PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

5/08 K:/Proleoc&Pres/ClRC/DateDue.indd

 

MECHANISMS OF N-3 POLYUNSATURATED FATTY ACID INHIBITION OF
MYCOTOXIN DEOXYNIVALENOL-INDUCED IMMUNE RESPONSE
By

Yuhui Shi

A DISSERTATION
Submitted to
Michigan State University
In partial fulfillment of the requirements
For the degree of
DOCTOR OF PHILOSOPHY

Food Science and Environmental Toxicology

2008

ABSTRACT

MECHANISMS OF N-3 POLYUNSATURATED FATTY ACID INHIBITION OF
MYCOTOXIN DEOXYNIVALENOL-INDUCED IMMUNE RESPONSE
By

YUHUI SHI

Consumption of deoxynivalenol (DON), a type B trichothecene mycotoxin
produced by the F usarium sp., has been recognized to affect immune function and induce
immunoglobulin A nephropathy (IgAN) in the mouse. Clinical trials have shown that
dietary n-3 polyunsaturated fatty acid (PUFA) supplementation is beneficial for patients
with progressing IgAN. The purpose of this dissertation was to determine the
mechanisms by which n-3 PUFAs suppressed pathogenesis of IgAN and interleukin-6
(IL-6) upregulation induced by DON. DON consmnption in the mouse model induced
halhnarks of IgAN, such as elevated serum IgA, IgA immune-complexes and IgA
deposition in the kidney. However, dietary supplementation of eicosapentaenoic acid
(EPA), an n-3 PUFA, alleviated these markers. Proinflammatory cytokine IL-6 has been
shown to be critical in the development of DON-induced IgAN. EPA consumption
decreased IL-6 gene expression by inhibiting the transcription factor from binding to the
IL-6 gene promoter. Therefore we proposed that n-3 PUFAS ameliorate DON-induced
IgAN through suppression of IL-6. Using peritoneal macrophages as a model, we
elucidated part of the signal transduction pathway through which DON activated
transcription factor CAMP response element-binding protein (CREB) and induced IL-6

expression. Double-stranded RNA-activated protein kinase (PKR) is a very important

upstream protein kinase in this signal pathway. Inhibition of PKR suppressed
phosphorylation of CREB and its upstream kinases, Aktl, MSKl and RSKl, and
abolished DON induced IL-6 expression. Consumption of docosahexaenoic acid (DHA),
another n—3 PUFA, suppressed IL-6 expression by inhibiting PKR, CREB kinases and
CREB activation. This inhibition was found not due to upregulation of protein
phosphatase 1 and 2A activities. We also investigated the role of endoplasmic reticulum
(ER) stress in the upregulation of IL-6. DON degraded BiP, an ER chaperone, and
induced an ER stress-like response in peritoneal macrophages. The degradation appeared
to be cathepsin/calpain—related. In addition, activating transcription factor 6 (ATF6)
upregulation due to ER stress was indicated to be involved in IL-6 gene expression.
Taken together, these data suggest that n-3 PUFA consmnption suppresses DON-induced
IgAN-like disease in the mouse by interfering with signal transduction involved in IL—6
gene expression. Upregulation of IL-6 might involve multiple pathways in DON-treated

peritoneal macrophages.

This work is dedicated to my dearest parents and sister.

iv

ACKNOWLEDGMENTS

I’m honored to express my deepest gratitude to my dedicated mentor, Dr. James J:
Pestka, for his generous time and commitment. Throughout my doctoral work he helped
me to develop independent thinking and research skills. His patience and encouragement
helped me overcome many crisis situations and finish this dissertation.

I am grateful to Dr. Dale Romsos, Dr. Venugopal Gangur, Dr. Kate Claycombe
and Dr. Julia Busik for their invaluable suggestions and assistance. I am also thankful to
Dr. Maurice Bennink for his kind directions in lipid analysis and to Dr. Linz for his
guidance in scientific writing.

I extend many thanks to my colleagues and friends, especially all the members in
Dr. Pestka’s lab and Dr. Linz’s lab. I will never forget these years we were working

together, learning from each other and helping each other.

TABLE OF CONTENTS

List of tables ......................................................................................... viii
List of figures .......................................................................................... ix
Abbreviations ......................................................................................... xii
Introduction ............................................................................................. 1
Chapter 1. Literature review .......................................................................... 3
Deoxynivalenol ............................................................................... 4
DON-induced IgAN-like disease ............................................................ 6
IgA nephropathy ............................................................................ 20
Treatment of IgAN ........................................................................... 7
n-3 polyunsaturated fatty acids .............................................................. 8
Interleukin-6 ................................................................................. l3
IL-6 gene transcription ...... ' ............................................................... 14
Akt, MSK and RSK ........................................................................ 17
Protein phosphatases and protein dephosphorylation ................................. 19
BiP and ER stress ........................................................................... 20
Protein degradation ......................................................................... 24
Immunoglobulin A and IgAN ............................................................. 26
Chapter 2. Attenuation of DON-induced IgAN by EPA in the mouse: dose response and
relation to IL-6 expression ...................................................................... 30
Abstract ....................................................................................... 31
Introduction .................................................................................. 33
Materials and Methods ...................................................................... 36
Results ................ . ....................................................................... 43
Discussion .................................................................................... 5 6

Chapter 3. Mechanisms for suppression of IL-6 expression in peritoneal macrophages

from DHArfed mice ............................................................ - ................ 61
AbstraCt ....................................................................................... 62
Introduction .................................................................................. 64
Materials and Methods ..................................................................... 66
Results ........................................................................................ 73
Discussion ................................................................................... 98

Chapter 4. Role of ER stress in deoxynivalenol-induced IL-6 expression in the peritoneal

macrophages ............................................................................... 105
Abstract ..................................................................................... 106
Introduction ................................................................................ 107

vi

Materials and Methods ................................................................... 109

Results ...................................................................................... 112

Discussion .................................................................................. 127
Chapter 5. Summary and perspectives .................................. I ........................ 132
Appendix A ......................................................................................... l 3 8
Appendix B ......................................................................................... 144
Appendix C ..................................................................... . ................... 148
Appendix D ......................................................................................... 151
Appendix E ........................................... - ........................ ' ...................... 156
References .......................................................................................... 159

vii

LIST OF TABLES

Table 2.1 Experimental groups for assessing the effects of EPA on

IgAN ............... 52

Table 2.2 Food consumption and body weight gain of mice ............................... 44

Table 2.3 Fatty acid composition of spleen phospholipids in mice fed EPA diets for 16
‘ wk ....................................................................................... 45

Table 2.4. Fatty acid composition of spleen phospholipids in mice fed control or EPA
diet for 4 wk .......................................................................... 51

Table AA.1 Experimental groups of mice for assessing the effects of a-linolenic acid on
DON-induced IgAN ......................................................... ' ...... 140

Table AA.2 Fatty acid composition of different diets for assessing the effects of a-
linolenic acid on DON-induced IgAN .......................................... 141

viii

Figure 1.1
Figure 1.2

Figure 1.3

Figure 1.4

Figure 2.1

Figure 2.2

Figure 2.3

Figure 2.4

Figure 2.5

Figure 2.6

Figure 2.7

Figure 3.1

Figure 3.2

Figure 3.3
Figure 3.4A

Figure 3.4B

LIST OF FIGURES

The structure of deoxynivalenol .................................................... 5
Biosynthesis and metabolism of fatty acids ..................................... 10
Schematic representations of XBPl transcripts splicing before and after ER
stress ..................................................................................... 23
The structure of human IgAl ...................................................... 27

EPA-enriched fish oil consumption suppresses DON-induced serum IgA
elevation in mice ..................................................................... 46

EPA-enriched fish oil consumption attenuates DON-induced serum IgA-1C
elevation in mice ..................................................................... 47

EPA-enriched fish oil consumption inhibits DON-induced mesangial IgA
deposition in mice ................................................................... 48

DON-induced ex vivo IgA secretion is suppressed in PP and spleen cell
cultures by EPA consumption ...................................................... 50

Induction of serum IL-6 by acute DON exposure is attenuated in EPA-fed
mice .................................................................................... 52

EPA-enriched fish oil consumption suppresses induction of IL—6 hnRNA
and mRNA after acute DON exposure in mouse spleen and PP .............. 53

EPA-enriched fish oil consumption suppresses DON-induced spleni'c
transcription factor binding activity ............................................... 55

Kinetics of DON-induced IL-6 mRNA expression in peritoneal
macrophages. . ............................................................................................. 74

Transcription factor CREB knockdown inhibits IL-6 mRNA expression
induced by DON ..................................................................... 75

Inhibition of CREB kinases suppresses DON-induced IL-6 expression... . .78
PKR inhibition blocks DON-induced IL-6 expression ..................... _. . .81

PKR inhibition blocks DON-induced protein phosphorylation ............... 82

Figure 3.5A DON-induced phosphorylation of CREB, Aktl, MSKl and RSKl is
suppressed in macrophages from DHA-fed mice ............................... 84

Figure 3.53 Plots of figure 3.5A ................................................................. 85

Figure 3.6 DON-induced Aktl activation is suppressed in macrophages from DHA-fed
mice .................................................................................... 86

Figure 3.7 Phosphorylation of PKR in the peritoneal macrophage is inhibited by DHA
consumption .......................................................................... 88

Figure 3.8A PP] and PP2A phosphatase activities are not increased in macrophages
from DHA-fed mice ................................................................. 89

Figure 3.8B Effects of calyculin A on protein phosphorylation ............................ 90
Figure 3.9A Fatty acids differentially affect DON-induced IL-6 mRNA expression....9l

Figure 3.9B Fatty acids do not affect protein phosphorylation in peritoneal
macrophages .......................................................................... 93

Figure 3.10 AA and DHA similarly decrease CREB kinase activities in the cell-free

system ................................................................................. 95
Figure 3.11 Effects of DHA consumption on signal transduction pathways mediating

DON-induced IL-6 expression in peritoneal macrophages ex vivo ......... 104
Figure 4.1 Kinetics of DON-induced BiP degradation ..................................... 113
Figure 4.2 DON treatment does not change BiP gene expression ........................ 115
Figure 4.3 DON-induced BiP degradation is eathepsin/calpain—dependent ............ 116
Figure 4.4 DON treatment upregulates IREIOL, XBPl and ATF6 ........................ 120
Figure 4.5 DON treatment induces splicing of XBPl mRNA ............................ 121

Figure 4.6 DON-induced IL-6 gene expression is related to ATF6 upregulation. . 122
Figure 4.7 BiP knockdown induces IL-6 gene expression ................... L ............ 124
Figure 4.8 Toxins induce BiP degradation .................................................. 126

Figure 4.9 Summary of DON-induced ER stress response and IL-6 gene expression in
peritoneal macrophages ........................................................... 131

Figure 5.1 Summary of pathways by which DON induces IL-6 gene expression and

IgAN and steps at which n—3 PUFAs suppress this process .................. 137
Figure AA.1 Effects of flaxseed oil consumption on DON-induced serum IgA elevation
in B6C3F1 mice .................................................................... 142
Figure AB.1 Effects of DHA on DON-induced PKC phosphorylation .................... 146
Figure AB.2 Effects of PKC inhibitor on DON-induced IL-6 gene expression .......... 147

Figure AC.1 Effects of IL-10 K0 and DHA consumption on DON-induced protein
phosphorylation in peritoneal macrophages .................................... 150

Figure AD.1 Effects of DON consumption on serum IgA and hypoglycosylated IgA...‘153

Figure AE.1 Effects of DHA on BiP degradation ............................................. 158

xi

ATF6
BiP
C/EBP
COX
CRE
CREB
DHA
DON
EPA
ER
GalNAc
IC
IgAN
IL-6
IL- 1 0

IREl

KEY TO ABBREVIATIONS

Arachidonic acid

a-linolenic acid

Activating protein-l

Activating transcription factor 6
Immunoglobulin binding protein
CCAAT/enhancer binding protein

Cyclooxygenase

CAMP response element

cAMP response element-binding protein
Docosahexaenoic acid

Deoxynivalenol

Eicosapentaenoic acid

Endoplasmic reticulum
N-acetylgalactosamine

Immune complexes

Immuno globulin A nephropathy

Interleukin-6

Interleukin-10

Inositol requiring enzyme 1

xii

LA

LOX

LT

MSKl

NeuAc

NF-KB

OA

PERK

PG

PKC

PKR

PPl

PP2A

PUFA

RSKl

TX

XBPl

Linoleic acid

Lipoxygenase

Leukotriene
Mitogen/ stress— activated protein kinase 1
N-acetylneuraminic acid

Nuclear factor-kappa B

Oleic acid

PKR-like endoplasmic reticulum kinase
Prostaglandin

Protein kinase C

Double-stranded RNA-activated protein kinase
Protein phosphatase 1

Protein phosphatase 2A

Polyunsaturated fatty acid

Ribosome S6 kinase 1

Thromboxane

Unfolded protein response

X-box binding protein 1

xiii

INTRODUCTION

Deoxynivalenol (DON) is a type B trichothecene mycotoxin produced by the
fungi Fusarium species. Dietary exposure to DON is common due to its frequent
detection in cereal-based food (Pestka and Smolinski 2005) (Rotter et al. 1996). In mice,
consumption of DON induces an IgA nephropathy (IgAN)-like disease (Pestka et al.
2004) (Pestka et al. 1989) (Dong et al. 1991). DON-induced murine IgAN provides us a
unique model to study the pathogenesis, prevention and treatment of this disease.

Overproduction of interleukin (IL)-6 is involved in the polyclonal B cell
activation and autoantibody production (Ishihara and Hirano 2002) (Nishimoto and
Kishimoto 2004) (Choy 2004). IL-6 can also promote mesangial cell proliferation and
extracellular matrix synthesis in the kidney. Furthermore, elevated circulating IL-6 has
been observed in patients with IgAN (Lim et al. 2003) (Harada et al. 2002). Accordingly,
IL-6 is considered a chief player in IgAN. In addition, IL-6 has been demonstrated to be
critical in the DON-induced IgAN in our mouse model (Yan et al. 1997) (Pestka and
Zhou 2000).

There is no consensus on how to best treat human IgAN due to the complexity of
this disease (Strippoli et al. 2003). Current treatments only alleviate its symptoms
(Barratt and Feehally 2006). However, epidemiological studies suggest that the risk of
IgAN is negatively correlated to n-3 polyunsaturated fatty acid (PUFA) tissue levels
(Wakai et al. 1999). Therefore n-3 PUFA consumption seems to be promising to treat this
disease. Although clinical trials have demonstrated beneficial effects of n-3 PUFA
consumption on IgAN (Donadi-o and Grande 2004), the mechanisms are still not

completely known.

In addition, previous study in out laboratory showed that DON treatment
decreased endoplasmic reticulum (ER) chaperone BiP (immunoglobulin binding protein)
in the EL-4 thymoma’ cell line (Yang et al. 2000). BiP is a key regulator of ER stress
response that has been related to inflammation and cytokine production (Hung et al. 2004)
(Zhang et al. 2006) (Iwakoshi et al. 2003b). Therefore, we proposed that DON-induced
ER stress-like response was also involved in the IL-6 gene expression.

The goal of this research was to: (I) confirm the effiacy of dietary n-3 PUFAS on
DON-induced mouse IgAN in a dose-response manner; (2) verify that n-3 PUFAs
suppressed IgAN by inhibiting the IL-6 gene expression; (the DON-induced activation of
transcription factor cAMP response element-binding protein (CREB) pathway in
peritoneal macrophages was studied) (3) relate DON-induced ER stress-like response to

the IL-6 gene expression.

CHAPTER 1

Literature Review

Deoxynivalenol. Deoxynivalenol, also known as DON, vomitoxin, 4-
deoxynivalenol or 12, 13-epoxy-3, 4, 15-trihydroxytrichothec-9-en-8-one (Figure 1.1), is
a type B trichothecene mycotoxin produced by the fungi Fusarium graminearum and E
culmorum. There have been concerns over this toxin because of its frequent detection in
cereal grains and potential for causing adverse effects in human beings and livestock
(Rotter et al. 1996).

DON was first isolated by Japanese workers in 1972 (Yoshizawa et al., 1973). The
production of DON is associated with ear rot in corn and scab in wheat and barley as a
result of low temperature and high humidity (Rotter et al. 1996). Economic losses due to
DON contamination are hundreds of millions of dollars in the United States annually
(Pestka and Smolinski 2005). In order to control food quality for human health, the US.
Food and‘Drug Administration has established an advisory level of 1 ppm of DON on
finished wheat products.

Although DON is not as toxic as other trichothecenes, such as T-2 toxin,
satratoxin and roridin, acute exposure to high doses of DON is lethal. Depending on
species and route of exposure, the LDSO of DON ranges from 27 to 140 mg/kg
bodyweight (Rotter et al. 1996). At lower doses, it has been found to affect the digestive,
reproductive and immune systems in animals (Pestka and Bondy 1990) (Pestka et al.
2004) (Pestka and Smolinski 2005). In regard to immune function modulation, DON
exposure impairs mitogen-activated lymphocyte proliferation (Tryphonas et a1. 1984)
(F orsell and Pestka 1985) and pathogen clearance (Pestka et al. 1987) (Tryphonas et al.
1986). DON consumption also promotes proinflammatory cytokine production (Zhou et

al. 2003a) and selectively upregulates immunoglobulin A (Pestka 2003).

 

Figure 1.1 The structure of deoxynivalenol (Clstooé, MW 296.32).

DON-induced IgA nephropathy-like disease. Mouse consumption of DON
induces a marked increase of serum IgA and IgA immune complexes, a shift of IgA
molecule from monomeric to polymeric form, hematuria and IgA accumulation in the
kidney mesangium, all of which mimic human IgA nephropathy (IgAN)(Pestka et al.
1989) (Dong et al. 1991). Consumption of DON has been found to increase the
percentage of IgA+ and CD4+ cells in Peyer’s patches and spleen (Pestka et al. 1990b).
Increased IgA production from Peyer’s patch and spleen cell cultures was also observed
in mice fed DON (Pestka et al. 1989) (Pestka et al. 1990a). These IgA molecules were
shown to be polyclonal and polyspecific to many different antigens such as casein, inulin
as well as autoantigens such as phosphorylcholine, sphingomyelin and cardiolipin
(Rasooly and Pestka 1994). The increased IgA production has been related to the
superinduction of several cytokines, esp.. interleukin-6 (Pestka and Zhou 2000) (Pestka
and Smolinski 2005) (Yan et a1. 1997). It has also been shown that macrophages play a
key role in the elevation of IgA production and IgAN pathogenesis in DON-exposed mice
(Yan et al. 1998).

IgA nephropathy. IgAN is the most common primary glomerulonephritis
worldwide. It is defined by the presence of predominant deposits of IgA within the
mesangial regions of glomeruli. Depending on different stages of this disease, the kidney
may have a wide variety of proliferative, inflammatory, and sclerosing lesions.
Histopathologic features include glomerular hypercellularity, the presence of interstitial
inflammatory infiltrates, excessive matrix deposition, and vascular sclerosis (Barratt et al.
2004) (Donadio and Grande 2004). Although the kidney is primarily affected, IgAN has

various clinical presentations. Current evidence indicates that IgAN is not a single

disease but rather a final common response to different causative and pathogenic
processes (Barratt and Feehally 2005).

The pathogenesis of IgAN remains unclear. Abnormalities in IgA production,
structure, and/or catabolism are suggested to facilitate renal deposition of immune
complexes containing IgA (Chintalacharuvu and Emancipator 1997). Many studies have
demonstrated that serum IgA levels are elevated in patients with IgAN (Barratt et al.
2007b). In addition, numerous molecular changes within IgA itself have been found in
IgAN patients. These changes include an altered glycosylation profile of IgA molecule
(Moldoveanu et al. 2007) (Yan et al. 2006) (Baharaki et al. 1996) (Suzuki et al. 2008),
increased anionic charge, 7» light chain usage and polymerization (Barratt et al. 2007b).

Due to the complexity of the characteristics of IgAN itself, many animal models
have been established via various means for studying this disease. ddY mice develop
IgAN spontaneously after the age of 40 wk (Imai et al. 1985); genetic knockout of B-l , 4-
galactosyltransferase ([346alT)-I or uteroglobin in mouse could upregulate IgA
production and induce mesangial IgA deposition and matrix expansion (Kobayashi et al.
2002) (Marquina et al. 2004) (Kim et al. 2001); inoculation with Sendai virus (Yamashita
et al. 2007) or Coxsackie B4 virus (Kawasaki et al. 2006) or injection of IgA immune
complexes (Rifai et al. 1979) (Chao et al. 2006), Haemophilus parainfluenzae antigens
(Yamamoto et al. 2002) staphylococcal enterotoxin B (Jia et al. 2007) or even ovalbumin
(Kurihara et al. 2005) could also generate symptoms mimic human IgAN.

fleatment of IgAN. IgAN accounts for up to 5 to 10% of glomerulopathies in
North America. Approximately 150,000 people in the US. have been diagnosed with

IgAN with 4000 new cases occurring each year (Hellegers 1993). IgAN is a progressive

disease and needs proper treatment. Natural reSolution of urinary abnormalities among
IgAN patients is less than 10% (Barratt and F eehally 2006). Between 20 to 40% of IgAN
patients develop renal failure with 1-2% of adult patients entering end-stage renal failure
each year (Donadio, Jr. et al. 1994) (Donadio, Jr. et al. 1999).

Currently, there is no consensus on how to best treat this disease (Strippoli et al.
2003). No treatment has been found to modify mesangial IgA deposition and those
available treatments are extrapolated from the management of symptoms of chronic
glomerulonephritis, such as proteinuria, hypertension and reduced glomerular filtration
rate (Barratt and Feehally 2006). Analysis of the effects of steroids (Lai et al. 1986)
(Pozzi et al. 1999) (Shoji et al. 2000) and cytotoxic agents (Walker et al. 1990) (Woo et
al. 1987) on IgAN have shown controversal results and their use is limited due to severe
side effects. Although angiotensin-eonverting enzyme inhibitor (ACEI) showed some
beneficial effects on hypertension in patients with IgAN, there is no controlled clinical
trial showing that blocking the renin-angiotensin system decreases the risk of progression
of IgAN (Pozzi et al. 2006).

It is important to note that epidemiological studies reveal a negative correlation
between n-3 polyunsaturated fatty acid (PUFA) tissue levels and IgAN (Wakai et al.
1999), whereas a positive correlation exists with n-6 PUFAS (Wakai et al. 2002). Clinical
trials have also demonstrated beneficial effects of n-3 PUFA consumption on IgAN by
inhibiting renal inflammation and mesangial proliferation. However the mechanisms are
still under investigation (Calder and Grimble 2002) (Donadio and Grande 2004).

n-3 polyunsaturated fatty acids. A fatty acid is a hydrocarbon chain with a

carboxyl group at one end and a methyl group at the other end. Naturally occurring fatty

acids have chains containing 2 to 30 (even number) of carbon atoms or more. Based on
the number (n) of double bonds in the carbon chain, fatty acids could be saturated (n=0),
monounsaturated (n=1) or polyunsaturated (n22). According to the position of the first
double bond from the methyl group, PUFA can be classified as n-6 or n-3. The simplest
member of n-6 or n-3 classes are linoleic acid (LA; 18:2) and a-linolenic acid (ALA;
18:3) respectively (Calder 2005) (Calder and Grimble 2002). LA and ALA are essential to
the human diet because neither of them is synthesized endogenously by humans, and the
n-3/n-6 families cannot be interconverted. Plant oils are the major food source of LA
(corn oil, cottonseed oil, sunflower oil, et al.) and ALA (flaxseed oil, canola oil, et al.)
(Lerman 2006). Docosahexaenoic acid (DHA; 22:6) and eicosapentaenoic acid (EPA;
20:5), two main components of fish oil, are synthesized from the n-3 precursor ALA,
whereas long chain n-6 PUFAS such as arachidonic acid (AA; 20:4) are synthesized from
the precursor LA. An outline of the pathways of biosynthesis and metabolism of
polyunsaturated fatty aids is shown in figure 1.2 (Young and Nicholls 2006).

It has long been observed that several diseases are influenced by the type and
amount of fat consumed (Yu et al. 1995). Observational and clinical evidence suggest
that n-3 PUFAS have beneficial effects on atherosclerosis (Anand et al. 2008) (Hansen
and Harris 2007), diabetes (Storlien et al. 1987) (Peyron-Caso et al. 2002), cancer (Cave,
Jr. 1991) (Xia et al. 2006), and other inflammatory diseases(Ruxton et al. 2004) (Grimm
et al. 2002). Therefore immunomodulating functions of n-3 PUFAs have gained
increasing attention.

Fatty acids are crucial components of cell membranes. The exact proportion of

fatty acids in human immune cells varies according to cell type and the lipid fraction

.mEou has.“ mo Sam—09808 EH £85585 .NA enema

Ema 298

+

mdwuvm

+

mamuvm

+

mamumm
HA N04

monom m f + +

A5832

5232 >\ +

motom m NOD mavuom

+

matuwfi

+

A<A<V mamuwfi

HA NH 98 GA
manna v motom N

XS/ \xoo

A5: 252

+

cannom

+

mqmnfl

+

A: Ed 22:
bao :35 bao :83
38333.2 < + umgamoCIQ 4
9: ”w m

+

3: 4.92 Are”: AI 92

10

examined. As precursors of many inflammatory mediators, n-6 PUFAS are more
prominent than n—3 PUFAS. The phospholipids of human mononuclear cells contain 6-
10% LA and 15-25% AA. n-3 PUFAS are low: ALA is rare; EPA and DHA comprise only
0.1 to 0.8% and 2 to 4% respectively (Calder and Grimble 2002). Although ALA can be
converted to EPA and DHA, humans still need an exogenous supply of these long chain
PUFAS. The reason exists in that biosynthetic pathways of both the n-3 and the n-6
families share the same enzyme called A-6-desaturase. A-6-desaturase is vital for the
conversion of LA to AA, and ALA to EPA and DHA. High levels of plasma LA due to
high n-6 PUFA intake shift its actions towards the n-6 pathway. Furthermore, the
conversion of ALA to DHA is inefficient (Ruxton et al. 2004). Lacking EPA and DHA in
the diet could make the body more susceptible to some diseases.

The important link between fatty acids and inflammation is a family of
inflammatory mediators termed eicosanoids. They are generated from. 20-carbon PUFAS
(AA and EPA). Both AA and EPA liberated from cell-membrane phospholipids by
phospholipase A2 can be metabolized to the eicosanoid family that include prostaglandins
(PG), Ieukotrienes (LT) and thromboxanes (TX). AA metabolized by cyclooxygenase-2
(COX-2) gives rise to the 2-series PG and TX, metabolized by 5-lipoxygenase (5-LOX)
gives rise to 4-series LT (Calder 2005). EPA also acts as a substrate for COX and LOX
enzymes, and gives rise to different eicosanoids: the 3-series PCs and TXs, and 5-series
of LTS (Calder and Grimble 2002). Eicosanoids are involved in modulating the intensity
and duration of inflammatory and immune response. Those eicosanoids produced from
AA are more potent than those derived from EPA (Ruxton et al. 2007). Increased

consumption of fish oil results in increased proportions of EPA and DHA in inflammatory

11

~_

cell phospholipids, and decreased arachidonic acid as compensation. Fish oil

supplementation has been shown to result in decreased production of PGE2 (Trebble et al.

2003b), TXBZ (Caughey et al. 1996), LTB4 (Sperling et al. 1993) and LTE4

(Grirnminger et al. 1997) because of decreased substrate level.

There are also eicosanoid-independent immune effects that play critical roles in n-
3 PUFA suppression of inflammation. n-3 PUFAS may directly (1) affect transcription
factor activity or abundance and thus modulate gene expression (Duplus and Forest 2002).
iNon—esterified fatty acids and their metabolites are able to bind transcription factors such
as peroxisome proliferator-activated receptors (PPARs) as ligands to activate them
(Kliewer et al. 1997) (Murakami et al. 1999) (Keller et al. 1993) (Yu et al. 1995). The
monounsaturated fatty acid Oleic acid and PUFAS have been demonstrated to decrease
transcription factor sterol regulatory element-binding protein (SREBP) in the liver and
consequently change expression of enzymes for lipogenesis (Worgall et al. 1998). (2)
interfere with signal transduction. Fatty acids can either bind to receptors, such as G-
protein-coupled receptors 40 (GPR40) (Itoh et a1. 2003), or change activities of signal
molecules such as JNK (Hirosumi et al. 2002), NF-IcB (Rolph et al. 2006), (3) change
lipid/lipid raft composition and membrane fluidity (Calder et al. 1990) (Clandinin et al.
1991) (Spector and Yorek 1985) (Chen et al. 2007) (Schley et al. 2007) thus alter the
function of membrane receptors and enzymes. Potent anti-inflammatory functions of E-
and D-series resolvins derived from EPA.and DHA respectively as well as protectins
derived from DHA have also been noticed (Serhan et al. 2008).

Through both eicosanoid-dependent and eicosanoid-independent mechanisms, n-3

12

PUFAS have been shown to inhibit proinflarnmatory gene expression. Fish oil feeding
decreased ex 'vivo production of TNF-ot, IL-lB and IL-6 by rodent macrophages and
splenocytes (Sears and Nevins 2002) (Patel and Mohan 2005) (Rathmell et al. 2003)
(Donadio and Grande 2004). In addition, supplementation of the diet for human
volunteers with fish oil has been shown to decrease production of TNF-a and IL-6 by
mononuclear cells (Bene and Faure 1988) (Taniguchi et al. 1996) (Moore et al. 2001).

Interleukin-6. IL-6 is an important proinflammatory cytokine that is produced by
various types of lymphoid and non-lymphoid cells, such as macrophages, monocytes, T
cells, B cells, fibroblasts, endothelial cells, adipocytes, mesangial cells, and several tumor
cells. IL-6 binds to its receptor to exert its functions. There are two components of IL-6
receptor (IL—6R), an 80-kDa IL-6 binding protein (a chain) and a 130-kDa signal
transducer known as gp130 ([3 chain). IL-6 binds to IL-6R0t which induces the
homodimerization of gpl30 and generates the high-affinity complex of IL-6/IL-
6R0t/gpl 30 that will induce downstream signal transduction(Naka et al. 2002).

IL-6 was originally identified as a B-cell differentiation factor, but now it is
known to be a multi-functional cytokine that regulates the immune response,
hematopoiesis and the acute phase response (Kishimoto 2006) (Song and Kellum 2005).
In regard to inflammation, IL-6 plays a critical role in the initiation of the reaction and
transformation from acute to chronic phase. Moreover, sustained IL-6 upregulation is
required to maintain chronic inflammation. Due to its function in eliciting T cell
activation, promoting end-stage B cell differentiation and immunoglobulin secretion,

dysregulation of IL-6 causes various clinical symptoms and abnormal laboratory findings

13

(Gabay 2006). Specifically, overproduction of IL-6 is involved in the polyclonal B cell
activation and autoantibody production (Ishihara and Hirano 2002) (Nishimoto and
Kishimoto 2004) (Choy 2004). It has been shown that circulating IL-6 levels are elevated
in several autoimmune . diseases, such as rheumatoid arthritis, systemic lupus
erythematosus, Crohn’s disease and psoriasis, and correlate with markers of disease
activity (Ishihara and Hirano 2002). Accordingly, IL-6 is considered a chief player in
autoimmune diseases. Therapies that target IL-6, such as specific antibody to IL-6
receptor has been shown to be beneficial (N ishimoto and Kishimoto 2004) (Choy 2004).

Elevated IL-6 also promotes proliferation of mesangial cells and synthesis of
extracellular matrix macromolecules in IgAN. Increased renal expression and urinary
excretion of interleukin-6 correlate with the degree of IgA deposition in the kidney, extent
of renal damage and disease progression in patients with IgAN (Lim et al. 2003) (Harada
et al. 2002) (Bene and Faure 1988) (Taniguchi et al. 1996).

In our IgAN mouse model, 'IL-6 has been demonstrated to be critical in the
upregulation of IgA. Anti-IL-6 antibody decreased IgA levels to background in DON-
exposed Peyer’s patch or spleen cell cultures (Yan et al. 1997). IL-6 knockout mice have
also been shown to be refractory to DON-induced IgAN (Pestka and Zhou 2000). These
data suggest that IL-6 is a requisite cytokine for DON-induced IgA production and
resultant IgA.

IL-6 gene transcription: Transcription factor and coactivator binding to their
recognition sequences on the IL-6 promoter and enhancer regions is important in IL-6
transcriptional regulation. In macrophages, IL-6 gene expression is induced by activation

of at least 4 transcription factorsi CAMP responsive element-binding protein (CREB),

l4

activating protein-1 (AP-l), nuclear factor-kappa B (NF -ch), and CCAAT/enhancer
binding protein (C/EBP) (Dendorfer 1996) (Matsusaka et al. 1993).

The CREB protein contains several functional domains. The C-tenninal basic
.domain facilitates DNA binding (conserved sequence: TGACGTCA) and the leucine
zipper domain facilitates dimerization with CREB or other members of the CREB family
such as cAMP response element modulator (CREM) and activating transcription factor 1
(ATF-l). Another important domain is the kinase inducible domain (KID) that contains
the critical serine-l33 amino acid residue (Pandey 2004). According to different stimuli,

this residue can be phosphorylated by Aktl (Shaywitz and Greenberg 1999), CAMP-

+
dependent protein kinase A (PKA) (Hagiwara et al. 1993), Ca2 /calmodulin- dependent

protein kinases II (CaMK II) (Dash et al. 1991), ribosomal S6 kinase 1 (RSKI) (Ginty et
al. 1994) and mitogen /stress-activated protein kinase 1 (MSKl) (Shaywitz and
Greenberg 1999). The phosphorylation status of CREB is also modulated via
dephosphorylation by activation of several serine/ threonine phosphatases including
protein phosphatase 1 (PPl) (Alberts et al. 1994) and protein phosphatase 2A (PP2A)
(Choe et a1. 2004). Phosphorylated CREB (p-CREB) could bind to CAMP-response
element (CRE) that is an eight-base-pair sequence, TGACGTCA, located within 100 base
pairs of the TATA box (Mayr and Montrniny 2001) and promote recruitment of
transcriptional coactivator CREB binding protein (CBP) and p300 for gene expression
(Shankar and Sakamoto 2004) (Johannessen et al. 2004).

NF-KB is composed of the Rel family of proteins including p65 (RelA), c-Rel,

RelB, p50, and p52. They form homo- or hetero-dimeric complexes. These proteins share

15

a 300 amino acid region, designated the Rel homology domain, which mediates
dimerization and DNA binding to KB elements in the enhancer regions of target genes
(Matt 2002). NF-KB is sequestered in the cytoplasm through associating with inhibitory
proteins, the IKBS. When cells are exposed to activation signals, the IKBS are
phosphorylated by the IKB kinase (IKK) complexes and undergo degradation by the
ubiquitin-proteasome system. Degradation of the IKBS exposed nuclear translocation
signal of NF-KB and results in moving of the free NF-KB into the nucleus (Karin and Ben
Neriah 2000) (Baldwin, Jr. 1996).

Both API and C/EBP contain a highly conserved, basic-leucine zipper domain at
the C-terminus that is involved in dimerization and DNA binding. AP1 are homodimers
or heterodimers composed of protein Jun (c-Jun, JunB, JunD), Fos (c-Fos, FosB, Fral,
Fra2), and activating transcription factor (ATF2, ATF3, B-ATF) (Wagner 2002). The
C/EBP family has at least six members isolated and characterized to date (C/EBPa -
C/EBPC) (Ramji and F oka 2002). Phosphorylation plays a key role in the modulation of
both AP] and C/EBP function.

Among the aforementioned transcription factors, we found previously that
consumption of n-3 PUFAS inhibited CREB, AP-l and NF-KB binding activity. CREB
exhibited marked inhibition in both electrophoretic mobility shift assay (EMSA) and
chromatin immunoprecipitation (CHIP) assay experiments (Jia et al. 2004b) (Jia et al.
2006) (Shi and Pestka 2006). How CREB is inhibited by n-3 PUFAS is still under
investigation. It has been shown that three possible CREB kinases, Aktl, MSKl, and

RSK], are activated by DON (Jia et al. 2006).

16

Akt, MSK and RSK: The protein kinases Aktl, MSKl and RSKl phosphorylate
CREB in the murine peritoneal macrophages upon DON treatment (J ia et al. 2006).

Akt/PKB has been extensively studied because alteration of Akt activity has been
associated with several human diseases, such as tumor (Creighton 2008) (Campbell et al.
2008), cardiovascular disease (Adya et al. 2008) (Bagli et a1. 2004) (Fernandez-Hemando
et al. 2007), neuronal degeneration (Greggio and Singleton 2007) (Burke 2007) ,diabetes
(Kobayashi et al. 2004) (Ono et al. 2001), and so on. Akt is a highly conserved protein
and the amino acid identity between mouse, rat and human is more than 95%. This
conservation makes them a feasible choice to study human Akt functions using murine
models (Hanada et al. 2004).

Three Akt isoforrns have been identified. Although encoded by distinct genes
localized on different chromosomes, these three isoforms have approximately 80% amino
acid identity and similar domain structures. All three Akt isofonns consist of a conserved
domain structure: an amino terminal pleckstrin homology (PH) domain which interacts
with membrane lipid products such as phosphatidyl inositol (3, 4, 5) triphosphate (PIP3)
produced by phosphatidyl inositol 3-kinase (PB-kinase) and a carboxyl-terminal
hydrophobic regulatory domain. The kinase domain of Akt has a high similarity with
other PKA, PKG, and PKC related kinases (AGC kinases) (Yang et al. 2004) (Song et al.
2005)

In mOuse tissues, the Aktl isoforrn is ubiquitously expressed, while Akt2 is
expressed predominantly in insulin targeted tissues, such as adipose tissues, liver and
skeletal muscle. Akt3 is highly expressed within the brain and testis (Hanada et al. 2004).

Of these isoforms, Aktl is most relevant to lymphocyte and immune function (Patel and

17

Mohan 2005). Aktl mutant mice were reported born smaller than their wild-type litter
mates and had increased spontaneous apoptosis in the thymus (Hanada et al. 2004). Mice

with high Aktl expression showed accumulation of peripheral lymphocytes, particularly

+ + \
CD4 and B220 cells, as well as resistance to Pas-mediated apoptosis in splenocytes.

Other features of systemic autoimmunity were also present, including lymphocyte
infiltration in various organs and increased IgA levels and deposition in tissues (Patel and
Mohan 2005). Due to different functions these Akt isoforms play, we will focus on Aktl

regulation.

The 90 kDa ribosomal S6 family of serine/threonine kinases (pgoRSK) mediates

cellular signaling downstream of the mitogen-activated protein kinase (MAPK) cascade.

The RSK family consists of four members, RSKI—4, that are encoded by distinct genes

and show 75-80% amino acid identity (Kohn et al. 2003) (Chung et al. 1991). p90RSK is

a unique serine-threonine kinase in that it contains two functional kinase domains which

include a N-terminal kinase domain that phosphorylates the substrates of pgoRSK and a

2‘

9O .
C-terminal kinase domain involved in the activation of p RSK itself (Frodm and

Gammeltoft 1999). As for signalling pathways, RSK is located downstream of the Raf-
MEK-ERK protein kinase cascade. ERK activates the C-terminal kinase of RSK, which

leads to activation of the N-terminal kinase by autophosphorylation. Thus, RSK .

represents a continuation of the ERK. pgoRSK has a broad range of substrates including

the transcription factors CREB, NF-KB and c-Fos (Chung et al. 1991).

18

MSK is an RSK-related kinase family and is about 40% structurally identical to
RSKl. MSK has two isoforms: MSKI and MSKZ. Both of them contain two protein
kinase domains in a single polypeptide typical of the RSK family. MSK is found to be the
substrate of ERK and p38 MAPKs. They are predominantly located in the nucleus and
phosphorylate transcription factors such as CREB, ATF-l and AP-l (Frodin and
Gammeltoft 1999) (De Cesare et al. 1998).

Protein phosphatases and protein dephosphorylation. The function of one-third
of all proteins in eukaryotic cells are controlled by phosphorylation of specific serine(Ser),
threonine(Thr), and/or tyrosine(Tyr) residues (Ceulemans and Bollen 2004). The status of
protein phosphorylation reflects the balance of the activities of protein kinases and
protein phosphatases. Mammalian cells have about 400 protein Ser/Thr kinases, and less
than 30 protein Ser/T hr phosphatases (Plowman et al. 1999). Based on different functions
and structures, protein Ser/T hr phosphatases are currently divided into the protein
phosphatase family P (PPP) and the protein phosphatase family M (PPM). Protein
phosphatase 1 (PPl), PP2A and PP2B (also known as calcineurin) are major Ser/T hr
protein phosphatases (Barford et al. 1998).

Both CREB and its kinases, Aktl, MSKl and RSKl, are regulated by
phosphorylation at Ser and/or Thr residues. Major phosphatases that dephosphorylate
those residues include PPl and PP2A (Alberts et al. 1994) (Wadzinski et al. 1993) (Choe
et al. 2004) (Li et al. 2003) (Resjo et al. 2002) (Garcia et al. 2003). PPl is one of the
most conserved eukaryotic proteins. This enzyme consists of multimeric structures
composed of a catalytic subunit complexed to a number of regulatory subunits. These

regulators include primary regulators such as inhibitor-2, NIPPI and Sd322 that have

19

PPl-binding sites and secondary regulators such as AKAP149, Nek2 and Bc12 that lack

PPl-binding sites (Ceulemans and Bollen 2004). The core structure of PP2A consists of a

36 kDa catalytic subunit (PPZAC) and a 65 kDa regulatory subunit (PP2Aa) as a

scaffolding component. A third regulatory B subunit can associate with this core enzyme
and direct the enzyme to various intracellular locations and also provides substrate
specificity (Janssens et al. 2005) (Van Hoof and Goris 2003) (Yu et al. 2004). PP] and
PP2A have overlapping substrate specificities (Oliver and Shenolikar 1998).

BiP and ER stress. The endoplasmic reticulum (ER) is a cytoplasmic
compartment within cells where membrane and secretory proteins are synthesized and
modified. The ER provides an environment for the folding of these proteins to be
transported to the cell surface, lysosomes and Golgi apparatus. Due to the presence of
high concentrations of proteins, protein chaperones exist in the ER to bind newly-
synthesized proteins and prevent folding intermediates from aggregation (F aitova et al.
2006)

In the presence of a range of cytotoxic conditions, such as calcium depletion from
the ER lumen, RNA virus infection, glucose depletion and protein overexpression, the
accumulation of nascent, unfolded or misfolded polypeptides in the ER leads to ER stress.
In response to the excessive protein loading, the cells start the process called ER stress
response or the unfolded protein response (UPR) to [overcome the situation. UPR includes
transient attenuation of protein translation, ER-associated degradation (ERAD) of
malfolded proteins and the induction of molecular chaperones and folding enzymes to

augment the ER capacity of protein folding and degradation. If the stress cannot be

20

relieved, apoptotic pathways will be activated (Ma and Hendershot 2001).

BiP (Immunoglobulin binding protein, also known as glucose-regulated protein
78/GRP 78) is the best characterized ER chaperone. It belongs to the heat shock protein
70 family. This protein consists of an N—terminal ATPase and a C-terminal substrate-
binding domain. By recognizing and binding to a hydrophobic domain of unfolded
proteins, BiP stabilizes unfolded protein for further modification. BiP also serves as a
master regulator of the ER stress response and plays a key role in activating ER stress
sensors (Zhang and Kaufman 2006). In both yeast and mammalian cells, overexpression
of BIP down-regulates the UPR, while reduction of BiP is sufficient to induce the UPR
(Kaufman 1999).

There are three major UPR pathways transduced by ER transmembrane sensors
including activating transcription factor 6 (ATF6), the inositol requiring kinase 1 (IREl)
and the double-stranded RNA-activated protein kinase (PKR)-like endoplasmic reticulum
kinase (PERK). BiP interacts directly with all the ER stress sensors and maintains them in
the inactive forms. Accumulated misfolded proteins titrate BiP away and release those
sensors. Free ATF6, IRE] and PERK are activated and transduce signals cross the ER
membrane to the cytosol and nucleus (Ni and Lee 2007) (Schroder and Kaufman 2005).
However, in certain cells, different stresses or physiologic conditions can selectively
activate only one or two of the ER stress sensors. It is still not clear how a general BiP
repression mechanism activates individual components of the UPR (Zhang and Kaufman
2006)

In mammalian cells, ATP 6 is a 90 kDa constitutively expressed protein. It is a

transmembrane glycoprotein embedded in the ER membrane with the N-terminal

21

fragment facing the cytoplasm. After dissociating from BiP, the full-length ATP 6
translocates to the Golgi complex and gets cleaved by a serine protease, site-1 protease
(SIP) and a metalloprotease, site-2 protease (S2P) to yield a cytosolic soluble ATF6 (50
kDa). The p50ATF6 translocates into the nucleus, binds to the ATP/CAMP response
element and to the ER stress response element and acts as a transcription factor (Yoshida
et al. 1998) (Haze et al. 1999).

IRE] in yeast encodes a lllS-amino-acid polypeptide which has an amino-
terrninal domain localized to the ER lumen, a short transmembrane domain spanning the
ER membrane and a carboxy-terminal domain. IRE] in mammals has two homologs
named IREla (110 kDa), which is expressed ubiquitously and IRE] B, which is expressed
predominantly in the gut epithelium (Ma and Hendershot 2001). The carboxyl terminus
has homology to the ribonuclease domain of RNaseL and thus has endoribonuclease
activity upon activation by autophosphorylation (Kaufman 1999). The mRNA of X-box
binding protein (XBPI) is cleaved by IRE] and a 26-nucleotide intron is removed. The
spliced mRNA has a translational frame-shift and generates a bigger translational product
(from 33 kDa to 54 kDa) (Calfon et al. 2002). (Figure 1.3) The translational product of
the spliced XBP] has increased transcriptional activity. XBP] is a transcription factor of
the ATP/CREB family (Shen et al. 2001).

PERK is an eIF20t kinase localized in the ER with an intralumenal “stress sensor”
domain that shares some homology with the IRE] intralumenal domain and a cytosolic

eukaryotic translation initiation factor 2 0L (eIF20L) kinase domain. Activated PERK

undergoes homodimerization and phosphorylates eIF20t (Kaufman 1999).When eIF20t is

22

.mmobm mm “can. 98 Home: wag—mm 3.3858. me mo noufiaomfimou uranium .m._ 0.53m

Nam—0+ EmO

 

 

 

 

New mt» Fmv

mmmbm mm

NHEO

. EEO

.
.
.
.
.
u

b—----

 

L-—---

 

Nmm man wow

23

phosphorylated, the. formation of the ternary translation initiation complex

eIF2/GTP/Met-tRNAiMCt is prevented, leading to attenuation of the global translation. At

the same time, phosphorylated eIF20t selectively stimulates translation of a specific ‘
subset of mRNAs by allowing translation of the open reading frame (ORF) in response to
stress (Zhang and Kaufman 2006).

Classical UPR maintains ER homeostasis by enhancing transcription of resident
ER proteins, such as BiP, protein disulfide isomerase (PDI), calreticulin and CHOP, etc,
whiCh facilitate protein maturation, secretion and degradation (Kaufman 1999) (Zhang
and Kaufman 2006). UPR is critical in differentiation and function of specialized cells.
During immune response, activated XBPl (Reimold et al. 2001) and ATF6 (Gass et al.
2002) (Gunn et al. 2004) are required for plasma cell differentiation and secretion of high
levels of immunoglobulins. XBPl is also involved in the induction of IL-6 gene
expression (Iwakoshi et al. 2003a) (Iwakoshi et al. 2003b).

Protein degradation. Eukaryotic cells have two major avenues for protein
degradation, the ubiquitin-proteasome and autophagy-lysosomal pathways (Cecarini et al.
2007) (Yorimitsu and Klionsky 2005).

Protein ubiquitination and proteasome-mediated protein degradation is an
1 important pathway responsible for misfolded and short-lived intracellular proteins
(Guerrero et al. 2006) (Rubinsztein 2006). The 268 proteasome is a 2.5 MDa complex
composed of two multisubunit subcomplexes: one is a 20S core particle and the other a
19S regulatory particle. (Demartino and Gillette 2007) The 20S core particle is a

cylinder-shaped structure composed of four stacked rings, each containing seven subunits

24

(a7B7B7a7). The two outer rings have seven different a-subunits that regulate the opening

of the proteasome to proteins. The core particle possesses three proteolytic activities:
chymotrypsin-like (subunit [35), trypsin-like (subunit [32) and peptidylglutamyl peptide-
hydrolyzing activities (subunit [3]). The regulatory particle is composed of 20 different
subunits, which is able to bind to the external rings to form the 26S proteasome and
therefore regulate proteolytic activity. Degradation of proteins by the proteasome requires
covalent attachment of ubiquitins to the substrates for recognition by the proteolytic
complex. Other enzymes are able to remove ubiquitins from proteins to be degraded and
allow them to be recycled (Cuervo and Dice 1998).

Another process named autophagy is also an important mechanism for the
degradation of cytoplasmic components, from single macromolecules (proteins, lipids
and nucleic acids) to whole organelles. Autophagy is the process conserved from yeast to
mammalian cells for degradation by lysosomes. There are two main steps in this process
including delivery of the substrates to the lysosomal lumen and breakdown of these
substrates by resident enzymes. Depending on how the substrates are delivered for
degradation, autophagy is classified as either macro-, micro- or chaperone-mediated
autophagy (CMA). Both macro- and microautophagy sequester a region of the cytosol for
non-selective complete degradation, while CMA only selectiVely degrades cytosolic
proteins that are targeted and translocated to lysosbmes by lysosomal receptor binding
and chaperone unfolding (Massey et al. 2004; Yorimitsu and Klionsky 2005). Once inside
the lysosomal system, substrates are degraded by different acidic hydrolases for protein

turnover (Grinyer et al. 2007) (Cecarini et al. 2007). Lysosomes contain a powerful

25

mixture of more than 80 types of proteases, peptidases and other hydrolases and all the

proteases inside lysosomes are called cathepsins (Cuervo and Dice 1998).

. . 2+ . .
Calparns are a family of Ca -regulated cysteine proteases that mediate cleavage

of specific substrates involved in cell differentiation, life and death (Demarchi and

2+ . . .
Schneider 2007). Depending on the Ca concentration necessary for their activation,

calpains are classified into two isozymes, u- and m-calpains. The proteins cleaved by
calpains include cytoskeletal and associated proteins, kinases and phosphatases,
membrane receptors and transporters, etc. Activated calpains can also compromise the
integrity of lysosomal membranes and liberate cathepsins from lysosomes (Yamashima
2004)

Immunoglobulin A and IgAN. IgA is the most abundantly produced
immunoglobulin and its production occurs in both mucosa] and systemic compartments.
Based on structural difference, human IgA is classified into two different isotypes, IgA]
and IgA2, IgAl,but not IgA2, possesses a hinge region which is composed Of 13 amino
acids (Figure 1. 4). The majority of IgA molecules produced in the mucosa] compartment
are polymeric (mostly dimeric) IgAl or IgA2. The main function of secretory IgA is to
bind and neutralize potential mucosa] pathogens and toxins and prevent them from
entering into the human body. Systemic IgA is produced in the bone marrow and is the
source of circulating IgA. Circulating IgA molecules are mostly monomeric with the
ratio of IgA] to IgA2 9:]. They are cleared from the circulation by the hepatocytes and
leucocytes and their function is still not understood (Barratt et al. 2007b) (Y00 and

Morrison 2005).

26

388 .3 e ease .23 883 he 0:53... £9 .3 2&5

 

:3.

.0“—

no“.

27

The IgA molecule is heavily glycosylated by both N-linked and O-linked
glycosylation. The N-linked carbohydrates are linked to asparagine and are the most
common form. The O-linked carbohydrates are linked to serine or threonine in the hinge
region (Barratt et al. 2007a). The glycosylation of IgA molecules is isotype specific:
IgA] has both O-linked glycosylation in the hinge region and N-linked glycosylation in
the FC region, while IgA2 has only N-linked glycosylation due to absence of the hinge
region (Y00 and Morrison 2005) (Baenziger and Komfeld 1974a) (Baenziger and
Komfeld 1974b). Each human IgAl heavy chain hinge region has 3 to 5 O-linked
glycans which include a core GalNAc linked to serine and/or threonine residues in the
hinge region and extended with galactose. This structure is covered by sialic acid N-
acetylneuraminic acid (NeuAc) linked to GalNAc or galactose (Suzuki et al. 2008).

IgAN is a disease characterized by mesangial deposition of polymeric IgAl that
has reduced galactosylation in its 0-linked glycans. These IgA molecules have reduced
galactose and/or sialic acid content with increased exposure of the N-acetylgalactosamine
(GalNAc). The structurally abnormal IgA tends to bind a wide variety of molecules
(antigens) by carbohydrate interactions, or form lgG-IgA, IgA-IgA immune complexes.
The hypoglycosylated IgA and its immune complexes are more likely to deposit in the
kidney mesangial area and cause IgAN (Coppo and Amore 2004). The exposed GalNAc
can be detected by binding of GalNAc-specific lectins and other more complicated
methods such as “fluorophore-assisted carbohydrate electrophoresis” (FACE) (Allen et' al.

1999) and “matrix-assisted laser desorption ionization time of flight mass spectrometry”
(MALDI-TOFMS) (Hiki et al. 200]) (Coppo and Amore 2004).

There are some concerns about using animal models to study the pathogenesis of

28

human IgAN because of the structural difference between human IgA and mouse IgA: (1)
human IgA has two isotypes, while mouse IgA has only one isotype; (2) comparison of
the sequence of IgA between human and mouse suggests that mouse IgA gene may be
more similar to human IgA2 than IgA]; (3) human IgAl is glycosylated by both O-linked
and N-linked glycans, mouse IgA does not have O-glycosylation sites in its hinge region.
Despite these differences, mouse IgA and human IgAl share some characteristics: (1)
mouse IgA has a hinge region (Phillips-Quagliata 2002); (2) it also has two N-
glycosylation sites in its CH1 and CH3 regions (Nishie et al. 2007b). Although many
studies on human IgAN have focused on O-linked glycosylation of IgA], aberrant N-
linked glycosylation has also been reported (Amore et al. 2001) (Barratt et al. 2007b). '
These: studies suggest that hypoglycosylation on either O-glycans or N-glycans might be
involved in the pathogenesis of IgAN and mouse models can be used to study IgAN

despite difference between species (Allen et al. 1995).

29

CHAPTER 2

Attenuation of DON-induced IgA nephropathy by eicosapentaenoic acid in the

mouse: dose response and relation to IL-6 expression

30

ABSTRACT

Clinical trials have revealed that progression of IgAN is inhibited by dietary n-3
PUFA supplementation. The early stages of IgAN can be mimicked by feeding mice the
mycotoxin DON. Here, the effects of consuming the n-3 PUFA eicosapentaenoic acid
(EPA) on DON-induced IgAN were assessed relative to dose dependency and to
expression of IL-6. In the dose-response study, Weight gain and feed intake did not differ
among mice consuming 20 ppm DON supplemented with 0%, 0.1%, 0.5% and 3% EPA
for 16 weeks. Mice fed the two highest EPA concentrations exhibited markedly increased
splenic EPA, docosapentaenoic acid and docosahexaenoic acid, whereas arachidonic acid
Was decreased in all three EPA fed groups. Deoxynivalenol consumption significantly
increased serum IgA and IgA immune complexes as well as kidney mesangial IgA
deposition. All three IgAN markers were attenuated in mice fed 3% EPA diet but not in
those fed 0.1% or 0.5% EPA. Elevated IgA production was observed in spleen and
Peyer’s patch (PP) cell cultures derived from mice fed DON in control diets, but this was
reduced in cultures from mice fed 0.1%, 0.5% and 3% EPA. Acute DON exposure
increased serum levels of IL-6, a cytokine that drives differentiation of IgA-committed B
cells to IgA secretion. Relatedly, expression of IL-6 mRNA and IL-6 heteronuclear RNA,
a marker of IL-6 transcription, was increased in spleen and PP. All three indicators of IL-
6 expression were suppressed in mice consuming 3% EPA. Suppressed IL-6
corresponded to decreased binding activity of two factors that regulate transcription of
this cytokine, cyclic AMP response element-binding protein (CREB) and activating
protein (AP)-l. The results indicate that a threshold existed for EPA relative to

suppression of experimental IgAN and that the threshold dose was effective at inhibiting

31

IL-6 transcription.

32

INTRODUCTION

Immunoglobulin A nephropathy (IgAN), the most common human
glomerulonephritis, is defined by predominant deposits of IgA within the mesangial
regions of the kidney glomerulus (Feehally 1997). Immunoglobulin A nephropathy
accounts for 5% to 10%, 20% to 35% and up to 50% of glomerulonephropathies in North
America, Europe and Japan, respectively (Hunley and Kon 1999) (Emancipator and
Lamm 1989). Approximately 150, 000 people in the United States have been diagnosed
with IgAN with 4000 new cases occurring each year (Hellegers et al., 1993). Between
20% and 40% of these patients will develop progressive renal failure with 1% to 2% of
adult patients entering end-stage renal failure yearly (Donadio, Jr. et a1. 1999). The
fundamental abnormality in IgAN lies within the IgA system and not the kidney because
IgA deposition in IgAN patients recurs after renal transplantation (Harper et al. 1996). An
Overly robust IgA response to mucosa] infections and dietary antigens in terms of quantity,
Size (primarily polymeric), glycosylation status and IgA immune complex (IgA-1C)
formation is suspected to contribute to IgAN (Emancipator and Lamm 1989) (Montinaro
et al. 1999). Resultant lgA-IC deposition in glomeruli likely triggers mesangial cell
proliferation, matrix secretion and inflammation in which proinflammatory cytokines
play important roles. Although no consistent infectious or environmental agent has been
identified to cause dysregulation of the IgA antibody response, the onset of IgA
nephropathy is often associated with upper respiratory tract infection (Emancipator and
Lamm 1989). Therapeutic strategies for IgAN remain elusive, partly because of its poorly

defined etiology.

33

Dietary supplementation with n-3 PUFAS found in fish oil, particularly (22:6n-3)
docosahexaenoic acid (DHA) and (20:5n-3) eicosapentaenoic acid (EPA), has potential
human health benefits relative to inflammatory diseases (Calder 2003) (Gil 2002). n-3
PUFAS suppress inflammatory responses through eicosanoid-dependent or eicosanoid-
independent mechanisms (Calder 2006b). Case-control studies reveal that dietary n-3
PUFAS are negatively associated with the risk of IgAN (Wakai et al. 1999), whereas high
intake of n—6 PUFAS is positively associated with increased risk (Wakai et al. 2002).
Holman et al. (Holman et al. 1994) demonstrated that some IgAN patients are deficient in
a-linolenic acid (18:3n-3), a precursor of DHA and EPA, and that supplementation with
EPA and DHA suppresses arachidonic acid (AA) synthesis, decreases proteinuria and
improves glomerular filtration rate in this group. Several elegant clinical trials by
Donadio and Grande (Donadio and Grande 2004) have now demonstrated that n-3 PUFA
retards late-stage renal disease progression in IgAN patients by reducing inflammation
and glomerulosclerosis.

The trichothecene mycotoxin deoxynivalenol (DON) is a secondary metabolite
produced by members of the fungus Fusarium and is frequently found in dietary staples
such as wheat, barley, corn, rice and oats (Pestka and Smolinski 2005). It is recalcitrant to
inactivation during milling and processing, and frequently enters finished food products.
Prolonged feeding of DON causes a dramatic elevation in total serum IgA in mice with
IgA becoming the major serum isotype (Pestka et al. 1989). This co-occurs with marked
elevation of serum. IgA-1C, kidney mesangial IgA accumulation, electron dense
mesangial deposits and hematuria (Dong and Pestka 1993) (Dong et al. 1991) which are

hallmarks of the early stages of human IgAN (Pestka 2003). IL-6 is critical to mucosa]

34

IgA immunity based both on its differentiative effects on IgA-committed B cells and its
production in the gut by macrophages, T cells and other cells (Beagley et al. 1989).
Deoxynivalenol up-regulates IL-6 expression in vivo and in vitro, and this has been
linked to increased IgA production. (Yan et al. 1998) (Yan et al. 1997) Interleukin-6-
deficient mice are refractory to DON-induced dysregulation of IgA production and
development of IgAN (Pestka and Zhou 2000). Thus, IL-6 is pivotal to DON-induced
IgAN.

Fish oil as well as the (n-3) PUFAS DHA and EPA suppress DON-induced IgAN
(Pestka et al. 2002) (Jia et al. 2004a) (Jia et al. 2004b). This preclinical model enables
exploration of how n-3 PUFAS attenuate aberrant IgA responses associated with IgAN
and as well as gain insight into therapeutic strategies for this disease. Key issues
concerning use of fish oil for treating IgAN and other inflammatory diseases relate to the
most efficacious types of n-3 PUFAS, optima] doses required to achieve ameliorative
effects and underlying molecular mechanisms. In particular, clarification is needed on
reported differential effects of DHA or EPA relative to biological efficacy and disease
prevention (Seo et al. 2005) (Yusufi et al. 2003) (Obajimi et al. 2005) (Egashira et al.
2004) (Woodman et al. 2003) (Leigh-Firbank et al. 2002). Previously, our laboratory
established that dietary DHA concentrations between 1% and 3% were necessary to
ameliorate DON-induced IgAN (Jia et al. 2004a) (Jia et al. 2004b). The goals of this
research were to (1) evaluate dose-response effects of EPA-enriched oils on DON-
induced IgAN and (2) determine effects of the optimal EPA dose on IL-6 mRNA

expression and transcription factor binding activities.

35

MATERIALS AND METHODS

Materials. All chemicals were reagent grade or better and were purchased from
Sigma (St. Louis, MO) unless otherwise noted. DON was produced in Fusarium
graminearum R6576 cultures and" purified chromatographically (Clifford et al. 2003).
DON was added to powdered diets as detailed previously (Pestka et al. 1989). DON-
contaminated labware was detoxified by soaking for >1‘ h in 10% (v/v) sodium
hypochlorite (Thompson and Wannemacher, Jr. 1986).

Animals. Female B6C7F 1 mice (7 weeks, 17—22 g) were obtained fi'om Charles
River Laboratories (Portage, NH). Housing, handling and sample collection procedures
conformed to the policies and recommendations of the Michigan State University
Laboratory Animal Research Committee and were in accordance with guidelines
established by the National Institutes for Health. Mice were housed three per cage in a
humidity (45—55%)- and temperature (23—25°C)-controlled university animal care facility
room with a 12-h light and dark cycle. Mice were acclimated for 1 week prior to
experiment initiation.

Experimental design. For the dose-response study, experimental diets were based
on the AlN-93G formulation of Reeves et al. (Reeveset al. 1993) and consisted of the
following ingredients (per kilogram): 10 g of AIN-93G mineral mix, 10 g of AIN-93
vitamin mix, 200 g of casein, 397.5 g of cornstarch, 132 g of Dyetrose (dextrinized
cornstarch), 50 g of cellulose, 3 g of l-cysteine, 2.5 g of choline bitartrate, 14 mg of
TBHQ and 100 g of sucrose (Dyets, Bethlehem, PA). Corn oil (Dyets), high oleic acid
safflower oil containing 75% oleic acid (l-Iain Pure Foods, Melville, NY) and MEG-3

EPA-Rich Oi] containing 49.9% EPA, 6.7% DHA and 1.2% docosapentaenoic acid (DPA)

36

(Ocean Nutrition Canada, Dartmouth, Nova Scotia) were used to amend the basal AIN-
93G diet to yield five experimental groups (n=9): control, control+DON, 0.1%
EPA+DON, 0.5% EPA+DON and 3% EPA+DON (Table 2.1). This range of doses was
selected to be equivalent, respectively, to 0.2><, IX and 5X the maximum recommended
level of n-3 PUFA consumption by FDA. A DON concentration of 20 mg/kg was
selected based on its previously observed efficacy in inducing IgAN in B6C3F1 mice
(Pestka 2003).

Diets were prepared every 2 weeks, stored in aliquots at -20°C and fed to mice
fresh daily. Blood was collected from the saphenous vein with Microvettes
(Aktiengesellschaft and Co., Germany) at 4-week intervals for serum IgA-1C
measurement. After 16 weeks, mice were euthanized and spleens and Peyer's patches
(PPS) aseptically removed. One half of the spleens and the entire PP pool were used for
cell culture. The remaining half of the spleen was used for fatty acid analysis. Kidneys
were removed and frozen at -80°C for measurement of IgA deposition.

For IL-6 expression studies, B6C3F1 mice were fed control or 3% EPA diet (n=9)
for 4 weeks. Prior to experiment termination, mice were gavaged with 25 mg/kg DON or
vehicle. After 3 h, mice were euthanized and one half of the spleen and pooled PP were
subjected to real-time PCR analysis. The remaining spleen portion was frozen at -80°C
for fatty acid analysis. The same approach was used for transcription factor studies except
that tissues were harvested after 30 min based on an optimal time point for DON
induction reported previously (Zhou et al. 2005b). Nuclear proteins from spleen cell
suspensions were extracted and analyzed by electrophoretic mobility shift asS‘ay (EMSA)

for transcription factor binding activity.

37

owe—h on we adorabaooaoo :0 Raw 26: 8 Bow 220 SE» @8953 203 $06 5:

{mm ©0268-ZOQ no <mm mo owamov Beanbag mo muooto 05 mfimmommm do.“ coma mo 359% Ecofitomxm A .N 353.

.35 see es... Em £39. a: me 3:. .5m é eeeefie a see me am eeeeaeeeeee 3 were...

 

 

 

SE 3 3m QR S o S om ZOQ+§m§.m
:2 me an ow S em S cm zon+§m$no
e3. 3 2 3 N mm S cm zoa+§m§ .o
:8 3 S o o 8 S cm zen—+3580
3e 3 3 o o 8 2 c 6280

Ce?
9% 33 9:3 see 3:3 see some some
one see new ‘ 3 «mm La 35:8 BE 93 $35 anew
mesa 6.3 35 -8 ash Bee .5m 28 220 me .50 zoo Eaeaeeexm

 

38

Fatty acid analysis. Fatty acids were analyzed by gas chromatography (GC)
utilizing a GC-2010 Gas Chromatograph (Shimadzu Scientific Instruments, Chicago, IL)
and standard fatty acid methyl ester (Nu-Check Prep, Elysian, MN) by the protocol of
Hasler et al (Hasler et al. 1991). -

Cell cultures. Spleens and PP were teased apart in harvest buffer consisting of
0.01 M phosphate-buffered saline (PBS, pH 7.4) containing 2% heat-inactivated fetal
bovine serum (FBS; Gibco, Grand Island, NY), 100 U/ml penicillin and 100 ug/ml
streptomycin (Sigma), passed through a sterile IOO-mesh stainless steel screen and
resuspended in the same buffer. Cells were centrifuged and erythrocytes lysed for 3 min
at 25°C in 20 mM Tris (pH 7.65) containing 0.14 M ammonium chloride. Cells were
centrifuged at 400><g for 10 min, resuspended in RPMI-1640 medium supplemented with
10% (v/v) FBS, 100 U/ml penicillin and 100 ug/ml streptomycin (Sigma), and counted

using a hemacytometer. Cells (1X105) from individual mice were cultured in flat-

bottomed 24-well tissue culture plates at 37°C under a 6% C02 in a humidified incubator.

Supernatants were collected after 5 days and analyzed by ELISA to determine IgA
secretion.

IgA and IgA-1C measurement. Serum IgA was measured by ELISA (Dong and
Pestka 1993) using mouse reference immunoglobulin serum (Bethyl Laboratories,
Montgomery, TX), goat antimouse IgA and peroxidase-conjugated goat antimouse IgA
(heavy chain specific) (Organon Teknika, West Chester, PA). Immunoglobulin A was
quantified by measuring enzyme end product absorbance using a Vmax Kinetic

Microplate Reader and Softrnax program from Molecular Devices (Menlo Park, CA). For

39

the detection of IgA-1C, diluted serum samples were first precipitated by 70% (w/v)
polyethylene glycol (PEG 6000, Sigma) (Dong et al. 199]) and quantified by IgA ELISA
(Dong and Pestka 1993).

Assessment of kidney mesangial IgA deposition. Kidney sections were prepared
and analyzed for IgA deposition according to Pestka et al.. (Pestka et al. 1989) Briefly,
removed kidneys were frozen in liquid nitrogen, sectioned to 7 mm with a cryoStat
(Reichert-Jung; Cambridge Instruments, Buffalo, NY) and stained with fluorescein
isothiocyanate-labeled goat antimouse IgA (Sigma). Immunoglobulin , A
immunofluorescence was assessed with a Nikon Labophot Microscope (Mager Scientific,
Dexter, MI) equipped with a Kodak DC290 digital camera (Kodak, Rochester, NY).
Mean fluorescence intensity of 10 consecutively arranged glomeruli from each section
was determined using UTHSCSA Image Tool Software V 1.2. (Jia et al. 2004b) Pixels
were measured on a grayness scale ranging from 0 (black) to 255 (white).

Interleukin-6 mRNA and heteronuclear RNA analysis. Total RNA from spleens
and PPS was isolated using the Trizol (Sigma) according to the manufacturer's protocol.
Resultant RNA was dissolved in 50 ul of RNAse-free water and stored at -80°C until
analysis. Probe and primers for mouse lL-6 mRNA and 18S RNA (endogenous control)
were purchased as TaqMan assay reagents (PE Applied Biosystems). PCR reactions for
IL-6 mRNA and 18S RNA quantification were performed on an ABI PRISM 7700
Sequence Detector System using a TaqMan One-Step RT-PCR Master Mix Reagents Kit
according to the manufacturer's protocol (PE Applied Biosystems) (Jia et al. 2004b).
SYBER Green PCR Master Mix ‘(PE Applied Biosystems) was used to detect IL-6

heteronuclear RNA (hnRNA) using primers (forward: gtccaactgtgctatcgctcact; backward:

4o

agaaggcaactggatggaagtct). Ct values were related to RNA concentrations using the
standard curves derived from serial dilutions of total RNA (ranging 1.37—1000 ng per
well) and normalized by dividing the IL-6 RNA value by the 188 RNA value. A

Electrophoretic mobility shift assay. Spleen cells were dissociated, passed
through a 100-mesh stainless steel screen and pooled. Cells were suspended in
Dulbecco's PBS. Erythrocytes were lysed for 2 min at 25°C in 10 mM KHC03 containing
0.14 M NH4Cl. Nuclear extracts were prepared based on the method of Zhou et al (Zhou
et al. 2003a). Briefly, cells were lysed in hypotonic buffer (10 mM HEPES, pH 7.9, 1.5
mM MgC12, 10 mM KC], 0.] mM EDTA, 0.1 mM EGTA and 1 mM dithiothreitol) with
phosphatase inhibitors (1 mM sodium orthovanadate and 10 mM sodium fluoride),
Complete Mini protease inhibitor cocktail (Roche, Mannheim, Germahy) and 0.7% (v/v)
Nonidef P-40. Nuclei were pelleted by centrifugation and suspended in hypertonic buffer
containing 20 mM HEPES, pH 7.9, 0.4 M KC1, 0.5 mM EDTA, 0.5 mM EGTA, 1 mM
dithiothreitol, 10% (w/v) glycerol and phosphatase and protease inhibitors. After 30 min
on the ice, a supernatant was collected by centrifugation at 14,000Xg for 10 min.
Resultant extracts were analyzed with a Bio-Rad Protein Assay kit (Melville, NY),
aliquoted and stored at -80°C for EMSA.

Double-stranded consensus probes for cyclic AMP response element-binding

protein (CREB), activator protein-1 (AP-1), nuclear factor kappa B (NF -KB) and C/EBPB

(Santa Cruz Biotech, Santa Cruz, CA) were radiolabeled with [7-32P]ATP using a Ready

to Go Polynucleotide Kinase Kit (Pharmacia Biotech, Piscataway, NJ). Nuclear protein

(10 ug) was added to DNA-binding reaction buffer consisting of 20 mM HEPES, pH 7.9,

41

60 mM KC], 1 mM EDTA, 0.5 mM DTT and 2 mg of poly(dI-dC), and preincubated on

ice for 15 min to block the nonspecific binding. After the addition of 1 ml of 32P-labeled

probe containing 30,000 cpm, the incubation was continued for 30 min at room
temperature to promote the formation of nucleoprotein complexes. Resultant
nucleoprotein complexes were separated on 4% (w/v) native polyacrylamide gels, dried
and visualized by autoradiography (Zhou et al. 2003a).

Statistics. Data were analyzed using Sigma Stat for Windows (Jandel Scientific,
San Rafael, CA). Serum IgA, IgA-1C and IgA deposition data were not normally
distributed and were therefore subjected to Kruskal—Wallis ANOVA on ranks and
pairwise comparisons made by Dunn's or Student—Newman—Keuls methods. All other
data were subjected to one-way ANOVA and pairwise comparisons made by Bonferroni

or Student—Newman—Keuls methods. Differences were considered significant at P<.05.

42

RESULTS

The capacity of DON to induce early markers of IgAN was compared in mice fed
diets containing 0%, 0.1%, 0.5% and 3% EPA. Consistent with its reported anorexic
effects (Pestka and Smolinski 2005), consumption of 20 mg/kg DON in the diet reduced
feed intake and weight gain in all groups (Table 2.2). However, no difference existed
among control and EPA-fed mice in either of these parameters. When fatty acid content
in splenic phospholipid fractions were assessed by GC, concentrations of AA [20:4(n-6)]
in control mice were two to three times higher than in those of mice fed with 0.1% to 3%
EPA (Table 2.3). Eicosapentaenoic acid content was 0%, 0.4%, 3.2% and 5.6% and DHA
content 2.7%, 5.3%, 7.5% and 6.1% in mice fed 0%, 0.1%, 0.5% and 3.0% EPA diets,
respectively. In addition, DPA, an intermediate in the conversion of EPA to DHA, was
also markedly elevated in mice fed the two highest EPA concentrations. Thus, EPA-
containing diets markedly decreased the ratio of (n-6) to (n-3) PUFAS in lymphoid tissue.

Serum IgA, serum IgA-1C and kidney mesangial IgA were used as markers for the
early stages of IgAN in DON-fed mice. Deoxynivalenol exposure significantly increased
serum IgA concentrations in mice fed control diet beginning at 8 weeks, reaching 10
times the control value after 16 weeks (Figure 2.1). Serum IgA accumulation was
0 Significantly suppressed in mice fed 3% EPA at 8, 12 and 16 weeks, whereas the 0.1%
and 0.5% EPA diets had no effect. Deoxynivalenol induced increases in serum IgA-1C at
week 16, and this was also suppressed by the 3% but not the 0.1% or 0.5% EPA diets
(Figure 2.2). When glomerular mesangial IgA deposition was measured at week 16 by
immunofluorescence, DON was found to induce IgA deposition (Figure 2.3).. Again, this

elevation was inhibited only by the 3% EPA diet, but not lower EPA concentrations.

43

.mmsaw 8% Schema. E 8:: mo 5am £303 >95 can 5:98:38 poem .N.~ £an

Amodvnb 8&6 8:2 58:80 a 805:» 5:28 a E 332
d”: 42mm a 2808 8d 333/

 

 

a de up ~¢.N a and um NWN ZOO +<mm foam
9 mmd u.” CNN a 05.6 h :..~ ZOO + <mm— $96
a wwd H mqm 9 @bd H mwd ZOQ + (Dam .XLd
a 33 H 2N a mod a wad ZOO + 35:00
a we; H vm.~_ a $6 H Gem 3980
E flaw Amv couagmaoo
Ems? .mp3 522 poem .33 582 98% angomxm

 

44

£3 2 How Some Enactfi pom 3:: E EEO—238:3 zoo—mm mo :oEmanoQ Eon eaten .m.N. 055.

.oBSoSoc you ”OZ
.nBoamoS mEom baa 8qu 05 baO
Amodvmv 5&6 act“: 8888 a 285m? 32 a E 832 .buZ .2.m.m H 3.88 0.8 333/

 

 

 

a NO H #6 n v; H ms an o; H On a w.o H EN a m6 H QM 35 .930
an; Has pm; Hm.m nu oded a deoO aodH mm 33 930
a 06 H 9m a N; H Nm a Nd H ed a OZ a OZ $5 mnomu
“1:ch noOHNk n~._Hm.w mo.mHv.m_ a_.NHw.£ 35 $30
a m6 H We a Re H 5v a m6 H mam a v.0 H we a md H Wm... 35 NHwO
«a; Ha.w_ madedN an; Hmdm am.NHm.~N an; Hedm fimOO

. a c; H 5.3 a Wm H oém a v._ H o.w~ a w.~ H NON a m; H NON cums
adenO «fioHfi— ademm ah.on.m mo.oHa._ 3:0
«OOHBON av.mH fimm modHNdN mwdeém amAH :N 930
adecN anHaA avdH Wm deH fin adewO oHEO

fieafimefi a a.
Bow gum
ZOO + <mm e\eo.m ZOO + <mm fiend ZOO + $5 .XLd ZOO + SEED 3980

 

45

 

 

 

 

 

  
       

      
                

  

 

  

 

A

_J -control

g 233%?me C

27 6' FZ—Z’ 3132522133

v

< 4

2, CC g

c c c

§2- 6 ° ., é

a z” a a a
aaaaa a f 3 ¢ V /

 

 

.s
N
.t
O

4 8
Time (wk)

Figure 2.1. EPA-enriched fish oil consumption suppresses DON-induced
serum IgA elevation in mice. Mice were fed control or 20 ppm DON
containing 0%, 0.1%, 0.5% or 3% EPA, and serum IgA was measured by
ELISA at 4, 8, 12', and 16 wk. Data are means i S.E.M. (n=8). Means at
a specific time point without a common letter differ (P<0.05). '

46

 

 

A
0’ O O
O O O

Serum IgA-IC (uglmL)
h

 

 

 

EPA (%) o o 0.1 0.5 l 3.0

Figure 2.2. EPA-enriched fish oil consumption attenuates DON-induced
serum IgA-1C elevation in mice. Mice were treated as described in figure
2.1. Sera were collected at 16 wk and analyzed by ELISA afier
polyethylene glycol precipitation. Data are means i S.E.M. (n=8).
Means without a common letter differ (P<0.05).

47

 

8

FITC intensity I pixel

 

 

 

DON - + + + +

EPA (%) o o 0.1. 0.5 3.0

Figure 2.3. EPA-enriched fish oil consumption inhibits DON-
induced mesangial IgA deposition in mice. Mice were treated as
described in figure 2.1. Relative mesangial IgA quantitation at- 16
wk was assessed by measuring irnmunofiuorescence by image
analysis. Data are means i S.E.M. (n=8). Means without a
common letter differ (P<0.05).

48

Deoxynivalenol-induced IgAN has been previously shown to correlate with
increased IgA secretion ex vivo in lymphoid tissue cultures derived from the mucosal and
systemic compartments (Pestka 2003). The effects of EPA consumption on ex vivo IgA
production were therefore compared. Inclusion of DON in basal control diet significantly
increased IgA production in spleen and PP cell cultures as compared to control group
(Figure 2.4). However, IgA secretion was markedly suppressed in cultures from all three
EPA groups.

J ia et al. (J ia et al. 2004a) (J ia et al. 2004b) demonstrated that DHA consumption
dose dependently suppresses DON-induced IL-6 expression in spleen and that this
correlates with reduced IL-6 mRNA transcription. To assess DON's acute effects on IL-6,
we fed the mice 0% or 3% EPA diet for 4 weeks prior to acute DON challenge. This
feeding period was sufficient to lower splenic AA and concurrently raise EPA, DHA and
DPA to levels observed after 16 weeks (Table 2.4). In control mice, acute DON exposure
was found to markedly induce serum IL-6 (Figure 2.5) as well as expression of IL-6
mRNA and hnRNA, a marker of IL-6 transcription, in spleen and PP (Figure 2.6). Prior
consumption of 3% EPA suppressed all three end points suggesting that this fatty acid
impaired IL-6 transcription. Consistent with these findings, EMSA revealed that CREB
and AP-l binding activities in splenic nuclear extracts were significantly increased by
acute DON exposure, but that consumption of 3% EPA diet suppressed this induction
(Figure 2.7). Eicosapentaenoic acid did not affect DON-induced NF-KB ac‘tivation.

Neither DON nOr EPA affected C/EBP binding.

49

.Godvmv are bus
8888 a 3055 £322
.aua .2.m.m H wave
03 «SO a? 3 you mo 5%
B:ot¢o-<mm wow wow:
88m 35:3 :8 52%
98 mm 5 wommoamsm
2 E5808 <3 03> 5

333-28 .2 2:5

 

 

 

3; Eu

ZOO

 

 

 

 

 

 

 

 

:moEw

 

 

 

 

 

m.
.
LE

 

I

I

 

 

~._
1.
o.
a.
o. F
N. F
3

2.

ON

on

at

cm

hut/BU) vfil

50

33 v com 5% <mm {em .5 15:8 vow 028 E mummzonmmonq 52% mo :oflfiomfioo Bow. 33m .vN 2an

638083 “on “OZ
.8505 03 man than.“ 8.88 05 >30
Amodvmv comm—u Eto— aoEEOQ a 305$, 32 a E 332 .mHZ .E.m.m H 8on as $3.9

 

 

a VO H wé a md H Wm anN0
a 3. H E H We H 3 . 38
a 9o H 3 a 92 38
$2me 2.3:: 35
a to H mm H. 2 H 3. 36
m 5H 3N “NNHNHN 3:0
a f H 0% a 2 H ”R 3:0
$.33 26H 3 $5
a 3 H 98 a mo H EN 920
a to H 2 H 2 H 3 9:0
avazonnmona E .x. 28 ban

 

ZOO + <55 fin“ 35:00

 

51

 

80

Serum lL-6 (nglmL)

 

 

 

DON - + +
EPA (%) o o 3.0

Figure 2.5. Induction of serum IL-6 by acute DON exposure
is attenuated in EPA-fed mice. Mice were fed experimental
diets for 4 wk and then gavaged with 25 mg/kg body weight
DON or vehicle. Data are means i S.E.M. (n=5). Means
without a common letter differ (P<0.05).

52

Figure 2.6. EPA-enriched fish oil consumption suppresses induction of IL-6 hnRNA and
mRNA after acute DON exposure in spleen and Peyer’s patches from B6C3F1 mice.
Mice were fed control or 3% EPA diet for 4 wk and gavaged with 25 mg/kg DON or
vehicle. RNA was extracted from organs after 3 h and analyzed by real-time PCR. Data
are means i S.E.M. (n=5). Means without a common letter differ (P<0.05).

53

 

(21.:
m...— an.

 

 

 

 

 

on... An.

 

 

 

 

 

 

od 6 5 Eu
+ . ZOO
a - o
. on a on
2: - 2:
3.. . 3.
can a - can.
can <sz . on"
2:" o...— u_:o_nw - can
on» on”
. O O
8 a
3 . 2:
a...
. 8 . SN
2: n
our . 8n
3;
o2. (21:..— . =3
2: ma: 2.3—aw
8N

 

 

NOISSEHdXE EAIJN'IEH

54

a...

n t u. .
.
. . . .... .. . ... .. 1.....t. ... . ....
. . , .. . ...... ..........I1......§.£IFQ341.! . . ...:

. .51.»???...,........-mmfl~tLH ..v

.3088 28 2: E @233qu me? one.“ 200 .mH<E~m-s 5:» @2332va 9590 was OUTmZ .Tm< .Ommo
8m monoa .msmaumaoo vowqabmo—nsou wfims <m2m .3 33:8 @555 “Scam :oumtomsab .8 cog—SS :05 28 58 on
“an? vows—cam 303 30:: Eco—am .2039» S ZOO OEEE mm 5:» vomgmw 28 x? v 8m 3% $5 $m .5 6280 now 0.53
8:2 .3158 wfivfin “Sou.“ newntomfiwb ammo—mm 3268-2OO 332.53 gums—:38 :0 Ana wonogou<mm 6N onE

 

  

..

...... , . . . . ‘ ... . .4 _ E...

>. : . . . . — p . . ‘ . .
......“ iii”. .3”... .... . .. .. . .. . 5 .. .....7... .. v . . 2.7.... . . . . ...: : n . H.511 .. ”512:1. . . ... l. .. .... - ...f 3...n:r..~a.5§f.hr.t?.r.nr7m.1$.t.rt.i.145
......t.rw....... . . .1. . ..d .hm....£,.xv I. . ”an.
. . .1
t... ... a... ..I MUN—0
. . . J ... . . . . .1 . . . . . v4
.. .11.... . .. .. {it f7 :... ...??«3 ...: .1 ..I. .1. I». I .321. 1.1....

 

80.5
+ - - - 28

.. + + - - + + - .. <n_m_

+. + + + + .I I I I 200

55

DISCUSSION

Although (n—3) PUFA supplementation has been suggested to be efficacious in the
treatment of late-stage IgAN (Donadio and Grande 2004), the potential preventative
benefits of (n-3) PUFAS in early stages of the disease are unknown. Aberrant serum IgA
production is an important early etiological factor for IgAN,~and resultant IgA-IC likely
binds receptors on mesangial cells, thereby inducing proliferation and cytokine
production (Barratt et al. 2004). Polymeric IgA deposition might also activate
complement via the alternative pathway, causing glomerular damage. Because DON-
induced dysregulation of IgA production and aberrant IgA accumulation mimic the early
stages of human IgAN (Jia et al. 2004a) (Pestka 2003), the results presented herein
suggest that EPA consumption might have possible prophylactic value in suppressing
early elevation of IgA and nephritogenic IgA-[C among individuals who have been
diagnosed with IgAN or who have genetic predisposition for this disease.

We observed here that 3% but not 0.1% or 0.5% EPA in the diet suppressed
serum IgA and IgA-1C elevation and. glomerular IgA deposition. Jia et al. (Jia et al.
2004a) previously found that 1% EPA in diet could also suppress these parameters.
Taking these studies together, dietary EPA concentrations of 1% to 3% appear to be the
prophylactic threshold in this model. These findings are consistent with prior studies
showing the same efficacious doses for DHA-enriched oil (Jia et al. 2004a) (Jia et al.
2004b). Because both EPA— and DHA-enriched oils seem to be similarly effective and
inhibiting IgA up-regulation, consumption of fish oils containing EPA+DHA might be
more cost effective to achieve the IgA endpoint than oils processed to selectively contain

either of the two (n-3) PUFAS.

56

A 1% to 3% EPA dose range provides 2.2% to 6.7% of the daily kilocalorie
consumed in the mouse, which can be compared to 1.5% daily kilocalorie for (n-3)
PUFAS in supplements (Donadio and Grande 2004) recommended for therapy in patients.
Here we employed the 3% diet as a strong positive control to discern underlying
mechanisms for inhibition of IgA up-regulation. A limitation of this approach is that this
dose would be equivalent to human consumption at 15 g/day, which is five times that of
the recommended FDA maximum of 3.0 g/day. Nevertheless, it should be noted that ex
vivo cultures from all three EPA concentrations showed suppressed IgA production. This
suggests that ongoing IgA production at experiment termination (16 weeks) might have
indeed been suppressed even at the lowest (0.1%) EPA concentration later in the feeding
study. Thus, a key future question relates to whether prefeeding (n-3) PUFAS at low
concentrations for an extended period before DON exposure might attenuate IgA
dysregulation.

Although EPA content in the spleen (0.4—5.6%) was highly dependent on the
concentration of this (n-3) PUFA in the experimental diet, DHA content was similar
(5.3—7.5%) among the experimental groups. Splenic DHA could arise from two sources.
First, although the EPA-enriched fish oil employed here contained predominantly EPA
(49%), it also contained a smaller amount of DHA (6.7%) that could accumulate in the
splenic pool. Second, EPA can be transformed to DHA in mammalian tissue via
intermediate DPA (F yfe and Abbey 2000) (Kanayasu-Toyoda et al. 1993). Accumulation
of DPA (3.2—7.9%) in EPA-fed mice suggests that such a conversion was ongoing and
thus could be another likely DHA source.

A critical observation was that EPA consumption significantly reduced serum IL-

57

6 and splenic IL-6 mRNA induced by acute DON exposure. The mucosal immune system
is a primary target of DON (Pestka 2003) where it disrupts oral tolerance and promotes
production of IgA capable of binding antigens found in food and commensal bacteria
(Rasooly 7 and Pestka 1994) (Rasooly et al. 1994). Deoxynivalenol up-regulates
expression of proinflammatory genes, notably IL-6, both in vivo and in vitro (Zhou et al.
1997) (Wong et al. 1998). IL-6 is produced by activated monocytes‘ and macrophages,
and also by endothelial cells, T cells and keratinocytes (Kanda and Takahashi 2004).
Interleukin-6 drives IgA-committed B cell to terminally differentiate to IgA—secreting
plasma cells (Beagley et al. 1989). Differentiated IgA-secreting B cells can migrate to
distal mucosal and systemic sites, survive for prolonged periods and . produce IgA.
Interleukin-6's role in DON-induced IgAN is supported by the ex vivo antibody
neutralization studies (Yan et al. 1998) (Yan et al. 1997) and by the observation that IL-
6-deficient mice resist DON-induced serum IgA elevation and mesangial IgA deposition
(Pestka and Zhou 2000).

Because hnRNA is a precursor species observed in cells prior to RNA splicing to
mRNA, its abundance can be used as a surrogate for the run-on assay in detection of gene
transcriptional activity (Elferink and Reiners, Jr. 1996). Eicosapentaenoic acid;enriched
oil consumption significantly blocked accumulation of IL-6 hnRNA as well as IL-6
mRNA, indicating that (n-3) PUFA attenuation IL-6 gene expression occurred in part at
the transcriptional level. This contention is further supported by our previous observation
that mice consuming 3% DHA for 4 weeks exhibit markedly less induction of IL-6
mRNA and IL-6 hnRNA expression following acute DON exposure (Jia et al. 2004b).

Diminished IL-6 transcription and ultimately, IL-6 expression, might attenuate IL-6

58

production by affecting transcription factor binding to the response element in the IL-6
promoter. Cyclic AMP response element-binding protein, AP-l, NF-KB and C/EBPIS
have all been associated with binding and transactivation of the IL-6 promoter (Dendorfer
et al. 1994) and (Tokunou et al. 2001). Of these, suppression of DON-induced IgAN
corresponded to decreased induction of CREB and AP-l binding activity. These two
factors might thus be important in diminished IL-6 transcription. '

n-3 PUFAS potentially influence functional activities of cells of the immune
system via several mechanisms. The ameliorative effects of the experimental diet 'in this
study were likely mediated by dramatic decreases in AA and corresponding increases in
splenic (n-3) PUFAS. Deoxynivalenol-induced IL-6 expression is mediated in part
through increased COX-2 levels and PGE2 production (Moon et al. 2003) (Moon and
Pestka 2003a) (Moon and Pestka 2002). Cyclooxygenase and lipoxygenase products
produced from EPA are much less potent as inflammatory mediators than are products
generated from AA (Calder 2005). Thus, decreased AA tissue concentration might reduce
IL-6 gene expression and attenuate overall IgA production in DON-exposed mice.
Inhibition of 1L-6 expression by (n-3) PUFAS could also involve deregulation of key
signal transduction pathways. Deoxynivalenol does not act through a known receptor but
rather acts via the ribotoxic stress response and activation of mitogen-activated protein
kinases (MAPKs) that drive expression of IL-6 and other inflammatory genes (Moyad
‘ 2005). Consumption of fish oil or (n-3) PUFAS can cause modest suppression of MAPK
activation (Jia et al. 2004b) (Moon and Pestka 2003b). ‘

Taken together, the data presented here suggest, for the firSt time, that a threshold

exists for EPA relative to suppression of experimental IgAN and that the threshold EPA

59

dose for IgA inhibition was effective at suppressing IL-6 transcription. Relevant to our
findings, two clinical trials reported that IL-6 production by peripheral blood
mononuclear cells is decreased in persons who consume (n-3) PUFA, and this co-occurs
with increased plasma and cell membrane (n-3) PUFA incorporation (T rebble et al.
2003a) (Wallace et al. 2003). (n-3) PUFA suppression of IL-6 production might have
additional clinical relevance because this cytokine is believed to contribute to kidney
injury (Taniguchi et al. 1996) (Bagheri et al. 1997) in human IgAN (Donadio and Grande
2002). Further study at the preclinical level is needed on the relationship between dietary
(n-3) PUFA and tissue phospholipid concentrations needed for optimal, efficacious
prophylactic and therapeutic treatment for IgAN and other immune-related diseases. The

strategy described here offers one animal model for such preclinical testing.

60

CHAPTER 3

Mechanisms for Suppression of Interleukin-6 Expression in Peritoneal

Macrophages from Docosahexaenoic Acid-Fed Mice

61

ABSTRACT

Consumption of the trichothecene mycotoxin deoxynivalenol (DON) induces
interleukin-6 (IL-6)-dependent IgA nephropathy (IgAN) in mice. This effect can be
prevented by feeding long chain n-3 polyunsaturated fatty acids (PUFAS) found in fish oil.
The purpose of this study was to identify the signal transduction pathways by which
DON upregulates IL-6 in the peritoneal macrophage and how consumption of fish oil
enriched with the n-3 PUFA, docosahexaenoic acid (DHA), suppresses these processes.
Incubation with DON induced IL-6 expression in naive macrophages maximally at 3 h.
Knockdown of the transcription factor CAMP response element-binding protein (CREB)
or pharmacologic inhibition of the CREB kinases, Aktl/2, MSK] and RSK],
downregulated this expression. Inhibition of double-stranded RNA-activated protein
kinase (PKR) suppressed not only IL'O‘ expression but also phosphorylation of CREB and
its upstream kinases, Aktl, MSKl and RSK]. Phosphorylation of PKR, CREB kinases
and CREB was markedly impaired in peritoneal macrophages isolated from mice that
consumed DHA-enriched fish oil for 6 to 8 wk. DHA’s effects were not explainable by
increased activity of protein phosphatase 1 and 2A since both were suppressed in mice
consuming the DHA diet. Although cells cultured directly with DHA expressed less IL-6.
compared to cells cultured with arachidonic acid (AA), neither fatty acid treatment
affected DON-induced protein phosphorylation. Furthermore, DHA and AA similarly
inhibited cell-free protein kinase activity. These data suggest that DON-induced IL-6

expression is CREB-mediated and PKR-dependent and that requisite kinase activities for

these pathways were suppressed in macrophages from mice fed DHA for an extended

62

period.

63

INTRODUCTION

Deoxynivalenol (DON) is a trichothecene mycotoxin produced by Fusarium that
is frequently encountered in cereal-based foods and that potentially evoke adverse effects
on human health. DON can induce both proinflammatory cytokine expression and
apoptosis in mononuclear phagocytes depending on exposure frequency and dose (Pestka
et al. 2004). Dietary exposure to DON selectively promotes polyclonal activation and
expansion of immunoglobulin A (IgA)-secreting B cells by activating macrophages and T
cells. Production of autoreactive IgA and its deposition in the mouse kidney mimic the
early stages of human IgA nephropathy (IgAN) (Pestka 2003) (Pestka et al. 1989). DON-
induced interleukin-6 (IL-6) expression in macrophages plays a critical role in IgA
upregulation (Yan et al. 1997) (Pestka and Zhou 2000). The upstream mechanisms by
which DON induces IL-6 production in macrophages remain unclear but appear to. be
mediated both transcriptionally and post-transcriptionally (Caravatta et al. 2008) (Suzuki
et a1. 2008) (N ishie et al. 2007a).

IL—6 plays a critical role in inflammation initiation and maintenance of chronic
inflammatory states. IL-6 also elicits T cell activation, end-stage B cell differentiation and
immunoglobulin secretion. Notably, circulating IL-6 levels are elevated in several
autoimmune diseases, such as rheumatoid arthritis, systemic lupus erythematosus,
Crohn’s disease and psoriasis, and correlate with markers of disease activity (Gabay 2006)
(Kishimoto 2006) (Ishihara and Hirano 2002). IL-6 has also been related to the degree of
IgA deposition in the kidney and disease progression in patients with IgAN (Lim et al.
2003) (Harada et a1. 2002).

Consumption of the n-3 polyunsaturated fatty acids (PUFAS), docosahexaenoic

64

acid (DHA) or eicosapentaenoic acid (EPA), suppresses DON-induced IgAN in mice (Jia
et al. 2004b) (Shi and Pestka 2006), which concurs with the proposed anti-inflammatory
action of these fatty acids. These results are consistent with randomized clinical trials
demonstrating that fish oil consumption retards the renal function loss in IgAN patients
(Donadio, Jr. et al. 1994) (Donadio, Jr. et al. 1999) (Donadio, Jr. et al. 2001) (Donadio
and Grande 2004).

Given the potential importance of IL-6 in the pathogenesis of IgAN and other
autoimmune diseases, it is important to understand how DON induces IL-6
overexpression in macrophages and how n-3 PUFA consumption ameliorates these
effects. DON-induced phosphorylation of cAMP response element-binding protein
(CREB), a transcription factor associated with IL-6 expression, and its subsequent
binding to the IL-6 promoter have recently been shown to be inhibited in mice fed DHA
or EPA (J ia et al. 2006) (Shi and Pestka 2006). The purpose of this study was to (_1_) verify
that CREB activation is critical for DON-induced IL-6 expression and (2) identify

upstream signaling pathways by which DHA suppresses DON-induced CREB activation.

65

MATERIALS AND METHODS

Materials. All chemicals including DON and cell culture components were
purchased from Sigma-Aldrich, Inc. (St. Louis, MO) unless otherwise noted. DON
contaminated labware and cell culture media were detoxified by sodium hypochlorite. All
kinase and phosphatase inhibitors were purchased from Calbiochem, Inc. (San Diego,
CA).

Animals and diet. Female B6C3F1 mice (5 wk old) weighing 16 to 18 g were
obtained from Charles River Laboratories, Inc (Wilmington, MA) or Harlan (Indianapolis,
IA). Housing, handling, and sample collection procedures conformed to the. policies of
the Michigan State University All-University Committee on Animal Use and Care in
accordance with NIH guidelines. Mice were fed Harlan Teklad 22/5 Rodent chow or fat-
amended diets prepared as described in previous studies (Jia et al. 2006) (Shi and Pestka
2006). Briefly, corn oil (Dyets, Bethlehem, PA), high oleic acid safflower oil (Hain
Celestial Group, Inc., Melville, NY) and MEG-3TM DHA-enriched fish oil (containing
DHA 483 g/kg and 113 g/kg EPA) (Ocean Nutrition Canada, Dartmouth, Nova Scotia)
were added to AIN 93G basal diet (Dyets) to generate a control diet (10 g corn oil and 60
g safllower oil/kg diet) and a DHA diet containing 30 g DHA/kg diet(10 g corn oil and
60 g DHA enriched oil/kg diet), respectively. Mice Were fed one of the diets for 6 to 8 wk
before peritoneal macrophage harvest. The DHA concentration was selected based on
previous work (J ia et al. 2004b) and the time period was chosen based on its efficacy in
preliminary studies to consistently suppress DON-induced IL-6 expression.

Peritoneal macrophage cultures. Mice were injected ip with 1.5 ml of sterile 3%

(w/v) thioglycollate broth. After 4 d, mice were euthanized and macrophages collected by

66

peritoneal lavage with ice-cold Hank's BSS (Invitrogen Corporation, Carlsbad, CA).
Cells were pelleted by centrifugation at 1,100 X g for 5 min. Cells were washed with BSS
once and resuspended in RPMI-l640 containing 10% (v/v) heat-inactivated fetal bovine

serum (Atlanta Biologicals, Norcross, GA), 100 U/ml penicillin, and 100 ug/ml

streptomycin. Cells were cultured at 37°C under 6% C02 in a humidified incubator for 24

h before treatment.

Macrophages were incubated with or without DON for various time periods and
analyzed for mRNA expression by real-time PCR or protein phosphorylation by Western
analysis. DON was dissolved in PBS first to make a 250 ug/ml stock solution and then

added to cell culture media as a 1:1000 (v/v) dilution to generate a 250 11ng working

solution. Two milliliters of cell suspension (1 X 106 /ml) were incubated in each well of

6-well cell culture plates (Corning Life Sciences, Lowell, MA) for experiments requiring

RNA isolation. For protein collection, 10 ml cell suspensions (1 X 106 /ml) were

incubated in 100 mm-diameter cell culture dishes (Corning Life Sciences).

For protein kinase studies, inhibitors of MSKl/RSK] (Ro3l-8220) and Aktl/2
(Akt inhibitor IV, V and VIII) were dissolved in DMSO and added to cultures 1 h before
DON treatment. DMSO alone was used at the vehicle control. PKR inhibitor C16 and its
negative control were added to cultures 45 min before DON treatment.

For protein phosphatase studies, calyculin A (20 nM), an inhibitor to type 1 and
2A protein phosphatase, was added to cell cultures 1 or 2 h prior to DON treatment. None

of the inhibitors at the indicated concentrations affected cell viability, as verified by

67

trypan blue staining, or induced morphological changes, as verified by phase contrast
microscopy.

Real-time PCR. RNA was exnacted using RNeasy Mini (Promega, Madison, WI)
and analyzed by real-time PCR for IL-6 mRNA expression (Shi and Pestka 2006).
TaqMan primers and probes were purchased from Applied Biosystems (Foster City, CA).
B-2 microglobulin RNA expression is not affected by DON treatment and thus was used
as endogenous control to normalize target gene expression.

Western analysis. For protein phosphorylation studies, macrophages were washed
with ice-cold PBS, lysed in Tris buffer (10 mM, pH 7.4) containing 1% (w/v) SDS and
phosphatase inhibitor cocktail (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), boiled
and sonicated. After centrifugation at 18,000 X g for 15 min, extracts were subjected to
Western analysis using specific antibodies to CREB, phospho-CREB, phospho-Aktl,
phospho-RSKl, phospho-MSKI (Cell Signaling Technology, Inc., Danvers, MA), PKR
(Millipore, Billerica, MA), phospho-PKR (Calbiochem) and B-actin (Sigma-Aldrich).
Alexa Fluor 680 goat-anti rabbit and IRDye® 800 goat-anti mouse secondary antibodies
were purchased from Invitrogen Corporation and Rockland Immunochemicals, Inc.
(Gilbertsville, PA) respectively. Infrared fluorescence was directly detected by using an
Odyssey Infrared Imaging System (Li-Cor Biosciences, Lincoln, NE).

siRNA transfection. An siRNA cocktail targeting mouse CREB and a comparable
scrambled siRNA were purchased from Dharmacon (Lafayette, CO). siRNA transfection

was performed by electroporation using an Amaxa Nucleofector (Gaithersburg, MD).

Briefly, 2 X106 cells were suspended in 100 pl electroporation buffer (mixture of 40 ul of

68

buffer 1 [20% ATP-disodium and 12% MgClz-6H20] and 2 m1 of buffer 2 [1.2%

K2HPO4, 0.12% NaHCO3 and 0.04% glucose]) and mixed with 10 [1M siRNA.

Electroporation was performed using program D032 for macrophages according to the
manufacturer’s protocol. Transfection efficacy was verified by assessing loss of CREB
protein by Western blot 48 h after transfection. IL-6 expression induced by DON after
transfection was analyzed by real-time PCR.

Aktl assay. Aktl activity in immunoprecipitates was measured by Western
analysis. For immunoprecipitation, media were removed by centrifugation and adherent
cells were washed twice with ice-cold PBS. After PBS was aspirated, 0.5 ml lysis buffer
(20 mM Tris [pH 7.5], 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% [v/v] Triton X-
100, 2.5 mM sodium pyrophosphate, phosphatase inhibitor cocktail and protease inhibitor
cocktail [Roche Diagnostics, Indianapolis, IN]) were added. Following incubation on ice
for 5 min, cells were scraped off the plates and transferred to microcentrifuge tubes,
sonicated 4 X 5 sec and clarified by centrifugation at 18,000 X g for 10 min. The
supernatants (40 [11) were incubated with 1 ug anti-Aktl antibody with gentle rocking for
2 h at 4 °C. Protein A-Sepharose beads (20 pl of 50% slurry) were then added and
incubated for 30 min. Beads were pelleted at 18,000 X g for 30 sec, washed twice with
lysis buffer and kinase assay buffer (25 mM Tris-HCl [pH 7.5], 1 mM dithiothreitol
[DTT], 10 mM MgC12, phosphatase inhibitor cocktail and protease inhibitor cocktail)
respectively. Aktl-specific CREB kinase activity in the immunoprecipitate was assessed
at 30°C for 30 min using 10 uM glutathione S-transferase (GST)-CREB (Upstate, Lake

Placid, NY) and 30 uM ATP as substrate. Assays were terminated by adding 2% (w/v)

69

SDS buffer, and CREB phosphorylation was detected by Western analysis.

Protein phosphatase assay. Phosphatase activity of protein phosphatase 1 (PPl)
and protein phosphatase 2A (PP2A) in immunoprecipitates was determined using para-
nitrophenyl phosphate (pNPP) as substrate. For immunoprecipitation, cells were rinsed
twice with ice-cold Hank’s BSS and incubated with lysis buffer (50 mM HEPES [pH 7.4],
0.1 mM EDTA, 0.1 mM EGTA, 0.5% Triton X-100, 1 mM DTT and protease inhibitor
cocktail) on ice. After 5 min, cells were scraped off the plates and transferred to
microcentrifuge tubes, sonicated and clarified by centrifugation at 18,000 X g for 10 min.
PP] and PP2A were immunoprecipitated using mouse IgG2b antibodies specific to C
subunit of PPla or PP2A respectively (Upstate). Briefly, a supernatant containing 500 pg
protein was incubated with 4 pg specific antibody or mouse IgG2b and 40 ul protein A-
Sepharose beads (50% slurry) at 4°C with gentle rocking for 2 h. The beads were pelleted

at 18,000 X g for 30 sec and washed 3 times with lysis buffer and phosphatase assay

buffer (50 mM HEPES [pH 7.2], 10 mM MnClz, 2 mM MgC12, 1 mM DTT and protease

inhibitor cocktail) respectively. The pellet was reconstituted in phosphatase assay buffer,
and pNPP was added to make a final concentration of 20 mM. The reaction mixture was
incubated with agitation at 30°C for 1 h. Phosphatase activity was measured by reading
the absorbance. of supernatant at 405 nm. Phosphatase. activity was expressed as relative
values compared to control group at time 0.

Fatty acid treatment of cell cultures. DHA, arachidonic acid (AA) and oleic acid
(0A) were prepared as 200 mM stock solutions in ethanol and stored under nitrogen in

the dark at -20 °C until needed. Fatty acid-bovine serum albumin (BSA) complexes were

70

made based on published methods (Moon and Pestka 2003b) with some modifications.
Briefly, fatty acids in ethanol and BSA (fatty acid free) (Serologicals proteins Inc.,
Kankakee, IL) were mixed in PBS at a 3:1 molar ratio under nitrogen on a rocking shaker
at 37 °C for 24 h. This ratio was previously shown to suppress DON-induced IL-6 in the
RAW 264.7 macrophage cell line(Moon and Pestka 2003b). These mixtures were then
diluted with RPMI-l640 which was supplemented with 0.25% (v/v) FBS. Fresh media
were prepared for each experiment. Prior to adding fatty acid-amended media, nai've
peritoneal macrophages were incubated in RPMI-l640 medium with 0.25% (v/v) F BS for
18 h to elicit fatty acid deprivation. Cells were then cultured with media amended with 50
[AM fatty acids for 24 h before DON (250 ng/ml) was added. Total RNA was collected
after 3 h and IL-6 mRNA was detected by real-time PCR. To measure phosphorylation of
CREB and its upstream kinases, cells were incubated with vehicle DON for 20min afier
fatty acid incubation. Protein was extracted and analyzed by Western blot analysis.

Fatty acid treatment of CREB kinases. The effects of fatty acids on CREB
kinases in a cell-free system were tested over a range of concentrations (0, 12.5, 25, 50
and 100 uM) using a constant ethanol concentration. Active Aktl, MSKl or RSK] (1 ng)
(Upstate) was incubated with or without free fatty acids for l min in kinase assay buffer
according to the protocol from Upstate. CREB (30 uM) and ATP (100 uM) were then
added. The reaction was incubated at 30°C for 10 min and then was terminated with 2%
SDS buffer. CREB phosphorylation was analyzed by Western analysis.

Statistics. All data were analyzed with SigmaStat v 3.1 (Jandel Scientific, San
Rafael, CA) with the criterion for significance set at p<0.05. Student’s t-test was used for

comparison of two groups of data. One-way ANOVA was performed for comparison of

71

multiple groups. Holm-Sidak (if normality test passed) or Dunnett’s (ANOVA on ranks if

normality test failed) tests were used as post-hoc analysis.

72

RESULTS
Incubation of naive peritoneal macrophages with DON (250 ng/ml) induced IL-6
mRNA expression within 1 h (Figure 3.1). Increased expression was detectable up to 7 h
with maximum induction being observed at 3 h. Based on this finding, a 3 h incubation

was chosen to study mechanisms for DON-induced IL-6 expression and how these are

affected by DHA.

To verify the role played by CREB in DON-induced IL—6 expression, this
transcription factor was knocked down by electroporating with a specific siRNA cocktail.
As revealed by Western blotting, CREB protein was knocked down by 47% at 48 h after
transfection. (Figure 3.2A) Correspondingly, DON-induced IL-6 mRNA expression was
decreased by 42%. (Figure 3.2B) These data confirm that CREB is likely to be a critical

transcription factor in DON-induced IL-6 expression in the macrophage.

DON induces phosphorylation of several protein kinases that are capable of
phosphorylating and activating CREB (Jia et al. 2006). Specific inhibitors were thus
employed to investigate the relationship between IL-6 mRNA expression and CREB
kinases. When naive macrophages were preincubated with the MSKl/RSK] inhibitor
Ro3l-8220 at 1000 nM (Figure 3.3A), DON-induced IL-6 expression was markedly
inhibited. The role of another CREB kinase family, Akt l and 2, in DON-induced IL-6
was also assessed with three inhibitors. Akt Inhibitor IV is an ATP-competitive inhibitor
of a kinase upstream of Akt, but downstream of PI-3 K while Akt Inhibitor V targets an

Akt effector molecule other than PI-3 K or PDKl. Akt Inhibitor VIII selectively inhibits

Aktl and Akt 2 and appears to be pleckstrin homology (PH) domain-dependent. This

73

lL-6 mRNA
relative expression
00
O

 

 

 

 

 

012 34 5 67 8
Time(h)

Figure 3.1. Kinetics of DON-induced IL-6 mRNA expression in
peritoneal macrophages. Naive peritoneal macrophages were
cultured with DON (250 ng/ml) for different time periods. Total
RNA was extracted and IL-6 mRNA was analyzed by real-time
PCR. Data are means :1: SEM. Data points with different letters
differ (p<0.05). All data were normalized against b2-

. microglobulin and expressed relative to the value at time 0.

Results are representative of two independent experiments.

74

Figure 3.2. Transcription factor CREB knockdown inhibits IL-6 mRNA
expression induced by DON. siRNA specific to CREB or scrambled
siRNA (NC) was transfected by electroporation into naive peritoneal
macrophages. (A) To evaluate CREB knockdown efficiency, total
protein was collected after 48 h and CREB measured by Western blot.
RI indicates relative intensity which is the percentage of the maximal
fluorescence in the same lane. (B) To detect the role of CREB on IL-6
mRNA expression, cells were treated with DON 48 h after transfection.
Total RNA was collected and IL-6 mRNA was analyzed by real-time
PCR. Data are means i SEM. Bars with different letters differ (p<0.05).
Results are representative of two independent experiments.

75

A NC CREB

 

 

siRNA siRNA
RI(%) 100 53
B-actin

B

.5
< 8
z e
(I o.
E 3‘:
“,3 a:
_J .2
" 3‘9

9

 

 

 

siRNA NC CREB NC CREB

DON - - + +

76

inhibitor has no activity against PH domain-lacking Akts, or other closely related AGC
family kinases, PKA, PKC, and SG Incubation of naive macrophages with each of these
inhibitors for 1 h prior toxin treatment, suppressed DON-induced IL-6 mRNA expression

(Figure 3.3B-D) suggesting the involvement of Akt l and 2.

Double-stranded RNA-activated protein kinase (PKR) has been previously shown
to be a critical upstream mediator of DON-induced ribotoxic stress response (Zhou et al.
2003b) (Yang et al. 2000)._ Incubation with a specific PKR inhibitor was found to
markedly inhibit DON-induced IL-6 mRNA expression (Figure 3.4A). suppressed IL-6
expression appeared to correlate with impaired phosphorylation of CREB, Aktl, RSK]

and to a lesser extent, MSKl by PKR inhibitor (Figure 3.4B).

Peritoneal macrophages from mice fed control or DHA diet were compared
relative to their ability to phosphorylate CREB kinases and CREB following DON
exposure. DON induced Aktl, MSK] and RSK] phosphorylation as early as l min after
treatment and these effects were maximal between 5 to 15 min (Figure 3.5A, B). CREB
phosphorylation was maximal at 30 min but decreased dramatically after 60 min. DHA
consumption suppressed DON-induced phosphorylation of CREB kinases and CREB at
most of these time points.

The capacity of DHA feeding to modify DON-induced CREB kinase activity was
assessed in peritoneal macrophages using Aktl as a model. Specifically,
immunoprecipitated Aktl was pulled down from extract of DON-treated macrophages
from mice fed DHA or control diets and then assessed for its ability to phosphorylate

CREB (Figure 3.6). CREB kinase activity was highest at 30 min after DON treatment.

77

Figure 3.3. Inhibition of CREB kinases suppresses DON-induced
IL-6 expression. Naive peritoneal macrophages were cultured for 1
h with CREB kinase inhibitors dissolved in DMSO or the DMSO
vehicle, incubated with DON (250 ng/ml) for 3 h and then IL-6
mRNA measured by real-time PCR.. Compounds used were (A)
MSKl/RSK] inhibitor Ro 31-8220, (B ) Akt inhibitor IV, (C) Akt
inhibitor V and (D) Akt inhibitor VIII. Data are means i SEM.
Bar with asterisk differs from that of DON treatment without
inhibitor (p<0.05). Results are representative of at least two
independent experiments.

78

 

re 3 on
..L ...L _x
O N -§

lL-6 mRNA >
00

relative exp s I

 

 

 

ORB->03

R0 31-8220 0 2001000 0 2001000
(nM)
DON - - — + + +

 

B 16
514‘
9,124

IL-6 mRNA
9..
0

relative ex re
0)

 

 

 

Akt inhibitor IV 0 2 20 O 2 20

(PM)
DON - — - + + . +

79

 

 

O .

 

 

tor V
(W)

DON

0 5 0 5 0 5 0 .
3 2 2 1 1
568.98 025.0.

C <ZmE 0...:

Akt inhib

 

 

 

 

 

 

5
.... 2
5
2
0
0
w w
r (
. _ .w
0 O O O 0 Him
4 3 2 1 ..m
0563.55 0259 .m
t
<sz 0...: ..An

DON

Figure 3.3 continued.

80

 

A—X—A

lL-6mRNA
ON-hCDCDON-b

relative expression

 

 

 

N - + - +
PKRI NC PKRI

U
0

 

 

Figure 3.4 A. PKR inhibition blocks DON-induced IL-6 expression.
Naive peritoneal macrophages were cultured for 45 min with PKR
inhibitor (PKRI) or PKR inhibitor negative control (PKRI NC) and
then with DON 250 ng/ml for 3 h. IL-6 mRNA was measured by real-
time PCR. Data are means i SEM. Bar with asterisk differs from that
of DON treatment without inhibitor (p<0.05).

81

Figure 3.4B. PKR inhibition blocks DON-induced protein phosphorylation. To detect the
role of PKR activation in CREB phosphorylation, naive macrophages were cultured for
45 min with PKR inhibitor (PKRI) or PKR inhibitor negative control (PKRI NC) and
then with DON (250 ng/ml) for different periods. Phosphorylation of CREB and its
upstream kinases was measured by Western blot. RI indicates relative intensity which is
the percentage of the maximal fluorescence in the same lane. Results are representative of
two independent experiments.

82

3E

 

Na Na mm mm Na 00? mm mm germ

8 me me 8 mm 2: mm 8 30:1

5 9. 9. 5 9. t 2: R 3E
Ex<-n_

me E mm mm mo 2: E .... 3.?

oo. on E o oo om m_. oAEEv wEE.
EVE . OZEvE

 

 

83

.05—
083 05 E 005000.82.“ 3838 05 mo 0w8:00.~0n 05 fl £0.33 36:00.: 0.520.. 0300me E .85
500003 8 3000.33 0003 000003 :00 202009 08d 330.65 com €590 cmmv ZOO at? 00009503
0.6.5 “0.6 Em 8 35:00 tom 02E 88m mowwaaobaa E08200.“ .028 00mi<mm Bob m0w0nm8008
a 08.2%..” a Q2 05 gm: .3... .mmmo. as 838.38% 08:05.28 <2 2.03

 

. + i + t + .. + t + ... + t (ID
8 om E 0 F o 3.5 05¢

84

2.5 see
cm on ov om ow o_. o

 

 

 

 

mmmoa

 

 

 

 

5.0m-..

.mN

.3.

.09

.ms

.00..

do... 2:0... 0o 92.. .m 3 2.0a

3:5 05¢
om cm 9. on cm or o

 

 

s s

(%) Ia

 

 

Earn

 

 

 

 

1.6101
ink—98+

 

 

Si iii

M) 18

 

 

3.053

O

O

..Q.

85

.23— 058 05 2 03000085: 382088 0% mo 0w8=080a 05 2 £033
baa—002 020200 0000202 B .83 50603 .3 @3328 mm? mmdo mo noun—bonmmonm PS. 28
mmmv :23 20003502 28 30.3220050ng we? 30?. .203 :00 m2?o=om .3209 0820 00002.02
02 €qu ommv ZOQ 523 0000252 0003 02 02c ED 00 35:00 U2 028 88m 39238008
Eggnom .028 u0mt<mm 88% 003238008 2 00000033 2 830200362 000202-209 6.». 052m

2 8. om mm mm 3. N0 R Aim
‘.' III E III III. 1 II... It... mmmod

+ - + - + .. + - <_._n_
on on m. m. m. m o o EEEEfi

 

86

DHA consumption suppressed Aktl kinase activity at all the time points.

Peritoneal macrophages from mice fed control or DHA diet were treated with
DON for O, 15, 30 or 60 min and PKR phosphorylation measured. DON treatment
moderately upregulated PKR phosphorylation at 15 and 30 min (Figure 3.7). In contrast,
PKR phosphorylation appeared to be suppressed in macrophages from DHA-fed mice at
the initiation of the experiment as well as at 15 and 30 min.

The possibility exists that DHA consumption inhibits phosphorylation of CREB
and CREB kinases by upregulating protein phosphatase activities. Therefore, the
activities of PPI and PP2A were measured. DON treatment slightly induced phosphatase
activities in macrophages from mice fed control diet (Figure 3.8A). However, both
phosphatase activities in macrophages from DHA-fed mice were decreased as compared
to control diet regardless of whether they were treated with DON or not.

To further assess possible roles of phosphatases in DHA-suppressed protein
phosphorylation, peritoneal macrophages from mice fed control or DHA diet were
incubated with the general protein phosphatase inhibitor calyculin A prior to DON
treatment. Calyculin A did not abolish the inhibition of CREB and Aktl phosphorylation
by DHA consumption. (Figure 3.8B)

'l"o test the direct effects of fatty acid treatments on responses of macrophages to
DON, nai've peritoneal macrophages were incubated with different fatty acids complexed
with BSA. Both DHA and AA increased IL-6 expression compared to monounsaturated
fatty acid oleic acid (OA). DON induced IL-6 expression in all three groups according to
the rank order: AA>DHA>OA. (Figure 3.9A) When the effects of in vitro fatty acid

treatment on IL-6 expression were related to protein phosphorylation, fatty acid

87

.092 088 05 E 00:0om0uosc 3:588 08 mo 03200000 05 mm £0.33 .3202: 032200
30008.: E .83 E0000? 8 3000.33 0.83 0.309»— :00 .3303 0:5 @800me Sm 95w: ommv
ZOO 55 0030.5 0003 00% ED .8 65:00 00% 028 Sou 83:38? Basia doumasmdoo
43.5 3 600535 mm 0wmnm8008 Ragga 0fi 3 ~33 mo nous—boammog gum 05wE

52¢

 

Nm wv m? 00—. roll—.m NV mo fixev—m

 

+ - + - + - + - <10
om on 3 o E_EV0E:.

88

+ CONTROL
—0— DHA

 

1.4
a? 1.2 *
.2 .
*6 1.0
co
‘7 0.8
it 0.6
0.4

 

 

 

0 1O 20 30 4O 50 60 70

 

A—K

A

PP-2A activity
0) (on O L: h C)

 

 

 

O

010 20 30 4o 50 so 70
Time(min)

Figure 3.8A. PP] and PP2A phosphatase activities are not increased in
macrophages from DHA-fed mice. Peritoneal macrophage from
control- or DHA-fed mice were treated with DON (250 ng/ml) for O,
10, 30, or 60 min. PPl and PP2A in the cell lysates were
immunoprecipitated and analyzed respectively for phosphatase
activities. Values were expressed relative to control at time 0. Data are
means i SEM. Points with asterisk differ from those of
corresponding DHA group (p<0.05).

89

.050— 083 05 3 0803825
3:888 06 .8 0380800 05 fl 3033 36:02: 03500 00000.83 3 .83 E0303
3 ensues...“ 203 meme: :8 .58 cm 5 788 a? 03235 55 05 a N 8 _ é oz: as
< £30300 8 0_030> 385 8080508 0003 ~08 ED 8 8580 80m 028 88m 8388008
~008E0Q .uofi—bonnmoam £088 8 <Nmm 85 PE .8 080.3% 08396 eh .m Wm 08me

 

E mm mm 2: ow me mm 00 n 2 A53.

 

Sxdrn.
+ .. + .. + - + - + .. <In_
- .. + + - .. + + - - zoo

 

 

- - <c__:o>_mo

9O

 

 

 

 

 

 

c 180 -
.9
<2}: g 150-
CE 5- 120 4
E 3‘, 90.
3% 60‘
L.“ 30-
9 0 a
Fatty acid OA DHA AA
DON - + - + - +

Figure 3.9 A. Fatty acids differentially affect DON-induced IL-6
mRNA expression in peritoneal macrophages. Serum-deprived
peritoneal macrophages were treated with 50 uM fatty acid
complexed with BSA for 24 h. For IL-6 measurement, RNA was
extracted after 3-h DON (250 ng/ml) treatment and analyzed by
real-time PCR. Data are means i SEM. Bars with different
letters differ (p<0.05).

91

treatments did not affect phosphorylation of CREB, Aktl, MSKl or RSK] induced by
DON compared to control group. (Figure 3.9B) '

The effects of direct incubation of free fatty acids on Aktl, MSKl and RSKl
activity was also assessed using CREB as substrate. Both DHA and AA similarly
inhibited AKTl (250 nM), RSK] (_>_25 uM) and MSKl (250 uM) activity to a much

greater extent than OA. (Figure 3.10)

92

Figure 3.9 B. Fatty acids do not affect protein phosphorylation in peritoneal
macrophages. Serum-deprived peritoneal macrophages were treated with 50 MM fatty
acid complexed with BSA for 24 h. To detect protein phosphorylation affected by
different fatty acids, cells were incubated with DON for 20 min, and total protein was
analyzed by Western blot. RI indicates relative intensity which is the percentage of the
maximal fluorescence in the same lane.

93

 

Ex<-n_
N o - . firm

5 oo 8 E 02. mu .8 -5 exam

 

 

 

 

....-i §0md
+ I + I + I + I 200

mmd mmd mmd S 5 mm“.
+ + + I (mm

<< <10 <0 0200 38“.

94

Figure 3.10. AA and DHA similarly decrease CREB kinase activities in the cell-free
system. Protein kinases (Aktl, RSKl and MSKl) were incubated with 12.5, 25, 50 and
100 “M fatty acids or with PBS vehicle before CREB and ATP were added. CREB
phosphorylation was analyzed by Western blot. RI indicates relative intensity which is
the percentage of the maximal fluorescence (for PBS vehicle control, far right) in the
same row.

95

02. cm 5.1
m00 << <10 <O << <10 <0 0200 >20“.
09 8 R S mm mm - E 3.2m
F102
3E

wxwm

 

00—. cm VN cm or t. No

 

96

802580 01m 000me

 

 

. 3 mm .21
000 << <10 <o << <10 <0 «.200 E0“.
02 00 3 mm 3 00 mo 30:1

_.v_m_>_

 

2: 8 8 8 mm mm. mm 00.x

 

97

DISCUSSION

Clinical studies suggest that consumption of n-3 PUFAS is efficacious for
prophylaxis and treatment of chronic inflammatory diseases that impact millions of
people in the US. and contribute extensively to morbidity, mortality and health care costs.
Our laboratory has focused on the mechanisms by which n-3 PUFAS suppress IgAN, the
most common primary glomerulonephritis worldwide, using an experimental mouse
model. Consumption of n-3 PUFAS has been determined to attenuate DON-induced IgAN
and that correlates with impairment of both systemic IgA hyperproduction and IL-6 gene
expression (J ia et al. 2004a) (Shi and Pestka 2006) (Jia et al. 2004b).

Since IL—6 is a proinflammatory cytokine that plays a role in numerous
inflammatory and autoimmune diseases (Gabay 2006) (Ishihara and Hirano 2002), the
capacity of n-3 PUFAS to reduce its transcription is of fundamental importance. The
transcription factor CREB which binds to the promoter region of the IL-6 gene and
regulates its expression contains several functional domains. The C-terminal basic
domain facilitates DNA binding (conserved sequence: TGACGTCA) and the leucine
zipper domain facilitates dimerization with CREB or other members of the CREB family
such as cAMP response element modulator (CREM) and activating transcription factor 1
(ATF-l). Most importantly, CREB has a kinase inducible domain (KID) that contains the
critical serine-133 amino acid residue. Exposure to DON results in phosphorylation of
this residue through the action of Aktl, ribosomal S6 kinase 1 (RSKI) and mitogen
/stress-activated protein kinase 1 (MSKl) (Jia et al. 2006). Since knockdown of CREB
by siRNA and pharmacolOgic inhibition of CREB kinases suppressed IL-6 expression, we

conclude that this transcription factor and its upstream kinases, Aktl, MSK] and RSKl,

98

are likely to be critical for DON-induced IL-6 production.

A key question relates to the molecular mechanism by which DON-induced stress
upregulates IL-6 expression. The ribotoxic stress response is a mechanism by which a
number of translational inhibitors, such as DON, act on cells and induce activation of
mitogen-activated protein kinases (MAPK), proinflammatory cytokine production and
apoptosis (Zhou et al. 2005a). It has been previously shown that PKR is a critical early
mediator of DON-induced ribotoxic stress response (Zhou, et al. 2003b). PKR is a
ubiquitously expressed serine/ threonine protein kinase that is activated by double-
stranded RNA, interferon, cytokines and stress signals. It is an essential signal transducer
and integrator for immune cells to respond to different stresses. Upon activation, PKR
inhibits translation initiation by phosphorylating eIF20t which leads to selective protein
synthesis inhibition and regulates several signal transduction pathways such as activation
of MAPK and NF-KB (Garcia et al. 2006) (Taylor et al. 2005). The results presented here
confirm that, in peritoneal macrophages, PKR is also an essential upstream regulator of
DON-induced IL-6 expression and CREB activation. It should be noted that while
inhibition of PKR almost completely abolished IL-6 expression, weak CREB activation
was still evident. Since DON also activates other transcription factors via PKR such as
NF-KB and AP-l that can contribute to IL-6 expression, suppression of their activation by
PKR inhibition might synergistically contribute to IL-6 suppression.

- Inhibition of CREB activation by n-3 PUFAS can be caused by decreased CREB
kinase activity (Caravatta et al. 2008) (Kato et al. 2007) (Chepumy et al. 2002) (Arthur et
al. 2004) (Zhang et al. 2002). In this study, we compared kinetic changes of protein

phosphorylation and kinase activity induced by DON in macrophages from mice fed

99

w'

control or DHA diet. Phosphorylation of Aktl, MSK] and RSKl occurred earlier than
that of CREB and all such phosphorylations were suppressed in macrophages from DHA-
fed mice. The results presented here suggest that suppression of PKR activation
contributed to reduced CREB kinase and CREB phosphorylation.

An alternative explanation for DHA’s inhibitory effects is that it interrupts CREB
activation by increasing serine/threonine protein phosphatase activities in macrophages.
Phosphorylation of serine and/or threonine is important for activation of CREB, Aktl,
MSKl and RSKl. Phosphorylation can be fine-tuned by competing dephosphorylations
carried out by protein phosphatases. The primary phosphatases that dephosphorylate
these residues are PP] and PP2A (Alberts et al. 1994) (Comerford et al. 2006)
(Wadzinski et al. 1993) (Katsiari et al. 2005). PP] and PP2A consist of multimeric
structures including a catalytic subunit complexed to a number of accessory subunits that
are able to regulate the activity of the catalytic subunit. Here, activities of the
phosphatases were measured rather than protein amounts of catalytic subunits. The
results showed that prior DHA consumption decreased both basal and DON-induced PPl
and PP2A activities in peritoneal macrophages, suggesting the .n-3 PUFAS do not
suppress protein phosphorylation by upregulating phosphatase activities. This conclusion
was further supported by studies employing calyculin A, a potent PP] and PP2A inhibitor,
which did not restore the reduced phosphorylation of CREB and Aktl observed in
macrophages from DHA-fed mice.

A further possibility was that DHA suppressed CREB phosphorylation by direct
interaction with macrophages. We thus examined the direct effects of fatty acids on IL-6

expression and protein phosphorylation in naive peritoneal macrophages. The

100

concentrations of total non-esterified fatty acids (NEFAs) in plasma range from 0.2 to 1.7
mM and the individual concentrations of the major fatty acids can range from 30 to
lBOpIM. Most (>99%) NEFAs bind with albumin to make complexes with the remainder
existing as unbound free fatty acid (Lloyd et al. 2006) (Calder et al. 1990) (Itoh et al.
2003) (Richieri and Kleinfeld 1995). Therefore the concentrations of fatty acid-BSA
complexes used in our in vitro experiments were in a physiological range.

The in vitro experiments showed that although macrophages secreted more DON-
induced IL-6 following treatment with AA than with CA or DHA, there was no marked
difference in DON-induced phosphorylation of CREB or CREB kinases among the three
different fatty acid treatments. Thus n-3 PUFA effects in vitro did not mimic those seen ex
vivo. One explanation for these differences might relate to the use of primary
macrophages which are central to innate immunity and are crucial for initiating,
maintaining and resolving an adaptive immune response. Macrophages are not a
homogeneous cell population, but rather encompass different phenotypes, which exhibit a
wide range of pro- and anti-inflammatory activities depending on their stage of
differentiation and activation. Fatty acid consumption could suppress inflammation by
differentially modulating expression of genes related to proinflammatory responses such
as colony-stimulating factor-1 (CSF-l) and PU.1, or anti-inflammatory responses such as
adenosine A3 receptor, CDld, and IL-l receptor 11 (Ehrchen et a1. 2006) (Desnues et al.
I 2006) (Hume 2006) (Shi and Simon 2006). It might be speculated that the DHA effects
observed herein represent a cumulative change in macrophage phenotypes resulting from
subchronic n-3 PUFA consumption.

Another explanation for the differences between ex vivo and in vivo responses is

101

that DHA is a precursor to some more potent anti-inflammatory mediators such as
resolvins and protectins (Ariel and Serhan 2007) (Hong et al. 2003). These mediators are
produced by epithelial cells, neutrophils and glial cells in intact animals and can have
anti-inflammatory effects on macrophages. Their effects might not be immediately
detectable in purified macrophage cell culture treated with DHA for a short period. A
further possible reason for the difference is that arachidonic acid depletion upon DHA
incorporation might result in less PGE2 production. Since DHA can be incorporated into
the cell membrane relatively rapidly, the latter might be a greater factor in suppressing
IL-6 expression in vitro than ex vivo (Calder 2006a).

After cell entry, free fatty acids bind to fatty acid binding proteins, which
facilitate their transportation, storage and metabolism (Rolph et al. 2006) (Makowski and
Hotamisligil 2004). These fatty acids can directly interact with proteins and modulate
their activities. It has been reported that unsaturated fatty acids are ligands not only for
nuclear (Kliewer et al. 1997) (Murakami et al. 1999) and membrane receptors (Itoh et al.
2003), but also for protein kinases (Lopez-Nicolas et al. 2006) (Eitsuka et al. 2005). A
cell-free system was therefore used to assess direct interactions among three molecules:
kinase, substrate and fatty acid. Although AA and DHA inhibited CREB kinase activities
at 100 and 50 uM compared to OA, these n-6 and n-3 PUFAS did not differ in the extent
of inhibition. It should be further noted that although direct effects of fatty acids on
protein kinases were observed, the concentrations employed were relatively high. The
total unbound intracellular fatty acids and FA-CoA levels reported previously are lower

than 10 11M (Gossett et al. 1996) (Jump and Clarke 1999). Since no inhibition of kinase

activity by fatty acids was observed at 12.5 1.1M, the effects of PUFA on Aktl, RSK] and

102

MSKl at high concentrations in peritoneal macrophages might not be physiologically
relevant.

In summary, the data presented here suggest that IL-6 expression induced by
DON is PKR-dependent and mediated, in part, by the transcription factor CREB. DHA
consumption appears to suppress these pathways in macrophages rendering them less
capable of CREB activation and thus IL-6 transcription. (Figure 3.11) Suppression of IL- I
6 expression by DHA might have general importance to human health relative to the
prevention and treatment of inflammatory and autoimmune diseases mediated by this

proinflammatory cytokine.

103

[3C)hl

l

PKR
DHA —| ‘
pPKR

l

CREB KINASE

DHA —-l
pCREB KINASE

DHA -|
CREB > pCREB

 

 

 

DHA—l IL-6 ‘—‘ I

 

 

Figure 3.1]. Effects of DHA consumption on signal transduction
pathways mediating DON-induced IL-6 expression in peritoneal
macrophages ex vivo. Possible CREB kinases inhibited by DHA
feeding include AKT, RSK] and MSKl. The symbol -1 on the
left indicates inhibition of the pathway step on the right.

104

CHAPTER 4

Role of ER stress in deoxynivalenol-induced interleukin-6 expression

in peritoneal macrophages

105

ABSTRACT

Oral exposure to the trichothecene deoxynivalenol (DON) in mice induces
aberrant systemic expression of the proinflammatory cytokine interleukin-6 (IL-6). The
purpose of this study was to relate DON-induced IL-6 expression to the endoplasmic
reticulum (ER) stress response in mouse peritoneal macrophages. BiP, an ER chaperone,
was markedly decreased upon incubation with DON (500 ng/ml) for 1 h. As little as 100
ng/ml of DON was found to decrease Bip within 6 h. In contrast, BiP mRNA was not
affected by DON suggesting BiP loss resulted from protein degradation. DON-induced
BiP degradation was suppressed by cathepsin/calpain inhibitors. DON was also found to
increase protein expression of ER stress sensor the inositol requiring kinase 10. (IREla)
and two transcription factors, X-box binding protein (XBPl) and activating transcription
factor 6 (ATF6), as well as XBPl mRNA splicing. Knockdown of ATF6 with siRNA
partially decreased DON-induced IL-6 expression in peritoneal macrophages; while
knockdown of BiP induced IL-6 gene expression directly. These data suggest that DON
exposure induces BiP degradation and evokes an ER stress-like response that is likely to

contribute in part to DON-induced IL-6 gene expression.

106

INTRODUCTION

Deoxynivalenol (DON) is a trichothecene mycotoxin produced by Fusarium spp.
that is prevalent worldwide in cereal-based foods (Rotter et al. 1996) (Pestka and
Smolinski 2005). Chronic exposure generates concern about DON. By selectively
promoting polyclonal activation and expansion of immunoglobulin A (IgA)-secreting B
cells, dietary exposure to DON causes a dramatic elevation in serum IgA, serum IgA
immune complexes (1C) and IgA deposition in the mouse kidney, which mimic the early
stages of human IgA nephropathy (IgAN) (Pestka et al. 1989) (Dong et al. 1991)
(Rasooly and Pestka 1994). Our laboratory has observed that DON-induced interleukin-6
(IL-6) upregulation plays a critical role in this mouse model of IgAN (Pestka and Zhou
2000) (Yan et al. 1997) (Yan et al. 1998).

Membrane and secretory proteins synthesized in the endoplasmic reticulum (ER)
must be folded properly with the assistance of chaperones and folding enzymes (Yoshida
2007). Under conditions of Cytotoxicity or nutrient starvation, unfolded or misfolded
proteins can accumulate and cause ER stress (Ma and Hendershot 2001). As a results,
cells can activate a series of self-defense mechanisms referred to as the “ER stress
response” or “unfolded protein response” (UPR) (Zhang and Kaufman 2006).

BR stress is involved in several human diseases including neurodegenerative
diseases, diabetes mellitus, heart diseases, kidney diseases and inflammation (Yoshida
2007). It hasgbeen shown that proinflarnmatory cytokines (Oliver et al. 2005) (Nowis et
al. 2007) and lipopolysaccharide (Endo et al. 2006) (Endo et al. 2005) induce ER stress
leading to expression of acute response proteins. ER stress is also related to some

autoimmune diseases, such as rheumatoid arthritis (Purcell et al. 2003), autoimmune

107

myositis (Nagaraju et al. 2005) and collagen-induced arthritis (Gao et al. 2008).

BiP (immunoglobulin binding protein, also known as glucose-regulated protein
78/GRP 78) is the one of the most characterized ER chaperones. BiP serves as a master
regulator in ER stress response and plays a key role in activating ER stress effectors that
consist of activating transcription factor 6 (ATF6), the inositol requiring kinase la
(IREl or), and double-stranded RNA-activated protein kinase (PKR)-like endoplasmic
reticulum kinase (PERK). IREla can activated transcription factor X-box binding protein
(XBPl) (Zhang and Kaufman 2006) (Ni and Lee 2007) (Schroder and Kaufman 2005).

We have previously shown that the transcription factor cAMP response element-
binding protein (CREB) promotes IL-6 mRNA transcription by binding to cAMP
response element (CRE) (Jia et al. 2006) (Shi and Pestka 2006). Both ATF6 and XBPl
are transcription factors belonging to CREB/ATF family and could regulate gene
expression by binding to CRE (Hai and Hartman 2001) (Kanemoto et al. 2005) (Schroder
and Kaufman 2005). Treatment to the EL-4 thymoma cell line with DON decreases BiP
mRNA and protein (Yang et al. 2000). The downregulation of BiP could adversely affect
protein folding and modification, thus lead to the ER stress-like response, which could
predominantly activate XBPl and ATF6. XBPl and ATF6 might thus play important roles
in the DON-induced upregulation of interleukin-6.

The purpose of our research was to test the hypothesis that BiP dysregulation was

a modulator in DON-induced IL-6 upregulation in the macrophage.

108

MATERIALS AND METHODS

Materials. All chemicals including DON and cell culture components were
purchased from Sigma-Aldrich, Inc. (St. Louis, MO) unless otherwise noted. DON
contaminated labware and cell culture media were detoxifled by sodium hypochlorite. All
inhibitors were purchased from Calbiochem, Inc. (San Diego, CA).

Animals and diet. Female B6C3F1 mice (7-wk old) weighing around 25 g were
obtained from Charles River Laboratories, Inc (Wilmington, MA). Housing, handling,
and sample collection procedures conformed to the policies of the Michigan State
University All-University Committee on Animal Use and Care in accordance with NIH
guidelines. Mice were provided free access to food and water.

Peritoneal macrophage cultures. Mice were injected ip with 1.5 ml of sterile 3%
(w/v) thioglycollate broth. After 3 (1, mice were euthanized and macrophages collected by
peritoneal lavage with ice-'cold Hank's BSS (Invitrogen Corporation, Carlsbad, CA).
Cells were pelleted by centrifugation at 1,100 X g for 5 min, washed with BSS once and
resuspended in RPMI-1640 containing 10% (v/v) heat-inactivated fetal bovine serum

(Atlanta Biologicals, Norcross, GA), 100 U/ml penicillin, and 100 ug/ml streptomycin.

These cells were cultured at 37°C under 6% C02 in a humidified incubator for 24 h

before treatment.

Macrophages were incubated with or without DON' for various time periods and
analyzed for mRNA expression by real-time PCR or protein amount by Western blot
analysis. DON was dissolved in PBS first to make a 500 ug/ml stock solution and then

added to cell culture media to generate different working concentration. Two milliliters of

109

cell suspension (1 X 106 /ml) were incubated in each well of 6-we11 cell culture plates

(Corning Life Sciences, Lowell, MA) for experiments requiring RNA isolation. For

protein collection, 10 ml cell suspensions (1 X 106 /ml) were incubated in 100 mm-

diameter cell culture dishes (Corning Life Sciences).

Western blot analysis. For protein detection studies, macrophages were lysed in
Tris buffer (10 mM, pH 7.4) containing 2% (w/v) SDS, protease inhibitor cocktail (Roche
Diagnostics, Indianapolis, IN) and phosphatase inhibitor cocktail (Santa Cruz
Biotechnology, Inc., Santa Cruz, CA), heated to 100 °C for 5 min and sonicated. After
centrifugation at 18,000 X g for 15 min, supernatants were subjected to Western analysis
using specific antibodies to BiP or IREla (rabbit anti-mouse antibody, Cell Signaling
Technology, Inc., Danvers, MA), XBPl, ATP 6 (rabbit anti-mouse antibody, Santa Cruz
Biotechnology, Inc.) and B—actin (mouse anti-mouse, antibody, Sigma-Aldrich). Alexa
Fluor 680 goat-anti rabbit and IRDye® 800 goat-anti mouse secondary antibodies were
purchased from Invitrogen Corporation and Rockland Immunochemicals, Inc.
(Gilbertsville, PA) respectively. Infrared fluorescence was directly detected by using an
Odyssey Infrared Imaging System (Li-Cor Biosciences, Lincoln, NE).

Real-time PCR. Total RNA of peritoneal macrophages was extracted using
RNeasy Mini (Promega, Madison, WI) and analyzed by real-time PCR for mRNA
expression. TaqMan primers and probes for IL-6 mRNA were purchased from Applied
Biosystems (Foster City, CA). The primer sequence for unspliced (u) and spliced XBPl
(s) were designed as follows: (forward) 5’- tgg ccg ggt ctg ctg agt ccg-3’ (u), 5’-ctg agt

ccg cag cag gtg cag -3’ (3); (reverse) 5’-gtc cat ggg aag atg ttc tgg-3’ (u and s). SYBER

.110

Green PCR Master Mix (Applied BiosyStems) was used for real time PCR to detect
unspliced and spliced XBPl mRNA. Beta-2 microglobulin RNA expression was not
affected by DON treatment and thus was used as endogenous cOntrol to normalize target
gene expression. Target gene expression levels were calculated relative to the control
group.

siRNA transfection. siRNA cocktail targeting mouse BiP, XBPl, ATF6 or a
comparable scrambled siRNA were purchased from Dharmacon (Lafayette, CO). siRNA

transfection was performed by electroporation using an Amaxa Nucleofector (Amaxa Inc.,

Gaithersburg, MD). Briefly, 2 X 106 cells were suspended in 100 III electroporation buffer

(Amaxa Inc.) and mixed with 10 pM siRNA. Electroporation was performed using
program D032 for macrophages according to the manufacturer’s protocol. Transfection
efficacy was verified by assessing loss of BiP, XBPl or ATP 6 protein by Western blot 48
h after transfection. IL-6 expression induced by DON after transfection was analyzed by
real-time PCR.

Statistics. All data were analyzed with SigmaStat v 3.1 (Jandel Scientific, San
Rafael, CA) with the criterion for significance set at p<0.05. Student’s t-test was used for
comparison of two groups of data; and one-way ANOVA was performed for comparison
of multiple groups. Holm-Sidak (if normality test passed) or Dunn (ANOVA on ranks if

normality test failed) tests were used as post-hoc analysis.

111

RESULTS
The effects of incubating peritoneal macrophages with DON (500 ng/ml) on BiP
protein was assessed (Figure 4.1A). As compared with vehicle treatment, BiP was
markedly decreased with 60-min DON treatment and no longer detectable after 6 h. The
effects of different DON concentrations on BiP degradation were determined (Figure
4.18). As little as 100 ng/ml DON decreased BiP protein dramatically at 3- and 6-h
treatment, DON at 500 ng/ml caused marked reduction of BiP after 3 h. Based on these

data, a concentration of 500 ng/ml was used in the following studies.

To determine if the DON-induced decrease in BiP was due to downregulated BiP
gene expression, the effects of DON on BiP protein and mRNA in peritoneal
macrophages were compared (Figure 4.2). BiP mRNA was not affected upon 12-h
incubation'whereas BiP protein was~ undetectable at 6 and '12 h. From these data we

concluded that decreased BiP protein amount was not related to BiP gene expression.

Specific inhibitors were used to ascertain whether DON-induced BiP" degradation
is proteasome-dependent (Figure 4.3A). There was no inhibition by the specific
proteasome inhibitor epoxomicin. However, DON-induced BiP degradation was inhibited
by the inhibitor ALLN which inhibits the activities of both cathepsins and calpains.
Cathepsins and calpains inhibitors were used to confirm these results (Figure 4.3B). Both
cathepsin inhibitor I (CATI-I) and calpain inhibitor III (CALI-III) inhibited DON-induced

BiP degradation.

To detect if DON-induced degradation of the ER chaperone BiP coincided with

ER stress-like response, treated macrophages were analyzed for changes in inositol

112

Figure 4.1. Kinetics of DON-induced BiP decrease in peritoneal macrophages. (A) Time-
course response of DON-induced BiP decrease. Peritoneal macrophages were cultured
with DON (500 ng/ml) for different time periods. Total protein was extracted and BiP
was analyzed by Western Blot. (B) Dose-course response of DON-induced BiP
degradation. Peritoneal macrophages were cultured with DON (0, 100, 250, 500, 1000 or
2000 ng/ml) for 3 or 6 h. Total protein was extracted and BiP was analyzed by Western
Blot. RI indicates relative intensity which is the percentage of the maximal fluorescence
in the same lane.

113

 

Doom 000—. com 0mm 00—. OOON 000—. com 0mm 00—.

o €85 zoo

 

 

cm cm

 

 

o 3.5 05:

 

<

114

A

 

Time (h) 0 1 3 6 12
SP

RI (%) 100 36 16 8 7

 

 

—

Relative mRNA 03
.o .3
(111 O

 

 

 

0

Figure 4.2. DON treatment does not change BiP gene expression in
peritoneal macrophages. Peritoneal macrophages were treated with DON
(SOOng/ml) for 0, 1, 3, 6, or 12 h. Bil? protein was detected by Western
Blot. RI indicates relative intensity which is the percentage of the maximal
fluorescence in the same lane. Total RNA was collected and BiP mRNA
was analyzed by real-time PCR. Data are means :1: SEM.

115

Figure 4.3. DON-induced BiP degradation is cathepsin/calpain—dependent. (A) Peritoneal
macrophages were incubated with vehicle (DMSO), ALLN or epoxomicin (EPO) for l h,
and DON (SOOng/ml) was added to cell culture media. After 3 h, total protein was
extracted and BiP was analyzed by Western Blot. (B) Peritoneal macrophages were
incubated with inhibitors to cathepsins (CATI-I) (50 nM) or calpains (CALI-III) (25 pM)
for 1 h, and then treated with DON (500 ng/ml) for 3 h. Total protein was extracted and
BiP was analyzed by Western Blot. RI indicates relative intensity which is the percentage
of the maximal fluorescence in the same lanl.

116

 

 

N? 2: : o8 No 5 B E : mm m: mm§rm

 

 

 

 

.Il... n__m
+ - + .. + - + - + .. + - 200
w or m , om $5.0 o\ofio $3525

33 cam :23 24.2 820

117

.vosgqoo m4» 083m

 

mm mm mm mm mm mm mm mm C 3 OS 5 £31
n__m

 

++ - - ++ - - ++ - - zoo

 

 

 

___-_._<o 2.20 :> $2525

118

requiring enzyme (IRE)-la, an ER stress sensor activated upon dissociation from BiP,
and transcription factors XBPl and ATF6 (Figure 4.4A and B). Western analysis revealed
that DON upregulated IRE] 0t , XBPl (54 kDa, spliced mRNA product) and ATF6 (50

kDa, activated form).

Since XBPl mRNA is spliced in response to ER stress, both unspliced and
spliced XBPI mRNA after DON treatment was detected by real-time PCR (Figure 4.5A
and B). Consistent with ER stress response, the spliced but not the unspliced form was

upregulated by DON.

XBPl and/or ATP 6 were knocked down by specific siRNA transfection to
determine if DON-induced IL-6 gene expression is related to ER stress-like response
(Figure 4.6A). The protein level of XBPl and ATF6 was decreased markedly 48 hr after
siRNA transfection compared with negative control. Knockdown of transcription factor
ATF6 decreased DON-induced IL-6 expression, while there was no effect observed with

transcription factor XBPl knockdown (Figure 4.6B).

To further confirm the relationship between DON-induced BiP degradation and
lL-6 gene expression, we knocked down BiP via siRNA transfection (Figure 4.7A). BiP

protein was downregulated 48 h after transfection, which induced IL-6 mRNA expression
(Figure 4.7B).

In order to check if BiP degradation was a general effect induced by different
toxins, peritoneal macrophages were treated with different toxins including roridin A,
satratoxin G, ricin, and T-2 toxin. Tunicamycin is a classic ER stress inducer thus used as

a positive control. BiP protein in macrophages was measured after toxin incubation

119

 

 

 

 

A >
Time (h) o 1 3
IRE-10L
RI (%) 56 79 100
B-actin - 1— -
B
XBP1<54 kDa) _
R1 (%) 64 77 100
ATF6 (50 kDa)

 

Rl(%) 76 89 w 100
B-actin _

   

Figure 4.4. DON treatment upregulates IREla , XBPl and ATF6 in
peritoneal macrophages. Peritoneal macrophages were cultured with
DON (500 ng/ml) for different time periods. Total protein was extracted;
IREla (A), XBPl and ATF6 (B) were analyzed by Western Blot. RI
indicates relative intensity which is the percentage of the maximal
fluorescence in the same lane.

120

E 05$
3 o m P o

A893
6&me E032
fififiugaefi
.sfim n” saga
as s8 .5.“ one
-38 .3 <58
_mmum acumen
EH @8293:
me 83033 Sm
@8355 we? <ZM
anew avenue
was Bahama
He Aasa Asa
zen a? was? . 823w
225 mommnnobma NV
Eggnog £728
mix .8 was?
38% oh .528
:2? mo mafia
@0265 32.585 . . . ...
209 6+ 932m . . m

m 80:35. N

 

 

 

 

 

 

 

121

VNEIUJ Ld8X e"lll‘a‘latl

Figure 4.6. DON-induced IL-6 gene expression is related to ATF6
activation. siRNA specific to ATF6, XBPl or scrambled siRNA
was transfected by electroporation into peritoneal macrophages. (A)
To evaluate ATF6 and XBPl knockdown efficiency, total protein
was collected after 48 h. ATF6 and XBPl were measured by
Western blot. RI indicates relative intensity which is the percentage
of the maximal fluorescence in the same lane. (B) To detect the role
of ATF6 and XBPl on IL-6 mRNA expression, cells were treated
with DON after transfection with siRNA specific to XBPl (XBP),
ATF6 (ATP) or both (X+A). Total RNA was collected 3 h later and
IL-6 mRNA was analyzed by real-time PCR. Data are means :1:
SEM. Bars with asterisk differ from NG+DON group (p<0.05).

122

A

RI (%) 100 RI (%)
siRNA

1011M NC ATF6

B

mil

100 42

NC XBP-1

 

A _x
O N
g

m
I

h
l

lL-6 mRNA Expression
N 0')

 

       

0 -
siRNA NG XBP ATF X+A NG
DON - - - - +

123

 

 

XBP ATF X+A
+ + +

A
Bip —

RI (%) 100 46

 

 

 

 

 

 

 

siRNA .
1 OuM NC Blp
B
C 100
.9
g .
Q) 80 l
a *
X
L“ 60 -
<
z
m 40 -
E
(D 20 -
__1.
0 III-
siRNA NG Bip

Figure 4.7. Bip knockdown induces IL-6 gene expression. siRNA
specific to mouse Bip or scrambled siRNA was transfected by
electroporation into peritoneal macrophages. (A) To evaluate
knockdown efficiency, total protein was collected after 48 h. Bip were
measured by Western blot. RI indicates relative intensity which is the
percentage of the maximal fluoresCence in the same lane. (B) To detect
the correlation of Bip knockdown and IL-6 gene expression, total RNA
was extracted and IL-6 mRNA was analyzed by real-time PCR. Data are
means :1: SEM. Bar with asterisk differs statistically from NG group
(p<0.05).

124

(Figure 4.8). As a positive control, tunicarnycin upregulated BiP dramatically at 6 h;
while all the toxin treatments induced BiP degradation at 3 and 6 h. This observation may

give some insight into the mechanisms by which these toxins function inside the cells.

125 .

.95 08% 05 E 858896. 38:88
05 mo owned—889 05 mm £033 baa—85 9632 33065 a .85 838.3 3 @8388 33 £8on
am a e s m 5 5x9 3 Es Soc 6% e masses .9»: < 5:8 .93: 3%;an .28
at.» @835 203 mowmnmeoaa Hangman .2389 Event? .3 @0263 mm coumwfiwoc Adm .wé earn

cm

 

 

 

m m a m m mm m 8 om OS 83?. cm

 

 

.53: .5? =58 .53: .531 .53:

cozmbcoocoo
8 cm m P 2 m S 2 8m

3 52. em <m BE 28 855 . 5x0...

126

DISCUSSION

The classical ER stress response is evoked by accumulation and aggregation of
nascent, unfolded or misfolded polypeptides in the ER. In order to maintain ER
homeostasis, the cells initiate a process that includes (1) transient attenuation of protein
translation, (2) ER-associated degradation (BRAD) of malfolded proteins and (3) the
induction of molecular chaperones and folding enzymes to augment the ER’s capacity for
protein folding and degradation. If the stress cannot be relieved, apoptotic pathways
might be activated in the damaged cells (Ma and Hendershot 2001).

BiP is an ER chaperone and belongs to the heat shock protein 70 family which
serves as a master regulator of ER stress response (Zhang and Kaufman 2006). By
recognizing and binding to the hydrophobic domains of unfolded proteins, BiP stabilizes
unfolded proteins for further modification. BiP also interacts directly with ER stress
sensors such as ATF6 and IREl a to maintain them in inactive forms. When unfolded
proteins accumulate in the ER lumen, BiP is titrated away and thus releasing ATF6 and
IRE] 0L (Kaufman 1999) (Zhang et al. 2006) (Zhang and Kaufinan 2006). ATF6 can
migrate from 13R to the Golgi where it is cleaved (from 90 kDa to 50 kDa) by two
proteases, SIP and SZP to become an active transcription factor (Shen et al. 2002).
Activated IREl at has RNase activity enabling it to cleave XBP] mRNA and generate
spliced XBPl. The resultant gene product is another active transcription factor that can
contribute to ER stress-related gene expression (Ron and Hubbard 2008).

The results presented herein indicate that DON induces BiP degradation in the

peritoneal macrophages and consequently, IREl a and ATF6 were released and activated.

127

Another ER stress sensor, PERK was not detectable in our study. Upregulation of the ER
stress sensors and transcription factors. after DON treatment suggests an ER stress-like
response. Downregulation of BiP has also been seen in the leukemia cells treated with a
multikinase inhibitor (Rahmani et al. 2007), kidney Vero cells treated with subtilase
cytotoxin (SubAB) (produced by Shiga-toxin producing E. coli (Morinaga et al. 2008)
and tumor cells treated with deoxyverrucosidin (produced by Penicillium sp.) and
prunustatin A (produced by Streptomyces sp.) (Choo et al. 2005) (Umeda et al. 2005).

A question relates to how BiP is degraded after DON treatment. Eukaryotic cells
have two major pathways for protein degradation, the. ubiquitin-proteasome and
autophagy-lysosomal pathways (Cecarini et al. 2007) (Yorimitsu and Klionsky 2005).
Protein ubiquitination and proteasome-mediated protein degradation is an important
pathway responsible for misfolded and short-lived intracellular protein (Guerrero et al.
2006) (Rubinsztein 2006). The 268 proteasome is a 2.5 MDa complex composed of two
multisubunit subcomplexes: one is a 208 core particle and the other a 198 regulatory
particle (Demartino and Gillette 2007). The core particle is characterized by three
proteolytic activities: chymotrypsin-like, trypsin-like and peptidylglutamyl peptide-
hydrolyzing activities (Cuervo and Dice 1998). Another process named autophagy is also
an important mechanism for the degradation of cytoplasmic components, from single
macromolecules (proteins, lipids and nucleic acids) to whole organelles (Yorimitsu and
Klionsky 2005). Once inside the lysosomal system, substrates are degraded by a mixture
of more than 80 types of proteases, peptidases and other hydrolases, which are all called

cathepsins(Grinyer et al. 2007) (Cecarini et al. 2007) (Cuervo and Dice 1998). Calpains

2+ . . .
are a family of Ca -regulated cysteine proteases that mediate cleavage of specrfic

128

substrates involved in cell differentiation, life and death (Demarchi and Schneider 2007).
The proteins cleaved by calpains include cytoskeletal and associated proteins, kinases and
phosphatases, membrane receptors and transporters, etc. Activated calpains can also
compromise the integrity of lysosomal membranes and liberate cathepsins from
lysosomes (Yamashima 2004)

Specific inhibitors were used here to study the mechanisms by which BiP was
degraded upon DON treatment. Epoxomicin is a potent, highly specific and irreversible
inhibitor of chymotrypsin-like, trypsin-like and peptidylglutamyl peptide hydrolyzing
activities of the proteasome. ALLN is an inhibitor of cathepsins, calpains and at higher
concentration proteasome. Epoxomicin did not affect DON-induced degradation of BiP;
while ALLN almost abolished these effects completely. In order to specify the results, we
used inhibitors to cathepsins and calpains. The results showed DON-induced BiP
degradation was cathepsin/calpain dependent. So the lysosomal pathway might be
important in this BiP degradation.

_ ER stress response has been shown to be involved in many immune processes.
For example, activation of XBPl and ATF6 is required for B lymphocytes differentiation
into plasma cells and antibody production (Iwakoshi et al. 2003b) (Gass et al. 2002). BR
stress response can also activates transcription factor NF-IcB and cyclic AMP response
element binding protein H (CREBH) which drives expression of inflammatory genes
such as TNF-a, C-reactive protein and COX-2. (Deng et al. 2004) (Hung et al. 2004)
(Hu et al. 2006) (Zhang et al. 2006). Transcription factor XBP] has also been shown to
be upstream of IL-6 gene expression (Iwakoshi et al. 2003b). In our study, we observed

that another ER stress activated transcription factor ATF6 might be upstream of IL-6

129

expression (Figure 4.9). Our results also showed that BiP knockdown directly induced
IL-6 upregulation, which confirms that BiP degradation induced PER Stress-like response
is related to IL-6 gene expression.

Based on these data, we conclude that DON induces ER stress-like response by
degrading ER chaperone BiP. Cathepsins and calpains are involved in the BiP
degradation. ER stress-like response is probably involved in DON-induced IL-6

expression in the peritoneal macrophage.

130

DON
\ 1F— cathepsin/ calpain inhibitors

1 Bip
1

ER stress-like response

/\

T lRE1oc TATFG
i ll— ATF6 siRNA

BiP siRNA

TXBP1 T lL-6 gene expression

1

Tgene expression of
chaperones, enzymes

Figure 4.9. Summary of DON-induced ER stress-like response and IL-
6 gene expression.

131

CHAPTER 5

Summary and Perspectives

132

Clinical trials have shown that progression-of human IgAN is inhibited by dietary
n-3 PUFA supplementation. The early stages of IgAN can be mimicked by feeding
B6C3Fl female mice the mycotoxin DON. Therefore, we used this animal model to
study the mechanisms by which n-3 PUFA suppressed the pathogenesis of IgAN.

Consumption of 20 ppm DON significantly increased mouse serum IgA, IgA
immune complexes and kidney mesangial IgA deposition compared with mice taking
control diet. Effects of EPA on DON-induced IgAN were assessed relative to dose
dependency. Mice were fed control diet or diets with 20 ppm DON supplemented with
0%, 0.1%, 0.5% and 3% EPA for 16 weeks. The two highest EPA concentrations
markedly increased splenic EPA, docosapentaenoic acid (DPA) and DHA, whereas
arachidonic acid was decreased in all three EPA fed groups. All three IgAN markers were
attenuated in mice fed 3% EPA diet but not in those fed 0.1% or 0.5% EPA. Elevated IgA
production induced by DON in spleen and Peyer’s patch (PP) cell cultures was reduced
by feeding 0.1%, 0.5% and 3% EPA. Increased expression of IL-6 in serum, spleen and
PP were also suppressed in mice consuming 3% EPA. Suppressed IL-6 corresponded to
decreased binding activity of two transcription factors CREB and AP-l. The results
suggest that the n-3 PUFA EPA consumption could impair pathogenesis of IgAN by
suppressing IL-6 gene expression.

In the next study, we identified part of the signal transduction pathway through
which DON upregulated IL-6 in peritoneal macrophages and investigated how
consumption of DHA, suppressed this pathway. Incubation with DON induced 11,-6 gene

expression in peritoneal macrophages. Knockdown of the transcription factor CREB or

133

pharmacologic inhibition of the CREB kinases, Aktl/2, MSKl and RSKl, downregulated
IL-6 expression. Inhibition of PKR suppressed not only IL-6 expression but also
phosphorylation of CREB and its upstream kinases. Phosphorylation of PKR, CREB
kinases and CREB was markedly impaired in peritoneal macrophages isolated from mice
that consumed DHA-enriched fish oil for 6 to 8 wk. DHA’s effects were not explainable
by increased activity of protein phosphatase 1 and 2A since both were suppressed in mice
consuming the DHA diet. We concluded from these data that DON-induced IL-6
expression is CREB-mediated and PKR-dependent and the requisite kinase activities for
this pathway were suppressed in macrophages from mice fed DHA.

The third investigation in my research was to explore a possibly alternative
pathway of DON-induced IL-6 geneupregulation. The ER chaperone BiP was markedly
decreased in peritoneal macrophages following incubation with DON. However, BiP

mRNA was not changed. Inhibitor studies showed that DON-induced BiP degradation
V was cathepsin- and calpain-dependent. BiP degradation caused ER stress-like response
that includes increased IREla, XBPl and ATF6 protein as well as XBPl mRNA
splicing. Knockdown of ATF6 partially decreased DON-induced IL-6 expression, while
knockdown of BiP itself increased IL-6 mRN A expression in peritoneal macrophages.
These data suggest that DON treatment decreases BiP protein and evokes ER stress-like
response. Furthermore, transcription factor ATF6 activation as a result of ER stress-like
response is likely to contribute to DON-induced IL-6 gene expression. Consumption of
DHA-enriched fish oil did not affect DON-induced BiP degradation, suggesting that n-3

PUFAS do not affect the DON-induced ER stress-like response.

134

Taken together, these studies indicate that n-3 PUFAS have beneficial effects on

DON-induced IgAN. The data also give an insight into the mechanisms by which n-3

PUFAS suppress IL-6 gene expression. A summary of the proposed mechanisms by

which n-3 PUFAS inhibit DON-induCed IL-6 gene expression and IgAN in the mouse

model is shown in Figure 5.1. Since DON-induced IL-6 gene expression may involve

multiple pathways, further study is needed to determine how these pathways interact with

each other.

The following experiments are suggested for future study:

1.

J

Detect the populations of different macrophage phenotypes from mice fed
control or n—3 PUFA-supplemented diet. (Markers for inflammatory

phenotype in the mouse may include CCR2, CD62L [also known as L-

selectin] and CX3C-chemokine receptor 1 [CX3CR1]). Since n—3 PUFA

consumption might change the phenotypes of macrophages and thus
render them less proinflammatory or even anti-inflammatory, measuring
their presence will provide insight into how long-term n-3 PUFA feeding
modulates the immune system.

Analyze resolvins and protectins in different tissues. Resolvins and
protectins are potent anti-inflammatory mediators that are upregulated by
n-3 PUFA consumption and may be important for the anti-inflammatory
effects provided by long-term n-3 PUFA consumption. Analysis of
resolvins and protectins in the whole blood and different tissues in mice

fed the n-3 PUFA supplemented diet and of the effects of treatment with

135

resolvins and protectins on IL-6 expression will help determine whether
this is another n-3 suppression of DON-induced inflammation.

. Measure fatty acid composition of different organelles inside the cell.
Fatty acids are important building blocks of cell membranous structures.
The changes of fatty acid components will affect the functions of
membrane-associated proteins and signal transductions in the cell.
Detection of fatty acid composition of different membranous organelles,
such as the endoplasmic reticulum, Golgi complex, mitochondria and
lysosomes from mice fed control or n-3 PUFA supplemented diet will
give important clues to relate the structural changes to the functional
changes in the immune cells.

. Relate DON-induced ribotoxic stress to the ER stress-like response. DON
is a trichothecene mycotoxin that acts by inducing the ribotoxic stress in
the cell and it also evokes ER stress-like response. Since ribosomes and
the ER are structural- and functional- related organelles inside the cell, it
will be important to relate ribotoxic stress to the ER stress-like response

for better understanding the mechanisms of DON’s function.

136

DON °

/\
I \
I \

u” \‘n
*PlKR i Blip
*CREB
Kinase ER stress-
activation "k9 response

l

  

CREB

 

 

*p-CREB __ ATF6 —>

*lL-6 gene -------- Macrophages

expression

*lgA production --------- B-cells
*lgAN ------------- mouse

Figure 5.1. Summary of mechanisms by which DON induces IL-6 gene
expression and IgAN. Asterisks indicate steps at which n-3 PUFAS cause
suppression.

137

Appendix A

138

Effects of n-3 PUFA a-linolenic acid on DON-induced IgAN

The n-3 PUFA, ALA, is an essential fatty acid for humans and is derived mainly
from terrestrial plant consumption. It is the principal precursor for EPA and DHA. In
human and animal studies, ALA was shown to be as beneficial to cardiovascular health as
EPA and DHA from marine and fish oils (Lanzmann-Petithory 2001). In respect of
attenuating inflammation, ALA showed conflicting results in publications (Marion-
Letellier et al. 2008) (Nelson et al. 2007) (Yoneyama et al. 2007) (Ren and Chung 2007)
(Calder 2006a). Furthermore, the potential effects of ALA on IgAN remain unknown.

Here, we conducted an experiment using diet supplemented with different
concentrations of flaxseed oil that contains high ALA to study the effects of ALA on
DON-induced IgAN. Corn oil, oleic acid, and flaxseed oil containing 570 g/kg ALA
(Dyets) were used to modify the AIN93G basal diet to yield 4 diet groups (n = 10):
control, control + DON (0.020 g/kg), 30 g/kg flaxseed oil + DON and 60 g/kg flaxseed
oil + DON (0.020 g/kg) (Table AA.1). Approximate fatty acid compositions of the
experimental diets are shown in Table AA.2. Diets were prepared every 2 wk, stored in
aliquots at —20°C, and provided fresh to female B6C3F1 mice each day. Mice were
housed 2—3 per cage and fed the diet for 18 wk. Mice were bled every 4 wk and serum
IgA was analyzed by ELISA.

DON significantly increased serum IgA beginning at 8 wk until 16 wk (Figure
AA.1). However, diets containing 30 or 60 g/kg flaxseed oil did not affect the elevation in
serum IgA. Because of this lack of effect, firrther analyses of downstream effects (IgA-1C
and mesangial IgA elevation) were not conducted. These data suggest that ALA did not

reduce the aberrant IgA production induced by DON in mice. Among the n-3 PUFAS,

139

.zfia 883

.209 no Eon 6820575 .«o abate ofi wfimmomma new 638 we asp—w EnoEtomxm ._.<< flash

 

. ZOQ + :0 Banana $0

 

 

9m; em on o 2 mod 2
w fig 2 am cm 3 mod 2 ZOO + no 33.5w: RR
:2 ed o co 2 mod 3 209 + 3580
fig ed o ow S o 2 75:00
3%
6:8 mane: : E55
m: :33. =0 33er Bow 265 :0 500 209

 

140

 

Com oil and

3% flaxseed oil

6% flaxseed oil

 

oleic acid
g/ 100g total fat
Type of fat
Saturated 0.6 0.63 0.66
Monounsaturated 5.24 3 .29 1 .34
Polyunsaturated 0.85 2.92 5
Total fat 7 7 7
g/ 100g fatty acids
Fatty acid
C16:0 4.6 5.1 5.7
CI 8:0 4.0 3.8 3.7
C1811 74.9 47 19.1
C18:2 (n6) 11.9 17.2 22.5
C1823 (n3) 0.26 24.6 49.0 '
C2025 (n3) 0 0 0
C22:6 (n3) . O 0 0
2 n3 0.26 24.6 49.0
22 n6 11.9 17.2 22.5
n6:n3 46:1 1:14 1:22

 

Only the major fatty acids are shown.

Table AA.2. Fatty acid composition of different diets for assessing the

effects of oc-linolenic acid on DON-indUced IgAN.

141

.36 V R comic BE: :0888 a 5923 £802 .2 n : .SEm H memos:
one 323/ .028 M mmoom E cargo—o <3 Baum 60265-20Q no acumen—mace =0 3038c mo floobm 44¢ 0.39m

25 as:

3. NF

 

 

 

 

 

N

 

 

 

 

(115‘) VBI

 

200+ =0 33.8: 9.3 on H”.
20.9.... Sofia: 9.3 8 a
200....ch I

.228 nHIIU

 

 

 

142

EPA and DHA are more biologically potent than ALA in preventing experimental IgAN.

143

Appendix B

144

Protein kinase C and DON-induced IL-6 upregulation

Protein kinase C (PKC) is a family of protein kinases that are expressed broadly
and regulate various cellular functions. They have been shown to be mediators of
different immune responses such’as signal transductions initiated by T-cell receptor and
B-cell receptor activation (Hayashi and Altman 2007) (Saijo et al. 2003). PKC family has
at least ten isoenzymes and these isoenzymes might have distinct roles in the immune
system (Tan and Parker 2003).

DON treatment induced multiple protein kinase activation. Protein kinase Aktl,
MSKl and RSK] belong to the protein kinase AGC family. In this experiment, we
studied if DHA consumption suppresses PKC (an important member of AGC family)
activation and if PKC is involved in DON-induced IL-6 gene expression.

Peritoneal macrophages from mice fed control or 3% DHA diet for 6-8 wk were
treated with DON (250 ng/ml) for indicated time points and cell lysates were subjected to
Western blotting. (Figure AB.1) DON treatment induced very weak phosphorylation of
PKC isoenzymes, DHA consumption inhibited the induction.

In order to test if PKC is involved in DON-induced IL-6 gene expression,
peritoneal macrophages were treated with 10 uM PKC inhibitor (PKC inhibitor Peptide
19-36) (Calbiochem) for 30 min. Then 250 ng/ml DON was added to cell cultures. Total
RNA was extracted for IL-6 expression 3 h later. Figure AB. 2 showed that PKC inhibitor

did not inhibit IL-6 gene expression upon DON stimulation.

145

.qofiboflmofi Ova 883-28 8 SE he 98% ._.m< 03E

 

om om m P m _. o o 200
+ - + - + - (In.
moEo FEE.
monEmfiEN
m 5.5% :5.
3%.: 2m
5 950m won
825 wmmhfi. mvtSfiE... 22
305 98
28$ 85.:
SEEEERV women... EEO
mvohmw mama

 

885m ...smmv
can

 

146

30

 

25-

20-

151

10-

IL-6 EXPRESSION

 

 

 

VH VH+DON PKC I PKCI+DON

Figure AB. 2. Effects of PKC inhibitor on DON-induced IL-6 gene
expression.

147

Appendix C

148

Role of interleukin-10 in DON-induced protein phosphorylation

Interleukin-10 (IL-10) is a pleiotropic cytokine produced by a variety of cells
such as T cells, B cells, monocytes, and macrophages (Moore et al. 2001). IL-10 has been
shown to strongly decrease the production of not only inflammatory cytokines such as
IL-6, IL-1, IL-8, TNF-a but also reactive oxygen and nitrogen species from macrophages
(Adorini 2003).

Clinical trials showed IL-10 could be beneficial to treat some autoimmune
diseases such as rheumatoid arthritis (Maini and Taylor 2000), Crohn’s disease (van
Deventer et al. 1997), and psoriasis (Adorini 2003). In research conducted by Matsumoto
et al., human recombinant IL-lO inhibited the spontaneous as well as the LPS-stimulated
cytokine secretion from peripheral blood monocytes in patients with IgAN (Matsumoto
1996)

Since IL-10 is important for inflammation regulation, we used protein
phosphorylation as a marker to study if knockout of IL-1.0 will affect DON-induced
macrophage activation and if DHA consumption will affect the results.

Peritoneal macrophages from wild type or IL-10 KO mice fed control or DHA
diet were taken and treated with DON (250 ng/ml). Total protein was subjected to
Western blot analysis. As shown in figure AC.1, IL-10 KO increased both total and
phosphorylated CREB and Aktl. DHA diet attenuated protein phosphorylation in

macrophages from both wild type and IL-10 KO mice.

149

.m3 3 82833 use 853 :8 .332. as: cases é can: as zoo a?
Beach 203 98 30.6 En— Ho 35:8 tom 028 Set :33 can? mowmnmeoafi Houston .mowgaeoma

E nose—bonamonn £88m woos—ETZOD :o corms—3:8 5.5 28 CM 2%: mo 38km . _ .U< onE
Ox ._.>> 0v. ._.>> 0v. .ES .

 

 

 

 

 

 

 

 

cm 8 0 3:5 mEfi

150

Appendix D

151

Effects of DON on IgA glycosylation

As mentioned in the literature review, IgA hypoglycosylation might be involved
in the pathogenesis of IgAN. ER is an important organelle for protein modification
including glycosylation. DON induces chaperone BiP degradation, which might affect
IgA glycosylation and result in IgAN in the mouse model.

To test the glycosylation of IgA affected by DON, we conducted an 8-wk feeding
study. Female B6C3F1 mice were fed diet supplemented with 20 ppm DON. Serum IgA
and its hypoglycosylated form were detected by ELISA.

The results showed that DON consumption upregulated IgA in the serum.
Hypoglycosylated IgA was also increased by DON treatment (Figure ADJ). The higher

hypoglycosylated IgA level might be a risk factor for the pathogenesis of IgAN.

152

 

<3 unanimoobmomh: end <3 gum no acumen—mace ZOO mo 38km 4.9.x earn

200 x26

02 x26

 

 

 

<9 333.836on

cod
mod
9.0
m v.0
owd
mNd
end
and

C10

 

200x26 ism ZOD§<x3¢ ZODxBN in

..1:

.325:-

'. ~#
":15 ..x
0".

"(re , ".1

I 3m._ I:.

.a: . :-- .-

.- . 1— ,L_ .
,. .. .
v».

1:.
. I

 

H...

 

 

 

 

 

 

od

. Pd

- Nd

CJO

. md

. v.0

. md

 

 

823 $39: 5 <9

$6

153

Method to detect serum hypoglycosylated IgA

Reagents
l. Carbonate Coating Buffer
Na2C03 1.59g
NaHCO3 2.93 g
dd-HzO lOOOml
pH = 9.6
2. Dilution buffer: 1% BSA-PBS
3. Phosphate Buffered Saline (PBS)
NaH2P04 6.62g
Na2HP04 49.98g
NaCl 11.80g
dd-HZO 4.0L
pH = 7.5
4. PBS Tween 0.02%
I To 4.0L PBS add 0.8m] of Tween-20
5. 0.01 M sodium acetate buffer, PH = 5.
6. Substrate: TMB substrate

7. Stopping reagent: 2N H2804

Procedure:

1. Coat goat anti-mouse IgA onto plate with SOul solution of protein in coating

buffer. For affinity purified anti IgA use 1:1000 (l ug/ml).

154

10.

ll.

12.

13.

14.

15.

l6.

l7.

l8.

10ml carbonate buffer + lOul anti-mouse IgA=1 plate

Cover plate with parafilm and aluminum foil to prevent evaporation and store
overnight at 37 oC.

Wash plate 3 times with PBS-Tween using plate washer.

Block all wells with 1% BSA-PBS; add 300 pl/well and incubate 2 h at 37 °C;
this binds nonspecific sites in well.

Wash plate 5 times as before.

Add sample.

Wrap in aluminum foil and incubate overnight at 4 °C; seal tightly.

Wash Stimes as before.

Add 50 pl 1011M neuraminidase in sodium acetate buffer and incubate for 3 h at
37 °C.

AddXSOul of a 1/500 solution of HAA-HRP and incubate for 3 h at 37C.

Wash 6 times with PBST.

Then wash with distilled water twice to clean plate.

Add TMB substrate at IOOul/well.

Wrap in aluminum foil to protect substrate from light.

Develop color at RT for about 30 to 60 min.

Stop with 100 ill/well of stopping reagent.

Read on ELISA reader at 450nm.

Calculate using SOFTMAX computer program.

155

Appendix E

156

Effect of DHA on BiP degradation

DHA has been shown to inhibit DON-induced signal pathways involved in IL-6
gene expression in peritoneal macrophages. We found that DON treatment induced BiP
degradation which was also related to IL-6 gene expression. Here, we investigated if
DHA consumption could affect BiP degradation and result in suppressed gene expression.

Peritoneal macrophages taken from B6C3Fl female mice fed 8-wk control or
DHA diet were treated with DON (500 ng/ml) for indicated period (Figure AE.1). DON
treatment induced BiP degradation, while there was no difference between control and
DHA group.

Based on these data, we conclude that although BiP degradation is involved in
DON-induced lL-6 gene expression, DHA feeding might not suppress IL-6 by affecting

this pathway.

157

.aoumufiwou .wm coostAAOQ no SEES—mace 3.5 we Hoobm .33. oEwE

 

 

158

Reference List

159

10.

11.

. Adorini, L. (2003). Cytokine-based immunointervention in the treatment of

autoimmune diseases. Clin. Exp. Immunol. 132(2), 185-192.

Adya, R., Tan, B. K., Punn, A., Chen, J., and Randeva, H. S. (2008). Visfatin
induces human endothelial VEGF and MMP-2/9 production via MAPK and
PIBK/Akt signalling pathways: novel insights into Visfatin-induced angiogenesis.
Cardiovasc. Res. 78(2), 356-365.

Alberts, A. S., Montminy, M., Shenolikar, S., and Feramisco, J. R. (1994).
Expression of a peptide inhibitor of protein phosphatase 1 increases
phosphorylation and activity of CREB in NIH 3T3 fibroblasts. Mol. Cell Biol.
14(7), 4398-4407.

Allen, A. C., Bailey, E. M., Barratt, J., Buck, K. .S., and Feehally, J. (1999).
Analysis of IgA] O-glycans in IgA nephropathy by fluorophore-assisted
carbohydrate electrophoresis. J. Am. Soc. Nephrol. 10(8), 1763-1771.

Allen, A. C., Harper, S. J., and Feehally, J. (1995). Galactosylation of N- and O-
linked carbohydrate moieties of IgAl and IgG in IgA nephropathy. Clin. Exp.
Immunol. 100(3), 470-474.

Amore, A., Cirina, P, Conti, G., Brusa, P., Peruzzi, L., and Coppo, R. (2001).
Glycosylation of circulating IgA in patients with IgA nephropathy modulates
proliferation and apoptosis of mesangial cells. J. Am. Soc. Nephrol. 12(9), 1862-
1871.

Anand, R. G., Alkadri, M., Lavie, C. J., and Milani, R. V. (2008). The role of fish
oil in arrhythmia prevention. J. Cardiopulm. Rehabil. Prev. 28(2), 92-98.

Ariel, A., and Serhan, C. N. (2007). Resolvins and protectins in the termination
program of acute inflammation. Trends Immunol. 28(4), 176-183.

Arthur, J. S., Fong, A. L., Dwyer, J. M., Davare, M., Reese, E., Obrietan, K., and
Impey, S. (2004). Mitogen- and stress-activated protein kinase 1 mediates cAMP

response element-binding protein phosphorylation and activation by
neurotrophins. J. Neurosci. 24(18), 4324-4332.

Baenziger, J., and Komfeld, S. (1974a). Structure of the carbohydrate units of
IgA] immunoglobulin. 1. Composition, glycopeptide isolation, and structure of
the asparagine-linked oligosaccharide units. J. Biol. Chem. 249(22), 7260-7269.

Baenziger, J ., and Komfeld, S. (1974b). Structure of the carbohydrate units of
IgAl immunoglobulin. 11. Structure of the O-glycosidically linked
oligosaccharide units. J. Biol. Chem. 249(22), 7270-7281.

160

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

Bagheri, N., Chintalacharuvu, S. R., and Emancipator, S. N. (1997).
Proinflammatory cytokines regulate Fc alphaR expression by human mesangial
cells in vitro. Clin. Exp. Immunol. 107(2), 404-409.

Bagli, E., Stefaniotou, M., Morbidelli, L., Ziche, M., Psillas, K., Murphy, C., and
Fotsis, T. (2004). Luteolin inhibits vascular endothelial growth factor-induced
angiogenesis; inhibition of endothelial cell survival and proliferation by targeting
phosphatidylinositol 3'-kinase activity. Cancer Res. 64(21), 7936-7946.

Baharaki, D., Dueymes, M., Perrichot, R., Basset, C., Le Corre, R., Cledes, J ., and
Youinou, P. (1996). Aberrant glycosylation of IgA from patients with IgA
nephropathy. Glycoconj. J. 13(4), 505-511.

Baldwin, A. S., Jr. (1996). The NF-kappa B and I kappa B proteins: new
discoveries and insights. Annu. Rev. Immunol. 14, 649-683.

Barford, D., Das, A. K., and Egloff, M. P. (1998). The structure and mechanism
of protein phosphatases: insights into catalysis and regulation. Annu. Rev.
Biophys. Biomol. Struct. 27, 133-164.

Barratt, J ., and Feehally, J. (2005). IgA nephmpathy. J. Am. Soc. Nephrol. 16(7),
2088-2097.

Barratt, J., and Feehally, J. (2006). Treatment of IgA nephropathy. Kidney Int.
69(11), 1934-1938.

Barratt, J., Feehally, J., and Smith, A. C. (2004). Pathogenesis of IgA
nephropathy. Semin. Nephrol. 24(3), 197-217.

Barratt, J ., Smith, A. C., and Feehally, J. (2007a). The pathogenic role of IgAl O-
linked glycosylation in the pathogenesis of IgA nephropathy. Nephrology.
(Carlton. ) 12(3), 275-284.

Barratt, J ., Smith, A. C., Molyneux, K., and Feehally, J. (2007b).
Immunopathogenesis of IgAN. Semin. Immunopathol. 29(4), 427-443.

Beagley, K. W., Eldridge, J. H., Lee, R, Kiyono, H., Everson, M. P., Koopman,
W. J., Hirano, T., Kishimoto, T., and McGhee, J. R. (1989). Interleukins and IgA
synthesis. Human and murine interleukin 6 induce high rate IgA secretion in IgA-
committed B cells. J. Exp. Med. 169(6), 2133-2148.

Bene, M. C., and Faure, G. (1988). [Nephropathies from mesangial deposits of
IgA: etiopathogenic aspects]. Nephrologie 9(3), 109-115.

Burke, R. E. (2007). Inhibition of mitogen-activated protein kinase and
stimulation of Akt kinase signaling pathways: Two approaches with therapeutic
potential in the treatment of neurodegenerative disease. Pharmacol. Ther. 114(3),
261-277.

161

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

37.

Calder, P. C. (2003). N-3 polyunsaturated fatty acids and inflammation: from
molecular biology to the clinic. Lipids 38(4), 343-352.

Calder, P. C. (2005). Polyunsaturated fatty acids and inflammation. Biochem. Soc.
Trans. 33(Pt 2), 423-427.

Calder, P. C. (2006a). n-3 polyunsaturated fatty acids, inflammation, and
inflammatory diseases. Am. J. Clin. Nutr. 83(6 Suppl), 15058-15198.

Calder, P. C. (2006b). Polyunsaturated fatty acids and inflammation.
Prostaglandins Leukot. Essent. Fatty Acids 75(3), 197-202.

Calder, P. C., Bond, J. A., Harvey, D. J., Gordon, 8., and Newsholme, E. A.
(1990). Uptake and incorporation of saturated and unsaturated fatty acids into
macrophage lipids and their effect upon macrophage adhesion and phagocytosis.
Biochem. J. 269(3), 807-814.

Calder, P. C., and Grimble, R. F. (2002). Polyunsaturated fatty acids,
inflammation and immunity. Eur. J. Clin. Nutr. 56 Suppl 3, 814-819.

Calfon, M., Zeng, H., Urano, F., Till, J. H., Hubbard, S. R.,, Harding, H. P., Clark,
8. G., and Ron, D. (2002). IRE] couples endoplasmic reticulum load to secretory
capacity by processing the XBP-l mRNA. Nature 415(6867), 92-96.

Campbell, L., Jasani, R, Edwards, K., Gumbleton, M., and Griffiths, D. F.
(2008). Combined expression of caveolin-l and an activated AKT/mTOR
pathway predicts reduced disease-free survival in clinically confined renal cell
carcinoma. Br. J. Cancer 98(5), 931-940.

Caravatta, L., Sancilio, 8., di, G., V, Rana, R., Cataldi, A., and Di Pietro, R.
(2008). PI3-K/Akt-dependent activation of cAMP-response element-binding
(CREB) protein in Jurkat T leukemia cells treated with TRAIL. J. Cell Physiol
214(1), 192-200.

Caughey, G. E., Mantzioris, E., Gibson, R. A., Cleland, L. G., and James, M. J.
(1996). The effect on human tumor necrosis factor alpha and interleukin 1 beta
production of diets enriched in n-3 fatty acids from vegetable oil or fish oil. Am. J.
Clin. Nutr. 63(1), 116-122.

Cave, W. T., Jr. (1991). Dietary n-3 (omega-3) polyunsaturated fatty acid effects
on animal tumorigenesis. FASEB J. 5(8), 2160-2166.

Cecan'ni, V., Gee, J., Fioretti, E., Amici, M., Angeletti, M., Eleuteri, A. M., and
Keller, J. N. (2007). Protein oxidation and cellular homeostasis: Emphasis on
metabolism. Biochim. Biophys. Acta 1773(2), 93-104.

Ceulemans, H., and Bollen, M. (2004). Functional diversity of protein
phosphatase-l, a cellular economizer and reset button. Physiol Rev. 84(1), 1-39.

162

38.

39.

40.

41.

42.

43.

45.

46.

47.

48.

Chao, T. K., Rifai, A., Ka, S. M., Yang, S. M., Shui, H. A., Lin, Y. F., Sytwu, H.
K, Lee, W. H., Kung, J. T., and Chen, A. (2006). The endogenous immune
response modulates the course of IgA-immune complex mediated nephropathy.
Kidney Int. 70(2), 283-297.

Chen, W., Jump, D. B., Esselman, W. J., and Busik, J. V. (2007). Inhibition of
cytokine signaling in human retinal endothelial cells through modification of
caveolae/lipid rafis by docosahexaenoic acid. Invest Ophthalmol. Vis. Sci. 48(1),
18-26.

Chepumy, O. G., Hussain, M. A., and Holz, G. G. (2002). Exendin-4 as a
stimulator of rat insulin I gene promoter activity via bZIP/CRE interactions
sensitive to serine/threonine protein kinase inhibitor Ro 31-8220. Endocrinology
143(6), 2303-2313.

Chintalacharuvu, S. R., and Emancipator, S. N. (1997). The glycosylation of IgA
produced by murine B cells is altered by Th2 cytokines. J. Immunol. 159(5),
2327-2333.

Choe, E. S., Parelkar, N. K, Kim, J. Y., Cho, H. W., Kang, H. 8., Mao, L., and
Wang, J. Q. (2004). The protein phosphatase 1/2A inhibitor okadaic acid
increases CREB and Elk-1 phosphorylation and c-fos expression in the rat
striatum in vivo. J. Neurochem. 89(2), 383-390.

Choo, S. J., Park, H. R., Ryoo, I. J., Kim, J. P., Yun, B. 8., Kim, C. J., Shin-ya,
K., and Y00, I. D. (2005). Deoxyverrucosidin, a novel GRP78/BiP down-
regulator, produced by Penicillium sp. J. Antibiot. (Tokyo) 58(3), 210-213.

Choy, E. (2004). Clinical experience with inhibition of interleukin-6. Rheum. Dis.
Clin. North Am. 30(2), 405-15, viii.

Chung, J., Pelech, S. L., and Blenis, J. (1991). Mitogen-activated Swiss mouse
3T3 RSK kinases I and II are related to pp44mpk from sea star oocytes and
participate in the regulation of pp90rsk activity. Proc. Natl. Acad. Sci. U. S. A
88(11), 4981-4985.

Clandinin, M. T., Cheema, 8., Field, C. J., Garg, M. L., Venkatraman, J., and
Clandinin, T. R. (1991). Dietary fat: exogenous determination of membrane
structure and cell function. FASEB J. 5(13), 2761-2769.

Clifford, L. J., Jia, Q., and Pestka, J. J. (2003). An. improved method for the
purification of the trichothecene deoxynivalenol (vomitoxin) from Fusarium
graminearum culture. J. Agric. Food Chem. 51(2), 521-523.

Comerford, K. M., Leonard, M. O., Cummins, E. P., Fitzgerald, K. T., Beullens,
M., Bollen, M., and Taylor, C. T. (2006). Regulation of protein phosphatase
1 gamma activity in hypoxia through increased interaction with NIPPl:
implications for cellular metabolism. J. Cell Physiol 209(1), 211-218.

163

49.

50.

51.

52.

53.

54.

55.

56.

57.

58.

59.

60.

61.

Coppo, R., and Amore, A. (2004). Aberrant glycosylation in IgA nephropathy
(IgAN). Kidney Int. 65(5), 1544-1547.

Creighton, C. J. (2008). Multiple oncogenic pathway signatures show coordinate
expression patterns in human prostate tumors. PLoS. ONE. 3(3), e1 8 16.

Cuervo, A. M, and Dice, J. F. (1998). How do intracellular proteolytic systems
change with age? Front Biosci. 3, d25- d43.

Dash, P. K, Karl, K. A., Colicos, M. A., Prywes, R., and Kandel, E. R. (1991).
cAMP response element-binding protein is activated by Ca2+/calmodulin- as well
as cAMP-dependent protein kinase. Proc. Natl. Acad. Sci. U. S. A 88(11), 5061-
5065.

De Cesare, D., Jacquot, 8., Hanauer, A., and Sassone-Corsi, P. (1998). Rsk-2
activity is necessary for epidermal growth factor-induced phosphorylation of
CREB protein and transcription of c-fos gene. Proc. Natl. Acad. Sci. U. S. A
95(21), 12202-12207.

Demarchi, F., and Schneider, C. (2007). The calpain system as a modulator of
stress/damage response. Cell Cycle 6(2), 136-138.

Demartino, G. N., and Gillette, T. G. (2007). Proteasomes: machines for all
reasons. Cell 129(4), 659-662.

Dendorfer, U. (1996). Molecular biology of cytokinesArtzf Organs 20(5), 437-
444.

Dendorfer, U., Oettgen, P., and Libermann, T. A. (1994). Multiple regulatory
elements in the interleukin-6 gene mediate induction by prostaglandins, cyclic
AMP, and lipopolysaccharide. Mol. Cell Biol. 14(7), 4443-4454.

Deng, J., Lu, P. D., Zhang, Y., Scheuner, D., Kaufman, R. J., Sonenberg, N.,
Harding, H. P., and Ron, D. (2004). Translational repression mediates activation
of nuclear factor kappa B by phosphorylated translation initiation factor 2. Mol.
Cell Biol. 24(23), 10161-10168.

Desnues, B., Ihrig, M., Raoult, D., and Mege, J. L. (2006). Whipple's disease: a
macrophage disease. Clin. Vaccine Immunol. 13(2), 170-178.

Donadio, J. V., Jr., Bergstralh, E. J., Offord, K. P., Spencer, D. C., and Holley, K.
E. (1994). A controlled trial of fish oil in IgA nephropathy. Mayo Nephrology
Collaborative Group. N. Engl. J. Med. 331(18), 1194-1199.

Donadio, J. V., and Grande, J. P. (2002). IgA nephropathy. N. Engl. J. Med.
347(10), 738-748.

164

62.

63.

64.

65.

66.

67.

68.

69.

70.

71.

72.

73.

Donadio, J. V., and Grande, J. P. (2004). The role of fish inomega-3 fatty acids
in the treatment of IgA nephropathy. Semin. Nephrol. 24(3), 225-243.

Donadio, J. V., Jr., Grande, J. P., Bergstralh, E. J ., Dart, R. A., Larson, T. 8., and
Spencer, D. C. (1999). The long-term outcome of patients with IgA nephropathy
treated with fish oil in a controlled trial. Mayo Nephrology Collaborative Group.
J. Am. Soc. Nephrol. 10(8), 1772-1777.

Donadio, J. V., Jr., Larson, T. 8., Bergstralh, E. J., and Grande, J. P. (2001). A
randomized trial of high-dose compared with low-dose omega-3 fatty acids in
severe IgA nephropathy. J. Am. Soc. Nephrol. 12(4), 791-799.

Dong, W., and Pestka, J. J. (1993). Persistent dysregulation of IgA production and
IgA nephropathy in the B6C3F1 mouse following withdrawal of dietary
vomitoxin (deoxynivalenol). Fundam. Appl. T oxicol. 20(1), 38-47.

Dong, W., 8e11, J. E., and Pestka, J. J. (1991). Quantitative assessment of
mesangial immunoglobulin A (IgA) accumulation, elevated circulating IgA
immune complexes, and hematuria during vomitoxin-induced IgA nephropathy.
Fundam. Appl. T oxicol. 17(1), 197-207.

Du, K., and Montminy, M. (1998). CREB is a regulatory target for the protein
kinase Akt/PKB. J. Biol. Chem. 273(49), 32377-32379.

Duplus, E., and Forest, C. (2002). Is there a single mechanism for fatty acid
regulation of gene transcription? Biochem. Pharmacol. 64(5-6), 893-901.

Egashira, Y., Murotani, G., Tanabe, A., Saito, K., Uehara, K., Morise, A., Sato,
M., and Sanada, H. (2004). Differential effects of dietary fatty acids on rat liver
alpha-amino-beta-carboxymuconate-epsilon-semialdehyde decarboxylase activity
and gene expression. Biochim. Biophys. Acta 1686(1-2), 118-124.

Ehrchen, J ., Steinmuller, L., Barczyk, K, Tenbrock, K., Nacken, W., Eisenacher,
M., Nordhues, U., Sorg, C., Sunderkotter, C., and Roth, J. (2006). Glucocorticoids
induce differentiation of a specifically activated, anti-inflammatory subtype of
human monocytes. Blood.

Eitsuka, T., Nakagawa, K., Suzuki, T., and Miyazawa, T. (2005). Polyunsaturated
fatty acids inhibit telomerase activity in DLD-l human colorectal adenocarcinoma
cells: a dual mechanism approach. Biochim. Biophys. Acta 1737(1), 1-10.

Elferink, C. J., and Reiners, J. J., Jr. (1996). Quantitative RT-PCR on CYP1A1
heterogeneous nuclear RNA: a surrogate for the in vitro transcription run-on
assay. Biotechniques 20(3), 470-477.

Emancipator, S. N., and Lamm, M. E. (1989). IgA nephropathy: pathogenesis of
the most common form of glomerulonephritis. Lab Invest 60(2), 168-183.

165

74.

75.

76.

77.

78.

79.

80.

81.

82.

83.

84.

85.

Endo, M., Mori, M., Akira, 8., and Gotoh, T. (2006). C/EBP homologous protein
(CHOP) is crucial for the induction of caspase-1] and the pathogenesis of
lipopolysaccharide-induced inflammation. J. Immunol. 176(10), 6245-6253.

Endo, M., Oyadomari, 8., Suga, M., Mori, M., and Gotoh, T. (2005). The ER
stress pathway involving CHOP is activated in the lungs of LPS-treated mice. J.
Biochem. 138(4), 501-507.

Faitova, J., Krekac, D., Hrstka, R., and Vojtesek, B. (2006). Endoplasmic
reticulum stress and apoptosis. Cell Mol. Biol. Lett. 11(4), 488-505.

Feehally, J. (1997). IgA nephropathy--a disorder of IgA production? QJM. 90(6),
387-390.

Femandez-Hemando, C., Ackah, B, Yu, J., Suarez, Y., Murata, T., Iwakiri, Y.,
Prendergast, J., Miao, R. Q., Bimbaum, M. J., and Sessa, W. C. (2007). Loss of
Aktl leads to severe atherosclerosis and occlusive coronary artery disease. Cell
Metab 6(6), 446-457.

Forsell, J. H., and Pestka, J. J. (1985). Relation of 8-ketotrichothecene and
zearalenone analog structure to inhibition of mitogen-induced human lymphocyte
blastogenesis. Appl. Environ. Microbiol. 50(5), 1304-1307.

Frodin, M., and Gammeltofi, S. (1999). Role and regulation of 90 kDa ribosomal
S6 kinase (RSK) in signal transduction. Mol. Cell Endocrinol. 151(1-2), 65-77.

Fyfe, D. J., and Abbey, M. (2000). Effects of n-3 fatty acids on growth and
survival of J774 macrophages. Prostaglandins Leukot. Essent. Fatty Acids 62(3),
201-207. '

Gabay, C. (2006). Interleukin-6 and chronic inflammation. Arthritis Res. Ther. 8
Suppl 2, S3.

Gao, B., Lee, S. M., Chen, A., Zhang, J., Zhang, D. D., Kannan, K., Ortmann, R.
A., and Fang, D. (2008). Synoviolin promotes IREl ubiquitination and
degradation in synovial fibroblasts from mice with collagen-induced arthritis.
EMBO Rep. 9(5), 480-485.

Garcia, A., Cayla, X., Guergnon, J., Dessauge, F., Hospital, V., Rebollo, M. P.,
Fleischer, A., and Rebollo, A. (2003). Serine/threonine protein phosphatases PP]

and PP2A are key players in apoptosis. Biochimie 85(8), 721-726.

Garcia, M. A., Gil, J., Ventoso, I., Guerra, 8., Domingo, E., Rivas, C., and
Esteban, M. (2006). Impact of protein kinase PKR in cell biology: from antiviral
to antiproliferative action. Microbiol. Mol. Biol. Rev. 70(4), 1032-1060.

166

86.

87.

88.

89.

90.

91.

92.

93.

94.

95.

96.

97.

Gass, J. N., Gifford, N. M., and Brewer, J. W. (2002). Activation of an unfolded
protein response during differentiation of antibody-secreting B cells. J. Biol.
Chem. 277(50), 49047-49054.

Gil, A. (2002). Polyunsaturated fatty acids and inflammatory diseases. Biomed.
Pharmacother. 56(8), 388-396.

Ginty, D. D., Bonni, A., and Greenberg, M. E. (1994). Nerve growth factor
activates a Ras-dependent protein kinase that stimulates c-fos transcription via
phosphorylation of CREB. Cell 77(5), 713-725.

Gossett, R. E., Frolov, A. A., Roths, J. B., Behnke, W. D., Kier, A. B., and
Schroeder, F. (1996). Acyl-CoA binding proteins: multiplicity and function.

(Lipids 31(9), 895-918.

Greggio, E., and Singleton, A. (2007). Kinase signaling pathways as potential
targets in the treatment of Parkinson's disease. Expert. Rev. Proteomics. 4(6), 783-
792.

Grimm, H., Mayer, K., Mayser, P., and Eigenbrodt, E. (2002). Regulatory
potential of n-3 fatty acids in immunological and inflammatory processes. Br. J.
Nutr. 87 Suppl 1, 859-867.

Grimminger, F., Wahn, H., Mayer, K., Kiss, L., Walmrath, D., and Seeger, W.
(1997). Impact of arachidonic versus eicosapentaenoic acid on exotonin-induced
lung vascular leakage: relation to 4-series versus 5-series leukotn'ene generation.
Am. J. Respir. Crit Care Med. 155(2), 513-519.

Grinyer, J., Kautto, L., Traini, M., Willows, R. D., Te'o, J., Bergquist, P., and
Nevalainen, H. (2007). Proteome mapping of the Trichoderma reesei 208
proteasome. Curr. Genet. 51(2), 79-88.

Guerrero, C., Tagwerker, C., Kaiser, P., and Huang, L. (2006). An integrated
mass spectrometry-based proteomic approach: quantitative analysis of tandem
affinity-purified in vivo cross-linked protein complexes (QTAX) to decipher the
26 S proteasome-interacting network. Mol. Cell Proteomics. 5(2), 366-378.

Gunn, K. E., Gifford, N. M., Mori, K., and Brewer, J. W. (2004). A role for the
unfolded protein response in optimizing antibody secretion. Mol. Immunol. 41(9),
919-927.

Hagiwara, M., Brindle, P., Harootrmian, A., Armstrong, R., Rivier, J ., Vale, W.,
Tsien, R., and Montminy, M. R. (1993). Coupling of hormonal stimulation and

transcription via the cyclic AMP-responsive factor CREB is rate limited by
nuclear entry of protein kinase A. Mol. Cell Biol. 13(8), 4852-4859.

Hai, T., and Hartman, M. G. (2001). The molecular biology and nomenclature of
the activating transcription factor/cAMP responsive element binding family of

167

98.

99.

100.

101.

102.

103.

104.

105.

106.

107.

108.

transcription factors: activating transcription factor proteins and homeostasis.
Gene 273(1), l-ll.

Hanada, M., Feng, J., and Hemmings, B. A. (2004). Structure, regulation and
fimction of PKB/AKT--a major therapeutic target. Biochim. Biophys. Acta
1697(1-2), 3-16.

Hansen, 8. N., and Harris, W. S. (2007). New evidence for the cardiovascular
benefits of long chain omega-3 fatty acids. Curr. Atheroscler. Rep. 9(6), 434-440.

Harada, K., Akai, Y., Kurumatani, N., Iwano, M., and Saito, Y. (2002).
Prognostic value of urinary interleukin 6 in patients with IgA nephropathy: an 8-
year follow-up study. Nephron 92(4), 824-826.

Harper, 8. J., Allen, A. C., Pringle, J. H., and Feehally, J. (1996). Increased
dimeric IgA producing B cells in the bone marrow in IgA nephropathy
determined by in situ hybridisation for J chain mRNA. J. Clin. Pathol. 49(1), 38-
42.

Hasler, C. M., Trosko, J. E., and Bennink, M. R. (1991). Incorporation of n-3 fatty
acids into WB-F 344 cell phospholipids inhibits gap junctional intercellular
communication. Lipids 26(10), 788-792.

Hayashi, K., and Altman, A. (2007). Protein kinase C theta (PKCtheta): a key
player in T cell life and death. Pharmacol. Res. 55(6), 537-544.

Haze, K., Yoshida, 11., Yanagi, H., Yura, T., and Mori, K. (1999). Mammalian
transcription factor ATF6 is synthesized as a transmembrane protein and activated
by proteolysis in response to endoplasmic reticulum stress. Mol. Biol. Cell 10(11),
3787- 3799.

Hellegers, BM. (1993). IgA nephropathy: questions and answers (a guide for
adult patients). IgA Nephropathy Support Network 1993 Granby MA (abs.).

Hiki, Y., Odani, H., Takahashi, M., Yasuda, Y., Nishimoto, A., Iwase, H.,
Shinzato, T., Kobayashi, Y. and Maeda, K. (2001). Mass spectrometry proves
under-O-glycosylation of glomerular IgAl in IgA nephropathy. Kidney Int. 59(3),
1077- 1085.

Hirosumi, J., Tuncman, G., Chang, L., Gorgun, C. 2., Uysal, K. T., Maeda, K.,
Karin, M., and Hotamisligil, G. S. (2002). A central role for JNK in obesity and
insulin resistance. Nature 420(6913), 333-336.

Holman, R. T., Johnson, 8. B., Bibus, D., Spencer, D. C., and Donadio, J. V., Jr.
(1994). Essential fatty acid deficiency profiles in idiopathic immunoglobulin A
nephropathy. Am. J. Kidney Dis. 23(5), 648-654.

168

109.

110.

111.

112.

113.

114.

115.

116.

117.

118.

119.

Hong, 8., Gronert, K., Devchand, P. R, Moussignac, R. L., and Serhan, C. N.
(2003). Novel docosatrienes and 17S-resolvins generated from docosahexaenoic
acid in murine brain, human blood, and glial cells. Autacoids in anti-
inflammation. J. Biol. Chem. 278(17), 14677-14687.

Hu, P., Han, Z., Couvillon, A. D., Kaufman, R. J., and Exton, J. H. (2006).
Autocrine tumor necrosis factor alpha links endoplasmic reticulum stress to the
membrane death receptor pathway through IRElalpha-mediated NF-kappaB
activation and down-regulation of TRAF2 expression. Mol. Cell Biol. 26(8),
3071 3-084.

Hume, D. A. (2006). The mononuclear phagocyte system. Curr. Opin. Immunol.
18(1), 49-53.

Hung, J. H., Su, 1. J., Lei, H. Y., Wang, H. C., Lin, W. C., Chang, W. T., Huang,
W., Chang, W. C., Chang, Y. 8., Chen, C. C., and Lai, M. D. (2004).
Endoplasmic reticulum stress stimulates the expression of cyclooxygenase-2
through activation of NF-kappaB and pp38 mitogen-activated protein kinase. J.
Biol. Chem. 279(45), 46384-46392.

Hunley, T. E., and K011, V. (1999). IgA nephropathy. Curr. Opin. Pediatr. 11(2),
152-157.

Imai, H., Nakamoto, Y., Asalcura, K., Mild, K., Yasuda, T., and Miura, A. B.
(1985). Spontaneous glomerular IgA deposition in ddY mice: an animal model of
IgA nephritis. Kidney Int. 27(5), 7 56-761 .

Ishihara, K., and Hirano, T. (2002). IL-6 in autoimmune disease and chronic
inflammatory proliferative disease. Cytokine Growth Factor Rev. 13(4-5), 357-
368.

Itoh, Y., Kawarnata, Y., Harada, M., Kobayashi, M., Fujii, R., Fukusumi, S., Og‘i,
K., Hosoya, M., Tanaka, Y., Uejima, H., Tanaka, H., Maruyama, M., Satoh, R.,
Okubo, 8., Kizawa, H., Komatsu, H., Matsumura, F., Noguchi, Y., Shinohara, T.,
Hinuma, 8., Fujisawa, Y., and Fujino, M. (2003). Free fatty acids regulate insulin
secretion fiom pancreatic beta cells through GPR40. Nature 422(6928), 173-176.

Iwakoshi, N. N., Lee, A. H., and Glimcher, L. H. (2003a). The X-box binding
protein-1 transcription factor is required for plasma cell differentiation and the
unfolded protein response. Immunol. Rev. 194, 29-38.

Iwakoshi, N. N., Lee, A. H., Vallabhajosyula, P., Otipoby, K. L., Rajewsky, K.,
and Glimcher, L. H. (2003b). Plasma cell differentiation and the unfolded protein
response intersect at the transcription factor XBP-l. Nat. Immunol. 4(4), 321-329.

Janssens, V., Gons, J, and Van Hoof, C. (2005). PP2A: the expected tumor
suppressor. Curr. Opin. Genet. Dev. 15(1), 34-41.

169

120.

121.

122.

123.

124
125.

126.

127.

128.

129.
130.

131.

Jia, L., Wang, C., Kong, H., Yang, J., Li, R, Lv, 8., and Xu, G. (2007). Effect of
PA-MSI-LA vaccine on plasma phospholipids metabolic profiling and the ratio of
Th2/Th1 cells within immune organ of mouse IgA nephropathy. J. Pharm.
Biomed. Anal. 43(2), 646-654.

Jia, Q., Shi, Y., Bennink, M. B., and Pestka, J. J. (2004a). Docosahexaenoic acid
and eicosapentaenoic acid, but not alpha-linolenic acid, suppress deoxynivalenol-
induced experimental IgA nephropathy in mice. J. Nutr. 134(6), 1353-1361.

Jia, Q., Zhou, H. R., Bennink, M., and Pestka, J. J. (2004b). Docosahexaenoic
acid attenuates mycotoxin-induced immunoglobulin a nephropathy, interleukin-6
transcription, and mitogen-activated protein kinase phosphorylation in mice. J.
Nutr. 134(12), 3343-3349.

Jia, Q., Zhou, H. R., Shi, Y., and Pestka, J. J. (2006). Docosahexaenoic acid
consumption inhibits deoxynivalenol-induced CREB/ATF] activation and IL-6
gene transcription in mouse macrophages. J. Nutr. 136(2), 366-372.

Johannessen, M., Delghandi, M. P., and Moens, U. (2004). What turns CREB on?
Cell Signal. 16(11), 1211-1227.

Jump, D. B., and Clarke, 8. D. (1999). Regulation of gene expression by dietary
fat. Annu. Rev. Nutr. 19, 63-90.

Kanayasu-Toyoda, T., Morita, I., Hibino, H., Nakao-Hayashi, J ., Ito, H., and
Murota, S. (1993). Eicosapentaenoic acid abolishes the proatherogenic effects of

cholesterol: effects on migration of bovine smooth muscle and endothelial cells in
vitro. Prostaglandins Leukot. Essent. Fatty Acids 48(6), 463-468.

Kanda, T., and Takahashi, T. (2004). Interleukin-6 and cardiovascular diseases.
Jpn. Heart J. 45(2), 183-193.

Kanemoto, 8., Kondo, S., Ogata, M., Murakami, T., Urano, F., and Irnaizumi, K.
(2005). XBPl activates the transcription of its target genes via an ACGT core
sequence under ER stress. Biochem. Biophys. Res. Commun. 331(4), 1146-1153.

Karin, M., and Ben Neriah, Y. (2000). Phosphorylation meets ubiquitination: the
control of NF-[kappa]B activity. Annu. Rev. Immunol. 18, 621-663.

Kato, S., Ding, J., and Du, K. (2007). Differential activation of CREB by Aktl
and Akt2. Biochem. Biophys. Res. Commun. 354(4), 1061-1066.

Katsiari, C. G., Kyttaris, V. C., Juang, Y. T., and Tsokos, G. C. (2005). Protein
phosphatase 2A is a negative regulator of IL-2 production in patients with
systemic lupus erythematosus. J. Clin. Invest 115(11), 3193-3204.

170

132.

133.

134.

135.

136.

137.

138.

139.

140.

141.

142.

Kaufman, R. J. (1999). Stress signaling from the lumen of the endoplasmic
reticulum: coordination of gene transcriptional and translational controls. Genes
Dev. 13(10), 1211-1233.

Kawasaki, Y., Mitsuaki, H., Isome, M., Nozawa, R., and Suzuki, H. (2006). Renal
effects of Coxsackie B4 virus in hyper-IgA mice. J. Am. Soc. Nephrol. 17(10),
2760-2769.

Keller, H., Dreyer, C., Medin, J., Mahfoudi, A., Ozato, K, and Wahli, W. (1993).
Fatty acids and retinoids control lipid metabolism through activation of
peroxisome proliferator-activated receptor-retinoid X receptor heterodimers.
Proc. Natl. Acad. Sci. U. S. A 90(6), 2160-2164.

Kim, Y. S., Kang, D., Kwon, D. Y., Park, W. Y., Kim, H., Lee, D. S., Lim, C. 8.,
Han, J. S., Kim, 8., and Lee, J. S. (2001). Uteroglobin gene polymorphisms affect
the progression of immunoglobulin A nephropathy by modulating the level of
uteroglobin expression. Pharmacogenetics 11(4), 299-305.

Kishimoto, T. (2006). Interleukin-6: discovery of a pleiotropic cytokine. Arthritis
Res. Ther. 8 Suppl 2, 82.

Kliewer, S. A., Sundseth, S. 8., Jones, 8. A., Brown, P. J., Wisely, G. B., Koble,
C. 8., Devchand, P., Wahli, W., Willson, T. M., Lenhard, J. M., and Lehmann, J.
M. (1997). Fatty acids and eicosanoids regulate gene expression through direct
interactions with peroxisome proliferator-activated receptors alpha and gamma.
Proc. Natl. Acad. Sci. U. S. A 94(9), 4318-4323.

Kobayashi, I., Nogaki, F., Kusano, H., Ono, T., Miyawaki, S., Yoshida, H., and
Muso, E. (2002). Interleukin-12 alters the physicochemical characteristics of
serum and glomerular IgA and modifies glycosylation in a ddY mouse strain
having high IgA levels. Nephrol. Dial. Transplant. 17(12), 2108-2116.

Kobayashi, T., Taguchi, K, Yasuhiro, T., Matsumoto, T., and Kamata, K. (2004).
Impairment of P13 -K/Akt pathway underlies attenuated endothelial function in
aorta of type 2 diabetic mouse model. Hypertension 44(6), 956-962.

Kohn, M., Hameister, H., Vogel, M., and Kehrer-Sawatzki, H. (2003). Expression
pattern of the Rsk2, Rsk4 and Pdkl genes during murine embryogenesis. Gene
Expr. Patterns. 3(2), 173-177.

Kurihara, R. 8., Yokoo, M., Domingues, W. V., Cabrera, W. H., Ribeiro, O. G.,
Ibanez, O. M., Malheiros, D. A., Barros, R T., and Almeida Prado, E. B. (2005).
Genetic potential for an acute inflammatory response in IgA glomerulonephritis in
mice. Braz. J. Med. Biol. Res. 38(12), 1807-1815.

Lai, K. N., Lai, F. M., Ho, C. P., and Chan, K. W. (1986). Corticosteroid therapy
in IgA nephropathy with nephrotic syndrome: a long-term controlled trial. Clin.
Nephrol. 26(4), 174-180.

171

143.

144.

145.

146.

147.

148.

149.

150.

151.

152.

153.

Lanzmann-Petithory, D. (2001). Alpha-linolenic acid and cardiovascular diseases.
J. Nutr. Health Aging 5(3), 179-183.

Leigh-Firbank, E. C., Minihane, A. M., Leake, D. 8., Wright, J. W., Murphy, M.
C., Griffin, B. A., and Williams, C. M. (2002). Eicosapentaenoic acid and
docosahexaenoic acid from fish oils: differential associations with lipid responses.
Br. J. Nutr. 87(5), 435-445.

Lerman, R. H. (2006). Essential fatty acids. Altern. Ther. Health Med. 12(3), 20-
29.

Li, L., Ron, C. H., Tahir, S. A., Ren, C., and Thompson, T. C. (2003). Caveolin-l
maintains activated Akt in prostate cancer cells through scaffolding domain
binding site interactions with and inhibition of serine/threonine protein
phosphatases PP1 and PP2A. Mol. Cell Biol. 23(24), 9389-9404.

Lim, C. 8., Yoon, H. J., Kim, Y. 8., Ahn, C., Han, J. 8., Kim, S., Lee, J. 8., Lee,
H. 8., and Chae, D. W. (2003). Clinicopathological correlation of intrarenal
cytokines and chemokines in IgA nephropathy. Nephrology. (Carlton. ) 8(1), 21-
27.

Lloyd, E. E., Gaubatz, J. W., Burns, A. R., and Pownall, H. J. (2006). Sustained
elevations in NEFA induce cyclooxygenase-2 activity and potentiate THP-l
macrophage foam cell formation. Atherosclerosis.

Lopez-Nicolas, R., Lopez-Andreo, M. J ., Marin-Vicente, C., Gomez-Fernandez, J.
C., and Corbalan-Garcia, S. (2006). Molecular mechanisms of PKCalpha
localization and activation by arachidonic acid. The C2 domain also plays a role.
J. Mol. Biol. 357(4), 1105- 1120.

Ma, Y., and Hendershot, L. M. (2001). The unfolding tale of the unfolded protein
response. Cell 107(7), 827-830.

Maini, R. N., and Taylor, P. C. (2000). Anti-cytokine therapy for rheumatoid
arthritis. Annu. Rev. Med. 51, 207-229.

Makowski, L., and Hotamisligil, G. S. (2004). Fatty acid binding proteins--the
evolutionary crossroads of inflammatory and metabolic responses. J. Nutr.
134(9), 24648-24688.

Marion-Letellier, R., Butler, M., Dechelotte, P., Playford, R. J ., and Ghosh, S.
(2008). Comparison of cytokine modulation by natural peroxisome proliferator-
activated receptor gamma ligands with synthetic ligands in intestinal-like Caco-2
cells and human dendritic cells--potential for dietary modulation of peroxisome
proliferator-activated receptor gamma in intestinal inflammation. Am. J. Clin.
Nutr. 87(4), 939-948. '

172

154.

155.

156.

157.

158.

159.

160.

161.

162.

163.

164.

165.

Marquina, R., Diez, M. A., Lopez-Hoyos, M., Buelta, L., Kuroki, A., Kikuchi, 8.,
Villegas, J., Pihlgren, M., Siegrist, C. A., Arias, M., Izui, 8., Merino, J., and
Merino, R. (2004). Inhibition of B cell death causes the development of an IgA
nephropathy in (New Zealand white x C57BL/6)F(l)-bcl-2 transgenic mice. J.
Immunol. 172(11), 7177-7185.

Massey, A., Kiffin, R., and Cuervo, A. M. (2004).- Pathophysiology of chaperone-
mediated autophagy. Int. J. Biochem. Cell Biol. 36(12), 2420-2434.

Matsumoto, K. (1996). Spontaneous and lipopolysaccharide-stimulated secretion
of cytokines by peripheral blood monocytes in IgA nephropathy is inhibited by
interleukin-10. Nephron 73(2), 305-309.

Matsusaka, T., Fujikawa, K., Nishio, Y., Mukaida, N., Matsushirna, K.,
Kishimoto, T., and Akira, S. (1993). Transcription factors NF-IL6 and NF-kappa
B synergistically activate transcription of the inflammatory cytokines, interleukin
6 and interleukin 8. Proc. Natl. Acad. Sci. U. S. A 90(21), 10193-10197.

Matt, T. (2002). Transcriptional control of the inflammatory response: a role for
the CREB-binding protein (CBP). Acta Med. Austriaca 29(3), 77-79.

Mayr, B., and Montminy, M. (2001). Transcriptional regulation by the
phosphorylation-dependent factor CREB. Nat. Rev. Mol. Cell Biol. 2(8), 599-609.

Moldoveanu, Z., Wyatt, R. J., Lee, J. Y., Tomana, M., Julian, B. A., Mestecky, J .,
Huang, W. Q., Anreddy, S. R., Hall, 8., Hastings, M. C., Lau, K. K., Cook, W. J.,
and Novak, J. (2007). Patients with IgA nephropathy have increased serum
galactose-deficient IgAl levels. Kidney Int. 71(11), 1 148-1 154.

Montinaro, V., Gesualdo, L., and Schena, F. P. (1999). The relevance of
experimental models in the pathogenetic investigation of primary IgA
nephropathy. Ann. Med. Interne (Paris) 150(2), 99-107.

Moon, Y., and Pestka, J. J. (2002). Vomitoxin-induced cyclooxygenase-2 gene
expression in macrophages mediated by activation of ERK and p38 but not JNK
mitogen-activated protein kinases. T oxicol. Sci. 69(2), 373-382.

Moon, Y., and Pestka, J. J. (20033). Cyclooxygenase-2 mediates interleukin-6
upregulation by vomitoxin (deoxynivalenol) in vitro and in vivo. T oxicol. Appl.
Pharmacol. 187(2), 80-88.

Moon, Y., and Pestka, J. J. (2003b). Deoxynivalenol-induced mitogen-activated
protein kinase phosphorylation and IL-6 expression in mice suppressed by fish
oil. J. Nutr. Biochem. 14(12), 717-726.

Moon, Y., Uzarski, R., and Pestka, J. J. (2003). Relationship of trichothecene
structure to COX-2 induction in the macrophage: selective action of type B (8-
keto) trichothecenes. J. T oxicol. Environ. Health A 66(20), 1967-1983.

173

166.

167.

168.

169.

170.

171.

172.

173.

174.

175.

176.

177.

Moore, K. W., de Waal, M. R., Coffman, R L., and O'Garra, A. (2001).
Interleukin-10 and the interleukin-10 receptor. Annu. Rev. Immunol. 19, 683-765.

Morinaga, N., Yahiro, K, Matsuura, G., Moss, J ., and Noda, M. (2008). Subtilase
cytotoxin, produced by Shiga—toxigenic 'Escherichia coli, transiently inhibits
protein synthesis of Vero cells via degradation of BiP and induces cell cycle arrest
at G1 by downregulation of cyclin D1. Cell Microbiol. 10(4), 921-929.

Moyad, M. A. (2005). An introduction to dietary/supplemental omega-3 fatty
acids for general health and prevention: part H. Urol. Oncol. 23(1), 36-48.

Murakami, K, Ide, T., Suzuki, M., Mochizuki, T., and Kadowaki, T. (1999).
Evidence for direct binding of fatty acids and eicosanoids to human peroxisome
proliferators-activated receptor alpha. Biochem. Biophys. Res. Commun. 260(3),
609-613.

Nagaraju, K, Casciola-Rosen, L., Lundberg, I.,' Rawat, R., Cutting, 8., Thapliyal,
R., Chang, J., vaivedi, S., Mitsak, M., Chen, Y. W., Plotz, P., Rosen, A.,
Hoffinan, E., and Raben, N. (2005). Activation of the endoplasmic reticulum
stress response in autoimmune myositis: potential role in muscle fiber damage
and dysfunction. Arthritis Rheum. 52(6), 1824-1835.

Naka, T., Nishimoto, N., and Kishimoto, T. (2002). The paradigm of IL-6: from
basic science to medicine. Arthritis Res. 4 Suppl 3, 8233-8242.

Nelson, T. L., Stevens, J. R., and Hickey, M. S. (2007). Inflammatory markers are
not altered by an eight week dietary alpha-linolenic acid intervention in healthy
abdominally obese adult males and females. Cytolcine 38(2), 101-106.

Ni, M., and Lee, A. S. (2007). BR chaperones in mammalian development and
human diseases. FEBS Lett. 581(19), 3641-3651.

Nishie, T., Miyaishi, O., Azuma, H., Kameyama, A., Naruse, C., Hashimoto, N.,
Yokoyama, H., Narimatsu, H., Wada, T., and Asano, M. (2007a). Development of
IgA nephropathy-like disease with high serum IgA levels and increased
proportion of polymeric IgA in Beta-l,4-ga1actosyltransferase-deficient mice.
Contrib. Nephrol. 157, 125-128.

Nishie, T., Miyaishi, O., Azuma, H., Kameyama, A., Naruse, C., Hashimoto, N.,
Yokoyama, H., Narimatsu, H., Wada, T., and Asano, M. (2007b). Development of
immunoglobulin A nephropathy- like disease in beta-1,4-galactosyltransferase-I-
deficient mice. Am. J. Pathol. 170(2), 447-456.

Nishimoto, N., and Kishimoto, T. (2004). Inhibition of IL-6 for the treatment of '
inflammatory diseases. Curr. Opin. Pharmacol. 4(4), 386-391.

Nowis, D., McConnell, E. J ., Dierlam, L., Palamarchuk, A., Lass, A., and Wojcik,
C. (2007). TNF potentiates anticancer activity of bortezomib (V elcade) through

174

178.

179.

180.

181.

182.

183.

184.

185.

186.

187.

188.

reduced expression of proteasome subunits and dysregulation of unfolded protein
response. Int. J. Cancer 121(2), 431-441.

Obajirni, 0., Black, K. D., MacDonald, D. J., Boyle, R. M., Glen, 1., and Ross, B.
M. (2005). Differential effects of eicosapentaenoic and docosahexaenoic acids
upon oxidant-stimulated release and uptake of arachidonic acid in human
lymphoma U937 cells. Pharmacol. Res. 52(2), 183-191.

Oliver, B. L., Cronin, C. G., Zhang-Benoit, Y., Goldring, M. B., and Tanzer, M.
L. (2005). Divergent stress responses to IL-lbeta, nitric oxide, and timicamycin
by chondrocytes. J. Cell Physiol 204(1), 45-50.

Oliver, C. J., and Shenolikar, S. (1998). Physiologic importance of protein
phosphatase inhibitors. Front Biosci. 3, D961-D972.

Ono, H., Katagiri, H., Funaki, M., Anai, M., Inukai, K., Fukushima, Y., Sakoda,
H., Ogihara, T., Onishi, Y., Fujishiro, M., Kikuchi, M., Oka, Y., and Asano, T.
(2001). Regulation of phosphoinositide metabolism, Akt phosphorylation, and
glucose transport by PTEN (phosphatase and tensin homolog deleted on
chromosome 10) in 3T3-L1 adipocytes. Mol. Endocrinol. 15(8), 1411-1422.

Pandey, S. C. (2004). The gene transcription factor cyclic AMP-responsive

element binding protein: role in positive and negative affective states of alcohol
addiction. Pharmacol. Ther. 104(1), 47-58.

Patel, R. K, and Mohan, C. (2005). PI3K/AKT signaling and systemic
autoimmunity. Immunol. Res. 31(1), 47-55.

Pestka, J. J. (2003). Deoxynivalenol-induced IgA production and IgA
nephropathy-aberrant mucosal immune response with systemic repercussions.
T oxicol. Lett. 140-141, 287-295.

Pestka, J. J., and Bondy, G. S. (1990). Alteration of immune function following
dietary mycotoxin exposure. Can. J. Physiol Pharmacol. 68(7), 1009-1016.

Pestka, J. J., Dong, W., Warner, R. L., Rasooly, L., and Bondy, G. 8. (1990a).
Effect of dietary administration of the trichothecene vomitoxin (deoxynivalenol)
on IgA and IgG secretion by Peyer's patch and splenic lymphocytes. Food Chem.
Toxicol. 28(10), 693-699.

Pestka, J. J ., Dong, W., Warner, R. L., Rasooly, L., Bondy, G. S., and Brooks, K.
H. (1990b). Elevated membrane IgA+ and CD4+ (T helper) populations in murine
Peyer's patch and splenic lymphocytes during dietary administration of the
trichothecene vomitoxin (deoxynivalenol). Food Chem. Toxicol. 28(6), 409-420.

Pestka, J. J., Moorrnan, M. A., and Warner, R. L. (1989). Dysregulation of IgA
production and IgA nephropathy induced by the trichothecene vomitoxin. Food
Chem. T oxicol. 27(6), 361-368.

175

189.

190.

191.

192.

193.

194.

195.

196.

197.

198.

199.

Pestka,“ J. J., and Smolinski, A. T. (2005). Deoxynivalenol: toxicology and
potential effects on humans. J. T oxicol. Environ. Health B Crit Rev. 8(1), 39-69.

Pestka, J. J., Tai, J. H., Witt, M. F., Dixon, D. E., and Forsell, J. H. (1987).
Suppression of immune response in the B6C3F1 mouse after dietary exposure to

the Fusarium mycotoxins deoxynivalenol (vomitoxin) and zearalenone. Food
Chem. T oxicol. 25(4), 297-304.

Pestka, J. J ., and Zhou, H. R. (2000). Interleukin-6-deficient mice refractory to
IgA dysregulation but not anorexia induction by vomitoxin (deoxynivalenol)
ingestion. Food Chem. T oxicol. 38(7), 565-575.

Pestka, J. J., Zhou, H. R., Jia, Q., and Timmer, A. M. (2002). Dietary fish oil
suppresses experimental immunoglobulin a nephropathy in mice. J. Nutr. 132(2),
261-269.

Pestka, J. J., Zhou, H. R., Moon, Y., and Chung, Y. J. (2004). Cellular and
molecular mechanisms for immune modulation by deoxynivalenol and other
trichothecenes: unraveling a paradox. T oxicol. Lett. 153(1), 61-73.

Peyron-Caso, E., Fluteau-Nadler, S., Kabir, M., Guerre-Millo, M., Quignard-
Boulange, A., Slama, G., and Rizkalla, S. W. (2002). Regulation of glucose
transport and transporter 4 (GLUT-4) in muscle and adipocytes of sucrose-fed
rats: effects of N-3 poly- and monounsaturated fatty acids. Horm. Metab Res.
34(7), 360-366.

Phillips-Quagliata, J. M. (2002). Mouse IgA allotypes have major differences in
their hinge regions. Immunogenetics 53(12), 1033-1038.

Plowman, G. D., Sudarsanam, 8., Bingham, J., Whyte, D., and Hunter, T. (1999).
The protein kinases of Caenorhabditis elegans: a model for signal transduction in
multicellular organisms. Proc. Natl. Acad. Sci. U. S. A 96(24), 13603-13610.

Pozzi, C., Bolasco, P. G., Fogazzi, G. B., Andrulli, 8., Altieri, P., Ponticelli, C.,
and Locatelli, F. (1999). Corticosteroids in IgA nephropathy: a randomised
controlled trial. Lancet 353(9156), 883-887.

Pozzi, C., Del Vecchio, L., Casartelli, D., Pozzoni, P., Andrulli, S., Amore, A.,
Peruzzi, L., Coppo, R., and Locatelli, F. (2006). ACE inhibitors and angiotensin II
receptor blockers in IgA nephropathy with mild proteinuria: the ACEARB study.
J. Nephrol. 19(4), 508-514. '

Purcell, A. W., Todd, A., Kinoshita, G., Lynch, T. A., Keech, C. L., Gething, M.
J ., and Gordon, T. P. (2003). Association of stress proteins withautoantigens: a
possible mechanism for triggering autoimmunity? Clin. Exp. Immunol. 132(2),
193-200.

176

 

200.

201.

202.

203.

204.

205.

206.

207.

208.

209.

210.

Rahmani, M., Davis, E. M., Crabtree, T. R., Habibi, J. R., Nguyen, T. K, Dent,
P., and Grant, 8. (2007). The kinase inhibitor sorafenib induces cell death through
a process involving induction of endoplasmic reticulum stress. Mol. Cell Biol.
27(15), 5499-5513.

Ramji, D. P., and Foka, P. (2002). CCAAT/enhancer-binding proteins: structure,
function and regulation. Biochem. J. 365(Pt 3), 561-575.

Rasooly, L., Abouzied, M. M., Brooks, K. H., and Pestka, J. J. (1994).
Polyspecific and autoreactive IgA secreted by hybridomas derived from Peyer's
patches of vomitoxin-fed mice: characterization and possible pathogenic role in
IgA nephropathy. Food Chem. Toxicol. 32(4), 337-348.

Rasooly, L., and Pestka, J. J. (1994). Polyclonal autoreactive IgA increase and
mesangial deposition during vomitoxin-induced IgA nephropathy in the BALB/c
mouse. Food Chem. T oxicol. 32(4), 329-336.

Rathmell, J. C., Elstrom, R. L., Cinalli, R. M., and Thompson, C. B. (2003).
Activated Akt promotes increased resting T cell size, CD28-independent T cell

growth, and development of autoimmunity and lymphoma. Eur. J. Immunol.
33(8), 2223-2232.

Reeves, P. G., Nielsen, F. H., and Fahey, G. C., Jr. (1993). AIN-93 purified diets
for laboratory rodents: final report of the American Institute of Nutrition ad hoc
writing committee on the reformulation of the AIN-76A rodent diet. J. Nutr.
123(11), 1939-1951.

Reimold, A. M., Iwakoshi, N. N., Manis, J., Vallabhajosyula, P., Szomolanyi-
Tsuda, E., Gravallese, E. M., Friend, D., Grusby, M. J ., Alt, F ., and Glimcher, L.
H. (2001). Plasma cell differentiation requires the transcription factor XBP-1.
Nature 412(6844), 300-307.

Ren, J ., and Chung, S. H. (2007). Anti-inflammatory effect of alpha-linolenic acid
and its mode of action through the inhibition of nitric oxide production and

inducible nitric oxide synthase gene expression via NF-kappaB and mitogen-
activated protein kinase pathways. J. Agric. Food Chem. 55(13), 5073-5080.

Resjo, S., Goransson, O., Harndahl, L., Zohrierowicz, 8., Manganiello, V., and
Degerman, E. (2002). Protein phosphatase 2A is the main phosphatase involved in
the regulation of protein kinase B in rat adipocytes. Cell Signal. 14(3), 231-238.

Richieri, G. V., and Kleinfeld, A. M. (1995). Unbound free fatty acid levels in
human serum. J. Lipid Res. 36(2), 229-240.

Rifai, A., Small, P. A., Jr., Teague, P. O., and Ayoub, E. M. (1979). Experimental
IgA nephropathy. J. Exp. Med. 150(5), 1161-1173.

177

 

211.

212.

213.

214.

215.

216.

217.

218.

219.

220.

221.

222.

223.

Rolph, M. 8., Young, T. R, Shum, B. O., Gorgun, C. Z., Schmitz-Peiffer, C.,
Ramshaw, I. A., Hotamisligil, G. 8., and Mackay, C. R. (2006). Regulation of
dendritic cell function and T cell priming by the Fatty Acid-binding protein AP2.
J. Immunol. 177(11), 7794-7801.

Ron, D., and Hubbard, S. R. (2008). How IREl reacts to ER stress. Cell 132(1),
24-26.

Rotter, B. A., Prelusky, D. B., and Pestka, J. J. (1996). Toxicology of
deoxynivalenol (vomitoxin). J. T oxicol. Environ. Health 48(1), 1-34.

Rubinsztein, D. C. (2006). The roles of intracellular protein-degradation pathways
in neurodegeneration. Nature 443(7113), 780-786.

Ruxton, C. H., Reed, 8. C., Simpson, M. J., and Millington, K. J. (2004). The
health benefits of omega-3 polyunsaturated fatty acids: a review of the evidence.
J. Hum. Nutr. Diet. 17(5), 449-459.

Ruxton, C. H., Reed, 8. C., Simpson, M. J., and Millington, K J. (2007). The
health benefits of omega-3 polyunsaturated fatty acids: a review of the evidence.
J. Hum. Nutr. Diet. 20(3), 275-285.

Saijo, K., Mecldenbrauker, 1., Schmedt, C., and Tarakhovsky, A. (2003). B cell
immunity regulated by the protein kinase C family.,Ann. N. Y. Acad. Sci. 987,
125-134. ’

Schley, P. D., Brindley, D. N., and Field, C. J. (2007). (n-3) PUFA alter raft lipid
composition and decrease epidermal growth factor receptor levels in lipid rafts of
human breast cancer cells. J. Nutr. 137(3), 548-553.

Schroder, M., and Kaufman, R. J. (2005). The mammalian unfolded protein
response. Annu. Rev. Biochem. 74, 739-789. -

Sears, R. C., and Nevins, J. R. (2002). Signaling networks that link cell
proliferation and cell fate. J. Biol. Chem. 277(14), 11617-11620.

Seo, T., Blaner, W. 8., and Deckelbaum, R. J. (2005). Omega-3 fatty acids:
molecular approaches to optimal biological outcomes. Curr. Opin. Lipidol. 16(1),
11-18.

Serhan, C. N., Chiang, N., and Van Dyke, T. E. (2008). Resolving inflammation:
dual anti-inflammatory and pro-resolution lipid mediators. Nat. Rev. Immunol.
8(5), 349-361.

Shankar, D. B., and Sakamoto, K. M. .(2004). The role of cyclic-AMP binding
protein (CREB) in leukemia cell proliferation and acute leukemias. Leuk.
Lymphoma 45(2), 265-270.

178

224.

225.

226.

227.

228.

229.

230.

231.

232.

233.

234.

235.

Shaywitz, A. J ., and Greenberg, M. E. (1999). CREB: a stimulus-induced
transcription factor activated by a diverse array of extracellular signals. Annu.
Rev. Biochem. 68, 821-861.

Shen, J ., Chen, X., Hendershot, L., and Prywes, R. (2002). BR stress regulation of
ATP 6 localization by dissociation of BiP/GRP78 binding and unmasking of Golgi
localization signals. Dev. Cell 3(1), 99-111.

Shen, X., Ellis, R. E., Lee, K., Liu, C. Y., Yang, K., Solomon, A., Yoshida, H.,
Morimoto, R., Kurnit, D. M., Mori, K, and Kaufinan, R. J. (2001).
Complementary signaling pathways regulate the unfolded protein response and
are required for C. elegans development. Cell 107(7), 893-903.

Shi, C., and Simon, D. I. (2006). Integrin signals, transcription factors, and
monocyte differentiation. Trends Cardiovasc. Med. 16(5), 146-152.

Shi, Y., and Pestka, J. J. (2006). Attenuation of mycotoxin-induced IgA
nephropathy by eicosapentaenoic acid in the mouse: dose response and relation to
IL-6 expression. J. Nutr. Biochem. 17(10), 697-706.

Shoji, T., Nakanishi, 1., Suzuki, A., Hayashi, T., Togawa, M., Okada, N., Irnai, E.,
Hori, M., and Tsubakihara, Y. (2000). Early treatment with corticosteroids
ameliorates proteinuria, proliferative lesions, and mesangial phenotypic
modulation in adult diffuse proliferative IgA nephropathy. Am. J. Kidney Dis.
35(2), 194-201.

Song, G., Ouyang, G., and Bao, S. (2005). The activation of Akt/PKB signaling
pathway and cell survival. J. Cell Mol. Med. 9(1), 59-71.

Song, M., and Kellum, J. A. (2005). Interleukin-6. Crit Care Med. 33(12 Suppl),
8463-8465.

Spector, A. A., and Yorek, M. A. (1985). Membrane lipid composition and
cellular function. J. Lipid Res. 26(9), 1015-1035.

Sperling, R. 1., Benincaso, A. 1., Knoell, C. T., Larkin, J. K, Austen, K. F., and
Robinson, D. R. (1993). Dietary omega-3 polyunsaturated fatty acids inhibit
phosphoinositide formation and chemotaxis in neutrophils. J. Clin. Invest 91(2),
651-660.

Storlien, L. H. Kraegen, E. W., Chisholm, D. J., Ford, G. L., Bruce, D. G., and
Pascoe, W. S. (1987). Fish oil prevents insulin resistance induced by high- fat
feeding inrats. Science 237(4817), 885- 888.

Strippoli, G. F ., Manno, C., and Schena, F. P. (2003). An "evidence-based"
survey of therapeutic options for IgA nephropathy: assessment and criticism. Am.
J. Kidney Dis. 41(6), 1129-1139.

179

 

236.

237.

238.

239.

240.

241.

242.

243.

244.

245.

246.

Suzuki, H., Moldoveanu, Z., Hall, 8., Brown, R., Vu, H. L., Novak, L., Julian, B.
A., Tomana, M., Wyatt, R. J., Edberg, J. C., Alarcon, G. 8., Kimberly, R. P.,
Tomino, Y., Mestecky, J., and Novak, J. (2008). IgAl-secreting cell lines from
patients with IgA nephropathy produce aberrantly glycosylated IgAl. J. Clin.
Invest.

Tan, 8. L., and Parker, P. J. (2003). Emerging and diverse roles of protein kinase
C in immune cell signalling. Biochem. J. 376(Pt 3), 545-552.

Taniguchi, Y., Yorioka, N., Oda, H., and Yamakido, M. (1996). Platelet-derived
growth factor, interleukin (IL)-1 beta, IL-6R and tumor necrosis factor-alpha in
IgA nephropathy. An immunohistochemical study. Nephron 74(4), 652-660.

Taylor, S. 8., Haste, N. M., and Ghosh, G. (2005). PKR and eIF2alpha:
integration of kinase dimerization, activation, and substrate docking. Cell 122(6),
823-825.

Thompson, W. L., and Wannemacher, R. W., Jr. (1986). Structure-function
relationships of 12,13-epoxytrichothecene mycotoxins in cell culture: comparison
to whole animal lethality. T oxicon 24(10), 985-994.

Tokunou, T., Ichiki, T., Takeda, K., Funakoshi, Y., lino, N., Shimokawa, H.,
Egashira, K., and Takeshita, A. (2001). Thrombin induces interleukin-6
expression through the cAMP response element in vascular smooth muscle cells.
Arterioscler. Thromb. Vasc. Biol. 21(11), 1759-1763.

Trebble, T., Arden, N. K., Stroud, M. A., Wootton, S. A., Burdge, G. C., Miles, E.
A., Ballinger, A. B., Thompson, R. L., and Calder, P. C. (2003a). Inhibition of
tumour necrosis factor-alpha and interleukin 6 production by mononuclear cells
following dietary fish-oil supplementation in healthy men and response to
antioxidant co-supplementation. Br. J. Nutr. 90(2), 405-412.

Trebble, T. M., Wootton, S. A., Miles, E. A., Mullee, M., Arden, N. K., Ballinger,
A. B., Stroud, M. A., Burdge, G. C., and Calder, P. C. (2003b). Prostaglandin E2
production and T cell function after fish-oil supplementation: response to
antioxidant cosupplementation. Am. J. Clin. Nutr. 78(3), 376-382.

Tryphonas, H., Iverson, F., 80, Y., Nera, E. A., McGuire, P. F., O'Grady, L.,
Clayson, D. B., and Scott, P. M. (1986). Effects of deoxynivalenol (vomitoxin) on
the humoral and cellular immunity of mice. Toxicol. Lett. 30(2), 137-150.

Tryphonas, H., O'Grady, L., Arnold, D. L., McGuire, P. F., Karpinski, K., and
Vesonder, R. F. (1984). Effect of deoxynivalenol (vomitoxin) on the humoral
immunity of mice. T oxicol. Lett. 23(1), l7-24.

Umeda, Y., Chijiwa, 8., Furihata, K, Furihata, K., Sakuda, 8., Nagasawa, H.,
Watanabe, H., and Shin-ya, K. (2005). Prunustatin A, a novel GRP78 molecular

180

247.

248.

249.

250.

251.

252.

253.

254.

255.

256.

257.

chaperone down-regulator isolated from Streptomyces violaceoniger. J. Antibiot.
(Tokyo) 58(3), 206-209.

van Deventer, S. J., Elson, C. O., and Fedorak, R. N. (1997). Multiple doses of
intravenous interleukin 10 in steroid-refractory Crohn's disease. Crohn's Disease
Study Group. Gastroenterology 113(2), 383-389.

Van Hoof, C., and Goris, J. (2003). Phosphatases in apoptosis: to be or not to be,
PP2A is in the heart of the question. Biochim. Biophys. Acta 1640(2-3), 97-104.

Wadzinski, B. E., Wheat, W. H., Jaspers, 8., Peruski, L. F., Jr., Lickteig, R L.,
Johnson, G. L., and, Klemm, D. J. (1993). Nuclear protein phosphatase 2A
dephosphorylates protein kinase A—phosphorylated CREB and regulates CREB
transcriptional stimulation. Mol. Cell Biol. 13(5), 2822-2834.

Wagner, E. F. (2002). Functions of AP] (Fos/Jun) in bone development. Ann.
Rheum. Dis. 61 Suppl 2, ii40-ii42.

Wakai, K, Kawamura, T., Matsuo, S., Hotta, N., and Ohno, Y. (1999). Risk
factors for IgA nephropathy. a case-control study in Japan. Am. J. Kidney Dis.
33(4), 738-745.

Wakai, 1c, Nakai, s., Matsuo, s., Kawamura, T., Hotta, N., Maeda, K., and Ohno,
Y. (2002). Risk factors for IgA nephropathy: a case-control study with incident
cases in Japan. Nephron 90(1), 16-23.

Walker, R. G., Yu, S. H., Owen, J. E., and Kincaid-Smith, P. (1990). The
treatment of mesangial IgA nephropathy with cyclophospharnide, dipyridamole
and warfarin: a two-year prospective trial. Clin. Nephrol. 34(3), 103-107.

Wallace, F. A., Miles, E. A., and Calder, P. C. (2003). Comparison of the effects
of linseed oil and different doses of fish oil on mononuclear cell function in
healthy human subjects. Br. J. Nutr. 89(5), 679-689.

Wong, 8. 8., Zhou, H. R., Marin-Martinez, M. L., Brooks, K., and Pestka, J. J.
(1998). Modulation of IL-lbeta, IL-6 and TNF-alpha secretion and mRNA

expression by the trichothecene vomitoxin in the RAW 264.7 murine macrophage
cell line. Food Chem. T oxicol. 36(5), 409-419.

Woo, K. T., Edmondson, R. P., Yap, H. K, Wu, A. Y., Chiang, G. 8., Lee, E. J.,
Pwee, H. S., and Lim, C. H. (1987). Effects of triple therapy on the progression of
mesangial proliferative glomerulonephritis. Clin. Nephrol. 27(2), 56-64.

Woodman, R. J., Mori, T. A., Burke, V., Puddey, I. B., Barden, A., Watts, G. F.,
and Beilin, L. J. (2003). Effects of purified eicosapentaenoic acid and
docosahexaenoic acid on platelet, fibrinolytic and vascular function in
hypertensive type 2 diabetic patients. Atherosclerosis 166(1), 85-93.

181

 

258.

259.

260.

261.

262.

263.

264.

265.

266.

267.

268.

Worgall, T. 8., Sturley, S. L., Seo, T., Osborne, T. F., and Deckelbaum, R J.
(1998). Polyunsaturated fatty acids decrease expression of promoters with sterol
regulatory elements by decreasing levels of mature sterol regulatory element-
binding protein. J. Biol. Chem. 273(40), 25537-25540.

Xia, 8., Lu, Y., Wang, J., He, C., Hong, S., Serhan, C. N., and Kang, J. X. (2006).
Melanoma growth is reduced in fat-1 transgenic mice: impact of omega-6/omega-
3 essential fatty acids. Proc. Natl. Acad. Sci. U. S. A 103(33), 12499-12504.

Yamamoto, C., Suzuki, 8., Kimura, H., Yoshida, H., and Gejyo, F. (2002).
Experimental nephropathy induced by Haemophilus parainfluenzae antigens.
Nephron 90(3), 320-327.

Yamashima, T. (2004). Ca2+-dependent proteases in ischernic neuronal death: a
conserved 'calpain-cathepsin cascade' from nematodes to primates. Cell Calcium
36(3-4), 285-293.

Yamashita, M., Chintalacharuvu, S. R., Kobayashi, N., Nedrud, J. G., Lamm, M.
E., Tomino, Y., and Emancipator, S. N. (2007). Analysis of innate immune
responses in a model of IgA nephropathy induced by Sendai virus. Contrib.
Nephrol. 157, 159-163.

Yan, D.,‘ Zhou, H. R., Brooks, K. H., and Pestka, J. J. (1997). Potential role for
IL-5 and IL-6 in enhanced IgA secretion by Peyer's patch cells isolated from mice
acutely exposed to vomitoxin. Toxicology 122(1-2), 145-158.

Yan, D., Zhou, H. R., Brooks, K. H., and Pestka, J. J. (1998). Role of
macrophages in elevated IgA and IL-6 production by Peyer's patch cultures
following acute oral vorrritoxin exposure. T oxicol. Appl. Pharmacol. 148(2), 261-
273. ‘

Yan, Y., Xu, L. X., Zhang, J. J., Zhang, Y., and Zhao, M. H. (2006). Self-
aggregated deglycosylated IgAl with or without IgG were associated with the
development of IgA nephropathy. Clin. Exp. Immunol. 144(1), 17-24.

Yang, G. H., Li, S., and Pestka, J. J. (2000). Down-regulation of the endoplasmic
reticulum chaperone GRP78/BiP by vomitoxin (Deoxynivalenol). Toxicol. Appl.
Pharmacol. 162(3), 207-217.

Yang, Z. Z., Tschopp, O., Baudry, A., Dummler, B., Hynx, D., and Hemmings, B.
A. (2004). Physiological functions of protein kinase B/Akt. Biochem. Soc. Trans.
32(Pt 2), 350-354.

Yoneyama, 8., Miura, K., Sasaki, 8., Yoshita, K, Morikawa, Y., Ishizaki, M.,

Kido, T., Naruse, Y., and Nakagawa, H. (2007). Dietary intake of fatty acids and
serum C-reactive protein in Japanese. J. Epidemiol. 17(3), 86—92.

182

 

269.

270.

271.

272.

273.

274.

275.

276.

277.

278.

279.

280.

Yoo, E. M., and Morrison, 8. L. (2005). IgA: an immune glycoprotein. Clin.
Immunol. 116(1), 3-10.

Yorimitsu, T., and Klionsky, D. J. (2005). Autophagy: molecular machinery for
self-eating. Cell Death. Dfier. 12 Suppl 2, 1542-1552.

Yoshida, H. (2007). ER stress and diseases. FEBS J. 274(3), 630-658.

Yoshida, H., Haze, K., Yanagi, H., Yura, T., and Mori, K. (1998). Identification
of the cis-acting endoplasmic reticulum stress response element responsible for
transcriptional induction of mammalian glucose-regulated proteins. Involvement
of basic leucine zipper transcription factors. J. Biol. Chem. 273(50), 33741-33749.

Yoshizawa, T., and Morooka, N. (1973). Deoxynivalenol and its monoacetate:

New mycotoxins from F usarium roseum and moldy barley. Agric. Biol. Chem.
37:2933-2934.

Young, 1. 8., and Nicholls, D. P. (2006). Lipid metabolism. Curr. Opin. Lipidol.
17(5), 606-608.

Yu, K., Bayona, W., Kallen, C. B., Harding, H. P., Ravera, C. P., McMahon, G.,
Brown, M. and Lazar, M. A. (1995). Differential activation of peroxisome
proliferator-activated receptors by eicosanoids. J. Biol. Chem. 270(41), 23975-
23983.

Yu, L. G., Packman, L. C., Weldon, M., Hamlett, J., and Rhodes, J. M. (2004).
Protein phosphatase 2A, a negative regulator of the ERK signaling pathway, is
activated by tyrosine phosphorylation of putative HLA class II-associated protein
I (PHAPI)/pp32 in response to the antiproliferative lectin, jacalin. J. Biol. Chem.
279(40), 41377-41383.

Yusufi, A. N., Cheng, J., Thompson, M. A., Walker, H. J., Gray, C. E., Warner,
G. M., and Grande, J. P. (2003). Differential effects of low-dose docosahexaenoic

acid and eicosapentaenoic acid on the regulation of mitogenic signaling pathways
in mesangial cells. J. Lab Clin. Med. 141(5), 318-329.

Zhang, K., and Kaufman, R. J. (2006). The unfolded protein response: a stress
signaling pathway critical for health and disease. Neurology 66(2 Suppl 1), 8102-
8109.

Zhang, K., Shen, X., Wu, J ., Sakaki, K., Saunders, T., Rutkowski, D. T., Back, 8.
H., and Kaufman, R. J. (2006). Endoplasmic reticulum stress activates cleavage of
CREBH to induce a systemic inflammatory response. Cell 124(3), 587-599.

Zhang, Y., Zhai, Q., Luo, Y., and Dorf, M. E. (2002). RANTES-mediated

chemokine transcription in astrocytes involves activation and translocation of p90
ribosomal 86 protein kinase (RSK). J. Biol. Chem. 277(21), 19042-19048.

183

 

281.

282.

283.

284.

285.

Zhou, H. R., Islam, Z., and Pestka, J. J. (2003a). Rapid, sequential activation of
mitogen-activated protein kinases and transcription factors precedes
proinflammatory cytokine mRNA expression in spleens of mice exposed to the
trichothecene vomitoxin. T oxicol. Sci. 72(1), 130-142.

Zhou, H. R., Islam, Z., and Pestka, J. J. (2005a). Induction of competing apoptotic
and survival signaling pathways in the macrophage by the ribotoxic trichothecene
deoxynivalenol. T oxicol. Sci. 87(1), 113-122.

Zhou, H. R., Jia, Q., and Pestka, J. J. (2005b). Ribotoxic stress response to the
trichothecene deoxynivalenol in the macrophage involves the SRC family kinase
Hck. T oxicol. Sci. 85(2), 916-926.

Zhou, H. R., Lau, A. 8., and Pestka, J. J. (2003b). Role of double-stranded RNA-
activated protein kinase R (PKR) in deoxynivalenol-induced ribotoxic stress
response. T oxicol. Sci. 74(2), 335-344.

Zhou, H. R., Yan, D., and Pestka, J. J. (1997). Differential cytokine mRNA
expression in mice after oral exposure to the trichothecene vomitoxin

(deoxynivalenol): dose response and time course. Toxicol. Appl. Pharmacol.
144(2), 294-305.

184