology 151: 399-420. Steinmetz, M. and R. Richter. (1994). Plasmids designed to alter the antibiotic resistance expression by insertion mutations in Bacillus subtilis, through in vivo recombination. Gene 142: 79- 83. Stelling, J ., U. Sauer, Z. Szallasi, F. J. Doyle, 3rd and J. Doyle. (2004). Robustness of cellular functions. gill 118: 675-685. Sterlini, J. M. and J. Mandelstam. (1969). Commitment to sporulation in Bacillus subtilis and its relationship to development of actinomycin resistance. Biochem. J. 113: 29-37. Stragier, P., C. Bonamy and C. Karmazyn-Campelli. (1988). Processing of a sporulation sigma factor in Bacillus subtilis: How morphological structure could control gene expression. C_el_1 52: 697-704. Stragier, P., B. Kunkel, L. Kroos and R. Losick. (1989). Chromosomal rearrangement generating a composite gene for a developmental transcription factor. Science 243: 507-512. Stragier, P. and R. Losick. (1996). Molecular genetics of sporulation in Bacillus subtilis. Ann. Rev. Genet. 30: 297-341. Sun, D., P. Stragier and P. Setlow. (1989). Identification of a new o-factor involved in compartmentalized gene expression during sporulation of Bacillus subtilis. Genes Dev. 3: 141-149. Sun, D., R. M. Cabrera-Martinez and P. Setlow. (1991). Control of transcription of the Bacillus subtilis spoIIIG gene, which codes for the forespore specfic transcription factor 00. J. Bacteriol. 173: 2977-2984. Sun, Y. L., M. D. Sharp and K. Pogliano. (2000). A dispensable role for forespore-specific gene expression in engulfment of the forespore during sporulation of Bacillus subtilis. J. Bacteriol. 182: 2919-2927. Tatti, K. M., C. H. Jones and C. P. Moran. (1991). Genetic evidence for interaction of 05 with the spoIIID promoter in Bacillus subtilis. J. Bacteriol. 173: 7828-7833. Thomaides, H. B., M. Freeman, M. El Karoui and J. Errington. (2001). Division site selection protein DivIV A of Bacillus subtilis has a second distinct function in chromosome segregation during sporulation. Genes Dev 15: 1662-73. Trach, K. A. and J. Hoch. (1993). Multisensory activation of the phosphorelay initiating sporulation in Bacillus subtilis: identification and sequence of the protein kinase of the alternate pathway. Mol. Microbiol. 8: 69-79. Wakeley, P., N. T. Hoa and S. Cutting. (2000). BofC negatively regulates SpoIVB-mediated signalling in the Bacillus subtilis (SK-checkpoint. Mol. Microbiol. 36: 1415-1424. 166 Wakeley, P. R., R. Dorazi, N. T. Hoa, J. R. Bowyer and S. M. Cutting. (2000). Proteolysis of SpoIVB is a critical determinant in signalling of Pro-oK processing in Bacillus subtilis. Mol. Microbiol. 36: 1336-1348. Wang, L., J. Perpich and L. Kroos. Unpublished data. Wang, S. T., B. Setlow, E. M. Conlon, J. L. Lyon, D. Imamura, T. Sato, P. Setlow, R. Losick and P. Eichenberger. (2006). The forespore line of gene expression in Bacillus subtilis. J. Mol. Biol. 358: 16-37. White, D. (1999). The Physiology and Biochemistry of Prokaryotes, 2 ed. Oxford UniversitLPress. Wu, L. J. and J. Errington. (1994). Bacillus subtilis SpoIHE protein required for DNA segregation during assymetric cell division. Science 264: 572-575. Wu, L. J. and J. Errington. (1998). Use of asymmetric cell division and SpoIHE mutants to probe chromosome orientation and organization in Bacillus subtilis. Mol. Microbiol. 27: 777-786. Wu, L. J. and J. Errington. (2003). RacA and the Soj-SpoOJ system combine to effect polar chromosome segregation in sporulating Bacillus subtilis. Mol. Microbiol. 49: 1463-1475. Youngman, P., J. B. Perkins and R. Losick. (1984). Construction of a cloning site near one end of Tn91 7 into which foreign DNA may be inserted without affecting transposition in Bacillus subtilis or expression of the transposon-bome erm gene. Plasmid 12: 1-9. Yu, Y.-T. N. and L. Kroos. (2000). Evidence that SpoIVFB is a novel type of membrane metalloprotease governing intercompartmental communication during Bacillus subtilis sporulation. J. Bacteriol. 182: 3305-3309. Zhang, B., R. Daniel, J. Errington and L. Kroos. (1997). Bacillus subtilis SpoHID protein binds to two sites in the spa VD promoter and represses transcription by GE RNA polymerase. J. Bacteriol. 179: 972-975. Zhang, B. and L. Kroos. (1997). A feedback loop regulates the switch from one sigma factor to the next in the cascade controlling Bacillus subtilis mother cell gene expression. J. Bacteriol. 179: 6138-6144. Zhang, B., P. Struffi and L. Kroos. (1999). UK can negatively regulate sigE expression by two different mechanisms during sporulation of Bacillus subtilis. J. Bacteriol. 181: 4081-4088. Zhang, J., H. Ichikawa, R. Halberg, L. Kroos and A. I. Aronson. (1994). Regulation of the transcription of a cluster of Bacillus subtilis spore coat genes. J. Mol. Biol. 240: 405-415. Zhang, L., M. L. Higgins, P. J. Piggot and M. L. Karow. (1996). Analysis of the role of prespore gene expression in the compartrnentalization of mother cell-specific gene expression during sporulation of Bacillus subtilis. J Bacteriol 178: 2813-7. Zheng, L., W. Donovan, P. C. Fitz-James and R. Losick. (1988). Gene encoding a morphogenic protein required in the assembly of the outer coat of the Bacillus subtilis endospore. Genes & Dev. 2: 1047-1054. 167 Zheng, L. and R. Losick. (1990). Cascade regulation of spore coat gene expression in Bacillus subtilis. J. Mol. Biol. 212: 645-660. Zheng, L., R. Halberg, S. Roels, H. Ichikawa, L. Kroos and R. Losick. (1992). Sporulation regulatory protein GerE from Bacillus subtilis binds to and can activate or repress transcription from promoters for mother-cell-specific genes. J. Mol. Biol. 226: 1037-1050. Zhou, R. and L. Kroos. (2005). Serine proteases from two cell types target different components of a complex that governs regulated intrarnembrane proteolysis of pro-0’K during Bacillus subtilis development. Mol. Microbiol. 58: 835-846. Zilhao, R., G. Naclerio, A. O. Henriques, L. Baccigalupi, C. P. Moran, Jr. and E. Ricca. (1999). Assembly requirements and role of CotH during spore coat formation in Bacillus subtilis. J Bacteriol 181 : 2631-3. 168 1l_- IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII ll1111111111111“111111