l , LIBRARY
jwi” Michigan State
University I

This is to certify that the
thesis entitled

CLONING AND EXPRESSION OF A CORTICOID
RECEPTOR IN THE SEA LAMPREY (Petromyzon man'nus)

presented by
Chu-Yin Yeh

has been accepted towards fulfillment
of the requirements for the

MS. degree in Physiologx

 

 

 

 

MSU is an affinnative-action, equal-opportunity employer

—A-. -oan-o-v---o-v----I------------n-

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

5/08 K1lProyAcc8PrelelRC/DateDue.indd

CLONING AND EXPRESSION OF A CORTICOID RECEPTOR
IN THE SEA LAMPREY (Petromyzon marinas)

By

Chu-Yin Yeh

A THESIS

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

MASTER OF SCIENCE
Department of Physiology

2008

ABSTRACT

CLONING AND EXPRESSION OF A CORTICOID RECEPTOR
IN THE SEA LAMPREY (Petromyzon marinas)

By
Chu—Yin Yeh

The sea lamprey, an Agnathan species (jawless fish), is one of the most important
animal models for studying the evolution of steroid receptors. It has been postulated that
sea lampreys regulate stress and salt and water homeostasis through a single corticoid
receptor while jawed vertebrates use glucocorticoid receptors and mineralocorticoid
receptors to mediate similar physiological responses. The purpose of this study was to
understand how steroid receptors evolved at the stage ofjawless vertebrates through
characterizations of an ancestral corticoid receptor in the sea lamprey. A partial sea
lamprey corticoid receptor cDNA was cloned and expressed in mammalian cells along
with a luciferase reporter system. The cloned sea lamprey corticoid receptor was
activated by multiple ligands, most effectively by ll-deoxycortisol and
deoxycorticosterone. Furthermore, regulation of corticoid receptor signaling was
Observed through splice variants and tissue specific levels of transcription. The sea
lamprey corticoid receptor shares similarities with other steroid receptors in higher

vertebrates both functionally and structurally.

3; my mot/792‘, {am 716iu~ Claimfir Fer [ova and-When;
to my fiareJtfi-z'enfi antl'famz'lj memfi'ero‘, for tFeir “effort mill-for (1/qu

”and?!” [aside me.

iii

ACKNOWLEDGMENTS

I’d like to give my most appreciation to my committee members, Weiming Li,
Richard Miksicek, and Cheryl Sisk. Their support is what made this project possible.
Especially, I’d like to thank Dr. Weiming Li for his mentoring and support. During the
entire period of my master’s degree, Weiming has not only provided me directions for my
thesis, he has also been considerate for my career goal, my education, and my life. I’ve
encountered many difficulties in the last two years. Weiming has served as a PI to help
me solve problems in this project, as a teacher to guide me through my education, and
most importantly as a friend to support my ideas and to encourage me in every sense.

Also, I’d like to thank Dr. Richard Miksicek and Emily Flynn for their assistance
and collaboration. Most of my thesis work was done in Dr. Miksicek’s lab. Their support
made my life and this work much easier and better. Especially, Richard has always been
very patient to teach me any technique I’ve encountered. He has also been very generous
to share any experience he’s had in research life and academics.

Moreover, I’d like to thank my colleagues in the Li lab, for everyone’s great ideas
and help. Discussions generated in this team really explored my views and ideas about
my thesis.

Lastly, I’d like to thank the supports by NSF JOB-0450916 and Great Lakes Fishery

Commission as well as US. Fish and Wildlife Service personnel who provided animals.

iv

TABLE OF CONTENTS

LIST OF FIGURES ................................................................................. vi
ABREVIATION .................................................................................... vii
ABSTRACT ............................................................................................ 1
INTRODUCTION ..................................................................................... 2
MATERIALS AND METHODS ................................................................... 6
Animals and Tissue Collection .............................................................. 6
RNA Extraction and Quantitative RT-PCR .............................................. 7
Molecular Cloning of Corticoid Receptor ................................................ 8
Cell Culture, Transfection, and Luciferase Reporter Assays ........................ 9
Immunohistochemical and Cytochemical Analysis ................................... 12
Statistics ....................................................................................... 13
RESULTS ............................................................................................. 14
Cloning of a Partial Sea Lamprey Corticoid Receptor .............................. 14
The Response of CR12 to ll-DC and Validation of Reporter System ............. 23
Screening for Potential Ligands for the Sea Lamprey Corticoid Receptor ...... 25
Concentration Response Relationships of Active Ligands for CR12 .............. 27
Nuclear Localization of CR Variants- Effect of Lacking Exon 7 on CR .......... 28
Ligand Independent Nuclear Localization of CR12 ................................... 32
Coexpression of CR12 and CR9- Enhanced Transactivation ....................... 33
Corticoid Receptor Transcript Levels in Sea Lamprey Tissues ..................... 37
DISCUSSIONS ....................................................................................... 41
REFERENCES ...................................................................................... 51

LIST OF FIGURES

Fig. 1 Alignment of Genomic Consensus cDNA Sequence, AY028457 and CR12
Sequence ............................................................................................. 16

Fig. 2 Predicted Amino Acid Residue Sequence Of the Genomic Consensus cDNA, CR12,

CR9, and CR1. ...................................................................................... 20
Fig. 2a: Alignment of Predicted Amino Acid Residues of Genomic Consensus
Sequence and CR12 ......................................................................... 21
Fig. 2b: Alignment of Predicted Amino Acid Residues of
CR12, CR9, and CR1 ....................................................................... 22

Fig. 3 CR12 Response to ll-DC ................................................................. 24

Fig. 4 Screening of Ligands for the Sea Lamprey Corticoid Receptor. ..................... 26

Fig. 5 Lack of Endogenous Corticoid Receptor Response to Ligands in HeLa Cells. .....29

Fig. 6 Concentration Response Curves of the Corticoid Receptor ............................ 30
Fig. 7 Concentration Response Curves of Exon 7 Deleted Splice Variants .................. 31
Fig. 8 Immunostaining of CR12 and CR9 ....................................................... 34
Fig. 8a: CR12 No Hormone ............................................................... 35
Fig. 8b: CR12-V5 No Hormone ........................................................... 35
Fig. 8c: CR12-V5 ll-DC Treated ......................................................... 35
Fig. 8d: CR9-V5 No Hormone ............................................................ 35
Fig. 8e: CR9-V5 ll-DC Treated ........................................................... 35
Fig. 9 Effect of Splice Variant CR9 on CR12 .................................................... 36
Fig. 10 Tissue Distribution of the Corticoid Receptor in the Sea Lamprey .................. 39
Fig. 10a: CR Transcripts in Tissues at Different Life Stages ........................ 39
Fig. 10b: Life Stages of the Sea Lamprey ............................................... 40

vi

ABREVIATION

(A) Aldosterone

(AF -1) Activation Function 1

(CR) Corticoid Receptor

(CC) Corticosterone

(C) Cortisol

(PCR) Polymerase Chain Reaction
(DBD) DNA-Binding Domain

(1 l-DC) l l-deoxycortisol

(DEOC) Deoxycorticosterone
(ER) Estrogen Receptors

(GCS) Glucocorticoids

(GR) Glucocorticoid Receptor
(LP) Large Parasitic-phase lampreys
(LBD) Ligand-Binding Domain
(MR) Mineralocorticoid Receptor
(mya) Million years ago

(N TD) N-terminus Domain

(N LS) Nuclear Localization Signal
(PSM) Pre-spermiating Male
(l7-OH P) l7-OH Progesterone
(PRE) Progesterone Response Element
(P) Small Parasitic-phase lampreys
(SM) Spermiating Males

vii

ABSTRACT

Studies of sea lamprey nuclear receptors have implications in evolutionary
endocrinology of vertebrates. It has been postulated that sea lampreys use a single
corticoid receptor to regulate salt and water homeostasis and stress responses while jawed
vertebrates mediate those responses through both glucocorticoid receptors and
mineralocorticoid receptors. A partial sea lamprey corticoid receptor cDNA (CR12) was
cloned and expressed in HeLa cells along with a luciferase reporter system. CR12 was
activated by multiple ligands at physiological concentrations in cell culture. The most
potent ligands were 11-deoxycortisol and deoxycorticosterone at 3 nM. CR12 was
nuclear localized independent of ligands and independent of serum. Splice variants
missing exon 7 were not nuclear localized and were unable to transactivate the reporter
gene; however, they were found to modulate CR12 transactivation in the presence of
ligand. Real-time quantitative PCR results suggested that corticoid receptor expression
level was highest in testes of lampreys at the parasitic stage and second highest in gills at
the Spermiating stage. The expression level of corticoid receptor was not significantly
different in whole brain or in liver across different life stages. This data suggested that an
ancestral sea lamprey corticoid receptor was functional and regulated at the
transcriptional and post-transcriptional levels. These regulations may be involved in the

regulation of stress responses and water and salt homeostasis.

INTRODUCTION

The sea lamprey (Petromyzon marinus), one Of the extant jawless vertebrates, goes
through a spawning migration from the Great Lakes or ocean to fresh water rivers and
streams (Tufts 1991). This behavior is similar to the spawning migration in salmonids
(Tufts 1991). In salmonids, the spawning migration requires salt and water homeostasis,
which includes osmoregulation by various hormones including cortisol (reviewed by
Makino et a1. 2007). The sea lamprey is also the most ancestral vertebrate known to
maintain water and salt homeostasis. Unlike in teleostean fish (bony fish), in the sea
lamprey, extensive Polymerase Chain Reaction (PCR) failed to amplify any
mineralocorticoid receptor (MR) ortholog (Thornton 2001). In fact, based on the
hypothesis that the important steps in evolution Of steroid receptor subfamily arose
through gene duplication about 450 million years ago (mya), which occurred after the
divergence of Agnathans (jawless fish) from jawed vertebrates about 470 mya (Bridgham
et a1. 2006), sea lampreys only contain a single corticoid receptor (CR). Furthermore, the
sea lamprey CR sequence was previously found to be similar to both glucocorticoid
receptors (GR) and MR of other vertebrate lineages in a phylogenic analysis (Thornton
2001). It is reasonable to propose that this primordial CR plays multiple physiological
roles in jawless vertebrates such as the sea lamprey. In contrast, among jawed vertebrates,

these physiological roles are mediated through separate receptors, GR and MR, involved

in response to various forms of environmental and physiological stress. Molecular
characterization of CR in sea lampreys may reveal how sea lampreys maintain
homeostasis and regulate stress response through only one single CR.

In tetrapods, GR and MR are stimulated by different steroids and regulate separate
firnctions (Agarwal & Mirshahi 1999, reviewed by Stolte et al. 2006). Glucocorticoids
(GCS) acting through GR govern stress responses, and regulate cell growth and
metabolism. GC and GR also suppress the immune system when the level of GC
hormones is elevated in mammalian cells and tissues (reviewed by Stolte et al. 2006).
Among GCs, cortisol is the principle hormone that binds to GR in tetrapods. Salt and
water homeostasis on the other hand is regulated by MR in most vertebrates and
aldosterone is the major hormone that mediates MR signaling in tetrapods (Agarwal &
Mirshahi 1999).

In teleostean fish, both MR and GR are present although aldosterone is absent.
Teleostean fish lack aldosterone due to the absence of the modified cytochrome P450 11B,
an enzyme required to convert corticosterone to aldosterone by the addition of an ll-B
hydroxyl group (N onaka et al. 1995, J iang et al. 1998, Bulow et al. 2002). Cortisol seems
to regulate salt and water balance by binding to GR and MR (Bury et al. 2003, Sturm et
al. 2005, Kiilerich et al. 2007). Cortisol stimulates sodium-potassium ATPase activity in

gills to maintain ion-osmotic homeostasis under both salt water and fresh water

conditions (review by McCormick 2001). Furthermore, one study showed that
deoxycorticosterone (DEOC) is a potent ligand for MR in another teleost, the rainbow
trout (Sturm et a1. 2005). These results indicate that MR signaling is not fully defined in
teleostean fish.

In the sea lamprey, the inability to make cortisol and corticosterone (Weisbart and
Youson 1975) and the lack of any evidence for the presence of MR raise the question of
how the sea lamprey regulates stress responses and osmotic homeostasis. Lacking the
enzyme cytochrome P450 11B in the sea lamprey results in missing cortisol and
corticosterone (Bridgham et a1. 2006). In previous studies, ll-deoxycortisol (1 l-DC) and
DEOC were the only two detectable corticoids in sea lampreys (Weibart and Youson
1975, David Close 2007, a PhD thesis, Michigan State University). An in vitro binding
assay showed that ll-DC was the most potent ligand for the sea lamprey CR (David
Close 2007, a PhD thesis, Michigan State University). More interestingly, a chimeric
receptor with native ligand- binding domain (LBD) of the sea lamprey CR responded to
the same degree to both ll-DC and DEOC at 100 nM in mammalian cells (Bridgham et
al. 2006). I therefore hypothesized that both 11-DC and DEOC are potent ligands for CR
in the sea lamprey because of l) the structural similarity of 1 l-DC to cortisol and Of
DEOC to aldosterone, 2) the high affinity of DEOC for MR in rainbow trout (Sturm et al.

2005) and 3) the possibility that DEOC is the ancestral ligand for MR (Bridgham et al.

2006)

In addition, hormonal responses can be regulated not only at the level of
ligand-receptor specificity, but also at the level of transcription, post-transcriptional, and
of post-translational modulation of the receptor (Faus and Haendler, 2006). In the case of
estrogen receptors (ER), dominant positive and dominant negative effects have been
described for splice variants lacking exon 5 and exon 7 ER, respectively (reviewed by
Pfeffer et. al. 1996). I therefore hypothesized that the sea lamprey CR responses may be
regulated differentially through both transcriptional and post-transcriptional mechanisms
(for example: involving splice variants) rather than through only the specificity of ligands
along.

Previously, in vivo molecular characterizations Of CR in sea lampreys have only
been undertaken by expressing the natural LBD with a chimeric GAL4-DNA-binding
domain (DBD) (Bridgham er al. 2006). Because of the lack of complete sequence
information on the lamprey genome and the lack of a full length CR cDNA for sea
lampreys, this study provides the first analysis of the natural DNA- and ligand- binding
domains of CR. In this study, I examined the ligand specificity of several splice variants
of a native lamprey CR and determined the tissue specific expression of CR as well as its

localization.

MATERIALS AND METHODS

Images in this thesis are presented in color.
Animals and Tissue Collection

All experiments involving animals were approved by the Michigan State University
Institutional Animal Use and Care Committee. Pre-spermiating male (PSM) sea lampreys
were collected during upstream spawning migrations by US. Fish and Wildlife Service
personnel. Animals were held at the Hammond Bay Biological Station (US. Geological
Survey - Biological Resources Division, Millersburg, MI, USA) in tanks containing
approximately 160 L of continuous-flow water (2 L/ min) from Lake Huron for at least
two days prior to treatments. To obtain sperrniating males (SM), lampreys were held in
tanks until milt was expressed from the cloaca upon gentle pressure. Temperature was
maintained at 16 °C (3: 1 °C). Parasitic-phase lampreys were collected from fisherman by
USGS personnel, transported to Michigan State University (East Lansing, MI, USA) and
held at 10 °C or less until sampling. Small parasitic-phase lampreys (P) were collected in
October 2005 and large parasitic-phase lampreys (LP) were collected in January 2006.
All lampreys were anesthetized with MS-222 prior to handling. All of the animals used in
Quantitative RT-PCR had 0.9% saline injected intraperitoneally. Animals used for cloning
were small parasitic-phase lampreys collected in October 2006. Whole brain tissue, liver,

gill, and gonads were collected from each animal and frozen immediately in liquid

nitrogen. All Of the samples were stored at -80 °C before RNA extraction.
RNA Extraction and Quantitative RT-PCR

Total RNA was isolated using Trizol Reagent (Life Technologies; Carlsbad, CA,
USA), and treated with TurboDNase (Ambion; Austin, TX, USA). RNA concentrations
were measured using a NanoDrop spectrophotometer (N anoDrop Technologies;
Wilmington, DE, USA). Samples were diluted to 100 ng/ul, and reverse transcribed using
M-MLV reverse transcriptase (Invitrogen; Carlsbad, CA, USA) and random primers
(Promega; Madison, WI, USA). Quantitative RT-PCR procedures were described in Rees
and Li (2004). Reactions were analyzed on an ABI 7900HT real-time PCR thermal cycler
(Applied Biosystems, Foster City, CA, USA). The sequence for primers and TaqMan
probe (5’ 6-FAM, 3’-MGB quencher) (Applied Biosystems, CA, USA) for mRNA of
corticoid receptor are listed below. 403 ribosomal RNA was used as an internal standard
and was confirmed not to have changes in expression levels across all experiments. 5'
primer (5' TCTCTGCCAGGTTTCCGAAA 3'), probe (5' CTGCACATCGACGACC 3'),
3' primer (5’ CCAGCTCATGGCAAATGACA 3'). The amplicon which was also the
standard is listed below:
5 ’ TCTCTGCCAGGTTTCCGAAACCTGCACATCGACGACCAGATGGTGTTAATCC
AGTACTCATGGATGGGCCTGATGTCATTTGCCATGAGCTGG 3’. To produce a

standard curve, cDNA standards of 103-1010 transcripts were included in each plate.

Molecular Cloning of Corticoid Receptor

The genomic consensus cDNA sequence of CR was generated with trace sequences
(Washington University, St. Louis, USA) using DNASTAR (DNASTAR, Inc., Madison,
WI, USA). cDNA was generated by reverse transcription with oligo dT from total RNA
extracted from gills of males at the parasitic stage. Nested PCR was used as the strategy
to amplify the receptor region containing the DNA- and the ligand- binding domains. The
primer set of the first amplification used: forward primer -5’
CTCCCAATGGAGTACAACAGGATGGATTT 3’, reverse primer- 5’
CAACTAAGCACTTTCGCCAGCCACAGAG 3’. Thirty-five cycles of amplification
were carried out under the following conditions: denaturation at 92 0C for 303, annealing
at 61.5 0C for l min, and extension at 72 °C for 1.5 min. At the completion of the PCR,
products were resolved on 1% agarose gels. The primer set of the second amplification
used: forward primer had the engineered CACCATG Kozak consensus sequence 5’ of the
beginning of the DBD-LBD sequence- 5’ CACCATGCCCGCACAGTCCTCAGTC 3’,
reverse primer was the same as the first amplification. The first two cycles of
amplification were carried out under the following conditions: denaturation at 92 0C for
303, annealing at 55 °C for l min, and extension at 72 °C for 1.5 min. Following the first
two cycles, thirty-six cycles Of amplification were carried out under the following

conditions: denaturation at 92 °C for 303, annealing at 63 °C for l min, and extension at

72 °C for 1.5 min. PCR products were resolved on 1% agarose gels. The band
corresponded to size of 1.2 kb was cut out and carried on for QIAEXII Agarose Gel
Extraction (Qiagen, Valencia, CA, USA). The final product was carried on to ligation into
pcDNA3.1 Directional TOPO mammalian expression vector (Invitrogen).
Cell Culture, Transfection, and Luciferase Reporter Assays
1. Cell Culture and Preparation for Hormones

HeLa cells were kept in boxes in a liquid nitrogen tank until use. Once thawed, they
were kept in lO-cm plates in Dulbecco’s modified Eagle’s medium and Glutarnax (4.5
g/L D-glucose, L-glutamine, 110 mg/L sodium pyruvate) (Invitrogen), supplemented with
HEPES (SmM, pH7.5), Penicillin (50 U/ml), Streptomycin (50 ug/ml), and 10% of calf
serum. Plates were kept in a 37.5 °C. incubator with 5% C02 injected into the incubator.
HeLa cells were normally passaged every 3-4 days. Media was regularly changed every
other day. All of the steroids were obtained from Sigma (St. Louis, MO, USA) in powder
and stored at 4 0C. Steroids were dissolved in 80% EtOH to make 10 mM stocks in glass
vials and were stored at -20 °C. Serial dilutions (1:100) were done to make stocks at 10'4
M, 10'6 M, and at 10'8 M in glass vials which were stored at -20 0C. Stock solutions were
brought to room temperature before use.
2. Transfection Assay and Luciferase Assay

Each sample was done in triplicates in the luciferase assay. ll-DC has been found as

an active ligand for a chimeric sea lamprey CR at 100 nM (Bridgham er. al. 2006). It has
also been found to be a potent ligand for sea lamprey CR in an in vitro competitive
binding assay (David Close 2007, a PhD thesis, Michigan State University). Therefore,
ll-DC was used to validate the luciferase reporter system by conducting controls as
described in the following procedures.

Experiment Day 1: HeLa cells were seeded at 9x104 cells/well in 12-well plates in
cell culture conditions as described above for 24 hrs. Day 2: Transfection was performed
by using FuGENE 6 reagent (Roche, Indianapolis, IN, USA) 24 hrs after plating. The
FuGENE 6 to total DNA ratio was 3:2 (pl to pg). The total transfection mixture was 50 ul.
The proper FuGENE amount was added to OptiMEM (Invitrogene) and incubated at
room temperature for 5 min. DNA was then added to the OptiMEM-fugene mixture and
incubated at room temperature for 20 min. Transfection mixture was added directly to
each corresponding well dropwisely. The first well of each plate was always not
transfected to serve as the background for luminescence measurement. The amount of
DNA used is listed as following: 500 ng of pGL3-promoter vector (Promoga, 5010bp)
containing 1.6 kb firefly luciferase gene driven by SV4O promoter was transfected to
wells that served as a constitutive positive luciferase control. 20 ng of pRL-CMV vector
(Promoga, 4079bp) containing 936bp Renilla reniformis luciferase gene driven by CMV

enhancer and immediate early promoter was transfected along with pGL3-promoter

vector or other firefly luciferase vector as internal controls for variations in transfection
efficiency. 600 ng of pGEM-TK-Luc vector (Emily Flynn, Michigan State University,
USA) containing firefly luciferase gene driven by HSV-TK promoter, 40 ng of
pcDNA3.1-CR12 (CR12) containing corticoid receptor driven by CMV promoter in
pcDNA3.1 vector (Invitrogen), and 20 ng of pRL-CMV were transfected as the negative
response element control. 600 ng of pPRE-TK-Luc vector (Emily Flynn, Michigan State
University, USA) containing one copy of progesterone response element, and firefly
luciferase gene driven by HSV-TK promoter, 40 ng ofpcDNA3.1DN5-His/lacZ
(Invitrogen) were transfected as a negative receptor control. 600 ng of pPRE-TK-Luc, 80
ng of pGR.1 (Richard Miksicek, Michigan State University, USA) containing
glucocorticoid receptor from rats were transfected as a positive control of pPRE and
expression system. 600 ng of pPRE-TK-Luc, and 40 ng (or as indicated in figure legends)
of CR12, pcDNA3.1-CR9 (CR9), or of pcDNA3.1-CR1 (CR1) were transfected for
hormone induced experiments. Cells were incubated in the cell culture conditions
described above for 24 hrs after transfection. Day 3: 24 hrs after transfection, hormone
treatments were performed. Media of each well was aspirated off. Cells were then washed
with 1X PBS (lml per well for 12-well plates). PBS was aspirated off and fresh phenol
red free DMEM (Invitrogen) supplemented with 5% charcoal/dextran treated fetal bovine

serum (Hyclone, USA), HEPES (SmM, pH7.5), Penicillin/Streptomycin, and

11

L-Glutamine (2mM), containing ethanol vehicle or hormone was then added to each well.
Cells were incubated for another 24 hrs before assaying. Day 4: 24 hrs after hormone
treatment, media was aspirated off and cells were washed with 1X PBS. Dual-G10
Luciferase Assay System (Promega, Madison, WI, USA) was used to collect cells and to
measure luciferase activity by a chemiluminescence assay. The Dual-G10 luciferase lysis
buffer was added to the Dual-G10 luciferase substrate to reconstitute the luciferase
reagent on the day of assaying. The 96-well plates were used for measuring light units in
the luminometer. Firefly activity to Renilla activity ratio was calculated and reported.
Immunohistochemical and Cytochemical Analysis

HeLa cells were plated and transfected directly on glass cover slips in 12-well plates
at a density of 5x104 cells per well. Cell culture and transfection conditions were the
same as noted for the luciferase assay. 660 ng of CR12, pcDNA3.1-CR12-V5 (CR12-V5),
or of pcDNA3.1-CR9-V5 (CR9-V5) was tranfected 24 hrs after plating. 24 hrs after
transfection, ll-DC (10 nM), DEOC (10 nM), or ethanol vehicle was used to treat cells
for 15 min, 30 min, 1 hr, 2 hr, or 4 hr. After treatment with hormone or ethanol vehicle,
1x PBS wash was applied. Cells were then fixed with 4% paraformaldehyde in PBS for
15 min. Fixed cells were washed with 1x PBS. Normal goat serum in PBS containing
0.2% Triton X—l 00 was added for 30 min to block non-specific binding. 1:1000 mouse

anti-V5 antibody (Invitrogen) in blocking buffer was added for 1 hr incubation at room

12

temperature. Three 1X PBS washes (20 min per time) were administrated. 2 ug/ml of
secondary Alexa F luor 594 Goat-anti—mouse IgG (Invitrogen) was applied in blocking
buffer for 1 hr in the dark. Three 1X PBS washes (5 min per time) were administrated.
Cover slips were mounted directly onto glass slides by using the Prolong Gold Mounting
Media with DAPI (Invitrogen). Slides were kept in the dark if not in use. Slides were
viewed and pictures were taken using a fluorescent microscope, Zeiss Axioskop 11 (Zeiss,
Thomwood, NY, USA).
Statistics

Statistical analyses were performed using StatView (SAS Institute, NC, USA). For
data from quantitative RT—PCR, a one-way ANOVA test was used to compare the
difference among different stages and different tissues. Fisher’s PLSD was used to
analyze significant difference between any two groups and data were noted when P<0.05.
Student’s T test was used to analyze data from luciferase assay and P value was reported

as indicated in figure legends.

13

RESULTS

Cloning of a Partial Sea Lamprey Corticoid Receptor

A 1203 bp fragment of the sea lamprey CR, CR12, was amplified from sea lamprey
gill cDNA by PCR. This fragment that included complete exon 2 through exon 8 of CR
contained the DBD, the hinge region containing the nuclear localization signal (N LS),
and the LBD. Because of the lack of a natural start codon of this partial corticoid receptor,
this fragment was added with an engineered Kozak consensus sequence for mammalian
expression followed by the beginning of the exon 2, where the DBD starts (Fig. 1). The
hinge region that contains the NLS was in between the DBD and the LBD. By comparing
to the AY028457 (GenBank) sequence, a partial CR amplified by degenerative PCR,
CR12 was trimmed at the 5’ end to exclude the region that is not in the DBD (Fig. 1). I
generated a genomic consensus cDNA sequence based on trace sequences of the sea
lamprey genome and compared it with CR12 and AY028457 (Fig. 1). The genomic
consensus cDNA sequence of the sea lamprey CR included the N-terrninus Domain
(NTD) of CR that was not included in CR12 (Fig. 1, 2a). This made CR12 about 240
amino acid residues shorter than the predicted peptide from the genomic consensus
cDNA sequence (Fig. 2a).

Splice variants CR9 and CR1 were found and cloned along with CR12 by PCR.

There are 8 exons in the sea lamprey CR that encode four major functional regions: the

14

NTD, the DBD, the NLS, and the LBD. Exon 7 encodes a portion of the LBD. CR9 had
the complete exon 7 deleted compared to CR12 while CR1 had the full exon 7 and most
of the exon 8 deleted (Fig. 2b). The deletions in both of CR9 and CR1 were out of the
open reading frame which caused completely different amino acid residues at the
c-terminus of the exon 7 (Fig. 2b).

Furthermore, there was an in-frame 12-bp (4 amino acid residue) insertion in CR12
compared to the genomic consensus sequence and AY028457 ((Fig. 1, 2a). This 4 amino
acid residue difference was supported by three individual clones, CR1, CR9 and CR12,
with sequence information from sequencing both upper and lower strands (Fig. 2a, b).
There were three silent mutations in AY028457 compared to CR12 and the genomic
consensus cDNA (Fig. l). The uncertainty of two locations in AY028457 reported as
purines was clarified in CR12 as indicated (Fig. 1). At the end of the CR sequence before
the stop codon, there was a single base pair frame shifting deletion in both ofAYO28457
and CR12, although they were not in the same position (Fig. 1); these deletions caused
differences in 6 amino acid residues of the open reading frame. However, the genomic
consensus cDNA agreed to the CR12 sequence rather than AY0284567 (Fig. 1, 2a). The
frame shift was not likely to alter the functional domains of CR. Overall, the sequence of
CR12 agreed to the genomic consensus cDNA except for the 12 bp in-frame insertion in

CR12 (Fig. 1, 2a), which was not likely to affect the functions of CR.

15

Fig. 1 Alignment of Genomic Consensus cDNA Sequence, AY028457 and CR12
Sequence.

The genomic consensus sequence (first line) was generated based on trance sequences;
only the CR coding region was aligned here. AY028457 (second line) is a partial sea
lamprey CR sequence (GenBank). CR12 (third line) is a partial sequence of the sea
lamprey CR cloned into pcDNA3.1 expression vector; this fragment of cDNA sequence
containing DBD and LBD of corticoid receptor along with the Kozak consensus sequence
was cloned. The CR12 sequence was compared with the published AY028457 (GenBank)
sequence and the genomic consensus sequence of the sea lamprey CR. The fourth line
represents the consensus sequence based on all of the three sequences. Black indicates
sequences based on single evidence. Blue indicates sequences based on two out of three
sequences. Red indicates that all of the three sequences agree. Two nucleotides in
AY028457 were sequenced as either of an adenine or a guanine (indicated as R in black).

 

 

 

Fig. 1: CR Sequences Alignment

GENDHIC
AY028457
CR12
Consensus

GEHDHIC
AY028457
CR12
Consensus

GENDMIC
AY028457
CR12

GENDHIC
AY028457
CR12

GENDHIC
AY028457
CR12

GENDHIC
AY028457
CR12
Consensus

GENDHIC
AY028457
CR12

GEHDHIC
AY028457
CR12
Consensus

GENDNIC
C812

1 10 20

0.0.0.0....0.00.00..0....0.00....O...0.0.0.0.000...OOOOOOOOOOOOOOOOOOOOOOCO

76 85 95 105 115 125 135 145 150

~# I

AGCAGCAGCAGCAGCAACAGCAGCAGCAGCAGTCTCBGCAGCTTCATCAGCAGTCAGCAAATATTTCTBTGAAAC

0.0.000...OOOOOOOOOOOOOOOOOOOOO0.0.0.0.0000...00......OOOOOOOOOOOOOOOOOOOOO

151 160 170 180 190 200 210 220 225
I
AGGAGAAACAACAGCCACAGCAACBTTCAGAAACACATBTTTTGATGAAACCAGAAGCTGACETTGEAGCAGATT

 

0.0.0.0...0.00....OOOOOOOOOO...0.00......0....0.0000.90.900.00.00.0.0000...

226 235 245 255 265 275 285 295 300
I I
6TAGCCACTTCTCTCATEGAAACATGCAGCCAAACAGECCAATTAAGBTGGAGCCCCABTCGTTCEAGAGTCCET

IF

0000......OOOOOOOQOOOOOOOOOOOOOOO.90.....0000.0..OOOOOOOOOOOOOOOO00.0.00...

301 310 320 330 340 350 360 370 375
I I
CAGAATATGGGBGACCTCAGCTGATGGBTTTTGATTCGAATTTACACACATACGBBGACATGGACTCCAGTGCGA

 

0....0.....00..0....0.0.0.0....OOOOOOOOOOOOO0.0.0.0.0000...OOOOOOOCOOOOOOOO

376 385 395 405 415 425 435 445 450
I I
GGCACGCAGAAAGGGGGGCATTTCCGGGTCCGTCCAGGGGTGACACCACTGCGAGTCGTGCCAACGTCAAAGAEG

 

0.0.0.0....0...CO0.0...OOOOOOOOOOOOOOOOOOOOOO...0.0...OOOOOOOOOOCOOOOOOOOOO

451 460 470 480 490 500 510 520 525
I t I
AAGACTCBGBTTGTGATTTACACATCTGCACGCCEEGCBTGCTTAAGAGAGAGTTGGATGAACTCAGCTACTGCE

 

0.0.0.0...09.0.....900...O...0.000......O...OOOOOOOOOOOOOOOOOOOOOOO00......

526 535 545 555 565 575 585 595 600
I = I
CCATGABTATGAGCACATCCGTGGCAGCBGGCTCCCCATTCGTGGAAGGBGTGBAGTTTCAGTTGCCCTACTCGG

EGGTGGAGTTTCAGTTGCCCTACTCGG

 

OOOOOOOOOOOOOOOOOO000.0...O.0..O.0.023..OOOOOOOOOOggg‘t‘gthttcagttgmtcgg
601 610 620 630 640 650 660 670 675

| L n n 1

I
CATCTGCCACATCCTTTCBTCCGTCCGTTGCCACCTCGTCCGCCTCGGGCATCTCCAAC|||ICAAATGGGAATA
CATCTGCCACATCCTTTCBTCCGTCCGTTGCCACCTCBTCCBCCTCGGGCATCTCCAACTTTTCAAATGGGAATA

catctgccacatcctttcgtccgtccgttgccacctcgtccgcctcgggcatctccaacttttcaaatgggaata

17

Fig. 1: CR Sequences Alignment, Continued

850111:
AY028457
CR12
Consensus

GENDHIC
AY028457
CR12

GENUHIC
AY028457
CR12

GENDHIC
AY028457
CR12

GENDHIC
AY028457
CR12

GENDHIC
AY028457
C812

GENDHIC
AY028457
CR12

GENDHIC
AY028457
CR12

GENDHIC
AY028457
C812

676 685 695 750
I t he : . - ~. . I
ATTTTBGATTCCTTTCTCCCAATGGAGTACAACAGBATGGATTTCCTTACCCTGGTTTCACGAGTCCCGCACAGT

ATTTTBGATTCCTTTCTCCCAATGGAGTACAACAGGATBGATTTCCTTACCCTGGTTTCACBAGTCCCBEACAGT

705 715 725 735 745

_ ECGCACAGT
attttggattcctttctcccaatggagtacaacaggatggatttccttaccctggtttcacgagtCCCGCACAGT
751 760 770 780 790 800 810 820 825

 

l A l L l
t

1 1 1 . . . I
CCTCAGTCCCTCCECAEAAGBCETGTCTCATCTBTAGTBATGAGEETTCGGGCTGCCACTACGGAGTBCICACCT
CCTCAGTCCCTCCBCAGAAEBCGTGTCTCATCTEIAETBATGAESCTTCBGECTGCCACTACGEAETGCTCACCT
CCTCAGTCCCTCCBCABAAEECGTGTCTCATCTGIAGTEATGAEGCTTCSSBCTGCCACTAEGEAGTGCTCACCT
CCTCAGTCCCICCGCAGAAUGCGIGTCTEATCTEIAGIBATGAEGCTTCEGECTGCCACTACGGAETGCTCACCT

875 885 895 900
. . - : s «r I
GTGBAAGCTGCAAGGTGTTCTTCAAGCGTBCCGTGBAAGC ACAGCACAATTATCTGTGEGCCG
GTGGAAGCTGCAAGSTGTTCTTCAAGCGTGCCGTBEAAGC ACABCACAATTATCTGTGCGCCB
GTGGAABCTBEAABUTBTTCTTCAABCGTBCCSTBBQQEGTACECGACAAGGACAGCACAATTAICTGTBCGCCG
BTGGRABCTECAAEGTBTTCTTCAABCGIBECGTUUAABG............ACAGCACAATTATCTGTBCBCCG

910 930 940 960 970 975
I r . s r s t e I
GACBAAATGACTGCATCATTGACAAGATCCGCCGCAAGAACTGCCCABCTTGCCGTCTGCGCAAGTGCATCCAGG
GACGAAQCGACTGCATCATTGRCAABATCCBECGEAAGAACTGCCEAGCTTGECGTCTUCGCAABTGCATCCAGG
GACGAAATGACTGCATCATTGACAGGATCCGCCBCAQGQACTGCCCAGCTTBCCGTCTGCBCAQGTGCATCCAGG
GACBAAAtBACTBCATCATTGACAAGATCCGCCBCAABAACTGCCCABCTTGCCGTCTGCGCAAGTGCATCCAGG

976 985 1025 1035 1045 1050
I t . - . s : t I
£88699TGRCGCTAGGAGCACGCAAGCTTAAGAASCRAEBCCBGGTAAABGBAGABAACCABCGEAGCCCAGCGT
CTUBAATGACGETAGGAGCACGCAAGCTTAAGAABCAABBCCGBBTAARGEGAGQBAACCAGCGCABCCCAGCGT
CGBEAATGACGCTAGGABEACBCAAGCTTAAGARGCAAGGCCBGGTAAABSDAGAGAQCCABCGCABCCCAGCGT
CgEBAATBACGCTAGGABCACBCAAGCTTAAGAHGCAAGGCCGGBTAAAGGBAUAGAACCABCGCABCCCAGCBT

1051 1060 1070 1120 1125
I e s . . 4. . s I
CCTCCAEABCCACCAGCTCGTCTBCCACCCCGCAACCCTCCAGCAACTCBACBGCCGTGACCACGTTCTCGCCAC
CCTCCACABCCACEACCTCSTCTGCCACCCEGCAACCCTCCAGCAACTCGAEBGCCGTUACCACGTTCTCBCCAC
CCTCCACABCCACCACCTCGTCTUCCACCCCBCAQECCTCCABCAACTCBACGGCCGTBACCACGTTCTCBCCAC
CCTCCACAGECACCACCTCGTCTDCCACCCCGCAACCCTCCABCAACTCBAEBGCCGTCACCAEBTTCTCBCCAC

1126 1135 1185 1195 1200
I e . . . - s t I
CGCCGACCGGAGAGCCCATTTTCTCACCCACACTEATCGCCATCCTBCABBCGATCBABCCCBAGGTGGTCATBT
CGCCBAECBBAGAGCCCATTTTCTCACCCACACTCATCGCCATCCTBLABGCGATCGAGCCCUAGGTGGTCATGT
CBCCGACEBGABAGCCCATTTTCTEACCCACACTCATCGCCATCCTBEABBEGATCGAGCECBABGTBGTCATET
CGCCGACCGGAUAGCCCATTTTCTCACCCACACTCAICGCCAICCTGCABGCBATCGAGCCCBAGGTGBTCATGT

1201 1210 1220 1230 1240 1250 1260 1270 1275
I e a: s : 4 : s I
CCBSCTATGACAACACGCGGTCCCASACCACCGCCTACATGCTGTCGAGECTCAACCGCCTCTGCBACAQBCASC
CCGGCTATBAEAACAEGCBGTCCCAGACCACEBCCTACAIGCTGTCGAGECTCRACCBCCTCTGCGACAAGEAGC
CCGBCTATGACAQCAEGKBGTCCCABACCACCBCCTACATBCTGTCEAGCCTCAACCBCCTCTGCBACAQGCAGC
CCGGCTATGACAACACGCBGTCCCAGACCACCGCCIACATGCTBTCGABCCTCAACCBCCTCTGCGACAABCAGC

1276 1285 1315 1345 1350
I e . . e . . e I
TESTGTCCATTGTCAAGTGBBECAAGTCTCTGCCABETTTCCGAAACCTGCACATCGACGACCAGATGGTGTTAA
TCGTBTCEATTGTCAAGTGBGECAQGTCTCTGCCAGGTTTCCGAAACCTGCACATCGACBACCAGATGGTUTTAA
TCGTGTCCATTBTCAAGTGGGCCAAGTCTCTBCCAGGTTTCCGAAACCTGCACATCGACBAECAGATGGTGTTAA
TCGTGTCCATTGTCAAGTGBGCCAAGTCTCTGCCAGGTTTCCGARAGETGCACATCGACBACCAGATBBTGTTAA

826 835 845 855 865

1 I l l
I

 

 

901 920 950

995 1005 1015

1080 1090 1100 1110

A A

1145 1155 1165 1175

L l

 

1295 1305 1325 1335

l

18

Fig. 1: CR Sequences Alignment, Continued

GENUHIC
8Y028457
CR12
Consensus

GENUHIC
8Y028457
CR12

GENUHIC
9Y028457
CR12
Consensus

GENDHIC
AY028457
CR12
Consensus

GENUNIC

GENflflIC

AY028457
CR12

GENDHIC

GENOHIC
8Y028457
CR12

1351 1360 1370 1380 1390 1400 1410 1420 1425
I n 1 1 '
TCCQGTRCTCQTBEQTBGBCCTGQTGTCRTTTBCCQTGQHCTCCQFGTCCTTCCQBCHLQFCRQFQHCQP CTGC
TCCQGTRCTCQTGURIGIGCC[BRIGICQTTTBCCQTGQLCTGPQFGTCCTTCCQUCQFQCCQQCQb QQQCTBC
TCCQGTQCTCQTCGRIUGGCCTBGTBTCQTTTFLCQTGQbCTBfGbBTCCTTCCQB HCRCCRRCQCCQQSCTGC
TCCQETQCTCQTGGQT6666CTGRTGTCQTTTGCCQTBHBCTBGQCGTCCTTCCPBCQLQCCRQCRGCQQSCTBC

 

1426 1435 1445 1455 1465 1475 1485 1495 1500
I : : : : : : : I
TCTQCTTTGCTCCTBRTCTGGTTTTTGRTSQGQCBCECQTDCRGCQGTEBECBRTGTnTCfinTTGTGCGTGBfinn
TCTQCTTTGETCCTGRTCTBGTTTTTBATBQEQCGCBCQTGCQGCfiRTCBBCGQTGTQTCQRTIBTGCGTSQG88
TCTRCTTTBCTCCTGQTETBGTTTTTGQTGHGQCBCGCQTBCHGCAGTCDGCGQTGTRTCQHTTBTBCBTBGHQR
TCTRCTTTGCTCCTGQTCTGGTTTTTGQTGQSRCGCBCRTGCAGCQgTCGGCGnTGTnTCnQTTGTGCGTGGfinn

1501 1510 1520 1530 1540 1550 1560 1570 1575
l % ‘ ‘ ‘ - l
TCQCGCQHBTCTCGGQfiGfiCTTLQTGQEGTTBCQfiGTCQfiTTCRBHGFQGTTTCTBTGCQTGPQHGCEQTCTTGC
T68sGFRQGTCTCGbRCFQCTTERT HGTTGLQHGTCRCTTCQFRCGQGTTTCTGTCLRTGQ IHBELRTCTTGC
TthuCfiAFTCTLBuHJGRLTTCQIBHHGTTGCQRGTEQCTTCRLsGBRGTTTCTBTGCRTCHfiAuCCRTCTTGC
TGGSGCRfiETCTCGGQGBQCTTCRTGQRGTTBCQQGTCQCTTCQBAGGRETTTCTGTGCRTGOQRGCCQTCTTGC

1576 1585 1595 1605 1615 1625 1635 1645 1650
I : : : : : 1 : I
TCCTGQGTRCTGTCCCnCnnG RGGGTCTGRQGHGCCQSEGCTBCTTCBQGSQQQTBCGGRTCQBCTQCQTCCGBG
TCCTGRGTRCTBTECCRCQfibHGLbTCTLARLHECCRBEUCTFCTTCGQBFFGRTGLGGQTCQGCTQCQTCCBFG
ICCTGRBTQCTBTCCEACAfibH:BbTLTCQQ HDLCQBLGCTBCTTCCRUFHQQTECGmnICQEETnCnTCCEGG
TCCTGGGTRCTGTCCCQEQQLQUGBTCTGQQLRBLCRGDQCTGCTTCGQ BeanTBEEGRTCOSCTRCATCCBGG

1651 1660 1670 1680 1690 1700 1710 1720 1725
I ‘ ‘ ‘ I
QQTTGGQCCGBQCCQTCBCBCGBRCGGQGQQGQQTGCCBTBCQGTGTTGBC SCGCTTCTQCCQGCTCQCCQQGC
QRTTBQRCCBGQCCRTCGCECFPQCEBQUQQGHQTGUESTECHGTGTTFBLQUEGETTCTQCCHFCTCQCCQQBC
RQTTGQQCEBBRCERTCGCGCBGRCBGQBQQBRQTBCCGTGCRBTGTTBBCQBCGCTTCTRCCQECTCRCCQQGC
RATTBRQCCBGQCCQTCGCBCBGQCGSQBQQERQTGCEGTBCQGTGTT6SCRGCBCTTCTRCCRGCTCQCCRQBC

1726 1735 1745 1755 1765 1775 1785 1795 1800
I : 1 : # 4 1 : I
TGCTBGQCTBCQTGCQGGQTCTCGTBQGEQQGCTCCTGBQGTTCTGETTCGCQQCCTTCQCGCQBQCGCAGGTBT
TGCTGSRCT6C9TBCQBGQTCTCGTGQGCQQGCTCCTGBQGTTCTGCTTCGCQQCETTCQCGCRBQCBCQEGTBT
TBCTBEQCTGCRTGCQBGQTCTCBTBRGCQRGETCCTGBQGTICTGCTTCGCRQCCTTEQCGCQURCBCQSGTGT
TGCTGGaCTBCnTGCHGBRTCTCBTGQGC9868TCCTGGQBTTCTGCTTCBCRGCCTTCRCGCQBRCBCQGGTGT

1801 1810 1820 1830 1840 1850 1860 1870 1875
I : e : %~ 1 : : I
GEQETGTGGQGTTTCCTBQCQTGQTBBCCGQGQTCATCQGTBCGCABCT-GCCTCGCQTCRTBBCCGBRGQQGCC
GGQGTGTGGQGTTTCCTBRCQTGQTGBCCGGBRTCQTCQGTGCBCQGCTTBCCTCGCRTCATGBECG—QGQRGCC
BGRBTGTBDRGTTTCCTBRCRTBRTGGCCBQBQTCRTCQGTBCGCQGCT-GCCTCGCQTCRTGBCCGBQBRABCC

EGGGTGTGBRBTTTCCTBQCQTBRTGGCCGQBRTCRTCRGTBCDCRGCT.BECTCBCRTCQTGBCCGgQBRQGCC

1876 1885 1895 1905 1915 1925 1935 1943
I ‘ I
BGCHCTCCRCTTCCQCRQGQQQTBfiGTCQCCCCTCTGTGGCTGGCCAQABTGCTTGQTTGTCGGBT
CGGGCQCTCCQCTTCCQCRQGRHQTGQ
CBBBCQCTCCRCTTCCAC905980TGaGTCRECCCTCTGTGGCTGBCBQQRGTGCTTAGTTG
CGGGCQCTCCRCTTCCRCRAB898TGngtcacccctctgtggctggcgaaagtgctt..ttg......

 

 

 

 

 

 

19

Fig. 2 Predicted Amino Acid Residue Sequence of the Genomic Consensus cDNA,
CR12, CR9, and CR1.

a, alignment of the predicted amino acid residues of the genomic consensus cDNA and
CR12. Amino acid residues of the genomic consensus sequence (first line) was aligned
with those of CR12 (second line). b, predicted open reading frames of CR12 (bold), CR9
(underlined), and CR1 were aligned. These amino acid sequences were translated based
on both upper and lower strand DNA sequencing from individual clones. Frame-shifi of
open reading frame occurred in both CR9 (red) and CR1 (red) when exon 7 was missing.
The 4 amino acid residues that are missing in AY028457 and the genomic consensus
cDNA are in green.

20

 

 

 

Fig. 2a: Alignment of Predicted Amino Acid Residues of Genomic Consensus
Sequence and CR12

BMIC
C812

GEMINIC
C812

GMIC
C812
Consensus

GENOIIC
C812

ERNIE
C812

GMIC
C812

GEKII‘IIC
C812

 

 

 

00.000.000.000...0.0.00...C0.0.0.0000...0.00.00.0.0.0.000.0000000000000000.

76 85 95 105 115 125 135 145 150

I A

o.o000.000ononoo000o00o.no.onoooso...Co00o.ooo0o00no...00000000000000.0000.

151 160 170 180 1% 200 210 220 225

imcumcwsmnnnsmmisvmwémmrssamm
225 235 245 255 255 275 255 295 300
mmvfiumwmmj ‘ ' ' ' '

 

 

ooooooooooooooooooooz “, 5:51.. .
301 310 320

       

Ii. 1.11.5.1. .3 .I .1 UL] .~l.y.~.I}?} f. 1Mu154553.13,ial_.!'&3."J‘I52i.-§I P
376 385 395 405 415 425 435 445 450
_. I I

     

 

 

GEIIIIIC
C812
Consensus

u a lle _L._i: , . MIIL} IIQIIL'JII} LEI

 

 

Fig. 2b: Alignment of Predicted Amino Acid Residues of CR12, CR9, and CR1

(3112:Net P A 0 S S V P P 0 K A C L I C S D E A S G O H Y G V L T C G S C
CH{9: Met P A 0 S S V P P 0 K A C L | C S D E A S G C H Y G V L T C G S 0
(Hit Met P A Q S S V P P 0 K A C L I C S D E A S G C H Y G V L T C G S C
K V F F K R A V E G T R 0 G 0 H N Y L C A G R N D C I | D K I R R K N C P
K V F F K R A V E G T R 0 G 0 H N Y L C A G R N D C | I D K I R R K N C P
K V F F K R A V E G T R Q G 0 H N Y L C A G R N D C | I D K I R R K N C P
A C R L R K C | 0 A G let T L G A R K L K K 0 G R V K G E N 0 R S P A S S
A C R L R K C I D A G Met T L G A R K L K K 0 G R V K G E N 0 R S P A S S
A C R L R K C I 0 A G Met T L G A R K L K K 0 G R V K G E N 0 R S P A S S
T A T T S S A T P G P S S N S T A V T T F S P P P T G E P I F S P T L I A
T A T T S S A T P 0 P S S N S T A V T T F S P P P T G E P I F S P T L I A
T A T T S S A T P 0 P S S N S T A V T T F S P P P T G E P I F S P T L I A
I L 0 A | E P E V V Met S G Y D N T R S 0 T T A Y Net L S S L N R L C D K
I L 0 A | E P E V V Met S G Y D N T R S 0 T T A Y Met L S S L N R L C D K
I L 0 A | E P E V V Met S G Y D N T R S 0 T T A Y Met L S S L N R L C D K
0 L V S I V K N A K S L P G F R N L H | D D 0 Net V L | 0 Y S N let G L Net
0 L V S | V K W A K S L P G F R N L H I D D 0 Met V L I 0 Y S W Met G L Met
0 L V S | V K W A K S L P G F R N L H I D D 0 Met V L I 0 Y S W Met G L Net
S F A let S N R S F 0 H T N S K L L Y F A P D L V F D E T 8 Net 0 0 S A let
S F A Met S W R S F 0 H T N S K L L Y F A P D L V F D E T R Met 0 0 S A Met
S F A Met S W R S F 0 H T N S K L L Y F A P D L V F D E T R Met 0 0 S A Met
Y 0 L C V E Net 8 0 V S E D F let K L 0 V T S E E F L C let K A I L L L S
Y O L C V E Met R 0 V S E D F Met K L 0 V T S E E F L 0 Met K A I L L L S
Y 0 L C V E Met R 0 V S E D F Met K L 0 V T S E E F L C Met K A I L L L S
T V P 0 E G L K S 0 G C F E E Met 8 I S Y I R E L N R T I A R T E K N A V
T A R E O A P G V L L R H L H A D A G V E C G V F Step H D GNR D H O C A A
T V P O E Nut S H P S V A G E S A Stup

0 C N 0 R F Y 0 L T K L L D 0 Net 0 D L V S K L L E F C F A T F T 0 T 0 V
A S H H G R R S P G T P L P O E Hat 8 H P S V A G E S A Step

N S V E F P D Net let A E I I S A 0 L P R I let A G E A R A L H F H K K Stop

 

 

 

 

 

 

 

22

».
1'!
|
~ I
I
I
I
\
. ya
I

The Response of CR12 to ll-DC and Validation of Reporter System

CR12 was expressed in pcDNA 3.1D/V5-His-TOPO, a mammalian expression
vector. I tested if CR12 induced luciferase activity in response tol l-DC in a luciferase
reporter system before further characterizations.

When transfected into HeLa cells, C812 responded to ll-DC at 10 nM and induced
the pPRE-TK-Luc reporter plasmid (Fig. 3). A series of controls were performed to test if
the dual-glow luciferase reporter system allowed for efficient normalization and if the
luciferase activity could only be induced when all of the three components- the luciferase
reporter gene with the response element (pPRE—TK-Luc), the functional receptor (CR12),
and a potential ligand- were present. pGL-3 (constitutive firefly luciferase), pGR.l (rat
glucocoricoid receptor) with pPRE-TK-Luc, pcDNA3.] (empty vector for receptor) with
pPRE-TK-Luc, and C812 with pGEM-TK-Luc (empty vector for the response element),
were included in one luciferase assay experiment with CR12/pPRE-TK-Luc (Fig. 3). To
normalize for differences in transfection efficiency in dual-glow luciferase system,
pRL-CMV (renilla luciferase) was used in every well. For all of the wells transfected,
both firefly luminescence and renilla luminescence were at least lO-fold above the
non-transfected background. The ratio of firefly luminescence to renilla luminescence
was used to report normalized activity. The pGL-3 transfected HeLa cells gave a

firefly/renilla ratio of 0.8672t0. 199 (Fig. 3). The rat glucocorticoid receptor (pGR.1)

23

Fig. 3

Corticoid Receptor Response to ll-DC

 

2.50 r~~- --- fl —— ~ , ——— — ~»—fi*_——'r~

 

 

“<2?

5

 

 

Firelly to Renilla Ratio
'8

 

0.50

 

 

 

 

0.00 L

pGL-3 pom/o pGR.1 pcDNABJpcDNA3J pGEM pGEM pPRE/CR12

PXWWC w’ w’° w/ll-DC “”0 will-DC
dexamethasone ll-DC ll-DC ll-DC will-DC

pPRE/C812

Fig. 3 CR12 Response to ll-DC.

pGL-3 (grey) was used as the constitutive firefly luciferase activity control. pGR.] (80
ng), the rat glucocorticoid receptor, was used as a positive luciferase assay control;
pPRE-TK-LUC (600 ng) was co-transfected with pGR. 1. pcDNA3.l (40 ng) was used as
a negative receptor control; pPRE-TK-LUC was co-transfected with pcDNA3.].
pGEM-TK-Luc (600 ng) was used as a negative PRE control; CR12 (40 ng) was
co-transfected with pGEM-TK-Luc. pPRE/C812 had both of the pPRE-TK-LUC (600 ng)
reporter plasmid and the C812 (40 ng) receptor plasmid. For each group, 20 ng of
pRL—CMV (Renilla luciferase) was transfected along with the reporter plasmid and the
receptor plasmid. Ethanol vehicle was given to pGL-3 transfected cells (gray) and the no
hormone treatment cells (open bars). pGR.1 w/ dexamethasone was treated with 10 nM
dexamethasone. pcDNA3.] w/ ll-DC, pGEM w/ ll-DC, and pPRE/CR12/w ll-DC were
all treated with 10 nM ll-DC. Vertical bars represent mean i: one standard error from
three separate wells. * represents for P value =0.015. # represents for P value <0.0001.

24

responded to dexamethasone at 10 nM and induced the firefly luciferase gene on the
pPRE-TK-Luc by more than two fold (P=0.015) (Fig. 3). In the empty vector for receptor
control pcDNA3.1, there was no difference between non-hormone treated HeLa cells and
ll-DC (10 nM) treated HeLa cells (P>0.05). Also, in the pGEM-TK-Luc (no response
element control), there was no significant change between non-hormone treated and
ll-DC treated cells (P>0.05). More importantly, CR12 responded to ll-DC at 10 nM and
induced the firefly luciferase activity by more than 2 fold (P<0.0001) (Fig.3). Based on
these measurements, CR12 functionally responded to ll-DC and induced the luciferase
reporter activity while all of the negative controls did not.
Screening for Potential Ligands for the Sea Lamprey Corticoid Receptor

As shown in Fig. 4, different steroid ligands were screened at both 1 nM and 100
nM. At the higher concentration, ll-DC, Corticosterone (CC), DEOC, Cortisol (C), and
Aldosterone (A) treated cells showed 2.5 to 7-fold inductions compared to the ethanol
treated cells. Interestingly, DEOC had less than 50% more induction at 100 nM compared
to at 1 nM even though it showed the highest luciferase activity at 100 nM compared to
others. There was no difference between CC and DEOC treated at 100 nM (P>0.05).
l7-OH Progesterone (17-OH P) showed a two fold induction at 100 nM compared to at 1
nM; however, it was lower than CC, ll-DC, and DEOC at 1 nM. The reporter activities

of estradiol, progesterone, and dihydrotestosterone treated cells were not different

25

Fig. 4

3.5

2.5

Normalized Firefly to Renilla Ratio
N

Screening of Ligands for the Sea Lamprey Corticoid Receptor

 

 

 

 

 

 

 

 

A’fl

bb
DHT

 

 

 

 

 

 

 

 

 

ll-DC DEOC

P l7-OH P Cortisol CC

Fig. 4 Screening of Ligands for the Sea Lamprey Corticoid Receptor.

HeLa cells were transfected with pPRE (600 ng), CR12 (40 ng), and pRL-CMV (20 ng).
pGL-3 (constitutive luciferase activity) + pRL-CMV (20 ng) were trasfected in duplicates
in every 12-well plate as controls to normalize data from each plate. Data reported here
were normalized per averaged pGL-3 firefly to renilla ratio. Negative hormone control
(grey) was treated with media containing EtOH vehicle. Two concentrations (1 nM (white
bars) and 100 nM (black bars)) of each hormone were included in this study. Vertical bars
represent mean i one standard error from three separate wells. A: Aldosterone, E2:
Estradiol, P: Progesterone, 17-OH P: 17-OH Progesterone, CC: Corticosterone, DHT:
Dihydrotestosterone, ll-DC: ll-Deoxycortisol, DEOC: Deoxycorticosterone. P value is
< 0.05 between a, and b; P value is < 0.0001 between a, and c. *, x, and m represent for P
value < 0.01. #, n, and 0 represent for P value < 0.05.

26

between the two concentrations (P>0.05) although progesterone at 100 nM and
dihydrotestosterone at both concentrations showed increased activities compared to
ethanol control (P<0.05) (Fig. 4). These indicated that estradiol, progesterone, and
dihydrotestosterone were inactive under physiological concentrations in this assay. In a
separate experiment, testosterone was screened at both of 1 nM and 100 nM and there
was no significant difference among the cells treated at the two concentrations and the
negative hormone treatment group (data not shown). Before further study of the
specificity of the active ligands, I tested if HeLa cells had endogenous activity in
response to ll-DC, CC, C, DEOC, or A. There was no induced luciferase activity in cells
treated with any of these active ligands when pcDNA3.l (empty vector for CR) was
transfected into cells instead of CR12 (Fig. 5).
Concentration Response Relationships of Active Ligands for CR12

The ligand screening experiment indicated that ll-DC, DEOC, A, C and CC induced
luciferase activities effectively. Therefore, these five ligands were included in a
concentration response analysis even though A, C, and CC are not physiologically present
in sea lampreys. The detected plasma level of l l-DC was about 1 ng per ml in sea
lampreys under stressed conditions (David Close 2007, a PhD thesis, Michigan State
University). This plasma concentration is equal to 2.89 nM.

As shown in Fig. 6, ll-DC treated cells had the highest overall activity and reached

27

a plateau phase at 3 nM. Both ll-DC and DEOC treated groups had about 2.5-fold
induction from base line to at 3 nM. Interestingly, DEOC had a slower rise of induced
activity than ll-DC had even though there may not be significant differences between
ll-DC and DEOC treated groups at some concentrations. Among the five ligands tested,
11-DC, CC, DEOC and A showed the typical rise of induced activity between 1 nM and
10 nM and the plateau after the rise while cortisol started to have a lower induced activity
at 10 nM. This data indicated that there was no apparent ligand specificity of CR12 in
response to ll-DC, DEOC, CC, and A. And, the two corticoids present in sea lampreys,
ll-DC and DEOC were the most potent ligands at 3 nM. Also, cortisol was not a potent
ligand for the sea lamprey CR12 under physiological conditions.
Nuclear Localization of CR Variants- Effect of Lacking Exon 7 on CR

Both of CR1 and CR9 had out of frame deletions involving Exon 7. Fig. 7 showed
clearly that both of CR1 and CR9 were not able to induce luciferase activity at any
concentration tested. Even though CR9 had less protein deleted than CR1 (Fig. 2), there
was no difference between them in the concentration response analysis (Fig.7). In
contrast, CR12 which contained the complete DBD and LBD showed induced activity
(Fig. 7). Furthermore, both CR12-V5 and CR9-V5 were visualized by immunostaining in
the absence and presence of 10 nM ll-DC (Fig. 8). As shown in Fig. 8a, CR12 without

V5-epitope did not give any red staining above the background. Nuclear localization was

28

Fig. 5

Lack of Endogenous Corticoid Receptor Response to Ligands in HeLa Cells

 

 

O
to .—
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
l
I
I
I

I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I

I
I
I
I
I
I
I
I
I
I
I
I
|
I
I
I
I
I
I
I
I
I

O
O
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I

i’
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I

 

 

Normalized Firefly to Renilla Ratio
0
|
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I

00
I
I
I
.——————’.—I
I
t-——-—-t

Il
.*
II

p——-|‘

I

I

I

I

I

I

I

I

I

I

fi—I‘I

I

II

II

II

II

 

 

 

 

 

I
I
I

 

 

 

 

 

 

 

 

 

O

 

- Hormone Aldosterone Corticosterone DEOC Cortisol ll~Deoxycortisol

Fig. 5 Lack of Endogenous Corticoid Receptor Response to Ligands in HeLa Cells.
pcDNA3.] (40 ng) (empty vector for CR) and pPRE-TK-LUC (600 ng) were
co-transfected along with 20 ng of pRL-CMV into HeLa cells. Ethanol vehicle was given
to negative hormone control wells. Transfected cells were treated with 100 nM A, CC,
DEOC, C, and ll-DC respectively. Vertical bars represent mean d: one standard error
from three separate wells. P value between any two groups is greater than 0.15.

29

Fig. 6

 

~u

 

 

  

 

+ Deoxycorticosterone '
I:‘:1_1:Des>xr<_=0riisql J

 

 

 

 

 

 

 

 

 

Normalized Firefly to Renilla Ratio

 

 

 

 

 

CD

Log of Concentration (log M)

Fig. 6 Concentration Response Curves of the Corticoid Receptor.

HeLa cells were tranfected with pPRE (600 ng), CR12 (40 ng), and pRL-CMV (20 ng).
Ethanol vehicle was added to wells in triplicates as negative hormone control (not shown
in this figure). pGL-3 (constitutive luciferase activity) + pRL-CMV (20 ng) were
trasfected in duplicates in every 12-well plate as controls to normalize data from each
plate. Data reported here were normalized per averaged pGL-3 firefly to renilla ratio.
Concentrations of from 10'11 M to 10'6 M of each hormone were used. Vertical bars
represent mean i one standard error fi'om three separate wells.

30

‘ ‘

‘0

Fig. 7

Function of Exon 7 Deleted Corticoid Receptor

 

CID

 

~IJ

Sick?
>—- +CR9 W.*_*_,_.._. *w

TERM

 

 

 

 

 

 

:Mvm: / ‘ _ I l
W X I
am TV

._.___s._ _. __._..._ _ ,__.__A_ 4
4 I

u.)

 

 

 

N)

Firefly to Renilla Ratio (light units)

I
I
I
I
I

r \x

/
I I

 

 

 

 

 

-12 -11 -IO -9 -8 -7 -6 -5
Log of Hormone Concentration (log M)

 

GP

Fig. 7 Concentration Response Curves of Exon 7 Deleted Splice Variants.

Both CR1 and CR9 were splice variants cloned which contained truncated ligand-binding
domain. CR1 had the fiill exon 7 and most of the exon 8 deleted while CR9 had the full
exon 7 deleted. HeLa cells were tranfected with pPRE (600 ng), pRL-CMV (20 ng), and
40 ng of CR1 (blue) or CR9 (red), or CR12 (black). Ethanol vehicle was added to wells
in triplicates as a negative hormone control (not shown in this figure). pGL-3
(constitutive luciferase activity) + pRL-CMV (20 ng) were trasfected in duplicates in
every 12-well plate as controls to normalize data from each plate. Data reported here
were normalized per averaged pGL-3 firefly to renilla ratio. Four concentrations of fiom
10"1 M to 106 M of 1 l-Deoxycortisol were used. Vertical bars represent mean i one
standard error from three separate wells.

31

observed in CR12-V5 without the dependency of ll-DC while none of the cells
transfected with CR9-V5 showed nuclear staining with or without ll-DC (Fig. 8b, c, d, c).
This demonstrated the importance of Exon 7 for NLS, hence the downstream
transcription activity, consistent with the behavior of mammalian steroid receptors.
Ligand Independent Nuclear Localization of CR12

As shown in Fig. 8b and c, CR12-V5 was observed in the nucleus in both the
absence and the presence of 1 l-DC. Because the immunostaining can only help visualize
the proteins in fixed cells while the localization and degradation of nuclear receptors is
dynamic (Hager, 1999, Phair et. al., 2000, Misteli, 2001), I tried to address the dynamics
of the nuclear localization of CR12-V5 by doing time course treatments of ethanol
vehicle, ll-DC or DEOC at 10 nM for 15 min, 30 min, 1 hr, 2 hr, and 4 hr followed by
fixation of cells. Surprisingly, I found nuclear staining in all of the treatment groups
independent to the length of the treatment. Moreover, the overall amount of nuclear
staining was similar to Fig. 8b and c (figure not shown).

To study if the presence of serum had any effect on the ligand independent nuclear
localization of CR12, I further examined CR12 transfected HeLa cells in the presence and
absence of serum under the presence or absence of 1 l-DC or DEOC. I found both serum
and ligand independent nuclear localization similar to fig. 8b and c (figure not shown).

Based on the results from time course treatments of ligands and experiments under

32

serum free conditions, I excluded the possible effects from phosphorylations on nuclear
localization of CR12. Furthermore, I determined that sea lamprey corticoid receptor
CR12 was localized in the nucleus independent to the presence of ligands.
Coexpression of CR12 and CR9- Enhanced Transactivation

In Figs. 7 and 8, I demonstrated that splice variant CR9, by itself, had neither the
transcription activation activity nor the nuclear localization behavior. This implied that
exon 7 of the sea lamprey CR was important for normal functions. However, whether the
existence of the splice variant CR9 is important physiologically needs to be fiirther
examined.

To address if inactive splice variant CR9 had any effect on the functional variant
CR12, I performed coexpression of CR12 and CR9 in HeLa cells with a luciferase assay
system. Surprisingly, I found that the presence of CR9 increased the luciferase activity by
more than 2 fold in the presence of ligands (P<0.05); but no difference was found in the
negative ligand controls (Fig. 9). This striking result demonstrated that CR12 responses
were modulated by the inactive receptor CR9, in which the LBD was not intact.
Especially, the coexpression of CR9 and CR12 showed differential activity in response to
ll—DC and DEOC at 10 nM while expression of CR12 alone did not (Fig. 6& 9). This
clearly implied a new phenomenon of how sea lampreys may regulate CR responses

through splice variants of the only corticoid receptor.

33

Fig. 8 Immunostaining of CR12 and CR9.

HeLa cells were transfected with 660 ng of CR12, CR12-V5, or CR9-V5 24 hrs after
plating. ll-DC (10 nM) or ethanol vehicle were applied to cells one hour before fixing
and staining. V5 epitope was fused at the c-terminus of CR12 and CR9. Pictures shown
were representative of at least 3 replicates. DAPI staining for non-specific nucleus
staining was applied to all cells (blue). Secondary antibody with an Alexa red fluorescent
label was used against anti-V5 antibody. a, CR12 without V5 and hormone treatment, b,
CR12 with V5 without hormone treatment, 0, CR12 with V5 treated with ll-DC, d, CR9
with V5 without hormone treatment, e, CR9 with V5 treated with ll-DC.

34

Fig. 8
a: CR12 No Hormone

 

b: CR12-V5 No Hormone c: CR12-V5 ll-DC Treated
d: CR9-V5 No Hormone e: CR9-V5 ll-DC Treated

35

 

T
v.

 

Fig. 9

 

EHeetol‘SplieeVariantClvonCRlZ
12 ,7 ,7 fig
IINoCR9 §
ICRaCR12=I:1
17ucmCR12=252177 7 777 7 77 7 7 77 777 7i? 77 7 7 77*77 7 7 77

I
‘DCRQCRIZ: 5:1 I

macw 101 I

    

Normalized Firefly to Renilla Ratio
9
0t

 

02*

 

 

Fig. 9 Effect of Splice Variant CR9 on CR12. HeLa cells were transfected with pPRE
(600 ng), pRL-CMV (20 ng), 40 ng of CR12 plus no CR9, 40 ng of CR9, 100 ng of CR9,
200 ng of CR9, or 400 ng of CR9 respectively fi'om left to right in each treatment group,
and pcDNA3 (empty vector) if necessary. The total DNA amount transfected in each
group was 1060 ng, including supplemental pcDNA3 to make equal DNA amount for
getting similar tranfection efficiency. Ethanol vehicle was added to wells in triplicates in
the negative hormone group. pGL-3 (constitutive luciferase activity) + pRL-CMV (20 ng)
were trasfected in duplicates in every 12-well plate as controls to normalize data from
each plate. ll—DC or DEOC were used to treat cells at 10 nM. The data reported here was
normalized per averaged pGL-3 firefly to renilla ratio. Vertical bars represent mean i one
standard error from three separate wells. Labeled bar graphs (#, *, and §) represent for
significant difference between labeled groups (P<0.05). No CR9 transfected group treated
with DEOC showed significant difference (P<0.05) compared to other DEOC treated
groups (x labeled).

36

Corticoid Receptor Transcript Levels in Sea Lamprey Tissues

To further understand if the sea lamprey CR is regulated tissue specifically, I
measured CR mRN A quantity expressed in brain, liver, gill, and testes tissues at different
stages under basal conditions by real-time quantitative PCR. While there was no change
in CR expression across different life stages in brain and liver tissues, the expression
level of CR in gill tissues of spermiating male animals (SMG) was significantly higher
than in gill tissues of sea lampreys at other stages (SMG/PSMG: P<0.0001, SMG/LPG:
P=0.0180, SMG/PG: P=0.0004) (Fig. 10). The highest expression level of CR in gill
tissues occurred at the spermiating male stage and it was about 3 fold higher than the
lowest expression level which occurred at the pre-spermiating male gill tissues (PSMG)
(Fig. 10). This change may be accounted by the changes of environmental conditions
which induce stress responses when pre-spermiating sea lampreys return to streams from
lakes. There was no difference between the expression level in gill tissues of sea
lampreys at the parasitic stage (PG) and at the large parasitic stage (LPG) (Fig. 10).
Furthermore, the CR mRNA level at the pre-spermiating stage (PSMG) was significantly
reduced by about 50% compared to the PG or the LPG stages (PSMG/PG: P=0.0021,
PSMG/LPG: P<0.0001) (Fig. 10).

In addition to the great changes of CR expression in gill tissues, the expression level

of CR in testes in sea lampreys showed dramatic changes among different life stages (Fig.

37

10). The expression level in testes between any two stages was significantly different.
The highest expression occurred in testes at the parasitic stage (PT) which was 3 fold
higher than the lowest expression level which occurred in testes at the spermiating stage
(SMT) (PT/SMT: P<0.0001) (Fig. 10). The expression level of CR in testes was lower at
the large parasitic stage (LPT) and the SMT stage compared to at the PT and the
pre-spermiating stage (PSMT), respectively (Fig. 10). These changes indicated that the
expression level of CR in testes was regulated differentially at various developmental
stages.

In general, the expression level of CR in brain tissues was significantly higher than
in liver tissues. Furthermore, the lowest expression levels in gill and testicular tissues
were not significantly different than in liver tissues. Notably, the highest level of CR was
found in gills of spermiating males and in testes of sea lampreys at the parasitic stage;

and there was no difference between the two (P>0.05) (Fig. 10).

38

Fig. 10
a: CR Transcripts in Tissues at Different Life Stages

I: Parasitic male

G Large parasitic male
- Pre-spermiating male
- Spermiating male

 

 

CR mRNA no. I ng Total RNA

          

Brain Gill

Liver Testes

Fig. 10 Tissue Distribution of the Corticoid Receptor in the Sea Lamprey. a, CR
transcripts in tissues at difl‘erent life stages. Brain, gill, liver, and testes tissues were
collected from sea lampreys at parasitic, large parasitic, pre-spermiating, and spermiating
stages. For each group, 4 or 8 (indicated on bar graph) individual animals were used to
collect tissues. For each animal, all of the four tissue types were collected and used for
RNA extraction, and real-time quantitative RT-PCR. The number of corticoid receptor
mRNA copies was normalized to total RNA. Measurements of each sample were done in
triplicates. Vertical bars represent mean of each group (4 or 8 samples) :I: one standard
error. * represents for P< 0.05 between indicated groups.

39

b: Life Stages of the Sea Lamprey

 

 

 

 

 

 

 

 

 

Larvae go through metamorphosis
followed by downstream migration
to lakes or oceans.

 

 

 

Approaching sexual
maturation, parasites migrate
back to tributary rivers.
0 High CR
. Hi3]? CI? expression in gills
expression in and low CR
“5t” Parasitic Stag ‘ expression in tastes
Larval Phase
in Rivers

Fig. 10b, Life Stages of the Sea Lamprey. Major events occurred throughout the sea
lamprey life cycle as indicated. Main findings from Fig. 10a were summarized in bullet

points.

 

DISCUSSION

In this study, I have provided the first functional characterization of a CR with its
intact natural DBD and LBD of a jawless vertebrate, the sea lamprey. When expressed in
mammalian cells, a partial native CR cDNA (CR12) responded to both ll-DC and DEOC
at the physiological range of concentrations as assayed using an in vivo assay involving a
luciferase reporter system. I demonstrated that an intact LBD is critical for proper nuclear
localization by comparing the behavior of CR12 with that of a splice variant CR9 missing
exon 7. Also, nuclear localization of CR12 was shown to be both ligand and serum
independent. More importantly, the splice variant CR9 was found to modulate CR
responses to ligands when it was cotransfected with the intact DBD-LBD CR, CR12.
These findings provided characterizations of an ancestral sea lamprey CR that gave us
better understanding of the steroid receptor evolution at the stage of jawless vertebrates.

CR represents an important signaling system to maintain the normal physiology of
the sea lamprey. The cDNA sequence of the sea lamprey CR was previously found to be
close to sequences of both MR and GR in jawed vertebrates, with greater similarity to
MR in a phylogenetic analysis (Thornton 2001). In jawed vertebrates, MR signaling
governs salt and water balance (McCormick 2001) while GR plays important roles in
development, metabolism, and immune responses (reviewed by Stolte et. al. 2006). In sea

lampreys, the lack of any evidence for the presence of GR and MR (Thornton 2001 ,

41

Bridgham et. al. 2006) leads to the hypothesis that CR can govern physiological
responses signaled through both MR and GR in other vertebrates. In addition, ll-DC is
the precursor to the final step of cortisol synthesis in jawed vertebrates (Bridgham et. al.
2006). Cortisol is the principle physiological ligand for GR in jawed vertebrates. Also,
DEOC was found to be a potent ligand for MR in rainbow trout (Sturm et. al. 2005)
while aldosterone is the principle ligand for MR in higher vertebrates other than fish.
Although cortisol and aldosterone are the principle ligands for GR and MR, respectively,
both of them are missing in sea lampreys due to the lack of 11-[3 hydroxylase activity
which is required for the synthesis of these ll-hydroxy steroids (Nonaka et. al. 1995,
Jiang et. al. 1998, Bulow et. al. 2002, Bridgham et. al. 2006). In this study, I showed that
both ll-DC and DEOC are the most potent ligands for the sea lamprey CR12. Therefore,
two lines of evidence support the conclusion that the sea lamprey CR may regulate
physiological responses governed by MR and GR in other jawed vertebrates: (I) evidence
that GR and MR as well as their principle ligands are missing while CR is the only
receptor that shares significant phylogenetic similarity to GR and MR, and (2) ll-DC and
DEOC are the most potent ligands able to activate a partial sea lamprey CR, CR12.

The sea lamprey CR represents one of the most ancestral corticoid receptors in
vertebrates. Based on the current hypothesis that GR and MR arose through gene

duplication, which occurred after the divergence of Agnathans (jawless fish) from other

42

jawed vertebrates, the ancestral CR was predicted to have affinity to multiple ligands
(Thornton 2001, Bridgham et. al. 2006). As a result, studies of sea lamprey CR can
provide information on CR signaling close to the ancestral state of this family member. In
this study, I showed that CR12, a cDNA clone representing most of the sea lamprey CR
sequence, responded to multiple ligands without apparent specificity. This result agrees
with what was predicted in the studies of Thornton and colleagues (Thornton 2001,
Bridgham et. al. 2006).

Whether the nuclear localization event is dependent on ligand binding has been
found to be model dependent in studies of GR and MR (Wikstrom et. al. 1987, Lombes et.
al. 1994, Robertson et. al. 1993, Welshons et. al. 1985, Martins et. al. 1991). Here, I
found that in CR12, nuclear localization was independent of ligands and serum,
suggesting that ligand- or growth factor-mediated changes in receptor phosphorylation
are unlikely to play a role in the subcellular localization of this nuclear receptor family
member. This implies that the ancestral CR may have shown a similar behavior as CR12.
Moreover, this ligand independent nuclear localization was also found in ER (King and
Greene 1984). As predicted by Thornton (2001), BR was the first steroid receptor and all
of the others arose through serial expansions of this ancestral receptor through successive
cycles of gene duplication and sequence divergence. Therefore, the similar localization

behavior between this partial sea lamprey CR, CR12, and ER support the proposed

43

hypothesis suggesting that the ancestral state of primitive steroid receptors involved
constitutive nuclear localization. The sea lamprey CR, hence, provides an efficient model
for understanding the evolution of steroid receptors.

To study ligand specificity of CR12 in response to various ligands, I performed a
concentration response analysis with diverse ligands. Among them, ll-DC and DEOC are
the only two ligands found naturally in sea lampreys (Weisbart and Youson 1975, a PhD
thesis by David Close 2007, Bridgham et. al. 2006). Even though I found a slightly
higher luciferase activity in ll-DC treated HeLa cells compared to physiological
concentrations of DEOC, there was little apparent ligand specificity of CR12 in
differentiating one ligand from the other. This result supports the conclusion that both
ll-DC and DEOC are biologically potent ligands that are able to induce CR response in
sea lampreys. This result is also expected based on previous findings of active ligands of
CR including ll-DC, DEOC, CC, and A at a saturating concentration (100 nM) in a
reporter assay with a chimeric CR (Bridgham et. al. 2006). Moreover, even though CC
and A were less active than ll-DC and DEOC, their ability to induce CR responses also
showed that sea lamprey CR were able to receive bio-signals from diverse corticoids and
A. It is worthwhile to note that these active ligands are all 21-carbon steroids sharing
similar structures.

Interestingly, Bridgham et al.(2006) presented concentration response curves

44

showing that their chimeric CR responded to DEOC and CC at concentrations similar to
what I found; their findings, however, showed that ll-DC and cortisol were inactive at
the physiological concentrations. I suspect that the difference between my findings and
theirs might be due to the use of an intact DBD-LBD CR rather than the use of a chimeric
CR.

The apparent lack of well-defined ligand specificity at the level of ligand- receptor
in CR12 raised the question of how sea lampreys regulate their physiological responses
through multiple ligands, but one CR. Of course, the sea lamprey CR could use different
ligands to target different downstream genes; however, this idea has not been studied.
Another possible way to regulate CR responses would be at the level of the receptor.
From my observation that the splice variant CR9 enhanced the activity in the presence of
the functional variant CR12 and ligand, I demonstrated a possible mechanism to
modulate CR responses. In addition, our data from quantitative RT-PCR indicated another
level of regulation through the expression level of CR in various tissues at different
developmental stages. Specifically, the relatively constant levels of CR mRNA in whole
brain and liver tissues indicate that CR expression needs to be stably maintained in these
tissues throughout these developmental stages even though CR expression may be varied
in different regions of the brain. In contrast, significant changes in the level of CR

transcripts in gill and testicular tissues may reflect regulation necessary to deal with

45

environmental and physiological stress, and cell growth at different developmental stages.
In conclusion, CR may cause different downstream physiological effects in response to
active ligands by (1) changes in the expression level of CR in various tissues at different
developmental stages, and (2) modulation of CR activity due to the presence or absence
of various splice variants.

The discovery of splice variants of CR led me to hypothesize that the inactive splice
variants CR9 and CR1 would have effects similar to either dominant positive or dominant
negative receptor variants of ER as described previously (Fuqua et. a1. 1991, Wang and
Miksicek 1991). Specifically, because CR9 and CR1 were splice variants missing exon 7,
I thought that they would be more likely to exert dominant negative effect similar to
previous findings on exon-7-spliced ER variant (F uqua et. al. 1992). Instead, I found
enhanced luciferase activity in the presence of ligand in whenever CR9 was coexpressed
with CR12. This clearly indicates that the splice variant CR9 is capable of modulating the
transcriptional effects mediated by CR12. Moreover, this unexpected enhanced
transcriptional activation of an otherwise inactive variant CR9 in the presence of
functional variant CR12 and ligand is qualitatively different than previously described
dominant positive or dominant negative effects. This implies that some other mechanism
such as nuclear receptor coregulators may be involved.

Most steroid receptors form dimers before translocating to the nucleus (reviewed by

46

Weigel & Moore 2007). Based on the observation that CR9, by itself, was inactive for
transcription activation and nuclear localization, and that transcription activity was
enhanced in the presence of ligand when CR12 and CR9 were cotransfected, it is possible
that CR9 dimerizes with CR12 and is co-transported to the nucleus, where it can interfere
with coregulators when ligand is present. Alternatively, CR9 might serve to sequester
co-repressors within the cytoplasmic compartment. To distinguish between these
hypotheses more investigations, including studies on protein-protein interactions, will be
necessary.

Recently, the regulation of nuclear receptor function has begun to take into
consideration the transcriptional machinery as a whole including coactivators and
corepressors, as well as chromatin remodeling (reviewed by Perissi and Rosenfeld 2005).
Corepressors and coactivators share several interaction sites in the LBD. Among them,
helix 12, which is also known as activation function 2 (AF 2), is the most important
docking site for coregulators (reviewed by Gurevich et. al. 2007). When the receptor is
ligand-occupied, conformational changes of helix 12 make the receptor available to
interact with coactivators instead of corepressors (reviewed by Gurevich et. al. 2007).
These coactivators and corepressors play an important role in regulating nuclear receptor
signaling (reviewed by Gurevich et. al. 2007). Whether the splice variant CR9 modulates

CR12 responses through one or more of these coregulators needs to be further studied.

47

CR12 contains most of the firnctional domains in nuclear receptors, with the
exception of the NTD, which might result in less transcriptional activation of the reporter
gene. There are four major regions in nuclear receptors which include the NTD, the DBD,
the hinge region, and the LBD. Based on all of the sequences currently available for sea
lamprey CR, there is insufficient information about the NTD of it. In this study, I cloned
sea lamprey CR without including the NTD. Based on analogy to other nuclear receptor
family members, a principle feature of the NTD includes the activation function 1 (AF-l)
(Reviewed by Weigel & Moore 2007). The main function of AF —1 is to optimize and
modulate the transcriptional activity in response to other signal transduction pathways
(Reviewed by Weigel & Moore 2007). Therefore, lacking the NTD in CR12 and CR9
might have an effect on the magnitude of the luciferase activity; however, the ligand
specificity is mainly determined by the LBD. Furthermore, the NLS is located in the
hinge region (Reviewed by Wei gel & Moore 2007). Another major function of the NTD
is to provide phosphorylation sites, which sometimes have an impact on nuclear
translocation of the receptor when they become highly phosphorylated (Reviewed by
Weigel & Moore 2007). However, in this study, I demonstrated that nuclear localization
of CR12 was neither ligand nor serum dependent. Moreover, strong evidence exists for
the function of CR12 as a transcription factor in response to ligands. Since CR12 contains

an intact LBD for ligand specificity, and the hinge region containing a functional NLS,

43

and since nuclear localization of CR12 was independent of both serum and ligand, studies
of CR12 appear to display activities similar to a fully intact CR in sea lampreys. This
study characterizes CR12 which is the closest available molecular approach to the natural
CR in sea lampreys even though the transcription activation mediated by CR12 might not
be optimized due to the lack of the NTD.

To further study how sea lampreys respond to stress signals through a single CR
with multiple ligands, downstream gene targets of CR signaling need to be identified.
Although I have shown that sea lamprey CR responds to both ll-DC and DEOC, it is not
yet clear whether these ligands activate the same genes in various tissues of the sea
lamprey. Insight into this question could be provided by a microarray study performed on
animals treated with ll-DC, or DEOC to understand which genes can be activated and
whether ll-DC and DEOC activate the same genes or have different downstream gene
targets. In addition, studies such as quantitative RT-PCR analysis on the abundance of
CR9 and CR12 under various conditions in different tissues will provide information to
further understand the role of CR9 and hence how sea lampreys use splice variants to
regulate stress signaling and salt and water balance. Therefore, future studies such as
microarray analysis and quantitative RT-PCR analysis will help us attain a better
understanding on the regulation of stress and salt and water homeostasis in sea lampreys.

From all of the experiments included in this thesis, I demonstrated that sea lampreys

49

use a single CR that responded to ll-DC and DEOC, which are structurally close to
cortisol and aldosterone, the principle ligands for GR and MR, respectively, in higher
vertebrates. Whether CR mediates physiological responses signaled through MR and GR
in jawed vertebrates has yet to be determined. From the screening of various ligands in a
luciferase reporter system expressing a partial sea lamprey CR cDNA, CR12, I first
showed that CR12 responded strongly to several ligands. Additionally, CR12 responded
to ll-DC and DEOC without significant difference between the two in a concentration
response analysis. Furthermore, CR12 also responded to CC and aldosterone even though
responses were less active and required higher ligand concentrations. All of this data
supports the hypothesis that both ll-DC and DEOC are potent activators for the sea
lamprey CR.

In addition, natural splice variants lacking an intact LBD were not functionally
active on their own based on both in vivo luciferase assays and immunostaining data.
However, the C-terminally truncated splice variant CR9 was found to modulate CR
activity in response to ligands. Also, quantitative RT—PCR analysis showed another level
of regulation on CR signaling. These lines of evidence support the conclusion that the sea
lamprey CR responses are regulated through transcriptional and post-transcriptional
mechanisms involving multiple ligands and the modulation of receptor function by a

physiologically important splice variant.

50

REFERENCES

Agarwal MK & Mirshahi M 1999 General overview of mineralcorticoid hormone action.
Pharmacology and Therapeutics 84 273-326.

Bridgham IT, Carroll SM & Thornton J W 2006 Evolution of horrnone-receptor
complexity by molecular exploitation. Science 312 97-101.

Bulow HE & Bernhardt R 2002 Analyses of the CYPIIB gene family in the guinea pig
suggest the existence of a primordial C YPI 1 B gene with aldosterone synthase activity.
European Journal of Biochemistry 269 3838-3846.

Bury NR, Sturm A, Le RP, Lethimonier C, Ducouret B, Guiguen Y, Robinson-Rechavi M,
Laudet V, Rafestin-Oblin ME & Prunet P 2003 Evidence for two distinct functional

glucocorticoid receptors in teleost fish. Journal of Molecular Endocrinology 31
141-156.

Faus H & Haendler B 2006 Post-translational modifications of steroid receptors.
Biomedicine and Pharmacotherapy 60 520-528.

F uqua SAW, Fitzgerald SD, Chamness GC, Tandon AK, McDonnell DP, Nawaz Z,
O’Malley BW & McGuire WL 1991 Variant human breast tumor estrogen receptor
with constitutive transcriptional activity. Cancer Research 51 105-109.

F uqua SAW, Fitzgerald SD, Allred C, Elledge RM, Nafar RM, McDonnell DP, O’Malley
BW, Greene GL & McGuire WL 1992 Inhibition of estrogen receptor action by a
naturally occurring variant in human breast tumors. Cancer Research 52 483-486.

Gurevich I, Flores AM & Aneskievich BJ 2007 Corepressors of agonist-bound nuclear
receptors. Toxicology and Applied Pharmacology 223 288-298.

Hager GL 1999 Studying nuclear receptors with GFP fusions. Methods in Enzymology
302 73-84.

Jiang JQ, Young G, Kobayashi T & Nagahama Y 1998 Eal (Anguilla japonica) testis 11

gene is expressed in interrenal tissue and its product lacks aldosterone synthesizing
activity. Molecular and Cellular Endocrinology 146 207-211.

51

Kiilerich P, Kristiansen K & Madsen SS 2007 Hormone receptors in gills of smolting
Atlantic salmon Salmo salar: expression of grth hormone, prolactin,
mineralocorticoid and glucocorticoid receptors and IIB-hydroxysteroid dehydrogenase
type 2. General and Comparative Endocrinology 152 295-303.

King WJ & Greene GL 1984 Monoclonal antibodies localize estrogen receptor in the
nuclei of target cells. Nature 307 745-747.

Lombes M, Binart N, Delahaye F, Baulieu EE & Rafestin-Oblin ME 1994 Differential
intracellular localization of human mineralocorticoid receptor on binding of agonists
and antagonists. Biochemical Journal 302 191-197.

Makino K, Onuma TA, Kitahashi T, Ando H, Ban M & Urano A 2007 Expression of
hormone genes and osmoregulation in homing chum salmon: A minireview. General
and Comparative Endocrinology 152 304-309.

Martins VR, Pratt WB, Terracio L, Hirst MA, Ringold GM & Housley PR 1991
Demonstration by confocal microscopy that unliganded overexpressed glucocorticoid
receptors are distributed in a nonrandom manner throughout all planes of the nucleus.
Molecular Endocrinology 5 217-225.

McCormick SD 2001 Endocrine control of osmoregulation in teleost fish. American
Zoologist 41 781-794 (Review).

Misteli T 2001 Protein dynamics: implications for nuclear architecture and gene
expression. Science 291 843-847.

Nonaka Y, Takemori H, Halder SK, Sun T, Ohta M, Hatano O, Takakusu A & Okamoto
M 1995 Frog cytochrome P-450 (11 beta, aldo), a single enzyme involved in the final
steps of glucocorticoid and mineralocorticoid biosynthesis. European Journal of
Biochemistry 229 249-256.

Perissi V & Rosenfeld MG 2005 Controlling nuclear receptors: the circular logic of
cofactor cycles. Nature Reviews, Molecular Cell Biology 6 542-554.

Pfeffer U, Fecarotta E, Arena G, F orlani A. & Vidali Giorgio 1996 Alternative splicing of
the estrogen receptor primary transcript normally occurs in estrogen receptor positive
tissues and cell lines. Journal of Steroid Biochemistry and Molecular Biology 56

99-105.

52

Phair RD & Misteli T 2000 High mobility of proteins in the mammalian cell nucleus.
Nature 404 604-609.

Rees CB & Li W 2004 Development and application of a real-time quantitative PCR
assay for determining CYPlA transcripts in three genera of salmonids. Aquat. Toxicol.
66(4) 357-368.

Robertson NM, Schulman G, Karnik S, Alnemri E & Litwack G 1993 Demonstration of
nuclear translocation of the mineralocorticoid receptor (MR) using an anti-MR

antibody and confocal laser scanning microscopy. Molecular Endocrinology 7
1226-1239.

Stolte EH, Verburg van Kemenade BML, Savelkoul HFJ & Flik G 2006 Evolution of
glucocorticoid receptors with different glucocorticoid sensitivity. Journal of
Endocrinology 190 17-28.

Sturm A, Bury NR, Dengreville L, Fagart J, Flouriot G, Rafestin-Oblin ME & Prunet P
2005 ll-Deoxycorticosterone is a potent agonist of the rainbow trout (Oncorhynchus
mykiss) mineralocorticoid receptor. Endocrinology 146 47-55.

Thornton J W 2001 Evolution of vertebrate steroid receptors from an ancestral estrogen
receptor by ligand exploitation and serial genome expansions. PNAS 98 5671-5676.

Tufts BL 1991 Acid-base regulation and blood gas transport following exhaustive
exercise in agnathan, the sea lamprey Petromyzon marinus. Journal of Experimental
Biology 159 371-85.

Wang Y & Miksicek RJ 1991 Identification of a dominant negative form of the human
estrogen receptor. Molecular Endocrinology 5 1707-1715.

Weigel NL & Moore NL 2007 Kinases and protein phosphorylation as regulators of
steroid hormone action. Nuclear Receptor Signaling 5 6005.

Weisbart M & Youson JH 1975 Steroid formation in the larval and parasitic adult sea

lamprey, Petromyzon marinus L. General and Comparative Endocrinology 27
517-526.

53

Welshons WV, Krumrnel BM & Gorski J 1985 Nuclear localization of unoccupied
receptors for glucocorticoids, estrogens, and progesterone in GH3 cells. Endocrinology
117 2140-2147.

Wikstrom AC, Bakke O, Okret S, Bronnegard M & Gustafsson JA 1987 Intracellular

localization of the glucocorticoid receptor: evidence for cytoplasmic and nuclear
localization. Endocrinology 120 123 2-1242.

54

I|IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
3 1293 02956 8577