FUNGICIDE RESISTANCE ANALYSIS OF MAJOR TREE FRUIT PATHOGENS IN MICHIGAN  By  Kimberley E. Lesniak           A DISSERTATION Submitted to Michigan State University in partial fulfillment of the requirements  for the degree of  Plant PathologyDoctor of Philosophy  2016     ABSTRACT   FUNGICIDE RESISTANCE ANALYSIS OF MAJOR TREE FRUIT PATHOGENS IN MICHIGAN  By Kimberley E. Lesniak  Chemical and/or antibiotic resistance management is critical in order to reduce the progression or complete loss of a product while effectively controlling plant pathogen populations. This dissertation focuses on the observation for control and resistance management of four major worldwide fruit tree pathogens: Venturia inaequalis (apple scab), Monilinia fructicola (American brown rot), Erwinia amylovora (Ea; fire blight) and Pseudomonas syringae pv. syringae (Pss; bacterial canker).  Chemical fungicides have been and are still heavily relied on for management of the fungal plant pathogens V. inaequalis and M. fructicola.  Single-site fungicides such as the quinone-outside inhibitors (QoIs) and succinate dehydrogenase inhibitors (SDHIs) have shown to provide excellent control but can also select for resistant pathogen populations in a relatively short time period, as in the case for both V. inaequalis and M. fructicola.  Adequate control of bacterial pathogens, such as Ea and Pss has been a challenge for pome and stone fruit growers for decades.  Antibiotics have been intensively used for the management of Ea while only copper formulations are registered for Pss.  The current research implicates that orchards in Michigan and in other states cannot further rely on QoI fungicides for apple scab control.  Further investigation of peach and cherry orchards indicates that SDHI applications have shifted Michigan populations toward resistance.  Results from studies performed with Ea and Pss indicate that non-chemical applications such as acibenzolar-S-methyl (ASM) and phosphate salts have a potential to reduce the use of antibiotics and copper for control in seasons when disease pressure is low to moderate.iv                       This dissertation is dedicated to my parents, Margaret and James and my brothers, Jim and Steve. I would not be where I am today if not for your encouragement and support and allowing me to do what I needed to  for the sake of my love of plant pathology and science. Your love and belief in my success helped me to reach for the stars and beyond. Love always and all ways.    v  ACKNOWLEDGEMENTS   My heartfelt and most sincere thanks are to my advisor Dr. George W. Sundin for providing me the opportunity to further my research and extension skills in his laboratory.  I would not be the scientist I am today after his guidance, instruction, knowledge, and patience in many different subjects. I would also like to extend my thanks and appreciation to my committee Dr. Mary Hausbeck, Dr. Tyre Proffer, Dr. Nikki Rothwell, and Dr. Frances Trail for their support and counseling throughout my education at Michigan State.  A special thanks is needed for Dr. Tyre Proffer and Gayle C. McGhee who were the backbone of my laboratory and field life, day-in and day-out, and who also further shaped me into the person I am today.  Last, but certainly not least, are my fellow Sundinites and MSU labmates who made my time at Michigan State a most memorable experience.  Finally, I need to provide a heartfelt thanks to Dr. V. Ganga Nair and Dr. Michael M. Morgan who led me to the path of plant pathology and plant biology.  To each and every one of you  thank you.  Thank you from the bottom of my heart.           vi  PREFACE  The limitation of QoI fungicide use will have a major impact on chemical management programs for apple scab control in Michigan orchards.  Further surveillance of QoI resistant populations is needed in order to fully understand the progression and future development or reversion of these populations.  The ability to manage QoI-resistant populations using less effective chemical classes will also need to be monitored to adequately structure and implement current integrated pest management programs.  While DMI fungicides do not have such an absolute effect on pathogen populations as the QoI fungicides, they still indicate a need for change in chemical management programs for M. fructicola in both cherry and peach orchards.  The current results indicate that one of the measures to genetically detect DMI-resistant isolates is not applicable to Michigan populations.  Therefore, in order to further monitor the spread of DMI resistance, a higher throughput assay needs to be implemented in order to identify resistant isolates rather than in vitro Poison plate agar assays.  To mitigate the reliance on antibiotics or copper for the control of Ea and Pss, respectively, ASM and phosphate salts were shown to potentially reduce the number of applications when disease pressure was low to moderate. Further analysis of application strategy (drench vs. foliar) and timing while alone or in combination with antibiotics/copper will help to identify an optimal management program to reduce resistance.  Overall, this research has identified major areas regarding resistance management to be addressed for the effective control of four major fruit pathogens in Michigan and worldwide.  These data will aid in restructuring integrated pest management programs for effective control and provide the bases necessary to document such populations in the future.  vii  TABLE OF CONTENTS  LIST OF TABLES .......................................................................................................... x  LIST OF FIGURES ....................................................................................................... xi  KEY TO ABBREVIATIONS..........................................................................................xiii  CHAPTER 1  Review of Important Topics in Michigan Fruit Orchards .......................... 1      MAJOR TREE FRUIT PATHOGENS IN MICHIGAN .................................................. 1      Venturia inaequalis (Cooke) G. Winter : Apple scab .................................................. 2       Monilinia fructicola (Winter) Honey: American brown rot (ABR).............................. 3      Blumeriella jaapii (Rehm) Arx: Cherry leaf spot (CLS).............................................. 5      Podosphaera leucotricha (Ell. and Ev.) Salm. : Powdery mildew ............................... 6      Erwinia amylovora (Burrill) Winslow et al. : Fire blight ............................................. 6 FUNGICIDE RESISTANCE AND SELECTED MODES OF ACTION OF SITE- SPECIFIC FUNGICIDES ............................................................................................... 7      Benzimidazoles ........................................................................................................ 10      Sterol demethylation inhibitors (DMIs) .................................................................... 10      Quinone-outside inhibitors (QoIs) ............................................................................ 11      Succinate dehydrogenase inhibitors (SDHIs) ............................................................ 11 REFERENCES ............................................................................................................. 13  CHAPTER 2  Occurrence of QoI resistance and detection of the G143A mutation  in Michigan populations of Venturia inaequalis ............................................................ 18 ABSTRACT ................................................................................................................. 18 INTRODUCTION ........................................................................................................ 19 MATERIALS AND METHODS ................................................................................... 22      Collection of isolates of Venturia inaequalis ............................................................ 22      Monoconidial isolation of Venturia inaequalis ......................................................... 25      In vitro fungicide sensitivity, 2008 survey ................................................................ 25      DNA extraction, molecular detection of the G143A mutation, and partial       sequencing of CYTB, 2008 and 2009 survey ............................................................. 26 RESULTS ..................................................................................................................... 28      Isolate collection of Venturia inaequalis: 2008 and 2009 surveys ............................. 28      In vitro fungicide sensitivity, 2008 survey ................................................................ 29      Molecular detection of the G143A mutation, 2008 survey ........................................ 30      Combined bioassay and PCR-based G143A assay during 2008 survey ..................... 31      Molecular detection of the G143A mutation, 2009 survey ........................................ 33      Validation of the allele-specific PCR assay............................................................... 38 DISCUSSION ............................................................................................................... 38 ACKNOWLEDGMENTS ............................................................................................. 43 REFERENCES ............................................................................................................. 44  viii  CHAPTER 3  Analysis of propiconazole sensitivity in Monilinia fructicola from  Michigan and effect on fruit rot control ......................................................................... 49 ABSTRACT ................................................................................................................. 49 INTRODUCTION ........................................................................................................ 50 MATERIALS AND METHODS ................................................................................... 53      Collection and monoconidial isolation of Michigan field isolates of M. fructicola .... 53      In vitro sensitivity to propiconazole .......................................................................... 54      DNA extraction for species identification and detection of the DMI-resistance       determinant,  ................................................................................................. 55      Species confirmation ................................................................................................ 55       .................................................................................. 55      Sequencing of the upstream region of CYP51 and the CYP51 gene ........................... 56      Analysis of CYP51 expression in isolates of M. fructicola ........................................ 56      Effect of consecutive transferring of Michigan isolates and stability of       DMI-phenotype ........................................................................................................ 58        Analysis of DMI fungicide application, rate, and pathogenicity of Michigan isolates       of M. fructicola on detached cherry and peach fruit .................................................. 59      Cherry inoculation experiment ................................................................................. 59      Isolate selection for in vitro peach evaluation of fenbuconazole applications ............ 62      Peach inoculation experiment ................................................................................... 62 RESULTS ..................................................................................................................... 63      Isolate collection ...................................................................................................... 63      In vitro sensitivity of isolates of M. fructicola to propiconazole ................................ 64       ............................................................... 64      Sequencing of the upstream region of CYP51 in isolates of M. fructicola ................. 68      Evaluation of the relative expression of the CYP51 gene in Michigan isolates of M.       Fructicola ................................................................................................................ 69         Evaluation of long-term storage and consecutive transferring on in vitro DMI       sensitivity ................................................................................................................. 71      Application timing and rate of fenbuconazole for the control of different       M. fructicola phenotypes on inoculated cherry and peach fruit ................................. 72 DISCUSSION ............................................................................................................... 78 REFERENCES ............................................................................................................. 83  CHAPTER 4  Evaluation of acibenzolar-S-methyl and phosphorous acid for the  control of bacterial diseases on tree fruit and PR-gene induction ................................... 87 ABSTRACT ................................................................................................................. 87 INTRODUCTION ........................................................................................................ 88 MATERIALS AND METHODS ................................................................................... 93      Field trials for analysis of Actigard and Phostrol as supplemental products for       Control of fire blight................................................................................................. 93      Field analysis of Phostrol foliar applications for control of the leaf spot phase of       Bacterial canker on sweet cherry cultivars ................................................................ 94      In vitro analysis of a direct effect of Phostrol on strains of Ea110 and PssF55       on two media types ................................................................................................... 95      Evaluation of PR-gene induction in Actigard and Phostrol treated trees .................... 95 ix       Evaluation of Phostrol drenches in potted trees under controlled conditions and       induction of PR-genes .............................................................................................. 96   RESULTS ..................................................................................................................... 97      Field trials for analysis of Actigard and Phostrol as supplemental products for       Control of fire blight................................................................................................. 97      Field analysis of Phostrol foliar applications for control of bacterial leaf spot on       sweet cherry cultivars ............................................................................................. 101      In vitro analysis of a direct effect of Phostrol on strains of Ea110 and PssF55       on two media types ................................................................................................. 101      Evaluation of PR-gene induction in Actigard and Phostrol treated trees .................. 104      Evaluation of Phostrol drenches in potted trees under controlled conditions and       induction of PR-genes ............................................................................................ 106 DISCUSSION ............................................................................................................. 108 REFERENCES ........................................................................................................... 111                  x  LIST OF TABLES  Table 2.1   Detection and distribution of QoI fungicide resistance in Michigan  populations of Venturia inaequalis sampled in 2008 using an in vitro conidial  germination assay .......................................................................................................... 29  Table 2.2  Molecular detection of the G143A mutation in isolates of V. inaequalis  collected during 2008 in commercial and experimental apple orchards in Michigan ...... 31  Table 2.3  Comparison of results from an in vitro fungicide sensitivity assay and  from molecular detection of the G143A mutation in isolates of V. inaequalis collected  during 2008 in Michigan ............................................................................................... 32  Table 2.4  Frequency of the G143A mutation of isolates collected in Michigan  (2008-2009) and Ohio (2009) ........................................................................................ 35  Table 3.1 Overall survey of isolates of Monilinia fructicola in Michigan commercial  tree fruit orchards and analyses of in vitro sensitivity to propiconazole and molecular  detection of the determinant: 2009-2011........................... 65  Table 3.2  Evaluation of relative growth phenotype after consecutive transferring and  storage of isolates of Monilinia fructicola on two media types....................................... 72  Table 3.3  Isolates used for in vitro cherry and peach assays to analyze protective  and curative applications of fenbuconzole for control of a range of DMI-sensitive  isolates of Monilinia fructicola ...................................................................................... 74  Table 4.1  Evaluation of fire blight symptoms (blossom blight and shoot blight) in  field trial experiments performed at Michigan State University Plant Pathology  and Horticulture Research Stations, East Lansing, MI ................................................... 99          xi  LIST OF FIGURES  Figure 2.1 Location of commercial apple orchards where leaf samples infected  With Venturia inaequalis were collected in the lower Michigan peninsula in  2008 and 2009 ............................................................................................................... 24  Figure 2.2 Gel electrophoresis showing amplification of the G143A mutation (433 bp) within V. inaequalis CYTB conferring QoI resistance and a 238 bp fragment of a  region downstream of the mutation used as an amplification control ............................. 28  Figure 2.3 Frequency distribution of the G143A mutation within populations  of Venturia inaequalis in Michigan commercial apple orchards during 2009 ................. 38  Figure 3.1 Frequency distribution of in vitro relative growth to a discriminatory dose of 0.3 g/ml propiconazole within populations of M. fructicola in Michigan  orchards.  Data consist of 49 orchards throughout Michigan, totaling 487 isolates ......... 66  Figure 3.2  insert in isolates of M. fructicola, as separated by Michigan orchard location ................ 67  Figure 3.3 Detection of additional inserts upstream of the CYP51 gene in DMI- sensitive isolates of M. fructicola in Michigan ............................................................... 69  Figure 3.4 Relative expression of the CYP51 gene in isolates of M. fructicola grown  on non-amended media (PDA) and media amended with DMI fungicide  (Orbit®, propiconazole) ................................................................................................. 70    Figure 3.5 Evaluation of fenbuconazole application on detached cherry fruit using  a standard field rate (6oz/A; 177ml/ha) ......................................................................... 75  Figure 3.6 Evaluation of fenbuconazole applications on the sweet cherry cultivar,   ......................................................................................................... 76  Figure 3.7 In vitro analysis of protective and curative applications of fenbuconazole  (6 fl. oz/A label rate) on Starfire peaches .................................................................... 77   Figure 3.8 Evaluation of protective application of on the peach cultivar Crest Haven .. 78 Figure 4.1 Application of Phostrol  (2 qt/A ) for control of Pseudomonas  syringae pv. syringae (Pss) leaf spot on 10-year old sweet cherry cultivars Cavalier  and Ulster ................................................................................................................. 102    xii  Figure 4.2 In vitro analysis of a direct effect of different Phostrol rates on the growth of Erwinia amylovora (Ea, strain Ea110; A) and Pseudomonas syringae pv. syringae (Pss, strain FF5; B), grown on two media types ........................................................... 103  Figure 4.3  Induction of PR-proteins in 2-year old potted Gala trees after  a single  application of  Phostrol (2 qt/A rate, black bars), foliar application of  Actigard  (2 oz/A rate, light gray bars), and drench application of Actigard (0.1 g/500ml per  tree, dark gray bars) in 2009 (A) and 2012 (B) ............................................................ 105  Figure 4.4  Evaluation of PR-protein induction after two soil drenches of Phostrol (A) and/or pathogen inoculation with Erwinia amylovora (strain Ea110; B) ................ 107                    xiii  KEY TO ABBREVIATIONS  EBDCs Ethylenbisdithiocarbates DMIs  Sterol demethylation inhibitors QoIs  Quinone-outside inhibitors SDHIs  Succinate dehydrongenase inhibitors ABR  American brown rot CLS  Cherry leaf spot FRAC  Fungicide Resistance Action Committee CYP51  C-demethlyase gene CYTB  Cytochrome b gene SDH  Succinate dehydrongenase enzyme TCA  Tricarboxcylic acid MSU  Michigan State University CWA  Coffee water agar dH2O  Distilled water SHAM  Salicylhydroxamic acid PCR  Polymerase chain reaction PDA  Potato dextrose agar PDAY  Potato dextrose agar with yeast extract ITS  Internal transcription region TBE  Tris/Borate/EDTA buffer RFLP  Restriction fragment length polymorphism xiv  DNA  Deoxyribonucleic acid RNA  Ribonucleic acid cDNA  Complimentary deoxyribonucleic acid RT-qPCR Real-time reverse transcription PCR RG  Relative growth CEA  Tart cherry extract agar Ea  Erwinia amylovora Pss   Pseudomonas syringae pv. syringae ASM  Acibenzolar-S-methyl (Actigard®) PH  Phosphorous acid salts (Phostrol®) PR-gene Pathogenesis related gene CFU  Colony forming unit INA  Ice-nucleation activity gene SAR  Systemic acquired resistance LSD  Least significant difference LB  Luria-Bertani broth MM  Minimal medium REST®  Relative Expression Software Tool     1  CHAPTER 1  Review of Important Topics in Michigan Fruit Orchards  MAJOR TREE FRUIT PATHOGENS IN MICHIGAN Five of the major tree fruit pathogens in Michigan are the fungal pathogens: 1) Venturia inaequalis, apple scab; 2) Monilinia fructicola, American brown rot; 3) Blumeriella jaapii, cherry leaf spot; 4) Podosphaera leucotricha, powdery mildew, and the bacterial pathogen 5) Erwinia amylovora, fire blight.  All of the diseases caused by these pathogens seriously affect yield, the potential to sell fruit in the fresh market, and tree vigor.  In addition, the costs of effective management programs for these diseases continues to rise, and fungicide and bactericide resistance issues place a significant constraint on tree fruit production in Michigan tree fruit orchards.  These pathogens are a constant, major problem in Michigan apple, cherry, and peach orchards and in many areas worldwide. Regarding tree fruit production, Michigan is the third leading producer of apples, ranks first in the production of tart cherries, and fourth in sweet cherry and peach cherry markets.  Apples are the largest tree fruit crop grown in Michigan, with 7.5 million trees planted for commercial production, resulting in an estimated $143 million production value.  Michigan produces about 75 percent of the U.S. tart cherries, valued at $47 million while the state accounts for 20 percent of sweet cherries, with an economic value of $18 million.  Peach production within Michigan accounts for about $13 million and the peach cultivar Red Haven, developed in 2  Michigan, is highly planted throughout the U.S.  (31, 32).  Overall, tree fruit production in Michigan is critical to maintain economic viability to the state.    Venturia inaequalis (Cooke) G. Winter : Apple scab  Apple scab, caused V. inaequalis, is one the most widespread and destructive fungal diseases in Michigan and worldwide affecting commercial apple trees. Orchard losses of 100% are common in management programs where chemical applications are improperly used (26).  The main detriment of apple scab is the appearance of lesions on the fruit, making fresh produce unmarketable to consumers due to the unattractive appearance of apple fruit.  Although scab-resistant cultivars are available, the fruit produced by these cultivars is unappealing to consumers; therefore, scab-susceptible apple cultivars are commercially grown and produced. The disease cycle of V. inaequalis starts with the overwintering of infected fallen leaves remaining on the orchard floor from the previous season.  In the beginning of spring, with periods of rainy and cool weather, from green tip to petal fall, these leaves will forcibly eject ascospores, the primary inoculum, harbored in pseudothecia, which will colonize and infect healthy young tissue and fruit (7, 26).  After primary infection, secondary spores (conidia) are produced and provide cyclic infections to healthy tissue throughout the remainder of the season, causing additional infections until infected leaves abscise and fall to the orchard floor.   Cultural control methods of apple scab involve sanitation of infected fallen leaves, which provide the primary inoculum for scab infection in the spring.  This is a widely incorporated method and is achieved by either shredding leaf litter during the autumn or by the application of urea to increase microbial decomposition of the infected leaf tissue.  These methods can result in a typical decrease of 70% of primary ascospores the following season (7, 42). 3  Although apple scab can be managed with protectant, multi-site chemicals such as, captan and ethylenebisdithiocarbates (EBDCs), the most effective chemical control management has relied heavily on the application of site-specific fungicide classes.  Currently, up to 12 fungicide applications are applied in management programs due to the use of susceptible apple cultivars.  Due to the reliance of chemical control for scab, there has also been a long history of resistance of V. inaequalis populations to single-site fungicides.  Dodine was first introduced in the 1950s, and resistance was detected after 10-yrs of application in apple orchards (43).  Following the loss of dodine, the benzimidazoles and sterol demethylation inhibitors (DMIs) were introduced and were effective until 10 and 5 years after incorporation into apple scab management programs, respectively (14, 18, 19, 20).  The quinone-outside-inhibitors (QoIs or strobilurins) were registered for use in apple orchards for control in 1999 and were effective until we detected resistance for the first time in the United States, and in Michigan in 2008 (21).  Due to the lack of chemical tools for scab management, a new chemical class, the succinate dehydrogenase inhibitors (SDHIs), are currently being incorporated into apple scab management programs and closely monitored for fungicide resistance management in field trials in Michigan orchards.  Monilinia fructicola (Winter) Honey: American brown rot (ABR)  Two species of Monilinia are present in the eastern United States and in Michigan; M. fructicola, the causal agent of American brown rot (ABR), which mainly causes fruit infection, and M. laxa, (European brown rot) which causes blossom and twig blight (7, 15).  In Michigan, we are more concerned with M. fructicola due to recent reports of chemical resistance in the southeastern and eastern United States (36, 44).  American brown rot is the most important fungal pathogen of stone fruit and is prevalent in tart and sweet cherry orchards as well as peach orchards in Michigan (8).   4  Fruit infection typically occurs closer to harvest in both peach and cherry fruit as the susceptibility of fruit intensifies with the amount of sugar content, or ripening of fruit.  The disease cycle of M. fructicola is comparable to that of V. inaequalis, except that warm and humid conditions are optimal for disease initiation.  Infected fruit from the previous season (mummies), remaining in trees or on the orchard floor provide the source of inoculum for the next season.  Primary spores are rarely produced from the overwintering mummies, only if they are buried or partially buried in the orchard floor, but conidia are readily produced and spread either by these mummified fruit or infected trunk cankers.  Even though ABR typically does not cause significant blossom blight, conidia present on the flowers can provide inoculum for developing fruit.  Fruit infection by M. fructicola typically occurs as fruit begin to ripen and can also occur by direct penetration of the fungus to the fruit cuticle or through the stomata, and of course through wounds caused by environmental conditions, insects, or cultural, orchard management practices (8, 15, 35).  Cultural control strategies to manage brown rot in peach and cherry orchards include the removal of mummified fruit from the orchard floor to reduce available inoculum as well as, the pruning of branches to minimize warm and humid conditions within the tree canopy, which are conducive for M. fructicola infection of tissue (8, 15, 35).   As with apple scab, the main form of effective control of ABR is through the application of single-site fungicides.  M. fructicola populations are currently resistant to the benzimidazole fungicides, which were the main form of chemical control for decades after labeling in Michigan orchards before resistance (14).  The DMI fungicide class is the most effective class for brown rot management and DMIs have been registered and used in Michigan orchards for over 25 years.  Other fungicides registered for ABR management programs are the QoIs and SDHIs, but 5  these fungicide classes are less effective than DMIs.  Although the DMIs are the most widely used chemical class for brown rot management and are site-specific, they have provided the most consistent efficacy in ABR management programs especially in years of high disease pressure, and resistance has appeared to evolve more slowly in M. fructicola compared to V. inaequalis (15, 35).    Blumeriella jaapii (Rehm) Arx: Cherry leaf spot (CLS)  B. jaapii is the most destructive fungal leaf pathogen affecting tart cherry trees in the United States.  As mentioned above, Michigan is the leading producer of tart cherry trees and the major cultivar grown in Michigan, Montmorency, is highly susceptible to cherry leaf spot (CLS).  The major importance of CLS is premature defoliation due to foliar lesions which lead to chlorosis and eventually premature defoliation, as well as pathogen colonization of the surface of leaves, reducing overall photosynthesis (16).  For young trees, between 2-5 yrs old, consecutive years of severe defoliation by CLS can result in tree death.  Older trees are also susceptible to being killed from winter injury in years following severe early defoliation events.  Severe CLS infection before harvest causes unmarketable fruit; containing less sugar content, not uniformly ripened and discolored.  This occurs because two leaves per cherry fruit are required for adequate development of a single fruit, so with CLS defoliation the result is the reduction of yield and quality of fruit production.  Additionally, in more mature trees affected by CLS, there can be a loss of tree vigor and reduction in blossom/fruit production in the successive season due to the -off for the winter season (8, 15, 16).   Chemical control is heavily relied upon for the control of CLS in cherry orchards.  However, as with the above pathogens, the use of site-specific fungicides has led to DMI resistance in CLS populations (25, 34).  While copper has been a traditional standard in 6  management programs, foliar phytotoxicity is a serious issue especially in extreme environmental conditions (30).   Podosphaera leucotricha (Ell. and Ev.) Salm. : Powdery mildew  Powdery mildew is another major foliar pathogen of apple and occurs in all major apple fruit production areas and causes symptoms not only on leaves, but flower buds, and in progressive infection, reduces fruit quality and can lead to fruit russeting, reducing the overall marketable yield of infected apples.  Infections of P. leucotricha are most devastating during hot and dry environmental conditions (7, 27).  There are tolerant/less susceptible apple cultivars that have natural resistance to P. leucotricha in seasons with moderate disease pressure, such as Enterprise, Jonafree, and Prima, but they are not widely planted.     As with the above fungal pathogens, chemical control of powdery mildew is most effective and protection of the newly formed leaf tissue is critical for optimal disease control.   Management of powdery mildew is typically incorporated into chemical spray regimens in accordance with apple scab consisting of a mixture of DMI and QoI fungicides. However, due to the loss of QoIs because of qualitative resistance in populations of V. inaequalis and previously the benzimidazoles, powdery mildew control relies on DMI applications for the most effective disease control.  There has been a concern of DMI-resistant populations of P. leucotricha in New York but there is no evidence of a lack of efficacy in Michigan orchards (7, 27). Erwinia amylovora (Burrill) Winslow et al. : Fire blight  For over 200 years, fire blight has been the most devastating bacterial pathogen of pome fruits worldwide and, throughout this time, long-term and effective control strategies are still lacking.   Current control measures rely on protection of the flower clusters to reduce epiphytic populations of the bacterium on the stigma 7  (2, 33).  This is to reduce the chance of systemic infection of the woody tissue in which management options are strictly limited and mainly ineffective.  However, existing control options are extremely limited.  The most effective form of management for fire blight is the application of antibiotics, namely streptomycin, however resistance of the pathogen has been reported in Michigan and in areas worldwide (6, 15, 28, 29).  Other available bactericides, oxytetracycline and kasugamycin, do provide adequate protection of flower populations but are not as effective as applications of streptomycin.  Additional control options are copper applications at early leaf stages and the pruning of infectious shoots after bloom to decrease the amount of inoculum for shoot blight later in the season (33).  More novel options involve the application of biological antagonists, such as commercial formulations of Bacillus or Pantoea species to try and out-compete the flower cluster from populations of E. amylovora.  However, these biological agents have only been shown to be effective in the western United States and not in Michigan or eastern apple orchards (40).   FUNGICIDE RESISTANCE AND SELECTED MODES OF ACTION OF SITE-SPECIFIC FUNGICIDES Certain agricultural practices have increased our reliance on chemicals for plant pathogen control.  For example, the reliance on susceptible cultivars due to public preference and the planting of genetically similar crops.  Chemical control of plant diseases has become a critical part of management programs since the development of specific-site fungicides beginning in the 1960s (9, 41).   However, the true beginning of chemical application in agriculture began with the use of Bordeaux mixture in 1885, leading to the classification of fungicide generations.  The Bordeaux mixture is considered the first generation of fungicides and incorporates inorganic chemicals.  In 8  1934, the second generation of chemicals was developed and included organic chemicals, which act as surface protectants and do not have translaminar activity on the plant tissue.  Chemicals in this second generation include captan, chlorothalonil, dithiocarbamates, and quinones (9).  Systemic, organic chemical comprise the third generation of fungicides and have not only protective but curative qualities as well.  Chemicals within this generation include the benzimidazoles, caboximides, and azoles.  Fourth generation fungicides include products that induce plant resistance or affect the pathogens ability to initiate disease, such as systemic acquired resistance-inducers or antagonistic organisms (9).   Before the 1970s, the majority of fungicides used for pathogen control were protective, multi-site chemicals, which did not pose a great threat for resistance.  However, the production and application of single-site fungicides that were first introduced in the 1960s were at high risk for the development of resistance.  The introduction of these single-site fungicides coincided with the first cases of fungicide resistance which has been an ongoing issue with growers and fungicide manufacturers, reducing the number of active ingredients available for successful disease management (3, 4, 9, 41). The Fungicide Resistance Action Committee (FRAC) was formed in 1981 in order to collaborate with chemical companies, growers, and extension representatives to establish educational outreach about chemical resistance and form anti-resistance strategies to increase the longevity of single-site fungicides.  They would also focus on reducing cross-resistance between chemical groups or within the same group to improve the longevity of particular classes of fungicides (3, 4, 9).   Resistance of plant pathogens to fungicides occurs through many different mechanisms.  The most typical mode of resistance is by a single, and sometimes multiple, genetic mutation 9  with in the pathogen inhibiting the binding site of the chemical within the pathogen.  This lack of binding by the fungicide molecule to its target site in the pathogen reduces, or completely eliminates the sensitivity of the pathogen to that particular fungicide. Other mechanisms include, pathogen drug-efflux pumps which reduces the amount of fungicide contained within fungal cells, overproduction of the fungicide target-site within the pathogen, fungal metabolism of the chemical resulting in its breakdown within the pathogen, or the production of an identical enzyme target in which the fungicide is not able to bind (3, 4, 24). Within a pathogen population, once genetic changes occur, fungicide resistance is heritable and can become stable within the population.  The frequency of resistant isolates or the initial onset of resistant pathogen populations are difficult to detect.  With repeated applications of the same class of fungicides, only a few individuals may develop resistance, leaving the remaining population sensitive to chemical application and implying chemical efficacy.  However, the accumulation of resistant isolates will increase over time outcompete the sensitive population in instances where higher rates or shorter intervals of the specific chemical are applied, thus allowing for quicker propagation of resistant mutants which will then dominate the population (3, 4, 24).   There are two types of pathogen resistance which is based on the chemical, the pathogen, and the number of genes involved.  The first is monogenic resistance which is also termed as --gene resistance.  This type of resistance typically confers high levels of resistance, leading to a qualitative resistance trait in the pathogen and complete loss of chemical control.   Whereas, polygenic fungicide resistance involves multiple genes, each with partially affected in some way, creating a wide range of chemical sensitivities within the population based on how many genes are transformed.  This is the case for quantitative resistance, in which higher 10  chemical rates and increased frequency of fungicide applications can still manage shifting pathogen populations (3, 4).     Benzimidazoles  -tubulin gene and are determined as high risk for fungicide resistance development.  Pathogen resistance to benzimidazoles is caused by point mutations within the target gene.  Several mutations have been documented in a wide range of -tubulin gene (24). Mutations within the same species are not necessarily located in the same position.  For example, isolates of M. fructicola from California orchards contained a point mutation either at codon 6 or 198 resulting in an amino acid change from histidine to tyrosine or glutamic acid to lysine, respectively (23).  Additionally,  evidence that mutations at different codons may result in different resistance phenotypes (low, medium, or high)  has been shown in populations of both M. fructicola and V. inaequalis (17, 23).  Sterol demethylation inhibitors (DMIs)  The DMIs belong to FRAC group 3 and pose a moderate risk for fungicide resistance and cross-resistance is also an issue within this class of fungicides (FRAC).  The DMIs target the cytoc- demethylase (CYP51) gene which alters ergosterol biosynthesis and affects the stability of the fungal cell membrane.  Three mechanisms have been attributed to resistance which include point mutations within the CYP51 gene, overexpression of drug efflux pumps with in the pathogen cell to remove lethal doses of chemical, or overexpression of CYP51 caused by insertions upstream of the gene or due to an elevated gene copy number.  These three mechanisms have been widely identified in field isolates of various plant pathogens (24).  A fourth mechanism, involved the overexpression of the ATP-Binding Cassette transporters were induced in DMI-resistant laboratory mutants of 11  Botrytis cinerea and Mycosphaerella graminicola, but has not been observed in field isolates (11, 46). Quinone-outside inhibitors (QoIs)  The QoIs (FRAC group 11) are a class of fungicides at a very high risk for resistance development.  The QoIs target the Qo-site within the cytochrome b gene (CYTB) located in the mitochondrial bc1 complex III.  These chemicals block electron transfer in the respiration chain, thereby inhibiting cellular respiration and successive ATP production.  Resistance to QoIs occurs through a single point mutation within the CYTB gene.  Three different point-mutations can occur in plant pathogenic fungi and depending on the position of the mutation confers the level of resistance to QoIs.  The most common mutation is the G143A mutation, changing glycine to alanine at amino acid position 143 of the CYTB gene, resulting in qualitative resistance.  The second mutation and third mutations, F129L (changing phenylalanine to leucine at position 129) and G137R (changing glycine to arginine at position 137) results in moderate QoI resistance, or quantitative resistance and are still able to be effectively controlled by QoI application (1, 10, 37). Succinate dehydrogenase inhibitors (SDHIs)  The SDHIs (FRAC group 7) are a class of chemicals with moderate to high risk of pathogen resistance and cross-resistance within the chemical group.  There are three generations of SDHI fungicides (12).  The SDHIs inhibit cellular respiration, similar to the QoIs, but target the succinate dehydrogenase (SDH) enzyme which is linked to tricarboxcylic acid cycle (TCA).  The SDH enzyme consists of four subunits, sdhA, sdhB, sdhC, and sdhD.  Resistance to SDHIs is due to point mutations occurring in the shdB, C, and D complexes. Numerous point mutations have been detected in multiple pathogens on a wide range of hosts while mutations in the sdhA subunit have not been associated with 12  SDHI resistance.  Cross-resistance to the newer generation of SDHIs (fluopyram, fluxapyroxad, etc.) has not currently been detected (38).                                           13                         REFERENCES                       14  REFERENCES    1.  Anke, T., Oberwinkler, F., Steglich, W., and Schramm, G. 1977. The strobilurins-new       antifungal antibiotics from the basidiomycete Strobiluris tenacellus. J. Antibiot. 30:806-810.   2.  Baker, K. F. 1971. Fire blight of pome fruits: The genesis of the concept that bacteria are       pathogenic to plants. Hilgardia 40:603-633.   3.  Brent, K. J. and Holloman, D.  2007. Fungicide resistance in crop pathogens: How can it be       managed? FRAC Monograph No. 1.   4.  Brent, K. J. and Hollowman, D. 2007. Fungicide resistance: The assessment of risk.  FRAC       Monograph No. 2.    5.  Chen, F., Lui, X., Chen, S., Schnabel, E., and Schnabel, G. 2013. Characterization of       Monilinia fructicola strains resistant to both propiconazole and boscalid. Plant Dis. 97:645-      651.  6.  Chio, C.S. and Jones, A.L. (1993): Nucleotide sequence analysis of a transposon (Tn 5393)       carrying streptomycin resistance genes in Erwinia amylovora and other Gram  negative       bacteria. J. Bacteriol. 175:732  740.  7.  Compendium of apple and pear diseases and pests, 2nd ed. 2014. American Phytopathology          Society Press. Eds. Sutton, T. B., et. al. 218 pp.   8.  Compendium of Stone fruit diseases. 1995. American Phytopathology Society Press. Eds.       Ogawa, J. M., et. al. 98 pp.   9.  De Waard, M. A., Georgopoulos, S. G., Hollomon, D. W., Ishii, H., Leroux, P., Ragsdale, N.       N., and Schwinn, F. J. 1993. Chemical control of plant diseases: Problems and prospects.       Annu. Rev. Phytopathol. 31:403-421.   10.  Gisi, U., Sierotski, H., Cook, A. and McCaffery, A. 2002. Mechanisms influencing the         evolution of resistance to Qo inhibitor fungicides. Pest Manage. Sci. 58:859-867.   11.  Hayashi, K., Schoonbeek, H., De Waard, M. A. 2002. Expression of the ABC transporter        BcatrD from Botrytis cinerea reduces sensitivity to sterol demethylation inhibitor fungicides.         Pestic. Biochem. Physiol. 73:110-121.   12.  Hirooka, T. and Ishii, H. 2013. Chemical control of plant diseases. J. Gen. Plant Pathol.         79:390-401.   13.  Holb, I. H. and Schnabel, G. 2007. Differential effect of triazoles on mycelial growth and        disease measurements of Monilinia fructicola isolates with reduced sensitivity to DMI   15        fungicides. Crop Protection 26:753-759.  14.  Jones, A. L. 1981. Fungicide resistance: Past experience with benomyl and dodine and           future concerns with sterol inhibitors. Plant Dis. 65:990-992.  15.  Jones, A. L. and Sutton, T. B. 1996. Diseases of tree fruits in the East.  North Central         Regional Extension Resource. Michigan State University Extension Cooperative          Compendium: NCR 45.  16.  Keitt, G. W., Blodgett, E. G., Wilson, E. E., and Magie, R. O. 1937. The epidemiology and         control of cherry leaf spot. Wis. Agric. Exp. Stn. Bull. 132. 118 pp.  17.  Koenraadt, H., Somerville, S. C., and Jones, A. L. 1992. Characterization of mutations in the         beta-tubulin gene of benomyl-resistant field strains of Venturia inaequalis and other plant         pathogenic fungi.  Phytopathology 82: 1348-1354.   18.  Koller, W., Wilcox, W. F., Barnard,  J. Jones, A. L., and Braun, P. G. 1997. Detection and        quantification of resistance of Venturia inaequalis populations to sterol demethylation        inhibitors. Phytopathology 87:184-190.  19.  Koller, W., Wilcox, W. F., and Jones, A. L. 1999. Quantification, persistence, and staus of         dodine resistance in New York and Michigan orchard populations of Monilinia fructicola.        Plant Dis. 83:66-70.   20.  Kunz, S., Deising, H., and Mendgen, K. 1997.  Acquisition of resistance to sterol         demethylation inhibitors by populations of Venturia inaequalis. Phytopathology 87:1272-        1278.   21.  Lesniak, K. E., Proffer, T. J., Beckerman, J. L. and Sundin, G. W. 2011. Occurrence of QoI         resistance and detection of the G143A mutation in Michigan populations of Venturia         inaequalis. Plant Dis. 95:927-934.   22.  Luo, C., Cox, K. D., Amiri, A., and Schnabel, G. 2008. Occurrence and detection of the         DMI resistance-Monilinia fructicola. Plant Dis.         92:1099-1103.  23.  Ma, Z.H., Yoshimura, M.A., and Michailides, T.J.  2003.  Identification and characterization         of benzimidazole resistance in Monilinia fructicola from stone fruit orchards in California.         Appl. Environ. Microbiol. 69:7145-7152.  24.  Ma, Z. and Michailides, T. J. 2005. Advances in understanding molecular mechanisms of        fungicide resistance and molecular detection of resistant genotypes in phytopathogenic fungi.        Crop Protection 24: 853-863.   25. Ma, Z.H., Proffer, T.J., Jacobs, J.L., and Sundin, G.W.  2006.  Overexpression of the 14-      demethylase target gene (CYP51) mediates fungicide resistance in Blumeriella jaapii.  Appl.  16       Environ. Microbiol. 72:2581-2585.  26. MacHardy, W. E. 1996. Apple Scab  Biology, Epidemiology, and Management. American        Phytopathological Society. St. Paul, MN.    27.  Marine, S. C., Yoder, K. S., and Baudoin, A. 2010. Powdery mildew of apple. The Plant         Healthy Instructor. DOI:10.1094/PHI-I-2010-1021-01.  28.   McGhee, G. C., and Sundin, G. W. 2011. Evaluation of kasugamycin for fire blight          management, effect on nontarget bacteria, and assessment of kasugamycin resistance          potential in Erwinia amylovora. Phytopathology 101:192-204.  29.  McManus, P. S., Stockwell, V. O., Sundin, G. W., and Jones, A. L. 2002. Antibiotic use in         plant agriculture. Annu. Rev. Phytopathology 40:443-465.  30.  McManus, P. S., Proffer, T. J., Beradi, R. Gruber, B. R., Nugent, J. E., Ehret, G. R., Ma, Z.,         and Sundin, G. W. 2007.  Integration of copper-based and reduced risk fungicides for control        of Blumeriella jaapii on sour cherry. Plant Dis. 91:294-300.   31.  Michigan Specialty Crops. Michigan Department of Agriculture and Rural Development.        http://www.michigan.gov/documents/mda/MDA_Crops_Brochure_low            resolution_324586_7.pdf  32.  National Agricultural Statistics Service. United State Department of Agriculture.          http://www.nass.usda.gov  33.  Norelli, J. L., Jones, A. L. and Aldwinkle, H. S. 2003. Fire blight management in the twenty-        first century: Using new technologies that enhance host resistance in apple. Plant Dis.         87:756-765.  34.  Proffer, T. J., Berardi, R., Ma, Z., Nugent, J. E., Ehret, G. R., McManus, P. S., Jones, A. L.         and Sundin, G. W. 2006. Occurrence, distribution, and PCR-based detection of resistance to         sterol demethylation-inhibiting fungicides in populations of Blumeriella jaapii in Michigan.         Phytopathology 96:709-717.  35.  Ritchie, D. F. 2000. Brown rot of stone fruits. The Plant Health Instructor. DOI:         10.1094/PHI-I-2000-1025-01. Updated 2005.    36.  Schnabel, G., Bryson, P.K., Bridges, W.C., and Brannen, P.  2004.  Reduced sensitivity in         Monilinia fructicola to propiconazole in Georgia and implications for disease management.          Plant Dis. 88:1000-1004.  37.  Sierotski, H., Frey, R., Wullschleger, J., Palmero, S., Karlin, S., Godwin, J., and Gisi, U.         2007. Cytochrome b gene sequence and structure of Pyrenophora teres and P. tritici-        repentis and implications for QoI resistance. Past Manage, Sci. 63:225-233.   17  38.  Sierotski, H., and Scalliet, G. 2013. A review of current knowledge of resistance aspects for         the next-generation succinate dehydrogenase inhibitor fungicides. Phytopthology 103: 880-         887  39.  Sundin, G. W., Jones, A. L., and Fulbright, D. W. 1989. Copper resistance in Pseudomonas          syringae pv. syringae from cherry orchards and its associated transfer in vitro and in planta           with a plasmid. Phytopathology 79:861-865.   40.  Sundin, G. W., Werner, N.A., Yoder, K. S., and Aldwinkle, H. S. 2009. Field evaluation of         biological control of fire blight in the eastern United States. Plant Dis. 93:386-394.  41.  Staub, T. 1991. Fungicide resistance: Practical experience with antiresistance strategies and         the role of integrated use. Annu. Rev. Phytopathol. 29:421-442.   42.  Sutton, D, K. MacHardy, W. E., and Lord, W. G. 2000. Effects of shredding or treating         apple leaf litter with urea on ascospore dose of Venturia inaequalis and disease buildup.         Plant Dis. 84: 1319-1326.   43.  Szkolnik, M. and Gilpatrick, J. D. 1969. Apparent tolerance to dodine in relation to orchard         control of apple scab. Phytopathology 64:649-652.   44.  Villani, S.M., and Cox, K.D.  2011.  Characterizing fenbuconazole and propiconazole         Monilinia fructicola from New York.          Plant Dis. 95:828-834.  45.  Zehr, E. I., Luszcz, L. A., Olien, W. C., Newall, W. C., and Toler, J. E. 1999. Reduced        sensitivity in Monilinia fructicola to propiconazole following prolonged exposure in peach        orchards. Plant Dis. 83:913-916.  46.  Zweirs, L. H., Stergiopoulos, I., Van Nistelrooy, J. G. M, De Waard, M. A. 2002. ABC         transporters and azole susceptibility on laboratory strains of the wheat pathogen        Mycosphaerella graminicola. Antimicrob. Agents Chemother. 46: 3900-3906.            18  CHAPTER 2  Occurrence of QoI resistance and detection of the G143A mutation in Michigan populations of Venturia inaequalis  This chapter has been published:  Lesniak, K. E., Proffer, T. J., Beckerman, J. L., and Sundin, G. W. 2011. Occurrence of QoI resistance and detection of the G143A mutation in Michigan populations of Venturia inaequalis. Plant Dis. 95:927-934.  ABSTRACT Control strategies for Venturia inaequalis rely heavily on chemical fungicides.  Single-site fungicides such as the quinone-outside inhibitors (QoI) have been used in Michigan apple orchards for more than 11 years.  In 2008, we sampled eight commercial orchards in the Fruit Ridge growing region of Michigan in which apple scab control failures were observed on McIntosh following applications of kresoxim-methyl or trifloxystrobin.  QoI resistance was assessed in 210 total isolates (a total of 17 orchards) using a spore germination assay and in 319 isolates using a PCR assay to detect the G143A mutation located within the V. inaequalis cytochrome b gene (CYTB).  The G143A mutation is known to confer high-level QoI resistance in plant-pathogenic fungi.  QoI resistance was confirmed in 50% and 64% of the isolates tested with the spore germination and PCR assays, respectively, and there was a 97% concordance observed between the assays.  In 2009, we sampled and examined an additional 1,201 V. inaequalis isolates from 64 orchards in Michigan and 86 isolates from four baseline sites in Ohio.  All of these isolates were assayed for the G143A mutation and it was detected within 67% and 0% of the Michigan and Ohio isolates, respectively.  Our results indicate the widespread occurrence of QoI resistance in Michigan commercial orchard populations of V. 19  inaequalis.  Loss of QoI fungicides further limits the arsenal of fungicides available to commercial apple growers for successful scab management. INTRODUCTION Apple scab, caused by the ascomycete Venturia inaequalis (Cooke) Winter, is the most prevalent and economically destructive fungal disease affecting commercial apple trees (Malus x domestica Borkh) in orchards worldwide (27).  Because of consumer preference, scab-susceptible cultivars such as McIntosh, Fuji, and Gala, are widely planted in Michigan despite the availability of resistant cultivars.  Chemical control is currently the only effective management strategy for apple scab on susceptible cultivars.  Up to 12 fungicide applications are required per season to ensure adequate control in commercial orchards in the eastern and midwestern United States.  Crop losses near 100% are common in control programs where fungicides were ineffective or improperly used (27).  The number and types of fungicides available for apple scab control are currently limited due to the development of reduced sensitivity and/or resistance to several classes of fungicides in populations of V. inaequalis.  demethylation inhibitor classes of fungicides developed sequentially in populations of V. inaequalis from commercial orchards in Michigan and New York (16, 20, 21, 24).      Quinone outside-inhibiting (QoI) fungicides including the strobilurins (FRAC Group 11) represent an important class of fungicides currently utilized for apple scab management (4).  QoI fungicides target the cytochrome b (CYTB) gene product located within the mitochondrial bc1 complex III and inhibit the transfer of electrons required for cellular respiration and subsequent ATP production (1, 12).  QoI fungicides exhibited demonstrated efficacy against a range of fungal and oomycete pathogens; however, economically important resistance to QoI fungicides 20  is now widespread in many pathogens including Blumeria graminis, Botrytis cinerea, and Pseudoperonospora cubensis (3, 12, 14, 33).  In previous studies, QoI resistance was shown to be conferred by point mutations within the CYTB gene, and the location of the mutation determined the level of reduced sensitivity.  In the majority of QoI-resistant plant pathogens examined, a single base pair mutation changing glycine (G) to alanine (A) at position 143 of the CYTB protein (G143A), has been detected.  The resistance factor (RF = effective dose with 50% inhibition of resistant strain / effective dose with 50% inhibition of sensitive, baseline strain) for various fungal species harboring the G143A mutation is greater than 100 in most cases and usually greater than several hundred (12).  The G143A mutation is the most common mutation discovered to date in QoI-resistant pathogens recovered from field surveys, including Blumeria graminis f. sp. tritici and f. sp. hordei, Didymella bryoniae, Plasmopara viticola, and Pseudoperonospora cubensis (4, 26, 33).  When the G143A mutation predominates in populations, there is a consistent association with loss of disease control.  A second mutation, F129L, results in the change of phenylalanine (F) to leucine (L) at amino acid position 129 within CYTB, and is commonly found in species of Alternaria (3, 4).  A third mutation, only recently detected in Pyrenophora tritici-repentis, is the G137R mutation, switching glycine (G) to arginine (R) at position 137 (34).  The F129L and G137R mutations are associated with moderate levels of resistance (RF of 5-15), and populations of these fungi are still controlled with QoI fungicides used at manufacturer recommended rates (3, 4, 34).  QoI fungicides were first registered for use on apples in Europe in 1996.  Even prior to their commercial introduction, QoI resistance in V. inaequalis was reported in isolates recovered from an experimental orchard in Switzerland in 1997 (23).  Reduced sensitivity to QoI 21  fungicides in populations of V. inaequalis typically occurs in two phases.  Initially, the pathogen population shifts toward reduced QoI sensitivity, while field application rates remain effective (22).  As the field population shifts towards a greater number of resistant isolates, field resistance develops and widespread fungicide failures occur.  During this initial phase, isolates with high levels of resistance due to point mutations, such as the G143A mutation within CYTB, may appear within the population.  Fungicide spray programs can strongly affect the time interval between the first appearance of highly-resistant isolates and their predominance in the population, and hence the length of time when normal fungicide rates are still effective.  If the field population continues to shift toward greater numbers of highly-resistant isolates due to fungicide selection, the second phase - field resistance, develops and widespread fungicide failures occur.  To date, QoI resistance has been reported in isolates of V. inaequalis from commercial orchards in Canada (< 2% of isolates), Chile, Belarus, and Poland (5, 15, 17, 32) and the G143A mutation has been detected in isolates of V. inaequalis from Germany and France (10, 22, 32). In Michigan, the QoI fungicides kresoxim-methyl (Sovran®) and trifloxystrobin (Flint®) were registered in 1999 and 2000, respectively, for apple scab management.  The label recommendations for these fungicides indicate that protective applications and/or incorporation into tank mixes with other protective, broad-spectrum fungicides are most effective for apple scab control and fungicide resistance management.  Some apple growers in Michigan however, have also routinely applied QoI fungicides in a curative manner; an approach that would increase selection for highly-resistant isolates.  In 2008, several established and proficient commercial apple growers located within the largest apple-growing area in Michigan (Fruit Ridge  Ottawa, Kent, Ionia, and Muskegon 22  Counties located north of Grand Rapids) experienced apple scab control failures on McIntosh following applications of kresoxim-methyl or trifloxystrobin.  These multiple instances of control failures in the field suggested the possibility that high-level QoI resistance had already developed within populations of V. inaequalis in Michigan.  We hypothesized that if QoI resistance was present in the Fruit Ridge area, then resistance was also likely to occur in V. inaequalis populations elsewhere in the state.  Our objectives in this work were to: firstly, determine if QoI resistance had developed in populations of V. inaequalis in Michigan apple orchards; secondly, extensively sample the population of V. inaequalis in Michigan apple orchards throughout all of the major growing regions; and thirdly, utilize a PCR assay to detect the G143A mutation in CYTB to rapidly assess the proportion of V. inaequalis isolates recovered with this mutation. MATERIALS AND METHODS Collection of isolates of Venturia inaequalis   In the initial stage of the project in 2008, eight commercial apple orchards from the Fruit Ridge region (Ottawa, Kent, Ionia and Muskegon Counties) and eight orchards from eastern Michigan (Monroe, Oakland, Macomb, and Huron Counties) were sampled (Figure 2.1).  The orchards from the Fruit Ridge region were originally examined due to the lack of apple scab management after applications of QoI fungicides.  The orchards sampled in eastern Michigan had not experienced control failures.  Samples from a Michigan State University (MSU) experimental orchard (Ingham County), where QoI fungicides had effectively controlled apple scab, were also collected for comparison.  During the second stage of the project in 2009, a total of 55 commercial apple orchards in Michigan from 18 counties (12 of these orchards were sampled in 2008) were sampled, as well as three MSU 23  experimental orchards.  In 2009, baseline isolates from unsprayed trees were also collected from four non-orchard sites in Ohio and one in Michigan.  Samples consisted of approximately 50 scab-infected leaves (one leaf per randomly selected tree) per orchard.  Samples were transported to the laboratory in paper bags for pathogen isolation and processing.  Collected leaves that were not immediately processed were stored at 4°C for a maximum of three days prior to isolation.                 24    25  Figure 2.1  County, no. 36-47; Northwest Michigan Manistee, Benzie, Grand Traverse, Leelanau Counties, no. 48-52; Central Michigan, Ingham County, no. 53-55; East Michigan  Lenawee, Monroe, Oakland, Macomb, and Huron Counties, no. 56-64. Monoconidial isolation of Venturia inaequalis   A single lesion on each leaf was scraped with a sterile scalpel and conidia and mycelia were spread onto coffee water agar (CWA) which consisted of 200 ml brewed black coffee (20 g ground coffee in 1 liter distilled H2O (dH2O) boiled for 10 min), 800 ml dH2O, and 20 g Bacto® agar (Difco Laboratories; Detroit, MI).  This medium promotes the rapid differentiation between common contaminating fungi and germinating conidia of V. inaequalis (T. J. Proffer, unpublished observations).  After 18-36 h, the streak plates were examined and when possible 1-3 single germinating conidia from each sample were transferred to PDAY (PDA (Difco), amended with 0.5 g yeast extract per liter).  From the resulting collection of isolates, 25 monoconidial isolates (representing isolates from different trees) per orchard or site were selected for further testing and maintained on PDAY.  Reduced spore germination for some samples, likely due to the effects of other fungicides applied to the orchard trees, resulted in the recovery of fewer than 25 isolates from some orchards. In vitro fungicide sensitivity, 2008 survey   The in vitro sensitivity of fungi to strobilurin fungicides is often measured by using a bioassay to examine the inhibition of spore germination (22).  To produce conidia for testing, a small plug was taken from the margins of actively growing cultures for each of the tested isolates and spread onto one-half thickness, sterile borosilicate glass fiber filters (Fisher; Chicago, IL) positioned on PDAY medium.  The cultures were grown for 7 to 10 days under long-wave UV light (Phillips F40T12/BLB) on a 12 h cycle.  Conidia were harvested by taking a portion of the borosilicate filter and colony and suspending it 26  in a 5 ml Falcon tube (BD Biosciences; Sparks, MD) containing 1 ml sterile dH2O.  The suspension was mixed by vortexing   Previous studies showed that only isolates of V. inaequalis with a high level of QoI resistance, would germinate on medium co-methyl (22, 30, 31).  To test for this high level of resistance in populations of V. inaequalis in Michigan, conidial -methyl (Sovran, (vol/vol) acetone:methanol and added to each medium in order to deter alternative oxidation of sensitive isolates in vitro (15, 22, 29-31).  A total of 210 randomly selected isolates from the 2008 survey pool were tested.  Isolates from each of the sampled orchards were represented in this pool.  After 24-48 h, the control and fungicide amended plates were examined using a compound microscope and at least 100 conidia per sample were evaluated for evidence of germination as indicated by the presence of a germ tube.  Isolates were considered to be highly resistant to QoI fungicides when the percentage of germinated spores on the control medium was similar to the percentage of germinated -methyl amended plates.  If conidia germinated on the control medium and failed to germinate on the fungicide-amended medium they were considered negative for high-level QoI resistance (22). DNA extraction, molecular detection of the G143A mutation, and partial sequencing of CYTB, 2008 and 2009 survey   Approximately 0.1 g of mycelium from each isolate was ground using liquid nitrogen and a bead beater homogenizer (FastPrep®-24, MP Biomedicals; Solon, OH).  DNA extractioDNeasy® Plant Mini Kit (Qiagen; Valencia, CA).  DNA samples were stored in TE buffer (pH 7.5) at -20°C until further use.  Control and allele-specific primer sets, as designed by Fontaine et 27  al. (2009), were used to amplify a 238 bp sequence downstream of the amino acid 143 codon and a 433 bp sequence encompassing the amino acid 143 codon (primers PS-exon7, PR-exon7 and PS1, G143AMM1, respectively).  The primer pair PS-exon7 and PR-exon7 is specific to V. inaequalis CYTB alleles and was used as a control measure to amplify a ubiquitous region 5 kb downstream from the G143A sequence and to eliminate the probable cause of PCR inhibition or false negatives (10).  Primers PS1 and G143AMM1 were used to amplify the G143A sequence from isolates of V. inaequalis, simultaneously with the above mentioned control primer set (Figure 2.2).  Reaction amounts and cycling parameters were performed as described by Fontaine et al (2009).  The 433-bp or 238-bp amplicon from a random selection of 90 isolates from both 2008 and 2009 was sequenced to confirm the presence or absence of the G143A mutation (Research Technology Support Facility, Michigan State University).  A random selection of 66 isolates that tested positive with the PCR-based assay was sequenced to confirm the mutation conferring the amino acid change from glycine to alanine.  The sequences of these 66 isolates were also checked for the possible presence of the F129L and G138R mutations.  A subset of 24 G143A-negative isolates was also subjected to sequence analysis in order to validate the lack of mutations within CYTB.        28                  RESULTS Isolate collection of Venturia inaequalis: 2008 and 2009 surveys   In the 2008 survey, a total of 635 monoconidial isolates of V. inaequalis were recovered from commercial orchards in Michigan and 63 from the experimental orchard at the East Lansing campus of MSU.  In the 2009 survey, an additional 1,340 isolates were established from Michigan commercial orchards, 67 from MSU experimental orchards, and 132 isolates were recovered from unsprayed landscape and sport apple trees in Michigan and Ohio. 1       2      3      4      5       6      7      8      9 433 bp 238 bp Figure 2.2  Gel electrophoresis showing amplification of the G143A mutation (433 bp) within V. inaequalis CYTB conferring QoI resistance and a 238 bp fragment of a region downstream of the mutation used as an amplification control.  Lane 1: DNA ladder; lanes 2-4 consist of a water control, negative control and a positive control for the G143A mutation.  Lanes 5, 6, 8, and 9 are isolates harboring the G143A mutation; isolates TJLV 2, BWV 2, GJMV 18, and BTHV 14, respectively.  Lane 7: isolate AWV 7B is negative for the G143A mutation. 29  In vitro fungicide sensitivity, 2008 survey   In vitro sensitivity testing confirmed the occurrence of high levels of resistance to the QoI fungicide, kresoxim-methyl, in 105 of 210 isolates of V. inaequalis from Michigan orchards.  Germination rates for the 210 isolates tested ranged from 52.0-92.0% on the control mediu-methyl, isolates showed one of two responses; they either germinated at rates similar to the control media (highly-resistant isolates) or they were completely inhibited (not highly-resistant).  The distribution and number of highly-resistant isolates varied by orchard and region (Table 2.1).  Highly-resistant isolates were detected in all of the sampled orchards from the Fruit Ridge region and were also found in orchards from eastern Michigan confirming a wider distribution of resistant populations. Table 2.1   Detection and distribution of QoI fungicide resistance in Michigan populations  of Venturia inaequalis sampled in 2008 using an in vitro conidial germination assay.    ______________________________________________________________________ Location  County           Orchard      No. isolates       Percent of      no. a           tested   resistant isolates b ______________________________________________________________________ Fruit Ridge Ottawa  19  11      100   Kent  26  10  60.0     27    8  87.5     29    7  100     32    9  100   Ionia  33  15  80.0   Muskegon 34  20  95.0     35    6  100 Central MI Ingham 53 c  13   0.0 Eastern MI Monroe 57  15  26.7     58  12  33.3   Oakland 54  18  0.0     60  17  0.0     61  14  35.7   Macomb 62    6  0.0     63  14  0.0   Huron  64  15  100 _______________________________________________________________________  a  The orchard number corresponds to orchard locations mapped in Figure 2.1. 30  Table 2 b Conidia of resistant isolates germinated on strobilurin amended water agar amended with - c Experimental research orchard. Molecular detection of the G143A mutation, 2008 survey   DNA was extracted from a total of 319 isolates collected during the 2008 survey and analyzed using PCR to detect the G143A mutation using allele-specific primers.  The G143A mutation was detected in isolates of V. inaequalis within the majority of orchards sampled during 2008 (Table 2.2).  A higher frequency of G143A positive isolates was detected in the Fruit Ridge area than in eastern Michigan (Table 2.2).  All of the isolates from five of the eight Fruit Ridge orchards assayed during 2008 tested positive for the G143A mutation, while in the remaining three orchards, G143A positive isolates ranged between 60-80% in the orchard population (Table 2.2).  In comparison, only one eastern Michigan orchard had 100% G143A positive isolates, while four orchards did not contain any isolates harboring the G143A mutation.  The three remaining orchards in eastern Michigan exhibited G143A positive frequencies ranging from 27-64% (Table 2.2).  None of the isolates sampled from the MSU experimental orchard, where there was no history of control failures associated with QoI fungicides, contained the G143A mutation (Table 2.2).       31  Table 2.2  Molecular detection of the G143A mutation in isolates of V. inaequalis collected during 2008 in commercial and experimental apple orchards in Michigan. __________________________________________________________________________ Location County Orchard         no. a Isolates assayed Isolates  with  G143A Percent of resistant isolates Fruit Ridge       Ottawa 19 25 25 100  Kent 26 24 17 71   27 25 20 80   29 32 24 25 24 25 100 100  Ionia 33 20 12 60  Muskegon 34 24 24 100   35 24 24 100 Central MI       Ingham   53 b 17 0 0 Eastern MI       Monroe 57 15 4 42   58 12 5 27  Oakland 54 16 0 0   60 17 0 0   61 14 9 64  Macomb 62 7 0 0   63 15 0 0  Huron 64 15 15 100 __________________________________________________________________________  a  The orchard number corresponds to orchard locations mapped in Figure 2.1.  b Experimental research orchard. Combined bioassay and PCR-based G143A assay during 2008 survey   In the 2008 survey, a total of 199 isolates of V. inaequalis were tested for QoI resistance by both the in vitro spore germination method and the PCR-amplification of the G143A mutation method.  Each assay to detect QoI resistance was performed independently by separate researchers. The results for each isolate were not compared until all of the isolates from an individual orchard were tested.  There 32  was a 97% concordance (193 of 199) between the results of the two methods (Table 2.3).  Of the six cases where the results of the two assays did not agree, three isolates were rated positive for QoI resistance by the spore germination method and negative for PCR-amplification of the G143A mutation.  In three other isolates, spore germination was inhibited by 0.1 g/ml kresoxim-methyl while the G143A mutation was detected by PCR. Table 2.3 Comparison of results from an in vitro fungicide sensitivity assay and from  molecular detection of the G143A mutation in isolates of V. inaequalis collected during  2008 in Michigan. ______________________________________________________________________________ Location County Orchard       no. a No. isolates tested Total agreement between    assays  b Percent agreement  Fruit Ridge       Ottawa 19 11 11 100  Kent 26 10 10 100   27 8 8 100   29 32 7 9 7 9 100 100  Ionia 33 15 11 73  Muskegon 34 20 19 95   35 6 6 100 Central MI       Ingham   53 c 7 7 100 Eastern MI       Monroe 57 14 14 92   58 12 12 100  Oakland 54 15 15 100   60 17 17 100   61 13 12 92  Macomb 62 6 6 100   63 14 14 100  Huron 64 15 15 100 ______________________________________________________________________________  a  The orchard number corresponds to orchard locations mapped in Figure 2.1.  33  Table 2.3  b Conidia of resistant isolates germinated on strobilurin amended water agar amended with -detected by PCR to have the G143A mutation. c Experimental research orchard. Molecular detection of the G143A mutation, 2009 survey   In the expanded 2009 survey, an additional 1,201 isolates of V. inaequalis from commercial (1,040), baseline (104), and experimental (57) orchards/sites within Michigan and Ohio were screened for resistance to QoI fungicides using the G143A PCR-based method.  Results from commercial orchards indicated that high levels of QoI resistance remained consistent within the Fruit Ridge region of Michigan (Table 2.4).  Examination of isolates from Oceana County (western Michigan), located northwest of the Fruit Ridge, showed that the frequency of isolates containing the G143A mutation was 100% in nine of the 12 orchards sampled (Table 2.4).  In the surveyed orchards in southwest and northwest Michigan, only 4 of 12 and 2 of 5 of the orchards yielded QoI resistant isolates at frequencies greater than 60%, respectively.  The frequency of resistant isolates was slightly lower in eastern Michigan: from a total of nine orchards within eastern Michigan, only three harbored QoI-resistant isolates at rates of 60% or greater (Table 2.4).  Of the 104 isolates of V. inaequalis tested from non-orchard sites within Ohio and Michigan, only a single isolate from a dooryard tree in East Lansing, MI, tested positive for G143A (Table 2.4, orchard no. 55).  Within the three experimental research orchards (67 isolates), only the southwest Michigan research station contained G143A positive isolates, which made up 14% of the tested population (Table 2.4, orchard no. 4). 34   Overall, 66.7% (694 of 1,040) of isolates examined from 55 commercial orchards during the 2009 survey were positive for the G143A mutation (Table 2.4).  Orchards within the Fruit Ridge region and Oceana County were the most sampled areas (33 of 55 total Michigan commercial orchards) and contained the highest frequencies of the G143A mutation.  Of these 33 commercial orchards, 22 contained G143A frequencies of 75% or greater; 16 of the 22 orchards were completely G143A positive (100%).  Within the 33 commercial orchards sampled in the Fruit Ridge and Oceana County only two orchards, one within each location, harbored no G143A positive isolates (Table 2.4).  Outside of the Fruit Ridge and Oceana County growing region, the number of orchards with high populations of QoI resistant isolates was lower, as was the uniformity of their distribution.  More orchards outside of this major apple producing area contained populations lacking G143A positive isolates (Table 2.4).  Results from southwest Michigan showed that five of the surveyed orchards did not harbor qualitative resistant isolates, while in another five orchards the frequency of the G143A mutation ranged from 16-87% (Table 2.4).  In eastern Michigan, a total of nine orchards were sampled with a single orchard in the Thumb region in which all of the isolates harbored the G143A mutation.  In the remaining orchards, four yielded no G143A positive isolates while the remaining four orchards had 43-65% of isolates carrying the G143A mutation (Table 2.4).  In northwest Michigan, 4 of 5 orchards contained G143A positive isolates with a frequency ranging from 13-100% and one orchard yielded no G143A positive isolates (Table 2.4).  A very low number of isolates (4-10 isolates/orchard) were obtained in northwest Michigan for testing and therefore, these results are less conclusive.   35  Table 2.4  Frequency of the G143A mutation of isolates collected in Michigan  (2008-2009) and Ohio (2009). ___________________________________________________________________________ Location County                     Orchard     no. a No.of isolates       assayed b No. of isolates with G143A Percent resistant per orchard Percent resistant      in 2008 c Southwest MI        Berrien 1 24 20 84    2 6 0 0    3 20 14 70     4d 5 14 25 2 4 14 16   Cass 6 7 8  9d 25 5 5 24 0 0 0 0 0 0 0 0   Van Buren 10 25 12 48   Allegan 11 25 21 84    12 23 20 87  Fruit Ridge        Ottawa 13 13 2 15    14 24 12 50    15 19 4 21    16 17 10 59    17 19 13 69    18 6 6 100    19 25 15 60 100  Kent 20 21 22 23 24 25 7 24 20 25 25 9 0 20 15 25 25 9 0 75 75 100 100 100    26 25 21 84 71   27 15 15 100 80   28 25 10 40    29 30 31 32 25 25 25 25 10 21 13 25 40 84 52 100 100  Ionia 33 22 17 77 57  Muskegon 34 35 12 24 12 24 100 100 100 36  Western MI        Oceana 36 25 25 100    37 25 25 100    38 25 25 100    39 40 41 42 43 44 45 46 47 23 24 24 25 25 24 24 19 15 23 6 24 25 19 24 24 12 15 100 25 100 100 76 100 100 63 100  Northwest MI        Manistee 48 8 2 25   Benzie 49 9 9 100   Grand Traverse  50 4 0 0   Leelanau 51 10 6 60    52 8 1 13  Central MI        Ingham  53d  54d  55e 17 19 18 0 0 1 0 0 6    Eastern MI        Lenawee 56 23 15 65   Monroe 57 58 7 21 3 11 43 52 27 42  Oakland 59 25 0 0 0   60 61 16 14 0 9 0 64 0  Macomb 62 63 16 15 0 0 0 0 0  Huron 64 25 25 100 100 OHIO       Cuyahoga Portage  65e  66e 24 18 0 0 0 0  Columbiana  67e  68e 25 19 0 0 0 0  _______________________________________________________________________________________________________________________ a  The orchard number corresponds to orchard locations mapped in Figure 2.1. 37  Table 2 b  A total of 319 isolates in Michigan were assayed in 2008 while 1,115 isolates from Michigan and 86 isolates from Ohio were assayed in 2009.    c  Results are shown for orchards from which isolates were examined in 2008.  QoI fungicides were not used in these orchards during 2009.  d  Michigan experimental research orchards tested during 2008 survey ( no. 53, 17 isolates) and 2009 survey (57 isolates). e  Non-orchard sites which have never received a strobilurin application and served as baseline sites during 2009 (104 isolates).  The distribution of the G143A mutation in V. inaequalis isolates from commercial orchards was not uniform throughout the state.  The largest group of orchards (44%) contained populations of V. inaequalis harboring at least 76-100% of isolates positive for the G143A mutation (Figure 2.3).  The remaining orchards examined showed 51-75% G143A frequency in 22% of orchards, 26-50% G143A frequency in 9% of orchards and lastly, 11% of orchards contained populations of G143A isolates between 1-25% while 14% of orchards contained no G143A positive isolates (Figure 2.3).         38              Validation of the allele-specific PCR assay   The results of the sequencing of CYTB confirmed the G143A sequence or lack thereof as well as, validated the PCR method for QoI resistance mutation was not observed in the randomly selected, QoI-sensitive isolates. DISCUSSION The results of this study indicate the widespread occurrence of QoI resistance in populations of V. inaequalis in commercial apple orchards in Michigan.  This is the first report within the United States of QoI resistance conferred by the G143A mutation in field isolates of V. inaequalis.  In Michigan, these resistant populations of V. inaequalis were detected nine years after QoI fungicides were registered for use on apples. 0510152025303540455001-2526-5051-7576-100Percentage of commercial apple orchards in Michigan Frequency of the G143A mutation within individual orchards  Figure 2.3  Frequency distribution of the G143A mutation within populations of Venturia inaequalis in Michigan commercial apple orchards during 2009. Data consist of 55 orchards throughout Michigan, totaling 1,041 isolates. 39   The areas where resistant populations were most prevalent were in the Fruit Ridge region and Oceana County during both of the 2008 and 2009 surveys.  Intensive use of QoI fungicides and multiple applications as a curative strategy over several years likely led to the development and expansion of these QoI-resistant populations, which now play a major role in the loss of scab control in these regions of Michigan.  The Fruit Ridge region is the major apple producing area within Michigan and contains 10,000 of the 40,000 acres used for commercial apple production.  Growers in these regions have utilized QoI fungicides more intensively in spray programs as compared to other regions of the state.  Our results, however, indicate that QoI resistance has also developed in southwest, northwest, and eastern Michigan, outside of this major commercial production area.  The G143A mutation is associated with what is referred to as complete or qualitative resistance and usually confers a resistance factor of greater than 100.  This mutation is located within CYTB, a mitochondrial gene.  It should be noted that the QoI resistance phenotype is likely only conferred after the QoI-resistant mitochondria become amplified within a cell (9).  Heteroplasmy is a state in which an individual cell contains more than one type of mitochondria; in this case, resistant isolates possess mitochondria that encode the wild-type and the mutated alleles of the CYTB gene.  However, the percentage of QoI-resistant mitochondria within a cell that is required to confer complete resistance is currently unknown. An independent assessment of QoI sensitivity for some of the Michigan isolates of V. inaequalis from the 2008 survey were tested concurrently by another group using a mycelial growth assay (6).  In the rating scale, developed by these authors, eight of the ten G143A positive isolates tested by both groups, were rated as shifted rather than resistant.  The presence of the G143A mutation in plant pathogens has been repeatedly associated with high levels of 40  resistance (4, 9, 10, 12, 22, 31, 36) and loss of efficacy in the field (11, 19).  The different ratings among researchers therefore, are due to differences in methodology, and the use of conidia versus mycelia for fungicide resistance assays.  In addition, the detection of the G143A mutation in the strains documented as shifted may also be due to the more powerful detection capabilities of PCR and could be reflective of mitochondrial heteroplasmy.  The percentage of QoI-resistant V. inaequalis strains remained relatively constant in the Fruit Ridge and eastern Michigan orchards sampled in 2008 and 2009 even though growers from these orchards did not utilize QoI fungicides in 2009.  These results imply that the QoI-resistance status of V. inaequalis did not impose a negative effect on ecological fitness in these strains over this one-year period.  The results of one previous study did indicate a negative impact on fitness in Botrytis cinerea isolates with resistance to pyraclostrobin, although the isolates used were UV-induced laboratory mutants (28).  However, the results of other studies have shown little (25, 28) or no fitness effects (2, 8, 18) of QoI resistance, including a recent study of V. inaequalis strains from Indiana and Michigan with multiple fungicide resistance including QoI resistance (6).  The long-term stability of QoI resistance in orchard populations of V. inaequalis, in the absence of selection pressure from QoI fungicide use, needs to be evaluated over a greater time scale.  However, it is likely that the utility of strobilurin fungicides for apple scab control in Michigan will be limited to individual orchards in which resistance has not been documented and only in use strategies where the strobilurin fungicide is mixed with a broad-spectrum protectant fungicide.   The manufacturer label recommends the usage of QoI fungicides in a protectant spray mination are applicable for this recommended use.  Bioassays however, do not identify the cause of the reduced 41  sensitivity of isolates to QoI fungicides and do not distinguish between the various mechanisms for reduced sensitivity such as a change in pathogen target, overexpression of this target, or reduced fungicide uptake.  Alternatively, the PCR-based assay, using allele-specific G143A primers, is limited to a specific genetic change common to several pathogens that exhibit QoI resistance.  The high concordance (97%) of results between the bioassay and PCR-based assay in this study, confirms the validity of either method to detect high-level QoI resistance in isolates of V. inaequalis within Michigan orchards.  Based on this concurrence of the assays, only the PCR-based method was performed in 2009 due to the relative rapidity of this assay and because it enabled us to screen a larger number of orchards and to quickly provide Michigan apple growers the information they needed to make proper management decisions.  We have also utilized this PCR assay to detect QoI resistance in V. inaequalis from apple orchards in Ontario, Canada (K.E. Lesniak and G.W. Sundin, unpublished information).  The widespread, simultaneous occurrence of QoI resistance and the G143A mutation in V. inaequalis from multiple commercial apple orchards in different growing regions raises questions concerning the origin of the resistant strains.  Two possible scenarios to explain our findings are that resistance arose once with this resistant genotype amplified due to fungicide selection and subsequently disseminated between orchards. The alternative scenario is that resistance arose independently in multiple genotypic backgrounds at multiple locations.  As the teleomorph of V. inaequalis plays an important role in the disease cycle, the role of sexual recombination in the dissemination of resistance and the association of the G143A CYTB allele with genotypes exhibiting increased ecological fitness warrant further study.  QoI resistance in the wheat pathogen, Mycosphaerella graminicola, emerged simultaneously in several locations within Europe in 2002, and the appearance of the G143A 42  allele in CYTB rapidly increased in frequency over a two-year period (7).  A retrospective population genetic analysis of the European fungal population revealed that at least four independent mutational events in different genetic backgrounds led to the introduction of the G143A mutation into at least 24 distinct mtDNA haplotypes (35).  Subsequent increases in frequency of QoI-resistant haplotypes are thought to be mostly controlled by fungicide selection and wind-aided ascospore dispersal (35).  A similar observation of the evolution of the G143A resistance allele in different genetic backgrounds was made in the downy mildew of grape pathogen Plasmopora viticola (7).  Thus, the recurrent appearance of this single G143A mutation in CYTB may occur readily in fungal pathogens that are exposed to strobilurin fungicides.  The appearance of widespread QoI resistance in V. inaequalis in Michigan occurred in commercial apple orchards that are not contiguous.  In addition, since two kinds of propagules of V. inaequalis are effectively disseminated only relatively short distances (~ 100 m for ascospores and only a few m for conidia) (13, 27), it seems plausible that multiple recurrent G143A mutations contributed to the QoI resistance structure in the populations observed in our study.  Population genetic studies and laboratory and field assessments of fitness will be required in order to assess the rapid widespread development of QoI resistance in Michigan populations of V. inaequalis. Resistance to QoI fungicides further limits the arsenal of fungicides available to growers for apple scab management in Michigan.  Currently, broad-spectrum protectant fungicides such as ethylenebisdithiocarbamates (EBDC; mancozeb, penncozeb, etc) and phthalimides (captan) are the only fungicide classes available with minimal risk of fungicide resistance development.  These fungicides however, must be applied prior to the occurrence of apple scab infection periods as they are less effective in apple scab control than QoI fungicides, and the EBDC class 43  of fungicides has a 66-day pre-harvest interval, limiting its use to applications only early in the shorter than that used with QoI fungicides.  The anilinopyrimidine (AP) fungicides therefore, are the only fungicide class currently available in Michigan for which some curative activity exists and resistant isolates in commercial orchard populations are known.  Thus, the continued loss of curative fungicides poses a significant challenge for Michigan apple growers and limits the number of options growers have to successfully manage V. inaequalis.  ACKNOWLEDGMENTS   This work was supported by Project GREEEN (Generating Research and Extension to meet Economic and Environmental Needs), a Michigan plant agriculture initiative at Michigan State University, USDA-NIFA-NCIPM grant #104637, startup funds from Purdue University, and the Michigan Agricultural Experiment Station.  We thank Mira Danilovic, Amy Irish-Brown, Erin Lizotte, Nikki Rothwell, Phil Schwallier, Bill Shane, and Bob Tritten for assistance in locating orchards.   44                         REFERENCES                    45  REFERENCES    1. Anke., T., Oberwinkler, F., Steglich, W., and Schramm, G. 1977. The strobilurins- New antifungal antibiotics from the basidiomycete Strobiluris tenacellus. J. Antibiot. 30:806-810.  2. Avila-Adame, C., and Köller, W. 2003. Characterization of spontaneous mutants of Magnaporthe grisea expressing stable resistance to the Qo-inhibiting fungicide azoxystrobin. Curr. Genet. 42: 332-338.  3. Banno, S., Yamashita, K., Fukumori, F., Okada, K., Uekusa, H., Takagaki, M., Kimura, M., and Fujimura, M. 2009. Characterization of QoI resistance in Botrytis cinerea and identification of two types of mitochondrial cytochrome b gene. Plant Pathol. 58:120-129.  4. Bartlett, D., W., Clough, J. M., Godwin, J. R., Hall, A. A., Hamer, M., and Parr-Dobrzanski, B. 2002. The strobilurin fungicides. Pest Manag. Sci. 58:649-662.  5. Broniarek-Niemiec, A., and Bielenin, A. 2008. Resistance of Venturia inaequalis to strobilurin and dodine fungicides in Poli-Agriculture 95:366-372.  6. Chapman, K.S., Sundin, G.W., and Beckerman, J.L.  2011.  Identification of resistance to multiple fungicides in field populations of Venturia inaequalis.  Plant Dis. (submitted for publication).  7. Chen, W.-J., Delmotte, F., Richard-Cervera, S., Dourence, L., Greif, C., and Corio-Costet, M.-F.  2007.  At least two origins of fungicide resistance in grapevine downy mildew populations.  Appl. Environ. Microbiol. 73:5162-5172.  8. Corio-Costet, M. F., Dufour, M. C., Cigna, J., Abadie, P., and Chen, W. 2011. Diversity and fitness of Plasmopora viticola isolates resistant to QoI fungicides. Eur. J. Plant Pathol. 129:315-329.  9. Fernandez-Ortuno, D., Tores, J.A., de Vicente, A., and Perez-Garcia, A.  2008.  Mechanisms of resistance to QoI fungicides in phytopathogenic fungi.  Int. Microbiol. 11:1-9.  10. Fontaine, S., Remuson, F., Fraissinet-Tachet, L., Micoud, A., Marmeisse, R., and Melayah, D. 2009. Monitoring of Venturia inaequalis harbouring the QoI resistance G143A mutation in French orchards as revealed by PCR assays. Pest Manag Sci. 65:74-81.   46   11. Fraaije, B. A., Burnett, F. J., Clark, W. S., and Lucas, J. A. 2006. Development and field testing of fungicide anti-resistance strategies, with particular reference to strobilurin QoI group of fungicides. London, UK: Home-Grown Cereal Authority: HGCA Project Report 392. 112 pages.  12. Gisi, U., Sierotzki, H., Cook, A., and McCaffery, A. 2002. Mechanisms influencing the evolution of resistance to Qo inhibitor fungicides. Pest Manag. Sci. 58:859-867.   13. Holb, I. J., Heijne, B., Withagen, J. C. M,. and Jeger, M. J. 2004. Dispersal of Venturia inaequalis ascospores and disease gradients from a defined inoculum source. J. Phytopathol. 152:639-646.  14. Ishii, H., Fraaije, B. A., Sugiyama, T., Noguchi, K., Nishimura, K., Takeda, T., Amano, T., and Hollomon, D. W. 2001. Occurrence and molecular characterization of strobilurin resistance in cucumber powdery mildew and downy mildew. Phytopathology 91:1166-1171.  15. Jobin, J., and Carisse, O. 2007. Incidence of myclobutanil- and kresoxim-methyl-insensitive isolates of Venturia inaequalis in Quebec orchards. Plant Dis. 91:1351-1358.  16. Jones, A. L. 1981. Fungicide resistance: Past experience with benomyl and dodine and future concerns with sterol inhibitors. Plant Dis. 65:990-992.  17. Kamardzina, V. 2009. Sensitivity of Venturia inaequalis to krezoxym methyl. -100.  18. Karaoglanidis, G. S., Luo, Y., and Michailides, T. J. 2011. Competitive ability and fitness of Alternaria alternata isolates resistant to QoI fungicides. Plant Dis. 95:178-182.  19. Pyraclostrobin reduces germ tube growth of QoI-resistant Mycosphaerella graminicola pycnidiospores and the severity of septoria leaf blotch on winter wheat. Plant Pathol. 59:1091-1098.  20. Köller, W., Wilcox, W. F., Barnard, J., Jones, A. L., and Braun, P. G. 1997. Detection and quantification of resistance of Venturia inaequalis populations to sterol demethylation inhibitors. Phytopathology 87:184-190.  21. Köller, W., Wilcox, W. F., and Jones, A. L. 1999. Quantification, persistence, and status of dodine resistance in New York and Michigan orchard populations of Venturia inaequalis. Plant Dis. 83:66-70.  22. Köller, W., Parker, D.M., Turechek, W.W., Avila-Adame, C., and Cronshaw, K. 2004. A two-phase resistance response of Venturia inaequalis populations to the QoI fungicides kresoxim-methyl and trifloxystrobin. Plant Dis. 88:537-544.   47   23. Kung Farber, R. B., Chin, M. K. and Leadbitter, N. 2002. Sensitivity of Venturia inaequalis to trifloxystrobin. Pest Manag. Sci. 58:261-267.  24. Kunz, S., Deising, H., and Mendgen, K. 1997. Acquisition of resistance to sterol demethylation inhibitors by populations of Venturia inaequalis. Phytopathology 87:1272-1278.   25. Ma, B., and Uddin, W. 2009. Fitness and competitive ability of an azoxystrobin-resistant G143A mutant of Magnaporthe oryzae from perennial ryegrass. Plant Dis. 93:1044-1049.  26. Ma, Z. and Michailides, T. J. 2005. Advances in understanding molecular mechanisms of fungicide resistance and molecular detection of resistant genotypes in phytopathogenic fungi. Crop Protect. 24:853-863.  27. MacHardy, W. E. 1996. Apple Scab  Biology, Epidemiology, and Management. American Phytopathological Society Press, St. Paul, MN.  28. Markoglou, A. N., Malandrakis, A. A., Vitoratos, A. G., and Ziogas, B. N. 2006. Characterization of laboratory mutants of Botrytis cinerea resistant to QoI fungicides. Eur. J. Plant Pathol. 115:149162.  29. Olaya, G., Zheng, D. and Köller, W. 1998. Differential responses of germinating Venturia inaequalis conidia to kresoxim-methyl. Pestic. Sci. 54:230-236.  30. Olaya, G., and Köller, W. 1999. Diversity of kresoxim-methyl sensitivities in baseline populations of Venturia inaequalis. Pestic. Sci. 55:1083-1088.  31. Olaya, G., and Köller, W. 1999. Baselines sensitivities of Venturia inaequalis populations to the strobilurin fungicide kresoxim-methyl. Plant Dis. 83:274-278.  32. Sallato, B. V. Latorre, B. A. and Aylwin G. 2006. First report of practical resistance to QoI fungicides in Venturia inaequalis (Apple scab) in Chile. Plant Dis. 90:375.  33. Sierotzki, H., Wullschleger, J., and Gisi, U. 2000. Point-mutation in cytochrome b gene conferring resistance to strobilurin fungicides in Erysiphe graminis f. sp. tritici field isolates. Pestic. Biochem. Physiol. 68:107-112.   34. Sierotzki, H., Frey, R., Wullschleger, J., Palmero, S., Karlin, S., Godwin, J., and Gisi, U. 2007. Cytochrome b gene sequence and structure of Pyrenophora teres and P. tritici-repentis and implications for QoI resistance. Pest Manag. Sci. 63:225-233.  35. Torriani, S.F.F., Brunner, P.C., McDonald, B.A., and Sierotzki, H.  2009.  QoI resistance emerged independently at least 4 times in European populations of Mycosphaerella graminicola.  Pest Manag. Sci. 65:155-162.  48  36.  Zheng, D. Olaya, G., and Köller, W. 2000. Characterization of laboratory mutants of Venturia inaequalis resistant to the strobilurin-related fungicide kresoxim-methyl. Curr. Genet. 38:148-155.                                 49  CHAPTER 3  Analysis of propiconazole sensitivity in Monilinia fructicola from Michigan and effect on fruit rot control  ABSTRACT A statewide survey of 49 Michigan orchards was conducted, and the sensitivity to propiconazole of a total of 487 isolates of Monilinia fructicola was investigated.  Resistance to sterol demethylation inhibitor fungicides (DMIs) has been reported in the southeastern US, New York, West Virginia, New Jersey, and Ohio.  Recent publications suggest a PCR-based survey to detect a novel 376-Monawhich causes overexpression of the cytochrome demethylase gene (CYP51), can be used as a molecular determinant to detect isolates with resistance to sterol demethylation inhibitor (DMI) fungicides.  The majority of Michigan isolates were characterized as resistant to propiconazole by relative growth (RG) insert was not uniformly detected.  Gene expression assays also indicated that expression of CYP51 was not elevated in DMI-resistant M. fructicola isolates from Michigan.  Amplification and sequencing upstream of CYP51 resulted in detection of DNA insertions in a wide range of isolates typed by DMI phenotype and the presence of  or other unique sequences.  The function of these unique sequences or their presence upstream of CYP51 cannot be correlated to a DMI-resistant genotype at this time. The stability of RG phenotypes after consecutive transferring was assessed in order to determine the consistency of isolates originally stored after field isolation.  In vitro assays were performed on inoculated peach or sweet cherry fruit to assess control of fruit rot of M. fructicola isolates differing in DMI sensitivity.  Protective applications of fenbuconazole controlled brown rot for a period of 4-5 days, regardless of DMI 50  phenotype.  However, curative applications were ineffective.  Our results indicate that Michigan populations of M. fructicola insert is not a marker for identifying resistant isolates. INTRODUCTION Monilinia fructicola (G. Winter) Honey is the causal agent of brown rot, a significant disease of stone fruit in the eastern and midwestern United States predominantly causing blossom blight and fruit rot symptoms.  Fruit rot can develop rapidly just prior to harvest and decay fruit on the tree, particularly in years with wet, humid conditions.  In high disease pressure years, truck load quantities of fruit grown for processing have been rejected and even entire orchard blocks have been left in the orchard because of brown rot.  The use of fungicides is the most effective method for brown rot management during pre-and post-harvest intervals.  Since the 1970s with the introduction of the benzimidazoles, site-specific fungicides have been predominantly utilized for brown rot control.  While the benzimidazoles were highly effective for brown rot control, their frequent use by growers exposed a critical weakness of site-specific fungicides, namely that frequent use will typically select for the evolution of fungicide resistance in the target pathogen population.  Resistance to benzimidazoles in M. fructicola and in other Monilinia spp. has been reported in many locations, including California, Michigan, and South Carolina (11, 15, 17, 25).  Following the emergence of benzimidazole resistance, other classes of site-specific fungicides were introduced for brown rot control including the sterol demethylation inhibitors (DMIs, 1980s; SBI: Class I, FRAC: Fungicide Resistance Action Committee), quinone outside inhibitors (1990s), and succinate dehydrogenase inhibitors (2000s).  Of these, the DMIs have been the most effective fungicide class for brown rot management and can function both as a protective and as a curative agent (7). 51   Because of the excellent efficacy of the DMIs for brown rot control, the stone fruit industry in the United States has heavily relied on these fungicides for successful fruit production for over 20 years.  However, strains of M. fructicola with reduced sensitivity to DMI fungicides have subsequently emerged, with initial reports from Georgia in 2004 (21) followed by detection of DMI-resistant strains in South Carolina, New Jersey, New York, Pennsylvania, and Ohio (1, 18, 14).  To date, three genetic mechanisms have been shown to confer DMI resistance in plant-pathogenic fungi: point mutations within the cytochrome demethylase (CYP51) target gene, overexpression of the CYP51 target gene, either due to elevated copy number or insertion of a putative promoter sequence upstream of the gene, or overexpression of drug efflux pumps.  Point mutations in CYP51 typically confer resistance to one or a few DMI fungicides, such as the Y136F mutation that confers resistance to triadimenol and propiconazole in Uncinula necator (6).  The exposure of individual fungal species to newer DMI fungicides after resistance has developed to previous DMIs has also led to the sequential accumulation of mutations within CYP51 (3, 4).  Overexpression of CYP51 is a common mechanism conferring resistance to DMI fungicides in plant pathogenic fungi including Blumeriella jaapii, M. fructicola, and Venturia inaequalis from tree fruit (13, 16, 20). Where the mechanism of CYP51 overexpression has been evaluated, it is typically associated with DNA sequence insertions in the promoter region that contain additional promoter sequences (13, 16, 22).  Lastly, an increase in expression of efflux pumps has been correlated with field resistance to DMIs in pathogens such as Sclerotinia homeocarpa (8).  The mechanism of DMI resistance in M. fructicola was investigated in strains isolated in the southeastern United States by Luo et al. (13) who determined that these strains overexpressed 52  CYP51 and carried a 65-CYP51 that presumably acted marker for DMI resistance and led to further detections of this sequence element in DMI-resistant M. fructicola isolates from New York and Ohio (14).  However, more recently, a largescale survey of M. fructicola isolates from New York and Pennsylvania resulted in the detection oresistance in M. fructicola (23).  Thus, it is currently unclear both if multiple DMI-resistance mechanisms are present in M. fructicola with regards to DMI resistance.  Studies of DMI sensitivity in M. fructicola and analyses of the effects of DMI phenotype on fruit brown rot control are further clouded by the instability of the DMI phenotype following long-term cold storage or after consecutive transfers in the laboratory (5, 26).  The loss of both DMI-phenotype and pathogenicity of isolates, regardless of storage method, or number of transfers on medium has been reported.  Results from these studies indicate the need to immediately assess isolates of M. fructicola after field isolation in order to adequately assess their true phenotype during in vitro bioassays.  The stone fruit industry in Michigan has relied on DMI fungicides for brown rot control for over 20 years.  While growers have occasionally suspected resistance issues in cases of brown rot infection, we had not observed wide-scale cases of severe brown rot in the state.  However, based on the recent observations of DMI-resistant isolates of M. fructicola and the (OH and NY), we felt the need to determine the status of Michigan orchard  populations.  The 53  objectives of the current study were to 1) perform a state-wide survey of Michigan cherry and peach orchards to assess populations of M. fructicola for DMI sensitivity and/or resistance using in vitro relative growth assays, 2) analyze these Michigan populations for the presence of the - and genotypes for overexpression of the CYP51 gene, 4) assess the effects of cold storage of isolates after 2-4 years of original field isolation, and 5) perform detached fruit assays to assess the pathogenicity of stored field isolates using protective and curative DMI fungicide applications and at varying label rates. MATERIALS AND METHODS  Collection and monoconidial isolation of Michigan field isolates of M. fructicola   In 2009, a preliminary sampling from peach orchards in Michigan was initiated after peach growers in southwest Michigan reported the reduced efficacy of DMI fungicides for management of brown rot.  Fifty peaches (Prunus persica L. (Batsch)) with brown rot symptoms from five southwest MI orchards (10 from each orchard) were submitted for analysis.  Based on the 2009 results, further sampling of Michigan stone fruit orchards and additional grower submissions ensued in 2010 and 2011.  During 2010-2011, fruit exhibiting brown rot symptoms were collected from a total of 44 commercial sweet and tart cherry (P. cerasus L. and P. avium L., respectively) and peach orchards in southwest, northwest, and west central Michigan.  Samples consisted of 10 to 45 infected fruit per orchard with a single infected fruit randomly selected per tree.   Selected fruit were transported to the laboratory, either individually or grouped per orchard, in paper or plastic bags for pathogen isolation and further processing.  Samples were immediately processed for pathogen isolation or stored at 4°C for a maximum of 36 h. 54  Conidia were scraped from brown rot lesions from each infected fruit with a sterile scalpel and spread onto coffee water agar (CWA, 12).  After 12-24 h, two germinating conidia per isolate were selected and transferred to Petri plates (15 x 90 mm) containing PDAY medium (PDA, Difco Laboratories, Detroit, amended with yeast extract, PDAY; 12).  After 8-14 days, one of two monoconidial isolates was selected and transferred for further study.  Isolates were subsequently stored on PDAY at 4°C for further in vitro and/or molecular analyses.  Isolates were identified to Monilinia spp. using primers and methods as described below.  In vitro sensitivity to propiconazole   Monoconidial isolates collected during the 2009-2011 surveys and identified as M. fructicola using PCR-ID primers were subjected to in vitro relative growth assays in order to determine DMI-sensitivity.  The DMI propiconazole (Orbit 3.6EC, Syngenta, Greensboro, NC) was used in the current study because a previous study using baseline isolates of M. fructicola the discriminatory dosage to distinguish DMI-sensitive and -resistant isolates (24).   Individual isolates were grown on Petri plates containing PDA for four days.  Three, 5mm agar plugs were transferred from the periphery of actively growing colonies to PDA amended with 0.3 g/ml a.i. propiconazole dissolved in ethanol and non-amended PDA, with an equal amount of ethanol added; three replicate plates were used per isolate.  Colony diameters (2 measurements per colony, perpendicular to each other) were measured after incubation for four days at 25°C.  The relative growth of each isolate was calculated by dividing the mean colony diameter growth on amended versus non-amended medium, multiplied by 100 and expressed as a percentage (% RG).  The plug diameter (5 mm) was subtracted from each measurement before final RG calculation.  55  DNA extraction for species identification and detection of the DMI-resistance determinant,   The monoconidial isolates were grown for approximately five to six days on PDAY medium overlaid with natural, sterile cellophane film (Paper Mart; Los Angeles, CA).  Monilinia isolates readily grew on top of cellophane and the mycelium was easily separated from the surface.  Approximately 0.1 mg of mycelium from each isolate was submerged in liquid nitrogen and macerated using a FastPrep bead beater homogenizer (FastPrep-24; MP Biomedicals, Solon, OH).   Genomic DNA was extracted with the Qiagen DNeasy Plant Mini Kit according to the -EDTA buffer (pH 7.5) at -20°C until further use.   Species confirmation   M. fructicola and M. laxa both occur in Michigan.  To confer preliminary identification of cultures, molecular testing was undertaken.  The species of Monilinia isolates was confirmed using published primer sets ITS1Mfcl, ITS4Mfcl and ITS1Mlx, ITS4Mlx which are specific to the internal transcription region (ITS) of M. fructicola and M. laxa, respectively (9).  The amplification of the ITS region of each sample was performed using polymerase chain reaction (PCR) using reaction amounts and conditions as previously reported (9).  Amplicons were imaged using a Fotodyne FOTO/Analyst Investigator Eclipse gel documentation system (Hartland, WI).    Each isolate in the survey was examined for the presence or insert (376 bp fragment, previously reported as confirming resistance to DMIs) or sensitive genotypes which amplify a 311-bp or 1815-bp amplicon, located upstream of the CYP51 gene (14).  PCR products were separated using a 2.0% agarose gel in TBE buffer for 1 hour and imaged as described above.  Restriction fragment length polymorphism (RFLP) was used to 56  furtheperformed in previous studies (14, 23).  Due to the consistent results of the RFLP analysis, the remaining isolates in the current study were only subjected to PCR amplification using the  We were unable to amplify any fragment using the INS65 primer set for a total of 80 isolates, confirmed as M. fructicola.  Therefore, new primer sets were designed targeting a sequence further within the CYP51 gene and a sequence extending further upstream than the original INS65 - TGCGGCCTTTGCGACTGAA - - TCCATGCTAGGGGCGTTTTCA - - GGGGGCTCTCGTTGGGATTG - Fragments amplified using this primer set were sequenced in order to determine the presence or Purification Kit (Qiagen, Valencia, CA) and submitted to the Research Technology Support Facility (RTS Facility) at Michigan State University for sequencing.  Sequences were analyzed using the DNASTAR Lasergene 9 Core Suite computer software for assembly and alignment to , Inc., Madison, WI).     Sequencing of the upstream region of CYP51 and the CYP51 gene   A random selection of isolates (36) was sequenced using the INS65 primer set in order to confirm the presence of the m set of 25 isolates, the entire CYP51 gene was amplified and sequenced to determine if any single-site mutations were present, relating to DMI resistance, using primer sets and conditions as designed by Luo et al (13).  PCR products were purified, submitted for sequencing, and analyzed as described above.  Analysis of CYP51 expression in isolates of M. fructicola   In a previous study, the 65-bp 57  CYP51 gene, and thus a marker for DMI-resistant isolates.  In the current study, a total of 10 isolates, 9 from the Michigan survey and 1 isolate from New York (courtesy of K. Cox, Cornell University) were evaluated for CYP51 expression.  Isolate propiconazole phenotype ranged from 22-and 2 isolates with a 500-bp amplicon generated by the INS65 primers.  Each isolate was grown -amended PDA, overlaid with sterile cellophane as described above.  Isolates cultured on PDA were grown for approximately 5 days whereas isolates on fungicide-amended PDA were removed after 7 days, in order to allow sufficient biological growth of material before RNA extraction.  Approximately 0.1 mg of mycelium was removed from each respective medium and instantly ground to a very fine powder in a pre-cooled mortar and pestle using liquid nitrogen.  Isolate RNA was immediately extracted using the Omega E.Z.N.A Plant RNA kit (Omega Bio-Tek, Norcross, GA) according to manufacturer instructions using the difficult sample type protocol.  Remnants of any potential DNA contamination, which could create false positive or negative results in further analyses, were removed using the Turbo DNA-Free Kit - DNase Treatment and Removal Agents (Ambion, Life Technologies; Carlsbad, NC).   Turbo-treated RNA was then quantified (NanaoDrop 1000, -free using the TaqMan® Reverse Transcription Reagents kit (Invitrogen, Life Technologies, Carlsbad, CA).     Reverse transcription, real-time PCR (RT-qPCR) reactions were performed using the MfCYP51 primer pair RealCYP-F2, and RealCYP-R2 in order to amplify expression of the CYP51 gene.  As an internal control, the expression of the CYP51 gene was standardized by the 58  constitutive expression the actin gene.  Each primer set was specifically designed for M. fructicola by Luo et al (13).  Reaction amounts, cycling parameters, and melt curve parameters were followed as previously described (13).  Products were amplified using an Applied Biosystems StepOne Plus Real-Time PCR System and visualized using the StepOne Software, version 2.3 (Grand Island, NY).  Each RT-qPCR reaction for each isolate and primer was performed in triplicate and two biological replicates were completed for analysis.  The relative expression ratio of the CYP51 gene for each isolate was compared to the actin gene, set to a value of 1.  Comparisons between the expression level of each transcript was analyzed using the REST© software (19).   Effect of consecutive transferring of Michigan isolates and stability of DMI-phenotype   The instability of the DMI insensitive phenotypes in M. fructicola after serial transfers using non-amended medium or after long-term cold storage was assessed.  The stability of DMI sensitivities after consecutive transfers onto fresh medium for eight Michigan isolates was assessed.  Isolates were subjected to weekly RG analysis (PDA (control) versus PDA amended lly, isolates were also sub-cultured consecutively on DMI-amended media and subjected to consecutive RG analysis.  The eight selected isolates consisted of RG phenotypes ranging from 0-92 % RG when first assessed immediately after field isolation.  The isolates used in this study had been in storage at 4°C on PDAY for 2-4 yr prior to the assay. After five days of growth at 25°C, 5 mm plugs from the periphery of each isolate colony were placed on to each of five plates of PDA control and five plates of PDA amended with 0.3  Five replicate plates were used for this assay to account for increased variation after long-term storage than the above assays for testing of field isolates which were 59  immediately collected and analyzed.  Relative growth assays were performed as described above.  After measurement, a single plate of each isolate from each medium was randomly selected and further incubated for three days.  These plates served as preparatory colonies for the next successive weekly transfer for relative growth analysis.  Relative growth of each isolate cultured on PDA or amended PDA was examined after each weekly transfer for 7 weeks.  Isolates on DMI-amended medium, used for weekly assessment of RG, was used for another assessment of isolates constantly transferred on DMI-PDA medium.  This method was repeated for a total of 7 weeks to investigate the stability of relative growth on PDA and DMI-amended medium after the storage of the original cultures for 2-4 years.  Analysis of DMI fungicide application, rate, and pathogenicity of Michigan isolates of M. fructicola on detached cherry and peach fruit  Detached cherry and peach fruit were inoculated to assess the efficacy of the DMI fungicide fenbuconazole (Indar 2F®, Dow AgroSciences; Midland, MI) on M. fructicola isolates with a range of DMI sensitivities.  Both protective and curative applications of fenbuconazole were evaluated.  Initial experiments evaluated the efficacy of protective and curative applications of fenbuconazole at the standard 6 oz/A (177 ml/0.4ha) field rate of Indar.  Additional experiments assessed the efficacy of protective applications of fenbuconazole at higher field rates of 8 and 12 oz/A (236 ml/0.4 ha and 355 ml/ 0.4 ha, respectively).   Cherry inoculation experiment.   Fifteen monoconidial isolates, representing a wide range of RG phenotypes and various genotypes were used in this study.   Selected isolates ranged from 0--70.6 % 30.9-42.5 %  RG), and 3 isolates completely sensitive to propiconazole 60  rate, comparing protective versus curative applications.  A separate experiment was performed to assess the effect of higher, protective application rates of fenbuconazole.  Four isolates from the  RG).  Mature sweet cherries were collected from 12-year old, unsprayed sweet cherry trees (cultivars Sam and Emperor Francis) from the Michigan State University Plant Pathology Farm.  Fruit, with the pedicels still attached, were hand-picked and transported to the laboratory in open plastic bags to allow respiration (~130 fruit per bag) and stored at 4°C for 24 hours.  The fruit were then removed and allowed to return to room temperature for 24 h.  Cherries were surface sterilized using 70% ethanol and gently wiped with Kimwipes.  The terminal 1 cm of pedicles was aseptically removed and the cut end of the pedicle was inserted into a 5 ml Falcon tube filled with sterile water, through a small hole made in the plastic cap until the fruit rested against the top of the cap.  This technique maintains the turgor pressure of the fruit and mimics tree attachment for the short duration of the experiment (10).  Inverted cherry fruits and tubes were staggered in 72-well plastic test tube racks, with 2 different isolates of the same treatment per rack. Fungicide was applied to each fruit using a hand spray bottle.  Prior to use, the interior of the bottle was sterilized using 70% ethanol and 10% bleach rinsed with sterile water.  A commercial formulation of fenbuconazole (Indar 2F®, Dow AgroSciences; Midland, MI) was mixed in distilled water, and constantly agitated before application to fruit.  Fungicide applications were applied until run-off (droplets visible on fruit surface, 23).  Protective fungicide applications were made 24 h before pathogen inoculation while curative applications 61  were made 24 h after inoculation.  Inoculated fruit serving as controls were sprayed in the same manner using sterile water.  To produce the conidia used to inoculate the cherry fruit in this study, mycelium from each of the selected M. fructicola isolates was placed under a wound flap cut into surface sterilized cherries.  The mycelium was taken from the PDAY slants used to store the isolates. The wound-flap inoculated cherries were place in moist chambers (sterilized, plastic boxes with wetted paper towels) to create humid conditions conducive for sporulation.  The boxes were sealed with Parafilm and incubated for 4 days at 25°C.  Conidial suspensions were prepared by swiping the surface of a sporulating cherry with a wetted, sterile toothpick and then suspending the conidia in a tube of sterile water containing 3 mm glass beads for agitation before inoculation of fruit.  The suspension was adjusted to 1x103 conidia/ml.  To inoculate the cherries, the skins were pierced 3 times in a triangular, equidistant fashion (holes 3-4 mm apart) using a 30 G½  hypodermic needle (PrecisionGlide®, Becton Dickinson, Franklin Lakes, NJ).  Immediately after wounding, each cherry fruit was inoculated by placing a 15 µl droplet of conidial suspension over the wounded tissue area.  The inoculated, fungicide treated fruit were kept in surface sterilized plastic storage bins (Sterilite®, 67x41x17cm).  Four racks of cherries, two isolates per rack, were placed within a single storage bin.  In order to create optimal infection conditions of isolates, sterile paper towels, soaked in a liter of sterile water, were placed around the inside of each bin.  To further maintain optimal infection conditions, fruit were lightly misted with sterile water 24 h after inoculation, each day after severity evaluation.   Assessment of fenbuconazole application at the standard field rate (6 oz/A; 177 ml/0.4ha) were done a single time on both Sam and Emperor Francis cherry cultivars. A total of 9 fruit 62  were used for each treatment (protective, curative, water-sprayed control) per isolate.  Severity of pathogen infection was evaluated each day after inoculation for each treatment for a total of 7 days.  Lesion size or infection was determined as a percentage of diseased versus healthy tissue for each fruit.  Data are reported as the mean percent lesion size for the 9 fruit used per treatment/isolate and grou Evaluation of higher rates of fenbuconazole applications was performed on Emperor Francis with 9 replications per isolate per treatment.  Severity of infection was evaluated each day for 6  Isolate selection for in vitro peach evaluation of fenbuconazole applications.  Based on results from the Michigan survey and previous reports of DMI resistant isolates characterized  RG > 30 percent additional detached fruit experiments were performed on peach fruit to investigate the pathogenicity of Michigan isolates within this select group.  A total of eight isolates were selected, ranging in phenotypes of 73.9-0.0 % RG.  Four of the selected isolates were within the 30 % RG range, each of 2 isolates containing either -bp amplicon.   Peach inoculation experiment.  Firm tree-ripened peaches were collected from unsprayed 18-year old trees (cultivars Starfire and Crest Haven) growing at the Michigan State University Horticultural Farm.  Peaches were hand-picked and layered in shallow crates to minimize bruising.  The peaches were kept at 4°C in a storage locker for 4 days prior to the inoculation study.  As in the cherry experiments, peach fruit were removed from storage at 4°C, allowed to return to room temperature for 24 h, and surface sterilized as described above.  Due to the 63  variability of fruit size, the diameter of each peach variety was recorded before surface sterilization in 70% ethanol.  For each isolate per treatment, a range of peach sizes was used in order to balance variability among isolate/treatment.  Fruit replications (12) for each isolate per treatment were stored in a single plastic storage bin after fungicide application and inoculation, using the same methods as above to maintain humidity for the duration of the experiment.  Protective and curative applications of fenbuconazole were applied to peach fruit as described above.   Sporulating colonies of each M. fructicola isolate were produced on tart cherry extract agar (CEA; 200 ml of cherry concentrate, 20 g Bacto agar, 800 ml of distilled H2O, pH 5).  Isolates were grown on CEA for 7 days in the dark at 25°C.  Conidial suspensions were prepared 3x105 conidial suspension.  Each isolate per treatment was placed in a single storage bin, with humid conditions maintained as previously mentioned.    Fenbuconazole protective and curative applications at the standard field rate (6 oz/A; 177 ml/0.4ha) were assessed using Starfire peaches and was replicated twice.  Severity of pathogen infection was measured each day, as described above, for a total of 5 days. Additional evaluation of protective applications of fenbuconazole at higher rates was performed on Crest Haven peaches with 12 replications per isolate per treatment.  Severity of infection was evaluated each day for 5 days and replicated twice.  The mean lesion size for each isolate per treatment was assessed daily as above.   RESULTS Isolate collection   When possible, a total of 25 isolates per orchard were chosen for analysis, although due to the condition of various samples and the time of isolation, a range of 1-40 64  monoconidial isolates per orchard were collected.  A total of 487 isolates of M. fructicola were obtained during the preliminary and additional surveys resulting in 162 isolates from southwest Michigan, 18 from west central, and 307 isolates from northwest orchards (Table 3.1).  All isolates were confirmed as M. fructicola using PCR. In vitro sensitivity of isolates of M. fructicola to propiconazole   The population of M. fructicola isolates, obtained in the Michigan survey in 2009-2011 showed a wide range of in vitro sensitivities to propiconazole.  Relative growth values obtained for individual isolates ranged from 0.0-. Examination of the mean RG of isolates from individual orchards also showed a range of sensitivities with orchard averages ranging from 25-49% RG (Table 3.1). Previous studies (14, 23) have correlated DMI-resistance in M. fructicola to a RG phenotype of or above 30% RG across all regions and years of sampling (Figure 3.1).  In Northwest MI, 250 isolates were above 30% RG (29 orchards), in Southwest MI 106 isolates were above 30% (18 orchards), and 17 isolates from West Central MI (1 orchard) (Figure 3.2).    All 487 isolates from Michigan orchards were isolates with the corresponding 376-isolates amplified the 311-bp and 1815-bp associated with sensitive isolates (14), while 4 isolates amplified a 500-bp fragment with unknown function.  These 4 isolates were detected within in same orchard in Northwest MI (Table 3.1).   65   -bp insert; 376-bp fragment) was detected in 16% of the total M. fructicola Michigan isolates examined, however this sequence was only detected in isolatealmost half of the isolates collected from southwest Michigan (80/162 total southwest isolates).  Additionally, 5 of 14 isolates from southwest Michigan within the 21-30% RG range harbored  (Figure 3.1). Table 3.1   Overall survey of isolates of Monilinia fructicola in Michigan commercial tree fruit orchards and analyses of in vitro sensitivity to propiconazole and molecular detection of the  as a resistance determinant: 2009-2011. a Genotype explained as the amplicon size using primer set INS65 (Luo et al, 2008) to determine DMI-genotype relating to the -bp -bp and 1815-bp are denoted as sensitive, while a 500-bp fragment has an unknown DMI-genotype.       Year Region(s)  Number of orchards Number of isolates Range of individual %RG Average individual %RG Isolate genotype a   -, 1815-, 500-bp)        2009 Northwest 1 27 0-68.5 31.3 0, 24, 3, 0  Southwest 5 50 0-87.2 25.4 27, 23, 0, 0         Northwest 20 162 0-68.1 37.9 0, 146, 15, 1 2010 Southwest  13 112 0-76.4 38.8 53, 54, 5, 0  West Central 2 18 28.4-71.9 48.9 0, 18, 0, 0               2011  Northwest 8 118 18.1-92.7 46.5 0, 105, 10, 3 66                         Figure 3.1 Frequency distribution of in vitro relative growth to a discriminatory dose of 0.3 g/ml propiconazole within populations of M. fructicola in Michigan orchards.  Data consist of 49 orchards throughout Michigan, totaling 487 isolates.  Number of isolates Percent relative growth categories (%RG) 67                       Figure 3.2  in isolates of M. fructicola, as separated by Michigan orchard location.  A) Northwest  Number of isolates Percent relative growth categories (%RG) C B A 68   Michigan 2009-2011, total of 29 orchards, 313 isolates; B) Southwest Michigan 2009-2010, total of 18 orchards, 162 isolates; C) West Central Michigan 2010, total of 2 orchards, 18 isolates.   Sequencing of the upstream region of CYP51 in isolates of M. fructicola    A subgroup of 36 isolates were chosen for analysis and the sequence upstream of CYP51 was amplified and sequenced using the INS65 element.  A total of 16 isolates with the 376-bp amplicon relating to the submitted for sequencing as well as, 19 fragments with the 311- or 1815-bp amplicon, and a single isolate the 500-indicated the presence of additional genetic inserts and alternative sequences upstream of CYP51 in 20 DMI-sensitive isolates.  Amplification and sequencing of the upstream region of CYP51 using the INS65 primer set generated four genotypes (Figure 3.3).  The first sequence is indicative of the size and posiCYP51 (Figure 3.3; sequence 1).  The second genotype amplified the 500-bp fragment, located 117-bp upstream of CYP51 -bp insert and has no Figure 3.3; sequence 2).   In the third detected genotype amplified 14 isolates with a 311-bp fragment and 2 isolates, with a 1815-bp fragment, all contained a 65--bp upstream from CYP51 Figure 3.3; sequence sequences, however it also contained two alternate sequences (Figure 3.3; sequence 4).     69                    Evaluation of the relative expression of the CYP51 gene in Michigan isolates of M. fructicola   A total of 10 isolates with varying RG phenotypes and genotypes as described above, were selected to assess CYP51 expression when subjected to non-amended medium as well as medium amended with propiconazole.  Replicates between each assay were similar and results were combined.  In comparison to the control gene, actin, a trend of CYP51 expression was not Figure 3.3   Detection of additional inserts upstream of the CYP51 gene in DMI-sensitive isolates of M. fructicola in Michigan.  Sequence groups were aligned using a previously published sequence (EU779922, Luo et al.).  Figure illustrates a graphic representation of inserts and alternate sequences detected.  Above results are based on following number of isolate sequ16 isolates); 14 isolates with 311-bp fragment and 2 isolates with 1815-bp fragment) ; alternate sequences C and D, detected in 3 isolates with 1815-bp amplicon.   70  observed in relation to isolate phenotype or genotype on either medium.  Four isolates grown on non-amended medium displayed significant expression ratios when compared to the control but 22% RG).  The remaining isolates grown on non-amended medium with significant expression ratios were the isolate with 59% RG (500-bp fragment) and another isolate with 28% RG (1815-bp fragment).  In comparison, only a single isolate subjected to propiconazole medium had significant CYP51 expression (45% RG and a 500-bp fragment) (Figure 3.4).  Overall, expression of the CYP51 gene in Michigan isolates was not elevated, regardless of DMI phenotype.              Figure 3.4  Relative expression of the CYP51 gene in isolates of M. fructicola grown on non-amended media (PDA) and media amended with DMI fungicide (Orbit®). propiconazole).   Expression levels  * * * * * * 71  Figure 3 Bars noted with an asterisk (*) indicate significant relative expression from 1 (P < 0.5). Expression values are the means of two biological replicates.  Phenotype indicated by growth of each isolate on 0.3 ug/ml of propiconazole amended medium relative to growth on non-amended medium (% RG).  Isolate genotype denoted by fragment size as amplified by  Evaluation of long-term storage and consecutive transferring on in vitro DMI sensitivity  A total of eight isolates, original RG phenotype, 0-93% RG, were removed from storage at 4°C after 2-4 years.  The isolates were then evaluated over seven cycles of weekly consecutive transfers on non-isolates transferred on PDA alone, after 1 week the RG of the highest isolates (61.0-92.7% RG) dropped significantly, while the remaining isolate phenotypes were fairly stable.  This trend was consistent among the next six weeks of transfers on PDA although two isolates with original phenotypes at 0% RG were able to grow at low levels of propiconazole at the end of the experiment (Table 3.2; PDA).  High relative growth isolates increased in sensitivity over 2-4 yrs in cold storage but still remain in the same RG-category (resulting RG did not go below 30%).  This same trend was also observed with isolates that would be considered moderate or low (0.0-22.0% RG).   Similar results were observed when isolates were consecutively transferred on DMI-amended medium. No continued loss of RG-phenotype in the higher isolates was observed over seven weekly transfers on DMI-amended medium, and increased slightly as compared to PDA medium only (Table 3.2; DMI).     72  Table 3.2  Evaluation of relative growth phenotype after consecutive transferring and storage of isolates of Monilinia fructicola on two media types.   a Relative growth assays were performed with isolates initially cultured on PDA.  After week 1, a culture of each isolate on DMI-amended media was used for a second consecutive transfer and storage study. Application timing and rate of fenbuconazole for the control of different M. fructicola phenotypes on inoculated cherry and peach fruit   Evaluation of protective and curative applications of fenbuconazole at the standard label rate of 6 fl oz/A (177ml/0.4ha) was assessed on detached cherry cultivars of Sam and Emperor Francis.  The results from each of the experiments were not significantly different and data were combined (P = 0.8).  A range of M. fructicola isolates with varying phenotypes were used to inoculate the excised fruit (Table 3.3; es than curative applications at the comparable rate.  Isolates within tfungicide was applied (Figure 3.5).   73   A following study compared the effect of standard label rates of fenbuconazole but also included two higher label rates of 8 and 12 oz/A (237ml/0.4ha, 355 ml/0.4 ha).  The higher rates combined as values were not significantly different.  Results again showed that protective applications of fenbuconazole at the standard label rate of 6 fl oz/A provided better control of han curative applications (Figure 3.6; B, C).  The best control of fenbuconazole.    Peach inoculation experiments were performed using detached peach fruit to evaluate the efficacy of application type and label rate of fenbuconazole using eight isolates of M. fructicola (Table 3.3).  The first peach experiment compared protective and curative applications of fenbuconazole at the 6 fl oz/A label rate.  The data from the two replicates of this experiment on Starfire peaches could not be combined as the results differed.  In the first experiment, a protective application of fenbuconazole offered less protection than the curative application.  The protective spray only showed reduced control of the 0% RG isolate and one of the 23% RG isolate whereas the curative treatment reduced the infection of 2, 30% RG isolates and the 0% RG isolate.  These results were switched in the second replicate, in which the protective application provided the best control of all isolates except the two highest (Figure 3.7).  An additional study using higher rates (8 and 12 fl oz/A rates) applied only in a protective manner were evaluated and compared to the standard field rate on Crest Haven peaches.  Five isolates from the previous peach experiment were selected for this experiment.   Replicates were not significantly different and data were combined.  Results indicate that the highest rate of 12 fl oz/A provided the best control but did not show a great improvement of control when compared  74  to the 6 and 8 fl oz rates (Figure 3.8).   Table 3.3  Isolates used for in vitro cherry and peach assays to analyze protective and curative  applications of fenbuconzole for control of a range of DMI-sensitive isolates of Monilinia fructicola.    Yr of isolation Isolate ID Host Phenotype (%RG) Genotype Isolate category for in vitro assay  Cherry                   Peach    2008 2010 2010 2010 2010 2010 2010 2010 2010 2009 2010 2010 2009 2010 2010    2010 2009 2009 2010 2011 2010 2010 2010    BR 8 RWBM 4 RW21M 2 PPOM 8 DDRM 1 RW21M 3 EGTM 8 EBSM 12 501 4 BR 29 RWBM 2 RBOM 7 BR 50 SCHM 14 DRAM 2    DBWM 7 BR 40 BR 29 RDWM 5 NYBM 8 PNSM 8 RWBM 2 DRAM 2      Peach Peach Peach Cherry Cherry Peach Peach Cherry Cherry Peach Peach Cherry Peach Cherry Cherry    Cherry Peach Peach Cherry Cherry Cherry Peach Cherry    87.2 71.3 74.0 70.6 76.4 39.4 42.5 41.4 42.4 30.9 23.1 22.2 0.0 0.0 0.0    73.9 53.4 30.9 33.0 32.4 30.4 23.0 0.0    376 376 376 376 376 376 376 1815 311 376 311 376 311 311 311    376 376 376 376 311 311 311 311    High High High High High Mid Mid Mid Mid Mid Low Low Low Zero  Zero    75                        Mean percent lesions size Days after inoculation A B C Figure 3.5 Evaluation of fenbuconazole application on detached cherry fruit using a standard field rate (6oz/A; 177ml/ha).  Applications were made either protectively (B) or  76  Figure 3curatively (C).  Water treated inoculations were also made as checks (A).  The progression of disease was evaluated as the ratio of infection versus healthy tissue per fruit for 7 days after inoculation.  The mean values of isolate categories (Highs, mids, lows, zeros) are shown.  For reference to colored lines in this graph and those following, the reader may confer the electronic version of this dissertation.                  B A C D E Percent control Days after inoculation Figure 3.6 Evaluation of fenbuconazole applications on the sweet cherry cultivar,   Applications were made protectively and curatively at the standard label  77  Figure 3 rate of 6oz/A (B, C) and protective applicationsat 8 oz/A (D) and 12 oz/A (E). Results were compared to nontreated controls (A).  Disease progression was assessed for 6 days after pathogen inoculation.  The mean values of isolate categories (highs, mids, lows, zeros) are shown for 15 isolates in A, B, and C, whereas the means of two isolates per category are shown in D and E.                   Figure 3.7  In vitro analysis of protective and curative applications of fenbuconazole (6 oz/A label rate) .   Nontreated controls (A), protective application (B),  A B C A B Replicate 1 C Replicate 2 Percent control Days after inoculation 78   Figure 3 and curative application (C).  Data from each replicate were different and shown separately.  The progression of disease for each isolate was assessed five days after inoculation.                 DISCUSSION The results of a three-year survey of stone fruit orchards in Michigan indicate that orchard populations of M. fructicola are shifting towards resistance to DMI fungicides and that approximately 5% of individuals examined exhibited a high level of resistance (above 70%).  However, to our knowledge, instances of largescale control failures have not occurred in A C B D Figure 3.8   Nontreated controls were sprayed with water (A).  Protective applications were made at the standard label rate of 6 oz/A (B), 8 oz/A  (C), and a 12 oz/A rate (D).  Disease progression was assessed for 5 days after pathogen inoculation.   Days after inoculation Percent control 79  Michigan, even though the DMI fungicide Indar is the predominant fungicide utilized for control of the fruit rot phase of brown rot.  This is likely due to the quantitative nature of DMI resistance and also is likely affected by the ability of growers to use higher rates of Indar (up to 12 fl oz /A compared to the original label rate of 6 fl oz /A) because of a Section 24(c) special exemption from the U.S. EPA. Previous studies have determined that isolates with a 30% or greater RG phenotype on (14, 18).  Overall, 77% of isolates from this study were above this 30% RG marker, indicating a and this sequence element was only detected in M. fructicola isolates from orchards in southwest number of isolates well above the phenotypic resistance marker of 30% RG.  However, the M. fructicola isolates from existing populations in Ohio. The lack of correlation between a DMI-resistance phenotype and presence or lack of the uced DMI sensitivity in some M. fructicola isolates, its presence cannot solely be used to distinguish between DMI sensitive and resistant sensitivities, but in New York populations and as now observed in Michigan, other genetic elements also have a role in the quantitative resistance response (18).  Examination of the upstream region of the CYP51 in a select group of Michigan isolates revealed two additional inserts and two alternate sequences.  The most interesting of these inserts 80  is a 171-bp insert that is located upstream of CYP51 element but which does not share any sequence homology.  This insert was detected in four isolates from the same orchard in northwest Michigan.  In a previous study, other inserts were also detected upstream of CYP51 but in isolates of M. fructicola resistant to both propiconazole and boscalid and were not similar to those detected in the current study (2).  At this time, we do not have a biological meaning for these inserts or what they may mean in the context of DMI-resistance, the characterization of M. fructicola isolates, or if they are just a trivial finding.  These observations do suggest that the region of DNA sequence upstream of CYP51 is a hotspot for insertions, but that these insertions may not affect the expression of CYP51.  Overexpression of CYP5113), is purportedly the genetic mechanism for DMI-resistance in isolates of M. fructicola.  In the current study, expression ratios of isolates on non-amended or fungicide-amended medium did not reach expression levels as previously reported for M. fructicola or in studies of other DMI-resistant plant pathogens (13, 15, 20).  Thus, our results indicate that the expression of CYP51 is not elevated in Michigan isolates of M. fructicola that exhibit DMI resistance.  Examination of the phenotypic stability of isolates of M. fructicola was assessed after long-term cold storage and serial transferring onto non-amended and DMI-amended medium for seven weeks.  The original phenotype of isolates exhibiting the highest levels of DMI resistance did show a decreasing variability of % RG on control medium and slightly on fungicide amended in the detached fruit assays.  These results are in concordance with previous studies that regardless of storage method or number of transfers, the original DMI phenotype of field isolates does degrade over time (5, 26).  The study performed by Cox et al, indicated that isolate fitness 81  decreased and propiconazole sensitivity increased after consecutive transferring after original field storage.  Isolates chosen for our study of pathogenicity on detached cherry and peach fruit were removed from cold storage after 2 to 4 years and 1 to 3 years, respectively.  While our instability study did mimic previous published results (5, 26), the virulence of the isolates chosen for the detached fruit assays remained similar to their original phenotypes.  Our results from the detached fruit assays are in accordance with previous assays that brown rot control is best achieved through protective applications of fenbuconazole (7, 18).  Although isolates with higher RG phenotypes were more difficult to control, even when using protective applications at higher field rates of fenbuconazole, all isolates were at fairly controllable levels three to four days after inoculation and four to five days after fungicide application in all experiments.  And even though DMI resistance is quantitative, our results using higher field rates of fenbuconazole showed the same results.  However, during these experiments, peaches were wounded before infection and optimal conditions for infection were created.  Overall, using detached fruit, in a semi-controlled environment, fenbuconazole activity lasted for 5-6 days. This study indicates the need to continue to survey and monitor populations of M. fructicola -resistant phenotype.  Therefore, in vitro relative growth assays need to continue to be relied on for assessment of DMI sensitivity from field isolates.  The long-term reliance of the stone fruit industry on site-specific fungicides for brown rot control and the subsequent evolution of fungicide resistance in M. fructicola populations has threatened the sustainability of stone fruit production in humid regions.  Besides a need for additional efficacious fungicide modes of 82  action, such as the succinate dehydrogenase inhibitors (SDHIs), growers will need to become more active in utilizing cultural techniques in inoculum reduction to maintain adequate levels of brown rot control.                                         83                          REFERENCES                      84  REFERENCES    1.  Burnett, A., Lalancette, N., and McFarland, K.  2010.  First report of the peach brown rot         fungus Monilinia fructicola resistant to demethylation inhibitor fungicides in New Jersey.          Plant Dis. 94:126.  2.  Chen, F., Lui, X., Chen, S., Schnabel, E., and Schnabel, G. 2013. Characterization of       Monilinia fructicola strains resistant to both propiconazole and boscalid. Plant Dis. 97:645-      651.    3.  Cools, H.J., Mullins, J.G.L., Fraaije, B.A.  2011.  Impact of recently emerged sterol 14-          demethylase (CYP51) variants of Mycosphaerella graminicola on azole fungicide sensitivity.         Appl. Environ. Microbiol. 77:3830-3837.   4.  Cools, H.J., Hawkins, N.J., and Fraaike, B.A.  2013.  Constraints on the evolution of azole       resistance in plant pathogenic fungi.  Plant Pathol. 62: (Suppl. 1) 36-42.  5.  Cox, K. D., Bryson, P. K., and Schnabel, G. 2007. Instability of propiconazole resistance and         fitness of Monilinia fructicola. Phytopathology 97:448-453.  6.  Délye, C., F. Laigret, and M.-F. Corio-Costet. 1997-demethylase gene        of Uncinula necator that correlates with resistance to a sterol biosynthesis inhibitor. Appl.       Environ. Microbiol.63:2966-2970.   7.  Holb, I. H. and Schnabel, G. 2007. Differential effect of triazoles on mycelial growth and       disease measurements of Monilinia fructicola isolates with reduced sensitivity to DMI        fungicides. Crop Protection 26:753-759.  8.  Hulvey, J., Popko, J.T., Sang, H., Berg, A., and Jung, G.  2012.  Overexpression of       ShCYP51B and ShatrD in Sclerotinia homeocarpa isolates exhibiting practical field resistance       to a demethylation inhibitor fungicide.  Appl. Environ. Microbiol. 78:6674-6682.   9.  Ioos, R. and Frey, Pascal. 2000. Genomic variation within Monilinia laxa, M. fructigena, and       M. fructicola and application to species identification by PCR. European Journal of Plant           Pathology 106:373-378.  10.  Jones, A. L. 1971. Bacterial canker of sweet cherry in Michigan. Plant Dis. Rep. 55:961-        965.  11.  Jones, A.L., and Ehret, G.R.  1976.  Isolation and characterization of benomyl-tolerant         strains of Monilinia fructicola.  Plant Dis. Rep. 60:765-769.  12.  Lesniak, K. E., Proffer, T. J., Beckerman, J. L., and Sundin, G. W. 2011. Occurrence of QoI         resistance and detection of the G143A mutation in Michigan populations of Venturia  85         inaequalis. Plant Dis. 95:927-934.   13.  Luo, C. and Schnabel, G. 2008. The Cytochrome P450 Lanosterol 14-Demethylase gene is a           demethylation inhibitor fungicide resistance determinant in Monilinia fructicola field         isolates from Georgia. Appl. Environ. Microbiol. 74:359-366.  14.  Luo, C., Cox, K. D., Amiri, A., and Schnabel, G. 2008. Occurrence and detection of the         DMI resistance-Monilinia fructicola. Plant Dis.         92:1099-1103.  15.  Ma, Z.H., Yoshimura, M.A., and Michailides, T.J.  2003.  Identification and characterization         of benzimidazole resistance in Monilinia fructicola from stone fruit orchards in California.         Appl. Environ. Microbiol. 69:7145-7152.  16.  Ma, Z.H., Proffer, T.J., Jacobs, J.L., and Sundin, G.W.  2006.  Overexpression of the 14-       demethylase target gene (CYP51) mediates fungicide resistance in Blumeriella jaapii.  Appl.        Environ. Microbiol. 72:2581-2585.  17.  Michailides, T.J., Ogawa, J.M., and Opgenorth, D.C.  1987.  Shift of Monilinia spp. and         distribution of isolates sensitive and resistant to benomyl in California prune and apricot         orchards.  Plant Dis. 71:893-896.  18.  Parker, D.M., Zhang, N., Smart, C.D., and Koller, W.  2006.  Polymorphism of 14-alpha         demethylase gene (CYP51) in brown rot pathogen Monilinia fructicola from a resistant         orchard in New York State.  (Abstr.) Phytopathology 96:S90.  19.  Pfaffl, M. W., Horgan, G. W., and Dempfle, L. 2002. Relative expression software tool         (REST©) for group-wise comparison and statistical analysis of relative expression results in         real-time PCR. Nucl. Acids Res. 30:e36  20.  Schnabel, G., and Jones, A.L.  2001.  The 14-demethylase (CYP51A1) gene is         overexpressed in Venturia inaequalis strains resistant to myclobutanil.  Phytopathology          91:102-110.  21.  Schnabel, G., Bryson, P.K., Bridges, W.C., and Brannen, P.  2004.  Reduced sensitivity in         Monilinia fructicola to propiconazole in Georgia and implications for disease management.          Plant Dis. 88:1000-1004.  22.  Sun, X., Xu, Q., Ruan, R., Zhang, T., Zhu, C., and Li, H.  2013.  PdMLE1, a specific and         active transposon acts as a promoter and confers Penicillium digitatum with DMI resistance.          Environ. Microbiol. Rep. 5:135-142.  23.  Villani, S.M., and Cox, K.D.  2011.  Characterizing fenbuconazole and propiconazole         Monilinia fructicola from New York.          Plant Dis. 95:828-834.  86  24.  Zehr, E. I., Luszcz, L. A., Olien, W. C., Newall, W. C., and Toler, J. E. 1999. Reduced        sensitivity in Monilinia fructicola to propiconazole following prolonged exposure in peach        orchards. Plant Dis. 83:913-916.  25.  Zhu, F.X., Bryson, P.K., Amiri, A., and Schnabel, G.  2010.  First report of the beta-tubulin         E198A allele for fungicide resistance in Monilinia fructicola from South Carolina.  Plant         Dis. 94:1511.  26.  Zhu F. X., Bryson, K. B., and Schnabel, G. 2012. Influence of storage approaches on         instability of propiconazole resistance in Monilinia fructicola. Pest Manag. Sci. 68:1003-         1009.                    87  CHAPTER 4   Evaluation of acibenzolar-S-methyl and phosphorous acid for the control of bacterial diseases on tree fruit and PR-gene induction   ABSTRACT       In Michigan and worldwide, fire blight (Erwinia amylovora, Ea) and bacterial canker (Pseudomonas syringae pv. syringae, Pss) are two of the most invasive and devastating bacterial diseases affecting pome and stone fruits, respectively. Effective management of fire blight relies heavily on the use of antibiotics while only copper formulations are registered for bacterial canker control. The current study is focused on the evaluation of a plant activator (Actigard®, a.i. acibenzolar-S-methyl, ASM) and a fungicide/resistance inducer (Phostrol®, a.i. phosphorous acid salts, PH) as candidates to supplement these bacterial management programs. During 2008-2013, field trials were conducted on apple and cherry to evaluate Phostrol and Actigard as supplementary candidates for fire blight and bacterial canker management programs.  On apple, ASM provided control of fire blight either alone or in combination with a biological control or antibiotic and PH controlled blossom blight best when combined with a biological control agent.  The effects of ASM and PH applications were most effective under low to moderate disease pressure.  During 2012 and 2013, field trials were conducted on two sweet cherry cultivars to evaluate a single application of Phostrol (2 qt/A rate) for the control of the leaf spot phase of bacterial canker.   Phostrol did not have an effect of the incidence of bacterial leaf spot but did reduce disease severity in one field trial.  In vitro analyses of a direct effect of Phostrol on bacterial populations was investigated using strains of Ea and  Pss on nutrient-rich and poor media amended with three rates of Phostrol.  Colony populations and fitness, as determined by 88  colony diameter, of each strain were not affected at any rate of Phostrol.  Additional studies included PR-gene expression profiling on Actigard and Phostrol-treated 2-yr old potted Gala trees using real-time quantitative PCR.  Induction of the PR-1 gene was detected after a single foliar application of Phostrol, and a foliar and drench application of Actigard.  Induction of all 3 PR-proteins investigated in the current study were elicited by Phostrol but was expression was transient. Further studies of Phostrol and PR-gene expression were performed using 2-yr potted Gala trees treated with weekly drenches of Phostrol, including pathogen challenge of strain Ea110.  Expression levels of all 3 PR-genes were maintained 21 days after the first drench application, regardless of pathogen inoculation. Overall results indicate that ASM and PH have potential in reducing the use of antibiotics and copper for fire blight and bacterial canker control in seasons when disease pressure is low to moderate.  Actigard and Phostrol both elicit PR-gene induction but further study is needed to determine the most effective application method (foliar/drench) and/or number of applications to fully prime the trees for potential management of fire blight and bacterial canker.   INTRODUCTION Fire blight (Erwinia amylovora (Burrill) Winslow et. al.) and bacterial canker/blossom blast (Pseudomonas syringae pv. syringae van Hall) are two of the most devastating and invasive bacterial diseases affecting fruit trees in Michigan and worldwide.  However, there are few tools available for their effective management, especially during epidemic infection periods.    Fire blight is an economically important disease on Rosaceous species, particularly apple and pear.  Disease is initiated each year during warm and humid conditions and infection is typically initiated by epiphytic E. amylovora populations that develop on the flower stigmas.  Under favorable environmental conditions, E. amylovora populations can rapidly increase to 104-89  106 CFU on a single stigma; wetting events enable cells to migrate from the stigma tip to natural openings at the nectarthodes of the flower, where infection occurs resulting in blossom blight symptoms (10).  The amplification of E. amylovora populations on flower stigmas and subsequent infection potential can be a triggering point for fire blight epidemics, thus, protection of the flower clusters is crucial for fire blight management.  Once blossom blight occurs, E. amylovora cells will readily establish systemic infections, and control of further disease progression within trees is extremely difficult because of the internal location of these cells.  Therefore, flower populations of E. amylovora are the main target for fire blight management. While apple cultivars with decreased susceptibility are available, many of the apples favored by consumers are highly susceptible to fire blight.  In addition, fire blight-resistant root stocks, while an essential management tool, do not reduce the disease susceptibility of the scion cultivar.  Therefore, management of fire blight relies heavily on the application of bactericides to the flower clusters to control blossom blight.  The antibiotic, streptomycin, is the most effective bactericide for managing blossom blight; however, streptomycin resistance has been detected in many locations including Michigan where streptomycin has been utilized intensively (2, 13, 17, 19, 20).  Oxytetracycline has also been shown to be a viable antibiotic in fire blight management programs, but is less effective than streptomycin, is bacteriostatic and not bactericidal, and is subject to rapid environmental degradation.  Kasugamycin is an agricultural antibiotic that has been shown in field trials to control blossom blight at levels similar to streptomycin, but is not currently registered (17).  Because fire blight control strategies rely heavily on antibiotic applications, the evolution of resistance in E. amylovora populations to additional bactericides is of major concern. 90  Bacterial canker is a serious disease of worldwide importance particularly on sweet cherry where canker formation leading to death of scaffold limbs and entire trees are common and other symptoms such as blossom blast and fruit and leaf spotting also occur readily.  Of the two pathovars of P. syringae that cause this disease, P. syringae pv. syringae is the predominant pathogen on sweet cherry.  Infection and disease progression by P. syringae pv. syringae is favored by cool, wet weather, and exacerbated by frost events.  Similar to E. amylovora, management strategies of bacterial canker rely heavily on protection of the flowers since epiphytic populations of P. syringae pv. syringae can increase to 104-106 CFU on a single flower under optimal environmental conditions.  During periods of extended cool, wet weather, or frost, bacterial populations can infect flowers and further invade woody tissue, causing fruit and leaf spot and/or girdling cankers.  Additionally, P. syringae pv. syringae is a unique pathogen in that it carries the ice-nucleation activity (INA) gene, allowing the bacterium to instigate frost damage and further aggravate disease initiation and progression (11). In contrast to fire blight, there are fewer management strategies available for the control of bacterial canker.  Most sweet cherry cultivars are susceptible or highly susceptible to bacterial canker.  Bactericides such as streptomycin and oxytetracycline are not registered for control of bacterial canker, but antibiotic resistance is also an issue in P. syringae pv. syringae isolates.  The only other option available for bacterial canker is application of various copper formulations during bud and flowering periods, but copper phytotoxicity is a significant problem on sweet cherry after trees break dormancy.  Copper treatments are also not a viable management option due to the propensity for the development of copper-resistant populations of P. syringae pv. syringae. (11). 91  Due to the limited number of resources for fire blight and bacterial canker management, infections of epidemic proportions during prolonged, optimal environmental conditions can, and have occurred.   In 2000, a regional fire blight epidemic occurred in southwest Michigan resulting in the death of 400,000 trees and losses in excess of $42 million dollars (12).  Significant bacterial canker epidemics have occurred in Michigan in 2002 and more recently, in 2012 resulting in severe blossom blast symptoms (Sundin, unpublished).  Therefore, there is an urgent need to find alternative materials for the control of fire blight and bacterial canker. Two prospective products for fire blight and bacterial canker management are acibenzolar-S-methyl (ASM), the commercial product Actigard (Syngenta) and phosphorous acid salts.  A recent meta-analysis which reviewed a large number of datasets from 2000-2008 for the control of fire blight evaluated the effectiveness of antibiotics, biologicals, and SAR-inducers.  Actigard and Phostrol were included in the SAR-inducer category and when compared across antibiotics and biologicals, showed that these products had a significant place in fire blight disease management.  This analysis showed that antibiotics, biologicals, and SAR-inducers all provide some degree of protection.  Unsurprisingly, the best products, were antibiotics (streptomycin), followed by the growth inhibitor prohexadione-calcium and then Actigard, and other SARs (21).  This extensive review showed that by using SARS, such as Actigard and Phostrol, some control is provided for fire blight. drench.  Actigard has a broad-spectrum activity for both fruit and vegetable pathosystems and a large amount of research has evaluated its effectiveness for disease control.  Research of Actigard (or ASM) applications on fruit trees have been investigated in Michigan and New York for fire blight on apple (foliar) (16, 32), Iran for shoot blight on quince (foliar) (1), in Germany 92  on apple seedlings (foliar) (9), in Italy for bacterial canker of hazelnut (P. avallanae) (foliar) (25), and in Florida for citrus canker on grapefruit (Xanthamonas citri pv. citri (foliar and drench) (6).  Studies in Michigan and New York showed that weekly applications of Actigard in combination with streptomycin or four applications throughout bloom period starting at tight cluster provided significantly less disease than applied alone or in combination with streptomycin, respectively (16, 30).  Balajoo et. al. showed that application of Bion (European formulation of Actigard) three times every four days significantly reduced shoot blight in 1 to 2-yr old trees.  While Scortichini et. al. determined that monthly applications of Bion relatively reduced bacterial blossom decline and Graham et. al. indicated that soil application of ASM reduced citrus canker but was dependent on the timing and rate of application. been performed to determine the efficacy of Phostrol in fruit systems.  Extensive testing has been done in vegetable systems for instance, the control of bacterial spot of tomato in which Wen et. al. found that weekly applications of phosphorous acid as well as, combined with biweekly applications of Actigard significantly reduced bacterial spot compared to the standard copper sprays.  Phosphorous acid has also been attributed to control many diseases caused by Oomycetes (3, 7).  We hypothesized that Actigard and the phosphorous acid compound Phostrol (Nu-Farm) would show demonstrated efficacy in the control of fire blight and bacterial canker and would be effective additions to existing disease control programs.  An additional hypothesis in this work was that Phostrol application to apple trees would induce the expression of pathogenesis-related proteins, known markers of a resistance response.  The major goals of the current study were to determine if Phostrol and Actigard could provide adequate control of fire blight and bacterial leaf 93  spot and replace or minimize the dependence of antibiotics and copper for control to help preserve the effectiveness of these limited chemicals. Additional studies were performed to determine if either product instigated pathogen-related (PR) protein expression in treated apple trees.      MATERIALS AND METHODS Field trials for analysis of Actigard and Phostrol as supplemental products for control of fire blight  Field experiments were conducted on the highly fire blight-susceptible apple seven experiments were performed in order to assess the efficacy or supplementary effect of Phostrol® (phosphorous acid salts, NuFarm US, Alsip, IL) or Actigard® (acibenzolar-S-methyl, Syngenta, Greensboro, NC) alone or in combination with current antibiotics available for fire blight management.  In each of the seven experiments, one of the following antibiotics was applied alone and used as a baseline to compare treatment combinations: streptomycin (Agrimycin®, Syngenta; Greensboro, NC), oxytetracycline (Fireline®, AgroSource, Cranford, NJ), or kasugamycin (Kasumin®, Arysta LifeScience, Cary, NC).  Evaluation of Phostrol in combination with the biological, Serenade MAX (QST 713 strain, Bacillus subtilis, Bayer CropScience, Muskegon, MI) or applied alone was compared to Agrimycin in three of the field experiments.  The efficacy of Actigard in combination with either Agrimycin, Fireline, or Kasumin was assessed in five experiments and assessed to the single application of each respective antibiotic for control of blossom and shoot blight.           Treatments were applied in various orchard blocks of the apple cultivars Jonathan (Jonnee) or Gala, ranging in age from 11 to 37-yrs of age.  Each experiment was set up in a randomized complete block design, and each treatment was replicated four times in single-tree 94  plots.  Treatments were applied at 300 gal/A using a handgun sprayer at 350-400 psi.  Application timing for each experiment varied from tight cluster, 50% bloom, 60-80% bloom, and full bloom.             Trees were inoculated with a suspension of E. amylovora strain Ea110 when trees were at 80% bloom using a 3-gallon hand-sprayer (RL PROFLO XL, Highland, CA).  The concentration of Ea110 inoculum varied in each experimental year, ranging from 1 x 105 to 5 x 106 CFU/ml.  Evaluation of blossom blight and shoot blight were performed approximately two weeks apart.  A range of 90-210 blossom clusters or shoots were evaluated for each tree per treatment.  The incidence of blossom blight and shoot blight were analyzed separately for each experiment using otected least significance difference (LSD) test, (P<0.05).    Field analysis of Phostrol foliar applications for control of the leaf spot phase of bacterial canker on sweet cherry cultivars  Field experiments were performed at the Michigan State University Plant Pathology Farm to assess the efficacy of a single Phostrol application for the management of leaf spotting caused by P. syringae pv. syringae on 10-yr old trees of the sweet cherry cultivars Cavalier and Ulster.  Phostrol (2 qt/A) was applied when trees were at 80 percent bloom using an RL PROFLO XL- 3 gallon sprayer (Highland, CA) and sprayed until run-off.   In 2012, a total of 6 trees per treatment were used while in 2013, 4 trees per treatment were used.  Initiation of disease was relied on by natural infection of Pss.  After petal fall, 20 shoots per tree/treatment were rated for the number of infected leaves and the number of leaves witProtected least significant difference test (P< 0.05) was used to determine if Phostrol had an effect on the incidence or severity of bacterial leaf spot infection.   95   In vitro analysis of a direct effect of Phostrol on strains of Ea110 and PssF55 on two media types  Strains of Erwinia amylovora (Ea110) and Pseudomonas syringae (PssF55) were grown in Luria-Bertani broth (LB, Research Products International, RPI; Mount Prospect, IL) and incubated for 24 hr on a rotary shaker at 28°C.  Strains were then cultured on LB for single colony isolation for in vitro analysis.  LB and minimal medium (MM; 10 g sucrose added) as described by Falkenstein et al were amended with Phostrol corresponding to field application rates of 2, 4, and 6 qt/A.  A dilution series of each strain was performed in 0.5x phosphate-buffered saline and 100 ul of each of bacterial suspension was spread onto Phostrol-amended and non-amended LB and MM. Three plates per dilution and medium were performed.  Cultures on LB were incubated for 2 days before colony enumeration while MM plates were incubated for 3 days at 28°C.  Colony width (mm) was also measured to assay fitness of the bacterium. The bioassay for each strain on each medium was repeated twice.     Evaluation of PR-gene induction in Actigard and Phostrol treated trees   Experiments were conducted on 2-year old apple trees (Gala cultivar on M-9 rootstock; Hill-top Fruit Trees, Hartford MI).  Trees were grown in 11.3 L pots in a mixture of peat soil and sand and kept in the Michigan State University greenhouses until actively growing shoots were produced.  Selected trees were then placed outside and acclimated under natural conditions for approximately 1.5 wk before experiment initiation.  All treatment applications were made at a single time point and consisted of: Phostrol (foliar spray, 2 qt/A rate; Nufarm US, Alsip, IL), Actigard (foliar spray, 2 oz/A rate; Sygenta, Greensboro, NC), Actigard (soil drench, 0.1 g/500 ml water/tree), and a water, foliar spray control.  Foliar applications were sprayed until leaf run-off using a RL PROFLO XL- 3 gallon sprayer (Highland, CA).  Three trees per treatment were used, with two biological replicates. 96  Two or three of the youngest leaves from actively growing shoots/tree/treatment were collected at 0, 2, 5, and 7 days after treatment.  Leaves were immediately placed in liquid nitrogen and stored at -80°C until further processing.   RNA extraction was performed using the collective tissue from 2-3 leaves sampled/tree. Final analysis was used for 2 of the 3 trees replicated per treatment.  Approximately 0.1 mg of leaf tissue was removed from storage at -80°C immediately ground to a fine powder in a pre-cooled mortar and pestle using liquid nitrogen.  RNA was extracted using the Omega E.Z.N.A Plant RNA kit, according to manufacturer instructions, using the difficult sample type protocol (Omega Bio-Tek, Norcross, GA).  Remnants of any potential DNA contamination, which may create false positive or negative results, were removed using the Turbo DNA-Free Kit  DNase Treatment and Removal Agents (Ambion, Life Technologies; Carlsbad, NC).  Turbo-treated RNA was quantified (NanaoDrop 1000, Thermo Scientific, Wilmington, DE) and standardized to 100 ng/ul with RNAse/DNase-free water.  Standardized RNA was synthesized to complimentary DNA (cDNA) in a 50 ul reaction using the TaqMan® Reverse Transcription Reagents kit (Invitrogen, Life Technologies, Carlsbad, CA).     Real Time quantitative Reverse Transcription PCR (RT-qPCR) was performed using forward and reverse primer sets for the PR-1, PR-2, PR-8 proteins, and the actin gene, which served as the internal control, previously designed by Maxson-Stein et. al.(16). Isolate cDNA was amplified in triplicate using the Applied Biosystems StepOne Plus Real-Time PCR System with StepOne Software, version 2.3 (Grand Island, NY).  PR-protein expression was analyzed using the Relative Expression Software Tool (REST©) as described by Pfaffl et al (23).   Evaluation of Phostrol drenches in potted trees under controlled conditions and induction of PR-genes  Two year old, potted Gala trees, as described above, were used to ascertain PR-97  induction after soil drenched with Phostrol.  Trees were moved to a growth chamber and kept under controlled conditions of 25°C, a photoperiod of 16 h light/8 h darkness, with a light intensity of 65 mE. Trees were acclimated under these conditions for 1.5 wks before experiment initiation.  Three trees per treatment were used for the following experiment which was repeated twice.  Treatments consisted two sets of trees treated with a Phostrol drench (2 qt/A rate per 1 L of water), one set inoculated with Ea110 and the other non-inoculated, and a water-drench control.  Two drenches were applied, each 7 days apart.  A week after the second drench, shoot inoculations were performed on one set of the Phostrol-drenched trees.  Three actively growing shoots per tree were inoculated with Ea110 (5 x 108 CFU/ml) using the scissor-cut inoculation method (18).  Approximately 1 cm of tissue from the youngest leaf tip was cut using sterilized scissors dipped in the bacterial suspension.   As in the previous PR-protein experiment, 2-3 of the youngest leaves from actively growing shoots/tree/treatment were collected at specific time points to analyze the effect of drench applications and pathogen challenge in weekly intervals.  Leaves were sampled before the first drench (Day 0), before the second drench (Day 7), before the inoculation of one set of Phostrol-drenched trees (Day 14), and the following week (Day 21).  Leaves were immediately placed in liquid nitrogen and stored at -80°C until RNA extraction, DNA clean-up, and cDNA synthesis, and RT-qPCR was performed for PR-protein expression, as described above.     RESULTS Field trials for analysis of Actigard and Phostrol as supplemental products for control of fire blight   Three field trials were established in order to evaluate the supplementary effects of Phostrol applications in combination with a biological control agent or applied alone for fire 98  blight management.  Results in the first 2008 field trial indicated that under moderate disease pressure, Phostrol, when in combination of Serenade MAX provided adequate control of blossom and shoot blight but not as significantly as the antibiotic, Agrimycin.  During the second 2008 trial, the mixture of Phostrol and Serenade MAX or Phostrol alone provided similar control of blossom blight as Agrimycin but as disease pressure rose, Agrimycin performed significantly better for shoot blight control. Results in 2010 indicated that under high disease pressure, Phostrol, applied alone at either low or high rates, was not able to provide adequate control when compared to Agrimycin. The 2011 field trial included Phostrol applications at the low and high rate alone as well as, Actigard, applied either as a foliar spray or drench, in combination with high or low rates of the antibiotic formulation, Agrimycin.  Although disease incidence in 2011 was very low (30%) both rates of Phostrol and all combination treatments of Actigard were comparable to Agrimycin for control of blossom and shoot blight.   An additional three field experiments were performed to evaluate the efficacy of foliar applications of Actigard combined with low or high rates of Fireline (2012) and in combination with Kasumin (2013 a,b) for fire blight control (Table 4.1).  In 2012, all treatments either with Fireline alone at a high and low rate, provided the same disease control as Actigard when combined with the higher rate of Fireline, mimicking the results from the previous year when Actigard was combined with Agrimycin and again, under low disease pressure (<30%).  Two field trials comparing Actigard combinations with Kasumin and Kasumin alone showed in one of the studies, under decreased disease pressure, both Kasumin and Actigard alone did not significantly reduce blossom blight but were able to provide adequate control of shoot blight (2013a), while in the second experiment when disease pressure was high (50-60% 99  incidence) Actigard, when applied at the King bloom petal fall stage combined with two applications of Kasumin provided the same amount of blossom blight control as Kasumin applied alone.  However, evaluation of shoot blight showed that this combination and timing of Actigard and Kasumin provided the best control of any treatment (Table 4.1).  Table 4.1   Evaluation of fire blight symptoms (blossom blight and shoot blight) in field trial experiments performed at Michigan State University Plant Pathology and Horticulture Research Stations, East Lansing, MI.   Location County                     Orchard     no. a No.of isolates       assayed b No. of isolates with G143A Percent resistant per orchard Percent resistant      in 2008 c Southwest MI        Berrien 1 24 20 84    2 6 0 0    3 20 14 70     4d 5 14 25 2 4 14 16   Cass 6 7 8  9d 25 5 5 24 0 0 0 0 0 0 0 0   Van Buren 10 25 12 48   Allegan 11 25 21 84    12 23 20 87  Fruit Ridge        Ottawa 13 13 2 15    14 24 12 50    15 19 4 21    16 17 10 59    17 19 13 69    18 6 6 100    19 25 15 60 100  Kent 20 21 22 23 24 25 7 24 20 25 25 9 0 20 15 25 25 9 0 75 75 100 100 100    26 25 21 84 71   27 15 15 100 80   28 25 10 40    29 30 31 32 25 25 25 25 10 21 13 25 40 84 52 100 100  Ionia 33 22 17 77 57  Muskegon 34 35 12 24 12 24 100 100 100        100     Western MI  Oceana 36 25 25 100    37 25 25 100    38 25 25 100    39 40 41 42 43 44 45 46 47 23 24 24 25 25 24 24 19 15 23 6 24 25 19 24 24 12 15 100 25 100 100 76 100 100 63 100  Northwest MI        Manistee 48 8 2 25   Benzie 49 9 9 100   Grand Traverse  50 4 0 0   Leelanau 51 10 6 60    52 8 1 13  Central MI        Ingham  53d  54d  55e 17 19 18 0 0 1 0 0 6    Eastern MI        Lenawee 56 23 15 65   Monroe 57 58 7 21 3 11 43 52 27 42  Oakland 59 25 0 0 0   60 61 16 14 0 9 0 64 0  Macomb 62 63 16 15 0 0 0 0 0  Huron 64 25 25 100 100 OHIO       Cuyahoga Portage  65e  66e 24 18 0 0 0 0  Columbiana  67e  68e 25 19 0 0 0 0  a Treatments were replicated four times in single-tree plots. A range of 90-210 blossom clusters or shoots per tree were evaluated for blossom blight or shoot blight.   b Treatments were applied at 300 gal/A using a handgun at 300-350 psi.  Commercial products (active ingredients): Agrimycin 50WG® (streptomycin), Syngenta, Greenboro, NC; Serenade MAX® ( QST 713 strain, Bacillus subtilis), Bayer CropScience, Muskegon, MI; Phostrol® (phosphorous acid salts), NuFarm US, Alsip, IL; Actigard® (acibenzolar-S-methyl), Syngenta,   101  Table 4Greensboro, NC; Fireline® (oxyetracycline), AgroSource, Cranford, NJ; and Kasumin® (kasugamycin), Arysta LifeScience, Cary, NC.   c Trees were inoculated with a suspension of Erwinia amylovora, strain Ea110, using 3-gallon hand sprayer at 80% bloom during each experiment (RL PROFLO XL- 3 gallon sprayer, Highland, CA).  Inoculations during each year were made at the following concentrations on each apple cultivar: 2008a, 107 CFU/ml, 37-yr old Jonathan (Jonnee); 2008b, 107 CFU /ml, 13-yr old Gala; 2010, 106 CFU /ml, 31-yr old Jonathan () ; 2011, 105 CFU /ml, 10-yr old Gala; 2012, 105 CFU /ml, 11 yr-old ; 2013a, 5.0 x 106 CFU /ml, 12-yr old , and 2013b, 5.0 x 106 CFU /ml, 12-yr old .  d FB = full bloom; TC = tight cluster; King bloom PF = King bloom petal fall. e For each experiment, means within a column followed by the same letter are not significantly ).  Field analysis of Phostrol foliar applications for control of bacterial leaf spot on sweet cherry cultivars   Disease incidence and severity of bacterial leaf spot infection was assessed after a single application of Phostrol at the standard field rate of 2 qt/A.  Evaluation of control by Phostrol was observed on Cavalier and Ulster sweet cherry cultivars in both 2012 and 2013.  The incidence of leaf spot infection was not reduced as compared to the control in either trial but Phostrol application did significantly reduce leaf spot severity in 2012 (Figure 4.1).    In vitro analysis of a direct effect of Phostrol on strains of Ea110 and PssF55 on two media types  -inducer, an in vitro bioassay was performed in order to assess if Phostrol had any direct effect on the bacterial pathogens, E. amylovora strain Ea110 and P. syringe pv. syringae strain PssF55.  A dilution series was performed and populations of each strain were evaluated on nutrient rich LB and 102  nutrient poor MM media amended with 2, 4, and 6 qt/A label rates of Phostrol.  Results from the first Ea110 assay indicated no effect on the pathogen population on either LB or MM when subjected to any of the 3 rates of Phostrol as compared to the control.  In the second replicate experiment with Ea110 the pathogen was only inhibited by the highest rate of Phostrol at 6 qt/A (Figure 4.2).  Analysis of strain PssF55 showed no inhibition of the pathogen population when subjected to any rate of Phostrol and these results were consistent between replicate assays (Figure 4.2).  The fitness of each strain was evaluated by the measurement of colony diameter (mm) but the varying rates of Phostrol were not found to have any effect on colony size (data not shown).                  Figure 4.1 Application of Phostrol (2 qt/A ) for control of Pseudomonas syringae pv. syringae (Pss) leaf spot on 10-year old sweet cherry cultivars Cavalierand in A) 2012 and B) 2013.  Disease incidence and severity was assessed based on natural infection of Pss. Black bars represent the water-sprayed control, gray bars are Phostrol-treated trees.  A B Cavalier Cavalier Ulster Ulster a a b a a a a a a a a b a a a a Incidence Severity Incidence Incidence Incidence Severity Severity Severity Percent 103                        Mean log (x+1) CFU Mean log (x+1) CFU Phostrol rate of application Phostrol rate of application Mean log (x+1) CFU Mean log (x+1) CFU Phostrol rate of application Phostrol rate of application A B Figure 4.2 In vitro analysis of a direct effect of different Phostrol rates on the growth of Erwinia amylovora (Ea, strain Ea110; A) and Pseudomonas syringae pv. syringae (Pss, strain FF5; B), grown on two media types.  Black bars indicate growth on Luria-Bertani medium while gray bars show growth on minimal medium with 10 g of sucrose added.  Each plate bioassay for each bacterial strain on each medium was repeated twice.   104  Evaluation of PR-gene induction in Actigard and Phostrol treated trees  PR-protein -to 2-yr old potted Gala trees.  PR gene induction was analyzed across all treatments at 0, 2, 5, and 7 days after application.  Expression levels were similar among replicates for each treatment and were combined for each year, respectively. During the first experiment, PR-induction was not observed at high levels among the three PR-proteins tested.  The PR-1 gene after the foliar application of Actiard showed a slight trend of increased induction from day 0 to day 7 but expression levels were not high (Figure 4.3A).  Higher levels of PR-protein expression were observed in the second experiment, most notably for the PR-1 gene, in which overexpression was detected among all treatments (Figure 4.3B).  Actigard, applied either as a foliar spray or drench, induced PR-1 gene expression after trees were primed for 5-7 days.  Application of Phostrol elicited a rapid burst of PR-gene induction for all three genes tested, but expression was not observed 5 days after treatment (Figure 4.3B).          105                          A B Relative quantitative gene expression Days post-treatment PR-1 PR-1 PR-2 PR-2 PR-8 PR-8 Figure 4.3  Induction of PR-proteins in 2-application of  Phostrol (2 qt/A rate, black bars), foliar application of  Actigard (2 oz/A rate, light gray bars), and drench application of Actigard (0.1 g/500ml per tree, dark gray bars) in 2009 (A) and 2012 (B).   Phostrol Actigard foliar Actigard drench Phostrol Actigard foliar Actigard drench 106  Evaluation of Phostrol drenches in potted trees under controlled conditions and induction of PR-genes  Due to the short-lived induction of expression levels of PR-genes after Phostrol application to the leaves of 2-yr old potted Gala trees, analysis of PR-gene induction was assessed after drenching the soil of potted trees with Phostrol.  The main objective this study was to determine if Phostrol application to the soil would cause longer PR-induction and if pathogen challenge would further increase this expression.  Results from this study showed that all three PR-genes were induced after soil was drenched with Phostrol at a 2 qt/A rate.  Expression levels of all PR-genes were detected 7 days after the first drench as well as, 7 days after the second drench application.  The highest levels of expression were detected for PR-1 and PR-2 at the third sampling point (Figure 4.4).  The third time point indicates 14 days after the second drench for the non-inoculated trees, while 7 days after inoculated of the other Phostrol-treated trees.               107                         A PR-1 PR-2 PR-8 a b c a b c a b c B PR-1 PR-2 PR-8 a b c a b c a b c Relative quantitative gene expression Time points associated after Phostrol drenches and/or pathogen challenge and                                     specific PR-gene examined for induction * * * * * * * * * * Figure 4.4 Evaluation of PR-protein induction after two soil drenches of Phostrol (A) and/or pathogen inoculation with Erwinia amylovora (strain Ea110; B).  Leaf samples were collected 7 days after the first Phostrol drench (a), 7 days after the second Phostrol drench (b), and either a total of 14 days after the second drench (non-inoculated trees, (A) or 7 days after pathogen challenge (B, c).  Experiments were replicated twice and values combined for each treatment.  Asterisks above each column represent a significant expression ratio (P <0.05) from the reference gene Actin which is normalized at the value, 1.   108  DISCUSSION Although management of fire blight in Michigan orchards will to continue to rely on the application of antibiotics, our field studies indicated that Actigard and Phostrol can both supplement control programs during seasons with low to moderate disease pressure. When Actigard was combined with an antibiotic, either streptomycin or oxytetracycline, adequate control of blossom and shoot blight was attained in comparison to antibiotic application alone.  Phostrol, applied alone or in combination with a biological also provided effective management of blossom and shoot blight.  However, for both Actigard and Phostrol, these field effects on fire blight management were only observed during years of low to moderate disease pressure. Conversely, a single foliar application of Phostrol on sweet cherry did not significantly reduce the incidence of the leaf spot phase of bacterial canker, although disease severity was reduced in a single trial.  The application of Phostrol was made at 80% bloom, a timing that was targeted to reduce the P. syringae pv. syringae populations on flowers that serve as an inoculum source for leaf infection.  Perhaps more efficacious control of the bacterial canker leaf spot phase would occur if additional applications of Phostrol were made at later timings, and directly to leaf tissue.  Previous studies have shown that multiple applications of plant inducers and sufficient timing of applications are required in order to prime plant tissue for pathogen infection (8, 24).  Since populations of P. syringae pv. syringae are typically orders of magnitude larger on flowers than leaves, our strategy was to target flowers to potentially prevent a buildup of inoculum.  However, it is also possible that plant uptake of Phostrol would occur more readily through leaf tissue than through flower tissue. Studies with Actigard for fire blight control were initially performed in the 1990s with formulated rates showing effective control of 500 mg/l in one study (16) and a suggested 109  minimum rate of 100 mg/l in another for controlling shoot blight infection in apple seedlings (29).  Levels of blossom blight control significantly different from nontreated trees was demonstrated with three applications of Bion (European formulation of Actigard) during bloom bloom in a separate study under moderate disease pressure on pears (30). Economic considerations, especially if multiple applications of Actigard are needed, have necessitated a reassessment of Actigard for fire blight in this study at a use rate of 50 mg/l.  Our results suggest that Actigard has a place in a fire blight blossom blight control program in particular as a supplement to existing antibiotics and potentially in programs that would reduce the total number of antibiotic applications by one.  In cases with the antibiotics streptomycin or kasugamycin, which provide good to excellent blossom blight control, the incorporation of Actigard into the spray program may not increase blossom blight control to a level greater than use of the antibiotics alone.  However, when incorporated into a program in which the antibiotic oxytetracycline is used or potentially with biological control agents, Actigard can provide a boost in control that makes the overall program effective.  The caveat is that disease pressure must be low to moderate as under high pressure, we and others have observed that blossom blight disease control can be ineffective in Actigard programs. In this study, we confirmed that Actigard elicited PR gene induction in apple leaves when applied to the foliage.  In addition, we demonstrated a similar effect on PR gene induction by Phostrol when applied to the foliage and a greater induction effect when applied as a drench.  Phosphites (phosphonates), inorganic salts of phosphorous acid (H3PO3) have been known since the 1980s as effective disease control materials, particularly in the control of diseases caused by oomycete pathogens (5).  The mechanism of phosphites in disease control is either through direct 110  inhibition of the pathogen or through priming of defense responses in plants to pathogen infection. The role of phosphites in eliciting host defense responses as an inducer of systemic acquired resistance (SAR) has been characterized in several crop plants including potato (14, 22) and in Arabidopsis (4, 15).  This response includes the expression of genes and production of proteins consistent with an SAR response.  In this study, we used PR genes as a marker for SAR and demonstrated a rapid, short-lived response in apple to foliar application of Phostrol and an increased gene expression of longer duration in response to drench application.  We believe that this is the first report of PR-gene induction caused by Phostrol. Our study confirms a role for Actigard in the control of the blossom blight phase of fire blight at lower rates of 50 mg/l.  This SAR inducer could become an important component of an antibiotic resistance management program and could possibly have a use later in seasons in limiting shoot blight infection.  Although we did not find Phostrol to be particularly effective in controlling blossom blight when applied to flowers, analysis of PR gene expression indicated that drench treatments were more effective in eliciting a genetic SAR response in apple.  Further research will be needed to evaluate drench treatments, or other methods of delivery such as trunk injection, as potentially better methods for priming an SAR response in apple for fire blight management.       111             REFERENCES                      112  REFERENCES   1.  Balajoo, O. M., Kesahavarzi, M., Zahabi, A., Danesh, Y. R., and Haghjuyan, R. 2012       Protective effect of acibenzolar-S-methyl on fireblight severity in quince and characterization       of Erwinia amylovora strains involved. Journal of Plant Pathology 94:211-214.  2.  Chio, C.S. and Jones, A.L. (1993): Nucleotide sequence analysis of a transposon (Tn 5393)       carrying streptomycin resistance genes in Erwinia amylovora and other Gram  negative       bacteria. J. Bacteriol. 175:732  740.  3.  Cohen, Y. and Coffey, M. D. 1986. Systemic fungicides and the control of Oomycetes. Ann,        Rev. Phytopathol. 24:311-38.   4.  Eshraghi, L., Anderson, J., Aryamanesh, N., Shearer, B., McComb, J., Hardy, G. E., and       defence       genes in Arabidopsis thaliana infected with Phytophthora cinnamomi. Plant Pathology       60:1086-1095.   5.  Fenn, M. E. and M. D. Coffey. 1984. Studies on the in vitro and in vivo antifungal activity of        fosetyl-Al and phosphorous acid. Phytopathology 74:606-611.  6.  Graham, J. H. and Meyers, M. E. 2011. Soil application of SAR inducers imidacloprid,         thiamethoxam, and acibenzolar-S-methyl for citrus canker control in young grapefruit trees.       Plant Dis. 95:725-728.  7.  Guest, D. and Grant, B. R. 1991. The complex mode of action of phosphonates as antifungal       agents. Biol. Rev. 66:159-187.   8.  Hammerschmidt, R. 2004. Induced resistance: Mechanisms and practical applications. In:                9.  Hasaan, M. A. E. and Buchenauer, H. 2007. Induction of resistance to fire blight in apple by       acibenzolar-S-methyl and DL-3-aminobutyric acid. Journal of Plant Diseases and Protection       114:151-158.  10.  Johnson, K. B. and Stockwell, V. O. 1998. Management of fire blight: A case study in         microbial ecology. Annu. Rev. Phytopathol. 36:227-248.  11.  Kennelly, M. M., Carzorla, F. M., de Vicente, A., Ramos, C. and Sundin, G. W. 2007.         Pseudomonas syringae Diseases of fruit trees: Progress toward understanding control. Plant         Dis. 91:4-17.  12.  Longstroth, M. 2001. The 2000 fire blight epidemic in southwest Michigan apple orchards.  113        Compact Fruit Tree 34:16-19.    13.  Loper, J. E., Henkels, M. D., Roberts, R. G., Grove, G. G., Willet, M. J., and Smith, T. J.        1991. Evaluation of streptomycin and oxytetracycline and copper resistance of Erwinia        amylovora isolated from pear orchards in Washington State. Plant Dis. 75:287-290.  14.  Machinandiarena, M., F., Lobato, M., C, Feldman, M. L. Daleo, G., R., and Andreu, A. B.        2012. Potassium phosphite primes defense responses in potato against Phytophthora        infestans. Journal of Plant Physiology 169:1417-1424.   15.  Massoud, K., Barchietto, T., Le Rudulier, T., Pallandre, L., Didierlaurent, L., Garmier, M.,        Ambard-Bretteville, F., Seng, J-M., and Saindrenan, P. 2012. Dissecting phosphite-induced        priming in Arabidopsis infected with Hyaloperonospora arabidopsidis. Plant Physiology        159:286-298.   16.  Maxon-Stein, K., He, S.-.Y., Hammerschmidt, R., and Jones, A. L. 2002. Effects of treating         apple trees with acibenzolar-S-methyl on fire blight and expression of pathogenesis-related         proteins. Plant Dis. 86:785-790.   17.  McGhee, G. C., and Sundin, G. W. 2011. Evaluation of kasugamycin for fire blight         management, effect on nontarget bacteria, and assessment of kasugamycin resistance         potential in Erwinia amylovora. Phytopathology 101:192-204.  18.  McGrath, M. J., Koczan, J. M., Kennelly, M. M., and Sundin, G. W. 2009. Evidence that        prohexadione-calcium induces structural resistance to fire blight infection. Phytopathology        99:591-596.    19. McManus, P. S. and Jones, A. L. 1994. Epidemiology and genetic analysis of streptomycin-       resistant Erwinia amylovora from Michigan and evaluation of oxytretracycline for control.        Phytopathology 84:627-633.  20.  McManus, P. S., Stockwell, V. O., Sundin, G. W., and Jones, A. L. 2002. Antibiotic use in         plant agriculture. Annu. Rev. Phytopathology 40:443-465.  21. Ngugi, H. K., Esker, P. D., and Scherm, H. 2011. Meta-analysis to determine the effects of        plant disease management measures: Review and case studies on soybean and apple.         Phytopathology 101: 31-41.   22.  Olivieri, F. P., Feldman, M. L., Machinandiarena, M. F., Lobaro, M. C., Caldiz, D. O.,         Daleo, G. R., and Andreu, A. B. 2012. Phosphite applications induce molecular         modifications in potato tuber periderm and cortex that enhance resistance to pathogens. Crop         Protection 32:1-6.  23.  Pfaffl, M. W., Horgan, G. W., and Dempfle, L. 2002. Relative expression software tool         (REST©) for group-wise comparison and statistical analysis of relative expression results in         real-time PCR. Nucl. Acids Res. 30:e36 114   24.  Sarowar, S., Zhao, Y., Soria-Guerra, R. E., Ali, S., Zheng, D., Wang, D., and Korban, S. S.        2011. Expression profiles of differentially regulated genes during the early stages of apple        flower infection with Erwinia amylovora. Journal of Experimental Botany 62:4851-4861.   25.  Scortichini, M. and Ligouri, R. 2003. Integrated management of bacterial decline of           hazelnut, by using Bion as an activator of systemic acquired resistance (SAR). Pages 483-       487 in: Pseudomonas syringae and Related Pathogens. Kluwer Academic Publishers,        Dordrecht, The Netherlands.   26.  Steiner, P. 2000. Integrated orchard and nursery management for the control of fire blight.         Pages 339-358 in: Fire Blight: The Disease and Its Causative Agent, Erwinia amylovora. J.         L. Vanneste, ed. CABI Publishing, New York.   27.  Sundin, G. W., Jones, A. L., and Fulbright, D. W. 1989. Copper resistance in Pseudomonas          syringae pv. syringae from cherry orchards and its associated transfer in vitro and in planta           with a plasmid. Phytopathology 79:861-865.   28.  Sundin, G. W., Werner, N.A., Yoder, K. S., and Aldwinkle, H. S. 2009. Field evaluation of         biological control of fire blight in the eastern United States. Plant Dis. 93:386-394.    29. Thomson, S. V., Gouk, S. L., and Paulin, J. P. 1998a. Efficacy of Bion® (Actigard®) to        control fire blight in pear and apple orchards in USA, New Zealand, and France. Acta        Horticulture 489:589-595.  30.  Thomson, S. V., Brisset, M. N., Chartier, R., and Paulin, J. P. 1998b. Induced resistance in         apple and pear seedlings to fire blight by Bion® and correlation with some defense related         enzymes. Acta Horticulture 489:583-588.  31.  Wen, A. M., Balogh, B., Momol, M. T., Olson, S. M., and Jones, J. B. 2009. Management of         bacterial spot of tomato with phosphorous acid salts. Crop Protection 28:859-863.   32.  Werner, N. A., Heidenreich, G. E., and Aldwinkle, H. S. 2006. Field evaluation of SAR-        inducers for management of fire blight of apple, 2006. Plant Dis. Manag. Rep. Online          publication 62: doi:10.1094/FN61.