 

v:
to
L.

IA. 1.5»

.....3
... 1 .
.‘1 .: ... {manninﬁ

w.

.nf
1
"m...

«mm;

..v.f.1..”.u.a.~ ”a.

:1
..ﬂti..vnn?

5.3. i...
......H. ...mWWsl
{I it?

l...S-..:i
5. 5.5.

......
, .1:
. In

Hwﬁwaummwﬁy. : ...:
in?) isuuoanmﬂa...
Z... an“... inﬂux”; “garn‘

“mun"... 3.3:. in:
41...» 3k:

.11.“ ... 7v .... . ..r
(Jun-QIXIMVt: ..ihlaM‘.’ .. .9: LJUHDH (M
313.? .ﬂWmW..V3$. a). in“ ... $0."!5‘:

1 1,

, Vii/...... gnu-gamut“. ...:

‘1‘ l 3“! .I' "u :1: 1
aﬁusiuaunnaﬁfhmmp
4...:A “2‘1. I.‘{

ma.
4
. manna»... $.51. i ..
l I 3.» I. Hint-
L... 14.2..
MP. .3.
.

s . «WHIAL‘
xix? .... a. a...
.4512... .WWHA..J.Iﬂe§I-.M

tut-t;
2.???) Jean...
. .. wirnhﬂtiii
...: v3.3 _

 

 

 

1pm T‘ ,LIBRARY
f Michigf State
/ ( '~'~’ University

 

‘*

 

This is to certify that the
thesis entitled

INCREASING STUDENT COMPREHENSION OF
EVOLUTION THROUGH LABORATORY INVESTIGATIONS
AND SIMULATIONS

presented by

STEVEN W. McCLINTOCK

has been accepted towards fulﬁllment
of the requirements for the

MS degree in INTERDEPARTMENTAL
BIOLOGICAL SCIENCE

 

 

 

/ Lew,

 

/ Major‘Prdfessor’s Signature

 

July 17, 2008

MSU is an aﬁinnative—action, equal-opportunity employer

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

5/08 K'lProj/AodPres/CIRCIDateDueindd

INCREASING STUDENT COMPREHENSION OF EVOLUTION THROUGH
LABORATORY INVESTIGATIONS AND SIMULATIONS

BY

STEVEN W. McCLINTOCK

A THESIS

Submitted to
Michigan State University
in Partial fulﬁllment of the requirements
for the degree of

MASTER OF SCIENCE

Interdepartmental Biological Sciences

2008

ABSTRACT
INCREASING STUDENT COMPREHENSION OF EVOLUTION THROUGH
LABORATORY INVESTIGATIONS AND SIMULATIONS
By

Steven W. McClintock

In order to provide an opportunity for students to learn the concept of evolution
an evolutionary unit of study was developed. It was designed to provide a hands on
learning experience that would assist them in understanding the theory of evolution and
the several lines of evidence that support it. By providing several laboratory experiences,
simulations, and models students were able to gain an appreciation of the nature of
science and an increased understanding of evolution. By utilizing humans as an example
the theory of evolution was directly applicable to the students. The students worked in
small and large groups, as well as individually, in order to collect and analyze their data.
The activities designed for this unit improved the students understanding of the lines of

evidence that support the theory of evolution.

ACKNOWLEDGEMENTS

I would like to express my gratitude to Dr. Merle Heidemann and Dr. Ken Nadler for
their guidance and instruction throughout my master's program. I would also like to
express thanks to Dr. Chuck Elzinga for his many enlightening discussions, and for
sharing his joy of the outdoors, getting lost and a love of ﬂy ﬁshing. I am in debt to
Margaret Iding for all that she did for me. To my colleagues who assisted me completing
my thesis: Jim Jakiemiec, the English teacher who proof read my papers, Kelly Hartley,
the chemistry teacher, who provided his computer expertise and scientiﬁc knowledge
whenever it was needed, and the school secretaries Gina Jenson, Alma Morales and
Tammy Manne for all their help. I would also like to thank my classmates, especially Jen
Baker and Amanda Whitﬁeld. Amanda had to tolerate my sense of humor and inability to
use a new computer for the summer of 2007 when we carried out our research on
evolution. I would like to acknowledge the hard work and perseverance of my students
as they performed their multitude of tasks for my research. I am also grateful that friends
like Mark Zimmer were willing to assist me with my remodeling projects by moving
maple bowling alley lanes. Finally, I would like to thank Floyd and Janet for their
endurance in raising three kids and for helping us understand the importance of
continuing our education. To the rest of my family, thank you, for their support as I
completed my masters program, in particular my wife DeAnn, for all of her support and

assistance.

iii

TABLE OF CONTENTS

LIST OF TABLES ................................................................................................... vi
LIST OF FIGURES ................................................................................................. vii
INTRODUCTION ..................................................................................................... 1
THEORETICAL FRAMEWORK ........................................................................... 10
DEMOGRAPHICS .................................................................................................. 15
IMPLMENTATION ................................................................................................. 17
Review of Activities ..................................................................................... 21
Assessments ................................................................................................. 28
Evaluation .................................................................................................... 31
RESULTS AND DATA ........................................................................................... 32
Analysis of Laboratory Activities ................................................................ 46
Analysis of Assessments .............................................................................. 52
CONCLUSION ........................................................................................................ 56
APPENDICES ......................................................................................................... 62
APPENDIX 1 ........................................................................................................... 62
A. Michigan Department of Education Biology Content Expectation: ....... 62
Unit 12 StatementB5.l Theory of Evolution
B. Parent Consent Form ............................................................................... 63
C. Student Consent Form ............................................................................. 65
APPENDIX 11 ......................................................................................................... 66
A. Simulating the Radioactive Decay of Carbon- 14 ................................... 66
B. Human Evolution: Hominid Skull Comparison ....................................... 69
C. Evolutionary Time Line ........................................................................... 76
D. A 19th Century Journey ............................................................................ 78
E. Variations of Seeds within Species of Maple Trees ................................. 86
F. Bead Bug Blitz ......................................................................................... 88
G. Human Variations .................................................................................... 92
H. Comparison of Homologous Structures .................................................. 95
1. Molecular Sequencing of Amino Acids ................................................... 102
J. Clipbirds ................................................................................................... 107
K. Chronology of Hominids ........................................................................ 112
L. Fossil and Migration Patterns in Early Hominids .................................. 114

iv

APPENDIX III ........................................................................................................ 1 18

A. Evolution Unit Pro-Survey ...................................................................... 118
B. Pre-test Chapter 14 The History of Life .................................................. 120
C. Test 14 The History of Life ..................................................................... 121
D. Pre-test Chapter 15 Natural Selection and the Evidence for Evolution...125
E. Test Chapter 15 Natural Selection and the Evidence for Evolution ......... 126
F. Pre-test Chapter 16 Human Evolution ..................................................... 132
G. Hominid skulls pre-lab ............................................................................ 133
H. Evolution Unit Post-survey ..................................................................... 134
1. Evolution Lab Assessment ........................................................................ 136
J. Chapter 16 Test Human Evolution and Final Examination ...................... 138
K. Evolution Assessments ............................................................................ 148
APPENDIX IV. ...................................................................................................... 150
A. Creating Phylogenic Trees using Caminalcules ..................................... 150
B. Laetoli Footprints: Analyzing Fossilized Footprints ............................... 154
C. Genetic Evidence for Evolution: DNA Analysis ..................................... 158
D. When Milk Makes You Sick ................................................................... 163
LITERATURE CITED ............................................................................................ 166

LIST OF TABLES

Table l-Evolution Unit Lesson Plan ........................................................................ 19
Table 2-Student Pre and Post Survey Comparison .................................................. 33
Table 3-Student Pre and Post Survey Comparison .................................................. 34
Table 4-Average lab grade and student lab rating .................................................... 46
Table 5-Average scores for pre and post-tests ......................................................... 52

vi

LIST OF FIGURES

Figure 1- World Map ............................................................................................... 85
Figure 2- Chimpanzee next to Human leg ............................................................... 97
Figure 3- Human arm and leg .................................................................................. 98
Figure 4- Chimpanzee arm and leg .......................................................................... 99
Figure 5- Human and Chimpanzee arm ................................................................... 100
Figure 6- Chimpanzee foot and hand ....................................................................... 101
Figure 7- World Map ................................................................................................ 117
Figure 8- Coloration of snails ................................................................................... 127
Figure 9- Coloration of snails ................................................................................. 143

vii

INTRODUCTION
The introduction of the new state science standards, (Appendix I, A) which have
greater emphasis on evolution and the process of science, presented an opportunity to
develop a lab-centered evolution unit. This unit gave my students the opportunity to
develop hypotheses and make predictions about upcoming activities and witness the
process of science ﬁrst hand. When they ﬁnished with their investigation, they came to
their own conclusions based on their outcomes. Through a lab-centered unit, with limited
lectures and note taking, students should start to develop an understanding of
evolutionary processes and improve on their test scores, as well as prepare for ﬁtture
merit tests required by the State of Michigan. Lawrence Scharmann (2005) stated that
teachers should try to utilize lessons that involve student-centered activities. Massimo
Pigliucci (2007) mentioned that lectures should play a smaller role in teaching. Instead,
students should engage in open ended inquiry activities that stress how science functions
rather than what science says. Robert Pennock (2007) of Michigan State University
believes that there are no substitutes for hands on learning and lab activities. In these
hands-on learning exercises, student are allowed to participate in the process of scientiﬁc
discovery.
Knowing that faith and religion are strong components of the community of Kent
City, Michigan, I utilized this research to gain a more comprehensive understanding of
what my students thought of evolution and if their beliefs would inhibit them from
learning how the theory has developed and understanding the research that supports it.
.My goal was to develop labs that would allow students to actively participate in the
learning process and employ laboratory activities that stressed the nature of science and
aided in developing life-long learners. When a concept that conﬂicts with personal belief

systems exists, as it does with religion, it may take maturation of the learner to fully

l

develop a respect and understanding of nature of science and evolution.

Evolution and science have been scrutinized, especially in recent political debates
and with the release of Ben Stein's movie ExpelledzNo Intelligence Allowed. The attacks
on science and in principal the theory of evolution are carried out from several different
fronts. Evangelical ministers, such as D. James Kennedy and John Hagee, profess the
evils of evolution and its negative impacts throughout history. In Darwinism Under the
Microscope, D. James Kennedy stated "In the last few decades, every major pillar of the
evolutionary faith has been collapsing all around us. And yet we have evolutionists today
saying 'Evolution is a fact. It is not only a fact, it is a most thoroughly proven fact in all
of science.‘ Nonsense. But the truth will win out, and I am sure the day will come when
evolution will be recognized to be a pernicious and harmful theory, falsehood, deceit, and
fairy tale that it really is." (Gills & Woodward, 2002) A student gave me Gills &
Woodward, Darwinism Under the Microm four or ﬁve years ago. She stated that this
book would prove to me that evolution was false. In general, the authors of the book
disguise Intelligent Design (ID) as a science that questions several aspects of current
evolutionary research. By quoting literature ﬁ'om different scientists, philosophers, and
mathematicians, they pose that if evolution is false, then ID must be correct. Michael J.

Behe, Ph.D. , author of Darwin's Black Box proclaims, in Darwinism Under the

 

Microscope, that if the biological components of a cell are irreducibly complex molecular
machines, then their existence can only be designed by an intelligent agent. He argues
that he is not operating under religious ideas, but under the rules of science and is
completely empirical (Gills & Woodward, 2002).

Many politicians throughout the state are introducing bills in state legislative
bodies pushing for the theory of evolution to be either strongly questioned as a legitimate

theory or stating that it should be taught along with other rival theories such as Intelligent

2

Design, Creationism or other types of theories. The Grand Rapids Press (GRP) recently
covered two new bills, both known as the "Academic Freedom Law". They were
introduced in the state House and Senate to address the ID/evolution debate. House Bill
6027 (2008) is sponsored by State Representatives Republican John Moolenaar of
Midland, Fulton Sheen of Plainwell, and supported by Tom Pearce, Republican of
Rockford, Dave Agema of Grandville, and Judy Emmons of Sheridan (GRP June 8,
2008). The lone Democratic sponsor is Representative Joel Sheltrown of West Branch.
Senate Bill 1361 is sponsored by Republican Senators Bill Hardiman, of Kentwood,
Wayne Kuipers of Holland, and Mark Jansen of Gaines Township. Bill Hardiman said
that he was inspired by the documentary Expelled: No Intelligence Allowed, and believes
that science teachers should have the freedom to teach and discuss ID. The bill states
schools can not be prohibited from helping students understand, analyze, critique or
review in an objective manner the strengths and weaknesses of scientiﬁc theories. Dave
Agema believes that students should be allowed to think critically and should be able to
see the facts, including alternative views of the theory of evolution. (GRP June 13, 2008)
Currently, this same "debate" is also taking place in 5 other states: Alabama,
Florida, Louisiana, Missouri, and South Carolina. In Texas, the ﬁght over science
textbooks, the teaching of evolution, and the language that is used should make those
involved in education concerned. The Texas Education Board will decide the curriculum
for the next ten years and will be involved in the determination of the strength and
weaknesses of evolutionary science. Glenn Branch of the National Center for Science
Education warns that "what happens in Texas does not stay in Texas". Texas is one of the
largest purchasers of textbooks in the nation and publishers try to appease Texas and
often refuse to print different versions of the same text in order to reduce the cost of

publishing textbooks (GRP June 8th, 2008).

3

In many political campaigns, the debate has come to the forefront. In the
Michigan's Governor's race, in 2006, Dick DeVos, Republican candidate, told a reporter
that he supports the teaching of "intelligent design" alongside evolution in public schools.
DeVos stated "I would like to see the ideas of intelligent design that many scientists are
now suggesting is a very viable alternative theory, and that theory, and others that would
be considered credible would expose our students to more ideas , not less."
(http://www.ncseweb.org/resources/news/2006/ MI/553_creationism)

In the Republican presidential debate, May 3, 2008, the candidates were asked if they
disagreed with evolution, to which three of the ten responded yes. A fourth candidate
said that he believes in evolution but feels God played a role.
(http://pewforum.org/docs/?DocID=215) Bobby Jindal, Governor of Louisiana, a
potential candidate for vice president ,running mate for John McCain, when questioned

on the news Show Face the Nation Sunday June 15, 2008, stated he thought Intelligent

 

Design should be taught in public schools, that students should look at the "evidence" for
both and come to their own conclusions.

It's no wonder that students are confused by the topic of evolution or strongly
believe it to be false. They are told by many in the public domain that it is incorrect or it
is not the only theory of the origins of life and that it is ﬁlled with gaps. Public polls shed
some light into what Americans believe about evolutionary sciences. According to The
National Center for Science Education in a poll conducted by Gallup, 35% of those
polled in November, 2004 thought that evolution was well supported and 35% said that it
was not, while another 29% said they did not know enough about the topic to reply. In
that same poll, 38% said they thought humans evolved over millions of years, guided by
God, 13% had the opinion that humans evolved over millions of years in an unguided

process and 45% had the view that God created humans in their present form within the

4

last 10,000 years. In a June 2007, USA Today/Gallup poll, 18% thought humans evolved
over millions of years as a deﬁnitely true statement, 35% thought it was probably true,
while 16% thought it to be probably false and 28% thought it to be deﬁnitely false.
When respondents were asked for their feelings on if Creationism- "the idea that God
created humans pretty much in their present form within the last 10,000 years", 39%
responded with deﬁnitely true, 27% thought it to be probably true, 16% said it was
probably false and another 15% said that it was deﬁnitely false. Three percent of the
people who were polled responded "unsure" to both of the previous questions. A
Newsweek poll, conducted by the Princeton Survey, in late March 2007, found that 30%
thought God guided the process of human origin and development, 13% thought that God
played no part and 48% responded that God created humans in their present form. Nine
percent were unsure of the how the process occurred. In the education of evolution and
creation poll conducted by the Pew Research Center for the People and the Press Forum
on Religion and Public Life survey found that a majority, 58%, favor the teaching of
creationism along side of evolution in public schools. That same poll found that 51%
thought that the decision to teach or not to teach creationism should be decided at the
federal level, while 35% thought it should be a state right. (www
pollingreport.com/science.html)

In Evolution and Creationism in America's Classroom: A National Portrait a

 

survey of high school biology teachers, between March 5 and May 1, 2007, found that
these teachers on average allocated 13.7 hours of instruction toward evolution, with 59%
of the teachers allowing between 3 and 15 hours of instructional time. Only 2% excluded
the topic of evolution completely and another 17% excluded human evolution. Twenty
three percent of the teachers who believed evolution to be a major unifying theme for

biology dedicated 18.5 hours of instruction towards evolution. They also found that 25%

5

of the teachers who participated in the survey spent time on intelligent design or
creationism. As in other national polls on evolution and intelligent design, they asked
biology teachers about their own personal beliefs. When asked how humans evolved and
developed, 28% thought that humans evolved over millions of years without divine
intervention, 47% thought that humans evolved under the guidance of God over millions
of years and only 16% believe that humans were created in our present form within the
last 10,00 years. They found that the concept that was least accepted by teachers was that
evolution was testable and humans evolved. They found that 37% responded in a manner
that suggests evolution can not be scientiﬁcally tested. Over 30% responded in an
unfavorable manner that humans are the product of millions of years of evolution. Many
feel that the suggested solution to this dilemma, lack of teacher comprehension of
evolution, is to increase teacher preparation and focus on certiﬁcation standards for
biology teachers. Winning court cases alone will not improve the science education of
American youth. There should be standards in place that require biology teachers to take
courses in evolutionary biology. (Berkman, Pacheco and Plutzer, 2008). Massimo
Pigliucci (2007) insists that teachers should be mandated to continue their education and
should consider teaching to be a life long learning experience. In order to keep up to date
with recent ﬁndings, research and discoveries, teachers should take classes that
emphasize evolution.

In an informal poll conducted March 24, 2005, by the National Science Teachers
Association (http://www.nsta.org/about/pressroom.aspx?id=50377), 31% of the teachers
feel pressured to teach Intelligent Design or creationism in their science classrooms. The
pressure was applied by students and parents at nearly equal amounts. When they were
asked if principals and superintendents were pressuring teachers to omit or deemphasize

evolution only 5% and 3% respectively said that they did.

6

In the United States there have been several attempts at implementing some form
of creationism or intelligent design instruction into the science class room. George J.
Annas, (2005) broke the attempts of reducing or omitting evolutionary instruction, in
public schools, into four waves. He described the ﬁrst wave as an attempt at outlawing
Darwin's theory of evolution all together. The court case that highlighted the ﬁrst wave
was the Scopes trial in which Clarance Darrow defended teacher John Thomas Scopes
against prosecutor William Jennings Bryant. Scopes was convicted of violating the
Tennessee law that prohibited any public school teacher from teaching theories that deny
the divine creation of the bible. Upon appeal, the Tennessee Supreme court later threw
out the case and ordered that Scopes was not to be tried again. The second wave was
described as the development of creationism. This challenged the First Amendment
prohibiting state established religion. In 1981, the state of Arkansas enacted a law that
allowed for the balanced treatment of creation-science and evolution-science. It was
overturned in court the next year.

AS court cases related to teaching evolution in science classes were lost, the
deﬁnitions used by opponents to evolutionary theory began to change in an attempt to
distance themselves from any religious groups or deity. This was the framework for the
third wave. The term Intelligent Design (ID) was strongly supported by the Discovery
Institute as the new creation-science. The Discovery Institute is based in Seattle,
Washington. The Discovery Institute's website states that "The point of view Discovery
brings to its work includes a belief in God-given reason and the permanency of human
natures..."(http://discovery.org/aboutFunctions.php). The goal of the Discovery Institute
was to discredit evolutionary science by ﬁnding gaps in information or by
misrepresenting current research and data. The Thomas Law Center defended the Dover

School board after scouring the country looking for a school board who was willing to

7

test the courts on ID. The Thomas Law Center located in Ann Arbor, Michigan
(http://www.thomasmore.org/qry/page.taf?id=23) is a not-for-proﬁt law ﬁrm dedicated to
the defense and promotion of religious freedom of Christians . With the unifying of old
earth and young earth creationists, Philip Johnson, a law professor, helped develop the
Wedge Strategy, which was to provide scientiﬁc alternatives (ID) to evolution (Pennock,
2006). The ﬁrst challenge to this new direction of attack on evolution occurred in Dover
Pennsylvania, in Kitzmiller et al. v. Dover Area School District trial. The school board
proposed making the book Of Pandas and People available to those students who were
interested in reading the science of Intelligent Design. They also required ninth grade
students to hear a statement, prior to instructions on evolution, that Darwin's theory is
"not a fact" and has inexplicable "gaps" (http://www.msnbc.msn.com/id/ 10545387). The
trial took Six weeks, in which Judge John E. Jones 111 stated that "it is an interesting
theological argument, but it is not science for several reasons... it relies on the same
ﬂawed arguments as creationism". According to Annas (2005), the fourth wave followed
in which several states and school boards throughout the country began reversing
previously made laws and mandates in favor of ID, due to the outcome of the Dover
Case.

I would argue that the ﬁfth wave is upon us. As the result of many court cases,
the intelligent design movement, under the direction of the Discovery Institute of Seattle,
has started to sway public opinion and is trying to write laws that may be able to pass the
jurisdiction of the courts and the First Amendment. They are attempting to carry out
scientiﬁc research that supports ID, and using mass media to get their information out.
By publishing literature, hosting seminars, making appearances on televised programs
they hope to promote that the "science" of ID becomes more popular. Finally, the

Discovery Institute seeks to inﬂuence teacher training and challenge the legal status of

8

teaching ID (http://www.antievolution.org/features/wedge.html). These efforts are taking
place in many of the states House and Senate debates at this moment, including

Michigan's, as previously mentioned.

THEORETICAL FRAMEWORK

Knowing the history, the politics, and the social views of evolution, it is no
wonder that teachers and students are apprehensive about the nature of science and
evolution, even though the theory of evolution is widely supported by multiple lines of
evidence and overwhelmingly accepted by the scientiﬁc community. How do we convey
this information to our students? Will increased efforts to teach evolution improve the
student's ability to comprehend and understand the science of evolution?

To begin with, teachers should address the term "theory". The word is used
differently within the scientiﬁc community and those of the general public. To some,
theory is a term used to invoke negative connotations about scientiﬁc information, that
confuse many people, including teachers and students. The term "theory" is often used to
replace the word hypothesis, which can be deﬁned as an educated guess or idea that may
answer scientiﬁc questions. Many of my students respond to the word evolution with the
statement "But it is only a theory". They don't understand that science deﬁnes a theory
and how strongly a theory like evolution is supported by evidence. When Americans
were polled, 75% responded that evolution is thought of as a theory because it has not
yet been proven. (Morrison, 2005) Although evolutionary biology is a theory, it is not
guesswork or unsupported by evidence. Scientists understand that a theory is a widely
supported explanation of nature, based on facts and data derived from several ﬁelds of
science (Cherif, Adams, and Loehr, 2001). There are 78 member societies of the
American Institute of Biological sciences. The American Association for the
Advancement of Science has members from many ﬁelds of science, all in support of
evolution. Their members represent biological, physical, medical sciences as well as
mathematics and many others. (Faber, 2003)

The Michigan Science Teachers Association (MSTA) and the National Science

10

Teachers Association (N STA) have made statements that strongly support the teaching of
evolution and the nature of science (http://www.nsta.org/about/positionS/evolution.aspx).
The MSTA position statement, which was adapted February 3, 2007, on Evolution
Education and the Nature of Science states that:

Scientists view and seek to explain the natural world through the empirical lens of
science. The nature of scientiﬁc investigation is to ask a question and then work
to ﬁnd the answer. While philosophy and theology are valuable forms of human
inquiry that also seek to explain our world, science is unique in its approach

by relying exclusively upon empirical natural law (e. g., the laws of physics,
chemistry, geology, etc.) in its explanation and not upon supernatural intervention
or untestable conjecture. It is this testability that is a hallmark of the nature and
process of science. Scientiﬁc hypotheses and theory must be testable against the
natural world and therefore at least potentially falsiﬁable. Furthermore, any
conclusions formulated from these tests are tentative pending new data to the
contrary. As our scientiﬁc knowledge expands and provides us with better
insights into the natural world, science is able to modify previous conclusions and
theory to incorporate this new knowledge. Like all scientiﬁc theories,
evolutionary theory is dynamic and will be modiﬁed as new information becomes
available ..... The scientiﬁc community’s strong advocacy for the theory of
evolution is a result of the preponderance of collaborating empirical data
originating from virtually all disciplines of the physical and biological sciences.
The scientiﬁc community regards evolutionary theory as on of the most robust
and well-substantiated theories to date as evolutionary theory represents the
convergence of corroborating evidence from independent lines of scientiﬁc
investigation (http://www.msta-mich.org/downloads/about/2007-02-03.doc).

In biology, the underlying theme that is central to all life sciences is the theory of
evolution (Faber, 2003). In "Nothing in Biology Makes Sense Except in The Light of
Evolution" (1973) Theodosius Dobzhansky stated "Seen in the light of evolution,
biology is, perhaps, intellectually the most satisfying and inspiring science. Without that
light, it becomes a pile of sundry facts, some of them interesting or curious, but making
no meaningful picture as a whole"
(http://www.ncseweb.org/resourceS/articles/9256_cans_and_cants_of_teaching_ev_2_1 3
_2001.asp). Unlike physical science that is searching for an underlying theme, biology

has one, evolution. All of the biological sciences ﬁt under the umbrella of evolutionary

sciences (Faber, 2003). It is the mechanism for studying the many interesting questions
1 1

that face biologists today (Rutledge and Warden, 2000).

Evolution explains how various organisms developed from common ancestors,
through the process of natural selection acting on variations within populations leading to
the development of new species. It is supported by many different lines of research and
data, from the many variations of ﬁnches that Darwin discovered on Galapagos Island to
the modern ﬁeld of genetic technology. DNA has been used in determining if the extinct
group of humans known as Neanderthal man are related to modern human or were they a
distinct group of Homo sapiens that could not compete with modern Homo sapiens
sapiens. Homologous structures and vestigial organs show the relationships that exist
between species and demonstrate a linkage to ancestors from the past. Homologous
structures of bat wings, whale ﬁns, and human arms are very Similar in design, thus
giving evidence of a common ancestor that lived millions of years ago. The appendix, a
vestigial organ, as well as many other useless organs, indicates that our ancestors may
have used these structures and through the process of evolution we have lost the function
of those organs. However, they have yet to lose the genetic material that leads to their
development. When comparisons are made between the embryo development of
different species, it becomes apparent that they develop in the same manner and utilize
many of the same genes in the regulation and development of the embryo, thus
demonstrating a common ancestry. The multitude of fossil ﬁnds throughout the world
has indicated that there have been many changes in organisms over the 3.5 billion years
of evolutionary history. When Donald Johansen discovered "Lucy," another critical piece
of human evolution was brought to light. Australopithecus afarensis, in Johansen's
scheme of thinking, should be linked by ancestry to Homo habilis and possibly modern
humans, whereas Richard Leaky would disagree with him. (Edey et al, 1989) Although

there is almost unanimous support for the theory of evolution, there can be controversy.

12

The controversy is not if evolution occurs, but with the details of how or when or what.

When teaching evolution, it is suggested that teachers do so in terms that make it
easier to carry out instruction. The ﬁrst guideline is to focus on the fundamentals, based
on four factors: variations, inheritance, time, and selection. The second point to consider
is what do you want your students to know and learn: plan out the concepts that you want
to use to develop the students' understanding of evolution. And ﬁnally, ﬁnd the resources
that you will require to carry out your task.
(http://evolution.berkley.edu/evosite/Lessons/index.shtml)

By using humans as an example when teaching evolution, the students' curiosity
will increase. By investigating lines of evidence, students will be able to make
phylogenic trees of hominid evolution. This can be achieved by examining models of
skulls of living hominids and their ancestors and by using molecular evidence of hominid
evolution (Nelson, 2007). By having students measure variations, as well as exploring
several lines of evidence, they will have an increased awareness of the nature of science.
This provides testable questions that can be answered through investigations, as well as
how evolutionary theory is supported (Flammer, 2006). Utilizing hominid Skulls also
helps to dispel myths such as humans evolved from monkeys or that there is no evidence
for the theory of evolution. By comparing hominid skulls, students begin to realize that
there are many differences between Homo sapiens sapiens and the other hominid skulls,
but that they also share characteristics that link them together.

It is also suggested that students may become more interested in learning about
evolution if they are aware of its importance to the biological sciences. Without the
support and evidence gathered from evolution, doctors would have to continuously go
back to square one when they are confronted by new viral or bacterial pathogens.

Doctors would be unaware of how vaccinations and the development of antibodies could

13

be used in combating many different ailments. The attempted management of the bird
ﬂu, HIV, or for that matter crop sciences and pest management all become uniﬁed under
the science of evolution. There are many practical uses that are adapted from the research
generated in biological science all uniﬁed by the theory of evolution (Nelson, 2007).

As we try to enlightening our students about the nature of science and the theory
of evolution, we must do so with great care. It is inevitable that some, if not many of our
students will be faced with conﬂict between their religious beliefs and the science that
they are responsible for learning. We must take care to educate them in a manner that is
respectful of their religious and social beliefs, being aware that at the same time there
may be many different cultural and religious groups within a single classroom (Nelson,
2007).

It is important that students are aware of the differences in belief systems and that
of science (Scharmann, 2005) . When students ask if I believe in evolution, they are
stunned when 1 respond that I don't. Science is not about beliefs, but I agree that there is
overwhelming evidence to support it, therefore evolution is a theory of science. Science
addresses natural phenomena that can be empirically tested. There is no scientiﬁc means
to study supernatural events and, in the process, science is not a fair democratic process
but must pass the challenges of critical scientiﬁc scrutiny. AS teachers, it is important to
allow the students to negotiate through learning scientiﬁc explanations about the origin of
life without convincing them to reject their religious beliefs. To help them through this
process, a teacher could provide them with different ways in which others have resolved
their personal views on evolution (Faber, 2003). Lee Meadows et al (2000) stress that
changing personal views is very troublesome; students that are forced to change their

views on religion may experience great anxiety and stress, which is a dangerous situation.

14

DEMOGRAPHICS

I teach for Kent City Community Schools which is located in northern Kent
County, Michigan. The 2000 United States census showed 1,094 lived in the village of
Kent City. It is described as a bedroom community in which the average travel to work
is 22.2 miles. This conservative community is composed of 82.9% Caucasian and 11.9%
Hispanic or Latino people. According to the United States Census Bureau, 79.7% were
high school graduates, and only 7.4% had a bachelor's degree. The average for the United
States is 24.4% with bachelors degree or higher. The median family income in Kent City
was $42,375, below the United Sates average of $50,046 in 1999 dollars. There were 28
families, and 128 individuals that were listed below the poverty line. The community is
composed of young families and individuals, the median age 28.1, with 66% of the
people being 18 years old or over, and those under 5 years old make up 8.8% of the
population (http://factﬁnder.census.gov/servlet/SAFFFacts?event=&geo_id=l60). The
community is home to many large orchards that are known for growing apples and
cherries, as well as peaches and apricots. There are many small dairy and cattle farms
found in the communities surrounding the the Village of Kent City.

In the 2007-2008 school year, there were 1,358 students that attended Kent City
Community Schools (preschool-12), of which 20.76% received free lunch and another
8.69% received reduced lunch. The student body was composed of 90% Caucasian, 9%
Hispanic, and the remaining students were identiﬁed as Asian, African American and
Native American. All of the Asian students were foreign exchange students. There were
423 students who attended Kent City High School, for the 2007-2008 school year. The
MEAP science scores for the 11th grade class of 2008, were as follows: 13.5% were
given a score of level 4 (Apprentice), 13.5% received a level 3 (Basic), 65.2% received a

level 2 (Met), and 7.9% earned a score of level 1 (Exceeded). The state averages were

15

25.0% at level 4, 15.2% at level 3, 54.4% at level 2, and 5.4% at level 1

( http://www.michigan.gov/mde/0,1607,7-140-22709_3 l 168_40135---,00.html).
According to an exit poll of graduating seniors in the class of 2008, 74% planned on
acquiring a post secondary degree, 3% planned on attending a trade school, 9% planned
to enter the military, and 14% planned on entering the workforce.

I have been employed by Kent City Community Schools for 16 years. I am one of
three full time teachers that compose the high school science department. For the duration
of this research project I taught 5 sections of biology. Students follow the sequence of
classes: as freshmen they take Applied science, which consists of units covering space,
weather, chemistry, geology, and rock cycles. They then take biology as sophomores and
as juniors and seniors they have Anatomy and Physiology, Chemistry I and II, and
Physics as optional classes. The largest biology class contained 26 students, and the
smallest class had only 12 students. There were 98 students who participated in biology
this year, of whom 46 were female. The majority of students were identiﬁed as
Caucasian, while 8 were identiﬁed as Hispanic. Three Hispanic students were
participants in the research project. Twelve students qualiﬁed for special education
services, or assistance through a 504 plan, and an additional fourteen students were
identiﬁed as needing academic support. These students participated in an academic
support class for one hour per day in which a teacher assisted students in becoming more
proﬁcient in completing the needed tasks for their classes. Fifty-eight students
participated my research, 30 females and 28 males. Of the 58 students, six were eligible
for special education services or accOmmodations through a 504 plan, and four were

placed into an academic support class.

16

IMPLEMENTATION

The implementation of the new state standards, which emphasized evolution to a
greater degree, allowed me an opportunity to develop an evolution unit. The newly
developed unit allowed students to learn evolutionary concepts through a hands on
approach. The evolution unit utilized laboratory activities, which allowed students the
opportunity to use the process of science in developing a scientiﬁc view of the origins of
life and the process of evolution. The unit began with the history of life, which was
followed by natural selection, and ﬁnally human evolution.

Parent consent forms (Appendix I, B) were sent out at the beginning of the 2007-
2008 school year and were returned by October 31, 2007. The consent forms explained
the purpose of the research project and asked them for permission to use their children's
photograph and classwork in the research project. The student consent (Appendix I, C)
forms were handed out in class after they were informed of the purpose of the research.
The pre-survey was administered by Kelly Hartley, the chemistry teacher, the day the
evolution unit began, April 14, 2008.

Students began the school year collecting and classifying insects. In doing so,
they were introduced to classiﬁcation and evolutionary principles from the beginning of
the school year. Eventually, the students covered cells and organelles, and learned that
the mitochondria and chloroplasts were similar to bacterial cells, thus providing more
evidence supporting evolution.

After we studied genetics, we then began the evolution unit. In the genetics unit,
students learned about the role of DNA in determining an individual's characteristics and
how DNA is passed to the offspring through sexual and asexual reproduction. In the
process of meiosis, genes and alleles are recombined creating new variations. Students

became aware that there were many variations among individuals in the classroom. We

17

looked for traits that could be observed easily by students. The students determined how
many of their classmates had a widows peak, hitch hikers thumb, tongue rolling ability,
ability to taste genetic taste papers, as well as many other characteristics.

This was followed by a study of the role of artiﬁcial selection in the development
of food crops and pets, including the role artiﬁcial selection has played in developing
chickens for the use in tying ﬂies. I have a collection of chicken hackles and feathers,
that span approximately sixty years of breeding. The feathers that my dad used in his
youth, for tying ﬂies, differ greatly from the quality of the feathers obtained from the
chickens today.

I can directly demonstrate how mutations may affect an individual and can have
positive, negative, or neutral affects on the individuals. I have a syndrome known as
Poland's syndrome. It has caused my left hand to be much smaller than my right hand
and I am also missing my pectoral major and minor muscles. My left hand becomes a
unique teaching tool. I explain to the students that when I was growing up I loved to play
sports, but it was very difficult shooting left handed lay ups, which exempliﬁes how
mutations can be negative. They became curious and began asking questions. Inevitably
someone asked if it is good for anything. This gave me the opportunity to demonstrate
how I can get my left hand into tight spots and manipulate tools and small pieces of
equipment easily. I also have the ability to grab pickles out of jars much easier than
anyone else in the classroom. This was a trait that my grandmother and mother disliked.
When I was young, I would pull pickles out of jars, contaminating the pickles for anyone
else who wanted to eat them. All this information prepared the students for our last unit,
which uniﬁed the entire year. We ended up where we began the year, with evolution. The
evolution unit that I developed in the summer of 2007 is summarized in Table l. The

Simulating Radioactive Decay of Carbon ‘4 (Appendix H, A) and Human Evolution:

18

Hominid Skull Comparison (Appendix II, B) labs were the only labs that I have used in
the past, both of which were altered for this project. I normally have great time
constraints at the end of the year, which prevented me from implementing more labs. I

was also pinched for time because of the ﬁve days lost to snow and ice during the winter.

ment

est

on on
ting the Radioactive Decay of Carbon-l4
on ng

on

Time Line
me
est

19th Cen

Variations of Seeds within Species of Maple 'Ii'ees
B Blitz

Variations
on variations, sources
of Structures
lines evidence
of Amino Acids
lines of evidence continued
Birds

15
15 Natural Selection and the Evidence for Evolution
16 Human evolution

of Hominids
ossil and Migration Patterns in Early Hominids

Evolution: Hominid Skull Comparison
on

 

Table 1. Evolution Unit Lesson Plan

19

The unit began with a discussion of the difference between science and religion
and how each is used to answer different types of question about our existence. We had
an open discussion on belief systems and what different people believe. Many students
asked why I don't teach creationism. They suggested that all ideas about the beginning of
life should be discussed. My reply was that I teach science, not belief systems. The
school could offer a class designed for religious studies, and if I were asked to teach it, I
would teach all stories of Creationism from different religions and cultures. In general,
the students want only their interpretation of Creationism to be taught alongside of
evolution, not all the other religions. This provided me an opportunity to address the
differences between science and religion. Science must be non-biased, supported by
measurable and reproducible evidence, and independent of their religious beliefs. The '
basis for all scientiﬁc information is the data and evidence that supports it. In the
discussion, I tried to convey that it became a personal process and that people combine
their religious beliefs and the scientiﬁc world in some manner. But there are some people
who reject either science or religion completely, in determining their own personal
philosophy of the origins of life.

The students were asked to answer questions on pre-test and post-test and perform
several tasks on the different laboratory activities. For each of the lab activities, they
were given questions that had to be answered. Many of the activities had tables, charts,
and graphs that had to be ﬁlled in as well. Even though the students worked with teams
or partners on many of the lab activities, each student was responsible for his or her own
answer Sheets. Working with other students allowed them to share data and discuss
results prior to turning in their work. The students were also asked to make comments
about each lab and to rate them. They rated them from one to ﬁve, ﬁve being the lowest

score and one being the highest score.

20

Review of Activities
Simulating the Radioactive Decay of Carbon-14 (APPENDIX 11, A)

This activity allowed students to work on their graphing skills, a skill that the
science department at Kent City has considered to be a weakness among the students
taking science courses. Students worked individually on this activity to visualize how the
half life of radioactive substances are used to determine the age of given artifacts and
materials. They cut the red licorice, which represents the amount of C”, in half by its
length. The licorice was placed on graph paper and remained in place until the students
can no longer cut their licorice in half. When all the licorice was cut, they then drew a
curve demonstrating how radioactive substances decay at a constant rate. They got an
image that allowed them to visualize what happens to the amount of C” as it decays into
N”. The students were then asked to determine the age of given "fossils" by using the
graph that they generated. AS they cut the licorice it became apparent that at a certain
point they would not have enough C” remaining to accurately measure the age of a fossil.
Human Evolution: Hominid Skull Comparison (APPENDIX 11, B)

A few years ago I had the opporttmity to listen to Ginny Lambert, discuss using
hominid skulls to teach evolution, at the Michigan Science Teachers Association
conference. I was introduced to the thought of using these skulls to teach evolution of
hominids. In this activity, students, working in teams, measured several different
morphological characteristics of hominids skulls in order to compare them to each other.
Their data allowed them to develop a phylogeny of hominids. By handling the skulls,
students gained insights into Hominid evolution and in particular that of humans. The
students learned the role that fossils play in assisting scientists in developing and
modifying the theory of evolution. They began to see the different characteristics and

how they were related from one specimen to another. The skulls have many

21

characteristics that provided evidence as to how the hominids moved, their intelligence,
and diet. By comparing the skulls of chimpanzees, gorillas, and humans, students
recognized that the chimp skull Shares many characteristics with those of the gorilla and
human. When they were ﬁnished examining the skulls the teams were asked to develop
phylogenic trees demonstrating that they comprehended the evolution of hominids.
Much debate occurred as they began to place the skulls, in sequence from oldest to more
recent species and tried to determine which species is the ancestor to the other species.
The question that they asked most often was how correct their prediction was to the right
answer. My reply was the scientiﬁc community debates how to interpret the data, but
that the debate was in the details not about the theory of evolution.

Evolutionary Time Line (APPENDIX 11, C)

This activity was adapted from the biology book that Kent City High School used,
Biology: The Dypamics of Life published by Glencoe McGraw-Hill. The time line that
is depicted in the book visually misrepresents the amount of time for each period of time
for the history of the Earth. The time line is not uniformly scaled from the beginning of
Earth to the present. The Precambrian is presented in a linear format that makes it appear
shorter than it Should be. To improve the student's perception of the geological time
scale, they used a 5 meter length of cash register tape to make a time line that accurately
represents the Earth's history. On the time line, the students labeled each era, period, and
drew the major life forms that were present in each period. The students realized that the
Earth is extremely old and that mammals have been the dominant life forms for a short
length of time and humans are a new species, present on Earth only a sliver of time.

A 19" Century Journey (APPENDIX 11, D)
The students mapped out Darwin's journey as he traveled on the HMS Beagle. His

observations during that epic journey allowed him to develop his theory of evolution

22

based on natural selection. As they mapped out his journey, it became evident that the
journey was very long and allowed Darwin to visit many different countries and
locations. The types of organisms that were collected and the number of variations made
a strong impression on the young naturalist. The students read excerpts from his journal
and draw pictures of the observations made by Charles Darwin. The students began to
understand the importance of variations and the impact that islands have on speciation.
Variations of Seeds within Species of Maple Trees (APPENDIX 11, E)

Several seeds were collected from four different species of maple trees. The
students were given ﬁfty seeds from one species of tree and asked to sort the seeds
according to the overall length of the seed in millimeters. The seeds were then placed
onto a graph, made on a piece of poster board and glued neatly in place. The mean,
median and mode were determined for seeds plotted on the graph. When students looked
at the seeds produced by maple trees, it became evident that there were not only
variations between the several different species, but also within a species of Maple trees.
This provided an excellent visual and allowed students to work on their graphing skills.
Bead Bug Blitz (APPENDIX 11, F)

One of the most important concepts involved in the study of evolution is the role
that variations within a species play in natural selection. Some variations give
individuals advantages while others greatly impede their success and survival rates. In
this activity, students gained a ﬁrst hand experience in how variations that exist within a
model population can play a role in the species' survival or extinction. The students were
given a piece of cloth as a habitat and three different colored beads that represented the
prey. Students acted as predators consuming the beads. The selection of the prey was
determined by how quickly the students could visualize and grab a bead. Some of the

variations were favored to survive based on their ability to camouﬂage into the

23

environment. The surviving beads were allowed to reproduce prior to predation. After
several seasons of predation and reproduction, the beads were placed in a different habitat
and the process was repeated. The success and survival rates for the beads varied with
each habitat. Natural selection acts on variations within a population or species. Those
that were favored survived and reproduced, causing changes to take place in the species
overtime. Student realized selection pressures were pivotal in the ability of a species to
survive and adapt or slip into extinction.

Human Variations (APPENDIX 11, G)

This activity was an excellent extension to the genetics unit in which students
determined the frequencies of phenotypes of their classmates. As a class, we determined
the ﬁequency of several characteristics such as tongue rolling ability, widows peak, the
ability to taste genetic taste papers, or those with hitch hiker's thumb as well as many
others. This activity allowed the students to move around and measure variations that
exist within the human population. Working in teams of four, they measured the length
of the arms, legs and hand spread of their classmates. The mean, median, and mode, for
each class, were determined for the hand spread. The students developed hypotheses
about the advantages and disadvantages of having different sized hand spreads. The
teams of students were then asked to measure two variables of their choosing as long as it
was appropriate for the class. This activity almost became a Show and tell session.
Students began to Show each other their own weird little quirks and characteristics, such
as very small hands or very long toes and digits. This activity reinforced the fact that
there are many variations that exist in any given population and the basis for those
variations was found in each individual's DNA.

Comparison of Homologous Structures (APPENDIX 11, H)

From the beginning of the year, my students have heard that the bonobo (lesser

24

chimpanzee) shares 97-98% of its DNA with humans, making it is our closest living
relative. They have no conception of what that means, even though they have been told
that the bonobo looks like and behaves like we do. The students were given photos of
chimpanzee and human skeletons. They were asked to measure the length of the human
arm and compare that to the length of the human leg and determine the ratio of arm to
leg. They repeated the process for the chimpanzee arm and legs. They also measured the
bones that compose the arms and legs of the two species and determined several different
ratios between the bones to be used for comparisons. When they completed the task of
measuring all of the bones they were asked to determine how anthropologists can
distinguish bones of chimpanzees and humans and why this data could be useﬁrl if they
were to discover fossilized remains of some extinct hominid. This activity made many of
the students take notice of the similarities. They have hands and feet with toenails that
are nearly identical in shape and structure. Is this by accident or due to common
ancestry?

Molecular Sequencing of Amino Acids (APPENDIX 11, 1)

Students were given a table that listed the amino acid sequence for beta
hemoglobin for several species of primates and one mystery animal that was later
identiﬁed as a horse. Each student determined the number of differences between each
species and used that information to develop a cladogram. They began to realize just
how closely related chimpanzees, gorillas and humans are. Not only do chimpanzees,
like the bonobo, share approximately 98 percent of their DNA with us, but also several
skeletal, behavioral, social characteristics as well. This close relationship can be
demonstrated by not only looking at the skeletal structure of each species, but by also
comparing biochemistry between the species. The development of a cladogram helped

students gain an insight into how anthropologists determine the evolutionary relationship

25

that exists among organisms and the thought that all the primates found today have a
common ancestor. This information became just one of the tools and pieces of evidence
that are used to support the theory of evolution.

Clip Birds (APPENDIX 11, J)

In this activity the students utilize a model that shows the concept of geographical
reproductive isolation. The clip birds become segregated after a dispute and now are
located in East and West Clip Land separated by a mountain. The students were
separated up into two groups and were given clips of three different sizes, that are used as
beaks. The clip birds must consume different types of foods on each side of the
mountain. The energy requirements for survival and reproduction were predetermined by
the teacher. The amount of food and its availability favored some clip birds while it
selected against other individuals. As students proceeded through the lab, it became
evident that natural selection acts on variations and will affect the survival rates of the
clip birds. Some of the clip birds went into extinction while others survived and
reproduced, thus demonstrating the role of reproduction and geographical isolation in the
process of speciation.

Fossil and Migration Patterns in Early Hominids (APPENDIX II, K)

The students were given a list of coordinates for several sites ﬁ'om around the
world where hominid fossils were discovered. They mapped the locations of the
Austalopithecines, Homo erectus, Homo sapiens neanderthalensis, and Homo sapiens
sapiens. As the students mapped locations of hominid fossils they began to realize that
the oldest hominid ﬁnds were iSolated in Africa. They then developed a hypothesis about
the birthplace of hominids and how the hominids spread throughout the world. They

noticed that in North and South America there were only Homo sapiens sapiens present.

26

Chronology of Hominids (APPENDIX 11, L)

The students were given the dates of several hominid species and asked to make a
time line of hominid evolution. Students recognized that the species Homo sapiens
sapiens is a very recent development in hominid evolution. They noticed that there were
several hominid fossils that date back millions of years. The common myth that humans
evolved from monkey was dispelled. Many of the species of fossilized hominids were
not known by the students. They began to ask question such as: What happened to
Neanderthals and why did they go extinct? What was Homo habilis or Homo erectus as
well as the other hominids? Finally, the time line they developed was used to make a
phylogenic tree or cladogram showing the suspected relationships between the different
species of hominids. Students began to hypothesize about the origin of modern humans

and how they were related to the older hominids and other living primates.

27

Assessments
Evolution Pre-survey (APPENDIX III, A)

The Pre-survey consisted of two parts. The ﬁrst portion was composed of ﬁfteen
statements that asked the students to comment on how strongly they agreed or disagreed
with it. They could choose: 1 strongly disagree, 2 disagree, 3 neutral/no opinion, 4 agree,
and 5 strongly agree. The second portion asked the students to comment on their beliefs
and to answer questions that dealt with science and evolution
Pre-test Chapter 14 The History of Life (APPENDIX III, B)

Chapter fourteen pre-test consisted of three short answers and six multiple choice
items. The questions were associated with Earth history, carbon dating, and the history of
life on planet Earth.

Test 14 The History of Life (APPENDIX HI, C)

The test for chapter fourteen consisted of forty-one multiple choice and matching
items. There were seven essay and short answer questions that ranged from two points to
eight points. Some of the topics included fossils, radiometric dating, time line of Earth's
history, and research on the origins of life. Some of the scientists that were mentioned
included F. Redi, L. Pasteur, S. Miller and H. Urey, A. Oparin and S. Fox.

Pre-test Chapter 15 Natural Selection and the Evidence for Evolution (APPENDIX
111, D)

Pre-test 15 consisted often Short answer and essay questions. The questions
focused on natural selection and variations, as well as evidence that supports the theory
of evolution. The students were asked to comment on vestigial organs, analogous
structures and embryology. They were asked to deﬁne convergent and divergent

evolution and speciation.

28

Test Chapter 15 Natural Selection and the Evidence for Evolution (APPENDIX III,
E)

There were 24 multiple choice items on test 15 and 10 essay questions. The
multiple choice questions emphasized natural selection, evidence supporting evolution,
and selection types either disruptive, stabilized, or directional. The essay questions
ranged in point values ﬁom 3 to 6 points. Some of the questions concentrated on the
Hardy-Weinberg Principal and genetic drift. There were questions on evidence
supporting evolution, variations, and how speciation occurs.

Pre-test Chapter 16 Human evolution (APPENDIX III, F)

Pretest sixteen had seven short answer and essay questions that were related to
hominids and human evolution. The students were asked to comment on evidence for
human evolution, sources of variations in the human population as well as making
statements on adaptations and why they were important to human evolution.

Hominid skulls pre-lab (APPENDIX 111, G)

This assessment was also used as a pre-test for Hominid evolution. There were
nine short answer and essay questions. The students were asked to comment on
adaptations found on hominid skulls, including the importance of the Slope of the
forehead and the location of the foramen magnum. They were asked to discuss what they
knew about different hominids, some of whom are still living and many of the extinct
Species.

Post-survey (APPENDIX 111, H)

The post-survey was the same as the pre-survey. This was used to monitor any

changes in opinions or knowledge of evolution and concepts and terms that are used in

the discussion of evolution.

29

Evolution Lab Assessment (APPENDIX HI, I)

There were twenty essay and short answer questions which focused on the lab
activities that the students performed during the evolution unit. The questions were
worth two to Six points. There were four questions focused on adaptations and variations.
The students were asked four questions that centered on Natural Selection. The questions
revolved around selective pressures, extinction, and mutations. Four of the questions
focused on evidence for evolution, including radiometric dating, evidence that results
from fossils, and how relationships between species can be determined. Students
responded to two questions about speciation and the role mountains play in it. The last
six questions concentrated on human evolution and the evidence that supports it. The
students were asked to respond to questions about hominids and human evolution. They
were asked to compare and contrast hominid skulls in particular human, chimpanzee, and
gorilla skulls. They were then asked to describe the pattern of hominid migration. The
last four questions were opinion questions that asked the students to comment on the
evolution unit and the labs.

Chapter 16 Test Human evolution (APPENDIX 111, J)

Due to the lack of time, test Sixteen was placed into the ﬁnal exam. It consisted of
forty-two matching and multiple choice items, questions thirteen to thirty-eight and
questions one hundred and one to one hundred and sixteen. The questions focused on
characteristics of human and chimpanzee skulls, and the different species of hominids.
Evolution Assessment and Final examination (APPENDIX 111, J and K)

The ﬁnal exam was composed of two parts. The ﬁrst part had ten essay and short
answer questions and the second portion was made of one hundred and sixteen multiple

choice and matching items.

30

Evaluation

The students' ﬁnal grades were the result of combining laboratory scores, test
scores, and homework. On all the laboratory activities the students were graded on how
well they performed the desired tasks. The lab assignments were graded on how well the
students responded to the questions, did they provide evidence from their data, and
throughly and properly explain their ideas. Many of the questions could be answered
directly from the lab activity and the data that they collected. I looked to see if they had
the data tables properly ﬁlled in and checked the graphs making sure they were properly
designed and labeled.

On the pre and post-test essay answers, students were graded based on three
components: Did they express their ideas in a manner that demonstrated knowledge of
the topic? Did they provide a correct deﬁnition for the term or terms of the question and
did they use them in the correct manner? Finally, did the students provide proper
examples for their responses, demonstrating that they understood the context of the
question? For a four point essay question, the students would need to deﬁne the terms
properly and provide one or two examples to obtain the four points. If they provided just
an example or just a deﬁnition they received two points. For the pre-tests and surveys,
students received ﬁve points for making an effort on answering the questions. The test's
format was multiple choice, matching terms, some short answer, and essay questions.
The lab assessment and evolution unit assessment were written response questions only.
The ﬁnal exam for the class was made up of several multiple choice questions, some
matching items and ten written response questions that were used as the evolution unit

assessment.

31

RESULTS AND DATA

The students were given a pre-survey at the beginning of the unit and the same
survey at the end of the unit. This information was used to determine if the students'
perceptions and ideas about evolution changed aﬁer completing the unit. There were
ﬁfteen questions in which the students were asked to respond by indicating if they
strongly disagreed, disagreed, had no opinion, agreed, or if they strongly agreed. The

students were also asked to respond to ten short answer questions. (Tables 2 and 3)

32

N 50:25 P 3.30:0 .2 0230.002. 05 0:0 02:00... 05 .0. 002.800.. 05.00800 300 .N 0.20...

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

8.: 00. 5 00.8 F o 2 om a 02308.. as... .8 0....
..o boa...— 05 .8.“ 00:00.0 Loon 0025.5
3.3” 3.0m mm. 3 m t 3 2 w 0230.05 35 .05 000—0835 m. 230.. :38 05. .N.
R.» 3.3 3.2. F v w 5. an 0330-33.
No.2. 3.3” 8.8. o m cm 2. 9 32:00.5 .Eo 0.80» coed .686 m. 5.30 0:... .0
wN.u_. 2...: 8. K m w m 0.. mm 02:008.".
.08.“ 088 05
36w 2.9 3.3 w or m 3 t 02:00.... 00 0800.8 0.83 6.80 :o 3.00% 3.22 .m
modm 8.9m Ed m «N «N v _. 0230.39.
0.08 0w0=0w
No.3 3.3 N09. m on S n N 02:00.5 .8032: 0 3 .0003. 0.8 0.80.5090 ..V
mos 3.9 2.8 _. m s cm mm 0230.59".
dew 3.3 2.8 F m S cm 3 0230-05 ..EEE £0.20 0.8 28.05::— <ZQ .m
cc. 5 mm. 5 No.» 3 R 9 ... o $230.50.".
.0000» mo 00:00.35 Low 808::
no. ..m on. 3 maﬁa m 9 VN NF m 02:00.... .3 .0003 :009 8.. 5.80.8 .3352. .N
52mm 3.3 00.0 mm 2. o o o > -
02:0 «won. €090.33
2.8 0nd...” 010 3 3 3 m 0 0230.05 0 .6 3380:. 55.3 30.00 co..0:0> ...
00.2 8.53
.x. 950.302 00.0005 00me 5.53 00500.0
.Soh as. .08... o\o .08.. zocobw 00.9.. 250.302 005005 29.95 00>... >025 c3030

 

 

33

.0. 50:9... 0 ..0..00:0 .0. 020.08 0... 0:0 02:00.0 0... .0. 00000000. 00.00800 0.00 .0 0.00...

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

0*. r0 no. —.N VON? DP ON N_. N m >023muumom 60T¢< 500%
3.00 00.00 .000 0 0 00 0 0. 02:00.0 3.2.0.... 0.8.0.... .0... 28... .8... 0. .. .0.
00.00 00.00 00.00 0 m. 0. 0.. 0 02:0...000
00.008
00.00 00.0N 00.0.. N. 0N N. 0 0 02:00.0 0.0... 0.000 00080.. .0... 00.0.0 00..:.0>m ....
00.3 ...0. ..N 00.00 N 0 N_. FN t. 02:0-.000
0.000..
.....m 5.0N No.00 .. N 0... 0N N.. 02:00.0 0.00.0008 a. 00.20000 .0: 0. 00.3.05. .m.
00.0. 00. .0 3.00 0 0 0. N. 0N 02:0-.000
0....NN mnNm 00.00 0 0.. 0.. t 0 02:00.0 00.3.00 .0. 00:00.0 0.. 0. 0.0.... .N.
00. .N 00.... 0.00 0 0 0 0. .N 02:0-.000
.. 2000:... 0. 00:00.0
mo. ..0 00.0. N000 n .... 0 NN N.. 02:00.0 0.. .0 0...: ......» 00000 0 .00.. 0. 200... < ...
00.0» 0N.N.. 0N.N. 0. ..N n m N 02:0-.000
00:00.00. 0:0 022:0 0. 80.0008 :0 ..0
05N0 00.0. 00.0 0 0m 0 N 0 02:00.0 2:30 0... 0. 80.0008 :0 ..0 000:... 0.... .0.
00.0N 00.: 00.0... m .... 0 _. MN 0 .. 02:0-.000
00.0000
3.0N ......N N». ..m m E. 3 NN 0 02:00.0 2.80.00 0.0 00.0.0000 0 00 0008:: .0
3N... 00. S 0... ...N 0 0. 0. 0 0 023.000
0.00.. .0 00:00:05 .0. 5.00 ..0 0000
00.0.. 00.00 00.0. n 0N 0N 0 N 02:00.0 00... 000. 00.0000... 00.0000 202 .0
00.0< 00....00
. . 00.0005 00.00 00.0.00 00.0006
.0 0.50.502 . 00.0... . . 00.0005 .
.0. 0 ... .x. _0.0... 0.. .000 2009.0 0.50.502 2002.0 0 0 2.. 02:0 ..0..00:G

 

 

 

 

 

 

 

 

 

 

 

34

When the students were asked if variations exist within members of a population
two students disagreed, nineteen students had no opinion, eighteen students agreed, and
nineteen students strongly agreed. When asked the same question at the end of the unit
thirty-two students replied that they strongly agreed, and nineteen agreed that variations
do exist. No one disagreed about the existence of variations.

Prior to the unit twelve students disagreed and three strongly disagreed with the
statement that humans have used artiﬁcial selection for thousands of years. Twenty four
students had no opinion, thirteen agreed, and only ﬁve strongly agreed with the
statement. The post-survey showed only four disagreed, eighteen had no opinion and
twenty agreed with the statement. Fourteen students strongly agreed that humans have
used artiﬁcial selection for thousands of years.

On the pre-survey eleven students strongly disagreed with the idea that mutations
are always harmful. On the post survey, that number increased to twenty six individuals
strongly disagreeing that mutations are always harmful. Prior to the unit, twenty-six
disagreed that mutations were always harmful on both the pre and post-survey only one
person strongly agreed with the statement.

The only question that showed a reversal of understanding occurred with question
number four: Organisms are linked by a universal genetic code. Thirty-eight individuals,
of which eight strongly agreed to question four. Nine total students disagreed, two of
which strongly disagreed. The post-survey indicated that eight students strongly agreed
with the thought of a universal genetic code, but only twenty-two agreed with the
statement. Eleven students had no opinion and in the end twenty-two students were of no
Opinion.

When the students were asked if most species were created at the same time a

total of thirty-six students disagreed, seventeen strongly, and fourteen students agreed, of

35

which four strongly agreed. Eight students had no opinion, at the beginning, while only
nine had no opinion in the end. On the post survey, a total of seven students were in
agreement that most species were created at the same time, three strongly agreed, and
forty one students disagreed with that statement. There was an increase of twelve
students who strongly disagreed in the creation of species at the same time.

One of the misconceptions that emerges when teaching evolution involves the age
of the Earth. When asked if the Earth is 6,000 to 10,000 years old, only a small number
of students responded in a positive manner. Six students strongly agreed, and three
students agreed with that statement, while twenty had no opinion. Twenty-nine students
disagreed with the statement, while eighteen of the students strongly agreed, on the pre-
survey. The number who had no opinion dropped to eight students and eleven disagreed.
There was an increase of fourteen students who strongly disagreed to an "early Earth".

The second misconception with the theory of evolution involves the scientiﬁc
evidence that has been gathered. Many students have the opinion that there is little fossil
evidence supporting the theory of evolution. On the pre-survey twenty students
responded that they agreed with the statement that there is poor evidence provided by the
fossil record. Three of those students indicated that they were in strong agreement.
Another fourteen students had no opinion and and twenty-four students disagreed with
that statement. Only ﬁve students strongly disagreed with the question that the fossil
record is incomplete. When the students were asked the same question on the post-
survey, only ten students had a favorable view for a lack of fossil evidence for evolution,
one strongly agreed. A total of twenty-nine disagreed that there is poor evidence supplied
by the fossil record. This was an increase of ﬁve students.

"Newly discovered species have been on the Earth for thousands of years" when '

posed as a question showed little change in student responses between the pre and post

36

survey. A total of eleven disagreed, two of them strongly, with the statement. There was
an increase of three who were in strong disagreement and minimal changes occurred in
those that agreed in some manner with that statement. When viewing humans, students

~ were asked to reply to the statement: Humans as a population are perfectly adapted.
There was an increase of three students from pre to post-survey that strongly disagreed
with humans as perfectly adapted. At the beginning fourteen were of no opinion and
fourteen total students were in agreement with humans being perfectly adapted. There
was no change in the number of students who agreed and only ten had no opinion.

When asked as to identify the deﬁnition of ﬁtness as the ability of an organism to
survive and reproduce, there was an increase from nine to eighteen who strongly agreed
with that principal. This gain was offset by an increase of ﬁve total students who viewed
this as a negative.

Scientiﬁc terms are also difficult for students to grasp. The terms of theory, law
and hypothesis proved to be troublesome for the entire year. When questioned on a
theory as being just a guess with little evidence supporting it, eighteen students originally
agreed with that statement, six were of no opinion, and thirty-three students disagreed
with it. On the post survey there were noticeable gains in a healthier understanding of the
term, theory. Overall, forty-six students disagreed with the thought of a theory being
only a guess, of those twenty-one students were in strong disagreement.

Students also demonstrated a positive trend toward the understanding of
evolutionary theory and the evidence that supports it. Originally, twenty-three students
disagreed with the statement that there is no evidence for the theory of evolution. Only
six were in strong disagreement. On the post survey that number increased to to thirty-
two students, of which twenty strongly disagreed with the idea that evolution has no

evidence. Six students indicated on the pre-survey that they strongly agreed with an

37

unsupported theory of evolution and on the post survey no students were in strong
agreement.

Continuing with thoughts on evolution, the students were asked to respond to the
statement that evolution is not occurring in organisms today. There was no change in the
total number of students who disagreed with that statement; there was a change from
twelve to seventeen students that strongly disagreed with it when the pre and post-
surveys were compared. Only three students had indicated on the pre-survey that they
agreed with the idea that evolution is not occurring today and increased to eight students

on the post-survey. On the pre-survey, seventeen students had no opinion or were neutral

on the idea that evolution is not occurring today. On the post survey, the number dropped
to twelve students who had no opinion or were neutral.

The last two questions on the survey pertained to human evolution. The ﬁrst
question was in response to the misconception that evolution states humans evolved from
monkeys. On the pre survey twenty-three students were in agreement, and twelve
students strongly agreed with the statement humans evolved from monkeys.

Surprisingly, only twelve students had no opinion. The pre-survey also indicated that
only eleven students disagreed with that thought, while only ﬁve strongly disagreed. On
the post survey, sixteen fewer students agreed with that idea. Thirteen students agreed
and six students strongly agreed with the statement. In the post survey, nineteen students,
overall, disagreed that humans evolved ﬁ'om monkeys, which was an increase of eight
students. Nineteen students had no opinion on humans evolving from monkeys; this was
an increase of seven students.

The ﬁnal question dealt with human origins. On the pre-survey thirteen students
responded that they strongly disagreed with the statement that it is most likely humans
originated from Africa, while another eight students simply disagreed. There were

38

fourteen students, overall that responded positively to humans originating in Aﬁica. The
post-survey indicated that many students began to understand that burnans originated in
Aﬁ‘ica. Thirty-ﬁve students agreed, in some manner with humans originating in Africa.
That was an increase of twenty-one students. The number of students who replied that
they strongly agreed increased from ﬁve students to ﬁﬁeen students on the post-survey
and a gain of eleven students who agreed with humans originating in Africa. The total
number of students who disagreed, overall, with humans originating in Africa dropped by
eleven students. Only three strongly disagreed with that statement.

The students were asked to respond to ten short answer questions based on
content knowledge. Some of the questions simply asked them to deﬁne a term and other
questions asked them for additional information by either explaining their answer or by
giving examples.

Students were ﬁrst asked what science is. On the pre-survey most of their
responses were simple. They either gave a quick example or said that is was the study of
"things. Some of the "things" included living animals, the study of living and nonliving
things or the development of technology. Often students chose a ﬁeld of science as the
deﬁnition of science, mainly biology or living sciences. Other topics that students used
were the study of the earth or space. One student stated "Science is life. It's how things
live and adapt. How things were created. It's living and nonliving things. What
elements make up something. It's everything in everyday life." Another student
expressed science in the following way; The knowledge (and search of it) about
everything related to nature, life chemistry...", Two students did not respond to the
question and one student responded with "lies". Many of the responses were the same on
the post-survey. One student answered the question with the statement "It is ideas and the

quest to prove them". A few students expressed science as making observations and

39

learning, the grouping of facts and unanswered questions. One of the better answers from
the post-survey was as follows: "I think science is something that tests and discovers
different things, about many things such as the universe, life, nature, water etc".

When the students were asked on the pre-survey what science is based on, many
of the students responded that it is based on biological subjects, knowledge, "studying
and learning for better understanding". Twenty-four students replied that it was based on
the Earth, humans or some other object. Twenty-nine students included one or more of
the following terms in their explanation; theories, laws, facts, observation, hypothesis or
the results of experimentation. On the post-survey, fewer students responded with
examples of objects such as the Earth or humans. Thirty students responded that science
is based on terms used in science such as laws, theories, observations, hypothesis, etc.
One student stated "science is based on "observations, facts, proven theories and
opinions". Another student suggested that it is based on "theories and ideas, wonder and
questions to ﬁnd answers".

When asked to deﬁne a fact, the students had difﬁculty explaining and giving an
example. They tended to do one or the other. Thirty-seven students used the word
"proven" in the pre-survey while thirty-one students used the word "proven" in their
explanation on the post-survey. One student mentioned that a fact is "Something that is
true. Example: There is gravity on the Earth". Other statements were similar to the
following "My hair is brown. A fact is something that can be proved [sic]." On the post-
survey seven students responded that a fact is based on a proven law or theory or a
proven hypothesis or question. On the pre-survey only two responded in that manner.
On the post survey one student used his knowledge gained from the evolution unit when
he stated; "A fact is something you know is true like humans have opposable thumbs

thats' a fact [sic] ".

4o

Although on the opinion portion of post survey the students demonstrated that
they understood what a theory was, they had difﬁculty explaining it in their own words.
Pre-instruction eight students responded that it is not "completely proven" or it is "not
100% correct, and one person responded that it is an unproven law. Four students
remarked that it is proven but there are still questions about the information. Seven
students noted a theory as an educated guess. Only eight students commented that it is
supported by facts, while on the post survey twenty students made statements that were
more accurate. They made comments along the lines of a theory being a widely accepted
idea, backed by many lines of information. One student explained that a theory is "facts
and evidence from several places compiled together. While eight students simply stated
that a theory is a proven hypothesis and supported by data.

On the pre-survey sixteen students differentiated a theory from a hypothesis with
comments that suggest that a hypothesis is an educated guess and a theory is supported
by evidence. Four students said that a theory is a fact and a hypothesis is an educated
guess, and another seventeen students stated that a theory has more evidence than a
hypothesis. Many comments were similar to: a "theory has been tested, where as a
hypothesis is an educated guess" or a "theory has more evidence than a hypothesis". On
the post-survey twenty-two students responded that a theory is well-supported and proven
where as a hypothesis was deﬁned as an educated guess. They made statements of a
theory being widely supported and a hypothesis as an educated guess. "A theory is
proven many times and supported by evidence" or that "a theory is different because it is
backed by facts and research, where a hypothesis is just a " guess" were common
statements that were noted on the post-survey. Nine students had the idea that a theory
has more evidence that a hypothesis.

Students expressed many ideas as to why evolution is considered a theory. On the

41

pre-survey nine students agreed that evolution is a theory because it is widely supported
and accepted. The number of students who viewed evolution as a widely accepted theory
increased to seventeen in the post-survey. Thirty-nine students on the pre-survey
expressed the thought that evolution was a theory because of uncertainties, that it's not
agreed upon or it can't be 100% proven. Prior to the evolution unit, three students stated
that it was not 100% proven That number increased to eleven students at the end of the
unit. It was also suggested that evolution is not a fact or that no evidence exists for
evolution. That number decreased to twenty-two in the post-survey from thirty-six on the
pre-survey.

The last four questions asked for the opinions from the students regarding
instructional techniques. Fifty seven students implied in some form that labs helped or
assisted in their ability to learn. Many thought that hands on learning allowed them to
focus or keep their attention and that it allowed them to see how science worked in the
real world This was noted on both the pre and post-surveys. On the post-survey two
students stated that they did not like labs. One student actually thought that she preferred
listening to me lecture over labs.

The last three questions dealt with their opinion on evolution, how life on Earth
began, and if it should be taught in schools. The ﬁrst of these questions asked the
student: what is your opinion of evolution? On the pre-survey nine students did not have
an opinion and one student did not respond. Twenty students said that they don't believe
it and one student stated "that humans came ﬁom two people, Adam and Eve". One
student wrote "It is not true, it should not be told the way it is". Another student said "I
don't think people evolved (God Created) but I think the animals and plants are evolving.
Some of the students believed that God started all life but that it has been evolving under

his guidance. Three students were on the fence stating that there is evidence for

42

evolution but there is room for error or that there is a 50% chance of evolution occurring.
Eighteen students had a more positive view of evolution. The conﬂict of religion and
evolution is displayed in the remarks of a student who wrote "I think there is some truth
to it but I do believe in God". Surprisingly, only three students commented that man
evolved from monkeys. One student commented "I believe evolution could have easily
of [sic] happened. There are so many things around us that relate to it easily". On the
post-survey seventeen students were absolute in their conviction that evolution is not
true, that they believe in God Five of those who disagreed with evolution stated that
they understand the theory better or could state as this student did "I think it is false. I
don't believe we are hominids adapting over millions of years". One student took the
view of micro evolution when he/she wrote "I don't believe in it, [sic] species change but
they don't become new species." Eight students either did not put a comment or
responded that they had no opinion. Four students combined evolutionary theory with
their religious beliefs. As one student put it "I believe God put us here to evolve and
change". Seven students were confused as to what to think by making statements along
the line of : "I am a Christian but there are scientiﬁc facts". This was indicated by one
student writing "I'm a Christian, but kind of have a scientist mind, so I have no idea" The
debate of evolution and religion is perplexing for some of my students. The post survey
found that sixteen student were in agreement with the theory of evolution. One student
reasoned "I think is [sic] good, because we can understand better about the species and
their skulls." Another wrote that evolution "is true, it makes sense plus protocells [sic]
and other test make it seem real".

Initial results from the pre-survey indicated that one student was unsure and
twelve students responded that evolution should not be taught, due to religious conﬂicts

and the fact that evolution is unproven. Four students commented that it should be taught

43

but not forced, and one student remarked that it should be covered but not in depth.
Some of the statements were as follows: "I think that it is important that we learn it but
not to have it pressed upon us". Prior to the evolution unit, eight students were of the
opinion that both sides or all theories should be presented, as represented by a student
who wrote "all aspects of it and different ideas" or as another student said "Yes, it gives
people more options to choose from as a base of religion or opinion". Twenty-four
students said that they thought evolution should be taught in high schools prior to
beginning the unit. In the post survey, eighteen students stated that they thought
evolution should not be taught in public schools, which was an increase of six students.
Twenty-seven students felt that evolution should be taught. Students commented that "it
tells us how organisms have changed and are changing", "yes in science, it is something
that the scientiﬁc community believes, its [sic] like teaching addition in math class", or
"it is science and it shows where we came from". On the post survey two students
thought it should be taught, but not pushed, and ﬁve said yes as long as it was taught with
other theories. There was one student who wished to have the option of opting out of the
evolution unit, and stated so on both the pre and post survey. Three students suggested
that is good to know science even though it may conﬂict with the religious beliefs of
some students.

The ﬁnal question on the survey asked for their opinion on how life began on
planet Earth. Thirty-two of the students said that God had placed life here, and ﬁve were
not sure. Thirteen students indicated that life evolved and another ﬁve students said it
evolved with God's involvement. Two students were not sure because there are many
theories about how life began on Earth. The post survey found that thirty-one believed
life originated through God, six students were not sure and three students had no

response. Five students responded by using terms that were vague or joked by saying

44

things like "Chuck Norris". Five students mixed their religious beliefs with those of
evolution stating that God had a role in life starting then it evolved, and seven said life
began through evolution. One student explains that "life began with lightning and rocks

and all came together in a kind of storm with proteins."

45

Analysis of Laboratory Activities
The students worked with partners or in groups for several of the laboratory
activities, but were responsible for turning in their own set of questions and data for each

laboratory exercise. The grades for the laboratory exercises are shown in Table 4.

 

 

 

 

 

 

 

 

 

 

 

 

 

Average Average {dissing
Name of Lab 'Score Rating abs
Simulating Radioactive Decay of Carbon-14 75 2.3 -1
Evolutionary Time Line 82 2.31 0
A 19'" Century Journey 91 3.35 -2
Variations of Seeds within Species of Maple Trees 86 2.8 -2
Bead Bug Blitz 85 2.54 -1
Human Variations 81 NA -1
Comparison of Homologous Structures 79 2.56 0
Molecular Sequencing of Amino Acids 81 3.22 -2
Clip bird 77 2.65 -4
Chronology of Hominids 97 2.33 -3
Fossil and Migration Patterns in Early Hominids 86 3.82 -6
Human Evolution: Hominid Skull Comparison 86 3.7 -2

 

 

 

 

 

 

Table 4. The average scores and student rating of labs and the number of students who

failed to turn in their assignments ( 1=highest and 5: lowest score).
Simulating the Radioactive Decay of Carbon-l4

Students worked alone in this activity, although many students assisted each other

setting up their graphs. The average score for this activity was 75%. I had one student
who failed to turn in this laboratory assignment. Students rated this a 2.3 out of a scale of
ﬁve. Aﬁer they turned it in, some students told me they read the scale wrong and thought
ﬁve was the best score. I think this lab would have had a better rating than it received
simply because they ate candy. Most people did well on this activity, although some
failed to properly label their graphs or determine the intervals for the x and y axis.
Students also had a problem answering question that entailed mathematical skills and

46

interpreting graphs. One student commented that "I thought it showed half-life very well.
It was a very easy lab [sic] taught a lot of info."
Evolutionary Time Line

This activity received an average rating of 2.31. This was one of the labs for
which everyone turned in an assignment. The average grade was 82%. I was surprised
as to how well this activity went. I had students, working in pairs, spread throughout my
classroom, which is very large, in my storage areas, and out in the hallway. It took
students two days to ﬁnish and some took three days to complete the task. Some students
had diﬁiculty in interpreting the time scale that we used. Many students commented
throughout the day that this helped them put the time scale of the Earth's history into
perspective. Because the book's image portrays the Precambrian as a shorter line than it
should be, some students were confused by the fact that their time scale showed that the
majority of Earth history is contained in the Precambrian. Many students who had a
better understanding of math helped the other students ﬁgure out how to use the time
scale.
3 A 19'II Century Journey

Darwin's Journey rated 3.35, which was the third lowest rating (third highest
score) of any of the laboratory activities. The students worked alone on this assignment.
The students did not like this activity for two reasons. They disliked mapping out the
points along the route of his journey, mainly do to the fact that the map was too small.
Secondly, they did not appreciate having to draw the sights that Darwin saw on his
voyage. On the other hand, the few artistic students liked the opportunity to draw in
biology class. The average grade that the students received was 91%. Two students

failed to turn in a worksheet for this activity.

47

Variations of Seeds within Species of Maple Trees

This rated 2.8 and had an average score of 86%. Many students found it boring
to measure and glue seeds, but appreciated learning in this manner over lectures and
notes. One student commented that "It's a lot better than worksheets" and another said "It
showed the variation of all the seeds, but it was very slow and boring." The students
worked with a partner during this laboratory. Many of the students made comments
during this activity on all the variations in length of the seeds. It also gave them an
excellent visual for graphing the seeds by length. It was easy to determine the mode and
median for the data. Two students failed to turn in this assignment.
Bead Bug Blitz

On average, students earned an 85% and this activity received a rating of 2.54.
This activity allowed for more student movement and a greater opportunity to actively
participate working in teams of three. If students are working with a partner you may
need to reduce the number of times the student feeds in each habitat due to time
constraints. One student commented that "I liked it because it was easy to see the natural
selection, but the beads were small. It was fun to be hands on." Some student thought it
took too long, but overall students began to envision the role of natural selection on
variations in the environment. Only one student failed to turn in this assignment.
Human Variations

The student rating and suggestion portion of this lab failed to be copied. The
students seemed to enjoy this lab. We had already worked on some of the simple
Mendelian inherited characteristics within each class. This gave them the opportunity to
to work in teams of four. They measured hand spread, leg length, arm length and two
variations of their choosing. The students were free to move about the room, and

remained very active and on task. Several of my rambunctious students performed very

48

well on this activity. The average score was 81%. There was one student who failed to
turn in this assignment.
Comparison of Homologous Structures

This lab was an enjoyable exercise to observe. This was the ﬁrst time many of
my students began to recognize that chimpanzees and humans are similar in structure.
This activity was a partner project. They made comments about the shape of the bones
and noticed the ﬁnger nails and toe nails on the chimpanzee. The average grade was a
79% and the activity received a rating of 2.56. This was one of three labs in which all the
students turned in their assignments. Many of the students thought the directions were
easy to understand and follow. One student commented on the assignment "That I liked it
because it was interesting to see the different measures from a human and a chimpanzee".
other thought "It was fun learning about bones". Many of the students had difﬁculty with
determining the ratios for the lengths of different bones.
Molecular Sequencing of Amino Acids

This activity did not rate very high with the students. It received a rating of 3.22,
which was the fourth lowest rating overall. The average score earned by the students was
81%. There were two students who failed to turn in the assignment. Working on their
own, students determined the number of amino acids that different primates shared with
each other. This gave them an opportunity to make a cladogram using scientiﬁc data.
Many thought this lab was boring and not fun, while some students thought it was
interesting. One student remarked that "It's cool to compare species alike [sic] ". One
student suggested giving them pictures of each of the species used in the comparison.
Clip Birds

Although this lab had a rating of 2.65, there were four students who did not

complete it and turn in their assignments. This activity required the students to work in

49

two large groups. The average score was 77%. The competitive nature of the students is
expressed in this activity. They were very aggressive in attempting to keep their clip bird
alive and successfully reproducing by collecting enough calories. They were asked to
make predictions before starting the laboratory and explain their thoughts. Many failed
to follow those instructions which resulted in a lower score. The graphs that they made
were of a higher quality than those they made in some of our previous experiments. They
commented that the graphing confused them and that some found it boring. Those that
found it enjoyable made comments similar to "It was fun using the clips to grab stuff
especially when we had a time limit. One of my artistic students rated the activity a l
commenting that "You had to pretend to be a funny looking bird".
Chronology of Hominids

This activity received a rating of 2.33 which was good for a worksheet type
assignment. They worked alone and it was similar to traditional worksheet type
assignments. The average grade was 97%. Some of the students completed the extra
credit portion of this activity. There were three students who failed to turn this
assignment in. Many commented that they liked it because it was short and easy to
complete. There were only a few comments that were worth noting. One of those
comments was "It was cool to see how we evolved through time". Another student
remarked that "It helped put into perspective the time of evolution". The students worked
in groups of three to six.
Fossil and Migration Patterns in Early Hominids

This assignment received the lowest rating of all the activities, 3.82, and it also
had the highest number of students failing to turn in their assignments. The average score
was an 86%. This was a fairly easy worksheet that the students completed on their own.

The worksheet activities did not spark the interest in the students in the manner that I

50

thought they would. Although it dealt with human evolution and migration, many
students thought that putting dots on a map, again, was just no fun. One student gave it a
rating of ﬁve, but scored it a "22,000, to [sic] many dots" and the only way to improve
this assignment was to give "candy and pop". This sentiment was expressed by many
other students in one form or another. One student liked it "because it was interesting
ﬁnd the countries on the map". I felt that the students began to understand that hominids
migrated out of Africa throughout the entire world over a very long period of time.
Human Evolution: Hominid Skull Comparison

This was my favorite lab. Prior to beginning this activity I set the skulls out in
front of the class for a couple of days to prompt student questions. They manipulated the
jaws, looked at the characteristics and became curious as to what they are. Even though
this laboratory exercise is time consuming, and involved a great amount of effort from the
students, only two students failed to turn this lab in, one of whom simply quit coming to
school by the last couple of weeks. The average grade for this assignment was 86% and
it received the second lowest rating overall, of 3.7. Most students did not enjoy making
all of the measurements. One student found it disgusting to handle all of the skulls even
thought they were plastic replicas. One student commented that they "Liked seeing the
different skulls". Many of the students mentioned that it was difficult making the
measurements and that it was time consuming. Some of the other comments were: "It
was scientiﬁc" and "I learned a lot about the differences between the skull but it took a

long time to do". And ﬁnally one student stated "It was fun but really tough".

51

Analysis of Assessments

The students took three pre-tests and three post-tests. They received ﬁve points
for attempting to answer questions on each pre-test. I gave the students two pre-tests on
human evolution, covering different aspects of human evolution. The ﬁrst one was given
at the beginning of the unit and the second pre-test was given to the students prior to the
hominid skull comparison activity. On all the pre-tests, the students performed poorly,
averaging less than 26% on each pre-test. On the written response portion of the pre-tests
students often left answers blank or simply responded with, "I don't know" or "IDK".
See Table 5 for a comparison of pre-test and test scores, as well as the student scores for

their assessments and ﬁnal exam.

% score % scone %

Exam and

 

Table 5. Average scores for pre-test, post-tests and assessments.

The average grade received for pre-test fourteen, The History of Life, was 26%
(n=56). This was the only pre-test that I gave that was composed solely of multiple
choice items. The average score for post test fourteen, The History of Life, was 52%
(n=56). The high score was 102% and low score was 9%. The lowest score, for test 14,

was recorded by a student who later dropped out of the class. When the test was

52

analyzed by the type of question, the average score for multiple choice items was 50%.
The high score was 93% and the low score was 12%. The average for the essay questions
was 54%. The high score was 121%. This individual had a perfect score and completed
all of the extra credit tasks on the test. The low score was 4%.

Pre-test and post-test for The History of Life were compared to each other with a
Paired Student's t-Test. It was determined that at a 95% conﬁdence interval the
probability of the null hypothesis was 0.000. The null hypothesis was stated as there was
no statistical difference between the pre-test and test for unit fourteen.

For pre-test on Natural Selection and the Evidence for Evolution, the students
were given a questionnaire that was composed of essay questions and short answers.
They did very poorly on the pre-test ﬁfteen. The average score was 14% (n=56). The
average score for post-test ﬁfteen, Natural Selection and the Evidence for Evolution, was
60% (n=56) with a high score was 98% and a low score of 13%. When the test was
analyzed by type of question the average score for the multiple choice items was 59%
with a high score of 96% and a low score of 25%. The essay question average score was
61%. The high score for the essay portion of test ﬁfteen was 104% and the low score was
12%. To determine if the students showed an increase in test scores a Paired Student's t-
Test indicated that at a 95% conﬁdence interval the probability of the null hypothesis
being true was 0.000.

For test on Human evolution, the result were much the same as the previous two
tests. Only forty seven students were used in the post analysis for this test due to the fact
that there were several students that missed one or both of the pre-tests that were given
for this unit. The pre-test scores were determined by adding the skull pre-lab and the pre-
test sixteen together. The average score for the pre-test was determined to be 20%. Since

the Human evolution test was added into the ﬁnal exam, the questions for this chapter

53

were scored independently of the ﬁnal exam. The average score for the Human evolution
test, which was composed of all multiple choice or matching items, was 65%. The high
score was 93% and the low score was 38%. When the pre-test and test were compared
for the Human evolution test, the Paired Student's t-Test indicated that at A 95%
conﬁdence interval the probability of the null hypothesis being true was 0.000.

The lab assessment was given to the students on Tuesday, which was the last day
of class prior to the exams. The average score was 74%. The low score was 34% and the
high score was 98%. The exams were scheduled to be taken Wednesday through Friday
and lasted for one and half hours. The exam for this class consisted of a multiple choice
and matching section and an essay portion, which had ten questions. This test covered
the three sections of evolution. The essay portion of the test was called the evolution
assessment. A portion of the multiple choice test was used as test sixteen, Human
evolution.

The score for the exam was determined by adding the two portions of the exam
together. The average was 63%. The high score was 90% and the low score was 37%.
When the test was analyzed by the type of questions, the average for the multiple choice
items was 59%. The high score was 87% and low score was 34%. The essay portion of
the exam, evolution assessment, had an average score of 7 5%, with a high score of 100%
and a low score of 38%.

The students' overall grade point average (GPA) was compared to their
performance on the evolution unit. It was determined that four students performed at the
same level as their GPA, thirty students performed at a higher level than their GPA, and
twenty four students performed at a level below their GPA. The students' grade for each
semester of science was averaged and compared to the grade they received in the fourth

marking period of Biology. Eighteen students performed at level that was lower than

54

their science average grade, ﬁve students performed at the same level, and thirty-ﬁve

recorded grades that were higher than their science grade average.

55

CONCLUSION

In the 2006-2007 school year, the science department at Kent City High School
began to work on implementing the new state high school science expectations
(Appendix I, A). The standards for biology had a greater emphasis on evolutionary
concepts. The evolution unit at that time was lecture driven, with only two laboratory
activities for the students. Also, the unit was rushed through at the end of the year. It was
difficult for me to get my students interested in the topic and since there were many time
constraints, the unit received very little attention on my part. The lack of hands on
activities and the large amount of notes made it difﬁcult to assist the students in
understanding evolution. With this in mind, I began my research in the summer of 2007
with the plan to design an evolution unit that was lab driven, emphasizing activities to
increase my students' understanding of the nature of science and the concept of evolution.
I also planned to utilize the evolution unit to increase my awareness of what my students
perception of evolution was and what their religious beliefs were. The community of
Kent City has deeply embraced their mostly Judeo-Christian religious beliefs.

The student surveys indicated that many of them are deeply committed to their
religious faith. Several students made comments on the survey that they believed God
created the Universe, Earth and all that is on Earth, including Man. My goal was not, and
should never be, to alter or change their perception of religion or a theology based belief
system. My goal as a teacher was to present the theory of evolution in a manner that was
respectful of their personal beliefs. I am also aware that I need to teach the nature of
science and how science is based solely on evidence. Beliefs and personal bias have no
place in properly conducted scientiﬁc research. When pre-survey and post-survey
responses were compared, there was a large shift in their answers. There was a change of

30% ﬁ'om the pre-survey to the post survey when students were asked if humans have

56

utilized artiﬁcial selection for thousands of years. When asked if humans originated in
Africa, the pre-survey indicated that 24% of the students agreed with that statement. On
the post survey 61% responded (correctly) that humans originated in Africa.

After completing their exams, I had the opportunity to discuss with two students,
what they thought of the evolution unit. One of them said that she was confused. When I
asked her what she found problematic about the evolution unit, she remarked that she
understood the theory of evolution much better, but she was confused as what to believe,
religion or science. I told her that is a problem that many people struggle with and that
she will have to work it out and that many people ﬁnd a way to make the two worlds ﬁt
together and others don't.

By making this a laboratory-focused unit that utilized humans as an example the
students were allowed to view evolution from the perspective of scientists and as humans.
We compared the human species with several of the other hominids and primate relatives
that share our history and planet. The average rating for the laboratory activities was
2.87. The lower the score, the more the students liked the activity. The activities that
scored the highest were those that allowed for the students to actively participate and
engage in the activity. The highest rated activity was Simulating Radioactive Decay of
Carbon-14; it received a rating of 2.3. The mapping worksheets received lower scores
than the other activities. Although Fossil Migration Patterns in Early Hominids did
achieve its goal of showing the students where hominids and humans evolved, it received
a rating of 3.82. Six students failed to turn in their assignments, which was the highest
recorded number during the revolution research. The average score for all of the
activities was 84%. The highest average score, 97%, was recorded for the Chronology of
Hominid activity. Although they enjoyed the radioactive decay exercise, the average

score was only 75%. They had difficulties with the graphing and using mathematical

57

equations.

One of the attributes of allowing students to work in a laboratory based setting is
the amount of energy that the students put into the class. I found that behavior of the
class overall was much better than when the students were asked to take notes and listen
to lectures. Some of the students that were high maintenance and in need of constant
attention became more focused and less distracting when we were engaging in the
exercises. This occurred even though it was the end of the year in one of the warmest
rooms in the high school. There is a greenhouse attached to the west wall of the
classroom which generates a lot of heat in the classroom.

After examining all of the information and making observations during the
teaching of the unit my plans are to change a few of the activities. I plan to continue
implementing laboratory type activities throughout the year. There were several labs that
I worked on that I just could not do because there was not enough time. In the beginning
of the year, we began by classifying insects. The process of classiﬁcation has been
greatly inﬂuenced by evolutionary sciences.

Most of the labs will be used again without alteration. I plan on altering a 19th
Century Journey by giving the students the opportunity to view online images of the
sights Darwin saw and then have them draw the images. The map that I used was too
small, so I hope to provide large laminated world maps for their use when plotting the
points, which should reduce some of the confusion that the students experienced in this
activity.

I thought the Time Line activity worked very well. It allowed students to get a
visual image of Earth's history. For next year my goal is to have my students use photos
of several different fossils that can be viewed on the Internet and have them place them

on their time lines. This will give them a better idea of what life forms lived in the past.

58

One of the suggestions that the students recommended for next year was to give
the them photos of the different species of primates and hominids that were used in the
activities. Many students wanted to know what each of the primates looked like while we
were working on the Molecular Sequencing of Amino Acids worksheet. The images
could also be used to enhance the Human Evolution: Hominid Skull Comparison
laboratory. I also plan on improving the Human Evolution lab by giving the students
laminated images of several different artifacts and fossilized remains of the different
types of hominids. Many students were very curious about the different types of skulls
and how each species survived.

For next year I am planning on using appropriate examples of evolution
throughout the school year. I expect that this will increase my students' awareness of the
theory of evolution and the multiple lines of evidence the support it. I plan on using a lab
entitled Creating Phylogenic Trees Using Caminicules (APPENDIX TV, A) for the
classiﬁcation unit at the beginning of the year. This activity was adapted from Robert P.
Gendron of Indiana University. He developed computer generated organisms that allow
students to visualize how evolution results in the development of different species
through natural selection. The students are given pictures of the organisms and asked to
make a phylogenic tree, and then compare their tree to those of others. It permits
students the opportunity to recognize that not all scientists interpret the information or
sets of data in the same way, which leads to discussions on the nature of science. When
more evidence or data are generated the view points of scientist may adjust to the new
information.

The second unit explores the nature of science and biology. I plan on inserting the
lab Laetoli Footprints: Analyzing F ossilized Footprints (APPENDIX IV, B) in this unit.

This activity will allow the students to gather data on themselves and fellow classmates.

59

They will use the information to analyze foot length, stride length and height of modern
man and compare those measurements to the Laetoli footprints to calculate early hominid
height. This laboratory activity has many potential opportunities to use graphing as a
learning tool. This was a weakness in the students who participated in my research
project. This activity was adapted from Jennifer Johnson, and is available on line at
www.indiana.edu/~ensiweb/lessons/footleng.html. In a June 2006 interview Louis J.
Gross commented that students are not capable of carrying out basic quantitative
research. They are not able to read, interpret, or produce graphs, even simple graphs
(http://www.actionbioscience.org/education/gross.htrnl). Graphing can be a powerful tool
for summarizing complex information. The ability to make and utilize graphing skills
may help students understand and interpret data and determine relationships. Even
though graphing skills are an important principle in sciences many students lack essential
graphing skills (Ozgun-Koca, 2001).

Prior to the evolution unit, I taught genetics. There are two short activities that I
plan on using that use humans as their source of information. The ﬁrst activity, Genetic
Evidence for Evolution: DNA analysis (APPENDIX IV, C) will be used as an
introductory lesson for DNA ﬁngerprinting. The second activity will reinforce the
genetic difference between people and the role mutations play in the survival of humans.
The activity; When Milk Makes You Sick (APPENDIX IV, D), will allow students the
opportunity to learn how some mutations have assisted in the survival of humans. They
learn about the lactose tolerant gene and how this mutation allowed humans to use milk
from other species as a food source. The allele is not equally distributed throughout the
world. This activity was adapted from Therese Passerini.
(www.indiana.edu/~ensiweb/lessons/tp.milk3.htrnl)

Evolutionary science has been a hot topic since its conception. From its pre

60

Darwinian origins, many pieces of evidence have been discovered and brought to light,
developing multiple lines of evidence for evolution. When Darwin wrote On Origins of
Species: by Means of Natural Selection in 1859, the debate was brought to the forefront.
In a debate between Thomas Huxley, "Darwin's Bulldog", and Bishop Samuel
Wilberforce, Darwin's ideas were defended vigorously (Edey and Johanson, 1989). That
debate rages on in the hallways of universities, schools, and in the public domain to this
day, but does not exist among scientists. The perceptions that students bring into the
classroom have been taught and embedded into their thought processes for most of their
childhood is basically a non-scientiﬁc view of the world. Many science teachers avoid
the conﬂict by not teaching evolution or lightly touching upon the topic, thus denying
young students the opportunity of gaining any knowledge of the theory of evolution and
the nature of science. In the process of education, our students need to increase their
awareness of humans are and the importance of science in their lives. One way to
achieve this goal is to incorporate evolution and the nature of science into your biology

lesson plans.

61

APPENDIX 1, A

Michigan Department of Education Biology Content Expectation:
Unit 12 StatementB5.l Theory of Evolution

Biology Content Expectation
Unit 12$tatementBSJ
Theory of Evolution

The theory of evolution provides a scientiﬁc explanation for the history of life on Earth as depicted in the
fossil record and in the similarities evident within the diversity of existing organisms.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

BS. 1A

CODE STATEMENT

B5. 1A Summarize the major concepts of natural selection (differential survival and reproduction of
chance inherited variants, depending on environmental conditions).

BS. 18 Describe how natural selection provides a mechanism for evolution.

B5. 1c Summarize the relationships between present-day organisms and those that inhabited the
Earth in the past (e.g., use fossil record, embryonic stages, homologous structures, chemical
basis).

BS. 1d Explain how a new species or variety originates through the evolutionary process of natural
selection.

B5. 1e Explain how natural selection leads to organisms that are well-suited for the environment
(differential survival and reproduction of chance inherited variants, depending upon
environmental conditions).

BS. 1 f Explain, using examples, how the fossil record, comparative anatomy, and other evidence
supports the theory of evolution.

BS. 1 g Illustrate how genetic variation is preserved or eliminated from a population through natural
selection (evolution) resulting in biodiversity.

BS.2x Molecular evidence substantiates the anatomical evidence for evolution and provides
additional detail about the sequence in which various lines of descents branched.

BS.2a Describe species as reproductively distinct groups of organisms that can be classiﬁed based on
morphological, behavioral, and molecular similarities.

BS.2b Explain that the degree of kinship between organisms or species can be estimated from the
similarity of their DNA and protein sequences.

BS.2c Trace the relationship between environmental changes and changes in the gene pool, such as
genetic drift and isolation of subpopulations.

BS.r2d Interpret a cladogram or phylogenetic tree showing evolutionary relationships among
organisms. (mermaid)

 

62

 

APPENDIX 1, B
Parent Consent Form

Improving Student Comprehension of Evolution Concepts
Parent Consent and Student Assent Form
I am currently enrolled as a graduate student in Michigan State University’s Department of
Science and Mathematics Education (DSME). My thesis research is on improving student
comprehension of evolution concepts. Some components of the unit are variation in organisms
and populations, artiﬁcial and natural selection, the fossil record, and speciation.

Data for the study will be collected ﬁ'om standard student work generated in the course of
teaching this unit such as pre and post tests, lab activities, and surveys. I am asking for your
permission to include your child’s data in my thesis. Your child’s privacy is a foremost concern.
During the study, I will collect and copy student work. These assignments will have the student’s
name removed prior to use in the study. All of the work being collected will be stored and locked
in high school office vault until my thesis is ﬁnished and will be shredded after that time. In
addition, your child’s identity will not be attached to any data in my thesis paper or in any images
used in the thesis presentation. Your child’s privacy will be protected to the maximum extent
allowable by law.

Participation in the study is completely voluntary. All students will be required to complete all of
the given class assignments and activities. Once the unit is completed I plan to use the students
work in my research. Students who do not participate in the study will not be penalized in any
way. Students who participate in the study will not be given extra work to complete. You may
request that your child’s information not be included in this study at any time and your request
will be honored. There are no known risks associated with participating in this study.
Participation in this study may contribute to determining the best way to present evolution
concepts to high school students.

Kelly Hartley, the chemistry teacher, will collect all of the consent forms and the pre-survey and
post surveys that the students will be asked to answer. Mr. Hartley will have all he consent forms
and surveys locked in the high school office vault until the unit is completed. If you are willing
to allow your child to participate in the study, please complete the attached form and return it by
October 31, 2007. Please seal it in the provided envelope with your child’s name on the outside of
the envelope. The envelopes will be stored in a locked cabinet and opened after the unit is
completed. Any work from a student who is not to be included in the study will be shredded.

If you have any questions about the study, please contact me by e-mail at mcclints@kent-
citv.k12.mi.us or by phone at (616) 678-4210. Questions about the study may also be directed to
Dr. Merle Heidemann at the DSME by e-mail at heidema2@msu.edu, by phone at (517) 432-
2152, or by mail at 118 North Kedzie, East Lansing, Michigan 48824. If you have any questions
or concerns regarding your rights as a study participant, or are dissatisﬁed at any time with any
aspect of this study, you may contact — anonymously, if you wish — Peter Vasilenko, Ph.D.,
Director of the Human Subject Protection Programs at Michigan State University, by phone at
(517) 355-2180, by e-mail at irb@msu.edu, by fax at (517) 432-4503, or by mail at 202 Olds
Hall, East Lansing, Michigan 48824.

Thank you,

Mr. Steven W. McClintock
Biology Teacher

63

Kent City High School
Parent/Guardian Consent Form

I voluntarily agree to allow to participate in
this study.
(print student name)

Please check all that apply.

I give Mr. McClintock permission to use data generated from my child’s work
in biology class to be used in the thesis project. All data from my child will remain
conﬁdential.

I do not wish to have my child’s work used in this thesis project. I acknowledge
that my child’s work will be graded in the same manner regardless of participation in the
study.

I give Mr. McClintock permission to use pictures of my child participating in
various activities while in biology class. I intend on using the pictures on this thesis
project. Your child's name will not be identiﬁed in these pictures.

I do not wish to have my child’s picture used at any time during this thesis
project.

 

 

(Parent/Guardian signature) (Date)

APPENDIX 1, C
Student Consent Form

Student Consent Form

I , ,voluntarily agree to participate in this
study.

 

(print name)
Please check all that apply.
I give Mr. McClintock permission to use data generated from my work in
biology class to be used in the thesis project. All data from my work will remain

conﬁdential.

I do not wish to have my work used in this thesis project. I acknowledge that my
work will be graded in the same manner regardless of participation in the study.

I give Mr. McClintock permission to use pictures of myself participating in
various activities while in biology class. I understand that Mr. McClintock intends on
using the pictures in this thesis project. Student's names will not be identiﬁed in these
pictures.

I do not wish to have my picture used at any time during this thesis project.

I voluntarily agree to participate in this thesis project.

 

 

(Student signature) (Date)

65

APPENDIX 11, A

Simulating the Radioactive Decay of Carbon-l4
Adapted from Ginny Lambert

Purpose: To understand the concepts of radioactive decay and half-life in the process of
carbon dating.

Materials:

2 pieces of red licorice
1 plastic knife

1 piece of graph paper
1 red colored pencil

1 black colored pencil

Introduction: Imagine you discover a fossil in your backyard. Although fossils are
interesting to look at, and a lot of information can be gathered just by observing a fossil,
it is also useful to estimate how old the fossil is. All living things consume carbon-14,
which is a radioactive version of carbon- 12. Organic molecules, like proteins,
carbohydrates, and lipids all contain carbon. All of us have carbon-14 in our bodies, and
it is constantly decaying. Radioactive atoms change over time into other types of atoms.
For instance, carbon-l4 decays into nitrogen- 14. Carbon-14 can be used to determine the
age of anything that was once living or was made of organic material up to 50,000 years
old! All radioactive materials have a half life, which is the amount of time it takes for half
of a sample to decay. The half life of carbon- 14 is 5,730 years, but other radioactive
atoms exist with longer half-lives. The ratio of carbon-14 to carbon-12 in living things is
relatively constant when the organism is alive. After death, the carbon-14 continues to
decay, but the amount of carbon-12 remains the same. By measuring the amount of
carbon-l4 remaining in a fossil, a bone, or even a piece of cloth, the age of the artifact
can be estimated. In this simulation, red licorice will be used to represent carbon-l4. To
simplify the graphing, we will assume the half-life is about 6,000 years.

Procedure:

1. Turn a piece of graph paper so that it is horizontal instead of vertical.

2. Label the x-axis number of years. The scale will be 500 years per line. You should
label the axis up to 55,000 years.

3. Label the y-axis Percent of Carbon-14 remaining. Using the entire y-axis (from
top to bottom), label from 0-100%.

4. Take both pieces of red licorice and lay them on the graph paper at time 0.

5. You need to cut the pieces of licorice so that they are the exact length of the y-
axis.

6. Mark the top of the licorice at time 0.

7. Lay one piece of licorice on the y-axis, this piece will remain here until the end.

8. Measure the length of your other piece of licorice in centimeters. Record the
number here:

9. Using the knife, cut the other piece of licorice exactly 1n half.

10. Place the half piece of licorice on the 6, 000 year point on the x-axis.

11. Draw a line at the top of the piece of licorice. This piece stays on the graph until
the end.

 

66

12. Measure the length of the other half of licorice in centimeters. Record the number
here:

13. Using the knife, cut the licorice exactly in half.

14. Place one of the halves of licorice on the 12,000 year point on the x-axis.

15. Draw a line at the top of the piece of licorice. This piece will also stay on the
graph.

16. Continue cutting the licorice in half, placing the pieces on the graph every 6,000
years. Your challenge is to see how many times you can cut the licorice in half!

17. Once you can no longer cut the licorice in half, connect all of the points with a
line graph, using the red colored pencil.

18. Above the red line, you need to draw a line from each of the intersects to the top
of the graph, using a black colored pencil. This line represents nitrogen-14, one of
the products of carbon- 14 decay. Draw a red line down representing Carbon 14.

19. Once your graph is complete, all of the radioactive licorice may be consumed.

 

Questions and Analysis:
1. Based on what you have seen in your graph, ﬁll in the chart below with the
percent of carbon- 14 remaining every 5,730 years.

Decay of Carbon-14
Years 0 5,730 11,460 17,190 22,920 28,650 34,380 40,110 45,840 51,570
from
present
% of
original
carbonl4 100
left

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2. Describe the problems you had as you approached the last division you did with
the licorice.

3. What do the black lines on your graph represent? Where did this element come
from?

4. Carbon dating is generally useful for dating objects up to about 50,000 years old.
Explain why this method is limited for objects older than 50,000 years and how
do you think scientists can date older objects.

5. If a 42,000 year old piece of pottery was sold to a museum, how many half-lives
has it existed for? If the original amount of carbon-l4 was 1 kg,
how much of the radioactive element is leﬁ today?

6. If you have a fossil with only 30% of the original radioactive carbon-l4
remaining, how old is the fossil?

 

67

7. Ask the teacher for your fossils. You will be given 3 licorice fossils that you must
date using your graph. Place your fossils on the graph and ﬁnd where they
intersect the curve and estimate the age of each fossil. Mark each fossil on your
graph. Record the ages of the fossils below from youngest to oldest.

Fossil 1

 

Fossil 2

 

Fossil 3

 

8. In 1991, a prehistoric man, Otzi, was discovered. The prehistoric man was frozen
in time by glaciers. Carbon dating of the samples from the site established the
time of Otzi’s death at approximately 5,300 years ago. What percentage of the
original carbon- 14 in the body was remaining in 1991?

9. While studying the nature of past climates, scientists in 1998 pulled two ice cores
from the bottom of a glacier. Trapped within the cores were insects and bark
fragments from local trees. Carbon from organic material near the bottom of the
cores dated to the coldest period of the last ice age. If those samples had 5.5
percent of their original carbon-l4 remaining, approximately how many years ago
did the glacier form?

10. The authenticity of the Shroud of Turin has long been debated. In 1988, scientists
removed small samples for carbon dating. Three different labs analyzed the
samples, and all three found that approximately 8 percent of the carbon-14 atoms
had decayed. Using this information, how old is the shroud?

68

APPENDIX H, B

Human Evolution: Hominid Skull Comparison
Adapted from: Ginny Lambert & Mari Knutson
www.woodrow.org/teachers/bi/ 1995/hominoidscomp.html

Introduction: There have been many fossilized hominid skulls that have been collected
from around the world. Three samples of living hominid skulls and several fossilized
skulls have been sent to Kent City High School for evaluation and classiﬁcation by a
paleo-archaeological team. Working in groups, students will collect data by measuring
the different skulls and interpret the data for presentation. This research will be tied to
development of a hominid phylogeny and to the evolution of the modern hominids in
particular humans.

Objectives:

1. To become familiar to the different tools and techniques used in
paleoanthropological studies.

2. To analyze structural features features of the skulls and determine their
importance in determining evolutionary relationships

3. To collect data by measuring and observing hominid skulls.

4. To use the data in analyzing and developing phylogenic trees showing
evolutionary relationships between fossilized hominid skulls and living specimens
of hominids.

Materials: Protractors, metric rulers, calipers, skulls (gorilla, chimpanzee, orangutan,
several homo species: Homo sapiens steinheimensis, Homo habilis, Sinanthropus
pekinensis, Homo sapiens sapiens (modern human), Homo sapiens sapiens (Cro-Magnon
man), Homo sapiens neanderthalensis, Homo erectus, Australopithicus africanus)

Procedure:

1. The teacher will introduce morphological characteristics that will be used to
examine the evolutionary relationships among primates that can be learned from
the study of their skulls.

2. Work in teams of four to collect data and complete the Hominid Skulls Data
Table. You will be given 7-10 minutes to make all measurements and record all
the data. Consult the hominid skull comparison checklist for an explanation of
each observation you will make.

3. For each measurement and observation that is made the team should come to a
consensus on the data that is recorded. Any characteristic that can not be made
due to missing or incomplete structures should be noted as not available (N A)-
such as missing teeth or a partial skull lacking foramen magnum. This will avoid
confusion when comparing data to skulls which are actually lacking a structure,
like with the modern human skull.

4. Once the data chart is complete, work with your team to review and construct a
phylogenic tree.

5. As you place the skulls in chronological order, generate a list of trends you
observed in the skulls.

6. Research the characteristics and materials found with each fossil. Note the
approximate date that the fossil lived, characteristics of the given hominid, what
type of tools, speciﬁc types of material and types of artifacts that have been found

69

with each type of fossil.

7. Discuss with the class the theory of human evolution and the data that is used to
support the theory.
Measurements
1. Width of cranium- Use the bow calipers and measure the widest portion of the

2.

10.

11.

12.

13.

14.
15.

16.

17.

cranium (ear to ear).

Length of cranium- Use bow calipers to measure from anterior to posterior of
cranium. Place one end of the calipers on the most forward portion of the
forehead and the other end of the calipers on the most posterior point of the skull.
Make sure you are measuring the cranium. The brow ridge or the saggital crest
should not be used in taking measurements

Maximum height- Measure from superior to inferior portion (foramen magnum)
of the cranium. Place the bow calipers on the midpoint of the anterior of the
foramen magnum and the other end of the calipers nearest the midline of the
coronal and sagittal sutures on the top of the cranium. Make sure that you are
measuring the cranium. Avoid the sagittal crest if present.

Determine cranial module- This provides a rough numerical value for the size of
the cranium. Add the cranium height, width and length and divide by 3.

Post orbital constriction- Using the bow caliper measure across the cranium from
behind the eye orbits on each side.

Angle of forehead- Place a protractor ﬂat against the eye. Determine the angle of
forehead by aligning a ruler so that it is parallel with the forehead. Place the ruler
against the protractor to determine the angle of the forehead.

Facial angle- Place protractor along the jaw line and align a ruler so it is parallel
with the face and record the angle.

Determine the angle and location of the foramen magnum. Place the protractor on
the foramen magnum using a straight edge perpendicular to the foramen magnum
to determine the angle.

Supraorbital browridge- Determine if it is present and if so determine if it is
small, medium or large.

Facial prognathism- Measure the angle of the facial prognathism by placing a
protractor onto the eye opening. Align a ruler parallel to a line from the front of
the teeth of top jaw to the eye.

Shape of chin— Does the chin angle in or out.

Dental arcade- Is the jaw U or V shaped. U-shaped jaws are distinguished by the
molars and premolars being parallel on each side of the jaw.

Dental formula- count the teeth on half of a jaw. Determine the number of
incisors, canines, premolars and molars.

Angle of incisors. Do they angle in or out.

Canine diastema- Measure th gap between the upper canines and the incisors
using the vemier calipers.

Upper Canine- Measure the length of the exposed upper canines using vemier
calipers.

Lower Canine- Measure the length of the lower canine using vemier calipers.

70

SKULLS USED

A. Gorilla gorilla gorilla (male gorilla)

B. Pan troglodytes (male chimpanzee)

C. Pongo pygmaeus pygmaeus (male orangutan)

D. Homo sapiens steinheimensis

E. Homo habilis

F. Sinanthropus pekinensis (female)

G. Homo sapiens sapiens (modern human)

H. Homo sapiens sapiens (Cro-Magnon man)

I. Homo sapiens neanderthalensis (Neanderthal man)
J. Homo erectus (Peking man, Java man)

K. Australopithicus africanus

71

Names of team members Name
Date
Hour

Working with your team answer the following questions:

1. What characteristics appear to change the most as you go from skulls that are least
similar to modern human skulls to those that are the most similar to the modern
human skull?

2. Using the cranial module measurement, please rank the skulls from the smallest to the
largest. What does the cranial module indicate about hominid evolution?

3. What four features of a hominid skull indicate that it was bipedal?

4. Why was bipedalism such an important evolution step in hominid evolution?

5. What changes in the hominid skull appear to have occurred early on in hominid
evolution?

6. What are the two most recent changes in hominids, resulting in the ﬁnal appearance of
the Homo sapiens sapiens skull?

72

10.

ll.

12.

13.

14.

What does the presence and size of the sagittal crest indicate about a hominid skull?

Describe the relationship between facial prognathism and the means of locomotion?

The location of the foramen magnum and the angle of the spinal cord is one of the
more important parameters for studying the means of hominid movement. Why are
these characteristics so useful for paleoanthropologists studying the locomotion of
hominid fossils?

What is the signiﬁcance of the angle of the forehead in hominid evolution?

The dental formula and type of teeth play a signiﬁcant role in diet. Try and predict
what types of diets each hominid skulls studied would have been able to consume.

Please arrange the skulls from most recent to oldest. When you have completed
placing them in order, try to make a phylogenic tree of human evolution. When
complete, compare your tree to the other groups.

What evidence exists that indicates more than one species of a hominid existed on
the planet at one time?

Based on your observation why would it be impossible for a human to evolve from
chimps, gorilla or orangutans?

73

Skull Measurements

   
    

post orbital Sagittal crest
eostriction
Angle of forehead Supraorbital
browridge

   

. ‘, ‘\,\ ‘1 l , ‘ “4
Angle of face Foramen magnum

74

Skull Measurements (Continued)

     

prognathism

U-shaped jaw V-shaped jaw
Shape of dental arcade

Length of canine

 

Dental Formula

APPENDIX II, C

EVOLUTIONARY TIME LINE
Adapted from: Biology The Dynamics of Life
Glencoe McGraw-Hill

Purpose: Construct a time line that is a scale model of the Geological Time Scale.
Use a scale in which one meter is equal to one billion years. Each
millimeter equals one million years

Introduction: The geologic time that encompasses all of the Earth's history is a
difﬁcult concept for people to comprehend. In this activity, you will use a cash
register tape to construct a scale to represent virtually all of geologic time. On the
time line label each era, period, and life forms that were present in each period.

Materials and Equipment:
The following materials will be needed by each group of two students:
0A cash register tape measuring 5 meters, meter stick, calculator, Colored pencils,
- Evolutionary/Geologic Time line on pages 382 and 383.

1. Use a meter stick to draw a continuous line near the bottom edge of the 5m piece

of cash register tape.

At the end of the strip place a vertical line and label it “The Present”

Measure a distance equal to 4.6 billion years ago. Draw a vertical line and label it

“Earth's Beginning”.

4. Use the time line found on pages 382 and 383 to plot the eras by making vertical
line across the piece of paper.

5. Mark the periods with a shorter vertical line, and identify the life forms that
would be present in each period.

'3’!”

76

EVOLUTIONARY TIME LINE

 

 

 

NAME
HOUR
Questions:
1. What era was the longest? The shortest?
2. In which era did dinosaurs dominate? Which period did dinosaurs ﬁrst appear?

When did mammals ﬁrst appear in the fossil record?
When did humans evolve?

What marks the end of one era and the beginning of the next?

How does your geologic time scale differ from the one used in the textbook?

When did life ﬁrst evolve?

Rate this activity 1 2 3 4 5, I liked 5 disliked and please tell me why.

What could be done to improve this activity?

77

APPENDIX 11, D

A l9"I Century Journey
Adapted ﬁom: Learning Evolution PBS
www.pbs.org/wgbh/evolution/educators/lessons/lesson2/act1 .htrnl

Introduction: Traveling in the 1830’s was expensive and dangerous. Few people went
very far from their homes. However, it was also a time of great discovery and
colonization. At this time, a young man had just recently graduated from Cambridge
University with a Bachelor’s of Art degree. He was planning to follow in his father’s
footsteps and become a physician, but he could not stand the sight of blood. His interests
extended beyond the arts to nature, including botany and geology. Eventually, he became
a pastor in a small church so that he could also study natural history.

In 1831, this young man was invited to voyage on a ship called the Beagle to
explore the shores of Chile, Peru, and island in the Paciﬁc. He took the job as an unpaid
naturalist and recorded his observations on his expedition.

Purpose: To map the journey of a young naturalist and identify key observations from
the voyage and hypothesize what they mean.

Procedure:

1. Using the excerpts from The Voyage of the BeagLe and a world map, plot the voyage.
You should include the date at each location and number the locations in chronological
order.

2. Connect the locations with a line, starting and ending in England.

3. When you are ﬁnished with your map, you should illustrate it. Use small pictures to
illustrate the observations made on the voyage. If you do not have enough room on the
map, you may draw on a separate piece of paper and number them to correspond to the
map.

4. List at least 5 signiﬁcant observations made on the journey in one column and write
how the observations contribute to the development of natural selection.

5. Rate this activity 1 2 3 4 S, I liked 5 disliked and please tell me why?

6. What could be done to improve this activity?

78

Excerpts from Voyage of the Beagle
Adapted ﬁom www. literature. org

Devonport, England: 50° N, 4° W

December 27, 1831

After having been twice driven back by heavy southwestern gales, Her Majesty’s ship
Beagle, a ten-gun brig, under the command of Captain Fitz Roy, R.N., sailed from
Devonport on the 27'11 of December, 1831. The object of the expedition was to
complete the survey of Patagonia and Tierra del F uego, commenced under Captain
King in 1826 to 1830—to survey the shores of Chile, Peru, and of some islands in the
paciﬁc — and to carry a chain of chronometrical measurements round the World.

Cape Verde, Porto Praya: 14° N, 23° W

January 16, 1832

The neighbourhood of Porto Praya, viewed from the sea, wears a desolate aspect. The
volcanic ﬁres of a past age, and the scorching heat of a tropical sun, have in most
places rendered the soil unﬁt for vegetation. The island would generally be
considered as very uninteresting. A single green leaf can scarcely be discovered over
wide tracts of the lava plains; yet ﬂocks of goats, together with a few cows, contrive
to exist. It rains very seldom, but during a short portion of the year heavy torrents fall,
and immediately afterwards a light vegetation springs out of every crevice. . ..

Rio de Janeiro, Brazil: 23° S, 43° W

July 5, 1832

In the morning we got under way, and stood out of the splendid harbour of Rio de
Janeiro. In our passage to the Plata, we saw nothing particular, excepting on one day a
great shoal of porpoises, many hundreds in number. As soon as we entered the estuary
of the Plata, the weather was very unsettled. One dark night we were surrounded by
numerous seals and penguins, which made such strange noises, that the ofﬁcer on
watch reported he could hear the cattle bellowing on shore. On a second night we
witnessed a splendid scene of natural ﬁreworks; the mast-head and yard-arm-ends
shone with St. Elmo’s light. . ..

Tierra del Fuego, Argentina: 55’ S, 73° W

December 17, 1832

Having now ﬁnished with Patagonia and the Falkland Islands, I will describe our ﬁrst
arrival in Tierra del Fuego. A little after noon we doubled Cape St. Diego, and entered
the famous strait of Le Maire. We kept close to the Fuegian shore, but the outline of
the rugged, inhospitable Statenland was visible amidst the clouds. In the aﬂemoon we
anchored in the Bay of Good Success. While entering we were saluted in a manner
becoming the inhabitants of this savage land. The savages followed the ship, and just
before dark we saw their ﬁre, and again heard their wild cry. The harbour consists of
a ﬁne piece of water half surrounded by low rounded mountains of clay-slate, which
are covered to the water’s edge by one dense gloomy forest. A single glance at the
landscape was sufﬁcient to show me how widely different it was from anything I had
ever beheld. . ..

Maldonado, Uruguay: 34° S, 54° W
July 24, 1833
The Beagle sailed from Maldonado, and on August the 3rd she arrived off the mouth

79

of the Rio Negro. This is the principal river on the whole line of caost between the
Strait of Magellan and the Plata. It enters the sea about three hundred miles south of
the estuary of the Plata. About ﬁfty years ago, under the old Spanish government, a
small colony was established here; and it is still the most southern position (lat. 41°)
on this eastern coast of America, inhabited by civilized man.

Buenos Aires, Argentina: 34° 8, 59° W

August 24, 1833

The Beagle arrived here on the 24'" of August, and a week afterwards sailed for the
Plata. With Captain Fitz Roy’s consent I was left behind, to travel by land to Buenos
Ayres. I will here add some oberstvations, which were made during this visit and on a
previous occasion, when the Beagle was employed in surveying the harbour.

The plain, at the distance of a few miles from the coast, belongs to the great Pampean
formation, which consists in part of a reddish clay, and in part of a highly calcareous
marly rock. Nearer the coast there are some plains formed ﬁ'om the wreck of the
upper plain, and from mud, gravel, and sand thrown up by the sea during the slow
elevation of the land, of which elevation we have evidence in upraised beds of recent
shells, and in rounded pebbles of pumice scattered over the country. At Punta Alta we
have a section of one of these later-formed little plains, which is highly interesting
from the number and extraordinary character of the remains of gigantic land-animals
embedded in it. I will here give only a brief outline of their nature.

First, parts of three heads and other bones of the Megatherium, the huge dimensions
of which are expressed by its name. Secondly, the Megalonyx, a great allied animal.
Thirdly, the Scelidotherium, also an allied animal, of which I obtained a nearly
perfect skeleton. It must have been as large as a rhinoceros: in the structure of its head
it comes, according to Mr. Owen, nearest to the Cape Anteater, but in some other
respects it approaches to the armadillos. Fourthly, the Mylodon Darwinii, a closely
related genus of little inferior size. Fifthly, another gigantic edental quadruped.
Sixthly, a large animal, with an osseous coat in compartments, very like that on an
armadillo. Seventhly, an extinct kind of horse, to which I shall have again to refer.
Eighthly, a tooth of a Pachyderrnatous animal, probably the same with the
Macrauchenia, a huge beast with a long neck like a camel, which 1 shall also refer
again. Lastly, the Toxodon, perhaps one of the strangest animals ever discovered: in
size it equaled an elephant or megatherium, but the structure of its teeth, as Mr. Owen
states, proves indisputably that it was intimately related to the Gnawers, the order
which, at the present day, includes most of the smallest quadrupeds.

The remains of these nine great quadrupeds, and many detached bones, were found
embedded on the beach, within the space of about 200 yards square. It is a remarkable
circumstance that so many different species should be found together; and it proves
how numerous in kind the ancient inhabitant of this country must have been.

The remains at Punta Alta were embedded in stratiﬁed gravel and reddish mud, just
such as the sea might now wash up on a shallow bank. They were associated with
twenty-three species of shells, of which thirteen are recent and four others very
closely related to recent forms. . ..

8O

Port St. Julian, Argentina: 49° S, 67° W

January 9, 1834

Everything in this southern continent has been effected on a grand scale: the land,
from the Rio Plata to Tierra del Fuego, a distance of 1200 miles has been raised in
mass (and in Patagonia to a height of between 300 and 400 feet), within the period of
the now existing sea-shells. I have said that within the period of existing sea-shells,
Patagonia has been upraised 300 to 400 feet: I may add that within the period when
icebergs transported boulders over the upper plain of Santa Cruz, the elevation has
been at least 1500 feet. Nor has Patagonia been affected only by upward movements:
the extinct tertiary shells from Port St. Julian and Santa Cruz cannot have lived,
according to Professor E. Forbes, in a greater depth of water than from 40 to 250 feet;
but they are now covered with sea-deposited strata from 800 to 1000 feet in thickness:
hence the bed of the sea, on which these shells once lived, must have sunk
downwards several hundred feet, to allow the accumulation of the superincumbent
strata. What a history of geological changes does the simply-constructed coast of
Patagonia reveal!

Bay of S. Carlos, Chile: 42° S, 73°W

January 15, 1835

On January the 15'h we sailed from Low’s Harbour, and three days afterwards
anchored a second time in the bay of S. Carlos in Chiloe. On the night of the 19th the
volcano of Osorno was in action. At midnight the sentry observed something like a
large star, which gradually increased in size till about three o’clock, when it presented
a very magniﬁcent spectacle. . ..

Valdivia, Chile: 39° S, 73°W

February 20, 1835

This day has been memorable in the annals of Valdivia, for the most severe
earthquake experienced by the oldest inhabitant. I happened to be on shore, and was
lying down in the wood to rest myself. It came on suddenly, and lasted two minutes,
but the time appeared much longer. The rocking of the ground was very sensible. The
undulation appeared to my companion and myself to come from due east, whilst
others thought they proceeded from southwest: this shows how difficult it sometimes
is to perceive the directions of the vibrations. There was no difﬁculty in standing
upright, but the motion made me almost giddy: it was something like the movement
of a vessel in a little cross-ripple, or still more like that felt by a person skating over
thin ice, which bends under the weight of his body. A bad earthquake at once destroys
our oldest associations: the earth, the very emblem of solidity, has moved beneath our
feet like a thin crust over a ﬂuid. . ..In the course of the evening there were many
weaker shocks, which seemed to produce in the harbour the most complicated
currents, and some of great strength.

Concepcion, Chile: 37° S, 73° W

March 4, 1835

We entered the harbour of Concepcion. While the ship was beating up to the
anchorage, I landed on the island of Quiriquina. The mayor-domo of the estate
quickly rode down to tell me the tenible news of the great earthquake of the 20'": --
“That not a house in Concepcion or Talcahuano (the port) was standing; that seventy
villages were destroyed; and that a great wave had almost washed away the ruins of
Talcahuano.” During my walk round the island, I observed that numerous fragments

81

of rock, which, ﬁom the marine productions adhering to them, must recently have
been lying in deep water, had been cast up high on the beach; one of these was six
feet long, three broad, and two thick.

Galapagos Islands, Ecuador: 0° S, 90° W

September 15, 1835

This archipelago consists of ten principal islands, of which ﬁve exceed the others in
size. They are situated under the Equator, and between the ﬁve and six hundred miles
westward of the coast of America. They are all formed of volcanic rocks; a few
fragments of granite curiously glazed and altered by the heat, can hardly be
considered as an exception...

Considering that these islands are placed directly under the equator, the climate is far
from being excessively hot; this seems chieﬂy caused by the singularly low
temperature of the surrounding water, brought here by the great southern polar
current. Excepting during one short season, very little rain falls, and even then it is
irregular; but the clouds generally hang low. Hence, whilst the lower parts of the
islands are very sterile, the upper parts at a height of a thousand feet and upwards,
possess a damp climate and a tolerably luxuriant vegetation. . ..

September 29'" — We doubled the southwest extremity of Albemarle Island...

The rocks on the coast abounded with great black lizards, between three and four feet
long; and on the hills, an ugly yellowish-brown species was equally common. The
whole of this northern part of Albemarle Island is miserably sterile. . ..

The natural history of these islands is eminently curious, and well deserves attention.
Most of the organic productions are aboriginal creations, found nowhere else; there is
even a difference between the inhabitants of the different islands;; yet all show a
marked relationship with those of America, though separated from that continent by
an open space of ocean, between 500 and 600 miles in width. The archipelago is a
little world within itself, or rather a satellite attached to America. . ..

. . ..The remaining land-birds form a most singular group of ﬁnches, related to each
other in the structure of their beaks, short tails, form of body and plumage: there are
thirteen species, which Mr. Gould has divided into four sub-groups. All these species
are peculiar to this archipelago; and so is the whole group, with the exception of one
species of the sub-group Cactomis, lately brought ﬁ'om Bow Island, in the Low
Archipelago. Of Cactomis, the two species may be often seen climbing about the
ﬂowers of the great cactus-trees; but all the other species of this group of ﬁnches,
mingled together in ﬂocks, feed on the dry and sterile ground of the lower districts.
The males of all, or certainly of the greater number, are jet black; and the females
(with perhaps one or two exceptions) are brown. The most curious fact is the perfect
gradation in the size of the beaks in the different species of Geospiza, ﬁ'om one as
large as that of a hawﬁnch to that of a chafﬁnch, and (if Mr. Gould is right in .
including his sub-group, Certhidea, in the main group) even to that of a warbler.
Seeing this graduation and diversity of structure in one small, intimately related group
of birds, one might really fancy that from an original paucity of birds in this
archipelago, one species had been taken and modiﬁed for different ends.

82

I will ﬁrst describe the habits of the large tortoises (Testudo nigra, formerly called
Indica), which has been so frequently alluded to. These animals are found, I believe,
on all the islands of the archipelago; certainly on the greater number. They frequent in
preference the high damp parts, but they likewise live in the lower and arid districts. I
have already shown, from the numbers which been caught in a single day, how very
numerous they must be. Some grow to an immense size: Mr. Lawson, an Englishman,
and vice-govemor of the colony, told us that he had seen several so large, that it
required six or eight men to lift them from the ground; and that some had afforded as
much as two hundred pounds of meat. The old males are the largest, the females
rarely growing to so great a size; the male can readily be distinguished from the
female by the greater length of its tail. The tortoises which live on those islands where
there is no water, or in the lower and arid parts of the others, feed chieﬂy on the
succulent cactus. Those which frequent the higher and damp regions, eat the leaves of
various trees, a kind of berry (called guayavita) which is acid and austere, and
likewise a pale green ﬁlamentous lichen, that hangs from the boughs of trees. . ..

I have not as yet noticed by far the most remarkable feature in the natural history of
this archipelago; it is, that the different islands to a considerable extent are inhabited
by a different set of beings. . .. I never dreamed that islands, about 50 or 60 miles
apart, and most of them in sight of each other, formed of precisely the same rocks,
placed under a quite similar climate, rising to a nearly equal height, would have been
differently tenanted; but we shall soon see that this is the case...

Tahiti Island, French Polynesia: 17° S, 149°W
November 15, 1835

At daylight, Tahiti, an island which must for ever remain classical to the voyager in
the South Sea, was in view. At a distance the appearance was not attractive. The
luxuriant vegetation of the lower part could not yet be seen, and as the clouds rolled
past, the wildest and most precipitous peaks showed themselves towards the centre of
the island. . ..

Sydney, Australia: 33° S, 151° E

January 12, 1836

Early in the morning a light air carried us towards the entrance of Port Jackson.
Instead of beholding a verdant country, interspersed with ﬁne houses, a straight line
of yellowish cliff brought to our minds the coast of Patagonia. A solitary lighthouse,
build of white stone, alone told us that we were near a great and populous city.
Having entered the harbour, it appears ﬁne and spacious, with cliff-formed shores of
horizontally stratiﬁed sandstone. The nearly level country is covered with thin
scrubby trees, bespeaking the curse of sterility. Proceeding further inland, the country
improves: beautiful villas and nice cottages are here and there scattered along the
beach.

Cocos Islands: 12° S, 96°E

April 1, 1836

We arrived in view of the Keeling or Cocos Islands, situated in the Indian Ocean, and
about six hundred miles distant ﬁ'om the coast of Sumatra. This is one of the lagoon-
islands (or atolls) of coral formation, similar to those in the Low Archipelago which
we passed near. .

83

Port Louis, Mauritius: 20° S, 57° E

May 9, 1836

We sailed from Port Louis, and calling at the Cape of Good Hope on the 8'" of July we
arrived off St. Helena. This island, the forbidding aspect of which has been so often
described, rises abruptly like a huge black castle from the ocean.

Ascension: 8° S, 14° W

July 19, 1836

On the 19'h of July we reached Ascension. Those who have beheld a volcanic island,
situated under an arid climate, will at once be able to picture to themselves the
appearance of Ascension. The will imagine smooth conical hills of a bright red
colour, with their summits generally truncated, rising separately out of a level surface
of black rugged lava.

Falmouth, England: 50° N, 5°W

October 2, 1836

....On the 2"" of October we made the shore, of England; and at Falrnouth I left the
Beagle, having lived on board the good little vessel nearly ﬁve years. . ..

84

Figure 1. World map

of

cm—

ow

o2

 

 

 

 

 

 

 

 

 

 

om~

om—

cm

85

APPENDIX 11, E
Name
Hour

 

Variations of Seeds within Species of Maple Trees
Adapted from Merle K. Heidemann
Science and Math Education Professor, Michigan State University

Introduction: Variations of individuals plays a critical role in the evolutionary process.
When you look around the classroom and hallways there are many variations of
characteristics that can be tested for. What role do these variations play in the evolution,
survival or failure of a species. A common family of trees found in Michigan are the
Maples. When looking at the seeds produced by maple trees it becomes evident that thee
are variations between the several different species, but what about within a species of
Maple trees. Your task today is to monitor the variations of the length of seeds ﬁ'om one
species of Maple tree and to plot them onto graph.

Material: Metric ruler, 50 maple seeds of one species, poster board, digital camera,
seeds from several different species of Maple trees.

Procedures:
1. Obtain the materials needed for this activity.
2. Measure the seed length, of 50 seeds, in centimeters.
3. Use a ruler to draw the x axis onto the poster board.
4. Leave enough space between the units on the x axis to place the seeds onto the

poster board
5. Place the seeds neatly onto the poster board as if making a bar graph. Stack them
one above the other horizontally.
Once you place the seed onto the poster board leave it in place.
Get a ﬁnal tally for the number of seeds for each length recorded.
Take a digital photo of your poster board for a permanent record of your work,
then answer the questions.

9°99

Questions:

1. Determine the mean, median and mode for seeds that you have measured and
graphed.

2. What was the range for the length of the seeds measured.

3. Make a prediction on how the survival rates may be inﬂuenced by the length of
the seed.

86

4. What other characteristics could you collect data on when looking at maple seeds?

5. How do the characteristics of your seeds compare to the seeds of other species of
Maple seeds?

6. Design an experiment that involves Maple seeds that you and your partner could
conduct in the classroom. You must set up, design and carry out your experiment.

7. Rate this activity 1 2 3 4 5, 1 liked 5 disliked and please tell me why?

8. What could be done to improve this activity?

87

APPENDIX 11, F

Name
Hour____
Bead Bug Blitz
Adapted from Merle K. Heidemann
Science and Math Education Professor, Michigan State University

 

Introduction: A population is a group of interbreeding organisms that exist within a
known range. Natural variation exists among the organisms in a population, and selection
pressures can cause certain individuals in a population to have an advantage over other
individuals. A classic example of this is the peppered moths. There are two morphs of
peppered moths, a light and a dark morph. Peppered moths live in England and rest on
trees that are nearly the same color as the light morph peppered moth. Predators can
easily ﬁnd the dark morphs against the light background of the tree, so very few of the
dark morphs survive to produce offspring. However, when the industrial revolution hit
England, ash in the air from the coal-burning factories caused some of the lightly colored
trees to become gray. In response, the light colored peppered moths were very easy to
spot, so very few of the light morphs survived to reproduce. As a result, the dark
peppered moths became more numerous because they had better camouﬂage and blended
in with the darker trees. This example shows that populations can change over time as a
result of selection pressures.

Purpose: To explain how genetic variation and environmental pressures contribute to the
diversity of organisms and how natural selection acts on individuals, causing changes in
populations over time.

Materials:

3 populations of colored beads (approximately 50 beads of each color)
2 fabric “habitats”

3 cups

Scenario: There exists a patch of land known as Multicolored Meadows. In the
Meadows, there are small critters known as Beadbugs, who come in a variety of colors.
The Meadow Muncher is a natural predator of Beadbugs. Today, you will become the
Meadow Muncher and devour the tasty Beadbug in its natural habitat. You will be
monitoring the different populations of Beadbugs for several generations to see if any
change occurs.

Procedure: Read all directions before beginning!

1. Form a group of three.

2. Assign the following roles in your group: Meadow Muncher, Recorder, and Beadbug
Reproduction Manager. You may swap duties when you change the habitat later.

3. Choose two types of habitats for your Beadbugs. The habitats come in the form of
patterned material.

4. Choose three colors of beads to represent your Beadbugs. The colors should roughly
match the colors of your ﬁrst habitat. In other words, your beads should blend in.

5. Gather about 50 head of each color and place each color into a separate cup.

6. Take all of your materials back to your lab station.

7. Lay down your ﬁrst habitat and everyone but the Meadow Muncher should evenly

88

place 16 beads of each color on the fabric.
8. Record in your data table the number of beads of each color in Generation 1.
9. Now it is time for the Meadow Muncher to start catching Beadbugs, but there are
some rules to follow:
1. The Meadow Muncher can only pick up one bead at a time.
2. The Muncher must take the ﬁrst bead that he or she sees.
3. After picking up a bead, the Muncher must look away before picking up
another bead.

10. The Muncher must eat 24 beads.

11. After the feeding, the number of each color Beadbug must be counted and recorded

in the data table.

12. Take the initial population and subtract the number eaten to ﬁnd the number of
survivors for each color.

13. The Beadbugs who survive get to reproduce. Each parent produces one offspring
identical to itself. The Beadbug Reproduction Manager must double the number of
survivors of each color and place the offspring in the habitat. For example, if 6 red
Beadbugs survived, there would be 6 red offspring, for a total of 12 red Beadbugs at
the beginning of the next generation.

14. Record the initial population for the next generation. This number should be two
times the number of survivors from the previous generation.

15. Continue to eat, reproduce, and record the information for ﬁve generations of
Beadbugs.

16. At the end of ﬁve generations, the Beadbugs are forced to move to a new habitat due
to a drought. Move your Beadbug population to your other habitat.

17. Continue to use the same procedure for ﬁve generations on the new habitat.

 

 

 

 

 

 

 

First Round
Habitat Description
Gen. Color: Color: Color:
Initial Population: __ Initial Population: __ Initial Population: __
1 Number Eaten: __ Number Eaten: _ Number Eaten: __
Survivors: Survivors: Survivors:
Initial Population: __ Initial Population: _ Initial Population:
2 Number Eaten: __ Number Eaten: __ Number Eaten: __
Survivors: Survivors: Survivors:
Initial Population: _ Initial Population: _ Initial Population: __
3 Number Eaten: __ Number Eaten: _ Number Eaten: __
Survivors: Survivors: Survivors:
Initial Population: _ Initial Population: __ Initial Population: __
4 Number Eaten: _ Number Eaten: __ Number Eaten: _
Survivors: Survivors: Survivors:
Initial Population: __ Initial Population: __ Initial Population: _
5 Number Eaten: _ Number Eaten: _ Number Eaten: __
Survivors: Survivors: Survivors:

 

 

 

 

 

 

89

Second Round

 

 

 

 

 

 

 

 

 

 

 

 

Habitat Description
Gen. Color: Color: Color:
Initial Population: _ Initial Population: __ Initial Population: __
1 Number Eaten: Number Eaten: __ Number Eaten: __
Survivors: Survivors: Survivors:
Initial Population: Initial Population: Initial Population:
2 Number Eaten: Number Eaten: ____ Number Eaten: __
Survivors: Survivors: Survivors:
Initial Population: Initial Population: Initial Population: __
3 Number Eaten: Number Eaten: Number Eaten: __
Survivors: Survivors: Survivors:
Initial Population: Initial Population: Initial Population:
4 Number Eaten: Number Eaten: __ Number Eaten: __
Survivors: Survivors: Survivors:
Initial Population: Initial Population: Initial Population:
5 Number Eaten: Number Eaten: _ Number Eaten: _
Survivors: Survivors: Survivors:
Questions and Analysis:

1. Did any speciﬁc color of Beadbug go extinct? If so, explain why extinction occurred

using the concept of natural selection. If no extinction occurred, explain why all colors

survived using the concept of natural selection.

2. Was there a change in the distribution of Beadbug colors when you switched habitats?
Explain what this change in habitat represents in the real world.

3. If you started with a population of only green Beadbugs, would you see any change

take place in this population over time? Why or why not?

90

 

4. If you only had green Beadbugs, explain whether or not this population would be able
to adapt in the future if the organisms had to change habitats again.

5. Predict what the population of Beadbugs in the second habitat would look like in 10
generations. Explain why you think the population may or may not change.

6. Rate this activity 1 2 3 4 5, I liked 5 disliked and please tell me why?

7. What could be done to improve this activity?

91

APPENDIX 11, G

Human Variations
Adapted from: Braun, S. and Young, J. (1989). Heath Biology Laboratory Investigations
/www.ncsu.edu/scivis/lessons/variation/varlab2.html

Introduction: The human population exhibits countless variations that result in each
individual being unique. Variations within a population provide the means for natural
selection by affecting the survival rates and reproductive success of individuals within a
population. In this lab we will determine the amount of variation that exists in our small
population by measuring the spread of the hand, and the length of the arm and leg. You
must also measure 2 other variations, on at least 10 people, to be determined by you and
your partner. Working in groups of four you and your partners will measure hand spread,
leg length, arm length and two other variables that will be determined by your group.
You will then graph the hand spread data for classroom data and determine the mean,
median and mode for the handspread data.

Materials: Meter stick, ruler, calipers, vemier calipers

Procedures:
1. To measure hand spread make a ﬁst with your thumb and pinky sticking out from
your ﬁst.

2. Press your ﬁngers down on a metric ruler with your thumb and pinky spread out
as far as possible and record the data in the table below and on the board.

3. Measure the length of your leg by measuring from the outside of the ankle bone to
the top of the hip bone.

4. Measure length of arm from the top of shoulder to the wrist.

5. You and your partners must make measurements of two other variations on 10
different pe0ple.

 

Hand Spread (cm) Leg length (cm) Arm length (cm)

 

 

 

 

 

 

 

 

 

Handspread Classroom Data

 

cm 10 11 12 13 14 15 l6 17 18 19 20 21 22 23 24

 

#
people

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

92

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Name Variation 1 Variation 2
l.
2.
3.
4.
5.
6.
7.
8.
9.
10.
1. Compare the leg length to the arm length of the individuals that you collected data
from. Why would this comparison be of interest to anthropologists?
2. What was the largest hand spread and smallest hand spread measured? What

would be the advantages and disadvantages of large and small hand spread?

. Why did your group select the two ﬁnal variations to be measured?

Determine the mean, median and mode for the classroom data and tell me what
this indicates about the data collected?

Mean-
Median-

Mode-

93

 

5. What is the signiﬁcance of having variations within a species such as humans
(Homo sapiens sapiens)?

6. What is the source of the variations that you observed?

7. In your own words deﬁne variation.

8. Beside the variations that were observed today list at least 10 other characteristics
that vary in human populations. Try to think of some that are internal rather than
externally visible.

9.Rate this activity 1 2 3 4 S, I liked 5 disliked and please tell me why.

10. What could be done to improve this activity?

94

APPENDIX 11, H

Name

 

Hour

Comparison of Homologous Structures

Introduction: Chimpanzees and humans have several characteristics that are shared
between the two species. When the bone structures of the two species are compared it
becomes evident that there are similarities in structure, yet there remain differences
between chimpanzees and humans. You and your partner will take measurements of the
leg and arm bones of a chimpanzee and human and compare the two.

Materials: Photos of leg and arm bones from a chimpanzee and a human, metric ruler
and skeletal models when possible.

Procedures:

1.
2.

Am

\IOIM

Make all measurements in centimeters.
Measure the length of the human arm including the length of humerus, radius and
ulna. Record in the table below.

. Determine the ratio of the humerus to the total arm length.
. Measure the length of the human leg including the femur, ﬁbula and tibia. Record in

table below.

. Determine the ratio of the femur to the leg length.
. Determine the ratio of the arm to the leg and record in the table below.
. Repeat for the chimpanzee arm and leg.

 

Structure Human Chimpanzee

 

Arm length (cm)

 

Humerus (cm)

 

Radius (cm)

 

Ulna (cm)

 

Ratio of Humerus: Arm length

 

Leg length (cm)

 

Femur (cm)

 

Fibula (cm)

 

Tibia (cm)

 

Ratio of Femur: Leg length

 

 

Ratio of Arm length: Leg length

 

 

 

95

 

Questions

1. What is a homologous structure?

2. Why is the comparison of homologous structures between different species useful?

3. Which organism has a smaller ratio of arm length: leg length? What does this indicate
about how the animal walks? Why?

4. If you discovered an arm and leg bone from an unknown species of a hominid how
could you determine if it was more human like or chimpanzee like?

5. Compare and contrast the bone and skeletal structures of the chimpanzee to that of a
human. You may wish to view the photos of the chimpanzee and compare them to the
skeleton in the front of the class.

6. Rate this activity 1 2 3 4 5, I liked 5 disliked and please tell me why?

7. What could be done to improve this activity?

96

Figure 2. CHIMPANZEE NEXT TO HUMAN LEG

 

97

Figure 3. HUMAN ARM AND LEG

 

98

4. CHIMPANZEE ARM AND LEG

Figure

 

99

Figure 5. HUMAN AND CHIMPANZEE ARM

 

100

Figure 6. CHIMPANZEE FOOT AND HAND

 

101

APPENDIX 11, I

Name
Hour
Molecular Sequencing of Amino Acids
Adapted from: Martin Nickels, Craig Nelson, Doug Karpa-Wilson, Steve Freedberg and
Nathan Murphy http://www.indiana.edu/~ensiweb/lessons/mol.prim.html

 

Purpose: In this activity, you will analyze the amino acid sequence of beta hemoglobin
molecules of eight different species to determine how closely the species are related. You
will also construct a cladogram and graph the similarities.

Introduction: For many years, organisms have been classiﬁed based mainly on their
visible characteristics. Organisms that are in the same genus are more closely related than
all of the organisms in the same kingdom. The fossil record shows that the types of
organisms on earth have changed dramatically over millions of years. However, the
change is gradual, and indicates that common ancestors connect all life forms to each
other. When tracing the ﬂow of life back deep in time, many examples of gradual changes
from earlier times can be seen. This leads to the understanding of descent with
modiﬁcation.

In addition to structural similarities and the fossil record, DNA and proteins can
be used to determine patterns of ancestry and how organisms are related. In fact, many
organic molecules can be used to determine the degree of similarity.

Procedure Part A:

1. On the Data Sheet you will ﬁnd an amino acid sequence for beta hemoglobin for
eight different species. To save time and space, only the amino acids that are
different have been listed.

2. Compare species A with species B. Count the number of differences you see
between the two sequences and record this number in the matrix below.

3. Compare species A with species C. Count the number of differences you see
between the two sequences and record this number in the matrix below.

4. Continue comparing the species and counting the number of differences seen in
each sequence and recording them in the matrix below.

5. Calculate the average number of differences for each species and record.

Note: The S m the matrix below means the same species were compared, so there are

obviously no differences. The X represents comparisons that overlap rn the matrix.

Part “A” Matrix: Differences Among Amino Acid Sequences

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Species A B C D E F G H
A S 25 24
B X S 25 24
C X X S 24 25
D X X X S 23 24
E X X X X S 22 27
F X X X X X S 25 24
G X X X X X X S 33
H X X X X X X X S
Averages 24 26

 

""Averages must be rounded to the nearest whole number.

102

Questions and Analysis for Part A:

1. What does the S represent in the matrix? In other words, what two species are
being compared? How many differences would you expect for this comparison?

2. What two species are the most closely related? How can you tell?

3. What two species are the least closely related? How can you tell?

4. What is the general pattern of differences among the column averages as you
move from left to right across the table? What does this suggest about the
relationships of each species?

Part B

5. The ﬁrst seven species in the data table and matrix are primates.

6. Label each of the species A-G with their names in the matrix according to the table
below:

 

 

 

 

 

 

 

 

 

 

Species A Human Species E Rhesus Monkey OWM
_Species B Chimp Species F Squirrel Monkey NWM

S ecies C Gorilla Species G Lemur

Species D Gibbon Species H Identiﬁed Later
Questions:

1. What two groups of primates is least similar to the others?

2. Are gorillas more similar to humans or to chimpanzees based on the sequence
data? Why?

3. Explain what you think the similarities between the species indicate about a
common ancestor?

103

Part C: Building a Cladogram

Cladistics is a classiﬁcation scheme that assumes every group of organisms arose by
branching off from a previous group. Each branch is called a clade. That clade
includes any and all subsequent branching. One clade often includes many smaller
clades. All the individuals within a clade share one or more selected traits. Each trait
must be identical or very similar within a clade. However the traits appear to be
modiﬁed from earlier forms of the trait. The simplest diagram showing the branches
is based on the sequence of modiﬁcations and produces a cladogram.

Place the name of the species across the top from a. to h. On the left hand side place
the average number of changes that occurs. You calculated averages in Table A.

 

common
ancestor

104

4. Rate this activity 1 2 3 4 5, I liked 5 disliked and please tell me why.

5. What could be done to improve this activity?

105

 

Species
H

 

G

 

Species Species
F

 

Species
E

 

Species
D

 

Data Table: Comparison of the Amino Acids in the Beta Chain of the Hemoglobin

Molecule in Eight Selected Species

Species
C

 

Species
B

 

Species
A

 

Acid

Amino

 

Position

 

 

 

 

10
12
13
16
20
21

 

 

 

 

 

 

 

 

 

22
33
43

 

 

 

50
52
54
56
69
70
72
73

 

 

 

 

 

 

 

 

75

 

 

76
87
94
95
104

112

 

 

 

116
120
121
123
125
126
129
130
135

 

 

 

 

 

 

 

 

 

 

 

 

 

106

APPENDIX 11, J

Clipﬁir‘és

Adapted from Al Janulaw and Judy Scotchmoor

Overview: This activity will demonstrate how variation in bird beaks within a
population varies from generation to generation based on the available food types.

Purpose: To show variation and natural selection within a population, adaptations that
are advantageous persist in a population, and speciation requires reproductive isolation.

Introduction: Evolution is the result of natural selection acting upon variation within a
population. Given a set of environmental circumstances, organisms with favorable traits
have a selective advantage over individuals with less favorable traits. Selective advantage
leads to speciation. It is important to understand that favored traits are only advantageous
within a particular situation and may not aid in survival if the circumstances change. For
Clipbirds, different types of food favor different beak sizes. One beak size may only be
favorable over another beak size under speciﬁc conditions. When conditions change, the
favored beak size may also change.

Materials per group:

3 bags ﬁlled with “food” for each season
10 large binder clips

10 medium binder clips

10 small binder clips

10 plastic cups

Scenario: In a land far, far away, there is an island known as Clipland. The island is
inhabited by a large population of Clipbirds that feed on a variety of foods. The Clipbirds
recently had a major disagreement about the mating season, and part of the population re-
located to the other side of the mountain range that divides the island. The two
populations now live separately because of their differences. Now, the two populations
are known as the East and West Clipbirds.

   

Procedure:

107

:‘t.m

>19.“

8.

9.

10.

11.
12.
13.
14.
15.

. The room will be divided in half, and you will be working with the people on your

side of the room.

. Before starting, predict which beak will be the most ﬁt for survival for the three

seasons described in Table 1. You should look at the energy values for each food type
and at each of the birds energy requirements for survival and reproduction.
Choose six people to begin as the Clipbirds.
Two of the six people will be given large clips, two will be given medium clips, and
the remaining two will be given small clips.
Each of the Clipbirds must also have a plastic cup that represents the stomach.
Spread out the food the ﬁrst season in the pan provided.
Each Clipbird has different energy requirements to survive, and additional energy is
needed to reproduce. See Table 2 for the caloric values of the food and Table 3 for the
survival and reproduction energy needs for each bird type. Keep in mind there is
competition between East and West Clipland to see which population will become the
largest. When there is enough energy to reproduce, one offspring is made that is
identical to the parent.
The entire population will have 30 seconds to eat all that they can, at the same time,
but remember each of the various food types have a different caloric value.
To gather food, the “beaks” are opened, the food is grasped, the “beak” is closed, and
the food is deposited in the stomach.
At the end of each feeding, the number of calories must be calculated and the fate of
the bird must be recorded in Table 4. The number of birds that survive and the
number of offspring for each season will be recorded. Students who were not part of
the original six birds, will become the offspring for seasons 2 and 3. Birds that do not
survive, are eliminated from the population, but may become offspring in future
seasons.
After Season 1 is completed, return all of the food to the bag.
Pour the bag labeled Season 2 into the container and repeat steps 7-10.
At the end of Season 2, return all of the food to the bag.
Pour the bag labeled Season 3 into the container and repeat steps 7-10.
Record the initial populations and the end total population for East and West
Clipland on the board for each season and each bird beak.

Table 1: Types and amounts of food available each season

 

 

 

 

 

 

 

 

 

Location Season 1 Season 2 Season 3
4 cups popcorn 1 cup popcorn
East Clipland 2 cups lima beans 20 lima beans 100 marbles
50 marbles 50 marbles
4 cups popcorn 4 cups popcorn
West Clipland 2 cups lima beans 20 lima beans 6 cups of popcorn
50 marbles 5 marbles
Name

 

108

Hour
1. Predict which bird beak will be the most successful in each season, and explain why
you think that way.
East Clipland Season 1:

 

East Clipland Season 2:

East Clipland Season 3:

West Clipland Season 1:

West Clipland Season 2:

West Clipland Season 3:

2. Based on your predictions, describe what you think the population on each side of the
island will look like at the end of the third season. Explain why you think your
predictions are likely.

East Clipland:

West Clipland:

Table 2: Food Values in Kilocalories
F
Marblefruit

B T 't rma beans
T' Tootfr'uit

 

Table 3: Kilocalories Needed for Survival and Reproduction

 

 

 

 

Type of beak Kilocalories needed Kilocalories needed
to survive to reproduce

Large beak 100 200

Medium beak 60 120

Small beak 35 70

 

 

 

 

 

Table 4: Clipbird Population
109

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Size Season 1 Season 2 Season 3

Small Initial Population Initial Population Initial Population
Survivors Survivors Survivors
Offspring Offspring Offspring
Total moving to Total moving to Total at end
Season 2 Season 3

Medium Initial Population Initial Population Initial Population
Survivors Survivors Survivors
Offspring Offspring Offspring
Total moving to Total moving to Total at end
Season 2 Season 3

Large Initial Population Initial Population Initial Population
Survivors Survivors Survivors
Offspring Offspring Offspring
Total moving to Total moving to Total at end
Season 2 Season 3

 

Questions and Analysis:

3. On a separate piece of paper, graph the initial populations and the end total population

for the small, medium, and large beaks for each season and for both sides of the

island. The seasons are on the x-axis and the number of birds should go on the y-axis.

All of the information should be put on one graph.

4. What does the graph show is happening to the population of birds in East Clipland?
Explain what you think caused the changes seen in the graph.

5. What does the graph show is happening to the population of birds in West Clipland?
Explain what you think caused the changes seen in the graph.

6. Determine which beak size was the best adaptation for each of the seasons in East

110

 

10.

ll.

12.

l3.

14.

15.

Clipland.
Season 1

 

Season 2

 

Season 3

 

. Compare your predictions with your results for East Clipland. Were the predictions the

same as the results? Why or why not?

. Determine which beak size was the best adaptation for each of the seasons in West

Clipland.
Season 1

 

Season 2

 

Season 3

 

Compare your predictions with your results for West Clipland. Were the predictions
the same as the results? Why or why not?

Deﬁne natural variation. Give at least two sources of natural variation found in this
simulation.

Explain the role of the mountain range on the island. In other words, how does the
mountain range effect the population of birds?

After three seasons, explain whether or not you think speciation is occurring between
the two populations of Clipbirds. Give evidence to support your claim.

What type of speciation do you think is occurring on Clipland? Explain your answer.

Rate this activity 1 2 3 4 5, I liked 5 disliked and please tell me why?

What could be done to improve this activity?
APPENDIX 11, K

111

Chronology of Hominids
Adapted from: by Larry F lammer
http://www.indiana.edu/~ensiweb/lessons/chronlab.html

Introduction: As more discoveries are made, the fossil record for hominids is becoming
more complete. Hominids include humans and their two-legged primate ancestors. With
the addition of more information, the gaps in the fossil record are starting to show a more
complete history of early man.

Purpose: To create a timeline of hominid fossils to show the changes in hominids over
time.

Procedure:

1. Start with the oldest fossil in the chart below (A. ramidus), and draw a vertical
line near the lower left corner on the chronology chart. The vertical line should
start at 4.6 million years ago (mya) and end at 4.2 mya. Write the name of the
fossil next to the vertical line.

2. For each of the remaining species, shift about a centimeter to the right each time
and plot the vertical lines on the chronology chart.

3. Estimate as closely as possible the positions to plot which fall between the lines

 

 

 

 

 

 

 

 

 

 

on the chronology chart.

Species/Sub-species Lived. . .Years Ago
Homo sapiens

Cro-Magnon ...................... 50,000-10,000

Neanderthal ....................... 125,000—30,000

Archaic H. sapiens .............. 700,000-250,000
Homo erectus 1.8 mya - 300,000
Homo habilis 2.5 mya — 1.5 mya
Australopithecus boisei 1.8 mya — 1.4 mya
A. robustus 2 mya — 1.5 mya
A africanus 3 mya - 2.3 mya
A. afarensszucy) 3.9 mya -— 3 mya
A. anamensis 4.5 ma — 3.0 mya
Ardipithecus ramidus 4.6 mya — 4.2 mya

 

 

 

 

Extended Chart—Extra Credit (You may tape extra sheets on the bottom of the
chronology chart and plot the following for extra credit)

 

 

 

 

 

 

 

 

 

Chimpanzee Line branched off about 7 mya
Gorilla Line branched off about 10 mya
Ramapthithecus (in orangutan line) Lived about 8 mya

Orangutan Line branched off about 16 mya
Proconsul (very early hominid) Lived about 20-18 mya
Aegyptopithecus (earliest known hominid) Lived about 33 mya

 

112

Chronology Chart

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

113

APPENDIX H, L

Fossil and Migration Patterns in Early Hominids
Adapted from John Banister-Marx
www.teachersdomain.org/resources/tdc02/sci/life/evo/lp_humanevo/index.htrnl

Introduction:

Discoveries of fossil hominids around the world have helped scientists to
determine not only a likely origin for human species, but also a migration pattern
throughout the world Until the 1920's, Asia had been considered the birthplace of
humans. Yet one man stood alone in his conviction that Asia was not the birthplace of
humankind. Louis S. B. Leakey searched the weathered desert slopes of Olduvai Gorge
for several decades, looking along what had been prehistoric shores of an ancient lake
looking for hominid fossils. Eventually his efforts paid off when he conﬁrmed ﬁnding
early hominid fossil remains. Since then, other fossil hominids have been discovered
throughout much of the world. It is the type, dates and distribution of these fossil
specimens that gives us an indication of where humankind's earliest ancestors had
migrated and originated.

Purpose:

Using knowledge of geography and mapping skills, students will determine the
location of a sampling of fossil honrinids to infer a continent of origin and a likely pattern
of migration from that point of origin.

Procedure:

Examine the data below and plot each coordinate. Though this list is not an
exhaustive list of all the fossil hominid discoveries, it is accurate in terms of general
trends of distribution and density within given regions. Mark your map by using red
numbers for Austalopithecines (1-10), blue numbers for Homo erectus (1 1-22), green
numbers for Homo sapiens neanderthalensis, and black numbers for Homo sapiens
sapiens. Write the numbers directly on your map using colored pencils.

Data:
The data below includes four pieces of information:
1. Fossil taxon and its age range in millions of years
2. Location in degrees east or west longitude and north or south latitude, and the
name of site where fossil was found

Australopithecines (4.4-1.4 MYA) Fossils 1-10
1 38°E, 1°S Chemeron 5) 36° E, 5° S Laetoli 9) 27° E, 27° S Swartkrans
2) 27°E, 27°S Sterfontein 6) 36° E, 7° N Omo 10) 38° E, 4° N Koobi-Fora
3) 43° E, 8°N Hadar 7) 26° E, 26° S Kromdrai

4) 37° E, 4° S Olduvai 8) 28° E, 25°S Magapansgat

 

 

 

 

 

 

 

 

 

114

Homo erectus (1.9-.3 MYA) Fossils 11-22

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

11) 112° E, 38° N 15) 38° E, 4° N Koobi- 19) 27° E, 27° S
Zhoukoudian Fora Sterkfontein
12) 112° E, 8°S Modjokerto 16) 6° W, 35 ° N Sale 20) 43° E, 8° N Nhadar
13) 18° E, 18° N Yayo 17) 13° E, 47° N Mauer 21) 37° E, 4° S Olduvai
14) 7° W, 34° N Rabat 18) 27° E, 27° S 22) 36° E, 7° N Omo
Swartkrans
Homo neanderthalensis (.13-.03 MYA) Fossils 23-44
23) 36° E, 33° N Amud 31) 11° E, 47° N Steinheim 39) 36° E, 35° N Tabun
24) 110° E, 7° S Solo 32) 7° E, 52° N Neanderthal 40) 24° E, 30° S Florisbad
25) 8° E, 32° S Saldanha 33) 34° E, 45° N Kiik-Koba 41) 138° E, 34° S Lake
MungO
26) 27° E, 32° S Broken 34) 5° W, 32° N Jebel- 42) 115° E, 1° N Niah
Hill Irhoud
27) 68° E, 41° N Teshik 35) 38° E, 50° N Sungir 43) 137° E, 38° N
Tash
28) 5° W, 35° N Gibraltar 36) 3° E, 43° N Lascaux 44) 112° E, 38° N
Zhoukoudian
29) 44° E, 36° N Shanidar 37) 18° E, 48° N Predmost
30) 2° W, 52° N 38) 70° E, 62° N
Swanscombe

 

Early modern Homo sapiens (.l-.02 MYA) Fossils 45-56

 

 

 

 

 

45) 75° W, 2° N Punin 49) 108° E, 27° N 53) 88° W, 32° N Natchez
46) 120° W, 44° N 50) 32° E, 27° S Border 54) 102° W, 32° N
Marmes Cave Midland
47) 100° E, 54° N 51) 35° E, 32° Jebel Qafzeh 55) 81° W, 27° N Vero
Beach
48) 70° E, 23° N 52) 44° W, 18° S Lagoa 56) 99° W, 19° N
Santo Tepexpan

 

 

 

115

 

 

 

Questions

1. How many thousands of years ago is 1.3 million years? Or .02 million years?

2. Why have scientists concluded that Africa is the “birthplace” of hominids?

3. Find a fossil and write its type (taxon) and map coordinates for each of the following
locations listed below.

 

Location

Coordinates

Fossil Type

 

China

 

United States

 

Mexico

 

Australia

 

Brazil

 

Java

 

Germany

 

Ethiopia

 

Iraq

 

 

South Aﬁica

 

 

 

4. Which taxon seems to have the smallest range of distribution?

5. Which taxon seems to have the largest range of distribution?

6. Explain how you think that the hominids got to all of the different places.

7. In which area does Neanderthal seem to be most prominent?

8. Describe the overall pattern of hominid migration based on the data that you plotted.

116

 

Figure 7. World Map

of

o2

o2

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

117

APPENDIX III, A

Evolution Unit Pre-Survey

Answer the following questions on a scale of 1-5.

10.

ll.

12.

13.

14.

15.

l6.

l7.

6. Strongly Disagree

7. Disagree
8. Neutral/No opinion
9. Agree

10. Strongly Agree

. Variation exists within members of a population.

1 2 3 4 5

. Artiﬁcial selection has been used by humans for thousands of years.

1 2 3 4 5

. DNA mutations are always harmful.

1 2 3 4 5

. Organisms are linked by a universal genetic code.

1 2 3 4 5

. Most species on earth were created at the same time.

1 2 3 4 5

. The earth is 6,000-10,000 years old.

1 2 3 4 5

. The fossil record is incomplete, and thus provides poor evidence for the history of life

on earth.
1 2 3 4 5

. New species discovered today have been on earth for thousands of years.

1 2 3 4 5

. Humans as a population are perfectly adapted.

1 2 3 4 5
The ﬁtness of an organism is the ability of an organism to survive and reproduce.
1 2 3 4 5
A theory is just a guess with little or no evidence to support it.
1 2 3 4 5
There is no evidence for evolution.
1 2 3 4 5
Evolution is not occurring in organisms today.
1 2 3 4 5
Evolution states that humans came ﬁ'om monkeys.
l 2 3 4 5
It is most likely that humans originated from Africa.
1 2 3 4 5

Open response questions

What is science?

What is science based on?

118

18.

19.

20.

21.

22.

23.

24.

25.

Explain what a fact is and give an example.

What is a scientiﬁc theory?

How is a theory different from a hypothesis?

Explain why evolution is considered a theory.

Do labs and activities enhance your learning Explain why or why not.

What is your opinion of evolution?

Do you think that evolution should be taught in schools? Why or why not?

How do you think life on earth originated? Explain your answer.

119

APPENDIX III, B

 

 

Chapter 14 pretest Name
Hour
1. How can the age of a fossil be determined?

2.

9.

What evidence is there of how the ﬁrst cells may have formed and evolved?

. What evidence is there for organisms that once lived on Earth?

How old is the Earth thought to be?
a. 10,000 years
b. 4.6 million years old
c. 1 billion years old
d. 4.6 billion years old

. When did life on Earth evolve?

a. 4.6 to 4.0 billion years ago
b. 3.9 to 3.5 billion years ago
a. 4.6 to 4.0 million years ago
b. 3.9 to 3.5 thousand years ago

Which of the following choices place the eras in order from oldest to most recent.
a. Mesozoic, Cenozoic, Paleozoic, Precambrian
b. Precambrian, Paleozoic, Mesozoic, Cenozoic
c. Cenozoic, Mesozoic, Paleozoic, Precambrian
d. Paleozoic, Cenozoic, Precambrian, Mesozoic

Life evolved in the?
a. Mesozoic
b. Cenozoic
c. Paleozoic
d. Precambrian

. Which of the following choices list the organisms in the proper order of appearance in

the fossil
record from the earliest appearing organisms to the most modern organisms.
a. prokaryotes, eukaryotes, ﬁsh, land plants, amphibians, reptiles, mammals,
birds, humans
b. ﬁsh, prokaryotes, land plants, eukaryotes, amphibians, humans, reptiles,
mammals, birds
c. eukaryotes, prokaryotes, amphibians,birds reptiles, mammals, birds, land
plants, humans
(1. humans, birds, mammals, reptiles, amphibians, land plants, ﬁsh, eukaryotes,
prokaryotes
Primates evolved years ago and modern humans evolved years
ago.

120

APPENDIX III, C

Test 14 THE HISTORY OF LIFE Name

Multiple Choice Hour
Identify the letter of the choice that best completes the statement or answers the question.

1. Since the 19503, experiments have been conducted that lead scientists to conclude that life
may have originated .
spontaneously as originally thought

 

 

 

a.
b. in small pools of water where amino acids could be concentrated

c. in other parts of the universe

(1. when prokaryotes joined together to make the ﬁrst eukaryotic cell

2. Before biogenesis became an accepted cornerstone of biology, _was widely accepted.
a. living things could arise spontaneously from other things

b. Francesco Redi and Louis Pasteur would be unable to test the current beliefs

c. ﬂies could be produced only ﬁ'om other ﬂies

d. maggots were the immature offspring of ﬂies

3. Humans are thought to have evolved during the Era.

a. Cenozoic c. Mesozoic

b. Paleozoic d. Precambrian

4. The Geologic Time Scale begins at the formation of Earth approximately years ago.
a. 4.6 thousand c. 46 million

b. 4.6 million (1. 4.6 billion

5. Which of the following statements are true about fossils?

a. Fossils are usually found in sedimentary rock layers.

b. There are many different ways that fossils can be formed.

c. Fossil insects preserved in amber may contain ancient DNA.

d. all of these

6. Which of the following fossils are not found in sedimentary rock?

a. imprints c. amber

b. ﬁ'ozen mammoths d. petriﬁed wood

7. While looking for fossils on an eroded hillside, you discover the fossil imprint of a fern frond
and some fossil moss. In a layer just above, you ﬁnd fossil coral and ﬁsh. Assuming the rock has
not been disturbed, which of the following is the most probable conclusion?

a. The area had been a sea until recent times.

b. A forest had once grown there but had become submerged by water.

c. A sea replaced been replaced by the land in ancient times.

d. A saltwater sea had changed to a ﬁ'eshwater lake in ancient times.

8. This scientist was the ﬁrst to teach spontaneous generation
a. L. Pasteur

b. F. Redi

c Aristotle

d J. van Helmont

121

9. The ﬁrst prokaryotes probably obtained their food

a. through the synthesis of organic molecules from inorganic molecules
b. through a combination of photosynthesis and aerobic respiration

c by eating carbohydrates formed by autotrophs

d by consuming organic molecules available in their environment

10. Which group of organisms is believed to have been the earliest to evolve?
a land plants 0. aquatic dinosaurs
b. cyanobacteria d. mammals

11. A theory concerning the origin of life states that Earth's ancient atmosphere contained
a. water vapor, methane, and ammonia

b. water vapor, oxygen, and hydrogen

c methane, ammonia, and oxygen

d methane, carbon dioxide, and oxygen

12. Which fact is the basis for using the fossil record as evidence that evolution has taken place?
a In undisturbed layers of rock strata, the older fossils are found in the deeper layers.

b. There are fossils of all life-forms to be found in rock layers.

c All fossils were formed at the same time.

d Fossils have been shown to provide a complete record of human evolution.

13. Urey and Miller subjected water, ammonia, methane, and hydrogen to heating and cooling

cycles and jolts of electricity in an attempt to

3. determine how the dinosaurs became extinct

b. ﬁnd out whether the conditions of ancient Earth could have formed complex organic
compounds

c. determine the age of microfossils

(1. ﬁnd out how ozone forms in the atmosphere

14. hypothesized, in the 1930's, that the early earth’s environment may have allowed
life to evolve. That the ammonia, methane, carbon dioxide, water vapor, heat, radiation, and
lightning created a primordial soup in the early oceans leading to the ﬁrst cells

 

a. Huxley c. Miller and Urey

b. Oparin d. Fox

15. Sidney Fox, in the 1950's, developed by heating amino acids
a. prokaryotic cells c. autotrophic cells

b. eukaryotic cells (1. protocells

16. The ﬁrst cells were thought to be

a. autotrophic eukaryotes c. heterotrophic eukaryotes
b. autotrophic prokaryotes d. heterotrophic prokaryotes
17. How long ago is it thought that life ﬁrst evolved on Earth?

a. 4.6 billion years ago c. 3.5 thousand years ago

b. 3.5 billion years ago d. 3.5 million years ago

18. Life ﬁrst evolved during the ?

a. Mesozoic c. Paleozoic

b. Cenozoic d Precambrian

122

19. Place the following eras in order from most recent to the oldest

a. Precambrian, Paleozoic, Mesozoic, c. Precambrian, Mesozoic, Cenozoic,
Cenozoic Paleozoic

b. Cenozoic, Mesozoic, Paleozoic, d. Paleozoic, Precambrian, Cenozoic,
Precambrian Paleozoic

20. Which of the following choices places the type of organism in the correct order of
appearance in the fossil record from the earliest organisms to the most recent organisms.
a. eukaryotes, prokaryotes, invertebrates, c. prokaryote, invertebrates, eukaryotes, ﬁsh,

 

ﬁsh, land plants, reptiles, dinosaurs, land plants, reptiles, dinosaurs, mammals,
mammals, humans humans

b. invertebrates, eukaryotes, prokaryote, d. prokaryotes, eukaryotes, invertebrates,
ﬁsh, land plants, reptiles, humans, ﬁsh, land plants, reptiles, dinosaurs,
dinosaurs, mammals mammals, humans

21. Currently, scientist think primates evolved years ago and that modern human

may have ﬁrst appeared years ago.

a. 30 million & 200,000 0. 30,000 & 3,000

b. 1 million & 1,000 d. 9,000 & 1,000

Matching

a. Precambrian i. Triassic

b. Cambrian j. Jurassic

c. Ordovician k. Mesozoic Era

d. Silurian l. Cretaceous

e. Paleozoic Era m. Cenozoic Era

f. Devonian n. Tertiary

g. Carboniferous- Penn and Miss. o. Quaternary

h. Permian

22. Era dominated by marine organisms

23. Period when coal was produced, ﬁrst seed plants and reptiles
24. Era dominated by dinosaurs

25. First dinosaurs and mammals

26. First placental animals

27. Flowering plants dominated, dinosaurs go extinct
28. Longest era, cells were thought to develop

29. First amphibians

30. Humans evolved in this period

31. First jawed ﬁsh and land plants

32. First invertebrates

33. Present era dominated by mammals and humans
34. First ﬂowering plants and birds

35. First Vertebrates

36. Conifers dominate

123

9‘!”

37.
38.

39.
40.
41.

Needharn (1. Van Helmont
Huxley e. Leeuwenhoek
Spallanzani

Discovered many microorganisms with microscopes

Used broth and glass jars boiled the broth then sealed the top by melting the glass- prevented
broth from spoiling, disproving S.G.

boiled broth for ~10 minutes, sealed with cork- broth spoiled, supported S.G.

Biogenesis- life arises from other living things

Had a recipe for mice= rags + grain

Short Answer

42.

43.

.0

45.
46.

47.

48.
a.

b.

C.

How did Francesco Redi and Louis Pasteur support the concept of biogenesis with their
experiments? Please draw out the experiments and explain the signiﬁcance of each (8
points).

Discuss three types of fossils and how they are formed (2 points each). Extra credit -
describe the other types of fossils

. Explain, in detail, how scientists determine the age of a fossil. We discussed two methods in

class (8 points).
What signals the beginning and the end of an era (2 points)?

How were the ﬁrst cells thought to have developed? Please give data that supports this
theory (4 points)?

Essay

What information and data do scientists use to support the theory of evolution. We discussed
several of them throughout chapter 14. Please explain them in detail and give examples to
support your answer(8 points).

What are the three statements of the cell theory (2 points each)?

124

APPENDIX 111, D

Name

 

Hour
Chapter 15 Pre-test

1. Who is the father of the modern theory of evolution?

2. Explain the concept of natural election.

4. What are the two main sources of variations within a population?

5. What is an adaptation?

6. Please give examples of adaptations and explain each one.

7. Compare and contrast artiﬁcial selection and natural selection.

8. Deﬁne speciation?

9. How does speciation occur?

10. Deﬁne the following terms and give examples for each.
a. Homologous structures

b. Vestigial organs

c. Analogous structures

d. Embryology

e. convergent evolution

f. divergent evolution

g. adaptive radiation

125

APPENDIX III, E

Test 15 Name

Multiple Choice Hour
Identiﬁr the letter of the choice that best completes the statement or answers the question.

1. Hawaiian honeycreepers are a group of birds with similar body shape and size. However, they
vary greatly in color and beak shape. Each species occupies its own niche and is adapted to the
foods available in its niche. The evolution from a common ancestor to a variety of species is an

example of
a. adaptive radiation c. vegetative propagation
b. cross-pollination d convergent evolution

2. Within a decade of the introduction of a new insecticide, nearly all of the descendants of the
target pests were immune to the usual-sized dose. The most likely explanation for this immunity
to the insecticide is that

eating the insecticide caused the bugs to become resistant to it

eating the insecticide caused the bugs to become less resistant to it

it destroyed organisms that cause disease in the insects, thus allowing them to live longer

it selected random mutations that were present in the insect population and that provided
immunity to the insecticide

9‘9 9'!”

3. Mutations such as polyploidy and crossing over provide the genetic basis for
a. evolution 0. biogenesis
b. spontaneous generation (1. sexual reproduction

4. Structures that have a similar embryological origin and structure but are adapted for different
purposes, such as a bat wing and a human arm and whale ﬁn are called

a. embryological structures c. homologous structures

b. analogous structures d. homozygous structures

5. Natural selection can best be deﬁned as the .

a. survival of the biggest and strongest organisms in a population

b. elimination of the smallest organisms by the biggest organisms

c. survival and reproduction of the organisms that occupy the largest area

(1. survival and reproduction of the organisms that are genetically best adapted to the

environment

6. A pattern of evolution that results when two unrelated species begin to appear similar because
of environmental conditions, such as birds, bats and bees, is

a. disruptive selection c. directional selection

b. convergent evolution (1. divergent evolution

7. The average individuals of a population are favored in selection.

a. directional c. disruptive

b. stabilizing (1. natural

8. In selection, individuals with both extreme forms of a trait are at a selective advantage.
The average organism is not selected for survival

a. directional c. disruptive

b. stabilizing (1. natural

126

9. selection favors one extreme form of a trait in a population, such as a larger beak
in birds.

at Directional c. Disruptive

b. Stabilizing (1. Natural

10. What is the movement of genes into and out of a gene pool called?
a. random mating c. migration

b. nonrandom mating (1. direct evolution

11. The variations needed for the origin of structural and physiological adaptations to occur are

provided by .
a. mimicry c. punctuated changes
b. gradual changes d. mutations

12. A mechanism of Darwin's proposed theory is

a. natural selection c. variation

b. evolution (1. all of these

13. The founder of modern evolution theory is considered to be .
a. Charles Darwin 0. Stephen Jay Gould
b. Alexander Oparin (1 Lynn Margulis

14. Upon close examination of the skeleton of an adult python, a pelvic girdle and leg bones can
be observed. These features are an example of

a. artiﬁcial selection 0. vestigial structures

b. homologous structures d. comparative embryology

15. The theory of continental drift hypothesizes that Africa and South America slowly drifted
apart after once being a single landmass. The monkeys on the two continents, although similar,
show numerous genetic differences. Which factor is probably the most important in maintaining
these differences?

a. comparative anatomy c. geographic isolation

b. comparative embryology d. fossil records

16. When checking shell color for a species of snail found only in a remote area seldom visited
by humans, scientists discovered the distribution of individuals that is shown in the graph in
Figure 8. Based on the information shown in the graph, the snail population is undergoing

‘8

 

 

Z

 

Figure 8. Coloration of snails

a. stabilizing selection c. artiﬁcial selection
b. disruptive selection (1. directional selection

127

17. The ﬂying squirrel of North America closely resembles the ﬂying phalanger of Australia.
They are similar in size and have long, bushy tails and skin folds that allow them to glide through
the air. The squirrel is a placental mammal, while the phalanger is a marsupial. These close
resemblances, even though genetically and geographically separated by great distances, can best

be explained by .

a. convergent evolution 0. spontaneous generation

b. divergent evolution d. vestigial structures

18. Which answer BEST shows an animal's adaptation to the tropical rain forest?
a. camouﬂage in a tree frog c. an elephant's long trunk

b. the long neck of a giraffe d. migration of birds in winter

19. Which of the following is _ngt a factor that causes changes in the frequency of homozygous
and heterozygous individuals in a population?

a. mutations c. random mating

b. migration (1. genetic drift

20. Which combination of characteristics in a population would provide the gr_eatest potential for
evolutionary change?

a. small population, few mutations c. large population, few mutations

b. small population, many mutations (1. large population, many mutations

21. Mutations occur because of
the introduction of new variations ﬁ'om elsewhere

 

 

a.
b. the introduction of new variations through mistakes in DNA replication

0. the chance survival and reproduction of new variations

(1. change in allele or genotype frequencies

22. When one species is thought to evolve into two different species, as in the ground squirrels
located at the Grand Canyon, evolution is said to have occurred.

a. convergent c. extinctive

b. divergent d. stabilized

23. In the changes in a species occurs slowly and over a long period of time,
while in there is very little change over long periods of time followed by sudden

 

change and development of species

a. punctuated, radiation c. punctuated, gradualism

b. gradualism, rapid pace d. gradualism, punctuated

24. Bacteria and viruses will demonstrate changes in a very short period of time
a. no c. slow

b. rapid d. few

128

25. Why is the Hardy-Weinberg Principle useful when studying evolution?

Explain each rule of H-W Principle please tell me how the human population violates it. (3 points
each).

a. Large populations-

b. No Mutations-

c. No Immigration-

d. Random mating-

e. No genotype more likely to survive-

26. The allele frequency for the pepper moth population prior to the industrial revolution was
determined to be W=.8 (white allele) and the w= .2 (dark allele). After the industrial revolution
the population frequency changed to W= .3 and w= .7. Why the did the frequencies change(6

points). Extra Credit- show me punnet squares that utilize this information.
Prior-

After industrial revolution-

27. Summarize Darwin's theory of evolution through natural selection. Also tell me what
inﬂuenced his thinking when developing the theory of evolution (2 points each).
Theory-

Inﬂuences
a.

d.
Extra credit: Tell me about Malthus and Wallace

Malthus-

Wallace-

129

29. A study of the squirrel population in a large northern city revealed that many of the squirrels
inhabited large park areas that were also populated by numerous squirrel predators. The graph in
Figure 9 reﬂects the data collected in regard to color and nmnber of squirrels. Explain why the
light- and dark-colored squirrels might be selected for and the medium-colored squirrels selected
against (3 points).

30. Deﬁne Speciation and Describe ways in which speciation is thought to occur. Give an
example for each (3 points each).

Speciation-

a. Geographical Isolation-

b. Reproductive Isolation-

c. Change of chromosome number-

31. How can scientist use data on DNA or biochemicals produced by different species to
determine how closely related they are to each other (6 points)?

32. What are the sources of variations within a population or species? Give examples of
variations (at least 2) and describe the importance of variations as they relate to natural selection
and evolution (6 points).

A. Sources-

B. Examples-

C. Importance-

130

33. Deﬁne the following terms, give examples of each, and tell me why they are considered
important for the theory of evolution.

a. Homologous structures-

b. Vestigial organs-

c. Embryology-

d. Physical adaptations-

g. F ossils-

34. Deﬁne Adaptation and explain why they are important for survival of a species (4 points).

131

APPENDIX III, F

Pretest 16 Name

 

Hour

1. What is a Hominid?

N

. What evidence is there for human evolution?

0»)

. What adaptations do humans have and tell me why they are important?

4. What primate is our closest relative?
5. What are the sources of variation in the human population?
6. Where are the oldest hominid fossils found?

7. What vestigial organs do humans have and why are they used to study human
evolution? -

132

APPENDIX 111, G

Skulls —Pre-lab questions Name

Hour___

1. What adaptations or changes have taken place in skulls of hominids over the millions
of years they have walked on this planet?

 

2. What can you tell me about the following species:
A. Australopithecus africanus-

B. Homo erectus-

C. Homo habilis-

D. Homo sapiens neanderthalensis-

3. Homo sapiens sapiens -

4. Pongo pygmaeus pygmaeus (orangutang)-

5. Pan troglodytes (chimpanzee)-

6. Gorilla gorilla gorilla —

7. What is the foramen magnum and why is it important when studying hominid
skulls?

8. What is the cranium module used to help determine?

9. Why is the slope of the forehead important when studying hominid skulls?

133

APPENDIX 111, H
Evolution Unit Post-Survey

Answer the following questions on a scale of 1-5.
11. Strongly Disagree
12. Disagree
13. Neutral/No opinion
14. Agree
15. Strongly Agree

1. Variation exists within members of a population.
1 2 3 4 5
2. Artiﬁcial selection has been used by humans for thousands of years.
1 2 3 4 5
3. DNA mutations are always harmful.
l 2 3 4 5
4. Organisms are linked by a universal genetic code.
1 2 3 4 5
5. Most species on earth were created at the same time.
1 2 3 4 5
6. The earth is 6,000-10,000 years old.
1 2 3 4 5
7. The fossil record is incomplete, and thus provides poor evidence for the history of life
on earth.
1 2 3 4 5
8. New species discovered today have been on earth for thousands of years.
1 2 3 4 5
9. Humans as a population are perfectly adapted.
1 2 3 4 5
10. The ﬁtness of an organism is the ability of an organism to survive and reproduce.
1 2 3 4 5
11. A theory is just a guess with little or no evidence to support it.
1 2 3 4 5
12. There is no evidence for evolution.
1 2 3 4 5
13. Evolution is not occurring in organisms today.
1 2 3 4 5
14. Evolution states that humans came ﬁom monkeys.
1 2 3 4 5
15. It is most likely that humans originated from Africa.
1 2 3 4 5

Open response questions

16. What is science?

17.What is science based on?

134

l8.

19.

20.

21.

22.

23.

Explain what a fact is and give an example.

What is a scientiﬁc theory?

How is a theory different from a hypothesis?

Explain why evolution is considered a theory.

Do labs and activities enhance your learning Explain why or why not.

What is your opinion of evolution?

24. Do you think that evolution should be taught in schools? Why or why not?

25. How do you think life on earth originated? Explain your answer.

135

APPENDIX III, I
Lab Assessments

Variation and Adaptation
1. What is natural variation within a population (2 points)?

2. What is the signiﬁcance of having variations within a species such as humans (4
points)?

3. What are the sources of natural variations (2 points)?

4. Explain how an adaptation increases the ﬁtness of a population (4 points).

Natural Selection
5. Using the concept of natural selection, explain how extinction can occur (4 points).

6. Describe selection pressures in nature that could play a role in natural selection (4
points).

7. Are all genetic mutations negative? Why or why not (4 points)?

8. Explain why more offspring are produced than will survive (three points).

Evidence for Evolution
9. Describe a process that can be used to date fossils (5 points).

10. What can be learned from studying the fossil record (4 points)?

11. Why is the comparison of homologous structures between different species useful (4
points)?

12. Describe two ways in which scientists determine how closely two species are related
(4 points).

136

Speciation

13.

14.

How can a mountain range effect a population of birds that has been separated (6
points)?

Explain how speciation can occur (3 points).

Human Evolution

15.

16.

17.

l8.

19.

20.

21.

22.

23.

23.

What are hominids (2 points)?

What characteristics of hominid skulls make them useful in studying the evolution
of hominids (6 points)?

What distinguishes a human skull from the other hominid skulls studied (4 points)?

Compare and contrast the chimp skull to both human and gorilla skulls (6 points).

What characteristics do chimpanzee skull share with early hominid skulls like
Australopithecus (4 points)?

Describe the overall pattern of hominid migration. In other words, where were the
ﬁrst human ancestors found and where did they go (3 points)?

What did you like most about the evolution unit (2 points)?

What did you dislike most about the evolution unit (2 points)?

Which lab did you like the most (2 points)?

Which lab did you like the most (2 points)?
137

APPENDIX III, J

Final Exam 2008

a. Speciation g. Founder effect

b. Mimicry h. Emigration

0. Natural Selection i. Immigration

(1. Analogous structures j. Gene pool

e. Vestigial organs k Genetic equilibrium
f. Genetic drift 1. Artiﬁcial selection
1. The best adapted organisms survive and reproduce

2. Genetic content of a population

3. To move out of a population or area

4. Small useless organs, tailbone wisdom teeth

5. Entering a new area

6. Diﬂ‘erent structures used to accomplish the same task

7. Man chooses who will reproduce, based on variations

8. The ﬁrst organisms to arrive establish the genetics of the population, 7 toed cat
9. Development of species over time

10. When a population is at a constant, no change
11. A change in allele frequency
12. When an organism behaves or appears like other species

a. Human b. Chimp

13. Large Facial prognathism

14. Flat Face

15. u shaped jaw

16. v-shaped jaw

17. foramen magnum at a ninety degree angle
18. arms are nearly as long as the legs.

19. large canine dystema

20. small canines

21. large canines

22. thumb that touches ﬁnger tips

23. large forehead

24. sloping forehead

25. large browridge

26. chin points outward

27. Large hips

28. ﬂat, wide feet

29. walks hunched over

30. foramen magnum at an angle less than 90 degrees

138

9‘1”

31.
32.
33.
34.
35.
36.
37.
38.

39.

44.

. Life ﬁrst evolved during the

Homo sapiens sapiens d. Homo habilis
Homo sapiens neanderthalensis e. Australopithecus aﬁacanus
Homo erectus

500 cc brain, human and apelike characteristics

1500 cc brain, had art and ﬁnely made tools

1000 cc brain, found in Europe, China, Africa, Island of Java

1600 cc brain buried dead with artifacts died out approximately 35,000 years ago
800 cc brain, possibly the ﬁrst tool maker

approximately 1.5-2million years ago

approximately 2 million to 300,000 years ago

approximately 3 million years ago

Multiple Choice

Identify the letter of the choice that best completes the statement or answers the question.
Select the group that best depicts the order that organisms were thought to appear on earth.
bacteria, eukaryotes, mammals, ﬁsh, land c. humans, bacteria, eukaryotes, ﬁsh, land

dinosaurs, plants, ,invertebrates, humans plants, invertebrates, dinosaurs, mammals,
eukaryotes ,bacteria, invertebrates, land (1. bacteria, eukaryotes, invertebrates, ﬁsh,
plants, dinosaurs, ﬁsh, mammals, humans land plants, dinosaurs, mammals, humans

. The primitive Earth atmosphere is hypothesized to have consisted mostly of .

oxygen, nitrogen, and water vapor

hydrogen, methane, ammonia, and water vapor
amino acids, ATP, carbohydrates, and oxygen
none of these

. Which of the following fossils are not found in sedimentary rock?

imprints c. amber
ﬁ'ozen mammoths d. petriﬁed wood

 

Mesozoic c. Cenozoic
Paleozoic d. Precambrian

. Place the following eras into the proper order from oldest to most recent.

Precambrian, Paleozoic, Mesozoic, c. Cenozoic, Mesozoic, Paleozoic,
Cenozoic Precambrian

Paleozoic, Mesozoic, Precambrian, d. Mesozoic, Paleozoic, Precambrian,
Cenozoic Cenozoic

Since the 1950s, experiments have been conducted that lead scientists to conclude that life

may have originated .

.o‘r» era-99‘s

 

spontaneously as originally thought

in small pools of water where amino acids could be concentrated
in other parts of the universe

when prokaryotes joined together to make the ﬁrst eukaryotic cell

. Which group of organisms is believed to have been the earliest to evolve?

land plants c. aquatic dinosaurs
cyanobacteria d. mammals

139

46. The ﬁrst cells were thought to be cells.
a. autotrophic eukaryotes c. heterotrophic eukaryotes
b. autotrophic prokaryotes d. heterotrophic prokaryotes

 

47. Before biogenesis became an accepted cornerstone of biology, it was widely accepted that

 

a. living things could arise spontaneously from other living things

b. Francesco Redi and Louis Pasteur would be unable to test the current beliefs
c. ﬂies could be produced only from other ﬂies

d. maggots were the immature offspring of ﬂies

48. Humans are thought to have evolved during the Era.

a. Cenozoic c. Mesozoic

b. Paleozoic d. Precambrian

49. Which event contributed most directly to the evidence of aerobic organisms?
a. an increase in the concentration of methane in the ancient atmosphere

b. a decrease in the sun's light intensity

0 the presence of organisms able to carry on photosynthesis

d an increase in the number of organisms carrying on fermentation

 

50. The Geologic Time Scale begins at the formation of Earth approximately years ago.
a. 4.6 thousand ' c. 46 million
4.6 million d. 4.6 billion
51. The longest period of Earth history is
a. Cenozoic c. Precambrian
b. Mesozoic d. Paleozoic
52. Currently, scientist think primates evolved over years ago and modern humans
may have ﬁrst appeared years ago
a. 1 million & 1000 c. 100,000 & 20,000
b. 30 million & 200,000 d. 10,000 & 5,000
53. Which of the following statements are true about fossils?
a. Fossils are usually formd in sedimentary rock layers.
b. There are many different ways that fossils can be formed.
c. Fossil insects preserved in amber may contain ancient DNA.
d. all of these

54. Scientists agree that two developments must have occurred for life to come into being: the
formation of simple organic molecules important to life and

a. development of prokaryotic cells in early oceans

b. organization of molecules into complex organic molecules

 

c. appearance of amino acids, monosaccharides, and lipids

d. an atmosphere rich in water vapor, oxygen, and ATP

55. The dinosaurs dominated the era.

a. Cenozoic c. Precambrian

b. Mesozoic d. Paleozoic

56. Life was first thought to evolve on planet Earth years ago
a 4.6 billion 0. 3.5 billion

b. 3.5 million (I. 1 million

140

57. In the 1950's, Sidney Fox developed by heating amino acids
a. protocells c. eutrophic cells
b. autotrophic cells (1 prokaryotic cells

 

58. While looking for fossils on an eroded hillside, you discover fossil coral and ﬁsh in one layer.
In a layer just above, you ﬁnd the fossil imprint of a fern frond and some fossil moss. Assuming
the rock has not been disturbed, which of the following is the most probable conclusion?

a. The area had been a sea until recent times.

b. A forest had once grown there but had become submerged by water.

0. A sea had been replaced by land in ancient times.

(1. A saltwater sea had changed to a ﬁ'eshwater lake in ancient times.

 

59. discovered many single-celled organisms, leading many to think that
spontaneous generation works on small organisms.

a. van Helmont c. Leeuwenhoek

b. Huxley d. Pasteur

60. Entire organisms, with even their most delicate parts intact, have been found preserved in
igneous rock formations and ice

mineral deposits and metamorphic rock

amber and ice

amber and mineral deposits

 

9-9 9’!”

O‘

1. According to one theory, the ﬁrst prokaryotes probably obtained their food .

 

a. through the synthesis of organic molecules ﬁ'om inorganic molecules

b. through a combination of photosynthesis and aerobic respiration

c. by eating carbohydrates formed by autotrophs

d. by consuming organic molecules available in their environment

62. A clear ﬁsh imprint in a rock indicates that the rock is probably .

a. volcanic c. metamorphic

b. sedimentary d. igneous

63. The age of a fossil can most accurately be determined by

a. relative dating c. elemental dating

b. ionic dating (1. radiometric dating

64. Marine organisms such as trilobites dominated the era.

a. Cenozoic c. Precambrian

b. Mesozoic d Paleozoic

65. Which fact is the basis for using the fossil record as evidence that evolution has taken place?
a. In undisturbed layers of rock strata, the older fossils are found in the deeper layers.

b. There are fossils of all life-forms to be found in rock layers.

c. All fossils were formed at the same time.

d. Fossils have been shown to provide a complete record of human evolution.

66. hypothesized, in the 1930's that early earth's environment may have allowed

 

life to evolve. that heat, methane, ammonia, carbon dioxide, water vapor, radiation, and lightning
created a primordial soup in the early oceans leading to the ﬁrst cells.

a. Miller c. Oparin

b. Huxley d. Fox

141

67. came up with the term biogenesis, life comes ﬁ'om life.
a Huxley c. Spallanzani
b. Needharn d. Pasteur

 

68. Urey and Miller subjected water, ammonia, methane, and hydrogen to heating and cooling

cycles and jolts of electricity in an attempt to

a. determine how the dinosaurs became extinct

b. ﬁnd out whether the conditions of ancient Earth could have formed complex organic
compounds

c. determine the age of microfossils

d. ﬁnd out how ozone forms in the atmosphere

 

 

69. carried out research on spontaneous generation. His work supported this
older thought in biology. He had a recipe for mice.

a. Redi c. van Helmont

b. Pasteur d Huxley

70. carried out research with s shaped ﬂasks. He supplied evidence that clearly
proved spontaneous generation was false.

a. Huxley c. Redi

b. Pasteur d. Aristotle

71. Redi carried out research on , disproving spontaneous generation for larger
organisms.

a. life cycles of frogs 0. life cycles of pea plants

b. life cycles of ﬂies (1 life cycles of dogs

72. Which statement would be considered false?
a. fossils appear to become more complex 0. organisms appear to be less complex today

over time than in the past
b. There appear to be more organisms today d. organisms appear to have gotten larger
than in the past over time

73. Galapagos Island ﬁnches are a group of birds with similar body shape and size. However,
they vary in color and beak shape. Each species occupies its own niche and is adapted to the
foods available in its niche. The evolution from a common ancestor to a variety of species is an

example of
a. adaptive radiation c. vegetative propagation
b. cross-pollination d convergent evolution

74. The Abert and Kaibab ground squirrel of North America closely resemble each other. They
are two different species found on different sides of the Grand Canyon. The fossil record
indicates that one species occupied the area in the past. What is thought to have occurred?

a. reproductive isolation c. geographical isolation

b. convergent evolution d. vestigial structures

75. Why is the Hardy-Weinberg Principle useful to biologists?

a. Determines why mutations occur c. Determines how many people live in an
area

b. Determines why populations change d. Determines the death rate of populations

142

76. Survival and reproduction of the best adapted organisms is described as
a artiﬁcial selection 0. hybridization
b. natural selection (1. survivalism

77. If the frequency of the black gene (B) is .2 and the frequency for white gene (b) rs .,8 what
would the frequencies be for each genotype?

3. BB=. 04, Bb=. l6, bb=. 64 c. BB=.04, Bb=.32, bb=.64

b. BB=.4, Bb=.32, bb=.64 d. BB=.04, Bb=.20, bb=. 16

78. Mutations such as polyploidy and crossing over provide the genetic basis for
a. evolution c. biogenesis

b. spontaneous generation (1. sexual reproduction

79. When checking shell color for a species of trout found only in a remote area seldom visited
by humans, scientists discovered the distribution of individuals that is shown in the graph in
Figure 10. Based on the information shown in the graph, the snail population is undergoing

 

 

 

 

;
z ’ :9 w '

light dark

Coloration

Figure 9. Coloration of snails
a. stabilizing selection 0. artiﬁcial selection
b. disruptive selection (1. directional selection
80. thought that the world's food supply for humans was limited and would lead
to war and struggle for survival.
a. Wallace c. Darwin
b. Huxley d. Malthus
81. traveled the area of the Indonesian Islands. He collected 125,000
different species.
a. Wallace c. Huxley
b. Malthus d Darwin
82. When organisms no longer mate and breed at the same time isolation has

 

occurred. This is what may have resulted in the development of several species of hog all mating
at different times of the years.

a. Geographical 0. Chromosomal

b. Reproductive (1. Vertical

143

83. Within a decade of the introduction of a new insecticide, nearly all of the descendants of the
target pests were immune to the usual-sized dose. The most likely explanation for this immunity
to the insecticide is that .

eating the insecticide caused the bugs to become resistant to it

eating the insecticide caused the bugs to become less resistant to it

it destroyed organisms that cause disease in the insects, thus allowing them to live longer

it selected random mutations that were present in the insect population and that provided
immunity to the insecticide

 

999'.”

84. Which of the following is ggt a factor that causes changes in the frequency of homozygous
and heterozygous individuals in a population?

a. mutations c. random mating

b. migration (1. genetic drift

85. Structures that have a similar embryological origin and structure but are adapted for different
purposes, such as a bat wing and a human arm, are called

a. embryological structures 0. homologous structures

b. analogous structures d. homozygous structures

86. Luther Burbank used in his plant breeding operation. He was able to create
several new variations of plants.

a outcrossing c. artiﬁcial selection

b. inbreeding (1. natural selection

87. Natural selection can best be deﬁned as the

survival of the biggest and strongest organisms in a population

elimination of the smallest organisms by the biggest organisms

survival and reproduction of the organisms that occupy the largest area

survival and reproduction of the organisms that are genetically best adapted to the
environment

9".“ 9"!”

88. A pattern of evolution that results when two unrelated species begin to appear similar because
of environmental conditions is

a. disruptive selection c. directional selection

b. convergent evolution (1 divergent evolution

89. The average individuals of a population are favored in __ selection.
a. directional c. disruptive

b. stabilizing d. natural

90. In _ selection, individuals with both extreme forms of a trait are at a selective
advantage.

a. directional c. disruptive

b. stabilizing (1. natural

91. selection favors one extreme form of a trait in a population.

a. Directional c. Disruptive

b. Stabilizing d. Natural

92. What is the movement of genes into and out of a gene pool called?

a. random mating c. migration

b. nonrandom mating (1 direct evolution

144

93. Which answer BEST shows an animal's adaptation to the tropical rain forest?
a. camouﬂage in a tree frog c. an elephant‘s long trunk
b. the long neck of a giraffe d. migration of birds in winter

94 The variations needed for the origin of structural and physiological adaptations to occur are

provided by .

a. mimicry c. punctuated changes
b. gradual changes d. mutations

95. A mechanism of Darwin's proposed theory is

a. artiﬁcial selection c. variation

b. evolution (1. all of these

96. The founder of modern evolution theory is considered to be
a. Charles Darwin c. Stephen Jay Gould
b. Alexander Oparin (1. Lynn Margulis

97. Mutations occur because of

a. the introduction of new variations from elsewhere

b. the introduction of new variations through mistakes in DNA replication
c the chance survival and reproduction of new variations

d change in allele or genotype frequencies

98. Upon close examination of the skeleton of an adult python, a pelvic girdle and leg bones can
be observed. These features are an example of

a. artiﬁcial selection c. vestigial structures

b. homologous structures (1. comparative embryology

99. Which combination of characteristics in a population would provide the mtest potential for
evolutionary change?

a. small population, few mutations c. large population, few mutations

b. small population, many mutations (1 large population, many mutations

100. The theory of continental drift hypothesizes that Africa and South America slowly drifted
apart after once being a single landmass. The monkeys on the two continents, although similar,
show numerous genetic differences. Which factor is probably the most important in maintaining
these differences?

a. comparative anatomy c. geographic isolation

b. comparative embryology d. fossil records

101. The major anatomical difference between hominids and the apes is that the foramen

magnum is in hominids.
a. less developed c. thicker
b. located at the bottom of the skull d all of these

102. As hominids evolved, they developed .

a. a good sense of smell and large lower vertebrae

b. good vision and large teeth

c. structures for walking in an upright bipedal motion
d. large teeth and a well-developed collar bone

145

103. Primates are adapted to live in trees because their eyes

a. are in the front of their beads C. see in stereovision

b. detect color (1. all of these

104. Evidence for the determination of bipedal locomotion in an animal could be found by an
examination of the

 

a. foramen magnum 0. ﬁnger (carpal)

b. upper arm and shoulder d. jaw

105. According to the scientist the lesser chimp or bonobo share of DNA with
humans.

a. 47 c. 100

b. 97 d. 67

106. Primates evolved approximately .

a. 200 000 years ago c. 8 million years ago

b. 2 million years ago (1. 65 million years ago

107. The had a very large saggital crest when compared to the other hominid
skulls.

a. Gorilla c. Homo habilis

b. Chimpanzee d. Orangutan

108. The hominid that had the most advanced tool making abilities and spoken language was

 

a. Homo sapiens sapiens c. Purgatorius
b. Homo sapiens neanderthalensis d. Homo habilis

109. The ﬁrst hominids to make and use simple stone tools were
a. Homo sapiens c. Australopithecus afarensis
b. Homo habilis d. Australopithecus africanus

110. Which factor may have played a large role in human evolution?

a. a geologic event that released much radiation into the environment, which in time resulted
in an increased mutation rate

b. climatic changes that caused the rainforest to change into grasslands, forcing existing
primates to search for new food sources

c. ﬂooding due to melting glaciers causing primates to seek refuge in the trees

(1. massive grassland ﬁres that caused existing primates to ﬂee to the mountains

111. Most early hominid fossils have been found in
a. Egypt 0. Africa
b. France d. North America

112. The jaw ﬁ'om the skull of the genus Homo and one from the genus Australopithecus are
different, in that the jaw from the genus Homo would
a. be much heavier with large teeth and well-deﬁned canines

b. be smaller with smaller teeth and not so much deﬁnition of tooth type
c. be larger with a multitude of small teeth with well-deﬁned canines

d. be smaller with larger teeth that were all about the same

 

146

113. Some primate skeletons were located in a cave in association with these things: a variety of
tools, the charred bones of some animals they had cooked and eaten, and numerous paintings on
the walls. Carbon- 14 dating techniques determined that the bones and other artifacts were about
35 000 years old. The skeletal remains probably belonged to .

a. afarensis c. Homo sapiens sapiens

b. Homo habilis d. Homo erectus

114. The skulls and pelvic bones of australopithecines have structures that appear those of
chimpanzees and modern humans.

a. vestigial to c. intermediate between

b. nothing like (1. identical to

115. Evidence that Homo erectus was more intelligent than its predecessors would include

a. a small cranial capacity as indicated by their skeletal remains
b. involved messages they wrote on cave walls

c. signs of agriculture and tilled ﬁelds

d. tools such as hand axes that have been found near their ﬁre pits

 

116. The had a very large brow ridge when compared to the other hominid
skulls.

a. Chimpanzee c. Homo habilis

b. Gorilla d. Homo erectus

147

APPENDIX 111, K

Name

 

Hour Date
Evolution Assessment
. Give at least two examples of variations that exist within a population of organisms
and tell me why they may be important.

. Why are mutations in the gametes able to be passed ﬁ'om one generation to the next in
organisms that sexually reproduce?

. What is an adaptation?

. Give three examples of a human adaptation and explain why the adaptation is useful.

. Compare the differences and similarities between artiﬁcial selection and natural
selection.

. How does natural selection increase the ﬁtness of a population?
. What is a scientiﬁc theory?

148

8. What is necessary for an idea to become a theory?

9. What does the theory of evolution state?

10. Provide at least three pieces of evidence for evolution and describe each.

149

APPENDIX IV, A

Creating Phylogenic Trees using Caminalcules
Adapted from Robert P. Gendron
Indiana University
http://nsml .nsm. iup.edu/rgendron/Caminalcules.shtrnl

Introduction: This exercise introduces the process of classiﬁcation and the development
of a Phylogenic tree based on the physical characteristics of Caminalcules. Caminalcules
have an extensive fossil record that has been collected by many scientists throughout the
world. You and your partner have been asked to assist in developing a Phylogenic tree
based on the fossil evidence and several currently surviving species of Caminalcules. As
you develop your Phylogenic tree please keep notes on the characteristics that you used
to develop your tree. You will later be asked to compare your classiﬁcation tree to those
of other researchers in your classroom. Your notes will assist you in defending your
Phylogenic tree. Please keep in mind that there may be many possible ways of
developing a phylogenic tree for a given set of data.

About The Caminalcules:

The Caminalcules are artiﬁcial animals created by the late Professor Joseph Camin of the
University of Kansas. They were developed to study how taxonomist classify real
organisms.

Materials: Scissors, rulers, poster board, tape, Caminalcules
Procedures:

1. Cut out the 14 currently living species of Caminalcules and 57 fossilized species of
Caminalcules.

2. Each Caminalcules is identiﬁed by a number, which corresponds to an individual
species.

3. The number in parentheses indicates the age of the fossil which was determined by
radiometric dating.

4. On poster board draw horizontal lines. Each line will represent 1 million years. On
the bottom you will place the oldest specimen at 19 million years ago.

5. You should place the Caminalcules onto the poster board on the corresponding dates.
Organisms that look alike should be placed above their ancestors to show the
evolutionary lines of descent.

6. As you move upward, toward the present, attempt to determine the relationship of the
newer species to the older species. Pay close attention to the characteristics that were
used in determining the relationship ﬁom one species to the others.

7. Use horizontal lines to connect species of Caminalcule that are related. Be able to
justify your reasoning for these relationships.

150

8. Compare your Phylogenic with others within the classroom. Openly discuss and share
your ideas on each Phylogenic tree.

9. When ﬁnished answer the questions and turn in your phylogenic tree making sure to
tape your Caminalcules to the poster board.

Questions

10. What does your phylogenic tree represent?

11. If two Caminalcules are related in your classiﬁcation, or appear close together, what
does that mean?

12. Which Caminalcule fossil is the oldest? What characteristics does it have?
13. Which Caminalcule is most closely related to number 9 and number 7 and why?

14. What may have occurred to number 34?

15. What is the common ancestor to number 20? Why do you think this?

16. If scientists wanted to test this hypothetical phylogenic tree, what other evidence
could be used to analyze the relationships between Caminalcule ?

17. Are any of the Caminalcules dead end lineages or went extinct? What could have
occurred to cause this extinction?

18. Write a paragraph explaining how you developed your phylogenic tree and what
characteristics were used

151

LIVING CAB/IINALCULES

 

FOSSIL CAMINALCULES
(numbers in parentheses indicate age in millions of years)

 

152

FOSSILS (continued)

 

153

APPENDIX IV, B

Laetoli Footprints: Analyzing Fossilized Footprints

Adapted from: Jennifer Johnson
www.indiana.edu/~ensiweb/lessons/footleng.html

Introduction: In 1976, a 3.6 million year old set of hominid footprints were discovered
in Tanzania that were preserved by volcanic ash. They were discovered by Andrew Hill
and a colleague when they were throwing elephant dung at each other. Hill dove out of
the way and landed on the tracks. Since then, the footprints have provided insight into
early bipedal ancestors of humans.

Purpose: To analyze foot length, stride length and height of modern man and compare
these measurements to the Laetoli footprints to calculate early hominid height.

Procedure: You will gather a classroom set of data to determine if there is a relationship
between foot length, leg length, and height. You will also measure your stride while
walking and running.

1.

Measure your foot length, leg length, and height in centimeters and record in the
data table 1.

Graph the footprint size vs. height for the entire class. Footprint size on the x-axis
and height on the y-axis.

Draw a line of best ﬁt thru the data points on your graph.

4. Measure and mark off a distance of 2000 cm (20m).

Walk the length while counting the number of strides (Nw). Record Nw in the
data table.

Run the length while counting the number of strides (Nr). Record the Nr in the
data table.

Calculate the stride length (S) by dividing by the distance (2000 cm) by the
number of strides (N).

Sw = 2000cm + Nw Sr = 2000 cm + Nr

Calculate the ratio of your stride length to leg length (S/L) and record in the data
table.

SfL = Sw + Leg length
Calculate the ratio of stride length (S) to height (S/H) and record in the data table.
S/H = Sw -=- Height

10. Measure the footprint sizes from the model of the Laetoli footprints and record in

Data Table 2.

11. Calculate the average size for the smaller individual and the average size for the

larger individual. Record in Data Table 2.

12. Using the best ﬁt line graph from the class data, determine how tall the

individuals might have been based on their footprint size.

154

l3. Measure the distances between the strides and calculate the average stride
distance for each individual and record in Data Table 2.

Conclusions and Analysis

1. Do you see a pattern on the stride graphs? Explain your answer.

2. Determine if foot length can be used to predict height. To test this hypothesis,
measure a person’s foot length and use your graph to predict his or her height.
Now, measure the height of that person. How close was your prediction to the
actual height? Explain whether or not foot length can be used to predict height.

3. Paleontologists use the ratio of stride length divided by leg length (S/L) to tell
whether a dinosaur is walking, trotting, or running. The following values are used
to determine how a dinosaur might have been moving:

Less than 2 = walking 2-2.9 = trotting More than 2.9 = running

Examine the class data for the ratios of stride to leg length (SW/L and Sr/L) to
determine if the values used for dinosaurs also apply to people. If not, what values
would change? Explain your answer.

4. If a person’s footprints were discovered in someone’s backyard, explain what
information could be determined about the person who made the footprints? What
information about the person could not be determined from the footprints?

5. Explain why you counted your strides over a 2,000 cm length rather than make
only one stride measurement.

155

6. Below is a series of footprints found in the mud outside of school. Based on the
measurements given, calculate the leg length and height of the person. Who do
you think the footprint belongs to?

Foot length = 29 cm Stride length = 160 cm

Estimate how tall the person is and what the person was doing when the footprints
were made.

Class Data Table 1

 

156

Table 2:
Small Footprint # Footprint Size

 

157

APPENDIX IV, C

Genetic Evidence for Evolution: DNA Analysis
Adapted from Heather Peterson,

High School Biology Teacher, Holt High School

Introduction: In today's entertainment world, watching CSI, Law & Order, etc. has
provided many with an experience in what is suitable evidence in a court case. One of
the most prominent evidences used in a courtroom is DNA evidence. Every person has
their own set of DNA, and therefore it is considered to be be their genetic ﬁngerprinting.
This evidence is based on test that looks for unique features in the genetic code that
identify an individuals genes. By comparing DNA sequences, a person can be identiﬁed
by looking at these unique sequences. To ﬁnd these sequences the DNA is digested (cut)
by enzymes that look for a certain part of the genetic code. Every time the sequence of
bases is discovered, by the enzymes, the DNA is out again repeatedly, until many
fragments are made. Then by comparing the amount of common fragments, an individual
person can be identiﬁed, or in a paternity cases, relationships can be identiﬁed ( the more
DNA that is in common between two individuals the closer the relationship). These
fragments are cut and sorted through a process known as gel electrophoresis. We can use
this technology to not only compare individual people, but compare different species. By
comparing these unique fragments of DNA in different species, we can determine how
closely related the species may be. These Genetic relationships are just piece of evidence
to show evolutionary relationships between different species. By understanding
commonality of DNA between species we can understand how they may fall on a
phylogenic tree. In this lab you will compare the DNA ﬁngerprints of a chimpanzee and
a gorilla to that of a human. From the data that you collect, you will be able to see how
related chimps, gorillas and humans are, and how the three species exhibit close
evolutionary relationships.

Objectives:

1. Compare the DNA of Chimpanzees, Gorilla, and Humans to determine their
evolutionary relationship with one another.
2. Simulate how DNA e1 electrophoresis works, and how its application can be used.

Materials:
1. Chimpanzee DNA
2. Gorilla DNA

3. Human DNA
4. Ruler
Procedure:

1. On your lab table, you will see three different DNA sequences that contain both
leading strand, and complementary strand. Each will be labeled according to its
source.

2. The enzyme we will be using to “cut” the DNA is CCGG. At every location on
the leading strand where you cross the CCGG sequence, draw a vertical line
between the C and the G.

3. Once you have completed cutting the three DNA strands with the enzyme, count
how many bases appear in each fragment. Record this value above the DNA

158

fragment.

4. On the “gel” provided, draw a horizontal; at every line that corresponds to your
DNA fragment length (If you have a fragment of 7 base pairs, then on the gel next
to line 7, draw a line).

5. For every duplicate you have of the same fragment length, increase the thickness
of the horizontal line. This will allow you to distinguish if the DNA sequence had
1,2,3, etc. fragments of that length.

6. Complete this process for Chimpanzee, Gorilla, and Human.

7. Once completed compare the similarities in DNA fragment size between the three
species and Answer the follow up questions provided.

Questions:

1. What is the purpose of DNA (2 pts)?

2. Which sized fragments moved farther up the gel (away from the insertion wells)?
Why do you think this is? (2 points each)

3. According to the DNA evidence you have discovered in this lab, which species is
more similar to human? State your evidence from this lab to support your answer
(4 points).

4. If you looked at two DNA sequences from the same species ( two humans, two
chimps, etc.) would their DNA sequence be exactly the same (2 points)?

5. Draw a phylogenic tree of the three species that we have looked at in this lab,

based upon the evidence we have found. What does this mean in terms of their
evolutionary relationship (6 points)?

159

DNA ﬁngerprints

 

160

CHIMP

ATGATCCGGTATTCCGGTAACGTCCGGATGTCCGGATGCGTTGAAACCGGATC
TACTAGGCCATAAGGCCATTGCAGGCCTACAGGCCTACGCAACTTTGGCCTAG

GATCGTTCCGGATGGACCGGTCGATGGTCTAGTCGTACCGGAGCTAGCTACTG
CTAGCAAGGCCTACCTGGCCAGCTACCAGATCAGCATGGCCTCGATCGATGAC

ATGCTAATGTCCTAGGCATATCCGGGAGAACCTTTCGCCGGCTGATCGATCGAT
TACGATTACAGGATCCGTATAGGCCCTCTTGGAAAGCGGCCGACTAGCTAGCTA

GCTATCACCGGTAGTCGAATCGACCGGTCCGGATCGTAGCCGGTCGATGCTATA
CGATAGTGGCCATCAGCTTAGCTGGCCAGGCCTAGCATCGGCCAGCTACGATAT

TTATATATGCGCGCCGGATGTAACCGGATGCTAGCTAGCCATCTAGATCCGGAA
AATATATACGCGCGGCCTACATTGGCCTACGATCGATCGGTAGATCTAGGCCTT

GCTAGCTAGCTAGCTAGTAGCTACGAACTCCGGTAGTACTGTGACCGGTTATCG
CGATCGATCGATCGATGATCGATGCTTGAGGCCATCATGACACTGGCCAATAGC

TATGAGCGTCATCCGGTACCGGTATACCGGCGCTA
ATACTCGCAGTAGGCCATGGCCATATGGCCGCGAT

GORILLA

ATGATCCGGTATTCCGGTAACGTCCGGATGTCCGGATGCGTTGAAACCGGATC
TACTAGGCCATAAGGCCATTGCAGGCCTACAGGCCTACGCAACTTTGGCCTAG

GATCGTTCCGGATGGACCGGTCGATGGTCTAGTCGTACCGGTGCTAGCTACAG
CTAGCAAGGCCTACCTGGCCAGCTACCAGATCAGCATGGCCACGATCGATGTC

ATGCTAATGTCCTAGGCATATCCGGGAGAACCTGTCGCCGGCTGATCGATCGAT
TACGATTACAGGATCCGTATAGGCCCTCTTGGACAGCGGCCGACTAGCTAGCTA

GCTATCACCGGTAGTCGAATCGACCGGTCCGGATCGTAGCCGGTCGATGCTATA
CGATAGTGGCCATCAGCTTAGCTGGCCAGGCCTAGCATCGGCCAGCTACGATAT

TTATATATGCCGGCCGGATGTAACCGGATGCTAGCTAGCCATCTAGATCCGGAG
AATATATACGGCCGGCCTACATTGGCCTACGATCGATCGGTAGATCTAGGCCTC
CTATGTAGCTAGCTAGTAGTATCGTATTCCAGTAGTACTGTGACCGGTTATCGTA
GATACATCGATCGATCATCATAGCATAAGGTCATCATGACACTGGCCAATAGCT

TGAGCGTCATCCGGTACCGGTATACCGGCGCTA
ACTCGCAGTAGGCCATGGCCATATGGCCGCGAT

161

HUMAN

ATGATCCGGTATTCCGGTAACGTCCGGATGTCCGGATGCGTTGAAACCGGATC
TACTAGGCCATAAGGCCATTGCAGGCCTACAGGCCTACGCAACTTTGGCCTAG

GATCGTTCCGGATGGACCGGTCGATGGTCTAGTCGTTTACGGCTATACCGGAGC
CTAGCAAGGCCTACCTGGCCAGCTACCAGATCAGCAAATGCCGATATGGCCTCG

TAGCTACTGATGCTAATGTCCTAGGCATATCCGGGAGAACCTTTCGCCGGCTGA
ATCGATGACTACGATTACAGGATCCGTATAGGCCCTCTI‘GGAAAGCGGCCGACT

TCGATCGATGCTATCACCGGTAGTCGAATCGACCGGTCCGGATCGTAGCCGGTC
AGCTAGCTACGATAGTGGCCATCAGCTTAGCTGGCCAGGCCTAGCATCGGCCAG

GATGCTATATTATATATGCGCGCCGGATGTAACCGGATGCTAGCTAGCCATCTA
CTACGATATAATATATACGCGCGGCCTACATTGGCCTACGATCGATCGGTAGAT

GATCCGGAAGCTAGCTAGCTAGCTAGTAGCTACGAACTCCGGTAGTACTGTGA
CTAGGCCTTCGATCGATCGATCGATCATCGATGCTTGAGGCCATCAT GAC A CT

CCGGTTATCGTATGAGCGTCATCCGGTACCGGTATACCGGCGCTATCGATCGCA
GGCCAATAGCATACTCGCAGTAGGCCATGGCCATATGGCCGCGATAGCTAGCGT

TTCGCCCGGCGATATCGGGTATAATTTACGACTTCGACATAGCGTACG
AAGCGGGCCGCTATAGCCCATATTAAATGCTGAAGCTGTATCGCATGC

162

APPENDIX IV, D

When Milk Makes You Sick
Adapted from: Therese Passerini
www.indiana.edu/~ensiweb/lessons/tp.milk3.htrnl

Introduction: According to statistics, approximately one third of all Americans feel ill
after consuming milk and other dairy products. Parents constantly tell their children to
drink their milk because milk “does a body good.” It is well known that the calcium in
milk helps to build strong teeth and bones. Overall, milk is a good source of nutrients,
like calcium and protein.

Most animals stop drinking milk after they are weaned and their body chemistry
changes so that they can no longer digest the sugar found in milk. Worldwide, this is also
true for the human population. It is actually unusual for adults to be able to digest milk
easily.

Lactose intolerance is the inability to breakdown the sugar found in milk. People
who are unable to breakdown lactose are missing, or have a non-functioning enzyme
called lactase. When lactose intolerant people consume milk, they often feel bloated and
experience gas and diarrhea. As mentioned earlier, most adult animals are not able to
breakdown lactose. Somewhere along the way, some adult humans might have developed
a mutation that allows them to digest lactose as adults.

Purpose: To hypothesize where lactose tolerance might have developed and why, and to
determine the mode of inheritance for the gene.

Part A: Pedigrees

You will make three pedigrees based on each of the scenarios below to determine how
lactose intolerance is inherited. Fill in the circles or squares of individuals that are lactose
intolerant.

Pedigree A

Mike and Donna Miller are both lactose tolerant. They have four children. Fred, Nick,
and Linda are all lactose tolerant. Their daughter Jane is lactose intolerant. Draw the
pedigree for this family below.

Pedigree B
Mary is married to John. Mary is lactose intolerant. They have ﬁve children. Ann, David,
and Dan are lactose intolerant. Nancy and Scott are lactose tolerant.

Pedigree C
Joe and Lucy Anderson are both lactose intolerant. They have four children: Alicia, Eric,
Ben, and Rodney and all of their children are lactose intolerant.

163

IE9:

Analysis of Pedigrees:

1. Does it appear that lactose intolerance is an inherited characteristic? Explain your

answer.

2. How can two parents who are both lactose tolerant produce children who are
lactose intolerant? Explain your answer.

3. What is the most probable mode of inheritance for lactose intolerance? In other
words, is lactose intolerance autosomal or sex-linked, and is it dominant or
recessive. Give reasons for your choices.

4. Draw a Punnett square to support your mode of inheritance for lactose

intolerance.

Part B: Populations and Lactose Intolerance

Graph the information in the charts below that provide percentages for lactose intolerant
populations in different countries. You may use a bar graph. The x-axis should be the
country of origin and the y-axis should be the percentage of lactose intolerance.

Percent of Lactose Intolerant People by Country

 

 

 

 

 

 

 

 

 

 

 

 

Country of Origin Percent Lactose Country of Origin Percent Lactose
Intolerant Intolerant

China 98 Iraq 71
Greenland 85 Russia 16
Mexico 53 Australia 20
Brazil 60 England 15
Italy 55 Kenya 88
South Aﬁica 95 United States 30
India 60 Nigeria 22

 

Ethnicity in the United States also plays a part in lactose intolerance. Graph the

information found in the table below in a bar graph. The ethnicity should go on the x-axis

and the percent of intolerance should go on the y-axis.

164

 

Lactose Intolerance in the United States

 

 

 

 

 

Ethnicity Percent Lactose Ethnicity Percent Lactose
Intolerant Intolerant

African Americans 75 Eskimos 80

Asian Americans 90 Hispanic Americans 53

Caucasians 15 Native Americans 90

 

 

 

 

 

Questions and Analysis:

1.

Formulate a hypothesis as to where lactose tolerance originated and explain why
tolerance would occur here.

2. During the past 5,000 years agriculture has been important to human populations.

In some isolated areas, crops did not perform as well or the climate did not permit
growing crops year round. In these places, animals and their milk were the main
food supply. Use your knowledge of evolution and natural selection to explain
how some populations may have become lactose tolerant.

. What would explain the statistics that approximately 30% of all Americans are

lactose intolerant compared to other parts of the world where that number is more
than 80%?

Compare the percentages of populations in African countries that are lactose
intolerant. Form a hypothesis to explain why Nigeria is so different from the other
African countries. You should include an explanation with your hypothesis.

. Use the articles on lactose tolerance and evolution available in the classroom, to

gather evidence to support your original hypothesis or formulate a new
hypothesis. Write a paragraph about how scientists think lactose tolerance
evolved.

165

Literature Cited

Annas, George J. (2005). Intelligent Judging-Evolution in the Classroom and the
Courtroom. The New England Journal of Medicine, 354:2277-2281(21).
Retrieved June 14, 2008 from http://content.nejm.org/cgi/content/ful1/354/21/2277

Associated Press Dec. 20, 2005. Judge rules against "intelligent design": 'Religous
alternative' to evolution barred ﬁom public-school science classes,
Retrieved June 12, 2008. from http://www.msnbc.msn.com/id/ 10545387

Beil, Laura. June 8, 2008. Grand Rapids Press, New evolution battle looms. page All

Berkley, Teaching Evolution: How to Teach Evolution. Created by University of
California Museum of Paleontology. Retrieved June 12, 2008 ﬁ'om
http://evolution.berkley.edu/evosite/Lessons/index.shtrnl

Berkrnan MB, Pacheco JS, Plutzer E (2008) Evolution and Creationism in America's
Classrooms: A National Portrait. PLoS Biol 6(5):
e124 doi:10.l371/joumal.pbio.0060124
Published: May 20, 2008 pages 13. Retrieved June 14, 2008 from
http:/biology.plosj oumals.org/perlserv/?request=get-document&do pages 1-13

Center for the Renewal of Science and Culture. The Wedge Strategy
Retrieved June 12, 2008 from http://www.antievolution.org/features/wedge.htrnl

Cherif, Abour, Adams, Gerald, Loehr, John. (2001). What on "Earth" is Evolution?
American Biology Teacher, 63(8), 569-585.

Discovery Institute, Seattle, Washington, http://discovery.org/aboutFunctions.php

Dobzhansky, Theodosius. (1973). Nothing in Biology Makes Sense Except in the Light
of Evolution, The American Biology Teacher, 25 125-129 p 129.

Edey, Maitland, Johanson, Donald C. (1989) Blueprints: Solving the Mystery of
Evolution, p. 347. Penguin Books New York.

Faber, Paul. (2003). Teaching Evolution and The Nature of Science. The American
Biology Teacher, 65(5), 347-354.

Flammer, Larry. (2006). The Evolution Solution: Teaching Evolution Without Conﬂict.
The American Biology Teacher; Online Publication, March 2006 1-7.

Gills, James P., Woodward, Tom . (2002). Darwinism Under the Microscope: How
Recent Scientiﬁc Evidence Points to Divine Design, opening and p. 125-126.
Charisma House, Florida.

Gross, Louis J. (June 2006). Computational Skills for Biology Students. An
ActionBioscience.org original interview. Retrieved July 11, 2008 from
http://www.actionbioscience.org/education/gross.html

166

Masci, David, Pew Forum: An Evolving Debate About Evolution, senior research
fellow, Pew Forum on Religion & Public life Retrieved June 14, 2008 from
http://pewforum.org/docs/?DocID=2 1 S.

Meadows, Lee, Doster, Elizabeth, Jackson, David F. (2000). Managing the Conﬂict
Between Evolution and Religion. The American Biology Teacher, 62(2), 102-10.

Michigan Department of Education 2007 MEAP Scores Retrieved June 13, 2008 from
http://www.michigan.gov/mde/0,1607,7- 140-22709_3 l 168_40135---,00.html

Michigan Legislature website. House bill no. 6027. Retrieved June 14, 2008 from
www.1egislature.mi. gov/documents/2007-2008/billintroduced

Michigan Legislature website. Senate bill no. 1361. Retrieved June 14, 2008 from
www.1egislature.mi. gov/documents/2007-2008/billintroduced

Michigan Science Teachers Association, Position Statement on Evolution and the Nature
of Science. Approved by MSTA Board of Directors, Febuary 3, 2007. Retrieved
June 10, 2008 from http://www.msta-mich.org/downloads/about/2007-02-03.doc)

Morrison, David. 2005. Only a Theory?. Skeptical Inquirer. Retrieved June 14, 2008
from http://www.csicop.org/si/2005-1 1/theory.html

Murray, Dave. June 13, 2008. Grand Rapids Press, Science bills not what they seem?
page A1 and A2

National Center for Science Education, Cans and Cant's of Teaching Evolution
Retrieved June 12, 2008 from
http://www.ncseweb.org/resources/articles/9256_cans_and_cants_of_teaching_ev
_2_13_2001 .asp

National Center for Science Education, Defending the Teaching of Evolution in the
Public Schools. NCSE Resource- Creationism in Michigan gubernatorial race.
Retrieved June 12, 2008 from
http://www.ncseweb.org/resources/news/2006/MI/S53_creationism

National Science Teacher Association, NSTA Position Statement: The Teaching of
Evolution. Retrieved June 12, 2008 from
http://www.nsta.org/about/positions/evolution.aspx

National Science Teacher Association, Survey Indicates Science Teachers Feel Pressure
to Teach Nonscientiﬁc Alternatives to Evolution. Released by Cindy Workosky.
Retrieved June 12, 2008 from
http://www.nsta.org/about/pressroom.aspx?id=503 77

Nelson, Craig E. (2007). Teaching Evolution Eﬂ‘ectively: A Central Dilemma and
Alternative Strategies. McGill Journal of Education, 42(2), 265-283.

167

Ozgun-Koca, Asli S. (2001). The Graphing Skills of Students in Mathematics and
Science Education. ERIC Digest. ED464804. Retrieved July 11, 2008 from
http://www.ericdigests.org/2003- 1/graphing.htm

Pennock, Robert T. (2007). Learning Evolution and the Nature of Science Using
Evolutionary Computing and Artiﬁcial Life. McGill Journal of Education,

42(2), 211-223.

Pennock, Robert T. (2006). Swords and Smoking Guns. Science & Theology News.
Retrieved March 27, 2006 from www.stnews.org/print.php?article_id=2688

Pigliucci, Massimo. (2007). The Evolution-Creation Wars: Why Teaching More Science
is Not Enough. McGill Journal of Education, 42(2), 285-306.

PollingReport.com, Origin of Human Life. Retrieved June 14, 2008 from
w pollingreport.com/science.htm Science and Nature pages 1-31

Rutledge, Michael L., Warden, Melissa A. (2000). Evolutionary Theory, The Nature of
Science and High School Biology Teachers: Critical Relationships. The American
Biology Teacher, 62(1). 23-31.

Scharmann, Lawrence C. (2005). A Proactive Strategy for Teaching Evolution. The
American Biology Teacher, 67(1), 12-16.

Thomas More Law Center Retrieved June 12, 2008 from
http://www.thomasmore.org/qry/page.taf?id=23

US. Census Bureau Kent City, Michigan- Fact Sheet - American Fact Finder

Retrieved June 10, 2008 from
http.//factﬁnder.census. gov/servlet/SAFFFacts?_=&geo_id=160

168

F3".

   

lulilliigiiililjiji111111111l