A

.

" firing; ,
.9339? . ..

, human.

.
IIIA 9:7?!
V as?
. .3.;......... .

. .w

I

6.... ..

..

..

a

Q.
wfifw
a

m.

h:
‘ m
.15.»,

.i
u.
an. flaw.
i... it! .
.fimfifinmw

m

. “mm
1-“:

i. 2) 3.
1 elkr‘ml

316-3”

,n... .: . Is I

u m».
was s
15%;-
-..i: Wu...
.3... .
.3, ‘
. .m t...
t , y t l’
, um" ..
9:0...
e 12-6”
12:12.; .(1
ti? ’ »
,. .
. Jag-(0197;,
V ..

5

”.3:
.32?
‘1‘
u fivnfiflwufi 3%
0.5.31 €.....uuu.4u
. .i i .2. z
f..z.ut,u......a\tLu.:Bt.-é
.l fifli‘} .uJ 5.5“

.vzitl. . > A . ‘7
131191;]. I. ‘x

1.5! in D .

 

 

 

.1 I LIBRARY
100 z Michigan State
1 University

 

This is to certify that the
dissertation entitled

Biochemical characterization of the COI1-JAZ receptor for
jasmonate

presented by

Leron J. Katsir

has been accepted towards fulfillment
of the requirements for the

PhD. degree in Biochemistry and Molecular
Biology

 

 

42/ M1,,

lWfibr Professor’ 3 Signature

0 9/2 1/0}

Date/

MSU is an affirmative-action, equal-opportunity employer

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

5/08 K IProi/Acc&Pres/CIRC/DaleDue indd

BIOCHEMICAL CHARACTERIZATION OF THE COI1-JAZ RECEPTOR
FOR JASMONATE _

By

Leron J. Katsir

A DISSERTATION

Submitted to
Michigan State University
In partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY
Biochemistry and Molecular Biology

2008

ABSTRACT

BIOCHEMICAL CHARACTERIZATION OF THE COI1-JAZ RECEPTOR
FOR JASMONATE

By

Leron J. Katsir

Jasmonates (JAs) are a class of lipid-derived hormones that regulate diverse
aspects of plant development and resistance to environmental stress. The
molecular mechanism of JA perception is poorly understood. A central
component of JA signaling is the F-box protein COI1 that assembles into the E3
ubiquitin ligase SCFCO". JAs regulate gene expression by stimulating the ability
of SCFCOI1 to degrade JAsmonate ZlM-domain (JAZ) proteins that repress
transcriptional activation of JA responsive genes. I employed an in vitro pull-
down assay to study the mechanism of COI1-dependent JAZ degradation in
response to JA. The results indicate that COI1 physically interacts with JAZ
proteins and that this interaction is highly specific for jasmonoyl-isoleucine (JA-
lle) and closely related structures. The bacterial phytotoxin coronatine (COR)
stimulated COI1 interaction with tomato JAZ proteins and was at least 100-fold
more active than JA-lle. Testing of a broad range of JA derivatives provided new
insight into the structural features of JA-Ile that are required for ligand binding,
attenuation of the signal, and the structural basis of COR’s enhanced activity.
COI1 bears striking sequence and structural similarity to the auxin receptor,
TIR1. JA—lle-dependent binding of COI1 to JAZs is analogous to the role of auxin

in promoting the interaction of Aux/IAA proteins with TIR1. Receptor binding

studies showed that COI1 is an essential component of a JA receptor. Analysis
of truncated JAZs revealed that the C-terminal domain of JAZ3 is necessary and
sufficient for ligand-induced COI1-JAZ interaction and ligand binding.
Significantly, binding assays performed with purified proteins showed that neither
COI1 nor JAZ alone acts as a JA receptor. Rather, COI1 and JAZ together are
required for ligand binding. These findings extend the paradigm of F-box proteins

as intracellular receptors of small molecules.

ACKNOWLEDGEMENTS

To be where I am now, writing thanks to all those Who have helped me, to be
here now is a bit surreal. I strongly feel if it was not for the strong push down the
“rabbit hole” by my former mentor Dr. Betty Jean Gaffney I may not have begun
down the path toward the wonderland of scientific exploration, and for that I am
forever grateful. Every successful journey needs a guide and when I found
myself on uncertain footing in the world of plant biology l was immensely
fortunate to have Dr. Gregg Howe to help lead the way. I cannot thank Gregg
enough for the joy I have had working on this project, spending time in the lab,
and just simply chatting about science, not to mention all of his help in getting
this thesis in good shape. I also have been I had a rather enjoyable and pretty
laid-back thesis committee. Thanks to Dr. Sheng Yang He, Dr. Robert Larkin, Dr.
John LaPres, and Dr. Kathy Gallo for not shouting “off with his head.” Special
thanks to Shang Yang and Rob for great discussions and for material and
technical support some of which you know of and some of which you don’t. I also
want to thank Dr. John Browse and Dr. Paul Staswick for collaborative efforts
with me during the course of my thesis. This acknowledgement would not be
complete without recognizing my lab colleagues and friends who have made the
time I have spent in Michigan easily one of the best periods of my life. Outside of
the lab the support from my parents, family, and friends has always been

overwhelming and I am forever grateful.

iv

TABLE OF CONTENTS

LIST OF TABLES ................................................................................................ vii

LIST OF FIGURE ................................................................................................ viii
CHAPTER 1 - Biology, synthesis, and perception ofjasmonates ........................ 1
1.1. Introduction .................................................................................. 2
1.2. JAs regulate a broad array of plant responses ............................ 3

1.3. Induction of JA synthesis ............................................................. 3

1.4. The biosynthetic pathway of jasmonic acid ................................. 5

1.5. Jasmonic acid is metabolized to many derivatives .................... 11

1.5.1. Hydroxylated JA and related derivatives ........................... 11

1.5.2. Methyl Jasmonate ............................................................. 13

1.5.3. cis-jasmone ....................................................................... 13

1.5.4. Jasmonoyl amino acid conjugate ...................................... 14

1.6. Coronatine is a molecular mimic of JA-lle ................................. 15

1.7. COI1 is a major regulator of JA perception ................................. 17

1.7.1. The F-box domain of COI1: a link between JA signaling and

the 268 proteasome ......................................................... 18

1.8. F-Box proteins serve many roles in hormone signaling ............. 19

1.8.1. Perception of GA is regulated by SCFG'DZ’SLY1 ................... 20

1.8.2. The F-box regulators of ethylene perception ..................... 21

1.8.3. The auxin receptor TlR1 .................................................... 21

1.9. Transcriptional regulators of JA responses ............................... 24

1.10 Rationale and outlook ................................................................ 26
References ........................................................................................... 27
CHAPTER 2 - Characterization of JA-lle mediated COI1-JAZ binding .............. 36
Abstract ................................................................................................ 37
Introduction ........................................................................................... 38
Materials and methods ......................................................................... 42

Results .................................................................................................. 48
Discussion ............................................................................................ 68
References ........................................................................................... 72

CHAPTER 3 - COI1 is a critical component of a receptor for jasmonate and the

bacterial virulence factor coronatine ........................................... 74

Abstract ................................................................................................. 75
Introduction ........................................................................................... 77
Materials and methods ......................................................................... 81

Results ..................................................... ' ............................................. 85
Discussion .......................................................................................... 103
References ......................................................................................... 1 08
CHAPTER 4 - Biochemical characterization of the JA receptor ....................... 112
Abstract .............................................................................................. 1 13
Introduction ......................................................................................... 1 14
Materials and methods ....................................................................... 118

Results ................................................................................................ 121
Discussion .......................................................................................... 139
References ......................................................................................... 143
CHAPTER 5 — Conclusions and future perspectives ........................................ 148
References ......................................................................................... 1 55

vi

LIST OF TABLES

Table 2.1. .............................................................. ' ........................................... 113

vii

LIST oF FIGURES

Figure 2.1. Alignment of SlJAZ amino acid sequences with AtJAZ1 .................. 50
Figure 2.2 Phlylogenetic analysis of JAZ proteins .............................................. 51
Figure 2.3. Effect of the jai1-1 mutation on JAZ gene expression ...................... 54

Figure 2.4. Complementation of the tomato jai1-1 mutant with 35S:COI1-Myc
and expression and purification of SIJAZ1-His .................................................... 58

Figure 2.5. In vitro interaction between COI1 & JAZ1 is promoted by JA-lle ...... 60
Figure 2.6. Specificity of jasmonate action in a cell-free system ........................ 61

Figure 2.7. JA-lle-mediated COI1-JAZ interaction in vitro is mediated by soluble
factors .................................................................................................................. 63

Figure 2.8. Effect of kinase and phosphatase inhibitors on JA-lIe-stimulated
interaction between COI1-Myc and JAZ1-His ..................................................... 64

Figure 2.9. Effect of temperature on JA—lle—mediated COI1-JAZI binding ......... 65
Figure 2.10. JA—lle-dependent interaction between COI1 and JAZ1 in yeast....67

Figure 3.1. Specificity of JA—amino acid conjugates in promoting COI1—JAZ
interaction ............................................................................................................ 86

Figure 3.2. Phylogenetic tree showing the relationship of tomato JAZ1 (SIJAZ1)

and JAZ3 (SIJAZ3) to the 12 JAZ proteins in Arabidopsis thaliana. ................... 87
Figure 3.3. Coronatine promotes formation of COI1—JAZ complexes ................ 90
Figure 3.4. Coronatine and JA-Ile bind to a COI1-JAZ complex. ....................... 93
Figure 3.5. COI1 is an essential component of the jasmonate receptor. ........... 95

Figure 3.6. The tomato jai1-3 mutant contains a Leu418Phe amino acid
substitution in COI1 that results in reduced sensitivity to endogenous and
exogenous JA. .................................................................................................... 98

viii

Figure 3.7. A Leu418Phe amino acid substitution in COI1 results in reduced

sensitivity to exogenous JA and reduced affinity for COR ................................... 99
Figure 3.8. The C-terminal region of JAZ3 is required for COI1 interaction and
specific binding of COR to the COI1-JAZ3 complex. ....................................... 102
Figure 4.1. JA-lle promotes JAZ interaction with COI1. ................................... 122
Figure 4.2. Coronatine promotes interaction with COI1 with several members of
the Arabidopsis JAZ family. .............................................................................. 124
Figure 4.3. COI1-JAZ is a co-receptor .............................................................. 127
Figure 4.4. Activity of JA-lle stereoisomers ...................................................... 130
Figure 4.5. Binding activity of various JA-lle derivatives ................................... 133
Figure 4.6. Comparison of JA-lle and JA-CMA ................................................. 136
Figure 4.7. Methylation of JA-lle reduces its activity. ....................................... 138

ix

Chapter 1

Biology, synthesis, and perception of jasmonates

1.1 . Introduction

Plant speciation is a record of adaptive success in coping with the challenges of
a terrestrial existence, like limited access to water, changing temperatures, and
solar radiation - not to mention countless hungry heterotrophs eager to consume
nutrient-laden photoautotrophic plants. An additional challenge complicating the
existence of plants, at least from an anthropomorphic perspective, is that plants
are sessile and cannot move to escape from environmental changes, save seed
dispersal of the next generation. To cope with a rapidly changing world plants
have developed a vast array of sensors to detect changes in the environment
and adaptive features to respond to these changes. One such plant sensor takes
advantage of the enzymatic generation of oxidized lipids that accumulate when
leaf tissue is damaged by various stress conditions. Oxidized lipids as signaling
molecules are not unique to plants; in animals the generation of eicosanoids
derived by oxygenation of arachidonic acid are regulators of inflammation and
immunity. This thesis is primarily concerned with the description of the machinery

plants use to recognize a class of oxidized lipid, the jasmonates (JAs).

1.2. JAs regulate a broad array of plant responses

Jasmonic acid is the prototypical member of a family of poly-unsaturated fatty
acid (PUFA) derived cyclized oxylipins. JAs constitute a major hormone signaling
pathway in higher plants. In unchallenged plants, JA is a minor contributor to

overall developmental patterning and progression up until the reproductive

phase. JAs serve a role in developmental regulation, where the hormone is
utilized as a cue at the later stages of reproductive patterning (Ito et al. 2008,
Mandaokar et al. 2006). Steady state JA synthesis influences a constitutive low-
level expression of genes that contribute to a basal level of plant defense. Stress-
triggered increases in JA synthesis induce a multi-phased response that
reinforces the components of JA signaling and synthesis, initiate the production
of a broad range of plant protective compounds, initiate changes in cell cycle
progression that effect growth, and promote the generation of signals that
redirect plant resources to manage these changes (Devoto et al 2005,
Mandaokar et al. 2003, Reymond et al. 2000, Schenk et al. 2000). The sweeping
transcriptional reprogramming that occurs in response to increased JA levels can
be summarized as a reorganization of plant resources away from growth and

towards defense (Howe and Jander 2008).

1.3. Induction of JA synthesis

JA is synthesized rapidly in response to a variety of environmental stimuli,
including wounding, cell wall elicitors, osmotic stress, bacterial and fungal
pathogens, and UV light exposure (Gundlach et al. 1992, Conconi et al. 1996,
Parchman et al. 1997, Kramell et al 2000). How a particular stress signal induces
JA synthesis is not entirely clear. The involvement of a lipase that acts to
perceive stress and generate free linolenic acid, the primary substrate for JA

biosynthesis, is a central tenant of JA signaling. The lipase DONGLE (DGL),

which is a member of the AtPLA1-I gene family, may be responsible for initiating
JA biosynthesis in vegetative tissue (Hyun et al. 2008). The events that lead to
DGL activation have yet to be characterized, however, the generation of
phosphatidic acid (PA) has been implicated as a possible signal to activate DGL

(Hyun et al. 2008).

More is known about how JA synthesis is initiated in response to
developmental cues. JA perception is required for reproductive processes,
including pollen development and the maternal control of seed maturation (Xie
et al 1999, Li et al 2004, Browse 2005). In Arabidopsis, a phospholipase A1
(PLA1) responsible for initiating JA synthesis in floral tissue has been identified
as Defective in Anther Dehiscence1 (DAD1). T-DNA insertions in DAD1 result in
anther dehiscence phenotypes observed in JA biosynthetic and perception
mutants (lshiguro et al. 2001). The finding that DAD1 expression is localized to
stamens is consistent with the accumulation of JA in floral tissues (Hause et al.
2000). Characterization of DAD1 remains incomplete, and it is not clear if DAD1
acts to release free linolenic acid, OPDA, or both. Induction of JA synthesis in
late stamen development is regulated by transcriptional induction of DAD1 by the
transcription factor Agamous (Ito et al. 2007). It is possible that a similar
sequence of events may lead to lipase activation and JA synthesis in wounded
leaves, though this remains to be determined. A deeper understanding of the
specificity, sub-cellular localization, and regulation of lipases that generate the JA

signal will provide better insight into the mechanics of this process.

1.4. The biosynthetic pathway of jasmonic acid

Jasmonic acid is derived from the PUFA linolenic acid. Direct evidence for the
role of trienoic fatty acids in JA synthesis came from the work of McConn and
Browse (1996), who sought to understand the role of PUFAs in thylakoid
membrane function. Instead of finding a photosynthesis-related phenotype in the
fatty acid desaturase triple mutant fad3-2 fad7-2 fad8 that contains <0.1%
trienoic fatty acids, they found this mutant to be male sterile. Significantly, fertility
could be restored by exogenous JA (McConn et al. 1996). The triple mutant was
also more susceptible to insect herbivory, which could be rescued with
exogenous JA as well. These key experiments established an important
connection between linolenic acid as substrate for JA synthesis (McConn et al.

1 997).

The cascade of events that lead to the generation of JA from linolenic acid
initiates in the chloroplast where linolenic acid is primarily located and is
completed in the peroxisome. Many of the precursors of JA are substrates for the
synthesis of other oxylipins (Howe and Schilmiller 2002). An overview of JA
biosynthesis is shown in Figure 1.1. In the chloroplast, the initial event the
enzyme that acts on linolenic acid (leads to the production of JA) is 13-
lipoxygenase (13-LOX), which catalyzes di-oxygenation of linoleic acid to 13-
hydroperoxy linolenic acid (13-H POT). This fatty acid hydroperoxide is then acted
on by allene oxide synthase (A08) to generate an unstable epoxide intermediate
12,13-epoxy octadecatrienoic acid (12,13-EOT). Next, allene oxide cyclase

(AOC) guides the unstable epoxide to form the cyclopentenone ring of the more

stable JA intermediate, OPDA. Cyclization by ADC establishes the
stereochemistry of OPDA as the (98,138) isomer. The detection of OPDA-
monogalactosyl diglyceride establishes that a pool of lipid conjugated OPDA
exists and accumulates in response to wounding (Stemlach et al. 2001).

/ Determining the role of OPDA-conjugated galactolipids is an active area of
research. Regardless, OPDA must be transported to the peroxisome for further
processing. The movement of OPDA to the peroxisome may involve the ATP-

binding cassette transporter COMATOSE (CTS) and related transporters

(T heodoulou et al. 2005).

Figure 1.1 The biosynthetic pathway to jasmonic acid

The enzymes 13-lipoxygenase (13-LOX), allene oxide synthase (A08),
and allene oxide cyclase (AOC) catalyze the initial steps of JA
biosynthesis in the chloroplast. The ATP-binding cassette transporter
COMATOSE (CTS) may have a role in transport of 12-OPDA to the
peroxisome. JA synthesis is completed in the peroxisome by the
involvement of OPDA reductase 3 (OPR3), OPC:8 CoA Ligase, acyl

CoA oxidase (ACX), and additional 8-oxidation enzymes (not shown).

 

 

o \
/

Linolcnic acid OH

Ho‘o I 13.1.ox

 

 

 

/ o
/
13-11pm OH
Inns
0 —
l o
/
12,13 EOT OH
O I...
W O
-v»/\/\/\_/<
III—OPDA OH
| Plasti
lcrs I 7
o I \
W 0
”WW _
12mm 0H
0 Iowa:

Iopcm CoA ngase

W O
'w/\/\/\_J<

CFC—8:0 - CoA COA

I ACXI 3x 8-oxldation
o

I

w:
o OH

Jasmonic Acid .
Peroxrsom

 

 

In the peroxisome, OPDA is reduced to 3-oxo-2- [2'—pentenyl]-
cyclopentane-1-octanoic acid (OPC:8) by OPDA reductase (OPR3) (Schaller et
al. 2000). The reduction of OPDA is a key step in JA biosynthesis because in the
absence of OPR3 jasmonic acid synthesis is aborted. Characterization of opr3
Arabidopsis mutants led to the idea that some plant-defense responses are
stimulated by OPDA rather than JA (Stintzi et al. 2001, Taki et al. 2005). OPC-
8:0 then undergoes conversion to its corresponding CoA derivative by the OPC-
8:0-CoA ligase1 (OPCL1)(Koo et al. 2006) for entry into B-oxidation. Impairment
of B-oxidation, such as in the acx1/5 double mutant, results in loss of resistance
to chewing insects as well as defects in male reproductive development
(Schilmiller et al. 2007). JA synthesis is completed after OPC-8:0 undergoes
three rounds of B-oxidation (Fig. 1a) (Howe et al. 2005). Jasmonic acid is freed of

CoA, presumably by a peroxisomal thioesterase.

Jasmonic acid possesses two chiral centers at the C-3 and C-7 positions,
resulting in four possible isomers (Figure 1.2). The stereochemistry of the
natural product, cis (3R,7S)— jasmonic acid is achieved by AOC. Epimerization of
the cis compound is the result of a keto-enol tautomerization that results in the
more stable trans (3R,7R) jasmonic acid (Vick and Zimmerman 1984). Factors
effecting epimerization include an acidic environment and temperature, which
complicates any analysis of the isomeric composition of jasmonic acid in plants.
Neither the rate of epimerization nor the isomeric composition of JA isomers in
planta is known. The individual activities of these stereoisomers have yet to be

carefully evaluated.

Natural
Products

 

 

 

(-) (3R, 7R) - JA /

o o
7%0“\\\ / I 78 /
O OH 0 OH
H (38. 7R) - JA (+) (33, 7S) - JA

Figure 1.2 Natural and synthetic isomers of jasmonic acid

10

1.5. Jasmonic acid is metabolized to many derivatives

Newly synthesized jasmonic acid is a substrate for modification of its free
carboxylic acid or pentenyl side chain. As such, many derivatives of JA have
been identified (see Figure 1.3), yet few have been assigned a definite function.
Some JAs have been suggested to affect the mobility, degradation, and/or

activity of the JA signal (Miersch et al. 2008).

1.5.1. Hydroxylated JA and related derivatives

Jasmonic acid can be hydroxylated at the 11 and 12-position of the
pentenyl side chain (Sembdner et al. 1994, Swiatek et al. 2004, Miersch et al.
2008)(Figure 1.3). Hydroxylated JA can undergo further modification by
sulfonation to HSO(4)-JA (Swiatek et al. 2004). An enzyme responsible for
sulfonation of 12-OH-JA was identified as 12-OH JA sulfotransferase (Gidda et
al. 2003). Wound-induced accumulation of 12-OH JA and HSO(4)-JA compounds
lags behind jasmonic acid accumulation, leading to the hypothesis that these
derivatives represent JA entry into an inactivation pathway (Miersch et al. 2008).
Jasmonoyl-1-B-glucose, jasmonoyl-1-j3-gentiobiose and hydroxyjasmonoyl-1-j3-
glucose are likely produced from 12-OH-JA (Swiatek et al. 2004). The role these

compounds serve in plants is not clear.

11

JMT ?
<— —->.
—->
MeJA MJE JA

cis-jasmone
O O

r 2/ 1°:

OH
o’Ra
JA-lle __.,
° 12-OH-JA
0 on 0 on

Figure 3.1 Biosynthetic fates of jasmonic acid

Jasmonic acid can be reversibly methylated by the action ofjasmonic acid methyl
transferase (JMT) and methyl jasmonate esterase (MJE). Conjugation of JA to
isoleucine is catalyzed by JAR1. The production of 12-OH-JA from JA can be
used as a substrate for addition of a variety of R substituents, including glucose,

gentiobiose, and sulfate.

12

1.5.2. Methyl Jasmonate

The free carboxylic acid moiety of jasmonic acid can be methylated by the
jasmonate methyl-transferase (JMT), to yield the more volatile methyl jasmonate
(MeJA)(Figure 1.3) (Cheong 2003). Over-expression of JMT up-regulates
defense related gene expression and confers increased tolerance to the fungal
pathogen B. cinera (Seo et al 2001). In tomato, a methyl jasmonate esterase
(MJE). that reverses the JMT reaction, was characterized (Stuhlfelder et al.
2005). Because it is more volatile than jasmonic acid, MeJA may be important for
movement through plant tissue as a systemic signal (Meyer et al. 2003). MeJA
has also been implicated as a plant-to-plant signaling compound that alerts

neighboring plants to impending attack (Farmer and Ryan 1990).
1.5.3. cis-Jasmone

Feeding of insect herbivore on plants also results in the release of the JA
derivative cis-jasmone (Birkett et al. 2000). cis-jasmone clearly plays a role in
plant defense. Though the scope of its activity has yet to be fully evaluated, cis-
jasmone has been shown to induce secondary metabolite synthesis and is a
potent aphid repellent (Pickett et al. 2007, Birkett et al. 2000). The biosynthetic
pathway to cis-jasmone is not fully understood. A recent proposal suggests cis-
jasmone synthesis is initiated by the isomerization of OPDA to iso-OPDA. iso-
OPDA would then proceed through 8—oxidation, followed by spontaneous

decarboxylation to produce cis-jasmone (Dabrowska et al. 2007). An alternative

13

to the iso-OPDA model relies on the spontaneous or enzyme mediated
decarboxylation ofjasmonic acid to cis-jasmone (Figure 1.3). The mechanism of

cis-jasmone perception is unknown.
1.5.4. JasmonyI-amino acid conjugates

Jasmonic acid can be conjugated via an amide linkage to amino acids.
The jasmonyl-amino acid conjugates (JACs) JA-lle, JA-Leu, JA-Val, and JA-Phe
have been found in a variety of plant species (Kramell et al. 1995, Staswick et al.
2004, Hause et al. 2004). Jasmonyl-isolelucine (JA-lle) has been proposed to be
an active jasmonate because it elicits responses similar to JA (Kramell et al.
1997, Staswick et al. 2004). It is difficult to resolve the activity of exogenous
JACs from other JAs because of the occurrence of metabolic inter-conversion in
planta. The contribution of JACs to JA signaling was reinforced with the
discovery and characterization of the Arabidopsis mutant jar1 that is insensitive
to JA but responsive to JA-lle (Staswick et al. 2002). JAR1 encodes an enzyme
that is structurally similar to members of the firefly Iuciferase super-family. JAR1
catalyzes the ATP-dependent formation of an iso-peptide bond between the free
carboxyl group of JA and the a-amino group of most amino acids and is highly
specific for JA (Staswick et al. 2004). Levels of JA—lle are markedly reduced in
the jar1 mutant, whereas other JACs are less affected, indicating JAR1 is specific
for JA-Ile synthesis (Figure 1.3) (Staswick et al. 2004). The phenotypes
associated with jar1 and JAR silenced lines of N. attenuate demonstrate that JA-
lle synthesis is important for plant protection against necrotrophic soil pathogens

(Staswick et al. 1998), Iepidopteran insects (Kang et al. 2006), and various

14

abiotic stresses as well (Rao et al. 2000). However, jar1 mutants retain some
COI1 dependent responses. For example, the mutant is only partially insensitive
to jasmonic acid and lacks the reproductive defects characteristic of mutants
blocked in JA synthesis and perception (Staswick ’et al. 2004). The persistence of
JACs in jar1 mutant plants makes it difficult to distinguish JA mediated processes
from those facilitated by JA-lle (Staswick et al. 2004). These recent findings
strongly support a role for JA-lle in activating the JA response but leave open the

possibility that jasmonic acid or other JAs are active as well.

1.6. Coronatine is a molecular mimic of JA-lle

Coronatine (COR) has played an important role in the dissection of the
jasmonate pathway and has been long recognized as a molecular mimic of JA
(Weiler et al. 1994, Staswick et al. 2008). Most notably, discovery of the
coronatine insensitive mutant1-1 (coi 1) mutant of Arabidopsis that is insensitive
to both COR and JA directly implicates COR in JA signaling (Xie et al. 1998).
COR strongly elicits the activation of jasmonate response both locally and
systemically (Cui et al. 2005, He et al. 2004, Zhao et al. 2003). Transcriptional
profiling of JA- and COR-inducible genes shows that both compounds impact
distinct and overlapping pathways, and a large majority of COR action is
mediated by COI1 (Zhao et al. 2003, Uppalapati et al. 2005). COR synthesis and
secretion is a key element off the virulence strategy of the plant bacterial
pathogen Pseudomonas syringae. The penultimate step in COR synthesis in P.

syn’ngae resembles the conjugation of JA and amino acid by JAR1. The

15

coronafacic acid ligase catalyzes the conjugation of coronafacic acid (a
polyketide) and coronamic acid (a cyclopropyl amino acid) moieties of COR
(Bender et al. 1999). The resulting COR molecule shares striking structural

similarity to JA-lle (Figure 1.4).

Jasmonic acld Jasmonyl-lsoleuclne Coronatine

o o 0
a "' c "
on an
o 0 #1 o m
o o
w CMA
OH
HO
Figure 1.4 The structures of jasmonic acid, jasmonoyl-isoleucine, and

coronatine.

Activation of COI1-mediated responses by COR suppresses salicylic acid (SA)
accumulation and SA-dependent defense responses targeted against bacterial
pathogens (Kloek et al. 2001, Uppalapati et al. 2007). Accordingly, in plants

lacking a functional COI1, the JA pathway cannot be activated and SA-mediated

l6

defense responses are not suppressed, making these plants more resistant to P.
symigae (Zhao et al. 2003). P. syringae also uses COR to facilitate host entry by
reopening or blocking the closure of stomata that shut in response to pathogen-
associated molecular patterns (PAMPs)(MeIotto et al. 2007). Thus, in addition to
serving as a useful tool to investigate COI1 dependent signaling pathways, COR
is an important component of the P. syn'ngae arsenal used to subvert host

defenses.

1.7. COI1 is a major regulator of JA perception

As the name of the coi1 mutant implies, these plants are insensitive to the
effects of COR, as well as to JA. A screen for JA-insensitive mutants in tomato
resulted in the discovery of the jasmonate insensitive1-1 (iai1-1) mutant that is
defective in the tomato homolog of COI1 (Xie at al. 1998, Li. et al. 2004).
Characterization of these mutants demonstrated a direct connection between JA
perception and COI1 and a key link between JA signaling and proper
reproductive development was established. coi1 Arabidopsis plants are sterile as
a result of defects in anther filament elongation, anther dehiscence, and pollen
development. The tomato jai1-1 mutant suffers impairment in embryo
development as well as defects in male reproductive development (pollen
viability). Mutants lacking a functional COI1 exhibit increased susceptibility to a

broad range of biotic and abiotic challenges (Howe and Jander 2008).

17

Cloning of COI1 revealed that the gene encodes a ~70 kDa protein consisting of
an N-terminal F-box domain and a large C-terminal leucine rich repeat (LRR)
(Xie et al. 1998). The F-box domain of COI1 places it within a large super family
of over 700 F-box proteins (Gagne et al. 2002). Yeast two-hybrid studies
revealed that Arabidopsis COI1 interacts with S-phase kinase-associated
protein1 (ASK1), ASK2, a Ring-box1 (Atbe1), and Cullin (AtCul). The human
homologs of these proteins are well-documented components of SCF (Skp-cullin-
F-box) type-E3 ubiquitin ligase complexes (Schulman et al. 2000). COI1 likewise
assembles with these components to form an E3 ubiquitin ligase designated as
SCFCO". COI1 participation in an SCF complex led to the hypothesis that post-
translational control by degradation is central to JA signaling (Devoto et al. 2002,

Xu et al. 2002).

1.7.1. The F-box domain of COI1: a link between JA signaling and the 26S

proteasome

Ubiquitin ligases covalently attach ubiquitin to a lysine residue on a target
protein, committing the ubiquitylated proteins for destruction by the 26S
proteasome. Ubiquitin is activated for transfer by an E1-activating enzyme and
subsequently transferred to an E2-conjugating enzyme that facilitates the
addition of ubiquitin to the substrate of an E3 ubiquitin ligase (Deshaies 1999).
The F-box protein confers substrate selectivity to the E3 complex through a
diversity of protein-protein interaction domains. In the case of COI1, LRRs are

well-documented protein-protein interaction domains (Kobe et al. 2001).

18

COI1 interacts with the constitutive photomorphogenic-9 (COP9)
signalasome (CSN), and defects in JA signaling are exhibited by CSN loss of
function mutants (Feng et al. 2003). The CSN is a large multimeric complex that
regulates the activity of E3-ubiquitin ligase complexes by removal of the small
protein NEDD8 from the cullin subunit of the SCF complex (Chew et al. 2007).
Much of our understanding of COP9 action in plants is derived from studying
CSN mutants in the context of auxin signaling, where the E3 ubiquitin ligase
SCFT'R1 is hindered in its ability to facilitate the degradation of its substrate
Aux/IAA (Schwechheimer et al. 2001). The similar effects that CSN mutants
have on JA and auxin signaling implies that COI1, like TIR1, is dependent on this
pathway for proper degradation of key transcriptional regulators. That the CSN
impacts multiple hormone pathways reinforces the notion that it is a nexus of

hormone regulation via SCF complexes in plants (Serino et al. 2003).

1.8. F-Box proteins serve many roles in hormone signaling

F-box proteins regulate an enormous diversity of plant physiological processes
including the regulation of circadian clock, floral development, cell cycle control,
leaf senescence, and root and shoot development (Lechner et al. 2006). Several
major hormone signaling pathways aside from JA, including gibberellin (GA),
ethylene, and auxin are regulated by F-box proteins. Understanding how plants
utilize F-box proteins in other hormone signaling pathways may help us

understand how COI1 regulates JA responses.

19

1.8.1. Perception of GA is regulated by screw“LY1

Gibberellins (GAs) are plant hormones that regulate-various developmental
processes, including stem elongation, germination, dormancy, and flowering. The
GA response is controlled in part by the DELLA proteins, a family of highly
conserved proteins defined by the canonical DELLA domain and the VHYNP
domain. DELLAs regulate repressors of GA mediated responses. The
mechanism by which DELLAs regulate transcription is unknown (Schwechheimer
2008). The F-box proteins GID2 and SLY1, which are involved in GA signaling in
rice and Arabidopsis, respectively, confer the specificity for ubiquitin—mediated
degradation to the SCF-E3 ubiquitin ligase, SCFG'DZ’SLY1 (Fu et al. 2004, Gomi et
al. 2004, Dill et al. 2004, McGinnis et al 2003). The molecular details surrounding
GA mediated degradation of DELLA proteins by SCFG'DZ’SLY1 are still being
worked out. The GA receptor for G|D1 is a enzymatically inactive relative of the
so-called hormone-sensitive lipases (HSLs) (Ueguchi-Tananka et al. 2006).
Biochemical evidence shows that GA binding G|D1 stimulates GID interaction
with DELLA proteins (Willige et al. 2007). The model that has emerged involves
GlDlGA-mediated interaction of SCFG'DZ’SLY1 with, and subsequent degradation
of, DELLA. In the absence of DELLA, GA-responsive genes are expressed

(Griffiths et al. 2006, Schwechheimer 2007).

20

1.8.2. The F-box regulators of ethylene perception

Another case of the involvement of an F-box protein in hormone signaling is the
gaseous hormone ethylene. Ethylene is involved in mediating responses to biotic
and abiotic stress, development, fruit ripening, and senescence (Etheridge et al.
2005). Ethylene is perceived by a family of membrane bound receptors; ETR1,
ETR2, EIN4, ERS1 and ERSZ (Hua et al. 1998). These ethylene receptors
interact with the serine/threonine protein kinase CTR1 (Kieber et al. 1993). The
ethlylene signal is relayed to transcriptional regulators via CTR1 and an
unconventional mitogen-activated protein kinase (MAPK) cascade. Most
transcriptional regulation in the ethylene response has been attributed to the
DNA-binding protein EIN3 (Chao et al 1997). EIN3, and also EIL1 are positive
regulators of the ethylene response. EIN3 and EIL1 protein levels are controlled
by proteolysis through the 26S ubiquitin proteasome pathway (Guo and Ecker
2003, Potuschak et al. 2003; Gagne et al. 2004). The F-box proteins EBF1 and
EBF2 interact with EIN3 and with EIL1 and constitutively target them for
degradation (Binder et al. 2007). Ethylene promotes the accumulation of EIN3

and EIL1, thus allowing them to activate transcriptional responses.
1.8.3. The auxin receptor TIR1

The auxin receptor TIR1 is by far the best-characterized F-box protein
involved in hormone perception in plants and most relevant to JA signaling. COI1
and TIR1 belong to a small subclade of F-box proteins that is comprised of five

additional members, the AFBs (Auxin- signaling F-box protein). All of these

21

proteins possess a large C-terminal LRR domain (Dharmasiri et al. 2005). The
strong sequence (34% identity) and structural similarity between COI1 and TIR1
supports the hypothesis that COI1 is a receptor for JA. TIR1 assembles into an
SCF complex, SCFT'm. Auxin induced-responses are controlled by TIR1-
mediated degradation of the Aux/IAA proteins, which act as repressors of auxin
signaling (Figure 1.5) (Kepinski et al, 2005, Dharmasiri et al, 2005). Aux/IAA '
proteins interact with and repress Auxin Response Factors (ARFs) that are
positive regulators of auxin gene expression. Auxin mediates TIR1 binding to
Aux/lAA by acting as a “molecular glue” to facilitate the interaction of these two
proteins (Tan et al. 2008). Bound Aux/IAA is then ubiquitylated and targeted for
degradation by the 26S proteasome pathway. Following Aux/IAAs degradation
ARFs activate auxin-responsive gene expression. Auxin is the first example of a
small molecule that acts non-covalently to enhance the affinity of an F-box
protein for its substrates (Kepinski et al, 2005, Dharmasiri et al, 2005). Testing
the hypothesis that COI1 acts to regulate JA responses in a manner similar to

TIR1 has been hindered by lack of knowledge of COI1 substrates (Figure 1.5).

22

 

Low Auxin High Auxin

24>
Auxin-res onse ene A - _
@(m reprgssion'g ARF “*‘“53i£§l‘§§*~’°"e

Low JA High JA

m6 ..
@‘P/V ‘°‘°a§° ’TF prre58§n
F Repre.sor
JA-res nse-gene JA-response-gene
FAC‘M” refipgssion -_ AC twator I activation

Figure 1.5 Comparison of auxin and JA signaling pathways

 

 

 

 

 

 

 

(A) The auxin model. In conditions of low auxin concentration, Aux/IAA
repressors bind to ARF activators. As auxin concentrations increase, SCFT'R1
binding to Aux/IAA is mediated directly by auxin. Aux/lAA is then targeted to the
26S proteasome for destruction. ARF activators are relieved of Aux/IAA
repression and activate auxin-responsive genes. (B) The JA model. When JA
levels are low, the expression of jasmonate-responsive genes are repressed. An
increase in JA concentration leads to SCFCOI1 ubiquitylation and subsequent

ubiquitin mediated degradation of a repressor protein. JA-responsive genes are

expressed in the absence of the repressor.

23

1.9. Transcriptional regulators of JA responses

How JA mediates transcriptional activation through COI1 is unknown. However,
several transcriptional regulators have been linked to JA responses. The
AP2/ERF-family of transcription factors (TF) is part of the regulatory machinery
controlling JA signaling. ORCA2, for example is an AP2/ERF TF that interacts
with jasmonate-responsive transcription elements (van der Fits et al. 2001).
ORCA2 transcript rapidly accumulates in response to JA; it has been proposed
that the protein plays a primary role in JA responses (van der Fits et al. 2001).
The fact that cycloheximide treatment causes the induction of ORCA2 transcript
indicates that its expression is controlled by a labile repressor (van der Fits et al.
2001). Precisely how ORCA2 or other AP2/ERF TFs regulate JA signaling is
currently unclear because some members of this family act as positive regulators

whereas others act as repressors (McGrath et al. 2005).

The Arabidopsis basic helix-loop-helix (bHLH) TF MYC2 (JIN1) plays a central
role in the regulation of JA-responsive gene expression. Arabidopsis plants
lacking a functional MYCZ have reduced responsiveness to JA (Lorenzo et al.
2004, Boter et al 2004). MYC2 is a positive regulator of JA signaling and its over-
expression results in hypersensitivity to JA (Lorenzo et al. 2004). Tomato
homologs of MYCZ, JAMYCZ and JAMYC10, have been characterized (Boter et
al. 2007). Arabidopsis and tomato MYC genes are induced in response to JA
treatment. MYCZ, JAMYCZ and JAMYC10 proteins also physically interact with -
JA responsive promoter elements such as the G-box (Lorenzo et al. 2004, Boter

et al 2004). mch/jin1 mutant plants do not exhibit the reproductive defects found

24

in coi1, indicating some parts of the COI1-dependent JA pathway are not under
the control of this TF. It is noteworthy that MYC2 has also been characterized as
a repressor of blue-light mediated photomorphogenic growth and also as a
positive regulator of abscisic acid singaling, raising the possibility that this protein
mediates crosstalk between several signaling pathways (Yadav et al. 2005,
Anderson et al. 2004). Identifying additional transcriptional regulators of JA
signaling is essential to understanding how JA influences a broad range of

responses.

25

1.10. Rationale and outlook

Hormone synthesis and perception is fundamental to cellular signaling. The
decimation by insect herbivores of plants impaired in JA signaling is evidence of
how critical this hormone pathway is to the success of plants (Li et al. 2004, Li et
al. 2003). Optimal plant fitness in natural environments depends on the ability of
plants to sense and respond to a range of biotic and abiotic challenges. That
reproductive development is so tightly linked to plant defense by JA is not

surprising considering the pressure to reproduce in challenging environments.

The molecular and biochemical characterization of a receptor is integral to any
hormone pathway. The best candidate for such a receptor in JA signaling is the
F-box protein COI1. The strong similarities shared between COI1 and the auxin
receptor TIR1 make it clear that identifying COI1 substrates would be a
breakthrough. The constitutive repression of JA responses in~ coi1 mutants
supports the existence of such repressor proteins. If the mechanism of JA
perception is similar to that of auxin, identification of COI1 substrates would allow

experiments to test the hypothesis that COI1 is a JA receptor.

26

References

Anderson, J., Badruzsaufari, E., Schenk, P., Manners, J., Desmond, 0.,
Ehlert, C., et al. (2004). Antagonistic interaction between abscisic acid and
jasmonate-ethylene signaling pathways modulates defense gene expression and
disease resistance in Arabidopsis. Plant Cell, 16: 3460-79.

Bender, C., Alarcén-Chaidez, F., 8: Gross, D. (1999). Pseudomonas syringae
phytotoxins: mode of action, regulation, and biosynthesis by peptide and
polyketide synthetases. Micro. and Molec. Biol. Rev. , 63: 266-92.

Binder, 8., Walker, J., Gagne, J., Emborg, T., Hemmann, G., Bleecker, A., et
al. (2007). The Arabidopsis EIN3 binding F-Box proteins EBF1 and EBF2 have
distinct but overlapping roles in ethylene signaling. Plant Cell, 19: 509-23.

Birkett, M., Campbell, 0., Chamberlain, K., Guerrieri, E., Hick, A., Martin, J.,
et al. (2000). New roles for cis-jasmone as an insect semiochemical and in plant
defense. Proc. Natl. Acad. Sci U. S.A. , 97: 9329-9334.

Boter, M., Ruiz-Rivera, O., Abdeen, A., 8: Prat, S. (2004). Conserved MYC
transcription factors play a key role in jasmonate signaling both in tomato and
Arabidopsis. Genes & Development, 18: 1577-91.

Browse, J. (2005). Jasmonate: an oxylipin signal with many roles in plants.
Vitamins and Hormones , 72: 431-56.

Chao, 0., Rothenberg, M., Solano, R., Roman, G., Terzaghi, W., 8. Ecker, J.
(1997). Activation of the ethylene gas response pathway in Arabidopsis by the
nuclear protein ETHYLENE-INSENSITIVE3 and related proteins. Cell, 89: 1133-
44.

Cheong, J.-J., 8. Choi, Y. (2003). Methyl jasmonate as a vital substance in
plants. Trends in Genetics, 19: 409-13.

Chew, E.-H., 8. Hagen, T. (2007). Substrate-mediated regulation of cullin
neddylation. J. Biol. Chem, 282: 17032—40.

Conconi, A., Smerdon, M., Howe, G., 8: Ryan, C. (1996). The octadecanoid
signalling pathway in plants mediates a response to ultraviolet radiation. Nature,
383: 826-9.

Cui, J., Bahrami, A., Pringle, E., Hernandez-Guzman, G., Bender, C., Pierce,
N., et al. (2005). Pseudomonas syringae manipulates systemic plant defenses
against pathogens and herbivores. Proc. Natl. Acad. Sci USA. , 102: 1791-6.

Dabrowska, P., 8: Boland, W. (2007). lso-OPDA: an early precursor of cis-
jasmone in plants? Chembiochem : European Chemical Biology, 8: 2281-5.

27

Devoto, A., Ellis, C., Magusin, A., Chang, H.-S., Chilcott, C., Zhu, T., et al.
(2005). Expression profiling reveals COI1 to be a key regulator of genes involved
in wound- and methyl jasmonate-induced secondary metabolism, defence, and
hormone interactions. Plant Molecular Biology 58: 497-513.

Devoto, A., Nieto-Rostro, M., Xie, D., Ellis, 0., Harmston, R., Patrick, E., et
al. (2002). COI1 links jasmonate signalling and fertility to the SCF ubiquitin-ligase
complex in Arabidopsis. Plant J. 32: 457-66.

Dharmasiri, N., Dharmasiri, S., & Estelle, M. (2005). The F-box protein TIR1 is
an auxin receptor. Nature 435: 441-5.

Dharmasiri, N., Dharmasiri, S., Weijers, D., Lechner, E., Yamada, M., Hobbie,
L., et al. (2005). Plant development is regulated by a family of auxin receptor F
box proteins. Developmental Cell 9: 109-19.

Dill, A., Thomas, S., Hu, J., Steber, C., & Sun, T.-p. (2004). The Arabidopsis F-
box protein SLEEPY1 targets gibberellin signaling repressors for gibberellin-
induced degradation. Plant Cell 16: 1392-405.

Etheridge, N., Chen, Y.-F., & Schaller, G. (2005). Dissecting the ethylene
pathway of Arabidopsis. Briefings in Functional Genomics & Proteomics 3: 372-
81.

Farmer, E., 8. Ryan, C. (1990). lnterplant communication: airborne methyl
jasmonate induces synthesis of proteinase inhibitors in plant leaves. Proc. Natl.
Acad. Sci U. SA. 87: 7713-6.

Feng, S., Ma, L., Wang, X., Xie, D., Dinesh-Kumar, 8., Wei, N., et al. (2003).
The COP9 signalosome interacts physically with SCF COI1 and modulates
jasmonate responses. Plant Cell 15: 1083-94.

Fu, X., Richards, D., Fleck, B., Xie, D., Burton, N., & Harberd, N. (2004). The
Arabidopsis mutant sleepylgar2-1 protein promotes plant growth by increasing
the affinity of the SCFSLY1 E3 ubiquitin ligase for DELLA protein substrates.
Plant Cell 16: 1406-18.

Gagne, J., Downes, 3., Shin, S.-H., Durski, A., & Vierstra, R. (2002). The F-
box subunit of the SCF E3 complex is encoded by a diverse superfamily of genes
in Arabidopsis. Proc. Natl. Acad. Sci USA. 99: 11519-24.

Gagne, J., Smalle, J., Gingerich, D., Walker, J., Yoo, S.-D., Yanagisawa, S.,
et al. (2004). Arabidopsis EIN3-binding F-box 1 and 2 form ubiquitin-protein
ligases that repress ethylene action and promote growth by directing EIN3
degradation. Proc. Natl. Acad. Sci USA. 101: 6803-8.

Gidda, S., Miersch, O., Levitin, A., Schmidt, J., Wasternack, C., 8. Varin, L.
(2003). Biochemical and molecular characterization of a hydroxyjasmonate
sulfotransferase from Arabidopsis thaliana. J. Biol. Chem. 278: 17895-900.

28

Gomi, K., Sasaki, A., ltoh, H., Ueguchi-Tanaka, M., Ashikari, M., Kitano, H.,
et al. (2004). GID2, an F-box subunit of the SCF E3 complex, specifically
interacts with phosphorylated SLR1 protein and regulates the gibberellin-
dependent degradation of SLR1 in rice. Plant J. 37: 626-34.

Gundlach, H., Miiller, M., Kutchan, T., 8 Zenk, M. (1992). Jasmonic acid is a
signal transducer in elicitor-induced plant cell cultures. Proc. Natl. Acad. Sci
USA. 89: 2389-93.

Guo, H., 8 Ecker, J. (2003). Plant responses to ethylene gas are mediated by
SCF(EBF1/EBF2)-dependent proteolysis of EIN3 transcription factor. Cell 115:
667-77.

Hause, B., Stenzel, I., Miersch, 0., Maucher, H., Kramell, R., Ziegler, J., et al.
(2000). Tissue-specific oxylipin signature of tomato flowers: allene oxide cyclase
is highly expressed in distinct flower organs and vascular bundles. Plant J. 24,

1 13-26.

He, P., Chintamanani, S., Chen, Z., Zhu, L., Kunkel, B., Alfano, J., et al.
(2004). Activation of a COI1-dependent pathway in Arabidopsis by Pseudomonas
syringae type III effectors and coronatine. Plant J. 37: 589-602.

Howe, G., 8 Jander, G. (2008). Plant immunity to insect herbivores. Ann. Rev.
Plant Biol. 59: 41-66.

Howe, G., 8 Schilmiller, A. (2002). Oxylipin metabolism in response to stress.
Current Opinion in Plant Biology 5: 230-6.

Hua, J., 8 Meyerowitz, E. (1998). Ethylene responses are negatively regulated
by a receptor gene family in Arabidopsis thaliana. Cell 94: 261-71.

Hyun, Y., Choi, S., Hwang, H.-J., Yu, J., Nam, S.-J., Ko, J., et al. (2008).
Cooperation and functional diversification of two closely related galactolipase
genes for jasmonate biosynthesis. Developmental Cell 14: 183-92.

lshiguro, 8., Kawai-Oda, A., Ueda, J., Nishida, I., 8 Okada, K. (2001). The
DEFECTIVE IN ANTHER DEHISCIENCE gene encodes a novel phospholipase
A1 catalyzing the initial step of jasmonic acid biosynthesis, which synchronizes
pollen maturation, anther dehiscence, and flower opening in Arabidopsis. Plant
Cell 13: 2191-209.

Ito, T., Ng, K.-H., Lim, T.-S., Yu, H., 8 Meyerowitz, E. (2007). The homeotic
protein AGAMOUS controls late stamen development by regulating a jasmonate
biosynthetic gene in Arabidopsis. Plant Cell 19: 3516-29.

Kang, J.-H., Wang, L., Giri, A., 8 Baldwin, I. (2006). Silencing threonine
deaminase and JAR4 in Nicotiana attenuata impairs jasmonic acid-isoleucine-
mediated defenses against Plant Cell 18: 3303-20.

29

Kepinski, S., 8 Leyser, O. (2005). The Arabidopsis F-box protein TIR1 is an
auxin receptor. Nature 435: 446-51.

Kieber, J., Rothenberg, M., Roman, G., Feldmann, K., 8 Ecker, J. (1993).
CTR1, a negative regulator of the ethylene response pathway in Arabidopsis,
encodes a member of the raf family of protein kinases. Cell 72: 427-41.

Kloek, A., Verbsky, M., Sharma, 8., Schoelz, J., Vogel, J., Klessig, D., et al.
(2001). Resistance to Pseudomonas syringae conferred by an Arabidopsis
thaliana coronatine-insensitive (coi1) mutation occurs through two distinct
mechanisms. Plant J. 26: 509-22.

Kobe, B., 8 Kajava, A. (2001). The leucine-rich repeat as a protein recognition
motif. Curr. Opin. in Struct. Biol. 11 : 725-32.

Koo, A., Chung, H., Kobayashi, Y., 8 Howe, G. (2006). Identification of a
peroxisomal acyl-activating enzyme involved in the biosynthesis of jasmonic acid
in Arabidopsis. J. Biol. Chem. 281: 33511-20.

Kramell, R., Atzorn, R., Schneider, G., Miersch, 0., Bruckner, C., Schmidt,
J., et al. (1995). OCCURRENCE AND IDENTIFICATION OF JASMONIC ACID
AND ITS AMINO-ACID CONJUGATES INDUCED BY OSMOTlC-STRESS lN
BARLEY LEAF TISSUE. J. Plant Growth Reg. 14: 29-36.

Kramell, R., Miersch, 0., Atzorn, R., Parthier, B., 8 Wasternack, C. (2000).
Octadecanoid-derived alteration of gene expression and the "oxylipin signature"
in stressed barley leaves. Implications for different signaling pathways. Plant
Physiol. 123: 177-88.

Kramell, R., Miersch, o., Hause, 8., Ortel, 3., Parthier, 3., a. Wasternack, c.
(1997). Amino acid conjugates of jasmonic acid induce jasmonate-responsive
gene expression in barley (Hordeum vulgare L.) leaves. FEBS letters 414: 197-
202.

Lechner, E., Achard, P., Vansiri, A., Potuschak, T., 8 Genschik, P. (2006). F-
box proteins everywhere. Curr. Opin. in Plant Biol. 9: 631-8.

Li, C., Liu, G., Xu, C., Lee, G., Bauer, P., Ling, H.-Q., et al. (2003). The tomato
suppressor of prosystemin-mediated responses2 gene encodes a fatty acid
desaturase required for the biosynthesis of jasmonic acid and the production of a
systemic wound signal for defense gene expression. Plant Cell 15: 1646-61.

Li, L., Zhao, Y., McCaig, B., Wingerd, B., Wang, J., Whalon, M., et al. (2004).
The tomato homolog of CORONATINE-INSENSITIVE1 is required for the
maternal control of seed maturation, jasmonate-signaled defense responses, and
glandular trichome development. Plant Cell 16: 126-43.

30

Lorenzo, 0., Chico, J., Sénchez-Serrano, J., 8 Solano, R. (2004).
JASMONATE-INSENSITIVE1 encodes a MYC transcription factor essential to
discriminate between different jasmonate-regulated defense responses in
Arabidopsis. Plant Cell 16: 1938-50.

Mandaokar, A., Kumar, V., Amway, M., 8 Browse, J. (2003). Microarray and
differential display identify genes involved in jasmonate-dependent anther
development. Plant Mol. Biology 52: 775-86.

Mandaokar, A., Thines, 8., Shin, B., Lange, B., Choi, G., Koo, Y., et al.
(2006). Transcriptional regulators of stamen development in Arabidopsis
identified by transcriptional profiling. The Plant Journal 46: 984-1008.

McConn, M., 8 Browse, J. (1996). The critical requirement for linolenic acid is
pollen development, not photosynthesis, in an Arabidopsis mutant. Plant Cell 8:
403-416.

McConn, M., Creelman, R., Bell, E., Mullet, J., 8 Browse, J. (1997).
Jasmonate is essential for insect defense in Arabidopsis. Proc. Natl. Acad. Sci
USA. 94: 5473-7.

McGinnis, K., Thomas, 8., Soule, J., Strader, L., Zale, J., Sun, T.-p., et al.
(2003). The Arabidopsis SLEEPY1 gene encodes a putative F-box subunit of an
SCF E3 ubiquitin ligase. Plant Cell 15: 1120-30.

McGrath, K., Dombrecht, B., Manners, J., Schenk, P., Edgar, C., Maclean, D.,
et al. (2005). Repressor- and activator-type ethylene response factors
functioning in jasmonate signaling and disease resistance identified via a
genome-wide screen of Arabidopsis transcription factor gene expression. Plant
Physio/09y 139: 949-59.

Melotto, M., Underwood, W., Koczan, J., Nomura, K., 8 He, S. (2006). Plant
stomata function in innate immunity against bacterial invasion. Cell 126: 969-80.

Meyer, R., Rautenbach, G., 8 Dubery, l. (2003). Identification and quantification
of methyl jasmonate in leaf volatiles of Arabidopsis thaliana using solid-phase
microextraction in combination with gas chromatography and mass spectrometry.
Phytochem Anal. 4: 155-9.

Miersch, 0., Neumerkel, J., Dippe, M., Stenzel, I., 8 Wasternack, C. (2008).
Hydroxylated jasmonates are commonly occurring metabolites of jasmonic acid
and contribute to a partial switch-off in jasmonate signaling. New Phytologist 177:
1 14-27.

Parchmann, 8., Gundlach, H., 8 Mueller, M. (1997). Induction of 12-oxo-
phytodienoic acid in wounded plants and elicited Plant Cell cultures. Plant
Physiol 115: 1057-64.

31

Pickett, J., Birkett, M., Bruce, T., 8 Chamberlain, K. (2007). Developments in
aspects of ecological phytochemistry: The role of cis-jasmone in inducible
defence systems in plants. Phytochemistry 68: 2937-2945

Potuschak, T., Lechner, E., Parmentier, Y., Yanagisawa, 8., Grave, 8.,
Koncz, C., et al. (2003). EIN3-dependent regulation of plant ethylene hormone
signaling by two arabidopsis F box proteins: EBF1 and EBF2. Cell 115: 679-89.

Rao, M., Lee, H., Creelman, R., Mullet, J., 8 Davis, K. (2000). Jasmonic acid
signaling modulates ozone-induced hypersensitive cell death. Plant Cell 12:
1633-46.

Reymond, P., Bodenhausen, N., Van Poecke, R., Krishnamurthy, V., Dicke,
M., 8 Farmer, E. (2004). A conserved transcript pattern in response to a
specialist and a generalist herbivore. Plant Cell 16: 3132-47.

Schaller, F., Biesgen, C., Mtissig, C., Altmann, T., 8 Weiler, E. (2000). 12-
Oxophytodienoate reductase 3 (OPR3) is the isoenzyme involved in jasmonate
biosynthesis. Planta 210: 979-84.

Schenk, P., Kazan, K., Wilson, I., Anderson, J., Richmond, T., Somerville, 8.,
et al. (2000). Coordinated plant defense responses in Arabidopsis revealed by
microarray analysis. Proc. Natl. Acad. Sci U. 8A. 97: 11655-60.

Schilmiller, A., Koo, A., 8 Howe, G. (2007). Functional diversification of acyl-
coenzyme A oxidases in jasmonic acid biosynthesis and action. Plant Physiol.
143: 812-24.

Schulman, B., Carrano, A., Jeffrey, P., Bowen, Z., Kinnucan, E., Finnin, M.,
et al. (2000). Insights into SCF ubiquitin ligases from the structure of the Skp1-
Skp2 complex. Nature 408: 381-6.

Schwechheimer, C. (2008). Understanding gibberellic acid signaling—are we
there yet? Curr. Opin. Plant Biol. 11: 9-15.

Schwechheimer, C., Serino, G., Callis, J., Crosby, W., Lyapina, 8., Deshaies,
R., et al. (2001). Interactions of the COP9 signalosome with the E3 ubiquitin
ligase SCFTIRI in mediating auxin response. Science 292: 1379-82.

Sembdner, G., Atzorn, R., 8 Schneider, G. (1994). Plant hormone conjugation.
Plant Mol. Biology 26: 1459-81.

Seo, H., Song, J., Cheong, J., Lee, Y., Lee, Y., Hwang, I., et al. (2001).
Jasmonic acid carboxyl methyltransferase: a key enzyme for jasmonate-
regulated plant responses. Proc. Natl. Acad. Sci U. SA. 98: 4788-93.

Serino, G., 8 Deng, X.-W. (2003). The COP9 signalosome: regulating plant
development through the control of proteolysis. Ann. Rev. Plant Biol. 54: 165-82.

32

Staswick, P. (2008) JAZing up jasmonate signaling. Trends in Plant Science 13:
66-71.

Staswick, P., 8 Tiryaki, l. (2004). The oxylipin signal jasmonic acid is activated
by an enzyme that conjugates it to isoleucine in Arabidopsis. Plant Cell 16: 2117-
27.

Staswick, P., Tiryaki, l., 8 Rowe, M. (2002). Jasmonate response locus JAR1
and several related Arabidopsis genes encode enzymes of the firefly luciferase
superfamily that show activity on jasmonic, salicylic, and indole-3-acetic acids in
an assay for adenylation. Plant Cell 14: 1405-15.

Staswick, P., Yuen, G., 8 Lehman, C. (1998). Jasmonate signaling mutants of
Arabidopsis are susceptible to the soil fungus Pythium irregulare. Plant J. 15:
747-54.

Stelmach, B., Miiller, A., Hennig, P., Gebhardt, 8., Schubert-Zsilavecz, M., 8
Weiler, E. (2001). A novel class of oxylipins, sn1-O-(12-oxophytodienoyI)-sn2-O-
(hexadecatrienoyI)-monogalactosyl Diglyceride, from Arabidopsis thaliana. J.
Biol. Chem. 276: 12832-8.

Stintzi, A., Weber, H., Reymond, P., Browse, J., 8 Farmer, E. (2001). Plant
defense in the absence of jasmonic acid: the role of cyclopentenones. Proc. Natl.
Acad. Sci USA. 98: 12837-42.

Stuhlfelder, C., Mueller, M., 8 Warzecha, H. (2004). Cloning and expression of
a tomato cDNA encoding a methyl jasmonate cleaving esterase. FEBS 271:
2976-83.

Swiatek, A., Van Dongen, W., Esmans, E., 8 Van Onckelen, H. (2004).
Metabolic fate of jasmonates in tobacco bright yellow-2 cells. Plant Physiology
135: 161-72.

Taki, N., Sasaki-Sekimoto, Y., Obayashi, T., Kikuta, A., Kobayashi, K., Ainai,
T., et al. (2005). 12-oxo-phytodienoic acid triggers expression of a distinct set of
genes and plays a role in wound-induced gene expression in Arabidopsis. Plant

Physiol. 139: 1268-83.

Tan, X., Calderon-Villalobos, L., Sharon, M., Zheng, C., Robinson, C.,
Estelle, M., et al. (2007). Mechanism of auxin perception by the TIR1 ubiquitin
ligase. Nature 446: 640-5.

Theodoulou, F., Job, K., Slocombe, 8., Footitt, 8., Holdsworth, M., Baker, A.,
et al. (2005). Jasmonic acid levels are reduced in COMATOSE ATP-binding
cassette transporter mutants. Implications for transport of jasmonate precursors
into peroxisomes. Plant Physiol. 137: 835—40.

33

Thines, B., Katsir, L., Melotto, M., Niu, Y., Mandaokar, A., Liu, G., et al.
(2007). JAZ repressor proteins are targets of the SCF(COI1) complex during
jasmonate signalling. Nature 448: 661-5.

Ueguchi-Tanaka, M., Ashikari, M. Nakajima, M., 8 Matsuoka, M. (2006).
[Gid1 encodes a soluble receptor for gibberellin] Tanpakushitsu kakusan koso
Protein, nucleic acid, enzyme 51: 2312- 20.

Uppalapati, 8., Ayoubi, P., Weng, H., Palmer, D., Mitchell, R., Jones, W., et
al. (2005). The phytotoxin coronatine and methyl jasmonate impact multiple
phytohormone pathways in tomato. Plant J. 42: 201-17.

Uppalapati, 8., Ishiga, Y., Wangdi, T., Kunkel, B., Anand, A., Mysore, K., et
al. (2007). The phytotoxin coronatine contributes to pathogen fitness and is
required for suppression of salicylic acid accumulation in tomato inoculated with
Pseudomonas syringae pv. tomato DC3000. MPMI 20: 955-65.

van der Fits, L., 8 Memelink, J. (2001). The jasmonate-inducible AP2/ERF-
domain transcription factor ORCA3 activates gene expression via interaction with
a jasmonate-responsive promoter element. Plant J. 25: 43—53.

Vick, 3., 8 Zimmerman, D. (1984). Biosynthesis of Jasmonic Acid by Several
Plant Species. Plant Physiol. 75: 458-461.

Weiler, E., Kutchan, T., Gorba, T., Brodschelm, W., Niesel, U., 8 Bublitz, F.
(1994). The Pseudomonas phytotoxin coronatine mimics octadecanoid signalling
molecules of higher plants. FEBS letters 345: 9-13.

Willige, B., Ghosh, S., Nill, C., Zourelidou, M., Dohmann, E., Maier, A., et al.
(2007). The DELLA domain of GA INSENSITIVE mediates the interaction with
the GA INSENSITIVE DWARF1A gibberellin receptor of Arabidopsis. Plant Cell
19: 1209-20.

Xie, D., Feys, B., James, 8., Nieto-Rostro, M., 8 Turner, J. (1998). COI1: an
Arabidopsis gene required for jasmonate-regulated defense and fertility. Science
280: 1091-4.

Xu, L., Liu, F., Lechner, E., Genschik, P., Crosby, W., Ma, H., et al. (2002).
The SCF(COI1) ubiquitin-ligase complexes are required for jasmonate response
in Arabidopsis. Plant Cell 14: 1919-35.

Yadav, V., Mallappa, C., Gangappa, 8., Bhatia, 8., 8 Chattopadhyay, S.
(2005). A basic helix-loop—helix transcription factor in Arabidopsis, MYC2, acts as
a repressor of blue light-mediated photomorphogenic growth. Plant Cell 17:
1953-66.

Zhao, Y., Thilmony, R., Bender, C., Schaller, A., He, 8., 8 Howe, G. (2003).
Virulence systems of Pseudomonas syringae pv. tomato promote bacterial speck

34

disease in tomato by targeting the jasmonate signaling pathway. Plant J. , 36:
485-99.

35

Chapter 2
Characterization of JA-lle mediated COI1-JAZ binding1

 

1 Part of this work has been published in Thines, B., Katsir, L., Melotto, M., Niu, Y., Mandaokar,
A., LIu, G., et al. (2007). JAZ repressor proteins are targets of the SCF(COI1) complex during
jasmonate signalling. Nature, 448: 661-5. Yeast-two hybrid assays were carried out by Maeli
Melotto.

36

Abstract

Jasmonate and related signaling compounds regulate a broad range of plant
defense responses, as well as growth and development in plants. However the
molecular mechanism of jasmonate perception is poorly understood. Recently,
members of the jasmonate ZlM-domain (JAZ) protein family were identified as
key regulators of jasmonate signaling. Jasmonate treatment causes JAZ

degradation that is dependent on the activity of the SCFCOI1

ubiquitin ligase and
the 268 proteasome. Recombinant tomato JAZ protein is used to test the
interaction between COI1 and JAZ in an in vitro pull-down assay. The
jasmonoyl—isoleucine (JA—lle) conjugate, but not jasmonic acid, 12-oxo-
phytodienoic acid, or methyl-jasmonate, promotes a physical interaction between
COI1 and JAZ1 in the absence of other plant proteins. Our results implicate the
COI1—JAZ1 protein complex as the site of JA-lle perception and establish that

JA-lle enables the SCFCOI1 ubiquitin ligase complex to bind to and subsequently

degrade the JAZ1 repressor protein.

37

Introduction

The synthesis and perception of jasmonic acid, and its bioactive
derivatives jasmonates (JAs). is a fundamental component of the biology of
higher plants. JAs are regulators of plant growth, reproductive development, and
are an integral part of a plants ability to detect and respond to biotic and abiotic
challenges (Wasternack 2007, Browse 2005). The JA biosynthetic pathway has
been well characterized largely due to the discovery of mutants unable to
complete the synthesis of JA. Much of our knowledge concerning JA responses
is derived from monitoring transcriptional and physiological changes induced by
wounding/herbivory or through exogenous application of JA (Devoto et al. 2005,
Mandoakar et al. 2003, Schenk et al. 2000). Such studies have enhanced our
broader understanding of how JA responses act to partition plant resources away
from growth and towards defense (Howe an Jander 2008). The mechanism by
which the JA signal is relayed to produce transcriptional changes is unknown, as
a receptor has not been identified. Complicating the search for such a receptor is
the diverse array of JAs identified and the in planta enzymatic conversions that
can obscure the results of hormone application experiments, which confounds

efforts to understand, which JAs are active ligands for a receptor.

Characterization of the Arabidopsis jar1 mutant, which is defective in the
perception of JA/Me-JA but responsive to the JA isoleucine conjugate jasmonyl

isoleucine (JA-Ile), suggests a central role for JA amino acid conjugates in this

38

signaling pathway (Staswick et al. 2002, Staswick et al. 2004). In Arabidopsis,
the enzyme JAR1 catalyzes the ATP—dependent adenylation of JA and the
subsequent formation of an iso-peptide bond between JA’s free carboxyl group
and the a—amino of most amino acids (Staswick et al. 2004). Though, JAR1 is
highly specific for JA and lle, it is only partially responsible for the production of
JA-lle, as residual JA-lle remains in the jar1 mutant. The importance of JA-lle
synthesis to the defense response is reflected in the defects associated with jer1
plants susceptibility to the pathogens Pythium imegulere and Pseudomonas
syringae (Staswick et al. 1998, Laurie-Berry et al. 2006). JA-conjugate production
has also been demonstrated to be a key element in the Nicotiana attenuate
defense response because silencing of a N. attenuate JAR1 homolog, JAR4,
impairs herbivore resistance (Kang et al. 2006). Still jer1 plants are only partially
insensitive to JA, and do not share the reproductive defects associated with a
block in JA signaling as in coi1 or OPR3. Because of residual JA-lle in jer1 plants
it is unclear if the remaining JA responses in the mutant are due to the
conjugating activity of a redundant enzyme or because other JAs such as

jasmonic acid have a distinct activity.

Several lines of evidence indicate that the F-box protein COI1 has a central role
in the perception of JA. coi1 mutants in Arabidopsis and tomato (iai1) are
unresponsive to JA, are susceptible to a broad range of insect herbivores and
fungal pathogens, and have reproductive defects similar to JA biosynthetic
mutants (Xie et el 1998, Devoto et al. 2002, Li et al. 2004, Adie et al. 2007).

Yeast two-hybrid interaction assays demonstrated that COI1 assembles into an

39

SCF (Skp, Cullin, F-box) complex, SCFCO”, suggesting that post-translational
control by degradation is involved in JA signaling (Devoto et al. 2002, Xu et al.
2002). Furthermore, COI1 shares 34% amino acid identity with the auxin receptor
TIR1 (Dharmisiri et al. 2005, Kepinski et al. 2005). Auxin induced responses are
controlled by TIR1-mediated degradation of Aux/IAA proteins which act as
repressors of auxin signaling (Gray et al. 2002). Auxin mediates TIR1 binding of
Aux/IAA by acting as a “molecular glue” to facilitate the interaction between these
two proteins (Tan et al. 2008). TIR1-bound Aux/lAA is then presumably
ubiquitylated and targeted for degradation by the 268 proteasome pathway.

COI1 has been proposed to act similarly to regulate JA signaling (Dharmasiri et

al. 2005).

JAZ proteins are transcriptional repressors of JA signaling and were
recently identified as substrates for SCFCOI1 (Chini et al. 2007, Thines et al.
2007). JAZ transcripts rapidly accumulate in response to JA treatment. Rapid
expression of these genes suggests that JAZ proteins may negatively regulate
their own transcription (Thines et al. 2007). The repressive action of JAZ proteins
appears to result from interaction with transcriptional activators. This idea is
based on the finding that Arabidopsis JAZ3 (also known as JAI3) interacts with
and presumably represses the activity of the transcription factor MCY2 (also

known as JIN1) (Chini et al. 2007).

JAZ proteins from all plants show overall sequence similarity and possess
two signature motifs. JAZs contain the highly conserved TlF[F/Y]XG sequence

located within a so-called ZlM domain making them members of the larger family

40

of TIFY proteins (Vanholme et al. 2007). The TIFY family includes the PEAPOD
(PPD) proteins that regulate leaf development (White et al. 2006), as well as ZIM
and ZIM-like proteins that other members contain zinc-finger DNA binding
domains (Shikata et al. 2003). Although some JAZs are known to be located in
the nucleus they do not contain a known DNA binding domain (Chini et al. 2007,
Thines et al. 2007). A distinguishing feature of JAZs is the C-terminal sequence
SLXzszKszRstY, known as the Jas motif (Chini et al. 2007, Thines et al.
2007). The C-terminal truncated forms of JAZ1 and JAZ3 lack the Jas motif, do
not interact with COI1, and strongly repress the JA response in a manner

reminiscent of coi1 (Chini et al. 2007, Thines et al. 2007).

In this study, we identified tomato homologs of JAZ transcriptional
repressors. The inducible expression of these genes is similar to that observed in
Arabidopsis and other plants. We have developed an in vitro pull-down assay to
investigate the mechanism of JA-induced COI1-mediated degradation of JAZ
repressor proteins. We present evidence that COI1 directly binds JAZ and that
this interaction is dependent on the presence of JA-lle. Our results support the

conclusion that a COI1-JAZ complex is the site of JA perception in plants.

41

Materials and Methods

Plant Material, Growth Conditions, and Isolation of jai1-1

Tomato (Lycopersicon esculentum) cv Micro-Tom was used as the "wild type"
(WT) for all experiments except in the Northern blot analysis, in which cv
Castlemart was used as the wild type. Homozygous jai1-1 seedlings were
selected from F2 populations as described previously (Li et al. 2004). Plants were
grown in Jiffy peat pots (Hummert International, Earth City, MO) and maintained

in growth chambers under 17 h of light (300 IE rn'2 s") at 28°C.
Blast and Phylogenetic Tree

Arabidopsis and tomato JAZ sequences were aligned with CLUSTALX
(Thompson et al. 1997). A phylogenetic tree was constructed with the Neighbor
Joining (NJ) method using MEGA 4 software (Molecular Evolutionary Genetics

Analysis) available at httpzllwww.megasoftware.net/index.html.

Northern Blot Analysis

Three-week old wild type (WT) and jei1 tomato plants were subjected to
mechanical wounding by crushing the leaf twice across the midrib with a
hemostat. For each time point leaf, tissue from a set of three plants was
harvested and pooled. cDNA probes were made by using SP6 (5’-
ATTTAGGTGACACTATAG-3’) and T7 (5’-TAATACGACTCACTATAGGG—3’)

primers to amplify the cDNA of tomato JAZ EST clones cLEC66E8 (SIJAZ1),

42

cLED-30-L12 (SGN-U319732), cLEC-15-K4 (SIJAZ3), cTOD-21-l17 (SGN-
U320368 ), cLEX-12-K20 (SGN-U327035), and TUS-19—D7(SGN-U315857). EST
clone cLED1DZ4 was used to make a cDNA probe to eiF4e, which was used as
a loading control. RNA extraction and gel-blot analyses were performed as

described previously (Li et al. 2002).
Construction of 35S:COI1-Myc transgenic tomato plants

The full-length tomato COI1 cDNA (Li et al. 2004) was amplified by PCR with the
primer set of 5’-CGGGATCCCTCTCCTCCATCTTCAA—3’ and 5'-
CCCTCGAGCTTCAGCGAGAAGGTAAGTTG-3’, and the resulting product was
digested with BamHI and Xhol. The 6x Myc cassette in vector pGEM-72f was
obtained from the Arabidopsis Biological Resource Center (ABRC) as stock CD3-
128. An Xhol-Sacl restriction fragment from this vector was used to generate a
6x-c-Myc tag at the C-terminal end of COI1. The COI1-containing BamHl-Xhol
fragment and c-Myc-conteining Xhol-Sacl fragment were simultaneously ligated
to binary vector pBl121 (Clontech) that was pre-digested with BamHI and Sacl.
Expression of chimeric COI1-Myc gene in the resulting plasmid (pBl-COI1-Myc)

is under the control of the Cauliflower mosaic virus 358 promoter.

pBI-CO/1-Myc was introduced into Agrobacten’um tumefeciens strain
AGLO and subsequently transformed into the jei1-1 mutant (cv Micro-Tom) as
described previously (Li et al. 2004). A primary transformed line (TO-03) that
tested positive for the 35S:COI1-Myc transgene and exhibited seed set was

chosen for further analysis. Restoration of seed production in this line indicated

43

that 35S:COl1-Myc complements the female sterile defect of jai1-1 plants (Li et
al. 2004). A T1 line that is homozygous for 35S:COl1-Myc was identified by
analysis of progeny in the T2 generation. Seed from T3 plants of this line was

bulked for use in pull-down assays.
Cloning and expression of tomato JAZ1-His

A cDNA for tomato JAZ1 (SIJAZ1) was PCR-amplified from an EST clone
(cLE066E8) obtained from the Solanaceae Genomics Network (Cornell
University). The primer set used was 5’-
GCGCGGCCGCCGGGTCATCGGAAAATATGGA'I‘I'CC-3’ and 5’-
CCCTCGAGAGCACCTAATCCCAACCATGC-3’ The 0.8 kb PCR product was
digested with Notl and Xhol and cloned into the Notl and Xhol restriction sites of
the high-copy expression plasmid pLW01 that was modified by addition of the
maltose binding protein (MBP). This derivative of pLW01 was provided by Dr.
Michael Garavito (Michigan State University). The final construct for SIJAZ1
expression encodes a fusion protein, referred to as JAZ1-His, in which the N-
and C-terrninal ends of SIJAZ1 are fused to an MBP and 6x-His tag, respectively.
SIJAZ1-His protein was expressed in E. coli strain BL21 DE3 according to the
following procedure. A single E. coli colony was inoculated into 5 mL of LB
medium containing 100 ug/mL ampicillin, and the culture grown overnight at
37°C. A 0.5 mL aliquot of this culture was used to inoculate 250 mL TB medium
containing 100 ug/mL ampicillin. This culture was grown at 37°C to an 00600 of
0.6, at which point isopropyl-thio-B-D-galactopyranoside (Sigma-Aldrich) was

added to final concentration of 0.5 mM. The culture was incubated at 37°C (with

44

shaking at 250 rpm) for an additional 3 hr. Cells were harvested by centrifugation
at 5,000 x g and the cell pellet was frozen at -80°C. Thawed cells were
resuspended in lysis buffer (50 mM sodium phosphate, pH 7.2, 300 mM NaCl, 10
mM imidazole, 1 mM phenylmethyl sulfonyl fluoride) and subsequently disrupted
by sonication carried out in an ice bath. Lysed cells were centrifuged at 11,000 x
g for 10 min and the cleared lysate was applied to a Ni affinity column (Ni-NTA
resin). The column was washed with three column volumes of lysis buffer,
followed by a final wash with lysis buffer containing 25 mM imidazole. JAZI-His
protein was eluted from the column with lysis buffer that contained 250 mM
imidazole. Purified JAZ1-His was dialyzed against 1000 volumes of a solution
containing 50 mM Tris-Cl (pH 7.6) and 100 mM NaCl. The purity of JAZ1-His was

typically >90% as determined by SDS-PAGE and Coomassie Blue staining.
COI1-Myc Pull down Assays

Leaflets from 2- to 3-week-old 358::COl1-Myc tomato plants were ground
to a fine powder in liquid N2. Protein was extracted in homogenization buffer
containing 50 mM Tris-Cl, pH 7.6, 100 mM NaCl, 25 mM imidazole, 10% (v/v)
glycerol, 0.1% (v/v) Tween 20, 20 mM 2-mercaptoethanol, 10 uM MG132, and
the EDTA-free complete miniprotease inhibitor cocktail (Roche). Insoluble debris
was removed by centrifugation at 14,000 x g for 10 min at 4°C. Each pull-down
assay contained ~1 mg total tomato protein and 100 pg recombinant SIJAZ1-His
in a total volume of 300 pl. Reactions were incubated, with gentle rocking, for 30

min at 4°C, or at the indicated temperature, in the absence or presence of

45

various JA derivatives. Following the addition of 80 ul of Ni-NTA Resin (Qiagen),
the reaction was incubated for an additional 15 min at 4°C. Ni-NTA resin was
recovered by centrifugation on a spin column (Biorad) and washed three times
with 250 uL of homogenization buffer. The affinity resin was eluted with 30 uL of
a solution containing 250 mM imidazole. The eluted protein was separated by
SDS-PAGE on e 12% gel, transferred to PVDF membrane, and probed with an
anti-c—Myc antibody (Roche). The amount of COI1-Myc recovered in the absence
of JA-lle varied between experiments, most likely as a result of differences in
endogenous levels of JA-lle or other active compounds in the tomato extract.
Control experiments showed that COI1-Myc was not recovered from pull—down
reactions containing JA-lle but lacking recombinant JAZ1-His or from reactions
containing a maltose-binding-protein-His fusion in place of SIJAZ1-His (data not
shown). (1:)-Jasmonic acid (J2500) and MeJA (392707) were purchased from
Sigma-Aldrich. 12-oxophytodienoic acid (OPDA) was chemiCally synthesized as
previously described (Schilmiller et al. 2007). Jasmonoyl-amino acid conjugates
were kindly provided by Dr. Robert Kramell (Halle, Germany). Conjugates were
synthesized by reaction of (i)-JA with the corresponding L-amino acid, followed

by purification of (-)-JA-L-amino acid isomers by chiral HPLC (Kremel et al. 1997)

Yeast Two-Hybrid Assays

46

SlCOl1 and JAZ1 were cloned into yeast two-hybrid (Y2H) vectors (Clontech)
pGlLDA and pB42AD, respectively. The primer pairs used for cloning were: 5’-
GGAATTCATGGAGGAACGGAACTCAACGAG-3’ and 5’-
GCCCTCGAGCTATTCAGCGAGAAGGTAAGT-3' for SICOI1, and 5’-
'l'l'ACCCGGGCATGGGGTCATCGGAAAATATGGA-3’ and 5’-
TTACCGCGGCTAGAAATATTGCTCAGTTTTAAC-3’ for SIJAZ1. The resulting
constructs were transformed into yeast (Seccheromyces cerevisee) strain
EGY48 (p80pLacz) using the Frozen-EZ yeast transformation ll kit (Zymo
Research). Transforments were selected on SD-glucose medium (BD
Biosciences) supplemented with -Ura/-His/-Trp drop- out solution (BD
Biosciences). To assess the interaction between COI1 and JAZ1 proteins,
transformed yeast strain was plated on SD-galactose/rafinose inducing medium
(BD Biosciences) containing -Ura/-His/-Trp drop out supplement, 80 ug/ml X-
Gal, and one of the following chemicals: 30 uM jesmonoyI-isoleucine, 30 uM JA
(Sigma), 30 uM MeJA (Sigma), 30 pM OPDA (Cayman Chemical Company), or
10% ethanol (the solvent for all chemicals). Plates were incubated for 6 days at
30°C. Yeast two-hybrid (Y2H) control cultures containing the positive control
strain pLexA-53 and the negative control strain pLexA-Lam (Clontech) were also

plated on inducing medium for comparison of the colony color.

47

Results

Identification of JAZ Genes in Tomato

Based on the finding that JA-mediated JAZ turnover in Arabidopsis is

COI1 dependent we sought to identify JAZ genes in tomato to test the hypothesis

that JAZ proteins directly interact with COI1. Full-length Arabidopsis JAZ cDNAs

were used as templates for BLAST searches of the tomato EST library

(www.sgn.cornell.edu). We identified and sequenced 28 EST clones with

sequence similarity to AtJAZ genes. This search yielded several full-length

clones representing seven unique tomato JAZ genes (Table 2.1).

Table 2.1 Tomato JAZ genes

 

 

 

 

 

 

 

 

 

 

 

SGN Unlgene Trivial Name Sequenced EST
us1soao (SIJAZ1) rue-3420, cLEC-66-EB
U319732 n.a. cTOS-14-N20, cLED-30-L12

U312806 (SIJAZ3) cLED-25-A20, cLEC-15-K4
U320368 n.a. cTOD-23-H2‘l, cTOD-21 -I17
U327035 n.a. TUS—27-L22, cLEX-12-K20

U315857 Pto-respgrrigsge gene 1 TUS-19-D7
U317846 M. _

 

* Gen Bank Accession AF146690, n.a. not assigned

48

 

The tomato JAZ proteins possess conserved features including, the TIFYxG
sequence and the canonical Jas motif SLXzFXZKRXZRstY (Fig. 2.1) Deviation
from the conserved TlFYxG motif is found in SGN-U319732 (SlFYxG) and in
SGN-U320368 (TMFYxG) (Fig. 2.1). Phylogenetic comparison of tomato and
Arabidopsis JAZs reveals that the tomato proteins cluster among the AtJAZ
proteins (Fig. 2.2). Tomato JAZs closely related to AtJAZB, AtJAZB, AtJAZ10,
AtJAZ11, or to AtJAZ12 were not identified. The lack of a broader distribution of
JAZ proteins in tomato may be species specific or a reflection of the limitations of
gene identification in the absence of a completed tomato genome. Based on our
phylogenetic analysis and sequence similarities, we assigned SGN-U315030 as
SIJAZ1 and SGN-U312806 as SIJAZ3. SGN-315857 was previously annotated
as Pto responsive gene 1 (Prg1) (T able 2.1). The analysis of tomato JAZ genes
identified through a search of EST libraries must be considered incomplete until

the tomato genome is sequenced.

49

AtJAIl
Ildlll
SCI-0319132
IOU-0320368
IlJIIJ
IOU-0327035
IOU-0315857
SCI-0311666

AtJAll
IlJAI1
SCI-0319732
ION-U320368
I1JAIJ
SCI-0327035
SCI-0315857
OOH-0311666

ItJISl
81J181
SCI-0319132
SCI-0320368
I1JAI3
IOU-0321035
IOU-0315957
SCI-0317866

AtJAll
81JAII
IOU-0319732
SCI-U320368
I1J523
SCI-0321035
SCI-0315951
SCI-0311866

AtJlll
IlJAI1
SCI-0319732
IOU-0320368
81JA23
IOU-0327035
IOU-0315851
OOH-0317666

AtJll1
313121
IOU-0319732
IOU-0320368
I1JAIJ
IOU-0327035
OBI-0315657
IOU-0317966

ltJAll
IlJIIl
IOU-0319732
SCI-0320366
I1JA23
SCI-"327035
IOU-0315657
SCI-0317846

Figure 2.1. Alignment of the 7 tomato JAZ amino acid sequences with AtJAZ1

HhflflflhihhiH

157
153
130
145
166
229
138
122

187
193
151
205
207
297
169
168

216
212
169

265'

264
363
189
175

   
  

---------- unlsllcslr' Irrox s .rc:stouLk-suo:r b0--N
------—-------lossclu xvrcq oICNLLsorLk-x ILOI!
................. nsunqLcsLnss aLMITCNLLSQFFI- Lr---
..... ------uleannnnlouaxars sfivgrcuLLsorxfi- Lo---

NIIDPNOLIIIDSLLVVKDIPVISBKDSGPRHPNSSKVGVPHFISLIS
NIRDPNGLTVKQIVLIIPIDPAPLISSANQNBflzlflvrABPO L rxs
--------- unslulxoruoLuagasttusx nxxvsouxwprsLAoLArusslrr---

-------- ------nssnvo "moms BMW“ -----
ACIPDVIOTLOIIROP! pcansuxos ------------- ---------—----
urrrssrosooflarrrr ssosssssss ----------------------
----xsluasAx---As LsrxrrI-------------------------
----xnoqesanoxrsr srner ---------- - --------------
----TPKAL8 OVDAOLKRQPGELQNKQVLO----—-------------—--------

-----rglxxs xvsxusxnssLun
- - - - -LDNIRIPDIAGIWII

TID'~---~-~--~----o~-----------

LASTOLVTIT AVDCIIIT!SD:T;§EKNLIIQGOTIYITTTPB’IIYDBIINIIBIO
Y

------------------------ -------------------uvuo
------------------------------------------vsrlp IP07
--------------------------------------------- an Inn s---
--------------- ------------------------------nu vogv'rugm
-------------------------------- -----------exrvr asuL
VRVLPLAIPTIQIBVINTNPGIRI'IIPVOQILITTVIOLPOAGALVVI ISA ssxv
----- ----------------- ---- -------- - ---------- grrnorrrLLAs
--------------------------------------------- Lvofisuuarfigeoux

 
 
  
  

88.8SSLPKIDVLKHTQ’TIBVEPBSQ

sxsgsrx --------- Illsuxpngfip no; 1'“
--——AIIRA ------ salxlxvaxsoxLAoLgxFxccxvfivroorp«ska
sxsnavnsp ------ srlxznr -lfiKA-QLT: rxfic u
AGrrthrl ------------ 3 sun? QLTIFYGG

vorrnLnoL------- ..... p
YDIIKIYDI -------------- Lg
Alll--------------------- ' ' '

—
IAIBLAIIQIDIIslrnrxnlgvenpnxrr ..... -------------------------
IPTIIPIYPIIlloxrnnqsovsronxng ..............................
ISIIBCAIFQTPTTTQTIOSI--- ....... ---_-_-,___---_______________

cvgssrcrrgntare:xarcsrarnerslnrnsvnrggongIxroscsnnrgolxlus
-CAPPIVVQPRPQLQASASKPAAADOVCVIQ!PINLPASOLBBPNSVBSIP109800880
vrvrelnrsrLsrvgnrxrxssnrnsrvvxgcuurtrr--LasrtsIrsloengannvsr
rrLunnl1levulxllxsluxsoeslasrl-----—-----------------------
soul----rserssAADLVVpsroxrsxg------- ----------- ------------

------------------------------- rQIpIstprpL: -LPIARRASIIRFLEK

 
  
  
 

IIDDHKHOK!AI---IIVTPIVKLDIIIIVTSLGPVOATTIMTAA
TTUGVTIIKBIG---VLPIPILKAIPIIVTICVOI'PIIoLVPIA

:II—------

  

 

  
  
 

RKDRVTSIAPYO sl ----- lxxsxlsole----NL gutter!

1T nnpyo nl-----------PLQIS rnoonrnL -------
j - _ vnuIrLLrssslruosss “no Li L-----
RKIRV:NL'PY Ls-KKSPICS suovar PLE oxsr ------
'KiRVISASPYPLNIKQSPICS BLOSRIL Eoscvraxstvx--
ax R'IKARPYIYGII---L8KF rnzqggsslrnsssvnwsn -------
axon-r x prints ----- AA allsxnr---uLm mafiavxrsgr

50

 

,_ 97 '
AtJAZ1 0

 

61

 

80 SIJAZ1
52 SGN-U317846
AtJAZ1

l" 99 AtJAZZ

74 J SGN-U319732
‘——‘* 98 ! ssN-uszosss
j— AtJAZS
{ AtJAZ"

AtJAZ12

 

 

 

 

 

 

 

 

 

 

 

SGN-U315857

 

AtJAZ9
SGN-U327035
SIJAZ3
AtJAZ3
AtJAZ4
J AtJAZ7

 

 

 

 

 

 

 

0.1

51

Figure 2.2. Phlylogenetic analysis of Arabidopsis and tomato JAZ proteins.

A phylogenetic tree of twelve Arabidopsis JAZ proteins and seven tomato JAZ
proteins was constructed with the Neighbor Joining (NJ) method using MEGA 4
software (Molecular Evolutionary Genetics Analysis) available at
httpzllwwwmggasoftware.net/index.html. 100,000 neighbor-joining bootstrap
replicates were analyzed to determine branching order. Bootstrap values greater

then 50 are displayed.
Wound responsiveness of tomato JAZ genes

In Arabidopsis, the majority of the 12 JAZ genes are induced rapidly in
response to herbivory and mechanical wounding (Chung et al. 2008). Chini et al
found that most JAZ genes are suppressed in the jei1-3 mutant and in mch,
indicating that a functional JA pathway is required for JA inducible JAZ
expression (Chini et al. 2007). We used northern blot analysis to detect changes
in transcript accumulation of six tomato JAZ genes after mechanical wounding
(Fig. 2.3). We detected SlJAZ1 and SGN-U327035 transcript accumulation
above unwounded levels after 15 minutes and after 30 minutes, these genes, as
well as SGN-U315857, were highly expressed. Mechanical wounding also led to
an increase in the transcript of SGN-U319732 and SGN-U320368, which were
weakly detectable after 60 minutes. SlJAZ3 was not induced early rather

transcript initially decreased at 30 minutes and then began to accumulate above

52

unwounded levels at 60 and 120 minutes after mechanical wounding. We
monitored the effects of wounding on JAZ transcript accumulation in jai1-1 plants
to determine whether a functional JA signaling pathway is required for JAZ gene
induction in tomato (Fig. 2.3). For the six tomato JAZ transcripts tested, none
accumulated to appreciable levels after wounding in jei1-1. These results
demonstrate that wound inducible expression of the tomato JAZ genes is largely
dependent on COI1 as previously reported for Arabidopsis JAZ genes (Chung et

al. 2008).

53

Figure 2.3. Effect of the jei1-1 mutation on JAZ gene expression in tomato
Three-week-old wild-type and jei1-1 plants were wounded twice across the
midrib with a hemostat. Damaged leaves were collected for RNA extraction
at the indicated times (min) after wounding. Ten micrograms of total RNA
was loaded in each lane and blots were hybridized to full length probes

for each of the six tomato JAZ genes, as well as eIF4a as a loading control.

54

WT [an

*V—i ...—._.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

min: 0 15 so so 120 o. 15 30 so 120
SIJAZ1

SGN-U319732
sum 7

sen-uazoass

sen-0327035 , ' gig fi sea

SGN-U315857
malaesa eases

 

 

 

 

Figure 2.3. Expression of tomato JAZ genes in response to mechanical

wounding.

55

Generation of a transgenic tomato line expressing epitope-tagged COI1

To facilitate the analysis of potential substrates of COI1, the tomato jai1 mutant
was stably transformed with a 358::COI1-Myc transgene that encoded a c-Myc
tagged COI1 fusion protein, designated. Phenotypic analysis of these lines
showed that the defense marker protein proteinase inhibitor ll (Pl-ll) was
expressed in response to mechanical wounding (Figure 4A), and that fertility had
been restored (data not shown). Complementation of jai1 by the transgene
indicates that COI1 is functional as a fusion with c-Myc. The expression of COI1-
Myc in these lines was confirmed by western blot analysis of protein extract with
the c-Myc antibody (Figure 2.4B). COI1-Myc expression was not detected by
Coomassie staining of total plant protein or in samples enriched for COI1-Myc by
anti-Myc affinity resin (data not shown). These findings suggest that COI1-Myc is

expressed at very low levels in these plants.

Expression and purification of tomato JAZ1

We next sought to prepare purified JAZ protein for use in pull down assays to
test the hypothesis that JAZ interacts physically with COI1. Initial attempts to
express tomato JAZ proteins as a His-tagged or GST-tagged fusion in E. coli
failed to produce sufficient amounts of protein for use in biochemical
experiments. Several other expression vectors were tested, including pB42AD
(Clontech) for expression as a glutathione s-transferase fusion, as well as

pQE30a (Qiagen) and pet24a (Novagen) for expression of 6X-His tagged

56

fusions. Finally, expression of tomato JAZ1 as a fusion with maltose binding
protein (MBP) at the N-terminus and a 6X-His tag at the C-terrninus yielded
sufficient amounts of recombinant proteins. The MBP-JAZ1-His fusion,
designated simply as JAZ1-His, was purified to ~90% homogeneity by Ni-affinity

chromatography (Figure 2.4C ).

57

Figure 2.4. Complementation of the tomato jai1-1 mutant with
35S:COl1-Myc and expression and purification of SIJAZ1-His

A, Three-week-old plants of the indicated genotype were mechanically
wounded on the lower leaves, and the level of proteinase inhibitor ll (PI-II)
in upper unwounded leaves was measured 24 hr later (W; grey). Pl-ll
levels were also measured in a second set of plants treated with vaporous
MeJA (MJ; white). As a control, PI-ll levels were determined in a set of
untreated plants (C; black). Data represent the mean and standard
deviation of at least 3 plants per treatment. B, Crude extracts (50 pg
protein) prepared from leaf tissue of 3-week-old wild-type (WT) and stably
transformed 35S:COI1-Myc (358) plants were separated by SDS-PAGE,
blotted to PVDF membrane, and probed with anti-Myc antibody. The
apparent Mr of the major cross-reacting protein in 35S:COI1-Myc leaves
was in good agreement with the calculated Mr of COI1-Myc (approximately
78,000). C, A Coomassie Blue stained gel shows the purity of 10 pg of

SlJAZ-His, as determined by SDS-PAGE gel (12% gel) .

58

 

 

 

 

 

 

 

 

 

 

 

A.
1.; 200- J.
.9.
.2 J.
“g 150 <
5, 100 .
3
E 50
0- _.l._
c WMJ c WMJ c WMJ
wr jei1-1 35S::COI1-m
3 WT T c
—92 kDa
_ 6-COI1-m
‘ ~50 kDa

 

 

 

 

 

Figure 2.4. Complementation of the tomato jai1-1 mutant with 358:COI1-Myc

and expression and purification of SIJAZ1-His

59

COI1-JAZ1 interaction assay

To determine whether COI1 and JAZ proteins interact in vitro, we took advantage
of the 358::COl1-Myc transgenic line of tomato that expresses a c-Myc-tagged
SICOI1 (COI1-Myc). We conducted in vitro pull-down assays in which protein
extracts prepared from 35S:COl1-Myc leaves were incubated with recombinant
JAZ1-His in the presence of 5 uM MeJA or JA-lle. JAZ1-His was recovered by Ni
affinity chromatography and the presence of COI1-Myc was assessed by western
blot analysis. COI1-Myc was recovered from pull-down reactions containing JA-
lle but not from reactions supplemented with MeJA or mock control (Figure 2.5A).
The identity of this interacting protein as COI1-Myc was confirmed by its co-
migration with COI1-Myc in leaf crude extracts, as well as the absence of this
band in control reactions containing protein extracts from wild-type leaves (not
shown). JA-lle promoted the COI1-JAZ1 interaction in a dose-dependent
manner (Figure 2.5B) with the stimulatory effect apparent at concentrations as
low as 50 nM JA-lle. To address the specificity of JA-Ile in promoting the COI1-
JAZ interaction, a variety of small molecules were tested. The plant hormones
auxin, gibberelin, and SA, when added at concentrations of 50 11M, did not
promote the recovery of COI1-Myc in this assay (Fig. 2.6A). MeJA, 12-oxo-
phytodienoic acid (OPDA), JA-Phe, and JA-Trp also failed to promote the COI1-
JAZ1 interaction at concentrations as high as 25 11M. JA-Leu stimulated recovery
of COI1-Myc, although its activity was approximately 50 fold less than that of JA-

lle (Fig. 2.63).

60

A Pull-down assay
Crude Mock MeJA lA-Ile

 

 

it

COI1-Myc £1 a

 

 

nM IA-lle: 0 S 50 500 5000

 

COIl-Myc _ W

 

 

 

lAZl-His

 

 

 

Figure 2.5. In vitro interaction between tomato COI1 and JAZ1 is promoted by
JA-lle.

Pull-down assays used recombinant SIJAZ1-His and extracts from 358::COI1-
Myc plants. A, Reactions were supplemented with 5 uM MeJA, JA-lle, or a
control (mock) and incubated for 30 min at 4°C. Protein bound to JAZ1-His was
analyzed by immunoblotting for the presence of COI1-Myc. Leaf extract (crude)
shows position of COI1-Myc. B, Assays supplemented with various
concentrations of JA-lle were processed as described above. In B Coomassie

stain shows JAZ1-His.

61

JA-Ile Aux SA ABA

 

 

COI1-Myc

 

 

 

 

JAZ1-His L

 

lA-lle IA MelA OPDA lA-Leu lA-Pbe lA-Trp
uM:0 1 125 125 125 125 125125

COIl-Myc '

 

 

 

 

 

 

lAZl-His I

 

Figure 2.6. Specificity of jasmonate action in a cell-free system.

A, Pull-down reactions containing purified JAZ1-His and protein extract from 358-
COI1-Myc plants were supplemented with JA-Ile, indole-3—acetic acid (IAA),
salicylic acid (SA), abscisic acid (ABA) or an equivalent amount of buffer (Mock)
at the indicated concentrations. B, Various jasmonate derivatives were added to
pull-down reactions at the indicated concentrations. Reactions were processed
as described in Figure 5. The Coomassie Blue-stained blot shows the recovery of

JAZ1-His by the Ni-affinity resin.

62

Characterization of JA-lle dependent COI1-JAZ interaction

Because these experiments utilized supernatants of tomato leaf extracts,
after low-speed centrifugation, as a source of epitope—tagged COI1 (i.e., COI1-
Myc), a potential role for cell membranes or membrane-bound proteins in JA—lle
signaling could not be excluded. To test the influence of membrane on COI1-JAZ
binding, COI1-Myc—containing tomato leaf extracts were cleared of membrane by
ultra-centrifugation. The membrane free extract was tested with the JAZ-His pull
down assay to detect the recovery of COI1-Myc. A requirement for cell
membrane or an association with it would influence the recovery of COI1-Myc in
pull down assays conducted with the membrane-cleared extract. No difference in
COI1-Myc recovery was detected in assays supplemented with protein
homogenate that had undergone ultra-centrifugation compared to those that had
not (Fig. 2.7). This finding indicates that JA-lle action in the cell-free system is

mediated by soluble components.

The involvement of phosphorylation as part of the mechanism of JA
signaling has been suggested from studies that link the abrogation of JA-
mediated responses to treatment with protein phosphatase 2A (PP2A) inhibitors
(Rojo et al. 1998). The stimulatory effect of JA-lle on the COI1-JAZ interaction
‘ may occur indirectly, for example phosphoryl-transfer to COI1 or JAZ, rather than
by JA-lle facilitating the interaction itself. To investigate the possibility that COI1-
JAZ binding could be blocked or enhanced by a phosphatase or kinase, we
conducted in vitro pull down reactions in the presence of the broad range

inhibitors of these enzymes.

63

x 9: 9.000 10.000

JA-IIO - 4' - +
C i
w

   

COI1-Myc

JAZ1-His

Figure 2.7. JA-lle-mediated COI1-JAZ interaction in vitro is mediated by soluble
factors.

Protein extract from 358-COl1-Myc plants was centrifuged at 9,000 x g for 20
min (9,000) or 100,000 x g for 1 hr (100,000). The resulting supernatant was
combined with purified JAZ1-His in the presence (+) or absence (-) of 1 uM JA-Ile
and incubated for 15 min at 4°C. Following recovery of JAZ1-His on Ni-affinity
resin, the presence of COI1-Myc was assayed by immunoblot analysis with anti-
Myc antibody. The Coomassie Blue-stained blot shows the recovery of JAZ1-His

by the Ni-affinity resin.

64

JA-Ile: ' "’ ' ' + 4'
srs: - - + - + -
Ppase: - I- I + o +

COI1-Myc

 

JAZ1-His

Figure 2.8. Effect of kinase and phosphatase inhibitors on JA-lle-stimulated
interaction between COI1-Myc and JAZ1-His.

Pull-down assays containing purified JAZ1-His and protein extract from 358-
COl1-Myc plants were incubated in the presence (+) or absence (-) of 1 pM JA-
lle, 10 uM steurosporine (STS), and 5X Phosphatase Inhibitor Cocktail (PPase)

as indicated. Assays were processed as described in the legend to Figure 5.

65

4°C 16°C ~ 30°C
Mock JA JA-lle Mock JA JA-Ile Mock JA JA-lle

 

 

 

COI1-Myc ‘

JAZ1-HIS

Figure 2.9. Effect of temperature on JA-Ile-mediated COI1-JAZ1 binding.

Pull-down reactions containing purified JAZ1-His and protein extract from 358-
COI1-Myc plants were supplemented with 1 uM JA, 1 uM JA-lle, or binding buffer
(Mock). Reactions were incubated for 30 min at the indicated temperature and
then incubated an additional 15 min at 4°C with 80 uL Ni resin, with gentle
rocking. JAZ1-His complexes were recovered and assayed for COI1- Myc by
immunoblotting. The Coomassie Blue-stained blot shows the recovery of JAZ-His

by the Ni-affinity resin.

66

In pull downs conducted with such enzyme inhibitors, we would expect to see a
negative effect on COI1-Myc recovery in the presence of JA—lle if the addition or
removal of a phosphate moiety was involved in complex formation. Neither
steurosporine nor the phosphatase inhibitor cocktail had a significant effect on
the interaction of COI1 with JAZ1 (Fig. 2.8). This result suggests that phosphoryl-

transfer is not a requirement for JA-lle promotion of a COI1-JAZ complex.

The original pull-down assays to detect the interaction of COI1 with JAZ
was conducted at 4°C. To investigate the effect of temperature on the COI1-JAZ
interaction, pull-down assays performed in the presence of JA or JA-lle were
incubated at 4, 16, and 30°C and were evaluated for the recovery of COI1-Myc
(Fig. 2.9). The results showed that as the incubation temperature of the assays is
increased to 16°C, the recovery of COI1-Myc by JAZ-His is abolished in JA-Ile-
containing reactions. That higher temperatures failed to stimulate COI1-Myc
recovery argues against the possibility that enzymatic activity is required for JA-
lle-mediated COI1-JAZ1 interaction. The loss of COI1-JAZ1 interaction at higher
temperatures may results from the instability of any of the components in this

assay. JA failed to promote COI1-Myc at any temperature.

To determine whether the JA-lle dependent interaction of COI1-JAZ
observed in vitro required accessory plant proteins, the interaction was tested in
the yeast two-hybrid assay. JA-lle included in the growth media stimulated a
positive interaction between tomato COI1 and SIJAZ1 (Fig. 2.10). However, in
the absence of JA-lle or in the presence of JA, MeJA, and OPDA, no interaction

was detected. This result demonstrates that no other plant proteins are required

67

to stimulate the COI1-JAZ interaction. Collectively, these results suggest that
COI1-JAZ interaction does not require a JA-lle-induced enzymatic modification of

either protein, but rather that JA-lle directly promotes the protein-protein

 

interaction.
30 M
10% u
Ethanol JA-Ile MeJA JA OPDA
Positive
Control
SICOI1
SIJAZ1

 

Figure 2.10. JA—lle-dependent interaction between COI1 and JAZ1 in yeast.

Yeast two-hybrid protein-protein interaction assay. Dark colonies indicate a
positive interaction light colonies indicate no interaction. Yeast growth media was
supplemented with either ethanol, JA-lle, MeJA, JA, or OPDA at the
concentrations indicated. Colonies of a positive-control strain in, pLexA-

53/pB42AD-Z, are shown (top row). Figure modified from Thines et al. 2007.

68

Discussion

The identification of JAZ proteins as substrates of COI1 is a major
advance in our understanding of JA signaling. It also sets the stage to investigate
how JA mediates COI1 dependent turnover of JAZ. We sought to address this
question using a tomato line that expresses an epitope-tagged SICOI1, which
could be used to test COI1 recovery in JAZ-pulldown assays. In order to
establish the approach with heterologous components, we identified seven JAZ
genes in the tomato EST database. Wounding induced all tomato JAZ genes
tested. The intensities and the timing of the expression among the different
genes varied. SlJAZ 1, SGN-U327035, and SGN-U315857 were the most rapidly
and strongly induced, whereas SGN-U319732 and SGN-U320368 were very
weakly induced. The jai1-1 mutation, which abolishes COI1 function, eliminated
JAZ transcript accumulation in response to wounding. Interestingly, basal levels
of JAZ3 transcript in jai1-1 plants were decreased, indicating that constitutive
expression of this gene is also regulated by COI1. The COI1-dependent
response of JAZ genes in tomato is similar to the rapid accumulation of
Arabidopsis JAZ transcripts in response to JA and wounding observed in (Chung
et al. 2008, Thines et al. 2007). The rapid induction of these genes in tomato fits
the hypothesis of Thines et al. that JAZ genes are induced quickly to negatively

regulate their own synthesis.

69

In our efforts to study the biochemical requirements of COI1-mediated JAZ
degradation, we developed an in vitro pull down assay to test for interactions
between COI1 and JAZ. The creation of the 358::COl1-Myc line generated in the
jai1-1 background provides the advantage of assesSing COI1-Myc—JAZ
interaction in the absence of endogenous COI1. A significant challenge in
establishing this assay was the expression and purification of a functional tomato
JAZ protein. We showed that expressing JAZ in E. coli as an MBP/6xHis fusion
yielded mg quantities of JAZt-His protein that was ~90% pure. This method for
expression and purification of JAZ in E. coli will likely be useful for purification

and biochemical characterization of JAZ proteins from other plant species.

In taking advantage of this JAZ-His pull down assay, we extended the
work of Thines et al. to demonstrate the basis of COI1-mediated JAZ degradation
(Thines et al. 2007). The assay was used to demonstrate that JA—lle mediates
physical interaction between COI1 and JAZ1. We have determined by this assay
that the specificity of the interaction of SIJAZ1 and COI1 is facilitated by JA—lle
and by JA-Leu to a lesser extent. That JA, MeJA, and OPDA do not promote this
interaction indicates it is highly specific for JA- amino acid conjugate such as JA-
lle. Interestingly, the hydrophobic character of the JA amino acid conjugate is not
sufficient for binding in pull down reactions containing JA-Trp or JA-Phe. The
weak activity of JA-Leu is not surprising considering the similarity of its structure

to JA-Ile.

Despite reports on the activity ofjasmonic acid, MeJA, and OPDA, none of

these molecules could promote COI1-JAZ1 binding (Browse 2005, Cheong et al.

70

2003, Stintzi et al. 2001). The characterization of the jar1 mutant, which is unable
to respond to JA or Me-JA due to a block in JA conjugation to Ile, provides the
first evidence for a role for JA-lle as an active ligand (Staswick et al. 2004).
However, a role for other JAs cannot be excluded at this time as the jar1 mutant
still retains some JA responses, including male fertility that depends on COI1. A
model in which one of the various JAs could promote the interaction of an as yet
characterized JAZ protein with COI1, is one such scenario which could explain
the residual JA responses of jer1. Alternatively, additional JA amino acid
conjugating enzymes could be acting redundantly with JAR1 to produce JA-Ile.
The later is supported by the detection of residual JA-lle in jer1 plants as well as
the large group of GH3 type enzymes, like JAR1 present, in Arabidopsis (Chung
et al 2008, Suza et al. 2008).

In the absence of a methodology to directly test JA-lle binding to a COI1-
JAZ complex, we exploited a pull down assay to characterize the conditions
required for binding to occur. We found the requirements for COI1-JAZ binding
resembled those described for the auxin induced TlR1-Aux/IAA interaction
- (Dharmasiri et al. 2003). Like TIR1, it appears that COI1-JAZ binding occurs
independently of membrane or membrane associated proteins. Although several
studies report roles for phospho—relay in modulating the JA response (Rojo et al.
1998, Kandoth et al. 2007), we were not able to detect a requirement for
phosphoryl transfer in COI1-JAZ interactions. Our results do not exclude the
possibility that COI1-JAZ can be modulated by phosphorylation. Indeed, a

tobacco JAZ homolog was identified as a target of phosphorylation by an elicitor-

71

responsive mitogen-activated protein kinase (Katou et al. 2005). We addressed
the requirement for of enzymatic activity in the tomato protein homogenate in
contributing to JA-lle-induced binding by testing COI1-JAZ interaction at various
temperatures above 4°C. The loss of COI1-JAZ binding at elevated temperature
indicates that the stability of some element of these pull-downs assays is
jeopardized at higher temperatures. We can conclude that binding is not affected
by an unknown enzymatic component. Yeast-two hybrid assays confirm the JA-
Ile dependence of the COI1-JAZ interaction and demonstrate this interaction can
occur at 30°C in the absence of additional plant proteins. Thus, the absence of in
vitm COI1-JAZ binding at elevated temperatures is likely an artifact of the cell-

free essay.

Collectively these results indicate that a COI1-JAZ complex is the site of
JA-lle perception, much like TlR1-Aux/IAA is the site of auxin perception. The
approaches used here can be applied to COI1 and JAZ proteins from any
species. By assessing the ligand dependence of a broad range of JAZs, the
paradigm of JA-lle-mediated COI1-JAZ binding can be fully evaluated. This
research sets the stage for a better understanding of how the diverse array of JA
responses are controlled by the action of COI1. Furthermore, the results

described here will be instrumental to identify a jasmonate receptor.

72

References

Adie, B., Perez-Perez, J., Perez-Perez, M., Godoy, M., Sénchez-Serrano, J.-
J., Schmelz, E., et al. (2007). ABA is an essential signal for plant resistance to
pathogens affecting JA biosynthesis and the activation of defenses in
Arabidopsis. Plant Cell 19: 1665-81.

Browse, J. (2005). Jasmonate: an oxylipin signal with many roles in plants.
Vitamins and Hormones 72: 431-56.

Cheong, J.-J., 8 Choi, Y. (2003). Methyl jasmonate as a vital substance in
plants. Trends in Genetics 19: 409-13.

Chini, A., Fonseca, 8., Fernandez, G., Adie, B., Chico, J., Lorenzo, 0., et al.
(2007). The JAZ family of repressors is the missing link in jasmonate signalling.
Nature 448: 666-71.

Chung, H., Koo, A., Gao, X., Jayanty, 8., Thines, B., Jones, A., et al. (2008).
Regulation and function of arabidopsis JASMONATE ZIM-domain genes in
response to wounding and herbivory. Plant Physiology 146: 952-64.

Devoto, A., Nieto-Rostro, M., Xie, D., Ellis, C., Harrnston, R., Patrick, E., et
al. (2002). COI1 links jasmonate signalling and fertility to the SCF ubiquitin-ligase
complex in Arabidopsis. The Plant Journal 32: 457-66.

Dharmasiri, N., Dharmasiri, 8., 8 Estelle, M. (2005). The F- box protein TIR1 is
an auxin receptor. Nature 435: 441 -.5

Dharmasiri, N., Dharmasiri, 8., Jones, A., 8 Estelle, M. (2003). Auxin action in
a cell-free system. Current biology 13: 1418-22.

Gray, W., Kepinski, 8., Rouse, D., Leyser, 0., 8 Estelle, M. (2001). Auxin
regulates SCF(TIR1)-dependent degradation of AUX/IAA proteins. Nature 414:
271-6.

Howe, G., 8 Jander, G. (2008). Plant Immunity to Insect Herbivores. Ann. Rev.
Plant Biol. 59: 41-66.

Kandoth, P., Ranf, 8., Pancholi, S., Jayanty, 8., Walla, M., Miller, W., et al.
(2007). Tomato MAPKs LeMPK1, LeMPK2, and LeMPK3 function in the
systemin-mediated defense response against herbivorous insects. Proc. Natl.
Acad. Sci. USA. 104: 12205-10.

Kang, J.-H., Wang, L., Giri, A., 8 Baldwin, I. (2006). Silencing threonine
deaminase and JAR4 in Nicotiana attenuate impairs jasmonic acid-isoleucine-
mediated defenses against Manduca sexta. Plant Cell 18: 3303-20.

73

Katou, 8., Yoshioka, H., Kawakita, K., Rowland, 0., Jones, J., Mori, H., et al.
(2005). Involvement of PP83 phosphorylated by elicitor-responsive mitogen-
activated protein kinases in the regulation of plant cell death. Plant Physiol. 139:
1914-26.

Kepinski, 8., 8 Leyser, O. (2005). The Arabidopsis F- box protein TIR1 is an
auxin receptor. Nature 435 (7041), 446-51.

Kramell, R., Miersch, O., Hause, B., Ortel, B., Parthier, B., 8 Wasternack, C.
(1997). Amino acid conjugates of jasmonic acid induce jasmonate-responsive
gene expression in barley (Hordeum vulgare L.) leaves. FEBS letters 414: 197-
202.

Laurie-Berry, N., Joardar, V., Street, |., 8 Kunkel, B. (2006). The Arabidopsis
thaliana JASMONATE INSENSITIVE 1 gene is required for suppression of
salicylic acid-dependent defenses during infection by Pseudomonas syringae.
MPMI 19: 789—800.

Li, L., Zhao, Y., McCaig, B., Wingerd, B., Wang, J., Whalon, M., et al. (2004).
The tomato homolog of CORONATINE-INSENSITIVE1 is required for the
maternal control of seed maturation, jasmonate-signaled defense responses, and
glandular trichome development. Plant Cell 16: 126-43.

Rojo, E., Titarenko, E., Leén, J., Berger, 8., Vancanneyt, G., 8 Sénchez-
Serrano, J. (1998). Reversible protein phosphorylation regulates jasmonic acid-
dependent and -independent wound signal transduction pathways in Arabidopsis
thaliana. Plant J. 13: 153-65.

Schenk, P., Kazan, K., Wilson, I., Anderson, J., Richmond, T., Somerville, 8.,
et al. (2000). Coordinated plant defense responses in Arabidopsis revealed by
microarray analysis. Proc. Natl. Acad. Sci. U. SA. 97: 11655-60.

Schilmiller, A., Koo, A., 8 Howe, G. (2007). Functional diversification of acyl-
coenzyme A oxidases in jasmonic acid biosynthesis and action. Plant Physiol.
143: 812-24.

Shikata, M., Takemura, M., Yokota, A., 8 Kohchi, T. (2003). Arabidopsis ZIM,
a plant-specific GATA factor, can function as a transcriptional activator.
Bioscience, Biotechnology, and Biochemistry 67: 2495-7.

Staswick, P., 8 Tiryaki, l. (2004). The oxylipin signal jasmonic acid is activated
by an enzyme that conjugates it to isoleucine in Arabidopsis. Plant Cell 16:
21 17-27.

Staswick, P., Tiryaki, l., 8 Rowe, M. (2002). Jasmonate response locus JAR1
and several related Arabidopsis genes encode enzymes of the firefly luciferase
superfamily that show activity on jasmonic, salicylic, and indole-3-acetic acids in
an assay for adenylation. Plant Cell 14: 1405-15.

74

Staswick, P., Yuen, G., 8 Lehman, C. (1998). Jasmonate signaling mutants of
Arabidopsis are susceptible to the soil fungus Pythium irregulare. Plant J. 15:
747-54.

Stintzi, A., Weber, H., Reymond, P., Browse, J., 8 Farmer, E. (2001). Plant
defense in the absence of jasmonic acid: the role of cyclopentenones. Proc. Natl.
Acad. Sci. USA. 98: 12837-42. '

Suza, W., 8 Staswick, P. (2008). The role of JAR1 in Jasmonoyl-L: -isoleucine
production during Arabidopsis wound response. Planta 227: 1221-32.

Tan, X., Calderon-Villalobos, L., Sharon, M., Zheng, C., Robinson, C.,
Estelle, M., et al. (2007). Mechanism of auxin perception by the TIR1 ubiquitin
ligase. Nature 446: 640-5.

Thines, B., Katsir, L., Melotto, M., Niu, Y., Mandaokar, A., Liu, G., et al.
(2007). JAZ repressor proteins are targets of the SCF(COI1) complex during
jasmonate signalling. Nature 448: 661-5.

Thompson, J., Gibson, T., Plewniak, F., Jeanmougin, F., 8 Higgins, D.
(1997). The CLUSTAL_X windows interface: flexible strategies for multiple
sequence alignment aided by quality analysis tools. Nucleic Acids Research 25:
4876-82.

Vanholme, B., Grunewald, W., Bateman, A., Kohchi, T., 8 Gheysen, G.
(2007). The tify family previously known as ZIM. Trends in Plant Science 12:
239-44.

Wasternack, C. (2007). Jasmonates: an update on biosynthesis, signal
transduction and action in plant stress response, growth and development.
Annals of Botany 100: 681-97.

White, D. (2006). PEAPOD regulates lamina size and curvature in Arabidopsis.
Proc. Natl. Acad. Sci. USA. 103: 13238-43.

Xie, D., Feys, B., James, 8., Nieto-Rostro, M., 8 Turner, J. (1998). COI1: an
Arabidopsis gene required for jasmonate-regulated defense and fertility. Science
280: 1091-4.

Xu, L., Liu, F., Lechner, E., Genschik, P., Crosby, W., Ma, H., et al. (2002).
The SCF(COI1) ubiquitin-ligase complexes are required for jasmonate response
in Arabidopsis. Plant Cell 14: 1919-35.

75

Chapter 3

COI1 is a critical component of a receptor for jasmonate and the
bacterial virulence factor coronatine2

 

2 This work has been published in Katsir, L., Schilmiller, A.L., Staswick, P.E., He, S.Y., 8
Howe, GA. (2008) COI1 is a critical component of a receptor for jasmonate and the
bacterial virulence factor coronatine. Proc. Natl. Acad. Sci. U. S.A., 105: 7100-5.

76

Abstract

Jasmonate is a lipid-derived hormone that regulates diverse aspects of plant
immunity and development. An amino acid-conjugated form of jasmonate,
jasmonoyl-isoleucine (JA-Ile), stimulates binding of the F-box protein
CORONATINE INSENSITIVE1 (COI1) to, and subsequent ubiquitin-dependent
degradation of, JAsmonate ZIM-domain (JAZ) proteins that repress transcription
of jasmonate-responsive genes. The virulence factor coronatine (COR), which is
produced by several plant pathogenic strains of Pseudomonas syringae,
suppresses host defense responses by activating jasmonate signaling in a COI1-
dependent manner. Although previous data indicate that COR acts as a
molecular mimic of JA-lle, the mechanism by which JA-lle and COR are
perceived by plant cells remains unknown. Here we show that interaction of
tomato COI1 with divergent members of the JAZ family is highly specific for JA-
lle and structurally related JA conjugates, and that COR is at least 100-fold more
active than JA-lle in promoting this interaction in vitro. JA-lle competes for
binding of COR to COI1-JAZ complexes, demonstrating that COR and JA-lle are
recognized by the same receptor. Binding of COR to the COI1-JAZ complex
requires COI1 and is severely impaired by a point mutation in the putative ligand-
binding pocket of COI1. Finally, we show that the highly conserved C-terrninal
domain of JAZB is necessary and sufficient for ligand-induced COI1-JAZ
interaction and ligand binding. These findings demonstrate that COI1 is a critical
component of the jasmonate receptor and that pathogens can manipulate

hormone receptors in their hosts to establish infection.

77

Introduction

Jasmonic acid (JA) and its bioactive derivatives, collectively referred to as
jasmonates (JAs). regulate a wide range of physiological processes in higher
plants. JAs have a well-established role in orchestrating genome-wide
transcriptional changes in response to biotic stress and developmental cues
(Blabi et al. 2008, Howe et al. 2008, Browse et al. 2008, Wasternack et al. 2007).
In general, JAs promote defensive and reproductive processes, as well as inhibit
the growth and photosynthetic output of vegetative tissues. These juxtaposing
activities suggest a general role for the hormone in controlling resource allocation
between growth- and defense-related processes, thus optimizing plant fitness in
rapidly changing and hostile environments.

Recent studies indicate that JA controls the expression of early response
genes by promoting the ubiquitin-dependent degradation of jasmonate ZIM
domain (JAZ) proteins (Thines et al. 2007, Chini et al. 2007, Yan et al. 2007).
The JAZ family of proteins in Arabidopsis consists of 12 members, which have
been classified as a subgroup of the larger family of TIFY proteins that share a
conserved TlF[F/Y]XG motif within the ZIM domain (Vanholme et al. 2007). A
second defining feature of JAZs is the highly conserved Jas motif, which has a
SLXzszKszRstY consensus sequence near the C terminus (Thines et al.
2007, Chini et al. 2007, Yan et al. 2007). Genetic analysis indicates that
coronatine-insensitive 1 (COI1), an F-box protein that determines the target
specificity of the £3 ubiquitin ligase SCFCO” (where SCF indicates Skp/Cullin/F-

box), is required for most, if not all, JA-signaled processes (Feys et al. 1994, Xie

78

et al. 1998, Li et al. 2004). Arabidopsis JAZ3 (also known as JAI3) interacts with
and presumably represses the activity of the MYCZ transcription factor that
promotes the expression of JA-responsive genes (Chini et al. 2007). Current

POW—ubiquitin—

models indicate that degradation of JAZ repressors by the SC
proteasome pathway in response to a bioactive JA signal relieves the inhibition of
MYCZ, thereby activating the expression of early response genes. Functional
analysis of the tomato homologs of COI1, JAZ, and MYCZ (Thines et al. 2007, Li
et al. 2004, Boter et al. 2004) indicates that this general mechanism of JA
signaling is conserved in the plant kingdom.

The JAR1 gene encodes a JA—amido synthetase that catalyzes the
formation of jasmonoyl-L-isoleucine (JA—lle) (Staswick et al. 2002, Staswick et al.
2004, Suza et al. 2008). The JA-insensitive phenotype of jer1 mutant plants
indicates that JA—lle is an active signal in the JA pathway. Analysis of jar mutants
also showed that JA—lle is important forthe regulation of plant defense responses
to attack by pathogens and insects (Staswick et al. 2004, Staswick et al. 1998,
Kang et al. 2006). Thines et al. (Thines et al. 2007) recently showed that
formation of both Arabidopsis and tomato COI1—JAZ1 complexes is stimulated by
JA-lle but not by jasmonic acid, methyl-JA (MeJA), or the JA precursor 12-oxo-
phytodienoic acid (OPDA). Endogenous JA—lle levels increase within minutes of
tissue damage, coincident with the expression of early JA-response genes
(Chung et al. 2008). It is not known whether the JA—Ile-dependent interaction with

COI1 is unique to JAZ1 or is more generally applicable to other members of the

JAZ family.

79

The mechanism by which JA—lle promotes COI1 binding to JAZ proteins
remains to be determined. In yeast and animal cells, target recognition by E3
ubiquitin ligases typically depends on phosphorylation or other posttranslational
modifications of the substrate (Deshaies et al. 1999). Notably, COI1 is
homologous to TIR1, which functions as a receptor for the plant hormone auxin
(Tan et al. 2007). Auxin regulates gene expression by binding to TIR1 and
stimulating the ubiquitin—proteasome—dependent degradation of Aux/IAA
transcriptional repressors (Dharmasiri et al. 2005, Kepinski et al. 2005). Despite
the many similarities between auxin and JA signaling, the identity of the JA
receptor and its physiological ligand(s) is not known.

Coronatine (COR) is a phytotoxin produced by some plant pathogenic
strains of Pseudomonas syringae (Bender et al. 1999). Several lines of evidence
indicate that COR exerts its virulence effects by activating the host's JA signaling
pathway (Feys et al. 1994, Zhao et al. 2003, Lauchli et al. 2003, Uppalapati et al.
2005, Thilmony et al. 2006). The insensitivity of coi1 mutants of Arabidopsis and
tomato to COR demonstrated that COI1 is required for the action of the toxin
(Feys et al. 1994, Zhao et al. 2003). These observations, together with the
structural similarity of COR to JA—lle, support the notion that this virulence factor
acts as a molecular mimic of JA—lle (Staswick et al. 2004, Krumm et al. 1995).

To test directly the hypothesis that JA—lle and COR share a common
molecular mechanism of action, we used an in vitro pull-down assay to assess
the ability of COR, JA—lle, and structurally related JA conjugates to promote the

interaction of tomato COI1 with two divergent tomato JAZ proteins. Here, we

80

provide evidence that COI1, or possibly a COI1—JAZ complex, is a receptor for
JA—lle and that COR exerts its virulence effects by functioning as a potent
agonist of this receptor system. We also show that the Jas motif-containing C-
terminal region of JAZ3 is necessary and sufficient'for hormone-induced

interaction of COI1 with JAZ3.

81

Materials and methods
Biological materials

Growth conditions for Solenum lycopersicum (tomato) were described previously
(Li et al. 2001). A 35S—COI1-Myc transgenic line of tomato (cv Microtom) was
used as a source of COI1-Myc in pull-down experiments (Thines et al. 2007).
The tomato jei1-1 and jai1-3 (previously called spr5) mutants (cv Castlemart)

were isolated and propagated as described. (Li et al. 2004 and Li et al. 2001).
Chemicals

Coronatine (08115), phosphatase inhibitor mixture 1 (P2850), steurosporine
(S4400), indole—3—acetic acid (l-2886), salicylic acid (87401), and (i)-JA were
purchased from Sigma. Jasmonoyl—amino acid conjugates were prepared, and
the structures were verified by GC-MS as described previously (Staswick et al.
2004, Kramell et al. 1988). The naturally occurring (—)-JA—lle isomer was
separated from (+)-JA—Ile by HPLC. (—)-JA—lle was used in pull-down assays,
whereas all other JA conjugates were used as a mixture of the (+)-JA- and (-)-
JA—amino acid diastereomers. [3H]COR was prepared commercially (GE
Healthcare) by using hydrogen—tritium exchange between tritiated water and
unlabeled COR. The specific activity of [3H]COR as determined by mass
spectrometry is 333 GBq per mmol. The radiochemical purity was 97.0% as

determined by HPLC.

82

Cloning and expression of JAZ fusion proteins

A full-length cDNA for SlJAZ3 was PCR-amplified from a tomato EST clone
(EST555543; Bl935654) provided by the SOL Genomics Network (Cornell
University). Primers used for the PCR were 5'-
GCGCGGCCGCCGAGATGGAGAGGGAC'ITTATGG-3' and 5'-
ACGCGTCGACTAGCTTGGTCTCCTTACCG-3'. The resulting PCR product was
cleaved with Notl and Sell and cloned into the corresponding restriction sites of
pRMG—nMAL (Thines et al. 2007) to make the MBP—JAZ3—His5 fusion plasmid.
Truncated derivatives of JAZ3, designated JAZ31_221 and JAZ3149_306, were
amplified by using the following two primer sets, respectively: 5'-
GCGCGGCCGCCGAGATGGAGAGGGAC'ITI’ATGG-B' and 5'-
CCCTCGAGCACATTAGGTGGAGCCA-3'; 5'-
GCGCGGCCGCCTGTGCTCCACCTAAT-3' and 5'- ,
CCTCGAGGGTCTCCTTACCGGCTAA-S'. The PCR products were cleaved with
Notl and Xhol and cloned into the corresponding sites of pRMG—nMAL. Full-
length JAZ3 and JAZ1 fusion proteins, as well as the JAZ31.221 and JAZ3149.305
truncations, were expressed in Escherichia coli and purified by Ni affinity

chromatography as described (Thines et al. 2007).
Pull-down and [3H]COR binding assays

A 358-COl1-Myc transgenic line of tomato was used as a source of COI1—Myc
in a JAZ—His pull-down assay described previously (Thines et al. 2007). Unless

otherwise indicated, the quantity of JAZ—His added to each reaction was 25 pg.

83

Protein concentrations were determined with a BCA protein assay kit (Pierce).
Standard [3H]COR-binding assays contained 50 pg of purified JAZ—His protein, 4
mg of total leaf protein from 35S::COl1-Myc plants or an othenrvise indicated
genotype, and 400 nM [3H]COR (1.86 pCi) in a final volume of 0.5 ml of binding
buffer [50 mM Tris, pH 6.8/10% glycerol, 100 mM NaCl, 25 mM imidazole, 20 mM
2-mercapto-ethanol, 10 pM MG132, 0.1% Tween 20, and Complete Mini
protease inhibitor tablet-EDTA free (Roche)] and were performed in triplicate.
Reactions were incubated at 4°C for 30 min, after which 80 pl of Ni resin was
added. After an additional 15-min incubation at 4°C, JAZ—His-bound Ni resin was
washed three times on microcentrifuge spin columns with 0.25 ml of binding
buffer at 4°C. JAZ—His was eluted from the resin with 100 pl of 300 mM
imidazole. Radioactivity in the resulting eluent was measured by scintillation
counting (MicroBeta Trilux; PerkinElmer) after the addition of 1 ml of scintillation

fluid (Optiphase Supermix; PerkinElmer).

Saturation-binding experiments were performed with increasing concentrations of
[3H]COR in the presence or absence of 100-fold excess unlabeled COR. For
experiments by using jei1-1 extracts, pull-down reactions contained 5 mg of total
leaf protein, 50 pg of JAZ3-His, and 400 nM [3H]COR with or without the addition
of 400 pM unlabeled COR. Saturation-binding experiments comparing WT and
jai1-3 leaf extracts were conducted by incubating 5 mg of leaf protein and 50 pg
of JAZ3—His with increasing concentrations of [3H]COR (10, 100, 500, and 1,000

nM) in the presence or absence of 100-fold excess unlabeled COR.

84

Analysis of Proteinase Inhibitor II Expression. Proteinase inhibitor ll (Pl-ll)
protein and mRNA levels were measured according to published procedures Li et
al 2004, Li et al. 2001). Probed RNA blots were visualized with a
phosphorimaging device, and the signal intensities quantified with the Quantity
One-4.2.2 program (Bio-Rad). Values for each time point were normalized to the

eIF4A loading control.

85

Results

Requirement of jasmonoyl—amino acid conjugates for COI1 interaction with

two divergent JAZs

We previously used an in vitro pull-down assay to demonstrate that JA—lle
stimulates interaction between tomato COI1 and a purified JAZ1-His fusion
protein in the absence of intact cells (Thines et al. 2007). Recovery of COI1-Myc
by JAZ1—His was not promoted by jasmonic acid (at concentrations up to 1 mM;
data not shown), MeJA, or the JA precursor OPDA (Thines et al. 2007). To
further define the specificity of JA—lle as a signal for COI1—JAZ1 interaction, we
compared the activity JA—lle with other naturally occurring jasmonoyl—amino acid
conjugates. JA—amino acid conjugates containing small hydrophobic amino acids
stimulated COI1—JAZ1 binding to varying degrees, with the relative order of
activity being JA—lle, —+ JA—Val, —+ JA—Leu (Figure 3.1A). JA—Ala was very
weakly active, whereas JA—Phe and JA—Gln were inactive at the highest

concentration tested (10 pM).

To determine whether the signal specificity of JAZ1 extends to other members of
the tomato JAZ family, we identified a tomato JAZ cDNA whose sequence is
significantly diverged from JAZ 1. BLAST and phylogenetic analyses indicated
that the tomato protein encoded by this cDNA is most similar to Arabidopsis JAZ3
(Figure 3.2). We therefore refer to this tomato protein as SlJAZ3 (or hereafter

simply as JAZ3).

86

JA-lle JA-Phe JA-Leu JA-Val JA-Ala JA-Gln
pM: 01 110110 110110110

 

I -
COI1-Myc O “"-

JAZ1-His

.-

JA-Ile JA-Phe JA-Leu JA-Val JA-Ala JA-Gln

 

pM: 01110110110110110

{if-.71

A
-v

 

COI1-Myc Q

JAZ3-His

Figure 3.1. Specificity of JA—amino acid conjugates in promoting COI1—JAZ
interaction. Pull-down assays were performed with recombinant JAZ1—His A, or
JAZ3—His B, and extracts from 35S-COl1—Myc plants. Assays were
supplemented with various JA—amino acid conjugates at the indicated
concentration and incubated for 30 min at 4°C. Protein bound to JAZ1—His or
JAZ3—His was analyzed by immunoblotting for the presence of COI1—Myc. The
Coomassie Blue-stained blot in each panel shows the recovery of JAZ—His by

the Ni affinity resin.

87

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

79 l JAZZ
82 - SIJAZ1
I ' JAZ5
i 100 I——— JAze
I JAZ1 1
—59— 99 I JAZ12
JA29
# 71 SlJAZ3
50 J JAZ4
* 98 I JAZ3
JAZ1 O
| JAZ7
100j JA28

0.1

Figure 3.2. Phylogenetic tree showing the relationship of tomato JAZ1 (SIJAZ1)
and JAZ3 (SIJAZ3) to the 12 JAZ proteins in Arabidopsis thaliana.

BLAST analysis indicated that tomato JAZ3 (SIJAZ3) is most similar to
Arabidopsis JAZ3/JAI3. The predicted amino acid sequence of SlJAZ3 exhibits
hallmark features of the JAZ protein family, including the highly conserved ZIM
and Jas motifs. The phylogenetic tree was constructed with the neighbor-joining
method by using MEGA 4 software (Molecular Evolutionary Genetics Analysis).
The value on each node is the percentage of the bootstrap value (only values 50

are shown).

88

The sequence similarity between tomato JAZ1 and JAZ3 (27% amino acid

identity) is restricted mainly to the ZIM domain and C-terminal Jas motif.

Pull-down assays performed with a JAZ3—His fusion protein showed that the
chemical specificity for COI1—Myc binding to JAZ3—His is very similar to that for
JAZ1—His. For instance, the COI1—JAZ3 interaction was strongly promoted by
JA—lle, whereas no stimulatory effect was observed with jasmonic acid, MeJA,
OPDA, JA—Phe, or JA—Gln (Figure 3.13 and data not shown). JA—Leu, —Val, and
—Ala stimulated recovery of COI1—Myc by JAZ3—His to various extents, with the
relative order of activity being JA—lle —+ JA—Val —» JA—Leu -+ JA—Ala. JA-Val and
JA—Ala were more effective in stimulating COI1-Myc binding to JAZS-His than to
JAZ1—His, suggesting that formation of COI1—JAZ1 complexes in vitro may be
more selective for JA—Ile than for COI1—JAZ3 complexes. We conclude that
recruitment of two divergent JAZ proteins by tomato COI1 is promoted

specifically by JA—lle and structurally related JA conjugates.

Coronatine Binds Directly to COI1-JAZ Complexes. The ability of the P.
syringae toxin COR to activate JA signaling in a COI1—dependent manner (Feys
et al. 1994, Zhao et al. 2004, Uppalapati et al. 2005, Thilmony et al. 2006)
together with the structural similarities between COR and JA—Ile (Figure 3.3A),
led us to hypothesize that COR exerts its virulence effects by promoting COI1—

JAZ interactions.

89

Figure 3.3. Coronatine promotes formation of COI1-JAZ complexes.

A, Molecular structures of JA—lle and COR. B, JAZ1—His-containing pull-down
assays supplemented with buffer (indicated by 0) or various concentrations of
COR were processed as described in the legend to Figure 3.1. C, Comparison of
the activity of JA—lle and COR in promoting COI1 interaction with JAZ1. Pull-
down assays containing purified JAZ1—His and protein extract from 35S—COI1-
Myc plants were incubated in the absence (indicated by 0) or presence of the
indicated concentration of JA—lle or COR. The Coomassie blue-stained blot

shows recovery of JAZ1—His.

9O

o o
o H . o m
Moos/kC "GOG/KL
JA-Ile Coronatine

B.
pM con: 0 0.05 0.5 5 50 500 5000
COI1-Myc - A - «mu-1‘
JAZ1-His
C.
JA-Ile (nM) Coronatine (pM)
0 5 50 5005000 0 5 50 5005000
COI1-Myc 1‘ Q 1 *1 III- -
JAZ1-H18 ”ff: 9‘3““ '22“: 11:-1-313% new new €2.23 31:...“

Figure 3.3. Coronatine promotes formation of COI1—JAZ complexes.

We found that COR promotes COI1—Myc binding to JAZ1-His in a dose-

dependent manner and, remarkably, that this stimulatory effect was apparent at

91

concentrations of COR as low as 50 pM (Figure 3.3B). Direct comparison of the
activity of COR with that of JA—lle showed that the toxin is 1,000-fold more active
than JA—Ile (Figure 3.30), which is in agreement with the previous observation
that 50—500 nM concentrations of JA—lle are required to stimulate COI1—JAZ1
interaction in this assay (Thines et al. 2007). COR was at least 100-fold more
effective than JA—lle in promoting the COI1—JAZ3 interaction in the JAZ3—His

pull-down assay (data not shown).

To determine whether COR is a ligand that directly binds to the COI1-JAZ
complex, we performed binding assays in which crude leaf extracts containing
COI1—Myc were incubated with [3H]COR and either JAZ1-His or JAZ3—His. The
results in Figure 3.4A show that both JAZ1—His and JAZ3-His retain [3H]COR
after isolation of the fusion protein by Ni-affinity chromatography and subsequent
washing steps. The ability of unlabeled COR to compete with [3H]COR for binding
indicates that the binding is specific. Binding of [3H]COR to JAZ3—His complexes
was competed by the addition of 10,000-fold excess unlabeled JA—lle but not by
the addition of the same amount of jasmonic acid (Figure 3.43), indicating that
the COR receptor eluting with JAZ3-His also binds to JA—lle. Similar results were
obtained in pull-down assays performed with JAZ1-His (Figure 3.40). Scatchard
analysis of saturation binding data obtained with the JAZ3-His pull-down assay
showed that the apparent dissociation constant (K.,) of the receptor for COR was

20 nM (Figure 3.4D).

92

Figure 3.4. Coronatine and JA-lle bind to a COI1-JAZ complex.

A, Pull-down reactions containing extracts from 35S-COI1—Myc plants and
JAZ3—His (filled circles) or JAZ1—His (open circles) were incubated with [3H]COR
in the presence of increasing concentrations of unlabeled COR. Radioactivity
recovered with JAZ—His is indicated (CPM). B, Pull-down reactions containing
358-COI1—Myc leaf extract, JAZ3-His, and [3H]COR were incubated in the
absence (indicated by 0) or presence of the indicated amount of unlabeled COR,
JA (jasmonic acid), or JA-lle. C, Specific binding of COR to a COI1—JAZ1 protein
complex. Pull-down reactions containing 35S—COl1—Myc leaf extract, JAZ1—His,
and [3H]COR were incubated in the absence (indicated by 0) or presence of the
indicated amount of unlabeled COR, JA (i.e., jasmonic acid), or JA—lle.
Radioactivity recovered with JAZ1—His is indicated (in cpm). Error bars denote
the SD of triplicate assays. D, Pull-down reactions containing 35S-COl1—Myc leaf
extract, JAZ3—His, and increasing concentrations of [3H] COR were used to
construct a saturation curve for specific binding. Shown is a Scatchard plot of the
saturation-binding data for a representative experiment. Error bars denote the SD

of triplicate assays.

93

 

 

 

 

 

 

 

 

A.
1000 r°\
E
o- r
U
. §§
100 :-
0 0.1 1 10 100 1000
Unlabeled COR (pH)
8. C.
11123 200 IAZI
1500
1000 100
500
- i —-——> 0 1000X 10.000X 10.000X
0 1000X 10,000X 10,000X COR JA JA-IIC
COR JA JA-IIO
0 0.012
0.010 -
O
0 008 -
3
g o
c 0 006 1-
g 0.004 r- .
0.002 "
O
1 l.

 

 

 

000 1 I l l l
100 120 140 160 180 200 220 240 260
Bound (pM)

Figure 3.4. Coronatine and JA-lle bind to a COI1-JAZ complex.

94

Specific binding of COR to the JAZ3—His complex was observed in pull-down
reactions supplemented with crude leaf extract from WT tomato leaves (Figure
3.5). Thus, like COI1—Myc, endogenous COI1 interacts with JAZ3-His in a COR-
dependent manner.To determine whether COI1 is required for COR binding, pull-
down reactions were performed with leaf extracts from the COI1-deficient jei1-1
mutant of tomato that harbors a deletion in the SICOI1 gene (Li et al. 2004). As
shown in Figure 3.5, jai1-1 extracts failed to promote recovery of [3H]COR by
JAZ3—His. Binding assays performed with JAZ3—His in the absence of tomato
leaf extract showed that COR does not bind specifically to JAZ3—His (Figure 3.5).
We thus conclude that COI1 is an essential component of the COR/JA—lle
receptor and that JAZ protein alone is not sufficient for high-affinity ligand
binding. Homology between COI1 and the TIR1 auxin receptor provides indirect
evidence for the idea that COI1 is a JA receptor (Tan et al.2007, Parry et al.
2006).

To define further the role of COI1 in COR binding, we used the jai1-3
tomato mutant that harbors a point mutation (L418F) in the leucine-rich repeat
domain of COI1 and, as a consequence, is partially insensitive to JA (Figure
3.6A, B). The tomato jai1-3 mutant, formerly called spr-5 (Li et al. 2001), was
isolated in a genetic screen for mutants that are suppressed in systemin-induced
defense responses (Li et al. 2001). Sequencing of two independent SICOlt
cDNAs from jai1-3 plants revealed a single G to T base change at position 1,254

of the cDNA ORF. This change results in substitution of Leu-418 with a Phe.

95

 

600

 

 

 

400
z
a.
U
200
0
1000x001: - + - + - + - 1-
Mock 35s-cor1 wr jai1-1
-Myc

Figure 3.5. COI1 is an essential component of the jasmonate receptor.

Pull-down reactions containing JAZB—His, [3H]COR, and crude leaf extract from
the indicated tomato genotype (or an equivalent volume of buffer; indicated by
Mock) were incubated in the presence (+) or absence (-) of 1,000-fold unlabeled
COR. The amount of radioactivity recovered in the JAZ3—His complex is shown.

Error bars denote the SD of triplicate assays.

96

Northern blot analysis of the JA-inducible proteinase inhibitor II gene showed that
jei1-3 leaves are approximately 100-fold less responsive than WT leaves to
exogenous MeJA (Figure 3.7A). The mutated Leu residue in jei1-3 aligns with an
lle residue (lie-406) in TIR1 that contacts the Aux/IAA peptide substrate within the
auxin-binding pocket of TIR1 (Tan et al. 2007). We hypothesized that jai1-3 might
impair COI1 interaction with either the ligand or the JAZ substrate. As shown in
Figure 3.7B, [3H]COR was recovered by JAZ3-His in pull-down assays
supplemented with jai1-3 leaf extract but to a level that was much less than that
obtained with WT extract. At 500 nM COR, for example, the recovery of specific
binding in the presence of jai1-3 extract was only 1.3-fold above background,
which was 10-fold lower than the amount of specific binding recovered in the
presence of WT extract. These results indicate that the reduced sensitivity of jei1-
3 leaves to exogenous JA correlates with reduced binding activity ofjai1-3 extract
to COR and provide evidence that Leu-418 of COI1 plays a role in the formation

of a stable complex between COI1, JAZ, and COR.

97

Figure 3.6. The tomato jai1-3 mutant contains a Leu418Phe amino acid
substitution in COI1 that results in reduced sensitivity to endogenous and
exogenous JA.

A, Effect of jai1-3 on MeJA-induced root growth inhibition. Wild-type, jai1-1,

and jai1-3 seedlings were treated with either water (-) or 1 mM MeJA (+) as
previously described (Li et al. 2004). Seedlings were photographed 9 days

after seed sowing. Note that the root length of MeJA-treated jai1-3
seedlings is intermediate between that of WT and jai1-1 seedlings. B,

Pl-ll deficiency in jai1-3 plants is restored by high concentrations of
exogenous MeJA. Two-leaf-stage wild-type (filled bar) and jei1-3 (open bar)
tomato plants were mechanically wounded on each leaf with a hemostat
(wounded leaf). Four additional sets of plants were exposed to the

indicated amount (in pl) of pure MeJA or a mock control (indicated by 0)
in an enclosed container (MeJA-treated leaf) as described (Li et al. 2004).

Pl-Il protein levels in the leaf tissue were measured 1 day after treatment.

Pl-ll levels were also measured in wild-type and jai1-3 flowers (flwr).

Data points represent the mean SD of at least six plants per treatment group.

98

 

Root length (cm)

 

 

 

 

 

 

 

 

B
3
HI
5
3'
t: W 0 0.05 0.5 5 flwr
wounded MeJA-treated
leaf leaf
Figure 3.6.

99

 

 

A. jai1-3
In
0 IO
leeJA e o' e' m
PI-II a
elF4A .flfl-C

 

250

200

150

100

50

Specific Binding (CPM)

 

 

 

0 I 1 I l
0 200 400 600 800 1000
3H-COR (nM)

Figure 3.7. A Leu418Phe amino acid substitution in COI1 results in reduced

sensitivity to exogenous JA and reduced affinity for COR

A, Northern blot analysis of proteinase inhibitor ll transcript accumulation in wild-

type and jai1-3 plants treated in a closed container for 10 h with various amounts
of vaporous MeJA. Blots were hybridized to an elF4A cDNA as a loading control.
B, Specific binding of [3H]COR in pull-down assays containing JAZ3-His and leaf

extract from either WT (closed circles) or jai1-3 (open circles) plants.

100

The C-Terminal Region of JAZ3 Interacts with COI1 and Promotes Ligand

Binding.

Having established that COR and JA—lle bind to, and stimulate the formation of, a
COI1—JAZ3 protein complex, we sought to identify the region of JAZ3 that
facilitates this interaction. Truncated derivatives (JAZ31_221 and JAZ3149_306) of
JAZ3 containing either the conserved TIFYXG motif in the ZIM domain or the Jas
motif (Figure 3.8A) were expressed as maltose-binding protein (MBP)-JAZ-His
fusion proteins and tested for their ability to interact with COI1-Myc (Figure 3.8A).
JAZ3149.306-His efficiently recovered COI1-Myc in a JA—lle-dependent manner,
whereas JAZ31_221-His did not (Figure 3.83). Moreover, we found that specific
binding of [3H]COR was recovered by JAZ3149_306—His but not JAZ31_221-His in
assays containing 35S-COl1-Myc extract (Figure 3.80). These results show that
tomato JAZ3149_306 is necessary and sufficient for the COI1—JAZ3 interaction and

specific binding of COR to the COI1-JAZ3 complex.

101

Figure 3.8. The C-terminal region of JA23 is required for COI1 interaction
and specific binding of COR to the COI1-JAZ3 complex. A, Schematic
diagram of full-length and truncated JAZ3 constructs. The positions of the
conserved ZIM (gray box) and Jas (black box) motifs are shown. The
N-terminal MBP and C-tennlnal Hise fusions are not shown. B, Pull-down
assays containing 35S-COl1—Myc leaf extract and the indicated JAZ3
fusion protein were incubated in the presence (+) or absence (-) of 1 pM
JA—lle. Reactions were processed as described in the legend to Fig. 1.
C, Pull-down reactions containing 358-COI1-Myc leaf extract, [3H]COR,
and the indicated JAZ3 fusion protein were incubated in the presence

(+) or absence (-) of unlabeled COR

102

A. m T306

 

 

 

 

l
JAZ3 [ [:l
(?7 V221
J
014237.22, I til I
A149 T303
JAZ3140-zm
JAZ3 JAZ31-221 JAZ3149-305
B. JA-lle - + - + - t

COI1-Myc

 

JAZ3-His

 

c_ 800

 

 

 

600 r
E 400 1
U
200 1
o I
+ - + - +

1 000x COR ' J

Figure 3.8.

103

Discussion

In this present study, we used a direct ligand-binding assay to investigate the
mechanism by which COR and JA—lle mediate the interaction between tomato
COI1 and JAZ proteins. Our results indicate that JA—Ile does not act indirectly to
induce an enzymatic modification of COI1 or JAZ but rather works directly to
promote the COI1—JAZ interaction. The ability of JA-lle to compete with COR for
specific binding indicates that COR and JA—Ile are recognized by the same
receptor. Because COR binding to the COI1—JAZ complex depends on COI1, we
conclude that COI1 is an essential component of the perception apparatus.
Moreover, that COR does not bind specifically to purified JAZ—His alone or in the
presence of COI1-deficient tomato extract excludes the possibility that JAZ
proteins function as JA receptors. These observations, together with the fact that
JA—lle-induced interaction between COI1 and JAZ does not require any other
plant protein (Thines et al. 2007), provide strong evidence that COI1 is a receptor
that specifically binds JA—Ile and COR.

Our results also provide evidence that the molecular mechanism of JA—lle
action is similar to that of auxin, which promotes substrate recruitment by creating
a surface on the leucine-rich repeat domain of TIR1 that facilitates Aux—IAA
binding (Tan et al. 2007). Detection of a stable ternary COI1—ligand—JAZ complex
in the pull-down assay is consistent with the idea that JA—lle/COR interact
simultaneously with COI1 and JAZ. Because our binding assay relies on the

recovery of components that copurify with JAZ—His, it remains to be determined

104

whether COI1 binds to JA—lle (or COR) in the absence of JAZ. A role for COI1
and JAZ as coreceptors thus remains a formal possibility. Significantly, however,
COI1 is predicted to adopt a structure that is similar to the auxin receptor TIR1
(Tan et al. 2007). Several amino acid residues that mediate the interaction of
TIR1 with auxin, substrate, and inositol hexakisphosphate are conserved in COI1.
The results of binding experiments performed with extracts from the tomato jai1-3
mutant, which harbors a point mutation (L418F) in a region of COI1 that is
homologous to the hormone-binding pocket of TIR1, suggests that this region of
COI1 is important for interaction with the ligand and/orJAZ substrate. However,
we cannot exclude the possibility that reduced binding of COR to jei1-3 extracts
results from an effect of the L418F mutation on the stability or abundance of
COI1.

We found that the interaction of COI1 with two divergent members (JAZ1
and JAZS) of the tomato JAZ family is promoted in a highly specific manner by
JA—lle and structurally related JA conjugates. It is noteworthy that JA—Val, whose
synthesis is catalyzed by JAR1-like enzymes (Staswick et al. 2004, Wang et al.
2008), was as active as JA—Ile in stimulating COI1 binding to JAZ3. This finding
indicates that JA—Val may function as an endogenous signal for COI1-dependent
responses, particularly in tissues that contain high JA—Val levels. JA—Leu and
JA—Ala also exhibited activity, suggesting that these derivatives are bioactive JAs
as well. Although several studies have suggested that jasmonic acid, MeJA, and
OPDA are active per 83 as signals in the JA pathway (Wang et al. 2008, Stintzi et

al. 2001, Seo et al. 2001, Kramell et al. 1997, Koch et al. 1999) these

105

compounds showed no activity in the JAZ1 and JA23 pull-down assays. It is
possible that these nonconjugated derivatives promote COI1 interaction with JAZ
proteins whose ligand specificity is different from that described here for JAZ1
and JAZ3. The well-defined repertoire of JAZ proteins in model plants such as
Arabidopsis indicates that it will be possible to systematically determine the signal
specificity of all JAZs by using protein—protein interaction assays.

Several pathovars of P. syringae possess a cluster of genes that direct the
synthesis of the phytotoxin COR (Bender et al. 1999). Here, we show that COR
functions as an agonist of the JA receptor. Remarkably, COR is 1000-fold more
active than JA—lle in promoting the COI1-JAZ3 interaction in vitro. This is
consistent with the fact that COR is generally a much more potent signal in
physiological responses than is jasmonic acid or MeJA (Uppalapati et al. 2005,
Koda et al. 1996). The virulence properties of COR can thus be attributed to its
ability to efficiently promote SCFCO'I-mediated ubiquitination and destruction of
JAZ proteins. This conclusion is supported by studies demonstrating that COI1-
deficient mutants of Arabidopsis and tomato are much less susceptible to
infection by COR-producing strains of P. syringae (Feys et al. 1994, Zhao et al.
2003). Targeting of eukaryotic hormone receptors by pathogen virulence factors
would appear to provide an efficient mechanism to manipulate genome-wide
transcriptional programs and other processes that effectively suppress host cell
defenses. It is not yet clear whether the toxic properties of COR result solely from
an overstimulation of the JA signaling pathway due to its high receptor-binding

efficiency or whether COR has additional properties that alter normal cellular

106

processes.

Pull-down experiments with truncated forms of tomato JAZ3 showed that
JAZ3149—306 interacts with COI1 in a ligand-dependent manner, whereas a
derivative consisting of the N-terminal 221 aa does not. This finding indicates that
the sequence determinants for substrate recognition by SCFCO" are located
within the C-terminal 157 aa of JAZ3. Because the highly conserved Jas motif is
located in this region, we suggest that the Jas motif mediates JAZ binding to
COI1. This hypothesis is consistent with studies showing that deletion of the Jas
motif stabilizes JAZ proteins against COI1-dependent degradation during JA
signaling (Thines et al. 2007, Chini et al. 2007, Yan et al. 2007). Experiments
conducted with Arabidopsis JAZ3, however, showed that the ZIM domain-
containing N-terminal region, but not the C-terminal region containing the Jas
motif, interacts with COI1 in the absence of exogenous JA (Chini et al. 2007).
7 One possible explanation for these apparently disparate results is that COI1
interacts with the N and C termini of JAZ3 in a JA-independent and -dependent
manner, respectively. Although we did not detect COI1—JAZ31_221 interaction in
the absence of JA—lle, our pull-down assay is likely less sensitive than the assay
used by Chini et al. (2007), who used radiolabeled proteins for their binding
studies.

In summary, our results build on recent studies (Thines et al. 2007, Chini
et al. 2007, Yan et al. 2007, Chung et al. 2008) to define a unifying model for JA
signaling in which direct recognition of JA—lle by COI1 is coupled to ubiquitin-

mediated degradation of JAZs and subsequent derepression of primary response

107

genes. The results extend the emerging paradigm (Tan et al. 2007, Dharmasiri et
al. 2005, Kepinski et al. 2005) of F-box proteins as intracellular sensors of small
molecules to trigger the destruction of regulatory proteins and suggest a common

evolutionary origin of the JA and auxin response pathways.

108

References

Bender, C. L., Alarcon-Chaidez, F. 8 Gross, 'D. C. (1999) Pseudomonas
syringae phytotoxins: mode of action, regulation, and biosynthesis by peptide
and polyketide synthetases. Microbiol. Mol. Biol. Rev. 63: 266-292.

Boter, M., Ruiz-Rivera, 0., Abdeen, A. 8 Prat, 8. (2004) Conserved MYC
transcription factors play a key role in jasmonate signaling both in tomato and
Arabidopsis. Genes Dev. 18: 1577-1591.

Chini, A., Fonseca, 8., Fernandez, G., Adie, B., Chico, J. M., Lorenzo, 0.,
Garcia- Casado, G., Lopez-Vidriero, l., Lozano, F. M., Ponce, M. R., Micol, J.
L.8 Solano, R. (2007) The JAZ family of repressors is the missing link in
jasmonate signalling. Nature 448: 666-671.

Deshaies, R. J. (1999) SCF and cullin/RING H2-based ubiquitin ligases. Annu.
Rev. Cell Devel. Biol. 15: 435-467.

Dharmasiri, N., Dharmasiri, S. 8 Estelle, M. (2005) The F—box protein TIR1 is
an auxin receptor. Nature 435: 441-445.

Feys, B., Benedetti, C. E., Penfold, C. N. 8 Turner, J. G. (1994) Arabidopsis
mutants selected for resistance to the phytotoxin coronatine are male sterile,
insensitive to methyl jasmonate, and resistant to a bacterial pathogen. Plant Cell
6: 751-759.

Howe, G. 8 Jander, G. (2008) Plant immunity to insect herbivores. Annu. Rev.
Plant Biol. 59: 41-66.

Kang, J. H., Wang, L., Giri, A. 8 Baldwin, l. T. (2006) Silencing threonine
deaminase and JAR4 in Nicotiana attenuate impairs jasmonic acid-isoleucine-
medieted defenses against Manduca sexta. Plant Cell 18: 3303-3320.

Katou, 8., Yoshioka, H., Kawakita, K., Rowland, 0., Jones, J. D. G., Mori, H.
8 Doke, N. (2005) Involvement of PPS3 phosphorylated by elicitor-responsive
mitogen-activated protein kinases in the regulation of plant cell death. Plant
Physiol. 139: 1914—1926.

Kepinski, S. 8 Leyser, O. (2005) The Arabidopsis F-box protein TIR1 is an
auxin receptor. Nature 435: 446-451.

Koch, T., Krumm, T., Jung, V., Engelberth, J. 8 Boland, W. (1999) Differential

109

induction of plant volatile biosynthesis in the lime been by early and late
intermediates of the octadecanoid-signaling pathway. Plant Physiol. 121: 153-
162.

Koda, Y., Takahashi, K., Kikuta, Y., Greulich, F., Toshima, H. 8 Ichihara, A.
(1996) Similarities of the biological activities ofcoronatine and coronafacic acid to
those of jasmonic acid. Phytochemistry 41: 93-96.

Kramell, R., Schmidt, J., Schneider, G., Sembdner, G. 8 Schreiber, K. (1988)
Amino acid conjugates of jasmonic acid induce jasmonate-responsive gene
expression in barley (Hordeum vulgare L.) leaves. Tetrahedron 44: 5791-5807.

Kramell, R., Miersch, O., Hause, B., Ortel, B., Parthier, B. 8 Wasternack, C.
(1997) Synthesis of N-(jasmonoyl)amino acid conjugates. FEBS Lett. 414: 197-
202.

Krumm, T., Bandemer, K. 8 Boland, W. (1995) Induction of volatile
biosynthesis in the lime bean (Phaseolus lunetus) by leucine— and isoleucine
conjugates of 1- oxo- and 1-hydroxyindan-4-carboxylic acid: evidence for amino
acid conjugates of jasmonic acid as intermediates in the octadecanoid signalling
pathway. FEBS Lett 377: 523-529.

Lauchli, R. 8 Boland, W. (2003) lndanoyl amino acid conjugates: tunable
elicitors of plant secondary metabolism. Chem. Rec. 3: 12-21.

Li, L. 8 Howe, G. A. (2001) Alternative splicing of prosystemin pre-mRNA
produces two isoforms that are active as signals in the wound response pathway.
Plant Mol. Biol. 46: 409—419.

Li, L., Zhao, Y., McCaig, B. C., Wingerd, B. A., Wang, J., Whalon, M. E.,
Pichersky, E. 8 Howe, G. A. (2004) The tomato homolog of CORONATINE-
INSENSITIVE1 is required for the maternal control of seed maturation,
jasmonate-signaled defense responses, and glandular trichome development.
Plant Cell 16: 126-143.

Parry, G. 8 Estelle, M. (2006) Auxin receptors: a new role for F-box proteins.
Curr. Opin. Cell Biol. 18: 152-156.

Rojo, E., Titarenko, E., Leon, J., Berger, 8., Vancanneyt, G. 8 Sanchez-
Serrano, J. J. (1998) Reversible protein phosphorylation regulates jasmonic
acid-dependent and -independent wound signal transduction pathways in
Arabidopsis thaliana. Plant J. 13: 1 53-165.

830, H. 8., Song, J. T., Cheong, J. J., Lee, Y. H., Lee, Y. W., Hwang, l., Lee, J.

S. 8 Choi, Y. D. (2001) Jasmonic acid carboxyl methyltransferase: a key enzyme
for jasmonate-regulated plant responses. Proc. Natl. Acad. Sci. U.S.A. 98: 4788-

110

4793.

Staswick, P. E., Tiryaki, l. 8 Rowe, M. L. (2002) Jasmonate response locus
JAR1 and several related Arabidopsis genes encode enzymes of the firefly
luciferase superfamily that show activity on jasmonic, salicylic, and indole—3-
acetic acids in an assay for adenylation. Plant Cell 14: 1405-1415.

Staswick, P. E. 8 Tiryaki, I. (2004) The oxylipin signal jasmonic acid is activated
by an enzyme that conjugates it to isoleucine in Arabidopsis. Plant Cell 16: 2117-
227.

Staswick, P. E., Yuen, G. Y. 8 Lehman, C. C. (1998) Jasmonate signaling
mutants of Arabidopsis are susceptible to the soil fungus Pythium in'egulere.
Plant J. 15: 747-754.

Stintzi, A., Weber, H., Reymond, P., Browse, J. 8 Farmer, E. E. (2001) Plant
defense in the absence of jasmonic acid: the role of cyclopentenones. Proc. Natl.
Acad. Sci. U.S.A. 98: 12837-12842.

Tan, X., Calderon-Villalobos, L. l., Sharon, M., Zheng, C., Robinson, C. V.,
Estelle, M. 8 Zheng, N. (2007) Mechanism of auxin perception by the TIR1
ubiquitin ligase. Nature 446: 640-645.

Thilmony, R., Underwood, W. 8 He, 8. Y. (2006) Genome-wide transcriptional
analysis of the Arabidopsis thaliana interaction with the plant pathogen
Pseudomonas syringae pv. tomato DC3000 and the human pathogen
Escherichia coli 0157: H7. Plant J. 46: 34-53.

Thines, 8., Katsir, L., Melotto, M., Niu, Y., Mandaokar, A., Liu, G., Nomura,
K., He, 8. Y., Howe, G. A. 8 Browse, J. (2007) JAZ repressor proteins are
targets of the SCF(COI1) complex during jasmonate signalling. Nature 448: 661-
665.

Uppalapati, S. R., Ayoubi, P., Weng, H., Palmer, D. A., Mitchell, R. E., Jones,
W. 8 Bender, C. L. (2005) The phytotoxin coronatine and methyl jasmonate
impact multiple phytohormone pathways in tomato. Plant J. 42: 201-217.

Vanholme, B., Grunewald, W., Bateman, A., Kohchi, T. 8 Gheysen, G. (2007)
The tify family previously known as ZIM. Trends Plant Sci. 12: 239—244.

Yan, Y., Stolz, 8., Chetelat, A., Reymond, P., Pagni, M., Dubugnon, L. 8

Farmer, E. E. (2007) A downstream mediator in the growth repression limb of the
jasmonate pathway. Plant Cell 19: 2470-2483.

111

Wang, L., Halitschke, R., Kang, J. H., Berg, A., Harnisch, F. 8 Baldwin, I. T.
(2007) Independently silencing two JAR family members impairs levels of trypsin
proteinase inhibitors but not nicotine. Planta 226: 159-167. ,

Wasternack, C. (2007) Jasmonates: an update on biosynthesis, signal
transduction and action in plant stress response, growth and development. Ann
Bot (Land) 100: 681-697.

Xie, D. X., Feys, B. F., James, 8., Nieto-Rostro, M. 8 Turner, J. G. (1998)
COI1: an Arabidopsis gene required for jasmonate-regulated defense and
fertility. Science 280: 1091-1094.

Zhao, Y., Thilmony, R., Bender, C. L., Schaller, A., He, 8. Y. 8 Howe, G. A.
(2003) Virulence systems of Pseudomonas syringae pv. tomato promote

bacterial speck disease in tomato by targeting the jasmonate signaling pathway.
Plant J. 36: 485-499.

112

Chapter 4

Biochemical characterization of the jasmonate receptor

113

Abstract

Jasmonic acid (JA) and its derivatives, collectively known as jasmonates, are
potent signals in growth regulation, reproductive development, and host immunity
to insects and pathogens. Among the central components of the JA signaling
cascade are the E3 ubiquitin ligase SCFCOI1 and JAZ proteins that repress
transcription of JA-responsive genes. Recent studies provide evidence that the
JA-amino acid conjugate jasmonoyl-isoleucine (JA-lle) initiates signal
transduction by promoting the formation of a stable complex between the F-box
protein COI1 and JAZ. The bacterial toxin coronatine (COR) is a structural mimic
of JA-lle and a potent agonist of this hormone receptor system. Here we show
that JA-lle and COR also promote interaction between Arabidopsis COI1 and
previously uncharacterized JAZ proteins. In vitro pull down experiments
performed with purified AtCO|1 showed that COI1 alone is not a JA receptor.
These findings show that ligand binding requires both COI1 and JAZ. Testing of
isomers of JA-lle in receptor binding assays have found that the orientation of the
side-chains of JA-lle affect its binding affinity. Pull down assays with JA-lle
derivatives identified structural features of JA-lle and COR which promote a
COI1-JAZ interaction and have provided insight into how the JA signal can be

attenuated in vivo.

114

Introduction

Jasmonic acid is the classical member of a family of linolenic acid derived
cyclized oxylipins, the jasmonates (JA). JAs regulate diverse aspects of plant
defense, growth, and reproductive development (Browse 2005, Wasternack
2008). The vast majority of JA—°mediated responses are dependent on a
functional COI1 (Devoto et al. 2005). As the F-box component of the SCFCO1
complex, COI1 establishes the specificity of the complex to bind to and target
JAZ repressors for ubiquitin-mediated degradation (Thines et al. 2007, Chini et
al. 2007). Degradation of JAZ proteins by COI1 activates the expression of JA-
responsive genes. Mutations that impair the turnover of JAZ result in the
constitutive repression of such genes (Thines et al. 2007, Chini et al. 2007).
Receptor-binding studies show a COI1-JAZ complex is the site of binding for
jasmonoyl-isoleucine (JA-lle) and the phytotoxin coronatine (COR) (Katsir et al.
2008). Such studies have yet to resolve if COI1 can act as a receptor in the
absence of JAZ but do indicate that COI1 is an essential component of the JA

receptor.

It is unclear whether jasmonic acid is recognized at the site of JA
perception. Rather, the emerging view is that JA-lle is the primary ligand for the
JA receptor. Both JA and JA—lle accumulate rapidly in response to wounding
(Chung et al. 2008, Suza et al. 2008). The rapid increase in both compounds
correlates with the induction of JA-responsive genes (Chung et al. 2008). The
characterization of jar1 plants, partially insensitive to JA but highly responsive to

JA-lle, indicate that conjugation of JA to isoleucine is important for JA perception.

115

JA-lle is primarily synthesized by the enzyme JAR1 that forms an isopeptide
bond between JA and the free carboxyl of isoleucine (Staswick et al. 2004).
Synthesis of JA-lle is required for a robust defense response to some insects and
pathogens (Staswick et al. 1998, Laurie-Berry et al. 2006, Kang et al. 2006). It is
not yet clear that all JA responses are initiated by the perception of JA-lle, as a

plant devoid of JA-lle has yet to be characterized.

JAZ proteins from both tomato and Arabidopsis interact with COI1 in a JA-
lle dependent manner. However, it is not known whether all JAZ proteins act in
this way (Katsir et al. 2008, Thines et al. 2007, Melotto et al. 2008). The JAZ
gene family in Arabidopsis contains twelve members, and in tomato seven JAZ
genes have been identified (Thines et al 2007, Chini et al 2007, Katsir et al.
2008, Katsir and Howe unpublished). Sequence similarity among JAZ proteins is
primarily limited to two signature sequence motifs. The TIF[F/Y]XG sequence is
highly conserved in all JAZ proteins and is located within the so-called ZIM
domain (Vanholme et al. 2007). Proteins that possess this sequence are part of a
larger TIFY family which include the PEAPOD (PPD) proteins that regulate leaf
development (White et al. 2006), as well as other members which contain zinc-
finger DNA binding domains (Shikata et al. 2003). Arabidopsis JAZ1 and JAZ3
are located in the nucleus, however neither contains a known DNA binding
domain (Chini et al. 2007, Thines et al. 2007). The C-terminal Jas motif
SLXzFXZKszRstY is the second distinguishing feature of the JAZ proteins
(Chini et al. 2007, Thines et al. 2007). The C-terminal domain of JAZ, containing

the Jas motif is necessary and sufficient for the formation of the COI1-JAZ

116

receptor complex (Katsir et al. 2008). Mutagenesis of conserved residues within
the Jas motif indicates this sequence maybe the site of JAZ binding to COI1
(Melotto et al. 2008). It is also through its C-terrninal domain that JAZ interacts
with MYC2, a basic helix-loop-helix (bHLH) transcription factor that is a positive
regulator of JA-responsive gene expression (Chini et al. 2008). Interestingly,
point mutations in the Jas motif that abrogate JA-lle stimulated COI1-JAZ binding

does not effect the interaction of JAZ with MYC2 (Melotto et al. 2008).

The JA signalling pathway may have mechanisms to attenuate itself. The
observation that JAZ genes are rapidly and transiently induced led to the
hypothesis that JAZ proteins may act to repress their own synthesis (Thines et al.
2007). Resynthesis of JAZ proteins during the JA response would provide a
negative feedback loop that could attenuate the responses. Both JA and JA-Ile
levels begin to decrease after an initial burst in response to wounding possibly
due to metabolism (Chung et al. 2008, Suza et al. 2008). Enzymatic modification
of JA-lle may be another route to attenuate the JA response. The fate of JA-lle is
poorly characterized. However, several derivatives of JA-lle that may represent
an inactivation pathway have been identified (Miersch et al. 2008). Hydroxylated
(12-OH-JA—lle) and di-carboxylated derivatives of JA-lle have been detected in
wounded plant tissue (Glauser et al. 2008). The phased accumulation of some of
these compounds suggests that they are products of JA—lle metabolism. In
tomato, methyl-JA-Ile (Me-JA-lle) has been detected in flowers (Hause et al
2000). It is not known if any of these compounds retain activity similar to that of

JA-lle or whether they represent distinct signalling molecules.

117

Here we have characterized several diverged JAZ proteins in Arabidopsis
and have shown that they interact with COI1 in a JA—lle and COR-dependent
manner. To determine whether the JA receptor requires both COI1 and JAZ
components acting together, rather than COI1 alone, we tested purified COI1 in a
radio-ligand binding assay. Taking advantage of a small library of JA-lle
conjugates we are able to assess the active moieties of the core JA molecule.
The loss of activity in some JA-Ile derivatives suggests modification of JA-Ile can
attenuate the JA signal. These results also provide insight into the characteristics
of COR that confer its strong activity compared to JA-lle in promoting a COI1-

JAZ interaction.

118

Materials and Methods
Biological Materials

Growth conditions for Solarium lycopersicum (tomato) and Arabidopsis thaliana
were previously described (Li et al. 2001, Koo et al. 2006). A 358-8ICOl1-Myc
transgenic line of tomato (cv Microtom) and a 35S-AtCOl1-Myc transgenic line of
Arabidopsis were used as sources of SICOI1-Myc and AtCOl1-Myc, respectively,

for pull-down experiments (Thines et al. 2007, Melotto et al. 2008).
Chemicals

Coronatine (C8115) and (:c) jasmonic acid were purchased from Sigma. 12-OH-
jasmonoyl-isoluecine (12-OH-JA—Ile), 12-oxo-phytodienoic acid isoleucine
(OPDA-lle), jasmonoyl-coranamic acid (JA-CMA) were synthesized and the
resulting compounds were verified by GC-MS as described previously (Kramel et
‘ al 1998, Staswick et al. 2004). lsomers of (3R, 7R)-cucurbinoyl-isoluecine were
prepared as reported previously (Kramel et al. 1999). The naturally occurring (-)-
JA-lle isomer was used in pull-down assays, whereas all other JA conjugates
were used as a mixture of the (+)-JA- and (-)-JA-amino acid diastereomers. The
synthesis of the four stereoisomers of JA-lle was carried out by Dr. Yuichl
Kobayashi (Department of Biomolecular Engineering, Tokyo Institute of
Technology). A description of the synthesis and characteristics of [3H]-COR was

previously reported (Katsir et al. 2008).

119

Cloning and Expression of Fusion Proteins

The AtJAZ1 cDNA was amplified by PCR using the primers JAZ1-Not1 (5'-
GCGCGGCCGCCATGTCGAGTTCTATGGAATGTTCT-3') and JAZ1-Xho1 (5'-
CCCTCGAGTATTTCAGCTGCTAAACCGAG-3'). The AtJAZ3 cDNA was
amplified using the primers AtJAZ3-Not1 (5’-
GCGCGGCCGCCATGGAGAGAGATT'I'TCTCGGG'ITG -3’) and AtJAZ3-Xho1
(5’- CCCTCGAGGGTTGCAGAGCTGAGAGAAGAACT -3'). The AtJA26 cDNA
was amplified using the primers AtJAZG-Not1 (5’-
GCGCGGCCGCCACGGGACAAGCGC -3’) and AtJAZ6-Xho1 (5’ —
CGGCTCGAGAAGCTTGAGTTCAAGGTITITGG -3’). The AtJAZ 7 cDNA was
amplified using the primers AtJAZ7-Not1 (5’-
GCGCGGCCGCCATCATCATCAAAAACTGCGACAAGCC -3’) and AtJAZ7-
Xho1 (5’- CGGCTCGAGTCGGTAACGGTGGTAAGG -3’). The AtJAZ12 cDNA
was amplified using the primers AtJAZ12-Not1 (5’-
GCGCGGCCGCCGTGAAAGATGAGCCACG -3’) and AtJAZ12-Sal1 (5’-
TCGGTCGACAGCAGTTGGAAATTCCTCC -3’) (restriction sites underlined).
The PCR products were digested with Notl and Xhol (or Sal1 in the case of
AtJAZ12) and cloned into the corresponding sites of pRMG-nMAL to produce
MBP-JAZ-6XHis fusion products (Thines et al., 2007). Cloning of SIJAZ1 and
SlJAZ3 into pRMG-nMAL was described previously (Katsir et al. 2008).
Expression and purification of JAZ-fusion proteins was previously described
(Thines et al. 2007, Katsir et al. 2008). GST-AtCOl1 and ASK1-6XHis (GST-

AtCOI1) were co-expressed and purified to >90% homogeneity as described

120

previously for the expression and purification of TIR1 (T an et al. 2007). Week
expression of AtJAZ7-His resulted in purification of this fusion protein to ~60%

homogeneity (data not shown).
Pull-Down and [3Hj-COR Binding Assays

A 35S-SlCOl1-Myc transgenic line of tomato and a 35S-AtCOl1-Myc line of
Arabidopsis were used as sources of SICOI1-Myc and AtCOl1-Myc, respectively
(Thines et al. 2007, Melotto et al. 2008). Unless otherwise indicated, the quantity
of JAZ-His added to each reaction was 25 pg. For pull-down reactions with
AtJAZ7-His, 50 pg of the purified protein was used. Protein concentrations were
determined with a BCA Protein Assay kit (Pierce). [3H]-COR binding assays
contained 20 pg AtJAZ12-His, 2 pg GST-AtCOl1, and 500 nM [3H]-COR in a final
volume of 0.1 mL binding buffer (50 mM Tris pH 6.8, 10% glycerol, 100 mM
NaCl, 0.1% Tween-20, and Complete Mini Protease Inhibitor tablet-EDTA free
Roche) and were performed in triplicate. Binding specificity was determined by
addition of 500 fold unlabeled COR.

Competitive binding reactions were supplemented with increasing
concentrations of either unlabeled COR, one of the four JA-Ile isomers, or
jasmonic acid. Reactions were incubated at 4°C for 30 min, after which 25 pl of
glutathione resin (Pierce) was added. Following an additional 15-min incubation
at 4°C, GST-AtCOl1-bound glutathione resin was washed three times on micro-
centrifuge spin columns with 0.25 ml binding buffer at 4°C. GST-COI1 was eluted
from the resin with 200 pl of a solution containing 10 mM reduced glutathione

(Pierce). Radioactivity in the resulting eluent was measured by scintillation

121

counting after addition of 1 ml scintillation fluid (MicroBeta Trilux, Perkin Elmer).

Results

Arabidopsis JAZ proteins interact with COI1

Several Arabidopsis JAZ (AtJAZ) proteins, including AtJAZ1, AtJAZ3, and
AtJAZ9 interact with Arabidopsis COI1 (AtCOI1) in a JA-lle and COR dependent
manner (Thines et al. 2007, Melotto et al. 2008). We used a similar pull-down
assay to test the interaction between AtCOI1 and several additional AtJAZs that
were expressed as MBP-6XHis fusion proteins (designated AtJAZ-His). To
determine if JA-lle is a ligand for other COI1-JAZ pairs, we tested three
uncharacterized JAZ proteins (AtJAZ6, AtJAZ7, and AtJAZ12) that are diverged
from two previously characterized JAZ proteins AtJAZ1 and AtJAZ3, which were

included as positive controls.

The positive controls AtJAZ1-His and AtJAZ3-His, as well as AtJAZ12-His
recovered AtCOl1-Myc above background levels in pull down assays

supplemented with 1 pM JA-lle (Thines et al. 2008, Melotto et al. 2008)

122

AtJAZ1-H18 AtJAZ3-H18 AtJAZ12-His

 

 

 

 

      

 

 

 

 

 

 

 

 

 

 

 

JA-Ile (PM) : 0 1 10 0 1 10

COI1-Myc ’ g e . f j ,
AUAZB-HIS AtJAZT-Hls

JA-lle(pM): 0 1 10 25 - 0 1 10 25 f

 

 

I "*— ——- x.__-_.—y- .__-— ——-—-—-— _-—-

COI1-Myc "1 "—1

 

 

 

 

 

51,34.

      

 

Figure 4.1. JA-lle promotes JAZ interaction with COI1. ’

Pull-down assays were preformed by mixing extracts from 35S-AtCOl1—Myc
plants with recombinant AtJAZ1—His, AtJAZ3-His, AtJAZG-His, AtJAZ7-His, or
AtJAZ12-His Assays were supplemented various concentrations of JA-lle and
incubated for 30 min at 4°C. Protein bound to JAZ-His was analyzed by
immunoblotting for the presence of AtCOl1—Myc. The Coomassie Blue-stained

blot in each panel shows the recovery of JAZ-His by the Ni-affinity resin.

123

Higher concentrations of JA—lle [10 pM] enhanced the recovery of AtJAZ1,
AtJAZ3, and AtJAZ12, demonstrating the dose dependence of hormone induced
binding. Binding of AtJAZ6-His to AtCOI1-Myc was only slightly enhanced by
1pM JA-lle in comparison to the mock control (Figure 4.1). Recovery of AtCOl1-
Myc by AtJAZ6-His was clearly enhance by higher concentrations of JA-Ile (10
and 25 pM). No binding above background levels was seen at 1 pM JA-lle, only
low amounts of AtCOl1-Myc were recovered in reactions containing 10 pM JA-
lle. Robust recovery of AtCOl1-Myc by AtJAZ7-His was observed in the presence
of 25 pM JA—lle. The weaker binding found in AtJAZ6-His and AtJAZ7-His pull
downs may reflect a weak affinity for AtCOl1 for these proteins. It cannot be ruled
out that the purity of AtJAZ7-His may account for its weak binding compared with

other AtJAZ- proteins.

We next tested whether binding of AtJAZ1, 3, 6, 7, and 12 to AtCOl1 is
stimulated by COR. All AtJAZ-His proteins assayed interacted with AtCOl1 in the
presence of 1 prl COR (Figure 4.2). These results indicate that COR exerts its
influence on JA signaling by promoting the interaction of COI1 with a majority of

the JAZ proteins, rather than selectively targeting a small sub-set.

124

AtJAZ1 AtJAZ3 AtJAZ1 2 AtJAZB AUAZT

 

 

COR (pM) : 0 1 0 1 0 1 o 1 o 1
I
COI1-Myc - - . - -

 

 

 

 

 

 

 

 

Figure 4.2. Coronatine promotes interaction with COI1 with several members of
the Arabidopsis JAZ family.

Pull-down assays were preformed with recombinant JAZ1-His, JAZ3-His, JAZG-
His, JAZ7-His, or JAZ12-His and extracts from 358-AtCOl1—Myc plants. Assays
were supplemented with various concentrations of COR and carried out as
described in Figure 4.1. The Coomassie Blue-stained blot in each panel shows

the recovery of JAZ-His by the Ni-affinity resin.

125

Ligand binding requires COI1 and JAZ

Previous studies showed that COI1 is an essential component of the receptor for
COR and JA-Ile (Katsir et al. 2008). However, because these receptor-binding
experiments depended on pull downs with JAZ protein we could not distinguish
whether COI1 acts as a receptor on its own or whether JAZ was required for
binding as well (Figure 4.3A). To address this question we collaborated with Dr.
Ning Zheng’s lab to obtain purified COI1 as a fusion to glutathione s-transferase
(GST-COI1). The availability of purified COI1 allowed us to test the ligand binding
characteristics of COI1 in the absence of JAZ. Pull down reactions containing
both AtCOl1-GST and AtJAZ12-His specifically recovered [3H]-COR (Figure
4.3C). Specific binding of COR to AtJAZ12 was not observed in the absence of
COI1, consistent with previous work with SIJAZ3. When GST—COI1 was tested
for its interaction with [3H-j-COR, specific binding was not detected. The inability
of [3H-]-COR to bind specifically to GST-COI1 or JAZ suggests that COI1-JAZ
may form a co-receptor complex. These results indicate that COI1 and JAZ are
both necessary for ligand binding, and that the two proteins together are

sufficient for binding.

COI1-JAZ is selective for JA-lle isomers

Jasmonic acid possesses two chiral centers at the C-3 and C-7 positions,
resulting in four possible isomers of jasmonic acid (Figure 4.4A). The biosynthetic
pathway of jasmonic acid guides the natural product into a (+)—(3R, 7S)
conformation, with the two side chains of the cyclopentenone ring in the cis

arrangement.

126

Figure 4.3. COI1-JAZ is a co-receptor.

Two models for JA-Ile binding to a COI1-JAZ receptor complex are
presented. A, COI1 first binds JA-Ile, which enhances COl1’s ability to
bind JAZ. B, Neither COI1 nor JAZ alone can bind to JA-Ile. The two
proteins may have weak affinity for each other in the absence of ligand
(Chini et al. 2007). JA—lle enhances the affinity of COI1 for JAZ, resulting

in a COI1-JA—Ile-JAZ complex. C, Pull-down reactions containing
AtJAZ12-His, GST-AtCOI1, and [3H]-COR were incubated in the presence
(+) or absence (-) of 1000-fold unlabeled COR. The amount of radioactivity
recovered by the GST-AtCOI1 complex is shown. Error bars denote the

SD of triplicate assays.

127

 

 

 

 

 

 

 

 

 

 

8000 ‘

6000 -
CPM -
4000 4

2000 .

 

 

500x COR : - + - + - + . +

R081" Resin 8 Resin 8 Resin 8
COI1 COI1 8 JAZ12 JAZ12

Figure 4.3. COI1-JAZ is a co-receptor.

128

The stereochemistry of jasmonic acid is established during cyclization by the
enzyme allene oxide cyclase (Ziegler et al. 1999). The cis configuration of JA is
less stable than JA with its side chains in trans. As a result the unstable cis
configuration, (+)-(3R, 7S)-JA undergoes epimerization to produce the (-)-(3R,
7R)-JA isomer, which has its side chains in the trans orientation. Naturally
synthesized jasmonic acid and JA-lle is a mixture of isomers in the cis and trans
conformations (Vick and Zimmerman 1984, Holbrook et al. 1997).

To understand how the isomeric configuration of JA-lle affects binding to
COI1-JAZ, we tested the ability of four isomers of JA-lle to compete with [3H]-
COR in competition binding assays (Figure 4.43). Unlabeled COR effectively
competed for the GST—COl1-AtJAZ-His binding site. The EC50 (50% effective
competition) for COR was 6 pM. The four JA-Ile isomers tested all competed with
COR for the COI1-JAZ binding site, but to differing degrees. The natural product
(3R, 7S)-JA-Ile and the (3S, 7S)-JA-lle isomer exhibited E050 values of 35 pM
and 45 pM, respectively, that were six to seven fold higher than COR. The other
two isomers, (3S, 7R)-JA-lle and (3R, 7R)-JA-Ile, were ~60 to 130 (EC50 of 350
pM and 800 pM) fold less active than COR, respectively. The lack of competition

with jasmonic acid is consistent with its inability to promote a COI1-JAZ complex.

129

Figure 4.4. Activity of JA-Ile isomers in competitive binding assays

A, Molecular structures of the four isomers of JA-lle and COR. B, Pull-
down reactions containing AtJAZ12 and GST-AtCOI1 were incubated
with [3H]-COR in the presence of increasing concentrations of unlabeled
COR (C), (3R,7S; K1) JA-Ile (O), (38, 7R; K2) JA-lle (A), (3R, 7R; K3)
JA-lle (A), (38, 7S; K4) JA-lle (I), and jasmonic acid ([2]). Radioactivity
recovered with JAZ12-His is indicated (CPM). C, Pull down assays were
performed with recombinant SlJAZ3-His and extracts from 358-COI1-Myc
plants supplemented with COR or an isomer of JA-lle at the concentration
indicated. The Coomassie Blue-stained blot in the lower panel shows the

recovery of protein by the Ni-affinity resin.

130

‘°: 33.33,]...in
Tic {to w w

 

 

 

 

 

 

 

(K1) (3875) 0(2) (35.7R) (K3) (387R) (K4) (33.73)
(+) IA-Ile (-) lA-lle t-l IA-Ile (+) lA-Ile
B /
8000i
D
6000
GP" COR- 0
4000 K1 - o
‘ K2 A
K3 .
2000‘ m _ .
C JA Cl
* . l
Fold CompotltornLfi/ 00
Compound: MK K1 K2 K3 K4 COR
nM: 1 10 1 10 1 10 1 10 1 10
SICOI1-Myc

SIJAZS-His

 

Figure 4.4. Activity of JA-lle stereoisomers

131

lsomers of JA-lle were also tested for their ability to promote a interaction
between SICOI1-Myc and SIJAZ3-His. The results showed pattern of activity
similar to what was observed in [3H]-COR competition assays is seen (Figure
4.4C). The most active of the isomers were (3R, 7S)- JA-Ile and (3S, 7S)-JA-lle.
These compounds stimulated the recovery of more SICOI1 than the (38, 7R)-JA—
lle and the (3R, 7R)-JA—lle. The similarity of the isomer preference in Arabidopsis
and tomato likely represent a conserved structural element that determines

specificity.

Structure activity relationships of JA-lle derivatives

We tested the ability of 12-OH-JA-lle to promote SICOI1 interaction with
SlJAZ3 in a pull down assay (Figure 4.58). This modification of the pentenyl
moiety of JA-lle had no effect on the amount of COI1-Myc recovered by SIJAZ3-
His. However, the interaction between SICOI1 and SIJAZ1-His was greatly
reduced in reactions supplemented with 12-OH-JA—lle compared to JA-lle. This
indicates that hydroxylation of the pentenyl side chain could potentially promote
some COI1-JAZ interactions while blocking others. These results also reinforce
previous observation that SlJAZ3 is less discriminating than SIJAZ1 with its

ligand preference (Katsir et al. 2008).

132

Figure 4.5. Binding activity of various JA-lle derivatives

A. Molecular structures of 12-OH-JA—lle, cucurbinoyl-isoleucine, OPDA,
and OPDA-lle. B, COI1-Myc pull-down assays were preformed with
SIJAZ1—His or SlJAZ3-His. Assays were supplemented with JA-lle (Jl),
12-OH-JA-lle (OH-J), (68)-curubinoyl-(S)-lle (C1), (6R)-cucurbinoyl-(S)-Ile
(C2), (6S)-cucurbinoyl-(R)-lle (C3), or (6R)-cucurbinoyl-(R)-lle (C4). C,
COI1-Myc pull-down assays were preformed with SIJAZ1-His or SIJAZ3-
His COI1-Myc and supplemented with JA—lle (J-lle), OPDA, or OPDA-lle
(O-Ile) at the indicated concentration. The Coomassie Blue-stained blot in

the lower panel shows the recovery of protein by the Ni-affinity resin.

133

 

 

 

o “0
\ 7
O “H o 9“
O O
0“ cr‘
12-OI-I-JA-lle CucurblnoyI-Ile OPDA OPDA-II.
B Mk JI OH-J c1 c2 cs C4
COI1-Myc ’11-
JAZ1-HI:
Mk Jl OH-J 01 c2 ca c4
COI1-Myc ~
JAZ3-His I
C. 2‘ \0 V1 \0
pm: 0 1 so 50 pm: 0 1 so so
COU'MYC I - I comma I Q I

 

 

 

 

Jaw" I . I JAZ3-His I a 1

Figure 4.5. Binding activity of various JA-lle derivatives.

134

The cyclopentenone ring is another distinguishing feature of JA-lle on
COR (Figure 4.5A). To test the importance of this substituent in the COI1-JAZ
interaction, we compared the activity of cucurbinoyl-Ile (CA-lie) to that of JA-lle in
SICOI1 pull down assays. CA-Ile is a JA-lle derivative in which the ketone of the
cyclopentenone ring is replaced by an alcohol (Figure 4.5A). Four isomers of CA-
Ile representing epimers of the cyclopentanol conjugated to either (R) or (8) lie
were tested (Figure 4.5B). No recovery of COI1-Myc above background was
detected in pull downs conducted with SIJAZ1 or SIJAZ3 in the presence of 1pM
CA-lle, whereas the same concentration of JA-Ile stimulated a robust recovery of
COI1-Myc. These results demonstrate that the ketone group on the
cyclopentenone ring is essential for hormone-induced COI1-JAZ interaction and
that lle-conjugated derivatives of cucurbic acid are not likely to signal through

COI1.

The JA biosynthetic precursor 12-oxo-phytodienoic acid (OPDA) has been
implicated as a signal for COI1-dependent responses (Stintzi et al. 2001, Ribot et
al. 2008). However, OPDA does not promote a COI1 interaction with any tomato
or Arabidopsis JAZ proteins tested to date (Thines et al. 2007, Katsir et al. 2008,
Melotto et al. 2008). One possibility is that OPDA is conjugated to lie to enhance
its activity, though an OPDA-lie conjugate has never been detected in plants.
This compound also provides a tool to test the importance of lle proximity to the
cyclopentenone ring (Figure 4.5A). To test this idea, the activity .of OPDA and

OPDA-lie was compared to JA-Ile in a COI1-Myc pull down assay (Figure 5.4C).

135

The results showed that OPDA-lie was unable to promote COI1 interaction with

either SIJAZ1-His or SlJAZ3-His at concentrations 50 times higher than JA-lle.

We previously reported that COR is 100 to 1000-fold more active than JA-
lle in promoting COI1—JAZ interactions in tomato (Katsir et al. 2008). COR is a
conjugate of coronafacic acid (CFA) and coronamic acid (CMA) (Figure 4.6A). It
was also shown that both the CFA and the CMA moieties of COR lack the ability
to promote a COI1-JAZ interaction (Melotto et al. 2008). To address the basis of
COR’s enhanced activity we tested the activity of a jasmonate-COR chimera
consisting of jasmonic acid conjugated to CMA (Figure 4.6A, B). The results
show that both SIJAZ1-His and SlJAZ3-His recovered slightly less SICOI1 in the
presence of JA-CMA compared to JA-lle. This result indicates that the CMA
moiety of COR is not sufficient to account for the enhanced ability of COR

(relative to JA-lle) in promoting COI1-JAZ binding.

136

A' .. CFA

NH 0 NH ° ""
OH H H
JA-Ilo JA-CMA Coronatine
B.
JA-Ilo JA-CMA JA-Ilo JA-CMA
MI: 0 1 1 I‘M: 0 1 1

 

 

COI1-Myc ,.... *1 COI1-Myc “an—q

 

 

 

 

JAZ1-HI: JAZ3-H Is

 

 

 

 

 

 

Figure 4.6. Comparison of JA-lle and JA—CMA

A, The molecular structures of JA-lle, JA-CMA, and coronatine. B, Pull-down
assays were preformed with SIJAZ1-His and SlJAZ3-His and extracts from 358-

SICOl1-Myc plants. Assays were supplemented with 1 pM JA-lle or JA-CMA.
The Coomassie Blue-stained blot in the lower panel shows the recovery of

protein by the Ni-affinity resin.

137

Methylation of JA-Ile reduces its activity in promoting a COI1-JAZ
interaction.

Me-JA-lle was previously shown to accumulate in tomato flowers, suggesting that
this compound may play a role in JA signaling (Haues et al. 2000). We compared
the activity of Me-JA-Ile to that of JA-lle in COI1-Myc pull down assays with
SIJAZ1-His and SIJAzs-His (Figure 4.7). At a concentration of 1 pM, MeJA-lle
promoted the recovery of COI1-Myc by both SIJAZ1 and SIJAZ3. The activity of
JA-lle was at least 10-fold higher than that of Me-JA-Ile. These results suggest
that the methylation of JA-lle may serve as a way to attenuate the intensity of the

JA-lle signal.

138

 

 

 

     

o o
_ ? _
0 NH 0 NH
0% Oq/l‘l:

0H H3(5.0
3- MK .1: Me.” MK .u MeJl
nM: T :7; "a; T ‘l 10
COI1-Myc San-.3 COI1-Myc l M

 

 

 

 

 

 

 

 

SlJAZl-Hls f ‘ J sums: [ ‘ ]

Figure 4.7. Methylation of JA-Ile reduces its activity.

A, The structures of JA-lle and Me—JA-lle are shown in a reversible reaction
carried out by unknown enzymes. B, Pull-down assays were preformed with
SIJAZ1—His or SIJAZB-His and extracts from 35S-SICOI1—Myc plants. Assays
were supplemented with JA-lle (Jl) and Me-JA-lle (MeJl) at the indicated

concentrations.

139

Discussion

Our results add to a growing consensus that interaction of JAZ proteins
with COI1 is promoted by JA-lle (T hines et al. 2007, Melotto et al. 2008, Katsir et
al. 2008). Among the 12 JAZ proteins in Arabidopsis, JAZ1, JAZ3, JAZS, JAZ7,
JAZQ, and JAZ12 have been shown to interact with COI1 in the presence of JA-
lle and the JA-lle mimic, COR (Thines et al. 2007, Melotto et al. 2008). In tomato,
two diverged JAZ proteins also interact with COI1 in a JA—lle dependent manner
(Katsir et al. 2008). The presence of the highly conserved Jas motif, which is
required for COI1-JAZ binding in all JAZ proteins, supports the idea that other
JAZs have a similar preference for JA-lle (Katsir et al. 2008, Melotto et al. 2008).
Until all JAZ proteins are characterized, however, the possibility that some JAZs
do not interact with COI1 cannot be ruled out. The regulatory functions of JAZ

proteins likely involves JAZ binding partners such as MYC2 (Chini et al. 2007).

Previously we showed that SlJAZ may be more permissive than SIJAZ1
in its ligand-mediated interaction with COI1. Here, we found that the affinity for
binding COI1 in the presence of JA-lle was reduced for AtJAZG and AtJAZ7
compared with other JAZ proteins. This observation suggests that some JAZ
interact with COI1 in response to low concentrations of JA-lle, whereas other
JAZs interact with COI1 when JA-lle concentrations are very high. The existence
of JAZ proteins with different binding affinities could provide plants with a

mechanism to tune their responses to the relative level of JA-lle signal.

140

Our results also provide new insight into the mechanism of JA-lle
perception by COI1-JAZ. Previously we reported that COI1 or a COI1-JAZ
complex is a receptor for JA—lle and COR (Katsir et al. 2008). These studies
could not discriminate between models in which ligand binding is mediated by
COI1 alone or whether binding involves a COI1-JAZ complex. We found that
COI1 cannot bind COR in the absence of JAZ and that both COI1 and JAZ
together are required for a functional receptor complex. Because TIR1 binding to
auxin in the absence of Aux/IAA has not been demonstrated, this conclusion is
not fundamentally different from what has been reported for TlR1-Aux/IAA
binding to auxin. One possible model for COI1-JAZ binding to JA-lle (Figure
4.28) is that CO1 and JAZ have very weak hormone independent affinity for each
other and are in constant equilibrium (Chini et al. 2007). Increases in JA-lle
concentrations would shift this equilibrium toward COI1-JAZ complex formation
. when JA-Ile interacts with the two proteins. It cannot be ruled out that JA-lle
binds to COI1 with an affinity that is below our ability to detect it. Biophysical
approaches will be required to further investigate how small molecules promote

this novel mode of receptor-ligand binding.

Enzymatic modification of JA-lle may be involved in the attenuation of JA
signaling. Epimerization of newly synthesized jasmonic acid may also represent
a mechanism for tuning down the JA response. Jasmonic acid is synthesized in
the unstable cis conformation that naturally epimerizes to the trans conformation
by a keto-enol tautomerization (Holbrook et al. 1997). As a result of this

epimerization it is likely that JA-lle is composed of both cis and trans isomers.

141

The isomeric composition of JA-lle and jasmonic acid in planta is unknown.
Competitive binding assays with the four isomers of JA-lle showed that the side
chain orientation of JA-lle affects the formation of the COI1-JAZ complex. We
found that the natural cis isomer (+) (BR, 78) of JA-lle was ~20-fold more
effective at competing with COR than the corresponding trans isomer (-) (3R, 7R)
JA-lle. We also showed a similar preference for specific JA-Ile isomers to
promote COI1-JAZ interactions in tomato. Thus, epimerization of JA-lle has a
profound effect on its activity, and suggests epimerization may act as a natural

timer for deactivation of the JA signal.

Although the enzymes that hydroxylate JA and JA-lle have not been
identified, the presence of such hydroxylated compounds in several plant species
has been demonstrated (Yoshihara et al. 1989, Swiatek et al. 2004, Glauser et
al. 2008). The physiological significance of JA hydroxylation has been primarily
attributed to the tuber inducing properties of tuberonic acid (12-OH-JA). The
emerging view of hydroxylated jasmonic acid and JA-lle is that they represent
intermediates in a pathway for inactivation of the JA signal (Miersch et al. 2008).
Hydroxylation is also route to further enzymatic modifications, resulting in a
diversity of JA conjugates linked through the C12 position (Swiatek et al. 2008).
We found that 12-OH-JA-lle promotes the interaction between tomato JAZ
proteins and COI1. Interestingly, 12-OH-JA—lle was more effective in promoting a
COI1 interaction with SIJAZ3 than with SIJAZ1. This result leads us to suggest
that hydroxylation reduces the activity of JA-lle. The contribution of the

cyclopentanone ring of JA-lle was also investigated with isomers of cucurbinoyl-

142

isoleucine. The results of these experiments demonstrate an absolute
requirement for this functional group, which is also present at an equivalent

position of the COR structure.

We found that the CMA conjugate of JA. was not more active than JA-lle.
This result implies that the CFA portion of COR is largely responsible for the high
potency of the toxin. lndanoyl-isoleucine conjugates have an activity similar to
COR, also suggesting that the CFA moiety confers the enhanced activity
(F leigman et al. 1995). JA-lle isomers with the pentenyl side chain in the (7S)
orientation were more active than the (7R) JA-Ile (Figure 4.4). This may be due
to the orientation of this side chain relative to the ketone group of the
cyclopentanone ring. The COR ring structure is locked in an equivalent
conformation, which may explain why the activity of COR more closely resembles

the activity of JA-lle molecules with their side chain in the (7R) orientation.

We found that methylation of JA-lle at its free carboxylic acid decreases
COI1-JAZ binding. Because Me—JA-lle is produced in plants, methylation of JA-
He may be a way to attenuate the signal (Hause et al. 2000). Alternatively,
methylation of JA-lle may facilitate its intra or intercellular transport as a less
active signal until arrival in appropriate target tissue where demethylation of Me-
JA-lle promotes JAZ degradation. The detection of Me-JA-Ile in flowers suggests
that this molecule may play a role in reproductive development (Hause et al.

2000).

143

Acknowledgements

We are very grateful to Ning Zheng for the contribution of purified COI1. We
thank Sheng Yang He for the use of AtCOI1-Myc expressing plants. Thanks also
to Yuichi Kobayashi for the isomers of JA-lle and thanks also to Paul Staswick for

providing us with various jasmonate derivatives.

144

References

Browse, J. (2005). Jasmonate: an oxylipin signal with many roles in plants.
Vitamins and hormones 72: 431-56.

Chini, A., Fonseca, S., Fernandez, G., Adie, ,B., Chico, J., Lorenzo, O., et al.
(2007). The JAZ family of repressors is the missing link in jasmonate signalling.
Nature 448: 666-71.

Chung, H., Koo, A., Gao, X., Jayanty, S., Thines, B., Jones, A., et al. (2008).
Regulation and function of arabidopsis JASMONATE ZIM-domain genes in
response to wounding and herbivory. Plant Physiol. 146: 952-64.

Devoto, A., Ellis, C., Magusin, A., Chang, H.-S., Chilcott, C., Zhu, T., et al.
(2005). Expression profiling reveals COI1 to be a key regulator of genes involved
in wound- and methyl jasmonate-induced secondary metabolism, defence, and
hormone interactions. Plant Mol. Biology 58: 497-513.

Fliegmann, J., Schiller, G., Boland, W., Ebel, J., 8: Mithofer, A. (2003). The
role of octadecanoids and functional mimics in soybean defense responses. Biol!
Chem. 384: 437-46.

Glauser, G., Grata, E., Dubugnon, L., Rudaz, 8., Farmer, E., & Wolfender, J.-
L. (2008). Spatial and temporal dynamics of jasmonate synthesis and
accumulation in Arabidopsis in response to wounding. J. Biol. Chem. 283:
16400-7.

Hause, B., Stenzel, l., Miersch, O., Maucher, H., Kramell, R., Ziegler, J., et al.
(2000). Tissue-specific oxylipin signature of tomato flowers: allene oxide cyclase
is highly expressed in distinct flower organs and vascular bundles. Plant J.

Holbrook, L., Tung, P., Ward, K., Reid, D., Abrams, 8., Lamb, N., et al.
(1997). Importance of the Chiral Centers of Jasmonic Acid in the Responses of
Plants. Plant Physiol. 1 14: 419-428.

Howe, G., & Jander, G. (2008). Plant immunity to insect herbivores. Ann. Rev.
Plant Biol. 59: 41-66.

Kang, J.-H., Wang, L., Girl, A., & Baldwin, I. (2006). Silencing threonine
deaminase and JAR4 in Nicotiana attenuata impairs jasmonic acid-isoleucine-
mediated defenses against Manduca sexta. Plant Cell 18: 3303-20.

Katsir, L., Schilmiller, A., Staswick, P., He, 8., 8: Howe, G. (2008). COI1 is a
critical component of a receptor for jasmonate and the bacterial virulence factor
coronatine. Proc. Natl. Acad. Sci. U.S.A. 105: 7100-5.

Koo, A., Chung, H., Kobayashi, Y., & Howe, G. (2006). Identification of a
peroxisomal acyl-activating enzyme involved in the biosynthesis of jasmonic acid
in Arabidopsis. J. Biol. Chem. 281: 33511-20.

145

Kramell, R., Miersch, O., Hause, B., Ortel, 8., Parthier, B., 8. Wasternack, C.
(1997). Amino acid conjugates of jasmonic acid induce jasmonate-responsive
gene expression in barley (Hordeum vulgare L.) leaves. FEBS Letters 414: 197-
202

Kramell, R., Miersch, O., Hause, B., Ortel, B., Parthier, B. 8. Wasternack, C.
(1997) Synthesis of N-(jasmonoyl)amino acid conjugates. FEBS Letters 414:
197-

202.

Kramell, R., Porzel, A., Miersch, G., Schneider, G., (1999) Analysis of
synthetic isoleucine conjugates of cucurbic acid isomers by liquid
chromatography. Phytochem. Anal. 10: 82-87.

Laurie-Berry, N., Joardar, V., Street, I., 8. Kunkel, B. (2006). The Arabidopsis
thaliana JASMONATE INSENSITIVE 1 gene is required for suppression of
salicylic acid-dependent defenses during infection by Pseudomonas syringae.
MPMI 19: 789-800.

Li, L., & Howe, G.A. (2001). Alternative splicing of prosystemin pre-mRNA
produces two isoforms that are active as signals in the wound response pathway.
Plant Mol. Biology 46: 409-1 9.

Melotto, M., Mecey, C., Niu, Y., Chung, H., Katsir, L., Yao, J., et al. (2008). A
critical role of two positively charged amino acids in the Jas motif of Arabidopsis
JAZ proteins in mediating coronatine- and jasmonoyl isoleucine-dependent
interaction with the COI1 F-box protein. Plant J., in press.

Miersch, O., Neumerkel, J., Dippe, M., Stenzel, l., & Wasternack, C. (2008).
Hydroxylated jasmonates are commonly occurring metabolites ofjasmonic acid
and contribute to a partial switch-off in jasmonate signaling. The New Phytologist
177: 114-27.

Ribot, C., Zimmerli, C., Farmer, E., Reymond, P., & Poirier, Y. (2008). Induction
of the Arabidopsis PHOl ;H1O gene by 12-oxo-phytodienoic acid but not jasmonic
acid via a CORONATINE INSENSITIVE1-dependent pathway. Plant Physiol.
147: 696-706.

Shikata, M., Takemura, M., Yokota, A., & Kohchi, T. (2003). Arabidopsis ZIM,
a plant-specific GATA factor, can function as a transcriptional activator.
Bioscience, Biotechnology, and Biochemistry 67: 2495—7.

Staswick, P., 8. Tiryaki, I. (2004). The oxylipin signal jasmonic acid is activated
by an enzyme that conjugates it to isoleucine in Arabidopsis. Plant Cell 16: 2117-
27.

Staswick, P., Yuen, G., & Lehman, C. (1998). Jasmonate signaling mutants of
Arabidopsis are susceptible to the soil fungus Pythium irregulare. The Plant
Journal 15: 747-54.

146

Stintzi, A., Weber, H., Reymond, P., Browse, J., 8: Farmer, E. (2001). Plant
defense in the absence of jasmonic acid: the role of cyclopentenones. Proc. Natl.
Acad. Sci. U.S.A. 98: 12837-42.

Suza, W., 8. Staswick, P. (2008). The role of JAR1 in Jasmonoyl-L: -isoleucine
production during Arabidopsis wound response. Planta 227: 1221-32.

Swiatek, A., Van Dongen, W., Esmans, E., 8: Van Onckelen, H. (2004).
Metabolic fate of jasmonates in tobacco bright yellow-2 cells. Plant Physiol. 135:
161-72.

Tan, X., Calderon-Villalobos, L. I., Sharon, M., Zheng, C., Robinson, C. V.,
Estelle, M. & Zheng, N. (2007) Mechanism of auxin perception by the TIR1
ubiquitin ligase. Nature 446: 640-645.

Thines, B., Katsir, L., Melotto, M., Niu, Y., Mandaokar, A., Liu, G., et al.
(2007). JAZ repressor proteins are targets of the SCF(COI1) complex during
jasmonate signalling. Nature 448: 661-5.

Vanholme, B., Grunewald, W., Bateman, A., Kohchi, T., 8. Gheysen, G.
(2007). The tify family previously known as ZIM. Trends in Plant Science 12:
239-44.

Vick, 8., 8. Zimmerman, D. (1984). Biosynthesis of Jasmonic Acid by Several
Plant Species. Plant Physiol. 75: 458-461.

Wasternack, C. (2007). Jasmonates: an update on biosynthesis, signal
transduction and action in plant stress response, growth and development. Ann.
of Botany 100: 681-97.

White, D. (2006). PEAPOD regulates lamina size and curvature in Arabidopsis.
Proc. Natl. Acad. Sci. U. SA. 103: 13238-43.

Yoshihara, T., Omer, E.-S.A., Koshino, H., Sakamura, S., Kikuta, Y., Koda, Y.
(1989) Structure of a tuber-inducing stimulus from potato leaves (Solanum
tuberosum L.) Agricultural and Biological Chemistry 53: 2835-2837

Ziegler, J., Wasternack, C., & Hamberg, M. (1999). On the specificity of allene
oxide cyclase. Lipids 34: 1005-1015.

147

Chapter 5

Conclusions and future perspectives

Major conclusions

148

FCOI1 is a watershed

The discovery that JAZ proteins are substrate of SC
mark in JA research. COI1-JAZ binding assays provided distinct evidence that
the hormone acts to promote COI1-JAZ binding and that this activity requires the
conjugation of jasmonic acid to Ile (Thines et al. 2008). That jasmonic acid is not
an active ligand for any of the COI1-JAZ pairs tested to date is remarkable
because jasmonic acid was long considered to be the active form of the hormone
(Thines et al. 2007, Katsir et al. 2008, Melotto et al. 2008). The windfall of
discoveries surrounding the identification of JAZ substrates included a
description of the mechanism by which COR activated JA signaling to promote P.
syringae virulence. The strength of COR binding also facilitated the
characterization of the COI1-JAZ complex as a receptor for COR and JA-lle
(Katsir et al. 2008). Further biochemical characterization revealed that COI1 and

JAZ are both required for ligand binding, highlighting the complexity of this new

class of receptor.
Unanswered questions and future directions

Many unanswered questions concerning the mechanism of JA perception
remain to be addressed. The finding that both COI1 and JAZ are required for
ligand binding has important implications for how F-box proteins, including TIR1,
perceive small molecules. One possibility is that at low levels of JA, COI1 and
JAZ interact weakly but that their association is unstable (Figure 4.13). This idea
is supported by the low level recovery of COI1 in JAZ-His pull down assays
performed in the absence of exogenous ligand, and the ligand-independent

COI1-JAZ interaction reported by Chini et al. (Chini et al. 2008). A weak,

149

hormone-independent COI1-JAZ interaction may serve to maintain JAZ in close
proximity to SCFCO”. As JA-lle levels increase, the interaction between COI1
and JAZ would be stabilized via the Jas motif, presumably in a manner similar to
auxin-mediated TlR1-Aux/IAA binding (Thineset al. 2007, Tan et al. 2007).
Crystal structures of the COI1—JA-JAZ complex, together with ligand binding
kinetic and affinity data acquired through the use of more sensitive biophysical
techniques, such as measuring protein-protein interaction by surface plasmon
resonance (Biacore), will increase our understanding of this novel type of

hormone-receptor binding.

Binding of JA to a COI1-JAZ complex presumably frees the TFs (i.e.
MYCZ) that are repressed by JAZ proteins in the absence of hormone. It is
currently unclear whether JAZ proteins are general suppressors of transcription,
recruited to the promoter of JA-responsive genes by a cognate TF (i.e. MYCZ), or
if JAZ proteins repress transcription by blocking their cognate TF from interacting
with DNA. Testing the influence of JAZ proteins in reporter gene assays and
determining the influence of JAZ on MYCZ-DNA binding could help discriminate
how TF activity is repressed by JAZ. JAZ recruitment to the promoters of JA

responsive genes would also imply that COI1 is recruited to those sites as well.

The finding that JAZs interact with both COI1 and MYC2 raises the
possibility that COI1 and MYC2 compete for JAZ binding and that JA influences
the binding equilibrium between these players. It was recently shown that two
amino acids in the Jas motif that are essential for COI1-JAZ interaction are not

required for JAZ-MYCZ binding (Melotto et al. 2008). Identifying specific regions

150

of JAZ that are important for MYC2 binding may reveal the basis for COI1-
induced dissociation of JAZ-MYCZ. Binding studies to determine the affinity of
different JAZ-MYCZ pairs may reveal specificity of some JAZ proteins for MYCZ
over others. It is also possible that a strong JAZ-MYC2 interaction impedes JA-
mediated binding of COI1 to JAZ. DNA binding and protein-protein interaction
studies will be necessary to reveal the dynamics of the multiple components of

JA signaling.

One of the major questions in JA biology is how SCFCO'1-mediated
degradation of JAZ stimulates specific responses, such as reproductive
development and defense. Critical to understanding this question is the
identification of additional-JAZ interacting proteins. The repressive function of
JAZ indicates that these proteins act to suppress the activity of TFs involved in
activating the JA response (Thines et al. 2007, Chini et al. 2007). In addition to
MYC2, the involvement of other TFs is predicted by the fact that JA signaling is
not completely abolished in plants lacking MYC2 (Lorenzo et al. 2004). The
identification of other JAZ-TF partners may reveal a role for specific TFs in
distinct responses. Cell specific expression of particular JAZ-TF pairs may also
be an important strategy to organize specific JA responses in a specific tissue
type. This would make sense in reproductive tissue where developmental signals

relayed by JA, would need to be kept distinct from defense responses.

The ability to discriminate between severe attack and more mild damage
may be advantageous to plants in natural environments. One reason for this is

the growth penalty incurred when a defense response is mounted (Howe and

151

Jander 2008). JA signaling may be tuned to generate an appropriate response.
One hypothesis is that the extent of JAZ degradation is graded in response to
increasing levels of JA. The binding properties of different COI1-JAZ pairs that
control different sets of genes may be determined by precise intracellular
concentrations of JA, rather than a mechanism in which a threshold level of JA
acts as an on/off switch. Thus, in Arabidopsis where there are 12 different JAZ
proteins and a single COI1, there may be 12 distinct COI1-JAZ receptors for the
hormone. A complete biochemical evaluation of different COI1-JAZ pairs could
determine whether these receptors have distinct JA binding affinities.
Physiological detection of dose-dependent JAZ degradation could be
accomplished by monitoring the degradation of JAZ proteins with JAZ-specific
antibodies. Fluorescence resonance energy transfer (FRET) may provide
another approach for in vivo monitoring of the dose specific interaction between

COI1 and specific JAZ proteins.

The JA signaling pathway must be turned off upon cessation of the
environmental stress that generated the signal. For example, the transcript level
of JA early responsive genes that are rapidly induced by wounding begins to
decrease three hours after the wound stimulus (Chung et al. 2008). It has been
hypothesized that JAZ proteins synthesized in response to JA re-accumulate and
act to repress their own gene expression, as a means of shutting down JA
responses (Thines et al. 2008, Chini et al. 2008). JA levels peak close to one
hour after wounding and then begin to decrease but remain above background

levels for at least 8 hours (Chung et al. 2008, Suza et al. 2008). In order to shut

152

off JA responses in wounded tissue where JA-Ile levels remain high, JAZ

FCOI1 mediated degradation (Chung et

proteins may be rendered resistant to SC
al. 2008, Suza et al. 2008). One explanation for wound-induced synthesis of JAZ
repressors that are unresponsive to JA-lle levels is the expression of alternatively
spliced JAZ variants (i.e. AtJAZ10) that lack the Jas domain and cannot interact
with COI1 (Yan et al. 2007). Another intriguing possibility is that phosphorylation
or other post-translational modifications may modify JAZ proteins to block their
interaction with COI1 in wounded plants. A JAZ protein has been identified as a

target of phosphorylation and there is evidence that phospho-transfer has a role

in JA signaling (Katou et al. 2005, Rojo et al. 1998).

Enzymatic and non-enzymatic factors contribute to the generation of an
active JA signal and also to signal attenuation. In this thesis I have defined an
active JA signal as a compound that promotes the interaction between COI1 and
a JAZ protein. The finding that JA-lle promotes COI1-JAZ interaction strongly
supports the idea that the conjugation of JA to lie is a requirement for JA activity
(Staswick et al. 2004). However, until a mutant plant completely devoid of JA-lle
is generated, it cannot be determined whether JA-lle is required for all JA-
mediated responses. In the course of this study I have identified a variety of
jasmonoyl-amino acid conjugates and JA-lle derivatives that promote a COI1-
JAZ interaction. Plants lacking the ability to synthesize JA-lle could be used to
monitor physiological responses to specific JAs, as well as for monitoring the
accumulation of alternative JAs in response to wounding. In this thesis, the

activity of several modifications to JA-Ile, including 12-hydroxylation, methylation,

153

and isomerization from cis to trans JA-Ile were described. It can be speculated
that certain modifications (e.g. methylation) that change the physical properties of
JA-lle may enhance the hormones mobility within or between cells. It is also
possible that in some cases the site of JA production and perception are distinct,
and that enzymes at the site of signal generation make JA-Ile inert for transit to
the site of perception. The importance of ligand modification to the attenuation of

the JA signal is an active and exciting area of research.

As with every important discovery, characterization of the JAZ proteins
has provoked many more questions than its discovery has answered. Uncovering
the mode of JA perception will have important implications for the way in which
we consider the mechanism of regulation of all JA mediated responses. In a
broader context understanding the basis of JA perception is critical to
understanding how the hundreds of other F-box proteins in plants sense other

hormones and environmental stimuli.

References

154

Chini, A., Fonseca, S., Fernandez, G., Adie, B., Chico, J., Lorenzo, 0., et al.
(2007). The JAZ family of repressors is the missing link in jasmonate signalling.
Nature 448: 666-71.

Chung, H., Koo, A., Gao, X., Jayanty, S., Thines, B., Jones, A., et al. (2008).
Regulation and function of arabidopsis JASMONATE ZIM-domain genes in
response to wounding and herbivory. Plant Physiol. 146: 952-64.

Howe, G. A., 8: Jander, G. (2008). Plant Immunity to Insect Herbivores. Ann.
Rev. Plant Biol. 59: 41-66.

Katsir, L., Schilmiller, A. L., Staswick, P. E., He, S. Y., & Howe, G. A. (2008).
COI1 is a critical component of a receptor for jasmonate and the bacterial
virulence factor coronatine. Proc. Natl. Acad. Sci. U.S.A. 105: 7100-5.

Katou, S., Yoshioka, H., Kawakita, K., Rowland, 0., Jones, J. D. G., Mori, H.
8. Doke, N. (2005) Involvement of PPS3 phosphorylated by elicitor-responsive
mitogen-activated protein kinases in the regulation of plant cell death. Plant
Physiol. 139: 1914—1926.

Melotto, M., Mecey, C., Niu, Y., Chung, H., Katsir, L., Yao, J., et al. (2008). A
critical role of two positively charged amino acids in the Jas motif of Arabidopsis
JAZ proteins in mediating coronatine— and jasmonoyl isoleucine-dependent
interaction with the COI1 F-box protein. Plant J. , in press.

Rojo, E., Titarenko, E., Leon, J., Berger, 8., Vancanneyt, G. 8: Sanchez-
Serrano, J. J. (1998) Reversible protein phosphorylation regulates jasmonic
acid-dependent and -independent wound signal transduction pathways in
Arabidopsis thaliana. Plant J. 13: 153-165.

Suza, W., 8: Staswick, P. (2008). The role of JAR1 in Jasmonoyl-L: -isoleucine
production during Arabidopsis wound response. Planta 227: 1221-32.

Staswick, P., & Tiryaki, I. (2004). The oxylipin signal jasmonic acid is activated
by an enzyme that conjugates it to isoleucine in Arabidopsis. Plant Cell 16: 2117-
27.

Tan, X., Calderon-Villalobos, L. l., Sharon, M., Zheng, C., Robinson, C. V.,
Estelle, M. 8. Zheng, N. (2007) Mechanism of auxin perception by the TIR1
ubiquitin ligase. Nature 446: 640-645.

Thines, B., Katsir, L., Melotto, M., Niu, Y., Mandaokar, A., Liu, G., et al.
(2007). JAZ repressor proteins are targets of the SCF(COI1) complex during
jasmonate signalling. Nature 448: 661-5.

Yan, Y., Stolz, S., Chetelat, A., Reymond, P., Pagni, M., Dubugnon, L. 8.
Farmer, E. E. (2007) A downstream mediator in the growth repression limb of the
jasmonate pathway. Plant Cell 19: 2470-2483.

155

 

IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII

ll 1111111111111111111llllllllllllllllll