THE LEBER CONGENITAL AMAUROSIS CEP290 CAT MODEL:
WORKING TOWARDS A CURE
By
Andrea Louise Minella

A DISSERTATION
Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of
Comparative Medicine and Integrative Biology — Doctor of Philosophy
2017

ABSTRACT
THE LEBER CONGENITAL AMAUROSIS CEP290 CAT MODEL:
WORKING TOWARDS A CURE
By
Andrea Louise Minella
Leber Congenital Amaurosis (LCA) is an early-onset and severe inherited retinal
dystrophy. The most commonly implicated gene is the centrosomal 290kDa (CEP290)
gene. There are currently no treatments for LCACEP290. Animal models are integral for
treatment safety and efficacy testing, with a feline model for CEP290 retinopathies
showing promise for this purpose. This model has a spontaneous mutation in CEP290
resulting in a progressive retinal degeneration and vision loss. This mutation alters
splicing and is predicted to result in a truncated protein. CEP290 is integrally involved in
the transport within photoreceptor cells, localizing to the interconnecting cilium.
The CEP290 mutant cat (“rdAc”) has a milder phenotype than the phenotype
most commonly associated with CEP290 mutations in people. Understanding the
reason for this milder phenotype was an important aim of this dissertation. We analyzed
the wild-type and truncated mutant transcript levels and total CEP290 protein levels in
cat retinal tissue across genotypes (wild-type, heterozygous, homozygous mutant). Our
findings show that the milder phenotype in mutant cats is likely the result of low-level
production of wild-type transcript and protein combined with production of truncated
protein that we suspect retains some function. These measures can also serve as
objective markers of disease progression or treatment success in future studies.
Further objective markers were investigated utilizing spectral-domain optical
coherence tomography. By analyzing photoreceptor layer thickness (receptor plus/REC

+) and the ellipsoid zone (EZ), a zone noted to change with disease in people, we
showed that REC+ thickness and EZ integrity can be used as markers of disease
progression. These findings support the cat as a CEP290 model, and show the affected
cats have a degeneration with central retinal sparing as described in human patients.
We also developed an in vitro tool by developing primary fibroblast cell cultures
from skin samples of CEP290 cats. We showed that cilia formation, which involves
CEP290, can be induced, opening the door for future cilia studies. We assessed cilia
length as an objective marker of disease, however, no difference was found in cilia
length across genotypes. Utilizing this new tool, we tested a CRISPR/Cas-9 genome
editing treatment in an attempt to replace the mutated region with a sequence that
would direct splicing to the correct location. We achieved high efficiency transduction of
CRISPR components, however, we failed to detect insertion of our chosen sequence.
As we work towards a treatment, it is imperative to develop an optimized method
to deliver the treatment to feline photoreceptors. To achieve this aim we tested hybrid
adeno-associated viral (AAV) vectors, the retinal viral vector of choice, in the wild-type
feline retina. We showed that all serotypes studied, AAV2/2, 2/5, 2/8, and 2/9, transduce
photoreceptor cells with AAV2/8 and 2/9 showing higher transduction and faster onset.
Interestingly, we found more efficient transduction of cones than rods, an unusual
finding that speaks to the need to use caution when extrapolating across species.
It is our hope that these data will help the scientific community move closer to
treatments for CEP290 retinopathies. We have added to the understanding of the rdAc
cat model and determined objective markers, supported the cat as a model, and have
made progress towards a treatment.

I dedicate this dissertation to my cousin Mikey- my first and forever best friend, my
family, my motivation in the fight against genetic diseases. To my inspiration- may you
always remember to smell the roses and ‘just breathe’.

iv

ACKNOWLEDGMENTS

I would first and foremost like to thank my mentor, Dr. Simon Petersen-Jones for his
never-ending guidance and patience. From the day I asked to be a summer research
student in his lab while he was on vacation (and he answered his email anyway) to the
day he had enough belief in me to let me stay as a PhD student, his commitment to my
success and growth as a budding scientist will forever be appreciated.

I would like to thank my committee members, Drs. Bartoe, Komaromy, Kruger, and
Langohr, I am so appreciative of your guidance and inspired by you. You are amazing
scientists who have taught me not just through mentorship but also through example.

To the many people involved in my PhD experience, I am forever grateful:

• To Dr. Yuzbasiyan-Gurkan for being the ultimate student advocate, enthusiastic
scientist, and a woman I truly look up to

• To Dr. Vicki Hoelzer-Maddox and Dimity Palazzola for their tireless efforts to answer
my many (probably annoying) emails and make sure that the many little details of
being a PhD student run smoothly

• To our many collaborators especially Dr. Steve Suhr and Dr. Marie-Claude Senut for
their enthusiastic contribution to our studies and undying patience for my questions

• To Kimberly Williamson and the Campus Animal Resources for their animal care
• To Janice Querubin, Kristin Koehl, Christine Harman for their assistance, hard work,
and friendly encouragement

v

• To my lab-mates and friends Drs. Marianna Bacellar Galdino, Laurence Occelli, and
Paige Winkler, and Ethan Dawson-Baglien for their camaraderie

• To The Grousbeck Family Foundation, Myers-Dunlap Endowment to Dr. Simon
Petersen-Jones, the CVM Center for Feline Health and Well-Being, and The Cotter
Endowment for providing the funding that allowed this dissertation to happen

• To the National Institutes of Heath for believing in an ambitious proposal and
honoring me with a loan repayment grant, allowing me to focus on my research
instead of student loans

• To my parents- people I know I can always count on to have my back and keep me
on my feet, to love me even in my crankiest hours, to believe in me when I don’t
believe in myself, and to show me what strength, resiliency, and love look like

• To my ‘little’ sister who is wise beyond her years and has always offered words of
wisdom, a sense of humor, a ray of positivity, and a strength for conquering life with a
smile that I will always admire

• To the rest of my family who have been behind me cheering me on since the day I
was barely old enough to hold the toy stethoscope they gave me that set the stage
for my career path

• To my friends who kept me laughing through even the most stressful of times
• To the many animals who have touched my life and my heart especially my “fur kids”
Millie, Gemma, Apollo, and Fred for being my saving grace during my darkest hours

• And last but never least, to all of the cats involved in these studies for making a
contribution to science that will help us reach a cure someday- their sacrifice was not
taken lightly and will never be forgotten

vi

TABLE OF CONTENTS
LIST OF TABLES ..............................................................................................................x
LIST OF FIGURES ...........................................................................................................xi
KEY TO ABBREVIATIONS .............................................................................................xiii
CHAPTER 1 ......................................................................................................................1
INTRODUCTION ..............................................................................................................1
1.1 The eye and ocular disease .......................................................................................2
1.1.1 Vision and its importance .............................................................................2
1.1.2 Ocular disease .............................................................................................2
1.1.3 Retinal disease ............................................................................................3
1.2 The Retina .................................................................................................................5
1.2.1 Retinal anatomy and physiology ..................................................................5
1.2.2 Photoreceptor cells and phototransduction .................................................7
1.2.3 Inherited retinal dystrophies .......................................................................10
1.2.3.1 Retinitis Pigmentosa (RP) .............................................................11
1.2.3.2 Leber Congenital Amaurosis (LCA) ..............................................12
1.2.3.2.a CEP290 associated disease and LCA ..........................12
1.3 Animal models for inherited retinopathies ................................................................20
1.3.1 Rodent models...........................................................................................20
1.3.2 Large animal models .................................................................................22
1.3.2.1 The feline CEP290 model .............................................................25
1.4 Treatments for retinal dystrophies ...........................................................................30
1.4.1 Vehicles for treatment delivery...................................................................34
1.4.1.1 Adeno-associated viruses and adeno-associated viral vectors ....37
1.4.1.1.a The need for AAV testing in the feline retina .................50
1.5 Dissertation aims and hypotheses ...........................................................................52
REFERENCES ...............................................................................................................57
CHAPTER 2 ....................................................................................................................78
ALTERNATIVE SPLICING IN CEP290 MUTANT CATS RESULTS IN A MILDER
PHENOTYPE THAN LCACEP290 PATIENTS ....................................................................78
2.1 Introduction ..............................................................................................................79
2.2 Methods ...................................................................................................................82
2.2.1 Animals and tissue processing .................................................................82
2.2.2 Transcript analysis ....................................................................................84
2.2.3 Protein analysis ........................................................................................85
2.2.4 Immunohistochemistry ..............................................................................86
2.3 Results .....................................................................................................................87
2.4 Discussion ...............................................................................................................90
2.5 Acknowledgments ....................................................................................................93
REFERENCES ...............................................................................................................94
vii

CHAPTER 3 ....................................................................................................................99
CENTRAL RETINAL PRESERVATION IN rdAc CATS ...................................................99
3.1 Abstract ...................................................................................................................100
3.2 Introduction .............................................................................................................101
3.3 Methods ..................................................................................................................105
3.3.1 Animals .....................................................................................................105
3.3.2 Scanning laser ophthalmoscopy and spectral domain optical coherence
tomography imaging ..........................................................................................105
3.3.3 Receptor plus thickness evaluation ..........................................................107
3.3.4 Ellipsoid zone assessment .......................................................................109
3.4 Results ....................................................................................................................111
3.5 Discussion ...............................................................................................................117
3.6 Acknowledgements .................................................................................................120
REFERENCES .............................................................................................................121
CHAPTER 4 ..................................................................................................................127
EVALUATION OF A CRISPR-CAS9 NUCLEASE GENOME EDITING TREATMENT
AGAINST THE FELINE CEP290 MUTATION USING A NEWLY DEVELOPED IN VITRO
TOOL ............................................................................................................................127
4.1 Introduction ............................................................................................................128
4.2 Methods .................................................................................................................132
4.2.1 Animals and tissue collection ..................................................................132
4.2.2 Establishment of cultured cell lines .........................................................133
4.2.3 Investigation of ciliation ...........................................................................134
4.2.4 Targeting of the feline CEP290 gene ......................................................135
4.2.5 Transduction of primary feline fibroblasts ...............................................135
4.2.6 Sequence of the feline CEP290 gene in DNA from mutant cat cells ......136
4.2.7 Identification of Cas9 target sites ............................................................137
4.2.8 Production and testing of CRISPR reagents ..........................................137
4.2.9 Detection of CRISPR activity ..................................................................138
4.2.10 CEP290 repair using single-stranded DNA (ssDNA) ..............................139
4.3 Results ...................................................................................................................140
4.3.1 Fibroblast production and ciliation ..........................................................140
4.3.2 Cilia analysis ...........................................................................................140
4.3.3 Targeting and repair of the feline CEP290 gene using CRISPR/Cas9 ...141
4.3.3.1 Transduction of feline fibroblasts ...............................................141
4.3.3.2 The CEP290 mutation and design of CRISPR reagents ...........143
4.3.3.3 Transduction of primary cat fibroblasts with CRISPR reagents
and assay of targeting ............................................................................146
4.3.3.4 Attempt to repair the CEP290 mutation .....................................151
4.4 Discussion ............................................................................................................154
4.5 Acknowledgments .................................................................................................161
REFERENCES .............................................................................................................162

viii

CHAPTER 5 ..................................................................................................................165
DIFFERENTIAL TARGETING OF FELINE PHOTORECEPTORS BY RECOMBINANT
ADENO-ASSOCIATED VIRAL VECTORS: IMPLICATIONS FOR PRECLINICAL GENE
THERAPY TRIALS .......................................................................................................165
5.1 Abstract ..................................................................................................................166
5.2 Introduction ............................................................................................................167
5.3 Methods .................................................................................................................169
5.3.1 Animals ....................................................................................................169
5.3.2 Production of vector .................................................................................169
5.3.3 Subretinal injections .................................................................................170
5.3.4 Monitoring for GFP expression ................................................................170
5.3.5 Eye processing ........................................................................................171
5.3.6 Immunohistochemistry .............................................................................171
5.3.7 Cell counting ............................................................................................172
5.3.8 Immune responses ..................................................................................172
5.3.9 Statistical Analysis ...................................................................................174
5.4 Results and Discussion ..........................................................................................175
5.4.1 In vivo GFP expression in cat eyes ..........................................................176
5.4.2 Histological assessment of GFP expression............................................178
5.4.3 Immune response ....................................................................................183
5.5 Acknowledgments ...................................................................................................188
5.6 Supplemental Information .......................................................................................189
REFERENCES .............................................................................................................190
CHAPTER 6 ..................................................................................................................195
DISCUSSION AND FUTURE DIRECTIONS ................................................................195

ix

LIST OF TABLES
Table 2.1: RNA Integrity Data .........................................................................................83
Table 2.2: TaqMan Primers and Probes ..........................................................................85
Table 2.3: Antibodies Used for Protein Analysis .............................................................86
Table 3.1: Animal numbers and design .........................................................................106
Table 4.1: Antibodies used for immunocytochemistry ...................................................133
Table 5.1: Antibodies used for immunohistochemistry ..................................................171
Table 5.2: Inflammatory infiltration scoring rubric .........................................................173
Table 5.3: Summary of rAAV transduction ....................................................................175
Table 5.4: Feline inner retinal cell transduction .............................................................178

x

LIST OF FIGURES
Figure 1.1: The eye and the retina ....................................................................................6
Figure 1.2: The photoreceptor cell and connecting cilium ................................................8
Figure 1.3: The phototransduction cascade......................................................................9
Figure 1.4: Disease-causing mutations in the CEP290 gene in people ..........................13
Figure 1.5: Distribution of cones in the feline retina.......................................................25
Figure 1.6: The feline CEP290 mutation and resultant truncated protein ......................26
Figure 1.7: CRISPR/Cas9 Genome Engineering ............................................................33
Figure 1.8 Adeno-associated viral vector transduction and creation ..............................44
Figure 2.1: Feline CEP290 genotyping assay ................................................................82
Figure 2.2: Relative expression of full-length wild-type and truncated mutant transcripts ..
........................................................................................................................................87
Figure 2.3: Automated capillary western blot shows detectable CEP290 signal in mutant
cats .................................................................................................................................88

Figure 2.4: Immunohistochemistry shows detectable CEP290 protein in CEP290 mutant
cats .................................................................................................................................89
Figure 3.1: Tapetal reflectivity changes in the rdAC feline ............................................104
Figure 3.2: Regional and SD-OCT Measurements .......................................................108
Figure 3.3: Preservation of the central retina ................................................................ 112
Figure 3.4: Regional rates of degeneration................................................................... 113
Figure 3.5: Ellipsoid zone integrity deteriorates with progressive stages of disease ....115
Figure 3.6: Preserved ellipsoid zone integrity corresponds to preserved central REC+
thickness .......................................................................................................................116
Figure 4.1: The feline CEP290 mutation .......................................................................129
Figure 4.2: Representative ICC images show growth of pure fibroblast culture and
xi

successful induction of cilia growth ...............................................................................140
Figure 4.3: Cilia show no significant difference in length across genotypes.................141
Figure 4.4: Example of transfection of three feline primary fibroblast lines with eGFP
mRNA ...........................................................................................................................142
Figure 4.5: PCR products from genomic DNA amplified from three cat fibroblast lines .....
......................................................................................................................................143
Figure 4.6: gRNA targets within the CEP290 gene region surrounding Exon 50 and the
mutation ........................................................................................................................145
Figure 4.7: Example of transfection of primary cat fibroblasts with 30, 10, and 3 nM
gRNA (as labeled) complexed with the trRNA and Cas9 protein ..................................147
Figure 4.8: Detection of Cas9 activity at the CEP290 TAR1 and TAR2 loci .................150
Figure 4.9: Comparison of the feline CEP290 Exon 50 mutant sequence with the
modified ssDNA ultramer ..............................................................................................152
Figure 4.10: Schematic of feline CEP290 repair using HITI .........................................158
Figure 5.1: In vivo transduction of the retina.................................................................176
Figure 5.2: In vivo expression in the ciliary body ..........................................................177
Figure 5.3: Histological transduction of feline and murine outer retinas .......................179
Figure 5.4: Histological sections showing GFP expression in other parts of the feline
eye ................................................................................................................................182
Figure 5.5: Immune responses to the rAAV serotypes and to GFP ..............................184
Figure 5.S1: Müller cell transduction ............................................................................189

xii

KEY TO ABBREVIATIONS
RP — Retinitis Pigmentosa
LCA — Leber Congenital Amaurosis
PRA — Progressive Retinal Atrophy
OLM — outer limiting membrane
ONL — outer nuclear layer
INL — inner limiting membrane
IPL — inner plexiform layer
GCL — ganglion cell layer
ILM — inner limiting membrane
RPE — retinal pigment epithelium
PDE — phosphodiesterase
CNG — cyclic nucleotide gated channel
CEP290 — centrosomal protein 290kDa
KAP3 — kinesis-associated protein 3
KIF3A — kinesin family member 3A
RPGR — retinitis pigmentosa GTP-ase regulator
RPGRIP1 — RPGR-interacting protein
ATF4 — activation transcription factor 4
rd16 — retinal degeneration 16 (mouse)
rdAc — retinal degeneration in the Abyssinian cat
MGS — Meckel-Grüber Syndrome
BBS — Bardet-Biedl Syndrome
xiii

SLS — Senor-Løken Syndrome
JS — Joubert Syndrome
CORS — cerebella-ocular-renal syndrome
rds — retinal degeneration slow (mouse)
ERG — electroretinogram
SD-OCT — spectral-domain optical coherence tomography
CRISPR — clustered regularly interspersed short palindromic repeats
Cas — CRISPR-associated (protein)
iPSC — induced pluripotent stem cell
AAV — adeno-associated viral (vector)
RPE65 — retinal pigment epithelium specific protein 65
MERTK — MER receptor tyrosine kinase
EIAV — equine infectious anemia virus
ITR — inverted terminal repeat
Rep — replication
Cap — capsid
CMV — cytomegalovirus
CBA — chicken beta actin
mOP — mouse opsin
GRK — G-protein coupled receptor protein kinase
EZ — ellipsoid zone
GFP — green fluorescent protein

xiv

CHAPTER 1

INTRODUCTION

!1

1.1 The eye and ocular disease


1.1.1 Vision and its importance
What we see and how we visually process the world around us influences how
we live. It is a sense that we rely on heavily in our daily lives for most tasks and need for
many, allowing us to process light to perceive shapes, colors, movements, and our
world around us. Losing the sense of sight can therefore be devastating and have a
significantly negative impact on one’s quality of life.
Ocular diseases are widespread and varied, ranging from traumatic injuries, to
infectious diseases, to inherited conditions, all of which can affect any part of the eye.
When these diseases affect the eye in a manner that impairs its ability to take in or
process light, visual loss can occur, taking away a crucial component of one’s sensory
system and jeopardizing quality of life.

1.1.2 Ocular disease
Ocular diseases make up a common category of conditions that range from mild
to vision threatening, with millions of people afflicted by diseases that significantly impair
vision (https://nei.nih.gov/eyedata/vision_impaired/tables). These diseases can affect
any part of the eye and can impair vision through a variety of mechanisms, such as by
opacifying the cornea or lens such that light cannot traverse them or by affecting the
health of the retina such that the light that reaches it cannot be processed to be sent to
the brain. While there are treatments for many conditions- surgeries to remove
cataracts, replacing them with an artificial lens, and medications or surgical procedures

!2

to decrease corneal edema, as examples, many other conditions have no treatments or
have proven difficult to develop effective therapies.
Retinal diseases are particularly difficult to treat as many involve the
photoreceptor cells, or rods and cones, which are a type of terminally differentiated
neuron. A common type of inherited retinal disease that poses a particularly devastating
impact on both the individual and society are inherited retinal degenerations. These
retinal dystrophies encompass an entire subcategory of eye disease that has a
significant worldly impact to both people and animals and as such, is an active area of
research.

1.1.3 Retinal disease
Inherited retinal dystrophies make up a leading cause of blindness in both
humans and companion animals. Characterized by progressive retinal degeneration
causing decreasing vision that ultimately leads to blindness, they are devastating
diseases that significantly affect quality of life.
Inherited retinopathies are a group of genetically heterogenous diseases that
have been associated with mutations in many different genes. These mutations affect
the production of a variety of important retinal proteins, including those involved in
metabolism, trafficking, transcription and other integral retinal functions.
In humans, inherited retinal diseases include a wide variety of conditions such as
Retinitis Pigmentosa (RP) in adults, which has an estimated prevalence as high as 1 in
2,500 people, and Leber Congenital Amaurosis (LCA) in children, which has an
estimated prevalence of 1 in every 81,000 and makes up the most common inherited

!3

cause of blindness in children.(1-3) In companion animals, this group of retinopathies is
denoted as Progressive Retinal Atrophy (PRA). These diseases occur naturally within
the pet and lab animal populations and can also be genetically created in some species.
With striking similarities to the conditions in people, including homologous genes
mutated and comparable phenotypes, these animals provide an assortment of useful
animal models. Interest in retinal disease and treatment development to combat these
diseases is therefore of interest to both scientists and physicians invested in treating the
human conditions as well as scientists and veterinarians concerned about the ocular
health of companion animals. Understanding the retina, its functioning, and how to treat
diseases within it are therefore important and active areas of research.

!4

1.2 The Retina

1.2.1 Retinal anatomy and physiology
The retina is a highly organized tissue that lies at the posterior pole of the eye.
Through a process known as phototransduction, it is responsible for taking the light that
enters the eye and transforming that light into chemical and electrical signals that can
then be sent to the brain for final processing and visual perception. To do this, the retina
is organized into multiple layers each comprised of different cell types. The cells of the
various layers work in a cooperative and complementary manner to create a cascade of
events for this first stage of processing to occur.(4)
After traversing the anterior components of the eye including the cornea and
lens, light that enters the eye hits the retina, first striking the inner limiting membrane,
the boundary between the vitreous and the retina, and then nerve fiber layer which is
compromised of the axons of the ganglion cells. These axons gather at the center of the
fundus to form the optic nerve head, which then continues as the optic nerve towards
the brain, carrying the electrical signal created by phototransduction for visual
processing. Following the ganglion cells are amacrine cells, which are laterally
functioning regulatory cells that interact with the ganglion cells or bipolar cells. Bipolar
cells interact between photoreceptor cells or horizontal cells and ganglion cells, deriving
their name from the two poles of dendrites extending from their central cell body to do
so. Bipolar cells interact with rod and cone photoreceptors allowing for extensive
regulatory capacity. Downstream from bipolar cells, horizontal cells, as the name
suggests, act laterally much like amacrine cells to infer additional regulatory capacity,

!5

integrating information between multiple photoreceptor cells. Spanning the entire
thickness of the retina are Müller cells, a specialized glial cell that provides support to
the retina via functions such as electrical insulation, uptake of neurotransmitters and
waste debris, regulation of electrolytes, and storage of energy. At the far end of the
retina, past the photoreceptor cells, is the retinal pigment epithelium, a layer of further
retinal support. The cells of this layer nourish and support the photoreceptor cells which
interdigitate with their processes. The photoreceptor cells, or rods and cones, are a
specialized type of neuron that respond to light of different wavelengths based on
subtype. These integral cells are those in which phototransduction occurs, allowing for
the processing of light stimuli into chemical and electrical impulses that can ultimately
lead to visually perception by the brain.(4, 5) (Figure 1.1)

Figure 1.1: The eye and the retina. A. Cross-sectional schematic showing the major
ocular structures and the location of the retina. B. Histological cross section of the
human retina, illustrating the layers. From top to bottom, the photoreceptor cells (rods
and cones) are the outer layer of the retina. The outer limiting membrane (OLM) is
positioned between the photoreceptor inner/outer segments and the nuclear region. The
outer nuclear layer (ONL) contains the nuclei of the photoreceptors and is followed by
the outer plexiform layer, which consists of the synapses between photoreceptors and
bipolar and horizontal cells. The inner nuclear layer (INL) is composed of the nuclei of
the inner retinal cells including bipolar, horizontal, and amacrine cells. The inner
plexiform layer (IPL) consists of the synapses between bipolar cells and ganglion cells,
and the ganglion cell layer (GCL) consists of the ganglion cells. Lastly, the inner limiting
membrane (ILM) makes up the barrier between the retina and the vitreous and is
composed of the end plates of Müller cells. Adapted from (4)
!6

1.2.2 Photoreceptor cells and phototransduction
Photoreceptor cells are a specialized neuron in which the process of
phototransduction occurs. Photoreceptors contain multiple domains, namely inner and
outer segments, an interconnecting region that connects those regions known as the
ciliary zone, and nuclear and synaptic regions. The outer segment is the region
responsible for phototransduction which occurs entirely within this segment. This
segment contains layers of membranous “discs”, which function to increase the
membrane surface area available to accommodate the proteins needed for
phototransduction. However, the outer segment does not contain any cell machinery for
the production of proteins and energy or for the processing and disposal of waste.
These functions occur in the inner segment and retinal pigment epithelium (RPE). The
inner segment is integral for production of proteins and energy needed by the outer
segment, necessitating transport between the inner and outer segments for delivery of
inner segment produced products. This transport occurs in the interconnecting region,
which contains a connecting cilium that extends between the two segments. The RPE is
a monolayer of cells external to photoreceptor cells, with processes that interdigitate
between the photoreceptor outer segments. This layer is integral for providing
substances to the outer segments, absorbing scattered light to offset the photooxidative stress on the retina, and for the processing of outer segment discs.
Additionally, photo-oxidative stress on photoreceptors as a given consequence of their
role in processing light causes a continual process of shedding of the outer segment
discs and renewal of the discs at the proximal end of the outer segment. The RPE
serves a crucial role by phagocytosing the spent outer segment discs.(4, 6) (Figure 1.2)

!7

Figure 1.2: The photoreceptor cell and connecting cilium. A. Schematic of a rod
photoreceptor cell illustrating the membrane disks and different regions of the cell. B.
Magnified view of the interconnecting region illustrating the location of CEP290 protein
in relation to the major machinery in this region. Adapted from (7)
Phototransduction is the process by which photoreceptor cells process light that
enters the eye into signals that can be transmitted to downstream cells for eventual
transmission to the brain for final visual processing and perception. It is a complex
process characterized by a series of sequential changes within the cell. It begins when
photons of light enter the eye, traverse the retina, and reach the outer segments of
photoreceptor cells. These photons are absorbed by a protein known as rhodopsin in
rod cells or opsin in cone cells, which are G-protein coupled receptors that contain the
light-absorbing chromophore “11-cis retinal”.(8)
!8

This photon absorption causes a conformational change in the retinal
chromophore. In the example of a rod photoreceptor cell, it changes 11-cis retinal to an
all-trans configuration. This in turn leads to activation of a G-protein called transducin,
which in turn activates a cGMP phosphodiesterase (PDE). The PDE molecule then
hydrolyzes cGMP. The hydrolysis of cGMP lowers the concentration of this molecule in
the outer segment, resulting in fewer of these molecules available to the membrane’s
cGMP-gated cation channels. The result is closure of the cyclic nucleotide-gated (CNG)
channels and hyperpolarization of the cell.(8) (Figure 1.3)

Figure 1.3: The phototransduction cascade. Photons of light activate rhodopsin (R*),
which in turn activates the G-protein. The activated G-protein binds to the inhibitory
subunits of phosphodiesterase (PDE), catalyzing the hydrolysis of cGMP causing a
decrease of cGMP concentration in the cell. The lack of cGMP results in the closure of
cGMP-gated channels in the surface membrane of the cell, causing hyperpolarization of
the cell. Adapted from (8)
Though phototransduction occurs in the outer segments of photoreceptor cells,
the rest of the cell supports this function by maintaining overall cell health and providing

!9

the necessary support for the outer segments. The inner segments contain the cell
machinery that conduct cell functions such as the production of energy and proteins. As
stated earlier, the outer segments are not capable of these functions and as such rely
on the inner segments to supply the products necessary for phototransduction. To allow
for this, photoreceptors have a ciliary zone between the inner and outer segments that
is responsible for the transportation of proteins to and from the outer segment. Within
this zone is a primary cilium that extends between the inner and outer segments known
as a connecting cilium, along which products are transported. This transport is
facilitated by a kinesin motor system that moves products toward the outer segment and
a dynein motor system that moves products towards the inner segment. In addition to
the transportation machinery, support proteins are integral for regulating the movement
of products and waste along this cilium. ‘Gate-keeper’ proteins, for example, bridge the
gap between the cilium and the wall of the photoreceptor, maintaining an appropriate
distance between components and regulating what products pass through. These
proteins interact with other proteins within the ciliary zone and together these
complexes are imperative for proper cell function, health, and phototransduction.

1.2.3 Inherited retinal dystrophies
Inherited retinal dystrophies are a leading cause of blindness that affect
approximately 1 in every 2,000 people worldwide.(9) They are debilitating and
devastating diseases that significantly impair or destroy vision and adversely affect
quality of life. The inherited nature of these diseases and the cell types they affect, often
the terminally differentiated photoreceptor cells, make them difficult to treat. As such,

!10

effective treatments are currently limited and primarily consist of clinical trials. However,
there are treatments that show promise in the laboratory, making these conditions both
imperative and exciting to study.
Two types of retinal dystrophy, Retinitis Pigmentosa (RP) and Leber Congenital
Amaurosis (LCA) make up a large portion of retinal dystrophies. The study of these
conditions are active areas of research and of specific interest to this dissertation, as
will be detailed in upcoming sections.

1.2.3.1 Retinitis Pigmentosa (RP)
Retinitis Pigmentosa, or RP, is a human retinal dystrophy that affects about 1 in
every 3,700 people (10). It is characterized by progressive loss of vision that begins in
the peripheral retina and spares central vision leading to tunnel vision. Most forms affect
rod photoreceptor cells prior to cones and are hence considered rod-cone dystrophies,
which results in diminished dim light vision first with bright light visual deterioration
occurring in later stages of disease. Visual acuity is preserved in early to mid stages of
disease and later is lost with patients experiencing increasing photophobia throughout
the course of the disease. (11)
Funduscopically, patients typically show characteristic changes to the retina.
Signs include pigmentary deposits that begin in the peripheral retina and extend
centrally, blood vessel attenuation, optic nerve head pallor, and visible retinal atrophy.
Electroretinographically, patients show progressively decreased a- and b-wave
amplitudes. (11)

!11

1.2.3.2 Leber Congenital Amaurosis (LCA)
Leber Congenital Amaurosis, or LCA, is the most severe inherited retinal disease
leading to blindness. It is characterized and diagnosed based on four features; severe
loss of vision that occurs early in life, nystagmus, amaurotic pupils and a nonrecordable
electroretinogram.(12) It is considerably more rare than Retinitis Pigmentosa with an
estimated prevalence of 1 in every 81,000, however, it is a particularly devastating form
of retinal dystrophy owing to its early-onset and often severe phenotype.(2)
Children affected with LCA typically begin showing clinical features of disease
within the first few weeks of life.(13) The speed with which the disease progresses as
well as the changes in fundic appearance depend upon the gene mutated and the
subsequent effect on the protein product.(14) This varies considerably as LCA has been
associated with over 400 mutations that occur in seventeen genes to date. These genes
account for roughly 70% of all LCA cases, suggesting mutations in other yet-to-be
identified genes as well.(14)

1.2.3.2.a CEP290 associated disease and LCA
Of the identified mutations association with LCA, over 100 involve the
centrosomal ciliary 290kDa (CEP290) gene, accounting for approximately twenty
percent of LCA cases.(15) Understanding this gene, the function of the protein it
encodes, and the effects mutations within this gene have on phenotype are therefore
important areas of research. (Figure 1.4)

!12

In humans CEP290, also known as nephrocystin 6, or NPHP6, is 93.2kb long
and is located on human chromosome 12, at q21.13. It contains a total of 54 exons and
encodes an 8kb transcript.(16)

Figure 1.4: Disease-causing mutations in the CEP290 gene in people. The
schematic illustrates the protein with known domains. Each mutation is marked based
on where it affects the protein.(17)
The protein produced by this gene is a large 290 kDa protein that has multiple
domains, many of which are highly evolutionarily conserved. There are thirteen coiledcoil domains, three tropomyosin homology domains, a hook domain, six RepA/Rep
protein kinase inducible domain motifs, a bipartite nuclear localization signal, an ATP/
GTP-binding site motif A (P-loop), a region with homology to structural maintenance of
chromosomes chromosome segregation ATPases, and a region with homology to a
myosin-tail domain. It is mostly unknown what roles these domains play in this particular
protein.(16) However, it has been suggested that the BPNLS domain likely functions in
the nuclear localization of the CEP290 protein (18), and that the myosin-tail-like domain
!13

may be important in the movement of the protein to centrosomes along microtubules by
providing a backbone for the myosin motor.(18, 19)
The protein is localized within the centrosomes of mitotic cells, nuclei, and in
certain cell types including photoreceptors, within the basal bodies at the base of ciliary
apparatuses. It has most notably been found to be expressed in rod and cone
photoreceptor cells, kidney cells, olfactory sensory neurons, and the brain.(18-22) The
protein is integral for the proper function of centrosomes and cilia, as it acts as part of a
protein complex that facilitates transport along microtubules. This protein complex
includes centrin, dynactin subunit P150, gamma-tubulin, kinesin-associated protein 3
(KAP3), kinesin family member 3A (KIF3A), ninein, p-50 dynamitin, pericentrin, retinitis
pigmentosa GTP-ase regulator (RPGR), and RPGR-interacting protein 1 (RPGRIP1), all
of which make up the important dynein-dynactin molecular motor. In the rd16 mouse, a
model of CEP290 mutation-associated retinal disease, it has been shown that the
CEP290 protein is integral for the proper trafficking of important phototransduction
molecules including rhodopsin and arrestin.(19)
Moreover, CEP290 seems to play a role in the assembly of primary cilia, through
its interactions with the proteins PCM-1 and Rab8a. PCM-1 is required for the proper
organization of microtubule networks, and it has been shown that CEP290 is recruited
to centrioles by PCM-1 and that disrupted CEP290 concentrations lead to the
mislocalization of PCM-1. Rab8a is recruited by CEP290, and is a GTPase required for
the proper elongation of ciliary membranes.(23)
CEP290 has been shown to interact with other important proteins as well. The
protein segment encoded by exons 2-21 of the CEP290 N-terminus interact with

!14

Activation Transcription Factor 4 (ATF4) and can lead to the activation of transcription
mediated by this factor.(18) Furthermore, CEP290 interacts with two important Gproteins within olfactory epithelial cells, suggesting an important role in G-protein
trafficking during olfaction.(22)
The CEP290 protein is important during the development of photoreceptor cells
due to its involvement in the transport of the proteins and lipids necessary for this
process. It accomplishes this by facilitating transport along the primary cilium that
eventually gives rise to the interconnecting cilium of photoreceptor cells, where it
remains localized following maturation of these cells. It is also essential for the
maintenance of photoreceptor cells, as rod photoreceptor discs have a high turnover
rate and therefore require a functional transport system to sustain their regenerative
processes.(24)
Due to the fairly widespread expression of CEP290 and the many important roles
it plays both alone and through its interactions with other proteins, several diseases
including syndromic and non-syndromic disorders have been associated with mutations
in the gene encoding this protein. These diseases have mostly been identified in
humans; however, non-syndromic retinal diseases have been identified in other species,
including the retinal degeneration 16 (rd16) mouse and the retinal degeneration in the
Abyssinian (rdAC) cat, two CEP290 mutant models to be discussed later in this chapter.
Owing to the ciliary location of the CEP290 protein, mutations in this gene have
been associated with a variety of “ciliopathies,” a class of diseases characterized by
dysfunction of cilia. These diseases range greatly in phenotype given the widespread

!15

presence of cilia throughout many cells types within the body and include diseases of
organs such as the kidneys, liver, brain, and retina.(25)
Due to the ubiquitous nature of the CEP290 protein and the existence of several
known mutations in the gene in humans, multiple ciliopathies and ciliopathy syndromes
have been associated specifically with CEP290 mutations in people, including four
different syndromic disorders; Meckel-Grϋber Syndrome, Bardet-Biedl Syndrome,
Senor-Løken Syndrome, and Joubert Syndrome, as well as non-syndromic Leber
Congenital Amaurosis.
Meckel-Grüber Syndrome (MGS) is an autosomal recessively inherited disease
that has been associated with CEP290 mutations in eight families, and an additional
four families show Meckle-like Syndromes, with incomplete MGS phenotypes, due to
mutations in this gene (26, 27). MGS is a severe and devastating disease that is fatal in
the neonatal stage. The syndrome includes severe central nervous system
malformations such as occipital meningo encephalocele, renal abnormalities typically
including bilateral cyctic kidney dysplasia, hepatic abnormalities including portal ductal
proliferation, as well as postaxial polydactyly. The syndrome may also present with
additional abnormalities in the cardiac system as well as additional developmental
abnormalities including cleft palate, situs inversus or malformations of the genitalia.(28)
Bardet-Biedl Syndrome (BBS) is a severe syndromic ciliopathy that ranges
considerably in phenotype and genotype. Fourteen genes have been implicated as
causes of BBS, including CEP290, and in most cases the disease is inherited in an
autosomal recessive manner. It has been reported that many patients have multiple
mutations in different genes with resulting effects on expressivity and penetrance

!16

(Zaghloul, 2009). The syndrome most commonly consists of retinal degeneration,
obesity, renal dysfunction, polydactyl, and hypogonadism, but may also include
neurological, cardiovascular, hepatic, and metabolic impairments as well as speech
deficits, hearing loss, diabetes mellitis, and Hirschsprung disease.(29)
Senor-Løken Syndrome (SLS) has been associated with mutations in CEP290 in
several families. The syndrome is characterized by nephronophthisis-like renal
impairment and retinal degeneration. An autosomal recessively inherited syndrome,
SLS causes severe renal impairment including tubulointerstitial fibrosis, tubular atrophy,
tubular dilatation and the formation of renal cysts, which together lead to end-stage
renal disease typically within the first thirty years of life.(30) The retinal degeneration
that occurs in patients with SLS also tends to be severe.(18, 31, 32) While certain
CEP290 mutations are recognized as causative of SLS, they are considered an
infrequent cause of the disease, as determined by mutation screenings in those
affected.(32, 33)
Mutations in several genes have thus far been associated with Joubert
Syndrome, or JS, a severe syndromic disorder characterized by psychomotor delay,
hypotonia and ataxia, and sometimes also associated with neonatal respiratory
dysfunction and oculomotor apraxia.(18, 34) A hallmark of JS is the “Molar Tooth Sign”,
a cerebellar abnormality apparent on magnetic resonance imaging.(35) The CEP290
mutations that cause this phenotype are almost entirely frameshift or nonsense
mutations that lead to severe loss of function of the CEP290 protein in multiple body
systems.(36) While mutations in CEP290 only account for approximately twenty percent
of JS cases, CEP290 mutations have been associated with a significant proportion of

!17

Joubert Syndrome Related Disorders, or JSRDs, which include not only the abovementioned clinical features, but others including retinopathy, renal abnormalities,
cerebello-ocular-renal syndrome (CORS), orofacialdigital syndrome type VI, or COACH
syndrome.(37) Of these disorders, mutations in CEP290 are a major cause of CORS
syndrome, of which they are estimated to cause about half of all cases (37).
Lastly, mutations in CEP290 have been associated with approximately twenty
percent of all non-syndromic LCA cases warranting a considerable amount of research
involving the CEP290 gene to develop treatments for this devastating disease.(15) As
described previously, LCA is a form of childhood blindness due to retinal degeneration.
The retinal phenotype most commonly caused by CEP290 mutations is an LCA
(LCACEP290 ) characterized by severe visual impairment.(38) Fundic changes include
white dots on the fundus and progression to pigmentation in the midperipheral fundus.
(15, 17, 38, 39) Microscopically, retinas show significant thickening of inner retinal layers
in the rod-rich periphery with good preservation of the outer nuclear layer in the region
of the fovea, even when the inner retina is significantly affected.(21, 40) Interestingly,
some LCACEP290 patients exhibit significant olfactory dysfunction and as many as thirtythree percent show neurologic dysfunction however, while these cases are often
classified as LCA they more closely resemble syndromic diseases caused by CEP290
mutations and are therefore probably misclassified.(17, 22, 38, 41)
The correlation between genotypes and phenotypes in cases of LCACEP290 is not
always clear. However, studies suggest that the phenotype may be determined by which
domains are adversely affected by the respective mutation. The rd16 mouse, for
example, displays a strictly retinal degeneration phenotype, which is caused by a

!18

mutation that cleaves only the myosin-tail homology domain leaving the downstream
domains intact. This suggests that this domain performs a retina-specific function in the
mouse, and likely in other species. Similarly, CEP290 mutant cats also display only
retinal degeneration, as detailed below. In these cats, though the myosin-tail homology
domain is intact, two other C-terminal domains, KIDV and VI, are cleaved. These data
all point to retina-specific functions of the C-terminal domains of the CEP290 protein.
(19)
Despite the many diseases associated with mutations in CEP290 and the
severity of these conditions, there are currently no treatments specifically aimed at
CEP290 diseases. Research to better understand disease mechanisms and develop
treatments are therefore of great importance. For the development of treatments and
testing of both the safety and efficacy needed to reach human clinical trials, animal
models are imperative. In the case of inherited retinopathies, including LCACEP290 there
are several species available for this purpose.

!19

1.3 Animal models for inherited retinopathies

Establishing animal models for human diseases is integral for establishing the
data necessary to begin human clinical trials. Rodent models, including transgenic
models as well as spontaneously occurring models, provide a strong backbone from
which to better understand disease mechanisms and take steps towards treatment
development. However, these models have certain limitations which can be overcome
by the use of large animal models such as cats and dogs.
With the discoveries of naturally occurring PRA-causing mutations in dogs and
cats, companion animals have become important large animal models for human retinal
dystrophies that can provide more information and more comparable information than
rodent models.
All of these animal models provide important information for human retinal
dystrophy studies. For instance, candidate genes may be found in animals that can then
be more efficiently tested in humans. Furthermore, once mutated genes are identified in
animals, the nature of that gene and its protein product and their effect on phenotype
can be more easily studied in the animal model and data can then be extrapolated to
humans. Importantly, treatment testing must first begin in animal models to provide the
proof-of-principle, safety, and efficacy data necessary to reach human clinical trials.(42)

1.3.1 Rodent models
Rodent models of retinal degenerations are numerous and have been described
since the 1920’s, with the rodless mouse marking the first animal model of a human

!20

retinal degeneration.(43) This naturally-occurring mouse model is now known as the rd1
mouse and is still a commonly used model for autosomal recessive retinal dystrophies
Shortly thereafter, a naturally-occurring rat model, the RCS rat, was identified.(44-46)
The retinal degeneration slow mouse model, or rds mouse, is another early-described
naturally-occurring model that was later described and characterized and remains in
use today.(47)
A variety of transgenic rodent models have since been created, which allows for
a specific gene to be genetically modified as a means of creating a desired model.
These techniques have proven particularly useful for creating models for the more rare
forms of human retinal dystrophy, including those inherited in autosomal dominant or Xlinked fashions. For instance, a murine model with an opsin knock-out has been created
that mimics human autosomal dominant Retinitis Pigmentosa, as well as an X-linked
model created by the knock-out of the Retinitis Pigmentosa GTPase Regulator (RPGR)
gene.(48, 49)
Rodent models make excellent tools for studying retinal degenerations. They are
inexpensive and can easily be housed in large numbers, making them efficient models
that can allow studies of high power due to higher animal numbers. They are relatively
easy to handle and in general pose fewer ethical and welfare concerns than higher
order models. However, there are differences in the anatomy and physiology of the
rodent eye, relative to the human eye, that pose significant limitations to their
usefulness as models of human retinal disease. The first most obvious difference is the
size of the eye; the strikingly smaller size of the rodent eye makes extrapolating
conclusions concerning surgical techniques from the rodent to the human more difficult.

!21

Similarly, the proportions of the structures within the eye are different, with a
proportionally larger lens, for example. Furthermore, most rodent models have a roddominant retina that lacks a macula and fovea. People rely heavily on the macula and
fovea for visual acuity and as such, studying treatment effects on these regions is
imperative. Furthermore, diseases of the macula make up a leading cause of visual
impairment, necessitating models with a homologous central retinal region and disease
for studying these diseases and developing treatments against them.(50) Therefore,
while rodents make useful animal models for retinal dystrophies, they have some
significant limitations that warrant the use of other species whose eyes bear greater
resemblance to the human eye.

1.3.2 Large animal models
Dogs and cats are moderately priced and relatively easy to house while affording
the benefits of eyes that are similar to humans, in size as well as anatomy. Companion
animal models of human retinal dystrophies have therefore become important models
used in research today. In particular, the dog, with retinal dystrophy occurring in a large
number of breeds, has established itself as a top spontaneously occurring model. With
the characterization of multiple forms of PRA in cats and the identification of the
mutations causing these forms, however, the cat has also become a useful animal
model for retinal dystrophies.(51-54)
Progressive Retinal Atrophy (PRA) is a group of genetically heterogenous retinal
diseases that cause blindness in companion animals. PRA makes up the leading
inherited cause of blindness in purebred dogs and has been identified in over 100

!22

breeds.(55) It is a naturally-occurring disease, and that characteristic, along with the
desirable characteristics of the canine eye, make canine forms of PRA excellent models
of RP and LCA in humans.
Though the canine eye is still smaller than the human eye it is more similar in
size to the human eye than rodent models, and in addition, has similar proportions.(56,
57) These characteristics make surgical techniques more comparable to the human.(55)
Moreover, though the canine does not have a macula or fovea it does have an area
centralis, a region of significantly increased cone density that may play a role in visual
acuity, much like the human macula.(58-60)
PRA in dogs makes an excellent model for RP or LCA in humans, as it is a group
of heterogeneous diseases that mimic RP and LCA both genetically and phenotypically.
Genes that are associated with PRA in dogs are the same genes associated with RP
and LCA in humans, and the phenotypes caused by these mutations are often similar
between the species.
Several mutations have been identified in dogs that cause PRA, including several
that contribute significantly to human retinal dystrophies such as CNGB1, and PDE6
both alpha and beta.(61-64) Most of these mutations cause autosomal recessively
inherited forms of PRA, though autosomal dominant and X-linked forms have been
described.(55, 65-67)
In addition to elucidating information concerning the defective genes and their
products, canine models have provided a platform in which to test prospective
treatments for retinal dystrophies. Such treatments have shown success in dog models
and have been important in the development of human clinical trials.(68-70)

!23

The discoveries of naturally-occurring disease-causing mutations in the dog, the
fact that these are in the same genes as disease-causing mutations in people, and the
similarities of their eye with the human eye, have made the species a leading large
animal model for human retinal dystrophies. As more mutations are identified in the
species, the dog will provide further opportunities for studying inherited retinal
dystrophies and will continue to be a popular large animal model for these diseases.
Two forms of PRA were identified in the cat in the 1980’s.(71, 72) With the
discoveries of the disease-causing mutations for these two forms of feline PRA,
mutations in the CEP290 and the CRX genes, the cat has presented itself as another
important large animal model for human retinal dystrophies.(53, 73) These feline forms
of PRA have allowed the establishment of two important and much needed LCA models;
a model for autosomal dominant LCA and for LCA caused by the commonly mutated
CEP290 gene.(72, 74)
Like the dog, the cat makes an excellent animal for use as a model of retinal
dystrophy. The feline eye shares great similarity in both size and anatomy to humans,
and has proportions conducive to practicing surgical techniques and treatments. Cats
also possess a photoreceptor and cone dense area centralis region, allowing for
extrapolation to the human macula. (Figure 1.5)
These two cat models are new valuable tools as the scientific community moves
towards the development of treatments for LCA. However, before these models can be
fully utilized, it is important that baseline information regarding these therapies and their
effects in cats be established.

!24

Figure 1.5: Distribution of cones in the feline retina. The schematic depicts a heat
map derived from the cone density of the retina with darker colors indicating higher
cone density. Cone density is higher along the visual streak than the peripheral retina
and is highest at the area centralis. S = superior, N = nasal, I = inferior, and T =
temporal. Letters A-H indicate regions the investigators characterized further. Adapted
from (75)
1.3.2.1 The feline CEP290 model
A form of spontaneously inherited PRA was discovered in Abyssinian cats in
Sweden in the 1980’s.(71) It was determined through breeding that this form is inherited
in an autosomal recessive fashion and it was determined that it is caused by a mutation
in the centrosomal ciliary 290kDa, or CEP290, gene.(73, 74) This intronic one base-pair
substitution allows for the usage of a GT sequence four base pairs upstream of the
mutation to be utilized as a splice donor site. This results in a four base-pair insertion in
the transcript during splicing and a predicted truncation of the protein that would
!25

eliminate 159 out of the total 2,479 amino acids.(52) CEP290 is the most commonly
mutated gene implicated in LCA cases, making the CEP290 PRA (PRACEP290) cat a new
and important LCA model.(15) (Figure 1.6)

Figure 1.6: The feline CEP290 mutation and resultant truncated protein. A.
Electropherogram of the feline genomic sequence in the region of the CEP290
mutation. The top row shows the wild-type T nucleotide, which is substituted with a G in
the mutant allele. This change allows for the GT upstream of the mutation to be used as
a splice donor site (spicing depicted by boxes). B. Electropherogram of the
corresponding cDNA shows the four base-pair insertion in the transcript. C. Schematic
representing the human gene and protein. Dotted lines indicate disease-causing
mutations in people, with the most common mutation highlighted in the red box at the
top of the image. The red box on the protein image represents the region of the protein
truncated by the CEP290 mutation in cats. Adapted from (16, 52)
The phenotype caused by the above-mentioned CEP290 mutation in the feline is
exclusively retinal and is considered a form of PRA.(71) This phenotype is most similar
to that seen in humans with non-syndromic Leber Congenital Amaurosis (LCA) caused
!26

by mutations in CEP290. However, the phenotype in cats is less severe than seen in
typical cases of CEP290 retinopathies in people, with a later onset and slower
progression, an interesting difference worth investigating that could help guide
treatment development. This question was addressed by our laboratory and the results
are detailed in Chapter 2 of this dissertation.
In homozygous animals, clinical signs include features characteristic of PRA.
Signs of progressive blindness are first apparent in early adulthood. Funduscopic
abnormalities are first observed at 1.5-2 years of age and include blood vessel
attenuation and changes in tapetal reflectivity that correspond to morphological changes
in retinal thickness. Initially, the fundus typically shows patchy regions of hyporeflectivity,
a sign that is different from other forms of PRA, but later becomes hyperreflective, as is
typical with PRA as the retina thins on top of the tapetum lucidum. This hyperreflectivity
is initially most obvious in the peripheral fundus and is not apparent in the central
fundus until late stages of disease. Cats are functionally blind by 3-5 years of age.(76)
Electroretinographically, the waveform of affected ERGs has a normal shape,
however, amplitudes progressively decrease. Beginning early in the disease, affected
cats show decreased b-wave amplitudes, an elevation in b-wave threshold, and may
begin showing a decrease in a-wave amplitude.(77, 78) At a more advanced stage of
disease, thresholds are significantly elevated, the amplitudes of both a- and b-waves
are markedly reduced, and flicker responses are non-recordable.(77, 79-81) At this
stage, oscillatory potentials are also non-recordable.(82) Eventually, all ERG responses
become non-recordable.(83) Implicit time changes are less severe throughout disease,

!27

with an increased implicit time noticed only for b-waves at high light intensities in later
stages of disease.(83)
Use of multifocal ERG can be used to study the distribution of electrical
responses across the retina. In one study using this technique, it was reported that
regional differences in ERG responses were not evident until a moderately advanced
stage of disease. At that stage they saw a slightly higher response from the area
centralis region, which is consistent with the morphological findings described below
and taken together suggest that the central retina may be spared until late stages of
disease.(84) This characteristic would be consistent with LCACEP290 in which central
retina sparing is seen and would support the cat as a model for this retinal dystrophy.
(21) However, studies to determine regional rates of degeneration were not conducted
to confirm this. We therefore aimed to study this change utilizing spectral-domain optical
coherence tomography (SD-OCT), a useful tool for in vivo monitoring of retinal
architecture and layer thicknesses, as detailed in Chapter 3 of this dissertation.
These changes correspond to the morphological changes noted histologically by
many studies. Though this form of feline PRA typically does not become evident
clinically until cats are adults, ultrastructural changes are evident early on. By about four
weeks of age rod outer segment discs show disorientation.(85) The same study noted
that these initial changes were later followed by rod degeneration, with individual rods or
small patches of rods beginning to degenerate before clinical signs become evident.
This patchy degeneration was reported to start in the peripheral and mid-peripheral
fundus, with significant shortening of the photoreceptor inner and outer segments and
slight reduction of the outer nuclear layer occurring in early stages in those patches.

!28

(86). Based on these findings, the authors divided the phenotype into two phases. The
first phase occurs before complete maturation of the retina and is characterized by
disorientation and disorganization of rod outer segment disc membranes. The second
phase occurs later on and is characterized by progressive degeneration of
photoreceptor cells culminating in photoreceptor cell death. Furthermore, vesicle
formation is evident in photoreceptor cells as degeneration progresses.(87)
Changes in the inner retina are also apparent, with changes most notable in
horizontal cells. These cells show significant extension and thickening of the lateral
processes beginning in the first stage of the disease. The apical dendrites then
degenerate as the disease progresses. Rod bipolar cells also show changes, but only in
the later stage of disease. They show loss of their fine dendritic processes and
disorganized axons, and decrease in number over time.(88) Furthermore, the axon
terminal boutons in the innermost section of the inner plexiform layer of the retina were
decreased in number and smaller in size in affected animals. However, it has also been
noted that the innermost region of the retina appears to be preserved throughout the
course of the disease.(89)
The feline CEP290 form of Progressive Retinal Atrophy is characterized by
progressive degeneration and thinning of the retina ultimately leading to blindness. The
phenotype is similar to LCACEP290 in people with likely central retinal sparing but with a
later onset and slower progression, warranting investigation of these differences.

!29

1.4 Treatments for retinal dystrophies

There are currently no treatments available for CEP290 associated retinal
dystrophies. With the cat now established as a useful model for LCACEP290, great
opportunity exists for treatment development and testing. Though CEP290 retinopathies
pose unique challenges for treatment development, stem cell transplantation, gene
therapy, and genome editing, all present promising treatment possibilities.
Stem cell therapy is appealing because it may allow for the replacement of
photoreceptor cells, a type of terminally differentiated cell, even after they have been
lost. This is something that gene therapy or genome editing cannot achieve, as they
must be administered prior to the loss of photoreceptor cells and therefore would need
to be administered earlier than stem cell therapy. However, while some reasonable
success has been demonstrated, this treatment has produced very limited success in
the feline CEP290 model.(90-99) One study was only able to achieve successful
transplantation in two out of the four cats studied, and in those two, host blood vessels
did not extend into the transplants and no improvement in vision could be recorded
electroretinographically.(100) Another study found some promising results, suggesting
that allografts can survive without rejection in the mutant feline retina; however, the
allografts caused significant photoreceptor detachment from the retinal pigment
epithelium and subsequent photoreceptor degeneration, and they found no
improvement in the rate of photoreceptor degeneration.(101)
Therefore, while stem cell transplantation holds promise in theory, it is important
to study alternative treatment methods. Gene therapy would allow the wild-type gene to

!30

be introduced into the host to promote the creation of the unaffected gene product. With
genome editing, the mutation may be edited out either in vivo or be combined with
similar methods presented above to edit the mutation out of a patient's own cells for retransplantation.
Gene therapy based treatments show great promise for the treatment of inherited
retinal dystrophies. Leber Congenital Amaurosis cases caused by CEP290 mutations
are no exception, and felines affected with PRA caused by the CEP290 mutation
provide an invaluable tool to test this therapy before proceeding to human clinical trials.
As discussed, the phenotype in the feline progresses fairly slowly and has an age
of onset that would allow administration of a gene therapy treatment prior to the loss of
the photoreceptor cells. Following introduction of the therapeutic gene into the feline
retina, cats could be examined for visual improvement and monitored for signs of
adverse reactions.
There is a significant obstacle to CEP290 gene therapy, however. With a
transcript size of approximately 8kb it may be impossible to fit the transcript into the
vector of choice for the retina, the adeno-associated viral vector.(16) Though ambitious
and still in the beginning stages of exploration, there are a few methods that may
overcome this obstacle, including heavily packing the AAV vectors, co-transduction,
inclusion of a partial transcript in the vector, or utilizing a different vector system
altogether.(102-108)
Alternatively, these obstacles can be avoided using a different treatment type,
genome editing. Genome editing is a method by which changes can be made to the
genome to achieve aims such as making insertions or deletions or even replacing a

!31

segment of the genome. Two previously common systems used to accomplish this were
TALENS (transcription activator-like effector-based nucleases) and zinc-finger
nucleases, both classes of enzymes known as nucleases that makes cuts in DNA and
through bioengineering can be directed to cut specific sequences. More recently, the
CRISPR-Cas nuclease (clustered regularly interspaced short palindromic repeats) has
gained favor as a more easily engineered, affordable, and scalable method of genome
editing.(109)
The CRISPR-Cas system is a bacterial immune system that infers an acquired
immunity against foreign nucleases such as the sequences contained within viruses and
plasmids. The DNA of this system, the basis of the name, consists of short palindromic
repeats next to which short “spacer” sequences are added through recognition and
copying of invading nucleases. Next to the CRISPR sequences are sequences
encoding the Cas (CRISPR-associated system) nuclease. Together this system
recognizes, remembers, and then in subsequence infections destroys invading
nucleases.(110)
This system has been harvested and bioengineered for use as a genome
engineering tool. Typically utilizing Cas type 9 (Cas 9), the CRISPR/Cas 9 system can
be introduced into cells along with a “guide” RNA, or gRNA, designed by the
investigator with a specific sequence to guide the system to cut at a designated location
within the genome.(111) (Figure 1.7)

!32

Figure 1.7: CRISPR/Cas9 Genome Engineering. A. Schematic representation of the
Cas9 nuclease. The enzyme is directed to a specific DNA sequence by the guide RNAs
(sgRNA) via a guide sequence (red). This sequence base-pairs with the target
sequence (light blue). The PAM (protospacer-adjacent motif) binds downstream of the
target and directs the double-stranded DNA breaks. The RuvC domain cleaves the
sequence that is not complementary to the guide sequence while the HNH domain
cleaves the sequence that is complementary to the guide sequence. B. The breaks are
then repaired by cell machinery via either nonhomologous end-joining or homologydirected repair. Adapted from (112)
This system can be utilized to genome edit for a variety of different purposes
including the creation of new models as well as the development of treatments against
inherited diseases. It therefore provides a useful tool in the fight against inherited

!33

retinopathies and is of particular interest in the development of treatments against those
retinopathies that pose challenges to methods such as gene therapy, as is the case with
LCACEP290.
Use of this system for therapies could be achieved in a variety of ways. Against
LCACEP290 the most likely method designs include the editing of patient-derived induced
pluripotent stem cells (iPSCs) or photoreceptor precursor cells for re-transplantation into
the retina (allowing for avoidance of immune responses to foreign cell transplantation),
or, direct in vivo delivery of the CRISPR system to the photoreceptor cells. For in vivo
delivery of this system, a delivery vehicle would be necessary to carry the system into
photoreceptor cells. The same vectors utilized in gene therapy could be utilized for this
purpose, amplifying the importance of developing, testing, and optimizing delivery
vehicles for retinal treatments.

1.4.1 Vehicles for treatment delivery
An integral component of many retinal dystrophy attempts is a vehicle to deliver
the transgene or machinery needed for repair to the appropriate cells. Gene therapy
and in vivo CRISPR genome editing based treatments would both require a vehicle, as
examples. Delivery vector testing has been extensively studied in the retina with ideal
vector systems determined in several species. However, minimal vector testing has
been conducted in some species including the feline. Only one study prior to our
investigation had analyzed AAV vector transduction in the feline and only studied a
basic AAV2 construct. This study showed effective transduction of photoreceptor cells,

!34

suggesting AAV vectors could be used in the feline retina, and highlighting the need to
study additional serotypes, the basis for Chapter 5 of this dissertation.(113)
There are several types of vectors available for delivery of treatment components
to the retina, encompassing both non-viral and viral forms. Many types have been
tested in the eye; however, most have shown limited success.
Many vector types being studied today are based on viral systems, however,
non-viral vector systems have also been investigated. One such vector utilizes plasmid
DNA. This vector may be useful for delivering therapeutic genes, however limited
success has been found in the retina unless used in conjunction with electroporation
(114). Though when combined with this technique plasmid DNA was shown to lead to
reporter gene expression in rodent photoreceptor, bipolar, and Müller cells, this
technique has fallen out of favor for more effective viral systems.(115) Similar results
have been found using other non-viral vector systems such as liposomes and
nanoparticles, though these systems show more promise and continue to be
investigated today.(116-120)
Viral vectors may stem from several different families of viruses, each with its
own advantages and disadvantages. Several virus systems have been tested
specifically for therapies to the retina, with varied success.
Adenovirus vectors have overall proven inefficient for retinal gene therapy. This is
especially true when using them to target photoreceptor cells.(121, 122) They have
shown inconsistent and overall poor photoreceptor transduction, with preferential
transduction of the RPE, though a recent study showed some transduction of
photoreceptors.(123, 124) Given the RPE targeting of these vectors, they are more

!35

useful for RPE related retinal dystrophies and have shown promise for treatments
against retinopathies caused by mutations in RPE65 and MERTK.(125, 126)
Slightly more success has been reported using lentivirus based vectors.
Lentiviral vectors are appealing because they are capable of transducing terminally
differentiated cells, a class of cells that includes photoreceptor cells, and because they
have a large carrying capacity capable of holding longer transcripts.(114) Despite that
however, lentivirus vectors favor transduction of the retinal pigment epithelium and have
shown unpredictable transduction of photoreceptors.(127) However, studies
investigating alterations to lentiviral vectors such as the use of bicistronic or dualpromotor vectors has resulted in successful delivery to the retina in some studies and
are currently in clinical trials against Stargardt's Disease.(128-132)
A concern with lentiviral vectors is the possibility of insertional mutagenesis due
to their integration into the host genome, though more recent studies have suggested
this risk is low.(133, 134) They also carry a higher risk of immune reactions against
them, which has demonstrated in our laboratory when an equine infectious anemia virus
(EIAV) vector was tested in a pilot study in a wild-type feline (unpublished results). In
this study the EIAV vector induced a severe acute immune response necessitating the
early sacrifice of the animal for humane purposes.
The greatest promise for a safe and effective retinal vector system has come
from the adeno-associated viral (AAV) vector. This vector type has repeatedly been
shown to effectively target retinal cells with minimal adverse side effects and has many
characteristics that make it ideally suited for use in the eye, resulting in its wide use in
retinal gene therapy studies and clinical trials.

!36

1.4.1.1 Adeno-associated viruses and adeno-associated viral vectors
The adeno-associated viruses (AAVs) are small, non-enveloped, single-stranded
DNA viruses of the parvovirus family.(135, 136) They exist endogenously in primates,
including humans, but are not associated with any pathological states and result solely
in latent infections.(135, 137) Their genome consists of two inverted terminal repeat
(ITR) regions that flank replication (Rep) and capsid (Cap) protein encoding regions that
are contained in two open reading frames.(138) These components are removed to
make room for the packaging cassette when creating AAV vectors.
AAVs gained their name from the discovery that they require a helper virus to
replicate, which is typically an adenovirus but may also be a herpes virus.(136) Wildtype AAVs integrate into the host genome in a specific location. In humans, they
integrate into chromosome 19, and 60-70% of the time, specifically at the location
19q13.3-qter.(139) However, AAV vectors do not integrate but instead exist in episomal
form, decreasing the risk of insertional mutagenesis.(140)
Vectors created from these viruses, denoted adeno-associated viral vectors,
show the greatest promise as vectors for retinal gene therapy, owing largely to the
inherent properties of this type of virus. Their endogenous and non-pathological nature
in primates infers a level of safety not offered by other virus type vectors, although
recent studies raise concerns that they can activate proto-oncogenes in both murine
and human hepatocellular carcinoma, a serious concern that warrants further
investigation.(135, 141, 142) AAV vectors have also been associated with more minimal
immune reactions than other vector types.(139) Lastly, AAV vectors induce long-term
expression at a stable level.(143)

!37

AAV vectors are particularly well suited for the retina. They have been shown to
transduce a variety of retinal cell types, are capable of transducing nondividing cells,
including photoreceptor cells, and are up to two-thousand times more efficient at
transducing said cells than adenovirus vectors.(139, 143-145). This characteristic is
essential for the treatment of most retinal dystrophies, which are predominantly
diseases of the photoreceptors.
The characteristics of AAV vectors make them a promising and exciting option for
treatment delivery. However, it is important to recognize a significant drawback of this
vector type. As they are derived from smaller viruses, AAV vectors have a small packing
capacity of only 4.7 kilobases.(146, 147) This may present a significant limiting factor
that may preclude AAV vector use for the delivery of larger products, such as gene
therapy treatments involving larger genes that would exceed this capacity.
An example of a gene of this type is the CEP290 gene. With a size of
approximately 8 kilobases the CEP290 transcript would not fit inside the compact AAV
vector.(16) However, there are ways in which this limitation may be overcome, notably,
over-packing of the AAV vector, the use of co-transduction, or the use of a partial
transcript.
It has been suggested that the capacity of AAV vectors can be stretched by
manipulating the vector.(104) One study showed the successful packaging of up to
8.9kb of transcript into an AAV2/5 hybrid vector, using genes including CEP290.(106)
They illustrated that the AAV5 capsid is capable of holding more transcript than six other
serotypes, and were able to demonstrate successful transgene expression of the large

!38

human ABCA4 gene using this over-packing construct. A method such as this may
therefore hold promise for gene therapy treatments involving large genes.(106)
An alternative method to increasing the capacity of the vector is to utilize more
than one vector to deliver the therapeutic gene. This method of co-transduction, or
“dual-vector" allows the transcript to be split into two parts, with each part inserted into
different AAV vectors. The gene is then pieced back together in the host in vivo. This
can be accomplished by either using different vectors with non-overlapping sequences
through concatamerization and trans-splicing, or using different vectors with overlapping
sequences using homologous recombination.(103)
Some studies have shown promise. One such study utilizing in vitro and murine
models to investigate this method's use as a treatment for hemophilia A showed strong
transduction and improved phenotypes in both models.(148) However, another study
showed that the large ABCA4 gene can be packed into two AAV vectors and result in in
vitro transcript levels, however, no protein could be detected.(149) While this method
therefore shows promise, it is clear that further studies are necessary to fine-tune this
methodology.
For some genes the entire gene is not necessary for proper function within a
given tissue. In these cases, it may be possible to compensate for the small AAV
packing capacity by only inserting the necessary segment of the gene of interest into
the vector. Using the CEP290 gene for example, one study reported that replacing only
the N-terminus rescued vision in a zebrafish model of retinal dystrophy.(108)
Another significant drawback of the AAV vector is the presence of a lag-phase
that precedes transgene expression. This lag-phase is related to the single-stranded

!39

nature of AAVs, as a single-stranded genome requires a conversion to a doublestranded genome in the host nucleus before expression can occur (150-152). This
drawback could preclude the use of the AAV vector for the treatment of early-onset or
rapidly-progressing forms of retinal dystrophy. To compensate for this drawback, selfcomplementary vectors can be created in which the DNA synthesis step is averted
using a construct that is capable of folding over on itself to create a double-strand.(153)
AAVs posses many different serotypes, each of which carries different properties
including capsid surface proteins, the receptors utilized to enter cells, and therefore, the
cellular tropism. Over 100 adeno-associated virus serotypes have been identified,
several of which have been studied in a variety of species to determine cellular tropism
in different tissues.(154-160)
The main steps involved in the process that leads to transgene expression
includes the binding of the vector to the host cell’s surface, the subsequent entry of the
vector into the host cell, and the intracellular trafficking and processing of the virus.
Adeno-associated virus vector binding to the cell-surface receptors of the host
cell are dependent on the surface proteins on the virus’s capsid. The receptors to which
AAV vectors bind is therefore variable and depends upon the serotype used to create
the capsid. AAV2 serotype vectors have been shown to bind primarily to heparin sulfate
proteoglycans, however there is also evidence for binding to alphaV beta 5 integrin, or
fibroblast or hepatocyte growth factor receptors.(161-164) AAV3 is similar to AAV2 and
has been shown to also bind to heparin sulfate proteoglycans.(144, 165) Similarly, AAV6
also binds heparin sulfate, while is has been shown that AAV1 lacks the necessary
amino acid sequence to do so and AAV12 enters cells in a sialic acid and heparan

!40

sulfate proteoglycan independent manner.(144, 166, 167) AAV4 and AAV5 both bind to
sialic acid, with AAV4 binding the alpha2-3 O-linked form and AAV5 binding the alpha
2-3 N-linked form.(168, 169)
Once bound to the host cell-surface receptor, the vector is taken up into the cell.
How this occurs is still largely unknown for most serotypes, however, it has been
moderately well characterized for AAV2. AAV2 particles are taken up into the cell
through clathrin-coated pits through the process of endocytosis.(170) This is initiated by
the binding of the capsid to the host cell receptors, which stimulates Rac1 activation, a
GTP-binding protein necessary for AAV2 endocytosis.(171) The energy necessary for
this to occur is provided by the GTP-ase dynamin, which is located in the cytosol of the
cell and is commonly associated with clathrin-mediated endocytosis.(172) It has also
been demonstrated that alpha V beta integrin is important in this process.(163)
Evidence suggests that AAV5 also enters cells through clathrin-mediated endocytosis.
(173)
Once endocytosed into the cell, intracellular trafficking and processing moves the
particles to the nucleus and prepares their genomes for integration into the host
genome. Processing begins while the virus particles are still within the endosome.(174)
It appears that acidification of the endosome and protease inhibitors are integrally
involved in this process.(175, 176) Studies suggest that the proteasome inhibitors are
involved in the ubiquitination of virus particles while in the endosome, and further
hypotheses have been made suggesting that this functions to prime the capsid for
disassembly and hence virus uncoating.(177, 178)

!41

Trafficking of the virus particles to the nucleus involves a pathway that utilizes
Rab proteins, a class of GTP-ases that regulate endosome functions such as budding,
movement, and fusion to a cell membrane.(179) The early endosome contains Rab5,
and for AAV2, has been shown to traffic either to late endosomes containing Rab7, or to
perinuclear recycling endosomes containing Rab11.(180, 181) New Rab proteins, Rab7
and Rab9, then direct the late endosome to either a lysosome or the trans golgi,
respectively.(181, 182)
Following the trafficking of the virus particles through the endosomal pathways, it
is necessary for the virions to escape the endosome. This process is not well
understood but seems to involve the acidification of the endosome as well as
phospholipase A2 activity.(183) Once the virions have exited the endosome and entered
the cytoplasm, they must enter the nucleus to gain access to the host’s genome.
There is strong evidence that the nuclear transport of AAV2 occurs via tubular
networks facilitated by ATP-powered molecular motors.(184) Once at the nucleus, it has
been suggested that AAV2 enters passively through diffusion, since their small size
would permit passage through nuclear pores.(185) It is thought that this occurs while
the particles are still coated.(170)
Once the particles have entered the nucleus, uncoating occurs. This is followed
by the conversion of the single-stranded genome into a double stranded genome, a
necessary rate-limiting step.(151) It is then that the genetic material of the virus can be
integrated into the host genome, in the case of wild-type virus, or maintained in an
episomal state, in the case of vectors.(140) (Figure 1.8)

!42

The main components of an AAV vector are the genetic backbone of the adenoassociated virus, the capsid of that virus or that of another serotype, the gene of
interest, and a promoter and poly-adenylation signal of the experimenter’s choice. They
are therefore created by removing the virus’s genome, leaving only the inverted terminal
repeat (ITR) regions, combining this “backbone” with the transgene of interest and a
promoter of interest, and by adding the genetics for the capsid of choice.(186) (Figure
1.8)

!43

Figure 1.8 Adeno-associated viral vector transduction and creation. A. Schematic
representation of the process by which AAV vectors enter the cell. 1- The rAAV capsid
binds to the cell surface receptors. 2- The viral particle enters the cell through
endocytosis. 3- The endosome is trafficked through the cytoplasm. 4- The particle is
released by the endosome and processed by the golgi apparatus. 5- The particle enters
the nucleus. 6- The capsid breaks down and ssDNA sequence is released. 7- ssDNA is
converted to dsDNA. 8- dsDNA is converted to mRNA. 9- Protein is translated. B.
Schematic representation of wild-type AAV and AAV vector creation. a- The wild-type
virus contains rep (replication) and cap (capsid) genes. Co-infection with a helper virus
results in viral replication and integration into the host genome. b- The rep and cap
sequences are removed and replaced by a poly-A tail (pA) and a promoter and
transgene sequence of the investigator’s design. Vector production utilizing adenovirus
or herpes virus helper components (Ad E1, E2, E4orf6) results in the production of rAAV
vector particles only that remain as episomes in the host cell.
!44

A common method used to accomplish this is a protocol that utilizes plasmids.
(187) Two different plasmid lines are created, one containing the AAV backbone that
includes only the long terminal repeat regions with the transgene, and the other
containing the coding sequences from the virus.(188, 189) These plasmids are then
transfected into an adenovirus or herpesvirus infected cell line, which in turn provides
the helper functions necessary for AAV production.(190, 191) Alternatively, a single
plasmid that contains the adenovirus genes can be used, thereby eliminating the need
for actual adenovirus.(192, 193)
Other methods have been developed to allow higher yield production. Mainly, it
has been demonstrated that higher titers of vector can be produced by introducing
adenovirus that contains the vector genome into cell lines that express the Rep and Cap
proteins required for vector production.(194-196) A more recent method illustrated the
feasibility of using an insect cell line. It appears that AAVs do not require helper virus in
insect cells, simplifying the protocol.(197)
To create the commonly used hybrid vectors, a cross-packaging method is
utilized. With the discovery that expression of AAV2 Rep proteins, when combined with
expression of another serotype’s Cap proteins, leads to the packaging of the AAV2
genome inside the other’s capsid, a method was derived in which the Cap expression
cassettes of the desired capsid is simply placed downstream of an otherwise unaltered
AAV Rep expression cassette.(144, 198)
The last step of vector production is purification to assure removal of all
adenovirus helper virus and safety. This is most often accomplished using a cesium

!45

chloride density gradient centrifugation method, though a multitude of other methods
have been developed. These include non-specific methods utilizing ion-exchange
chromatography, and serotype specific methods including the purification of AAV5 using
mucin columns that take advantage of the serotype’s ability to bind sialic acid in mucin.
(199-201)
There are several factors that have significant effects on the cellular tropism and
the transgene expression of vector constructs, and these factors can have a significant
impact on treatment success and which cell types particular serotypes are ideal for
targeting. Factors may be related to characteristics of the virus(s) from which the vector
is created, or from elements added to the genome. In particular, the virus capsid and its
associated proteins and the promoter added to the genome, can alter the tropism and
expression of vectors. Moreover, the route of vector administration can have significant
effects on the which cells are transduced due to the differential cell exposure between
different routes.
The varying properties of different capsids can be utilized to increase the efficacy
of vector constructs. The cellular tropism is largely determined by the proteins located
on the capsid. As discussed in more detail in a previous section, the capsid proteins
determine the receptors to which the serotype binds, thereby determining the cellular
tropism of the serotype. Furthermore, the capsid proteins affect how efficiently the virus
can bind and lead to uptake into the host cell, and thus also plays a role in the speed of
transgene expression.
Another way in which AAV vectors can be altered to affect cellular tropism is
through the use of different promoters. The use of ubiquitous promoters, such as the

!46

cytomegalovirus (CMV) promoter, drives transgene expression in the photoreceptor
cells, retinal pigment epithelium, and some inner retinal cells in dog models of retinal
dystrophy.(113) Similarly, the use of the constituitive chicken beta-actin (CBA) enhancer,
typically used with the CMV promotor, has been shown to drive expression in both rod
and cone photoreceptor cells as well as inner retinal cells including Müller, ganglion,
and horizontal cells.(202) With the use of more specific promoters, transgene
expression can be targeted to particular cells of interest. The use of the mouse opsin
(mOP) promoter or the human G-protein coupled receptor protein kinase 1 (hGRK1)
promoter in a dog model for retinal dystrophy, for example, directed expression
specifically to rod photoreceptor cells.(202) Similar findings were found in the pig retina
utilizing this promotor.(203) It is important to note the significance of species differences
in cellular tropism, however. Different studies have found that the same mOP promoter
drives both rod and cone transduction in a mouse model and that the GRK promotor
can drive cone transduction in mice.(204, 205)
There are two main administration routes that have been investigated for
potential use in gene therapy treatments; subretinal and intravitreous. Both routes
require surgery, however, subretinal injections require a more precise surgery that
involves carefully injecting the gene therapy vector beneath the layers of the retina. This
causes a “bleb,” or retinal detachment in the region of injection, but allows more efficient
transduction of the photoreceptor cell layer, which lies at the back of the retina adjacent
to the retinal pigment epithelium.(139) This is crucial for the treatment of many retinal
dystrophies as the photoreceptors are a commonly affected cell type. The intravitreal
approach has the benefit of a more widespread administration of the vector, allowing the

!47

entire retinal surface to be exposed to the treatment, rather than a smaller region as in
the subretinal approach. However, it has been demonstrated that intravitreal injections
favor transduction of the inner retina, and does not effectively lead to outer retina
transduction.(139, 206-208) Combination of this approach with vector modifications
however, such as the tyrosine mutations discussed below, has resulted in more
promising transduction of the outer retina via an intravitreal approach.
Adeno-associated viruses can be combined or altered to create superior vectors
with increased efficacy, or more specific cell targeting. The three most common
engineered vector types in use for retinal gene therapy are hybrid vectors, mutant
capsid vectors, and self-complementary vectors.(209)
The proteins on the capsid surface of the virus infer the cellular tropism and have
a significant effect on the speed and strength of transgene expression. The efficacy of a
vector can therefore be enhanced by creating pseudotypes of vectors in which the
genome of one AAV serotype is packaged within the capsid of another serotype.(144,
157) These “hybrid” vectors are widely used in retinal gene therapy research.
Traditionally, the genome from the AAV2 serotype is used and packaged into the
capsids of other vectors to make AAV2/x vectors. The capsid from another serotype can
then be used to infer greater efficacy through increased speed and strength of
transgene expression, as well as a specific desired cellular tropism.
Another method that can be used to improve the efficiency of AAV vectors
involves creating mutations in the capsid proteins to bypass the ubiquitination ratelimiting step described earlier.(175) It has been shown that phosphorylation of tyrosine
residues within capsid proteins mark the proteins for ubiquitination, and thereby make

!48

the virus particle more likely to be degraded in the cytosol before reaching the nucleus.
(210, 211) Taking advantage of this, vectors can now be created with mutations in the
tyrosine residues, protecting them from phosphorylation and hence preventing
ubiquitination of the virus particle.(212) These “mutant capsid vectors” provide a
promising alternative to other vector types that may infer significantly increased
efficiency.
As discussed briefly previously, a significant drawback of the AAV vector is the
lag-phase created by the conversion of the single-stranded genome into a double
stranded genome. This drawback can be overcome through the creation of selfcomplementary vectors. This type of vector is most commonly designed such that the
genome contains a single-stranded inverted-repeat genome, which contains a mutated
terminal resolution site in-between the repeats. This design allows the DNA to fold over
onto itself, thereby creating a double-stranded transgene without a DNA synthesis step.
(153) Using these self-complementary constructs, studies have shown that they infer
faster and stronger transgene expression. In mouse models, it has been illustrated that
self-complementary AAV2/8 (scAAV2/8) was shown to lead to faster and stronger
transgene expression than its single-stranded counterpart, and that scAAV2/5 led to a
stronger transgene expression with similar speed of onset.(213, 214) In a dog model, it
was shown that scAAV2/5 leads to a faster time of onset and a stronger expression than
ssAAV2/5.(215)

!49

1.4.1.1.a The need for AAV testing in the feline retina
The work that has been done thus far testing adeno-associated virus vectors in
the retina has been extensive in rodents, dogs and primates. In these species, a
multitude of serotypes have been tested and in some cases, proof-of principle has been
established for the ability of AAV vector based gene therapy to restore vision.
The most notable example of this is in the naturally-occurring dog model of Leber
Congenital Amaurosis caused by a mutation in the retinal pigment epithelium (RPE)
gene. In this model, it has been shown that significant vision can be restored to visually
impaired dogs using an AAV2/2 vector based gene therapy treatment.(68, 69, 216-220)
This demonstrates that strong enough transgene expression to restore working vision
can be obtained. These results have been supported in a transgenic RPE knockout
mouse model in which AAV gene therapy was able to partially restore vision and
morphology when administered in fetal life, and to a lesser extent, when administered in
adulthood.(221, 222) It was later shown that the visual restoration was still evident in the
RPE dogs up to several years years post-injection, suggesting a long-term effect of the
AAV delivered treatment.(70, 223, 224)
Establishment of proof-of-principle in animal models has provided a foundation
from which human clinical trials can be conducted. The reports from these trials are
promising, as they demonstrate the safety and efficacy of these treatments.(225-231)
Despite the plethora of data concerning AAV based delivery in other animal
models however, very limited data has been collected concerning use of these vectors
in the feline retina with only one study investigating AAV vectors in the feline retina.(113)
With the discoveries and classification of forms of Progressive Retinal Atrophy in the cat

!50

that make important large animal models for human retinal dystrophies the cat has
become a new and important tool for studying treatments against these debilitating
diseases. However, before studies can investigate therapies in the feline retina, vectors
must be identified for the delivery of transgenes or the components required for
treatments such as gene therapy or genome editing based therapies.
It is therefore necessary to test vector constructs in the feline retina to study the
efficacy of transduction and transgene expression. Similarly, it is important that the
cellular tropism of these vectors be elucidated in the feline retina, and that any species
differences that may be relevant when studying the cat and extrapolating from feline to
the human be determined. To gather this information, it is imperative that adenoassociated virus vector constructs be tested in the wild-type feline retina prior to the use
of such vectors for introducing therapeutic genes, which is the focus of Chapter 5 of this
dissertation.

!51

1.5 Dissertation aims and hypotheses

The scientific community has made great progress in the understanding of
inherited retinal dystrophies in recent years and has made strides towards geneticsbased treatments for these debilitating diseases. Animal models have been integral for
this progress, with large animal models such as dogs and cats emerging as particularly
useful and important tools. The cat provides a unique opportunity to study retinal
dystrophies caused by a mutation in the CEP290 gene, a important gene implicated in
about twenty percent of LCA cases.(15) Though the phenotype has been well described
for this model, questions remained before the model can be utilized for in vivo treatment
trials.
A few important questions remained to be answered about the CEP290 cat
model. Though previous studies had suggested a degeneration that affected the
peripheral retina greater than the central retina, a characteristic common in people with
LCACEP290, it had yet to be determined if the actual rate of degeneration was faster in
the periphery than in the central retina. Definitively clarifying this point holds important
implications as we move towards treatments. Treatment timing and targeting could be
affected by this difference, as it would suggest that the central retina may be sensitive to
treatments longer due to the longer availability of viable photoreceptor cells. We
therefore aimed to utilize an in vivo monitoring tool, spectral-domain optical coherence
tomography (SD-OCT) to investigate retinal degeneration in this model over time and
compare regional rates of degeneration. We hypothesized that CEP290 mutant cats

!52

would show a slower rate of degeneration in the central retina than in the peripheral
retina.
Furthermore, previous studies have shown that the mutant cat has a milder
phenotype than that typically seen in LCA in people, the most common disease caused
by mutations in this gene. Why the phenotype is milder was not well understood. We
hypothesized that the mutant cat is a hypomorph, with residual wild-type protein due to
some level of useage of the wild-type splice donor site. We therefore aimed to analyze
the wild-type and mutant transcript and protein levels to determine what levels of
transcript and protein were present in the mutant cat, relative to wild-type and
heterozygous carrier cats, that might explain the milder phenotype. If this is correct this
has important implications for treatment development. If the shorter mutant protein is
translated and is the reason for the milder phenotype, this suggests that a full transcript
is not necessary for rescue of some vision and warrants future investigation to
determine how much of the transcript is required to improve vision. This is particularly
exciting for LCACEP290 cases as utilizing a partial transcript is a possible means of
overcoming the obstacle that the gene’s large size presents. AAV vectors cannot fit the
entire CEP290 transcript but could fit part of the transcript.
Furthermore, as we move towards treatment trials in the feline model it is
imperative that we develop tools for treatment testing and identify objective markers for
following treatment efficacy. Establishing transcript and protein levels has the added
benefit of providing measurable values for this purpose. However, these values can only
be obtained following sacrifice of valuable research animals, thus limiting their utility. We
therefore also sought measures that could be used in vivo as well as aimed to develop

!53

an in vitro tool that could be used to optimize treatments prior to use of animals. Utilizing
SD-OCT we therefore also aimed to analyze the ellipsoid zone (EZ), an identifiable
layer on OCT that has been shown in people to be a valuable marker of photoreceptor
health. The EZ is thought to arise from the reflection of mitochondria in the inner
segments of photoreceptors and can be visualized as a distinctive line on OCT imaging.
(232) It has been shown in previous studies to disappear or lose distinction in regions of
photoreceptor loss and be associated with visual loss.(233-235) We therefore aimed to
study this zone in the feline retina via OCT and hypothesized that loss of this zone or
loss of EZ integrity would correlate to photoreceptor degeneration, as indicated by
photoreceptor layer thickness on OCT.
Development of an in vitro tool that would allow for testing and optimization of
treatments in a faster and more affordable system would provide a valuable advantage
that would allow us to save time and money and would allow us to produce faster
results to reach towards treatments as well as reduce animal numbers needed for in
vivo trials. We therefore aimed to develop primary fibroblast cell cultures from wild-type,
heterozygous carrier, and homozygous mutant cats that could be utilized for this
purpose. We then aimed to induce ciliation in these cells, a potentially useful alteration
given the ciliary location and function of the CEP290 protein. To identify an objective
functional marker for treatment trials in these cells, we lastly aimed to compare the
length of these induced cilia across genotypes. We hypothesized that mutant cat cells
would grow shorter cilia than wild-type or carrier cat cells.
Given the significant obstacles to a gene therapy based treatment for CEP290
diseases, we decided to take a different approach and investigate a genome editing

!54

based treatment. To do this we utilized the CRISPR/Cas-9 nuclease system, a newer
genome editing modality that has created great excitement in the scientific community
for its more affordable, scalable, and promising utility. Utilizing this system we aimed to
delete the feline mutation-introduced splice donor site that deleteriously redirects
splicing and then replace that segment with a strong splice donor site in the desired,
wild-type location. We utilized the above-mentioned cell cultures to test this construct
and hypothesized that we could successfully cause a deletion followed by an insertion
that would redirect splicing to the wild-type location. In future studies it is our hope that
this editing technique could then be translated to the cat model for testing, either as a
method for editing induced pluripotent stem cells or by directly delivering the machinery
to the feline retina.
To deliver such a treatment a delivery vector is imperative. We therefore lastly
aimed to test adeno-associated viral (AAV) vectors, the vector system of choice for
photoreceptor cell transduction, in the wild-type feline retina to study the safety and
efficacy of this vector system in the feline retina. Testing four commonly used hybrid
vectors, AAVs 2/2, 2/5, 2/8, 2/9, we aimed to determine the cellular tropism, speed of
transduction, and safety of these vectors and to determine which vector was most ideal
for feline retinal treatments. We hypothesized that all four vectors would lead to
successful transduction of feline photoreceptor cells with minimal side effects, and that
AAV 2/8 and 2/9 would lead to faster and stronger transduction than 2/2 and 2/5.
The results of these studies are detailed in the proceeding chapters of this
dissertation. It is our hope that this body of work can build on previous studies to help
better understand this useful model and prepare for use of this model for in vivo

!55

treatment trials. Ultimately, we hope these studies will become a part of the body of
work that leads to a treatment for LCACEP290.

!56

REFERENCES

!57

REFERENCES

1.
Allikmets R. Leber congenital amaurosis: a genetic paradigm. Ophthalmic Genet.
2004;25(2):67-79.
2.
Stone EM. Leber congenital amaurosis - a model for efficient genetic testing of
heterogeneous disorders: LXIV Edward Jackson Memorial Lecture. Am J Ophthalmol.
2007;144(6):791-811.
3.
Parmeggiani F. Clinics, epidemiology and genetics of retinitis pigmentosa. Curr
Genomics. 2011;12(4):236-7.
4.
Kolb H. Simple Anatomy of the Retina. In: Kolb H, Fernandez E, Nelson R,
editors. Webvision: The Organization of the Retina and Visual System. Salt Lake City
(UT)1995.
5.
Kolb H. Gross Anatomy of the Eye. In: Kolb H, Fernandez E, Nelson R, editors.
Webvision: The Organization of the Retina and Visual System. Salt Lake City (UT)1995.
6.
Kolb H. Photoreceptors. In: Kolb H, Fernandez E, Nelson R, editors. Webvision:
The Organization of the Retina and Visual System. Salt Lake City (UT)1995.
7.
Fliegauf M, Benzing T, Omran H. When cilia go bad: cilia defects and ciliopathies.
Nat Rev Mol Cell Biol. 2007;8(11):880-93.
8.
Fu Y. Phototransduction in Rods and Cones. In: Kolb H, Fernandez E, Nelson R,
editors. Webvision: The Organization of the Retina and Visual System. Salt Lake City
(UT)1995.
9.
Sohocki MM, Daiger SP, Bowne SJ, Rodriquez JA, Northrup H, Heckenlively JR,
et al. Prevalence of mutations causing retinitis pigmentosa and other inherited
retinopathies. Hum Mutat. 2001;17(1):42-51.
10.
Boughman JA, Conneally PM, Nance WE. Population genetic studies of retinitis
pigmentosa. Am J Hum Genet. 1980;32(2):223-35.
11.

Hamel C. Retinitis pigmentosa. Orphanet J Rare Dis. 2006;1:40.

12.
Franceschetti A, Dieterle P. [Diagnostic and prognostic importance of the
electroretinogram in tapetoretinal degeneration with reduction of the visual field and
hemeralopia]. Confin Neurol. 1954;14(2-3):184-6.

!58

13.
Koenekoop RK. An overview of Leber congenital amaurosis: a model to
understand human retinal development. Surv Ophthalmol. 2004;49(4):379-98.
14.
den Hollander AI, Roepman R, Koenekoop RK, Cremers FP. Leber congenital
amaurosis: genes, proteins and disease mechanisms. Prog Retin Eye Res. 2008;27(4):
391-419.
15.
den Hollander AI, Koenekoop RK, Yzer S, Lopez I, Arends ML, Voesenek KE, et
al. Mutations in the CEP290 (NPHP6) gene are a frequent cause of Leber congenital
amaurosis. Am J Hum Genet. 2006;79(3):556-61.
16.
Moradi P, Davies WL, Mackay DS, Cheetham ME, Moore AT. Focus on
Molecules: Centrosomal protein 290 (CEP290). Exp Eye Res. 2011;92(5):316-7.
17.
Coppieters F, Lefever S, Leroy BP, De Baere E. CEP290, a gene with many
faces: mutation overview and presentation of CEP290base. Hum Mutat. 2010;31(10):
1097-108.
18.
Sayer JA, Otto EA, O'Toole JF, Nurnberg G, Kennedy MA, Becker C, et al. The
centrosomal protein nephrocystin-6 is mutated in Joubert syndrome and activates
transcription factor ATF4. Nat Genet. 2006;38(6):674-81.
19.
Chang B, Khanna H, Hawes N, Jimeno D, He S, Lillo C, et al. In-frame deletion in
a novel centrosomal/ciliary protein CEP290/NPHP6 perturbs its interaction with RPGR
and results in early-onset retinal degeneration in the rd16 mouse. Hum Mol Genet.
2006;15(11):1847-57.
20.
Nagase T, Ishikawa K, Nakajima D, Ohira M, Seki N, Miyajima N, et al. Prediction
of the coding sequences of unidentified human genes. VII. The complete sequences of
100 new cDNA clones from brain which can code for large proteins in vitro. DNA Res.
1997;4(2):141-50.
21.
Cideciyan AV, Aleman TS, Jacobson SG, Khanna H, Sumaroka A, Aguirre GK, et
al. Centrosomal-ciliary gene CEP290/NPHP6 mutations result in blindness with
unexpected sparing of photoreceptors and visual brain: implications for therapy of Leber
congenital amaurosis. Hum Mutat. 2007;28(11):1074-83.
22.
McEwen DP, Koenekoop RK, Khanna H, Jenkins PM, Lopez I, Swaroop A, et al.
Hypomorphic CEP290/NPHP6 mutations result in anosmia caused by the selective loss
of G proteins in cilia of olfactory sensory neurons. Proc Natl Acad Sci U S A.
2007;104(40):15917-22.
23.
Kim J, Krishnaswami SR, Gleeson JG. CEP290 interacts with the centriolar
satellite component PCM-1 and is required for Rab8 localization to the primary cilium.
Hum Mol Genet. 2008;17(23):3796-805.

!59

24.
Pazour GJ, Rosenbaum JL. Intraflagellar transport and cilia-dependent diseases.
Trends Cell Biol. 2002;12(12):551-5.
25.
Badano JL, Mitsuma N, Beales PL, Katsanis N. The ciliopathies: an emerging
class of human genetic disorders. Annu Rev Genomics Hum Genet. 2006;7:125-48.
26.
Baala L, Audollent S, Martinovic J, Ozilou C, Babron MC, Sivanandamoorthy S,
et al. Pleiotropic effects of CEP290 (NPHP6) mutations extend to Meckel syndrome. Am
J Hum Genet. 2007;81(1):170-9.
27.
Frank V, den Hollander AI, Bruchle NO, Zonneveld MN, Nurnberg G, Becker C, et
al. Mutations of the CEP290 gene encoding a centrosomal protein cause MeckelGruber syndrome. Hum Mutat. 2008;29(1):45-52.
28.
Jha T, Bardhan J, Das B, Patra KK, Dhali B, Seth S. Meckel-Gruber syndrome: a
rare clinical entity. J Indian Med Assoc. 2010;108(9):611-2.
29.

Waters AM, Beales PL. Bardet-Biedl Syndrome. 1993.

30.
Salomon R, Saunier S, Niaudet P. Nephronophthisis. Pediatr Nephrol.
2009;24(12):2333-44.
31.
Tory K, Lacoste T, Burglen L, Moriniere V, Boddaert N, Macher MA, et al. High
NPHP1 and NPHP6 mutation rate in patients with Joubert syndrome and
nephronophthisis: potential epistatic effect of NPHP6 and AHI1 mutations in patients
with NPHP1 mutations. J Am Soc Nephrol. 2007;18(5):1566-75.
32.
Helou J, Otto EA, Attanasio M, Allen SJ, Parisi MA, Glass I, et al. Mutation
analysis of NPHP6/CEP290 in patients with Joubert syndrome and Senior-Loken
syndrome. J Med Genet. 2007;44(10):657-63.
33.
O'Toole JF, Otto EA, Hoefele J, Helou J, Hildebrandt F. Mutational analysis in 119
families with nephronophthisis. Pediatr Nephrol. 2007;22(3):366-70.
34.
Valente EM, Silhavy JL, Brancati F, Barrano G, Krishnaswami SR, Castori M, et
al. Mutations in CEP290, which encodes a centrosomal protein, cause pleiotropic forms
of Joubert syndrome. Nat Genet. 2006;38(6):623-5.
35.
Doherty D. Joubert syndrome: insights into brain development, cilium biology,
and complex disease. Semin Pediatr Neurol. 2009;16(3):143-54.
36.
Brancati F, Barrano G, Silhavy JL, Marsh SE, Travaglini L, Bielas SL, et al.
CEP290 mutations are frequently identified in the oculo-renal form of Joubert syndromerelated disorders. Am J Hum Genet. 2007;81(1):104-13.

!60

37.
Valente EM, Brancati F, Dallapiccola B. Genotypes and phenotypes of Joubert
syndrome and related disorders. Eur J Med Genet. 2008;51(1):1-23.
38.
Perrault I, Delphin N, Hanein S, Gerber S, Dufier JL, Roche O, et al. Spectrum of
NPHP6/CEP290 mutations in Leber congenital amaurosis and delineation of the
associated phenotype. Hum Mutat. 2007;28(4):416.
39.
Littink KW, Pott JW, Collin RW, Kroes HY, Verheij JB, Blokland EA, et al. A novel
nonsense mutation in CEP290 induces exon skipping and leads to a relatively mild
retinal phenotype. Invest Ophthalmol Vis Sci. 2010;51(7):3646-52.
40.
Pasadhika S, Fishman GA, Stone EM, Lindeman M, Zelkha R, Lopez I, et al.
Differential macular morphology in patients with RPE65-, CEP290-, GUCY2D-, and
AIPL1-related Leber congenital amaurosis. Invest Ophthalmol Vis Sci. 2010;51(5):
2608-14.
41.
Hanein S, Perrault I, Gerber S, Tanguy G, Barbet F, Ducroq D, et al. Leber
congenital amaurosis: comprehensive survey of the genetic heterogeneity, refinement of
the clinical definition, and genotype-phenotype correlations as a strategy for molecular
diagnosis. Hum Mutat. 2004;23(4):306-17.
42.
Chader GJ. Animal models in research on retinal degenerations: past progress
and future hope. Vision Res. 2002;42(4):393-9.
43.
Keeler CE. The Inheritance of a Retinal Abnormality in White Mice. Proc Natl
Acad Sci U S A. 1924;10(7):329-33.
44.
Bourne MC, Campbell DA, Tansley K. Hereditary Degeneration of the Rat Retina.
Br J Ophthalmol. 1938;22(10):613-23.
45.
Dowling JE, Sidman RL. Inherited retinal dystrophy in the rat. J Cell Biol.
1962;14:73-109.
46.
Pittler SJ, Keeler CE, Sidman RL, Baehr W. PCR analysis of DNA from 70-yearold sections of rodless retina demonstrates identity with the mouse rd defect. Proc Natl
Acad Sci U S A. 1993;90(20):9616-9.
47.
van Nie R, Ivanyi D, Demant P. A new H-2-linked mutation, rds, causing retinal
degeneration in the mouse. Tissue Antigens. 1978;12(2):106-8.
48.
Naash MI, Hollyfield JG, al-Ubaidi MR, Baehr W. Simulation of human autosomal
dominant retinitis pigmentosa in transgenic mice expressing a mutated murine opsin
gene. Proc Natl Acad Sci U S A. 1993;90(12):5499-503.

!61

49.
Hong DH, Pawlyk BS, Shang J, Sandberg MA, Berson EL, Li T. A retinitis
pigmentosa GTPase regulator (RPGR)-deficient mouse model for X-linked retinitis
pigmentosa (RP3). Proc Natl Acad Sci U S A. 2000;97(7):3649-54.
50.
Hageman GS, Gehrs K, Johnson LV, Anderson D. Age-Related Macular
Degeneration (AMD). In: Kolb H, Fernandez E, Nelson R, editors. Webvision: The
Organization of the Retina and Visual System. Salt Lake City (UT)1995.
51.
Rah H, Maggs DJ, Blankenship TN, Narfstrom K, Lyons LA. Early-onset,
autosomal recessive, progressive retinal atrophy in Persian cats. Invest Ophthalmol Vis
Sci. 2005;46(5):1742-7.
52.
Menotti-Raymond M, David VA, Schaffer AA, Stephens R, Wells D, Kumar-Singh
R, et al. Mutation in CEP290 discovered for cat model of human retinal degeneration. J
Hered. 2007;98(3):211-20.
53.
Menotti-Raymond M, Deckman KH, David V, Myrkalo J, O'Brien SJ, Narfstrom K.
Mutation discovered in a feline model of human congenital retinal blinding disease.
Invest Ophthalmol Vis Sci. 2010;51(6):2852-9.
54.
Ofri R, Reilly CM, Maggs DJ, Fitzgerald PG, Shilo-Benjamini Y, Good KL, et al.
Characterization of an Early-Onset, Autosomal Recessive, Progressive Retinal
Degeneration in Bengal Cats. Invest Ophthalmol Vis Sci. 2015;56(9):5299-308.
55.
Beltran WA. The use of canine models of inherited retinal degeneration to test
novel therapeutic approaches. Vet Ophthalmol. 2009;12(3):192-204.
56.
Tuntivanich N, Petersen-Jones SM, Steibel JP, Johnson C, Forcier JQ. Postnatal
development of canine axial globe length measured by B-scan ultrasonography. Vet
Ophthalmol. 2007;10(1):2-5.
57.
Gilger BC, Reeves KA, Salmon JH. Ocular parameters related to drug delivery in
the canine and equine eye: aqueous and vitreous humor volume and scleral surface
area and thickness. Vet Ophthalmol. 2005;8(4):265-9.
58.
McGreevy P, Grassi TD, Harman AM. A strong correlation exists between the
distribution of retinal ganglion cells and nose length in the dog. Brain Behav Evol.
2004;63(1):13-22.
59.
Mowat FM, Petersen-Jones SM, Williamson H, Williams DL, Luthert PJ, Ali RR,
et al. Topographical characterization of cone photoreceptors and the area centralis of
the canine retina. Mol Vis. 2008;14:2518-27.
60.
Beltran WA, Cideciyan AV, Guziewicz KE, Iwabe S, Swider M, Scott EM, et al.
Canine retina has a primate fovea-like bouquet of cone photoreceptors which is affected
by inherited macular degenerations. PLoS One. 2014;9(3):e90390.
!62

61.
Petersen-Jones SM, Entz DD, Sargan DR. cGMP phosphodiesterase-alpha
mutation causes progressive retinal atrophy in the Cardigan Welsh corgi dog. Invest
Ophthalmol Vis Sci. 1999;40(8):1637-44.
62.
Dekomien G, Runte M, Godde R, Epplen JT. Generalized progressive retinal
atrophy of Sloughi dogs is due to an 8-bp insertion in exon 21 of the PDE6B gene.
Cytogenet Cell Genet. 2000;90(3-4):261-7.
63.
Sidjanin DJ, Lowe JK, McElwee JL, Milne BS, Phippen TM, Sargan DR, et al.
Canine CNGB3 mutations establish cone degeneration as orthologous to the human
achromatopsia locus ACHM3. Hum Mol Genet. 2002;11(16):1823-33.
64.
Winkler PA, Ekenstedt KJ, Occelli LM, Frattaroli AV, Bartoe JT, Venta PJ, et al. A
large animal model for CNGB1 autosomal recessive retinitis pigmentosa. PLoS One.
2013;8(8):e72229.
65.
Zeiss CJ, Acland GM, Aguirre GD. Retinal pathology of canine X-linked
progressive retinal atrophy, the locus homologue of RP3. Invest Ophthalmol Vis Sci.
1999;40(13):3292-304.
66.
Kijas JW, Cideciyan AV, Aleman TS, Pianta MJ, Pearce-Kelling SE, Miller BJ, et
al. Naturally occurring rhodopsin mutation in the dog causes retinal dysfunction and
degeneration mimicking human dominant retinitis pigmentosa. Proc Natl Acad Sci U S
A. 2002;99(9):6328-33.
67.
Beltran WA, Hammond P, Acland GM, Aguirre GD. A frameshift mutation in
RPGR exon ORF15 causes photoreceptor degeneration and inner retina remodeling in
a model of X-linked retinitis pigmentosa. Invest Ophthalmol Vis Sci. 2006;47(4):
1669-81.
68.
Acland GM, Aguirre GD, Ray J, Zhang Q, Aleman TS, Cideciyan AV, et al. Gene
therapy restores vision in a canine model of childhood blindness. Nat Genet.
2001;28(1):92-5.
69.
Narfstrom K, Katz ML, Bragadottir R, Seeliger M, Boulanger A, Redmond TM, et
al. Functional and structural recovery of the retina after gene therapy in the RPE65 null
mutation dog. Invest Ophthalmol Vis Sci. 2003;44(4):1663-72.
70.
Acland GM, Aguirre GD, Bennett J, Aleman TS, Cideciyan AV, Bennicelli J, et al.
Long-term restoration of rod and cone vision by single dose rAAV-mediated gene
transfer to the retina in a canine model of childhood blindness. Mol Ther. 2005;12(6):
1072-82.
71.
Narfstrom K. Hereditary progressive retinal atrophy in the Abyssinian cat. J
Hered. 1983;74(4):273-6.

!63

72.
Barnett KC, Curtis R. Autosomal dominant progressive retinal atrophy in
Abyssinian cats. J Hered. 1985;76(3):168-70.
73.
Menotti-Raymond M, David VA, Schaffer AA, Stephens R, Wells D, Kumar-Singh
R, et al. Mutation in CEP290 discovered for cat model of human retinal degeneration. J
Hered. 2007;98(3):211-20.
74.
Narfström K. Hereditary progressive retinal atrophy in the Abyssinian cat. J
Hered. 1983;74(4):273-6.
75.
Linberg KA, Lewis GP, Shaaw C, Rex TS, Fisher SK. Distribution of S- and Mcones in normal and experimentally detached cat retina. The Journal of comparative
neurology. 2001;430(3):343-56.
76.
Narfstrom K. Progressive retinal atrophy in the Abyssinian cat. Clinical
characteristics. Invest Ophthalmol Vis Sci. 1985;26(2):193-200.
77.
Narfstrom K, Nilsson SE. Hereditary retinal degeneration in the Abyssinian cat:
correlation of ophthalmoscopic and electroretinographic findings. Doc Ophthalmol.
1985;60(2):183-7.
78.
Narfström K, Wilen M, Andersson BE. Hereditary retinal degeneration in the
Abyssinian cat: developmental studies using clinical electroretinography. Doc
Ophthalmol. 1988;69(2):111-8.
79.
Jacobson SG, Kemp CM, Narfstrom K, Nilsson SE. Rhodopsin levels and rodmediated function in Abyssinian cats with hereditary retinal degeneration. Exp Eye Res.
1989;49(5):843-52.
80.
Ekesten B, Narfstrom K. Abnormal dark-adapted ERG in cats heterozygous for a
recessively inherited rod-cone degeneration. Vet Ophthalmol. 2004;7(1):63-7.
81.
Hyman JA, Vaegan, Lei B, Narfstrom KL. Electrophysiologic differentiation of
homozygous and heterozygous Abyssinian-crossbred cats with late-onset hereditary
retinal degeneration. Am J Vet Res. 2005;66(11):1914-21.
82.
Kang Derwent JJ, Padnick-Silver L, McRipley M, Giuliano E, Linsenmeier RA,
Narfstrom K. The electroretinogram components in Abyssinian cats with hereditary
retinal degeneration. Invest Ophthalmol Vis Sci. 2006;47(8):3673-82.
83.
Narfstrom KL, Nilsson SE, Andersson BE. Progressive retinal atrophy in the
Abyssinian cat: studies of the DC-recorded electroretinogram and the standing potential
of the eye. Br J Ophthalmol. 1985;69(8):618-23.

!64

84.
Seeliger MW, Narfstrom K. Functional assessment of the regional distribution of
disease in a cat model of hereditary retinal degeneration. Invest Ophthalmol Vis Sci.
2000;41(7):1998-2005.
85.
Wiggert B, van Veen T, Kutty G, Lee L, Nickerson J, Si JS, et al. An early
decrease in interphotoreceptor retinoid-binding protein gene expression in Abyssinian
cats homozygous for hereditary rod-cone degeneration. Cell Tissue Res. 1994;278(2):
291-8.
86.
Narfstrom K, Nilsson SE. Morphological findings during retinal development and
maturation in hereditary rod-cone degeneration in Abyssinian cats. Exp Eye Res.
1989;49(4):611-28.
87.
Narfstrom K, Nilsson SE. Progressive retinal atrophy in the Abyssinian cat.
Electron microscopy. Invest Ophthalmol Vis Sci. 1986;27(11):1569-76.
88.
Narfstrom K, Ehinger B, Bruun A. Immunohistochemical studies of cone
photoreceptors and cells of the inner retina in feline rod-cone degeneration. Vet
Ophthalmol. 2001;4(2):141-5.
89.
Narfstrom K, Holland Deckman K, Menotti-Raymond M. The domestic cat as a
large animal model for characterization of disease and therapeutic intervention in
hereditary retinal blindness. J Ophthalmol. 2011;2011:906943.
90.
Jomary C, Jones SE. Induction of functional photoreceptor phenotype by
exogenous Crx expression in mouse retinal stem cells. Invest Ophthalmol Vis Sci.
2008;49(1):429-37.
91.
Lamba DA, Gust J, Reh TA. Transplantation of human embryonic stem cellderived photoreceptors restores some visual function in Crx-deficient mice. Cell Stem
Cell. 2009;4(1):73-9.
92.
Assawachananont J, Mandai M, Okamoto S, Yamada C, Eiraku M, Yonemura S,
et al. Transplantation of embryonic and induced pluripotent stem cell-derived 3D retinal
sheets into retinal degenerative mice. Stem Cell Reports. 2014;2(5):662-74.
93.
Ng TK, Fortino VR, Pelaez D, Cheung HS. Progress of mesenchymal stem cell
therapy for neural and retinal diseases. World J Stem Cells. 2014;6(2):111-9.
94.
Tzameret A, Sher I, Belkin M, Treves AJ, Meir A, Nagler A, et al. Transplantation
of human bone marrow mesenchymal stem cells as a thin subretinal layer ameliorates
retinal degeneration in a rat model of retinal dystrophy. Exp Eye Res. 2014;118:135-44.
95.
Leow SN, Luu CD, Hairul Nizam MH, Mok PL, Ruhaslizan R, Wong HS, et al.
Safety and Efficacy of Human Wharton's Jelly-Derived Mesenchymal Stem Cells
Therapy for Retinal Degeneration. PLoS One. 2015;10(6):e0128973.
!65

96.
Nazari H, Zhang L, Zhu D, Chader GJ, Falabella P, Stefanini F, et al. Stem cell
based therapies for age-related macular degeneration: The promises and the
challenges. Prog Retin Eye Res. 2015;48:1-39.
97.
Tzameret A, Sher I, Belkin M, Treves AJ, Meir A, Nagler A, et al. Epiretinal
transplantation of human bone marrow mesenchymal stem cells rescues retinal and
vision function in a rat model of retinal degeneration. Stem Cell Res. 2015;15(2):387-94.
98.
Shirai H, Mandai M, Matsushita K, Kuwahara A, Yonemura S, Nakano T, et al.
Transplantation of human embryonic stem cell-derived retinal tissue in two primate
models of retinal degeneration. Proc Natl Acad Sci U S A. 2016;113(1):E81-90.
99.
Garg A, Yang J, Lee W, Tsang SH. Stem Cell Therapies in Retinal Disorders.
Cells. 2017;6(1).
100. Seiler MJ, Aramant RB, Seeliger MW, Bragadottir R, Mahoney M, Narfstrom K.
Functional and structural assessment of retinal sheet allograft transplantation in feline
hereditary retinal degeneration. Vet Ophthalmol. 2009;12(3):158-69.
101. Ivert L, Gouras P, Naeser P, Narfstrom K. Photoreceptor allografts in a feline
model of retinal degeneration. Graefes Arch Clin Exp Ophthalmol. 1998;236(11):844-52.
102. Yan Z, Zhang Y, Duan D, Engelhardt JF. Trans-splicing vectors expand the utility
of adeno-associated virus for gene therapy. Proc Natl Acad Sci U S A. 2000;97(12):
6716-21.
103. Duan D, Yue Y, Engelhardt JF. Expanding AAV packaging capacity with transsplicing or overlapping vectors: a quantitative comparison. Mol Ther. 2001;4(4):383-91.
104. Grieger JC, Samulski RJ. Packaging capacity of adeno-associated virus
serotypes: impact of larger genomes on infectivity and postentry steps. J Virol.
2005;79(15):9933-44.
105. Ghosh A, Duan D. Expanding adeno-associated viral vector capacity: a tale of
two vectors. Biotechnol Genet Eng Rev. 2007;24:165-77.
106. Allocca M, Doria M, Petrillo M, Colella P, Garcia-Hoyos M, Gibbs D, et al.
Serotype-dependent packaging of large genes in adeno-associated viral vectors results
in effective gene delivery in mice. J Clin Invest. 2008;118(5):1955-64.
107. Ghosh A, Yue Y, Lai Y, Duan D. A hybrid vector system expands adenoassociated viral vector packaging capacity in a transgene-independent manner. Mol
Ther. 2008;16(1):124-30.

!66

108. Baye LM, Patrinostro X, Swaminathan S, Beck JS, Zhang Y, Stone EM, et al. The
N-terminal region of centrosomal protein 290 (CEP290) restores vision in a zebrafish
model of human blindness. Hum Mol Genet. 2011;20(8):1467-77.
109. Gaj T, Gersbach CA, Barbas CF, 3rd. ZFN, TALEN, and CRISPR/Cas-based
methods for genome engineering. Trends Biotechnol. 2013;31(7):397-405.
110. Horvath P, Barrangou R. CRISPR/Cas, the immune system of bacteria and
archaea. Science. 2010;327(5962):167-70.
111. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, et al. Multiplex genome
engineering using CRISPR/Cas systems. Science. 2013;339(6121):819-23.
112. Hsu PD, Lander ES, Zhang F. Development and applications of CRISPR-Cas9
for genome engineering. Cell. 2014;157(6):1262-78.
113. Bainbridge JW, Mistry A, Schlichtenbrede FC, Smith A, Broderick C, De Alwis M,
et al. Stable rAAV-mediated transduction of rod and cone photoreceptors in the canine
retina. Gene Ther. 2003;10(16):1336-44.
114. Bainbridge JW, Tan MH, Ali RR. Gene therapy progress and prospects: the eye.
Gene Ther. 2006;13(16):1191-7.
115. Matsuda T, Cepko CL. Electroporation and RNA interference in the rodent retina
in vivo and in vitro. Proc Natl Acad Sci U S A. 2004;101(1):16-22.
116. Hangai M, Kaneda Y, Tanihara H, Honda Y. In vivo gene transfer into the retina
mediated by a novel liposome system. Invest Ophthalmol Vis Sci. 1996;37(13):2678-85.
117. Masuda I, Matsuo T, Yasuda T, Matsuo N. Gene transfer with liposomes to the
intraocular tissues by different routes of administration. Invest Ophthalmol Vis Sci.
1996;37(9):1914-20.
118. del Pozo-Rodriguez A, Delgado D, Solinis MA, Gascon AR, Pedraz JL. Solid lipid
nanoparticles for retinal gene therapy: transfection and intracellular trafficking in RPE
cells. Int J Pharm. 2008;360(1-2):177-83.
119. Conley SM, Naash MI. Nanoparticles for retinal gene therapy. Prog Retin Eye
Res. 2010;29(5):376-97.
120. Adijanto J, Naash MI. Nanoparticle-based technologies for retinal gene therapy.
Eur J Pharm Biopharm. 2015;95(Pt B):353-67.
121. Bennett J, Wilson J, Sun D, Forbes B, Maguire A. Adenovirus vector-mediated in
vivo gene transfer into adult murine retina. Invest Ophthalmol Vis Sci. 1994;35(5):
2535-42.
!67

122. Li J, Samulski RJ, Xiao X. Role for highly regulated rep gene expression in
adeno-associated virus vector production. J Virol. 1997;71(7):5236-43.
123. Wu L, Lam S, Cao H, Guan R, Duan R, van der Kooy D, et al. Subretinal gene
delivery using helper-dependent adenoviral vectors. Cell Biosci. 2011;1(1):15.
124. Puppo A, Cesi G, Marrocco E, Piccolo P, Jacca S, Shayakhmetov DM, et al.
Retinal transduction profiles by high-capacity viral vectors. Gene therapy. 2014;21(10):
855-65.
125. Vollrath D, Feng W, Duncan JL, Yasumura D, D'Cruz PM, Chappelow A, et al.
Correction of the retinal dystrophy phenotype of the RCS rat by viral gene transfer of
Mertk. Proc Natl Acad Sci U S A. 2001;98(22):12584-9.
126. Chen Y, Moiseyev G, Takahashi Y, Ma JX. RPE65 gene delivery restores
isomerohydrolase activity and prevents early cone loss in Rpe65-/- mice. Invest
Ophthalmol Vis Sci. 2006;47(3):1177-84.
127. Kostic C, Chiodini F, Salmon P, Wiznerowicz M, Deglon N, Hornfeld D, et al.
Activity analysis of housekeeping promoters using self-inactivating lentiviral vector
delivery into the mouse retina. Gene Ther. 2003;10(9):818-21.
128. Kong J, Kim SR, Binley K, Pata I, Doi K, Mannik J, et al. Correction of the
disease phenotype in the mouse model of Stargardt disease by lentiviral gene therapy.
Gene therapy. 2008;15(19):1311-20.
129. Semple-Rowland SL, Coggin WE, Geesey M, Eccles KS, Abraham L, Pachigar
K, et al. Expression characteristics of dual-promoter lentiviral vectors targeting retinal
photoreceptors and Muller cells. Mol Vis. 2010;16:916-34.
130. Verrier JD, Madorsky I, Coggin WE, Geesey M, Hochman M, Walling E, et al.
Bicistronic lentiviruses containing a viral 2A cleavage sequence reliably co-express two
proteins and restore vision to an animal model of LCA1. PLoS One. 2011;6(5):e20553.
131. Binley K, Widdowson P, Loader J, Kelleher M, Iqball S, Ferrige G, et al.
Transduction of photoreceptors with equine infectious anemia virus lentiviral vectors:
safety and biodistribution of StarGen for Stargardt disease. Invest Ophthalmol Vis Sci.
2013;54(6):4061-71.
132. Semple-Rowland SL, Berry J. Use of lentiviral vectors to deliver and express
bicistronic transgenes in developing chicken embryos. Methods. 2014;66(3):466-73.
133. Bartholomae CC, Arens A, Balaggan KS, Yanez-Munoz RJ, Montini E, Howe SJ,
et al. Lentiviral vector integration profiles differ in rodent postmitotic tissues. Mol Ther.
2011;19(4):703-10.

!68

134. Balaggan KS, Duran Y, Georgiadis A, Thaung C, Barker SE, Buch PK, et al.
Absence of ocular malignant transformation after sub-retinal delivery of rAAV2/2 or
integrating lentiviral vectors in p53-deficient mice. Gene therapy. 2012;19(2):182-8.
135. Kotin RM. Prospects for the use of adeno-associated virus as a vector for human
gene therapy. Hum Gene Ther. 1994;5(7):793-801.
136. Xie Q, Bu W, Bhatia S, Hare J, Somasundaram T, Azzi A, et al. The atomic
structure of adeno-associated virus (AAV-2), a vector for human gene therapy. Proc Natl
Acad Sci U S A. 2002;99(16):10405-10.
137. Laughlin CA, Jones N, Carter BJ. Effect of deletions in adenovirus early region 1
genes upon replication of adeno-associated virus. J Virol. 1982;41(3):868-76.
138. Lusby E, Fife KH, Berns KI. Nucleotide sequence of the inverted terminal
repetition in adeno-associated virus DNA. J Virol. 1980;34(2):402-9.
139. Ali RR, Reichel MB, De Alwis M, Kanuga N, Kinnon C, Levinsky RJ, et al. Adenoassociated virus gene transfer to mouse retina. Hum Gene Ther. 1998;9(1):81-6.
140. Calado SM, Oliveira AV, Machado S, Haase R, Silva GA. Sustained gene
expression in the retina by improved episomal vectors. Tissue Eng Part A.
2014;20(19-20):2692-8.
141. Donsante A, Miller DG, Li Y, Vogler C, Brunt EM, Russell DW, et al. AAV vector
integration sites in mouse hepatocellular carcinoma. Science. 2007;317(5837):477.
142. Russell DW, Grompe M. Adeno-associated virus finds its disease. Nat Genet.
2015;47(10):1104-5.
143. Auricchio A, Kobinger G, Anand V, Hildinger M, O'Connor E, Maguire AM, et al.
Exchange of surface proteins impacts on viral vector cellular specificity and transduction
characteristics: the retina as a model. Hum Mol Genet. 2001;10(26):3075-81.
144. Rabinowitz JE, Rolling F, Li C, Conrath H, Xiao W, Xiao X, et al. Cross-packaging
of a single adeno-associated virus (AAV) type 2 vector genome into multiple AAV
serotypes enables transduction with broad specificity. J Virol. 2002;76(2):791-801.
145. Surace EM, Auricchio A, Reich SJ, Rex T, Glover E, Pineles S, et al. Delivery of
adeno-associated virus vectors to the fetal retina: impact of viral capsid proteins on
retinal neuronal progenitor transduction. J Virol. 2003;77(14):7957-63.
146. Sun L, Li J, Xiao X. Overcoming adeno-associated virus vector size limitation
through viral DNA heterodimerization. Nat Med. 2000;6(5):599-602.

!69

147. Dong JY, Fan PD, Frizzell RA. Quantitative analysis of the packaging capacity of
recombinant adeno-associated virus. Hum Gene Ther. 1996;7(17):2101-12.
148. Wang Q, Dong B, Firrman J, Roberts S, Moore AR, Cao W, et al. Efficient
production of dual recombinant adeno-associated viral vectors for factor VIII delivery.
Hum Gene Ther Methods. 2014;25(4):261-8.
149. McClements ME, Charbel Issa P, Blouin V, MacLaren RE. A fragmented adenoassociated viral dual vector strategy for treatment of diseases caused by mutations in
large genes leads to expression of hybrid transcripts. J Genet Syndr Gene Ther.
2016;7(5).
150. Fisher KJ, Gao GP, Weitzman MD, DeMatteo R, Burda JF, Wilson JM.
Transduction with recombinant adeno-associated virus for gene therapy is limited by
leading-strand synthesis. J Virol. 1996;70(1):520-32.
151. Ferrari FK, Samulski T, Shenk T, Samulski RJ. Second-strand synthesis is a ratelimiting step for efficient transduction by recombinant adeno-associated virus vectors. J
Virol. 1996;70(5):3227-34.
152. Zhong L, Zhou X, Li Y, Qing K, Xiao X, Samulski RJ, et al. Single-polarity
recombinant adeno-associated virus 2 vector-mediated transgene expression in vitro
and in vivo: mechanism of transduction. Mol Ther. 2008;16(2):290-5.
153. McCarty DM, Fu H, Monahan PE, Toulson CE, Naik P, Samulski RJ. Adenoassociated virus terminal repeat (TR) mutant generates self-complementary vectors to
overcome the rate-limiting step to transduction in vivo. Gene Ther. 2003;10(26):2112-8.
154. Chiorini JA, Kim F, Yang L, Kotin RM. Cloning and characterization of adenoassociated virus type 5. J Virol. 1999;73(2):1309-19.
155. Chiorini JA, Yang L, Liu Y, Safer B, Kotin RM. Cloning of adeno-associated virus
type 4 (AAV4) and generation of recombinant AAV4 particles. J Virol. 1997;71(9):
6823-33.
156. Flotte TR. Adeno-associated virus-mediated gene transfer for lung diseases.
Hum Gene Ther. 2005;16(6):643-8.
157. Gao GP, Alvira MR, Wang L, Calcedo R, Johnston J, Wilson JM. Novel adenoassociated viruses from rhesus monkeys as vectors for human gene therapy. Proc Natl
Acad Sci U S A. 2002;99(18):11854-9.
158. Gao G, Vandenberghe LH, Alvira MR, Lu Y, Calcedo R, Zhou X, et al. Clades of
Adeno-associated viruses are widely disseminated in human tissues. J Virol.
2004;78(12):6381-8.

!70

159. Handa A, Muramatsu S, Qiu J, Mizukami H, Brown KE. Adeno-associated virus
(AAV)-3-based vectors transduce haematopoietic cells not susceptible to transduction
with AAV-2-based vectors. J Gen Virol. 2000;81(Pt 8):2077-84.
160. Rutledge EA, Halbert CL, Russell DW. Infectious clones and vectors derived from
adeno-associated virus (AAV) serotypes other than AAV type 2. J Virol. 1998;72(1):
309-19.
161. Summerford C, Samulski RJ. Membrane-associated heparan sulfate
proteoglycan is a receptor for adeno-associated virus type 2 virions. J Virol. 1998;72(2):
1438-45.
162. Qing K, Mah C, Hansen J, Zhou S, Dwarki V, Srivastava A. Human fibroblast
growth factor receptor 1 is a co-receptor for infection by adeno-associated virus 2. Nat
Med. 1999;5(1):71-7.
163. Summerford C, Bartlett JS, Samulski RJ. AlphaVbeta5 integrin: a co-receptor for
adeno-associated virus type 2 infection. Nat Med. 1999;5(1):78-82.
164. Kashiwakura Y, Tamayose K, Iwabuchi K, Hirai Y, Shimada T, Matsumoto K, et al.
Hepatocyte growth factor receptor is a coreceptor for adeno-associated virus type 2
infection. J Virol. 2005;79(1):609-14.
165. Lerch TF, Xie Q, Chapman MS. The structure of adeno-associated virus serotype
3B (AAV-3B): insights into receptor binding and immune evasion. Virology. 2010;403(1):
26-36.
166. Halbert CL, Allen JM, Miller AD. Adeno-associated virus type 6 (AAV6) vectors
mediate efficient transduction of airway epithelial cells in mouse lungs compared to that
of AAV2 vectors. J Virol. 2001;75(14):6615-24.
167. Schmidt M, Voutetakis A, Afione S, Zheng C, Mandikian D, Chiorini JA. Adenoassociated virus type 12 (AAV12): a novel AAV serotype with sialic acid- and heparan
sulfate proteoglycan-independent transduction activity. J Virol. 2008;82(3):1399-406.
168. Kaludov N, Brown KE, Walters RW, Zabner J, Chiorini JA. Adeno-associated
virus serotype 4 (AAV4) and AAV5 both require sialic acid binding for hemagglutination
and efficient transduction but differ in sialic acid linkage specificity. J Virol. 2001;75(15):
6884-93.
169. Walters RW, Yi SM, Keshavjee S, Brown KE, Welsh MJ, Chiorini JA, et al.
Binding of adeno-associated virus type 5 to 2,3-linked sialic acid is required for gene
transfer. J Biol Chem. 2001;276(23):20610-6.
170. Bartlett JS, Wilcher R, Samulski RJ. Infectious entry pathway of adenoassociated virus and adeno-associated virus vectors. J Virol. 2000;74(6):2777-85.
!71

171. Sanlioglu S, Benson PK, Yang J, Atkinson EM, Reynolds T, Engelhardt JF.
Endocytosis and nuclear trafficking of adeno-associated virus type 2 are controlled by
rac1 and phosphatidylinositol-3 kinase activation. J Virol. 2000;74(19):9184-96.
172. Duan D, Li Q, Kao AW, Yue Y, Pessin JE, Engelhardt JF. Dynamin is required for
recombinant adeno-associated virus type 2 infection. J Virol. 1999;73(12):10371-6.
173. Bantel-Schaal U, Hub B, Kartenbeck J. Endocytosis of adeno-associated virus
type 5 leads to accumulation of virus particles in the Golgi compartment. J Virol.
2002;76(5):2340-9.
174. Vihinen-Ranta M, Kalela A, Makinen P, Kakkola L, Marjomaki V, Vuento M.
Intracellular route of canine parvovirus entry. J Virol. 1998;72(1):802-6.
175. Douar AM, Poulard K, Stockholm D, Danos O. Intracellular trafficking of adenoassociated virus vectors: routing to the late endosomal compartment and proteasome
degradation. J Virol. 2001;75(4):1824-33.
176. Yan Z, Zak R, Zhang Y, Ding W, Godwin S, Munson K, et al. Distinct classes of
proteasome-modulating agents cooperatively augment recombinant adeno-associated
virus type 2 and type 5-mediated transduction from the apical surfaces of human airway
epithelia. J Virol. 2004;78(6):2863-74.
177. Ros C, Burckhardt CJ, Kempf C. Cytoplasmic trafficking of minute virus of mice:
low-pH requirement, routing to late endosomes, and proteasome interaction. J Virol.
2002;76(24):12634-45.
178. Yan Z, Zak R, Luxton GW, Ritchie TC, Bantel-Schaal U, Engelhardt JF.
Ubiquitination of both adeno-associated virus type 2 and 5 capsid proteins affects the
transduction efficiency of recombinant vectors. J Virol. 2002;76(5):2043-53.
179. Zerial M, McBride H. Rab proteins as membrane organizers. Nat Rev Mol Cell
Biol. 2001;2(2):107-17.
180. Trischler M, Stoorvogel W, Ullrich O. Biochemical analysis of distinct Rab5- and
Rab11-positive endosomes along the transferrin pathway. J Cell Sci. 1999;112 ( Pt 24):
4773-83.
181. Bucci C, Thomsen P, Nicoziani P, McCarthy J, van Deurs B. Rab7: a key to
lysosome biogenesis. Mol Biol Cell. 2000;11(2):467-80.
182. Diaz E, Schimmoller F, Pfeffer SR. A novel Rab9 effector required for endosometo-TGN transport. J Cell Biol. 1997;138(2):283-90.
183. Suikkanen S, Antila M, Jaatinen A, Vihinen-Ranta M, Vuento M. Release of
canine parvovirus from endocytic vesicles. Virology. 2003;316(2):267-80.
!72

184. Seisenberger G, Ried MU, Endress T, Buning H, Hallek M, Brauchle C. Real-time
single-molecule imaging of the infection pathway of an adeno-associated virus. Science.
2001;294(5548):1929-32.
185. Ding W, Zhang L, Yan Z, Engelhardt JF. Intracellular trafficking of adenoassociated viral vectors. Gene Ther. 2005;12(11):873-80.
186. Pang JJ, Lauramore A, Deng WT, Li Q, Doyle TJ, Chiodo V, et al. Comparative
analysis of in vivo and in vitro AAV vector transduction in the neonatal mouse retina:
effects of serotype and site of administration. Vision Res. 2008;48(3):377-85.
187. Clement N, Grieger JC. Manufacturing of recombinant adeno-associated viral
vectors for clinical trials. Mol Ther Methods Clin Dev. 2016;3:16002.
188. Hermonat PL, Labow MA, Wright R, Berns KI, Muzyczka N. Genetics of adenoassociated virus: isolation and preliminary characterization of adeno-associated virus
type 2 mutants. J Virol. 1984;51(2):329-39.
189. Samulski RJ, Chang LS, Shenk T. Helper-free stocks of recombinant adenoassociated viruses: normal integration does not require viral gene expression. J Virol.
1989;63(9):3822-8.
190. Muzyczka N. Use of adeno-associated virus as a general transduction vector for
mammalian cells. Curr Top Microbiol Immunol. 1992;158:97-129.
191. Adamson-Small L, Potter M, Falk DJ, Cleaver B, Byrne BJ, Clement N. A
scalable method for the production of high-titer and high-quality adeno-associated type
9 vectors using the HSV platform. Mol Ther Methods Clin Dev. 2016;3:16031.
192. Xiao X, Li J, Samulski RJ. Production of high-titer recombinant adeno-associated
virus vectors in the absence of helper adenovirus. J Virol. 1998;72(3):2224-32.
193. Grimm D, Kern A, Rittner K, Kleinschmidt JA. Novel tools for production and
purification of recombinant adenoassociated virus vectors. Hum Gene Ther. 1998;9(18):
2745-60.
194. Chadeuf G, Favre D, Tessier J, Provost N, Nony P, Kleinschmidt J, et al. Efficient
recombinant adeno-associated virus production by a stable rep-cap HeLa cell line
correlates with adenovirus-induced amplification of the integrated rep-cap genome. J
Gene Med. 2000;2(4):260-8.
195. Liu X, Voulgaropoulou F, Chen R, Johnson PR, Clark KR. Selective Rep-Cap
gene amplification as a mechanism for high-titer recombinant AAV production from
stable cell lines. Mol Ther. 2000;2(4):394-403.

!73

196. Gao GP, Lu F, Sanmiguel JC, Tran PT, Abbas Z, Lynd KS, et al. Rep/Cap gene
amplification and high-yield production of AAV in an A549 cell line expressing Rep/Cap.
Mol Ther. 2002;5(5 Pt 1):644-9.
197. Urabe M, Ding C, Kotin RM. Insect cells as a factory to produce adenoassociated virus type 2 vectors. Hum Gene Ther. 2002;13(16):1935-43.
198. Grimm D, Kay MA, Kleinschmidt JA. Helper virus-free, optically controllable, and
two-plasmid-based production of adeno-associated virus vectors of serotypes 1 to 6.
Mol Ther. 2003;7(6):839-50.
199. Auricchio A, O'Connor E, Hildinger M, Wilson JM. A single-step affinity column for
purification of serotype-5 based adeno-associated viral vectors. Mol Ther. 2001;4(4):
372-4.
200. Auricchio A, Hildinger M, O'Connor E, Gao GP, Wilson JM. Isolation of highly
infectious and pure adeno-associated virus type 2 vectors with a single-step gravity-flow
column. Hum Gene Ther. 2001;12(1):71-6.
201. Wu Z, Asokan A, Samulski RJ. Adeno-associated virus serotypes: vector toolkit
for human gene therapy. Mol Ther. 2006;14(3):316-27.
202. Beltran WA, Boye SL, Boye SE, Chiodo VA, Lewin AS, Hauswirth WW, et al.
rAAV2/5 gene-targeting to rods:dose-dependent efficiency and complications associated
with different promoters. Gene Ther. 2010;17(9):1162-74.
203. Manfredi A, Marrocco E, Puppo A, Cesi G, Sommella A, Della Corte M, et al.
Combined rod and cone transduction by adeno-associated virus 2/8. Hum Gene Ther.
2013;24(12):982-92.
204. Quiambao AB, Peachey NS, Mangini NJ, Rohlich P, Hollyfield JG, al-Ubaidi MR.
A 221-bp fragment of the mouse opsin promoter directs expression specifically to the
rod photoreceptors of transgenic mice. Vis Neurosci. 1997;14(4):617-25.
205. Khani SC, Pawlyk BS, Bulgakov OV, Kasperek E, Young JE, Adamian M, et al.
AAV-mediated expression targeting of rod and cone photoreceptors with a human
rhodopsin kinase promoter. Invest Ophthalmol Vis Sci. 2007;48(9):3954-61.
206. Mowat FM, Gornik KR, Dinculescu A, Boye SL, Hauswirth WW, Petersen-Jones
SM, et al. Tyrosine capsid-mutant AAV vectors for gene delivery to the canine retina
from a subretinal or intravitreal approach. Gene therapy. 2014;21(1):96-105.
207. Boyd RF, Boye SL, Conlon TJ, Erger KE, Sledge DG, Langohr IM, et al. Reduced
retinal transduction and enhanced transgene-directed immunogenicity with intravitreal
delivery of rAAV following posterior vitrectomy in dogs. Gene therapy. 2016;23(6):
548-56.
!74

208. Woodard KT, Liang KJ, Bennett WC, Samulski RJ. Heparan Sulfate Binding
Promotes Accumulation of Intravitreally Delivered Adeno-associated Viral Vectors at the
Retina for Enhanced Transduction but Weakly Influences Tropism. J Virol. 2016;90(21):
9878-88.
209. Kay CN, Ryals RC, Aslanidi GV, Min SH, Ruan Q, Sun J, et al. Targeting
photoreceptors via intravitreal delivery using novel, capsid-mutated AAV vectors. PLoS
One. 2013;8(4):e62097.
210. Qing K, Hansen J, Weigel-Kelley KA, Tan M, Zhou S, Srivastava A. Adenoassociated virus type 2-mediated gene transfer: role of cellular FKBP52 protein in
transgene expression. J Virol. 2001;75(19):8968-76.
211. Qing K, Li W, Zhong L, Tan M, Hansen J, Weigel-Kelley KA, et al. Adenoassociated virus type 2-mediated gene transfer: role of cellular T-cell protein tyrosine
phosphatase in transgene expression in established cell lines in vitro and transgenic
mice in vivo. J Virol. 2003;77(4):2741-6.
212. Zhong L, Li B, Mah CS, Govindasamy L, Agbandje-McKenna M, Cooper M, et al.
Next generation of adeno-associated virus 2 vectors: point mutations in tyrosines lead
to high-efficiency transduction at lower doses. Proc Natl Acad Sci U S A. 2008;105(22):
7827-32.
213. Yokoi K, Kachi S, Zhang HS, Gregory PD, Spratt SK, Samulski RJ, et al. Ocular
gene transfer with self-complementary AAV vectors. Invest Ophthalmol Vis Sci.
2007;48(7):3324-8.
214. Natkunarajah M, Trittibach P, McIntosh J, Duran Y, Barker SE, Smith AJ, et al.
Assessment of ocular transduction using single-stranded and self-complementary
recombinant adeno-associated virus serotype 2/8. Gene Ther. 2008;15(6):463-7.
215. Petersen-Jones SM, Bartoe JT, Fischer AJ, Scott M, Boye SL, Chiodo V, et al.
AAV retinal transduction in a large animal model species: comparison of a selfcomplementary AAV2/5 with a single-stranded AAV2/5 vector. Mol Vis.
2009;15:1835-42.
216. Ford M, Bragadottir R, Rakoczy PE, Narfstrom K. Gene transfer in the RPE65
null mutation dog: relationship between construct volume, visual behavior and
electroretinographic (ERG) results. Doc Ophthalmol. 2003;107(1):79-86.
217. Narfstrom K, Bragadottir R, Redmond TM, Rakoczy PE, van Veen T, Bruun A.
Functional and structural evaluation after AAV.RPE65 gene transfer in the canine model
of Leber's congenital amaurosis. Adv Exp Med Biol. 2003;533:423-30.

!75

218. Annear MJ, Bartoe JT, Barker SE, Smith AJ, Curran PG, Bainbridge JW, et al.
Gene therapy in the second eye of RPE65-deficient dogs improves retinal function.
Gene Ther. 2011;18(1):53-61.
219. Annear MJ, Mowat FM, Bartoe JT, Querubin J, Azam SA, Basche M, et al.
Successful gene therapy in older Rpe65-deficient dogs following subretinal injection of
an adeno-associated vector expressing RPE65. Hum Gene Ther. 2013;24(10):883-93.
220. Mowat FM, Breuwer AR, Bartoe JT, Annear MJ, Zhang Z, Smith AJ, et al. RPE65
gene therapy slows cone loss in Rpe65-deficient dogs. Gene Ther. 2013;20(5):545-55.
221. Dejneka NS, Surace EM, Aleman TS, Cideciyan AV, Lyubarsky A, Savchenko A,
et al. In utero gene therapy rescues vision in a murine model of congenital blindness.
Mol Ther. 2004;9(2):182-8.
222. Lai CM, Yu MJ, Brankov M, Barnett NL, Zhou X, Redmond TM, et al.
Recombinant adeno-associated virus type 2-mediated gene delivery into the Rpe65-/knockout mouse eye results in limited rescue. Genet Vaccines Ther. 2004;2(1):3.
223. Narfstrom K, Katz ML, Ford M, Redmond TM, Rakoczy E, Bragadottir R. In vivo
gene therapy in young and adult RPE65-/- dogs produces long-term visual
improvement. J Hered. 2003;94(1):31-7.
224. Narfstrom K, Vaegan, Katz M, Bragadottir R, Rakoczy EP, Seeliger M.
Assessment of structure and function over a 3-year period after gene transfer in
RPE65-/- dogs. Doc Ophthalmol. 2005;111(1):39-48.
225. Bainbridge JW, Smith AJ, Barker SS, Robbie S, Henderson R, Balaggan K, et al.
Effect of gene therapy on visual function in Leber's congenital amaurosis. N Engl J Med.
2008;358(21):2231-9.
226. Hauswirth WW, Aleman TS, Kaushal S, Cideciyan AV, Schwartz SB, Wang L, et
al. Treatment of leber congenital amaurosis due to RPE65 mutations by ocular
subretinal injection of adeno-associated virus gene vector: short-term results of a phase
I trial. Hum Gene Ther. 2008;19(10):979-90.
227. Maguire AM, Simonelli F, Pierce EA, Pugh EN, Jr., Mingozzi F, Bennicelli J, et al.
Safety and efficacy of gene transfer for Leber's congenital amaurosis. N Engl J Med.
2008;358(21):2240-8.
228. Bainbridge JW, Mehat MS, Sundaram V, Robbie SJ, Barker SE, Ripamonti C, et
al. Long-term effect of gene therapy on Leber's congenital amaurosis. N Engl J Med.
2015;372(20):1887-97.
229. Bennett J, Wellman J, Marshall KA, McCague S, Ashtari M, DiStefano-Pappas J,
et al. Safety and durability of effect of contralateral-eye administration of AAV2 gene
!76

therapy in patients with childhood-onset blindness caused by RPE65 mutations: a
follow-on phase 1 trial. Lancet. 2016;388(10045):661-72.
230. Ghazi NG, Abboud EB, Nowilaty SR, Alkuraya H, Alhommadi A, Cai H, et al.
Treatment of retinitis pigmentosa due to MERTK mutations by ocular subretinal injection
of adeno-associated virus gene vector: results of a phase I trial. Hum Genet.
2016;135(3):327-43.
231. Weleber RG, Pennesi ME, Wilson DJ, Kaushal S, Erker LR, Jensen L, et al.
Results at 2 Years after Gene Therapy for RPE65-Deficient Leber Congenital Amaurosis
and Severe Early-Childhood-Onset Retinal Dystrophy. Ophthalmology. 2016;123(7):
1606-20.
232. Spaide RF, Curcio CA. Anatomical correlates to the bands seen in the outer
retina by optical coherence tomography: literature review and model. Retina.
2011;31(8):1609-19.
233. Hood DC, Zhang X, Ramachandran R, Talamini CL, Raza A, Greenberg JP, et al.
The inner segment/outer segment border seen on optical coherence tomography is less
intense in patients with diminished cone function. Invest Ophthalmol Vis Sci.
2011;52(13):9703-9.
234. Wu Z, Ayton LN, Guymer RH, Luu CD. Relationship between the second
reflective band on optical coherence tomography and multifocal electroretinography in
age-related macular degeneration. Invest Ophthalmol Vis Sci. 2013;54(4):2800-6.
235. Wu Z, Ayton LN, Guymer RH, Luu CD. Second reflective band intensity in agerelated macular degeneration. Ophthalmology. 2013;120(6):1307-8 e1.

!77

CHAPTER 2

ALTERNATIVE SPLICING IN CEP290 MUTANT CATS RESULTS IN A MILDER
PHENOTYPE THAN LCACEP290 PATIENTS

Author contributions
Conceived and designed the experiments: ALM, SMP-J. Performed the experiments:
ALM. Analyzed the data: ALM. Wrote the chapter: ALM, SMP-J.

!78

2.1 Introduction

Leber Congenital Amaurosis (LCA) is a group of debilitating inherited retinal
diseases that cause retinal degeneration and eventual blindness in children.(1) There
are currently no treatments outside of clinical trials for these devastating conditions,
however, experimental procedures aimed at replacing or repairing the causative genetic
defect show great promise.(2-4)
For such treatments to reach clinical trials in people, animal models are
imperative for achieving optimal efficacy and to ensure safety. Rodent models have
been widely utilized and are useful for initial development of therapeutic approaches but
studies using large animal models such as the cat that have eyes with critical similarities
to those of humans, can build on data collected in such models. The feline eye is close
in size and proportions to the human eye, allowing for optimization of surgical delivery
techniques and greater ease of detailed in vivo imaging. Importantly, the feline retina
also has a similar photoreceptor topography to the human retina with an area centralis,
a region semi-homologous to the human macula, that could allow for greater
translational analysis of treatment to this crucial region.(5)
About 20% of LCA cases are caused by mutations in the centrosomal 290kDa
(CEP290) gene.(1) Mutations in this gene have been associated with a broad spectrum
of diseases, ranging from neonatal lethal syndromes to retina-only phenotypes.(6-13)
The most common retinal phenotype caused by mutations in this gene is LCA, with the
commonest mutation being an intronic mutation that creates a strong splice donor site,
leading to the introduction of a cryptic exon in the CEP290 transcript.(1)

!79

A spontaneous mutation in the CEP290 gene in the cat resulting in an autosomal
recessive retinal degeneration has provided a naturally-occurring feline model for LCA
caused by CEP290 mutations known as the rdAc cat.(14-33) The feline defect arises
from an intronic T to G substitution 9 base-pairs downstream from the wild-type splice
donor site.(34) . This is predicted to result in a canonical GT splice donor site 4 basepairs downstream of the wild-type GC donor site that is preferentially used. Use of the
alternative splice site in mutant cats results in a frameshift and a premature termination
codon following two altered codons.(35) The predicted effect on the protein, if
translated, would be a truncation of 159 amino acids out of the total 2,479. This feline
mutation offers an opportunity to study splice-altering mutations, how they affect
transcript levels relative to the wild-type state, and what types of molecular intervention
could reverse the dysfunction. This model therefore provides a valuable tool for better
understanding this commonly mutated gene, as well as for the development and testing
of treatments.
Cats show a significantly milder phenotype than most human CEP290
retinopathy patients, with a later-onset and slowly-progressing photoreceptor
degeneration.(14, 15) The underlying mechanism for this milder phenotype may shed
light on CEP290-associated retinopathies and for the development of treatments. This
mutation in felines occurs further downstream than the similar mutation in people,
suggesting that a possible mechanism could be the translation of a longer, more
functional, protein due to a less severe truncation. Furthermore, the wild-type splice site
remains, raising the question of whether some amount of full-length protein is still
produced in homozygous mutant cats.

!80

The CEP290 gene encodes a ciliary protein that localizes to the interconnecting
cilium of rod and cone photoreceptors and is integral for protein transport between the
inner and outer segments.(36) The large size of this gene precludes packaging of the
full-length cDNA into the most effective retinal vector system; adeno-associated virus
(AAV) vectors, and other vector types have shown poor retinal transduction, making
gene therapy based treatments challenging. However, a possible method to circumvent
this obstacle to gene therapy could be to deliver a partial CEP290 transcript if this
provides some protein function. A study in zebrafish supports this approach with rescue
of vision noted after injection of a partial transcript.(37) However, the effect of a
truncated protein has not been studied in mammals, leaving a significant information
gap before this form of treatment could reach human clinical trials. The CEP290 mutant
feline may provide information on the retinal phenotype associated with a truncated
protein. However, detailed characterization of the rdAc mutation on retinal CEP290
transcripts in affected cats has not been reported. We therefore analyzed CEP290
transcript levels and the protein profile in rdAc cats versus wild-type and heterozygous
carrier cats aiming to investigate whether the canonical splice site resulting from the
intronic mutation is used exclusively and whether the mutant mRNA avoids nonsensemediated decay to result in a truncated protein.

!81

2.2 Methods

2.2.1 Animals and tissue processing
All cats were purpose bred as part of a CEP290 retinopathy breeding colony
maintained at Michigan State University. All animal practices were approved by the
Michigan State University Institutional Animal Care and Use Committee and conducted
according to the Association for Research in Vision and Ophthalmology Statement for
the Use of Animals in Ophthalmic and Vision Research. Colony cats were genotyped
utilizing a standard assay developed by our laboratory. A 240 base-pair genomic region
spanning the mutation site was amplified by polymerase chain reaction. The amplicons
were then differentially cut by restriction enzyme digestion with the TasI/Tsp509I enzyme
(NEB, Beverly, MA, USA). (Figure 2.1)
A. Step 1: PCR
Forward primer

TCAATGAATTATTTCCATGTCTACACT

Reverse primer

ATGCCAAGAAGTGGCTTGAG
B. STEP 2: Restriction enzyme digestion

Enzyme

TasI/Tsp509I (NEB)
Differential Digestion

Band size

Wild-type

Heterozygous

Homozygous Mutant

188
125
63
52
Figure 2.1: Feline CEP290 genotyping assay. A. A 240 base-pair region spanning
the mutation site is amplified by PCR. B. The amplicon is digested for differential
cutting of the wild-type versus mutant alleles, resulting in a larger band present for
mutant alleles for clear genotype confirmation.
!82

Following euthanasia by intravenous pentobarbital overdose (Fatal-Plus, Vortech
Pharmaceuticals, Dearborn, MI, USA), retinas were collected from nine 16 week-old
cats, three from each genotype; homozygous wild-type, CEP290 mutation
heterozygous, and CEP290 mutation homozygous,flash frozen and stored at -80°C until
use. RNA was extracted using the 5 Prime PerfectPure RNA Tissue Kit (Fisher Scientific
Co., Fair Lawn, NJ, USA) following the standard kit protocol. RNA quality and quantity
was analyzed using the Agilent BioAnalyzer 2100 (Agilent Technologies, Palo Alto, CA,
USA) with a minimum RNA Integrity Number (RIN) set at 6 (Table 2.1). cDNA was
synthesized using the Transcriptor First Strand cDNA synthesis kit (Roche Diagnostics,
Basel, Switzerland) following standard kit protocol using the provided random primers
and including a DNase step to prevent DNA contamination.

Table 2.1: RNA Integrity Data. RNA integrity data for
RNA samples used to create cDNA for transcript
analysis.

!83

2.2.2 Transcript analysis
For quantitative real-time polymerase chain reactions (qRT-PCRs), custom
TaqMan assays were designed (Applied Biosystems, Foster City, CA, USA) to detect
the wild-type CEP290 transcript, the mutation-created alternative CEP290 transcript,
and Tuba1b transcript as an endogenous control (Table 2.2). qRT-PCR was carried out
on a ABI 7500 Fast qRT-PCR system (Applied Biosystems) under standard conditions
which included a 2 minute UNG incubation at 50°C, a 10 minute polymerase activation
step at 95°C, and then 40 cycles of a denature and anneal protocol of 95°C for 15
seconds and 60°C for 1 minute, respectively. All samples were run in triplicate and
technical replicates were analyzed and only used if within 0.3 Ct of each other. Samples
were re-run if outside of this level of consistency. CEP290 data was normalized to the
Tuba1b data and analyzed using the comparative delta delta Ct method with the wildtype samples set as the reference. Data was analyzed for normality using the ShapiroWilk test for normality. Since the datasets did not pass normality testing, non-parametric
tests were used to compare genotypes. For wild-type transcript level data, in which
three genotypes were compared, the Kruskal-Wallis One Way Analysis of Variance on
ranks was used. To compare the two genotypes in which the truncated transcript was
analyzed, the Mann-Whitney Rank Sum test was used. Statistical significance was set
at p < 0.05 for all testing. All statistical analysis and graphing was completed in
SigmaPlot12 statistical software (Systat Software Inc., Chicago, IL, USA).

!84

2.2.3 Protein analysis
Protein was extracted from retinal tissue as follows: Retinal tissue was immersed
in a Tris-Triton cell lysis buffer and homogenized with a pestle. Samples were then
vigorously mixed on a vortex machine and centrifuged, saving the supernatant sample.
Protein was quantified by spectrophotometry using a ND-1000 NanoDrop machine
(NanoDrop Technologies, Wilmington, DE, USA) and stored at -20°C.
Relative quantification of CEP290 protein across genotypes was determined by
automated capillary western blot utilizing the WES system (ProteinSimple, San Jose,
CA, USA) following standard kit protocols. All samples were run in duplicate and were
run against a calnexin control. Relative protein concentration was compared across
genotypes. To do this, the area under the curve of the CEP290 peaks for each sample
was generated by the WES Compass software (ProteinSimple, San Jose, CA, USA).
Genotypes were then statistically compared using the Kruskal-Wallis One Way Analysis
of Variance on ranks using SigmaPlot12 software (Systat Software Inc.) (Table 2.3)

!85

Table 2.3: Antibodies Used for Protein Analysis. The same CEP290 antibody was
used for both WES western blotting and IHC. Different secondary antibodies
appropriate to the assays were used, with the WES-provided secondary antibody used
for the WES and an IHC verified antibody used for the IHC. A nuclear counterstain was
used on all IHC slides.
2.2.4 Immunohistochemistry
One eye from each of four mid-stage (four year-old) CEP290 mutant cats and
one eye from an adult wild-type cat were processed for immunohistochemistry (IHC) as
previously described.(38) Briefly, eyes were promptly enucleated, fixed in 4%
paraformaldehyde, and dissected along the limbus to separate the posterior eye cup
which was then embedded in optimal cutting temperature gel (OCT. Sakura Finetek
USA, Inc., Torrance, CA, USA) and flash frozen in liquid nitrogen.
For visualization of CEP290 protein in retinal sections, serial 14 micron vertical
retinal sections were taken from the above eyes and stained with a CEP290 specific
antibody (Table 2.3). Immunohistochemistry was performed as previously reported by
our laboratory to label CEP290 protein against a nuclear counterstain and images were
collected on a Nikon Eclipse 80i microscope (Nikon instruments Inc., Melville, NY, USA)
equipped with a CoolSnap ESv camera (Photometrics, Tuscon, AZ, USA).(38)

!86

2.3 Results

qRT-PCR revealed that CEP290 homozygous mutant felines produce both fulllength wild-type and truncated mutant transcript. Mutant cats produce 17.4% as much
full-length transcript as wild-type cats (p < 0.001), a statistically significant difference
that shows that mutant cat cells do utilize the wild-type splice site at a low level.
Heterozygous mutant (carrier) cats produce 67.8% as much full-length transcript as
wild-type cats, a difference which was not statistically significant (p= 0.125). Mutant cats
also showed usage of the mutant splice site, with heterozygous cats showing 48% as
much mutant transcript as mutant cats (p = 0.026). Taken together, these data suggest
that homozygous mutant cats produce a combination of shortened mutant transcript and
full-length wild-type transcript. (Figure 2.2)

Figure 2.2: Relative expression of full-length wild-type and truncated mutant
transcripts. A. Mutant cats produce 17.4% as much full-length transcript as wild-type
cats. B. Mutant cats show production of truncated transcript and heterozygous cats
show 48% as much truncated transcript as mutant cats. ** = p < 0.005

!87

WES analysis shows production of CEP290 protein in cats of all genotypes. The
homozygous mutant CEP290 cats showed a protein blot that appeared as a smear with
a wider band that extends from 290kDa to slightly lower. Because the truncated protein
is only shortened by 159 of 2,479 amino acids (approximately 6%), it is difficult to
separate the truncated and full-length proteins on western blot. The area under the
CEP290 peaks show a stronger CEP290 signal for wild-type cats (average area =
24,917.5 chemiluminescence) than the other genotypes, with heterozygous cats having
an intermediate protein signal (average area = 16,140.8 chemiluminescence) and
homozygous mutant cats having the weakest signal (average area = 13,466.25
chemiluminescence). Statistical comparison of the genotypes shows a significant
difference between the protein signals of mutant cats and wild-type cats (p= 0.005) and
between wild-type cats and heterozygous cats (p = 0.01). (Figure 2.3)

Figure 2.3: Automated capillary western blot shows detectable CEP290 signal in
mutant cats. A. Representative blots generated by the WES software showing the shift
towards a lower band in a CEP290 homozygous mutant cat. The band at 116 shows the
calnexin loading control. B. Relative quantitation shows a significant difference between
CEP290 protein levels in wild-type cats versus heterozygous or homozygous mutant
cats. * = p < 0.05

!88

Immunohistochemistry (IHC) in wild-type cats showed strong labeling of the
photoreceptors at the inner segment/outer segment junction. IHC on sections from midstage (4 year-old) CEP290 mutant cats also shows immunolabeling for CEP290 in the
region of the connecting cilium. (Figure 2.4)

CEP290, DAPI
Figure 2.4: Immunohistochemistry shows detectable CEP290 protein in CEP290
mutant cats. A. Wild-type cats show significant CEP290 protein signal in the inner/
outer segment junction extending into the outer segments. B. CEP290 mutant cats
show a low but detectable signal for CEP290, which appropriately localizes to the region
of the connecting cilium.

!89

2.4 Discussion

CEP290 mutant cats have a milder phenotype than is typical for people with
LCACEP290. Our results show that this is likely to be due to a combination of some
production of full-length CEP290 due to use of the wild-type splice site and some
production of truncated protein due to use of the introduced splice site. Western blot
resulted in a wider band in CEP290 cats compared to wild-type cats that likely
represented the presence of both full-length and truncated CEP290 protein. The protein
signal was 54% as strong as seen in wild-type cats but the wild-type transcript levels
were only 17.4% that detected in wild-type cats, suggesting the production of a
significant amount of truncated protein. The CEP290 protein produced by mutant cats is
visualized in the correct retinal location on IHC of retinal sections. The predicted
truncated protein resulting from this mutation would be shortened by 159 out of the
2,479 amino acids.(34) The truncation would remove two kinase inducible domains but
leaves the rest of the protein, including other functional domains and localization
signals, intact. This taken together with our IHC findings of appropriate localization and
studies in other species showing truncated CEP290 can be functional, supports likely
residual function of this shortened protein.(37) Taken together, these results suggest
that the milder phenotype seen in CEP290 mutant felines is because of the production
wild-type protein and a significant production of shortened but semi-functional protein.
It is important to note that the antibody used in this study is a polyclonal antibody
that targets upstream of the truncation at amino acids 781-830 of the human protein.
This antibody would therefore label both the full-length protein as well as the truncated

!90

protein produced by the shortened transcript. In future studies it would be valuable to
create antibodies to differentiate between the full-length and truncated proteins..
These findings in CEP290 cats have important implications for the development
of treatments against LCACEP290. Since the full CEP290 transcript cannot fit into an AAV
vector, packing a partial transcript into an AAV is one possible approach to lessen the
severity of the phenotype While the shortened transcript produced in these mutant cats
is still too large to fit into an AAV vector, a previous study in a zebrafish model showed
that only the N-terminal region of the protein was required to rescue vision in this model
suggesting that a shorter transcript than that produced in mutant cats may be
therapeutic.(37)
This study also holds interesting implications for nonsense-mediated decay
(NMD) in the retina as it shows that a significant amount of truncated transcript is
translated. Future studies investigating this anomaly may hold additional insights into
retinopathy mechanisms and treatments against these diseases.
Lastly, when studying animal models, objective markers for monitoring disease
progression and treatment efficacy are integral. This study provides new information
about this important model of LCACEP290 and also provides new markers that could be
used for objectively measuring treatment efficacy in treatment trials using this model.
Transcript and protein levels relative to wild-type cats could be analyzed to determine
level of rescue, which could then be combined with visual function assays for a
thorough picture of treatment efficacy.

!91

In summary, we present here evidence that translation of a truncated protein
along with a low level of wild-type protein is the likely reason for the comparatively mild
phenotype seen in the CEP290 mutant feline.

!92

2.5 Acknowledgments

The authors would like to thank the Michigan State University College of Veterinary
Medicine vivarium staff and Campus Animal Resources for animal care. We would also
like to thank Pragnesh Dave and the Protein Simple technical support team for help with
the WES western assay. Supported by The Grousbeck Family Foundation, MyersDunlap Endowment to Dr. Simon Petersen-Jones, the CVM Center for Feline
Health and Well-Being, and The Cotter Endowment.

!93

REFERENCES

!94

REFERENCES

1.
den Hollander AI, Koenekoop RK, Yzer S, Lopez I, Arends ML, Voesenek KE, et
al. Mutations in the CEP290 (NPHP6) gene are a frequent cause of Leber congenital
amaurosis. American journal of human genetics. 2006;79(3):556-61.
2.
Bainbridge JW, Mehat MS, Sundaram V, Robbie SJ, Barker SE, Ripamonti C, et
al. Long-term effect of gene therapy on Leber's congenital amaurosis. N Engl J Med.
2015;372(20):1887-97.
3.
Ghazi NG, Abboud EB, Nowilaty SR, Alkuraya H, Alhommadi A, Cai H, et al.
Treatment of retinitis pigmentosa due to MERTK mutations by ocular subretinal injection
of adeno-associated virus gene vector: results of a phase I trial. Hum Genet.
2016;135(3):327-43.
4.
Weleber RG, Pennesi ME, Wilson DJ, Kaushal S, Erker LR, Jensen L, et al.
Results at 2 Years after Gene Therapy for RPE65-Deficient Leber Congenital Amaurosis
and Severe Early-Childhood-Onset Retinal Dystrophy. Ophthalmology. 2016;123(7):
1606-20.
5.
Linberg KA, Lewis GP, Shaaw C, Rex TS, Fisher SK. Distribution of S- and Mcones in normal and experimentally detached cat retina. The Journal of comparative
neurology. 2001;430(3):343-56.
6.
Valente EM, Silhavy JL, Brancati F, Barrano G, Krishnaswami SR, Castori M, et
al. Mutations in CEP290, which encodes a centrosomal protein, cause pleiotropic forms
of Joubert syndrome. Nat Genet. 2006;38(6):623-5.
7.
Baala L, Audollent S, Martinovic J, Ozilou C, Babron MC, Sivanandamoorthy S,
et al. Pleiotropic effects of CEP290 (NPHP6) mutations extend to Meckel syndrome.
American journal of human genetics. 2007;81(1):170-9.
8.
Brancati F, Barrano G, Silhavy JL, Marsh SE, Travaglini L, Bielas SL, et al.
CEP290 mutations are frequently identified in the oculo-renal form of Joubert syndromerelated disorders. American journal of human genetics. 2007;81(1):104-13.
9.
Helou J, Otto EA, Attanasio M, Allen SJ, Parisi MA, Glass I, et al. Mutation
analysis of NPHP6/CEP290 in patients with Joubert syndrome and Senior-Loken
syndrome. J Med Genet. 2007;44(10):657-63.
10.
Frank V, den Hollander AI, Bruchle NO, Zonneveld MN, Nurnberg G, Becker C, et
al. Mutations of the CEP290 gene encoding a centrosomal protein cause MeckelGruber syndrome. Hum Mutat. 2008;29(1):45-52.

!95

11.
Travaglini L, Brancati F, Attie-Bitach T, Audollent S, Bertini E, Kaplan J, et al.
Expanding CEP290 mutational spectrum in ciliopathies. Am J Med Genet A.
2009;149A(10):2173-80.
12.
Ghaffari SR, Rafati M, Ghaffari G, Morra M, Tekin M. Familial intellectual
disability in an Iranian family with a novel truncating mutation in CEP290. Clin Genet.
2014;86(4):387-90.
13.
Wang L, Yang Y, Song J, Mao L, Wei X, Sun Y, et al. Two novel mutations in the
C-terminal region of centrosomal protein 290 (CEP290) result in classic Joubert
syndrome. J Child Neurol. 2015;30(6):772-6.
14.
Narfstrom K. Hereditary progressive retinal atrophy in the Abyssinian cat. J
Hered. 1983;74(4):273-6.
15.
Narfstrom K. Progressive retinal atrophy in the Abyssinian cat. Clinical
characteristics. Invest Ophthalmol Vis Sci. 1985;26(2):193-200.
16.
Narfstrom KL, Nilsson SE, Andersson BE. Progressive retinal atrophy in the
Abyssinian cat: studies of the DC-recorded electroretinogram and the standing potential
of the eye. Br J Ophthalmol. 1985;69(8):618-23.
17.
Narfstrom K, Nilsson SE. Hereditary retinal degeneration in the Abyssinian cat:
correlation of ophthalmoscopic and electroretinographic findings. Doc Ophthalmol.
1985;60(2):183-7.
18.
Narfstrom K, Nilsson SE. Hereditary rod-cone degeneration in a strain of
Abyssinian cats. Prog Clin Biol Res. 1987;247:349-68.
19.
Narfstrom K, Wilen M, Andersson BE. Hereditary retinal degeneration in the
Abyssinian cat: developmental studies using clinical electroretinography. Doc
Ophthalmol. 1988;69(2):111-8.
20.
Jacobson SG, Kemp CM, Narfstrom K, Nilsson SE. Rhodopsin levels and rodmediated function in Abyssinian cats with hereditary retinal degeneration. Exp Eye Res.
1989;49(5):843-52.
21.
Narfstrom K, Arden GB, Nilsson SE. Retinal sensitivity in hereditary retinal
degeneration in Abyssinian cats: electrophysiological similarities between man and cat.
Br J Ophthalmol. 1989;73(7):516-21.
22.
Narfstrom K, Nilsson SE. Morphological findings during retinal development and
maturation in hereditary rod-cone degeneration in Abyssinian cats. Exp Eye Res.
1989;49(4):611-28.

!96

23.
Anderson RE, Maude MB, Nilsson SE, Narfstrom K. Plasma lipid abnormalities in
the abyssinian cat with a hereditary rod-cone degeneration. Exp Eye Res. 1991;53(3):
415-7.
24.
Ehinger B, Narfstrom K, Nilsson SE, van Veen T. Photoreceptor degeneration
and loss of immunoreactive GABA in the Abyssinian cat retina. Exp Eye Res.
1991;52(1):17-25.
25.
Ekesten B, Narfstrom K. Cone positive off-response in normal and dystrophic
cats. Doc Ophthalmol. 1998;97(1):9-21.
26.
Seeliger MW, Narfstrom K. Functional assessment of the regional distribution of
disease in a cat model of hereditary retinal degeneration. Invest Ophthalmol Vis Sci.
2000;41(7):1998-2005.
27.
Narfstrom K, Ehinger B, Bruun A. Immunohistochemical studies of cone
photoreceptors and cells of the inner retina in feline rod-cone degeneration. Vet
Ophthalmol. 2001;4(2):141-5.
28.
Nilsson SF, Maepea O, Alm A, Narfstrom K. Ocular blood flow and retinal
metabolism in abyssinian cats with hereditary retinal degeneration. Invest Ophthalmol
Vis Sci. 2001;42(5):1038-44.
29.
Kang Derwent JJ, Padnick-Silver L, McRipley M, Giuliano E, Linsenmeier RA,
Narfstrom K. The electroretinogram components in Abyssinian cats with hereditary
retinal degeneration. Invest Ophthalmol Vis Sci. 2006;47(8):3673-82.
30.
Padnick-Silver L, Kang Derwent JJ, Giuliano E, Narfstrom K, Linsenmeier RA.
Retinal oxygenation and oxygen metabolism in Abyssinian cats with a hereditary retinal
degeneration. Invest Ophthalmol Vis Sci. 2006;47(8):3683-9.
31.
May CA, Narfstrom K. Choroidal microcirculation in Abyssinian cats with
hereditary rod-cone degeneration. Exp Eye Res. 2008;86(3):537-40.
32.
Thompson S, Whiting RE, Kardon RH, Stone EM, Narfstrom K. Effects of
hereditary retinal degeneration due to a CEP290 mutation on the feline pupillary light
reflex. Vet Ophthalmol. 2010;13(3):151-7.
33.
Narfstrom K, Menotti Raymond M, Seeliger M. Characterization of feline
hereditary retinal dystrophies using clinical, functional, structural and molecular genetic
studies. Vet Ophthalmol. 2011;14 Suppl 1:30-6.
34.
Menotti-Raymond M, David VA, Schaffer AA, Stephens R, Wells D, Kumar-Singh
R, et al. Mutation in CEP290 discovered for cat model of human retinal degeneration. J
Hered. 2007;98(3):211-20.

!97

35.
Menotti-Raymond M, David VA, Schaffer AA, Stephens R, Wells D, Kumar-Singh
R, et al. Mutation in CEP290 discovered for cat model of human retinal degeneration. J
Hered. 2007;98(3):211-20.
36.
Betleja E, Cole DG. Ciliary trafficking: CEP290 guards a gated community. Curr
Biol. 2010;20(21):R928-31.
37.
Baye LM, Patrinostro X, Swaminathan S, Beck JS, Zhang Y, Stone EM, et al. The
N-terminal region of centrosomal protein 290 (CEP290) restores vision in a zebrafish
model of human blindness. Hum Mol Genet. 2011;20(8):1467-77.
38.
Minella AL, Mowat FM, Willett KL, Sledge D, Bartoe JT, Bennett J, et al.
Differential targeting of feline photoreceptors by recombinant adeno-associated viral
vectors: implications for preclinical gene therapy trials. Gene therapy. 2014;21(10):
913-20.

!98

CHAPTER 3

CENTRAL RETINA PRESERVATION IN rdAc CATS

In review with the Veterinary Ophthalmology journal.

Author Contributions
Conceived and designed the experiments: Andrea L. Minella, Simon M. PetersenJones. Performed the experiments: ALM, Laurence M. Occelli. Analyzed the data: ALM.
Wrote the paper: ALM, SMP-J. Provided input for writing the manuscript: LMO, Kristina
Narström.

!99

3.1 Abstract

Objective. Children with Leber Congenital Amaurosis (LCA) due to CEP290 mutations
show characteristic macular preservation. Spectral domain optical coherence tomography (SD-OCT) is a non-invasive technique to investigate retinal structural changes.
Loss of integrity of the ellipsoid zone (EZ) on OCT in people with retinal disease has
been associated with loss of visual function and is a useful measure of retinal disease
progression. We hypothesized that rdAc felines with Cep290 mutation would have a
similar pattern of degeneration, with relative central retinal preservation associated with
maintenance of the EZ. Procedures. Fundus imaging, confocal scanning laser ophthalmoscopy, and SD-OCT cross sectional imaging was performed on 11 rdAc cats
ranging from 6 months to 10 years of age. Images were collected from the area centralis, visual streak, and the mid-superior and mid-inferior retina. Receptor plus (REC+,
encompassing the entire length of photoreceptors) thicknesses were measured. Regional rates of degeneration were determined by regression analysis and compared using unpaired t-tests. The EZ was evaluated for presence, absence, or loss of definition.
Results. RdAc cats showed REC+ thinning over time in all regions. The area centralis
and visual streak had a slower rate of thinning than the mid-peripheral retina. There was
loss of integrity of the EZ initially in the more peripheral regions while its integrity was
maintained in the area centralis and visual streak at all ages studied. Conclusions.
rdAc cats show preservation of the central retina with maintenance of EZ integrity, which
recapitulates findings in human patients.

!100

3.2 Introduction

Progressive Retinal Atrophy (PRA) is a group of genetically heterogenous retinal
degenerative diseases that cause blindness in cats and dogs. Though more common in
dogs, a well-described form of autosomal recessive PRA, designated rdAc, segregates
in the feline population across several breeds and is the result of a mutation in the centrosomal protein 290kDa (Cep290) gene.(1-3) The affected cats have a relatively lateonset, slowly progressing retinal degeneration eventually leading to blindness.(4-8)
Mutations in CEP290 in people are associated with a wide spectrum of phenotypes dependent on the effect of the mutation on gene function. The most severe result
in early lethality or syndromic conditions (such as Joubert syndrome, Meckel syndrome
and Senior-Løken syndrome).(9-16) Milder phenotypes are of a non-syndromic retinal
dystrophy.(17-19) The most common retinal phenotype is Leber Congenital Amaurosis
(LCA), which is a devastating disease and a leading cause of childhood blindness.(20)
Mutations in CEP290 are the commonest cause of LCA accounting for about 20% of
cases.(21) There are currently no treatments for LCA outside of clinical trials, and no
clinical trials aimed at LCACEP290. The rdAc cat therefore is a valuable model for this
human retinal dystrophy, allowing for the study of molecular mechanisms, phenotype,
and treatments that may benefit both veterinary and human patients.
A thorough characterization of disease phenotype and identification of biomarkers of disease progression, which can be used to assess treatment efficacy, are necessary for animal models intended for use in the development of translational therapies.
Several modalities are available for this purpose, with electroretinographic, histological,

!101

and ultrastructural changes well described in the rdAc cat.(4, 6-8, 22-40) However, investigations using a newer modality, spectral domain optical coherence tomography
(SD-OCT), have not been published for this model. SD-OCT provides a valuable imaging technique that allows for the in vivo monitoring of retinal health by enabling visualization of retinal layers and retinal architecture. The images can match those of low
power histological sections. Changes in layer thickness and in the visualization of the
reflective zones from photoreceptor inner and outer segments can be used for longitudinal monitoring of disease progression, photoreceptor health, and for targeting therapeutic interventions and monitoring treatment efficacy. In the normal retina, a series of
zones can be distinguished between the external limiting membrane (ELM) and the interdigitation zone (IZ). The IZ represents the tips of outer segments with enveloping
retinal pigment epithelial cell processes.(41) Loss of definition of one of these zones,
the ellipsoid zone (EZ), has been correlated with functional vision loss in people with
retinal disease.(42-44) This zone represents the ellipsoid region of photoreceptor inner
segments and is thought to arise from laser light reflection from mitochondria in this region.(45) EZ integrity has been suggested as a marker to monitor disease progression
and could also be used to select regions to target with therapies such as gene augmentation therapy in human patients.(46-49) The EZ has not been studied in detail in the cat
but could be a valuable tool for the same purposes in feline models.
Humans with LCACEP290 have a distinctive pattern of retinal degeneration with
sparing of the central retina (i.e. macula) until later stages of disease.(17) SD-OCT can
be used to monitor these changes and has implications for judging whether there are
still photoreceptors remaining and if so their location to target with treatment.(50) The

!102

central retina in humans contains the macula within which is the fovea and foveola.
These are regions of high photoreceptor, in particular cone, density with the centermost
part, the foveola, containing exclusively cones, that are important for high visual acuity.
Degeneration of this macular region causes severe impairment of vision. Therefore
therapy aiming to conserve that retinal area is of particular importance.
Laboratory rodents are commonly used in the study of hereditary retinal disease
but they do not have a central region of higher photoreceptor density that is similar to
the macula. This is a serious limitation of these species for translational studies. Cats
and dogs on the other hand have a semi-homologous region known as the area centralis that allows for the study of regions of high photoreceptor density making them important models of human disease. Given the central, macular preservation seen in
LCACEP290, a large animal model with a homologous retinal region is imperative for understanding disease mechanisms and studying treatments. Previous studies in the rdAc
cat have suggested that the central retina degenerated at a slower rate than the peripheral retina and that there is functional preservation, as assessed by multifocal ERG, in
the central retinal region.(6, 30)
The tapetal reflectivity changes in rdAc cats includes the appearance of patchy
hyporeflectivity in earlier disease stages prior to the development of more extensive hyperreflectivity. The central retina, including the area centralis and visual streak, will often
appear hyporeflective compared to the more peripheral retina suggestive of a relative
preservation of the central region (Figure 3.1). SD-OCT is an ideal tool for longitudinal
comparison of regional rates of degeneration and for further detailed investigation of regional differences in rate of photoreceptor degeneration.

!103

Figure 3.1: Tapetal reflectivity changes in the rdAC feline. A. The wild-type feline
fundus shows the distinctive feline tapetum lucidum and well defined vasculature. B. A
fundus image from a 1.5 year-old rdAC feline. In earlier stages of disease the rdAC fundus often shows patchy changes in tapetal reflectivity. C. A fundus image from a 6 yearold rdAC feline. In later stages of disease the fundus shows blood vessel attenuation
and a characteristic tapetal hyporeflectivity of the central fundus that extends across the
area centralis and visual streak.
In this study, we used SD-OCT to study the regional rates of degeneration to determine if rdAc cats show the same pattern of degeneration as people with LCACEP290
and to evaluate the EZ as a possible biomarker of retinal preservation in the rdAc feline.
We hypothesized that rdAc cats will show central retinal sparing on SD-OCT with corresponding maintenance of EZ definition. If true, this would further validate and direct future studies utilizing this feline disease as a model to test therapies aimed at preserving
photoreceptors and vision in patients with CEP290 mutations.

!104

3.3 Methods

3.3.1 Animals
RdAc cats maintained as a breeding colony at Michigan State University were
utilized in this study . The genotypes of colony cats was confirmed utilized a standard
genotyping assay developed in our laboratory that includes a polymerase chain reaction
(PCR) to amplify the mutant region followed by a restriction enzyme digestion to result
in differential cutting of the mutant region. Cutting with the TasI/Tsp509I enzyme (NEB,
Beverly, MA, USA) results in cutting of the wild-type allele but not the mutant allele, allowing for definitive identification of wild-type, heterozygous, and homozygous mutant
animals. They were maintained under 12:12hr light dark cycles and fed ad libitum with
Purina Cat Chow (Nestlé Purina, Wilkes-Barre, PA). Standard complete eye examinations including indirect ophthalmoscopy and wide-field fundus imaging (RetCam II. Clarity Medical Systems, Pleasanton, CA, USA) were performed at regular intervals. All procedures were approved by the Michigan State University Institutional Animal Care and
Use committee and were conducted in accordance with the Association for Research in
Vision and Ophthalmology statement on the use of animals.

3.3.2 Scanning laser ophthalmoscopy and spectral domain optical coherence tomography imaging
A standardized spectral domain-optical coherence tomography (SD-OCT; Spectralis OCT+HRA, Heidelberg Engineering Inc., Heidelberg, Germany) protocol was developed and performed on the right eye of 11 RdAc cats under general anesthesia. A

!105

total of 23 OCT examinations were performed covering ten time-points from 6 months of
age to 10 years of age (Table 3.1).

Table 3.1: Animal numbers and design. 11 mutant cats that were part of an
rdAc breeding colony were used to collect 23 SD-OCT scans over an age range
of 6 months to 10 years old. A. The numbers of cats in each age group and sex of
those cats. B. A visual depiction of the distribution of the scans collected.
Anesthesia was induced by isoflurane delivered by mask or induction box (IsoFlo, Abbott Laboratories, North Chicago, IL, USA). Following anesthesia induction, cats were
intubated and maintained on isoflurane delivered in oxygen for the entire procedure.
They were positioned in sternal recumbency on a heating pad for thermoregulation and
monitored with a pulse oximeter (Vet/Ox 4400, Heska Corporation, Fort Collins, CO).
Mydriasis was induced by topical application of tropicamide (Tropicamide Ophthalmic
!106

Solution UPS 1%®, Falcon Pharmaceuticals Ltd., Fort Worth, TX, USA). The eyes were
maintained in primary gaze using a stay suture placed in the perilimbal conjunctiva.
Confocal scanning laser ophthalmoscopy (cSLO) followed by SD-OCT was performed.
The corneas were kept constantly moist with sterile eye wash applied regularly throughout the procedure. For all scans, the retinal vasculature was used for orientation. The
Heidelberg Eye Explorer Software (Heidelberg Engineering Inc., Heidelberg, Germany),
which has a function to align scans was used to allow the same region to be imaged in
repeat scans.

3.3.3 Receptor plus thickness evaluation
The standard SD-OCT protocol used includes cross-sectional volume scan images collected from the area centralis, visual streak, and the inferior and superior midperipheries (Figure 3.2A). The photoreceptor structural preservation was evaluated by
measuring the thickness of the receptor plus (REC+). The REC+ extends from the outer
plexiform layer to the IZ and therefore represents the full length of the photoreceptor cell
(Figure 3.2B). The REC+ layer was measured for each cat, in each region, at each timepoint, in triplicate and the measurements from each region averaged. All measurements
were conducted manually by the same investigator and areas under major blood vessels were avoided.

!107

Figure 3.2: Regional and SD-OCT Measurements. A. Circles indicate where measurements were taken for REC+ evaluation. Measurements were taken from the area
centralis (AC) with retinal vasculature utilized as landmarks. The visual streak (VS) was
then assessed as the mirror image region on the opposite side of the vasculature. The
superior and inferior mid-peripheries (SP and IP) were measured superior or inferior to
the optic nerve head, respectively, at a distance of 5,000 microns from the edge of the
optic nerve head. B. Photoreceptor degeneration was assessed using the receptor plus
(REC+) layer indicated in by the yellow line. This layer represents the entire length of
the photoreceptor cell as it extends from the outer plexiform layer to the interdigitation
between the photoreceptor cells and the retinal pigment epithelium. The ellipsoid zone,
indicated by the green box, was monitored for presence or absence across all retinal
sections.

!108

The rate of degeneration over time was calculated for each region by performing
a linear regression on the REC+ thickness measurements. Analysis of differences between the rates of degeneration across different retinal regions was performed by comparing the slopes of the regressions using un-paired two-tailed Student’s t-tests with
significance set at p < 0.05, after all data passed the Shapiro-Wilk test for normality.
Bonferroni correction was applied to account for the multiple comparisons. All regions
were compared separately against the measurements from the area centralis. The area
centralis and visual streak measurements were then averaged to represent the central
retina and compared against the mid-peripheral retina, calculated by averaging the values for the superior and inferior mid-peripheries. Data was then graphed using SigmaPlot12 statistical software (Systat Software Inc., Chicago, IL, USA).
Color heat maps to illustrate REC+ thickness across the fundus were developed
using the Heidelberg Eye Explorer Software (Heidelberg Engineering Inc., Heidelberg,
Germany). Heat maps were created by tracing two lines, the proximal line following the
outer plexiform layer and a distal line following the IZ. The software could then calculate
the REC+ thickness across the entire section. This was performed for all sections within
each selected volume scan.

3.3.4 Ellipsoid zone assessment
The EZ was visually assessed for presence, absence, or loss of definition, in all
cats for all time-points (Figure 3.2B). It was mapped by following the layer across sections and marking on the corresponding cSLO fundus image where the layer was no
longer discernible. This was performed in all sections across a chosen volume scan of

!109

61 sections. The marks for each section were then connected to create a map of the
region over which there was discernible uninterrupted EZ. This was then visually compared to the heat map created from the same volume scan.

!110

3.4 Results

Color fundus images and infrared cSLO images captured from cats at various
disease stages showed an initial patchy tapetal hyporeflectivity as one of the earliest
changes. With progression, they developed blood vessel attenuation and more obvious
taptetal hyperreflectivity in the peripheral regions. With more advanced disease a hyporeflective band involving the area centralis and visual streak became more apparent
(Figure 3.1).
The REC+ layer thickness of rdAc cats decreased over time in all regions (Figure
3.3 and 3.4). However, the central retina (area centralis and visual streak) showed a
significantly slower rate of thinning of the REC+ layer than the combined mid-peripheral
retinal regions (superior and inferior mid-peripheries) (p=0.00016). When broken down
by region, the superior mid-periphery was found to have a significantly faster rate of
thinning than the area centralis (p=7.20e-5). Though the difference was not statistically
significant (p=0.14), the slope indicating thinning of the inferior mid-periphery REC+ was
also steeper than that of the central retinal regions. The rates of degeneration of the two
central retinal regions, the area centralis and visual streak, were similar over the time
period studied. (Figure 3.4)

!111

Figure 3.3: Preservation of the central retina. A. Wide-field color fundus images
of the corresponding eyes and time-points (6 month-old pre-degeneration, 2 yearold early-stage, 6 year-old mid-stage, and 9 year-old later-stage) in B, C, and D,
taken from four different cats. Patchy tapetal reflectivity changes in earlier stages
of disease progress to hyporeflectivity in the central retina (extending across the
area centralis and visual streak) and hyperreflectivity in the peripheral fundus, with
eventual hyperreflectivity of the central fundus as well in late stages of disease.
Progressive blood vessel attenuation, a hallmark of progressive retinal atrophy, can
also be seen. B. cSLO images corresponding to the heat maps in C without color
overlay. The changes in reflectivity noted in A are also apparent here. C. Heat
maps derived from the REC+ layer thickness show that despite pan retinal
degeneration there is preservation of REC+ thickness in the central retina even in
later stages of disease. D. Representative cross-sectional images taken from the
area centralis show REC+ layer thinning over time but with remaining measurable
REC+ in this area even in later stages of disease. Yellow vertical lines indicate the
REC+ layer and illustrate progressive thinning, from 108 microns at the earliest
stage, down to 103 microns, then 74 microns, and finally 67 microns in subsequent
stages in these examples.
!112

Figure 3.4: Regional rates of degeneration. A. The central retina (combined area
centralis and visual streak) degenerates at a slower rate than the mid-peripheral retina
(combined superior and inferior mid-peripheries). B. There is no difference in the rate
of degeneration between the area centralis and visual streak, however, the superior
and inferior mid-peripheries degenerate at faster rates than the area centralis based
on slope, with a significant difference in rate of degeneration between the area centralis and superior mid-periphery. C. The range of data is shown for the area centralis,
visual streak, superior periphery, and inferior periphery REC+ thickness data sets.
!113

The EZ could be clearly seen on cross sectional images in young cats with early
stages of disease (Figure 3.5A). With progression, patchy loss of integrity became apparent in some retinal regions. This patchy loss in integrity was first apparent in the midperipheral retina while in the central retina the EZ remained clearly discernible. Once
cats reached a later stage of disease characterized by more significant pan retinal thinning, there was severe to complete loss of EZ integrity in the mid-peripheral retina,
however, even at this late stage of disease the integrity of the EZ was readily visualized
within the central region (Figure 3.5B). This area of retained EZ integrity closely corresponded to the region of preserved REC+ thickness as illustrated by superimposition of
the extent of the EZ integrity on the REC+ thickness heat map (Figure 3.6).

!114

Figure 3.5: Ellipsoid zone integrity deteriorates with progressive stages of disease. A. In early stages of disease the ellipsoid zone (EZ) can be visualized and followed across all sections, showing well preserved integrity across the entire length of
the example scan (yellow arrow). B. In later stages of disease, patchy or complete loss
of EZ integrity is apparent in the peripheral retina (towards the left of the image with
the left yellow box indicating a region of EZ loss) . However, the EZ was visible in the
central retina even in this later stage of disease despite pan retinal thinning (right of
the image with the right yellow box indicating a region of EZ preservation).

!115

Figure 3.6: Preserved ellipsoid zone integrity corresponds to preserved central
REC+ thickness. A. When the region of continuous ellipsoid zone (EZ) integrity is
mapped across the fundus of a 9 year-old late-stage cat, central maintenance is apparent. B. This region corresponds closely with the region of REC+ thickness preservation,
suggesting that preservation of EZ integrity can be used as a marker of regions of preserved photoreceptor cells.

!116

3.5 Discussion

Measurement of the thickness of the REC+ layer and construction of heat maps
of the REC+ clearly demonstrate that in the rdAc cat with advancing disease this layer
remains notably thicker in the area centralis and visual streak than in the more peripheral retinal regions. This is in keeping with previous descriptions of the phenotype and
confirms the clinical impression from indirect ophthalmoscopy and wide-angle color fundus photography where the difference in tapetal reflectivity between the central and peripheral tapetal fundus suggests central retinal preservation.(6, 30) The central retina in
normal cats is thicker than the more peripheral retina so it is conceivable that the apparent preservation of REC+ thickness simply reflects that the region had a greater
number of starting photoreceptors and that the rate of thinning was not different from
the more peripheral retina. However, plotting the REC+ thickness against age shows
that in fact the rate of thinning in the central retina is significantly slower than that in the
combined mid-peripheral retinal regions. When the rate of REC+ thinning of the four regions that were measured are examined separately the superior mid-peripheral retina
shows the greatest rate of thinning and is significantly different to that in the area centralis or visual streak. However, the rate of thinning in the inferior mid-peripheral region
was not significantly different to that of the central retinal regions. Study of larger numbers of animals would be required to be sure that this latter finding was not a type II statistical error. The central retinal preservation in the rdAc cat mirrors the finding in people
with LCA due to CEP290 mutations thus supporting the cat as a model for this devastating disease.

!117

The relative preservation of the area centralis and visual streak may be because
these regions have a higher cone density than the more peripheral retina and cones
degenerate at a slower rate than rods in CEP290 retinopathies.(51, 52) An investigation
of the relative rod and cone numbers over time in the area of preservation would be required to see if there were larger numbers of surviving cones than rods and that another
factor such as a protective effect of having a higher number of photoreceptors was not
playing a role in the slower rate of degeneration in this region. Furthermore, given the
innate difference in photoreceptor density between the central retina and regions outside of the central retina, proper identification of the central retina as well as accurate
alignment of scans from one session to the next is important to ensure accurate longitudinal evaluation. Utilizing retinal vasculature to orient the investigator to the central
retina and then utilizing the OCT software’s ability to align scans across sessions for
example, are therefore important study design components to consider.
This study also showed that the EZ is preserved in the central retina until late
stages of disease, corresponding to the region of REC+ preservation. In human patients
the preserved continuity of the EZ correlates with remaining visual function.(42-44) In
human patients with established retinal degeneration therapeutic interventions such as
gene augmentation therapy must target remaining photoreceptors that can still be rescued. Retinal imaging (such as SD-OCT) to identify the location of such photoreceptors
is important.(53) Large animal models that have similar changes detectable by SD-OCT
afford the opportunity to evaluate the safety and efficacy of such therapies in a retina
with established disease. This will more closely reflect the situation in clinical patients

!118

rather than treating young animals where there has been little or no loss of photoreceptors.
These parameters, differences in rate of degeneration of the REC+ layer and EZ
integrity changes, may be valuable in pre-clinical studies as markers of disease progression and/or treatment success. It is important to note however that inter-observer
and inter-session reproducibility should be considered. In this study a single investigator
conducted all measurements to eliminate the possible effects of inter-observer differences and maximize reproducibility. For maximum utility of these parameters in future
studies we suggest similar efforts to ensure consistency across measurements. Moreover, in longer-term studies in which study cats age significantly throughout the course
of the study, age-related retinal changes should also be considered as a possible confounding factor. If the study length is extensive enough that normal age-related changes
may be present, we suggest that measurements also be taken in wild-type cats such
that changes in mutant cats can be normalized to wild-type changes.
In conclusion, we have further defined the central retinal preservation in the rdAc
cat, which shows a similar pattern of degeneration to that reported in the literature in
human LCACEP290 patients. Furthermore, we show that integrity of the EZ is maintained
in the better preserved retinal regions providing the opportunity to use this as a marker
of photoreceptor morphological preservation. This further supports the cat as a useful
large animal model for studies of retinal dystrophy including future translational studies
investigating potential therapies.

!119

3.6 Acknowledgements

The authors would like to thank Dhruv Sharma and the Michigan State University Center for Statistical Training and Consulting for their assistance with the statistical analysis
and the Michigan State University Campus Animal Resources for animal care. Supported by The Grousbeck Family Foundation, Myers-Dunlap Endowment to Dr. Simon Petersen-Jones, the CVM Center for Feline Health and Well-Being, and The Cotter Endowment.

!120

REFERENCES

!121

REFERENCES

1.
Menotti-Raymond M, David VA, Schaffer AA, Stephens R, Wells D, Kumar-Singh
R, et al. Mutation in CEP290 discovered for cat model of human retinal degeneration. J
Hered. 2007;98(3):211-20.
2.
Narfstrom K, David V, Jarret O, Beatty J, Barrs V, Wilkie D, et al. Retinal degeneration in the Abyssinian and Somali cat (rdAc): correlation between genotype and phenotype and rdAc allele frequency in two continents. Vet Ophthalmol. 2009;12(5):285-91.
3.
Menotti-Raymond M, David VA, Pflueger S, Roelke ME, Kehler J, O'Brien SJ, et
al. Widespread retinal degenerative disease mutation (rdAc) discovered among a large
number of popular cat breeds. Vet J. 2010;186(1):32-8.
4.
Narfstrom K. Hereditary progressive retinal atrophy in the Abyssinian cat. J
Hered. 1983;74(4):273-6.
5.
Narfstrom LK, Nilsson SE. Progressive retinal atrophy in the Abyssinian cat: an
update. Vet Rec. 1983;112(22):525-6.
6.
Narfstrom K. Progressive retinal atrophy in the Abyssinian cat. Clinical characteristics. Invest Ophthalmol Vis Sci. 1985;26(2):193-200.
7.
Narfstrom K, Nilsson SE. Hereditary rod-cone degeneration in a strain of
Abyssinian cats. Prog Clin Biol Res. 1987;247:349-68.
8.
Kang Derwent JJ, Padnick-Silver L, McRipley M, Giuliano E, Linsenmeier RA,
Narfstrom K. The electroretinogram components in Abyssinian cats with hereditary retinal degeneration. Invest Ophthalmol Vis Sci. 2006;47(8):3673-82.
9.
Valente EM, Silhavy JL, Brancati F, Barrano G, Krishnaswami SR, Castori M, et
al. Mutations in CEP290, which encodes a centrosomal protein, cause pleiotropic forms
of Joubert syndrome. Nat Genet. 2006;38(6):623-5.
10.
Baala L, Audollent S, Martinovic J, Ozilou C, Babron MC, Sivanandamoorthy S,
et al. Pleiotropic effects of CEP290 (NPHP6) mutations extend to Meckel syndrome.
American journal of human genetics. 2007;81(1):170-9.
11.
Brancati F, Barrano G, Silhavy JL, Marsh SE, Travaglini L, Bielas SL, et al.
CEP290 mutations are frequently identified in the oculo-renal form of Joubert syndromerelated disorders. American journal of human genetics. 2007;81(1):104-13.

!122

12.
Helou J, Otto EA, Attanasio M, Allen SJ, Parisi MA, Glass I, et al. Mutation analysis of NPHP6/CEP290 in patients with Joubert syndrome and Senior-Loken syndrome.
J Med Genet. 2007;44(10):657-63.
13.
Frank V, den Hollander AI, Bruchle NO, Zonneveld MN, Nurnberg G, Becker C, et
al. Mutations of the CEP290 gene encoding a centrosomal protein cause Meckel-Gruber syndrome. Hum Mutat. 2008;29(1):45-52.
14.
Travaglini L, Brancati F, Attie-Bitach T, Audollent S, Bertini E, Kaplan J, et al. Expanding CEP290 mutational spectrum in ciliopathies. Am J Med Genet A.
2009;149A(10):2173-80.
15.
Ghaffari SR, Rafati M, Ghaffari G, Morra M, Tekin M. Familial intellectual disability in an Iranian family with a novel truncating mutation in CEP290. Clin Genet.
2014;86(4):387-90.
16.
Wang L, Yang Y, Song J, Mao L, Wei X, Sun Y, et al. Two novel mutations in the
C-terminal region of centrosomal protein 290 (CEP290) result in classic Joubert syndrome. J Child Neurol. 2015;30(6):772-6.
17.
Cideciyan AV, Aleman TS, Jacobson SG, Khanna H, Sumaroka A, Aguirre GK, et
al. Centrosomal-ciliary gene CEP290/NPHP6 mutations result in blindness with unexpected sparing of photoreceptors and visual brain: implications for therapy of Leber
congenital amaurosis. Hum Mutat. 2007;28(11):1074-83.
18.
Coppieters F, Lefever S, Leroy BP, De Baere E. CEP290, a gene with many
faces: mutation overview and presentation of CEP290base. Hum Mutat. 2010;31(10):
1097-108.
19.
Littink KW, Pott JW, Collin RW, Kroes HY, Verheij JB, Blokland EA, et al. A novel
nonsense mutation in CEP290 induces exon skipping and leads to a relatively mild retinal phenotype. Invest Ophthalmol Vis Sci. 2010;51(7):3646-52.
20.
Perrault I, Delphin N, Hanein S, Gerber S, Dufier JL, Roche O, et al. Spectrum of
NPHP6/CEP290 mutations in Leber congenital amaurosis and delineation of the associated phenotype. Hum Mutat. 2007;28(4):416.
21.
den Hollander AI, Koenekoop RK, Yzer S, Lopez I, Arends ML, Voesenek KE, et
al. Mutations in the CEP290 (NPHP6) gene are a frequent cause of Leber congenital
amaurosis. American journal of human genetics. 2006;79(3):556-61.
22.
Narfstrom KL, Nilsson SE, Andersson BE. Progressive retinal atrophy in the
Abyssinian cat: studies of the DC-recorded electroretinogram and the standing potential
of the eye. Br J Ophthalmol. 1985;69(8):618-23.

!123

23.
Narfstrom K, Nilsson SE. Hereditary retinal degeneration in the Abyssinian cat:
correlation of ophthalmoscopic and electroretinographic findings. Doc Ophthalmol.
1985;60(2):183-7.
24.
Narfstrom K, Nilsson SE. Progressive retinal atrophy in the Abyssinian cat. Electron microscopy. Invest Ophthalmol Vis Sci. 1986;27(11):1569-76.
25.
Narfstrom K, Wilen M, Andersson BE. Hereditary retinal degeneration in the
Abyssinian cat: developmental studies using clinical electroretinography. Doc Ophthalmol. 1988;69(2):111-8.
26.
Jacobson SG, Kemp CM, Narfstrom K, Nilsson SE. Rhodopsin levels and rodmediated function in Abyssinian cats with hereditary retinal degeneration. Exp Eye Res.
1989;49(5):843-52.
27.
Narfstrom K, Arden GB, Nilsson SE. Retinal sensitivity in hereditary retinal degeneration in Abyssinian cats: electrophysiological similarities between man and cat. Br
J Ophthalmol. 1989;73(7):516-21.
28.
Ehinger B, Narfstrom K, Nilsson SE, van Veen T. Photoreceptor degeneration
and loss of immunoreactive GABA in the Abyssinian cat retina. Exp Eye Res.
1991;52(1):17-25.
29.
Ekesten B, Narfstrom K. Cone positive off-response in normal and dystrophic
cats. Doc Ophthalmol. 1998;97(1):9-21.
30.
Seeliger MW, Narfstrom K. Functional assessment of the regional distribution of
disease in a cat model of hereditary retinal degeneration. Invest Ophthalmol Vis Sci.
2000;41(7):1998-2005.
31.
Narfstrom K, Ehinger B, Bruun A. Immunohistochemical studies of cone photoreceptors and cells of the inner retina in feline rod-cone degeneration. Vet Ophthalmol.
2001;4(2):141-5.
32.
Nilsson SF, Maepea O, Alm A, Narfstrom K. Ocular blood flow and retinal metabolism in abyssinian cats with hereditary retinal degeneration. Invest Ophthalmol Vis
Sci. 2001;42(5):1038-44.
33.
Ekesten B, Narfstrom K. Abnormal dark-adapted ERG in cats heterozygous for a
recessively inherited rod-cone degeneration. Vet Ophthalmol. 2004;7(1):63-7.
34.
Vaegan, Narfstrom K. Optimal discrimination of an Abyssinian cat recessive retinal degeneration: a short electroretinogram protocol is more efficient than a long one.
Clin Exp Ophthalmol. 2004;32(6):619-25.

!124

35.
Hyman JA, Vaegan, Lei B, Narfstrom KL. Electrophysiologic differentiation of
homozygous and heterozygous Abyssinian-crossbred cats with late-onset hereditary
retinal degeneration. Am J Vet Res. 2005;66(11):1914-21.
36.
May CA, Lutjen-Drecoll E, Narfstrom K. Morphological changes in the anterior
segment of the Abyssinian cat eye with hereditary rod-cone degeneration. Curr Eye
Res. 2005;30(10):855-62.
37.
Vaegan, Narfstrom K. A(max) is the best a-wave measure for classifying Abyssinian cat rod/cone dystrophy. Doc Ophthalmol. 2005;111(1):33-8.
38.
May CA, Narfstrom K. Choroidal microcirculation in Abyssinian cats with hereditary rod-cone degeneration. Exp Eye Res. 2008;86(3):537-40.
39.
Vaegan, Narfstrom K. Amax to scotopic Imax diagnoses feline hereditary rod
cone degeneration more efficiently than any other combination of long protocol electroretinogram parameters. Doc Ophthalmol. 2008;117(1):1-12.
40.
May CA, Narfstrom K. Retinal capillary morphology in the Abyssinian cat with
hereditary retinal degeneration. Exp Eye Res. 2012;99:45-7.
41.
Banaee T. Re: Staurenghi et al.: Proposed lexicon for anatomic landmarks in
normal posterior segment spectral-domain optical coherence tomography: the IN*OCT
consensus (Ophthalmology 2014;121:1572-8). Ophthalmology. 2015;122(7):e40.
42.
Hood DC, Zhang X, Ramachandran R, Talamini CL, Raza A, Greenberg JP, et al.
The inner segment/outer segment border seen on optical coherence tomography is less
intense in patients with diminished cone function. Invest Ophthalmol Vis Sci.
2011;52(13):9703-9.
43.
Wu Z, Ayton LN, Guymer RH, Luu CD. Relationship between the second reflective band on optical coherence tomography and multifocal electroretinography in agerelated macular degeneration. Invest Ophthalmol Vis Sci. 2013;54(4):2800-6.
44.
Wu Z, Ayton LN, Guymer RH, Luu CD. Second reflective band intensity in agerelated macular degeneration. Ophthalmology. 2013;120(6):1307-8 e1.
45.
Spaide RF, Curcio CA. Anatomical correlates to the bands seen in the outer
retina by optical coherence tomography: literature review and model. Retina.
2011;31(8):1609-19.
46.
Fischer MD, Fleischhauer JC, Gillies MC, Sutter FK, Helbig H, Barthelmes D. A
new method to monitor visual field defects caused by photoreceptor degeneration by
quantitative optical coherence tomography. Invest Ophthalmol Vis Sci. 2008;49(8):361721.

!125

47.
Birch DG, Locke KG, Wen Y, Locke KI, Hoffman DR, Hood DC. Spectral-domain
optical coherence tomography measures of outer segment layer progression in patients
with X-linked retinitis pigmentosa. JAMA Ophthalmol. 2013;131(9):1143-50.
48.
Mathew R, Richardson M, Sivaprasad S. Predictive value of spectral-domain optical coherence tomography features in assessment of visual prognosis in eyes with
neovascular age-related macular degeneration treated with ranibizumab. Am J Ophthalmol. 2013;155(4):720-6, 6 e1.
49.
Sujirakul T, Lin MK, Duong J, Wei Y, Lopez-Pintado S, Tsang SH. Multimodal
Imaging of Central Retinal Disease Progression in a 2-Year Mean Follow-up of Retinitis
Pigmentosa. Am J Ophthalmol. 2015;160(4):786-98 e4.
50.
Jacobson SG, Aleman TS, Cideciyan AV, Sumaroka A, Schwartz SB, Windsor
EA, et al. Identifying photoreceptors in blind eyes caused by RPE65 mutations: Prerequisite for human gene therapy success. Proc Natl Acad Sci U S A. 2005;102(17):
6177-82.
51.
Pasadhika S, Fishman GA, Stone EM, Lindeman M, Zelkha R, Lopez I, et al. Differential macular morphology in patients with RPE65-, CEP290-, GUCY2D-, and AIPL1related Leber congenital amaurosis. Invest Ophthalmol Vis Sci. 2010;51(5):2608-14.
52.
Cideciyan AV, Rachel RA, Aleman TS, Swider M, Schwartz SB, Sumaroka A, et
al. Cone photoreceptors are the main targets for gene therapy of NPHP5 (IQCB1) or
NPHP6 (CEP290) blindness: generation of an all-cone Nphp6 hypomorph mouse that
mimics the human retinal ciliopathy. Human molecular genetics. 2011;20(7):1411-23.
53.
Jacobson SG, Aleman TS, Cideciyan AV, Sumaroka A, Schwartz SB, Windsor
EA, et al. Identifying photoreceptors in blind eyes caused by RPE65 mutations: Prerequisite for human gene therapy success. ProcNatlAcadSciUSA. 2005;102(17):6177-82.

!126

CHAPTER 4
EVALUATION OF A CRISPR-CAS9 NUCLEASE GENOME EDITING TREATMENT
AGAINST THE FELINE CEP290 MUTATION USING A NEWLY DEVELOPED
IN VITRO TOOL

Author Contributions
Conceived and designed the experiments: Andrea L. Minella (ALM), Marie-Claude
Senut (M-CS), Steve Suhr (SS), Simon M. Petersen-Jones (SMP-J) . Performed the
experiments: ALM, M-CS, SS. Analyzed the data: ALM, SS. Wrote the chapter: ALM,
SS, SMP-J.
!127

4.1. Introduction

The CEP290 gene encodes a ciliary protein that localizes to the interconnecting
cilium of rod and cone photoreceptors and is integral for proper transport between the
inner and outer segments.(1) The large size of this gene precludes packaging of the
transcript into the gene therapy vector of choice for retinal therapies, the adenoassociated viral (AAV) vector. Other vector types that could accommodate larger
payloads have shown poor retinal transduction, making gene therapy based treatments
for CEP290 retinopathies challenging. Alternatively, genome editing techniques that
could allow direct “repair” of the CEP290 gene show promise while circumventing the
size limitations of AAV packaging.
A method of genome editing, the Clustered Regularly Interspersed Short
Palindromic Repeats (CRISPR) Cas9 nuclease system has been shown to be able to
correct defects in human cell lines and provides a more easily engineered, scalable,
and affordable method of genome manipulation. The CRISPR system is a component of
bacterial-immunity that has been repurposed as a promising genome editing tool. This
method of editing is an appealing option for LCA treatments, including LCACEP290.
Before such treatments can reach human clinical trials, however, extensive in vitro and
animal model testing is necessary for proof-of-principle and safety assurance.(2)
A spontaneous CEP290 mutation in cats causes a retinal degeneration that has
been well characterized and shows promise as a model for LCACEP290.(3-6) This
mutation is an intronic T>G substitution that allows for the usage of a GT downstream of
the wild-type splice donor site of Exon 50 to be used as a new donor site (Figure 4.1).

!128

This results in a four base-pair insert in the transcript, a frameshift, and a premature
stop codon.(7) This leads to a slow autosomal recessively-inherited retinal
degeneration. All human CEP290 phenotypes are recessively inherited, including null
mutations, indicating that 50% of normal transcript levels will rescue the phenotype
(https://cep290base.cmgg.be). This suggests that for phenotype rescue, a treatment
that results in cellular wild-type transcript levels of 50%, and potentially less, should be
successful.

Figure 4.1: The feline CEP290 mutation. A. The feline CEP290 gene (NCBI) showing
the large gene size and exon number. B. Magnified view of exon 50 and the following
intron in the wild-type and mutant alleles. A single base-pair T > G substitution (vertical
arrow) in the mutant allele makes the upstream GT (underlined) a stronger splice donor
site, altering splicing such that a 4 base-pair insert is incorporated into the transcript
(bold italics). this results in a frameshift and premature stop codon.
The cat offers a unique and useful model for studying retinopathies given the
large eye size and ocular anatomy that shares similarities to the human eye such as
proportional components and a similar distribution of rods and cones with a central
region semi-homologous to the human macula.(8) These advantages combined with the

!129

CEP290 mutation make the CEP290 mutant cat a valuable model for testing the safety
and efficacy of CEP290 based therapies.
The feline CEP290 model could also be utilized for the development of an in vitro
model for preliminary treatment testing of a variety of therapy modalities including
genome editing therapies. This would allow for extensive testing of different treatment
constructs before implementation in animal models, providing a valuable tool for
reducing animal numbers and animal trial costs. A treatment could then be taken to the
animal model once optimized in the cells. Although fibroblasts from human patients can
be grown and used for in vitro testing of CRISPR-Cas9 therapy, the developed
treatment would require animal testing before they could be used in clinical trials.
Attempts at creating a rodent knock-in model containing the common human CEP290
splice-altering mutation have shown differences in splicing in the mouse than in the
human, limiting its usefulness as a model and reiterating the need for a naturallyoccurring splice mutation model such as the cat.(9) We therefore aimed to develop an in
vitro tool for this purpose by growing primary fibroblast cells from CEP290 wild-type,
mutant, and heterozygous carrier cats and to utilize this tool to test CRISPR-Cas 9
nuclease editing to remove the mutation in the mutant cells.
Given the localization and proposed function of the CEP290 protein within cilia,
we further speculated that defects in CEP290 could impact cilia formation. To test this
possibility, we sought to induce ciliation in cultured cells and compare cilia length across
genotypes to determine whether CEP290 mutant cells would show altered ciliation
which could then be used as an objective marker for treatment assessment.
Furthermore, we reasoned that even if differences are not observed in cilia length

!130

between experimental groups, induced ciliation in fibroblasts is a relatively wellestablished technique that could be exploited to better understand the function of
CEP290 and its role in the ciliation process in on-going studies and the development of
future therapies for application to both animal and human LCACEP290 patients.

!131

4.2 Methods

4.2.1 Animals and tissue collection
Eighteen cats from a purpose-bred CEP290 retinopathy breeding colony
maintained at Michigan State University were utilized for this study, six from each
genotype: CEP290 wild-type, heterozygous carrier, and homozygous mutant. Cats were
housed under 12:12hr lightdark cycles and were fed Purina Cat Chow (Nestlé Purina,
Wilkes-Barre, PA) ad libitum. All animal practices were carried out in accordance with
the Association for Research in Vision and Ophthalmology Statement for the Use of
Animals in Ophthalmic and Vision Research and were approved by the Michigan State
University Institutional Animal Care and Use Committee.
Skin biopsies were performed on each cat under general anesthesia. Anesthesia
induction was performed with isoflurane (IsoFlo, Abbott Laboratories, North Chicago, IL,
USA) delivered by mask or induction box. Cats were maintained in a light plane of
anesthesia by flow-by isoflurane. A small area on the flank was shaved and cleaned
thoroughly with alcohol. A sterile 4mm biopsy punch (Acuderm Inc., Ft. Lauderdale, FL,
USA) was then used to remove a piece of skin, which was immediately placed into a
vial of sterile Dulbecco’s Modified Eagle Medium (DMEM, Thermo Fisher Scientific,
Waltham, MA, USA) with 10% fetal bovine serum (FBS, Thermo Fisher Scientific) and
1% penicillin (Gibco, Grand Island, NY, USA) for culture. Hemostasis of the biopsy site
was achieved by applying pressure with medical gauze when needed and a single
simple interrupted suture was placed to close the defect. Cats were given a single

!132

injection of meloxicam (0.3mg/kg dose, Boehringer lngelheim Vetmedica Inc., St.
Joseph, MO, USA) to relieve pain or discomfort and then recovered from anesthesia.

4.2.2 Establishment of cultured cell lines
Skin samples were cultured to develop primary fibroblast cells as previously
described.(10) Briefly, samples were aseptically dissected in a cell culture hood into 6
small even pieces, each of which was placed in a single well of a 6-well cell-culture
plate containing DMEM media (Thermo Fisher Scientific). Cells were incubated under
standard cell culture conditions at 37C and 5% carbon dioxide and imaged on an
Olympus IX71 microscope (Olympus America Inc., Melville, NY, USA) daily to monitor
for adherence and growth. Cells were fed or passed every few days with the same
media. Once microscopic visualization showed outgrowth of cells with fibroblastic
morphology, immunocytochemistry (ICC) was performed to confirm cell type. (Table 4.1)

Table 4.1: Antibodies used for immunocytochemistry.

!133

ICC was performed as previously described.(11) Briefly, cells were fixed with
methanol/acetone and stained for vimentin and cytokertatin overnight. Slides were
incubated with secondary antibody for one hour, mounted, and then imaged on a Nikon
Eclipse 80i microscope (Nikon instruments Inc., Melville, NY, USA) equipped with a
CoolSnap ESv camera (Photometrics, Tuscon, AZ, USA). Cultured cells were examined
for the marker proteins vimentin (indicative of fibroblasts) and cytokeratin, (inducative of
keratinocytes) to confirm that they were fibroblasts. (Table 4.1)

4.2.3. Investigation of ciliation
Fibroblast cultures were induced to form cilia as previously reported.(10) Cells
were serum starved for 24 hours by incubating in DMEM media with no FBS added to
induce ciliation. ICC against acetylated alpha-tubulin (Table 4.1) was then performed
based on an established protocol to confirm ciliation and collect images for cilia
analysis.(11) Cells from each cat were stained in three separate ICC reactions and a
fluorescent image was taken from each reaction for analysis on the same Nikon Eclipse
80i microscope. Images were randomized by an investigator not involved in this study. A
different investigator, masked to the genotype of the cats from which the images were
taken, then measured all cilia in each image. Cilia were measured as a function of
pixels using ImageJ software (NIH, Bethesda, MD, USA) on all images. To do this,
ImageJ pixels were calibrated to the pixel:micron ratio of the microscope used (above).
Cilia were then manually measured by the investigator using the straight line tool to
measure each cilia from end to end. Cilia measurements from the three images of
ciliated cells for each cat were averaged and then measurements were compared

!134

across genotypes. Data was tested for normality using the Shapiro-Wilk test and
passed. A Student’s two-tailed unpaired t-test was therefore performed with significance
set at p < 0.05 and Bonferroni correction was applied to account for multiple
comparisons. All statistical analysis and graphing was completed using SigmaPlot12
statistical software (Systat Software Inc., Chicago, IL, USA).

4.2.4 Targeting of the feline CEP290 gene
Targeting of the feline CEP290 gene defect entailed several steps: 1) determine
if cultured feline primary fibroblasts were amenable to transduction, 2) determine the
efficiency of this process, 3) confirm the sequence of the feline CEP290 gene in DNA
isolated from our mutant cat cells, 4) identify potential Cas9 recognition sites proximal to
the mutated region, 5) design gRNAs recognizing these sites, 6) determine conditions
for most efficient transduction of factors into cultured feline fibroblasts, 7) determine an
optimal time for post-transduction recombination to occur, 8) test methods for detection
of mutation events at the target locus, and 9) determination of the relative efficiency of
targeting at different loci.

4.2.5 Transduction of primary feline fibroblasts
To determine the parameters for optimal transduction of mutant feline fibroblasts
we transduced fibroblast lines derived from three different cats with varying amounts of
capped-polyadenylated mRNA for eGFP (Trilink Biotech, San Diego, CA, USA) using
the liposome-based transduction reagents Lipofectamine 2000 or Lipofectamine
RNAiMAX (Invitrogen, Carlsbad, CA, USA) that had proven effective on primary canine

!135

cells of similar origin previously used by our laboratory. Green fluorescence indicative of
production of the eGFP protein 16-48 hours post-transduction was used as an indicator
of relative efficiency. Both Lipofectamine reagents were determined to be approximately
equally efficient on the feline cells, but since short RNAs were to be the ultimate
payload, Lipofectamine RNAmax was selected as the reagent of choice (see Results).

4.2.6 Sequence of the feline CEP290 gene in DNA from mutant cat cells
To confirm the sequence of the CEP290 mutation in the cells derived from the
mutant cats, DNA was isolated from each line using the Promega Genomic DNA
isolation kit (Promega, Madison, WI, USA) following the manufacturer’s protocol. 100 ng
of purified DNA from each line was amplified by PCR using two alternate sets of primers
(CEP2901F – 5’gtgcaatgacttgaactggc/CEP2901R – 5’gcaccgacagcagaagctcc or
CEP2902F – 5’gaagcagtgtaagatactg/CEP2902R – 5’ggaacagaggatctgaag) flanking the
putative mutation site. Amplification with Set 1 was predicted to return a 405 bp
fragment and amplification with Set 2 a 463 bp fragment. The Promega GoTaq Kit
(Promega) using enclosed default buffers and reaction conditions was used to produce
PCR products in an Applied Biosystems GenaAmp thermocycler (Applied Biosystems,
Foster City, CA, USA) using prolonged denaturation for 5min at 95oC, cycled for 40
cycles using 1 min. 95°C, 1 min. 55°C, 1 min 72°C, and polished with a 5 min.
incubation at 72°C. The amplified PCR products were visualized on a 3% agarose gel,
the band excised and purified using centrifugation through sterile nylon fiber, and the
flow through sent to the MSU RTSF core with either the 5’ or 3’ primer for sequence

!136

analysis. The returned sequence confirmed that the sequence of the feline CEP290
gene in our cultured lines matched the published sequence of the mutated allele.

4.2.7 Identification of Cas9 target sites
The CRISPR guide design engines maintained by MIT (http://crispr.mit.edu) and
Harvard (https://crispr.med.harvard.edu/) were used to identify potential Cas9 binding
sites within an approximately 250 bp region surrounding the mutation. More in depth
scrutiny of these sites and comparison of their relative positions was performed using
the Lasergene suite of programs on license from the Michigan State University
Research Technology Support Facility genomics core.
Eleven sites were identified by the Harvard sgSCORER1.0 website that allowed
off-target analysis using the cat FC5 genome (see Results). Of the 11 sites, two sites
(referred to as Target 1 and 2) had relatively few off-targets that did not reside within
coding or known control regions of transcribed genes and were proximal to the point
mutation in the CEP290 gene. These two gRNAs were selected for production of
synthetic gRNAs for direct targeting by Cas9.

4.2.8 Production and testing of CRISPR reagents
Previous work in our laboratory using CRISPR/Cas9 to target genes in canine
primary fibroblasts indicated that the Alt-R system available from IDT (Integrated DNA
Technologies Inc., Coralville, Iowa, USA) displayed a high-efficiency of targeting in our
hands, so this system that uses a synthetic gRNA, a separate tracerRNA, and purified
Cas9 protein was utilized. One advantage of this system is that since no DNA

!137

components are used, there is no possibility of incorporation of foreign DNA into target
cells that could complicate future analysis. Target 1 (PAM underlined)
(ACTTACTTGCTTGTTGCTCAAGG) and Target 2 (TTTCATCTCAAGCCACTTCTTGG)
on either side of the mutation region were synthesized by IDT and received for testing.
The RNAs and Cas9 protein were complexed in different ratios and amounts as
described in the Results Section to determine functionality and efficiency. Cells from
each of the three lines were transduced in wells of a 96-well plate with 40K cells/well
and left for 1-7 days post-transduction until DNA harvest to determine efficiency.

4.2.9 Detection of CRISPR activity
To determine the efficiency of disruption at the individual target sites, PCR
products produced using the flanking primer sets described above were subjected to
two types of analysis: 1) digestion with restriction endonuclease, or 2) digestion with the
ssDNA cutter T7 endonuclease. The disadvantage of using specific restriction
endonucleases is that the restriction site must overlap the cut site of Cas9 within the
target but has the advantage that any change in the recognition sequence will prevent
digestion. T7 endonuclease, on the other hand is advantageous in that any mismatch of
>1 base can potentially act as a cleavage site, however, single-base mismatches will
not be detected. Target 1 had an Sml I site proximal to the predicted cut site and Target
2 had a Bsl I restriction site directly on top of the predicted cleavage position in TAR2.
Targeting at both loci was determined by incubation of PCR products with the
appropriate restriction enzyme or with T7endo following procedures outline by the
enzyme manufacturer (New England BioLabs Inc., Ipswich, MA, USA). Digested PCR

!138

products were examined on a 3% agarose gel and imaged using and EagleEye imaging
system (BioRad, Hercules, CA, USA).

4.2.10 CEP290 repair using single-stranded DNA (ssDNA)
A long single-stranded synthetic DNA oligonucleotide (“ultramer”) was cotransfected along with the CRISPR reagents into feline fibroblasts. The success of
recombination measured by the loss of regional restriction sites within the target region
(as described above) and by the introduction of novel restriction sites within the newly
integrated DNA. Design of the ssDNA ultramer was performed using the Lasergene
suite licensed from the MSU RTSF Core along with the WatCut engine at the University
of Waterloo (http://watcut.uwaterloo.ca/template.php). The sequence of the 154bp
CEP290 repair ultramer was
5’AGAGAGGGAGCAAAAAGCTAAGAAATACACTGAAGACCTTGAGCAACAAGTAATT
AATTTTATCAAATTAGAAAATAATGCATTTCATCTCGAGCCACTTCTTTGCATTATCTTA
TGTATATAAAAATGAACTCTTGGGGCAACTGGGTGGCTC 3’. The optimal amount of
Target2 gRNA, trRNA, and Cas9 protein were combined with different amounts of the
ultramer oligonucleotide and co-transfected into recipient cells using both Lipofectamine
2000 and RNAiMAX reagents.

!139

4.3 Results

4.3.1 Fibroblast production and ciliation
Primary cultures of fibroblast cells were successfully created from all 18 cats,
with no more than two passages necessary to reach pure fibroblast culture, as
confirmed by vimentin and cytokeratin staining (Figure 4.2 A). Cells from all 18 cats
were also successfully ciliated via serum starvation, as confirmed by acetylated alphatubulin staining (Figure 4.2 B).

Figure 4.2: Representative ICC images show growth of pure fibroblast culture and
successful induction of cilia growth. A. Positive vimentin staining supports the
growth of fibroblast culture. B. Immunolabeling against acetylated alpha-tubulin shows
the presence of cilia extending from cultured cells following serum starvation. Scale =
100 microns

4.3.2 Cilia analysis
There were no significant differences in cilia length across genotypes. Wild-type,
heterozygous, and homozygous mutant cells grew cilia of nearly identical average
lengths (3.8 +/- 0.36 SD microns, 3.7 +/- 0.46 SD microns, and 3.7 +/- 0.38 SD microns,
respectively). (Figure 4.3)
!140

Figure 4.3: Cilia show no significant difference in length across genotypes. Cilia
lengths were nearly identical across genotypes with wild-type cells having an average
cilia length of 3.8 microns and heterozygous and homozygous mutant cells having
average lengths of 3.7 microns each. Student’s t-test showed no significant differences.
Bars = standard deviation.
4.3.3 Targeting and repair of the feline CEP290 gene using CRISPR/Cas9
4.3.3.1 Transduction of feline fibroblasts
Establishment of methods to induce changes at the feline CEP290 mutation site
started with testing methods of transduction. Fibroblasts from three mutant cat
fibroblasts that displayed the best growth were used in transfection tests. An example of
these lines transduced with 100ng of eGFP mRNA is shown in Figure 4.4.

!141

Cat# 11-209

Cat# 16-005

Cat# 11-209

Figure 4.4: Example of transfection of three feline primary fibroblast lines with
eGFP mRNA. Cells from three cats with good growth characteristics were used.
Fluorescence indicative of eGFP expression from the transduced mRNA was imaged at
16 and 24 hour post-transfection, as labeled.

Transfection was scalable with more mRNA and Lipofectamine RNAiMax producing
more intense fluorescence and more transduced cells (>50%). Expression of eGFP was
found to peak 20-30 hours post-transduction, and although this does not necessarily
mean that transduced CRISPR reagents would display maximum activity along the
same time-course, based on these results, published reports in other animal systems,
and our experiences with canine fibroblasts, we thought that 48-72 hours would likely be

!142

sufficient time for targeting to be completed. Overall, these results gave us confidence
that we could transduce a significant population of our feline fibroblasts.
4.3.3.2 The CEP290 mutation and design of CRISPR reagents
Since efficient targeting of genomic loci with Cas9 is dependent on precise
recognition of 23-base pair sequences, we decided to first confirm the sequence of the
CEP290 gene proximal to the reporter mutation in our cat cell lines. Using two primer
sets flanking the putative location of the mutation, we amplified DNA fragments from
genomic DNA of each cell line (Figure 4.5).

Figure 4.5: PCR products from genomic DNA amplified
from three cat fibroblast lines. Sequences were amplified
using Primer Sets 1 and 2 (as labeled) flanking the putative
CEP290 mutation region. Primer Sets 1 and 2 were predicted
to produce bands of 405 and 463 base pairs, respectively.
Relative to molecular weight markers, the PCR products
appeared to match the predicted size. The bands in this gel
were excised, purified, and sent for sequence analysis that
revealed that they were a match for the published sequence
(genome browser accession number: GCA_000181335.3).

!143

The confirmed sequence was submitted to Cas9 target finder engines at MIT and
Harvard for analysis. The Harvard engine provided analysis against the feline Fc5
genome and ultimately was used. Eleven targets were found and two were selected for
their relatively low off-target prediction and the fact that no off-targets for these gRNAs
were found to reside within protein coding regions except for CEP290 (Figure 4.6A).
TAR1 and TAR2 bracketed the region with the CEP290 mutation with TAR1 slightly
overlapping, and the TAR2 cleavage site roughly 40 bp downstream (Figure 4.6B). Both
sites were within the distance limits suggested for insertion of single-stranded DNAs for
replacement and repair. TAR1 and 2 gRNAs were produced and used in the CRISPR/
Cas9 Alt-R system from IDT as outlined in Methods.

!144

A

B

Figure 4.6: gRNA targets within the CEP290 gene region surrounding Exon 50
and the mutation. A. Highlighted targets labeled 1 and 2 displayed relatively few offtargets using the sgSCORER 1.0 website. B. Location of TAR1 and TAR2 within the
405 bp PCR product amplified with primer Set 1. The amplification primers are shown
in purple, Exon 50 in light red, and the two gRNAs in dark red, as labeled. The weak
splice donor site (light blue) and stronger splice donor site created by the mutation
(green), are shown at the end of Exon 50 between the two gRNA targets.

!145

4.3.3.3.Transduction of primary cat fibroblasts with CRISPR reagents
and assay of targeting
Previous work in our laboratory suggested that the Alt-R system worked best at
concentrations ranging from 3-30nM gRNA. These three (3, 10, 30 nM) concentrations
were tested on the most transfectable feline cell lines along with 100ng/well of eGFP
gRNA to allow monitoring of transfection efficiency. As shown in Figure 4.7, we
observed only slight toxicity in transduced wells compared to untransduced controls,
and based on fluorescence, transduction efficiency in both lines exceeded
approximately 80%. Cells were allowed to continue growth for 3-5 days post
transduction and tested for modification of their genomic DNA.

!146

#16-005
#15-015
#16-005
#15-015
Figure 4.7: Example of transfection of primary cat fibroblasts with 30, 10, and 3
nM gRNA (as labeled) complexed with the trRNA and Cas9 protein. 100ng of eGFP
RNA was included to allow visualization of transduced cells. Cellular toxicity as
indicated by phase-bright rounded cells was slightly higher in transfected cells
compared to un-transfected cell (far left) but did not appear to differ with changing
concentration of CRISPR reagents. Transfection efficiency appeared high over-all
(based on visible fluorescence, >80%), and increased slightly in wells receiving more
reagent. Cells were imaged at 24-hours post transduction.

As described in Methods, two approaches were used to look for mutations in
targeted DNA – T7 endonuclease digestion and restriction enzyme digestion. Figure 4.8
shows the results of digestion with these reagents on PCR fragments generated from
each DNA sample using the primer sets shown in Figure 4.8. Figure 4.8A shows
digestion of DNA from cat # 15-015 targeted with either TAR1 or TAR2 at the different

!147

concentrations. Despite repeated attempts to generate a “clean” digest and image, the
results invariably looked hazy and indistinct. Our interpretation was that there was some
activity at the TAR2 locus as evidenced by fragments in the T7endo-digested lanes
approximating the sizes (around 145bp and 270bp) predicted for digestion of the 405bp
PCR fragment if disruption occurred at the TAR2 position. Bands corresponding to
digestion at the TAR1 locus, however, were not observed. The haziness of the bands
may suggest that digestion of TAR2 by Cas9 is quite variable, perhaps ranging from a
single base indel (which would not digest with T7endo) to 2-10 base indels that would
produce dozens of bands of various sizes. In short, this expriment suggested activity at
TAR2 and much less at TAR1.
Further investigation of mutation at TAR1 was performed by Sml I digestion of the
405bp PCR product. As shown in Figure 4.8B, Sml I digestion, which is more complex
given that there are multiple Sml I sites within the PCR fragment, was difficult to
interpret, but showed no difference in cut pattern between DNAs targeted with the TAR1
gRNA or the TAR2 gRNA. Successful targeting by TAR1 should result in an increase in
a 273bp band in TAR1 transduced cells, but we observed no difference regardless of
which gRNA was used. Digestion under different conditions, different concentrations of
agarose gel, and running the gels further did not produce any results indicating a
difference between the use of either gRNA or no gRNA at all. This result coupled with
the results of T7endo digestion, suggested to us that TAR1 gRNA activity was low.
Better results were obtained with TAR2 using digestion with the restriction
endonuclease Bsl I. Bsl I cuts only at a single site in the PCR product, almost directly on
top of the TAR2 Cas9 cleavage site, and creates bands of approximately 160 and 300

!148

bp (using the 463 Primer Set 2 fragment). As shown in Fig. 4.8C distinct bands of this
size are observed in the TAR1 transduced cells or cell transduced with no gRNA, but in
cells transduced with the TAR2 gRNA, an undigested band corresponding to the uncut
460-bp band is observed. We estimate the relative ratio of uncut DNA:cut DNA to be
approximately 50%. If 100% of cells were transduced, this suggests that essentially all
cells have targeting of one CEP290 allele. Since transduction was estimated at closer
to 80%, this suggests that there is a population of 10-20% of total cells that likely have
disruption of both alleles in the mutant CEP290 gene. The same result was observed
using either PCR primer set and was reproduced over several experiments. Curiously
3nM gRNA appeared slightly more efficient at targeting than higher amounts, so this
amount was used in ongoing experiments aimed at inserting DNA correcting the splice
donor mutation proximal to the CEP290 TAR2 site.

!149

#15-015

#16-015

#15-015

Figure 4.8: Detection of Cas9 activity at the CEP290 TAR1 and TAR2 loci. A. Digest
of PCR amplified Primer Set 1 (405bp) DNA, melted, re-annealed, and digested with
T7endo. Spurious digestion and haziness of bands complicates interpretation, but sizes
suggest some activity at TAR2 but little at TAR1. B. Sml I digest of PCR products
(Primer set 2) indicative of activity at TAR1 likewise showed no clear difference between
TAR1, TAR2, or untargeted PCR products, further suggesting a lack of activity at TAR1.
C. Digest of PCR products (from Primer Set 2) with Bsl I indicating activity at the TAR2
locus. Uncut bands (Targeted) and cut bands (untargeted) clearly differ between TAR2
and other gRNAs. 30, 10, 3, and 0 indicates the nanomolar amount used of individual
gRNAs. Labels on the left edge of gels indicate the size of the DNA ladder. See text for
further detail.

!150

4.3.3.4 Attempt to repair the CEP290 mutation
It has been reported that new replacement DNA can be integrated into genomic
loci using disruption of DNA with Cas9 and homologous recombination.(12-14) It has
further been reported that short single-stranded DNAs (ssDNAs) can be used for this
process with double-digit efficiencies of insertion. Given the efficiency of Cas9 cleavage
at TAR2, we elected to try to repair the CEP290 gene defect by co-introducing a long
ssDNA (ultramer) of 154bp synthesized by IDT. This ultramer had several features
designed to both repair the splicing defect at Exon 50 and to facilitate detection of the
integrated ssDNA (Figure 4.9). First, the ultramer had over-all homology with the original
154bp region just downstream of CEP290 Exon 50 of >92% with perfectly matched
homology arms of ~50bp on either end. This high level of similarity should favor correct
homologous recombination. The size was slightly longer than the preferred length of
100-120bp, however, to replace the splice donor and eliminate competing mis-splice
sites, we felt that the length was justified. We used the splice donor of a downstream
CEP290 Exon (Exon 53) as a template for replacing the low-efficiency splice donor of
Exon 50. We reasoned that if this splice donor worked well elsewhere in the feline
CEP290 gene, it should also work here. The Exon 53 splice donor also contained an
Ase I site that was not in the original Exon 50 sequence, so this further justified the
strategy. Finally, we incorporated an Xho I site slightly further downstream that required
the change of only two base pairs from the original sequence.

!151

Figure 4.9: Comparison of the feline CEP290 Exon 50 mutant sequence with the
modified ssDNA ultramer. Sequence underlined in blue indicated the homology arms.
Black shading indicates identical bases in both sequences. Yellow boxes indicate
ultramer sequence matching the splice donor copied from Exon 52. The Ase I and
introduced Xho I sites are also shown. Mismatches in red were introduced to prevent
cleavage of TAR2 by Cas9 in the repaired sequence. Green arrow indicates splice site
corrected from GC to GT.
We tested co-transfection of 100, 50, 10, 3, 1 and 0 nM concentrations of
ultramer in combination with the TAR2 targeting conditions worked out in the
experiments of Figure 4.8 and assayed the amplified PCR products for cleavage by
either the Xho I or Ase I enzymes in a similar fashion to our analysis with Bsl I. Even
though we observed transfection efficiencies and targeting efficiencies somewhat
attenuated in the presence of ultramer compared to zero co-transduced ultramer
(variable, but ~50% reduction), we still felt that they were high enough to produce a
usable result. In short, we were not able to detect cleavage of the PCR products with
either Primer set 1 or 2 by either Ase I or Xho I. Repeats of this experiment altering
parameters or using increased gRNA (TAR2 gRNA was increased from 3nM to 30nM)
still did not yield evidence of incorporation of the ssDNA. Since individual targeting
DNAs, both single and double-stranded are variably able to function efficiently (most
likely based on sequence composition), we have concluded that the ultramer we tested

!152

is not a high-efficiency integrator. We predict that integration at <5% of alleles could
probably not be detected with confidence using our assay methods. Since this method
also affords us no way to select or identify repaired cells that had undergone
recombination, an efficiency below 10-20% would probably been of little use in most
assays.

!153

4.4 Discussion

Fibroblast cells were successfully grown from all cats with minimal passages
required to establish pure fibroblast culture. This creates a useful in vitro tool that is
easy to develop and quick to grow, allowing for fast and efficient downstream analysis in
future studies. Successful cilia induction further increases the utility of this tool for
analysis of CEP290 mutations. Since the protein produced by this gene is a ciliary
protein, assays investigating ciliation and ciliary effects may be useful for better
describing this model and for establishing objective markers for treatment efficacy
analysis.
Our attempt at establishing one such marker by measuring cilia length did not
produce a useful marker as cells from all genotypes produce cilia of similar same
length. This is not surprising given the milder nature of the phenotype seen in cats,
suggesting that more severe changes such as disruption of cilia growth is unlikely to be
an issue in this model.(15) However, this does not exclude use of this in vitro tool but
simply highlights the need for further investigation to identify objective markers. Though
cilia length is not affected by the feline CEP290 mutation, the presence of a retinal
phenotype in cats shows that the mutation has deleterious effects on protein levels and/
or function and therefore suggests that abnormalities in mutant cells are likely to be
present. Future studies should be aimed at identifying these abnormalities such that
they can be utilized as markers in treatment trials. Alternatively, it may be possible to
utilize genome editing to alter the cells to make the phenotype more severe, perhaps by

!154

knocking down or out another gene involved in ciliation. This would result in more
obvious abnormalities in mutant cells that could be identified as objective markers.
CRISPR/Cas9 editing of CEP290 mutant feline fibroblast cells proved
challenging and requires further optimization and studies to reach a useable treatment.
It is important to note that before proceeding with the above-mentioned methods, a
“nickase” method was attempted. The nickase method is a modified editing technique
that utilizes a mutated Cas9 enzyme to introduce single-stranded cuts instead of
double-stranded cuts. In theory, this should result in a lower risk of off-target
mutagenesis as naturally present cell repair machinery will detect and repair singlestranded disruptions with high fidelity by homology-directed repair.(16) Off-target
breaks, which will be single-stranded, will therefore be repaired while double stranded
breaks directed by the gRNA pairs will only occur at the chosen target site.
Unfortunately, pilot studies showed insufficient transfection efficiency using this method,
precluding its use for our desired purposes. We therefore switched to the described premade kit that includes the wild-type Cas9 enzyme and does not employ a nickase
method. This method could lead to significant off-target mutagenesis, a potentially
significant safety concern as we moves towards an in vivo treatment. However, there
are methods to overcome this obstacle. The same CRISPR engines used to design our
CRISPR constructs can also analyze these constructs for possible off-target sites. We
can then use this information to determine the possible effects cuts in these off-target
sites could cause, gauge the safety of the treatment, and make adjustments as needed.
If off-target sites occur in oncogenes for example, new gRNAs can be analyzed until a
construct that does not target important genes is found. Once a construct that has

!155

minimal off-target sites of less importance (non-coding regions, for example) is
designed, pilot studies can be conducted to analyze the percentage of target hit versus
off-target hit utilizing assays such as T7 endonuclease or restriction enzyme digestion.
As treatments move closer to in vivo models and human clinical trials, other
methods can be employed to even further reduce the possible effects of off-target
mutagenesis and improve treatment safety. Treatments utilizing this machinery will likely
employ one of two methods; either direct in vivo delivery of the CRISPR machinery, or
correction of induced pluripotent stem cells (iPSCs) for transplantation. Direct delivery of
the machinery, likely utilizing a vehicle such as adeno-associated viral (AAV) vectors,
could result in off-target mutagenesis. However, though off-target sites should be
avoided as much as possible in pre-delivery construct design as described above,
remaining off-target breaks are likely to be repaired by cell repair machinery, further
reducing possible deleterious effects. Treatments utilizing corrected iPSCs could be
verified as safe pre-treatment by sequence analysis. iPSCs corrected could be
sequenced to definitively determine all sites targeted and then a cell that has no or
minimal off-target mutagenesis could be identified and clonally expanded to create a
line of cells known to contain no potentially hazardous off-target sites.
Though we achieved high-efficiency of cell transfection and showed good cutting
with one of our gRNA pairs, our diagnostic assays for insert integration showed no
detectable integration of the insertion oligonucleotide. We are not able to determine if
this is due to no integration at all, or more likely, integration that is occurring but at too
low of a level for our diagnostic assays to detect. It is unclear why we did not achieve
integration of the insert at detectable levels but there are several possibilities. DNA does

!156

not transfect with nearly as strong an efficiency as RNA.(17) Therefore, while our RNAs
transfected cells effectively it is possible that the DNA oligonucleotide insert did not
transfect the cells with these RNAs and the Cas9 enzyme with detectably high
efficiency. This could be compounded by our CRISPR efficiency; though 50%
transfection efficiency is relatively strong, that indicates that whatever oligo transfection
efficiency we achieved would only be appreciated at 50% of that level. If we for example
achieved 10% insert integration, the overall integration is then only 5%. Alternatively, the
lack of detectable integration could be an issue with the oligonucleotide, warranting
further optimization such as pilot studies investigating a variety of oligo lengths and
alternative sequences. A likely explanation therefore is that different targeting fragments
and genomic targets possess intrinsically different capacities for recombination and by
chance the target we had to work with is not a site of high-efficiency. Expansion of
testing to more ssDNAs or dsDNAs with different length homology arms and
compositions is necessary to explore this possibility.
A strategy that may overcome the obstacles faced in this study could be based
on the recently described process for precise integration of non-homologous DNA
fragments termed “homology-independent targeted integration”, or HITI.(18) If the
technique described in this report can be successfully adapted to feline cells, it is a
superior method for repair of the feline CEP290 mutation because it would also allow for
easy identification and selection of cells with mutation-correcting recombination. (Figure
4.10)

!157

Figure 4.10: Schematic of feline CEP290 repair using HITI. A. Sequence proximal to
the splice acceptor of CEP290 Exon 50. The proposed guide RNA sequence labeled
HITI TARGET on the left. Green shading indicates sequence upstream of the putative
Cas9 cleavage site and orange shading indicates sequence downstream. Blue shading
indicates sequence within the proximal splice acceptor (ending in AG). Red bar
indicates exon mRNA for CEP290 Exon 50. B. Schematic of the insertion of the
synthetic DNA fragment into the HITI TARGET (TARH) site. Note that the two “halves” of
the recognition site on genomic DNA and the DNA fragment for insertion are flipped
relative to each other such that correct insertion of the DNA fragment juxtaposes to
“green” halves and two “orange” halves, effectively destroying the recognition site,
stopping further digestion by the Cas9 enzyme, and completing the recombination
reaction. Insertions in reverse are subject to continued digest by Cas9, thus favoring
eventual correctly oriented insertion events.

!158

As suggested above, one severe limitation of the ssDNA recombination method
of repair is that unless insertion of the repair region is quite efficient (we estimate
>5-10% of all alleles), detection of the insertion events will be difficult and isolation and
enrichment of repaired cells will be impractical. HITI could solve this problem by
permitting the relatively efficient integration of larger payloads into the CEP290 defect
region and allowing selection of correctly recombined cells using standard antibiotic
resistance genes.
The HITI strategy is based on: 1) a high-efficiency and unique Cas9 target, 2)
high-level Cas9 expression, 3) an abundance of a double-stranded DNA insert of
moderate length (<10Kb) with reverse Cas9 target sequences (relative to the genomic
target) such that the insert DNA is cut on the 5’ and 3’ ends by Cas9 and insertion in the
correct orientation destroys the target sequences on both ends. Insertion of the DNA
insert in the incorrect (reverse) orientation re-creates the Cas9 target site that continues
to be cleaved by Cas9 until the target is destroyed by indel creation or by insertion of
the foreign DNA fragment in the correct orientation into the genomic site.
Consequently, three classes of allele are generated in the target cell population: wildtype, indel mutated, and correctly inserted “repaired” alleles. By including a selectable
marker such as a drug-resistance gene in the insertion cassette, only those cells with
correct integration of the repair fragment will be returned.
In the case of feline CEP290, the high-efficiency gRNA Target 2 that we identified
would not be ideal for use with HITI. The reason for this is that TAR2 resides just
downstream of the Exon 50 splice site and insertion of a new fragment would leave the
non-canonical splice intact. Although there are possible work-arounds for using the

!159

TAR2 site, we have concluded that the simplest and likely best approach for repairing
the defect using HITI is to insert a fragment just upstream of the Exon 50 splice
acceptor that will essentially replace the coding portion of CEP290 from Exon 50
downstream, adding a puromycin-resistance ORF attached to the C-terminus of the
completed CEP290 protein using a 2A element. This new CEP290-2A-Puro ORF would
then be transcriptionally-terminated by a foreign polyadenylation signal immediately
following the inserted fragment such that the remainder of the gene downstream
(including the splice donor mutation) not utilized. A schematic of this process is shown in
Figure 4.10. This is a good experimental design that has a high probability of success
and would be a worthwhile effort for future studies.
While we did not complete successful integration of an oligonucleotide insert to
repair the defect in feline CEP290 mutant cells, we achieved the initial steps to reach
this aim, including RNA and Cas9 enzyme transfection of cells and cutting with gRNAs,
with strong efficiency. We are confident that with further trials and optimizations editing
of the CEP290 feline mutation can be achieved and are particularly hopeful that the HITI
method could be employed with a successful outcome. Future studies should aim to
reach this goal as well as identify differences between mutant and non-mutant cells for
utilization as objective markers of treatment success.

!160

4.5 Acknowledgments

The authors would like to thank the Michigan State University Campus Animal
Resources and the College of Veterinary Medicine Vivarium staff for animal care. We
would like to thank Ethan Dawson-Baglien for cilia image randomization. This study was
supported by The Grousbeck Family Foundation, Myers-Dunlap Endowment to Dr.
Simon Petersen-Jones, the CVM Center for Feline Health and Well-Being, and The
Cotter Endowment.


!161

REFERENCES

!162

REFERENCES

1.
Betleja E, Cole DG. Ciliary trafficking: CEP290 guards a gated community. Curr
Biol. 2010;20(21):R928-31.
2.
Mali P, Yang L, Esvelt KM, Aach J, Guell M, DiCarlo JE, et al. RNA-guided
human genome engineering via Cas9. Science. 2013;339(6121):823-6.
3.
Narfström K. Hereditary progressive retinal atrophy in the Abyssinian cat. J
Hered. 1983;74(4):273-6.
4.
Narfström K. Progressive retinal atrophy in the Abyssinian cat. Clinical
characteristics. Invest Ophthalmol Vis Sci. 1985;26(2):193-200.
5.
Menotti-Raymond M, David VA, Schaffer AA, Stephens R, Wells D, Kumar-Singh
R, et al. Mutation in CEP290 discovered for cat model of human retinal degeneration. J
Hered. 2007;98(3):211-20.
6.
Menotti-Raymond M, David VA, Pflueger S, Roelke ME, Kehler J, O'Brien SJ, et
al. Widespread retinal degenerative disease mutation (rdAc) discovered among a large
number of popular cat breeds. Vet J. 2010;186(1):32-8.
7.
Menotti-Raymond M, David VA, Schaffer AA, Stephens R, Wells D, Kumar-Singh
R, et al. Mutation in CEP290 discovered for cat model of human retinal degeneration. J
Hered. 2007;98(3):211-20.
8.
Linberg KA, Lewis GP, Shaaw C, Rex TS, Fisher SK. Distribution of S- and Mcones in normal and experimentally detached cat retina. The Journal of comparative
neurology. 2001;430(3):343-56.
9.
Garanto A, van Beersum SE, Peters TA, Roepman R, Cremers FP, Collin RW.
Unexpected CEP290 mRNA splicing in a humanized knock-in mouse model for Leber
congenital amaurosis. PLoS One. 2013;8(11):e79369.
10.
Vangipuram M, Ting D, Kim S, Diaz R, Schule B. Skin punch biopsy explant
culture for derivation of primary human fibroblasts. J Vis Exp. 2013(77):e3779.
11.
Rao KN, Li L, Zhang W, Brush RS, Rajala RV, Khanna H. Loss of human disease
protein retinitis pigmentosa GTPase regulator (RPGR) differentially affects rod or coneenriched retina. Hum Mol Genet. 2016;25(7):1345-56.
12.
Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genome engineering
using the CRISPR-Cas9 system. Nat Protoc. 2013;8(11):2281-308.
!163

13.
Sander JD, Joung JK. CRISPR-Cas systems for editing, regulating and targeting
genomes. Nat Biotechnol. 2014;32(4):347-55.
14.
Hoshijima K, Jurynec MJ, Grunwald DJ. Precise genome editing by homologous
recombination. Methods Cell Biol. 2016;135:121-47.
15.
Narfstrom K. Hereditary progressive retinal atrophy in the Abyssinian cat. J
Hered. 1983;74(4):273-6.
16.
Shen B, Zhang W, Zhang J, Zhou J, Wang J, Chen L, et al. Efficient genome
modification by CRISPR-Cas9 nickase with minimal off-target effects. Nat Methods.
2014;11(4):399-402.
17.
Wiedenheft B, Sternberg SH, Doudna JA. RNA-guided genetic silencing systems
in bacteria and archaea. Nature. 2012;482(7385):331-8.
18.
Suzuki K, Tsunekawa Y, Hernandez-Benitez R, Wu J, Zhu J, Kim EJ, et al. In vivo
genome editing via CRISPR/Cas9 mediated homology-independent targeted
integration. Nature. 2016;540(7631):144-9.

!164

CHAPTER 5
DIFFERENTIAL TARGETING OF FELINE PHOTORECEPTORS BY
RECOMBINANT ADENO-ASSOCIATED VIRAL VECTORS:
IMPLICATIONS FOR PRECLINICAL GENE THERAPY TRIALS

Minella AL, Mowat FM, Willett KL, Sledge D, Bartoe JT, Bennett J, Petersen-Jones SM.
Differential targeting of feline photoreceptors by recombinant adeno-associated viral
vectors: implications for preclinical gene therapy trials. Gene Therapy. 2014;21(10):
913-20. PMID: 25056608

Author Contributions
Conceived and designed the experiments: ALM, FMM, JTB, JB, SMP-J. Performed the
experiments: ALM, FMM, KLW, DS, JTB, SMP-J. Analyzed the data: ALM, KLW, SMP-J.
Wrote the paper: ALM, KLW, SMP-J. Provided input for the manuscript: FMM, JTB, JB. 


!165

5.1 Abstract
The cat is emerging as a promising large animal model for preclinical testing of retinal
dystrophy therapies, for example, by gene therapy. However, there is a paucity of
studies investigating viral vector gene transfer to the feline retina. We therefore sought
to study the tropism of recombinant adeno-associated viral (rAAV) vectors for the feline
outer retina. We delivered four rAAV serotypes; rAAV2/2, rAAV2/5, rAAV2/8, and
rAAV2/9, each expressing GFP under the control of a cytomegalovirus promoter, to the
subretinal space in cats and, for comparison, mice. Cats were monitored for gene
expression by in vivo imaging and cellular tropism was determined using
immunohistochemistry. In cats, rAAV2/2, rAAV2/8, and rAAV2/9 vectors induced faster
and stronger GFP expression than rAAV2/5 and all vectors transduced the RPE and
photoreceptors. Unlike in mice, cone photoreceptors in the cat retina were more
efficiently transduced than rod photoreceptors. In mice, rAAV2/2 only transduced the
RPE whereas the other vectors also transduced rods and cones. These results highlight
species differences in cellular tropism of rAAV vectors in the outer retina. We conclude
that rAAV serotypes are suitable for use in retinal gene therapy trials in feline models,
particularly where cone photoreceptors are the target cell.

!166

5.2 Introduction

Leber Congenital Amaurosis (LCA) is a group of hereditary retinal dystrophies
with an estimated incidence of 1 in 81,000, that is characterized by early-onset vision
loss.(1) With the recent findings that causative mutations for two feline retinal
dystrophies are in genes responsible for LCA, the cat has become a promising large
animal model for preclinical testing of therapies.(2, 3) The rod-cone dysplasia (Rdy) cat
has a mutation in the cone rod homeobox gene (Crx) resulting in a severe, early-onset,
dominant cone-rod dystrophy (the initial description of this as a rod-cone dystrophy was
subsequently corrected (3)), mirroring the severe LCACRX.(4) The retinal degeneration
Abyssinian cat (RdAc) has a mutation in the centrosomal protein of 290 kDa (Cep290)
and is a model for recessive non-syndromic CEP290 retinopathy.(2) Studies to develop
gene therapy vectors applicable for LCACRX and LCACEP290 are underway and these cat
models offer the opportunity to test promising approaches in a large animal model.
The feline eye and vision have been extensively studied by retinal physiologists,
thus laying the groundwork for the use of this species in therapeutic studies. The
similarity in size of the feline and human globe, coupled with the presence of an area
centralis and visual streak with similarities to the human macula (namely higher
numbers of cones and a greater density of photoreceptors), offers advantages over
rodent models for the preclinical testing of therapy. Canine spontaneous retinal
dystrophy models, which offer similar advantages, have already proven invaluable for
proof-of-concept gene therapy trials.(5, 6) The aforementioned feline models, along with
other spontaneous models currently being characterized ((7) L Lyons personal

!167

communication 2013, and SM Petersen-Jones, unpublished results), show promise for
this purpose.
Recombinant adeno-associated viral (rAAV) constructs have become the vectors
of choice for retinal gene therapy.(8) However, there is limited information about the use
of rAAV vectors in the feline retina. Successful gene therapy of feline
mucopolysaccharidosis VI using an rAAV2 vector delivered subretinally has been
reported to transduce feline retinal pigment epithelium.(9) Only one study has been
published investigating rAAV transduction of feline photoreceptor cells (the target for
both LCACRX and LCACEP290 therapy), which showed transduction of both rods and
cones in two eyes injected subretinally with an rAAV2 construct.(10)
The purpose of the current study was to test a variety of rAAV vector serotypes
delivered by subretinal injection for their potential use in preclinical retinal gene therapy
trials in feline LCA models.

!168

5.3 Methods

5.3.1 Animals
Ten adult wild-type male domestic shorthair cats (Liberty Research, Inc. Waverly,
NY) and eight 3-4 week old female C57Bl6J mice (Harlan Sprague Dawley Inc.,
Indianapolis, IN) were used. All procedures were conducted according to the ARVO
Statement for the Use of Animals in Ophthalmic and Vision Research and were
approved by the Michigan State University Institutional Animal Care and Use
Committee.

5.3.2 Production of vector
Recombinant adeno-associated virus 2/2, 2/5, 2/8 and 2/9vectors packaged with
the green fluorescent protein (GFP) gene driven by the cytomegalovirus promoter were
produced by the University of Pennsylvania Viral Vector Core. rAAV vectors were
manufactured and purified from cell lysates after triple transfection of HEK293 cells.
rAAV particles were purified from cell lysates by two rounds of cesium chloride
centrifugation. Vector was concentrated and desalted, using Amicon Ultra-15 centrifugal
filtration devices (Millipore, Bedford, MA, USA). Glycerol was added to the concentrate
to a final concentration of 5% (v/v), and aliquots stored at -80°C. All vector preparations
were evaluated by multiple assays, including whole purity analysis by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis, endotoxin determination (with < 20 EUml-1
as a lot release criterion), and by TaqMan quantitative PCR for genome copy titration.

!169

For subretinal injection, vectors were diluted to a titer of 5 x 1011 viral genomes per
milliliter (vgml-1) in sterile balanced salt solution (Alcon Laboratories, Fort Worth, TX).

5.3.3 Subretinal injections
Subretinal injections in cats were performed using the technique previously
described in dogs(11) but with the addition of a standard 3-port 23 gauge vitrectomy;
200µL of vector was injected. Six cats received rAAV2/5 in the right eye and rAAV2/8 in
the left eye, and four cats received rAAV2/9 in the right eye and rAAV2/2 in the left eye.
Post-operatively, 0.2mg dexamethosone (Bimeda LC, Oakbrook, IL) and 4mg
methylprednisolone acetate (Depo-medrol. Pfizer Animal Health, Madison, NJ) were
injected subconjunctivally. Approximately 2 µl of vector was subretinally injected into
mice using a transcleral approach as previously described.(12) Following injection,
neomycin,/bacitracin/polymyxin B ointment (Henry Schein, Melville, NY) was applied
twice daily for two days. Each vector was injected into 4 mouse eyes.

5.3.4 Monitoring for GFP expression
Fundus photography and GFP expression monitoring was performed in cats daily
for 10 days, every-other-day for 1 week, twice weekly for 1 week and once weekly until
euthanasia (RetCam II. Clarity Medical Systems, Pleasanton, CA). Mice were
maintained for 6-8 weeks, during which time only gross ocular examinations were
performed.

!170

5.3.5 Eye processing
Cats were euthanized 21-56 days and mice 55-71 days post- injection. Feline
globes were fixed in 4% paraformaldehyde and dissected along the limbus, dividing the
anterior and posterior segments. Mouse globes were fixed in 1% paraformaldehyde.
Feline anterior and posterior segments and whole mouse eyes were embedded in
optimal cutting temperature gel (OCT. Sakura Finetek USA, Inc., Torrance, CA) and
flash frozen. Serial 14 µm (cat) and 10µm (mouse) cryosections were prepared for
immunohistochemistry (IHC).

5.3.6 Immunohistochemistry
Immunohistochemistry was performed as previously described.(13) Antibodies
are listed in Table 5.1. Feline sections were imaged using an Olympus FluoView 1000
Laser Scanning Confocal microscope (Olympus American Inc., Melville, NY). Z-depth
series were constructed using Image J software (Adobe Photoshop 3.0 software, Adobe
Systems Inc., Mountain View, CA) and examined using Adobe Photoshop 3.0 software
(Adobe Systems Inc., Mountain View, CA, USA). Murine sections were imaged using a
Nikon Eclipse 80i microscope (Nikon instruments Inc., Melville, NY) equipped with a
CoolSnap ESv camera (Photometrics, Tuscon, AZ).

Table 5.1: Antibodies used for immunohistochemistry
!171

5.3.7 Cell counting
Rod and cone photoreceptors expressing GFP in cat eyes were counted. Images
from three retinal sections from each injected region stained with CAR and DAPI were
captured. With the GFP signal masked and cones labeled with hCAR, a masked
observer counted and marked 200 rod photoreceptor cell bodies. The GFP signal was
then unmasked, and all marked cell bodies positive for GFP expression were counted.
All cones (CAR positive) across sections were counted and the number of GFP-labeled
cones were recorded.

5.3.8 Immune responses
To detect antibodies against rAAVs, an in vitro transduction assay was adapted
from previous methods.(14) Briefly, 84-31 cells (293 HEK stably expressing Ad-E4,,
University of Pennsylvania Vector Core) were seeded overnight at 6000 cells per well.
Half-log serial dilutions of test sera (1:3.16 – 1:10 000) were incubated with appropriate
rAAV serotypes containing a GFP reporter at a multiplicity of infection (MOI) optimized
such that ~80% of cells were transduced in control wells lacking test sera. Plates were
inoculated and incubated at 37° C under 5% CO2 for 36 hours and then assayed for
GFP fluorescence with a Typhoon 9400 Variable Mode Imager (GE Healthcare,
Piscataway, NJ). Images were analyzed with Protein Array Analyzer for ImageJ(15) and
samples are reported as neutralizing when fluorescence was <50% of un-inhibited
controls. An indirect enzyme-linked immunosorbant assay (ELISA) was performed to
detect anti-GFP antibodies in serum samples; 0.1 µg of recombinant purified GFP
(Clontech, Palo Alto, CA) was incubated overnight at 4° C then blocked and incubated

!172

with feline test sera diluted to 1:400. Samples were then incubated with HRPconjugated anti-feline IgG secondary antibody (Thermo Fisher Scientific, Waltham, MA)
diluted to 1:10000. The plate was developed using SIGMAFAST OPD system (SigmaAldrich, St. Louis, MO). Results are presented relative to serum from an un-injected
naïve cat. All samples were run in triplicate. For evaluation of inflammatory infiltration
three sections of each eye was stained stained with hematoxylin and eosin stain and
evaluated based on an objective scoring system (Table 5.2). Four ocular regions were
were designated and scored and a total infiltration score was determined for each eye
by adding the four individual scores.

Table 5.2: Inflammatory infiltration scoring rubric
!173

5.3.9 Statistical Analysis
All statistical analysis was conducted using SigmaPlot software (SigmaPlot 12.
Systat Software Inc. San Jose, CA). Normally distributed cell counting data sets
(determined by Shapiro-Wilk normality test) were compared using unpaired t-tests. Nonparametric cell counting data sets were compared by a Mann-Whitney Rank Sum Test.
Significance was set at P < 0.05. The hematoxylin and eosin data were analyzed using
Kruskal-Wallis one way analysis of variance with a significance set at P < 0.05.

!174

5.4 Results and Discussion

Subretinal injections of rAAV vectors, all at the same dose (1 X 1011vg) and all
expressing green fluorescent protein (GFP) were performed on 20 feline eyes (10 cats)
(Table 5.3). During injections the feline retina did not detach as readily as has been our
experience in the dog, and the resistance to expanding the detachment resulted in
some back-flow of vector into the vitreous. Post-injection inflammation in 17 of 20 eyes
was minimal consisting of trace to 1+ aqueous flare (on a scale of 1-4) during the first
few days following the procedure, but this was transient and required no treatment. The
retinal detachments resolved over this period. However, three eyes were excluded from
the study due to the development of procedure-related intraocular inflammation (Table
5.3). The same vector constructs were also injected subretinally in mouse eyes for
comparison. There were no adverse complications in these eyes.

Table 5.3: Summary of rAAV transduction

!175

5.4.1 In vivo GFP expression in cat eyes
Green fluorescence (indicative of GFP expression) was detected by in vivo
imaging in injected retinal regions of rAAV2/8 injected eyes between 1 and 3 days postinjection. Fluorescence in rAAV2/2, 2/5, and 2/9 injected eyes developed slightly later
(Table 1). Fluorescence appeared noticeably brighter in eyes injected with rAAV2/2, 2/8
and 2/9 compared to rAAV2/5 injected eyes, although this difference was not quantified.
The stronger GFP expression in rAAV2/8 eyes compared to rAAV2/5 is consistent with
previous reports in mice.21, 22 In two out of three rAAV2/2 injected eyes evidence of
posterior segment inflammation was noted (first detectable at 13-18 days post-injection)
and was followed by a progressive loss of GFP fluorescence, noted as decreased GFP
signal on fluorescent photography (Figure 5.1).

Figure 5.1: In vivo transduction of the retina. Representative fundus images of
cats from each vector group. Pre-injection (Pre-inj.) column shows the fundus
preoperatively and post injection (Post-inj.) images show the ‘bleb’ created by vector
subretinal injection (color images). GFP fluorescence images for the same eyes are
shown in subsequent columns at day 1, day 3, maximum GFP expression (Max) and
immediately prior to euthanasia (Final). Maximum GFP intensity was reached by day
12 for rAAV2/2, 35 for rAAV2/5, 24 for rAAV2/8 and 28 for rAAV2/9. Note the
decrease in GFP expression in the rAAV 2/2 eye.

!176

This decreased signal is similar to the signal decrease noted in the primate retina
injected subretinally with the rAAV2-GFP construct, in which fluorescence disappeared
over time; however, the kinetics of signal reduction was slower in the primate retina than
we note here in the feline retina.(16) Fluorescence was maintained in the remaining
eyes for the study duration. The onset of expression in the rAAV2/2 eyes was faster
than has been reported in other species, where up to four weeks may be required for
expression.(16, 17)
In one rAAV2/8 eye, multiple linear, fluorescent connections between the site of
the subretinal injection and the optic nerve head were noted, and most likely
represented expression in the nerve fiber layer. The ciliary body in the rAAV2/2 injected
eyes showed strong in vivo fluorescence (Figure 5.2).

Figure 5.2: In vivo expression in the ciliary body. In vivo wide-field fundus
photograph illustrating rAAV2/2 expression in the ciliary processes. All
vectors transduced the ciliary processes, but in vivo fluorescence was only
noted in rAAV2/2-injected eyes.

!177

5.4.2 Histological assessment of GFP expression
Following euthanasia, GFP expressing cells were labeled in feline retinal
sections using an anti-GFP antibody. Double labeling with markers specific for different
retinal cells was performed to confirm transduced cell type. GFP expression was
detected in photoreceptor cells, the retinal pigment epithelium (RPE), and some inner
retinal cells for all vectors in the feline eye (Figure 5.2, Table 5.4). In mice,
photoreceptors and RPE were transduced by rAAV 2/5, 2/8 and 2/9 whereas rAAV 2/2
transduced only the RPE (Figure 5.3).

Table 5.4: Feline inner retinal cell transduction.

!178

Figure 5.3: Histological transduction of feline and murine outer retinas. (a)
Feline retinal sections co-labeled with a GFP antibody and cone arrestin antibody
show the predominance of cone transduction for each of the vectors. rAAV2/2 eyes
all showed inflammation, thereby affecting section quality, as evidenced in the
rAAV2/2 images. (b) In murine retinas, rAAV2/5, 2/8 and 2/9 vectors transduced
rods, cones and RPE, whereas rAAV2/2 only transduced the RPE. Scale bar = 50
microns. CAR, cone arrestin labeling; DAPI, nuclear counterstain; INL, inner nuclear
layer; ONL, outer nuclear layer.
Photoreceptor transduction was quantified by counting GFP-labeled rods and
cones. For all four vectors a significantly higher percentage of cones were transduced
than rods (Table 5.3) and the transduced cones had noticeably brighter GFP-labeling
(Figure 5.3). rAAV2/8 transduced the highest percentage of photoreceptors, followed by
rAAV2/5, rAAV2/2, and lastly, rAAV2/9. The percentage of rods transduced was

!179

significantly higher in rAAV2/8 injected eyes than rAAV2/9 injected eyes (Mann-Whitney
Rank Sum, p =0.019). Although quantification of photoreceptor transduction was not
performed in murine retinas, those vectors that transduced photoreceptor cells
subjectively appeared to have a more efficient transduction of rods than seen in cats
(Figure 5.3).
The greater efficiency of cone transduction compared to rods in the cat retina by
the rAAV serotypes used in this study was unexpected considering the findings in other
species. In mice, rAAV2/2, 2/5, 2/8, and 2/9 vectors have been reported to transduce
photoreceptors but with a rod predominance.(18-20) Similarly, it has been shown that
rAAV2/2, 2/5, and 2/8 transduce canine photoreceptors, also with a rod predominance.
(21-24) Furthermore, a study in nonhuman primates showed strong rod transduction by
rAAV2/2 and 2/8, but with some cone transduction.(25) Similarly, another nonhuman
primate study showed strong rod transduction by rAAV2/2 and 2/8 but, similar to our
findings in the feline, cone and rod transduction with rAAV2/9.(25) Also similar to our
findings, a study investigating rAAV2/5 and 2/8 transduction showed both rod and cone
transduction in the high cone/rod ration porcine retina at comparable doses.(26) Studies
have shown that dosage affects cone transduction with greater cone transduction at
higher doses noted for rAAV2/2, rAAV2/5, and rAAV2/8.(16, 26) The high dose we used
may have contributed to the high cone transduction; however, the relatively poorer rod
transduction cannot be explained by this dosage phenomenon and points to possible
species differences in cone and rod receptor populations. Studies investigating
expression of rAAV serotype-specific receptors on feline photoreceptors may clarify this
species difference. Moreover, our findings that rAAV2/2 transduced only RPE in murine

!180

retinas is in contrast to other studies reporting photoreceptor transduction.(27, 28) This
could reflect a slower onset of photoreceptor versus RPE expression from rAAV2/2 in
the mouse, or may, conversely, reflect expression “turn-off” as was observed for this
vector in some feline retinas. As mice were not euthanized until at least 55 days post
injection, it is possible that the murine retina responded to rAAV2/2 similarly to the feline
retina and experienced expression turn-off prior to histological evaluation.
In the cat, GFP expression in two out of three rAAV2/2 injected eyes dramatically
decreased as early as 21 days post-injection. Histological findings in these eyes
showed subjectively thinned retinas with disruption of normal retina architecture, most
notable in the outer nuclear layer. These findings are similar to a report of rAAV2/2injected primate retinas.(16) These findings were most obvious within the region of the
subretinal injection; however, retinal histology outside of the subretinally injected region
also showed mild retinal thinning and disorganization. Hematoxylin and eosin staining of
sections of the posterior eyecup of these eyes showed a plasmacytic and lymphocytic
infiltration of the retina, choroid and vitreous.
To evaluate inner retinal transduction, co-labeling for protein kinase c-alpha,
calbindin, calretinin, and glutamine synthetase was performed. Protein kinase c-alpha
labeled rod bipolar cells were not co-labeled for GFP, and similarly, calretinin and
calbindin antibodies, both of which label certain inner retinal cells including horizontal
cells, did not colabel with GFP. These results suggest that the vectors evaluated do not
transduce bipolar or horizontal cells in the cat from a subretinal injection. Glutamine
synthetase was used as a marker for Müller cells and showed substantial colabeling
with GFP from all vectors (Figure 5.S1). Glial fibrillary acidic protein (GFAP) was used

!181

as a marker for activated Müller cells and also showed co-labeling with GFP. Glial
fibrillary acidic protein expression is increased in various retinal degenerative and
inflammatory conditions, and positive labeling may therefore indicate glial cell activation
associated with the therapy. Subjectively, glial fibrillary acidic protein labeling was more
extensive in eyes with brighter GFP fluorescence, suggesting that stronger GFP
expression may be associated with greater activation of retinal glia.(29) (Table 5.4,
Figure 5.S1).

Figure 5.4: Histological sections showing GFP expression in other parts of the
feline eye. (a). Representative histological image of the ciliary body from an
rAAV2/2-injected eye illustrating transduction of cells within the stroma of the ciliary
processes. There were similar findings for all vector types. (b) Histological sections
of optic nerve from each vector. rAAV 2/8, 2/9 and 2/2 showed transduction of the
optic nerve, with 2/8 showing the strongest transduction. rAAV2/5 showed no
transduction of the optic nerve. Scale bar = 100 microns.
!182

Transverse sections through the optic nerves showed a well-defined region of
GFP labeling in all eyes injected with rAAV2/2, rAAV2/8, and rAAV2/9, but not those
injected with rAAV2/5 (Figure 5.4).
Subjectively, the GFP labeling in the optic nerve was brightest in rAAV2/8 eyes,
followed by rAAV2/9, and weakest in rAAV2/2. Further investigation is required to
determine if transgene expression spreads to the brain as showed in dogs and rats
following subretinal injection of rAAV2/8.(30, 31) Stromal cells in the ciliary body and iris
leaflet of all eyes labeled positive for GFP (Figure 5.4).
Exposure of these tissues to vector may have resulted from leakage from the
subretinal injection site into the vitreous. There was no GFP labeling of the cornea or
lens in any eyes.

5.4.3 Immune response
A neutralizing antibody assay was used to detect serum antibodies directed
against the vectors in five cats; three cats that received rAAV2/2 in one eye and
rAAV2/9 in the contralateral eye, and two cats that received rAAV2/5 in one eye and
rAAV2/8 in the contralateral eye. Serum neutralizing antibodies to both injected rAAV
serotypes were detected in each cat (Figure 5.5a). The highest titer of neutralizing
antibodies was to rAAV2/8, followed by rAAV2/2, rAAV2/5, and rAAV2/9. Development
of neutralizing antibodies to rAAV capsids has been reported in other large animal
models following injection into the immune-privileged subretinal space.23, 24 This
highlights the importance of considering possible systemic immune reactions to rAAVs
when

!183

Figure 5.5: Immune responses to the rAAV serotypes and to GFP. (a)
Quantification of Nab assay reported as the reciprocal of the most dilute serum
concentration that blocked infections (+s.e.m.). Note that the antibody response to
rAAV2/2 was significantly greater than that to rAAV2/9, there were no other
significant differences. (b) Indirect ELISA detecting anti-GFP antibodies in the serum,
reported relative to a naïve cat (+s.e.m.). Cats injected with rAAV2/2 and 2/9 showed
a significantly higher response to GFP than those injected with rAAV2/5 and 2/8.
Both assays were performed in triplicate. For animals exposed to rAAV2/2 and
rAAV2/9, n = 3 and for rAAV2/5 and rAAV2/8, n = 2.

!184

conducting gene therapy trials. The immune response to GFP in the five cats was
analyzed using an ELISA (Figure 5.5b). Cats injected with rAAV2/2 and rAAV2/9 had a
greater titer of anti-GFP antibodies than cats injected with rAAV2/5 and rAAV2/8 (MannWhitney Rank Sum Test, p= 0.002). The inflammation and decrease in GFP expression
noted in some rAAV2/2 injected eyes may be associated with the initial strong GFP
expression either as a direct toxic effect or as a result of immune destruction. It is of
note that GFP expression did not decrease in the contralateral rAAV2/9 treated eyes,
suggesting either a direct toxic effect rather than a circulating antibody response, or that
the blood-retinal barrier remained intact in the contralateral eye. Future studies
analyzing the immune response in cats injected with a single vector serotype will be
important to clarify these findings. Hematoxylin and eosin staining was performed to
analyze inflammatory infiltration. Eighteen of 20 eyes showed at least mild
lymphoplasmacytic inflammatory infiltration, with significant variation between individual
eyes. Overall, infiltration was most prominent in rAAV2/9 eyes followed by rAAV2/2, then
rAAV2/8, and lastly rAAV2/5 with average total infiltration scores of 9.25/12, 6.5/12,
4.7/12, and 1.3/12, respectively. Statistically, infiltration was significantly higher in
rAAV2/9 eyes than rAAV2/5 eyes (Kruskal-Wallis one way analysis of variance; P =
0.01). In all cases, the infiltration was evident across the entire retina; however, in 5/20
eyes (1 rAAV2/5, 2 rAAV2/8 and 2 rAAV2/9), the infiltration was subjectively slightly
greater in the region of the bleb.
We have demonstrated that a variety of rAAV serotypes transduce feline
photoreceptors. More efficient transduction of cones compared to rods differs from other
species and highlights that extrapolating vector tropism between species should be

!185

made with caution. Three of the four vectors resulted in GFP presence in ganglion cell
axons within the optic nerve. Central nervous system (CNS) transmission of vectors
should be considered in future safety studies. The use of tissue-specific promoters may
help confine expression to selected target cells, reducing or preventing off-target
transgene expression.(32) Immune responses following rAAV gene therapy may be
directed at the vector or the expressed transgene. In humans, it is estimated that up to
60% of the population has been exposed to AAV; priming of the immune system to
AAVs may predispose clinical patients to even greater immune reactions than seen in
pre-clinical animal studies.(33) Injecting vector through a retinotomy, as used here, may
allow reflux into the vitreous. As intravitreal administration of rAAVs has been
associated with an immune response that can interfere with subsequent transduction
events even by the subretinal route,(34, 35) administration route of rAAV retinal gene
therapy should be carefully considered. Furthermore, vector titer is known to have a
significant effect on the immune response.(29) The titer used here may be higher than
needed for adequate therapeutic transgene expression and lower effective titers might
reduce the risk of immune-related side effects. Lastly, the only immune modulating
therapy used in this study was a single subconjunctival steroid injection immediately
post-injection. Additional immunosuppression may be useful to prevent inflammation
and subsequent loss of transgene expression.(36-38)
In conclusion, the tested vectors showed preferential cone transduction making
them particularly suited for therapy targeted at cone photoreceptors. Further studies
testing additional vector and promoter combinations are required to identify the optimal
construct for targeting both rods and cones for gene therapy trials in the Crx and

!186

Cep290 mutant cat models. Further studies are also necessary to better characterize
the central nervous system transmission of rAAV vectors and investigate any associated
immune responses.

!187

5.5 Acknowledgments

Funding for this study was provided by the Grousbeck Family Foundation, the Hal and
Jean Glassen Memorial Foundation, the Myers Dunlap Endowment (to SMP-J) and
research grants from the National Institutes of Health (8DP1EY023177 and
1R24EY019861 to JB, and T32OD011167 to Michigan State University), Foundation
Fighting Blindness, and Research to Prevent Blindness. We would like to thank Janice
Querubin and Lisa Allen for their assigstance and animal care, and Cheryl Craft for
providing the cone arrestin antibody.

!188

5.6 Supplemental Information

Figure 5.S1: Müller cell transduction. (A) Glutamine synthetase labeling shows
overlap with GFP, indicating transduction of Müller cells. (B) The degree of GFAP
expression varied between the vectors and is indicative of the degree of glial activation.
GFAP expression was most prominent in rAAV2/2 injected eyes (top row), which also
had outer nuclear layer thinning and disorganization. Scale bar = 100µm.

!189

REFERENCES

!190

REFERENCES

1.
Stone EM. Leber congenital amaurosis - a model for efficient genetic testing of
heterogeneous disorders: LXIV Edward Jackson Memorial Lecture. Am J Ophthalmol.
2007;144(6):791-811.
2.
Menotti-Raymond M, David VA, Schaffer AA, Stephens R, Wells D, Kumar-Singh
R, et al. Mutation in CEP290 discovered for cat model of human retinal degeneration.
Journal of Heredity. 2007;98:211-20.
3.
Menotti-Raymond M, Deckman KH, David V, Myrkalo J, O'Brien SJ, Narfstrom K.
Mutation discovered in a feline model of human congenital retinal blinding disease.
Invest Ophthalmol Vis Sci. 2010;51(6):2852-9.
4.
Furukawa T, Morrow EM, Cepko CL. Crx, a novel otx-like homeobox gene, shows
photoreceptor-specific expression and regulates photoreceptor differentiation. Cell.
1997;91:531-41.
5.
Acland GM, Aguirre GD, Ray J, Zhang Q, Aleman TS, Cideciyan AV, et al. Gene
therapy restores vision in a canine model of childhood blindness. Nat genet. 2001;28(1):
92-5.
6.
Beltran WA, Cideciyan AV, Lewin AS, Iwabe S, Khanna H, Sumaroka A, et al.
Gene therapy rescues photoreceptor blindness in dogs and paves the way for treating
human X-linked retinitis pigmentosa. Proc Natl Acad Sci U S A. 2012;109(6):2132-7.
7.
Rah H, Maggs DJ, Blankenship TN, Narfström K, Lyons LA. Early-onset,
autosomal recessive, progressive retinal atrophy in Persian cats. Invest
OphthalmolVisSci. 2005;46:1742-7.
8.
Buch PK, Bainbridge JW, Ali RR. AAV-mediated gene therapy for retinal
disorders: from mouse to man. Gene Ther. 2008;15:849-57.
9.
Ho TT, Maguire AM, Aguirre GD, Surace EM, Anand V, Zeng Y, et al. Phenotypic
rescue after adeno-associated virus-mediated delivery of 4-sulfatase to the retinal
pigment epithelium of feline mucopolysaccharidosis VI. J Gene Med. 2002;4(6):613-21.
10.
Bainbridge JW, Mistry A, Schlichtenbrede FC, Smith A, Broderick C, De Alwis M,
et al. Stable rAAV-mediated transduction of rod and cone photoreceptors in the canine
retina. Gene Ther. 2003;10(16):1336-44.
11.
Petersen-Jones SM, Bartoe JT, Fischer AJ, Scott M, Boye SL, Chiodo V, et al.
AAV retinal transduction in a large animal model species: comparison of a self-

!191

complementary AAV2/5 with a single-stranded AAV2/5 vector. Mol Vis.
2009;15:1835-42.
12.
Tan MH, Smith AJ, Pawlyk B, Xu X, Liu X, Bainbridge JB, et al. Gene therapy for
retinitis pigmentosa and Leber congenital amaurosis caused by defects in AIPL1:
effective rescue of mouse models of partial and complete Aipl1 deficiency using AAV2/2
and AAV2/8 vectors. Hum Mol Genet. 2009;18(12):2099-114.
13.
Mowat FM, Breuwer AR, Bartoe JT, Annear MJ, Zhang Z, Smith AJ, et al. RPE65
gene therapy slows cone loss in Rpe65-deficient dogs. Gene Ther. 2013;20(5):545-55.
14.
Kay MA, Manno CS, Ragni MV, Larson PJ, Couto LB, McClelland A, et al.
Evidence for gene transfer and expression of factor IX in haemophilia B patients treated
with an AAV vector. Nat Genet. 2000;24(3):257-61.
15.
Carpentier G, Henault E, editors. Protein array analyzer for ImageJ. Proceedings
of the ImageJ User and Developer Conference; 2010; Centre de Recherche Public.
16.
Vandenberghe LH, Bell P, Maguire AM, Cearley CN, Xiao R, Calcedo R, et al.
Dosage thresholds for AAV2 and AAV8 photoreceptor gene therapy in monkey. Sci
Transl Med. 2011;3(88):88ra54.
17.
Rabinowitz JE, Rolling F, Li C, Conrath H, Xiao W, Xiao X, et al. Cross-packaging
of a single adeno-associated virus (AAV) type 2 vector genome into multiple AAV
serotypes enables transduction with broad specificity. Journal of virology. 2002;76(2):
791-801.
18.
Allocca M, Mussolino C, Garcia-Hoyos M, Sanges D, Iodice C, Petrillo M, et al.
Novel adeno-associated virus serotypes efficiently transduce murine photoreceptors. J
Virol. 2007;81(20):11372-80.
19.
Natkunarajah M, Trittibach P, McIntosh J, Duran Y, Barker SE, Smith AJ, et al.
Assessment of ocular transduction using single-stranded and self-complementary
recombinant adeno-associated virus serotype 2/8. Gene Ther. 2008;15:463-7.
20.
Lebherz C, Maguire A, Tang W, Bennett J, Wilson JM. Novel AAV serotypes for
improved ocular gene transfer. J Gene Med. 2008;10(4):375-82.
21.
Beltran WA. The use of canine models of inherited retinal degeneration to test
novel therapeutic approaches. Vet Ophthalmol. 2009;12(3):192-204.
22.
Bainbridge JWB, Mistry A, Schlichtenbrede FC, Smith A, Broderick C, De Alwis
M, et al. Stable rAAV-mediated transduction of rod and cone photoreceptors in the
canine retina. Gene Ther. 2003;10(16):1336-44.

!192

23.
Acland GM, Aguirre GD, Bennett J, Aleman TS, Cideciyan AV, Bennicelli J, et al.
Long-term restoration of rod and cone vision by single dose rAAV-mediated gene
transfer to the retina in a canine model of childhood blindness. Molecular therapy : the
journal of the American Society of Gene Therapy. 2005;12(6):1072-82.
24.
Stieger K, Colle MA, Dubreil L, Mendes-Madeira A, Weber M, Le Meur G, et al.
Subretinal delivery of recombinant AAV serotype 8 vector in dogs results in gene
transfer to neurons in the brain. Molecular Therapy. 2008;16(5):916-23.
25.
Vandenberghe LH, Bell P, Maguire AM, Xiao R, Hopkins TB, Grant R, et al. AAV9
targets cone photoreceptors in the nonhuman primate retina. PLoS One.
2013;8(1):e53463.
26.
Mussolino C, della Corte M, Rossi S, Viola F, Di Vicino U, Marrocco E, et al. AAVmediated photoreceptor transduction of the pig cone-enriched retina. Gene therapy.
2011;18(7):637-45.
27.
Gao G, Vandenberghe LH, Wilson JM. New recombinant serotypes of AAV
vectors. Current gene therapy. 2005;5(3):285-97.
28.
Lei B, Zhang K, Yue Y, Ghosh A, Duan D. Adeno-associated virus serotype-9
mediated retinal outer plexiform layer transduction is mainly through the photoreceptors.
Advances in experimental medicine and biology. 2010;664:671-8.
29.
Beltran WA, Boye SL, Boye SE, Chiodo VA, Lewin AS, Hauswirth WW, et al.
rAAV2/5 gene-targeting to rods:dose-dependent efficiency and complications associated
with different promoters. Gene Ther. 2010;17(9):1162-74.
30.
Stieger K, Colle MA, Dubreil L, Mendes-Madeira A, Weber M, Le MG, et al.
Subretinal delivery of recombinant AAV serotype 8 vector in dogs results in gene
transfer to neurons in the brain. MolTher. 2008;16:916-23.
31.
Dudus L, Anand V, Acland GM, Chen SJ, Wilson JM, Fisher KJ, et al. Persistent
transgene product in retina, optic nerve and brain after intraocular injection of rAAV.
Vision research. 1999;39(15):2545-53.
32.
Mancuso K, Hendrickson AE, Connor TB, Jr., Mauck MC, Kinsella JJ, Hauswirth
WW, et al. Recombinant adeno-associated virus targets passenger gene expression to
cones in primate retina. J Opt Soc Am A Opt Image Sci Vis. 2007;24(5):1411-6.
33.
Boutin S, Monteilhet V, Veron P, Leborgne C, Benveniste O, Montus MF, et al.
Prevalence of serum IgG and neutralizing factors against adeno-associated virus (AAV)
types 1, 2, 5, 6, 8, and 9 in the healthy population: implications for gene therapy using
AAV vectors. Hum Gene Ther. 2010;21(6):704-12.

!193

34.
Anand V, Duffy B, Yang Z, Dejneka NS, Maguire AM, Bennett J. A deviant
immune response to viral proteins and transgene product is generated on subretinal
administration of adenovirus and adeno-associated virus. MolTher. 2002;5(2):125-32.
35.
Li Q, Miller R, Han PY, Pang J, Dinculescu A, Chiodo V, et al. Intraocular route of
AAV2 vector administration defines humoral immune response and therapeutic
potential. Mol Vis. 2008;14:1760-9.
36.
Chirmule N, Xiao W, Truneh A, Schnell MA, Hughes JV, Zoltick P, et al. Humoral
immunity to adeno-associated virus type 2 vectors following administration to murine
and nonhuman primate muscle. J Virol. 2000;74(5):2420-5.
37.
Halbert CL, Standaert TA, Wilson CB, Miller AD. Successful readministration of
adeno-associated virus vectors to the mouse lung requires transient
immunosuppression during the initial exposure. J Virol. 1998;72(12):9795-805.
38.
Kay MA, Meuse L, Gown AM, Linsley P, Hollenbaugh D, Aruffo A, et al. Transient
immunomodulation with anti-CD40 ligand antibody and CTLA4Ig enhances persistence
and secondary adenovirus-mediated gene transfer into mouse liver. Proc Natl Acad Sci
U S A. 1997;94(9):4686-91.

!194

CHAPTER 6
DISCUSSION AND FUTURE DIRECTIONS

!195

The CEP290 mutant cat provides a valuable large animal model for studying
retinal dystrophies caused by mutations in this gene. With an eye similar in size and
proportions to the human eye, a central retina semi-homologous to the human macula,
and a spontaneous mutation in this gene, there is great opportunity for investigation.
Understanding the phenotype and molecular underpinning of the disease in cats is
imperative as we move towards using this model for treatment trials. Furthermore,
assessing treatment modalities in vitro and identifying optimal delivery vectors are
necessary steps before reaching these trials. This dissertation aims to better
understand the CEP290 mutant feline, to determine objective markers for assessing
disease progression and treatment planning and assessment, to evaluate delivery
vehicles in the feline, and to work towards a genome editing treatment for this model.
We start by showing that the CEP290 mutant cat produces a low-level of wildtype transcript, showing use of the wild-type splice donor site even in the presence of
the mutation-created splice donor site. Additionally, we show that there is also
production of truncated mutant transcript, suggesting the possibility that mutant cats
could produce both full-length wild-type protein as well as truncated protein. Automated
western blot analysis, though proving difficult to differentiate between the full-length and
truncated proteins which are close in size, provides evidence that suggests mutant cats
do produce both wild-type and truncated protein. Given the predicted mild effect on the
protein predicted by the truncation, we suspect the truncated protein has residual
function. We therefore hypothesize that the milder phenotype seen in the cat, relative to
most human CEP290 retinopathy patients, is due to CEP290 function resulting from the
presence of both wild-type and truncated protein.

!196

This interesting finding maybe also hold implications for treatment development
against these diseases. These results may suggest that even with truncation the
CEP290 protein remains at least partially functional. This finding is significant given the
limitations caused by the large size of the CEP290 gene, which precludes packaging of
the full transcript into the retinal gene therapy vector of choice, the adeno-associated
viral (AAV) vector. Given findings in a zebrafish model that suggest a partial transcript
could be sufficient to improve vision in CEP290 retinopathy patients, our findings
suggesting that truncated protein may be produced and may retain some functionality
suggest that this could be true in higher order animals as well. To build on this, future
studies should test progressively more truncated transcript to determine what length
and segments of the CEP290 gene are necessary for improvement in vision in higher
order animals, such as in the rd16 mouse or the CEP290 mutant cat. It must be
determined if half transcript length, the length that would fit in an AAV vector, would be
sufficient for improvement in vision.
The milder phenotype with a later-onset and slowly-progressing retinopathy has
been well described in the literature but an element of the disease phenotype warranted
further clarification- the regional rate of retinal degeneration. This was another important
question as people with CEP290 retinopathies typically show a characteristic
preservation of the central retina. Given the presence of an area centralis in the cat and
the resultant utility of cat models for studying central retinal disease, it was important to
definitively clarify whether the cat also shows slower degeneration in the central retina
relative to other retinal regions. To study this we utilized spectral-domain optical
coherence tomography (SD-OCT), a tool never used in the CEP290 cat that can provide

!197

valuable information in vivo. Using SD-OCT we were able to study the regional
degeneration of the retina over time. Our results show that mutant cats do show slower
degeneration in the central retina, similar to the pattern of degeneration seen in people.
This strengthens the CEP290 cat as a model for CEP290 retinopathies and also means
this model has great potential for studying treatments aimed at the central retina. Given
the higher density of photoreceptor cells and the higher proportion of cones, treatments
aimed at this region may respond differently to components of treatment such as the
retinal detachment caused by subretinal injection. As such, testing of central retinal
treatments in an animal model is integral before human clinical trials can be pursued.
Additionally, tools for following disease progression, treatment efficacy, and for
targeting treatments, are necessary to pursue these pre-clinical trials. Though our
studies and the characteristic central retinal sparing seen in LCACEP290 patients suggest
that treatment should target the central retina, it remains important to have methods to
identify regions of a patient’s retina that will best respond to therapy. SD-OCT can
provide this tool, with in vivo monitoring of cell layer thickness and retinal architecture.
The finding in people that the ellipsoid zone (EZ), a layer discernible on OCT, can be
used to identify retinal regions with more preserved photoreceptor cells is an exciting
finding that warranted study in the cat model. We therefore analyzed the EZ in our
mutant cats and found that, as seen in people, this layer is discernible in more
preserved regions and loses integrity or disappears altogether in more degenerate
regions. Assessment of the integrity of this layer therefore provides a valuable tool for
quickly and effectively assessing regional photoreceptor health. In the future, this tool
should be used to further follow disease progression and for treatment trials. During

!198

planning of treatment testing the EZ could be utilized to determine where treatments
should be targeted. Following treatment instigation, the EZ can be assessed along with
retinal layer thicknesses to assess retinal rescue. Conversely, retinal regions with poor
EZ integrity could also be targeted with treatments, after which the effect of the
treatment on the EZ could be studied. This may provide valuable information regarding
treatment timing. Since LCACEP290 is a childhood disease and may go undiagnosed in
earlier stages of disease, pushing the temporal limits of treatment trials may help us
develop treatments that could be used in later stages of disease. If we can develop
treatments that could target retinal regions that show loss of EZ integrity, suggesting a
more degenerate retina, and can lead to rescue of this EZ, this would suggest the
treatment could be used after photoreceptor loss has begun, a useful finding that could
lead to better treatments for later-stage patients.
Unfortunately, the slowly progressing nature of this disease is actually a research
limitation that we have found makes it difficult to study treatments. Studying treatments
in this model, for example, would be difficult as it would take years of post-treatment
monitoring to appreciate any rescue of vision. The milder nature of the phenotype also
makes it more difficult to identify objective markers for treatment monitoring, as the cats
simply do not show as many significant differences from wild-type cats as one would
find in a more severe model. This held true when we studied ciliation in fibroblast cells
grown from mutant cats. In an effort to identify an objective marker in fibroblast cells that
we anticipated using for treatment development, we induced ciliation in these cells and
studied cilia length across genotypes. Given the ciliary location and function of the
CEP290 protein, it is logical that loss of this protein or its function would lead to stunted

!199

ciliation in mutant cells. However, given the milder phenotype seen in the cats and the
hypomorphic situation we confirmed, we were suspicious that the residual CEP290
protein and function would be sufficient for mutant cells to produce normal length cilia.
However, recognizing the potential utility of this simple measurement if there was a
difference between mutant cells and wild-type or carrier cells, we felt it was important to
study to definitively determine if this could be used as a marker. As we suspected
however, mutant cats showed no defect in ciliation of fibroblast cells, with cilia that were
nearly identical in length to those grown by wild-type and heterozygous cells. Cilia
length is therefore not a useful marker and future studies should be aimed at identifying
differences between mutant and wild-type/heterozygous cells such that treatment
testing in cells can be thoroughly assessed.
The cells we grew and verified still provide a valuable in vitro tool that holds great
utility. The cells can be used for developing, studying, and fine-tuning treatments before
taking these treatments into the cat model. This provides a quicker and easier tool for
this treatment development and would allow for the reduction of animal numbers and
trial cost as treatments could be optimized in the cells rather than in the cats
themselves. One such treatment type that could be effectively tested in the cells are
CRISPR/Cas9 nuclease based therapies. CRISPR-Cas9 nuclease therapies have
shown great promise against a variety of inherited diseases, with the power to
genetically edit the genome for purposes such as removing mutations, inserting new
sequences, and knocking out genes. These treatments require considerable fine-tuning
however. Our cells provide an ideal tool for this purpose. Using these cells we have
been able to show successful RNA transfection of feline cells, as well as appropriate

!200

cutting of the mutant sequence. Future studies should therefore aim to successfully
insert the desired sequence. In our initial attempts at CRISPR/Cas9 nuclease treatment
development we also attempted to use a “nickase” method to reduce off-target
mutagenesis. This method was not successful in feline cells in our trials but would be a
valuable and potentially safer treatment. Further studies to troubleshoot this method in
the feline is therefore also worthwhile.
Additionally, these steps could potentially be even more quickly studied if the
phenotype were modified to increase severity. This is another potential advantage of the
in vitro tool- the potential to genetically modify these cells to make the phenotype more
severe, creating a more useful tool that would show more obvious differences from wildtype cells. Once successful editing is achieved in the cells, these developed and
optimized treatments can then be taken into the cat model for in vivo treatment testing.
Similarly, genome editing could be utilized to make the phenotype more severe in the
actual cat by editing blastocysts for example. Though ambitious, this strategy could
allow for the creation of a new CEP290 mutant cat model that would have a more
severe disease with faster progression that would be even more useful for treatment
trials. It would also conceivably be possible to generate a cat that had the same deep
intronic cryptic exon as in patient with LCACEP290.
For delivering a variety of treatments to the retina, a vector for delivery is
necessary. The above discussed partial transcript or CRISPR therapies for example,
would require a vehicle for delivery of the transcript, CRISPR components, or CRISPRcorrected induced pluripotent stem cells to the retina. A large body of research has
shown that the ideal vector for delivery to the retina is the AAV vector, however, very

!201

limited testing of these vectors had been done in the feline retina. This testing was
important as significant species differences in vector characteristics such as cellular
tropism have been found in previous studies. We therefore tested four of the most
commonly used hybrid AAV vectors in the wild-type feline retina. Interestingly, we found
that the four vectors show stronger targeting of cone photoreceptor cells than rod cells,
a finding that reiterates the species differences in cellular tropism and speaks to the
need to use caution when extrapolating between species. However, these findings set
the stage for AAV testing in the feline and provide valuable information that can be used
as studies move toward any treatment testing in the feline retina that utilizes AAV
vectors as the delivery vehicle. Further studies are warranted to study additional vectors
and modifications to vectors to determine the ideal vectors for use in the feline retina.
This vector can then be utilized for in vivo treatment testing, such as testing of those
treatments mentioned above.
The CEP290 mutant feline is a valuable tool for understanding CEP290
retinopathies and for developing treatments against them. In this dissertation we provide
a better understanding of the model and lay the groundwork for treatment development.
Further studies are necessary to fine-tune the CRISPR-Cas9 nuclease treatment and to
determine objective markers in this slowly-degenerating model. Once these aims are
achieved, in vivo treatment trials in this model could provide valuable data as the field
works towards treatments that could be tested in human clinical trials.

!202