TM

(3
DOOc

 

 

_UBRARY
Mlchigan State
Universrty

 

This is to certify that the
thesis entitled

PHOTORHABDUS LUMINESCENS PUTATIVE MAD
FIMBRIAE ARE REQUIRED FOR ADHERENCE IN THE
MATERNAL INTESTINE AND INITIATION OF SYMBIONT

TRANSMISSION IN HETERORHABDITIS BACTERIOPHORA

presented by

Bettina Maria Kaufmann-Daszczuk

has been accepted towards fulfillment
of the requirements for the

Masters of degree in Microbiology and Molecular
Science Genetics

 

 

 

f/%‘//7M

Major ProfesWature
(31a: / 6100’!

Date

MSU is an Afiinnative Action/Equal Opportunity Institution

— --‘.-._--a-;I--I-n- -.--.-n-a-

---—-.----n---.---u--n-.—.-.-.—.-l-.-»-.-.--o-n---c-o--.--.----¢-— —

 

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE

DATE DUE

DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

6/07 p:/CIRC/DateDue.indd-p.1

 

PHOTORHABDUS LUMINESCENS PUTATIVE MAD FIMBRIAE ARE REQUIRED
FOR ADHERENCE IN THE MATERNAL INTESTINE AND INITIATION OF
SYMBIONT TRANSMISSION IN HETERORHABDITIS BA CTERIOPHORA
By

Bettina Maria Kaufmann-Daszczuk

A THESIS

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

MASTER OF SCIENCE
Department of Microbiology and Molecular Genetics

2007

ABSTRACT
PHOTORHABDUS LUMINESCENS PUTATIVE MAD F IMBRIAE ARE REQUIRED
FOR ADHERENCE IN THE MATERNAL INTESTINE AND IN ITIATION OF
SYMBIONT TRANSMISSION IN HET ERORHABDITIS BA CT ERIOPHORA
By
Bettina Kaufmann-Daszczuk
The nematode Heterorhabditis bacteriophora lives in a symbiotic relationship
with the entomopathogenic bacterium Photorhabdus luminescens, which colonizes and
persists in the intestine of H. bacteriophora infective juveniles. To identify the genes
involved in colonization of H. bacteriophora, ~8000 Photorhabdus spp. mutants were
constructed by transposon mutagenesis and screened for symbiont transmission. Twelve
of the 30 t_ragsmission mutants (TRN) contained transposon insertions in the putative
fImbrial gene cluster VI, comprised of genes madR through mad]. While P. luminescens
has eleven fimbrial gene clusters, only gene cluster VI encoded fimbriae might be
essential for symbiont transmission. When one of the TRN mutants was complemented
with mad genes, it was able to adhere to the maternal H. bacteriophora intestine once
again, but no transmission of the complemented mutant from mother to offspring was
observed. All TRN mutants displayed characteristics of wild-type P. Iuminescens such as
bioluminescence, pigmentation, and colony morphology. All TRN fimbrial mutants were
able to form a biofilm on an abiotic surface and were shown to hemaglutinate blood cells.
In addition, an inverted repeat switch, found just upstream of madA, controls gene cluster
VI during phase variation (ON H OFF switching of phenotype expression). Overall, the

results of this study suggest that fimbriae encoded by gene cluster VI are nematode

specific and important during colonization.

Copyright by
BETTINA MARIA KAUFMANN-DASZCZUK
2007

ACKNOWLEDGEMENTS

I would like to thank my advisor Todd A. Ciche for the opportunity to do this
research, which enabled me to expand my knowledge of microbiology and molecular
genetics. I would like to thank Kwi Suk Kim for providing the cloning vector used in the
transformation experiments and for her continuous support. I would also like to thank
Poorna Viswanathan, Katherine Hi gginbotham, Eric Kleiner, and past and present
members of the Ciche lab for their support and helpful suggestions.

I would like to thank my committee members, Martha Mulks, Cindy Arvidson,
Gemma Reguera, and Suzanne Thiem for helpful comments and suggestions along the
way. Special thanks to Vincent Young, Robert Britten, and Georg Bird for reviewing
drafts of my thesis and providing guidance to improve my writing.

I would like to dedicate this thesis to my husband Joseph Daszczuk and my

mother Maria Kaufmann, the two most important people in my life.

iv

TABLE OF CONTENTS

LIST OF TABLES .................................................................................. vi

LIST OF FIGURES ................................................................................ vii

CHAPTER 1

INTRODUCTION .................................................................................. l
Photorhabdus luminescens and Heterorhabditis bacteriophora symbiosis ............. 2
Symbiont transmission .......................................................................... 4
Phenotypic variation in P. luminescens ....................................................... 6
General role of fimbriae in transmission ....................................................... 8
Major types of fimbriae and biosynthesis pathways ....................................... 12
Nematode-bacteria symbiosis as a model system ........................................... 16
Literature cited ................................................................................. 18

CHAPTER 2

PHOTORHABDUS LUMINESCENS PUTATIVE MAD FIMBRIAE ARE REQUIRED
FOR ADHERENCE AND TRANSMISSION IN HE T ERORHABDIT IS

BA CT ERIOPHORA ................................................................................ 24
Abstract .......................................................................................... 26
Introduction ...................................................................................... 27
Materials and Methods ........................................................................ 29
Results ............................................................................................ 40
Discussion ....................................................................................... 51
References ....................................................................................... 56

CHAPTER 3

SUMMARY AND FUTURE DIRECTIONS .................................................. 59
Summary ........................................................................................ 60
Future Directions .............................................................................. 63

APPENDICES ..................................................................................... 65
RNA isolation and RT-PCR of mad gene cluster operon ................................. 66
Gene knockout by PCR Strand Overlapping Extension .................................. 68
Biofilm formation on polystyrene plates ................................................... 72

LIST OF TABLES

CHAPTER 2
Table 2—1: Strains and plasmids used in this study ........................................ 30

Table 2-2: Transmission efficiencies of P. temperata NC] and P. luminescens
TTOl TRN mutants and predicted transposon insertion sites ............... 43

Table 2-3: Comparison of P. luminescens mad genes with their E. coli
homolog and their proposed functions .......................................... 44

Table 2-4: Expression of major fimbrial subunits in P. luminescens

TTOl Tn7GF P and TRN 26—26 as measured by RT-PCR .................. 49
APPENDICES
Table 1: Expression of mad genes as measured by RT-PCR .............................. 67

vi

LIST OF FIGURES

CHAPTER 1
Figure l-1: Lifecycle of H. bacteriophora ................................................... 3
Figure 1-2: Location of GFP-labeled P. luminescens bacteria within
H. bacteriophora during development ......................................... 5
Figure 1-3: P. luminescens fimbrial gene clusters ......................................... 10
Figure 1-4: Putative biosynthesis pathway of mad fimbriae via the
usher-chaperone pathway ...................................................... 15
CHAPTER 2
Figure 2-1: Nucleotide sequence upstream of madA and size of inverted repeat
PCR fragments after digestion with SfcI ...................................... 37
Figure 2-2: Locations of transposon insertions in the P. luminescens gene cluster
VI .................................................................................. 42
Figure 2-3: P. luminescens TTOl Tn7GFP, TRN 26-25, and transformed TRN 26-25
bacteria in 44-hour post-IJ H. bacteriophora ................................ 46
Figure 2-4: Sfcl digested inverted repeat PCR products .................................. 48
Figure 2-5: TEM images of P. luminescens TT01 Tn7GFP and TRN 26-25 .......... 50
CHAPTER 3
Figure 3-1: A hypothetical model of adherence of P. luminescens to
H. bacteriophora intestinal cells mediated by mad fimbriae .............. 62
APPENDICES

Figure l: Biofilm formation of wildtype P. luminescens and TRN mutants on a
96-well plate ........................................................................ 73

vii

CHAPTER 1: INTRODUCTION

The introduction is divided into six parts. Part I describes the symbiotic
relationship of Photorhabdus spp. and Heterorhabditis bacteriophora. Part II explains
how symbionts are transmitted during different stages of H. bacteriophora development.
Part III introduces the importance of phenotypic variation in P. luminescens. Part IV
summarizes the general role of fimbn'ae in transmission. Part V describes the major
types of pili and fimbriae and biosynthesis pathways. Part VI explains why the
nematode-bacteria symbiosis is an excellent model to study the role of fimbriae in human

pathogens.

INTRODUCTION

Photorhabdus spp. and Heterorhabditis bacteriophora symbiosis

The Gram-negative bacteria Photorhabdus luminescens and Photorhabdus
temperata, of the family Enterobacteriaceae, are symbiotically associated with the
nematode Heterorhabditis bacteriophora (Khan & Brooks, 1976; Poinar, 1975). In this
obligate mutualism, the nematodes require the bacteria for growth, reproduction, and
insect killing, while the bacteria require the nematode host as a vector for transmission to
an insect prey (Han and Ehlers, 2000; Ciche et al. 2001). Together, P. luminescens and
H. bacteriophora are able to infect and kill a large variety of insect larvae (Khan and
Brooks, 1976; Poinar, 1975). In soil, H. bacteriophora persists as the developmentally
arrested infective juvenile (IJ) stage, which transmits P. luminescens cells in its intestine
to insect hosts (Figure 1-1; Hatab et al. 1998). When IJs encounter insect hosts, they
migrate into the insect’s hemocoel either by means of natural openings, such as the
mouth or anus, or by penetrating the outer cuticle (Abu Hatab et al. 1995). Once inside
the larval body, the Us regurgitate their symbiotic bacteria into the hemolymph of the
insect, where they infect and kill the insect within 24-48 hours (Figure l-l; Johnigk and
Ehlers, 1999; Ciche and Ensign, 2003). While the bacteria actively divide in the insect’s
hemolymph, they produce and secrete a large variety of toxins, antibiotics, antifungal
compounds, nematicidal compounds, and enzymes, which function in the protection,
preservation, and degradation of the insect cadaver (Forst and Nealson, 1996; Richardson
et al. 1988). Within this nutritionally favorable and protective environment, the
developmentally arrested 115 exit from diapause and resume development into egg-laying

hermaphroditic adults (Johnigk and Ehlers, 1999). Eggs deposited into the highly

        

.52. 635 26: a 2
neocmbEEQ m «:55: 2 3.3% can
88.80; omqu cm 3.9% m2

scammed m2 So”. 3 TN .1

”mecca—co: :33 21.3.2

A599
388$sz m

a
N46 2 / £55.30 2

 
    

 
 

   

 

.. F xm.~.\3 WI
= . «no... .035
_ = < n. _ .n 88.5:
.. ; v .. Ee>ooom
. .mtI .<
u €5=§9=§§
em: .u $.83:
. . . .. goo»...

 

.c.>IUIU
ugls goat..— uO om
COCOUIOC_E:_O.D

.Amv “won 802: Bo: a H8 5988

5 E530 885 2: 8on 0308» an mega»: RP 63953: c.5803» 3:3 $085 a 3 5508 05 mo anon on. £53» @293
38mg :5 .Eonaohzo 08 85 ES comp—2 o: 0.8 ammo .maoufioaom 335m B¢< .3388 gas—Ewe 28 338 SE 923%

can. 3 nmsohu 3 89% 82988 can :8“: wwwo 33 Amy wozcofimmacon :38 mammflmmo 95 EB EEG was 3 98 m:— momma
3:85 cm GA 09?. E @835 33383653 m: was .mmBEQ @388 05 5me 40% “58806:: ~33 «on .83 anaaohgm
ADV 885 05 mama. 3205 .naabofios 08 85 «28.8355 .& 839:on >05 .36: 885 5 c3582... m: no; A<V

838:: :05 E EweuuSEE .m go 3.6 33.3% 258%: £8 05 5 A220 805 39392293 .m mo 20583 H T~ Bang

nutritious insect cadaver develop into males, females, or hermaphrodites (Johnigk and
Ehlers, 1999).

After several generations, in response to environmental cues that are not yet fully
understood, eggs are no longer laid but instead hatch and develop into US inside the body
of adult hermaphrodites and females — a process known as endotokia matricida (Johnigk
and Ehlers, 1999). The resulting IJs leave the insect cadaver, most transmitting symbiotic
bacteria and actively hunt for a new insect host (Figure 1-1; Boemare et al. 1997).
Symbiont transmission

Entomopathogenic nematodes, such as H. bacteriophora, are highly specific as to
which bacteria they associate with (Akhurst, 1983; Gerritsen and Smits, 1997). In fact,
when the nematodes are given a mixture of symbiotic and non-symbiotic bacteria, only
the symbiotic bacteria are transmitted to the Us (Ciche et al. 2006). In the U stage of
nematode development (Figure 1-2; Ciche et al. 2006), symbiotic bacteria are located in
the anterior intestine immediately posterior to the pharyngeal bulb (Johnigk and Ehlers,
1999), but are also distributed throughout the intestines. After recovery, during which the
nematode regurgitates all of the symbiotic bacteria, H. bacteriophora are recolonized by
P. luminescens at the most posterior end of the intestine, near the rectal gland cells, by
adherence of symbiotic bacteria (Figure 1-2; Ciche et al. unpublished data). The
symbionts actively reproduce in the posterior intestine of H. bacteriophora until about 42
hours post IJ recovery, when the biofilm-like aggregate of P. luminescens begins to
invade the rectal gland cells of the adult nematode (Figure 1-2). The bacteria continue to

divide and persist inside vacuoles within the rectal gland cells.

m=oo 9.66
.909 F0 5232: New“

mo_o:om> E wtouomn NNHH

                     

   

cocci: 2.00 0:90
comp. E. o_ n .309 E.» wen“
>t>mo

>89 8599: E
mc_Qo_o>ov 24-05
>9 new: 9m
wo_osom> NV PM“

utmuomn ho oocemzum Nruu

w=oo o>_m> .mczwofi:
.. -6006?ch

condom: 9.658. :m on“ 8 £588 .
ONrnu

I:

 

wzoo o>_m>
.mczonTfiomcfch
F0 co_mm>c_ mmrnu
Saws 0:925 on. 305585 38% 58 ESSSEE M i=8 o>=~> 35685-30?ng 2: mo coast: ~83.

.mb Lo £8 9:? Ecnmofiffiowcgam 05 8 226m 2583 05 can @093 2a EeemeSEE .& wEEaaoo 3.25? Sven E0508
2: £53, Mada Lo Savage—05“. wEEQ .mo_o=om> 55:5 :8: .8 :otomoc s $52988 $8335.: .& 22:» £30 93% 302
59392893 .E 032: 58 8503 $5. .w=oo 93% 382 05 an: 9:383 ofiTEEoE e E8 Ea 838%: 3268 3883
2F Estevan 2mg: a mo E08533 E 0:585 33.392293 E CO use c2858 2: mouse—82 geezefififi .& .60: 885
05 55:» £558? no 8522 “8?. 6:58.: 05 Boswsocfi caustic 2a «:38: .2633 03835 05 E .830: E E 3 08E.
.8205 Bob uufinué 6083350 9:26 Sextetefiea E 5.33 «£8qu 38%355 N uofinflimb .8 cosmos ..N.~ 953E

  
 

Pre-le, which develop from eggs inside the mother’s body cavity, gain access to
symbiotic bacteria when vacuoles containing P. luminescens lyse. While still in the
mother’s body, pre-IJs acquire P. luminescens by feeding on the body contents that are
mixed with bacteria. During this feeding, a single P. luminescens bacterium adheres to
and eventually invades the pharyngeal-intestinal valve cells (Figure 1-2). From there, P.
luminescens can recolonize and persist in the intestinal lumen of 118 until the next insect
host is found.
Phenotypic variation in P. luminescens

In order to adapt to changing environments, a variety of bacteria undergo phase
variation, which is usually a hi gh-frequency ON H OFF switching of phenotype
expression in most bacterial species (Henderson et al. 1999). Phase variation is a random
event and results in a mixed bacterial population of phenotypes, allowing the population
to quickly adapt to more than one environment (Henderson et al. 1999). In P.
luminescens, the switch from primary to secondary phenotyic variants occurs at low
frequency, and reversal from secondary to primary has not yet been reported (Joyce et al.
2005). Only primary phenotypic variants are transmitted to H. bacteriophora 11s and
support nematode reproduction and development (Han and Ehlers, 2001). Secondary
phenotypic variants also differ from the primary variants by repression of many other
primary phenotypes such as crystalline inclusion proteins, antibiotic production,
pigmentation, and bioluminescence (Akhurst, 1983). It is important to be able to
distinguish between the two variants when working with P. luminescens. If phenotypic
variants are not carefully selected for experiments, the resulting data can be misleading or

inconclusive.

Phase variation in bacteria in general can occur by several mechanisms by which
gene expression is regulated. One mechanism is known as slipped-strand mispairing,
which employs a series of repetitive DNA segments for translational control resulting in
the alteration of the reading frame and protein expression (Henderson et al. 1999). For
example, promoter strength of nadA in Neisseria meningitides strain MC58 is reduced by
a change in the unit repeat number upstream of the promoter region (Martin et al. 2003).
Another mechanism is the differential methylation of GATC sites by deoxyadenosine
methylase. Depending on whether or not GATC sites are methylated, genes are either
expressed or not (van der Woude et al. 1996). For example, expression of P fimbriae in
E. coli is regulated by differential methylation depending on temperature. At 37°C, P
fimbriae are expressed, but no expression takes places at temperatures below 26°C (Blyn
et al. 1990; van der Woude et al. 1996). Environmental signals can also affect the switch
frequency of phase variation. For example, low iron concentrations initiate phase
variation in N. gonorrhoeae pili during the infection process, allowing this human
pathogen to rapidly adapt to environmental conditions within a host (reviewed in van der
Woude and Baumler, 2004).

While random phase variation affects more than one phenotypic characteristic,
antigenic variation, a process related to phase variation, results in the differentiated
expression of surface organelles (Henderson et al. 1999). One of the earliest examples of
antigenic variation of flagellar biosynthesis was found in Salmonella spp. that exhibited
diphasic agglutination stages due to variation of flagellar biosynthesis (Zieg et al. 1977).
Antigenic variation of type 1 fimbriae in E. coli is accomplished by inverting the

promoter region upstream of fimA, thereby turning the operon ON or OFF (Abraham et

al. 1985). Expression of P. luminescens fimbrial gene cluster VI, which has a
recombinase homologous to F imB found in the fim operon in Escherichia coli (based on
a coliBASE search), could also be regulated by such an invertible switch. Antigenic
variation of the mad fimbriae in P. luminescens might enable a subset of the bacterial
population to express a fimbrial adhesin allowing them to colonize a specific receptor
expressed in the H. bacteriophora posterior intestine.
General role of fimbriae in transmission

Bacterial attachment to a eukaryotic host cell is the first step in the colonization
process of many bacteria (Yamashiro and lwanaga, 1996). Attachment by means of pili
or fimbriae is a common mechanism found in various Gram-negative bacteria, such as
Pseudomonas aeruginosa and E. coli, but can also be utilized by some Gram-positive
bacteria, such as Enterococcusfaecalis (Handley and Jakobs, 1981; Woods et al. 1980).
The nematode symbiont P. luminescens has eleven gene clusters predicted to encode
proteins related to known pili and fimbriae biosynthesis (Figure 1-3; Duchaud et al.
2003). Gene cluster IV consists of putative pseudogenes and is probably not filnctional
(Figure 1-3). Gene clusters 11, III, VII, and VIII encode fimbrial like proteins of unknown
function (Figure 1-3), but the presence of an usher and chaperone suggest that these
putative fimbriae are assembled via an usher-chaperone type pathway. Cluster 1 and V
encode proteins similar to mannose-resistant/Proteus-like (MR/P) fimbriae, also predicted
to be assembled by an usher-chaperone pathway (Figure 1-3). In humans, Proteus
mirabilis is a common cause of urinary tract infection, and the bacteria express MR/P
fimbriae especially during the infection process (reviewed by Zhao et al. 1997). Cluster

Vl, characterized in this study, is also likely to be assembled by an usher-chaperone

pathway. Cluster IX fimbriae are similar to Type I fimbriae, commonly found in
uropathogenic bacteria (Figure 1-3). The pili encoded by clusters X and XI are similar to
Type 4 pili that enable twitching motility in Ps. aeruginosa, a common human pathogen
(Figure 1-3).

This large number of gene clusters devoted to the biosynthesis of pili and fimbriae
is uncommon in bacteria. For example, Salmonella enterica serovar Typhimurium has
five fimbrial gene clusters, and the uropathogenic P. mirabilis produces four types of
fimbriae (Ledboer et al. 2006; Massad et al. 1996). On the other hand, E. coli 0157:H7
was recently found to have a total of 16 fimbrial gene clusters (Low et al. 2006). Perhaps
bacteria benefit from having multiple gene clusters encoding pili and fimbriae, for it
allows them to attach to different types of surfaces and tissues. For example, variation in
surface appendages in Neisseria spp. modulates tissue tropism and allows the bacteria to
adapt to different environments (reviewed in Dehio et al. 2000). Also, symbiotic
bacteria might require specialized pili to switch from being a symbiont to being a
pathogen. For example, phase variation of surface components in N. meningitides results
in a pathogenic phenotype (de Vries et al. 1996). While the exact role of fimbriae in the
establishment of symbiosis is currently not clear, fimbriae are expected to play a key role

in the establishment of symbiotic host-bacterial interactions.

  

>535

   

       

31:35.?

. r, as . 222i 2%:
52:22: Sea: 5%: 33:2 32:: 38:: fine: 33::

 

 

 

 

 

 

 

   

35:32— .:EEE 031232
EEEEEEE
2.835
Egan—.5
. :35
555...: is So Eeaafi 555.5 3:329 3““?
$.25 _ E: .535
eggs... €33 .Ea ea...” baa. Essa Eiéfi
games 523 5.55 Egg SEE .522: .355; :5... :5 gas: 5 .2335 83%:—
=2¥ao¢ E264. .55: 25%? SEE . . 3:55: 3:2
:3: _ .

.Gaoficom comes—ow. fifiofimfl was 8 :3 Eat @0822 ma? 5 8320 .25; 05 @228 Em 228:3 3:86 «o 3:00 d9
05 a 53%. can mcouocé 2:5 .808 .3 S 320:9 Soc @8983 E0330 3% Etnam azwonwfiss “£3388: ..m.-~ 95%:

10

Figure 1-3: continued

 

33. $3., $3. .ag.-..w...:_.__.. “E E3. H. ages
$5: $8.: 35%. 3.9: 35.2.; 3.3.: Egg:

 

 

 

 

 

 

as first: .53 5a % ea 1%.... .. 226
.. , . .3
2% EE. .33... a as
as? 35.2.; 3:25,

nah a... a... a... w§r§ 52...;
gas; sci Ea- 3.1 5,535

€33 ES :5 gangs 3:33

Eacgm EacEm
.: .: HI $32.5

 

 

 

 

Es mérfifkalméfrl Elisa.

 

saga. 55%.. is :5 ages: as: 5E... 5.5.; 223.5 35. Ea 225:

382.5 .233 3552.3—
3.5%

355.50 "M4 93%:

Major types ofpili and fimbriae and biosynthesis path ways

While the variety of pili and fimbriae is large and new types of adhesive
structures are discovered continuously, the best-characterized types are type 1 fimbriae, P
pili, type IV pili, and curli. Type I fimbriae function in invasion and persistence of
uropathogenic bacteria in host cells (Baorto et al. 1997; Martinez et al. 2000). These
fimbriae are distributed all over the bacterial surface and vary in length from 0.2 to 1.0
pm (Sharon, 1987). The rod of type 1 fimbriae consists of 500 to 3000 copies of the
major structural subunit, FimA, that are arranged in a right-handed helix about 6.9 nm in
diameter (Capitani, 2006). The linear tip fibrillum consists of several copies of FimG and
FimF, topped by the adhesin protein FimH (Jones et al. 1995). The chaperone FimC
binds fimbrial subunits and prevents degradation and premature folding (Jones et al.
1993). FimC delivers each subunit to the outer membrane usher F imD where it is
channeled to the bacterial surface and incorporated in the growing fimbriae (Jones et al.
1993)

Alongside Type I fimbriae, uropathogenic bacteria also express P pili. P pili are
flexible pili that can elongate when exposed to mechanical stress and spontaneously
contract when stress is absent (Jass et al. 2004; Féillman et al. 2005). This ability of P pili
enables E. coli to withstand the rinsing action of urine in the urinary tract and allows
them to colonize epithelial host cells (Fallman et al. 2005). P pili are assembled on the
bacterial surface into right-handed helices of repeated PapA subunits with a tip consisting
of mostly PapE subunits (reviewed in Soto and Hultgren, 1999). Assembly of P pili is
achieved via the general secretory pathway. During this process, pilin subunits are

secreted across the inner cell membrane, where they bind to a chaperone and are taken to

12

the usher (Hultgren et al. 1991). The resulting pilin fiber consists of ~103 PapA subunits
organized into a right—handed helix (reviewed in Fallman et al. 2005). The tip fibrillum
consists of subunits PapK, PapE, and PapF, topped with the adhesion subunit PapG
(Hultgren et al. 1991). Both type I fimbriae and P pili act as virulence factors and are
commonly found in uropathogenic E. coli and other members of the Enterobacteriaceae
family (Kallenius et al. 1981; Krogfelt et al. 1990).

Type IV pili are utilized by a number of human pathogens, such as Pseudomonas
aeruginosa, and are involved in activities such as eukaryotic cell colonization and phage
adsorption, but their most notable function is in twitching motility (Smyth et al. 1996).
When pathogens lose Type IV pili or their ability to move by twitching motility they
become avirulent (reviewed in Mattick et al. 1996). Type IV pili are located at the pole
of bacterial cells, consist of a single repeated pilin subunit PilA arranged in a helical
conformation, and vary in length from ~1 .0-4.0 um (Mattick et al. 1996). They are
assembled via the general secretion pathway (Soto and Hultgren, 1999). The prepilin
peptidase PilD cleaves a short leader peptide from the subunits (Alm and Mattick, 1997).
The inner membrane protein PilC binds the cleaved pilin subunit and serves as a platform
for assembly (Alm and Mattick, 1997). PilB, a nucleotide-binding protein, facilitates
secretion of the pilus through the outer membrane channel PilQ (Alm and Mattick, 1997).
While all Type IV pili have similar quatemary and tertiary structure, they exhibit some
primary and secondary structural differences depending on species and strains (Mattick,
2002)

Curli, a class of thin and irregular pili, are found on the surface ofa variety of

clinical isolates of human pathogens, such as E. coli and Salmonella enteritidis, that

13

allow them to bind to a large variety of host proteins (reviewed in Soto and Hultgren,
1999). Curli pili are assembled by the extracellular nucleation-precipitation pathway
(Soto and Hultgren, 1999). Individual subunits of ngA are secreted into the
extracellular environment where they are nucleated by ngB to form a fiber (reviewed in
Bamhart and Chapman, 2006). Accessory proteins ngE, ngF, and ngG function
during secretion of ngA and assembly of the curli fiber, but their exact roles are not yet
known (Bamhart and Chapman, 2006). Regulation of curli expression is dependenton a
variety of environmental cues and is under the control of the transcriptional regulator
ngD (Hammar et al. 1995). Curli can bind to many different host proteins and are
proposed to play a key role in invasion of host cells (Bian et al. 2000).

Photorhabdus luminescens mad genes are homologous to fim genes in E. coli, and
the mad gene cluster contains genes predicted to encode an usher and three chaperones.
The presence of the usher and the chaperones lead to the conclusion that mad fimbriae
are likely to be assembled by an usher-chaperone pathway. A hypothetical biosynthesis
pathway for fimbriae encoded by P. luminescens gene cluster V1 is given in Figure 1-4.
Pre-fimbrial Mad protein is secreted into the cytoplasm, where it binds to its chaperone
(Figure 1-4). The chaperone prevents protein degradation and promotes proper folding of
pre-fimbrial proteins into mad subunits (Figure 1-4). The chaperone transports mad
subunits to the outer membrane usher, which channels it to the outside of the bacteria
where the subunits assemble into mad fimbriae (Figure 1-4).

While pili and frmbriae continue to be the most common form of bacterial

adhesins, several nonfimbrial adhesins, such as filamentous hemagglutinin, mannose-

14

resistant hemagglutinin, and invasion proteins have been discovered (reviewed in Finlay
and Falkow, 1989).

Figure 1-4: Putative biosynthesis pathway of mad fimbriae via the usher-chaperone
pathway. Individual subunit proteins are secreted into the periplasm, where they bind to a
chaperone. The chaperone prevents degradation, promotes proper folding, and transports
the subunit to the outer membrane usher. The fimbrial subunits migrate through the usher
to the bacterial surface, where they assemble into the final structure.

     

Outer membrane

 

Cytoplasmic membrane

 

Once bacteria are attached to a host cell surface, they can persist, ofien as a
biofilm, and sometimes invade the host cells. The term biofilm can be broadly applied to
_ any community of microorganisms that can attach to a range of biotic and abiotic
surfaces (O’Toole et al. 2000). Within the biofilm, bacteria are often encased by an

extracellular matrix, often consisting of polysaccharides and proteins, and assemble into

highly complex structures (O’Toole et al. 2000). Induced by surface attachment, bacteria
undergo changes in gene expression, such as down regulation of flagella synthesis,
increased exopolysaccharide synthesis, and antibiotic resistance (reviewed by O’Toole et
al. 2000). In the nematode intestine, in addition to many other benefits, the biofilm
protects P. luminescens from the shear forces that occur during frequent defecation.
Invasion can take place by many mechanisms. For example, some bacteria actively alter
the plasma membrane of the host cell by either contacting cell surface receptors or by
injecting a protein into the host cell, both of which trigger engulfrnent of bacteria by the
host cell (Pizarro-Cerda and Cossart, 2006). However, bacteria in a biofilm do not always
invade host cells.
Nematode-bacteria symbiosis as a model system

Some of the same processes that take place during colonization of a nematode
host by its symbiotic bacteria are the same, processes used by pathogens during infectious
disease (Hentschel et al. 2000; Bennett and Clarke, 2005). Neisseria meningitides and N.
gonorrhoeae cause infection in their human host by a cascade of events, such as
adhesion, invasion, and signaling (Plant and Johnsson, 2003). In the same manner, P.
luminescens adheres to rectal gland cells in H. bacteriophora and forms a biofilm that
ultimately invades the rectal gland cells. Uropathogenic E. coli cause urinary tract
infections in humans using Type I pili to attach to and invade epithelial cells in the
urinary tract, where they establish a reservoir of E. coli cells that can cause recurrent
infections in the human host (Mulvey et al. 1998). In a similar manner, P. luminescens
persist in vacuoles within invaded rectal gland cells (Figure 1-2).

Pseudomonas aeruginosa, an opportunistic human pathogen, attaches to the

16

surface of mucosa-l host cells using Type IV pili and is involved in infections most
frequently associated with burn victims, cancer patients, cystic fibrosis, and other
immune-compromised individuals (Bodey et al. 1983; Pier, 1985; Irvin, 1993;
Paranchych et al. 1986; Lee et al. 1989). Burkholderia cenocepacia uses cable pili to
attach to the lung epithelial cells of cystic fibrosis patients (Clode et al. 2000; Sun et al.
1995). Based on these similarities to human pathogens, the nematode-bacteria-insect
system could serve as a model system for the role of fimbriae in the pathogenicity of
human pathogens.

This model system has other advantages as well. The entire genome of P.
luminescens TT01 has been completely sequenced and is publicly available, simplifying
molecular and genetic work tremendously. Also, H. bacteriophora is transparent and
allows for detection of even single GFP-Iabeled P. luminescens throughout the entire
body of the nematode. In the lab, H. bacteriophora and P. luminescens can be cultured
separately, and H. bacteriophora is an excellent model organism for it has a short

development time and is easily maintained.

17

LITERATURE CITED

Abraham, J .M., C.S. Freitag, J.R. Clements, and BI. Eisenstein. 1985. An Invertible
Element of DNA Controls Phase Variation of Type 1 F imbriae of Escherichia coli.
Proceedings of the National Academy of Science USA 82:5724-5727.

Abu Hatab, M., S. Selvan, and R. Gaugler. 1995. Role of Proteases in the Penetration of
Insect Gut by the Entomopathogenic Nematode, Steinemema glaseri (Nematoda:
Steinemematidiae). Journal of Invertebrate Pathology 66: 125-1 30.

Akhurst, RI. 1983. Neoplectana Species: Specificity of the Association With Bacteria of
the Genus Xenorhabdus. Experimental Parasitology 55:258-263.

Alm, RA. and J .S. Mattick. 1997. Genes Involved in the Biogensis and Function of
Type-4 Fimbriae in Pseudomonas aeruginosa. Gene 192289-98.

Baorto, D.M., Z. Gao, R. Malaviya, M.L. Dustin, A. van der Merwe, D.M. Lublin, S.N.
Abraham. 1997. Survival of F imH-expressing Enterobacteria in Macrophages Relies
on Glycolipid Traffic. Nature 389:636-639.

Bamhart, M.M., and MR. Chapman. 2006. Curli Biogenesis and Function. Annual
Review of Microbiology 60:131-147.

Bennett, H.P.J., and DJ. Clarke. 2005. The pbgPE operon in Photorhabdus luminescens
Is Required for Pathogenicity and Symbiosis. Journal of Bacteriology 187277-84.

Bian, Z., A. Brauner, Y. Li, and S. Normark. 2000. Expression of and Cytokine
Activation by Escherichia coli Curli Fibers in Human Sepsis. Journal of Infectious
Diseases 181:602-612.

Blyn, L.B., B.A. Braaten, and DA. Low. 1990. Regulation of Pap Pilin Phase Variation
By a Mechanism Involving Differential Dam Methylation States. EMBO Journal
9:4045-4054.

Bodey, G.P., R. Bolivar, V. Fainstein, and L. Jadeja. 1983. Infections Caused by
Pseudomonas aeruginosa. Reviews of Infectious Diseases 5:279-313.

Boemare, N., A. Guivaudan, M. Brehelin, and C. Laumond. I997. Symbiosis and
Pathogenicity of Nematode-bacterium Complexes. Symbiosis 22:21-45.

Capitani, G., O. Eidam, R. Glockshuber, M.G. Griitter. 2006. Structural and Functional
Insights Into the Assembly of Type 1 Pili from Escherichia coli. Microbes and
Infection 8:2284-2290.

Ciche, T.A., S.B. Bintrim, A.R. Horswill, and J .C. Ensign. 2001. A Phosphantetheinyl
Transferase Homolog Is Essential for Photorhabdus luminescens To Support Growth

18

and Reproduction of the Entomopathogenic Nematode Heterorhabditis bacteriophora.
Journal of Bacteriology 1 83:31 17-3 126.

Ciche, T.A., and J .C. Ensign. 2003. For the Insect Pathogen Photorhabdus luminescens,
Which End of a Nematode Is Out? Applied and Environmental Microbiology
69: 1 890-1 897.

Ciche, T.A., C. Darby, R. Ehlers, S. Forst, and H. Goodrich-Blair. 2006. Dangerous
Liaisons: The Symbiosis of Entomopathogenic Nematodes and Bacteria. Biological
Control 38:22-46.

Clode, F.E., M.E. Kaufmann, H. Malnick, and TL. Pitt. 2000. Distribution of Genes
Encoding Putative Transmissibility Factors Among Epidemic and Nonepidemic
Strains of Burkholderia cepacia from Cystic Fibrosis Patients in the United Kingdom.
Journal of Clinical Microbiology 38: 1 763-1 766.

Dehio, 0, SD. Gray-Owen, and TE Meyer. 2000. Host Cell Invasion by Pathogenic
Neisseriae. Subcell Biochemistry 33 :61 -96.

deVries, F.P., A. van der Ende, J .P.M. vanPutten, and J. Dankert. 1997 Invasion of
Primary Nasopharyngeal Epithelial Cells by Neisseria meningitidis Is Controlled
by Phase Variation of Multiple Surface Antigens. Infection and Immunity 64:2998-
3006.

Duchaud, E. C. Rusniok, L. Frangeul, C. Buchrieser, A. Givaudan, S. Taourit, S. Bocs, C.
Boursaux-Eude, M. Chandler, J. Charles, E. Dassa, R. Derose, S. Derzelle, G.
Freyssinet, S. Gaudriault, C. Médigue, A. Lanois, K. Powell, P. Siguier, R. Vincent,
V. Wingate, M. Zouine, P. Glaser, N. Boemare, A. Danchine, and F. Kunst. 2003. The
Genome Sequence of the Entomopathogenic Bacterium Photorhabdus luminescens.
Nature Biotechnology 21 :1307-13 13.

Féillman, E., S. Schedin, J. Jass, B-E. Uhlin, and O. Axner. 2005. The Unfolding of the P
Pili Quaternary Structure by Stretching is Reversible, Not Plastic. EMBO Reports
6:52-56.

Finlay, BB, and S. Falkow. 1989. Common Themes in Microbial Pathogenicity.
Microbiological Reviews 53:210-230.

Forst, S. and K. Nealson. 1996. Molecular Biology of the Symbiotic-pathogenic Bacteria
Xenorhabdus spp. and Photorhabdus spp. Microbiology Review 60:21-43.

Gerritsen, L.J.M., and PH. Smits. 1997. The Influence of Photorhabdus luminescens
Strains and Form Variants on the Reproduction and Bacteria] Retention of
Heterorhabditis megidis. Fundamental and Applied Nematology 20:317-322.

Hammar, M., A. Amqvist, Z. Bian, A. Olsen, and S. Normark. 1995. Expression of Two

19

csg Operons is Required for Production of Fibronectin- and Congo Red-binding Curli
Polymers in Escherichia coli K-12. Molecular Microbiology 18:661-670.

Han, RC. and R.-U. Ehlers. 2000. Pathogenicity, Development, and Reproduction of
Heterorhabditis and Steinemema carpocapsae Under Axenic in vivo Conditions.
Journal of Invertebrate Pathology 75:55-58.

Han, R. and R.—U. Ehlers. 2001. Effect of Photorhabdus luminescens Phase Variants on
the in vivo and in vitro Development and Reproduction of the Entomopathogenic
Nematodes Heterothabditis bacteriophora and Steinemema carpocapsae. FEMS

Microbiology Ecology 35:239-247.

Handley, RS. and A.E. Jakobs. 1981. Some Structural and Physiological Properties of
Fimbria of Streptococcus faecalis. Journal of General Microbiology 127:289-293.

Hatab, M.A., R.J. Stuart, and R. Gaugler. 1998. Antibiotic Resistance and Protease
Production by Photorhabdus luminescens and X enorhabdus poinarii Bacteria
Symbiotic With Entomopathogenic Nematodes: Variation Among Species and
Strains. Soil Biology and Biochemistry 30: 1955-1961.

Henderson, I.R., P. Owen, and J .P. Nataro. 1999. Molecular Switches — The ON and OFF
of Bacterial Phase Variation. Molecular Microbiology 33:919-932.

Hentschel, U., M. Steinert, and J. Hacker. 2000. Common Molecular Mechanisms of
Symbiosis and Pathogenesis. Trends in Microbiology 81226-23 1.

Hultgren, S.J. S. Normark, and SN. Abraham. 1991. Chaperone-Assisted Assembly and
Molecular Architecture of Adhesive Pili. Annual Review of Microbiology 45:383-415.

Irvin, R.T. 1993 in Pseudomonas aeruginosa as an Opportunistic Pathogen (Campa, M.,
M. Bendinelli, and H. Friedman, eds) pp. 19-42. Plenum Publishing Corp., New York.

Jass, J ., S. Schedin, E. Fallman, J. Ohlsson, U. Nilsson, B.E. Uhlin, and O. Axner. 2004.
Physical Properties of Escherichia coli P Pili Measured by Optical Tweezers.
Biophysical Journal 87:4271-4283.

Johnigk, S. and R. Ehlers. 1999. Juvenile Development and Life Cycle of
Heterorhabditis bacteriophora and H. indica (Nematoda: Heterorhabditidae).
Nematology 1:251-260.

Jones, C.H., J .S. Pinkner, A.V. Nicholes, L.N. Slonim. S.N. Abraham, and SJ. Hultgren.
1993. FimC is a Periplasmic PapD-like Chaperone That Directs Assembly of Type 1
Pili in Bacteria. Proceedings of the National Academy of Science USA 90:8397-8401 .

Jones, C.H., J .S. Pinkner, R. Roth, J. Heuser, A.V. Nicholes, S.N. Abraham, and SJ.
Hultgren. 1995. FimH adhesin of Type 1 Pili is Assembled Into a Fibrillar Tip

20

Structure in the Enterobacteriaceae. Proceedings of the National Academy of Science
USA 92:2081-2085.

Joyce, S.A., R.J. Watson, and DJ. Clarke. 2005. The Regulation of Pathogenicity and
Mutualism in Photorhabdus. Current Opinion in Microbiology 9:1-6.

Kallenius, G., S.B. Svenson, H. Hultberg, R. Molby, I. Helin, B. Cedergen, and J.
Windberg. 1981. Occurrence of P fimbriated Escherichia coli in Urinary Tract
Infection. Lancet ii: 1 369-1 372.

Khan, A. and W.M. Brooks. 1976. A Chromogenic Bioluminescent Bacterium
Associated With the Entomophilic Nematode Chromonema heliothidis. Journal of
Invertebrate Pathology 29:253-261.

Krogfelt, K.A., H. Bergmans, and P. Klemm. 1990. Direct Evidence that the FimH
Protein is the Mannose Specific Adhesion of Escherichia coli Type 1 Fimbriae.
Infection and Immunity 58: 1995-1999.

Ledeboer, N.A., J .G. Frye, M. McClelland, and ED. Jones. 2006. Salmonella enterica
Serovar Typhimurium Requires the Lpf, Pef, and Tafi fimbirae for Biofilm Formation
on HEp-2 Tissue Culture Cells and Chicken Intestinal Epithelium. Infection and
Immunology 74:3156—3169.

Lee, K.K., P. Doig, R.T. Irvin, W. Paranchych, and RS. Hodges. 1989. Mapping the
Surface Regions of Pseudomonas aeruginosa PAK Pilin: the Importance of the C-
terminal Region for Adherence to Human Buccal Epithelial Cells. Molecular
Microbiology 3:1493-1499. '

Low, A.S., N. Holden, T. Rosser, A.J. Roe, C. Constantinidou, J .L. Hobman, D.G. Smith,
J .C. Low, and D.L. Gally. 2006. Analysis of Fimbria] Gene Clusters and Their
Expression in Enterohaemorrhagic Escherichia coli OlS7:H7. Environmental
Microbiology 8:1033-1047.

Martin, P., T. van de Ven, N. Mouchel, A. C. Jeffi‘ies, D. W. Hood, and E. R. Moxon.
2003. Experimentally Revised Repertoire of Putative Ccontingency Loci in Neisseria
meningitidis Strain MC58: Evidence for a Novel Mechanism of Phase Variation.
Molecular Microbiology 50:245—257.

Martinez, J .J ., M.A. Mulvey, J .D. Schilling, J .S. Pinkner, and SJ. Hultgren. 2000. Type 1
Pilus-mediated Bacterial Invasion of Bladder Epithelial Cells. EMBO Journal
19:2803-2812.

Massad, G., J .K. Fulkerson, D.C. Watson, and H.L. Mobley. 1996. Proteus mirabilis

21

Ambient-temperature Fimbriae: Cloning and Nucleotide Sequence‘of the aft Gene
Cluster. Infection and Immunology 64:4390-4395.

Mattick, J .S., C.B. Whitchurch, and R.A. Alm. 1996. The Molecular Genetics of Type-4
Fimbriae in Pseudomonas aeruginosa — A Review. Gene 179:147-155.

Mattick, J .S. 2002. Type IV Pili and Twitching Motility. Annual Review of Microbiology
56:289-314.

Mulvey, M.A., Y.S. Lopez-Boado, C.L. Wilson, R. Roth, W.C. Parks, J. Heuser, and SJ.
Hultgren. 1998. Induction and Evasion of Host Defenses by Type 1-piliated
Uropathogenic Escherichia coli. Science 282: 1 494-1497.

O’Toole, G., H.B. Kaplan, and R. Kolter. 2000. Biofilm Formation as Microbial
Development. Annual Review of Microbiology 54:49-79.

Paranchych, W., P.A. Sastry, K. Volpel, B.A. Loh, and DP. Speert. 1986. F imbriae
(Pili): Molecular Basis of Pseudomonas aeruginosa Adherence. Clinical Investigative
Medicine 9:113-118.

Pier, GB. 1985. Pulmonary Disease Associated with Pseudomonas aeruginosa in Cystic
Fibrosis: Current Status of a Host—bacterium Interaction. Journal of Infectious
Diseases 151:575-580.

Pizarro-Cerda, J. and P. Cossart. 2006. Bacterial Adhesion and Entry into Host Cells.
Cell 124:715-727.

Plant, L. and A. Johnsson. 2003. Contacting the Host: Insights and Implications of
Pathogenic Neisseria Cell Interactions. Scandinavian Journal of Infectious Diseases
35:608-613.

Poinar, G.O., Jr. 1975. Description and Biology of a New Insect Parasitic Rhabditoid
Heterorhabditis bacteriophora. Nematologica 21 :463-470.

Richardson, W.H., T.M. Schmidt, and KB. Nealson. 1988. Identification of an
Anthraquinone Pigment and a Hydroxystilbene Antibiotic from Xenorhabdus
luminescens. Applied and Environmental Microbiology 54:1602-1607.

Sharon, N. 1987. Bacterial Lectins, Cell-cell Recognition and Infectious Disease. FEBS
Letters 217:145-157.

Smyth, C.J., M.B. Marron, J.M.G.J. Twohig, and S.G.J. Smith. 1996. Fimbria]

Adhesions: Similarities and Variations in Structure and Biogenesis. FEMS
Immunology and Medical Microbiology 16:127-139.

22

Soto, GE. and SJ. Hultgren. 1999. Bacterial Adhesins: Common Themes and Variations
in Architecture and Assembly. Journal of Bacteriology 181:1059-1071.

Sun, L. R. Jiang, S. Steinbach, A. Holmes, C. Campanelli, J. Forstner, U. Sajjan, Y. Tan,
M. Riley, and R. Goldstein. 1995. The Emergence of a Highly Transmissible Lineage
of cbl+ Pseudomonas (Burkholderia) cepacia Causing CF Centre Epidemics in North
America and Britain. Nature Medicine 1:661-666.

van der Woude, M., B. Braaten, and D. Low. 1996. Epigenetic Phase Variation of
Escherichia coli pap Transcription: H-NS is a Temperature-dependent DNA
Methylation Blocking Factor. Molecular Microbiology 28:1 121-1137.

van der Woude, M., and A.J. Baumler. 2004. Phase and Antigenic Variation in Bacteria.
Clinical Microbiology Reviews 17:581-61 1 .

Woods, DE, DC. Straus, W.G. Johanson, Jr., V.K. Berry, and J.A. Bass. 1980. Role of
Pili in Adherence of Pseudomonas aeruginosa to Mammalian Buccal Epithelial Cells.
Infection and Immunity 29:] 146-1 151.

Yamashiro, T. and M. Iwanaga. 1996. Purification and Characterization of a Pilus of a
Vibrio cholerae Strain: A Possible Colonization Factor. Infection and Immunity
64:5233-5238.

Zhao, H., X. Li, DE. Johnson, I. Blomfield, H.L.T. Mobley. 1997. In vivo Phase
Variation of MR/P Fimbria] Gene Expression in Proteus mirabilis Infecting the

Urinary Tract. Molecular Microbiology 23:1009—1019.

Zieg, J ., M. Silverman, M. Hilmen, and M. Simon. 1977. Recombinational switch for
gene expression. Science 196: 1 70-1 72.

23

CHAPTER 2: PHOTORHABDUS LUMINESCENS PUTATIVE MAD FIMBRIAE ARE
REQUIRED FOR ADHERENCE AND TRANSMISSION 1N HE T ERORHABDIT IS
BA CT ERIOPHORA

This chapter is formatted to be published in the Journal of Bacteriology. This
study reported for the first time that a putative type of fimbriae, mad fimbn'ae, 'is required
for host colonization and symbiont transmission. Photorhabdus luminescens mutants
with a defect in mad genes cannot adhere to the posterior maternal intestine and
consequentially are not transmitted to infective juveniles that develop inside the maternal
body cavity. This inability to adhere in H. bacteriophora ultimately hinders symbiont
transmission. When a P. luminescens mutant was complemented with mad genes,
adherence to the maternal intestine was partially restored. In addition, this study is the
first to report the involvement of an inverted repeat switch in the regulation of the mad
gene cluster during phase variation. The presence of this switch was made obvious by the
presence of a recombinase included in the mad gene cluster. In primary P. luminescens
phenotypic variants, the inverted repeat was in the ON position and OFF in secondary

phenotypic variants.

24

Title. Photorhabdus luminescens putative mad fimbriae are required for adherence and

transmission in Heterorhabditis bacteriophora

BETTINA M. KAUFMANN-DASZCZUK', KWI S. KIM], AND TODD A. CICHE1*

1Department of Microbiology and Molecular Genetics, Michigan State University, East
Lansing, MI 48824

*Corresponding author: Department of Microbiology and Molecular Genetics, Michigan
State University, East Lansing, M148824, Phone: (517) 355-6463 x1569, Fax: (517) 353-

8957, E-mail: ciche@msu.edu.

25

ABSTRACT

The nematode Heterorhabditis bacteriophora lives in a symbiotic relationship
with the entomopathogenic bacterium Photorhabdus luminescens. In this obligate
mutualism, P. luminescens colonizes and persists in the intestine of H. bacteriophora
infective juveniles by transmission of bacterial symbionts from mother to offspring. In
order to identify symbiont genes required for transmission, ~8000 transposon mutants
(labeled with GFP) were screened for a decreased efficiency in transmission to H.
bacteriophora infective juveniles (IJs). Thirty gagsmission mutants (TRN) were
obtained defective in transmission to 1.15. Twelve of the TRN mutants contained
transposon insertions in one of ten putative fimbrial gene clusters, VI, comprised of genes
madR through mad] (maternal adhesion deficient) and predicted to encode an usher-
chaperone assembled fimbriae. All but two of these twelve mutants were totally
defective in transmission and were unable to adhere to the maternal intestine to initiate
transmission. One of the TRN fimbrial mutants, TRN26-25 (mad! defective), was able to
adhere to the maternal intestine again when it was complemented with wild-type mad
genes. An inverted repeat promoter switch located upstream of madA was determined to
be ON in P. luminescens primary phenotypic variants and OFF in secondary phenotypic
variants. RT-PCR of P. luminescens primary phenotypic variants revealed expression of
mad genes in wild-type and TRN26-25 bacteria. Despite having a mutation in one of the
fimbrial gene clusters, the mad mutants were able to hemaglutinate blood cells and form
a biofilm on an abiotic surface (data not shown), indicating that mad fimbriae are not
essential to these functions. Expression of mad fimbriae was detected in Grace’s Insect

media, and fimbriae were observed by transmission electron microscopy, but no apparent

26

differences between wild-type and mutant fimbriae were seen. In summary, we have

identified the essential role of the putative mad fimbriae for symbiont transmission,

specifically adherence to the maternal intestine of H. bacteriophora.
INTRODUCTION

The Gram-negative bacterium Photorhabdus luminescens, of the family
Enterobacteriaceae, is symbiotically associated with the nematode Heterorhabditis
bacteriophora (7). In this mutualistic relationship, the nematodes require the bacteria for
growth, reproduction, and insect killing, while the bacteria require the nematode host as a
vector for transmission to an insect prey (5, 1 1). Together, P. luminescens and H.
bacteriophora are able to infect and kill a large variety of insect larvae (18, 22). In soil,
[-1. bacteriophora persists as the developmentally arrested infective juvenile stage, which
transmits P. luminescens cells in its intestine to insect hosts (14). Upon encountering
insect prey, H. bacteriophora infective juveniles (IJs) migrate into the insect’s hemocoel
(blood cavity) either by means of natural openings, such as the mouth or anus, or by
penetrating the outer cuticle (2).

Within the insect hemocoel, IJs regurgitate their symbiotic bacteria into the
hemolymph, thereby infecting and killing the insect within 24-48 hours (6, 16). Within
the insect’s hemolymph, P. luminescens produce and secrete a large variety of toxins,
antibiotics, antifungal compounds, nematicidal compounds, and enzymes, which function
in the protection, preservation, and degradation of the insect cadaver (9, 23).
Developmentally arrested IJs exit diapause and resume development within this
nutritionally favorable environment and become egg-laying hermaphroditic adults (16).

Eggs deposited into the insect cadaver develop into males, females, or hermaphrodites

27

(7). After several generations, eggs are no longer laid into the environment but instead
hatch and develop into US inside the body of adult hermaphrodites and females - a
process known as endotokia matricida (7). While developing within the maternal body
cavity, pre-IJ ’s are recolonized by a single P. luminescens bacterium while feeding on the
mother’s body contents and leave the insect cadaver to actively hunt for another insect
host (4). While they can feed on some other bacterial species, H. bacteriophora are
highly specific as to the species of bacteria with which they associate (3, 10). In fact,
when the nematodes are given a mixture of symbiotic and non-symbiotic bacteria, only
the symbiotic bacteria will be transmitted to Us (7).

In order to adapt to changing environments, some bacteria may undergo phase
variation, which is a hi gh-frequency ON H OFF switching of phenotype expression (15).
In P. luminescens, the switch from primary to secondary phenotypic variants occurs at
much lower frequency and does not appear to be reversible (17). Only primary
phenotypic symbionts are able to colonize H. bacteriophora and support nematode
reproduction and development (12). Secondary phenotypic P. luminescens variants also
lose some of the other important characteristics, such as inclusion bodies, antibiotic
production, pigmentation, and bioluminescence, which are normally found in primary
bacteria (12). While phase variation affects a large number of phenotypic characteristics,
antigenic variation targets expression of surface organelles. For example, expression of
fimA (which encodes the major structural subunit of pili in Escherichia coli) is regulated
by inverting a region containing the promoter (1). Photorhabdus luminescens putative
fimbrial gene cluster VI, which has a recombinase homologous to that found in the fim

operon in E. coli, could also be regulated by such an invertible switch.

28

Bacterial attachment to a eukaryotic host cell is often the initial step in the
colonization process of many bacteria (26). Attachment by means of pili or fimbriae is a
common mechanism found in many species of Gram-negative and some Gram-positive
bacteria (13, 25). The nematode symbiont P. luminescens has eleven gene clusters that
are predicted to encode a variety of proteins related to known pili and fimbriae (8). This
rather large number of gene clusters devoted to the biosynthesis of pili and fimbriae is
uncommon in bacteria. Perhaps, symbiotic bacteria require specialized pili that allow
them to adhere to their proper host in addition to common major types of fimbriae and
pili.

In this study, we describe the identification of a P. luminescens putative fimbrial .
locus, mad (maternal adhesion deficient), specifically required for adherence to the
maternal posterior epithelium in H. bacteriophora, the first step in symbiont
transmission.

MATERIALS AND METHODS

Note: Images in this thesis are presented in color.
Bacterial strains and culture methods

Photorhabdus luminescens and P. temperata were cultured in liquid PP3S
media (2% Proteose Peptone #3 [Difco, Sparks, MD] containing 0.5% NaCl , and
Grace’s Insect Media (Invitrogen, Carlsbad, CA). Agar (1.5%), gentamicin (0.75
ug/mL), streptomycin (40 ug/mL), zeocin (50 ug/mL) and kanamycin (3.75 ug/mL) were
added when required. E. coli strains were grown in Lysogenic Broth (LB) containing
5g/L NaCl. Agar (1.5%), gentamicin (Gm, 5 ug/mL), ampicillin (Amp,50 ug/mL),

zeocin (Zeo, 50 ug/mL), and diaminopimelic acid (DAP, 300 ug/mL) were added when

29

 

comoEZ:
comp—~35
EaEBoZ .Qmofl .Qv

$832835 mxezmoam
@852 .93: .9
can»: .2:

356V
228
3m¢~UUH<
25

mo: otQmEoZ

.ooN .889» wane—o AX Ono...

.ooN .882, misc—o AN 055,—.
80385-81:

:8 .m Ecuafioooboofi
Egan—Ema?
£05825 new

nEGAUZ EEomES .&
3:8on commmgmafih
&O& E. 53, “co—onw—
Aommsm gar—3 25-23,

95%... 55 8.22

383 >383: 099-25,

:Easa

wfiaza
25%
£83:

STE 8on azémseh
295a $9.325 :8 .m
5.83m :8 assafifi

£73;

EOAUZ automate» .m

#0 Z Saxomfifi ”5331893
awn—0-5.3.

5320235 dmnsm 388553 .R
5: 538533 dmnsm

9.238355 méfiofoagm

3.333—

2 m2 0:: BEE . at

 

@595on 98 265V 32:: 2 com no~2€££o$ 3.55 Eo:mo.:8o3 afihgcfogfimt
8635—82
ooh—8m osmtoaoauagu ESQ—m .8 £25

 

.353 £5 5 wow: mEEmmE can £53m ..~.N flack

30

required. Freezer stocks were prepared by combining 5% DMSO with bacterial culture
in PP3S and stored at -80 °C.
Axenic nematode stock

Nematodes of the inbred H. bacteriophora strain M31e were grown on lawns of
the GFP-labeled t_ransmission mutant (TRN) 16, totally defective in transmission, on
NA-comoil (8 g of Nutrient broth, 15 g of agar, 12 mL of comoil [Mazola] per liter) split
plates for about 14 days. Then, Ringer’s solution (100 mM NaCl, 1.8 mM KCl, 2 mM
CaClz, 1 mM MgC12, and 5 mM HEPES pH 6.9) was added to the empty half of the plate
to collect the emerging US, which were harvested by centrifugation (1,200 rpm for 1
min.). The US were surface sterilized in 1% bleach (6.15% NaOCl) for 5 min., washed
three times with Ringer’s, and then stored in 10 mL of Ringer’s solution in tissue culture
bottles. Axenic stocks were tested for sterility by removing and disrupting a 45 uL
sample using a motorized tissue grinder (Kontes Glass Co., Vineland, NJ). The ground
sample was plated on PP3S and incubated at 28°C for 2 days to verify that the nematode
stock was sterile. Antibiotics were added at the following concentrations: 100 ug/mL
streptomycin, 100 ug/mL ampicilin, 30 ug/mL kanamycin, and 10 ug/mL gentamicin.
The nematode stocks were also inspected under a fluorescent MZl 6F stereomicroscope
(Leica Microsystems, Wetzlar, Germany) to verify that no fluorescent bacteria were
present in the intestines of the nematodes.
Adherence assay

Liquid cultures of P. temperata TRN16 (labeled with GF P) were spread on NA-
cholesterol (recipe for NA as described above plus 10 mg/mL cholesterol) plates and

incubated at 28°C for 48 hours. Axenic M31 e nematodes were added to the TRN16

31

plates, incubated at 28°C, and after 16 hours transferred to plates containing P.
luminescens TT01 Tn7GFP or mutant bacteria (labeled with GF P) for further incubation
for 24 hours. Finally, the nematodes were transferred to plates with unlabeled TT01 and
incubated for 4 hours to allow the nematodes to clear transient symbionts from their
intestine before assaying for the presence of adherent P. luminescens using a fluorescent
compound microscope (Leica DM5000).
T ransposon mutagenesis and mutant screening

Photorhabus luminescens strain TT01 Tn7GF P, P. temperata strain NCl
Tn7GFP, and E. coli strain BW29427 donor cells containing pURE10 were grown
overnight. 1/ 100 of the volume from each culture was transferred to fresh media and
grown to an OD600 of 0.6. Cells were harvested by centrifugation, Washed three times,
and resuspended in 500 u] LB DAP. The recipient and donor suspensions were
combined, centrifuged again, resuspended in 50 ul LB DAP, and plated on LB DAP.
After incubation for 8 hours, the cells were washed off the plates with LB, centrifuged,
washed two times, and resuspended in 1.5 mL of LB. 100 pl of cells were plated on LB
Gm and incubated. Isolated colonies were picked from conjugation plates with sterile
toothpicks, transferred to PP3S Gm, and incubated at 28°C for 48 hours. Each colony
was subcultured in disposable 5 mL Falcon tubes (12x75 mm polystyrene) containing
250 uL of PP3S Gm. After incubation at 28°C for 48 hours, 50 uL of each liquid culture
was spread to a lawn on to a NA-comoil Gm plate. After incubation at 28°C for another
48 hours, 10 uL of nematode stock (M3 1e TRN16), washed three times with sterile
0.85% saline solution, was placed on each plate and incubated at 28°C for 10-12 days or

until IJs migrated and became trapped in the condensation droplets present lids. US were

32

checked for colonization (GFP present or absent) under the fluorescent stereo
microscope. Potential mutants were plated on PP3S plates.
Verification of mutant phenotype

Liquid cultures for each potential mutant were prepared and spread on NA-
cholesterol plates. 10 uL of nematode stock (M31e TRN 16), washed three times with
sterile 0.85% saline solution, was added to each plate and incubated at 28°C for 10-12
days or until IJs appeared in the condensation on the lid. On average, ~5000 113 were
checked for colonization (GFP present or absent) for each potential mutant using the
fluorescent stereo microscope and the percentage of transmission efficiency (%
colonized/total) determined.
T ransposon retrieval and sequencing

The Himaer transposon contains an R6K‘y origin of replication allowing direct
retrieval of the transposon along with flanking DNA in strains expressing the pi protein.
To retrieve the Himaer, genomic DNA was purified using the DNeasy Tissue Kit
(Qiagen, Valencia, CA) from verified mutant strains grown in 3 mL of Grace’s Insect
Media incubated at 28°C overnight. Five to 20 ug of genomic DNA was digested with
SphI restriction enzyme (New England Biolabs, Ipswitch, MA) to release the region of
the genomic DNA containing the transposon plus DNA flanking the insertion. Linear
digested DNA fragments were ligated with T4 DNA Li gase to construct circular DNA
(New England Biolabs). The cirCular DNA was concentrated by isopropanol
precipitation and resuspended in 10 uL ddeO. The ligation product was electroporated
into TransforMax EC100D pir-I I6 electro-competent E. coli cells (EPICENTRE

Biotechnologies, Madison, WI) using a Gene Pulser Xcell Electroporation System

33

(BioRad, Hercules, CA).

After electroporation, E. coli cells were recovered in SOC broth, harvested by
centrifugation, resuspended, and plated on LB Gm. Plates were incubated at 37°C
overnight. Isolated colonies of transformants were grown overnight in liquid LB Gm.
Plasmid DNA was extracted with Qiagen QIAprep Spin Miniprep Kit, digested with Sac
I restriction enzyme to release a 1 kb fragment within the HiMar region of the transposon
(New England Biolabs), and separated on 1% Agarose (Invitrogen). Plasmids that
showed 1 kb fragments were submitted for sequencing. For sequencing, uncut plasmid
DNA was combined with MarOut primer (5’-caagcttgtcatcgtcatcc-3’) or GmOut primer
(5’-cggtaaattgtcacaacgcc-3’). Sequencing was performed at the Michigan State
University Research Technology Support Facility. Sequenced plasmids were analyzed
with coliBLAST (http://colibase.bham.ac.uk/) to determine homologies to P. luminescens
TT01 genes.

Complementation assay

Two regions of the mad cluster were amplified with an XL PCR kit (Invitrogen):
madA through madJ (F im Forward 5’-tgacagttaggaccattttgacaattg-3’ and SpoT Reverse
5’-atccggctcacgactaaagaccgt-3’), and madH through madJ (Ush Forward 5’-
acggccgtttacttgttgtcgttg-3’ and SpoT Reverse). XL PCR was performed by combining
70-80 ng of genomic DNA with 2 uL of rTh DNA polymerase, followed by denaturation
at 95°C for 1 minute. Then, 20 11L 3.3X XL PCR buffer, 8 uL 10 mM dNTP mix, 4.8 1.1L
Mg(OAC)2,-l.3 11L each of forward and reverse primers, and ddeO for a final volume of
50 14L. Thermocycler was set for 93°C for 1 minute, 30 cycles of 93°C for 1 minute,

57°C for 1 minute, 66°C for 15 minutes, and finally 72°C for 10 minutes. Fragment sizes

34

were checked by agarose gel electrophoresis.

The PCR products were cloned into the Topo XL PCR vector (Invitrogen) as per
manufacturer’s instructions. The vector was electroporated into TransforMax EC100D
pir-I I 6 electro-competent E. coli cells (EPICENTRE Biotechnologies) and correct gene
orientation and expression was tested by restriction endonuclease digestion. Liquid PP3S
was inoculated with a TRN mutant overnight starter culture and grown to an OD600 of
0.6. The flasks were placed on ice for 20 minutes, and the cells harvested by
centrifugation. The bacterial pellet was washed twice with ice cold 10% glycerol,
centrifuged, and resuspended in 1 mL of ice cold 10% glycerol. Most of the supernatant
was removed by centrifugation, and the bacteria were aliquoted into clean 1.7 mL
microcentrifuge tubes so that each tube contained about 35 1.1L. Each aliquot was mixed
with 1.5 uL of the constructed Topo XL PCR vector (Invitrogen) containing either the
entire P. luminescens TT01 gene cluster VI (madA through madJ) or a portion (madH
through mad!) and electroporated as described above. After electroporation, the cells
were recovered in SOC broth, harvested by centrifugation, and plated on PP3S Zeo.
Plates were incubated at 28°C for two days or until colonies appeared. Transformants
were grown in liquid PP3S Zeo and plated on NA-cholesterol Zeo plates. At the same
time, liquid cultures of P. luminescens TT01, TT01 Tn7GFP, and TRN16 were plated on
NA-cholesterol plates and incubated. Transforrnants were tested in‘H. bacteriophora
following the adherence assay described above.

Inverted repeat analysis
The DNA sequence upstream of madA was searched for the presence of

inverted repeats using “EMBOSS einverted”

35

(http://bioweb.pasteur.fr/seqanal/interfaces/einverted.html). Putative promoter sites were
predicted with “BPROM” (http://www.softberry.com). Primers were designed to amplify
a 1 kb region including the inverted repeat (Figure 2-1 A; Method adapted from 1): fimIR
forward 5’-taggccatcgttttgggtag-3’ and fimIR reverse 5’-actcgtgcatcacgttttga-3’. A SfcI
restriction site located within the inverted repeat was used to determine orientation (ON
or OFF). After PCR amplification of P. luminescens strain TT01 Tn7GFP (primary and
secondary phenotypic variants) and TRN26-25 (primary) genomic DNA, and bacterial
genomic DNA extracted from boiled nematodes (after 24 and 48 hours), the PCR product
was digested with SfcI and separated on a 2% agarose gel. In the putative ON position,
fragments of 925 bp and 128 bp were expected (Figure 2-1 B). In the putative OFF
position, fragments of 753 bp and 300 bp should be seen (Figure 2-1 B).

In addition, PCR amplification was also performed using colonized H.
bacteriophora to determine the state of the switch within P. luminescens in the nematode
intestine. Nematodes were grown on TT01 Tn7GFP for 24 and 48 hours. The nematodes
were picked off the plates and washed in sterile saline. Then, individual H.
bacteriophora were placed in PCR tubes containing ddHZO and heated at 95°C for 10
minutes. Axenic H. bacteriophora US were heated alongside as a negative control. After

a brief spin, the supernatant was used as template for PCR amplification.

36

Figure 2-1: A) Nucleotide sequence upstream of madA (capital letters) that contains the
inverted repeat (black boxes), primer sites (underlined), Sfcl recognition site (grey box),
and the possible promoter site, as indicated by the presence of a -10 and -35 box. The
start of the madA open reading frame is indicated by capital letters. The start codon is
highlighted by a box. B) Size of inverted repeat PCR fragments after digestion with SfcI.
Fragment sizes are different depending on whether the repeat is in the ON or OFF
postion. (Method adapted from 1)

A)
acaataggccatcgttttgggtagcggtgtctattttatcctagcttatgtctgttctaa
fimIR forward primer

gcgggatatagccgggttgtactatcaatatattttggagaaataatcatgggccaaaga
aaatatctgactcaatcagaagtagaaagcatgttggaaatggcaaaagttgggcctaat
ccagaacggaattactgtctggtttatatgagctatatccacggctttcgtgttagtgaa
gccaggcatttacggttatctgacatggaattaaaagaaaaatgtttatatatcaggcgg
ttaaagggagggttttgtactaaccatcccctgttgcagcgtgaggttaaggcgattaag
gcatggcttaaagtgcgcaaaactttacagggcgcggatagtgattggctgtttttgtcg
cgttgtgggaaaccgcttactcgccagcgtatctatcagattatcaaccagttagggcaa
cgggcgaatatcgcggtagatccgcatccgcatatgttgcgtcatgcctgcggttttgct
cttgcagatcgagggatagatacccgactgatacaagattatcttggacataaaaacatt

 

cgccatacggtacgctatacagccagtaatgctgaacgttttcaaggagtttggagtata

  

aaaggtagacgttaaggt.*
inverted repeat
agaaattatactaaaagttttctaataaaaaaagagatagatttgtatatatttgtaaaa
cgcaactatcctaccacaaaaacatttcgataatccactctttttattccaatatgtaaa
aacatcacacttccttcgttactttaaagaaattactgttactaatttcggattaaataa
—35 box
ttaaatatccttaaaatttgcgaaataafitatagttatatccatattgctttgtttttgc
- 10 box SfcI site

  

acagaaaaattt‘
inverted repeat
ctagatgtctctgtttgtcaaaacgtgatgcacgagtttgaaccagattttagttaagta
fimIR reverse primer
gttaaaaagagattaatgaaEEAAAAGACAGATATTAAAGATAAGCGTCGTGGCGGCGT
start of madA ’
TGGTTTTGGGAGCAGCTTCGGCTGCTAATGCGGCGAATAATGCCATAGTAAATGTTACCG

t-atatttgtacag

 

37

Figure 2-1 (continued)

 

   

 

  
 

 

 
 

 

 

 

 

 

 

 

 

 

 

 

B)
A 1053 bp L
ON Position: ;T sfc, T
madR . madA
f Recombinase major swunlt
Inverted repeat .
925 bp T1 23 hp;
4 1053 bp j
OFF Position: ;T Sfcl T
madR . madA
Recombinase major swunlt
Inverted repeat
300 pr 753 bp

RT -PCR for major fimbrial subunits

RNA was isolated from bacteria grown in Grace’s Insect medium liquid cultures.
Bacteria were harvested by centrifugation, frozen in liquid nitrogen, and resuspended in
Trizol. After addition of chloroform and a brief incubation time, the tubes were
centrifuged and the resulting aqueous, colorless, RNA containing phase was transferred
to a clean tube before addition of isopropanol. After centrifugation, the RNA pellet was
washed twice with ice cold 70% ethanol (diluted in DEPC H20) and centrifuged. After

air drying, the pellet was resuspended in 10 uL DEPC H20, and RNA yield and quality

38

was measured with a NanoDrop ND-l 000 (NanoDrop lnc., Wilmington, DE). RNA was
treated with DNAsel and reverse transcribed with Thermoscript Reverse Transcriptase
(Invitrogen). The resulting cDNA was amplified in a GeneAmp PCR System 9700
therrnocycler (Applied Biosystems, Foster City, CA). Primers used were as follows:
madA for 5’-gtatttgccgcgtttttgtt-3’, madArev 5’-gccgaagcagacgaaactac-3’
mrfA for 5’-gtcacggaacggtgactttt-3’, mrfArev 5’-gtcagctggaagttggcaat-3’
plu0779for 5’-tgctcttaagcatggggatg-3’, plu0779rev 5’-aaagctaaccgcatcattgg-3’
plu0786for 5’-gatgtgagtgccggtacctt-3’, plu0786rev 5’-ggagtctgctgcttttaccg-3’
plu04 I 8for 5’-ccctagcagcaggttctgtc-3’, plu0418rev 5’-ccccgtcaccttgtaagaaa-3’
plu0507for 5’-gtgcagtcactgatgccact—3’, plu0507rev 5’-atcaccagcgcctactttgt-3’
phfoor 5’-tttggcttctttagtgacggta-3’, phfSrev 5’-tgaaattcatagtggcggtgt-3’
plu2159for 5’-tatcatcgcgaatgcctgta-3’, plu2159rev 5’-atcgtaaaattggcgactgc-3’
pilLfor 5’-ctgtgtgataccaccgcaac-3’, pilLrev 5’-ctatcggtaccgttgccact-3’
pluI 732for 5’-tcggaaatctcaaccgaatc-3 ’, pluI 732rev 5’-aaaccagcgtcacggtattc-3’
Negative controls included DNaseI treated but not reverse transcribed RNA and ddeO.
Positive control used was genomic DNA from P. luminescens TT01 and TRN26-25.
PCR products were separated on a 1% agarose gel to check for presence or absence of
bands.
Transmission Electron Microscope Imaging
Cultures of TT01 Tn7GFP and TRN26-26 were grown in liquid Grace’s Insect
media in a 28°C shaker overnight. The cultures were diluted 1:1 with fresh Grace’s Insect
media and transferred to a 300 mesh nickel grid, coated with formvar, by submersing the

grid into the diluted culture to collect bacteria. Negative staining was performed with 4%

39

ammonium molybdate. Grids were examined with a JEOL 100CX transmission electron
microscope at the MSU Center for Advanced Microscopy.

RESULTS
Photorhabdus temperata and P. luminescens mutant screening in H. bacteriophora

In order to determine which genes are required for transmission of Photorhabdus
spp. to H. bacteriophora, the bacterial mutants isolated during the transposon
mutagenesis where screened for their inability to colonize the intestine of H.
bacteriophora IJs. Of the ~8,000 screened mutants, 30 mutants were isolated which were
transmission defective. Transmission was determined by the presence or absence of GFP
throughout the IJ intestine when observed under a fluorescent microscope. While these
mutants were not able to be transmitted, they still displayed other wild-type primary
phenotypic characteristics such as pigmentation, bioluminescence, and colony
morphology, when observed under a dissecting microscope.

Twelve of the Photorhabdus spp. t_ra;r_smission (TRN) mutants had transposon
insertions in genes homologous to those of P. luminescens fimbrial gene cluster VI
(Figure 2-2), comprised of genes madR through mad], which is predicted to encode
putative fimbrial proteins assembled by an usher-chaperone pathway. The defective mad
genes that resulted in a transmission phenotype were the major structural subunit madA
(TRN359), the three chaperones madB,F, and G (TRN 5-60, TRN10-245, TRN 17-60,
and TRN23-30), the putative adhesion subunit madE (TRN16-158, TRN19-124, and
TRN 24-55), and the outer membrane usher madH (TRN583 and TRN18-110; Figure 2-
2). Two genes encoding proteins of unknown function were also mutated: madI (TRN22-

68) and mad! (TRN26-25; Figure 2-2). These fimbrial TRN mutants are defective in the

40

initial adherence event that takes place in recovering Us 12 hours after regurgitation. All
fimbrial TRN mutants had 0% transmission efficiency (>5,000 H. bacteriophora IJs
assayed for transmission of any symbiont bacteria), except for TRN22-68 (46.2%) and
TRN24-55 (2.3%; Table 2-2).

A comparison of mad genes to their E. coli homolog revealed significant
homologies of three mad genes (madB,F, and G) with E. coli chaperones (encoded by
fimC; Table 2-3). Significant homology was also seen between madH and the outer
membrane usher protein in E. coli encoded by fimD (Table 2-3). Both madA and madD
were homologous to a minor fimbrial subunit FocF of E. coli (Table 2-3), No significant
homologies were seen for the two mad genes with unknown function, mad] and mad]
(Table 2-3), but madE was homologous to an. adhesion protein when the retrieved
plasmid ofTRN16-158, TRN19-124, and TRN24-55 was compared with P. luminescens
TT01 using coliBASE. The recombinase MadR was similar to the recombinase FimB in
E. coli. Overall, mad genes were predicted to encode fimbriae similar to Type I fimbriae
in E. coli encoded by the fim operon (Table 2-3).

The remaining TRN mutants had transposon insertions in 18 different loci,
including sspA (stress response), sctP (type III secretion), wzc (capsule secretion and
polymerization), nhaA (NaVI-IT antiporter), livM (leucine, isoleucine, and valine
transporter), and abgR (p-aminobenzoyl-glutamate catabolism). The role of these genes
and others in symbiont transmission is currently being investigated by the Ciche Lab

(Michigan State University, Department of Microbiology and Molecular Genetics).

41

mméuzmh
mm Pic—.21...

mmfiuzm... momzmh mvué Fzmh om-mzm._.

h H

EA 3. is.

L L

muémzmh or T» wzc... 00.x. wzmh «N Tm szh mmmzmh
onéuzmh

 

 

 

 

 

 

APE. 5 33:3 8% 08.8 2:

Bob Senate bfiwzm 2 55:3 scum 52 2: 35 036.com E z .3: 3.38233 .& So: 038 we? :03? .3699? H8 aeoxo
JUZ Schemes» .m Be 3:82: 2%... =< oath—Eu oceoaanoeofi: H 09C. 2580 9 388on mm 5520 ocow $5. .23 come—85
888 8865 8: cc mBob< .H> “Ema—o ocow Rise: 3.5. mzoonmfifis .m 05 E 30985 sewage: mo 28:83 ..N.N wuaui

42

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

o v2-5: Sm 385 28.5 3.85;.
md omc 30 mp3: mmémeE.
o E: can ESE 3-8792.
Nov N9 32 :33: wo-NNZ~:
o co hmo WEE waTSZmH
o 3: Row 23:: 9 Tm _ 73:.
o E: was OBS: 8-:th.
o E: ewe Bess mm H -c _ 73:.
c C n can rises mvmé L ZME.
o E: E: E: 2&2”:
o mum :l. $35 8.253.
c 2: “men $35 mmeMH
o mmm coo SSE ommZME.
aozflomhv 23%..3355 as 35 2.3 5:235 RS on: ~55 BSM «5.9%555 .m 5 2823.5 “:53: >3:

 

 

 

 

 

 

.Ahm<.._m.¢oo 5:5 nos—€203 moi coEowE acmommamh Bufiioama 98 @5528
ESE: 05 waist vocab—Bow mg 9532: 2MB 5.5. neoouoemfié .& Ea HUZ SEKEE N we momocoB—bo 56355“; "N.N $.35

43

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

E: E: E: 535:: 25.. 02 has
2: E: E: 555:: 25a 3 :55
mm mm on?“ £28m 8%: 28562: $50 QER. 05 5:33:
3 mm Bacon seen 80320 9E vow ESE
mm mm 2&8; 522m 882:5 92% a8 ESE
S 2 2 .o 52on $7356: 3352:: 9? mg mg:
Q E 3.95 w 5&8on m €33 Essa 8&6 0E hack 8“ 93::
mm mm Sued £22m 30305093 EBOSE: SSA OE DES:
E X” 2 -mocw 53% 22256 9% SN m3:
om mm Emcee 82:85 m €33 ESE 8&5 0E {tax SN 3&5
3 an S-m8.~ 582m rename arena H 25 mé mm: 585

.8m as 4:93 ob o:_«>.m— 55:5 5395 383.5 wigs: :8 .m << 5 5.954 2:5 383..»535 N

 

 

 

 

.Emomammm 620238

2m ed 323 333$ .maouoca womomoa :05 Ea onEo: :8 .m :05 .23 85» E Ewamfififi .& Mo acmfiumfioo “MIN flack

 

T RN mutant complementation

Afier verifying mad gene orientation and expression of complementing plasmids
in E. coli, three of the P. temperata NCl TRN mutants in the mad cluster were
transformed with either the complete (pMadA-J) or partial (pMadHlJ) gene cluster:
TRN583 (transposon insertion in madH), TRN17-6O (madG), and TRN22-68 (madJ).
None of these transformed mutants were able to colonize H. bacteriophora after 24
hours, as there was no GFP detected in the intestine. When the P. luminescens TT01
mutant TRN26-25 (transposon insertion in mud!) was complemented with the complete
(pMadA-J) or partial (pMadHlJ) gene cluster, the bacteria were able to colonize H.
bacteriophora again (Figure 2-3). As expected, wild-type strain TT01 Tn7GFP bacteria
(positive control) were able to fully colonize H. bacteriophora, while untransformed
TRN26-25 (negative control) was not able to initiate adherence and colonization (Figure
2-3). TRN26-25 complemented with pMadA-J or pMadHIJ were partially restored in the
ability to adhere to the maternal intestine, and TRN26-25 pMadHlJ was better able to
adhere to H. bacteriophora intestine than TRN26-25 pMadA-J. In addition, 118
developed from nematodes grown on TRN26-25 pMadA-J and TRN26-25 pMadHIJ, but

these 113 were not colonized by bacteria.

45

Figure 2-3: Photorhabdus luminescens TT01 Tn7GFP, TRN26-25, and transformed
TRN26—25 bacteria in 44-hour post-IJ H. bacteriophora. Nematodes were recovered on
TRN16 for 16 hours, transferred to either TT01 Tn7GFP, TRN26-25, TRN26-25 pMadA-
J , or TRN26—25 pMadHIJ for 24 hours, and placed on unlabeled TT01 for 4 hours. White
arrows point to rectal gland cells that have been invaded (GFP present) or not (no GFP).

TT01 Tn7GFP

TRN 26-25

TRN 26-25 pMadABCDEFGHIJ

TRN 26-25 pMadHlJ

 

46

Inverted repeat switch

Analysis of the upstream region of madA revealed the presence of an inverted
repeat (IR). The IR is 35 bp long, matches at 33 bp (94% complementarity) with 0 gaps,
and has a 31.4% GC content (Figure 2-1 A). Analysis of the same region (Length of
input sequence: 112] bp; threshold for promoters: 0.20; scores above 0.20 are significant)
also yielded a predicted promoter site within the IR, with a _-10 box at position 809
(Score: 68) and a -35 box at position 786 (Score 13; Figure 2-1 A). The presence of an
IR and madR recombinase just upstream of madA suggested that gene cluster VI might be
regulated by phase variation under different grth conditions by inverting the promoter.
To test this, the orientation of the mad promoter was analyzed in primary phenotypic
variants which are transmitted in Us and secondary phenotypic variants that are not.

In P. luminescens primary phenotypic variants (TT01 Tn7GFP, TRN26-25, and
TRN26-25 pMadABCDEFGHIJ 1°) the switch was primarly in the predicted ON
postition (Figure 2-4), as evidenced by SfcI restriction endonuclease treated PCR
products of 925 bp and 128 bp. However, a small percentage (<5%) of the bacterial
population seemed to be in the “OFF” position, since very faint bands were observed at
750 and 300 bp (data not shown). In TT01 Tn7GFP secondary phenotypic variants (2°)
the switch was in the OFF position, as evidenced by fragment sizes of 750 bp and 300 bp
only detected (Figure 2-4). In addition, PCR amplification of P. luminescens genomic
DNA recovered from boiled worms indicated that the switch is in the “ON” position in P.
luminescens within the nematode intestine (Figure 2-4). These results indicate that the IR
switch is ON in 1° P. luminescens (from liquid cultures and boiled H. bacteriophora) and

OFF in 2° P. luminescens (from liquid culture).

47

Figure 2-4: SfcI digested inverted repeat PCR products from P. luminescens TT01
Tn7GFP and TRN26—25 colonies (a) or boiled H. bacteriophora (b) on 2% agarose gel.
Lane contents in a) are: 1) 100 bp ladder, 2) TT01 Tn7GFP 1°, 3) TT01 Tn7GFP 2°, 4)
TRN26-25 1°, and 5) TRN26-25 pMadA-J 1° (4). Lane contents in b) are: 1) 100 bp
ladder, 2) TT01 Tn7GFP from 24 hr. post-IJ H. bacteriophora, 3) TT01 Tn7GFP from 48
hr. post-IJ H. bacteriophora, 4) same as (1) but uncut fragment, and 5) same as (2) but
uncut fragment. ON position: 925 bp and 128 bp fragments. OFF position: 753 bp and
300 bp fragments.

8) _1_ 2

   

ON 1000 bp ON
FF OFF

 

OFF

ON

100 bp

   

RT -PCR for major fimbrt'al subunits

To determine if, in fact, the promoter switch is in the “ON” position of primary
phenotypic P. luminescens, transcription of madA was analyzed by RT-PCR. Since the
IR switch was ON in P. luminescens TT01 and TRN26—25 1°, mad fimbriae should be
expressed in both. Expression of mad fimbriae was tested by RT-PCR. The resulting
expression profiles of major fimbrial subunits were identical in P. luminescens TT01 and
TRN26-25 (Table 2-4). Both showed expression of madA, as well as all other major

fimbrial subunits, except for piIL which was not expressed (Table 2-4).

48

Table 2-4: Expression of major fimbrial subunits in 1° P. luminescens TT01 Tn7GFP and
TRN26-25 as measured by RT-PCR.

 

Primer TT01 Tn7GFP TRN26-25
madA
mrfA
lu07 79
plu0786
plu0418
plu0507
pit/S
plu2159
piIL
plu] 732

 

 

 

 

 

 

 

 

++++++++
++++++++

 

 

 

 

 

 

 

Transmission electron microscopy (T EM)

We attempted to detect mad fimbriae using TEM of P. luminescens TT01
Tn7GFP and TRN26-25. Surprisingly, both strains were indistinguishable (Figure 2-5).
Both had long peritrichous flagella (Figure 2-5). Under higher magnification, shorter pili
(or fimbriae) were found covering the entire bacterial surface of both wild-type and
mutant. This suggests that fimbriae other than mad are expressed on plates or in liquid
cultures. Expression of mad fimbriae is possibly restricted to the intestine of H.

bacteriophora, or they might be indistinguishable from other fimbriae that are present.

49

, . <
.E a:
5 En can can G can <V 51 N E0352 was 833 .Ag 98 e 0358c no 6 can <v «Ewan on “Eon @505 83>? .EZEOL 5.3

c038 2% $122 :88 8m a co AD 98 UV 3-8795. n5 Am 98 5 $955. 5: 388:..55 .m mo 893: Emu. ..m.-N 93%:

 

50

DISCUSSION

Specialized fimbriae and pili play a key role in the attachment of human
pathogens to their proper host. For example, Salmonella enterica serovar Typhi has IVB
pili that were found to be essential for pathogenesis in humans (21). Photorhabdus
temperata possesses an mrfoperon encoding mannose-resistant fimbriae that are
expressed prior to insect lethality but their exact role during insect pathogenesis is
unknown (20). In Vibrio cholerae, the flexible NAGV14 pili were shown to mediate
adhesion, allowing the bacteria to adhere to rabbit intestinal tissue (26). In Ps.
aeruginosa, only cup fimbriae are involved in surface attachment and are expressed in
response to environmental signals indicating a favorable attachment site (1 9, 24). These
examples demonstrate how pathogens employ specialized fimbriae to adhere to host cells,
so it is possible that symbiotic bacteria possess similarly specialized means of host
attachment. The fact that almost half of the TRN mutants unable to colonize H.
bacteriophora had transposon insertions in one of the eleven P. luminescens fimbrial
gene clusters suggests that the putative mad fimbriae encoded by gene cluster VI play a
key role in initial host-bacteria interactions during the gut colonization process. The mad
fimbriae might be the first kind of fimbriae discovered to be absolutely required for
symbiosis and symbiont transmission, although further research needs to be done to
support this hypothesis.

The complemented mutant TRN26-25 was able to adhere to the maternal intestine
of H. bacteriophora. Because the mad] mutant (TRN26-25) was complemented in its
ability to adhere to the maternal intestine of H. bacteriophora, it is clear that this gene is

required for adherence of P. luminescens to its nematode host. While there was no

51

transmission of complemented TRN26-25 from mother to offspring, these findings still
indicate the significance of these apparently specialized fimbriae in the colonization
process. Since the transformed mutants had to be grown on media containing Zeocin, the
presence of the antibiotic seemed to have a minor effect on nematode development (such
as increased recovery time), which could explain why TRN26-25 pMadA-J and pMadHIJ
did not show levels of colonization similar to wild-type. Also, it is very difficult to
maintain plasmid selection inside the nematode intestine. As seen in this study, the
complemented mutant TRN26—25 was able to adhere to the maternal intestine within 24
hours, but when H. bacteriophora were grown until IJs developed, those 113 were not
colonized. The majority of the bacterial population, therefore, might have lost the
plasmid within the nematode intestine, where antibiotic selection can no longer be
maintained, and were no longer able to utilize the plasmid to make the fimbriae required
for colonization and transmission to offspring.

Although P. luminescens and P. temperata are genetically very similar, and both
can successfully colonize H. bacteriophora, the question remains why P. temperata
mutants TRN583, TRN17-60, and TRN22-68 did not complement. Since both
Photorhabdus species can colonize H. bacteriophora, they apparently produce similar
fimbrial proteins that allow them to adhere to the nematode intestine and to be
transmitted to offspring. While these fimbrial proteins might be very similar, they may
adhere to different receptors within the nematode intestine. However, maintaining the
plasmid within the nematode intestine continues to be a problem, even after successful

complementation. In order to solve this problem, the mutations found during transposon

52

mutagenesis need to be reconstructed by making P. luminescens TT01 Tn7GFP
knockouts by a single insertion of a gene deletion into the chromosome.

Phase variation results in a mixed population of phenotypes, which allows
bacteria to quickly adapt to new environments (15). Populations of P. luminescens are no
exception. After seven days of culturing on a plate, populations of P. luminescens were
observed to consist of mostly primary phenotypic variants (1°), but a small group of
secondary phenotypic variants (2°) was also present (data not shown). After 14 days of
culturing on the same plate, the same population consisted entirely of 2° P. luminescens.
With regards to the mad gene cluster, the IR switch was seen to be ON in 1° P.
luminescens and OFF in 2°. P. luminescens TT01 Tn7GFP 1° and TRN26-25 1°
expressed mad genes, as seen by RT-PCR, providing further evidence that the IR switch
is ON. Secondary phenotypic variants of P. luminescens are not able to colonize H.
bacteriophora (12). Bacteria] genomic DNA isolated from nematode intestines revealed
the IR switch to be ON within the nematode intestine, suggesting that this gene cluster is
involved in the colonization process. Also, since the switch was ON in both TT01
Tn7GF P and TRN26-25, it suggests that the mutant is a primary phenotypic variant. In
addition, TRN26-25 exhibited 1° characteristics, such as pigmentation, bioluminescence,
and colony morphology when observed using a dissecting microscope. Therefore, the
observed inability of this mutant to colonize H. bacteriophora is due to the gene
disruption and suggests that TRN26-25 is a true mutant and not just a 2° functioning in a
way similar to a mutant. The presence of an inverted repeat switch suggests that madA
and perhaps other genes critical for mad function might be regulated by the IR.

Differences in the amount of fimbriae present were seen during TEM imaging,

53

depending on what media P. luminescens was grown in. When bacteria were grown in
PP3 S, pili and fimbriae were sparse and mostly absent, even on the wild-type strain
surface. When bacteria were grown in Grace’s Insect media, pili and fimbriae were
abundant and found on almost all (~95%) bacteria in a sample. Grace’s Insect media is a
rich media that mimics the environment found within an insect host, and nutrient
availability may have stimulated production of fimbriae. Based on the expression results
from the RT-PCR, there could be three reasons why there was no difference detected by
TEM: 1) mad fimbriae were present in both, wild-type and mutant, but were non-
functional, 2) mad fimbriae are transcribed but not made in Grace’s Insect media, and 3)
mad fimbriae were lost in the mutant but loss was not detectable. While the structural
differences between P. luminescens wild-type and TRN26-25 pili were not obvious under
the microscope, the differences could be found at a much smaller molecular level.
Perhaps, the protein encoded by madJ (the defective gene in TRN26-25) has an essential
accessory function, such as the correct assembly of fimbrial subunits, or attachment of
the correct adhesin protein to the fimbrial tip and sides.

Since the mad proteins are very similar in size to each other, SDS-PAGE analysis
would probably be very difficult. A better approach would be to align amino acid
sequences of Mad proteins to each other and to other fimbrial proteins to detect unique
residues only found in Mad proteins. These unique residues could be used to develop
antibodies, which could be labeled with fluorescent probes and used in a Western blot
that could detect which proteins are present or absent. Another approach could be to
shear fimbriae off the bacterial surface and run the sample through a mass spectrometer.

In order to test whether or not mad proteins are present during different growth

54

conditions, Western blots with labeled mad antibodies could also be done for mad
proteins isolated from liquid culture, from nematodes at different developmental stages,
and from insect larvae. Based on the results of this study, mad fimbriae possibly are
expressed in L3 H. bacteriophora after regurgitation, When P. luminescens initiates
adherence to the posterior intestine, and in pre-IJs that are colonized by adherence of a
single P. luminescens cell to the pharyngeal-intestinal valve cells. Since the adherence of
P. luminescens is specific to H. bacteriophora, mad fimbriae might be strain specific and

arose by co-evolution.

55

10.

11.

REFERENCES

. Abraham, J.M., C.S. Freitag, J.R. Clements, and 8.1. Eisenstein. 1985. An

Invertible Element of DNA Controls Phase Variation of Type 1 Fimbriae of
Escherichia coli. Proceedings of the National Acadamy of Science USA 82:5724-
5727.

Abu Hatab, M., S. Selvan, and R. Gaugler. 1995. Role of Proteases in the
Penetration of Insect Gut by the Entomopathogenic Nematode, Steinernema glaseri
(Nematoda: Steinemematidiae). Journal of Invertebrate Pathology 66:125-130.

. Akhurst, R.J. 1983. Neoplectana Species: Specificity of the Association with

Bacteria of the Genus Xenorhabdus. Experimental Parasitology 55:258-263.

Boemare, N., A. Guivaudan, M. Brehelin, and C. Laumond. 1997. Symbiosis and
Pathogenicity of Nematode-bacterium Complexes. Symbiosis 22:21-45.

. Ciche, T.A., S.B. Bintrim, A.R. Horswill, and J.C. Ensign. 2001. A

Phosphantetheinyl Transferase Homolog is Essential for Photorhabdus luminescens
to Support Growth and Reproduction of the Entomopathogenic Nematode
Heterorhabditis bacteriophora. Journal of Bacteriology 183:3117-3126.

Ciche, T.A., and J.C. Ensign. 2003. For the Insect Pathogen Photorhabdus
luminescens, Which End of a Nematode Is Out? Applied and Environmental
Microbiology 69:1890-1897.

Ciche, T.A., C. Darby, R. Ehlers, S. Forst, and H. Goodrich-Blair. 2006.
Dangerous Liaisons: The Symbiosis of Entomopathogenic Nematodes and Bacteria.
Biological Control 38:22-46.

Duchaud, E. C. Rusniok, L. Frangeul, C. Buchrieser, A. Givaudan, S. Taourit, S.
Bocs, C. Boursaux-Eude, M. Chandler, J. Charles, E. Dassa, R. Derose, S.
Derzelle, G. Freyssinet, S. Gaudriault, C. Médigue, A. Lanois, K. Powell, P.
Siguier, R. Vincent, V. Wingate, M. Zouine, P. Glaser, N. Boemare, A. Danchine,
and F. Kunst. 2003. The Genome Sequence of the Entomopathogenic Bacterium
Photorhabdus luminescens. Nature Biotechnology 21:1307-1313.

Forst, S. and K. Nealson. 1996. Molecular Biology of the Symbiotic-pathogenic
Bacteria Xenorhabdus spp. and Photorhabdus spp. Microbiology Review 60:21-43.

Gerritsen, L.J.M., and RH. Smits. 1997. The Influence of Photorhabdus
luminescens Strains and Form Variants on the Reproduction and Bacteria] Retention
of Heterorhabditis megidis. Fundamental and Applied Nematology 20:317-322.

Han, R.C. and R.-U. Ehlers. 2000. Pathogenicity, Development, and Reproduction

of Heterorhabditis and Steinernema carpocapsae Under Axenic in viva Conditions.
Journal of Invertebrate Pathology 75:55-58.

56

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

Han, R. and R.-U. Ehlers. 2001. Effect of Photorhabdus luminescens Phase
Variants on the in vivo and in vitro Development and Reproduction of the
Entomopathogenic Nematodes Heterothabditis bacteriophora and Steinernema
carpocapsae. FEMS Microbiology Ecology 35:239—247.

Handley, P.S. and A.E. Jakobs. 1981. Some Structural and Physiological Properties
of F imbria of Streptococcus faecalis. Journal of General Microbiology 127:289-293.

Hatab, M.A., R.J. Stuart, and R. Gaugler. 1998. Antibiotic Resistance and
Protease Production By Photorhabdus luminescens and Xenorhabdus poinarii
Bacteria Symbiotic With Entomopathogenic Nematodes: Variation Among Species
And Strains. Soil Biology and Biochemistry 30:1955-1961.

Henderson, I.R., P. Owen, and J.P. N ataro. 1999. Molecular Switches — The ON
and OFF of Bacterial Phase Variation. Molecular Microbiology 33:919-932.

Johnigk, S. and R. Ehlers. 1999. Juvenile Development and Life Cycle of
Heterorhabditis bacteriophora and H. indica (Nematoda: Heterorhabditidae).
Nematology 12251-260.

Joyce, S.A., R.J. Watson, and DJ. Clarke. 2005. The Regulation of Pathogenicity
and Mutualism in Photorhabdus. Current Opinion in Microbiology 9:1-6.

Khan, A. and W.M. Brooks. 1976. A Chromogenic Bioluminescent Bacterium
Associated with the Entomophilic Nematode Chromonema heliothidis. Journal of
Invertebrate Pathology 292253-26].

Kulasekara, H.D., I. Ventre, B.R. Kulasekara, A. Lazdunski, A. Filloux, and S.
Lory. 2005. A Novel Two-component System Controls the Expression of
Pseudomonas aeruginosa Fimbria] cup Genes. Molecular Microbiology 55:368-3 80.

Meslet-Cladiere, L.M., A. Pimenta, E. Duchaud, I.B. Holland, and M.A. Blight.
2004. In Vivo Expression of the Mannose-Resistant Fimbriae of Photorhabdus
temperata K122 during Insect Infection. Journal of Bacteriology 186:611-622.

Pan, Q., X-L. Zhang, H-Y. Wu, P-W. He, F. Wang, M-S. Zhang, J-M. Hu, B.
Xia, and J. Wu. 2005. Aptamers That Preferentially Bind Type IVB Pili and Inhibit
Human Monocytic-Cell Invasion by Salmonella enterica Serovar Typhi.
Antimicrobial Agents and Chemotherapy 49:4052-4060.

Poinar, G.O., Jr. 1975. Description and Biology of a New Insect Parasitic
Rhabditoid Heterorhabditis bacteriophora. Nematologica 21:463-470.

Richardson, W.H., T.M. Schmidt, and K.H. Nealson. 1988. Identification of an
Anthraquinone Pigment and a Hydroxystilbene Antibiotic from Xenorhabdus

57

luminescens. Applied and Environmental Microbiology 54:1602—1607.

24. Vallet, 1., SP. Diggle, R.E. Stacey, M. Camara, I. Ventre, S. Lory, A. Lazdunski,
P. Williams, and A. Filloux. 2004. Biofilm Formation in Pseudomonas aeruginosa:
F imbrial cup Gene Clusters Are Controlled by the Transcriptional Regulator MvaT.
Journal of Bacteriology 186:2880-2890.

25. Woods, D.E., D.C. Straus, W.G. Johanson, Jr., V.K. Berry, and J.A. Bass. 1980.
Role of Pili in Adherence of Pseudomonas aeruginosa to Mammalian Buccal
Epithelial Eells. Infection and Immunity 29:1 146-1151.

26. Yamashiro, T. and M. Iwanaga. 1996. Purification and Characterization of a Pilus

of a Vibrio cholerae Strain: A Possible Colonization Factor. Infection and Immunity
64:5233-5238.

58

CHAPTER 3: SUMMARY AND FUTURE DIRECTIONS
This chapter is divided into two parts. Part I summarizes the findings presented in
the chapters and appendices of this thesis. Part 11 makes suggestions for future research

in addition to that presented in Chapter 2.

59

SUMMARY

The results of this study were able to answer some fundamental questions regarding
the symbiotic relationship of P. luminescens with H. bacteriophora: I) which genes are
important in symbiosis? Photorhabdus luminescens with transposon insertions in the
mad fimbrial gene cluster were not able to colonize H. bacteriophora. Therefore, mad
fimbriae likely play an essential role during initial host-bacteria specific interactions in
the nematode intestine colonization process. 2) Can these mutants colonize H.
bacteriophora again when wild-type genes are supplied? TRN26-25, when
complemented with the wild-type gene cluster, was able to adhere to H. bacteriophora
maternal intestinal cells again. While adherence was only partially restored, and there
was no transmission from mother to offspring, this finding supports the hypothesis that
this particular type of fimbriae must be nematode-specific and important in the symbiotic
relationship of P. luminescens with H. bacteriophora. 3) How are mad fimbriae
regulated? The mad gene cluster in P. luminescens seems to be regulated by an IR switch
that is ON in primary phenotypic variants grown on plates and from within the nematode
intestine and OFF in secondary phenotypic variants grown on plates. Expression of mad
genes was seen in P. luminescens primary phenotypic variants, further suggesting that the
IR switch is in the ON position. Further research needs to be done to confirm that the
mad gene cluster is an operon (see appendices). 4) Are other fimbriae present and
functional in mad mutants? All TRN fimbrial mutants were able to form a biofilm on an
abiotic surface (see appendices) and hemaglutinate blood cells (data not shown),
suggesting that the other fimbrial gene clusters in P. luminescens are functional and are

not involved in the colonization process. The absence of obvious structural differences,

6O

as observed by TEM, suggests that differences between wildtype and mutant fimbriae are
at a much smaller molecular level that need to be investigated.

In conclusion, I would like to present the following model depicting the
hypothetical series of events that lead to adherence and transmission of P. luminescens in
H. bacteriophora mediated by mad fimbriae (Figure 3-1). Afier regurgitation within the
insect larvae, H. bacteriophora ingests P. luminescens cells while feeding on the insect
body contents (Figure 3-1). An unknown signal within the intestine of H. bacteriophora
might initiate expression of mad fimbriae, which allow the bacteria to adhere near the
rectal gland cells (Figure 3-1). After several generations, H. bacteriophora no longer
lays eggs into the environment, and Us develop within the mother’s body. While feeding
on the body contents of the mother, pre-IJs ingest P. luminescens once again (Figure 3-1).
After ingestion, an unknown signal might initiate expression of mad fimbriae, which
allow the bacteria to adhere to the pharyngeal-intestinal valve cells (Figure 3-1). From

there, P. luminescens recolonizes the entire intestine of H. bacteriophora (Figure 3-1).

6]

OCOOwOSEE .l

gun-cc. 8:330 .68 mafia oEoEoE 0.112810 . -
8°52: co 9.82 o5 ' 22% 92.1888 .1

 

 

 

 

 

 

 

 

 

 

9.3293 03 «2.2a .
2.8 22a .88.
. 8 8:22?
. 2.38:. a c. 58298 E
96301203 .I c. .965— U8 0 . . no

 

 

 

 

 

 

 

 

868.. 8.3
«.883 38?. 38.25:

g m MVP M. l
«=8 029 35385 ouflm Q. B 2982 2
489;.ch 8 oozeocumh town. 55.3 gage—V
fl @ I filgngfl‘l

8.52... c. ”888.53 .1 5.;
2.8.5.. 882... 8236.93 .1

vogue. 5.32on has 0552:.
330.508 .1 c. .23

 

 

 

 

 

 

 

 

 

 

 

 

data—Em was .3 33:58 we .58 3:585 3836.28er E 9 ”1.88355 .& “o 358:? we 388 3285093 < ..~.m. 95M;

62

FUTURE DIRECTIONS

The results of this study were helpful to answer some of the fundamental
questions associated with bacteria-nematode symbiosis, but there are a number of
questions that still need to be answered. In order to further test the importance of mad
fimbriae in colonization and transmission, one could run adhesion inhibition tests. There
are two ways in which these tests could be conducted: 1) wild-type and mutant bacteria
could be treated with anti-fimbriae antibodies before testing them in the nematodes, and
2) nematode intestines could be treated with purified mad fimbriae to block receptors
before testing adherence of wild-type and mutant bacteria to the nematode intestine. In
both cases, if mad fimbriae are important for colonization, wild-type bacteria should not
be able to colonize the nematode intestine. The mutant bacteria act as a negative control.

In addition, it would be interesting to see if TRN fimbrial mutants could still be
pathogenic in insects. For this purpose, one could inject serial dilutions of TRN fimbrial
mutants liquid cultures into insect larvae, such as Manduca sexta, and determine insect
survival curves and LD50. If TRN fimbrial mutants are not pathogenic to insects, mad
fimbriae might act as a virulence factor in insects.

Most importantly, it would be important to determine what surface receptors mad
fimbriae bind to within the nematode intestine. There are several ways in which this
question could be answered. For example, one could assemble a glycoarray containing a
variety of sugars and probe the array with a solution of sheared mad fimbriae that have
been labeled with a fluorescent probe. If fluorescence is detected for a certain sugar, that
sugar might be the receptor to which mad fimbriae bind to on the surface of H.

bacteriophora intestinal cells. Another way would be affinity chromatography, during

63

which labeled H. bacteriophora intestinal cells are run on a column of immobilized mad
fimbriae. This would give some insights into what kind of nematode cells mad fimbriae
can bind to and where in the nematode intestine these cells are located.

Finally, it would be important to further investigate the structure of mad fimbriae.
In order to better visualize mad fimbriae, immunogold electron microscopy of wild-type
and mutant bacteria could be done. This could help to better determine structural
differences between wild-type and mutant mad fimbriae, such as differences in length,
number, or distribution on the bacterial surface. In the case where mad fimbriae are
completely absent from mutant bacteria, this could also be detected by immunogold
electron microscopy. For a more detailed look at the molecular structure of mad
fimbriae, crystallography and X-ray diffraction could shed light on the exact structure
and receptor binding sites. Since wild-type and mutant bacteria did not appear different
under the TEM, qRT-PCR could be done to detect if other fimbrial genes are upregulated
in mad mutants. In addition, flow cell experiments could answer the question if mad

fimbriae promote adherence under flow.

64

APPENDICES

65

RNA ISOLATION AND RT-PCR OF mad GENE CLUSTER OPERON
Two results presented in Chapter 2 suggest that P. luminescens gene cluster VI
might be an operon: 1) the mad gene cluster is regulated by an inverted repeat switch, and
2) no matter what mad gene the transposon inserted into, TRN mad mutants did not
colonize H. bacteriophora. If the mad gene cluster is an operon, genes should be
transcribed continuously and expression should be detected by RT-PCR. For this
purpose, RNA was isolated from bacteria grown in Grace’s Insect medium liquid cultures

and reverse transcribed as described before. Primers used were as follows:

 

 

 

 

 

 

 

 

 

 

 

 

forward reverse

madR/madA 5'-acagccagtaatgctgaacg-3' 5'-tcacaatgaaccggtaaca-3'
madA/madE 5'-acggttgctatgatcgttcc—3' 5'-atcaacggtgctggtgattt-3'
madB/madC 5'-gccagagctggcatacaaag-3' 5'-cgtgcaatttctcagcgtaa-3'
madC/madD 5'-ttcgtgataaaggggcagat-3' 5'-ccaggaacagcagaaccatt-3'
madD/madE 5'-tgttccggttgaatttgatg-3' 5'-aaagctggacccattcacac-3'
madE/madF 5'-gaaattggagggagcaatga-3' 5'-acggtaaactccgatgaacg-3'
madF/madG 5'-cctatggccgactgacattt-3' 5'—gactccgttgctggatgatt-3'
madG/madH 5'-gttgcagactttgcaggtca-3' 5'-gctccatcccgtcagaaata-3'
madH/mad] 5'-agtgcgaggtggcatttaac-3' 5'-taaggtcgctttacccg1tg-3'
madI/madJ 5'-cccaagctttctggtgagtt-3' 5'-tctgtcactcggaacacctg-3'

 

 

 

 

These primers were designed to amplify from the end of one gene to the start of the next
gene to detect co-transcription of mad genes. Controls included DNaseI treated but not
reverse transcriped RNA and genomic DNA. PCR products were analyzed for
appropriate fragment size on a 1% agarose gel.
Results

In P. luminescens TT01 Tn7GFP, madA through madF were co-transcribed, with
a gap in transcription from madG through madI (Table 1). In TRN26-25, there were gaps

in transcription between madB and madC, madD through madG, and mad] and mad]

66

(Table 1). In TT01 Tn7GF P, madR and madA were not co-transcribed, but they were in

TRN26-25 (Table 1).

Table I : Expression of mad genes as measured by RT-PCR.

 

 

Primer TT01 Tn7GFP TRN26-25 Putative protein
madR/madA - + fimA
madA/madB + + chaperone
madB/madC + — fimA
madC/madD + + fimA
madD/madE + - adhesin
madE/madF + - chaperone
madF/madG - - chaperone
madG/madH - + usher
madH/mad] - - secreted protein
madI/madJ + - unknown
Discussion

It was not confirmed by this test that gene cluster VI in P. luminescens is an
operon. The results were too inconclusive and the experiment needs to be repeated to
optimize PCR conditions. However, it makes sense that madR and madA are not co-
transcribed, otherwise it would defeat the purpose of the inverted repeat switch that was
found upstream of madA. Perhaps, the RNA was not isolated during a time when all the
genes are expressed, or the RNA was degraded before reverse transcription was
completed. Also, secondary promoters could be distributed throughout the gene cluster.
The fact that about half of the genes were expressed and half weren’t suggests that the
operon might have been in the beginning stage of being fully activated. Other problems
could include pipetting errors during PCR setup, with some of the PCR tubes not
receiving any cDNA or not enough. Also, either the reverse transcriptase or primers used
could have been faulty and might have not worked. This could be tested by ordering new

enzyme and primers.

67

GENE KNOCKOUT BY PCR STRAND OVERLAPPING EXTENSION

In order to reconstruct the TRN mutant phenotype in P. luminescens TT01, gene
knockouts were attempted by using the PCR SOEing method adapted from Metcalf et al.
1996. Oligonucleotide primers for the flanking regions upstream and downstream of
madA and madH were designed to amplify a ~500 bp fragment including at least the first
and last six to eight codons. The Oligonucleotide sequences were as follows:

madA Afor 5 ’-gtaccggccgtgctgaacgttttcaaggagt-3 ’

madA Arev 5 ’-ataggagaaggtgatgggggccgccacgacgcttatctttaa-3 ’

madA Bfor 5’-ttaaagataagcgtcgtggcggcccccatcaccttctcctat-3’

madA Brev 5 ’-tcgacggccgagggtccaaacgaaataaagg-3 ’

madH Afor 5 ’—gtaccggccgagcgcgtcagtaaaagaggat-3 ’

madH Arev 5’-attccagcgtttatctgccttaaataccagcatcacccgaca-3’

madH Bfor 5’-tgtcgggtgatgctggtatttaaggcagataaacgctggaat-3’

madH Brev 5’-tcgacggccgtaaggtcgctttacccgttgc-3 ’

Afor and Brev primers also included an EagI linker. Half of Arev and Bfor were
complimentary to each other to create a linking region. First, both fragments were
amplified in separate PCR reactions. Fragment sizes were checked by agarose gel
electrophoresis. Correct fragments were treated with ExoSap and diluted 1:500 with
sterile ddeO. The diluted fragments were combined and amplified by PCR again using
Afor and Brev primers to fuse the two fragments into one. Fragment sizes were checked
again by agarose gel electrophoresis. Correct fragments were ligated into pCRII dual

promoter cloning vector (Invitrogen).

68

The ligated vector plus insert was transformed into DHSa chemically competent
cells (Invitrogen) and plated on MacConkey Agar containing 100 ug/mL ampicillin.
DHSa cells contain a lacZ gene that allows for red-white screening on MacConkey Agar.
The insert disrupts the lacZ gene on the vector and the cells are no longer able to utilize
the lactose in the MacConkey Agar, resulting in colonies to be white. When colonies
appeared, only white colonies were used for further screening, since they are likely to
contain the vector plus insert. Transformants were screened for the correct insert by
colony PCR using Afor and Brev primers. Plasmids of correct transformants were
extracted and digested with Eagl to release the insert. The insert was gel purified, ligated
into vector pWM91 (digested with EagI and treated with Shrimp Alkaline Phosphatase),
and electroporated into TransforMax EC 100 Dpir-116 electrocompetent cells
(EPICENTRE Biotechnologies). Cells were recovered in SOC broth and plated on
MacConkey Agar Amp.

Transformants were screened for the correct insert by colony PCR using Afor and
Brev primers followed by agarose gel electrophoresis. Plasmids of correct transformants
were extracted, digested with Bag], and separated on a 1% agarose gel to check fragment
sizes. Correct plasmids were electroporated into E. coli BW29427 cells. The cells were
recovered in SOC broth and plated on LB DAP Amp. Transformants were screened for
the correct insert by colony PCR using Afor and Brev primers followed by gel
electrophoresis. Cells containing the correct insert were mated with TT01 Tn7GFP for 7
hours, plated on PP3S Amp in different volumes (25 uL, 50 uL, 100 uL, and 100 uL each
of 104 and 105 dilutions), and incubated for two days. Ampicillin resistant colonies were

further plated on PP3S Amp Suc 7.5% and PP3S Suc 7.5%. Colonies that were

69

ampicillin resistant and sucrose sensitive were tested for gene deletion by colony PCR
using primers designed to amplify a region within the deleted gene followed by agarose
gel electrophoresis. Oligonucleotide sequences were: madA del confirm for 5’-
tgttaccggttcgattgtga-3’, madA del confirm rev 5’-ggtttccaggagcatctgtg-3’, madH del
confirm for 5’-ggtagtgtggcaggtcaggt-3’, and madH del confirm rev 5’-
ccaggcagaccgtaaatcat-3 ’.
Results

Two of the genes in gene cluster VI where chosen for deletion based on their
importance: 1) madA - the major structural subunit of fimbriae, and 2) madH - the outer
membrane usher. After successful cloning of each gene deletion into E. coli BW29427,
three independent matings of P. luminescens TT01 Tn7GFP with E. coli
BW29427AmadA or E. coli BW29427AmadH were performed. During the mating, by
means of a 2-step gene replacement, the targeted genes should be deleted. Colony PCR
of the offspring revealed four possible TT01 Tn7GFPAmadH knockouts and none for
TT01 Tn7GFPAmadA. However, when the possible TT01 Tn7GFPAmadH knockouts
were tested in H. bacteriophora, all nematodes were fully colonized by bacteria,
indicating that the gene was not deleted.
Discussion

Although, P. luminescens gene knockouts in this study were not confirmed, it
would still be important to continue efforts to reconstruct the mutations found in the NCI
Tn7GFP mutants in TT01 Tn7GFP. At this point, pWM91AmadA and pWM9lAmadH
were cloned into E. coli BW29427, and presence of the correct fragment was confirmed

by PCR. The step that proved to be problematic was the mating of TT01 Tn7GFP with

70

BW29427AmadA and BW29427AmadH. Some of the problems that occurred during
mating could probably be solved by optimizing the mating process. For example, mating
time could be increased from 7 hours to an overnight (or 12 hour) mating. Also,
ampicillin didn’t seem to be very effective at keeping down background growth, which
made it difficult to screen offspring by colony PCR after matings. Due to poor Ap
selection, plasmid integration was not confirmed, and it would be prudent to move the
deletion construct to a plasmid with a tighter antibiotic selection, like a Tet plasmid.

Reference

Metcalf, W.W., W. Jiang, L.L. Daniels, S.K. Kim, A. Haldimann, and BL. Wanner.
1996. Conditionally replicative and conjugative plasmids carrying lacZ 74 alpha for
cloning, mutagenesis, and allele replacement in bacteria. Plasmid 3521-13.

71

BIOFILM FORMATION ON POLYSTYRENE PLATES

In order to test if mad fimbriae were major fimbriae, P. luminescens and P.
temperata wild-type and TRN mutants were tested for biofilm formation on polystyrene
plates (assay adapted from O'Toole and Kolter, 1998). If mad fimbriae are not a major
type of fimbriae, TRN mad mutants should still be able to form biofilms on an abiotic
surface.

Overnight bacterial cultures were diluted to an ODboo of 0.6, and 10 uL of each
were used to inoculate a 96-well microtiter plate containing 100 [AL Grace’s Insect media
per well. Rows with media blanks were also included. After reading the initial ODboo,
the microtiter plates were parafilmed and incubated on wet paper towels for 48 hours at
28°C. After 48 hours, the OD600 was read again for the entire plate before removing the
liquid. Each well received 150 1.1L of 0.1% crystal violet (in ethanol), and the plate was
incubated at room temperature for 15 minutes. The stain was removed and the plates
were rinsed with DI water three times by immersing. Each well received 200 11L of a
95% ethanol/5% acetic acid mixture to dissolve the stained biofilm. Absorbance was read
at 590 nm with SpectraMax M5 plate reader (Molecular Devices Corporation, Sunnyvale,
CA).

Results

Biofilm formation was not significantly different among the four wild-type strains
TT01, TT01 Tn7GFP, NCI , and NC] Tn7GFP (Figure 1). The majority of the fimbrial
mutants tested were able to form biofilms on an abiotic surface at levels not significantly
different from wild-type, with the exception of TRN359, TRN10-245, TRN10-329,

TRN] 8-264, TRNl9-124, and TRN22-68 (Figure l).

72

8983 NHL
1781-61» NHL
LBZ‘BI. NHL
VQZ'BI- NHL
01 1'81- NHL
0911» NHL
891-91 NHL
639-01- NHL
9173'01- NHL
LL'B NHL
09-9 NHL
889 NHL
698 NHL
9L NHL
ddEMUL ION
LON
dd'EJLUL LOLL
LOLI.

mm

0.0

...0

N0

0.0

10

wuoesmeowqmqv

0.0

0.0

 

5.0

.8: com um 32
£3 8:353.“ 2:. .23ch Bow ocean $39850 $3 a E 32038 can .203 REED $ch 55 @05de 33 8503 was—88
05 £09385 00 £30: we 30¢. .083 53.00 a so $532: 2.3. can $831.55 .& 316:3 mo c2388“ 852m ..~ 23%:

73

Discussion

Since the majority of TRN mutants were able to form a biofilm on an abiotic
surface, such as a microtiter plate, the fimbriae encoded by gene cluster VI must be
specialized for attachment within the nematode intestine, since the remaining functional
fimbrial gene clusters were sufficient for biofilm formation. It was a little surprising to
see the variability in the wild-type strains, which should have displayed equal levels of
biofilm formation. The Crystal violet should have been dissolved in water instead of
ethanol. During the staining, the ethanol that was used to dissolve the Crystal violet
probably dissolved some of the biofilm that had formed in the wells. When the plates
were rinsed with DI water, a substantial amount of biofilm was washed away before it
could be measured. Also, some of the TRN mutants showed low levels of biofilm
formation, which could indicate an overall growth defect in these mutants due to the
transposon insertion. Growth rates for mad mutants and wild-type strains could be
measured by growing overnight cultures of wild-type strains and mutants and inoculating
a 96-well plate with 10 1.1L of an overnight culture that was diluted to an OD600 of 0.6.
Then, the 96-well plate could be placed in a SpectraMax M5 Spectrophotometer, which
can be set to automatically take OD measurements at pre-set time intervals for a total of
16 or more hours. The resulting growth curves could be compared for any kind of
growth defects. Also, different kinds of media, such as 2% PP3S and Grace’s Insect
media, could result in growth differences.
Reference
O'Toole, G. A., and R. Kolter. 1998. Flagellar and twitching motilities are necessary for -

Pseudomonas aeruginosa biofilm development. Molecular Microbiology 30:295-304.

74

IIIIIIIIIIIIIIIIIIIIIIIIIII

llllllllllllllll‘lllllllllllllllllllllllllllllll