BIOLOGY AND MANAGEMENT OF MULTIPLE-(GLYPHOSATE, ALS, ANDATRAZINE) RESISTANT PALMER AMARANTH IN MICHIGANByJonathonKohrtA DISSERTATIONSubmitted toMichigan StateUniversityin partial fulfillment of the requirementsfor the degree ofCrop and Soil Sciences•Doctor of Philosophy2017ABSTRACTBIOLOGY AND MANAGEMENT OF MULTIPLE-(GLYPHOSATE, ALS, ANDATRAZINE) RESISTANT PALMER AMARANTH IN MICHIGANByJonathonKohrtPalmer amaranth (Amaranthus PalmeriS. Wats.)was first identified in Michigan in 2010, itis anon-native pigweed species that has been detrimental torowcrop production throughout thesouthern and Great Plains regions of the United States.In 2013, the failure of atrazine to controla suspected glyphosate-and ALS-resistant Palmer amaranth population identified in BarryCounty, MI prompted further investigation into the possibility that this Palmer amaranthpopulation was resistant to threedifferent herbicide sites of action.  Field, greenhouse, andlaboratory experiments were conducted in 2013, 2014, and 2015 to quantify the levelsofresistance,identify the mechanisms,studythe biology, and identify possible managementstrategies for Palmer amaranth in Michigan corn production systems.  The resistance factor (RF)valuesfor the suspected multiple-resistantBarry County (MR) Palmer amaranth population were12, 43, and 9X for POST applications of glyphosate, thifensulfuron, and atrazine, respectively,compared with a knownsusceptible population.  The MRpopulation was also highly resistant toPRE applications of atrazine, RF = 112X.  These results confirmed that this population wasresistant to three different herbicide sites of action.  Laboratory experiments identified target-sitebased resistance for glyphosate and the ALS-inhibiting herbicides via gene amplification andamino acid substitution, respectively.  Resistance to atrazine was not target-site mediated, withno observed nucleotide substitutions within thepsbAgene, leading us to believe that atrazineresistance in this population may be metabolism-based.  In the field, sole reliance on a PRE orsingle site of action POST herbicide application did not provide season-long control of Palmeramaranth.  Several one-pass EPOSweed managementprograms effectively managed multiple-resistant Palmer amaranth.  However, these programsmustcontain at least two effectiveherbicide sites of action with foliar activity tank-mixed with a residual herbicide for season-longcontrol.  The most consistent and effective management strategies for control of this multiple-resistant Palmer amaranth population in corn were two-pass herbicide programs, PRE followedby POST.  These strategies included at least one effective herbicide site of action PRE and twoeffective foliar sites of action POST plus a soil residual herbicide for season-long Palmeramaranth control.  The HPPD-inhibiting herbicides will be a major component of a Palmeramaranth management program in corn.  The effectiveness of the POST HPPD-inhibitingherbicides for Palmer amaranth control weretolpyralate > tembotrione = topramezone >mesotrione.  The addition of atrazine to mesotrione and tembotrione was synergistic for Palmeramaranth control.  This suggests that even in an atrazine-resistant Palmer amaranth populationthe addition of atrazine to some of the HPPD-inhibiting herbicides would be beneficial forPalmer amaranth control, especially as Palmer amaranth size increases.In a threeyear croprotation experiment, Palmer amaranth emergence startedat ~281 GDD10(late May/early June)and did not cease until September in central Michigan.  The total number as well as the durationof Palmer amaranth emergence was greater in corn than insoybean.  The initial growth rate ofPalmer amaranth was greatest for early emerging cohorts in corn, however those that emerged2wkslaterin the seasonwere more competitive in soybean.  Seed production declined with eachsuccessive cohort and was greatest for early emerging Palmer amaranth in soybean with >64,000seeds plant-1.  Palmer amaranth that emergedin Augustafter wheat harvest produced seed thatadded to the soil seedbank.  When corn is included in the rotation the availability of moreeffective herbicide sites of action paired with reducedPalmer amaranthgrowth and lower seedproduction can lead to greater success inmanaging resistant Palmer amaranth populations.ACKNOWLEDGEMENTSI would like to thankDr. Christy Sprague for giving me the opportunity to be a part of theweed science team and for serving as major advisor.  Her guidance has been invaluable in botheducational and professional development throughout graduate studies here at Michigan StateUniversity.I would also like to thank Dr. Karen Renner, Dr. Christina DiFonzo, and Dr. KurtSteinke for serving on my guidance committee.I would like to give special thanks to Gary Powell and Erin Hill for their assistance in thesetup and design ofthe field and greenhouse aspects of my project.  This research would havebeen very difficult to conduct without the help of my fellow graduate students:  Dr. DavidPowell, Amanda Harden, Amanda Goffnett, and Kelsey Rogers.It would have been impossibleto complete this research without the help from all oftheundergraduates: Megan Tomlin, ChrisBauer, Chelsea Bonthuis, Kalvin Canfield, R.J.Lee, Taylor Truckey, Kelly White, DennisErickson, Jerrid Smith, Cody Tyrell, Mike Schulze, Jake Hall, Mitchell Ackerman, Haonan Qi,and Matt Singer.  Special thanksto theMichigan CornMarketing Boardand Project GREEENfor the funding to conduct this research.I alsoowea great deal of gratitude to my friends and family.  Without their support none ofthis would have been possible.TABLE OF CONTENTSLIST OF TABLES........................................................................................................................ixLIST OF FIGURES.....................................................................................................................xiiCHAPTER 1....................................................................................................................................1REVIEW OF LITERATURE..........................................................................................................1Introduction..........................................................................................................................1Biology of Palmer amaranth................................................................................................1Germination.............................................................................................................2Emergence................................................................................................................2Growth rate, Biomass Accumulation and Seed Production.....................................3Competition..............................................................................................................5Herbicide Resistance............................................................................................................5HerbicideResistanceMechanisms..........................................................................7Palmer amaranth Management............................................................................................8Interactionof HPPD-Inhibitors and Atrazine......................................................................9Cultural Practices for Depletion of the Soil Seedbank......................................................12LITERATURE CITED..................................................................................................................14CHAPTER 2..................................................................................................................................22CONFIRMATION OF ATHREE-WAY (GLYPHOSATE, ALS, AND ATRAZINE)HERBICIDE-RESISTANT POPULATION OF PALMER AMARANTH IN MICHIGAN.......22Abstract†††††††††††††††††††††††††††††††..22Introduction††††††††††††††††††††††††††††††23Materials and Methods†††††††††††††††††††††††††...27SeedCollection and Preparation............................................................................27Initial Screen for Three-Way Resistance...............................................................27Resistance Factor...................................................................................................28Dose-Response to Postemergence Herbicides...........................................28Dose-Response to Preemergence Atrazine................................................29Statistical Analysis.....................................................................................29Molecular Basis for Resistance..............................................................................30PlantMaterial and DNA Extraction...........................................................30ALS and psbA Gene Isolation and Sequencing.........................................31EPSPS Copy Number................................................................................32Results and Discussion......................................................................................................33Initial Screen for Three-Way Resistance...............................................................33Resistance Factor...................................................................................................34ALS Resistance..........................................................................................34Glyphosate Resistance...............................................................................35Atrazine ResistancePOST.........................................................................35Atrazine Resistance PRE...........................................................................36Molecular Basis for Resistance..............................................................................37ALS-Inhibitors...........................................................................................37Glyphosate Resistance...............................................................................38Atrazine Resistance....................................................................................39APPENDIX....................................................................................................................................42LITERATURE CITED..................................................................................................................51CHAPTER 3..................................................................................................................................58HERBICIDE MANAGEMENTSTRATEGIES IN CORN FOR A THREE-WAY(GLYPHOSATE,ALS, AND ATRAZINE) HERBICIDE-RESISTANT PALMERAMARANTH POPULATION......................................................................................................58Abstract†††††††††††††††††††††††††††††††..58Introduction††††††††††††††††††††††††††††††59Materials and Methods†††††††††††††††††††††††††...62Evaluation of Preemergence (PRE) Herbicides.....................................................63Evaluation of Postemergence (POST) Herbicides.................................................63Evaluation of Herbicide Programs for Palmer amaranth Control in Corn.............64StatisticalAnalysis................................................................................................64Results and Discussion......................................................................................................65Evaluation of PRE Herbicides...............................................................................65Evaluation of POST Herbicides.............................................................................69Evaluation ofHerbicide Programs for Palmer amaranth Control in Corn.............70APPENDIX....................................................................................................................................73LITERATURE CITED..................................................................................................................81CHAPTER 4..................................................................................................................................86RESPONSE OF A MULTIPLE-RESISTANT PALMER AMARANTH POPULATION TOFOUR HPPD-INHIBITING HERBICIDES APPLIED ALONE AND WITH ATRAZINE........86Abstract..............................................................................................................................86Introduction........................................................................................................................87Materials and Methods.......................................................................................................90Field Experiment....................................................................................................90Greenhouse Experiments.......................................................................................92Differential Response of Palmer amaranth with Four HPPD-InhibitingHerbicides..................................................................................................92Joint Activity of HPPD-Inhibiting Herbicides with Atrazine....................93Results andDiscussion......................................................................................................95Palmer amaranth Control in the Field with HPPD-Inhibiting Herbicides Alone andwith Atrazine..........................................................................................................95Differential Response of Atrazine-Resistant Palmer amaranth (AR) with FourHPPD-Inhibiting Herbicides in the Greenhouse....................................................98Joint Activity ofHPPD-Inhibiting Herbicides with Atrazine on Atrazine-Sensitiveand Atrazine-Resistant Palmer amaranth Populations in the Greenhouse.............98Mesotrione.................................................................................................98Tembotrione...............................................................................................99Tolpyralate...............................................................................................100Topramezone............................................................................................101APPENDIX..................................................................................................................................104LITERATURECITED................................................................................................................114CHAPTER 5................................................................................................................................118INFLUENCE OF CROP, CROP ROTATION, AND MANAGEMENT STRATEGY ONPALMER AMARANTH EMERGENCE, GROWTH, REPRODUCTION, AND DEPLETIONOF THE SOIL SEEDBANK.......................................................................................................118Abstract............................................................................................................................118Introduction......................................................................................................................119Materials and Methods.....................................................................................................122BMP and WF Treatments....................................................................................123Palmeramaranth Emergence...............................................................................124Palmer amaranth Growth, Development, and Seed Production..........................124Palmer amaranth Soil Seedbank..........................................................................126Results and Discussion....................................................................................................127Palmer amaranthEmergence...............................................................................127Corn and Soybean....................................................................................127Wheat.......................................................................................................129Palmer amaranthRelative Growth Rate,Height,Reproductive Development...130Corn and Soybean....................................................................................130Wheat.......................................................................................................132Palmer amaranth Dry Weight and Seed Production............................................132Corn and Soybean....................................................................................132Wheat.......................................................................................................134Soil Seedbank Reduction.....................................................................................134APPENDIX..................................................................................................................................137LITERATURE CITED................................................................................................................150LIST OF TABLESTable 2.1.List of oligonucleotide primers used for PCR, gene sequencing, and qPCR of theALS,psbA, and EPSPSgenes................................................................................................................43Table 2.2.GR50avalues, standard errors (+S.E.) and resistance factors (RF) for suspectedmultiple-resistant (MR) and susceptible (S) Palmer amaranth populationsfollowingpreemergence and postemergence applications of atrazine, glyphosate, and thifensulfuron........44Table 2.3Nucleotide and amino acid polymorphisms conferring ALS-resistance inthe suspectedmultiple-resistant (MR) Michiganpopulation of Palmer amaranth...............................................45Table 3.1.Planting dates,hybrids, and herbicide application dates for the PRE, POST, andherbicide program experimentsto controlmultiple-resistant Palmer amaranth in corn in BarryCounty, MI (2013-2015)................................................................................................................74Table3.2.Herbicideproduct, application rates,timings, andmanufacturer information forherbicide treatments used for Palmer amaranth control in corn in Barry County, MI (2013-2015).........................................................................................................................................................75Table 3.3.Multiple-resistant Palmer amaranth control in corn with preemergence herbicides 45and 72 days after planting (DAP) and Palmer amaranth biomass reduction for 2013 and 2014-2015 in Barry County, MI.............................................................................................................77Table 3.4.Multiple-resistant Palmer amaranth control in corn with postemergence herbicides 7and 14 days after treatment (DAT)in Barry County, MI..............................................................78Table 3.5.Evaluation of herbicide programs for the management of multiple-resistant Palmeramaranth in corn for 2013-2015 in Barry County, MI...................................................................79Table 4.1.Herbicide information for all treatments applied to8 and 15 cm tall multiple-resistantPalmer amaranth in Barry County, MI in 2013 and 2015...........................................................105Table 4.2.Interaction of weed height and HPPD-inhibiting herbicides applied with and withoutatrazine on atrazine-resistant Palmer amaranthacontrol and biomass reduction in the field, 21DAT............................................................................................................................................106Table 4.3.Joint activity of the combination of HPPD-inhibiting herbicides and atrazine onatrazine-resistant Palmer amaranthacontrol in the field, 21 DAT.  Data were combined overyears............................................................................................................................................107Table 4.4.Equations, R2values, and GR50values calculated from dose response experiments inthe greenhouse to compare the differential response of four HPPD-inhibiting herbicides onatrazine-resistant Palmer amaranthacontrol, 14 DAT................................................................108Table 4.5.Equations, R2values, and GR50values calculated from dose response experiments inthe greenhouse to compare the differential response of four HPPD-inhibiting herbicides onatrazine-resistant Palmer amaranthadry weight, 14 DAT..........................................................109Table 4.6.Joint activity of mesotrione and atrazine applied in combination for control ofatrazine-sensitive (AS) and atrazine-resistanta(AR) Palmer amaranth biotypes in the greenhouse,14 DAT. Herbicide joint activity was determined by comparing the slope of thelog-transformeddose response of atrazine alone compared with that obtained from atrazine combined with aconstant rate of mesotrione (Flint et al. 1988; Hugie et al. 2008)..............................................110Table 4.7.Joint activity of tembotrione and atrazine applied in combination for control ofatrazine-sensitive (AS) and atrazine-resistanta(AR) Palmer amaranth biotypes in the greenhouse,14 DAT. Herbicide joint activity was determined by comparing the slope of the log-transformeddose response of atrazine alone compared with that obtained from atrazine combined with aconstant rate of mesotrione (Flint et al. 1988; Hugie et al. 2008)..............................................111Table 4.8.Joint activity of tolpyralate and atrazine applied in combination for control ofatrazine-sensitive (AS) and atrazine-resistanta(AR) Palmer amaranth biotypes in the greenhouse,14 DAT. Herbicide joint activity was determined by comparing the slope of the log-transformeddose response of atrazine alone compared withthat obtained from atrazine combined with aconstant rate of mesotrione (Flint et al. 1988; Hugie et al. 2008)..............................................112Table 4.9.Joint activity of topramezone and atrazine applied in combination for control ofatrazine-sensitive (AS) and atrazine-resistanta(AR) Palmer amaranth biotypes in the greenhouse,14 DAT. Herbicide joint activity was determined by comparing the slope of the log-transformeddose response of atrazine alone compared with that obtained from atrazine combined with aconstant rate of mesotrione (Flint et al. 1988; Hugie et al. 2008)..............................................113Table 5.1.Planting information for the long-term crop rotation study in Barry County, MI.....138Table 5.2.Best management practice (BMP) herbicide programs for multiple-resistant Palmeramaranth control used in corn, soybean, and wheat in Barry County, MI.................................139Table 5.3.Gompertzaequation parameters and growing degree days (GDD) for cumulativeemergence of Palmer amaranth in corn, soybean, and wheat for 2013, 2014, and 2015 in BarryCounty, MI..................................................................................................................................140Table 5.4.Total relative growth ratea(RGR) and the RGR for the first 3 and 5 wks after flaggingPalmer amaranth for early, mid, and late emergence cohorts in corn and soybeanin BarryCounty, MI.  Data are combined over 2013, 2014, and 2015.....................................................141Table 5.5.Palmer amaranth height, dry weight, and seed production for early, mid,and latecohorts in corn and soybean in Barry County, MI.  Data are combined over 2013, 2014, and2015..............................................................................................................................................142Table 5.6.Growing degree daysa(GDD) and days required for the reproductive development ofPalmer amaranth in corn and soybean. Data are combinedover years and pooled over cohortemergence time............................................................................................................................143Table 5.7.Growing degree daysa(GDD) and days required for the reproductive development ofearly, mid, and late Palmer amaranth emergence cohorts. Data are combined over years andpooled over corn and soybean crop.............................................................................................144LIST OF FIGURESFigure 2.1.Biomassgrowthreduction of Palmer amaranth populations in response toapplications of thifensulfuron.  Fitted lines were calculated with the 3-parameter log-logisticmodel:S(susceptible), y=90.5/(x/0.14)1.08, R2= 0.79;MR(suspected multiple-resistant),y=84.8/(x/5.96)1.26, R2= 0.77.  Means for theSpopulation are represented by (‡) and means forMRpopulation are represented by (…)..........................................................................................46Figure 2.2.Biomassgrowthreduction of Palmer amaranth populations in response toapplications of glyphosate.  Fitted lines were calculated with the 3-parameter log-logistic model:S(susceptible), y=90.5/(x/0.14)1.08, R2= 0.79;MR(suspected multiple-resistant),y=84.8/(x/5.96)1.26, R2= 0.77.  Means for theSpopulation are represented by (‡) and means forMRpopulation are represented by (…)..........................................................................................47Figure 2.3Biomassgrowthreduction of Palmer amaranth populations in response topostemergence (POST) applications of atrazine.  Fitted lines were calculated with the 3-parameter log-logistic model:S(susceptible), y=90.5/(x/0.14)1.08, R2= 0.79;MR(suspectedmultiple-resistant), y=84.8/(x/5.96)1.26, R2= 0.77.  Means for theSpopulation are represented by(‡) and means forMRpopulation are represented by (…)............................................................48Figure 2.4.Biomassgrowthreduction of Palmer amaranth populations in response topreemergence (PRE) applications of atrazine.  Fitted lines were calculated with the 3-parameterlog-logistic model:S(susceptible), y=90.5/(x/0.14)1.08, R2= 0.79;MR(suspected multiple-resistant),y=84.8/(x/5.96)1.26, R2= 0.77.  Means for theSpopulation are represented by (‡) andmeans forMRpopulation are represented by (…).........................................................................49Figure 2.5.EPSPScopy numberrelativetoALS enzymein susceptible (S) andsuspectedmultiple-resistant (MR)populations of Palmer amaranth.  Relative copy number determinedusing real-time qPCR with methods described by Gaines et al. (2010).......................................50Figure 5.1a-c.Cumulative Palmer amaranth emergence as a percent of total emergence in corn(ðu), soybean (‡), andwheat (…) in 2013 (a), 2014 (b), and 2015 (c)and bars represent standarderror of emergence.Regression parameters are listed in Table 5.3............................................145Figure 5.2a-c.Total Palmer amaranth emergence in corn (ðu), soybean (‡), and wheat (…) in2013 (a), 2014 (b), and 2015 (c).................................................................................................146Figure 5.3.Cumulative growth of Palmer amaranth as influenced by crop and emergence time,with 0 weeks representing the time of flagging for the early emergence time.  Lines for Palmeramaranth growth in weeks were fitted usingthe 4-parameter log-logistic model.  Early cohortcorn (‡), early cohort soybean (—), mid cohort corn (…), mid cohort soybean (–), late cohort corn(ƒ), and late cohort soybean (ðr)..............................................................................................147Figure 5.4.Palmer amaranth seed distribution after three years inthe best management practice(BMP) plots for four different crop rotations.  The base plot represents the initial Palmeramaranth soil seedbank.  The letters above indicate significant differences; plots followed by thesame letter are not significantly different at ⁄ = 0.05.................................................................148Figure 5.5.Palmer amaranth seed distribution after three years in the weed-free plots for fourdifferent crop rotations.  The base plot represents the initial Palmer amaranth soil seedbank...149CHAPTER 1REVIEW OF LITERATUREIntroductionThe genusAmaranthusis comprised of over 70 species both native and non-native to theUnited States (U.S.).  However, only a select few are problematic in U.S.crop productionsystems.  The most common species areredroot pigweed (Amaranthus retroflexusL.), Powellamaranth (Amaranthus powelliiS. Wats.), spiny amaranth (Amaranthus spinosusL.), smoothpigweed (Amaranthus hybridusL.), common waterhemp (Amaranthus tuberculatusMoq.Sauer.), and Palmer amaranth (Amaranthus palmeriS. Wats.) (Bensch et al. 2003; Knezevic etal. 1994; Gossett and Toler 1999; Grichar 1994; Hager et al. 2002; Massinga et al. 2001;Moolani et al. 1964; Schweizer and Lauridson 1985; Toler et al. 1996).  The majority of thesedetrimental species are monoecious (male and female structures on the same plant), whilecommon waterhemp and Palmer amaranth are dioecious (male and female structures on separateplants) (Bryson and DeFelice 2010).Although all of these species are troublesome in row cropproduction and are distributed throughout the U.S. and Canada, few have been as detrimental inrecent history as Palmer amaranth.Biology of Palmer amaranthPalmer amaranth is a C4Sonoran Desertannual indigenous to the Southwestern U.S. andNorthern Mexico, andthe most successfulAmaranthusspecies to establish itself asaweedyspecies in artificial habitats (Eleringer 1983, Sauer 1957).  Within six years of being observed inSouth Carolina in1989, Palmer amaranth was the most problematic weed in cotton (GossypiumhirsutumL.) in both North and South Carolina (Webster and Coble 1997).  By 2009, Palmeramaranth was ranked in the top 10 most troublesome weeds in corn (Zea mays), soybean(Glycinemax), and cotton in several southern states (Webster and Nichols 2012).  Thedevelopment of herbicide resistancelikely contributed to the spread and success of Palmeramaranth as a weedy species throughout most of the Southern and Great PlainsregionsoftheU.S. (Horak and Peterson 1995; Gossett et al. 1992).  While Palmer amaranth remainsa majorweed problem in these regions, it has recently spread throughout the Midwest(Sellers et al.2003)and was first identified in Michigan in 2010(Sprague 2011).Germination.The inherent ability of Palmer amaranth to germinate rapidly under favorabletemperatures in the presence of moisture is one characteristicthat has makesit a successful weedspecies (Ehleringer 1983).  Temperatures for initial and peak germination vary widely for thedifferentAmaranthusspecies (Guo and Al-Khatib 2003; Steckel et al. 2004; Steinmaus et al.2000).  Steinmaus et al. (2000) reported that the minimum temperature requirement for Palmeramaranth germination was approximately 17 C.  While initial germination can occur undercooler soil temperatures, Palmer amaranth favors warmer conditions for germination.Palmeramaranth germination was 8 and83% when temperatures were alternated ± 40% at 5 and 30 C,respectively (Steckel et al. 2004).  Peak germination occurred when temperaturewas alternatedfrom 32 to 38 C;when temperatures were alternated from 45 to 50 C no germination occurred(Guo and Al-Khatib 2003).Emergence.Similar to germination, time to emergence also differs among theAmaranthusspp.with Palmer amaranth emergence occurring within 5 d of planting, while otherAmaranthusspp.may take up to 17 d (Sellers et al. 2003).Under non-crop situations, Palmer amaranthemergence has been reported to occur from March through October in California and from mid-May through September in Michigan(Keeley et al. 1987; Powell 2014) indicating that,regardless of climate, Palmer amaranth has the ability to emerge throughout the growing season.This rapid and continued emergence may require the useofresidual herbicides to manage Palmeramaranth throughout the growing season.  Including different crops and cultural practices into acrop rotation may help to reduce Palmer amaranth emergence.Soybean canopy can reducePalmer amaranth emergence >70% (Jha and Norsworthy2009).Palmer amaranth emergencecan also be influenced by burial depth,with greater emergence occurring when seeds wereburied‹ 1.3 cm (Keeley et al. 1987).  The decline in emergence is likely related to the lightrequirement and phytochrome-mediated responses associated with Palmer amaranth germination.Jha et al. (2010) found that once soybean canopied,far-red light increased which inhibitedPalmer amaranth germination.  Further research needs to be conducted to determine the influenceof other crops on the emergence of Palmer amaranth in cooler climates.Growth rate,BiomassAccumulation, andSeedProduction.Other characteristics that canattribute to the competitiveness of Palmer amaranth with other weeds and crops are its rapidgrowth rate, biomass accumulation, and abundant seed production.  Palmer amaranth grew at aquicker rate and accumulated more biomass than otherAmaranthusspp., including redrootpigweed, common waterhemp, and tumble pigweed (Amaranthus albusL.) (Horak and Loughin2000).  Palmer amaranth has also been reported to be 45 and 600% taller than commonwaterhemp and redroot pigweed, respectively (Sellers et al. 2003).  The rapid growth rate ofPalmer amaranth makes it an ideal indicator species for herbicide applications when dealing withmixedAmaranthuspopulations (Horak and Loughin 2000).Climate and time of establishmentgreatly influence Palmer amaranth seed production.  Atoptimal emergence times Palmer amaranth produced 250,000, 446,000, 613,000 seedsplant-1inMissouri, Georgia, and California, respectively, when there was no inter-or intra-specific plantcompetition (Keeley et al. 1987; Sellers et al. 2003; Webster and Grey 2015).  Seed productionof Palmer amaranth declines as plants emerge later in the growing season.  In California, seedproduction was reduced 90% when plants were established in August compared with May(Keeley et al. 1987).  A 50% reduction in seed production was observed when Palmer amaranthwas established 6 wk after initial cohort planting in Georgia (Webster and Grey 2015).  Inaddition to time of emergence, the presence of a crop at the time of Palmer amaranthestablishment also influences seed production.When established at the time of cotton plantingPalmer amaranth seedproductionwas reduced by30%,compared with plants grown in theabsence of cotton (Webster and Grey 2015).  At a density of 8 plants m-2, seed production wasreduced from 514,000 to 91,000 seeds m-2when Palmer amaranth emergence was delayed untilthe7-leaf stage in corn (Massinga et al. 2001).  Seed production was reduced 97% when Palmeramaranth emerged inV3 to V6 soybean compared, withplants that emerged fromsoybeanplanting to the V3 stage (Jha et al. 2008).  If Palmer amaranth is not controlledthroughout thegrowing season seedrainwill add tothe soil seedbank,perpetuating the problem.  Littleinformation is available on how cropping system and Palmer amaranth emergence timeinfluences the growth and seed production of Palmer amaranth in thecooler climate of Michigan.Competition.Palmer amaranth readily competes with crops for water, light, and nutrientsresulting in a negative impact on yield. Corn yield was reduced up to 91% when 8Palmeramaranthplants m-2competed with corn throughoutthe growing season (Massinga 2001).  WhenPalmer amaranth emergence was delayed until V4 to V7 corn, yield was reduced by <35%(Massinga et al. 2001). Competition from Palmer amaranth at densities ranging 0.33 to 10 plantsm-1row reduced soybean yield from 17 to 64% (Klingaman and Oliver 1994).  The ability ofPalmer amaranth to effectively compete and reduce yield even after crop establishment may bedue to high photosynthetic capacity and the ability to acclimate to shade.  Palmer amaranth hasadapted to tolerate and maintain growth under high light and temperature environments, with90% of peak photosynthetic rate occurring between 36 and 46oC (Eleringer 1983).  However,photosynthetic rate is highlydependent on temperature.Photosynthesis occurredat 50% of themaximum rate at 25oC(Eleringer 1983),indicating that Palmer amaranth may not be abletoeffectively compete with crops in a cooler climate like Michigan.To compensate for shading,Palmer amaranth,can alter leaf area and increase chlorophyll content to maintain growth andeffectively compete with crops (Jha et al. 2008).HerbicideResistanceIn addition to Palmer amaranth›s biological characteristics, the propensity at which Palmeramaranth develops resistance to different herbicideshas perpetuated it as a problem weed.Palmer amaranth has developed resistance to severalherbicide sites of action including:acetolactate synthase inhibitors (ALS) (Group 2), microtubule inhibitors (Group 3), photosystemII (PSII)(Group 5), Protoporphyrinogen oxidase inhibitors (PPO) (Group 14), and 4-hydroxyphynelpyruvate dioxygenase inhibitors (HPPD) (Group 27) (Gossett 1992, Horak andPeterson 1995, Heap 2016).  Resistance to ALS-inhibiting herbicides in Palmer amaranth hasbeen reported to be as high as 2,800 timestheuse rate of imazethapyr (Sprague et al. 1997).While not widespread 6, 14, and 23 times the use rate were required to achieve the same level ofcontrol in susceptible Palmer amaranth compared with resistant populations for dinitroaniline,atrazine,andHPPD-inhibiting herbicides, respectively (Gossett et al. 1992; Jhala et al. 2014).Perhaps one of the most important and widespread resistances in Palmer amaranth was thedevelopment of glyphosate resistance.  One of the major contributors to the development ofherbicide resistance was the rapid adoption of glyphosate-resistant (GR) crops.  This adoption ofGR crops led to multiple applications of a single herbicide site of action glyphosate (Group 9),which increased selection pressurefor resistant weed biotypes (Young 2006; Owen 2008;Vencill et al. 2012).  The first case of glyphosate-resistant Palmer amaranth was reported inGeorgia in 2005 (Culpepper et al. 2006).  This population survived applications of glyphosate inthe field at12 times (10 kg ae ha-1) the normal use rate.  Palmer amaranth resistant to glyphosatehas since spread to 23 other states including Michigan (Heap 2016).  The magnitude ofglyphosate resistance within these populations ranges from 1.5 to 115 times the rate ofglyphosate required to achieve 50% control in a susceptible population (Norsworthy et al. 2008;Steckel et al. 2008).  In addition to resistance to a single herbicide site of action, there are severalpopulations demonstrating resistance to multipleherbicide sites of action (Heap 2016).  InMichigan, there are three different confirmed resistance profiles in Palmer amaranth rangingfrom single site of action glyphosate or ALS to multiple sites glyphosate and ALS within a singlepopulation.  In addition to these there is a population suspected of being resistant to threeherbicide sites of action:glyphosate, ALS-inhibitors, and atrazine.  There have been severalreported instances of populations of Palmer amaranth resistant to glyphosate and ALS-inhibitors,however there has only been one other documented case of Palmer amaranth resistant toglyphosate, ALS-inhibitors, and atrazine (Heap 2016).  This population was found in Georgiaand there has been littleinformationpublished.  Common waterhemp, a close relative of Palmeramaranth has developed resistance to five different herbicide sites of action in a single Illinoispopulation (Evans et al. 2015).  The development of resistance,specifically multiple resistance,drastically limits the options forcontrol.Herbicide ResistanceMechanisms.The primary mechanisms in which resistance to herbicidesis conferred in weeds has been categorized into five mechanisms: altered-target site, metabolism-based, reduced absorption/translocation, sequestration intovacuoles, and gene amplification(Heap 2014).  Altered target-site resistance is the most common mechanism of resistance forvarious herbicides in several weed species.  In Palmer amaranth and otherAmaranthusspp., theprimary mechanism for resistance to ALS-inhibiting herbicides is due to an altered target site viaamino acid substitution within the ALS enzyme (Foes et al. 1998; Franssen et al. 2001; Spragueet al. 1997).  Betha et al. (2015) reported that a proline to serine change at site 197 in a Kansaspopulation of Palmer amaranth. The majority of instances of atrazine resistance have beenattributed to either amino acid substitutions at the D1 protein that have been found in otherAmaranthusspp., and insome instances non-target site mediated forms of resistance have beenreported (Foes et al. 1998; Patzoldt et al. 2003).  In a Kansas population of triazine-resistantPalmer amaranth it was determined that resistance was non-target site based and possiblyglutathione-s-transferase conjugation (Betha et al. 2015).  In 2010, Gaines et al. (2010) identifiedgene amplification of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) enzyme as anovel mechanism for glyphosate-resistance in Palmer amaranth.  Inthe Palmer amaranthpopulation that they studied from Georgia expression of the EPSPS enzyme relative to the ALSenzyme ranged from 1.0 to 1.3 for the susceptible population and was 5 to >160 copies of theEPSPS enzyme in the resistant population (Gaineset al. 2010).  Since 2010, gene amplificationhas been confirmed as the mechanism of resistance to glyphosate in populations of Palmeramaranth in Mississippi, North Carolina, and New Mexico (Chandi et al. 2012; Ribeiro et al.2013; Mohseni-Moghadam et al.2013).Palmer amaranth ManagementIn the Northern Corn Belt the majority of Palmer amaranth populations are resistant toglyphosate and/or ALS-inhibiting herbicides. This poses significant challenges for thedevelopment of effective Palmer amaranthmanagement strategies.  With limited herbicideoptions available in soybean, planting corn may provide farmers the greatest opportunity toeffectively managing Palmer amaranth.  One reason is that there are a greater number ofeffective herbicide site ofaction groups available in corn versus soybean.  With Palmer amaranthbeing a relatively new problem in major corn producing regions of the U.S., little research hasbeen conducted on effective management strategies in corn.  The majority of research has beenfocused on multiple-resistant Palmer amaranth management in cotton, soybean, and peanut(Ward et al. 2013).  However, in corn Johnson et al. (2012) found that atrazine,s-metolachlor,and isoxaflutole applied preemergence (PRE) alone and in combinationwith other cornherbicides was able to provide 78 to 100% control of herbicide-susceptible Palmer amaranth, 8wks after application.  The addition of atrazine to low rates of pyroxasulfone ands-metolachlorimprovedPalmer amaranth control when applied PRE (Geier et al. 2006).  Atrazine at 2.24 kgha-1applied postemergence (POST) controlledherbicide-susceptible Palmer amaranth 96%, 28 dafter treatment (Stephenson et al. 2015).  The addition of the ALS-inhibitor, thiencarbazone-methyl, to tembotrione didnot improve Palmer amaranth control. However, the addition of eitheratrazine, glyphosate, or glufosinate to the combination improved control 4 to 6% (Stephenson etal. 2015).  Others have reported that the use of HPPD-inhibiting herbicides, a common siteofaction in corn production, can effectively control resistant Palmer amaranth with isoxaflutole,tembotrione, and mesotrione providing 90, 92, and 97% control 21 to 28 DAT, respectively(Norsworthy et al. 2008; Schuster et al. 2008; Stephenson et al. 2015).In order to maintain high levels of Palmer amaranth controlPOST,application timing aspertaining to weed height must be considered.  Corbett et al. (2004), observed greater levels ofPalmer amaranth control when glufosinate was appliedto 2 to 5 cmweeds compared with 8 to10 cm.  Control of Palmer amaranth was reduced when herbicide applications were delayed for 8d after intended application timing (Eure et al. 2013). The success of the previously describedmanagement strategies is primarily dueto the susceptibility of the Palmer amaranth populationsto specific herbicide site of action groups.  However, whenmanagingmultiple-resistantpopulations of Palmer amaranth, management strategies need to be based on the use of multipleeffective herbicide sites of action.  These strategies will likely need to include multiple herbicideapplications,such asPRE followed by (fb) POST programs, due to Palmer amaranths prolongedemergence patterns and fastgrowth rate. Little information is available on detailed managementstrategies for multiple-resistant Palmer amaranth in corn.Interaction of HPPD-Inhibitors andAtrazineCombinations of two or more herbicides can yield either an additive, synergistic, orantagonistic response.  These responses are determined by calculating a predicted value andcomparing it to an expected value of the herbicide combination (Colby 1967; Flint et al. 1988;Gowing 1960).  If the observed value is significantly greater than the calculated predicted valuethen the herbicidecombination is deemed to be synergistic.  A combination is antagonistic if theobserved value is significantly less than predicted.  If the values of the observed and predictedare equal then the combination is additive.  Previous research has shown that antagonism canoccur between mesotrione and sulfonylurea herbicides.  The addition of mesotrione tonicosulfuron reduced green foxtail (Setaria viridisL.) control up to 23% compared withnicosulfuron alone (Schuster et al. 2008).  The mechanisms by which antagonism can occur hasbeen attributedtoreduced absorption, reduced translocation, and physiological interactionswithin the plant (Hart and Wax 1996; Green 1989; Schuster et al. 2007).  A well-documentedinstance of herbicide synergism has been observed with the 4-hydroxyphenylpyruvatedioxygenase (HPPD)-inhibiting herbicides applied in combination with atrazine (Abendroth etal. 2006, Armel et al. 2007, Hugie et al. 2008, Woodyard et al. 2009a).  The modes of action foratrazine and the HPPD-inhibitorsare complementary to each other which leads to an increase inactivity when they are applied in combination.Herbicides that inhibit the HPPD enzyme are members of the isoxazole, pyrazole, pyrazoloneand triketone chemical families.  HPPD-inhibiting herbicides stop the conversion of 4-hydroxyphenylpyruvate to homogentisate, which leads to the depletion of plastoquinone and ⁄-tocopherol (Grossmann and Ehrhadt 2007; Mitchell et al. 2001; Pallett et al. 1998; Schulz 1993).Plastoquinone is an enzyme cofactor for phytoene desaturase and depletion results in a loss ofcarotenoid production, causing the bleaching of new tissue (Mitchell et al 2001; Schulz et al.1993).As a member of thes-triazine chemical family atrazine is a photosynthetic inhibitorfunctioning withinPSII, and has both PRE and POST herbicidal activity.  In PRE and POSTapplications, atrazine is rapidly absorbed via passive diffusion (Thompson and Slife 1970; Priceand Blake 1983).   Movement of atrazine is primarily conducted within the xylem in thetranspiration stream, and once in the leaves movement is acropetal following the transpirationstream (Jachetta et al. 1986; Thompson and Slife 1970).  Initial injury symptoms from atrazineapplied either PRE or POST is localized chlorosis leading to necrosis on leaf margins.Ultimately herbicidal activity of atrazine and plant death is caused by the binding of atrazineover plastoquinoneto the QBregion of the D1 protein in the electron transport chain of PSII(Hess 2000, Pfister 1981).  This binding results in the production of singlet oxygen and tripletchlorophyll which results in lipid peroxidation of cell membranes (Hess 2000).The synergismbetween atrazine and the HPPD-inhibitors may be attributed totheindirect effectof plastoquinone and ⁄-tocopherol depletion caused by the HPPD inhibitors (Kruk et al. 2005;Trebst et al. 2002).  This synergism has been observed in giant ragweed (AmbrosiatrifidaL.),common lambsquarters (Chenopodium albumL.), velvetleaf (Abutilon theophrastiM.), commonwaterhemp, and redroot pigweed (Abendroth et al. 2006; Hugie et al. 2008; Woodyard et al.2009a; Woodyard et al. 2009b). Synergism between PSII and HPPD-inhibitors has beenobserved in triazine-resistant redroot pigweed and velvetleaf, however the extent of thisinteraction is dependent on whether the mechanism of resistance is altered-target site ormetabolism based (Woodyard et al. 2009b).  The majorityof previous research has been focusedon the interaction of mesotrione and atrazine;little information is available on the potentialsynergism with the other classes of HPPD-inhibitors and atrazine.  While previous research hasshown the presence of synergism with HPPD-inhibitors and atrazine in other triazine-resistantweed species, it is unknown whether this interaction exists in triazine-resistant Palmer amaranth.Cultural Practices for Depletion of Soil SeedbankManagement of herbicide resistance should include cultural practices to reduce theabundance of these species within the soil seedbank, andshouldnot be limited to only herbicide-based programs (Norsworthy et al. 2012).  Declines in the soil seedbank can be attributed tocultural practices such as crop rotation and tillage, or through natural processes like seedpredation and seed mortality over time (Ball and Miller 1990; Bellinder et al. 2003; Buhler et al.2001; Cardina et al. 2002; Davis et al. 2005; Sonoskie et al. 2013).  Rotating crops from year toyear can influence weed species densities and the soil seedbank based on the differentmanagement practices (Ball and Miller 1990, Buhler et al. 2001, Cardina et al. 2002 Davis et al.2005, Bellinder et al. 2003). The pairing of an herbicide program along with tillage can alsoreduce soil seedbank densities (Ball and Miller 1990, Bellinder et al. 2003, Davis et al. 2005).The use of continuous corn or a corn and soybean rotation reduced shepherd›s-purse (Capsellabursa-pastorisL. Medik), Pennsylvania smartweed (Polygonum penslvanicumL.), cornspeedwell (Veronica arvensisL.), yellow woodsorrel (Oxalis strictaL.), spotted spurge(Chamaesyce maculateL. Small), and redroot pigweed compared with a corn, oats, and hayrotation (Cardina et al. 2002).  Herbicide availability and tillage practices associated with cornmay be one reason for relatively low increases in the weed seedbank compared with rotationsthat included rye and legume crops (Bellinder et al. 2003).  In monoculture croppingsystems fewwell adapted species will dominate the seedbank, whereas varying levels of competition,allelopathy, soil disturbance, and management strategies associated with diverse croppingsystems can increase diversity and reducethesize of the seedbank (Buhler et al. 1997; Cardina etal. 2002).  Seed predation can also influence the soil seedbank.  Seed predation from insects androdents resulted in a Palmer amaranth seedbank decline of 66 and 75%, respectively (Sosnoskieet al. 2013).  Sosnoskie et al. (2013), also reported that inaGeorgia Palmer amaranth populationseed burial depth can affect viability, with 9 and 22% of Palmer amaranthremaining viableafter3 years at 1 cm and 40 cm burial depths, respectively.  In Michigan, one year after burialtherewas no difference between burial depth and seed viability (Powell 2014).  Powell (2014)concluded that the Palmer amaranth seedbank could be reduced anywhere from 50 to 90%in oneyearif no seed was produced.  These results indicate that significant reductions can be made in ashort amount of time to the Palmer amaranth seedbank if best management practices are utilizedto reduce Palmer amaranth seed production.LITERATURE CITEDLITERATURECITEDAbendroth JA, Martin AR, Roeth FW (2006) Plant response to combinations of mesotrione andphotosystem II inhibitors 1.Weed Technol20.1:267•274Armel GR, Rardon PL, McComrick MC, Ferry NM (2007) Differential response of severalcarotenoid biosynthesis inhibitors in mixtures with atrazine.Weed Technol21.4:947•953Ball DA, Miller SD (1990) Weed seed population response to tillage and herbicide use in threeirrigated cropping sequences.Weed Sci511•517Bellinder RR, Dillard HR,Shah DA (2003) Weed seedbank community responses to croprotation schemes.Crop Protect23.2:95•101Bensch CN, Horak MJ, Peterson D (2003) Interference of redroot pigweed (Amaranthusretroflexus), Palmer amaranth (A. palmeri), and common waterhemp (A. rudis) in soybean.Weed Sci 51:37•43Bryson CT, DeFelice MS, eds (2010) Weeds of the Midwestern United States & Central Canada.Athens, GA: University of Georgia Press. Pp 34•39.Buhler DD, Hartzler RG, Forcella F (1997) Implications of weed seedbank dynamics to weedmanagement. Weed Sci 45:329•336Buhler DD, Kohler KA, Thompson RL (2001) Weed seed bank dynamics during a five-year croprotation 1.Weed Technol15.1:170•176Cardina JC, Herms P, Doohan DJ (2002) Crop rotation and tillage system effects on weedseedbanks.Weed Sci50.4:448•460Chandi A, Milla-Lewis SR, Giacomini D, Westra P, Preston C, Jordan DL, York AC, Burton JD,Whitaker JR (2012) Inheritance of evolved glyphosate resistance in a North Carolina Palmeramaranth (Amaranthus palmeri) biotype. Int J Agron DOI:10.1155/2012/176108Colby SR (1967) Calculating synergistic and antagonistic responses of herbicidecombinations.Weeds20•22Corbett JL, Askew SD, Thomas WE, Wilcut JW (2004) Weed efficacy evaluations forbromoxynil, glufosinate, glyphosate, pyrithiobac, and sulfosate. Weed Technol 18:443•453Culpepper AS, Grey TL, Vencill WK, Kichler JM, Webster TM, Brown SM, York AC, DavisJW, Hanna WW (2006) Glyphosate-resistant Palmer amaranth (Amaranthus palmeri)confirmed in Georgia.Weed Sci54.4:620•626Davis AS, Renner KA, Gross KL (2005) Weed seedbank and community shifts in a long-termcropping systems experiment.Weed Sci53.3:296•306Ehleringer J (1983) Ecophysiology ofAmaranthus palmeri, a sonoran desert summer annual.Oecologia 57:10•112Eure PM, Jordan DL, Fisher LR, York AC (2013) Efficacy of herbicides when spray solutionapplication is delayed. Int J Agron DOI: 10.1155/2013/782486Evans CM, Tranel P, Riechers DE, Davis AS, Maxwell D, Gonzini L, Hager AG (2015)Characterization of a novel five-way resistant population of waterhempAmaranthustuberculatus. Page 61inProceeding of the 70thAnnual Meeting of the North Central WeedScience Society. Indianapolis, IN:  North Central Weed Science SocietyFlint JL, Cornelius PL, Barrett M (1988) Analyzing herbicide interactions: a statistical treatmentof Colby's method.Weed Technol304•309Foes MJ, Tranel PJ, Wax, LM, Stoller EW (1998)A biotype of common waterhemp(Amaranthus rudis) resistant to triazine and ALS herbicides.Weed Sci514•520Franssen AS, Skinner DZ, Al-Khatib K, Horak MJ, Kulakow PA (2001) Interspecifichybridization and gene flow of ALS resistance inAmaranthusspecies.Weed Sci49.5:598•606Gaines TA, Zhang W, Wang D, Bukun B, Chisholm ST, Shaner DL, Nissen SJ, Patzoldt WL,Tranel PJ, Culpepper AS, Grey TL, Webster TM, Vencill WK, Sammons RD, Jiang J,Preston C, Leach JE, Westra P (2010) Gene amplification confers glyphosate resistance inAmaranthus palmeri. Proc Natl Acad Sci 107.3:1029•1034Geier PW, Stahlman PW, Frihauf JC (2006) KIH-485 and s-metolachlor efficacy comparisons inconventional and no-tillage corn.Weed Technol20.3:622•626Gossett BJ, Toler JE (1999) Differential control of Palmer amaranth (Amaranthus palmeri) andpigweed (Amaranthus hybridus) by postemergence herbicides in soybean (Glycine max)Weed Technol 13:165•168Gossett BJ, Murdock EC, Toler JE (1992) Resistance of Palmer amaranth (Amaranthuspalmeri)to the dinitroaniline herbicides.Weed Technol587•591Gowing DP (1960) Comments on tests of herbicide mixtures.Weeds8.3:379•391Green JM (1989) Herbicide antagonism at the whole plant level. Weed Technol 3:217•226Grichar WJ (1994) Spinyamaranth (Amaranthus spinosusL.) control in peanut (ArachishypogaeaL.). Weed Technol 8:199•202.Grossmann K, Ehrhardt T (2007) On the mechanism of action and selectivity of the cornherbicide topramezone: a new inhibitor of 4hydroxyphenylpyruvate dioxygenase.PestManag Sci63.5:429•439Guo P, Al-Khatib K (2003) Temperature effects on germination and growth of redroot pigweed(Amaranthus retroflexus), Palmer amaranth (A. palmeri), and common waterhemp (A.rudis).Weed Sci51.6:869•875Hager AG, WaxLM, Bollero GA (2002) Common waterhemp (Amaranthus rudis) interferencein soybean. Weed Sci 50:607•610Hart SE, Wax LM (1996) Dicamba antagonizes grass weed control with imazethapyr byreducing foliar absorption. Weed Technol 10:828•834Heap I (2014) Herbicide resistant weeds. Pages 281-301inPimentel D, Peshin R, eds. IntegratedPest Management. Netherlands: SpringerHeap I (2016) The international survey of herbicide resistant weeds.www.weedscience.com.Accessed: February 5, 2016.Hess DF (2000) Light-dependent herbicides: an overview.Weed Sci48.2:160•170Horak MJ, Loughin TM (2000) Growth analysis of fourAmaranthus species.WeedSci48.3:347•355Horak MJ, Peterson DE (1995) Biotypes of Palmer amaranth (Amaranthus palmeri) andcommon waterhemp(Amaranthus rudis) are resistant to imazethapyr andthifensulfuron.Weed Technol9:192•195Hugie JA, Bollero GA, Tranel PJ (2008) Defining the rate requirements for synergism betweenmesotrione and atrazine in redroot pigweed (Amaranthus retroflexus).Weed Sci56.2:26•-270Jachetta JJ, Appleby AP, Boserma L (1986) Apoplastic and symplastic pathways of atrazine andglyphosate transport in shoots of seedling sunflower. Plant Physiol 82:1000•1007Jha P, Norsworthy JK (2009) Soybean canopy and tillage effects on emergence of Palmeramaranth (Amaranthus palmeri) from a natural seed bank.Weed Sci57.6:644•651Jha P, Norseworthy JK, Riley MB, Bridges Jr W (2010) Annual changes in temperature and lightrequirements for germination of Palmer amaranth (Amaranthuspalmeri) seeds retrieved formthe soil.  Weed Sci 58:426•432Jha P, Norsworthy JK, Bridges Jr W, Riley MB (2008) Influence of glyphosate timing and rowwidth on Palmer amaranth (Amaranthus palmeri) and pusley (Richardia spp.) demographicsin glyphosate-resistant soybean.Weed Sci56.3:408•415Jhala AJ, Sandell LD, Rana N, Kruger GR, Knezevic SZ (2014) Confirmation and control oftriazine and 4-hydroxyphenylpyruvate dioxygenase-inhibiting herbicide-resistant Palmeramaranth (Amaranthus palmeri) inNebraska. Weed Technol 28:28•38Johnson WG, Chahal GS, Regehr DL (2012) Efficacy of various corn herbicides applied preplantincorporated and preemergence.Weed Technol26.2:220•229Keeley PE, Carter CH, Thullen RJ (1987) Influence of planting date ongrowth of Palmeramaranth (Amaranthus palmeri).Weed Sci199•204Klingaman TE, Oliver LR (1994) Palmer amaranth (Amaranthus palmeri) interference insoybeans (Glycine max).Weed Sci523•527Knezevic SZ, Weise SF, Swanton CJ (1994) Interference of redrootpigweed (Amaranthusretroflexus) in corn (Zea mays). Weed Sci 42:568•573Kruk J, Holländer-Czytko H, Oettmeier W, Trebst A (2005) Tocopherol as singlet oxygenscavenger in photosystem II.Journal of Plant Phys162.7:749•757Massinga RA, Curie RS, HorakMJ, Boyer Jr J (2001) Interference of Palmer amaranth incorn.Weed Sci49.2:202•208Menges RM (1987) Weed seed population dynamics during six years of weed managementsystems in crop rotations on irrigated soil.Weed Sci328•332Mengistu LW, Christoffers MJ, Lym RG (2005) ApsbAinKochia scoparia(L) Schrad fromrailroad rights-of-way with resistance to diuron, tebuthiuron and metribuzin. Pest Manag Sci61:1035•1042Mitchell G, Barlett DW, Fraser TEM, Hawkes TR, Holt DC, Townson JK, Wichert RA (2001)Mesotrione: a new selective herbicide for use in maize.Pest Manag Sci57.2:120•128Mohseni-Moghadam M, Schroeder J, Ashigh J (2013) Mechanism of resistance and inheritancein glyphosate resistant Palmer amaranth (Amaranthus palmeri)populations from NewMexico, USA. Weed Sci 61:517•525Moolani KM, Knake EL, Slife FW (1964) Competition of smooth pigweed with corn andsoybeans. Weeds 126•128Norsworthy JK, Griffith GM, Scott RC, Smith KL, Oliver LR (2008) Confirmation and controlof glyphosate-resistantPalmer amaranth (Amaranthus palmeri) in Arkansas. Weed Technol22:108•113Norsworthy JK, Ward SM, Shaw DR, Llewellyn RS, Nichols RL, Webster TM, Bradley KW,Frisvold G, Powles SB, Burgis, NR, Witt, WW, Barrett M (2012) Reducing risks of herbicideresistance:  best management practices and recommendations. Weed Sci60:31•62Owen MDK, Zelaya IA (2005) Herbicideresistant crops and weed resistance to herbicides.PestManag Sci61.3:301•311Pallett KE, Little JP, Sheeky M, Veerasekaran P (1998) The mode of action of isoxaflutole: I.Physiological effects, metabolism, and selectivity.Pesticide Biochemistry andPhys62.2:113•124Patzoldt, WL, Tranel PJ, Hager AG (2002) Variable herbicide responses among Illinoiswaterhemp (Amaranthus rudisandA. tuberculatus)populations.  Crop Prot 21:707•712Patzoldt WL, Dixon BS, Tranel PJ (2003) Triazine resistance inAmaranthus tuberculatus(Moq)Sauer that is not site-of-action mediated. Pest Manag Sci 59:1134•1142Pfister K, Steinback KE, Gardner G, Arntzen (1981) Photoaffinity labeling of an herbicidereceptor protein in chloroplast membranes.Proc Natl Acad Sci78.2:981•985Powell DK (2014) Biology and management of multiple (glyphosate/ALS)-resistant Palmeramaranth in Michigan soybean. Ph.D dissertation. East Lansing, MI: Michigan StateUniversity. 122 pPrice TP, Blake NE (1983) Characterization of atrazine accumulation by excised velvetleaf(Abutilon theophrasti) roots.  Weed Sci 31:14•19Ribeiro DN (2013) Mechanisms and variability of glyphosate resistance inAmaranthus palmeriandIpomoea lacunosePh.D dissertation. Starkville, MS: Mississippi State University. 127 pSauer J (1957) Recent migration and evolution of the dioecious amaranths.Evolution11•31Schulz A, Ort O, Beyer P, Kleinig H (1993) SC0051, a2benzoylcyclohexane1, 3dionebleaching herbicide, is a potent inhibitor of the enzyme phydroxyphenylpyruvatedioxygenase.FEBS letters318.2:162•166Schuster CL, Al-Khatib K, Dille JA (2007) Mechanism of antagonism of mesotrione onsulfonylurea herbicides. Weed Sci 55:429•434Schuster CL, Al-Khatib K, Dille JA (2008) Efficacy of sulfonylurea herbicide when tank mixedwith mesotrione. Weed Technol 22:222•230Schweizer EE, Lauridson TC (1985) Powell amaranth (Amaranthus powellii) interference insugarbeet (Beta vulgaris). Weed Sci 33:518•520Sellers BA, Smeda RJ, Johnson WG, Kendig JA, Ellersieck MR (2003) Comparative growth ofsixAmaranthus speciesin Missouri.Weed Sci51.3:329•333Sonoskie LM, Webster TM, Culpepper AS (2013) Glyphosateresistance does not affect Palmeramaranth (Amaranthus palmeri) seedbank longevity. Weed Sci 61:283•288Sprague CL (2011) Glyphosate-resistant Palmer amaranth confirmed in Michigan.http://msuweeds.com/newsletter-holder/emerging-weed-issues/glyphosate-resistant-palmer-amaranth-confirmed-in-southwest-michigan/.  Accessed July 11, 2016Sprague CL, Stoller EW, Wax LM, Horak MJ (1997) Palmer amaranth (Amaranthus palmeri)and common waterhemp (Amaranthus rudis) resistance to selected ALS-inhibitingherbicides.Weed Sci192•197Steckel LE, Main CL, Ellis AT, Mueller TC (2008) Palmer amaranth (Amaranthus palmeri) inTennessee has low level glyphosate resistance. Weed Technol 22:119•123Steckel LE, Sprague CL, Stoller EW, Wax LM (2004) Temperature effects on germination ofnineAmaranthusspecies. Weed Sci 52:217•221Steinmaus SJ, Prather TS, Holt JS (2000) Estimation of base temperatures for nine weedspecies.J of Exper Bot51.343:275•286Stephenson IV DO, Bond JA, Landry RL, Edwards HM (2015) Weedmanagement in corn withpostemergence applications of tembotrione or thiencarbazone:tembotrione.WeedTechnol29.3:350•358Thompson L, Jr, Slife FW (1970) Root and Foliar absorption of atrazine applied postemergenceto broadleaf weeds.  Weed Sci 18:349•351Toler JE, Guice B, Murdock EC (1996) Interference between Johnsongrass (Sorghumhalepense), smooth pigweed (Amaranthus hybridus), and soybean (Gylcine max). Weed Sci44:331•338Trebst A, Depka B, Holländer-Czytko H (2002) A specific role for tocopherol and of chemicalsinglet oxygen quenchers in the maintenance of photosystem II structure and function inChlamydomonas reinhardtii.FEBS letters516.1:156•160Vencill WK, Nichols RL, Webster TM, Soteres JK, Mallory-Smith C, Burgos NR, Johnson WG,McClelland MR (2012) Herbicide resistance: toward an understanding of resistancedevelopment and the impact of herbicide-resistant crops.Weed Sci60:2•30Ward SM, Webster TM, Steckel LE (2013) Palmer amaranth (Amaranthus palmeri): a review.Weed Technol27:12•27Webster TM, Coble HD (1997) Changes in the weed species composition of the Southern UnitedStates: 1974 to 1995. Weed Technol 11:308•317Webster TM, Grey TL (2015) Glyphosate-resistant Palmer amaranth (Amaranthus palmeri)morphology, growth, andseed production in Georgia. Weed Sci 63:264•272Webster TM, Nichols RL (2012) Changes in the prevalence of weed species in the majoragronomic crops of the Southern United States: 1994/1995 to 2008/2009. Weed Sci 60:145•157Whaley CM, Wilson HP, Westwood JH (2007) A new mutation in plantALSconfers resistance tofive classes of ALS-inhibiting herbicides. Weed Sci 55:83•90Woodyard AJ, Bollero GA, Riechers DE (2009a) Broadleaf weed management in corn utilizingsynergistic postemergence herbicide combinations. Weed Technol 23:513•518Woodyard AJ, Hugie JA, Riechers DE (2009b) Interactions of mesotrione and atrazine in twoweed species with different mechanisms for atrazine resistance.Weed Sci57.4:369•378Young BG (2006) Changes in herbicide use patterns and production practices resulting fromglyphosate-resistant crops 1.Weed Technol20.2:301•307CHAPTER 2CONFIRMATION OF A THREE-WAY (GLYPHOSATE, ALS, AND ATRAZINE)HERBICIDE-RESISTANT POPULATIONOF PALMER AMARANTH INMICHIGANAbstractThe failure of PRE and POST applications of atrazine to control Palmer amaranth in recent fieldstudiesprompted further investigation to determine if this population had evolved resistance tomultipleherbicide sites of actionincluding, glyphosate (Group 9), thifensulfuron (Group 2), andatrazine (Group 5).  Greenhouse and laboratory experiments were conducted to: 1) confirm thepresence of a 3-way resistant Palmer amaranth population, 2) determine the resistance factor(RF) for herbicide site of action group, and 3) determinethemolecular basis for resistance in thispopulation.  In the greenhouse, the combination of glyphosate + thifensulfuron + atrazine at1.26+ 0.0044 + 1.12 kg ai ha-1provided 55% control of the suspectedmultiple-resistant (MR) Palmeramaranth population and 93% control of the known susceptible population (S).  Thedecreasedsensitivity of the MRpopulation compared withtheSpopulation at labeled use rates of theseherbicides indicated that this population waslikely resistant to three different herbicide site ofaction groups.  The RF values for POST applications of glyphosate, thifensulfuron, and atrazinewere 12.2, 42.9, and 9.3X, respectively, for the MRPalmer amaranth population relative to the Spopulation.  The RF value for atrazine PRE for the MRpopulation was 112.2X.  Laboratoryexperiments confirmed that the mechanisms for ALS-inhibitor andglyphosate resistance in theMRPalmer amaranth population were target site based, via amino acid substitution andamplifiedEPSPScopy number, respectively.  For the ALS-inhibitor resistance there was a Pro toLeu substitution at site 197 and for the glyphosate resistance there was a >50-fold increase inEPSPScopy number.  There were no nucleotide changes in thepsbAgene, therefore atrazineresistance in this population was nottarget-site mediated.  Atrazine resistance in this populationcould possibly be metabolism based.  The development of multiple resistance in Palmeramaranth populationsposessignificantmanagementchallenges to growers.Nomenclature:Atrazine; glyphosate; thifensulfuron; Palmer amaranth,Amaranthus palmeriS.Wats.Keywords:3-way resistance; gene amplification; mechanism of resistance; molecular analysis;resistance factor.IntroductionPalmer amaranth (Amaranthus palmeriS. Wats.) is a C4Sonoran Desert annual indigenous tothe Southwestern U.S. and Northern Mexico, and the most successfulAmaranthusspecies toestablish itself as a weedy species in artificial habitats (Eleringer 1983; Sauer 1957).Within sixyears ofbeing identified in South Carolina in 1989, Palmer amaranth becamethe mostproblematic weed in cotton (Gossypium hirsutumL.) in bothNorth and South Carolina (Websterand Coble 1997).  By 2009, Palmer amaranth was ranked as one of the Top 10 most-troublesomeweeds in corn (Zea maysL.), soybean (Glycine maxL. Merr.), and cotton in several states of theSoutheastern U.S. (Webster andNichols 2012).  The development of herbicide resistance likelycontributed to the spread and success of Palmer amaranth as a weedy species throughout most ofthe southern and Great Plains regionsof the U.S. (Horak and Peterson 1995; Gossett et al. 1992).While Palmer amaranth remains a majorproblem in those regions, it has recently spread intotheMidwest(Sellers et al. 2003)and was first identified in Michigan in 2010(Sprague 2011).The propensity at which Palmer amaranth develops resistance to different herbicides hasperpetuated it as a problem weed.  Herbicide resistance in Palmer amaranth is not new.  The firstreported case of herbicide-resistance in Palmer amaranth was identified in South Carolina in1989 (Gossett et al. 1992).Populations fromtwo South Carolina counties evolved resistance totrifluralin, a dinitroaniline (Group 3) herbicide.  These populationshadvarying levels ofresistance to five other dinitroaniline herbicides.By1993, atrazine (Group 5) resistance wasreported in a Texas populationof Palmer amaranth (Heap 2016), but sincethen, triazine-resistantpopulationshavebeen reportedonlyin three other states.  The inability for triazine-resistantPalmer amaranth to establish and become widespread may be due to reproductivefitnesspenalties often associated with triazine resistance in otherAmaranthusspecies (Sibony andRubin 2003; Soltani et al. 2008).As Palmer amaranth expanded northin the mid-1990s, it rapidly developed resistance to thewidely used ALS-inhibiting (Group 2) herbicides in several states(Heap 2016;Horak andPeterson 1995).  Selectivity, low use rate, and the ability to control a broad-spectrum of weedspecies both pre-and post-emergence led to the rapid adoption and extensive use of ALS-inhibiting herbicides (Tranel and Wright 2002).  Resistance to the ALS-inhibiting herbicidesisso widespread in Illinois that all populations of common waterhemp (Amaranthus rudis),aclosely related species to Palmer amaranth,are assumed resistant (Tranel and Wright2002;Patzoldt et al 2002).  To date, populations of Palmer amaranth demonstrating resistance to ALS-inhibiting herbicides has been reported in 12 states (Heap 2016).The advent of glyphosate-resistant crops in the mid-1990s provided growers with an effectiveoption to control weeds resistantto other herbicide sites of action (Shaner 2000).The rapidadoption of glyphosate-resistant crops led to the abandonment of preemergence (PRE) herbicidesand the sole reliance on multiple applications glyphosate (Group 9) for weed control (Young2006; Owen 2008; Shaner 2000; Vencill et al. 2012).  This over-reliance on a single siteselectedfor the development ofglyphosate-resistant biotypes and weedpopulation shifts towardstomoretolerant species (Young 2006; Owen 2008; Vencill et al. 2012).The first case of glyphosate-resistant Palmer amaranth was reported in Georgia in 2005 (Culpepper et al. 2006).  Thispopulation survived applications of glyphosate in the field at 12 times (10 kg ae ha-1) the normaluse rate.Glyphosate-resistantPalmer amaranth has sincebeen reported in27 other states,including Michigan (Heap 2016).In addition to the development of resistance to a single herbicide site of action, Palmeramaranthhasdeveloped resistance to multiple herbicide sites of action.  One of the mostprevalent instances of multiple resistance in populations of Palmer amaranth is resistance toglyphosate and ALS-inhibiting herbicides.  Populations of Palmer amaranth resistant tobothglyphosate and ALS-inhibitors have been identified in eight states including Georgia,Mississippi, Tennessee, South Carolina, Arizona, Illinois, Florida, Delaware, and Michigan(Heap 2016; Nandula et al. 2012; Sosnoskie et al. 2011).  Other cases ofmultiple resistance thathave been reported in Palmer amaranth are:protoporphyrinogen oxidase (PPO)-inhibitors(Group 14) + glyphosate (IL, TN), atrazine + 4-hydroxyphenylpyruvate dioxygenase (HPPD)-inhibiting herbicides (Group 27) (NE), atrazine + glyphosate (NE), ALS-inhibitors + atrazine +HPPD-inhibitors (KS), andALS-inhibitors+ atrazine + glyphosate (GA)(Heap 2016).  Thedevelopment ofresistance multiple herbicide sites of action drastically limits the options forPalmer amaranthcontrol.The primary mechanisms by which weeds develop resistance to herbicidesarecategorizedinto five mechanisms: altered-target site, metabolism-based, reduced absorption/translocation,sequestration into vacuoles, and gene amplification (Heap 2014).Altered target-site resistance isthe most common mechanism of resistance for various herbicides in several weed species.InPalmer amaranth and otherAmaranthus spp., the primary mechanism for resistance to ALS-inhibiting herbicidesisan altered target site via amino acid substitution within the ALS enzyme(Foes et al. 1998; Franssen et al. 2001).  Betha et al. (2015) reported that ALS resistance inKSpopulation ofPalmer amaranth was due to a proline to serine change at site 197.An alteredtarget sitewasreported as the primary mechanism for atrazine resistance in smooth pigweed(Amaranthus hybridusL.), common waterhemp, kochia (Kochia scopariaL.), and Powellamaranth (Amaranthus powelliiS. Wats) (Diebold et al. 2003; Foes et al. 1998; Foes et al. 1999;Maertens et al. 2004),attributed to an amino acid substitution of glycine for serine at position264 of the D1 protein.  However, non-target site based triazine resistance has been reported forpopulations of tall waterhemp and velvetleaf (Abutilon theophrastiMedic) (Anderson andGronwald1991; Patzoldt et al. 2003).  To date, the only identified mechanism ofglyphosateresistance in Palmer amaranthis the over production of the target enzyme 5-enolpyruvlshikimate-3-phosphate synthase (EPSPS) (Chandi et al. 2012; Gaines et al. 2010;Ribeiro et al. 2013; Mohseni-Moghadam et al. 2013).  This means thatglyphosate cannotsaturate the systemandstop normal enzyme function, resulting in plant survival.The failure of atrazine to control a newly-identified population of Palmer amaranth inMichigan that was suspected to be resistant to glyphosate and ALS-inhibiting herbicides in fieldexperiments in 2013 led to thefollowing researchobjectives:1) confirm the presence ofresistance to glyphosate, an ALS-inhibitor (thifensulfuron), and atrazine in a single Palmeramaranth population, 2) establish resistance factors (RF) for herbicide site of action, and 3)establish the molecular basis for resistance to these herbicide sites of action.Materials and MethodsSeed Collection and Preparation.Seed heads from the suspectedmultiple-resistant populationwere collected in fall 2013 from a field in Barry County, MI (MR) (42.702467oN;-85.524992oW) and threshed.  Since Palmer amaranth is notnative to Michigan, seed for theknown susceptible population was obtained from Dr. Larry Steckel, University of Tennessee (S).Seed from both populations were treated with a 50% sulfuric acid and water solution for 4 min,rinsed, and then exposed to gibberellic acid at a concentration of 0.15 g L-1of water for 6 h toenhance germination.Initial Screen for Three-Way Resistance.Approximately15 seeds of the MRandSPalmeramaranth populations were planted 0.75 cm deep in 10 x 10 cm pots filled with potting media(Suremix Perlite, Michigan Gower Products, Inc., Galesburg, MI).  Seedlings were grown in thegreenhouse at 25 ± 5 C and sunlight was supplemented to provide a total midday light intensityof 1,000 µmol m-2s-1photosynthetic photon flux at plant height in a 16 h day.  Plants werewatered and fertilized as needed to promote optimum plant growth.After emergence, pots werethinned to one Palmer amaranth plant pot-1.  Whenplants were approximately 10 cm tall, amixture of glyphosate (Roundup PowerMAX, Monsanto Co., St. Louis, MO) + thifensulfuron(Harmony, DuPont Crop Protection, Wilmington, DE) + atrazine (AAtrex 4L, Syngenta LLC,Greensboro, NC) was applied at1.26+ 0.0044 + 1.12 kg ai ha-1with a single nozzle (8001E,TeeJet Technologies, Wheaton, IL) track sprayer calibrated to deliver 187 L ha-1at 193 kPa ofpressure.  These rates representedthe 1X field use rates for these herbicides.  Spray gradeammonium sulfate (AMS) (Actamaster, Loveland Products, Inc., Loveland, CO) at 2% w w-1and1% v v-1of crop oil concentrate (COC) (Herbimax, Loveland Products Inc., Loveland, CO) wasadded to this treatment.  Palmer amaranth control was evaluated 14 days after treatment (DAT)on a scale of 0 to 100, with 0 indicating no Palmer amaranth control and 100 indicating completeplant death.  Aboveground biomass was harvested 14 DAT and dried at 60 C for 7 d andweighed.Resistance Factor.Greenhouse experiments were conducted to determine the resistance factor(RF) (Equation 1) of the suspectedmultiple-resistant Michigan Palmer amaranth population(MR) to postemergence applications of glyphosate, thifensulfuron, and atrazine, and topreemergence applications of atrazine.  The suspected resistant Michigan Palmer amaranthpopulation was compared with aknown susceptible population (S) to determine the doserequired for 50% growth reduction (GR50).[EQ. 1]Dose-Response to Postemergence Herbicides.Palmer amaranth planting, greenhouse growingconditions, and herbicide application for this experiment were the same as described above.Herbicide applications of the isopropylamine salt of glyphosate (Buccaneer, Tenkoz Inc.,Alpharetta, GA), thifensulfuron, and atrazine were made when Palmer amaranth averaged 10 cmin height.  Application rates ranged from 1/32 to 2X the labeled rate for the Spopulation and 1/4to 32X the labeled rate for the suspected resistant MRpopulation. The 1X rates for eachherbicide were:1.26kg ae ha-1of glyphosate, 0.0044 kg ai ha-1of thifensulfuron, and 1.12 kg aiha-1of atrazine.  Herbicide rates were selected to provide a range of responses from no control tocomplete plant death.  All atrazine treatments contained 1% v v-1COC.  Glyphosate andthifensulfuron treatments each included NIS at 0.5% v v-1and AMS at 2% ww-1.  Non-treatedcontrols for each Palmer amaranth population (MRandS) were also included in the experiment.Palmer amaranth control was evaluated 14 DAT on a scale of 0 to 100.  Aboveground biomasswas harvested 14 DAT and dried at 60 C for 7 d and weighed.Dose-Response to Preemergence Atrazine.Twenty-five seeds of the MRandSPalmer amaranthpopulations were planted at a depth of 0.75 cm in 10 x 10 cm pots filled with a steam sterilizedCapac loam (fine-loamy, mixed, active, mesic Aquic Glossudalfs) soil composed of 78.1, 13.3,and 8.6% sand, silt, and clay, respectively, with a pH of 7.6 and 2.7% organic matter.  Prior toplanting and herbicide application, pots were watered to near field capacity.  Atrazine wasapplied to the soil surface at rates ranging from 1/8 to 8X for the Spopulation and at 1/2 to 32Xfor the MRpopulation, with the 1X equal to 1.12 kg ai ha-1.  After herbicide application, potswere placed in the greenhouse (see greenhouse conditions listed above), and the soil surfaceforeach pot was watered uniformly to incorporate the herbicide.  To minimize herbicide leachingallsubsequent watering was done through sub-irrigation.  A single application of a 50 mL of a 20-20-20 fertilizer solution was applied as a drench to the soilsurface 14 DAT to maintain normalplant growth.   Emergence counts were taken weekly and aboveground biomass was harvested28 DAT.  Biomass was dried at 60C for 7 d and weighed.Statistical Analysis.Each experiment was arranged in a randomized complete block design withsix (initial screen and postemergence experiment) or seven (preemergence experiment)replications and conducted twice.  Dry weights from each experiment were converted to apercent of the non-treatedcontrol for each population (MRandS).  In order to keep the resultsobjective, only the dry weight data was used to determine the GR50values.  Data for eachexperiment was analyzed using nonlinear-regression inSigmaPlot version 11.0 (Systat SoftwareInc., San Jose, CA).The herbicide dose required to reduce Palmer amaranth biomass (growth)by 50% (GR50) was then calculated for each population-herbicide combination using thelog-logistic model (Burgos et al. 2013) (Equation 2):[EQ. 2]Wheredequals the upper limit,cis the lower limit, andbis the relative slope around the GR50.Deviations from the model are indicated by R2valuesand standard errors for the GR50values arepresented.  The resistancefactors were calculated for each population-herbicide combination(Equation 1).Molecular Basis for Resistance.Plant Material and DNA Extraction.Suspectedmultiple-resistant (MR) and susceptible (S) Palmer amaranth plants were grown as described above in thepostemergence experiment.  When plants from theMRpopulation reached 10 cm in heightatrazine was applied at 18 kg ha-1+ 1% v v-1COC, or 16X the normal use rate to select foratrazine-resistant plants.  Glyphosate and thifensulfuron were not applied to these plants sincethere was less variability in the whole plant responses to these herbicides.  Young newly-emerging leaf tissue (approximately 150 mg) was harvested 21 d after atrazine was applied to theMRpopulation from four individual plants from theMRandSpopulations.  Harvested leaftissue was immediately frozen in liquid nitrogen and stored at-20 C until extraction for genomicDNA (gDNA).Palmer amaranth gDNA was extracted for eachindividual plant using theQiagen DNeasy Mini Kit (Qiagen, Valencia, CA), and quantified using a nanodrop spectrometer(NanoDrop 2000c, Thermo Fisher Scientific Inc., Waltham, MA).ALS and psbA Gene Isolation and Sequencing.TheALSandpsbAgeneswereisolated andsequenced to determine if ALS and atrazine resistance in theMRPalmer amaranth populationwas conferred through nucleotide changes leading to amino acid substitution at the target site.Primer selection and methods for polymerase chain reaction (PCR) and sequencing were basedoff previous research conducted by Betha et al. (2015), Mengistu et al. (2005), and Whaley et al.(2007).  Primers for amplifying approximately a 2 kb section of theALSgene were designed byWhaley et al. (2007) and based on theAmaranthus spp.sequence (GenBank Accession U55852).Primers used for amplification of theALSgene in Palmer amaranth are listed in Table 2.1 asALSforward 1 andALSreverse 1.  Amplification of a 576 bp region of thepsbAgene was done withprimers designed by Mengistu et al. (2005).  Primers used for amplification of thepsbAgene arelisted in Table 2.1 aspsbAforward 1 andpsbAreverse 1.  Each PCR reaction for bothALSandpsbAamplification contained 2 µL of gDNA, 10 µM of each forward and reverse primers, 10mM deoxynucleotide triphosphates (DNTP›s), 0.5 −L Phusion‰ high-fidelity DNA polymerase(New England Biolabs Inc., Ipswich, MA), 10 µL of supplied 5x buffer, and nuclease-free waterto a final volume of 50 µL.  Two separate thermoprofiles were designed for the amplification oftheALSandpsbAgenes.  Reactions for theALSgenes were subjected to 30 s at 98 C, 10 s at 98C, 30 s at 60 C, 90 s at 72 C, 34 cycles of 98 C, anda final 10:00 min at 72 C.  Reactions for thepsbAgenes were subjected to 30 s at 98 C, 10 s at 98 C, 30 s at 55 C, 30 s at 72 C, 34 cycles of98 C, and a final 10:00 min at 72 C.  PCR products were quantified using gel electrophoresis.Prior to sequencing, PCR products were purified using the Wizard® SV gel and PCR clean-upkit (Promega Co., Madison, WI), and concentrations were measured using a nanodropspectrometer.  Eight and four separate sequencing reactions were conducted for theALSandpsbAgene, respectively, for each of the four biological replicates for theMRandSPalmeramaranth populations.  To ensure complete coverage and overlap of 2 kbALSregion,ALSforward and reverse primers 1-3 were used (Table 2.1).  Since thepsbAregion was only 576 bp,only a single set of forward and reverse primers was necessary (Table 2.1).  Sanger sequencing(Applied BiosystemsTM3730 XL, Thermo Fisher Scientific Inc., Waltham, MA) reactionscontained 1 µL of 100 ng purified PCR product, 3 µL of forward orreverse primers, andbiologically pure water brought up to a final volume of 12 µL.  Sequences were aligned andcompared using SequencherTM5.4.1 software (Gene Codes Corporation, Ann Arbor, MI).Additional sequence alignment was done with clustalW analysis and peptide sequences andnumbering was obtained with translate tools available through ExPASy (ExPASy: SIBbioinformatics resource portal, http://www.expasy.org).EPSPS Copy Number.Real-time quantitative polymerase chain reaction (qPCR) was usedtodetermine if glyphosate resistance in theMRPalmer amaranth population was due toamplification of theEPSPSgene.  Quantification of the EPSPS gene was determined bycomparing the relative copy number of theEPSPSgene to theALSgene.  The primers used inthe qPCR assay were identical to the ones described by Gaines et al. (2010) and Giacomini et al.(2014). These primers are listed asALSforward and reverse 4 andEPSPSforward and reverse 1in Table 2.1.  Dilution series of the primers were not conducted, since previous research hasshown high efficiencies with these primer sets (Gaines et al. 2010; Giacomini et al. 2014).The reactions for qPCR were setup containing 3 µL of gDNA (2 ng µL-1) fromthe two Palmeramaranth populations, 2x SYBR® GreenMaster Mix (Applied BiosystemsTM, Thermo FisherScientific Inc.), 10 µM of each forward and reverse primer, and distilled water to bring the finalreaction volume to 15 µL.  The negative controls contained 7.5µL of the 2x SYBR® GreenMaster Mix and 7.5µLof distilled water.  All reactions for the four biological replicates of theMRandSpopulations were run in triplicate with the following thermoprofile on QuantStudioTM7 Flex real-time PCR system (Applied BiosystemsTM, Thermo Fisher Scientific Inc.): 10 min of95 C, 40 cycles of 95 C for 30 s, 1 min at 60 C, and melt curve analysis to check for primerdimers.Threshold cycles (Ct) were calculated using QuantStudio real-time PCR software version 1.2(Applied BiosystemsTM, Thermo Fisher Scientific).  Relative copy number of theEPSPSgenecompared to theALSgene was calculated using a modification of the 2-„„Ctmethod (Gaines et al2010; Livak and Schmittgen 2001).  EstimatedEPSPScopy number was determined by findingthe change inCt values (Equation 3), and calculating the 2„Ct.„Ct = (Ct,ALS•Ct,EPSPS)[EQ. 3]Results and DiscussionInitial Screen for Three-Way Resistance.The initial screen showed that the combination ofglyphosate + thifensulfuron + atrazinefailed to control the MRpopulation of Palmer amaranth.Previous research has shown complete control of other Palmer amaranth populations with theseherbicides applied alone,at or below the rates used in this experiment (Chandi et al. 2013; Horakand Peterson 1995; Norsworthy et al. 2008).  Control with all three herbicides applied incombination was 55 and 93% 14 DAT for theMRandSpopulations, respectively.  Biomassreduction from the combination was 7.15X greater in theSpopulation compared with theMRpopulation.  The results from this initial screen in the greenhouse confirm the preliminaryobservations from previous field trials,of alack of sensitivityintheMRpopulation toglyphosate, ALS-inhibitors, and atrazine.  This multiple-resistance of glyphosate, ALS-inhibitors, and atrazine in Palmer amaranth is not widespread, and has only been reported in oneother population in Georgia (Heap 2016).  To date, there hasbeen little published on the Georgiapopulation.Resistance Factor.ALS Resistance.Thifensulfuron applied at half (0.002 kg ai ha-1) of thenormal field use rate or greater provided near complete control of theSPalmer amaranthpopulation(Figure 2.1).  However, there were some plants that survived the higher applicationrates,indicating that this population may not be completely susceptible to thifensulfuron.  Evenwith this minor variability in control of the susceptible population, thedose of thifensulfuronrequired to reduce biomass of the Spopulation 50% was 0.00014 kg ai ha-1(Table 2.2).  TheGR50value for the suspected ALS-resistant population (MR) was 0.006 kg ai ha-1ofthifensulfuron,indicating the RFfor theMRpopulationto be42.9X (Table 2.2).  The level ofresistance in this population is lower than what has been previously reported for otherpopulations of ALS-resistant Palmer amaranth (Sprague et al. 1997).  The populationinvestigated by Sprague et al. (1997) was highly resistant to ALS-inhibiting herbicides, withanRF of >3700 for thifensulfuron.  There have been other reports of varying levels of ALSresistance between populations.  For example, suspected ALS-resistant populations of Palmeramaranth from Mississippi and Georgia treated with pyrithiobac had RF values of 8 and 303X,respectively (Nandula et al. 2012; Sosnoskie et al. 2011).  The difference in resistance levels maybe attributed to the sensitivity of the susceptible population to ALS-inhibiting herbicide used thein screening process.  Even with the lower resistance level of theMRpopulation, completecontrol with thifensulfuron was not observed with 32X (0.14 kg ai ha-1),the normal field use ofrate of thifensulfuron and biomass was only reduced 70%at this rate (Figure 2.1).Glyphosate Resistance.The dose response analysis showed that theSPalmer amaranthpopulation was more sensitive to glyphosatecompared with theMRpopulation (Figure 2.2).The 1X (1.26kg ae ha-1) rate of glyphosate completely controlled theSpopulation, while the 1Xrate of glyphosate only reduced Palmer amaranth biomass 10% for theMRpopulation.Glyphosate applied at 16X (13.5 kg ae ha-1) the labeled rate reduced Palmer amaranth biomass95% for the MRpopulation. The GR50values were 0.094 and 1.14 kg ae ha-1for theSandMRpopulations, respectively (Table 2.2).  The RF value of 12X for theMRpopulation falls withinthe range of the RF values of 5 to 115X that have been previously reported for other populationsof glyphosate-resistant Palmer amaranth (Culpepper et al. 2006; Norsworthy et al. 2008; Steckelet al. 2008).  These results demonstrate that theMRpopulation is resistant to both glyphosateandALS-inhibiting herbicides, includingthifensulfuron.  The first populations of documentedglyphosate-and ALS-resistant Palmer amaranth were found in Georgia and Mississippi in 2008(Nandula etal. 2012; Sosnoskie et al. 2011).  Since then,several other Palmer amaranthpopulations have been documented as having multiple resistance to glyphosate and ALS-inhibiting herbicides.  This multiple-resistance can limit options for Palmer amaranth controlandin some cases, the only option for POST management is the use of glufosinate in glufosinate-resistant crops.Atrazine Resistance POST.  Atrazine applied POST at 1.12 kg ai ha-1(1X) reduced Palmeramaranth biomass 89% for theSpopulation (Figure 2.3).  This dose falls in the range of ratesthat Jhala et al. (2014) reported for the effective dose to reducePalmer amaranth biomass 90%(ED90) in two atrazine-sensitive Palmer amaranth populations.  To reduce Palmer amaranthbiomass90% for theMRpopulation, atrazine needed to be applied at 32X (35.90 kg ai ha-1) thenormal use rate (Figure 2.3).  The GR50values for theSandMRPalmer amaranth populationswere 0.13 and 1.20 kg ai ha-1, respectively, resulting in a RF of 9X (Table2.2).  The RF value fortheMRpopulation is similar to RF values (9 to 14X) reported by Jhala et al. (2014) in aNebraska Palmer amaranth population resistant to atrazine.  However, the RF for atrazine in theMRPalmer amaranth population is lower than what haspreviously been reportedfortriazine-resistant smooth pigweed and tall waterhemp, where RFswere greater than 100X (Foes et al.1998; Maertens et al. 2003).  The mechanism for atrazine resistance in these populations wasreported as target site mediated.  The lower RF observed in theMRpopulation may indicate thatthe mechanism for resistance in this population may not be target-site based, and anothermechanism for atrazine resistance, such as metabolism, may be responsible.  Metabolism hasbeen reported as another mechanism for triazine resistance in velvetleaf, Palmer amaranth, andcommon waterhemp (Anderson and Gronwald 1991; Betha et al. 2015; Patzoldt et al. 2003).Atrazine Resistance PRE.In addition to theMRpopulation being less sensitive to atrazineapplied POST, it was alsoless sensitive to atrazine applied PREcompared withtheSpopulation.The 1X (1.12 kg ai ha-1) rate of atrazine reduced biomass of theSPalmer amaranth population98%, while rates as high as 32X (35.90 kg ai ha-1) the normal use rate failed to reduce biomass intheMRpopulation >60% (Figure 2.4).  Palmer amaranth is generally quite susceptible to PREapplications of atrazine (Johnson etal. 2012).  Atrazine applied PRE failed to control severalother weed species, such as common groundsel (Senecio vulgarisL.), common lambsquarters(Chenopodium albumL.), hood canarygrass (Phalaris paradoxaL.), rigid ryegrass (LoliumrigidumGaudin), andblackgrass (Alopecurus myosuroidesHuds.) that have displayed resistanceto atrazine applied POST (Fuerst et al. 1986; Ryan 1970; Yaacoby et al. 1986).  The GR50valuesatrazine applied PRE for theSandMRPalmer amaranth populations were 0.035 and 3.93kg aiha-1, respectively (Table 2.2).  The RF for theMRpopulation was 112.2X for atrazine appliedPRE.  This RF was 12 times greater than the RF for atrazine POST, showing that this populationhasamuch higher level of resistance to PRE applications ofatrazine than when it is appliedPOST.  A possible explanation for the higher RF for atrazine PRE could be the rapiddetoxification of atrazine via glutathione conjugation in the stem prior to movement into theleaves when atrazine is absorbed by the roots.  This has been reported for velvetleaf whereatrazine was metabolized at a higher rate in stem tissue compared with leaves, and stemmetabolism has also been reported as an important mechanism for soybean (Glycine maxLMerr.) tolerance to metribuzin (Fedtke and Schmidt 1983; Gronwald et al. 1989).Molecular Basis for Resistance.ALS-Inhibitors.Previous research has shown that a singlenucleotide change leading to amino acid substitution is responsible for the majority of ALS-resistance in tall waterhemp, redroot pigweed, smooth pigweed, Powell amaranth, and Palmeramaranth (Diebold et al. 2003; Foes et al. 1998; Patzoldt and Tranel 2007; Sibony et al. 2001;Whaley et al. 2007).  This paired with the level of resistance expressed by theMRPalmeramaranth population in the dose response experiments, prompted molecular analysis to establishthe alteration conferring resistance in this population of Palmer amaranth.  Resistance to ALS-inhibitors inAmaranthus spp.have been well documented.  Amino acid substitutions reported tocause resistance to the ALS-inhibitors inAmaranthusspp. have been found at six locationswithin the ALS enzyme: alanine122(Ala), proline197(Pro), Ala205, aspartate376(Asp),tryptophan574(Trp), and serine653(Ser) (Ashigh et al. 2009; Heap 2016; Huang et al. 2016;McNaughton et al. 2005; Tranel and Wright 2002).  All amino acid numbering is normalized totheArabidopsis thalianasequence.  In the MRPalmer amaranth population,there were severalnucleotide changes at multiple locations within theALSenzyme.With one exception, allpolymorphisms resulted in an amino acid change and all others were silent mutations, resultingin no amino acid changes.  In theMRpopulation there wasacytosine to thymine change atposition 574(Table 2.3).  This change allowed for a Pro to Leu amino acid substitution at Pro197relativetotheArabidopsis thaliananumbering.  This mutation has not been identified in otherALS-resistant Palmer amaranth populations, howeverthe Pro to Leu substitution waspreviouslyreported to confer resistance to sulfonylurea herbicides (i.e., thifensulfuron) in redroot pigweedat similar levels as observed here with theMRpopulation (Heap 2016; Sibony et al. 2001).  TheMRpopulation was only screened with thifensulfuron, a sulfonylurea herbicide, for ALS-resistance, so cross-resistance to other classes of ALS-inhibiting herbicideswasnot determined.However, the Pro to Leu substitutionwasreported to cause low to high RF in redroot pigweed tothe imidazolinone, trizolopyrimadine, and pyrimidinylthiobenzoic acid classes of ALS-inhibitingherbicides, in addition to the sulfonylurea herbicides (Sibony et al. 2001).  This indicates a stronglikelihood that theMRpopulation would demonstrate cross resistance to four of the five classesof ALS-inhibiting herbicides.Glyphosate Resistance.Weed resistance to glyphosate has been shown to be due to multiplemechanisms.  Inpopulations of horseweed(ConyzaCanadensisL Cronq.) and rigid ryegrass,glyphosate resistance is conferred through reduced translocation and vacuole sequestration(Koger and Reddy 2005; Ge et al. 2009; Lorraine-Colwill et al. 2002).  Similar to evolvedresistance in weeds to ALS-inhibitors, populations of goosegrass (Eleusine indicaL. Gaertn.),rigid ryegrass, and Italian ryegrass (Lolium perenneL.ssp. multiflorum(Lam.)Husnot) haveexpressed target-site resistance to glyphosate with amino acid substitutions at Pro106(Perez-Joneset al. 2007; Powles and Preston 2006; Wakelin and Preston 2006).  The novel mechanism ofresistance that has been attributed to conferring resistance to glyphosate in Palmer amaranthpopulations from Georgia, North Carolina, and New Mexico isover expression of the targetenzyme EPSPS (Chandi et al. 2012; Gaines et al. 2010; Ribeiro et al. 2013; Mohseni-Moghadamet al. 2013).  Based on these previous reports and the RF for theMRPalmer amaranthpopulation, a molecular analysis was conducted to determine if gene amplification was themechanism of glyphosate resistance in this population.  The qPCR results indicated that thesusceptibleSpopulation had only one copyof the EPSPS gene (Figure 2.5),while the number ofcopies ranged from 47 to >100 copies of EPSPS enzyme relative to ALS enzyme in the resistantMRpopulation.  The number of EPSPS copies in theMR population fell within the range of 5 to>160 genomic copies reported by Gaines et al. (2010).  Gaines et al. (2010) reported thatshikimate, the normal substrate for EPSPS, accumulation was minimal illustrating normalenzyme function with 65 or more copies of EPSPS in Palmer amaranth.  Resistance toglyphosate increases as EPSPS copy number increases, however only 30 to 50 copies arenecessary to survive normal field use rates of glyphosate (Gaines et al. 2011).  All of the plantstested from theMRpopulation fall within or above this range, with 75% of the plants having >60genomic copies of the EPSPS enzyme.  The results from qPCR and dose responseexperimentsconfirm that that MRpopulation has moderate to high levels of resistance to glyphosate that iswidely distributed within the population.Atrazine Resistance.Target-site resistance with an amino acid substitution of Gly forSer atposition 264 of the D1 protein, has been reported as the primary mechanism for triazineresistance in smooth pigweed, common waterhemp, kochia, and Powell amaranth (Diebold et al.2003; Foes et al. 1998; Foes et al. 1999; Maertens et al. 2004).  This amino acid substitution likemost target-site based resistances confers a high level of resistance to atrazine.  For example, thissubstitution was reported in an Illinois atrazine-resistant common waterhemp population that hada RF of 185X (Foes et al.1998).  There have been reports of other amino acid substitutions atPhe211, Val219, and Ala251conferingresistance to the Photosystem II (PSII) herbicides (i.e.,atrazine) at a lower RF than the Gly to Ser264substitution (Devine and Shukla 2000; Mengistu etal. 2000).  The RF values reported for these other amino acid substitutions are similar to the onereported here for theMRpopulation.  Molecular analysis was conducted to determine if anamino acid substitution was present within the region of thepsbAgene causing atrazineresistance in theMRpopulation of Palmer amaranth.  Evaluation of thepsbAgene showed nonucleotide polymorphisms within thesequencedregion.  The absence of polymorphisms and thevariability in expression of resistance,indicate that the mechanism of resistance for atrazine ismost likely metabolism based.  Non-target site triazine resistance, possibly via glutathione-S-transferase conjugation,wasrecently reported in a Kansas Palmer amaranth population and inotherAmaranthus spp.(Betha et al. 2015; Ma et al. 2013).This research confirms thataPalmer amaranth population found in Michigan is resistant tothree different herbicide sites of action: glyphosate (Group 9), thifensulfuron an ALS-inhibitingherbicide (Group 2), and to PRE and POST applications of atrazine (Group 5).  Whilethisresistance profile wasdocumented with one other Palmer amaranth population in Georgia 2010(Heap 2016), this is the first report of RF values and the possible mechanisms of resistance forthis type of three-way resistance.  The addition of atrazine resistance to the already wide-spreadresistanceto glyphosate and ALS-inhibiting herbicides will make managementof Palmeramaranthmore of a challenge in corn.  Atrazine applied both PRE and POST has been aneffective tool for Palmer amaranth management (Johnson et al. 2012; Norsworthy et al. 2008;Wiggins et al. 2015). Without atrazine, glyphosate, or the ALS-inhibiting herbicides for Palmeramaranth control, farmers will rely heavily on HPPD-inhibiting (Group 27) herbicides both PREand POST, the long chain fatty acid inhibitors (Group 15) PRE, glufosinate (Group 10) POST,and the plant growth regulating herbicides (Group 4) POST.  The sole reliance on theseherbicides applied alone isnot a sustainable approach to management, especially since therearerecent documented cases of HPPD-resistance in Palmer amaranth (Jhala et al. 2014, Heap 2016),and a case of tall waterhemp with reported resistance to five different herbicide sites of action(Evans et al. 2015).  Integrated approaches that include crop rotation, tillage, the use of both PREand POST herbicide applications with overlapping residuals, tank-mixtures of herbicides withmultiple effective sites of action, and perhaps the incorporation of cover crops will be needed tomanagemultiple-resistantPalmer amaranthpopulations.APPENDIXAPPENDIXCHAPTER 2 TABLES AND FIGURESTable 2.1.  List of oligonucleotide primers used for PCR, gene sequencing, and qPCR of theALS, psbA, and EPSPSgenes.PrimerSequenceALSforward 15›TCCTCGCCGCCCTCTTCAAATCALSforward 25›GTCCGGGTGCTACTAATCTTGTTTALSforward 35›TTGCTAGTACTTTAATGGGGTTGGALSforward 45›GCTGCTGAAGGCTACGCTALSreverse 15›CAGCTAAACGAGAGAACGGCCAGALSreverse 25›GCATCTGGTCGAGCAACAGCAGALSreverse 35›GTCACTCGATCATCAAACCTAACCALSreverse 45›GCGGGACTGAGTCAAGAAGTGpsbAforward 15›CTCCTGTTGCAGCTGCTACTpsbAreverse 25›GAGGGAAGTTGTGAGCEPSPSforward 15›ATGTTGGACGCTCTCAGAACTCTTGGTEPSPSreverse 25›TGAATTTCCTCCAGCAACGGCAATable 2.2.GR50avalues, standard errors (+S.E.) and resistance factors (RF) for suspectedresistant (MR) and susceptible (S) Palmer amaranth populationsfollowingpreemergence andpostemergence applications of atrazine, glyphosate, and thifensulfuron.HerbicidePopulationGR50a+S.E.RFbkg ai ha-1Atrazine (PRE)MR3.9277.99112.2XS0.0350.02Atrazine (POST)MR1.2060.21819.3XS0.130.0235GlyphosateMR1.1430.7907412.2XS0.0940.00696ThifensulfuronMR0.0060.0009342.9XS0.000140.00003aGR50= required dose to reduce Palmer amaranth dry biomass 50%.bTable 2.3.Nucleotide and amino acid polymorphisms conferring ALS-resistance in thesuspectedmultiple-resistant (MR)Michigan population of Palmer amaranth.Nucleotide and amino acid polymorphismsaPopulationCodon 573-575Amino acid 197Susceptible (S)CCCProlineResistant (MR)CTCLeucineaPolymorphisms denoted by nucleotide position within the codon.  Amino acid positionnumbering normalized toArabidopsis thaliana.Thiefensulfuron rate (kg ai ha-1)0.0000.0020.0040.0060.0080.010Growth reduction (%)020406080100SMRFigure 2.1.Biomassgrowthreduction of Palmer amaranth populations in response toapplications of thifensulfuron.  Fitted lines were calculated with the 3-parameter log-logisticmodel:S(susceptible), y=90.5/(x/0.14)1.08, R2= 0.79; MR(suspected multiple-resistant),y=84.8/(x/5.96)1.26, R2= 0.77.  Means for theSpopulation are represented by (‡) and means forMRpopulation are represented by (…).Glyphosate rate (kg ae ha-1)0.00.20.40.60.81.01.21.41.61.8Growth reduction (%)020406080100SMRFigure 2.2.Biomassgrowthreduction of Palmer amaranth populations in response toapplications of glyphosate.  Fitted lines were calculated with the 3-parameter log-logistic model:S(susceptible), y=90.5/(x/0.14)1.08, R2= 0.79; MR(suspected multiple-resistant),y=84.8/(x/5.96)1.26, R2= 0.77.  Means for the Spopulation are represented by (‡) and means forMRpopulation are represented by (…).Atrazine rate (kg ai ha-1)0.00.51.01.52.0Growth reduction (%)020406080100SMRFigure 2.3.Biomass growthreduction of Palmer amaranth populations in response topostemergence (POST) applications of atrazine.  Fitted lines were calculated with the 3-parameter log-logistic model:S(susceptible), y=90.5/(x/0.14)1.08, R2= 0.79;MR(suspectedmultiple-resistant), y=84.8/(x/5.96)1.26, R2= 0.77.  Means for theSpopulation are represented by(‡) and means for MRpopulation are represented by (…).Atrazine rate (kg ai ha-1)0.02.04.06.08.010.0Growth reduction (%)020406080100SMRFigure 2.4.Biomassgrowthreduction of Palmer amaranth populations in response topreemergence (PRE) applications of atrazine.  Fitted lines were calculated with the 3-parameterlog-logistic model:S(susceptible), y=90.5/(x/0.14)1.08, R2= 0.79;MR(suspected multiple-resistant),y=84.8/(x/5.96)1.26, R2= 0.77.  Means for theSpopulation are represented by (‡) andmeans forMRpopulation are represented by (…).PopulationS 1S 2S 3S 4MR 1MR 2MR 3MR 4RelativeEPSPSCopy Number020406080100120Figure 2.5.EPSPScopy numberrelativetoALS enzymein susceptible (S) andsuspected multiple-resistant(MR) populations of Palmer amaranth.  Relative copy number determined using real-timeqPCR with methods described by Gaines et al. (2010).LITERATURE CITEDLITERATURECITEDAnderson MP, Gronwald JW (1991) Atrazine resistance in a velvetleaf (Abutilon theophrasti)biotype due to enhanced glutathioneS-transferase activity.  Plant Physiol 96:104•109Ashigh J, Corbett CL, Smith PJ, Laplante J, Tardif FJ (2009) Characterization and diagnostictests of resistance to acetohydroxyacid synthase inhibitors due to an Asp376Glu substitution inAmaranthus powellii. Pestic Biochem and Physol 95:38•46Betha S, Thompson CR, Peterson DE, Jugulam M (2015) Mechanism(s) of resistance to PS II-and ALS-inhibitors in mesotrione-resistant Palmer amaranth.  Pages 36-37inProceedings of70thannual meeting of the North Central Weed Science Society Indianapolis,IN:  NorthCentral Weed Science SocietyBurgos NR, Tranel PJ, Streibig JC, Davis VM, Shaner D, Norseworthy JK, Ritz C (2013)Review: Conformation of resistance to herbicides and evaluation of resistance levels.  WeedSci 61:4•20Chandi A, Jordan DL, YorkAC, Milla-Lewis SR, Burton JD, Culpepper AS, Whitiker JR (2013)Interference and control of glyphosate-resistant and•susceptible Palmer amaranth(Amaranthus palmeri) populations under greenhouse conditions. Weed Sci 61:259•266Chandi A, Milla-Lewis SR,Giacomini D, Westra P, Preston C, Jordan DL, York AC, Burton JD,Whitaker JR (2012) Inheritance of evolved glyphosate resistance in a North Carolina Palmeramaranth (Amaranthus palmeri) biotype. Int J Agron DOI:10.1155/2012/176108Culpepper AS, Grey TL, Vencill WK, Kichler JM, Webster TM, Brown SM, York AC, DavisJW, Hanna WW (2006) Glyphosate-resistant Palmer amaranth (Amaranthus palmeri)confirmed in Georgia.Weed Sci54.4:620•626Devine MD, Shukla A (2000) Altered target sites as a mechanism ofherbicide resistance. CropProt 19:881•889Diebold RS, McNaughton KE, Lee EA, Tardif FJ (2003) Multiple resistance to imazethapyr andatrazine in Powell amaranth (Amaranthus powellii).  Weed Sci 51:312•318Ehleringer J (1983) Ecophysiology ofAmaranthuspalmeri, a sonoran desert summer annual.Oecologia 57:10•112Evans CM, Tranel P, Riechers DE, Davis AS, Maxwell D, Gonzini L, Hager AG (2015)Characterization of a novel five-way resistant population of waterhempAmaranthustuberculatus. Page 61inProceeding of the 70thAnnual Meeting of the North Central WeedScience Society. Indianapolis, IN:  North Central Weed Science SocietyFedtke C, Schmidt RR (1983) Behavior of metribuzin in tolerant and susceptible soybeanvarieties. Pages 177•182inMiyamoto J, Kearney PC, Eds. Pesticide chemistry:  Humanwelfare and the environment, volume 3. Pergamon, Elmsford, New YorkFoes MJ, Tranel PJ, Wax, LM, Stoller EW (1998) A biotype of common waterhemp(Amaranthus rudis) resistant to triazine and ALSherbicides.Weed Sci514•520Foes MJ, Liu L, Vigue G, Stoller EW, Wax LM, Tranel PJ (1999) A kochia (Kochia scoparia)biotype resistant to triazine and ALS-inhibiting herbicides. Weed Sci 47:20•27Franssen AS, Skinner DZ, Al-Khatib K, Horak MJ, Kulakow PA (2001) Interspecifichybridization and gene flow of ALS resistance inAmaranthusspecies.Weed Sci49.5:598•606Fuerst EP, Barrett M, Penner D (1986) Control of triazine-resistant common lambsquarters(Chenopodium album) and two pigweed species (Amaranthus spp.) in corn (Zea mays).Weed Sci 34:440•443Gaines TA, Zhang W, Wang D, Bukun B, Chisholm ST, Shaner DL, Nissen SJ, Patzoldt WL,Tranel PJ, Culpepper AS, Grey TL, Webster TM, Vencill WK, Sammons RD, Jiang J,Preston C, Leach JE, Westra P (2010) Gene amplification confers glyphosate resistance inAmaranthus palmeri. Proc Natl Acad Sci 107.3:1029•1034Gaines TA, Shaner DL, Ward SM, Leach JE, Preston C, Westra P (2011) Mechanism ofresistance of evolved glyphosate-resistant Palmer amaranth (Amaranthus palmeri). J AgricFood and Chem 59:5886•5889Ge X,d›Avignon DA, Ackerman JJ, Sammons RD (2010) Rapid vacuolar sequestration: thehorseweed glyphosate resistance mechanism.  Pest Manag Sci 66:345•348Giacomini D, Westra P, Ward SM (2014) Impact of genetic background in fitness cost studies:an example from glyphosate-resistant Palmer amaranth. Weed Sci 62:29•37Gossett BJ, Murdock EC, Toler JE (1992) Resistance of Palmer amaranth (Amaranthus palmeri)to the dinitroaniline herbicides.Weed Technol6:587•591Gronwald JW, Anderson RN, Yee C (1989)Atrazine resistance in velvetleaf (Abutilontheophrasti)due toenhanced atrazine detoxification. Pestic Biochem Physiol 34:149•163Heap I (2014) Herbicide resistant weeds. Pages 281-301inPimentel D, Peshin R, eds. IntegratedPest Management. Netherlands: SpringerHeap I (2016) The international survey of herbicide resistant weeds.www.weedscience.com.Accessed: June 24, 2016.Horak MJ, Peterson DE (1995) Biotypes of Palmer amaranth (Amaranthus palmeri) andcommon waterhemp (Amaranthus rudis) are resistant to imazethapyr andthifensulfuron.Weed Technol9:192•195Huang Z, Chen J, Zhang C, Huang H, Wei S, Zhou X, Chen J, Wang X (2016) Target-site basisfor resistance to imazethapyr in redroot amaranth (Amaranthus retroflexusL.) PesticBiochem andPhysol 128:10•15Jhala AJ, Sandell LD, Rana N, Kruger GR, Knezevic SZ (2014) Confirmation and control oftriazine and 4-hydroxyphenylpyruvate dioxygenase-inhibiting herbicide-resistant Palmeramaranth (Amaranthus palmeri) in Nebraska. Weed Technol 28:28•38Johnson WG, Chahal GS, Regehr DL (2012) Efficacy of various corn herbicides applied preplantincorporated and preemergence.  Weed Technol 26:220•229Koger CH, Reddy KN (2005) Role of absorption and translocation in the mechanism ofglyphosateresistance in horseweed (Conyza canadensis).  Weed Sci 55:84•89Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-timequantitative PCR and 2-„„CTmethod. Methods 25:402•408Lorraine-Colwill DF, Powles SB, Hawkes TR, Hollinshead PH, Warner SAJ, Preston C (2002)Investigations into the mechanism of glyphosate resistance inLolium rigidum.  PesticBiocehm and Physio 74:62•72Ma R, Kaundun SS, Tranel PJ, Riggins CW, McGinness DL, Hager AG, Hawkes T, McIndoe E,Riechers DE (2013) Distinct detoxification mechanisms confer resistance to mesotrione andatrazine in a population of waterhemp.  Plant Phys 163:363•377Maertens KD, Sprague CL, Tranel PJ, Hines RA (2004)Amaranthus hybriduspopulationsresistant to atrazine and acetolactate synthase-inhibiting herbicides.  Weed Res 44:21•26McNaughton KE, Letarte J, Lee EA, Tardif FJ (2005) Mutations inALSconfer herbicideresistance in redroot pigweed (Amaranthus retroflexus) and Powell amaranth (Amaranthuspowellii).  Weed Sci 53:17•22Mengistu LW, Mueller-Warrant GW, Liston A, Barker REpsbAmutation (valine219toisoleucine) inPoa annuaresistant to metribuzin and diuron.  Pest Manag Sci 56:209•217Mengistu LW, Christoffers MJ, Lym RG (2005) ApsbAinKochia scoparia(L) Schrad fromrailroad rights-of-way with resistance to diuron, tebuthiuron and metribuzin. Pest Manag Sci61:1035•1042Mohseni-Moghadam M, Schroeder J, Ashigh J (2013) Mechanism of resistance and inheritancein glyphosate resistant Palmer amaranth (Amaranthus palmeri)populations from NewMexico, USA. Weed Sci 61:517•525Nandula VK, Reddy KN, Koger CH, Poston DH, Rimando AM, Duke SO, Bond JA, Ribeiro DN(2012) Multiple resistance to glyphosate and pyrithiobac in Palmer amaranth (Amaranthuspalmeri) from Mississippi and response to flumiclorac. Weed Sci 60:179•188Norsworthy JK, Griffith GM, Scott RC, Smith KL, Oliver LR (2008) Confirmation and controlof glyphosate-resistant Palmer amaranth (Amaranthus palmeri) in Arkansas. Weed Technol22:108•113Owen MDK (2008) Weed species shifts in glyphosateresistant crops.Pest Manag Sci64.4:377•387Patzoldt WL, Dixon BS, Tranel PJ (2003) Triazine resistance inAmaranthus tuberculatus(Moq)Sauer that is not site-of-action mediated. Pest Manag Sci 59:1134•1142Patzoldt, WL, Tranel PJ, Hager AG (2002) Variable herbicide responses among Illinoiswaterhemp (Amaranthus rudisandA. tuberculatus) populations.  Crop Prot 21:707•712Patzoldt WL, Tranel PJ (2007) Multiple ALS mutations confer herbicide resistance inwaterhemp (Amaranthus tuberculatus) Weed Sci 55:421•428Perez-Jones A, Park K-W, Polge N, Colquhoun, Mallory-Smith CA (2007) Investigating themehanisms of glyphosate resistanceinLolium multiflorum.  Planta 226:395•404Powles SB, Preston C (2006) Evolved glyphosate resistance in plants:  Biochemical and geneticbasis of resistance.  Weed Technol 20:282•289Ribeiro DN (2013) Mechanisms and variability of glyphosate resistanceinAmaranthus palmeriandIpomoea lacunosePh.D dissertation. Starkville, MS: Mississippi State University. 127 pRyan GF (1970) Resistance of common groundsel to simazine and atrazine. Weed Sci 18:614•616Sauer J (1957) Recent migration and evolution ofthe dioecious amaranths.Evolution11:11•31Sellers BA, Smeda RJ, Johnson WG, Kendig JA, Ellersieck MR (2003) Comparative growth ofsixAmaranthus speciesin Missouri.Weed Sci51.3:329•333Sibony M, Michel A, Haas HU, Rubin B, Hurle, K (2001) Sulfometuron-resistantAmaranthusretroflexus: cross-resistance and molecular basis for resistance to acetolactate synthase-inhibiting herbicides.  Weed Res 41:509•522Sibony M, Rubin B (2003) The ecological fitness ofAmaranthus retroflexusandA.blitoidesresistant to acetolactate synthase (ALS) inhibitors and atrazine. Weed Res 43.1:40•47Shaner DL (2000) The impact of glyphosate-tolerant crops on the use of other herbicides and onresistance management. Pest Manag Sci 56:320•326Soltani N, Vyn JD, Swanton CJ, Weaver S, Sikkema PH (2008) Growth and fitness of triazine-susceptible and triazine-resistant common waterhemp (Amaranthus tuberculatusvar.rudis).Weed Biol Manag 8:73•77Sosnoskie LM,Kichler JM, Wallace RD, Culpepper AS (2011) Multiple resistance in Palmeramaranth to glyphosate and pyrithiobac confirmed in Georgia. Weed Sci 59:321•325Sprague CL (2011) Glyphosate-resistant Palmer amaranth confirmed in Michigan.http://msuweeds.com/newsletter-holder/emerging-weed-issues/glyphosate-resistant-palmer-amaranth-confirmed-in-southwest-michigan/.  Accessed July 11, 2016Sprague CL, Stoller EW, Wax LM, Horak MJ (1997) Palmer amaranth (Amaranthus palmeri)and common waterhemp (Amaranthusrudis) resistance to selected ALS-inhibitingherbicides.Weed Sci192•197Steckel LE, Main CL, Ellis AT, Mueller TC (2008) Palmer amaranth (Amaranthus palmeri) inTennessee has low level glyphosate resistance. Weed Technol 22:119•123Tranel PJ, Wright TR(2002) Resistance of weeds to ALS-inhibiting herbicides:  what have welearned?  Weed Sci 50:700•712Vencill WK, Nichols RL, Webster TM, Soteres JK, Mallory-Smith C, Burgos NR, Johnson WG,McClelland MR (2012) Herbicide resistance: toward an understanding of resistancedevelopment and the impact of herbicide-resistant crops.Weed Sci60:2•30Wakelin AM, Preston C (2006) A taget-site mutation is present in a glyphosate-resistantLoliumrigidumpopulation.  Weed Res 46:432•440Webster TM, Coble HD (1997)Changes in the weed species composition of the Southern UnitedStates: 1974 to 1995. Weed Technol 11:308•317Webster TM, Nichols RL (2012) Changes in the prevalence of weed species in the majoragronomic crops of the Southern United States: 1994/1995 to2008/2009. Weed Sci 60:145•157Whaley CM, Wilson HP, Westwood JH (2007) A new mutation in plantALSconfers resistance tofive classes of ALS-inhibiting herbicides. Weed Sci 55:83•90Wiggins MS, McClure MA, Hayes RM, Steckel LE (2015) Integrating cover crops and POSTherbicides for glyphosate-resistant Palmer amaranth control in corn. Weed Technol 29:412-418Yaacoby T, Schonfeld M, Rubin B (1986) Characteristics of atrazine-resistant biotypes of threegrass weeds. Weed Sci 34:181•184Young BG (2006)Changes in herbicide use patterns and production practices resulting fromglyphosate-resistant crops 1.Weed Technol20.2:301•307CHAPTER 3HERBICIDE MANAGEMENTSTRATEGIES IN CORN FOR A THREE-WAY(GLYPHOSATE, ALS, AND ATRAZINE) HERBICIDE-RESISTANT PALMERAMARANTH POPULATIONAbstractThree different field experiments were conducted from 2013-2015 in Barry County, MI toevaluate the effectiveness of PRE, POST, and one-(EPOS) and two-pass (PRE followed byPOST) herbicide programs for management of multiple-resistant Palmer amaranth in corn.  ThePalmer amaranth population at this location has demonstrated resistance to glyphosate (Group 9),ALS-inhibiting herbicides (Group 2), and atrazine (Group 5).  In the PRE only experiment,control with the soil-applied products varied by year.  In 2013,rainfallexceeded 17 cm 30 daysafter treatment (DAT)causing the failure of several PRE herbicides tocontrolPalmer amaranth45 DAT.  Atrazine at 1.12 and 2.24 kg ai ha-1applied PRE failed to control Palmer amaranthcontrol in all three years of the experiment, confirming that this populationwas resistantatrazine.The only herbicides that consistently provided ~80% or greater control PREwere pyroxasulfoneandthe combination of mesotrione +s-metolachlor.  However, none of these treatments providedseason-long Palmer amaranth control.  In the POST only experiment,onlytopramezone provided>85% Palmer amaranth control 14 DAT.  Of the 19 herbicide programsstudiedall but threeprograms provided“88%Palmer amaranth control at corn harvest.Herbicideprograms that didnot control Palmer amaranth relied on only one effective herbicide site of action and in one casedid not include a residual herbicide POST for late-season Palmer amaranth control.Some of theEPOS treatments were effective for season-long Palmer amaranth control; however,applicationtiming will be critical and the inclusion of a residual herbicide component necessaryforcontrolling Palmer amaranth.  The programs that consistently provided the highest levels ofseason-long Palmer amaranth control were PRE followed by POSTherbicide programs thatrelied on a minimum of two effective herbicidesites of action and usuallyincluded a residualherbicide for late-season Palmer amaranth control.Nomenclature:Atrazine; glyphosate; mesotrione; pyroxasulfone;s-metolachlor; corn,ZeamaysL.;Palmer amaranth,Amaranthus palmeriS. Watts.Keywords:Herbicide sites of action; multiple-resistance; Palmer amaranth control.IntroductionThe genusAmaranthusis comprised of over 70 species that are both native and non-nativetothe United States (U.S.).  However, only a select few are problematic in U.S. crop productionsystems.  Redroot pigweed (Amaranthus retroflexusL.), Powell amaranth (Amaranthus powelliiS. Wats.), spiny amaranth (Amaranthus spinosusL.), smooth pigweed(Amaranthus hybridusL.),common waterhemp (Amaranthus tuberculatusMoq.Sauer.), and Palmer amaranth (AmaranthuspalmeriS. Wats.) are the most common of these problematic species (Bensch et al. 2003;Knezevic et al. 1994; Gossett and Toler 1999; Grichar1994; Hager et al. 2002; Massinga et al.2001; Moolani et al. 1964; Schweizer and Lauridson 1985; Toler et al. 1996).Redroot pigweed,Powell amaranth, spiny amaranth, and smooth pigweed are monoecious (male and femalestructures on the same plant), whilecommon waterhemp and Palmer amaranth are dioecious(male and female structures on separate plants) (Bryson and DeFelice 2010).  Although all ofthese species arebroadly distributed andtroublesome in row crop production,butfew have beenas detrimentalin recent history as Palmer amaranth.Some of the attributes that make Palmer amaranth a troublesome weed are season-longemergence, rapid growth, and prolific seed production (Ehleringer 1983; Horak and Loughin2000; Keeley et al. 1987).  In Michigan,Palmer amaranth emergesfrom mid-May throughSeptember (Powell 2014).  This extended emergence pattern makes it difficult to achieveseason-long Palmer amaranth control with soil-applied, preemergence (PRE) herbicides.Followingemergence, Palmer amaranthgrowsmore rapidly and accumulatesmore biomass than otherAmaranthusspp. (Horak and Loughin 2000).  Thismakes itdifficulttotime postemergence(POST) herbicide applications for Palmer amaranth control.  Palmer amaranthproduced250,000,446,000, and 613,000 seeds plant-1in Missouri, Georgia, andCalifornia, respectively, when itemerged at optimal times without inter-or intra-specific competition (Keeley et al. 1987; Sellerset al. 2003; Webster and Grey 2015).  This prolificseed production allows Palmer amaranth toremain and replenish the soil seedbank if left uncontrolled.  If Palmer amaranth competesfromcrop emergence, yield can be reduced up to 91 and 64% in corn and soybean, respectively(Klingaman and Oliver 1994; Massinga 2001).  Delaying Palmer amaranth emergence canreducecompetition, however yield can still be impacted by as much as 35%when Palmeramaranth competed with corn starting at V4 to V7 (Massinga et al. 2001).The rapid growth rateof Palmer amaranth allow for it to effectively compete with crops for light, water, and nutrients(Horak and Loughin 2000; Massinga et al. 2003; Wiese 1968).In addition to biological characteristics, Palmer amaranth›s propensity to develop resistanceto herbicides has perpetuated it as a problem weed.  Currently, Palmer amaranth is resistant to sixherbicide sites of action (Heap 2016),includingglyphosate.  The first case of glyphosate-resistant Palmer amaranth was reported in Georgia in 2005(Culpepper et al. 2006).  Sincethen,glyphosate-resistant Palmer amaranth has spread to 23 other states,including Michigan (Heap2016).  The magnitude of glyphosate resistance ranges from 1.5 to 115-times the rate ofglyphosate required to achieve 50% control in a susceptible population (Norsworthy et al. 2008;Steckel et al. 2008).  In addition to resistance to single herbicide sites of action, there are severalpopulationswithresistance to multiple herbicide sites of action (Heap 2016).  One of the mostprevalent is resistance to glyphosate and ALS-inhibiting herbicides.  Populations of Palmeramaranth resistant to both glyphosate and ALS-inhibitorswereidentified in eight states,including Michigan (Heap 2016; Nandula et al. 2012; Sosnoskie et al. 2011).  In Michigan, thereare fourconfirmed resistance profiles in Palmer amaranth,ranging from single site of action,glyphosate or ALS-inhibiting herbicides, to multiple herbicide sites of action, glyphosate+ALS-inhibitors, within a single population.  In addition to these populations, there is a population inMichigan withconfirmed resistant to three different herbicide sites of action, glyphosate+ALS-inhibitors+atrazine (Chapter 2).  Herbicide resistance in Palmer amaranth poses significantchallenges for the development of management strategies.With the limited number of effective herbicide options available for Palmer amaranth controlin soybean, planting corn may provide farmers the greatest opportunity to manage this weed.Herbicides that control herbicide-susceptible and glyphosate and ALS-resistant Palmer amaranthin corn include: photosystem II inhibitors (Group 5), glufosinate (Group 10), long-chain fattyacid inhibitors (Group 15),and4-hydroxyphenylpyruvate dioxygenase (HPPD)-inhibiting(Group 27) herbicides (Geier et al. 2006; Johnson et al. 2012; Norsworthy et al. 2008; Schusteret al. 2008; Stephenson et al. 2015).  The success of the previously described managementstrategies is primarily due to the susceptibility of the Palmer amaranth populations to specificherbicide sites of action.  However, whenmanagingPalmer amaranthpopulations resistant tothree-herbicide sites of action, management strategies need to be based on the use of effectiveherbicides.  These strategies will likely need toinclude multiple herbicide applications,due toPalmer amaranth›s prolonged emergence and rapidgrowth rate.  Palmer amaranth is a relativelynew problem in the major corn producing regions of the U.S;the majority of research hasfocused on management ofmultiple-resistant Palmer amaranth in cotton, soybean, and peanut(Ward et al. 2013).  Therefore, the objectives of this research were to: 1) evaluate theeffectiveness of several PRE herbicides applied alone, in combination with atrazine, andcommerciallyavailable premixes, 2) evaluate the effectiveness of POST applied herbicides, and3) develop and evaluate one-and two-pass herbicide programs for the control of multiple-resistant Palmer amaranth in corn.Materials and MethodsThree separate field experiments were conducted ina commercial corn production field with aknown population of multiple-resistant Palmer amaranth in Barry County, MI (42.702467°N;-85.524992°W) in 2013, 2014, and 2015.  This populationwassuspected to beresistant toglyphosate andALS-inhibiting herbicides.After control failures with atrazine in2013, thispopulation was confirmed resistant to three herbicidessite of actions: glyphosate, ALS-inhibitingherbicides, and atrazine (Chapter 2).  All experiments were arranged in a randomized completeblock design with four replications.  Plot size for each treatment was 3 m wide by 10 m long.The soil type was a combination of Oshtemo sandy loam and a Boyerloamy sand composed of73.0, 15, and 12% sand, silt, and clay, respectively, with a pH of 7.0 and 2.2% organic matter(OM).Field preparation includedfall chisel plowingfollowed by two-passes of a soil finisher inthe spring.Corn was planted at 67,950 seeds ha-1in 76 cm rows;planting dates and corn hybridinformation can be found in Table 3.1.Precipitation and temperature data were obtained from anearby weather station operated by Michigan State University (MSU Enviroweather 2016).Evaluation of Preemergence (PRE) Herbicides.Field experiments were conducted to evaluatethe control of multiple-resistant Palmer amaranth with soil-applied PRE herbicides.Herbicidetreatments were applied to the soil surface after planting (0-2 d) using a CO2-pressurizedbackpack sprayer calibrated to deliver 187 L ha-1at a pressure of 207 kPa through 11003 AIXRflat-fan nozzles (TeeJet, Spraying Systems Co., Wheaton, IL 60187) (Table 3.1).Herbicideproduct information and treatments for this experiment can be found in Tables 3.2 and 3.3,respectively.  A non-treated control treatment was included as a comparison.Corn injury and Palmer amaranth control wereevaluatedat 30, 45, 60, and 72days after planting(DAP).  Evaluations were based on a scale of 0 to 100%, with 0 being no control and 100indicating complete control.  Aboveground Palmer amaranth biomass was harvested from two0.25 m-2quadrats, 45DAP in 2013 (June 30) and 60 DAP in2014 (July 18) and 2015 (July 13).Palmer amaranth biomass was dried at 60 C for approximately 1 wk then weighed and percentbiomass reduction was calculated using equation 1.[EQ. 1]Evaluation of Postemergence (POST) Herbicides.Afield experiment wasconducted only in2013 and 2014evaluatedthe effectiveness of POST herbicidesfor multiple-resistant Palmeramaranth control in corn.  Herbicide treatments were applied when Palmer amaranth wasbetween 7.5 and 10 cm tall, using the equipment described above.  Application dates can befound in Table 3.1.  Herbicide product information and treatments for this experiment can befound in Tables 3.2 and 3.4,respectively.  A non-treated control treatment was included in thisexperiment as a comparison.  Crop injury and weed control wereevaluated7 and 14 DAT, on ascale from 0 to 100% with 0 representing no control and 100 indicating plant death.Evaluationof Herbicide Programs for Palmer amaranth Control in Corn.Fieldexperiments were conducted to evaluate several weed control programs for control of multiple-resistant Palmer amaranth in corn. These programs consisted of: 1) two POST herbicideapplications, early POST (EPOS) followed by (fb) POST, 2) PRE fb POST, and 3) one-passEPOS options.  The herbicide programs examined are listed in Table 3.5 and herbicide productinformation can be found in Table 3.2.  Spray grade ammonium sulfate (AMS) (Actamaster,Loveland Products, Inc., Loveland, CO) at 2% w w-1was added to all EPOS and POST herbicidetreatments.  Herbicide applications were made using the same equipment as described above.Herbicide application dates can be found in Table 3.1.  PRE herbicides wereapplied to the soilsurface after planting (0-2 d) andPOSTherbicides appliedwhen the majority of plots hadPalmer amaranth at 7.5 cm.  The one-pass EPOS applications were made when Palmer amaranthwas 5 to 7.5 cm in height.Corn injury and Palmeramaranth control were evaluated 14 d after the EPOS (DAEP) andPOST (DAPO) and at harvest.  Evaluations were based on a scale of 0 to 100 described above.Aboveground Palmer amaranth biomass was harvested from two 0.25 m-2quadrats,14 DAPO.Palmeramaranth biomass was dried at 6 C for approximately 1 wk,weighed,and percentbiomass reductioncalculated using equation 1.StatisticalAnalysis.Statistical analysis was conducted using SAS 9.4 (SAS Institute, Cary,NC).  Each experiment was analyzedseparately.  Assumptions of normality of residuals andhomogeneity of variances were confirmed using PROC UNIVARIATE and analysis of variance(ANOVA) was conducted using PROC MIXED.  The statistical model included herbicidetreatment and year as fixed effects and replication as a random effect for the PRE and POSTherbicide experiments.  Data were combined over years when there was not a treatment by yearinteraction.  For the herbicide programs experiment, the statistical model included herbicideprogramsas a fixed effect and replications and years as random effects in the model.  Levene›stest for homogeneity of variances indicated that the variance was unequal between years for thisexperiment.  Therefore, data was analyzed using the REPEATED statement and the GROUP =option; GROUP = year was used to compensate for differences in variance and the degrees offreedom was adjusted for unequal variances with DDFM = SATTERTH option in the MODELstatement.  For all experiments, multiple comparisons among the means weremadeusingt-testswhen herbicide treatments were found to be statistically significant at 0.05 levels.Results and DiscussionEvaluation of PRE Herbicides.  Little to no corn injury was observed with any of the PREherbicide treatments (data notshown).  Overall Palmer amaranth control from the PRE herbicidetreatments was lower in 2013 than in 2014 and 2015.  This may have been attributed to thehigher amounts of rainfall within 10 d of planting and the PRE applications.  In 2013, 9.3 cm ofrainfell compared with 1.71 and 1.57 cm in 2014 and 2015, respectively, within this timeframe.Therefore, the 2013 results are presented separately from the combined 2014 and 2015 results.The small seed size of Palmer amaranth generally favors germinationfrom shallow depths (‹ 1.3cm) in the soil (Keeley et al. 1987).  The rainfall in 2013 could have accelerated herbicidedissipation and increased leaching of some of the herbicides below the Palmer amaranthgermination zone,resulting in lower control in 2013 as compared with 2014 and 2015.Atrazine at 1.1 and 2.2 kg ai ha-1failed to control Palmer amaranth (Table 3.3).  Palmeramaranth control and biomass reduction with atrazine was amongst the poorest in 2013 with bothrates, and even though 2.2 kg ai ha-1provided slightly better control 72 DAP and higher biomassthan 1.1 kg ai ha-1of atrazine in 2014-2015, Palmer amaranth control was only 51% andunacceptable.  Atrazine applied PRE has generally been an effective tool for Palmer amaranthcontrolin corn.  Johnson et al. (2012) reported that atrazine PRE at 1.68 kg ai ha-1controlledPalmer amaranth >98%, 8 wks after application (WAP).  After the failure to control thispopulation with atrazine in 2013, greenhouse testing confirmed that this population was resistantto PRE atrazine (resistance factor = 112-fold).Isoxaflutole was the only other herbicide active ingredient applied alone or in combinationwith atrazine that failed (<60%) to control Palmer amaranth in all three years (Table 3.3).Whilecases of HPPD-resistance in Palmer amaranth have been documented (Jhala et al. 2014, Heap2016), Palmer amaranth control from mesotrione was amongst the highest in 2014-2015, andwas just slightly lower than the best treatments in 2013.  This suggests that this population is notresistant to the HPPD-inhibiting herbicides and that isoxaflutole is not an effective herbicide forPalmer amaranth control at this location.  Greater levels of Palmer amaranth control withisoxaflutole have been previously reported (Johnson et al. 2012; Stephenson and Bond 2012).Isoxaflutole is a pro-herbicide that needs to be converted to the more soluble compounddiketonitrile for activity (Pallett et al. 1998).  The sorption of isoxaflutole to the soil is influencedby soil OM and pH, with sorption decreasing as soil pH increases from 4.5 to 8.5 (Pallett et al.2001).  The rate at which isoxaflutole converts to diketonitrile increases as soil moistureincreases, increasing the possibility of leaching or the conversion to the inactive benzoic acid(Taylor-Lovell et al. 2002).  The relatively high soil pH and low OM at this location paired withhigher rainfall after application in 2013 could have led to the rapid conversion of unboundisoxaflutole to diketonitrile,leading toincreased leaching or the degradation of isoxaflutole anddiketonitrile complexes outside of the Palmer amaranth germination zone.  These factors mayhave contributed to the overallreduction inPalmer amaranth control observed with isoxaflutoleat this location compared withpreviousreports.Control of Palmer amaranth with saflufenacil applied alone or in combination with atrazine ordimethenamid-P was drastically different between 2013 and 2014-2015 (Table 3.3).In 2013,Palmer amaranth biomass was reduced <50% with these treatments and provided no Palmeramaranth control with saflufenacil alone or tank-mixed with atrazine.  In 2014-2015,70-85%visualcontrol anda reduction inPalmer amaranth biomass between 82-87%occurred with thesame treatments.  Saflufenacil doesn›t bind strongly to soil particles;the majority of theherbicide remainsin the soil solution which could make it prone to leachingfollowing heavyrainfall in the10 dafter application in 2013 (Papierniket al. 2012).Palmer amaranth control with the long chain fatty acid inhibitors (Group 15), acetochlor,pyroxasulfone, and s-metolachlor, varied by active ingredient and year.  Pyroxasulfone was themost consistent at controlling Palmer amaranth of thethree products applied alone.Pyroxasulfone at 0.18 kg ai ha-1provided 83% Palmer amaranth control 45 DAP, and wasamongst the treatments with the greatest control in 2013 (Table 3.3).  Control with acetochlorand s-metolachlor was 33 and 20%, respectively, 45 DAP.  In 2014-2015, Palmer amaranthcontrol was greater with all three products;77% with s-metolachlor and 89 and 91% withacetochlor and pyroxasulfone (0.24 kg ai ha-1), respectively, 72 DAP.  Palmer amaranth biomassreduction 60 DAP followed similar trends as control 72 DAP in 2014-2015.  Previous researchshowedthat in saturated soils,acetochlor and metolachlor dissipate more rapidly thanpyroxasulfone (Mueller et al. 1999; Westra et al. 2014).Thedifferences in Palmer amaranthcontrol between years was likely due to greater dissipationofs-metolachlor and acetochlorcompared topyroxasulfone.The addition of atrazine at 1.1 kg ai ha-1to any of the single active ingredient tested did notimprove Palmer amaranth control over the single active ingredient alone, with the exception ofmesotrione 72 DAP in 2014-2015 (Table 3.3).  The lack of improved control with thesecombinations was expected due to the decreased sensitivity of this Palmer amaranth populationto atrazine.  However, the greaterPalmer amaranth control 72 DAP in 2014-2015 from the PREapplication of the atrazine and mesotrione combination should be examined further.  Othersreported synergistic responses from the addition of atrazine to mesotrione applied POST toatrazine-resistant velvetleaf and redroot pigweed (Woodyard et al. 2009).Mesotrione and s-metolachlor applied alone, tank-mixed with atrazine, or tank-mixed withbicyclopyrone and atrazine were amongst the treatments that provided the greatest Palmeramaranth control (Table 3.3).  Palmer amaranth control 45 DAP in 2013 and 72 DAP in 2014-2015 with this combination was greater than control with either mesotrione or s-metolachloralone, indicating that both mesotrione and s-metolachlor were contributing to control.Overall the results from the three years of this experiment,Palmer amaranth controlwasinconsistentfrom PRE only herbicide treatments.  In 2013, none of thePREtreatments providedgreater than 85% control beyond 45 DAP.  Palmer amaranth control was moreconsistent andlasted longer in 2014-2015.  Of the 20 PRE herbicide treatments examined,there were 10treatments that provided similar levels of Palmer amaranth control (89-98%) 72 DAP in 2014-2015.  However, none of these treatments provided complete control for the entire growingseason andallwould likely need an effective POST herbicide treatment for season-long control.Treatments that included pyroxasulfone or the combination of mesotrione and s-metolachlorprovided the greatestandmost consistentPalmer amaranth control in all three years of thisexperiment.  However, relying on a single site of action (i.e., pyroxasulfone) for Palmeramaranth control will increase the selection pressure for additional resistances.  Tank-mixingherbicides with other sites of action (i.e., saflufenacil), while not always the most consistent,mayhelp reduceselection pressure on a single site of action.Evaluation of POST Herbicides.There was no corn injuryfromany of the POST herbicidetreatments (data not shown).  Due to a significant year-by-treatment interaction, Palmer amaranthcontrol results are presented separately by year.  The majority of the POST herbicide treatmentsin 2013 failed to provide adequatePalmer amaranth control 14 DAT.  Topramezone was the onlyherbicide that provided greater than 85% control (Table 3.4).  Control with all otherswas lessthan 65%.In 2014,five of the nine herbicide treatments evaluated provided greater than 90%control14DAT.  These treatments included;topramezone, dicamba, dicamba + diflufenzopyr,and glufosinate.Palmer amaranth control was lowest with glyphosate, atrazine at 0.56 and 1.12 kg ai ha-1, and2,4-D amine in both years of the study (Table 3.4).  Glyphosate and atrazine applied POSThistorically provided excellent Palmer amaranth control (Bond et al. 2006; Jhala et al. 2014;Norsworthy et al. 2008).  The failuretoeffectively control Palmer amaranth in both years of thisexperimentillustrates the resistance in this population to both atrazine and glyphosate.  Whilethis population was not tested for resistanceto 2,4-D, the lower controlobserved with 2,4-Damine was most likely due to an ineffective dose.  Miller and Norsworthy (2016) reported similarPalmer amaranth control results when 2,4-D choline was applied at similar acid equivalent ratesin 2,4-D resistant soybean.  Palmer amaranth control was greatest when 2,4-D choline wasapplied at 1.1 kg ae ha-1, twice the amount that can be applied in corn.Palmer amaranth population densities at the time of application may help explain thecontrastingdifferences in Palmer amaranth control between 2013 and 2014.  Palmer amaranthpopulations were10-fold greater in 2013 (484) compared with (43)plants m-2in 2014.  Therelatively poor control of Palmer amaranth in 2013 with several of the POST herbicides could beattributed to a lack of spray coverage and possible plant stresses associated with higher Palmeramaranth populations.  Previous research has shown that the lack of spray coverage can lead toinconsistent control of annual weeds, particularly with contact herbicides like glufosinate(Eubank et al. 2008; Steckel et al. 1997).  The higher levels of control observed with some of thetreatments in 2014may have been somewhat inflated due to the lower Palmer amaranthpopulation.  Farmers who rely on a single POST herbicide applications will most likely be facedwith Palmer amaranth population densities similar to what was observed in 2013.Topramezoneprovided the most consistent control over the two years, however,it was not completelyeffective.  Results suggest that an effective PRE herbicide will be needed to reduce Palmeramaranth populations prior to a POST application.Evaluation of Herbicide Programs for Palmer amaranth Control in Corn.None of theherbicide programs examined resulted in significant corn injury (data not shown).   Palmeramaranth control was 87% 14 DAEP with three of the five EPOS herbicide treatments (Table3.5).  Each of the effective treatments contained aHPPD-inhibiting herbicide.  Previous researchshowedtopramezone, tembotrione, and mesotrione POST can effectively control Palmeramaranth (“90%)(Jhala et al. 2014; Norsworthy et al. 2008; Schuster et al. 2008; Stephenson etal. 2015).Palmer amaranth control from the PRE herbicides at the time of the POST applicationranged between 73 and 85%.  All POST treatments, with the exception of glyphosate alone,following a PRE herbicide application provided greater than 90% Palmer amaranth control 14DAPO.  Palmer amaranth control was 58% and biomass was reduced only 48% when glyphosatewas applied POST following a PRE application ofs-metolachlor + atrazine.  The EPOStreatment ofacetochlor + clopyralid + flumetsulam + glyphosate also failed to provide a highlevel of Palmer amaranth control and only reduced biomass 83% 14 DAPO.  At harvest, theseprograms only provided 34% and 69% Palmer amaranth control, respectively.  Additionally, atharvest the EPOS program of atrazine + tembotrione + thiencarbazone-methyl + glyphosateprovided slightly lower control (83%) than several of the other programs evaluated.  Due to theresistance profile of this Palmer amaranth population, tembotrione would have been the solecomponent of this treatment contributing to Palmer amaranth control.  Tembotrione is a highlyeffective HPPD-inhibitor for management of Palmer amaranth, and a synergistic response hasbeen reported when applied in combination with atrazine in atrazine-resistant Palmer amaranth(Chapter 4).  However, the lower level of Palmer amaranth control at harvest with this treatmentwas most likely due to lack of the addition of a residual herbicide to control later emergingPalmer amaranth.The majority of EPOS programs provided similar Palmer amaranth control as the PRE fbPOST programs.  The EPOS programs that provided the greatest Palmer amaranth control allcontained a HPPD-inhibiting herbicide plus atrazinefor POST control and a Group 15 herbicide(i.e.,s-metolachlor, pyroxasulfone) for residual Palmer amaranth control.  However, due toPalmer amaranth›s extended emergence pattern and rapid growth,relying on a one-pass EPOSprogram may not be the most consistentlong-termstrategy,especially whenmanagingamultiple-resistant Palmer amaranth population.  If the EPOS program fails to control Palmeramaranth, options for rescue treatments become extremely limited.  The two-pass POSTprograms of glufosinate(EPOS) fb glufosinate (POST) provided controlcomparable toseveralof the PRE fb POST and EPOS programs, controlling 88% of Palmer amaranth at harvest (Table3.5).  While this program provided good Palmer amaranth control, it would increase selectionpressure for glufosinate resistance from the repeated application of a single herbicide site ofaction.Weconcludethat one of the most effective and consistent management strategiesto controlmultiple-resistant Palmer amaranthisa PRE fb POST herbicide program approach.  While someof the PRE and POST only treatments provided good control of Palmer amaranth, completeseason-long control was not achieved.  Herbicide programs that contained effective herbicidesites of action bothPRE and POST were among the most consistent programs.  Strategies shouldinclude at least one effective herbicide site of action PRE and two effective foliar sites of actionPOST plus a soil residual herbicide to control Palmer amaranth for the entire growing season.APPENDIXAPPENDIXCHAPTER 3 TABLESTable 3.1.Planting dates,hybrids, and herbicide application dates forPRE, POST, and herbicide program experiments to controlmultiple-resistant Palmer amaranth in corn in Barry County, MI (2013-2015).PRE experimentPOST experimentHerbicide program experiment20132014201520132014201320142015Planting dateMay 16May 19May 16May 16May 19May 16May 19May 14Corn hybridaDKC 48-12DKC 48-12P0157 AMDKC 48-12DKC 48-12DKC 48-12DKC 48-12P0157 AMPRE application dateMay 18May 19May 18____May 18May 19May 18EPOS application date__________June 6June 5June 4POST application date______June 14June 9June 21June 26June 22aCompany information: DKC 48-12, Dekalb, Monsanto Company, St. Louis MO; P0157 AM, Dupont Pioneer, Johnston, IA.Table 3.2.Herbicide product, application rates and timings, and manufacturer information for herbicide treatments used for Palmeramaranth control in corn in Barry County, MI (2013-2015).Trade nameActive ingredientsRatesTimingsaManufacturerbkg ai or aeha-12,4-D Amine 42,4-D amine0.56POSTWinfield SolutionsAAtrex 4Latrazine1.12, 1.68, 2.24PRE, EPOS, POSTSyngenta Crop ProtectionArmezontopramezone0.018POST, EPOSBASF CorporationAcuronatrazine + bicyclopyrone + mesotrione +s-metolachlor0.84 + 0.05 + 0.20 +1.8PRESyngenta Crop ProtectionBalance Flexxisoxaflutole0.11PREBayer CropScienceBicep II Magnumatrazine + s-metolachlor1.82 + 1.41PRESyngenta Crop ProtectionCallistomesotrione0.21PRESyngenta Crop ProtectionCallisto Xtraatrazine + mestrione0.67 + 0.1POSTSyngenta Crop ProtectionCaprenothiencarbazone-methyl + tembotrione0.015 + 0.076EPOSBayer CropScienceClaritydicamba0.56POSTBASF CorporationDualII Magnums-metolachlor1.4PRESyngenta Crop ProtectionHalex GTglyphosate + mesotrione + s-metolachlor1.05 + 0.1 + 1.05POST, EPOSSyngenta Crop ProtectionHarnessacetochlor1.79PREMonsanto CompanyHarness Xtraacetochlor + atrazine1.4 + 1.73PREMonsanto CompanyLaudistembotrione0.092POSTBayer CropScienceLexar EZcatrazine + mesotrione + s-metolachlor1.46 + 0.18 + 1.46PRESyngenta Crop ProtectionLiberty 280SLglufosinate0.6POST, EPOSBayer CropScienceLumax EZatrazine +mesotrione + s-metolachlor0.7 + 0.18 + 1.8PRESyngenta Crop ProtectionRoundup PowerMaxglyphosate0.84POST, EPOSMonsanto CompanySharpensaflufenacil0.08PREBASF CorporationStatusdicamba + diflufenzapyr0.14 + 0.056POSTBASF CorporationTripleFLEXacetochlor + clopyralid + flumetsulam0.31 + 0.13 + 0.04EPOSMonsanto CompanyVerdictdimethenamid-P + saflufenacil0.66 + 0.075PREBASF CorporationWarrantacetochlor1.26POSTMonsanto CompanyZemaxmesotrione + s-metolachlor0.19 + 1.9PRESyngenta Crop ProtectionZiduadpyroxasulfone0.18/0.24PREBASF CorporationaAbbreviations: PRE, preemergence application; POST, postemergence application; EPOS, early postemergence application.Table 3.2 (cont†d)bManufacturer information:  Winfield Solutions, LLC, St. Paul, MN, www.winfield.com; Syngenta Crop Protection, LLC,Greensboro, NC, www.syngenta.com; BASF Corporation, Research Triangle Park, NC, www.basf.com; Bayer CropScience, ResearchTriangle Park, NC,www.cropscience.bayer.com; Monsanto Company, St. Louis, MO, www.monsanto.com.cThe Lexar EZ (atrazine + mesotrione + s-metolachlor) rate was lowered to 0.73 + 0.09 + 0.73 kg ai ha-1when mesotrione wasapplied POST in the programs experimentto staywithin the maximum allowed mesotrione rate per season.dThe Zidua application rate was 0.18 kg ai ha-1in 2013 and increased to 0.24 kg ai ha-1for 2014 and 2015.Table 3.3.Multiple-resistant Palmer amaranth controlin corn with preemergence herbicides 45 and 72 days after planting (DAP) andPalmer amaranth biomass reduction for 2013 and 2014-2015 in Barry County, MI.Palmer amaranth control45 DAP72 DAPPalmer amaranth biomassaTreatmentRate20132014-20152014-201520132014-2015kg ai ha-1______________________%_____________________________% reduction_______atrazine1.10fb24g13h22g30fatrazine2.23f58e51fg30fg65deacetochlor1.833cd91ab89a-c43ef91abisoxaflutole0.115f64de59f53de76cdmesotrione0.2168b87ab79cd83b94abpyroxasulfonec0.18/0.24c83a94ab91ab94a97as-metolachlor1.420e82bc77de46ef76cdsaflufenacil0.750f75cd70ef18g87a-cacetochlor + atrazine1.8 + 1.140c93ab90ab55de91abisoxaflutole + atrazine0.11 + 1.120e49f43g45ef62emesotrione + atrazine0.21 + 1.170b97a97a81b99apyroxasulfonec+ atrazine0.18/0.24 + 1.185a97a98a95a99as-metolachlor + atrazine1.4 + 1.140c84bc83b-d64cd98asaflufenacil + atrazine0.75 + 1.13f83bc80c-e47ef83bcpyroxasulfonec+ saflufenacil0.18/0.24 + 0.7579ab97a96a96a98amesotrione +s-metolachlor0.19 + 1.979ab96a92ab93a98adimethenamid-P + saflufenacil0.66 + 0.07537cd86bc81cd78bc82bcmesotrione +s-metolachlor + atrazine0.19 + 1.9 + 0.780ab97a98a88ab99amesotrione +s-metolachlor + atrazine0.19 + 1.4 + 1.584a98a94ab95a98abicyclopyrone + mesotrione +s-metolachlor + atrazine0.05 + 0.19 + 1.8+ 0.84__93ab90ab__86a-caPalmer amaranth biomass was collected 45 DAP in 2013 and 60 DAP in 2014 and 2015. Biomass reduction was calculated as y =(100•((sample dry weight / non-treated control dry weight) * 100)).bMeans followed by the same letter within a column are not statistically different at ⁄ = 0.05.cThe pyroxasulfone rate was increased to 0.24 kg ai ha-1for 2014 and 2015 from 0.18 kg ai ha-1in 2013.Table 3.4.Multiple-resistant Palmer amaranth control in corn with postemergence herbicides 7 and 14 days after treatment (DAT) inBarry County, MI.Palmer amaranth control20132014Herbicide treatmenta7 DAT14 DAT7 DAT14 DATkg ai ha-1___________________%_____________________________________%__________________atrazine + COC0.5628da15cd68bc68batrazine + COC1.1247c26cd70bc72bdicamba0.5664b55b68bc91adicamba + diflufenzopyr +NIS + AMS0.14 + 0.0663b64b74bc94aglufosinate + AMS0.690a23cd96a95aglyphosate + AMS0.870e8d68bc66btopramezone + MSO + AMS0.01881a88a78b96a2,4-D amine0.5662b30c62c68baMeans followed by the sameletter within a column are not statistically different at ⁄ = 0.05.bAdjuvant information: COC = crop oil concentrate at 1% v v-1(Herbimax, Loveland Products Inc., Loveland, CO), AMS =ammonium sulfate at 2% w w-1(Actamaster, Loveland Products Inc., Loveland, CO), NIS = non-ionic surfactant at0.25% v v-1(Activator 90, Loveland Products Inc., Loveland, CO), MSO = methylated seed oil at1% v v-1(SuperSpread, Wilbur-Ellis Co., SanFrancisco, CA).Table 3.5.Evaluation of herbicide programs for the management of multiple-resistant Palmer amaranth in corn for 2013-2015 inBarry County, MI.Palmer amaranth controlBiomassaTreatmentbTimingcRate14 DAEP14 DAPOat Harvestd14 DAPOkg aiha-1%% reductionglufosinate fbglufosinateEPOSPOST0.6 fb0.673ee90b-d88ab100aacetochlor + clopyralid + flumetsulam +glyphosateEPOS0.31 + 0.13 + 0.0476e80e69c83batrazine + mesotrione + s-metolachlor +glyphosate + COCEPOS1.12 + 0.1 + 1.05 + 1.05+ 1% v v-187a93a-d92ab99aatrazine + tembotrione + thiencarbazone-methyl + glyphosate + COCEPOS1.12 +0.015 + 0.076 +0.84 + 1% v v-187a89cd84b96aatrazine + topramezone + pyroxasulfone+ glyphosate + MSOEPOS1.68 + 0.018 + 0.18 +0.84 + 1% v v-187a96a95a100aacetochlor fbglufosinatePREPOST1.79 fb0.676e91a-d87ab97aatrazine + s-metolachlor fbglufosinatePREPOST1.82+ 1.41 fb0.684a-c94a-c93a99aatrazine + s-metolachlor fbtembotrione + glufosinatePREPOST1.82 + 1.41 fb0.092+ 0.683a-d94a-c92ab99aatrazine + s-metolachlor fbglyphosatePREPOST1.82 + 1.41 fb0.8479b-d58f34d48catrazine + s-metolachlor fbatrazine + mesotrione + COCPREPOST1.82 + 1.41 fb0.67 + 0.1 + 1% v v-179b-d95ab94a100aatrazine + s-metolachlor fbmesotrione + s-metolachlor + glyphosate+ NISPREPOST1.82 + 1.41 fb0.1 + 1.05 + 1.05 +0.25% v v-185ab93a-d88ab97aacetochlor + atrazine fbatrazine + topramezone + glyphosate +MSOPREPOST1.4 + 1.73 fb0.56 + 0.018 + 0.84 +1% v v-178de94a-c92ab100aatrazine + isoxaflutole fbacetochlor + glufosinatePREPOST1.12 + 0.11 fb1.26 + 0.680b-d93a-d95a99aTable 3.5 (cont†d)Palmer amaranth controlBiomassTreatmentTimingRate14 DAEP14 DAPOat Harvest14 DAPOkg ha-1%% reductiondimethenamid-p + saflufenacil fbdicamba + diflufenzopyr + glyphosatePREPOST0.66 + 0.075 fb0.14 + 0.056 + 0.8483a-d92a-d93a96adimethenamid-p + saflufenacil fbdicamba + diflufenzopyr + tembotrione+ glyphosatePREPOST0.66 + 0.075 fb0.14 + 0.056 + 0.014+ 0.8473e91a-d94a100adimethenamid-p + saflufenacil fbdicamba + diflufenzopyr + tembotrione+ glufosinatePREPOST0.66 + 0.075 fb0.14 + 0.056 + 0.092+ 0.683a-d95a-c94a100aatrazine + mesotrione +s-metolachlor fbacetochlor + glufosinatePREPOST1.46 + 0.18 + 1.46 fb1.26 + 0.685ab95a-c93a100aatrazine + mesotrione + s-metolachlor fbatrazine + tembotrione + COCPREPOST1.46 + 0.18 + 1.46 fb0.56 + 0.092+ 1% v v-179b-d95a-c92ab100aatrazine + mesotrione + s-metolachlor fbmesotrione + s-metolachlor + glyphosate+ NISPREPOST0.73 + 0.09 + 0.73 fb0.1 + 1.05 + 1.05 +0.25% v v-184a-c95ab90ab99aaPalmer amaranth biomass reduction was calculated as y =(100•((sample dry weight / non-treated control dry weight) * 100)).bAdjuvant information: COC = crop oil concentrate at 1% v v-1(Herbimax, Loveland Products Inc., Loveland, CO),NIS = non-ionicsurfactant at0.25% v v-1(Activator 90, Loveland Products Inc., Loveland, CO), MSO = methylated seed oil at1% v v-1(SuperSpread, Wilbur-Ellis Co., San Francisco, CA).  All treatments containedAMS = ammonium sulfate at 2% w w-1(Actamaster,Loveland Products Inc., Loveland, CO).cAbbreviations:  EPOS = early postemergence; PRE = preemergence; POST = postemergence; 14 DAEP = 14 d after EPOS, 27 to 38d after PRE, and at POST; 14 DAPO = 14 d after POST.dWeed control was evaluated just prior to corn harvest.eMeans followed bythe same letter within a column are not statistically different at ⁄ = 0.05.LITERATURE CITEDLITERATURECITEDBensch CN, Horak MJ, Peterson D (2003) Interference of redroot pigweed (Amaranthusretroflexus), Palmeramaranth (A. palmeri), and common waterhemp (A. rudis) in soybean.Weed Sci 51:37•43Bond JA, Oliver LR, Stephenson DO, IV (2006) Response of Palmer amaranth (Amaranthuspalmeri) accessions to glyphosate, fomesafen, and pyrithiobac. Weed Technol 20:885•892Bryson CT, DeFelice MS, eds (2010) Weeds of the Midwestern United States & Central Canada.Athens, GA: University of Georgia Press. Pp 34•39.Culpepper AS, Grey TL, Vencill WK, Kichler JM, Webster TM, Brown SM, York AC, DavisJW, Hanna WW (2006)Glyphosate-resistant Palmer amaranth (Amaranthus palmeri)confirmed in Georgia.Weed Sci54.4:620•626Ehleringer J (1983) Ecophysiology ofAmaranthus palmeri, a sonoran desert summer annual.Oecologia 57:10•112Eubank TW, Poston DH, Nandula VK, Koger CH,Shaw DR. Reynolds DB (2008) Glyphosate-resistant horseweed (Conyza Canadensis) control using glyphosate-, paraquat-, glufosinate-based herbicide programs.  Weed Tecnol 22:16•21Geier PW, Stahlman PW, Frihauf JC (2006) KIH-485 and s-metolachlor efficacy comparisons inconventional and no-tillage corn.Weed Technol20.3:622•626Gossett BJ, Toler JE (1999) Differential control of Palmer amaranth (Amaranthus palmeri) andpigweed (Amaranthus hybridus) by postemergence herbicides in soybean (Glycine max)WeedTechnol 13:165•168Grichar WJ (1994) Spiny amaranth (Amaranthus spinosusL.) control in peanut (ArachishypogaeaL.). Weed Technol 8:199•202.Hager AG, Wax LM, Bollero GA (2002) Common waterhemp (Amaranthus rudis) interferencein soybean. Weed Sci 50:607•610Heap I (2016) The international survey of herbicide resistant weeds.www.weedscience.com.Accessed: February 5, 2016.Horak MJ, Loughin TM (2000) Growth analysis of fourAmaranthus species.WeedSci48.3:347•355Jhala AJ, Sandell LD, Rana N, Kruger GR, Knezevic SZ (2014) Confirmation and control oftriazine and 4-hydroxyphenylpyruvate dioxygenase-inhibiting herbicide-resistant Palmeramaranth (Amaranthus palmeri) in Nebraska. Weed Technol 28:28•38Johnson WG, Chahal GS, Regehr DL (2012) Efficacyof various corn herbicides applied preplantincorporated and preemergence.Weed Technol26.2:220•229Keeley PE, Carter CH, Thullen RJ (1987) Influence of planting date on growth of Palmeramaranth (Amaranthus palmeri).Weed Sci 35:199•204Klingaman TE, Oliver LR (1994) Palmer amaranth (Amaranthus palmeri) interference insoybeans (Glycine max).Weed Sci 42:523•527Kohrt JR (2016) Biology and management of multiple-(glyphosate,ALS, and atrazine)-resistantPalmer amaranth in Michigan. Ph.D dissertation. East Lansing, MI: Michigan StateUniversity.150pKnezevic SZ, Weise SF, Swanton CJ (1994) Interference of redroot pigweed (Amaranthusretroflexus) in corn (Zea mays). Weed Sci 42:568•573Massinga RA, Curie RS, Horak MJ, Boyer Jr J (2001) Interference of Palmer amaranth incorn.Weed Sci49.2:202•208Massinga RA, Currie RS, Trooien TP (2003) Water use and light interception under Palmeramaranth (Amaranthus palmeri) and corn competition.Weed Sci 51:523•531Michigan State University Enviro-weather (2016) weather station network.https://www.enviroweather.msu.edu.  Accessed: May 15, 2016Miller MR, Norsworthy JK (2016) Evaluation of herbicide programs for use in a 2,4-D-resistantsoybeantechnology for control of glyphosate-resistant Palmer amaranth (Amaranthuspalmeri) Weed Technol 30:366-376Moolani KM, Knake EL, Slife FW (1964) Competition of smooth pigweed with corn andsoybeans. Weeds 12:126•128Mueller TC, Shaw DR, Witt WW (1999) Relative dissipation of acetochlor, alachlor,metolachlor, and SAN 582 from three surface soils.  Weed Technol 13:341•346Nandula VK, Reddy KN, Koger CH, Poston DH, Rimando AM, Duke SO, Bond JA, Ribeiro DN(2012) Multiple resistance to glyphosate and pyrithiobac in Palmer amaranth (Amaranthuspalmeri) from Mississippi and response to flumiclorac. Weed Sci 60:179•188Norsworthy JK, Griffith GM, Scott RC, Smith KL, Oliver LR (2008) Confirmation and controlof glyphosate-resistant Palmer amaranth (Amaranthuspalmeri) in Arkansas. Weed Technol22:108•113Pallett KE, Little JP, Sheeky M, Veerasekaran P (1998) The mode of action of isoxaflutole: I.Physiological effects, metabolism, and selectivity.Pesticide Biochemistry andPhys62.2:113•124Pallett KE, CrampSM, Little JP, Veerasekaran P, Crudace AJ, Slater AE (2001) Isoxaflutole: thebackground to its discovery and the basis of its herbicidal properties.  Pest Manag Sci57:133•142Papiernik SK, Koskinen WC, Barber BL (2012) Low sorption and fast dissipationof theherbicide saflufenacil in surface soils and subsoils of an eroded prairie landscape.  J AgricFood Chem 60:10936•10941Powell DK (2014) Biology and management of multiple (glyphosate/ALS)-resistant Palmeramaranth in Michigan soybean. Ph.D dissertation. East Lansing, MI: Michigan StateUniversity. 122 pSchuster CL, Al-Khatib K, Dille JA (2008) Efficacy of sulfonylurea herbicide when tank mixedwith mesotrione. Weed Technol 22:222•230Schweizer EE, Lauridson TC (1985) Powell amaranth (Amaranthuspowellii) interference insugarbeet (Beta vulgaris). Weed Sci 33:518•520Sellers BA, Smeda RJ, Johnson WG, Kendig JA, Ellersieck MR (2003) Comparative growth ofsixAmaranthus speciesin Missouri.Weed Sci51.3:329•333Sosnoskie LM, Kichler JM, Wallace RD, Culpepper AS (2011) Multiple resistance in Palmeramaranth to glyphosate and pyrithiobac confirmed in Georgia. Weed Sci 59:321•325Steckel GJ, Wax LM, Simmons FW, Phillips WH, II (1997) Glufosinate efficacy on annualweeds is influenced by rate and growth stage. Weed Technol 11:484•488Steckel LE, Main CL, Ellis AT, Mueller TC (2008) Palmer amaranth (Amaranthus palmeri) inTennessee has low level glyphosate resistance. Weed Technol 22:119•123Stephenson DO IV, Bond JA (2012) Evaluation ofthiencarbazone-methyl-and isoxaflutole-based herbicide programs in corn.  Weed Technol 26:37•42Stephenson DO IV, Bond JA, Landry RL, Edwards HM (2015) Weed management in corn withpostemergence applications of tembotrione or thiencarbazone:tembotrione.WeedTechnol29.3:350•358Taylor-Lovell S, Sims GK, Wax LM (2002) Effects of moisture, temperature, and biologicalactivity on the degradation of isoxaflutole in soil.  J Agric Food Chem 50:5626•5633Toler JE, Guice B, Murdock EC (1996) Interference between Johnsongrass (Sorghumhalepense), smooth pigweed (Amaranthus hybridus), and soybean (Gylcine max). Weed Sci44:331•338Ward SM, Webster TM, Steckel LE (2013) Palmer amaranth (Amaranthus palmeri): a review.Weed Technol 27:12•27Webster TM, Grey TL (2015) Glyphosate-resistant Palmer amaranth (Amaranthus palmeri)morphology, growth, and seed production in Georgia. Weed Sci 63:264•272Westra EP, Shaner DL, Westra PH, Chapman PL (2014) Dissipation and leaching ofpyroxasulfone ands-metolachlor.  WeedTechnol 28:72•81Wiese (1968) Rate of weed root elongation. Weed Sci 16:11•13Woodyard AJ, Hugie JA, Riechers DE (2009) Interactions of mesotrione and atrazine in two weedspecies with different mechanisms for atrazine resistance.Weed Sci57.4:369•378CHAPTER 4RESPONSE OF A MULTIPLE-RESISTANT PALMER AMARANTH POPULATION TOFOUR HPPD-INHIBITING HERBICIDES APPLIED ALONE AND WITH ATRAZINEAbstractControl of multiple-(glyphosate, ALS, and atrazine) resistant Palmer amaranth populations incorn will rely heavily on the use of POST 4-hydroxyphenylpyruvate dioxygenase (HPPD)-inhibiting herbicides.  Therefore, field and greenhouse experiments were conducted to: 1)evaluate the level of Palmer amaranth control with four HPPD-inhibitors alone and incombination with atrazine at two application timings, and 2) investigate the joint-activity ofHPPD-inhibiting herbicides and atrazine in atrazine-resistant (AR) and atrazine-susceptible (AS)Palmer amaranth populations.  Control of the AR Palmer amaranth population varied among theHPPD-inhibiting herbicides with tolpyralate > tembotrione = topramezone > mesotrione basedGR50values in the greenhouse.  In the field Palmer amaranth control was lower when the HPPD-inhibiting herbicides, with the exception of tolpyralate, were applied to 15 cmversus8 cmtallPalmer amaranth.  Tolpyralate controlled Palmer amaranth 95% or greater at both applicationtimings.  The addition of atrazine at 560 g ai ha-1improved Palmer amaranth control withmesotrione and topramezone at the 8 cm application timing and with mesotrione and tembotrioneat the 15 cm application timing.  In the greenhouse, the joint activity of mesotrione and atrazineand tembotrione and atrazine was synergistic with both the AR and AS Palmer amaranthpopulations.  To initiate a synergistic response in the AR population with tembotrione 8X therate of atrazine was needed compared with the AS population.  Synergistic responses withmesotrione were detected with all the atrazine rates for the AS population and for atrazine ratesof 280 to 2,240 g ai ha-1.  Only additive responses were observed when atrazine was applied withtolpyralate and topramezone,indicating that the triketones are more susceptible to joint activityin the form of synergism compared withthe benzopyrazoles.  When faced with an AR populationPalmer amaranth, the addition ofatrazine to HPPD-inhibitors mayincrease the overall success ofweed management due to joint activity.Nomenclature:Atrazine; mesotrione; tembotrione; tolpyralate; tembotrione; corn,Zea maysL.;Palmer amaranth,Amaranthus palmeriS. Wats.Key words:HPPD-inhibitors; joint activity; multiple-resistance; synergism.IntroductionPalmer amaranth (Amaranthus palmeriS. Wats) is one of the most troublesome weeds inagronomic row crop production, due to season-long emergence, rapid growth rate,andprolificseed production (Horak and Loughin 2000; Keeley et al. 1987).  In addition to its innatebiological characteristics, the development of resistance to several different herbicide sites ofaction that makes Palmer amaranth difficult to control.  Currently in the United States, Palmeramaranth populations have developed resistance to six different herbicide sites of action (Heap2016).  In addition to populations that are only resistant to a single site of action, there areseveral populations that have developed resistance to multiple herbicide sites of action whichrestricts the number of herbicides that farmers can use to manage this weed.  In 2013, apopulation of Palmer amaranth found in Michigan was confirmed to be resistant to threeherbicide sites of action groups: Group 9 (glyphosate), Group 2 (ALS-inhibitors), and Group 5(atrazine) (Chapter 2), limiting the number of herbicide options available for Palmer amaranthcontrol in corn.The 4-hydroxyphenylpyruvate dioxygenase (HPPD)-inhibiting herbicides (Group 27) arepotential postemergence options for control of multiple herbicide-resistant Palmer amaranth incorn.  Mesotrione, tembotrione, topramezone and the new herbicide active ingredient,tolpyralate, are herbicides that inhibit the HPPD-enzyme and may potentially control multiple-resistant Palmer amaranth (Grossmann and Ehrhardt(2007); Mitchell et al. 2001; Witschel2008).  HPPD-inhibiting herbicides control sensitive species by stopping the conversion of 4-hydroxyphenylpyruvate to homogentisate, which leads to the depletion of plastoquinone and ⁄-tocopherol (Grossmann and Ehrhadt 2007; Mitchell et al. 2001; Pallett et al. 1998; Schulz 1993).Plastoquinone is a key enzyme cofactor for phytoene desaturase, ultimately leading to theinhibition of carotenoid biosynthesis, which results in the bleaching of new tissue (Mitchell et al2001; Schulzet al. 1993).  The inhibition of ⁄-tocopherol results in membrane destruction anddegradation of the D1 protein, due to the plant›s inability to quench reactive oxygen species andtriplet chlorophyll produced by photosystem II (PSII) (Kruk et al. 2005; Trebst et al. 2002).Combinations of two or more herbicides can yield either an additive, synergistic, or antagonisticresponse.  These responses are determined by calculating a predicted value and comparing it toan expected value of the herbicide combination (Colby 1967; Flint et al. 1988; Gowing 1960).  Ifthe values of the observed and predicted are equal then the combination is additive.  If theobserved value is significantly greater than the calculated predicted value then the herbicidecombination is deemed to be synergistic and if the observed value is significantly less thanpredicted the combination is antagonistic.  Antagonistic responses have been observed withseveral herbicide tank-mixtures (Damalas and Eleftherohorinos 2001; O›Donovan andO›Sullivan 1982; Schuster et al. 2008; Selleck and Baird 1981). For example, previous researchhas shown that antagonism can occur between the HPPD-inhibiting herbicide mesotrione andsulfonylurea herbicides (Schuster et al. 2008). The addition of mesotrioneto nicosulfuronreduced green foxtail (Setaria viridisL.) control up to 23% compared with nicosulfuron alone.The mechanisms by which antagonism can occur has been attributed reduced absorption,reduced translocation, and physiological interactions at the target site within the plant (Hart andWax 1996; Green 1989; Schuster et al. 2007).A well-documented instance of a synergistic response with combinations of two herbicideshas been with the HPPD-inhibiting herbicide, mesotrione and the PSII-inhibitingherbicide,atrazine (Abendroth et al. 2006; Armel et al. 2007; Hugie et al. 2008; Woodyard et al. 2009a).This synergistic response wasobserved in giant ragweed (Ambrosia trifidaL.), commonlambsquarters (Chenopodium albumL.), velvetleaf (Abutilon theophrastiM.), commonwaterhemp (Amaranthus rudisSauer), and redroot pigweed (Amaranthus retroflexusL.)(Abendroth et al. 2006; Hugie et al. 2008; Woodyard et al. 2009a; Woodyard et al. 2009b),andhas also been observed in atrazine-resistant redroot pigweed and velvetleaf (Woodyard et al.2009b).  However, the extent of synergistic responses in the atrazine-resistant weed species wasdependent on whether the mechanism of resistance was altered-target site or metabolism based.The majority of previous research has been focused on the interaction of mesotrione andatrazine.  Currently, there is no information available on the potential synergistic effects ofatrazine with the newer HPPD-inhibiting herbicides, tembotrione, topramezone, and tolpyralate.While previous research has shown that synergistic responses can occur with mesotrione andatrazine in other atrazine-resistant weed species, it is unknown whether this interaction will existin the multiple-resistant Palmer amaranth population found in Michigan. Therefore, theobjectives of this research were to: 1) evaluate Palmer amaranth control with four HPPD-inhibiting herbicides alone and in combinationwithatrazine at two different application timings,and 2) characterize the response of an atrazine-resistant and atrazine-sensitive Palmer amaranthpopulation to combinations of HPPD-inhibiting herbicides and atrazine.Materials and MethodsField Experiment.Field experiments were conducted in 2013 and 2015 in a commercial cornfield in Barry County, MI(42.702467°N;-85.524992°W).  The Palmer amaranth population atthis location was confirmed to be resistant to glyphosate, ALS-inhibiting herbicides,andatrazinethough previous greenhouse screenings(Chapter 2).The soil type was a combination of anOshtemo sandy loam and a Boyer loamysand composed of 73% sand, 15%silt, and 12%clay,with a pH of 7.6 and 2.2% organic matter.  Field preparation at this location was fall chisel plowfollowed by two-passes of a soil finisher in the spring.Corn (DKC 48-12, Dekalb, MonsantoCompany, St. Louis, MO.) was planted on May 20, 2013 and May 14, 2015 at 67,950 seeds ha-1.The Palmer amaranth population at this location was relatively high with 484 and 334 plants m-2in 2013 and 2015, respectively.The experiment was conducted as a two-factor randomized complete block design with fourreplications. Factor A was application timing and Factor B was herbicide treatment.  Each plotwas 3 m wide by 9 m long.  Herbicide treatments were applied when Palmer amaranth was 8 and15 cm in height.Mesotrione, tembotrione, tolpyralate, and topramezone were applied alone andin combination with atrazine.  Table 4.1 provides a complete listing of product information,application rates, and adjuvants for each herbicide treatment.  Herbicide treatments were appliedusing a CO2-pressurized backpack sprayer calibrated to deliver 187 L ha-1at a pressure of 207kPa through 11003 AIXR flat-fan nozzles (TeeJet, Spraying Systems Co., Wheaton, IL 60187).Crop injury and weed controlwereevaluated7, 21, and 28 days after treatment (DAT) for the 8cm application timing, and at 7 and 21 DAT forthe 15 cm timing.  Evaluations were based on ascale from 0 to 100% with 0 representing no control or crop injury and 100 indicating completecontrol or total plant death.  At the conclusion of the visual evaluations,aboveground Palmeramaranth biomass was harvested from two random 0.25 m2quadrats in each plot.  Biomass wasdried for approximately 7 d at 65 C, andthen weighedto calculate the percent Palmer amaranthbiomass reduction compared with the non-treated control plots.Statistical analysis wasconducted using SAS® 9.4 (SAS institute Inc. Carey, NC 27513).Assumptions of normality of residuals and homogeneity of variances were confirmed using thePROC UNIVARIATE.  Analysis of variance was conducted using PROC MIXED to test formain effects (application timing and herbicide treatment), their interactions, and interactionsbetween years.  Since year interactions were not significant, data was combined over both yearsof the experiment.  Multiple comparisons among the means were conducted usingt-tests whendata was found to be statistically significant at 0.05 levels.Joint activity between atrazine and each HPPD-inhibiting herbicide were evaluated using themodel described by Gowing (1960) (Equation 1).[EQ. 1]WhereEis theexpected value of the herbicide combination,Ais the observed percent control byherbicide atrazine, andBis the observed percent control by the HPPD-inhibiting herbicide.  Theexpected values and observed values for each herbicide combination were compared using t-testsin PROC MIXED.  If the observed value was significantly less than the expected value thecombination was antagonistic; if the observed value was significantly greater than the expectedvalue the combination was synergistic; and if therewas no significant difference between theobserved and expected values the combination was additive.Greenhouse Experiments.Seed heads from the multiple herbicide-resistant Palmer amaranthpopulation from Barry County, MI (42.702467°N;-85.524992°W)were collected in fall 2013and threshed.  We will refer to this population as atrazine-resistant (AR) throughout theremainder of the text.  Seed from a susceptible Palmer amaranth population was obtained fromDr. Larry Steckel, University of Tennessee and will be referred to as our atrazine-sensitivepopulation (AS).  Seed from both populations were treated with a 50% sulfuric acid and watersolution for 4 min, rinsed, and then exposed to gibberellic acid at a concentration of 0.15 g L-1ofwater for 6 hto enhance germination.Approximately 15 Palmer amaranth seeds of the AR andAS populations were planted 0.75 cm deep in 10 x 10 cm pots filled with potting media (SuremixPerlite, Michigan Gower Products, Inc., Galesburg, MI).  Seedlings were grown in thegreenhouse at 25 ± 5 C and sunlight was supplemented to provide a total midday light intensityof 1,000 µmol m-2s-1photosynthetic photon flux at plant height in a 16 h day.  Plants werewatered and fertilized as needed to promote optimum plant growth.After emergence, pots werethinned to one Palmer amaranth plant pot-1.Differential Response of Palmer amaranth with Four HPPD-Inhibiting Herbicides.Mesotrione,tembotrione, tolpyralate, and topramezone were applied at rates ranging from 0.125 to 4X,0.063to 2X, 0.031 to 2X, and 0.063 to 2X, respectively, when the AR Palmer amaranth population was10 cm tall. The 1X rates of mesotrione, tembotrione, tolpyralate, and topramezone were 105, 92,39, and 18 g ai ha-1, respectively.  Tembotrione, tolpyralate, and topramezone treatments wereapplied withmethylated seed oil (MSO) (SuperSpread, Wilbur-Ellis Co., San Francisco, CA) at1% v v-1and 1% w w-1of spray grade ammonium sulfate (AMS) (Actamaster, LovelandProducts, Inc., Loveland, CO).  Mesotrione treatments were appliedwith 1% v v-1crop oilconcentrate (COC) (Herbimax, Loveland Products Inc., Loveland, CO)and 1% w w-1AMS.Herbicide treatments were applied using a single-nozzle track sprayer equipped with an 8001ETeeJet flat-fan nozzle (Teejet Technologies, Wheaton, IL) calibrated to deliver 187 L ha-1at 193kPa of pressure.  Weed control was evaluated 14 DAT usinga 0 to 100% scale, 0 representing nocontrol and 100 equaling plant death.  Aboveground biomass was harvested 14 DAT, dried for 7d at 60C, and weighed.  Dry weights were converted to the percent of the non-treated controlpots.  All treatments were replicated fivetimesand the experiment was repeated in time.Data was analyzed using nonlinear-regression inSigmaPlot version 11.0 (Systat SoftwareInc., San Jose, CA).The herbicide dose required to provide 50% control and reduce Palmeramaranth biomass (growth) by 50% (GR50) was calculated for each herbicide using thelog-logistic model (Equation 2) (Burgos et al. 2013):[EQ. 2]Wheredequals the upper limit,cis the lower limit, andbis the relative slope around the GR50.Deviations from the model are indicated byr2values.  Differences in GR50values between theHPPD-inhibitors were detected using the extra sum of squares principle for non-linear regression(Lindquist et al 1996).Joint Activity of HPPD-Inhibiting Herbicides with Atrazine.Atrazine was applied at ratesranging from 0.031 to 2X (0.04 to 2.24 kg ai ha-1)for the susceptible (AS) population and 0.25 to32X (0.28 to 35.89 kg ai ha-1) for the resistant (AR) population.These rates were applied aloneand in combination with mesotrione at 35 g ai ha-1, tembotrione at 11.5 g ai ha-1, tolpyralate at2.5 g ai ha-1, and topramezone 2.25 g ai ha-1.  Rates of the HPPD-inhibiting herbicides selectedwere closely related to the GR50responses from the previous experiment with the AR population.The 1X atrazine rate was 1.12 kg ai ha-1, regardless of population.  Crop oil concentrateat 1% vv-1plus AMS at 1% w w-1was included when atrazine was applied alone or incombination withmesotrione.  Methylated seed oilat 1% v v-1plus AMS at 1% w w-1was added to the treatmentsthat included tembotrione, tolpyralate, and topramezone.  Similar to the previous experiment, allherbicide treatments were applied using a single-nozzle track sprayer equipped with an 8001ETeeJet flat-fan nozzle calibrated todeliver 187 L ha-1at 193 kPa of pressure.  Weed controlevaluations were made 14 DAT on a scale of 0 to 100.  All treatments were replicated six timesand the experiment was repeated in time.Data was analyzed in SAS 9.4 using a method described by Flint et al. (1988) to evaluateherbicide interactions.  The expected values for the herbicide combinations were derived fromthe equation developed by Colby in 1967 (Equation 3).[EQ. 3]WhereErepresents the expected growth reduction of the herbicide combination,XandYis theobserved growth reduction with atrazine and HPPD-inhibitor applied at specific rates,respectively.  Flint et al. (1988), developed a statistical test using ANOVA for Colby›s equationto determine whether herbicide interactions were additive, antagonistic, or synergistic.  All datawas log-transformed to account for heterogeneity and allow for slope comparison of the HPPD-inhibitors and atrazine applied alone and in combination to determine herbicide interaction (Flintetal. 1988; Hugie et al. 2008; Woodyard et al 2009b).  Slope estimate comparisons wereconducted using PROC MIXED and a series of contrast statements to determine whether theherbicide combinations were additive, antagonistic, or synergistic.Resultsand DiscussionPalmer amaranth Control in the Field with HPPD-Inhibiting Herbicides Alone and withAtrazine.Corn injury was minimal (<3%) with all of the treatments examined (data not shown).Atrazine applied alone was one of the least effectivetreatments for Palmer amaranth control,regardless of Palmer amaranth height at the time of application (Table 4.2).  Postemergenceapplications of atrazine are generally effective for Palmer amaranth control (Norsworthy et al.2008; Stephenson et al. 2015).  Atrazine plus glyphosate applied POST provided 95% control ofa glyphosate-resistant Palmer amaranth population in Tennessee, 28 DAT (Wiggins et al. 2015).Seed samples collected from the field where our experiments were conducted showed that thePalmer amaranth population that we were examining had a resistance factor of 9.3X for POSTapplied atrazine compared with an atrazine-sensitive Palmer amaranth population (Chapter 2).Even though we consider this population to be atrazine resistant, control of this population wasvariable and slightly higher than we expected (61%) for a resistant population when atrazine wasapplied to 8 cm tall Palmer amaranth.  The observations of live Palmer amaranth plants thatsurvived the POST atrazine application next to dead plants indicates that this population may stillbe segregating toward an atrazine-resistant population in the field.  Palmer amaranth control was<20% when atrazine was applied to 15 cm tall Palmer amaranth.  Atrazine-resistant Palmeramaranth populations have also been reported in Georgia, Kansas, Nebraska, and Texas (Heap2016).Of the four HPPD-inhibiting herbicidesapplied; tolpyralate provided the greatest control(>95%), regardless of Palmer amaranth height at the time of application(Table 4.2).Tembotrione also provided good control of Palmer amaranth (91%) when it was applied at the 8cm application timing.  However, control was significantly lower (59%) when tembotrione wasapplied to 15 cm tall Palmer amaranth.  Applications ofmesotrione and topramezone were not aseffective at controlling Palmer amaranth as tolpyralate or tembotrione at the 8 cm applicationtiming and only tolpyralate effectively controlled Palmer amaranth (95%) at the 15 cm timing.Biomass results were less indicative of the differences in the response of Palmer amaranth to theHPPD-inhibiting herbicides when compared with the control evaluations applied at the 8 cmtiming, even though similar trends were observed (Table 4.2).  However, biomass resultsadequately reflectedthe differences observed when the HPPD-inhibiting herbicides were appliedto 15 cm tall Palmer amaranth; tolpyralate reduced Palmer amaranth biomass (98%) more thantembotrione and topramezone, and mesotrione was the least effective of the HPPD-inhibitors atreducing Palmer amaranth biomass.  Variability in the Palmer amaranth growth and populationsacross the plots may have skewed the biomass data, since biomass was sampled from tworandom 0.25 m-2quadrats per plot.  Each quadrat would not have had the same number of initialplants.  Possibly flagging a known number of plants at the time of application and harvestingthose plants for biomass would have provided more representative results.The addition of atrazine to mesotrione and topramezone improved Palmer amaranth controlfrom 69 to 97% and 77 to 97%, respectively, at the 8 cm application timing (Table 4.2).  Addingatrazine to tolpyralate and tembotrione did not improve Palmer amaranth control over theseHPPD-inhibiting herbicides applied alone, possibly due to the already high levels of control.When Palmer amaranth was 15 cm tall an improvement in control and percent biomass reductionwas also observed when atrazine was added mesotrione and tembotrione.  Even with thisimproved control, the combination of mesotrione plus atrazine failed to adequately control (65%)larger Palmer amaranth plants.  Adding atrazine to topramezone did not improve Palmeramaranth control at the later application timing and control was only around 70% withtopramezone alone or in combination with atrazine.  Tolpyralate with or without the addition ofatrazine provided the greatest Palmer amaranth control (>95%) when it was applied to 15 cm tallPalmer amaranth.The improved Palmer amaranth control with the addition of atrazine with some of the HPPD-inhibiting herbicides was somewhat unexpected, since this population has been shown to beresistant to atrazine.  Synergistic responses were observed with the combination of mesotrioneand atrazine at both application timings, topramezone and atrazine at the 8 cm applicationtiming, and tembotrione plus atrazine at the 15 cm application timing (Table 4.3).  Weed heightat application has previously been reported to influence the detection of synergism (Abendroth etal. 2006).  This population of Palmer amaranth has demonstrated resistance to atrazine that issuspected to be metabolism based (Chapter 2).  Synergism has been observed with atrazine andthe HPPD-inhibitors in atrazine-resistant weed species, however the level at which the synergismoccurs is dependent on mechanism resistance.  In metabolism based atrazine-resistant velvetleafsynergistic interactions were present when atrazine and mesotrione were applied as a tank-mixture; whereas in an altered target-siteresistant redroot pigweed synergism occurred with bothtank-mixtures and when atrazine was applied PRE and mesotrione was applied POST(Woodyard et al. 2009b).  The lack of synergism in the metabolism-based velvetleaf whenatrazine was applied PRE followed by mesotrione POST was likely due to atrazine beingdetoxified prior to mesotrione application.Differential Response of Atrazine-Resistant Palmer amaranth (AR) with Four HPPD-Inhibiting Herbicides in the Greenhouse.Dose response experiments were conducted tocompare the response of Palmer amaranth to the HPPD-inhibiting herbicides: mesotrione,tembotrione, tolpyralate, and topramezone.  Of the four HPPD-inhibiting herbicides examined,Palmer amaranth was the least sensitive to mesotrione.  Thedoses required to control and reducePalmer amaranth biomass by 50% (GR50values), 14 DAT, were 0.23X (24.2 g ai ha-1) and 0.12X(12.6 g ai ha-1) the labeled use rates, respectively (Tables 4.4 and 4.5).  These doses are in therange of GR50values reported by Abendroth et al. (2011) and Jhala et al. (2014) for control ofPalmer amaranth populations sensitive to HPPD-inhibiting herbicides.  According to GR50valuesfor dry Palmer amaranth biomass, Palmer amaranth responses to tembotrione, tolpyralate, andtopramezone were similar, with GR50values ranging from 0.03 to 0.05X the labeled use rates ofthese products (Table 4.5).  However, GR50values for Palmer amaranth control indicated thatPalmer amaranth was slightly more sensitive to applications of tolpyralate than tembotrione ortopramezone (Table 4.4).  These results are consistent with results that we observed in the field,where tolpyralate was amongst the most effective and mesotrionewasthe least effective of theHPPD-inhibiting herbicides for Palmer amaranth control, regardless of application timing (Table4.2).  Palmer amaranth control with tembotrione and topramezone fell somewhere in betweentolpyralate and mesotrione, depending on Palmer amaranth height.Joint Activity of HPPD-InhibitingHerbicides with Atrazine on Atrazine-Sensitive andAtrazine-Resistant Palmer amaranth Populations in the Greenhouse.Mesotrione.In theatrazine-sensitive (AS) Palmer amaranth population,a synergistic response was detected when aconstant rate of 35 g ai ha-1of mesotrione was tank-mixed with all rates of atrazine ranging from40 to 2,240 g ai ha-1(Table 4.6).  The strongest synergistic response, as indicated by the estimatevalues, occurred when 35 g ai ha-1of mesotrione was applied in combination with 560 g ai ha-1of atrazine.  Palmer amaranth control with this combination was 23% higher than expected.Synergistic responses were also detected in the atrazine-resistant (AR) population.  Thecombination of the single rate of mesotrione with atrazineat rates ranging from 280 to 2,240were all synergistic and the strongest response occurred when atrazine was at 2,240 g ai ha-1, 2Xthe labeled atrazine rate.  When atrazine was applied the higher rates from 4,480 to 35,900 g aiha-1(4 to 32X) the response in the AR population was additive.  The additive response withatrazine applied form the 4 to 32X rate could possibly be due to an interaction of mesotrionewith and the clay-based formulation of atrazine at these high rates.  A visible white film coatedthe leaf surface when atrazine was applied at the 32X rate, which may have restricted mesotrioneuptake.Tembotrione.Synergistic responses were also detected in the atrazine-sensitive (AS) andatrazine-resistant (AR) Palmer amaranth populations when a constant rate of tembotrione (11.5 gai ha-1) was applied with atrazine (Table 4.7).  Unlike the synergistic responses observed withmesotrione, a much narrower range of atrazine rates triggered the synergistic response withtembotrione.  Atrazine rates ranging from 140 to 1,120 g ai ha-1triggered the synergisticresponses in the AS population and only 1,120 and 2,240 g ai ha-1of atrazine triggered thesynergistic responses in the AR population.  Additive responses were observed at both the lowestand highest atrazine rates tested in both populations.  With the exception of atrazine applied at35,900 (32X) in the AR population, all other additive responses had a negative slope estimate,indicating the potential for synergism.  To date, we are unware of any research that has tested thecombination of tembotrione and atrazine for synergistic responses.  However, several researchershave reported improved and less variable weed control in several weed species, including redrootpigweed and Palmer amaranth, when various rates of atrazinewereapplied with tembotrionecompared with tembotrione applications alone (Stephenson et al. 2015; Williams et al. 2011).Tolpyralate.All responses to the combination of the single rate of tolpyralate with atrazine inboth the AS and AR Palmer amaranth populations were not significant and therefore additive,with the exception of the combination with the highest rate of atrazine 35,900 g ai ha-1(32X) inthe AR population (Table 4.8).  The strong antagonistic response (estimate = 2.1) at this rate maypossibly be due to reduced absorption of the HPPD-inhibitor, tolpyralate.  Atrazine applied at32X the labeled rate caused a white film over the leaf›s surface, possibly due to the clay basedformulation.  This clay film may have resulted in the binding of tolpyralate on the leaf›s surface,resulting in reduced absorption which could lead to decreased levels of the herbicide reaching thetarget sitein the plant. The herbicidal activity of tolpyralate is similar to that of other HPPD-inhibitors, however our results indicate that it may function at a different site within thecarotenoid biosynthesis pathway than the triketone herbicides, mesotrione andtembotrione.Differential responses of synergism and antagonism, have been observed with atrazinecombinations with herbicides that inhibit different sites within the carotenoid biosynthesispathway (Armel et al. 2007).  Since tolpyralate is pro-herbicide and needs to be metabolized tobecome herbicidally active (Jeanmart et al. 2015), the rate of metabolism to the active form mayoccur at different rates within different plant species, similar to conversion of the pro-herbicideisoxaflutole to the activediketonitrile (Pallet et al. 1998).  If metabolism of tolpyralate occurs toorapidly in Palmer amaranth, and the herbicidal activity does not coincide with that of atrazine,synergism may be lost, regardless of atrazine susceptibility.Topramezone.Similar to tolpyralate, no synergistic responses were observed with thecombination of the single rate of 2.25 g ha-1of topramezone and atrazine at any rate for both theAS and AR Palmer amaranth populations (Table 4.9).  These results are contrary to thesynergistic response that we observed in the field when 18 g ai ha-1of topramezone was appliedwith 560 g ai ha-1atrazine to the 8 cm tall AR Palmer amaranth population (Table 4.3).  Thepresence of negative slopes within some of the atrazine rates and topramezone combinationsindicate that there is potential for a synergistic response between these herbicides (Table 4.9).The combination of topramezone with the highest rate of atrazine (32X) on the AR Palmeramaranth population showed a strong antagonisticresponse (estimate = 1.7) and was likely dueto possible reductions in topramezone absorption, similar to what was observed with tolpyralate.Topramezone and tolpyralate are members of the benzolpyrazole chemical family (Witschel etal. 2009; Wood 2016).Benzolpyrazole herbicides are considered the most herbicidally activemembers of the known HPPD-inhibiting herbicides (Almsick 2009; Witschel 2008).  Thepotency of these herbicides for inhibition of the HPPD enzyme compared with the triketoneherbicides, mesotrione and tembotrione, may have led to the lack synergistic responses withtopramezone and tolpyralate.The majority of previous research conducted on synergism has only focused on one ofHPPD-inhibiting herbicides, mainly mesotrione in combinationwith atrazine (Abendroth et al.2006; Hugie et al. 2008; Woodyard et al. 2009a; Woodyard et al. 2009b).  The novel aspect ofthis research isshowingthe differential control of Palmer amaranth and joint-activity of fourdifferent HPPD-inhibiting herbicides applied alone and in combination with atrazine.Differential levels of Palmer amaranth control between the HPPD-inhibitors were observed inboth the field and greenhouse, with mesotrione being the least effective on Palmer amaranth.The GR50values from the greenhouse dose response experiments indicate that tolpyralate >tembotrione = topramezone > mesotrione for HPPD-inhibitor activity for Palmer amaranthcontrol 14 DAT.  Weed height at application also influenced Palmer amaranth control with theHPPD-inhibiting herbicides.  Control was lower when HPPD-inhibitors were applied to 15 cmtall Palmer amaranth compared with the 8 cm application timing with all of the HPPD-inhibitors,except for tolpyralate, which provided >95% control.  Even though this population of Palmeramaranth has demonstrated atrazine resistance, the addition of atrazine to some of the HPPD-inhibiting herbicides improved control at both application timings.  The less effective HPPD-inhibitors like mesotrione showed the greatest increases in control.  This increase in control canbe attributedtosynergistic interactions between some of the HPPD-inhibitors and atrazine.The joint-activity of atrazine and HPPD-inhibitors in the field was synergistic for mesotrione andtopramezone at the 10 cm timing and for tembotrione and mesotrione at the 15 cm timing;allother combinations were additive.  In the greenhouse, synergism was detected in both AS andAR populations with mesotrione and tembotrione.  While trends forsynergism in the greenhousewere present with 3 of the 4 HPPD-inhibitors, they were only significant with mesotrione andtembotrione,the members of the triketone chemical family.This indicatesthat the independentphysical chemical properties, potency,and speed of activity associated with different HPPD-inhibiting herbicides can influence the joint-activity with atrazine in both resistant andsusceptible populations.  Armel et al. (2007) demonstrated similar results showing that jointactivity can varywithin herbicides within the same mode of action.  Previous research hassuggested that joint-activity between HPPD-inhibitors and atrazine is due to the depletion ofplastoquinone and ⁄-tocopherol caused by inhibition of the HPPD enzyme (Armel et al. 2005;Kruk et al. 2005; Trebst et al. 2002).  Plastoquinone is the normal substrate for the QBbindingsite of the D1 protein PSII, and depletion could cause an increase in atrazine binding (Hess 2000,Pfister 1981).  This binding results in the production ofsinglet oxygen and triplet chlorophyllwhich results in lipid peroxidation of cell membranes (Hess 2000).  Therefore, the inhibition of⁄-tocopherol, an important plant antioxidant, can exacerbate the lipid peroxidation caused by thedegradation of PSII due to the plant›s inability to quench reactive oxygen species and tripletchlorophyll produced by PSII (Armel et al. 2005; Kruk et al. 2005; Trebst et al. 2002).The results from this research show that even when faced with an AR population of Palmeramaranth, atrazine can still be an effective tool for weed management.  Applying atrazine incombination with the HPPD-inhibitors can generate a synergistic or additive increase for thecontrol of AS and AR weed species.  These responses can be helpful in controlling AR Palmeramaranth, especially as Palmer amaranth size increases.APPENDIXAPPENDIXCHAPTER 4 TABLES AND FIGURESTable 4.1.Herbicide information for all treatments applied to 8 and 15 cm tall multiple-resistant Palmer amaranth in Barry County,MI in 2013 and 2015.Herbicide treatmentsAdjuvantsaHerbicide ratesTrade namesManufacturerbg ai ha-1atrazineCOC560AAtrex 4LSyngenta Crop ProtectionmesotrioneCOC + AMS105CallistoSyngenta Crop ProtectiontembotrioneMSO + AMS92LaudisBayer CropScience LPtolpyralateMSO + AMS40SL-573ISK Biosciences, CorptopramezoneMSO + AMS18ArmezonBASF Corporationmesotrione  + atrazineCOC + AMS105 + 560Callisto +AAtrex 4LSyngenta Crop Protectiontembotrione + atrazineMSO + AMS92 + 560Laudis+AAtrex 4LBayer CropScience + Syngentatolpyralate + atrazineMSO + AMS40 + 560SL-573 +AAtrex 4LISKBiosciences + Syngentatopramezone + atrazineMSO + AMS18 + 560Armezon+AAtrex 4LBASF Corporation + SyngentaaCOC = crop oil concentrate at 1% v v-1, Herbimax, Loveland Products Inc., Loveland, CO; AMS = ammonium sulfate at 1% w w-1,Actmaster,Loveland Products Inc., Loveland, CO; MSO = methylated seed oil at 1% v v-1, SuperSpread®, Wilbur-Ellis Co., SanFrancisco, CA.bManufacturer information:Syngenta Crop Protection, LLC, Greensboro, NC; Bayer CropScience LP, Research Triangle Park, NC;ISK Biosciences, Corp, Concord, OH; BASF Corporation, Research Triangle Park, NC.Table 4.2.Interaction of weed height and HPPD-inhibiting herbicides applied with and withoutatrazine on atrazine-resistant Palmer amaranthacontrol and biomass reduction in the field, 21DAT.Palmer amaranthWeed heightHerbicide treatmentRateControlBiomasscg ai ha-1______%_________% reduction___8 cmatrazine56061cb77bcmesotrione10569bc92atembotrione9291a98atolpyralate4096a98atopramezone1877b96amesotrione + atrazine105 + 56097a100atembotrione + atrazine92 + 56096a100atolpyralate+ atrazine40 + 56098a100atopramezone + atrazine18 + 56097a100a15 cmatrazine56018e47dmesotrione10534d68ctembotrione9259c82btolpyralate4095a98atopramezone1868bc84bmesotrione + atrazine105+ 56065c88abtembotrione + atrazine92 + 56088ab97atolpyralate + atrazine40 + 56098a100atopramezone + atrazine18 + 56070bc94aaThis Palmer amaranth population has been confirmed resistant to glyphosate, ALS-inhibitingherbicides, and atrazine (Chapter 2).bMeans followed by the same letter are not statistically significant at an ⁄ value of 0.05.cBiomass was collected from two 0.25m2quadrats per plot and samples were dried and biomasswas converted to a percent of the non-treated control plots.Table 4.3.Joint activity of the combination of HPPD-inhibiting herbicides and atrazine onatrazine-resistant Palmer amaranthacontrolin the field, 21 DAT.  Data were combined over years.Palmer amaranth controlWeed heightHerbicide treatmentRateExpectedbObservedResponsecg ai ha-1________%________________%________8 cmmesotrione + atrazine105 + 5608597Synergistictembotrione + atrazine92 + 5609596Additivetolpyralate + atrazine40 + 5609798Additivetopramezone + atrazine18 + 5608997Synergistic15 cmmesotrione + atrazine105 + 5603965Synergistictembotrione + atrazine92 + 5605588Synergistictolpyralate + atrazine40 + 5609798Additivetopramezone + atrazine18 + 5606670AdditiveaThis Palmer amaranth population has been confirmed resistant to glyphosate, ALS-inhibiting herbicides, and atrazine (Chapter 2).bExpected control values were calculated using the Gowing (1960) equation.cA synergistic response occurred when the observed control value was statistically greater than then the expected control value at ⁄<0.05.Table 4.4.Equations, R2values, and GR50values calculated from dose response experiments in the greenhouse to compare thedifferential response of four HPPD-inhibiting herbicides on atrazine-resistant Palmer amaranthacontrol, 14 DAT.HerbicideLog-logistic modelR2GR50valuesb_____X dose (g ai ha-1)_____Mesotrioney=89.4/(x/0.23)1.930.910.23X (24.2)aTembotrioney=99.5/(x/0.11)1.470.930.10X (9.2)bTolpyralatey=89.0/(x/0.07)2.230.900.07X (2.7)cTopramezoney=93.7/(x/0.10)1.480.960.11X (2.0)baThis Palmer amaranth population has been confirmed resistant to glyphosate, ALS-inhibiting herbicides, and atrazine (Chapter 2).bGR50values followed by the same letter are not significantly different at ⁄<0.05.Table 4.5.Equations,R2values, and GR50values calculated from dose response experiments in the greenhouse to compare thedifferential response of four HPPD-inhibiting herbicides on atrazine-resistant Palmer amaranthadry weight, 14 DAT.HerbicideLog-logistic modelR2GR50valuesb_____X dose (g ai ha-1)_____Mesotrioney=13.96+(100-13.96)/(x/0.12)-3.550.910.12X (12.6)aTembotrioney=7.32+(100-9.32)/(x/0.03)-1.090.940.03X (2.80)bTolpyralatey=12.88+(100-12.88)/(x/0.05)-2.470.880.05X (1.95)bTopramezoney=12.26+(100-12.26)/(x/0.04)-1.580.880.04X (0.72)baThis Palmer amaranth population has been confirmed resistant to glyphosate, ALS-inhibiting herbicides, and atrazine (Chapter 2).bGR50values followed by the same letter are not significantly different at ⁄<0.05.Table 4.6.Joint activity of mesotrione and atrazine applied in combination for control of atrazine-sensitive (AS) and atrazine-resistanta(AR) Palmer amaranth biotypes in the greenhouse, 14 DAT. Herbicide joint activity was determined by comparing the slopeof the log-transformed dose response of atrazine alone compared with that obtained from atrazine combined with a constant rate ofmesotrione (Flint et al. 1988; Hugie et al. 2008).Herbicide rate (g ai ha-1)Palmer amaranth control (%)PopulationMesotrioneAtrazineExpectedbObservedP valuecEstimatedResponseSensitive (AS)354056910.0001-1.9390Synergistic3514060910.0001-1.7438Synergistic3528070900.0001-1.6063Synergistic3556073960.0001-2.3982Synergistic351,12083970.0001-1.9616Synergistic352,24093980.0010-1.3357SynergisticResistant (AR)3528069860.0323-1.3197Synergistic351,12082960.0165-1.4725Synergistic352,24083970.0013-2.0926Synergistic354,48087970.6223-0.2881Additive358,98090980.1919-0.7731Additive3535,90098980.24240.7002AdditiveaThis Palmer amaranth population has been confirmed resistant to glyphosate, ALS-inhibiting herbicides, and atrazine (Chapter 2).bExpected control values were calculated using theexplained by Colby (1967).cP values<0.05 are indicative ofa significant response.dSignificant negative slope estimates indicate a synergistic response, significant positive slope estimates indicate an antagonisticresponse and non-significant slope estimates equal an additive response.Table 4.7.Joint activity of tembotrione and atrazine applied in combination for control of atrazine-sensitive (AS) and atrazine-resistanta(AR) Palmer amaranth biotypes in the greenhouse, 14 DAT. Herbicide joint activity was determined by comparing the slopeof thelog-transformed dose response of atrazine alone compared with that obtained from atrazine combined with a constant rate ofmesotrione (Flint et al. 1988; Hugie et al. 2008).Herbicide rate (g ai ha-1)Palmer amaranth controlPopulationTembotrioneAtrazineExpectedbObservedP valuecEstimatedResponseSensitive (AS)11.54064750.1331-0.5120Additive11.514064840.0010-1.2308Synergistic11.528073890.0041-1.0319Synergistic11.556075920.0018-1.1488Synergistic11.51,12086940.0272-0.7897Synergistic11.52,24093960.4918-0.2308AdditiveResistant (AR)11.528076880.0699-1.1243Additive11.51,12083950.0241-1.4213Synergistic11.52,24079960.0047-1.8271Synergistic11.54,48089970.2403-0.7160Additive11.58,98085990.0750-1.0875Additive11.535,90097970.16010.8612AdditiveaThis Palmer amaranth population has been confirmed resistant to glyphosate, ALS-inhibiting herbicides, and atrazine (Chapter 2).bExpected control values were calculated using theexplained by Colby (1967).cP values<0.05 are indicative of a significant response.dSignificant negative slope estimates indicate a synergistic response, significant positive slope estimates indicate an antagonisticresponse and non-significant slope estimates equal an additive response.Table 4.8.Joint activity of tolpyralate and atrazine applied in combination for control of atrazine-sensitive (AS) and atrazine-resistanta(AR) Palmer amaranth biotypes in the greenhouse, 14 DAT. Herbicide joint activity was determined by comparing the slopeof the log-transformed dose response of atrazine alone compared with that obtained from atrazine combined with a constant rate ofmesotrione (Flint et al. 1988; Hugie et al. 2008).Herbicide rate (g ai ha-1)Palmer amaranth controlPopulationTolpyralateAtrazineExpectedbObservedP valuecEstimatedResponseSensitive (AS)2.54059580.85720.0512Additive2.514062610.92660.0270Additive2.528071690.70790.1069Additive2.556074690.63120.1390Additive2.51,12086820.5095-0.1912Additive2.52,24093830.37300.2556AdditiveResistant (AR)2.528046560.7707-0.2069Additive2.51,12066690.97520.0214Additive2.52,24063580.59140.3819Additive2.54,48083680.11861.1171Additive2.58,98081800.59190.3762Additive2.535,90095820.00652.1000AntagonisticaThis Palmer amaranth population has been confirmed resistant to glyphosate, ALS-inhibiting herbicides, and atrazine (Chapter 2).bExpected control values were calculated using theexplained by Colby (1967).cP values<0.05 are indicative of a significant response.dSignificant negative slope estimates indicate a synergistic response, significant positive slope estimates indicate an antagonisticresponse and non-significant slope estimates equal an additiveresponse.Table 4.9.Joint activity of topramezone and atrazine applied in combination for control of atrazine-sensitive (AS) and atrazine-resistanta(AR) Palmer amaranth biotypes in the greenhouse, 14 DAT. Herbicide joint activity was determined by comparing the slopeof the log-transformed dose response of atrazine alone compared with that obtained from atrazine combined with a constant rate ofmesotrione (Flint et al. 1988; Hugie et al. 2008).Herbicide rate (g ai ha-1)Palmer amaranth controlBiotypeTopramezoneAtrazineExpectedbObservedP valuecEstimatedResponseSensitive (AS)2.254068590.39170.2658Additive2.2514068700.9884-0.0046Additive2.2528076760.7927-0.0800Additive2.2556079800.3864-0.2688Additive2.251,12087900.1453-0.4573Additive2.252,24094930.88730.0437AdditiveResistant (AR)2.2528069820.3462-0.6768Additive2.251,12085810.7952-0.1826Additive2.252,24080880.3311-0.6891Additive2.254,48089950.9068-0.0812Additive2.258,98090920.5830-0.3816Additive2.2535,90099870.01711.7638AntagonisticaThis Palmer amaranth population has been confirmed resistant to glyphosate, ALS-inhibiting herbicides, and atrazine (Chapter 2).bExpected control values were calculated using theexplained by Colby (1967).cP values<0.05 are indicative of a significant response.dSignificant negative slope estimates indicate a synergistic response, significant positive slope estimates indicate an antagonisticresponse and non-significant slope estimates equal an additive response.LITERATURE CITEDLITERATURECITEDAbendroth JA, Martin AR, Roeth FW (2006) Plant response to combinations ofmesotrione andphotosystem II inhibitors.Weed Technol20:267•274Almsick AV (2009) New HPPD-inhibitors•a proven mode of action as a new hope to solvecurrent weed problems. Outlooks Pest Manag. 20:27•30Armel GR, Hall GJ, Wilson HP, Cullen N (2005)Mesotrione plus atrazine mixtures for controlof Canada thistle (Cirsium arvense).  Weed Sci 53:202•211Armel GR, Rardon PL, McComrick MC, Ferry NM (2007) Differential response of severalcarotenoid biosynthesis inhibitors in mixtures with atrazine.WeedTechnol21.4:947•953Burgos NR, Tranel PJ, Streibig JC, Davis VM, Shaner D, Norseworthy JK, Ritz C (2013)Review: Conformation of resistance to herbicides and evaluation of resistance levels.  WeedSci 61:4•20Colby SR (1967) Calculating synergistic andantagonistic responses of herbicidecombinations.Weeds15:20•22Damalas CA, Eleftherohorinos IG (2001) Dicamba and atrazine antagonism on sulfonylureaherbicidesused for Johnsongrass (Sorghum halepense) control in corn (Zea mays).  WeedTechnol 15:62•67Flint JL, Cornelius PL, Barrett M (1988) Analyzing herbicide interactions: a statistical treatmentof Colby's method.Weed Technol2:304•309Gowing DP (1960) Comments on tests of herbicide mixtures.Weeds8.3:379•391Green JM (1989) Herbicide antagonism at the whole plant level. Weed Technol 3:217•226Grossmann K, Ehrhardt T (2007) On the mechanism of action and selectivity of the cornherbicide topramezone: a new inhibitor of 4hydroxyphenylpyruvate dioxygenase.PestManag Sci63.5:429•439Hart SE,Wax LM (1996) Dicamba antagonizes grass weed control with imazethapyr byreducing foliar absorption. Weed Technol 10:828•834Heap I (2016) The international survey of herbicide resistant weeds.www.weedscience.com.Accessed: February 5, 2016Hess DF (2000) Light-dependent herbicides: an overview.Weed Sci48.2:160•170Horak MJ, Loughin TM (2000) Growth analysis of fourAmaranthus species.WeedSci48.3:347•355Hugie JA, Bollero GA, Tranel PJ (2008) Defining the rate requirements for synergism betweenmesotrione and atrazine in redroot pigweed (Amaranthus retroflexus).Weed Sci56.2:26•-270Jeanmart S, Edmunds AJF, Lamberth C, Pouliot M (2015) Synthetic approaches to the 2010-2014 new agrochemicals. Bioorg Med Chem 24:317-341Jhala AJ, Sandell LD,Rana N, Kruger GR, Knezevic SZ (2014) Confirmation and control oftriazine and 4-hydroxyphenylpyruvate dioxygenase-inhibiting herbicide-resistant Palmeramaranth (Amaranthus palmeri) in Nebraska. Weed Technol 28:28•38Keeley PE, Carter CH, Thullen RJ (1987) Influence of planting date on growth of Palmeramaranth (Amaranthus palmeri).Weed Sci 35:199•204Kohrt JR (2016) Biology and management of multiple-(glyphosate, ALS, and atrazine)-resistantPalmer amaranth in Michigan. Ph.D dissertation. EastLansing, MI: Michigan StateUniversity. 149pKruk J, Holländer-Czytko H, Oettmeier W, Trebst A (2005) Tocopherol as singlet oxygenscavenger in photosystem II.Journal of Plant Phys162.7:749•757Lindquist JL, Mortenson DA, Clay SA, Schmenk R, Kells JJ,Howatt D, Westra P (1996)Stability of corn (Zea mays) velvetleaf (Abutilon theophrasti) interference relationships.Weed Sci 44:309•313Mitchell G, Barlett DW, Fraser TEM, Hawkes TR, Holt DC, Townson JK, Wichert RA (2001)Mesotrione: a new selectiveherbicide for use in maize.Pest Manag Sci57.2:120•128Norsworthy JK, Griffith GM, Scott RC, Smith KL, Oliver LR (2008) Confirmation and controlof glyphosate-resistant Palmer amaranth (Amaranthus palmeri) in Arkansas. Weed Technol22:108•113O›DonovanJT, O›Sullivan (1982) The antagonistic action of 2,4-D and bromoxynil onglyphosate phytotoxicity to barley (Hordeum vulgare).  Weed Sci 30:30•34Pallett KE, Little JP, Sheeky M, Veerasekaran P (1998) The mode of action of isoxaflutole: I.Physiologicaleffects, metabolism, and selectivity.Pesticide Biochemistry andPhys62.2:113•124Pfister K, Steinback KE, Gardner G, Arntzen (1981) Photoaffinity labeling of an herbicidereceptor protein in chloroplast membranes.Proc Natl Acad Sci78.2:981•985SchulzA, Ort O, Beyer P, Kleinig H (1993) SC0051, a 2benzoylcyclohexane1, 3dionebleaching herbicide, is a potent inhibitor of the enzyme phydroxyphenylpyruvatedioxygenase.FEBS Letters318.2:162•166Schuster CL, Al-Khatib K, Dille JA (2007) Mechanismof antagonism of mesotrione onsulfonylurea herbicides. Weed Sci 55:429•434Schuster CL, Al-Khatib K, Dille JA (2008) Efficacy of sulfonylurea herbicide when tank mixedwith mesotrione. Weed Technol 22:222•230Selleck GW, Baird DD (1981) Antagonism withglyphosate and residual herbicide combinations.Weed Sci 29:185•190Stephenson DO IV, Bond JA, Landry RL, Edwards HM (2015) Weed management in corn withpostemergence applications of tembotrione or thiencarbazone:tembotrione.WeedTechnol29.3:350•358Trebst A, Depka B, Holländer-Czytko H (2002) A specific role for tocopherol and of chemicalsinglet oxygen quenchers in the maintenance of photosystem II structure and function inChlamydomonas reinhardtii.FEBS Letters516.1:156•160Williams MM, BoydstonR, Peachey E, Robinson D (2011) Significance of atrazine as a tank-mix partner with tembotrione. Weed Technol 25:299-302Wiggins MS, McClure MA, Hayes RM, Steckel LE (2015) Integrating cover crops and POSTherbicides for glyphosate-resistant Palmer amaranth control in corn. Weed Technol 29:412-418Witschel M (2009) Design synthesis and herbicidal activity of new iron chelating motifs forHPPD-inhibitors. Bioorg Med Chem 17:4221-4229Wood A (2016) Compendium of herbicide common names.http://www.alanwood.net/pesticides/index.  Accessed: September 15, 2016Woodyard AJ, Bollero GA, Riechers DE (2009a) Broadleaf weed management in corn utilizingsynergistic postemergence herbicide combinations. Weed Technol 23:513•518Woodyard AJ, Hugie JA, Riechers DE (2009b) Interactions of mesotrione and atrazine in twoweed species with different mechanisms for atrazine resistance.Weed Sci57.4:369•378CHAPTER 5INFLUENCE OF CROP, CROP ROTATION, AND MANAGEMENT STRATEGY ONPALMER AMARANTH EMERGENCE, GROWTH,REPRODUCTION, ANDDEPLETION OF THE SOIL SEEDBANKAbstractPalmer amaranth, a non-native weed species to Michigan, was first identified in a Michigansoybean field in 2010.  Several factors, including crop rotation, weed management practice, andtime of emergence can influence the growth, reproductive potential, and persistence of Palmeramaranth.  In 2013, a 3-year experiment was initiated to study the emergence, growth andfecundity of Palmer amaranth in Michigan cropping systems.  The crop rotations includedcontinuous corn (C-C-C), corn-soybean-corn (C-S-C), soybean-corn-soybean (S-C-S), and corn-soybean-wheat (C-S-W).  Winter wheat delayed Palmer amaranth emergence until late Julyfollowing harvest.  In two of three years Palmer amaranth emerged over alonger period of timein corn as compared with soybean, and total Palmer amaranth emergence was greater in corn,due to rapid early emergence possibly influenced by nitrogen fertilizer application at V3-V4corn.Palmer amaranth emergence was reduced by 95% in 2015 compared with 2013,suggestinga rapid decline in the soil seedbank over the three year period.The relative growth rate (RGR) ofthe early-emerging cohort was greater during the first 3 wks of growth in corn compared withsoybean.However, forthe mid-and late-emerging cohorts the RGR was greater in soybean thancorn throughout the growing season.  The excessive lateral branching in soybean as opposed tothe primarily vertical growth in corn, allowed Palmer amaranth to accumulate more biomass andproduce more seed for the early-and mid-emergence cohorts.  Palmer amaranth seed productionwas >64,000 seeds plant-1for plants emerging 2 wks after soybean planting; seed productiondeclined to 40 seeds plant-1for the late cohort in corn. Variability in the soil seedbank numbersresulted in few differences in final Palmer amaranth seedbank as compared with the initialseedbank in 2013 in the corn-soybean rotations. Not controlling Palmer amaranth in the wheatphase of the C-S-W rotation increased theseedbank by >100,000 seeds m-3, illustrating thenecessity of implementing Palmer amaranth management practices after wheat harvest.  Thenon-native weed species, Palmer amaranth, has adapted to northern climates, with emergencebeginning at ~281 GDD10inlater May and early June. Palmer amaranth emergence continuedfor ~1216 GDD (through August), and all cohorts produced viable seed.  To reduce 95% ofviable seed production, Palmer amaranth emergence must be delayed approximately 6 weeksafter mid-May corn and soybean planting to allow crop competition to reduce Palmer amaranthgrowth and fecundity.Nomenclature:  Corn,Zea maysL.; Palmer amaranth,Amaranthus palmeriS. Wats.; soybean,Glycine max(L.) Merr.; wheat,Triticum aestivumL.Key words: Emergence; relative growth rate; reproduction; seed production; soil seedbank.IntroductionPalmer amaranth (Amaranthus palmeriS. Wats.) was first identified in Michigan in 2010.   Itis a non-native pigweed species that is detrimental in row crop productionthroughout theSouthern and Great Plains regions of the United States (Jha et al. 2008; Massinga 2001; Sprague2011).  One of the characteristics that makes Palmer amaranth a successful weed species is theinherent ability to germinate rapidly and emerge throughout the growing season (Ehleringer1983).  Palmer amaranth germination tends to occur at higher temperatures compared with otherannual weed species. Of nine weedy species studied, Palmer amaranth had one of the highesttemperature requirements (~17C) for initial germination (Steinmaus et al. 2000).  Palmeramaranth attained complete germination in less than one day, whereas it took several otherAmaranthusspecies 3 to 8 d to reach 50% germination when temperatures were alternated ±40% around 30 C.Time to emergence can also occur more rapidly for Palmer amaranth thanotherAmaranthusspp.  In Missouri, initial Palmer amaranth and common waterhemp emergenceoccurred within 5 and 17 d of seeding, respectively (Sellers et al. 2003).In non-crop situations,Palmer amaranth emergence occurred from March through October in California and from mid-May through September in Michigan(Keeley et al. 1987; Powell 2014).  Rapid and continuedemergence of Palmer amaranth may require the use of residualherbicides to manage this weedthroughout the growing season.  Crop rotation and other cultural practices may also reducePalmer amaranth emergence.  Jha and Norsworthy (2009) reported a 70% or greater reduction inPalmer amaranth emergence when grown in the presence of a soybean canopy, likely due to thelight requirement and phytochrome-mediated responses associated with Palmer amaranthgermination.  In research by Jha et al. (2010), far-red light in the soybean canopy inhibitedPalmer amaranth germination.  The influence of maize (Zea maysL.), cotton(GossypiumhirsutumL.)and other crop canopies on Palmer amaranth emergence has not been reported in theliterature.Other characteristics that contribute to the competitiveness of Palmer amaranth includearapid growth rate, rapid biomass accumulation, and abundant seed production.  Palmer amaranthgrew faster and accumulated more biomass than otherAmaranthusspp., including redrootpigweed (Amaranthus retroflexusL.), common waterhemp (Amaranthus rudisSauer), andtumble pigweed (Amaranthus albusL.) in Kansas research (Horak and Loughin 2000).  Palmeramaranth was 45 and 600% taller than common waterhemp and redroot pigweed, respectively, inMissouri (Sellers et al. 2003).Climate and time of establishment influence Palmer amaranth seed production.  Palmeramaranth produced 250,000, 446,000, 613,000 seeds plant-1in Missouri, Georgia, and California,respectively, in early-emerging cohorts when there was no inter-or intra-specific competition(Keeley etal. 1987; Sellers et al. 2003; Webster and Grey 2015).  Seed production was reducedby 90% when plants established in August compared with May in California (Keeley et al.1987).  In Georgia, Palmer amaranth seed production was reduced 50% when establishment wasdelayed by 6 wk compared with the initial cohort planting (Webster and Grey 2015), and inKansas, seed production from 8 plants m-2was reduced from 514,000 to 91,000 seeds m-2whenemergence was delayed until the 7-leaf stage in corn (Massinga et al. 2001). Seed production inSouth Carolina was reduced 97% when Palmer amaranth emerged between V3 and V6 soybeancompared with plants that emerged from soybean planting to the V3 stage (Jha et al. 2008a).Little information is available on Palmer amaranth emergence timing, growth and fecundity innorthern climates.Management of Palmer amaranth and other weeds should include cultural practices and notbe limited to herbicides alone (Norsworthy et al. 2012).  Cultural practices such as crop rotationand tillage, or ecosystem processes including seed predation and seed decay may reduce thepersistence of Palmer amaranth seedbanks (Ball and Miller 1990; Bellinder et al. 2003; Buhler etal. 2001; Cardina et al. 2002; Davis et al. 2005; Sonoskie et al. 2013).Crop rotation changesmanagement practices, which in turn changes the niche for weed species emergence andcompetition with the crop (Ball and Miller 1990; Buhler et al. 2001; Cardina et al. 2002; Davis etal. 2005; Bellinder et al. 2003).  The pairing ofa herbicide program along with tillage can reducesoil seedbank densities (Ball and Miller 1990, Bellinder et al. 2003, Davis et al. 2005), andusually more diverse crop rotations reduce the size of the seedbank compared with monocultures(Buhler et al. 1997).  Tillage practices and the herbicides used in corn may be a reason forrelatively low increases in the weed seedbank compared with rotations that include rye, hay andlegume crops (Bellinder et al. 2003).  In monoculture cropping systems, a few welladaptedspecies will dominate the seedbank, whereas management strategies and predation associatedwith diverse cropping systems can increase weed diversity and reduce the seedbank (Buhler et al.1997; Cardina et al. 2002).  Sosnoskie et al. (2013) reported that Palmer amaranth burial depthaffected seed viability in Georgia; 9 and 22% of Palmer amaranth seed remained viable after 3years at 1 and 40 cm burial depths, respectively.  In Michigan, there was no influence of burialdepth on seed viability afterone year (Powell 2014).  Powell concluded that the Palmer amaranthseedbank could be reduced from 50 to 90% in one year if no further seed was produced.  Thissuggests that a significant reduction in the Palmer amaranth seedbank can occur in a short timeperiod if management practices are utilized that stop Palmer amaranth seed production.The objectives of our research were to determine the duration of emergence, the relativegrowth rate, and the reproductive development of Palmer amaranth in Michigan.In addition tothe biological characteristics of Palmer amaranth, the use of crop rotation paired with weedmanagement strategy was investigated as a strategy for depleting the Palmer amaranth seedbank.Materials and MethodsA three-year field study was initiated in 2013 in a commercial no-till production field with aknown herbicide (glyphosate, ALS, and atrazine)-resistant Palmer amaranth population in BarryCounty, MI (42.702467°N;-85.524992°W).  The soil type at this location was a combination ofOshtemo sandy loam and a Boyer loamy sand composed of 73.0, 15, and 12% sand, silt, clay,respectively, with a pH of 6.7 and 2.2% organic matter.  Four crop rotations were established fora three-year period.  The rotations were: three years of continuous corn(C-C-C), corn-soybean-corn (C-S-C), soybean-corn-soybean (S-C-S), and corn-soybean-wheat (C-S-W) with each croprotation replicated four times.  Plot size was 6 m wide by 12 m long, and each plot was dividedinto three sub-plots.  Subplot treatments consisted of: 1) weed-free (WF), 2) best managementpractice (BMP), and 3) weedy (W) control plots.  The BMP and WF subplots were 3 m wide by7.5 m long and the W plots were 6 m wide by 4.5 m long.  The duration of Palmer amaranthemergence and the influence ofcrop rotation on the soil seedbank were evaluated in the BMPand WF plots.  Palmer amaranth growth and development were evaluated in the W plots.Planting information can be found in Table 5.1.  Urea (46-0-0) was broadcast surface-applied at90 kg ha-1in early spring to wheat (Feekes 3), and at 168 kg ha-1to corn at the V3-V4 growthstage.  Temperature and precipitation data were monitored throughout the growing season at anearby long-term weather station that is part of the Michigan State University weathermonitoring system (MSU Enviroweather 2016).BMP and WF Treatments.The BMP treatments for corn and soybean consisted ofpreemergence (PRE) followed by (fb) postemergence (POST) herbicide applications.  PREherbicide applications were made immediately after planting and POST herbicides were appliedwhen Palmer amaranth was10 cm tall.  The BMP for wheat was a POST herbicide application inearly spring when wheat was at Feekes stage 4.  Herbicide products and applications rates for theBMP treatments are listed in Table 5.2.  The WF plots were kept weed-free with applications ofglufosinate (Liberty 280SL, Bayer CropScience LP, Research Triangle Park, NC) and/or hand-weeding in the corn and soybean years of the rotation and by hand-weeding in wheat.Herbicidetreatments were applied using a CO2-pressurized backpack sprayer calibrated to deliver 187 Lha-1at a pressure of 207 kPa through 11003 AIXR flat-fan nozzles (TeeJet, Spraying SystemsCo., Wheaton, IL 60187).Palmer amaranth Emergence.Two 0.25 m2permanent quadrats plot-1were established at thebeginning of each season in the WF and BMP subplots.  Each week throughout the growingseason newly emerged Palmer amaranth plants were counted and removed.  Total emergencewas calculated and fit to a logistic curve.  Time was converted to growing degree days (GDD)each year starting January 1,using a base temperature of 10 C.Cumulative weekly emergencewas regressed against growing degree days (GDD) using the Gompertz equation (Equation 1;Forcella et al. 2000).[Eq. 1]WhereYis the cumulative emergence,Bis the GDD prior to emergence,Kis the rate ofemergence, andXis GDD accumulation.  Differences in emergence between crops and yearswere determined using the extra sum-of-squares principle for non-linear regression analysis(Linquist et al. 1996).  In order to measure Palmer amaranth cumulative and total emergence inthe absence of herbicides, measurements were taken in the WF plots.  The BMP plots were usedto determine how management practices influenced Palmer amaranth emergence in corn andsoybean.Palmer amaranth Growth, Development, and Seed Production.In the W plots, 10 plantsplot-1for three different Palmer amaranth cohorts (early, mid, and late) were flagged at 2-wkintervalsbeginning at 200-300 GDD.  Additional Palmer amaranth plants were removed fromaround the marked plants to reduce intra-specific competition.  Palmer amaranth height wasmeasured weekly (2014 and 2015) or biweekly (2013).  The relative growth rate (RGR) for eachcohort in each crop was calculated using the height data (Equation 2).[Eq. 2]H2represents plant height at time 2,H1is plant height at time 1,T2is the GDD for the endingheight measurement, andT1is the GDD for the initial height measurement.Palmer amaranth development was also assessed weekly in 2014 and 2015, and biweekly in2013.  Plant stages recorded were: first sight of male and female flowering structures, pollination(onset of anthers formale plants), flowering (onset of pistils for female plants), and stages ofseed maturity.  Seed maturity was assessed by taking small subsamples of the seed head andevaluating for the presence of brown immature seed or black mature seed.  At plant maturity,aboveground biomass was harvested, dried at 60 C for approximately 1 wk, and then weighed.Male plants were deemed mature when pollination ceased and female plants were harvested 3-wks after the onset of black seed.  Plants that never matured were harvested just prior to cropdestruction.  Seed heads from the female plants were hand threshed and seed was separated fromthe chaff by sieving through a 500 µ screen and air-column separator (Seedburo Equipment Co.,Des Plains, IL).  Total seed number wasdetermined by dividing the total clean sample weight bythe 100 seed weight for three subsamples and then multiplying by 100 (Equation 3).[Eq. 3]Data for RGR, Palmer amaranth height, time to reproductive stages, end-of-season biomass,and seed production were analyzedusing SAS 9.4 (SAS Institute, Cary, NC).  Assumptions ofnormality of residuals and homogeneity of variances were confirmed using PROCUNIVARIATE and analysis of variance (ANOVA) was conducted using PROC MIXED.Palmer amaranth biomass and seed production data were square-root and log-transformed,respectively, as suggested by Box-Cox analysis (Box and Cox 1964) using PROC TRANSREG.The statistical model included the main effects of crop, cohort, and their interactions as fixedeffects.  Years and replication were considered random effects in the model.  Mean separationfor the main effects of crop and cohort, and their interaction wasconducted with multiplet-testsand were found to be statistically significant at ⁄ level of 0.05.Palmer amaranth Soil Seedbank.At the establishment of the experiment in the spring of 2013,three soil cores (10.4 cm diameter by 15 cm depth) were taken in the BMP and WF subplots.These plots were sampled again at the conclusion of the experiment in the fall of 2015.  Soilsampleswere stored in the freezer at-20 C until sample processing.  Palmer amaranth seed wasseparated into different soil fractions by wet sieving samples through a 2,000 and 500 µ screens.Samples were then air dried and Palmer amaranth seed was extracted from the remaining soilusing a method previously described by Malone (1967).  This procedure uses a solution of 10 gsodium hexametaphosphate, 5 g sodium bicarbonate, and 25 g magnesium sulfate in 200 mL ofwater.  Each sample was agitated for 2 min in the solution, decanted through a 500 µ sieve, andrinsed.  This process was repeated 3 times or until all the seed had been removed.  Samples wereair dried, and seed was enumerated by hand counting seed in 0.5 g of the total sample andextrapolating the totalseed number (Equation 4).[Eq. 4]All data for the 2013 seedbank was pooled over management practice to establish a base orinitial Palmer amaranth seedbank and compared with 2015.  Soil seedbank data were analyzedfor differences between the different crop rotations within the BMP and WFmanagementpractices with ANOVA using PROC MIXED in SAS 9.4.  Each management practice wasanalyzed separately with rotation as a fixed effect and replication as random.  Mean separationfor the influence of crop rotation on the Palmer amaranth soil seedbank was conducted withmultiple t-tests at ⁄ level 0.05.  To show the variability of Palmer amaranth within the soilseedbank data are presented in box-plots as seeds m-3.Results and DiscussionPalmer amaranth Emergence.Corn and Soybean.Initial emergence of Palmer amaranth incorn and soybean was similar for all three years, occurring on May 24 (260 GDD), May 28 (260GDD), and June 8 (323 GDD) in 2013, 2014, and 2015, respectively.  Similar results for Palmeramaranth initial emergence in Michigan were reported by Powell (2014).  Emergence did notoccur until the minimum soil temperature was >17 C, similar to the temperature requirementsreported by Stienmaus et al. (2000) for Palmer amaranth germination.  Ideal corn planting datesin central Michigan are the first two weeks in May; ideal soybean planting dates are May 8through May 20, suggesting that Palmer amaranth would begin emerging within the first threeand two weeks following corn and soybean emergence, respectively.The duration of Palmer amaranth emergence in corn and soybean were measured in the WFsub-plots.  In 2013, a significant rainfall event caused flooding forcing the experiment to berelocated, shortly after initial Palmer amaranth emergence.  Corn and soybean were replantedJune 6.  Warm temperatures coupled with high soil moisture caused high numbers of Palmeramaranth plants to emerge prior to reestablishment of the experiment.  This initial emergence,accounted for 40 and 85% of the total Palmer amaranth emergence for corn and soybean,respectively, in 2013 (Figure 5.1a).  The duration of Palmer amaranth emergence in 2013 wasgreater in corn compared with soybean; 95% of total emergence had occurred by July 24 (829GDD) 24 d (223 GDD) after soybean (Table 5.3).  In 2014, there was no difference in theduration of Palmer amaranth emergence in corn compared with soybean (Figure 5.1b).  Theduration of Palmer amaranth emergence from 10 to 95% was 863 GDD (87 d) and 768 GDD (77d) for corn and soybean, respectively, with 95% emergenceoccurring by Aug. 26 (Table 5.3).Similar to 2013, the duration of Palmer amaranth emergence was greater in corn compared withsoybean in 2015 (Figure 5.1c).  Palmer amaranth continued to emerge for an additional 181GDD (17 d) longer in corn compared with soybean, lasting until July 27 (Table 5.3).  Palmeramaranth emergence ceased on Sept. 18, Sept. 9, and Sept. 23 in 2013, 2014, and 2015,respectively.In two of three years, the duration of and the total emergence of Palmer amaranth wasinfluenced bycrop.  Total emergence was greater in corn compared with soybean (Figures 5.2a-c) in 2013, 2014, and 2015, and more Palmer amaranth emerged in corn early in the season (400•800 GDD).  Nitrogen fertilizer was broadcast applied as urea (46-0-0) in corn atthe V3 growthstage, possibly influencing Palmer amaranth emergence.  Sweeney et al. (2008) reported anincrease in common lambsquarters (Chenopodium albumL.) emergence in the presence ofnitrogen, however redroot pigweed emergence was not influenced.  Cumulative Palmer amaranthemergence in soybean plateaued prior to complete canopy closure, suggesting that another cropmanagement factor, possibly shading Pfr, may influence emergence patterns in crop.  In researchby Jha et al. (2010) reduced Pfr below the soybean canopy reduced Palmer amaranth emergencecompared with the absence of crop. In 2014, lower amounts and less frequent rainfall eventswithin two weeks after planting may have reduced overall soybean growth leaving a more opensoybean canopy and more Pfr for continued Palmer amaranth emergence similar to what wasobserved in corn.A sharp decline in total Palmer amaranth emergence occurred over the three years of thisexperiment, regardless of the crop or rotation (Figure 5.2a-c).  There was >95% reduction inPalmer amaranth emergence when the 2013 and 2015 emergence data were compared.  Thissuggests a relatively non-persistent seedbank for Palmer amaranth in Michigan, and supportsprevious seed viability results reported by Powell (2014).  Palmer amaranth emergence was alsoinfluenced by weed management practice.  The mean for total emergence of Palmer amaranthpooled over crop rotation was 137 and 36 plants in0.5 m-2for the WF and BMP managementpractices, respectively (P = 0.0286), suggesting that herbicides with residuals in the BMPmanagement strategy reduced Palmer amaranth emergence by up to 74%.  The influence of croprotation on Palmer amaranth emergence was evaluated in the WF and the BMP managementstrategy in the C-C-C and C-S-C rotations.  These two rotations were chosen because they bothstarted and ended with corn in the rotation.  Palmer amaranth emergence in the WF plots in 2015was similar in the C-C-C and C-S-C rotations, averaging 5 and 11 plants 0.5 m-2, respectively.However, in the BMP treatment, Palmer amaranth emergence declined more in the C-C-Ccompared with the C-S-C rotation, averaging 0.75 and 18.5 plants 0.5 m-2, respectively (P =0.0452). This suggests that planting continuous corn is the best strategy for Palmer amaranthmanagement if residual herbicides are applied.Wheat.Winter wheat was only present in the last year of the experiment. Wheat was planted inthe fall of 2014 and was 45 cm tall and at Feekes stage 7 by the end of May when Palmeramaranth typically emerged in corn and soybean.  Wheat was very effective in delaying theemergence of Palmer amaranth; little to no emergence occurred until wheat senescence andharvest in late July (Figure 5.1c).  Ten percent of the total cumulative emergence occurred onAugust 16 (1089 GDD), 3 weeks after wheat harvest (Table 5.3); emergence of Palmer amaranthcontinued until the end of September.  This data suggests that wheat can suppress Palmeramaranth emergence until harvest, however, fall management practices must be implemented tocontrol Palmer amaranth emergence in August and September and to stop seed production.Palmer amaranth Relative Growth Rate, Height, and Reproductive Development.Cornand Soybean.The emergence cohort influenced Palmer amaranth RGR and final height.  RGRwas greater initially (the first three weeks) for the early-emerging cohort in corn compared withsoybean (Table 5.4), likely due to the application of nitrogen fertilizer to V3-V4 corn.  Theopposite trend in RGR was observedfor the mid-emerging cohort (Figure 5.3 and Table 5.4);RGR was two times greater in soybean compared with corn (Table 5.4).  The mid cohort grewabove the soybean canopy prior to closure; the mid cohort could not effectively compete for lightin the corncanopy. Furthermore, the N application in corn may have had less influence on RGRin the mid cohort because light resources were reducing Palmer amaranth nutritional demands.The early cohort (emergence 2 wks after corn and soybean planting) grew to ~180cm in bothcorn and soybean (Table 5.5).  Palmer amaranth was much shorter in the later-emerging cohortsin both crops (Figure 5.3). The average final height for the late-emerging (~6 wks after planting)Palmer amaranth cohort was 18 cm(Table 5.5).Palmer amaranth reached the reproductive stage more rapidly in soybean (441 GDD, 42 d)compared with corn (506 GDD, 49 d), when combined over years and cohorts (Table 5.6).  Insoybean the early-and mid-emerging cohorts were able to grow above the canopy, while allcohorts in corn were unable to grow above the corn canopy. In previous research, Palmeramaranth, common waterhemp, and redroot pigweed life history stages were delayed whenplants were grown in shade (Jha et al. 2008b; McLachlan et al. 2003; Steckel et al. 2003).Resources were allocated to the main stem rather than to lateral branches or reproductivestructures, suggesting that the corn canopy may delay Palmer amaranth reproductivedevelopment. Alternatively, a delay in the reproductive developmentof Palmer amaranth in cornmay have been caused by additional nitrogen from fertilization in corn that may have prolongedPalmer amaranth›s vegetative growth.  Furthermore, Palmer amaranth development from floralinitiation to the presence of mature seeddid not differ between corn and soybeans (Table 5.6).The time of cohort emergence also influenced the development of Palmer amaranth whendata were pooled over crop and year.  Initiation of reproductive structures occurred more rapidly(406 GDD 38 d) with the early emerging cohort compared with the mid and late emergingcohorts (Table 5.7).  This change from the vegetative to reproductive stages for the early cohort,aligns with the decrease in day length that has been speculated to trigger reproductivestages inPalmer amaranth and otherAmaranthus spp.(Keeley et al. 1987; Huang et al. 2000; Norsworthyet al. 2016).  The delay in the transition to the reproductive stage in the mid and late cohorts maybe due to the slowed growth rate of Palmer amaranthunder the crop canopy.  Contrary to thosethat emerge early, the development of reproductive structures for Palmer amaranth that emergedlater in the season may be dependent on the quantity and quality of light, rather than day length.Little informationis available on the reproductive phenology of Palmer amaranth at differentemergence times.  Generally, once the reproductive structures have developed, fewer GDD›s arerequired for the later emerging Palmer amaranth to reach the reproductive growth stages and theonset of mature black seed (Table 5.7).  The more rapid development in the later-emergingcohorts could be attributed to the greater reproductive effort required for the early cohorts due toplant size and total number of inflorescences on the lateral branches.  Reproductive efforts inredroot pigweed increased with plant height and lateral branching (Wang et al. 2006).  The totaltime from flagging to mature seed production was 750 (72 d), 795 (81 d), 709 GDD (80 d) forthe early, mid, and late cohorts, combined over crop and year (Table 5.7), which isapproximately 10 to 11 weeks from emergence until mature seed production.  Mature seed fromPalmer amaranth emerging in June and July will be produced in late August through Septemberin Michigan.In California, viable Palmer amaranth seed was produced 8 to 12 and 5 to 7 wksafter emergence for early-and late-emergence timings, respectively, in the absence of cropcompetition (Keeley et al. 1987).  The longer length of time for seed production in our researchmay be attributed to the cooler temperatures of Michigan compared with California (longer timefor GDD to accumulate), coupled with crops competing for resources in our research.Wheat.With only one year of wheat data and little to no emergence of Palmer amaranth duringthe time of cohort flagging, results for wheat were viewed as anecdotal and will be discussedseparately from corn and soybean.  In wheat, Palmer amaranth plants were marked with flags 2wks (August 6) and 5 wks (August 27)after wheat harvest (WAH), 5 to 7 wks after the lastcohort was flagged in corn and soybeans.  Palmer amaranth RGR was similar between the twocohorts (data not shown); mean height for the 2 and 5 WAH cohorts was 67 and 16 cm plant-1,respectively.Palmer amaranth Dry Weight and Seed Production.Corn and Soybean.The time of Palmeramaranth emergence and the presence of a crop influenced final dry weight and seed production.Palmer amaranth dry weight decreased with each successive cohort (Table 5.4),and dry weightwas 6 to 8 times greater in soybean compared with corn for the early and mid cohorts,respectively (Table 5.4).  Palmer amaranth had excessive lateral branching in soybean, whereasgrowth was mainly vertical with little branching in corn.Similar trends in common waterhempdry weight production in corn and soybean were previously reported (Uscanga-Mortera et al.2007).  Decreases in Palmer amaranth dry weight with later emergence times have also beenpreviously reported in the absence of acrop (Keeley et al. 1987; Horak and Loughin 2000;Sellers et al. 2003).The early and late cohorts of Palmer amaranth produced >64,000 and 40 seeds plant-1,respectively (Table 5.4).  In both corn and soybean, Palmer amaranth seed production wasreducedby as much as 99% in the late compared with the early cohorts (Table 5.4).  Previousresearch has shown that the presence of a crop and the time of emergence influence seedproduction.  Palmer amaranth that was established at the time of cotton planting produced 30%less seed compared with plants grown in the absence of cotton (Webster and Grey 2015), anddelaying Palmer amaranth emergence reduced seed production in corn (Massinga et al. 2001)and soybean (Jha et al. 2008).Palmer amaranth seed productionwas 6 and 14 times greater for the early and mid cohortsrespectively, in soybean compared with corn, due to the increased lateral branching andinflorescences in the early-emerging cohort (Table 5.4).  Taller plants and increased branching inthe mid cohort allowed for greater seed production in soybean compared with corn.  Similartrends were observed in the seed production of common waterhemp with different emergencetimes in corn and soybean (Uscanga-Mortera et al. 2007).   Palmer amaranth seed production incorn and soybean has previously been reported to be as high as 514,000 and 211,400 seeds m-2,respectively (Jha et al. 2008; Massinga et al. 2001).  However, when the Palmer amaranthdensity was reduced to 0.5 plants m-1, seed production in corn wasreported as 140,000 seeds m-2(Massinga et al. 2001).  The greatest mean seed production of Palmer amaranth in ourexperiment was 64,257 seeds plant-1for early-emerging Palmer amaranth in Michigan soybean(Table 5.4).  This is much lower than what was previously reported from other areas, howeverindividual plants in this experiment produced >350,000 seeds plant-1, indicating the potential forsevere infestations of Palmer amaranth the following year if the weed is allowed to emerge inlater May and growto maturity.Wheat.In wheat, Palmer amaranth dry weight was 22 and 2 g plant-1for plants emerging at 2and 5 WAH, respectively.  The 2 and 5 WAH cohorts produced >20,000 and 27 viable seedsplant-1, respectively.  While these observations are derivedfrom only 1-year of data, they suggestthe need for Palmer amaranth control strategies following wheat harvest to prevent seedproduction.Soil Seedbank Reduction.The soil seedbank for Palmer amaranth at this location was highlyvariable, which led tothe inability to detect differences in the seedbank in the rotations wherewheat was not included (Figures 5.4 and 5.5).  The soil seedbank in 2013 ranged from 13,000 to300,000 Palmer amaranth seeds m-3.  Previous research has documented that accurate soilseedbank determination can be highly variable depending on sampling method (Gross 1990).However, variability in seed distribution at our research location may have also been caused bythe manure application that introduced Palmer amaranth in this fieldcreating greater densities ofPalmer amaranth seeds in some areas within the field.  At the conclusion of the 3-year croprotations the Palmer amaranth soil seedbank ranged from 0 to >690,000 and 0 to >130,000 seedsm-3for the BMP and WF plots, respectively (Figures 5.4 and 5.5).  Palmer amaranth was notallowed to disperse seed in the WF treatment, and it was expected that the seedbank would havedeclined over the three-year period in this treatment.There was an increase of Palmer amaranth in the soilseedbank with the BMP managementpractice in the C-S-W rotation (Figure 5.4).  The soil seedbank increased 3X from 43,726 in2013 to 145,734 seeds m-3following the 3-year rotation of C-S-W.  Palmer amaranth producedseed following wheat harvest.  The seed bank was sampled in late October 2015 and Augustemerging Palmer amaranth had produced seed following wheat harvest.In conclusion, Palmer amaranth is well-adapted to the cooler climate and crop rotations inMichigan.  Palmer amaranth produced viable seeds in corn, soybean, and following wheat whennot managed. Palmer amaranth emerged in late May (281 GDD) and emergence continuedthroughout the growing season.  Winter wheat can effectively delay emergence until cropsenescence, however management practices such as tillage, frost-seeded clover, or herbicideapplications in wheat stubble need to be implemented to maintain any benefit from integratingwheat into the rotation.  Palmer amaranth can successfully produce seed, regardless ofemergence time in corn and soybean; however, total seed number was reduced with eachsuccessive emergence cohort.  Both RGR and seed production were greater for the mid cohort insoybean compared with corn.  Therefore, it is important to monitor and employ timely controlmeasures for the mid-cohort emerging Palmer amaranth in soybean.Soybean in our research was planted at a 76 cm row spacing; previous research has shown a35% reduction in Palmer amaranth seed production when grown in narrow rows compared withwide rows (Jha etal. 2008).  Decreasing the soybean row spacing from 76 cm may help managePalmer amaranth in Michigan.  The early cohort in corn was very competitive and had a fasterRGR and delayed time to reproductive stage compared with soybean. Broadcast nitrogenfertilizer at V3 in corn, just prior to the first cohort emergence, may increase the emergence andcompetitiveness of Palmer amaranth in corn.Crop rotation and management practice did not have a significant influence on the Palmeramaranth seedbank, exceptfor in the C-S-W rotation.  Several other studies have reported thatcrop rotation can influence the composition of the soil seedbank of various weed species (Ball1992; Buhler et al 2001; Cardina et al. 2002).  To reduce the chances of cross-plot contaminationthis research was conducted in no-till.  Previous research has shown that in no-till productionsystems 90% of the seedbank will be within the top 5 cm (Swanton et al. 1999).  The variabilityin the soil seedbank distribution paired with the methodology used for enumeration may havecontributed to our inability to detect changes in the seedbank. Regardless, Palmer amaranthemergence in this no-till production system declined over the three-year period in all of the croprotations by >95%.  Therefore,not allowing Palmer amaranth to produce seed could result in upto 278 fewer plants 0.5 m-2emerging after a three-year period in rotations that include corn.APPENDIXAPPENDIXCHAPTER 5 TABLES ANDFIGURESTable 5.1.Planting information for the long-term crop rotation study in Barry County, MI.201320142015CornaPlanting dateJune 6May 28May 18HybridbDKC 48-12P 9807 AMP 9807 AMPopulation79,000 seeds ha-179,000 seeds ha-179,000 seeds ha-1SoybeanaPlanting dateJune 6May 28May 18VarietybDF 9251 LLMCIA2365 LLMCIA2512 LLPopulation420,000 seeds ha-1420,000 seeds ha-1420,000 seeds ha-1WheataPlanting dateOctober 17VarietybSunburstPopulation5.2 million seeds ha-1aCorn and soybean were planted in 76 cm row widths and wheat was planted in 19 cm rows.bCompany information: DKC 48-12; Dekalb, Monsanto Company, St. Louis, MO; P 9807 AM,DuPont Pioneer, Johnston, IA; DF 9251 LL, D.F. Seeds, Inc., Dansville, MI; MCIA2365LL,MCIA2512LL, and Sunburst, Michigan Crop Improvement Assoc., Lansing, MI;Table 5.2.Best management practice (BMP) herbicide programs for multiple-resistant Palmer amaranth control used in corn,soybean, and wheat in Barry County, MI.CropTimingbTreatmentRate (kg ai ha-1)Trade nameaCornPREs-metolachor + atrazine1.4 +1.79Bicep II MagnumPOSTmesotrione + atrazine + COC + AMS0.11 + 0.67 + 1% v v-1+ 1% w w-1Callisto XtraSoybeanPREflumioxazin0.07Valor SXPOSTglufosinate +s-metolachlor + AMS0.6 + 1.42 + 1% w w-1Liberty + Dual II MagnumWheatPOST2,4-Damine + pyrosulfotole +bromoxynil + NIS + AMS0.56 + 0.04 + 0.12 + 0.25% v v-1+1% w w-12,4-D Amine + HuskieaManufacturer information:  Bicep II Magnum, Syngenta Crop Protection, LLC, Greensboro, NC; Callisto Xtra, Syngenta CropProtection, LLC, Greensboro, NC; COC, crop oil concentrate, Herbimax, Loveland Products, Inc., Loveland, CO;  AMS, ammoniumsulfate, Actamaster, Loveland Products, Inc., Loveland, CO; Valor SX, Valent Corporation,  Walnut Creek, CA; Liberty 280SL,Bayer CropScience LP, Research Triangle Park, NC; Dual II Magnum, Syngenta Crop Protection, LLC, Greensboro, NC; 2,4-DAmine 4, Winfield Solutions, LLC, St. Paul, MN; Huskie, Bayer CropScience, Research Triangle Park, NC; NIS, non-ionic surfactant,Activator 90, Loveland Products, Inc., Loveland, CO.bAbbreviations:  PRE, preemergence; POST, postemergence.Table 5.3.Gompertzaequation parameters and growing degree days (GDD) for cumulativeemergence of Palmer amaranth in corn, soybean, and wheat for 2013, 2014, and 2015 in BarryCounty, MI.ParametersGDDbto X% emergenceYearCropBKR210%50%95%2013Corn3.90.0050.65332829Soybean0.250.0030.306062014Corn9.00.0040.753135921176Soybean13.80.0050.7436360611312015Corn39.50.0080.72370533862Soybean227.70.010.94361454672Wheat146,2390.010.93108912201482aGompertz equation for cumulative emergence:, whereYis cumulative emergence,Bis growing degree day (GDD) lag time,Kis rate of emergence, andXis GDD accumulation.Table 5.4.Total relative growth ratea(RGR) and the RGR for the first 3 and 5 wks after flaggingPalmer amaranth for early, mid, and late emergence cohorts in corn and soybeanin BarryCounty, MI.  Data are combined over 2013, 2014, and 2015.Palmer amaranth growth periodCropCohortFirst 3 wksFirst 5 wksTotal___________________RGR cm cm-1wk-1 ___________________CornEarly1.13ab0.81a0.52aMid0.42d0.33c0.24dLate0.24e0.18d0.20eSoybeanEarly1.03b0.81a0.53aMid0.80c0.62b0.42bLate0.43d0.30c0.23caRelative growth rate for plant height was calculated as (ln Height2•ln Height1) / (Time2-Time1).bMeans followed by the same letter within a column are not statistically different at ⁄ = 0.05.Table 5.5.Palmer amaranth height, dry weight, and seed production for early, mid, and latecohorts in corn and soybean in Barry County, MI.  Data are combined over 2013, 2014, and2015.CropCohortFinal heightDry weightaSeed productionbcm plant-1g plant-1number plant-1CornEarly176ac28b10,849bMid34c1d350cLate12d0.1e40cSoybeanEarly182a178a64,257aMid95b8c4,862bLate23cd0.2e458caMeans for the dry weight data are the back-transformed values from log-transformed data.bMeans for Palmer amaranth seed production are the back-transformed values from square-roottransformed data.cMeans followed by the same letter within a column are not statistically different at ⁄ = 0.05.Table 5.6.Growing degree daysa(GDD) and days required for the reproductive development of Palmer amaranth in corn andsoybean. Data are combined over years and pooled over cohort emergence time.GDD toGDD from reproduction toGDD from flagging toCropReproductionPollenFlowerImmature seedMature seedMature seed_____________________________________________________GDD (days)b _____________________________________________________Corn506 (49)ac141 (15)a84 (10)a216 (23)a277 (32)a783 (81)aSoybean441 (42)b129 (14)a93 (10)a213 (23)a280 (32)a721 (74)baGrowing degree days were calculated using a base temperature of 10 C from the time of flagging for each emergence cohort as GDD= (((Tempmax+ Tempmin)/2)•base temp).bValues within the parentheses represent the number of days required to accumulate the number of GDD›s; all mean separations weredone with the GDD values.cMeans followed by the same letter within a column are not statistically different at⁄ = 0.05.Table 5.7.Growing degree daysa(GDD) and days required for the reproductive development of early, mid, and late Palmer amaranthemergence cohorts. Data are combined over years and pooled over corn and soybean crop.GDD toGDD fromreproduction toGDD from flagging toCohortReproductionPollenFlowerImmature seedMature seedMature seed_____________________________________________________GDD (days)b _____________________________________________________Early406 (38)bc157 (16)a103 (10)a284 (27)a344 (34)a750 (72)aMid513 (51)a147 (15)a90 (10)ab209 (23)b282 (30)b795 (81)aLate500 (49)a102 (12)b72 (10)b151 (20)c209 (31)c709 (80)aaGrowing degree days were calculated using a base temperature of 10 C from the time of flagging for each emergence cohort as GDD= (((Tempmax+ Tempmin)/2)•base temp).bValues within the parentheses represent the number of days required to accumulate the number of GDD›s; all mean separations weredone with the GDD values.cMeans followed by the same letter within a column are not statistically different at ⁄ = 0.05.Figure 5.1a-c.  CumulativePalmer amaranth emergence as a percent of total emergence in corn(ðu), soybean (‡), and wheat (…) in 2013 (a), 2014 (b), and 2015 (c) and bars represent standarderror of emergence.Regression parameters are listed in Table 5.3.Cumulative emergence (% of total)20406080100Cumulative emergence (% of total)20406080100GDD (base 10 C, starting Jan. 1)2004006008001000120014001600Cumulative emergence (% of total)0204060801002013 (a)2014 (b)2015 (c)Figure 5.2a-c.  Total Palmer amaranth emergence in corn (ðu), soybean (‡), and wheat (…) in2013 (a), 2014 (b), and 2015 (c).Total emergence (0.5 m2)050100150200250300Total emergence (0.5 m2)05101520253035GDD (base 10 C, starting Jan. 1)2004006008001000120014001600Total emergence (0.5 m2)0246810122013 (a)2014 (b)2015 (c)Weeks after flagging0246810Height (cm)020406080100120140160180200Figure 5.3. Cumulative growth of Palmer amaranth asinfluenced by crop and emergence time,with 0 weeks representing the time of flagging for the early emergence time.  Lines for Palmeramaranth growth in weeks were fitted using the 4-parameter log-logistic model.  Early cohortcorn (‡), early cohort soybean (—), mid cohort corn (…), mid cohort soybean (–), late cohort corn(ƒ), and late cohort soybean (ðr).BaseC-C-C BMPC-S-C BMPS-C-S BMPC-S-W BMPSeed number cu. meter (x1000)0200400600800Figure 5.4. Palmer amaranth seed distribution after three years in thebest management practice(BMP) plots for four different crop rotations.  The base plot represents the initial Palmeramaranth soil seedbank.  The letters above indicate significant differences; plots followed by thesame letter are not significantly different at ⁄ = 0.05.BaseC-C-C WFC-S-C WFS-C-S WFC-S-W WFSeed number cu. meter (x1000)050100150200250300350Figure 5.5. Palmer amaranth seed distribution after three years in the weed-free plots for fourdifferent crop rotations.  The base plot represents the initial Palmer amaranth soilseedbank.LITERATURE CITEDLITERATURE CITEDBall DA (1992) Weed seedbank response to tillage, herbicides, and crop rotation sequence.Weed Sci 40:654•659Ball DA, Miller SD (1990) Weed seed population response totillage and herbicide use in threeirrigated cropping sequences.Weed Sci38:511•517Bellinder RR, Dillard HR, Shah DA (2003) Weed seedbank community responses to croprotation schemes.Crop Protection23.2:95•101Box GEP, Cox DR (1964) An analysis of transformation (with discussion). J R Stat Soc B26:211•252Buhler DD, Hartzler RG, Forcella F (1997) Implications of weed seedbank dynamics to weedmanagement. Weed Sci 45:329•336Buhler DD, Kohler KA, Thompson RL (2001) Weed seed bank dynamics during a five-year croprotation 1.Weed Technol15.1:170•176Cardina JC, Herms P, Doohan DJ (2002) Crop rotation and tillage system effects on weedseedbanks.Weed Sci50.4:448•460Davis AS, Renner KA, Gross KL (2005) Weed seedbank and community shifts in a long-termcropping systems experiment.Weed Sci53.3:296•306Ehleringer J (1983) Ecophysiology ofAmaranthus palmeri, a sonoran desert summer annual.Oecologia 57:10•112Forcella F, Benech-Arnold RL, Sanchez R, Ghersa CM (2000) Modeling seedling emergence.Field Crops Res 67:123•139Gross KL (1990) A comparison of methods for estimating seed numbers in the soil.  J Ecol78:1079•1093Horak MJ, Loughin TM (2000) Growth analysis of fourAmaranthus species.WeedSci48.3:347•355Huang JZ, Shrestha A, Tollenaar M, Deen W, Rahimian H, Swanton CJ (2000) Effects ofphotoperiod on the phenological development of redroot pigweed (Amaranthus retroflexusL.). Can J Plant Sci 80:929•938Jha P, Norseworthy JK, Riley MB, Bridges Jr W (2010) Annual changes in temperatureand lightrequirements for germination of Palmer amaranth (Amaranthus palmeri) seeds retrieved formthe soil.  Weed Sci 58:426•432Jha P, Norsworthy JK (2009) Soybean canopy and tillage effects on emergence of Palmeramaranth (Amaranthus palmeri) from anatural seed bank.Weed Sci57.6:644•651Jha P, Norsworthy JK, Bridges Jr W, Riley MB (2008a) Influence of glyphosate timing and rowwidth on Palmer amaranth (Amaranthus palmeri) and pusley (Richardia spp.) demographicsin glyphosate-resistant soybean.Weed Sci56.3:408•415Jha P, Norsworthy JK, Riley MB, Bielenberg DG, Bridges Jr W (2008b) Acclimation of Palmeramaranth (Amaranthus palmeri) to shading.  Weed Sci 56:729•734Keeley PE, Carter CH, Thullen RJ (1987) Influence of planting date on growth of Palmeramaranth (Amaranthus palmeri).Weed Sci 35:199•204Lindquist JL, Mortenson DA, Clay SA, Schmenk R, Kells JJ, Howatt D, Westra P (1996)Stability of corn (Zea mays) velvetleaf (Abutilon theophrasti) interference relationships.Weed Sci 44:309•313Malone CR (1967) A rapid method for enumeration of viable seeds in soil. Weeds 15:381•382Massinga RA, Curie RS, Horak MJ, Boyer Jr J (2001) Interference of Palmer amaranth incorn.Weed Sci49.2:202•208McLachlan SM, Tollenaar M, Swanton CJ, Weise SF (1993) Effect of corn-induced shading ondry matter accumulation, distribution, and architecture of redroot pigweed (Amaranthusretroflexus).  Weed Sci 41:568•573Michigan State University Enviro-weather (2016) weather station network.https://www.enviroweather.msu.edu.  Accessed: May 15, 2016Norsworthy JK, Schrage BW, Barber TL, Schwartz LM (2016) Emergence date influencesgrowth and fecundity of Palmer amaranth in cotton. J Cotton Sci 20:263•270Norsworthy JK, Ward SM, Shaw DR, Llewellyn RS, Nichols RL, Webster TM, Bradley KW,Frisvold G, Powles SB, Burgis, NR, Witt, WW, Barrett M (2012) Reducing risks of herbicideresistance:  best management practices and recommendations. Weed Sci spec iss 31•62Powell DK (2014) Biology and management of multiple (glyphosate/ALS)-resistant Palmeramaranth in Michigan soybean. Ph.D dissertation. East Lansing, MI: Michigan StateUniversity. 122 pSchweizer EE, Lauridson TC (1985) Powell amaranth (Amaranthus powellii) interference insugarbeet (Betavulgaris). Weed Sci 33:518•520Sellers BA, Smeda RJ, Johnson WG, Kendig JA, Ellersieck MR (2003) Comparative growth ofsixAmaranthus speciesin Missouri.Weed Sci51.3:329•333Sonoskie LM, Webster TM, Culpepper AS (2013) Glyphosate resistance does not affect Palmeramaranth (Amaranthus palmeri) seedbank longevity. Weed Sci 61:283•288Sprague CL (2011) Glyphosate-resistant Palmer amaranth confirmed in Michigan.http://msuweeds.com/newsletter-holder/emerging-weed-issues/glyphosate-resistant-palmer-amaranth-confirmed-in-southwest-michigan/.  Accessed July 11, 2016Steckel LE, Sprague CL, Hager AG, Simmons FW, Bollero GA (2003) Effects of shading oncommon waterhemp (Amaranthus rudis) growth and development. Weed Sci 51:898•903Steinmaus SJ, Prather TS, Holt JS (2000) Estimation of base temperatures for nine weedspecies.Journal of Experimental Botany51.343:275•286Swanton CJ, Shrestha A, Knezevic SZ, Roy R, Ball-Coelho BR (1999) Influence of tillage onvertical seedbank distribution in a sandy soil.  Can J Plant Sci 80:455•457Sweeney AE, Renner KA, Laboski C, Davis A (2008) Effect of fertilizer nitrogen on weedemergence and growth. Weed Sci 56:714•721Uscanga-Morta E, Clay SA, Forcella F, Gunsolus J (2007) Common waterhemp growth andfecundity as influenced by emergence date and competing crop.  Agron J 99:1265•1270Wang T, Zhou D, Wang P, Zhang H (2006) Size-dependent reproductive effort inAmaranthusretroflexus:the influence of planting density and sowing date.  Can J Bot 84:485•492Webster TM,Grey TL (2015) Glyphosate-resistant Palmer amaranth (Amaranthus palmeri)morphology, growth, and seed production in Georgia. Weed Sci 63:264•272