f. . w. ,.
”mm «a h
.Wwflma‘fim .3.

Sum
~.~—.I\l.l I:
3.. (.33. . 3

a?

u. 1 a
(“wasn‘ti'n‘dn
3 gm»
. dawn“

5 .m . yuiufloaqux...

.1. "Month. 3A!

n
‘15...

A Pm’éégig
'th ed
"is; 1

,3:

:c. .
Ilt I .1

03%:

 

dawmn‘mwwwm.»

7}.

5.“..1. .
5...: .

THESIS

 

a, * LIBRARY
1093 Michigan State
University

 

fl

This is to certify that the
thesis entitled

EVALUATION OF A NOVEL DECONTAMINATION AND DNA
RECOVERY AND DETECTION METHOD FOR BACILLUS
ANTHRACIS

presented by

Kristy Ann Bachus

has been accepted towards fulfillment
of the requirements for the

MS. degree in Forensic Science

 

 

WWW

Major Professor’s Signature

19%. M 07007
Date

MSU is an affirmative-action, equal-opportunity employer

-—a—---u----.---—.—.—‘—.— _~

a.-o---n-o----o---o-n-u-n— 4

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE

DATE DUE

DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

6/07 p:/CIRCIDateDue.indd-p.1

 

 

 

 

Zlo-

 

EVALU

 

 

EVALUATION OF A NOVEL DECONTAMINATION AND DNA RECOVERY AND
DETECTION METHOD FOR BACILL US AN T HRACIS

By

Kristy Ann Bachus

A THESIS

Submitted to
Michigan State University
in partial fiJlfillment of the requirements
for the degree of

MASTER OF SCIENCE
School of Criminal Justice

2007

 

2105

 

EVAL

diseas.
of 5 in
the U1
adequ
in an :
Impor
DNA
Cmca
B. an
reCm
Diovi
comI
comI
“'hic
Idem

Endo

ABSTRACT

EVALUATION OF A NOVEL DECONTAMINATION AND DNA RECOVERY AND
DETECTION METHOD FOR BA CILL US AN THRA C15

By
Kristy Ann Bachus

Bacfllus anthracis is a spore-forming bacterium that is the causative agent of the
disease anthrax. In 2001, anthrax-filled letters sent through the mail resulted in the death
of 5 individuals and cost millions of dollars for decontamination of affected facilities in
the United States. Current methods for killing B. anthracis endospores have not been
adequately studied and may not be effective in treating the many different surfaces found
in an indoor setting. In addition, endospores collected from a biological attack are also
important evidence in a criminal prosecution, and therefore preservation of endospore
DNA is necessary for a successful microbial forensics analysis. This study evaluates the
efficacy of a novel chemical compound for its use against Bacillus atrophaeus and
B. anthracis spores on metal, glass, paper, wood, and carpet surfaces. A simple spore
recovery protocol to sample the above surfaces after treatment is described. Evidence is
provided that the proprietary chemical compound is an effective sporicidal agent when
compared to other decontaminating agents. Following spore inactivation using the
compound, intact DNA is still present in sufficient quantities to be amplified by PCR,
which allows the amplification and analysis of genes that are important for forensic
identification of virulent B. anthracis strains. This technique can be used to kill
endospores while simultaneously preserving the DNA evidence necessary for forensic
analysis, allowing a scene to be decontaminated prior to exposing investigators and

laboratory workers to viable B. anthracis spores.

 

DJ>C’?3

 

 

 

and at
years
home

many

Foran.
I need
Bari/1'4
0n the
gfiing

“Dem

experir
wonder
paSSIOn

there W

80 than

ACKNOWLEDGEMENTS

I would like to thank my mentor Dr. Martha Mulks for all her support, guidance
and advice. She took a chance on a wide—eyed college freshman and over the past six
years has taught me to be the scientist I am today. The Mulks laboratory became my
home away from home and I am grateful to have had the opportunity to work with so
many wonderful people in my time here at Michigan State University.

I would also like to thank the other members of my committee. To Dr. David
Foran, for accepting me into the Forensic Science program and giving me the experiences
I need to pursue my dreams. To Dr. Stephen Cendrowski for granting me access to
Bacillus anthracis spores, without which my project would not have had such an impact
on the field. To Dr. Vincent Hoffman for reviewing my work and to Dr. Aziz Awad for
giving me permission to use the chemical compound developed by his company in my
experiments.

A special thank you to Rhiannon Leveque for the use of her quantitative killing
experiment data and for all of her assistance with my own experiments. She has been a
wonderful colleague and friend and I will miss her dearly. To Dr. Trevor Wagner, whose
passion for science and incredible patience has made a lasting impression on me. He was
there when I set up my first PCR and from him I learned what it means to be a scientist.
So thank you for guiding me onto the path and for all the laughs along the way.

Jonathan Lenz, who has been the driving force and inspiration for all that I do and

accomplish. For all the times I said “I can’t” he has told me “you will” and it is his belief

iii

 

THESIS

9.0 '3 ‘5

 

in me that has given me the confidence to reach higher. He has supported me for the past
five years and I look forward to finally starting our new life together.

My parents, Gary and Rebecca Bachus for their unconditional love and support.
They have had to help me move more times than any parents should and yet they never
complained. Without them I would not be the person I am today, through all the
triumphs and heartaches they have been there and for that I am truly grateful.

This research was performed under an appointment to the US. Department of
Homeland Security (DHS) Scholarship and Fellowship Program, administered by the
Oak Ridge Institute for Science and Education (ORISE) through an interagency
agreement between the US. Department of Energy (DOE) and DHS. ORISE is managed
by Oak Ridge Associated Universities (ORAU) under DOE contract number DE-ACOS-
06OR23100. All opinions expressed in this paper are the author’s and do not necessarily

reflect the policies and views of DHS, DOE, or ORAU/ORISE.

iv

 

1o 0%

M.

RE

TABLE OF CONTENTS

LIST OF TABLES .................................................................................. vii
LIST OF FIGURES ................................................................................. viii
INTRODUCTION .................................................................................... l
Bacillus anthracis ............................................................................ l
Microbial forensics ........................................................................... 6
Decontaminating agents .................................................................... 14

Goals of the study .......................................................................... 20
MATERIALS AND METHODS .................................................................. 22
Bacterial strains and growth conditions ................................................... 22

B. anthracis endospore preparation ....................................................... 22
Decontaminating agents 23
Quantitative killing assays ................................................................................ 24
Qualitative killing assays ................................................................................... 25

DNA amplification by polymerase chain reaction........................ . . 27
Design ofprimers for PCR assays... . 28
Sensitivity of B. atrophaeus-specific” primers with spores” 3O
Sensitivity of B. atrophaeus—specific primers with vegetative cells. . . . . . . . . . . .......3l
Decontamination and DNA recovery experiments ..................................... 31
Scanning electron microscopy... .... 32
Sequencing of B. anthracis PCR products ............................................... 33
RESULTS ............................................................................................ 34
Sporicidal activity of Mandala PDS Formula 1 ......................................... 34
Design and optimization of primers for B. atrophaeus ................................ 35
Sensitivity of assay for detection of B. atrophaeus ..................................... 38

B. atrophaeus decontamination and DNA recovery experiments .................... 43
Examination of B. atrophaeus spore-coated disks by SEM ........................... 46

B. anthracis qualitative killing assays .................................................... 49
Design and sensitivity of primers for B. anthracis ...................................... 50

B. anthracis decontamination and DNA recovery experiments. . . . . . . . . . . . . . 55
Stainless steel ........................................................................ 55

Glass ................................................................................ 57

Paper ................................................................................. 59

Wood ............................................................................... 61

Carpet ............................................................................... 63

Sequencing of B. anthracis PCR products ............................................... 65

 

2.008

 

 

Effect of extended sporicide treatment of B. anthracis spores. . . . . . . . . . . 67
Multiplex of B. anthracis primers ......................................................... 67

DISCUSSION ........................................................................................ 69
SUMMARY AND FUTURE DIRECTIONSS6

BIBLIOGRAPHY ...................................................................................... 89

vi

 

2.00%

 

 

LIST OF TABLES

Table 1: Primers used in this study

vii

.29

 

1008

 

Figure 1.
Figure 2.

Figure 3.

Figure 4.

Figure 5.

Figure 6.
Figure 7.
Figure 8.

Figure 9.

Figure 10.
Figure 11.
Figure 12.
Figure 13.
Figure 14.

Figure 15.

Figure 16.

Figure 17.

LIST OF FIGURES

Diagram of a B. anthracis spore .................................................................
Killing curve of B. atrophaeus spores treated with Formula 1

Specificity of the PCR assay for B. atrophaeus using the BAl -UP520

primer pair for 168 rRNAH

Sensitivity of 168(520) and gyrA primers for detection of

B. atrophaeus spores ................................................................

Limit of detection of PCR assays with B. atrophaeus spores and

vegetative cells .....................................................................
Pilot B. atrophaeus treatment and DNA recovery experiment. . . . . . . . . . .
Detection of DNA from B. atrophaeus spore-coated metal disks. . . . . . . .
SEM images of B. atrophaeus spore-coated metal disks. . . . . . . . . . .
Limit of detection of PCR assay with B. anthracis spores ...................
Sensitivity of B. anthracis—specific primers for detection of spores. ........
Detection of DNA from B. anthracis spore-coated metal disks. . . . . . . . . . .
Detection of DNA from B. anthracis spore-coated glass. . . . . . . . . . . . . . . . .
Detection of DNA from B. anthracis spore-coated paper. . . . . . . . . . . . . . . . .

Detection of DNA from B. anthracis spore-coated wood. . . . . . . . . . . . . . . .

Detection of DNA from B. anthracls spore-coated carpet

with pagA primers ..................................................................

Partial sequence of the gyrA gene (bp 1-935) fi'om the B. anthracis

Sterne strain ............................................................................................

MultiplexPCR

viii

..... 14

35

...38

41

42

45

48

52

54

56

58

6O

62

64

66

68

23.008

 

INTRODUCTION

The threat of biological warfare is of increasing concern in modern society, but its
origins may be traced back as far as the Middle Ages. During the fourteenth century
cadavers of plague-infected individuals were catapulted over the walls of the besieged
city of Kaffa by the Tartars (Hawley and Eitzen, 2001). It was not until World Wars I
and 11, however, that research into the use of biological agents as weapons of mass
casualties began. Many countries are known or suspected to have had active biological
weapons programs, including the United States, Japan, the former Soviet Union, the
United Kingdom, and Iraq (Szinicz, 2005). In 1972, over 100 countries signed the
Biological and Toxin Weapons Convention, banning research on deadly biological agents
except for defensive purposes, though some countries continued their programs even after
signing (Miller et al., 2001). Research into the weaponization of biological agents
included plant, animal and human pathogens, such as the bacterial species that cause the

diseases plague, tularemia, brucellosis, cholera, and anthrax.

Bacillus anthracis

Bacillus anthracis is a gram positive, rod-shaped bacterium which is capable of
producing endospores, often referred to as spores. Endospore formation occurs when the
environment in which the bacterium is growing is nutrient poor. While the bacterium is
metabolically inactive in this state, the nature of the spore is complex and protects against
extreme environmental conditions. When the spore encounters nutrients such as amino

acids, nucleosides or specific ions, molecules that are encountered in a mammalian host,

9.008

 

it initiates the process of germination (Liu et al., 2004). Germination and outgrth are
the beginning of the vegetative cycle, during which bacteria rapidly multiply. Vegetative
B. anthracis has a very low survival rate outside of a host, which is in stark contrast to the
ability of B. anthracis spores to withstand any number of insults from the environment
(Inglesby et al., 2002)

Anthrax is the disease caused by B. anthracis, a ubiquitous soil-dwelling
bacterium found on every continent but Antarctica. B. anthracis spores prefer
environments rich in organic material and calcium with a pH above 6.0 and a temperature
above 155°C (Grabenstein, 2003). Under natural circumstances, the spores can survive
in soil for decades and then infect grazing mammals such as sheep, goats and cattle that
consume grass contaminated with B. anthracis spores. Humans can then become infected
as a result of eating under-cooked meat from an infected animal or from handling animal
products, such as hair, that are contaminated (Pile et al., 1998). There are three forms of
anthrax disease in humans, the most common of which is cutaneous anthrax. A
cutaneous infection involves spores penetrating the skin, usually through a break or
abrasion, and producing localized edema accompanied by the formation of a lesion which
eventually becomes a characteristic black eschar that sloughs off in a matter of weeks.
Cutaneous infections comprise 95% of all human anthrax cases and if lefi untreated can
be fatal up to 20% of the time (Pile et al., 1998).

Gastrointestinal anthrax and inhalational anthrax together account for the
remaining 5% of cases, although the gastrointestinal form is rarely seen. Inhalational
anthrax occurs when B. anthracis spores of a particle size between 1 and 5 pm are

deposited in the lower respiratory tract (Hawley and Eitzen, 2001). The spores are

9.008

 

 

engulfed by macrophages and transported to the lymph nodes where the spores can
remain dormant for weeks, even up to 43 days as observed with one case (Meselson et
al., 1994). Germination and rapid bacterial growth results in expression of large
quantities of toxins and eventually leads to the spread of bacteria in the bloodstream.
Both of these forms are more difficult to diagnose as anthrax-related because the
symptoms produced are nonspecific. Initially the disease presents with flu-like
symptoms, a low-grade fever, mild gastroenteritis, and general malaise. Once the
symptoms become more severe with respiratory failure, septicemia and toxemia, death
usually occurs within 24 hours (Mock and F ouet, 2001; Pile et al., 1998). Currently, there
are several antibiotics used to treat an anthrax infection including penicillin, ciprofloxacin
and doxycycline. However, concerns over antibiotic-resistant strains of B. anthracis have
led to the recommendation that multiple antibiotics be given simultaneously as a
precaution (Inglesby et al., 2002).

The pathogenesis of B. anthracis relies on the presence of two toxins and a
capsule around the bacterium. There are two unique toxin proteins, each of which
interacts with a third protein to comprise two AB subunit toxins. This common binding
protein (B subunit) for the two toxins is called protective antigen and it interacts with the
surface of target cells to mediate entry of the toxins into the cytosol. A second binding
domain of the protective antigen protein is capable of binding either the edema factor
protein or the lethal factor protein (the A subunits) to form edema toxin and lethal toxin,
respectively (Inglesby et al., 2002; Pile et al., 1998). Edema factor acts by both inhibiting
phagocytosis by neutrophils and increasing intracellular levels of cyclic adenosine

monophosphate, which produces the edema associated with the disease. Lethal toxin is a

 

THESIS

33.008

 

zinc metalloprotease that cleaves specific proteins required for intracellular signaling and
disrupts the ability of immune cells to respond to the presence of the bacterium (Turk,
2007). The presence of capsule inhibits phagocytosis and enhances bacterial evasion of
the host immune response. The genes which encode the toxin proteins are all located on
a plasmid called pXOl, while the capsule genes are found on a second plasmid called
pXOZ. For most strains of B. anthracis to be fully virulent, the presence of both plasmids
is required.

There are several strains of B. antlzracis that are used in research. The Ames
strain is a fully virulent strain isolated from a dead cow in Texas in 1981 and is used in
research laboratories around the world (Read et al., 2002). The Vollum strain is another
fully virulent strain, isolated in England, which was used by both the United States and
the United Kingdom in their biological weapons programs (Regis, 1999). Two avirulent
strains that have been cured of one of the toxin plasmids are also used for research
purposes. The Pasteur strain was generated by cultivation at high temperatures, resulting
in loss of the pXOl plasmid (Little and Ivins, 1999). The use of this strain as a vaccine
proved to be much less effective than the use of the Sterne strain, which was isolated in
South Africa and is lacking the pXO2 plasmid. While the Sterne strain is still capable of
producing the toxins, it is unencapsulated, rendering the bacteria avirulent but allowing
the immune system to produce antibodies against the toxin proteins (Mock and F ouet,
2001)

The Sterne strain is still used as a live vaccine in animals and is used frequently in
laboratory experiments on anthrax. The vaccine approved for human use in the United

States is produced by BioPort Corporation in Lansing, Michigan, and is sold under the

2.008

name BioThraX (Grabenstein, 2003). To produce the vaccine an attenuated,
unencapsulated B. anthracis strain is grown in culture and the cell-free filtrate containing
5 to 20 rig/ml of protein is adsorbed to aluminum hydroxide (Grabenstein, 2003).
Unfortunately, the availability is limited, the immunization schedule requires six shots
and the side effects of administration can be severe (Inglesby et al., 2002).

Several epidemics of human anthrax have been documented in the recent past.
One of these occurred in Sverdlovsk, Russia, in 1979, when an accidental explosion at a
military microbiology facility released virulent B. anthracis spores into the air. These
spores were carried downwind and caused at least 66 deaths from inhalational anthrax of
individuals within 4 kilometers of the facility (Meselson et al., 1994). This epidemic is of
particular interest to researchers because it is an example of an airborne release of anthrax
and can be used to model what might occur during a similar bioterrorism event.

Of most recent public interest are the highly publicized attacks in the United
States in September and October of 2001 , where letters containing anthrax spores were
sent to broadcasting companies and to the Hart Senate Building on Capital Hill. A report
by J ernigan et al. (2002) stated that four anthrax powder-containing envelopes were
recovered, all of which had been mailed from Trenton, New Jersey, on two separate
dates. As a result, 22 cases of anthrax were identified. Eleven of these cases were
inhalation and the remaining 11 were cutaneous. Of the inhalational cases, 5 were fatal,
and the majority of cases were in postal workers and individuals working in areas where
they had contact with contaminated mail. Because this was the first anthrax bioterrorism
event to occur in the United States, the scope of the problem presented new challenges.

The first question became how to identify the victims of the attack when there were so

THESIS

1008

 

many locations involved and ensure that they were all linked to the same event. This
meant matching the strains of B. anthracis isolated from the victims to the strains found
in the four recovered envelopes. The second challenge was how to identify and clean all
the locations that were contaminated with anthrax spores. The letters had traveled long
distances and had been processed in mail sorting machines at several postal facilities
along the way. These mail processing centers had to be shut down and decontaminated

along with the areas where the letters were eventually received and opened.

Microbial Forensics

Microbial forensics is an emerging discipline in the field of forensic science with
the 2001 anthrax attacks serving as a demonstration of the need for this area of expertise
(Budowle etal., 2003). The origins of microbial forensics are in molecular
epidemiology, which has been used for many years to trace the source of hospital-
acquired and food-bome infections. The main difference between molecular
epidemiology and microbial forensics is that in forensics the science must withstand the
rigors of legal scrutiny. The goal of microbial forensics is essentially to ‘fingerprint’ a
microbe and determine if a strain used in a particular criminal act is identical to the strain
associated with a suspect. In order to convince a judge or jury of this connection, there is
a requirement for unique characteristics of the strain in question that are not found in
every strain of the species. A set of unique genetic or biochemical markers provides a
stronger link between the strain found at the crime scene and the one in the suspect’s
possession. Finding unique characteristics can be straightforward for some

microorganisms but the high level of genetic monomorphism observed among

2.008

 

 

 

B. antlzracis isolates presents a challenge. Also, the high level of similarity between
B. anthracis and its nearest phylogenetic neighbors, B. cereus and B. thuringiensis, can
make even species identification a challenge.

During a bioterrorism attack, rapid identification of the agent being used is critical
for determining the appropriate course of action. Depending on the agent, treatment of
exposed individuals and decisions about what prophylactic measures to take can be very
different. The three closely related Bacillus species, B. cereus, B. thuringiensis, and
B. anthracis, are so genetically similar that it has been suggested they are actually a
single species (Helgason, 2000). Despite the genetic similarities, the diseases caused by
these three species are dramatically different. B. cereus is most commonly encountered
as a food contaminant that causes food poisoning due to an emetic (vomit inducing) toxin
produced by the bacterium (Valjevac, 2005). It can also be an opportunistic pathogen
found in hospital settings and can cause a number of nonintestinal diseases including eye
and central nervous system infections (Drobniewski, 1993). B. tlzuringiensis is not a
known mammalian pathogen but does produce unique parasporal crystals that are toxic to
several orders of insects including lepidopteron. For this reason, B. thuringiensis is the
most commonly used biopesticide worldwide and is the major pesticide used against
gypsy moths (Schnepf, 1998). The genes for these toxic crystal proteins are encoded on
plasmids which, if lost from the bacterium, results in B. cereus and B. thuringiensis being
indistinguishable from one another (Helgason, 2000). This group undertook a study in
2000 to construct a phylogenetic tree comparing strains from all three Bacillus species
based on the results from multilocus enzyme electrophoresis and DNA sequence

comparisons. The tree produced revealed that B. cereus was the ancestor species from

2.008

 

 

which B. anthracis and B. thuringiensis evolved and that the major differences among the
three species is a result of extrachromosomal DNA found on plasmids.

Recently, many authors have published methods to distinguish B. antlrracis from
its closest relatives to make species identification more rapid and specific. Initially, real-
time PCR assays were developed using primers and probes targeting the protective
antigen gene on the pXOl plasmid and one of the capsule genes on pX02 (Bell, 2002).

It is known that B. anthracis requires the presence of at least both plasmids to be fully
virulent, so an assay which can detect the plasmid—encoded virulence genes and report on
the plasmid content of the strain is important. Despite the use of plasmid content as a
diagnostic marker, it has also been demonstrated that plasmid transfer among the three
Bacillus species is possible (Green, 1989). Transfer could occur naturally in the soil
where different Bacillus species coexist or could result from bioengineering that inserts
the virulence plasmid(s) into B. cereus. While the resulting strain may look like B.
cereus, it may act more like B. anthracis or lose its responsiveness to the vaccines or
drugs used to treat B. anthracis infections. For this reason, there is a push to find unique
chromosomal markers for B. anthracis that complement the plasmid markers. A study by
Q1 et al. (2001) developed a real-time PCR assay using the rpoB gene, which encodes the
B-subunit of RNA polymerase, to successfully identify 144 different strains of B.
anthracis while only cross-reacting with one of 175 background bacterial strains tested.
The gyrA gene has also been studied and sequence comparisons revealed six nucleotide
differences between B. anthracis and two strains of B. cereus (Hurtle et al., 2004). In
their study, a real-time PCR assay was used that employed an oligonucleotide probe with

a chemical conjugate that binds in the minor groove of the DNA helix. These minor

 

THESIS

9.008

 

 

 

groove binding probes are able to form more stable complexes with target DNA than
conventional TaqMan probes, allowing minor groove binding probes to be significantly
shorter. The increased melting temperature of these conjugated oligonucleotides
combined with their shorter probe length allows for greater sensitivity, which is ideal for
detecting single nucleotide differences. A probe was designed around one of the
identified differences in the gyrA gene and in a blind study of 105 samples, all of the B.
anthracis samples were correctly identified, with no false positives. Another gene, plcR,
acts as a transcriptional activator in both B. cereus and B. thuringiensis but contains a
nonsense mutation in B. anthracis and is inactive. This mutation is believed to be a
stable mutation found within the B. anthracis species and has been exploited as a B.
anthracis—specific marker by Easterday et a1. (2005). In their study, minor groove
binding probes were again used in a real-time PCR assay to show that 89 diverse strains
of B. anthracis contained the nonsense mutation and confirmed that the alternate allele
was present in 18 near-neighbor strains, demonstrating the mutation is B. anthracis-
specific. In addition to PCR-based assays using known genes, the technique of
subtractive DNA hybridization has been used to successfully identify previously
uncharacterized regions of the B. anthracis genome that are unique. A multiplex PCR
assay developed by Radnedge et al. (2003) targeted four loci which were identified as B.
anthracis-specific by subtractive hybridization and demonstrated that these loci were
amplified from all of the B. anthracis strains tested but not from 10 closely related
species. Bode et al. (2004) also used subtractive hybridization to locate unique
chromosomal targets in B. antlzracis and demonstrated that one region, with homology to

an abhydrolase, was present in all B. anthracis strains tested but absent from a panel of

 

1038

 

 

 

 

76 closely related microorganisms. Their work showed the power of a rapid real-time
PCR assay to sensitively and specifically identify B. anthracis.

Once the species determination has been made, the next step in a bioterrorism
scenario is the ‘fingerprinting’ or strain determination that involves subtyping the
bacterial isolates. This is a critical process for both epidemiological and forensic reasons.
In the 2001 attacks, because there were simultaneous infections spread out over a large
geographic distance, the question of whether the incidents were related became very
important. Also, from a forensics point of view, being able to correctly identify the strain
used and link that strain to a suspect is helpful for a successful prosecution.

B. anthracis is one of the most genetically monomorphic species that has been
characterized. This is possibly due to the life cycle of this spore-forming organism, with
the majority of the time spent in a dormant spore state where DNA replication and
mutation are not occurring at the same rate as for other bacterial species (Keim et al.,
2004). Methods of subtyping which have worked for other species have failed to
differentiate strains of B. anthracis. Henderson et al. (1994) found that the restriction
fragmentation of genomic DNA from 38 B. anthracis strains produced identical profiles
with 18 different restriction enzymes. A similar study used pulsed-field gel
electrophoresis (PF GE) and sequencing of the intergenic spacer regions between the 16S-
23S rDNA genes and the gyrB-gyrA genes to compare strains. PF GE is the methodology
currently being used by the Centers for Disease Control to subtype E. coli strains during
outbreaks of food-borne disease to separate cases which are part of the outbreak from
sporadic incidents. However, the research by Harrell et al. (1995) showed identical

PF GE patterns and intergenic sequences for all strains of B. anthracis tested. Another

10

 

9.0 9%

 

technique for subtyping bacterial strains, which is becoming more popular, is multilocus
sequence typing (MLST) where the sequences from seven housekeeping genes are
compiled to produce the sequence type for a strain (Helgason et al., 2004). When MLST
was performed on five strains of B. anthracis they were all categorized into the same
sequence type and could not be separated (Helgason et al., 2004).

Several other techniques have also been attempted for subtyping B. anthracis
isolates with limited success. Sequencing of the protective antigen gene (pag) from 26
different strains revealed six genotypes. However, this was after sequencing over 2,000
bases to find only five base pair differences among the strains (Price et al., 1999).
Amplified fi'agment length polymorphism (AF LP) is a technique which combines
restriction enzyme digestion with PCR amplification. Genomic DNA is first digested
with a single restriction enzyme to produce fragments with the same nucleotide overhang
on each end. Nucleotide adapters are then ligated to the ends of the fragments. PCR
primers specific for the sequence of the adapters with arbitrary nucleotides added to the
3’ end are used to selectively amplify a subset of the fragments. These fragments are
then electrophoresed on a polyacrylamide gel which has the resolution to identify
fiagments with lengths varying by as little as a single base pair. The patterns generated
with the PCR amplified fragments can be compared among many strains of a bacteria to
locate genomic regions that vary. Keirn et al. (1997) analyzed 1,221 AF LP fragments
across 79 B. antlzracis strains and found that 97% of them were monomorphic. They
were able to identify 31 polymorphic fragments though and sequenced these to determine
why these regions exhibited polymorphisms. Sequence data revealed that some of these

regions contained repetitive nucleotide sequences that varied among strains in the number

11

 

23.0 9%

 

of repeats. Several of these regions were selected for use in the more powerful and
discriminating technique of multi-locus variable-number tandem repeat analysis
(MLVA).

With the information obtained from their previous AF LP analysis, Keim et al.
(2000) developed a set of 8 loci containing variable-number tandem repeats into their
MLVA assay. Tandem repeats of nucleotides are regions where errors in DNA
replication more frequently occur and the loss or addition of a repeat unit can happen due
to slip-strand mispairing (Lindstedt, 2005). MLVA analysis determines the number of
repeats at each locus and combines this information across all loci to discriminate among
bacterial strains. Of the 8 loci chosen for MLVA by Keim et al., five were discovered
from chromosomal fragments in the AF LP assay, two were from sequence data of the
toxin plasmids pXOl and pX02, and the eighth was a previously characterized
chromosomal locus (Andersen et al., 1996). The primers for the loci were fluorescently
labeled and were designed to amplify the regions with slightly different amplicon sizes
ranging from 120 up to nearly 700 base pairs so they could be separated on a single gel
for analysis. The repeat sizes within the loci varied from 2 to 36 nucleotides and the
number of alleles observed at the various loci ranged fi'om 2 at the CG3 locus up to 9 in
the pX02 marker. When this method was employed, Keim et al. were able to subtype
426 B. anthracis strains into 89 different genotypes. Because this method was so robust
and was able to distinguish 89 genotypes within the B. anthracis species, it was selected
to subtype the 135 isolates fiom the 2001 anthrax outbreak (l-Ioffmaster et al., 2002).
Results from the MLVA analysis revealed that all of the isolates belonged to the same

genotype as the Ames strain and thus the same strain could link all of the independent

12

 

 

2908

 

 

incidents. They were also able to determine that two isolates submitted externally, one
from a different state and one from a different country, were not the genotype of the
Ames strain and could be excluded from the outbreak.

More recently, due to the increasing power of molecular technologies, the use of
single-nucleotide polymorphisms (SNPs) and single-nucleotide repeats (SNRs) has been
proposed for B. anthracis subtyping. So-called canonical SNPs have been developed for
use in identifying specific phylogenetic branches of the B. anthracis species because they
are evolutionarily stable (Keim et al., 2004). Locating a single SNP that defines a clade
or evolutionary group of strains is useful as an initial broad analysis of an isolate. A real-
time PCR SNP assay has been developed using a set of 6 SNPs, 4 chromosomal and 2 on
the toxin plasmids, that are specific for the Ames strain (Van Ert et al., 2007). Because
SNPs are stable genetic markers, they are helpfiil in broad strain identification but less
usefirl in an epidemiological outbreak situation where isolates of the same strain need to
be differentiated. For this purpose, the best marker is a SNR because they have a much
higher mutation rate due to slip-strand mispairing during replication (Keim et al., 2004).
Because B. anthracis has a low baseline genomic mutation rate, it is necessary to use a
marker with a higher likelihood of changing in one generation. However, SNR markers
may mutate too frequently in other, less monomorphic, bacterial species and may not be a
suitable subtyping method for those species. Stratilo et al. (2006) used 22 SNR loci and

were able to distinguish strains of B. anthracis that were all of the same MLVA

genotype.

l3

THESIS

1008

 

 

 

Decontaminating agents

A spore is composed of several highly ordered outer layers that protect the
bacterium while it is dormant in the soil. The core is the innermost part containing the
DNA, RNA, enzymes and ions necessary for survival and successful germination of the
spore. In the dormant state the spore is enzymatically inactive and DNA repair is not
possible so prevention of DNA damage is critical. This is the role of the unique a/B-type
small, acid-soluble proteins (SASP) that complex with the outside of the DNA helix and
serve to decrease the reactivity of DNA with damaging or denaturing chemicals
(Nicholson et al., 2000). The core is protected from the inside out by the germ cell wall,
the cortex, the spore coat and finally the exosporium (Setlow, 1995). These external
layers along with the cr/B-type SASPs present a formidable defense against a number of

insults including heat, ultraviolet radiation, and chemical agents.

Figure 1. Diagram of a B. anthracis spore.

-. u
.......

   

DNA and
Ribosomes

 

9.008

There are currently a large number of chemicals that have been proven to
effectively kill bacteria and viruses. However, the number of chemicals shown to be
effective for use against bacterial spores is limited. A recently published review article
by Sports-Whitney et a1. (2003) thoroughly compiled all the studies that have been
performed since 1930 on chemicals with sporicidal activity. The authors reported several
problems with the available data. While there has been much research performed in this
area, the studies were difficult to compare to one another because there were too many
variables among the studies, such as concentrations of chemicals and both the
temperature and pH at which they were used. It was also noted that the majority of the
studies used Bacillus species other than B. anthracis, which presents a problem if these
laboratory conditions are going to be used in a real-world decontamination situation
because the chemicals may not react with B. anthracis spores with the same kinetics.

The experimental conditions also varied dramatically, as some studies used spore
suspensions while others used spores dried on surfaces, and the initial concentration of
spores present was not consistent.

The use of formaldehyde both in solution and as a vapor has been shown to be
effective for spore decontamination in some circumstances. Cross and Lach (1990)
treated B. globigii spores with formaldehyde vapor, at a concentration of 400 mg/m3 and
98% relative humidity and were able to produce 100% inactivation of 109 spores after 3.5
hours. Their data suggested that the effectiveness of formaldehyde vapor increased with
greater relative humidity and over 80% humidity was generally needed to produce
optimal inactivation. In studies using formaldehyde solutions, Rubbo et al. (1967) used a

4% solution on 108 B. anthracis spores in suspension and achieved 99.99% inactivation

15

210 0‘28

after 2 hours, while Sagripanti and Bonifacino (1996) used an 8% solution for 30 minutes
against 109 B. subtilis spores and were unable to produce more than 10% spore
inactivation.

There was also a non-laboratory use of formaldehyde to inactivate B. antliracis
spores on Gruinard Island in Scotland (Manchee et al., 1994). The island was used
during World War II by the British to detonate biological weapons containing
B. anthracis spores and evaluate their potential use. Sheep were tethered downwind of
the detonation site to determine the effectiveness of the airborne spores in producing
disease. As a result of the tests, the island became heavily contaminated with spores and,
based on soil samples taken annually from 1946 to 1969, it was determined that the island
would remain measurably contaminated into the 21St century (Manchee et al., 1994). A
5% formaldehyde solution diluted in seawater was applied to the island with each square
meter receiving 50 liters of solution. Two months later soil samples were collected and
95% of the areas sampled were no longer contaminated.

The mechanism of action for formaldehyde is believed to be its chemical
reactivity and its ability to penetrate the spore coat. Formaldehyde cross-links protein,
RNA, and DNA and is also a suspected human carcinogen (Spotts-Whitney et al., 2003;
Sykes, 1970). This is a concern when using formaldehyde as a decontaminating agent.
In addition, the demands of relative humidity and maintained vapor concentrations may
be difficult to employ in a large building. Paraforrnaldehyde, which produces
formaldehyde gas when vaporized, is currently approved as an emergency anthrax
decontaminating agent by the Environmental Protection Agency (EPA) (US.

Environmental Protection Agency, 2007C).

16

Glutaraldehyde is similar to formaldehyde but has demonstrated a much higher
sporicidal activity. The standard concentration that has been shown to be most effective
is a 2% solution of glutaraldehyde buffered to a pH near 8.0 with sodium bicarbonate
(Borick et al., 1964). The alkaline formulation was superior in performance to an
unbuffered 4% formaldehyde solution and was able to produce 99.99% killing of spores
in 15 minutes compared to the 2 hours necessary for formaldehyde (Rubbo et al., 1967).
However, several additional studies since that time have failed to reproduce this success.
Sagripanti and Bonifacino (1996) found that 2% glutaraldehyde exposure for 30 minutes
produced inconsistent killing of spores. Several other studies showed that between 2 and
3 hours of treatment was required to kill 100% of spores (Scott and Gorman, 2001). One
potential drawback is that glutaraldehyde at an alkaline pH is not stable and sporicidal
activity decreases with the age of the solution (Sagripanti and Bonifacino, 1996). The
mechanism of action of the chemical is penetration into the spore coat and reaction with
amino acids and nucleotides (Russell, 2001). Glutaraldehyde is also known to have toxic
properties including being a respiratory and dermal irritant, which is a drawback when
using the chemical in a confined space such as a building (Scott and Gorman, 2001).

Peroxygen compounds include hydrogen peroxide, which has been studied as
both a liquid and gaseous sporicide, and peracetic acid, which is most commonly used as
a liquid. There are currently four commercial compounds approved for use by the EPA
that are mixtures of hydrogen peroxide and peracetic acid, as well as one commercial
product that contains only hydrogen peroxide (U .S. Environmental Protection Agency,
2007B). In a study performed by Baldry (1983) on both spore suspensions and spores on

carriers, peracetic acid exhibited much stronger sporicidal activity than hydrogen

l7

 

filo-98

 

 

 

peroxide. With a spore suspension, 0.13 mol/L of peracetic acid produced 100% killing
in less than 30 minutes while it took 3 hours exposure at 0.88 mol/L of hydrogen
peroxide to have the same effect. In a separate comparison study, a 0.03% peracetic acid
solution inactivated over 99.9% of spores in 30 minutes while a 10% solution of
hydrogen peroxide inactivated less than 90% of spores present (Sagripanti and
Bonifacino, 1996). Hydrogen peroxide gas has also been tested against spores on a
variety of porous and non-porous surfaces and was found to be less effective on the
porous surfaces such as carpet and pine wood (Rogers et al., 2005). Hydrogen peroxide
is considered to be less toxic than other decontaminating agents since its breakdown
products are oxygen and water. Peracetic acid breaks down into acetic acid, hydrogen
peroxide, oxygen and water but at concentrations above 1% in solution is a known tumor
promoter (Bock et al., 1975). The mechanism of action is considered to be similar for the
two chemicals because they both contain highly reactive free hydroxyl radicals which can
damage the spore coat and cleave the backbone of DNA (Russell, 2001).

Sodium hypochlorite, which is the active ingredient in bleach, is also approved by
the EPA for emergency treatment of anthrax spores. Bleach has a pH of 12 and studies
have shown that the maximum sporicidal effect occurs when the bleach has been diluted
in water to increase the level of free available chlorine and the pH has been adjusted to
neutral with acetic acid (Sagripanti and Bonifacino, 1996). According to the EPA
guidelines for using bleach as a decontaminant, only hard surfaces should be treated and
the surface must remain in contact with a 10% bleach solution for a minimum of 60
minutes (US. Environmental Protection Agency, 2007A). The disinfecting properties of

hypochlorite have been known for decades and have both commercial and industrial uses

18

2.00%

 

 

(Dychdala, 2001). The reactivity of hypochlorite results from the release of chlorine into
the solution and the level of activity is dictated by the amount of free available chlorine in
solution. A study by Sykes (1970) showed, using a suspension of 4x105 B. subtilis
spores, exposure to 100 parts per million (ppm) of available chlorine killed 90% of the
spores in 5 minutes and exposure to 1000 ppm killed 100% of spores in 30 seconds.
Other studies have used sodium hypochlorite solutions without determining the exact
concentration of free chlorine, which makes comparisons among studies difficult.
Sagripanti and Bonifacino (1996) used 0.5% sodium hypochlorite and were able to kill
99.9% of a 108 suspension of B. subtilis spores after 30 minutes. Chlorine ions in
solution act as strong oxidizing agents capable of inactivating metabolic enzymes
necessary for bacterial survival, combining with cell membrane proteins, altering cellular
metabolism, and damaging DNA (Dychdala, 2001). Because chlorine-containing
disinfectants are commonly used in homes, schools, hospitals and in water treatment
plants, they are often selected as a decontamination standard to which other agents can be
compared.

Other methods of inactivating spores have included heat, either moist or dry, at
temperatures ranging from 90 to 200°C, as well as ultraviolet (UV) or gamma radiation.
Heat sterilization is a very effective method; however, from a practical standpoint, it
cannot be used if the spores are on a material that cannot withstand those extreme
temperatures. UV radiation as a means of spore inactivation requires a large dose for an
extended period of time because of the nature of the a/B-type SASPs and the many spore
coat layers which protect it from naturally occurring UV radiation (Nicholson et al.,

2000). Gamma radiation has successfully been used to kill spores on goat hair and was

19

used to decontaminate all of the mail from the postal facilities impacted by the 2001
anthrax attacks (Spotts-Whitney et al., 2003).

Each method of decontamination has its own drawbacks. The use of gaseous
compounds generally requires maintaining a proper relative humidity. In addition, some
of the gases do not penetrate well into different surfaces and may be flammable. Many of
the chemical agents approved for use are toxic to humans and some are potentially
carcinogenic. Some chemicals are corrosive to metals or have other unwanted properties.
Also, the presence of organic material can substantially reduce the effectiveness of some
chemical agents by either protecting the spore or absorbing the chemical (Spotts-Whitney
et al., 2003). It is important to note that the mechanism of killing for almost all of these
decontaminating agents is through damage to the DNA, whether it is from breaks in the
backbone, alkylation or cross-linking of bases, or adjunct formation caused by high
energy radiation. Depending on the severity of damage to the DNA, the use of standard
molecular biology techniques such as PCR amplification and DNA sequencing may be
inhibited. These techniques are essential in all of the previously described methods for
performing species identification and forensically subtyping B. anthracis strains during a

bioterrorism event.

Goals of the study

The demonstrated need for sporicidal agents that are able to kill effectively in a
short amount of time while being safe for humans has prompted research into the field of
decontaminating agents. One such product, Mandala PDS Formula 1, has been

developed by Mandala Technologies, LLC. This study involved two components: 1)

20

1008

 

 

 
 

analysis of the ability of Formula 1 to inactivate spores on a variety of surfaces and 2)
testing the decontaminated surfaces for forensic typing of the bacterial strain involved.
To accomplish this, the first goal was to determine the efficacy of the novel
decontaminant against the spore-forming bacteria Bacillus atrophaeus, a commonly used
simulant of B. anthracis. It was hypothesized that following treatment of Bacillus spores
with this novel compound under conditions producing complete spore inactivation,
sufficient intact DNA could be recovered by amplification for forensic typing purposes.
To demonstrate the feasibility of this novel treatment and DNA recovery procedure in a
real-world bioterrorism situation, sporicidal activity studies were also performed on B.
antliracis spores deposited on a variety of surfaces including paper, carpet, and wood,
and recovered and amplified DNA from these surfaces as would be performed in a

forensic investigation.

21

 

9.008

 

 

MATERIALS AND METHODS

Bacterial strains and growth conditions

The Bacillus strains used in this study were B. atrophaeus (ATCC 93 72), a non-
pathogenic Bacillus species frequently used as a simulant of B. anthracis, and
B. anthracis Sterne 34F 2 strain (Sterne, 1937), a highly attenuated strain containing the
toxin plasmid pXOl and missing the capsule plasmid pX02. B. atrophaeus was cultured
in tryptic soy broth (TSB; Difco Laboratories, Detroit, Michigan) or on tryptic soy agar
(TSA) plates at 32°C. B. anthracis was cultured in brain heart infusion (BHI; Difco)
broth or on TSA plates at 32°C. All work with B. anthracis was performed in a Sterigard
biosafety cabinet (The Baker Company, Inc., Sanford, Maine) to control and minimize
exposure to aerosolized spores.

Bacterial strains used in the primer specificity assays included Staphylococcus
aureus (ATCC 29213), Escherichia coli (ATCC 25922), Enterococcus faecalis (ATCC
29212), and Pseudomonas aeruginosa (ATCC 27853). All were cultured in TSB and

incubated at 37°C.

B. anthracis endospore preparation

Spores from the B. anthracis Sterne strain were provided by Dr. Stephen
Cendrowski, Michigan State University. A single colony of B. anthracis was used to
inoculate BHI broth containing 0.5% glycerol, which was incubated overnight at 37°C
shaking at 225 rpm. This culture was seeded into a sporulation medium (described as

‘modified G’ by Kim et al., 1974) at a dilution of 1:24 and incubated in a baffled

22

 

9.008

 

Erlenmeyer flask for 72 hours at 37°C, shaking at 325 rpm, until mature endospores
dominated over vegetative cells. Spores were pelleted by centrifugation and resuspended
in 40 mls of filter-sterilized double-deionized water. The centrifugation and wash steps
were repeated 3 additional times with a vegetative cell heat-inactivation step performed
for 30 minutes in a 65-70°C water-bath prior to the final centrifugation. The spore pellet
was resuspended in 1 ml of filter-sterilized double-deionized water and four additional
washes were performed, with a second heat-inactivation prior to the final centrifugation
step. The purity of the preparation was checked microscopically to verify that vegetative
cell forms had been adequately reduced and that 2 95% endospores were seen. Viable
spore counts were performed and the preparation was determined to contain an average

of 2.4x109 spores per ml.

Decontaminating agents

Mandala PDS Formula 1 (Formula 1) was prepared fiom stock solutions
according to the manufacturer’s instructions (Mandala Technologies, LLC, F armington
Hills, Michigan) (Awad, 2006). Stock solution 1 was made by dissolving 115.13 g of
lauric acid (assay 99.6%) Kosher flakes (KIC Chemicals, Inc., Armonk, New York) in
ethyl alcohol ACS spectrophotometric grade (190 proof) (Sigma-Aldrich Inc., St Louis,
Missouri), to a final volume of 500 ml. Stock solution 2 was made by dissolving 250 g of
potassium hydroxide (assay 90%) pellets (N .F .-F.C.C. grade, J .T. Baker Inc.,
Phillipsburg, New Jersey) in deionized water to a final volume of 500 ml. To prepare
100 mls of Mandala PDS Formula 1, the following were added to a 100 m1 mixing bottle

in sequential order: 43.5 ml of stock solution 1; 33 ml of ethyl alcohol; 12.3 ml of

23

9.008

 

 
 

 

deionized water; and 11.2 ml of stock solution 2. The mixture was shaken for 30 seconds
and allowed to sit for 1 minute for the air bubbles to disappear prior to being used. The
pH of Mandala PDS Formula 1 is 14.84.

The guidelines set forth by the EPA on the use of bleach to decontaminate anthrax
were followed (US. Environmental Protection Agency, 2007A). Sodium hypochlorite
6% (commercial Clorox, The Clorox Company, Oakland, California) was diluted with
sterile water to a final concentration of 10% (v/v) and glacial acetic acid was added at a

final concentration of 10% (v/v) to make the activated bleach solution.

Quantitative killing assays

For quantitative killing assays, stainless steel disks inoculated with 2x106
B. atrophaeus spores were purchased from SGM Biotech, Inc. (Bozeman, Montana).
Disks were completely submersed in 10 mls of the liquid decontaminants in 15-ml
conical tubes. Formula l-treated disks were exposed for 5, 10, 15, 20, 25 and 30 minutes
in triplicate for each time-point. Three disks were exposed to activated bleach for 60
minutes as a positive killing control and three disks were exposed to sterile water for 30
minutes as a positive spore viability control. Disks were blotted on sterile filter paper to
remove excess treatment and the spores were removed from the surface of the disk
following the manufacturer’s instructions. Briefly, the disks were transferred to flat-
bottom tubes containing four glass beads and 5 mls of 0.1% Tween 80 solution. The
amount of treatment transferred with the blotted disks was less than 100 111, and this 50—
fold or greater dilution both effectively diluted the active ingredients to an inactive

concentration (M. H. Mulks and A. C. Awad, personal communication) and neutralized

24

 

THESIS

Z10 '3 8

 

 

 

the alkaline pH of Formula 1. The tubes were sonicated for 5 minutes in a Branson
Model 2510 Ultrasonic Cleaner (Danbury, Connecticut), and then vortexed on medium
speed for 5 minutes. Five mls of sterile double-deionized water were added and the tubes
were vortexed an additional 5 minutes before being heat shocked at 82°C for 10 minutes.
The suspension was vortexed for 10 seconds, five serial lO-fold dilutions were made, and
100 111 from each dilution was plated on triplicate TSA plates. The plates were incubated

at 32°C and colonies were enumerated daily for 6 days.

Qualitative killing assays

To determine appropriate exposure times necessary to achieve complete killing of
B. anthracis spores on different surfaces, qualitative killing assays were performed with
each of five different carriers: stainless steel, glass, paper, wood, and carpet. Carriers
made of five surfaces representing materials that might be present in an office building,
including both porous and non-porous surfaces, were selected. Stainless steel disks
measuring 0.8 cm in diameter and sterile paper carriers measuring 3 cm x 0.5 cm were
purchased (SGM Biotech). Commercially available clear window glass was obtained and
cut using a glass cutter into roughly 1 cm x 1 cm pieces. Untreated, commercially
available, wood dowel was obtained and cut with a circular saw into disks 1.2 cm in
diameter and 0.5 cm thick. A carpet sample made of an unknown synthetic fiber was
purchased from Menard, Inc. (Madison, Wisconsin) and cut with a box cutting tool into
roughly 1 cm x 1 cm square pieces. The carriers were sterilized in an autoclave at 121°C
for 30 minutes. The stainless steel disks and glass pieces were cleaned with ethanol prior

to being autoclaved.

25

 

9.093

 

 

 

Qualitative killing assays were performed separately for each surface but were
done in the same manner. Briefly, each sterile carrier was spotted with 10 pl of a
B. anthracis spore suspension containing approximately 2x108 spores per m1, resulting in
2x106 spores per carrier. The carriers were allowed to air dry at room temperature for 4
hours. Carriers were placed in scintillation vials containing 10 mls of the liquid
decontaminating agents, and were completely submersed in the treatment liquid. Two
carriers, wood and carpet, floated to the surface and were inverted in solution to ensure
the side inoculated with spores was surrounded by liquid. Formula l-exposed carriers
were treated for 30, 60, and 120 minutes in triplicate for each time-point. After exposure,
the carriers were removed, blotted on sterile filter paper to remove any excess liquid, and
placed in a 50-ml conical tube containing 10 mls of BHI broth. As in the quantitative
killing assays, the amount of treatment transferred with the blotted carriers was generally
less than 100 111, and this lOO-fold or greater dilution both diluted the active ingredients to
an inactive concentration and neutralized the alkaline pH of Formula 1. Because of the
nature of carpet fiber, a significant amount of liquid was retained in the carpet carriers, so
an additional drying step was required to prevent carry-over of treatment liquid into the
broth. These samples were dried in an air vacuum for one hour before being placed in
broth. Three carriers were exposed to activated bleach for 60 minutes as a positive
killing control and one carrier was exposed to sterile double-deionized water as a positive
spore viability control. Three sterile, uninoculated carriers were exposed to sporicide for
120 minutes as controls for any changes in color or turbidity not related to the presence of
spores. Three sterile, uninoculated carriers not exposed to treatment liquid were placed in

BHI broth to ensure that no growth occurred from the carrier alone. The conical tubes

26

TEES?!

210-98

 

were shaken and then placed in a 32°C incubator for 14 days. The tubes were monitored
daily for qualitative signs of turbidity and active growth. After 14 days, 100 pl of broth
from each conical tube was plated on a TSA plate, incubated at 32°C overnight, and

checked the next day for growth to verify the qualitative assessments.

DNA amplification by polymerase chain reaction

The same optimized PCR reaction mixtures and PCR cycling parameters were
used with a GeneAmp 9700 thermocycler (PE Biosystems, Foster City, California) for all
DNA amplifications performed with both B. atrophaeus and B. anthracis. A 50 pl total
reaction volume contained 5 pl of 10X PCR buffer (Invitrogen, Carlsbad, California),
2.25 mM MgC12, 10 pmol of each primer, 0.16 mM of each dNTP, 2% formamide, 1.5 U
of Taq DNA Polymerase (Invitrogen), and 2 pl of sample containing template. An initial
extended denaturing step at 94°C for 10 minutes served as a lysis step to release DNA
from intact spores into solution (Makino et al., 2001). This lysis step was followed by 35
cycles of denaturing at 94°C for 15 seconds, primer annealing at 62°C for 30 seconds,
and extension at 72°C for 1 minute, with a final 7 minute 72°C extension. Following
amplification, 25 pl of the 50 pl total PCR reaction volume was electrophoresed on a
1.2% agarose gel. The gel was stained with 0.7 pg/ml ethidium bromide and bands were
visualized with ultraviolet light using a BioDoc-It System from UVP, Inc. (Upland,

California).

27

 

9.09?

 

 

Design of primers for PCR assays

Sequences of all primers used in this study are shown in Table 1. The sequences
for the gyrA gene from B. atrophaeus, and three B. anthracis strains (Ames, Ancestor
Ames, and Sterne) were downloaded from GenBank and aligned using the MegAlign
program which is part of the Lasergene software package from DNASTAR, Inc
(Madison, Wisconsin). Highly conserved regions were located and primers designed
from these regions for use with B. atrophaeus (gyrAl and gyrA2). These primers were
redesigned for use with B. anthracis (gyrA3 and gyrA4) by modifying the bases which
differ between B. atrophaeus and B. anthracis so that the primers were specific for
B. anthracis.

For the 16S rRNA gene, data available through the Ribosome Database Project at
Michigan State University were used to design a reverse primer specific for
B. atrophaeus, designated 8A]. This primer was redesigned to form primer BA2,
specific for B. anthracis, by modifying the bases which differed between B. atrophaeus
and B. anthracis and by extending the primer by two bases to equalize the annealing
temperatures, as calculated using the PrimerSelect program in the LaserGene software
package. A previously published universal 16S rRNA forward primer, UP927 (Amann et
al., 1995) was chosen. A second forward primer, UP520, was designed based on the
location of another universal 16S rRNA primer (Amann et al., 1995), but modified to
match the 16S sequences from both B. atrophaeus and B. anthracis.

Two previously described primer pairs for genes located on the pXOl plasmid

were also used for analysis of B. anthracis: pagAl and pagA2, which are specific for the

28

9.008

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

«DEE .m was mamgmgm .m gauges 6&6 35 823 828%": Odom...
88: .3 a osmium oefiooofiooficooege 825% .m NE
885 ..a a snag <<eofio<eeooo<<oe<e<wo m8 Magus. .m :2 E
6%: a e sass. oe<<o<oooeoe<<e<oooe masses .m mama
$8; a 3 Omega oooo<oooto<<oe<<o<o ts messes. .m Emma w e
seam may co<E<o<oe<eEcoo<<o<o 885% .m 2m
seam “Eh “SE/258800505 a? 838m 82:
as... was oo<fi<o<oe<eEooo<<o<o wages .m ~<m
a3: a a 2%.... ecooo<<o<oooooooo EM E83 895
seam fie ooofi<ceoeuE<o<o<<o msmlmqmoem .m Ed
as“ we: o§<<eooooooo<oe<o E sang 82:
seam afi cowfi<oeoeoet<c<o<<o magmas... .m Em
G8: a s 538.... Hoooo<<o<oooooooo mom Eves R95 <zx. m2
as“ afi ooe<eeer<<oEoofl<floeo 885% .m sea
seam afi 8H<0H5eeooe<e<fioo Em assess .m 2%..
as“ afi oozfiogiofiootfitego SEES .m 23w
as: afi ocw<omhotoee<e<fioo Em segmosm .m 2;» Eu
oocsom £30 cocoaow Aha :4”qu 80:95.. 858 m 5.5.5 3604

 

 

be: a... 5 e8: 22:5 a use...

29

1008

 

protective antigen gene, and lefl and 1e12, which are specific for the lethal factor gene

(Ramisse, 1996).

Sensitivity of B. atrophaeus-specific primers with spores

Paper carriers inoculated with B. atrophaeus spores were purchased (SGM
Biotech). Spores were removed from the surface of the paper carrier following the
manufacturer’s instructions. Briefly, each paper carrier was placed in a flat-bottom glass
tube containing 4 glass beads and 5.0 mls of sterile double-deionized water. The tube
was vortexed for 5 minutes and the paper carrier was macerated to a pulp. An additional
5.0 mls of sterile double-deionized water was added to the tube and the mixture was
vortexed for 30 more seconds. The macerated paper suspension was heat shocked at
80°C for 10 minutes and then cooled rapidly in an ice bath. Five serial lO-fold dilutions
of the initial spore suspension were made in sterile double-deionized water, plated in
triplicate on TSA, and incubated at 32°C overnight. Colonies that grew on the dilution
plates were counted and averaged to determine the spore concentration in each dilution
and calculate the concentration of the initial spore suspension. The procedure was
repeated for each spore sensitivity assay to normalize the number of spores added to each
PCR reaction. Two pl from each of the serial dilutions was used as template in PCR
reactions with the three B. atrophaeus-specific primer pairs, and the products analyzed by

gel electrophoresis.

30

1008

 

 

Sensitivity of B. alrophaeus-specific primers with vegetative cells

A single colony of B. atrophaeus grown on TSA was suspended in 5.0 ml of TSB
in a 15 ml polypropylene tube. For each experiment, two 5.0 ml cultures were incubated
overnight at 32°C without shaking and were combined into a single tube the following
day. Eight serial 10-fold dilutions of the culture were made in TSB, plated in triplicate
on TSA, and incubated at 32°C overnight. Colonies were counted and averaged to
calculate the bacterial cell concentration in the initial culture and the subsequent
dilutions. This procedure was repeated for each vegetative cell sensitivity assay to
normalize the number of bacteria added to each PCR reaction. Two pl from each serial
dilution was used as template in PCR reactions with the five B. anthracis—specific primer
pairs. Following amplification, PCR products were analyzed by agarose gel

electrophoresis as described above.

Decontamination and DNA recovery experiments

To determine whether bacterial DNA could be detected on spore-contaminated
surfaces after decontamination with the sporicide, stainless steel disks coated with 2x106
B. atrophaeus spores and paper carriers with 1.6x107 spores (SGM Biotech) were treated
with 10 ml sporicide or water for 30 minutes or with activated bleach for 60 minutes,
following the procedures described for quantitative killing studies. Activated bleach was
used as a negative control for the PCR reactions, since bleach destroys nucleic acid.
Sterile double-deionized water was used as a positive control for the PCR reactions
because water does not inactivate spores or damage DNA. Following treatment the

carriers were removed from solution and blotted on sterile filter paper to remove any

31

1008

 

 

 

excess liquid. Each carrier was swabbed with a cotton-tipped applicator and the
applicator tip was placed in 500 pl of sterile double-deionized water, hand-mixed for 30
seconds, pressed against the side of the tube to elute the liquid, and discarded. Two pl of
the sample was used as template in PCR reactions with the three pairs of B. atrophaeus—
specific primers. Following amplification, 25 pl of the total 50 pl PCR reactions were
electrophoresed on a 1.2% agarose gel and stained. In each experiment, each treatment
was performed in duplicate. A minimum of three replicates of each experiment was
performed.

Qualitative killing assays were used to determine the required exposure time to
kill B. anthracis spores on each of the five carrier surfaces. Stainless steel, paper, glass,
and carpet carriers were exposed to sporicide for 60 minutes. Wood carriers required an
exposure time of 2 hours to ensure that all B. anthracis spores had been killed.
Decontaminated carriers were sampled by swabbing with a cotton-tipped applicator, and

samples were tested for recovered DNA by PCR as described above.

Scanning electron microscopy

Metal disks coated with 2x106 B. atrophaeus spores were treated with either the
sporicide or water for 30 minutes as described above. Treated disks, as well as the
untreated control disks, were fixed with paraforrnaldehyde/glutaraldehyde (2.5% each) in
0.1M sodium cacodylate buffer, pH 7.4 (Electron Microscopy Sciences, Hatfield,
Pennsylvania), for 2 hours. The samples were rinsed for 15 minutes in 0.1M sodium
cacodylate buffer, pH 7.4, and dehydrated using a graduated ethanol series (25%, 50%,

75%, 95%, 100%, 100%, 100%), for 5 minutes at each concentration. The disks were

32

to o

 

 

dried using a critical point dryer (Balzers CPD, Lichtenstein). The disks were mounted
on a standard aluminum J EOL stub and coated with osmium using a pure osmium coater
(NEOC-AN, Meiwa Shoji Co., LTD, Osaka, Japan). A JEOL 6300F scanning electron
microscope (JEOL, Tokyo, Japan) was used to examine the samples, with an accelerating
voltage of lOkV. Digital images were collected using AnalySIS Software from Soft

Imaging Systems (Munster, Germany).

Sequencing of B. anthracis PCR products

Stainless steel disks which had been spotted with 2x106 B. anthracis spores and
treated with Formula 1 for 60 minutes were swabbed with a cotton-tipped applicator and
expressed in 500 p1 of sterile double-deionized water as described above. Two p1 of the
suspension was used as template in PCR reactions with the five B. anthracis specific
primer pairs. Following amplification, 25 pl of each 50 pl PCR reaction was analyzed on
a 1.2% agarose gel to verify that correct fragment sizes had been obtained. Each
fragment was excised from the gel with a sterile scalpel blade and DNA was extracted
from the agarose gel using a QIAquick Gel Extraction Kit (Qiagen Inc., Valencia,
California) following the manufacturer’s protocol. The DNA recovered was eluted into
50 pl of sterile double-deionized water and quantified using an ND-1000
spectrophotometer (N anoDrop Technologies, Inc., Wilmington, Delaware). The
sequencing reactions included 40 ng of DNA and 30 pmol of the desired primer in a total
volume of 13.0 pl. Sequencing was performed by the Research Technology Support
Facility at Michigan State University. Results were analyzed using the SeqMan program,

part of the Lasergene software package described previously.

33

9.008

 

 

 

RESULTS

Sporicidal activity of Mandala PDS Formula 1

Mandala PDS Formula 1 was developed to be used as a sporicidal agent but had
previously not been tested as such. Under the Association of Analytical Communities
(AOAC) guidelines, to be classified as a sporicide, a chemical compound must
demonstrate the ability to kill spores from both aerobic and anaerobic bacterial species
(AOAC 966.04, 2000). The assays in this study were performed only with aerobic spores
of the Bacillus genus. Testing is currently being performed on anaerobic spores. While
awaiting the results of the anaerobic spore testing, the compound will be referred to as a
sporicide in this paper.

Quantitative killing experiments were performed using B. atrophaeus spores on
both stainless steel disks and paper carriers to assess the sporicidal activity of the
compound. Starting with 2x106 spores on stainless steel disks, exposure to the compound
for 10 minutes resulted in 4 orders of magnitude of killing (Figure 2). When the
exposure time was extended to 15 and 20 minutes an additional 1 — 2 orders of magnitude
of killing were observed. In 8 of 9 samples there was total killing in 30 minutes and on
average the 30 minute exposure killed 99.999% of B. atrophaeus spores. Quantitative
killing experiments with B. atrophaeus spores on paper carriers were performed with a 30
minute exposure time in triplicate and an average of 99.99995% spore inactivation was

observed (data not shown).

34

100?

 

 

 

Figure 2. Killing curve showing survival of B. atrophaeus spores on stainless steel disks
exposed to Mandala PDS Formula 1. Each data point shows the average number of
colonies cultured plus or minus the standard deviation for 3-9 replicates. The lowest
reliably detectable viable count was 3 CFU/ml.

 

Log1o Average Viable Spores
...s o ...s N 00 «B 01 O) \l

0 5 10 15 20 25 30
Exposure Time (min)

Design and optimization of primers for B. atrophaeus

The initial experiments to test the efficacy of the sporicide were performed using
B. atrophaeus spores, requiring that the primers used for detection of residual DNA be
specific to B. atrophaeus. The complete genome sequences for multiple B. anthracis
strains have been published, including several different outbreak strains and strains used
for laboratory research. Sequence data for B. atrophaeus is limited and only a few genes
have sequence data which can be used as a basis for primer design. One gene that has
been sequenced in both B. atrophaeus and B. anthracis is the gyrase A gene (gyrA),
which encodes two of the four subunits of the bacterial gyrase enzyme (Hurtle et a1,

2004). The gyrA gene was also chosen because it is one of the genes that have been

35

 

9.00?

 

 

identified by other researchers as containing single nucleotide polymorphisms that can
differentiate B. anthracis from two other Bacillus species which are closely related,

B. cereus and B. thuringiensis (Hurtle et al, 2004). A pair of primers, gyrAl and gyrA2,
were designed for the gyrA gene that amplifies a 574 base pair product (Table 1).

The 16S rRNA gene from B. atrophaeus has also been completely sequenced and
was selected as the other gene target to amplify in this study. A 168 rRN A reverse
primer specific for B. atrophaeus, BAl , was designed. When this primer is paired with a
universal 16S rRNA forward primer, UP927 (Amann et al., 1995), a 368 base pair
product is formed. When the BA] primer is used with a second reverse primer, UP520, a
777 base pair product is amplified. The gyrAl — gyrA2, BAl — UP927, and BAI ~—
UP520 primer pairs were designed to amplify three distinct product sizes so that they
could be used to determine how large a fragment of intact DNA can be amplified after
treatment with the sporicide. The genes selected include a gene found in single copy in
the genome, gyrase, and a gene found in multiple copies, the 16S rRN A gene. In Bacillus
species where complete genome sequence data are available, there are 7 to 14 copies of
the 16S rRNA gene. In this way, the effect of single versus multiple copies of a target
gene on the amplification of DNA and the sensitivity of that amplification could be
assessed.

To facilitate future experiments, a set of conditions for PCR with all three
B. atrophaeus primer pairs that gave the strongest product with B. atrophaeus and limited
the background amplification from other organisms was determined. Each primer pair
was tested for specificity against genomic DNA prepared from B. atrophaeus, S. aureus,

E. coli, E. faecalis, P. aeruginosa, and humans. When testing the primers against

36

§r§ I

 

 

microorganisms other than B. atrophaeus, between 10 and 20 ng of template DNA was
used while 0.28 ng of template DNA was added to the B. atrophaeus reactions, ensuring
a higher level of specificity. Annealing temperatures ranging from 55°C to 65°C were
tested, with 62°C resulting in consistently optimal amplification of the desired product
sizes while minimizing nonspecific amplification. The 62°C annealing temperature
resulted in amplification of the correct product size with the UP927 and BA] primer pair
and no amplification with the other bacterial and human DNA templates. To eliminate
remaining background amplification in the UP520 and BAl primer pair and the gyrA
pair, the concentration of magnesium chloride was varied and formamide was added to
the PCR reaction to increase primer specificity. Magnesium chloride was added to final
concentrations of 0.75 mM to 3 mM. Forrnamide was added in a range of concentrations
up to 5%. A combination of 2% forrnamide and 2.25 mM magnesium chloride produced
the cleanest product while minimizing the background amplification. These conditions,
combined with the 62°C annealing temperature, eliminated nearly all background
amplification fi'om the gyrA primers, with the exception of two higher molecular weight
products in P. aeruginosa, which could easily be distinguished fiom the expected product
size of 574 base pairs in B. atrophaeus. Under these optimized conditions, the UP520
and BA] primer pair amplify a faint product with S. aureus and P. aeruginosa which is
the same size as the expected 777 base pair product in B. atrophaeus. The primers also
amplify a product with E. coli that is of a higher molecular weight than B. atrophaeus.
As seen in Figure 3, these background amplifications were minor in comparison to the

intense product observed with B. atrophaeus DNA.

37

 

9.00?

 

 

Figure 3. Specificity of the PCR assay for B. atrophaeus using the BAl-UP520 primer
pair for 16S rRNA. PCR reactions were performed using the optimized PCR conditions
and the following amounts of genomic DNA as template: B. atrophaeus, 0.3 ng; S.
aureus, 11 ng; E. faecalis, 15 ng; P. aeruginosa, 20 ng; and E. coli, 11 ng. A 777 bp
product is detected in both the S. aureus and P. aeruginosa reactions but is much fainter
than the B. atrophaeus positive control. A product close to 2000 bp is detected in the E.
coli reaction. The first lane contains a 100 bp ladder.

l ()0 hp

1L]. .lilt’ul/lx
l’. ut'ruginmu

l.
\.
N
u
\
v
~
\
N
\
a
>—
K
\
-.
\l
M
N

2042 bp

777 bp
600 bp

 

Sensitivity of assay for detection of B. atmphaeus

Primer sensitivity is an important component of detecting biological agents
because it is pertinent to know the lower limit of detection of the detection method used.
For this study, the sensitivity of the gyrA primers and both pairs of 16S primers were
assayed using vegetative cells and spores of B. au‘ophaeus to determine the lowest level
detectable under the optimized PCR conditions. For each sensitivity experiment, the

limit of detection was determined to be the lowest dilution where a band was visible on

38

 

9.00?

 

 

the ethidium bromide-stained agarose gel. These experiments were performed, at a
minimum, in triplicate for each of the three primer pairs and results were averaged.

Serial 10-fold dilutions of spores were added as template in PCR reactions, with
spore concentrations ranging fi'om 104 to less than one spore per reaction. The exact
number of spores in each reaction varied with each replicate but was quantitatively
determined (as described in Materials and Methods). An example of a sensitivity assay
for detection of B. atrophaeus spores is shown in Figure 4. Complete sensitivity data is
summarized in Figure 5. The 3A1 and UP927 primers and the BAl and UP520 primers
had similar average detection limits of 15 and 13 spores, respectively. The sensitivities
from the individual experiments for both 168 primer pairs ranged from 8 — 20 spores.
The assay using the gyrAl and gyrA2 primers was three orders of magnitude less
sensitive than assays using either pair of 16S rRNA primers, with an average minimum
detection level of 13,500 spores. The range of values was between 8,000 and 20,000
spores.

Serial 10-fold dilutions of vegetative cells were added as template in PCR
reactions, with bacterial concentrations ranging from 105 to less than one bacterium per
reaction. As in the previous experiments with spores, the exact number of cells in the
reactions varied with each replicate but was quantitatively determined. The average limit
of detection for assays using either BAl with UP927 or BAl with UP520 was 3 bacterial
cells and the sensitivities ranged from 1 bacterium to 6 bacteria (Figure 5). For
vegetative cells, the assay with the gyrAl and gyrA2 primers was still not as sensitive as

either assay using the 16S rRNA primers but was only one order of magnitude less

39

 

9.00?

 

 

sensitive, with a range between 30 and 60 bacteria and an average minimum detection

level of 38 bacterial cells (Figure 5).

40

 

 

filo-9‘.

 

Figure 4. Sensitivity of 16S(520) and gyrA primers for detection of B. arrophaeus
spores. The first and last lanes contain a 100 base pair ladder. The ‘+’ denotes the PCR
positive amplification control with B. atrophaeus genomic DNA as template. The
negative control contained no template DNA. (a) PCR reactions with BA] and UP520
primers amplifying a 777 bp product from the 16S rRNA gene. Template ranged from
10,000 spores to less than a single spore. (b) PCR reactions with gyrAl and gyrA2
primers amplifying a 574 bp product with template ranging from 8,000 spores to less than
1 spore per reaction.

(a)
'13 1'11
U -D
I: ‘:
v 'J
C1-- C1.
.1, W
C' :-
C' -—4
c.
I.
-—4

in tr
'1) '11
l— I—
O 0
EL Cl-
ill if
C- 2
C- C,
12* VJ
.
'I’J

 

41

lo 0 I

 

 

 

Figure 5. Limit of detection of PCR assays with B. atrophaeus spores and vegetative
cells. The data from each sensitivity experiment for each primer pair were log
transformed and then averaged. The bars on the graphs represent the mean log number of
spores (a) or vegetative cells (b) needed for detection. The brackets indicate the standard
deviation from the mean. 16S(927) represents the BAl and UP927 primer pair.

16S(520) represents the BA] and UP520 primer pair.

(a)

 

 

Logra Number of Spores Needed For

 

 

 

 

 

    

 

 

 

gyrA 168(927) 168(520)
PrimerPairs
(131------ H ,L, L, , , , H ,, ,
1.8
B
‘ 1.64» ,7 W , ,
i
a 1.4 «4 ~ , -
O
<§§12<~ , , , ,
"‘ 1. ~7 ,L, r
«3 11 °
I! O
{90.8 v— 7 —
8 12
13 0.6% ~ , v
I E
y; 0.4 7 , 7 -
‘g' 0.2-7 A 7
.l
. 0.0 “
gyrA 168(927) 168(520)
PrimerPairs

 

 

42

100‘

 

 

 

B. atrophaeus decontamination and DNA recovery experiments

To test the feasibility of recovery of sufficient intact DNA from treated spores for
detection by PCR, 3 pilot study was conducted using stainless steel disks coated with
B. atrophaeus spores and the BAl — UP927 primer pair that amplifies the smallest
fragment. Disks treated with either sporicide or sterile double-deionized water for 30
minutes were swabbed with a cotton-tipped applicator and the resulting sample was used
as template in a PCR reaction. In addition, PCR reactions were performed using 2 pl of
the exposure solution as template to test for the presence of intact spores or DNA in the
treatment liquid. Because of concerns that the high pH and chemical nature of the
sporicide might inhibit PCR reactions, 2 pl of the sporicide was added to a reaction with
1 pl of B. atrophaeus genomic DNA to test the effect on amplification. A 368 bp product
was amplified from the water-treated disks from both the swab and the treatment solution
(Figure 6, lanes 6-9). However, the bands from the swab samples were much brighter,
indicating that recovery directly fiom the disk was more successful than the treatment
solution. A PCR product was also obtained from both of the swab samples from the
sporicide-treated disks (Figure 6, lanes 2 and 4). In contrast, no product was detected
from the sporicide treatment solution (Figure 6, lanes 3 and 5) and no product was
detected in the sporicide-spiked positive control reaction (Figure 6, lane 11), indicating
that the sporicide inhibits PCR reactions. This pilot experiment verified that either intact
non-viable spores or released spore DNA can be recovered from the stainless steel disks
after treatment with sporicide, using cotton swabs, in sufficient quantity to be detected by

PCR.

43

.m.‘

 

Figure 6. Pilot B. atrophaeus treatment and DNA recovery experiment. PCR reactions
with BAI - UP927 primers and B. atrophaeus DNA recovered from treated spore-coated
stainless steel disks by swabbing are shown. The expected product size is 368 bp. Lanes
1 and 13 contain the 100 bp ladder. PCR templates were as follows: Lanes 2 and 4,
swabs of the sporicide treated disks; lanes 3 and 5, treatment liquid from the sporicide
treatment; lanes 6 and 8, swabs of the water treated disks; lanes 7 and 9, treatment liquid
from the water treatment; lane 10, B. atrophaeus genomic DNA (positive control); lane
11, B. atrophaeus genomic DNA in the presence of sporicide; and lane 12, no template
(negative control).

600 bp
368 bp

 

Using this cotton swab recovery method, spore-coated stainless steel disks were
treated with sporicide or water for 30 minutes or activated bleach for 60 minutes and the
recovered material tested by PCR with all three B. atrophaeus primer pairs (Figure 7).
PCR products of the correct size were detected with all three primer pairs with 4/4 of the
disks treated with water and 4/4 of the sporicide-treated disks. PCR products were not
amplified from any (0/4) of the bleach-treated disks. These experiments showed that,
after inactivation with sporicide but not with bleach, B. atrophaeus DNA could be
detected and amplified from both a multi-copy gene and a single-copy gene at sizes

ranging from 368 — 777 base pairs.

2.0 0

 

 
 

Figure 7. Detection of DNA from B. atrophaeus spore-coated stainless steel disks. PCR
reactions with B. atrophaeus DNA recovered from spore-coated stainless steel disks
treated with sporicide (lanes 3 and 4), activated bleach (lanes 5 and 6), or water (lanes 7
and 8) are shown. Lane 2 contains the positive control (B. arrophaeus genomic DNA);
lane 9 contains the negative control (no template): and lanes 1 and 10 contain 100 bp
ladder. The same swab samples were used as template in PCR reactions with all three
primer pairs: gyrA (panel (a), 574 bp product). BAl — UP927 (panel (b), 368 bp
product), BAl — UP520 (panel (c), 777 bp product).

 

45

 

:1o 0

Paper strips coated with 1.6x107 B. atrophaeus spores were tested in the same way
as the stainless steel disks to analyze any recovery or detection differences between the
two surfaces. As in the experiments with the stainless steel disks, a 30 minute exposure
time was selected because sporicidal testing showed that after 30 minutes there is on
average a 99.99995% reduction in viable B. atrophaeus spores. PCR products were
detected with all three primer pairs with all of the sporicide (4/4) and water-treated (4/4)
paper strips, but not with the bleach-treated disks (0/4), as was observed with the stainless
steel disks (data not shown). Swabbing the paper strips was more difficult than the
stainless steel disks, because when wet the paper carriers ripped very easily. For the
paper strips, the intensity of the gyrA PCR products was much lower than for the 168
products, indicating that the recovery efficiency from the paper carriers was lower than
from disks and that the number of recovered spores in the PCR reactions was nearer to
the limit of detection for the assay with the gyrA primers. If, for example, only 20% of
the spores. (3.2x10‘5 spores) were recovered from paper, that would result in ~12,800
spores in each PCR reaction, which is close to the average number of spores needed

(13,500 spores) for detection with the gyrA primers.

Examination of B. aflophaeus spore-coated disks by SEM

The mechanism of action causing the sporicidal activity of this compound is as
yet undetermined. Whether the spores were physically damaged, rendered non-viable but
remained intact and attached to the disks, or were removed from the surface of the metal
disks was addressed using scanning electron microscopy (SEM). Stainless steel disks

containing 2x106 spores were treated with sporicide and analyzed by SEM. Water-treated

46

 

9.0 0

 

disks were also analyzed to serve as a baseline control for the appearance of intact

B. atrophaeus spores. As seen in Figure 8, the sporicide-treated disks looked identical to
those that were treated with water. It did not appear that spores were being removed
from the surface of the disk to any large extent, and the spores also appeared to remain

intact.

47

9.0 0

Figure 8. SEM images of B. atrophaeus spore-coated stainless steel disks. Panels (a)
and (b) are water-treated spores at 1,500x ((a)) and 10,000x ((b)) magnification. Panels
(c) and (d) are Formula 1-treated spores at 1,500x ((c)) and 10,000x ((d)) magnification.
The scale bars in panels (a) and (c) represent 10 pm and the scale bars in panels (b) and
((1) represent 2 pm.

 

48

 

23.0 o

 

 

B. anthracis qualitative killing assays

Qualitative spore inactivation experiments were performed with the sporicide
against the B. anthracis Sterne strain to determine the length of exposure time necessary
to achieve total killing. Spore-coated stainless steel, glass, paper, wood, and carpet were
treated with sporicide for 30, 60, and 120 minutes, or 10 % bleach or water for 60
minutes, and then transferred to BHI broth and incubated. Verification of spore
inactivation was assessed by visually inspecting the broth culture for signs of active
nricrobial growth, and by subculture of the broth after 14 days incubation onto BHI agar
plates. This visual assessment was challenging for several of the carriers including wood,
paper, and carpet because, immediately upon placement in the broth, the culture became
cloudy. Similar cloudiness of the broth did not occur with the same carriers exposed in
the bleach or water controls, but did occur when uninoculated carriers were exposed to
sporicide. For both stainless steel and glass carriers, no visual grth in the broth
cultures was observed after 14 days and the plates showed no B. anthracis growth from
any of the sporicide treatments (30, 60, or 120 minutes of exposure) or the bleach
treatments. The results from the experiment using paper carriers showed almost total
killing at all of the exposure times for the sporicide and bleach. With one of the three
replicates of the 60 minute sporicide treatment, a single colony grew on the 14 day plate.
Treatment with sporicide failed to produce total killing on the wood surface after either
30 or 60 minutes of exposure, and cultures of 2/3 of the bleach-exposed wood disks also
became turbid by day 5 of incubation. Cultures of the wood disks exposed to the
sporicide for 120 minutes showed no growth from all three replicates. This was the

exposure time chosen for subsequent wood treatment and DNA recovery experiments.

49

 

:roc

Treatment of the carpet carriers produced the same results as observed with stainless steel
and glass with no growth of B. anthracis following any of the sporicide or bleach
treatments. An exposure time of 60 minutes was selected for all surfaces, except wood,

for the remaining DNA recovery experiments.

Design and sensitivity of primers for B. anthracis

The same genes which were targeted in B. atrophaeus were also used in the
studies of B. anthracis. Modified primers specific for B. anthracis were designed for the
gyrA gene (gyrA3 and gyrA4) that were located in the same position within the gene as
gyrAl and gyrA2 so that the size of the amplicon was still 574 base pairs. A modified
16S rRNA reverse primer, BA2, specific for B. anthracis, was designed for use in
combination with the two universal forward primers, UP927 and UP520 to amplify 370
and 779 base pair products, respectively. Two other primer pairs were used that are
specific for the pXOl plasmid found in B. anthracis and have been previously published
(Ramisse et al., 1996). The pagAl and pagA2 primers amplify a 747 base pair product
from the pagA gene, which encodes the protective antigen that is the major component of
the anthrax vaccine. The lefl and lefZ primers amplify a 993 base pair product from the
lethal factor (lefl gene, which produces one of the two toxins that are responsible for most
of the damage during B. anthracis infection. These additional primers were selected for
this study so that both chromosomal and plasmid markers could be included in the
amplification of intact DNA following decontamination. Only pXOl plasmid markers
were chosen because the B. anthracis Sterne strain contains the pXOl plasmid but is

lacking the pX02 plasmid, which carries the capsule genes needed for infection. The

50

range of PCR product sizes used in these studies varies from 370 base pairs to nearly 1
kilobase, which also aided in determining how large the intact DNA fragments are that
can be amplified following spore treatment.

To maintain consistency, the optimized PCR conditions chosen for the
B. atrophaeus primers were used for all experiments with the B. anthracis primers. Five
B. anthracis-specific primer pairs were assayed with spores from the B. anthracis Sterne
strain to determine the limit of detection for each primer pair under these conditions,
which was defined as the lowest dilution of spores at which an amplified PCR product
could be visualized on an ethidium bromide stained agarose gel. For all primer pairs, the
sensitivity experiments were repeated, at a minimum, in triplicate and the results fi'om
each experiment were averaged. Serial 10-fold dilutions of spores were added as
template in PCR reactions, with spore concentrations ranging from 2x106 to less than two
spores per reaction. As in the B. atrophaeus primer sensitivity experiments, the detection
limit values obtained were log-transformed and the mean log of spores needed for

detection was calculated (Figure 9).

51

10¢

 

 

Figure 9. Limit of detection of PCR assays with B. anthracis spores. The data from
each sensitivity experiment for each primer pair were log transformed and then averaged.
The height of the bars on the graphs represents the mean log number of spores needed for
detection with the individual primer pairs under the PCR reaction conditions used. The
brackets indicate the standard deviation from the mean. 16S(927) represents the BA2 and
UP927 primers. 16S(520) represents the BA2 and UP520 primers.

 

 

I 6.0
It
‘ u 5.0
O
‘ u
8
I z 4.0
10
2 §
1 O -
, 1% 8 30
fl “
1 2 8
. 3 20
E .
i 3
1 E
a, 1.0
‘ 3
i
i 0.0
pagA lef gyrA 168(927) 168(520)
‘ PrimerPairs

 

As seen with the B. atrophaeus primers, the assay using either pair of the 16S
rRNA primers was more sensitive than the assay using the gyrA primers. With both 16S
rRNA primer pairs, BA2 with UP927 and BA2 with UP520, PCR products were
consistently detected in the dilution containing 200 spores. The assay with the gyrA
primers, gyrA3 and gyrA4, was much less sensitive and less consistent, requiring 2,000
to 200,000 spores per reaction, with a mean of 60,500 spores needed for detection, 2
orders of magnitude less sensitive than the 16S rRN A primers. The sensitivity of the
assay using primers specific for the pXOl toxin plasmid genes fell between these two
values. The detection limit of the pagA primers averaged 800 spores and the [ref primers

had an average limit of detection of 1,550 spores. The fact that the assay for gyrA is the

52

least sensitive is consistent with gyrA being a single copy gene. Both the 16S rRNA
primers and the pXOl primers are targeting genes that exist in multiple copies within the
B. anthracis spore, requiring fewer spores for detection. Examples of assay sensitivity

experiments are shown in Figure 10.

53

 

2.1m

Figure 10. Sensitivity of the assay using B. anthracis—specific primers for detection of
spores. Panel (a) shows results using the pagA primers (747 bp product); Panel (b), the
lef primers (993 bp product); Panel (c), the gyrA3 and gyrA4 primers (5 74 bp product).
Panel (d), the BA2 and UP927 primers (370 bp product); and Panel (e), the BA2 and
UP520 primers (779 bp product). The lane assignments are the same in each panel and
are as follows: 100 base pair ladder (lane 1), 2x 106 spores (lane 2), 2xlO5 spores (lane 3),
2x104 spores (lane 4), 2x103 spores (lane 5), 200 spores (lane 6), 20 spores (lane 7), 2
spores (lane 8) and negative control (lane 9).

 

54

2.0:

B. anthracis decontamination and DNA recovery experiments

The successful recovery of B. atrophaeus DNA on both stainless steel and paper
surfaces led to the expansion of the surfaces tested with B. anthracis to include wood,
carpet and glass in addition to stainless steel and paper. All surfaces were tested with
2x106 B. anthracis spores and the same cotton-swab recovery method from the B.
atrophaeus experiments was used. The PCR reactions with the five B. anthracis—specific
primer pairs amplify product sizes ranging from 370-993 base pairs and were used to

assess whether there was a limit in the size of fragment that could be amplified.

Stainless steel

With stainless steel disks treated for 60 minutes with sporicide, DNA was
amplified with all five primer pairs in all reactions, including six disks for each primer
pair and a total of 30 PCR reactions. With the water treated disks, amplified product was
detected with all five primer pairs in 28 out of 30 PCR reactions for a success rate of 93.3
percent. In one water sample from one replicate the lef locus did not amplify and in
another replicate one sample did not amplify the gyrA locus. No DNA could be detected
from any of the activated bleach treated disks by PCR for any DNA target. Figure 11

shows a representative replicate of the stainless steel treatment results.

55

 

filo

Figure 11. Detection of DNA from B. anthracis spore-coated stainless steel disks.
Stainless steel disks were treated with sporicide, activated bleach, or water and DNA was
recovered by swabbing. Each panel represents a different primer pair used in the PCR:
(a) pagA, 747 bp product; (b) lef, 993 bp product; (c) gyrA, 574 bp product; (d) BA2 and
UP927 16S rDNA, 370 bp product; and (e) BA2 and UP520 16S rDNA, 779 bp product.
The lanes in each panel are identical: 100 bp ladder (lanes 1 and 9), sporicide treated
disks (lanes 2 and 3), bleach treated disks (lanes 4 and 5), water treated disks (lanes 6 and
7) and a substrate negative control (lane 8).

 

56

 

lo

Glass

Samples recovered from all of the glass pieces treated with sporicide for 60
minutes yielded amplifiable DNA with all five target loci, totaling 30 out of 30 PCR
reactions. The same success rate (30/30) was observed with all of the water-treated glass
pieces. None (0/3 0) of the loci could be amplified from the bleach-treated glass samples.

Figure 12 shows a representative replicate of the glass treatment results.

57

lo

Figure 12. Detection of DNA from B. anthracis spore-coated glass. Glass pieces were
treated with sporicide, activated bleach, or water and DNA was recovered by swabbing.
Each panel represents a different primer pair used in the PCR: (a) pagA, 747 bp product;
(b) 19f, 993 bp product; (c) gyrA, 574 bp product; (d) BA2 and UP927 l6S rDNA, 370 bp
product; and (e) BA2 and UP520 l6S rDNA, 779 bp product. The lanes in each panel are
identical: 100 bp ladder (lanes 1 and 9), sporicide treated disks (lanes 2 and 3), bleach
treated disks (lanes 4 and 5), water treated disks (lanes 6 and 7) and a substrate negative
control (lane 8).

 

58

,lo

Paper

DNA recovered from all of the paper carriers treated for 60 minutes with either
sporicide or water (48/48 reactions) was successfully amplified with PCR reactions using
the pagA, lef, BA2 — UP927, and BA2 — UP520 primer pairs. In contrast, DNA
recovered from only 33% of the sporicide-treated carriers and 67% of the water-treated
carriers was amplified with PCR using the gyrA primers, and the PCR products that were
visible on these agarose gels were very faint in comparison to the other loci. None of the
primers were able to amplify DNA recovered from the bleach treated paper carriers.

Figure 13 shows a representative replicate of the paper treatment results.

59

Figure 13. Detection of DNA from B. anthracis spore-coated paper. Paper carriers were
treated with sporicide, activated bleach, or water and DNA was recovered by swabbing.
Each panel represents a different primer pair used in the PCR: (a) pagA, 747 bp product;
(b) 18f, 993 bp product; (c) gyrA, 574 bp product; (d) BA2 and UP927 16S rDNA, 370 bp
product; and (e) BA2 and UP520 16S rDNA, 779 bp product. The lanes in each panel are
identical: 100 bp ladder (lanes 1 and 9), sporicide treated disks (lanes 2 and 3), bleach
treated disks (lanes 4 and 5), water treated disks (lanes 6 and 7) and a substrate negative
control (lane 8). '

 

60

 

..ail

1c

 

Wood

In the first two experiments performed with wood disks, DNA recovered after
treatment for 120 minutes with either sporicide or water amplified 100% of the time
using the pagA, lei: BA2 — UP927, and BA2 — UP520 primer pairs. Template was
amplified from all four water-treated wood samples and 3/4 sporicide-treated wood
samples with the gyrA primers, which was more successful than was seen with the paper
samples. No amplified DNA was produced from bleach-treated wood samples using any
of the primer pairs in the assay. After duplicate experiments were performed, the original
wood source was exhausted and a new source was used with the same treatment and
recovery procedures. The experiments performed on the new wood resulted in
amplification with the samples recovered from the water-treated wood but not from the
sporicide or bleach-treated wood. It was noted that the sporicide in the exposure vial
turned a yellow color after the wood disk had been in the liquid for 2 hours, both with
spore-coated wood disks and control wood disks, suggesting a chemical reaction between
the sporicide and some compound in the wood. This color change was not observed with
the water or bleach-treated wood nor to the same extent in the sporicide-treated wood
from the first two experiments. Figure 14 shows a representative experiment from the

wood treatment experiments with the original source of wood.

61

.31

DJ

 

Figure 14. Detection of DNA from B. anthracis spore-coated wood. Wood disks were
treated with sporicide, activated bleach, or water and DNA was recovered by swabbing.
Each panel represents a different primer pair used in the PC R: (a) pagA, 747 bp product;
(b) 19f, 993 bp product; (c) gyrA. 574 bp product; (d) BA2 and UP927 l6S rDNA, 370 bp
product; and (e) BA2 and UP520 16S rDNA, 779 bp product. The lanes in each panel are
identical: 100 bp ladder (lanes 1 and 9), sporicide treated disks (lanes 2 and 3), bleach
treated disks (lanes 4 and 5), water treated disks (lanes 6 and 7) and a substrate negative
control (lane 8).

 

62

 

1c

Carpet

Carpet was the only carrier which required an additional step after exposure and
before surface sampling could take place. Due to the nature of the sporicide and the
results of previous experiments, which showed that excess sporicide inhibits PCR
reactions, a vacuum drying step was added to remove as much residual liquid from the
carpet fiber as possible. Despite this added drying step, the amplification results from the
PCR reactions were inconsistent for all loci. Three replicates of the experiment were
performed in the same way and results from the experiments varied greatly. In the first
experiment, PCR product was produced with all primer pairs from all samples treated
with either sporicide or water for 60 minutes and then vacuum dried. However, in the
second experiment only the water-treated samples produced PCR product with all primer
pairs. Product was seen with sporicide-treated samples only when the pagA and BA2 —
UP927 primer pairs were used. In the final replicate, DNA was amplified from the
sporicide-treated samples with all of the primer pairs, but only when the BA2 — UP927
primers were used in the PCR assay could DNA from the water-heated carpet samples be
amplified. The extreme variation among experiments is demonstrated in Figure 15 with

the three replicates with the pagA primers.

63

a;

Figure 15. Detection of DNA from B. anthracis spore-coated carpet by PCR
amplification using pagA primers. Carpet pieces were treated with sporicide, activated
bleach, or water, vacuum dried, and DNA was recovered by swabbing. Panels (a), (b),
and (c) are three replicates with the pagA primers, showing a 747 bp product. The lanes
in each panel are identical: 100 bp ladder (lanes 1 and 9), sporicide treated disks (lanes 2
and 3), bleach treated disks (lanes 4 and 5), water treated disks (lanes 6 and 7) and a
substrate negative control (lane 8).

123456789

(a)

 

 

64

DJ

 

Sequencing of B. anthracis PCR products

To confirm that the sporicide was not acting as a mutagen, PCR products which
had been amplified from B. anthracis spores recovered from stainless steel disks treated
with sporicide for 60 minutes were sequenced and aligned with the known genomic
sequence data for the Sterne strain. Sequencing results of products amplified in reactions
with all five primer pairs matched the Sterne strain sequence (GenBank accession number
NC_005945). This included the gyrA gene, in which two base pairs in the amplicon that
have been identified by Hurtle et al. (2004) as being single nucleotide polymorphisms for

differentiating B. anthracis from B. cereus were correctly amplified (Figure 16).

65

a |

 

 

 

 

Figure 16. Partial sequence of the gyrA gene (bp 300 — 874) from the B. anthracis
Sterne strain (GenBank accession number NC_005945). The gyrA3 and gyrA4 primers
are represented in bold. The sequence between the primers was amplified following
treatment with sporicide and the product was sequenced, verifying that no mutations had
occurred from the treatment. The highlighted bases at bp 656 and bp 793 represent two
single nucleotide polymorphisms identified by Hurtle et al. (2004) as being different in B.
anthracis than in B. cereus. Base 656 and 793 are both thymine in B. anthracis and
cytosine in B. cereus.
CGTTATATGCTTGTTGATGchatggtaactttggatctgtcgatggagattcag 355
cggcagcaatgcgttatacagaagcaagaatgtctaaaatctctatggaattaat 410
acgtgatatttcaaaaaatacaattgattatcaagataactatgatggttctgaa 465
agagagccgattgtgttaccagcgcgttttcctaacttactagtaaatggtacga 520
caggtattgcagttggtatggcaacaaatattccgccgcatcaacttggtgaagt 575
aattgatggcgtattggcattaagtcataatcccgatattactattgcagaatta 630
atggagtgcattccaggaccagatt tccgacggcaggtttaattttaggaagaa 685
gtggtattcgtagagcttatgaaacaggacgcgggtctattatacttcgtgctaa 740
agttgaaattgaagagaagtcaaatggcaaacaatctattatcgtaacggaa ta 795

ccttatcaagtgaataaggcgcgattgattgaaaaaattgcagaattagttchG 850

AEAAGAAAATTGAAGGTATTACAG 874

66

Effect of extended sporicide treatment of B. anthracis spores

To determine whether exposure to sporicide for an extended time period would
detrimentally affect detection of DNA, stainless steel disks spotted with 2x10‘5 B.
anthracis spores were treated with the sporicide, bleach, or water for 12 hours and the
same DNA recovery and amplification methods were employed. In triplicate
experiments, product was detected with all five primer pairs in all of the sporicide and
water treated samples (12/ 12 total disks). No product was detected with any of the bleach

treated disks with any of the primer pairs (0/6 disks).

Multiplex of B. anthracis primers

One way to increase the efficiency and accuracy of B. anthracis detection would
be to combine several of the B. anthracis specific targets into a single PCR reaction.
Both chromosomal markers and pXOl plasmid markers were chosen in combinations
which would generate products with distinguishable size differences on an agarose gel.
Primers for the two pXOl plasmid genes, pagA and let; which amplify 747 and 993 base
pair products respectively, were paired with primers for two different chromosomal
markers, gyrA3 — gyrA4 and BA2 — UP927, to assess whether one combination was
superior to the other. Samples recovered from stainless steel disks treated with sporicide,
bleach, or water were tested as template in PCR reactions with both multiplex primer
combinations. In triplicate experiments, the pagA-lefi16S(927) combination was
amplified from all of the sporicide and water treated samples, although all product bands
were not equally intense (F igurel7a); no products were detected with the bleach treated

disks. With the pagA-lef-gyrA combination, product was consistently detected from

67

:3.

 

sporicide and water-treated samples from both the pXOl plasmid genes, but the gyrA
product could not be visualized (Figure 17b). This experiment revealed that the primers,
which had been previously used individually, could be combined into a single reaction to

amplify multiple B. anthracis target sequences without cross-reactivity.

Figure 17. Multiplex PCR. Metal disks spotted with 2x106 B. andrracis spores were
treated for 60 minutes with the sporicide, swabbed, and 2 pl of the swab suspension was
used as template in multiplex PCR reactions. Panel (a) shows the multiplex reactions
with the lef(993 bp), pagA (747 bp), and BA2-UP927 (370 bp) primer pairs. Panel (b)
shows the multiplex reactions with the 1613 pagA, and gyrA (574 bp) primer pairs. The
lane assignments in each panel are identical: 100 base pair ladder (lane 1), sporicide
treated disk #1 (lane 2), and sporicide treated disk #2 (lane 3).

993 bp

993
747119 hp

747 bp

574 hp
3701;»

   

68

DISCUSSION

Very few chemicals with the ability to kill bacteria and viruses can also be
classified as sporicidal agents (Russell, 2001). The properties of an endospore and the
defensive mechanisms which have evolved to withstand extreme environmental stress are
also protective against many decontaminating agents. In this study, the efficacy of a
newly developed potential sporicide, Mandala PDS Formula 1, against spores from
aerobic gram-positive bacilli was evaluated and compared with that of activated bleach,
one of the EPA approved agents for emergency use against anthrax spores. Initial
quantitative killing experiments performed with spores of B. atrophaeus coated onto
stainless steel disks yielded no culturable B. atrophaeus spores after 30 minutes of
exposure to the sporicide, a reduction of 6 orders of magnitude in viable spores, in 8 out
of 9 trials. Exposure to activated bleach for 60 minutes, double the exposure time used
with the sporicide, produced complete killing in 100% of the experimental trials.

Much of the published research on the sporicidal activity of decontaminating
agents has been performed with B. anthracis simulants such as B. atrophaeus, which
exhibit similar sensitivities to chemical agents containing peroxide, chlorine or oxidants
(Sagripanti et al., 2007). However, decontamination procedures that have been optimized
for killing a simulant under laboratory conditions do not necessarily reflect how a
sporicide will work when applied to B. anthracis in a real-world situation. For this
reason, once Mandala PDS Formula 1 was shown to be effective against the simulant B.
atrophaeus, it was tested for efficacy against the avirulent Sterne strain of B. anthracis.

Qualitative killing experiments, which are designed to detect growth from as little as a

69

single viable spore, recovered no viable spores from stainless steel disks coated with
2x106 spores of B. anthracis after 30, 60, or 120 minutes of exposure. These results
demonstrate that Mandala PDS Formula 1 is an effective sporicide against at least two
species of aerobic spore-forming bacteria, B. anthracis and B. atrophaeus.—

Preliminary experiments with B. atrophaeus spores on stainless steel and paper
demonstrated that B. atrophaeus DNA could be recovered fi'om these surfaces after
decontamination with Formula 1 using a simple sample collection procedure. DNA was
recovered in sufficient quantity and quality to allow direct detection of B. atrophaeus
genes, both single and multi-copy, by routine PCR without clean-up or concentration of
the DNA. Similar results were achieved with B. anthracis spores on stainless steel disks.
Both single and multi-copy chromosomal genes could be detected as well as genes found
on the toxin plasmid pXOl. Validation of the decontamination and sample collection
procedure revealed that DNA fragments as large as 1 Kb could be amplified following
spore inactivation, which is greater than the 700 base pairs needed for the largest MLVA
locus used to type the samples taken from the 2001 anthrax attacks. Exposure
experiments beyond 60 minutes were also performed to simulate a scenario where the
sporicide was applied to surfaces for up to 12 hours, which might occur during
decontamination of a large area or if sampling of a treated area were delayed. The same
level of DNA recovery and amplification was achieved from spores left in contact with
the sporicide for 12 hours.

Species identification and subtyping of outbreak strains of B. anthracis sometimes
involves analysis of bacterial DNA at the nucleotide level to identify specific single

nucleotide polymorphisms. For example, the pagA gene was sequenced from some of the

70

2001 anthrax attack isolates to verify that the gene had not been modified or
bioengineered (Hoffrnaster et al., 2002), and SNPs of the gyrA gene have been used to
differentiate closely related Bacillus species (Hurtle et al., 2004). Accurate determination
of the nucleotide sequence is critical in these instances to correctly classify the strain in
question. For this reason, any sporicidal agent applied to kill spores prior to genetic
analysis must not alter the DNA sequence so that the integrity of the information is
preserved. To determine whether Mandala PDS Formula 1 has mutagenic activity,
sequencing was performed on the five B. anthracis genetic loci amplified from residual
DNA remaining on metal disks following a 60 minute exposure. The sequences from the
five products, including nearly 1 Kb of the lef gene and 747 bases of the pagA gene, were
successfully obtained and matched the known sequence of the Sterne strain. These
results demonstrate that this sporicide kills spores without degradation or mutagenesis of
the spore DNA, and suggest that Mandala PDS Formula 1 could be used to
decontaminate an area prior to collection of specimens, with no loss of valuable sequence
information needed for forensic analysis. In contrast, many sporicides currently
recommended for decontamination of anthrax, such as activated bleach, destroy the spore
DNA, and therefore sampling for forensic analysis must be performed before
decontamination (Dychdala, 2001).

The mechanism of sporicidal activity of Mandala PDS Formula 1 has yet to be
determined. In the SEM photographs, the spores on the Formula l-treated metal disks
appeared to still be intact and identical to the water-treated spores. These findings can be
compared to those of Setlow et al. (2002), who inactivated B. subtilis spores with

hydrochloric acid, ethanol, and sodium hydroxide to analyze the mechanism of killing.

71

 

:l

 

Using nucleic acid staining and electron microscopy, they concluded that exposure to
acid and ethanol alters the spore coat permeability and ruptures the spore coat. This is in
contrast to alkaline exposure, which they found did not disrupt the integrity of the spore
coat. Instead, they proposed that spore inactivation from alkaline conditions is caused by
denaturation of lytic enzymes necessary for lysis of the spore coat during the germination
process. Given that the pH of Mandala PDS Formula 1 is 14.84, it is possible that part of
the mechanism for spore inactivation is destruction of enzymes needed for spore
germination by alkaline conditions. The reasons DNA remains intact and not
mutagenized may largely be due to the presence of the a/B SASPs bound to the DNA.
These proteins surrounding the DNA serve as a barrier to prevent the nucleotides and
DNA molecule from reacting with damaging chemicals in the environment. Since the
spore coat is not being visibly damaged, this in addition to the 01/13 SASPs may contribute
to the protection and successful amplification of DNA following treatment. It should be
noted that the lack of obvious damage to the spore coat by this sporicide may preserve
not only the DNA evidence but also post-spore production treatment signatures related to
weaponization, which may also be important in the forensic analysis.

The sample collection procedure utilized in this study was designed to minimize
the number of steps required as well as the amount of equipment and reagents necessary
for full sample processing. Following application of the sporicide, sterile cotton swabs
were used on the surface of the material and then agitated in a tube containing sterile
double-deionized water. The swab suspension could then be directly used as template in
PCR reactions to amplify the targeted DNA. The procedure is ideal for an anthrax

investigation where time is a critical factor. Samples could be collected by law

72

enforcement and then sent to a laboratory for scientific analysis with little technical
knowledge required by the on-site individuals. The supplies needed are inexpensive and
sterile cotton swabs and pre-aliquoted vials of water could easily be added to the crime
scene kit of an investigator.

The use of cotton swabs for spore recovery was chosen because of the small
surface area being sampled and the prior use of cotton in other studies. Rose et al. (2004)
compared a variety of swab materials for efficiency of spore recovery from a metal
surface and concluded that cotton and macrofoam swabs had higher recoveries than rayon
and polyester. They also found that vortexing the swabs resulted in an increased number
of spores being released compared to sonication and agitation. The vortexing step could
easily be added to the method outlined in this study and could improve the DNA
detection from surfaces which suffered from low spore recovery, such as paper and
carpet. Other methods of surface sampling, including the use of sponge kits, wipes, and
HEPA vacuum filters, have been shown to have higher spore recovery than swabs
(Buttner et al., 2001; Sanderson et al., 2002; Teshale et al., 2002). This is likely due to
the larger surface area that can be sampled by these methods. While use of these
sampling methods was beyond the scope of this study, the ability to amplify DNA from
samples recovered by different methods should be evaluated to ensure that they are
compatible with the protocol developed in this research.

The demonstrated sporicidal activity of Formula 1 against both B. atrophaeus and
B. anthracis deposited on stainless steel disks and the subsequent detection of
amplifiable, non-mutated DNA led to studies on additional surfaces likely to be

encountered in an office building, including window glass, wood, paper, and commercial

73

carpet. In the qualitative killing experiments on the non-porous metal and glass surfaces,
as well as the carpet, there was no visible change in the surface or the treatment solution
and no observable grth in any of the sporicide treatment cultures after 30, 60, or 120
minutes of exposure. Almost complete killing was observed after treatment of spores on
paper for 30, 60, or 120 minutes, with a single culturable spore detected in 1 out of 9
trials. In contrast, wood required 120 minutes of exposure to the sporicide before no
culturable B. anthracis spores could be detected, and exposure of wood to the sporicide
led to the appearance of a yellow color in the treatment solution. The difference in
exposure times required for complete killing among the surfaces is most likely due to the
varying porosities of the materials. On non-porous materials, spores will remain on the
surface, allowing maximum contact with the sporicidal agent. In contrast, it was
anticipated that the fibrous weave of carpet and the exposed grain of untreated wood have
more crevasses and places where spores could become sequestered. This can limit the
accessibility of the spores to the sporicide and decrease the effectiveness of the treatment.
While paper is a porous surface, it is thin and the sporicide absorbs easily into it, possibly
increasing the interaction with spores that are embedded throughout the paper.
Observations made in a similar study by Rogers et al. (2005) found that spores deposited
on carpet and wood were more resistant to hydrogen peroxide gas decontamination than
spores deposited on non-porous surfaces. Results from our study agree with their
findings for wood surfaces but present a more effective option for decontamination of
carpet. The properties of gases and liquids may largely contribute to the observed
differences since the liquid Formula 1 could absorb into the surfaces better and have

increased contact with the spores. Another possible reason for the difference between

74

these studies is the type of carpet which was used and any differences inherent in the
fiber, dyes, or chemical treatments that may alter the effectiveness of the sporicide. Also,
in this study, the post-exposure vacuum drying step was added only to the carpet
experiment to remove any residual sporicide retained in the fiber. This added step may
have had the unintended effect of increasing the killing activity of the sporicide. These
results demonstrate the overall efficacy of this novel sporicide for inactivating both

B. atrophaeus and B. anthracis spores on non-porous and some porous surfaces in 30
minutes. This exposure time is within the range of use for currently approved sporicidal
agents and the longer exposure time necessary for porous surfaces is a problem
encountered with other decontaminating agents.

While conducting the experiments on the various surfaces, it was noted that the
sporicide did not damage or corrode any of the materials aside fiom causing a yellow
color to appear in the solution following wood treatment. In a similar study where a
foam decontaminant was being tested, the product dissolved vinyl tiles, stripped paint off
metal cabinets, and caused laminated wood surfaces to bubble (Buttner et al., 2004).
Other chemicals, including chlorine dioxide gas, have been noted for their corrosive
properties, which are undesirable if the decontamination of a building destroys the
equipment and furniture inside G3uttner et al., 2004). It is important to note that the
composition of Formula 1 contains chemicals which individually are generally regarded
as safe (GRAS) for humans and are not known to be carcinogenic. This is an
improvement over many of the currently used sporicides that are known to be harmful to
humans. Formula 1 can also be neutralized with water, which is another improvement

over current sporicide formulations. Some of the sporicidal gases used, such as chlorine

75

dioxide, are harmful to the environment as well and require scrubbers to clean the air as it
is ventilated. In comparison to other sporicides currently in use, Mandala PDS Formula 1
is an effective yet safer decontaminating agent that can be easily neutralized.

While DNA could be amplified from samples recovered from each of the surfaces
tested following treatment with the sporicide, efficiency of recovery of spores and thus
spore DNA from the different surfaces varied. Recovery and detection from the smooth
non-porous metal and glass surfaces was straightforward and consistent with all of the
PCR assays used. In contrast, the paper strips presented a sampling challenge because
once wet, the paper had a tendency to rip while being swabbed. Despite the difficult
sampling fi'om paper, sufficient DNA was recovered for PCR amplification with all of the
16S primer pairs from both B. atrophaeus and B. anthracis as well as the pagA and 16f
primer pairs. When the gyrA primers were used in the assay, successful amplification of
DNA from B. atrophaeus was possible but use of the B. anthracis gyrA primers in the
assay was only successful in 33% of the trials. This discrepancy can potentially be
attributed to the number of spores applied to or recovered from the surface of the paper.
For the experiments with B. atrophaeus, the paper carriers contained 1.6x107 spores
while in the B. anthracis experiments the paper carriers were spotted with 2x106 spores.
The results suggest that the number of B. anthracis spores recovered from paper
approached the limit of detection as previously determined for the assay with the gyrA
primers. In contrast, since the initial spore concentration for the B. atrophaeus
experiments was one order of magnitude higher, the number of recovered spores was
likely also ten-fold higher and therefore above the limit of detection for the assay using

the gyrA primers.

76

Carpet, which was expected to behave similarly to wood based on their porous
textures, was the poorest surface from which to attempt DNA recovery. The carpet did
stay intact when swabbed, but ensuring that every part of the carpet had been swabbed,
including in between the fibers, was not possible. Retention of sporicide in the carpet
fiber resulting in PCR inhibition was another problem encountered that required an
additional vacuum drying step. While it can be concluded that DNA recovery from
carpet and successful PCR amplification are possible, the inconsistencies make it a less
than ideal surface for sampling and other surfaces should be considered first.

It is interesting that while wood required a longer exposure time for complete
inactivation of the B. anthracis spores, recovery of spores from the surface and
subsequent DNA amplification using the five primer pairs in the assay was possible at a
higher success rate than observed with paper. The need to switch to a new source of
wood after the second experiment revealed an issue which must be addressed in a real-
world decontamination situation: the possibility of PCR inhibition. The intense yellow
color of the sporicide solution following exposure of the new wood source may indicate a
chemical interaction between compounds found in the wood and those present in the
sporicide, production of new compounds, or release of chemical compounds from the
wood that were then swabbed into the spore suspension and subsequently inhibited the
PCR. Since the amplification of template DNA recovered from water-treated wood was
successful it is believed that this inhibition was directly caused by an interaction between
the wood and the sporicide. The addition of a DNA extraction procedure afier spore
recovery but prior to PCR amplification is one method of eliminating chemical inhibitors.

However, in a study using quantitative PCR (QPCR) to detect DNA following

77

9.9

 

decontamination that also encountered PCR inhibition, a DNA extraction and purification
procedure was performed prior to QPCR analysis and inhibition was still observed
(Buttner et al., 2004). This could be a problem specific to that study, but regardless, PCR
inhibition is a valid concern for samples collected in real-world situations and more
research must be done before these techniques are used in bioterrorism investigations.

There are many potential modifications that could be made in this sampling
protocol to increase the efficiency of detection of DNA by PCR. Larger samples could
be collected, for example by using sponges to swab larger surface areas. This method
would require the use of larger volumes of liquid to suspend the swabbed samples, and
therefore also a sample concentration step prior to the PCR assay. It would also be
feasible to add clean-up steps to extract and concentrate DNA and remove potential PCR
inhibitors from the samples. However, these modifications would increase the time and
expense of this testing procedure, which was designed to be simple, rapid, and
inexpensive.

Other modifications that might improve the efficiency of the DNA detection
would involve changes in the PCR primers used or the assay conditions to decrease the
limit of detection, which was defined as the lowest number of spores added to a PCR
reaction that produced sufficient amplified DNA product for visualization on an agarose
gel. The assay conditions used in this study were optimized initially for specificity with
B. atrophaeus using primer pairs targeting the 16S rRN A gene. For consistency, these
same assay conditions were used for detection of B. anthracis DNA. Optimization of the

PCR conditions for the specific B. anthracis primer pairs to be used could reduce the

78

9,9

 

limit of detection and improve the sensitivity of this testing procedure for use in an actual
bioterrorism situation, but was beyond the scope of this study.

In this study, the PCR assay used for detection of the B. atrophaeus l6S rRNA
and gyrA genes varied in sensitivity when performed on spores and vegetative cells.
Differences in sensitivity can likely be attributed to the variable efficiency of cell lysis
and subsequent DNA release. This presumption is substantiated by Makino et al. (2001),
who showed that heating spores at 95°C for 15 minutes was needed to provide effective
spore lysis. Potentially, the resistance of spores to heat damage compared to vegetative
cells is enough to produce a difference in the number of spores versus cells being lysed
during the 10 minute, 94°C pre-treatment used in this study. Another factor to consider is
the difference in copy number of the two target genes, with the 165 rRNA gene existing
in multiple copies in a single B. atrophaeus genome and the gyrA gene being found only
in single copy. The exact copy number of the 16S rRNA gene in B. atrophaeus is
currently unknown but other Bacillus species are known to have on average 10 copies.
This inherent lO-fold increase in target sequence availability could also contribute to the
increased sensitivity of the 16S rRNA primers compared to the gyrA primers.

The limit of detection of the B. anthracis 16S rRNA and gm primers exhibited a
similar pattern as the corresponding B. atrophaeus-specific primers however, they were
less sensitive. The pagA and lef primer pairs required roughly 1,000 spores for detection,
between that of the 16S primers and the gyrA primers. This difference in sensitivity is
likely due to the copy number of the plasmid containing pagA and let; pXOl, which is
closer in number to the 16S rRNA gene than to the single copy gyrA gene. There is only

one published report on the copy number of the pXOl and pX02 toxin plasmids in

79

B. anthracis, where real-time PCR was compared to a standard curve to assess the c0py
number of these two plasmids (Coker et al., 2003). This group found that, depending on
the strain, between 33 and over 200 c0pies of the pXOl plasmid are present per cell;
however, these results were based on vegetative cells, not spores.

During the endospore formation process, changes in genomic DNA content occur
which may include a decrease in the extrachromosomal DNA, such as plasmids, that are
not of immediate use in the dormant stage. Some researchers believe the copy number of
the pXOl plasmid in spores to be closer to 10 (S. Cendrowski, personal communication).
The sensitivity results from this study support a copy number closer to the number of 16S
rRNA genes in the chromosome, which is 11 for the Sterne strain. If the pXOl plasmid
were at a copy number higher than the 16S rRNA gene, the limit of detection of both the
pagA and lef primers would be expected to be lower than that of the 168 primers. As this
is not the case, the observed sensitivities more closely resemble a situation where the
copy numbers are similar.

Most of the research on PCR assay sensitivity using Bacillus species has been
performed with genomic DNA dilutions in a real-time PCR format. However a study by
F asanella et al. (2003) was performed in a manner similar to this study, with detection
based upon standard PCR amplification followed by visualization on an agarose gel. A
previously published paper from this group was the source of the sequences for the pagA
and lef primers used in this study (Ramisse et al., 1996). Therefore, a direct comparison
could be made between the sensitivities determined under the conditions used in their
study to the conditions used in this study. The detection limit of the pagA gene was

reported by Fasanella et al. (2003) as 1x104 spores/ml, which is comparable to the results

80

from this study, where the sensitivity reported is equivalent to 8x104 spores/ml. The
detection limit of the lef gene was reported at 1x106 spores/n11 by Fasanella et al. (2003).
In contrast, this research using the same primers was shown to be more sensitive,
detecting 1.5x105 spores/ml. Although the primers used were not identical, the sensitivity
results from the 83813 primers used by F asanella et al. (2003) can be compared to the
gyrA primers because both are targeting single—copy chromosomal genes. The limit of
detection for the Ba813 locus was reported to be over two orders of magnitude more
sensitive than the detection of the gyrA locus, 1x104 and 6x106 spores/ml respectively.
One possible explanation for this discrepancy is that the expected product sizes for the
two genes, 152 base pairs for Ba813 and 574 base pairs for gyrA, are so different that
amplification of a smaller product is more efficient than for a larger product. The
difference could also be caused by the primers themselves and their interactions with
each other and the DNA template during the PCR reaction resulting in the 83813 primer
pair performing better than the gyrA primers. Overall, a direct comparison of the assay
sensitivities between studies reveals that the differences observed are primer pair specific
with some assays being more sensitive in this study and some being less sensitive.
Analysis of the methods used in each study reveals several differences which may also
contribute to the conflicting sensitivity results. F asanella et al. (2003) used a primer
concentration of 0.5 pM, and 1.5 mM MgC12 compared to a 0.2 pM primer concentration
and 2.25 mM MgC12 used in this study. The Fasanella et al. (2003) PCR reactions also
contained sucrose and cresol red while the PCR reactions in this study contained
formamide. The template for each reaction also differed. As previously mentioned, the

template in this study was intact spores which were lysed during the extended 94°C step

81

of the PCR cycling. In the F asanella et al. (2003) study, template was DNA fiom a
known number of spores already in suspension. The increased primer concentration and
decreased magnesium chloride concentration along with a decreased annealing
temperature, and differences in the source of the template DNA are all important factors
that could alter the observed limit of detection of the primer pairs.

Despite the addition of forrnamide and the increased annealing temperature, non-
specific amplification from other bacterial species did occur in our study. This was most
problematic with the 16S primers and can probably be attributed to the use of two
universal primers. These 168 primers were chosen to allow the same primers to be used
with both B. atrophaeus and B. anthracis. However, the background amplification
observed is not ideal for an assay to detect B. anthracis DNA and not environmental
bacterial contamination. The sensitivity of the 16S primers was challenging to work with
as the slightest amount of DNA contamination in the PCR reactions could be detected by
the 16S primers but none of the other primer pairs. Extreme precaution was necessary
when setting up the PCR reactions including fi'esh aliquots of reagents, bleaching of
pipettors and racks, and using only screw-cap tubes to eliminate as many sources of
contamination as possible. In future studies or applications of this research to actual
bioterrorism investigations, a more suitable primer pair that detects a chromosomal
marker specific to B. anthracis should be chosen.

During a bioterrorism event, it is critical to determine both the species of bacteria
and the specific strain being used. The recent advances in molecular biology have made
new tools available to researchers that can have both positive and negative consequences.

In 1995 Soviet scientists presented a poster at a conference Iclaiming they had inserted B.

82

cereus virulence genes into B. anthracis and had created a strain that the current anthrax
vaccine did not protect against (Pomerantsev et al., 1997). Such biological engineering is
a concern with B. anthracis because the Bacillus species are so closely related and
transfer of plasmids among the strains is possible. For this reason, assays being
developed for detection of B. anthracis involve identification of both a chromosomal
specific marker and markers that are specific for the pXOl and pX02 toxin plasmids.
Depending on which DNA markers are detected, there are several important pieces of
information that can be obtained. If just the toxin plasmids are found but not the
chromosomal marker, it is possible that the bacterium is a different Bacillus species with
the toxin plasmids artificially transferred to the bacteria. If only one of the toxin plasmid
markers is found, this could indicate that the strain being used is missing a plasmid and is
therefore attenuated. A multiplex PCR specific for three toxin genes on pXOl, one on
pX02 and a chromosomal marker was developed previously and was able to differentiate
virulent and avirulent B. anthracis and was shown to be specific for B. anthracis
(Ramisse et al., 1996). Because this study used the Sterne strain which is lacking the
pX02 plasmid, two multiplex PCRs were tested using the pagA and Ief primer pairs to
detect the pXOl plasmid in addition to a chromosomal marker. When the gyrA primers
were included to amplify a chromosomal target, both pagA and lef products were seen
but not gyrA. The failure to detect gyrA most likely occurred because the pXOl toxin
genes were preferentially amplified, as there were multiple copies of their target
sequences. In the second multiplex reaction, which included the BA2-UP927 l6S rRNA
primer pair, the correct product sizes from all three genes were produced, although the lef

product was consistently faint. The reduced lef product formation was most likely caused

83

by preferential amplification of the 370 base pair 16S rDNA product, which consumed
most of the reagents, over the 997 base pair product from the Ief gene. The addition of
extra dNTPs, Taq, and altering the primer concentrations could improve the amplification
of the [cf gene product. The multiplex reaction that was successful in this study
contained primer pairs specific for multi—copy genes. However, if conditions were
optimized it is believed that it would be possible to detect a single-copy chromosomal
marker in a multiplex PCR as has been shown by other researchers. The benefit of this
experiment has been to show that, following spore inactivation with this novel sporicide,
complex PCR detection methods such as multiplexing primer pairs are still possible and
can be used to rapidly detect B. anthracis specific genetic markers.

In this study the efficacy of a novel sporicide was demonstrated against both a
simulant, B. atrophaeus, and the Sterne strain of B. anthracis spores. Spores were
recovered after they had been inactivated by the sporicide and, without performing a
DNA extraction, were used as template for the successful amplification of DNA
fragments as large as 1 Kb, which is suitable for current methods in use to forensically
distinguish strains of B. anthracis. The real benefit of this research comes from the
combination of both these findings. With the protocol developed here, it would be
possible to completely inactivate virulent spores at a contaminated site before exposing
any person involved in the processing of the crime scene or analyzing the evidence
collected from it. When dealing with virulent biological agents, the safety of the
individuals involved is the most important issue and limiting their exposure to harmful
bacteria is critical. During the 2001 anthrax attacks, the discovery of a spore-filled letter

addressed to Senator Tom Daschle prompted a search through all the mail from the

84

congressional buildings for additional letters (Beecher, 2006). This search required
physical handling of mail and as a result three individuals sorting mail from a bag
containing another spore-filled letter all became contaminated with B. anthracis spores
on their personal protective equipment. From one individual alone upwards of 150
colonies were cultured from their right arm and thigh (Beecher, 2006). Such extensive
personal exposure could be eliminated by inactivating spores first and sampling the scene
afterwards with the knowledge that the DNA evidence needed for a microbial forensics

investigation will not be damaged.

85

 

SUMMARY AND FUTURE DIRECTIONS

The research presented in this thesis demonstrates for the first time the sporicidal
activity of a novel chemical compound, Mandala PDS Formula 1, against both
B. atrophaeus and B. anthracis spores. The efficacy of this novel agent was shown to be
similar to that of activated bleach, an EPA-approved sporicide. Mandala PDS Formula 1
is comprised of chemicals which are safer for human handling than other approved
sporicides, and the Formula can be neutralized by dilution with water. This compound
was shown to effectively kill spores deposited on a variety of surfaces, including those
that are non-porous, such as glass and metal, and porous surfaces, such as paper, carpet,
and wood.

Primers were designed and optimized to maximize their specificity and sensitivity
and used in PCR reactions to amplify DNA from spores which had been inactivated. A
simple DNA recovery protocol was developed that involved swabbing surfaces with
cotton swabs and using suspensions from these swabs as template in PCR reactions
without a DNA extraction and purification method or complicated spore removal
processes. These experiments revealed that exposure to the novel sporicide and
inactivation of spores did not hamper the ability to detect DNA and amplify fragments as
large as 1 Kb. This technique successfully amplified DNA from spores recovered from
metal, glass, carpet, wood, and paper, and the PCR conditions allowed for detection of
both single—copy and multi-copy genes. In addition, a multiplex PCR was demonstrated
that could detect both chromosomal and virulence plasmid genes simultaneously as a

more powerful B. anthracis-specific assay. Sequencing of PCR amplified products

86

 

following sporicide treatment revealed no mutations, demonstrating that the DNA which
is recovered after treatment with this sporicide is suitable for analysis of single nucleotide
polymorphisms. In contrast, exposure of spores to activated bleach for the time
recommended by the EPA to kill spores resulted in no detectable amplified DNA.

This research is directly applicable to a real bioterrorism event where safety of
people is the major concern. With this protocol it would be possible to inactivate virulent
spores before collecting samples for forensic analysis. This chemical agent has been
shown to leave intact DNA of sufficient size for analysis with the currently used forensic
anthrax typing methods, and does not alter the sequence of the DNA recovered.
Therefore, a scene could be decontaminated and made safe for people to enter and the
integrity of the microbial evidence needed for the investigation could be maintained.

Future research could be performed to validate the protocol developed and test its
feasibility in a real bioterrorism event. While the multiplex PCR was shown to be
possible in this study, further optimization of the PCR conditions should be done to
ensure that all products are amplified in roughly equal proportions. In addition, there are
other surface sampling methods that may be superior to cotton swabs in their spore
recovery capabilities. These other methods, which include sponges, wipes, and HEPA
vacuums, could be tested on larger surface areas to recover a larger amount of spore
DNA, although this might require addition of a concentration step to the protocol. In a
real bioterrorism event, the surfaces being sampled are realistically not going to be sterile
as those surfaces tested in this study. Therefore, prior to use of this procedure in the real
world, experiments should be performed with spores on surfaces that contain

environmental background, including other bacterial species and PCR inhibitors. These

87

 

are both problems that would likely be encountered in the real world and ways to
overcome these need to be examined before this protocol can realistically be
implemented. However, it should be noted that collection of larger samples, addition of
pmification and concentration steps to remove inhibitors and concentrate template, or use
of a more sensitive technique such as QPCR, would all add to the time and expense of the
analysis. The protocol described here was developed as a rapid and inexpensive method
to detect B. anthracis DNA after decontamination.

One method to improve this procedure that would not increase costs or time
would be to re-design primers for B. anthracis, and optimize the PCR conditions for that
set of primers. In this study, the conditions were developed using the surrogate species
B. atrophaeus. For continuity, the assay conditions were not altered when the study was
extended to include B. anthracis. The lower sensitivity seen in experiments with B.
anthracis suggests that optimization for the B. anthracis primers would increase the
sensitivity of detection.

In summary, the goals of this thesis project were achieved: 1) to evaluate the
efficacy of Mandala PDS Formula 1 as a sporicide against the aerobic spore-forming
bacteria B. atrophaeus and B. anthracis; and 2) to develop and test a DNA recovery and
detection protocol that allowed rapid and sensitive detection of B. anthracis DNA for
species identification and forensic analysis after decontamination of surfaces with this

novel sporicide.

88

 

BIBLIOGRAPHY

Amann, R. 1., W. Ludwig, and K. Schleifer. 1995. Phylogenetic identification and in situ

detection of individual microbial cells without cultivation. Microbiological Reviews 59:
143 — 169.

Andersen, G. L., J. M. Simchock, and K. H. Wilson. 1996. Identification of a region of
genetic variability among Bacillus anthracis strains and related species. Journal of
Bacteriology 178: 377 — 384.

AOAC Official Method 966.04. 2000. Sporicidal activity of disinfectants. In Official
Methods of Analysis of AOAC International. AOAC International. Gaithersburg, MD.

Awad, A. C. 2006. Methods and composition for treating a material. US. Patent
Application #11/486736.

Baldry, M. G. C. 1983. The bactericidal, fimgicidal and sporicidal properties of hydrogen
peroxide and peracetic acid. Journal of Applied Bacteriology 54: 417 - 423.

Beecher, D. J. 2006. Forensic application of microbiological culture analysis to identify
mail intentionally contaminated with Bacillus anthracis spores. Applied and
Environmental Microbiology 72: 5304 -— 5310.

Bell, C. A., J. R. Uhl, T. L. il-Iadfield, J. C. David, R. F. Meyer, T. F. Smith, and F. R.
Cockerill. 2002. Detection of Bacillus anthracis DNA by LightCycler PCR. Journal of
Clinical Microbiology 40: 2897 — 2902.

Bock, F. G., H. K. Myers, and H. W. Fox. 1975. Cocarcinogenic activity of peroxy
compounds. Journal of the National Cancer Institute 55: 1359 — 1361.

Bode, E., W. Hurtle, and D. Norwood. 2004. Real-time PCR assay for a unique
chromosomal sequence of Bacillus anthracis. Journal of Clinical Microbiology 42: 5825
—- 5831.

Borick, P. M., F. H. Dondershine, and V. L. Chandler. 1964. Alkalinized glutaraldehyde,
a new antimicrobial agent. Journal of Pharmaceutical Sciences 53: 1273 — 1275.

Budowle, B., S. Schutzer, A. Einseln, L. C. Kelley, A. C. Walsh, .1. A. L. Smith, B. L.
Marrone, and J. Robertson. 2003. Building microbial forensics as a response to
bioterrorism. Science 301: 1852 — 1853.

Buttner, M. P., P. Cruz-Perez, and L. D. Stetzenbach. 2001. Enhanced detection of

surface-associated bacteria in indoor environments by quantitative PCR. Applied and
Environmental Microbiology 67: 2564 — 2570.

89

Buttner, M. P., P. Cruz, L. D. Stetzenbach, A. K. Klima-Comba, V. L. Stevens, and T. D.
Cronin. 2004. Determination of the efficacy of two building decontamination strategies

by surface sampling with culture and quantitative PCR analysis. Applied and
Environmental Microbiology 70: 4740 — 4747.

Coker, P. R., K. L. Smith, P. F. Fellows, G. Rybachuck, K. G. Kousoulas, and M. E.
Hugh-J ones. 2003. Bacillus anthracis virulence in guinea pigs vaccinated with anthrax

vaccine adsorbed is linked to plasmid quantities and clonality. Journal of Clinical
Microbiology 41: 1212 — 1218.

Cross, G. L. C., and V. H. Lach. 1990. The effects of controlled exposure to
formaldehyde vapour on spores of Bacillus globigii NCTC 10073. Journal of Applied
Bacteriology 68: 461 — 469.

Drobniewski, F. A. 1993. Bacillus cereus and related species. Clinical Microbiology
Reviews 6: 324 — 338.

Dychdala, G. R. 2001. Chlorine and chlorine compounds, p. 135 - 157. In S. S. Block
(ed.), Disinfection, sterilization and preservation, 5‘h ed. Lippincott Williams & Wilkins,
Philadelphia, PA.

Easterday, W. R., M. N. Van Ert, T. S. Simonson, D. M. Wagner, L. J. Kenefic, C. J.
Allender, and P. Keim. 2005. Use of single nucleotide polymorphisms in the plcR gene
for specific identification of Bacillus anthracis. Journal of Clinical Microbiology 43:
1995 — 1997.

F asanella, A., S. Losito, R. Adone, F. Ciuchini, T. Trotta, S. A. Altamura, D. Chiocco,
and G. Ippolito. 2003. PCR assay to detect Bacillus anthracis spores in heat-treated
specimens. Journal of Clinical Microbiology 41: 896 — 899.

Grabenstein, J. D. 2003. Anthrax vaccine: a review. Immunology and Allergy Clinics of
North America 23: 713 — 730.

Green, B. D., L. Battisti, and C. B. Thorne. 1989. Involvement of Tn4430 in transfer of
Bacillus anthracis plasmids mediated by Bacillus thuringiensis plasmid pXOl2. Journal
ofBacteriology 171: 104 - 113.

Harrell, L. J ., G. L. Andersen, and K. H. Wilson. 1995. Genetic variability of Bacillus
anthracis and related species. Journal of Clinical Microbiology 33: 1847 - 1850.

Hawley, R. J., and E. M. Eitzen. 2001. Biological weapons—a primer for
microbiologists. Annual Reviews Microbiology 55: 235 — 253.

90

 

Helgason, E., O. A. Okstad, D. A. Caugant, H. A. Johansen, A. Fouet, M. Mock, I.
Hegna, and A. Kolsto. 2000. Bacillus anthracis, Bacillus cereus, and Bacillus

thuringiensis—one species on the basis of genetic evidence. Applied and Environmental
Microbiology 66: 2627 — 2630.

Helgason, E., N. J. Tourasse, R. Meisal, D. A. Caugant, and A. Kolste. 2004. Multilocus
sequence typing scheme for bacteria of the Bacillus cereus group. Applied and
Environmental Microbiology 70: 191 — 201.

Hendersen, I., C. J. Duggleby, and P. C. B. Turnbull. 1994. Differentiation of Bacillus
anthracis from other Bacillus cereus group bacteria with the PCR. International Journal
of Systematic Bacteriology 44: 99 - 105.

Hoffrnaster, A. R., C. C. Fitzgerald, E. Ribot, L. W. Mayer, and T. Popovic. 2002.
Molecular subtyping of Bacillus anthracis and the 2001 bioterrorism-associated anthrax
outbreak, United States. Emerging Infectious Diseases 8: 1111 — 1116.

Hurtle, W., E. Bode, D. A. Kulesh, R. S. Kaplan, J. Garrison, D. Bridge, M. House, M. S.
Frye, B. Loveless, and D. Norwood. 2004. Detection of the Bacillus anthracis gyrA gene
by using a minor groove binder probe. Journal of Clinical Microbiology 42: 179 — 185.

lnglesby, T. V., T. O’Toole, D. A. Henderson, J. G. Bartlett, M. S. Ascher, E. Eitzen, A.
M. Freidlander, J. Gerberding, J. Hauer, J. Hughes, J. McDade, M. T. Osterholrn, G.
Parker, T. M. Perl, P. K. Russell, and K. Tonat. 2002. Anthrax as a biological weapon,
2002 — updated recommendations for management. Journal of American Medical
Association 287: 2236 — 2252.

Jemigan, D. B., P. L. Raghunathan, B. P. Bell, R. Brechner, E. A. Bresnitz, J. C. Butler,
M. Cetron, M. Cohen, T. Doyle, M. Fischer, C. Greene, K. S. Griffith, J. Guarner, J. L.
Hadler, J. A. Hayslett, R. Meyer, L. R. Petersen, M. Phillips, R. Pinner, T. Popovic, C. P.
Quinn, J. Reeflruis, D. Reissman, N. Rosenstein, A. Schuchat, W. Shieh, L. Siegal, D. L.
Swerdlow, F. C. Tenover, M. Traeger, J. W. Ward, 1. Weisfuse, S. Wiersma, K. Yeskey,
S. Zaki, D. A. Ashford, B. A. Perkins, S. Ostroff, J. Hughes, D. Fleming, J. P. Koplan, J.
L. Gerberding, and the National Anthrax Epidemiologic Investigation Team. 2002.
Investigation of bioterrorism-related anthrax, United States, 2001: epidemiologic
findings. Emerging Infectious Diseases 8: 1019 — 1028.

Keim, P., A. Kalif, J. Schupp, K. Hill, S. E. Travis, K. Richmond, D. M. Adair, M. Hugh-
Jones, C. R. Kuske, and P. Jackson. 1997. Molecular evolution and diversity in Bacillus

anthracis as detected by amplified fragment length polymorphism markers. Journal of
Bacteriology 179: 818 — 824.

Keim, P., L. B. Price, A. M. Klevytska, K. L. Smith, J. M. Schupp, R. Okinaka, P. J.
Jackson, and M. E. Hugh-Jones. 2000. Multiple-locus variable-number tandem repeat

analysis reveals genetic relationships within Bacillus anthracis. Journal of Bacteriology
182: 2928 — 2936.

91

 

Keim, P., M. N. Van Ert, T. Pearson, A. J. Vogler, L. Y. Huynh, and D. M. Wagner.
2004. Anthrax molecular epidemiology and forensics: using the appropriate marker for
different evolutionary scales. Infection, Genetics and Evolution 4: 205 — 213.

Lindstedt, B. 2005. Multiple-locus variable number tandem repeats analysis for genetic
fingerprinting of pathogenic bacteria. Electrophoresis 26: 2567 — 2582.

Little, S. F ., and B. E. Ivins. 1999. Molecular pathogenesis of Bacillus anthracis
infection. Microbes and Infection 2: 131 — 139.

Liu, H., N. H. Bergman, B. Thomason, S. Shallom, A. Hazen, J. Crossno, D. A. Rasko, J.
Ravel, T. D. Read, S. N. Peterson, J. Yates, and P. C. Hanna. 2004. Formation and
composition of the Bacillus anthracis endospore. Journal of Bacteriology 186: 164 — 178.

Makino, S. I., H. I. Cheun, M. Watarai, I. Uchida, and K. Takeshi. 2001. Detection of
anthrax spores from the air by real-time PCR. Letters in Applied Microbiology 33: 237 —
240.

Manchee, R. J., M. G. Broster, A. J. Stagg, and S. E. Hibbs. 1994. Formaldehyde solution
effectively inactivates spores of Bacillus anthracis on the Scottish island of Gruinard.
Applied and Environmental Microbiology 60: 4167 — 4171.

Meselson, M., J. Guillemin, M. Hugh-Jones, A. Langmuir, I. Popova, A. Shelokov, and
O. Yampolskaya. 1994. The Sverdlovsk anthrax outbreak of 1979. Science 266: 1202 —
1208.

Miller, J ., S. Engelberg, and W. Broad. 2001. Germs: biological weapons and America’s
secret war. Simon and Schuster, New York, NY.

Mock, M., and A. F ouet. 2001. Anthrax. Annual Reviews Microbiology 55: 647 — 671.

Nicholson, W. L., N. Munakata, G. Horneck, H. J. Melosh, and P. Setlow. 2000.
Resistance of Bacillus endospores to extreme terrestrial and extraterrestrial environments.
Microbiology and Molecular Biology Reviews 64: 548 — 572.

Pile, J. C., J. D. Malone, E. M. Eitzen, and A. M. Friedlander. 1998. Anthrax as a
potential biological warfare agent. Archives of Internal Medicine 158: 429 — 434.

Pomerantsev, A. P., N. A. Staritsin, Y. V. Mockov, and L. I. Marinin. 1997. Expression
of cereolysine AB genes in Bacillus anthracis vaccine strain ensures protection against
experimental hemolytic anthrax infection. Vaccine 15: 1846 — 1850.

Price, L. B., M. Hugh-Jones, P. J. Jackson, and P. Keim. 1999. Genetic diversity in the
protective antigen gene of Bacillus anthracis. Journal of Bacteriology 181: 2358 — 2362.

92

Qi, Y., G. Patra, X. Liang, L. E. Williams, S. Rose, R. J. Redkar, and V. G. DelVecchio.
2001. Utilization of the rpoB gene as a specific chromosomal marker for real-time PCR

detection of Bacillus anthracis. Applied and Environmental Microbiology 67: 3720 —
3727.

Radnedge, L., P. G. Agron, K. K. Hill, P. J. Jackson, L. O. Ticknor, P. Keim, and G. L.
Andersen. 2003. Genome differences that distinguish Bacillus anthracis from Bacillus

cereus and Bacillus thuringiensis. Applied and Environmental Microbiology 69: 2755 —
2764.

Ramisse, V., G. Patra, H. Garrigue, J. Guesdon, and M. Mock. 1996. Identification and
characterization of Bacillus anthracis by multiplex PCR analysis of sequences on
plasmids pXOl and pX02 and chromosomal DNA. FEMS Microbiology Letters 145: 9 —
16.

Read, T. D., S. L. Salzberg, M. Pop, M. Shumway, L. Umayam, L. Jiang, E. Holtzapple,
J. D. Busch, K. L. Smith, J. M. Schupp, D. Solomon, P. Keim, and C. M. Fraser. 2002.
Comparative genome sequencing for discovery of novel polymorphisms in Bacillus
anthracis. Science 296: 2028 — 2033.

Regis, E. 1999. The biology of doom: the history of America’s secret germ warfare
program. Henry Holt, New York, NY.

Rogers, J. V., C. L. K. Sabourin, Y. W. Choi, W. R. Richter, D. C. Rudnicki, K. B. Riggs,
M. L. Taylor, and J. Chang. 2005. Decontamination assessment of Bacillus anthracis,
Bacillus subtilis, and Geobacillus stearothermophilus spores on indoor surfaces using a
hydrogen peroxide gas generator. Journal of Applied Microbiology 99: 739 — 748.

Rose, L., B. Jensen, A. Peterson, S. N. Banerjee, and M. J. Arduino. 2004. Swab
materials and Bacillus anthracis spore recovery from nonporous surfaces. Emerging
Infectious Diseases 10: 1023 — 1029.

Rubbo, S. D., J. F. Gardner, and R. L. Webb. 1967. Biocidal activities of glutaraldehyde
and related compounds. Journal of Applied Bacteriology 30: 78 — 87.

Russell, A. D. 2001. Chemical sporicidal and sporostatic agents, p. 529 -— 541. In S. S.
Block (ed.), Disinfection, sterilization and preservation, 5‘h ed. Lippincott Williams &
Wilkins, Philadelphia, PA.

Sanderson, W. T., M. J. Hein, L. Taylor, B. D. Curwin, G. M. Kinnes, T. A. Seitz, T.
Popovic, H. T. Holmes, M. E. Kellum, S. K. McAllister, D. N. Whaley, E. A. Tupin, T.
Walker, J. A. Freed, D. S. Small, B. Klusaritz, and J. H. Bridges. 2002. Surface sampling
methods for Bacillus anthracis spore contamination. Emerging Infectious Diseases 8:
1145 — 1151.

93

 

Sagripanti, J ., and A. Bonifacino. 1996. Comparative sporicidal effects of liquid chemical
agents. Applied and Environmental Microbiology 62: 545 — 551.

Sagripanti, J ., M. Carrera, J. Insalaco, M. Ziemski, J. Rogers, and R. Zandomeni. 2007.
Virulent spores of Bacillus anthracis and other Bacillus species deposited on solid
surfaces have similar sensitivity to chemical decontaminants. Journal of Applied

Microbiology 102: 11 — 21.

Schnepf, E., N. Crickmore, J. Van Rie, D. Lereclus, J. Baum, J. F eitelson, D. R. Zeigler,
and D. H. Dean. 1998. Bacillus thuringiensis and its pesticidal crystal proteins.
Microbiology and Molecular Biology Reviews 62: 775 — 806.

Scott, E. M., and S. P. Gorman. 2001. Glutaraldehyde, p. 361 — 381. In S. S. Block (ed.),
Disinfection, sterilization and preservation, 5th ed. Lippincott Williams & Wilkins,
Philadelphia, PA.

Setlow, P. 1995. Mechanisms for the prevention of damage to DNA in spores of Bacillus
species. Annual Reviews Microbiology 49: 29 — 54.

Setlow, B., C. A. Loshon, P. C. Genest, A. E. Cowan, C. Setlow, and P. Setlow. 2002.
Mechanism of killing spores of Bacillus subtilis by acid, alkali, and ethanol. Journal of
Applied Microbiology 92: 362 — 375.

Spotts-Whitney, E. A., M. E. Beatty, T. H. Taylor, R. Weyant, J. Sobel, M. J. Arduino,
and D. A. Ashford. 2003. Inactivation of Bacillus anthracis spores. Emerging Infectious
Diseases 9: 623 — 627.

Sterne, M. 1937. The effects of different carbon dioxide concentrations on the growth of
virulent anthrax strains. Pathogenicity and immunity tests on guinea-pigs and sheep with
anthrax variants derived from virulent strains. Onderstepoort Journal of Veterinary
Science and Animal Industry 9: 49 — 67.

Stratilo, C. W., C. T. Lewis, L. Bryden, M. R. Mulvey, and D. Bader. 2006. Single-
nucleotide repeat analysis for subtyping Bacillus anthracis isolates. Journal of Clinical
Microbiology 44: 777 — 782.

Sykes, G. 1970. The sporicidal properties of chemical disinfectants. Journal of Applied
Bacteriology 33: 147 — 156.

Szinicz, L. 2005. History of chemical and biological warfare agents. Toxicology 214: 167
— 181.

Teshale, E. H., J. Painter, G. A. Burr, P. Mead, S. V. Wright, L. F. Cseh, R. Zabrocki, R.
Collins, K. A. Kelley, J. L. Hadler, D. L. Swerdlow, and members of the Connecticut
Anthrax Response Team. 2002. Environmental sampling for spores of Bacillus anthracis.
Emerging Infectious Diseases 8: 1083 — 1087.

94

Turk, B. E. 2007. Manipulation of host signalling pathways by anthrax toxins. The
Biochemical Journal 402: 405 — 417.

US. Environmental Protection Agency. 2007A. Pesticides: topical and chemical fact
sheets. Bleach. US. Environmental Protection Agency, Washington, DC. [Online.]
http://www.epa.grv/pesticides/factsheets/chemicals/bleachfactsheethtm.

US. Environmental Protection Agency. 2007B. Pesticides: topical and chemical fact
sheets. Hydrogen peroxide and peroxyacetic acid. US. Environmental Protection
Agency, Washington, DC. [Online.]
Imp://www.epa.gov/pesticides/factsheets/chemicals/hvdrgenperoxide_peroxyaceticacid_
factsheethtm.

US. Environmental Protection Agency. 2007C. Pesticides: topical and chemical fact
sheets. Paraforrnaldehyde. US. Environmental Protection Agency, Washington, DC.
[Online.]

hgpz//www.epa.gov/pesticides/factsheets/chemicals/paraformaldehyde factsheethtm.

Valjevac, S., V. Hilaire, O. Lisanti, F. Ramisse, E. Hernandez, J. Cavallo, C. Pourcel, and
G. Vergnaud. 2005. Comparison of minisatellite polymorphisms in the Bacillus cereus
complex: a simple assay for large-scale screening and identification of strains most
closely related to Bacillus anthracis. Applied and Environmental Microbiology 71: 6613
- 6623.

 

Van Ert, M. N., W. R. Easterday, T. S. Simonson, J. M. U’Ren, T. Pearson, L. J. Kenefic,
J. D. Busch, L. Y. Huynh, M. Dukerich, C. B. Trim, .1. Beaudry, A. Welty-Bernard, T.
Read, C. M. Fraser, J. Ravel, and P. Keim. 2007. Strain-specific single-nucleotide
polymorphism assays for the Bacillus anthracis Ames strain. Journal of Clinical
Microbiology 45: 47 — 53.

95