, , «WkWWw. .1
. , . Ln. L... a. ..
. my . mfufl

z.
. . . In.“ 14
. .wfiu 2.th
.. ,2. aw. .1 i.

. .

a.
.. 13:... 2.
12%
«WSW.

..
I
I
K
.

h
.mnnhw . I.‘
:x..~t.h.$r. g a;

u

4. , .... ..
v.0. bra Kb.
\«h.W¥PHHW«y a...»

31‘...)

9 .Va ‘tx
. 4.; $53!.-
. 5112. V
II I I!
5’. 3%.. e!

1... :

. .l..¢..¢l.

3.3.1 1.11:5?!
It. ‘5}

I «4.
v 1....1
V‘xilll’i

. 3‘
5% .i

in! I- .
. #52...
. thy. . .1359.
. .1... flunk... a
.. . .. 1..
233.12.. .‘Iv 3-1.1?
. 6‘ €3.15... :7 .vl.1\l..\ "A

at... z .. ksgmfiig .......

.\ L.$.
7 .o .J . :5.

 

 

?
Michigan State
University

This is to certify that the
dissertation entitled

ESPRESSION OF AMINO ACID TRANSPORTERS IN
PORCINE MAMMARY TISSUE DURING LACTATION

presented by

JULlANA PEREZ LASPIUR

has been accepted towards fulfillment
of the requirements for the

Doctoral degree in Animal Science

 

 

  

(tux;

 

/ NTajor Professor's Signature
O‘o/v o G — O Q

Date

 

I MSU is an aflirmative-action, equal-opportunity employer

... -.-.--.-.--—.‘v------

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

5/08 K'IProlecc8Pres/CIRC/DateDueindd

EXPRESSION OF AMINO ACID TRANSPORTERS IN PORCINE MAMMARY
GLAND DURING LACTATION

BY

Juliana Pérez Laspiur

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY
Department of Animal Science

2008

ABSTRACT

EXPRESSION OF AMINO ACID TRANSPORTERS IN PORCINE MAMMARY
GLAND DURING LACTATION

By
Juliana Pérez Laspiur

Efficient synthesis of milk protein is crucial to sustain normal growth of the
nursing neonate and is dependent upon the intracellular availability of amino
acids in mammary epithelial cells in very specific proportions. Thus, mammary
cells must be equipped to recognize extracellular amino acids and regulate
amino acid entry into the intracellular space in a coordinated fashion in order to
optimize their utilization for milk protein synthesis. The extracellular availability of
amino acids also is directly dependent upon dietary provision of amino acids. It
is well recognized that a diet providing proteins composed of amino acids in the
proportions in which they are required improves efficiency of utilization. There is
an obvious gap of mechanistic understanding, however, between the processes
involved in mammary use of extracellular amino acids and amino acid nutrition.
Optimizing milk production and dietary protein utilization remains an overarching
goal of swine production. The overall goal of dissertation research described
herein was to determine the impact of nutritional and production (milk demand)
factors on mammary amino acid utilization. The studies described in this
dissertation are the first in lactating pigs and focus on amino acid transporters

CAT-1, CAT-23, ASCT1, and B°"’. These transporters are distinguished for

transporting amino acids that are indispensable in the diet of sows during
lactation.

The main hypothesis of this dissertation was that under conditions of
protein nutritional stress (deficiency or excess), the mammary gland adaptively
regulates amino acid transport by increasing (during deficiency) and decreasing
(during excess) the level of expression of CAT-1, CAT-28, ASCT1, and B°'+ in
porcine mammary gland, respectively. To test this hypothesis changes in
transcript and protein abundance of amino acid transporters were determined in
porcine mammary gland at two stages of lactation (milk demand).

Fundamental to the described studies was the development of a novel
mammary biopsy technique that allowed for tissue collection from the same
animal at different stages of lactation without affecting lactation performance.
Results of the described studies provided (1) direct evidence for the presence of
CAT-1 and CAT-23, 3°”, and ASCT1 mRNA and CAT-1 and ASCT1 protein in
porcine mammary tissue; (2) evidence of a linear decrease in CAT-28 but not
CAT-1 mRNA abundance with increasing maternal dietary protein intake from
deficient to excess was determined; and (3) evidence of increasing ASCT1 and
B°'+ mRNA abundance in porcine mammary gland with milk demand was shown.

The observed differential regulation of these amino acid transporters in
response to amino acid availability explain, in part, how the mammary gland
responds to dietary protein intake and stage of lactation and the respective
outcome in lactation performance. These contributions improve our
understanding on protein nutrition of the lactating sow and enhance our ability to

develop mechanistic models to ultimately maximize milk production.

In memory of

Jeannie L. Burton

ACKNOWLEDGEMENTS

I want to express my most sincere gratitude to everyone who contributed
in a way or another to the completion of this dissertation. First and foremost,
there are no words to express how grateful I am to my mentor, Dr. Nathalie L.
Trottier, for her unconditional support and guidance throughout these years, in
my scientific career and my personal life. To my guidance committee, Drs.
Jeannie L. Burton, Paul M. Coussens, George W. Smith and Roy N. Kirkwood for
their confidence in me and for welcoming me in their laboratories. To my favorite
lab gurus, Julie M. Moore, Dr. Patty S. D. Weber, and Sue Sipkovsky for teaching
me the tricks of the trade in the laboratory. To the staff at the Center for Animal
Functional Genomics for their support and training. I would also like to express
my gratitude to Drs. Robert Tempelman and Guilherme Rosa for all their
patience and assistance with statistical analysis. A special acknowledgement to
Allan Snedegar, Brian Story, Lance Kirkpatrick, and the MSU Swine Farm staff
ensuring that the tools were available and functional to conduct the animal work
throughout my studies at MSU. I would like to express my gratitude to Barb
Sweeney, Jackie Christie, Kathy Tatro and Dr. Steve Bursian for their assistance
throughout my graduate career at MSU and to all the post—docs, graduate and
undergraduate students that helped me in any ways. I am grateful to my family
and friends for their unconditional love and support through this journey. Last but
not least, to my daughter Isabella, for giving me the motivation and love to

complete this chapter of my life.

TABLE OF CONTENTS

LIST OF TABLES ................................................................................................. ix
LIST OF FIGURES ................................................................................................ x
KEY TO ABBREVIATIONS ................................................................................. xiii

CHAPTER 1: INTRODUCTION

Introduction ........................................................................................................... 1
1. Intracellular milk protein synthesis ................................................................... 7
1.1 Role of transcription factors ....................................................................... 7
1.2 Role of lactogenic hormones and metabolites ........................................... 9
1.3 Role of the extracellular matrix ................................................................ 12
2. Intracellular amino acid availability: role of amino acid transport processes ...13
2.1 Current knowledge on amino acid uptake by the mammary gland .......... 13
2.2 Amino acid transport systems and proteins ............................................. 19

2.3 Transport characteristics of amino acid transport systems of interest... ..20
2.4 Molecular and kinetic characteristics of transporter systems and

proteins of interest ......................................................................................... 26
2.4.1 CAT family system ........................................................................... 26

2.4.2 ASC system ..................................................................................... 28

2.4.3 8"" system ...................................................................................... 29

2.5 Regulation of amino acid transporters expression ................................... 30
2.5.1 Amino acid availability ..................................................................... 30

2.5.2 Lactogenic hormones and metabolites ............................................ 31

2.5.3 Inflammation .................................................................................... 32

Main hypothesis and objectives .......................................................................... 33
Literature cited .................................................................................................... 35

CHAPTER 2: MAMMARY GLAND BIOPSY DOES NOT AFFECT LACTATION
PERFORMANCE IN SOWS

Abstract ............................................................................................................... 51

vi

Introduction ......................................................................................................... 51

Material and Methods .......................................................................................... 53
Results and Discussion ....................................................................................... 56
Literature cited .................................................................................................... 59

CHAPTER 3: AMINO ACID TRANSPORTERS IN PORCINE MAMMARY GLAND
DURING LACTATION

Abstract ............................................................................................................... 70
Introduction ......................................................................................................... 70
Material and Methods .......................................................................................... 71
Results and Discussion ....................................................................................... 73
Literature cited .................................................................................................... 77

CHAPTER 4: DIETARY PROTEIN INTAKE AND STAGE OF LACTATION
ALTER AMINO ACID TRANSPORTER EXPRESSION IN PORCINE MAMMARY
TISSUE

Abstract ............................................................................................................... 83
Introduction ......................................................................................................... 84
Material and Methods .......................................................................................... 87
Results ................................................................................................................ 99
Discussion ......................................................................................................... 105
Literature cited .................................................................................................. 1 19
SUMMARY AND CONCLUSIONS .................................................................... 171

APPENDIX A: AMINO ACID EXTRACTION BY PORCINE MAMMARY GLAND:
A PILOT STUDY TO TEST FEED INTAKE RESPONSE TO DIETARY PROTEIN
INTAKE ............................................................................................................. 176

APPENDIX B: SUS SCROFA AMINO ACID TRANSPORTER B°'+ and ASCT1
mRNA, PARTIAL SEQUENCES ....................................................................... 190

vii

APPENDIX C: PORCINE POLY A+ RNA NORTHERN BLOT ANALYSIS OF
CAT-1 ................................................................................................................ 194

APPENDIX D: REPRESENTATIVE STANDARD CURVES FOR CANDIDATE
GENES ............................................................................................................. 197

APPENDIX E: B-ACTIN TRANSCRIPT ABUNDANCE IN PORCINE MAMMARY
GLAND DURING LACTATION .......................................................................... 208

APPENDIX F: CONTRIBUTION OF EPITHELIAL CELLS TO PORCINE
MAMMARY TISSUE AT PEAK LACTATION .................................................... 215

APPENDIX G: DIETARY PROTEIN INTAKE DOES NOT ALTER PROTEIN
ABUNDANCE OF ASCT1 IN PORCINE MAMMARY GLAND DURING
LACTATION ...................................................................................................... 223

APPENDIX H: JOURNAL OF DAIRY SCIENCE PERMISSION FOR REPRINT IN
DISSERTATION ................................................................................................ 230

APPENDIX I: CANADIAN JOURNAL OF ANIMAL SCIENCE FOR REPRINT IN
DISSERTATION ................................................................................................ 231

viii

LIST OF TABLES

Table 1.1 Amino acid transporter systems and proteins names, amino acid
affinity, and known species and tissues distribution ...................................... 21

Table 2.1 Sow feed intake, rectal temperature and milk somatic cell count pre
and post mammary biopsy ..................................................................... 60

Table 4.1 Ingredient and nutrient composition of experimental diets on as fed
basis (%) ........................................................................................... 128

Table 4.2 Primer sequences for real-time PCR (5’-) 3’) .............................. 129

Table 4.3 Effect of protein intake on sow lactation performance, milk yield and
composition ....................................................................................... 1 30

Table 4.4 Effect of stage of lactation on sow lactation performance, milk yield and
composition ....................................................................................... 1 32

Table 4.5 Effect of protein intake on plasma glucose and amino acid
concentration ..................................................................................... 1 33

Table 4.6 Effect of stage of lactation on plasma glucose and amino acid
concentration ..................................................................................... 1 35

Table 4.7 Effect of protein intake on milk free amino acid
concentration ..................................................................................... 1 37

LIST OF FIGURES

Figure 1.1. Simplified representation of amino acid movement between the
circulatory system, the extracellular space and mammary epithelial cells ......... 16

Figure 2.1. Mammary biopsy technique: One mammary gland (thoracic) was
prepared for biopsy with a combination of povidone-iodine scrub and 70 %
ethanol ............................................................................................... 62

Figure 2.2. Mammary biopsy technique: Lidocaine was injected sub-cutaneously
and intramuscularly 1 min prior to
incision .............................................................................................. 64

Figure 2.3. Mammary biopsy technique: Mammary tissue was exteriorized with
forceps and excised with a scalpel in a circular
motion ................................................................................................ 66

Figure 2.4. Mammary biopsy technique: The incision was closed using simple
interrupted sutures ................................................................................ 68

Figure 3.1. Northern blot analysis of human CAT-1, CAT-2A, CAT-2B and
porcine B°'+ and ASCT1 mRNA in porcine mammary or liver tissue ................ 80

Figure 3.2A. Northern blot analysis of B°"’ at early (d 7) and peak (d 17) lactation
in mammary tissue of 3 multiparous lactating sows (A) ................................ 82

Figure 3.28. Quantitative analysis of porcine BO'+ transcript abundance in
mammary tissue collected on d 7 and d 17 of lactation and determined by real-
time PCR analysis (B) ........................................................................... 82

Figure 4.1. Effect of dietary protein intake and stage of lactation on milk true
protein percentage ............................................................................... 140

Figure 4.2. Effect of dietary protein intake and stage of lactation on milk casein
percentage ......................................................................................... 142

Figure 4.3. Effect of protein intake and stage of lactation on plasma glucose
(mgldL) ............................................................................................. 144

Figure 4.4. Effect of protein intake on piglet average daily gain (gld) and milk
casein and true protein yield (gld) ........................................................... 146

Figure 4.5. Effect of dietary protein intake and stage of lactation on CAT-23
mRNA transcript abundance ................................................................. 148

Figure 4.6. Effect of dietary protein intake and stage of lactation on CAT-1 mRNA
transcript abundance ........................................................................... 1 50

Figure 4.7. Effect of dietary protein intake and stage of lactation on 8°” mRNA
transcript abundance ........................................................................... 152

Figure 4.8. Effect of dietary protein intake on ASCT1 mRNA transcript
abundance ......................................................................................... 154

Figure 4.9. Effect of stage of lactation on ASCT1 mRNA transcript
abundance ........................................................................................ 1 56

Figure 4.10 Representative western blot demonstrating the presence of CAT-1
amino acid transporter in porcine mammary tissue during lactation at the three
levels of dietary protein intake ............................................................... 158

Figure 4.11. Representative western blot demonstrating the presence of ASCT1
amino acid transporter in porcine mammary tissue during lactation at three levels
of dietary protein intake ........................................................................ 160

Figure 4.12. Relative abundance of CAT-1 protein in porcine mammary tissue at
early (d 4) and peak (d 18) stage of lactation ............................................. 162

Figure 4.13. Relative abundance of CAT-1 protein in porcine mammary tissue
from sows fed a Deficient (12%), Adequate (18%), or Excess (24%) protein
diet .................................................................................................. 164

Figure 4.14. Relative abundance of ASCT1 protein in porcine mammary tissue at
early (d 4) and peak (d 18) stage of lactation ............................................. 166

xi

Figure 4.15. lmmunohistochemical staining of porcine mammary tissue at peak
lactation with CAT-1 antiserum (a) or negative control (b) ........................... 168

Figure 4.16. lmmunohistochemical staining of porcine mammary tissue at peak
lactation with ASCT1 (a) or negative control (b) ........................................ 170

Images in this dissertation are presented in color

xii

KEY TO ABBREVIATIONS
AA = amino acid
AV = arterio-venous
BCAA = branched chain amino acids
EAA = essential amino acid
MT = mammary tissue
NEAA = nonessential amino acid
PCR = polymerase chain reaction

Q-RT-PCR = quantitative real-time polymerase chain reaction

xiii

CHAPTER ONE
INTRODUCTION

The postnatal survival and optimum growth of neonates in mammalian
species depends solely on the care and nutrition the mother provides through
lactation. During this stage of development, maternal milk is the primary source
of nutrients to guarantee the survival of the progeny and hence, the species.

Sow’s milk yield and composition is the most important factor limiting
growth of nursing pigs (Hodge, 1974; Harrell et al., 1993; Pluske and Dong,
1998). Milk yield increases with advancement of lactation and plateaus as early
as day 15 and up to day 18 of lactation (Jones and Stahly, 1999). Conversely,
up to 25% of nursing pigs are currently weaned at a very young age, i.e.,
between days 12 to 14. The early weaning practice provides health and
economic benefits over conventional weaning, which is usually performed around
21 days of age (Hohenshell et al., 2000), but does not allow the nursing pig to
benefit from the maximum milk production period. In addition, sow milk yield
during the early phase of lactation is lower than desired to maximize the growth
potential of her nursing pigs (Hartmann et al., 1997). For instance, artificially-
reared piglets weaned shortly after birth and provided ad Iibitum access to liquid
milk diet have the potential to duplicate their weight gain by 3 weeks of age
(Harrell et al., 1993). Increasing piglet growth rate during lactation leads to
higher weaning weights and decreased time to reach market weight (Slade and

Miller, 1999). Selection pressure for prolific sows coupled with lower incidence of

piglet death has set milk production as one of the most important limiting factors
behind nursing pig growth (Boyd and Kensinger, 1998).

Research efforts on malnutrition and its effect on lactation performance
and milk composition are increasing worldwide, particularly in developing
countries. Maternal nutrient intake, especially in suboptimal quantities affects
milk composition and consequently, growth and development of neonates
(Forsum and LOnnerdal, 1980; Noblet and Etienne, 1986; King et al., 1993; Motil
et al., 1995; Zubieta and Lonnerdal, 2006).

Milk composition varies at different stages of lactation (Klobasa et al.,
1987; Wu and Knabe, 1994). Shortly after parturition, the mammary gland
secretes colostrum in small quantities. Colostrum is composed of high
concentrations of immunoglobulins and growth factors. Protein percentage in
sow’s colostrum can be as high as 15 % (Oftedal, 1984). Post colostrogenesis,
mature milk composition is relatively stable throughout the remainder of lactation
(Klobasa et al., 1987; Csapo et al., 1996). Sow's mature milk is composed of 7.6
% fat, 5.5 % protein, 5.3 % carbohydrates and 18.7 % total solids (Oftedal, 1984;
Csapo et al., 1996).

Studies in rat and other species have demonstrated that depressed
maternal protein intake can diminish the total protein, nitrogen and non-protein
nitrogen content of milk (Ronayne de Ferrer and Sambucetti, 1993; Sturrnan et
al., 1986; Forsum and LOnnerdal, 1980; Motil et al., 1995). These changes in milk
protein and nitrogen content are attributable mainly to changes in the casein-to-

whey ratio, which decreases with increasing deficiency in dietary protein intake. It

has been hypothesized that nutritional stress impairs the functional integrity of
epithelial cells, thus diminishing their synthetic capacity (Ronayne de Ferrer and
Sambucetti, 1993). It has also been suggested that sow's milk is deficient in
protein content for optimal lean body mass deposition (Williams, 1976). Sow’s
milk has a relatively low protein to energy ratio ranging from 9.2 to 10.4 g of
protein per MJ GE, consequently, fat deposition is favored over protein
deposition (Pluske et al., 1995). However, attempts to alter the protein profile of
replacement milk to achieve higher protein to energy ratios and therefore,
increase growth rate of neonates, have yielded controversial results (Sherry et
aL,1978)

Milk protein secretion results from a series of processes that can be
divided into four main steps: 1) amino acids removal from blood by mammary
epithelial cells; 2) expression of milk protein-encoding genes in the mammary
epithelial cells for synthesis of new proteins (Boisgard et al., 2001); 3) transport
of plasma-bome proteins directly into mammary epithelial cells by transcytosis
(Boisgard et al., 2001); and 4) transport and post-translational modification of
newly synthesized and plasma borne proteins within the mammary epithelial
cells. Of all organs, the lactating mammary gland has the highest demand for
amino acids to meet the requirements of both milk protein synthesis and tissue
growth (Boyd and Kensinger, 1998). In lactating sows, more than 95% of the
essential dietary amino acid requirement is attributable to the need of the udder
for protein synthesis (NRC, 1998). During lactation, 31 to 45% of whole-body

protein flux is attributed to milk protein synthesis compared to 1 to 6% in dry,

non-pregnant animals (Champredon et al., 1990). In the dairy cow and goat,
whole body protein synthesis is increased during lactation, a large proportion
being attributable to mammary metabolism (Bequette and Backwell, 1997).

Of the indispensable amino acids utilized by the porcine mammary gland,
lysine, threonine and valine in practical diets fed to sows have the potential to
limit milk protein synthesis. To date, our understanding of the limitation of these
amino acids is confined to empirical studies demonstrating their high
requirements for milk protein synthesis relative to their low concentrations in
feeds fed to lactating sows (Pettigrew, 1993). Uptake of certain indispensable
amino acids by mammary epithelial cells is rate limiting for milk protein synthesis
in vitno (Mephan, 1982; Maas et al; 1997).

Of the proteins synthesized by the mammary gland, up to 60% are
excreted in the milk (Champredon et al., 1990; Oddy et al., 1988). Mammary
protein secretion rate varies from 60 to 600 g per day in lactating humans and
sows, corresponding to as much as 676 and 240 mg milk protein per g of weight
gain in nursing infants and neonatal pigs, respectively. Amino acids extracted by
the mammary epithelial cells are used mainly for the synthesis of caseins, the
most abundant proteins in mammalian milks (Aimutis et al., 1982). Caseins are
phosphoproteins, mammary derived and constitute over 40% of the proteins
found in porcine milk; the remaining proteins include immunoglobulins and other
blood borne proteins, collectively called whey proteins. Caseins and whey
proteins average 2.74 and 2.22 %, respectively, in sow’s milk (Oftedal, 1984).

Whey proteins account for 85% of total protein in colostrum and 60% in mature

milk. The whey proteins, except for a-lactalbumin, are synthesized ex—situ and
brought into the mammary gland to be deposited in milk.

Apart from their role as substrates for casein proteins synthesis, amino
acids are used for the synthesis of constitutive proteins needed to support the
metabolic functions of mammary cells. For instance, total protein synthesis in the
dairy cow and goat lactating mammary gland is 1.3 to 2.5 fold the rate of milk
protein secretion (Bequette and Backwell, 1997; Bequette et al., 1996). Other
proteins in milk include enzymes such as lipoprotein lipase, lysozyme, plasmin,
alkaline phosphatase, Iactoferrin, and lactoperoxidase that facilitate digestion of
the major milk components once milk is secreted and also act as
immunomodulators (Hartmann and Holmes, 1989).

The genes that encode the proteins found in milk are not exclusive to the
mammary gland and/or lactation. Caseins are encoded by a cluster of single-
copy genes in a locus of around 350 kb (Rijnkels et al, 1997). The as1- casein
and [3- casein genes are closely related genes while the ic-casein gene is not
evolutionary related to these genes; the expression of these genes is
nonetheless coordinated. In contrast, the principal whey proteins are encoded by
a relatively small, single-copy, genes.

Expression of milk-specific genes occurs in the lobulo-alveolar epithelium
of the lactating mammary gland and is regulated by nutrient availability and
hormonal stimuli transmitted through a set of transcription factors that bind to
enhancer elements on these genes (Rosen et al., 1998). Interestingly, the

transcription factors that regulate the promoter regions of milk protein genes are

not specific to the mammary gland, nor restricted to lactation. Nevertheless, the
unique combination and orchestrated efforts of these transcription factors and
hormones result in mammary- and lactation-specific expression of milk protein
genes. Of the processes involved in milk protein synthesis, the rate of amino acid
uptake by mammary epithelial cells and the rate of intracellular protein synthesis

may represent the two major limiting processes.

1. Intracellular milk protein synthesis
1.1. Role of transcription factors

Milk protein gene expression is controlled by promoter regions containing
complex DNA elements referred to as composite response elements or CoREs.
The CoREs are cluster of binding sites for transcription factors that act as
positive or negative regulators of gene expression. Transcription factors act
cooperatively to either enhance or repress expression of these genes. This type
of gene regulation permits different levels of transcription depending on the
combination of these positive and negative regulators of transcription. Some of
the most studied transcription factors related to these CoREs are Stat5, CAAT
enhancer binding proteins (C/EBPs), Nuclear factor (NFI), glucocorticoid receptor
(GR), Yin Yang 1 (YY 1), and octamer binding transcription factor 1 (Oct-1).

Stat5 is not mammary specific (Kazansky et al., 1995; Liu et al., 1995) and
its expression in the mammary gland is not lactation-specific either. Stat5 is the
primary transcription factor responsible for prolactin signaling in the mammary
gland. Then again, other hormones not related to lactation, cytokines, and growth
factors can activate Stat5. Two Stat5 genes (Stat5a and Stat5b) have been
identified, with their protein products exhibiting 93% similarity at the amino acid
level. In addition, both these genes encode different Stat5 isoforrns that arise by
alternative splicing. These alternative spliced isoforrns cannot activate
transcription and thus may act as transcription inhibitors instead (Jolivet et al.,

1996).

The B-casein gene promoter contains four CIEBPs binding sites required
for hormonal regulation. The CIEBP genes, like Stat5, also encode multiple
protein isofonns by using alternative translational activation sites. Some of these
isofonns can act as negative transcription factors inhibiting transcription. The
ratio of the different ClEBPs therefore determines the resulting activation or
repression of the milk protein genes.

NF l plays a critical role in the expression of WAP and several other whey
proteins. However, NFI is not only expressed during the lactation period, and
also plays a major role during involution of the mammary gland. Several NFI
isoforrns have been identified, and similarly to Stat5 and CIEBPs, some of these
are activators while others are repressors of transcription.

Glucocorticoid response elements in milk protein genes are responsible
for the cooperative effects of hydrocortisone and prolactin on expression at least
in mammary epithelial cell lines (Lechner et al., 1997). However, the action of GR
on regulation of milk protein gene expression has not been extensively studied
apart from its cooperative role with Stat5.

Recently, another ubiquitous transcription factor, Oct-1, was shown to be
present in mammary epithelial cells and to bind to a promoter region of the B-
casein gene (Dong and Zhao, 2007). Oct-1 has a critical role in the hormonal
activation of expression of the B—casein gene as demonstrated by a 70% reduced
hormonal induction when the Oct-1 binding site is mutated.

The B—casein promoter region also contains a negative regulatory region

that represses transcription in the absence of the lactogenic hormones in

mammary epithelial cells (Meier and Groner, 1994). Mutation of this region leads
to hyper-transcription of these genes. YY1 has been shown to interact directly
with this inhibitory region repressing transcription of the milk protein genes
(Raught et al., 1994). F urtherrnore, CIEBPs and YY1 associate through protein-
protein interactions to this negative regulatory site. Interestingly, the effects of
YY1 in transcription repression are counteracted by Stat5 and vice versa (Raught
et al., 1994). This suggests that the ratio of YY1 to Stat5 is important in the

induction or repression of milk protein gene expression.

1.2. Role of lactogenic hormones and metabolites

Milk protein synthesis during lactation requires a major increase in amino
acid partitioning towards the mammary gland (Bequette et al., 1994), which in
turns is under complex homeorhetic control. Recently, relationships between
circulating concentrations of lactogenic hormones and extraction by the porcine
mammary gland on mammary amino acid uptake were investigated (Farmer et
al., 2008). Amino acid AV difference was shown to be positively correlated to
prolactin AV difference and to insulin arterial plasma concentration. This is
supported by the fact that both prolactin and insulin are required for the full
expression of milk protein genes (Nagaiah et al., 1981; Worthington-Roberts,
1997; Kozakai et al., 2002).

In both animals and humans, the synthesis of milk proteins and mammary
enzymes is induced primarily by prolactin and further stimulated by insulin and

cortisol (Nagaiah et al., 1981; Worthington-Roberts, 1997). Prolactin stimulates

B—casein gene expression in epithelial cell lines of mouse mammary gland after
stimulation with dexamethasone (Kozakai et al., 2002). The effect of prolactin on
milk protein gene expression is mostly mediated by activation of Stat5a and
Stat5b by tyrosine phosphorylation through the JAK/STAT signal transduction
pathway (Darnell, 1997). Circulating prolactin binds to the extracellular
component of the prolactin receptor initiating the JAK/STAT signal transduction
cascade. Specifically, prolactin induces dimerization of the receptor which, by
means of transphosphorylation, activates JAK2 (Rui et al., 1994). The activated
JAK2 tyrosine kinase in turn phosphorylates the prolactin receptor where proteins
containing SH2 domains can dock (Pezet et al., 1997). The Stat5s contain such
domains and consequently are phosphorylated, form a heterodimer, and
translocate to the nucleus where they can activate transcription of the milk
protein genes. In the absence of Stat5a or Stat5b, mice are unable to lactate (Liu
et al., 1997) but B-casein gene expression is not dramatically altered (Liu et al.,
1997) suggesting that the activation of one of the Stat5 alone is enough to induce
B—casein gene expression.

Insulin and hydrocortisone alone cause little induction of B-casein gene
expression in mammary epithelial cells, while addition of prolactin results in a
marked increase in induction of this gene. In fact, pretreatment with
glucocorticoids is crucial for induction of this gene by prolactin (Doppler et al.,
1990). It has been hypothesized that glucocorticoids act indirectly by altering the
levels of different CIEBPs isoforrns in a way that lactogenic hormones can then

prevent the repression in transcription caused by the C/EBPs transcription

10

factors directly at the promoter level (Schmitt-Ney et al., 1991). In contrast, the
glucocorticoid receptor associates with Stat5 through proteinzprotein interactions
and can act directly and synergistically to regulate B—casein gene expression
(Stdcklin et al., 1996). Although the role of insulin on lactation in intact animals is
well established (Lau et al., 1993), the molecular mechanism by which insulin
cooperates with prolactin and glucocorticoids to induce milk protein gene
expression is not well defined. What is clear is that the effect of insulin on milk
protein gene expression occurs at the level of transcription and this effect is only
minimally mediated by lGF-l and lGF-ll (Prosser et al., 1987). One potent
mechanism by which insulin could mediate induction of milk protein gene
transcription is through its well established role in nutrient uptake and
metabolism. For example, through induction of glucose uptake and the glucose
metabolic pathway, insulin can activate transcription of several genes in the liver
like GLUT2 (a glucose transporter) and insulin itself, and other enzymes (Vallet
et al., 1997). Using primary cultures of mammary epithelial cells, a glucose-
dependent increase in transcription of B-casein and a-lactalbumin that occurs at

normal circulating glucose levels was demonstrated (Rosen et al., 1999).

11

1.3. Role of the extracellular matrix

The role of the extracellular matrix in mammary gland development and
maintenance of differentiated lobulo-alveolar ducts is well established (Parry et
al., 1987). However, our interest lies in the role of the extracellular matrix on milk
protein gene expression during lactation. Studies using primary epithelial cells
and mammary epithelial cell lines have revealed that, in addition to the presence
of lactogenic hormones, interaction with the extracellular matrix is required for
high levels of milk protein gene expression. This effect occurs via induction of cell
morphological changes required for expression and induction of a signal that, in
the presence of lactogenic hormones, induces milk protein gene expression.
Specifically, laminin and B1-integrins are responsible for producing this signal
(Edwards et al., 1998; Streuli et al., 1991). The induction of milk protein gene
expression occurs via interaction with several promoter regions in these genes
collectively called extracellular matrix-dependent enhancers (Schmidhauser et
al., 1992). Most importantly, signaling by the prolactin receptor is not initiated in
primary mammary epithelial cells in the absence of extracellular matrix (Edwards
et al., 1998).

The importance of the cellzstratum interaction between the extracellular
matrix and mammary epithelial cells on milk protein gene expression cannot be
ignored when studying in vitm milk protein gene expression as cell and tissue

culture systems may not simulate the intact mammary gland environment.

12

2. Intracellular Amino Acid Availability: Role of Amino Acid Transport

Processes

Control of milk protein synthesis ultimately occurs within epithelial cells
and it is here that amino acid supply may be limiting to milk protein synthesis.
The intracellular availability of amino acids is determined in part by the activity of
a range of amino acid transport processes (Baumrucker, 1985). In spite of their
central importance to milk synthesis, there is relatively little known about
mammary transport systems and their control in agriculturally valuable animals.

Most of the available knowledge comes from rodent species (Sherman, 1998).

2.1. Current knowledge on amino acid uptake by the mammary gland
Arteriovenous (AV) exchange of amino acids across the lactating udder
has been investigated in pigs (Linzell et al., 1969; Spincer et al., 1969; Trottier et
al., 1995a and 1995b; Guan et al., 2002; Nielsen et al., 2002), cows (Guinard et
al., 1994; Metcalf et al., 1994; Cant and McBride, 1995; Metcalf et al., 1996) and
goats (Mepham and Linzell, 1966; Mepham, 1982; Bequette et al., 1997;
Bequette et al., 2000) as a mean to indirectly assess the rate of transport of
amino acids into mammary glands for milk production. This technique is based
on the knowledge that amino acids are carried either as free entities or bound
with albumin to cells through arterial supply and removed by cells via transport
systems located on the apical surface of cell membranes. Amino acids not
removed by cells appear in the venous circulation. Thus, the difference between

arterial and venous amino acid concentration (AV difference) represents the

13

concentration of a particular amino acid removed by the cell. In all species
studied, lactation is accompanied by a significant increase in AV difference for all
amino acids compared to the non-lactating state. However, regulatory
mechanisms facilitating this uptake are unknown. A simplified amino acid
removal scheme across the circulatory system and mammary epithelial cells is
presented in Figure 1.1

A number of AV tracer kinetic models have been used to address whether
amino acid transport processes place a limitation on milk protein synthesis by the
mammary gland in vivo, and whether transport activity defines limiting amino
acids for milk protein synthesis. In lactating pigs, lactating goats (Bequette et al.,
2000) and dairy cows (Schwab et al., 1992; Guinard et al., 1994), AV differences
across the mammary gland for the majority of amino acids parallel milk protein
secretion rate. It is not known if the parallelism observed between amino acid AV
difference and milk protein secretion rate is directly related to transporter
functions. Despite the reported abundant variety of amino acid transporter
systems in numerous tissues and animal species, very few have been studied in
mammary tissue. New experimental approaches are essential to address
whether these transport processes place a limitation on milk protein synthesis by
the porcine mammary glands during the developmental phases of lactation.

Maternal protein nutrition alters mammary uptake of amino acids in
lactating sows (Guan et al., 2002; Trottier et al., 1997; Guan et al., 2004).
Changes in amino acid extraction rate by the mammary gland in response to

dietary and/or arterial amino acid availability indicate that mammary amino acid

14

Figure 1.1. Simplified representation of amino acid movement between the
circulatory system, the extracellular space and mammary epithelial cells. Amino
acids are carried via the arterial system (red) and diffuse into the extracellular
space via blood flow (indicated by horizontal arrow) and concentration gradient.
Amino acids are also transported via transporter systems from the intracellular
space to the extracelular space, and from the extracellular space to the venous
compartment (blue).

15

sols?

/

 

 

  

16

uptake is a regulated process (T rottier et al., 1997; Bequette et al., 2000; Guan et
al., 2004). For instance, when histidine was severely limiting in systemic supply,
the goat mammary gland was able to increase extraction efficiency of histidine
from 17 to 74% to avoid a dramatic decrease in milk protein synthesis (Bequette
et al., 2000). To accomplish this, rates of inward and outward transport of
histidine across the mammary gland were altered in favor of its net uptake
(Bequette et al., 2000). Similar response was observed when feeding diets
deficient in lysine (Guan et al., 2002). However, while lysine extraction
increased, the mammary gland was unable to transfer sufficient quantities of
lysine to maintain protein synthesis and net mammary protein balance
presumably due to the fact that there is no endogenous synthesis of lysine
compared to some for histidine. It is unknown whether the increase in extraction
efficiency for lysine as reported by Guan et al. (2002) or histidine as reported by
Bequette et al. (2000) was consequent to an increase in amino acid transporter
capacity.

Milk production increases from approximately 6.5 to 8 kg per day (litter
size of 7 to 8 pigs) from day 9 to 17 of lactation (23% increase) (Nielsen et al.,
2002), respectively, which corresponds to a milk protein secretion rate of
approximately 325 to 400 g per day, respectively. Several reports show that
amino acid uptake is limited by stage of lactation (Nielsen et al., 2002; Guan et
al., 2002) and presumably by milk demand. During peak lactation, AV difference
for the majority of amino acids across the porcine udder increased by

approximately 25% relative to day 9 of lactation. The increase in AV difference

17

corresponded to an increase in extraction rate of approximately 40% for the
majority of amino acids to up to 74% for arginine (Nielsen et al., 2002). Similarly,
in a recent study, Guan and coworkers (2004) found that the total AV difference
of dietary essential amino acids across the porcine udder increased from 287 to
377 pmollL from day 10 to 18 of lactation, corresponding to a 31% increase.
Similarly, Nielsen and coworkers (2002) reported that the increase in milk
production with progression of lactation was associated with increased plasma
amino acid AV difference rather than blood flow across the porcine mammary
gland. It was also demonstrated that changes in plasma amino acid AV
difference paralleled changes in milk production level and net milk protein
secretion (Guan et al. 2002; Trottier, 1997; Nielsen et al., 2002). In both studies
(Nielsen et al., 2002 and Guan et al., 2002), amino acid AV difference and
extraction rate also decreased past peak milk production (i.e., from day 18 to 24
of lactation) by approximately 15 and 25%, respectively, for the majority of the
essential amino acids. This decrease in AV and extraction rate paralleled a 10%
decrease in milk production (Nielsen et al., 2002). Schawb and coworkers
(1992) demonstrated a reduced responsiveness of the udder to amino acid
availability for milk protein synthesis with advancement of lactation. Taken
together, stage of lactation may dictate milk protein synthesis in part via
regulatory control of amino acid transfer processes across the mammary gland.
To date, two main restrictions to the net quantitative uptake of amino acid
across the capillary wall into the extracellular mammary space have been

suggested: 1.) the rate at which blood flow transports amino acids to the arterial

18

capillary; and 2) blood concentrations of amino acids. However, these factors are
probably not important in defining differences in mammary amino acid uptake
and milk protein secretion with increasing days of lactation based on the notion
that blood flow remains relatively constant throughout lactation (Nielsen et al.
2002) and that arterial concentrations of indispensable amino acids either vary
inversely with milk production (in particular of threonine and valine) or do not

change as in the case for lysine.

2.2. Amino acid transport systems and proteins

Uptake of amino acids by mammary gland epithelial cells is thought to be
mediated by several transport systems with unique kinetic and regulatory
properties (Shennan et al., 1997). Several transport systems with different
substrate specificities for amino acids have been identified and characterized in a
variety of mammalian cell systems. Amino acid transfer processes across
mammary tissue have been studied using in vitro approaches in mice (Van
Winkle et al., 1985; Verma and Kansal, 1995), rats (Kilberg et al., 1981; Sherman
et al., 1994; Sherman et al., 2002; Howard et al., 2004; Lopez et al., 2006) and
pigs (Hurley et al., 2000; Jackson et al., 2000) and have enabled kinetic
definitions of amino acid transport and, with these, assignments of amino acids to
specific systems sharing similar transport kinetic properties. Transport systems
are characterized by the type of amino acid that they transport and by the
thermodynamic properties of the transport. Specific transport systems carry

different types of amino acids and different transport systems show overlapping

19

specificities for amino acids (Palacln et al., 1998). Transport systems are either
ubiquitous or tissue-specific. Tissue-specific transport systems are usually

‘ isoforrns of ubiquitous transport systems (Palacln et al., 1998). Of main interest
for sow lactation is the study of the transporter systems y”, ASC, and 8°” in
mammary tissue because these are specific for amino acids that are essential in
the diet of sows and thus can limit milk protein synthesis. These systems have
been isolated and their cDNAs cloned from various non-mammary tissues as well
as human and ovine mammary tissue (Table 1.1). Amino acid transport systems
that have been kinetically defined in mammary tissue are presented and
discussed below. Of all the studies reviewed, only two (Hurley et al., 2000;
Jackson et al., 2000) were found that pertain to amino acid transport systems in

porcine mammary tissue, highlighting an important gap in knowledge.

2.3. Transport characteristics of amino acid transport systems of interest
The uptake of cationic amino acids (lysine, arginine, ornithine, and
histidine) is mediated by five transporter systems, namely y“, y*L, b”, b°”, and
8°” (Hyde et al., 1993; Palacin et al., 1998). The y+ system and possibly the
B°” system likely make the major contributions to lysine uptake in sow mammary
tissue (Shennan et al., 1997). These systems differ in their affinity for cationic
amino acids, their dependence on sodium for transport of amino acids, and their
capacity to additionally transport zwitterionic amino acids (Palacin et al., 1998).

System y“, also referred to as the CAT (cationic amino acid transporter) family

20

 

voom
.._5 5 5555... 55m
”mam? ...5 5 55:2
652 .._5 .5 5.25:5

coca ...5 5
5555.. N65."— 653
555.2 5:5 :56

33 655580
5:5 o: 553
...5 5 55:23. K53
...5 5 58.0 ”35m
...5 5 5555.. 55.”.

5:5:

5:5:

5:5:
.228:

52.

56:55. .55. 65655.5 .556:
.555 656555 .2552: .5555
65555585: . 5:55 55:55:.

5:55
E5555 .co5Eo5 5:25 >555»
66:55: .55. .555 E5EE5E

55E>5 .259 .2552:
.5555 $5>o 65:65:25.5
66555555.: 565255 .555
.55. .52. .555 55EE5E

65:55.5
65655
6555 65:55

Ebm< ow<

55ox_m 65:25
65555 655».

65:555.: +.om tom
65_5> 6552

652552

9.55.. .8553

65595 6552 mun—.56 +>

 

553 65:23.
5:5 55555.2
{.53 5 mm?
...5 5 5520 M33..
.._5 5 5555; 555

5:5:
.528:

55:55 .555 .525 .2552:
.5555 .52. .555 E5EE5E

2.5.2.. .5555

65595 6552 <~Q<o +>

 

32.9.3 ...5 .5 555.
:52 .5 .5 a:
:82 ...5 a 553.5:

mmocmhmuwm

65>O
€58:

52535
525555
55.2

525 .25sz .5555 .556:
6:555 6:535 =5Em 5:5
655. .5265 55.6 .55. 56:55.
.5255 .5255 .555 £25.:
6:8 .259 5.55 65:55::

853555 5.55. 265.

5555.. 655.5

_.-._.<o
65555 655». +>

5655 :55?
5:555:55 5:55:55

555 o5E< 5_o5 o5E<

5555
55:5 :8 555....

5555525 .5555: 5:5 525% :265. 5:5 55:55 555 o5E5 62.5: 55555 5:5 55555 5:35:55 555 o5E<

_.._. m..m<._.

21

transport system, is a high affinity, sodium-independent transporter, and is
specific for cationic amino acids. It is also capable of carrying zwitterionic amino
acids across cell membranes, though with low affinity and in a sodium-dependent
manner (Closs, 1996). The y” transporter system is of particular interest because
lysine is the first dietary limiting amino acid for milk protein synthesis in lactating
pigs (Shennan et al., 1997), and growing evidence shows that arginine may be a
dietary essential amino acid for lactation in the pig (Perez Laspiur and Trottier,
2001; O’Quinn et al., 2002). Thus, it is likely that the y+ system is predominantly
responsible for lysine and arginine transport into mammary tissue for milk protein
synthesis.

The nature of cationic amino acid transport system in porcine mammary
tissue is controversial, and the transporter for lysine has not been identified
(Hurley et al., 2000). Lysine was originally proposed by Baumrucker (1985) to be
primarily transported via the classical y” system in mammary tissue. Now,
however, lysine is believed to be transported in porcine mammary tissue via a
Na*-independent system that differs from the classical y+ system (Hurley et al.,
2000). This belief is based on two findings: 1) lysine uptake in porcine mammary
tissue occurs via a Na“-independent transport mechanism with a Km of
approximately 1.4 mM (Hurley et al., 2000), which is 3 to 10-fold higher than the
reported Km for y+ systems in any other tissues (Closs et al, 1997); and 2) lysine
uptake in porcine mammary tissue is not specific for lysine, because lysine
uptake can be inhibited 50% by supra-physiological concentrations of L-leucine,

L-alanine, and L-methionine (Calvert and Sherman, 1996; Hurley et al., 2000). In

22

support of this argument, arginine was shown to be transported via two systems
in the mouse mammary gland, one specific for cationic amino acids (i.e., the
classical y” system) and the other capable of interacting with both cationic and
neutral amino acids, such as leucine (Sharrna and Kansal, 1999). In fact, the Km
for arginine uptake in mouse mammary tissue via the y” system was reported to
be 0.76 mM (Sharma and Kansal, 1999), which, as argued for lysine, is
approximately 10-fold higher than the reported Km for arginine uptake in other
tissues (Closs et al., 1997). Admittedly, one cannot rule out that the Km for
lysine uptake via the y+ system in porcine mammary tissue may be much higher
than that found in other tissues, given the uniqueness of the mammary gland in
protein synthetic capacity. On the other hand, the fact that lysine uptake is only
partly inhibited by supra-physiological concentrations of neutral amino acids but
strongly inhibited by physiological concentration of arginine (Hurley et al., 2000)
suggests that system y+ contribution to lysine uptake in sow mammary tissue is of
physiological importance, supporting the original argument of Baumrucker
(1985). Calvert and Sherman (1996) and Sharma and Kansal (1999) proposed
that the mammary cationic amino acid transport system that interacts with neutral
amino acids may be a tissue specific variant of system y+ or y+L, respectively.
With the notion that lysine uptake by lactating rat mammary tissue (Sherman and
McNeillie, 1994) and porcine mammary tissue (Hurley et al., 2000) is not
dependent upon Na‘, the contribution to cationic and neutral amino acid
interactive uptake by system B°"' is unlikely. Both y+ and B°°+ transport system

family members remain to be cloned from bovine or porcine mammary tissue.

23

The branched-chain amino acids (BCAA) isoleucine, leucine and valine
are retained by the porcine (T rottier et al., 1997; Nielsen et al., 2002) and bovine
(Clark et al., 1980; Hanigan et al., 1991) mammary gland in excess of their
output in milk. The branched chain amino acids, in particular valine, seem to play
an important role in the process of milk protein synthesis and overall mammary
metabolism (Richert et al., 1996; Richert et al., 1997; Guan et al., 2002). To date,
there is very little understanding of their importance relative to metabolic
functions other than protein synthesis in the mammary gland. The BCAA are
potentially taken up via at least four systems, including the ASC and B°"’ systems
(Palacin et al., 1998). These systems transport zwitterionic amino acids in a
sodium-dependent manner. Jackson and coworkers (2000) previously found that
only about half of the uptake of valine by lactating porcine mammary tissue
occurred via a sodium-independent mechanism, presumably the L system.
Valine is largely taken up by a Na”-dependent system (Jackson et al., 2000).
Two Na*-dependent amino acid transport systems with substrate specificity for
BCAA have been identified in mammary tissues of some species, system B°"’
(Sloan and Mager, 1999), and system ASC (Arriza et al., 1993; Sherman, 1998).

System ASC has a preference for linear dipolar amino acids (alanine,
serine, and cysteine) but has highest affinity for amino acids containing distal
hydroxyl group, such as threonine (Arriza et al., 1993). It is discernible from
system A (neutral amino acid transporter) in that it does not recognize N-
methylated amino acids and is pH insensitive (Makowske and Christensen, 1982;

Vadgama and Christensen, 1984; and Utsunomiya-Tate et al., 1996). System

24

ASC has been shown to be a major component of Na*-dependent transport of
amino acids in a number of tissues and species, including rabbit intestine and
reticulocytes, pigeon erythrocytes, and human fibroblasts (White, 1985). Cellular
uptake of BCAA in sow mammary tissue was characterized to describe the
kinetic properties and substrate specificity of the valine uptake system (Jackson
et al., 2000). The valine transport system in porcine mammary tissue has a Km
of 0.64 mM and a Vm.x of 1.84 mmol/kg cell. The characterization of the level of
expression of system ASC is of interest because of its specificity for BCAA, and
to the ASCT1 specificity for threonine (Neville et al., 1980), the second limiting
amino acid for milk protein synthesis in lactating sows (Pettigrew, 1993).

System B°'*, characterized in mouse blastocysts, has broad specificity
with high affinity for both cationic and neutral amino acids that is Na+ and Cl'-
dependent (Van Winkle et al., 1985), but has highest affinity for hydrophobic
amino acids (the BCAA isoleucine, leucine, and valine, the sulfur amino acids
methionine and cysteine, and the aromatic amino acids phenylalanine and
tryptophan) (Sloan and Mager, 1999). System B°"’ is well characterized for its
inhibition by bicyclic amino acids such as 2-aminobicyclo-[2.2.1]-heptane-2-
carboxylic acid. Because system BO” is a broad specificity transporter,
characterization of its expression level in porcine mammary tissue will provide
further insight into its physiological relevance to amino acid uptake regulation in
that system.

While the changes in AV difference reported in the literature may be

mediated via changes in amino acid transporter affinity and kinetics (i.e., Km and

25

Vmax), the focus of this dissertation is to begin to test the hypothesis that AV
differences and milk protein secretion differences related to dietary protein intake
and across day of lactation are related to the level of expression of mammary

amino acid transporters.

2.4. Molecular and kinetic characteristics of transporter systems and

proteins of interest
2.4.1. CAT family system

CAT-1 was the first of the CAT family of transporters studied (Palacin et
al., 1998). Cloning of this transporter resulted from studies demonstrating
induction of cationic amino acid transport by the murine ecotropic leukemia virus
(ecoR) (Kim et al., 1991), which was cloned and called CAT-1. The murine CAT-
1 is a 622 amino acid glycoprotein with a predicted molecular mass of 67 kDa
(Albritton et al., 1989). It has the substrate specificity and kinetic properties
consistent with the high-affinity, low-capacity, system y“ properties (White, 1985).
The human gene homologous to the murine CAT-1 was cloned and mapped to
chromosome 13q12-13 (Yoshimoto et al., 1992; Albritton et al., 1992). This gene
consists of 10 introns and 11 exons, which code for an mRNA transcript of 9kb
with an open reading frame of 1.8kb (reviewed by Malandro and Kilberg, 1996).

Isolation and cloning of CAT-2A, the second CAT transporter to be
studied, occurred from investigations of genes involved in T-cell function during
immune responses (MacLeod et al., 1990). The full-length cDNA (called Tea)

predicted a 50-kDa protein of 658 amino acids (Reizer et al., 1993). This low

26

affinity transporter was subsequently isolated from murine liver, where it appears
to be abundantly expressed (Closs et al., 1993a). Cloning of the third member of
the CAT family, CAT-23, was performed by Closs and coworkers (1993b) using
mouse lymphocytes and macrophages. CAT-2A and CAT-28 are encoded by
one gene in mouse and are known to arise through alternative splicing, which
appears to confer tissue expression characteristics of these transporters (Closs
etaL,1993b)

The fourth member of the CAT family is called CAT-3 and was isolated
from mouse and rat brain tissue by Hosokawa and coworkers (1997) and Ito and
Groudine (1997). The CAT-3 transporter was shown by these investigators to be
brain-specific, and the mouse and rat counterparts exhibit 95% identity in amino
acid sequence. Vékony and coworkers (2001) cloned the homo sapiens CAT- 3
transporter and reported that it is expressed in the thymus, lymphoma cells,
uterus, testis, mammary gland, ovary, stomach, as well as the brain in humans.
The human cationic amino acid transporter (formerly CAT-3) is now called CAT-4
and maintains high sequence homology to the other members of the cationic
transporters (Sebastio et al., 1997). However, the literature on this transporter is
scarce (Palacln et al., 1998) and will not be discussed further.

The members of the cationic amino acid transporters have good homology
between them at the DNA sequence level. The amino acid sequences of murine
CAT-2A and CAT-23 maintain ~60% homology with CAT-1 (Closs et al., 1993a;
Reizer et al., 1993). The deduced amino acid sequences for CAT-2A and CAT-

2B differ in 19 amino acid residues in humans (Closs et al., 1997), and on a

27

stretch of 42 amino acid residues in mouse (Albritton et al., 1992; Kavanaugh et
al., 1994). It has been proposed that all the members of this oationic amino acid
transporter group are isofon'ns resulting from mutually exclusive alternate splicing
of a primary transcript (MacLeod and coworkers quoted in MacLeod and Kaduka,
1996). There is also evidence that the different isoforrns result from
transcriptional initiation at distinct promoters (Finley et al., 1995).
Posttranscriptional regulation of CAT-1 gene expression with highly regulated
and rapid turnover of the CAT-1 transcript modifies the expression of CAT-1 in
various tissues (Aulak et al., 1999; Closs, 2002). CAT-1 and CAT-ZNZB
expression has been reported in epithelial cells of several tissues and in various
cell lines (Palacin et al., 1998; Closs et al., 1993a; Closs, 1996; Close et al.,
1997; Burger-Kentischer et al., 1998; Cariappa et al., 2002). Tissue distribution of
CAT-1 is relatively ubiquitous in humans, consistent with system y“ expression
properties in several other species, except in hepatic tissue (Closs et al., 1997;
Burger- Kentischer et al., 1998). CAT-2A is expressed abundantly in hepatic

tissue (Closs et al., 1993a).

2.4.2. ASC System

Two members of the ASC family have been isolated: ASCT1 from human
hippocampus (Shafqat et al., 1993; Arriza et al., 1993) and ASCT2 from mouse
testis (Utsunomiya-Tate et al., 1996). It is proposed herein to study system
ASCT1 due to its specificity for threonine, the second limiting amino acid after

lysine for milk protein synthesis in lactating pigs (Pettigrew, 1993). Arriza and

28

coworkers (1993) and Shafqat and coworkers (1993) cloned the ASCT1
transporter cDNA and reported that it codes for a 532-amino acid protein. They
also reported that ASCT1 has an open reading frame of 1572 bp which encodes
524 amino acid residues distributed over 8 exons. ASCT1 also functions as a
receptor for the baboon endogenous retrovirus in certain conditions (Marin et al.,
2000).

ASCT2 was cloned by Fairman and coworkers (1995) and encodes for a
553-amino acid protein. The difference between the ASCT1 and ASCT2 isoforrns
is substrate specificity, where ASCT2 recognizes as substrate a broader set of
amino acids (Bussolati et al. 1992). The system ASC transporters show 40 to
44% identity to the human glutamate transporter, and can also transport

glutamate with low affinity at neutral pH (Vadgama and Christensen, 1984).

2.4.3. 8°" System

System B°"’ was first cloned by Sloan and Mager (1999) and called
hATB°+. The human cDNA for this transporter is 4.5 kb in length and encodes a
642-amino acid protein. it has a high sequence similarity to the glycine and
proline transporters. Tissue distribution of this transporter has been reported for
humans, with the highest expression in the lung, trachea, and salivary gland, and
lower levels of expression in the mammary gland, stomach, and pituitary gland
(Sloan and Mager, 1999).

There is no published information demonstrating the molecular presence

of amino acid transporters in porcine mammary tissue. Indeed, only human B°'+

29

(Sloan and Mager, 1999), CAT-3 (Vékony et al., 2001), GLT-1 (Berger and
Hediger, 2006), the ovine CAT-1 (Kiaei et al., unpublished), and the rat LAT1,
LAT2 (Shennan et al., 2002), and SNAT2 (Lopez et al., 2006) transport proteins
have been studied in the context of mammary tissue expression. In this
dissertation, the presence of these transporters in porcine mammary tissue

during lactation will be investigated.

2.5. Regulation of amino acid transporter expression
2.5.1. Amino acid availability

Expression of various amino acid transporters is affected by amino acid
availability (Shennan et al., 1994; Taketani et al., 1998; Fernandez et al., 2001;
Christie et al., 2001; Closs, 2002; Kimball and Jefferson, 2006). In general,
excess amino acid availability promotes anabolism and global protein synthesis
(Fafoumoux et al., 2000). This can occur by a global increase in mRNA
transcription, stability and translation. Conversely, when amino acids are in short
supply, global protein synthesis is depressed to the point of entering a catabolic
state. In this state of proteolysis, a select group of genes are transcribed and
translated at an increase rate via a process known as adaptive regulation. These
groups of selected genes are related to the biosynthesis and transport of amino
acids into cells (Barbosa-Tessmann et al., 2000). During adaptive regulation,
amino acid transporter expression, stability and activity are increased to ensure
the uptake of amino acids for the sustainability and survival of the cell in a

nutrient deprived environment. An example of these genes are the transporters

30

SNAT2 (system A; Lopez et al., 2006); CAT-1 (system y”; Aulak et al., 1999),
ASCT1 (system ASC; Howard et al., 2004) and 8°” (system 8°”; Satsu et al.,
1998) among others.

Amino acid availability stimulates uptake of amino acids via the system y+
through trans stimulation, with CAT-1 exhibiting a greater rate of trans stimulation
than CAT-2 (Closs et al., 1997). On the other hand, through adaptive regulation,
amino acid starvation increases CAT-1 mRNA and protein levels. Indeed, mRNA
levels for CAT-1 increased 3.8 to 18 folds in C6 glioma and NRK kidney cells
following a 2-h amino acid starvation (Aulak et al.; 1999). An increase in
translation via an internal ribosomal entry sequence within the 5’ untranslated
region of the CAT-1 transcript has also been demonstrated (Fernandez et al.,
2001). Yaman and coworkers (2002) also demonstrated that during amino acid
starvation, CAT-1 mRNA stability increased with corresponding increase in CAT-
1 protein expression. Yet, long-term protein malnutrition or dietary protein
deficiency causes down regulation of these amino acid transporters (Hyde et al.,

2003)

2.5.2. Lactogenic hormones and metabolites

Hormonal availability also plays a role in the expression of several amino
acid transporters. Increased uptake of amino acids by mammary tissue explants
has been reported in the presence of lactogenic hormones such as prolactin,
insulin, and also in the presence of glucocorticoids and glucose (Shanna and

Kansal, 2000; Simmons et al., 1996). In the same manner, hepatic treatment with

31

insulin and glucocorticoids increased CAT-1 expression through increase in
mRNA transcription and stability (Liu and Hatzoglou, 1998). Another important
piece of evidence related to regulation of amino acid transporter expression is
the finding that glucose limitation can cause an increase in CAT-1’s mRNA and
protein levels, with a consequent increase in arginine uptake (Fernandez et al.,
2002) similar to the effect of amino acid starvation. The amino acid transporter
8°” capacity of transport seems to increase in blastocysts during implantation by

the presence of estrogen (Kilberg et al., 1993).

2.5.3. Inflammation

The importance of CAT-2 regulation by external factors can be clearly
appreciated in cytokine-activated cells in which nitric oxide (NO) production is
increased. CAT-2 seems to be required for sustained NO production, and its
expression increased when cells or tissues are activated in order to increase
their NO supply (Nicholson et al., 2001). This is accomplished by increasing the
expression of CAT-28 and, in some cases, an increase in CAT-1. Kakuda and
coworkers (1998) reported that food deprivation and surgical trauma increases
CAT-2A transcripts and that activated macrophages show an increase in CAT-2
transcript and protein, but a decrease in CAT-1 transcripts. Similar results have
been reported subsequently (Kakuda et al., 1999; Nelin et al., 2001). In some
cases where cells are challenged with lipopolysaccharide and interferon gamma,
all CATs transcripts (CAT-1, CAT-2A and CAT-28) increase (Baydoun et al.,

1999) and this increase appears to be regulated by the p38 mitogen-activated

32

protein kinases. On the other hand, polyamines like spermine inhibit NO
production via depressed arginine uptake in activated macrophages by
downregulating CAT-28 mRNA abundance (Mossner et al., 2001).

MAIN HYPOTHESIS AND OBJECTIVES

In spite of their central importance to milk synthesis, there is relatively little
known about mammary transport systems and their control in agriculturally
valuable animals. It is not known if the parallelism observed between amino acid
AV difference and milk protein secretion rate is directly related to transporter
functions. Although there is abundant variety of amino acid transporter systems
in numerous tissues and animal species, very few have been studied in porcine
mammary tissue. Furthermore, the extent to which these transport processes
control the entry of amino acids into porcine mammary tissue for milk protein
synthesis has not been studied. New experimental approaches are essential to
address whether these transport processes place a limitation on milk protein
synthesis by the porcine mammary glands during the developmental phases of
lactation.

Increases in amino acid transport into mammary epithelial cells during
lactation may be mediated via two main mechanisms: (i) increased tissue
sensitivity for amino acid transport via increased affinity of transporters for amino
acids; and (or) (ii) a change in capacity for transport via an increase in mammary
expression of key amino acid transporter systems. Acknowledging that amino

acid transport into mammary epithelial cells may be mediated via multiple

33

complex mechanisms, it is proposed that the change observed in milk protein
secretion rate with lactation demand is regulated, in part, by an alteration in
capacity for amino acid transport across mammary epithelial cells.

The studies described herein will begin to address whether or not maternal
protein nutrition and stage of lactation exerts regulatory control of the amino acid
transfer processes across the mammary gland. The hypothesis of the present
study is that under conditions of protein nutritional stress, the mammary gland
adaptively regulates amino acid transport. To test this hypothesis gene
expression of amino acid transporters (i.e., CAT-1, CAT-2A, CAT-28, ASCT1,
and 8°”) will be determined at two stages of lactopoesis. The main objective is
to examine changes occurring in the expression of amino acid transporters
specific for the transfer of lysine, threonine, and valine across mammary tissue
during lactation as these amino acids are limiting in diets of lactating sows. To
achieve this, mammary parenchyma mRNA and protein abundance for the
various transporters will be measured as an indicator of expression. Additional
objectives of this thesis include 1) the development of a biopsy technique in
mammary gland that permits collection of mammary tissue at different stages in
lactation from the same animal, thus decreasing the number of animals used in
the study and biological variation in the analysis; 2) investigate the effect of
protein nutritional stress in lactation performance, specially milk protein yield and
piglet growth rate; and 3) determine the effect of protein nutritional stress and
milk demand on mammary amino acid transporter expression. These objectives

are addressed-in the following chapters.

34

Literature cited

Aimutis, W. R., Komegay, E. T. & Eigel, W. N. (1982) Electrophoretic and
biochemical comparison of casein and whey protein from porcine colostrum
and milk. J. Dairy Sci. 65:1874-1881.

Albritton, L. M., Bowcock, A. M., Eddy, R. L., Morton, C. C., Tseng, L., Farrer, L.
A., Cavalli-Sforza, L. L., Shows, T. B. & Cunningham, J. M. (1992) The
human cationic amino acid transporter (ATRC1): physical and genetic
mapping to 13q12-q14. Genomics. 12:430-434.

Albritton , L. M., Tseng, L., Scadden, D. & Cunningham, J. M. (1989) A putative
murine ecotropic retrovirus receptor gene encodes a multiple membrane

spanning protein and confers susceptibility to virus infection. Cell. 57:659-
666.

Arriza, J. L., Kavanaugh, M. P., Fairman, W. A., Wu, Y. N., Murdoch, G. H.,
North, R. A. & Amara, S. G. (1993) Cloning and expression of a human
neutral amino acid transporter with structural similarity to the glutamate
transporter gene family. J. Biol. Chem. 268:15329-15332.

Aulak, K. S., Mishra, R., Zhou, L., Hyatt, S. L., Jonge, W., Lamers, W., Snider, M.
& Hatzoglou, M. (1999). Post-transcriptional regulation of the arginine
transporter Cat-1 by amino acid availability. J. Biol. Chem. 274:30424-30432.

Barbosa-Tessmann, I. P., Chen, C., Zhong, C., Siu, F., Schuster, S. M., Nick, H.
S. & Kilberg, M. S. (2000) Activation of the human asparagine synthetase
gene by the amino acid response and the endoplasmic reticulum stress
response pathways occurs by common genomic elements. J. Biol. Chem.
275:26976—26985.

Baumrucker, C. R. (1985) Amino acid transport systems in bovine mammary
tissue. J. Dairy. Sci. 68:2436-2451.

Baydoun, A. R., Wileman, S. M., Wheeler-Jones, C. P., Marber, M. S., Mann, G.
E., Pearson, J. D. & Closs, E. I. (1999) Transmembrane signalling
mechanisms regulating expression of cationic amino acid transporters and
inducible nitric oxide synthase in rat vascular smooth muscle cells. Biochem.
J. 344:265-272.

Bequette, B. J., Backwell, F. R. C. (1997) Amino acid supply and metabolism by
the ruminant mammary gland. Proc. Nutr. Society. 56:593-605.

Bequette, 8. J., Backwell, F. R., Calder, A. G., Metcalf, J. A., Beever, D. E.,

MacRae, J. C. & Lobley, G. E. (1997) Application of a U-13C-Iabeled amino
acid tracer in lactating dairy goats for simultaneous measurements of the flux

35

of amino acids in plasma and the partition of amino acids to the mammary
gland. J Dairy Sci. 80:2842-2853.

Bequette, B. J., Hanigan, M. D., Calder, A. G., Reynolds, C. K., Lobley, G. E. &
MacRae, J. C. (2000) Amino acid exchange by the mammary gland of
lactating goats when histidine limits milk production. J. Dairy Sci. 83:765-775.

Bequette, B. J., Backwell, F. R. C., Dhanoa, M. S., Walker, A., Calder, A. G.,
Wray-Cahen, D., Metcalf, J. A., Sutton, J. D., Beever, D. E., Lobley, G. E. &
MacRae, J. C. (1994) Kinetics of blood free and milk casein-amino acid
labelling in the dairy goat at two stages of lactation. Br. J. Nutr. 72:211-220.

Bequette, B. J., Backwell, F. R. C., MacRae, J. C., Lobley, G. E., Crompton, L.
A., Metcalf, J. A. & Sutton, J. D. (1996) Effect of Intravenous Amino Acid
Infusion, on Leucine Oxidation Across the Mammary Gland of the Lactating
Goat J. Dairy Sci.79:2217-2224.

Berger, U. V. & Hediger, M. A. (2006) Distribution of the glutamate transporters
GLT-1 (SLC1A2) and GLAST (SLC1A3) in peripheral organs. Anat. Embryol.
(berl). 21 1 :595-606.

Boisgard, R., Chanat, E., Lavialle, F., Pauloin, A., & Ollivier-Bousquet. (2001)
Roads taken by milk proteins in mammary epithelial cells. Liv. Prod. Sci.
70:49-61.

Boyd, D. R. & Kensinger, R. S. (1998) Metabolic precursors for milk synthesis. In:
Verstegen MWA, Moughan PJ, Scharrna,JW (Eds), The Lactating Sow.
Wageningen Press, Wageningen, 71-95.

Burger-Kentischer, A., Muller, E., Klein, H. G., Schober, A., Neuhofer, W. & Beck,
F. X. (1998) Cationic amino acid transporter mRNA expression in rat kidney
and liver. Kidney lntl. Suppl. 67: $136-$138.

Bussolati, O., Laris, P. C., Rotoli, B. M., Dall’Asta, V. & Gazzola, G. C. (1992)
Transport system ASC for neutral amino acids. An electroneutral
sodium/amino acid cotransport sensitive to membrane potential. J. Biol.
Chem. 267: 8330-8335.

Calvert, D.T. & Shennan, DB. (1996) Evidence for an interaction between
cationic and neutral amino acids at the blood-facing aspect of the lactating rat
mammary epithelium. J. Dairy Research. 63: 25-33.

Cant, J. P. & McBride, 8. W. (1995) Mathematical analysis of the relationship

between blood flow and uptake of nutrients in the mammary glands of a
lactating cow. J Dairy Res. 62:405-422.

36

Cariappa, R., Heath-Monnig, E., Furesz, T. C., Kamath, S. G. & Smith, C. H.
(2002) Stable polarized expression of hCAT-1 in an epithelial cell line. J.
Membr. Biol. 186: 23-30.

Champedron, C., Debras, E., Mirand, P. P. 8 Amal, M. (1990) Methionine flux
and tissue protein synthesis in lactating and dry goats. J. Nutr. 120:1006-
1015.

Christie, G. R., Hyde, R., & Hundal, H. S. (2001) Regulation of amino acid
transporters by amino acid availability. Curr. Opin. Clin. Nutr. Metab. Care 4:
425-431.

Clark, R. M., Chandler, P. T., Park, C. S. & Norman, A. W. (1980) Extracellular
amino acid effects on milk protein synthesis and intracellular amino acid pools
with bovine mammary cells in culture. J Dairy Sci. 63:1230-1234.

Closs, E. l. (1996) CATs, a family of three distinct mammalian cationic amino
acid transporters. Amino Acids 11:193-208.

Closs, E. l. (2002) Expression, regulation and function of carrier proteins for
cationic amino acids. Curr. Opin. Nephrol. Hypertens. 11: 99-107.

Closs, E. l., Albritton, L. M., Kim, J. W. & Cunningham, J. M. (1993a)
Identification of a low affinity, high capacity transporter of cationic amino acids
in mouse liver. J. Biol. Chem. 268:7538-7544.

Closs, E. l., Graf, P., l-labermeier, A., Cunningham, J. M. & Forsterrnann, U.
(1997) Human cationic amino acid transporters hCAT-1, hCAT-2A, and
hCAT-28: three related carriers with distinct transport properties.
Biochemistry. 36:6462-6468.

Closs, E. l., Lyons, R. l., Kelly, C. & Cunningham, J. M. (1993b) Characterization
of the third member of the mCAT family of cationic amino acid transporters. J.
Biol. Chem. 268:20796-208000.

Csapo, J., Martin, T. G., Csapo-Kiss, Z. S., & Hazas, Z. (1996) Proteins, fats,
vitamin and mineral concentrations in porcine colostrums and milk from
parturition to 60 days. Int. Dairy J. 62881-902.

Darnell, J. E. Jr. (1997) STATs and gene regulation. Science. 277:1630-1635.

Dong, B., 8 Zhao, F. O. (2007) Involvement of the ubiquitous Oct-1 transcription

factor in hormonal induction of beta-casein gene expression. Biochem. J.
401257-64.

37

Doppler, W., Heck, W., Hofer, P., Groner, B. 8 Ball, R. K. (1990) Prolactin and
glucocorticoid hormones control transcription of the beta-casein gene by
kinetically distinct mechanisms. Mol Endocrinol. 42912-919.

Edwards, G. M., Wilford, F. H., Liu, X., Henninghausen, L., Dijiane, J., 8 Streuli,
C. H. (1998) Regulation of mammary differentiation by extracellular matrix
involves protein-tyrosine phosphatases. J. Biol. Chem. 273: 9495-9500.

Fafournoux, P., Bruhat, A. 8 Jousse, C. (2000) Amino acid regulation of gene
expression. Biochem. J. 351:1-12.

Fairman, W. A., Vandenberg, R. J., Arriza, J. L., Kavanaugh, M. P. 8 Amara,
S.G. (1995) An excitatory amino-acid transporter with properties of a ligand-
gated chloride channel. Nature. 375:599—603.

Farmer, C., Guan, X. 8 Trottier, N. L. (2008; Epub 2006) Mammary arteriovenous
differences of glucose, insulin, prolactin and IGF-l in lactating sows under
different protein intake levels. Domest Anim Endocrinol. 34:54-62.

Fernandez, J., Lopez, A.B., Wang, C., Mishra, R., Zhou, L., Yaman, I., Snider, M.
D. 8 Hatzolgou, M. (2003) Transcriptional control of the arginine/lysine
transporter cat-1 by physiological stress. J. Biol. Chem. 278: 50000—50009.

Fernandez, J., Yaman, l., Mishra, R., Merrick, W.C., Snider, M.D., Lamers, W.H.
8 Hatzolgou, M. (2001) Internal ribosome entry site-mediated translation of a
mammalian mRNA is regulated by amino acid availability. J. Biol. Chem.
276:12285-12291.

Fernandez, J., Yaman, I., Samow, P., Snider, M. D. 8 Hatzolgou, M. (2002)
Regulation of internal ribosome entry site-mediated translation by
phosphorylation of the translation initiation factor elF2d. J. Biol. Chem. 277:
2050-2058.

Finley, K. D., Kakuda, D. K., Barrieux, A., Kleeman, J., Huynh, P. D. 8 MacLeod,
C. L. (1995) A mammalian arginine/lysine transporter uses multiple
promoters. Proc. Natl. Acad. Sci. USA. 92:9378-9382.

Forsum, E. 8 Lonnerdal, B. (1980) Effect of protein intake on protein nitrogen
composition of breast milk. Am. J. Clin. Nutr. 33:1809-1813.

Guan, X., Bequette, B. J., Calder, G., Ku, P. K., Ames, K. N. 8 Trottier, N. L.
(2002) Amino acid availability affects amino acid transport and protein
metabolism in the porcine mammary gland. J. Nutr. 132:1224-1234.

Guan, X., Pettigrew, J. E., Ku, P. K., Ames, K. N., Bequette, B. J. 8 Trottier, N. L.
(2004) Dietary protein concentration affects plasma arteriovenous difference

38

of amino acids across the porcine mammary gland. J. Anim. Sci. 82: 2953-
2963.

Guinard, J., Rulquin, H. 8 Verite, R. (1994) Effect of graded levels of duodenal
infusions of casein on mammary uptake in lactating dairy cows. 1. major
nutrients. J. Dairy Sci. 77:2221-2231.

Hanigan, M. D., Calvert, C. C., DePeters, E. J., Reis, B. L. 8 Baldwin, R. L.
(1991) Whole blood and plasma amino acid uptakes by lactating bovine
mammary glands. J Dairy Sci. 74:2484-2490.

Harrell, R. J., Thomas, M. J. 8 Boyd, R. D. (1993) Limitations of sow milk yield on
baby pig growth. In: Proceedings of the 1993 Cornell Nutrition Conference for
Feed Manufacturers, pp. 156-164. Department of Animal Science and
Division of Nutritional Sciences of the New York State College of Agriculture
and Life Sciences, Cornell University, Ithaca, NY, USA.

Hartmann, P. E. 8 Holmes, M. A. (1989) Sow lactation. In: Manipulating Pig
Production ll (Barnett, J. L. 8 Hennessy, D. P., eds.), pp. 72—97. Australasian
Pig Science Association, Albury, NSW, Australia.

Hartmann, P. E., Smith, N.A., Thompson, M. J., Wakeford, C. M. 8 Arthur, P. G.
(1997) The lactation cycle in the sow: physiological and management
contradictions. Liv. Prod. Sci. 50:75-87.

Hodge, R. M. W. (1974) Efficiency of food conversion and body composition of
the pre-ruminant lamb and the young pig. Br. J. Nutr. 32: 113-126.

Hohenshell, L. M., Cunnick, J. E., Ford, S. P., Kattesh, H. G., Zimmerman, D. R.,
Wilson, M. E., Matteri, R. L., Carrols, J. A. 8 Lay Jr., D. C. (2000) Few
differences found between early- and late-weaned pigs raised in the same
environment. J. Anim. Sci. 78:38-49.

Hosokawa, H., Sawamura, T., Kobayashi, s., Ninomiya, H., Miwa, S. 8 Masaki,
T. (1997) Cloning and characterization of a brain-specific cationic amino acid
transporter. J. Biol. Chem. 272:8717-8722.

Howard, A., Goodlad, R. A., Walters, J. R. F., Ford, D. 8 Hirst, B. H. (2004)
Increased expression of specific intestinal amino acid and peptide transporter
mRNA in rats fed by TPN is reversed by GLP-2. J. Nutr. 134: 2957-2964.

Hurley, W. L., Wang, H., Bryson, J. M. 8 Shennan, D. B.(2000) Lysine uptake by
mammary gland tissue of the lactating sow. J. Anim. Sci. 78:391-395.

Hyde, R., Taylor, P. M. 8 Hundal, H. S. (2003) Amino acid transporters: roles in
amino acid sensing and signaling in animal cells. Biochem. J. 373: 1-18.

39

Ito, K. 8 Groudine, M. (1997) A new member of the cationic amino acid
transporter family is preferentially expressed in adult mouse brain. J Biol
Chem. 272:26780—26786.

Jackson, S. C., Bryson, J. M, Wang, H., Hurley, W. L. (2000) Cellular uptake of
valine by lactating porcine mammary tissue. J. Anim. Sci. 78:2927-2932.

Jolivet, G., L'Hotte, C., Pierre, S., Tourkine, N. 8 Houdebine, L. M. (1996) A
MGF/STAT5 binding site is necessary in the distal enhancer for high prolactin
induction of transfected rabbit alpha s1-casein-CAT gene transcription. FEBS
Lett. 389:257-262.

Jones, D. 8. 8 Stahly, T. S. (1999) Impact of amino acid nutrition during lactation
on body nutrient mobilization and milk nutrient output in primiparous sows. J.
Anim. Sci. 77:1513-1522.

Kakuda, D. K., Finley, K. D., Dionne, V. E. 8 MacLeod, C. L. (1993) Two distinct
gene products mediate y+ type cationic amino acid transport in Xenopus
oocytes and show different tissue expression patterns. Transgene 1:91-101.

Kakuda, D. K., Finley, K. D., Maruyama, M. 8 MacLeod, C. L. (1998) Stress
differentially induces cationic amino acid transporter gene expression.
Biochim. Biophys. Acta 1414: 75-84.

Kakuda, D. K., Sweet, M. J., Mac Leod, C. L., Hume, D. A. 8 Markovich, D.
(1999) CAT2-mediated L-arginine transport and nitric oxide production in
activated macrophages. Biochem. J. 340:549-553.

Kavanaugh, M. P., Wang, H., Zhang, Z., Zhang, W, Wu, Y. N., Dechant, E.,
North, R. A. 8 Kabat, D. (1994) Control of cationic amino acid transport and
retroviral receptor functions in a membrane protein family. J. Biol. Chem.
269:15445-15450.

Kazansky, A. V., Raught, 8., Lindsey, S. M., Wang, Y. F., Rosen, J. M. (1995)
Regulation of mammary gland factor/Stat5a during mammary gland
development. Mol. Endocrinol. 921598-1609.

Kiaei, M., Prosser, C. G., Thompson, M. P. 8 Grigor, M. R. (Unpublished) Partial
cDNA clone and sequence of an ovine mammary gland cationic amino acid
transporter (system y+). GenBank Accession Number AF212146.

Kilberg, M. S., Handlogten, M. E. 8 Christensen, H. N. (1981) Characteristics of
system ASC for transport of neutral amino acids in the isolated rat
hepatocytes. J. Biol. Chem. 256: 3304-3312.

40

Kilberg, M. S., Stevens, 8. R. 8 Novak, D. A. (1993) Recent advances of
mammalian amino cid transport. Annu. Rev. Nutr. 13:137-165.

Kim, J. W., Closs, E. l., Albritton, L. M., Cunningham, J. M. (1991) Transport of
cationic amino acids by the mouse ecotropic retrovirus receptor. Nature.
352:725-728.

Kimball, S. R. 8 Jefferson, L. S. (2006) New functions for amino acids: ofects on
gene transcription and translation. Am. J. Clin. Nutr. 83: 500S-507S.

King, R. H., Toner, M. S., Dove, H., Atwood, C. S. 8 Brown, W. G. (1993) The
response of first-litter sows to dietary protein level during lactation. J. Anim.
Sci. 71: 2457-2463.

Klobasa, F., Werhahn, E. 8 Butler, J. E. (1987) Composition of sow milk during
lactation. J. Anim. Sci. 52: 1458-1466.

Kozakai, T., Sakate, M., Masuo, Y., Uchide, T. 8 Saida, K. (2002) Increased
gene expression of endothelin-1 and vasoactive intestinal
contractor/endothelin-2 in the mammary gland of lactating mice. Biochem.
Biophys. Res. Commun. 297:1339-1343.

Lau, O, Sullivan, M. K. 8 Hazelwood, R. L. (1993) Effects of diabetes mellitus on
lactation in the rat. Proc. Soc. Exp. Biol. Med. 204281-89.

Lechner, J., Welte, T. 8 Doppler, W. (1997) Mechanism of interaction between
the glucocorticoid receptor and Stat5: role of DNA-binding. lmmunobiol.
198:112-123.

Linzell, J. L., Mepham, T. 8., Annison, E. F. 8 West, C. E. (1969) Mammary
metabolism in lactating sows: arteriovenous differences of milk precursors
and the mammary metabolism of [14C]glucose and [14C]acetate. Br J Nutr.
23:31 9-332.

Liu, J. 8 M. Hatzoglou. (1998) Control of expression of the gene for the arginine
transporter Cat-1 in rat liver cells by glucocorticoids and insulin. Amino Acids.
15:321-337.

Liu, K. D., Lai S. Y., Goldsmith, M. A. 8 Greene, W. C. (1995) Identification of a
variable region within the cytoplasmic tail of the IL-2 receptor beta chain that
is required for growth signal transduction. J. Biol. Chem. 270:22176-22181.

Liu, X., Robinson, G. W., Wagner, K. U., Garrett, L., Wynshaw-Boris, A. 8

Hennighausen, L. (1997) Stat5a is mandatory for adult mammary gland
development and Iactogenesis. Genes Dev. 1 1 :179-186.

41

Lepez, A., Torres, N., Ortiz, V., Aleman, G., Hemandez-Pando, R. 8 Tovar, A. R.
(2006) Characterization and regulation of the gene expression of amino acid
transport system A (SNAT2) in rat mammary gland. Am. J. Physiol.
Endocrinol. Metab. 291 :E1059-E1066.

Maas, J. A., France, J. 8 McBride, 8. W. (1997) Model of milk protein synthesis.
A mechanistic model of milk protein synthesis in the lactating bovine
mammary gland. J. Theor. Biol. ‘1872363-378.

MacLeod, C. L., Finley, K., Kakuda, D., Kozak, C. A. 8 Wilkinson, M. F. (1990)
Activated T cells express a novel gene on chromosome 8 that is closely
related to the murine ecotropic retrovirus receptor. Mol. Cell. Biol. 10:3663-
3674.

MacLeod, C. L. 8 Kakuda, D. K. (1996) Regulation of CAT: cationic amino acid
transporter gene expression. Amino Acids 11:171-191.

Makowske, M. 8 Christensen, H. N. (1982) Hepatic transport system
interconverted by protonation from service for neutral to service for anionic
amino acids. J. Biol. Chem. 257:14635-14638.

Malandro, MS. 8 Kilberg, MS. (1996) Molecular biology of mammalian amino
acid transporters. Annu. Rev. Biochem. 65:305-336.

Marin, M., Tailor, C.S., Nouri, A. 8 Kabat, D. (2000) Sodium-dependent neutral
amino acid transporter type 1 is an auxiliary receptor for baboon endogenous
retrovirus. J. \firol. 74:8085-8093.

Meier, V. S. 8 Groner, B. (1994) The nuclear factor YY1 participates in
repression of the beta-casein gene promoter in mammary epithelial cells and
is counteracted by mammary gland factor during lactogenic hormone
induction. Mol. Cell Biol. 14:128-137.

Mepham, T. B. (1982) Amino acid utilization by lactating mammary gland. J.
Dairy Sci. 65: 287-298.

Mepham, T. B. 8 Linzell, J. L. (1966) A quantitative assessment of the
contribution of individual plasma amino acids to the synthesis of milk proteins
by the goat mammary gland. Biochem J. 101:76-83.

Metcalf, J. A., Beever, D. E., Sutton, J. D., Wray-Cahen, D., Evans, R. T.,
Humphries, D. J., Backwell, F. R., Bequette, B. J. 8 MacRae, J. C.(1994) The
effect of supplementary protein on in vivo metabolism of the mammary gland
in lactating dairy cows. J Dairy Sci. 77:1816-1827.

42

Metcalf, J. A., Wray-Cahen, D., Chettle, E. E., Sutton, J. D., Beever, D. E., .
Crompton, L. A., MacRae, J. C., Bequette, B. J. 8 Backwell, F. R. (1996) The
effect of dietary crude protein as protected soybean meal on mammary
metabolism in the lactating dairy cow. J Dairy Sci. 79:603-611.

Motil, K. J., Thotathuchery, M., Bahar, A. 8 Montandon, C. M. (1995) Marginal
dietary protein restriction reduced nonproteinnitrogen, but not protein nitrogen
components, of human milk. Am. J. Coll. Nutr. 14:184-191.

Mossner, J., Hammerrnann, R. 8 Racké, K. (2001) Concomitant down-regulation
of L-arginine transport and nitric oxide (NO) synthesis in rat alveolar
macrophages by the polyamine spermine. Pulm. Phannacol. Ther. 14:297-
305.

Nagaiah, K, Bolander, F. F., Jr., Nicholas, K. R., Takemoto, T. 8 Topper, Y. J.
(1981) Prolactin-induced accumulation of casein messenger RNA in mouse
mammary explants: A selective role of glucocorticoid. Biochem. Biophys. Res.
Commun. 98:380-387.

National Research Council. (1998) Nutrient requirements of swine. 10th ed.
Washington, DC: National Academy Press.

Nelin, L. D., Nash, H. E. 8 Chicoine, L. G. (2001) Cytokine treatment increases
arginine metabolism and uptake in bovine pulmonary arterial endothelial cells.
Am. J. Physiol. Lung Cell. Mol. Physiol. 281:L1232-L1239.

Neville, M. C., Lobitz, C. J., Ripoll, E. A. 8 Tinney, C. (1980) The sites of El-
aminoisobutyric acid uptake in normal mammary gland and ascites tumor
cells. J. Biol. Chem. 255:7311-7316.

Nicholson, 8., Manner, C. K., Kleeman, J. 8 MacLeod, C. L. (2001)
Sustained nitric oxide production in macrophages requires the arginine
transporter CAT2. J. Biol. Chem. 276: 1 5881-1 5885.

Nielsen, T. T., Trottier, N. L., Stein, H. H., Bellaver, 0., Easter, RA. (2002) The
effect of litter size and day of lactation on amino acid uptake by the porcine
mammary gland. J. Anim. Sci. 80:2402-2411.

Noblet, J., Etienne, M. (1986) Effect of energy level in lactating sows on yield and
composition of milk and nutrient balance of piglets. J. Anim. Sci. 63:1888-
1896.

Oddy, V. H., Lindsay, D. B. 8 Fleet, l. R. (1988) Protein synthesis
and degradation in the mammary gland of goats. J Dairy Res.55:143-154.

43

Oftedal, O. T. (1984) Milk composition, milk yield and energy output at peak
lactation: A comparative review. In: Physiological Strategies in Lactation.
Symposia of the Zoological Society of London, Vol. 51. Peaker, M., Vernon,
R. G. 8 Knight, C. H. (Eds.) Academic Press, London. pp. 33-85.

O’Quinn, P. R., Knabe, D. A. 8 Wu, G. (2002) Arginine catabolism in lactating
porcine mammary tissue. J. Anim. Sci. 80: 467-474.

Palacin, M., Estévez, R., Bertran, J. 8 Zorzano, A. (1998) Molecular biology of
mammalian plasma membrane amino acid transporters. Physiological
Reviews. 78(4):969-1054.

Parry, G., Cullen, 8., Kaetzel, C. S., Kramer, R. 8 Moss, L. (1987) Regulation of
differentiation and polarized secretion in mammary epithelial cells maintained
in culture: extracellular matrix and membrane polarity influences. J. Cell Biol.
105:2043-2051 .

Perez Laspiur, J. 8 Trottier, N. L. (2001) Effect of dietary arginine
supplementation and environmental temperature on sow lactation
performance. Livest. Prod. Sci. 70: 159-165.

Pettigrew, J. E. (1993) Amino acid nutrition of gestating and lactating sows.
BioKyowa technical Review #5. Nutri-Quest, Inc. Chesterfield, MO.

Pezet, A., Buteau, H., Kelly, P. A. 8 Edery, M. (1997) The last proline of Box 1 is
essential for association with JAK2 and functional activation of the prolactin
receptor. Mol. Cell Endocrinol. 129:199-208.

Pluske, J. R. 8 Dong, G. Z. (1998) Factors influencing the utilization of
colostrums and milk. In: Verstegen, M. W. A., Moughan, P. J., Scharrna, J. W.
(Eds) The Lactating Sow, Wageningen Press, Wagenigen, pp 45-70.

Pluske, J. R., Williams, I. H. 8 Aherne, F. X. (1995) Nutrition of the neonatal pig.
In: The Neonatal Pig: Development and survival (Ed. M. A. Varley), pp 187-
235. CAB lntemational, Wallingford, London, UK.

Prosser, C. G., Sankaran, L., Hennighausen, L. 8 Topper, Y. J. (1987)
Comparison of the roles of insulin and insulin-like growth factor I in casein
gene expression and in the development of alpha-Iactalbumin and glucose
transport activities in the mouse mammary epithelial cell. Endocrinol.
120:1411-1416.

Raught, 8., Khursheed, B., Kazansky, A. 8 Rosen, J.(1994) YY1 represses beta-
casein gene expression by preventing the formation of a lactation-associated
complex. Mol. Cell Biol. 14:1752-1763.

Reizer, J., Finley, K., Kakuda, D., MacLeod, C. L., Reizer, A. 8 Saier, M. H.
(1993) Mammalian integral membrane receptors are homologous to
facilitators and antiporters of yeast, fungi and eubacteria. Protein Sci. 2:20-30.

Richert, B. T., Tokach, M. D., Goodband, R. D., Nelssen, J. L., Campbell, R. G. 8
Kershaw, S. (1997) The effect of dietary lysine and valine fed during lactation
on sow and litter performance. J. Anim. Sci. 75: 1853-1860.

Richert, B. T., Tokash, M. D., Goodband, R. D., Nelssen, J. L., Pettigrew, J. E.,
Walker, R.W. 8Johnston, L.J. (1996) Valine requirement of the high-
producing sow. J. Anim. Sci. 74: 1307-1313.

Rijnkels, M., Kooiman, P. M., de Boer, H. A. 8 Pieper F. R. (1997) Organization
of the bovine casein gene locus. Mamm. Genome 8: 148-152.

Ronayne de Ferrer, P. A. 8 Sambucetti, M. A. (1993) Casein to whey protein
ratio in rat and human milks: effects of maternal protein intake. J Dairy Sci.
76: 1645-1653.

Rosen, J. M., Wyszomierski, S. L., 8 Hadsell, D. (1999) Regulation of milk
protein gene expression. Annu. Rev. Nur. 19: 407-436.

Rosen, J. M., Zahnow, C., Kasansky, A. 8 Raught, B. (1998) Composite
response elements mediate hormonal and developmental regulation of milk
protein gene expression. Biochem. Soc. Symp. 63: 101-113.

Rui, H., Lebrun, J. J., Kirken, R. A., Kelly, P. A. 8 Farrar, W. L. (1994) JAK2
activation and cell proliferation induced by antibody-mediated prolactin
receptor dimerization. Endocrinol. 135: 1 299-1 306.

Satsu, H., Watanabe, H., Arai, S. 8 Shimizu, M. (1998) System BO,(+)-mediated
regulation of lysine transport in Caco-2 human intestinal cells. Amino Acids.
14: 379-384.

Schmidhauser, C., Casperson, G. F., Myers, C. A, Sanzo, K. T., Bolten, S. 8
Bissell, M. J. (1992) A novel transcriptional enhancer is involved in the
prolactin- and extracellular matrix-dependent regulation of b-casein gene
expression. Mol. Biol. Cell 3:699-709.

Schmitt-Ney, M., Doppler, W., Ball, R. K. 8 Groner, B. (1991) Beta-casein gene
promoter activity is regulated by the hormone-mediated relief of
transcriptional repression and a mammary-gland-specific nuclear factor. Mol.
Cell Biol. 11:3745-3755.

45

Schwab, C. G., Bozak, C. K., Whitehouse, N. L. 8 Mesbah, M. M. A. (1992)
Amino acid limitation and flow to the duodenum at four stages of lactation. 1.
sequence of lysine and methionine limitation. J. Dairy. Sci. 75:3486-3502.

Sebastio, G., Sperandeo, M. P., Incerti, 8., De Brasi, D., Rossi, E., Zuffardi, O.,
Andria, G. 8 Borsani, G. (1997) Isolation of a new gene (HCAT-3) with a
putative role of cationic amino acid transporter (Abstract). Med. Genet.
9(Suppl.):131.

Shafqat, S., Tamarappoo, 8. K., Kilberg, M. S., Puranam, R. S., McNamara, J.
O., Guadano-Ferraz, A. 8 Fremeu, R. T. J. (1993) Cloning and expression of
a novel Na+ -dependent neutral amino acid transporter structurally related to
mammalian Na+lglutamate cotransporters. J. Biol. Chem. 268:15351-15355.

Sharma, R. 8 Kansal, V. K. (1999) Characteristics of transport systems for L-
alanine in mouse mammary gland and their regulation by lactogenic

hormones: evidence for two broad spectrum systems. J. Dairy Research. 66:
385-398.

Shanna, R. 8 Kansal, V. K. (2000) Heterogeneity of cationic amino acid transport
systems in mouse mammary gland and their regulation by lactogenic
hormones. J. Dairy Research. 67: 21-30.

Shennan, DB. (1998) Mammary gland membrane transport systems. J. Mam.
Gland Biol. Neoplasia 3: 247-258.

Shennan, D. 8., Calvert, D. T., Travers, M. T., Kudo, Y. 8Boyd, C. A. R. (2002) A
study of L-Ieucine, L-phenylalanine and L-alanine transport in the perfused rat
mammary gland: possible involvement of LAT1 and LAT2. Biochimica et
Biophysica Acta. 1564: 133-139.

Shennan, D. B. 8 McNeillie, S. A. (1994) Characteristics of alpha-aminoisobutyric
acid transport by lactating rat mammary gland. J Dairy Res. 61 :9-19.

Shennan, D. B., McNeillie, S. A., Jamison, E. A. 8 Calvert, D. T. (1994) Lysine
transport in lactating rat mammary tissue: evidence for an interaction between
cationic and neutral amino acids. Acta Physiol. Scand. 151 :461-466.

Shennan, D. 8., Millar, I. D. 8 Calvert, D. T. (1997) Mammary-tissue amino acid
transport systems. Proc. Nutr. Society. 56: 1 77-1 91 .

Sherry, M. P., Schmidt, M. K. 8 Veum, T. L. (1978) Dietary protein to calorie

ratios and fat sources for neonatal piglets reared artificially with subsequent
performance. I. Performance. J. Anim. Sci. 46:1259-1266.

46

Simmons, W. W., Ungureanu-Longrois, D., Smith, G. K., Smith, T. W. 8 Kelly, R.
A. (1996) Glucocorticoids regulate inducible nitric oxide synthase by inhibiting
tetrahydrobiopterin synthesis and L-arginine transport. J. Biol. Chem.

271 :23928-23937.

Slade, R. D. 8 Miller, H. M. (1999) Influences of litter origin and weaning weight
on post-weaning piglet growth. In: Cranwell, P. D. (Ed.) Proceedings of the
Australasian Pig Science Association. Manipulating Pig Production, Vol III, p
131.

Sloan, J. L. 8 Mager, S. (1999) Cloning and functional expression of a human
Na+ and Cl- -dependent neutral and cationic amino acid transporter 80,+. J.
Biol. Chem. 274:23740-23745.

Spincer, J., Rook, J. A., Towers, K. G. (1969) The uptake of plasma constituents
by the mammary gland of the sow. Biochem J. 111:727-732.

Stdcklin, E, Wissler, M., Gouilleux, F. 8 Groner, B.(1996) Functional interactions
between Stat5 and the glucocorticoid receptor. Nature. 383:726-728.

Streuli, C. H., Bailey, N. 8 Bissell, M. J. (1991) Control of mammary epithelial
differentiation: basement membraneinduces tissue-specific gene expression
in the absence of cell-cell interaction and morphological polarity. J. Cell Biol.
115: 1383-1395.

Sturrnan, J., A., Devine, E., Resnick, O. 8 Morgane, P. J. (1986) Maternal protein
malnutrition in the rat: effect onprotein and two enxymes in the milk. Nutr.
Res. 6: 437-445.

Taketani, Y., Segawa, H., Chikamori, M., Morita, K., Tanaka, K., Kido, S.,
Yamamoto, H., lemori, Y., Tatsumi, S., Tsugawa, N., Okano, T., Kobayashi,
T., Miyamoto, K. 8 Takeda, E. (1998). Regulation of type II renal Na+-
dependent inorganic phosphate transporters by 1,25-dihydroxyvitamin D3.
Identification of a vitamin D-responsive element in the human NAPi-3 gene. J.
Biol. Chem. 273: 14575-14581.

Trottier, N. L. (1997) Nutritional control of amino acid supply to the mammary
gland during lactation in the pig. Proc. Nutr. Society. 56:581-591.

Trottier, N. L., Shipley, C. F. 8 Easter, R. A. (1995a) A technique for the venous
cannulation of the mammary gland in the lactating sow. J. Anim. Sci. 73:1390—
1 395.

Trottier, N. L., Shipley, C. F. 8 Easter, R. A. (1995b) Arteriovenous differences

for aminoacids, urea nitrogen, ammonia and glucose across the mammary
gland of the lactating sow. J. Anim. Sci. 73(Suppl. 2):57-58.

47

Trottier, N. L., Shipley, C. F. 8 Easter, R. A. (1997) Plasma amino acid uptake by
the mammary gland of the lactating sow. J. Anim. Sci. 75:1266-1278.

Utsunomiya-Tate, N., Endou, H. 8 Kanai, Y. (1996) Cloning and functional
characterization of a system ASC-like Na+ -dependent neutral amino acid
transporter. J. Biol. Chem. 271:14883-14890.

Vadgama, J. V. 8 Christensen, H. N. (1984) Wide distribution of pH-dependent
service of transport system ASC for both anionic and zwitterionic amino acids.
J. Biol. Chem. 259:3648-3652.

Vallet, V. S., Henrion, A. A., Bucchini, D., Casado, M., Raymondjean, M., Kahn,
A. 8 Vaulont, S. (1997) Glucose-dependent liver gene expression in upstream
stimulatory factor 2 -/- mice. J. Biol. Chem. 272:21944-21949.

Van Winkle, L. J., Christensen, H. N. 8 Campione, A. L. (1985) Na+ -dependent
transport of basic, zwitterionic, and bicyclic amino acids by a broad-scope
system in mouse blastocysts. J. Biol. Chem. 260:12118-12123.

Vékony, N., Sabine, W., Boissel, J.P., Gnauert, K. 8 Closs, E. I. (2001) Human
cationic amino acid transporter hCAT-3 is preferentially expressed in
peripheral tissues. Biochemistry. 40:12387-12394.

Verrna, N. 8 Kansal, V. K. (1995) Characterisation and starvation induced
regulation of methionine uptake sites in mouse mammary gland. Indian J.
Exp. Biol. 33: 516-520.

White, M. F. (1985) The transport of cationic amino acids across the plasma
membrane of mammalian cells. Biochim. Biophys. Acta. 822:355-374.

Williams, I. H. (1976) Nutrition of the young pig in relation to body composition.
PhD Thesis, University of Melbourne.

Worthington-Roberts, B. (1997) The role of maternal nutrition in the prevention of
birth defects. J. Am. Diet Assoc. 97:S184-S185.

Wu, G. 8 Knabe, D. A. (1994) Free and protein-bound amino acids in sow's
colostrum and milk. J. Nutr. 124:415-424.

Yaman, l., Fernandez, J., Sarkar, 8., Schneider, R. J., Snider, M. D., Nagy, L. E.
8 Hatzolgou, M. (2002) Nutritional control of mRNA stability is mediated by a
conserved AU-rich element that binds the cytoplasmic shuttling protein HuR.
J. Biol. Chem. 277:41539—46.

48

Yoshimoto, T., Yoshimoto, E. 8 Meruelo, D. (1992) Enhanced gene expression
of the murine ecotropic retroviral receptor and its human homolog in
proliferating cells. J. Virol. 66:4377-4381.

Zubieta, A. C. 8 L6nnerdal, B. (2006) Effect of suboptimal nutrition during

lactation on milk protein gene expression in the rat. J. Nutr. Biochem. 17: 604-
610.

49

CHAPTER TWO

Kirkwood”, R. N., Perez Laspiur‘, J., Ames", N. K., Moore‘, J. 8., Cegielskid, A.,
and N. L. Trottier". 2007. Mammary gland biopsy does not affect lactation
performance in sows. Can. J. Anim. Sci. 87: 281-284.

Used by permission of the Canadian Joumal of Animal Science (Appendix)

a'Primary author and project manager; performed all biopsies, responsible for
study design, animal care, data collection and analysis.

”Assisted with biopsy technique development and manuscript revision.
cLaboratory technician of the project, assisted in all biopsies, sample collection,
and animal care.

“Assisted with biopsy technique development.

°Principa| Investigator and mentor; main co-author.

50

CHAPTER TWO
MAMMARY GLAND BIOPSY DOES NOT AFFECT LACTATION
PERFORMANCE IN SOWS

Abstract

To determine morphological and molecular characteristics of porcine
mammary tissue in vivo, mammary tissue was collected from 18 sows at 3 to 6
days of lactation and 17 to 19 days of lactation using a biopsy technique. The
success of the technique was determined by monitoring lactation performance,
as evidenced by sow rectal temperature, voluntary feed intake, milk somatic cell
count, and piglet average daily gain. Up to 1.7 g of mammary tissue was

collected at each biopsy without decreasing sow feed intake or piglet growth.

Keywords: Biopsy, mammary gland, lactation, sow

Introduction

Investigating developmental changes in pig mammary tissue composition
and metabolism during lactation has historically been achieved by partial or total
mammary tissue collection following the serial slaughter of sows (e.g., Kim et al.
1999). Serial slaughter is costly and wasteful of animals, in particular because it
requires a relatively large number of sows to account for animal variation.

Furthermore,post-mortem decay of cellular components can occur in only

51

minutes (Wilusz et al. 2001), so time of tissue collection after euthanasia,
compared to tissue collection in vivo, may alter the integrity of these components.
A mammary needle biopsy approach has been used in different animal species,
including lactating goats (Cvek et al. 1998) and sows (Magnusson 1999, Thiel et
al. 2005). However, experimental requirements may arise necessitating the
collection of relatively large tissue samples. Cerveza et al. (2000) reported the
collection of relatively large (1.5 g) sow mammary gland samples in early and
late lactation, but few details of the procedure were provided. A mammary gland
biopsy procedure was adequately described by Richert et al. (1998), but only
single samples of mammary tissue were obtained. Serial biopsy samples to
monitor changes in mammary composition or metabolism may be necessary, but
subsequent biopsies may be impacted by inflammatory responses to the first
biopsy affecting sow lactation performance. In none of the earlier studies were
potential adverse effects on sow lactation performance investigated. Therefore,
our primary goal was to obtain mammary tissue from the same sow at two stages
of lactation in sufficient quantity to perform RNA and protein abundance assays,
morphometric analysis and immunohistochemistry. Our secondary goal was to
determine any effects on the welfare of the sow and litter as evidenced by piglet

growth.

52

Materials and Methods

The All-University Committee on Animal Use and Care of Michigan State
University approved all procedures performed in this study. At 110 day of
gestation, 18 multiparous sows (12 Landrace x Yorkshire and 6 Yorkshire) were
moved to individual crates within an environmentally controlled farrowing room.
Room temperature was maintained at 20°C and photoperiod controlled at 10 h of
light and 14 h of darkness. Litters were equalized to 8 piglets per sow by cross-
fostering within 36 h of birth.

Sows were fed com-soybean meal-based diets formulated to meet all
nutrient requirements according to NRC (1998) for lactating sows housed in a
therrnoneutral environment (20°C) and nursing 8 piglets with a predicted average
daily gain of 225 g d". Throughout the study, sows were fed twice daily at 0800
and 1600. Prior to farrowing, sows received a total of 2.5 kg d". After farrowing,
on days 1, 2, and 3 of lactation sows were fed a total of 2, 4, and 6 kg,
respectively. Thereafter, sows were fed to-appetite. Fresh water was freely
available throughout the experimental period.

Sow feed intake was recorded daily from 1 to 20 days of lactation. Orts
were collected before the morning meal, weighed and discarded. Sows were
weighed on 1 and 17 days of lactation and piglets were weighed individually on
days 1, 4, and 18 of lactation. Milk samples were collected manually at 3 and 17
days of lactation from the first and second thoracic mammary glands on each

side of the udder (4 glands total) and pooled within sow. Milk letdown was

53

stimulated by intramuscular injection of 10 IU oxytocin (Vet Tek, Phoenix
Scientific, St.Joseph, MO). Milk samples were preserved with 8 mg of 2-bromo-2-
nitropropane-1,3-diol (bronopol) and 0.3 mg of natamycin (Broad Spectrum
Microtabs ll, D8F Control Systems, Inc., Son Ramon, CA) and kept refrigerated
for determination of somatic cell counts (Dairy Herd Improvement Association,
East Lansing, MI, USA).

Mammary gland tissue was collected between 3 and 6 days and again
between 17 and 19 days of lactation from the first and second thoracic mammary
glands, respectively. On the day of biopsy sows were fed 2 kg of their morning
meal and then from 60 min after feeding, piglets were isolated for 45 min.
Isolated piglets were kept in a pen adjacent to the sow equipped with a heat lamp
and ample bedding. Following the 45 min isolation period, piglets were returned
to sows and allowed to nurse. Piglets suckling the glands to be biopsied were
identified on their back using a permanent marker. Immediately upon cessation
of milk letdown, sows were rapidly anesthetized by intramuscular injection 1.0 mL
per 34 kg BW of TKX [(250 mg tiletamine and 250 mg zolazapam (T elozol®; Fort
Dodge Animal Health, Fort Dodge, IA), dissolved in 2.5 mL ketamine (VetaKet®;
Lloyd Laboratories, Shenandoah, IA) and 2.5 mL xylazine-100 (AnaSed®; Lloyd
Laboratories)].

Piglets were removed to their isolation pen, and the sow remained in her
farrowing crate. While under anesthesia, sows were positioned in lateral
recumbency to expose one entire lateral side of the udder. One mammary gland

was prepared for biopsy using Povidone—iodine scrub, USP, 7.5 % (Novaplus,

Novation, Irving, TX) followed by rinsing with 70% ethanol and cleaning with
Povidone-iodine solution, USP, 10% (Novaplus, Novation) (Figure 2.1). Following
subcutaneous and intramammary injection of 1.0 mL of 2% lidocaine (Lidoject®;
Butler Animal Health supply, Dublin, OH) (Figure 2.2), a 2-cm incision was made
vertical to the plica Iateralis, aligned with the nipple and approximately 5 cm
dorsal to the perimeter of the nipple areola. Hemorrhage was minimal but, if
evident, was controlled by pressure with gauze. Two pieces of mammary tissue
(~400 to 850 mg each) were exteriorized by gently grasping a small piece of
mammary tissue with forceps and using this to elevate a much larger piece of
tissue, which was then excised with a scalpel in a circular motion (Figure 2.3).
Mammary tissue was rapidly flash-frozen in liquid nitrogen and stored at -80°C to
determine the relative transcript abundance of key genes of interest or incubated
in 10% buffered formalin for histological preparation and in situ hybridization. The
incision was closed with simple interrupted sutures using size 0 nylon (CP-1
ethilon suture, Ethicon, Inc., Piscataway, NJ) (Figure 2.4). Time from incision to
closing was approximately 5 min. Sows received an intramuscular injection of
Banamine® (1.1 mg/kg BVV) (flunixin meglumine, Schering-Plough Animal
Health, Omaha, NE) immediately after biopsy and again at 24 and 48 h later.
Following full recovery from anesthesia, sows were fed the reminder of their
morning meal and piglets were returned to the sow and allowed to suckle
normally. Rectal temperature was recorded after biopsy and again at 24 and 48 h

to monitor health status of the sow. Sutures were removed 7 days after biopsy.

55

Analysis of variance was conducted to determine differences in average
daily gain for piglets suckling the mammary glands subjected to biopsy compared
to piglets suckling the intact glands, and to determine differences in sow daily
feed intake, rectal temperature and milk somatic cell count one day prior to
biopsy (pre) compared to two days following biopsy (post). Sources of variation in
the model included effect of sow, stage of lactation, and mammary gland
treatment (biopsy vs intact). Statistical analysis was performed using the MIXED
procedure of SAS ( SAS Institute Inc., Cary, NC). Repeated measures analysis
was used for repeated measures over days of lactation based on different
covariance structures (Littell et al. 1998). The best fitting repeated measures
covariance structure was determined using the Akaike information criterion.
Separation of means was performed by least squares estimates. Least square
means were considered different at P<0.05. Pre- and post-test power

calculations were performed as previously described by Stroup (1999, 2002).

Results and Discussion

Up to 1.7 g of mammary tissue was obtained from live lactating sows at
both early and late stages of lactation without apparent effect on sow welfare as
indicated by sow feed intake, rectal temperature, and milk somatic cell count
(Table 2.1). One sow developed a local infection at the biopsy site and was
treated with a topical triple antibiotic containing neomycin, polymyxin B sulfates,

and bacitracin zinc (Fougera, Altana Inc, Melville, NY) for 5 days until infection

56

subsided. No local or systemic infections were observed for the remaining 17
sows. Average sow rectal temperature was lower (P<0.001) on the two days
following biopsy compared to that of the day of biopsy, reflecting the efficacy of
the Banamine. Sow feed intake was not different on the day following biopsy than
that on the day prior to biopsy. On average, sows gained 3.3 kg of body weight
during the 18-day lactation period. Average daily gain from days 4 to 18 of
lactation of the piglets suckling the glands subjected to biopsy versus that of
piglets suckling intact glands did not differ (244.23 :I: 12.72 g-day'1 vs 237.13 1
9.76 g-day“, respectively, P=0.54). Somatic cell counts from biopsied glands in
early lactation period (3 — 6 days) were not different during the late lactation
period (17 - 19 days) when compared to that of milk from non-biopsied glands.
Sows were weaned at 20 day of lactation and returned to the breeding herd.

Using mammary mRNA transcript abundance data for two amino acid
transporters (Chapter 4), the power to detect differences with stage of lactation
was calculated using serial slaughtering design and biopsy techniques. Power to
detect stage of lactation effects on mRNA transcript abundance using 18 animals
in a serial slaughtering design was 0.64 compared to 0.98 when using a biopsy
approach. A similar power (0.93) could be achieved with a serial slaughtering
design by doubling the number of animals, i.e., using 36 sows.

The data presented indicates that mammary tissue can be collected from
the same sow at different stages of lactation without adversely affecting lactation
performance. Voluntary feed intake, rectal temperature, or apparent sow

behavior were not compromised using the biopsy technique approach described

57

herein, suggesting that welfare of the sow was not impaired. The present biopsy
technique describes a practical method for collection of mammary tissue in
sufficient quantities for quantification of RNA and protein abundance,
morphometric analysis, and immuno-histochemistry (Perez Laspiur et al. 2004;
Chapters 3, 4, and 5). Therefore, when total collection of parenchymal tissue is
not required, this mammary biopsy technique allows for larger amount of
mammary tissue compared to that of the needle biopsy technique and offers an
alternative to serial slaughtering thus decreasing the number of animals needed

to detect differences with stage of lactation.
Acknowledgements
The authors would like to acknowledge all staff at the Michigan State
University Teaching and Research Center for their assistance with facilities and

animal handling. The authors are also grateful for Steve Moore’s assistance in

digital picture formatting.

58

Literature cited

Cerveza, P.J., Mehrbod, F., Cotton, S.J., Lomeli, N., Linder, M.C., Fonda, EC.
and Wickler, SJ. 2000. Milk ceruloplasmin and its expression by mammary
gland and liver in pigs. Arch. Biochem. Biophys. 373: 451-461.

Cvek, K., Dahlbom, K. and Ridderstale, Y. 1998. Localization of carbonic
anhydrase in the goat mammary gland during involution and Iactogenesis. J.
Dairy Sci. 65: 43-54.

Kim, S.W., Hurley, W.L., Han, |.K. and Easter, RA. 1999. Changes in tissue
composition associated with mammary gland growth during lactation in sows. J.
Anim. Sci. 77: 2510-2516.

Littell, R.C., Henry, PR. and Ammennan, CB. 1998. Statistical analysis of
repeated measures data using SAS procedures. J. Anim. Sci. 76: 1216-1231.

Magnusson, U. 1999. Longitudinal study of lymphocyte subsets and major
histocompatibility complex-class ll expressing cells in mammary glands of sows.
Am. J. Vet. Res. 60: 546-548.

National Research Council 1998. Nutrient requirements of swine (10th Rev.
Ed.). National Academy Press, Washington, DC.

Perez Laspiur, J., Burton, J.L., Weber, P.S.D., Kirkwood, RN. and Trottier, N.L.
2004. Amino acid transporters in porcine mammary gland during lactation. J.
Dairy Sci. 87: 3235-3237.

Richert, 8.T., Goodband, R.D., Tokach, M.D., Nelssen, J.L. 1998. In vitro
oxidation of branched chain amino acids by porcine mammary tissue. Nutrition
Res. 18: 833-840.

Stroup, WW. 1999. Mixed model procedures to assess power, precision, and
sample size in the design of experiments. Proc. Biopharrn. Section, American
Statistical Association, 15—24.

Stroup, WW. 2002. Power analysis based on spatial effects mixed models: A
tool for comparing design and analysis strategies in the presence of spatial
variability. J. Agric. Biol. Environ. Stat. 7: 491—511.

Theil, P.K., Labouriau, R., Sejrsen, K., Thomsen, B. and Sorensen M. T. 2005.
Expression of genes involved in regulation of cell turnover during milk stasis and
lactation rescue in sow mammary glands. J. Anim. Sci. 83:2349-2356.

WIIUSZ, C.J., Wonnington, M. and Peltz, SW. 2001. The cap-to-tail guide to
mRNA turnover. Nature Rev., Mol. Cell Biol. 2: 237-246.

59

TABLE 2.1

Sow feed intake, rectal temperature and milk somatic cell count pre and post
mammary biopsy1

Time relative to biopsy

 

 

Item P-value
Before After

Sow feed intake (kg d") ‘ 5.13 :l: 0.32 5.02 :l: 0.33 0.79

Sow rectal temperature (°C) 39.2 i 0.07 38.7 :I: 0.07 <0.001

Milk somatic cell count (1000 mL") 3677 :I: 781 4969 :t 918 0.15

 

1Data are least square means 1 standard error of the mean.

60

Figure 2.1. Mammary biopsy technique: One mammary gland (thoracic) was
prepared for biopsy with a combination of povidone-iodine scrub and 70 %
ethanol.

61

 

62

Figure 2.2. Mammary biopsy technique: Lidocaine was injected sub-cutaneously
and intramuscularly 1 min prior to incision.

63

 

Figure 2.3. Mammary biopsy technique: Mammary tissue was exteriorized with
forceps and excised with a scalpel in a circular motion.

65

 

66

Figure 2.4. Mammary biopsy technique: The incision was closed using simple
interrupted sutures. Three to four sutures were sufficient to close the incision
and ensuring space for drainage.

67

 

68

CHAPTER THREE

Perez Laspiur, J., Burton, J. L., Weber, P. S. D., Kirkwood, R. N. 8 Trottier, N. L.
(2004) Short Communication: Amino acid transporters in porcine mammary gland
during lactation. J. Dairy Sci. 87: 3235-3237.

Used by permission of the Joumal of Diary Science

69

CHAPTER THREE
AMINO ACID TRANSPORTERS IN PORCINE MAMMARY GLAND DURING
LACTATION

Abstract

The objective of this study was to determine if mRNA transcripts for the
amino acid (AA) transporter proteins CAT-1, CAT-28, 8°” and ASCT1 are
present in porcine mammary tissue (MT). Transcript abundance on d 7 and 17 of
lactation was determined by northern blot analysis and absolute quantification
performed by real-time polymerase chain reaction. Porcine MT expresses CAT-1,
CAT-28, 8°” and ASCT1 during lactation. Preliminary findings indicate that 8°”

mRNA abundance tended to decrease on d 17 compared to that of d 7.

Keywords: Amino acids transporters, Mammary gland, Lactation, Porcine

Introduction

Despite the central role of AA transporters in provision of AA necessary for
synthesis of proteins for cell structure, enzymes and signaling mechanisms
(Meyer, 2001), little is known about regulation of AA transport and (or) the factors
that affect their activity in various tissues. Expression of AA transporter

transcripts and proteins known to mediate AA transport in other tissues have not

70

been studied in porcine MT. Such knowledge is critical to enhance our
understanding of the factors controlling milk protein synthesis in lactating sows.
Kinetic studies using porcine MT explants have provided indirect evidence that
AA transport in MT is specific and carrier-mediated (Jackson et al., 2000; Hurley
et al., 2000). This led us to hypothesize that AA transporter proteins CAT-1, CAT-
2A and CAT-28 (system y”), 8°” (system 8°”), and ASCT1 (system ASC) are
present in porcine MT. The objectives were to determine the presence of RNA
transcripts for these transporters and quantify their abundance during early (d 7)

and peak (d 17) lactation.
Materials and Methods

Mammary biopsies from randomly selected lactating sows (n=3) were
performed at two stages of lactation and tissue rapidly flash-frozen in liquid
nitrogen and stored at -80°C. Liver from a pre-pubertal gilt was collected
following euthanasia and handled in same manner as MT. Liver was collected as
a negative control for CAT-1 and CAT-28, and as a positive control for CAT-2A.
Total RNA was isolated from liver and MT using TRIzoI Reagent (lnvitrogen Life
Technologies) following manufacturer’s instructions as described in Weber et al.
(2001).

Human CAT-1, CAT-2A, and CAT-28 cDNA probes were donated by Dr.
E. Closs (Johannes Gutenberg University, Germany). A 400bp CAT-28 specific

cDNA probe was developed from the region where human CAT-2A and CAT-28

71

differ (Closs et al., 1997). To confirm its identity to the human CAT-28 (GenBank
Accession number U76369), the DNA fragment was sequenced using a dye-
terrninator fluorescent cycle sequencing technique and an A8l° 3100 Genetic
Analyzer (PerkinEImer Applied Biosystems, Foster City, CA). The sequenced
fragment was then used to synthesize a 32P-labeled CAT-28 cDNA probe.
Porcine 8°” and ASCT1 cDNA probes were developed by polymerase chain
reaction (PCR) using pooled cDNA from porcine MT as a template. PCR primers
were designed from the published human 8°” (GenBank Accession number

AF 1 51978) and human ASCT1 (GenBank Accession numbers L14595 and
L19444) cDNA sequences. PCR was carried out in a RoboCycler Gradient 96
(Stratagene, La Jolla, CA) using Taq DNA polymerase as recommended by
manufacturer (Invitrogen, Life Technologies, USA). Resulting PCR amplification
products were visualized as single bands of correct size using agarose gel
electrophoresis (1 .8% gel), gel purified (\Mzard° PCR Preps DNA Purification
System, Promega, Madison, WI), ligated into the pGEM-T Easy cloning vector
(Promega, Madison, WI), and the recombinant plasmids transformed into JM109
competent cells (Promega, Madison, WI). Prior to radioactive labeling for
Northern blot hybridizations, the cloned inserts were excised from purified
plasmid DNA using EcoRl, gel purified (Wizard kit, Promega, Madison, WI), and
visualized as single bright bands on 1.8% agarose checking gels stained with
ethidium bromide. The 1058 and 373 bp cDNA probes for 8°” and ASCT1,
respectively, were DNA sequenced in both directions to confirm identities using a

dye-tenninator fluorescent cycle sequencing technique and an ABI® 3100

72

Genetic Analyzer (PerkinEImer Applied Biosystems, Foster City, CA), and the
sequence information deposited in GenBank (Accession numbers: AY375264
and AY375265) (Appendix B).

The CAT-1, CAT-2A, CAT-28, 8°”, and ASCT1 probes were validated by
Northern blot analysis using duplicate aliquots of porcine liver and MT collected
as described in Weber et al. (2001). Hybridizations were carried out for 18 to 24
h at 42°C using a 32P-Iabeled cDNA probes (NEN Life Science Products, Inc.,
Boston, MA) generated by the random prime method (Feinberg and Vogelstein,
1983.). The blot was probed first with B-actin cDNA to verify equality of RNA
loading across lanes, followed by CAT-1, CAT-2A, CAT-28, 3°“: and ASCT1
cDNA with complete stripping of the blot between hybridizations. Nylon
membranes (Amersham Biosciences, NJ) were then washed and exposed to
BioMax MS film (Fisher Scientific, Pittsburgh, PA) for 24 to 240 h at -80°C with an

intensifying screen (Fisher Scientific, Pittsburgh, PA).
Results and Discussion

Figure 3.1 shows Northern blot validations of CAT-1, CAT-2A, CAT-28,
8°” and ASCT1 cDNA probes. Human CAT-1 probe hybridized to a predominant
transcript of expected size (~5.2 kb) in MT. CAT-1 also hybridized to a
predominant transcript in liver tissue, which is in contrast to most species studied
to date, but in agreement with Liu and Hatzoglou (1998) who also demonstrated

the presence of CAT-1 in rat liver. CAT-1 transcript presence in MT has also

73

been demonstrated in sheep (Kiaei et al., unpublished; GenBank Accession
number AF212146) and humans (Vékony et al., 2001). CAT-2A hybridized to a
predominant transcript of expected size (~7.9 kb) in porcine liver but not MT,
consistent with other studies (Closs et al., 1993) demonstrating to date the
specificity of CAT-2A for hepatic tissue only. In contrast to CAT-2A, the 400 bp
CAT-28 probe hybridized to a single transcript in both liver and MT.

Porcine 8°” probe hybridized to a predominant transcript in porcine MT,
but not in liver. To date, 8°” transcript presence in MT had been reported in
humans only (Sloan and Mager, 1999). Porcine ASCT1 probe hybridized to a
predominant transcript in both porcine liver and MT. While ASCT1 expression
has been demonstrated in a variety of tissues (Arriza et al., 1993), its expression
in MT had not been reported to date. In summary, results demonstrate the
presence of CAT-1, CAT-28, 8°”, and ASCT1 transcripts in lactating porcine MT.

Transcript abundance on d 7 and d 17 of lactation of AA transporters CAT-
1, CAT-28, 8°”, and ASCT1 was determined by Northern blot analysis using the
validated probes as described above. Figure 3.2A suggests that 8°” transcript
abundance was lower on d 17 compared to d 7. No apparent change in transcript
abundance was observed for CAT-1, CAT-28, and ASCT1 (data not shown).
Absolute quantification of 8°” and B—actin mRNA abundance on d 7 and 17 was
also determined by real-time PCR. Porcine 8°” and B-actin cDNA probes
developed for northern blot analysis were used as a standard template.
Mammary tissue RNA from d 7 and 17 was converted into first-strand cDNA and

quantitative real-time RT-PCR was conducted as previously described

74

(Coussens et al., 2003; Madsen et al., 2004) with 50 ng of template cDNA and
gene specific primers designed using Primer Express (PerkinEImer Applied
Biosystems, Foster City, CA). The 8°” fonlvard primer was 5’
GGTGGTCCATITI'GGTCCATAT 3’ and reverse primer was 5’
GTGATCGTTI'CAATCGAAGCAA 3’. B-actin was used as the control gene in this
system with forward primer 5’ CTCCTI'CCTGGGCATGGA 3’ and reverse primer
5’ CGCACTTCATGATCGAGTTGA 3’. Three and five-point standard curves for
8°” and B-actin were run on each plate and determined to be linear and parallel
to each other, indicating similar reaction efficiency. All samples were run in
triplicates. Three wells per plate had all reagents added except cDNA template to
serve as negative controls. All analyses were conducted using an ABI° 7700
DNA sequence detection system (PerkinEImer Applied Biosystems, Foster City,
CA). For each test amplification reaction, mean 8°” expressions were
normalized against B-actin (within sow and sample day) to account for
differences between individual samples in RNA loading, cDNA synthesis
efficiency, and amplification efficiency. Differences between means were
detected using the MIXED procedure of SAS (1998). Figure 3.28 demonstrates
that 8°” transcript abundance tended (P = 0.08) to decrease from early to peak
lactation in porcine MT.

Considering that the protein synthetic capacity and AA uptake by porcine
MT are higher during peak lactation compared to that of early lactation (Kim et
al., 1999; Nielsen et al., 2002), an increase in transcript abundance of AA

transporter proteins was expected. However, data presented herein on transcript

75

abundance suggest that CAT-1, CAT-28 and ASCT1 do not change with day of
lactation and that 8°” decreases from early to peak lactation. With the notion
that mammary tissue is heterogeneous and composed of both stromal and
epithelial cells, the possibility that expression of AA transporters differed between
cell types cannot be refuted. We recognize that these results are limited due to
the small sample size, and that further research with larger sample size is critical
to determine the relationship between AA transporters mRNA abundance and
day of lactation. Nevertheless, as a whole, the data are novel and represent a
gateway for the study of AA utilization and transport regulation in porcine MT at a

molecular level.

76

Literature cited

Arriza, J. L., M. P. Kavanaugh, W. A. Fairman, Y. Wu, G. H. Murdoch, R. A.
North, and S. G. Amara. 1993. Cloning and expression of a human neutral amino
acid transporter with structural similarity to the glutamate transporter gene family.
J. Biol. Chem. 268:15329-15332.

Closs, E. l., L. M. Albritton, J. W. Kim, and J. M. Cunningham. 1993. Identification
of a low affinity, high capacity transporter of cationic amino acids in mouse liver.
J. Biol. Chem. 268:7538—7544.

Closs, E. I., P. Graf, A. Haberrneier, J. M. Cunningham, and U. FOrstermann. 1997.
Human cationic amino acid transporters hCAT-1, hCAT-2A, and hCAT-28: three
related carriers with distinct transport properties. Biochemistry. 36:6462-6468.

Coussens, P. M., C. J. Colvin, G. J. M. Rosa, J. Pérez Laspiur, and M. D. Elftman.
2003. Evidence of a novel gene expression program in peripheral blood
mononuclear cells from Mycobacterium avium subsp. paratuberculosis-infected
cattle. Infect. lmmun. 71:6487-6498.

Feinberg, A. P., and B. Vogelstein. 1983. A technique fOr radiolabeling DNA
restriction endonuclease fragments to high specific activity. Anal. Biochem. 132:6-
1 3.

Jackson, S. C., J. M. Bryson, H. Wang, and W. L. Hurley. 2000. Cellular uptake
of valine by lactating porcine mammary tissue. J. Anim. Sci. 78:2927-2932.

Kim, S. W., W. L. Hurley, l. K. Han, and R. A. Easter. 1999. Changes in tissue
composition associated with mammary gland growth during lactation in sows. J.
Anim. Sci. 77:2510-2516.

Liu, J., and M. Hatzoglou. 1998. Control of expression of the gene for the arginine
transporter Cat-1 in rat liver cells by glucocorticoids and insulin. Amino Acids.
15:321-337.

Madsen, S. A., L. Chang, M. Hickey, G. J. M. Rosa, P. M. Coussens, and J. L.
Burton. 2004. Microarray analysis of gene expression in blood neutrophils of
parturient cows. Physiol. Genomics. 16:212-221.

Meyer, J.S. 2001. Commentary: How is tumor growth controlled? In: Ohkame,

H., Masuda, H., Yukinoto, I. Yoshikatsu, K. 2001. Expression of L-type amino

acid transporter 1 (LAT1) and 4F2 heavy chain (4F2hc) in liver tumor lesions of
rat models. J. Surgical Oncology 78:265-272.

77

Nielsen, T. T., N. L. Trottier, H. H. Stein, C. Bellaver, and R. A. Easter. 2002. The
effect of litter size and day of lactation on amino acid uptake by the porcine
mammary gland. J. Anim. Sci. 80:2402-2411.

SAS/STAT Software 8.1, 2000. SAS Institute Inc., Cary, NC.

Hurley, W. L., H. Wang, J. M. Bryson, and D. 8. Sherman. 2000. Lysine uptake
by mammary gland tissue from lactating sows. J. Anim. Sci. 78:391-395.

Sloan, J. L., and S. Mager. 1999. Cloning and functional expression of a human
Na+ and CI' -dependent neutral and cationic amino acid transporter 8°”. J. Biol.
Chem. 274:23740-23745.

Vékony, N., W. Sabine, J. P. Boissel, K. Gnauert, and E. l. Closs. 2001. Human
cationic amino acid transporter hCAT-3 is preferentially expressed in peripheral
tissues. Biochemistry. 40:12387-12394.

Weber, P. S. D., S. A. Madsen, G. W. Smith, J. J. Ireland, J. L. Burton. 2001. Pre-

translational regulation of neutrophil L-selectin in glucocorticoids-challenged cattle.
Vet. Immunol. lmmunop. 652921-28.

78

Figure 3.1. Northern blots of human CAT-1, CAT-2A, CAT-28 and porcine 8°” and
ASCT1 in porcine mammary (lanes 1 8 2) or liver tissue (lanes 3 8 4). Blots were
exposed to X-ray film for 120h (CAT-1), 96h (CAT-2A), 122h (CAT-28), 48h (8°”), 24h
(ASCT1) or 240h (B-actin).

79

Lactating

 

 

 

 

 

 

Mammary Liver
1 2 3 4
~5.2 kb
~7.9 kb
~7.9 kb
~5.5 kb
~2o8 kb 1‘ ”3‘ Wm”; —ASCT1

80

Figure 3.2. Northern blots of 8°” at early (d 7) and peak (d 17) lactation in MT of 3
multiparous lactating sows (A). Lanes 1 and 3, sow 1; lanes 2 and 5, sow 2; lanes 3 and
6, sow 3. Blots were exposed to X-ray film for 13h (p8°” ~5.3 Kb) or 24h (pB-actin ~2.8
Kb). Porcine 8°” transcript abundance in 50ng cDNA as a function of day of lactation by
using RT-PCR analysis (8). Bars represent means i standard errors from 3 multiparous

tended to be lower than on day 7 for (P = 0.08).

81

mRNA abundance, pg

(I7 (117
35X10‘° d7 123 456

- .w an - -~ BO,+

D d17 .... B-actln

§
=2.

25x10‘

§
8.

15x106

8
a

5x10‘

 

 

 

BIOr+l

82

CHAPTER FOUR

DIETARY PROTEIN INTAKE AND STAGE OF LACTATION ALTER AMINO
ACID TRANSPORTER EXPRESSION IN PORCINE MAMMARY TISSUE

Abstract

To test the hypothesis that under conditions of restricted or surfeit amino
acid (AA) availability, the mammary gland undergoes adaptations aimed at
optimizing AA uptake, changes in AA transporter mRNA and protein abundance
were investigated at two distinct stages of lactopoesis. Eighteen multiparous
lactating sows were used in a 2X3 randomized incomplete block design
consisting of two stages of lactation and three dietary treatments. Diets were
formulated to restrict (Deficient), meet (Adequate) or exceed (Excess) the
quantity of valine, lysine, threonine, methionine, tyrosine and tryptophan required
by lactating sows. Mammary tissue was biopsied at Early and Peak lactation.
Compared to Adequate, sows fed Excess diet had lower piglet growth rate
(P<0.05). Compared to Adequate, sows fed Deficient and Excess diets had
lower milk protein and casein yield (P<0.05). Compared to sows fed the
Adequate diet, feeding the Excess diet decreased CAT-28 mRNA abundance
(P<0.05). Dietary protein intake had no effect on CAT-1, ASCT1 and 8°” mRNA
abundance. Abundance for ASCT1 and 8°” mRNA was higher at Peak
compared to that at Early stage of lactation (P<0.01). Lactation demand and
dietary protein intake did not alter CAT-1 and ASCT1 protein levels. In

conclusion, dietary protein intake modulated CAT-28 expression but not CAT-1,

83

ASCT1 or 8°”. These results suggest that changes in AA extraction rates by the
mammary gland in response to sow protein intake may be mediated by other
mechanisms, including changes in other amino acid transporters with

overlapping specificity or by changes in activity of these AA transporters.
Keywords: Amino acid transporter, mammary gland, lactation, protein intake

Milk yield and composition are crucial factors limiting neonatal growth
(Grantham-McGregor et al., 2000). During the early phase of lactation, milk
protein yield is insufficient to maximize growth of piglets (Hartmann et al., 1997).
The same is true in humans, in particular those living in poor communities and
developing countries (Cisse et al., 2002; Kaseb et al., 2002). Despite the crucial
importance of efficient milk protein secretion to sustain normal rate of growth of
the nursing neonate (Raiha et al., 1986), current understanding of mammary
protein synthetic processes is lacking, in particular those involved in the transport
of AA across the blood-mammary gland barrier.

The porcine mammary gland has the highest demand for AA compared to
that of other organs (Shennan and Peaker, 2000) and thus represents a unique
model of AA supply and demand at very high rates of AA utilization for protein
synthesis (Baracos, 2006). Dietary protein intake below that of requirement
depresses milk protein yield and subsequent neonatal pig growth (Guan et al.,
2002). Likewise, excessive intake of protein by the dam depresses piglet growth,

but does so to an even greater extent than that of dietary protein deficiency (King

84

et al., 1993; Yang et al., 2000). These changes are accompanied by what seems
to be some adaptive mechanisms whereby the mammary gland modulates the
extraction rates of circulating AA in response to dietary AA imbalances, on one
hand in an attempt to meet the need of milk protein demand, but on the other
hand to limit the unnecessary uptake of certain AA (Guan et al., 2004),
suggesting that AA transport is a regulated step of AA utilization for mammary
protein synthesis.

It is well documented that AA are transported across cells by a large
number of transport systems with distinct molecular and functional characteristics
(Palacin et al., 1998). Several AA transport systems have been characterized in
mammary glands of humans, rats, mice, and pigs, but only a few of their
molecular entities have been identified. Of the molecular entities, only the human
8°” (Sloan and Mager, 1999), CAT-3 (Vékony et al., 2001) and GLT-1 (Berger
and Hediger, 2006), and the rat LAT1, LAT2 (Shennan et al., 2002) and SNAT2
(Lopez et al., 2006) transport proteins have been cloned from mammary tissue.
Relative to porcine mammary tissue, transcripts encoding for transport proteins
CAT-1, CAT-28, ASCT1 and 8°” have been identified (Perez Laspiur et al.,
2004). Amino acid transporters act as nutrient sensors in many tissues and
respond to AA availability by initiating signaling cascades that promote cell
survival under different environments (Hyde et al., 1993). For instance, several
AA transporters, including the ASCT1 and some belonging to the CAT family
may be adaptively regulated with increased uptake activity and expression in

conditionsof limited AA availability (Hyde et al., 1993; Hatzoglou et al., 2004;

85

Howard et al., 2004). In contrast, under conditions of surfeit AA, uptake of lysine
(Hurley et al., 2000), valine (Jackson et al., 2000), alanine (Sharma and Kansal,
1999), and glycine (Rehan et al., 2000), among others (T ovar et al., 2000) is
depressed.

In vitro, AA availability alters transcription, translation and activity of AA
transporters (Hyde et al., 2003; Hatzoglou et al., 2004). The CAT-1 gene is one
of the few nutrient sensitive genes that are up-regulated under nutrient deficient
environments and down-regulated under nutrient rich environments (Fernandez
et al., 2001; Bruhat et al., 2002; Yaman et al., 2002; Hyde et al., 2003;
Fernandez et al., 2003). However, changes in mRNA abundance of AA
transporters do not necessarily equate to changes in protein levels (Hatzoglou et
al., 2004). In addition, while we have previously demonstrated the presence of
CAT-1, CAT-28, ASCT1 and 8°” transcripts in whole mammary tissue (Perez
Laspiur et al., 2004), it is possible that these transcripts may be primarily
expressed in stromal cells in addition to epithelial cells. In other tissues studied to
date, CAT-1 was shown to be expressed in epithelial cells (Koga et al., 2003;
Verri et al., 2005). Whether or not these AA transporter proteins are also
expressed in mammary epithelial cells where caseins, the most abundant
proteins in milk, are synthesized remains to be ascertained.

Determining whether or not adaptive regulation of AA transporters in
response to AA availability occurs in the mammary gland of lactating sows would
provide some initial and fundamental understanding of the mechanisms defining

the efficiency of dietary AA utilization in response to dietary AA imbalances. In

86

addition, with the notion that milk demand constitutes a driving force for milk
protein synthesis (Daly and Hartmann, 1995; Spinka et al., 1997) and that AA
influx increases with increasing milk demand (Nielsen et al. 2002, Guan et al.
2004), investigating if these changes are associated with modulating AA
transporter abundance would offer additional insight into differential regulation
amongst AA.

To test the hypothesis that under conditions of restricted or surfeit AA
availability, the mammary gland differentially expresses AA transporters aimed at
optimizing AA uptake, changes in AA transporter mRNA and protein expression

were investigated at two distinct stages of lactopoesis.

Materials and Methods

The All-University Committee on Animal Use and Care of Michigan State

University approved all procedures performed in this study (AUF#11102-161-00).

Dietary treatments and feed nutrient analysis

Diets were formulated to contain 12 % (Deficient), 18 % (Adequate), and
24% (Excess) protein, for a targeted protein intake respectively meeting 77, 116,
and 157 % of lysine required by lactating sows to support nursing pigs with a
predicted growth rate of 225 gld. (NRC, 1998) (Table 1). Both Adequate and

Deficient protein diets were mixed by diluting the Excess protein diet with

87

cornstarch in order to equalize the soybean meal to corn ratio and thus the AA
profile relative to lysine across all diets. The Deficient diet restricted the quantity
of valine, lysine, threonine, methionine, tyrosine and tryptophan required by 25,
23, 22, 15, 15, and 13%, respectively. The Excess diet exceeded the quantity of
all AA by over 157%. Solka floc was included in the Adequate and Deficient
protein diets to maintain an identical level of NDF. Corn oil was used to reduce
dustiness, improve palatability and maintain isocaloricity across diets. Feed
samples were analyzed for DM, CP, starch, and AA concentrations. Samples
were finely ground using a sample mill (Cyclotec 1093, Foss Tecator). Feed N
was analyzed using a combustion based N/protein determinator (F P-2000, LECO
Corp.). Starch content of diets was determined enzymatically after samples were
gelatinized with NaOH as described by Karkalas (1985). Amino acid
concentrations in feed samples were analyzed by reverse-phase HPLC (Alliance
2690, Waters Corp.) after hydrolysis in 6N HCL at 110°C for 24 hrs (Guay and

Trottier, 2006).

Animals and experimental design

Eighteen multiparous lactating sows (12 Landrace x Yorkshire and 6
Yorkshire) were used in a randomized incomplete block design with two
replications. Block was defined as a farrowing cycle, the first block or replicate
consisted of 7 sows and the second block or replicate consisted of 11 sows.

Sows were individually housed in farrowing crates in a thermally controlled room

88

(20°C) during the length of the study. Sows were randomly allocated to one of
three dietary treatments (Deficient, Adequate, or Excess) one week prior to the
expected farrowing date and fed 2.5 kg divided into two meals per day. Litters
were equalized to 8 piglets by cross-fostering within 36 h of birth. The day after
farrowing was considered day one of lactation and sows received two 1-kg meals
(0800 and 1600 h). On day 2 and 3 of lactation sows were fed 4 and 6 kg,
respectively, in two meals. Sows fed the Excess diet were provided ad Iibitum
access to feed thereafter, while sows fed the Adequate and Deficient diets were
pair-fed to sows fed the Excess diet. Sow feed intake was recorded daily
throughout the lactation period. Orts were collected before the morning meal and
weighed. Sow body weight was recorded on d 1 and 17 of lactation. Piglets were
weighed individually on d 1, 4, and 18 of lactation. Milk yield was estimated
based on litter average daily gain (ADG in g/d) and litter size (No. of piglets in
litter) according to Noblet and Etienne (1989) where milk yield (gld) = 2.42 x ADG
+ 78.2 x 8wi + 26 x No. of piglets in litter, where 8wi is the initial whole litter body

weight in kg.
Mammary tissue collection

Mammary tissue was collected between d 3 and 6 (Early) and d 17 and 19
(Peak) of lactation from the first and second thoracic mammary glands,

respectively following the biopsy procedure of Kirkwood and coworkers (2007).

Sows were fed 2 kg of their morning meal and piglets were removed from the

89

sows 1 hr post-feeding. Piglets remained isolated for 45 min in an adjacent pen
equipped with a heat lamp and ample bedding. Following the 45-min isolation
period, piglets were returned to sows and allowed to nurse. Immediately
following completion of the nursing bout and while sows still remained in lateral
recumbence, sows were sedated and mammary tissue collected as described in
Kirkwood and coworkers (2007). Mammary tissue was rapidly flash-frozen in
liquid N2 and stored at -80°C. For immunohistochemistry analysis, collected
tissue (~ 0.5 g) was immediately transferred in 10% buffered formalin and

incubated for 16 hr at 4°C. The tissue was then rinsed in phosphate buffered

saline and stored in 70% ethanol at 4°C until analysis.

Blood collection and analysis

Blood samples were collected at Early and Peak lactation immediately
following mammary tissue collection while sows were at rest under residual
sedation. Blood (7.0 mL) was collected via an ear vein using a butterfly needle
attached to an extension and 8D VacutainerTM glass blood tubes containing
EDTA (2.1 % EDTA/mL blood) (Becton, Dickinson and Company). Samples were
immediately centrifuged and plasma stored at -20°C until later analysis of free AA
and glucose concentrations. Determination of free AA in plasma was performed
by reverse-phase HPLC (Pico Tag, Waters) as previously described (Guay and
Trottier, 2006). Plasma glucose concentration was determined using a glucose

oxidase method (Wako Diagnostics, Wako Chemicals) and absorbance was

90

determined with a micro-plate reader (Spectramax 340, Molecular Devices

Corporation).

Milk collection and analysis

Approximately 30 mL of milk was manually collected from the first and
second thoracic mammary glands on each side of the udder (4 glands total) on
the day prior to biopsy following i.m. administration of 10 I.U. of oxytocin (Vet
Tek, Phoenix Scientific) and pooled within sow. Approximately 15 mL of milk was
kept refrigerated and analyzed for true protein, fat, lactose and solids by energy
absorption analysis (Bentley 2000, Bentley Instruments), and for somatic cell
counts by flow cytometry method (Somacount 500, Bentley Instruments). The
remaining 15-mL milk aliquot was frozen and stored at -20°C for later analysis of
free AA, total N, total casein and for casein-N determination. Milk samples were
thawed on ice and whole milk was defatted by centrifugation for 30 min (1500 x g
at 4°C) followed by removal of the fat layer by low vacuum suction. A 1-mL
defatted milk aliquot was used for determination of free AA by HPLC as
described for plasma after centrifugation at 1500 x g for 15 min at 4°C. Total N in
defatted milk was determined using a combustion based N/protein determinator
(FP-2000, LECO Corp.) and EDTA (Sigma) as a calibration standard. Milk
protein concentration was determined from total milk N using a factor of 6.38. For
casein determination, casein was precipitated out of a weighed aliquot of fluid

milk at room temperature after adjusting the pH to 4.6 using 1N HCI. Following

91

centrifugation (1500 x g for 15 min at 4°C), the precipitated casein pellets were
washed twice with distilled water, solubilized at pH 7.0, freeze-dried, and stored
at -20°C. Casein concentration was determined by dividing the freeze-dried pellet
weight by the defatted liquid milk aliquot weight. Casein-N in defatted milk was

determined as described above for milk N.

RNA isolation

Total RNA was isolated from mammary tissue using TRIzol Reagent
(lnvitrogen Life Technologies) following manufacturer’s instructions as described
in Weber and coworkers (2001). RNA isolated from mammary tissue was treated
with R01 RNase-free DNase (Promega Corp.) for 15 min at 37°C to remove any
contaminating genomic DNA. RNA was then purified further by
phenol/chloroform (1:1) extraction and ethanol precipitation. Pellets of RNA were
suspended in RNase-free water, and quantified using a spectrophotometer (DU-
650 Beckman) and the 260 and 280 nm readings, and evaluated for RNA

integrity on 1.2% agarose gels (Weber et al., 2001; Madsen et al., 2002).

cDNA synthesis

RNA samples (1 ug) were converted to cDNA using Superscript II reverse

transcriptase (lnvitrogen Life Technologies) as recommended by the

manufacturer and as previously described by Coussens and coworkers (2003)

92

and Madsen and coworkers (2004). Remaining RNA was degraded by RNase H
and the resulting cDNA extracted with phenol/chloroform (1:1). Following
precipitation with ethanol, final cDNA pellets were suspended in 20 uL of RNase-
free water for quantitative real-time polymerase chain reaction (Q-RT-PCR)
analysis of abundance of the various AA transporters. Concentration of cDNA
was measured using a nano-spectrophotometer (Nano Drop ND-1000,

NanoDrop Technologies Inc.).

Transcript abundance

Absolute quantification of transcript expression of the AA transporters
CAT-1, CAT-28, ASCT1, and 8°” was determined in mammary tissue using Q-
RT-PCR. Primers for Q-RT-PCR assessment of CAT-1, CAT-28, ASCT1, and
8°” mRNA abundance were designed using Primer Express (PE ABI Inc.) (Table
2). Standards for each AA transporter were developed using these primers and
our cloned AA transporters cDNAs as templates (Perez Laspiur et al., 2004).
Standard curves for Q-RT-PCR are shown in Figures 4.5 to 4.8. Quantitative RT-
PCR was conducted in 96-well optical plates (Perkin Elmer Corp.) using triplicate
2-uL (25ng) of starting cDNA for each reaction. To run the Q-RT-PCR assays,
cDNA templates were combined with SYBR green dye mix (Perkin Elmer Corp.)
and Q-RT-PCR conducted as recommended by the manufacturer. Triplicate five-
point standard curves for each test gene were run on every plate. Three wells per

plate had all reagents added except cDNA template to serve as negative

93

controls. All analyses were conducted using a DNA sequence detection system
(PE 7700 Perkin Elmer Corp.). Abundance data of the cDNAs for triplicate
samples were recorded automatically by the instrument software as cycles to
threshold (Ct), based on threshold lines adjusted to intersect PCR amplification
lines in the linear portion of the amplification standard curves. For each test
amplification reaction, mean CAT-1, CAT-28, ASCT1, and 8°” expressions were
normalized against starting cDNA concentration to account for differences
between individual samples in RNA loading and cDNA synthesis efficiency. 8-
actin was not used as a housekeeping gene as its abundance was shown to

change with stage of lactation (data not shown).
Protein isolation and quantification

Total protein was isolated from mammary tissue using the procedure
described by Krotova et al. (2003) with modifications. Briefly, mammary tissue
(30 - 45 mg) was pulverized in liquid N2 with a mortar and pestel and transferred
to a 15-mL glass tube containing 1 mL chilled lysis buffer (10mM Tris, pH 7.5;
100mM NaCl; 1mM EDTA; 1mM EGTA; 1% Nonidet P-40; 0.4% deoxycholate;
60mM octylglucoside) per 10 mg of tissue and homogenized at medium speed
with a tissue homogenizer (PT 10-35 Brinkmann Instruments). Samples were
then centrifuged at 20,000 x g for 30 min and the supernatant collected. Samples
were centrifuged a second time at 13,000 x g for 10 min and the supernatant

collected and pooled with the first supernatant. Protein concentration was

94

determined using a modified Lowry assay (RC DC Protein Assay, Bio-Rad

Laboratories).

Antibodies

A rabbit polyclonal anti-CAT-1 antibody and pre-immune serum was
donated by Dr. E. R. Block (Malcom Randall VA Medical Center, Gainesville,
Florida). This antibody recognizes the fourth extracellular domain of the human
CAT-1 peptide (T -Y-F-G-V-S-A-A-L-T-L-M-M-P-Y-F-C-L-D-K-D-T-P-L-P-D-A-F-K-
H-V-G-W-G) as described by Krotova et al. (2003). For detection of ASCT1, a
commercially available rabbit polyclonal anti-human ASCT1 antibody (Chemicon
International) recognizing a 12-AA peptide sequence (M-E-K-S-N-E-T-N-G-Y-L-
D) corresponding to the NH) terminus was used for western blot analysis. The
secondary antibody used for detection of both CAT-1 and ASCT1 was a
commercially available donkey anti-rabbit horseradish peroxidase-conjugated

antibody (Amersham Biosciences UK).

Westem blot analysis

Protein samples (~100 — 150 ug) were denatured and separated by one

dimensional SDS-PAGE on a 10% Tris-HCI Ready Gel (Bio-Rad Laboratories)

and transferred to nitrocellulose membranes (Bio-Rad Laboratories). Membranes

were blotted overnight at 4°C with either the anti-CAT—1 antibody at a 123,000

95

dilution or without a primary antibody. All membranes were incubated for 1 hr at
room temperature with our HRP-conjugated secondary antibody at a 1:2,500
dilution. Following stripping, membranes were blotted overnight at 4°C with
either anti-ASCT1 antibody at a 125,000 dilution or without a primary antibody.
Expressed CAT-1 and ASCT1 were detected using an ultra sensitive HRP
detection system (femtoLucentT'V' PLUS-HRP Reagent Kit, Geno Technology).
The density of the band was quantified using a scanning densitometer (Bio-Rad
GS-700 Imaging Densitometer, Bio-Rad Laboratories). Uniformity of protein
loading was confirmed by staining of the blots with Ponceau S staining (Sigma)

as described previously (Schedin et al., 2004).

Immunohistochemistry analysis

Mammary tissue from three lactating sows at Peak lactation (day 17) was
biopsied as described previously (Kirkwood et al., 2007). Immunohistochemistry
analysis was performed using a modified vector protocol (Vectastain Universal
Elite ABC Kit, Vector Laboratories). Unstained slides for antigen retrieval were
prepared by the Histology Laboratory, Division of Human Pathology, Department
of Physiology at Michigan State University. Tissues were processed on an
automated tissue processor (Thermo Electron Excelsior) and embedded in
paraffin on a Miles Tissue Tek II embedding station (Sakura Finetek USA. Inc).
Paraffin blocks were sectioned on a Reichert Jung 2030 Rotary microtome

(Leica) and placed on adhesive slides coated with 3-aminoethylalkylsilane

96

solution (Sigma Chemical). Slides were then dried overnight in a slide drying
oven not exceeding 60°C. Slides were deparaffinized in xylene 100% and tissue
hydrated through descending grades of ethanol to distilled water. Antigen
retrieval protocol was performed per manufacturer’s instructions (Citra Antigen
Retrieval, Biogenex Laboratories). Slides were then incubated with 3% H202 in
methanol with the purpose of total quenching of endogenous peroxidase activity.
Slides were then rinsed, washed in phosphate buffered saline and air-dried. To
prevent non-specific binding, slides were incubated for 35 min with diluted goat
normal blocking serum. Sections were incubated for 60 min with CAT-1
antiserum at 1:300 dilution in normal goat serum or no primary antibody in
normal goat serum as a negative control. For ASCT1 detection, sections were
incubated overnight at 4°C with ASCT1 at 1:200 dilution in normal goat serum or
no primary antibody in normal goat serum as a negative control. Slides were
washed and incubated for 30 min with biotinylated goat anti-rabbit IgG antibody
(HRP-conjugated) at 1:200 and then washed in phosphate saline buffer and ABC
reagent prepared as instructed by manufacturer. Slides were then rinsed,
washed and incubated for 30 min with ABC reagent. Slides were mounted and
stained with diaminobenzidine tetrahydrochloride (DAB) peroxidase and staining
observed under a microscope (Leica Microskopie and Systeme GmbH).
Morphological analysis was performed to identify and distinguish epithelial and

stromal cells.

Statistical analyses

97

Differences in lactation performance, plasma AA concentrations, milk
composition and yield, RNA and protein levels as affected by dietary protein
intake and stage of lactation were determined by analysis of variance. Sources
of variation in the full model included sow, diet, stage of lactation, breed, parity,
and replicate as classification variables, and the two-way and three-way
interactions of interest. Sow nested within diet was included as a random effect.
For all AA transporter genes, a reduced model was used that included stage of
lactation, diet, and the stage of lactation x diet interaction. When the effect of
replicate, diet x replicate, day x replicate, replicate x breed, and replicate x parity
were significant they were included in the model. Sow nested within diet was
included as a random effect. Statistical analysis was performed using the MIXED
procedure of SAS (1998). Repeated measures analysis was used for repeated
measures over days of lactation based on different covariance structures (Litell et
al., 1998). The best fitting repeated measures covariance structure was
determined using the Akaike information criterion (AlC). Relationships between
dietary protein intake and response variables were determined by linear and
quadratic orthogonal contrasts. Separation of means was performed by the least
squares estimates. Differences were considered significant at P<0.05.
Suggestive differences between treatments were considered at P5010. A
square root transformation was used to normalize distributions of mRNA
abundance for CAT-1, ASCT1, and 8°”. A logarithmic transformation was used
to normalize mRNA abundance of CAT-28. Data are presented as

backtransformed means on the original scale of measurement. Abundance of

98

CAT-1 and ASCT1 in porcine mammary tissue at Peak lactation was expressed
relative to abundance at Early lactation per individual sow. Effects of Deficient or
Excess dietary protein level on CAT-1 protein abundance in porcine mammary
tissue was expressed relative to Adequate dietary protein level per individual

sow.
Results
Lactation performance

Effect of protein intake and stage of lactation on sow lactation
performance, and milk composition and yield are presented in Tables 3 and 4
respectively. Pair-feeding Adequate and Deficient diet-fed sows to sows fed the
Excess diet resulted in similar DM intake across dietary treatments. Sows in the
Deficient, Adequate, and Excess diets consumed 86, 135, and 195 % of their
lysine requirement, respectively (NRC, 1998), which was marginally higher than
the targeted lysine intakes, but close to the targeted differences in protein intake
between diets. Due to the starch concentration of the diets, starch intake was
3000, 2422, and 2006 gld in sows fed Deficient, Adequate, and Excess diets,
respectively (P<0.001). Sows consuming the Deficient diet lost 2.13 kg over the
21-d lactation period, while sows in the Adequate and Excess diets gained 2.50
and 9.75 kg, respectively (Linear, P=0.09). Compared to Adequate fed sows,

piglet daily weight gain was (P<0.05) lower for sows fed Excess diet.

99

Relationship between piglet daily weight gain and sow protein intake was
curvilinear, with increasing gain from Deficient to Adequate and decreasing from
Adequate to Excess (quadratic, P<0.05). Dietary sow feed intake and protein
intake did not differ with stage of lactation, while starch intake was higher

(P<0.001) at Peak lactation compared to Early lactation.

Milk composition and yield

Effect of protein intake on milk composition and yield are presented in
Table 3 and Figures 4.1 and 4.2. Compared to Adequate fed sows, % milk CP
was lower in sows fed Deficient (P<0.05) but not different for sows fed Excess.
Percentage of milk lactose and total solids were not affected by protein intake.
Fat % increased linearly (P<0.05) with increasing protein intake, but was not
different for either Deficient or Excess fed sows when compared to Adequate fed
sows. The interaction between dietary protein intake and stage of lactation on
milk true protein and casein percentage was significant (P<0.05) and results are
presented in Figures 4.1 and 4.2, respectively. Milk protein percentage was
higher (P<0.05) for sows fed the Deficient diet compared to sows fed the
Adequate diet at Early lactation, while it was lower for sows fed the Deficient diet
compared to sows fed the Adequate diet at Peak lactation (P<0.05). Milk casein
percentage was lower for sows fed the Deficient and Excess diet compared to
sows fed the Adequate diet (P<0.05) and was lower at Peak lactation compared

to Early lactation only for sows fed the Deficient diet (P<0.05).

100

Milk yield tended to decrease in sows fed the Excess diet (P=0.07)
compared to sows fed the Adequate diet. Compared to Adequate fed sows, milk
CP yield was lower (P<0.05) for sows fed Deficient diet. Compared to Adequate
fed sows, milk casein yield was lower (P<0.05) for both sows fed either Deficient
or Excess diets. Relationship ”between true protein (P=0.08), CP (P< 0.05), and
casein yield (gld) (P<0.01) was quadratic, with increasing values with increasing
protein intake from Deficient to Adequate and decreasing values with increasing
protein intake from Adequate to Excess. Fat yield did not differ between dietary
treatments. Yield of lactose and solids did not differ with increasing dietary
protein intake (P>0.10).

The effect of stage of lactation on milk composition and yield are
presented in Table 4. Milk yield was higher (P<0.001) at Peak lactation compared
to that of Early lactation. On a percentage basis, true protein, CP, fat and casein
were lower (P<0.05) and lactose was higher (P<0.001) at Peak lactation
compared to those in Early lactation. Casein-N % did not change with stage of
lactation but the contribution of casein-N to total N was higher (P<0.01) at Peak
lactation than that of Early lactation. Total solids percentage did not differ with
stage of lactation. Yield of lactose and total solids were higher (P<0.001) while
yield of true protein tended to be higher (P<0.10) at Peak lactation compared to

Early lactation. Casein, CP, and fat yield did not differ with stage of lactation.

Plasma free AA and glucose concentration

101

Plasma glucose and AA concentrations as affected by protein intake are
presented in Table 5. With the exception of arginine and histidine where no
changes were observed, total plasma essential amino acid (EAA) concentration
increased linearly (P<0.001) with increasing protein intake, while total and the
majority of plasma nonessential amino acid (NEAA) concentrations decreased
linearly (P<0.05) with increasing protein intake. Plasma glucose concentration did
not differ with protein or starch intake. Glucose and AA concentrations as
affected by stage of lactation are presented in Table 6. Stage of lactation had no
effect on total AA concentrations or on the majority of plasma EAA and NEAA
concentrations. The interaction between dietary protein intake and stage of

lactation on plasma glucose was significant (P<0.05).
Milk free AA concentration

Milk free AA concentrations as affected by protein intake are presented in
Table 7. Total free EAA concentration in milk increased linearly (P<0.01) with
increasing protein intake. Total free NEAA and the majority of NEAA
concentration in milk did not differ between dietary treatments (P<0.10; Table 7).

Amino acid transporter mRNA abundance

The effect of dietary protein intake and stage of lactation on mRNA

abundance is presented in Figures 4.5 to 4.9. The interaction between diet and

102

stage of lactation was not significant for ASCT1 (P>0.10) and CAT-1 (P>0.10)

but tended to be significant for CAT-28 (P=0.09) and 8°” (P=0.08).

Protein intake. In Early lactation, CAT-28 mRNA abundance was lower
(P<0.01) in sows fed the Excess diet when compared to Adequate fed sows but
did not differ for sows fed the Deficient diet (Figure 4.5). Overall, in early
lactation, CAT-28 mRNA abundance decreased linearly with increasing dietary
protein intake (P<0.01). At Peak lactation, when compared to Adequate fed
sows, CAT-28 mRNA abundance did not differ for either sows fed Deficient nor
fed Excess. Overall, at Peak lactation, CAT-28 mRNA abundance tended to
decrease linearly with increasing protein intake (P=0.12). During both Early and
Late stages of lactation, when compared to sows fed Adequate, mRNA
abundance of CAT-1 (Figure 4.6), 8°” (Figure 4.7) and ASCT-1 (Figure 4.8) did
not differ for sows fed either Deficient or Excess diets. Overall, during both
stages of lactation, there was no linear or quadratic relationships between dietary

protein intake and mRNA abundance for CAT-1, 8°”, and ASCT-1.

Stage of lactation. Compared to Early lactation, CAT-1 mRNA abundance
tended to be higher at Peak lactation only for sows consuming the Excess diet
(P<0.10; Figure 4.6), and 8°” mRNA abundance was higher only for sows
consuming the Adequate diet (P<0.01; Figure 4.7). Dietary protein intake had no
effect on ASCT1 mRNA abundance (P>0.10; Figure 4.8). Abundance for ASCT1

103

was higher at Peak compared to that at Early stage of lactation (P<0.01; Figure
4.10).

Amino acid transporter protein abundance

The CAT-1 antibody used in this experiment recognized a single band of
expected size for CAT-1 protein (Figure 4.11) demonstrating that this protein is
expressed in porcine mammary tissue during lactation. The ASCT1 antibody
used in this experiment also recognized a single band of expected size for
ASCT1 (Figure 4.12) demonstrating that this protein is expressed in porcine
mammary tissue during lactation. No bands were detected when membranes
were blotted with secondary antibody alone, this observations were used as
negative controls.

Relative abundance of the CAT-1 protein in mammary tissue during Early
and Peak lactation and at different levels of dietary protein intake is presented in
Figures 4.13 and 4.14, respectively. Relative abundance of CAT-1 protein in
lactating mammary tissue did not differ with protein intake (P>0.10) or stage of
lactation (P>0.10). Relative abundance of the ASCT1 protein in mammary tissue
during Early and Peak lactation is presented in Figure 4.15. Relative abundance
of the ASCT1 protein in response to dietary protein intake could not be used due
to a significant replicate by diet interaction. Relative abundance of the ASCT1
protein in lactating mammary tissue did not respond to changes in milk demand

(P>0.10).

104

Amino acid transporter cellular localization

Immunohistochemical analysis of lactating porcine mammary tissue at
Peak lactation revealed that CAT-1 (Figure 4.15) and ASCT1 (Figure 4.16)
expression occurs mostly in epithelial cells with negligible staining in stromal cells
and none in fat globules. CAT-1 expression, however, showed abundant
localization in the perinuclear area of epithelial cells besides the expected

staining in the cell membrane.

Discussion

P rotein intake. Feeding sows both under conditions of restricted and
surfeit protein levels depressed piglet growth rate. This is in agreement with
others reporting a curvilinear relationship between protein intake and piglet
growth rate (Stahly et al., 1992, King et al., 1993; Johnston et al., 1999; Yang et
al., 2000; Guan et al., 2002). In this study, the depression in growth rate was
accompanied by a decrease in total protein and casein yield, indicating that
protein intake below or in excess of requirements depress neonatal growth in
part via change in mammary protein and/or casein synthesis. Values for true
milk protein were lower than expected while values for total protein and for
casein-N and casein-N as a percentage of total N are in agreement with others

(Guan et al., 2002), indicating that true milk protein analysis underestimated true

105

protein yield. The strong depressive effect of excess protein intake on piglet
growth rate may also have resulted from a combined decrease in both milk
protein and lactose yield. In parallel, plasma concentrations for the majority of
EAA increased linearly with increasing protein intake, indicating that extracellular
availability of AA to the mammary gland in sows fed protein in excess of
requirements was not a limiting factor to mammary protein synthesis.

Excessive protein intake decreases AA arterio-venous difference across
the porcine mammary gland in vivo regardless of the linear increase in plasma
AA availability (Guan et al., 2004), suggesting that the mammary gland is unable
to utilize excess AA. Others have also demonstrated, using porcine mammary
tissue explants, that excess availability of several EAA and NEAA depresses
uptake of limiting AA for milk synthesis, namely lysine and valine. Hurley and
coworkers (2000) reported a lysine uptake inhibition in porcine mammary tissue
explants in the presence of high concentration of arginine, methionine, leucine,
alanine, and ornithine in the medium. Similarly in vivo, Guan and coworkers
(2004) reported a decreased AV difference for lysine while AV difference for
leucine increased with excess intake of protein. Jackson and coworkers (2000)
demonstrated an inhibition of valine uptake by porcine mammary tissue explants
when methionine, leucine, alanine, and glutamine were present in the medium. In
our study, plasma concentrations of alanine and glutamine in plasma of sows fed
Excess protein were lower compared to sows fed Adequate protein suggesting
that alanine and glutamine may not interact with lysine and valine uptake.

Although the ratio of all AA to lysine were constant across all diets, the ratio of

106

leucine to lysine increased from 1.30 to 1.43 in sows consuming Excess protein
intake compared to Adequate (data not shown). Likewise, the ratio of valine to
lysine and isoleucine to lysine increased from 2.13 to 2.43 and 0.77 to 0.88,
respectively. It is unlikely that the depressed lysine and valine uptake in the
studies by Hurley and coworkers (2000) and Jackson and coworkers (2000), and
the lower AV difference of AA in the study by Guan and coworkers (2004), was
due to saturation of these transporters as the estimated Michaelis Constant (Km)
for the transport of lysine and valine is 10-fold and 2-fold higher, respectively,
than their plasma concentrations of sows consuming excess dietary protein
intake. Inhibition or a depressed AA uptake can occur via interaction among AA
and transporter proteins or by a change in the expression of amino acid
transporter proteins. Regulation of AA transporter proteins expression by AA
availability is well documented (Shennan et al., 1994; Taketani et al., 1998;
Fernandez et al., 2001; Christie et al., 2001; Closs, 2002; Kimball and Jefferson,
2006). Furthermore, the evidence for a role of AA transporters in regulating the
intracellular AA pool size by changes in transporter expression is growing (Hyde
et al., 2003). We had hypothesized that AA transporter gene expression plays a
role in modulating milk protein synthesis in the porcine mammary gland,
presumably via changes in intracellular AA availability.

Four AA transporters belonging to three major transport systems were
studied herein, two of the y" transport system, namely CAT-1 and CAT-28, one
of the ASC system, namely ASCT1, and one which constitutes in itself the 8°”

system. Expression and/or activity of these AA transporters, among others, may

107

be crucial for the uptake of AA across the mammary gland. The y+ transport
system is Na+-independent and specific for cationic AAs, namely arginine,
histidine and lysine. Lysine is the first limiting AA for milk protein synthesis and
neonatal pig growth (Kirchgessner et al., 1993; Knabe et al., 1996; Richert et al.,
1997; O’Quinn et al., 2002). Arginine is taken up by the mammary gland in
excess of that excreted in milk suggesting a requirement for mammary tissue
metabolism that extends far above that required for milk protein synthesis and
neonatal growth (Trottier et al., 1997). Under conditions of restricted protein or
lysine intake, mammary extraction of lysine and arginine increased (Perez
Laspiur et al., 2006) and mammary lysine retention increased (Guan et al.,
2002), respectively. In lactating goats fed diets limiting in histidine, mammary
extraction rate of histidine increased from 17 to 74% to avoid a dramatic
decrease in milk protein (Bequette et al., 2000). Adaptive regulation of CAT-1 by
AA availability in vitro is well documented (Fernandez et al., 2001; Bruhat et al.,
2002; Yaman et al., 2002; Hyde et al., 2003; Fernandez et al., 2003). Under
nutrient deficient environments, global protein synthesis is depressed, while the
synthesis of crucial proteins required for cell survival, including AA transporters,
is increased (Hyde et al., 2003). Amino acid starvation is sensed by an AA
response element sequence in the first exon of the CAT-1 gene (Bnlhat et al.,
2002) and this response element, when induced, stimulates the CAT-1 gene
promoter (Fernandez et al, 2003). In addition to increased transcription of the
CAT-1 gene, AA starvation increases CAT-1 mRNA stability via an additional

nutrient sensor, an AU-rich element, located at the 3’-end of the transcript

108

(Yaman et al., 2002). In vitro, adaptive regulation of CAT-1 occurs not only by
deficiency or excess of the CATs AA substrates but also via depletion or excess
of any single EAA (Fernandez et al., 2003). In addition, mRNA abundance of
CAT-1 is increased 3 to 18-fold by AA starvation in in vitro studies (Hyatt et al.,
1997; Aulak et al., 1999).

We therefore hypothesized that under dietary protein deficiency, CATs
mRNA and protein abundance would increase, and under protein excess, CATs
mRNA and protein abundance would decrease. However, feeding a protein
Deficient diet and subsequent decreased plasma AA concentration, did not
upregulate CAT-1 mRNA abundance. Similarly, in the rat small intestine in vivo,
restricted luminal availability of Ms failed to alter mRNA abundance of CAT-1 in
this tissue (Howard et al., 2004). It is possible that the previously observed
changes in CAT-1 gene expression with varying AA availability in vitro require
complete starvation of AA. Unlike starvation, protein deficiency may not be
sensed by the animal as an immediate life-threatening situation and therefore the
response of these AA transporters to decreased AA availability may be
attenuated. In addition, animals respond through changes in dietary protein
availability by mobilizing body protein and thus provide supplemental
endogenous AA. However, our dietary treatments must have created a real
deficiency of AA whereby endogenous sources of AA were not sufficient since
milk protein yield in particular and piglet growth rate were depressed in the
Deficient group. In contrast to CAT-1, CAT-28 mRNA mammary abundance

overall did respond to dietary protein intake with decreasing abundance with

109

increasing protein intake. In early phase of Iactopoesis however, a critical period
during which the lactogenic process establishes milk production capacity for the
later stages of lactation (Ostrom, 1990), CAT-28 responded per so only to the
excess in AA availability. CAT-28 has been studied in vitro in other cell types and
shown to be inducible by infection and cellular stress to increase arginine uptake
for NO synthesis (Stevens et al., 1996; lrie, et al., 1997; Kakuda et al., 1998).

Although modulation of the CAT-1 gene has been well documented in
vitro, very few studies have been conducted and/or reported similar changes in
vivo. Despite that CAT-1 is the major contributor to system y+ transport in most
cells (Closs, 2002), in this study dietary protein intake and thus AA availability did
not alter CAT-1 protein levels either. It is possible that the lysine and/or arginine
deficit resulting from intake of the Deficient diet was not sufficient to generate a
starvation response at a cellular level similar to that observed with total AA
depletion in vitro. In fact, arginine concentration, albeit considerably lower than
that of the Adequate and Excess protein diets, was not below the NRC (1998)
recommended dietary arginine concentration. CAT-1 may be more responsive to
arginine deficiency than that of lysine. While AA transport activity was not
measured in this experiment, it is possible that dietary protein and stage of
lactation modulate AA transport across the mammary gland via changes in CAT-
1 activity. Alternatively, it has been shown that posttranslational CAT-1 activity
can be altered via its interactions with cytoskeletal proteins like fodrin (Zharikov
and Block, 2000) and also by internalization of the transporter away from the

plasma membrane rendering it inactive (Hatzoglou et al., 2004). Other

110

transporters are also compartmentalized away form the plasma membrane in
order to decrease or totally devoid their function (Piroli et al., 2004; Watson and
Pessin, 2001).

Mammary tissue is a heterogeneous mixture of cells with 80% of the total
cell population consisting of epithelial cells (data not shown). Morphological
identification of mammary epithelial cells, fat lobules, connective tissue and
lobular ducts was performed by visual and comparative analysis guided by
previous publications (Pitelka and Hamamoto, 1977; Wooding, 1977; Caruolo,
1980; Keenan and Dylewski, 1985; Akers et al., 2006). As demonstrated by
immunohistochemistry, AA transporter CAT-1 and ASCT1 are localized in
epithelial cells of mammary tissue and in the perinuclear area of epithelial cells.
The CAT-1 antibody used in our study was raised against the 4th putative extra
cellular domain of the human sequence (Krotova et al., 2003). The perinuclear
staining observed in this study and others may be due to a weak recognition of
our antibody for non-solubilized non-reduced CAT-1; therefore, the perinuclear
binding observed may be non-specific binding. On the other hand, it is possible
that CAT-1 perinuclear staining indicates internalization of the CAT-1 transporter.
Hence, if the CAT-1 transcript can indeed sense AA availability directly, the lack
of response of CAT-1 to extracellular AA availability may be explained by
internalization of the transporter. Others (Woodward et al., 1994) have also
shown abundant perinuclear staining in addition to staining in plasma membrane
clusters in porcine arterial endothelial cells and human fibroblasts using

antibodies against the same CAT-1 epitope but of the murine peptide. In a review

111

on plasma membrane transporters for cationic AA, Closs and coworkers (2004)
stated that subcellular localization of CAT-1 depends on the cell type. For
instance, CAT-1 localizes to the plasma membrane of kidney and glioblastoma
cells (Kizhatil and Albritton, 2002; Wolf et al., 2002) as well as in association with
caveoli (McDonald et al., 1997), fodrin (Zharikov and Block, 2000), or actin
cytoskeleton (Zharikov et al., 2001) of porcine artery endothelial cells.

In lactating mouse mammary tissue, in vitro starvation increased uptake of
AA via system ASC by an increase in V.,“,)( suggesting an increase in transporter
protein expression (Verrna and Kansal, 1995). Thus, it was expected herein that
ASCT1 would respond to AA deficiency through increase in mRNA abundance.
System ASC, in addition to its capacity to transport linear dipolar NEAAs, such as
alanine, serine, and cysteine, has highest affinity for AA containing a distal
hydroxyl group, such as threonine (Kilberg et al., 1981). Although the ASCT1
transporter functions in a Na+-dependent manner, predominantly as a mediator of
neutral AA exchange rather than net uptake (Arriza et al., 1993), it can effectively
induce net transport of a particular AA using as driving force the concentration
gradient of another AA (Zerangue and Kavanaugh, 1996). In other words, high
intracellular concentration of alanine has the potential to drive the uptake of
threonine into the mammary gland. In this study, protein deficiency or excess did
not modulate ASCT1 mRNA abundance. In contrast, Howard and coworkers
(2004) reported an increase in ASCT1 mRNA abundance in rat small intestine by
dietary removal of luminal AA. Surprisingly, in our study, plasma concentration of

ASCT1 substrates, alanine and serine, decreased linearly with increasing dietary

112

protein intake, while threonine concentration in plasma increased. This may
suggest that ASCT1 has a role as an AA exchanger translocating threonine from
the mammary gland into plasma, while translocating alanine and serine from
plasma into the mammary gland during Excess protein intakes. It is noteworthy
to mention, however, that without kinetically defined movements of these AA, one
should be cautious in interpreting the results as such. Nonetheless, the changes
observed in plasma alanine and serine profile in parallel with changes in plasma
threonine do indicate that threonine utilization by the mammary gland decreased
in sows fed the Excess protein diet. Its adaptable role as an AA exchanger may
explain why ASCT1 mRNA failed to respond to protein deficiency or excess.

It is possible that uptake of cationic AA and BCAA in porcine mammary
gland may also be mediated by other transport systems such as system 8°”.
System 8°” transports a wide range of AA, including the normal substrates for
CATs and ASCT1 (Van Winkle et al., 1985), with highest affinity for hydrophobic
AA (Sloan and Mager, 1999). To our knowledge, this study is the first to
investigate mRNA abundance responses of 8°” to dietary protein intake in an in
vivo system. While 8°” substrates availability varied greatly with changes in
dietary protein intake, 8°” mRNA abundance remained unaffected. In some
cases in vitro, system 8°” exhibited adaptive regulation in the same manner as
reported for CAT-1 (Taylor et al., 1996; Satsu et al., 1998). On the contrary,
regulation of 8°” transport activity occurs in enterocytes under hormonal
stimulation in vitro resembling that of feeding. Ray et al. (2005) reported a 250%

increase in enterocyte glutamine uptake by system 8°” following treatment with

113

growth hormone. Several AA at ultraphysiological high concentrations can
induce growth hormone release. For instance, arginine infusion to pigs and
humans increased plasma growth hormone concentration (Rakoff et al., 1973;
Atinmo et al., 1978). In our study, it is unlikely that plasma arginine concentration
of sows consuming the Excess diet was sufficiently high to increase plasma
growth hormone concentration. In fact, there were little changes in plasma
arginine concentrations across the range of dietary protein intake. The lack in
response of ASCT1 and 8°” mRNA abundance to deficiency and excess of AA
availability indicate that changes in mRNA abundance of these AA transporters
may not limit the inward or outward movements of AA across the porcine
mammary gland.

1 Stage of lactation. Milk protein yield increased with advancement of
lactation, while dietary protein intake and plasma concentrations for the majority
of AA (and thus presumably AA availability to the mammary gland) remained
unchanged, indicating that plasma AA retrieval by the mammary gland increased
to meet milk protein demand by the growing progeny. Other studies have
demonstrated that for the cationic AA lysine and arginine, arterio-venous
differences across the mammary gland remain unchanged with advancement of
lactation while that of other AA increase (Nielsen et al., 2002). In parallel to these
observations, increasing day of lactation from 4 to 18 in this study increased
overall transporter ASCT1 mRNA and 8°” mRNA abundance but did not affect
the cationic specific AA transporters CAT-1 and CAT-28 abundance. In

mammaryglands of dairy cows, other nutrient transporters, including the glucose

114

transporter GLUT—8 (Zhao et al., 2004) are up-regulated with advancement of
lactation, possibly to facilitate increase glucose extraction by the mammary
gland.

Because the synthetic capacity of the porcine mammary gland is higher at
peak lactation compared to early lactation (Kim et al., 1999), a higher demand for
AA and energy is likely. The increase in synthetic capacity at peak lactation is
sustained by increases in cell numbers (DNA concentration) and cell volume.

Thus, one should acknowledge that the observed increase in ASCT1 and 8°”
mRNA abundance may be due to an increase in mammary cell numbers. If so,
our interpretation for the lack of CAT-1 and CAT-28 mRNA abundance response
to lactopoesis may not be correct.

Similarly to CAT-1, ASCT1 is subject to trans-stimulation by its substrates,
meaning that the rate of transport of ASC AA substrates is higher when the
extracellular concentration of those AA is increased (Christensen, 1990). Although
there is direct evidence for regulation of the ASCT1 gene by AA availability in vivo
(Howard et al., 2004) and in vitro (Sakai et al., 2003), AA availability in this study did
not alter mRNA abundance of the ASCT1 gene in porcine mammary tissue. On the
other hand, ASCT1 mRNA was higher at Peak lactation (peak milk demand)
compared to that of Early lactation. As for CAT-1, we hypothesized that ASCT1 may
be adaptively regulated at the translational level and that the increase in mRNA

abundance with milk demand would translate in higher ASCT1 protein abundance.

115

Neither AA availability nor milk demand altered the expression of ASCT1
transporter protein. Hence, the changes observed in mRNA abundance of
ASCT1 with stage of lactation did not equate to changes in ASCT1 protein levels.

In this study, milk protein and casein yield, and neonatal pig growth were
impacted by dietary protein intake with a corresponding impact on AA availability
to the mammary gland. Of the four AA transporters studied herein, only CAT-28
responded to changes in AA availability at the mRNA abundance level,
suggestive of CAT-28 involvement in promoting and restricting arginine and
lysine transport into mammary tissue for protein synthesis. CAT-28 may play a
crucial role in regulating milk protein synthesis in response to changes in protein
concentration and dietary AA imbalance of sow diets.

On the other hand, increasing lactation demand increased ASCT1 and
8°” mRNA abundance, while the CATs remained unchanged, suggestive of a
different regulatory pathway for stimulation of neutral AA transport across the
mammary gland in vivo. Changes in AA uptake in response to AA availability
and milk demand may occur via two other mechanisms: (1) changes in
abundance of other amino acid transporters and/or (2) changes in kinetic
properties (i.e., changes in Km, not in Vmax) of the CAT and ASC transporter
systems. Future studies on the regulation of amino acid availability to the
mammary gland during lactation are necessary to investigate changes in kinetic
and expression of other AA transporters such as those of systems A and L which

also transport neutral AA in several tissues (Palacin et al., 1998).

116

Acknowledging that other AA transporters may be regulated by changes in
AA availability and lactation demand, results nonetheless indicate that the AA
transporters studied herein are differentially regulated by diet and stage of
Iactopoeisis, exemplifying the complexity and the dearth of knowledge about the
regulation of these important genes in porcine mammary tissue. Furthermore, it
is unknown if mRNA transcription rate and stability were altered by AA availability
and stage of lactation. Nor if the observed changes in mRNA abundance
translated into changes in transporter protein levels for CAT-2B and 8°”. The
possibility that the expression of these AA transporters may be regulated post-
transcriptionally in mammary tissue, as shown in other tissues (Palacin et al.,

1998), cannot be ruled out.

Acknowledgements

The authors are grateful for the assistance of the Center for Animal
Functional Genomics at Michigan State University and staff regarding mRNA
quantification and optimization of Q-RT-PCR assays. We are also grateful for the
kind donation of the rabbit polyclonal anti-CAT-1 antibody and pre-immune
serum used in this study to Dr. E. R. Block from University of Florida. The
authors greatly appreciate the assistance with western blot analysis and protein
detection provided by Qinglei Li from the Laboratory of Mammalian
Reproductive Biology and Genomics, and by Ling Chu from the lmmunogenetics

Laboratory, Department of Animal Science at Michigan State University. The

117

authors would also like to thank Julie 8. Moore for her assistance throughout this
study and to acknowledge the staff at the Michigan State University Swine

Teaching and Research Facility for assistance with animals.

118

Literature cited

Akers, R. M., Capuco, A. V. 8 Keys, J. E. (2006) Mammary histology and
alveolar cell differentiation during late gestation and early lactation in
mammary tissue of beef and dairy heifers. Livest. Sci. 105244-49.

Arriza, J. L., Kavanaugh, M. P., Fairman, W. A., Wu, Y. N., Murdoch, G. H.,
North, R. A. 8 Amara, S.G. (1993) Cloning and expression of a human neutral
amino acid transporter with structural similarity to the glutamate transporter
gene family. J. Biol. Chem. 268: 15329-15332.

Atinmo, T., Baldijao, C., Houpt, K. A., Pond, W. G. 8 Barnes, R. H. (1978)
Plasma levels of growth hormone and insulin in protein malnourished vs.

normal growing pigs in response to arginine or glucose infusion. J. Anim. Sci.
46: 409-416.

Aulak, K. S., Mishra, R., Zhou, L., Hyatt, S. L., Jonge, W., Lamers, W., Snider, M.
8 Hatzoglou, M. (1999) Post-transcriptional regulation of the arginine
transporter Cat-1 by amino acid availability. J. Biol. Chem. 274: 30424-30432.

Baracos, V. E. (2006) Integration of amino acid metabolism during intense
lactation. Curr. Opin. Clin. Nutr. Metab. Care 9: 48-52.

Baumrucker, C. R. (1984) Cationic amino acid transport by bovine mammary
tissue. J. Dairy Sci. 67: 2500-2506.

Baumrucker, C. R. (1985) Amino acid transport systems in bovine mammary
tissues. J. Dairy Sci. 68: 2436-2451.

Bequette, B. J., Hanigan, M. D., Calder, A. G., Reynolds, C. K., Lobley, G. E. 8
MacRae, JC (2000) Amino acid exchange by the mammary gland of
lactating goats when histidine limits milk production. J. Dairy Sci. 83: 765-775.

Berger, U. V. 8 Hediger, M. A. (2006) Distribution of the glutamate transporters
GLT-1 (SLC1A2) and GLAST (SLC1A3) in peripheral organs. Anat Embryol
(Berl). 21 1: 595-606.

Bruhat, A., Averous, J., Carraro, V., Zhong, C., Reimold, A. M., Kilberg, M. S., 8
Fafournoux, P. (2002) Differences in the molecular mechanisms involved in
the transcriptional activation of the CHOP and asparagine synthetase genes
in response to amino acid deprivation or activation of the unfolded protein
response. J. Biol. Chem. 277: 48107—14.

Caruolo, E. V. (1980) Scanning electron microscope visualization of the
mammary gland secretory unit and of myoepithelial cells. J. Dairy Sci. 63:
1987-1998.

119

Christensen, G. (1990) Role of amino acid transport and countertransport in
nutrition and metabolism. Physiol. Rev. 70: 43-77.

Christie, G. R., Hyde, R., 8 Hundal, H. S. (2001) Regulation of amino acid
transporters by amino acid availability. Curr. Opin. Clin. Nutr. Metab. Care 4:
425-431.

Cisse, A. S., Dossou, N., Ndiaye, M., Gueye, A. L., Diop el, H. l., Diaham, 8.,
Guiro, A. T., Cisse, D., Sarr, C. S. 8 Wade, S. (2002) Stable isotope aided
evaluation of community nutrition program: effect of food supplementation
schemes on maternal and infant nutritional status. Food Nutr Bull. 23: 169-
173.

Closs, E. I. (2002) Expression, regulation and function of carrier proteins for
cationic amino acids. Curr. Opin. Nephrol. Hypertens. 11: 99-107.

Closs, E. l., Simon, A., Vekony, N. 8 Rotmann, A. (2004) Plasma membrane
transporters for arginine. J. Nutr. 134: 27528-27598.

Coussens, P. M., Colvin, C. J., Rosa, G. J. M., Perez Laspiur, J. 8 Elftman, M. D.
(2003) Evidence of a novel gene expression program in peripheral blood
mononuclear cells from Mycobacterium avium subsp. paratuberculosis-
infected cattle. lnfect. lmmun. 71:6487-6498.

Daly, SE. 8 Hartmann, P. E. (1995) Infant demand and milk supply. Part 1:
Infant demand and milk production in lactating women. J. Hum. Lact. 11221-
26.

Fernandez, J., Lopez, A. 8., Wang, C., Mishra, R., Zhou, L., Yaman, l., Snider,
M. D. 8 Hatzolgou, M. (2003) Transcriptional control of the arginine/lysine
transporter cat-1 by physiological stress. J. Biol. Chem. 278: 50000—50009.

Fernandez, J., Yaman, l., Mishra, R., Merrick, W.C., Snider, M.D., Lamers, W.H.
8 Hatzolgou, M. (2001) Internal ribosome entry site-mediated translation of a
mammalian mRNA is regulated by amino acid availability. J. Biol. Chem.
276:12285-12291.

Fernandez, J., Yaman, l., Samow, P., Snider, M. D. 8 Hatzolgou, M. (2002)
Regulation of internal ribosome entry site-mediated translation by
phosphorylation of the translation initiation factor elF2o. J. Biol. Chem. 277:
2050-2058.

Grantham-McGregor, S. M., Walker, S. P. 8 Chang, S. (2000) Nutritional

deficiencies and later behavioural development Proceedings of the Nutrition
Society 59: 47-54.

120

Guan, X., Bequette, B. J., Calder, G., Ku, P. K., Ames, K. N. 8 Trottier, N. L.
(2002) Amino acid availability affects amino acid transport and protein
metabolism in the porcine mammary gland. J. Nutr. 1322 1224-1234.

Guan, X., Pettigrew, J. E., Ku, P. K., Ames, K. N., Bequette, B. J. 8 Trottier, N. L.
(2004) Dietary protein concentration affects plasma arteriovenous difference
of amino acids across the porcine mammary gland. J. Anim. Sci. 82: 2953-
2963.

Guay, F. 8 Trottier, N. L. (2006) Muscle growth and plasma concentrations of
amino acids, lGF-l and insulin in growing pigs fed reduced-protein diets.
Journal of Animal Science. 8423010-3019.

Hartmann, P. E., Smith, N. A., Thompson, M.J ., Wakeford, C. M. 8 Arthur, P. G.
(1997) The lactation cycle in the sow: physiological and management
contradictions. Liv. Prod. Sci. 50: 75-87.

Hatzoglou, M., Fernandez, J., Yaman, I. 8 Closs, E. I. (2004) Regulation of
cationic amino acid transport: the story of CAT-1 transporter. Annu. Rev. Nutr.
24: 377-399.

Hellen, C.U. 8 Samow, P. (2001) lntemal ribosome entry sites in eukaryotic
mRNA molecules. Genes Dev. 15:1593—1612.

Howard, A., Goodlad, R. A., Walters, J. R. F., Ford, D. 8 Hirst, B. H. (2004)
Increased expression of specific intestinal amino acid and peptide transporter
mRNA in rats fed by TPN is reversed by GLP-2. J. Nutr. 1342 2957-2964.

Hurley, W. L., Wang, H., Bryson, J. M. 8 Shennan, D. B. (2000) Lysine uptake by
mammary gland tissue from lactating sows. J. Anim. Sci. 78:391-395.

Hyatt, S. L., Aulak, K. S. , Malandro, M., Kilberg, M. S. 8 Hatzoglou, M. (1997)
Adaptive regulation of the cationic AA transporter-1 (Cat-1) in Fao cells. J.
Biol. Chem. 272: 19951-19957.

Hyde, R., Taylor, P. M. 8 Hundal, H. S. (2003) Amino acid transporters: roles in
amino acid sensing and signaling in animal cells. Biochem. J. 3732 1-18.

lrie, K., Tsukahara, F., Fujii, E., Uchida, Y., Yoshioka, T., He, W., Shitashige, M.,
Murota, S. 8 Muraki, T. (1997) Cationic amino acid transporter-2 mRNA
induction by tumor necrosis factor-a in vascular endothelial cells. European J.
Phannacol. 339: 289-293.

Jackson, S. C., Bryson, J. M, Wang, H. 8 Hurley, W. L. (2000) Cellular uptake of
valineby lactating porcine mammary tissue. J. Anim. Sci. 78: 2927-2932.

121

Johnston, L. J., Ellis, M., Libal, G. W., Mayrose, V. B. 8 Weldon, W. C. (1999)
Effect of room temperature and dietary amino acid concentration on
performance of lactating sows. J. Anim. Sci. 772 1638-1644.

Kakuda, D. K., Finley, K. D., Maruyama, M. 8 MacLedo, C. L. (1998) Stress
differentially induces cationic amino acid transporter gene expression.
Biochim. Biophys. Acta 1414: 75-84.

Karkalas, J. 1985. An improved enzymatic method for the determination of
native and modified starch. J. Sci. Food Agric. 36:1019-1027.

Kaseb, F., Kimiagar, M., Ghafarpoor, M. 8 Valaii, N. (2002) Effect of traditional
food supplementation during pregnancy on maternal weight gain and
birthweight. Int. J. Vitam. Nutr. Res. 72: 389-393.

Keenan, T. W. 8 Dylewski, D. P. (1985) Aspects of intracellular transit of serum
and lipid phases of milk. J. Dairy Sci. 68:1025-1040.

Kilberg, M. S., Handlogten, M. E. 8 Christensen, H. N. (1981) Characteristics of
system ASC for transport of neutral amino acids in the isolated rat
hepatocytes. J. Biol. Chem. 256: 3304-3312.

Kim, S. W., Hurley, W. L., Han, l. K. 8 Easter, R. A. (1999) Changes in tissue
composition associated with mammary gland growth during lactation in sows.
J. Anim. Sci. 77:2510-2516.

Kimball, S. R. 8 Jefferson, L. S. (2002) Control of protein synthesis by amino
acid availability. Curr. Opin. Clin. Nutr. Metab. Care. 5: 63-67.

Kimball, S. R. 8 Jefferson, L. S. (2006) New functions for amino acids: effects on
gene transcription and translation. Am. J. Clin. Nutr. 83: 5008-507S.

Kimball, SR. (2002) Regulation of global and specific mRNA translation by
amino acids. J. Nutr. 1322 883-886.

King, R. H., Toner, M. S., Dove, H., Atwood, C. S. 8 Brown, W. G. (1993) The
response of first-litter sows to dietary protein level during lactation. J. Anim.
Sci. 71: 2457-2463.

Kirchgessner, M., Maierhofer, R., Schwarz, F. J. 8 Eidelsburger, U. (1993) Effect
of feeding protected arginine on food intake, milk yield, and growth hormone
and amino acid levels in blood plasma of cows during the summer feeding
period with grass. Arch Tierernahr. 45: 57-69.

122

Kirkwood, R. N., Perez Laspiur, J., Ames, N. K., Moore, J. 8., Cegielski, A. 8
Trottier, N. L. (2007) Mammary gland biopsy does not affect lactation
performance in sows. Can. J. Anim. Sci. 87: 281-284.

Kizhatli, K. 8 Albritton, L. M. (2002) System y+ localizes to different membrane
subdomains in the basolateral plasma membrane of epithelial cells. Am. J.
Physiol. Cell Physiol. 283: C1784-C1794.

Knabe, D. A., Brendemuhl, J. H., Chiba, L. I. 8 Dove, C. R. (1996) Supplemental
lysine for sows nursing large litters. J. Anim. Sci. 74: 1635-1640.

Koga, T., Zhang, W. Y., Gotoh, T., Oyadomari, S., Tanihara, H. 8 Mori, M. (2003)
Induction of citrulline-nitric oxide (NO) cycle enzymes and NO production in
immunostimulated rat RPE-J cells. Exp. Eye Res. 76: 15-21.

Krotova, K. Y., Zharikov, S. l. 8 Block, E. R. (2003) Classical isoforrns of PKC as
regulators of CAT-1 transporter activity in pulmonary artery endothelial cells.
Am J Physiol. Lung Cell Mol. Physiol. 284: L1037-L1044.

Kusina, J., Pettigrew, J. E., Sower, A. F., White, M. E., Crooker, B. A. 8
Hathaway, M. R. (1999) Effect of protein intake during gestation and lactation
on the lactational performance of primiparous sows. 77: 931-941.

Littell, R. C., Henry, P. R. 8 Ammerman, C. B. (1998) Statistical analysis of
repeated measures data using SAS procedures. J. Anim. Sci. 76: 1216-1231.

Lepez, A., Torres, N., Ortiz, V., Aleman, G., Hemandez-Pando, R., and Tovar, A.
R. (2006) Characterization and regulation of the gene expression of amino
acid transport system A (SNAT2) in rat mammary gland. Am J Physiol
Endocrinol Metab. 2912 E1059-1066.

Madsen, S. A., Chang, L., Hickey, M., Rosa, G. J. M., Coussens, P. M. 8 Burton,
J. L. (2004) Microarray analysis of gene expression in blood neutrophils of
parturient cows. Physiol. Genomics. 162212-221.

Madsen, S. A., Weber, P. S. D. 8 Burton, J. L. (2002) Altered Blood Neutrophil
Gene Expression in Periparturient Dairy Cows. Vet. Immunol. Immunopathol.
86:159-175.

McDonald, K. K., Zharikov, S., Block, E. R. 8 Kilberg, M. S. (1997) A caveolar
complex between the cationic amino acid transporter 1 and endothelial nitric-
oxide synthase may explain the “arginine paradox”. J. Biol. Chem. 272:
31213-31216.

National Research Council (NRC). (1998) Nutrient requirements of swine (10th
Rev. Ed.). National Academy Press, Washington, DC.

123

Nielsen, T. T., Trottier, N. L., Stein, H. H., Bellaver, C. 8 Easter, R. A. (2002) The
effect of litter size and day of lactation on amino acid uptake by the porcine
mammary gland. J. Anim. Sci. 80:2402-2411.

Noblet, J. 8 Etienne, M. (1989) Estimation of sow milk nutrient output. J. Anim.
Sci. 67: 3352-3359.

O’Quinn, P. R., Knabe, D. A. 8 Wu, G. (2002) Arginine catabolism in lactating
porcine mammary tissue. J. Anim. Sci. 80: 467-474.

Ostrom, M. K. (1990) A review of the hormone prolactin during lactation. Prog.
Food Nutr. Sci. 14: 1-43.

Palacin, M., Estévez, R., Bertran, J. 8 Zorzano, A. (1998) Molecular biology of
mammalian amino acid transporters. Physiol. Rev. 78: 969-1054.

Pérez Laspiur, J., Burton, J. L., Weber, P. S. D., Kirkwood, R. N. 8 Trottier, N. L.
(2004) Short Communication: Amino acid transporters in porcine mammary
gland during lactation. J. Dairy Sci. 87: 3235-3237.

PiniIIa-Tenas, J., Barber, A., 8 Lostao, M. P. (2003) Transport of proline and
hydroxyproline by the neutral amino-acid exchanger ASCT1. J. Membr. Biol.
195: 27-32.

Piroli, G. G., Grillo, C. A., Charron, M. J., McEwen, B. S. 8 Reagan, L. P. (2004)
Biphasic effects of stress upon GLUT8 glucose transporter expression and
trafficking in the diabetic rat hippocampus. Brain Res. 1006: 28-35.

Pitelka, D. R. 8 Hamamoto, S. T. (1977) Form and function in mammary
epithelium: the interpretation of ultrastructure. J. Dairy Sci. 60:643-654.

Proud, CG. (2002) Regulation of mammalian translation factors by nutrients.
Eur. J. Biochem. 269: 5338—5349.

Raiha, N., Minoli, I. 8 Moro, G. (1986) Milk protein intake in the term infant. I.
Metabolic responses and effects on growth. Acta Paediatr Scand 75: 881-
886.

Rakoff, J. S., Siler, T. M., Sinha, Y. N. 8 Yen, S. S. C. (1973) Prolactin and
growth hormone release in response to sequential stimulation by arginine and
synthetic TRF. J. Clin. Endocrinol. Metab. 37: 641-644.

Ray, E. C., Avissar, N. E., Salloum, R. 8 Sax, H. C. (2005) Growth hormone and

epidermal growth factor upregulate specific sodium-dependent glutamine
uptake systems in human intestinal C288e 1 cells. J. Nutr. 1352 14-18.

124

Rehan G, Kansal VK, Sharrna R. (2000) Mechanism of glycine transport in
mouse mammary tissue. J Dairy Res. 67:475-483.

Richert, B. T., Tokach, M. D., Goodband, R. D., Nelssen, J. L., Campbell, R. G. 8
Kershaw, S. (1997) The effect of dietary lysine and valine fed during lactation
on sow and litter performance. J. Anim. Sci. 75: 1853-1860.

Sakai, K., Shimizu, H., Koike, T., Furuya, S. 8 Watanabe, M. (2003) Neutral
amino acid transporter ASCT1 is preferentially expressed in L-Ser-
synthetic/storing glial cells in the mouse brain with transient expression in
developing capillaries. J. Neurosci. 23: 550-560.

SAS/STAT Software 8.1. (2000) SAS Institute Inc., Cary, NC.

Satsu, H., Watanabe, H., Aral, S. 8 Shimizu, M. (1998) System 80,(+)-mediated
regulation of lysisne transport in Caco-2 human intestinal cells. Amino Acids.
14: 379-384.

Schedin, P., Mitrenga, T., McDaniel, S. 8 Kaeck, M. (2004) Mammary ECM
composition and function are altered by reproductive state. Molecular
Carcinogenesis. 41:207-220.

Sharma, R. 8 Kansal, V. K. (1999) Characteristics of transport systems for L-
alanine in mouse mammary gland and their regulation by lactogenic
hormones: evidence for two broad spectrum systems. J. Dairy Research. 66:
385-398.

Shennan, D. B. 8 Peaker, M. (2000) Transport of milk constituents by the
mammary gland. Physiol. Rev. 802 925-951.

Shennan, D. 8., Calvert, D. T., Travers, M. T., Kudo, Y. 8Boyd, C. A. R. (2002) A
study of L-leucine, L-phenylalanine and L-alanine transport in the perfused rat
mammary gland: possible involvement of LAT1 and LAT2. Biochimica et
Biophysica Acta. 1564: 133-139.

Shennan, D. 8., McNeillie, S. A., Jamison, E. A., and Calvert, D.T. (1994). Lysine
transport in lactating rat mammary tissue: evidence for an interaction between
cationic and neutral amino acids. Acta Physiol. Scand. 151:461-466.

Shennan, D. 8., Millar, I. D. 8 Calvert, D. T. (1997) Mammary-tissue amino acid
transport systems. Proc. Nutrition Soc. 56: 177-191.

Sloan, J. L. 8 Mager, S. (1999) Cloning and functional expression of a human

Na+ and Cl- -dependent neutral and cationic amino acid transporter 80,+. J.
Biol. Chem. 274: 23740-23745.

125

Spinka, M., lllmann, G., Algers, 8. 8 Stétkova, Z. (1997) The role of nursing
frequency in milk production in domestic pigs. J. Anim. Sci. 75:1223—1228.

Stahly,T. S., Cromwell, G. L. 8 Monegue, H. J. (1992) Milk yield responses of
sows nursing large litters to dietary amino acid levels. J. Anim. Sci. 70: 238
(Abstract).

Stevens, 8. R., Kakuda, D. K., Yu, K. 8 Waters, M. (1996) Induced nitric oxide
synthesis is dependent on induced alternatively spliced CAT-2 encoding L-
arginine transport in brain astrocytes. J. Biol. Chem. 39: 24017-24022.

Taketani, Y., Segawa, H., Chikamori, M., Morita, K., Tanaka, K., Kido, S.,
Yamamoto, H., lemori, Y., Tatsumi, S., Tsugawa, N., Okano, T., Kobayashi,
T., Miyamoto, K. 8 Takeda, E. (1998). Regulation of type II renal Na+-
dependent inorganic phosphate transporters by 1,25-dihydroxyvitamin D3.
Identification of a vitamin D-responsive element in the human NAPi-3 gene. J.
Biol. Chem. 273: 14575-14581.

Taylor, P. M., Kaur, S., Mackenzie, 8. 8 Peter, G. J. (1996) Amino-acid
dependent modulation of amino acid transport in Xenopus laevis oocytes. J.
Exp. Biol. 199: 923-931.

Tovar, A. R., Avila, E., DeSantiago, S. 8 Torres, N. (2000) Characterization of
methylaminoisobutyric acid transport by system A in rat mammary gland.
Metabol. 492873-879.

Van Winkle, L. J., Christensen, H. N. 8 Campione, A. L. (1985) Na+ -dependent
' transport of basic, zwitterionic, and bicyclic amino acids by a broad-scope
system in mouse blastocysts. J. Biol. Chem. 260: 12118-12123.

Vékony, N., Sabine, W., Boissel, J.P., Gnauert, K. 8 Closs, El. (2001) Human
cationic amino acid transporter hCAT-3 is preferentially expressed in
peripheral tissues. Biochemistry. 40: 12387-12394.

Verma, N. 8 Kansal, V. K. (1995) Characterisation and starvation induced
regulation of methionine uptake sites in mouse mammary gland. Indian J.
Exp. Biol. 33: 516-520.

Verri, T., Dimitri, C., Treglia, S., Storelli, F., De Michell, S., Ulianich, L., Vito, P.,
Marsigliante, S., Storelli, C. 8 Di Jeso, 8. (2005) Multiple pathways for
cationic amino acid transport in rat thyroid epithelial cell line PC Cl3. Am. J.
Physiol. Cell Physiol. 288: C290-303.

126

Watson, R. T. 8 Pessin, J. E. (2001) Subcellular compartmentalization and
trafficking of the insulin-responsive glucose transporter, GLUT4. Exp. Cell
Res. 2712 75-83.

Weber, P. S. D., Madsen, S. A., Smith, G. W., Ireland, J. J. 8 Burton, J. L. (2001)
Pre-translational regulation of neutrophil L-selectin in glucocorticoids-
challenged cattle. Vet. Immunol. lmmunop. 652921-28.

Wolf, S., Janzen, A., Vekony, N., Martine, U., Strand, D. 8 Closs, E. I. (2002)
Expression of solute carrier 7A4 (SLC7A4) in the plasma membrane is not
sufficient to mediate an amino acid transport activity. Biochem. J. 364: 767-
775.

Wooding, F. B. P. (1977) Comparative mammary fine structure. Symp. Zool. Soc.
Lond. 4121-41.

Woodward, M. H., Dunn, W. A., Laine, R. O., Malandro, A., McMahon, R., Simell,
0., Block, E. R. 8 Kilberg, M. S. (1994) Plasma membrane clustering of
system y-I- (CAT-1) amino acid transporter as detected by
immunohistochemistry. Am. J. Physiol. 266: E817-E824.

Yaman, l., Fernandez, J., Sarkar, 8., Schneider, R. J., Snider, M. D., Nagy, L. E.
8 Hatzolgou, M. (2002) Nutritional control of mRNA stability is mediated by a
conserved AU-rich element that binds the cytoplasmic shuttling protein HuR.
J. Biol. Chem. 277241539—41546.

Yang, H., Pettigrew, J. E., Johnston, L. J., Shurson, G. C. 8 Walker, R. D. (2000)
Lactational and subsequent reproductive responses of lactating sows to
dietary lysine (protein) concentration. J. Anim. Sci. 782 348-357.

Zerangue, N. 8 Kavanaugh, M. P. (1996) ASCT-1 is a neutral amino acid
exchanger with chloride channel activity. J. Biol. Chem. 271: 27991-27994.

Zhao, F., Miller, P. J., Wall, E. H., Zheng, Y., Dong, 8., Neville, M. C. 8
McFadden, T. 8. (2004) Bovine glucose transporter GLUT8: cloning,
expression, and developmental regulation in mammary gland. Biochim
Biophys Acta 1680: 103-113.

Zharikov, S. I. 8 Block, E. R. (2000) Association of L-arginine transporters with
fodrin: implications for hypoxic inhibition of arginine uptake. Am. J., Physiol.
Lung Cell Mol. Physiol. 278: L111-L117.

Zharikov, S. l., Sigova, A. A., Chen, S., Bubb, M. R. 8 Block, E. R. (2001)

Cytoskeletal regulation of the L-arginine/NO pathway in pulmonary artery
endothelial cells. Am. J. Physiol. Lung Cell Mol. Physiol. 2802 L465-L473.

127

TABLE 4.1
Ingredient and nutrient composition of experimental diets on as fed basis (%)

 

 

 

 

Item Dietary treatments
12% CP 18% CP 24% CP
Ingredients
Corn, dent yellow 23.96 36.34 48.22
Soybean meal, solv 22.75 34.50 45.78
Corn oil 0.60 1.45 2.30
Dicalcium phosphate 2.05 1.45 0.90
Limestone 0.60 0.87 1 .10
Trace mineral‘ 0.50 0.50 0.50
Vitamin premix2 0.60 0.60 0.60
Salt, NaCl 0.30 0.30 0.30
Sowpac3 0.30 0.30 0.30
Solka floc 5.40 2.65 0.00
Cornstarch 42.94 21.04 0.77
Chemical analysis
CP, % 12.08 18.19 24.05
Starch, % 58.44 50.65 36.29
Calculated analysis 12.08 18.19 24.05
DE, kcal/kg 3409 3454 3499
ME, kcaI/kg 3305 3300 3298
Ca, % 0.75 0.75 0.75
P, % 0.61 0.60 0.60
NDF, % 10.73 10.73 10.72
Fat, % 1.37 1.34 2.57
Lysine, % 0.62 0.94 1.25
75:33?“ the following per kilogram of diet: 335 9 Ca, 5 9 Fe, 5 9 Zn, 5 mg Cu, 150 pg Se, and

2 Provided the following per kilogram of diet: 4,583 IU vitamin A, 458 IU vitamin D3, 55 IU vitamin
E, 11 mg vitamin K, 3.66 mg menadione, 0.0275 mg vitamin 812, 3.66 mg riboflavin, 14.67 mg D-
pantothenic acid, 22 mg niacin, 0.913 mg thiamine, 0.825 mg pyridoxine.

Provided the following per kg premix: 918583 IU vitamin A, 73487 mcg biotin, 128602 mg
choline, 551 mg folic acid.

128

TABLE 4.2

Primer sequences for real time PCR (5 ’93’)

 

cDN A GenBank Primers

 

Accessron # Forward Reverse Tms

 

CAT-1 NM_003045 TCATCATCACC'IT CACAGCGCCCC 60l58

CTGCATTGTG T'ITGG
CAT-28 U76369 C'ITTGATGGCCTT GGCCATGAGTG 60/59
TCTGTTTGAC TGCCAATG

8°” AF151978 GGTGGTCCATI'T GTGATCGTTTC 59I59
TGGTCCATAT AATCGAAGCAA

ASCT1 L14595 and GAAAGGCGAGCA GGCGATGTCTC 59/59
L1 9444 GGAACTTG CTCCTCAGA

 

129

 

 

 

is mod 82 38. B «8.8 38.8 2 .32 so a. .z-=_oooo
2.0 «to 58 8.2 8. 2 28.2 2-588
28 2.0 No 228.... gems. 2:.” scene
a; 8.0 to 8.2 5.2 8.2 egow
mod to 28 88 our. 88 ocean...
2.8 3.0 «so .2.» some 98.0 so“.
2.0 88 «No «one 88 ..28 asses ooao
cad So to .88 8e 2:. seed cap
as; 8280.58 é:
mod 88 2 sown seam team 53 58. Ego; can
:3 88 8+ «2.8 2.8.8 ..2.~- as: 885 Eco; sow
88 38.2 8.8 088 .88 ...88 :23 9.35 55m
3o 58.? N2. .22 a, 5 088 59 9.35 seed
Ed and 83 2?. ~28 89m 59: 9.25 boos sow
o m o emcozmzmmno .02
o u Aooooxmv $8 @8838 $2 cascade $2
asmm so:
emozmzmuw cozmbcoocoo 5888 oqu

 

.coEmoquo new Rm: «:8 .oocmztotoq 28.22863 so» co 385 £883 so 89cm

«6 m...m<._.

130

Emu 22> new 80.83888 85.: .2 Eva E 93304. E0: 5:6 2 0:2 mamms. 2
.modvm am .320 298283 222% £5, 250.2 3...

88.8 x z .8 m
.EmEfim: .8 2252320 .o .3832 8

.9858 35005.5 A00 002026 0cm :0 Ema: .o magi n

.CNOE we: 50 50:0 UBNUcmum N

...imu 3 8 00:8 82.38. m .2 2508 35:3 6mm. 2m 5523 EmaF

 

_.0.0V
3.0
0N0
80.0
00.0
00.0
0.20

00.0

00.0
0N0
80.0
00.0
00.0
00.0

0v
00

mm
00
00
mm
00.0

now?
kmNNP

228
3.2
gum:
#888
88.2

2030363200 m.‘ W4m<h

8000
05—.

NE
882
928
888
8.2

n~8v
88:

000
0N0
a BB
#00
{NF

206330

2882.8

20.3203

28 .6“.

@3868... $20

023 .5205 25.
59: 22> 8:2

131

TABLE 4.4

Efi'ect of stage of lactation on sow lactation performance and milk composition‘

 

 

 

 

Stage of lactation Statistics3
Item srsM2
Early Peak P-value
No. Observations‘ 18 18
Sow feed intake (kn/d) 5.381 5.576 0.379 0.43
Protein intake (old) 945 992 58 0.50
Starch intake (old) 1756 2899 157 <0.001
Milk composition (%)
True protein 5.17 4.28 0.14 <0.001
Crude protein5 7.03 5.46 0.14 <0.001
Fat 8.90 6.72 0.49 0.03
Lactose 4.59 5.51 0.13 <0.001
Solids 10.44 10.63 0.14 0.41
Casein 4.61 3.83 0.18 <0.001
Casein N 12.06 12.49 0.23 0.18
Casein N / Total N 51.51 54.19 0.84 0.003
Milk vield (kn/d) 11.4 15.1 0.43 <0.001
True protein (old) 578 638 24 0.06
Crude protein (old) 802 830 36 0.38
Fat (Cl/d) 1030 1041 80 0.93
Lactose (old) 532 834 36 <0.001
Solids (.a/d) 1176 1615 57 <0.001
Casein (gld) 535 576 36 0.38

 

‘ Data are least squares means for a lactation period of 18 days.
2 Standard error of the mean.

3 P-value of ANOVA.

‘ Number of observations per treatment.

5 % N x 6.38.

132

 

 

 

888 588v 88.28 8888 2.8.8 8882 _8>
28 S8v 888 88.88 2.8 :88 e:
:8 58v 8.: 8882 888.2 88.8: 8:
8N8 2888v 888 88.: 2.2. :88 9:.
R8 88 88.8 8888 28.: 88.2 8.2
888 58 88.2 8882 282 SR 83
~88 38.8v 88.2 «~88 2.82 28.88 83
888 2888v 888 8882 288 .888 8..
888 888 2.2 88.82 :88 8888 8E
888 :8 88.2 88.82 28: 88.88 82
P88 .888v 88.88 8888: 88.882 2.888 .888
.mzcmmmm

8.85: .22 85:2

88 28 28 88.88 8888 F888 8285 .8820

8 8 8 v8.582.880 .82

o 8 $88wa 8% 3.888828 82 8828889 82
N.288 .88..

88888888

cozmbcoocoo £903 .8qu

 

Ecumacmocoo 0.6.8 225 058 8850 8:883 to 92885 £293 80 “cotm
mi m...m<._.

133

8:88:89. .3 8800828880 80 83:52 .

8889888 .mcomocto 60 00858.6 8:8 30 .82.: 8c 8283”. 8

.cmmE 85 80 .95 2805880 8

.8880 08 80 00:3 80:88. a 88 8:80;. 98:08 8880. 28 E8628 9.80 8

 

88.8 28.8 88.2 8.882 88.82 88.28 .88
88.8 88.8 88.8 88.88 88.28 88.88 888
88.8 28.8v 88.8 88.88 88.8... 88.88 .88
28.8 88.8 88.3 88.888 88.888 88.888 an.
88.8 28.8v 88.8 88.88 88.88 88.; so
88.8 2.8 2.2 2.82 88.88 88.88 8.0
88.8 8.? 28.88 88. 22 2.82 82.888 :6
88.8 88.8 88.82 8582 88.882 88.882 so
88 88.8 83 88.8 88.8 88.8 88o
28.8 2.8 88.8 88.88 .8888 88.88 80
88.8 88.8 28.2 2.2 88.8 88.8 88<
28.8 88.8 88.8 88.2 88.28 88.8.8 58.
88.8 .888v 88.3 88.888 88.888 88.888 8_<
28.8 8.8 82 8888 2888 888 .888
50:33:02

8.032.530". rev mamas...

134

TABLE 4.6

Efl'ect of stage of lactation on plasma glucose and amino acid concentration‘

 

 

 

 

Sta e of lactation Statistics3
Item Earl: Peak SEM2 P-value
No. Observations“ * 18 18
Glucose, mg/dL 79.86 66.40 3.69 <0.01
Amino Acid, pmol/L
Essential
Total 1028.45 1 1 15.58 63.41 0.24
Arg 101.86 116.50 10.47 0.18
His 78.16 115.36 7.93 <0.001
lle 84.68 97.24 6.04 0.03
Leu 142.22 151.47 10.10 0.32
Lys 117.11 100.41 11.20 0.14
Met 25.81 14.89 2.08 <0.01
Phe 52.06 58.91 4.16 0.16
Thr 146.58 147.81 11.94 0.95
Trp 50.46 54.40 3.59 0.29
Val 229.76 258.84 15.28 0.10
Nonessential
Total 2924.40 2778.29 142.76 0.42
Ala 447.98 429.37 28.82 0.18
Asn 22.09 20.21 1.61 0.25
Asp 10.10 8.32 0.70 0.03
Cit 56.98 74.85 4.98 0.02
Cys 11.02 6.95 1.14 0.05
Gln . 1406.22 1249.48 76.22 0.14
Glu 227.83 190.83 16.66 0.02

TABLE 4.6 continuation

Gly 100.02 96.12
Orn 56.83 60.67
Pro 397.94 395.01
Ser 49.82 39.13
Tau 70.07 55.85
Tyr 103.62 114.80

7.12
4.91
30.91
2.13
3.44
9.81

0.63
0.34
0.95
<0.01
<0.01
0.36

 

1 Data are least squares means for a lactation period of 18 days.
2 Standard error of the mean.

3 P-value of ANOVA.

‘ Number of observations per treatment.

136

 

 

 

3.8 88.8 88.8 88.88 88.88 88.88 _8>
88.8 88.8 88.8 88.88 88.88 88.88 E...
88.8 88.8 8.288 88.88 88.88 88.88 Eh
88.8 888.8 88.88 88888.. 88.88:. 88.88: :8...
88.8 88.8 88.8 88.88 88.88 88.88 8:8.
88.8 88.8 88.8 88.8.. 88.88 88.88 88.2
88.8 88.8 88.8.. 88.88 88.88 88.88 88..
88.8 _.8.8 88.8.. 88.88 88.88 88.88 88..
88.8 88.8 88.8 88.8 88.8 88.8 m:
88.8 88.8 88.88 88.888 88.888 88.88.. 8_I
8.28 88.8 88.88 88.88.. 88.888 88.888 88.8.
88.8 38 88.888 88.8888 88.8888 88.8888 .880...
885888
88.8 88.8 88.888 88.8888 8 8.8888 88.8888 .880...
.508: .298. oc_E<
8 8 8 8828828880 .02
O ._ 88880me Ax888 8888:8838 8888 9:98.8va .888
8.288 Em:
88888888 cozmbcmocoo 5928 888:0

 

820888828828 8.888 oSEm 8888 «888: :o 88:882.. 58888 80 8.8th
8.8 m4m<h

137

888.5888 .88 8808885888 80 8888.52 8

8888888 8808055 Ag 888.8888 8:8 38 .885. 88 8:_8>d8
.8888 85 88 .888 88888888 8

.8888 88 88 82888 8588888. 8 .8 88888. 8888888 8888. 8.8 8880 F

 

 

88.8 88.8 88.88 88.188 88.888 88.888 .88
88.8 88.8 88.88 88.888 88.88 88.888 .88
88.8 88.8 88.88 88.888 88.888 88.88 28
88.8 88.8 8: 88.88 88.88 88. 88 so
88.8 88.8 88.88 88.888 88.888 88.888 8.8
88.8 88.8 88.88 88.888 88.888 88.888 8.0
88.8 88.8 88.88 88.888 88.888 88.888 so
88.8 88.8 88.88 88.888 88.888 88.888 880
88.8 88.8 88.88 88.888 88.888 88.888 88,8
88.8 88.8 88.88 88.888 88.888 88.888 88.8
88.8 88.8 88.88 88. 888 88.888 88. 888 8_<
88.8 88.8 88.888 88.8888 88.8888 88.8888 .888
.mzcmmwmcoz

:Ofluacucoo 8.8 m4m<h

138

Figure 4.1. Effect of dietary protein intake and stage of lactation on milk true
protein percentage. Bars with different letters differ at P<0.05 across stages of
lactation.

139

Milk protein % - Deficient
= Adequate
- Excess

b b
a ‘11

5 c
1 be bc

percentage
N w 8 U!
I l l l

—I
I

 

 

 

 

 

 

O
l

 

Early Pe'ak
Stage of lactation

140

Figure 4.2. Effect of dietary protein intake and stage of lactation on milk casein
percentage. Bars with different letters differ at P<0.05 across stages of lactation.

141

 

percentage
N w A 01 m 81
I I I I I I

A
I

 

O
I

Milk casein % - Deficient

a

{1

 

 

= Adequate
- Excess

b bC bC

 

 

I
Eafly

Peak
Stage of lactation

142

Figure 4.3. Effect of dietary protein intake and stage of lactation on plasma
glucose concentration. Bars with different letters differ at P<0.05 across stages of
lactation.

143

glucose concentration (mgldL)

1 001
75-
50-

25-

 

bc

 

 

 

Plasma glucose - Deficient
= Adequate
C bC - Excess
ac
{T ab
a
Ea'rly Peak

Stage of lactation

144

Figure 4.4. Effect of protein intake on piglet average daily gain (gld) and milk
casein and true protein yield (gld). The relationship was curvilinear between
protein intake, piglet average daily gain (quadratic, P<0.05) and yields of milk
casein (quadratic, P<0.01) and true protein (quadratic, P=0.08).

145

Casein and True protein in milk (gld)

1111

211

v/V\\v

     

 

Deficient Adequate Excess
Dietary treatments

-.- True protein in milk (gld)
[I Casein in milk (gld)

-V- Piglet daily gain (gld)

146

§

#200

j.
8

 

(1)/6) Uiefi 41129161618

Figure 4.5. Effect of dietary protein intake and stage of lactation on CAT-2B
mRNA transcript abundance. Relationship between protein intake and mRNA
abundance in Early lactation was linear (P<0.01). Relationship between protein
intake and mRNA abundance at Peak lactation tended to be linear (P=0.12).
Bars with different letters a vs b differ at P<0.01 across stages of lactation.

147

mRNA abundance, pg

CAT-23

18x10‘6 8

 

 

 

 

 

 

 

 

 

- Deficient
16x10‘5 . a E Adequate
a - Excess
14x10“ - a
a

12x10" - a
10x10‘6 -

8x10‘ - b

6x10'° -

4x10“ -

2x10'6 -

0 ' 1'
Early Peak
Stage of lactation

$8 45

9. 4o

'0

E 35

m 30

2 25

5 20

9- 15

3 10 y = -2.0044Ln(x) + 9.6075

g 5 R2 = 0.981

0 8 i l l 4.
0.000001 0.00001 0.0001 0.001 0.01
mRNA abundance (pg)

148

Figure 4.6. Effect of dietary protein intake and stage of lactation on CAT-1 mRNA
transcript abundance. There was no relationship (linear or quadratic) between
protein intake and mRNA abundance. Bars with different letters tended to differ
at P<0.10 across stages of lactation.

149

 

100x1043 -

80x10'e -

mRNA abundance, pg

60x10'6 -

CAT-1

- Deficient
= Adequate

ab ab - Excess

ab
ab b

 

 

 

 

 

 

 

 

Early Peak

Stage of lactation

y = -1.5521Ln(x) + 20.079
R2 = 0.9895

R l l 4|
I I I I

 

0.00001 0.0001 0.001 0.01 0.1

mRNA abundance (pg)

150

Figure 4.7. Effect of dietary protein intake and stage of lactation on Bo'+ mRNA
abundance. There was no relationship (linear or quadratic) between protein
intake and mRNA abundance. Bars with different letters differ at P<0.01 across
stages of lactation. Diet x day interaction tended to differ at P=0.09. Overall
(across diets), Bo'+ mRNA abundance was higher at Peak compared to Early
stage (**P < 0.01).

151

2.5X104-

 

 

 

 

 

 

g -4

05‘ 2.0x10 -

o

E 4
.5 1.5X10 ..

c
3 4

a 1.0X10 -

‘z‘

a: 5.OX10'5-

E

0-
Early Peak
Stage of lactation

A40

Q35 ‘

8

3 30

fi 25

8

Fl: 20

2 15

3 10 y = -1.5608Ln(x) + 16.319

1;, 5 R2=0.9964

0

0 i l l 1
0.00001 0.0001 0.001 0.01 0.1
mRNA abundance (pg)

152

Figure 4.8. Effect of dietary protein intake on ASCT1 mRNA transcript
abundance. There was no relationship (linear or quadratic) between dietary
protein intake and ASCT1 mRNA abundance.

153

 

ASCT1

 

 

 

 

 

 

 

 

 

 

4x10'3 -
2 3x10"3 - I
8'
8
g 2x10“-
.8
N
<
z
m
5 1x103 -

0 - .
Deficient Adequate Excess
Dietary protein summation, %
A45 E
g 40
2 35 ‘
g 30 K
2 25 -
5 20 .
2 :3 : y = -1.222Ln(x) + 22.758
8 5 _ R2 = 0.9892
0
0 i i 1
0.0001 0.001 0.01 0.1

mRNA abundance (pg)

154

Figure 4.9. Effect of stage of lactation on ASCT1 mRNA transcript abundance.
ASCT1 mRNA abundance was higher at Peak lactation compared to Early

lactation (***P<0.001).

155

11111

44444
o o o o o o
1 1 1 1 1

.3
*
*

1

T

C

S

A

 

 

 

XXXXX
55555

Figure 4.10. Representative western blot demonstrating the presence of CAT-1
amino acid transporter in porcine mammary tissue during lactation at three levels of
dietary protein intake. Uniformity of loading was confirmed by Ponceus S staining
and scanning of the membranes. Representative band is shown.

157

12% 18% 24%

4 1_8 4 18 4 1_8 Day of lactation

~65 KDa. -—' -~ - 8 ._... CAT-1

 

~75 KDa .h*;- *5" 7i» m .8. Loading control

158

Figure 4.11. Representative western blot demonstrating the presence of ASCT1
amino acid transporter in porcine mammary tissue during lactation at three levels of
dietary protein intake. Uniformity of loading was confirmed by Ponceus S staining
and scanning of the membranes. Representative band is shown.

159

 

12% 18% 24%

4 18 4 18 4 18 Day of lactation
~55 KDa fi~i‘--‘-'---- ~— .-, ASCT-1
~75 KDa 1' ' Loading control

 

 

160

Figure 4.12. Relative abundance of CAT-1 protein in porcine mammary tissue at
Early and Peak stage of lactation. CAT-1 protein levels did not different with stage of
lactation in porcine mammary tissue (P>0.10).

161

relative abundance

1 .25-

1 .00d

0.758

0.50-

0.25-

CAT-1 protein

 

0.00d

 

Early Peak

Stage of lactation

162

Figure 4.13. Relative abundance of CAT-1 protein in porcine mammary tissue from
sows fed a Deficient (12%), Adequate (18%), or Excess (24%) protein diets. CAT-1
protein levels were not altered with dietary protein intake in porcine mammary tissue
during lactation (P>0.10).

163

 

relative abundance

CAT -1 protein

 

 

Deficient Adequate Excess
Dietary treatments

164

Figure 4.14. Relative abundance of ASCT1 protein in porcine mammary tissue at
Early and Peak stage of lactation. ASCT1 protein levels did not different with stage
of lactation in porcine mammary tissue (P>0.10).

165

 

 

 

 

relative abundance

ASCT1 protein

 

 

Early Peak

Stage of lactation

166

Figure 4.15. Immunohistochemistry staining of porcine mammary tissue at Peak
lactation with CAT-1 antiserum (a) or negative control (b). CAT-1 localizes to
membrane and perinuclear areas in epithelial cells (1) but not stromal (2) cells.

167

 

 

168

Figure 4.16. Immunohistochemistry staining of porcine mammary tissue at Peak
lactation with ASCT1 (a) or negative control (b). ASCT1 localizes to membrane and
perinuclear areas in epithelial cells (1) but not stromal (2) cells.

169

 

 

 

 

 

 

170

 

SUMMARY AND CONCLUSIONS

During lactation, intake of protein in adequate quantity and a balanced
amino acid profile by the mother is crucial to provide amino acids essential for
the synthesis of milk proteins. Conversely, excessive intake of dietary protein
may be detrimental to milk protein production as revealed by depressed neonatal
growth. Dietary amino acids are transported via the circulatory system to organs
and enter tissues via specific transporters. The transport processes are
seemingly regulated by mechanisms that are still largely undefined. In the
present study, a porcine model was used to begin addressing whether protein
nutrition and milk demand modulate amino acid transport in mammary tissue. To
test the hypothesis that under conditions of protein nutritional stress the
mammary gland adaptively regulates amino acid transport, gene expression of
amino acid transporters (i.e., CAT-1, CAT-2A, CAT-28, ASCT1, and 8°”) were
determined at two stages of lactopoiesis. The specific objectives of this
dissertation were to 1) develop a non-invasive mammary biopsy technique
allowing repeated collection of large quantities of mammary tissue from nursing
sows; 2) determine the presence of amino acid transporter transcripts and
proteins, respectively, in mammary tissue of nursing sows; 3) investigate the
effect of nutritional protein stress (i.e. deficiency and excess) in nursing sows on
their milk protein and casein yields, and their piglet growth rate; and 4) determine

the level of amino acid transporter transcript and protein expression in mammary

171

tissue of nursing sows in response to dietary protein deficiency and excess at
two levels of milk demand.

Transcripts for CAT-1, CAT-28, ASCT1, and BO'+ were detected while that
of CAT-2A was not detected in lactating porcine mammary gland under the
experimental conditions presented in this thesis and within the limits of the
technique used (i.e., Northern blots). The presence of CAT-1, CAT-28, ASCT1,
and B°'+ mRNA was furthered oonfinned using Q-RT-PCR. Proteins at least for
CAT-1 and ASCT1 were detected in mammary tissue of nursing sows.

Dietary protein deficiency and protein excess decreased milk protein and
casein yields, and nursing pig growth rate while neither dietary protein deficiency
nor excess affected CAT-1, ASCT1 or B°'+ mRNA abundance. In contrast,
increasing dietary protein intake from deficient to excess conditions decreased
mRNA abundance of CAT-28, and more so for sows fed excessive levels of
protein under lower milk demand status or early stage of lactation. Similar,
protein excess diet was more detrimental than protein deficiency on piglet growtg
rate. Changes in CAT-28 mRNA abundance in response to protein deficiency
and excess indicate that mammary cells adaptively down-regulated CAT-23, in
response to conditions of protein excess. Conversely, there was no evidence for
adaptive regulation both at the mRNA abundance for Bo" and at mRNA and
protein abundance for CAT-1 and ASCT1.

Increasing milk demand had no effect on amino acid transporters CAT-1
and CAT-28 mRNA abundance, but increased ASCT1 and Bo'+ mRNA

abundance. An increase in ASCT1 and BO'+ transcript abundance with increase

172

milk demand may be a result of the well recognized increase in cell number
(DNA concentration) in porcine mammary tissue with advancement of lactation.
In this case, the lack of response observed for CAT-1 and CAT-28 mRNA
abundance, and ASCT1 and CAT-1 protein abundance, to an increase in milk
demand may be translated into masked decreases in abundance of these
transporters or changes in the relative number of epithelial cells versus stromal
cells. It is unknown if the increase in mammary cell numbers with advancement
of lactation is a result of proportional increases in both epithelial and stromal cells
equally. It remains to be investigated if protein levels of CAT-23 and B“ are
altered with increasing milk demand.

Transporter CAT-23 may be of physiological importance in terms of
modulating the entry of the nutritionally first limiting amino acid for lactation, and
may be responsible in part for the improved efficiency of lysine utilization in the
face of reduced extracellular lysine availability. More prominently so, CAT-28
may play a larger role behind the reduced efficiency of lysine utilization upon
excess extracellular exposure to lysine, or to other amino acids in particular
arginine and the large neutral amino acids. For instance in this study, sows fed
excessive quantities of protein were not only exposed to high concentrations of
arginine, but to even higher levels of large neutral amino acids, in particular
leucine and valine. These amino acids either specifically share transport with
lysine (arginine) or utilize with lower affinity the y“ system, and have been well

shown in various in vitro systems to reduce lysine uptake.

173

At least in regards to the amino acid transporters studied in this thesis, the
response to either protein nutritional stress or milk demand was not uniform
across the selected transporters. These results indicate that amino acid
transporters may be differentially regulated in response to protein nutritional
stress. Differentially regulating expression of amino acid transporters in response
to amino acid availability would serve as a biological advantage to mammary
cells in order to adapt and survive in extreme scenarios and utilize available
amino acids and nutrients with precise efficiency. Various amino acid transport
systems with different specificities and affinities for amino acids have been
identified and these can be expressed and active in cells at different stages of
development as well as at different states of the cell. A mosaic of amino acid
transporters can then be expressed at a certain time in a cell and it is the
combination of these transport systems that capacitate cells to utilize
extracellular amino acids effectively for their survival and growth. For example, a
hallmark of mammary tumor cells is an overexpression of the System A
transporter. This transporter is overexpressed in tumor cells to a degree that
these cells have a biological advantage over normal cells in terms of amino acid
uptake and therefore thrive and survive at better rates than non-tumor cells.
Thus, differential expression of this amino acid transporter make tumor cells
more fit to survive than non-tumor cells. In a way, the ability of expressing the
right assortment of amino acid transporters at the right time, thus, being able to
sense amino acid availability and responding accordingly, would make mammary

cells more efficient in synthesizing milk proteins with the available nutrients and,

174

ultimately, in providing their offspring with the best milk protein quantity and
quality possible ensuring survival of their young, hence, the species.

The mere fact that the transporters CAT-1, ASCT1 and B°'+ studied
herein did not respond with changes in mRNA abundance in some cases or in
protein abundance, at least in two of the transporters with available antibodies,
does not necessarily minimize or eliminate their theorized role in modulating
amino acid transport; it remains to be determined whether these transporters
modulate amino acid uptake through changes in affinity. Overall, the results of
this study highlight the hidden complexity between amino acid interaction and
lactation performance outcome, yet also shed some lights on one potential
mechanism responsible for defining the efficiency of dietary protein utilization for
milk protein synthesis.

While this thesis was limited to the study of four transporter genes, it is
recognized that many other genes important to milk protein synthesis and
mammary epithelial and stromal cell functions may be influenced by the
treatments imposed on the sows in these studies. Increased knowledge of the
molecular basis regulating amino acid availability for milk protein synthesis will
improve our understanding of porcine protein nutrition during lactation,
specifically regarding lactation performance responses to amino acid interaction
in diets of lactating sows. This knowledge ultimately contributes to expanding and
enhancing our models of amino acid utilization for increasing milk production

efficiently in lactating sows.

175

APPENDICES

176

 

APPENDIX A

AMINO ACID EXTRACTION BY PORCINE MAMMARY GLAND: A PILOT

STUDY TO TEST FEED INTAKE RESPONSE TO DIETARY PROTEIN INTAKE
Abstract
Six multiparous sows were used to test the hypothesis that amino acid

(AA) extraction rate by the porcine mammary gland decreases with increasing
availability of dietary AA. Sows were fed graded concentrations of protein
consisting of 12, 18, and 24% protein to provide Deficient, Adequate, and Excess
protein and AA, respectively. Sows were fitted with mammary vein and carotid
artery catheters between (I 3 and 5 of lactation. Arterial and venous blood
samples were collected on d 10, 14, and 18 of lactation. For each blood
sampling day, blood samples were collected every 30 min for a total of 3 h, and
samples pooled per sow. Piglet average daily gain (ADG) tended to decrease
linearly (P=0.12) with increasing dietary crude protein concentration. Mammary
extraction rates of arginine and lysine decreased linearly (P=0.06) with increasing
dietary crude protein concentration. Leucine, threonine, and phenylalanine
extraction rates tended to increase with increasing protein intake from 12 to 18%
and to decrease with increasing protein intake from 18 to 24% (quadratic,
P<0.10). Mammary gland AA extraction rates decreased with increasing dietary
protein intake, indicating that AA uptake processes are regulated in part by AA

availability.

Keywords: amino acid uptake, dietary protein, mammary gland, lactation

177

Introduction

Milk protein intake is crucial to neonatal development and growth (Millar,
1970). Free AA in blood are the major precursors for milk protein synthesis
(Mepham, 1982) and their arterial concentration appears to be the most limiting
factor affecting their uptake by the mammary gland (Bequette et al., 2000).
Uptake of essential AA by mammary epithelial cells in vitro is rate limiting for milk
protein synthesis (Gomez et al., 1995). However, the regulatory mechanisms
behind arterial AA uptake by the mammary gland are unknown. Both deficiency
and excess of dietary protein intake by lactating sows result in depression of
piglet ADG compared to that of sows fed adequate amount of protein (Stahly et
al., 1992, King et al., 1993; Yang et al., 2000; Guan et al., 2002). Depression in
piglet ADG is correlated to lower milk protein yield (Guan et al., 2002). In
lactating goats and sows, reduced availability of any one of the essential AA in
plasma decreases mammary AA uptake and milk protein synthesis (Bequette et
al., 2000; Guan et al., 2002). In lactating sows, AA arterio-venous (AV) difference
and extraction rates across the mammary gland is also a function of AA arterial
concentration (T rottier et al., 1997). Mammary AA AV difference responds
curvilinearly to dietary protein intake, with protein deficiency leading to low AV
difference but high extraction rate and protein excess leading to low AV
difference but with low extraction rate (Guan et al., 2004). This suggests that AA
uptake and transport processes can be modulated by AA availability, possibly as

an attempt by the mammary tissue to maintain optimum intracellular

178

concentrations of AA for protein synthesis (Bequette et al., 1996). In the study by
Guan et al. (2004), dietary AA profiles across diets were adjusted to be the same
using AA in crystalline form. The objective of this study was to determine AA
extraction rate response by the porcine mammary gland to dietary protein intake
independent from crystallineAA inclusion or maintenance of AA profile across
diets. A second objective was to test the feasibility of using corn and soybean
meal as the sole ingredients to vary dietary crude protein concentration. It was
hypothesized that increasing dietary total protein concentration from deficient to
excess would decrease extraction rates of AA by the porcine mammary gland as

observed in the study by Guan et al. (2004).
Materials and Methods

Dietary Treatments

Experimental diets were formulated to vary in CF concentrations by
modifying the ratio of corn to soybean meal. An Adequate diet (18 % protein) was
formulated to meet the protein and AA requirements for high producing sows and
all other nutrients according to the NRC (1998). A Deficient (12 % protein) and
an Excess (24 % protein) diets were formulated to provide CP and AA intake
below and above those of NRC (1998), respectively. All three dietary treatments
were formulated to be isocaloric with a metabolizable energy (ME) of 3.4

Mcallkg. Diet ingredient and nutrient composition are shown in Table A1.

179

Animals

Six multiparous (parity 2 or 3) sows (Landrace x Yorkshire) were selected
one week prior to parturition and allocated to dietary treatments. Sows were
provided ad Iibitum access to feed throughout the lactation period and feed
intakes were recorded daily from parturition to weaning on d 18. Litters were
randomly cross-fostered within 48 hours after birth to ensure litter size of 11 pigs
and uniform suckling demand across all sows. Live body weight, ultrasonic
backfat depth and loin area were recorded post-farrowing (d 0) and at weaning (d

18). Pigs were individually weighed at birth (d 0), and on d 7, 14 and 18.

Sample collection

Cannulation of the anterior main mammary vein and the carotid artery
were performed between d 3 and 5 of lactation to allow for recovery after
parturition and proper ingestion of colostrums by piglets, as described by Trottier
et al. (1995). Sows were allowed to recover for 5 to 6 days prior to blood and
milk sample collection. Blood samples were collected on d 10, 14 and 18 of
lactation. A total of seven arterial and mammary venous blood samples were
obtained from each sow on each sampling day at 30 min intervals. Plasma was
separated, pooled per sampling day and sow, and stored at -20°C. Amino acids
in plasma samples were quantified by reverse-phase HPLC (Pico Tag, Waters)

as previously described (Guan et al., 2002).

180

Amino acid extraction rates
Amino acid extraction rates were calculated as described previously
(Guan et al., 2002) where mammary AA extraction rate = AV difference across

the mammary gland / plasma arterial AA concentration.

Statistical Analysis

Differences in lactation performance and AA extraction rates were
determined by analysis of variance. Sources of variation in the model included
sow, diet and day of lactation as classification variables and the two-way
interactions of interest, diet by day of lactation. Sow nested within diet was
included as a random effect. Statistical analysis was performed using the MIXED
procedure of SAS (1998). Repeated measures analysis was used for repeated
measures over days of lactation based on different covariance structures (Litell et
al., 1998). The best fitting repeated measures covariance structure was
determined using the Akaike information criterion (AIC). Relationships between
dietary protein intake and response variables were determined by linear and
quadratic orthogonal contrasts. Differences were considered significant at.
P<0.05. Tendency for differences between treatments was considered at

PSO.10

181

Results and Discussion

Sow and litter lactation performances are shown in Table A2. The
combined voluntary feed intake response by the sows during the 18—d lactation
period with dietary protein concentration did not create significant differences
between protein intake. Consequently, the low dietary energy intake per se may
have limited litter growth rate.

Amino acid extraction rates by the mammary gland are shown in Table
A3. Mammary extraction rates represent the amount of AA being taken up by the
mammary gland relative to AA availability. Mammary extraction rates of lysine
and arginine tended to decrease with increasing dietary protein concentration
(linear, P=0.06), suggesting protein excess limited milk protein synthesis as piglet
ADG also decreased linearly (P=0.12). Extraction rates of leucine, threonine, and
phenylalanine also were lowest (P<0.10) in sows fed the Excess diet.

Because energy intake may have been limiting, it is possible that AA
extraction rates decreased in response to a decrease in energy substrates
availability. In the study by Guan et al. (2004), sows were offered similar dietary
protein concentrations with no impact on voluntary dry matter intake, yet AA
extraction rates decreased with feeding excess protein. Nonetheless, AA
extraction rate responses to changes in AA availability in this pilot study
resemble that of Guan et al. (2004), who suggested that AA transporter
processes may be regulated in part by AA availability. Amino acid uptake by the

mammary gland may be regulated by AA transporters that sense AA availability

182

and regulate cellular uptake of AAs (Hyde et al., 2003). The majority of amino
acid transporters in the porcine mammary gland have not been characterized to
date. However, of the diverse group of AA transport systems characterized so
far in other tissues and species, three systems appear to play a major role in
transport of all essential AA. An AA transport system specific for cationic AA,
namely y+, has been characterized in a number of tissues (Palacin et al., 1998),
including the porcine mammary gland (Hurley et al., 2000). In this study, lysine
and arginine extraction were notably affected by dietary protein availability,
suggesting that system y+ transporter may be involved in mediating this
response. So far, there is no reported evidence for the molecular presence of
system y+ transporters in the mammary gland. To a lesser extent, threonine
extraction rate was also depressed with deficiency and excess protein intake.
System ASC transports alanine, serine, and cysteine but has highest affinity for
threonine (Kilberg et al., 1981), the second limiting AA for milk protein synthesis
in lactating sows (Pettigrew, 1993). The molecular presence of system ASC in
mammary gland is unknown. Extraction rates of the branched chain AA, leucine,
valine and isoleucine, were depressed with increasing protein intake. System B°'+
transports a wide range of AAs with the highest affinity for hydrophobic AAs,
such as the branched-chain AAs valine, leucine and isoleucine (Van Winkle et
al., 1985; Sloan and Mager, 1999). The branched chain AAs play important roles
in the process of milk protein synthesis and overall mammary metabolism

(T rottier et al., 1997; Nielsen et al., 2002) and therefore a depressed extraction

rate of these AAs may also limit milk production.

183

Implication

Amino acid availability to the mammary gland modulates AA uptake and
thus possibly milk protein synthesis. Depressed postnatal growth of piglets under
conditions of deficiency and excesses of sow dietary protein intake may be
related to changes in AA extraction by the mammary gland and thus milk protein
yield. Preliminary results generated by this study imply that AA uptake by the
mammary gland may be regulated by AA availability. This regulation may occur
in part via AA transporter systems Future studies investigating the expression
and regulation of AA transporters in porcine mammary gland during lactation are
essential to our understanding of AA utilization and milk protein synthesis.
Results of this study reinforces the importance of maintaining the AA profile
equal across dietary treatments in order to insure similar voluntary feed intake
across dietary treatments and thus expected changes in dietary crude protein
intake. Accordingly, to test AA transporter gene expression response to AA
availability, corn to soybean meal ratio was maintained and variation in crude

protein concentrations was achieved with dilution with corn starch.

184

 

Literature cited

Bequette, B. J., Backwell, F. R. C., MacRae, J. C., Lobley, G. E., Crompton, L.
A., Metcalf, J. A. & Sutton, J. D. (1996) Effect of intravenous amino acid
infusion on leucine oxidation across the mammary gland of the lactating goat.
J Dairy Sci. 79: 2217-2224.

Bequette, B. J., Hanigan, M. D., Calder, A. G., Reynolds, C. K., Lobley, G. E. &
MacRae, J. C. (2000) Amino acid exchange by the mammary gland of
lactating goats when Histidine limits milk production. J. Dairy Sci. 83: 765-
775.

Gomez Angelats, M., Ruiz Montasell, B., Felipe, A., Marin, J. J., Casado, F. J. &
Pastor Anglada, M. (1995) Effect of protein malnutrition on neutral amino acid
transport by rat hepatocytes during development. Am. J. Physiol. 268: E368-
E374.

Guan, X., Bequette, B. J., Calder, G., Ku, P. K., Ames, K. N. & Trottier, N. L.
(2002) Amino acid availability affects amino acid transport and protein
metabolism in the porcine mammary gland. J. Nutr. 132: 1224-1234.

Guan, X., Pettigrew, J. E., Ku, P. K., Ames, K. N., Bequette, B. J. & Trottier, N. L.
(2004) Dietary protein concentration affects plasma arteriovenous difference
of amino acids across the porcine mammary gland. J. Anim. Sci. 82: 2953-
2963.

Hatzoglou, M., Fernandez, J., Yaman, l. & Closs, E. I. (2004) Regulation of
cationic amino acid transport: the story of CAT-1 transporter. Annu. Rev. Nutr.
24: 377-399.

Hurley, W. L., Wang, H., Bryson, J. M. & Shennan, D. B. (2000) Lysine uptake by
mammary gland tissue from lactating sows. J. Anim. Sci. 78:391-395.

Hyde, R., Taylor, P. M. & Hundal, H. S. (2003) Amino acid transporters: roles in
amino acid sensing and signaling in animal cells. Biochem. J. 373: 1-18.

Kilberg, M. S., Handlogten, M. E. & Christensen, H. N. (1981) Characteristics of
system ASC for transport of neutral amino acids in the isolated rat
hepatocytes. J. Biol. Chem. 256: 3304-3312.

King, R. H., Toner, M. S., Dove, H., Atwood, C. S. & Brown, W. G. (1993) The
response of first-litter sows to dietary protein level during lactation. J. Anim.
Sci. 71 : 2457-2463.

Littell, R. C., Henry, P. R. & Ammerman, C. B. (1998) Statistical analysis of
repeated measures data using SAS procedures. J. Anim. Sci. 76: 1216-1231.

Millar, S. A. (1970) Nutrition in the neonatal development of protein metabolism.
Nutrition and Cell Dev. Federation Proceedings. 29: 1497-1502.

185

Mepham, T. B. (1982) Amino acid utilization by lactating mammary gland. J.
Dairy Sci. 65: 287-298.

National Research Council (NRC). (1998) Nutrient requirements of swine (10th
Rev. Ed.). National Academy Press, Washington, DC.

Nielsen, T. T., Trottier, N. L., Stein, H. H., Bellaver, C. & Easter, R. A. (2002) The
effect of litter size and day of lactation on amino acid uptake by the porcine
mammary gland. J. Anim. Sci. 80:2402-2411.

Palacin, M., Estévez, R., Bertran, J. & Zorzano, A. (1998) Molecular biology of
mammalian amino acid transporters. Physiol. Rev. 78: 969-1054.

Pettigrew, J.E. (1993) Amino acid nutrition of gestating and lactating sows.
BioKyowa technical Review #5. Nutri-Quest, Inc. Chesterfield, MO.

Richert , B. T., Goodband, R. D., Tokach, M. D. & Nelssen, J. L. (1998) In vitro
oxidation of branched chain amino acids by porcine mammary tissue.
Nutrition Res. 18: 833-840.

SAS/STAT Software 8.1 (2000) SAS Institute Inc., Cary, NC.

Sloan, J. L. & Mager, S. (1999) Cloning and functional expression of a human
Na+ and CI- -dependent neutral and cationic amino acid transporter BO,+. J.
Biol. Chem. 274: 23740-23745.

Stahly. T. S., Cromwell, G. L. & Monegue, H. J. (1992) Milk yield responses of
sows nursing large litters to dietary amino acid levels. J. Anim. Sci. 70: 238
(Abstract).

Trottier, N. L., Shipley, C. F. & Easter, R. A. (1995) A technique for the venous
cannulation of the mammary gland in the lactating sow. 73: 1390-1395.

Trottier, N. L., Shipley, C. F. & Easter, R. A. (1997) Plasma amino acid uptake by
the mammary gland of the lactating sow. J. Anim. Sci. 75: 1266-1278.

Van Winkle, L. J., Christensen, H. N. & Campione, A. L. (1985) Na+ -dependent
transport of basic, zwitterionic, and bicyclic amino acids by a broad-scope
system in mouse blastocysts. J. Biol. Chem. 260: 12118-12123.

Yang, H., Pettigrew, J. E., Johnston, L. J., Shurson, G. C. & Walker, R. D. (2000)
Lactational and subsequent reproductive responses of lactating sows to
dietary lysine (protein) concentration. J. Anim. Sci. 78: 348-357.

186

TABLE A1
Ingredient and nutrient composition of experimental diets on as fed basis (%)

 

 

 

Dietary treatments

Item Deficient Adequate Excess

Ingredients
Com, dent yellow 80.16 64.16 47.16
Soybean meal, 13.00 29.00 46.00
Corn oil 2.30 2.30 2.30
Dical. phos. 1.97 1.97 1.97
Limestone 0.87 0.87 0.87
MSU vit premix‘ 0.60 0.60 0.60
MSU min premixz 0.50 0.50 0.50
Salt, NaCl 0.30 0.30 0.30
Sow pack3 0.30 0.30 0.30

Calculated analysis
CP, % 12.35 18.03 24.06
ME, Kcal/kg 3348 3310 3270
CFat, % 3.32 2.94 2.53
CFiber, % 9.42 10.02 10.65
Ca, % 0.81 0.86 0.91
P, % 0.67 0.73 0.80
Ca:P 1.20 1.17 1.14

 

1 Provided the following per kilogram of diet: 4,583 IU vitamin A, 458 IU vitamin 03, 55 IU vitamin
E, 11 mg vitamin K, 3.66 mg menadione, 0.0275 mg vitamin B12, 3.66 mg riboflavin, 14.67 mg D-
pantothenic acid, 22 mg niacin, 0.913 mg thiamine, 0.825 mg pyridoxine.

Provided the following per kilogram of diet: 335 9 Ca, 5 9 Fe, 5 9 Zn, 5 mg Cu, 150 $9 Se, and
75 (D9 I.
3 Provided the following per kg premix: 918583 IU vitamin A, 73487 mcg biotin, 128602 mg
choline, 551 mg folic acid.

187

.2 u I S 3 8:8 8:903 m

.wummzcoo .mcomocto Ag 0:933 can 3 Laos. ..o 029d '
.EQoE ficvwv «.896 new 390.5 $va eumacoo< .3665 exam: €22.50 ”fledged: >565 a

does. 05 he Lots 285% a

.5958: >596 Lea mu: £3 £3 3 .0 voted 5:98. a .8 memos moan—cm fine. 9m 56% Ema .

 

 

 

 

who «to «.2 m. EN 32 38 m .03 .25
:3 who a; 8...”- 8. F- tn? «.8 69.20 8:... ea 53
mud and EN 2.? 8.8. who as 69.20 3:08
Ed and 3: s. E» 2.2. ENE Ea .955 5.205 8992
8d mg was 83 BE. 33 29. .395 Be omega
and Ed Ea 5.2- 3.3- 8.8- m9. .855 2925

o ._ N5mm 802m 9382 €22.50 52.

Vmozwzmfi ”Eco—Ewe: >535

 

.Emu $.66 3896 35.5 new oocEEotoQ c9383 Bow :o 955 £921

N< m._m<._.

188

0.00.500 .0200055 .0. 0.0.0030 0:0 A... .00.... .0 0:.0>-n. 0
5.0.05 0008 0000xm 000 5.0.05 #0... 0.030000. 550.05 55... 5.0.0500 ”0.005.091.0005 0

.0005. 0.... .0 5:0 0.00:0.0 00.005 ~

500.00.. 500.0 .05 mu: 5.; 0.00 3 .0 00.05 0030.00. 0 .0. 0:005. 0.030 .000. 0.0 030% 0.00 5

 

 

 

 

0...... 2.0 ~0.~ 8.: 00.v~ 00.0~ 05_0>
00.0 .00 00.0 0~.0 00.» 0.0 020205
0~0 05.0 00.~ 00.0. 00.- 50.5 05085
~00 2.0 $.~ 3.0~ 00.00 00- 05050555
00.0 00.0 2.0 0.0.5 00:. 8.00 050.:
00.0 3.0 00.~ 00. .0 00.0.. 030 05000..
0~.0 .0~.0 -0 00.0~ E00 3.00 0500202
00.0 00.0 00.~ ~0.~. ~05: ~0.~. 055E...
~00 00.0 -.~ 00.0. 02~ 00.0~ 0550.0.
C 1. ~S_mw wwwoxw m~m=cmv< Em_ocw0 20m OEE<
00030.06 0050500.. 20.05

 

w0:05 b0EE0E 0:. 330. 0.0. 00.500506
n< m..m<._.

189

APPENDIX B

Sus scrofa Amino Acid Transporter B°"’ and ASCT1 mRNA, partial sequences

Porcine B°"’ and ASCT1 cDNA probes were developed by polymerase
chain reaction (PCR) using pooled cDNA from porcine MT as a template. PCR
primers were designed from the published human B°'+ (GenBank Accession
number AF151978) and human ASCT1 (GenBank Accession numbers L14595
and L19444) cDNA sequences. PCR was carried out in a RoboCycler Gradient
96 (Stratagene, La Jolla, CA) using Taq DNA polymerase as recommended by
manufacturer (lnvitrogen, Life Technologies, USA). Resulting PCR amplification
products were visualized as single bands of correct size using agarose gel
electrophoresis (1 .8% gel), gel purified (Wizard® PCR Preps DNA Purification
System, Promega, Madison, WI), ligated into the pGEM-T Easy cloning vector
(Promega, Madison, WI), and the recombinant plasmids transformed into JM109
competent cells (Promega, Madison, WI) and stored at -80°C. The 1058 and 373
bp cDNA probes for B°'* and ASCT1, respectively, were DNA sequenced in both
directions to confirm identities using a dye-tenninator fluorescent cycle
sequencing technique and an ABI® 3100 Genetic Analyzer (PerkinEImer Applied
Biosystems, Foster City, CA), and the sequence information deposited in
GenBank (Accession numbers: AY375264 and AY375265). Sequence alignment
and homology information to the human Bo'+ (GenBank Accession number
AF151978) and human ASCT1 (GenBank Accession number L14595) cDNA

sequences is provided.

190

The porcine partial cDNA sequence for amino acid transporter B°"’ (italics)
has a 93% homology to the human B°'+ cDNA sequence (GenBankAccession

numbers AY375265 and AF151978, respectively).

433 AGGTGTGGGAATTACAATGGTCCTGATCTCCATTTTTGTGACAATCTATTACAATGTCAT 492

1 AGGTGTGGGAATTACAATGGTCCTGATATCCATTTTTGTGACAATCTACTACAATGTCAT 60

493 AATT ACTAC CATGTTTGCTTCTTTTCAAAGTGAACTACCATGGAAAAA 552

61 mTGTTTGCTTCTTTTCAAAGTAAACTACCATGGGAAAA 120

553 TTGTTCTTCGTGGTCAGATAAAAACTGTAGCAGATCACCAATAGTAACTCACTGTAATGT 612

121 TKKTTCTWWTTGGGCAGATGAAAACTGTAGCAGATCGCCTATAGTAACACATTGTAATGT 180

613 GAGTA 617

181 GAGTA 185

641 ATCATCCAAATGAATAAAAGCTGGGTAGACATCAACAATTTTACCTGCATCAACGGCAGT 700

200 ATCTTCCAAATGAATAAAAGCTGGGTAGATGCCAACAATCTTACCTGCATCAATGGAAGC 259

701 GAAATTTATCAGCCAGGGCAGCTTCCCAGTGAACAATATTGGAATAAAGTGGCGCTCCAA 760

260 GAAGTTTATCAGCCAGGGCAGCTTCCCAGTGAACAATATTGGAATAAAGTGGCGCTCCAA 319

761 CGGTCAAGTGGAATGAATGAGACTGGAGTAATTGTTTGGTATTTAGCACTTTGTCTTCTT 820

320 CGGTCGAGTGGAATGGATGAGACTGGAGTCATTGTGTGGTATTTAGCACTTTGTCTTCTT 379

821 CTGGCTTGGCTCATAGTTGGAGCAGCACTATTTAAAGGAATCAAATCGTCTGGCAAGGTG 880

380 CTGGCCTGGCTCATAGTTGGAGCAGCACTGTTTAAAGGAATCAAGTCTTCTGGCAAGGTG 439

881 GTATATTTTACAGCTCTTTTCCCCTATGTGGTCCTACTCATCCTGTTAGTACGAGGTGCA 940

440 GTATATTTTACAGCTATTTTCCCCTATGTTGTTCZACTCATCCTGTTGATCCGAGGAGCA 499

941 ACTCTGGAGGGTGCTTCAAAAGGCATTTCATACTATATTGGAGCCCAGTCAAATTTTACA 1000

500 ACTCTGGATGGTGCATCAAAAGGCATTTCATACTATATTGGAGCACAGTCAAATTTTACA 559
1 o o 1 AAACTTAAGGAAGCTGAGGTATGGAAAGATGCTGCCACTCAGATATTTTACTCCCTTTCA 1 o 6 o
|||l||| |||||||||||| ||||||||||||||||| ||||||||||||||||||||

560 AAACTTAGGGAAGCTGAGGTTTGGAAAGATGCTGCCACACAGATATTTTACTCCCTTTCT 619

1061 GTGGCTTGGGGTGGCTTAGTTGCTCTATCATCTTACAATAAGTTCAAAAACAACTGCTTC 1120

191

620

1121

680

1181

740

1241

800

1301

860

1361

920

1421

980

1481

1040

GTGGCTTGGGGTGGTTTAGTTGCTCTATCATCTTACAACAAGTTCAATAACAATTGCTAC 679

TCTGATGCCATTGTGGTTTGTTTGACAAACTGTCTCACTAGCGTGTTTGCTGGATTTGCT 1180
|| ||||||||||| ||||||||||||||||| || ||||| |||l| ||||||||l|||
TCAGATGCCATTGTAGTTTGTTTGACAAACTGCCTTACTAGTGTGTTCGCTGGATTTGCT 739
TTTTTCTATATTGGGACACATGGCCCATATATCTGGAAAGGAAGTTTCTCAAGTTGTA 1240
ll|||||||||||||||||||||l|| | ||||||||||||||l||| ||||||||||||
NTTTTCTATATTGGGACACATGGCTCGTATATCTGGAAAGGAAGTCTCTCAAGTTGTA 799
AAATCAGGTTTTGATTTGGCATTCATTGCCTATCCAGAGGCTCTAGCCCAACTCCCAGGT 300
||||||||||| |||||||| |l|||||| |||||||| |||||||||||||||||||||
AAATCAGGTTTCGATTTGGCGTTCATTGCTTATCCAGAAGCTCTAGCCCAACTCCCAGGT 859
GGTCCATTTTGGTCCATATTATTTTTTTTCATGCTTTTAACTTTGGGTCTCGATTCTCAG 1360
|| ||||||||||||||||||||||| ||l|||||||| ||||||l|||| || ||||||
GGGCCATTTTGGTCCATATTATTTTTCTTCATGCTTTTGACTTTGGGTCTGGACTCTCAG 919
TTTGCTTCGATTGAAACGATCACAACAACAATTCAAGATTTATTTCCCAAAGTGATGAAG 1420
|l|||||| ||||||||||| |||||||| ||||||||||||||||||||||||||||||
TTTGCTTCCATTGAAACGATTACAACAACGATTCAAGATTTATTTCCCAAAGTGATGAAG 979

AAAATGAGGGTTCCCATAACTTTGGGCTGCTGCTTGGTTTTGTTTCTCCTTGGTCTCGTC 1480

AAAATGAGGGTTCCCACAACTTTGGGTTGCTGCTTGGTTTTGTTTCTCCTTGGTCTCGTC 1039
TGTGTGACTCAGGCTGGAAT 1500

TGTG-GACTCAGGCTGGAAT 1058

The porcine partial cDNA sequence for amino acid transporter ASCT1

(italics) has a 92% homology to the human ASCT1 cDNA sequence

(GenBankAccession numbers AY375264 and L14595, respectively).

1185

1245

61

1305

121

1365

181

CCCATTTGCGACAGCATTTGCTACCTGCTCCAGCTCAGCGACCCTTCCCTCTATGATGAA 1244

mTTT TGCGACAGCATTTGCCACCTGCTCCAGCTCAGCAACCCTTCCCTCGATGATGAA 60

GTGCATTGAAGAGAACAATGGTGTGGACAAGAGGATCAGCAGGTTTATTCTCCCCATCGG 1304

GTGCATTGAAGATAACAATGGTGTAGACAAGAGGATCAGCAGGTTCATTCTTCCCATCGG 120

GGCCACC CGTGAACATGGACGGAGCAGCCATCTTCCAGTGTGTGGCCGCGGTGTTCATTGC 1364

CGTGAACATGGACGGAGCTGCCATCTTCCAGTGCGTGGCCGCCGTGTTCATTGC 180
GCAACTCAACAACATAGAGCTCAACGCAGGACAGATTTTCACCATTCTAGTGACTGCCAC 1424

CCAGCTCAACAATGTGGAGCTGAAAGCAGGACAGATTTTCACCATCCTAGTGACAGCCAC 240

192

1425

241

1485

301

1545

361

AGCGTCCAGTGTTGGAGCAGCAGGCGTGCCAGCTGGAGGGGTCCTCACCATTGCCATTAT 1484

GGCATCCAGTGTTGGAGCAGCAGGTGTGCCAGCTGGAGGGGTCCTCACCATCGCCATTAT 300

CCTGGAGGCCATTGGGCTGCCTACTCATGACCTGCCTCTGATCCTGGCTGTGGACTGGAT 1544

CCTGGAGGCCATCGGGCTGCCCACTCAAGACCTCTCTTTGATCCTGGCTGTGGACTGGAT 360
TGTGGACCGGACCA 1558

TGTGGACCGGACCA 374

193

APPENDIX C

Porcine Poly A+ RNA Northern Blot Analysis of CAT-1

As shown in Figure 3.1 (Chapter 3), hCAT-1 hybridized to porcine
mammary tissue during lactation. While the band was of expected size, it
required intensification. Thus, a second northern blot using poly A" RNA was
performed (Figure C1). Following total mammary RNA isolation and assessment
of RNA purity and quality as described in Chapter 3, purification of poly A“ RNA
was performed using the Oligotex method (Qiagen lnc.; Valencia, CA). Duplicate
5 pg-samples of this Poly A+ RNA were size separated on a 1.2% 0.2M
formaldehyde agarose gel. RNA was then transferred to a nylon membrane and

hybridized with the CAT-1 probe as described in Chapter 3.

194

Figure C1. Northern blot analysis of CAT-1 mRNA abundance in poly A“ RNA
from lactating porcine mammary tissue, demonstrating that the human CAT-1
cDNA probe hybridized well to a single transcript of correct size (5.2 kb). Lanes
1 and 2 contained 5ug of mRNA from mammary tissue of one sow. The hCAT-1
cDNA was donated by Dr. Closs. Blot was exposed to X-ray film for 168h.

195

 

 

Mammary
1 2 .,
~5.2 kb w 0.. §<—CAT-1

196

APPENDIX D

Representative Standard Curves for Candidate Genes

Standard curves for Q-RT-PCR were generated using cDNA templates
and primers as described in Chapters 3 and 4. Representative standard curves

for the genes of interest are reported in Figures D1 to D5 below.

197

Figure D1. Representative standard curve generated by Q-RT—PCR for porcine
CAT-1.

198

Cycles to threshold (Ct)

45
40
35 t
30 "
25 '
20 ’
15 "
10

i

y = -1.5521I.n(x) + 20.079
- n’ = 0.9895

 

d.
b

0 3 1
0.00001 0.0001 0.001 0.01 0.1
mRNA abundance (pg)

199

Figure D2. Representative standard curve generated by Q-RT—PCR for porcine
CAT-2B.

200

 

 

 

 

Cycles to threshold (Ct)

45
40
35
30
25
20
15
10

5

0

y = -2.0044r.n(x) + 9.5075
. n’ =o.9s1

 

I l l
I I I

0.000001 0.00001 0.0001 0.001

mRNA abundance (pg)

201

 

0.01

Fiogure D3. Representative standard curve generated by Q-RT-PCR for porcine
B "T

202

 

Cycles to threshold (Ct)

p
O

HNNWUI
UIOU'IOU'I

0'!

0

b v = 455031.10) + 15.319
' Rz =0.9964

l L l I
I U I U

 

0.00001 0.0001 0.001 0.01 0.1

mRNA abundance (pg)

203

Figure D4. Representative standard curve generated by Q-RT-PCR for porcine
ASCT1.

204

Cycles to threshold (Ct)

Ul

 

 

y = -1.222I.n(x) + 22.758
3' = 0.9392

 

0.0001 0.001 cm

mRNA abundance (pg)

205

0.1

Figure D5. Representative standard curve generated by Q-RT-PCR for porcine B-
actin.

206

 

 

 

15-

10-

y = -1.60ln(x) + 22.76
R’ = 0.996

 

 

 

0.001

d-

0.1

all.

APPENDIX E
B—actin Transcript Abundance in Porcine Mammary Tissue During Lactation

Transcript abundance of a gene of interest can be quantified by real-time
PCR using two main methods, relative and absolute quantification. Relative
abundance of a gene of interest refers to its expression compared to a control
gene. Control genes for relative transcript abundance can be endogenous or
external standards added to the samples. Endogenously expressed genes or
housekeeping genes are most often used and encode for proteins that are
essential for maintenance of cell function (e.g., cytoskeletal, glycolytic, and
ribosomal proteins) (Eisenberg and Levanon, 2003). These housekeeping genes
are therefore presumed to be expressed in every experimental sample. In
addition, similar expression of these genes is assumed in different tissues and
cell types since their protein products are required for cell viability. In previous
studies of relative RNA abundance in mammary tissue throughout stages of
lactation, several housekeeping genes have been commonly used as control
genes in real-time PCR assays. These are gcheraldehyde-3-phosphate
dehydrogenase (GAPDH), B-actin, and cyclophilin (Komatsu et al., 2005; Zhao et

al., 2004; Kozakai et al., 2002; Bonnet et al., 2002).
Two well-known housekeeping genes were evaluated during the

development and validation of the real-time assays performed in the experiments

described in this dissertation. Due to the nature of dietary treatments imposed,

208

glycolytic enzymes, such as GAPDH, were expected to be differentially
expressed. A pilot study using three animals was conducted to determine
whether GAPDH transcript abundance varied with stage of lactation. Relative
abundance of GAPDH varied significantly (P<0.05) with stage of lactation (data
not shown). When analyzing B—actin suitability as a normalizing gene to correct
for qualitative and quantitative differences in transcript abundance caused by
variations in cDNA synthesis efficiency and sample loading, transcript abundance

was found to change as well (data not shown).

Others have also found B—actin and GAPDH to be unsuitable normalizing
genes (Glare et al., 2002; Chang et al., 1998; Foss et al., 1998; Yamada et al.,
1997; Marten et al., 1994). Consequently, transcript abundance analysis was
modified. Absolute quantification of genes of interest was performed using
specific standard curves for all genes including B-actin. For experiments in
Chapter 4, diluted cDNA was quantified using a nano-spectrophotometer (Nano
Drop ND-1000, NanoDrop Technologies, Inc., Rockland, DE) and these values
were then used to correct for differences in efficiency and loading of cDNA.
When samples from the experiments described in Chapter 4 (n = 18) were
normalized with cDNA concentration, B-actin transcript abundance was indeed

different at Early versus Peak lactation (Figure E1).

Using B-actin and GAPDH expression as housekeeping genes to

normalize transcript abundance of genes of interests in the mammary gland at

209

different stages of lactation should be avoided. The assumption that the
housekeeping gene expression does not change with stage of lactation is
erroneous as the mammary gland is in constant proliferation during lactation. Not
only the number of cells in porcine mammary tissue increases with advancement
of lactation, the size of these cells increase as well (Kim et al., 1999). Taken
together, caution is necessary when studying previous experiments investigating
gene expression in mammary tissue across stages of lactation by relative

abundance using GAPDH and B-actin as normalizing genes.

210

Literature Cited

Bonnet, M., Gourdou, l., Leroux, C., Chilliard, Y. & Djiane, J. (2002) Leptin
expression in the ovine mammary gland: putative sequential involvement of
adipose, epithelial, and myoepithelial cells during pregnancy and lactation. J.
Anim. Sci. 80: 723-728.

Chang, T. J., Juan, C. C., Yin, P. H., Chi, C. W. & Tsay, H. J.. (1998) Up-
regulation of beta-actin, cyclophilin and GAPDH in N1S1 rat hepatoma.
Oncol. Rep. 5: 469-471.

Eisenberg, E. & Levanon, E. Y. (2003) Human housekeeping genes are
compact. Trends Genet. 19: 362-365.

Foss, D. L., Baarsch, M. J. & Murtaugh, M. P. (1998) regulation of hypoxanthine
phosphoribosyltransferase, glyceraldehyde-3-phosphate dehydrogenase and
beta-actin, mRNA expression in porcine immune cells and tissues. Anim.
Biotechnol. 9: 67-78.

Glare, E. M., Divjak, M., Bailey, M. J. & Walters, E. H. (2002) Beta-actin and
GAPDH housekeeping gene expression in asthmatic ainrvays is variable and
not suitable for normalizing mRNA levels. Thorax 57: 765-770.

Kim, S.W., Hurley, W.L., Han, |.K. & Easter, R. A. (1999) Changes in tissue
composition associated with mammary gland growth during lactation in sows.
J. Anim. Sci. 77: 2510-2516.

Komatsu, T., Itoh, F., Kushibiki, S. & Hodate, K. (2005) Changes in gene
expression of glucose transporters in lactating and nonlactating cows. J.
Anim. Sci. 83: 557-564.

Kozakai, T., Sakate, M., Masuo, Y., Uchide, T. & Saida, K. (2002) Increased
gene expression of endothelin-1 and vasoactive intestinal
contractor/endothelin-2 in the mammary gland of lactating mice. Biochem.
Biophys. Res. Comm. 297: 1339-1343.

Marten, N. W., Burke, E. J., Hayden, J. M. & Strauss, D. S. (1994) Effect of
aminoacid limitation on the expression of 19 genes in rat hepatoma cells.
FASEB J. 8: 538-544.

211

Yamada, H., Chen, D., Monstein, H. J. & Hakanson, R. (1997) Effects of fasting
on the expression of gastrin, cholecystokinin, and somatostatin genes and of
various housekeeping genes in the pancreas and upper digestive tract of rats.
Biochem. Biophys. Res. Comm. 231: 835-838.

Zhao, F., Miller, P. J., Wall., E. H., Zheng, Y., Dong, B., Neville, M. C. &
McFadden, T. B. (2004) Bovine glucose transporter GLUT8: cloning,
expression, and developmental regulation in mammary gland. Biochim.
Biophys. Acta 1680: 103-113.

212

Figure E1. B-actin transcript abundance in porcine mammary tissue (n=18) at Early
and Peak lactation. B-actin transcript abundance was higher at Peak lactation
compared to Early lactation (***P < 0.001).

213

 

 

ddddddd

444444
0000000
111111

XXXXXX
oooooo
66666

APPENDIX F

Contribution of Epithelial Cells to Porcine Mammary Tissue at Peak Lactation

With the notion that mammary tissue is heterogeneous and composed of
both stromal and epithelial cells, the possibility that expression of amino acid
transporters differed between cell types in the experiments described in this
dissertation cannot be refuted. Relative contribution of epithelial and stromal cells
in porcine mammary tissue during lactation was therefore estimated. Two
thoracic mammary glands were collected and sliced in four main regions as
shown in Figure F1. Each region was then divided in small sections (~0.5g) and
incubated separately in 10% formalin for 16 hrs at 4°C. Sections were then
rinsed in phosphate buffered saline and stored in 70% ethanol at 4°C. Sections
of mammary tissue were embedded in paraffin following the procedure described
by Weber-Hall and Dale (2000). Embedded samples were sent to Dr. R. M.
Akers at Virginia Polytechnic Institute and State University for histological
assessment of relative density of epithelial cells across the sampling regions as
described previously (Berry et al., 2003). Briefly, 5mm sections were cut and
placed on positively charged microscope slides (Fisher Scientific, Pittsburgh,
PA). Slides were first de-paraffinized in two changes of xylene (5 min each) and
subsequently rehydrated through a graded series (100%, 95%, and 70%) of
ethanol followed by incubation in water. Sections were then stained by
incubation in Ehrlich’s Hematoxylin and Eosin (Sigma, St. Louis, M0) for 10 min.

Following staining, slides were washed in water for 5 to 10 min, dehydrated (2

215

min each in 70%, 95% and 100% ethanol), incubated in two changes of xylene (5
min each), and cover slipped using Perrnount mounting media (Fisher Scientific,

Pittsburgh, PA).

Mammary epithelial cells, stromal cells, and fat globules are identified in
Figure F2 as described in Chapter 5. Table F1 shows the relative distribution of

epithelial and stromal cells in porcine mammary tissue at peak lactation.

216

Literature Cited

Berry, S. D., Howard,R. D. & Akers, R. M. (2003) Mammary localization of
laminin, fibronectin, and collagen IV proteins in prepubertal heifers. J. Dairy
Sci. 86: 2864-2874.

Weber-Hall, S. & Dale, T. (2000) mRNA in situ hybridization in the mammary
gland. In: Methods in mammary gland biology and breast cancer research.
Ed: M. M. lp and B. B. Asch., pp. 211-221. Kluwer Academic/Plenum
Publishers, New York, NY.

217

Figure F1. Longitudinal cut of one porcine mammary gland depicting the four
regions used for histological examination.

218

 

Cranial

219

 

u
d
.u.
C

Figure F2. Photographic representation of cell type distribution in porcine mammary
tissue on day 18 of lactation at a 100x magnification. a: mammary epithelial cells; b:
stromal cells; c:, and fat globules.

220

 

m

 

.IU

221

TABLE F1

Relative distribution of epithelial and stromal cells in porcine mammary tissue on day

18 of lactation‘, %

 

 

 

- 2
Cell type Region P-value3
1 2 3 4
Epithelial 81.6 :I: 1.4 80.3 :I: 0.9 80.2 :I: 0.7 80.5 :I: 0.9 > 0.1
Stromal 18.4 :I: 1.4 19.7 :t: 0.9 19.8 :I: 0.7 19.5 :I: 0.9 > 0.1

 

1Values are mean :I: standard error of the mean.
2As illustrated in Figure 2.
3t-tests of paired means.

222

 

APPENDIX G

Dietary Protein Intake Does Not Alter Protein Abundance of ASCT1 in Porcine

Mammary Gland during Lactation.

System ASC is a ubiquitous AA transport system that provides cells with AAs
required for cellular metabolism and nutrition (Christensen, 1990). ASC transporter
mediates Na+-dependent exchange of small neutral AAs such as alanine, serine,
cystine, threonine, and in some situations proline (Pinilla-Tenas et al., 2003).
Extraction rates of these amino acids by the porcine mammary gland in vivo were
higher at peak lactation compared to early lactation (Nielsen et al., 2002). In
addition, similarly to CAT-1, ASCT1 is subject to trans-stimulation by its substrates.
This means that the rate of transport of ASC substrates is higher when the
extracellular concentration of those AAs is increased (Christensen, 1990). Although
there is direct evidence for regulation of the ASCT1 gene by AA availability (Sakai et
al., 2003; Howard et al., 2004), AA availability did not alter mRNA abundance of the
ASCT1 gene in porcine mammary tissue, however, it was higher at Peak lactation
(peak milk demand) compared to Early lactation (Chapter 4).

The objective was to test the hypothesis that ASCT1 is subject to adaptive
regulation in the porcine mammary gland during lactation and responds to milk
demand. Western blot analysis was used to determine the relative abundance of

ASCT1 protein levels in mammary tissue.

223

The experimental design, animals, dietary treatments, tissue collection
and protein isolation, and western blotting procedures are described in Chapter
5. Relative abundance of the ASCT1 protein in mammary tissue during Early
and Peak lactation are presented in Chapter 5. Relative abundance of ASCT1
protein in response to different levels of dietary protein intake is presented in
Figure G1. Relative abundance of the ASCT1 protein in lactating mammary
tissue did not differ with AA availability (P>0.10). However, there was an
interactive effect of dietary treatment x replicate where ASCT1 protein levels
were lower and higher with Excess protein intake in replicates 1 and 2,
respectively, compared to Adequate protein intake (Figure GZ). The interactive
effect of dietary treatment and replicate could not be explained, and

consequently, the data was not included within the main body of the thesis.

224

Literature cited

Christensen, G. (1990) Role of amino acid transport and countertransport in
nutrition and metabolism. Physiol. Rev. 70:43-77.

Howard, A., GoOdIad, R. A., Walters, J. R. F., Ford, D. & Hirst, B. H. (2004)
Increased expression of specific intestinal amino acid and peptide transporter
mRNA in rats fed by TPN is reversed by GLP-2. J. Nutr. 134: 2957-2964.

Nielsen, T. T., Trottier, N. L., Stein, H. H., Bellaver, C. & Easter, R. A. (2002) The
effect of litter size and day of lactation on amino acid uptake by the porcine
mammary gland. J. Anim. Sci. 80:2402-2411.

PinilIa-Tenas, J., Barber, A. & Lostao, M. P. (2003) Transport of praline and
hydroxyproline by the neutral amino-acid exchanger ASCT1. J. Membr. Biol.
195: 27—32.

Sakai, K., Shimizu, H., Koike, T., Furuya, S. & Watanabe, M. (2003) Neutral
amino acid transporter ASCT1 is preferentially expressed in L-Ser—
synthetic/storing glial cells in the mouse brain with transient expression in
developing capillaries. J. Neurosci. 23: 550-560.

225

Figure G1. Relative abundance of ASCT1 protein in porcine mammary during
lactation at three levels of dietary protein intake (n=6). ASCT1 protein levels did not
change with dietary protein intake (P>0.10).

226

 

relative abundance

.3
01
I

-L
O
I

9
0|
1

 

p
O
l

ASCT1 protein

  

Deficient Adequate
Dietary treatments

227

  

Excess

 

Figure G2. The effect of dietary protein intake on ASCT1 relative abundance was
different within replicates. Relative abundance of ASCT1 in porcine mammary tissue
by experimental replicate. Excess dietary protein intake (24%) decreased ASCT1
protein abundance compared to Adequate protein intake on sows in replicate 1,
while on sows in replicate 2, Excess dietary protein intake increased ASCT1
abundance when compared to the Adequate protein diet (P<0.01).

228

 

relative abundance

2.5x10°-

2.0X10°-

1.5X10°-

1.0X10°-

5,0x10-1-

ASCT1 protein

 

0'

 

replicate
- Deficient
m Adequate
% Excess

229

‘4 Sa£~o

    

Editor-In-chlet

Gary w. Rogers
University of Tennessee
865.974.7289

Fax: 865.974.3394
grogers2@tennessee.edu

Wag Editor
Susan M. Pollock
FASS. ADSA
217.356.7641

Fax: 217.378.4083

susanp@assocnq.org

m Admlltlm
Jeremy Hotzner

FASS, ADSA
217.356.2426 ext. 38
Fax: 217.378.4083

WW©3$80CMUQ

JOURNAL or

DAIRY SCIENCE

 

1111 N. Dmlap Ave, Savoy IL 61874

~ Journal of Dairy Science” and include identifying information, such as year,

217/356-5146 Fur2l7/398-4119 adse@assochq.org

February 26, 2007

Juliana Perez Laspiur

University of Puerlo Rico Medical Sciences Campus
NeuroAlDS Research Program

Estudios Biomedicos Ste. 310

GPO Box 365067

San Juan, PR. 00936

 

Dear Ms. Perez Laspiur:

The American Dairy Science Association grants you nonexclusive permission to
use the article listed below in your dissertation, provided that appropriate credit
is given to the original publication in the Journal of Dairy Science.

J. Perez Laspiur, J. L. Burton, P. S. D. Weber, R. N. Kirkwood, and N. L.
Trottier, ”Short communication: Amino acid transporters in porcine mammary
gland during lactation” J. Dairy Sci. 2004 87:3235—3237.

Authors typically use a statement along the lines of “Used by permission of the
volume, and pages.

Sincerely,

Susan Pollock
Managing Editor
Journal of Dairy Science

230

 

CANADIAN JOURNAL OF ANIMAL SCIENCE
CANADIAN JOURNAL OF PLANT SCIENCE
CANADIAN JOURNAL OF SOIL SCIENCE

PUBLISHED BY THE AGRICULTURAL INSTITUTE OF CANADA

Michigan State University

2209 Anthony Hall

East Lansing, MI 48824

27 November 2007

Re: Kirkwood et al. 2007. Mammary gland biopsy does not affect lactation
performance in sows. Canadian Journal of Animal Science Vol. 87 pages 281-284.
Dear Ms. Pérez Laspiur:

This letter is to formally give you permission to include the above paper in your PhD

thesis. This paper was originally published in Canadian Journal of Animal Science,
published by the Agricultural Institute of Canada.

Yours sincerely

flit/0100

Tim Fenton

Head, Journals Section

Agricultural Institute of Canada

Suite 900, 280 Albert St, Ottawa, ON.

231

 

EEEEEEEEEEEEEEEEEEEEEEEEEE

Ill/Ill Ill/lllll11211111111ill/ll!

3 1293 0 956 7694