ASSESSMENT OF ROD, CONE, AND INTRINSICALLY PHOTOSENSITIVE RETINAL GANGLION CELL (ipRGC) CONTRIBUTION TO THE CANINE CHROMATIC PUPILLARY RESPONSE  By  Connie Yun Yeh                A THESIS  Submitted to Michigan State University in partial fulfillment of the requirements  for the degree of  Comparative Medicine and Integrative Biology  Master of Science  2016    ABSTRACT  ASSESSMENT OF ROD, CONE, AND INTRINSICALLY PHOTOSENSITIVE RETINAL GANGLION CELLS (IPRGC) CONTRIBUTION TO THE CANINE CHROMATIC PUPILLARY RESPONSE  By  Connie Yun Yeh  Functional testing is a crucial part of assessing retinal and optic nerve diseases in human patients and animals  both in a clinical and research setting. This not only includes the diagnosis of disease, but also monitoring of disease progression and response to newly developed therapies. The electroretinogram (ERG) is the benchmark method for specific testing of retinal function and is routinely used in both clinical and research settings.  Altering the testing condition (background light and intensity of light stimulus) allows recording of rod and cone photoreceptor-specific responses.  For complete assessment of the visual system, the evaluation of the central visual pathways within the brain is also important.  Chromatic pupillometry was recently developed and measures the rate and amplitude of pupil constriction in response to light stimuli of different color, mostly blue and red. Since pupillometry involves the evaluation of retina, optic nerve, and components of the central visual pathways, it complements ERG and visual behavioral testing for complete functional assessment of visually impaired human and animal patients.  Chromatic pupillometry is likely going to be considered an additional standard technique in veterinary and comparative ophthalmology; therefore, validation in dogs is a high priority.  The goal of this thesis is to develop chromatic pupillometry for specific assessment of canine retina and optic nerve function.       Copyright by CONNIE YUN YEH 2016  iv                   This thesis is dedicated to my husband, Brad, who has been a constant source of support and encouragement during the challenges of graduate school and residency.  No matter where my career has taken me, he has always supported me 100%.  Thank you for enduring living in Lansing, MI, home of the Spartans, for 4 years despite being an avid Wolverine fan!  This work is also dedicated to my parents, Yung Hua and Pi Yun, who have always loved me unconditionally and whose good examples have taught me to work hard for the things that I aspire to achieve.  Thank you for being my biggest supporters.  I love all of you very much without all your support.      v  ACKNOWLEDGMENTS  My deepest appreciation goes to my mentor, Dr. Andras Komaromy, for his continuous guidance and support.  I can never thank him enough for all the great opportunities he provided for me.  Without him, I would not be where I am in my career currently, finishing a Masters degree and an ophthalmology residency!  I have learned so much from him over the past several years and am truly grateful for having the chance to work with him.  I thank him also for his never ending positive outlook on everything in life!   I would also like to thank my committee members, Dr. Simon Petersen-Jones, Dr. Eric Eggenberger, and Dr. Arthur Weber for their support, expertise, and guidance through the program.    Thank you to everyone in the Komaromy lab for all your help with this project, especially Christine Harman and Kristin Koehl for their technical and moral support, and Gabriel Stewart for his help compiling the anesthesia parameters into Excel.    A special thanks to Dr. Gustavo Aguirre and Dr. William Beltran for the use of the animals at the Retinal Disease Study Facility (RDSF) at the University of Pennsylvania.  A large portion of this project could not have been completed without their support.  Thank you to Dr. Karina E. Guziewicz for assistance in primer design, Melinda Frame (Michigan State University) for assistance with confocal microscopy, Cheryl Craft (University of Southern California) for the hCAR antibody, and the staff at the RDSF for their amazing technical support. vi  This work was supported by the NIH (EY-019304, 017549, 006855, T32-RR007063), the Foundation Fighting Blindness, and the Michigan State University College of Veterinary Medicine Endowed Research Funds.   vii  TABLE OF CONTENTS  LIST OF TABLES ........................................................................................................................ ix  LIST OF FIGURES....................................................................................................................... x  KEY OF ABBREVIATIONS........................................................................................................ xi  CHAPTER 1 - INTRODUCTION ................................................................................................ 1 1.1 Discovery of Melanopsin and a New Photoreceptor .................................................... 1 1.2 Morphology and Diversity of ipRGCs.............................................................................. 5 1.3 Brain Targets of ipRGCs ................................................................................................... 5 1.4 ipRGC Intraretinal Signaling ............................................................................................. 7 1.5 ipRGC Phototransduction ................................................................................................. 8 1.6 Response of Melanopsin to Light .................................................................................... 9 1.7 ipRGCs and the PLR ....................................................................................................... 11 1.8 Using Pupillary Light Reflex to Measure the ipRGC Response ............................... 13 1.9 Inherited Retinal Disease Canine Models .................................................................... 19 1.10 Purpose of the Current Study ...................................................................................... 23  CHAPTER 2  MATERIALS AND METHODS ...................................................................... 27 2.1 Animals .............................................................................................................................. 27 2.2 Anesthesia......................................................................................................................... 32 2.3 Chromatic Pupillometry ................................................................................................... 32 2.4 Data Analysis .................................................................................................................... 37 2.5 Electroretinography.......................................................................................................... 40 2.6 Sequencing and Cloning ................................................................................................. 40 2.7 qRT-PCR Analysis of Retinal Gene Expression ......................................................... 42 2.8 Immunohistochemistry (IHC).......................................................................................... 43  CHAPTER 3 - RESULTS .......................................................................................................... 45 3.1 Normal Chromatic Pupillometry Recorded From Wt Dogs........................................ 45 3.2 Primary Rod Disease Leads to Lost Pupil Responses to Low-intensity Blue Stimulus .................................................................................................................................... 47 3.3 Primary Cone Disease Leads to Reduced Pupil Responses to Bright Red Stimulus ................................................................................................................................................... 51 3.4 Response to Bright Blue Light is Maintained with Advanced Outer Retinal Disease ................................................................................................................................................... 55 viii  3.5 ipRGC Function Loss ...................................................................................................... 60 3.6 Variation in Constriction Amplitude: Reproducibility and Light Intensity Series ..... 62 3.7 Presence of ipRGC and Melanopsin Expression in Disease Retinas ..................... 69  CHAPTER 4 - DISCUSSION AND CONCLUSIONS............................................................ 76  CHAPTER 5 - FUTURE DIRECTIONS................................................................................... 83  REFERENCES ........................................................................................................................... 86      ix  LIST OF TABLES   Table 1.  Comparison of the maximal sensitivity for canine and human photopigments16 Table 2.  Canine inherited retinal diseases with identified gene mutation and ERG changes ....................................................................................................................................... 21 Table 3.  Summary of dogs used in the study ....................................................................... 29 Table 4.  Summary of dogs used for the molecular work .................................................... 31 Table 5.  Antibodies used in the study ................................................................................... 44   x  LIST OF FIGURES   Figure 1.  Hematoxylin and eosin staining of wild type canine retina ................................. 4 Figure 2.  Phototranduction in vertebrate (ciliary) vs. invertebrate (rhabdomeric) photoreceptors. ............................................................................................................................. 9 Figure 3.  Comparison of the spectral sensitivity curves for canine and human photoreceptors ............................................................................................................................ 17 Figure 4.  Chromatic pupillometry recording with the RETIport system with a Ganzfeld dome............................................................................................................................................. 34 Figure 5.  Machine measured pupil size vs. actual pupil size in 4 dogs........................... 35 Figure 6.  Pupillogram showing the PLR parameters of interest ....................................... 39 Figure 7.  Average (A) and individual (B) PLRs from the wt dogs..................................... 46 Figure 8.  Chromatic pupillometry and ERG results for dogs with primary rod disease 49 Figure 9.  Chromatic pupillometry and ERG for dogs with primary cone disease .......... 53 Figure 10. Chromatic pupillometry and ERG results for dogs with advanced outer retinal disease ......................................................................................................................................... 57 Figure 11.  PLRs from the dog affected by a mutation in RD3 and concurrent severe optic nerve head coloboma associated with the NEHJ1 mutation ..................................... 61 Figure 12.  PLRs from the wt and 2 CNGB3-mutant dogs that had the same chromatic pupillometry testing protocol performed within 4-5 months after the first recording ........ 64 Figure 13.  Light intensity series performed on wt and CNGB3-mutant dogs ................. 65 Figure 14.  Alignment of the amino acid sequence of canine melanopsin with other species (mouse, chicken, lizard and human)......................................................................... 71 Figure 15.  qRT-PCR results for canine models of inherited retinal disease................... 72 Figure 16.  Melanopsin immunostaining of representative retinal sections from wt and PDE6B-mutant dogs .................................................................................................................. 73 Figure 17.  Immunohistochemistry results of affected dogs compared to wt dog........... 74    xi  KEY TO ABBREVIATIONS   ACHM Achromatopsia   crd2 Cone-rod dystrophy 2  CEA Collie eye anomaly   DAG Diacyglycerol  erd Early retinal degeneration  ERG Electroretinogram  IHC Immunohistochemistry  IP3 Inositol triphosphate  IPL Inner plexiform layer  ipRGC Intrinsically photosensitive retinal ganglion cell   IV Intravenous  LCA Leber congenital amaurosis  LGN Lateral geniculate nucleus   OPN Olivary pretectal nucleus   PLC Phospholipase C   PIP2 Phosphatidylinositol 4,5-bisphosphate   PIPR Post-illumination pupil response   PLC Phospholipase C   PLR Pupillary light reflex   PRA Progressive retinal atrophy   PRCD Progressive rod cone degeneration   qRT-PCR Real-time quantitative reverse transcription-PCR xii  rcd1 Rod-cone dysplasia 1   rcd2 Rod-cone dysplasia 2  rcd3 Rod-cone dysplasia 3    RGC Retinal ganglion cell   SARDS Sudden acquired retinal degeneration syndrome  SCN Suprachiasmatic nucleus   wt Wildtype  XLPRA2 X-linked progressive retinal atrophy 2   1  CHAPTER 1 - INTRODUCTION There has been compelling evidence emerging over the past decade about a novel class of photoreceptors in the mammalian retina: a subset of retinal ganglion cells (RGCs) that express the photopigment melanopsin.1-7  These intrinsically photosensitive RGCs (ipRGCs) differ in form and function from the classic rod and cone photoreceptors.  They are important for a variety of non-image forming light responses due to their ability to measure ambient light levels (irradiance), including regulation of pupil size (pupillary light reflex, PLR), pineal melatonin production, sleep propensity, and the alignment of circadian clocks to the light-dark cycle (circadian photoentrainment).  Recent studies suggest that ipRGCs could also have image forming functions.  Since the discovery studies on these cells, and it is a rapidly developing field.  This study utilizes these new finding to better understand and assess the function of the classic photoreceptors and the ipRGCs.    1.1 Discovery of Melanopsin and a New Photoreceptor Vision scientists have long thought of rods and cones photoreceptors but there have been clues that other photoreceptors exist, including the preserved circadian photoentrainment and pupillary light reflex in mice lacking rods and cones.1-7  In 1927, Keeler identified a strain of mice that lacked rods, and he observed that they maintained a pupillary light response.1  iris may f1, 8  Since Keeler, other reports 2  have also supported the idea of a specialized, non-visual photoreceptor within the inner retina (nerve fiber layer, ganglion cell layer, and inner plexiform layer  Figure 1).2  Many vision scientists believed that the persistent light response were due to the residual cones in retinal degenerate mice.9  Furthermore, since light suppression of melatonin production by the pineal gland was still present despite the loss of rod photoreceptors, it was thought that the cone photoreceptors contribute to photic melatonin suppression and circadian photoentrainment.10  This theory was disclaimed when it was shown that a transgenic mouse model that lacked both photoreceptor types still had normal circadian photoentrainment and photic melatonin suppression.4   Similar observations noted above were found in human patients with advanced outer retinal (loss of rod and cone photoreceptor  Figure 1) disease and furthered the case for a novel inner retinal photoreceptor.11, 12    Besides the preservation of circadian photoentrainment in mice and humans with retinal degeneration, the spectral sensitivity of photoentrainment in wt Mesocricetus auratus (hamster) was located near 500 nm and similar to the absorption spectrum for rhodopsin; however, there were certain characteristics, such as low light sensitivity, considered unusual for rods and cones and suggesting a different photoreceptor.13, 14    These findings/clues motivated the discovery of a third retinal photoreceptor.  It came in 1998 from studies on amphibian dermal melanophores by Provencio and the finding of the new photopigment melanopsin .15  Since then, melanopsin has been found in the retina of primates, including human, rodents, rabbit, and cat.16-22  In situ hybridization 3  histochemistry showed that melanopsin is expressed in a subset of RGCs.16  Provencio at it is not involved in image formation but rather may mediate nonvisual photoreceptive tasks, such as the regulation of circadian rhythms and the acute suppression of pineal 16  This theory was supported by the observation that melanopsin-expressing RGCs project to the suprachiasmatic nucleus (SCN), which controls circadian rhythm.23  In 2002, two publications proved the existence of ipRGCs.17, 24  Berson et al. labeled RGCs that were found to innervate the SCN by injecting fluorescent microspheres into the rat hypothalamus.  They exposed the isolated retinas to light and recorded the responses from the labeled RGCs.  They responded to light by depolarizing and increasing their firing rate while the unlabeled RGCs lacked detectable responses.  The labeled RGCs also responded to light when input from the rods and cones was blocked by cobalt chloride.24  Berson et al. concluded that these RGCs are intrinsically photosensitive.   Subsequently, Hattar et al. found that these ipRGCs contain melanopsin and that their axons project to the SCN and other brain centers responsible to non-image forming functions.17  In support of these findings, specific ablation of ipRGCs eliminated non-image forming responses.25        4  Figure 1.  Hematoxylin and eosin staining of wild type canine retina. Layers of the retina: retinal pigment epithelium (RPE), photoreceptors (PR), outer nuclear layer (ONL), outer plexiform layer (OPL), inner nuclear layer (INL), inner plexiform layer (IPL), ganglion cell layer (GCL), nerve fiber layer (NFL). Calibration bar: 20 µm.                                               5  1.2 Morphology and Diversity of ipRGCs Berson and Hattar initially identified ipRGCs as a single type of RGC; however, since then multiple types of ipRGC have been identified.  There is morphological and functional heterogeneity with at least five types of ipRGCs, M1-M5, with M1-M3 being the most studied.26-32   M1 class cells were the first to be identified with somata of ~13-17 µm in diameter.17, 18, 24, 29, 31  These M1 cells are mostly located in the RGC layer, with some displaced to the inner nuclear layer.  M1 cells have a higher melanopsin immunoreactivity and intrinsic photosensitivity compared to the other ipRGCs.27, 29, 33  With a mean diameter of 15-21 µm, the somata of M2 cells are slightly larger than those of M1.29, 31  These cells express lower levels of melanopsin compared to M1 cells and therefore, are less intrinsically photosensitive.  M2 cells project minimally to the SCN and strongly to the olivary pretectal nucleus (OPN).27  M3 cells are similar to M2 cells in terms of dendritic field size, soma size, and complexity of their dendritic branching.31, 32  Two additional types of ipRGC with unique morphologies, M4 and M5, were revealed in a study by Ecker et al.30  M4 cells have the largest soma of any ipRGC subtypes and large, highly branched dendritic fields of about 302-.  M5 cells have compact, highly branched dendritic fields of about 149-  1.3 Brain Targets of ipRGCs The use of mouse lines with labeled ipRGCs allowed the identification of numerous targeted, non-image forming brain areas, such as SCN, OPN, intergeniculate leaflet 6  (IGL), ventral division of the lateral geniculate nucleus (vLGN), ventral subparaventricular zone, and ventrolateral preoptic nucleus.17, 33-35  Other brain regions such as the medial amygdale, lateral habenula, and periaqueductal gray are also targeted by ipRGCs but their function remains unclear.33  Distinct ipRGC subtypes seem to project to specific brain regions.  About 80% of ipRGCs projecting to the SCN are M1 cells.27  The OPN receives input from both M1 and M2 cells in similar proportions.27    M1 cells can be subdivided into Brn3b-positive M1 cells that mainly project to the OPN and Brn3b-negative M1 cells that project mainly to the SCN.36  Genetic ablation of Brn3b-positive M1 cells in mice leaves just the Brn3b-negative M1 cells, leading to an impairment in PLR but functional circadian photoentrainment.36  This suggests that different subtypes of ipRGCs may be responsible for specific behaviors.    Based on the projections to the non-image forming regions of the brain, it was previously thought that ipRGCs were not involved in vision.  However, recent studies have shown that ipRGC projections may be more extensive than previously thought, and include image forming visual functions, such as the dorsal and ventral aspects of the LGN, the core of the OPN, the posterior pretectal nucleus, and the superior colliculus.30, 37  Most of the M2, M4, and M5 cells project to the dorsal LGN.30  The functional significance of ipRGCs for image-forming vision still needs to be explored.  Recent data indicate that in mice and humans, ipRGCs may help with reception of spatial brightness.38   7  1.4 ipRGC Intraretinal Signaling Although ipRGCs are intrinsically photosensitive, they are also subject to intraretinal synaptic influences and serve as principle channels for delivering rod- and cone-driven information to non-image forming areas of the brain.25, 39-43  One piece of evidence is the presence of their extensive dendritic arbors that stratify in the inner plexiform layer (IPL), the synaptic layer in which bipolar and amacrine cells convey rod and cone signals to RGCs.17, 18, 24  Belenky et al. were able to identified synaptic contacts from both amacrine and ON bipolar cells on melanopsin-positive processes in the IPL of mouse retina.39  Another piece of evidence that ipRGCs are also subject to intraretinal synaptic influences is that melanopsin knock-out mice lack the intrinsic light response however, they still were able to photoentrain and retained PLR.44-46  On the other hand, in mice lacking melanopsin, rods, and cones, all non-visual responses to light were abolished.47, 48    ipRGC subtypes receive different inputs from the outer retina based on the location of their dendrites in either the ON or OFF layers of the IPL.32, 43, 49, 50  It still remains to be determined how the ipRGCs integrate their intraretinal inputs to generate the signals that mediate non-image forming vision.  Additional work is needed to establish the exact pattern of innervation of each ipRGC type which may provide insight to the physiological functions performed by each type of ipRGCs.     8  1.5 ipRGC Phototransduction Two melanopsin gene families exist: Opn4x, originally discovered in Xenopus laevis by Provencio, is expressed by all vertebrates except mammals, and Opn4m is found in all vertebrates including mammals.51  The sequence of both melanopsin families is more similar to invertebrate rhabdomeric photoreceptor opsins vs. vertebrate ciliary photoreceptor (rods and cones) opsins.15  This suggests that melanopsin and invertebrate phototransduction may be similar.  Although the precise cellular mechanisms of phototransduction in ipRGCs have not been fully characterized, the current model of melanopsin phototransduction (Figure 2) is that melanopsin activation leads to activation of a Gq/11-type G-protein.  There is then activation of phospholipase C beta 4 (PLC4).  Usually, PLC activation leads to the hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP2) which forms inositol triphosphate (IP3) and diacyglycerol s involvement in melanopsin phototransduction, the downstream effectors of PLC activity are unclear.  Further studies need to be completed to determine if DAG and IP3 are the exact second messengers.  Then there is opening of TRP6/7-type channels, voltage gated calcium channel activation which leads to action potential generation.    The chromophore for melanopsin is 11-cis retinal, similar to rod and cones, and after light stimulation, it is isomerized to all-trans retinal.  The mechanism of regeneration of 11-cis retinal in ipRGC has been a subject of much debate.  It is thought that melanopsin may be similar to invertebrate photopigments in that it has two thermostable 9  states (bistable photopigment).  This means that they have an ability to regenerate 11-cis-retinal without the need for a complex cycle of enzymatic reactions.    Figure 2.  Phototranduction in vertebrate (ciliary) vs. invertebrate (rhabdomeric) photoreceptors.  In vertebrate photoreceptors, the activation of the opsin triggers G-protein transducin (Gt) leading to the activation of phosphodiesterase (PDE) that hydrolyzes cGMP.  The decrease in cGMP closes the cyclic-nucleotide-gated (CNG) channels, decreasing the cation current and hyperpolarization of the photoreceptor cell.  In rhabdomeric photoreceptors, the activation of the opsin triggers Gq-protein leading to the activation of phospholipase C (PLC) that hydrolyzes phosphatidylinositol 4,5-bisphosphate (PIP2) which forms inositol triphosphate (IP3) and diacyglycerol (DAG).  There is activation of TRP channels, an increase in ionic current and depolarization of the photoreceptor cell.      1.6 Response of Melanopsin to Light ipRGCs response to light set them apart from rod and cone photoreceptors.  The most notable difference is that ipRGC depolarize upon light activation and photocurrents exhibit a TRP channel-like pharmacology, as mentioned in the previous section (Figure 1).  In addition, ipRGCs are less sensitive to light and have slow response kinetics.24, 52  The low sensitivity is thought to be due to the low membrane density of melanopsin in ipRGCs, which results in a lower probability of photon absorption.52  This is related to the fact that ipRGCs lack structural specialization, such as the outer segments of rods 10  and cones, to maximize the probability of photon capture.  The membrane density of melanopsin has been estimated to be about 8 thousand times lower  than that of photopigments in the outer segments of rods and cones (~3 µm-2 compared to ~25,000 µm-2).52  Although ipRGCs have low sensitivity, each captured photon generates a large and prolonged response and the slow response kinetics may provide for long temporal integration and reporting of ambient light in the environment.52  With increasing light intensities, ipRGCs increase their firing rate which then reduces to a steady plateau.       When stimulated by a prolonged light flash, the ipRGC voltage response rises to a transient peak and then gradually decays to a lower steady state level.53, 54  This finding is thought to be due to light adaptation.  There is a shortening in the time to peak of responses to brighter flashes and a reduction of the response amplitude to repeated flashes.53  The overall loss in sensitivity due to light adaptation is far less than the loss in sensitivity found in the rods and cones.55  Dacey et al. evaluated the contributions to the primate ipRGC response by obtaining response vs. intensity date under different light conditions and found that there is distinct rod, cone and melanopsin-initiated responses.21    Under dark adapted conditions, rods primarily detected light and this light response depolarized ipRGCs, triggering an action potential.  As the light increases in intensity, but still within the working range of rods, there is an increase in ipRGC firing.  In light adapted conditions, the rods are bleached and the cones and melanopsin initiate light responses.  Rods as well as the red (long wavelength sensitive or L) and green (medium wavelength 11  sensitive or M) cones trigger an short wavelength sensitive or S) co21  1.7 ipRGCs and the PLR Various non-image forming photic responses including circadian photoentrainment, PLR, and pineal melatonin suppression are mediated by the ipRGCs.4, 7, 10, 45, 48  Several investigations have sought to determine the contribution of ipRGCs to the PLR.  As previously discussed, the ipRGCs project to the OPN of the dorsal midbrain, forming the afferent limb of the PLR.27  Functional studies in mice have provided evidence for ipRGC modulation of the PLR.  In rodless and coneless (rd/rd cl ) mice, PLR is retained with rapid pupillary constriction following bright white light stimulation.7   Although PLR was present, the latency to maximal constriction was increased and the irradiance needed to produce the constriction was higher than in mutant vs. wt mice.  In mice with the melanopsin gene ablated PLR was similar to that of wt mice at low irradiances, but at high irradiances it was incomplete.44  Mice lacking melanopsin as well as rods and cones, lack pupillary responses.47, 48  The results from these studies show that rods, cones, and ipRGCs all contribute to the afferent pupillomotor signal, and the contribution of each photoreceptor is dependent on the light condition.         Studies in humans and non-human primates have also support a role for ipRGCs in the PLR.56  Following pharmacological blockade of rod and cone photoreceptor signals, PLR persisted and the spectral sensitivity of the response was close to that of melanopsin (~480 nm).  In macaque eyes stimulated with equiluminant red and blue 12  light, fast onset of pupil constriction was noted for both stimuli but the maximum constriction amplitude was greater with the blue light under constant illumination.  Also, a sustained, post-stimulus pupil constriction after high intensity light offset was noted and thought to be melanopsin driven.    McDougal et al. evaluated the individual contributions of rods, cones, and ipRGCs to the human PLR.55  They found tstimulus is below the threshold for activating ipRGCs, then the rod and cones determine the spectral sensitivity of the PLR: The spectral responses of the PLR are consistent with rods with little contribution from cones, since they rapidly adapt with steady-state light stimuli.  In contrast, if the stimulus is above the threshold for ipRGC activation, the spectral sensitivity is determined by melanopsin, and the ipRGCs are solely responsible for driving the PLR.    Furthermore, Gooley et al. showed that rods and cones are capable of driving the initial rapid pupil constriction following light stimulus onset and during exposure to continuous low-irradiance light.57  Similar to what was found by McDougal, the contribution of cones to pupillary constriction decreases over time during exposure to continuous light.   In blind individuals without rod and cone function, PLR is preserved at high irradiance 480 nm light but weak or absent at lower irradiance light.  These findings suggest that ipRGCs dominate PLR at high irradiances while rods and cones mediate PLR at continuous low irradiances.  In addition, in the absence of rod and cone function, the pupillary response was slow and sustained and was unable to tract intermittent light 13  stimuli suggesting that the classic photoreceptors are required for fast modulations in light intensity.  1.8 Using Pupillary Light Reflex to Measure the ipRGC Response  Due to the recent advances in understanding the ipRGCs and the previously mentioned studies on the contribution of rods, cones, and ipRGCs to the PLR, there have been renewed interests in PLR and its value as a noninvasive test for neuroretinal function.  PLR assessment is routinely performed as part of the ophthalmic examination of human patients and animals.  While this testing is done qualitatively in a clinical setting by describing the rate and extent of pupil constriction, pupillometry uses digital imaging for precise quantitative measurement of the pupil (Chapter 2).  Pupillometry with white light has been applied in as assessment of nociception during general anesthesia (for review, see Larson et al., 2015).58  Pupillometry has been applied in intensive care medicine and in patients that have survived cardiopulmonary resuscitation, the return of PLR is a valuable prognostic indicator for return of neurologic function.59-62  White light pupillometry has also been used to assess retinal function and outcome of retinal gene therapy.63-67  Leber congenital amaurosis (LCA) due to a four base-pair deletion in the RPE65 gene has been described in the Briard dog and served as a large animal model for human RPE65-LCA.68  Gene therapy using adeno-associated virus (AAV) vectors resulted in improved retinal function in affected Briard dogs as assessed by ERG and obstacle course vision testing.66  In addition, there was improved transmission of signals from the retina to higher visual pathways, as the results from white light pupillometry 14  showed that the treated dogs had improved pupil constriction.66  Chromatic pupillometry uses different light stimulus parameters based on well-established knowledge about the spectral sensitivity difference of photopigment in each photoreceptor, to activate each receptor system separately.  For example, humans are trichromats having red (L), green (M), and blue (S) cone pigments with a maximal sensitivity of 560 nm, 530 nm, and 430 nm, respectively.69, 70  The maximal sensitivity for human rhodopsin is ~495 nm.71-73  The spectral sensitivity of human melanopsin is 480 nm, similar to other species.16, 17, 21, 40, 47, 56    Chromatic pupillometry has been explored and optimized in a number of human studies.74-77  Kardon et al. developed a protocol to assess the contributions of the rods, cones, and ipRGCs to the PLR in both normal subjects and patients with neuroretinal visual loss.75  They tested red (640 nm) and blue light (467 nm) at three different light intensities (1, 10, 100 cd/m2).  It was thought that the low intensity red and blue light stimuli were most likely driven by the cones and rods, respectively.  The medium intensity red and blue light stimuli were most likely similar to the low intensity light stimuli but had a greater cone contribution.  High intensity red and blue light stimuli were most likely driven by cones and a combination of cones and ipRGCs, respectively.  A patient with retinitis pigmentosa showed a reduced pupil response to low intensity blue light.  There was a reduced pupil response to red light stimulation in a patient with achromatopsia.  A patient with ganglion cell dysfunction due to anterior ischemic optic neuropathy had loss of pupil response to both red and blue light.  A second study by 15  Kardon et al. applied the protocol to a group of patients with retinitis pigmentosa.76  They found that the median rod-, cone-, and melanopsin- weighted pupil responses were significantly reduced compared to normal subjects.  They compared the pupil nonrecordable ERG tended to have the greatest loss of pupil response.  Although these studies showed that chromatic pupillometry was a useful noninvasive diagnostic tool for monitoring outer and inner retinal function, the protocol did not seem to selectively activate rod, cone, and ipRGC responses independently.  For example, retinitis pigmentosa patients with abnormal but recordable scotopic ERGs did not have a rod-weighted pupil response that was significantly different than the normal subjects, indicating that the 1 cd/m2 blue light stimulus may not be selective enough to measure pure rod activity.    Park et al. aimed to develop a chromatic pupillometry protocol that would optimally assess the rods, cones, and ipRGCs.75-77  Their testing on normal subjects and patients with retinitis pigmentosa and LCA, found that low intensity (0.001 and 0.01 cd/m2) blue light stimulus (467 nm) in the dark, high intensity (~ 400 cd/m2) red light stimulus (640 nm) on a blue background, and high intensity (~ 400 cd/m2) blue light stimulus (467 nm) was able to preferentially test rods, cones, and ipRGCs, respectively.  Only the high intensity blue light stimulus in the dark was able to produce a sustained pupil response and this sustained response is most likely melanopsin driven.    16  Chromatic pupillometry has also been introduced over recent years for the assessment of the canine visual pathway.78-80  The absorption spectra of canine photoreceptors are similar to humans (except for human M-cones) (Table 1 and Figure 3).  Dogs are function dichromats, having combined red-green (L/M) and blue (S) cone pigments with a maximal sensitivity of 555 nm and 429-435 nm, respectively.81, 82  Canine rhodopsin has peak sensitivity of 506-510 nm.82  The spectral sensitivity of canine melanopsin has not been validated but it is assumed to be 480 nm, similar to other species, including humans.16, 17, 21, 40, 47, 56   Table 1.  Comparison of the maximal sensitivity for canine and human photopigments     Canine Human Rhodopsin 506-510 nm 495 nm L - opsin   560 nm M - opsin   530 nm L/M - opsin 555 nm   S - opsin 429-435 nm 430 nm Melanopsin 480 nm 480 nm      17      Figure 3.  Comparison of the spectral sensitivity curves for canine and human photoreceptors.  Courtesy of Dr. Randy Kardon, University of Iowa.   Grozdanic et al. used a handheld light source (Melan-100; BioMed Vision Technologies, Ames, IA) to performed chromatic PLR analysis in healthy dogs and dogs with sudden acquired retinal degeneration syndrome (SARDS) using light stimulus of different intensity and wavelength.78  Dogs affected with SARDS present with sudden onset of blindness and have a complete loss of photoreceptor activity based on the flatline ERG recording.83, 84  The etiology of SARDS is still unknown but it is thought to be immune mediated.85  The Melan-100 has a diode-based light source with blue light (480 nm) and red light (630 nm) and a function to change the light stimulus intensity.  Grozdanic et al. tested both red and blue light intensities of 3.47, 4.3, 5.3, 5.7, and 6 log cd/m2.  In 18  normal dogs, low intensity red and blue light stimuli can elicit a PLR but in dogs with SARDS, only the high intensity blue light stimulus (5.3 log cd/m2) was able to elicit a PLR.  Based on the spectral sensitivity of the photopigment in canine rods and cones, it is likely that their red light protocol primarily activated the L/M cones and was unable to full test the rods. The blue light most likely activated the ipRGCs.  The finding suggests a loss of outer retinal mediated PLR and the preservation of the inner retinal (ipRGC) mediated PLR.       As a follow-up to their initial study, Grozdanic tried to determine the reliability of the chromatic PLR results from the Melan-100 to diagnose retina and optic nerve diseases in canine cataract patients.79  From the results of the initial study performed in 2007, blue (480 nm) and red (630 nm) light stimuli at an intensity of 5.3 log cd/m2 (200 kcd/m2) were used for testing the PLR.  There was a high sensitivity and specificity in detecting retinal degeneration and retinal detachment in canine cataract patients by chromatic PLR.  Furthermore, chromatic PLR can be used to assess optic nerve disease, as optic neuritis patients were found to have absent chromatic PLR.      Whiting et al. developed a custom-made recording system and a chemical restraint protocol that was able to reliably quantify the canine PLR.80  PLR was recorded in normal dogs for red (627 nm) light stimuli at 13.5 and 15.0 log photons/cm2/s and blue (470 nm) light stimuli at 13.0 and 14.5 log photons/cm2/s.  There were robust PLRs with both red and blue light stimuli at the two intensities tested.  At the lower intensities of light (13.0 and 13.5 log photons/cm2/s), the constriction amplitude for the blue and red 19  light was similar.  At the higher intensities of light (14.5 and 15.0 log photons/cm2/s), the pupil redilated quickly after offset of the red light stimulus but there was a sustained pupil constriction after offset of the blue stimulus.  The sustained response to the bright blue light stimulus suggested that ipRGC input to the PLR is conserved in the dog. Whiting et al. also evaluated injectable vs. combination of injectable and inhalant (isoflurane) chemical restraint for PLR recording.  The combination of injectable and inhalant chemical restraint allowed for more consistent baseline pupil size measurements with minimal noise and the use of an eyelid speculum and conjunctival stay suture for eye positioning without too much stress on the dog.  Although the baseline pupil size was significantly reduced in dogs that received a combination of injectable and inhalant chemical vs. injectable chemical restraint alone, the PLR was still reliably measured (as small as 5% constriction).  Large PLR constriction amplitudes were observed even with the use of isoflurane.  Based on the results of both human and canine studies, chromatic pupillometry appears to be a reliable diagnostic tool for retina and optic nerve disease, and these studies provide a basis for the work described in this thesis.  1.9 Inherited Retinal Disease Canine Models Similar to humans, dogs are affected by various forms of inherited retinal diseases.86  There are many similarities between dogs and human eyes, including size, morphology, and density of photoreceptor distribution; these allow dogs to be good models for equivalent human diseases in order to study pathogenesis, and novel diagnostic 20  techniques and therapies. The availability of an unparalleled group of well-characterized canine retinal disease models at both Michigan State University (MSU) and the University of Pennsylvania (UPENN) provided us with a unique opportunity to test the hypothesis that rod-, cone-, and ipRGC-mediated pupil responses in canines can be specifically assessed by use of blue and red light stimuli.  The dogs available at these two universities included dogs with CNGB1  progressive retinal atrophy (PRA), CNGB3  achromatopsia (ACHM), PDE6B  rod-cone dysplasia 1 (rcd1), RD3  rod-cone dysplasia 2 (rcd2), PDE6A  rod-cone dysplasia 3 (rcd3), RPE65 LCA, PRCD  progressive rod cone degeneration (prcd), IQCB1  cone rod dystrophy 2 (crd2), RPGR  X-linked progressive retinal atrophy 2 (XLPRA2), and STK38L  early retinal degeneration (erd) (Table 2).   21  Table 2.  Canine inherited retinal diseases with identified gene mutation and ERG changes  22    23  1.10 Purpose of the Current Study Although chromatic pupillometry has been introduced over the recent years for the assessment of the canine visual pathway, the contribution of different cell populations to the response to specific light stimuli has not been determined in detail.78-80  The chromatic pupillometry methods and results from a human study form the basis on which we have formulated the work described in this thesis.77  The evaluation of the previously established human protocol was justified by the fact that the absorption spectra of canine photoreceptors are similar to humans (except for human M-cones) (Table 1 and Figure 3).    As mentioned previously, the availability of an unparalleled group of well-characterized canine retinal disease models provided us with an unique opportunity to test the hypothesis that rod-, cone-, and ipRGC-mediated pupil responses in canines can be specifically assessed by use of blue and red light stimuli.  The study resulted in an additional effective functional assessment tool for the canine retina, and helped to verify previously made predictions about the cell-specificity of particular pupillometry protocols used in human patients.76, 77    Our hypothesis was that pupil responses elicited by light stimuli of different color and intensity allow functional assessment of canine rod and cone photoreceptors as well as ipRGCs.    The specific aims were: 24  Specific Aim 1: Develop a chromatic pupillometry protocol for reproducible assessment of cone-mediated retinal function. Rationale: By testing dogs with isolated cone function loss (achromatopsia caused by mutations in the CNGB3 gene; CNGB3-ACHM92) and comparing the results to normal controls, we have a unique tool to verify that our stimulation protocol is specific for canine cones.  Currently, the most likely testing protocol for cones is the use of a bright red stimulus (640 nm, 400 cd/m2) on a blue background (480 nm, 25 cd/m2).76, 77  Specific Aim 2: Develop a chromatic pupillometry protocol for reproducible assessment of rod-mediated retinal function. Rationale: Dogs with progressive retinal atrophy (PRA) due to a mutation in the rod specific gene CNGB1 (CNGB1-PRA)87 and young animals (<6 months of age) affected by rod-cone dysplasia (rcd type 1  PDE6B gene mutation99; type 2  RD3 gene103; and type 3  PDE6A gene106) completely lack rod function while cone function is still intact. By comparing the pupil responses of these dogs to age-matched normal controls, we can define responses that are rod-specific. The most likely testing protocol consists of a dim blue stimulus (470 nm, 1 cd/m2) under dark adaptation.76, 77  Note that in older (>1 year) rcd-affected dogs, both rod and cone function is lost, providing an additional tool to support Specific Aims 1 and 2. Because optic nerve function is not affected in these dogs, they should still have normal ipRGC-mediated responses, likely elicited by use of a bright blue stimulus (470 nm, 400 cd/m2) under dark adaptation (see Specific Aim 3).  25   Specific Aim 3: Develop a chromatic pupillometry protocol for reproducible assessment of ipRGC-mediated retinal function. Rationale: A dog with optic nerve disease (severe optic nerve head coloboma) was used to verify that pupil constriction elicited by bright blue light originates from RGCs.  We can also draw some conclusions about testing conditions specific for ipRGCs based on the results from other dogs: All the dogs tested under Specific Aims 1 and 2 are expected to have comparable pupil responses following the presumed ipRGC specific light stimulus. Should this not be the case, then the testing protocol will have to be modified accordingly.  The most likely testing protocol consists of a bright blue stimulus (470 nm, 400 cd/m2) under dark adaptation.76, 77  Specific Aim 4: Establish normal reference values for chromatic pupillometry in dogs. Rationale: The testing of normal dogs will not only provide the age-matched (<6 months and >1 year) controls for the mutant dogs tested under Specific Aims 1 and 2, but will also yield normal reference values for future studies.  Specific Aim 5: Apply chromatic pupillometry for testing of dogs with inherited retinal diseases and variable severity of both rod and cone degeneration. Rationale: Once rod-, cone-, and ipRGC-specific testing protocols have been established, we will apply them to a number of other well defined canine retinal disease models with known genetic defects and decreased rod- and cone-function, such as RPE65-LCA68, 121, early retinal degeneration (erd; STK38L gene mutation)122, cone-rod 26  dystrophy 2 (crd2; IQCB1 gene mutation)118, and X-linked PRA type 2 (XLPRA2; RPGR gene mutation)120.   The protocol established could help evaluate melanopsin vs. rod and cone contribution to the PLR and could be used clinically to estimate the degree of RGC vs. the photoreceptor loss.  This is particularly important to assess novel therapies such as gene therapy and retinal prosthesis.    27  CHAPTER 2  MATERIALS AND METHODS 2.1 Animals For the chromatic pupillometry testing, 37 dogs with different stages of primary loss of rod-, cone-, combined rod/cone-, and optic nerve function were tested and compared to 5 wt dogs (Table 3).  This included dogs with CNGB1  progressive retinal atrophy (PRA), CNGB3  achromatopsia (ACHM), PDE6B  rod cone dysplasia 1 (rcd1), RD3  rod cone dysplasia 2 (rcd2), PDE6A  rod cone dysplasia 3 (rcd3), RPE65  Leber congenital amaurosis (LCA), PRCD  progressive rod cone degeneration (prcd), IQCB1  cone rod dystrophy 2 (crd2), RPGR  X-linked progressive retinal atrophy 2 (XLPRA2), STK38L  early retinal degeneration (erd), and NEHJ1  Collie eye anomaly (CEA).68, 87, 88, 92, 99, 103, 104, 106, 115-118, 120-129  The dogs were grouped and tested based on the previously reported retinal and optic nerve disease phenotype.  Dogs with primary loss of rod function included dogs affected by CNGB1-PRA, and young dogs (<1 year of age) affected by PDE6A-rcd3 and PDE6B-rcd1.101, 102  Dogs with primary loss of cone function included dogs affected by CNGB3-ACHM.  Dogs with primary loss of optic nerve function included a dog with severe optic nerve head coloboma due to NEHJ1-CEA.  This dog was also affected by RD3-rcd2.  Once rod-, cone-, and ipRGC-specific testing protocols were established based on testing of the group of dogs, we tested dogs with variable severity of rod and cone degeneration.  These included older dogs affected with PDE6B-rcd1, RD3-rcd2, and PDE6A-rcd3, and dogs affected with RPE65-LCA, PRCD-prcd, IQCB1-crd2, STK38L-erd, and RPGR-XLPRA2.  A light intensity series was also performed on 2 additional wt dogs and 2 CNGB3 affected dogs.  28  A complete ophthalmic examination, including vision assessment via testing of the menace response, slit lamp biomicroscopy (SL15, Kowa Optimed, Inc., Torrance, CA), indirect ophthalmoscopy (All Pupil II, Keeler Instruments Inc., Broomall, PA), and retinal photography (RetCamII, Clarity Medical Systems, Pleasanton, CA), was performed on all dogs included in this part of the study.  Twenty three additional dogs, both wt dogs and dogs with different stages of retinal diseases, were used for the molecular work of this study.  Seventeen dogs were used for sequencing/cloning and real-time quantitative reverse transcription-PCR (qRT-PCR) and 6 dogs were used for immunohistochemistry (IHC) (Table 4).  Two of the dogs used for IHC also had chromatic pupillometry performed.  The eyes were enucleated immediately following euthanasia with an overdose of sodium pentobarbital.  All studies were performed in compliance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and were approved by Michigan State University and the University of Pennsylvania Institutional Animal Care and Use Committees.      29  Table 3.  Summary of dogs used in the study  Disease Mutated Gene Functional Change Dog Gender Age (years) Normal     N1 F 1     N2 F 1     N3 F 0.6     N4 M 1     N5 F 2.5     N6* F 0.8     N7* M 0.8 CNGB1-PRA CNGB1 No/reduced rod function 1CNGB1 M 0.3 2CNGB1 M 5.2 CNGB3-ACHM CNGB3 No/reduced cone function 1CNGB3* M 4.8 2CNGB3 F 4.6 3CNGB3 M 1.6 4CNGB3 F 1.3 5CNGB3 M 1.4 6CNGB3* M 0.6 PDE6B-rcd1 (young) PDE6B No/reduced rod function 1PDE6B M 0.7 2PDE6B F 0.7 3PDE6B F 0.4 PDE6B-rcd1 (old) PDE6B No/reduced rod and cone function 4PDE6B F 6 5PDE6B F 5.3 RD3-rcd2 (old) RD3 No/reduced rod and cone function 1RD3 M 1.3 3RD3 F 3.7 4RD3 F 3.4 PDE6A-rcd3 (young) PDE6A No/reduced rod function 1PDE6A F 0.7 PDE6A-rcd3 (old) PDE6A No/reduced rod and cone function 2PDE6A M 3.8 RPE65-LCA RPE65 No/reduced rod and cone function 1RPE65 F 4.4 2RPE65 F 4.4 3RPE65 F 2.1 4RPE65 F 0.8 5RPE65 F 0.8 6RPE65 F 0.8   30  Table 3  Disease Mutated Gene Functional Change Dog Gender Age (years) PRCD-prcd PRCD No/reduced rod and cone function     1PRCD F 8.3 2PRCD M 5.9 IQCB1-crd2 IQCB1 No/reduced rod and cone function 1crd2 F 1.5 2crd2 F 1.5 3crd2 M 3.8 4crd2 M 3.8 STK38L-erd STK38L No/reduced rod and cone function 1erd M 8.4 2erd M 3.5 3erd M 3.5 RPGR-XLPRA2 RPGR No/reduced rod and cone function 1XLPRA2 F 7.2 2XLPRA2 F 6.5 3XLPRA2 F 5.8 RD3-rcd2 (old) and NEHJ1-CEA RD3 and NEHJ1 No/reduced rod, cone, and ipRGC function  2RD3§ M 3.3  * Light intensity series performed with multiple increases in stimulus intensity dogs    § Animal also had severe optic nerve head coloboma ducibility evaluated by repeat testing 4-5 months later            31    Table 4.  Summary of dogs used for the molecular work   Disease Dog Gender Age (years) Studies Normal 1984 F 0.8 Sequence/cloning 1985 F 0.9 Sequence/cloning/qRT-PCR V11614 - 0.06 qRT-PCR M656 M 0.5 qRT-PCR GS170 M 0.8 qRT-PCR Mateo M 0.5 IHC CNGB3-ACHM GS86 M 0.6 qRT-PCR M550 M 0.08 qRT-PCR GS53 F 2.2 qRT-PCR M676 M 0.4 qRT-PCR M681 F 0.4 qRT-PCR M614 F 2.5 qRT-PCR GS171 M 0.8 qRT-PCR M501 F 7.3 IHC PRCD-prcd X168 F 4.8 qRT-PCR X225 M 3.5 qRT-PCR P774 F 3 qRT-PCR P1450* F 8.2 IHC RPGR-XLPRA2 Z234 M 0.06 qRT-PCR PDE6B-rcd1 2055 F 0.06 qRT-PCR 1888 M 0.3 IHC 2016 F 1.5 IHC STK38L-erd E1044* M 8.4 IHC  * Chromatic pupillometry performed      32  2.2 Anesthesia In an initial pilot study, 5 dogs underwent chromatic pupillometry recordings using injectable chemical restraint alone with intravenously (IV) administered dexmedetomidine (Dexdomitor®, Zoetis, Florham Park, NJ) at a dose of 4 µg/kg. This sedation alone did not provide adequate restraint for reliable PLR recordings due to fluctuations in pupil size and movement of the eyes (data not shown).  Therefore, for all pupillometry recording sessions, dogs were placed under isoflurane gas anesthesia and positioned in sternal recumbency on a custom made table with a head rest. The dogs were premedicated with acepromazine at a dose of 0.02 mg/kg IV (AceproJect; Henry Illinois) given IV to effect (starting dose 4 mg/kg).  The dogs were then intubated and general anesthesia was maintained with isoflurane (2-3% vaporizer settingHenry Schein, Dublin, Ohio) in oxygen. Heart rate, respiratory rate, and body temperature were monitored throughout the procedure.  A portable multiparameter veterinary monitor (PM-9000Vet, Shenzhen Mindray Bio-Medical Electronics Co., Ltd., Nanshan, Shenzhen, P.R. China) was used to assess blood pressure, oxygen saturation, and end-tidal CO2. The level anesthesia was evaluated by monitoring changes in respiration or heart rate.  2.3 Chromatic Pupillometry Both the left and right eyes were tested separately, and the right eye was tested first.  A Barraquer eyelid speculum was inserted to ensure that the nictitating membrane and eyelids did not interfere with testing.  Stay sutures (4-0 Perma-, Ethicon, 33  Inc., Somerville, NJ) were placed in the superior and inferonasal bulbar conjunctiva 2 mm posterior to the limbus.  The stay sutures allowed globe manipulation and maintenance of the pupil in the central optical axis for pupillometry recording.  The eye was lubricated (Optixcare Eye Lube; CLC Medica; Waterdown, Ontario, Canada) prior to the start of the recording.  The untested eye was covered with a black plastic ocular shield (Oculo-Plastik, Inc., Montréal, Canada) which contained a hypermellose 2.5% ophthalmic demulcent (Goniosoft; OCuSOFT, Inc.; Rosenberg, Texas). Once the testing on the right eye was completed, the left eye was tested with the same process outlined above.    Recordings were performed with the RETIport system with a Ganzfeld dome (Roland Consult; Germany) (Figure 4).  This system allowed timed delivery of an LED light of a particular wavelength and intensity.  An infrared-sensitive camera located within the Ganzfeld dome was used for real-time pupil recording.  The system also contained an automatic pupil detector that measured the size of the pupil throughout the recording with a sample rate of 30 fps. The RETIport pupillometry system was developed for testing of human subjects, but we found that there was a linear correlation between the the pupil size by ~33% (Figure 5).  The actual canine pupil size was measured via a ruler that was placedome.  Since this pupillometry system was new, we continued to improve it for use in animals in collaboration with the Roland Consult company.34  Figure 4.  Chromatic pupillometry recording with the RETIport system with a Ganzfeld domeinto the Ganzfeld dome and correctly positioned so that the tested eye can be visualized by the infrared camera.  The system has a pupil detector that automatically detects the pupil (green circle) and measures the diameter of the pupil.  A light stimulus is delivered and the pupil response is recorded on the computer.     35     Figure 5.  Machine measured pupil size vs. actual pupil size in 4 dogs. D1 and D2 are normal dogs that were not included in the main study.  Solid black line shows x = y.           0 5 10 15 20 25 30 35 40 0 5 10 15 20 25 30 Machine Pupil Size (mm) Actual Pupil Size (mm) D1 D2 1CNGB3 6CNGB3 36  The testing parameters were adapted from previously published human protocols. 76, 77  After 10 minutes of dark adaptation (scotopic conditions), the eye was stimulated with a 1 second dim (1 cd/m2) and bright (400 cd/m2) blue light stimulus (470 nm).  Following 5 minutes of light adaptation to a blue background (480 nm, 25 cd/m2) the eye was stimulated with a 1 second bright red (640 nm, 400 cd/m2) light. The blue background light remained on throughout the testing (photopic condition).  Two runs were performed for each of the light intensities and the results were averaged.  While these intensities were photopically matched for the human eye, we found good agreement with canine spectral sensitivity (Figure 3).  It is important to note that as we were evaluating the system, in dogs that still had cone function, a small light artifact (movement of the pupil detector) was observed for several milliseconds after the bright red light stimulus onset but the pupil response quickly overcame the artifact.  In dogs that had an absence of cone function, the light artifact was seen throughout the time the bright red light stimulus was on.  We found that it was important to observe the real time video recording for the bright red light testing with blue background due to the light artifact to determine if there is a true pupil response.  Test-retest variability was assessed in 3 dogs (Table 3) by performing the same chromatic pupillometry testing protocol 4-5 months after the first recording.    In order to determine if variation in constriction amplitude found between the normal dogs could be due to entrance pupil size, pupil responses were measured over a range 37  of light stimulus intensities under both dark and light adaptation.  For this light intensity series, the right eye of 2 wt dogs and 2 CNGB3-mutant dogs were tested. After a 10 minute dark adaptation, alternating red and blue light stimuli were presented over an intensity range from 1 to 400 cd/m2 in ~0.5-log steps.  Light stimulus duration of 1 second was used.  Two runs were performed for each of the light intensities.  The same protocol outlined above was followed for the photopic condition except the addition of a blue background light to suppress rod function.  Blue background light intensity of 6 cd/m2 and 25 cd/m2 were tested. Light adaptation of 5 minutes with the blue background light was given prior to testing and remained on throughout the testing.   2.4 Data Analysis The data was exported to Microsoft Excel for analysis.  Absolute PLRs were recorded and averaged for the two runs performed for each of the light intensities.  The baseline pupil size was calculated by obtaining the median pupil size during 1 second prior to each stimulus onset.  The normalized pupil size was then calculated by dividing the averaged absolute pupil size by the baseline pupil size.  When both the right and left eyes were tested, the normalized pupil size for both eyes was averaged.  The maximum constriction amplitude was defined as the minimum pupil size after stimulus-onset.  The latency was defined as the time between stimulus onset and the beginning of pupil constriction.77   A method to determine the onset of the pupil light reflex was devised by Bergamin et al. and it involved filtering, as well as analysis of the first and second derivative.130  Filtering of the data as well as analysis of the first and second derivative of the pupil movement as described in Bergamin et al. was attempted but was unsuccessful due to the low sample rate of 30 fps.130  Therefore, latency was 38  determined by evaluating the pupil response graph for the time from stimulus onset to the beginning of pupil constriction.  PLR parameters that can be calculated are shown in Figure 6.    Anesthesia records of the tested dogs were evaluated to determine if PLRs were affected by the level of anesthesia as measured by heart rate, respiratory rate, isoflurane level, end tidal CO2 level, and blood pressure.  Results were presented as mean ± SD.  F t-test or Mann-Whitney U test were performed to measure any statistically significant difference in latency and constriction amplitude between wt dogs and affected dogs in the 3 different disease groups for all testing protocols.  The relationship between baseline pupil size and constriction amplitude was evaluated by Pearson correlation.  Statistical computations were performed in Microsoft Excel, GraphPad (www.graphpad.com/quickcalcs/contMenu/), and VassarStats (www.vassarstats.net/index.html).  Differences were considered statistically significant if the P-value <0.05.     39  Figure 6.  Pupillogram showing the PLR parameters of interest.  The parameters can be calculated as indicated.       40  2.5 Electroretinography Standard scotopic and phototopic full-field electroretinograms (ERG) were recorded in select dogs (Table 3) under isoflurane anesthesia during the same chromatic pupillometry recording session using the Roland Consult system with a Ganzfeld dome, Jet contact lens electrodes (Fabrinal Eye Care; Switzerland), and commercially available platinum subdermal needle electrodes (Grass Technologies; Warwick, RI).  In these selected dogs, chromatic pupillometry was only performed in one eye.  The ERG was recorded first in the left eye followed by chromatic pupillometry in the right eye.  The untested eye was covered with a black plastic ocular shield as described above. The left pupil was dilated with tropicamide 1% ophthalmic solution (Akorn Inc., Lake Forest, IL) prior to electroretinography.  Rod and mixed cone-rod mediated responses were recorded after 20 min of dark-adaptation with scotopic single white flash stimuli of three different light luminances (0.01, 3, and 10 cds/m2). Multiple responses (25 for the 0.01 cds/m2 single white flash and 10 for the 3, and 10 cds/m2 single white flash) were averaged. Following 10 min of light-adaptation to white background illumination of 30 cd/m2, 1 Hz single white flash (3 and 10 cds/m2) and 30 Hz white flicker (3 cds/m2) cone-mediated signals were recorded.  Multiple responses (10 for the 1 Hz single flash and 90 0.05 s sweeps for the 30 Hz flicker) were averaged.    2.6 Sequencing and Cloning Normal canine retina was collected from a wt dog and flash frozen immediately following euthanasia. Total RNA was isolated from the retina using TRIzol reagent (TRIzol; Invitrogen, Carlsbad, CA) after homogenization.  First stranded cDNA was synthesized from 2 µg of   RNA using High Capacity Reverse Transcription Kit (Applied 41  Biosystem; Waltham, MAuctions.  The resultant cDNA was used in a 50 µL PCR reaction using the  (Epicentra; -ACCACCCCCAGGATGAAC--CTGCAGGCTTGTCCCTGT- designed using Primer3 (http://frodo.wi.mit.edu) and the predicted canine sequence (CanFam 2.0) assembly; http://genome.ucsc.edu/cgi-bin/hgGateway).  Each 50 µL reaction contained PCR grade water, FailSafe PCR enzyme mix, 1 µL (100ng/ µL) DNA template, 1 µL of both forward and reverse primers, and one of the 12 different FailSafe PCR 2X PreMixes (A-L).  PCR reaction was performed under the following conditions: an initial denaturation step at 94°C for 3 min, then 94°C for 30 s, 58° for 1 min, and 72°C for 2 mins for 35 cycles, followed by a final extension at 72°C for 5min.     PCR products were electrophoresed on 1.5% agarose gel containing ethidium bromide and a single DNA band of the correct size was observed for FailSafe PCR 2X PreMix G. The DNA was purified using the QIAquick Gel Extraction Kit (QIAGEN Inc., USA; was cloned into t-TOPO® TA vector using the TOPO TA cloning kit (Thermo Fisher Scientific; Waltham, MA) according to the provided protocol.  The plasmid was (Promega; Madison, WI) and 5-10 individual clones were sequenced using the Applied Biosystems Automated 3730 DNA analyzer (Applied Biosystems, Foster City, CA, USA), and aligned to the predicted sequence (CanFam 2.0 assembly 42  (http://genome.ucsc.edu/cgi-bin/hgGateway) using Sequencher 4.2.2 software (Gene Codes Corporation, Ann Arbor,MI, USA) (GeneBank KU341721).  The predicted amino acid sequence of the canine melanopsin was aligned with other species using the program Clustal Omega (http://www.ebi.ac.uk/Tools/msa/).  2.7 qRT-PCR Analysis of Retinal Gene Expression Primers and Taqman Probes were designed for canine Opn4 using the Primer Express Software Version 2.0 (Applied Biosystems, Foster City, CA).  Primer pair and probe were designed to neighboring exon sequences to ensure that only cDNA and not genomic DNA was amplified. Using cDNA synthesized as described in the above section, qRT-PCR was performed with the custom designed primer pairs MelDegE67F (forward  GCGGCTACAGAGAGAGTGGAA) and MelDegE67R (reverse - ACATGAACTCCGTGCCAGC) and probe (CTTTCGCTGGGTATT) that spans the junction of exons 6 and 7.  All the qRT-PCR reactions were performed in 96 well plates using an ABI 7500 real-time PCR machine with the 7500 detection software (v2.0.1, Applied Biosystems, Foster City, CA). Cycling parameters were as follows 50°C for 2 min, then 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Relative melanopsin/Opn4 gene expression was compared with the GAPDH product and calculated as 1/[2^(CtGene  CtGAPDH)].  The ratio of relative gene expressions was calculated between the diseased eye and wt 131  Ratio that was different from 1 was relevant and indicated either an increase (>1) or decrease (<1) of gene expression.      43  2.8 Immunohistochemistry (IHC) Retinal IHC was performed as previously described.131-133  Following enucleation, the globes were fixed in 4% paraformaldehyde for 3 hours and then in 2% paraformaldehyde for 21 hours, both in 0.1 mol/L PBS at 4°C.  Subsequently, the tissue was processed for embedding in optimal cutting temperature medium.131-133  Cryosections were then cut at 10 µm thickness.  Immunohistochemical staining was performed using the antibodies outline in Table 5.  A custom made rabbit anti-canine melanopsin N- terminal (NH2- MNPPSGPGAQEPGC-amide) and C-terminal (CAKAPLRPRGQAVETPGKV-amide) antibody (21st Century Biochemicals; Marlboro, MA) was generated and affinity purified.   Alexa Fluor®-labeled chicken anti-rabbit IgG, goat anti-rabbit IgG, or goat anti-mouse IgG was used as secondary antibodies.  DAPI stain was used to detect cell nuclei.  Slides were mounted with Gelvatol and were imaged using the Olympus FluoView FV1000 confocal laser scanning microscope (Olympus America, Inc, Center Valley, PA).            44  Table 5.  Antibodies used in the study   Antigen Host Catalogue No./Source Working Dilution Normal Retina Localization Cone alpha transducin (GNAT2)           Rabbit polyclonal Santa Cruz sc-390 1:5000 Cone outer segments Human cone arrestin (hCAR) Rabbit polyclonal Cheryl Craft (University of Southern California) 1:5000 Cone photoreceptors NeuN cloneA60 Mouse polyclonal Millipore MAB377 1:2000 Ganglion cells Neurofilament 200 (NF200) Rabbit polyclonal Sigma N4142 1:1000 Nerve fiber, outer and inner pexiform layer L/M opsin Rabbit polyclonal Millipore AB5405 1:500 Outer segments of L/M - cones Melanopsin 1 Rabbit 21st Century 1:1000 ipRGCs Rhodopsin  Mouse monoclonal Millipore MAB5316 1:1000 Rod outer segments/axons and pedicles  Santa Cruz Biotechnology Inc., Santa Cruz, CA; Millipore Corporation, Temecula, CA; Sigma-Aldrich Co. LLC., St. Louis, MO; 21st Century Biochemicals, Marlboro, MA    45  CHAPTER 3 - RESULTS 3.1 Normal Chromatic Pupillometry Recorded From Wt Dogs The testing parameters developed based on human protocol 77 were performed on 5 wt dogs (Figure 7).  After a 10-minute dark adaptation, the mean pupil diameter of the 5 wt dogs was 10.8 ± 2.4 mm. The mean constriction amplitudes induced by the dim blue/rod testing, bright blue/ipRGC testing, and bright red/cone testing stimuli in wt dogs were 21.3 ± 10.6%, 50.0 ± 17.5%, and 19.4 ± 7.4% respectively.  The mean latency induced by the dim blue/rod testing, bright blue/ipRGC testing, and bright red/cone testing stimuli in wt dogs were 0.26 ± 0.05 s, 0.28 ± 0.10 s, and 0.32 ± 0.03 s respectively. The PLRs to the bright blue stimuli were characterized by a sustained response, which is thought to be melanopsin driven based on previous studies.77 The melanopsin response was sustained for several minutes (mean ± SD: 7.7 ± 4.6 min) after the offset of the bright blue stimulus. A small light artifact (movement of the pupil detector) that lasted for several milliseconds after the light stimuli onset was observed for cone testing conditions.    A considerable variation in pupil constriction amplitude was noted between individual dogs (Figure 7B).  There was a significant positive correlation between baseline pupil size and constriction amplitude for the ipRGC testing protocol (r=0.72, p<0.05) but not for the rod (r=0.46, p=0.19) or cone (r=-0.27, p=0.45) testing protocol.  No other obvious causes for this variation could be identified, including age, gender, and anesthesia level.   46  Figure 7.  Average (A) and individual (B) PLRs from the wt dogs. The gray shaded area and black bar represents the 1 second light stimulus presentation.  Open circle indicates the light artifact.   47  3.2 Primary Rod Disease Leads to Loss of Pupil Responses to Low-intensity Blue Stimulus Figure 8 shows the normalized PLRs to the 1-second stimuli for each of the dogs affected by mutations in PDE6A, PDE6B, and CNGB1 compared to the normalized PLRs averaged for the five wt dogs.  The low-intensity blue light stimuli in the dark that tested the rods did not induce measurable PLRs in any of the dogs affected by the three diseases.  A sustained response to the bright blue light stimuli represents the melanopsin driven response and was still present in all affected dogs.  The bright-intensity red light stimuli with a bright blue light background that tested the cones resulted in measurable PLRs in most of the affected dogs confirmed also by the video observation of pupil constriction, with the exception of the 8 month old PDE6A- and CNGB1- mutant dogs.      The chromatic pupillometry results correspond with the previously described functional phenotype of these diseases as shown by the ERG.  One of the younger 5 month old PDE6B-mutant dogs had an ERG performed during the same session as the chromatic pupillometry.  ERGs from a representative wt dog and the younger PDE6B-mutant dog are illustrated (Figure 8B).  In the PDE6B-mutant dog, there was absent rod-mediated ERG response and preservation of reduced cone photoreceptor responses. As mentioned previously, the 8 month old PDE6A-mutant dog and the 2 CNGB1-mutant dogs were expected to still have some remaining cone function but this was not found with chromatic pupillometry testing. The bright-intensity red light stimuli with a blue background light did not result in measureable PLRs (Figure 8A), which was also 48  confirmed by observing the real time video recording.  However, a small amplitude deflection in the pupil tracing was often seen, which could have resulted from loss of tracking of the true pupil borders or a reflection onto the pupil area causing an artifact.  The 8 month old PDE6A-mutant dog also had an ERG performed during the same chromatic pupillometry testing session and the ERG showed nonrecordable rod-mediated response but a reduced, yet recordable cone mediated ERG response (Figure 8B).  It was difficult to ascertain with certainty whether a small cone mediated pupil response was present or due to an artifact in the pupil tracing.   The mean constriction amplitude induced by the bright blue for all the affected dogs and bright red stimuli for the affected dogs excluding the non-responders were 49.1 ± 13.4% and 24.2 ± 23.6%, respectively.  Compared to wt dogs, there was no significant difference in constriction amplitude for both the bright blue (p=0.89) and bright red stimuli (p=0.55). The mean latency induced by the bright blue/ipRGC testing and bright red/cone testing stimuli for all the affected dogs were 0.32 ± 9.56 s and 0.27 ± 9.32 s, respectively.  Compared to wt dogs, there was no significant difference in latency for both the bright blue (p=0.37) and bright red stimuli (p=0.89).   A variation in pupil constriction amplitude was also noted between individual PDE6B-mutant dogs similar to what was found for the wt dogs and no obvious causes for this variation could be identified, including age, gender, and anesthesia level.  No significant correlation between baseline pupil size and constriction amplitude for the ipRGC (p=0.14) or cone (p=0.84) testing protocol was found.    49  Figure 8.  Chromatic pupillometry and ERG results for dogs with primary rod disease.  (A) PLRs from dogs affected by mutations in CNGB1, PDE6A, and PDE6B.  Dark, bold blue and red lines represent averaged PLRs from wt dogs.  Lighter blue and red lines represent individual PLRs from affected dogs.  The  represents the non-recordable PLR from the 8 month old PDE6A-mutant dog and the CNGB1-mutant dogs.  The gray shaded area and black bar represents the 1 second light stimulus presentation.  (B) Representative full-field ERGs recorded from a young PDE6B- and PDE6A-mutant dog. Responses were recorded from a wt dog for comparison.  In the young PDE6B- and PDE6A-mutant dogs, rod-mediated response was non-recordable while the cone-mediated function was recordable but the amplitude was reduced compared to wt.  50  Figure 8    51  3.3 Primary Cone Disease Leads to Reduced Pupil Responses to Bright Red Stimulus In the 6 dogs affected by the CNGB3 mutation, response to bright red stimulus was mostly absent; however, there was interference due to the light artifact (Figure 9A). A well-preserved response to both dim and bright blue stimulus was noted.  The results of the chromatic pupillometry correspond with the ERG (Figure 9B).  There was normal rod function and loss of cone function in the affected dogs compared with a wt dog.   Although most chromatic pupillometry results were as expected based on the phenotypic description of the disease, there were, however, 2 CNGB3-mutant dogs that did have pupil responses to bright red light stimulus, but which were very reduced (Figure 9A).  A small recordable photopic ERG was also observed in these 2 dogs, indicating incomplete ACHM (Figure 9B).  These two dogs underwent behavioral vision testing in the obstacle avoidance course as outlined in a previous study and their performance was the same as other CNGB3-mutant dogs, indicating that their remaining cone function was not enough to support day vision (results not shown).134     The mean constriction amplitude induced by the dim blue and bright blue stimuli were 31.2 ± 6.2% and 63.4 ± 8.7%.  Compared to wt dogs, the constriction amplitude for the dim blue stimuli was significantly greater (p=0.02) and for the bright blue stimuli was not significantly different (p=0.16).  The mean latency induced by the dim blue stimuli and bright blue stimuli were 0.29 ± 0.06 s and 0.27 ± 0.07s. Compared to wt dogs, there was no significant difference in latency for both the bright blue (p=0.26) and bright blue stimuli (p=0.78). 52   For the 2 CNGB3-mutant dogs that had pupil constriction with the bright red light, the mean constriction amplitude and median latency induced by the bright red stimuli were 9.1 ± 2.4% and 0.26 ± 0.05 s, respectively.  The mean latency was similar compared to normal dogs but the mean constriction amplitude was considerably lower.  Sample size was too small for quantitative, statistical analysis.    A variation in pupil constriction amplitude was also noted between individual CNGB3-mutant dogs similar to what was found for the wt dogs and no obvious causes for this variation could be identified, including age, gender, and anesthesia level.  There was a significant positive correlation between baseline pupil size and constriction amplitude for the ipRGC testing protocol (r=0.72, p<0.05) but not for the rod (r=-0.34, p=0.34) testing protocol.   53  Figure 9.  Chromatic pupillometry and ERG for dogs with primary cone disease.  (A) PLRs from dogs affected by mutations in CNGB3. (a) Represents the PLRs from the CNGB3-mutant dogs with no response to bright red stimuli with blue background, as expected.  (b) Represents the PLRs from the CNGB3-mutant dogs with reduced response to bright red stimuli with blue background. Dark, bold blue and red lines represent averaged PLRs from wt dogs.  Lighter blue and red lines represent individual PLRs from affected dogs. The gray shaded area and black bar represents the 1 second light stimulus presentation.  (B) Representative full-field ERGs recorded from CNGB3-mutant dogs. (a) Responses recorded from a wt dog for comparison. (b) Normal rod-mediated function and loss of cone-mediated function in the CNGB3-mutant dog.  Although a lower amplitude was noted for the rod ERG, it was still within normal reference range. (c) Normal rod-mediated function and small cone-mediated function (black arrows) in the CNGB3-mutant dog with a response to bright red stimuli with blue background recorded via chromatic pupillometry. The black star indicates an artifact.  54  Figure 9     55  3.4 Response to Bright Blue Light is Maintained with Advanced Outer Retinal Disease With retinal disease progression, there was an absent pupillary response to dim blue and bright red stimuli, indicating loss of rod and cone function (Figure 10A).  The melanopsin response was maintained in all dogs even when rod- and cone-mediated retinal function was not detectable, providing strong evidence that this stimulus is specific for inner retina.    The melanopsin post-illumination sustained pupil response was maintained and there was a significant increase in the mean latency in the retinal disease dogs (0.61 ± 0.26 s) by 0.33 s compared to the wt dog (p=0.0003), consistent with a melanopsin mediated pupil response without rod or cone influence.  The mean initial, transient constriction amplitude induced by the bright blue stimuli was 38.3 ± 13.9% and when compared to wt dogs, there was a significant decrease in constriction amplitude by 11.7% (p=0.03), indicating loss of contribution of rods and cones to the initial constriction amplitude.      One of the older PRCD dogs had both rod and cone function preserved that was detected by both the chromatic pupillometry and ERG (Figure 10).   One of the older STK38L-mutant dogs had absent pupil response to all light stimuli including bright blue.  The loss of inner retinal response is due to advanced retinal degeneration involving the inner retina.107, 116 The function of STK38L is not known to cause changes in the inner retinal response.    56  A variation in pupil constriction amplitude was also noted between individual affected dogs similar to that found for the wt dogs and no obvious causes for this variation could be identified, including age, gender, and anesthesia level; however individual variations in disease severity could be possible.  No significant correlation between baseline pupil size and constriction amplitude for the ipRGC (p=0.14) or cone (p=0.43) testing protocol was found.   57  Figure 10. Chromatic pupillometry and ERG results for dogs with advanced outer retinal disease.  (A) PLRs from dogs affected by mutation in STK38L, IQCB1, RPGR, RPE65, and PRCD, and older dogs affected by mutations in PDE6B, RD3, and PDE6A. Dark, bold blue and red lines represent averaged PLRs from wt dogs.  Lighter blue and red lines represent individual PLRs from affected dogs. The gray shaded area and black bar represents the 1 second light stimulus presentation. The  represents the non-recordable bright blue light PLR from the older STK38L-mutant dog.  The black arrow represents the preservation of rod and cone function in the older PRCD-mutant dog. (B) Representative full-field ERGs recorded from an older PDE6B-, STK38L-, and PRCD-mutant dog. Responses were recorded from a wt dog for comparison.  For the PDE6B- and STK38K- mutant dogs, the rod- and cone- mediated function was non-recordable.  For the PRCD-mutant dog, the cone-mediated function was recordable but the amplitude was reduced compared to the wt.  58  Figure 10   59  Figure 10   60  Figure 10       3.5 ipRGC Function Loss The dog with severe optic nerve head coloboma associated with the NEHJ1 mutation was also affected with RD3-rcd2 and therefore, all pupillary responses were absent, including to the bright blue stimulus (Fig. 11).      61   Figure 11.  PLRs from the dog affected by a mutation in RD3 and concurrent severe optic nerve head coloboma associated with the NEHJ1 mutation. Dark, bold blue and red lines represent averaged PLRs from wt dogs.  Lighter blue and red lines represent the PLRs from the affected dog. The gray shaded area and black bar represents the 1 second light stimulus presentation.   62  3.6 Variation in Constriction Amplitude: Reproducibility and Light Intensity Series By retesting 3 dogs (1 wt and 2 CNGB3-mutants) twice within 4-5 months, we were able to show that recorded PLRs were highly reproducible, supporting the diagnostic value of chromatic pupillometry in dogs (Figure 12).  We hypothesized that the variation in constriction amplitude found between the normal dogs could be due to entrance pupil size and therefore, the amount of light entering the eye.  To examine the role of light stimulus intensity on pupil response both in scotopic and photopic conditions, a light intensity series was performed on 2 wt dogs (Figure 13).   Under scotopic conditions (Figure 13A), saturation of peak amplitudes occurred at high light intensities (32-400 cd/m2) and there was a fast recovery with the red light stimuli. The PLRs to the blue stimuli were characterized by a sustained post-illumination response for intensities  32 cd/m2 and this sustained response is attributed to melanopsin in the ipRGC.  A light artifact was noted for 0.1 s after red stimulus onset at high light intensity (400 cd/m2) under scotopic conditions.  The photopically matched red and blue stimuli under scoptic conditions are shown in Figure 13C.  Under photopic conditions with a blue background light of 25 cd/m2 (Figure 13B), the PLRs to the red stimuli are fairly similar to the blue stimuli of the same intensity and were thought to be cone mediated. No sustained response was noted with blue stimuli under photopic condition, which suggests that the blue background also suppressed melanopsin activity.   A light artifact was noted for about 0.1 s after red and blue stimuli onset at high light intensities (100 and 400 cd/m2) under photopic conditions.  The 63  photopically matched red and blue stimuli under photopic conditions are shown in Figure 13D.  Two CNGB3-mutant dogs were also test under photopic conditions.  There was absence of response with all light intensities tested and a light artifact was clearly noted at a high red light intensity of 400 cd/m2 (Figure 13E).    Based on the light intensity series, it is possible that a smaller baseline pupil size would allow less light to enter the eye, contributing to the difference in constriction amplitude between dogs.  Although the correlation analysis showed that a larger baseline pupil size appeared to be associated with a greater constriction amplitude for the different testing protocols, especially for the bright blue stimuli, there also appeared to be other factors that contribute to the variation in constriction amplitude.   64  Figure 12.  PLRs from the wt and 2 CNGB3-mutant dogs that had the same chromatic pupillometry testing protocol performed within 4-5 months after the first recording.  In general, there was no obvious difference in the first and second recording for any of the pupillary response parameters. (       First recording;        Second recording)   65  Figure 13.  Light intensity series performed on wt and CNGB3-mutant dogs.  Scotopic (A) and photopic (B) light intensity series performed on 2 wt dogs.  The average PLRs for the 2 wt dogs to the red (a) and blue (b) light at 5 intensity levels are represented. (C) Photopically matched red and blue light stimuli for scotopic conditions.  (D) Photopically matched red and blue light stimuli for photopic conditions.  (E) Photopic light intensity series performed on 2 CNGB3-mutant dog.  The average PLRs for the affected dog to the red and blue light at 5 intensity levels are represented.  The black arrow represents the light artifact noted at a high red light intensity of 400 cd/m2 with blue background of 25 cd/m2.  For all graphs, the gray shaded area and the black bar represents the 1 second light stimulus presentation.     66      67  Figure     68      69  3.7 Presence of ipRGC and Melanopsin Expression in Disease Retinas In order to design antibodies and qRT-PCR primers for canine melanopsin/Opn4, the gene was cloned.  The melanopsin full-length cDNA contains a 1,446 bp open reading frame encoding a 482 amino acid protein (Figure 14).  Alignment of the isolated canine sequences with those from mouse, chicken, lizard and human sequences, show some homology.  The highest sequence similarity (89.60%) was with the cat homolog, whereas weaker (46.63%) similarity was evident with the Italian wall lizard homolog.  There is about 75.4% sequence similarity to the mouse and rat homolog and about 78.9% to the human homolog.      As retinal disease continues to progress, there is severe retinal degeneration leading to some loss of ipRGCs and subsequently, a decrease in their melanopsin expression (Figure 15).  There was a significant decrease of canine melanopsin expression in advanced stages of PRCD (p<0.05).  Melanopsin expression in early onset retinal degeneration, RPGR- and PDE6B-mutant dogs, appeared to be decreased and comparable to PRCD.  In contrast, there was no significant change in melanopsin expression in CNGB3-mutant dogs with achromatopsia, a non-degenerative retinal disease (p=0.193).     The IHC on selected disease models corresponds with the chromatic pupillometry results in that melanopsin expressing cells with their dendritic arborizations were observed (Figure 16).  Representative IHC on a young PDE6B-mutant dog showed a reduction in the rod outer segment lengths and relative preservation of cone 70  photoreceptors early in the disease although there is stunting of the outer segments (Figure 17).  With progression of the disease, in the old PDE6B-mutant dog cones are lost.  Melanopsin immunostaining of representative retinal sections from the young and old PDE6B-mutant dogs confirm the presence of ipRGCs (Figure 16), which corresponds to the bright blue/ipRGC chromatic pupillometry testing results.  Similarly, in addition to the previously reported morphologic abnormalities and gradual loss of cones in CNGB3-mutant dogs, ipRGC do not appear to be affected by the disease.93, 94, 97  In contrast, IHC from the one STK38L-mutant dog showed loss of the normal retinal architecture.107, 116, 131  RGCs are completely lost due to severe retinal degeneration (Figure 17).  This corresponds to the negative or flat line bright blue/ipRGC chromatic pupillometry testing results for this dog.  71  Figure 14.  Alignment of the amino acid sequence of canine melanopsin with other species (mouse, chicken, lizard and human).  Residues that are identical to the canine sequence are shaded.  Percentage identity of canine melanopsin to other species is reported at the end of the alignment.   72        Figure 15.  qRT-PCR results for canine models of inherited retinal disease. There was a significant decrease (**) in melanopsin/Opn4 expression in PRCD-mutant retinas compared to wt (p<0.05). The expression levels in the individual RPGR- and PDE6B-mutant samples were at the lower end of wt range.   73  Figure 16.  Melanopsin immunostaining of representative retinal sections from wt and PDE6B-mutant dogs.  Immunohistochemistry confirm the presence of ipRGCs.  Other RGCs are shown in green (NeuN).  Cell nuclei are shown in blue with DAPI.  Calibration bar = 20 µm.  ONL, outer nuclear layer; OPL, outer plexiform layer; INL, inner nuclear layer; IPL, inner plexiform layer; GCL, ganglion cell layer.             74  Figure 17.  Immunohistochemistry results of affected dogs compared to wt dog. In young and old PDE6B-mutant dogs, rod outer segments (rho) are abnormal (young, B1) and lost (old, C1) with mislocalization of rho from the OS to the cell body.  The cone OS (GNAT2, hCAR, and LM) are short (young, B2) and eventually lost (old, C2).  There is also progressive thinning of the ONL.  In CNGB3-mutant dogs, rods (rho) are present with normal OS (D1).  There fewer and abnormally shaped cone OS compared to wt (hCAR, LM) and they contain no detectable GNAT2 (D1, D2).  In the STK38L affected dogs, there is severe degeneration of the retina with loss of characteristic layering.  No rod and cone photoreceptors are present (E1, E2).  In the PRCD-mutant dogs, both rods and cones are still present with normal localization of their specific markers Rho, GNAT2, LM, and hCAR despite a loss of ONL thickness (F1, F2).  Except for STK38L-mutant dog (E3), dendrites/axons of secondary neurons (Neurofil) as well as RGC (NeuN) are well preserved in all the retina samples (A2, B3, C3, D3, F3). Cell nuclei are shown in blue with DAPI.  Calibration bar = 20 µm.  OS, outer segment; IS, inner segment; ONL, outer nuclear layer; OPL, outer plexiform layer; INL, inner nuclear layer; IPL, inner plexiform layer; GCL, ganglion cell layer.        75  Figure 17     76  CHAPTER 4 - DISCUSSION AND CONCLUSIONS In this study, we successfully verified in dogs the use of a previously developed protocol for chromatic pupillometry in human patients.77  The evaluation of previously established human protocol was justified by the fact that the absorption spectra of canine photoreceptors are similar to humans (Table 1).  By using the same clinical protocol established in humans, we were able to isolate and measure rod, cone, and ipRGC contribution to the PLR in dogs.81, 82  Standard pupillometry has been used in dogs before, and chromatic pupillometry has been suggested, but we have now confirmed the validity of this method in this species.65, 66, 78-80, 135  Specifically, we found that pupil constriction evaluated in the dark by dim and bright blue light is specific for rod and ipRGC function, respectively, and a bright red light stimulus in a blue-lit background is specific for cone function.   The proposed rod protocol worked well to isolate rod function. We were able to confirm this protocol by testing purpose-bred dogs with well-defined retinal disease phenotypes. For example, young dogs affected by PDE6B-rcd1that are expected to have a complete lack of rod function while cone function initially remains intact, were found to have no PLR response to the rod testing protocol.     The proposed cone protocol worked well to isolate cone function.  Similar to the results found in humans, our results showed that the blue background used in the cone protocol was able to suppress rod response.  Interestingly, the blue background was also able to suppress ipRGC response as shown in our light intensity series, as 77  previously reported in normal humans.77  It has been previously shown that ipRGC respond with sustained firing during steady light stimulation, therefore, it is less likely that suppression of ipRGC response with the blue background light is due to bleaching of the melanopsin photopigment.56  reduced when exposing it to a green or white background light for 5 minutes; we assume that our blue background was sufficient to decrease the sensitivity of ipRGCs.53  It is also possible that the suppression is due to inhibitory signals from S-cones; it is believed that rods, and L/M-cones provide excitatory inputs to the ipRGCs and the S-cones provide inhibitory inputs.21, 136  However, there are also studies that contradict these findings.32, 137    Based on the known absorbance spectrum of canine cones, the cone protocol (red light stimulus on a blue background) used in this study highly favors testing of L/M-cone response.  While it was beyond the scope of our work to develop a protocol that isolates S-cone function, we propose a way that it can be accomplished.  The absorbance spectra of S-cones and melanopsin overlap.  One way to assess the S-cones would be to use light intensities that are below the threshold for melanopsin.  The threshold can be seen based on the results of our light intensity series (Figure 13).  We start to see a sustained post-illumination response for light intensities  32 cd/m2, which is higher than what has been reported in humans (10 cd/m2).77  The S-cone response would also have to be isolated from the rod response and one possible way to do this would be to suppress the rods with a dim background light prior to stimulating the S-cones with a dim blue light.          78   For validating the cone protocol, we tested dogs affected with CNGB3-ACHM.  A unique feature of complete ACHM in humans is paradoxical pupillary constriction to darkness.138-140  Pupil constriction can be observed when a patient is moved to darkness after exposure to bright light for several minutes.  For reasons that remain to be determined, we did not observe paradoxical pupil constriction in our dogs with CNGB3-ACHM.  We showed that the proposed bright blue light stimulus successfully isolated ipRGC function.  This response is well preserved unless inner retina and optic nerve are impaired, as we have shown in the dogs that were either affected with a severe optic nerve head coloboma or advanced retinal degeneration.  Future studies will need to determine how the bright blue light response can be correlated to the number of optic nerve axons in order to qualitatively assess optic nerve damage.    In our study, only blue light at high intensities was able to produce a post-illumination sustained pupil response.  This sustained response is thought to be melanopsin driven. 21, 56, 75  In macaques, after pharmacologic blockade of the classic rod and cone photoreceptors, the melanopsin driven pupillary responses were present even after light stimulus offset.56  This sustained response has been defined as post-illumination pupil response (PIPR).141  Recent studies have used PIPR to assess the function of the melanopsin signaling pathway and for measuring progressive changes in ipRGC function in diseases.141-145  It has been shown that in patients with advanced glaucoma, the PIPR was reduced compared to normal age-matched patients.142, 143 Gooley et al. 79  also found that redilation time was slower for the humans with no rods or cones.57  We observed a sustained post-illumination pupil response present in all dogs tested with intact inner retina.  Since the pupillometry recording performed by the Roland system recorded up to only 14 seconds after light offset, we were unable to calculate the full extent of the PIPR as previously described.141, 142  We plan on evaluating and measuring PIPR in future studies.    Another interesting result from the ipRGC testing was the difference in latency in the dogs with rod and cone function loss.  The latency of the PLR response for the ipRGC testing in dogs with loss of either rod or cone function compared to wt dogs was not significantly different.  However, it was noted that in dogs with both rod and cone function loss the latency was significantly prolonged (0.61 ± 0.26 s vs. 0.28 ± 0.10 s).  It took an average of 0.33 s longer for the dogs with advanced retinal disease to show detectable response to the light stimulus.  The rapid constriction of the pupils following light stimulus onset is mediated by the rods and cones57 and therefore, similar to what is found in human studies, in our affected dogs lacking rod and cones the onset of pupil response was abnormally slow, consistent with the long latency time for a pure melanopsin-mediated pupil response.    Finally, we have for the first time documented the presence of melanopsin/Opn4- expressing ipRGCs in the canine retina  with and without disease.  Based on qRT-PCR results, melanopsin expression is decreased in canine models of early and late onset retinal degeneration but is not changed in non-degenerative retinal disease such as ACHM.  Melanopsin expressing cells with their dendritic arborizations were observed 80  on IHC, supporting the findings in chromatic pupillometry.  In particular, the complete loss of RGCS due to severe retinal degeneration noted on IHC from one of the STK38L affected dog corresponded to the negative or flat line bright blue/ipRGC chromatic pupillometry testing results for this dog.        Although our study results are highly promising for the use of chromatic pupillometry as an additional diagnostic tool for the testing of canine outer and inner retinal function, the current testing protocol still needs to be optimized, and there are limitations to this study.  Most importantly, improvements are needed in the Roland system for the cone testing protocol to eliminate the red light artifact.  For patients in which the cone response is small, it may be difficult to produce a real response over the light artifact and it becomes important to observe the video recording for a response. Such could be the case for the negative cone result for the young PDE6A mutant dog.   It is possible s) of 700 nm for the infrared camera in the Ganzfeld dome is not high enough to prevent passing of light from the 640 nm red LED, leading to the formation of a light artifact.   Another observation in this study is the variation in constriction amplitude noted between dogs which may prevent drawing conclusions about the number of photosensitive cells.  There appeared to be good test-retest reproducibility for chromatic pupillometry.  Although pupillometry is an objective way for precise quantitative measurement of change in pupil size, there are factors that can affect pupil size and contraction, such as retinal illumination, accommodative state of the eye, age, and emotional conditions.55, 146-148    One important cause of the variability, confirmed in this 81  study, is the difference in baseline pupil size and the amount of retinal illumination (Figure 13).  Kardon et al. has determined that in eyes with darkly pigmented irides, baseline pupil size greatly influences retinal illumination.149  In addition, the variability could also be due to the mechanical effects of a small pupil on iris movement.150  In our study, we used a closed-loop paradigm, meaning that the PLR was measured in the same eye that received the light stimulation; retinal illumination is affected by baseline pupil size.  Alternatively, an open-looped paradigm could be used, in which one pupil is dilated pharmacologically and stimulated with light but the recordings were taken from the undilated contralateral eye.      Another possible cause of the variability may be anesthesia level and anesthetic drug used.  We looked at variables measured on our dogs during anesthesia, such as heart rate and blood pressure, and we found that they were very consistent with little variability.  Significant differences in pupillometry parameters also have been reported in humans treated with different anesthetics.58, 151  The medications used for anesthesia in that particular study, ketamine, and xylazine, have all been reported to have a mydriatic effect in dogs.  In our study, the anesthetics used were acepromazine, propofol, and isoflurane.  Intramuscular administration of acepromazine in dogs has been shown to cause miosis and halogenated agents (isoflurane) cause mydriasis, while propofol does not alter pupil reactivity.152, 153  Although these affects on the pupil has been noted with these anesthetic agents, the dogs in our study dilated well to baseline pupil size after a period of dark adaptation.  82  In summary, we confirmed the chromatic pupillometry protocol for use in dogs assessing canine rod, cone and ipRGC function and that the chromatic pupillometry results from the specific retinal disease correlated well with ERG, IHC, and qRT-PCR results.  This is relevant since the dogs have become increasingly important for the study of inherited retinal diseases and the development of novel therapies.86, 154  One such example is retinal gene therapy for the treatment of LCA, which causes progressive vision loss starting in childhood.66, 155-161  Chromatic pupillometry can complement ERG recording and visual behavioral testing for complete functional assessment of the retinal and central visual pathways.  It can be used clinically to monitor progression of retinal degeneration and quantify the therapeutic outcome following gene therapy.     83  CHAPTER 5 - FUTURE DIRECTIONS The increase in knowledge of melanopsin containing ipRGCs resulted in clinical applications in various branches of science such as circadian/endocrine biology, vision science, sleep research and neuroscience.162-164  Of particular interest to our laboratory is the use of the melanopsin photosystem in the diagnosis of blinding diseases affecting retina and optic nerve.       Pupil constriction evaluated in the dark by dim and bright blue light stimuli are specific for rod and ipRGC function, respectively, and a bright red light stimulus in a blue-lit background is specific for cone function.  Chromatic pupillometry offers an effective diagnostic tool for retinal and optic nerve disease in both clinical and research settings.  It complements ERG and visual behavioral testing for complete functional assessment of the retina and central visual pathways.  In addition, we also found that melanopsin expression is decreased in canine models of early and late onset retinal degeneration but is unchanged in non-degenerative retinal disease such as ACHM.  ipRGC dysfunction is more pronounced in advanced disease/degeneration in which both the inner and outer retina are affected.    Now that we have established/verified chromatic pupillometry as a valuable diagnostic tool for assessment of retinal and optic nerve diseases in dogs, we posit that chromatic pupillometry is also a very useful tool to assess outcome of novel therapies in canine disease models, including retinal gene therapy or application of neuroprotective agents.    84  Another important use of chromatic pupillometry would be to calculate PIPR to assess the function of the melanopsin signaling pathway and to measure progressive changes in ipRGC function in diseases.141-145  Since the full extent of the PIPR could not be calculated in this study, we plan on evaluating and measuring the PIPR in future studies.  The first step in accomplishing this would be to work with the manufacturer of our system to increase the recording time.   One possible application would be in early diagnosis of glaucoma, an optic neuropathy associated with RGC loss.  PIPR is reduced in human patients with advanced stages of glaucoma compared to age-matched controls.142, 143     ipRGCs are resistant to injury in animal models of glaucoma and following optic nerve injury.165-167  In a rodent model of glaucoma, conventional RGCs decreased in number with increase in intraocular pressure while there was no change in the number of ipRGCs.165  Following optic nerve transection in the mouse, ipRGCs showed a threefold increase in survival rate compared to conventional RGCs.166  The exact mechanism that provides neuroprotection to ipRGCs is still unknown.  An understanding of the protective mechanism in the ipRGCs may allow us to design strategies to decrease the loss of vision following optic nerve injury or ocular disease, such as glaucoma.    More work is needed to find optimal conditions that decrease individual variability in pupil constriction amplitude with chromatic pupillometry.  With handheld pupillometry devices becoming more readily available, it will be possible in the future to avoid the use of anesthetic agents for testing.  With a handheld device, anesthesia and head 85  positioning in the Ganzfeld dome would be less critical, allowing chromatic pupillometry to be easily performed.  A recent study found that a handheld white light pupillometer was easy to use in both conscious and anesthetized dogs.168            86            REFERENCES   87  REFERENCES    1. Keeler CE. Iris Movements in Blind Mice. American Journal of Physiology 1927;81:107-112. 2. Foster RG, Provencio I, Hudson D, Fiske S, De Grip W, Menaker M. Circadian photoreception in the retinally degenerate mouse (rd/rd). J Comp Physiol A 1991;169:39-50. 3. Provencio I, Wong S, Lederman AB, Argamaso SM, Foster RG. Visual and circadian responses to light in aged retinally degenerate mice. Vision Res 1994;34:1799-1806. 4. Freedman MS, Lucas RJ, Soni B, et al. Regulation of mammalian circadian behavior by non-rod, non-cone, ocular photoreceptors. Science 1999;284:502-504. 5. Lucas RJ, Freedman MS, Munoz M, Garcia-Fernandez JM, Foster RG. Regulation of the mammalian pineal by non-rod, non-cone, ocular photoreceptors. Science 1999;284:505-507. 6. Mrosovsky N, Lucas RJ, Foster RG. Persistence of masking responses to light in mice lacking rods and cones. J Biol Rhythms 2001;16:585-588. 7. Lucas RJ, Douglas RH, Foster RG. Characterization of an ocular photopigment capable of driving pupillary constriction in mice. Nat Neurosci 2001;4:621-626. 8. Keeler CE. Blind Mice. Journal of Experimental Zoology 1928;51:495-508. 9. Drager UC, Hubel DH. Studies of visual function and its decay in mice with hereditary retinal degeneration. J Comp Neurol 1978;180:85-114. 10. Lucas RJ, Foster RG. Neither functional rod photoreceptors nor rod or cone outer segments are required for the photic inhibition of pineal melatonin. Endocrinology 1999;140:1520-1524. 88  11. Czeisler CA, Shanahan TL, Klerman EB, et al. Suppression of melatonin secretion in some blind patients by exposure to bright light. N Engl J Med 1995;332:6-11. 12. Lockley SW, Skene DJ, Arendt J, Tabandeh H, Bird AC, Defrance R. Relationship between melatonin rhythms and visual loss in the blind. J Clin Endocrinol Metab 1997;82:3763-3770. 13. Takahashi JS, DeCoursey PJ, Bauman L, Menaker M. Spectral sensitivity of a novel photoreceptive system mediating entrainment of mammalian circadian rhythms. Nature 1984;308:186-188. 14. Nelson DE, Takahashi JS. Sensitivity and integration in a visual pathway for circadian entrainment in the hamster (Mesocricetus auratus). J Physiol 1991;439:115-145. 15. Provencio I, Jiang G, De Grip WJ, Hayes WP, Rollag MD. Melanopsin: An opsin in melanophores, brain, and eye. Proc Natl Acad Sci U S A 1998;95:340-345. 16. Provencio I, Rodriguez IR, Jiang G, Hayes WP, Moreira EF, Rollag MD. A novel human opsin in the inner retina. J Neurosci 2000;20:600-605. 17. Hattar S, Liao HW, Takao M, Berson DM, Yau KW. Melanopsin-containing retinal ganglion cells: architecture, projections, and intrinsic photosensitivity. Science 2002;295:1065-1070. 18. Provencio I, Rollag MD, Castrucci AM. Photoreceptive net in the mammalian retina. This mesh of cells may explain how some blind mice can still tell day from night. Nature 2002;415:493. 19. Hoshi H, Liu WL, Massey SC, Mills SL. ON inputs to the OFF layer: bipolar cells that break the stratification rules of the retina. J Neurosci 2009;29:8875-8883. 20. Semo M, Munoz Llamosas M, Foster RG, Jeffery G. Melanopsin (Opn4) positive cells in the cat retina are randomly distributed across the ganglion cell layer. Vis Neurosci 2005;22:111-116. 89  21. Dacey DM, Liao HW, Peterson BB, et al. Melanopsin-expressing ganglion cells in primate retina signal colour and irradiance and project to the LGN. Nature 2005;433:749-754. 22. Jusuf PR, Lee SC, Hannibal J, Grünert U. Characterization and synaptic connectivity of melanopsin-containing ganglion cells in the primate retina. Eur J Neurosci 2007;26:2906-2921. 23. Gooley JJ, Lu J, Chou TC, Scammell TE, Saper CB. Melanopsin in cells of origin of the retinohypothalamic tract. Nat Neurosci 2001;4:1165. 24. Berson DM, Dunn FA, Takao M. Phototransduction by retinal ganglion cells that set the circadian clock. Science 2002;295:1070-1073. 25. Hatori M, Le H, Vollmers C, et al. Inducible ablation of melanopsin-expressing retinal ganglion cells reveals their central role in non-image forming visual responses. PLoS One 2008;3:e2451. 26. Viney TJ, Balint K, Hillier D, et al. Local retinal circuits of melanopsin-containing ganglion cells identified by transsynaptic viral tracing. Curr Biol 2007;17:981-988. 27. Baver SB, Pickard GE, Sollars PJ. Two types of melanopsin retinal ganglion cell differentially innervate the hypothalamic suprachiasmatic nucleus and the olivary pretectal nucleus. Eur J Neurosci 2008;27:1763-1770. 28. Schmidt TM, Taniguchi K, Kofuji P. Intrinsic and extrinsic light responses in melanopsin-expressing ganglion cells during mouse development. J Neurophysiol 2008;100:371-384. 29. Schmidt TM, Kofuji P. Functional and morphological differences among intrinsically photosensitive retinal ganglion cells. J Neurosci 2009;29:476-482. 30. Ecker JL, Dumitrescu ON, Wong KY, et al. Melanopsin-expressing retinal ganglion-cell photoreceptors: cellular diversity and role in pattern vision. Neuron 2010;67:49-60. 31. Berson DM, Castrucci AM, Provencio I. Morphology and mosaics of melanopsin-expressing retinal ganglion cell types in mice. J Comp Neurol 2010;518:2405-2422. 90  32. Schmidt TM, Kofuji P. Structure and function of bistratified intrinsically photosensitive retinal ganglion cells in the mouse. J Comp Neurol 2011;519:1492-1504. 33. Hattar S, Kumar M, Park A, et al. Central projections of melanopsin-expressing retinal ganglion cells in the mouse. J Comp Neurol 2006;497:326-349. 34. Hannibal J, Fahrenkrug J. Target areas innervated by PACAP-immunoreactive retinal ganglion cells. Cell and tissue research 2004;316:99-113. 35. Gooley JJ, Lu J, Fischer D, Saper CB. A broad role for melanopsin in nonvisual photoreception. J Neurosci 2003;23:7093-7106. 36. Chen SK, Badea TC, Hattar S. Photoentrainment and pupillary light reflex are mediated by distinct populations of ipRGCs. Nature 2011;476:92-95. 37. Brown TM, Gias C, Hatori M, et al. Melanopsin contributions to irradiance coding in the thalamo-cortical visual system. PLoS Biol 2010;8:e1000558. 38. Brown TM, Tsujimura S, Allen AE, et al. Melanopsin-based brightness discrimination in mice and humans. Curr Biol 2012;22:1134-1141. 39. Belenky MA, Smeraski CA, Provencio I, Sollars PJ, Pickard GE. Melanopsin retinal ganglion cells receive bipolar and amacrine cell synapses. J Comp Neurol 2003;460:380-393. 40. Guler AD, Ecker JL, Lall GS, et al. Melanopsin cells are the principal conduits for rod-cone input to non-image-forming vision. Nature 2008;453:102-105. 41. Ostergaard J, Hannibal J, Fahrenkrug J. Synaptic contact between melanopsin-containing retinal ganglion cells and rod bipolar cells. Invest Ophthalmol Vis Sci 2007;48:3812-3820. 42. Vugler AA, Redgrave P, Semo M, Lawrence J, Greenwood J, Coffey PJ. Dopamine neurones form a discrete plexus with melanopsin cells in normal and degenerating retina. Experimental neurology 2007;205:26-35. 43. Wong KY, Dunn FA, Graham DM, Berson DM. Synaptic influences on rat ganglion-cell photoreceptors. J Physiol 2007;582:279-296. 91  44. Lucas RJ, Hattar S, Takao M, Berson DM, Foster RG, Yau KW. Diminished pupillary light reflex at high irradiances in melanopsin-knockout mice. Science 2003;299:245-247. 45. Panda S, Sato TK, Castrucci AM, et al. Melanopsin (Opn4) requirement for normal light-induced circadian phase shifting. Science 2002;298:2213-2216. 46. Ruby NF, Brennan TJ, Xie X, et al. Role of melanopsin in circadian responses to light. Science 2002;298:2211-2213. 47. Hattar S, Lucas RJ, Mrosovsky N, et al. Melanopsin and rod-cone photoreceptive systems account for all major accessory visual functions in mice. Nature 2003;424:76-81. 48. Panda S, Provencio I, Tu DC, et al. Melanopsin is required for non-image-forming photic responses in blind mice. Science 2003;301:525-527. 49. Dumitrescu ON, Pucci FG, Wong KY, Berson DM. Ectopic retinal ON bipolar cell synapses in the OFF inner plexiform layer: contacts with dopaminergic amacrine cells and melanopsin ganglion cells. J Comp Neurol 2009;517:226-244. 50. Schmidt TM, Kofuji P. Differential cone pathway influence on intrinsically photosensitive retinal ganglion cell subtypes. J Neurosci 2010;30:16262-16271. 51. Bellingham J, Chaurasia SS, Melyan Z, et al. Evolution of melanopsin photoreceptors: discovery and characterization of a new melanopsin in nonmammalian vertebrates. PLoS Biol 2006;4:e254. 52. Do MT, Kang SH, Xue T, et al. Photon capture and signalling by melanopsin retinal ganglion cells. Nature 2009;457:281-287. 53. Wong KY, Dunn FA, Berson DM. Photoreceptor adaptation in intrinsically photosensitive retinal ganglion cells. Neuron 2005;48:1001-1010. 54. Warren EJ, Allen CN, Brown RL, Robinson DW. Intrinsic light responses of retinal ganglion cells projecting to the circadian system. Eur J Neurosci 2003;17:1727-1735. 92  55. McDougal DH, Gamlin PD. The influence of intrinsically-photosensitive retinal ganglion cells on the spectral sensitivity and response dynamics of the human pupillary light reflex. Vision Res 2010;50:72-87. 56. Gamlin PD, McDougal DH, Pokorny J, Smith VC, Yau KW, Dacey DM. Human and macaque pupil responses driven by melanopsin-containing retinal ganglion cells. Vision Res 2007;47:946-954. 57. Gooley JJ, Ho Mien I, St Hilaire MA, et al. Melanopsin and rod-cone photoreceptors play different roles in mediating pupillary light responses during exposure to continuous light in humans. J Neurosci 2012;32:14242-14253. 58. Larson MD, Behrends M. Portable infrared pupillometry: a review. Anesthesia and analgesia 2015;120:1242-1253. 59. Jorgensen EO, Malchow-Moller AM. Cerebral prognostic signs during cardiopulmonary resuscitation. Resuscitation 1978;6:217-225. 60. Levy DE, Caronna JJ, Singer BH, Lapinski RH, Frydman H, Plum F. Predicting outcome from hypoxic-ischemic coma. Jama 1985;253:1420-1426. 61. Longstreth WT, Jr., Diehr P, Inui TS. Prediction of awakening after out-of-hospital cardiac arrest. N Engl J Med 1983;308:1378-1382. 62. Behrends M, Niemann CU, Larson MD. Infrared pupillometry to detect the light reflex during cardiopulmonary resuscitation: a case series. Resuscitation 2012;83:1223-1228. 63. Aleman TS, Jacobson SG, Chico JD, et al. Impairment of the transient pupillary light reflex in Rpe65(-/-) mice and humans with leber congenital amaurosis. Invest Ophthalmol Vis Sci 2004;45:1259-1271. 64. Cideciyan AV, Aleman TS, Boye SL, et al. Human gene therapy for RPE65 isomerase deficiency activates the retinoid cycle of vision but with slow rod kinetics. Proc Natl Acad Sci U S A 2008;105:15112-15117. 65. Aguirre GK, Komaromy AM, Cideciyan AV, et al. Canine and human visual cortex intact and responsive despite early retinal blindness from RPE65 mutation. PLoS medicine 2007;4:e230. 93  66. Acland GM, Aguirre GD, Ray J, et al. Gene therapy restores vision in a canine model of childhood blindness. Nature genetics 2001;28:92-95. 67. Lorenz B, Strohmayr E, Zahn S, et al. Chromatic pupillometry dissects function of the three different light-sensitive retinal cell populations in RPE65 deficiency. Invest Ophthalmol Vis Sci 2012;53:5641-5652. 68. Veske A, Nilsson SE, Narfstrom K, Gal A. Retinal dystrophy of Swedish briard/briard-beagle dogs is due to a 4-bp deletion in RPE65. Genomics 1999;57:57-61. 69. Schnapf JL, Kraft TW, Baylor DA. Spectral sensitivity of human cone photoreceptors. Nature 1987;325:439-441. 70. Merbs SL, Nathans J. Absorption spectra of human cone pigments. Nature 1992;356:433-435. 71. Kemp CM, Jacobson SG. Rhodopsin levels in the central retinas of normal miniature poodles and those with progressive rod-cone degeneration. Experimental eye research 1992;54:947-956. 72. Parkes JH, Aguirre G, Rockey JH, Liebman PA. Progressive rod-cone degeneration in the dog: characterization of the visual pigment. Invest Ophthalmol Vis Sci 1982;23:674-678. 73. Kraft TW, Schneeweis DM, Schnapf JL. Visual transduction in human rod photoreceptors. J Physiol 1993;464:747-765. 74. Kawasaki A, Kardon RH. Intrinsically photosensitive retinal ganglion cells. Journal of neuro-ophthalmology : the official journal of the North American Neuro-Ophthalmology Society 2007;27:195-204. 75. Kardon R, Anderson SC, Damarjian TG, Grace EM, Stone E, Kawasaki A. Chromatic pupil responses: preferential activation of the melanopsin-mediated versus outer photoreceptor-mediated pupil light reflex. Ophthalmology 2009;116:1564-1573. 76. Kardon R, Anderson SC, Damarjian TG, Grace EM, Stone E, Kawasaki A. Chromatic pupillometry in patients with retinitis pigmentosa. Ophthalmology 2011;118:376-381. 94  77. Park JC, Moura AL, Raza AS, Rhee DW, Kardon RH, Hood DC. Toward a clinical protocol for assessing rod, cone, and melanopsin contributions to the human pupil response. Invest Ophthalmol Vis Sci 2011;52:6624-6635. 78. Grozdanic SD, Matic M, Sakaguchi DS, Kardon RH. Evaluation of retinal status using chromatic pupil light reflex activity in healthy and diseased canine eyes. Invest Ophthalmol Vis Sci 2007;48:5178-5183. 79. Grozdanic SD, Kecova H, Lazic T. Rapid diagnosis of retina and optic nerve abnormalities in canine patients with and without cataracts using chromatic pupil light reflex testing. Vet Ophthalmol 2013;16:329-340. 80. Whiting RE, Yao G, Narfstrom K, et al. Quantitative assessment of the canine pupillary light reflex. Invest Ophthalmol Vis Sci 2013;54:5432-5440. 81. Neitz J, Geist T, Jacobs GH. Color vision in the dog. Vis Neurosci 1989;3:119-125. 82. Jacobs GH, Deegan JF, 2nd, Crognale MA, Fenwick JA. Photopigments of dogs and foxes and their implications for canid vision. Vis Neurosci 1993;10:173-180. 83. O'Toole D, Roberts S, Nunamaker C. Sudden acquired retinal degeneration ('silent retina syndrome') in two dogs. The Veterinary record 1992;130:157-161. 84. Miller PE, Galbreath EJ, Kehren JC, Steinberg H, Dubielzig RR. Photoreceptor cell death by apoptosis in dogs with sudden acquired retinal degeneration syndrome. Am J Vet Res 1998;59:149-152. 85. Komaromy AM, Abrams KL, Heckenlively JR, et al. Sudden acquired retinal degeneration syndrome (SARDS) - a review and proposed strategies toward a better understanding of pathogenesis, early diagnosis, and therapy. Vet Ophthalmol 2015. 86. Petersen-Jones SM, Komaromy AM. Dog models for blinding inherited retinal dystrophies. Human gene therapy Clinical development 2015;26:15-26. 87. Winkler PA, Ekenstedt KJ, Occelli LM, et al. A large animal model for CNGB1 autosomal recessive retinitis pigmentosa. PLoS One 2013;8:e72229. 95  88. Ahonen SJ, Arumilli M, Lohi H. A CNGB1 frameshift mutation in Papillon and Phalene dogs with progressive retinal atrophy. PLoS One 2013;8:e72122. 89. Narfstrom K, Ekesten B. Electroretinographic evaluation of Papillons with and without hereditary retinal degeneration. Am J Vet Res 1998;59:221-226. 90. Narfstrom K, Wrigstad A. Clinical, electrophysiological and morphological changes in a case of hereditary retinal degeneration in the Papillon dog. Vet Ophthalmol 1999;2:67-74. 91. Michaelides M, Hunt DM, Moore AT. The cone dysfunction syndromes. The British journal of ophthalmology 2004;88:291-297. 92. Sidjanin DJ, Lowe JK, McElwee JL, et al. Canine CNGB3 mutations establish cone degeneration as orthologous to the human achromatopsia locus ACHM3. Human molecular genetics 2002;11:1823-1833. 93. Komaromy AM, Alexander JJ, Rowlan JS, et al. Gene therapy rescues cone function in congenital achromatopsia. Human molecular genetics 2010;19:2581-2593. 94. Aguirre GD, Rubin LF. Pathology of hemeralopia in the Alaskan malamute dog. Investigative ophthalmology 1974;13:231-235. 95. Aguirre GD, Rubin LF. The electroretinogram in dogs with inherited cone degeneration. Investigative ophthalmology 1975;14:840-847. 96. Rubin LF. Hemeralopia in Alaskan Malamute pups. J Am Vet Med Assoc 1971;158:1699-1701. 97. Rubin LF. Clinical features of hemeralopia in the adult Alaskan malamute. J Am Vet Med Assoc 1971;158:1696-1698. 98. Long KO, Aguirre GD. The cone matrix sheath in the normal and diseased retina: cytochemical and biochemical studies of peanut agglutinin-binding proteins in cone and rod-cone degeneration. Experimental eye research 1991;52:699-713. 96  99. Suber ML, Pittler SJ, Qin N, et al. Irish setter dogs affected with rod/cone dysplasia contain a nonsense mutation in the rod cGMP phosphodiesterase beta-subunit gene. Proc Natl Acad Sci U S A 1993;90:3968-3972. 100. Dekomien G, Runte M, Godde R, Epplen JT. Generalized progressive retinal atrophy of Sloughi dogs is due to an 8-bp insertion in exon 21 of the PDE6B gene. Cytogenetics and cell genetics 2000;90:261-267. 101. Aguirre GD, Rubin LF. Rod-cone dysplasia (progressive retinal atrophy) in Irish setters. J Am Vet Med Assoc 1975;166:157-164. 102. Parry HB. Degenerations of the dog retina. VI. Central progressive atrophy with pigment epithelial dystrophy. The British journal of ophthalmology 1954;38:653-668. 103. Kukekova AV, Goldstein O, Johnson JL, et al. Canine RD3 mutation establishes rod-cone dysplasia type 2 (rcd2) as ortholog of human and murine rd3. Mammalian genome : official journal of the International Mammalian Genome Society 2009;20:109-123. 104. Santos-Anderson RM, Tso MO, Wolf ED. An inherited retinopathy in collies. A light and electron microscopic study. Invest Ophthalmol Vis Sci 1980;19:1281-1294. 105. Wolf ED, Vainisi SJ, Santos-Anderson R. Rod-cone dysplasia in the collie. J Am Vet Med Assoc 1978;173:1331-1333. 106. Petersen-Jones SM, Entz DD, Sargan DR. cGMP phosphodiesterase-alpha mutation causes progressive retinal atrophy in the Cardigan Welsh corgi dog. Invest Ophthalmol Vis Sci 1999;40:1637-1644. 107. Gelatt KN, Gilger BC, Kern TJ. Veterinary ophthalmology. Ames, Iowa: Wiley-Blackwell,; 2013:1330. 108. den Hollander AI, Roepman R, Koenekoop RK, Cremers FP. Leber congenital amaurosis: genes, proteins and disease mechanisms. Progress in retinal and eye research 2008;27:391-419. 109. Redmond TM, Poliakov E, Yu S, Tsai JY, Lu Z, Gentleman S. Mutation of key residues of RPE65 abolishes its enzymatic role as isomerohydrolase in the visual cycle. Proc Natl Acad Sci U S A 2005;102:13658-13663. 97  110. Narfstrom K, Wrigstad A, Nilsson SE. The Briard dog: a new animal model of congenital stationary night blindness. The British journal of ophthalmology 1989;73:750-756. 111. Aguirre G, Alligood J, O'Brien P, Buyukmihci N. Pathogenesis of progressive rod-cone degeneration in miniature poodles. Invest Ophthalmol Vis Sci 1982;23:610-630. 112. Goldstein O, Zangerl B, Pearce-Kelling S, et al. Linkage disequilibrium mapping in domestic dog breeds narrows the progressive rod-cone degeneration interval and identifies ancestral disease-transmitting chromosome. Genomics 2006;88:541-550. 113. Aguirre GD, Acland GM. Variation in retinal degeneration phenotype inherited at the prcd locus. Experimental eye research 1988;46:663-687. 114. Kommonen B, Karhunen U. A late receptor dystrophy in the Labrador retriever. Vision Res 1990;30:207-213. 115. Zangerl B, Goldstein O, Philp AR, et al. Identical mutation in a novel retinal gene causes progressive rod-cone degeneration in dogs and retinitis pigmentosa in humans. Genomics 2006;88:551-563. 116. Acland GM, Aguirre GD. Retinal degenerations in the dog: IV. Early retinal degeneration (erd) in Norwegian elkhounds. Experimental eye research 1987;44:491-521. 117. Kijas JW, Zangerl B, Miller B, et al. Cloning of the canine ABCA4 gene and evaluation in canine cone-rod dystrophies and progressive retinal atrophies. Molecular vision 2004;10:223-232. 118. Goldstein O, Mezey JG, Schweitzer PA, et al. IQCB1 and PDE6B mutations cause similar early onset retinal degenerations in two closely related terrier dog breeds. Invest Ophthalmol Vis Sci 2013;54:7005-7019. 119. Acland GM, Blanton SH, Hershfield B, Aguirre GD. XLPRA: a canine retinal degeneration inherited as an X-linked trait. American journal of medical genetics 1994;52:27-33. 98  120. Zhang Q, Acland GM, Wu WX, et al. Different RPGR exon ORF15 mutations in Canids provide insights into photoreceptor cell degeneration. Human molecular genetics 2002;11:993-1003. 121. Aguirre GD, Baldwin V, Pearce-Kelling S, Narfstrom K, Ray K, Acland GM. Congenital stationary night blindness in the dog: common mutation in the RPE65 gene indicates founder effect. Molecular vision 1998;4:23. 122. Goldstein O, Kukekova AV, Aguirre GD, Acland GM. Exonic SINE insertion in STK38L causes canine early retinal degeneration (erd). Genomics 2010;96:362-368. 123. Chader GJ, Fletcher RT, Sanyal S, Aguirre GD. A review of the role of cyclic GMP in neurological mutants with photoreceptor dysplasia. Current eye research 1985;4:811-819. 124. Woodford BJ, Liu Y, Fletcher RT, et al. Cyclic nucleotide metabolism in inherited retinopathy in collies: a biochemical and histochemical study. Experimental eye research 1982;34:703-714. 125. Keep JM. Clinical aspects of progressive retinal atrophy in the Cardigan Welsh Corgi. Australian veterinary journal 1972;48:197-199. 126. Nilsson SE, Wrigstad A, Narfstrom K. Changes in the DC electroretinogram in Briard dogs with hereditary congenital night blindness and partial day blindness. Experimental eye research 1992;54:291-296. 127. Wrigstad A, Nilsson SE, Narfstrom K. Ultrastructural changes of the retina and the retinal pigment epithelium in Briard dogs with hereditary congenital night blindness and partial day blindness. Experimental eye research 1992;55:805-818. 128. Beltran WA, Hammond P, Acland GM, Aguirre GD. A frameshift mutation in RPGR exon ORF15 causes photoreceptor degeneration and inner retina remodeling in a model of X-linked retinitis pigmentosa. Invest Ophthalmol Vis Sci 2006;47:1669-1681. 129. Parker HG, Kukekova AV, Akey DT, et al. Breed relationships facilitate fine-mapping studies: a 7.8-kb deletion cosegregates with Collie eye anomaly across multiple dog breeds. Genome research 2007;17:1562-1571. 99  130. Bergamin O, Kardon RH. Latency of the pupil light reflex: sample rate, stimulus intensity, and variation in normal subjects. Invest Ophthalmol Vis Sci 2003;44:1546-1554. 131. Berta AI, Boesze-Battaglia K, Genini S, et al. Photoreceptor cell death, proliferation and formation of hybrid rod/S-cone photoreceptors in the degenerating STK38L mutant retina. PLoS One 2011;6:e24074. 132. Komaromy AM, Rowlan JS, Corr AT, et al. Transient photoreceptor deconstruction by CNTF enhances rAAV-mediated cone functional rescue in late stage CNGB3-achromatopsia. Molecular therapy : the journal of the American Society of Gene Therapy 2013;21:1131-1141. 133. Beltran WA, Boye SL, Boye SE, et al. rAAV2/5 gene-targeting to rods:dose-dependent efficiency and complications associated with different promoters. Gene therapy 2010;17:1162-1174. 134. Garcia MM, Ying GS, Cocores CA, Tanaka JC, Komaromy AM. Evaluation of a behavioral method for objective vision testing and identification of achromatopsia in dogs. Am J Vet Res 2010;71:97-102. 135. Whiting RE, Narfstrom K, Yao G, et al. Pupillary light reflex deficits in a canine model of late infantile neuronal ceroid lipofuscinosis. Experimental eye research 2013;116:402-410. 136. Spitschan M, Jain S, Brainard DH, Aguirre GK. Opponent melanopsin and S-cone signals in the human pupillary light response. Proc Natl Acad Sci U S A 2014;111:15568-15572. 137. Allen AE, Brown TM, Lucas RJ. A distinct contribution of short-wavelength-sensitive cones to light-evoked activity in the mouse pretectal olivary nucleus. J Neurosci 2011;31:16833-16843. 138. Flynn JT, Kazarian E, Barricks M. Paradoxical pupil in congenital achromatopsia. International ophthalmology 1981;3:91-96. 139. Frank JW, Kushner BJ, France TD. Paradoxic pupillary phenomena. A review of patients with pupillary constriction to darkness. Archives of ophthalmology 1988;106:1564-1566. 100  140. Price MJ, Thompson HS, Judisch GF, Corbett JJ. Pupillary constriction to darkness. The British journal of ophthalmology 1985;69:205-211. 141. Kankipati L, Girkin CA, Gamlin PD. Post-illumination pupil response in subjects without ocular disease. Invest Ophthalmol Vis Sci 2010;51:2764-2769. 142. Kankipati L, Girkin CA, Gamlin PD. The post-illumination pupil response is reduced in glaucoma patients. Invest Ophthalmol Vis Sci 2011;52:2287-2292. 143. Feigl B, Mattes D, Thomas R, Zele AJ. Intrinsically photosensitive (melanopsin) retinal ganglion cell function in glaucoma. Invest Ophthalmol Vis Sci 2011;52:4362-4367. 144. Lei S, Goltz HC, Chandrakumar M, Wong AM. Full-field chromatic pupillometry for the assessment of the postillumination pupil response driven by melanopsin-containing retinal ganglion cells. Invest Ophthalmol Vis Sci 2014;55:4496-4503. 145. van der Meijden WP, Te Lindert BH, Bijlenga D, et al. Post-illumination pupil response after blue light: Reliability of optimized melanopsin-based phototransduction assessment. Experimental eye research 2015;139:73-80. 146. Watson AB, Yellott JI. A unified formula for light-adapted pupil size. Journal of vision 2012;12:12. 147. Marg E, Morgan MW, Jr. The pupillary near reflex; the relation of pupillary diameter to accommodation and the various components of convergence. American journal of optometry and archives of American Academy of Optometry 1949;26:183-198. 148. Bradley MM, Miccoli L, Escrig MA, Lang PJ. The pupil as a measure of emotional arousal and autonomic activation. Psychophysiology 2008;45:602-607. 149. Kardon RH, Hong S, Kawasaki A. Entrance pupil size predicts retinal illumination in darkly pigmented eyes, but not lightly pigmented eyes. Invest Ophthalmol Vis Sci 2013;54:5559-5567. 150. Chen Y, Kardon RH. Studying the effect of iris mechanics on the pupillary light reflex using brimonidine-induced anisocoria. Invest Ophthalmol Vis Sci 2013;54:2951-2958. 101  151. Larson MD, Sessler DI, McGuire J, Hynson JM. Isoflurane, but not mild hypothermia, depresses the human pupillary light reflex. Anesthesiology 1991;75:62-67. 152. Gunderson EG, Lukasik VM, Ashton MM, Merideth RE, Madsen R. Effects of anesthetic induction with midazolam-propofol and midazolam-etomidate on selected ocular and cardiorespiratory variables in clinically normal dogs. Am J Vet Res 2013;74:629-635. 153. Stephan DD, Vestre WA, Stiles J, Krohne S. Changes in intraocular pressure and pupil size following intramuscular administration of hydromorphone hydrochloride and acepromazine in clinically normal dogs. Vet Ophthalmol 2003;6:73-76. 154. Switonski M. Dog as a model in studies on human hereditary diseases and their gene therapy. Reproductive biology 2014;14:44-50. 155. Lorenz B, Gyurus P, Preising M, et al. Early-onset severe rod-cone dystrophy in young children with RPE65 mutations. Invest Ophthalmol Vis Sci 2000;41:2735-2742. 156. Bainbridge JW, Smith AJ, Barker SS, et al. Effect of gene therapy on visual function in Leber's congenital amaurosis. N Engl J Med 2008;358:2231-2239. 157. Maguire AM, Simonelli F, Pierce EA, et al. Safety and efficacy of gene transfer for Leber's congenital amaurosis. N Engl J Med 2008;358:2240-2248. 158. Hauswirth WW, Aleman TS, Kaushal S, et al. Treatment of leber congenital amaurosis due to RPE65 mutations by ocular subretinal injection of adeno-associated virus gene vector: short-term results of a phase I trial. Human gene therapy 2008;19:979-990. 159. Simonelli F, Maguire AM, Testa F, et al. Gene therapy for Leber's congenital amaurosis is safe and effective through 1.5 years after vector administration. Molecular therapy : the journal of the American Society of Gene Therapy 2010;18:643-650. 160. Cideciyan AV, Hauswirth WW, Aleman TS, et al. Human RPE65 gene therapy for Leber congenital amaurosis: persistence of early visual improvements and safety at 1 year. Human gene therapy 2009;20:999-1004. 102  161. Jacobson SG, Cideciyan AV, Ratnakaram R, et al. Gene therapy for leber congenital amaurosis caused by RPE65 mutations: safety and efficacy in 15 children and adults followed up to 3 years. Archives of ophthalmology 2012;130:9-24. 162. Lucas RJ, Peirson SN, Berson DM, et al. Measuring and using light in the melanopsin age. Trends in neurosciences 2014;37:1-9. 163. Feigl B, Zele AJ. Melanopsin-expressing intrinsically photosensitive retinal ganglion cells in retinal disease. Optometry and vision science : official publication of the American Academy of Optometry 2014;91:894-903. 164. Roecklein KA, Wong PM, Miller MA, Donofry SD, Kamarck ML, Brainard GC. Melanopsin, photosensitive ganglion cells, and seasonal affective disorder. Neurosci Biobehav Rev 2013;37:229-239. 165. Li RS, Chen BY, Tay DK, Chan HH, Pu ML, So KF. Melanopsin-expressing retinal ganglion cells are more injury-resistant in a chronic ocular hypertension model. Invest Ophthalmol Vis Sci 2006;47:2951-2958. 166. Robinson GA, Madison RD. Axotomized mouse retinal ganglion cells containing melanopsin show enhanced survival, but not enhanced axon regrowth into a peripheral nerve graft. Vision Res 2004;44:2667-2674. 167. Perez de Sevilla Muller L, Sargoy A, Rodriguez AR, Brecha NC. Melanopsin ganglion cells are the most resistant retinal ganglion cell type to axonal injury in the rat retina. PLoS One 2014;9:e93274. 168. Kim J, Heo J, Ji D, Kim MS. Quantitative assessment of pupillary light reflex in normal and anesthetized dogs: a preliminary study. The Journal of veterinary medical science / the Japanese Society of Veterinary Science 2015;77:475-478.