TEMPERATURE MODULATION OF SALICYLIC ACID-MEDIATED SIGNALING AND PSEUDOMONAS SYRINGAE PV. TOMATO DC3000 PATHOGENESIS IN ARABIDOPSIS THALIANA By Bethany Huot             A DISSERTATION Submitted to Michigan State University  in partial fulfillment of the requirements  for the degree of Cell and Molecular BiologyDoctor of Philosophy 2016             ABSTRACT TEMPERATURE MODULATION OF SALICYLIC ACID-MEDIATED SIGNALING AND PSEUDOMONAS SYRINGAE PV. TOMATO DC3000 PATHOGENESIS IN ARABIDOPSIS THALIANA By Bethany Huot A predominant issue of global concern is increasing agricultural output to meet the steady rise in global demand. One of the most significant challenges to meeting this objective is overcoming crop loss due to disease and adverse weather. While individual biotic and abiotic stresses are damaging to plants, they can have catastrophic affects when combined, as most often occurs in the field. It has long been observed that environmental conditions, such as temperature and humidity, play a determining role in the outcome of plant-pathogen interactions. Both low and high temperatures have been shown to promote disease depending on the pathosystem involved. Salicylic acid (SA) is a plant hormone important for protection against a broad spectrum of crop-relevant pathogens. However, the direct effect of elevated temperature on SA-mediated defense is unknown. The aims of the research described here were to determine 1) what impact elevated temperature has on SA biosynthesis and signaling, 2) whether observed effects are a direct result of temperature on the host or are also pathogen-dependent and 3) how observed temperature effects on the plant and pathogen interact to determine the final disease outcome. Using the model Arabidopsis thaliana and Pseudomonas syringae pv. tomato DC3000 plant-pathosystem, I present evidence demonstrating that loss of SA biosynthesis and enhanced delivery of bacterial type III effector (T3E) proteins into the plant cells at elevated temperature (30°C) both contribute to enhanced disease.    In the host, both SA biosynthesis and signaling are affected in a pathogen-independent manner resulting in enhanced susceptibility. Global transcriptome profiling revealed a temperature-sensitive bifurcation in the SA signaling pathway, with 66% of benzothiadiazole (BTH)-regulated genes, including ISOCHORISMATE SYNTHASE 1 (ICS1) and the widely-used SA marker genes PATHOGENESIS RELATED 1 (PR1), PR2 and PR5, showing compromised expression at 30°C. Surprisingly, BTH-mediated protection against disease is maintained at elevated temperature in spite of the loss of the temperature-sensitive PR1/ICS1 branch of SA-signaling. Exploration of a potential mechanism for SA-mediated protection revealed a novel role of SA in restricting translocation of bacterial T3E into host cells, as translocation was increased in SA-deficient mutants and reduced in BTH-treated plants at 23°C. However, there also seems to be a direct effect of temperature on the pathogen, as T3E translocation was increased more in response to elevated temperature than SA-deficiency. Taken together, these findings support a model whereby elevated temperature acts on both the host, resulting in loss of SA biosynthesis, and on the pathogen, resulting in increased secretion of T3E proteins into plant cells, to promote enhanced bacterial multiplication and disease. Provision of an SA signal, such as BTH, is sufficient to reduce translocation of effector proteins to confer protection against disease. As BTH is used commercially as a crop protectant, the discovery of preserved BTH-mediated protection at elevated temperatures is agriculturally relevant. Furthermore, exploration of the temperature-sensitive and -insensitive branches of SA signaling may also be used to inform genetic approaches to achieve plant resilience to disease under adverse environmental conditions.                         Copyright by BETHANY HUOT 2016  v                      This dissertation is dedicated to my family, Scott and Carla Caughel. I would not have achieved this without you.                       vi  ACKNOWLEDGEMENTS  I would like to acknowledge my professors, Dr. Sheng Yang He and Dr. Beronda L. Montgomery, for their mentoring and support during my Ph.D. Sheng Yang, you have been especially instrumental in helping me become more rigorous in my thinking and more focused in my writing. Thank you for seeing what I could do on my own and never doing it for me. Your ability to find and frame the most interesting story in a mess of data is truly inspiring. I hope I have learned something from you. Beronda, thank you for showing me that, as scientists, we have as much to offer outside as inside of the lab. Thank you especially for the many times you helped me see that stress is a reality of life, but cracking under the pressure is a choice. A big thank you to the He and Montgomery labs. The constant exposure to science outside of my research area that I received by participating in the Montgomery lab helped broaden my thinking and communication skills. The lively debates in the He lab meetings were also excellent training for developing critical thinking. I will definitely miss them. Dr. Jian Yao, for the technical expertise and training as well as unexpected friendship. Dr. André C. Velásquez, for being my trouble-shooting and venting partner after Jian left, and for constantly challenging me when I get hung up on inconsequential details. Dr. Sookyung Oh, for your kind and patient mentoring  and your friendship since. Emily Hubbard, for your hard work and stubborn commitment to improve. Dr. Christian Danve M. Castroverde, for helping me with final experiments while wrapping up my Ph.D. You truly were a life saver! Dr. Andi Busch and Dr. Xiufang Xin, for friendship in and outside the lab. Dr. Li Zhang, for being an awesome graduating buddy.  vii  A big thank you to the teachers and mentors I had outside of my lab  Dr. Rob Last, Dr. Rique Campa, Dr. Eva Farré, Dr. Robin Buell, Dr. Shinhan Shiu, Dr. Dan Jones, Dr. Diane Ebert-May, Melinda Frame and Dr. David Arnosti. Your guidance and support has been instrumental in my development over the last six years. I truly appreciate the extra effort you put into us graduate students and post docs. Thank you also, to Dr. Kevin L. Childs and Dr. Jane A. Pulman for helping guide me through the basics of RNA-sequencing analysis, and to Dr. Ken Tsuda for his contributions towards the RNA-sequencing data analysis. Thanks also to Jim Klug and Cody Keilen for their tremendous greenhouse support and all the PRL office ladies. Finally, I want to thank my friends and family for helping me through this long journey. Payam and Sabrina, for your help through a tough situation and your continued friendship. Gautam Shirsekar and Jane Devos, for the lengthy discussions and Arabidopsis hunting adventures. Jay Romick, for your friendship and  world. My Grandpa Huot, for teaching me how to tell stories that connect with people. My sister, Hannah, for helping with the house and yard chores when I was too busy. Carla, for wanting me in the family and doing so much to take care of us. Scott, for everything you have done to help me become the person I am today. Thank you for seeing my potential and believing in my ability to overcome seemingly insurmountable obstacles to achieve it.    viii  TABLE OF CONTENTS  LIST OF TABLES .............................................................................................................................. x LIST OF FIGURES ........................................................................................................................... xi KEY TO ABBREVIATIONS .............................................................................................................. xiii Chapter 1 ....................................................................................................................................... 1 Turning up the heat: the role of elevated temperature in plant-pathogen interactions ............. 1 Abstract ................................................................................................................................... 2 Introduction ............................................................................................................................ 3 Temperature is a key conditioning factor for plant disease ................................................... 6 Elevated temperature affects Pst DC3000 virulence ............................................................ 11 Plant perception and responses to elevated temperature .................................................. 12 Salicylic acid signaling in Arabidopsis ................................................................................... 16 Crosstalk with potential to suppress SA-mediated defense at elevated temperature ........ 19 Summary and conclusions .................................................................................................... 23  Chapter 2 ..................................................................................................................................... 24 Dual impact of elevated temperature on plant defense and bacterial virulence in Arabidopsis .. ..................................................................................................................................................... 24 Abstract ................................................................................................................................. 25 Introduction .......................................................................................................................... 26 Materials and methods ......................................................................................................... 29 Plant materials and growth conditions .............................................................................. 29 Temperature and chemical treatments ............................................................................. 29 Phytohormone extraction and quantification by liquid chromatography-tandem mass spectrometry (LC/MS) ........................................................................................................ 32 RNA extraction and qPCR ................................................................................................... 32 RNA sequencing and data analysis .................................................................................... 33 Callose accumulation ......................................................................................................... 34 Confirmation of a T-DNA knock-out allele for NPR1 ......................................................... 35 Preparation, selection and complementation analysis of transgenic lines ....................... 35 Disease and BTH protection assays ................................................................................... 36 Effector translocation assay ............................................................................................... 37 Nuclear fractionation and western blotting ...................................................................... 38 Confocal microscopy .......................................................................................................... 39 Statistical analysis .............................................................................................................. 39 Results ................................................................................................................................... 40 Elevated temperature causes loss of SA biosynthesis and enhanced disease susceptibility............................................................................................................................................ 40   ix  Enhanced disease at 30°C is correlated with increased pathogen virulence .................... 45 BTH-induction of SA accumulation, marker gene expression and callose deposition is impaired at 30°C ................................................................................................................ 47 The master regulator of SA-signaling, NPR1, retains nuclear localization at 30°C ............ 50 Discovery of temperature-sensitive and -insensitive sectors of the SA-regulated transcriptome .................................................................................................................... 55 JA, ET and ABA do not contribute to enhanced susceptibility at 30°C .............................. 69 Loss of CAMTA2 and CAMTA3 enables resistance but not recovery of SA biosynthesis at 30°C .................................................................................................................................... 73 Provision of an SA signal restores resistance to Pst DC3000 at 30oC ................................ 73 BTH-mediated protection against disease involves reduction in effector protein translocation ...................................................................................................................... 78 Discussion.............................................................................................................................. 79  Chapter 3 ..................................................................................................................................... 86 Future perspectives .................................................................................................................... 86 Strategies for identifying the component upstream of ICS1 responsible for loss of SA biosynthesis at elevated temperature .................................................................................. 88 Determining the mechanism for BTH-mediated restriction of T3E translocation ............... 90  APPENDICES ................................................................................................................................ 93 APPENDIX A: Additional data ................................................................................................ 94 APPENDIX B: Growth-defense tradeoffs in plants: a balancing act to optimize fitness ..... 100  LITERATURE CITED .................................................................................................................... 121      x  LIST OF TABLES  Table 1. Primer sequences used in this study ............................................................................. 31  Table 2. Subset of functional annotations for differentially expressed genes in RNA-seq dataset..................................................................................................................................................... 61  Table 3. Transcription factors implicated in regulation of genes within each cluster ............... 63  Table 4. RNA-seq differentially expressed genes involved in SA biosynthesis and/or signaling ..............67     xi  LIST OF FIGURES  Figure 1. Overview of Arabidopsis perception of and responses to Pst DC3000 ......................... 5 Figure 2. Pst DC3000- and temperature-induced hormone crosstalk with potential to suppress SA ................................................................................................................................................ 20  Figure 3. Morphological response of Arabidopsis plants to elevated temperature .................. 41  Figure 4. Increased susceptibility of Arabidopsis to Pst DC3000 at 30°C is correlated with a loss of SA marker gene expression and SA metabolite accumulation ............................................... 43  Figure 5. Enhanced growth of Pst DC3000 in planta at 30°C requires a functional type III secretion system and results in elevated levels of effector translocation ................................. 46  Figure 6. Elevated temperature does not affect bacterial growth at 6 hpi ................................ 46  Figure 7. BTH-induction of SA marker genes, SA metabolite accumulation and callose  deposition is compromised at 30°C ............................................................................................ 48  Figure 8. Characterization of npr1-6 knock-out and pNPR1::NPR1-YFP transgenic lines........... 51  Figure 9. BTH-induction of NPR1 nuclear localization is retained at 30°C ................................. 52  Figure 10. BTH-induction of NPR1 nuclear localization does not enable PR1 protein accumulation at 30°C .................................................................................................................. 54  Figure 11. The effect of elevated temperature on the BTH-regulated transcriptome .............. 56  Figure 12. Genevestigator analysis using publicly available microarray expression data of genes in response to biotic stress ......................................................................................................... 58  Figure 13. Genevestigator analysis using publicly available microarray expression data genes in response to SA/BTH or microbe-associated elicitors ................................................................. 59  Figure 14. Genevestigator analysis usingpublicly available microarray expression data of genes in response to heat stress ........................................................................................................... 60  Figure 15. Global transcriptome analysis of BTH-regulated genes reveals a temperature-sensitive bifurcation in the SA-signaling network ...................................................................... 65  Figure 16. Validation of RNA-seq gene expression patterns. ..................................................... 68  xii  Figure 17. CAMTAs contribute to enhanced susceptibility but are not responsible for loss of SA induction at 30°C........................................................................................................................... 71  Figure 18. BTH-mediated protection against Pst DC3000 persists at 30°C in the absence of PR1, ICS1 and SA metabolite accumulation .......................................................................................... 75  Figure 19. BTH-mediated protection at 30°C requires NPR1 and the TGA2, TGA5, TGA6 TFs and involves restriction of bacterial T3E ............................................................................................. 77  Figure 20. Model for Arabidopsis  Pst DC3000 interaction at elevated temperature ................ 84  Figure 21. Effect of temperature on SA marker gene induction in WT, npr1, coi1, myct2/3/4, and anac19/55/72 mutant plants ........................................................................................................ 95  Figure 22. PHYTOCHROME INTERACTING FACTORs (PIFs) are not involved in enhanced susceptibility or loss of SA marker gene induction at elevated temperature .............................. 96  Figure 23. DC3000-induction of ABA involves ABA2 but does not account for loss of SA ........... 97  Figure 24. BTH-mediated reduction of translocation of bacterial T3E proteins occurs at 30°C and requires NPR1 ............................................................................................................................... 98  Figure 25. Effect of elevated temperature on JA marker gene induction in WT, coi1, npr1 and pifq mutant plants......................................................................................................................... 99  Figure 26. Plant growth-defense trade-offs ............................................................................... 103  Figure 27. Known signaling contributing to growth-defense tradeoffs between PTI-mediated defense and auxin-, brassinosteroid (BR)- and gibberellin (GA)-mediated growth ................... 110  Figure 28. Known signaling contributing to growth-defense tradeoffs between salicylic acid (SA)-mediated defense and auxin-, brassinosteroid (BR)- and gibberellin (GA)-mediated growth ... 114  Figure 29. Known signaling contributing to growth-defense tradeoffs between jasmonate (JA)-mediated defense and auxin-, brassinosteroid (BR)- and gibberellin (GA)-mediated growth ... 117    xiii  KEY TO ABBREVIATIONS  ABA abscisic acid BTH benzothiadiazole COR coronatine DEG differentially expressed gene ET ethylene ETI effector triggered immunity JA jasmonate Pst  Pseudomonas syringae pv. tomato PTI pattern triggered immunity SA salicylic acid SAG glucosylated SA SAR systemic acquired resistance T3E type III effector T3SS type III secretion system TF transcription factor WT wild type 1  Chapter 1  Turning up the heat: the role of elevated temperature in plant-pathogen interactions                  A special thank you to Scott A. Caughel for help with the figures in this chapter.    2  Abstract One of the greatest challenges scientists face in the 21st century is how to increase crop yields to meet rising global food demands. This challenge is made more difficult by global changes in weather that may increase the severity of crop loss due to combined abiotic and biotic stresses. To meet these challenges, a more thorough understanding of how environmental factors affect the plant host, the pathogen and their interaction is needed. In this chapter, I outline some of the known effects of an important climate condition, elevated temperature, on plant-pathogen interactions, as well as relevant crosstalk between salicylic acid and other hormones, such as jasmonic acid, abscisic acid and auxin, that may be involved in determining the disease outcome under this condition.    3  Introduction It was the perfect storm  a genetically limited, susceptible host (potato), an exotic pathogen (Phytophthora infestans) and the cool, moist conditions ideal for sporulation. The outcome? A famine that ravaged Ireland from 1845 to 1852, killing a million people1. While not typical, severe crop losses due to biotic and abiotic stresses can be as high as 40% and 50%, respectively, even with modern disease prevention strategies2, 3. When these stresses are combined, the losses can be catastrophic, especially in poor and developing countries that often rely on a single staple crop as their primary source of nutrition1. Unfortunately, breeding efforts to optimize yield typically reduce genetic diversity, resulting in a general loss of crop plant resistance that will likely be exacerbated by adverse environmental conditions4. With global demand for food, fuel and other plant products on the rise, one of the primary challenges for plant scientists in the 21st century will be increasing crop yield in the face of increasingly severe and dynamic weather conditions1, 2. Most plant pathogens cause disease by secretion of virulence factors, such as effector proteins, into host cells to shut down basal plant defense responses5 (Fig. 1b). One of the most widely used methods of engineering crop resistance has been breeding for plant resistance (R) proteins, which function by recognizing, either directly or indirectly, the presence of pathogen effector proteins resulting in effector-triggered immunity (ETI)6. ETI is associated with a specific type of programmed cell death called the hypersensitive response (HR), and can result in a broad spectrum, long lasting systemic defense response, systemic acquired resistance (SAR)6. Because ETI involves recognition of a single effector protein by a single R protein, it is also -for- 4  7. The downside of this type of defense response is that the pathogen can, over time, modify or eliminate the avirulence gene to restore its virulence6.  Within the last several years a novel approach for engineering a longer-lasting, broad-spectrum resistance has been shown to be successful. This approach involves the introduction of pattern recognition receptors (PRRs) into crop plants to broaden their pathogen detection capabilities8. PRRs are membrane-localized receptors that activate defense responses, referred to as pattern-triggered immunity (PTI), upon detection of conserved microbial patterns, such as fungal chitin or bacterial flagellin9, 10 (Fig. 1b). PTI is transient and elicits a less intense defense response compared to ETI; however, because PTI involves recognition of conserved components, the pathogen cannot easily modify them to avoid detection6.  Activation of ETI or PTI results in the accumulation of defense-associated hormones, including salicylic acid (SA)11-13 (Fig. 1b). SA is important for both local and systemic acquired resistance against hemi/biotrophic microbes that feed from living plant tissues14. SA-mediated protection is broad-spectrumit is effective against various types of pathogens, including bacterial, viral, fungal and oomycete14. Examples of economically important pathogens against which SA provides protection are Fusarium graminearum, which is a fungal pathogen that causes blight in wheat, barley and maize15, 16; Ralstonia solanacearum, which is a bacterial pathogen that causes wilt in a large host range including potato and soybean17, 18; Xanthomonas oryzae pv. oryzae, which is a bacterial pathogen that causes blight in rice18, 19; and Phytophthora infestans, which is the oomycete responsible for late blight resulting in the Irish potato famine1, 20, 21.   5   Figure 1. Overview of Arabidopsis perception of and responses to Pst DC3000. (a) In an uninduced state, SA levels are low and NPR1 is sequestered in the cytosol via disulfide bonds between conserved cysteine residues. (b) Virulent strains of Pst DC3000 can be detected by PRR recognition of conserved microbial patterns, such as flagellin, to induce PTI. Pst DC3000 secretes type III effector proteins into the host cell to shut down plant defense responses. Avirulent strains of Pst DC3000 can be detected by host R protein recognition of specific bacterial effector proteins to induce ETI. Upon induction of either PTI or ETI, SA is produced in the chloroplast via the isochorismate pathway, and is then transported into the cytosol. Following SA accumulation, reducing conditions within the cytosol enable reduction of NPR1 disulfide bonds by thioredoxin activity. Upon monomerization, NPR1 protein accumulates in the nucleus where it interacts with various TGA and WRKY TFs to facilitate SA-dependent transcriptional reprogramming. PR proteins are produced and secreted into the apoplast (not shown) where they presumably inhibit bacterial multiplication.     6  Due to its broad-spectrum protection, activation of SA-mediated defense, either through genetic modifications of plants or application of the SA synthetic analog, benzothiadiazole (BTH), has been shown to be an effective crop protection strategy22-25. However, the resilience of this important pathway to the combination of an important climate condition, elevated temperature, and pathogen stress is unknown. The purpose of this dissertation research is to improve our understanding of how elevated temperature affects SA biosynthesis and signaling, with the hope that this information may prove useful in developing strategies for robust crop resistance under increasingly dynamic environmental conditions.  To explain the basis for specific approaches and lines of inquiry pursued during this research project, this literature review will provide 1) examples of temperature affects on plant diseases for which SA-mediated defense is known to be important, 2) what is known regarding the effect of elevated temperature on pathogen growth and virulence, 3) a brief background regarding plant responses to elevated temperature and 4) possible hormonal crosstalk that may be important in the context of disease progression at elevated temperature.  Temperature is a key conditioning factor for plant disease all approffects on plant disease as conditions that cause disease in one pathosystem may not in another26. In 1928, Dickson and Holbert described the effect of temperature on disease progression in two major crop plants  wheat and maize27. Using the same fungal pathogen, F. graminearum, to infect both plant species, they discovered that temperature played a determining role in the disease outcome; however, the temperature range favoring disease varied. Wheat, which has an optimal growing temperature of 4°C to  7  12°C, was resistant to the fungus around 8°C and susceptible at temperatures above 12°C. On the other hand, maize, which has an optimal growing temperature of 20°C to 24°C, was resistant at temperatures above 24°C and susceptible at temperatures below its optimal growing temperature range. Further investigation into this phenomenon revealed that the cellular composition of the wheat and maize cells was similarly altered when grown outside of their optimal temperature ranges. In both cases, cells had a reduction in cell wall reinforcement, enabling higher penetration efficiency of the fungus, and higher levels of carbohydrates shown to enable optimal growth of the fungus in vitro27. In this 1928 study, the authors cite similar observations for enhanced disease potential of temperature27. In these cases, all the plant species assessed were more susceptible at elevated temperatures, but the temperature threshold was shifted up depending on the optimal growing temperature of the plant. For example, cotton and tomato, which are both high temperature grown plants, have a 5°C higher threshold of resistance to fungal wilt than the low temperature plants, flax and cabbage27. A more recent study investigating the effect of environmental conditions on sporulation and lesion expansion caused by the fungal pathogen Cercospora zeae-maydis in maize found that both were greater at 25°C and 30°C relative to either 20°C and 35°C28.  The phenomenon of enhanced disease at elevated temperature is not restricted to fungal infections. In fact, some of the earliest temperature-related studies were done to improve methods for infecting tobacco with viral pathogens for the purpose of studying this specific plant-pathogen interaction29, 30. One study assessed the effect of pre- and post-incubation of Nicotiana glutinosa plants at elevated temperature (36°C) infected with five different viruses.  8  Although the disease outcome varied for each virus when plants were infected first and then incubated at elevated temperature, increased host susceptibility to all five viruses was observed following pre-incubation at elevated temperature30. Both resistant and susceptible sweet potato varieties as well as cotton have been observed to be more susceptible to nematode infection at elevated temperatures (28°C, sweet potato; 35°C, cotton)31, 32, and Arabidopsis thaliana (hereafter Arabidopsis) and Nicotiana benthamiana have been shown to be more susceptible to both bacterial and oomycete pathogens in this temperature range as well33-35.  Within the last ten years, a series of studies from the Hua lab have begun to uncover the molecular mechanisms underlying host susceptibility at elevated temperature specific to R protein-mediated defense. The first study identified that the dwarf plant and disease resistance phenotypes of the bonzai1 (bon1) mutant were due to constitutive activation of the R gene, SUPPRESSOR OF NPR1-1, CONSTITUTIVE1 (SNC1)34. Both the growth and defense phenotypes were suppressed by crossing the bon1 mutant with mutants compromised in SA-mediated defense or by growing plants at temperatures above 28°C34. They next explored the effect of elevated temperature on both basal defense and ETI, and found both to be compromised; however, the temperature-sensitive component resulting in enhanced susceptibility remained elusive35.  To gain further insight regarding the temperature-sensitive component in ETI, the snc1 and bon1 constitutive defense mutants were each mutagenized and the resulting populations screened for retention of disease resistance at elevated temperature. Based on characterization of one of these mutants, Zhu and colleagues (2010) identified that loss of SNC1 nuclear  9  localization at elevated temperature was likely responsible for loss of disease resistance associated with this protein36. A specific mutation within the SNC1 gene restored both SNC1 nuclear localization and disease resistance at 28°C36. Interestingly, a similar mutation within the NECROSIS (N) gene also enabled HR in Nicotiana tobaccum when co-expressed with a viral elicitor protein at 30°C, indicating that loss of R protein nuclear localization may be an important underlying cause and that naturally occurring genetic variants or genetic modification may be used to overcome it36. Another mutant identified as retaining disease resistance at elevated temperature was found to be affected in the ABA biosynthetic gene, ABA237. ABA deficiency caused by this mutation enabled increased nuclear accumulation of both the SNC1 and RPS4 R proteins at 28°C, indicating a role for ABA in loss of R protein nuclear localization at elevated temperature37. However, ABA signaling mutants did not have the same effect, making the role of ABA in suppression of R proteins unclear37. In addition to protein localization, transcription of several R genes is suppressed at elevated temperatures, suggesting there are multiple levels of inhibition of ETI in response to this environmental condition38, 39.  It is interesting to note that R proteins in every category have been found to be temperature-sensitive, indicating this may be a conserved trait. The majority of R proteins contain nucleotide-binding and leucine-rich repeat (NB-LRR) domains, and are further categorized based on the presence of a Toll interleukin 1 receptor homology (TIR) or coiled-coil (CC) domain40. Wang and colleagues (2009) showed loss of HR-induction and disease resistance mediated by three TIR-NB-LRRs  N, SNC1 and RESISTANCE TO PSEUDOMONAS SYRINGAE4 (RPS4)  and three CC-NB-LRRs  RESISTANCE TO P. SYRINGAE PV MACULICOLA1 (RPM1), RPS2 and Rx35. Temperature-sensitivity has also been observed for the CLADOSPORIUM FULVUM4  10  (Cf-4) and Cf-9 R proteins41, which are LRRs with transmembrane domains (LRR-TM), and RESISTANCE TO POWDERY MILDEW8 (RPW8)33, which is a TM-CC R protein. However, based on the studies discussed here, the effect of temperature on disease outcome is affected by the pathosystem involved, the temperature used and the length and timing of temperature exposure. For example, Wang and colleagues (2009) observed loss of both HR and disease resistance in Arabidopsis infected with Pst DC3000 carrying AvrRpt235. In this study, they used 3-week-old plants acclimated for one week to elevated temperature (28°C) for HR assays and 10 to 14-day-old seedlings grown at constant elevated temperature for disease assays35. Conversely, a more recent study using a 24 h acclimation period to elevated temperature (30°C) showed loss of HR but retention of disease resistance in Arabidopsis plants infected with Pst DC3000 carrying either HopZ1a or AvrRpt242.  The temperature-sensitivity of N-mediated resistance in tobacco was used to correlate plant resistance to an avirulent pathogen with induction of SA, which was prevented when infected plants were kept at 32C and was dramatically elevated upon shifting plants back to 22C43. However, as the N protein has since been shown to be temperature-sensitive in terms of nuclear localization36, it is likely that loss of SA in these cases is an indirect effect of temperature on the R protein behavior. The few studies specifically investigating the effect of elevated temperature on SA signaling and resistance show conflicting results depending on whether plants were kept at elevated temperature for the duration of the experiment or not. For example, exogenous application of aspirin (acetylsalicylic acid) or SA to tobacco plants at 32C conferred protection against tobacco mosaic virus in both resistant and susceptible cultivars, as measured by lesion size after shifting plants back to 20C44, 45. However, in another  11  study, exogenous application of aspirin to tobacco did not provide protection when plants were kept at 32C46. The effect of elevated temperature on PTI (a major component of basal defense) was also investigated recently47. Several PTI-associated defense responses, including marker gene induction and MAP kinase phosphorylation, appear to be enhanced rather than suppressed at elevated temperatures47. This has been suggested to result from plant adaptation to temperature-regulation of plant pathogens, whose growth (and therefore production of PAMPs) is generally enhanced at elevated temperatures47. Elevated temperature affects Pst DC3000 virulence Due to the differential effects of temperature on various plant pathogens, I focus here on what is known regarding the effect of elevated temperature on aspects relevant to Pseudomonas syringae pv tomato (Pst) DC3000 that I studied. The basic life cycle of Pst DC3000 begins with a brief epiphytic stage on the leaf surface followed by entry into the leaf interior via natural openings, such as stomata, or wounds48. Pst DC3000 multiplies in the intercellular spaces within the leaf, and successful colonization requires the use of various virulence factors 48. Two important virulence mechanisms used by Pst DC3000 involve the phytotoxin coronatine (COR), which mimics the hormone JA-isoleucine (JA-Ile), and the type III secretion system (T3SS), which is used to secrete bacterial type III effectors (T3E) into plant cells48. COR is a polyketide comprised of coronafacic acid (CFA) and coronamic acid (CMA), and genes involved in COR biosynthesis are encoded in the cfa and cma operons, respectively48. Infiltration of tomato plants with a COR-deficient strain showed necrosis but no chlorosis, indicating that COR is important for this disease symptom development49. The T3SS is a syringe-like structure comprised of multiple components encoded by the hrp (hypersensitive  12  response and pathogenicity) and hrc (hrp conserved) genes50. Loss of the hrcC gene prevents assembly of the T3SS apparatus50. Although COR production is still present in a Pst DC3000  mutant strain, it is considered a non-pathogenic strain due to its inability to multiply and cause normal disease symptoms49  A majority of studies show a negative impact of elevated temperature on bacterial virulence51. For example, production of COR was found to be negatively affected in P. syringae pv. glycinea grown at elevated temperature (28°C) due to a down-regulation of COR biosynthetic gene expression as well as a decrease in stability of COR biosynthetic proteins52. Similarly, down-regulation of hrp genes in Erwinia amylovora and decreased secretion of T3E proteins by P. syringae strains were both observed at 28°C and 30°C, respectively53, 54. However, as these studies were done in vitro, it is possible they do not reflect what occurs within the plant. For example, a study using a promoter-reporter system to assess expression of COR biosynthetic genes in planta showed that induction of these genes was impaired at elevated temperature in P. syringae pv. glycinea but not in Pst DC300055. Additionally, bacterial genes involved in auxin biosynthesis were observed to be upregulated at elevated temperature in P. syringae pv. syringae56. Auxin and other growth hormones are known to be used by plant pathogens to suppress host immune responses57; therefore, more information is needed to determine the effect of elevated temperature on bacterial virulence within the host. Plant perception and responses to elevated temperature Plants have the ability to sense temperature changes as small as 1C, and there is evidence to support the role of active signaling vs. temperature-induced changes in enzymatic activity in regulating plant responses to temperature58. Based on responses in Arabidopsis, temperature  13  ranges are typically categorized as warm ambient (22C to 27C), moderately elevated or high (27C to 30C) and extremely high or heat shock (37C to 42C)59. Some of the known temperature-induced changes include alterations in membrane fatty acid composition to regulate membrane fluidity, as well as temperature-sensitive exclusion of the histone variant, H2A.Z, to facilitate transcriptional responses affecting cell elongation and flowering time60, 61. Although many of these temperature-induced responses have been well characterized, the identity of the plant temperature sensor(s) has been an outstanding question until now. Two recent studies showed that, in addition to its role as a photoreceptor, phytochrome B (phyB) also functions as a temperature receptor62, 63.  Phytochromes are red/far-red light photoreceptors in plants that exist in two interconvertible forms, an inactive, red-light (R ~660 nm) absorbing form (Pr) and an active, far-red light (FR ~ 730 nm) absorbing form (Pfr)60. It was recently shown that the spontaneous reversion of the light-activated Pfr form to the inactive Pr form is accelerated in response to increased ambient temperature, resulting in a reduction in both the pool of active PhyB and its localization to nuclear bodies63. Systematic analyses of wild type, phyB deficient and phyB thermo-stable plants under different light and temperature conditions were used to demonstrate the dual function of phyB as both a light and temperature receptor in plants63.  Dual functionality of phytochromes was previously hypothesized based on similar morphological and developmental changes in Arabidopsis in response to vegetative shade and elevated temperature, including elongation of the hypocotyl and petioles, raising of the petioles (hyponasty) and accelerated flowering58, 60, 64, 65. These responses are regulated by several PHYTOCHROME INTERACTING FACTORs (PIFs), with PIF4 playing a major role in response to  14  elevated temperature66, 67. PhyB negatively regulates PIFs to restrict hypocotyl growth and promote cotyledon expansion upon transitioning from dark to light conditions68. It was recently shown that PhyB represses the expression of PIF1-, 3-, 4- and 5-regulated genes by binding to the same G-box cis element within gene promoters62. However, PhyB promoter-binding was diminished at elevated temperature (27C) due to the accelerated depletion of active PhyB in warm temperature conditions, thereby resulting in a de-repression of PIF-activated genes62.  At ambient temperatures (17C), PIFs are suppressed in a fluence-dependent manner by the LONG-HYPOCOTYL 5 (HY5) TF, resulting in a reduction in hypocotyl length with increasing fluence rates67. However, at elevated temperature (27C), PIF-mediated hypocotyl elongation is promoted with increasing fluence due to accumulation of auxin67. PIF4 binding to promoters of auxin biosynthetic genes, including YUCCA 8, is increased at elevated temperatures, resulting in an increase of free indole-3-acetic acid (IAA)69-71. Additionally, a recent study showed that the co-chaperones, HEAT SHOCK FACTOR 90 (HSP90) and SUPPRESSOR OF G2 ALLELE SKP 1 (SGT1) physically interact with the auxin co-receptor, TRANSPORT INHIBITOR REPONSE 1 (TIR1), resulting in stabilization and accumulation of the TIR1 protein at elevated temperature72. The combination of increased PIF4-mediated auxin biosynthesis and HSP90-SGT1-mediated TIR1 stability at elevated temperature enable up-regulation of auxin signaling and promotion of cell elongation and extension under this condition. Two other growth-promoting hormones, gibberellins (GA) and brassinosteroids (BR) have also been implicated in morphological responses to elevated temperature, although to a somewhat lesser extent than auxin73. The positive role of GA most likely occurs via removal of the growth-repressing DELLA proteins, which are known inhibitors of PIFs74, whereas the BR TF, BZR1, has been shown to physically  15  interact with PIF4 to co-regulate nearly 2,000 genes73. Among the genes co-regulated by BZR1 and PIF4 are the family of PACLOBUTRAZOL RESISTANCE (PRE) helix-loop-helix factors75, which are positive regulators of cell elongation in Arabidopsis76.   Plants exhibit both basal and acquired tolerance to heat shock, and various hormones have been shown to contribute to both77. SA was found to be important for basal thermotolerance based on increased electrolyte leakage, reduced seedling survival and increased oxidative damage in mutants compromised in either SA accumulation or signaling relative to wild type plants78, 79 . Plants treated with SA or mutants with elevated endogenous SA exhibited increased basal thermotolerance, further supporting a role for SA in this response. ET and abscisic acid (ABA) were also shown to contribute to basal thermotolerance, although ABA seems to play a larger role in acquired thermotolerance79. The role of SA in acquired thermotolerance is a bit unclear. In two separate studies, mutants compromised in either SA accumulation or signaling were evaluated to determine a role of SA on acquired thermotolerance. In the first study, SA accumulation and signaling were determined to not be required for acquired thermotolerance based on hypocotyl elongation and electrolyte leakage similar to wild type plants following temperature acclimation and heat stress treatments78. However, the authors of the second study concluded SA may play a minor role in acquired thermotolerance based on impaired seedling survival and increased oxidative damage in the SA mutants relative to wild type plants following temperature acclimation and heat shock treatment79.     16  Salicylic acid signaling in Arabidopsis SA is a phenolic hormone shown to affect many plant processes including growth, development, senescence and stress responses12, 80. While SA is generally credited for its role in biotic stress responses, it has also been shown to alleviate oxidative stress caused by adverse abiotic conditions, such as drought and salinity80, 81. Both freezing and heat shock conditions induce SA biosynthesis78, 82, 83. Although SA accumulation was shown to not be required for freezing tolerance84, it has been shown to potentiate thermotolerance as described above78, 79, 85. However, the effect of SA on plant tolerance to most abiotic stresses is concentration dependent, with low concentrations of SA alleviating oxidative stress and high concentrations of SA, such as occur in response to biotic stress responses to facilitate cell death, exacerbating abiotic stress tolerance80, 81.  Plant biosynthesis of SA occurs in the chloroplast via modification of a chorismate precursor through either the PHENYLALANINE AMMONIA LYASE (PAL) pathway or the ISOCHORISMATE SYNTHASE (ICS) pathway86. SA levels rise significantly in both local and systemic tissues following induction of either PTI or ETI12, 87, 88, and roughly 90% of this increase is due to ICS1 activity89. Free SA is quickly metabolized in the cytoplasm, primarily by conjugation with glucose (SAG), and sequestered in the vacuole90. Experiments using plants genetically altered in SA biosynthesis or accumulation as well as wild type plants treated with pathogen or exogenous application of SA have shown that SA is required for full induction of local resistance and is also both necessary and sufficient for establishment of SAR88, 89, 91-93.   Multiple components, including the lipase like proteins PHYTOALEXIN DEFICIENT 4 (PAD4)94, 95 and ENHANCED DISEASE SUSCEPTBILITY 1 (EDS1)96, 97, the CAM-BINDING PROTEIN 60-LIKE G  17  (CBP60g) and SAR DEFICIENT 1 (SARD1) proteins98, and the WRKY28 TF99 have been shown to positively regulate ICS1 gene expression to promote accumulation of SA. CALMODULIN-BINDING TRANSCRIPTION ACTIVATORS (CAMTAs) are negative regulators that modulate SA biosynthesis in a temperature-dependent manner84, 100. Whereas CAMTA-mediated suppression of SA accumulation is alleviated by long-term (1-week) exposure to low temperatures (4°C)84, the dwarf phenotype of the camta3 mutant, which was shown to be associated with elevated basal SA, was restored to wild type by growing plants at an elevated temperature (25°C to 27°C)100. CAMTA3 was shown to directly suppress two positive regulators of SA biosynthesis, EDS1 and NON RACE-SPECIFIC DISEASE RESISTANCE 1 (NDR1), by binding to their gene promoters100, 101. Although up-regulation of CBP60g, SARD1 and ICS1 gene expression was correlated with both cold-induced de-activation and genetic removal of CAMTA TFs, it is unclear whether CAMTAs act directly or indirectly to regulate expression of these genes. However, a possible mechanism for indirect regulation may be via CAMTA3-mediated promotion of ETHYLENE INSENSITIVE 3 (EIN3) gene expression101. EIN3 and EIN3-LIKE 1 (EIL) are both negative regulators of ICS1 gene expression, with EIN3 functioning by directly binding to the ICS1 gene promoter102.  Multiple genetic screens led to the identification of NONEXPRESSOR OF PATHOGENESIS RELATED PROTEINS 1 (NPR1, aka NIM1, SAI1), which is a key regulator of SA signaling103-106. In the non-induced state, NPR1 proteins oligomerize in the cytoplasm due to S-nitrosylation of highly conserved cysteine residues resulting in the formation of intermolecular disulfide bonds107. Cellular redox changes in response to SA accumulation activate cytoplasmic thioredoxins, which reduce the disulfide bonds to release active NPR1 monomers that then  18  translocate to the nucleus and activate defense gene expression107-109. Nuclear localized NPR1 is phosphorylated and poly-ubiquitinated by the CULLIN 3 (CUL3) E3 ubiquitin ligase complex resulting in its degradation by the 26S proteasome110. This process of NPR1 protein turnover is promoted during SAR and is required for full induction of NPR1-mediated transcriptional reprogramming110. After years of searching, two recent studies have proposed NPR1 and its paralogs, NPR3 and NPR4, to act as SA receptors111-113. NPR3 and NPR4 function as adaptors for the CUL3 ubiquitin E3 ligase, with NPR4 serving to remove NPR1 to prevent defense gene activation when SA levels are low and NPR3 facilitating NPR1 turnover when SA levels are high111. Specific post-translational modifications of the NPR1 protein regulate its interactions with NPR3 and NPR4 and help switch its role from a transcriptional repressor to a transcriptional activator depending upon accumulation of SA114. NPR1 regulates gene expression through physical interaction with TGA transcription factors (TFs), which bind to promoters of PATHOGENESIS RELATED (PR) genes to activate expression in the presence of SA and repress expression in the absence of SA13, 115. PR genes encode small proteins, some of which have been shown to possess antimicrobial or antifungal properties in vitro116. Of the many PR genes identified, PR1, PR2 and PR5 have been shown to be induced by SA and have long been used as markers of SA signaling in Arabidopsis13. Other genes identified as direct targets of NPR1 include WRKY TFs and components required for the synthesis and secretion of PR proteins117. WRKYs are involved in both NPR1-dependent and NPR1-independent SA signaling and, as in the case of PTI, include both positive and negative regulators of SA-mediated defense117-119.     19  Crosstalk with potential to suppress SA-mediated defense at elevated temperature As sessile organisms, plants must perceive, integrate and respond appropriately to multiple environmental and developmental cues for successful growth and reproduction57, 120. Both spatial and temporal modulation of various hormones, calcium and other signals enables fine-tuning of these responses121, 122. Due to the need for this delicate and dynamic balance, there are examples of both synergistic and antagonistic interactions between SA and other hormone-signaling pathways123. Here I will discuss negative crosstalk between SA and auxin, JA and ABA, with an emphasis on specific examples of Pst DC3000 hijacking of plant hormone signaling to shut down SA biosynthesis and signaling.  Negative crosstalk between SA and growth-promoting hormones, such as auxin, are best illustrated by the dwarf plant phenotype typical of mutants with constitutively elevated SA124, 125. Application of SA analogues, such as BTH, or extended exposure to cold temperatures are also known to inhibit growth due to elevated SA biosynthesis and/or signaling83, 126. However, the dwarf phenotype associated with constitutive SA mutants is typically lost at elevated temperature due to a loss of SA accumulation under these conditions127. As described above, auxin plays a primary role in response to elevated temperature; therefore, it is possible that up-regulation of auxin biosynthesis and signaling may contribute to suppression of SA-regulated responses under this condition (Fig. 2). SA-mediated defense has been shown to be affected by auxin, as transgenic overexpression of the AFB1 gene, which enhances auxin signaling, led to a reduction in pathogen-induced SA biosynthesis relative to wild type plants128. However, transgenic overexpression of the YUCCA 1 gene showed that elevation of auxin levels alone can promote plant disease without affecting SA levels or signaling129.  20   Figure 2. Pst DC3000- and temperature-induced hormone crosstalk with potential to suppress SA. ICS1 gene induction results in increased SA biosynthesis, which activates NPR1. NPR1 interaction with TGAs and other TFs facilitates SA-dependent transcriptional reprogramming. Both ABA and auxin are up-regulated in response to elevated temperature (depicted with sun). In the case of auxin (white with brown outline), the H2A.Z histone variant (black ball) is excluded from nucleosomes as temperatures rise, enabling increased PIF4 gene expression. The PIF4 TF binds the YUCCA 8 gene promoter to enhance its expression, resulting in auxin biosynthesis and signaling. Increased auxin levels result in hypocotyl and petiole elongation, as well as leaf hyponasty as shown by the Arabidopsis plant in the insert. This plant was grown at 23°C, shifted to 30°C at 2-weeks-old and photographed 4 d later. Pathogen produced auxin (blue with white outline) may also contribute to suppression of SA via unknown mechanisms. ABA inhibits SA both upstream and downstream of its biosynthesis. It is possible that ABA inhibition of SA upstream of NPR1 occurs via MYC2, however, this has not been shown. ABA also inhibits NPR1 gene expression and NPR1 protein stability to suppress SA-mediated signaling. T3E-induction of ABA biosynthesis occurs by induction of NINE-CIS-EPOXYCAROTENOID DIOXYGENASE 3 (NCED3) gene expression, possibly due to AvrPtoB activity. COR-induction of MYC2 occurs in a CORONATINE INSENSITIVE 1 (COI1)-dependent manner, and results in upregulation of three ANAC TFs, which bind the ICS1 gene promoter to suppress its expression. In addition, two T3E proteins, HopZ1a and HopX1, target the JASMONATE ZIM-DOMAIN (JAZ) repressor proteins to relieve suppression of JA-mediated signaling to enable suppression of SA-mediated defense. Solid lines depict confirmed, direct connections, whereas dashed lines depict indirect/multiple or missing/unknown steps between components. Bent arrows next to DNA molecules depict gene promoters. Arrowheads show positive and blunted lines show negative interactions. Circles depict metabolites, hexagons depict TFs.   21  Auxin positively regulates expansins, which are involved in cell wall loosening, to promote growth130, 131, and the ability of Xanthomonas oryzae pv. oryzae to induce expansins in rice was shown to be important in determining the outcome of the plant-pathogen interaction131. In fact, many pathogens, including P. syringae and Agrobacterium tumefasciens, can directly synthesize auxin or manipulate auxin synthesis and signaling in plants to promote disease132 (Fig. 2). Microorganisms primarily synthesize IAA from tryptophan, and, in some cases, the genes encoding the enzymes required for this process are located on a pathogen virulence plasmid 133. Analysis of plant transcriptional reprogramming following some pathogen infections has shown a general de-repression of the auxin pathway including promotion of auxin biosynthetic genes and repression of AUX/IAA genes resulting in enhanced plant susceptibility134, 135. Furthermore, virulence of Pst DC3000 can be enhanced by treatment with synthetic auxins prior to pathogen inoculation136, 137. Together these studies indicate a dual function for auxin in direct interference with SA-mediated defense and in positive regulation of physiological changes that aid pathogen proliferation in the plant. Pst DC3000 employs various other virulence mechanisms to specifically target and suppress SA. Because of their specialized functions, signaling regulated by SA and JA/ET is generally antagonistic121, 138. JA-Ile is perceived by a co-receptor complex formed with the F-box protein CORONATINE INESENSTIVE 1 (COI1) and the JASMONATE ZIM-DOMAIN (JAZ) family of transcription repressors139. The JAZ-family proteins repress JA signaling by directly binding to the MYC family of TFs required for the expression of JA-responsive genes140-142. An increasing concentration of JA-Ile promotes physical interaction between COI1 and JAZ proteins, which leads to ubiquitination and subsequent degradation of JAZs through the 26S proteasome,  22  thereby relieving the repression on MYC TFs and initiating the expression of JA-responsive genes140, 141, 143. One of the best examples of SA-JA antagonism is the use of COR by Pst DC3000 to activate JA signaling. COR is more efficient than JA-Ile in promoting interaction between COI1 and JAZ proteins, resulting in MYC2 activation143, 144. MYC2 then induces the expression of several genes encoding ANAC TFs, which bind to the ICS1 promoter to suppress its expression, resulting in loss of SA accumulation144. In addition, two T3E proteins, HopZ1a and HopX1, directly target and promote degradation of JAZ repressor proteins to activate JA signaling resulting in suppression of SA-mediated defense145, 146.  MYC2 is also involved in ABA-mediated responses, which are also targeted by Pst DC3000 to suppress SA147, 148. ABA is considered the primary hormone associated with abiotic stress tolerance149. Although examples of synergism between SA and ABA exist, such as in pathogen-induced stomatal closure150, interactions between these two pathways are generally antagonistic. For example, SA-mediated defense was increased in tomato mutants with reduced ABA151, whereas exogenous application of ABA resulted in enhanced susceptibility to pathogens in both tomato and Arabidopsis151-153. The use of chemicals that induce SA signaling either upstream or downstream of SA biosynthesis were used to show that ABA-mediated antagonism occurs both upstream of ICS1 induction and downstream of NPR1 activation154. While the effect of exogenous ABA on SA is independent of JA/ET-mediated signaling154, an activation-tagged line with elevated endogenous ABA also showed increases in JA levels and resistance to necrotrophic pathogens concomitant with suppression of SA and enhanced susceptibility to biotrophic pathogens153. This may indicate a synergistic or additive effect of ABA and JA antagonism resulting in suppression of SA in these plants. In rice, ABA was shown to  23  suppress pathogen-induction of WRKY45 and NPR1, which are important for SA-mediated signaling and defense in rice155. Recently it was shown that one of the mechanisms for ABA suppression of SA signaling involves promotion of NPR1 degradation156.  In addition, Pst DC3000 uses T3Es to induce the expression of the ABA biosynthetic gene, NINE-CIS-EPOXYCAROTENOID DIOXYGENASE 3 (NCED3), to promote ABA accumulation and signaling, which results in suppression of SA biosynthesis and enhanced susceptibility157, 158. It is possible, therefore, that the combination of Pst DC3000 infection and elevated temperature would promote ABA accumulation, which would in turn suppress SA-mediated defense.  Summary and conclusions With global food demand on the rise, mitigating crop loss due to abiotic and biotic stresses is imperative1, 159. There are many examples of elevated temperature promoting plant disease27, 28, 30, 31; however, genetic variation for temperature-sensitivity of various defense responses have been observed27, 160, 161. While progress has been made in elucidating the molecular mechanisms underlying loss of ETI-mediated defense, the factors contributing to loss of basal defense remain unknown. As SA-mediated defense is important for protecting crop plants against multiple economically important diseases15, 19, 20, 162-164, a more thorough understanding of how elevated temperature specifically effects SA accumulation, signaling and defense will provide an avenue for engineering robust, broad-spectrum resistance in plants that will be resilient to both current and anticipated changes in global climate.     24  Chapter 2  Dual impact of elevated temperature on plant defense and bacterial virulence in Arabidopsis                         I would like to acknowledge the following people for contributing to results in this chapter: André C. Velásquez, Christian Danve M. Castroverde, Emily Hubbard, Jane A. Pulman, Yuki Yoshida, Jian Yao, Gregg A. Howe, Kevin L. Childs, Kenichi Tsuda    25  Abstract Salicylic acid (SA) is a plant hormone critical for local and systemic resistance against pathogens.  I investigated the impact of an important climate condition on SA-mediated defense in Arabidopsis, and found that loss of ICS1-mediated SA biosynthesis at 30°C largely accounts for enhanced susceptibility to Pseudomonas syringae pv. tomato. Application of an SA analogue, benzothiadiazole (BTH), confers protection against disease at both 23°C and 30°C; however, global transcriptome analysis revealed a clear bifurcation in the SA signaling network, with a majority (66%) of BTH-regulated genes constituting the temperature-sensitive, PR1/ICS1 branch. Contrary to previous in vitro analyses showing down-regulation of virulence-associated genes at elevated temperature, I observed increased translocation of bacterial type III effectors (T3E) into the plant cell at 30°C. Enhanced translocation of T3E into SA-deficient plants at 30°C vs 23°C reveals previously unrecognized molecular interplays between temperature, SA signaling and the function of a central bacterial virulence system.    26  Introduction Plant diseases represent one of the most important causes of crop loss worldwide1; therefore, understanding the mechanisms underlying disease development is critical for generating effective disease control measures as part of global efforts to enable crop yields commensurate with increasing demand1, 2. Climate plays a large role in determining the outcome of plant-pathogen interactions, and it has been noted that disease epidemics are more likely to occur when environmental conditions are suboptimal for the plant26, 27. Responding to combined stresses (e.g., abiotic plus biotic) is challenging for plants because the response needed to mitigate one stress often can exacerbate another165, 166. Breeding efforts to enhance yield typically reduce genetic diversity, which increases vulnerability to disease and is also likely to negatively impact the resilience of plant immunity under adverse environmental conditions1, 167. Increasing our understanding of how specific environmental factors affect the host and the pathogen as well as their interactions can inform strategies for developing robust crop resistance under increasingly unpredictable climate conditions. The hormones salicylic acid (SA), jasmonate (JA) and ethylene (ET) are important regulators of plant defense responses, with SA generally facilitating defense against biotrophs, which feed off of living plant tissue, and JA/ET primarily defending against necrotrophs, which feed off of the nutrients released upon killing plant cells168. In Arabidopsis, pathogen induction of SA biosynthesis occurs predominantly through the isochorismate pathway involving ICS189. Following SA induction, the master regulator, NPR1, accumulates in the nucleus where it interacts with various TGA and WRKY transcription factors (TFs) to promote transcriptional  27  reprogramming to activate SA-mediated defense169. Among the many genes induced by SA, PR1 is one of the most widely used markers for SA signaling in Arabidopsis116, 170, 171. SA is important for both local and systemic resistance against pathogens13. SA-mediated defense has been well established as a crop protectant; for example, an SA synthetic analogue, benzothiadiazole (BTH), is used commercially to provide resistance resulting in increased yield in multiple crops, including wheat22 and maize23. Additionally, over-expression of NPR1 has been shown to improve fitness in field-grown Arabidopsis25 and to improve disease resistance in rice172. As both basal defense against Pseudomonas syringae pv. tomato DC3000 (Pst DC3000) and induction of SA during effector-triggered immunity (ETI) have been shown to be compromised at elevated temperature35, 43, SA-mediated defense may be compromised as well. However, it is unclear whether either of these outcomes results from a direct impact of temperature on SA, as SA-deficient mutants were reported to retain temperature sensitivity during basal defense35, and loss of ETI-induced SA may be an indirect effect resulting from temperature-mediated loss of upstream R protein function. In addition, SA plays a role in pattern-triggered immunity (PTI)87, which is not suppressed at elevated temperature47. Overall, whether there is a direct impact of elevated temperature on the SA-mediated defense network remains unclear. The aim of this study is to address this important biological question.  Our findings reveal a direct effect of elevated temperature on both SA-mediated defence in the host and type III secretion in the pathogen resulting in enhanced disease. Additionally, in spite of loss of the PR1/ICS1 temperature-sensitive branch of BTH-regulated genes, BTH-mediated protection against Pst DC3000 persisted at 30°C. Together, these results shed light on  28  the enigmatic interplays in host-pathogen interactions, and demonstrate the potential use of BTH as a crop protectant even at elevated temperatures.    29  Materials and Methods Plant materials and growth conditions Arabidopsis Columbia-0 (Col-0) WT and mutant plants (in Col-0 background) were soil-at 12 h light (85 ± 10 µmol m-2 s-1), 12 h dark, 23°C and 60% relative humidity. Two-week-old plants were used for confocal microscopy to minimize the loss of age-related decrease in yellow fluorescent protein (YFP)-associated fluorescence. The tga2 tga5 tga6, sid2-2 (ics1), ein2-1, aba2-1 and camta2 camta3 mutants were previously characterized84, 89, 115, 173-176. The myc2 myc3 myc4 mutant was generated by combining the previously described single mutants: myc2-1 (SALK_040500)177, myc3-1 (GK-445B11)178, and myc4-1 (GK-491E10)178. The npr1-6 (SAIL-708F09) T-DNA insertion mutant was obtained from the Arabidopsis Biological Resource Centre (ABRC) at The Ohio State University. T-DNA insertion mutants were genotyped using the REDExtract-N-Amp Plant PCR kit (Sigma) tocol. Primers used for genotyping are listed in Table 1. Temperature and chemical treatments Test chambers were set to either 23°C (control) or 30°C (test), with all other conditions the same as above. Plants were moved to test chambers 2 h after lights on and acclimated for 48 h before pathogen infiltration. For experiments with chemical pre-treatment, plants were temperature-acclimated for 24 h before spraying with either mock (0.1% DMSO, 0.01% Silwet L-77) or benzo(1,2,3)thiadiazole-7-carbothioic acid-S-methyl ester (BTH, Chem Service Inc.; 100 µM, 0.1% DMSO, 0.01% Silwet). For callose assays, flg22 (200 nM in 0.1% DMSO) served as a  30  positive control, and all solutions were infiltrated into leaves using a needleless syringe. Subsequent assays were performed 24 h after chemical treatment.    31  Table 1. Primer sequences used in this study.  AGI Number (Gene name) Primer name Primer sequence (5'-3') Purpose NA SAIL_LB3 TAGCATCTGAATTTCATAACCAATCTCGATACAC Genotyping  AT1G64280 (NPR1) SAIL708F09_LP ATTTGTTTGAAGCACACCTGC Genotyping  SAIL708F09_RP CTCTCAAAGGCCGACTATGTG Genotyping NA SALK_LBb1.3 ATTTTGCCGATTTCGGAAC Genotyping AT1G32640 (MYC2) MYC2_GT_LP GCTACAACCAACGATGAATC Genotyping MYC2_GT_RP TCATCAACAGCGTCATCCGA Genotyping NA GABI Kat_LB1 ATAACGCTGCGGACATCTACATT Genotyping AT5G46760 (MYC3) MYC3_GT_LP GTTAGATCAGCTGCGAATGATTCGG Genotyping MYC3_GT_RP CTCCGACTTTCGTCATCAAAGCAAC Genotyping AT4G17880 (MYC4) MYC4_GT_LP GGATCCATGTCTCCGACGAATGTTCAAGTA Genotyping MYC4_GT_RP TCTCTCACAACTTGATCCAGCTAA Genotyping AT1G64280 (NPR1) NPR1_F agaattcATGGACACCACCATTGATGGA cloning NPR1_R agtcgacCCGACGACGATGAGAGARTTTAC cloning NPR1 promoter pNPR1_F cgcggccgcTCGTTTGTTTTCCGTTTTGTTCTGA cloning pNPR1_R agaattcCAACAGGTTCCGATGAATTGAAAT cloning AT1G64280 (NPR1) NPR1-NT F AGGATCCATGGACACCACCATTGATGG RT-PCR NPR1-CT R AGCGGCCGCTCACCGACGACGATGAGAGA RT-PCR At2g14610 (PR1) PR1-RT-F GTTCACAACCAGGCACGA RT-PCR PR1-RT-R CACCTCACTTTGGCACATCC RT-PCR AT4G05320 (UBQ10) UBQ10-RT-F ACCCTCCACTTGGTCCTCA RT-PCR UBQ10-RT-R AGTTTTCCCAGTCAACGTCTT RT-PCR At1G13320 (PP2AA3) PP2AA3_qRT_F1 GGTTACAAGACAAGGTTCACTC qPCR PP2AA3_qRT_R1 CATTCAGGACCAAACTCTTCAG qPCR At2g14610 (PR1) PR1_qRT_F1 GGCTAACTACAACTACGCTG qPCR PR1_qRT_R1 TCTCGTTCACATAATTCCCAC qPCR At1g74710 (ICS1) SID2_qRT_F2 ACTTACTAACCAGTCCGAAAGACGA qPCR SID2_qRT_R2 ACAACAACTCTGTCACATATACCGT qPCR AT1G64280 (NPR1) NPR1_qRT_F1 CCGCCGCTAAGAAGGAGAAA qPCR NPR1_qRT_R1 GCCAAAACAGTCACAACCGA qPCR AT4G18170 (WRKY28) WRKY28_qRT_F CTCCTTCTAATTCTTCCTCTAGTG qPCR WRKY28_qRT_R TCTCTTTGTTTCTTCACCTCAG qPCR AT4G17880 (MYC2) MYC2_qRT_F1 GAAACTCCAAATCAAGAACCAG qPCR MYC2_qRT_R1 ATCTTCACTTCAATCTCCATCC qPCR At5g13220 (JAZ10) JAZ10_qRT_F1 GTAGTTTCCGAGATATTCAAGGTG qPCR JAZ10_qRT_R1 GAACCGAACGAGATTTAGCC qPCR    32  Phytohormone extraction and quantification by liquid chromatography-tandem mass spectrometry (LC/MS)  Phytohormones were extracted and quantified as previously described179 with some modifications. Leaf tissue between 10 - 50 mg (fresh weight, FW) was flash-frozen in liquid nitrogen, ground and extracted at 4°C overnight (~16 h) using 0.3  0.5 mL of ice-cold extraction buffer (methanol:water (80:20 v/v), 0.1% formic acid, 0.1 g L-1 butylated hydroxytoluene, 100 nM ABA-d6). After filtering and transferring to autosampler vials, plant hormones were quantified using an Acquity Ultra Performance Liquid Chromatography (UPLC) system (Waters Corporation, Milford, MA) as previously described179, except the capillary voltage, cone voltage, and extractor voltage were set to 3.5 kV, 25 V, and 5 V, respectively, and the desolvation gas and cone gas were set to flow rates of 600 L h-1 and 50 L h-1, respectively. Selected ion monitoring (SIM) was conducted in the negative ES channel for salicylic acid (SA; m/z 137>93), SA glucoside (SAG; m/z 299.1>137) and the internal ABA-d6 standard (m/z 269.1>159.1). Parent>daughter SIM pairs, as well as the optimal source cone and collision energy voltages for each compound monitored were determined using Quan-Optimize software. Analyte responses based on peak area integrations relative to the internal standard was determined using QuanLynx v4.1 software (Waters, Milford, MA). Both the SA and SAG analytes were quantified based on the SA standard curve to calculate the sample concentrations (nM), which were converted to ng using the molecular weight of the compound and the extraction volume, and were then normalized by sample FW in g. RNA extraction and qPCR RNA was extracted from flash-frozen, ground leaf tissue with the ToTally RNA kit following  33  any genomic DNA contamination, and then purified using the RNeasy Mini kit (Qiagen). M-MLV reverse transcriptase (RT, Life Technologies) was used to synthesize cDNA. For all genes of interest, approximately 1.5 ng of cDNA template was used for quantitative PCR (qPCR), with expression normalized to the PROTEIN PHOSPHATASE 2A SUBUNIT A3 (PP2AA3) internal control gene using the equation 2-T is CT target gene  CT PP2AA3 (see Table 1 for primer sequences). All qPCR reactions were performed using the SYBR® Green master mix (Life Technologies) and 7500 Fast Real-Time PCR system (Applied Biosystems, Foster City, California), with three technical replicates and a minimum of three biological replicates per experimental treatment. RNA sequencing and data analysis Extracted RNA was checked for purity using a BioAnalyzer Agilent 2100 and three biological replicates of each treatment type were selected based on having a RNA Integrity Number (RIN) score around 7. The final twelve samples were submitted to the Research Technology Support Facility at Michigan State University for preparation of next-generation sequencing libraries. Pooled samples were loaded on two lanes of an Illumina HiSeq 2500 Rapid Run flow cell (v1) and sequenced in a 1 x 50 bp single end format using Rapid SBS reagents. Base calling was done by Illumina Real Time Analysis (RTA) v1.18.61 and output of RTA was de-multiplexed and converted to FastQ format using Illumina Bcl2fastq v1.8.4. Due to inadvertent exclusion of sample 6, a second pool was generated and run on one lane of a Rapid Run flow cell, and sample 6 was also run individually on a MiSeq flow cell. RNA-seq reads were cleaned and trimmed using Trimmomatic180 and were aligned to the Arabidopsis genome assembly (TAIR10) using the STAR alignment program, allowing only unique alignments181. Read counts were  34  obtained for each gene using the featureCounts function from the Rsubread package in R182, and subsequent count data were normalized using TMM using the limma package in R183. Genes with average counts less than 10 across all samples were discarded. The count data were further normalized using voom within the limma package183. The expression data were fit to a linear model (treatment:temp + replicate), and differentially expressed genes were identified with a FDR < 0.01 for four specific contrasts (23°C mock vs. 30°C mock; 23°C BTH vs 30°C BTH; 23°C BTH vs 23°C mock; 30°C BTH vs 30°C mock) using the eBayes function within the limma package. Results were then filtered for those genes that exhibited a log2-fold change greater than 2 for at least one of the tested contrasts. Gene ontology analysis was done for genes in each cluster using The Database for Annotation, Visualization and Integrated Discovery (DAVID)184. Callose accumulation Following temperature acclimation and chemical treatment, leaves were harvested and cleared in 100% ethanol overnight. Cleared leaves were fixed with a 75% ethanol, 25% acetic acid solution for 2 h, after which leaves were washed consecutively with 75% ethanol, 50% ethanol, and 150 mM K2HPO4 pH 9.5 for 15 min. Finally, leaves were stained in an aniline blue solution (0.1%, 150 mM K2HPO4 pH 9.5) overnight at 4°C. Callose deposits were visualized using an Olympus IX71 inverted microscope with a 120-watt metal halide lamp (X-Cite series 120) using a DAPI filter (Semrock, excitation 377/50 and emission 447/60). Images shown are at 10X-magnification. Callose counts were processed using ImageJ (Rasband W.S., National Institutes of Health, U.S.A.). Images were first converted to 32-bit grayscale, after which the threshold of the image was adjusted so that only callose deposits were visible over the background. Callose  35  deposits were then counted using the analyse particles tool. Four callose measurements were collected per leaf; each individual leaf was collected from a different plant. Six to eight plants were evaluated per treatment. Confirmation of a T-DNA knock-out allele for NPR1 An npr1 mutant allele, SAIL_708F09, was identified as an NPR1 knock-out allele, which was named npr1-6. This allele contains a T-DNA insertion in the third exon of the NPR1 gene (Fig. 8a). RT-PCR was used to confirm this allele has a complete loss of NPR1 transcript and loss of PR1 gene induction by BTH (Fig. 8d). Bacterial growth in mock- and BTH-treated plants was assessed to confirm enhanced susceptibility relative to WT and loss of BTH-mediated protection (Fig. 8c).  Preparation, selection and complementation analysis of transgenic lines The full length coding sequence of NPR1 without the stop codon was PCR-amplified using NPR1_F and NPR1_R primers (Table 1) and cloned into EcoRI/XhoI sites of pENJAZ9C185 to create pENNPR1C, a Gateway compatible entry vector. Next, a 2.3kb DNA fragment containing the NPR1 promoter was PCR-amplified using pNPR1_F and pNPR1_R primers (Table 1) and cloned into NotI/EcoRI sites of pENNPR1C to create pENpNPR1C::NPR1. Then, the pNPR1::NPR1 construct was transferred by LR recombination into the binary expression vector pGWB540 to create the pNPR1::NPR1-YFP construct (Fig. 3b). The correct construct was confirmed by sequencing and introduced into Agrobacterium tumefaciens (GV3101) by electroporation. GV3101 clones containing the gene fusion construct were selected on LB medium containing rifampicin (Rif, 100 mg L-1), spectinomycin (50 mg L-1), and gentamycin (25 mg L-1) antibiotics and used to transform npr1-6 by floral dipping. T1 seeds were plated on ½X Murashige and  36  Skoog, 5 mM MES, 0.7% Bacto agar plates (1/2 MMS) containing hygromycin and resistant seedlings were transplanted to soil. Ten T1 plants were selected for protein extraction, and -GFP primary antibody (1:5,000, Abcam, data not shown). T2 seeds were collected from the ten T1 lines and ~100 seeds each were sown on ½ MMS plus 1% sucrose (1/2 MMSS) plates containing hygromycin (25 mg L-1) to ascertain segregation ratios. Resistant T2 seedlings from lines exhibiting a 3:1 segregation ratio were then screened for induction by BTH using confocal microscopy (data not shown). Lines showing strong induction were transplanted to soil. Homozygous T3 lines were selected by screening for 100% resistance to hygromycin. BTH protection assays were conducted in three independent lines to confirm complementation of the npr1-6 knockout mutation (Fig. 3c). RT-PCR was also used to confirm recovery of NPR1 expression and BTH-induction of PR1 in the NPR1-Y1 line used for experiments (Fig. 3d).  For generation of p35S::YFP transgenic plants, the GATEWAY cassette in pEARLEYGATE104186 was removed by XmaI digestion, and the resulting linearized vector was re-ligated to create pJYP35S:YFP. This construct was used for Agrobacterium-mediated transformation of Arabidopsis Col-0 wild-type plants by floral dipping187. A homozygous T3 line with the single T-DNA insertion was selected for the further experiments. Disease and BTH protection assays Pst DC3000 was streaked from a frozen glycerol stock onto a LM (10.0 g Bacto Tryptone, 6.0 g Bacto yeast extract, 1.5 g K2HPO4, 0.6 g NaCl, 0.4 g MgSO4 * 7 H2O L-1) + Rif (100 mg L-1) plate and grown in the dark for two days at room temperature until single colonies were formed. Colonies from this plate were streaked onto a fresh LM+Rif plate and grown in the dark for one  37  day at room temperature, after which 100 µl sterile LM media was added to the plate and the cells were spread evenly and kept in the dark at room temperature overnight to form a lawn. Cells were scraped from this lawn plate and re-suspended in 0.25 mM MgCl2 by incubating at room temperature for 5 min and then vortexing vigorously. A DU800 Spectrophotometer (Beckman Coulter, Inc, Fullerton, California) was used to measure the optical density (OD) of the culture at an absorbance wavelength of 600 nm (OD600), and an inoculation culture was prepared by first adjusting the starting culture to 1 x 108 colony forming unites (cfu) ml-1 (OD600 of approximately 0.1) and then preparing 1:10 dilutions to reach the desired inoculum concentration of ~1  3 x 106 cfu ml-1 (OD600 of approximately 0.001).  For vacuum infiltration, Silwet (0.005%) was added to the culture to enhance wetting of the leaves. Serial dilutions of inoculum were plated to determine the actual cfu ml-1 of culture used in each experiment.  Following temperature acclimation and chemical treatments (see above), syringe- or vacuum-infiltration was used to inoculate plants as previously described188. Following infiltration, plants were immediately returned to the test chambers where the leaves were allowed to dry completely before covering with transparent domes to maintain high humidity. Bacterial quantification was done by harvesting and grinding leaf discs in 0.25 mM MgCl2 and preparing serial dilutions, which were then plated on LM+Rif plates and kept for 24 h at 30°C. Cfus were counted and the cfu cm-2 calculated as (cfus * total dilution)/(vol plated)/leaf area harvested. Effector translocation assay Following temperature and/or chemical treatments, plants were infiltrated using a needless syringe with a high inoculum (2  4 x 107 cfu mL-1, 0.25 mM MgCl2) of Pst hrcC  38  mutant carrying the PnptII::avrPto-cyaA construct189. To offset the effect of BTH on bacterial populations, Pst DC3000 PnptII::avrPto-cyaA inoculum was adjusted to 2 x 107 cfu mL-1 for mock-pre-treated plants and 4 x 107 cfu mL-1 for BTH-pre-treated plants. Leaf discs were harvested using a biopsy punch 6-7 hpi for both bacterial population quantification and cAMP quantification, which was normalized by total plant protein. cAMP was extracted and quantified protocol. Nuclear fractionation and western blotting Following temperature and chemical treatments, a minimum of 0.5 g (FW) leaf tissue was harvested and the mass recorded prior to flash freezing in liquid nitrogen. After grinding, cell lysate was isolated using the CelLytic PN Isolation/Extraction Kit (Sigma), using the semi-pure fractionation, the whole cell lysate and cytosolic fractions were diluted with an equal volume of 4X SDS Laemmli sample buffer (125 mM Tris-HCl, pH 6.8; 4% (w/v) SDS; 20% glycerol; 0.02% -mercaptoethanol) while the nuclei pellet was resuspended in 100 µl of 2X SDS Laemmli sample buffer, resulting in a nuclear fraction sample with an 8-fold higher concentration than the whole cell or cytosolic fraction samples. All samples were boiled for 10 min at 95°C, equal volumes of each were loaded in 4-12% SDS-PAGE gradient gels (NuPAGE, Novex) and run for 40  50 min at 200 V. Proteins were transferred to PVDF membranes at room temperature for 1 h a-GFP (1:7,500, Abcam), for detection of NPR1--- 39  -H3 (1:10,000, Agrisera). The secondary antibody used for all blots was a go-rabbit (1:20,000, Thermo). Confocal microscopy Images were taken on a Zeiss 510 Meta Confocal Laser Scanning system configured on a Zeiss AxioObserver.Z1 inverted microscope (Carl Zeiss Microscopy, Thornwood, NY) using a Zeiss 63x C-Apochromat water immersion objective (NA 1.2) objective. Sequential imaging with a Kalman averaging of 4 and pinhole set to 120 µm was used to capture images from a single confocal plane. Bright-field (BF) images were recorded using an Argon 514 nm laser. YFP was excited with an Argon 514 nm laser set at 20% and fluorescence emission was recorded using a 535-565 band pass filter. Aim Image Browser Software (Zeiss LSM) was used to add scale bars and for adjustments to brightness and contrast, which were as follows: NPR1-Y1 images, contrast 60%; npr1 images, contrast 65%; 35S::YFP YFP images, brightness 52%, contrast 55%; 35S::YFP BF images, brightness 48%, contrast 55%. Images were also adjusted for sharpness and contrast using Microsoft PowerPoint as follows: all images, sharpness +50%; npr1 BF images, contrast (+20%); 35S::YFP YFP images, -40% contrast; 35S::YFP BF images, +20% contrast.  Statistical analysis A minimum of three independent experiments were done for all assays unless otherwise t-test (Excel) for pairwise comparisons or by conducting a 2x2 factorial analysis of variance (ANOVA) honest significant difference (HSD) test (RStudio (https://www.rstudio.com/) for multi-variate analyses. In the case of unequal variances as determined by the Brown-Prism 6, GraphPad Software, Inc.), data were log10-transformed prior to conducting the ANOVA.  40  Results Elevated temperature causes loss of SA biosynthesis and enhanced disease susceptibility  Arabidopsis thaliana (hereafter Arabidopsis) is more susceptible to Pst DC3000 when grown continuously at elevated temperatures (28°C)35. However, these plants also exhibit dramatically different morphology relative to plants grown at 23°C, including exaggerated hypocotyl and petiole elongation, due to PHYTOCHROME INTERACTING FACTOR 4 (PIF4)-induction of auxin190. To minimize the impact of physiological differences confounding my study, I first assessed the effect of a short-term temperature acclimation period on infection of Arabidopsis plants by the virulent pathogen Pst DC3000. Four-week-old plants were acclimated to test chambers at 23°C (control) or 30°C (test) for 48 h prior to syringe infiltration with Pst DC3000. Although leaf hyponasty (raising of leaves) was observed within 24 h after shifting plants to 30°C, morphological differences were greatly reduced between test and control plants acclimated for 48 h relative to those acclimated for 7 d (Fig. 3a  c). A 30-fold increase in bacterial growth as well as a dramatic increase in disease-associated chlorosis was observed in plants at 30°C relative to those kept at 23°C (Fig. 4a, b). Based on these results, I concluded that a 48 h acclimation to 30°C prior to inoculation results in enhanced plant susceptibility with minimal differences in plant morphology.     41   Figure 3. Morphological response of Arabidopsis plants to elevated temperature. (a) Four-week-old plants were shifted to test chambers at 23°C or 30°C. Pictures were taken 24 h or (b) 48 h after temperature shift. (c) Two-week-old plants were shifted to test chambers at 23°C or 30°C. Pictures were taken 7 d after temperature shift.     42  As SA-mediated defense plays a major role in resistance of Arabidopsis against virulent Pst DC3000, I investigated the possibility that increased susceptibility of plants at 30°C is caused by this pathway being compromised. I measured ICS1 and PR1 marker gene expression as well as free and glucosylated SA (SAG) 24 h post infiltration (hpi) with mock or Pst DC3000. I observed significant induction of both ICS1 (7-fold) and PR1 (60-fold) by Pst DC3000 in plants kept at 23°C, whereas neither gene was induced by the pathogen at 30°C (Fig. 4c). Similarly, both SA metabolites were induced by Pst DC3000 to levels roughly 8-fold higher than in mock-infiltrated plants at 23°C with no significant difference at 30°C (Fig. 4d). Finally, I tested bacterial growth in both wild type (WT, Col-0) and sid2-2 (hereafter, ics1) mutant plants. As previously reported35, ics1 plants were more susceptible to Pst DC3000 than WT plants at 23°C, showing 40-fold more bacterial growth 3 dpi (Fig. 4e); however, under my experimental conditions, there was no difference in bacterial growth between the WT and ics1 mutant plants at 30°C and a minimal difference (2.5-fold) between the ics1 mutant plants at 23°C vs. 30°C (Fig. 4e, 3 dpi). To confirm temperature sensitivity of the ics1 mutant was not missed due to bacterial saturation at 3 dpi, I also measured bacterial growth at 2 dpi with similar results (Fig. 4e). Based on these results, I concluded that pathogen-induction of SA is compromised at 30°C in association with enhanced disease susceptibility. Furthermore, loss of SA production via the ICS1 pathway appears to be the primary cause for this enhanced susceptibility, as there is no further enhanced bacterial growth in the ics1 mutant relative to WT plants at 30°C.    43   Figure 4. Increased susceptibility of Arabidopsis to Pst DC3000 at 30°C is correlated with a loss of SA marker gene expression and SA metabolite accumulation. (a) Bacterial growth in temperature acclimated plants (n = 4) three days after syringe infiltration with Pst DC3000. (b) Disease symptoms three dpi for plants in (a). (c) SA marker gene expression (n = 3) and (d) SA metabolite quantification (n = 4) in temperature acclimated plants 24 h after vacuum infiltration with mock or Pst DC3000. qPCR was used for gene expression analysis, with expression of ICS1 and PR1 normalized to the expression of PP2AA3. SA and SAG metabolites were quantified using LCMS. An SA standard curve was used to determine the SA and SAG metabolite concentrations (nM) within each sample, which were then converted to ng and normalized by sample fresh weight (FW) mass (g). (e) Bacterial growth in WT and ics1 mutant plants (n = 4). Experimental conditions are the same as in (a). All data are representative of   44  Figure 4. (contd) three independent experiments, except the 2 dpi data in (e), which was collected in two of the three independent experiments. All graphical data are presented as the mean ± standard error of the mean (SEM), with n = biological replicates. Asterisks indicate statistical significance based t-test (*** P<0.001). Letters indicate statistical significance based on a two-factor ANOVA with Tukey HSD post hoc analysis (P<0.05); samples sharing letters are not significantly different.    45  Enhanced disease at 30°C is correlated with increased pathogen virulence To test whether or not enhanced multiplication of Pst DC3000 in planta at 30°C requires specific virulence factors, growth of two bacterial mutant strains, Pst hrcC hrcC) and Pst DC3118, was compared with growth of Pst DC3000 in Arabidopsis plants kept at 23°C or hrcC mutant lacks a functional type III secretion system (T3SS) for translocation of disease-promoting type III effector (T3E) proteins into host cells49, 191, and the Pst DC3118 mutant is deficient in the production of the coronatine (COR) toxin192. While disease-associated leaf chlorosis was greatly reduced in plants infiltrated with the Pst DC3118 mutant, growth of this strain was 400-fold higher at 30°C than that at 23°C (Fig. 5hrcC mutant strain had no detectable increase in growth at 30°C (Fig. 5a), indicating that enhanced growth of Pst DC3000 in planta at 30°C requires a functional T3SS but not COR. The observed dependence on a T3SS for the positive effect of elevated temperature on Pst DC3000 growth seems to contradict previous in vitro analyses, which showed a negative impact of elevated temperature on T3SS gene expression51, 53, 54. I used a Pst DC3000 strain carrying a plasmid containing a PnptII::avrPto-cyaA reporter construct to quantify T3E translocation into the plant cells to assess if this process is affected at 30°C189hrcC mutant strain carrying the same plasmid was used as a negative control. I observed a 3-fold increase in T3E translocation 6 hpi of plants at 30°C relative to plants infiltrated at 23°C (Fig. 5c) with no detectable difference in bacterial populations at this time point (Fig. 6a). A significant increase in bacterial populations within plants at 30°C vs. 23°C was confirmed at 24 hpi (Fig. 6b). Therefore, increased Pst DC3000 virulence at 30°C is linked to increased translocation of T3E proteins prior to and likely resulting in a difference in bacterial populations.  46   Figure 5. Enhanced growth of Pst DC3000 in planta at 30°C requires a functional type III secretion system and results in elevated levels of effector translocation. (a) Bacterial growth in temperature acclimated plants (n = 4) three days after syringe infiltration with Pst DC3000, Pst DC3118 (coronatine deficient mutant) or hrcC (T3SS-deficient mutant) strains at 1 x 106 cfu mL-1. (b) Disease symptoms three dpi for plants in (a). (c) Amount of cyclic AMP (cAMP) generated in temperature acclimated plants (n = 4) syringe infiltrated with Pst DC3000 PnptII::avrPto-cyaA or Pst DC3000 hrcC PnptII::avrPto-CyaA strains at 2 x 107 cfu mL-1. Tissue was collected at 6 hpi for quantification of cAMP, which was normalized by total protein. Higher levels of cAMP indicate more translocation of bacterial effectors. All data are representative of three independent experiments. All graphical data are presented as the mean ± SEM, with n = biological replicates. Letters indicate statistical significance based on a two-factor ANOVA with Tukey HSD post hoc analysis (P<0.05); samples sharing letters are not significantly different.    Figure 6. Elevated temperature does not affect bacterial growth at 6 hpi. Bacterial growth in temperature acclimated plants 6 h (a) and 24 h (b) after syringe infiltration with Pst DC3000 PnptII::avrPto-cyaA (2 x 107 cfu ml-1).  Data are presented as the mean (n = 4) ± SEM, and are representative of three independent experiments. Asterisks indicate statistical significance t-test (*** Psignificance.     47  BTH-induction of SA accumulation, marker gene expression and callose deposition is impaired at 30°C  BTH was used to directly test the effect of elevated temperature on SA biosynthesis and signaling in a pathogen-free system. BTH is widely used as a surrogate for the SA signal and is a potent inducer of SA response genes in Arabidopsis193, 194. BTH significantly induced both ICS1 (10-fold) and PR1 (>2,500-fold) gene expression as well as SA (5-fold) and SAG (2-fold) metabolite levels in plants kept at 23°C with no significant induction in plants treated at 30°C (Fig. 7a, b). Similarly, an 8-fold increase in BTH-induced callose was observed at 23°C, whereas no significant accumulation of callose was observed following BTH treatment at 30°C (Fig. 7c, d). In contrast, although reduced at elevated temperature, flg22 was able to elicit a strong callose response at both 23°C (90-fold) and 30°C (50-fold; Fig. 7e, f), indicating that the observed effect of temperature on BTH-induced callose deposition is likely due to compromised SA signaling rather than an effect on the callose synthase enzyme.     48   Figure 7. BTH-induction of SA marker genes, SA metabolite accumulation and callose deposition is compromised at 30°C. (a) SA marker gene expression (n = 6) and (b) SA metabolite quantification (n = 8) in temperature acclimated plants 24 h after spraying with mock or BTH. qPCR was used for gene expression analysis, with expression of ICS1 and PR1 normalized to the expression of PP2AA3. SA and SAG metabolites were quantified using LCMS. An SA standard curve was used to determine the SA and SAG metabolite concentrations (nM) within each sample, which were then converted to ng and normalized by sample fresh weight (FW) mass (g). (c) Representative images of callose accumulation 24 hpi with mock, BTH or (e) flg22 of temperature acclimated plants. Callose deposits were stained with aniline blue and visualized with an epifluorescent microscope using a DAPI filter (excitation 377/50 and emission   49  Figure 7. (contd) 447/60). Scale-bar length represents 100 µm. (d), (f) Quantification of callose accumulation from plants (n = 6) treated as described in (c) and (e), respectively. Callose assays conducted by André C. Velásquez. All data are representative of three independent experiments. All graphical data are presented as the mean ± SEM, with n = biological replicates. Letters indicate statistical significance based on a two-factor ANOVA with Tukey HSD post hoc analysis (P<0.05); samples sharing letters are not significantly different.    50  The master regulator of SA-signaling, NPR1, retains nuclear localization at 30°C Zhu et al. (2010) showed that loss of R protein nuclear localization contributes to compromised R-mediated defense at elevated temperature (28°C)36. NPR1 is a key regulator of SA signaling and accumulates in the nucleus upon SA signal perception169, 195. As nuclear localization of NPR1 is required for PR1 gene induction109, it is possible that loss of NPR1 nuclear localization results in loss of PR1 gene induction at 30°C. To test this, I generated transgenic lines expressing a functional NPR1 protein tagged at the C-terminal end with YFP under control of the native NPR1 promoter (pNPR1::NPR1-YFP hereafter, NPR1-Y1; Fig. 8b  d) in a confirmed npr1 knock-out mutant (Fig. 8a, c, d). Transgenic lines expressing the YFP protein under the control of the constitutive 35S promoter (p35S::YFP) were also generated as controls. A nuclear YFP signal was observed in both mock- and BTH-treated NPR1-Y1 plants at both 23°C and 30°C, although the signal was extremely weak in mock-treated plants at both temperatures (Fig. 9a). There was no observable effect of treatment (chemical or temperature) on YFP signal detected in the p35S::YFP control, and no YFP signal was detected in the parent npr1 plants (Fig. 9b, c).    51   Figure 8. Characterization of npr1-6 knock-out and pNPR1::NPR1-YFP transgenic lines. (a) Model of T-DNA insertion in NPR1 for the SAIL_708F09 allele, named here npr1-6 and referred to as npr1. (b) Model of pNPR1::NPR1-YFP construct. The NPR1 promoter used was 2.3 kb upstream of the NPR1 transcriptional start site (TSS). (c) Bacterial growth in five-week-old mock- or BTH-pre-treated plants three days after syringe infiltration with Pst DC3000. Data are presented as the mean (n = 3) ± SEM, and are representative of three independent experiments. Letters indicate statistical significance based on a two-factor ANOVA with Tukey HSD post hoc analysis (P<0.05); samples sharing letters are not significantly different. (d). Five-week-old plants (n = 3) were sprayed with mock or BTH 24 h prior to harvesting tissue for RNA extraction. Semi-quantitative gene expression analysis was used to determine the expression levels of NPR1 (35 cycles) and PR1 (25 cycles) with UBQ10 (25 cycles) expression used as an internal control. Data are representative of two independent experiments. Primer sequences are provided in Table 1.    52   Figure 9. BTH-induction of NPR1 nuclear localization is retained at 30°C. Representative confocal microscopy images of temperature acclimated NPR1-YFP (a) 35S::YFP (b) and npr1 mutant (c) plants (n = 4) 24 h after spraying with mock or BTH. Images are of YFP (yellow) alone or YFP overlaid on Brightfield (gray-scale). Brightfield images were recorded using an Argon 515 nm laser. YFP was excited with an Argon 515 nm laser and fluorescence emission was recorded using a 535-565 band pass filter. Scale bar length represents 10 µm.   53  To independently confirm NPR1 nuclear localization, subcellular fractionation experiments were also conducted. Total protein was extracted from fully expanded leaves pooled from four NPR1-Y1 plants following temperature acclimation and BTH treatment. Samples were then separated into nuclear and non-nuclear (referred to as cytosolic) fractions, and western blotting using a GFP antibody was used to determine the presence or absence of the NPR1-YFP protein in each fraction. Whole cell lysate extracted from npr1 plants treated with BTH at 23°C was used as a negative control. NPR1-YFP was observed in whole cell lysate and both fractions of BTH-treated samples at both temperatures (Fig. 10a). Western blotting of UDP-GLUCOSE PYROPHOSPHORYLASE (UGPase) and HISTONE 3 (H3) proteins, which were used as cytosolic- and nuclear-fraction specific markers, respectively, showed significant enrichment within their respective fractions (Fig. 10a). The confocal and nuclear fractionation data both show that elevated temperature does not prevent BTH-induced nuclear accumulation of the NPR1 protein. To confirm the loss of BTH-induction of PR1 protein accumulation, western blot analysis using an anti-PR1 antibody was also conducted with fractionated protein samples confirmed to have NPR1 localized to the nucleus. Similar to PR1 gene expression (Fig 7a), PR1 protein was only detectable in BTH-treated plants at 23°C (Fig. 10b).    54   Figure 10. BTH-induction of NPR1 nuclear localization does not enable PR1 protein accumulation at 30°C. (a) Western blots of whole cell lysate (W), and non-nuclear (C, cytosolic) and nuclear (N) enriched fractions isolated from leaves pooled from four NPR1-Y1 transgenic plants treated with mock (-) or BTH (+) solutions at 23°C or 30°C. Equal volumes (10 µl) of each protein sample were loaded and run in two separate 4-12% gradient SDS-PAGE gels. Following transfer to PVDF membranes, one blot was probed with -GFP primary antibody to detect the NPR1-YFP protein (expected MW ~90 kD) while the other blot was cut in two and the upper portion probed with the -UGPase cytosolic protein control and the lower portion probed with the -H3 nuclear protein control. Whole cell lysate extracted from npr1 plants treated with BTH at 23°C was used as the negative control for the NPR1-YFP band. (b) Western blot of non-nuclear fraction isolated from leaves pooled from four, temperature acclimated NPR1-Y1 plants treated with mock (-) or BTH (+). Equal volumes (10 µl) of each protein sample were loaded and run a 4-12% gradient SDS-PAGE gel. Following transfer, the PVDF membrane was probed using a -PR1 primary antibody (expected MW ~16 kD). NPR1 nuclear localization was confirmed in the same samples. Data are representative of three independent experiments.    55  Discovery of temperature-sensitive and -insensitive sectors of the SA-regulated transcriptome  As BTH-induction of the canonical SA marker genes, PR1 and ICS1, is compromised at 30°C but NPR1 nuclear accumulation is not, I conducted RNA sequencing (RNA-seq) using the BTH-mediated global transcriptional reprogramming. Four separate contrasts (23°C Mock vs. 30°C Mock, 23°C BTH vs. 30°C BTH, 23°C Mock vs. 23°C BTH and 30°C Mock vs. 30°C BTH) were used to identify differentially expressed genes (DEGs, 4-fold cut-off, P<0.01), resulting in a total of 2,820 DEGs. K-means cluster analysis (k = 9) was conducted using fold change values (BTH/mock) for all DEGs at both temperatures. Clusters 1, 2 and 3 contain genes induced by BTH at 23°C but compromised in BTH-induction at 30°C, cluster 4 contains genes similarly induced at both temperatures, clusters 5, 6 and 7 contain genes induced more by BTH at 30°C than at 23°C and clusters 8 and 9 contain genes suppressed by BTH at 23°C but compromised in suppression at 30°C (Fig. 11).     56   Figure 11. The effect of elevated temperature on the BTH-regulated transcriptome. Differentially expressed genes were identified from RNA-seq data and k-means clustering was conducted as described in the Methods and Results. The heat map shows a visual representation of gene expression patterns based on fold change (BTH/mock) within each cluster. Down-regulation of expression between the mock- and BTH-treated plants at each temperature is denoted by the level of blue color, up-regulation by the level of yellow color and no change by black as indicated by the color scale. DEG identification, k-means clustering and heat map generation all done by Dr. Kenichi Tsuda.    57  To gain insight into the types of genes found in each cluster, expression patterns were analysed using publicly available microarray datasets and functional annotations using gene ontology (GO) analysis. Together, these analyses show that genes in clusters 1  7 are involved in various biotic or abiotic stress responses and genes in clusters 8 and 9 are involved in photosynthesis and growth-related processes (Fig. 12  14, Table 2). As growth-defense trade-offs are known to occur57, it is possible that the compromised suppression of cluster 8 and 9 genes at 30°C either contributes to or is the consequence of compromised induction of SA-associated defense signaling. The same may be true for genes in clusters 5 and 6 (uniquely induced by BTH at 30°C), which were functionally annotated as being involved in ET-, JA- and abscisic acid (ABA)-regulated responses (Table 2), all of which are known to be antagonistic with SA102, 144, 154.      58    Figure 12. Genevestigator analysis using publicly available microarray expression data of genes in response to biotic stress.  Of the pathogens listed under biotic stress, Alternaria brassicicola and Botrytis cinerea are necrotrophic pathogens, Hyaloperonospora arabidopsidis is an obligate biotrophic pathogen and both strains of Pseudomonas syringae are hemi-biotrophic pathogens. Numbers to the left of each panel indicate the cluster to which that set of genes is assigned.  Expression values are log2 ratios of treated vs. untreated or mock controls, with down-regulation of expression denoted by the level of blue color, up-regulated denoted by the level of yellow color and no change in expression denoted by black color as indicated by the color scale. Genevestigator analysis conducted by Dr. Kenichi Tsuda.    59   Figure 13. Genevestigator analysis using publicly available microarray expression data genes in response to SA/BTH or microbe-associated elicitors. Numbers to the left of each panel indicate the cluster to which that set of genes is assigned.  Expression values are log2 ratios of treated vs untreated or mock controls, with down-regulation of expression denoted by the level of blue color, up-regulated denoted by the level of yellow color and no change in expression denoted by black as indicated by the color scale. Genevestigator analysis conducted by Dr. Kenichi Tsuda.    60   Figure 14. Genevestigator analysis usingpublicly available microarray expression data of genes in response to heat stress. Numbers to the left of each panel indicate the cluster to which that set of genes is assigned. Expression values are log2 ratios of treated vs untreated or mock controls, with down-regulation of expression denoted by the level of blue color, up-regulated denoted by the level of yellow color and no change in expression denoted by black as indicated by the color scale. Genevestigator analysis conducted by Dr. Kenichi Tsuda.    61  Table 2. Subset of functional annotations for differentially expressed genes in RNA-seq dataset. The GO term is provided in the second column. Subsequent columns provide the number of unique genes within each cluster containing the corresponding GO term. GO analysis was conducted using DAVID (https://david.ncifcrf.gov/) by Dr. Jane A. Pulman. Category GO term 1 2 3 4 5 6 7 8 9 Biotic Stress Defense   40 53 54 21    Immune   20 26 31 8    Cell death   20 20 21     Bacterium 7 13 15 17 14     Chitin    16 32 20 3   SA/SAR   17 19      ET     9 17    JA     8     Abiotic stress Abiotic stress     8 17    ABA    13  7    heat 7 8        Growth Chloroplast part        34 45 photosynthesis         26 auxin        10 12     62  To identify TFs that may be involved in regulation of genes within each cluster, Analysis of Motif Enrichment (AME)196 was conducted using 1,000 bp upstream of each gene. Overall these results matched those based on the microarray and GO analyses. Genes in clusters 2, 4 and 5 had an over-representation of the as-1 element bound by TGA TFs197, which are known regulators of genes involved in biotic stress responses198, and genes in clusters 2, 3, 4, 5 and 6 had an over-representation of the W-box motif bound by WRKY TFs119, which are known regulators of genes involved in both biotic and abiotic stress responses119, 198 (Table 3). Additionally, genes in cluster 6 have an over-representation of cis elements bound by TFs involved in ABA signaling as well as the CAMTA2 and CAMTA3 TFs, both of which are negative regulators of SA100, 148. Finally, clusters 8 and 9 genes show an overrepresentation of cis elements bound by PIFs, which are growth-promoting TFs involved in responses to high temperature, red- and far red-light and shade avoidance199, and MYCs, which are involved in both ABA- and JA-mediated signaling147.     63  Table 3. Transcription factors implicated in regulation of genes within each cluster. Analysis of Motif Enrichment (AME; http://meme-suite.org/tools/ame) was conducted by cluster as described in the Methods. For each cluster analysis, a subset of TFs, as implicated by enrichment of the motif to which they bind, was compiled based on known relevance to SA, ABA, JA and growth-related processes. No enriched motifs were identified for clusters 1 and 7. AME analysis conducted by Dr. Kenichi Tsuda. Cluster 2 Cluster 3 Cluster 4 Cluster 5 Cluster 6 Cluster 8 Cluster 9 TGA2 WRKY (x23) TGA5 TGA5 CAMTA2 PIF1 PIF1 TGA5  TGA6 TGA6 CAMTA3 PIF3 PIF3 TGA6  WRKY (x25) WRKY (x24) ABF1 PIF4 PIF4 WRKY (x13)    ABF2 PIF5 PIF5     ABF3 MYC2 MYC2     ABI5 MYC3 MYC3     PIF3 MYC4      WRKY (x19) JAM2      64  To take a closer look at genes well-characterized for their involvement as positive or negative regulators of either SA biosynthesis and/or signaling, genes were grouped based on the differences of expression levels in BTH-treated plants at 23°C vs. 30°C. BTH-induced genes (clusters 1  7; 1,833 genes) were categorized into three groups as follows: Group A, expression -fold lower at 30°C vs. 23°C (956 genes; 52% of BTH-induced genes); Group B, expression similar at 30°C and 23°C (725 genes; 40% of BTH--fold higher at 30°C vs. 23°C (152 genes; 8% of BTH-induced genes; Fig. 15a). Using the same 2-fold cut-off criteria, 810 out of 987 (82%) of BTH-suppressed genes at 23°C were compromised in suppression at 30°C; therefore, BTH-suppressed genes were kept in a single Group D (Fig. 15a). If genes regulated by BTH at 23°C (Groups A, B and D) are defined as the typical SA signaling network, a clear temperature-sensitive bifurcation is revealed, with 66% (1,766) of genes misregulated and 34% (902) retaining similar expression levels at 30°C. Based on this analysis, known positive regulators of SA biosynthesis, including EDS1, PAD4, CBP60g and SARD113, are predominantly in the PR1/ICS1 branch (Group A), while negative regulators, such as WRKY54, MYC2 and several MYC2-regulated ANACs13, are predominantly in Groups B and C (Fig. 15b, c). NPR1 and two of its known regulators, NPR313 and SUMO3114, are in Group B (Fig. 15b), further supporting my finding that NPR1 induction and localization are not impaired at 30°C. Downstream of NPR1, many SAR-related genes, including PR1, PR2, PR5, ALD1 and FMO113, appear in Group A; however, several positive regulators of SA signaling, including WRKY5413 and GRX480200 are in Group B (Fig. 15b, c).     65   Figure 15. Global transcriptome analysis of BTH-regulated genes reveals a temperature-sensitive bifurcation in the SA-signaling network. (a) RNA-seq gene expression profiles. Genes were grouped based on a 2-fold change difference in expression between BTH-treated samples at 30°C vs. 23°C. Data are represented as the mean ± SEM of the centered, normalized expression values for each sample type (23°C, Mock; 23°C, BTH; 30°C, Mock; 30°C, BTH) within each group. The number of genes within each group is shown in the upper left corner of each graph. (b) and (c) Graphical depiction of genes involved in promotion or suppression of SA biosynthesis via regulation of the ICS1 gene as well as genes involved in the SA signaling pathway. Genes are color-coded based on the gene group (a) to which they belong. Shapes without fill denote metabolites and COI1, which was not a DEG in this study. Metabolites are   66  Figure 15. (contd) also denoted by oval shapes; TFs are denoted by hexagon shapes. The DNA helix with bent arrow depicts the ICS1 gene promoter. Solid lines depict confirmed, direct connections, whereas dashed lines depict indirect/multiple or missing/unknown steps between components. Bent arrows next to DNA molecules depict gene promoters. Arrowheads show positive and blunted lines show negative interactions. References for each gene function depicted are provided in Table 4.    67  Table 4. RNA-seq differentially expressed genes involved in SA biosynthesis and/or signaling. Genes are identified based on their Arabidopsis Genome Initiative (AGI) number and commonly used gene name. Cluster numbers are based on k-means clustering. Group classifications are based on differences in fold change (2-fold cut-off) between the BTH-treated samples at 23°C and 30°C.  Process AGI Number Gene Name Cluster Group References Positive regulation of SA biosynthesis AT3G52430 PAD4 3 A 94, 95, 201 AT3G48090 EDS1 4 A 96, 97 AT3G20600 NDR1 5 B 202 AT5G13320 PBS3 2 A 203, 204 AT5G26920 CBP60G 4 A 98 AT1G73805 SARD1 4 A 98 AT4G18170 WRKY28 5 B 99 AT2G46400 WRKY46 4 A 99 AT1G74710 ICS1, SID2 1 A 89, 205 AT4G39030 EDS5, SID1 1 A 205 AT4G14400 ACD6 4 B 206 AT2G13810 ALD1 2 A 207, 208 AT1G64280 NPR1, SAI1, NIM1 4 B 201 Negative regulation of SA biosynthesis AT2G40750 WRKY54 4 B 117 AT3G56400 WRKY70 4 A 117 AT1G29690 CAD1 5 B 209 AT2G39660 BIK1 4 B 210 AT1G28380 NSL1 5 B 211 AT1G64280 NPR1, SAI1, NIM1 4 B 105, 201 AT1G52890 ANAC019 5 B 144 AT3G15500 ANAC055 5 B 144 AT4G27410 ANAC072 5 B 144 AT1G32640 MYC2 7 C 144 Positive role in SA signaling/SAR AT1G28480 GRX480 4 B 200, 212 AT1G03850 GRXS13 4 A 200 AT1G64280 NPR1, SAI1, NIM1 4 B 103, 105, 106 AT5G55170 SUMO3 4 B 114 AT1G22070 TGA3 3 A 213, 214 AT5G06960 TGA5, OBF5 2 A 115 AT4G31800 WRKY18 4 A 117 AT4G23810 WRKY53 5 C 117 AT2G40750 WRKY54 4 B 117 AT3G56400 WRKY70 4 A 117 AT2G13810 ALD1 2 A 207, 215     68   Process AGI Number Gene Name Cluster Group References Positive role in SA signaling/SAR, cont. AT1G19250 FMO1 3 A 216 AT2G14610 PR1 2 A 170 AT3G57260 PR2, BGL2 4 A 170 AT1G75040 PR5 4 A 170 Negative role in SA signaling/SAR AT5G45110 NPR3 4 B 111, 217 AT1G02450 NIMIN1 4 A 218, 219 AT3G25882 NIMIN-2 4 A 218, 219 AT4G31800 WRKY18 4 A 220 AT5G22570 WRKY38 4 B 117, 221 AT3G01080 WRKY58 4 A 117 AT2G25000 WRKY60 3 A 220 AT5G01900 WRKY62 3 A 221, 222 AT5G04340 ZAT6 6 B 223  Figure 16. Validation of RNA-seq gene expression patterns. qPCR was conducted to validate the expression patterns of RNA-seq Groups (Fig. 15a) (a) NPR1 is a positive regulator of SA signaling that also acts in both positive and negative feedback loops regulating SA biosynthesis. (b) WRKY28 is a positive regulator of SA biosynthesis that binds the ICS1 promoter to promote its expression. (c) MYC2 promotes expression of ANAC TFs that bind and suppress ICS1 expression. (d) JAZ10 is induced by activation of the JA signaling pathway, which is known to antagonize SA signaling. All genes were normalized to the expression of PP2AA3. Data are presented as the mean (n = 6) ± SEM, and are representative of three independent experiments. Letters indicate statistical significance based on a two-factor ANOVA with Tukey HSD post hoc analysis (P<0.05); samples sharing letters are not significantly different.  69  Gene expression profiles were confirmed using qPCR for several genes in each group of BTH-induced genes. While Group A (ICS1, PR1) and B (NPR1, WRKY28) genes showed reproducible expression profiles across several independent experiments, Group C genes (MYC2, JAZ10) did not (Fig. 15a, Fig. 16). However, the overall expression values for these two genes as measured by qPCR were low, which may contribute to their variability between experiments. JA, ET and ABA do not contribute to enhanced susceptibility at 30°C As mentioned above, JA, ET and ABA are known to antagonize SA biosynthesis and signaling102, 144, 154, and all three of these pathways were implicated as being up-regulated in response to BTH at 30°C. To test the possibility that one or more of these hormone pathways might contribute to loss of SA accumulation at elevated temperature resulting in enhanced susceptibility, I conducted disease assays at 23°C and 30°C using mutants affected in either the biosynthesis and/or signaling of these hormones. The JA mutants tested were dde2-2 (hereafter aos), which is JA-deficient due to a defect in the ALLENE OXIDE SYNTHASE gene224, and myc2 myc3 myc4 (hereafter myc2/3/4), which is compromised in three TFs involved in JA-mediated signalling178. The ET mutants tested were ein2-1 (hereafter ein2), which is compromised in ET-mediated signaling173, and the ein3 eil1 double mutant, which is defective in two TFs known to promote ET signaling and negatively regulate ICS1 gene expression102. I also tested aba2-1 (hereafter aba2), which is an ABA biosynthetic mutant having roughly 20-25% of ABA present in WT plants174, 176. All five mutants showed a slight (5 to 10-fold) but significant reduction of Pst DC3000 growth at 23°C compared to WT plants (Fig. 17a  e). However, based on the retention of temperature sensitivity in the mutant plants and the similar level of susceptibility between  70  each mutant and the WT plants at 30°C (Fig. 17a  e) none of these signaling pathways is likely responsible for enhanced susceptibility to Pst DC3000 at elevated temperature.    71   Figure 17. CAMTAs contribute to enhanced susceptibility but are not responsible for loss of SA induction at 30°C. Bacterial growth in temperature acclimated WT vs. (a) aos1, (b) myc2/3/4, (c) aba2, (d) ein2, (e) ein3 eil1 and (f) camta2/3 mutant plants three days after vacuum infiltration with Pst DC3000. (g) SA marker gene expression and (h) SA metabolite quantification 24 h after vacuum infiltration with mock or Pst DC3000. qPCR was used for gene expression analysis, with expression of ICS1 and PR1 normalized to the expression of PP2AA3. SA and SAG metabolites were quantified using LCMS. An SA standard curve was used to determine the SA and SAG metabolite concentrations (nM) within each sample, which were then converted to ng and normalized by sample fresh weight (FW) mass (g). Data are presented as the mean (n = 4) ± SEM, and are representative of three independent experiments. Letters   72  Figure 17. (contd) indicate statistical significance based on a two-factor ANOVA with Tukey HSD post hoc analysis (P<0.05); samples sharing letters are not significantly different. Data in (g) and (h) were      73  Loss of CAMTA2 and CAMTA3 enables resistance but not recovery of SA biosynthesis at 30°C CAMTA1, CAMTA2 and CAMTA3 are TFs that function redundantly in repressing SA biosynthesis at temperatures between 19°C and 22°C84, 100. This repression is relieved upon pathogen perception or in response to cold temperatures (~4°C), enabling SA accumulation in these conditions84, 225. As expected, the camta2 camta3 double mutant (hereafter camta2/3) showed enhanced resistance against Pst DC3000 relative to WT plants at 23°C (140-fold less growth; Fig. 17f). Unlike the other mutants tested, the camta2/3 mutant retained heightened resistance at 30°C (80-fold less growth; Fig. 17f), indicating that CAMTAs may contribute to enhanced susceptibility at elevated temperature by suppressing SA biosynthesis. Although ICS1 and PR1 gene expression was constitutively elevated in the camta2/3 mutants at 23°C, expression of these genes remained compromised at 30°C (Fig. 17g), indicating that loss of SA biosynthesis at elevated temperature is not due to CAMTA2/3-mediated suppression. SA and SAG levels were observed to be constitutively elevated in the camta2/3 mutants relative to WT at both temperatures; however, there was a significant decrease in the amount of both SA and SAG in mutant plants at 30°C vs. 23°C (Fig. 17h).  Provision of an SA signal restores resistance to Pst DC3000 at 30oC  Although greatly depleted, it is possible that the residual levels of endogenous SA/SAG and/or priming effects associated with plant development in the presence of constitutively elevated SA may be sufficient to confer the protection against disease observed in the camta2/3 mutants at 30°C. This would support the hypothesis that loss of SA biosynthesis is the cause of enhanced susceptibility at elevated temperature. However, it is intriguing that this disease resistance exists in the absence of the PR1/ICS1 branch of SA signaling, suggesting it  74  may be SA-independent. To investigate whether provision of an exogenous SA signal can confer disease protection at elevated temperature, I conducted BTH-protection assays in WT plants at 23°C and 30°C. Similar to the camta2/3 mutants, BTH-treated WT plants had 150 to 200-fold less bacterial growth and showed no disease symptoms relative to the mock-treated controls at both temperatures (Fig. 18a, b). Furthermore, no induction of the ICS1 and PR1 marker genes or of the SA and SAG metabolites was observed in plants pre-treated with BTH and infiltrated with Pst DC3000 relative to the control (mock-pre-treatment + mock infiltration) plants at 30°C (Fig. 18c, d). Full transcriptome analysis of pathogen- and BTH-treated plants at both temperatures would be needed to determine whether the entire PR1/ICS1 branch identified in the RNA-seq analysis also remains compromised. However, it is possible that both BTH-mediated protection and the enhanced resistance of the camta2/3 mutant plants at 30°C are SA-dependent, but occur in the absence of this important branch of SA-mediated signaling.     75   Figure 18. BTH-mediated protection against Pst DC3000 persists at 30°C in the absence of PR1, ICS1 and SA metabolite accumulation. (a) Bacterial growth in temperature acclimated, mock- or BTH-pre-treated plants (n = 4) three days after vacuum infiltration with Pst DC3000. (b) Disease symptoms three dpi in plants used for BTH protection assay in (a). Tissue was collected 24 hpi from the same plants in (a) as well as mock-infiltrated plants for quantification of (c) SA marker gene expression (n = 3) and (d) SA metabolites (n = 4). qPCR was used for gene expression analysis, with expression of ICS1 and PR1 normalized to the expression of PP2AA3. SA and SAG metabolites were quantified using LCMS. An SA standard curve was used to determine the SA and SAG metabolite concentrations (nM) within each sample, which were then converted to ng and normalized by sample fresh weight (FW) mass (g). All data are representative of three independent experiments. All graphical data are presented as the mean ± SEM with n = biological replicates. Letters indicate statistical significance based on a two-factor ANOVA with Tukey HSD post hoc analysis (P<0.05); samples sharing letters are not significantly different.     76  To determine if NPR1 is required for BTH-mediated protection at 30°C, I conducted BTH-protection assays in WT and npr1 mutant plants. The npr1 mutant plants had 30-fold higher bacterial growth relative to WT plants at 23°C, but no difference in bacterial growth was observed between the two genotypes at 30°C (Fig. 19a). Whereas BTH-mediated protection was once again observed in the WT plants at both temperatures, no protection was observed in npr1 plants at either temperature (Fig. 19a), indicating that NPR1 is required for BTH-induced protection at both 23°C and 30°C. The combined loss of TGA2, TGA5 and TGA6 TFs is known to compromise SA-mediated defense at 23°C115. To further investigate the utilization of the core SA-signaling pathway in BTH-mediated protection at elevated temperature, I repeated the BTH-protection assay at 23°C and 30°C using WT and tga2 tga5 tga6 (hereafter tga2/5/6) triple mutant plants.  The tga2/5/6 mutant plants had 10-fold more bacterial growth than WT at 23°C, but were slightly more resistant (2-fold less bacterial growth) than WT at 30°C (Fig. 19b). While some protection was observed in BTH-treated tga2/5/6 mutants at 23°C, it was compromised relative to WT plants (5-fold vs. 55-fold) and completely absent at 30°C, indicating that TGA2, TGA5 and TGA6 are required for BTH-mediated protection at elevated temperature (Fig. 19b).          77   Figure 19. BTH-mediated protection at 30°C requires NPR1 and the TGA2, TGA5, TGA6 TFs and involves restriction of bacterial T3E. (a) Bacterial growth in temperature acclimated, mock- or BTH-pre-treated WT and npr1 mutant plants and (b) tga2/5/6 mutant plants three days after vacuum infiltration with Pst DC3000. The effect of BTH (c, d) and SA-deficiency (e, f) on translocation of bacterial effectors (c, e) and bacterial multiplication (d, f) 6 hpi of temperature acclimated plants with Pst DC3000 PnptII::avrPto-cyaA or Pst DC3000 hrcC PnptII::avrPto-CyaA strains. cAMP levels were normalized by total protein, and higher levels of cAMP indicate more translocation of bacterial effectors. All data are representative of three independent experiments. All data are presented as the mean (n = 4) ± SEM. Letters indicate statistical significance based on a two-factor ANOVA with Tukey HSD post hoc analysis (P<0.05); samples sharing letters are not significantly different. Data in (a) and (b) were analyzed in two groups     78  BTH-mediated protection against disease involves reduction in effector protein translocation Because BTH-mediated protection remains intact in spite of increased T3E translocation by Pst DC3000 at elevated temperature, it is possible that a component of the SA/BTH-protection mechanism is to restrict T3E translocation. To test this, I quantified T3E translocation in mock- and BTH-treated WT plants at 23°C as well as in WT and ics1 mutants at 23°C and 30°C. As before, bacterial populations were assessed at 6 hpi to confirm differences in T3E translocation are not due to differences in bacterial population at this time point (Fig. 19d, f). I observed a significant reduction (4-fold) in T3E translocation into BTH-treated plants relative to the mock-treated controls (Fig. 19c) as well as a significant increase (2-fold) in T3E translocation into ics1 vs. WT plants at 23°C (Fig. 19e), indicating that SA does play a role in restricting T3E translocation into host cells. However, the effect of elevated temperature on T3E translocation is larger than that of SA, as I observed significantly more translocation into both WT and ics1 mutant plants at 30°C relative to 23°C (~5-fold; Fig. 19e). This indicates that, at elevated temperature, both loss of SA biosynthesis in the host and increased translocation of T3E by the pathogen contribute to enhanced disease.     79  Discussion According to the long-plant-pathogen interactions can only be fully understood within the context of environment226. Elevated temperature has been shown to promote disease in many plant-pathosystems227, from fungal infection of wheat27 to viral infection of tobacco29. While some insight regarding the molecular mechanisms involved in loss of ETI-mediated defense has been gained127, the underlying cause for a potentially general reduction of basal defense was unknown. Wang et al. (2009) found that 10- to 14-d-old SA-deficient mutant seedlings grown continuously at elevated temperature (28°C) retained temperature sensitivity in terms of enhanced bacterial growth at elevated temperature35. Because extended growth at elevated temperature results in dramatically altered plant morphology (and likely altered plant physiology) compared to 48 h treatment (Fig. 3b, c), future research is needed to determine the causes for the apparently SA-independent effect of long-term treatment of elevated temperature on disease susceptibility of seedlings, as observed by Wang and colleagues20.  I provide evidence showing that enhanced basal susceptibility of Arabidopsis to Pst DC3000 is correlated with a loss of SA biosynthesis and downstream defense gene expression following a brief (48 h) acclimation to elevated temperature (Fig. 4a - d). Furthermore, I show that the SA-deficient mutant, ics1, has greatly diminished temperature sensitivity relative to WT plants and exhibits similar susceptibility as WT plants at 30°C (Fig. 4e). Additionally, provision of the SA analogue, BTH, confers similar levels of protection against disease at both temperatures (Fig. 18a). Based on these data, I conclude that loss of SA is the primary temperature-sensitive component in the host responsible for enhanced disease.   80  I considered three potential models to determine how elevated temperature affects the SA-mediated host-pathogen interaction to enable enhanced disease. Based on previous in vitro analyses showing a negative effect of elevated temperature on the expression of virulence-associated genes51-54, 56 and my data showing loss of pathogen-induced SA biosynthesis (Fig. 4b), Model 1 predicts that elevated temperature negatively affects both pathogen virulence and SA-mediated defense. In this model, enhanced disease would result from increased host susceptibility in spite of compromised bacterial pathogenicity. However, the inability of the non-hrcC mutant strain to grow more in plants at elevated temperature indicates that a functional T3SS is required for enhanced bacterial growth at 30°C (Fig. 5a). Also, contrary to the in vitro studies, my results show that effector translocation in planta is more efficient at 30°C (Fig. 5c), effectively refuting Model 1.  Alternatively, Model 2 proposes that elevated temperature enhances bacterial virulence, which then causes loss of SA biosynthesis to promote disease. Pst DC3000 production of COR, which is known to specifically target and antagonize SA biosynthesis144, was previously shown to be unaffected by elevated temperature in planta55. Although symptom development was greatly reduced in plants infected with the COR-deficient mutant strain, Pst DC3118, growth of this strain was enhanced similarly to that of Pst DC3000 at 30°C (Fig. 5a), thereby eliminating COR-mediated suppression of SA biosynthesis as the potential mechanism. As T3E translocation is increased at 30°C, it is possible that an effector-mediated process may contribute to loss of SA biosynthesis at elevated temperature. However, the loss of BTH-induced SA production at 30°C (Fig. 7b), which is a pathogen-free treatment, prompts rejection of Model 2.   81  Therefore, I propose a third model whereby elevated temperature directly antagonizes SA accumulation in the host as well as promotes virulence in the pathogen resulting in enhanced disease (Fig. 20). Increased T3E translocation into the ics1 mutant relative to WT plants at 23°C (Fig 19e) combined with the discovery of a novel function of BTH in restricting T3E translocation (Fig. 19c) suggests that loss of SA may result in increased permeability of the cell to T3SS-mediated pathogenesis. This enhanced permeability coupled with temperature-mediated promotion of T3E translocation would result in the observed temperature-sensitivity of the ics1 mutant to effector delivery (Fig. 19e).  One outstanding question to be addressed is what is the mechanism responsible for loss of SA at elevated temperature? Based on in vitro activity assays, which show the ICS1 enzyme maintains >90% maximal activity from 4 to 37C228, and my data showing complete loss of ICS1 gene induction at 30°C, it seems likely that loss of SA biosynthesis and accumulation occurs upstream of ICS1 gene expression. However, ICS1 protein abundance and/or modifications occurring in planta at elevated temperature may affect ICS1 activity in addition to loss of ICS1 gene expression. In this study, I focused on testing various known negative regulators of ICS1-mediated SA biosynthesis, including components of JA-144, ET-102 and ABA-154, 157mediated signalling, to determine if one or more of these hormones could be responsible for the loss of SA production and subsequent enhanced susceptibility at 30°C. However, the aos JA-deficient mutant, the myc2/3/4 JA-signaling mutant, the ein2 and ein3 eil1 ET-signaling mutants and the aba2 ABA biosynthesis mutant showed similar levels of susceptibility as the WT plants at 30°C (Fig. 17a - e), indicating that none of these pathways is solely responsible for SA suppression at elevated temperature. While the camta2/3 mutant exhibited elevated resistance compared to  82  WT plants at 30°C (Fig. 17f), ICS1 gene induction remained compromised (Fig. 17g), indicating that CAMTA2 and CAMTA3 are not responsible for suppression of SA biosynthesis at elevated temperature. It is possible that loss of SA biosynthesis is due to loss of a positive regulator rather than enhanced suppression by a negative regulator. The high number of positive regulators that are compromised in induction at 30°C lends support to this theory. EDS5 is a multidrug and toxin extrusion transporter that functions in export of SA out of the chloroplast229. Although a mechanism has yet to be demonstrated, loss of stress-induced SA in the eds5 mutant has been proposed to occur due to autoinhibitory feedback loop229. As BTH-induction of EDS5 is compromised at elevated temperature, it is possible that loss of SA transport from the chloroplast to the cytosol is blocked at elevated temperature resulting in loss of SA biosynthesis. Retention of resistance in the camta2/3 mutants at 30°C in the absence of PR1/ICS1 gene induction could implicate involvement of an SA-independent process. However, I observed the same uncoupling between resistance and BTH-induction of PR1/ICS1 gene expression at 30°C (Fig. 18a, c). The observed retention of BTH-induced NPR1 nuclear accumulation (Fig. 9a, 10a), as well as the requirement for NPR1 and the TGA2, TGA5, TGA6 TFs (Fig. 19a, b) indicates that the core SA signaling pathway is utilized to facilitate this resistance at 30°C. Global transcriptome analysis of BTH-regulated genes revealed a temperature-sensitive bifurcation in the SA signaling pathway, with 66% of genes in the canonical PR1/ICS1 temperature-sensitive branch, and 34% of genes in the temperature-insensitive branch (Fig. 15a, 20). Future research should investigate whether plants treated with both BTH and Pst DC3000 exhibit a similar temperature-sensitive bifurcation in the SA signaling network at elevated temperature.  83  However, based on the lack of induction of PR1 and ICS1 by either BTH or Pst DC3000 alone (Fig. 4c, Fig. 7a) or in combination (Fig. 18c), it is possible that a major part of the SA-regulated transcriptome is dispensable for BTH-mediated protection against Pst DC3000 (Fig 20). This surprising result indicates that either the temperature-insensitive branch of the SA transcriptome and/or a gene expression-independent process underlies BTH-mediated resistance against Pst DC3000 at 30°C. It is also possible that the set of genes uniquely induced by BTH at elevated temperature (Group C) may compensate for the loss of the PR1/ICS1 temperature-sensitive branch to enable protection (Fig. 15a, 20).     84   Figure 20. Model for Arabidopsis  Pst DC3000 interaction at elevated temperature. At elevated temperature (depicted by sun), pathogen-induction of SA biosynthesis via the ICS1 enzyme is blocked and translocation of bacterial T3E proteins is enhanced to promote disease. SA signaling induced by the synthetic analogue, BTH, is also affected, with the PR1/ICS1 branch (group A in Fig. 15a) no longer induced. However, BTH-mediated resistance against Pst DC3000 is still conferred at elevated temperature in a NPR1- and TGA2/5/6-dependent manner. It is possible that genes in the temperature-insensitive branch (Group B) and/or genes in the elevated temperature + BTH-induced branch (Group C) are involved in BTH-mediated resistance under this condition.             represent direct positive interactions,           represents induction of ICS1 in response to pathogen detection and  represent inhibitory interactions.      85  In summary, I have studied the impact of one of the most important climate conditions, elevated temperature, on a model compatible plant-pathogen interaction. My results highlight pathogen-induced SA production as a key temperature-vulnerable step in the SA defense network. In addition, my study revealed a surprisingly positive effect of elevated temperature on T3E translocation in planta, which challenges the long-standing notion based on previous in vitro studies that an efficient T3SS requires a low temperature (e.g., 18°C to 20°C)51. Although not required for enhanced bacterial growth, COR-associated virulence is likely also increased at elevated temperature based on the dramatic increase in disease-associated chlorosis. Surprisingly, in spite of the increase in pathogen virulence and loss of the PR1/ICS1 branch of SA-dependent signaling at elevated temperature, I still observed BTH-mediated protection against Pst DC3000 infection. Although much of the SA-signaling network has been described13, little is known regarding the actual mechanism of protection against disease. My research also uncovered a novel function of BTH in restriction of bacterial T3E protein translocation into host cells, presumably as an important part of its protection mechanism. Because the SA pathway is an integral component of the plant immune system, I hope that the fundamental insights gained from this study will stimulate future research to uncover additional temperature-sensitive and -insensitive nodes of the plant immune system. This information should prove useful for genetic manipulation of climate-relevant components of the plant immune system to enhance plant resilience to combined adverse abiotic and biotic conditions.     86  Chapter 3  Future perspectives    87  There are many interesting questions to pursue regarding how environmental conditions affect plant-pathogen interactions. Of special interest would be repeating experiments with fluctuating day/night temperature cycles that more closely resemble natural conditions to determine whether lower temperatures during the night would enable SA biosynthesis in response to a pathogen in spite of elevated day time temperatures. As SA biosynthesis is light-dependent230, it is possible that day time temperatures are more relevant than night time temperatures, but it would be necessary to test this directly. Another line of inquiry would be to determine whether loss of the PR1/ICS1 branch of SA signaling at elevated temperature affects the broad-spectrum nature of BTH-mediated protection. This could be tested using different pathogens in Arabidopsis and/or more crop-relevant species. Some plants, such as rice, have elevated basal levels of SA and so have differences in regulation and signaling231. As a model monocot that is also an important crop, it would be interesting to repeat some of these experiments in rice to see what similarities and/or differences exist relative to Arabidopsis relating to the effect of elevated temperature on basal SA levels and induction of SA-signaling.   While there are many more such questions one might wish to pursue, in this final section, I will focus on potential strategies for addressing two main questions that are a more direct follow-up to the research I conducted for my dissertation: 1) What is the factor upstream of SA biosynthesis responsible for loss of ICS1 induction and SA accumulation at elevated temperature? and 2) How does BTH restrict T3E translocation to protect against Pst DC3000 infection?     88  Strategies for identifying the component upstream of ICS1 responsible for loss of SA biosynthesis at elevated temperature   It is currently unknown whether loss of ICS1 gene induction at elevated temperature is due to loss of a positive regulator or increased suppression by a negative regulator. During my dissertation research, I focused primarily on negative regulators of SA biosynthesis and/or signaling, and so assessed Jasmonic acid (JA)-biosythetic and signaling mutants, two ethylene (ET)-signaling mutants, an abscisic acid (ABA)-deficient mutant and the camta2/3 (CALMODULIN-BINDING TRANSCRIPTION ACTIVATOR) mutant. Although not included in the preceding chapter, a mutant deficient in PIF1, PIF3, PIF4 and PIF5 (pifq), was assessed to determine whether growth-defense tradeoffs are involved in loss of SA biosynthesis at elevated temperature. Based on similar levels of susceptibility of the pifq mutant and wild type plants to Pst DC3000 at 30°C, and lack of recovery of BTH-induction of ICS1 gene expression (see Appendix A, Fig. 22), I concluded that PIF-mediated growth responses are not responsible for enhanced susceptibility or loss of SA biosynthesis at elevated temperature.  It remains possible that the actual cause for loss of SA biosynthesis at elevated temperature is loss of a positive regulator. To test this, over-expression lines of known positive regulators, such as EDS1, PAD4, CBP60g, SARD1, etc., may be acquired or constructed to determine if ICS1 is expressed at 30°C. Another candidate that would be interesting to test is phytochrome B (phyB). Two recent Science papers have finally revealed phyB as a temperature sensor in addition to its function as a red-light photoceptor62, 63. SA-induction of PR1 is negatively affected in the phyB mutant, and is positively correlated with increasing light fluence. Although SA accumulation was also observed to be positively regulated by light, it was not affected in the phyB mutant, so it remains unclear whether phyB itself or another light-regulated factor may be  89  involved in regulation of SA biosynthesis. It would be interesting, however, to test both the phyB mutant and phyB temperature stable transgenic plants to determine whether this newly identified temperature sensor contributes in any way to loss of SA biosynthesis at 30°C.    In addition to the candidates mentioned above, several studies have been published recently identifying new regulatory components upstream of SA, including TFs that bind to its promoter232-234. As testing potential candidates one by one can be costly and time-consuming, an alternative approach would be to use a method like chromatin immunoprecipitation (ChIP) followed either by sequencing or PCR of known cis regulatory elements bound by TFs such as CBP60g or WRKY28235. This may reveal how temperature affects which positive and negative regulators bind the ICS1 gene promoter to regulate its expression. Of course, it is possible that the temperature-sensitive component is not a TF and so would not be identified with this method, or there could be multiple temperature-sensitive components involved. The latter case is probable based on the additional affects I observed on BTH-mediated signaling at elevated temperature. A more comprehensive approach would be to obtain or generate a reporter line, such as luciferase driven by the ICS1 gene promoter. This line could then be mutagenized and the resulting population screened for recovery of ICS1 induction at 30°C. One thing to keep in mind is that induction with BTH is not the same as induction with a pathogen. Although SA biosynthesis and signaling is activated by the plant as a defense mechanism, the pathogen will also induce genes, such as those involved in JA-, auxin- and/or ABA- signaling, to antagonize SA and promote susceptibility. It is possible, therefore, that a specific regulator may be compromised in response to pathogen but not BTH treatment, and vice versa. To help with this issue, it would be interesting and informative to compare the  90  global transcriptional profile following pathogen treatment with that observed following BTH-treatment at 23°C and 30°C. As indicated by the heat map generated using RNA-sequencing data from mock- or BTH-treated plants at 23°C and 30°C (Fig. 11), there is a gradient effect of temperature on BTH-induced genes. For instance, of the upstream regulators of SA biosynthesis that were in Group A (compromised in expression levels following BTH treatment at 30°C relative to 23°C), many were still induced by BTH, but to a much less extent.   Determining the mechanism for BTH-mediated restriction of T3E translocation The identification of T3E restriction by BTH is exciting, but more information is needed as to how this restriction occurs. Although not shown in the chapter above, I did confirm that restriction of T3E translocation occurs at 30°C and that it is NPR1-dependent (See Appendix A, Fig. 24). Unfortunately, it is difficult to conduct this experiment in such a way that the bacterial populations are equal within the BTH-treated plants at both temperatures, so these analyses require additional experimentation. Some of the outstanding questions are: Is the process transcription-dependent or -independent? Does it involve cell wall reinforcements to provide an extra physical barrier against penetration of the T3SS or does BTH act by suppressing the expression of virulence genes within the pathogen? In regards to transcriptional dependence, I identified a large number of genes, which comprise the PR1/ICS1 temperature-sensitive branch, that are not required for BTH-mediated protection against Pst DC3000. While I did observe that NPR1 is required for BTH-mediated reduction in T3E (Fig. 24), it is possible that the role of NPR1 in this process does not involve transcriptional changes. One way to determine this would be to use the NPR1-GR (glucocorticoid receptor) fusion transgenic line, which requires dexamethasone treatment for  91  nuclear accumulation of NPR1117. This line was used previously to show that NPR1 plays a role in antagonizing JA-signaling that does not require NPR1 nuclear localization236, so it remains possible that there are other cytosolic functions of the NPR1 protein.   The primary type of pathogen-induced cell wall fortification is callose deposition237; however, BTH-induction of callose deposition is blocked at 30°C (Fig. 7c, d). BTH-mediated reduction in T3E translocation was slightly compromised at 30°C relative to 23°C, but I still observed a significant decrease relative to mock-treated plants (Fig 24). It is possible that this negative effect on the efficiency of BTH at elevated temperature is due to loss of callose deposition; however, it is unlikely that callose deposition alone is responsible for the observed effect of BTH on T3E translocation. Lignin is also used to reinforce plant cell walls during defense238. The CAROTENOID AND CHLOROPLAST REGULATION 2 (CCR2) gene in Arabidopsis was shown to be specifically induced in response to pathogen detection. Interestingly, this gene is in Group C of my RNA-seq dataset, showing higher expression levels in response to BTH at 30°C relative to 23°C. Histochemical staining can be used to determine if BTH-induction of lignin occurs239, and, if so, how it is affected at elevated temperature. Lignin-compromised mutants could then be used to determine the role it may play in BTH-mediated restriction of T3E effectors. Finally, it is possible that BTH acts by suppressing the expression of T3E-associated genes within the pathogen. This is something I have wanted to test, but which has proven technically difficult. It is possible to isolate bacterial RNA from plant tissue, but the concentration is low, -to use for normalization of genes of interest for the purposes of qPCR. Over the last year, a  92  former member of the He lab has worked to identify and validate several such house-keeping genes, so this may be a feasible approach in the near future. In addition to measuring bacterial gene expression within the host, it would also be useful to look at protein abundance of bacterial T3E proteins for which antibodies are available, like AvrPto. Using these approaches in combination with the cAMP method for quantifying effector translocation may enable us to distinguish whether BTH acts strictly in preventing T3E entry into host cells and/or affects the quantity of T3E that are produced, thereby reducing overall translocation.  In conclusion, having a basic understanding of the molecular mechanisms governing plant-pathogen interactions, especially in the context of adverse climate conditions, is crucial for crop yield optimization. It is my hope that the work I have done during my graduate studies may help provide a foundation on which others, including those within the new Plant Resilience Center here at Michigan State University, can build towards achieving this goal.     93                       APPENDICES                         94  APPENDIX A  Additional data    95    Figure 21. Effect of temperature on SA marker gene induction in WT, npr1, coi1, myct2/3/4, and anac19/55/72 mutant plants. SA marker gene expression in WT vs. npr1 (a) coi1 (b) myc2/3/4 (c) and anac19 anac55 anac72 (anact) mutant plants. Plants were grown at 20°C (a, b) or 23°C (c, d) and temperature acclimated in test chambers at either the growth temperature (20°C/23°C) or 30°C 24 h before spraying with mock or BTH. Tissue for RNA extraction was collected 24 h after chemical treatment. qPCR was used for gene expression analysis, with expression of ICS1 and PR1 normalized to the expression of PP2AA3. Data are representative of one (c, d) or two (a, b) independent experiments, and are presented as the mean (n = 4) ± SEM. Letters indicate statistical significance based on a two-factor ANOVA with Tukey HSD post hoc analysis (P<0.05); samples sharing letters are not significantly different. Data were analyzed in two groups based on temperature as indicated by the prim  96   Figure 22. PHYTOCHROME INTERACTING FACTORs (PIFs) are not involved in enhanced susceptibility or loss of SA marker gene induction at elevated temperature. (a) Bacterial growth in temperature acclimated WT vs. pifq mutant plants three days after vacuum infiltration with Pst DC3000. (b) SA marker gene expression in WT vs. pifq mutant plants. Plants were grown at 20°C and temperature acclimated to test chambers at either 20°C or 30°C for 24 h, then sprayed with mock or BTH. Tissue for RNA extraction was collected 24 h after chemical treatment. qPCR was used for gene expression analysis, with expression of ICS1 and PR1 normalized to the expression of PP2AA3. Data are representative of two independent experiments, and are presented as the mean (n = 4) ± SEM. Letters indicate statistical significance based on a two-factor ANOVA with Tukey HSD post hoc analysis (P<0.05); samples sharing letters are not significantly different. Data in (b) were analyzed in two groups based on       97   Figure 23. DC3000-induction of ABA involves ABA2 but does not account for loss of SA. ABA marker gene expression (a) and SA and ABA metabolite quantification (c - d) in temperature acclimated WT and aba2 mutant plants 24 h after vacuum infiltration with mock or Pst DC3000. (a) qPCR was used for NCED3 gene expression analysis (n = 3), which was normalized to the expression of PP2AA3. (b, c) metabolites were quantified using LCMS (n = 4). An SA standard curve was used to determine the SA and SAG metabolite concentrations (nM) within each sample, which were then combined to get Total SA. An ABA standard curve was used to determine ABA concentrations. All sample concentrations were then converted to ng and normalized by sample fresh weight (FW) mass (g). Data are representative of two (a), three (b) and one (c) independent experiments, respectively. Data are presented as the mean ± standard error of the mean (SEM) with n = number of biological replicates. Letters indicate statistical significance based on a two-factor ANOVA with Tukey HSD post hoc analysis (P<0.05); samples sharing letters are not significantly different. Data in (c) were analyzed in two groups based on      98    Figure 24. BTH-mediated reduction of translocation of bacterial T3E proteins occurs at 30°C and requires NPR1. WT and npr1 mutant plants were temperature acclimated 24 h prior to syringe infiltration with mock, BTH or flg22 (500 nM). Plants were syringe infiltrated with Pst DC3000 PnptII::avrPto-cyaA (6.7 x 107 cfu ml-1) 24 h after chemical treatment. Tissue for cAMP quantification was collected 6 hpi. cAMP levels were normalized by total protein, and higher levels of cAMP indicate more translocation of bacterial effectors. Data are representative of two independent experiments, and are presented as the mean (n = 3) ± SEM. Letters indicate statistical significance based on a two-factor ANOVA with Tukey HSD post hoc analysis (P<0.05); samples sharing letters are not significantly different. Data were analyzed in two groups based      99    Figure 25. Effect of elevated temperature on JA marker gene induction in WT, coi1, npr1 and pifq mutant plants. JA marker gene expression in WT vs. coi1 (a) npr1 (b) and pifq (c) mutant plants. Plants were grown at 20°C and temperature acclimated to test chambers at either 20°C or 30°C for 24 h, then sprayed with mock or COR. Tissue for RNA extraction was collected 24 h after chemical treatment. qPCR was used for gene expression analysis, with expression of LOX2 and JAZ9 normalized to the expression of PP2AA3. Data are representative of two independent experiments, and are presented as the mean (n = 3) ± SEM. Letters indicate statistical significance based on a two-factor ANOVA with Tukey HSD post hoc analysis (P<0.05); samples sharing letters are not significantly different. Data in (b) were analyzed in two groups based on     100  APPENDIX B  Growth-defense tradeoffs in plants: a balancing act to optimize fitness           This was published as an invited review article: Huot B, Yao J, Montgomery BL and He SY (2014) Growth-defense tradeoffs in plants: a balancing act to optimize fitness. Molecular Plant 7(8): 1267-1287.         101  ABSTRACT  Growth-defense tradeoffs are thought to occur in plants due to resource restrictions, which demand prioritization towards either growth or defense depending on external and internal factors.  These tradeoffs have profound implications in agriculture and natural ecosystems, as both processes are vital for plant survival, reproduction and, ultimately, plant fitness.  While many of the molecular mechanisms underlying growth and defense tradeoffs remain to be elucidated, hormone crosstalk has emerged as a major player in regulating tradeoffs needed to achieve a balance.  In this review, we cover recent advances in understanding growth-defense tradeoffs in plants as well as what is known regarding the underlying molecular mechanisms.  Specifically, we address evidence supporting the growth-defense tradeoff concept, as well as known interactions between defense signaling and growth signaling.  Understanding the molecular basis of these tradeoffs in plants should provide a foundation for the development of breeding strategies that optimize the growth-defense balance to maximize crop yield to meet rising global food and biofuel demands.   Keywords: plant immunity; plant hormone; salicylic acid; jasmonate; PAMP; plant growth    102  INTRODUCTION While the deployment of defense mechanisms is imperative for plant survival, defense activation generally comes at the expense of plant growth (Fig. 20-defense -insect interactions, and is based on the assumption that plants possess a limited pool of resources that can be invested either in growth or in defense240-242.  As plants must both grow and defend in order to survive and reproduce, growth-defense tradeoffs have important ecological, agricultural and economic consequences.  In nature plants live in diverse and complex environments in which they constantly encounter a variety of pathogens and insect herbivores with a wide array of life styles and infection strategies.  In adaptation to such natural conditions, plants have evolved sophisticated mechanisms to balance growth and defense242-244.  However, in agricultural settings, crops have been bred for centuries to maximize growth-related traits resulting in a loss of genetic diversity that often compromises defense1.  Understanding the molecular mechanisms used by plants to balance growth and defense can enrich plant breeding and engineering strategies for selection of elite genetic traits that will maximize plant fitness.   In this review, we discuss the evidence supporting the concept of growth-defense tradeoffs in plants as well as the recent advances in deciphering the molecular mechanisms underlying their occurrence.  As numerous studies have implicated hormone crosstalk as having a fundamental role in fine-tuning the growth-defense process, we provide brief descriptions of each defense and growth signaling pathway to introduce key players, and then discuss relevant hormone-crosstalk.  Due to space constraints, we focus our discussion on tradeoffs between defenses mediated by pathogen-associated-molecular-pattern (PAMP)-triggered immunity (PTI), salicylic acid (SA) and jasmonate (JA) vs. growth mediated by auxin, brassinosteroids (BR) and gibberellins (GA), for which most progress has been made (Fig. 20).  Readers are referred to several recent reviews related to this topic, including discussions of the roles of ethylene (ET) and cytokinins120, 123, 231, 245-248.  We conclude with a summary of concepts that may be drawn from current knowledge as well as several key areas where further research is needed.     103   Figure 26. Plant growth-defense trade-offs. Plants use photosynthesis to convert light energy into chemical energy in the form of carbohydrates.  These resources are then allocated towards growth or defense depending on the presence/absence of specific stresses.  This process is facilitated by hormone crosstalk and is referred to as the growth-defense tradeoff.  BR, brassinosteroid; GA, gibberellin; PTI, pathogen-associated-molecular-pattern-triggered immunity; SA, salicylic acid; JA, jasmonates.     104  DEFENSE SIGNALING The ability to perceive and mount a rapid response to pathogen attack is critical for plant survival.  Plants have evolved a sophisticated immune system that is initiated upon detection of highly conserved PAMPs by membrane-associated pattern recognition receptors (PRRs), which leads to activation of PTI249, 250.  While PTI is believed to provide sufficient defense against non-pathogenic microbes, pathogens have developed the ability to secrete virulence effectors into the plant cell to suppress PTI and promote disease10, 48, 251.  Plants have evolved resistance (R) genes to recognize these effectors and activate a much stronger immune response, effector-triggered immunity (ETI), which often results in a type of programmed cell death response known as the hypersensitive response (HR) in pathogen-infected tissue5, 7, 40, 252.   ETI may also trigger secondary immune responses in distal, uninfected tissues and lead to so-called systemic acquired resistance (SAR)13, 253. Plant hormones are small organic molecules that are required by plants in low concentrations and regulate growth, development, reproduction and immune responses.  Changes in environmental signalsboth abiotic and bioticinduce changes in the quantity and composition of these signal molecules to facilitate appropriate plant responses120, 123, 254, 255.  Plant defense hormones such as SA, JA and ET play important roles in the precise regulation of plant immune responses both locally and systemically to co-ordinate plant defense against different types of pathogens and in different parts of the plant256-258.  SA signaling is primarily induced by and used to effectively defend against biotrophic pathogens, whereas JA signaling is primarily induced by and used to effectively defend against insect herbivores and, in conjunction with Et, against necrotrophic pathogens168, 259.  SA and JA signaling pathways are generally antagonistic to each other256.  For example, elevated SA signaling in response to biotrophic pathogens is often correlated with reduced JA signaling and decreased resistance to necrotrophic pathogens260.  The following sections provide brief summaries of PTI, SA and JA signaling pathways relevant to this review.  PAMP-Triggered Immunity   As mentioned above, PTI is triggered following detection of PAMPs by PRRs249.  The best characterized PRRs are leucine-rich repeat receptor kinases (LRR-RKs) consisting of an extracellular LRR domain, which can vary in the number of repeats and is directly involved in ligand perception, a transmembrane domain and an intracellular kinase domain261.  FLAGELLIN SENSING 2 (FLS2) and ELONGATION FACTOR-TU RECEPTOR (EFR) are LRR-RKs that recognize bacterial flagellin and bacterial EF-Tu, respectively262-265.  Upon ligand perception, both FLS2 and EFR rapidly recruit a LRR-RK, BRI1-ASSOCIATED RECEPTOR KINASE 1 (BAK1), resulting in their transphosphorylation266-269.  Treatment with flg22, a bioactive 22-amino acid peptide derived from bacterial flagellin, activates the FLS2/BAK1 co-receptor complex and triggers a phosphorylation cascade, including the phosphorylation and displacement of BOTRYTIS-INDUCED KINASE 1 (BIK1) from the FLS2 complex to promote the immune response270, 271.  Initial PTI responses occur within minutes to hours following PAMP perception, and include elevation of reactive oxygen species (ROS), calcium influx, activation of calcium/calmodulin-dependent kinases and of mitogen-activated protein kinase signaling cascades and  105  transcriptional reprogramming6, 250.  PTI-associated transcriptional reprogramming is facilitated in part by the WRKY family of transcription factors, members of which are involved in both positive and negative regulation of PTI119, 135, 272.  Later responses attributed to PTI activation include deposition of callose at the cell wall near the site of pathogen infection and seedling growth inhibition250, 273.  Salicylic Acid   SA is a phenolic hormone shown to affect many plant processes including growth, development, senescence and stress responses12, 274.  It is primarily recognized for its role in local defense induced against biotrophic and hemi-biotrophic pathogens and in the establishment of SAR13.  After years of searching, two recent studies have proposed NONEXPRESSOR OF PATHOGENESIS RELATED PROTEINS 1 (NPR1) and its paralogs, NPR3 and NPR4, to act as SA receptors111-113.  Multiple genetic screens led to the identification of NPR1, which is a key regulator of SA signaling103-106.  Under non-induced conditions, NPR1 proteins oligomerize in the cytoplasm107.  SA accumulation in response to pathogen detection triggers the release of NPR1 monomers, which then translocate to the nucleus and activate defense gene expression107-109.  NPR1 regulates gene expression through physical interaction with TGA transcription factors, which bind to promoters of PATHOGENESIS RELATED (PR) genes to activate expression in the presence of SA and repress expression in the absence of SA13, 115.  PR genes encode small proteins, some of which have been shown to possess antimicrobial or antifungal properties in vitro116.  Of the many PR genes identified, PR1, PR2 and PR5 have been shown to be induced by SA and have long been used as markers of SA signaling13.  Other genes identified as direct targets of NPR1 include WRKY transcription factors and components required for the synthesis and secretion of PR proteins117.  WRKYs are involved in both NPR1-dependent and NPR1-independent SA signaling and, as in the case of PTI, include both positive and negative regulators of SA-mediated defense13, 117-119.    Jasmonate   JAs are a group of lipid-derived hormones that regulate plant defense against necrotrophic pathogens and insect herbivores256 and also affect several other physiological processes including abiotic stress responses, reproductive development, and primary and secondary metabolism275, 276.  JA-isoleucine (Ile) is perceived by a co-receptor complex formed with the F-box protein CORONATINE INESENSTIVE 1 (COI1) and the JASMONATE ZIM-DOMAIN (JAZ) family of transcription repressors139.  COI1 is required for almost all known JA-dependent responses143, 277, 278.  The JAZ-family proteins repress JA signaling by directly binding to the MYC family of transcription factors required for the expression of JA-responsive genes140-142.  Under normal growth conditions where JA-Ile levels are low, JAZ proteins recruit co-repressors, TOPLESS (TPL) or TPL-related proteins, either directly through their ETHYLENE RESPONSE FACTOR-ASSOCIATED AMPHIFILIC REPRESSION (EAR) motifs, or indirectly through NOVEL INTERACTOR of JAZ (NINJA) protein to suppress MYC activities279, 280.  It was recently shown that physical association of JAZ proteins with MYC2 is required for the nuclear localization of JAZ repressors281; however, the mechanism for JAZ repression of MYC activity is not clearly understood.  Upon wounding or  106  pathogen attack, JA-Ile is rapidly synthesized in both local and distal tissues282, 283.  An increasing concentration of JA-Ile promotes physical interaction between COI1 and JAZ proteins, which leads to ubiquitination and subsequent degradation of JAZs through the 26S proteasome, thereby relieving the repression on MYC transcription factors and initiating the expression of JA-responsive genes140, 141, 143.    GROWTH PROMOTING HORMONE SIGNALING  Plant growth and development is coordinately regulated by a complement of hormones in order to optimize growth and reproduction284.  Growth hormones implicated in growth-defense tradeoffs are auxin, BRs, GAs and cytokinins.  As excellent reviews have been written on each of these hormones74, 255, 285, we will briefly describe what is known regarding the main signaling components for the three growth hormones relevant to this review.       Auxin  Auxins regulate many fundamental aspects of plant growth and development including stem and petiole elongation and root architecture in response to light, temperature and gravity255, 286-288.  Biosynthesis of indole-3-acetic acid (IAA), one of the primary auxins studied, occurs primarily in young leaves via multiple biosynthetic pathways and IAA is transported throughout the plant289, 290.  Once synthesized, accumulation of free IAA is regulated by GH3 proteins, which conjugate IAA with amino acids to yield metabolites for storage (IAA-alanine and IAA-leucine) or oxidation and degradation (IAA-aspartate and IAA-glutamic acid)291-293.  When auxin levels are low, auxin response genes are actively repressed by heterodimerization of the AUX/IAA family of transcriptional repressor proteins with the AUXIN RESPONSIVE FACTORS (ARF) family of transcription factors294-297.  The F-box proteins, TRANSPORT INHIBITOR RESISTANT 1 (TIR1) and AUXIN SIGNALING F-BOX (AFB), are substrate-recognition components of an SKP-Cullin-F box (SCF) E3 ubiquitin ligase complex, SCFTIR1/AFB 298, 299.  When auxin concentration reaches a threshold in the cell, auxin directly facilitates SCFTIR1/AFB binding to AUX/IAA proteins, resulting in the ubiquitination and degradation of AUX/IAA repressors via the 26S proteasome thereby de-repressing ARF-dependent transcription of auxin-regulated genes300-302.  Auxin-regulated genes include the AUX/IAA and GH3 gene families303, 304, expression of which forms part of a feedback mechanism to re-set auxin signaling homeostasis.  Brassinosteroids  BRs are polyhydroxylated steroid phytohormones that influence diverse developmental processes from seed germination to plant senescence305-307.  Plants that are insensitive to or deficient in BR signaling have severely stunted growth and are male infertile, whereas exogenous application of BR has a positive impact on the quality and quantity of crop yield305-308.  In the absence of BR, the glycogen-synthase-kinase-3-like kinase BRASSINOSTEROID INSENSITIVE 2 (BIN2) phosphorylates two nuclear-localized transcription factors, BRI1-EMS-SUPPRESSOR 1 (BES1) and BRASSINAZOLE-RESISTANT 1 (BZR1), to block activation of BR-responsive genes309-314.  The presence of BR stabilizes the BRASSINOSTEROID INSENSITIVE 1  107  (BRI1)/BAK1 co-receptor complex, causing activation of their respective kinase domains and subsequent transphosphorylation315-320.  The resulting cascade of phosphorylation events leads to the phosphorylation and inactivation of BIN2 kinase and the dephosphorylation and activation of BES1 and BZR1 to promote the expression of BR-regulated genes321, 322.  Gibberellins  GAs are tetracyclic diterpene acids that control seed development and germination, vegetative growth, and flower initiation and development74.  GA induces gene expression by relieving the repression of a family of transcriptional repressors known as DELLA proteins323, 324.  In the absence of bioactive GAs, DELLAs bind to and inactivate PHYTOCHROME INTERACTING FACTORS (PIFs), a group of bHLH-family transcription factors74.  The presence of a growth signal stimulates the biosynthesis of GA, which is perceived by GA INSENSTIVE DWARF 1 (GID1) through direct binding.  This leads to a conformational change of GID1, facilitating its binding to DELLA proteins325.  The formation of the GID1-DELLA complex enhances the interaction between DELLA and the F-box protein SLEEPY 1 in the SCFSLY1 E3 ubiquitin ligase complex, which results in DELLA ubiquitination and degradation that relieves PIF repression and promotes GA-mediated gene expression and growth326-329.  IN DEFENSE OF THE GROWTH TRADEOFF   Implementation of defense imposes a substantial demand for resources, which has been suggested to reduce growth.  This negative impact on growth could result from diminished photosynthesis, which would decrease the overall pool of energy reserves, and/or from a diversion of resources away from growth and towards defense.  As deficiencies in defense capabilities can result in pathogen-induced decimation of a plant population, a balance must be achieved between growth and defense to optimize plant fitness.    Finding Balance to Optimize Fitness  Fitness costs associated with defense have been clearly demonstrated25, 330-334.  For example, silencing components in JA-mediated defense signaling was shown to alleviate fitness costs observed in wild type plants334.  In the case of constitutive defense responses, reduced fitness may be due in part to unnecessary diversion of energy reserves away from growth in the absence of stress.  Benzothiadiazole (BTH) is a synthetic analog of SA used commercially to enhance disease resistance by inducing SAR in crops22, 194.  Application of BTH to wheat was observed to negatively impact fitness in the absence of pathogens335 and to increase fitness in the presence of powdery mildew22.  Another fitness cost attributed to constitutive defense is the inability of the plant to respond appropriately to environmental conditions that limit energy production.  In support of this, enhanced susceptibility to the hemi-biotrophic pathogen, Pseudomonas syringae (P. syringae), and the necrotrophic pathogen, Botrytis cinerea, is observed in shade-grown plants attributed to the need to prioritize growth under these light-restrictive conditions336-338.    108  While it is easy to understand the costs associated with constitutive defense, fitness is also compromised in the absence of defense.  Loss of NPR1-dependent, SA-mediated defense was shown to reduce the fitness of field-grown plants25, whereas overexpression of NPR1 was shown to enhance resistance to biotrophic and hemi-biotrophic pathogens without adversely affecting growth or fitness25, 339.  This is most likely due to the fact that SA signaling is not constitutively active but rather primed for quicker response to pathogen detection in these plants339.  Together these studies indicate that approaches used to achieve an enhanced primed state can ameliorate the fitness costs associated with constitutive defense, while optimizing the fitness benefits of rapid defense induction upon pathogen detection.  They also emphasize the point that increased growth is not equivalent to enhanced fitness.  Rather, plant fitness is optimized when growth and defense are appropriately prioritized in response to both environmental and developmental cues25, 340.      Impacts on Photosynthesis  Pathogen/herbivore activity that results in damage to photosynthetic machinery, loss of photosynthetic tissue and/or disruption of the vasculature affecting water and sugar transport has been shown to negatively impact photosynthesis341-345.  In addition, pathogen/herbivore attack has been shown to suppress components of photosynthesis at both the level of gene expression and of protein abundance344, 346-354.  The negative impact of defense on photosynthesis has been best demonstrated in response to JA treatment, which results in a reduction of components essential for light harvesting and carbon fixation346, 347, 355, 356 as well as a substantial decrease in photosynthetic activities and chlorophyll contents in Arabidopsis357.  Conversely, RuBPCase activase (RCA), which has a critical role in carbon fixation, has been shown to diminish JA-mediated defenses by promoting JA-Ile metabolism358. However, down-regulation of photosynthetic genes following defense activation does not always correlate with changes in protein profiles350, leading to the hypothesis that the stability of most photosynthetic proteins allows for a temporary halt at the transcriptional level without a significant impact on photosynthesis itself.  This appears to be supported by some studies using chlorophyll fluorescence to measure photosynthetic rates following infection with biotrophic, hemi-biotrophic or necrotrophic pathogens.  A similar spatial pattern has been reported for each pathogen type where inhibition of photosynthesis is confined to infected cells and is offset by elevated photosynthesis in the surrounding cells whereas no impact is observed in distal, uninfected tissues359-362.  Also, proteomic and biochemical analyses of resistant and susceptible plants have shown that the ability to maintain photosynthesis during infection is a vital element of defense341, 363.  Together, these studies indicate that the ability to appropriately maintain photosynthesis is crucial for defense.  Whether or not the observed effects on photosynthesis are a programmed part of the defense response or merely a by-product remains to be determined.  Resource Diversion   In support of the growth-defense tradeoff theory, diversion of plant resources has been shown to occur at all levels, including machinery involved in transcription, translation and  109  protein secretion from cells as well as prioritization of carbon and nitrogen towards production of defense compounds.  Transcriptomic and proteomic studies have demonstrated transcriptional reprogramming and altered protein profiles upon pathogen/herbivore detection to promote defense at the expense of growth117, 346-353.  Production and secretion of proteins with specific defensive properties, such as PR proteins, place a significant demand on the protein folding and secretory systems, which have also been shown to be required for defense364-366.  Allocation of resources involved in protein folding and secretion towards defense has been proposed to be regulated in part by TL1 BINDING TRANSCRIPTION FACTOR 1 (TBF1)366.   Many TBF1-regulated genes encode ER resident proteins involved in protein folding and secretion, and loss of TBF1 was shown to compromise the unfolded protein response as well as to impair PTI and SAR366.  Furthermore, tbf1 knockout mutants were shown to exhibit partial suppression of growth inhibition associated with defense activation, and transcriptional profiling of these mutants showed a general promotion of growth-related genes and repression of defense-related genes366.   Studies using radiolabeled carbon or nitrogen have shown that pathogen/herbivore detection alters the normal metabolic flux to enable the incorporation of these resources into defense-related compounds367, 368.  Reallocation of labeled nitrogen from ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO) into nicotine and phenolamide compounds following simulated herbivory was shown to rely on a functional JA pathway368.  Carbon availability has been shown to be important for SA-regulated defense, as starch-free mutants, which have a general reduction in carbohydrates compared with wild type plants, showed a delayed production of SA-regulated defense compounds resulting in increased susceptibility to the hemi-biotrophic pathogen Colletotrichum higginsianum367.  Carbohydrates are produced in -photosynthetic 369.  Upon pathogen infection in the leaves, this process is disrupted by up-regulation of cell wall invertases, which cleave sucrose into glucose and fructose thereby preventing sucrose export from infected cells369-372.  Transgenic suppression of cell wall invertase activity results in  elevated sucrose to hexose ratios accompanied by reduced and delayed callose deposition and inhibition of PR gene expression following pathogen infection371, 373, whereas ectopic expression of a yeast cell wall invertase has been shown to activate defense responses in tobacco374.  Comparison of resistant and susceptible barley interactions with the biotrophic fungal pathogen Blumeria graminis revealed a more robust activation of cell wall invertase in the resistant interaction resulting in accumulation of hexose sugars localized to regions of actively defending cells370.  In addition, a recent study has shown cell wall invertase activity to be a possible virulence target of the biotrophic pathogen, Xanthomonas campestris pv. vesicatoria, to promote disease in pepper375, providing further evidence supporting a role for cell wall invertases in redirecting carbon resources to enable plant defense.     Together these studies begin to reveal some of the regulatory mechanisms underlying resource reallocation to mediate the growth-defense tradeoff in plants.  Along with the co-opting of energy reserves and cellular machinery to produce compounds necessary for defense, transcriptional reprogramming induced by defense activation is often accompanied by repression of growth hormone signaling as a fundamental aspect of growth-defense tradeoffs.  In the following sections, we discuss current knowledge regarding crosstalk between defense signaling and growth hormone.    110    Figure 27. Known signaling contributing to growth-defense tradeoffs between PTI-mediated defense and auxin-, brassinosteroid (BR)- and gibberellin (GA)-mediated growth.  Black arrows and red, blunted lines represent positive and negative regulation, respectively.  Double helices with arrows represent global transcriptional reprogramming, and gray lines with dots at both ends indicate protein-protein interactions.  Solid lines indicate a known connection between two components, whereas dashed lines indicate unknown connections or missing steps between two components.  The solid blue line with an arrow represents TIR1/AFB genes, which are targeted by miR393.  FLS2, FLAGELLIN SENSING 2; ROS, reactive oxygen species; WRKY, WRKY DNA-BINDING PROTEIN; miR393, microRNA 393; TIR1, TRANSPORT INHIBITOR RESPONSE 1; AFB, AUXIN SIGNALING F-BOX; AUX/IAA, AUXIN-INDUCIBLE/INDOLE-3-ACETIC ACID INDUCIBLE; ARF, AUXIN RESPONSE FACTOR; BAK1, BRI1-ASSOCIATED RECEPTOR KINASE 1; BRI1, BRASSINOSTEROID INSENSITIVE 1; BSU1, BRI1 SUPPRESSOR 1; BIN2, BRASSINOSTEROID-INSENSITIVE 2; BES1, BRI1-EMS-SUPPRESSOR 1; BZR1, BRASSINAZOLE-RESISTANT 1; SLY1, SLEEPY 1; GID1, GA INSENSITIVE DWARF 1A; DELLA, repressor protein; PIF, PHYTOCHROME INTERACTING FACTOR.     111  PAMP-TRIGGERED IMMUNITY-MEDIATED DEFENSE VS. GROWTH   One of the most noticeable physiological consequences of prolonged or constitutively active PTI is growth inhibition, which is observed upon treatment of a plant with a PAMP264, 273.  As discussed in the previous section, there is mounting evidence to support a mechanism whereby resources normally allocated towards growth are diverted to support defense and, as discussed below, hormonal crosstalk appears to play a major role in regulating the tradeoff between growth and PTI-mediated defense.    PAMP-Triggered Immunity Crosstalk with Auxin   Auxin has long been implicated in suppressing plant defense due to the fact that many pathogens, including P. syringae and Agrobacterium tumefasciens, can directly synthesize auxin or manipulate auxin synthesis and signaling in plants to promote disease132-134, 136, 376.  Microorganisms primarily synthesize IAA from tryptophan, and in some cases the genes encoding the enzymes required for this process are located on a pathogen virulence plasmid133.  Analysis of plant transcriptional reprogramming following some pathogen infections has shown a general de-repression of the auxin pathway including promotion of auxin biosynthetic genes and repression of AUX/IAA genes resulting in enhanced plant susceptibility134, 135.  Furthermore, virulence of the bacterial hemi-biotrophic pathogen P. syringae pv. tomato DC3000 (Pto DC3000) can be enhanced by treatment with synthetic auxins prior to pathogen inoculation136, 137.   To combat the effects of pathogen produced or induced auxin to promote disease, plants actively suppress auxin signaling during defense377.  Following flg22-treatment, wild type Arabidopsis plants show a reduction in both transcript and protein levels of the auxin F-box receptors, resulting in stabilization of AUX/IAA proteins and repression of auxin-responsive genes137.  This suppression is partially due to the activity of the microRNA miR393 (Fig. 21), which is induced by flg22 and directly targets and cleaves TIR1, AFB2 and AFB3 transcripts137, 378, 379.  However, additional mechanisms such as transcriptional repression must also contribute to PTI inhibition of auxin signaling, as partial reduction in transcript levels is still observed in the DICER LIKE 1 (DCL1) mutant, dcl1-9, which is required for miR393 function137.  Also, the AFB1 transcript is partially resistant to miR393 activity, and shows reduced transcript levels in both wild type and dcl1-9 mutant plants137.   Suppression of auxin signaling has been shown to be biologically relevant to PTI, as overexpression of miR393 enhances resistance to virulent pathogens and overexpression of AFB1 increases susceptibility relative to that observed in wild type plants, as measured by bacterial growth137.  One study has shown that pathogen manipulation of auxin metabolism to generate higher levels of IAA-aspartate (IAA-Asp) promotes disease by positively regulating the expression of bacterial virulence genes rather than by directly suppressing PTI380.  This was shown to require the GH3.2 enzyme, as gh3.2 knockout plants exhibited reduced susceptibility to Pto DC3000380.  However, Mutka et al., (2013) were unable to reproduce these results, making the role of GH3.2 in this process unclear.  If GH3.2 is involved, it cannot fully account for auxin-induced susceptibility because gh3.2 knockout plants crossed with plants overexpressing the auxin biosynthetic gene, YUCCA 1, retained enhanced susceptibility129.  Therefore, while  112  there is much evidence to implicate auxin in promoting plant disease, the exact mechanism underlying this phenomenon remains unclear.  PAMP-Triggered Immunity Crosstalk with Brassinosteroids and Gibberellins  Unlike the mutually antagonistic interactions observed between PTI and auxin-mediated growth, negative crosstalk between PTI and BR-mediated growth is unidirectional381, 382.  Elevation of BR signaling in Arabidopsis using either transgenic modifications382, 383 or exogenous application of BR381 results in inhibition of flg22-mediated protection against Pto DC3000.  Conversely, treatment with brassinazole, which inhibits BR biosynthesis, elevates ROS production in response to PAMP treatment384, indicating that endogenous levels of BR are sufficient to suppress PTI.  Due to the association of BAK1 with both FLS2 and BRI1 receptors, it was hypothesized that FLS2 and BRI1 competition for BAK1 might facilitate BR-mediated suppression of PTI-mediated defense (Fig. 21).  However, while overexpression of BRI1 was shown to inhibit PTI responses in a BAK1-dependent manner382, neither exogenous BR nor expression of a hyperactive form of BRI1, BRI1sud1, were shown to affect FLS2-BAK1 complex formation, transphosphorylation or phosphorylation of downstream targets381, 384.   A recent study by Lozano-Duran et al. (2013) has shown that constitutively active BZR1, but not BES1, is sufficient to block PAMP-triggered ROS burst, gene expression and seedling growth inhibition (Fig. 21).  BZR1 inhibition of PTI appears to be mediated through its downstream targets, which include transcription factors known to promote BR responses and/or block defense384, 385.  For example, a group of WRKY transcription factors known to negatively regulate PTI were identified as BR-induced BZR1 targets384.  Of these, WRKY40 was shown to have a role in suppression of PAMP-induced ROS production and seedling growth inhibition.  It is possible that BZR1 and  WRKY40 act together to suppress PTI, as co-immunoprecipitation experiments indicated that these two proteins physically interact (Fig. 21), and analysis of publicly available gene expression data revealed that all WRKY40 regulated genes are also targets of BZR1384.  Another example of a BZR1 target involved in PTI suppression is HBI1, which encodes a bHLH transcription factor shown to promote BR-regulated cell elongation by inducing the expression of expansin genes386.  In addition to enhanced growth phenotypes, overexpression of HBI1 was shown to suppress PAMP-induced ROS and seedling growth inhibition downstream of FLS2-BAK1 complex formation385.  While the mechanism for HBI1-mediated suppression of PAMP-responses is not known, identification of specific defense gene targets of BZR1-regulated transcription factors, including the WRKYs identified by Lozano-Duran et al. (2013) begin to shed light on the molecular mechanism behind BR suppression of PTI-mediated defense.   GA suppression of PAMP-induced seedling growth inhibition most likely occurs through promotion of BR signaling.  BR- and GA-mediated signaling pathways work additively or synergistically to promote growth in response to environmental and developmental cues387, 388.  This cooperative relationship is facilitated in part by the formation of a BZR1/PIF4 heterodimer (Fig. 21), which binds to the promoters of some 2,000 shared target genes to promote growth75.  DELLA proteins have been shown to inhibit both BZR1 and PIF4 proteins and may also target the BZR1/PIF4 heterodimer389-391.  While exogenous application of GA did not affect PAMP-induced seedling growth inhibition, chemical inhibition of GA synthesis completely  113  blocked the effect of BR on seedling growth inhibition, and GA treatment in combination with BR resulted in an additive effect on PAMP-induced seedling growth inhibition384.  This is most likely due to the effect of GA on DELLA stabilization.  In the absence of GA, increased DELLA stabilization would result in BZR1 inhibition and loss of BR-mediated seedling growth inhibition (Fig. 21).  In support of this, flg22-induced stabilization of DELLA proteins has been shown to be a mechanism for PTI inhibition of GA-mediated growth392.    SALICYLIC ACID-MEDIATED DEFENSE VS. GROWTH    Suppression of growth by SA is best illustrated by constitutive defense mutants, which typically have a dwarf plant phenotype due in part to elevated SA accumulation or signaling124, 125; however, as these mutants may be perturbed in cellular processes other than SA defense, it is difficult to ascertain how SA itself is directly contributing to growth suppression in these plants.  To demonstrate the effect of SA on plant growth, experiments employing chemical inducers or genetic manipulation to alter SA accumulation or perception have been used.  Cold temperature-induced growth reduction in Arabidopsis has been shown to be due to endogenous elevation of SA as it was lost in plants compromised in SA accumulation83.  Also, repeated application of BTH reduced plant biomass in a reproducible and dose-dependent manner that was correlated with induction of SA-mediated defense responses126.  Mutants isolated in a screen based on resistance to BTH-induced growth inhibition were compromised in SA-mediated disease resistance and were primarily identified as non-functional alleles of NPR1393.  The mechanisms for SA-induced suppression of growth are most likely mediated by crosstalk with growth hormone signaling pathways, as discussed in the following sections.     114   Figure 28. Known signaling contributing to growth-defense tradeoffs between salicylic acid (SA)-mediated defense and auxin-, brassinosteroid (BR)- and gibberellin (GA)-mediated growth.  As in Figure 2, black arrows and red, blunted lines represent positive and negative regulation, respectively.  Double helices with arrows represent global transcriptional reprogramming, and solid lines associated with arrows represent specific genes and indicate an effect on gene expression.  Solid lines indicate a known connection between two components, whereas dashed lines indicate unknown connections or missing steps in between two components.  NPR1, NONEXPRESSOR OF PR GENES 1; TGA,TGACG SEQUENCE-SPECIFIC BINDING PROTEIN; PR,PATHOGENESIS RELATED; IAA, INDOLE-3-ACETIC ACID; Asp, aspartate; TIR1, TRANSPORT INHIBITOR RESPONSE 1; AFB, AUXIN SIGNALING F-BOX; AUX/IAA, AUXIN-INDUCIBLE/IAA INDUCIBLE; ARF, AUXIN RESPONSE FACTOR.     115  Salicylic Acid Crosstalk with Auxin  One of the primary ways SA has been shown to inhibit growth is by suppression of auxin signaling (Fig. 22).  A microarray study revealed that a number of auxin-responsive genes were affected by BTH treatment, i.e., twenty-one genes encoding proteins involved in auxin reception, import and export and signaling were down-regulated and two genes encoding GH3 enzymes were up-regulated117, 394.  As GH3 enzymes are responsible for regulating auxin homeostasis by conjugating IAA with different amino acids293, the transcriptional profile indicates a general BTH-dependent repression of auxin homeostasis and signaling.  A follow-up study confirmed this by investigating the effect of SA on auxin levels, uptake, sensitivity and signaling394.  It was shown that SA does not affect auxin synthesis, but instead represses the expression of the TIR1/ABF F-box genes (Fig. 22), resulting in stabilization of AUX/IAA repressor proteins to decrease auxin signaling394.   One of the two GH3 genes identified in the microarray study encodes GH3.5117, 394, which conjugates IAA with Asp293.  The gh3.5 knockout mutants were shown to be compromised in SAR while overexpression lines exhibited a dwarf phenotype, accumulated higher levels of SA, had elevated expression of PR1, and increased resistance to Pto DC3000395-397.  IAA-Asp is an inactive form of auxin that is targeted for catabolic metabolism291, 398; therefore, it would seem logical to infer that GH3.5 directly facilitates the growth-defense tradeoff between SA and auxin by simultaneously elevating SA levels and reducing active IAA levels.  However, the dwarf phenotype observed in several GH3.5 overexpression lines did not always correlate with a reduction in free IAA395, 396.  As GH3.5 expression is also induced by IAA to regulate its homeostasis304, 399, it is possible for GH3.5 to inhibit the auxin pathway directly by conjugating IAA and also indirectly by promoting SA biosynthesis and signaling, which then acts to block auxin responses (Fig. 22).   SA-mediated defense has also been shown to be affected by auxin, as transgenic overexpression of the AFB1 gene, which enhances auxin signaling, led to a reduction in pathogen-induced SA biosynthesis relative to wild type plants (Fig. 22)128.  However, transgenic overexpression of the YUCCA 1 gene showed that elevation of auxin levels alone can promote plant disease without affecting SA levels or signaling129.  Auxin positively regulates expansins, which are involved in cell wall loosening, to promote growth130, 131, and the ability of Xanthomonas oryzae pv oryzae to induce expansins in rice was shown to be important in determining the outcome of the plant-pathogen interaction131.  Together these studies indicate a dual function for auxin in direct interference with SA-mediated defense and in positive regulation of physiological changes that aid pathogen proliferation in the plant.  Salicylic Acid Crosstalk with Brassinosteroids and Gibberellins    There is much less known regarding the relationships between SA-mediated defense and BR- and GA-mediated growth.  BR treatment was shown to block BTH-mediated resistance in rice, indicating suppression of SA signaling400.  Based on analysis of mutant plants affected in SA production or NPR1-mediated signaling it was concluded that this antagonism occurs downstream of SA biosynthesis and upstream of NPR1 signaling (Fig. 22), but the mechanism for this suppression is unknown400.  A recent study showed that down-regulation of the gene  116  encoding the hydroxycinnamoyl CoA (HCT) enzyme resulted in stunted plant growth that was directly correlated with lignin reduction and endogenous SA elevation401.  These same plants were also shown to be impaired in both GA accumulation and perception401, 402.  Crosses between HCT RNAi plants and plants defective in SA biosynthesis, accumulation, or perception by NPR1 revealed that loss of SA production and accumulation, but not NPR1-dependent SA perception, was responsible for growth suppression in these plants401.  Loss of SA accumulation was also shown to restore gene induction and growth enhancement in response to exogenous GA, implicating SA in repression of GA-signaling and growth401.  As mentioned previously, BZR1 is directly targeted and suppressed by the DELLA family of growth-suppressing proteins390.  SA-mediated suppression of GA would most likely result in increased DELLA stability, which may lead to suppression of BR-mediated signaling.   Further studies are needed to both establish a molecular mechanism for SA-inhibition of GA signaling and to determine whether this suppression of GA results in loss or reduction in BR signaling.    JASMONATE-MEDIATED DEFENSE VS. GROWTH    It has long been known that activation of JA signaling by applying JA into the growth medium results in growth inhibition403.  Correlated with growth inhibition, JA suppresses mitosis, arrests the cell cycle in G1 prior to the S transition, and delays the switch from the mitotic cell cycle to the endoreduplication cycle404, 405.  Transcriptomic analysis further confirmed that JA activates several critical regulators of endoreduplication and affects the expression of key determinants of DNA replication404.  As in the case of PTI and SA-mediated defense, the effects of JA on growth appear to be mediated by crosstalk with growth hormone signaling.    117   Figure 29. Known signaling contributing to growth-defense tradeoffs between jasmonate (JA)-mediated defense and auxin-, brassinosteroid (BR)- and gibberellin (GA)-mediated growth.  Black arrows and red, blunted lines represent positive and negative regulation, respectively.  Double helices with arrows represent global transcriptional reprogramming, and solid lines with arrows represent specific genes and indicate an effect on gene expression.  Solid lines indicate a known connection between two components, whereas dashed lines indicate unknown connections or missing steps in between two components.  COI1, CORONATINE INSENSITIVE 1; JAZ, JASMONATE ZIM DOMAIN; MYC, transcription factor; SLY1, SLEEPY 1; GID1, GA INSENSITIVE DWARF 1A; DELLA, repressor protein; PIF, PHYTOCHROME INTERACTING FACTOR; PLT, PLETHORA.     118  Jasmonate Crosstalk with Auxin and Brassinosteroids  The auxin signaling pathway has been implicated in JA-induced growth inhibition in Arabidopsis (Fig. 23)406.  JA not only suppresses the expression of the auxin efflux carrier PINFORMED 2 (PIN2) but also inhibits PIN2 endocytosis and membrane accumulation329.  Consequently, the normal auxin distribution in roots is disrupted after JA treatment329.  Moreover, MYC2 has been shown to negatively regulate the expression of PLETHORA (PLT1 and PLT2) transcription factors407, which are important regulators of auxin-mediated root stem cell development and auxin biosynthesis in roots (Fig. 23)408.  Taken together, it is postulated that JA changes the spatial and temporal distribution pattern of auxin in plants to suppress normal plant growth mediated by auxin.  However, JA was also shown to increase auxin biosynthesis by inducing ANTHRANILATE SYNTHASE (ASA1 and ASB1) and YUCCA (YUC8 and YUC9) gene expression in certain plant tissues409, 410, and JA-induced auxin biosynthesis and lateral root formation were impaired in yuc knockout mutants410.  Conversely, auxin has been shown to induce expression of JAZ1, suggesting that auxin may suppress JA signaling through JAZ1 (Fig. 23)411.  These latter studies illustrate the complexity of the interaction between JA and auxin signaling pathways. BR signaling has also been implicated in antagonizing JA-induced growth suppression (Fig. 23)257.  The first indication of a connection between JA-mediated defense and BR-mediated growth was the identification of a partially suppressing coi1 ( psc1) mutant, which carries a mutation in a key enzyme involved in BR biosynthesis, DWARF 4 (DWF4)412.  In Arabidopsis the psc1 mutation partially suppresses the loss of JA-induced growth inhibition in the coi1 mutant background412 and displays increased JA-induced growth inhibition in the wild-type background413.  The negative impact of BR signaling on JA signaling has also been demonstrated in tomato, where BR was shown to antagonize several JA-dependent traits including trichome density and allelochemical content414.  Unlike in Arabidopsis, BR appears to act upstream of COI1 in tomato since loss of BR synthesis cannot suppress the tomato coi1 mutation (Fig. 23)414.  However, BR has also been shown to have positive effects on some JA-mediated traits, as JA-induced anthocyanin accumulation is reduced both in BR-biosynthetic mutants and a BR signaling mutant415, 416. Thus, as in the case of the JA-auxin interaction, the crosstalk between JA and BR appears to be complicated.   Jasmonate Crosstalk with Gibberellins   A wave of recent studies has shown an important role for JA-GA signaling crosstalk in regulating the growth-defense tradeoff (Fig. 23)185, 417-419.  In Nicotiana attenuata, elevated JA has a negative effect on GA biosynthesis in stems resulting in growth inhibition419.  In several Arabidopsis mutants in which the DELLA transcriptional repressors are stabilized, MYC2-dependent JA-responsive genes are hypersensitive to JA treatment resulting in increased growth inhibition417.  In addition, overexpression of a DELLA protein, RGA LIKE 3 (RGL3), which reduces GA-mediated growth, increases MYC2-dependent gene expression; whereas rgl3 mutation reduces MYC2-dependent gene expression418.  MYC2 has also been shown to positively regulate RGL3 by directly binding to the promoter of this gene, creating a positive feedback loop in JA signaling418.  Consistent with GA antagonism of JA signaling, DELLA  119  repressor proteins have been shown to be positive regulators of JA-mediated disease resistance against necrotrophic pathogens, as JA-mediated defense is compromised in DELLA loss-of-function mutants and is enhanced by overexpression of RGL3392, 418. Direct physical interaction between JAZ and DELLA repressor proteins turns out to be crucial for the JA-GA crosstalk in regulating growth and defense (Fig. 23)185, 417, 418.  JAZ proteins interact with the GRAS domain of DELLA proteins, which is important for the interaction between DELLAs and growth-promoting PIF transcription factors391.  JAZ binding to DELLA proteins was shown to block the interaction between DELLAs and PIFs, thereby relieving the inhibition of DELLAs on PIFs and promoting GA-dependent growth in Arabidopsis185.  Accordingly, Arabidopsis coi1 mutants, JAZ overexpression lines and COI1-silenced rice plants show enhanced growth; whereas Arabidopsis della mutants and PIF overexpression lines are compromised in JA-induced growth inhibition185.  These results suggest that in response to pathogen or herbivore attack, degradation of JAZ proteins makes more DELLA proteins available for interaction with and inhibition of PIF transcription factors as part of a mechanism to inhibit growth (Fig. 23)147, 185.  Conversely, GA has also been demonstrated to have a positive effect on some JA-mediated traits420.  The RGA DELLA protein can interact with and repress MYC2 activity resulting in inhibition of JA-mediated terpene biosynthesis; in this case, GA-mediated degradation of DELLAs promotes a specific JA-mediated trait420.  Together, these findings suggest that interactions between JA and GA signaling pathways can occur at multiple levels and in different directions, illustrating the dynamic nature of JA-GA crosstalk in regulating the growth-defense tradeoff.  CONCLUSIONS AND FUTURE PERSPECTIVES  Pathogen and herbivore-induced damage is known to reduce plant yield, causing substantial economic losses2, 421.  However, simply breeding plants to have constitutively active defense is not a viable solution as there are known fitness costs associated with the induction of defense responses25, 330-332, as well as conditions under which growth must be prioritized in spite of pathogen or herbivore attack336, 384.  Plants have evolved mechanisms, such as hormone crosstalk, to optimize fitness in response to the dynamic environments in which they live.  A critical step in harnessing this process for the improvement of crop performance is the identification of molecular targets responsible for implementing resource reallocation to facilitate prioritization of growth or defense.   Studies reviewed here and elsewhere have revealed a web of interconnected hormone signaling networks that enable fine-tuning of plant responses to environmental and developmental cues120, 123, 231, 245-248, 306.  However, it can be challenging to compare and integrate data collected using different experimental parameters i.e. plant growth conditions and/or age.  Untangling this web is also constrained by the tools and methods available.  For and protein profiles to some extent, the snapshots they provide are incapable of capturing the full range of dynamic temporal and spatial processes of growth-defense interactions.  Also, tools currently available to isolate or amplify certain effects, such as the use of exogenous application of elicitors/hormones and stable genetic manipulation, may result in the identification of interactions that do not exist in nature or fail to identify those that do330.   120  Other issues include the limitations of using whole seedlings or tissues to investigate changes occurring on a sub-organismal scale, and the relatively few studies conducted to investigate the effects of multiple or variable stresses on growth-defense interactions.   Therefore, while the use of simple laboratory conditions are essential for establishing foundational knowledge of individual signaling pathways, it will also be necessary in the future to design experiments that more accurately reflect natural environmentsfluctuating conditions, exposure to multiple stresses and field studiesto identify network interactions and to test putative molecular mechanisms.  As technology advances, the ability to observe plant growth and plant-pathogen/herbivore interactions at a cellular level and in a spatiotemporal manner will provide valuable insight towards elucidating the timing and sub-cellular localization of molecular interactions as well as to distinguish between local and global effects on plant growth and defense.  Understanding the specific molecular interactions that facilitate these tradeoffs will provide powerful tools to genetically tailor plants that optimize this balance to maximize crop yield in fluctuating environmental conditions.  FUNDING  Research in the authors' laboratories and preparation of this review article was supported by grants from the US Department of Energy (the Chemical Sciences, Geosciences, and Biosciences Division, Office of Basic Energy Sciences, Office of Science; DEFG0291ER20021), the National Institutes of Health (R01AI068718 and R01AI060761), and the Gordon and Betty Moore Foundation (GBMF3037) to SYH, and the National Science Foundation (MCB-0919100), to BM. BH is supported by the Michigan State University Enrichment Fellowship.  ACKNOWLEDGMENTS  We thank Andre Velasquez and Lori Imboden for critically reading and commenting on the manuscript and Marlene Cameron for her graphic design expertise.    121            LITERATURE CITED              122  LITERATURE CITED  1. Strange, R.N. & Scott, P.R. Plant disease: a threat to global food security. Annu. Rev. Phytopathol. 43, 83-116 (2005). 2. Oerke, E.C. Crop losses to pests. J. Agric. Sci. 144, 31-43 (2006). 3. Boyer, J.S. Plant productivity and environment. Science 218, 443-448 (1982). 4. Hamblin, M.T., Buckler, E.S. & Jannink, J.L. Population genetics of genomics-based crop improvement methods. Trends Genet. 27, 98-106 (2011). 5. Jones, J.D.G. & Dangl, J.L. The plant immune system. Nature 444, 323-329 (2006). 6. Dodds, P.N. & Rathjen, J.P. Plant immunity: towards an integrated view of plant-pathogen interactions. Nat. Rev. Genet. 11, 539-548 (2010). 7. Chisholm, S.T., Coaker, G., Day, B. & Staskawicz, B.J. Host-microbe interactions: shaping the evolution of the plant immune response. Cell 124, 803-814 (2006). 8. Lacombe, S. et al. Interfamily transfer of a plant pattern-recognition receptor confers broad-spectrum bacterial resistance. Nat. Biotechnol. 28, 365-369 (2010). 9. Macho, A.P. & Zipfel, C. Plant PRRs and the activation of innate immune signaling. Mol. Cell 54, 263-272 (2014). 10. Boller, T. & He, S.Y. Innate immunity in plants: an arms race between pattern recognition receptors in plants and effectors in microbial pathogens. Science 324, 742-744 (2009). 11. Tsuda, K. & Katagiri, F. Comparing signaling mechanisms engaged in pattern-triggered and effector-triggered immunity. Curr. Opin. Plant Biol. 13, 459-465 (2010). 12. Vlot, A.C., Dempsey, D.A. & Klessig, D.F. Salicylic acid, a multifaceted hormone to combat disease. Annu. Rev. Phytopathol. 47, 177-206 (2009). 13. Fu, Z.Q. & Dong, X.N. Systemic acquired resistance: turning local infection into global defense. Annu. Rev. Plant Biol. 64, 839-863 (2013). 14. Durrant, W.E. & Dong, X. Systemic acquired resistance. Annu. Rev. Phytopathol. 42, 185-209 (2004). 15. Sorahinobar, M. et al. Central role of salicylic acid in resistance of wheat against Fusarium graminearum. J. Plant Growth Regul. 35, 477-491 (2016). 16. Dean, R. et al. The top 10 fungal pathogens in molecular plant pathology. Mol. Plant Pathol. 13, 414-430 (2012).  123  17. Jacobs, J.M. et al. Ralstonia solanacearum requires PopS, an ancient AvrE-family effector, for virulence and to overcome salicylic acid-mediated defenses during tomato pathogenesis. mBio 4, e00875-00813 (2013). 18. Mansfield, J. et al. Top 10 plant pathogenic bacteria in molecular plant pathology. Mol. Plant Pathol. 13, 614-629 (2012). 19. Babu, R.M. et al. Induction of systemic resistance to Xanthomonas oryzae pv. oryzae by salicylic acid in Oryza sativa (L.). J. Plant Dis. Prot. 110, 419-431 (2003). 20. Halim, V.A. et al. Salicylic acid is important for basal defense of Solanum tuberosum against Phytophthora infestans. Mol. Plant Microbe Interact. 20, 1346-1352 (2007). 21. Kamoun, S. et al. The top 10 oomycete pathogens in molecular plant pathology. Mol. Plant Pathol. 16, 413-434 (2015). 22. Gorlach, J. et al. Benzothiadiazole, a novel class of inducers of systemic acquired resistance, activates gene expression and disease resistance in wheat. Plant Cell 8, 629-643 (1996). 23. Morris, S.W. et al. Induced resistance responses in maize. Mol. Plant Microbe Interact. 11, 643-658 (1998). 24. Chern, M., Fitzgerald, H.A., Canlas, P.E., Navarre, D.A. & Ronald, P.C. Overexpression of a rice NPR1 homolog leads to constitutive activation of defense response and hypersensitivity to light. Mol. Plant Microbe Interact. 18, 511-520 (2005). 25. Heidel, A.J., Clarke, J.D., Antonovics, J. & Dong, X.N. Fitness costs of mutations affecting the systemic acquired resistance pathway in Arabidopsis thaliana. Genetics 168, 2197-2206 (2004). 26. Colhoun, J. Effects of environmental factors on plant disease. Annu. Rev. Phytopathol. 11, 343-364 (1973). 27. Dickson, J.G. & Holbert, J.R. The relation of temperature to the development of disease in plants. Am. Nat. 62, 311-333 (1928). 28. Paul, P.A. & Munkvold, G.P. Influence of temperature and relative humidity on sporulation of Cercospora zeae-maydis and expansion of gray leaf spot lesions on maize Leaves. Plant Dis. 89, 624-630 (2005). 29. Samuel, G. Some experiments on inoculating methods with plant viruses, and on local lesions. Ann. Appl. Biol. 18, 494-507 (1931). 30. Kassanis, B. Some effects of high temperature on the susceptibility of plants to infection with viruses. Ann. Appl. Biol. 39, 358-369 (1952). 31. Jatala, P. & Russell, C.C. Nature of sweet potato resistance to Meloidogyne incognita and the effects of temperature on parasitism. J. Nematol. 4, 1-7 (1972).  124  32. Carter, W.W. Influence of soil temperature on Meloidogyne incognita resistant and susceptible cotton, Gossypium hirsutum J. Nematol. 14, 343-346 (1982). 33. Xiao, S.Y., Brown, S., Patrick, E., Brearley, C. & Turner, J.G. Enhanced transcription of the arabidopsis disease resistance genes RPW8.1 and RPW8.2 via a salicylic acid-dependent amplification circuit is required for hypersensitive cell death. Plant Cell 15, 33-45 (2003). 34. Yang, S.H. & Hua, J. A haplotype-specific Resistance gene regulated by BONZAI1 mediates temperature-dependent growth control in Arabidopsis. Plant Cell 16, 1060-1071 (2004). 35. Wang, Y., Bao, Z., Zhu, Y. & Hua, J. Analysis of temperature modulation of plant defense against biotrophic microbes. Mol. Plant Microbe Interact. 22, 498-506 (2009). 36. Zhu, Y., Qian, W.Q. & Hua, J. Temperature modulates plant defense responses through NB-LRR proteins. PLoS Pathog. 6, e1000844 (2010). 37. Mang, H.G. et al. Abscisic acid deficiency antagonizes high-temperature inhibition of disease resistance through enhancing nuclear accumulation of resistance proteins SNC1 and RPS4 in Arabidopsis. Plant Cell 24, 1271-1284 (2012). 38. Kathiria, P., Sidler, C., Woycicki, R., Yao, Y. & Kovalchuk, I. Effect of external and internal factors on the expression of reporter genes driven by the N resistance gene promoter. Plant Signal. Behav. 8, e24760 (2013). 39. Li, W., Xu, Y.P. & Cai, X.Z. Transcriptional and posttranscriptional regulation of the tomato leaf mould disease resistance gene Cf-9. Biochem. Biophys. Res. Commun. 470, 163-167 (2016). 40. Caplan, J., Padmanabhan, M. & Dinesh-Kumar, S.P. Plant NB-LRR immune receptors: from recognition to transcriptional reprogramming. Cell Host Microbe 3, 126-135 (2008). 41. de Jong, C.F., Takken, F.L.W., Cai, X.H., de Wit, P. & Joosten, M. Attenuation of Cf-mediated defense responses at elevated temperatures correlates with a decrease in elicitor-binding sites. Mol. Plant Microbe Interact. 15, 1040-1049 (2002). 42. Menna, A., Nguyen, D., Guttman, D.S. & Desveaux, D. Elevated temperature differentially influences effector-triggered immunity outputs in Arabidopsis. Front. Plant Sci. 6, 995 (2015). 43. Malamy, J., Hennig, J. & Klessig, D.F. Temperature-dependent induction of salicylic acid and its conjugates during the resistance response to tobacco mosaic virus infection. Plant Cell 4, 359-366 (1992). 44. Loon, L.C. & Antoniw, J.F. Comparison of the effects of salicylic acid and ethephon with virus-induced hypersensitivity and acquired resistance in tobacco. Neth. J. Plant Pathol. 88, 237-256 (1982). 45. White, R.F., Antoniw, J.F., Carr, J.P. & Woods, R.D. The effects of aspirin and polyacrylic acid on the multiplication and spread of TMV in different cultivars of tobacco with and without the N-gene. J. Phytopathol. 107, 224-232 (1983).  125  46. White, R.F. Acetylsalicylic acid (aspirin) induces resistance to tobacco mosaic virus in tobacco. Virology 99, 410-412 (1979). 47. Cheng, C. et al. Plant immune response to pathogens differs with changing temperatures. Nat. Commun. 4, 2530 (2013). 48. Xin, X.F. & He, S.Y. Pseudomonas syringae pv. tomato DC3000: a model pathogen for probing disease susceptibility and hormone signaling in plants. Annu. Rev. Phytopathol. 51, 473-498 (2013). 49. Penaloza-Vazquez, A., Preston, G.M., Collmer, A. & Bender, C.L. Regulatory interactions between the Hrp type III protein secretion system and coronatine biosynthesis in Pseudomonas syringae pv. tomato DC3000. Microbiology 146, 2447-2456 (2000). 50. He, S.Y., Nomura, K. & Whittam, T.S. Type III protein secretion mechanism in mammalian and plant pathogens. BBA Mol. Cell Res. 1694, 181-206 (2004). 51. Smirnova, A. et al. Thermoregulated expression of virulence factors in plant-associated bacteria. Arch. Microbiol. 176, 393-399 (2001). 52. Budde, I.P., Rohde, B.H., Bender, C.L. & Ullrich, M.S. Growth phase and temperature influence promoter activity, transcript abundance, and protein stability during biosynthesis of the Pseudomonas syringae phytotoxin coronatine. J. Bacteriol. 180, 1360-1367 (1998). 53. Wei, Z.M., Sneath, B.J. & Beer, S.V. Expression of Erwinia amylovora hrp genes in response to environmental stimuli. J. Bacteriol. 174, 1875-1882 (1992). 54. van Dijk, K. et al. The Avr (effector) proteins HrmA (HopPsyA) and AvrPto are secreted in culture from Pseudomonas syringae pathovars via the Hrp (type III) protein secretion system in a temperature- and pH-sensitive manner. J. Bacteriol. 181, 4790-4797 (1999). 55. Weingart, H., Stubner, S., Schenk, A. & Ullrich, M.S. Impact of temperature on in planta expression of genes involved in synthesis of the Pseudomonas syringae phytotoxin coronatine. Mol. Plant Microbe Interact. 17, 1095-1102 (2004). 56. Hockett, K.L., Burch, A.Y. & Lindow, S.E. Thermo-regulation of genes mediating motility and plant interactions in Pseudomonas syringae. PLoS One 8, e59850 (2013). 57. Huot, B., Yao, J., Montgomery, B.L. & He, S.Y. Growth-defense tradeoffs in plants: a balancing act to optimize fitness. Mol. Plant. 7, 1267-1287 (2014). 58. Wigge, P.A. Ambient temperature signalling in plants. Curr. Opin. Plant Biol. 16, 661-666 (2013). 59. Liu, J.Z., Feng, L.L., Li, J.M. & He, Z.H. Genetic and epigenetic control of plant heat responses. Front. Plant Sci. 6, 21 (2015). 60. Lorenzo, C.D., Sanchez-Lamas, M., Antonietti, M.S. & Cerdan, P.D. Emerging hubs in plant light and temperature signaling. Photochem. Photobiol. 92, 3-13 (2016).  126  61. Kumar, S.V. & Wigge, P.A. H2A.Z-containing nucleosomes mediate the thermosensory response in Arabidopsis. Cell 140, 136-147 (2010). 62. Jung, J.-H. et al. Phytochromes function as thermosensors in Arabidopsis. Science 354, 886-889 (2016). 63. Legris, M. et al. Phytochrome B integrates light and temperature signals in Arabidopsis. Science 354, 897-900 (2016). 64. Samach, A. & Wigge, P.A. Ambient temperature perception in plants. Curr. Opin. Plant Biol. 8, 483-486 (2005). 65. Penfield, S. Temperature perception and signal transduction in plants. New Phytol. 179, 615-628 (2008). 66. Quint, M. et al. Molecular and genetic control of plant thermomorphogenesis. Nat. Plants 2, 9 (2016). 67. Johansson, H. et al. Arabidopsis cell expansion is controlled by a photothermal switch. Nat. Commun. 5, 4848 (2014). 68. Lau, O.S. & Deng, X.W. Plant hormone signaling lightens up: integrators of light and hormones. Curr. Opin. Plant Biol. 13, 571-577 (2010). 69. Franklin, K.A. et al. PHYTOCHROME-INTERACTING FACTOR 4 (PIF4) regulates auxin biosynthesis at high temperature. Proc. Natl. Acad. Sci. U.S.A. 108, 20231-20235 (2011). 70. Sun, J., Qi, L., Li, Y., Chu, J. & Li, C. PIF4mediated activation of YUCCA8 expression integrates temperature into the auxin pathway in regulating Arabidopsis hypocotyl growth. PLoS Genet. 8, e1002594 (2012). 71. Gray, W.M., Ostin, A., Sandberg, G., Romano, C.P. & Estelle, M. High temperature promotes auxin-mediated hypocotyl elongation in Arabidopsis. Proc. Natl. Acad. Sci. U.S.A. 95, 7197-7202 (1998). 72. Wang, R.H. et al. HSP90 regulates temperature-dependent seedling growth in Arabidopsis by stabilizing the auxin co-receptor F-box protein TIR1. Nat. Commun. 7, 10269 (2016). 73. Stavang, J.A. et al. Hormonal regulation of temperature-induced growth in Arabidopsis. Plant J. 60, 589-601 (2009). 74. Sun, T.-p. The molecular mechanism and evolution of the GAGID1DELLA signaling module in plants. Curr. Biol. 21, R338-R345 (2011). 75. Oh, E., Zhu, J.Y. & Wang, Z.Y. Interaction between BZR1 and PIF4 integrates brassinosteroid and environmental responses. Nat. Cell Biol. 14, 802-809 (2012).  127  76. Zhang, L.-Y. et al. Antagonistic HLH/bHLH transcription factors mediate brassinosteroid regulation of cell elongation and plant development in rice and Arabidopsis. Plant Cell 21, 3767-3780 (2009). 77. Song, L.L., Jiang, Y.L., Zhao, H.Q. & Hou, M.F. Acquired thermotolerance in plants. Plant Cell Tissue Organ Cult. 111, 265-276 (2012). 78. Clarke, S.M., Mur, L.A.J., Wood, J.E. & Scott, I.M. Salicylic acid dependent signaling promotes basal thermotolerance but is not essential for acquired thermotolerance in Arabidopsis thaliana. Plant J. 38, 432-447 (2004). 79. Larkindale, J., Hall, J.D., Knight, M.R. & Vierling, E. Heat stress phenotypes of Arabidopsis mutants implicate multiple signaling pathways in the acquisition of thermotolerance. Plant Physiol. 138, 882-897 (2005). 80. Vicente, M.R.S. & Plasencia, J. Salicylic acid beyond defence: its role in plant growth and development. J. Ex. Bot. 62, 3321-3338 (2011). 81. Miura, K. & Tada, Y. Regulation of water, salinity, and cold stress responses by salicylic acid. Front. Plant Sci. 5, 4 (2014). 82. Dat, J.F., Foyer, C.H. & Scott, I.M. Changes in salicylic acid and antioxidants during induced thermotolerance in mustard seedlings. Plant Physiol. 118, 1455-1461 (1998). 83. Scott, I.M., Clarke, S.M., Wood, J.E. & Mur, L.A.J. Salicylate accumulation inhibits growth at chilling temperature in Arabidopsis. Plant Physiol. 135, 1040-1049 (2004). 84. Kim, Y., Park, S., Gilmour, S.J. & Thomashow, M.F. Roles of CAMTA transcription factors and salicylic acid in configuring the low-temperature transcriptome and freezing tolerance of Arabidopsis. Plant J. 75, 364-376 (2013). 85. Larkindale, J. & Knight, M.R. Protection against heat stress-induced oxidative damage in Arabidopsis involves calcium, abscisic acid, ethylene, and salicylic acid. Plant Physiol. 128, 682-695 (2002). 86. Dempsey, D.M.A., Vlot, A.C., Wildermuth, M.C. & Klessig, D.F. Salicylic acid biosynthesis and metabolism. The Arabidopsis Book, e0156 (2011). 87. Tsuda, K., Sato, M., Glazebrook, J., Cohen, J.D. & Katagiri, F. Interplay between MAMP-triggered and SA-mediated defense responses. Plant J. 53, 763-775 (2008). 88. Malamy, J., Carr, J.P., Klessig, D.F. & Raskin, I. Salicylic acid: a likely endogenous signal in the resistance response of tobacco to viral infection. Science 250, 1002-1004 (1990). 89. Wildermuth, M.C., Dewdney, J., Wu, G. & Ausubel, F.M. Isochorismate synthase is required to synthesize salicylic acid for plant defence. Nature 414, 562-565 (2001).  128  90. Enyedi, A.J., Yalpani, N., Silverman, P. & Raskin, I. Localization, conjugation, and function of salicylic acid in tobacco during the hypersensitive reaction to tobacco mosaic virus. Proc. Natl. Acad. Sci. U.S.A. 89, 2480-2484 (1992). 91. Metraux, J.P. et al. Increase in salicylic acid at the onset of systemic acquired resistance in cucumber. Science 250, 1004-1006 (1990). 92. Gaffney, T. et al. Requirement of salicylic-acid for the induction of systemic acquired-resistance. Science 261, 754-756 (1993). 93. Delaney, T.P. et al. A central role of salicylic-acid in plant-disease resistance. Science 266, 1247-1250 (1994). 94. Zhou, N., Tootle, T.L., Tsui, F., Klessig, D.F. & Glazebrook, J. PAD4 functions upstream from salicylic acid to control defense responses in Arabidopsis. Plant Cell 10, 1021-1030 (1998). 95. Jirage, D. et al. Arabidopsis thaliana PAD4 encodes a lipase-like gene that is important for salicylic acid signaling. Proc. Natl. Acad. Sci. U.S.A. 96, 13583-13588 (1999). 96. Feys, B.J., Moisan, L.J., Newman, M.-A. & Parker, J.E. Direct interaction between the Arabidopsis disease resistance signaling proteins, EDS1 and PAD4. The EMBO Journal 20, 5400-5411 (2001). 97. Falk, A. et al. EDS1, an essential component of R gene-mediated disease resistance in Arabidopsis has homology to eukaryotic lipases. Proc. Natl. Acad. Sci. U.S.A. 96, 3292-3297 (1999). 98. Zhang, Y.X. et al. Control of salicylic acid synthesis and systemic acquired resistance by two members of a plant-specific family of transcription factors. Proc. Natl. Acad. Sci. U.S.A. 107, 18220-18225 (2010). 99. van Verk, M.C., Bol, J.F. & Linthorst, H.J.M. WRKY transcription factors involved in activation of SA biosynthesis genes. BMC Plant Biol. 11, 89 (2011). 100. Du, L. et al. Ca2+/calmodulin regulates salicylic-acid-mediated plant immunity. Nature 457, 1154-1158 (2009). 101. Nie, H. et al. SR1, a calmodulin-binding transcription factor, modulates plant defense and ethylene-induced senescence by directly regulating NDR1 and EIN3. Plant Physiol. 158, 1847-1859 (2012). 102. Chen, H. et al. ETHYLENE INSENSITIVE3 and ETHYLENE INSENSITIVE3-LIKE1 repress SALICYLIC ACID INDUCTION DEFICIENT2 expression to negatively regulate plant innate immunity in Arabidopsis. Plant Cell 21, 2527-2540 (2009). 103. Cao, H., Bowling, S.A., Gordon, A.S. & Dong, X.N. Characterization of an Arabidopsis mutant that is nonresponsive to inducers of systemic acquired-resistance. Plant Cell 6, 1583-1592 (1994).  129  104. Cao, H., Glazebrook, J., Clarke, J.D., Volko, S. & Dong, X.N. The Arabidopsis NPR1 gene that controls systemic acquired resistance encodes a novel protein containing ankyrin repeats. Cell 88, 57-63 (1997). 105. Delaney, T.P., Friedrich, L. & Ryals, J.A. Arabidopsis signal-transduction mutant defective in chemically and biologically induced disease resistance. Proc. Natl. Acad. Sci. U.S.A. 92, 6602-6606 (1995). 106. Shah, J., Tsui, F. & Klessig, D.F. Characterization of a salicylic acid-insensitive mutant (sai1) of Arabidopsis thaliana, identified in a selective screen utilizing the SA-inducible expression of the tms2 gene. Mol. Plant Microbe Interact. 10, 69-78 (1997). 107. Mou, Z., Fan, W.H. & Dong, X.N. Inducers of plant systemic acquired resistance regulate NPR1 function through redox changes. Cell 113, 935-944 (2003). 108. Tada, Y. et al. Plant immunity requires conformational charges of NPR1 via S-nitrosylation and thioredoxins. Science 321, 952-956 (2008). 109. Kinkema, M., Fan, W.H. & Dong, X.N. Nuclear localization of NPR1 is required for activation of PR gene expression. Plant Cell 12, 2339-2350 (2000). 110. Spoel, S.H. et al. Proteasome-mediated turnover of the transcription coactivator NPR1 plays dual roles in regulating plant immunity. Cell 137, 860-872 (2009). 111. Fu, Z.Q. et al. NPR3 and NPR4 are receptors for the immune signal salicylic acid in plants. Nature 486, 228-232 (2012). 112. Wu, Y. et al. The Arabidopsis NPR1 protein is a receptor for the plant defense hormone salicylic acid. Cell Reports 1, 639-647 (2012). 113. Attaran, E. & He, S.Y. The long-sought-after salicylic acid receptors. Mol. Plant. 5, 971-973 (2012). 114. Saleh, A. et al. Posttranslational modifications of the master transcriptional regulator NPR1 enable dynamic but tight control of plant immune responses. Cell Host Microbe 18, 169-182 (2015). 115. Zhang, Y., Tessaro, M.J., Lassner, M. & Li, X. Knockout analysis of Arabidopsis transcription factors TGA2, TGA5, and TGA6 reveals their redundant and essential roles in systemic acquired resistance. Plant Cell 15, 2647-2653 (2003). 116. van Loon, L.C., Rep, M. & Pieterse, C.M.J. Significance of inducible defense-related proteins in infected plants. Annu. Rev. Phytopathol. 44, 135-162 (2006). 117. Wang, D., Amornsiripanitch, N. & Dong, X.N. A genomic approach to identify regulatory nodes in the transcriptional network of systemic acquired resistance in plants. PLoS Pathog. 2, 1042-1050 (2006).  130  118. Yu, D.Q., Chen, C.H. & Chen, Z.X. Evidence for an important role of WRKY DNA binding proteins in the regulation of NPR1 gene expression. Plant Cell 13, 1527-1539 (2001). 119. Rushton, P.J., Somssich, I.E., Ringler, P. & Shen, Q.J. WRKY transcription factors. Trends Plant Sci. 15, 247-258 (2010). 120. Denance, N., Sanchez-Vallet, A., Goffner, D. & Molina, A. Disease resistance or growth: the role of plant hormones in balancing immune responses and fitness costs. Front. Plant Sci. 4, 155 (2013). 121. Spoel, S.H. & Dong, X.N. Making sense of hormone crosstalk during plant immune responses. Cell Host Microbe 3, 348-351 (2008). 122. Kissoudis, C., van de Wiel, C., Visser, R.G.F. & van der Linden, G. Enhancing crop resilience to combined abiotic and biotic stress through the dissection of physiological and molecular crosstalk. Front. Plant Sci. 5, 207 (2014). 123. Robert-Seilaniantz, A., Grant, M. & Jones, J.D.G. Hormone crosstalk in plant disease and defense: more than just jasmonate-salicylate antagonism. Annu. Rev. Phytopathol. 49, 317-343 (2011). 124. Clarke, J.D., Volko, S.M., Ledford, H., Ausubel, F.M. & Dong, X.N. Roles of salicylic acid, jasmonic acid, and ethylene in cpr-induced resistance in Arabidopsis. Plant Cell 12, 2175-2190 (2000). 125. Zhang, Y.L., Goritschnig, S., Dong, X.N. & Li, X. A gain-of-function mutation in a plant disease resistance gene leads to constitutive activation of downstream signal transduction pathways in suppressor of npr1-1, constitutive 1. Plant Cell 15, 2636-2646 (2003). 126. Canet, J.V., Dobon, A., Ibanez, F., Perales, L. & Tornero, P. Resistance and biomass in Arabidopsis: a new model for salicylic acid perception. Plant Biotechnol. J. 8, 126-141 (2010). 127. Hua, J. Modulation of plant immunity by light, circadian rhythm, and temperature. Curr. Opin. Plant Biol. 16, 406-413 (2013). 128. Robert-Seilaniantz, A. et al. The microRNA miR393 re-directs secondary metabolite biosynthesis away from camalexin and towards glucosinolates. Plant J. 67, 218-231 (2011). 129. Mutka, A.M., Fawley, S., Tsao, T. & Kunkel, B.N. Auxin promotes susceptibility to Pseudomonas syringae via a mechanism independent of suppression of salicylic acid-mediated defenses. Plant J. 74, 746-754 (2013). 130. Cosgrove, D.J. Growth of the plant cell wall. Nat. Rev. Mol. Cell Biol. 6, 850-861 (2005). 131. Ding, X.H. et al. Activation of the indole-3-acetic acid-amido synthetase GH3-8 suppresses expansin expression and promotes salicylate- and jasmonate-independent basal immunity in rice. Plant Cell 20, 228-240 (2008). 132. Glickmann, E. et al. Auxin production is a common feature of most pathovars of Pseudomonas syringae. Mol. Plant Microbe Interact. 11, 156-162 (1998).  131  133. Yamada, T. The role of auxin in plant-disease development. Annu. Rev. Phytopathol. 31, 253-273 (1993). 134. O'Donnell, P.J. et al. Susceptible to intolerance - a range of hormonal actions in a susceptible Arabidopsis pathogen response. Plant J. 33, 245-257 (2003). 135. Thilmony, R., Underwood, W. & He, S.Y. Genome-wide transcriptional analysis of the Arabidopsis thaliana interaction with the plant pathogen Pseudomonas syringae pv. tomato DC3000 and the human pathogen Escherichia coli O157 : H7. Plant J. 46, 34-53 (2006). 136. Chen, Z.Y. et al. Pseudomonas syringae type III effector AvrRpt2 alters Arabidopsis thaliana auxin physiology. Proc. Natl. Acad. Sci. U.S.A. 104, 20131-20136 (2007). 137. Navarro, L. et al. A plant miRNA contributes to antibacterial resistance by repressing auxin signaling. Science 312, 436-439 (2006). 138. Caarls, L., Pieterse, C.M.J. & Van Wees, S.C.M. How salicylic acid takes transcriptional control over jasmonic acid signaling. Front. Plant Sci. 6, 170 (2015). 139. Sheard, L.B. et al. Jasmonate perception by inositol-phosphate-potentiated COI1-JAZ co-receptor. Nature 468, 400-405 (2010). 140. Chini, A. et al. The JAZ family of repressors is the missing link in jasmonate signalling. Nature 448, 666-671 (2007). 141. Thines, B. et al. JAZ repressor proteins are targets of the SCFCO11 complex during jasmonate signalling. Nature 448, 661-665 (2007). 142. Yan, Y.X. et al. A downstream mediator in the growth repression limb of the jasmonate pathway. Plant Cell 19, 2470-2483 (2007). 143. Katsir, L., Schilmiller, A.L., Staswick, P.E., He, S.Y. & Howe, G.A. COI1 is a critical component of a receptor for jasmonate and the bacterial virulence factor coronatine. Proc. Natl. Acad. Sci. U.S.A. 105, 7100-7105 (2008). 144. Zheng, X.Y. et al. Coronatine promotes Pseudomonas syringae virulence in plants by activating a signaling cascade that inhibits salicylic acid accumulation. Cell Host Microbe 11, 587-596 (2012). 145. Gimenez-Ibanez, S. et al. The bacterial effector HopX1 targets JAZ transcriptional repressors to activate jasmonate signaling and promote infection in Arabidopsis. PLoS Biol. 12, e1001792 (2014). 146. Jiang, S.S. et al. Bacterial effector activates jasmonate signaling by directly targeting JAZ transcriptional repressors. PLoS Pathog. 9, e1003715 (2013). 147. Kazan, K. & Manners, J.M. MYC2: the master in action. Mol. Plant. 6, 686-703 (2013). 148. Cao, F.Y., Yoshioka, K. & Desveaux, D. The roles of ABA in plant-pathogen interactions. J. Plant Res. 124, 489-499 (2011).  132  149. de Zelicourt, A., Colcombet, J. & Hirt, H. The role of MAPK modules and ABA during abiotic stress signaling. Trends Plant Sci. 21, 677-685 (2016). 150. Melotto, M., Underwood, W., Koczan, J., Nomura, K. & He, S.Y. Plant stomata function in innate immunity against bacterial invasion. Cell 126, 969-980 (2006). 151. Audenaert, K., De Meyer, G.B. & Hofte, M.M. Abscisic acid determines basal susceptibility of tomato to Botrytis cinerea and suppresses salicylic acid-dependent signaling mechanisms. Plant Physiol. 128, 491-501 (2002). 152. Mohr, P.G. & Cahill, D.M. Abscisic acid influences the susceptibility of Arabidopsis thaliana to Pseudomonas syringae pv. tomato and Peronospora parasitica. Funct. Plant Biol. 30, 461-469 (2003). 153. Fan, J., Hill, L., Crooks, C., Doerner, P. & Lamb, C. Abscisic acid has a key role in modulating diverse plant-pathogen interactions. Plant Physiol. 150, 1750-1761 (2009). 154. Yasuda, M. et al. Antagonistic interaction between systemic acquired resistance and the abscisic acidmediated abiotic stress response in Arabidopsis. Plant Cell 20, 1678-1692 (2008). 155. Jiang, C.J. et al. Abscisic acid interacts antagonistically with salicylic acid signaling pathway in rice-Magnaporthe grisea interaction. Mol. Plant Microbe Interact. 23, 791-798 (2010). 156. Ding, Y., Dommel, M. & Mou, Z. Abscisic acid promotes proteasome-mediated degradation of the transcription coactivator NPR1 in Arabidopsis thaliana. Plant J. 86, 20-34 (2016). 157.  et al. Pseudomonas syringae pv. tomato hijacks the Arabidopsis abscisic acid signalling pathway to cause disease. The EMBO Journal 26, 1434-1443 (2007). 158. de Torres Zabala, M., Bennett, M.H., Truman, W.H. & Grant, M.R. Antagonism between salicylic and abscisic acid reflects early host-pathogen conflict and moulds plant defence responses. Plant J. 59, 375-386 (2009). 159. Chakraborty, S. & Newton, A.C. Climate change, plant diseases and food security: an overview. Plant Pathol. 60, 2-14 (2011). 160. Veremis, J.C. & Roberts, P.A. Relationships between Meloidogyne incognita resistance genes in Lycopersicon peruvianum differentiated by heat sensitivity and nematode virulence. Theort. Appl. Genet. 93, 950-959 (1996). 161. Bryant, R.R.M. et al. A change in temperature modulates defence to yellow (stripe) rust in wheat line UC1041 independently of resistance gene Yr36. BMC Plant Biol. 14, 10 (2014). 162. Crampton, B.G., Hein, I. & Berger, D.K. Salicylic acid confers resistance to a biotrophic rust pathogen, Puccinia substriata, in pearl millet (Pennisetum glaucum). Mol. Plant Pathol. 10, 291-304 (2009). 163. Maksimov, I., Troshina, N., Surina, O. & Cherepanova, E. Salicylic acid increases the defense reaction against bunt and smut pathogens in wheat calli. J. Plant Interact. 9, 306-314 (2014).  133  164. Silva, K.J., Brunings, A., Peres, N.A., Mou, Z. & Folta, K.M. The Arabidopsis NPR1 gene confers broad-spectrum disease resistance in strawberry. Transgenic Res. 24, 693-704 (2015). 165. Atkinson, N.J. & Urwin, P.E. The interaction of plant biotic and abiotic stresses: from genes to the field. J. Ex. Bot. 63, 3523-3543 (2012). 166. Mittler, R. & Blumwald, E. Genetic engineering for modern agriculture: challenges and perspectives. Annu. Rev. Plant Biol. 61, 443-462 (2010). 167. Tanksley, S.D. & McCouch, S.R. Seed banks and molecular maps: unlocking genetic potential from the wild. Science 277, 1063-1066 (1997). 168. Glazebrook, J. Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annu. Rev. Phytopathol. 43, 205-227 (2005). 169. Pajerowska-Mukhtar, K.M., Emerine, D.K. & Mukhtar, M.S. Tell me more: roles of NPRs in plant immunity. Trends Plant Sci. 18, 402-411 (2013). 170. Uknes, S. et al. Acquired resistance in Arabidopsis. Plant Cell 4, 645-656 (1992). 171. Maleck, K. et al. The transcriptome of Arabidopsis thaliana during systemic acquired resistance. Nature Genet. 26, 403-410 (2000). 172. Chern, M.S. et al. Evidence for a disease-resistance pathway in rice similar to the NPR1-mediated signaling pathway in Arabidopsis. Plant J. 27, 101-113 (2001). 173. Guzmán, P. & Ecker, J.R. Exploiting the triple response of Arabidopsis to identify ethylene-related mutants. Plant Cell 2, 513-523 (1990). 174. Leon-Kloosterziel, K.M. et al. Isolation and characterization of abscisic acid-deficient Arabidopsis mutants at two new loci. Plant J. 10, 655-661 (1996). 175. Dewdney, J. et al. Three unique mutants of Arabidopsis identify eds loci required for limiting growth of a biotrophic fungal pathogen. Plant J. 24, 205-218 (2000). 176. Schwartz, S.H., Leon-Kloosterziel, K.M., Koornneef, M. & Zeevaart, J.A. Biochemical characterization of the aba2 and aba3 mutants in Arabidopsis thaliana. Plant Physiol. 114, 161-166 (1997). 177. Boter, M., Ruiz-Rivero, O., Abdeen, A. & Prat, S. Conserved MYC transcription factors play a key role in jasmonate signaling both in tomato and Arabidopsis. Genes Dev. 18, 1577-1591 (2004). 178. Fernández-Calvo, P. et al. The Arabidopsis bHLH transcription factors MYC3 and MYC4 are targets of JAZ repressors and act additively with MYC2 in the activation of jasmonate responses. Plant Cell 23, 701-715 (2011). 179. Zeng, W.Q. et al. A genetic screen reveals Arabidopsis stomatal and/or apoplastic defenses against Pseudomonas syringae pv. tomato DC3000. PLoS Pathog. 7, e1002291 (2011).  134  180. Bolger, A.M., Lohse, M. & Usadel, B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114-2120 (2014). 181. Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15-21 (2013). 182. Liao, Y., Smyth, G.K. & Shi, W. The subread aligner: fast, accurate and scalable read mapping by seed-and-vote. Nucleic Acids Res. 41, e108 (2013). 183. Law, C.W., Chen, Y., Shi, W. & Smyth, G.K. Voom: precision weights unlock linear model analysis tools for RNA-seq read counts. Genome Biol. 15, R29 (2014). 184. Huang da, W., Sherman, B.T. & Lempicki, R.A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 4, 44-57 (2009). 185. Yang, D.L. et al. Plant hormone jasmonate prioritizes defense over growth by interfering with gibberellin signaling cascade. Proc. Natl. Acad. Sci. U.S.A. 109, E1192-E1200 (2012). 186. Earley, K.W. et al. Gateway-compatible vectors for plant functional genomics and proteomics. Plant J. 45, 616-629 (2006). 187. Bent, A. Arabidopsis thaliana floral dip transformation method. Methods Mol. Biol. 343, 87-103 (2006). 188. Katagiri, F., Thilmony, R. & He, S.Y. The Arabidopsis thaliana-Pseudomonas syringae Interaction. The Arabidopsis Book, e0039 (2002). 189. Schechter, L.M., Roberts, K.A., Jamir, Y., Alfano, J.R. & Collmer, A. Pseudomonas syringae type III secretion system targeting signals and novel effectors studied with a cya translocation reporter. J. Bacteriol. 186, 543-555 (2004). 190. Proveniers, M.C.G. & van Zanten, M. High temperature acclimation through PIF4 signaling. Trends Plant Sci. 18, 59-64 (2013). 191. Roine, E. et al. Hrp pilus: an hrp-dependent bacterial surface appendage produced by Pseudomonas syringae pv tomato DC3000. Proc. Natl. Acad. Sci. U.S.A. 94, 3459-3464 (1997). 192. Ma, S.W., Morris, V.L. & Cuppels, D.A. Characterization of a DNA region required for production of the phytotoxin coronatine by Pseudomonas-syringae pv tomato Mol. Plant Microbe Interact. 4, 69-74 (1991). 193. Friedrich, L. et al. A benzothiadiazole derivative induces systemic acquired resistance in tobacco. Plant J. 10, 61-70 (1996). 194. Lawton, K.A. et al. Benzothiadiazole induces disease resistance in Arabidopsis by activation of the systemic acquired resistance signal transduction pathway. Plant J. 10, 71-82 (1996). 195. Dong, X. NPR1, all things considered. Curr. Opin. Plant Biol. 7, 547-552 (2004).  135  196. McLeay, R.C. & Bailey, T.L. Motif enrichment analysis: a unified framework and an evaluation on ChIP data. BMC Bioinformatics 11, 1-11 (2010). 197. Lam, E. & Lam, Y.K. Binding site requirements and differential representation of TGF factors in nuclear ASF-1 activity. Nucleic Acids Res. 23, 3778-3785 (1995). 198. Moore, J.W., Loake, G.J. & Spoel, S.H. Transcription dynamics in plant immunity. Plant Cell 23, 2809-2820 (2011). 199. de Lucas, M. & Prat, S. PIFs get BRright: PHYTOCHROME INTERACTING FACTORs as integrators of light and hormonal signals. New Phytol. 202, 1126-1141 (2014). 200. Blanco, F. et al. Early genomic responses to salicylic acid in Arabidopsis. Plant Mol. BIol. 70, 79-102 (2009). 201. Lu, H. et al. Genetic analysis of acd6-1 reveals complex defense networks and leads to identification of novel defense genes in Arabidopsis. Plant J. 58, 401-412 (2009). 202. Shapiro, A.D. & Zhang, C. The role of NDR1 in avirulence gene-directed signaling and control of programmed cell death in Arabidopsis. Plant Physiol. 127, 1089-1101 (2001). 203. Jagadeeswaran, G. et al. Arabidopsis GH3-LIKE DEFENSE GENE 1 is required for accumulation of salicylic acid, activation of defense responses and resistance to Pseudomonas syringae. Plant J. 51, 234-246 (2007). 204. Nobuta, K. et al. The GH3 acyl adenylase family member PBS3 regulates salicylic acid-dependent defense responses in Arabidopsis. Plant Physiol. 144, 1144-1156 (2007). 205. Nawrath, C. & Metraux, J.P. Salicylic acid induction-deficient mutants of Arabidopsis express PR-2 and PR-5 and accumulate high levels of camalexin after pathogen inoculation. Plant Cell 11, 1393-1404 (1999). 206. Lu, H., Rate, D.N., Song, J.T. & Greenberg, J.T. ACD6, a novel ankyrin protein, is a regulator and an effector of salicylic acid signaling in the Arabidopsis defense response. Plant Cell 15, 2408-2420 (2003). 207. Cecchini, N.M., Jung, H.W., Engle, N.L., Tschaplinski, T.J. & Greenberg, J.T. ALD1 regulates basal immune components and early inducible defense responses in Arabidopsis. Mol. Plant Microbe Interact. 28, 455-466 (2015). 208. Ng, G.N. et al. Genetic dissection of salicylic acid-mediated defense signaling networks in Arabidopsis. Genetics 189, 851-859 (2011). 209. Morita-Yamamuro, C. et al. The Arabidopsis gene CAD1 controls programmed cell death in the plant immune system and encodes a protein containing a MACPF domain. Plant Cell Physiol. 46, 902-912 (2005). 210. Veronese, P. et al. The membrane-anchored BOTRYTIS-INDUCED KINASE1 plays distinct roles in Arabidopsis resistance to necrotrophic and biotrophic pathogens. Plant Cell 18, 257-273 (2006).  136  211. Noutoshi, Y. et al. Loss of NECROTIC SPOTTED LESIONS 1 associates with cell death and defense responses in Arabidopsis thaliana. Plant Mol. BIol. 62, 29-42 (2006). 212. Ndamukong, I. et al. SA-inducible Arabidopsis glutaredoxin interacts with TGA factors and suppresses JA-responsive PDF1.2 transcription. Plant J. 50, 128-139 (2007). 213. Johnson, C., Boden, E. & Arias, J. Salicylic acid and NPR1 induce the recruitment of trans-activating TGA factors to a defense gene promoter in Arabidopsis. Plant Cell 15, 1846-1858 (2003). 214. Zhou, J.M. et al. NPR1 differentially interacts with members of the TGA/OBF family of transcription factors that bind an element of the PR-1 gene required for induction by salicylic acid. Mol. Plant Microbe Interact. 13, 191-202 (2000). 215. Song, J.T., Lu, H., McDowell, J.M. & Greenberg, J.T. A key role for ALD1 in activation of local and systemic defenses in Arabidopsis. Plant J. 40, 200-212 (2004). 216. Mishina, T.E. & Zeier, J. The Arabidopsis flavin-dependent monooxygenase FMO1 is an essential component of biologically induced systemic acquired resistance. Plant Physiol. 141, 1666-1675 (2006). 217. Zhang, Y. et al. Negative regulation of defense responses in Arabidopsis by two NPR1 paralogs. Plant J. 48, 647-656 (2006). 218. Hermann, M. et al. The Arabidopsis NIMIN proteins affect NPR1 differentially. Front. Plant Sci. 4, 88 (2013). 219. Weigel, R.R., Pfitzner, U.M. & Gatz, C. Interaction of NIMIN1 with NPR1 modulates PR gene expression in Arabidopsis. Plant Cell 17, 1279-1291 (2005). 220. Xu, X., Chen, C., Fan, B. & Chen, Z. Physical and functional interactions between pathogen-induced Arabidopsis WRKY18, WRKY40, and WRKY60 transcription factors. Plant Cell 18, 1310-1326 (2006). 221. Kim, K.-C., Lai, Z., Fan, B. & Chen, Z. Arabidopsis WRKY38 and WRKY62 Transcription Factors Interact with Histone Deacetylase 19 in Basal Defense. Plant Cell 20, 2357-2371 (2008). 222. Mao, P., Duan, M., Wei, C. & Li, Y. WRKY62 transcription factor acts downstream of cytosolic NPR1 and negatively regulates jasmonate-responsive gene expression. Plant Cell Physiol. 48, 833-842 (2007). 223. Shi, H. et al. The cysteine2/histidine2-type transcription factor ZINC FINGER OF ARABIDOPSIS THALIANA6 modulates biotic and abiotic stress responses by activating salicylic acid-related genes and C-REPEAT-BINDING FACTOR Genes in Arabidopsis. Plant Physiol. 165, 1367-1379 (2014). 224. von Malek, B., van der Graaff, E., Schneitz, K. & Keller, B. The Arabidopsis male-sterile mutant dde2-2 is defective in the ALLENE OXIDE SYNTHASE gene encoding one of the key enzymes of the jasmonic acid biosynthesis pathway. Planta 216, 187-192 (2002).  137  225. Zhang, L., Du, L., Shen, C., Yang, Y. & Poovaiah, B.W. Regulation of plant immunity through ubiquitin-mediated modulation of Ca2+-calmodulin-AtSR1/CAMTA3 signaling. Plant J. 78, 269-281 (2014). 226. Stevens, R. in Plant Pathology, An Advanced Treatise, Vol. 3. (ed. D.A. Horsfall JG) 357-429 (Academic Press, New York, NY USA; 1960). 227. Alcázar, R. & Parker, J.E. The impact of temperature on balancing immune responsiveness and growth in Arabidopsis. Trends Plant Sci. 16, 666-675 (2011). 228. Strawn, M.A. et al. Arabidopsis isochorismate synthase functional in pathogen-induced salicylate biosynthesis exhibits properties consistent with a role in diverse stress responses. J. Biol. Chem. 282, 5919-5933 (2007). 229. Serrano, M. et al. Export of salicylic acid from the chloroplast requires the multidrug and toxin extrusion-like transporter EDS5. Plant Physiol. 162, 1815-1821 (2013). 230. Genoud, T., Buchala, A.J., Chua, N.-H. & Métraux, J.-P. Phytochrome signalling modulates the SA-perceptive pathway in Arabidopsis. Plant J. 31, 87-95 (2002). 231. Yang, D.L., Yang, Y.N. & He, Z.H. Roles of plant hormones and their interplay in rice immunity. Mol. Plant. 6, 675-685 (2013). 232. Ding, Y.Z., Shaholli, D. & Mou, Z.L. A large-scale genetic screen for mutants with altered salicylic acid accumulation in Arabidopsis. Front. Plant Sci. 5, 763 (2015). 233. Wang, X. et al. TCP transcription factors are critical for the coordinated regulation of ISOCHORISMATE SYNTHASE 1 expression in Arabidopsis thaliana. Plant J. 82, 151-162 (2015). 234. Zheng, X.-y. et al. Spatial and temporal regulation of biosynthesis of the plant immune signal salicylic acid. Proc. Natl. Acad. Sci. U.S.A. (2015). 235. Roccaro, M. & Somssich, I.E. Chromatin immunoprecipitation to identify global targets of WRKY transcription factor family members involved in plant immunity, in Plant Immunity: Methods and Protocols, Vol. 712. (ed. J.M. McDowell) 45-58 (Humana Press Inc, Totowa; 2011). 236. Spoel, S.H. et al. NPR1 modulates cross-talk between salicylate- and jasmonate-dependent defense pathways through a novel function in the cytosol. Plant Cell 15, 760-770 (2003). 237. Underwood, W. The plant cell wall: A dynamic barrier against pathogen invasion. Front. Plant Sci. 3, 85 (2012). 238. Bhuiyan, N.H., Selvaraj, G., Wei, Y. & King, J. Gene expression profiling and silencing reveal that monolignol biosynthesis plays a critical role in penetration defence in wheat against powdery mildew invasion. J. Ex. Bot. 60, 509-521 (2009). 239. Pradhan Mitra, P. & Loque, D. Histochemical staining of Arabidopsis thaliana secondary cell wall elements. J Vis. Exp. 13 (2014).  138  240. Coley, P.D., Bryant, J.P. & Chapin, F.S. Resource availability and plant antiherbivore defense. Science 230, 895-899 (1985). 241. Simms, E.L. & Rausher, M.D. Costs and benefits of plant-resistance to herbivory. Am. Nat. 130, 570-581 (1987). 242. Herms, D.A. & Mattson, W.J. The dilemma of plants: to grow or defend. Q. Rev. Biol. 67, 283-335 (1992). 243. Baldwin, I.T. An ecologically motivated analysis of plant-herbivore interactions in native tobacco. Plant Physiol. 127, 1449-1458 (2001). 244. Walling, L.L. Adaptive defense responses to pathogens and insects, in Plant Innate Immunity, Vol. Volume 51. (ed. L.C.V. Loon) 551-612 (Academic Press, London, England; 2009). 245. Bari, R. & Jones, J.D.G. Role of plant hormones in plant defence responses. Plant Mol. BIol. 69, 473-488 (2009). 246. Naseem, M. & Dandekar, T. The role of auxin-cytokinin antagonism in plant-pathogen interactions. PLoS Pathog. 8, e1003026 (2012). 247. De Vleesschauwer, D., Gheysen, G. & Höfte, M. Hormone defense networking in rice: tales from a different world. Trends Plant Sci. 18, 555-565 (2013). 248. Bartoli, C.G., Casalongué, C.A., Simontacchi, M., Marquez-Garcia, B. & Foyer, C.H. Interactions between hormone and redox signalling pathways in the control of growth and cross tolerance to stress. Environ. Exp. Bot. 94, 73-88 (2013). 249. Monaghan, J. & Zipfel, C. Plant pattern recognition receptor complexes at the plasma membrane. Curr. Opin. Plant Biol. 15, 349-357 (2012). 250. Boller, T. & Felix, G. A renaissance of elicitors: perception of microbe-associated molecular patterns and danger signals by pattern-recognition receptors. Annu. Rev. Plant Biol. 60, 379-406 (2009). 251. Dou, D.L. & Zhou, J.M. Phytopathogen effectors subverting host immunity: different foes, similar battleground. Cell Host Microbe 12, 484-495 (2012). 252. Bent, A.F. & Mackey, D. Elicitors, effectors, and R genes: the new paradigm and a lifetime supply of questions. Annu. Rev. Phytopathol. 45, 399-436 (2007). 253. Grant, M. & Lamb, C. Systemic immunity. Curr. Opin. Plant Biol. 9, 414-420 (2006). 254. Kazan, K. & Manners, J.M. Linking development to defense: auxin in plant-pathogen interactions. Trends Plant Sci. 14, 373-382 (2009). 255. Santner, A. & Estelle, M. Recent advances and emerging trends in plant hormone signalling. Nature 459, 1071-1078 (2009).  139  256. Pieterse, C.M.J., Van der Does, D., Zamioudis, C., Leon-Reyes, A. & Van Wees, S.C.M. Hormonal modulation of plant immunity. Ann. Rev. Cell Dev. Biol. 28, 489-521 (2012). 257. Wasternack, C. Action of jasmonates in plant stress responses and development  Applied aspects. Biotech. Adv. 32, 31-39 (2013). 258. Erb, M., Meldau, S. & Howe, G.A. Role of phytohormones in insect-specific plant reactions. Trends Plant Sci. 17, 250-259 (2012). 259. Thomma, B. et al. Separate jasmonate-dependent and salicylate-dependent defense-response pathways in Arabidopsis are essential for resistance to distinct microbial pathogens. Proc. Natl. Acad. Sci. U.S.A. 95, 15107-15111 (1998). 260. Spoel, S.H., Johnson, J.S. & Dong, X. Regulation of tradeoffs between plant defenses against pathogens with different lifestyles. Proc. Natl. Acad. Sci. U.S.A. 104, 18842-18847 (2007). 261. Nicaise, V., Roux, M. & Zipfel, C. Recent advances in PAMP-triggered immunity against bacteria: pattern recognition receptors watch over and raise the alarm. Plant Physiol. 150, 1638-1647 (2009). 262. Gomez-Gomez, L. & Boller, T. FLS2: An LRR receptor-like kinase involved in the perception of the bacterial elicitor flagellin in Arabidopsis. Mol. Cell 5, 1003-1011 (2000). 263. Sun, Y. et al. Structural basis for flg22-induced activation of the Arabidopsis FLS2-BAK1 immune complex. Science 342, 624-628 (2013). 264. Zipfel, C. et al. Perception of the bacterial PAMP EF-Tu by the receptor EFR restricts Agrobacterium-mediated transformation. Cell 125, 749-760 (2006). 265. Zipfel, C. et al. Bacterial disease resistance in Arabidopsis through flagellin perception. Nature 428, 764-767 (2004). 266. Chinchilla, D. et al. A flagellin-induced complex of the receptor FLS2 and BAK1 initiates plant defence. Nature 448, 497-500 (2007). 267. Heese, A. et al. The receptor-like kinase SERK3/BAK1 is a central regulator of innate immunity in plants. Proc. Natl. Acad. Sci. U.S.A. 104, 12217-12222 (2007). 268. Roux, M. et al. The Arabidopsis leucine-rich repeat receptor-like kinases BAK1/SERK3 and BKK1/SERK4 are required for innate immunity to hemibiotrophic and biotrophic pathogens. Plant Cell 23, 2440-2455 (2011). 269. Schulze, B. et al. Rapid heteromerization and phosphorylation of ligand-activated plant transmembrane receptors and their associated kinase BAK1. J. Biol. Chem. 285, 9444-9451 (2010). 270. Lin, W. et al. Tyrosine phosphorylation of protein kinase complex BAK1/BIK1 mediates Arabidopsis innate immunity. Proc. Natl. Acad. Sci. U.S.A. 111, 3632-3637 (2014).  140  271. Lu, D.P. et al. A receptor-like cytoplasmic kinase, BIK1, associates with a flagellin receptor complex to initiate plant innate immunity. Proc. Natl. Acad. Sci. U.S.A. 107, 496-501 (2010). 272. Pandey, S.P. & Somssich, I.E. The role of WRKY transcription factors in plant immunity. Plant Physiol. 150, 1648-1655 (2009). 273. Gomez-Gomez, L., Felix, G. & Boller, T. A single locus determines sensitivity to bacterial flagellin in Arabidopsis thaliana. Plant J. 18, 277-284 (1999). 274. Rivas-San Vicente, M. & Plasencia, J. Salicylic acid beyond defence: its role in plant growth and development. J. Ex. Bot. 62, 3321-3338 (2011). 275. Browse, J. Jasmonate passes muster: a receptor and targets for the defense hormone. Annu. Rev. Plant Biol. 60, 183-205 (2009). 276. Wasternack, C. Jasmonates: an update on biosynthesis, signal transduction and action in plant stress response, growth and development. Ann. Bot. 100, 681-697 (2007). 277. Feys, B.J.F., Benedetti, C.E., Penfold, C.N. & Turner, J.G. Arabidopsis mutants selected for resistance to the phytotoxin coronatine are male-sterile, insensitive to methyl jasmonate, and resistant to a bacterial pathogen. Plant Cell 6, 751-759 (1994). 278. Xie, D.X., Feys, B.F., James, S., Nieto-Rostro, M. & Turner, J.G. COI1: an Arabidopsis gene required for jasmonate-regulated defense and fertility. Science 280, 1091-1094 (1998). 279. Pauwels, L. et al. NINJA connects the co-repressor TOPLESS to jasmonate signalling. Nature 464, 788-791 (2010). 280. Shyu, C. et al. JAZ8 lacks a canonical degron and has an EAR motif that mediates transcriptional repression of jasmonate responses in Arabidopsis. Plant Cell 24, 536-550 (2012). 281. Withers, J. et al. Transcription factor-dependent nuclear localization of a transcriptional repressor in jasmonate hormone signaling. Proc. Natl. Acad. Sci. U.S.A. 109, 20148-20153 (2012). 282. Fonseca, S. et al. (+)-7-iso-Jasmonoyl-L-isoleucine is the endogenous bioactive jasmonate. Nat. Chem. Biol. 5, 344-350 (2009). 283. Staswick, P.E. & Tiryaki, I. The oxylipin signal jasmonic acid is activated by an enzyme that conjugates it to isoleucine in Arabidopsis. Plant Cell 16, 2117-2127 (2004). 284. Depuydt, S. & Hardtke, C.S. Hormone signalling crosstalk in plant growth regulation. Curr. Biol. 21, R365-R373 (2011). 285. Zhao, B.L. & Li, J. Regulation of brassinosteroid biosynthesis and inactivation. J. Integr. Plant Biol. 54, 746-759 (2012). 286. Kazan, K. Auxin and the integration of environmental signals into plant root development. Ann. Bot. 112, 1655-1665 (2013).  141  287. Kieffer, M., Neve, J. & Kepinski, S. Defining auxin response contexts in plant development. Curr. Opin. Plant Biol. 13, 12-20 (2010). 288. Vanneste, S. & Friml, J. Auxin: a trigger for change in plant development. Cell 136, 1005-1016 (2009). 289. Woodward, A.W. & Bartel, B. Auxin: regulation, action, and interaction. Ann. Bot. 95, 707-735 (2005). 290. Normanly, J. Approaching cellular and molecular resolution of auxin biosynthesis and metabolism. CSH Perspect. Biol. 2, a001594 (2010). 291. Ljung, K. et al. Biosynthesis, conjugation, catabolism and homeostasis of indole-3-acetic acid in Arabidopsis thaliana. Plant Mol. BIol. 50, 309-332 (2002). 292. Ludwig-Muller, J. Auxin conjugates: their role for plant development and in the evolution of land plants. J. Ex. Bot. 62, 1757-1773 (2011). 293. Staswick, P.E. et al. Characterization of an Arabidopsis enzyme family that conjugates amino acids to indole-3-acetic acid. Plant Cell 17, 616-627 (2005). 294. Tiwari, S.B., Hagen, G. & Guilfoyle, T.J. Aux/IAA proteins contain a potent transcriptional repression domain. Plant Cell 16, 533-543 (2004). 295. Tiwari, S.B., Wang, X.J., Hagen, G. & Guilfoyle, T.J. AUX/IAA proteins are active repressors, and their stability and activity are modulated by auxin. Plant Cell 13, 2809-2822 (2001). 296. Liscum, E. & Reed, J.W. Genetics of Aux/IAA and ARF action in plant growth and development. Plant Mol. BIol. 49, 387-400 (2002). 297. Ulmasov, T., Hagen, G. & Guilfoyle, T.J. Activation and repression of transcription by auxin-response factors. Proc. Natl. Acad. Sci. U.S.A. 96, 5844-5849 (1999). 298. Gray, W.M. et al. Identification of an SCF ubiquitin-ligase complex required for auxin response in Arabidopsis thaliana. Genes Dev. 13, 1678-1691 (1999). 299. Gray, W.M., Kepinski, S., Rouse, D., Leyser, O. & Estelle, M. Auxin regulates SCFTIR1-dependent degradation of AUX/IAA proteins. Nature 414, 271-276 (2001). 300. Dharmasiri, N., Dharmasiri, S. & Estelle, M. The F-box protein TIR1 is an auxin receptor. Nature 435, 441-445 (2005). 301. Kepinski, S. & Leyser, O. Auxin-induced SCFTIR1-Aux/IAA interaction involves stable modification of the SCFTIR1 complex. Proc. Natl. Acad. Sci. U.S.A. 101, 12381-12386 (2004). 302. Kepinski, S. & Leyser, O. The Arabidopsis F-box protein TIR1 is an auxin receptor. Nature 435, 446-451 (2005).  142  303. Abel, S., Oeller, P.W. & Theologis, A. Early auxin-induced genes encode short-lived nuclear proteins. Proc. Natl. Acad. Sci. U.S.A. 91, 326-330 (1994). 304. Hagen, G., Kleinschmidt, A. & Guilfoyle, T. Auxin-regulated gene-expression in intact soybean hypocotyl and excised hypocotyl sections. Planta 162, 147-153 (1984). 305. Gruszka, D. The brassinosteroid signaling pathway-new key players and interconnections with other signaling networks crucial for plant development and stress tolerance. Int. J. Mol. Sci. 14, 8740-8774 (2013). 306. Hao, J.J., Yin, Y.H. & Fei, S.Z. Brassinosteroid signaling network: implications on yield and stress tolerance. Plant Cell Rep. 32, 1017-1030 (2013). 307. Fariduddin, Q., Yusuf, M., Ahmad, I. & Ahmad, A. Brassinosteroids and their role in response of plants to abiotic stresses. Biol. Plantarum 58, 9-17 (2014). 308. Khripach, V., Zhabinskii, V. & De Groot, A. Twenty years of brassinosteroids: steroidal plant hormones warrant better crops for the XXI century. Ann. Bot. 86, 441-447 (2000). 309. He, J.X., Gendron, J.M., Yang, Y.L., Li, J.M. & Wang, Z.Y. The GSK3-like kinase BIN2 phosphorylates and destabilizes BZR1, a positive regulator of the brassinosteroid signaling pathway in Arabidopsis. Proc. Natl. Acad. Sci. U.S.A. 99, 10185-10190 (2002). 310. Yin, Y.H. et al. BES1 accumulates in the nucleus in response to brassinosteroids to regulate gene expression and promote stem elongation. Cell 109, 181-191 (2002). 311. Vert, G. & Chory, J. Downstream nuclear events in brassinosteroid signalling. Nature 441, 96-100 (2006). 312. Wang, Z.Y. et al. Nuclear-localized BZR1 mediates brassinosteroid-induced growth and feedback suppression of brassinosteroid biosynthesis. Dev. Cell 2, 505-513 (2002). 313. Yin, Y.H. et al. A new class of transcription factors mediates brassinosteroid-regulated gene expression in Arabidopsis. Cell 120, 249-259 (2005). 314. He, J.X. et al. BZR1 is a transcriptional repressor with dual roles in brassinosteroid homeostasis and growth responses. Science 307, 1634-1638 (2005). 315. Li, J.M. & Chory, J. A putative leucine-rich repeat receptor kinase involved in brassinosteroid signal transduction. Cell 90, 929-938 (1997). 316. Hothorn, M. et al. Structural basis of steroid hormone perception by the receptor kinase BRI1. Nature 474, 467-471 (2011). 317. She, J. et al. Structural insight into brassinosteroid perception by BRI1. Nature 474, 472-476 (2011). 318. Li, J. et al. BAK1, an Arabidopsis LRR receptor-like protein kinase, interacts with BRI1 and modulates brassinosteroid signaling. Cell 110, 213-222 (2002).  143  319. Nam, K.H. & Li, J.M. BRI1/BAK1, a receptor kinase pair mediating brassinosteroid signaling. Cell 110, 203-212 (2002). 320. Wang, X.L. & Chory, J. Brassinosteroids regulate dissociation of BKI1, a negative regulator of BRI1 signaling, from the plasma membrane. Science 313, 1118-1122 (2006). 321. Mora-Garcia, S. et al. Nuclear protein phosphatases with Kelch-repeat domains modulate the response to brassinosteroids in Arabidopsis. Genes Dev. 18, 448-460 (2004). 322. Tang, W.Q. et al. PP2A activates brassinosteroid-responsive gene expression and plant growth by dephosphorylating BZR1. Nat. Cell Biol. 13, 124-131 (2011). 323. Peng, J.R. et al. The Arabidopsis GAI gene defines a signaling pathway that negatively regulates gibberellin responses. Genes Dev. 11, 3194-3205 (1997). 324. Silverstone, A.L. et al. Repressing a repressor: gibberellin-induced rapid reduction of the RGA protein in Arabidopsis. Plant Cell 13, 1555-1565 (2001). 325. Murase, K., Hirano, Y., Sun, T.P. & Hakoshima, T. Gibberellin-induced DELLA recognition by the gibberellin receptor GID1. Nature 456, 459-463 (2008). 326. Achard, P. et al. DELLAs contribute to plant photomorphogenesis. Plant Physiol. 143, 1163-1172 (2007). 327. Dill, A., Thomas, S.G., Hu, J.H., Steber, C.M. & Sun, T.P. The Arabidopsis F-box protein SLEEPY1 targets gibberellin signaling repressors for gibberellin-induced degradation. Plant Cell 16, 1392-1405 (2004). 328. McGinnis, K.M. et al. The Arabidopsis SLEEPY1 gene encodes a putative F-box subunit of an SCF E3 ubiquitin ligase. Plant Cell 15, 1120-1130 (2003). 329. Sun, J.Q. et al. Jasmonate modulates endocytosis and plasma membrane accumulation of the Arabidopsis PIN2 protein. New Phytol. 191, 360-375 (2011). 330. Heil, M. & Baldwin, I.T. Fitness costs of induced resistance: emerging experimental support for a slippery concept. Trends Plant Sci. 7, 61-67 (2002). 331. Tian, D., Traw, M.B., Chen, J.Q., Kreitman, M. & Bergelson, J. Fitness costs of R-gene-mediated resistance in Arabidopsis thaliana. Nature 423, 74-77 (2003). 332. Kempel, A., Schadler, M., Chrobock, T., Fischer, M. & van Kleunen, M. Tradeoffs associated with constitutive and induced plant resistance against herbivory. Proc. Natl. Acad. Sci. U.S.A. 108, 5685-5689 (2011). 333. Zavala, J.A., Patankar, A.G., Gase, K. & Baldwin, I.T. Constitutive and inducible trypsin proteinase inhibitor production incurs large fitness costs in Nicotiana attenuata. Proc. Natl. Acad. Sci. U.S.A. 101, 1607-1612 (2004).  144  334. Meldau, S., Ullman-Zeunert, L., Govind, G., Bartram, S. & Baldwin, I.T. MAPK-dependent JA and SA signalling in Nicotiana attenuata affects plant growth and fitness during competition with conspecifics. BMC Plant Biol. 12, 213 (2012). 335. Heil, M., Hilpert, A., Kaiser, W. & Linsenmair, K.E. Reduced growth and seed set following chemical induction of pathogen defence: does systemic acquired resistance (SAR) incur allocation costs? J. Ecol. 88, 645-654 (2000). 336. Ballare, C.L. Light regulation of plant defense. Annu. Rev. Plant Biol. 65, 335-363 (2014). 337. Cerrudo, I. et al. Low red/far-red ratios reduce Arabidopsis resistance to Botrytis cinerea and jasmonate responses via a COI1-JAZ10-dependent, salicylic acid-independent mechanism. Plant Physiol. 158, 2042-2052 (2012). 338. de Wit, M. et al. Perception of low red:far-red ratio compromises both salicylic acid- and jasmonic acid-dependent pathogen defences in Arabidopsis. Plant J. 75, 90-103 (2013). 339. Cao, H., Li, X. & Dong, X.N. Generation of broad-spectrum disease resistance by overexpression of an essential regulatory gene in systemic acquired resistance. Proc. Natl. Acad. Sci. U.S.A. 95, 6531-6536 (1998). 340. Valverde, P.L., Fornoni, J. & Nunez-Farfan, J. Evolutionary ecology of Datura stramonium: equal plant fitness benefits of growth and resistance against herbivory. J. Evol. Biol. 16, 127-137 (2003). 341. Gutsche, A.R., Heng-Moss, T.M., Higley, L.G., Sarath, G. & Mornhinweg, D.W. Physiological responses of resistant and susceptible barley, Hordeum vulgare to the Russian wheat aphid, Diurpahis noxia (Mordvilko). Arthropod Plant Interact. 3, 233-240 (2009). 342. Kerchev, P.I., Fenton, B., Foyer, C.H. & Hancock, R.D. Plant responses to insect herbivory: interactions between photosynthesis, reactive oxygen species and hormonal signalling pathways. Plant Cell Environ. 35, 441-453 (2012). 343. Aldea, M. et al. Indirect effects of insect herbivory on leaf gas exchange in soybean. Plant Cell Environ. 28, 402-411 (2005). 344. Zou, J.J. et al. Expression profiling soybean response to Pseudomonas syringae reveals new defense-related genes and rapid HR-specific downregulation of photosynthesis. Mol. Plant Microbe Interact. 18, 1161-1174 (2005). 345. Nabity, P.D., Zavala, J.A. & DeLucia, E.H. Indirect suppression of photosynthesis on individual leaves by arthropod herbivory. Ann. Bot. 103, 655-663 (2009). 346. Chen, Y.Z. et al. Proteomic identification of differentially expressed proteins in Arabidopsis in response to methyl jasmonate. J. Plant Physiol. 168, 995-1008 (2011). 347. Guo, J. et al. Proteomic identification of MYC2-dependent jasmonate-regulated proteins in Arabidopsis thaliana. Proteome Sci. 10 (2012).  145  348. Jung, C. et al. Microarray-based screening of jasmonate-responsive genes in Arabidopsis thaliana. Plant Cell Rep. 26, 1053-1063 (2007). 349. Denoux, C. et al. Activation of defense response pathways by OGs and Flg22 elicitors in Arabidopsis seedlings. Mol. Plant. 1, 423-445 (2008). 350. Gohre, V., Jones, A.M.E., Sklenar, J., Robatzek, S. & Weber, A.P.M. Molecular crosstalk between PAMP-triggered immunity and photosynthesis. Mol. Plant Microbe Interact. 25, 1083-1092 (2012). 351. Borges, L.L. et al. Differentially expressed proteins during an incompatible interaction between common bean and the fungus Pseudocercospora griseola. Mol. Breed. 32, 933-942 (2013). 352. Bilgin, D.D. et al. Biotic stress globally downregulates photosynthesis genes. Plant Cell Environ. 33, 1597-1613 (2010). 353. Sugano, S. et al. Role of OsNPR1 in rice defense program as revealed by genomewide expression analysis. Plant Mol. BIol. 74, 549-562 (2010). 354. Ishiga, Y. et al. The phytotoxin coronatine induces light-dependent reactive oxygen species in tomato seedlings. New Phytol. 181, 147-160 (2009). 355. Wierstra, I. & Kloppstech, K. Differential effects of methyl jasmonate on the expression of the early light-inducible proteins and other light-regulated genes in barley. Plant Physiol. 124, 833-844 (2000). 356. Shan, X.Y. et al. The role of Arabidopsis rubisco activase in jasmonate-induced leaf senescence. Plant Physiol. 155, 751-764 (2011). 357. Jung, S. Effect of chlorophyll reduction in Arabidopsis thaliana by methyl jasmonate or norflurazon on antioxidant systems. Plant Physiol. Biochem. 42, 225-231 (2004). 358. Mitra, S. & Baldwin, I.T. RuBPCase activase (RCA) mediates growthdefense trade-offs: silencing RCA redirects jasmonic acid (JA) flux from JA-isoleucine to methyl jasmonate (MeJA) to attenuate induced defense responses in Nicotiana attenuata. New Phytol. 201, 1385-1395 (2014). 359. Berger, S. et al. Visualization of dynamics of plant-pathogen interaction by novel combination of chlorophyll fluorescence imaging and statistical analysis: differential effects of virulent and avirulent strains of P. syringae and of oxylipins on A. thaliana. J. Ex. Bot. 58, 797-806 (2007). 360. Berger, S., Papadopoulos, M., Schreiber, U., Kaiser, W. & Roitsch, T. Complex regulation of gene expression, photosynthesis and sugar levels by pathogen infection in tomato. Physiol. Plantarum 122, 419-428 (2004). 361. Chou, H.M., Bundock, N., Rolfe, S.A. & Scholes, J.D. Infection of Arabidopsis thaliana leaves with Albugo candida (white blister rust) causes a reprogramming of host metabolism. Mol. Plant Pathol. 1, 99-113 (2000).  146  362. Bonfig, K.B., Schreiber, U., Gabler, A., Roitsch, T. & Berger, S. Infection with virulent and avirulent P. syringae strains differentially affects photosynthesis and sink metabolism in Arabidopsis leaves. Planta 225, 1-12 (2006). 363. Zhang, X.H., Fu, J.M., Hiromasa, Y., Pan, H.Y. & Bai, G.H. Differentially expressed proteins associated with fusarium head blight resistance in wheat. PLoS One 8, e82079 (2013). 364. Wang, D., Weaver, N.D., Kesarwani, M. & Dong, X.N. Induction of protein secretory pathway is required for systemic acquired resistance. Science 308, 1036-1040 (2005). 365. Kwon, C. et al. Co-option of a default secretory pathway for plant immune responses. Nature 451, 835-840 (2008). 366. Pajerowska-Mukhtar, Karolina M. et al. The HSF-like transcription factor TBF1 is a major molecular switch for plant growth-to-defense transition. Curr. Biol. 22, 103-112 (2012). 367. Engelsdorf, T. et al. Reduced carbohydrate availability enhances the susceptibility of Arabidopsis toward Colletotrichum higginsianum. Plant Physiol. 162, 225-238 (2013). 368. Ullmann-Zeunert, L. et al. Quantification of growth-defense trade-offs in a common currency: nitrogen required for phenolamide biosynthesis is not derived from ribulose-1,5-bisphosphate carboxylase/oxygenase turnover. Plant J. 75, 417-429 (2013). 369. Roitsch, T. & Gonzalez, M.C. Function and regulation of plant invertases: sweet sensations. Trends Plant Sci. 9, 606-613 (2004). 370. Swarbrick, P.J., Schulze-Lefert, P. & Scholes, J.D. Metabolic consequences of susceptibility and resistance (race-specific and broad-spectrum) in barley leaves challenged with powdery mildew. Plant Cell Environ. 29, 1061-1076 (2006). 371. Kocal, N., Sonnewald, U. & Sonnewald, S. Cell wall-bound invertase limits sucrose export and is involved in symptom development and inhibition of photosynthesis during compatible interaction between tomato and Xanthomonas campestris pv vesicatoria. Plant Physiol. 148, 1523-1536 (2008). 372. Sturm, A. Invertases. Primary structures, functions, and roles in plant development and sucrose partitioning. Plant Physiol. 121, 1-8 (1999). 373. Essmann, J. et al. RNA interference-mediated repression of cell wall invertase impairs defense in source leaves of tobacco. Plant Physiol. 147, 1288-1299 (2008). 374. Herbers, K., Meuwly, P., Frommer, W.B., Metraux, J.P. & Sonnewald, U. Systemic acquired resistance mediated by the ectopic expression of invertase: possible hexose sensing in the secretory pathway. Plant Cell 8, 793-803 (1996). 375. Sonnewald, S. et al. Regulation of cell wall-bound invertase in pepper leaves by Xanthomonas campestris pv. vesicatoria type three effectors. PLoS One 7, e51763 (2012).  147  376. Kidd, B.N. et al. Auxin signaling and transport promote susceptibility to the root-infecting fungal pathogen Fusarium oxysporum in Arabidopsis. Mol. Plant Microbe Interact. 24, 733-748 (2011). 377. Navarro, L. et al. The transcriptional innate immune response to flg22. Interplay and overlap with Avr gene-dependent defense responses and bacterial pathogenesis. Plant Physiol. 135, 1113-1128 (2004). 378. Jones-Rhoades, M.W. & Bartel, D.P. Computational identification of plant microRNAs and their targets, including a stress-induced miRNA. Mol. Cell 14, 787-799 (2004). 379. Sunkar, R. & Zhu, J.K. Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis. Plant Cell 16, 2001-2019 (2004). 380. González-Lamothe, R., El Oirdi, M., Brisson, N. & Bouarab, K. The conjugated auxin indole-3-acetic acidaspartic acid promotes plant disease development. Plant Cell 24, 762-777 (2012). 381. Albrecht, C. et al. Brassinosteroids inhibit pathogen-associated molecular pattern-triggered immune signaling independent of the receptor kinase BAK1. Proc. Natl. Acad. Sci. U.S.A. 109, 303-308 (2012). 382. Belkhadir, Y. et al. Brassinosteroids modulate the efficiency of plant immune responses to microbe-associated molecular patterns. Proc. Natl. Acad. Sci. U.S.A. 109, 297-302 (2012). 383. Jaillais, Y., Belkhadir, Y., Balsemao-Pires, E., Dangl, J.L. & Chory, J. Extracellular leucine-rich repeats as a platform for receptor/coreceptor complex formation. Proc. Natl. Acad. Sci. U.S.A. 108, 8503-8507 (2011). 384. Lozano-Durán, R. et al. The transcriptional regulator BZR1 mediates trade-off between plant innate immunity and growth. eLIFE 2, e00983 (2013). 385. Malinovsky, F.G. et al. Antagonistic regulation of growth and immunity by the Arabidopsis basic helix-loop-helix transcription factor HOMOLOG OF BRASSINOSTEROID ENHANCED EXPRESSION2 INTERACTING WITH INCREASED LEAF INCLINATION1 BINDING bHLH1. Plant Physiol. 164, 1443-1455 (2014). 386. Bai, M.Y., Fan, M., Oh, E. & Wang, Z.Y. A triple helix-loop-helix/basic helix-loop-helix cascade controls cell elongation downstream of multiple hormonal and environmental signaling pathways in Arabidopsis. Plant Cell 24, 4917-4929 (2012). 387. Lilley, J.L.S., Gan, Y.B., Graham, I.A. & Nemhauser, J.L. The effects of DELLAs on growth change with developmental stage and brassinosteroid levels. Plant J. 76, 165-173 (2013). 388. Jaillais, Y. & Vert, G. Brassinosteroids, gibberellins and light-mediated signalling are the three-way controls of plant sprouting. Nat. Cell Biol. 14, 788-790 (2012). 389. Bai, M.Y. et al. Brassinosteroid, gibberellin and phytochrome impinge on a common transcription module in Arabidopsis. Nat. Cell Biol. 14, 810-817 (2012).  148  390. Gallego-Bartolome, J. et al. Molecular mechanism for the interaction between gibberellin and brassinosteroid signaling pathways in Arabidopsis. Proc. Natl. Acad. Sci. U.S.A. 109, 13446-13451 (2012). 391. de Lucas, M. et al. A molecular framework for light and gibberellin control of cell elongation. Nature 451, 480-484 (2008). 392. Navarro, L. et al. DELLAs control plant immune responses by modulating the balance and salicylic acid signaling. Curr. Biol. 18, 650-655 (2008). 393. Canet, J.V., Dobon, A., Roig, A. & Tornero, P. Structure-function analysis of npr1 alleles in Arabidopsis reveals a role for its paralogs in the perception of salicylic acid. Plant Cell Environ. 33, 1911-1922 (2010). 394. Wang, D., Pajerowska-Mukhtar, K., Culler, A.H. & Dong, X. Salicylic acid inhibits pathogen growth in plants through repression of the auxin signaling pathway. Curr. Biol. 17, 1784-1790 (2007). 395. Park, J.E. et al. GH3-mediated auxin homeostasis links growth regulation with stress adaptation response in Arabidopsis. J. Biol. Chem. 282, 10036-10046 (2007). 396. Zhang, Z.Q. et al. Dual regulation role of GH3.5 in salicylic acid and auxin signaling during Arabidopsis-Pseudomonas syringae interaction. Plant Physiol. 145, 450-464 (2007). 397. Zhang, Z., Wang, M., Li, Z., Li, Q. & He, Z. Arabidopsis GH3.5 regulates salicylic acid-dependent and both NPR1-dependent and independent defense responses. Plant Signal. Behav. 3, 537-542 (2008). 398. Ostin, A., Kowalyczk, M., Bhalerao, R.P. & Sandberg, G. Metabolism of indole-3-acetic acid in Arabidopsis. Plant Physiol. 118, 285-296 (1998). 399. Hagen, G. & Guilfoyle, T. Auxin-responsive gene expression: genes, promoters and regulatory factors. Plant Mol. BIol. 49, 373-385 (2002). 400. De Vleesschauwer, D. et al. Brassinosteroids antagonize gibberellin- and salicylate-mediated root immunity in rice. Plant Physiol. 158, 1833-1846 (2012). 401. Gallego-Giraldo, L., Escamilla-Trevino, L., Jackson, L.A. & Dixon, R.A. Salicylic acid mediates the reduced growth of lignin down-regulated plants. Proc. Natl. Acad. Sci. U.S.A. 108, 20814-20819 (2011). 402. Gallego-Giraldo, L., Jikumaru, Y., Kamiya, Y., Tang, Y.H. & Dixon, R.A. Selective lignin downregulation leads to constitutive defense response expression in alfalfa (Medicago sativa L.). New Phytol. 190, 627-639 (2011). 403. Staswick, P.E., Su, W.P. & Howell, S.H. Methyl jasmonate inhibition of root-growth and induction of a leaf protein are decreased in an Arabidopsis thaliana mutant. Proc. Natl. Acad. Sci. U.S.A. 89, 6837-6840 (1992).  149  404. Noir, S. et al. Jasmonate controls leaf growth by repressing cell proliferation and the onset of endoreduplication while maintaining a potential stand-by mode. Plant Physiol. 161, 1930-1951 (2013). 405. Zhang, Y. & Turner, J.G. Wound-induced endogenous jasmonates stunt plant growth by inhibiting mitosis. PLoS One 3, e3699 (2008). 406. Wasternack, C. & Hause, B. Jasmonates: biosynthesis, perception, signal transduction and action in plant stress response, growth and development. An update to the 2007 review in Annals of Botany. Ann. Bot. 111, 1021-1058 (2013). 407. Chen, Q. et al. The basic helix-loop-helix transcription factor MYC2 directly represses PLETHORA expression during jasmonate-mediated modulation of the root stem cell niche in Arabidopsis. Plant Cell 23, 3335-3352 (2011). 408. Pinon, V., Prasad, K., Grigg, S.P., Sanchez-Perez, G.F. & Scheres, B. Local auxin biosynthesis regulation by PLETHORA transcription factors controls phyllotaxis in Arabidopsis. Proc. Natl. Acad. Sci. U.S.A. 110, 1107-1112 (2013). 409. Sun, J.Q. et al. Arabidopsis ASA1 is important for jasmonate-mediated regulation of auxin biosynthesis and transport during lateral root formation. Plant Cell 21, 1495-1511 (2009). 410. Hentrich, M. et al. The jasmonic acid signaling pathway is linked to auxin homeostasis through the modulation of YUCCA8 and YUCCA9 gene expression. Plant J. 74, 626-637 (2013). 411. Grunewald, W. et al. Expression of the Arabidopsis jasmonate signalling repressor JAZ1/TIFY10A is stimulated by auxin. EMBO Reports 10, 923-928 (2009). 412. Ren, C.M. et al. A leaky mutation in DWARF4 reveals an antagonistic role of brassinosteroid in the inhibition of root growth by jasmonate in Arabidopsis. Plant Physiol. 151, 1412-1420 (2009). 413. Huang, Y. et al. Brassinosteroid negatively regulates jasmonate inhibition of root growth in Arabidopsis. Plant Signal. Behav. 5, 140-142 (2010). 414. Campos, M.L. et al. Brassinosteroids interact negatively with jasmonates in the formation of anti-herbivory traits in tomato. J. Ex. Bot. 60, 4346-4360 (2009). 415. Peng, Z.H. et al. Brassinosteroid enhances jasmonate-induced anthocyanin accumulation in Arabidopsis seedlings. J. Integr. Plant Biol. 53, 632-640 (2011). 416. Song, S.S. et al. The jasmonate-ZIM domain proteins interact with the R2R3-MYB transcription factors MYB21 and MYB24 to affect jasmonate-regulated stamen development in Arabidopsis. Plant Cell 23, 1000-1013 (2011). 417. Hou, X.L., Lee, L.Y.C., Xia, K.F., Yen, Y.Y. & Yu, H. DELLAs modulate jasmonate signaling via competitive binding to JAZs. Dev. Cell 19, 884-894 (2010). 418. Wild, M. et al. The Arabidopsis DELLA RGA-LIKE3 is a direct target of MYC2 and modulates jasmonate signaling responses. Plant Cell 24, 3307-3319 (2012).  150  419. Heinrich, M. et al. High levels of jasmonic acid antagonize the biosynthesis of gibberellins and inhibit the growth of Nicotiana attenuata stems. Plant J. 73, 591-606 (2013). 420. Hong, G.J., Xue, X.Y., Mao, Y.B., Wang, L.J. & Chen, X.Y. Arabidopsis MYC2 interacts with DELLA proteins in regulating sesquiterpene synthase gene expression. Plant Cell 24, 2635-2648 (2012). 421. Smedegaardpetersen, V. & Stolen, O. Effect of energy-requiring defense reactions on yield and grain quality in a powdery mildew-resistant barley cultivar. Phytopathology 71, 396-399 (1981).