 

2 LIBRARY
Zoo 8 M ichigan State
mversity

This is to certify that the
dissertation entitled

GENOMIC ANALYSIS OF PATHOGEN EVOLUTION: VIRULENCE
GENE ACQUISITION AND GENETIC EROSION IN ESCHERICHIA
COLI

presented by

Adam Michael Nelson

has been accepted towards fulﬁllment
of the requirements for the

Ph.D degree in Genetics

 

 

SAL wow/1 15%”

 

Major Professor’s Signature

5/2? / 5%”

 

Date

MSU is an affirmative-action, equal-opportunity employer

_._.-.-.---.-.-.-.--o--.-.-.-.-.-.---.-.-.-.-.—.-.-.-.-.-.- ----.--.-

PLACE IN RETURN BOX to remove this checkout from your record.
To AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

5l08 KIProj/Aoc8Pres/ClRC/Dateoueindd

 

GENOMIC ANALYSIS OF PATHOGEN EVOLUTION: VIRULENCE GENE
ACQUISITION AND GENETIC EROSION IN ESCHERICHIA COLI
By

Adam Michael Nelson

A DISSERTATION

Submitted to
Michigan State University ‘
in partial fulﬁllment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY
Genetics

2008

ABSTRACT

GENOMIC ANALYSIS OF PATHOGEN EVOLUTION: VIRULENCE GENE
ACQUISITION AND GENETIC EROSION IN ESCHERICHIA COLI

By
Adam Michael Nelson

Escherichia coli is a gram-negative, rod-shaped bacterium that lives naturally and
commensally in the intestinal tract of humans and other mammals. However, some types
of E. coli have acquired genetic elements encoding virulence factors that contribute to
disease. Different disease phenotypes are caused by strains carrying a variable array of
virulence factors. Many of these virulence factors are largely acquired through horizontal
transfer. Pathogenic E. coli are grouped into at least twelve classes, or pathotypes, based
on the type of disease they cause. Observing the acquisition of virulence elements as a
means to study evolution has been previously used to determine the genetic ancestry of E.
coli and other pathogenic microorganisms. Conversely, gene loss can also be important in
enhancing pathogenicity by removing genes that encode proteins that may hinder
increased virulence, or are no longer functional because they are mutated or otherwise
incomplete. The research presented here is intended to enhance the current understanding
of the roles of genetic acquisition and genetic loss to virulence changes in pathogenic E.
coli by applying three paths of inquiry.

To address correlations between virulence proﬁles and disease incidence, 392 E.
coli isolates from 115 pediatric patients were screened for virulence gene content using
ﬂuorescently labeled PCR amplicons in a capillary based sequencing system. Virulence
proﬁles were compared to a phylogenetic framework to determine virulence distribution,

and correlations between presence of speciﬁc genes and the incidence of disease in

patients. The screening of this pediatric population lead to the discovery of a variant of E.
coli (sequence type 29), which was found very frequently (19%) in all of the samples
examined. This population of ST-29 isolates was further characterized by PCR to
determine the frequency of a panel of attachment-related loci, and by RFLP to determine
the capsular polysaccharide type.

To track genetic erosion events, PCR-based screening of individual components
in a pathogenicity island, called ETT2, showed examples of gene loss that rids possibly
non-functional genetic material from the genome. When a strain acquires new genetic
material by horizontal transfer, the new material must provide some ﬁtness beneﬁt or it
will be under selection to be removed. Type III secretion systems are complicated
structures that require a large number of genes to encode the proteins necessary for
proper assembly. If critical components of the type III assembly are missing, the
assembly will not function properly, and is likely to be under selective pressure for
deletion. A streamlined genome may result in a more efﬁcient pathogen. Here, the loss of
all or portions of ETTZ is shown in a variety of pathogenic isolates of E. coli. At least six
different deletion variants were discovered in the 57 strains examined.

These results help advance our understanding of evolution in E. coli by both
acquisition and loss of virulence elements and further demonstrate the dynamic and

diverse nature of the E. coli genome.

Copyright By
Adam Michael Nelson
2008

ACKNOWLEDGEMENTS

I would like to thank Thomas Whittam, my mentor, for his invaluable support and
guidance, and for the opportunity to work on a project I really enjoyed during my time at
Michigan State University. I also thank my guidance committee members, Drs. Michael

Bagdasarian, Linda Mansﬁeld and Vincent Young for their suggestions and support.

I have met so many people in our lab who were both friends and helpful co-
workers that were crucial to the completion of this research. I wish to thank Galeb Abu-
Ali, Dr. Teresa Bergholz, Sivapriya Kailasan, Sara Kienzle, Dr. David Lacher, Albert
Lee, Dr. Shannon Manning, Lindsey Ouellette, Dr. Weihong Qi, Dr. James Riordan, Dr.

Hans Steinsland, Dr. Cheryl Tarr, Dr. Seth Walk, and Dr. Lukas Wick.

I owe a great debt for the support of my family during my graduate career. I wish
to thank my parents, Bruce and Sue Nelson, my brothers, Josh and Jordan, my wife,

Suzanne, and my daughter Emily for their encouragement, patience and love.

TABLE OF CONTENTS

viii

LIST OF TABLES ...........................................................................
LIST OF FIGURES ......................................................................... ix
KEY TO ABBREVIATIONS .............................................................. x
Chapter 1. Literature Review ............................................................... 1
PATHOGENIC TYPES OF E. coli ............................................... 2
PARALLEL EVOLUTION OF VIRULENCE ................................. 4
EVOLUTION BY HORIZONTAL TRANSFER OF GENETIC
MATERIAL .......................................................................... 5
GENE LOSS AND THE EFFECT ON VIRULENCE — GENETIC
EROSION OF E. coli TYPE III SECRETION SYSTEM 2 ................... 5
DETERMINATION OF VIRULENCE PROFILES ........................... 8
PURPOSE ............................................................................ 9
HYPOTHESES TO BE TESTED ................................................ 9
Chapter 2. Genetic and virulence characterization of Escherichia coli isolated
from pediatric patients in Seattle, WA ..................................................... 12
SUMMARY ........................................................................ 13
INTRODUCTION .................................................................. 14
MATERIALS AND METHODS ................................................ 20
Bacterial Strains and DNA Isolation .................................... 20
PCR Primer Design ....................................................... 21
PCR of MLST Genes ...................................................... 24
Phylogenetic Analyses of Sequence Data .............................. 24
Virulence Genes and Protein Functions ................................ 25
MVGP Procedure Summary ............................................. 27
PCR of MVGP Genes .................................................... 28
Controls for MVGP ....................................................... 28
MVGP Data Conﬁrmation ............................................... 29
RESULTS ........................................................................... 30
Genetic Diversity of MLST Loci ........................................ 30
Sequence Type Diversity and Clonal Groups .......................... 3O
MVGP Analysis ............................................................ 33
Comparison of Virulence Gene Proﬁles and Phylogenetic
Relationships ............................................................... 33
DISCUSSION ....................................................................... 39
Diversity of Virulence Gene Proﬁles ................................... 39
Frequency of ST-29 Isolates in this Sample Set ....................... 40
ACKNOWLEDGEMENTS ....................................................... 42

Vi

Chapter 3. Characterization of a common meningitis-associated clone (ST-29) of
Escherichia coli found in pediatric patients in Seattle, WA

SUMMARY ........................................................................ 43

INTRODUCTION ................................................................. 44

MATERIALS AND METHODS ................................................ 45

PCR Primer Design ....................................................... 49

Strain Growth Conditions and DNA Extractions ..................... 49

MVGP PCR ................................................................ 49

Controls ..................................................................... 49

MLST PCR ................................................................. 49

Phylogenetic Analyses .................................................... 50

PCR for Attachment Loci ................................................ 50

Capsular Typing — PCR ................................................... 50

Capsular Typing — Restriction Digestion .............................. 50

RESULTS ........................................................................... 53

Attachment Genes ......................................................... 55

Capsular Typing .............................................................. 55

DISCUSSION ....................................................................... 57

ACKNOWLEDGEMENTS ....................................................... 59
Chapter 4. Genetic erosion of Escherichia coli type III secretion system 2

(ETT2) in 0157:H7 isolates ............................................................... 60

SUMMARY ........................................................................ 61

INTRODUCTION ................................................................. 62

MATERIALS & METHODS .................................................... 68

PCR Primer Design ....................................................... 68

Strain Growth Conditions and DNA Extractions... .................. 68

PCR ......................................................................... 68

RESULTS ........................................................................... 7O

ETT2 in EHEC 0157 ..................................................... 71

ETT2 in NON-0157 STEC .............................................. 71

ETT2 in 055:H7 ........................................................... 71

DISCUSSION ....................................................................... 79

ACKNOWLEDGEMENTS ....................................................... 82

Chapter 5. Summary and Synthesis ........................................................ 83

Future Considerations ...................................................... 85

REFERENCES ............................................................................... 89

vii

Table 1.

Table 2.

Table 3.

Table 4.

Table 5.

Table 6.

Table 7.

Table 8.

Table 9.

LIST OF TABLES

Patients in the Seattle pediatric study grouped based. on the diagnosis
of microorganisms .............................. , ..............................

Oligonucleotide primers used in the Seattle pediatric study. . . . . . . .
Virulence genes associated with diarrhea] disease ........................
Sequence variation among alleles of seven MLST genes. . . . . . . . . .

Summary of virulence gene detection frequency in sequence
types and in patients from the Seattle pediatric population study.. .

Gene and protein data for attachment-related loci used in PCR
assays of ST-29 isolates ........................................................

Comparison of genes from the Salmonella Pathogenicity Island 1
(SPI-l) of Salmonella enterica serovar Typhimurium and their
corresponding homologous counterpart in ETT2 .........................

Primer sequences used to amplify individual genes within ETT2. .

Results from the PCR assay of individual ETT2 genes within a
variety of E. coli serotypes and control strains. ........ ' ....................

viii

19

22

26

31

34

52

65

67

73

Figure 1.

Figure 2.

Figure 3.

Figure 4.

Figure 5.

Figure 6.

Figure 7.

Figure 8.

Figure 9.

Figure 10.

Figure 11.

Figure 12.

LIST OF FIGURES

Fluorescent chromatogram output from the multilocus virulence

gene proﬁling (MVGP) procedure ........... . ................................ 18
Phylogenetic tree showing the genetic relatedness of pediatric

E. coli in Seattle, WA ......................................................... 32
Virulence type diversity in two representative patients ................... 35

Non-metric dimensional scaling (NMDS) analysis of MVGP
results of 94 patients based on the presence or absence of 29
known or putative virulence factors ........................................ 38

Organization of the kps operon in E. coli .................................. 47

Representative banding pattern from a Sau96I restriction

endonuclease digest of the ampliﬁed kpsCM region in E. coli .......... 48
Frequency distribution of each gene from MVGP analysis of 392

isolates from 94 pediatric patients. ......................................... 54
Organization of E TT 2 gene cluster in E. coli .............................. 66

Pairing of the phylogenetic analysis and ETT2 deletion proﬁles in
many pathogenic types of E. coli ............................................ 76

Map of the region of ETT2 that was examined by PCR, and the
results of that screen. ......................................................... 77

Stepwise evolution model for the emergence of the modern
pathogenic clone of EHEC 0157:H7 from ancestral 055:H7 isolates. 78

The EIP island from enteroaggregative strain 042 ........................ 81

ix

KEY TO ABBREVIATIONS:

E. coli Pathotypes:

EPEC

EHEC

ETEC

EIEC

STEC

EAggEC

Phenotypes:
A/E

HC

HUS

Enteropathogenic E. coli - cause watery diarrhea in infants, can form
microcolonies and NE phenotype. EPEC contain the LEE island and a
large adherence-related plasmid.

Enterohemorrhagic E. coli - cause severe bloody diarrhea, HC, developing
sometimes into HUS. EHEC encode Shiga toxins, a large virulence
plasmid, and the LEE island.

Enterotoxigenic E. coli - cause travelers diarrhea, similar to cholera, but
not as severe. ETEC can contain heat stable and/or heat labile toxins.

Enteroinvasive E. coli - can invade epithelial cells through proteins
encoded on a virulence plasmid. EIEC have a similar invasive phenotype
to Shigella.

Shiga toxin-producing E. coli - any strain possessing one or both of the
Shiga toxins (Stxl/Stx2). EHEC are a subset of STEC.

Enteroaggregative E. coli - cause mild but prolonged watery diarrhea.

Attaching/Effacing phenotype seen in EPEC and EHEC. Characterized by
effacement of microvilli, intimate attachment, and pedestal formation due
to actin polymerization. Characteristic of strains harboring the LEE island.

Hemorrhagic colitis - severe bloody diarrhea caused by EHEC.
Hemolytic uremic syndrome - life-threatening disease caused by EHEC -

characterized by acute renal failure, the destruction of platelets and
destruction of red blood cells.

Virulence Factors:

sth/stxZ

Shiga toxin 1 or Shiga toxin 2 genes - both encoded on integrated
bacteriophages in EHEC and STEC — encode cytotoxins which inhibit
protein synthesis and cause characteristic HC and HUS symptoms.

ETT2

EIP

TTSS

LEE

Effector

KEY TO ABBREVIATIONS (cont’d):

E. coli type III secretion system 2 - cryptic island, widely distributed, but
usually deleted, possibly because it no longer functions as a TTSS. ETT2
may encode structural proteins for typeIII secretion, but likely not
effectors.

Largely uncharacterized island encoding possible effectors for ETT2.
Found in EAggEC strain 042, but not in 0157.

Type III secretion system - contact dependent method for directly injecting
bacterial proteins into the host cell by use of a needle-like complex that
spans both the inner and outer bacterial membranes.

Locus of enterocyte effacement - pathogenicity island encoding both
structural components and effector molecules for a functional type III
secretion system in EHEC and EPEC.

The actual proteins injected into the host cell using a TTSS. Effectors are
responsible for eliciting the pathological changes seen during A/E.

Strains of E. coli:

ECOR

K12

E. coli reference collection - diverse set of strains of E. coli maintained by
Dr. Thomas Whittam at Michigan State University.

Domesticated, non-pathogenic strain of E. coli lacking many virulence
factors characteristic of pathogenic strains (LEE island, Shiga toxins, etc).

Molecular Techniques:

MLST

MVGP

CEQ

ORF

Multi locus sequence typing - a DNA sequencing technique using
sequencing of 450-600 nucleotides of conserved genes to generate
phylogenetic comparisons.

Multi locus virulence gene proﬁling - typing system to examine 29
virulence genes & 1 positive control in uncharacterized E. coli isolates.

Genetic analysis machine developed by Beckman Coulter for use with
DNA sequencing (MLST) and virulence proﬁling (MVGP).

Open reading frame - DNA sequences containing a putative gene.

xi

CHAPTER 1

LITERATURE REVIEW

Commensal strains of E. coli exist naturally in the gut of humans and other
mammals without causing disease in healthy individuals. However, a small subset of E.
coli have acquired additional genetic elements encoding the production of toxins and
other virulence factors, such as invasion ability, secretion systems, and increased iron
utilization. Pathogenicity islands are horizontally-acquired genetic elements (plasmids,
phages, chromosomal islands) that increase pathogenicity in recipient strains. DNA
fragments of various sizes containing genes or groups of genes can be transferred

between strains or even between bacterial species, and are a force driving rapid evolution.

Pathogenic types of E. coli. At least 12 different classes, or pathotypes, of E. coli
have been identiﬁed based on distinct disease phenotypes [1, 2], and often contain
different pathogenicity islands encoding virulence factors responsible for conferring the
different disease phenotypes. This allows grouping of strains based on similar disease-
causing ability, rather than serological similarities based On typing of the somatic 0-
antigen and ﬂagellar H antigens. So while two strains may share the same serotype
(OlO3:H2, for example), they may not necessarily share the same virulence proﬁle.
Although the more closely related two strains are genetically, the more likely they will
have the same array of virulence factors and cause the same disease. The major
pathotypes of E. coli used in this work, and common virulence-related genes found
within those pathotypes, will be discussed below.

In the gut, enteropathogenic E. coli (EPEC) strains have the ability to form
microcolonies through localized adherence by genes encoded on a large virulence

plasmid [3]. EPEC also contain numerous pathogenicity islands, including the EspC

island, which encodes a serine protease autotransporter toxin (espC) that aids in
virulence, [4, 5] and the locus of enterocyte effacement (LEE) island which encodes a
type III secretion system and the ability to form attaching-effacing (A/E) lesions on
intestinal epithelial cells [6, 7]. NE lesions are characterized by brush border microvilli
destruction, intimate attachment to the host cell membrane, and the formation of a
pedestal structure in the host cell through the polymerization of actin ﬁlaments [6, 8].

Enterohemorrhagic E. coli (EHEC) strains also encode LEE and can elicit A/E
lesions as well. Unlike EPEC, they contain Shiga toxins (stxl and/or stx2) and the EHEC
virulence plasmid. This plasmid contains hemolysin (ehx) for iron piracy, adhesion
factors (toxB, iha) for attachment to the intestinal epithelia, iron utilization genes (chuA)
to process iron, and a protease autotransporter (espP) to cause proteolytic damage and
inhibit blood coagulation [9, 10].

Enterotoxigenic E. coli (ETEC) strains can encode two distinct toxins responsible
for increased ﬂuid accumulation in the gut lumen. The heat-stable (estA) toxin, which
binds to and activates guanylate cyclase, causes the increase of chloride ion secretion
resulting in the rapid accumulation of intestinal ﬂuid. The heat-labile (elt) toxin causes a
disease similar to cholera (heavy ﬂuid and electrolyte accumulation in the gut), because it
shares the same structure and mode of action as cholera toxin from Vibrio cholerae [11-
13].

Enteroinvasive E. coli (EIEC) strains cause dysentery and have invasive
phenotypes similar to Shigella, possessing a plasmid essential for invasion ability [14,
15]. Enteroaggregative E. coli (EAggEC) are able to adhere to HEp-2 cells in an

aggregative or ‘stacked brick’ pattern of autoagglutination. These strains encode some

enterotoxins, including a plasmid-encoded serine autotransporter toxin (pet) [16, 17],
Shigella enterotoxin 1 (setIA) [18-20], and the EAST heat-stable toxin (astA), which is
also found in some EPEC strains [21]. EAggEC can cause mild, but prolonged watery
diarrhea lacking fever or blood loss, however symptoms are frequently non-uniform [22-
25].

Shiga-toxin producing E. coli (STEC) are strains grouped by one common factor;
they contain one or both of the Shiga toxin genes (sth, stx2) [26-28]. Since sth and stx2
are encoded on separate, mobile bacteriophages, STEC strains are often not closely
related, but rather have only acquired and incorporated the 5th and/or stx2-containing
phages into their genome.

Parallel evolution of virulence. Strains from each pathotype are often not
evolutionarily related, but rather have acquired similar pathogenic ability through parallel
acquisition of the same or similar virulence factors. Despite the harm caused to the host,
selection favors increased virulence when it allows for better spread or transmission of
the pathogen [29]. Often better transmission equals more severe disease symptoms.

The discovery of a new pathogenic variant of E. coli capable of causing
widespread foodbome illness occurred in 1982 [30, 31]. Since then, this pathogenic
variant, 0157:H7, has been responsible for an estimated 74,000 infections each year in
the US. [32], causing bloody diarrhea and hemolytic uremic syndrome, a life threatening
illness characterized by acute renal failure, hemolytic anemia, and reduced ability to form
blood clots through the destruction of platelets [28, 33]. Since 0157:H7 strains also
contain the LEE island, they have the ability to form the characteristic A/E lesions on

epithelial cells, just as seen with EPEC.

Evolution by horizontal transfer of genetic material. The genome of E. coli is
extremely heterogeneous, having undergone remarkable sequence divergence between
the common pathotypes that cause disease. Horizontaltransfer of genetic material is
common, with striking variability between 0157:H7 isolates and the commensal K12
strain. Nearly 1400 genes in 0157:H7 are unique compared to K12, including many that
encode virulence functions. The genome is nearly 20% larger in 0157:H7 strains vs. K12
(5.5MB vs. 4.6MB) [34]. Other pathotypes are also highly divergent. For example, the
recent genome sequencing of the uropathogenic strain CFT073 revealed only 39.2% of
the total protein content in CFT073, the laboratory K12 strain MG1655, and EHEC
0157:H7 strain EDL933 is conserved between all 3 strains. CF T073 is as different

genetically from the commensal K12 strain as it is from EDL933 [35].

Gene loss and the effect on virulence - Genetic erosion in E. coli type III
secretion system 2 (ETT2). The publication of genomic DNA sequences has facilitated
rapid comparisons between strains to identify unique genes or pathogenicity islands.
EPEC and EHEC encode a well-characterized TTSS called LEE, which is known to be
functional [7, 36, 37]. Comparative genomic scans were used to discover a cryptic
pathogenicity island named ETT2 (for E. coli Type III Secretion System 2) in 0157:H7
strains [3 8]. ETT2 encodes a putative TTSS in select serotypes of E. coli, including
0157:H7 [39]. Type III secretion systems need two basic sets of genes necessary for
proper secretion. The structural genes encode proteins that assemble into a needle

complex, with a basal component spanning both the inner and outer bacterial membrane

and a needle-like component that forms a molecular syringe that allows for direct transfer
of bacterial proteins into the host cell [40]. It is thought that the structural genes for a
second TTSS in E. coli 0157 could be encoded in ETT2 [41].

However, the other crucial component needed for TTSS are the effector proteins,
which are the injected proteins that travel through the type III needle complex into the
host cell. Effectors then elicit pathological changes in the host [40]. Some effectors that
work with ETT2 may be encoded on a separate pathogenicity island called EIP. Putative
effectors with sequence homology to effectors that are secreted through two distinct
TTSS in Salmonella (SPI-l and SPI-2) are found in some strains of E. coli [41]. ETT2
shares sequence homology and genetic organization with the SPI-l TTSS [39]. This
suggests EIP-encoded effectors may work with the structural framework encoded by
ETT2, since both loci may share a common origin from in Salmonella.

In LEE, effectors cause pathological changes, such as actin polymerization and
pedestal formation. LEE has both the structural genes and the effectors encoded together
in the same island. In contrast, ETT2 and EIP are separate islands and rarely found
together [4 1 ].

The secretion framework is an energetically expensive structure to assemble, and
likely provides little or no ﬁtness beneﬁt without the accompanying effectors necessary
for pathogenic effects on the host cell. Genes encoding structural components are
conserved throughout various gram-negative bacterial pathogens encoding TTSS.
However, the effector molecules secreted into the host cell are oﬂen highly divergent and
cause distinctly different effects [42, 43]. In EPEC and EHEC, these changes are

characterized by massive actin polymerization causing structural rearrangement of the

eukaryotic cell surface into a pedestal shape that is essential for a close association
between the E. coli and the eukaryotic cell. The intimate association is necessary for the
onset of diarrhea] disease characteristic of EPEC and EHEC infection [7, 36, 37]. It has
not been demonstrated that ETT2 & EIP confer a similar phenotype. However, ETT2 &
EIP may be important disease determinants when found together in the same strain.
When they are not together, the numerous deletions observed in ETT2 may be an
example of genetic reﬁnement through erosion of factors not enhancing virulence.

Ren and colleagues showed a widespread distribution of individual genes or
groups of genes in ETT2 [41]. This included parts of ETT2 in K12, which does not cause
disease. Despite the diverse distribution, most strains examined had deletions that
eliminated major sections of ETT2. Only a few strains contained all of the island,
including all 0157 isolates, EAggEC strain 042, and several strains from the E. coli
Reference Collection (ECOR), a diverse set of 72 strains assembled from a variety of
locations and hosts [44]. All strains showing deletions in ETT2, including K12, are
apparently missing the EIP island [41].

ETT2 likely had a distant acquisition point and has been selectively eroded in
strains where it was lacking EIP, and was possibly non-functional. A variety of deletions
of ETT2 are evident in all strains that do not also encode EIP, except for 0157 strains,
which curiously have retained an intact set of structural TTSS components, despite
containing several frameshift mutations [41]. This may represent the ﬁrst stages of
genetic erosion, preceding the larger deletions seen in K12 and other isolates. Only a few
strains have been identiﬁed that contain both ETT2 and EIP. One example is an EAggEC

strain called 042. To date, no strains have been identiﬁed as encoding only EIP but

without ETT2. Conversely, all strains with deletions in ETT2 are missing EIP, except for

0157:H7 isolates, as previously mentioned.

Determination of virulence profiles. A large-Scale comprehensive assessment of
the prevalence of many virulence genes in clinical samples has not been done for
pathogenic E. coli. Existing studies have only examined smaller numbers of speciﬁc
strains. These studies were not randomized, nor did they examine more than a handful of
virulence factors [45-47]. The genetic elements necessary for enhanced virulence in the
various pathotypes are not fully understood, despite the importance of these pathogens. In
addition, the effect of strain mixtures providing complementing virulence factors to cause
disease is poorly understood. Multiple samples from the same patient may show the
patient is infected with more than one distinct pathogenic clone of E. coli. Two
techniques were used to address these issues: the identiﬁcation of phylogenetic
frameworks and the generation of virulence proﬁles in each strain.

Multi-locus sequence typing (MLST) compares the internal sequences of
housekeeping genes (n=7), which are considered to be under stabilizing selection
resulting in minimal variation in functionally essential proteins. Phylogenetic trees are
constructed by statistical software that compares genetic relatedness of nucleotide
sequences. This technique has been used successfully in a variety of microorganisms [48-
51], including E. coli.

Multi-locus virulence gene proﬁling (MVGP) was been developed to rapidly
characterize outbreak strains and new serotypes of pathogenic E. coli, and to discover

novel virulence proﬁles in each pathotype. MVGP works by combining ﬂuorescently

labeled PCR amplicons with capillary-based sequencing tools to generate chromatograms
displaying virulence proﬁles for individual strains. Each proﬁle identiﬁes individual
virulence factors as peaks of deﬁned size and dye label, and provides a ﬁngerprint of the
virulence content of each strain. When using samples isolated from patients displaying
disease symptoms of unknown etiology, MVGP can help identify virulence factors
important for causing or contributing to disease.

Purpose. The primary objective of this research is to identify examples of
evolution through gene loss and gene acquisition in a variety of genes associated with
pathogenesis. In patients with unexplained cases of diarrheal disease, analysis of the E.
coli collected from them was screened for a panel of known and putative virulence genes
that may have contributed to illness. It is important to note that the presence of a
virulence-related gene in an isolate of E. coli is not automatically correlated to either the
expression of that gene or the ability of that strain to cause disease symptoms, but it at
least makes that strain suspect, and worth investigating further.

The phenomenon of gene loss enhancing virulence or genetic ﬁtness has been
examined with the erosion of a cryptic pathogenicity island in E. coli called ETT2. This
island is believed to contain the structural genes to assemble a type III secretion system.
ETT2 is found in 0157:H7 isolates, but has numerous deletions in many other serotypes
of E. coli. The numerous deletions may be due to selection acting on a non—functional
pathogenicity island to remove unnecessary genetic material and streamline the genome.

Hypotheses to be tested. We will test the following hypotheses from chapter 2:

1. There will be a correlation between the number of virulence genes per patient

and an increase in disease duration. We will use chi-square tests to determine if there is a

correlation between virulence genes (0-5 genes) vs (6 or more) and the duration of illness
(0-3 days), (4-7 days), and (8 or more days).

2. When patients are put into two categories, a diagnosis group consisting of all
the possible diagnoses (Salmonella, rotavirus, etc) combined, there will be more
virulence genes in those patients with a diagnosis than in patients without a diagnosis.
We will also use chi-square to test this hypothesis using groups for genes (0-5) and (6 or
more) per patient).

From chapter 3, we will test these hypotheses:

1. Because the clinical isolate R8218 is a ST-29 strain and has a K1 capsule type,
we predict all or nearly all pediatric ST-29 isolates from Seattle will also have the K1
capsule type. A capsule typing method using restriction fragment length polymorphism
will be used to determine capsule proﬁles.

2. We also predict the prevalence of ST-29 isolates is related to an enhanced
ability to adhere to the intestine. Therefore we predict we will ﬁnd some attachment-
related genes common in extra-intestinal E. coli to be in very high frequency (near 100%)
in the ST-29 strains. A panel of genes encoding proteins related to attachment will be
screened by individual pairs of PCR primers.

From chapter 4, we will test these hypotheses:

l. The region of ETT2 we are examining will be found intact and undeleted in all
strains from the ancestral stepwise lineage related to modern 0157:H7 isolates. Strains
that represent the stepwise changes from ancestral EPEC-like 055:H7 to the modern
EHEC 0157:H7 will be screened by PCR for 11 individual genes within a 17-kb region

encoding the structural apparatus of the type III secretion system.

10

2. We predict other non-0157 isolates will have a variety of deletion proﬁles,
including some newly described deletion types. In addition to strains from the 0157
stepwise model, additional strains from other pathogroups will be examined and we

predict new deletion proﬁles unseen in previous studies will be found.

11

CHAPTER 2
GENETIC AND VIRULENCE CHARACTERIZATION OF Escherichia coli

ISOLATED FROM PEDIATRIC PATIENTS IN SEATTLE, WA

12

SUMMARY

A collection of 392 E. coli isolates were examined for virulence content using
multi-locus virulence gene proﬁling. These strains were taken from children hospitalized
with diarrheal disease of unknown cause. More than half of the E. coli strains were from
patients where no identiﬁable pathogenic organism was isolated (Campylobacterjejuni,
Clostridium diﬂicile, rotavirus, Shigella, etc). The E. coli from these patients was
examined for the presence of 29 known and putative virulence genes that serve as both
general markers for all major pathotypes of E. coli and speciﬁc markers for certain
pathogenicity islands or plasmids. These strains were also sequenced for 7 housekeeping
genes to determine clonal relationships and generate phylogenetic trees. The virulence
results from MVGP were paired with the phylogenetic framework generated by MLST to
infer patterns of acquisition in speciﬁc virulence genes and to study their distribution

across different clonal groups of E. coli.

13

INTRODUCTION

Escherichia coli are Gram-negative bacteria that include harmless, useful, and
harmful organisms within this genospecies [1]. There are a variety of pathogenic variants
of E. coli that can not only be group based on sequence similarities, but also by the
characteristics of the diseases that they cause. Often virulence factors are frequently or
exclusively found in speciﬁc pathotypes, and are necessary to cause the speciﬁc disease
associated with each pathotype [2]. E. coli can frequently acquire new virulence abilities
by horizontal transfer of genetic material [34, 35]. Despite the possible role of a number
of these putative virulence loci in disease, many have not been extensively studied.
Correlations between speciﬁc virulence proﬁles in clinical samples of E. coli and the
incidence of disease in patients have not yet been established.

In addition to well-deﬁned pathogenic clones, the effect of strain mixtures that
provide complementing virulence factors is poorly understood. Analysis of multiple
isolates from the same patient might show if a patient is infected With more than one
distinct pathogenic clone of E. coli. Two techniques have been used to address these
issues: the generation of phylogenetic frameworks by multi-locus sequence typing
(MLST) [52-54], and the identiﬁcation of virulence proﬁles in each strain by multi-locus
virulence gene proﬁling (MVGP) [47, 53, 55, 56].

MLST is a procedure that involves the sequencing of genes under stabilizing
selection to generate phylogenies that show the evolutionary history of the strains under
examination. Here, we have used a panel of seven “housekeeping” genes encoding
proteins that serve basic biological functions in the cell. Once the sequences are

assembled, they are concatenated and analyzed for single nucleotide variations to allow

14

for the generation of phylogenies. Based on the pattern of alleles for each gene, an allele
assignment can be made. When all of the allele assignment numbers are put together for
each of the genes sequenced, a “barcode” of that particular strain is generated. The
barcode represents a particular sequence type (ST), which is unique. So when two strains
share the same sequence type, every nucleotide sequenced is exactly the same in all seven
genes examined. MLST has been used repeatedly to characterize E. coli populations [56-
58]. One major advantage of this system is that the data is portable and can easily be
compared with results from other laboratories, provided the same primers were used to
sequence the same genes in both labs.

MVGP uses similar reagents and equipment as MLST, but generates data in a
different manner. It works by combining ﬂuorescently labeled PCR amplicons with
capillary-based sequencing tools to generate chromatograms displaying virulence proﬁles
for individual strains. This technique allows rapid generation of the virulence proﬁle of
bacterial isolates. Each proﬁle identiﬁes individual virulence factors as peaks of deﬁned
size and dye label, and “ﬁngerprints” the virulence content of each strain. When using
isolates from patients with illnesses of unknown etiology, MVGP can help identify
virulence factors that may be important for causing or contributing to disease. This
technique also can be applied to any set of strains of E. coli and can be customized by
adding or removing virulence loci, so newly identiﬁed virulence genes can be
incorporated, if desired. MVGP has already been used to characterize a number of
populations of E. coli, including clinical STEC isolates of serotype 0121:H19 [47], E.
albertii, which is closely related to Shigella boydii type 13 [59] , and E. coli serogroups

0174 [60].

15

The MVGP procedure consists of the following steps: 1) collection of bacterial
strains for study; 2) extraction of DNA; 3) PCR using one regular and one Beckman dye-
labeled primer; 4) pooling of labeled post-PCR products together; 5) running the sample
on a Beckman CEQ sequencing machine; and 6) analysis of the results to determine
virulence proﬁles. The Beckman dyes are available in 3 colors: D2 (black), D3 (green),
and D4 (blue). The red dye (D1) is reserved for a size standard and should not be used to
label PCR products. Post-PCR ampliﬁed product can be pooled together (we used 14 and
16 genes in two sets). The data output is shown as a chromatogram with peaks of '
increased ﬂuorescent intensity at a speciﬁc size representing each amplicon (Figure 1).

Here we used MLST and MVGP to examine 392 pediatric E. coli from patients
with diarrheal disease of unknown cause. Samples were collected for this study at the
University of Washington and Children’s Hospital & Regional Medical Center in Seattle,
WA. The E. coli isolates were collected from stool samples from patients from a number
of categories based on the identiﬁcation of other microorganismsi(Table 1). Up to ﬁve
isolates from each patient were taken for comparison to improve the statistical power of
the results, and to determine if individual patients have mixtures of strains with distinct,
and possibly synergistic, virulence proﬁles. So, for example, in patients diagnosed with
speciﬁc pathogens such as Salmonella, ﬁve E. coli isolates were also collected from those
patients for use in this study. Each isolate was conﬁrmed to be E. coli by PCR testing for
the presence of the uidA gene, which encodes beta—glucuronidase, an indicator of E. coli.
To blind the study from any potential bias, all samples were identiﬁed only by a unique
number. It was not until after typing was ﬁnished that epidemiological info (diagnosis,

illness duration, fever, vomiting, and bloody diarrhea) for speciﬁc strains was revealed.

16

We hypothesized that there would be a correlation between the number of
virulence genes per patient and an increase in disease duration. Also, when patients are
put into two categories, a diagnosis group consisting of all the possible diagnoses
(Salmonella, rotavirus, etc) there will be more virulence genes in those patients than in

those patients without a diagnosis.

17

Dye Signal

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

  

 

 

225000“;
5 135
200000 : ureA 1.85 . 45
175000 : 112 ma 207 440a 491
1; 163
f aStA ehxl terc 53ng 39‘“ ﬁyuA 223 toxB
150000 - ;
E l
125000-5 l
100000-E ‘
75000-5
50000-5 l 304
: ll md” .
I llllll lll lf
0 I . [I ll ll .
0 100 200 300 400 500 500 700

Size (nt)

Figure 1. Fluorescent chromatogram output from the multilocus virulence gene proﬁling
(MVGP) procedure. The Beckman CEQ genetic analysis system displays each dye-
labeled PCR amplicon as a peak of ﬂuorescence. Peaks are labeled with nucleotide size,
and a locus tag that speciﬁes the gene name.

18

Table 1. Patients in the Seattle pediatric study grouped based on the diagnosis of
microorganisms

 

Diagnosis Numbe Numbe Average Averag Vomiti a Bloody Severit Severit

Fever

 

r of r of Illness e a . Diarrhea b y and
Patient Isolates Duration Numbe ng a ' Duratio
s (in days) r of C
Stools n
1/221
C. jejuni 3 13 5.3 1 1/3 3/3 1.8 9.5
3/10“1
C. difﬁcile 12 37 5.5 1.2 6/12 8/12 1.5 8.3
STEC
(0157) 5 23 2.5 1 4/5 3/5 3/5 2.0 5.0
STEC

(non-0157) 5 24 6.3 1.2 2/5 1/5 4/5 1.4 8.8

0/7a
Rotavirus 8 35 4.1 1.5 7/8 4/8 1.4 5.7
Salmonella 4 15 1.8 1 2/4 4/4 3/4 2.3 4.1
Shigella 5 25 2 1 4/5 5/5 3/5 2.4 4.8
Negative
32/49a 27/50a 9/50a
(all) 51 219 5.1 1 1.3 6.6
Negative
a
(Groupl) 25 100 4.3 1 17/2412/23 2/24 1.3 5.6
Negative
14/21a 13/20a
(Group2) 22 99 6.2 1 5/22 1.5 9.3

 

a Number of responded patients
Calculated as the sum of fractions from vomiting, fever and bloody diarrhea

c Index is calculated from the severity index multiplied by the duration in days

19

MATERIALS AND METHODS

Bacterial Strains and DNA Isolation. E. coli isolates were cultured from the
stools of children with diarrhea who presented to a pediatric Emergency Department at
the Children’s Hospital and Regional Medical Center (CHRMC) in Seattle, WA. All
patients who presented with diarrhea to the CHRMC emergency department during the
period from November 1998 through October 2001 were considered eligible and
appropriate for enrollment in the study. This population has also been reported in other
studies [61-63]. Parents were given an information form that described the study and also
informed them of its voluntary nature. If they agreed to enroll their child, they were
instructed to complete a questionnaire in English, Russian, Spanish, Somali, or
Vietnamese. Questions asked addressed illness history and patient demographic
characteristics. If the patient was unable to provide stool during the visit, a swab
specimen from the rectum was obtained, but only if the family consented. The procedures
fOllowed were performed with the approval of the CHRMC Institutional Review Board.

A panel of diagnostic tests was done to determine a possible cause of illness on all
stools submitted in sufﬁcient quantity. These including inoculating the specimen onto
sheep's blood, MacConkey, sorbitol-MacConkey, Hektoen, and Salmonella-Shigella—,
Campylobacter-, and Yersinia-selective (Prepared Media Laboratories) agars and
inoculation into Selenite F (BBL; Becton Dickinson) and MacConkey (Binax) broths.
Campylobacter plates were incubated under microaerophilic conditions at 42°C, while all
other incubations were at 35°C. These techniques are standard for the isolation of
Aeromonas species, Campylobacter species, E. coli 0157:H7, Pleisiomonas shigelloides,

and Salmonella, Shigella, Vibrio, and Yersinia species. Also, the MacConkey broth was

20

tested after overnight incubation by EIA (Meridian Biosciences) for the Shiga toxin
antigen and Clostridium diﬂicile toxin was tested using a cytotoxicity assay with cultured
human diploid ﬁbroblasts. Cytotoxicity was conﬁrmed by neutralization with
Clostridium sordellii antitoxin. We sought parasites using trichrome stains and
formalin/ethyl acetate sedimentation. Fluorescence antibody testing was also used to
detect Giardia and Cryptosporidium species (Techlab). On frozen specimens, we sought
rotavirus, adenoviruses, and astrovirus using Rotaclone (Meridian Biosciences),
Adenoclone (Meridian Biosciences), and astrovirus (IDEIA Astrovirus EIA kit, DAKO)
EIAs, respectively.

All E. coli were grown on LB agar overnight at 37 °C from freezer stocks created
with single-colony picks of each strain. Strains were inoculated into 10 ml of sterile LB
broth for overnight growth at 37 °C, with moderate shaking. DNA isolation was
performed using the PureGene (Minneapolis, MN) DNA isolation kit protocol for Gram-
negative bacteria. Extracted DNA was quantiﬁed by a Nanodrop ND-1000 (Wilmington,
DE), then diluted with sterile water to ~100 ng/ml. DNA samples were stored at —20 °C
until use.

PCR Primer Design. DNA sequences of MVGP components were obtained from
GenBank. Homologous genes were aligned, with PCR primers designed from the
conserved regions of each gene (Table 2). A11 primers were synthesized by Integrated
DNA Technologies (Coralville, LA) and were stored at a concentration of 100 mM in
ddeO. Working concentrations of each primer were 1 mM for MVGP, and 20 mM for

MLST.

21

Table 2. Oligonucleotide primers used in the Seattle pediatric study.

 

 

Gene Name 5' - 3' sequence Reference

astA EAST-1P1 GGTCGCGAGTGACGGCTTTGT [64]
EAST- 1P2 CCATCAACACAGTATATCCGA [64]

bpr bpr-F 11 GTCTGCGTCTGATTCCAATA This study
bpr-Rl TCAGCAGGAGTAATAGC This study

cth cthl-R2 TGCCGCTCTGACAGGTGGACTTA This study
cthl-FZ GCCTTTAAAAACGGGGTGATACA This study

chuA chuA-63 6F TGAAACCGCGCCGAATGACGAGT This study
chuA-1171R GGGTTCCGCCAAGCAGGGTAATC This study

eae eae-F626 ATTATGGAACGGCAGAGGTTAAT This study
eae-R1166 ATCCCCATCGTCACCAGAGG This study

ehx MFSlFb GTTTATTCTGGAGCAGGCTC [65]
MFSIR CTCCACGTCACCATACATAT [65]

elt TW20 GGCGACAGATTATACCGTGC [66]
J W1 1 CGGTCTCTATATTCCCTGTT [66]

espC 601F GTTGGGGCTCGGACGACTTAT This study
1151R CCGGCACCCTTGAATGTTAATT This study

espP 2859F CGCGCCAAAAGACACCAATGAA This study
3321R CAGGCCAGCCCCCACAGACTT This study

estA JW 14 ATTTTTMTTTCTGTATTRTCTT [66]
W 7 CACCCGGTACARGGCAGGATT I [66]

ﬁzuA fyuA-924F GCAGCAGCAGCATTATTCG [47]
fyuA-RP CGCAGTAGGCACGATGTTGTA [67]

iha iha-Fl ACGCAGCCGCCAGTGTT This study
iha-R1 CCATCAATCAGTATCAGCGTGTAA This study

invG invG-481 F TGACCTGGTCGTTAATGCTG This study
invG-572R CGCCACGTAACTCATAAGTCC This study

irpZ irp2-FP AAGGATTCGCTGTTACCGGAC [67]
irp2-RP TCGTCGGGCAGCGTTTCTTCT [67]

mdh 269F GGTATGGATCGTTCCGACCT This study
p10 GGCAGAATGGTAACACCAGAGT This study

pet F2227 GTTACGGCCAGCAGTTCCCTTTTC This study
R2596 AATTGCCGGTCACTTTCCAGAGC This study

pic 921F CGATGCCCCCGTAGACTTTGTTTC This study
1333R TACCGTCTCCCCTTTTCAGTCCTC This study

saa saa-1442F CGTGATGAACAGGCTATTGC [68]
saa-1522R ATGGACATGCCTGTGGCAAC [68]

 

22

Table 2 (cont’d)

 

sat 1083F TGGTAGCGGTGGTATTATCTTTGA This study
1525R CGGCTTCTTTCGTTGTATCTGAGT This study
senA F486 GGGGGATTTTGTCATTCAGC This study
R975 CATTCCTTCCGCAGTTAGTAGTTC This study
sepA 1672F GGAGCGCCGGGAGACCT This study
2093R GCCGCATCGAGTTTCAGTT’I‘TTC This study
setIA F46 ACGGTTTTCCCAGTCTTTCT This study
R481 TATATCCCCCTTTGGTGGTA This study
shuA F285 CATCGCGGCGTGCTGGTTCTTG This study
R657 CTCGTCATTCGGCGCGGTTTCAC This study
sigA 30F GCCCAGGGAAAAATGTATGTAGAT This study
434R AAGACTGTCGCGGGTTTTTA This study
spaP SpaP-143F GGACTTCAGCAAGTGCCATC This study
SpaP-275R ACCACTCATGCCTGTCTCAA This study
3th 1A-251F GGGATAGATCCAGAGGAAGG This study
1A-832R CCGGACACATAGAAGGAAACTC This study
stx2 2A-506F CTGGCGTTAATGGAGTTCAG This study
2A-848R CCTGTCGCCAGTTATCTGAC This study
terC terC-106F TATGCACCGTGATGACAAGC This study
terC-275R GGCGAACCAGGAGAAGATTG This study
toxB toxB-911F ATACCTACCTGCTCTGGATTGA . This study
toxB-l468R TTCTTACCTGATCTGATGCAGC [10]
ureA ureA-109F TAACTATCCCGAATCCGTGG This study
ureA-213R GGGATCATTTCTGGTATGCCT This study

 

23

PCR of MLST Genes. E. coli isolates were characterized using MLST for
sequence and phylogenetic characterization of seven conserved housekeeping loci, and
MVGP for virulence characterization using a panel of 29 known and putative virulence
loci.

Aliquots, (1 pl) of each DNA sample were ampliﬁed in a 25-pl reaction mixture
using the AmpliTaq Gold system (Applied Biosystems, Foster City, Calif). Each reaction
contained 2.5 p1 10X Gold buffer (150 mM Tris-HCl, pH 8.3, 500 mM KCl), 2.5 pl
dNTPs (2 mM each dATP, dCTP, dGTP, and dTTP), 2.0 pl 25 mM MgC12, 0.5 pl of each
primer (lmM), 1.5 units AmpliTaq Gold, and 15.7 pl sterile ddeO. Ampliﬁcation in a

Hybaid PCR Express therrnocycler (Hybaid Limited, Middlesex, England) utilized an
initial denaturing step at 94 °C for 10 min., followed by 35 cycles of 92°C for 1 min., 58
°C for 1 min., and 72 °C for 30 see. A ﬁnal step of 72 °C for 5 min. was used for ﬁnal
completion of any partially extended product.

The PCR products were puriﬁed using QIAquick PCR Puriﬁcation Kit (QIAGen
Inc., Valencia, CA). Puriﬁed PCR amplicons were sequenced using a Beckman CEQ
2000 XL DNA sequencer (Beckman, Fullerton, CA) according to the manufacturer’s

suggested protocol.

Phylogenetic Analyses of Sequence Data. Sequences were aligned with the
ClustalW algorithm using the computer software MegAlign (Lasergene), and allelic
sequences were determined. Neighbor-joining trees of the concatenated internal regions
of 7 conserved housekeeping genes (aspC, cle,fadD, ich, lysP, mdh, and uidA) were

constructed using p-distance of nucleotide substitution with the computer software

24

MEGA version 2.1 [69] and the inferred phylogenies were each tested with 500 bootstrap

replications.

Virulence Genes and Protein Functions. KnovVn and putative virulence genes
used for MVGP screening are listed in Table 3. A summary of gene functions are
described below and grouped by the major pathotype in which the genes are found. The
gene mdh, encoding malate dehydrogenase, was used as a positive control for all E. coli.
A brief description of the virulence genes listed in Table 3 is described below.

Two iron-related genes were used to identify enteroaggregative E. coli,ﬁ)uA [67,
70, 71] and irp2 [67]. These are both markers for the High Pathogenicity Island [67],
which is believed to have been horizontally acquired by E. coli from Yersinia. EAggEC
also contain the serine protease autotransporter, pet in strain 042. This toxin is associated
with mucosal damage, increased mucus release, exfoliation of cells, and development of
crypt abscesses [16, 17].

Three markers were used for the p0157 plasmid: hemolysin (encoded by ehx) for
iron piracy [72], EPEC secreted protein P (encoded by espP) [73-76] and an adherence
enhancing protein [10] (encoded by toxB). In addition, strains were screened for an
autoagglutinating adhesin (encoded by saa), a marker for a subset of LEE-negative STEC
strains capable of causing severe gastrointestinal disease [68].

EHEC also have other genes encoding a variety of possible virulence functions,
including toxins (cth) [77-80], and iron utilization (chuA) [81, 82]. EHEC also contain
the TAI island (O-island 43). We screened for 3 markers from this island, iha [83], terC

[84], and ureA [85, 86].

25

Table 3. Virulence genes associated with diarrheal. disease

 

 

Major pathogensa Gene Protein Locationb
Control mdh Malate dehydrogenase C
EAggEC ﬁzuA Yersinabactin receptor F yuA C
irp2 Iron repressor HMWP2 C
pet Secreted autotransporter toxin P
EHEC cth Cytolethal distending toxin C
chuA Heme utilization C
iha IrgA homologue adhesin C
terC Tellurite resistance protein C C
ureA Urease C
ehx Enterohemolysin P (p0157)
saa Autoagglutinating adhesin P (p0157)
espP EPEC secreted protein P P (p0157)
toxB Toxin B P (p0157)
EHEC/EPEC eae Intimin C
spaP Surface protective antigen P C
EHEC/STEC stxl Shiga toxin 1 C
stx2 Shiga toxin 2 C
EPEC astA EASTl heat stable toxin C, P
bfoA Bundlin P (EAF)
espC Secreted protein C C
ETEC elt Heat labile toxin (LT-A) P
estA Heat stable toxin (STI) P
S. dysenteriae shuA Heme receptor C
S. ﬂexneri pic Secreted autotransporter toxin C
sat Secreted autotransporter toxin C
senA Enterotoxin ShET2 P
sepA Secreted protein A P
set] a Enterotoxin ShETl C
sigA Secreted autotransporter toxin C
Shigella Sp. invG Transport C

 

a EAggEC, entero-aggregative E. coli; EHEC, enterohemorrhagic E. coli; EPEC,

enteropathogenic E. coli; ETEC, enterotoxigenic E. coli; STEC; Shiga toxin-producing E.

coli; S., Shigella

b C, chromosome; P plasmid; p0157, plasmid found in E. coli 0157:H7 strains; P (EAF),

plasmid found in EPEC strains

26

EHEC and STEC also contain one or both Shiga toxins (encoded by sth
and stx2). The toxins’ ability to stop peptide elongation during translation has been well
characterized [87-89].

Three genes used in this study are common to bOth EHEC and EPEC: eae
(encoding the adhesin intimin and serving as a marker for the LEE island), and two
markers for O-island 115, spaP [90], and invG [91].

Three additional markers for EPEC used in this study include astA, the heat—stable
enterotoxin EASTl [64], bpr, which encodes bundlin and is a marker for the EAF
plasmid [92], and the serine protease autotransporter toxin gene espC [4, 5].

ETEC were identiﬁed by detection of two distinct toxins responsible for the
disease symptoms in ETEC infection. ST, the heat-stable toxin (encoded by estA) causes
the rapid accumulation of intestinal ﬂuid [66], while LT, the heat-labile toxin (encoded
by elt), is a secretory toxin with a function similar to that of cholera toxin [66, 93, 94].

Our marker for S. dysenteriae was the heme receptor gene ‘shuA [95, 96], which is
closely related to chuA from EHEC.

We used six markers for S. ﬂexneri, including 4 serine protease autotransporter
genes (pic [85, 97], sat [98, 99], sepA [100], and sigA [101, 102]), and enterotoxins

ShETl encoded by set] a [19, 20, 101] and ShET2 encoded by senA [24, 103].

MVGP Procedure Summary. Multi-locus virulence gene proﬁling involves
PCR ampliﬁcation of extracted DNA with a primer pair that has one regular (unlabeled)
and one Beckman ﬂuorescently-labeled primer with the dye attached to the 5’ end of the

primer. Up to 16 of the labeled amplicons are then pooled together, and then separated on

27

the CEO Genetic Analysis System using capillary based sequencing analysis. Visual
determination of virulence proﬁles resulted from analyses with pre-set parameters for

each locus for size and dye label.

PCR of MVGP Genes. This technique allows rapid generation of
virulence proﬁle data using proprietary technology developed by Beckman Coulter
(Fullerton, CA). We analyzed raw data with a collection of pre-set parameters, including
data indicating locus tags speciﬁng gene name, amplicon size (i 3 nucleotides), and dye
color. A size marker estimates the size of unknown fragments within 1-2 nucleotides.
Each proﬁle identiﬁes individual virulence factors as peaks of deﬁned size and dye label,
to provide a ﬁngerprint of the virulence content of each strain.

PCR for virulence loci examined by MVGP used the same protocol as the MLST
PCR except for the following changes: the 20 p1 cocktail contained 2.0 pl of 10X Buffer,
2.0 p1 dNTPs, 2.4 p1 MgClz, 1.0 pl each of forward and reverse primer, and 6.4 pl sterile
ddeO; cycling conditions included: 40 cycles of 92 °C for 30 sec., 50 °C for 30 sec., and
72 °C for 45 sec., with a ﬁnal extension step at 72 °C for 7 min. 5 pl of DNA template

was used per reaction. PCR primers and amplicon sizes for virulence genes are listed in

Table 2.

Controls for MVGP. Positive controls consisted of the malate dehydrogenase
gene (mdh) for all strains and a pooled positive reaction containing a mixture of DNA
from all strains serving as positive controls for the other 29 loci (Table 3) in the study.

Negative controls contained H20 and DNA from E. coli K12, which was negative for

28

most genes. In some cases, two sets of primers with the same dye-label were multiplexed
to save reagents and space. In that case, the H20 per reaction was reduced from 6.4 to
4.4 ml. The mdh gene was used as the positive control strains for each gene in the MGVP
set.

Each sample run contained both a positive control for each individual strain tested
(mdh), but also a pooled positive control that contained positive labeled amplicons for

each gene tested in that set.

MVGP Data Conﬁrmation. Inconsistencies in the data were clariﬁed by
standard PCR using 1.5% agarose gel electrophoresis. Approximately 900 individual
PCR reactions were performed to conﬁrm cases where a gene was not uniformly positive
in all strains of the same ST in a patient. PCR was used to also check inconsistencies
involving results when one, but not both genes on a speciﬁc element were detected, such
as irp2 and ﬁuA, markers for the High Pathogenicity Island from Shigella. In all cases,

every strain with variable results was re-tested to be as thorough as possible.

Images in this dissertation are presented in color.

29

RESULTS

Genetic Diversity of MLST Loci. All 392 strains from 94 patients in this study
were sequenced by MLST for seven loci. The nucleotide diversities of these loci were
between 4.2% (lysP) to 14.2% (fadD). The overall variability across all loci was 9.4%
(353 variable sites in 3753 total nucleotides sequenced) (Table 4). The lowest and
highest rates of synonymous substitutions, as measured by the Nei-Gojobori method of
nucleotide substitution, were also found in lysP (3.00 :l: 0.90) and fadD (9.74 :t 1.62)
respectively. However, for non-synonymous substitutions, IysP also had the lowest rate

(0.00 i 0.00), but uidA had the highest rate (0.41 d: 0.12). The overall rates of

synonymous and non-synonymous substitution were 5.69 d: 0.41 and 0.10 i 0.02,

respectively.

Sequence Type Diversity and Clonal Groups. A phylogenetic framework was
assembled to display the diversity of different STs. The 392 strains contained a total of 67
unique ST s (Figure 2). This sample set was widely distributed across the diversity of all
known E. coli and included some strains representing speciﬁc classes of disease-
associated E. coli that were highly overrepresented in the sample. For example, clonal
group 35 (CG-35) contains strains associated with septicemia and meningitis, including
clinical isolate R8218 [104, 105]. Our sample set contained 74 strains of ST-29, which
belongs to CG-35. ST-29 is the sequence type of 19% of all strains in this study, and was

found four times more frequently than the next most common type, ST-27 (n=1 8).

30

Table 4. Sequence variation among alleles of seven MLST genes. Shown here are the
number of nucleotides sequenced per gene, the number of variable nucleotides, the
number of parsimoniously informative sites (nucleotide variations in more than one
strain), the number of alleles identiﬁed for that gene in this sample set, and the p-
distance.

 

 

 

Locus" No. sites No. variable No. PI No. alleles % p distance
sites i SE
aspC 513 45 25 33 1.20 :l: 0.24
cle 567 68 53 34 2.36 :1: 0.31
fadD 492 70 57 36 2.70 :l: 0.41
ich 567 52 42 33 1.84 :1: 0.29
lysP 477 20 14 20 0.84 i 0.23
mdh 549 36 29 27 1.11 d: 0.22
uz'dA 588 62 42 39 1.83 i 0.31
Total 3753 353 262 222 1.70 3: 0.12

31

No. No.
NJ tree 8 T isolates patients
295 3
298 3
1 69 1 2
1 71 1 4
31 3
1 68
297
300
281
282

  
  
 
    
 
 

Distance

1-——I
0.002

 

 

 

 

 

 

.3

 

d-I

 

 

 

 

—l

 

V
AGM‘UDOIAOIhNUI-‘UI-‘UIQO’IAhwdd-‘AmN-‘OJ-‘UIOJ-‘CD-‘ddAV-‘UINMO'IN-‘UI-‘NNUN‘(DU-hmméé-‘UIA

.3hawmgmagbaQAJAgﬁdgaa4.:ANNQQAudnanaaaaudanawmaaaaaaaA—LAANNAAANJUIQAA

 

 

 

_|-I

J-l

 

A

 

Figure 2. Neighbor-joining tree showing the genetic relatedness of 67 sequence types
392 E. coli from 94 patients. Each branch tip represents a unique sequence type (ST)
based on multilocus sequence typing of 7 genes. Distance is measured by p distance with
bootstrap support greater than 70% given by italics. The number of isolates and number
of patients in which each ST was isolated are given in the right hand columns. The
circles denote STs that were recovered from more then 1 patient (n = 24). The most
frequently detected ST (ST-29) is indicated by the gray arrow.

32

The second and third most common clonal groups included CG-23 (ECOR A)
with 34 isolates, and CG-38 (UTI-l associated strains from ST-27 and ST-28), with 25

isolates. We found more than one representative for 24 of the 67 STs (35.8%).

MVGP Analysis. A total of 392 isolates from 94 patients were examined via
MGVP, with an average of 8.1 unique virulence genes detected per patient. The overall
virulence type (VT) diversity is 71%, indicating that two strains chosen at random have a
71% chance of displaying different proﬁles in virulence genes. Ten patients had strains
with zero diversity (all isolates with the same VT), whereas twenty patients had strains
with 100% diversity (all isolates with different VTs). Genes encoding iron acquisition or
utilization ability were the most frequently detected in this sample set (Table 5),
including shuA (72.5% positive), irp2 (72.0%), ﬁzuA (68.4%), and chuA (65.5%). In
contrast, other genes restricted to speciﬁc pathotypes were found less frequently,

including six] and stx2 (6.0% detection each).

Comparison of Virulence Gene Proﬁles and Phylogenetic Relationships.
Virulence proﬁles were compared with phylogenetic frameworks generated by MLST.
Three examples of virulence diversity within individual patients include the following:
Patient 1 had 5 individual isolates with the same ST (ST-29) and VT. Patients 34 and 35
(Figure 3) had isolates that showed variability in their proﬁles. Patient 34 contained 5
strains with the same ST (ST-292), but had 5 slightly different VTs. Patient 35 had
strains with 4 different STs (STs 119, 272, 293, and 294) and 5 different VTs.
Collectively, patient 35 contained strains with 17 of 29 Virulence genes examined in this

study (59%). This patient shows the

33

Table 5. Summary of virulence gene detection frequency in sequence types and in
patients from the Seattle pediatric population study.

 

 

Gene % STs (67) % Patients Gene % STs (67) % Patients

£4) (94)
shuA 70.1 79.8 set] a 17.9 12.8
irpZ 70.1 81.9 pet 16.4 23.4
ﬁ/uA 67.2 85.1 sepA 16.4 9.6
spaP 64.2 50.0 espP 11.9 11.7
chuA 62.7 74.5 stxl 11.9 12.8
terC 62.7 74.5 toxB 10.4 11.7
invG 59.7 47.9 pic 10.4 8.5
eae 44.8 40.4 stx2 7.5 10.6
iha 37.3 40.4 espC 7.5 6.4
ureA 35.8 25.5 senA 6.0 6.4
saa 32.8 30.9 bﬁDA 3.0 2.1
sat 28.4 29.8 cdt 3.0 2.1
ehx 22.4 17.0 elt 3.0 1.1
astA 20.9 11.7 estA 1.5 1.1
sigA 20.9 10.6

 

34

63865 8? 2 £8:me :5qu .8505 go: 0.8 SEES etaawoz .ocow 832th 35
new :38 m0>2 0353 m E8058 235mm 3.8—8 2.2. .3538 egg—com 3335838 95 E gauze cab coco—35 .m charm

o O O o
OO OO O O O
OO 00. O O O
o OO O OO
8 as O O ooo

59: V23. Vase .63 Va.» Dame V36 one E9. NR2 new 9: 3o V56
to VQQ lean Noam V6.5 952 D2: Knee Vase Be Vs

O O

O O

O

O O O

O O O

Vat. Vase :8 V3}.

O O
O O
O O
O O
O O

$2:

00

as

swam Hm» 33959
S: Hwy Eng?
3: km» thoozﬁt
ANNN Hwy mummokﬁ.

Ammm Hm» Shook/H

uﬂumcﬁO ~39 .N "mmmc:wamﬁ I mm 33:?—

OO O O 000
OO O 0 GOO
000 O O @O
OO O O OO
00 0 000

O

O
O

V23. V23. NE V36 USO Vac one :3. .38» e5. 5: 33 V56 mdh

Vat. V93.

3m V5}.

to VQS meme Noam Von: Uh: bsﬁ meme Vase

En SE

3am Hm» smack/H
Ammm pm; @302?
Sam Hwy $3023.
Amom Hwy $395k

Amam Hwy 833:.

:— m=:own=m e-e=e£~eh Ewe—.35 I vm 285.5

35

greatest diversity of STs and VTs in this study, and may be an example of how different
strains can contribute to unique disease by complementation of virulence ability.

A number of genes related to type III secretion (eae, invG, and spaP) and iron
utilization (chuA, shuA, ﬁzuA, and irp2) are seen in 30 or more different STs, and 38 or
more patients (Table 5). Detection of autotransporter genes was highly variable.

Another analysis technique called non-metric multidimensional scaling (NMDS)
analysis was used to place most patients into two clustered groups based on the virulence
content of results from each patient, not per isolate. This allowed for distinctions based
on the detection of virulence genes in any strain found in a patient, while keeping the
individual patient as the unit of measurement, and not individual isolates. Since we used
29 virulence loci, NMDS combines these 29 dimensions into a two-dimensional image.

NMDS showed two distinct groups (Figure 4). Groups 1 and 2 contain 42 and 43
total patients respectively. All 10 STEC patients were within group 1, whereas 9 of 11
patients with C. difﬁcile were in group 2. Group 1 also had 25 patients with no diagnosis
and an average of 9.0 virulence genes per patient, while group 2 had 23 patients with no
diagnosis and an average of 6.6 virulence genes.

Statistical analysis. Our ﬁrst hypothesis was that a longer illness duration (0-3
days vs. 4-6 days vs. 7 or more days) was signiﬁcantly correlated with more virulence
genes found per patient. We accepted this hypothesis based on a chi-square test (2:7.5,
p-value =0.02). The second hypothesis was that we would ﬁnd a signiﬁcant correlation
between the number of virulence genes (0-5) vs. (6 or more) and diagnosis group. This
was based on the idea that the E. coli from the no diagnosis group were not likely the

cause of the illness seen in the patient and therefore would tend to have less virulence

36

genes. We rejected this hypothesis based on a chi-square test (2:2.07, p-value =0.150),
so there is no signiﬁcifcant difference between the number of virulence genes in the

diagnosis and the no diagnosis groups.

37

 

 

 

 

 

 

 

1.20— '
0
N 0.80-
.2 .
>< Group 1 . Group 2
(0
\ 0.40"
m o
.e
0
E 0.00 '
Q o
-040—
1 o
-0.80 Tl'l'l'l'l'l'l’
-1.00 -0.60 -020 0.20 0.60

-0.80 -0.40 0.00 0.40
Principal axis 1

o No Diagnosis 0 Rotavirus
o C. difficile 0 Salmonella
O C. jejuni O Shigella

0 E. coli

Figure 4. Non-metric dimensional scaling (N MDS) analysis of the MVGP results of 94
patients based on the presence or absence of 29 known or putative virulence factors. Two
clusters are indicated by the circles, named group 1 and group 2.

38

DISCUSSION

Diversity of Virulence Gene Profiles. Virulence proﬁles in this study are highly
variable. Individual patients often contain multiple STs with minor to major variation in
virulence diversity. At least 70 STs were found from 392 isolates sequenced, including
45 newly discovered STs. Some individual patients contained strains with different STs
and VTs. Even in patients with strains that all have the same ST, variability in virulence
exists, such as was seem in the analysis of strains from patient 34 (Figure 3). Other
patients had diversity in both STs and VT. The greatest example of ST and VT diversity
was in patient 35, with four unique sequence types (STs 119, 272, 293 and 294) and ﬁve
unique virulence proﬁles. This patient harbored E. coli with 17 of 29 (59%) virulence-
related genes used in our study.

Genes encoding virulence factors responsible for iron acquisition and utilization
(shuA, ﬁzuA, chuA, and irpZ) were the most prevalent in the samples examined. Although
iron is important for the survival of E. coli [106, 107], the role of iron—related genes in
pathogenesis is not entirely clear. Such widespread distribution in this sample set may
indicate a role in survival, as a means for virulence enhancement, rather than overt
pathogenic ability.

Some of the variation seen among isolates with the same ST may be a result of
natural rates of gene ﬂux. Because many of the virulence genes in this study are found
on mobile elements, it is possible the plasmid or phage containing certain genes could be
lost. There is also a possibility of mutations at the primer site affecting proper

ampliﬁcation and the affect of false-negative or false-positive results. Extensive rechecks

39

by standard PCR and gel electrophoresis helped clarify initially inconsistent results in the

data set.

Frequency of ST-29 Isolates in this Sample Set. The detection of a high
frequency of ST-29 isolates in this study was surprising. These may represent a group of
strains with enhanced colonization ability. ST-29s appear to be largely lacking the genes
encoding many virulence factors typically associated with disease. They do, however
contain, an even higher frequency of iron-related genes than the non-8T-29 strains in this
study.

The detection of such a high number of ST-29 isolates was unexpected. This
sequence type is the same as the meningitis-associated isolate RS218. Nearly all (68/70)
of the ST-29’s in this set also contained the same capsule type (K1) as R8218 [105]. This
isolate may represent a widespread meningitis associated clone that has been under-
investigated. The reasons for the high frequency of detection may indicate this strain has
an ability to cause disease that is yet uncharacterized, or it simply might colonize and
survive better in the gut. Why a strain with potential extra-intestinal disease-causing
ability is so frequent in the stool of children is also unclear. Since neonatal meningitis
caused by strains like R8218 is present only in very young children [108], perhaps ST-
29’s can cause disease, but only when a child has an underdeveloped immune system.
Perhaps, in older children, ST-29 isolates are not able to cause disease, but still persist in
the gut through a mechanism of attachment or immune avoidance.

A total of 10 of 51 patients without a diagnosis (19.6%) had ST-29 isolated from

their stool. However, ST-29’s were isolated from 5 of 12 (41.7%) of patients diagnosed

40

with C. diﬁicile and 3 of 5 (60%) of patients diagnosed with Shigellaﬂexneri. No ST-29
isolates were found in patients with a diagnosis of C. jejuni, rotavirus, Salmonella
paratyphi B, Salmonella subgenus 1 (Salmonella D) or E. coli serotypes 01032H2,
O111:H8, 01 l 1 :NM, or O] 182H16. The presence of C. jejuni, rotavirus, Salmonella, etc,
may change the local environment of the gut in ways that inhibit the survival of 8T-29
isolates.

Virulence proﬁling of E. coli has been used previously to detect a large number of
mostly attachment-related loci in strains from the E. coli Reference collection (ECOR)
[109]. We hypothesized ST-29 isolates would contain a gene or genes found in nearly
every strain that is associated with attachment in extra-intestinal variants of E. coli. We
further investigated ST-29 strains by examining a select number of attachment-related
loci used by Johnson, et al. [109], which were not included in our original MVGP gene
set. This work is detailed in a subsequent study.

It is also unclear if 8T-29 isolates have a differential geographic distribution. The
Seattle, Washington state area has a high incidence of illness due to E. coli 0157:H7
[110-114], but also has the research and laboratory facilities for efﬁcient detection of this
serotype. The closely related strains of 8T-29 may in fact exist in large numbers
worldwide, but the low detection frequency may be due to a lack of appropriate

surveillance.

41

ACKNOWLEDGEMENTS

I would like to thank Lindsey O'uellette for her tireless work sequence typing the
strains used in this set, as well as Drs. Eileen Klein and Phillip Tarr for collecting and
sending us the strains examined here. Thanks are also due to Albert Lee for his help with
virulence gene data conﬁrmation and to Drs. David Lacher and Cheryl Tarr for technical
assistance.

This research was supported by funds from the Centers for Disease Control and
Prevention (Cooperative Agreement CCU015040) and NIAID, NIH, DHHS, under NIH

research contract # N01-AI-30058 (TSW).

42

CHAPTER 3

CHARACTERIZATION OF A COMMON MENINGITIS-ASSOCIATED CLONE

(ST-29) FOUND IN PEDIATRIC PATIENTS IN SEATTLE, WA

43

SUMMARY

The intrinsic virulence of individual Escherichia coli strains is determined in part
by the ability to encode toxins, enhanced nutrient utilization, attachment, or other abilities
important for disease. However the distribution and relationship of virulence factors to
disease-causing ability is not entirely understood. As seen in Chapter 2, we reported the
sequence types and virulence proﬁles of 392 E. coli isolates from pediatric patients with
diarrheal disease of unknown cause. In this strain set, a high prevalence (19%) of isolates
of a single sequence type (ST-29) were detected by MLST analysis. 8T-29 belongs to a
larger clonal group that includes 8Ts of extraintestinal pathogenic E. coli (ExPEC)
including the meningitis-associated strain R8218. We hypothesized that 8T-29 strains
have a ﬁtness advantage related to adherence to the intestine. To address this hypothesis
we assayed for the presence of additional genes associated with ExPEC adherence (aafA,
aggR, bmaE, ﬁmH, iutA, focG, ibeA, nfaA, pap/1H, sfaA, sfaS) in 70 8T-29 strains using
PCR-based assays. MVGP screening showed iron acquisition and iron utilization genes
were the most frequently detected, including shuA (97%), ith (97%),ﬁ/uA (90%), and
chuA (90%). Toxin genes like six] (10%), and stx2 (3%) were found less frequently. The
prevalence of attachment factors was mixed, with some detected frequently, ﬁmH (97%)
and nfaA (90%), whereas others were low or absent (aggR, focG, and aafA were not
detected in any 8T-29 strain). An RFLP-based capsule typing method showed 68 of 70
(97%) ST-29 isolates to be K1, the same type as R8218. ST-29 warrants further study
because it appears to mark a common E. coli intestinal clone, related to ExPEC, which

lacks virulence genes associated with diarrheagenic E. coli.

44

INTRODUCTION

Escherichia coli is a gram negative bacterial resident of the intestinal ﬂora within
a healthy human host. However, some strains of E. coli have acquired the ability to cause
a variety of illness, ranging from mild diarrhea to a severe bloody diarrhea that can be life
threatening. Certain strains are also associated with disease outside the intestine,
including meningitis, septicemia, urinary tract infections, and kidney damage [1, 115].
The different pathogenic abilities are seen because some strains have acquired genes or
pathogenicity islands that allow for the production of toxins and other factors necessary
for disease onset [1, 2]. E. coli is capable of frequent acquisitions of new virulence ability
by horizontal transfer of genetic material. One way to group E. coli is based on the type
of disease they cause. Strains of the same disease class are not necessarily evolutionarily
related, but may have acquired the same virulence factors encoded in their genome to
produce similar disease phenotypes.

We are interested in determining the prevalence of the genes encoding many
common virulence factors in speciﬁc populations. In Chapter 2, we examined 392 E. coli
isolates from children hospitalized in Seattle, WA with unexplained cases of diarrheal
disease. These strains were characterized by two methods: multi-locus sequence typing
(MLST), and multi-locus virulence gene proﬁling (MVGP). DNA sequencing revealed a
predominant sequence type (ST-29) found in 18.9% of strains (n=74).

MLST detected 67 unique sequence types in this population that were distributed
throughout the diversity of E. coli. However, 8T-29 was discovered at an exceptionally
high frequency compared to other sequence types. 8T-29 isolates do not contain many of

the classical virulence factors associated with enteric disease. We hypothesized ST-29

45

isolates may be more frequently detected because they are better able to attach to the
intestinal tract. The majority of 8T-29 isolates, 60 (81%) were examined for the presence
of 11 attachment associated genes by PCR. In addition, 70 (95%) of the ST-29 strains
were capsular typed using an RFLP-based method (Figure 5) to determine the speciﬁc
allele of their polysaccharide capsule. The banding pattern of the ~10,000-12,000 base
pair kpsC—kpsM ampliﬁed region after digestion with the Sau96I restriction endonuclease
is seen in Figure 6. Determination of allele type is easily made based on the distinct
banding pattern for each allele standard.

8T-29 is important for further study because it is the same sequence type as
R8218, a strain implicated in extra-intestinal infections, including septicemia and
meningitis [116, 117]. We also propose that ST-29 marks a clone that has a role in
intestinal pathogenesis that has yet to be determined.

We wish to test the following hypotheses regarding 8T-29 isolates examined here.

1. Because the clinical isolate R8218 is a 8T-29 strain and has a K1 capsule type,
we predict all or nearly all pediatric 8T-29 isolates from Seattle will also have the K1
capsule type. A capsule typing method using restriction fragment length polymorphism
will be used to determine capsule proﬁles.

2. We also predict the prevalence of ST-29 isolates is related to an enhanced
ability to adhere to the intestine. Therefore we predict we will ﬁnd some attachment-
related genes common in extra-intestinal E. coli to be in very high frequency (near 100%)
in the 8T-29 strains. Individual pairs of PCR primers will screen a panel of genes

encoding proteins related to attachment.

46

central variable region

Keeeel'e ' "hﬁh‘ '
enamels eewneahﬁ
122450bp wmﬂﬁwlﬁw @iﬁiﬂéﬂ

L_---_---——-_I

Figure 5. Organization of the kps operon in E. coli. Primers were designed in the
conserved ﬂanking regions (kpsC and kpsM genes) and ampliﬁed a central variable
region that differs greatly between strains of E. coli. The area ampliﬁed is indicated by
the boxed region.

47

High Mass

DNA Ladder
”-000 5 042 R8218 CFTO73 T18 100 bp — 19999
_ Ladder
_ K1 Type K2 Type K5 Type
_. A - 6000
- 5123
_ 4469 _ 4159
._ — 4000
— 2019
— - 2995 - 3000
— - 2420 — 2072 - 2000
-' 1333
—1s49 _ 1500
- 1505 — 1563 -1522 = 1333
- “19 — 1331 - 33
1,000 — - 1000
_ - 979 _ 900 - 1°00
-— - 834 - 783 - 800
ﬁ — 729 - 729 — 729 _ 700
— 527 - 679
__ — 502 — 502 - 500
— 551
_ 500
_ - 463 _ ’77
- 403 — 403 — 400
— 357
_ — 300
— 205
— - 200
— 155
J _ 100
100

 

Figure 6. Representative banding pattern from a Sau96I digest of the ampliﬁed kpsCM
region in E. coli. Shown here are the speciﬁc types used as standards when comparing the
8T-29 isolates used in this study. 97% of the 70 8T—29s examined by RF LP were K1, the
same as the R8218 standard pattern.

48

MATERIALS & METHODS

MVGP PCR primer design: DNA sequences of MVGP components were
obtained from GenBank. PCR primers were designed from the conserved regions of each
gene sequence available. All primers (Table 2) were synthesized by Integrated DNA
Technologies (Coralville, IA.) and were stored at a concentration of 100 mM in ddH20.
Working concentrations of each primer were 1 mM for MVGP, and 20 mM for MLST.

Strain growth conditions and DNA extractions: All E. coli strains were grown
on LB agar plates overnight at 37 “C from freezer stocks created with single-colony picks
of each strain. Strains were inoculated into 10 m1 of sterile LB broth for overnight grth
at 37 °C, with moderate shaking. DNA isolation was performed according to the
PureGene (Minneapolis, MN) DNA isolation kit protocol for gram-negative bacteria.
After extraction, DNA was quantiﬁed by a Nanodrop ND-1000 (Wilmington, DE), and
then diluted with water to ~100 ng/ml.

MVGP PCR: PCR of virulence-related loci were performed as described in
Chapter 2.

Controls: Positive controls consisted of the malate dehydrogenase gene (mdh)
for all strains, and a pooled positive reaction containing a mixture of DNA from all
strains serving as positive controls for the other 29 genes in the study. Negative controls
contained H20 and DNA from K12, which was negative for most genes. In some cases,
two sets of primers with the same dye-label were multiplexed to save reagents and space.
In that case, the H20 per reaction was reduced from 6.4 pl to 4.4 pl.

MLST PCR: MLST PCR, puriﬁcation, and sequencing were performed as

described in Chapter 2.

49

Phylogenetic analyses: Phylogenetic analyses of sequencing data was performed
as described in Chapter 2.

PCR for attachment loci: 5 pl of DNA template was used with 2.5 pl of 10X
Buffer, 2.5 pl dNTPs, 2.0 pl MgClz, 1.0 pl each of forward and reverse primer, 1.5 units
AmpliTaq Gold, and 15.7 pl sterile ddH20. Cycling conditions included: 10 minute
initial soak at 94 °C, 35 cycles of 92 °C for 1 min., 55-60 °C for 30 sec., and 72 °C for 30
sec., with a ﬁnal extension step at 72 °C for 5 min. Speciﬁc annealing temperatures
varied, depending on the gene (Table 6).

Capsular typing - PCR: Primers were used to amplify a region (~11,000 bp) in
the kps operon (Figure 5). PCR was performed using Takara LA Taq polymerase (1 .5U),
Takara 10x buffer (2.5 pl), Takara 2.5 mM dNTPs (4.0 p1), 1.5 pl of each primer (10
mM), and 14.2 pl sterile ddH20. Primer sequences are: Forward: kpsC-F558 5’ —
AGCCGAAATTTGGGTGAAGGTG — 3’ and Reverse: kpsM-R120 5’ —
YGCGCATTTGCTGATACTGTTGG — 3’. Amplicons (5 p1) were visualized on 1.5%
agarose gels with 6 ml ethidium bromide stain to conﬁrm successful ampliﬁcation prior
to digestion. Controls included strains R8218 (K1 capsule standard), CFT073 (K2
standard), T18 (K5 standard), and 042 (042 standard), along with a negative control of
water.

Capsular typing - digest: Amplicons were digested using restriction enzyme
Sau96I. Each 30 pl reaction contained 3.0 pl of 10x buffer, 1.0 U of enzyme (0.2 pl), 16.8
pl sterile ddHZO, and 10 pl template. Reactions were digested overnight at 37 °C then
separated on a 1.5% agarose gel stained with 12 pl ethidium bromide. Ladders included

100 bp standard (2 pl), and a high DNA mass ladder (4 pl). Gels were loaded with 15 pl

50

of digested PCR product, and run at 80 volts of constant current for about 2.5 hours to
allow for sufﬁcient separation. An example of representative banding patterns for four

different capsule types is seen in Figure 6.

51

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

.8: 0800 05250500055005.0008 :05 0&4
H8: 0&0: om 8550 0 co 0: 05050<C<00<00<5<0050 mm 90 “.20 0&0
30: 05.0: <000500<<<0<t<<50<00<000 m an 8.8
We: 0&0: ow 885..., 0<C05<00500050<<0<000050 8 0:. 0 em 88
w :0 5:320 BEE .
$0; 0500 0t0500e00<e<00<000500 :0va $.80
50: 0500 N4 855.: 0 0500E505050050<0005< 00 own 000: Iq m.
:0 €30.00 BEE - (awn
80: 2800 5.0002205000000000 09.0 85
_8 a 08500 om _ 58:8 085.058 04002000552055.0500 00 000 050 85
80 L 2800 005<<0<50000<<0000500 mm? F $5
60: Soto mm 8 8880.0 3 cos 00508000205105.0058 00 08 u. :00 $5
090000: 5000000 0E0:
ac: mama ooh/5.003000005005005 009. <05
$0: 9%: ow 588500 05.000000005500009 S at $8 85
50.5 00 :o_mm>:_
:00: N3 e00t<000050000505<<0 080 . 069
:8: NS 0 855.: <00<5<0050<000<0<00<0 .50 000 080 08:
OK 05006:. a: 025
481: Soto <5000050000500<050<00 028 1:5
50: 2800 8 855.0 :80 .5858 00500008200025.0505 mm 08 039 IE:
0500000005050
3% 0800 05500000514205.0000? :80 085
so: 0800 00 58028 05002000015052.5800: mm 50 “.2 085
05000012 0305 0003
x020 5:: N3 <0<0<00C5<C000000C0 mom? :08
€30 0E .00 o 5858 88: :88: opt/45550000050504: 8 E. 030 :08
€20 eﬁ 08 05200550050008 :3: $8
N030 0:: ~50 o 55.58 50$; 88:: 00<0E0<00<0000005 00 08 080 58
00:90:00 020000500
00:0:000m 6::00 :25300 :ozocsn— £805 .MA-.m 00:0: 0w .955 g 35 SEE 0:00
80 .x. ﬂ 0:3

00:00 02:80 0 00 00m: 5000 05 we :03 me .0000 550:0 0:0 :0000000 03:80 0:00:00 0:0 £5023 500000 00805000
02:50 .0050: SEC: .00E0: 0:00 0000.00: mméw 00 @3000 yam E 003 62 0000—00-“:0E00000 :00 0000 5205 0:0 0:00 .0 030:.

52

RESULTS

The ST-29 isolates used in this study were from 21 unrelated, unassociated
pediatric patients in the Seattle area. This represented 18.9% of all strains previously
collected for the larger paired sequence and virulence typing experiment described in
Chapter 2. ST-29s contained very few or no genes typical of most diarrheagenic E. coli
(sLxI/Z, eae, toxB, bpr), although these strains do have a higher frequency of iron
acquisition and utilization genes than non-ST-29 strains (Figure 7)

The only genes with a higher frequency of detection in ST-29s isolates were:
shuA (97% vs. 67% in non-ST-29’s), irpZ (97% vs. 66%), ﬁzuA (91% vs. 63%), chuA
(91% vs. 60%), terC (65% vs. 42%), pet (31% vs. 12%), saa (23% vs. 15%), and $th
(8% vs. 5%).

Strain 9918304843 was the only ST-29 isolate with the K2 capsule proﬁle and
was negative for the most frequently detected genes, shuA and irp2. It was also negative
for ﬁuA, chuA, and terC, and was the only strain positive for invG and spaP (the only
positive results of these two genes in all of the ST-29 isolates). This isolate was taken
from a child without a definitive diagnosis for the bloody diarrhea symptoms that lead to
hospitalization. All tests for Campylobacterjejuni, Clostridium diﬂicile, Shigella,
Salmonella, rotavirus and both 0157 and non-0157 STEC as described in Chapter 2 were
negative. The child had no fever or vomiting prior to admission. Strain 9918304843 was
the only ST-29 isolate from that patient; the other four isolates were ST-303.

Another strain, 2320612D, taken from a patient exhibiting both vomiting and

fever prior to admission, was also negative for the panel of tests described previously.

53

Conpan'son of MVGP detection in ST-29 isolates vs non-ST-29 isolates

 

- ST-29 (n=74)
1:] Non-ST-29 (n=318)

Virulence loci examined by MVGP

 

 

 

 

O 20 4O 60 80 100 120
% Positive Detection

Figure 7. Frequency distribution of each gene from MVGP analysis of 392 isolates from
94 pediatric patients. Bars indicate the percent of isolates in which each gene was found.
The graph compares the frequency of virulence gene detection by MVGP in ST-29
isolates (black) vs. all non-ST-29 isolates (grey).

54

This strain was positive for both 5th and stx2, but data on bloody diarrhea was
unavailable because the stool was not examined by the parent.

Attachment Genes: Many genes were detected at low frequencies (0-20%), but
some were found in nearly all ST-29 strains examined (Table 6). Aside from the
attachment-related loci used in the MVGP screening, these additional genes included an
aggregative adherence ﬁmbrae (aafA), a transcriptional activator (aggR), a blood group
M-speciﬁc adhesin (bmaE), a gene encoding an invasion of brain epithelium (ibeA), the
major subunit of S ﬁmbrae (sfaA), and sfaS, encoding the tip of the S ﬁmbrae, which may
play a role in human brain microvascular endothelial cells [109]. Of the 60 ST-29 strains
we examined, only bmaE showed reasonably frequent detection by PCR (55%), whereas
all the others were detected in 20% or less of all isolates tested. Other attachment-related
loci may be important for ST-29 isolates, aside from those examined here; including the
possibility of loci yet to be characterized. However, the prevalence may also be unrelated
to attachment-aided survival.

Aside from nfaA with 90% detection, there does not appear to be any gene
detected frequently that is unique to extra-intestinal pathogenic E. coli (ExPEC). The
non-ﬁmbrial adhesin encoded by the nfa operon was found in at least 3 strains associated
with extra-intestinal infection, CFT073 [35], 536 [118], and R8218, as well as EAggEC
strain 042. We predicted there would be one or more genes very frequently detected (near
100%) in the ST-29 sample set. Therefore, based on the 93% detection of ﬁmH, and the
90% detection of nfaA, we accept this hypothesis.

Capsular Typing: 69 of 70 ST-29 strains had successful ampliﬁcation of the kps

region (Figure 5). Of these, all had K1 capsule according to RF LP digestion, except strain

55

991830484B (TW09832), which had the K2 capsule proﬁle. The high frequency of K1
capsule type in these ST-29s is consistent with the capsule type of strain R8218 [116],
which is also a K1/ST-29 isolate (Figure 6). K2 is the capsule type is seen in the urinary
tract pathogenic strain CFT073 [35, 119-121]

We hypothesized all or nearly all of the ST—29 isolates will have the same capsule
type as RS218. 68 of 70 ST-29 strains did share the K1 capsule type with RS218, so we

fail to reject this hypothesis.

56

DISCUSSION

In this diverse set of E. coli isolated from children, ST—29s were detected at a high
frequency — 19%. We hypothesized that this ST marks a widespread clone with an
enhanced ability to colonize the intestine. This hypotheSis may explain why these strains
are found in such high numbers in patients with unattributed bloody diarrhea. It is also
possible ST-29 isolates may be more frequent in certain populations than previously
realized, but lack of surveillance may be the reason for this infrequent identiﬁcation.

The detection of nfaA in 90% of the strains warrants further investigation into the
role of this adhesin, especially considering it is found in ExPEC. The other attachment-
related loci we examined that were found at low frequencies in ST-29 isolates does not
necessarily mean that these strains do not use increased attachment as a means for
survival. It is likely that additional loci that we did not examine, or loci that has yet to be
characterized, may be critical for attachment in these strains. Despite all of these strains
sharing the same sequence type, they still showed variability in both the virulence
proﬁles and the attachment-related genes. This is especially true with bmaE (55%),
papAH (42%), and iutA (32%), which seem to have signiﬁcant variability in their
presence or absence within this set. It is unclear why this is the case.

We also performed MLST on E. coli isolates taken from patients with Crohn’s
disease and colon cancer in England [122] and found those to also be ST-29. These
strains may play a role in disease by using a mechanism of pathogenesis or mode of
invasion that has yet to be characterized. It should be reiterated that while these ST-29
isolates contain genetic and virulence proﬁle similarities to ExPEC, they were isolated

from stool samples and not from gut contents in close association with the intestine. It is

57

unclear if any ST-29 isolates have been discovered in proximity to the intestine, but it has
been shown that many virulence factors important for extra-intestinal pathogenesis are
also important for binding to intestinal cells [123]. It is entirely possible these strains may
be more common than once believed. Since they do not contain many of the ‘classical’
virulence factors or cause disease of a speciﬁc pathotype, then they may be overlooked in
a clinical setting. Therefore, the lack of both intestinal and extraintestinal detection of

ST-29 isolates may be due to a lack of surveillance utilizing appropriate sampling.

58

ACKNOWLEDGEMENTS
Albert Lee, who did many of the PCR reactions involving the attachment-related
loci, was tremendously helpful in the generation of this data. Lindsey Ouellette did the
MLST work on the ST-29s strains from the Seattle pediatric population and the strains
from patients in England with Crohn’s disease and colon cancer.
This research was supported by funds from the Centers for Disease Control and
Prevention (Cooperative Agreement CCU015040) and NIAID, NIH, DHHS, under NIH

research contract # N01-AI-30058 (TSW).

59

CHAPTER 4

GENETIC EROSION OF E. Coli TYPE III SECRETION SYSTEM 2 (ETT2) IN

0157:H7 ISOLATES

60

SUMMARY

Recently, a cryptic gene cluster encoding a secondary type III secretion system
(ETT2) was identiﬁed in enterohemorrhagic Escherichia coli 0157:H7 strains. This
locus contains genes displaying a high degree of similarity to the inv-spa-prg locus from
the SPI-l island in Salmonella. A 17-kb central region of ET T2 is thought to encode
most of the putative proteins involved in the formation of the needle complex. We
determined the acquisition point of this l7-kb region of ETT2 using an existing model for
the stepwise evolution of modern strains of E. coli 0157:H7 from ancestral 055:H7
strains. The gene cluster appears to be quite variable; truncated portions are also found in
other Shiga toxin-producing E. coli, including serogroups 026 and 01 1 1. Strains were
tested using gene-speciﬁc PCR primers for 11 of 17 open reading frames in ETT2,
including the following genes: eer, eer, epaS, epaP, eivJ, ez'vI, eivC, eivA, eivE, eivG,
and eivF. All twenty-two representatives from four electrophoretic types of 0157:H7
descended from this lineage contained the entire ETT2 gene cluster. More ancestral
055:H7 strains that are stxZ negative contain only a small terminal portion of ETT2.
There are at least 3 different deletion types in the strains representing the rise of modern
0157:H7, but all of those are found in the older 055:H7 strains before the somatic
antigen shift to 0157. Non-0157 isolates examined had other, distinct types of deletion
patterns. It appears this island has an ancient point of acquisition, but has been
undergoing different forms of genetic erosion to remove portions from the genome over

time.

61

INTRODUCTION

Pathogenic Escherichia coli are responsible for numerous outbreaks of food-
borne disease. Enterohemorrhagic E. coli (EHEC) strains of serotype 0157:H7 and other
non-0157 Shiga toxin-producing E. coli (STEC) are the most common causes of a
number of diseases, including bloody and non-bloody diarrhea, and hemolytic uremic
syndrome. Variations in the severity of disease are due in part to the presence and
absence of speciﬁc virulence factors [1, 115].

The mechanism of delivery of toxins and other effector molecules via a type III
secretion system (TTSS) in E. coli has been extensively characterized [124-127]. The
locus for enterocyte effacement (LEE) island encodes a functional TTSS in EHEC and
enteropathogenic E. coli (EPEC). LEE also encodes the effectors intimin, an adhesin, and
Tir, the receptor for intimin, which are responsible for the close association of the
bacterial cell to the host epithelium [36]. The presence of LEE in isolates of E. coli
confers the ability to form close associations of the bacterium and host cells leading to
actin polymerization and cytoskeletal rearrangements characteristic of EPEC infections
[128].

Recent genome sequence analysis has identiﬁed another island in E. coli that
presumably also encodes a TTSS. This secondary type 111 system has been named ETT2
for E. coli type III secretion system 2, and is found in addition to the ﬁrst TTSS encoded
by LEE. Previous work [39] has shown the island contains open reading frames with a
high similarity to some parts of a TTSS encoded by Salmonella called SPI-l (Salmonella
Pathogenicity Island 1). ETT2 is located at 64.5 min on the E. coli chromosome (O-island

121) and was presumably acquired by horizontal transfer because it has a lower G+C

62

content than the rest of the chromosome (36.9% vs. 50.8%) [39]. ETT2 is widely
distributed, including in both 0157:H7 and K12, but is usually found with many
deletions [41].

SPI-l in Salmonella is required for invasion of I mammalian cells. The phenotype
was ﬁrst identiﬁed during a search for genes responsible for mediating bacterial entry
into non-phagocytic cells [42, 129]. Encoded within SPI-l are genes responsible for the
formation of a needle complex capable of delivery of effector molecules, which are also
encoded within SPI-l and elsewhere in the genome of Salmonella [129]. The genetic
structure of portions of ETT2 and SPI-l are highly conserved [39]. A comparison of SP1-
1 genes and ETT2 genes is shown in Table 7.

Previous work [39, 41] has identiﬁed the distribution of regions of ETT2 in
various pathovars of E. coli. While some 0157:H7 isolates contain the entire island, non-
0157 STEC contain a truncated portion of the island that is missing the eiv gene cluster
[3 9]. This study has developed a ﬁner scale map of the components of ETT2 by screening
for individual genes within the island via PCR. Parts of ETT2 are found in several 0157
strains, however, the central region analyzed here is not present in the genome of K12,
EPEC strains like E2348/69, or the uropathogen CFTO73 [41]. A major portion of ETT2
is also missing in the 01 l 1:NM strain 3171. The only known non-0157 isolate that
appears to contain the entire ETT2 gene cluster is the enteroaggregative strain 042 [41]
(Figure 8).

Primers were designed to detect 11 ORFs in a 17-kb central region of ETT2 that

contains homology to the needle complex genes of SPI-l (Table 8).

63

In this study, we report the acquisition point of the ETT2 island in an existing
stepwise model of the evolution of the modern 0157:H7 pathogenic clone as well as the
distribution of individual components within a set of 57 isolates (mostly 0157 and non-
0157 STEC).

Hypotheses to be tested. 1. The region of ETT2 we are examining will be found
intact and undeleted in all strains from the ancestral stepwise lineage related to modern
0157:H7 isolates. Strains that represent the stepwise changes from ancestral EPEC-like
055:H7 to the modern EHEC 0157:H7 will be screened by PCR for 11 individual genes
within a l7-kb region encoding the structural apparatus of the type III secretion system.

2. We predict other non-0157 isolates will have a variety of deletion proﬁles,
including some newly described deletion types. In addition to strains from the 0157
stepwise model, additional strains from other pathogroups will be examined and we

predict new deletion proﬁles unseen in previous studies will be found.

64

Table 7. Comparison of genes from the Salmonella Pathogenicity Island 1 (SPI-l) of
Salmonella enterica serovar Typhimurium and their corresponding homologous
counterpart in ETT2. Protein functions are listed only for SPI-l homologues; ETT2 genes
are thought to play a similar role due to sequence conservation. Amplicon sizes (for those
ETT2 genes tested in this study) are included.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

ETT2
TTSS Genes _G_en_e Amplicon
Size
ETT2 SPI-l (22).. Size Protein Function Reference
required for invasion and secretion phenotypes - forms part
eer prgK 735 387 of the base of the needle complex [130, 131]
required for invasion and secretion phenotypes - may play a:
eprJ prgJ 333 - role in formation of needle complex [13(L
required for invasion and secretion phenotypes - forms
eprI prgI 240 - needle in needle complex [130]
required for invasion and secretion phenotypes - forms part
eer prgH 735 416 of the base of the needle complex [130, 131]
required component of export apparatus - probable inner
epaS spaS 793 475 membrane platform protein [90]
required for protein secretion and Salmonella access to
epaR spaR 786 - cultured epithelial cells [90]
required for protein secretion and Salmonella access to
epaQ spaQ 261 - cultured epithelial cells [90]
required for protein secretion and Salmonella access to
epaP spaP 666 366 cultured epithelial cells [90]
required for protein secretion and Salmonella access to
epaO spaO 987 - cultured epithelial cells [90]
controls the length of the needle substructure of the needle [90, 131-
eivJ 1'an 618 210 complex 133]
eivl invl 336 201 may function as a chaperone for Ian secretion [131-133]
ATPase activity - required for invasion of nonphagocytic
eivC invC 1320 355 cells [134]
chaperone - binds to SopA to stabilize it - also binds to
- 1‘an - - SopE, SopE2 [135]
required for invasion of nonphagocytic cells - may form a
eivA MM 1261 340 channel in the membrane [136, 137]
controls effector translocation - interacts with SipBC
eivE invE 1146 357 rotein complex [138-140]
eivG invG 904 380 forms part of the base of the needle complex [129, 131]
transcriptional regulatory expression - required for efﬁcient
eivF invF 750 277 entry into host cells [141]
outer membrane lipoprotein required for proper localization
- ian - - of invG [142]

 

 

 

 

 

 

 

 

65

.mtm .00 :0 mammmmﬁ 000 mSmeNm Ummm 0:0 mnonU E000

AOmEDV 0E0woﬁ0QED £00030 0m ~50=§~x0=0m3m .NTM 00 :03 00 .00—02 22” _ _ #0 :0 J Sm 00 00:0 .095 020-000 E 0000
000 30: 000000 05 .3 0000295 00:0w 02300.00 0% .00 0000200 0304 - Q; 600 Q E 000020 000w atm— mo 00:0NE0w00 .w 95$...“

300.0 x 0502589080
000000”... 300 A880
0N_:wmm0c_0_0mw_wm_cm RUAU nvmv AUﬂannvﬂv

3200 225:0 RV 5338i
88... 30050000355835 8505580080

_
n 0.500000 5.500 0000 K IE0

_ K /»
5....0 Ea 58H 0 50000555530008.5295 5 589080

5+0 " m 0 m <05 5. 00000153: x: 105:4: 0 m 50008
u 20 0&0 000 . 00X 00A 000‘
_

 

 

 

66

Table 8. Primer sequences used to amplify individual genes within ETT2. All primers
were designed speciﬁcally for this study.

 

 

 

 

 

 

 

 

 

 

 

 

Gene Primer Sequence 5' -> 3' Size (bp)

eer 144F TCAAGGCAAAACTGGATTC 387
530R TGTACGCTTGCAAAACTATTA

eer 60F TGATCCGCAGCTGAGACATA 416
475R CAATAGCCTGACTTTCCAATACAT

epaS 54F AAAAGGGCAAATTCTAAAAAGTA 475
528R CTCTCCCCAATCTGATAATAAAG

epaP193F ATGCCGGTTGGGAAGGAA 366
558R TACCGGACTCATCATCATCATACC

eivJ 187F TACCGCGATGGAGACAAAATAA 210
396R TCCCCAACGCTGAAACTGA

eivl 44F TACTCGGCGAAGTTGTATTT 201
244R TTT'lTAGTCGGTCGTATTTTTCTC

eivC 689F GGTGTAATGCCGCCCTGATG 355
1 052R ATTGCCGGATAGTGACCTTGACC

eivA 88F ATTCCATTGCCCACCTATIT 340
410R AGCGGGCAGCAACTTCAG

eivE 416F ATGTCCGGCTAAACGCTGAAG 357
772R CTGCCGACTGAAGAGACAATAG

eivG 417F GGACGGCAATGGTACTTTCTAT 380
796R AACGCGCTCCTGCTGTCG

eivF 27OF TGAATCAACGGGGAGTGTGG 277
546R ACGGCGAAAATGTGAATACGATA

 

 

 

 

67

 

MATERIALS & METHODS

PCR Primer Design. DNA sequences of ETT2 components eer, eer, epaS,
epaP, eivJ, eivI, eivC, eivA, eivE, eivG, and eivF were obtained from GenBank.
Homologous genes were aligned, with PCR primers designed from the conserved regions
of each gene. All primers were synthesized by Integrated DNA Technologies (Coralville,
IA.) and were stored at a concentration of 100 mM in ddH20. Working concentrations of
each primer were 10 mM.

Strain Growth Conditions & DNA Extractions. All E. coli strains were grown
overnight at 37 °C in 10 ml of sterile LB broth with moderate shaking, prior to PCR.
DNA isolation was performed by suspending a single large colony of cells in 200 ml of
sterile TE before heating at 95 °C for 10 min and centrifuging at 13,200 rpm for 10 min.
All colonies were grown on LB agar plates overnight at 37 °C from freezer stocks created
with single-colony picks of each strain.

PCR. Aliquots, (5 ul) of each DNA sample, were ampliﬁed in a 25-ul reaction
mixture using the AmpliTaq Gold system (Applied Biosystems, Foster City, Calif).

Each reaction contained 2.5 ul 10X Gold buffer (150 mM Tris-HCl, pH 8.3, 500 mM
KCl), 2.5 ul dNTPs (2 mM each dATP, dCTP, dGTP, and dTTP), 4.0 [1125 mM MgC12,

1.25 ul of each 10 mM primer, 1.5 units AmpliTaq Gold, and 8.2 ul sterile ddH20.

Ampliﬁcation in a Hybaid PCR Express therrnocycler (Hybaid Limited, Middlesex,
England) utilized an initial denaturing step at 94 °C for 10 min., followed by 40 cycles of
92 °C for 1 min., 50 °C for 45 sec., and 72 °C for 45 see. A ﬁnal step of 72 °C for 5 min.
was used for completion of any partially extended product. The positive control strain

for all ETT2 genes was Sakai, an E. coli 0157:H7 strain that the primers were designed

68

from sequence available on GenBank (accession number NC_002128). Negative controls
included the laboratory strain K—12, an EPEC 1 strain E2348/69 and one reaction that
contained no template DNA. Visualization of PCR products (5 ul) was achieved on
ethidium bromide-stained 1.5% agarose gels via illumination with UV light.

Primer sequences and amplicon sizes for the individual ETT2 genes examined in

this study are shown in Table 8.

69

RESULTS

ETT2 in EHEC 0157. Phylogenetic analysis involving MLST of 7 housekeeping
genes in a set of pathogenic strains allowed for the determination of the evolutionary
history of the 57 strains tested (Table 9). The MLST loci sequenced here were the same
loci applied to the Seattle pediatric population in Chapter 2 and the ST-29 isolates in
Chapter 3.

Patterns of ETT2 gene detection were then overlaid onto the phylogenetic
framework developed via MLST (Figure 9). This combination allowed for the discovery
of possible points of acquisition of these virulence factors in evolutionary time.

The detection of 11 genes distributed across a 17-kb segment of ETT2 (Fig. 10)
provides evidence for the existence of an intact island in all of the OlS7:H7/H- strains
examined in this study. These ﬁnding agree with previous work [3 8, 39] on the
distribution of ETT2 in these EHEC isolates. While Makino et al. characterized the
presence of gene groups or regions of ETT2, this study characterizes ETT2, and the
associated erosion of many genes within it, on a ﬁner scale.

It is unclear if this secretion system is able to function in the cell. Because of the
level of genetic attrition seen in this island, it seems unlikely that it is able to encode a
fully functional needle complex [41]. However, some level of genetic expression or
control apparently still remains within some genes in ETT2 [143, 144]. So even large-
scale deletions seen in some strains my not entirely abolish expression of the remaining
components of ETT2.

We predicted ETT2 would remain intact in all of the strains representing the

stepwise evolution of modern 0157. This hypothesis must be rejected based on the

70

deletion proﬁles observed in three different 055:H7 isolates. ETT2 is retained, in part, in
these strains, and is intact in all known 0157:H7 strains, but some isolates are undergoing
erosion of this island by a variety of different deletions.

ETT2 in non-0157 STEC. As seen in previous work [38, 39], Shiga toxin-
encoding non-0157 isolates had a truncated copy of ETT2 that was lacking the eiv gene
cluster, containing 7 genes. All 026, 01 11 and other non-0157 serotypes contained a
truncation at or near the epa-eiv gene cluster joint (Figure 10F). Although no experiments
have been published on transformation of this truncated ETT2 island into another E. coli
strain to see if it is functional, the lack of many critical genes needed for needle formation
and proper assembly makes the possibility of functional type III secretion using ETT2
unlikely. Complementation experiments to restore a full copy of the island also have not
been attempted. However, residual expression of some genes may still be possible, as was
seen in 0157:H7 [144].

We predicted to see new deletion types in non-0157 isolates. We accept this
hypothesis due to the discovery of 3 new deletion proﬁles (types 4-6). Other existing
deletions seen in strains like K-12 and CFTO73 were also conﬁrmed by this work.

ETT2 in 055:H7. A different truncation of ETT2 was seen when examining
representatives of the 055:H7 serotypes. While other serotypes seem to be consistent in
the presence or absence of ETT2, there appears to be some variation within 055:H7
strains. A stepwise model for the evolution of modern 015 7:H7 from ancestral 055:H7
isolates has been described previously [145]. Here, this model has been modiﬁed to show
an ancient point of acquisition of ETT2 in modern 0157:H7, and indicate a variety of

deletions (Figure 11). Two of three isolates on the stepwise model after the acquisition of

71

the Stx2 phage (5905 and MDCH-lO) were positive for all individual ETT2 genes tested,
and presumably have an intact island (Figure 10B). These were the only 055:H7 strains
examined in the study to be positive for all ETT2 genes examined. A third stx2+ 055:H7
strain, 97-3256, contained a unique type of deletion not seen in any other strain (Figure
10C). This strain was negative for eer, eer and epaS. However, this strain was
positive for epaP, but may be missing the entire epr gene cluster and part of the adjoining
epa cluster.

All four isolates representing more ancestral 055:H7 strains from before the
acquisition of the Stx2 phage showed two distinct types of deletions of ETT2. Both DEC
5d and TB 1 82A had a major portion of the eiv gene cluster, as well as all of the epr and
epa genes that were not detectable via PCR (Figures 9-10). Microarray analysis involving

ORF comparisons in the genetic content of 0157:H7 strain Sakai, K-12 and
055:H7 isolates DEC 5d and TB182A have conﬁrmed this deletion in ETT2 [146]. This
deletion also extends to 8 ORFs upstream of the epa genes in ETT2. The other two
055:H7 isolates on this stepwise model (DEC 5e and LTOSS-62) contained another
unique type of deletion (Figure 10E). All genes examined by PCR were positive, except
for epaS. This may represent either sequence diversion in the primer site, or partial or

total loss of the gene.

72

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

73

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

+ + + + + + + + + + + _ Ommm m0 - 02 SE3
+ + + + + + + + + + + _ Him 2. - 02 02%:
+ + + + + + + + + + + _ Ommm 2. - mm 2 00220
+ + + + + + + + + + + _ Ummm m0 - mm 2 32003
+ + + + + + + + + + + _ Umzm 2. - 2h _ 8202”?
+ + + + + + + + + + + _ Ummm mm - hm _ $2002
+ + + + + + + + + + + _ Ummm n0 - 2.2 00223
+ + + + + + + + + + + {BO _ Him 2. - 2.2 3230
+ + + + + + + + + + + 005.50 _ 08.5 2. - 2.2 00203
+ + + + + + + + + + + _ Ummm 00 22 02 £385
+ + + + + + + + + + + _ 00:0 8 22 5 3005
+ + + + + + + + + + + _ Ummm 2. - 02 mQNZm
+ + + + + + + + + + + _ 8:5 mm - 02 $230
+ + + + + + + + + + + _ 09$ 00 0 02 $-00
+ + + + + + + + + + + _ 0.005 00 .22 02 2350
+ + + + + + + + + + + 2 Ommm m0 2. 02 02:
+ + + + + + + + + + + _ Ummm m0 2. 2.2 wmg
+ + + + + + + + + + + _ UmIm 00 2. 2.2 7M0
+ + + + + + + + + + + _ Ummm m0 0 02 5220
+ + + + + + + + + + + 00m _ Ummm 00 n 02 :73
+ + + + + + + + + + + 000.23% _ Ommm 00 2. 2.2 080m
+ + + + + + + + + + + 2.29 _ UB5 00 0 02 mma
-Aom

k3» 93.20 @320 V3.20 93.20 :20 2.3.20 $50 940% 1.2%..» 0250 9.9.0 9309 Hm I O Eabm

.0020

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

0003800 0:0 850% 0:20 .3 00:00 000 058% 02:03 20 0:30.00 0>00w0: At
0 .3 00000205 0:0 0:30: 0300052 0000302 .2200 .m 2:05:00: .20 000 0 :80 00:0w Nut—.m— _0=0_>_0:_ .20 000000 M00 .20 33.00% .0 030,—.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

74

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

+ + + + N 08$ 02: 22 222 m2N2v

+ + + + N 05$ 82 S22 2 2 2 3.33.

+ + + + N 085 82 w 222 N220

+ + + + 20m N 09.5 82 w 2 2 2 36 2Nm

+ + + + 222C N 05$ 82 w 22 2 mm 0mm

+ + . + + N ommm 02: $22 0N 2.23

+ + + + N Ummm 02: - 0N $220

+ + + + N Dmmm 82 22 0N N-mam

+ + + + 00m N Him 82 N 0N <22th

+ + + + 08 N 00220 82 E 8 $-88

+ + + + + + + + + + + 200%0025 EN N mm 3

-30.:

+ + + + + + + + + + 2 Ummm mN N mm No

-395

+ + + + + + + + + + 2 USE 0N N mm on 85

+ + + + 2 Ummm mN 2. mm 20m Umo

+ + + + 2 ommm mN N mm on own

+ + + + + + + + + + + 2 USE MN N mm pm 0mm

+ + + + + + + + + + + 2 09.5 MN N mm an own

+ + + + 2 Ummm «N N mm <Nw2m.2.

+ + + + + + + + 2 Ummm mN N mm omNmNa

+ + + + + + + + + + + “.mmo 2 Ummm MN N mm 02

.2092

+ + + + + + + + + + + .2050 2 Ummm MN N mm moon

$2.20 90.20 @220 32.20 90.20 :20 2.3.20 2‘0 203 thw 2:20 98.20 9.qu Hm I O Eabm
.0255

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

20.2.82 0 22¢

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

<y200m2 2.2 m N2-v2
020.5.50 2 Guam 2 o NN2 $22238
002033.00 N0 92 E $-82
m.
E0520. 2m 22 ~92 2:02
mom—Hm NM: 02 2N2 N092
m Umhm N2: 22 2N2 2.25
+ + 2223520 MN2 2N 32 830
+ + + + N Ummm a: 2 82 wmno
+ + + + 8000 22 N 82 002;:
+ + + + N Umhm on 2 2N m 22 mud
+ + + + 305 22 :3 2.: 32.8
+ + + + N Ummm 82 02 2 2 vam
+ + + + UPS N ommm aw 2N 20 :28
+ + + + 00225 2020 oN $22 2.2 mw-mN
0320 63.00 @020 $.20 93.20 320 2.3.20 933.. V450 22530 2.2% 22.5.20 9.0.26 Hm I O Eabm
EEO—U

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

80:82 0 29¢

75

Deletion

we 11 (2er (3er e003 epaP ele ezvl eva GIVA etvE esz eva

 

 

 

 

 

 

 

 

5130010151117) 5 e o o o o o o o o o o
41310157:NM) 1 o c o o o o o o o o 0
51EDL-933(0157:H7) 1 o o o e o o o o o o o
100 GS]01(O|57:H7) 3 o o 0 o o o o o o o o
493/89(Ol$7:H-) 2 0 o 'o o o o o o o o 0
62 59051055117) 2 e) o e 0 o o o o o o o
97-3256(055:H7) A1 1 e o o o o o o o
DEC5d(055:H7) A2 2 o o o 0
DECSe(055:H7) A3 2 G) <9 0 o o e e o o e
E2348/69 (0127:H6) 1
2747-71 (F221) 1
30 3823-69 (D1) 1
61 1— 75-83 (01452NM) A4 1 0 0 o o 0
K-12 1
99 _10_0_|6:3810103:HN) A4 1 o o o o o
5 MT-80 (0103:1121 A4 1 o o o o o
69 —BZFI 1091:1121) A5 1 0 o o 0
05506 (0104:1121) A6 1 e a
99 90-1787(0X3:NM) A4 1 e o o o o
100 CL-3(Oll3:H21) A4 1 o o o o 0
CL-37 101 1 le8l A5 1 O o o 0
DEC 8b (01 11:11:31 A5 2 0 o o e
‘00 OS482(OI]8:H16) A5 1 o o o 0
74 3215-99(OIII:H8) A5 2 o o o 0
DEC 9f(026:NM) A5 5 e 0 e 0

Figure 9. This neighbor-joining tree was constructed using the Kimura 2-parameter
model of nucleotide substitution and shows the relationships between strains using 3732
nucleotide sites from 7 housekeeping genes (aspC, cle, fadD, ich, lysP, mdh, and
uz'dA). Values for 500 bootstrap replications are given at the internal nodes. Gray ﬁlled
symbols indicate positive PCR results for multiple representatives (n) of each sequence
type tested in this study. Also indicated are the six distinct deletion types of this region.

76

e r eivH e a Bil)
Sakai, 493/89 p p

A (0157:H7/11:) KJIH “fl 5 RQPO J 1 C A E G F
“0157““ Aa<1<1<2=1 c>t><-«<«-<-« <1=<=<1za<=<1=

epr eivH epa ezv

 

5905,MDCH-10 __ t A
B (055:H7’s) KJIH 9:1 S RQPO J I C A E G F

S‘Xmsmve <12<1<1<2 c>1><22<1<1<1<1<z<=40
epr eivH epa eiv
97-3256 __ tr A
c (055:H7’s) KJIH 9,1 S RQPO J 1 C A E G F
5‘“ “We ¢<l<l<$5 :1» MW <2==<121<2==<L=<l=
epr eivH epa eiv

Dec 5d, TBIBZA e tr A
D (055:H7’S) KJIH vi SRQPO J I C A E G F

S‘szega“ve «140:: mm W

 

 

 

 

epr eivH epa ezv
Dec 5e, LT055-62 tr A
E (055:H7’s) KJIH 3,1 S RQPO J 1 C A E G F

Stx2Negative MC: C>i> %{¢‘¢‘_¢u44 W

epr eivH epa » ezv

 

 

026and0111 — etrA
F Strains KJIH vi SRQPOJICA EGF

N°“'°‘57STEC «new mwmm W

 

Figure 10. Results of PCR screen of individual genes in ETT2 showing different types of
deletion patterns. All solid gray shaded arrows represent genes with positive PCR
detection results. Genes negative for PCR screening are shaded in a grey checkerboard
pattern, while genes not tested are shown in white. (A) Proﬁle of positive results for
0157:H7 and 0157:H- isolates. All 0157’s were positive for all genes tested. (B) Two of
three Stx2 positive 055:H7 strains were also positive for all genes tested, just like
0157:H7 isolates. (C) A single stx2 positive 055:H7 strain had a distinct deletion type,
missing the epr gene cluster and part of the epa cluster. (D) Stx2 negative 055:H7’s
results showing a different truncation than seen in non-0157 STEC strains, which is
missing a majority of the genes examined. (E) Some Stx2-negative 055:H7 isolated
showed the same proﬁle as 0157 strains, except for a single deletion in epaS. (B) The
truncation seen in previous work with ETT2 in non-0157 STEC isolates was also found
in this study.

77

6020282
220022 822 .2ow2mmvv =o2m20> 02288-5: 0222 25020208020 05 422:0 020282 E02008 .2220 c000 2042 8: 09$ 0 3:000:28 m< 25222022

3 5qu +30 :18 £50 82% 50 EN .005 $5.25: 2.5... 202 0:622: .228 5° 8&0 5,28 has a 25:32:22.
2000:2823 32 :0>2w 2:020:20 mass 00 20258 0222 so 223920 3 20:02.02 N .2. Hm 0222 .20 E222 282220232000 022,2. 222$ 0020282 Nmnmmo
2022000220 E02 22 EB NINEO Ummm mo 0:020 02=0wo222ma 2:0on 0222 .8 0802080 05 28 202008 28223230 0022:202w .22 0.22—M202

 

  
                          

    

AAU nvzvﬁv
kbmwo2somo~2 :2N02
. >20 0&0 420'
nvﬂk oVﬂmvﬂwV (Nani. Um Um: m Hm 222.030 00.20 2.0085
30 Nw1mmOH1— .0m DMD
3:030 «0.20 2.885
cmNmuba
I I I I _
.2 o .0 w ,0 2 N 0292 Wm. I: N éomézo
30 0mm Ihwml

65:30.25: 2-:0:E.3% m .5

\ NIUWmO /
Nair—m

 

32m: .20 PM
2.0025
SEC 0w02222 2.,
m E New _
_
m5. .0 new»: at +~20w
23200 D
N Fm ed. 20 M02320 3 M20. yaww
02E 2 8:5 8222-00.20
202200052.
2.3—um

 

 

 

2km

78

DISCUSSION

Recent analysis of the genetic composition of ETT2 has shown a number of small
deletions, frameshift mutations and premature stop codons [41]. This previous work, and
the data presented here demonstrate a degree of genetic erosion in relatives of modern
0157:H7 isolates, which contain various deletions. Despite this level of genetic attrition,
some residual expression of ETT2 genes has been detected, which apparently plays a role
in enhancing virulence [143, 144]. Since ETT2 may serve as a backup copy of a
functional TTSS in E. coli, it is possible these isolates had, at one time, an entire ETT2
island then lost a major portion, along with a number of ORFs upstream, as a result of a
deletion.

This work demonstrates the effect of genetic erosion on an apparently non—
functional secretion system in strains representing the genetic ancestry of modern
0157:H7. This erosion may be ongoing in a number of 055:H7 isolates. It is unclear why
0157:H7 has retained an apparently intact ETT2 island, but this element may play a role
in regulating the expression of other genes, rather than producing its own secretion
system.

The type III secretion system encoded by LEE contains a number of effector
molecules that are secreted through the needle apparatus [36]. Initial genomic analysis of
ETT2 indicates this island may lack any apparent effectors [41]. This may explain, in
part, why ETT2 is undergoing selective pressure to be deleted. Because it is complicated
and requires a number of genes, the type III secretion machinery is energetically-
expensive to assemble. Without a collection of effector molecules to be secreted into host

cells, any needle apparatus that may have been encoded by ETT2 would have allowed for

79

the assembly of a complicated structure without any function. This is roughly akin to a
house or other building without any occupants - it was expensive to build, but is now
without ﬁrnction because of a lack of occupants.

The search for potential effector molecules for ETT2 is still underway. With the
LEE-encoded TTSS, there have been a number of effectors identiﬁed that are encoded
outside of the LEE island, but use LEE for secretion [147, 148]. Previous work with
ETT2 identiﬁed potential effector molecules in an island dubbed EIP [41]. This island
has curiously only been found in the enteroaggregative E. coli strain 042, which also
contains a complete ETT2 (Figure 12). It is unclear why 0157:H7 strains have an intact
ETT2, but lack EIP. The potential effectors encoded in EIP, or other yet-uncharacterized
effectors elsewhere may in fact work in conjunction with ETT2 to form a functional
TTSS unit in some strains, although this has not yet been demonstrated.

Despite the possibility of non-ETT2 encoded effectors, none have yet been found
in any strain of E. coli except 042. It is possible only strain 042 and a small number of
other strains acquired EIP, leaving most strains with ETT2 without any functional
effectors. This could be one reason for the frequent cases of genetic erosion outlined in
this work and elsewhere. Obviously a cell copying large regions of DNA spanning 20-40
kb that encode no functional system or tools for survival is wasting valuable energy and
resources. There must be strong selective pressures on these types of regions for either
conversion to a functional form by recombination or most likely removal by deletion.
While acquisition of genetic material can be a means of evolution, the removal of non-

functional DNA may also help streamline the genome and enhance ﬁtness.

80

eip
eicA B X D eiIA

ean

 

042 (EAggEC)

 

QEDW
Ex:

11%

 

C:

 

>{><:J 0157:H7 (Sakai)

Figure 12. The EIP island from Enteroaggregative (EAggEC) strain 042, encodes
possible ETT2 effectors, including an intimin homologue (ean). EIP has been identiﬁed
only in a handﬁrl of strains, and is absent in all 0157:H7 strains, including Sakai.

81

ACKNOWLEDGEMENTS
Special thanks to Dr. David Lacher for assistance in the design of the ETT2
primers, and for initial optimization advice. Thanks are also due to Lindsey Ouellette for
MLST sequencing of the 0157:H7 isolates used in this study.
This work was supported by a USDA National Needs Fellowship, NIH, and the

Microbial Research Unit at Michigan State University.

82

CHAPTER 5

SUMMARY AND SYNTHESIS

83

The genetic diversity of Escherichia coli is dynamic, complex, and driven by a
variety of external forces that help shape its evolution. The overall purpose of the
research presented here is to characterize a small portion of that dynamic genome, to
allow for the more efﬁcient tracking and characterizing of unknown E. coli isolates, and
to show in greater detail how gene ﬂux is both a process of horizontal acquisition of
mobile elements, and occasionally a loss of genetic material.

The need for rapid characterization of isolates becomes important with increasing
threats to food safety, and ever-larger outbreaks of foodbome disease. MVGP is one
technique that can be used to give an initial “ﬁngerprint” of an isolate’s virulence gene
content, and characterize that strain to a particular pathotype within the diversity of E.
coli. As shown in Chapter 2, this technique is also useful for characterizing strains
isolated from a clinical setting. Because any gene can be added or removed easily, the set
of virulence loci examined can be tailored exactly to speciﬁc strain sets, or to speciﬁc and
investigative groups. The reagents and machinery used for MLST are similar or identical
to what is necessary to perform MVGP, so labs already doing phylogenetic analysis can
adapt their existing reagents and laboratory equipment to virulence proﬁling without
much of a learning curve. Also, while the initial order of Beckman dye-labeled primers is
costly, the amount used with each reaction is so small, so a primer may last for hundreds
or even thousands of reactions.

Aside from the practical aspects of MVGP for use as a clinical tool, the work
presented here also illustrates why it is important to screen for E. coli from speciﬁc
groups of individuals. The microbiota of the gut is extremely diverse and E. coli plays

only a small component of the ﬂora under most circumstances. However, it is an

84

important component that can often cause or contribute to disease. It also appears to be
highly variable with respect to virulence gene content, partially due to the mobile nature
of those elements. Determining the basal level of virulence diversity within patients
under different circumstances is important to understand not only the diversity of
individual virulence genes, but also to link, statistically and epidemiologically, some of
these virulence loci to speciﬁc clinical symptoms.

Many of the virulence loci examined here are listed as putative, and given the
risks posed by many of the pathotypes in which they are found, they are likely to remain
so indeﬁnitely. The level of regulation and approvals needed for human trials, especially
involving potentially pathogenic organisms is understandably complex. There are also
obvious ethical considerations, as many of the virulence genes included here may
produce proteins that could signiﬁcantly affect human health. Despite these necessary
restrictions, the molecular characterization of virulence-related loci is important. One of
the ﬁrst steps towards characterization is the determination of the distribution of these
loci in both the general population and a variety of speciﬁc sub-populations, including

those with a variety of diseases.

Future considerations. There are a number of future projects that could help
expand the work started here. One includes a more detailed look at ST-29 loci, including
microarray analysis to compare multiple isolates for genomic content, and also for
expression differences. This may help identify any loci that could play a role in survival

through enhanced attachment or immune system avoidance. Animal models could be

85

used to ascertain hypotheses that ST—29 strains do indeed have enhanced survival,
because as of now this is only an epidemiological association.

Recent work with ETT2 has shown that despite many examples of gene loss
within this region, and no apparent ETT2-speciﬁc effectors identiﬁed, some genes within
this island are still actively transcribed [144]. Curiously, ETT2 may have an antagonistic
effect, on the LEE-encoded TTSS in 0157:H7. Strains with mutational inhibition of
ETT2 loci etrA and eivF had both “greatly increased secretion of proteins by the LEE”
and “increased adhesin to human epithelial cells” [144]. Exactly why ETT2 appears to be
encoding proteins that inhibit LEE-related gene expression is still unclear. ETT2 would
be another good candidate for expression microarray analysis to further characterize this
phenomenon. It is possible that other loci within ETT2 are expressed, either in different
strains, aside from 0157’s, or under different conditions. This expression may have a
dramatic effect on other loci, as seen with etrA and eivF in ETT2 [144].

A further characterization of the genes encoded within the EIP island may also
shed some more light on this situation. In vivo studies involving a ﬂuorescent actin
staining (FAS) assay [149] could show if ETT2 does in fact function as a type III
secretion system. The assay works by detecting the polymerized actin ﬁlaments
characteristic of the close adherence of strains attaching to epithelial cells. This
polymerization is a hallmark of the attaching/effacing phenotype of EPEC and EHEC,
and indicates type III effectors have entered the host cell to induce physiological changes
{6,125,150}

An ideal candidate for this would be strain 042 since it has both an intact ETT 2

and EIP and does not contain the other type III island encoded by LEE. Using a strain

86

without LEE is critical, so the actin polymerization phenotype could be attributed to
ETT2, and not LEE.

Finally, MVGP could easily be either expanded or adapted for use on other
microbial pathogens. Simply by selecting a set of PCR primers for speciﬁc genes of
interest, a labeled pair can be ordered and incorporated into a collection to generate a
proﬁle. This technique may be especially useful in screening for virulence proﬁles of
other species with high genomic diversity that are not well characterized regarding
virulence genes. Organisms with frequent horizontal gene exchange would likely beneﬁt
most from virulence proﬁling because this technique allows for the tracking of numerous
virulence loci across the diversity of the species, as it has with E. coli.

Evolution in all types of E. coli appears to be a dynamic process, with many
documented cases of horizontal acquisition of bacteriophages [27, 151], plasmids [152-
154], and even large chromosomal pathogenicity islands [155, 156]. Even amongst
strains of the same serotype, such as the 0157:H7’s, increased Virulence is seen between
distinct groups, or clades [157]. The 0157:H7 strains responsible for the recent outbreaks
on contaminated spinach [158, 159] and lettuce [158, 160] in late 2006 had enhanced
virulence compared to 0157:H7 isolates from past outbreaks (Sakai from 1996 or EDL-
933 from 1982). Virulence was measured by the rate of hospitalization and development
of HUS. Both of these markers were signiﬁcantly higher in the spinach and lettuce
outbreak strains, which belong to clade 8, than previous 0157:H7 outbreak strains Sakai
(clade 1) and EDL-933 (clade 3) [157]. This is evidence for ongoing evolution that
appears to be favoring enhanced virulence, possibly as a means to spread more

effectively. It is also possible that other serotypes of E. coli that are not frequently

87

detected in the United States may become more prevalent here in the future.
Geographical preferences appear to exist in the distribution of certain serotypes, but this
may change given today’s global environment.

In the future, it seems reasonable to expect new outbreaks of highly virulent
serotypes of E. coli, like 0157:H7, to result in elevated levels of HUS, hospitalization,
and death in affected individuals. Therefore, the urgency for rapid and coordinated
identiﬁcation of outbreaks should grow in the future, whether applied to food safety for

the consumer and industry or to bioterrorism.

88

REFERENCES

89

10.

11.

Kaper, J .B., J .P. Nataro, and H.L. Mobley, Pathogenic Escherichia coli. Nat Rev
Microbiol, 2004. 2(2): p. 123-40.

Donnenberg, MS. and TS. Whittam, Pathogenesis and evolution of virulence in

enteropathogenic and enterohemorrhagic Escherichia coli. J Clin Invest, 2001.
107(5): p. 539-48.

Tobe, T., et al., Complete DNA sequence and structural analysis of the
enteropathogenic Escherichia coli adherence factor plasmid. Infect Immun, 1999.
67(10): p. 5455-62.

Navarro-Garcia, F., et al., The serine protease motif of EspC from
enteropathogenic Escherichia coli produces epithelial damage by a mechanism
different from that of Pet toxin from enteroaggregative E. coli. Infect Immun,
2004. 72(6): p. 3609-21.

Mellies, J .L., et al., espCpathogenicity island of enteropathogenic Escherichia
coli encodes an enterotoxin. Infect Immun, 2001. 69(1): p. 315-24.

Donnenberg, M.S., J .B. Kaper, and BB. Finlay, Interactions between
enteropathogenic Escherichia coli and host epithelial cells. Trends Microbiol,
1997. 5(3): p. 109-14.

Donnenberg, M.S., L.C. Lai, and K.A. Taylor, The locus of enterocyte eﬂacement
pathogenicity island of enteropathogenic Escherichia coli encodes secretion

functions and remnants of transposons at its extreme right end. Gene, 1997.
184(1): p. 107-14.

Cleary, T.G., The role of Shiga-toxin-producing Escherichia coli in hemorrhagic
colitis and hemolytic uremic syndrome. Semin Pediatr Infect Dis, 2004. 15(4): p.
260-5.

Burland, V., et al., The complete DNA sequence and analysis of the large
virulence plasmid of Escherichia coli 015 7.°H7. Nucleic Acids Res, 1998. 26(18):
p. 4196-204.

Tatsuno, I., et al., toxB gene on p015 7 of enterohemorrhagic Escherichia coli
015 7.'H7 is required for full epithelial cell adherence phenotype. Infect Immun,
2001. 69(1 1): p. 6660-9.

Merritt, E.A., et al., Crystal structure of cholera toxin B-pentamer bound to
receptor GM] pentasaccharide. Protein Sci, 1994. 3(2): p. 166-75.

90

12.

13.

14.

15.

l6.

17.

18.

19.

20.

21.

22.

23.

Lencer, W.I., et al., Targeting of cholera toxin and Escherichia coli heat labile
toxin in polarized epithelia: role of COOH-terminal KDEL. J Cell Biol, 1995.
131(4): p. 951-62.

Rodighiero, C., et al., Structural basis for the diﬂerential toxicity of cholera toxin
and Escherichia coli heat-labile enterotoxin. , Construction of hybrid toxins
identifies the A2-domain as the determinant of differential toxicity. J Biol Chem,
1999. 274(7): p. 3962-9.

Sansonetti, P.J., et al., Molecular comparison of virulence plasmids in Shigella
and enteroinvasive Escherichia coli. Ann Microbiol (Paris), 1983. 134A(3): p.
295-318.

Harris, J .R., et al., High-molecular-weight plasmid correlates with Escherichia
coli enteroinvasiveness. Infect Immun, 1982. 37(3): p. 1295-8.

Navarro-Garcia, F ., et al., Cytoskeletal effects induced by pet, the serine protease
enterotoxin of enteroaggregative Escherichia coli. Infect Immun, 1999. 67(5): p.
2184-92.

Eslava, C., et al., Pet, an autotransporter enterotoxin from enteroaggregative
Escherichia coli. Infect Immun, 1998. 66(7): p. 3155-63.

Vila, J ., et al., Enteroaggregative escherichia coli virulence factors in traveler's
diarrhea strains. J Infect Dis, 2000. 182(6): p. 1780-3.

F asano, A., et al., Effect of Shigella enterotoxin I (ShE TI) on rabbit intestine in
vitro and in vivo. Gut, 1997. 40(4): p. 505-11.

F asano, A., et al., Shigella enterotoxin 1: an enterotoxin of Shigella ﬂexneri 2a
active in rabbit small intestine in vivo and in vitro. J Clin Invest, 1995. 95(6): p.
2853-61.

Savarino, S.J., et al., Enteroaggregative Escherichia coli heat-stable enterotoxin
is not restricted to enteroaggregative E. coli. J Infect Dis, 1996. 173(4): p. 1019-
22.

Itoh, Y., et al., Laboratory investigation of enteroaggregative Escherichia coli 0
untypeablesHI 0 associated with a massive outbreak of gastrointestinal illness. J
Clin Microbiol, 1997. 35(10): p. 2546-50.

Cobeljic, M., et al., Enteroaggregative Escherichia coli associated with an
outbreak of diarrhoea in a neonatal nursery ward. Epidemiol Infect, 1996.
117(1): p. 11-6.

91

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

37.

Nataro, J .P., et al., Heterogeneity of enteroaggregative Escherichia coli virulence
demonstrated in volunteers. J Infect Dis, 1995. 171(2): p. 465-8.

Mathewson, J .J ., et al., Pathogenicity of enteroadherent Escherichia coli in adult
volunteers. J Infect Dis, 1986. 154(3): p. 524-7.

Herold, S., H. Karch, and H. Schmidt, Shiga toxin-encoding bacteriophages--
genomes in motion. Int J Med Microbiol, 2004. 294(2-3): p. 115-21.

Schmidt, H., Shiga-toxin-converting bacteriophages. Res Microbiol, 2001.
152(8): p. 687-95.

O'Brien, A.D., et al., Shiga toxin: biochemistry, genetics, mode of action, and role
in pathogenesis. Curr Top Microbiol Immunol, 1992. 180: p. 65-94.

Ewald, P.W., Guarding against the most dangerous emerging pathogens. Emerg
Infect Dis, 1996. 2(4): p. 245-57.

Wells, J .G., et al., Laboratory investigation of hemorrhagic colitis outbreaks
associated with a rare Escherichia coli serotype. J Clin Microbiol, 1983. 18(3): p.
512-20.

Riley, L.W., et al., Hemorrhagic colitis associated with a rare Escherichia coli
serotype. N Engl J Med, 1983. 308(12): p. 681-5.

Mead, P.S., et al., F ood-related illness and death in the United States. Emerg
Infect Dis, 1999. 5(5): p. 607-25. '

Karmali, M.A., Infection by Shiga toxin-producing Escherichia coli: an overview.
Mol Biotechnol, 2004. 26(2): p. 117-22.

Pema, N.T., et al., Genome sequence of enterohaemorrhagic Escherichia coli
015 7:H7. Nature, 2001. 409(6819): p. 529-33.

Welch, R.A., et al., Extensive mosaic structure revealed by the complete genome
sequence of uropathogenic Escherichia coli. Proc Natl Acad Sci U S A, 2002.
99(26): p. 17020-4.

Elliott, S.J., et al., The complete sequence of the locus of enterocyte effacement
(LEE) from enteropathogenic Escherichia coli E2348/69. Mol Microbiol, 1998.
28(1): p. 1-4.

Sperandio, V., et al., Characterization of the locus of enterocyte effacement (LEE)
in different enteropathogenic Escherichia coli (EPEC) and Shiga-toxin producing
Escherichia coli (ST EC) serotypes. FEMS Microbiol Lett, 1998. 164(1): p. 133-9.

92

38.

39.

40.

41.

42.

43.

44.

45.

46.

47.

48.

49.

50.

Hartleib, S., et al., Prevalence of the new, SPII-like, pathogenicity island E TT 2
among Escherichia coli. Int J Med Microbiol, 2003. 292(7-8): p. 487-93.

Makino, S., et al., Distribution of the secondary type III secretion system locus
found in enterohemorrhagic Escherichia coli 01 5 7:H 7 isolates among Shiga
toxin-producing E. coli strains. J Clin Microbiol, 2003. 41(6): p. 2341-7.

Galan, J .E. and H. Wolf-Watz, Protein delivery into eukaryotic cells by type III
secretion machines. Nature, 2006. 444(7119): p. 567-73.

Ren, C.P., et al., The E TT 2 gene cluster, encoding a second type III secretion
system from Escherichia coli, is present in the majority of strains but has
undergone widespread mutational attrition. J Bacteriol, 2004. 186(11): p. 3547-
60.

Galan, J .E. and A. Collmer, Type III secretion machines: bacterial devices for
protein delivery into host cells. Science, 1999. 284(5418): p. 1322-8.

Pallen, M.J., R.R. Chaudhuri, and LR. Henderson, Genomic analysis of secretion
systems. Curr Opin Microbiol, 2003. 6(5): p. 519-27.

Ochman, H. and R.K. Selander, Standard reference strains of Escherichia coli
from natural populations. J Bacteriol, 1984. 157(2): p. 690-3.

Welinder-Olsson, C., et al., Genetic proﬁling of enterohemorrhagic Escherichia
coli strains in relation to clonality and clinical signs of infection. J Clin
Microbiol, 2002. 40(3): p. 959-64. '

Obata-Yasuoka, M., et al., Vaginal Escherichia coli share common virulence
factor proﬁles, serotypes and phylogeny with other extraintestinal E. coli.
Microbiology, 2002. 148(Pt 9): p. 2745-52.

Tarr, C.L., et al., Molecular characterization of a serotype 0121.°H19 clone, a
distinct Shiga toxin-producing clone of pathogenic Escherichia coli. Infect
Immun, 2002. 70(12): p. 6853-9.

F eil, E.J., et al., Estimating recombinational parameters in Streptococcus
pneumoniae from multilocus sequence typing data. Genetics, 2000. 154(4): p.
1439-50.

Kotetishvili, M., et al., Multilocus sequence typing for characterization of clinical
and environmental salmonella strains. J Clin Microbiol, 2002. 40(5): p. 1626-35.

Nicolas, P., et al., The 1998 Senegal epidemic of meningitis was due to the clonal

expansion of A :4.'P1 .9, clone 111-], sequence type 5 Neisseria meningitidis strains.
J Clin Microbiol, 2000. 38(1): p. 198-200.

93

51.

52.

53.

54.

55.

56.

57.

58.

59.

60.

61.

62.

Zhou, J ., M.C. Enright, and B.G. Spratt, Identification of the major Spanish
clones of penicillin-resistant pneumococci via the Internet using multilocus
sequence typing. J Clin Microbiol, 2000. 38(3): p. 977-86.

Kriz, P., J. Kalmusova, and J. Felsberg, Multilocus sequence typing of Neisseria
meningitidis directly from cerebrospinal ﬂuid. Epidemiol Infect, 2002. 128(2): p.
157-60.

Urwin, R. and MC. Maiden, Multi-locus sequence typing: a tool for global
epidemiology. Trends Microbiol, 2003. 11(10): p. 479-87.

Bizzarri, M.F., A. Prabhakar, and AH. Bishop, Multiple-Locus Sequence Typing
Analysis of Bacillus thuringiensis Recovered from the Phylloplane of Clover
( T rifolium hybridum) in Vegetative Form. Microb Ecol, 2007.

Tarr, CL. and TS. Whittam, Molecular evolution of the intimin gene in 01]]
clones of pathogenic Escherichia coli. J Bacteriol, 2002. 184(2): p. 479-87.

Lacher, D.W., et al., Molecular evolution of typical enteropathogenic Escherichia
coli: clonal analysis by multilocus sequence typing and virulence gene allelic
profiling. J Bacteriol, 2007. 189(2): p. 342-50.

Walk, S.T., et al., Genetic diversity and population structure of Escherichia coli
isolated from freshwater beaches. Environ Microbiol, 2007. 9(9): p. 2274-88.

Johnson, J .R., et al., Molecular comparison of extraintestinal Escherichia coli
isolates of the same electrophoretic lineages from humans and domestic animals.
J Infect Dis, 2001. 183(1): p. 154-9.

Hyma, K.E., et al., Evolutionary genetics of a new pathogenic Escherichia
species: Escherichia albertii and related Shigella boydii strains. J Bacteriol,
2005. 187(2): p. 619-28.

Tarr, C.L., et al., Molecular characterization reveals similar virulence gene
content in unrelated clonal groups of Escherichia coli of serogroup 01 74 (0X3).
J Bacteriol, 2008. 190(4): p. 1344-9.

Stapp, J.R., et al., Comparison of Escherichia coli 015 7.'H 7 antigen detection in
stool and broth cultures to that in sorbitol-MacConkey agar stool cultures. J Clin

Microbiol, 2000. 38(9): p. 3404-6.

Klein, E.J., et al., Diarrhea etiology in a Children's Hospital Emergency
Department: a prospective cohort study. Clin Infect Dis, 2006. 43(7): p. 807-13.

94

63.

64.

65.

66.

67.

68.

69.

70.

71.

72.

73.

74.

Klein, E.J., et al., Shiga toxin-producing Escherichia coli in children with
diarrhea: a prospective point-of-care study. J Pediatr, 2002. 141(2): p. 172-7.

Monteiro-Neto, V., et al., Virulence properties of Escherichia coli 0111:H12
strains. FEMS Microbiol Lett, 1997. 146(1): p. 123-8.

F eng, P., S.D. Weagant, and SR. Monday, Genetic analysis for virulence factors
in Escherichia coli 0104:H21 that was implicated in an outbreak of hemorrhagic
colitis. J Clin Microbiol, 2001. 39(1): p. 24-8.

Stacy-Phipps, S., J .J . Mecca, and J .B. Weiss, Multiplex PCR assay and simple
preparation method for stool specimens detect enterotoxigenic Escherichia coli
DNA during course of infection. J Clin Microbiol, 1995. 33(5): p. 1054-9.

Schubert, S., et al., Prevalence of the "high-pathogenicity island " of Yersinia
species among Escherichia coli strains that are pathogenic to humans. Infect
Immun, 1998. 66(2): p. 480-5.

Paton, A.W. and J .C. Paton, Direct detection and characterization of Shiga
toxigenic Escherichia coli by multiplex PCR for sth, stx2, eae, eth, and saa. J
Clin Microbiol, 2002. 40(1): p. 271-4.

Kumar, S., et al., ME GA2: molecular evolutionary genetics analysis software.
Bioinformatics, 2001. 17(12): p. 1244-5.

Okeke, I.N., et al., Molecular epidemiology of the iron utilization genes of
enteroaggregative Escherichia coli. J Clin Microbiol, 2004. 42(1): p. 36-44.

Karch, H., et al., A genomic island, termed high-pathogenicity island, is present in
certain non-015 7 Shiga toxin-producing Escherichia coli clonal lineages. Infect
Immun, 1999. 67(11): p. 5994-6001.

Oswald, E., et al., Typing of intimin genes in human and animal
enterohemorrhagic and enteropathogenic Escherichia coli: characterization of a
new intimin variant. Infect Immun, 2000. 68(1): p. 64-71.

Brunder, W., et al., The large plasmids of Shiga—toxin-producing Escherichia coli
(ST EC) are highly variable genetic elements. Microbiology, 1999. 145 ( Pt 5): p.
1005-14.

Velarde, J .J . and J .P. Nataro, Hydrophobic residues of the autotransporter EspP
linker domain are important for outer membrane translocation of its passenger. J
Biol Chem, 2004. 279(30): p. 31495-504.

95

75.

76.

77.

78.

79.

80.

81.

82.

83.

84.

85.

86.

McNally, A., et al., Differences in levels of secreted locus of enterocyte

eﬂacement proteins between human disease-associated and bovine Escherichia
coli 015 7. Infect Immun, 2001. 69(8): p. 5107-14.

Brunder, W., H. Schmidt, and H. Karch, EspP, a novel extracellular serine

protease of enterohaemorrhagic Escherichia, coli 01 5 7:H 7 cleaves human
coagulation factor V. Mol Microbiol, 1997. 24(4): p. 767-78.

Bielaszewska, M., et al., Characterization of cytolethal distending toxin genes
and expression in shiga toxin-producing Escherichia coli strains of non-015 7
serogroups. Infect Immun, 2004. 72(3): p. 1812-6.

Bielaszewska, M., et al., Cytolethal distending toxin from Shiga toxin-producing
Escherichia coli 015 7 causes irreversible G2/M arrest, inhibition of
proliferation, and death of human endothelial cells. Infect Immun, 2005. 73(1): p.
552-62.

Nesic, D., Y. Hsu, and CE. Stebbins, Assembly and function of a bacterial
genotoxin. Nature, 2004. 429(6990): p. 429—33.

Pickett, C.L., et al., Patterns of variations in Escherichia coli strains that produce
cytolethal distending toxin. Infect Immun, 2004. 72(2): p. 684-90.

Torres, AG. and SM. Payne, Haem iron-transport system in enterohaemorrhagic
Escherichia coli 01 5 7:H 7. Mol Microbiol, 1997. 23(4): p. 825-33.

Nagy, G., et al., Expression of hemin receptor molecule ChuA is inﬂuenced by
RfaH in uropathogenic Escherichia coli strain 536. Infect Immun, 2001. 69(3): p.
1924-8.

Tarr, P.I., et al., Iha: a novel Escherichia coli 015 7:H7 adherence-conferring

molecule encoded on a recently acquired chromosomal island of conserved
structure. Infect Immun, 2000. 68(3): p. 1400-7.

Taylor, D.E., et al., Genomic variability of 0 islands encoding tellurite resistance
in enterohemorrhagic Escherichia coli 015 7:H7 isolates. J Bacteriol, 2002.
184(17): p. 4690-8.

Heimer, S.R., et al., Urease of enterohemorrhagic Escherichia coli: evidence for
regulation by fur and a trans-acting factor. Infect Immun, 2002. 70(2): p. 1027-
3 1 .

D'Orazio, SE. and CM. Collins, The plasmid-encoded urease gene cluster of the

family Enterobacteriaceae is positively regulated by UreR, a member of the AraC
family of transcriptional activators. J Bacteriol, 1993. 175(11): p. 3459-67.

96

87.

88.

89.

90.

91.

92.

93.

94.

95.

96.

97.

98.

Wang, G., C.G. Clark, and F.G. Rodgers, Detection in Escherichia coli of the
genes encoding the major virulence factors, the genes deﬁning the 01 5 7 :H 7

serotype, and components of the type 2 Shiga toxin family by multiplex PCR. J
Clin Microbiol, 2002. 40(10): p. 3613-9.

De Baets, L., et al., Genetic typing of shiga toxin 2 variants of Escherichia coli by
PCR-restriction fragment length polymorphism analysis. Appl Environ Microbiol,
2004. 70(10): p. 6309-14.

Eklund, M., K. Leino, and A. Siitonen, Clinical Escherichia coli strains carrying
stx genes: stx variants and stx—positive virulence proﬁles. J Clin Microbiol, 2002.
40(12): p. 4585-93.

Collazo, CM. and J .E. Galan, Requirement for exported proteins in secretion
through the invasion-associated type III system of Salmonella typhimurium. Infect
Immun, 1996. 64(9): p. 3524-31.

Crago, A.M. and V. Koronakis, Salmonella InvG forms a ring-like multimer that
requires the Ian lipoprotein for outer membrane localization. Mol Microbiol,
1998. 30(1): p. 47-56.

Hwang, J ., et al., Structural and topographical studies of the type IV bundle-
forming pilus assembly complex of enteropathogenic Escherichia coli. J Bacteriol,
2003. 185(22): p. 6695-701.

Green, B.A., et al., Evidence that a new enterotoxin of Escherichia coli which
activates adenylate cyclase in eucaryotic target cells is not plasmid mediated.
Infect Immun, 1983. 41(1): p. 383-90.

Yamamoto, T. and T. Yokota, Release of heat-labile enterotoxin subunits by
Escherichia coli. J Bacteriol, 1982. 150(3): p. 1482-4.

Wyckoff, E.E., et al., Structure of the Shigella dysenteriae haem transport locus
and its phylogenetic distribution in enteric bacteria. Mol Microbiol, 1998. 28(6):
p. 1139-52.

Mills, M. and SM. Payne, Identification of shuA, the gene encoding the heme
receptor of Shigella dysenteriae, and analysis of invasion and intracellular
multiplication of a shuA mutant. Infect Immun, 1997. 65(12): p. 5358-63.

Henderson, I.R., et al., Characterization of pic, a secreted protease of Shigella
ﬂexneri and enteroaggregative Escherichia coli. Infect Immun, 1999. 67(11): p.

5587-96.

Guyer, D.M., et al., Identiﬁcation of sat, an autotransporter toxin produced by
uropathogenic Escherichia coli. Mol Microbiol, 2000. 38(1): p. 53-66.

97

99.

100.

101.

102.

103.

104.

105.

106.

107.

108.

109.

110.

111.

Guyer, D.M., et al., Sat, the secreted autotransporter toxin of uropathogenic
Escherichia coli, is a vacuolating cytotoxin for bladder and kidney epithelial
cells. Infect Immun, 2002. 70(8): p. 4539-46.

Dutta, P.R., et al., Functional comparison of serine protease autotransporters of
enterobacteriaceae. Infect Immun, 2002. 70(12): p. 7105-13.

Al-Hasani, K., et al., Distribution and structural variation of the she

pathogenicity island in enteric bacterial pathogens. J Med Microbiol, 2001.
50(9): p. 780-6.

Al-Hasani, K., et al., The sigA gene which is borne on the she pathogenicity
island of Shigella ﬂexneri 2a encodes an exported cytopathic protease involved in
intestinal ﬂuid accumulation. Infect Immun, 2000. 68(5): p. 2457-63.

Venkatesan, M.M., et al., Complete DNA sequence and analysis of the large
virulence plasmid of Shigella flexneri. Infect Immun, 2001. 69(5): p. 3271-85.

Rode, C.K., et al., T ype-speciﬁc contributions to chromosome size differences in
Escherichia coli. Infect Immun, 1999. 67(1): p. 230-6.

Huang, S.H., et al., Escherichia coli invasion of brain microvascular endothelial
cells in vitro and in vivo: molecular cloning and characterization of invasion gene
ibe10. Infect Immun, 1995. 63(11): p. 4470-5.

Litwin, CM. and SB. Calderwood, Role of iron in regulation of virulence genes.
Clin Microbiol Rev, 1993. 6(2): p. 137-49.

Grandjean, D., et al., Iron uptake is essential for Escherichia coli survival in
drinking water. Lett Appl Microbiol, 2006. 43(1): p. 111-7.

Xie, Y., et al., Identification and characterization of Escherichia coli RS218-
derived islands in the pathogenesis of E. coli meningitis. J Infect Dis, 2006.

194(3): p. 358-64.

Johnson, J .R., et al., Phylogenetic distribution of extraintestinal virulence-
associated traits in Escherichia coli. J Infect Dis, 2001. 183(1): p. 78-88.

Ostroff, S.M., et al., A statewide outbreak of Escherichia coli 015 7:H7 infections
in Washington State. Am J Epidemiol, 1990. 132(2): p. 239-47.

Tarr, P.I., et al., Escherichia coli 015 7:H7 and the hemolytic uremic syndrome:
importance of early cultures in establishing the etiology. J Infect Dis, 1990.
162(2): p. 553-6.

98

112.

113.

114.

115.

116.

117.

118.

119.

120.

121.

122.

123.

124.

Tarr, P.I., N.T. Tran, and RA. Wilson, Escherichia coli 0157:H7 in retail ground
beef in Seattle: results of a one-year prospective study. J Food Prot, 1999. 62(2):
p. 133-9.

Haack, J .P., et al., Escherichia coli 015 7 exposure in Wyoming and Seattle:
serologic evidence of rural risk. Emerg Infect Dis, 2003. 9(10): p. 1226-31.

Denno, D.M., et al., Explaining unexplained diarrhea and associating risks and
infections. Anim Health Res Rev, 2007. 8(1): p. 69-80.

Nataro, J .P. and J .B. Kaper, Diarrheagenic Escherichia coli. Clin Microbiol Rev,
1998. 11(1): p. 142-201.

Achtman, M., et al., Six widespread bacterial clones among Escherichia coli K 1
isolates. Infect Immun, 1983. 39(1): p. 315-35.

Bloch, CA. and CK. Rode, Pathogenicity island evaluation in Escherichia coli
K1 by crossing with laboratory strain K-12. Infect Immun, 1996. 64(8): p. 3218-
23.

Hochhut, B., et al., Role of pathogenicity island-associated integrases in the
genome plasticity of uropathogenic Escherichia coli strain 53 6. Mol Microbiol,
2006. 61(3): p. 584-95.

Johnson, J.R., et al., Phylogenetic and pathotypic similarities between
Escherichia coli isolates from urinary tract infections in dogs and extraintestinal
infections in humans. J Infect Dis, 2001. 183(6): p. 897-906.

Johnson, J .R., et al., Virulence genotypes and phylogenetic background of
Escherichia coli serogroup 06 isolates from humans, dogs, and cats. J Clin
Microbiol, 2008. 46(2): p. 417-22.

Oelschlaeger, T.A., U. Dobrindt, and J. Hacker, Virulence factors of
uropathogens. Curr Opin Urol, 2002. 12(1): p. 33-8.

Martin, H.M., et al., Enhanced Escherichia coli adherence and invasion in
Crohn 's disease and colon cancer. Gastroenterology, 2004. 127(1): p. 80-93.

Adlerberth, I., et al., Adhesins of Escherichia coli associated with extra-intestinal
pathogenicity confer binding to colonic epithelial cells. Microb Pathog, 1995.
18(6): p. 373-85.

Jores, J ., L. Rumer, and L.H. Wieler, Impact of the locus of enterocyte eﬂacement
pathogenicity island on the evolution of pathogenic Escherichia coli. Int J Med
Microbiol, 2004. 294(2-3): p. 103-13.

99

125.

126.

127.

128.

129.

130.

131.

132.

133.

134.

135.

136.

Mota, LI. and GR. Comelis, The bacterial injection kit: type III secretion
systems. Ann Med, 2005. 37(4): p. 234-49.

Clarke, SC, et al., Virulence of enteropathogenic Escherichia coli, a global
pathogen. Clin Microbiol Rev, 2003. 16(3): p. 365-78.

Zaharik, M.L., et al., Delivery of dangerous goods: type III secretion in enteric
pathogens. Int J Med Microbiol, 2002. 291(8): p. 593-603.

Elliott, S.J., J. Yu, and J .B. Kaper, The cloned locus of enterocyte effacement from
enterohemorrhagic Escherichia coli 01 5 7 :H 7 is unable to confer the attaching
and eﬂacing phenotype upon E. coli K—12. Infect Immun, 1999. 67(8): p. 4260-3.

Galan, J .E., Salmonella interactions with host cells: type III secretion at work.
Annu Rev Cell Dev Biol, 2001. 17: p. 53-86.

Klein, J .R., T.F. Fahlen, and ED. Jones, Transcriptional organization and
function of invasion genes within Salmonella enterica serovar T yphimurium
pathogenicity island 1, including the prgH, prgI, prgJ, prgK, orgA, orgB, and
orgC genes. Infect Immun, 2000. 68(6): p. 3368-76.

Kubori, T., et al., Molecular characterization and assembly of the needle complex
of the Salmonella typhimurium type III protein secretion system. Proc Natl Acad
Sci U S A, 2000. 97(18): p. 10225-30.

Collazo, C.M., M.K. Zierler, and J .E. Galan, Functional analysis of the
Salmonella typhimurium invasion genes invl and ian and identiﬁcation of a
target of the protein secretion apparatus encoded in the inv locus. Mol Microbiol,

1995. 15(1): p. 25-38.

Russmann, H., et al., Molecular and functional analysis of the type III secretion
signal of the Salmonella enterica Ian protein. Mol Microbiol, 2002. 46(3): p.
769-79.

Eichelberg, K., C.C. Ginocchio, and J .E. Galan, Molecular and functional
characterization of the Salmonella typhimurium invasion genes ian and invC:
homology of InvC to the FOF1 AT Pase family of proteins. J Bacteriol, 1994.
176(15): p. 4501-10.

Ehrbar, K., et al., Ian is required for type III-dependent secretion of SopA in
Salmonella enterica serovar T yphimurium. J Bacteriol, 2004. 186(4): p. 1215-9.

Ginocchio, CC. and J .E. Galan, Functional conservation among members of the

Salmonella typhimurium InvA family of proteins. Infect Immun, 1995. 63(2): p.
729-32.

100

137.

138.

139.

140.

141.

142.

143.

144.

145.

146.

147.

Galan, J .E. and R. Curtiss, 3rd, Distribution of the invA, -B, -C, and -D genes of
Salmonella typhimurium among other Salmonella serovars: invA mutants of

Salmonella typhi are deﬁcient for entry into mammalian cells. Infect Immun,
1991. 59(9): p. 2901-8.

Ginocchio, C.C., et al., Contact with epithelial cells induces the formation of
surface appendages on Salmonella typhimurium. Cell, 1994. 76(4): p. 717-24.

Ginocchio, C., J. Pace, and J .E. Galan, Identification and molecular
characterization of a Salmonella typhimurium gene involved in triggering the

internalization of salmonellae into cultured epithelial cells. Proc Natl Acad Sci U
S A, 1992. 89(13): p. 5976-80.

Kubori, T. and J .E. Galan, Salmonella type III secretion-associated protein InvE

controls translocation of eﬂector proteins into host cells. J Bacteriol, 2002.
184(17): p. 4699-708.

Eichelberg, K. and J .E. Galan, Differential regulation of Salmonella typhimurium
type III secreted proteins by pathogenicity island 1 (SP1- I)-encoded
transcriptional activators InvF and hilA. Infect Immun, 1999. 67(8): p. 4099-105.

Daeﬂer, S. and M. Russel, The Salmonella typhimurium Ian protein is an outer
membrane lipoprotein required for the proper localization of InvG. Mol
Microbiol, 1998. 28(6): p. 1367-80.

Ideses, D., et al., A degenerate type III secretion system from septicemic
Escherichia coli contributes to pathogenesis. J BacteriOl, 2005. 187(23): p. 8164-
71.

Zhang, L., et al., Regulators encoded in the Escherichia coli type III secretion
system 2 gene cluster inﬂuence expression of genes within the locus for enterocyte
eﬂacement in enterohemorrhagic E. coli 01 5 7:H 7. Infect Immun, 2004. 72(12):
p. 7282-93.

Feng, P.C., et al., Genetic diversity among clonal lineages within Escherichia coli
015 7:H7 stepwise evolutionary model. Emerg Infect Dis, 2007. 13(11): p. 1701-
6.

Wick, L.M., et al., Evolution of genomic content in the stepwise emergence of
Escherichia coli 01 5 7:H 7. J Bacteriol, 2005. 187(5): p. 1783-91.

Garcia-Angulo, V.A., et al., Regulation of expression and secretion of NleH, a
new non-locus of enterocyte effacement-encoded effector in Citrobacter
rodentium. J Bacteriol, 2008. 190(7): p. 2388-99.

101

148.

149.

150.

151.

152.

153.

154.

155.

156.

157.

158.

159.

Gruenheid, S., et al., Identification and characterization of NleA, a non-LEE-

encoded type III translocated virulence factor of enterohaemorrhagic Escherichia
coli 0157:H7. Mol Microbiol, 2004. 51(5): p. 1233—49.

Shariff, M., N. Bhandari, and S. Saini, F luorescent—actin staining (FAS) test: a

novel assay to detect enteropathogenic E. coli. Indian J Pediatr, 1994. 61(6): p.
737-8.

Jarvis, K.G., et al., Enteropathogenic Escherichia coli contains a putative type III
secretion system necessary for the export of proteins involved in attaching and
effacing lesion formation. Proc Natl Acad Sci U S A, 1995. 92(17): p. 7996-8000.

Shaikh, N. and RI. Tarr, Escherichia coli 015 7:H7 Shiga toxin-encoding
bacteriophages: integrations, excisions, truncations, and evolutionary
implications. J Bacteriol, 2003. 185(12): p. 3596-605.

Hopkins, K.L., R.H. Davies, and E.J. Threlfall, Mechanisms of quinolone
resistance in Escherichia coli and Salmonella: recent developments. Int J
Antimicrob Agents, 2005. 25(5): p. 358-73.

Johnson, T.J., et al., Plasmid replicon typing of commensal and pathogenic
Escherichia coli isolates. Appl Environ Microbiol, 2007. 73(6): p. 1976-83.

Maeda, S., et al., Horizontal transfer of nonconjugative plasmids in a colony
bioﬁlm of Escherichia coli. FEMS Microbiol Lett, 2006. 255(1): p. 115-20.

Mills, D.M., V. Bajaj, and CA. Lee, A 40 kb chromosOmal fragment encoding
Salmonella typhimurium invasion genes is absent from the corresponding region
of the Escherichia coliK-12 chromosome. Mol Microbiol, 1995. 15(4): p. 749-59.

Pema, N.T., et al., Molecular evolution of a pathogenicity island from
enterohemorrhagic Escherichia coli 01 5 7:H 7. Infect Immun, 1998. 66(8): p.
3810-7.

Manning, S.D., et al., Variation in virulence among clades of Escherichia coli
015 7:H7 associated with disease outbreaks. Proc Natl Acad Sci U S A, 2008.
105(12): p. 4868-73.

Cooley, M., et al., Incidence and Tracking of Escherichia coli 01 5 7 :H 7 in a
Major Produce Production Region in California. PLoS ONE, 2007. 2(11): p.
@1159.

Jay, M.T., eta1., Escherichia coli 01 5 7:H 7 in feral swine near spinach ﬁelds and
cattle, central California coast. Emerg Infect Dis, 2007. 13(12): p. 1908-11.

102

160. Uhlich, G.A., et al., Characterization of Shiga toxin-producing Escherichia coli
isolates associated with two multistatefood—borne outbreaks that occurred in
2006. Appl Environ Microbiol, 2008. 74(4): p. 1268-72.

103

 

 

 
 

 

 

 
 

 

 

 

milWiAd . .
. Rwlil . .
R.
B 1 .
uiL/ . .
Yd . 4
T1
w}. 41 6 . . .
RM... 11 5 . . . . .
N|4l2
Ui.i0 . .
EH .
. Tilii . . . .
Sul‘lmg , .
“"2 . .
, will 1 . . .. .
. Hi .
1 u . . . i . , .. . .
. f . 1 t.
. . . . . . . . .. . . . .. . . . $2.3.»
. . . .. . . .. . ... . . ... . . . . Iainx? J.
. . . . . . . . . .. . .