MAKING MAMMALIAN STEM CELLS: IDENTIFYING AND OVERCOMING REPROGRAMMING BARRIERS  By  Anthony M. Parenti               A DISSERTATION  Submitted to Michigan State University In partial fulfillment of the requirements for the degree of  Cell and Molecular Biology - Doctor of Philosophy   2016           ABSTRACT  MAKING MAMMALIAN STEM CELLS: IDENTIFYING AND OVERCOMING REPROGRAMMING BARRIERS  By  Anthony M. Parenti   The field of stem cell biology had its first major boon when embryonic stem cells (ESCs) were derived from a mouse blastocyst in the 1980Õs.  ESCs have the potential to form any type of cell in the body, and thus represent a powerful new tool to study and treat a number of diseases that plague modern society.  Despite the potential advantages ESCs offer, an embryo is destroyed in the derivation process, which leads to many ethical objections.  Further, ESCs are not an exact genetic match to the patient they would be put into, which may lead to problems of graft rejection like we observe with organ transplantation.    In 2006, a group of scientists made a revolutionary discovery when they expanded upon the trailblazing efforts of others, who employed somatic cell nuclear transfer and transcription factor based lineage conversion, to discover that a fully differentiated cell could be driven back to an embryonic state through forced expression of four transcription factors: Oct4, Sox2, Klf4, and cMyc (OSKM).  These induced pluripotent stem cells (iPSCs) can also become any type of cell in the body and are identical to ESCs in many ways, but have the advantage of being derived from the patient they would be put back into, and do not require the destruction of an embryo.  iPSCs offer the ideal tool to study and treat many different diseases including AlzheimerÕs, ParkinsonÕs, diabetes, HuntingtonÕs, and Huntington-Gilford Progeria Syndrome among many others.   Despite the potential for iPSCs, they remain extremely hard to produce.  Various reports have described Òbarriers to reprogrammingÓ that inhibit the conversion of differentiated cells to iPSCs.  In the chapters that follow, I present my work uncovering previously unknown barriers to iPSC reprogramming including the formation of a different stem cell type during OSKM mediated reprogramming.  Further, I detail my findings that examine the impact of aging on iPSC reprogramming and my findings that cells derived from aged individuals are not rejuvenated during the iPSC reprogramming process as previously hypothesized, but instead maintain the functional defects of old cells.  The work presented herein represents my efforts to uncover the mechanisms underlying OSKM reprogramming.  Many previously-held conceptions about OSKM reprogramming are not supported by my findings and need to be reassessed.  Further, my work should serve as the launching point for future studies aimed at improving iPSC reprogramming efficiency and quality.          iv ACKNOWLEDGEMENTS    Jennifer Parenti Ð You were by my side through the highs and lows and have a special way of helping me see the positive in life.  Thank you for remaining remarkably calm when I came home one day to tell you that we would be moving our family to the Midwest and for being an amazing mother to our children throughout this endeavor.  I know it has not been easy, but I could not have accomplished this without you and cannot imagine another person I would want to share this moment with.  I love you more everyday and know that I am lucky to have found you.  Mary and Lucy Parenti Ð You give me a reason to smile and something to look forward to each day.  Watching you grow up has been the highlight of my life.  I hope that you are happy and that I have set a good example for you to follow in whatever your futures hold.  You will never know how much I love you. Paul and Kathy Parenti Ð You taught me the value of hard work and family, I strive everyday to live up to the example you set.  The strength and grace you display while dealing with your personal struggle is inspiring and gives me a hope for the future.  At various times on this graduate school journey, you put a roof over my head and took care of our children.  I am forever grateful and will always love you. D.J. Parenti Ð You were my sounding board for various issues over the years and have been doing the duty of two sons in my absence.  Thank you for being there for me, I love you. Jim and Karen Hall Ð At various times you offered Jen and I a place to live and cared for our children while we navigated this confusing and convoluted process and I am truly  v grateful.  I donÕt know what we would have done without your support.  Please know that I will never forget the generosity and love you showed us. David Fernandes Ð Thank you for taking time to visit us throughout my time in graduate school, we enjoy every visit.  You have a good natured attitude that brightens our moods.  Your knowledge and skill were also invaluable throughout our home renovation process and we could not have completed our projects without your sweat and input.  I admire your courage and work ethic and could not be happier to be you son in law. Dr. David Arnosti, Dr. Monique Floer, Dr. Jason Knott, and Dr. Keith Latham Ð Thank you for serving as members of my thesis committee.  Each of you offered valuable insight, pushed me to progress as a scientist, and made suggestions that improved the quality of my work.   Dr. Keith Latham and Dr. Kai Wang Ð You made valuable experimental and intellectual contributions to my thesis work and I do not know how I would have completed the in vivo developmental experiments without your help. Dr. Yi Zuo and Dr. Min Fu Ð Thank you for providing aged mice for my aging/reprogramming work.  You saved us at least 2 years of time and allowed our research to progress. Dr. Stephanie Blij Ð Thank you for being my first true lab friend.  I cherished our conversations and debates and hope we cross paths in the future.  Dr. Tristan Frum Ð You served as my debate opponent, comedic foil, occasional golfing partner, and friend for the better part of 6 years.  Thank you for helping to lighten my mood and remind me that science is fun.  vi Dr. Michael Halbisen Ð You were the first person in the lab to take me under your wing and show me how to be a scientist.  I enjoyed working with you and arguing with you about topics that ranged from the origins of the U.S. Navy to ÒWhich city sucks the most?Ó.  I would also like to thank you for the opportunity to work on my physical fitness outside of the traditional gym environment when we moved trees, radiators, home contents, etcÉ Dr. Alyson Lokken Ð You are truly one of the nicest people I have ever met and it makes me feel like I am a better person because I can call you a friend.  Thank you for being there to listen to my myriad complaints and always finding a positive way to spin the situation.  I know your work ethic and intelligence will propel you to success in all your future endeavors. Dr. Amy Ralston Ð Working for you over the past 6 years has been an honor, thank you for taking a chance on me.  You taught me how to think critically and helped to give me a sense of confidence I have often lacked.  I do not know what compelled you to offer me a space in your lab, but I am glad to have played a part, however small, in your success.   You are a brilliant scientist and I know you will find continued success in the future.           vii TABLE OF CONTENTS    LIST OF TABLES          xi  LIST OF FIGURES          xii  KEY TO ABBREVIATIONS        xv  Chapter 1 Mammalian Development, Stem Cells, Reprogramming, and  Aging: A Historical Perspective        1  Abstract          2  Section 1.  The Mammalian Blastocyst and Embryo Derived   Stem Cells          4   The Mammalian Blastocyst      4   Embryo-Derived Stem Cells      5  Section 2.  Somatic Cell Nuclear Transfer     7  Section 3.  Cell Fate Conversion and the Discovery of Induced  Pluripotency          9   Transcription Factor Based Cell Fate Conversion   9   The Discovery of Induced Pluripotency     10   Problems associated with iPSCs and Barriers to the    Acquisition of Pluripotency       11  Section 4.  The Role of OSKM in Development     13  Section 5.  Aging and Questions of Stem Cell Quality    15  APPENDIX          18  REFERENCES         24  Chapter 2 OSKM induce extraembryonic endoderm stem (iXEN) cells in parallel to iPSCs          35  Abstract          36  Section 1.  Introduction        37  Section 2.  Materials and Methods      38   Mouse Strains        38   Fibroblast preparations       39   Reprogramming        39   XEN cell derivation and culture      40   Immunofluorescence and flow cytometry     40   RNA sequencing and qPCR      41   XEN/iXEN in vitro differentiation      43   iXEN/XEN/iPSC/ESC in vivo differentiation    43   Lineage Tracing        44   Viral Genotyping        44   shRNA Cloning and Testing      45   Proximity         45  viii   Statistical Analyses        45  Section 3.  Results         46   iXEN cells display XEN cell morphology and gene expression 46   MEF-derived XEN cells exhibit stem cell properties   48   iXEN cells are not derived from pre-existing iPSC colonies  49   All four reprogramming factors induce XEN cell fate   51   GATA6 and GATA4 facilitate iXEN, but not iPSC, cell formation 52  Section 4.  Discussion        54   Comparison of Parenti et al. and Zhao et al.    55   What role does MEF heterogeneity play in the establishment   of iXEN and iPSCs?        58   How do iXEN and cXEN compare to embryo-derived XEN?  59   Can iXEN contribute to Visceral Endoderm in vivo?   60   Can iXEN cells be derived from human cells and used as a    model to study human extraembryonic development?   62  Acknowledgments         62  APPENDIX          63  REFERENCES         78  Chapter 3 iXEN and iPSC reprogramming is influenced by extrinsic and intrinsic factors          85  Abstract          86  Section 1.  Introduction        87  Section 2.  Materials and Methods      90   Mouse Strains        90   Fibroblast preparations       90   XEN cell derivation and culture      90   Immunofluorescence and flow cytometry     91   RNA isolation and qRT-PCR      92   shRNA Cloning and Testing      92   Statistical Analyses        93   Reprogramming        93    Retroviral Reprogramming      93    Chemical Reprogramming      95   Proliferation Assay        96   iXEN/XEN in vivo differentiation      96  Section 3.  Results         97   FGF signaling improves iXEN and iPSC reprogramming    efficiency by increasing cellular proliferation    97   Oct4 is not a specific marker of pluripotency during   reprogramming        98   Reprogramming on a monolayer of mitotically inactivated   XEN cells decreases iXEN and iPSC reprogramming   efficiency         99   There is no difference in iXEN or iPSC reprogramming   efficiency when knocking down multiple XEN genes  ix   compared to silencing Gata6 alone     100   Gata6 expression during OSKM reprogramming inhibits   acquisition of pluripotency       100   All four factors (OSKM) are required to induce XEN gene   expression and derive iXEN during reprogramming   101   Age and genetic background are not barriers to the   acquisition of iXEN cell fate      102   XEN-like cells could not be derived from MEFs using   chemical reprogramming       102   Pdgfralpha-GFP cannot be used as a reliable marker to   isolate iXEN cells after reprogramming     104  Section 4.  Discussion        104   FGF signaling improves iXEN and iPSC reprogramming   efficiency by increasing cellular proliferation    104   iXEN inhibit acquisition of iPSC fate during   reprogramming        105   Reprogramming context impacts iXEN reprogramming   efficiency         106   Oct4 is expressed in both iXEN and iPSCs after   reprogramming        107   PDGFRalpha-GFP cannot be used to isolate putative   iXEN during reprogramming      107  APPENDIX          109  REFERENCES         119  Chapter 4 Examining the Impact of Aging on iPSC Reprogramming   125  Abstract          126  Section 1.  Introduction        127  Section 2.  Materials and Methods      130   Mouse Strains        130   Fibroblast preparations       130   Reprogramming        130   ESC Derivation        131   Chimera Generation       132   Chromosome Counting       132   Embryoid Body Differentiation      133   Fibroblast Derivation from iPSCs      133   RNA isolation and qPCR       134   Microarray Sample Preparation      134   Microarray Analysis        135   Scratch Assay        135   Proliferation Assay        136  Section 3.  Results         136   Old fibroblasts can generate iPSCs, but at lower efficiency   than young cells        136   iPSCs derived from old cells show hallmarks of pluripotency  137  x   iPSCs derived from old fibroblasts display age related   functional defects        138   iPSC derived fibroblasts maintain proliferation defect   139   iPSC derived fibroblasts maintain a migration defect   140   C57BL/6 pluripotent cells are karyotypically unstable   141   iPSCs can be derived from aged BALB/c cells and do not   show signs of aneuploidy       142   BALB/c fibroblasts show age-associated proliferation and   migration defects        143  Section 4.  Discussion        143  APPENDIX          147  REFERENCES         160  Chapter 5 Cdx2 efficiently induces trophoblast stem-like cells in naŁve,  but not primed, pluripotent stem cells       164  Abstract          165  Section 1.  Introduction        166  Section 2.  Materials and Methods      168   Cell culture         168   Reprogramming        169   Gene expression analysis       170  Section 3.  Results         170   EpiSCs do not give rise to TSCs following overexpression   of Cdx2 in TSC conditions       170   ECCs generate cells with TSC properties following Cdx2    overexpression        174   The efficiency of deriving TSC-like cells varies among   iPSC and ESC Lines       176   Cdx2 overexpression induces expression of non-TSC   genes in multiple pluripotent stem cell lines    178   Myc expression levels predict TSC-forming potential   180   Inhibitors of GSK3/MAPK signaling increase potential to   form TSC-like cells        181  Section 4.  Discussion        182  Acknowledgments         186  APPENDIX          187  REFERENCES         202  Chapter 6 Three, two, oneÉ TROPHO-BLAST OFF!     210  Abstract          211  Section 1.  Main Text        212  Acknowledgments         215  APPENDIX          216  REFERENCES         218    xi LIST OF TABLES    Table 2.1. Primers and Oligos        76  Table 2.2. Antibodies         77  Table 5.1. Summary of cell lines used in this study     200  Table 5.2. Primers and Oligos        201                                     xii LIST OF FIGURES    Figure 1.1. Three unique stem cell types are derived from the three lineages of the blastocyst         19  Figure 1.2. Somatic Cell Nuclear Transfer      21  Figure 1.3. Do OSKM induce two types of stem cells during transgene reprogramming?          22  Figure 1.4 Does iPSC reprogramming erase age related functional defects?           23  Figure 2.1. OSKM-induced extraembryonic endoderm (iXEN) cells   64  Figure 2.2. iXEN cells are self-renewing and multipotent    66  Figure 2.3. OSKM induce iXEN fate in MEFs      68  Figure 2.4. MEF-expressed endodermal genes promote iXEN cell fate  69  Figure 2.5. Sox2-CREER lineage tracing suggests that most iXEN are not derived from iPSCs         71  Figure 2.6. Comparison of iXEN and XEN cell lines     72  Figure 2.7. Developmental contributions of stem cell lines in chimeras  73  Figure 2.8. Flow cytometry and gene knockdown data     74  Figure 2.9. Endodermal gene expression during TTF reprogramming  75  Figure 3.1. FGF activity influences iXEN and iPSC reprogramming efficiency           110  Figure 3.2. iXEN cells express Oct4 after reprogramming    111  Figure 3.3. iXEN and iPSC reprogramming efficiency is decreased when reprogramming in a XEN environment       112  Figure 3.4. Double knockdown or overexpression, of XEN genes can change iXEN and iPSC reprogramming efficiency     113  Figure 3.5. All four factors are required to make iXEN     115  xiii  Figure 3.6. Genetic background and age are not strict barriers to the acquisition of iXEN fate         116  Figure 3.7. Summary of attempts to assess the effect of chemical reprogramming on iXEN and iPSC reprogramming efficiency    117  Figure 3.8. Pdgfralpha-GFP reporter MEF line cannot be used to isolate iXEN or iXEN progenitors during reprogramming     118  Figure 4.1. C57BL/6 Old fibroblasts can be reprogrammed with OSKM to become iPSCs          148  Figure 4.2. iPSCo have an age related proliferation defect    150  Figure 4.3. Age related fibroblast proliferation defect is not erased by reprogramming          151  Figure 4.4. Age related fibroblast migration defect is not erased by reprogramming          153  Figure 4.5. C57BL/6 pluripotent lines are prone to become aneuploid,  but parental fibroblasts and iPSC-derived cells are normal    154  Figure 4.6. BALB/c Old fibroblasts can be reprogrammed with OSKM to become iPSCs          156  Figure 4.7. Age related proliferation and migration defect present in BALB/c parental fibroblasts        158  Figure 4.8. OSKM reprogramming does not erase age related functional defects           159  Figure 5.1. EpiSCs do not give rise to TSCs following Cdx2 overexpression          188  Figure 5.2. ECCs give rise to TSC-like cells efficiently upon Cdx2 overexpression          190  Figure 5.3. iPSCs and ESCs give rise to TSC-like cells with variable efficiency           192  Figure 5.4. Cdx2 overexpression induces expression of non-TSC genes  193     xiv Figure 5.5. Correlation between TSC gene expression levels and markers of pluripotency         194  Figure 5.6. Pre-treatment of ESC lines in 2i leads to increased levels of TSC gene expression following Cdx2 overexpression     195  Figure 5.7. Relative efficiency of TSC-like cell formation reveals a continuum of pluripotent states        196  Figure 5.8. Expression levels of exogenous Cdx2ER for subclones used in this study           197  Figure 5.9. Validation of iPSC lines       198  Figure 5.10. Germ layer markers are not increased in 2i-pretreated cells during TSC-like differentiation        199  Figure 6.1. Overcoming the fetal/placental lineage barrier by reprogramming          217                             xv KEY TO ABBREVIATIONS    AVE  Anterior visceral endoderm  BMP2  Bone morphogenic protein 2  BMP4  Bone morphogenic protein 4  DMEM DubleccoÕs modified eagle medium  DOX  Doxycycline  E3.5  Embryonic day 3.5  E-cad  E-cadherin  EDTA  Ethylenediaminetetraacetic acid  EPI  Epiblast  ESC  Embryonic stem cell  FACS  Fluorescence activated cell sorting  FBS  Fetal bovine serum  FGF4  Fibroblast growth factor 4  GFP  Green fluorescence protein  HEP  Heparin  ICM  Inner cell mass  iFib  iPSC-derived fibroblast  iPSC  Induced pluripotent stem cell  iTSC  Induced trophoblast stem cell  iXEN  Induced extraembryonic endoderm stem cell  KOSR  Knockout serum replacement   xvi LIF  Leukemia inhibitory factor  MDS  Multidimensional scaling analysis  MEF  Mouse embryonic fibroblast  NaCl  Sodium chloride  NEAA  Non-essential amino acids  PBS  Phosphate buffered saline  PE  Primitive endoderm  Pen/Strep Penicillin and Streptomycin  pFib  Parental fibroblast  OSK  Oct4, Sox2, Klf4  OSKM  Oct4, Sox2, Klf4, cMyc  qPCR  Quantitative polymerase chain reaction  qRT-PCR Quantitative reverse transcription polymerase chain reaction  RA  Retanoic acid  RNA  Ribonucleic acid  RNAseq RNA sequencing  SCNT  Somatic cell nuclear transfer  SDS  Sodium dodecyl sulfate  shRNA Short hairpin RNA  SKM  Sox2, Klf4, cMyc  TE  Trophectoderm  TSC  Trophoblast stem cell  TTF  Tail tip fibroblast   xvii VE  Visceral endoderm  XEN  Extraembryonic endoderm stem cells  1 Chapter 1   Mammalian Development, Stem Cells, Reprogramming, and Aging: A Historical Perspective.    A. Parenti wrote this chapter and assembled the figures.                2 Abstract  Since the days of Aristotle humans have been enamored with the beauty and complexity required for a single cell zygote to develop into the complex organs and systems that make up our bodies.  In the past 80 years, scientists have developed an array of tools to investigate the morphological, transcriptional, epigenetic, and biochemical changes that underpin the transformation from zygote to mature adult.  In the 1950Õs and 60Õs Briggs, King, and Gurdon used somatic cell nuclear transfer to show that development, and indeed aging, is not a one-way street.  Building upon these early embryological studies, in the 1980Õs and 90Õs two groups found that it was possible to derive Embryonic Stem Cells (ESCs), which are able to differentiate into any type of cell in the body, from mammalian blastocysts.  The advent of ESCs signaled a new age for developmental biology and offered a source of cells to replace diseased or damaged cells.  Despite the promise, ethical issues may limit the use of ESCs in research and therapeutic settings.  In 2006, Shinya Yamanaka discovered that it was possible to create induced pluripotent stem cells (iPSCs) from terminally differentiated somatic cells by driving expression of 4 transcription factors: Oct4, Sox2, Klf4, and cMyc (OSKM).  Unlike ESCs, to which they are nearly identical, iPSCs are not derived from embryos, which eliminates many of the ethical concerns associated with ESCs, and are derived directly from the patient they would be put back into.  The advent of iPSCs is intriguing because various maladies that affect modern society, including a number of age-associated diseases, can be studied and treated using iPSCs.  Despite the bright future I have described for iPSCs, a number of major questions and concerns remain.   3 In the chapter that follows, I detail the events that led to the discovery of iPSCs and the areas of research that remain outstanding.                       4 Section 1.  The Mammalian Blastocyst and Embryo Derived Stem Cells The Mammalian Blastocyst  Mammalian development is marked by the gradual, regulated restriction of lineage potential.  Initially, a single cell zygote is totipotent, in that it will give rise to every cell in the embryo as well as two extraembryonic lineages, the primitive endoderm (PE) and the trophectoderm (TE) (Fig 1.1A) (reviewed in Beddington and Robertson, 1999; Rossant and Tam, 2004; Yamanaka et al., 2006).  Each cell of the embryo remains totipotent until the first lineage decision, on day ~E3.0 of mouse development, when the TE is segregated from the inner cell mass (ICM; Flemming, 1987).  The TE is multipotent, meaning its developmental potential is restricted to placental derivatives, while the ICM will go through a second lineage decision where it differentiates into the PE and the epiblast (EPI; Fig 1.1A; Gardner and Rossant, 1979; Gardner 1982).  The PE is also multipotent and will form the visceral endoderm (VE) and parietal endoderm (PrE).  The VE is involved in patterning the neural and cardiac lineages of the embryo, and contributes to portions of the yolk sac (Thomas and Beddington, 1996), while the PrE will contribute to the ReichertÕs membrane (Fig 1.1A; Gardner, 1983).  Finally, the EPI is pluripotent, meaning that it will give rise to every cell in the developing fetus (Fig 1.1A).  The interaction of each lineage with each other as well as the maternal environment is key to proper fetal development.  Experiments aimed at understanding these interactions can be challenging due to ethical concerns with fetal manipulation and the limited amount of material that can be obtained from individual embryos.  Though stem cells are not an exact match to their embryo counterparts, they can be  5 used as in vitro models of embryonic lineages to aide in our understanding of development and fertility.  Embryo-Derived Stem Cells  Though embryonic stem cells (ESCs) get a majority of the attention from the public, significant effort over the past 30 years was aimed at understanding the three lineages of the early embryo (EPI, TE, and PE) and attempting to derive stem cell models of them (Ralston and Rossant, 2005).  Careful study and manipulation of these stem cells advanced our understanding of the signaling networks and genes required for their proper function.  In 1981, Evans and Kaufman as well as Gail Martin made a major breakthrough when they derived ESCs from the EPI of mouse blastocyst (Fig 1.1B; Evans and Kaufman, 1981; Martin, 1981).  Years later, another group derived ESCs from human blastocysts (Thomson et al., 1998).  ESCs are characterized by their expression of Nanog, Sox2, and Oct3/4, among other pluripotency markers, and can be maintained in a pluripotent state indefinitely (Chambers et al., 2003; Niwa et al., 2000; Chew et al., 2005; Masui et al., 2007).  Further, ESCs offer a powerful tool because they can be manipulated to generate genetic mutants and can be placed back into developing embryos where they will contribute to a developing fetus.  The discovery of ESCs offered a powerful tool to study genes in the context of development and pluripotency, however, the most intriguing use of ESCs is in regenerative medicine.  As stated above, ESCs are pluripotent and have the potential to generate any cell in the body (Bradley et al., 1984).  The fact that ESCs can generate any type of cell in the body means that  6 ESCs can be used to regenerate tissues for medical use.  In recent years, researchers have made strides in pushing ESC derived tissues into the clinic (Schwartz et al., 2012; Trounson et al., 2015).  Along the way, however, progress in ESC research has been hampered by controversy because the process of deriving ESCs, which requires the destruction of human embryos and therefore raises a number of ethical and political concerns (Nisbet et al, 2003).  In addition, use of ESCs in a therapeutic setting may be limited by the fact that they are not derived from the patient they would be put into, which could lead to problems with graft rejection.  While the discovery of ESCs was revolutionary, many maladies of fetal development are a consequence of dysfunctional extraembryonic development (Gruenwald, 1963; Jauniaux et al., 2006).  To study those ailments, we needed stem cell lines derived from the extraembryonic lineages.  The placenta is an extraembryonic tissue that plays a critical role in the maturation of an embryo from implantation to birth and is derived from the TE.  In 1998, the Rossant lab was the first to derive trophoblast stem cells (TSC) from the TE of a mouse blastocyst (Fig 1.1B; Tanaka et al., 1998).  TSCs, like ESCs, offer a tool to study placental biology outside of the blastocyst, and TSCs can be placed back into blastocysts where they contribute to the developing placenta.  In the decades that followed, significant research went into identifying genes involved in TE/TSC fate and maintenance and the genes include Cdx2, Gata3, Eomes, Elf5, Ets2, and Tfap2c (Strumpf et al., 2005; Blij et al., 2015; Ralston et al., 2010; Russ et al., 2000; Ng et al., 2008; Wen et al., 2007; Kuckenberg et al., 2010).  In 2005, the Rossant lab derived extraembryonic endoderm stem cells (XEN) from the PE (Fig 1.1B; Kunath et al., 2005).  Like ESCs and TSCs, XEN offer a tool to study the PE outside of the embryo and can  7 be placed back into the embryo where they will contribute to the derivatives of the PE in vivo (Kunath et al., 2005).  Analysis of genetic mutants demonstrated that the PE/XEN lineage expresses Gata6, Gata4, Sox17, Sox7, and Pdgfralpha (Koutsourakis et al., 1999; Molkentin et al., 1997; Niakan et al., 2010; Artus et al., 2011; Plusa et al., 2008), and recent work showed that Oct3/4, long believed to be a marker of the pluripotent lineage, is required for the PE/XEN lineage in the embryo (Frum et al., 2013).  Though hypotheses regarding embryogenesis have changed over the years, scientists believed development and aging to be unidirectional.  Indeed, C.H. Waddington encapsulated the prevalent thought of the mid 20th century when he described development and differentiation as a cell traversing downhill through a landscape (Waddington, 1940; Waddington, 1957).  Each valley represented a different developmental pathway a cell could take.  A major implication of WaddingtonÕs hypothesis was that once a cell went down a given pathway (differentiated), it stayed there.  However, future experiments would demonstrate that mammalian cells are far more plastic than hypothesized.  Section 2.  Somatic Cell Nuclear Transfer  The role of the nucleus in directing embryonic maturation and differentiation has been at the center of developmental biology since the beginning of the discipline.  In the mid 20th century, scientists developed a technique to introduce a donor nucleus into an enucleated egg, a technique known as somatic cell nuclear transfer (SCNT; Fig. 1.2).  The possibility of SCNT had been posited by Hans Spemann in the early 20th century, but it wasnÕt until the 1950Õs when Briggs and King perfected the technique that the  8 potential of SCNT could be fully realized (Spemann, 1938; Briggs and King, 1952).  At the time, there was a vigorous debate in the field about what happened to the genome as a fertilized egg developed.  Experiments by Roux, Driesch, and others attempted to address this question, but contradicted each other (Roux, 1888; Driesch, 1892; Steward et al., 1958).  There were two competing hypotheses: First, as cells differentiated they lost all genes that were not relevant to their current function (Weisman, 1893; Roux, 1888; Driesch, 1892; Briggs and King, 1957; Gurdon, 1960a; Gurdon, 1960b; Gurdon, 1962).  If this were true, a nucleus from a differentiated cell placed back into an enucleated oocyte would be unable to develop into a complete new organism.  The second hypothesis was that cells retained all genes and simply turned the genes that were not relevant to their current function off (Driesch, 1892; Steward et al., 1958; Briggs and King, 1957; Gurdon, 1960a; Gurdon, 1960b; Gurdon, 1962).  If this hypothesis were true, the nucleus of any cell could be placed into an enucleated egg and would have the potential to form a fully functional new organism.  In 1962, John Gurdon used SCNT to introduce nuclei from Xenopus laevis intestinal epithelium cells into enucleated eggs.  Though the success rate was low, he found that the eggs with nuclei from differentiated intestinal epithelium cells could generate live tadpoles (Gurdon, 1962).  Though the definitive experiment supporting his work was not completed until 1975 (Wabl et al., 1975), his experiments demonstrated that differentiated Xenopus laevis cells retained the entire genome and had the potential to give rise to an entirely new organism.  Later, scientists would use SCNT to clone mammalian species, demonstrating that the ability to generate clones from differentiated nuclei was not restricted to  9 amphibians (Wilmut et al., 1997; Cibelli et al., 1998; Wakayama et al., 1998; Shiels et al., 1999).  The fact that SCNT can successfully ÒreprogramÓ a differentiated nucleus suggests there are proteins present within the cytoplasm of an enucleated egg that can alter which genes are expressed by the nucleus, as proposed by Jacob and Monod (Jacob and Monod, 1961), allowing that nucleus to revert to an embryonic state.  Somatic cell fusion experiments performed in the 1980Õs demonstrate that the ability to ÒreprogramÓ a nucleus is not specific to an oocycte, but fusion of two differentiated cells can reactivate silenced genes (Blau et al., 1983).  The experiments done with SCNT and cell fusion demonstrate that the process of embryonic and post-embryonic development is more plastic than previously believed.  Section 3.  Cell Fate Conversion and the Discovery of Induced Pluripotency Transcription Factor Based Cell Fate Conversion   Transcription factors can induce/inhibit expression of lineage specific genes, and thus can be used to alter a cellÕs identity.  The first example of transcription factor based cell fate conversion was reported in the late 1980Õs when multiple groups demonstrated that it was possible to induce muscle cell gene expression and convert a number of differentiated cell types into striated mononucleated myoblasts and multinucleated myotubes (Davis et al., 1987; Weintraub et al., 1989; Choi et al., 1990; Schafer et al., 1990).  This was the first evidence that transcription factor overexpression could convert differentiated cells to a different cell fate.  This finding suggested that with the right combination of transcription factors a cell could be reprogrammed to a different cell fate, potentially even back to an embryonic state.  If that was possible, we would have a way  10 to generate patient specific pluripotent cells without having to use oocytes, whose use is often met with similar skepticism as ESCs.  The Discovery of Induced Pluripotency   In 2006, Kazutoshi Takahashi and Shinya Yamanaka used transcription factor overexpression to convert differentiated cells back to a pluripotent embryonic state, a feat that would later earn Yamanaka the Nobel Prize together with Sir John Gurdon (Takahashi and Yamanaka, 2006).  The Yamanaka group developed a screen of 24 pluripotency associated transcription factors and found it was possible to convert differentiated cells into induced pluripotent stem cells (iPSC; Takahashi and Yamanaka, 2006; Takahashi et al., 2007).  In their initial discovery, Takahashi and Yamanaka found that it was possible to convert mouse embryonic fibroblasts into iPSCs with just four transcription factors: Oct4, Sox2, Klf4, and cMyc (OSKM).  Years of work after the initial discovery show that while there may be subtle differences, iPSCs are essentially identical to ESCs in terms of their developmental potential and their transcriptional and epigenetic profiles (Takahashi and Yamanaka, 2006; Takahashi et al., 2007; Yu et al., 2007; Wernig et al., 2007; Chin et al., 2010).  The potential for iPSC technology to revolutionize the field of regenerative medicine was immediately apparent.  As stated above, a major problem with ESCs is that any tissue generated from them would not be derived from the patient they would be put back into, bringing up the potential for graft rejection.  Further, the ethics of ESC use is questioned because an embryo is destroyed when they are derived.  iPSCs offer an alternative that eliminates both issues because they are derived directly from the patient they would be put back into and embryos are  11 not destroyed when iPSCs are made.  While iPSCs seemed like the answer to many of the problems associated with ESCs, rigorous evaluation in the past decade demonstrates that the reprogramming process and the iPSCs produced are not perfect.  In the next section, I detail problems with OSKM reprogramming and the iPSCs that are generated.  Problems associated with iPSCs and Barriers to the Acquisition of Pluripotency   A major hurdle that the iPSC field has yet to overcome is the fact that routinely, less than 1% of cells can become iPSCs.  Early attempts to explain low reprogramming efficiency produced two different models (Yamanaka, 2009).  The first model, the elite model, suggested that a few elite cells have the potential to become iPSCs, and the fact that few of these primed cells exist explains why iPSC reprogramming efficiency is low.  An alternate model, the stochastic model, suggested that any cell can become an iPSC, but the events that lead to one cell or another becoming an iPSC are stochastic and rare.  In the years that followed, a majority of the data produced supports the stochastic model.  For instance, research from the Jaenisch lab suggested that given enough time any cell could become an iPSC (Hanna et al., 2009).  JaenischÕs finding lends support to the stochastic model, but the issue has not been resolved.  Various groups report that addition of small molecules or Vitamin C to the reprogramming medium can improve reprogramming efficiency (Huangfu et al., 2008; Esteban et al., 2010).  Further, some reports suggest that significantly increasing the duration of OSKM induction (from 2 weeks to 20 weeks) or inhibition of chromatin modifiers that ÒsafeguardÓ the somatic cell state, Mbd3/NuRD or CAF-1, activity can increase reprogramming efficiency to nearly  12 100% (Hanna et al., 2009; Rais et al., 2013, Cheloufi et al., 2015).  This work suggests that given enough time or with the correct perturbations to a cellÕs epigenetic profile, that any cell can become an iPSC.  However, these studies do nothing to eliminate the possibility that some cells may be initially more amenable toward becoming iPSCs, and that others may be biased toward alternate cell fates.  While reprogramming efficiency remains a major focus of the field, in recent years many studies were published that suggest that the current protocol to induce pluripotency selects for mutations in the parental population and introduces new mutations during reprogramming (Gore et al., 2011; Hussein et al., 2011; Laurent et al., 2011).  Discovery of the problematic mutations in iPSCs led to the hypothesis that the low efficiency of inducing pluripotency generates low quality iPSCs (Okita and Yamanaka, 2011).  If iPSC technology is to reach its potential, significant efforts must be made to improve iPSC reprogramming efficiency and quality.  Examination of the mechanisms underlying transcription factor based reprogramming uncovered numerous barriers to the acquisition of pluripotency, including expression of p53-p21 pathway, TGF§ expression, expression of Wnt/§-catenin pathway members, and many others in the cells being reprogrammed (Hong et al., 2009; Samavarchi-Tehrani et al., 2010; Vidal et al., 2014).  One major barrier to the acquisition of iPSC fate is expression of transcription factors that oppose pluripotency in the cells being reprogrammed (Maekawa et al., 2011; Serrano et al., 2013).  While significant effort has been made to understand the mechanisms underlying iPSC reprogramming, it remains unclear why most cells (>99%) do not become iPSCs.  One hypothesis is that these cells have been diverted towards different developmental tracts.   13 If this is true, inhibition of alternate developmental programs could improve iPSC reprogramming efficiency.  A second major barrier to iPSC fate is the age of the cell being reprogrammed (Li et al., 2009).  Studies by Briggs and King showed that the age of the donor nucleus directly impacts the efficiency of generating live tadpoles by SCNT (Briggs and King, 1957).  Similarly, the age of the cell undergoing reprogramming impacts the efficiency of deriving iPSCs (Li et al., 2009).  Though it is possible to generate iPSCs from older mice and humans (Li et al., 2009; Lapasset et al., 2011), the quality of those iPSCs has yet to be fully examined, and it is unclear if reprogramming is rejuvenating the older cells.  If the iPSCs derived from older cells are not of a sufficiently high quality, then the cells differentiated from them may maintain age associated defects that were present in the parental cells.      Section 4.  The Role of OSKM in Development  Transcription factors play a key role in development, but it is rare to find a transcription factor that drives expression of a single cell type, SOX2 for instance is involved in establishing both pluripotency and the neural lineage (Avilion et al., 2003; Graham et al., 2003).  In their first paper, YamanakaÕs group limited their screen to transcription factors known to be associated with pluripotency, and in so doing, identified OSKM as the combination of transcription factors required to derive iPSCs from mouse embryonic fibroblasts (Takahashi and Yamanaka, 2006).  Intriguingly, while each of the four transcription factors are classically defined as pluripotency factors,  14 each is also known to play a role in driving expression of PE/XEN lineage genes in various developmental contexts.  Oct4, (encoded by Pou5f1), was first identified as a pluripotency factor in 1998, when it was discovered that ESCs could not be derived from Oct4-null embryos (Nichols et al., 1998).  Further, in the years following the discovery of iPSCs, a number of new protocols used different combinations of transcription factors to derive iPSCs, but Oct4 was always included (Wernig et al., 2008; Silva et al., 2008; Tiemann et al., 2014).  These reports and many others, served to cement the belief of Oct4 as a pluripotency factor, but recently, the advent of improved tools for analysis has reignited interest in Oct4Õs role in the embryo.  Frum et al. and others discovered that in addition to its role in establishing the pluripotent lineage, OCT4 directly promotes expression of genes associated with the PE/XEN lineage (Niwa et al., 2000; Aksoy et al., 2013; Frum et al., 2013; Le Bin et al., 204).  Sox2 was hypothesized to play a similar role in pluripotency as Oct4 because they have similar expression patterns in the preimplantation blastocyst (Pesce and Scholer, 2000).  It wasnÕt until 2003, however, when researchers found that ESCs could not be derived from Sox2-null embryos that Sox2Õs importance for development of the pluripotent lineage was confirmed (Avilion et al., 2003).  In 2014, Wicklow et al. analyzed SOX2 null embryos and found that SOX2 indirectly supports expression of genes associated with the PE/XEN lineage in vivo (Wicklow et al., 2014).  Klf4 was linked with the pluripotent lineage through microarray expression profiling of ESCs and in greater depth when it was discovered that Klf4 overexpression promotes ESC self-renewal and inhibits differentiation (Palmqvist et al., 2005; Li et al.,  15 2005).  Recently, it was found that Klf4 is expressed in the PE/XEN lineage in vivo and may regulate expression of PE genes therein (Morgani and Brickman, 2015).  cMyc expression was identified as a key mechanism by which ESCs maintain their ability to self renew in culture (Cartwright et al., 2005).  Indeed, expression of constitutively active cMyc in ESCs renders them independent of LIF, a growth factor normally required to promote self-renewal and inhibit differentiation (Cartwright et al., 2005).  Recent reports however suggest the cMyc regulates endoderm genes in fibroblasts and ESCs (Neri et al., 2012; Smith et al., 2010).  These observations suggest that each of the reprogramming transcription factors plays a role in driving PE/XEN gene expression in blastocysts and in cell culture, and raised the possibility that OSKM induce PE/XEN gene expression during somatic cell reprogramming as well (Fig. 1.3B).  Interestingly, a number of reports demonstrate that PE/XEN genes are upregulated during iPSC reprogramming including Gata6, Gata4, and Sox17 (Serrano et al., 2013; Hou et al., 2013; Zhao et al., 2015).  Despite observations that PE/XEN genes are expressed during reprogramming, there is no consensus in the field as to whether expression of these genes acts as a barrier or enhancer to the acquisition of iPSC fate.  Careful examination of the effect of PE/XEN gene expression on OSKM reprogramming could provide a way to improve iPSC reprogramming efficiency through manipulation of PE/XEN genes.     Section 5.  Aging and Questions of Stem Cell Quality  Aging is the main risk factor for many different diseases including AlzheimerÕs, ParkinsonÕs, cardiovascular disease, and various cancers.  Identifying the mechanisms  16 of age related diseases is made more challenging by the fact that obtaining cells and tissues from affected individuals is challenging.  iPSC technology offers an ideal tool to treat and study age related disease because iPSCs can be generated from individuals suffering from each disease.  iPSCs could then be used as a renewable source of cells to replace defective tissue and study disease models outside of the body.  While the potential for success in curing age-associated disease is clear, very little research has focused on examining the effect of aging on the quality of iPSCs and cells derived from them.  As mentioned above, iPSC reprogramming is extremely inefficient and the process is thought to select for mutations in the parental population while adding new mutations during the conversion to pluripotency.  A prominent hypothesis in the field is that low iPSC reprogramming efficiency selects for abnormal iPSCs (Okita and Yamanaka, 2011).  Early efforts to derive iPSCs from older humans or mice found that it is possible to derive iPSCs from old cells, but that it was 2-5x less efficient than deriving iPSCs from young cells (Li et al., 2009).  If the hypothesis that reprogramming selects for mutations in the parental population is true, reprogramming cells from older individuals may be even worse because it is known that our cells acquire more mutations as we age.  Thus, the possibility of generating iPSCs with harmful mutations is even more likely if we are reprogramming old cells.  The promise of iPSCs for understanding and combating age associated diseases will only be realized if we can improve reprogramming efficiency to make high quality iPSCs.  The discovery that iPSCs could be derived from old cells was a breakthrough for the study of aging for a variety of reasons, chief among them was that it was widely  17 believed that OSKM reprogramming would rejuvenate old cells (Mahmoudi and Brunet, 2012).  Indeed, early examinations of iPSCs derived from old cells found that many classic markers of aging like shortened telomeres, mitochondrial dysfunction, and an ÒoldÓ transcriptional profile are rejuvenated and returned to an embryonic state (Marion et al., 2009; Lapasset et al., 2011).  While these studies offered valuable information, few of them examined cells differentiated from the iPSCs, the cells that would actually be used in regenerative medicine and disease modeling.  One of the few studies that scrutinized iPSC-derived cells examined cellular markers of aging (telomere length, mitochondrial function, DNA-damage response, and nuclear lamina-associated proteins) and reported that iPSC-derived cells appeared to be rejuvenated, and did not ÒrememberÓ their true age (Miller et al., 2013).  However, these studies did not use functional assays to determine if the iPSC-derived cells were functionally rejuvenated by OSKM reprogramming.  To evaluate whether iPSC-derived cells are truly rejuvenated, we must determine if they continue to function like an old cells, or if they have been reset and function like young cells (Fig 1.4).  Fortunately, a number of aging phenotypes have been identified that can be tested in the parental population and retested in iPSC-derived cells to determine if iPSCs actually ÒresetÓ old cells to a youthful state.  Examination of the functional attributes of iPSC-derived cells will reveal the usefulness of OSKM reprogramming to treat age associated diseases.          18           APPENDIX              19  Figure 1.1. Three unique stem cell types are derived from the three lineages of the blastocyst  A) In the preimplantation stage blastocyst, there are three different lineages.  The pluripotent Epiblast (EPI) is shown in yellow and gives rise to the entire embryo proper.  The primitive endoderm (PE), shown in red, is an extraembryonic lineage that gives rise to portions of the yolk sac and plays a critical role in axial patterning of the embryo (Thomas and Beddington, 1996; Rhinn et al. 1998).  The   20 Figure 1.1. contÕd trophectoderm (TE), shown in blue, is another extraembryonic lineage and gives rise to the placenta.  B) Stem cell lines can be derived from each of the three lineages of the preimplantation blastocyst.  Embryonic stem cells (ESC) are derived from the EPI, and are pluripotent.  This means that they can differentiate into any type of cell in the body.  Extraembryonic endoderm (XEN) stem cells are derived from the PE and are multipotent, which means that they can only differentiate into cells of the PE lineage.  Trophoblast stem cells (TSC) are derived from the TE, and like XEN cells, are multipotent and can only differentiate into cells of the TE lineage. Figure modified from original by A. Ralston.                                      21 Figure 1.2. Somatic Cell Nuclear Transfer.  A schematic representation of somatic cell nuclear transfer (SCNT), developed by Briggs and King in the 1950s.  To begin, the nucleus (1n) of an oocyte is removed using a thin glass needle to generate an enucleated oocyte.  Next, a donor cell or its nucleus (2n) is introduced via injection or electrofusion into the enucleated oocyte (Chung et al., 2006).  Finally, the embryo is allowed to develop in its natural environment (i.e. water for Xenopus, a uterus for mammals).  John Gurdon used SCNT to show that the nuclei of terminally differentiated Xenopus cells retained all the genetic material required to produce a complete tadpole.                     22  Figure 1.3. Do OSKM induce two types of stem cells during transgene reprogramming?  A) Recent work demonstrates that each of the four iPSC reprogramming factors, Oct4, Sox2, Klf4, and cMyc (OSKM), induce expression of both pluripotency genes (ESCs) and PE/XEN genes.  B) We hypothesized that OSKM induce expression of pluripotent genes and PE/XEN genes in iPSC reprogramming as well.                        23 Figure 1.4. Does iPSC reprogramming erase age related functional defects?  The advent iPSC reprogramming was hypothesized as a way to rejuvenate old cells.  Experiments completed in the last 10 years suggest that some cellular signs of aging like telomere length, mitochondrial function, and DNA damage response are rejuvenated by iPSC reprogramming.  However, no studies have examined functional defects associated with aging, like proliferation and migration defects, to determine if old cells are rejuvenated by iPSC reprogramming at the functional level.  An examination of age associated functional defects in iPSC-derived cells will provide insight on the use of reprogramming to rejuvenate old cells.                24            REFERENCES             25 REFERENCES    Aksoy, I., Jauch, R., Chen, J., Dyla, M., Divakar, U., Bogu, G.K., Teo, R., Ng, C.K.L., Herath, W., Lili, S. and Hutchins, A.P., 2013. Oct4 switches partnering from Sox2 to Sox17 to reinterpret the enhancer code and specify endoderm. The EMBO journal, 32(7), pp.938-953.  Artus, J., Piliszek, A. and Hadjantonakis, A.K., 2011. The primitive endoderm lineage of the mouse blastocyst: sequential transcription factor activation and regulation of differentiation by Sox17. Developmental biology, 350(2), pp.393-404.  Avilion, A.A., Nicolis, S.K., Pevny, L.H., Perez, L., Vivian, N. and Lovell-Badge, R., 2003. Multipotent cell lineages in early mouse development depend on SOX2 function. Genes & development, 17(1), pp.126-140.  Beddington, R.S. and Robertson, E.J., 1999. Axis development and early asymmetry in mammals. Cell, 96(2), pp.195-209.  Blau, H.M., Chiu, C.P. and Webster, C., 1983. Cytoplasmic activation of human nuclear genes in stable heterocaryons. Cell, 32(4), pp.1171-1180.  Blij, S., Parenti, A., Tabatabai-Yazdi, N. and Ralston, A., 2015. Cdx2 efficiently induces trophoblast stem-like cells in naŁve, but not primed, pluripotent stem cells. Stem cells and development, 24(11), pp.1352-1365.  Bradley, A., Evans, M., Kaufman, M.H. and Robertson, E., 1984. Formation of germ-line chimaeras from embryo-derived teratocarcinoma cell lines.Nature, 309(5965), pp.255-256.  Briggs, R. and King, T.J., 1952. Transplantation of living nuclei from blastula cells into enucleated frogsÕ eggs. Proceedings of the National Academy of Sciences, 38(5), pp.455-463.  Briggs, R. and King, T.J., 1957. Changes in the nuclei of differentiating endoderm cells as revealed by nuclear transplantation. Journal of morphology, 100(2), pp.269-311.  Cartwright, P., McLean, C., Sheppard, A., Rivett, D., Jones, K. and Dalton, S., 2005. LIF/STAT3 controls ES cell self-renewal and pluripotency by a Myc-dependent mechanism. Development, 132(5), pp.885-896.  Chambers, I., Colby, D., Robertson, M., Nichols, J., Lee, S., Tweedie, S. and Smith, A., 2003. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell, 113(5), pp.643-655.   26 Cheloufi, S., Elling, U., Hopfgartner, B., Jung, Y.L., Murn, J., Ninova, M., Hubmann, M., Badeaux, A.I., Ang, C.E., Tenen, D. and Wesche, D.J., 2015. The histone chaperone CAF-1 safeguards somatic cell identity. Nature,528(7581), pp.218-224.  Chew, J.L., Loh, Y.H., Zhang, W., Chen, X., Tam, W.L., Yeap, L.S., Li, P., Ang, Y.S., Lim, B., Robson, P. and Ng, H.H., 2005. Reciprocal transcriptional regulation of Pou5f1 and Sox2 via the Oct4/Sox2 complex in embryonic stem cells. Molecular and cellular biology, 25(14), pp.6031-6046.  Chin, M.H., Pellegrini, M., Plath, K. and Lowry, W.E., 2010. Molecular analyses of human induced pluripotent stem cells and embryonic stem cells. Cell stem cell, 7(2), pp.263-269.  Choi, J., Costa, M.L., Mermelstein, C.S., Chagas, C., Holtzer, S. and Holtzer, H., 1990. MyoD converts primary dermal fibroblasts, chondroblasts, smooth muscle, and retinal pigmented epithelial cells into striated mononucleated myoblasts and multinucleated myotubes. Proceedings of the National Academy of Sciences, 87(20), pp.7988-7992.  Cibelli, J.B., Stice, S.L., Golueke, P.J., Kane, J.J., Jerry, J., Blackwell, C., de Leon, F.A.P. and Robl, J.M., 1998. Cloned transgenic calves produced from nonquiescent fetal fibroblasts. Science, 280(5367), pp.1256-1258.  Davis, R.L., Weintraub, H. and Lassar, A.B., 1987. Expression of a single transfected cDNA converts fibroblasts to myoblasts. Cell, 51(6), pp.987-1000.  Driesch, H., 1892. The potency of the first two cleavage cells in echinoderm development. Experimental production of partial and double formations. Foundations of experimental embryology. Hafner, New York.  Chung, Y.G., Gao, S. and Latham, K.E., 2006. Optimization of procedures for cloning by somatic cell nuclear transfer in mice. Nuclear Transfer Protocols: Cell Reprogramming and Transgenesis, pp.111-123.  Esteban, M.A., Wang, T., Qin, B., Yang, J., Qin, D., Cai, J., Li, W., Weng, Z., Chen, J., Ni, S. and Chen, K., 2010. Vitamin C enhances the generation of mouse and human induced pluripotent stem cells. Cell stem cell, 6(1), pp.71-79.  Evans, M.J. and Kaufman, M.H., 1981. Establishment in culture of pluripotential cells from mouse embryos. nature, 292(5819), pp.154-156.  Fleming, T.P., 1987. A quantitative analysis of cell allocation to trophectoderm and inner cell mass in the mouse blastocyst. Developmental biology, 119(2), pp.520-531.  Frum, T., Halbisen, M.A., Wang, C., Amiri, H., Robson, P. and Ralston, A., 2013. Oct4 cell-autonomously promotes primitive endoderm development in the mouse blastocyst. Developmental cell, 25(6), pp.610-622.  27  Gardner, R.L. and Rossant, J., 1979. Investigation of the fate of 4! 5 day post-coitum mouse inner cell mass cells by blastocyst injection. Development, 52(1), pp.141-152.  Gardner, R.L., 1982. Investigation of cell lineage and differentiation in the extraembryonic endoderm of the mouse embryo. Development, 68(1), pp.175-198.  Gardner, R.L., 1982. Origin and differentiation of extraembryonic tissues in the mouse. International review of experimental pathology, 24, pp.63-133.  Gore, A., Li, Z., Fung, H.L., Young, J.E., Agarwal, S., Antosiewicz-Bourget, J., Canto, I., Giorgetti, A., Israel, M.A., Kiskinis, E. and Lee, J.H., 2011. Somatic coding mutations in human induced pluripotent stem cells. Nature,471(7336), pp.63-67.  Graham, V., Khudyakov, J., Ellis, P. and Pevny, L., 2003. SOX2 functions to maintain neural progenitor identity. Neuron, 39(5), pp.749-765.  Gruenwald, P., 1963. Chronic Fetal Distress and Placental Insufficiency (Part 3 of 3). Neonatology, 5(3-4), pp.249-265.  Gurdon, J.B., 1960a. The developmental capacity of nuclei taken from differentiating endoderm cells of Xenopus laevis. Development, 8(4), pp.505-526.  Gurdon, J.B., 1960b. Factors responsible for the abnormal development of embryos obtained by nuclear transplantation in Xenopus laevis. Development, 8(3), pp.327-340.  Gurdon, J.B., 1962. The developmental capacity of nuclei taken from intestinal epithelium cells of feeding tadpoles. Development, 10(4), pp.622-640.  Hanna, J., Saha, K., Pando, B., Van Zon, J., Lengner, C.J., Creyghton, M.P., van Oudenaarden, A. and Jaenisch, R., 2009. Direct cell reprogramming is a stochastic process amenable to acceleration. Nature, 462(7273), pp.595-601.  Hong, H., Takahashi, K., Ichisaka, T., Aoi, T., Kanagawa, O., Nakagawa, M., Okita, K. and Yamanaka, S., 2009. Suppression of induced pluripotent stem cell generation by the p53Ðp21 pathway. Nature, 460(7259), pp.1132-1135.  Hou, P., Li, Y., Zhang, X., Liu, C., Guan, J., Li, H., Zhao, T., Ye, J., Yang, W., Liu, K. and Ge, J., 2013. Pluripotent stem cells induced from mouse somatic cells by small-molecule compounds. Science, 341(6146), pp.651-654.  Huangfu, D., Maehr, R., Guo, W., Eijkelenboom, A., Snitow, M., Chen, A.E. and Melton, D.A., 2008. Induction of pluripotent stem cells by defined factors is greatly improved by small-molecule compounds. Nature biotechnology,26(7), pp.795-797.   28 Hussein, S.M., Batada, N.N., Vuoristo, S., Ching, R.W., Autio, R., N−rv−, E., Ng, S., Sourour, M., H−m−l−inen, R., Olsson, C. and Lundin, K., 2011. Copy number variation and selection during reprogramming to pluripotency. Nature,471(7336), pp.58-62.  Jacob, F. and Monod, J., 1961. Genetic regulatory mechanisms in the synthesis of proteins. Journal of molecular biology, 3(3), pp.318-356.  Jauniaux, E., Poston, L. and Burton, G.J., 2006. Placental-related diseases of pregnancy: involvement of oxidative stress and implications in human evolution. Human reproduction update, 12(6), pp.747-755.  Koutsourakis, M., Langeveld, A., Patient, R., Beddington, R. and Grosveld, F., 1999. The transcription factor GATA6 is essential for early extraembryonic development. Development, 126(4), pp.723-732.  Kuckenberg P, Buhl S, Woynecki T, van Frden B, Tolkunova E, Seiffe F, Moser M, Tomilin A, Winterhager E, Schorle H., 2010. The transcription factor TCFAP2C/AP-2gamma cooperates with CDX2 to maintain trophectoderm formation. Mol Cell Biol. 30(13):3310-20.  Kunath, T., Arnaud, D., Uy, G.D., Okamoto, I., Chureau, C., Yamanaka, Y., Heard, E., Gardner, R.L., Avner, P. and Rossant, J., 2005. Imprinted X-inactivation in extra-embryonic endoderm cell lines from mouse blastocysts. Development, 132(7), pp.1649-1661.  Lapasset, L., Milhavet, O., Prieur, A., Besnard, E., Babled, A., AŁt-Hamou, N., Leschik, J., Pellestor, F., Ramirez, J.M., De Vos, J. and Lehmann, S., 2011. Rejuvenating senescent and centenarian human cells by reprogramming through the pluripotent state. Genes & development, 25(21), pp.2248-2253.  Laurent, L.C., Ulitsky, I., Slavin, I., Tran, H., Schork, A., Morey, R., Lynch, C., Harness, J.V., Lee, S., Barrero, M.J. and Ku, S., 2011. Dynamic changes in the copy number of pluripotency and cell proliferation genes in human ESCs and iPSCs during reprogramming and time in culture. Cell stem cell, 8(1), pp.106-118.  Le Bin, G.C., MuŒoz-Descalzo, S., Kurowski, A., Leitch, H., Lou, X., Mansfield, W., Etienne-Dumeau, C., Grabole, N., Mulas, C., Niwa, H. and Hadjantonakis, A.K., 2014. Oct4 is required for lineage priming in the developing inner cell mass of the mouse blastocyst. Development, 141(5), pp.1001-1010.  Li, Y., McClintick, J., Zhong, L., Edenberg, H.J., Yoder, M.C. and Chan, R.J., 2005. Murine embryonic stem cell differentiation is promoted by SOCS-3 and inhibited by the zinc finger transcription factor Klf4. Blood, 105(2), pp.635-637.   29 Li, H., Collado, M., Villasante, A., Strati, K., Ortega, S., CaŒamero, M., Blasco, M.A. and Serrano, M., 2009. The Ink4/Arf locus is a barrier for iPS cell reprogramming. Nature, 460(7259), pp.1136-1139.  Maekawa, M., Yamaguchi, K., Nakamura, T., Shibukawa, R., Kodanaka, I., Ichisaka, T., Kawamura, Y., Mochizuki, H., Goshima, N. and Yamanaka, S., 2011. Direct reprogramming of somatic cells is promoted by maternal transcription factor Glis1. Nature, 474(7350), pp.225-229.  Mahmoudi, S. and Brunet, A., 2012. Aging and reprogramming: a two-way street. Current opinion in cell biology, 24(6), pp.744-756.  Marion, R.M., Strati, K., Li, H., Tejera, A., Schoeftner, S., Ortega, S., Serrano, M. and Blasco, M.A., 2009. Telomeres acquire embryonic stem cell characteristics in induced pluripotent stem cells. Cell stem cell, 4(2), pp.141-154.  Martin, G.R., 1981. Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proceedings of the National Academy of Sciences, 78(12), pp.7634-7638.  Masui, S., Nakatake, Y., Toyooka, Y., Shimosato, D., Yagi, R., Takahashi, K., Okochi, H., Okuda, A., Matoba, R., Sharov, A.A. and Ko, M.S., 2007. Pluripotency governed by Sox2 via regulation of Oct3/4 expression in mouse embryonic stem cells. Nature cell biology, 9(6), pp.625-635.  Miller, J.D., Ganat, Y.M., Kishinevsky, S., Bowman, R.L., Liu, B., Tu, E.Y., Mandal, P.K., Vera, E., Shim, J.W., Kriks, S. and Taldone, T., 2013. Human iPSC-based modeling of late-onset disease via progerin-induced aging. Cell Stem Cell, 13(6), pp.691-705.  Molkentin, J.D., Lin, Q., Duncan, S.A. and Olson, E.N., 1997. Requirement of the transcription factor GATA4 for heart tube formation and ventral morphogenesis. Genes & development, 11(8), pp.1061-1072.  Morgani, S.M. and Brickman, J.M., 2015. LIF supports primitive endoderm expansion during pre-implantation development. Development, 142(20), pp.3488-3499.  Neri, F., Zippo, A., Krepelova, A., Cherubini, A., Rocchigiani, M. and Oliviero, S., 2012. Myc regulates the transcription of the PRC2 gene to control the expression of developmental genes in embryonic stem cells. Molecular and cellular biology, 32(4), pp.840-851.  Ng, R.K., Dean, W., Dawson, C., Lucifero, D., Madeja, Z., Reik, W. and Hemberger, M., 2008. Epigenetic restriction of embryonic cell lineage fate by methylation of Elf5. Nature cell biology, 10(11), pp.1280-1290.   30 Niakan, K.K., Ji, H., Maehr, R., Vokes, S.A., Rodolfa, K.T., Sherwood, R.I., Yamaki, M., Dimos, J.T., Chen, A.E., Melton, D.A. and McMahon, A.P., 2010. Sox17 promotes differentiation in mouse embryonic stem cells by directly regulating extraembryonic gene expression and indirectly antagonizing self-renewal. Genes & development, 24(3), pp.312-326.  Nichols, J., Zevnik, B., Anastassiadis, K., Niwa, H., Klewe-Nebenius, D., Chambers, I., Schıler, H. and Smith, A., 1998. Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell, 95(3), pp.379-391.  Nisbet, M.C., Brossard, D. and Kroepsch, A., 2003. Framing science the stem cell controversy in an age of press/politics. The International Journal of Press/Politics, 8(2), pp.36-70.  Niwa, H., Miyazaki, J.I. and Smith, A.G., 2000. Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nature genetics, 24(4), pp.372-376.  Okita, K. and Yamanaka, S., 2011. Induced pluripotent stem cells: opportunities and challenges. Philosophical Transactions of the Royal Society of London B: Biological Sciences, 366(1575), pp.2198-2207.  Palmqvist, L., Glover, C.H., Hsu, L., Lu, M., Bossen, B., Piret, J.M., Humphries, R.K. and Helgason, C.D., 2005. Correlation of murine embryonic stem cell gene expression profiles with functional measures of pluripotency. Stem cells, 23(5), pp.663-680.  Pesce, M. and Schıler, H.R., 2000. Oct!4: Control of totipotency and germline determination. Molecular reproduction and development, 55(4), pp.452-457.  Plusa, B., Piliszek, A., Frankenberg, S., Artus, J. and Hadjantonakis, A.K., 2008. Distinct sequential cell behaviours direct primitive endoderm formation in the mouse blastocyst. Development, 135(18), pp.3081-3091.  Rais, Y., Zviran, A., Geula, S., Gafni, O., Chomsky, E., Viukov, S., Mansour, A.A., Caspi, I., Krupalnik, V., Zerbib, M. and Maza, I., 2013. Deterministic direct reprogramming of somatic cells to pluripotency. Nature, 502(7469), pp.65-70.  Ralston, A. and Rossant, J., 2005. Genetic regulation of stem cell origins in the mouse embryo. Clinical genetics, 68(2), pp.106-112.  Ralston, A., Cox, B.J., Nishioka, N., Sasaki, H., Chea, E., Rugg-Gunn, P., Guo, G., Robson, P., Draper, J.S. and Rossant, J., 2010. Gata3 regulates trophoblast development downstream of Tead4 and in parallel to Cdx2.Development, 137(3), pp.395-403.   31 Rhinn, M., Dierich, A., Shawlot, W., Behringer, R.R., Le Meur, M. and Ang, S.L., 1998. Sequential roles for Otx2 in visceral endoderm and neuroectoderm for forebrain and midbrain induction and specification. Development, 125(5), pp.845-856.  Rossant, J. and Tam, P.P., 2004. Emerging asymmetry and embryonic patterning in early mouse development. Developmental cell, 7(2), pp.155-164.  Roux, W., 1888. Contributions to the developmental mechanics of the embryo. On the artificial production of half-embryos by destruction of one of the first two blastomeres, and the later development (postgeneration) of the missing half of the body. Foundations of experimental embryology, pp.2-37.  Russ, A.P., Wattler, S., Colledge, W.H., Aparicio, S.A., Carlton, M.B., Pearce, J.J., Barton, S.C., Surani, M.A., Ryan, K., Nehls, M.C. and Wilson, V., 2000. Eomesodermin is required for mouse trophoblast development and mesoderm formation. Nature, 404(6773), pp.95-99.  Samavarchi-Tehrani, P., Golipour, A., David, L., Sung, H.K., Beyer, T.A., Datti, A., Woltjen, K., Nagy, A. and Wrana, J.L., 2010. Functional genomics reveals a BMP-driven mesenchymal-to-epithelial transition in the initiation of somatic cell reprogramming. Cell stem cell, 7(1), pp.64-77.  Sch−fer, B.W., Blakely, B.T., Darlington, G.J. and Blau, H.M., 1990. Effect of cell history on response to helix-loop-helix family of myogenic regulators. Nature, 344(6265), pp.454-458.  Schwartz, S.D., Hubschman, J.P., Heilwell, G., Franco-Cardenas, V., Pan, C.K., Ostrick, R.M., Mickunas, E., Gay, R., Klimanskaya, I. and Lanza, R., 2012. Embryonic stem cell trials for macular degeneration: a preliminary report. The Lancet, 379(9817), pp.713-720.  Serrano, F., Calatayud, C.F., Blazquez, M., Torres, J., Castell, J.V. and Bort, R., 2013. Gata4 blocks somatic cell reprogramming by directly repressing Nanog. Stem Cells, 31(1), pp.71-82.  Silva, J., Barrandon, O., Nichols, J., Kawaguchi, J., Theunissen, T.W. and Smith, A., 2008. Promotion of reprogramming to ground state pluripotency by signal inhibition. PLoS Biol, 6(10), p.e253.  Shiels, P.G., Kind, A.J., Campbell, K.H., Wilmut, I., Waddington, D., Colman, A. and Schnieke, A.E., 1999. Analysis of telomere length in Dolly, a sheep derived by nuclear transfer. Cloning, 1(2), pp.119-125.  Speman, H., 1938. Embryonic Development and Induction. The American Journal of the Medical Sciences, 196(5), p.738.   32 Smith, K.N., Singh, A.M. and Dalton, S., 2010. Myc represses primitive endoderm differentiation in pluripotent stem cells. Cell stem cell, 7(3), pp.343-354.  Steward, F.C., Mapes, M.O. and Mears, K., 1958. Growth and organized development of cultured cells. II. Organization in cultures grown from freely suspended cells. American Journal of Botany, pp.705-708.  Strumpf, D., Mao, C.A., Yamanaka, Y., Ralston, A., Chawengsaksophak, K., Beck, F. and Rossant, J., 2005. Cdx2 is required for correct cell fate specification and differentiation of trophectoderm in the mouse blastocyst. Development, 132(9), pp.2093-2102.  Takahashi, K. and Yamanaka, S., 2006. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. cell,126(4), pp.663-676.  Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K. and Yamanaka, S., 2007. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. cell, 131(5), pp.861-872.  Tanaka, S., Kunath, T., Hadjantonakis, A.K., Nagy, A. and Rossant, J., 1998. Promotion of trophoblast stem cell proliferation by FGF4. Science, 282(5396), pp.2072-2075.  Tiemann, U., Marthaler, A.G., Adachi, K., Wu, G., Fischedick, G.U.L., Araœzo-Bravo, M.J., Schıler, H.R. and Tapia, N., 2014. Counteracting Activities of OCT4 and KLF4 during Reprogramming to Pluripotency. Stem cell reports,2(3), pp.351-365.  Thomas, P. and Beddington, R., 1996. Anterior primitive endoderm may be responsible for patterning the anterior neural plate in the mouse embryo. Current Biology, 6(11), pp.1487-1496.  Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J., Marshall, V.S. and Jones, J.M., 1998. Embryonic stem cell lines derived from human blastocysts. Science, 282(5391), pp.1145-1147.  Trounson, A. and McDonald, C., 2015. Stem cell therapies in clinical trials: progress and challenges. Cell stem cell, 17(1), pp.11-22.  Vidal, S.E., Amlani, B., Chen, T., Tsirigos, A. and Stadtfeld, M., 2014. Combinatorial modulation of signaling pathways reveals cell-type-specific requirements for highly efficient and synchronous iPSC reprogramming. Stem cell reports, 3(4), pp.574-584.  Waddington, C.H., 1940. Organisers and Genes. Cambridge University Press.  Waddington, C.H., 1957. The strategy of the genes. Geo Allen and Unwin.   33 Wabl, M.R., Brun, R.B. and Du Pasquier, L., 1975. Lymphocytes of the toad Xenopus laevis have the gene set for promoting tadpole development. Science, 190(4221), pp.1310-1312.  Wakayama, T., Perry, A.C., Zuccotti, M., Johnson, K.R. and Yanagimachi, R., 1998. Full-term development of mice from enucleated oocytes injected with cumulus cell nuclei. Nature, 394(6691), pp.369-374.  Weismann, A., 1893. The germ-plasm: a theory of heredity. C. Scribner's sons.  Wernig, M., Meissner, A., Foreman, R., Brambrink, T., Ku, M., Hochedlinger, K., Bernstein, B.E. and Jaenisch, R., 2007. In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state. nature, 448(7151), pp.318-324.  Wernig, M., Meissner, A., Cassady, J.P. and Jaenisch, R., 2008. c-Myc is dispensable for direct reprogramming of mouse fibroblasts. Cell stem cell,2(1), pp.10-12.  Weintraub, H., Tapscott, S.J., Davis, R.L., Thayer, M.J., Adam, M.A., Lassar, A.B. and Miller, A.D., 1989. Activation of muscle-specific genes in pigment, nerve, fat, liver, and fibroblast cell lines by forced expression of MyoD. Proceedings of the National Academy of Sciences, 86(14), pp.5434-5438.  Wen, F., Tynan, J.A., Cecena, G., Williams, R., Mœnera, J., Mavrothalassitis, G. and Oshima, R.G., 2007. Ets2 is required for trophoblast stem cell self-renewal. Developmental biology, 312(1), pp.284-299.  Wicklow, E., Blij, S., Frum, T., Hirate, Y., Lang, R.A., Sasaki, H. and Ralston, A., 2014. HIPPO pathway members restrict SOX2 to the inner cell mass where it promotes ICM fates in the mouse blastocyst. PLoS Genet, 10(10), p.e1004618.  Wilmut, I., Schnieke, A.E., McWhir, J., Kind, A.J. and Campbell, K.H.S., 1997. Viable offspring derived from fetal and adult mammalian cells.  Yamanaka, S., 2009. Elite and stochastic models for induced pluripotent stem cell generation. Nature, 460(7251), p.49.  Yamanaka, Y., Ralston, A., Stephenson, R.O. and Rossant, J., 2006. Cell and molecular regulation of the mouse blastocyst. Developmental Dynamics,235(9), pp.2301-2314.  Yu, J., Vodyanik, M.A., Smuga-Otto, K., Antosiewicz-Bourget, J., Frane, J.L., Tian, S., Nie, J., Jonsdottir, G.A., Ruotti, V., Stewart, R. and Slukvin, I.I., 2007. Induced pluripotent stem cell lines derived from human somatic cells. Science, 318(5858), pp.1917-1920.   34 Zhao, Y., Yin, X., Qin, H., Zhu, F., Liu, H., Yang, W., Zhang, Q., Xiang, C., Hou, P., Song, Z. and Liu, Y., 2008. Two supporting factors greatly improve the efficiency of human iPSC generation. Cell stem cell, 3(5), pp.475-479.                        35 Chapter 2   OSKM induce extraembryonic endoderm stem (iXEN) cells in parallel to iPSCs  Anthony Parenti 1,2, Michael Halbisen2, Kai Wang3, Keith Latham3, Amy Ralston1,2 1) Program in Cell and Molecular Biology, Michigan State University, East Lansing, MI 48824, USA  2) Department of Biochemistry and Molecular Biology, Michigan State University, East Lansing, MI 48824, USA  3) Department of Animal Sciences, Michigan State University, East Lansing, MI 48824, USA  Published as: Parenti, A., Halbisen, M.A., Wang, K., Latham, K. and Ralston, A., 2016. OSKM Induce Extraembryonic Endoderm Stem Cells in Parallel to Induced Pluripotent Stem Cells. Stem cell reports. A. Ralston wrote the manuscript with additions from A. Parenti. A. Parenti (and all the authors) edited the manuscript and assembled the figures with A. Ralston and M Halbisen. A. Parenti performed experiments for Figures 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, and 2.8. M. Halbisen performed bioinformatic analysis in Figure 2.1E and 2.1F. K. Wang performed experiments for Figure 2.2G.  36 Abstract  While the reprogramming factors OCT4, SOX2, KLF4, and MYC (OSKM) can reactivate the pluripotency network in terminally differentiated cells, they also regulate expression of non-pluripotency genes in other contexts, such as the mouse primitive endoderm. The primitive endoderm is an extraembryonic lineage established alongside the pluripotent epiblast in the blastocyst, and is the progenitor pool for extraembryonic endoderm stem (XEN) cells. Several studies have shown that endodermal genes are upregulated in fibroblasts undergoing reprogramming, although whether endodermal genes promote or inhibit acquisition of pluripotency is unclear. We show that, in fibroblasts undergoing conventional reprogramming, OSKM-induced expression of endodermal genes leads to formation of induced XEN (iXEN) cells, which possess key properties of blastocyst-derived XEN cells, including morphology, transcription profile, self-renewal, and multipotency. Our data show that iXEN cells arise in parallel to iPSCs, indicating that OSKM are sufficient to drive cells to two distinct fates during reprogramming.          37 Section 1.  Introduction  After the discovery of iPSCs, the field began work to identify barriers and roadblocks to the acquisition of pluripotency.  Many researchers have characterized the morphological, transcriptional, and epigenetic changes that are required to make iPSCs (Banito et al., 2009; Polo et al., 2010; Maekawa et al., 2011; Li et al., 2012; dos Santos et al., 2014).  Recently, the field shifted focus to determine the fate of cells that do not become iPSCs, >99% of the population, after reprogramming (Guo et al., 2014; Tonge et al., 2014; Zhao et al., 2015).    The pluripotency-promoting role of the reprogramming factors OCT4, SOX2, KLF4, and MYC (OSKM) is widely appreciated. However, the reprogramming factors also promote expression of non-pluripotency genes in a variety of contexts. For example, SOX2 indirectly promotes expression of PE genes, an extraembryonic lineage present in the blastocyst (Wicklow et al., 2014).  Our lab hypothesized that OCT4 promotes PE fate indirectly, like SOX2 and NANOG.  However, we and others found that OCT4 directly promotes expression of genes associated with mouse PE (Aksoy et al., 2013; Frum et al., 2013; Le Bin et al., 2014).  KLF4 may also regulate expression of primitive endoderm genes in the mouse blastocyst (Morgani and Brickman, 2015) and MYC regulates endodermal genes in cell lines such as fibroblasts and embryonic stem (ESCs; Neri et al., 2012; Smith et al., 2010). These observations raise the possibility that OSKM could induce expression of endodermal genes, as well as pluripotency genes, in somatic cells.  Several groups have reported that endodermal genes, including Gata6, Gata4, and Sox17, are upregulated in protocols used to reprogram fibroblast to iPSCs (Zhao et al., 2015; Hou et al., 2013; Serrano et al., 2013).  38  In spite of the evidence that endodermal genes are expressed following fibroblast reprogramming, there is no consensus as to whether endodermal gene expression promotes or antagonizes the acquisition of pluripotency.  One group proposed that iPSCs transiently express endodermal genes during acquisition of pluripotency (Zhao et al., 2015; Hou et al., 2013).  Moreover, the endodermal factors GATA4 and GATA6 can reportedly substitute for OCT4 to produce iPSCs (Shu et al., 2013; Shu et al., 2015). Yet, other evidence indicates that Gata4 expression inhibits pluripotency (Serrano et al., 2013). Additionally, Gata6 expression was detected in Ôpartially reprogrammedÕ cells (Mikkelsen et al., 2008), which are thought to be trapped in an intermediate state (Meissner et al., 2007), and Gata6 knockdown helped increase expression of Nanog in these cells (Mikkelsen et al., 2008). Thus endodermal genes have described as indicators of normal and abnormal reprogramming. Here, we investigate the timing and consequences of endodermal gene expression in detail.  Section 2.  Materials and Methods Mouse Strains Alleles were maintained on a CD-1 background: Sox17tm1(icre)Heli (Liao et al., 2009), Gt(ROSA)26Sortm14(CAG-tdTomato)Hze (Madisen et al., 2010), Col1a1tm4(tetO-Pou5f1,-Sox2,-Klf4,-Myc)Jae (Carey et al., 2010), Tg(CAG-cre)1Nagy (Belteki et al., 2005). All animal work conformed to the guidelines and regulatory standards of the University of Michigan State University Institutional Animal Care and Use Committee.    39 Fibroblast preparations To establish MEF lines, embryos were collected from pregnant mice on E13.5.  After head and viscera were removed, individual embryos were dissociated, and then plated on gelatin in MEF Medium [DMEM, 10% Fetal Bovine Serum (Hyclone), Pen/Strep (10,000 units each), Glutamax (200 mM), NEAA (200 mM), and beta-mercaptoethanol (55 mM)] and grown at 37¡C with 5% CO2.  Each MEF line was passaged once, and then stored in liquid nitrogen until used. To establish TTF lines, adult tail tips were isolated, epidermis was removed, and remaining tissue was plated in MEF medium, and then cultured for seven days.  TTFs were then harvested, frozen, and stored in liquid nitrogen until needed.  Reprogramming OSKM retrovirus was produced by transfecting 293T cells with pCL-ECO and pMXs plasmids containing Oct4, Klf4, Sox2, or cMyc (OSKM) cDNAs (Addgene). Culture supernatant was harvested 48 hours later, and qPCR used to quantify soluble virus using standard curves. Viral preps were stored at -80¼C until use.  For retroviral reprogramming (Takahashi and Yamanaka, 2006), 6x107 copies each OSKM viral particle were added to 40,000 MEFs (passage 2), and incubated for 24 hr. Media was then replaced with MEF medium, then ES Medium +FBS [DMEM (Invitrogen), 15% Fetal Bovine Serum (FBS; Hyclone), Pen/Strep (10,000 units each), Glutamax (200 mM), NEAA (200 mM), beta-mercaptoethanol (55 mM), and 10 ng/mL recombinant LIF (protocol available on request)]) on days 2 and 4, and then replaced with Reprogramming Medium (DMEM, 15% Knockout Serum Replacement (Invitrogen),  40 Pen/Strep (10,000 units each), Glutamax (200 mM), NEAA (200 mM), beta-mercaptoethanol (55 mM), and 10 ng/mL LIF]) on day 6 and then every other day until day the end of the experiment. For dox-induced reprogramming (Carey et al., 2010), Col1a1tm4(tetO-Pou5f1,-Sox2,-Klf4,-Myc)Jae MEFs were plated at a density of 50 cells/mm2 on gelatin in MEF medium. The following day, and every two days for 16 days thereafter, medium was replaced with ESC medium with 2 "g/mL dox (Sigma).  XEN cell derivation and culture Blastocysts were collected from pregnant mice on E3.5 by flushing uterine horns with M2 medium (Millipore).  Blastocysts were then transferred to 4-well dishes plated with mitotically inactivated (3,500 rads) MEFs in ESC medium, and were incubated at 37¡C with 5% CO2, changing the medium every 4 days.  On day 10, blastocyst outgrowths were dissociated with trypsin, and then cultured another 5-7 days.  Finally, expanded XEN cell lines were frozen and stored in liquid nitrogen until needed.  For experiments, XEN and iXEN cells were cultured in ESC medium with or without LIF or in XEN medium [30% Incomplete TS cell Medium [RPMI (Invitrogen), 20% FBS, Pen/Strep (10,000 units each), Glutamax (200 mM), NEAA (200 mM), beta-mercaptoethanol (55 mM)] + 70% MEF-conditioned medium + 1 "g/mL FGF4 (R&D Systems) + 1 U/mL Heparin (R&D Systems)].  Immunofluorescence and flow cytometry For immunofluorescence, cells were harvested with trypsin, washed twice with PBS, fixed with 4% formaldehyde in PBS for 15 min. at room temperature, washed twice with  41 PBS, and were then resuspended in 100% ice-cold methanol and placed on ice for 10 min.  Cells were incubated in blocking solution (PBS +10% FBS), and then incubated in primary antibody diluted in Blocking Solution overnight at 4¡C.  The next day, cells were washed twice with PBS, and then resuspended in secondary antibody diluted in blocking solution and incubated on ice for 1 hr.  Finally, cells were washed twice with PBS, resuspended in PBS and analyzed on a Becton Dickinson LSR II.  Data were analyzed using FlowJo software.  For immunofluorescence, cells were grown for 2 passages, before plating onto gelatinized (0.1% gelatin) cover slips.  Cells were then fixed with 4% formaldehyde in PBS at room temperature for 10 min., washed with PBS, and incubated in 0.5% Triton x-100 in PBS for 30 min at room temperature. Cells were blocked in Blocking Solution + 0.2% Triton x-100 for 1 hour at room temperature, and were then incubated in primary antibody in Blocking Solution + 0.2% Triton x-100 overnight at 4¡C.  Next, cells were washed with PBS and incubated in secondary antibody in Blocking Solution and DAPI (Sigma) in Blocking Solution for 1 hour. Cells were imaged using an Olympus Fluoview FV1000 with 20x UPlanFLN objective, NA 0.5).  (For antibodies used for either procedure, see Antibodies).  FACS was performed on a Becton Dickinson LSR II.  RNA sequencing and qPCR RNA was harvested with Trizol (Invitrogen), and cDNA was reverse transcribed from 1 "g RNA using Qiagen QuantiTect Reverse Transcription Kit (Qiagen), following manufacturersÕ instructions.  For qPCR, cDNA was amplified using a Lightcycler 480 (Roche), according to manufacturerÕs guidelines.  The amplification efficiency of each  42 primer pair (see Primers & Oligos), was measured by generating a standard curve from appropriate cDNA libraries.  All reactions were performed in quadruplicate.  For RNA-sequencing, cell lines were cultured for at least three passages before RNA was harvested.  Libraries were prepared from 1 "g of RNA using Illumina Truseq mRNA kit, and libraries were sequenced using an Illumina HiSeq 2500, to a depth of 25-50 million 50 bp single end reads per sample.  Before mapping, adapter sequences were removed with Trimmomatic/0.32 (Bolger et al., 2014), and then trimmed raw sequencing reads were aligned to the UCSC mouse reference genome mm9 assembly (http://ccb.jhu.edu/software/tophat/igenomes.shtml) with TopHat2/2.0.12 (Kim et al., 2013; Trapnell et al., 2009), and were then counted with HTSeq/0.6.1 (Anders et al., 2015).  Sequence quality was evaluated before and after read mapping with FastQC/0.11.3 (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/), and mapping rates ranged from 85%-99%.  Transcripts with low levels of expression in XEN and iXEN cell lines were filtered out across all samples by removing genes that did not have at least 10 counts per million (cpm) in at least 3 samples across XEN and iXEN cell lines.  Differential gene expression analysis between XEN and iXEN lines was then performed on the filtered transcripts with edgeR (Robinson et al., 2010; Robinson and Smyth, 2007, 2008), for each culture medium (see main text) in R version 2.15.1 (R Core Team 2012).  Gene annotations were performed using MGI (http://www.informatics.jax.org/batch), and GO-term enrichment was evaluated using the MGI Gene Ontology Term Finder (http://www.informatics.jax.org/gotools/MGI_Term_Finder.html).  Functional Annotation Clustering of associated KEGG pathway terms (Ogata et al., 1999) was performed with  43 DAVID 6.7 (Huang et al., 2009a, b), using default parameters.  Raw and processed RNA sequencing files used in this study will be archived and available from the Gene Expression Omnibus database (GEOACC# pending).  XEN/iXEN in vitro differentiation  In vitro differentiation followed previously described techniques (Artus et al., 2012; Paca et al., 2012).  Culture dishes were treated with Poly-L-ornithine (Sigma) for 30 minutes at room temperature, and then with Laminin (Sigma) at a concentration of 0.15 "g/cm2.  XEN and iXEN cells were plated at a density of 20,000 cells/well of a 24-well dish in N2B27 Medium [50% DMEM-F12 (Invitrogen) + 50% Neural Basal Medium (Invitrogen) + N2 Medium (Invitrogen, 100x) + B27 (Invitrogen, 50x) + Pen/Strep (10,000 units each), beta-mercaptoethanol (55 mM)], and were cultured overnight at 37¡C and 5% CO2.  On days 2, 4, and 6, the culture medium was replaced with fresh N2B27 + 50 ng/"L BMP4 (R&D Systems).   iXEN/XEN/iPSC/ESC in vivo differentiation Embryo manipulation and transfers were performed as previously described (Cheng et al., 2009).  Fluorescently labeled ESCs were previously described (George et al., 2007).  Fluorescently labeled iPSCs were created by reprogramming tdTomato-expressing MEFs, described above.  Fluorescently labeled XEN lines were derived from blastocysts generated by crossing Sox17tm1(icre)Heli and Gt(ROSA)26Sortm14(CAG-tdTomato)Hze mice.  Finally, fluorescently labeled iXEN lines were derived from MEFs expressing tdTomato.  To create chimeras, ~15 fluorescently labeled cells were injected into each blastocoel of  44 unlabeled CD-1 host blastocysts, and the injected embryos were then transferred into the uterus of E2.5 pseudopregnant recipient females.  Embryos were harvested on E6.5-7.5 and examined by fluorescence microscopy.  Lineage Tracing  For sparse labeling lineage tracing, unlabeled MEFs were plated on ~100 gelatinized wells in 24-well plates, at a density of 20,000 cells/well.  Approximately 10 tdTomato-labeled MEFs (created by intercrossing Tg(CAG-cre)1Nagy and Gt(ROSA)26Sortm14(CAG-tdTomato)Hze mice) were added to each well.  Cells were then retrovirally infected with OSKM, and each well was examined 18 days later. For Sox17 lineage tracing, MEFs carrying Sox17tm1(icre)Heli and Gt(ROSA)26Sortm14(CAG-tdTomato)Hze were infected with OSKM retrovirus, as described above.  Viral Genotyping  Genomic DNA was isolated from cell lines by overnight incubation in Lysis Buffer (100 mM Tris-HCl, pH8.5 + 5 mM EDTA, 0.2% SDS, 200 mM NaCl, and 100 "g/mL Proteinase K), precipitated with an equal volume 100% isopropanol, washed with 70% ethanol, and then resuspended in water.  Approximately 800 cellsÕ worth of DNA was used for each qPCR to determine absolute copy numbers of O, S, K, and M.  Primers spanned cDNA and viral backbone (see Primers & Oligos), and pMXs plasmids were used to generate standard curves.    45 shRNA Cloning and Testing  Plasmids encoding multiple Gata6, Gata4, Sox17, and Sox7 shRNAs (sequences from Open Biosystems, see shRNA Table) were created by synthesizing oligos, which were then cloned into pLKO.1-TRC cloning vector (Addgene).  Knock down efficiency was tested by transfection of XEN cells, and RNA was harvested 48 hours later to assess knockdown efficiency by qPCR.  shRNAs producing the strongest knockdown were then PCR amplified from pLKO.1-TRC using 5Õ-TCAGCTGGATCCATATATCTTGTGGAAAGGACGAAACA-3Õ  and 5Õ-GGTGCAGCGGCCGCAGTGGATGAATACTGCCATTTGTC-3Õ primers, and the PCR fragment was then cloned into the pMXs vector for retroviral production. Viral particles were quantified by qPCR using standard curves, as described above.  Proximity  After performing OSKM retroviral reprogramming on CD-1 MEFs, images were taken of all iXEN and iPSC colonies in each well.  Then, using ImageJ, distances between the edges of iXEN and iPSCs were measured.  Statistical Analyses Unless otherwise stated, T-tests were performed for pairwise comparisons, and ANOVA for multiple pairwise comparisons.     46 Section 3.  Results iXEN cells display XEN cell morphology and gene expression   We infected mouse embryonic fibroblasts (MEFs) or adult tail tip fibroblasts (TTFs) with retroviruses, carrying Oct4, Sox2, Klf4, or cMyc (OSKM) using an established protocol (Takahashi and Yamanaka, 2006). After 18 days of OSKM infection, we observed colonies that were small and domed, with smooth boundaries (Fig. 2.1A), and could be propagated as stable iPSC lines (16/28 colonies). In addition, we noted colonies that were large and flat, with ragged boundaries (Fig. 2.1A), and roughly three times more abundant and three times larger than presumptive iPSC colonies (Fig. 2.1B). These colonies could be detected as early as six days after OSKM infection (Fig. 2.6A). Below, we demonstrate extensive similarity between blastocyst-derived XEN cell lines and the MEF-derived cell lines that we hereafter refer to as induced XEN (iXEN) cells.  We manually isolated putative iXEN colonies and cultured these in ESC medium without LIF (incomplete ESC medium) or in XEN cell medium, which includes FGF4 and HEPARIN, because both media support the expansion of blastocyst-derived XEN cells (Kunath et al., 2005). Most iXEN colonies that were picked could be expanded (40/51 colonies) and maintained a XEN cell morphology, growing as individual, dispersed, and apparently motile cells in either medium (Fig. 2.1C). A minority of non-iPSC colonies picked (11/51 colonies) displayed a mesenchymal, fibroblast-like appearance (not shown), reminiscent of partially reprogrammed or transformed cells (Buganim et al., 2012; Meissner et al., 2007; Mikkelsen et al., 2008).  47  To confirm the iXEN phenotype at the molecular level, we first evaluated expression of key endodermal markers, including GATA6, GATA4, SOX17, SOX7, and PDGFRA (Artus et al., 2011; Chazaud et al., 2006; Niakan et al., 2010; Plusa et al., 2008), which were expressed to a similar degree in both cell types (Fig. 2.1D and 2.6B, C). Notably, NANOG was not detected in iXEN cells (Fib. 2.6C), indicating that iXEN cells are distinct from F-class (ÔfuzzyÕ) cells, which exist in a state of alternative pluripotency (Tonge et al., 2014). These observations support the conclusion that iXEN cells express key regulators of XEN cell fate.  Finally, we compared iXEN and XEN cell transcriptomes by RNA-sequencing of independently derived cell lines, cultured in either medium, as well as MEF cell lines. Multidimensional Scaling Analysis (MDS) of the top 100 differentially expressed genes showed that iXEN and XEN cell transcriptomes are more similar to each other than to MEF cell lines, regardless of the culture medium (Fig. 2.1E). Comparing XEN to iXEN cell lines, we observed significant (FDR < 0.05) differences in the expression levels of few (146) genes between XEN and iXEN cells cultured in incomplete ESC medium, and even fewer (16) gene differences in XEN cell medium (Fig. 2.1F). Expression of OSKM was not detected in iXEN cells, consistent with transgene silencing, and indicating that iXEN cells do not depend on continued expression of OSKM. Pathway and GO term analysis of the differentially expressed genes identified deficiencies in expression of oxidative phosphorylation and glutathione metabolism genes in iXEN cells cultured in incomplete ESC medium (Table S1), which could indicate deficient iXEN proliferation in the absence of growth factor. No pathways were significantly enriched among the differentially expressed genes when iXEN cells had been cultured in XEN cell medium.  48 We conclude that iXEN cells are very similar to XEN cell lines, and XEN cell medium better supports conversion of MEFs to XEN-like cells, consistent the role of FGF4 signaling in promoting primitive endoderm development (Chazaud et al., 2006; Kang et al., 2013; Nichols et al., 2009; Yamanaka et al., 2010).   MEF-derived XEN cells exhibit stem cell properties  Next, we evaluated the self-renewal and multipotency of iXEN cell lines. In terms of self-renewal, iXEN cells could be passaged more than 35 times in either medium (not shown). However, iXEN cells grew more slowly than XEN cells in incomplete ESC medium than in XEN cell medium (Fig. 2.2A), consistent with our predictions based on transcriptional profiling. Because Leukemia Inhibitory Factor (LIF) supports the expansion of totipotent ESCs that possess XEN-like properties (Morgani et al., 2013), we also examined the proliferation rate of iXEN cells in ESC medium with LIF, but iXEN cells did not proliferate as rapidly as XEN cells in this condition (Fig. 2.2A).   Next, we evaluated the multipotency of iXEN cells. Blastocyst-derived XEN cells are multipotent because they can differentiate into visceral or parietal endoderm (Artus et al., 2012; Kunath et al., 2005; Paca et al., 2012). We first performed the visceral endoderm differentiation assay (Fig. 2.2B), and observed that iXEN cell lines were able to differentiate to visceral endoderm, evidenced by formation of epithelial-like colonies, upregulation of E-cadherin (CDH1) at cell boundaries (Fig. 2.2C), and upregulation of visceral endoderm markers (Fig. 2.2D). Finally, we examined the in vivo developmental potential of iXEN cells by blastocyst injection of fluorescently labeled iXEN cells (Fig. 2.2E). Fluorescently labeled XEN, ES, and iPSC lines were used in parallel positive  49 controls. Chimeras were transferred to recipient female mice to allow postimplantation development. In control chimeras, examined between embryonic day (E) 7.5-8.5, ESC and iPSCs had each contributed to the epiblast lineage, while XEN cells had contributed to parietal endoderm (Fig. 2.2F and Fig. 2.7), with the expected degree and frequency (Kunath et al., 2005; Wamaitha et al., 2015). iXEN cells cultured in incomplete ESC medium did not contribute to chimeras, even though XEN cells cultured in incomplete ESC medium did. However, iXEN cell lines cultured in XEN cell medium contributed to parietal endoderm (Fig. 2.2F, G) to a similar extent as XEN cells, indicating that iXEN cells have XEN cell-like developmental potential in vivo. These observations underscore the importance of FGF4/HEP for acquisition of complete XEN cell functionality. These results also indicate that iXEN cells are distinct from totipotent cells isolated from pluripotent cell cultures (Canham et al., 2010; Macfarlan et al., 2012; Morgani et al., 2013), because iXEN cells did not contribute to epiblast or trophoblast lineages.   iXEN cells are not derived from pre-existing iPSC colonies  In monolayers, ESCs can differentiate to primitive endoderm at low frequency in the presence of LIF (Niakan et al., 2010), or at high frequency in the absence of LIF and presence of Retinoic Acid and Activin (RA/Activin) (Cho et al., 2012; Niakan et al., 2013). These observations raised the question as to whether iXEN cells were derived from iPSCs. However, this possibility seemed unlikely for several reasons. First, iXEN cells were derived in the presence of LIF and absence of RA/Activin. XEN-like cells that arise in these conditions are rare and are located adjacent to, or encircling, the ESC colony from which they are derived (Niakan et al., 2010). However, iXEN colonies were  50 often located far (#50 "m) from the nearest iPSC colony (29/48 colonies). In addition, we routinely observed iXEN cell colonies on the sixth day of OSKM infection, which is before we observed iPSCs. These observations argue that iXEN cells are derived from MEFs in parallel to iPSCs.   To query the cellular the origins of iXEN cells experimentally, we infected around ~100 wells containing around ten labeled MEFs per 20,000 unlabeled MEFs with OSKM retroviruses (Fig. 2.3A). Because MEFs were sparsely labeled, we predicted that labeled iPSC or iXEN cell colonies would be relatively rare, enabling us to discern iXEN origins. For example, if iXEN cells were derived from iPSC colonies, then labeled iXEN cell colonies would always be coincident in wells with labeled iPSC colonies. Alternatively, if iXEN cells were derived from MEFs, then labeled iXEN cell colonies would be observed in wells lacking labeled iPSCs colonies. As expected, most of the wells (85/93 wells) contained unlabeled colonies after 18 days of OSKM infection (Fig. 2.3A). Of the wells containing labeled colonies, most (7/8) contained one labeled iXEN cell colony no labeled iPSC colonies. Only in one well did we observe a labeled iXEN cell colony and a labeled iPSC colony (1/93 wells). These observations indicate that, while iPSCs could give rise to XEN-like cells, the majority of iXEN cells are not derived from iPSC colonies. We do not exclude the possibility that iXEN cells could be derived from a pre-iPSC like cell, or from a cell that transiently expresses pluripotency genes (Bar-Nur et al., 2015; Maza et al., 2015). Regardless, the presence of iXEN cells in conventional reprogramming experiments could influence the interpretation of studies of partially reprogrammed cells, and could influence interpretation of studies aimed at characterizing totipotent iPSCs (Abad et al., 2013; De Los Angeles et al., 2015).  51  Our sparse labeling assay strongly suggests that a majority of iXEN are not derived from iPSCs, but we decided to test this another way using lineage tracing.  We reprogrammed MEFs, carrying CreER recombinase under the control of the Sox2 promoter (Arnold et al., 2011) and a CRE-sensitive tdTomato reporter (Madisen et al., 2010).  We predicted that if iXEN were derived from iPSCs, then they would express Sox2, a pluripotency marker, during reprogramming and iXEN would be tdTomato positive.  After OSKM infection and culture in the presence or absence of 4-hydroxy-tamoxifen, to enable labeling, we stained the cells on day 20 with NANOG and SOX17 and found that a majority (~65%) of SOX17 positive cells were tdTomato negative (Figure 2.5).  This suggests that most iXEN are not derived from pluripotent cells.  However, we found that ~20% of NANOG-positive cells were tdTomato negative, which suggests that our lineage tracing system was not robust enough to label all pluripotent cells (Fig 2.5).  Thus, we could not use this data to draw any definitive conclusions about the origins of iXEN cells.  All four reprogramming factors induce XEN cell fate  Next, we investigated whether iXEN and iPSCs are induced by similar or different combinations of OSKM. We evaluated the genotypes of independently derived iXEN and iPSC lines to compare copy numbers of each reprogramming factor by quantitative PCR (qPCR) analysis of genomic DNA. We observed that the OSKM copy numbers tended to be lower for iXEN than iPSC lines, although the average copy numbers did not differ significantly (Fig. 2.3B). To determine whether the trend was meaningful, we sought to overexpress uniform levels of OSKM by using MEFs by carrying a doxycycline  52 (dox)-inducible OSKM cassette, containing one copy of each reprogramming factor (Carey et al., 2010). We obtained both iPSC and iXEN cell colonies from these MEFs with increased efficiency (Fig. 2.3C), indicating that all four reprogramming factors induce formation of iXEN cells.  GATA6 and GATA4 facilitate iXEN, but not iPSC, cell formation  Several groups reported that cells undergoing reprogramming express endodermal genes, but the role of this gene expression is unclear because endodermal genes have been proposed to promote (Shu et al., 2013; Shu et al., 2015) and antagonize (Mikkelsen et al., 2008; Serrano et al., 2013) pluripotency. Endodermal genes are reportedly upregulated prior to pluripotency genes in cultures of MEFs undergoing small molecule reprogramming, leading to the conclusion that endodermal genes are expressed in cells that are becoming pluripotent (Hou et al., 2013). Similarly, our qPCR analysis of gene expression in MEFs undergoing retroviral OSKM reprogramming showed that endodermal genes were detected throughout the course of reprogramming (Fig. 2.4A). However, it was unclear from these data whether endodermal genes were expressed in iPSC progenitors or in a distinct population. Therefore, we used flow cytometry to determine whether all NANOG-positive cells express endodermal (GATA6 or SOX17) proteins during the course of reprogramming. However, we did not detect endodermal proteins in most NANOG-positive cells at any time point examined (Fig. 2.4B and Fig. 2.8A-C). Conversely, we did not detect NANOG in most GATA6-positive or SOX17-positive cells. Rather, we detected NANOG and endodermal proteins in two largely distinct populations, which increased in size over the  53 course of reprogramming. Neither population was prevalent in MEFs undergoing mock reprogramming (Fig. 2.9A), but were both present in TTFs during OSKM reprogramming (Fig. 2.9B). These observations suggest that most iPSCs do not upregulate endodermal genes during the course of reprogramming.   Next, we used lineage tracing to determine whether iPSCs transiently express endodermal genes during reprogramming. We retrovirally reprogrammed MEFs, carrying CRE recombinase under the control of the Sox17 promoter (Liao et al., 2009) and a CRE-sensitive tdTomato reporter (Madisen et al., 2010). We predicted that if iPSCs had expressed Sox17 during reprogramming, then iPSCs would be tdTOMATO-positive. We observed that, after OSKM infection, almost all pluripotent (SSEA1-positive) cells were tdTOMATO-negative (Fig. 2.4C and 2.8D), indicating that most pluripotent cells had not expressed Sox17 during reprogramming. Taken together, our observations indicate that, during reprogramming, endodermal genes are upregulated in cells that are distinct from those becoming pluripotent.   Finally, we tested the requirement for endodermal genes in the formation of iXEN cells, with the expectation that knocking down endodermal genes would result in a decrease in the proportion of iXEN cells. We first confirmed substantial knock down of Gata6, Gata4, Sox17, or Sox7 in established XEN cells by transfection of shRNA-encoding plasmids (Fig. 2.8E). We then introduced individual shRNAs retrovirally during retroviral OSKM reprogramming of MEFs. We observed that retroviral knockdown of Gata6 or Gata4 led to a two-fold decrease in the number of iXEN colonies obtained (Fig. 2.4D), indicating that these genes are required for iXEN cell reprogramming. Notably, knock down of Gata6 also led to a significant increase in the number of iPSC  54 colonies. These results indicate that endodermal gene expression, or formation of iXEN cells, interferes with the formation of iPSCs. We propose a model in which OSKM activity is influenced by the cellular context, and that fibroblast heterogeneity contributes to different outcomes during reprogramming inducing either pluripotency or endodermal fates (Fig. 2.4E).  We anticipate that identification of additional mechanisms regulating the balance between iXEN and iPSC fates will inform future efforts to characterize the molecular steps of reprogramming at the single cell level, and facilitate the streamlined establishment of new genetic models of reproductive disorders.  Section 4.  Discussion  Previous investigations focused on identifying barriers to pluripotency, cell fate, and the molecular mechanisms of OSKM reprogramming have largely ignored the fate of cells that do not become iPSCs.  Here, I showed that an extraembryonic cell type, iXEN, is generated in parallel to iPSCs during transgene induced OSKM reprogramming.  My analyses demonstrate that iXEN are nearly identical to embryo-derived XEN at the morphological, transcriptional, and developmental levels.  Notably, both time course and lineage tracing analyses show that the vast majority of pluripotent cells do not express Sox17, a XEN marker, at any point during OSKM reprogramming.  This suggests that XEN genes are expressed in a group of cells that are distinct from pluripotent cells during OSKM reprogramming.  Further, I show that inhibition of XEN gene expression (Gata6 and Gata4) via shRNA inhibits formation of iXEN and, in the case of Gata6, improves iPSC reprogramming efficiency.  My work suggests that XEN gene expression during transgene induced OSKM reprogramming is a barrier to the  55 acquisition of pluripotency.  This work is an important first step toward understanding the relationship between iXEN and iPSCs and the molecular mechanisms that govern their interactions.  Comparison of Parenti et al. and Zhao et al.  Recently, Zhao et al. reported that XEN-like cells are generated from MEFs during the first phase of chemical reprogramming to iPSCs, which relies on small molecule treatment to reverse development.  In line with my findings, Zhao et al showed that XEN-like cells are transcriptionally and developmentally similar to embryo derived XEN cells.  However, Zhao et al suggest that XEN-like cells are an intermediate cell type that eventually give rise to iPSCs, and that XEN-like cells are not produced during transgene induced OSKM reprogramming.  Last, Zhao et al suggest that  inhibition of XEN gene expression during reprogramming increases iPSC reprogramming efficiency.  Below, I discuss the salient differences between our study and Zhao et al, and offer explanations for our diverging conclusions.  The first key difference between our findings and those of Zhao et al. is that Zhao et al. hypothesize that XEN-like cells are a transient cell type that eventually give rise to iPSCs.  Zhao et al used FACS to isolate EpCAM positive cells, which they describe as a XEN marker, after the first stage of chemical reprogramming and found that the EpCAM positive population produced >20-fold the number of iPSC colonies relative to the EpCAM negative population.  However, previous work shows that EpCAM is not a XEN specific marker and, is in fact, expressed at a higher relative level in pluripotent cells relative to XEN cells (Rugg-Gunn et al., 2012).  This suggests that EpCAM is not a XEN  56 marker and that Zhao et al., may have improved iPSC reprogramming efficiency by selecting for cells that were already committed to the iPSC lineage.  By contrast, we used lineage tracing to test whether iXEN are a transient cell type that give rise to iPSCs and found that pluripotent cells do not express Sox17, a key XEN transcription factor, at any point during transgene induced OSKM reprogramming.  Thus, our work shows that cells expressing endodermal genes (iXEN) are not a transient cell type that give rise to iPSCs, but in fact are made in parallel to iPSCs.  The second difference between our findings and those of Zhao et al. is that Zhao et al. suggest that iXEN/XEN-like cells are made during chemically induced reprogramming and not during transgene induced OSKM reprogramming.  Zhao et al. compared expression of key XEN markers (Gata6, Gata4, Sox17, Foxa2, and Sox7) during chemical reprogramming over 44 days and OSKM transgene reprogramming over 12 days using a qRT-PCR time-course analysis.  My qRT-PCR analysis over 20 days shows that XEN genes (Gata6, Gata4, Sox17, and Sox7) are induced during OSKM transgene reprogramming, albeit at lower levels than those reported during chemical reprogramming.  However, qRT-PCR cannot be used to determine which cells are expressing each marker or at what level.  For this reason, I used FACS, which allows us to analyze each cell individually, over 20 days of reprogramming and found that XEN genes are expressed by a subset of the population of cells undergoing reprogramming.  Further, the proportions of cells that express XEN markers (GATA6 and SOX17) or pluripotency markers (NANOG) are roughly equal, with very few cells expressing both.  ItÕs possible that Zhao et alÕs use of qRT-PCR alone, instead of FACS,  57 was not sensitive enough to detect the cells expressing XEN markers during OSKM transgene reprogramming.  The last difference between our findings and those of Zhao et al. is that Zhao et al. reports that shRNA-mediated knockdown of XEN genes (Gata6, Gata4, and Sox17) during chemical reprogramming reduced the number of XEN-like and iPSCs cells generated.  My shRNA experiments show that knockdown of Gata6 or Gata4 during transgene-induced OSKM reprogramming decreases the number of iXEN made.  Further, I found that Gata6 knockdown increases iPSC reprogramming efficiency by ~1.6x.  My results, and those presented by others (Serrano et al., 2013), disagree with Zhao et al. and show that XEN gene expression is a barrier to the acquisition of pluripotency during reprogramming.  My findings and those presented by Zhao et al. are the first to report the formation of an extraembryonic cell type during transgene induced OSKM and chemical reprogramming.  How, then, do we disagree on so many key points?  On the first point, that XEN-like cells are a transient population that give rise to iPSCs, Zhao et al. did not directly analyze the fate of XEN-like cells.  In order to say with certainty that these cells are/are not a transient cell type that give rise to iPSCs, an approach that allows them to track the fate of each XEN-like cell is required.  Lineage tracing analysis would shed light on the fate of XEN-like cells during chemical reprogramming.  We attempted to replicate chemical reprogramming following the protocol described in a previous paper by the Deng group (Hou et al., 2013), but have been unable to generate iPSCs or XEN-like cells in 4 different attempts.    58  On the second point, that XEN fate is only a product of chemical reprogramming, it seems likely that Zhao et alÕs use of qRT-PCR was not the ideal method to assay the presence of cells expressing XEN markers.  We used FACS to show that a population of cells is made in parallel to iPSCs during transgene induced OSKM reprogramming which express XEN markers (GATA6 and SOX17).  Further, a majority of these cells do not express the pluripotency marker NANOG.    Finally, the third point of contention, that XEN gene expression promotes/inhibits iPSC formation, a simple explanation is that chemical reprogramming and OSKM transgene reprogramming are fundamentally different.  However, a close examination of the chemical reprogramming protocol employed by Zhao et al. shows that they supplement their reprogramming medium with FGF4, a potent mitogen (Kosaka et al., 2009; Chapter 3 of this thesis).  It is possible that in the presence of mitogens, inhibition of PE gene expression may not have the same influence iPSC/iXEN reprogramming.  I explore this possibility in greater detail in the next chapter of this thesis.  What role does MEF heterogeneity play in the establishment of iXEN and iPSCs?  MEFs have been used in the majority of reprogramming studies because they are an easily attainable cell type that can be expanded in culture and were initially thought to be a fairly homogeneous population.  However, recent work suggests that a given population of MEFs is not homogeneous in terms of an individual cellÕs expression profile and developmental potential (Driskell et al., 2009; Singhal et al., 2016).  Discovery of heterogeneity in MEF populations leads us to ask how heterogeneity impacts iPSC reprogramming efficiency, a key focus of the field.    59  Our analysis revealed that before reprogramming had started, a subset of the MEF population (~3%) were already GATA6-positive.  This observation raises the possibility that a group of cells are primed to become iXEN.  An interesting next step would be to isolate GATA6-positive cells before reprogramming and characterize their response to OSKM transgene reprogramming relative to GATA6-negative cells.  If Gata6 expression predisposed cells towards an iXEN fate then this sub-population of cells should give rise to a greater number of iXEN compared to GATA6-negative cells.  This could overcome a barrier in reprogramming.  How do iXEN and cXEN compare to embryo-derived XEN?  Our work demonstrates that iXEN are highly similar to XEN at the developmental, morphological, and global transcriptional levels.  A number of other groups took an alternate approach and found that ESCs can be converted to XEN cells (cXEN) through transcription factor overexpression or culture in Retinoic Acid and Activin (Fujikura et al., 2002; Shimosato et al., 2007; Niakan et al., 2010; Cho et al., 2012; McDonald et al., 2014).  However, a direct comparison of iXEN and cXEN has not been performed and it is unclear whether iXEN, cXEN, or neither, are most similar to embryo-derived XEN cells.  iXEN and cXEN cells offer an attractive tool to study the role and regulation of XEN genes in establishing XEN fate, but the validity of future studies relies on the knowledge that the cell type used is identical to embryo-derived XEN cells.  Recently, two groups examined induced trophoblast stem cells (iTSCs) from fibroblasts, embryo derived TSCs, and TSC-like cells made from ESCs with transcription factor overexpression, at the transcriptional and epigenetic levels (Kubaczka at al., 2015;  60 Benchetrit et al., 2015; Parenti and Ralston, 2015).  The groups found that iTSCs made from fibroblasts were more similar to embryo-derived TSCs than those generated from ESCs in their global epigenetic profiles and expression of key TSC genes.  Their combined work suggests that greater epigenetic barriers exist between lineages of the early embryo than exist between those lineages and fibroblasts, making it easier to derive cells that are highly similar to embryo-derived TSCs from somatic cells rather than ESCs.  In terms of development, this hypothesis may suggest that greater epigenetic barriers exist between lineages of the early embryo as a defense against developmental defects associated with lineage switching, which is expected.    The iTSC studies demonstrate the need for a detailed comparison of iXEN cells, cXEN cells, and embryo-derived XEN cells at the transcriptional, epigenetic, and developmental levels.  After determining which cell type is most similar to embryo-derived XEN, we can begin to answer important questions about how XEN genes are involved in the acquisition and maintenance of XEN identity with cells that are nearly identical to embryo derived XEN.  Can iXEN contribute to Visceral Endoderm in vivo?  Visceral Endoderm (VE) is a derivative of the primitive endoderm that lines the distal portion the embryonic compartment in the blastocyst on E5.5 of development and plays a number of key roles in the embryo including neural and cardiac patterning.  On E6.5, the anterior visceral endoderm (AVE) secretes signaling molecules including Lefty, a Nodal inhibitor, and Cer1, a Wnt and BMP inhibitor, which pattern the underlying epiblast (Perea-Gomez et al., 2002; Kimura-Yoshida et al., 2005).  The  61 epiblast cells in the anterior region that receive the signal from the AVE form the head of the embryo and anterior neural tissue (Thomas and Beddington, 1996; Rhinn et al. 1998).  The epiblast cells on the opposite side of the embryo do not receive an anteriorizing signal from the AVE, form the primitive streak and, in the process, the anterior-posterior axis of the embryo is established.  Further, after the primitive streak is formed, a subset of cells in the AVE express BMP2 and have recently been shown to direct the formation of the heart (Madabhushi and Lacy, 2011).  Taken together, these studies detail the importance of the VE in patterning the neural and cardiac cell fate in the gastrulation stage embryo.  The well-established role of VE in embryo patterning and differentiation has important consequences for regenerative medicine as well.  Recently, various groups co-cultured ESCs with VE or VE-like cells to improve ESC differentiation into cardiomyocytes, but many of the mechanisms at work are poorly understood (Arai et al., 1997; Mummery et al., 2003; Nijmeijer et al., 2009).  XEN and iXEN cells can be differentiated into VE-like cells by exposing them to BMP4 or Nodal for 6 days on laminin. (Paca et al., 2011; Artus et al., 2011; Kruithof-de Julio et al., 2011).  iXEN cells, which could potentially be derived from conditional mutant backgrounds, are thus an ideal tool to improve our understanding of the mechanism by which VE co-culture with ESCs improves differentiation.      62 Can iXEN cells be derived from human cells and used as a model to study human extraembryonic development?  Research aimed at understanding the extraembryonic endoderm and its derivatives in the human blastocyst is challenging from both technical and ethical perspectives.  XEN cells offer a way around many of these limitations, but, there are no reports that XEN cells have been derived from human embryos.  Without human XEN cell lines, we are forced to rely on mouse models, which while they have provided useful information, are not the preferred system to study human extraembryonic development.    We report that stable iXEN lines can be established after OSKM transgene reprogramming from mouse fibroblasts.  Perhaps stable iXEN cells could be derived by reprogramming human cells as well.  Derivation of iXEN cells from human cell lines would open up new avenues of investigation, and would provide a tool to improve our understanding of the signaling pathways at work in human embryonic development, without having to use embryos.   Acknowledgements We thank Jason Knott, Beronda Montgomery, David Arnosti, and Monique Floer for discussion. This work was supported by CIRM TG2-01157 to AP, R03 HD077112 to KW, R01 HD075093 to KL, MSU AgBioResearch and Michigan State University, and R01 GM104009 to AR.     63             APPENDIX            64 Figure 2.1. OSKM-induced extraembryonic endoderm (iXEN) cells A) Fibroblasts were reprogrammed using standard protocols (Takahashi and Yamanaka, 2006), and examined 18 days after OSKM infection. B) Frequencies at which iPSC and iXEN cell colonies were observed. MEFs = mouse embryonic fibroblasts, TTFs = adult tail tip fibroblasts, error bars = standard error (s.e.) among 3 reprogramming experiments, each. C) Morphology of iXEN cells is similar to that of blastocyst-derived XEN cells. D) Flow cytometric analysis shows that endodermal proteins are detected in essentially all XEN and iXEN cells (representative of 3 independently derived XEN and iXEN cell lines; brackets, see Fig. 2.6B). E) Multi-dimensional Scaling analysis of top 100 differentially expressed genes shows that iXEN and XEN cell lines are highly similar, and dissimilar to the MEFs from which iXEN lines were derived. F) Volcano plots of all detected genes identify genes whose average expression level differs significantly (FDR   65 Figure 2.1 contÕd > 0.05, red dotted line) between three independently derived XEN and iXEN cell lines, for each cell culture medium. See also Table S1.                                             66  Figure 2.2. iXEN cells are self-renewing and multipotent A) Rates of proliferation for XEN and iXEN cell lines grown in each cell culture medium, error bars = s.e. among 3 XEN and iXEN cell lines. B) Overview: XEN cells cultured in N2B27 with BMP4 for 6 days differentiate to visceral endoderm. C) Immunofluorescence shows that CDH1 localizes to cell junctions in iXEN and XEN cells after the differentiation assay, but not in control cells (representative of 5 independent cell lines, DNA = DAPI, scale bar = 100 "m). D) qPCR analysis of visceral endoderm gene expression in BMP4-treated cell lines, relative to untreated cell lines cultured in N2B27 alone, error bars = s.e. for duplicate assays and quadruplicate qPCRs, each. E) Overview: blastocysts were   67 Figure 2.2 contÕd injected with fluorescent cell lines, transferred to recipient females, and then dissected at E7.5-8.5. F) Summary of chimera results. G) Confocal image of a typical iXEN cell chimera (scale bar = 100 "m; see Fig. 2.7 for control chimeras).                                            68  Figure 2.3. OSKM induce iXEN fate in MEFs A) Overview and results: Around 100 wells of sparsely labeled MEFs were infected with OSKM, and the coincidence of fluorescently labeled colonies determined. Most labeled iXEN cells arose in wells with unlabeled iPSCs, indicating that iXEN cells are not derived from pre-existing iPSC colonies (representative of 2 experiments). B) Absolute qPCR measurement of OSKM copy number in gDNA from independent XEN and iXEN cell lines. C) Comparison of the frequency of iXEN colonies 18 days after retroviral delivery of OSKM or dox treatment of a dox-inducible OSKM cassette, error bars = s.e. for 2 cell lines and 4 experiments, each; see also Fig. 2.8.            69 Figure 2.4. MEF-expressed endodermal genes promote iXEN cell fate A) Expression of endodermal (Gata6, Gata4, Sox17, and Sox7) and pluripotency (Nanog, Lin28, Utf1, and Gdf3) genes during the course of retroviral OSKM infection of MEFs, as measured by qPCR, showing that both classes of genes are upregulated on the population level, error bars = s.e. among triplicate reprogramming experiments and quadruplicate qPCRs. B) Flow cytometry analysis of the expression of endodermal and pluripotency genes on a cell-by-cell level during the course of OSKM infection of MEFs, showing that cells that express primitive endoderm and pluripotency genes are largely distinct, error bars = s.e. among duplicate experiments. C) Overview and summary: Sox17Cre lineage tracing and flow cytometry analysis of cells after 20 days of OSKM infection, showing that the vast majority of pluripotent (SSEA1-positive) cells never expressed Sox17, error bars = s.e. among triplicate reprogramming experiments (raw data provided in Fig. 2.9). D) Proportions of iPSC and iXEN cell colonies after coinfection of OSKM and shRNA constructs indicated, error bars = s.e. among triplicate   70 Figure 2.4 contÕd reprogramming experiments (Fig. 2.9 shows knock down efficiencies). E) Model proposing that OSKM can push cells toward either iPSC or iXEN cell fate, depending on the availability of GATA6.                                            71  Figure 2.5. Sox2-CREER lineage tracing suggests that most iXEN are not derived from iPSCs A) FACS plots showing NANOG vs tdTOMATO indicate that NANOG positive cells in untreated samples were mostly tdTOMATO negative.  Samples treated with Tamoxifen show that 80% of NANOG positive cells are tdTOMATO positive, however 20% are tdTOMATO negative.  This indicates that the Sox2 lineage tracing system is not sensitive enough to label all pluripotent cells.  B) FACS plots show that very few SOX17 positive cells are tdTOMATO positive after treatment with Tamoxifen.  Suggests that most iXEN (SOX17 positive) are not derived from iPSCs.            72  Figure 2.6. Comparison of iXEN and XEN cell lines A) iXEN-like colonies visible six days after OSKM infection, scale bar = 200 "m. B) Proportion of cells within regions gated in Fig. 2.1D, error bars = s.e. among four independent cell lines. C) Immunofluorescence analysis of cell fate markers in XEN and iXEN cells, scale bar = 100 "m.                   73  Figure 2.7. Developmental contributions of stem cell lines in chimeras Fluorescently labeled ESCs and iPSCs chimerize the epiblast, while XEN cells contribute to parietal endoderm, scale bars = 100 "m.  See Fig. 2.2F for quantification.                       74  Figure 2.8 Flow cytometry and gene knockdown data A) Positive and negative control experiments, as indicated, showing that flow cytometry reagents are specific, representative of at least four experiments. B-C) Flow cytometric analyses of data shown in Fig. 2.4B, representative of duplicate reprogramming experiments. D) Flow cytometric analyses of Sox17Cre lineage tracing experiment shown in Fig. 2.4C on day 18 after OSKM infection, representative of triplicate reprogramming experiments. E) qPCR analysis of XEN cells with and without shRNA-mediated knock-down of each indicated gene, error bars = s.e. among triplicate knockdown experiments.     75  Figure 2.9. Endodermal gene expression during TTF reprogramming A) Comparison of percent marker-positive cells on day 0 of reprogramming. B) Comparison on day 20 of reprogramming. Error bars = s.e. among duplicate reprogramming experiments.                  76 Table 2.1. Primers and Oligos Primers for Viral Particle Quantification  Gene Forward Primer (5'-3') Reverse Primer (5'-3') Pou5f1 GAACCTGGCTAAGCTTCCAA ACTTCCTTTCCACTCGTGCT Sox2 AACCAAGACGCTCATGAAGAA GCTGTAGCTGCCGTTGCT Klf4 CTGAACAGCAGGGACTGTCA GTGTGGGTGGCTGTTCTTTT Myc GCCCAGTGAGGATATCTGGA ATCGCAGATGAAGCTCTGGT shRNA CAACCCGGTAAGACACGACT CCGGATCAAGAGCTACCAAC Quantitative RT-PCR Primers Gene Forward Primer (5'-3') Reverse Primer (5'-3') Actb CTGAACCCTAAGGCCAACC CCAGAGGCATACAGGGACAG Afp AAGAAAAACTCTGGCGATGG CAGCAGCCTGAGAGTCCATA Apoa1 GTGGCTCTGGTCTTCCTGAC ACGGTTGAACCCAGAGTGTC Apoa2 TTGATGGAGAAGGCCAAGAC CGGTTTCTCCTCAAGGTTCA Apoe CAGAGCTCCCAAGTCACACA CCCGTATCTCCTCTGTGCTC Cldn6 AGACAAAGCTGACCGAGCAC GCTCTGAACCACACAGGACA Gata4 CTGGAAGACACCCCAATCTC ACAGCGTGGTGGTGGTAGT Gata6 ATGCTTGCGGGCTCTATATG GGTTTTCGTTTCCTGGTTTG Gdf3 GATTGCTTTTTCTGCGGTCTGT CCAAGTTCTTCAGTCGGTTGCT H19 AGAGGACAGAAGGGCAGTCA CAGACATGAGCTGGGTAGCA Lgals TGAACATGAAACCAGGGATG CTCTGACCCTGGACTGAAGC Lin28 CTGCTGTAGCGTGATGGTTGA CCACCCAATGTGTTCTATTGCA Nanog ATGCCTGCAGTTTTTCATCC GAGGCAGGTCTTCAGAGGAA Sox17 CTTTATGGTGTGGGCCAAAG GCTTCTCTGCCAAGGTCAAC Sox7 GGCCAAGGATGAGAGGAAAC TCTGCCTCATCCACATAGGG Spink3 CTTTGGCCCTGCTGAGTTTA TTCGAATGAGGACAGGCTCT Tnnc1 CAGCAAAGGGAAGTCTGAGG TAGTCAATTCGGCCATCGTT Utf1 CAACCCCTAGTAGATTCGAGACGAT GGCAGGTTCGTCATTTTCC Cell Genotyping Primers Gene Forward Primer (5'-3') Reverse Primer (5'-3') Pou5f1 CCAATCAGCTTGGGCTAGAG GGCAGAGGAAAGGATACAGC Sox2 TACCTCTTCCTCCCACTCCA CGCTCAGCTGGAATCTCACC Klf4 ACTCACACAGGCGAGAAACC GCCCACCCTTACATCCACTA Myc CCCCAAGGTAGTGATCCTCA CGCTCAGCTGGAATCTCACC shRNA sequences Gene shRNA Sequence  (5'-3')   Gata4 CATCTCCTGTCACTCAGACATCTCGAGATGTCTGAGTGACAGGAGATG Gata6 CCTCGACCACTTGCTATGAAACTCGAGTTTCATAGCAAGTGGTCGAGG Sox17 GCTAAGCAAGATGCTAGGCAACTCGAGTTGCCTAGCATCTTGCTTAGC Sox7 GAGACATGGATCGCAATGAATCTCGAGATTCATTGCGATCCATGTC  77 Table 2.2. Antibodies Antigen Antibody Source SOX17 R&D Systems (AF1924) SOX7 R&D Systems (AF2766) GATA6 R&D Systems (AF1700) GATA4 Santa Cruz Biotech (sc-1237) PDGFRA (CD140a) eBioscience (17-1401-81) NANOG Reprocell (RCAB0002P-F) SSEA-1 DSHB (MC-480-c) Anti-Mouse IgG 488 Jackson Immuno Research (715-545-140) Anti-Rabbit IgG 488 Invitrogen (A10040) Anti-Rabbit IgG 647 Jackson Immuno Research (711-606-152) Anti-Goat 546 Invitrogen (A11055)                   78            REFERENCES             79 REFERENCES    Aksoy, I., Jauch, R., Chen, J., Dyla, M., Divakar, U., Bogu, G.K., Teo, R., Ng, C.K.L., Herath, W., Lili, S. and Hutchins, A.P., 2013. Oct4 switches partnering from Sox2 to Sox17 to reinterpret the enhancer code and specify endoderm. The EMBO journal, 32(7), pp.938-953.  Arai, A., Yamamoto, K. and Toyama, J., 1997. Murine cardiac progenitor cells require visceral embryonic endoderm and primitive streak for terminal differentiation. Developmental Dynamics, 210(3), pp.344-353.  Artus, J., Douvaras, P., Piliszek, A., Isern, J., Baron, M.H. and Hadjantonakis, A.K., 2012. BMP4 signaling directs primitive endoderm-derived XEN cells to an extraembryonic visceral endoderm identity. Developmental biology,361(2), pp.245-262.  Arnold, K., Sarkar, A., Yram, M.A., Polo, J.M., Bronson, R., Sengupta, S., Seandel, M., Geijsen, N. and Hochedlinger, K., 2011. Sox2+ adult stem and progenitor cells are important for tissue regeneration and survival of mice. Cell stem cell, 9(4), pp.317-329.  Banito, A., Rashid, S.T., Acosta, J.C., Li, S., Pereira, C.F., Geti, I., Pinho, S., Silva, J.C., Azuara, V., Walsh, M. and Vallier, L. (2009). Senescence impairs successful reprogramming to pluripotent stem cells. Genes & development,23(18), pp.2134-2139.  Bar-Nur, O., Verheul, C., Sommer, A.G., Brumbaugh, J., Schwarz, B.A., Lipchina, I., Huebner, A.J., Mostoslavsky, G. and Hochedlinger, K., 2015. Lineage conversion induced by pluripotency factors involves transient passage through an iPSC stage. Nature biotechnology, 33(7), pp.761-768.  Benchetrit, H., Herman, S., van Wietmarschen, N., Wu, T., Makedonski, K., Maoz, N., Tov, N.Y., Stave, D., Lasry, R., Zayat, V. and Xiao, A., 2015. Extensive Nuclear Reprogramming Underlies Lineage Conversion into Functional Trophoblast Stem-like Cells. Cell stem cell, 17(5), pp.543-556.  Canham, M.A., Sharov, A.A., Ko, M.S. and Brickman, J.M., 2010. Functional heterogeneity of embryonic stem cells revealed through translational amplification of an early endodermal transcript. PLoS Biol, 8(5), p.e1000379.  Carey, B.W., Markoulaki, S., Beard, C., Hanna, J. and Jaenisch, R., 2010. Single-gene transgenic mouse strains for reprogramming adult somatic cells. Nature methods, 7(1), pp.56-59.  Chazaud, C., Yamanaka, Y., Pawson, T. and Rossant, J., 2006. Early lineage segregation between epiblast and primitive endoderm in mouse blastocysts through the Grb2-MAPK pathway. Developmental cell, 10(5), pp.615-624.  80  Cho, L.T., Wamaitha, S.E., Tsai, I.J., Artus, J., Sherwood, R.I., Pedersen, R.A., Hadjantonakis, A.K. and Niakan, K.K., 2012. Conversion from mouse embryonic to extra-embryonic endoderm stem cells reveals distinct differentiation capacities of pluripotent stem cell states. Development,139(16), pp.2866-2877.  dos Santos, R. L., Tosti, L., Radzisheuskaya, A., Caballero, I. M., Kaji, K., Hendrich, B., & Silva, J. C. (2014). MBD3/NuRD facilitates induction of pluripotency in a context-dependent manner. Cell stem cell, 15(1), 102-110.  Driskell, R. R., Giangreco, A., Jensen, K. B., Mulder, K. W., & Watt, F. M. (2009). Sox2-positive dermal papilla cells specify hair follicle type in mammalian epidermis. Development, 136(16), 2815-2823.  Frum, T. and Ralston, A., 2015. Cell signaling and transcription factors regulating cell fate during formation of the mouse blastocyst. Trends in Genetics, 31(7), pp.402-410.  Frum, T., Halbisen, M.A., Wang, C., Amiri, H., Robson, P. and Ralston, A., 2013. Oct4 cell-autonomously promotes primitive endoderm development in the mouse blastocyst. Developmental cell, 25(6), pp.610-622.  Fujikura, J., Yamato, E., Yonemura, S., Hosoda, K., Masui, S., Nakao, K., Miyazaki, J.I and Niwa, H. (2002). Differentiation of embryonic stem cells is induced by GATA factors. Genes & development, 16(7), 784-789.  Guo, S., Zi, X., Schulz, V. P., Cheng, J., Zhong, M., Koochaki, S. H., ... & Gallagher, P. G. (2014). Nonstochastic reprogramming from a privileged somatic cell state. Cell, 156(4), 649-662.  Hou, P., Li, Y., Zhang, X., Liu, C., Guan, J., Li, H., Zhao, T., Ye, J., Yang, W., Liu, K. and Ge, J., 2013. Pluripotent stem cells induced from mouse somatic cells by small-molecule compounds. Science, 341(6146), pp.651-654.  Ichida, J.K., Blanchard, J., Lam, K., Son, E.Y., Chung, J.E., Egli, D., Loh, K.M., Carter, A.C., Di Giorgio, F.P., Koszka, K. and Huangfu, D., 2009. A small-molecule inhibitor of Tgf-$ signaling replaces Sox2 in reprogramming by inducing Nanog. Cell stem cell, 5(5), pp.491-503.   Kang, M., Piliszek, A., Artus, J. and Hadjantonakis, A.K., 2013. FGF4 is required for lineage restriction and salt-and-pepper distribution of primitive endoderm factors but not their initial expression in the mouse. Development,140(2), pp.267-279.  Kimura-Yoshida, C., Nakano, H., Okamura, D., Nakao, K., Yonemura, S., Belo, J.A., Aizawa, S., Matsui, Y. and Matsuo, I., 2005. Canonical Wnt signaling and its antagonist  81 regulate anterior-posterior axis polarization by guiding cell migration in mouse visceral endoderm. Developmental cell, 9(5), pp.639-650.  Kosaka, N., Sakamoto, H., Terada, M., & Ochiya, T. (2009). Pleiotropic function of FGF!4: Its role in development and stem cells. Developmental Dynamics, 238(2), 265-276.  Kruithof-de Julio, M., Alvarez, M.J., Galli, A., Chu, J., Price, S.M., Califano, A. and Shen, M.M., 2011. Regulation of extra-embryonic endoderm stem cell differentiation by Nodal and Cripto signaling. Development, 138(18), pp.3885-3895.  Kubaczka, C., Senner, C.E., Cierlitza, M., Araœzo-Bravo, M.J., Kuckenberg, P., Peitz, M., Hemberger, M. and Schorle, H., 2015. Direct induction of trophoblast stem cells from murine fibroblasts. Cell stem cell, 17(5), pp.557-568.  Kunath, T., Arnaud, D., Uy, G.D., Okamoto, I., Chureau, C., Yamanaka, Y., Heard, E., Gardner, R.L., Avner, P. and Rossant, J., 2005. Imprinted X-inactivation in extra-embryonic endoderm cell lines from mouse blastocysts. Development, 132(7), pp.1649-1661.  Le Bin, G.C., MuŒoz-Descalzo, S., Kurowski, A., Leitch, H., Lou, X., Mansfield, W., Etienne-Dumeau, C., Grabole, N., Mulas, C., Niwa, H. and Hadjantonakis, A.K., 2014. Oct4 is required for lineage priming in the developing inner cell mass of the mouse blastocyst. Development, 141(5), pp.1001-1010.  Li, Z., & Rana, T. M. (2012). A kinase inhibitor screen identifies small-molecule enhancers of reprogramming and iPS cell generation. Nature communications, 3, 1085.  Liao, W.P., Uetzmann, L., Burtscher, I. and Lickert, H., 2009. Generation of a mouse line expressing Sox17!driven Cre recombinase with specific activity in arteries. Genesis, 47(7), pp.476-483.  Macfarlan, T.S., Gifford, W.D., Driscoll, S., Lettieri, K., Rowe, H.M., Bonanomi, D., Firth, A., Singer, O., Trono, D. and Pfaff, S.L., 2012. Embryonic stem cell potency fluctuates with endogenous retrovirus activity. Nature, 487(7405), pp.57-63.  Madisen, L., Zwingman, T.A., Sunkin, S.M., Oh, S.W., Zariwala, H.A., Gu, H., Ng, L.L., Palmiter, R.D., Hawrylycz, M.J., Jones, A.R. and Lein, E.S., 2010. A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Nature neuroscience, 13(1), pp.133-140.  Maekawa, M., Yamaguchi, K., Nakamura, T., Shibukawa, R., Kodanaka, I., Ichisaka, T., Kawamura, Y., Mochizuki, H., Goshima, N. and Yamanaka, S. (2011). Direct reprogramming of somatic cells is promoted by maternal transcription factor Glis1. Nature, 474(7350), pp.225-229.   82 Maza, I., Caspi, I., Zviran, A., Chomsky, E., Rais, Y., Viukov, S., Geula, S., Buenrostro, J.D., Weinberger, L., Krupalnik, V. and Hanna, S., 2015. Transient acquisition of pluripotency during somatic cell transdifferentiation with iPSC reprogramming factors. Nature biotechnology, 33(7), pp.769-774.  McDonald, A.C., Biechele, S., Rossant, J. and Stanford, W.L., 2014. Sox17-Mediated XEN Cell Conversion Identifies Dynamic Networks Controlling Cell-Fate Decisions in Embryo-Derived Stem Cells. Cell reports, 9(2), pp.780-793.  Meissner, A., Wernig, M. and Jaenisch, R., 2007. Direct reprogramming of genetically unmodified fibroblasts into pluripotent stem cells. Nature biotechnology, 25(10), pp.1177-1181.  Mikkelsen, T.S., Hanna, J., Zhang, X., Ku, M., Wernig, M., Schorderet, P., Bernstein, B.E., Jaenisch, R., Lander, E.S. and Meissner, A., 2008. Dissecting direct reprogramming through integrative genomic analysis. Nature, 454(7200), pp.49-55.  Morgani, S.M. and Brickman, J.M., 2015. LIF supports primitive endoderm expansion during pre-implantation development. Development, 142(20), pp.3488-3499.  Morgani, S.M., Canham, M.A., Nichols, J., Sharov, A.A., Migueles, R.P., Ko, M.S. and Brickman, J.M., 2013. Totipotent embryonic stem cells arise in ground-state culture conditions. Cell reports, 3(6), pp.1945-1957.  Mummery, C., Ward-van Oostwaard, D., Doevendans, P., Spijker, R., van den Brink, S., Hassink, R., Van der Heyden, M., Opthof, T., Pera, M., de la Riviere, A.B. and Passier, R., 2003. Differentiation of human embryonic stem cells to cardiomyocytes role of coculture with visceral endoderm-like cells.Circulation, 107(21), pp.2733-2740.  Neri, F., Zippo, A., Krepelova, A., Cherubini, A., Rocchigiani, M. and Oliviero, S., 2012. Myc regulates the transcription of the PRC2 gene to control the expression of developmental genes in embryonic stem cells. Molecular and cellular biology, 32(4), pp.840-851.  Niakan, K. K., Ji, H., Maehr, R., Vokes, S. A., Rodolfa, K. T., Sherwood, R. I., Yamaki, M., Dimos, J.T., Chen, A.E., Melton, D.A. and  McMahon, A. P. (2010). Sox17 promotes differentiation in mouse embryonic stem cells by directly regulating extraembryonic gene expression and indirectly antagonizing self-renewal. Genes & development, 24(3), 312-326.  Niakan, K.K., Schrode, N., Cho, L.T. and Hadjantonakis, A.K., 2013. Derivation of extraembryonic endoderm stem (XEN) cells from mouse embryos and embryonic stem cells. Nature protocols, 8(6), pp.1028-1041.   83 Nichols, J., Silva, J., Roode, M. and Smith, A., 2009. Suppression of Erk signalling promotes ground state pluripotency in the mouse embryo. Development, 136(19), pp.3215-3222.  Nijmeijer, R.M., Leeuwis, J.W., DeLisio, A., Mummery, C.L. and de Sousa Lopes, S.M.C., 2009. Visceral endoderm induces specification of cardiomyocytes in mice. Stem cell research, 3(2), pp.170-178.  Paca, A., S”guin, C.A., Clements, M., Ryczko, M., Rossant, J., Rodriguez, T.A. and Kunath, T., 2012. BMP signaling induces visceral endoderm differentiation of XEN cells and parietal endoderm. Developmental biology,361(1), pp.90-102.  Parenti, A. and Ralston, A., 2015. Three, two, oneÉ TROPHO-BLAST OFF!. Cell stem cell, 17(5), pp.499-500.  Perea-Gomez, A., Vella, F.D., Shawlot, W., Oulad-Abdelghani, M., Chazaud, C., Meno, C., Pfister, V., Chen, L., Robertson, E., Hamada, H. and Behringer, R.R., 2002. Nodal antagonists in the anterior visceral endoderm prevent the formation of multiple primitive streaks. Developmental cell, 3(5), pp.745-756.  Polo, J.M., Liu, S., Figueroa, M.E., Kulalert, W., Eminli, S., Tan, K.Y., Apostolou, E., Stadtfeld, M., Li, Y., Shioda, T. and Natesan, S. (2010). Cell type of origin influences the molecular and functional properties of mouse induced pluripotent stem cells. Nature biotechnology, 28(8), pp.848-855.  Rhinn, M., Dierich, A., Shawlot, W., Behringer, R.R., Le Meur, M. and Ang, S.L., 1998. Sequential roles for Otx2 in visceral endoderm and neuroectoderm for forebrain and midbrain induction and specification. Development, 125(5), pp.845-856.  Rugg-Gunn, P.J., Cox, B.J., Lanner, F., Sharma, P., Ignatchenko, V., McDonald, A.C., Garner, J., Gramolini, A.O., Rossant, J. and Kislinger, T., 2012. Cell-surface proteomics identifies lineage-specific markers of embryo-derived stem cells. Developmental cell, 22(4), pp.887-901.  Serrano, F., Calatayud, C.F., Blazquez, M., Torres, J., Castell, J.V. and Bort, R., 2013. Gata4 blocks somatic cell reprogramming by directly repressing Nanog. Stem Cells, 31(1), pp.71-82.  Shimosato, D., Shiki, M., & Niwa, H. (2007). Extra-embryonic endoderm cells derived from ES cells induced by GATA factors acquire the character of XEN cells. BMC developmental biology, 7(1), 80.  Shu, J., Wu, C., Wu, Y., Li, Z., Shao, S., Zhao, W., Tang, X., Yang, H., Shen, L., Zuo, X. and Yang, W., 2013. Induction of pluripotency in mouse somatic cells with lineage specifiers. Cell, 153(5), pp.963-975.   84 Shu, J., Zhang, K., Zhang, M., Yao, A., Shao, S., Du, F., Yang, C., Chen, W., Wu, C., Yang, W. and Sun, Y., 2015. GATA family members as inducers for cellular reprogramming to pluripotency. Cell research, 25(2), pp.169-180.  Singhal, P. K., Sassi, S., Lan, L., Au, P., Halvorsen, S. C., Fukumura, D., Jain, R.K. and Seed, B. (2016). Mouse embryonic fibroblasts exhibit extensive developmental and phenotypic diversity. Proceedings of the National Academy of Sciences, 113(1), 122-127.  Smith, K.N., Singh, A.M. and Dalton, S., 2010. Myc represses primitive endoderm differentiation in pluripotent stem cells. Cell stem cell, 7(3), pp.343-354.  Sridharan, R., Tchieu, J., Mason, M.J., Yachechko, R., Kuoy, E., Horvath, S., Zhou, Q. and Plath, K., 2009. Role of the murine reprogramming factors in the induction of pluripotency. Cell, 136(2), pp.364-377.  Takahashi, K. and Yamanaka, S., 2006. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. cell,126(4), pp.663-676.  Thomas, P. and Beddington, R., 1996. Anterior primitive endoderm may be responsible for patterning the anterior neural plate in the mouse embryo. Current Biology, 6(11), pp.1487-1496.  Tonge, P.D., Corso, A.J., Monetti, C., Hussein, S.M., Puri, M.C., Michael, I.P., Li, M., Lee, D.S., Mar, J.C., Cloonan, N. and Wood, D.L., 2014. Divergent reprogramming routes lead to alternative stem-cell states. Nature, 516(7530), pp.192-197.  Wamaitha, S.E., del Valle, I., Cho, L.T., Wei, Y., Fogarty, N.M., Blakeley, P., Sherwood, R.I., Ji, H. and Niakan, K.K., 2015. Gata6 potently initiates reprogramming of pluripotent and differentiated cells to extraembryonic endoderm stem cells. Genes & development, 29(12), pp.1239-1255.  Wicklow, E., Blij, S., Frum, T., Hirate, Y., Lang, R.A., Sasaki, H. and Ralston, A., 2014. HIPPO pathway members restrict SOX2 to the inner cell mass where it promotes ICM fates in the mouse blastocyst. PLoS Genet, 10(10), p.e1004618.  Yamanaka, Y., Lanner, F. and Rossant, J., 2010. FGF signal-dependent segregation of primitive endoderm and epiblast in the mouse blastocyst. Development, 137(5), pp.715-724.  Zhao, Y., Zhao, T., Guan, J., Zhang, X., Fu, Y., Ye, J., ... & Cheng, L. (2015). A XEN-like state bridges somatic cells to pluripotency during chemical reprogramming. Cell, 163(7), 1678-1691.     85 Chapter 3   iXEN and iPSC reprogramming is influenced by extrinsic and intrinsic factors.     A. Parenti wrote the chapter, assembled the figures, and performed the experiments. A. Ralston edited the chapter. V. Benham helped with the experiments in Figure 3.2             86 Abstract  In our previous work, we found that Oct4, Sox2, Klf4, and cMyc (OSKM) induced reprogramming generates induced extraembryonic endoderm stem cells (iXEN) in parallel to induced pluripotent stem cells (iPSC).  Further, we found that iXEN inhibit the acquisition of pluripotency during OSKM reprogramming.  In this report, I expand upon our previously published work and answer questions about how FGF signaling, acquisition of iXEN fate, and reprogramming context influence production of iPSCs during OSKM reprogramming.  Further, I found that Oct4 is not a specific marker of pluripotency, but instead is expressed by iXEN and iPSCs during reprogramming.  This finding is important because numerous reports have relied on quantification of Oct4-GFP as a readout of reprogramming to pluripotency.  Further, I show that neither a cellÕs age nor genetic background are strict barriers to acquisition of iXEN fate. These findings warrant a revision of key paradigms in regenerative medicine and will aid future work aimed at elucidating the mechanism by which cells re-acquire pluripotency.              87 Section 1.  Introduction  My initial work demonstrated that iXEN are derived from fibroblasts during OSKM induced reprogramming in parallel to iPSCs (Parenti et al., 2016).  iXEN are made ~3x more efficiently than iPSCs, but the mechanisms that govern acquisition of iXEN versus iPSC fate are not clear.  In the work presented below, I sought to answer questions about how FGF signaling and reprogramming context influence production of iXEN and iPSCs during OSKM reprogramming.  Further, I investigate whether acquisition of iXEN fate during reprogramming inhibit iPSC production.   Rigorous optimization of OSKM induced reprogramming in the past decade identified cell culture conditions to improve iPSC generation efficiency, including the addition of Vitamin C and identification of defined culture medium to promote iPSC fate (Esteban et al., 2010; Huangfu et al., 2008; Zhao et al, 2008; Maekawa et al., 2011; Cheloufi et al., 2015).  Recently, the Deng group reported that is possible to derive iPSCs from fibroblasts by treating the cells with combinations of small molecules (Hou et al., 2013, Zhao et al., 2015; Ye et al., 2016).  Interestingly, small molecule based reprogramming includes the addition of high concentrations FGF4, a potent growth factor and signaling molecule, in the reprogramming medium.  Rudolf JaenischÕs group demonstrated that iPSC reprogramming efficiency could be improved by increasing the proliferation rate of the cells being reprogrammed (Hanna et al., 2009).  Manipulation of FGF4 activity may alter the proliferation rate of the cells being reprogrammed, or their response to OSKM induction, to influence iXEN and iPSC reprogram efficiency.  In the experiments detailed below, I test the hypothesis that activation of FGF signaling improves iXEN and iPSC reprogramming efficiency by increasing cell proliferation.  88  Many studies have explored the dynamics of pluripotency gene expression in fibroblasts to identify early markers of cells that become iPSCs during OSKM reprogramming (Buganim et al., 2012; Stadtfeld et al., 2008; Li et al., 2010; Samavarachi-Tehrani et al., 2010).  Many groups use Oct4 expression to identify the proportion of a population that acquire pluripotency after reprogramming (Huangfu et al., 2008; Shi et al., 2008; Judson et al., 2009; Zhao et al., 2009; Rais et al., 2013; dos Santos et al., 2014).  Previous studies from our lab demonstrate that OCT4 plays a key role in establishing XEN fate in the embryo and helps establish iXEN cell fate during OSKM reprogramming (Frum et al., 2013; Parenti et al., 2016).  Taken together, our results call into question whether Oct4 is a specific marker of pluripotency, and necessitate a detailed analysis of Oct4 expression in iXEN cells and iPSCs during OSKM reprogramming.  In the experiments presented below, I test the hypothesis that Oct4 is a specific marker of pluripotency during reprogramming.  Identifying barriers to iPSC reprogramming efficiency is a key goal of the field and has been the focus of many different studies (Banito et al., 2009; Li et al., 2009; Feng et al., 2009; Hong et al., 2009).  In a previous study, we knocked down Gata6 during reprogramming to demonstrate that acquisition of iXEN cell fate during reprogramming is a barrier to iPSC fate.  However, redundancy among the XEN markers may explain why iPSC reprogramming efficiency did not increase further.  Our previous data also show that a subset of MEFs are GATA6 positive before reprogramming begins and thus may be predisposed towards becoming iXEN.  If a fixed subset of MEFs are predisposed toward becoming iXEN, then simultaneous knockdown of multiple XEN genes should not improve iPSC reprogramming efficiency beyond the  89 levels observed in Gata6 knockdown alone.  Further, in our previous work, we did not evaluate the effect of XEN gene overexpression on iXEN and iPSC reprogramming efficiency.  If the hypothesis that XEN gene expression predisposes cells toward iXEN fate is true, then expression of XEN markers in combination with OSKM should improve iXEN reprogramming efficiency.  Last, our previously published work suggests that the presence of iXEN during OSKM reprogramming inhibit acquisition of iPSC fate.  At this point however, the mechanism by which iXEN inhibit iPSC fate is unclear.  In the experiments presented below, I test the hypothesis that iXEN inhibit iPSC reprogramming through paracrine signaling.  My initial work demonstrated that iXEN cells are derived in parallel to iPSCs in a specific reprogramming context, OSKM induced reprogramming of CD-1 mouse embryonic and 3-month-old fibroblasts (Parenti et al., 2016).  However, the combination of reprogramming factors used, age and genetic background of the cells being reprogrammed, and reprogramming method all impact iPSC reprogramming efficiency (Schnabel et al., 2012; Li et al., 2009; Okita et al., 2009; Shi et al., 2008; Ichida et al., 2009; Georgetti et al, 2009; Hou et al., 2013, Zhao et al., 2015), and thus may impact iXEN reprogramming efficiency as well.  In the experiments detailed below, I test the hypothesis that reprogramming context (i.e. transcription factor combination, method, or age and genetic background of the cells being reprogrammed) impacts iXEN reprogramming efficiency.     90 Section 2.  Materials and Methods Mouse Strains Alleles were maintained on a CD-1 background except BALB/c, which was maintained as an isogenic strain: Gt(ROSA)26Sortm14(CAG-tdTomato)Hze (Madisen et al., 2010), Pou5f1tm2Jae (Lenger et al., 2007), Tg(CAG-cre)1Nagy (Belteki et al., 2005), PDGFRatm11(EGFP)Sor (Hamilton et al., 2003).  All animal work conformed to the guidelines and regulatory standards of the University of Michigan State University Institutional Animal Care and Use Committee.  Fibroblast preparations   To establish MEF lines, embryos were collected from pregnant mice on E13.5.  After head and viscera were removed, individual embryos were dissociated, and then plated on gelatin in MEF Medium [DMEM, 10% Fetal Bovine Serum (Hyclone), Pen/Strep (10,000 units each), Glutamax (200 mM), NEAA (200 mM), and beta-mercaptoethanol (55 mM)] and grown at 37¡C with 5% CO2.  Each MEF line was passaged once, and then stored in liquid nitrogen until used. To establish TTF lines, adult tail tips were isolated, epidermis was removed, and remaining tissue was plated in MEF medium, and then cultured for seven days.  TTFs were then harvested, frozen, and stored in liquid nitrogen until needed.  XEN cell derivation and culture Blastocysts were collected from pregnant mice on E3.5 by flushing uterine horns with M2 medium (Millipore).  Blastocysts were then transferred to 4-well dishes plated with  91 mitotically inactivated (3,500 rads) MEFs in ES cell medium, and were incubated at 37¡C with 5% CO2, changing the medium every 4 days.  On day 10, blastocyst outgrowths were dissociated with trypsin, and then cultured another 5-7 days.  Finally, expanded XEN cell lines were frozen and stored in liquid nitrogen until needed.  For experiments, XEN and iXEN cells were cultured in ES cell medium with or without LIF or in XEN medium [30% Incomplete TS cell Medium [RPMI (Invitrogen), 20% FBS, Pen/Strep (10,000 units each), Glutamax (200 mM), NEAA (200 mM), beta-mercaptoethanol (55 mM)] + 70% MEF-conditioned medium + 1 "g/mL FGF4 (R&D Systems) + 1 U/mL Heparin (R&D Systems)].  Immunofluorescence and flow cytometry For immunofluorescence, cells were harvested with trypsin, washed twice with PBS, fixed with 4% formaldehyde in PBS for 15 min. at room temperature, washed twice with PBS, and were then resuspended in 100% ice-cold methanol and placed on ice for 10 min.  Cells were incubated in blocking solution (PBS +10% FBS), and then incubated in primary antibody diluted in Blocking Solution overnight at 4¡C.  The next day, cells were washed twice with PBS, and then resuspended in secondary antibody diluted in blocking solution and incubated on ice for 1 hr.  Finally, cells were washed twice with PBS, resuspended in PBS and analyzed on a Becton Dickinson LSR II.  Data were analyzed using FlowJo software.  For immunofluorescence, cells were grown for 2 passages, before plating onto gelatinized (0.1% gelatin) cover slips.  Cells were then fixed with 4% formaldehyde in PBS at room temperature for 10 min., washed with PBS, and incubated in 0.5% Triton x-100 in PBS for 30 min at room temperature. Cells were  92 blocked in blocking solution + 0.2% Triton x-100 for 1 hour at room temperature, and were then incubated in primary antibody in Blocking Solution + 0.2% Triton x-100 overnight at 4¡C.  Next, cells were washed with PBS and incubated in secondary antibody in Blocking Solution and DAPI (Sigma) in Blocking Solution for 1 hour. Cells were imaged using an Olympus Fluoview FV1000 with 20x UPlanFLN objective, NA 0.5).  (For antibodies used for either procedure, see Antibodies).  FACS was performed on a Becton Dickinson LSR II or Becton Dickinson Influx.  RNA isolation and qRT-PCR RNA was harvested with Trizol (Invitrogen), and cDNA was reverse transcribed from 1 "g RNA using Qiagen QuantiTect Reverse Transcription Kit (Qiagen), following manufacturersÕ instructions.  For qPCR, cDNA was amplified using a Lightcycler 480 (Roche), according to manufacturerÕs guidelines.  The amplification efficiency of each primer pair (see Primers & Oligos), was measured by generating a standard curve from appropriate cDNA libraries.  All reactions were performed in quadruplicate.   shRNA Cloning and Testing  Plasmids encoding multiple Gata6, Gata4, Sox17, and Sox7 shRNAs (sequences from Open Biosystems, see shRNA Table) were created by synthesizing oligos, which were then cloned into pLKO.1-TRC cloning vector (Addgene).  Knockdown efficiency was tested by transfection of XEN cells, and RNA was harvested 48 hours later to assess knockdown efficiency by qPCR.  shRNAs producing the strongest knockdown were then  93 PCR amplified from pLKO.1-TRC using 5Õ-TCAGCTGGATCCATATATCTTGTGGAAAGGACGAAACA-3Õ  and 5Õ-GGTGCAGCGGCCGCAGTGGATGAATACTGCCATTTGTC-3Õ primers, and the PCR fragment was then cloned into the pMXs vector for retroviral production. Viral particles were quantified by qPCR using standard curves, as described above.  Statistical Analyses Unless otherwise stated, T-tests were performed for pairwise comparisons, and ANOVA for multiple pairwise comparisons.  Reprogramming  Retroviral Reprogramming OSKM retrovirus was produced by transfecting 293T cells with pCL-ECO and pMXs plasmids containing Oct4, Klf4, Sox2, or cMyc (OSKM) cDNAs (Addgene). Culture supernatant was harvested 48 hours later, and qPCR used to quantify soluble virus using standard curves. Viral preps were stored at -80¼C until use.  For retroviral reprogramming (Takahashi and Yamanaka, 2006), 6x107 copies each OSKM viral particle were added to 40,000 MEFs (passage 2), and incubated for 24 hr. Media was then replaced with MEF medium, then ES Medium (FBS [DMEM (Invitrogen), 15% Fetal Bovine Serum (FBS; Hyclone), Pen/Strep (10,000 units each), Glutamax (200 mM), NEAA (200 mM), beta-mercaptoethanol (55 mM), and 10 ng/mL recombinant LIF (protocol available on request)]) on days 2 and 4, and then replaced with Reprogramming Medium (DMEM, 15% Knockout Serum Replacement (Invitrogen),  94 Pen/Strep (10,000 units each), Glutamax (200 mM), NEAA (200 mM), beta-mercaptoethanol (55 mM), and 10 ng/mL LIF]) on day 6 and then every other day until day the end of the experiment. For FGF activation reprogramming, 6x107 copies each OSKM viral particle were added to 40,000 MEFs (passage 2), and incubated for 24 hr. Media was then replaced with MEF medium, then ES Medium (FBS [DMEM (Invitrogen), 15% Fetal Bovine Serum (FBS; Hyclone), Pen/Strep (10,000 units each), Glutamax (200 mM), NEAA (200 mM), beta-mercaptoethanol (55 mM), 25 ng/mL FGF4 (R&D Systems), 1 U/mL Heparin (R&D Systems), and 10 ng/mL recombinant LIF (protocol available on request)]) every other day until the end of reprogramming.  For FGF inhibition reprogramming, 6x107 copies each OSKM viral particle were added to 40,000 MEFs (passage 2), and incubated for 24 hr. Media was then replaced with MEF medium, then ES Medium (FBS [DMEM (Invitrogen), 15% Fetal Bovine Serum (FBS; Hyclone), Pen/Strep (10,000 units each), Glutamax (200 mM), NEAA (200 mM), beta-mercaptoethanol (55 mM), and 10 ng/mL recombinant LIF (protocol available on request)]) on days 2 and 4, and then replaced with Reprogramming Medium (DMEM, 15% Knockout Serum Replacement (Invitrogen), Pen/Strep (10,000 units each), Glutamax (200 mM), NEAA (200 mM), beta-mercaptoethanol (55 mM), MEK inhibitor PD0325901 (500 ng/mL) (Stemgent), FGF inhibitor PD17306 (100 ng/mL) (Stemgent), and 10 ng/mL LIF]) on day 6 and then every other day until day the end of the experiment.  For reprogramming on inactivated XEN, XEN were inactivated by radiation with 3000 grays, and plated onto 12 well dishes.  Then 40,000 MEFs were plated on top of the XEN and treated with 6x107 copies each OSKM viral particle the next day, and incubated for 24 hr. Media was then replaced with MEF medium, then ES Medium (FBS  95 [DMEM (Invitrogen), 15% Fetal Bovine Serum (FBS; Hyclone), Pen/Strep (10,000 units each), Glutamax (200 mM), NEAA (200 mM), beta-mercaptoethanol (55 mM), and 10 ng/mL recombinant LIF (protocol available on request)]) on days 2 and 4, and then replaced with Reprogramming Medium (DMEM, 15% Knockout Serum Replacement (Invitrogen), Pen/Strep (10,000 units each), Glutamax (200 mM), NEAA (200 mM), beta-mercaptoethanol (55 mM), and 10 ng/mL LIF]) on day 6 and then every other day until day the end of the experiment.  Chemical Reprogramming Chemical reprogramming followed previously published work (Hou et al., 2013).  Briefly, 50,000 MEFs were plated into wells of a 6 well dish. The cells were grown in Phase 1 Medium [DMEM, 10% FBS, 10% KOSR, Pen/Strep (10,000 units each), Glutamax (200 mM), NEAA (200 mM), Sodium Pyruvate (200 mM), beta-mercaptoethanol (55 mM), and bFGF 20 ng/"L] + VPA (0.5 mM), CHIR99021 (10 "M), 616452 (10 "M), Tranylcypromine (10 "M), and Forskolin (50 "M)] for days 1-12.  On day 12, cells were passaged and re-plate at 300,000 cells/well in a 6-well in Phase 1 medium.  On days 16-30, the medium was changed to Phase 2 medium [DMEM, 10% FBS, 10% KOSR, Pen/Strep (10,000 units each), Glutamax (200 mM), NEAA (200 mM), Sodium Pyruvate (200mM), beta-mercaptoethanol (55 mM), and bFGF 20 ng/"L] + VPA (0.5 mM), CHIR99021 (10 "M), 616452 (10 "M), Tranylcypromine (10 "M), and Forskolin (50 "M) DZNep (50 nM)].  Finally, on days 30-40, the medium was switched to Phase 3 medium [DMEM, 10% FBS, 10% KOSR, Pen/Strep (10,000 units each), Glutamax (200 mM), NEAA (200 mM), Sodium Pyruvate (200mM), beta-mercaptoethanol (55 mM), 2i  96 (CHIR99021 3 "M and PD0325901 1 "M), and LIF (1000 U/mL)].  Chemical iPSCs were analyzed on day 40.  Proliferation Assay Proliferation assays were performed over the course of 20 days with cells harvested every 5 days for counting.  Briefly, 10,000 CD-1 MEFs/well were plated on gelatinized 24 well dishes.  Cells were grown in standard ES Medium, ES Medium with FGF4 (25 ng/mL), or ES Medium with MEKi and FGFi [MEK inhibitor PD0325901 (500 ng/mL) (Stemgent), FGF inhibitor PD17306 (100 ng/mL)].  Cells were raised, pelleted, and resuspended in 100 uL of medium.  Then, 10uL of each cell suspension was used to count cells using a hemocytometer.  (n= 2 technical replicates for each condition for each day, error bars = standard error for replicates)  iXEN/XEN in vivo differentiation  Embryo manipulation and transfers were performed as previously described (Cheng et al., 2009).  Fluorescently labeled ES cells were previously described (George et al., 2007).  Fluorescently labeled iPSCs were created by reprogramming tdTomato-expressing MEFs, described above.  Fluorescently labeled XEN lines were derived from blastocysts generated by crossing Sox17tm1(icre)Heli and Gt(ROSA)26Sortm14(CAG-tdTomato)Hze mice.  Finally, fluorescently labeled iXEN lines were derived from MEFs expressing tdTomato.  To create chimeras, ~15 fluorescently labeled cells were injected into each blastocoel of unlabeled CD-1 host blastocysts, and the injected embryos were then cultured at 37¡C for 24 hours before imaging.  97  Section 3.  Results FGF signaling improves iXEN and iPSC reprogramming efficiency by increasing cellular proliferation  Special attention should be paid to the medium and culture conditions used during reprogramming because they can impact reprogramming efficiency and quality of iPSCs generated (Chen et al., 2011).  Some reprogramming protocols call for the addition of FGF4 to the reprogramming medium (Hou et al., 2013; Zhao et a., 2015).  FGF is a potent mitogen which, when added to cell culture medium, can increase the growth rate of fibroblasts (Kosaka et al., 2009).  Indeed, improved cell proliferation has been linked to increased iPSC reprogramming efficiency (Hanna et al., 2009).  In addition, FGF signaling plays a key role in cell fate decisions in a number of developmental contexts, including the specification of the PE/XEN in the preimplantation mouse blastocyst (Nichols et al., 2009; Yamanaka et al., 2010; Kang et al., 2013; Krawchuck et al., 2013).  Given the reported roles of FGF signaling in development and the finding that improved cell proliferation can increase iPSC efficiency, I sought to test the hypothesis that FGF signaling improves iXEN and iPSC reprogramming efficiency by improving cell proliferation.  To assess the role of FGF signaling on iXEN and iPSC reprogramming, I reprogrammed MEFs with OSKM in standard conditions (KOSR+LIF), in the presence of FGF4 (KOSR+LIF+FGF4), or in the presence of FGF/ERK signaling inhibitors (KOSR+LIF+MEKi+FGFi).  I found that reprogramming in the presence of FGF4 increased the number of iXEN and iPSCs by 1.8x and 1.4x respectively (Fig. 3.1A and  98 B).  Further, the addition of FGF/ERK signaling inhibitors to the reprogramming medium completely eliminated iXEN cells, and decreased the number of iPSCs by 36x (Fig. 3.1B).  To determine whether the increase/decrease in iXEN and iPSCs was associated with the mitogenic activity of FGF4, I mock-treated cells by culturing them in KOSR+LIF, KOSR+LIF+FGF4, or KOSR+LIF+MEKi+FGFi and collected them on days 0, 5, 10, 15, and 20 of reprogramming to quantify cell number in KOSR+LIF, KOSR+LIF+FGF4, or KOSR+LIF+MEKi+FGFi.  I found that addition of FGF4 to the medium increased growth rate by 3.27x while treatment with FGF/ERK inhibitors decreased growth rate by ~10x (Fig. 3.1C).  Oct4 is not a specific marker of pluripotency during reprogramming  Oct4 has a well-known and established role initiating pluripotency both in the embryo and in reprogramming (Nichols et al., 1998; Takahashi and Yamanaka, 2006).  However, work by Frum et al. and others demonstrate that Oct4 is also required cell autonomously for specification of PE/XEN (Aksoy et al., 2013; Frum et al. 2013; Le Bin et al., 2014).  Further, countless studies have used Oct4-GFP MEFs to quantify the number of cells that have acquired pluripotency after reprogramming (Huangfu et al., 2008; Shi et al., 2008; Judson et al., 2009; Zhao et al., 2009; Rais et al., 2013; dos Santos et al., 2014).  My previously published work suggests that Oct4 plays a role in the derivation of iXEN during reprogramming and brings into question whether Oct4 is a specific marker of pluripotency during reprogramming.  To determine whether Oct4 is a specific marker of pluripotency during OSKM reprogramming, I reprogrammed  99 transgenic MEFs that carry Oct4-GFP (Lengner et al., 2007) with OSKM and harvested cells on Day 20.  I observed GFP-positive iXEN cell and iPSC colonies (Fig 3.2A).  Then, I used FACS to determine if cells expressing PE genes, GATA6 or SOX17, were also GFP-positive.  I found that ~37% of GATA6-positive cells and ~38% of SOX17-positive cells were Oct4-GFP-positive on Day 20 (Fig 3.2B).  Reprogramming on a monolayer of mitotically inactivated XEN cells decreases iXEN and iPSC reprogramming efficiency  In my previously published work, I found that acquisition of iXEN fate inhibits iPSC reprogramming (Parenti et al., 2016).  I hypothesized therefore, that the presence of a XEN environment would inhibit iPSC reprogramming further.  To determine if there is any change in the number of iPSCs made in the presence of a XEN environment, I mitotically inactivated XEN cells with !-irradiation and plated them onto tissue culture plates.  Then, I plated fluorescently labeled MEFs on top of the inactivated XEN cells and reprogrammed the MEFs with OSKM.  In this experiment, the inactivated XEN will not be reprogrammed because they lack the ability to divide, a key requirement to convert into iPSCs (Hanna et al., 2009).  I counted iXEN and iPSC colonies on Day 20 of reprogramming and observed a ~1.5x decrease in the number of iXEN cell and iPSC colonies relative to MEFs reprogrammed in standard conditions (Fig 3.3A).     100 There is no difference in iXEN or iPSC reprogramming efficiency when knocking down multiple XEN genes compared to silencing Gata6 alone  In our published work, we demonstrated that Gata6 knockdown during OSKM induced reprogramming decreased iXEN reprogramming efficiency and increased iPSC reprogramming efficiency (Parenti et al., 2016).  It was unclear however, whether redundancy among the XEN markers inhibited further improvement of iPSC reprogramming efficiency.  I tested the hypothesis that simultaneous knockdown of multiple XEN genes could improve iPSC reprogramming efficiency to a greater degree than knockdown of Gata6 alone.  I performed double knockdowns with combinations of Gata6, Gata4, Sox17, and Sox7 shRNA during OSKM induced reprogramming.  I found that while knockdown of most pairs significantly decreased iXEN reprogramming efficiency and increased iPSC reprogramming efficiency compared to OSKM alone, there was no difference in iXEN or iPSC efficiency compared to Gata6 knockdown alone (Fig 3.4A and B).  Gata6 expression during OSKM reprogramming inhibits acquisition of pluripotency  In my prior work, I found that a subset of the MEF population was GATA6 positive before reprogramming began (Parenti et al., 2016).  This suggests that a population of cells may be predisposed toward iXEN fate before reprogramming begins.  If this is true, induced expression of XEN genes during OSKM reprogramming should improve iXEN reprogramming efficiency and decrease iPSC reprogramming efficiency. To address this, I reprogrammed MEFs with OSKM while overexpressing Gata6, Gata4,  101 Sox17, or Sox7 with retrovirus.  I found that Gata6 overexpression decreased the number of iPSC colonies by ~2x while overexpression of each of the other XEN markers had no effect (Fig. 3.4C and D).  However, I found that overexpression of XEN genes did not significantly change the number of iXEN colonies generated, which was surprising because I hypothesized that the cells diverted from iPSC fate would become iXEN.  All four factors (OSKM) are required to induce XEN gene expression and derive iXEN during reprogramming  iPSCs can be made from MEFs with less than the full complement of OSKM (Wernig et al., 2008; Silva et al., 2008).  After establishing that iXEN are made during OSKM reprogramming, I sought to determine whether different combinations of the four reprogramming factors, could produce iXEN from MEFs.  To address this, I reprogrammed MEFs with OSKM, OSK, SKM, Oct4 alone, and a mock viral treatment.  I assessed the number of iXEN and iPSC colonies on Day 20 of reprogramming and observed iPSCs in both OSKM and OSK treated wells (Fig. 3.5A).  However, I only observed iXEN cell colonies in OSKM treated wells (Fig. 3.5A).  Next, I harvested all cells on Day 20 and used qRT-PCR to determine which conditions induced XEN gene expression and found that only OSKM induced XEN gene expression significantly over mock infected cells (Fig. 3.5B).     102 Age and genetic background are not barriers to the acquisition of iXEN cell fate  The work presented in our published manuscript was performed with cells derived from the outbred mouse strain CD-1.  Inbred mouse strains have shown variable ability to acquire iPSC fate (Schnabel et al., 2012) and therefore, it was not clear if the genetic background of the cells reprogrammed could pose a barrier to acquisition of iXEN fate.  Further, our published studies only examined iXEN derived from mouse embryonic fibroblasts (MEFs) and 3-month-old fibroblasts.  Deriving iXEN from aged cells may not be trivial, because published work demonstrates that it iPSC reprogramming efficiency drops 2-5x when reprogramming cells derived from older individuals compared to younger individuals (Li et al, 2009, Lapassat et al., 2011).  I tested the hypothesis that age and genetic background are barriers to iXEN fate, by reprogramming isogenic BALB/c fibroblasts, which have been previously reported to be recalcitrant to iPSC reprogramming (Schnabel et al, 2012), from 1-month and 19-month mice with OSKM.  I found that iXEN could be derived from fibroblasts derived from younger and older BALB/c mice (Figure 3.6A).  In this experiment, I found that iPSC reprogramming efficiency drops by ~4x while iXEN efficiency drops by ~5x when reprogramming older cells compared to younger cells (Figure 3.6A).  XEN-like cells could not be derived from MEFs using chemical reprogramming  In order to examine the effect of reprogramming method on iXEN reprogramming efficiency, I used a recently developed small molecule based reprogramming technique (Hou et al., 2013; Zhao et al., 2015).  Small molecule based reprogramming is the ideal system to test the effect of reprogramming method on iXEN efficiency because  103 published reports suggest that both iPSCs and ÒXEN-likeÓ cells are produced, albeit at lower efficiency than viral reprogramming (Zhao et al., 2015).  I hypothesized then, that chemical reprogramming would produce iXEN at lower efficiency that viral OSKM reprogramming.  To test this, I reprogrammed CD-1 MEFs using small molecules with the protocol detailed in Hou et al. to test the hypothesis that reprogramming method effects iXEN reprogramming efficiency (Hou et al., 2013).  I reprogrammed 6 wells of fibroblasts on 4 different occasions, but was unable to generate any XEN-like or iPSC colonies (Fig 3.7A and B).  In every attempt, on Day 16-20 the cells began to die and detach from the plate.  MEFs do not grow well when plated at low concentrations, and though Hou et al. do not report the addition of Heparin to their reprogramming medium, Heparin has been shown to protect FGF from inactivation and promotes FGF ligand/receptor binding (Gospodarowicz and Cheng, 1986; Schlessinger et al., 2000; Caldwell et al., 2004). On my final attempt, I set up a chemical reprogramming experiment where 4 wells each were plated with 50,000, 100,000, and 150,000 cells per well (50,000 per well is recommended by Hou et al.).  In addition, I reprogrammed 2 of the 4 wells at each concentration with the medium recommended by Hou et al and their follow up paper Zhao et al., and I reprogrammed the other 2 wells at each concentration with medium plus Heparin (1 U/mL).  Once again I did not see any XEN-like or iPSCs and the cells died around Day 20.  Future attempts to answer questions about the effect of reprogramming method on iXEN efficiency will only be possible once a detail protocol is published.   104 Pdgfralpha-GFP cannot be used as a reliable marker to isolate iXEN cells after reprogramming  I sought to identify a marker we could use to isolate putative iXEN during reprogramming with FACS.  Pdgfralpha is expressed exclusively in the XEN lineage on day E4.0 and is also expressed in embryo derived XEN lines (Kunath et al., 2005; Plusa et al., 2008; Rugg-Gunn et al., 2013).  Further, my previously published work demonstrates that established iXEN lines uniformly express PDGFRalpha (Parenti et al., 2016), and thus it seemed like an ideal candidate for FACS based isolation.  I generated MEFs from mice carrying Pdgfralpha-GFP (Hamilton et al., 2003) and reprogrammed these with OSKM retrovirus.  I collected cells on Day 0, 6, 12, and 18 of reprogramming, and then used FACS to determine what percent of the population were GFP positive.  As a control, I used a mock treatment, which does not produce iXEN, and assayed those cells for GFP expression as well.  I found that very few cells expressed Pdgfralpha throughout OSKM reprogramming with the highest percentage being 1.1% on Day 12 (Fig. 3.8A).  However, the mock-treated control produced as many 10% Pdgfralpha-GFP positive cells on Day 18 (Fig. 3.8A).  Section 4.  Discussion FGF signaling improves iXEN and iPSC reprogramming efficiency by increasing cellular proliferation  My data support the hypothesis that the addition of FGF to reprogramming medium improves iPSC and iXEN reprogramming by increasing fibroblast growth rate.  Further, I found that the addition of FGF to the reprogramming medium improved iXEN  105 and iPSC reprogramming efficiency equally, which suggests that the presence of FGF in the reprogramming medium does not bias reprogrammed cells towards either fate.  iXEN inhibit acquisition of iPSC fate during reprogramming   The experiments detailed above support my hypothesis that acquisition of iXEN fate during reprogramming inhibits iPSC reprogramming.  The experiments focusing on the presence of a XEN environment during reprogramming suggest that the presence of iXEN during reprogramming inhibit iPSC reprogramming.  This finding suggests two different mechanisms by which iXEN can inhibit iPSC derivation.  First, iXEN may use paracrine-signaling molecules to inhibit iPSC derivation during reprogramming.  Therefore, limiting the number of iXEN through shRNA knockdown decreases the amount of inhibitory signal produced and increases iPSCs reprogramming efficiency.  Second, iXEN may inhibit pluripotency through direct cell-cell interactions with cells headed toward iPSC fate.  However, the second scenario seems less likely because we reported that iXEN are found near iPSCs (<50 um) 41% of the time (Parenti et al., 2016).  Second, the XEN gene overexpression experiments suggest that Gata6 overexpression is sufficient to inhibit iPSC formation during OSKM reprogramming.  However, the molecular mechanisms that govern acquisition of iXEN fate are more complex because induction of XEN genes during OSKM reprogramming was not sufficient to improve iXEN reprogramming efficiency.  While expression of Gata6 may be a marker of cells that are predisposed toward an iXEN fate during OSKM reprogramming, Gata6 expression alone is not sufficient.  106  Last, the experiments to test the redundancy of XEN markers to inhibit iPSC reprogramming suggest that while iXEN cell fate is a barrier to iPSC derivation, there is a limit to the effect that XEN gene silencing can have on improving iPSC reprogramming efficiency.  Taken together, my results strongly suggest that acquisition of iXEN cell fate is a barrier to iPSC derivation during OSKM reprogramming.  However, the mechanisms by which iXEN inhibit iPSC formation are still unclear and should be investigated in greater detail in the future.  Reprogramming context impacts iXEN reprogramming efficiency  I tested the hypothesis that reprogramming context can impact iXEN reprogramming efficiency in three different ways.  First, I tested the effect of reprogramming MEFs with different combinations of O, S, K, and M and my results suggest that all four factors are required to induce XEN gene expression and generate iXEN.  However my results do not eliminate the possibility that fewer factors could be used to make iXEN from other cell types.    Second, I examined the effect of age and genetic background on iXEN reprogramming efficiency and my results suggest that age and genetic background are not strict barriers to iXEN fate.  However, there was  a decrease in iXEN reprogramming efficiency when reprogramming cells derived from old people that mirrored the decrease in iPSC reprogramming efficiency.  The decrease in iXEN and iPSC reprogramming efficiency suggests that old cells are not just limited in their ability to become iPSCs, but instead are more restricted in their potential to change cell fate.    107  Last, my experiments that examined the effect of reprogramming method on iXEN reprogramming efficiency using a recently developed chemical reprogramming technique, were not successful.  Each time the protocol was attempted, the cells died and no conclusions about iXEN could be drawn.  This suggests that the chemical reprogramming protocol is not as simple as it has been described and needs further refinement before it can be used.   Oct4 is expressed in both iXEN and iPSCs after reprogramming  My previous work demonstrated that few cells expressed both pluripotency markers (NANOG) and XEN markers (SOX17 or GATA6) during reprogramming which suggests that the iPSC and iXEN populations are distinct populations of cells (Parenti et al, 2016).  I performed experiments to test the hypothesis that Oct4-GFP is a strict marker of pluripotent cells, but instead found that Oct4-GFP is also expressed in putative iXEN cells.  Combined, my results suggest that previous studies using Oct4-GFP expression to identify iPSCs likely included iXEN cells as well.  Further, my results provide additional support for the hypothesis that Oct4 plays a role in establishing iXEN during reprogramming.  PDGFRalpha-GFP cannot be used to isolate putative iXEN during reprogramming  I sought to identify a marker that would allow me to identify putative iXEN cells throughout reprogramming with FACS, but found that the PDGFRalpha-GFP marker is induced in Mock treated cells, but not OSKM treated cells.  This suggests that the Pdgfralpha-GFP reporter expression is not dependent on OSKM overexpression.  Since  108 we do not observe iXEN cells after mock treatment (Parenti et al., 2016), we conclude that the Pdgfralpha-GFP reporter is not a reliable marker for isolating iXEN during reprogramming and would not serve as a useful tool to isolate cells on the path toward iXEN fate.                      109             APPENDIX            110  Figure 3.1. FGF activity influences iXEN and iPSC reprogramming efficiency A) iPSC reprogramming efficiency in standard medium (KOSR+LIF), standard medium +FGF (KOSR+LIF+FGF), and standard medium with FGF inhibitor (KSOR+LIF+MEKi+FGFi).  Addition of FGF to reprogramming medium increases iPSC reprogramming efficiency ~1.5x, while inhibition of FGF signaling reduces efficiency to nearly 0 (n = 3 reprogrammed wells; error bars = standard error).  B) iXEN reprogramming efficiency in standard medium (KOSR+LIF), standard medium +FGF (KOSR+LIF+FGF), and standard medium with FGF inhibitor (KSOR+LIF+MEKi+FGFi).  Addition of FGF to reprogramming medium increases iXEN reprogramming efficiency ~1.8x, while inhibition of FGF signaling reduces efficiency to 0 (n = 3 reprogrammed wells; error bars = standard error).  C) Fibroblast growth curves in standard medium (KOSR+LIF), standard medium +FGF (KOSR+LIF+FGF), and standard medium with FGF inhibitor (KSOR+LIF+MEKi+FGFi).  Fibroblasts grow ~3x faster in medium with FGF and ~10x slower in medium with FGF inhibition over the first 10 days of reprogramming.  These differences in fibroblast growth rate may account for the differences in iXEN and iPSC reprogramming efficiency in each condition (n = 2 wells for each treatment at each time point; error bars = standard error).  111  Figure 3.2. iXEN cells express Oct4 after reprogramming A) Images taken on Day 20 of OSKM reprogramming show that both iXEN and iPSC colonies express Oct4-GFP.  This suggests that previous studies using Oct4 expression to count changes in the number of iPSCs were likely counting iXEN as well (scale bar = 200 uM).  B) FACS analysis of cells on Day 20 of OSKM reprogramming shows cells that are GATA6-positive/Oct4-GFP-positive and SOX17-positive/Oct4-GFP-positive. We found that ~37% of all GATA6-positive cells and ~38% of all SOX17+ cells were Oct4-GFP-positive.   112 Figure 3.3. iXEN and iPSC reprogramming efficiency is decreased when reprogramming in a XEN environment A) Both iXEN and iPSC reprogramming efficiency decreases by ~1.5x when reprogramming on inactivated XEN cells versus gelatin (n = 4 reprogrammed wells; error bars = standard error; iXEN T-Test = 0.006; iPSC T-Test = 0.05).                       113 Figure 3.4. Double knockdown or overexpression, of XEN genes can change iXEN and iPSC reprogramming efficiency A) XEN gene double knockdown did not significantly increase iPSC reprogramming efficiency with every combination of Gata6, Gata4, Sox17, and Sox7 knockdown (n = 3 reprogrammed wells per treatment; error bars = standard error).  B) XEN gene double knockdown significantly decreased the number of iXEN with every combination of Gata6, Gata4, Sox17, and Sox7 knockdown (n = 3 reprogrammed wells per treatment; error bars = standard error).  C)   114 Figure 3.4 contÕd Overexpression of Gata6, but no other XEN genes, decreased iPSC reprogramming efficiency (n = 3 reprogrammed wells per treatment; error bars = standard error).  D) Overexpression of XEN genes did not change the number of iXEN made in reprogramming (n = 3 reprogrammed wells per treatment; error bars = standard error).  E) Validation of XEN gene knockdown after treatment with shRNA.  This graph shows that XEN gene expression is reduced after shRNA treatment. (n = 1 well per treatment; error bars = standard error).  F) Validation of XEN gene overexpression after viral treatment.  This graph shows that MEFs express each of the 4 XEN genes after they were induced with the corresponding virus (n = 1 well per treatment; error bars = standard error).                                     115  Figure 3.5. All four factors are required to make iXEN A) OSKM is the only treatment where both iXEN and iPSCs are made. OSK treatment can generate a small number of iPSCs, but no iXEN (n = 3 reprogrammed wells per treatment; error bars = standard error).  B) OSKM is the only treatment that significantly induces XEN genes (Sox17, Sox7, Gata6, and Gata4) over Mock treatment (n = 3 reprogrammed wells per treatment; error bars = standard error).    116 Figure 3.6. Genetic background and age are not strict barriers to the acquisition of iXEN fate A) iXEN and iPSCs are made when young (4-week) and old (19-month) BALB/c fibroblasts are reprogrammed with OSKM.  Old cells show a similar decrease in both iXEN and iPSC reprogramming efficiency (n = 4 fibroblast lines per age group ; error bars = standard error).                    117 Figure 3.7. Summary of attempts to assess the effect of chemical reprogramming on iXEN and iPSC reprogramming efficiency A) Image of cells on Day 20 of chemical reprogramming (scale bar = 100 um).  B) Summary table showing my attempts to reprogram MEFs with small molecules.  I reprogrammed on 4 different occasions and treated 3 wells each of 50,000 and 100,000 cells.  Experiment continued until day 40, however no iPSCs or iXEN colonies were observed.                118 Figure 3.8. Pdgfralpha-GFP reporter MEF line cannot be used to isolate iXEN or iXEN progenitors during reprogramming A) Pdgfralpha reporter activity is not dependent on the presence of iXEN.  Mock treatment, where no iXEN are made, produced a greater percentage of Pdgfralpha-GFP positive cells than OSKM treatment, which generates iXEN.                 119             REFERENCES             120 REFERENCES    Aksoy, I., Jauch, R., Chen, J., Dyla, M., Divakar, U., Bogu, G.K., Teo, R., Ng, C.K.L., Herath, W., Lili, S. and Hutchins, A.P., 2013. Oct4 switches partnering from Sox2 to Sox17 to reinterpret the enhancer code and specify endoderm. The EMBO journal, 32(7), pp.938-953.  Banito, A., Rashid, S.T., Acosta, J.C., Li, S., Pereira, C.F., Geti, I., Pinho, S., Silva, J.C., Azuara, V., Walsh, M. and Vallier, L., 2009. Senescence impairs successful reprogramming to pluripotent stem cells. Genes & development,23(18), pp.2134-2139.  Belteki, G., Haigh, J., Kabacs, N., Haigh, K., Sison, K., Costantini, F., Whitsett, J., Quaggin, S.E. and Nagy, A., 2005. Conditional and inducible transgene expression in mice through the combinatorial use of Cre-mediated recombination and tetracycline induction. Nucleic acids research, 33(5), pp.e51-e51.  Buganim, Y., Faddah, D.A., Cheng, A.W., Itskovich, E., Markoulaki, S., Ganz, K., Klemm, S.L., van Oudenaarden, A. and Jaenisch, R., 2012. Single-cell expression analyses during cellular reprogramming reveal an early stochastic and a late hierarchic phase. Cell, 150(6), pp.1209-1222.  Caldwell, M.A., Garcion, E., He, X. and Svendsen, C.N., 2004. Heparin stabilizes FGF-2 and modulates striatal precursor cell behavior in response to EGF. Experimental neurology, 188(2), pp.408-420.  Chen, J., Liu, J., Chen, Y., Yang, J., Chen, J., Liu, H., Zhao, X., Mo, K., Song, H., Guo, L. and Chu, S., 2011. Rational optimization of reprogramming culture conditions for the generation of induced pluripotent stem cells with ultra-high efficiency and fast kinetics. Cell research, 21(6), pp.884-894.  dos Santos, R.L., Tosti, L., Radzisheuskaya, A., Caballero, I.M., Kaji, K., Hendrich, B. and Silva, J.C., 2014. MBD3/NuRD facilitates induction of pluripotency in a context-dependent manner. Cell stem cell, 15(1), pp.102-110.  Esteban, M.A., Wang, T., Qin, B., Yang, J., Qin, D., Cai, J., Li, W., Weng, Z., Chen, J., Ni, S. and Chen, K., 2010. Vitamin C enhances the generation of mouse and human induced pluripotent stem cells. Cell stem cell, 6(1), pp.71-79.  Feng, B., Ng, J.H., Heng, J.C.D. and Ng, H.H., 2009. Molecules that promote or enhance reprogramming of somatic cells to induced pluripotent stem cells. Cell stem cell, 4(4), pp.301-312.   121 Frum, T., Halbisen, M.A., Wang, C., Amiri, H., Robson, P. and Ralston, A., 2013. Oct4 cell-autonomously promotes primitive endoderm development in the mouse blastocyst. Developmental cell, 25(6), pp.610-622.  Giorgetti, A., Montserrat, N., Aasen, T., Gonzalez, F., Rodr™guez-Piz‹, I., Vassena, R., Raya, A., Bou”, S., Barrero, M.J., Corbella, B.A. and Torrabadella, M., 2009. Generation of induced pluripotent stem cells from human cord blood using OCT4 and SOX2. Cell stem cell, 5(4), p.353.  Gospodarowicz, D. and Cheng, J., 1986. Heparin protects basic and acidic FGF from inactivation. Journal of cellular physiology, 128(3), pp.475-484.  Hamilton, T.G., Klinghoffer, R.A., Corrin, P.D. and Soriano, P., 2003. Evolutionary divergence of platelet-derived growth factor alpha receptor signaling mechanisms. Molecular and cellular biology, 23(11), pp.4013-4025.  Hong, H., Takahashi, K., Ichisaka, T., Aoi, T., Kanagawa, O., Nakagawa, M., Okita, K. and Yamanaka, S., 2009. Suppression of induced pluripotent stem cell generation by the p53Ðp21 pathway. Nature, 460(7259), pp.1132-1135.  Hou, P., Li, Y., Zhang, X., Liu, C., Guan, J., Li, H., Zhao, T., Ye, J., Yang, W., Liu, K. and Ge, J., 2013. Pluripotent stem cells induced from mouse somatic cells by small-molecule compounds. Science, 341(6146), pp.651-654.  Huangfu, D., Maehr, R., Guo, W., Eijkelenboom, A., Snitow, M., Chen, A.E. and Melton, D.A., 2008. Induction of pluripotent stem cells by defined factors is greatly improved by small-molecule compounds. Nature biotechnology,26(7), pp.795-797.  Ichida, J.K., Blanchard, J., Lam, K., Son, E.Y., Chung, J.E., Egli, D., Loh, K.M., Carter, A.C., Di Giorgio, F.P., Koszka, K. and Huangfu, D., 2009. A small-molecule inhibitor of Tgf-$ signaling replaces Sox2 in reprogramming by inducing Nanog. Cell stem cell, 5(5), pp.491-503.  Judson, R.L., Babiarz, J.E., Venere, M. and Blelloch, R., 2009. Embryonic stem cellÐspecific microRNAs promote induced pluripotency. Nature biotechnology, 27(5), pp.459-461.  Kang, M., Piliszek, A., Artus, J. and Hadjantonakis, A.K., 2013. FGF4 is required for lineage restriction and salt-and-pepper distribution of primitive endoderm factors but not their initial expression in the mouse. Development,140(2), pp.267-279.  Kosaka, N., Sakamoto, H., Terada, M., & Ochiya, T. (2009). Pleiotropic function of FGF!4: Its role in development and stem cells. Developmental Dynamics, 238(2), 265-276.   122 Krawchuk, D., Honma-Yamanaka, N., Anani, S. and Yamanaka, Y., 2013. FGF4 is a limiting factor controlling the proportions of primitive endoderm and epiblast in the ICM of the mouse blastocyst. Developmental biology, 384(1), pp.65-71.  Kunath, T., Arnaud, D., Uy, G.D., Okamoto, I., Chureau, C., Yamanaka, Y., Heard, E., Gardner, R.L., Avner, P. and Rossant, J., 2005. Imprinted X-inactivation in extra-embryonic endoderm cell lines from mouse blastocysts. Development, 132(7), pp.1649-1661.  Lengner, C.J., Camargo, F.D., Hochedlinger, K., Welstead, G.G., Zaidi, S., Gokhale, S., Scholer, H.R., Tomilin, A. and Jaenisch, R., 2007. Oct4 expression is not required for mouse somatic stem cell self-renewal. Cell stem cell, 1(4), pp.403-415.  Le Bin, G.C., MuŒoz-Descalzo, S., Kurowski, A., Leitch, H., Lou, X., Mansfield, W., Etienne-Dumeau, C., Grabole, N., Mulas, C., Niwa, H. and Hadjantonakis, A.K., 2014. Oct4 is required for lineage priming in the developing inner cell mass of the mouse blastocyst. Development, 141(5), pp.1001-1010.  Li, H., Collado, M., Villasante, A., Strati, K., Ortega, S., CaŒamero, M., Blasco, M.A. and Serrano, M., 2009. The Ink4/Arf locus is a barrier for iPS cell reprogramming. Nature, 460(7259), pp.1136-1139.  Li, R., Liang, J., Ni, S., Zhou, T., Qing, X., Li, H., He, W., Chen, J., Li, F., Zhuang, Q. and Qin, B., 2010. A mesenchymal-to-epithelial transition initiates and is required for the nuclear reprogramming of mouse fibroblasts. Cell stem cell, 7(1), pp.51-63.  Maekawa, M., Yamaguchi, K., Nakamura, T., Shibukawa, R., Kodanaka, I., Ichisaka, T., Kawamura, Y., Mochizuki, H., Goshima, N. and Yamanaka, S., 2011. Direct reprogramming of somatic cells is promoted by maternal transcription factor Glis1. Nature, 474(7350), pp.225-229.  Messerschmidt, D.M. and Kemler, R., 2010. Nanog is required for primitive endoderm formation through a non-cell autonomous mechanism. Developmental biology, 344(1), pp.129-137.  Plusa, B., Piliszek, A., Frankenberg, S., Artus, J. and Hadjantonakis, A.K., 2008. Distinct sequential cell behaviours direct primitive endoderm formation in the mouse blastocyst. Development, 135(18), pp.3081-3091.  Rais, Y., Zviran, A., Geula, S., Gafni, O., Chomsky, E., Viukov, S., Mansour, A.A., Caspi, I., Krupalnik, V., Zerbib, M. and Maza, I., 2013. Deterministic direct reprogramming of somatic cells to pluripotency. Nature, 502(7469), pp.65-70.  Samavarchi-Tehrani, P., Golipour, A., David, L., Sung, H.K., Beyer, T.A., Datti, A., Woltjen, K., Nagy, A. and Wrana, J.L., 2010. Functional genomics reveals a BMP-driven mesenchymal-to-epithelial transition in the initiation of somatic cell reprogramming. Cell  123 stem cell, 7(1), pp.64-77.  Schlessinger, J., Plotnikov, A.N., Ibrahimi, O.A., Eliseenkova, A.V., Yeh, B.K., Yayon, A., Linhardt, R.J. and Mohammadi, M., 2000. Crystal structure of a ternary FGF-FGFR-heparin complex reveals a dual role for heparin in FGFR binding and dimerization. Molecular cell, 6(3), pp.743-750.  Silva, J., Barrandon, O., Nichols, J., Kawaguchi, J., Theunissen, T.W. and Smith, A., 2008. Promotion of reprogramming to ground state pluripotency by signal inhibition. PLoS Biol, 6(10), p.e253.  Rugg-Gunn, P.J., Cox, B.J., Lanner, F., Sharma, P., Ignatchenko, V., McDonald, A.C., Garner, J., Gramolini, A.O., Rossant, J. and Kislinger, T., 2012. Cell-surface proteomics identifies lineage-specific markers of embryo-derived stem cells. Developmental cell, 22(4), pp.887-901.  Schnabel, L.V., Abratte, C.M., Schimenti, J.C., Southard, T.L. and Fortier, L.A., 2012. Genetic background affects induced pluripotent stem cell generation. Stem Cell Res Ther, 3, p.30.  Shi, Y., Desponts, C., Do, J.T., Hahm, H.S., Schıler, H.R. and Ding, S., 2008. Induction of pluripotent stem cells from mouse embryonic fibroblasts by Oct4 and Klf4 with small-molecule compounds. Cell stem cell, 3(5), pp.568-574.  Silva, J., Barrandon, O., Nichols, J., Kawaguchi, J., Theunissen, T.W. and Smith, A., 2008. Promotion of reprogramming to ground state pluripotency by signal inhibition. PLoS Biol, 6(10), p.e253.  Stadtfeld, M., Maherali, N., Breault, D.T. and Hochedlinger, K., 2008. Defining molecular cornerstones during fibroblast to iPS cell reprogramming in mouse. Cell stem cell, 2(3), pp.230-240.  Takahashi, K. and Yamanaka, S., 2006. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. cell,126(4), pp.663-676.  Thomas, P. and Beddington, R., 1996. Anterior primitive endoderm may be responsible for patterning the anterior neural plate in the mouse embryo.Current Biology, 6(11), pp.1487-1496.  Wernig, M., Meissner, A., Cassady, J.P. and Jaenisch, R., 2008. c-Myc is dispensable for direct reprogramming of mouse fibroblasts. Cell stem cell,2(1), pp.10-12.  Yamanaka, Y., Lanner, F. and Rossant, J., 2010. FGF signal-dependent segregation of primitive endoderm and epiblast in the mouse blastocyst. Development, 137(5), pp.715-724.   124 Ye, J., Ge, J., Zhang, X., Cheng, L., Zhang, Z., He, S., Wang, Y., Lin, H., Yang, W., Liu, J. and Zhao, Y., 2016. Pluripotent stem cells induced from mouse neural stem cells and small intestinal epithelial cells by small molecule compounds. Cell research, 26(1), pp.34-45.  Zhao, X.Y., Li, W., Lv, Z., Liu, L., Tong, M., Hai, T., Hao, J., Guo, C.L., Ma, Q.W., Wang, L. and Zeng, F., 2009. iPS cells produce viable mice through tetraploid complementation. Nature, 461(7260), pp.86-90.  Zhao, Y., Yin, X., Qin, H., Zhu, F., Liu, H., Yang, W., Zhang, Q., Xiang, C., Hou, P., Song, Z. and Liu, Y., 2008. Two supporting factors greatly improve the efficiency of human iPSC generation. Cell stem cell, 3(5), pp.475-479.                    125 Chapter 4   Examining the Impact of Aging on iPSC Reprogramming     A. Parenti wrote the chapter, assembled the figures, and performed the experiments. A. Ralston edited the chapter. M. Halbisen performed analysis on microarray samples in Fig 1D.              126 Abstract  Induced pluripotent stem cells (iPSCs), are similar to embryonic stem cells (ESCs) in that they can generate any type of cell in the body, but offer the advantage of being derived from the patient recipient.  Recent work suggests that cells from older individuals can generate iPSCs, but do so 2-5x less efficiently than young cells.  Intriguingly, some classic signs of aging, like telomere length and mitochondrial function, are rejuvenated by reprogramming.  However, the possibility that iPSCs derived from old cells ÒrememberÓ their true age could influence their quality and safety in a clinical setting.  Consequently, we have performed a rigorous comparison of the effect of aging on iPSCs and differentiated cells derived from these iPSCs.   We evaluated potential differences in iPSCs generated from old and young individuals by comparative analysis of cellular characteristics, and performed a functional analysis of cells derived from young and old iPSCs to determine if they ÒrememberÓ their true age, or if the reprogramming process had rejuvenated them.  We found that fibroblasts from old mice generate iPSCs less efficiently than those from young mice.  Further, we found that age related functional defects present in the parental fibroblasts used to make iPSCs were also present in fibroblasts derived from iPSCs.  This suggests that while reprogramming rejuvenates some characteristics aging, it does not completely reset old cells to a youthful state, which may impede the use of iPSC technology in regenerative medicine.     127 Section 1.  Introduction  Embryonic stem cells (ESC) are pluripotent, meaning they can differentiate into any cell of the body (Evans and Kaufman, 1981; Martin, 1981, Thomson, 1998).  While ESCs could be used in cell replacement therapies to treat many disorders, they would not be derived from the patient they are used to treat which could lead to graft rejection.  Further, ESC derivation requires the destruction of an embryo, which leads to ethical and political controversy.  While ESCs remain a powerful tool with great potential, the technical and ethical barriers associated with their use remain major roadblocks.  In 2006, Shinya YamanakaÕs group discovered it is possible to generate induced pluripotent stem cells (iPSC) from a patientÕs terminally differentiated cells by inducing expression of four transcription factors, Oct4, Sox2, Klf4, and cMyc (OSKM) (Takahashi and Yamanaka, 2006, Takahashi et al., 2007, Yu et al., 2007).  iPSCs are nearly identical to ESCs in terms of their epigenetic and transcriptional profiles, and also have the ability the differentiate into any type of cell in the body (Takahashi and Yamanaka, 2006; Yu et a., 2007; Takahashi et al., 2007; Lowry et al., 2008; Kang et al., 2009; Marion et al., 2009; Zhao et al., 2009; Guenther et al., 2010).  Unlike ESCs, iPSCs are derived directly from the patients they would be used to treat, and thus are less likely to be rejected by the patient immune system.  Further, iPSCs are not derived from embryos, which make them ethically less problematic.  iPSCs offer a renewable source of cells to replace defective tissue, study disease models outside of the body, and potentially cure a number of diseases that plague modern society, including those associated with aging.  128  While iPSCs offer a great deal of hope for the future, a number of reports detail several areas of concern (Pera, 2011).  First, routinely, less than 1% of cells can become iPSCs, and many studies show that the current OSKM reprogramming protocol actually selects for cells in the parental population with problematic mutations (Gore et al., 2011; Young et al., 2012).  Further, OSKM reprogramming introduces new mutations during the conversion from a differentiated cell to an iPSC (Hussein et al., 2011; Laurent et al., 2011).  One hypothesis in the field is that the extremely low efficiency of reprogramming produces low quality iPSCs that will not be useful in a clinical setting (Okita and Yamanaka, 2011).  Efforts to improve reprogramming efficiency are underway so that cells that do not carry problematic mutations can become iPSCs.    A key area of research where iPSC technology could make an impact is in the study of aging and age-related diseases.  Studies characterizing the effect of aging on iPSCs demonstrate that old cells can be reprogrammed with OSKM to become iPSCs, which demonstrates that age is not a complete barrier to reprogramming (Li et al., 2009; Lapasset et al., 2011).  Further, previous studies show that some classic signs of aging like shortened telomeres, mitochondrial dysfunction, and an ÒoldÓ transcriptional profile are rejuvenated and returned to an embryonic state (Banito et al., 2009; Li et al., 2009; Marion et al., 2009; Lapasset et al., 2011).  However, these studies found that iPSC reprogramming efficiency using old cells is~2-5x lower than young cells.  Reduced efficiency associated with reprogramming older cells becomes even more concerning when we consider that our cells tend to gain mutations as we age, increasing the  129 likelihood that problematic mutations present in the parental population will be present in the iPSCs.  Each of the earlier studies examining the effect of aging on iPSCs added valuable insight and showed that reprogramming can rejuvenate some signs of aging (Marion et al., 2009).   However, few of the studies actually analyzed cells derived from the iPSCs, the cells that would actually be used in a therapeutic setting, to determine if they had been rejuvenated by OSKM reprogramming.  The studies that analyzed iPSC-derived cells examined cellular markers of aging (telomere length, mitochondrial function, DNA-damage response, and nuclear lamina-associated proteins) and found that the iPSC-derived cells did not maintain a ÒmemoryÓ of the true age, and appeared to be rejuvenated (Lapasset et al., 2011; Miller et al., 2013).  However, these studies did not use any functional assays to determine if the iPSC-derived cells were functionally rejuvenated by OSKM reprogramming.   In the research presented below, we demonstrate that age related functional defects present in the parental fibroblast population are still present in iPSC-derived fibroblasts.  Our work suggests that, at a functional level, OSKM reprogramming does not rejuvenate old cells.  Further, our work suggests that the iPSC field needs to reevaluate the way we think about reprogramming in the context of aging.  However, our findings also suggest that use of iPSC-derived cells to model age related diseases may be more feasible than many have thought possible, because age related functional defects are still present.  Our work should serve as the impetus for future studies of human iPSCs and aging.   130  Section 2.  Materials and Methods Mouse Strains C57BL/6 mice were aged in-house and had the following allele: Tg(Thy1-CFP)23Jrs (Feng et al., 2000).  BALB/c, CBA, and DBA mice were aged at the NIA.  All animal work conformed to the guidelines and regulatory standards of the University of Michigan State University Institutional Animal Care and Use Committee.  Fibroblast preparations   To establish fibroblast lines, ear punches and adult tail tips were isolated, epidermis was removed, and remaining tissue was plated in MEF medium [DMEM, 10% Fetal Bovine Serum (Hyclone), Pen/Strep (10,000 units each), Glutamax (200 mM), NEAA (200 mM), and beta-mercaptoethanol (55 mM)] and grown at 37¡C with 5% CO2.  Each line was then cultured for seven days, harvested, frozen, and stored in liquid nitrogen until needed.  Reprogramming  OSKM retrovirus was produced by transfecting 293T cells with pCL-ECO and pMXs plasmids containing Oct4, Klf4, Sox2, or cMyc (OSKM) cDNAs (Addgene). Culture supernatant was harvested 48 hours later, and qPCR used to quantify soluble virus using standard curves. Viral preps were stored at -80¼C until use.  For retroviral reprogramming (Takahashi and Yamanaka, 2006), 6x107 copies each OSKM viral particle were added to 40,000 MEFs (passage 2), and incubated for 24 hr. Media was  131 then replaced with MEF medium, then ES Medium (FBS [DMEM (Invitrogen), 15% Fetal Bovine Serum (FBS; Hyclone), Pen/Strep (10,000 units each), Glutamax (200 mM), NEAA (200 mM), beta-mercaptoethanol (55 mM), and 10 ng/mL recombinant LIF (protocol available on request)]) on days 2 and 4, and then replaced with Reprogramming Medium (DMEM, 15% Knockout Serum Replacement (Invitrogen), Pen/Strep (10,000 units each), Glutamax (200 mM), NEAA (200 mM), beta-mercaptoethanol (55 mM), and 10 ng/mL LIF]) on day 6 and then every other day until day the end of the experiment.  On day 20 of reprogramming, the number of iPSC colonies were counted, and reprogramming efficiency was calculated by dividing that number by the number of cells initially infected with OSKM virus.  All iPSCs and ESCs were cultured for at least 10 passages before analysis.  ESC Derivation  Blastocysts were collected from pregnant mice on E3.5 by flushing uterine horns with M2 medium (Millipore).  Blastocysts were then transferred to a single well of a 4-well dish plated with mitotically inactivated (3,500 rads) MEFs in KOSM+AA +2i (1 "M PD0325901 and 3 "M CHIR99021) ES cell and were incubated overnight at 37¡C with 5% CO2.  The next day, each embryo was moved to its own MEF covered well on a 4-well dish with ES Medium +2i [DMEM (Invitrogen), 15% Fetal Bovine Serum (FBS; Hyclone), Pen/Strep (10,000 units each), Glutamax (200 mM), NEAA (200 mM), beta-mercaptoethanol (55 mM), PD0325901 (1 "M), CHIR99021 (3 "M), and 10 ng/mL recombinant LIF (protocol available on request)]).  The medium was changed every 4 days, and on day 10, blastocyst outgrowths were dissociated with trypsin, and then  132 cultured another 5-7 days in ES Medium +2i.  Finally, expanded ESC lines were frozen and stored in liquid nitrogen until needed.  Chimera Generation  Embryo manipulation and transfers were performed as previously described (Cheng et al., 2009). To create chimeras, ~15 fluorescently labeled cells were injected into each blastocoel of unlabeled CD-1 host blastocysts, and the injected embryos were then transferred into the uterus of E2.5 pseudopregnant recipient females.  Embryos were allowed to come to term and chimeric contribution was assessed by coat color 1 week after birth.  Chromosome Counting  Cells were grown to ~60% confluence in a single well of a 6 well dish.  ESC Medium or MEFs Medium was added to a final volume of 3 mL for ESC/iPSC or fibroblasts respectively.  Cells were returned to 37 ¼C for at least 30 min.  Next, 300 "L Colcemid (Life Tech) was added to the well and cells were incubated at 37 ¼C for 1 hr (ESC or iPSC) or 6 hr (fibroblasts).  After incubation, cells were raised off of the wells with Trypsin, and pelleted in a 15 mL conical tube.  Cells were then resuspended in ice cold KCL (0.56%) and incubated at room temperature for 6 min.  The cells were pelleted again and all but 100 "L of KCL was removed.  Cells were resuspended in the 100 "L of leftover KCL and then fixed with ice cold Fixing Medium (3:1 methanol:glacial acetic acid).  Cell were pelleted again and all but ~100 "L of Fixing Medium was removed.  Cells were resuspended in leftover 100 "L of Fixing Medium and then placed onto glass  133 slides drop wise from a height of 12 inches.  Next, slides were allowed to air dry for 1 hr before 100 "L of Vectashield with DAPI was added to the dried cells and covered with a coverslip.  Chromosomes were imaged on Olympus Fluoview Confocal Microscope with a 60x objective.  At least 5 spreads were counted for every sample.  Embryoid Body Differentiation  ESCs or iPSCs were grown to confluence and raised off of the bottom of the well with Trypsin.  Cells were pelleted, resuspended in ES Medium +FBS without LIF, and counted with a  hemocytometer.  Then, 2x106 cells were added to a 10cm non-adherent dish that had 10 mL ES Medium +FBS without LIF.  Cells were cultured at 37 ¼C 5% CO2 for 8 days, with media changes every 3 days.  After 8 days, all floating embryoid bodies were collected, pelleted, and resuspended in Trizol for RNA extraction.  Fibroblast Derivation from iPSCs  Fibroblast derivation from iPSCs combined work presented previously (Mio et al., 1996; Togo et al., 2011).  Briefly, iPSCs were grown to confluence and raised off of the bottom of the well with Trypsin.  Cells were pelleted, resuspended in ES Medium +FBS without LIF, and counted with a  hemocytometer.  Then, 2x106 cells were added to a 10cm non-adherent dish that had 10 mL ES Medium +FBS without LIF.  Cells were cultured at 37 ¼C 5% CO2 for 8 days, with media changes every 3 days.  After 8 days, all floating Embryoid Bodies were collected, pelleted, and resuspended in collagen solution [Rat Tail Tip Collagen 0.5 mg/mL (Sigma), distilled water, 10% FBS, and 4X DMEM (Life Tech)].  The collagen/cell mixture was added to tissue culture dishes and  134 allow it to solidify.  After the collagen/cell mix has solidified, and equal volume of MEFs Medium was added.  The plates were then incubated in 5% CO2 at 37 ¼C for 21 days and the medium was changed every other day.  After 21 days collagen gels were dissolved with 1 mg/ml collagenase @ 5% CO2 at 37 ¼C for 1 hour.  Then, the cells were washed once with 5 mL PBS and then resuspended in MEFs Medium.  The cells were then plated on a 10 cm plate in 10 mL MEFs media.  The cells were then passaged carefully (with Trypsin for ~3 min.) to prevent detachment of EBs. Then, cells were plated in a single well of a 6 well dish for 10 minutes to allow fibroblasts to attach.  Next, the supernatant  was removed and replate in a 10 cm dish.  Finally, 2 mL MEFs Medium was added to the well that cells were left to sit in for 10 min.  Allow 4-5 passages to remove all undifferentiated EBs.  RNA isolation and qPCR  RNA was harvested with Trizol (Invitrogen), and cDNA was reverse transcribed from 1 "g RNA using Qiagen QuantiTect Reverse Transcription Kit (Qiagen), following manufacturersÕ instructions.  For qPCR, cDNA was amplified using a Lightcycler 480 (Roche), according to manufacturerÕs guidelines.  The amplification efficiency of each primer pair (see Primers & Oligos), was measured by generating a standard curve from appropriate cDNA libraries.  All reactions were performed in quadruplicate.   Microarray Sample Preparation  RNA was harvested with Trizol (Invitrogen) and cleaned with RNeasy Kit (Qiagen).  Next, RNA quality and concentration was assessed with a Bioanalyzer RNA- 135 Total Eukaryotic Nano RNA chip.  Only samples with RIN number above 9 were used for experiments.  Next, the Ambion Poly-A RNA Control Kit was used to add control RNA to each sample.  Then, the Ambion WT Expression Kit was used to generate cDNA from our RNA for each sample.  Next, the Affymetrix WT Terminal Label Kit was used to fragment the cDNA and attach a fluorescent label for the array.  Next, the Affymetrix Hybridization Control Kit was used to prepare the labeled cDNA for hybridization on the Affymetrix Mouse Exon 1.0 ST Chip.  Finally, the Chip with hybridized cDNA was run on the Affymetrix Gene Chip Scanner.   Microarray Analysis  After microarray data was collected, an RMA gene level normalization was performed and COMBAT was used to correct batch effects (Johnson et al., 2007).  Next, MDS plots were generated using the limma R package (Smyth, 2004; Smyth, 2005) to visualize transcriptional similarities/differences between iPSCy, iPSCo, ESC, pFiby, and pFibo.   Scratch Assay  A razor blade was used to press a single line onto the underside of each well of a 12-well tissue culture dish.  Then, each well was coated with gelatin and 60,000 fibroblasts (parental or iPSC derived) were plated.  Each cell line tested was plated onto 4 wells.  After 3 hrs, a scratch was made down the middle of the well using a p200 pipette tip.  Immediately after the scratch was made, each well was rinsed with PBS, and 1 mL of MEFs Medium was added.  Each well was imaged first, by focusing on the  136 razor blade mark, to orient the image, and second focusing on the cells.  Images were taken every 6 hrs until the scratch was completely filled in.  After the images were collected, Adobe Illustrator was used to analyze each image and measure the size of the scratch at each time point.  Proliferation Assay  ESCs, iPSCs, and Fibroblasts were plated at 10,000 cells per well in 6 gelatinized wells of a 24-well dish and incubated at 5% CO2 at 37 ¼C.  24 hrs later, and every 24hrs for the next 6 days (excluding day 6), the cells were harvested from the wells with Trypsin and resuspended in 500 Ð 1000 "L in appropriate medium.  Cells were then counted on a hemocytometer and values were recorded for each day.  Section 3.  Results Old fibroblasts can generate iPSCs, but at lower efficiency than young cells  In the past, a number of groups characterized the effect of aging on OSKM reprogramming and found that old cells generate iPSCs less efficiently than young cells (Li et al., 2009; Lapasset et al., 2011; Prigione et al., 2011).  While each study contributes valuable information, they used few individuals per age group, did not control for sex, or did not rigorously evaluate the pluripotency of their iPSCs thus the implications of their results are challenging to extend beyond their respective studies.  We hypothesized that any differences related to age would be subtle, and thus any unnecessary source of noise introduced into the experiment would obscure the results.  To address this, we designed our experiments with special consideration to control for  137 genetic background, reprogramming method, sex, and cell passage number.  We infected passage 2 tail-tip fibroblasts derived from young (1-month) and old (19-month) C57BL/6 mice with OSKM retrovirus.  I found that both young and old fibroblasts could generate iPSCs (Fig. 4.1A), but the efficiency of forming iPSCs drops by ~2x when reprogramming old fibroblasts versus young fibroblasts (Fig 4.1B).  Our findings suggest that aging is a barrier to the acquisition of pluripotency, although the age-associated barrier to iPSC reprogramming can be overcome.  iPSCs derived from old cells show hallmarks of pluripotency  Previous groups studying the effect of aging on reprogramming used alkaline phosphatase staining as a marker of pluripotency, however alkaline phosphatase is expressed by partially reprogrammed cells as well (Li et al., 2009; Lapasset et al., 2011; Prigione et al., 2011).  Thus, their analyses may have counted partially reprogrammed cells as iPSCs which makes the implications of their results hard to predict.  We used four different methods to evaluate the pluripotency of the iPSCs we derived from aged mice.  First, we used qRT-PCR and found that there was no difference in expression levels of pluripotency markers Nanog, Oct3/4, Gdf3, Lin28, Stella, or Rex1 between ESCs, iPSC derived from young (iPSCy), and old (iPSCo) mice (Fig. 4.1C).  This suggests that at the transcriptional level, iPSCy and iPSCo are equivalent to each other and to ESCs.  Second, we analyzed each group of cells at the global transcriptional level with microarray.  A multidimensional scaling (MDS) plot shows that ESC, iPSCy, and iPSCo all cluster near each other, and away from both young and old fibroblasts (Fig. 4.1D).  This suggests that iPSCy and iPSCo are highly similar to ESCs, although  138 there may be subtle differences in gene expression.  Next, we differentiated these cell lines to embryoid bodies.  After differentiation, we use qRT-PCR and found that ESCs, iPSCy, and iPSCo all downregulated Nanog, a pluripotency marker, and upregulated markers of the three germ lineages Sox17 (endoderm), Zic1 (ectoderm), and Brachyury (mesoderm) (Fig. 4.1E).  This observation demonstrates that iPSCy and iPSCo are not transformed cells, but instead can differentiate in vitro like ESCs.  The gold standard assay for pluripotency is in vivo contribution in chimeras.  To test in vivo developmental potential, we injected 10-15 ESCs or iPSCs into CD-1 host blastocysts, transferred chimeric blastocysts into recipient mothers and let the pregnancies come to term.  We then assessed pup coat color contribution to determine what percentage of pups were chimeric.  We found that ESCs, iPSCy, and iPSCo, could all differentiate in vivo and contribute to chimeras (Fig. 4.1F).  Taken together, our results indicate that iPSCs, with all of the hallmarks of pluripotency, can be derived from old fibroblasts and that age is not a complete barrier to pluripotency.  Having established that our iPSCs have all of the hallmarks of pluripotency we were poised to assess the effect of aging on iPSC quality.  iPSCs derived from old fibroblasts display age related functional defects  As organisms age, their cells begin to show signs of aging, and previous reports show that some signs of aging such as telomere length, mitochondrial activity, and DNA-damage response are rejuvenated upon acquisition of pluripotency (Marion et al., 2009; Lapasset et al., 2011; Miller et al., 2013).  We sought to determine if there were any functional signs of aging that were not rejuvenated in iPSCo.  One hallmark of aging  139 is a decrease in cellular proliferation rate (Shiraha et al., 2000).  In order to determine if iPSCo grow at the same rate as iPSCy or ESCs, we performed a six-day proliferation assay and found that there was no difference in proliferation rate between ESC and iPSCy, however iPSCo proliferated much more slowly than both ESCs and iPSCy (Fig 4.2A).  This suggests that, while iPSCo have all of the hallmarks of pluripotency, they have a diminished proliferation capacity compared to iPSCy or ESC.  iPSC derived fibroblasts maintain proliferation defect  Our work above shows that iPSCs derived from old cells have an age related proliferation defect.  Of greater relevance to regenerative medicine however, is an analysis of cells derived from iPSCs.  Indeed, most studies that have described the effect of aging on iPSCs and OSKM reprogramming fail to evaluate cells derived from iPSCs to determine if they are functionally rejuvenated by the reprogramming process.  Differences that are present in iPSCy and iPSCo are interesting, but may not be meaningful if cells derived from iPSCs are functionally rejuvenated.  We hypothesized, therefore, that if reprogramming rejuvenates old cells, iPSC-derived cells would not maintain functional defects present in the aged parental population.  Among the many observable defects of old fibroblasts is a decrease in proliferation rate (Shiraha et al., 2000).  We examined the proliferation rate of the parental fibroblasts (pFib) using a six-day proliferation assay to determine whether proliferation rate decreases with age (Fig 4.3A).  Then, we examined proliferation rate in iPSC-derived fibroblasts to determine if the age-associated phenotype was maintain after reprogramming (iFib; Fig 4.3A).  We found that pFiby grew faster that pFibo (Fig 4.3B), indicating that old cells have age- 140 associated functional defects.  After confirming that fibroblast exhibit an age-associated proliferation abnormality, we performed a directed differentiation of iPSCy and iPSCo to fibroblasts (Fig 4.3A), and confirmed that we had obtained fibroblasts by assessing expression of Nanog, a pluripotency marker, and a fibroblast specific marker FSP-1 (Fig 4.3D and E).  Once we had obtained iFib from iPSCy (iFiby) and iPSCo (iFibo), we performed the same proliferation assay and observed that the age related proliferation defect was still present (Fig 4.3C).  This suggests that reprogramming had not rejuvenated the cells at the functional level, as we had hypothesized, and brings into question the utility of reprogramming to generate ÒyouthfulÓ cells.  iPSC derived fibroblasts maintain a migration defect  Our proliferation assay demonstrated that older fibroblasts do not proliferate as quickly as young cells and reprogramming does not erase the age related proliferation defect.  Another hallmark of aging is compromised wound healing (Guo and DiPietro, 2010), a process that relies on fibroblast migration.  Consistent with this idea, previously published work shows that fibroblast migration rate decreases with age (Reed et al., 2001).  We performed a wound-healing assay to determine if fibroblast migration is rejuvenated by reprogramming.  As in the proliferation assay, we started by examining pFiby and pFibo to determine if we could detect an age-associated defect in migration, and we found that pFibo migrated slower than pFiby (Fig 4.4B).  Next, we assessed migration rate of iFiby and iFibo with the same wound healing assay and found that iFibo did not migrate as quickly as iFiby (Fig 4.4C).  Just as with the proliferation assay,  141 this suggests reprogramming does not rejuvenate old cells, and that they maintain functional defects and a ÒmemoryÓ of their original age.  C57BL/6 pluripotent cells are karyotypically unstable  The work detailed above was performed in the C57BL/6 mouse background.  After establishing that iPSCy and iPSCo are transcriptionally and developmentally similar to ESCs we analyzed the chromosomal content of the pluripotent cells.  We found that >60% of pluripotent cells derived from C57BL/6 were aneuploid (Fig 4.5A).  Notably, the aneuploidy we uncovered was not age dependent, and was present in ESCs, iPSCy, and iPSCo from this genetic background.  After observing that every pluripotent cell line was aneuploid, we analyzed pFib and iFib, derived from the C57 pluripotent cell lines, to determine if they, too, were aneuploid.  Surprisingly, we found that pFiby, pFibo, iFiby, and iFibo were more chromosomal stability (~80% euploid; Fig 4.5B).  My data suggest that there is a selection process wherein a greater percentage of chromosomally normal pluripotent cells are able to differentiate but chromosomally unstable cells are not as likely to differentiate.  Indeed, there is recent evidence from the literature to suggest that, although there may be chromosomal abnormalities in the pluripotent population, cells derived from the pluripotent cells have fewer abnormalities (Gao et al., 2015).     142 iPSCs can be derived from aged BALB/c cells and do not show signs of aneuploidy  To account for differences in genetic background we repeated our reprogramming and differentiation experiments in three different inbred mouse strains: CBA, DBA, and BALB/c. To date, an exhaustive search of the literature shows that there are no reports of BALB/c pluripotent cells showing signs of aneuploidy.  I reprogrammed fibroblasts derived from young (4 week) and old (19 month) CBA and DBA mice, but was never able to derive iPSCs (data not shown).  This suggests that genetic background is a barrier to reprogramming, but has not been investigated rigorously by the field.  Then, I reprogrammed young (4 week) and old (19 month) tail tip fibroblasts with OSKM to generate iPSCs.  In addition, I derived ESCs from BALB/c blastocysts.  I found that my BALB/c results were very similar to my C57BL/6 results in that I could generate iPSCs from both young and old BALB/c cells but iPSC reprogramming efficiency was reduced by ~3x relative to young cells (Fig 4.6A and B).  I performed qRT-PCR analysis of BALB/c ESC, iPSCy, and iPSCo of pluripotency genes and found that there was no difference between ESCs, iPSCy, and iPSCo in terms of expression levels of Nanog, Oct4, Sox2, Gdf3, Utf1, Stella, and Rex1 (Fig 4.6C).  Further, BALB/c iPSCy and iPSCo differentiated in vitro in an embryoid body assay, where they downregulated Nanog, and upregulated markers of the three germ layers Sox17 (endoderm), Zic1 (ectoderm), and Hand1 (mesoderm; Fig 4.6D).  These data confirm our C57BL/6 results, that iPSCs with hallmarks of pluripotency can be generated from old cells, however, iPSC reprogramming efficiency is reduced ~3x when reprogramming old cells versus young cells.  143  Next, we sought to determine if BALB/c fibroblasts and pluripotent cells were karyotypically normal, or, if like C57BL/6 pluripotent cells, they were prone to chromosomal instability.  We counted chromosomes for each BALB/c fibroblast and pluripotent line and found that they were each ~90% euploid (Fig 4.6E).  This result demonstrates that BALB/c pluripotent cells are not prone to aneuploidy.  BALB/c fibroblasts show age-associated proliferation and migration defects  As of the time of writing, our efforts to derive fibroblasts from BALB/c iPSCs are underway.  We have, however, performed both proliferation and migration assays with BALB/c parental fibroblasts and found that BALB/c pFibo exhibit slower proliferation and migration rates than pFiby, consistent with our C57BL/6 results (Fig 4.7A and B).  We have set the groundwork for experiments that allow us to test our hypothesis, that OSKM reprogramming does not functionally rejuvenate old cells, in an additional mouse genetic background.  Section 4.  Discussion  Previous work aimed at gauging the impact of age on OSKM reprogramming focused on comparing iPSCs to ESCs.  These studies demonstrated that a number of key age-associated defects like transcriptional profile, mitochondrial dysfunction, and telomere length are all rejuvenated and returned to an embryonic like state after OSKM reprogramming.  However, most of the earlier studies ignored the impact of aging on cells derived from iPSCs, the cells that would eventually be used in regenerative medicine, and those that did focus on cellular markers of aging.  In the research  144 presented above, we used functional assays to analyze young and old cells before and after OSKM reprogramming and found that reprogramming had not rejuvenated the old cells.  Our results should change the way we think about iPSCs in the context of regenerative medicine and aging, and suggest that more work needs to be done to produce cells that are truly rejuvenated.  In the experiments presented above, we found that old cells from two different mouse genetic backgrounds, C57BL/6 and BALB/c, can be reprogrammed with OSKM to become iPSCs, but generate iPSCs  ~2x and ~3x less efficiently than young cells respectively.  Our observations confirm that, even though old cells are harder to reprogram, they can make bona fide iPSCs with OSKM reprogramming.  Further, using two different functional assays we found that cells derived from iPSCs had not been rejuvenated by the reprogramming process.  This suggests that even though we successfully generated iPSCs from old cells, the cells derived from those iPSCs maintained a ÒmemoryÓ of their true age.  Of greater importance, this finding suggests that even though many signs of aging are erased by reprogramming, differentiated cells derived from iPSCs may not be useful in treating age-associated defects.  Many studies using ESCs and iPSCs characterized the pluripotency of the cells without confirming that the pluripotent cells are chromosomally stable.  We analyzed the chromosomal content of all C57BL/6 pluripotent and pluripotent derived lines used in the above studies (iPSCy, iPSCo, ESC, iFiby, and iFibo), and found that C57BL/6 pluripotent lines are prone to become aneuploid.  Indeed, evidence in the literature confirms that abnormal chromosome number is a characteristic of C57BL/6 pluripotent cells, and not specific to our study (Hughes et al., 2007).  Interestingly, we found that  145 iFib derived from iPSCs were euploid, suggesting that, although the iPSCs are largely aneuploid, the differentiation process is selective, and mostly euploid cells can successfully differentiate.  Further, the fact that iFib are chromosomally normal suggests that our findings that old cells are not rejuvenated by OSKM reprogramming cannot be disregarded as a finding limited to aneuploid cells.  The work presented here is an important step in assessing the impact of aging on OSKM reprogramming.  Future analyses should be directed in 3 key areas: 1) Do other cell types maintain age-associated functional defects after OSKM reprogramming?  With each passing day, new directed differentiation protocols to derive myriad cell types from pluripotent stem cells are published.  An analysis of age related functional defects present in neurons, pancreatic islet cells, and cardiomyoctes before and after OSKM reprogramming would expand our knowledge of the effect of aging on OSKM reprogramming.  Further, these analyses would help determine if the inability to rejuvenate cells with OSKM reprogramming is restricted to fibroblasts, or if it is a universal defect.  2) Do different combinations of reprogramming factors, or the addition of small molecule inhibitors, improve our ability to rejuvenate old cells?  Over the past 10 years, a great deal of effort has been put into improving the reprogramming protocol and identifying conditions to generate iPSCs with different combinations of transcription factors and small molecules.  An analysis of iPSCs derived with different protocols and the cells derived from those iPSCs will shed light on the usefulness of each protocol to rejuvenate old cells.  3) Do cells derived from human iPSCs (HiPSCs) maintain age related functional defects?  Many of the earlier studies that reported that cellular markers of aging were erased in iPSC-derived cells were performed with human cells,  146 however those analyses did not examine functional rejuvenation.  Our work argues that these earlier studies should be revisited and functional signs of aging should be tested.  Our work suggests that OSKM reprogramming does not completely rejuvenate old cells and that iPSC-derived cells maintain age related functional defects, which is not desirable from a regenerative medicine point of view.  However, an alternate interpretation of our data is that maintenance of age-associated defects is a good thing for disease modeling.  If iPSC-derived cells are reset to a more youthful state, then uncovering the underlying mechanisms that led to the age related defects will be more challenging to study.  Our results suggest that iPSC-derived cells are a useful tool in studying aging and age related diseases because they maintain age related defects (Fig. 4.8).                          147              APPENDIX            148  Figure 4.1. C57BL/6 Old fibroblasts can be reprogrammed with OSKM to become iPSCs A) C57BL/6 ESC, iPSCy, and iPSCo have classic ESC morphology (scale bar = 100um).  B) Reprogramming efficiency drops by ~2x when reprogramming ÒoldÓ cells (19-month) versus ÒyoungÓ cells (4-week)(n= 4 cell lines derived from different individual mice for each age group; error = standard error).  C) qRT-PCR analysis shows that   149 Figure 4.1. contÕd iPSCy and iPSCo express pluripotency markers (Nanog, Stella, Rex1, Oct3/4, Lin28, and Gdf3) at similar levels to ESCs )(n= 4 cell lines derived from different individual mice for each age group; error = standard error).  D) Multi-dimensional Scaling (MDS) analysis of top 5000 expressed genes shows that iPSCy and iPSCo are highly similar to ESC, but not similar to the young or old fibroblasts. Further, the MDS analysis shows that there are differences in the young and old fibroblast lines.  E) qRT-PCR analysis shows that ESC, iPSCy, and iPSCo can all differentiate in vitro in an embryoid body assay to downregulate the pluripotency marker Nanog and upregulate markers of each of the three germ lineages Sox17(endoderm), Brachyury(mesoderm), and Zic1(ectoderm) (Expression normalized to matched pluripotent lines.  Each column represents a different cell line generated from a single individual mouse; error = technical error normalized to matched pluripotent line).  F) Images of chimeric animals generated when ESC (n=17 of 48 pups), iPSCy (n=26 of 31 pups), or iPSCo (n=40 of 91 pups) were injected into albino host blastocysts.                                150 Figure 4.2. iPSCo have an age related proliferation defect A) 6-day proliferation assay demonstrates that there is no difference in proliferation rate between ESC and iPSCy, but iPSCo proliferate slower than both ESC and iPSCy (n= 4 cell lines for each cell type; error bars = standard error).                 151 Figure 4.3. Age related fibroblast proliferation defect is not erased by reprogramming A) Schematic detailing our experimental design.  Proliferation rate was assessed in pFiby and pFibo before reprogramming, differentiation, and retesting proliferation rate in iFiby and iFibo.  B) Proliferation assay shows that pFibo do not grow as quickly as pFiby (n= 4 cell lines for each age group; error bars = standard error).  C) Proliferation assay shows that iFibo do not grow as quickly as iFiby (n= 4 cell lines for each age group; error bars = standard error).  C) qRT-PCR analysis of Nanog expression in pluripotent cells (ESC), parental fibroblasts (pFib), and iPSC-derived fibroblasts (iFib) shows that Nanog expression is downregulated after iFib differentiation   152 Figure 4.3. contÕd  (n=2 cell lines for each group; error bars = standard error). D) qRT-PCR analysis of Fsp-1 expression in pluripotent cells (ESC), parental fibroblasts (pFib), and iPSC-derived fibroblasts (iFib) shows that Fsp-1 expression is upregulated after iFib differentiation (n=2 cell lines for each group; error bars = standard error).                                           153 Figure 4.4. Age related fibroblast migration defect is not erased by reprogramming A) Schematic detailing our experimental design.  Migration rate was assessed in pFiby and pFibo before reprogramming, differentiation, and retesting migration rate in iFiby and iFibo.  B) Migration assay shows that pFibo do not migrate as quickly as pFiby (n= 4 cell lines for each age group; error bars = standard error).  C) Migration assay shows that iFibo do not migrate as quickly as iFiby (n= 4 cell lines for each age group; error bars = standard error).                154  Figure 4.5. C57BL/6 pluripotent lines are prone to become aneuploid, but parental fibroblasts and iPSC-derived cells are normal A) Black bars are the percentage of cells with a normal chromosome number (40) and white bars are the percentage of cells  with an abnormal chromosome number.  C57BL/6 ESC, iPSCy, and iPSCo all have a large percentage of cells with an abnormal chromosome number (n= 4 cell lines for   155 Figure 4.5. contÕd each category; error bars = standard error).  B) Black bars are the percentage of cells with a normal chromosome number (40) and white bars are the percentage of cells  with an abnormal chromosome number.  C57BL/6 pFiby, pFibo, iFiby, and iFibo are ~80% euploid (n= 3 cell lines for each category; error bars = standard error).                                          156 Figure 4.6. BALB/c Old fibroblasts can be reprogrammed with OSKM to become iPSCs A) BALB/c ESC, iPSCy, and iPSCo have classic ESC morphology (scale bar = 200 "m).  B) Reprogramming efficiency drops by ~3x when reprogramming ÒoldÓ cells (19-month) versus ÒyoungÓ cells (4-week) (n= 4 cell lines derived from different individual mice for young and 6 for old; error = standard error).  C) qRT-PCR analysis shows that iPSCy and iPSCo express pluripotency markers (Nanog, Oct3/4, Sox2, Gdf3, Utf1, Stella, and Rex1) at similar levels to ESCs (n= 4 cell lines derived from different individual mice for ESC and iPSCy, and 6 individuals for iPSCo; error = standard error).  D) qRT-PCR analysis shows that iPSCy and iPSCo can differentiate in vitro in an embryoid body assay to downregulate the pluripotency marker Nanog and upregulate markers of each of the three germ lineages Sox17 (endoderm), Hand1 (mesoderm), and Zic1 (ectoderm) (Expression normalized to matched pluripotent lines.  Each column represents a different cell line generated from a single individual mouse;   157 Figure 4.6. contÕd error = technical error normalized to matched pluripotent line).  E) Black bars are the percentage of cells with a normal chromosome number (40) and white bars are the percentage of cells  with an abnormal chromosome number.  Chromosome counting demonstrates that all BALB/c pluripotent and fibroblast lines are ~90% euploid (n= 4 individuals for ESC, iPSCy, and pFiby; n= 6 individuals for iPSCo and pFibo; error bars = standard error).                                         158 Figure 4.7. Age related proliferation and migration defect present in BALB/c parental fibroblasts A) Proliferation assay shows that pFibo do not proliferate as quickly as pFiby (n= 4 cell lines for young and 6 for old; error bars = standard error).  C) Migration assay shows that pFibo do not migrate as quickly as pFiby (n= 4 cell lines for young and 6 for old; error bars = standard error).                             159 Figure 4.8. OSKM reprogramming does not erase age related functional defects Previous research suggests that cellular markers of aging (telomere length, abnormal mitochondrial function, and impaired DNA-damage response) are rejuvenated in iPSC-derived cells after OSKM reprogramming.  In the work presented herein, we demonstrate that there are functional signs of aging (proliferation and migration) that are not reset to an embryonic state in iPSC-derived cells after OSKM reprogramming.                    160            REFERENCES             161 REFERENCES    Banito, A., Rashid, S.T., Acosta, J.C., Li, S., Pereira, C.F., Geti, I., Pinho, S., Silva, J.C., Azuara, V., Walsh, M. and Vallier, L., 2009. Senescence impairs successful reprogramming to pluripotent stem cells. Genes & development,23(18), pp.2134-2139.  Evans, M.J. and Kaufman, M.H., 1981. Establishment in culture of pluripotential cells from mouse embryos. nature, 292(5819), pp.154-156.  Feng, G., Mellor, R.H., Bernstein, M., Keller-Peck, C., Nguyen, Q.T., Wallace, M., Nerbonne, J.M., Lichtman, J.W. and Sanes, J.R., 2000. Imaging neuronal subsets in transgenic mice expressing multiple spectral variants of GFP. Neuron, 28(1), pp.41-51.  Gao, S., Zheng, C., Chang, G., Liu, W., Kou, X., Tan, K., Tao, L., Xu, K., Wang, H., Cai, J. and Tian, J., 2015. Unique features of mutations revealed by sequentially reprogrammed induced pluripotent stem cells. Nature communications, 6.  Gore, A., Li, Z., Fung, H.L., Young, J.E., Agarwal, S., Antosiewicz-Bourget, J., Canto, I., Giorgetti, A., Israel, M.A., Kiskinis, E. and Lee, J.H., 2011. Somatic coding mutations in human induced pluripotent stem cells. Nature,471(7336), pp.63-67.  Guo, S. and DiPietro, L.A., 2010. Factors affecting wound healing. Journal of dental research, 89(3), pp.219-229.  Hughes, E.D., Qu, Y.Y., Genik, S.J., Lyons, R.H., Pacheco, C.D., Lieberman, A.P., Samuelson, L.C., Nasonkin, I.O., Camper, S.A., Van Keuren, M.L. and Saunders, T.L., 2007. Genetic variation in C57BL/6 ES cell lines and genetic instability in the Bruce4 C57BL/6 ES cell line. Mammalian Genome, 18(8), pp.549-558.  Hussein, S.M., Batada, N.N., Vuoristo, S., Ching, R.W., Autio, R., N−rv−, E., Ng, S., Sourour, M., H−m−l−inen, R., Olsson, C. and Lundin, K., 2011. Copy number variation and selection during reprogramming to pluripotency. Nature,471(7336), pp.58-62.  Johnson, W.E., Li, C. and Rabinovic, A., 2007. Adjusting batch effects in microarray expression data using empirical Bayes methods. Biostatistics,8(1), pp.118-127.  Lapasset, L., Milhavet, O., Prieur, A., Besnard, E., Babled, A., AŁt-Hamou, N., Leschik, J., Pellestor, F., Ramirez, J.M., De Vos, J. and Lehmann, S., 2011. Rejuvenating senescent and centenarian human cells by reprogramming through the pluripotent state. Genes & development, 25(21), pp.2248-2253.  Laurent, L.C., Ulitsky, I., Slavin, I., Tran, H., Schork, A., Morey, R., Lynch, C., Harness, J.V., Lee, S., Barrero, M.J. and Ku, S., 2011. Dynamic changes in the copy number of  162 pluripotency and cell proliferation genes in human ESCs and iPSCs during reprogramming and time in culture. Cell stem cell, 8(1), pp.106-118.  Li, H., Collado, M., Villasante, A., Strati, K., Ortega, S., CaŒamero, M., Blasco, M.A. and Serrano, M., 2009. The Ink4/Arf locus is a barrier for iPS cell reprogramming. Nature, 460(7259), pp.1136-1139.  Lowry, W.E., Richter, L., Yachechko, R., Pyle, A.D., Tchieu, J., Sridharan, R., Clark, A.T. and Plath, K., 2008. Generation of human induced pluripotent stem cells from dermal fibroblasts. Proceedings of the National Academy of Sciences, 105(8), pp.2883-2888.  Marion, R.M., Strati, K., Li, H., Tejera, A., Schoeftner, S., Ortega, S., Serrano, M. and Blasco, M.A., 2009. Telomeres acquire embryonic stem cell characteristics in induced pluripotent stem cells. Cell stem cell, 4(2), pp.141-154.  Martin, G.R., 1981. Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proceedings of the National Academy of Sciences, 78(12), pp.7634-7638.  Miller, J.D., Ganat, Y.M., Kishinevsky, S., Bowman, R.L., Liu, B., Tu, E.Y., Mandal, P.K., Vera, E., Shim, J.W., Kriks, S. and Taldone, T., 2013. Human iPSC-based modeling of late-onset disease via progerin-induced aging. Cell Stem Cell, 13(6), pp.691-705.  Mio, T., Adachi, Y., Romberger, D.J., Ertl, R.F. and Rennard, S.I., 1996. Regulation of fibroblast proliferation in three-dimensional collagen gel matrix. In Vitro Cellular & Developmental Biology-Animal, 32(7), pp.427-433.  Okita, K. and Yamanaka, S., 2011. Induced pluripotent stem cells: opportunities and challenges. Philosophical Transactions of the Royal Society of London B: Biological Sciences, 366(1575), pp.2198-2207.  Pera, M.F., 2011. Stem cells: The dark side of induced pluripotency. Nature,471(7336), pp.46-47.  Prigione, A. and Adjaye, J., 2010. Modulation of mitochondrial biogenesis and bioenergetic metabolism upon in vitro and in vivo differentiation of human ES and iPS cells. International Journal of Developmental Biology, 54(11), p.1729.  Reed, M.J., Ferara, N.S. and Vernon, R.B., 2001. Impaired migration, integrin function, and actin cytoskeletal organization in dermal fibroblasts from a subset of aged human donors. Mechanisms of ageing and development,122(11), pp.1203-1220.  Shiraha, H., Gupta, K., Drabik, K. and Wells, A., 2000. Aging fibroblasts present reduced epidermal growth factor (EGF) responsiveness due to preferential loss of EGF receptors. Journal of Biological Chemistry, 275(25), pp.19343-19351.  163  Smyth, G.K., 2004. Linear models and empirical Bayes methods for assessing differential expression in microarray experiments. Stat Appl Genet Mo B 3: Article 3Song JT, Lu H, Greenberg JT (2004) Divergent roles in Arabidopsis thaliana development and defense of two homologous genes, ABERRANT GROWTH AND DEATH2 and AGD2-LIKE DEFENSE RESPONSE PROTEIN1, encoding novel aminotransferases. Plant Cell, 16, p.353366.  Smyth, G.K., 2005. Limma: linear models for microarray data. InBioinformatics and computational biology solutions using R and Bioconductor(pp. 397-420). Springer New York.  Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J., Marshall, V.S. and Jones, J.M., 1998. Embryonic stem cell lines derived from human blastocysts. Science, 282(5391), pp.1145-1147.  Takahashi, K. and Yamanaka, S., 2006. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell,126(4), pp.663-676.  Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K. and Yamanaka, S., 2007. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell, 131(5), pp.861-872.  Togo, S., Sato, T., Sugiura, H., Wang, X., Basma, H., Nelson, A., Liu, X., Bargar, T.W., Sharp, J.G. and Rennard, S.I., 2011. Differentiation of embryonic stem cells into fibroblast-like cells in three-dimensional type I collagen gel cultures. In Vitro Cellular & Developmental Biology-Animal,47(2), pp.114-124.  Young, M.A., Larson, D.E., Sun, C.W., George, D.R., Ding, L., Miller, C.A., Lin, L., Pawlik, K.M., Chen, K., Fan, X. and Schmidt, H., 2012. Background mutations in parental cells account for most of the genetic heterogeneity of induced pluripotent stem cells. Cell stem cell, 10(5), pp.570-582.  Yu, J., Vodyanik, M.A., Smuga-Otto, K., Antosiewicz-Bourget, J., Frane, J.L., Tian, S., Nie, J., Jonsdottir, G.A., Ruotti, V., Stewart, R. and Slukvin, I.I., 2007. Induced pluripotent stem cell lines derived from human somatic cells. Science, 318(5858), pp.1917-1920.       164 Chapter 5  Cdx2 efficiently induces trophoblast stem-like cells in naŁve, but not primed, pluripotent stem cells.  Stephanie Blij1, Anthony Parenti1,2, Neeloufar Tabatabai-Yazdi1, Amy Ralston2# 1) Department of Molecular, Cell, and Developmental Biology, University of California Santa Cruz, Santa Cruz, CA, 96064 2) Department of Biochemistry and Molecular Biology, Michigan State University, East Lansing, MI, 48824   Published as: Blij, S., Parenti, A., Tabatabai-Yazdi, N., Ralston, A. (2015). Cdx2 efficiently induces trophoblast stem-like cells in naŁve, but not primed, pluripotent stem cells. Stem Cells and Development. 24(11), 1352-1365.  Note: A. Parenti helped edit the manuscript and performed experiments for Figures 5.1B, 5.1C, 5.1F, 5.1J, 5.1L, 5.2I, and all of 5.9.      165 Abstract  Diverse pluripotent stem cell lines have been derived from mouse, including embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs), embryonal carcinoma cells (ECCs), and epiblast stem cells (EpiSCs).  While all are pluripotent, these cell lines differ in terms of developmental origins, morphology, gene expression, and signaling, indicating that multiple pluripotent states exist.  Whether and how the pluripotent state influences the cell lineÕs developmental potential or the competence to respond to differentiation cues could help optimize directed differentiation protocols.  To determine whether pluripotent stem cell lines differ in developmental potential, we compared the capacity of mouse ESCs, iPSCs, ECCs, and EpiSCs to form trophoblast.  ESCs do not readily differentiate into trophoblast, but overexpression of the trophoblast-expressed transcription factor CDX2 leads to efficient differentiation to trophoblast and to formation of trophoblast stem cells (TSCs), in the presence of FGF4 and Heparin.  Interestingly, we found that iPSCs and ECCs could both give rise to TSC-like cells following Cdx2 overexpression, suggesting that these cell lines are equivalent in developmental potential.  By contrast, EpiSCs did not give rise to TSCs following Cdx2 overexpression, indicating that EpiSCs are no longer competent to respond to CDX2 by differentiating to trophoblast.  In addition, we noted that culturing ESCs in conditions that promote naŁve pluripotency improved the efficiency with which TSC-like cells could be derived.  This work demonstrates that CDX2 efficiently induces trophoblast in more naŁve than in primed pluripotent stem cells and that the pluripotent state can influence the developmental potential of stem cell lines.    166 Section 1.  Introduction  Pluripotent stem cell lines have been derived from diverse sources, and include mouse and human germ cell tumor-derived Embryonal Carcinoma Cells (ECCs; Kahan and Ephrussi, 1970), mouse and human preimplantation epiblast-derived Embryonic Stem Cells (ESCs; Evans and Kaufman, 1981; Thomson et al., 1998; Martin, 1981), mouse post-implantation epiblast-derived Epiblast Stem Cells (EpiSCs; Tesar et al., 2007; Brons et al., 2007), and mouse and human mature cell-derived induced Pluripotent Stem Cells (iPSCs; Takahashi and Yamanaka, 2006).  All these pluripotent stem cell lines are capable of self-renewal and differentiating to embryonic germ layer derivatives.  However, it has long been appreciated that there are differences in the morphology, gene expression, and pathways that regulate self-renewal and differentiation among these pluripotent stem cell lines (Ohtsuka and Dalton, 2008).  In addition, both human and mouse ESCs and iPSCs can exist in either of two pluripotent states, termed ground state and naŁve pluripotency (Marks et al., 2012; Ying et al., 2008; Nichols and Smith, 2009).  Recent studies have begun to investigate whether differences in pluripotent state influence each cell lineÕs ability to reproducibly differentiate into specific cell fates during directed in vitro differentiation (Marks et al., 2012; Cho et al., 2012; Bernemann et al., 2011).  Resolving the differences in in vitro differentiation among these cell types will critically inform the decision as to whether new stem cell models are equivalent to, or can effectively replace, ESCs as both a model for basic biology, and as a tool for regenerative medicine.  The mouse provides a powerful system for resolving differences in developmental potential among pluripotent stem cell lines because the developmental  167 potential of mouse pluripotent cell lines can be evaluated with reference to mouse development.  During mouse development, the first two lineage decisions establish the pluripotent epiblast and two extraembryonic tissues: the trophectoderm and the primitive endoderm.  The epiblast will give rise to fetus and contains progenitors of ESCs.  The trophectoderm (TE) lineage will give rise to placenta, and trophoblast stem cells can be derived from the TE in the presence of FGF4, Heparin (FGF4/Hep) and a feeder layer of mouse embryonic fibroblasts (MEFs; Tanaka et al., 1998).  Primitive endoderm (PE) will give rise to yolk sac, and extraembryonic endoderm (XEN) stem cells can be derived from the PE (Kunath et al., 2005).  Knowledge of signaling pathways and transcription factors that reinforce these three lineages in the blastocyst has pointed to ways to alter the developmental potential of the stem cell lines derived from the blastocystÕs lineages.  For example, ESCs can be converted to TSCs by overexpressing the TE-specific transcription factor CDX2, in TSC medium (Niwa et al., 2005) and by other means (Schenke-Layland et al., 2007; He et al., 2008; Nishioka et al., 2009; Lu et al., 2008; Cambuli et al., 2014).  Importantly, overexpression of CDX2 in ESCs leads to TSC-like cells with highly similar morphology, developmental potential, and gene expression as embryo-derived TSCs (Niwa et al., 2005; Ralston et al., 2010; Nishiyama et al., 2009).  Similarly, TSC can be converted to ESC-like iPSC by overexpressing Oct4 (Kuckenberg et al., 2011; Wu et al., 2011).  Likewise, ESC can be converted to XEN using growth factors or PE transcription factors (Cho et al., 2012; Niakan et al., 2010; Shimosato et al., 2007; Niakan et al., 2013; Schroeder et al., 2012).  Interestingly, differences in pluripotent state influence the ability of pluripotent stem cell lines to give rise to XEN cell lines (Cho et al., 2012).  Whether CDX2 efficiently induces formation of TSC-like cells in  168 EpiSC or ECC has not been examined, but would provide new insight into the developmental potential of the various pluripotent stem cell states.  Section 2.  Materials and Methods Cell culture  TSCs were maintained on MEFs in TSC medium (RPMI + 20% FBS + 1 "g/mL FGF4 and 1 U/mL Heparin (R&D Systems) as described (Tanaka et al., 1998), unless otherwise indicated. ESC and iPSC lines were maintained on mitotically inactivated MEFs in standard ESC medium (DMEM with 15% fetal bovine serum (FBS; Hyclone) and Leukemia Inhibitory Factor (LIF), or in 2i medium (15% knockout serum replacement (KOSR; Gibco) replaced FBS, 1 "M PD0325901 and 3 "M CHIR99021 (Stemgent).  EpiSCs were maintained on MEFs in EpiSC medium (1:1 DMEM/F12 (Gibco), 20% KOSR, 100 "M 2-mercaptoethanol, 2mM L-glutamine (Gibco), 1 mM non-essential amino acids (Gibco), 50 ug/mL penicillin/streptomycin (Gibco), and 5 ng/mL FGF2 (R&D Systems).  EpiSCs were split 1:4 every 2-3 days with type IV collagenase (Gibco).  ECCs were maintained in DMEM with 15% FBS, L-Glutamine, and Penicillin/Streptomycin.  Linearized pCAG-hCdx2ERT2-ires-puror construct was introduced into cells and stably transformed colonies were selected and screened as previously described (Ralston et al., 2010).  The Cdx2-overexpression assay was carried out by harvesting confluent wells of pluripotent cells and seeding at a 1:100 split ratio.  The next day media was replaced with TSC medium with FGF4, Heparin, and 4-hydroxytamoxifen (Sigma) to induce transgene activity.  After 6 days of CDX2ER  169 activation cells were passaged and maintained under standard TSC conditions for an additional 2-3 passages prior to gene expression analysis.  Reprogramming  Mouse iPS cells were generated by reprogramming as described (Takahashi and Yamanaka, 2006). Briefly, retroviral reprogramming vectors were produced by transfecting 293T cells with pCL-ECO and pMXs plasmid containing Oct4, Klf4, Sox2, or cMyc (OKSM) cDNAs (Addgene).  OKSM tissue culture supernatant was harvested 48 hr later and stored at -80¼C until use. Subsequently, passage 2 E13.5 MEFs were seeded at a density of 5000 cells/mL on gelatin in MEF culture medium (DMEM + 10% FBS + 200 mM glutamax + 10000 U each pen/strep) in 96-well plates. 24 hr later, MEFs were cultured in OKSM supernatant for 24 hr.  24 hr later, OKSM supernatant was replaced with MEF medium, and then standard ESC medium on days 2 and 4, and finally ESC medium w/ KOSR.  On day 18 after retroviral treatment, iPSC colonies were picked, expanded, and characterized after passage 10.  For immunofluorescent characterization, iPSCs were plated on gelatinized cover slips and grown overnight.  Cells were then fixed with 4% formaldehyde, washed with PBS, and incubated in 0.5% Triton x-100 in PBS for 30 min. Cells were then blocked in PBS with 10% FBS and 0.2% Triton x-100 for 1 hour at room temperature, then incubated in mouse anti-SSEA-1 (MC-480, Developmental Studies Hybridoma Bank) at 1:1000 in blocking buffer, overnight at 4¡C.  Cells were then washed with PBS and incubated with secondary antibody (Cy3-conjugated donkey anti-mouse IgM; Jackson Labs) at 1:1000 and 1:1000 DAPI (Sigma) in blocking buffer for 1 hour. For chimera characterization, iPS cells were injected into  170 CD1 blastocysts, which were then transferred to pseuodopregnant recipient females, whereupon they were allowed to come to term. All animal work conformed to the guidelines and regulatory standards of the University of California Santa Cruz Institutional Animal Care and Use Committee.  Gene expression analysis  RNA was harvested from cells using Trizol (Invitrogen).  cDNA was generated from 1 "g RNA using the Quantitect Reverse Transcription Kit (Qiagen). qPCR was performed using SYBR Green and LightCycler 480 (Roche).  All reactions were performed in triplicate, with 100-200 ng cDNA and 300 nM primers per reaction.  For each primer pair (Table 5.2), a standard curve was generated to determine PCR efficiency using either R1 ESC or TSC cDNA. Relative levels of gene expression were subsequently calculated using the empirically determined efficiency.    Section 3.  Results EpiSCs do not give rise to TSCs following overexpression of Cdx2 in TSC conditions  EpiSCs differ from ESCs in many ways, including developmental origin, morphology, gene expression, and developmental potential.  For example, EpiSCs are thought to be capable of differentiating to trophoblast cells (Tesar et al., 2007; Brons et al., 2007), while ESCs do not readily differentiate to trophoblast in the absence of transcription factor overexpression (Niwa et al., 2005; Beddington and Robertson, 1989; Niwa et al., 2000).  It is not yet known whether EpiSCs can give rise to TSC-like cells  171 following overexpression of Cdx2.  We therefore introduced a tamoxifen-inducible CDX2ER fusion protein (Niwa et al., 2005) into R1 ESCs (Nagy et al., 1993) and into EpiSCs (Tesar et al., 2007), and selected multiple subclones of each cell line that were stably expressing Cdx2ER.  Since Cdx2ER mRNA is constitutively expressed, but the CDX2ER protein remains inactive until 4-hydroxytamoxifen (Tx) is added (Eilers et al., 1989), we were able to screen ESC and EpiSC subclones by quantitative RT-PCR (qPCR) and to select subclones expressing levels of Cdx2ER that were at least as high as the level of Cdx2 detected in TSC lines (d S1). Subsequently, we attempted to derive TSCs by treating multiple Cdx2ER-expressing ESC and EpiSC subclones with Tx in TSC medium on MEFs for six days (Fig. 5.1A, K), as previously described (Niwa et al., 2005; Ralston et al., 2010).  As a negative control, we treated ESC or EpiSC lines lacking the Cdx2ER plasmid, with Tx in TSC medium in parallel (Fig. 5.1A, K).  After the six-day differentiation, cells were passaged 2-3 times in TSC medium without Tx, and cell morphology and gene expression were then examined to determine whether TSC-like cells had been successfully derived, using E6.5 extraembryonic ectoderm-derived TSCs (Tanaka et al., 1998) as a reference.    We first confirmed that ESCs had acquired TSC morphology after Cdx2 overexpression, as previously demonstrated (Niwa et al., 2005; Ralston et al., 2010).  Under conditions that support ESC self-renewal, ESCs grow as small, domed colonies (Fig. 5.1B), while TSCs grow as flat, epithelial colonies with smooth borders (Fig. 5.1C).  Similarly, most Cdx2 overexpressing ESC subclones had acquired TSC morphology after the Cdx2 overexpression assay (5/6 subclones; Fig. 5.1E). By contrast, TSC morphology was not observed in ESCs cultured in TSC medium without Cdx2ER at the  172 end of the assay (Fig. 5.1D), confirming that the acquisition of TSC morphology was Cdx2-dependent.  Next, we evaluated expression levels of TSC markers in each of these cell lines.  Endogenous Cdx2, Eomes, and Rhox4b (Ehox) are all highly expressed in TSCs, and are rapidly downregulated during their differentiation (Tanaka et al., 1998; Jackson et al., 2003).  In all of the ESC-derived TSC-like cells, TSC genes were detected at levels comparable to TSCs (5/5 subclones; Fig. 5.1H), indicating that the ESC-derived TSC-like cells expressed TSC markers, consistent with prior reports (Niwa et al., 2005; Ralston et al., 2010).  As expected, expression of TSC genes was barely detectable in differentiated ESCs lacking Cdx2ER (Fig. 5.1H).  Next, we confirmed that the TSC-like cells had acquired the self-renewal and differentiation properties of TSCs.  Indeed, the TSC-like cells were capable of long-term self-renewal, evidenced by stable maintenance of TSC morphology for more than 50 days (10 passages) (data not shown).  In addition, the TSC-like cells were able to differentiate on gelatin, upon withdrawal of FGF4/Hep and MEFs, evidenced by the formation of giant and multinucleated trophoblast cell types (Fig. 5.1F, G), and molecularly by the downregulation of TSC genes and concomitant upregulation of genes associated with mature trophoblast, such as Prolactin family members Prl3d1 (also known as Placental Lactogen 1) and Prl3b1 (also known as Placental Lactogen 2), and Trophoblast specific protein alpha (Tpbpa), which are expressed in placental junctional zone cell types (Tanaka et al., 1998; Niwa et al., 2005; Ralston et al., 2010; Simmons et al., 2007) (Fig. 5.1I, J) (3/3 TSC-like lines) (Fig. 5.1J).  We also examined expression of markers of other differentiated trophoblast cell types, such as those present in the labyrinth layer of the placenta.  We noted that Syna, Dlx3, and Ctsq,  173 which are expressed in labyrinth cell types (Simmons et al., 2008; Simons et al., 2007; Morasso et al., 1999) were expressed at higher levels in differentiated ESC-derived TSC-like cells, relative to differentiated ESCs, but these genes were not upregulated to the same degree as in differentiating TSCs (Fig. 5.1J), suggesting that ESC-derived TSCs give rise to labyrinth cell types less efficiently in vitro than do TSCs.  Importantly, differentiated trophoblast genes were not detectable in differentiated ESCs lacking Cdx2ER (Fig. 5.1J).  These observations demonstrate that R1 ESCs reproducibly give rise to TSC-like cells, consistent with prior reports (Niwa et al., 2005; Ralston et al., 2010), and provide a reference for evaluating whether TSC-like cells can be derived from other pluripotent stem cell types following Cdx2 overexpression.  We next evaluated whether we could derive TSCs from EpiSCs using the assay described (Fig. 5.1K).  Self-renewing EpiSCs grow as large, compact, epithelial colonies that are morphologically similar to TSCs (Fig. 5.1L). However, after the Cdx2 overexpression assay, EpiSCs did not exhibit an epithelial morphology (5/5 subclones; Fig. 5.1N). Rather, cells lost their epithelial appearance and appeared similar to EpiSCs differentiated without Cdx2ER (Fig. 5.1M), pointing to non-specific differentiation.  In addition, TSC genes were not upregulated in EpiSCs after Cdx2 overexpression (Fig. 5.1O). Thus TSCs cannot be derived from EpiSCs using the same conditions that are used for deriving TSCs from ESCs.  We conclude that, in spite of the fact that both ESCs and EpiSCs are pluripotent, the developmental potential of ESCs differs fundamentally from that of EpiSCs, evidenced by differential responsiveness to overexpressed Cdx2 in TSC culture conditions.   174 ECCs generate cells with TSC properties following Cdx2 overexpression  Our observations indicated that the Cdx2 overexpression assay can reveal differences in developmental potential among pluripotent stem cell lines.   To determine whether other pluripotent stem cell lines differ in developmental potential from ESCs, we next asked whether ECCs could give rise to TSCs.  ECCs can contribute to fetal development in chimeras (Mintz and Illmensee, 1975; Papaioannou et al., 1975; Andrews, 2002; Blelloch et al., 2004), suggesting that ECCs and ESCs are comparable in terms of developmental potential.  To determine whether ECCs can also give rise to TSCs following Cdx2 overexpression, we introduced the Cdx2ER expression plasmid, selected subclones expressing appropriate levels of Cdx2ER (Fig. 5.8), and then attempted to derive TSC-like cells as described (Fig. 5.2A).   We first evaluated cell morphology and gene expression in ECCs following the Cdx2 overexpression assay.  Unmanipulated ECC colonies appear epithelial (Fig. 5.2B), and after the Cdx2 overexpression assay ECC subclones remained epithelial (6/6 subclones; Fig. 5.2D), as did ECCs cultured in TSC conditions without Cdx2ER (Fig. 5.2C).  However, TSC genes were upregulated in ECCs following the Cdx2 overexpression assay (6/6 subclones), but not in ECCs differentiated in the absence of overexpressed Cdx2 (Fig. 5.2G), consistent with successful derivation of TSC-like cells from ECCs.  Consistent with these observations, ECC-derived TSC-like cells were capable of self-renewing for at least 10 passages.  To further characterize the TSC-like cells, we allowed them to differentiate by withdrawing FGF4/HEP and MEFs (Fig. 5.2A).  We observed that ECC-derived TSC-like cells underwent differentiation following withdrawal of FGF4/HEP and MEFs, but the rate at which ECC-derived TSC-like cells  175 differentiated was somewhat slower than the rate of TSC differentiation. While TSCs had completely lost their epithelial characteristics and adopted giant cell morphologies by seven days of differentiation (Fig. 5.1F), giant cells were not yet visible at this time point in differentiating ECC-derived TSC-like cell cultures, and cells exhibited a loosened epithelial appearance (2/2 subclones; Fig. 5.2E). In addition, after seven days of differentiation, TSC genes were downregulated, although not to the extent that they were downregulated in differentiating TSCs at this time point (Fig. 5.2H).  Similarly, after seven days of differentiation, markers of differentiated trophoblast were not yet fully upregulated (Fig. 5.2I), suggesting that ECC-derived TSC-like cells are delayed in their rate of differentiation or are resistant to differentiation.  By 14 days of differentiation, ECC-derived TSC-like cells had acquired differentiated TSC morphology (2/2 subclones Fig. 5.2F), and upregulated markers of differentiated trophoblast, such as junctional zone and labyrinth markers  (Fig. 5.2I).  These observations indicate that ECC-derived TSC-like cells differentiate into trophoblast subtypes less efficiently than do TSCs in vitro.  By contrast, trophoblast markers were not upregulated in ECC differentiated in the absence of Cdx2ER (Fig. 5.2I).  These observations indicate that ECCs, like ESCs, respond to Cdx2 overexpression and TSC culture conditions by generating TSC-like cells, and suggest that ESCs and ECCs are equivalent in terms of developmental potential.  Moreover, these observations indicate that the ability to generate TSC-like cells in response to ectopic Cdx2 is not unique to ESCs, but is also a property of pluripotent cells of non-blastocyst origin.    176 The efficiency of deriving TSC-like cells varies among iPSC and ESC lines  Our observations indicated that the different types of pluripotent stem cells differ in their developmental potential.  Given that EpiSCs and ESCs are derived from the embryo at different developmental stages, our results suggested that pluripotent stem cell origins could influence a cell lineÕs competence to respond to TSC-inducing factors.  iPSCs are thought to be very similar, if not identical to ESCs, based on gene expression and developmental potential, despite originating from more differentiated cell types (Yamanaka, 2012). We therefore hypothesized that, like ESCs, iPSCs should give rise to TSCs very robustly.  To test this hypothesis, we attempted to derive TSCs from three different iPSC lines (Table 5.1).  All three iPSC lines were first cultured beyond passage 11 in standard ESC conditions, to allow these lines to stably acquire ESC gene expression profiles (Polo et al., 2010).  We then introduced the Cdx2ER expression plasmid into each iPS cell line, and then selected 5-6 subclones expressing levels of Cdx2ER that were at least as high as TSC levels of Cdx2 (Fig. 5.8). We then attempted to derive TSC lines from each of these subclones following the Cdx2 overexpression assay (Fig. 5.3A).    As expected, TSC-like cells could be derived from iPSC lines, although there were differences among the iPSC lines in the efficiency of derivation and the quality of the TSC-like cells.  One iPSC line (iPSC2) consistently gave rise to cells with high degree of TSC morphology and TSC-like levels of TSC gene expression (6/6 subclones; Fig. 5.3C).  However, two iPSC lines (iPSC1 and iPSC3) gave rise to cells with relatively low degree of TSC morphology and gene expression (Fig. 5.3B, D), and did so  177 with lower efficiency than other cell lines (3/5 subclones for iPSC1 and 4/5 subclones for iPSC3).  We conclude that iPSC can give rise to TSCs, although the efficiency and the quality of the resultant TSC-like cells varies among iPSC lines.  The basis for the differing capacity of the different iPSC lines to give rise to TSC-like cells was unclear.  While each iPSC line had been generated with different vectors or reprogramming factor cocktails (Table 5.1), these differences did not clearly correlate with the observed differences in propensity to form TSC-like cells.  Rather, those iPSC lines that gave rise to TSC-like cells with relatively low efficiency were of mixed genetic background, while the iPSC line that gave rise to TSC-like cells efficiently was derived from mice of 129 genetic background.  Since all the other pluripotent cell lines we had examined thus far were of 129 background, this prompted us to investigate whether ESCs derived from mixed backgrounds might also exhibit reduced efficiency of TSC differentiation in the Cdx2 overexpression assay, and whether the variable efficiency of producing TSC-like cells might be influenced by genetic background in ESCs and iPSCs alike.   We therefore introduced the Cdx2 overexpression plasmid into two additional ESC lines (ESC 2 and ESC3), which were each of mixed genetic background (Table 5.1).  We selected five Cdx2ER-expressing subclones from each of these two ESC lines, and then evaluated the ability of these 10 Cdx2-overexpressing subclones to give rise to TSC-like cells following the Cdx2 overexpression assay.  We were able to derive cells with TSC-like morphology and gene expression from both ESC lines (5/5 subclones each), although the quality and consistency of TSC morphology and the  178 degree of TSC gene expression (Fig. 5.3E, F) were lower from these ESC lines than with ESC1 (Fig. 5.3L).  These findings are consistent with our hypothesis that the efficiency with which TSC-like cells can be derived depends upon genetic background, with 129 being the more permissive to derivation of TSC-like cells following Cdx2 overexpression.   Cdx2 overexpression induces expression of non-TSC genes in multiple pluripotent stem cell lines   Although the EpiSC line we examined was derived from a 129 background, the genetic background that we found to be permissive to derivation of TSC-like cells following Cdx2 overexpression, we were unable to derive TSCs from EpiSCs.  Thus, unlike 129-derived ESC/iPSCs, 129-derived EpiSCs are not competent to respond to overexpressed CDX2 by activating TSC gene expression, pointing to differences in developmental potential.  Consistent with this proposal, EpiSCs are thought to be primed to differentiate into germ layer derivatives, and express markers of late epiblast, including Sox17, Gata6, Foxa2, and T (Tesar et al., 2007; Brons et al., 2007; Bernemann et al., 2011; Tsakiridis et al., 2014; Kojima et al., 2014).  We therefore hypothesized that the degree of lineage priming could differ between ESC/iPSCs that do not efficiently produce TSC-like cells and ESC/iPSCs that do efficiently produce TSC-like cells.  To test this hypothesis, we compared expression levels of several germ layer markers in EpiSCs and in ESC/iPSC lines of differing ability to give rise to TSC-like cells (ESC1 and iPSC3), each cultured in self-renewal conditions.  We observed that EpiSCs expressed higher levels of mesendoderm genes than did either ESC or  179 iPSC line (Fig. 5.4A), consistent with the lineage primed state of EpiSCs.  However, the levels of mesendoderm markers were not higher in iPSC3 than in ESC1, even though iPSC3 was refractory to forming TSC-like cells, while ESC1 was not.  These observations support the hypothesis that lineage priming in EpiSCs could limit TSC potential, but lineage priming does not explain the variation in TSC potential observed among ESC/iPSC lines.   Given the mesendoderm-primed state of EpiSCs, we next hypothesized that Cdx2 over-expression in EpiSCs preferentially drives expression of mesendoderm genes rather than TSC genes, since Cdx2 plays well-established roles in promoting mesendoderm fates in the fetus (Chaengsaksophak et al., 2004; Chaengsaksophak et al., 1997; Beck et al., 2003; Guo et al., 2004).  To test this hypothesis, we examined the expression levels of endoderm, mesoderm, and ectoderm markers as well as Hoxb9 and Isx, which are regulated by CDX2 directly (van den Akker et al., 2002; Choi et al., 2006; Boyd et al., 2010), in multiple EpiSCs subclones following Cdx2 overexpression.  Consistent with our predictions, we observed that ectopic Cdx2 induced the expression of the mesoderm markers Meox1 and Hoxb9 in the majority of EpiSC subclones, relative to treated and untreated parental cells (Fig. 5.4B).  However ectopic Cdx2 did not induce expression of Isx or other endoderm or ectoderm markers, relative to treated and untreated controls.  These observations are consistent with the conclusion that overexpressed Cdx2 exhibits some of its postimplantation activity in EpiSCs cultured in these conditions, by activating expression of non-TSC genes.  Next we evaluated whether ectopic Cdx2 preferentially induces expression of non-TSC genes in ESC/iPSC lines that do not efficiently give rise to TSCs.  We  180 evaluated expression of the same markers in multiple subclones of iPSC3, which did not efficiently give rise to TSCs, as well as ESC1, which did give rise efficiently to TSC-like cells.  We expected to observe higher levels of non-TSC gene expression following Cdx2 overexpression in iPSC3 subclones than in ESC1 subclones.  However, we were surprised to observe expression of Hoxb9 in both iPSC3 and ESC1 after six days of Cdx2 overexpression (Fig. 5.4C), suggesting that expression of non-TSC genes does not interfere with formation of TSC-like cells in ESC/iPSCs.  Although we have not ruled out the possibility that TSC and non-TSC genes are expressed in distinct cells within these cultures, we note that ESC1 had given rise to TSC-like cells very efficiently.  We therefore propose that genetic background limits TSC-forming efficiency in ESC/iPSCs.   Myc expression levels predict TSC-forming potential  Our evidence suggested that pluripotent stem cell lines differ in their competence to respond to ectopic Cdx2, but the molecular basis for this was unclear.  Since the Oct4 expression level directly limits TSC formation in ESCs (Niwa et al., 2000), we hypothesized that levels of Oct4 or of other pluripotency genes might correlate inversely with TSC-forming potential.  To test this hypothesis, we evaluated expression levels of Oct4 and eleven additional pluripotency genes by qPCR in all seven of the pluripotent stem cell lines (EpiSCs, ECCs, ESCs and iPSCs).  We then evaluated the correlation between pluripotency gene expression value and TSC-forming ability, here defined as total TSC gene expression after Cdx2 overexpression.  However, we observed no strong correlation between the Oct4 expression level and potential to give rise to TSC-like cells (Fig. 5.5).  Similarly, we observed no strong correlation between the levels of  181 most of the other pluripotency genes and potential to form TSC-like cells.  Notably, Myc was an exception to this trend, since Myc levels were inversely correlated with potential to form TSC-like cells.  These observations suggest that Myc levels can predict the propensity of a given pluripotent cell line to give rise to TSC-like cells following Cdx2 overexpression, with those pluripotent stem cell lines that express low levels of Myc giving rise to TSCs more efficiently. Since the level of Myc expression is lower in naŁve ESCs than in the primed ESCs (Marks et al., 2012), our results suggest that naŁve pluripotency is more permissive to formation of TSCs following Cdx2 overexpression than is primed pluripotency.  Inhibitors of GSK3/MAPK signaling increase potential to form TSC-like cells   We observed that Myc expression levels in pluripotent stem cells are inversely correlated with their ability to form TSCs.  Culturing ESC lines in inhibitors of GSK3 and MAPK (2i) is sufficient to reduce Myc expression levels, and push cells from primed to naŁve pluripotent states (Marks et al., 2012; Ying et al., 2008).  We therefore hypothesized culturing ESC lines in 2i prior to the Cdx2 overexpression assay would increase the efficiency with which they formed TSCs.  To test this hypothesis, we cultured ESC lines (ESC2 and ESC3) in 2i for 7 passages (Fig. 5.6A), the number of passages needed to transition ESCs into the naŁve pluripotent state (Marks et al., 2012).  We first confirmed that 2i treatment effectively lowered expression levels of Myc, in these ESC lines (Fig. 5.6B).  In addition, expression levels of Tert and Dazl were increased following 2i treatment, further demonstrating that the cells had entered a state of naŁve pluripotency (Marks et al., 2012) (Fig. 5.6B).  Next, we pretreated Cdx2ER- 182 expressing ESC2 and ESC3 (4 subclones each) with 2i for seven passages, and then we treated these lines with Tx and FGF4/Hep for six days (Fig. 5.6C).  After this treatment, TSC-like cell morphology was again observed (not shown), and expression of markers associated germ layer lineages was not increased (Fig. 5.10), indicating that pre-treatment of ESCs with 2i supports derivation of TSC-like cells.  We then compared the degree to which TSC markers were upregulated in TSC-like cells derived from ESCs that had been cultured in 2i, compared to TSC-like cells derived from ESCs that had been cultured in serum. We observed that TSC gene expression levels were increased in the majority of TSC-like cell lines that had been derived from ESC lines pretreated with 2i (Fig. 5.6D, E). These observations are consistent with the idea that naŁve pluripotency is more permissive to derivation of TSC-like cells than is the primed pluripotent state.  Section 4.  Discussion  We have shown that multiple pluripotent states can be resolved on the basis of cellular response to ectopic Cdx2, with some stem cell lines giving rise to TSC-like cells readily, and others less so.  We observed that the efficiency with which pluripotent stem cell lines gave rise to TSC-like cells is influenced by their degree of naivet”.  Our observations support the idea that a spectrum of pluripotent states exists, with cell lines exhibiting differing degrees of naivet” (Fig. 5.7).  Accordingly, ectopic Cdx2 induces trophoblast with a range of efficiencies, and does so more efficiently in more naŁve pluripotent states.  Our observations are consistent with the hypothesis that 129 genetic background influences ESC naivet”, both in terms of expression of markers of naŁve  183 pluripotency, as well as responsiveness to Cdx2.  By contrast, ectopic Cdx2 did not induce formation of trophoblast in primed pluripotent stem cell lines, such as EpiSCs. Thus the ability of ectopic Cdx2 to induce TSC-like cells is a newly defined property of naŁve pluripotency.  Our proposal that primed pluripotent cells resist forming TSC-like cells is consistent with prior observations that EpiSCs are resistant to forming other extraembryonic XEN cells, while ESC and iPSC give rise to XEN cells readily (Cho et al., 2012).  Our model is also consistent with prior observations that EpiSCs are resistant to forming trophoblast following growth factor treatment (Bernardo et al., 2011). Notably, multiple pluripotent states exist within EpiSCs (Bernemann et al., 2011; Han et al., 2010), with some lines more primed for mesendodermal differentiation than others (Bernemann et al., 2011).  It would be interesting to determine whether genetic background influences the degree of naivet” and differentiation potential in EpiSCs as in ESCs, but this has not yet been examined.  Rather, the degree of mesendodermal priming is thought to be influenced by the expression level of Brachyury (Bernemann et al., 2011).  However, we observed that ectopic Cdx2 and FGF4/Hep were sufficient to repress expression of Brachyury in EpiSCs, arguing that mesendodermal lineage priming is not a barrier to activation of trophoblast gene expression.  In addition, EpiSCs were derived from 129 background, which we found to be permissive to formation of TSC-like cells.  We therefore hypothesize that EpiSCs differ in their competence to respond to ectopic Cdx2 because they represent a later developmental stage.  Interestingly, EpiSCs have also been derived from mouse blastocysts (Najm et al., 2011), prior to the stage from which they are normally derived.  Comparing the ability of  184 ectopic Cdx2 to induce formation of TSCs between EpiSCs from pre and post-implantation embryos could provide insight into whether developmental origins or other properties limit the activity of CDX2.   Our model makes several predictions about the pluripotent state of other pluripotent stem cell lines.  For example, since human ESCs bear numerous similarities to EpiSCs (Tesar et al., 2007; Brons et al., 2007), our model predicts that ectopic Cdx2 would not induce expression of TSC-like cells genes in human ESCs in the conditions we tested here.  Recently, totipotent or naŁve pluripotent stem cell lines have been derived from both humans and mice (Gafni et al., 2013; Macfarlan et al., 2012; Morgani et al., 2013; Ware et al., 2014; Hanna et al., 2010).  In several cases, these cell lines have been shown contribute to extraembryonic lineages in chimeras.  We therefore hypothesize that totipotent human ESCs would more readily give rise to TSCs following Cdx2 overexpression, but this has not yet been tested.  Interestingly, variable germ layer differentiation potential among human ESC and iPSC lines has been noted (Bock et al., 2011), but whether and how differentiation potential varies among naŁve human pluripotent stem cell lines has not yet been explored.  Our study thus provides a foundation for future studies to query the pluripotent state of new stem cell lines, based on their response to ectopic Cdx2 and TSC medium.  Finally, our study leads to the exciting future opportunity to investigate the mechanisms that limit the trophoblast gene-inducing activity of CDX2 in primed pluripotent stem cell types.  CDX2 has long been recognized to play multiple roles during embryogenesis, with a preimplantation role in promoting trophoblast fate, and a postimplantation role in promoting posterior mesendoderm fates.  It is tempting to  185 speculate that a common molecular mechanism limits the trophoblast gene-inducing activity in postimplantation embryos and EpiSC lines.  However, the mechanisms regulating CDX2 activity during embryogenesis are incompletely described.  Exploring the mechanisms regulating CDX2 activity in naŁve and primed pluripotent stem cells could lead the way to discovering how CDX2 activity is regulated in vivo.  We hypothesize that transcriptional or epigenetic mechanisms could regulate CDX2 activity in naŁve and primed pluripotent stem cell types.  Interestingly, ESC-derived TSC-like cells fail to acquire genomic methylation features of TSCs (Cambuli et al., 2014), arguing that differences between ESCs and EpiSCs could further limit the developmental potential of EpiSCs to become TSCs.  Differences in the transcriptomes, proteomes, and chromatin states of ESC and EpiSCs have been compared (Senner et al., 2012; Frochlich et al., 2013; Song et al., 2012). Notably, Nurd-dependent methylation prevents ESCs from spontaneously acquiring trophoblast fate (Latos et al., 2012; Zhu et al., 2009; Kaji et al., 2007; Kaki et al., 2006; Hooper et al., 1987).  However, it is not known whether Nurd methylation maintains this lineage barrier in EpiSCs.  Use of conditional alleles to study loss of gene function in EpiSCs will provide exciting insight into molecular mechanisms preventing EpiSCs from differentiating to TSCs and regulating CDX2 activity during postimplantation stages of development.  In summary, we have compared the relative efficiency with which TSC-like cells can be derived from a variety of pluripotent stem cell types.  Our data show that TSC-like cells can be derived efficiently from naŁve pluripotent stem cell lines, but not from primed pluripotent stem cell lines.  We also report that ESC lines derived from mixed genetic background exhibit features of primed ESCs, but when these ESCs are pushed  186 to naŁve pluripotency using inhibitors of MAPK/GSK3, these cell lines exhibit increased efficiency of TSC-like cells derivation.  We propose that the Cdx2 overexpression assay could be used to assess the pluripotent state of newly derived mouse, and possibly human, stem cell lines.  Acknowledgments We thank Dr. Jonathan S. Draper for discussion and members of the Ralston Lab for discussion, and Dr. Paul Tesar and Dr. Knut Woltjen for cell lines.  S.B. was supported by NIH T32 GM008646 and A.P. was supported by CIRM TG2-01157. This study was supported by UCSC Committee on Research, Ellison Medical Foundation, and NIH R01GM104009 grants to A.R.               187            APPENDIX             188 Figure 5.1. EpiSCs do not give rise to TSCs following Cdx2 overexpression A) Experimental outline of the Cdx2 overexpression assay. B) Typical ESCs morphology. C) Typical morphology of TSCs in TSC medium (with FGF4/Hep). D) ESCs lacking Cdx2ER cultured in TSC medium do not exhibit TSC-like morphology, evidenced by ragged cell boundaries. E) TSC-like cells derived from ESCs after Cdx2 overexpression.  Note smooth colony boundary as in panel C. F) TSCs differentiated in the absence of FGF4/Hep for 7 days G). ESC-derived TSC-like cells differentiated in the absence of FGF4/Hep for 7 days resemble cells shown in panel F.  H) RT-qPCR measurement of   189 Figure 5.1. contÕd expression levels of TSC markers relative to Hprt1, in ESCs following Cdx2 overexpression and in ESCs lacking Cdx2ER, relative to TSC levels of these genes, shows that TSC-like cell lines express levels of TSC genes that are at least as high as those expressed by TSCs.  I) Expression levels of TSC markers in TSCs and ESC-derived TSC-like cells after 7-day differentiation shows that both cell lines downregulate TSC markers to a similar degree. J) Expression levels of markers of differentiated trophoblast cell types in TSCs and ESC-derived TSC-like cells after 7-day differentiation shows that both cell types increase junctional zone markers to a similar degree, but only TSCs efficiently upregulate labyrinth cell markers during in vitro differentiation. K) Experimental outline of Cdx2 overexpression in EpiSCs. L) Typical morphology of EpiSC colonies. M) EpiSCs lacking Cdx2 cultured in TSC medium do exhibit TSC-like morphology. N) EpiSCs do not exhibit TSC-like morphology after Cdx2 overexpression. O) Expression levels of TSC markers in EpiSC overexpressing Cdx2, shows that EpiSCs do not acquire TSC-like properties after Cdx2  overexpression. Scale bars = 150 "m, error bars = standard error among three technical replicates, Endo = endogenous.                               190 Figure 5.2. ECCs give rise to TSC-like cells efficiently upon Cdx2 overexpression A) Experimental outline of the Cdx2 overexpression assay. B) Typical ECC morphology. C) ECCs lacking Cdx2ER do not acquire TSC-like morphology. D) TSC-like cells derived from ECCs after Cdx2 overexpression in TSC medium. E) ECC-derived TSCs after 7 days differentiation in the absence of FGF4/Hep. F) Fourteen day differentiated   191 Figure 5.2. contÕd ECC-derived TSC-like cells (compare with Fig. 5.1F). G) Expression levels of TSC markers in indicated cell line after Cdx2 overexpression shows that ECC-derived TSC-like cell lines express levels of TSC genes that are at least as high as those expressed by TSCs. H) Expression levels of TSC markers are downregulated in ECC-derived TSC-like cells during differentiation. I) Expression levels of differentiated trophoblast genes relative to Hprt1 in indicated cell lines, shows that ECC-derived TSC-like take twice as long as TSCs to upregulated differentiation markers. Scale bars = 150 "m, error bars = standard error among three technical replicates.                                       192 Figure 5.3. iPSCs and ESCs give rise to TSC-like cells with variable efficiency A) Experimental outline of the Cdx2 overexpression assay. (B-F) The morphology and gene expression of one representative iPSC or ESC subclone after the Cdx2-overexpression assay, showing that some iPSC/ESC lines give rise to TSC-like cells with higher efficiency than others. L) Comparison of combined total expression values of TSC genes for all tested subclones for ESCs, EpiSCs, ECCs, and iPSCs, compared to TSC values (TSC = 3.0), with genetic background indicated for each cell line.  Scale bar = 150 "m, error bars in B-F = standard error among qPCR replicates, error bars in L = standard error among subclones.            193 Figure 5.4. Cdx2 overexpression induces expression of non-TSC genes A) qPCR measurement of mesendoderm gene expression levels in undifferentiated cell lines. B) qPCR measurement of germ layer marker expression levels, relative to Hprt1, in untreated EpiSCs and in five Cdx2-overexpressing subclones and control cell lines. C) qPCR measurement of germ layer marker expression levels, relative to Hprt1, in untreated ESC1 and iPSC3 cells and in five Cdx2-overexpressing subclones and control cells after Cdx2 overexpression, for both ESC1 and iPSC3. Error bars = standard error among qPCR replicates.          194  Figure 5.5. Correlation between TSC gene expression levels and markers of pluripotency Average TSC gene expression values relative to Hprt1 and normalized to TSCs for all pluripotent stem cell lines used in this study (Table 5.1), except ESC3, which is deficient for Hprt1 (Hooper et al., 1987), plotted against the average expression levels of the indicated pluripotency genes.  The degree of correlation (r value) was calculated using PearsonÕs correlation.    195  Figure 5.6. Pre-treatment of ESC lines in 2i leads to increased levels of TSC gene expression following Cdx2 overexpression A) Overview of experiment shown in panel B.  B) qPCR measurement of expression levels of the ground state pluripotency markers Tert, Dazl, and Myc, relative to Hprt1 following treatments described in panel A. C) Overview of experiment shown in panels D and E.  D, E) TSC gene expression values for ESC2 and ESC3 subclones after treatment described in panel C, showing that pre-treatment with 2i leads to increased expression of TSC genes following Cdx2 overexpression.  Error bars = standard error among qPCR replicates.      196  Figure 5.7. Relative efficiency of TSC-like cell formation reveals a continuum of pluripotent states In our model, there exists a continuum of pluripotent states, ranging from naŁve to primed.  Here, the degree of naivet” for a given cell line is predicted by the efficiency with which it gives rise to TSC-like cells following Cdx2 overexpression.                                  197 Figure 5.8. Expression levels of exogenous Cdx2ER for subclones used in this study Subclones were screened by qPCR, and those expressing Cdx2ER at levels that were at least as high as TSCs are shown here and were selected for further study.                         198  Figure 5.9. Validation of iPSC lines A-B) iPSC lines exhibit ESC-like morphology (compare with Fig. 5.1B. C-F) iPSC lines express SSEA1. G) Chimeric pups were obtained following injection of iPSC3 (or ESC1) into CD1 host blastocysts. H) qPCR measurement of pluripotency genes shows that iPSC lines express levels of pluripotency genes that are at least as high as ESC1.  199 Figure 5.10. Germ layer markers are not increased in 2i-pretreated cells during TSC-like differentiation qPCR analysis of germ layer markers shows that pretreatment of Cdx2ER clones with 2i, which increased expression of TSC genes following Cdx2 overexpression (Fig. 5.6), does not increase differentiation toward germ layer fates in these conditions.                       200 Table 5.1. Summary of cell lines used in this study.                                    201 Table 5.2. Primers and Oligos                              202            REFERENCES             203 REFERENCES    Andrews PW. (2002). From teratocarcinomas to embryonic stem cells. Philosophical Transactions of the Royal Society of London Series B-Biological Sciences 357:405-417.  Beck F, K Chawengsaksophak, J Luckett, S Giblett, J Tucci, J Brown, R Poulsom, R Jeffery and NA Wright. (2003). A study of regional gut endoderm potency by analysis of Cdx2 null mutant chimaeric mice. Dev Biol 255:399-406.  Beddington RS and EJ Robertson. (1989). An assessment of the developmental potential of embryonic stem cells in the midgestation mouse embryo. Development 105:733-7.  Bernardo AS, T Faial, L Gardner, KK Niakan, D Ortmann, CE Senner, EM Callery, MW Trotter, M Hemberger, JC Smith, L Bardwell, A Moffett and RA Pedersen. (2011). BRACHYURY and CDX2 mediate BMP-induced differentiation of human and mouse pluripotent stem cells into embryonic and extraembryonic lineages. Cell Stem Cell 9:144-55.  Bernemann C, B Greber, K Ko, J Sterneckert, DW Han, MJ Araœzo-Bravo and HR Schıler. (2011). Distinct developmental ground states of epiblast stem cell lines determine different pluripotency features. Stem Cells 29:1496-503.  Blelloch RH, K Hochedlinger, Y Yamada, C Brennan, MJ Kim, B Mintz, L Chin and R Jaenisch. (2004). Nuclear cloning of embryonal carcinoma cells. Proceedings of the National Academy of Sciences of the United States of America 101:13985-13990.  Bock C, E Kiskinis, G Verstappen, H Gu, G Boulting, ZD Smith, M Ziller, GF Croft, MW Amoroso, DH Oakley, A Gnirke, K Eggan and A Meissner. (2011). Reference Maps of human ES and iPS cell variation enable high-throughput characterization of pluripotent cell lines. Cell 144:439-52.  Boyd M, M Hansen, TGK Jensen, A Perearnau, AK Olsen, LL Bram, M Bak, N Tommerup, J Olsen and JT Troelsen. (2010). Genome-wide Analysis of CDX2 Binding in Intestinal Epithelial Cells (Caco-2). Journal of Biological Chemistry 285:25115-25125.  Brons IGM, LE Smithers, MWB Trotter, P Rugg-Gunn, BW Sun, S Lopes, SK Howlett, A Clarkson, L Ahrlund-Richter, RA Pedersen and L Vallier. (2007). Derivation of pluripotent epiblast stem cells from mammalian embryos. Nature 448:191-5.  Cambuli F, A Murray, W Dean, D Dudzinska, F Krueger, S Andrews, CE Senner, SJ Cook and M Hemberger. (2014). Epigenetic memory of the first cell fate decision prevents complete ES cell reprogramming into trophoblast. Nat Commun 5:5538   204 Chawengsaksophak K, R James, VE Hammond, F Kıntgen and F Beck. (1997). Homeosis and intestinal tumours in Cdx2 mutant mice. Nature 386:84-7.  Chawengsaksophak K, W de Graaff, J Rossant, J Deschamps and F Beck. (2004). Cdx2 is essential for axial elongation in mouse development. Proc Natl Acad Sci U S A 101:7641-5.  Cho LT, SE Wamaitha, IJ Tsai, J Artus, RI Sherwood, RA Pedersen, AK Hadjantonakis and KK Niakan. (2012). Conversion from mouse embryonic to extra-embryonic endoderm stem cells reveals distinct differentiation capacities of pluripotent stem cell states. Development 139:2866-77.  Choi MY, AI Romer, M Hu, M Lepourcelet, A Mechoor, A Yesilaltay, M Krieger, PA Gray and RA Shivdasani. (2006). A dynamic expression survey identifies transcription factors relevant in mouse digestive tract development. Development 133:4119-4129.  Evans MJ and MH Kaufman. (1981). Establishment in culture of pluripotent cells from mouse embryos. Nature 292:154-156.  Eilers M, D Picard, KR Yamamoto and JM Bishop. (1989). Chimeras of Myc oncoprotein and steroid-receptors caouse hormone-dependent transformation of cells. Nature 340:66-68.  Frıhlich T, M Kısters, A Graf, E Wolf, J Kobolak, V Brochard, A Dinny”s, A Jouneau and GJ Arnold. (2013). iTRAQ proteome analysis reflects a progressed differentiation state of epiblast derived versus inner cell mass derived murine embryonic stem cells. J Proteomics 90:38-51.  Gafni O, L Weinberger, AA Mansour, YS Manor, E Chomsky, D Ben-Yosef, Y Kalma, S Viukov, I Maza, A Zviran, Y Rais, Z Shipony, Z Mukamel, V Krupalnik, M Zerbib, S Geula, I Caspi, D Schneir, T Shwartz, S Gilad, D Amann-Zalcenstein, S Benjamin, I Amit, A Tanay, R Massarwa, N Novershtern and JH Hanna. (2013). Derivation of novel human ground state naive pluripotent stem cells. Nature 504:282-6.  Guo RJ, ER Suh and JP Lynch. (2004). The role of Cdx proteins in intestinal development and cancer. Cancer Biol Ther 3:593-601.  Han DW, N Tapia, JY Joo, B Greber, MJ Araœzo-Bravo, C Bernemann, K Ko, G Wu, M Stehling, JT Do and HR Schıler. (2010). Epiblast stem cell subpopulations represent mouse embryos of distinct pregastrulation stages. Cell 143:617-27.  Hanna J, AW Cheng, K Saha, J Kim, CJ Lengner, F Soldner, JP Cassady, J Muffat, BW Carey and R Jaenisch. (2010). Human embryonic stem cells with biological and epigenetic characteristics similar to those of mouse ESCs. Proc Natl Acad Sci U S A 107:9222-7.   205 He S, D Pant, A Schiffmacher, A Meece and CL Keefer. (2008). Lymphoid enhancer factor 1-mediated Wnt signaling promotes the initiation of trophoblast lineage differentiation in mouse embryonic stem cells. Stem Cells 26:842-9.  Hooper M, K Hardy, A Handyside, S Hunter and M Monk. (1987). HPRT-Defcicient (lesch-Nyhan) mouse embryos derived from germline colonization by cultured-cells. Nature 326:292-295.  Hutchins AP, SH Choo, TK Mistri, M Rahmani, CT Woon, CK Ng, R Jauch and P Robson. (2013). Co-motif discovery identifies an Esrrb-Sox2-DNA ternary complex as a mediator of transcriptional differences between mouse embryonic and epiblast stem cells. Stem Cells 31:269-81.  Jackson M, JW Baird, J Nichols, R Wilkie, JD Ansell, G Graham and LM Forrester. (2003). Expression of a novel homeobox gene Ehox in trophoblast stem cells and pharyngeal pouch endoderm. Developmental Dynamics 228:740-744.  Kaji K, IM Caballero, R MacLeod, J Nichols, VA Wilson and B Hendrich. (2006). The NuRD component Mbd3 is required for pluripotency of embryonic stem cells. Nat Cell Biol 8:285-92.  Kaji K, J Nichols and B Hendrich. (2007). Mbd3, a component of the NuRD co-repressor complex, is required for development of pluripotent cells. Development 134:1123-32. Kahan BW and B Ephrussi. (1970). Developmental potentialities of clonal in-vitro cultures of mouse testicular teratoma. Journal of the National Cancer Institute 44:1015-36.  Kojima Y, K Kaufman-Francis, JB Studdert, KA Steiner, MD Power, DA Loebel, V Jones, A Hor, G de Alencastro, GJ Logan, ET Teber, OH Tam, MD Stutz, IE Alexander, HA Pickett and PP Tam. (2014). The transcriptional and functional properties of mouse epiblast stem cells resemble the anterior primitive streak. Cell Stem Cell 14:107-20.  Kuckenberg P, M Peitz, C Kubaczka, A Becker, A Egert, E Wardelmann, A Zimmer, O stle and H Schorle. (2011). Lineage conversion of murine extraembryonic trophoblast stem cells to pluripotent stem cells. Mol Cell Biol 31:1748-56.  Kunath T, D Arnaud, G Uy, I Okamoto, C Chureau, Y Yamanaka, E Heard, R Gardner, P Avner and J Rossant. (2005). Imprinted X-inactivation in extra-embryonic endoderm cell lines from mouse blastocysts. Development 132:1649-61.  Latos PA, C Helliwell, O Mosaku, DA Dudzinska, B Stubbs, M Berdasco, M Esteller and B Hendrich. (2012). NuRD-dependent DNA methylation prevents ES cells from accessing a trophectoderm fate. Biol Open 1:341-52.   206 Lu CW, A Yabuuchi, L Chen, S Viswanathan, K Kim and GQ Daley. (2008). Ras-MAPK signaling promotes trophectoderm formation from embryonic stem cells and mouse embryos. Nat Genet 40:921-6.  Macfarlan TS, WD Gifford, S Driscoll, K Lettieri, HM Rowe, D Bonanomi, A Firth, O Singer, D Trono and SL Pfaff. (2012). Embryonic stem cell potency fluctuates with endogenous retrovirus activity. Nature 487:57-63.  Marks H, T Kalkan, R Menafra, S Denissov, K Jones, H Hofemeister, J Nichols, A Kranz, AF Stewart, A Smith and HG Stunnenberg. (2012). The Transcriptional and Epigenomic Foundations of Ground State Pluripotency. Cell 149: 590-604.  Martin GR. (1981). Isolation of a pluripotent cell-line from early mouse embryos cultured in medium conditioned by teratocarinoma stem-cells. Proceedings of the National Academy of Sciences of the United States of America-Biological Sciences 78:7634-7638.  Mintz B and K Illmensee. (1975). Nornal genetically mosaic mice produced from malignant teratocarinoma cells. Proceedings of the National Academy of Sciences of the United States of America 72:3585-3589.  Morasso MI, A Grinberg, G Robinson, TD Sargent and KA Mahon. (1999). Placental failure in mice lacking the homeobox gene Dlx3. Proc Natl Acad Sci U S A 96:162-7.  Morgani SM, MA Canham, J Nichols, AA Sharov, RP Migueles, MS Ko and JM Brickman. (2013). Totipotent embryonic stem cells arise in ground-state culture conditions. Cell Rep 3:1945-57.  Nagy A, J Rossant, R Nagy, W Abramow-Newerly and JC Roder. (1993). Derivation of completely cell culture-derived mice from early-passage embryonic stem cells. Proc Natl Acad Sci U S A 90:8424-8.  Nagy A, J Rossant, R Nagy, W Abramownewerly and JC Roder. (1993). Derivation of completely cell culture-derived mice from early-passsage embryonic stem-cells. Proceedings of the National Academy of Sciences of the United States of America 90:8424-8428.  Najm FJ, JG Chenoweth, PD Anderson, JH Nadeau, RW Redline, RD McKay and PJ Tesar. (2011). Isolation of epiblast stem cells from preimplantation mouse embryos. Cell Stem Cell 8:318-25.  Niakan KK, H Ji, R Maehr, SA Vokes, KT Rodolfa, RI Sherwood, M Yamaki, JT Dimos, AE Chen, DA Melton, AP McMahon and K Eggan. (2010). Sox17 promotes differentiation in mouse embryonic stem cells by directly regulating extraembryonic gene expression and indirectly antagonizing self-renewal. Genes Dev 24:312-26.   207 Niakan KK, N Schrode, LT Cho and AK Hadjantonakis. (2013). Derivation of extraembryonic endoderm stem (XEN) cells from mouse embryos and embryonic stem cells. Nat Protoc 8:1028-41.  Nichols J and A Smith. (2009). Naive and primed pluripotent states. Cell Stem Cell 4:487-92.  Nishioka N, K Inoue, K Adachi, H Kiyonari, M Ota, A Ralston, N Yabuta, S Hirahara, RO Stephenson, N Ogonuki, R Makita, H Kurihara, EM Morin-Kensicki, H Nojima, J Rossant, K Nakao, H Niwa and H Sasaki. (2009). The Hippo signaling pathway components Lats and Yap pattern Tead4 activity to distinguish mouse trophectoderm from inner cell mass. Dev Cell 16:398-410.  Nishiyama A, L Xin, A Sharov, M Thomas, G Mowrer, E Meyers, Y Piao, S Mehta, S Yee, Y Nakatake, C Stagg, L Sharova, L Correa-Cerro, U Bassey, H Hoang, E Kim, R Tapnio, Y Qian, D Dudekula, M Zalzman, M Li, G Falco, H Yang, S Lee, M Monti, I Stanghellini, M Islam, R Nagaraja, I Goldberg, W Wang, D Longo, D Schlessinger and M Ko. (2009). Uncovering early response of gene regulatory networks in ESCs by systematic induction of transcription factors. Cell Stem Cell 5:420-33.  Niwa H, J Miyazaki and A Smith. (2000). Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet 24:372-6.  Niwa H, T Toyooka, D Shimosato, D Strumpf, K Takahashi, R Yagi and J Rossant. (2005). Interaction between Oct3/4 and Cdx2 determines trophectoderm differentiation. Cell 123:917-929.  Ohtsuka S and S Dalton. (2008). Molecular and biological properties of pluripotent embryonic stem cells. Gene Therapy 15:74-81.  Papadaki C, M Alexiou, G Cecena, M Verykokakis, A Bilitou, JC Cross, RG Oshima and G Mavrothalassitis. (2007). Transcriptional repressor Erf determines extraembryonic ectoderm differentiation. Molecular and Cellular Biology 27:5201-5213.  Papaioannou VE, MW McBurney, RL Gardner and MJ Evans. (1975). Fate of teratocarcinoma cells injected into early mouse embryos. Nature 258:70-73.  Polo JM, S Liu, ME Figueroa, W Kulalert, S Eminli, KY Tan, E Apostolou, M Stadtfeld, YS Li, T Shioda, S Natesan, AJ Wagers, A Melnick, T Evans and K Hochedlinger. (2010). Cell type of origin influences the molecular and functional properties of mouse induced pluripotent stem cells. Nature Biotechnology 28:848-55.  Ralston A, BJ Cox, N Nishioka, H Sasaki, E Chea, P Rugg-Gunn, GJ Guo, P Robson, JS Draper and J Rossant. (2010). Gata3 regulates trophoblast development downstream of Tead4 and in parallel to Cdx2. Development 137:395-403.   208 Schenke-Layland K, E Angelis, KE Rhodes, S Heydarkhan-Hagvall, HK Mikkola and WR Maclellan. (2007). Collagen IV induces trophoectoderm differentiation of mouse embryonic stem cells. Stem Cells 25:1529-38.  Schroeder IS, S Sulzbacher, T Nolden, J Fuchs, J Czarnota, R Meisterfeld, H Himmelbauer and AM Wobus. (2012). Induction and selection of Sox17-expressing endoderm cells generated from murine embryonic stem cells. Cells Tissues Organs 195:507-23.  Senner CE, F Krueger, D Oxley, S Andrews and M Hemberger. (2012). DNA methylation profiles define stem cell identity and reveal a tight embryonic-extraembryonic lineage boundary. Stem Cells 30:2732-45.  Shimosato D, M Shiki and H Niwa. (2007). Extra-embryonic endoderm cells derived from ES cells induced by GATA factors acquire the character of XEN cells. BMC Dev Biol 7:80.  Simmons DG, AL Fortier and JC Cross. (2007). Diverse subtypes and developmental origins of trophoblast giant cells in the mouse placenta. Developmental Biology 304:567-578.  Simmons DG, DR Natale, V Begay, M Hughes, A Leutz and JC Cross. (2008). Early patterning of the chorion leads to the trilaminar trophoblast cell structure in the placental labyrinth. Development 135:2083-91.  Song J, S Saha, G Gokulrangan, PJ Tesar and RM Ewing. (2012). DNA and chromatin modification networks distinguish stem cell pluripotent ground states. Mol Cell Proteomics 11:1036-47.  Takahashi K and S Yamanaka. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126:663-676.  Tanaka S, T Kunath, AK Hadjantonakis, A Nagy and J Rossant. (1998). Promotion of trophoblast stem cell proliferation by FGF4. Science 282:2072-2075.  Tesar PJ, JG Chenoweth, FA Brook, TJ Davies, EP Evans, DL Mack, RL Gardner and RDG McKay. (2007). New cell lines from mouse epiblast share defining features with human embryonic stem cells. Nature 448:196-9.  Thomson JA, J Itskovitz-Eldor, SS Shapiro, MA Waknitz, JJ Swiergiel, VS Marshall and JM Jones. (1998). Embryonic stem cell lines derived from human blastocysts. Science 282:1145-1147.  Tsakiridis A, Y Huang, G Blin, S Skylaki, F Wymeersch, R Osorno, C Economou, E Karagianni, S Zhao, S Lowell and V Wilson. (2014). Distinct Wnt-driven primitive streak-like populations reflect in vivo lineage precursors. Development 141:1209-21.  209  van den Akker E, S Forlani, K Chawengsaksophak, W de Graaff, F Beck, BI Meyer and J Deschamps. (2002). Cdx1 and Cdx2 have overlapping functions in anteroposterior patterning and posterior axis elongation. Development 129:2181-2193.  Ware CB, AM Nelson, B Mecham, J Hesson, W Zhou, EC Jonlin, AJ Jimenez-Caliani, X Deng, C Cavanaugh, S Cook, PJ Tesar, J Okada, L Margaretha, H Sperber, M Choi, CA Blau, PM Treuting, RD Hawkins, V Cirulli and H Ruohola-Baker. (2014). Derivation of naive human embryonic stem cells. Proc Natl Acad Sci U S A 111:4484-9.  Woltjen K, IP Michael, P Mohseni, R Desai, M Mileikovsky, R Hamalainen, R Cowling, W Wang, PT Liu, M Gertsenstein, K Kaji, HK Sung and A Nagy. (2009). piggyBac transposition reprograms fibroblasts to induced pluripotent stem cells. Nature 458:766-70.  Wu T, H Wang, J He, L Kang, Y Jiang, J Liu, Y Zhang, Z Kou, L Liu, X Zhang and S Gao. (2011). Reprogramming of trophoblast stem cells into pluripotent stem cells by Oct4. Stem Cells 29:755-63.  Yamanaka S. (2012). Induced Pluripotent Stem Cells: Past, Present, and Future. Cell Stem Cell 10:678-684.  Ying QL, J Wray, J Nichols, L Batlle-Morera, B Doble, J Woodgett, P Cohen and A Smith. (2008). The ground state of embryonic stem cell self-renewal. Nature 453:519-23.  Zhu D, J Fang, Y Li and J Zhang. (2009). Mbd3, a component of NuRD/Mi-2 complex, helps maintain pluripotency of mouse embryonic stem cells by repressing trophectoderm differentiation. PLoS One 4:e7684.                   210 Chapter 6   Three, two, oneÉ  TROPHO-BLAST OFF!    Anthony Parenti1,2 and Amy Ralston1,2,# 1) Cell and Molecular Biology Program, Michigan State University, East Lansing, MI, 48824, USA 2) Department of Biochemistry and Molecular Biology, Michigan State University, East Lansing, MI, 48824, USA  Published as: Parenti, A. and Ralston, A., 2015. Three, two, oneÉ TROPHO-BLAST OFF!.Cell stem cell, 17(5), pp.499-500.         211 Abstract Trophoblast stem cells (TSCs) are derived from the early mouse embryo and can substantially contribute to placental development.  Two studies in Cell Stem Cell now report reprogramming mouse fibroblasts into TSCs, surmounting the first lineage barrier established in development, and providing new tools for researching placental specification and diseases.                   212 Section 1.  Main Text  Shortly after fertilization, the mammalian embryo sets aside cells that will produce major portions of the placenta.  This first step, which establishes the trophoblast lineage, is essential for healthy pregnancy.  A number of reproductive disorders, and even adult diseases, may result from defects in this segregation event (Guttmacher et al., 2014), underscoring the importance of understanding trophoblast biology.  Because the trophoblast lineage is set aside so early, the remaining cells of the embryo, which include progenitors of embryonic stem cells (ESCs), mostly lose the intrinsic ability to produce placental cell types.  Notably, self-renewing, multipotent trophoblast stem cells (TSCs) that can contribute to placenta development in vivo have been derived from the mouse embryo (Tanaka et al., 1998), and these TSCs provide a paradigm for efforts to derive or create new models of reproductive disorders.    Many prior efforts have focused on identifying the molecular mechanisms that establish and maintain the fetal/placental lineage barrier (Latos and Hemberger, 2014).  However, notions of lineage barriers, in general, were challenged when Takahashi and Yamanaka demonstrated that forced expression of specific transcription factors could change the fate of terminally differentiated cells, creating induced pluripotent stem cells (iPSCs) (Takahashi and Yamanaka, 2006).  This landmark observation prompted efforts to investigate whether other cell types could be created by transcription factor-induced transdifferentiation, bypassing a pluripotent intermediate.  In this issue of Cell Stem Cell, papers from the Schorle {Kubaczka, 2015} and Buganim {Benchetrit, 2015} laboratories identify factors that drive the transdifferentiation of mouse dermal fibroblasts to induced  213 TSCs (iTSCs) (Fig. 6.1), and provide exciting new insight into fundamental problems in developmental and stem cell biology.  To identify iTSC factors, the two groups used a Yamanaka-like approach, screening more than twelve transcription factors previously known to be important in trophoblast development.  Remarkably, both groups reported that overexpression of just three or four transcription factors induced fibroblasts to acquire key properties of TSCs, and showed that iTSCs resemble their bona fide counterparts in regards to morphology, transcriptome, epigenome, proliferation, and developmental potential in vitro and in vivo.  Three genes were present in both groupsÕ reprogramming cocktails, including Gata3, Eomes, and Tfap2c (GET).  However, Kubaczka et al. also included Ets2, while Benchetrit et al. reported that GET alone could produce iTSCs.  In addition, Benchetrit noted that Myc could boost the efficiency of iTSC formation, similar its role in iPSC reprogramming.  Notably, the duration of iTSC factor overexpression differed between the two groups, suggesting that the levels of iTSC factor overexpression influences the efficacy of the particular cocktail.     Trophoblast aficionados may be surprised to note that favorite genes, such as Cdx2 and Elf5, were not among the iTSC factors.  Although these two factors are potent inducers of trophoblast in ESCs (Latos and Hemberger, 2014), both groups noted that neither factor improved the overall efficiency of iTSC reprogramming. One possibility, raised by the Kubaczka et al., is that genes such as Cdx2 are needed to overcome the pluripotency network that is active in ESCs.  Thus, in the context of a mature, differentiated cell where the pluripotency network is inactive, factors such as CDX2 and ELF5 provide no added benefit.  Consistent with this hypothesis, Benchetrit et al.  214 reported that iTSC factors were able to induce formation of TSCs in MEFs lacking Oct4 (Pou5f1).  This observation, together with other data from the Buganim group, also strongly suggest that iTSCs bypass a pluripotent intermediate en route to adopting trophoblast fate, since Oct4 is strictly required for pluripotency.  This discovery is particularly interesting in light of evidence that many transdifferentiation protocols rely on a NANOG/OCT4-positive intermediate state (Bar-Nur et al., 2015; Maza et al., 2015).  Therefore, pluripotency may not be the only developmental state that can support the conversion of cell fate.  This work also provides important insight into mammalian development.  The Schorle group reported that iTSCs more closely resemble embryo-derived TSCs than do ESC-derived TSCs, created by overexpression of transcription factors such as Cdx2 or Elf5.  By comparing global DNA methylation profiles of embryo-derived TSCs, ESC-derived TSCs, and iTSCs, Kubaczka et al. demonstrated that iTSCs undergo a more complete conversion to the TSC state than do ESC-derived TSCs.   Interestingly, they also showed that their iTSC cocktail (GET + ETS2) was not sufficient to induce formation of TSCs in ESCs, suggesting that the ESCs are not competent to respond to these factors in the way that fibroblasts are.  Consistent with this notion, Kubaczka et al. showed that the global DNA methylation profile of iTSCs is, curiously, more similar to fibroblast than to ESCs.  Thus it appears that the epigenetic differences that define the fetal/placental lineage barrier and guard against errors in initial cell fate specification may be less prominent later in development, long after the first lineage decision has been made.  215  With the advent of this discovery that high quality iTSCs can be made by reprogramming, future trophoblast/placental studies are truly ready for takeoff.  iTSCs offer a tool to study the roles and regulation of specific trophoblast genes, and they provide a paradigm for deriving TSCs from human sources Ð a technology that is not currently available (Maltepe and Fisher, 2015).  Much as iPSCs have contributed to our understanding of how pluripotency is established in the blastocyst, iTSCs may offer unique insight into the mechanisms that regulate normal trophoblast development and organogenesis of the placenta.  Further, we may soon apply this new technology to establish patient-derived iTSC disease models, which will drive the discovery of the genetic mechanisms underlying diseases of placental origin.  With these new protocols and approaches in place, the new era of TSC research is sure to be out of this world.  Acknowledgements Our work is supported by R01 GM104009 from the National Institutes of Health.           216           APPENDIX              217 Figure 6.1. Overcoming the fetal/placental lineage barrier by reprogramming Pluripotent stem cells are largely prevented from differentiating into trophoblast cell types because of a lineage barrier that is established very early in development, at the blastocyst stage.  Two studies in this issue of Cell Stem Cell (Benchetrit et al., 2015; Kubaczka et al., 2015) identify protocols for reprogramming fibroblasts to induced Trophoblast Stem Cells (iTSCs), much as fibroblasts have been reprogrammed to induced Pluripotent Stem Cells (iPSCs).  iPSCs are self-renewing and pluripotent, or able participate in fetal development.  Similarly, iTSCs are self-renewing and multipotent, or able to participate in placental development.  Surprisingly, the iTSC reprogramming factors are distinct from those factors that have been shown to enable pluripotent stem cell lines to overcome the first lineage barrier, and iTSCs are more similar to TSCs derived from blastocysts than from pluripotent cell lines, illuminating differences in the establishment versus the maintenance of the fetal/placental lineage barrier.  218             REFERENCES             219 REFERENCES    Bar-Nur, O., Verheul, C., Sommer, A.G., Brumbaugh, J., Schwarz, B.A., Lipchina, I., Huebner, A.J., Mostoslavsky, G., and Hochedlinger, K. (2015). Lineage conversion induced by pluripotency factors involves transient passage through an iPSC stage. Nat Biotechnol 33, 761-768.  Benchetrit, H., Herman, S., van Wietmarschen, N., Wu, T., Makedonski, K., Maoz, N., Yom Tov, N., Stave, D., Lasry, R., Zayat, V., et al. (2015). Extensive Nuclear Reprogramming Underlies Lineage Conversion into Functional Trophoblast Stem-like Cells. Cell Stem Cell.  Guttmacher, A.E., Maddox, Y.T., and Spong, C.Y. (2014). The Human Placenta Project: placental structure, development, and function in real time. Placenta 35, 303-304.  Kubaczka, C., Senner, C.E., Cierlitza, M., Araœzo-Bravo, M.J., Kuckenberg, P., Peitz, M., Hemberger, M., and Schorle, H. (2015). Direct Induction of Trophoblast Stem Cells from Murine Fibroblasts. Cell Stem Cell.  Latos, P.A., and Hemberger, M. (2014). Review: the transcriptional and signalling networks of mouse trophoblast stem cells. Placenta 35 Suppl, S81-85.  Maltepe, E., and Fisher, S.J. (2015). PLACENTA: The Forgotten Organ. Annu Rev Cell Dev Biol.  Maza, I., Caspi, I., Zviran, A., Chomsky, E., Rais, Y., Viukov, S., Geula, S., Buenrostro, J.D., Weinberger, L., Krupalnik, V., et al. (2015). Transient acquisition of pluripotency during somatic cell transdifferentiation with iPSC reprogramming factors. Nat Biotechnol 33, 769-774.  Takahashi, K., and Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663-676.  Tanaka, S., Kunath, T., Hadjantonakis, A.K., Nagy, A., and Rossant, J. (1998). Promotion of trophoblast stem cell proliferation by FGF4. Science 282, 2072-2075.