NEUROTENSIN ENGAGES MESOLIMBIC DOPAMINE CIRCUITS
TO REGULATE BODY WEIGHT
By
Hillary L. Woodworth
A DISSERTATION
Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of
Physiology—Doctor of Philosophy
2017
ABSTRACT
NEUROTENSIN ENGAGES MESOLIMBIC DOPAMINE
CIRCUITS TO REGULATE BODY WEIGHT
By
Hillary L. Woodworth
Body weight is determined by feeding and volitional physical activity behaviors that are
regulated, in part, by dopamine (DA) neurons of the ventral tegmental area (VTA). Here, we
sought to understand how the neuropeptide, neurotensin (Nts) engages VTA DA neurons to
modify body weight. The rationale for this work is that pharmacologic application of Nts into the
VTA suppresses food intake and promotes locomotor activity, yet the endogenous circuits by
which Nts acts on the VTA to modify these behaviors and body weight remain unclear. First, we
identified the endogenous sources of Nts input to the VTA; using retrograde tracing we found
that the lateral hypothalamic area (LHA), a critical neural hub for coordinating energy balance,
provides substantial Nts projections to the VTA. We next examined how Nts directly engages
VTA DA neurons by identifying Nts receptor-expressing cells in the VTA. To do this, we
generated mice expressing Cre-recombinase in Nts receptor 1 (NtsR1) or Nts receptor 2
(NtsR2) cells, which revealed that NtsR1 is expressed on many VTA DA neurons, whereas
NtsR2 is predominantly restricted to glial cells. Furthermore, only the VTA NtsR1 neurons
project to the nucleus accumbens (NA), where DA release is known to modify feeding and
locomotor behavior. We therefore tested the physiologic necessity for Nts action via the VTA by
genetically ablating VTA NtsR1 neurons. Mice lacking VTA NtsR1-DA neurons were
hyperactive, failed to gain weight, and could not appropriately coordinate feeding behavior with
peripheral energy cues, demonstrating that VTA NtsR1 neurons are essential for energy
balance. Finally, we tested the hypothesis that endogenous Nts input from the LHA to the
mesolimbic DA system would be sufficient to regulate body weight. Indeed, chemogenetic
activation of LHA Nts neurons increased physical activity, restrained food intake, and promoted
weight loss in lean mice. Interestingly, the anorectic effects of LHA Nts activation were
mediated via NtsR1 and DA signaling, while the physical activity was NtsR1-independent.
Furthermore, in hungry mice (a state in which increased appetitive drive can promote overeating
and weight gain), activation of LHA Nts neurons suppressed intake of chow and palatable
sucrose rewards. Collectively, this work defines an endogenous LHA Nts circuit that engages
the mesolimbic DA system via NtsR1 to suppress food intake in both energy replete and energy
depleted states. Enhancing action via this circuit may thus be useful to support dual weight loss
behaviors in an obesogenic environment.
To my family, labmates, and mentors
iv
ACKNOWLEDGEMENTS
First, I would like to thank Dr. Gina Leinninger for her unremitting support,
encouragement and enthusiasm over the last five years. Not only are you my mentor, but you
are also an authentic role model, leader, and teacher whom I admire for your communication
skills and respect for others. Thank you for showing me how much fun science can be, for
being my advocate, and for always helping me feel like my work was valued. It’s been an honor
and a privilege to be your graduate student.
I also want to thank Dr. Steve Heidemann, a long-time mentor whom I first met as an
undergraduate and who connected me to Gina Leinninger. Your kind, sage, and honest advice
helped guide my career trajectory toward the right track on multiple occasions and I can’t
express how much I appreciate it. I would like to thank Drs. Michelle Mazei-Robison and A.J.
Robison for always having open doors and being willing to help me with experiments and give
advice. I would also like to thank my thesis committee members, Drs. Michelle Mazei-Robison,
Cheryl Sisk, Alex Johnson, and Bob Wiseman for helpful suggestions, discussion, and support.
I am indebted to three talented undergraduate students who made substantial
contributions to the project: Hannah Batchelor, Trevor Lewis and Bethany Beekly. Thank you for
your willingness to learn, constant curiosity, and attention to detail. Your hard work made a
huge difference and I couldn’t be more proud to have been your mentor. I would like to thank all
the members of the Leinninger lab—Raluca Bugescu, Juliette Brown, Gizem Kurt, Patricia
Perez-Bonilla, and Laura Schroeder, for being my support system and treating me to some of
the best philosophical conversations with many laughs over food and drinks. Much of this work
would not have been possible without Sandra O’Reilly—I truly appreciate how consistent and
thorough you were with my metabolism experiments. Many members of the Mazei-Robison and
Robison labs helped me on numerous occasions with behavioral experiments, particularly
v
Andrew Eagle and Ken Moon. I am so grateful for the hours you spent helping me set up
equipment, answering my questions, and looking at my data.
None of this work would have possible without the animal care staff—thank you for
taking such good care of our mice. I’d also like to thank Susanne Mohr and Cindy Arvidson for
providing me with support and guidance as a student in the Physiology PhD Program and MSU
MD/PhD Program. Finally, I would to express my gratitude for the entire Physiology faculty and
staff who have been continuously helpful, friendly, and interested. Thank you for making me feel
at home for the past five years.
This work was supported by the NIDDK: HLW (F30-DK107163) and GML (R01-DK103808).
vi
TABLE OF CONTENTS
LIST OF FIGURES ...................................................................................................................ix
KEY TO ABBREVIATIONS .......................................................................................................xi
Chapter 1. A Weighty Introduction: Neurotensin and Dopamine Circuits that Regulate
Energy Balance ........................................................................................................................1
1.1 Background and Significance ...........................................................................................1
1.2 Coordination of Energy Balance ...................................................................................... 3
1.2.1 What is Energy Balance and How Does it Determine Weight? .............................. 3
1.2.2 The Brain Coordinates Energy Balance .................................................................5
1.2.3 The Lateral Hypothalamic Area (LHA) is Essential for Energy Balance .................. 7
1.3 Dopamine Signaling and Body Weight ............................................................................ 9
1.3.1 Dopamine Circuitry, Signaling, and General Function ............................................ 9
1.3.2 Dopamine and Feeding .......................................................................................12
1.3.3 Dopamine and Energy Expenditure .....................................................................16
1.3.4 Neuropeptide Regulation of Dopamine Signaling .................................................17
1.4 Neurotensin Physiology ..................................................................................................19
1.4.1 Discovery, Receptors, and Expression Patterns ..................................................19
1.4.2 Neurotensin and Dopamine Signaling ..................................................................21
1.4.3 Neurotensin and Energy Balance ........................................................................22
1.5 Neurotensin and Dopamine Signaling in Energy Balance Disorders ........................... 24
1.5.1 Is Dopamine Disrupted in Obesity? ......................................................................24
1.5.2 Evidence for Neurotensin in Obesity ....................................................................28
1.6 Goals of the Dissertation .................................................................................................29
REFERENCES ........................................................................................................................33
Chapter 2. Determination of Neurotensin Projections to the Ventral
Tegmental Area in Mice ..........................................................................................................58
2.1 Abstract ............................................................................................................................58
2.2 Introduction ......................................................................................................................59
2.3 Results ..............................................................................................................................61
2.4 Discussion ........................................................................................................................68
2.5 Methods ............................................................................................................................74
APPENDIX ...............................................................................................................................78
REFERENCES .........................................................................................................................91
Chapter 3. Identification of Neurotensin Receptor Expressing Cells in the Ventral
Tegmental Area Across The Lifespan .................................................................................105
3.1 Abstract ..........................................................................................................................105
3.2 Introduction ....................................................................................................................106
3.3 Results ............................................................................................................................108
3.4 Discussion ......................................................................................................................113
3.5 Methods ..........................................................................................................................117
APPENDIX .............................................................................................................................121
REFERENCES .......................................................................................................................129
vii
Chapter 4. Neurotensin Receptor-1 Identifies a Subset of Ventral Tegmental
Dopamine Neurons that Coordinate Energy Balance ......................................................... 137
4.1 Abstract ..........................................................................................................................137
4.2 Introduction ....................................................................................................................137
4.3 Results ............................................................................................................................139
4.4 Discussion .....................................................................................................................145
4.5 Methods ..........................................................................................................................151
APPENDIX .............................................................................................................................159
REFERENCES .......................................................................................................................170
Chapter 5. A Central Neurotensin Circuit That Coordinates Weight Loss Behaviors ..... 176
5.1 Abstract ..........................................................................................................................176
5.2 Introduction ....................................................................................................................176
5.3 Results ............................................................................................................................178
5.4 Discussion ......................................................................................................................185
5.5 Methods ..........................................................................................................................189
APPENDIX .............................................................................................................................196
REFERENCES .......................................................................................................................208
Chapter 6. Summary, Discussion, and Translational Implications.................................... 213
6.1 Summary of Dissertation ...............................................................................................213
6.2 Discussion .......................................................................................................................214
6.2.1 Technical Considerations of Transgenic vs. Knock-in Models to Study
VTA NtsR1 Neurons ...................................................................................................214
6.2.2 Phenotype of Mice Lacking VTA NtsR1 Neurons ............................................... 215
6.2.3 Chemogenetic Activation of LHA Nts Neurons: Limitations and
Future Directions ........................................................................................................217
6.3 Translational Implications ..............................................................................................219
6.3.1 Neurotensin Circuits as a Translational Target .................................................. 219
6.3.2 Final Thoughts on the Challenges of Addressing Obesity .................................. 221
REFERENCES .......................................................................................................................223
viii
LIST OF FIGURES
Figure 1. Schematic of hypothesized neural circuit by which Nts acts to modify
mesolimbic DA signaling and body weight ..........................................................................32
Figure 2. Local Nts expression in the VTA ...........................................................................79
Figure 3. Validation of VTA targeting in NtsCre;GFP mice injected unilaterally with FG .... 80
Figure 4. The NA shell contains clusters of Nts neurons that project to the VTA ............. 81
Figure 5. Cortical Nts inputs to the VTA originate in the CeA but not neocortex ............. 82
Figure. 6. Nts neurons in the IPAC, pallidum, and ST that project to the VTA ................... 83
Figure 7. Sub-regions of the hypothalamus provide Nts afferents to the VTA .................. 84
Figure 8. Brainstem Nts inputs to the VTA ...........................................................................86
Figure 9. Nts-ergic VTA inputs from the LHb and RMTg ....................................................88
Figure 10. Quantification of Nts-expressing afferents to the VTA by anatomical
sub-region ..............................................................................................................................89
Figure 11. Schematic illustration of Nts afferents to the VTA ............................................ 90
Figure 12. Generation of mouse models to identify developmental vs. adult
expression patterns of NtsR1 and NtsR2 ........................................................................... 122
Figure 13. Developmental vs. adult expression of NtsR1 and NtsR2 in the VTA ............ 123
Figure 14. NtsR1 and NtsR2 colocalization with TH in development compared to
adulthood .............................................................................................................................124
Figure 15. Ad-syn-mCherry reveals projections of VTA NtsR1 neurons ......................... 126
Figure 16. Projections of VTA NtsR1 neurons .................................................................. 127
Figure 17. Generation of NtsR1Cre;GFP and NtsR2Cre;GFP reporter mice to visualize
NtsR1 and NtsR2 neurons in the VTA .................................................................................160
Figure 18. Distribution and neurochemical phenotype of VTA NtsR1 and NtsR2
neurons .................................................................................................................................161
Figure 19. VTA NtsR1 neurons project to the ventral striatum ........................................ 162
Figure 20. Loss of VTA NtsR1 neurons disrupts energy balance .................................... 163
ix
Figure 21. Water intake and additional metabolic parameters in mice lacking VTA
NtsR1 neurons .....................................................................................................................165
Figure 22. VTA NtsR1 neurons modulate hedonic and motivated ingestive behavior ... 166
Figure 23. Loss of VTA NtsR1 neurons alters response to amphetamine ...................... 167
Figure 24. Anxiety-like behavior assessed via elevated-plus maze ................................ 168
Figure 25. Ablation of VTA NtsR1 neurons decreases markers of DA signaling ............ 168
Figure 26. Virally-induced vs. endogenous GFP reporter expression for identification
of VTA NtsR1 neurons .........................................................................................................169
Figure 27. Examination of the LHA NtsVTA circuit in WT and NtsR1KO mice ............ 197
Figure 28. Acute activation of LHA Nts neurons promotes energy expenditure and
suppresses feeding .............................................................................................................198
Figure 29. Additional acute metabolic data in WT and NtsR1KO mice ........................... 199
Figure 30. Acute NtsR1 or D1R blockade abolishes LHA Nts-induced suppression of
feeding ..................................................................................................................................200
Figure 31. Food intake separated by circadian period with NtsR1 or D1R
antagonists ............................................................................................................................201
Figure 32. Chronic activation of LHA Nts neurons induces mild weight loss in
chow-fed lean mice ..............................................................................................................202
Figure 33. Chronic VEH or CNO injection in WTChR controls ........................................... 202
Figure 34. Repeated activation of LHA Nts neurons does not induce weight loss in
obesity ..................................................................................................................................203
Figure 35. Chronic activation of LHA Nts neurons does not prevent weight gain in lean
mice on HF diet ....................................................................................................................204
Figure 36. Activation of LHA Nts neurons suppresses fasting-induced ad lib and
motivated food intake ..........................................................................................................205
Figure 37. Learning acquisition during operant training .................................................. 206
Figure 38. Assessment of reward, anxiety, and repetitive behaviors associated
with LHA NtsNtsR1 circuit activation .............................................................................. 207
Figure 39. LHA Nts neurons restrain feeding and promote locomotor activity,
in part via NtsR1 and the mesolimbic DA system .............................................................. 222
x
KEY TO ABBREVIATIONS
3N
oculomotor nucleus
3V
third ventricle
4V
fourth ventricle
aca
anterior commissure
AHA
anterior hypothalamic area
APTN
anterior pretectal nucleus
aq
cerebral aqueduct
ARC
arcuate nucleus
ATg
anterior tegmental nucleus
BLA
basolateral amygdala
cc
corpus callosum
CeA
central amygdala
ChR
channel rhodopsin
CNO
clozapine-N-oxide
cp
cerebral peduncle
CPP
conditioned place preference
CPu
caudate/putamen
D1R
dopamine receptor 1
D2R
dopamine receptor 2
D3V
dorsal third ventricle
DA
dopamine
DAT
dopamine transporter
DMH
dorsomedial hypothalamus
DR
dorsal raphe
DREADD
Designer Receptors Exclusively Activated by Designer Drugs
xi
DTg
dorsal tegmental nucleus
EA
extended amygdala
ec
external capsule
En
endopiriform cortex
f
fornix
FG
fluorogold
fr
fasciculus retroflexus
GABA
gamma-aminobutyric acid
GFAP
glial fibrillary acid protein
GFP
green fluorescent protein
GP
globus pallidus
ic
internal capsule
ICV
intracerebroventricular
IL
infralimbic cortex
ip
interpeduncular nucleus
i.p.
intraperitoneal
IPAC
interstitial nucleus of posterior limb of anterior commissure
ISH
in situ hybridization
LDTg
laterodorsal tegmental nucleus
LepRb
leptin receptor
LHA
lateral hypothalamic area
LHb
lateral habenula
LO
lateral orbital cortex
LPO
lateral preoptic area
LS
lateral septum
lv
lateral ventricle
xii
MCH
melanin-concentrating hormone
MCR-4
melanocortin receptor-4
MHb
medial habenula
ml
medial lemniscus
MPN
medial preoptic nucleus
MPO
medial preoptic area
MS
medial septum
α-MSH
alpha-melanocyte stimulating hormone
mt
mammillothalamic tract
NAc
nucleus accumbens core
NAsh
nucleus accumbens shell
ns
nigrostriatal tract
Nts
neurotensin
NtsR1
neurotensin receptor 1
NtsR2
neurotensin receptor 2
OFT
olfactory tubercle
ot
optic tract
OX
orexin/hypocretin
PAG
periaqueductal gray
PBN
parabrachial nucleus
pc
posterior commissure
PFC
prefrontal cortex
POA
preoptic area
PPTg
pedunculopontine tegmental nucleus
PrL
prelimbic cortex
pSTN
para subthalamic nucleus
xiii
PVH
paraventricular hypothalamus
RER
resting energy expenditure
RMTg
rostromedial tegmental nucleus
RLi
raphe linear nucleus
SC
superior colliculus
scp
superior cerebral peduncle
SN
substantia nigra
SPTg
subpedunculuar tegmental nucleus
ST
stria terminalis
STN
subthalamic nucleus
TEA
thermic effect of activity
TEF
thermic effect of food
TH
tyrosine hydroxylase
ts
tectospinal tract
VMH
ventromedial hypothalamus
VP
ventral pallidum
VTA
ventral tegmental area
ZI
zona incerta
xscp
decussation of superior cerebellar peduncle
xiv
Chapter 1. A Weighty Introduction: Neurotensin and Dopamine Circuits
that Regulate Energy Balance
1.1 Background and Significance
Global rates of obesity have grown significantly over the past three decades with >1.9
billion adults qualifying as overweight or obese in 20151,2. Obesity is a particularly serious
problem in the U.S., where almost 70% of adults have a BMI in the overweight or obese
category (>25 kg/m2) and minority populations are disproportionately affected3. U.S. childhood
obesity rates have also sky-rocketed, with 20% of children ages 6-19 qualifying as obese
nation-wide4,5 and rates upwards of 32% are present in certain locations such as the South
Bronx6. Obese children are 80% more likely to be obese as adults and have increased risk of
early death7, and in fact, increased body mass has now surpassed undernutrition as a top
cause of death and disability worldwide8. Furthermore, being overweight increases risk for
developing chronic conditions such as type-2 diabetes, heart disease, stroke, cancer, fatty liver
disease, and kidney disease, conditions that are expensive to treat and reduce quality of life9,10.
The high incidence of obesity already exerts a considerable toll on healthcare systems
worldwide, but the rising costs associated with treating obesity/overweight and concomitant
complications will be unsustainable without intervention11. Curtailing the obesity pandemic is
thus a global health concern of paramount importance.
Despite the overwhelming prevalence of obesity and overweight, few medical strategies
to date have proven effective in maintaining long-term weight loss. The first-line prescription for
weight reduction is diet and exercise, which has been capitalized by the U.S. weight loss
industry, a market worth $60 billion in 201512. While many individuals initially lose weight
through dieting, most do not maintain the weight loss long-term13. A regimen of both diet and
1
exercise is more likely to provide long-term benefit13, however adherence to such lifestyle
modification is notoriously challenging. Given the high likelihood of weight regain, many dieters
enter a vicious cycle of weight cycling or “yo-yo dieting” which increases risk of heart disease,
stroke, and diabetes14. Thus, not only are lifestyle modifications largely ineffective, but repeated
dieting and weight cycling imposes adverse health effects. A handful of pharmacologic agents
have been developed to aid weight loss, but most have side effects and not all are approved for
long-term use15. The effectiveness of obesity medications is typically modest, with most agents
achieving 5% loss of body weight at 1 year16,17. While 5% weight loss can reduce risk of
obesity-related complications, it is not enough to achieve a healthy BMI for most patients.
Additionally, few studies have examined outcomes including potential weight regain after
patients stop taking the medication, thus the long-term effectiveness of anti-obesity drugs is
largely undetermined. Currently, the most effective obesity treatment is bariatric surgery, with
the Roux-en-Y gastric bypass procedure (RYGB) producing an average loss of 5 BMI points at
5 years18,19. In addition to substantial weight loss, bariatric surgery also alleviates obesityrelated type 2 diabetes, hypertension, and joint pain18, plus patients report increased quality of
life after surgery20. The major drawbacks of bariatric surgery include the risk of complications
and the cost which averages $15,000-$25,00021,22. Due to this, surgery is usually reserved as a
last resort for the morbidly obese (BMI>40 kg/m2), which comprise less than 10% of overweight
or obese adults. Thus, moderately overweight or obese individuals who are still at risk for
developing obesity-related complications have limited options for weight control (diet and
exercise or pharmacotherapy), which provide only modest benefit. Therefore, there is a clear
need to develop better strategies to promote weight loss and prevent weight gain to improve
health outcomes for overweight and obese individuals.
It is also vital to understand why the surge in overweight and obesity has occurred, as
this may inform design of interventions to manage body weight. Average caloric intake has
2
increased by around 240 kcals/day since 1970, with most of the increase attributed to
carbohydrates23. Interestingly, fat intake decreased over the same time period as obesity rates
continued to rise, suggesting that excess caloric intake, not high dietary fat consumption,
potentiates weight gain. Further, occupational-associated energy expenditure has progressively
declined since 196024 and only 1 in 5 adults fulfills the recommend amount of daily physical
activity25. Thus, one would speculate that the obesity epidemic is fueled by excess caloric
intake combined with reduced physical activity. While this certainly explains what causes
obesity, it does not explain why individuals overeat and move less. The increasing availability of
palatable, calorie-rich, and inexpensive food has fueled obesity rates26, but what permits caloric
intake in excess of metabolic demands? Under normal circumstances, energy intake is
exquisitely coordinated with energy expenditure in an effort to defend body weight from both
loss and gain27,28. However, these mechanisms are not completely understood and are
impacted by numerous variables (i.e. food palatability, genetics, sedentary lifestyle) that
contribute to the development of obesity. The brain plays an essential role in coordinating
motivated behaviors such as feeding and voluntary physical activity, but the neural circuits
involved remain poorly understood. The purpose of this chapter is thus to provide an overview
of energy balance physiology and describe how disruption of dopamine-mediated feeding and
physical activity behaviors contributes to the development of obesity. We will also evaluate how
the neuropeptide, neurotensin (Nts) may engage dopamine circuits, and hence the potential of
the Nts signaling system as a novel target for weight control.
1.2 Coordination of Energy Balance
1.2.1 What is Energy Balance and How Does it Determine Weight?
The term “energy balance” is used to describe the relationship between energy intake
and expenditure that determines body weight. Energy intake consists of calories consumed
3
through food and liquids. Energy expenditure refers to the calories burned to support basal
metabolism and voluntary physical activity. For most individuals, energy expenditure is the sum
of resting metabolic rate (RMR), the thermic effect of feeding (TEF), and the thermic effect of
activity (TEA)29. RMR comprises 60-75% of total energy expenditure and is the energy required
by the body to perform basic physiologic functions, or more simply, “the number of calories an
individual would use if he/she stayed in bed all day.” TEF accounts for 10% of energy
expenditure and is the energy required for digesting food. TEA can account for 15-30% of
energy expenditure and refers to the additional calories burned through volitional activity and
exercise29. When energy intake exceeds expenditure it creates a caloric surfeit, or “positive
energy balance”, which can be stored in the body as fat and lead to weight gain. Conversely,
when energy expenditure exceeds caloric intake, the body experiences a caloric deficit or
“negative energy balance”; as a result, calories required to support survival are obtained from
adipose reserves, leading to weight loss. At face value, energy balance appears to be a simple
math equation, but its coordination is complex, requiring continuous communication between
the periphery (to sense energy status) and the brain (to appropriately modulate energy intake
and expenditure).
Energy balance is intimately tied to the idea of a body weight “set-point” wherein genetic
and environmental factors determine an individual’s body weight, which is defended through
homeostatic mechanisms that compensate for positive or negative energy balance28. For
example, in controlled over-feeding studies, total energy expenditure increases and appetite
decreases as the body attempts to deplete the caloric surplus30,31. Similarly, weight loss leads
to increased appetite and reduced energy expenditure that drives recovery of lost body weight
and indeed, most people who lose weight gain it back32-36. Cota et al. provide a salient example
of just how tightly the body coordinates energy balance: the average adult male uses around
900,000 calories per year and only gains (on average) one pound or 3600 extra calories during
4
that time, which amazingly amounts to >99% accuracy in matching food intake with energy
expenditure27. Although energy balance is exquisitely fine-tuned in the short-term, small,
incremental weight gain over years is thought to contribute to obesity. As such, the body weight
set-point slowly drifts upward with time28, and losing weight after being overweight or obese for
several years is extremely challenging as the body strives to defend a heavier set-point35,37. A
prime example of this physiology comes from study of obese participants on the TV show “The
Biggest Loser”: contestants lost >120 pounds on average during the show, but 6 years later,
individuals had regained approximately 2/3 of the weight and their energy-expenditure was
significantly decreased compared to what would be expected for their body weight38. Thus
overweight individuals who have lost weight are constantly battling increased hunger and
reduced energy expenditure as their bodies defend their heavier weight set-point.
1.2.2 The Brain Coordinates Energy Balance
Energy balance strongly relies on behavioral output, namely feeding and volitional
activity that are controlled by the brain. Interestingly, most genes implicated in obesity have
enriched expression in the nervous system39, supporting the role of the brain as a master
regulator of body weight. In particular, sub-regions of the hypothalamus have been implicated
in regulating energy balance, including the arcuate nucleus (ARC), paraventricular nucleus
(PVN), ventromedial hypothalamus (VMH) and the lateral hypothalamic area (LHA). The
hypothalamus is found at the base of the brain near the third ventricle and is well positioned to
intercept circulating energy cues from the periphery. Important hormonal cues detected by the
hypothalamus include the anorectic hormone leptin and the orexigenic hormone ghrelin. Leptin
is secreted in proportion to adipose tissue as a signal of long-term energy storage and acts on
hypothalamic nuclei to suppress food intake40. Ghrelin, by contrast, is secreted from the
stomach as hunger increases and acts on the hypothalamus and other brain areas to promote
food intake41. The ARC is a key site for energy integration and has been extensively studied.
5
The ARC contains two discrete neuronal populations expressing either agouti-related peptide
(AgRP) or promelanocortin (POMC), which exert opposing actions on feeding and body
weight42. AgRP neurons are activated by physiologic hunger and promote food intake while
reducing energy expenditure43,44. AgRP neurons also express neuropeptide Y (NPY) and
GABA, and the contribution of each individual neurotransmitter has been shown to increase
feeding45. AgRP neurons are active in a fasted state, which is potentiated by ghrelin-mediated
excitatory input46,47. After a meal, ghrelin levels fall and leptin becomes a dominant circulating
signal of energy status, which inhibits AgRP neurons to reduce food intake48.
By contrast, neighboring POMC neurons are activated during satiation and suppress
food intake while increasing energy expenditure49-51. POMC is a precursor protein that is
cleaved into alpha melanocyte stimulating hormone (α-MSH) and exerts anorectic effects by
binding the melanocortin-4 (MCR-4) receptors at key brain sites. Rodents deficient in MCR-4
signaling are hyperphagic and obese52,53 and MCR-4 mutations are the most common
monogenic cause of human obesity54,55, underscoring the importance of melanocortin signaling
in energy balance. While the ARC is a critical center for direct sensing of peripheral energy
cues, POMC and AgRP neurons likely feed into a variety of downstream circuits that fine-tune
feeding behavior and energy expenditure such as the lateral hypothalamic area (LHA). Indeed,
POMC neurons project heavily to the LHA which expresses MCR-451,56, but the functional role of
melanocortin signaling in the LHA has not been characterized. For the purposes of this chapter,
we will focus on the LHA as a hypothalamic center that plays an essential, yet incompletely
understood role in energy balance by both receiving input from the ARC and directly sensing
peripheral energy cues.
6
1.2.3 The Lateral Hypothalamic Area (LHA) is Essential for Energy Balance
The LHA was initially described as a “feeding center” when investigators found that
electrical stimulation induced voracious feeding behavior in sated animals57,58. Conversely,
lesions of the LHA produced such profound self-induced starvation that animals had to be forcefed to maintain survival58-60. Subsequent neuroanatomical studies revealed that the LHA
provides efferents to numerous brain regions, but it provides particularly dense projections to
dopamine (DA) neurons in the ventral tegmental area (VTA) that modify the motivation to obtain
pharmacological and natural rewards (e.g. food, physical activity, and sex)61. Indeed, electrical
stimulation of the LHA is rewarding and increases DA release in nucleus accumbens (NA)57,62-64.
Thus, the LHA directly accesses DA-ergic circuitry that controls motivated behaviors, and
provides an explanation for why lesion of the LHA abolishes the motivation to eat. Additionally,
the LHA receives information concerning energy status that may be important for appropriately
coordinating feeding and other motivated behaviors. Some LHA neurons express receptors for
leptin while others respond to ghrelin65,66, indicating that the LHA can directly intercept
circulating anorectic and orexigenic cues. The LHA also receives dense input from the ARC51,
and thereby receives indirect information regarding peripheral energy status. Taken together,
this work suggests that the LHA is uniquely positioned to integrate peripheral energy cues with
DA-mediated motivated behaviors that may promote or suppress feeding. Given that the LHA
responds to both anorectic and orexigenic cues, there are likely distinct neural mechanisms by
which the LHA can coordinate motivated behaviors and energy balance. Indeed, several
populations of neurons have been described in the LHA that vary in neurotransmitter and
neuropeptide content, projection targets, and function67,68. The contributions of the key
neuropeptide-defined neuronal populations in the LHA with respect to energy balance will be
briefly discussed below.
7
Orexin: Many neurons in the LHA express the orexigenic neuropeptide
hypocretin/orexin (OX)69. As its name implies, OX stimulates food intake but also plays a critical
role in wakefulness and arousal68,70. As such, DREADD-mediated activation of OX neurons
increases feeding, locomotor activity, and energy expenditure71. OX neurons are activated by
cues of energy depletion including fasting, ghrelin, and low glucose66,72,73 and thus act to
promote food intake and arousal necessary to obtain food when peripheral energy stores are
low. Although OX-expressing neurons are only found within in the LHA, they project widely
throughout the brain, including to the VTA74,75. OX neurons also co-express markers of
glutamatergic neurons76 and therefore can excite afferent projection targets such as VTA DA
neurons75.
Melanin-concentrating hormone: A separate subset of LHA neurons contains melaninconcentrating hormone (MCH), which similar to OX, promotes food intake and weight gain77,78.
Instead of stimulating arousal however, MCH supports sleeping behavior79. MCH neurons
express both glutamatergic and GABAergic markers, and thus may be divided into further
functional subsets based on excitatory vs. inhibitory potential79-81. While MCH neurons do not
project directly do the VTA, many instead project directly to GABA-ergic neurons in the NA that
provide tonic inhibitory input on food intake82-84. Thus GABA-ergic MCH neurons may dis-inhibit
the NA, removing the “brake” on feeding to promote food intake67.
Neurotensin: A third molecularly distinct population of LHA neurons expresses the
neuropeptide, neurotensin (Nts)66,85. Unlike the orexigenic effects of MCH and OX,
pharmacologic Nts suppresses feeding and promotes weight loss86-90, however the functional
role of LHA Nts neurons has not been completely defined. A subset of LHA Nts neurons
expresses the long form of the leptin receptor, are activated by leptin, and co-express
GABA65,85. Some LHA Nts neurons project locally to and inhibit neighboring OX neurons91 while
8
others project to the VTA66,85, where pharmacologic Nts administration produces anorexia and
locomotor activity86,88,92. Consistent with this, developmental loss of leptin receptor signaling
specifically from LHA Nts neurons results in reduced striatal DA action, increased adiposity, and
disrupted feeding response to leptin66,85. Nts is an established modulator of DA signaling (see
section 1.4.1) and the LHA may provide an endogenous source of Nts input to the VTA that
impacts motivated behaviors. In support of this, it was recently demonstrated that
chemogenetic activation of LHA Nts neurons increased mesolimbic DA release, locomotor
activity, and reduced body weight93. Thus, Nts and DA action may be useful to promote weight
loss behaviors, while disruption of Nts-mediated DA signaling might contribute to the
development of obesity. Understanding how Nts engages the DA system to modify motivated
behaviors, including the specific role of LHA Nts neurons, will be important for discerning the
therapeutic potential for Nts in regulating energy balance.
1.3 Dopamine Signaling and Body Weight
1.3.1 Dopamine Circuitry, Signaling, and General Function
Dopamine (DA) is a catecholamine neurotransmitter that is essential for movement and
motivation94, and DA disruption is a hallmark of several neuropsychiatric diseases. Neurons
that synthesize DA are found primarily in the VTA and substantia nigra pars compacta (SN) of
the midbrain. DA synthesis begins with the amino acid, tyrosine, which is converted to L-DOPA
by tyrosine hydroxylase (TH), the rate-limiting step in DA synthesis. L-DOPA is rapidly
converted to DA by DOPA-decarboxylase, and DA is stored in highly concentrated vesicles until
an action potential initiates their release95. DA binds to five receptor isoforms, however most
work has focused on the DA receptor 1 and 2 isoforms (D1R and D2R), both of which are
expressed on GABA-ergic medium spiny neurons (MSNs) in the NA, and all are coupled to G9
proteins. D1R is coupled to Gα which increases protein kinase A (PKA) activity through
induction of adenyl cyclase and cyclic adenosine monophosphate (cAMP), while D2R is coupled
to Gi which essentially has the opposite effect and inhibits PKA activity96-98. PKA regulates a
variety of downstream targets including AMPA and NMDA receptors, CREB, and DARP-3299,
and the outcome of DA receptor signaling therefore includes changes in glutamatergic
regulation, ion channel phosphorylation, and gene transcription100. Interestingly, D2R is also
expressed presynaptically on DA neuron terminals and dendrites and acts as an inhibitory
autoreceptor that decreases DA synthesis and release101-103. After DA is released into the
synaptic cleft and binds to DA receptors, it is taken back up into the pre-synaptic terminal by the
DA transporter (DAT), where it can then be recycled back into vesicles or degraded (see104,105
for review). VTA DA neurons project to the ventral striatum and prefrontal cortex (the
mesolimbic and mesocortical pathways, respectively), whereas SN DA neurons project to the
caudate and putamen (CPu), collectively referred to as the dorsal striatum (the nigrostriatal DA
pathway). Generally speaking, the mesolimbic circuit controls motivation, while the nigrostriatal
circuit regulates movement, hence the degeneration of nigrostriatal DA neurons in Parkinson’s
disease causes loss of motor function. While the VTA and SN may exert some overlapping
contributions to motivation and movement106, we will focus on role of VTA mesolimbic signaling
in energy balance because it is implicated in regulating motivated feeding and locomotor
behaviors that alter body weight.
DA has often been suggested to signify reward, however some have argued that this
term is ambiguous and obfuscates the actual role of DA in behavior107-110. According to Berridge
and Kringelbach, reward is a complex term that encompasses aspects of pleasure,
reinforcement, and learning, all processes that are mediated by distinct neural circuits that may
or may not involve DA. They suggest that procurement and consumption of rewards, such as
food, sex or drugs, are mediated by at least two distinct neural mechanisms which are
10
described in terms of “liking” and “wanting”. “Liking” is analogous to the positive feeling or
pleasure evoked during physical contact with the reward, while “wanting” refers to behavioral
investment required to attain the reward. Although DA has been popularized as the “pleasure”
neurotransmitter, pioneering work by Berridge et al. called this into question when they showed
that DA-depleted rats have intact hedonic or “pleasure” responses to sweet taste111. This
suggests that DA is not necessary for the “liking” of rewards, and has since been supported by
further work showing that hedonic reactions are not impacted by interruption of DA
signaling109,110. Instead, DA mediates the effort an animal is willing to exert to attain a reward, or
“wanting.” Thus, DA depletion does not alter hedonic response to a reward, but it does reduce
willingness to work for the reward or responsiveness to cues that predict the reward112,113.
Salamone and Correa propose a similar model narrowed to mesolimbic DA release,
whereby the behaviors necessary to approach the reward (analogous to “wanting”) require DA
release in the NA, whereas the direct interaction with the reward (analogous to “liking”) is
independent of NA DA61. Both the models of Berridge et al. and Salamone et al. align with the
involvement of DA in reward prediction error, the observation that DA neurons fire based on the
perceived expectations of how “rewarding” a particular stimulus will be. As described by
Schultz, DA neurons fire in response to an unexpected reward and are inhibited when the
reward is omitted112. In a sense, DA neurons code the “error” between perceived and actual
expectations, thus explaining why disruption of DA signaling may interfere with the perceived
value of a reward, not necessarily consumption of the reward itself112,113.
A final note with respect to VTA DA neurons is that they are molecularly heterogeneous
and can be divided into subsets based on their electrophysiological properties, projection sites,
co-expression of classical neurotransmitters, and response to neuropeptide modulators114.
While VTA DA neurons heavily project to the NA, they also project to the prefrontal cortex
11
(PFC), amygdala and hindbrain, and DA release in each of these areas plays unique roles in
behavior115. For instance, VTA DA neurons projecting to the NA are activated by rewards and
promote positive reinforcement, while VTA DA neurons projecting to the PFC are activated by
aversive cues and promote conditioned-place aversion116-118. Thus, VTA DA signaling does not
purely regulate pursuit of pleasant stimuli but is also processes aversive stimuli.
1.3.2 Dopamine and Feeding
The idea that DA is essential for movement and motivation came from early work
showing that destruction of midbrain DA neurons leads to hypotonia and hypophagia119,120.
Consistent with these observations, mice genetically lacking DA fail to gain weight and starve to
death by 3 weeks of age unless DA is restored pharmacologically94. Since feeding requires
physical movement, it was difficult to ascertain whether DA-deficient mice were hypophagic due
to a primary feeding deficit or because of generalized impairment of motor function necessary to
procure food. The latter explanation is supported by observations that animals with impaired
DA signaling, either brain-wide or specifically to the dorsal striatum, ate less due to defective
forepaw usage121,122. Furthermore, selective disruption of DA signaling in the NA does not
impair free food intake, but instead reduces lever-pressing for food, which becomes more
pronounced as the amount of work necessary to attain food increases123-128. These data
suggest that NA DA release is not necessary for ad libitum feeding, but instead regulates the
effort (e.g. work) an animal will exert to obtain food. Salamone and colleagues examined this
using a food choice test, wherein animals were given the option of either lever-pressing to
obtain palatable rewards or freely accessing less-desirable chow. At baseline, the reward was
highly preferred and animals chose to lever-press for rewards while eating very little chow.
However, disruption of DA signaling in the NA shifted their preference to chow, suggesting that
loss of NA DA signaling reduced willingness to work for the palatable reward. By contrast,
disruption of DA signaling in the dorsal striatum equally reduced both lever-pressing and chow
12
intake, indicating generalized reduction of feeding regardless of effort129-131. Similar results were
observed using other behavioral paradigms to parse motivated vs. free intake132,133,
substantiating the hypothesis that NA DA is specifically necessary for “wanting” or the approach
phase of motivated behavior. By contrast, DA deficient mice with select restoration of DA to the
dorsal but not ventral striatum recover their ability to feed ad libitum134,135, suggesting that dorsal
striatal DA is sufficient for food intake that does not require effort. However, this type of freefeeding behavior is not necessarily analogous to “liking”. The hedonic responses to food can be
assessed in animals through orofacial responses during eating136, and Berridge argues that
“liking” does not require DA at all. Complete destruction of mesolimbic and nigrostriatal DA
neurons does not reduce hedonic responses to sweet taste111. Furthermore, DA-deficient mice
have normal preference for rewards and enhancing NA DA fails to increase “liking” of palatable
food, but does increase “wanting”137,138. Instead, “liking” may be mediated by mu opioid or
GABA-ergic inhibition of anatomically restricted “hedonic hotspots” in the NA shell and ventral
pallidum109.
DA neurons also play important roles in the initial and continued response to cues that
may impact feeding. For example, DA neurons are activated in response to unexpected
presentation of food, but this response quickly habituates112,139. When animals are conditioned
to associate a cue with a food reward, DA firing will initially occur during consumption of the
reward, however with learning, a shift occurs and DA neurons fire instead during the cue112,
hence DA serves as a signal that predicts delivery of the reward. Rats presented with a novel
palatable meal have increased NA DA release during consumption, however when presented
with the same meal a second time, DA release is absent during consumption due to habituation.
By contrast, if a novel palatable food is presented instead at the second meal, NA DA release
increases during consumption, suggesting that DA neurons fire in response to the unexpected
palatability of the second meal140. Although NA DA release may occur during feeding due to
13
novelty or unexpected presentation of food, as discussed above, lesion studies have shown that
NA DA is not required for free feeding behavior. In line with the idea of reward prediction error,
NA DA serves more as a “teaching signal” that codes how valuable a reward is, and therefore,
how much work an animal should put forth to attain the reward113.
While DA release occurs in response to palatable taste transmitted by gustatory
pathways 141-143, additional work has demonstrated that taste-independent post-ingestive signals
can also trigger mesolimbic DA release and food reinforcement. For example, mice genetically
blind to sweet taste still develop preference for sucrose and display DA release in response to
sucrose but not saccharin144. Given that saccharin is devoid of calories, this suggests that postingestive signals, likely released in response to caloric delivery to the gut, are sufficient to
induce DA release independently of taste perception. This is supported by recent work showing
that striatal DA release also occurs in proportion to increasing concentrations of intra-gastric
infusion of lipid emulsions145, thus taste perception is not necessary for DA release in response
to caloric content. In sum, these studies support the view that DA release occurs in response to
both 1) sensory perception of taste, especially when novel or more palatable than expected, and
2) delivery of calories to the gut via post-ingestive mechanisms and independently of taste.
Mesolimbic DA neurons and food “wanting” are also modulated with respect to
peripheral energy status. For example, food deprivation increases DA neuron excitability,
decreases DA re-uptake, and potentiates DA release during re-feeding62,140,146-149. Thus energy
deficit appears to heighten the sensitivity of the mesolimbic DA system to food, and indeed,
food-restricted animals will work harder to obtain food compared to sated controls150,151.
Interestingly, fasted animals will also work harder to obtain sucrose but not for saccharin,
indicating that post-ingestive mechanisms signal the caloric value of ingested rewards to VTA
DA neurons151. However, after unlimited access to food and subsequent satiety, they diminish
14
their effort to obtain the palatable rewards151. Thus, food “wanting” is modulated by peripheral
energy status (e.g. deficiency or satiety) presumably to coordinate food intake needed to ensure
survival.
There has been considerable interest in understanding if hormones conveying energy
status, such as leptin or ghrelin, directly or indirectly engage VTA DA neurons to modify energy
balance. Leptin is a satiety cue secreted from adipose tissue and serves as a long-term signal
of peripheral fat stores40. Leptin action via the long form of the leptin receptor (LepRb) is also
important for suppressing feeding via the hypothalamus, but some part of leptin action may be
mediated via the VTA. Indeed, exogenous leptin treatment alters signaling in VTA DA
neurons152,153, but only 6% of VTA DA express LepRb and they project to the amygdala rather
than the NA154. Furthermore, while peripheral or ICV leptin suppresses food intake, sucrose
self-administration, and conditioned place preference for palatable food150,155-157, the evidence
for direct behavioral effects of leptin signaling via the VTA are limited. One study reported that
intra-VTA leptin decreased food intake while silencing of VTA LepRb receptors increased it152,
but subsequent work has not supported a direct role for VTA LepRb neurons in regulating
feeding158,159. Instead, the anorectic effects of leptin may be induced via LHA LepRb neurons
that project to the VTA and modulate DA signaling65,160. In contrast to leptin, ghrelin is a gastricderived hormone that increases in the circulation to signify energy deficit and strongly promotes
food intake41. Ghrelin acts on the growth hormone secretagogue receptor (GHSR), which is
also present in the hypothalamus and VTA161. Intra-VTA ghrelin increases firing of DA neurons
through enhanced excitatory input and increases NA DA release161-163. In line with this, ghrelin
infusion into the VTA increases both ad libitum food intake and self-administration of palatable
food161,164,165 and blocking GHSRs in the VTA or DA signaling in the NA abolishes these
effects161,162,166. Taken together, there is some evidence for direct modulation of VTA DA
15
neurons by leptin and ghrelin, but these hormones may also exert control via hypothalamic
targets that project to the VTA.
1.3.3 Dopamine and Energy Expenditure
The role of DA signaling in energy balance has been studied extensively in the context
of feeding, yet energy expenditure represents an equally important determinant of body weight.
It is well-established that pharmacologic enhancement of DA release also induces locomotor
activity167,168 and in fact, psychostimulant-induced locomotor activity is often used as a
behavioral surrogate to assess striatal DA signaling. For example, reducing DA re-uptake
through pharmacologic or genetic disruption of DAT activity is associated with increased
locomotion169,170. Similarly, agonist-mediated stimulation of D1R also increases locomotor
activity, while D2 agonists increase autoinhibition that tends to suppress locomotor activity104. It
is interesting that altering mesolimbic DA signaling has a predictable and well-established direct
impact on locomotor activity, while the same manipulations rarely alter food intake unless
animals are forced to work for food61,171. Thus, locomotor activity in general is tightly linked to
DA signaling, but certain aspects of food intake may not be. Furthermore, it is difficult to
interpret what locomotor activity means in rodents since it varies based on the testing procedure
and encompasses aspects of novelty, exploratory, and emotional behaviors171.
A standard way to examine volitional activity in rodents is to provide access to running
wheels. Animals will lever-press for access to wheels and in some cases find it more reinforcing
than sucrose172,173. Additionally, animals prefer to spend time in environmental contexts that
they have been conditioned to associate with running wheels, even when the wheel is not
present174. These data indicate that volitional wheel running is both rewarding and reinforcing,
and therefore may engage mesolimbic DA circuits. Indeed, rodents bred for high levels of
physical activity have increased levels of striatal DA and increased expression of D1R175,176.
16
Long-term access to wheels also increases TH expression and ∆FosB in the mesolimbic
system174. Interestingly, food-deprived rats work harder for wheel access and run more when
they are on the wheel, suggesting that physiologic state regulates the motivation to run177.
Recently, Fernandes et al. showed that deletion of a critical mediator of leptin signaling
specifically in the VTA caused increased volitional activity and preference for running wheels
compared to controls158. Together, these studies support the hypothesis that the hormonal
signature of energy depletion (i.e. lack of leptin signaling or food restriction) may directly act via
VTA DA neurons to increase locomotor activity. While it seems counterintuitive that animals
would increase energy expenditure in an energy-depleted state, one explanation is that
ambulation and exploratory behavior is advantageous in a food-restricted state, as it could
increase the probability of finding food. Consistent with this theory, Beeler et al. argues that DA
is not a feeding signal per se, but instead coordinates energy expenditure in terms of how much
energy should be allocated towards specific behaviors, including, but not limited to feeding171.
DA neurons become hypersensitive during food deprivation146,147,178 in part due to changes in
insulin, leptin, and ghrelin levels, thus engaging in reinforcing behaviors such as feeding or
running in a fasted state is associated with more DA release and increased effort to attain the
reward. This is supported by numerous lines of evidence demonstrating that fasted animals
work harder for not only food or running but also for abusive drugs179-181. In sum, locomotor
behavior is tightly tied to DA release, and may indicate a general increase in attention, arousal,
and exploratory behavior that can increase effort for rewards in a context-dependent manner.
1.3.4 Neuropeptide Regulation of Dopamine Signaling
Recent interest has been invested in understanding how neuropeptides modulate
midbrain DA neurons, and hence how they direct behaviors relevant to energy balance. For
example, pharmacological and electrophysiological studies suggest that VTA DA neurons
express receptors for the neuropeptides, orexin, corticotropin-releasing factor, and neurotensin,
17
which all have the capacity to regulate DA neuronal function and motivated behaviors (reviewed
in182-184). The specific importance of neuropeptides in directing neuronal signaling is just
beginning to be appreciated (as recently reviewed by van den Pol185). Neuropeptides are often
co-expressed along with the classical amino acid neurotransmitters glutamate or GABA,
however the properties of neuropeptides vary greatly from classical transmitters. First,
glutamate and GABA are released from the pre-synaptic terminal and travel mere nanometers
across the synapse, where they act rapidly on ion channels to activate or inhibit the postsynaptic neuron. By contrast, neuropeptides released form presynaptic terminals can diffuse
microns outside the synapse and thus can bind to both the post-synaptic neuron and
neighboring neurons that do not make direct synaptic contact. While classical transmitters can
gate ligand-gated ion channels to rapidly alter membrane potential, neuropeptides bind to Gprotein coupled receptors that change gene transcription or intracellular Ca++, and hence
mediate long-term signaling changes in target neurons. Furthermore, in addition to release at
the presynaptic terminal, some neuropeptides can be released from the dendrites or anywhere
along the axon, which further increases the number of neurons that are influenced by
neuropeptide release. Thus, although classical transmitters and neuropeptides may be
released from the same neuron, they mediate very distinct and temporally dissociable effects on
target cells. Furthermore, the distribution of different neuropeptide receptors on target neurons
allows for further refinement of signal transduction and physiologic regulation, and these may be
selectively targeted via pharmacological means. Understanding the role of neuropeptide and
neuropeptide receptor systems that engage the DA system thus holds promise for selective,
long-term control of DA-mediated behaviors that impact body weight.
18
1.4. Neurotensin Physiology
1.4.1 Discovery, Receptors, and Expression Patterns
Neurotensin (Nts) is a 13 amino-acid neuropeptide that was first isolated from bovine
hypothalamus by Carraway and Leeman in 1973. Upon discovery, Nts was first appreciated for
its hypotensive effects as the authors noted “visible dilation” when it was applied to blood
vessels in anesthetized rats186,187. In addition to regulation of blood pressure, Nts has since
been implicated in a diverse array of physiologic processes including feeding, locomotor activity,
body temperature, and gastric motility188. Nts is synthesized as part of a larger pro-peptide that
also contains neuromedin-N and is cleaved into biologically active Nts by pro-hormone
convertases in the Golgi apparatus and endoplasmic reticulum189. In neurons, the processing,
storage, and release of Nts has not been well characterized, but similar to other neuropeptides,
Nts has been localized in dense core vesicles at pre-synaptic terminals190.
The discovery of Nts in the brain suggested it exerts central control of physiology, and
indeed ICV administration of Nts is sufficient to alter food intake, locomotion, and body
temperature87,191,192. Nts is also highly expressed within the gastrointestinal tract and adrenal
gland, and release of Nts from these tissues presumably accounts for the high levels of Nts in
the circulation. However, circulating Nts has an extremely short half-life due to rapid
degradation by proteolytic enzymes193 . Thus, the central effects of Nts are likely due to Nts that
is produced by, and released within the brain, but not from peripheral tissues. In the brain,
studies using in situ hybridization and immunohistochemistry reveal that Nts is highly expressed
within the LHA, NA, lateral septum, stria terminalis, preoptic area, central amygdala,
periaqueductal grey and parabrachial nucleus188,194.
19
Nts binds two G-protein coupled receptors, Nts receptor 1 and Nts receptor 2 (NtsR1
and NtsR2), and Nts has a 10-30 fold higher affinity for NtsR1 than NtsR2195-198. NtsR1 is
coupled to Gq, which leads to induction of phospholipase C and increased intracellular
Ca++199,200. The downstream signaling transduction of NtsR2, however, is not well
characterized; it may be Gq or Gi-coupled and could vary across species197,201. Nts also binds to
a third non-G-protein-coupled receptor known as Nts receptor 3 (NtsR3) or sortilin, which
consists of a single transmembrane protein but little else is known about its role in Nts
signaling202,203. In situ hybridization and autoradiography reveals that NtsR1 is robustly
expressed within the VTA, SN, septum and suprachiasmatic nucleus in adult animals.
Interestingly, Ntsr1 expression is high and extensively distributed throughout the brain during
early embryonic stages but is rapidly downregulated within the first few weeks of life, suggesting
that Nts signaling via NtsR1 may be involved in the development of neural circuits204,205. By
contrast, the expression of NtsR2 has been difficult to localize because most in situ
hybridization studies show low levels of diffuse expression throughout the entire brain, however
some have reported notably high levels in the cerebellum, periaqueductal gray, hippocampus,
and VTA and SN206,207. Furthermore, NtsR2 does not exhibit a transient peak in expression
during early development like NtsR1, and instead, is produced at low amounts during gestation
and slowly increases to adult levels after birth. Several authors have suggested that NtsR2 is
expressed on astrocytes in vitro208-210, however controversy remains as one report found that
NtsR2 binding sites do not colocalize in vivo with the astrocyte marker, GFAP211. Clearly, the
differences between NtsR1 and NtsR2 in terms of their affinity for Nts, expression patterns, and
ontogeny suggest that they are functionally distinct, and indeed this is supported by work using
antagonists or mice with developmental deletion of NtsR1 and NtsR2. In general, NtsR1 is
implicated in mediating the feeding, locomotor, reward, and body temperature effects of Nts,
while NtsR2 is implicated in Nts-induced analgesia203,212-218. The contributions of different Nts
20
receptors with respect to Nts modulation of DA signaling and energy balance will be discussed
in detail in the following sections.
1.4.2 Neurotensin and Dopamine Signaling
Nts regulates DA signaling and has accordingly generated considerable interest as a
potential therapeutic target in diseases characterized by disrupted DA action, especially
schizophrenia and Parkinson’s disease. Generally-speaking, Nts or Nts analogues enhance the
activation of DA neurons through three different mechanisms: 1) increased intracellular Ca++219,
2) decreased D2R-mediated autoinhibition220-223, and 3) increased presynaptic excitatory
input217,220,224. While several studies suggest that NtsR1 is required to activate DA neurons,
roles for NtsR2 have also been proposed217,224, hence the precise mechanism by which Nts
promotes activation of DA neurons remains unclear.
Pharmacologic studies indicate a specific role for Nts action via the VTA, where it
increases NA DA release and locomotor activity similar to psychostimulants92,214,225-232. Nts
administration to the VTA also supports self-administration217,233,234, conditioned place
preference (CPP)216,235, and sensitization236,237, indicating that Nts signaling in the VTA modifies
DA-dependent behavior and is rewarding. Loss of NtsR1 signaling abolishes Nts-mediated selfadministration and CPP216,217, suggesting that NtsR1 confers the reinforcing properties of Nts
activity in the VTA. In support of this, transgenic NtsR1Cre reporter mice indicate that NtsR1 is
expressed almost exclusively by DA neurons within the VTA238. However, the receptor
mechanism by which Nts acts in the VTA remains controversial, since studies using receptor
antagonists or receptor-null mouse models have yielded conflicting data on the importance of
NtsR1 and/or NtsR2214,228. Indeed, the VTA contains mRNA and binding sites for both
receptors206,207,239,240, so both could play roles in modulating DA signaling and behavior.
Reagents to permit the visualization of NtsR1 and NtsR2-expressing cells in the VTA would be
21
useful to determine if the receptor isoforms directly or indirectly modify VTA DA neurons, and
hence to understand how Nts exerts control over DA signaling.
While pharmacologic administration of Nts in the VTA strongly influences mesolimbic DA
signaling and reward behaviors, the endogenous circuits providing Nts to the VTA, and how
they modulate it, remain undetermined. Some Nts-containing neurons must provide Nts to the
VTA, as demonstrated by the density of Nts immunoreactive terminals in the midbrain241-244 that
are found in close apposition to VTA DA neurons238. Interestingly, Nts itself is present in the
VTA and colocalizes with DA markers in rats244-246, but not in mouse or human247,248. Thus in
mice and humans, Nts input to the VTA does not originate locally and must therefore come from
elsewhere in the brain. Retrograde tracing in rats demonstrated the many Nts afferents to the
VTA reside in the preoptic (POA) area, rostral LHA, and NA182,249, but the functional significance
of these Nts inputs remains undefined. Curiously, destruction of the Nts neurons in the POA
and LHA, which provided the majority of input to the VTA, did not substantially reduce Nts
reactivity in the VTA, suggesting that Nts regulation of DA signaling is highly conserved250.
Methods to selectively activate Nts neurons that project to the VTA are necessary to reveal how
endogenous Nts circuits contribute to behavior. For example, chemogenetic activation of LHA
Nts neurons increases NA DA release and locomotor activity93, similar to the effects of
pharmacologic Nts in the VTA. While it will be important to assess the roles of each population
of Nts neurons that project to the VTA, these data suggest that LHA Nts neurons mediate at
least some aspects of Nts action via the VTA, and deserve further exploration.
1.4.3 Neurotensin and Energy Balance
A first glimpse into the idea that Nts may be involved in energy balance came from work
in the early 1980’s showing that central administration of Nts suppresses food intake in hungry
rats251. The central anorectic effects of Nts have since been replicated by multiple independent
22
groups87,252-254, and peripheral Nts treatment has also been demonstrated to suppress appetite
and reduce body weight 90,252,255,256. Nts administration directly to the VTA potently suppresses
food intake, spurring interest in whether this might be associated with the known roles for Nts in
regulating mesolimbic DA signaling86,88. Consistent with this, intra-VTA Nts also reduces
operant responding for food88,257 and in most of the studies cited above, animals were either
fasted or trained to eat food within a single short time period, both procedures that increase
motivation to eat. Nts also suppresses feeding when administered to hypothalamic sites258, but
not the NA87, indicating that Nts-induced anorexia occurs within specified anatomical circuits.
Importantly, repeated peripheral injection of brain-penetrating Nts analogues or NtsR1 agonists
suppresses food intake and promotes sustained weight loss in both lean and obese mice89,90,
indicating that the anorectic effects of Nts are sufficient to modify body weight. Nts treatment
does not, however, suppress feeding in mice lacking NtsR1212,253, suggesting that Nts mediates
anorectic effects via NtsR1. This finding prompted investigation of whether loss of NtsR1
altered body weight, but independent reports suggest that NtsR1 knockout mice are either
overweight212, not different213,218, or slightly lighter238 compared to controls. This variation could
be explained by differences in genetic background and environment, similar to how some, but
not all individuals with genetic predisposition to obesity become obese. Mice genetically lacking
NtsR1 are also more susceptible to weight gain when given high fat diet, implicating NtsR1
signaling in palatable food intake238.
Interestingly, mounting evidence suggests some overlap in the mechanisms by which
the anorectic hormone leptin and central Nts suppress feeding. Leptin treatment increases Nts
expression in the hypothalamus259,260, but disruption of NtsR1 signaling abolishes the ability of
leptin to suppress food intake238,253,261. Taken together, these data support a hypothesis
whereby leptin acts via LepRb-expressing neurons to increase Nts signaling via NtsR1, leading
to reduced food intake. Leinninger et al. began to investigate this hypothesis by showing that
23
many LepRb-expressing neurons in the LHA also express Nts, and that the LHA is the only
place in the brain where LepRb and Nts are co-expressed65,85. Deletion of LepRb selectively
from LHA Nts neurons leads to increased body fat and impaired coordination of feeding
behavior with peripheral energy cues66,85. These LHA Nts neurons project to the VTA, where
their terminals are in close apposition with DA neurons85,238. Furthermore, NtsR1 is expressed
almost exclusively on DA neurons in the VTA238, thus LHA Nts neurons can directly access
mesolimbic DA circuits and are poised to regulate DA signaling via NtsR1. Consistent with this,
chemogenetic activation of LHA Nts neurons increases DA release to the NA, as well as
locomotor activity and energy expenditure that causes weight loss over 12 hours, but no
alteration in food intake was observed93. This acute study, however, does not rule out a role for
LHA Nts neurons in regulating feeding, nor does it indicate whether action via LHA Nts neurons
can maintain sustained weight loss. These issues merit further investigation to understand the
contribution of LHA Nts neurons to physiology and energy balance.
1.5 Neurotensin and Dopamine Signaling in Energy Balance Disorders
1.5.1 Is Dopamine Disrupted in Obesity?
The hallmarks of obesity include overconsumption of calorically dense food and lack of
physical activity, leading to weight gain. Since DA circuits regulate both feeding and volitional
activity, many efforts have attempted to establish a causal link between dysfunctional DA
signaling and obesity. One explanation for why obese individuals overeat is that they
experience less reward in response to palatable foods and overeat to compensate; this is
termed the “reward deficiency” hypothesis262. An alternative explanation is that obese
individuals overeat because they have heightened reward responses to food cues and hence
experience more pleasure during ingestion of highly palatable food. Thus, hypersensitive
24
reward circuits could also drive hyperphagia and weight gain, and this is referred to as the
“reward-surfeit” hypothesis263,264. Evidence for both of these hypotheses will be discussed
below.
Several studies indicate that obese individuals have reduced D2R availability in the
striatum265-268, suggesting rationale for the “reward deficiency hypothesis”. Indeed, humans with
polymorphisms in the taq1 gene, which reduces D2R binding by 30-40%, are overrepresented
in obese human populations compared to lean controls269-272. Furthermore, individuals with
these taq1 variants are more likely to have reduced striatal response to palatable food that is
predictive of future weight gain271,273. Similar results have been noted in animal obesity models.
For example, rodents fed high-fat diets have reduced DA release in the NA, and blunted
expression of DA-associated markers274-277. Johnson and Kenny showed that rats fed a
palatable “cafeteria diet” consisting of “bacon, sausage, cheesecake, pound cake, frosting, and
chocolate” have reduced striatal D2R binding and engage in compulsive-like behavior to attain
the calorie-dense foods. Experimental depletion of striatal D2R receptors in lean rats mimicked
compulsive feeding behavior, but did not alter ad libitum cafeteria diet consumption or weight
gain, suggesting that lack of D2R signaling may regulate specific facets of feeding behavior but
is not sufficient to cause obesity on a calorie-rich diet278. Taken together, these data suggest
that striatal D2R signaling is blunted in obesity, which could be interpreted as hypoactivity of
motivational and reward circuits, lending support to the reward deficiency hypothesis. Despite a
seemingly strong link between low D2R and obesity, the idea that reduced D2R signaling is a
cause rather than consequence of obesity has been called into question. Conflicting with
previous work, several more recent studies have found no link between obese populations and
D2R binding279-283. Furthermore, whole-body or striatal knockdown of D2Rs decreases
locomotor activity but does not predispose animals to weight gain on HF diet278,284,285,
suggesting that reduced D2R signaling may cause lower activity levels in obesity, but is not
25
sufficient to drive overconsumption on palatable diet. This casts doubt on the reward deficiency
hypothesis and suggests that reduced striatal D2R may be a consequence rather than a cause
of weight gain.
An alternate explanation is the reward-surfeit hypothesis, which argues that individuals
with hyper-responsive reward circuits overconsume food that leads to weight gain and
obesity263,264. Indeed, obese individuals show a greater response to anticipation and receipt of
food in brain areas associated with sensory and hedonic aspects of food286 and they perceive
palatable foods as more pleasant than lean controls287,288. Obese individuals also show greater
striatal activation in response to visual food cues than normal weight subjects289,290.
Interestingly, adolescents at risk for obesity show greater striatal activation during receipt of
palatable food but not during anticipation, suggesting that initial vulnerability to obesity may
explained by hyper-responsive reward circuits during food intake264. Thus, via the reward-surfeit
hypothesis, increased hedonic and sensory response to palatable foods may initially fuel
overconsumption, and repeated intake of palatable foods over time leads to conditioned
associations with cues that predict food, which over-activate striatal regions to drive further
overconsumption after the onset of obesity264. However, none of these neuroimaging studies
have implicated DA dysfunction in hyperactive responses to food and food cues in obesity. In
fact, increased hedonic response to food is likely mediated via non-DA-ergic mechanisms such
as mu opiod receptor signaling or other neurotransmitter systems in both animals and
humans280,281,291. Although evidence exists for both the reward deficit and reward surfeit
hypotheses, like many human diseases, obesity may be a heterogeneous disease that can be
caused by either hyperactivity or hypoactivity of the reward system, which could vary with
genetics and environment. Consistent with this, humans with genetic reduction in D2R
availability had increased risk of future weight gain if they showed reduced striatal response to
food cues, whereas humans with genetically normal D2R signaling had increased risk of future
26
weight gain if they showed increased striatal response to food cues273. Thus, obesity cannot be
defined by one mechanism but clearly involves disruption in reward circuitry that encompasses
both DA-mediated “wanting” and DA-independent “liking.”
A note on food addiction: Many behavioral and biological parallels have been drawn
between obesity and substance abuse, leading some to ask whether overconsumption of food
in obese individuals is caused by “food addiction.” For example, similar to obesity, taq1 allele
polymorphisms are associated with substance abuse disorders and drug addicted subjects
show reduced striatal D2R binding292-295. Although the neural circuitry disrupted in substance
use disorders and obesity may overlap to some degree, Stice et al. caution against using the
term food addiction296. As the authors point out, the substance use disorder often has elements
of both dependence (i.e. tolerance and withdrawal) and abuse (use of substance despite
negative consequence) and they argue it is difficult to apply these criteria to palatable food. In
particular, few studies have shown that animals can develop tolerance and withdrawal
symptoms to sugar297,298. Furthermore, few people who try addictive substances go on to
develop substance use disorder, yet a much higher proportion of individuals who eat palatable
foods gain weight and become obese. In the words of Stice et al., “very few humans are driven
to violent criminal behavior due to craving for chocolate”296. While this may be true, it is
important to remember that unlike most addictive drugs, possession and consumption of
palatable food is not against the law, thus the immediate negative consequences for obtaining
high calorie foods are comparatively minimal. In fact, consumption of calorically-rich food is
socially acceptable and often expected (i.e. cake and ice cream at birthday parties), plus food
intake in general is necessary for survival. Thus, it is difficult to directly compare food to
addictive drugs as “substances” that have abusive potential. In sum, although obesity and
substance abuse may share some common features, care should be taken in considering
27
whether obese individuals are “food addicts” especially in the context of how medical
professionals define addiction.
1.5.2 Evidence for Neurotensin in Obesity
As described previously, Nts suppresses food intake when administered peripherally or
centrally, including directly to the VTA, and this is likely mediated by NtsR1. Nts also increases
locomotor activity through NtsR1 when delivered to the VTA, but not centrally or
peripherally92,191,299. Chronic Nts or NtsR1 agonists may therefore have therapeutic potential to
induce weight loss if delivered to the VTA, but this has not been examined. The physiological
role of Nts in energy balance also remains unclear. To date, a handful of studies have shown
reduced levels of Nts protein or mRNA in the hypothalamus of genetically obese mice and
rats300-303. Given the anorectic effects of pharmacologic Nts, reduced levels in obesity might
lead to increased food intake, but there is insufficient data to evaluate whether decreased
hypothalamic Nts content is a cause or effect of long-term hyperphagia. Peripheral injection of
Nts analogs or NtsR1 agonists are sufficient to suppress food intake and either induce weight
loss or prevent weight gain in lean rodents89,90. Interestingly, these compounds also restrain
feeding and reduce body weight in genetically obese rodents, indicating that Nts may have
translational potential as an anti-obesity agent89,90. In both of these studies however, the obese
animal models were genetically deficient in leptin signaling; given the overlap between leptin
and Nts action, inducing Nts signaling might have simply rescued their disrupted leptin-induced
Nts signaling to potentiate weight loss. The anorectic potential of Nts in diet-induced obesity,
which is the common cause of human obesity, has yet to be examined. Peripheral Nts or intraVTA Nts suppresses operant responding for sucrose257,304, suggesting that Nts may indeed be
capable of restraining intake of palatable, obesogenic foods. Furthermore, mice genetically
lacking NtsR1display increased sucrose preference and susceptibility to weight gain on
palatable diet but not chow, implicating the requirement of NtsR1 for restraint of hedonic
28
intake238. Collectively these data suggest potential for Nts signaling as a novel target system for
weight control, but much additional work is necessary to determine the precise circuits by which
Nts acts to modify feeding and energy expenditure.
In 2016, Nts received considerable attention in the context of obesity when Evers et al.
published in Nature that Nts knockout mice were protected from obesity on high fat diet. This
report focused on peripheral Nts, suggesting that Nts produced within the gastrointestinal tract
is essential to facilitate intestinal fat absorption. As a result, loss of Nts-mediated fat absorption
led to protection from diet-induced obesity. The authors also showed that circulating Nts levels
were increased in the blood of obese individuals, and that elevated Nts in lean individuals
predicted future weight gain305. While this study implicates an important role for peripheral Nts
in energy accumulation, it also underscores the importance for site-specific investigation of Nts
action to discern its contributions to physiology. The potentially differing roles of Nts in the brain
(to suppress feeding) compared to the gut (to promote fat absorption) must also be taken into
account in the development of future pharmaceuticals that target the Nts system. Given the
very short half-life of circulating Nts, and the unlikelihood of the neuropeptide to traverse the
blood brain barrier, the central effects of Nts are unlikely to be mediated by peripherallygenerated Nts. As such, Nts signaling in the gut is outside the scope of this dissertation, which
instead focuses on elucidating the mechanisms by which central Nts engages the DA system to
modify behavior and body weight.
1.6 Goals of the Dissertation
Pharmacologic Nts modifies VTA DA signaling, increases physical activity, and restrains
food intake, but the endogenous circuits by which Nts mediates these effects to regulate energy
balance remain unclear. Previously, understanding of the physiological roles of Nts in engaging
DA signaling was limited by the lack of reagents to visualize and manipulate specific populations
29
of Nts-expressing and Nts-regulated cells. To overcome this obstacle, we used existing mice
that express Cre-recombinase in Nts neurons, and we developed mice that express Cre in
NtsR1 or NtsR2 cells; these models allow us to reveal and interrogate specific Nts circuits using
Cre-inducible molecular tools. Better understanding of the precise mechanisms by which Nts
acts to coordinate food intake and energy expenditure will lead to novel therapeutic targets for
the prevention and treatment of obesity. As such, the major goals of this dissertation are:
1. Define the Endogenous Nts Inputs to the VTA (Chapter 2)
Hypothesis: The VTA receives afferent input from select anatomically-defined Nts populations
that regulate reward rather than aversion.
Method: We utilized retrograde tracing in mice expressing GFP selectively in Nts neurons to
identify all Nts neurons that project to the VTA, and hence revealed which neural populations
are anatomically positioned to mediate the weight-reducing effects of Nts within the VTA.
2. Decipher the Neurotransmitter Content, Ontogeny, and Projections of VTA NtsR1 and
NtsR2 Neurons (Chapter 3)
Hypothesis: NtsR1 is the dominant neuronal isoform by which Nts regulates DA signaling.
Method: We utilized a dual recombinase strategy to reveal the VTA cells that express NtsR1
and NtsR2 during development and in the adult brain, and their projection sites. This study
reveals that NtsR1 and NtsR2 are expressed by different VTA cell types, and implicate NtsR1
as the predominant receptor isoform on VTA DA neurons.
3. Understand How Loss of Nts Input to the VTA Modifies Energy Balance (Chapter 4)
Hypothesis: NtsR1 signaling in the VTA is critical for coordination of behaviors that impact body
weight.
30
Method: Genetic ablation of NtsR1 neurons in the VTA revealed the requirement for Nts
signaling via the DA-ergic VTA NtsR1 neurons, and hence for control of DA-mediated behaviors
that coordinate body weight.
4. Determine How LHA Nts Neurons Regulate Feeding and Body Weight (Chapter 5)
Hypothesis: LHA Nts neurons regulate energy balance by engaging the mesolimbic DA system
via NtsR1.
Method: DREADD technology was used to selectively activate LHA Nts neurons in mice that
have intact and disrupted NtsR1, permitting examination of how LHA NtsNtsR1 signaling
contributes to feeding behavior and energy expenditure in lean and obese mice.
Through these goals (Fig. 1), we establish a central circuit whereby LHA Nts neurons act
via VTA NtsR1 neurons to coordinate feeding and volitional activity that modify body weight.
These data establish a novel, physiologic mechanism to explain the anorectic and locomotor
effects induced by pharmacologic Nts, and the translational implications of these findings for
treating overweight and obesity will be discussed in Chapter 6.
31
Figure 1. Schematic of hypothesized neural circuit by which Nts acts to modify
mesolimbic DA signaling and body weight. A) Hypothesis for dissertation: Nts regulates
mesolimbic DA signaling via Nts receptors, and input from the LHA is critical for anorectic
effects of Nts. B) Key questions addressed in each chapter of the dissertation to investigate how
Nts regulates DA signaling energy balance.
32
REFERENCES
33
REFERENCES
1
Ng, M. et al. Global, regional, and national prevalence of overweight and obesity in
children and adults during 1980-2013: a systematic analysis for the Global Burden of
Disease Study 2013. Lancet 384, 766-781, doi:10.1016/s0140-6736(14)60460-8 (2014).
2
World Health Organization. Obesity and Overweight Fact Sheet,
(2016).
3
Flegal, K. M., Carroll, M. D., Kit, B. K. & Ogden, C. L. Prevalence of obesity and trends
in the distribution of body mass index among US adults, 1999-2010. JAMA : the journal
of the American Medical Association 307, 491-497, doi:10.1001/jama.2012.39 (2012).
4
Fryar CD, C. M., Ogden CL. Prevalence of overweight and obesity among children and
adolescents: United States, 1963-1965 through 2011-2012. (National Center for Health
Statistics, Atlanta, GA, 2014).
5
Ogden, C. L. et al. Trends in Obesity Prevalence Among Children and Adolescents in
the United States, 1988-1994 Through 2013-2014. JAMA : the journal of the American
Medical Association 315, 2292-2299, doi:10.1001/jama.2016.6361 (2016).
6
Matt T, E. J., Bedell J, Selenic D, Young C, Deitcher D. . Obesity in the South Bronx: A
look across generations. (New York City Department of Health and Metnal Hygeine,
New York, NY, 2007).
7
Whitaker, R. C., Wright, J. A., Pepe, M. S., Seidel, K. D. & Dietz, W. H. Predicting
obesity in young adulthood from childhood and parental obesity. The New England
journal of medicine 337, 869-873, doi:10.1056/nejm199709253371301 (1997).
8
Lim, S. S. et al. A comparative risk assessment of burden of disease and injury
attributable to 67 risk factors and risk factor clusters in 21 regions, 1990-2010: a
systematic analysis for the Global Burden of Disease Study 2010. Lancet 380, 22242260, doi:10.1016/s0140-6736(12)61766-8 (2012).
9
Malnick, S. D. & Knobler, H. The medical complications of obesity. QJM : monthly
journal of the Association of Physicians 99, 565-579, doi:10.1093/qjmed/hcl085 (2006).
10
Kushner, R. F. & Foster, G. D. Obesity and quality of life. Nutrition (Burbank, Los
Angeles County, Calif.) 16, 947-952 (2000).
11
James, W. P. WHO recognition of the global obesity epidemic. International journal of
obesity (2005) 32 Suppl 7, S120-126, doi:10.1038/ijo.2008.247 (2008).
12
Marketdata Enterprises Inc. The U.S. Weight Loss Market: 2015 Status Report and
Forcast. (2015).
34
13
Mann, T. et al. Medicare's search for effective obesity treatments: diets are not the
answer. The American psychologist 62, 220-233, doi:10.1037/0003-066x.62.3.220
(2007).
14
French, S. A. et al. Weight variability and incident disease in older women: the Iowa
Women's Health Study. International journal of obesity and related metabolic disorders :
journal of the International Association for the Study of Obesity 21, 217-223 (1997).
15
Bray, G. A. & Ryan, D. H. Update on obesity pharmacotherapy. Annals of the New York
Academy of Sciences 1311, 1-13, doi:10.1111/nyas.12328 (2014).
16
Khera, R. et al. Association of Pharmacological Treatments for Obesity With Weight
Loss and Adverse Events: A Systematic Review and Meta-analysis. JAMA : the journal
of the American Medical Association 315, 2424-2434, doi:10.1001/jama.2016.7602
(2016).
17
Yanovski, S. Z. & Yanovski, J. A. Long-term drug treatment for obesity: a systematic and
clinical review. JAMA : the journal of the American Medical Association 311, 74-86,
doi:10.1001/jama.2013.281361 (2014).
18
Cheng, J., Gao, J., Shuai, X., Wang, G. & Tao, K. The comprehensive summary of
surgical versus non-surgical treatment for obesity: a systematic review and metaanalysis of randomized controlled trials. Oncotarget 7, 39216-39230,
doi:10.18632/oncotarget.9581 (2016).
19
Colquitt, J. L., Pickett, K., Loveman, E. & Frampton, G. K. Surgery for weight loss in
adults. The Cochrane database of systematic reviews, CD003641,
doi:10.1002/14651858.CD003641.pub4 (2014).
20
Janik, M. R., Rogula, T., Bielecka, I., Kwiatkowski, A. & Pasnik, K. Quality of Life and
Bariatric Surgery: Cross-Sectional Study and Analysis of Factors Influencing Outcome.
Obesity surgery 26, 2849-2855, doi:10.1007/s11695-016-2220-2 (2016).
21
Pories, W. J. Bariatric surgery: risks and rewards. The Journal of clinical endocrinology
and metabolism 93, S89-96, doi:10.1210/jc.2008-1641 (2008).
22
National Institute of Diabetes and Digetsive and Kidney Diseases. Definition and Facts
for Bariatric Surgery, (2016).
23
Ford, E. S. & Dietz, W. H. Trends in energy intake among adults in the United States:
findings from NHANES. The American journal of clinical nutrition 97, 848-853,
doi:10.3945/ajcn.112.052662 (2013).
24
Church, T. S. et al. Trends over 5 decades in U.S. occupation-related physical activity
and their associations with obesity. PloS one 6, e19657,
doi:10.1371/journal.pone.0019657 (2011).
25
Ward BW, C. T., Nugent CN, Schiller JS. Early release of selected estimates based on
data from the 2015 National Health Interview Survey., (U.S. Department of Health and
Human Services, 2016).
35
26
Cordain, L. et al. Origins and evolution of the Western diet: health implications for the
21st century. The American journal of clinical nutrition 81, 341-354 (2005).
27
Cota, D., Proulx, K. & Seeley, R. J. The role of CNS fuel sensing in energy and glucose
regulation. Gastroenterology 132, 2158-2168, doi:10.1053/j.gastro.2007.03.049 (2007).
28
Muller, M. J., Bosy-Westphal, A. & Heymsfield, S. B. Is there evidence for a set point
that regulates human body weight? F1000 medicine reports 2, 59, doi:10.3410/m2-59
(2010).
29
Poehlman, E. T. A review: exercise and its influence on resting energy metabolism in
man. Medicine and science in sports and exercise 21, 515-525 (1989).
30
Jebb, S. A. et al. Changes in macronutrient balance during over- and underfeeding
assessed by 12-d continuous whole-body calorimetry. The American journal of clinical
nutrition 64, 259-266 (1996).
31
Diaz, E. O., Prentice, A. M., Goldberg, G. R., Murgatroyd, P. R. & Coward, W. A.
Metabolic response to experimental overfeeding in lean and overweight healthy
volunteers. The American journal of clinical nutrition 56, 641-655 (1992).
32
Taylor, H. L. & Keys, A. Adaptation to caloric restriction. Science (New York, N.Y.) 112,
215-218 (1950).
33
Leibel, R. L., Rosenbaum, M. & Hirsch, J. Changes in energy expenditure resulting from
altered body weight. The New England journal of medicine 332, 621-628,
doi:10.1056/nejm199503093321001 (1995).
34
Redman, L. M. et al. Metabolic and behavioral compensations in response to caloric
restriction: implications for the maintenance of weight loss. PloS one 4, e4377,
doi:10.1371/journal.pone.0004377 (2009).
35
Larder, R. & O'Rahilly, S. Shedding pounds after going under the knife: guts over glorywhy diets fail. Nature medicine 18, 666-667, doi:10.1038/nm.2747 (2012).
36
Sumithran, P. et al. Long-term persistence of hormonal adaptations to weight loss. The
New England journal of medicine 365, 1597-1604, doi:10.1056/NEJMoa1105816 (2011).
37
Sumithran, P. & Proietto, J. The defence of body weight: a physiological basis for weight
regain after weight loss. Clinical science (London, England : 1979) 124, 231-241,
doi:10.1042/cs20120223 (2013).
38
Fothergill, E. et al. Persistent metabolic adaptation 6 years after "The Biggest Loser"
competition. Obesity (Silver Spring, Md.) 24, 1612-1619, doi:10.1002/oby.21538 (2016).
39
Locke, A. E. et al. Genetic studies of body mass index yield new insights for obesity
biology. Nature 518, 197-206, doi:10.1038/nature14177 (2015).
40
Friedman, J. M. & Halaas, J. L. Leptin and the regulation of body weight in mammals.
Nature 395, 763-770, doi:10.1038/27376 (1998).
36
41
Muller, T. D. et al. Ghrelin. Molecular metabolism 4, 437-460,
doi:10.1016/j.molmet.2015.03.005 (2015).
42
Richard, D. Cognitive and autonomic determinants of energy homeostasis in obesity.
Nature reviews. Endocrinology 11, 489-501, doi:10.1038/nrendo.2015.103 (2015).
43
Krashes, M. J. et al. Rapid, reversible activation of AgRP neurons drives feeding
behavior in mice. The Journal of clinical investigation 121, 1424-1428,
doi:10.1172/jci46229 (2011).
44
Krashes, M. J., Shah, B. P., Koda, S. & Lowell, B. B. Rapid versus delayed stimulation of
feeding by the endogenously released AgRP neuron mediators GABA, NPY, and AgRP.
Cell metabolism 18, 588-595, doi:10.1016/j.cmet.2013.09.009 (2013).
45
Webber, E. S., Bonci, A. & Krashes, M. J. The elegance of energy balance: Insight from
circuit-level manipulations. Synapse (New York, N.Y.) 69, 461-474,
doi:10.1002/syn.21837 (2015).
46
Betley, J. N. et al. Neurons for hunger and thirst transmit a negative-valence teaching
signal. Nature 521, 180-185, doi:10.1038/nature14416 (2015).
47
Chen, Y., Lin, Y. C., Kuo, T. W. & Knight, Z. A. Sensory detection of food rapidly
modulates arcuate feeding circuits. Cell 160, 829-841, doi:10.1016/j.cell.2015.01.033
(2015).
48
Morrison, C. D., Morton, G. J., Niswender, K. D., Gelling, R. W. & Schwartz, M. W.
Leptin inhibits hypothalamic Npy and Agrp gene expression via a mechanism that
requires phosphatidylinositol 3-OH-kinase signaling. American journal of physiology.
Endocrinology and metabolism 289, E1051-1057, doi:10.1152/ajpendo.00094.2005
(2005).
49
Zhan, C. et al. Acute and long-term suppression of feeding behavior by POMC neurons
in the brainstem and hypothalamus, respectively. The Journal of neuroscience : the
official journal of the Society for Neuroscience 33, 3624-3632,
doi:10.1523/jneurosci.2742-12.2013 (2013).
50
Cowley, M. A. et al. Leptin activates anorexigenic POMC neurons through a neural
network in the arcuate nucleus. Nature 411, 480-484, doi:10.1038/35078085 (2001).
51
Elias, C. F. et al. Leptin differentially regulates NPY and POMC neurons projecting to the
lateral hypothalamic area. Neuron 23, 775-786 (1999).
52
You, P. et al. Effects of Melanocortin 3 and 4 Receptor Deficiency on Energy
Homeostasis in Rats. Scientific reports 6, 34938, doi:10.1038/srep34938 (2016).
53
Huszar, D. et al. Targeted disruption of the melanocortin-4 receptor results in obesity in
mice. Cell 88, 131-141 (1997).
54
Vaisse, C., Clement, K., Guy-Grand, B. & Froguel, P. A frameshift mutation in human
MC4R is associated with a dominant form of obesity. Nature genetics 20, 113-114,
doi:10.1038/2407 (1998).
37
55
Farooqi, I. S. et al. Clinical spectrum of obesity and mutations in the melanocortin 4
receptor gene. The New England journal of medicine 348, 1085-1095,
doi:10.1056/NEJMoa022050 (2003).
56
Liu, H. et al. Transgenic mice expressing green fluorescent protein under the control of
the melanocortin-4 receptor promoter. The Journal of neuroscience : the official journal
of the Society for Neuroscience 23, 7143-7154 (2003).
57
Delgado, J. M. & Anand, B. K. Increase of food intake induced by electrical stimulation of
the lateral hypothalamus. The American journal of physiology 172, 162-168 (1953).
58
Anand, B. K. & Brobeck, J. R. Localization of a "feeding center" in the hypothalamus of
the rat. Proceedings of the Society for Experimental Biology and Medicine. Society for
Experimental Biology and Medicine (New York, N.Y.) 77, 323-324 (1951).
59
Morrison, S. D., Barrnett, R. J. & Mayer, J. Localization of lesions in the lateral
hypothalamus of rats with induced adipsia and aphagia. The American journal of
physiology 193, 230-234 (1958).
60
Grossman, S. P., Dacey, D., Halaris, A. E., Collier, T. & Routtenberg, A. Aphagia and
adipsia after preferential destruction of nerve cell bodies in hypothalamus. Science (New
York, N.Y.) 202, 537-539 (1978).
61
Salamone, J. D. & Correa, M. The mysterious motivational functions of mesolimbic
dopamine. Neuron 76, 470-485, doi:10.1016/j.neuron.2012.10.021 (2012).
62
Hernandez, L. & Hoebel, B. G. Feeding and hypothalamic stimulation increase
dopamine turnover in the accumbens. Physiology & behavior 44, 599-606 (1988).
63
Olds, J. & Milner, P. Positive reinforcement produced by electrical stimulation of septal
area and other regions of rat brain. Journal of comparative and physiological psychology
47, 419-427 (1954).
64
Saper, C. B., Swanson, L. W. & Cowan, W. M. An autoradiographic study of the efferent
connections of the lateral hypothalamic area in the rat. The Journal of comparative
neurology 183, 689-706, doi:10.1002/cne.901830402 (1979).
65
Leinninger, G. M. et al. Leptin acts via leptin receptor-expressing lateral hypothalamic
neurons to modulate the mesolimbic dopamine system and suppress feeding. Cell
metabolism 10, 89-98, doi:10.1016/j.cmet.2009.06.011 (2009).
66
Brown, J. A. et al. Loss of Action via Neurotensin-Leptin Receptor Neurons Disrupts
Leptin and Ghrelin-Mediated Control of Energy Balance. Endocrinology,
doi:10.1210/en.2017-00122 (2017).
67
Brown, J. A., Woodworth, H. L. & Leinninger, G. M. To ingest or rest? Specialized roles
of lateral hypothalamic area neurons in coordinating energy balance. Frontiers in
systems neuroscience 9, 9, doi:10.3389/fnsys.2015.00009 (2015).
68
Stuber, G. D. & Wise, R. A. Lateral hypothalamic circuits for feeding and reward. Nature
neuroscience 19, 198-205, doi:10.1038/nn.4220 (2016).
38
69
de Lecea, L. et al. The hypocretins: hypothalamus-specific peptides with neuroexcitatory
activity. Proceedings of the National Academy of Sciences of the United States of
America 95, 322-327 (1998).
70
Yamanaka, A. et al. Hypothalamic orexin neurons regulate arousal according to energy
balance in mice. Neuron 38, 701-713 (2003).
71
Inutsuka, A. et al. Concurrent and robust regulation of feeding behaviors and metabolism
by orexin neurons. Neuropharmacology 85, 451-460,
doi:10.1016/j.neuropharm.2014.06.015 (2014).
72
Cai, X. J. et al. Hypoglycemia activates orexin neurons and selectively increases
hypothalamic orexin-B levels: responses inhibited by feeding and possibly mediated by
the nucleus of the solitary tract. Diabetes 50, 105-112 (2001).
73
Moriguchi, T., Sakurai, T., Nambu, T., Yanagisawa, M. & Goto, K. Neurons containing
orexin in the lateral hypothalamic area of the adult rat brain are activated by insulininduced acute hypoglycemia. Neuroscience letters 264, 101-104 (1999).
74
Marcus, J. N. et al. Differential expression of orexin receptors 1 and 2 in the rat brain.
The Journal of comparative neurology 435, 6-25 (2001).
75
Korotkova, T. M., Sergeeva, O. A., Eriksson, K. S., Haas, H. L. & Brown, R. E. Excitation
of ventral tegmental area dopaminergic and nondopaminergic neurons by
orexins/hypocretins. The Journal of neuroscience : the official journal of the Society for
Neuroscience 23, 7-11 (2003).
76
Rosin, D. L., Weston, M. C., Sevigny, C. P., Stornetta, R. L. & Guyenet, P. G.
Hypothalamic orexin (hypocretin) neurons express vesicular glutamate transporters
VGLUT1 or VGLUT2. The Journal of comparative neurology 465, 593-603,
doi:10.1002/cne.10860 (2003).
77
Ludwig, D. S. et al. Melanin-concentrating hormone overexpression in transgenic mice
leads to obesity and insulin resistance. The Journal of clinical investigation 107, 379386, doi:10.1172/jci10660 (2001).
78
Qu, D. et al. A role for melanin-concentrating hormone in the central regulation of
feeding behaviour. Nature 380, 243-247, doi:10.1038/380243a0 (1996).
79
Jego, S. et al. Optogenetic identification of a rapid eye movement sleep modulatory
circuit in the hypothalamus. Nature neuroscience 16, 1637-1643, doi:10.1038/nn.3522
(2013).
80
Harthoorn, L. F., Sane, A., Nethe, M. & Van Heerikhuize, J. J. Multi-transcriptional
profiling of melanin-concentrating hormone and orexin-containing neurons. Cellular and
molecular neurobiology 25, 1209-1223, doi:10.1007/s10571-005-8184-8 (2005).
81
Elias, C. F. et al. Characterization of CART neurons in the rat and human hypothalamus.
The Journal of comparative neurology 432, 1-19 (2001).
39
82
Chee, M. J., Pissios, P. & Maratos-Flier, E. Neurochemical characterization of neurons
expressing melanin-concentrating hormone receptor 1 in the mouse hypothalamus. The
Journal of comparative neurology 521, 2208-2234, doi:10.1002/cne.23273 (2013).
83
Pissios, P. et al. Dysregulation of the mesolimbic dopamine system and reward in MCH/- mice. Biological psychiatry 64, 184-191, doi:10.1016/j.biopsych.2007.12.011 (2008).
84
Sears, R. M. et al. Regulation of nucleus accumbens activity by the hypothalamic
neuropeptide melanin-concentrating hormone. The Journal of neuroscience : the official
journal of the Society for Neuroscience 30, 8263-8273, doi:10.1523/jneurosci.585809.2010 (2010).
85
Leinninger, G. M. et al. Leptin action via neurotensin neurons controls orexin, the
mesolimbic dopamine system and energy balance. Cell metabolism 14, 313-323,
doi:10.1016/j.cmet.2011.06.016 (2011).
86
Cador, M., Kelley, A. E., Le Moal, M. & Stinus, L. Ventral tegmental area infusion of
substance P, neurotensin and enkephalin: differential effects on feeding behavior.
Neuroscience 18, 659-669 (1986).
87
Hawkins, M. F. Central nervous system neurotensin and feeding. Physiology & behavior
36, 1-8 (1986).
88
Hawkins, M. F. Aphagia in the rat following microinjection of neurotensin into the ventral
tegmental area. Life sciences 38, 2383-2388 (1986).
89
Feifel, D., Goldenberg, J., Melendez, G. & Shilling, P. D. The acute and subchronic
effects of a brain-penetrating, neurotensin-1 receptor agonist on feeding, body weight
and temperature. Neuropharmacology 58, 195-198,
doi:10.1016/j.neuropharm.2009.07.001 (2010).
90
Boules, M. et al. A novel neurotensin peptide analog given extracranially decreases food
intake and weight in rodents. Brain research 865, 35-44 (2000).
91
Goforth, P. B., Leinninger, G. M., Patterson, C. M., Satin, L. S. & Myers, M. G., Jr. Leptin
acts via lateral hypothalamic area neurotensin neurons to inhibit orexin neurons by
multiple GABA-independent mechanisms. The Journal of neuroscience : the official
journal of the Society for Neuroscience 34, 11405-11415, doi:10.1523/jneurosci.516713.2014 (2014).
92
Kalivas, P. W., Burgess, S. K., Nemeroff, C. B. & Prange, A. J., Jr. Behavioral and
neurochemical effects of neurotensin microinjection into the ventral tegmental area of
the rat. Neuroscience 8, 495-505 (1983).
93
Patterson, C. M. et al. Ventral tegmental area neurotensin signaling links the lateral
hypothalamus to locomotor activity and striatal dopamine efflux in male mice.
Endocrinology 156, 1692-1700, doi:10.1210/en.2014-1986 (2015).
94
Zhou, Q. Y. & Palmiter, R. D. Dopamine-deficient mice are severely hypoactive, adipsic,
and aphagic. Cell 83, 1197-1209 (1995).
40
95
Elsworth, J. D. & Roth, R. H. Dopamine synthesis, uptake, metabolism, and receptors:
relevance to gene therapy of Parkinson's disease. Experimental neurology 144, 4-9,
doi:10.1006/exnr.1996.6379 (1997).
96
Kebabian, J. W. & Greengard, P. Dopamine-sensitive adenyl cyclase: possible role in
synaptic transmission. Science (New York, N.Y.) 174, 1346-1349 (1971).
97
Enjalbert, A. & Bockaert, J. Pharmacological characterization of the D2 dopamine
receptor negatively coupled with adenylate cyclase in rat anterior pituitary. Molecular
pharmacology 23, 576-584 (1983).
98
Missale, C., Nash, S. R., Robinson, S. W., Jaber, M. & Caron, M. G. Dopamine
receptors: from structure to function. Physiological reviews 78, 189-225 (1998).
99
Greengard, P. The neurobiology of dopamine signaling. Bioscience reports 21, 247-269
(2001).
100
Yao, W. D., Spealman, R. D. & Zhang, J. Dopaminergic signaling in dendritic spines.
Biochemical pharmacology 75, 2055-2069, doi:10.1016/j.bcp.2008.01.018 (2008).
101
Onali, P., Olianas, M. C. & Bunse, B. Evidence that adenosine A2 and dopamine
autoreceptors antagonistically regulate tyrosine hydroxylase activity in rat striatal
synaptosomes. Brain research 456, 302-309 (1988).
102
Pothos, E. N., Przedborski, S., Davila, V., Schmitz, Y. & Sulzer, D. D2-Like dopamine
autoreceptor activation reduces quantal size in PC12 cells. The Journal of neuroscience
: the official journal of the Society for Neuroscience 18, 5575-5585 (1998).
103
Cass, W. A. & Zahniser, N. R. Potassium channel blockers inhibit D2 dopamine, but not
A1 adenosine, receptor-mediated inhibition of striatal dopamine release. Journal of
neurochemistry 57, 147-152 (1991).
104
Baik, J. H. Dopamine signaling in reward-related behaviors. Frontiers in neural circuits 7,
152, doi:10.3389/fncir.2013.00152 (2013).
105
Beaulieu, J. M. & Gainetdinov, R. R. The physiology, signaling, and pharmacology of
dopamine receptors. Pharmacological reviews 63, 182-217, doi:10.1124/pr.110.002642
(2011).
106
Roeper, J. Dissecting the diversity of midbrain dopamine neurons. Trends in
neurosciences 36, 336-342, doi:10.1016/j.tins.2013.03.003 (2013).
107
Salamone, J. D., Correa, M., Mingote, S. M. & Weber, S. M. Beyond the reward
hypothesis: alternative functions of nucleus accumbens dopamine. Current opinion in
pharmacology 5, 34-41, doi:10.1016/j.coph.2004.09.004 (2005).
108
Yin, H. H., Ostlund, S. B. & Balleine, B. W. Reward-guided learning beyond dopamine in
the nucleus accumbens: the integrative functions of cortico-basal ganglia networks. The
European journal of neuroscience 28, 1437-1448, doi:10.1111/j.14609568.2008.06422.x (2008).
41
109
Berridge, K. C. & Kringelbach, M. L. Pleasure systems in the brain. Neuron 86, 646-664,
doi:10.1016/j.neuron.2015.02.018 (2015).
110
Berridge, K. C. & Robinson, T. E. What is the role of dopamine in reward: hedonic
impact, reward learning, or incentive salience? Brain research. Brain research reviews
28, 309-369 (1998).
111
Berridge, K. C., Venier, I. L. & Robinson, T. E. Taste reactivity analysis of 6hydroxydopamine-induced aphagia: implications for arousal and anhedonia hypotheses
of dopamine function. Behavioral neuroscience 103, 36-45 (1989).
112
Tobler, P. N., Fiorillo, C. D. & Schultz, W. Adaptive coding of reward value by dopamine
neurons. Science (New York, N.Y.) 307, 1642-1645, doi:10.1126/science.1105370
(2005).
113
Schultz, W. Dopamine reward prediction-error signalling: a two-component response.
Nature reviews. Neuroscience 17, 183-195, doi:10.1038/nrn.2015.26 (2016).
114
Morales, M. & Margolis, E. B. Ventral tegmental area: cellular heterogeneity, connectivity
and behaviour. Nature reviews. Neuroscience 18, 73-85, doi:10.1038/nrn.2016.165
(2017).
115
Swanson, L. W. The projections of the ventral tegmental area and adjacent regions: a
combined fluorescent retrograde tracer and immunofluorescence study in the rat. Brain
research bulletin 9, 321-353 (1982).
116
Lammel, S. et al. Unique properties of mesoprefrontal neurons within a dual
mesocorticolimbic dopamine system. Neuron 57, 760-773,
doi:10.1016/j.neuron.2008.01.022 (2008).
117
Lammel, S., Ion, D. I., Roeper, J. & Malenka, R. C. Projection-specific modulation of
dopamine neuron synapses by aversive and rewarding stimuli. Neuron 70, 855-862,
doi:10.1016/j.neuron.2011.03.025 (2011).
118
Lammel, S. et al. Input-specific control of reward and aversion in the ventral tegmental
area. Nature 491, 212-217, doi:10.1038/nature11527 (2012).
119
Ungerstedt, U. & Arbuthnott, G. W. Quantitative recording of rotational behavior in rats
after 6-hydroxy-dopamine lesions of the nigrostriatal dopamine system. Brain research
24, 485-493 (1970).
120
Ungerstedt, U. Adipsia and aphagia after 6-hydroxydopamine induced degeneration of
the nigro-striatal dopamine system. Acta physiologica Scandinavica. Supplementum
367, 95-122 (1971).
121
Salamone, J. D., Mahan, K. & Rogers, S. Ventrolateral striatal dopamine depletions
impair feeding and food handling in rats. Pharmacology, biochemistry, and behavior 44,
605-610 (1993).
42
122
Salamone, J. D., Zigmond, M. J. & Stricker, E. M. Characterization of the impaired
feeding behavior in rats given haloperidol or dopamine-depleting brain lesions.
Neuroscience 39, 17-24 (1990).
123
Baldo, B. A., Sadeghian, K., Basso, A. M. & Kelley, A. E. Effects of selective dopamine
D1 or D2 receptor blockade within nucleus accumbens subregions on ingestive behavior
and associated motor activity. Behavioural brain research 137, 165-177 (2002).
124
Jicha, G. A. & Salamone, J. D. Vacuous jaw movements and feeding deficits in rats with
ventrolateral striatal dopamine depletion: possible relation to parkinsonian symptoms.
The Journal of neuroscience : the official journal of the Society for Neuroscience 11,
3822-3829 (1991).
125
Aberman, J. E. & Salamone, J. D. Nucleus accumbens dopamine depletions make rats
more sensitive to high ratio requirements but do not impair primary food reinforcement.
Neuroscience 92, 545-552 (1999).
126
Salamone, J. D. et al. Haloperidol and nucleus accumbens dopamine depletion
suppress lever pressing for food but increase free food consumption in a novel food
choice procedure. Psychopharmacology 104, 515-521 (1991).
127
Ikemoto, S. & Panksepp, J. Dissociations between appetitive and consummatory
responses by pharmacological manipulations of reward-relevant brain regions.
Behavioral neuroscience 110, 331-345 (1996).
128
Nicola, S. M. The flexible approach hypothesis: unification of effort and cue-responding
hypotheses for the role of nucleus accumbens dopamine in the activation of rewardseeking behavior. The Journal of neuroscience : the official journal of the Society for
Neuroscience 30, 16585-16600, doi:10.1523/jneurosci.3958-10.2010 (2010).
129
Cousins, M. S., Sokolowski, J. D. & Salamone, J. D. Different effects of nucleus
accumbens and ventrolateral striatal dopamine depletions on instrumental response
selection in the rat. Pharmacology, biochemistry, and behavior 46, 943-951 (1993).
130
Nowend, K. L., Arizzi, M., Carlson, B. B. & Salamone, J. D. D1 or D2 antagonism in
nucleus accumbens core or dorsomedial shell suppresses lever pressing for food but
leads to compensatory increases in chow consumption. Pharmacology, biochemistry,
and behavior 69, 373-382 (2001).
131
Sink, K. S., Vemuri, V. K., Olszewska, T., Makriyannis, A. & Salamone, J. D.
Cannabinoid CB1 antagonists and dopamine antagonists produce different effects on a
task involving response allocation and effort-related choice in food-seeking behavior.
Psychopharmacology 196, 565-574, doi:10.1007/s00213-007-0988-4 (2008).
132
Denk, F. et al. Differential involvement of serotonin and dopamine systems in costbenefit decisions about delay or effort. Psychopharmacology 179, 587-596,
doi:10.1007/s00213-004-2059-4 (2005).
133
Mai, B., Sommer, S. & Hauber, W. Motivational states influence effort-based decision
making in rats: the role of dopamine in the nucleus accumbens. Cognitive, affective &
behavioral neuroscience 12, 74-84, doi:10.3758/s13415-011-0068-4 (2012).
43
134
Szczypka, M. S. et al. Feeding behavior in dopamine-deficient mice. Proceedings of the
National Academy of Sciences of the United States of America 96, 12138-12143 (1999).
135
Hnasko, T. S. et al. Cre recombinase-mediated restoration of nigrostriatal dopamine in
dopamine-deficient mice reverses hypophagia and bradykinesia. Proceedings of the
National Academy of Sciences of the United States of America 103, 8858-8863,
doi:10.1073/pnas.0603081103 (2006).
136
Steiner, J. E. The gustofacial response: observation on normal and anencephalic
newborn infants. Symposium on Oral Sensation and Perception, 254-278 (1973).
137
Pecina, S., Cagniard, B., Berridge, K. C., Aldridge, J. W. & Zhuang, X.
Hyperdopaminergic mutant mice have higher "wanting" but not "liking" for sweet
rewards. The Journal of neuroscience : the official journal of the Society for
Neuroscience 23, 9395-9402 (2003).
138
Wyvell, C. L. & Berridge, K. C. Intra-accumbens amphetamine increases the conditioned
incentive salience of sucrose reward: enhancement of reward "wanting" without
enhanced "liking" or response reinforcement. The Journal of neuroscience : the official
journal of the Society for Neuroscience 20, 8122-8130 (2000).
139
Bassareo, V., De Luca, M. A. & Di Chiara, G. Differential Expression of Motivational
Stimulus Properties by Dopamine in Nucleus Accumbens Shell versus Core and
Prefrontal Cortex. The Journal of neuroscience : the official journal of the Society for
Neuroscience 22, 4709-4719, doi:20026445 (2002).
140
Ahn, S. & Phillips, A. G. Dopaminergic correlates of sensory-specific satiety in the
medial prefrontal cortex and nucleus accumbens of the rat. The Journal of neuroscience
: the official journal of the Society for Neuroscience 19, RC29 (1999).
141
Beeler, J. A. et al. Taste uncoupled from nutrition fails to sustain the reinforcing
properties of food. The European journal of neuroscience 36, 2533-2546,
doi:10.1111/j.1460-9568.2012.08167.x (2012).
142
Hajnal, A. & Norgren, R. Sucrose sham feeding decreases accumbens norepinephrine in
the rat. Physiology & behavior 82, 43-47, doi:10.1016/j.physbeh.2004.04.024 (2004).
143
Wheeler, R. A. et al. Cocaine cues drive opposing context-dependent shifts in reward
processing and emotional state. Biological psychiatry 69, 1067-1074,
doi:10.1016/j.biopsych.2011.02.014 (2011).
144
de Araujo, I. E. et al. Food reward in the absence of taste receptor signaling. Neuron 57,
930-941, doi:10.1016/j.neuron.2008.01.032 (2008).
145
Ferreira, J. G., Tellez, L. A., Ren, X., Yeckel, C. W. & de Araujo, I. E. Regulation of fat
intake in the absence of flavour signalling. The Journal of physiology 590, 953-972,
doi:10.1113/jphysiol.2011.218289 (2012).
146
Branch, S. Y. et al. Food restriction increases glutamate receptor-mediated burst firing of
dopamine neurons. The Journal of neuroscience : the official journal of the Society for
Neuroscience 33, 13861-13872, doi:10.1523/jneurosci.5099-12.2013 (2013).
44
147
Wilson, C., Nomikos, G. G., Collu, M. & Fibiger, H. C. Dopaminergic correlates of
motivated behavior: importance of drive. The Journal of neuroscience : the official
journal of the Society for Neuroscience 15, 5169-5178 (1995).
148
Zhen, J., Reith, M. E. & Carr, K. D. Chronic food restriction and dopamine transporter
function in rat striatum. Brain research 1082, 98-101, doi:10.1016/j.brainres.2006.01.094
(2006).
149
Sevak, R. J. et al. Feeding conditions differentially affect the neurochemical and
behavioral effects of dopaminergic drugs in male rats. European journal of
pharmacology 592, 109-115, doi:10.1016/j.ejphar.2008.07.002 (2008).
150
Sharma, S., Hryhorczuk, C. & Fulton, S. Progressive-ratio responding for palatable highfat and high-sugar food in mice. Journal of visualized experiments : JoVE, e3754,
doi:10.3791/3754 (2012).
151
Scheggi, S., Secci, M. E., Marchese, G., De Montis, M. G. & Gambarana, C. Influence of
palatability on motivation to operate for caloric and non-caloric food in non food-deprived
and food-deprived rats. Neuroscience 236, 320-331,
doi:10.1016/j.neuroscience.2013.01.027 (2013).
152
Hommel, J. D. et al. Leptin receptor signaling in midbrain dopamine neurons regulates
feeding. Neuron 51, 801-810, doi:10.1016/j.neuron.2006.08.023 (2006).
153
Fulton, S. et al. Leptin regulation of the mesoaccumbens dopamine pathway. Neuron 51,
811-822, doi:10.1016/j.neuron.2006.09.006 (2006).
154
Leshan, R. L. et al. Ventral tegmental area leptin receptor neurons specifically project to
and regulate cocaine- and amphetamine-regulated transcript neurons of the extended
central amygdala. The Journal of neuroscience : the official journal of the Society for
Neuroscience 30, 5713-5723, doi:10.1523/jneurosci.1001-10.2010 (2010).
155
Ahima, R. S. et al. Role of leptin in the neuroendocrine response to fasting. Nature 382,
250-252, doi:10.1038/382250a0 (1996).
156
Figlewicz, D. P., Higgins, M. S., Ng-Evans, S. B. & Havel, P. J. Leptin reverses sucroseconditioned place preference in food-restricted rats. Physiology & behavior 73, 229-234
(2001).
157
Figlewicz, D. P. et al. Intraventricular insulin and leptin reverse place preference
conditioned with high-fat diet in rats. Behavioral neuroscience 118, 479-487,
doi:10.1037/0735-7044.118.3.479 (2004).
158
Fernandes, M. F. et al. Leptin Suppresses the Rewarding Effects of Running via STAT3
Signaling in Dopamine Neurons. Cell metabolism 22, 741-749,
doi:10.1016/j.cmet.2015.08.003 (2015).
159
Liu, J., Perez, S. M., Zhang, W., Lodge, D. J. & Lu, X. Y. Selective deletion of the leptin
receptor in dopamine neurons produces anxiogenic-like behavior and increases
dopaminergic activity in amygdala. Molecular psychiatry 16, 1024-1038,
doi:10.1038/mp.2011.36 (2011).
45
160
Opland, D. M., Leinninger, G. M. & Myers, M. G., Jr. Modulation of the mesolimbic
dopamine system by leptin. Brain research 1350, 65-70,
doi:10.1016/j.brainres.2010.04.028 (2010).
161
Abizaid, A. et al. Ghrelin modulates the activity and synaptic input organization of
midbrain dopamine neurons while promoting appetite. The Journal of clinical
investigation 116, 3229-3239, doi:10.1172/jci29867 (2006).
162
Egecioglu, E. et al. Ghrelin increases intake of rewarding food in rodents. Addiction
biology 15, 304-311, doi:10.1111/j.1369-1600.2010.00216.x (2010).
163
Jerlhag, E. et al. Ghrelin administration into tegmental areas stimulates locomotor
activity and increases extracellular concentration of dopamine in the nucleus
accumbens. Addiction biology 12, 6-16, doi:10.1111/j.1369-1600.2006.00041.x (2007).
164
Skibicka, K. P., Hansson, C., Alvarez-Crespo, M., Friberg, P. A. & Dickson, S. L. Ghrelin
directly targets the ventral tegmental area to increase food motivation. Neuroscience
180, 129-137, doi:10.1016/j.neuroscience.2011.02.016 (2011).
165
Skibicka, K. P., Hansson, C., Egecioglu, E. & Dickson, S. L. Role of ghrelin in food
reward: impact of ghrelin on sucrose self-administration and mesolimbic dopamine and
acetylcholine receptor gene expression. Addiction biology 17, 95-107,
doi:10.1111/j.1369-1600.2010.00294.x (2012).
166
Skibicka, K. P. et al. Divergent circuitry underlying food reward and intake effects of
ghrelin: dopaminergic VTA-accumbens projection mediates ghrelin's effect on food
reward but not food intake. Neuropharmacology 73, 274-283,
doi:10.1016/j.neuropharm.2013.06.004 (2013).
167
Kelly, P. H., Seviour, P. W. & Iversen, S. D. Amphetamine and apomorphine responses
in the rat following 6-OHDA lesions of the nucleus accumbens septi and corpus striatum.
Brain Res 94, 507-522, doi:0006-8993(75)90233-4 [pii] (1975).
168
Beninger, R. J. The role of dopamine in locomotor activity and learning. Brain research
287, 173-196 (1983).
169
Cagniard, B., Balsam, P. D., Brunner, D. & Zhuang, X. Mice with chronically elevated
dopamine exhibit enhanced motivation, but not learning, for a food reward.
Neuropsychopharmacology : official publication of the American College of
Neuropsychopharmacology 31, 1362-1370, doi:10.1038/sj.npp.1300966 (2006).
170
Giros, B., Jaber, M., Jones, S. R., Wightman, R. M. & Caron, M. G. Hyperlocomotion
and indifference to cocaine and amphetamine in mice lacking the dopamine transporter.
Nature 379, 606-612, doi:10.1038/379606a0 (1996).
171
Beeler, J. A., Frazier, C. R. & Zhuang, X. Putting desire on a budget: dopamine and
energy expenditure, reconciling reward and resources. Frontiers in integrative
neuroscience 6, 49, doi:10.3389/fnint.2012.00049 (2012).
46
172
Belke, T. W. Exclusive preference develops less readily on concurrent ratio schedules
with wheel-running than with sucrose reinforcement. Journal of the experimental
analysis of behavior 94, 135-158, doi:10.1901/jeab.2010.94-135 (2010).
173
Lett, B. T., Grant, V. L., Byrne, M. J. & Koh, M. T. Pairings of a distinctive chamber with
the aftereffect of wheel running produce conditioned place preference. Appetite 34, 8794, doi:10.1006/appe.1999.0274 (2000).
174
Greenwood, B. N. et al. Long-term voluntary wheel running is rewarding and produces
plasticity in the mesolimbic reward pathway. Behavioural brain research 217, 354-362,
doi:10.1016/j.bbr.2010.11.005 (2011).
175
Yang, H. S., Shimomura, K., Vitaterna, M. H. & Turek, F. W. High-resolution mapping of
a novel genetic locus regulating voluntary physical activity in mice. Genes, brain, and
behavior 11, 113-124, doi:10.1111/j.1601-183X.2011.00737.x (2012).
176
Mathes, W. F. et al. Dopaminergic dysregulation in mice selectively bred for excessive
exercise or obesity. Behavioural brain research 210, 155-163,
doi:10.1016/j.bbr.2010.02.016 (2010).
177
Belke, T. W. & Pierce, W. D. Wheel-running reinforcement in free-feeding and fooddeprived rats. Behavioural processes 124, 1-9, doi:10.1016/j.beproc.2015.11.018
(2016).
178
Cone, J. J., McCutcheon, J. E. & Roitman, M. F. Ghrelin acts as an interface between
physiological state and phasic dopamine signaling. The Journal of neuroscience : the
official journal of the Society for Neuroscience 34, 4905-4913,
doi:10.1523/jneurosci.4404-13.2014 (2014).
179
Stuber, G. D., Evans, S. B., Higgins, M. S., Pu, Y. & Figlewicz, D. P. Food restriction
modulates amphetamine-conditioned place preference and nucleus accumbens
dopamine release in the rat. Synapse (New York, N.Y.) 46, 83-90,
doi:10.1002/syn.10120 (2002).
180
Marinelli, M., Le Moal, M. & Piazza, P. V. Acute pharmacological blockade of
corticosterone secretion reverses food restriction-induced sensitization of the locomotor
response to cocaine. Brain research 724, 251-255 (1996).
181
Carr, K. D. & Wolinsky, T. D. Chronic food restriction and weight loss produce opioid
facilitation of perifornical hypothalamic self-stimulation. Brain research 607, 141-148
(1993).
182
Geisler, S. & Zahm, D. S. Neurotensin afferents of the ventral tegmental area in the rat:
[1] re-examination of their origins and [2] responses to acute psychostimulant and
antipsychotic drug administration. The European journal of neuroscience 24, 116-134,
doi:10.1111/j.1460-9568.2006.04928.x (2006).
183
Quarta, D. & Smolders, I. Rewarding, reinforcing and incentive salient events involve
orexigenic hypothalamic neuropeptides regulating mesolimbic dopaminergic
neurotransmission. European journal of pharmaceutical sciences : official journal of the
47
European Federation for Pharmaceutical Sciences 57, 2-10,
doi:10.1016/j.ejps.2014.01.008 (2014).
184
Borgland, S. L., Ungless, M. A. & Bonci, A. Convergent actions of orexin/hypocretin and
CRF on dopamine neurons: Emerging players in addiction. Brain research 1314, 139144, doi:10.1016/j.brainres.2009.10.068 (2010).
185
van den Pol, A. N. Neuropeptide transmission in brain circuits. Neuron 76, 98-115,
doi:10.1016/j.neuron.2012.09.014 (2012).
186
Carraway, R. & Leeman, S. E. The isolation of a new hypotensive peptide, neurotensin,
from bovine hypothalami. The Journal of biological chemistry 248, 6854-6861 (1973).
187
Carraway, R. & Leeman, S. E. Characterization of radioimmunoassayable neurotensin in
the rat. Its differential distribution in the central nervous system, small intestine, and
stomach. The Journal of biological chemistry 251, 7045-7052 (1976).
188
Geisler, S., Berod, A., Zahm, D. S. & Rostene, W. Brain neurotensin, psychostimulants,
and stress--emphasis on neuroanatomical substrates. Peptides 27, 2364-2384,
doi:10.1016/j.peptides.2006.03.037 (2006).
189
Kitabgi, P., De Nadai, F., Rovere, C. & Bidard, J. N. Biosynthesis, maturation, release,
and degradation of neurotensin and neuromedin N. Annals of the New York Academy of
Sciences 668, 30-42 (1992).
190
Bayer, V. E., Towle, A. C. & Pickel, V. M. Vesicular and cytoplasmic localization of
neurotensin-like immunoreactivity (NTLI) in neurons postsynaptic to terminals containing
NTLI and/or tyrosine hydroxylase in the rat central nucleus of the amygdala. Journal of
neuroscience research 30, 398-413, doi:10.1002/jnr.490300216 (1991).
191
Elliott, P. J., Chan, J., Parker, Y. M. & Nemeroff, C. B. Behavioral effects of neurotensin
in the open field: structure-activity studies. Brain research 381, 259-265 (1986).
192
Bissette, G., Luttinger, D., Mason, G. A., Hernandez, D. E. & Loosen, P. T. Neurotensin
and thermoregulation. Annals of the New York Academy of Sciences 400, 268-282
(1982).
193
Leeman, S. E. & Carraway, R. E. Neurotensin: discovery, isolation, characterization,
synthesis and possible physiological roles. Annals of the New York Academy of
Sciences 400, 1-16 (1982).
194
Lein, E. S. et al. Genome-wide atlas of gene expression in the adult mouse brain. Nature
445, 168-176, doi:10.1038/nature05453 (2007).
195
Tanaka, K., Masu, M. & Nakanishi, S. Structure and functional expression of the cloned
rat neurotensin receptor. Neuron 4, 847-854 (1990).
196
Vita, N. et al. Cloning and expression of a complementary DNA encoding a high affinity
human neurotensin receptor. FEBS letters 317, 139-142 (1993).
48
197
Mazella, J. et al. Structure, functional expression, and cerebral localization of the
levocabastine-sensitive neurotensin/neuromedin N receptor from mouse brain. The
Journal of neuroscience : the official journal of the Society for Neuroscience 16, 56135620 (1996).
198
Chalon, P. et al. Molecular cloning of a levocabastine-sensitive neurotensin binding site.
FEBS letters 386, 91-94 (1996).
199
Hermans, E., Jeanjean, A. P., Laduron, P. M., Octave, J. N. & Maloteaux, J. M.
Postnatal ontogeny of the rat brain neurotensin receptor mRNA. Neuroscience letters
157, 45-48 (1993).
200
Amar, S., Kitabgi, P. & Vincent, J. P. Activation of phosphatidylinositol turnover by
neurotensin receptors in the human colonic adenocarcinoma cell line HT29. FEBS
letters 201, 31-36 (1986).
201
Vita, N. et al. Neurotensin is an antagonist of the human neurotensin NT2 receptor
expressed in Chinese hamster ovary cells. European journal of pharmacology 360, 265272 (1998).
202
Mazella, J. et al. The 100-kDa neurotensin receptor is gp95/sortilin, a non-G-proteincoupled receptor. The Journal of biological chemistry 273, 26273-26276 (1998).
203
Kleczkowska, P. & Lipkowski, A. W. Neurotensin and neurotensin receptors:
characteristic, structure-activity relationship and pain modulation--a review. European
journal of pharmacology 716, 54-60, doi:10.1016/j.ejphar.2013.03.004 (2013).
204
Lepee-Lorgeoux, I., Betancur, C., Rostene, W. & Pelaprat, D. Differential ontogenetic
patterns of levocabastine-sensitive neurotensin NT2 receptors and of NT1 receptors in
the rat brain revealed by in situ hybridization. Brain research. Developmental brain
research 113, 115-131 (1999).
205
Palacios, J. M., Pazos, A., Dietl, M. M., Schlumpf, M. & Lichtensteiger, W. The ontogeny
of brain neurotensin receptors studied by autoradiography. Neuroscience 25, 307-317
(1988).
206
Sarret, P., Beaudet, A., Vincent, J. P. & Mazella, J. Regional and cellular distribution of
low affinity neurotensin receptor mRNA in adult and developing mouse brain. The
Journal of comparative neurology 394, 344-356 (1998).
207
Walker, N. et al. Tissue distribution and cellular localization of the levocabastinesensitive neurotensin receptor mRNA in adult rat brain. Brain research. Molecular brain
research 57, 193-200 (1998).
208
Yamauchi, R. et al. Neurotensin type 2 receptor is involved in fear memory in mice.
Journal of neurochemistry 102, 1669-1676, doi:10.1111/j.1471-4159.2007.04805.x
(2007).
209
Nouel, D., Sarret, P., Vincent, J. P., Mazella, J. & Beaudet, A. Pharmacological,
molecular and functional characterization of glial neurotensin receptors. Neuroscience
94, 1189-1197 (1999).
49
210
Nouel, D. et al. Differential binding profile and internalization process of neurotensin via
neuronal and glial receptors. The Journal of neuroscience : the official journal of the
Society for Neuroscience 17, 1795-1803 (1997).
211
Sarret, P., Perron, A., Stroh, T. & Beaudet, A. Immunohistochemical distribution of NTS2
neurotensin receptors in the rat central nervous system. The Journal of comparative
neurology 461, 520-538, doi:10.1002/cne.10718 (2003).
212
Remaury, A. et al. Targeted inactivation of the neurotensin type 1 receptor reveals its
role in body temperature control and feeding behavior but not in analgesia. Brain
research 953, 63-72 (2002).
213
Pettibone, D. J. et al. The effects of deleting the mouse neurotensin receptor NTR1 on
central and peripheral responses to neurotensin. The Journal of pharmacology and
experimental therapeutics 300, 305-313 (2002).
214
Leonetti, M. et al. Specific involvement of neurotensin type 1 receptor in the neurotensinmediated in vivo dopamine efflux using knock-out mice. Journal of neurochemistry 89, 16, doi:10.1046/j.1471-4159.2003.02231.x (2004).
215
Kim, E. R. & Mizuno, T. M. Role of neurotensin receptor 1 in the regulation of food intake
by neuromedins and neuromedin-related peptides. Neuroscience letters 468, 64-67,
doi:10.1016/j.neulet.2009.10.064 (2010).
216
Rouibi, K., Bose, P., Rompre, P. P. & Warren, R. A. Ventral Midbrain NTS1 Receptors
Mediate Conditioned Reward Induced by the Neurotensin Analog, D-Tyr[11]neurotensin.
Frontiers in neuroscience 9, 470, doi:10.3389/fnins.2015.00470 (2015).
217
Kempadoo, K. A. et al. Hypothalamic neurotensin projections promote reward by
enhancing glutamate transmission in the VTA. The Journal of neuroscience : the official
journal of the Society for Neuroscience 33, 7618-7626, doi:10.1523/jneurosci.258812.2013 (2013).
218
Maeno, H. et al. Comparison of mice deficient in the high- or low-affinity neurotensin
receptors, Ntsr1 or Ntsr2, reveals a novel function for Ntsr2 in thermal nociception. Brain
research 998, 122-129 (2004).
219
St-Gelais, F., Legault, M., Bourque, M. J., Rompre, P. P. & Trudeau, L. E. Role of
calcium in neurotensin-evoked enhancement in firing in mesencephalic dopamine
neurons. The Journal of neuroscience : the official journal of the Society for
Neuroscience 24, 2566-2574, doi:10.1523/jneurosci.5376-03.2004 (2004).
220
Legault, M., Congar, P., Michel, F. J. & Trudeau, L. E. Presynaptic action of neurotensin
on cultured ventral tegmental area dopaminergic neurones. Neuroscience 111, 177-187
(2002).
221
Werkman, T. R., Kruse, C. G., Nievelstein, H., Long, S. K. & Wadman, W. J.
Neurotensin attenuates the quinpirole-induced inhibition of the firing rate of dopamine
neurons in the rat substantia nigra pars compacta and the ventral tegmental area.
Neuroscience 95, 417-423 (2000).
50
222
Stuhrman, K. & Roseberry, A. G. Neurotensin inhibits both dopamine- and GABAmediated inhibition of ventral tegmental area dopamine neurons. Journal of
neurophysiology 114, 1734-1745, doi:10.1152/jn.00279.2015 (2015).
223
Thibault, D., Albert, P. R., Pineyro, G. & Trudeau, L. E. Neurotensin triggers dopamine
D2 receptor desensitization through a protein kinase C and beta-arrestin1-dependent
mechanism. The Journal of biological chemistry 286, 9174-9184,
doi:10.1074/jbc.M110.166454 (2011).
224
Bose, P., Rompre, P. P. & Warren, R. A. Neurotensin enhances glutamatergic EPSCs in
VTA neurons by acting on different neurotensin receptors. Peptides 73, 43-50,
doi:10.1016/j.peptides.2015.08.008 (2015).
225
Sotty, F. et al. Differential effects of neurotensin on dopamine release in the caudal and
rostral nucleus accumbens: a combined in vivo electrochemical and electrophysiological
study. Neuroscience 85, 1173-1182 (1998).
226
Kalivas, P. W., Nemeroff, C. B. & Prange, A. J., Jr. Increase in spontaneous motor
activity following infusion of neurotensin into the ventral tegmental area. Brain research
229, 525-529 (1981).
227
Kalivas, P. W. & Duffy, P. Effect of acute and daily neurotensin and enkephalin
treatments on extracellular dopamine in the nucleus accumbens. The Journal of
neuroscience : the official journal of the Society for Neuroscience 10, 2940-2949 (1990).
228
Steinberg, R. et al. SR 48692, a non-peptide neurotensin receptor antagonist
differentially affects neurotensin-induced behaviour and changes in dopaminergic
transmission. Neuroscience 59, 921-929 (1994).
229
Sotty, F. et al. Comparative effects of neurotensin, neurotensin(8-13) and [DTyr(11)]neurotensin applied into the ventral tegmental area on extracellular dopamine in
the rat prefrontal cortex and nucleus accumbens. Neuroscience 98, 485-492 (2000).
230
Laitinen, K., Crawley, J. N., Mefford, I. N. & De Witte, P. Neurotensin and
cholecystokinin microinjected into the ventral tegmental area modulate microdialysate
concentrations of dopamine and metabolites in the posterior nucleus accumbens. Brain
research 523, 342-346 (1990).
231
Steinberg, R. et al. Neurochemical and behavioural effects of neurotensin vs [DTyr11]neurotensin on mesolimbic dopaminergic function. Neuropeptides 28, 43-50
(1995).
232
Rivest, R., Jolicoeur, F. B. & Marsden, C. A. Use of amfonelic acid to discriminate
between classical and atypical neuroleptics and neurotensin: an in vivo voltammetric
study. Brain research 544, 86-93 (1991).
233
Glimcher, P. W., Giovino, A. A. & Hoebel, B. G. Neurotensin self-injection in the ventral
tegmental area. Brain research 403, 147-150 (1987).
51
234
Rompre, P. P. & Gratton, A. Mesencephalic microinjections of neurotensin-(1-13) and its
C-terminal fragment, neurotensin-(8-13), potentiate brain stimulation reward. Brain
research 616, 154-162 (1993).
235
Glimcher, P. W., Margolin, D. H., Giovino, A. A. & Hoebel, B. G. Neurotensin: a new
'reward peptide'. Brain research 291, 119-124 (1984).
236
Elliott, P. J. & Nemeroff, C. B. Repeated neurotensin administration in the ventral
tegmental area: effects on baseline and D-amphetamine-induced locomotor activity.
Neuroscience letters 68, 239-244 (1986).
237
Kalivas, P. W. & Taylor, S. Behavioral and neurochemical effect of daily injection with
neurotensin into the ventral tegmental area. Brain research 358, 70-76 (1985).
238
Opland, D. et al. Loss of neurotensin receptor-1 disrupts the control of the mesolimbic
dopamine system by leptin and promotes hedonic feeding and obesity. Molecular
metabolism 2, 423-434, doi:10.1016/j.molmet.2013.07.008 (2013).
239
Elde, R., Schalling, M., Ceccatelli, S., Nakanishi, S. & Hokfelt, T. Localization of
neuropeptide receptor mRNA in rat brain: initial observations using probes for
neurotensin and substance P receptors. Neuroscience letters 120, 134-138 (1990).
240
Nicot, A., Rostene, W. & Berod, A. Neurotensin receptor expression in the rat forebrain
and midbrain: a combined analysis by in situ hybridization and receptor autoradiography.
The Journal of comparative neurology 341, 407-419, doi:10.1002/cne.903410310
(1994).
241
Hokfelt, T., Everitt, B. J., Theodorsson-Norheim, E. & Goldstein, M. Occurrence of
neurotensinlike immunoreactivity in subpopulations of hypothalamic, mesencephalic,
and medullary catecholamine neurons. The Journal of comparative neurology 222, 543559, doi:10.1002/cne.902220407 (1984).
242
Szigethy, E. & Beaudet, A. Correspondence between high affinity 125I-neurotensin
binding sites and dopaminergic neurons in the rat substantia nigra and ventral tegmental
area: a combined radioautographic and immunohistochemical light microscopic study.
The Journal of comparative neurology 279, 128-137, doi:10.1002/cne.902790111
(1989).
243
Woulfe, J. & Beaudet, A. Immunocytochemical evidence for direct connections between
neurotensin-containing axons and dopaminergic neurons in the rat ventral midbrain
tegmentum. Brain research 479, 402-406 (1989).
244
Beaudet, A. & Woulfe, J. Morphological substrate for neurotensin-dopamine interactions
in the rat midbrain tegmentum. Annals of the New York Academy of Sciences 668, 173185 (1992).
245
Seroogy, K. et al. A subpopulation of dopaminergic neurons in rat ventral
mesencephalon contains both neurotensin and cholecystokinin. Brain research 455, 8898 (1988).
52
246
Studler, J. M. et al. Extensive co-localization of neurotensin with dopamine in rat mesocortico-frontal dopaminergic neurons. Neuropeptides 11, 95-100 (1988).
247
Smits, S. M., Terwisscha van Scheltinga, A. F., van der Linden, A. J., Burbach, J. P. &
Smidt, M. P. Species differences in brain pre-pro-neurotensin/neuromedin N mRNA
distribution: the expression pattern in mice resembles more closely that of primates than
rats. Brain research. Molecular brain research 125, 22-28,
doi:10.1016/j.molbrainres.2004.03.001 (2004).
248
Berger, B., Gaspar, P. & Verney, C. Colocalization of neurotensin in the mesocortical
dopaminergic system. Restricted regional and laminar distribution in rat, lack of
colocalization in human. Annals of the New York Academy of Sciences 668, 307-310
(1992).
249
Zahm, D. S., Grosu, S., Williams, E. A., Qin, S. & Berod, A. Neurons of origin of the
neurotensinergic plexus enmeshing the ventral tegmental area in rat: retrograde labeling
and in situ hybridization combined. Neuroscience 104, 841-851 (2001).
250
Geisler, S. & Zahm, D. S. On the retention of neurotensin in the ventral tegmental area
(VTA) despite destruction of the main neurotensinergic afferents of the VTA--implications
for the organization of forebrain projections to the VTA. Brain research 1087, 87-104,
doi:10.1016/j.brainres.2006.02.108 (2006).
251
Luttinger, D. et al. The effect of neurotensin on food consumption in the rat. European
journal of pharmacology 81, 499-503 (1982).
252
Cooke, J. H. et al. Peripheral and central administration of xenin and neurotensin
suppress food intake in rodents. Obesity (Silver Spring, Md.) 17, 1135-1143,
doi:10.1038/oby.2008.652 (2009).
253
Kim, E. R., Leckstrom, A. & Mizuno, T. M. Impaired anorectic effect of leptin in
neurotensin receptor 1-deficient mice. Behavioural brain research 194, 66-71,
doi:10.1016/j.bbr.2008.06.024 (2008).
254
Levine, A. S., Kneip, J., Grace, M. & Morley, J. E. Effect of centrally administered
neurotensin on multiple feeding paradigms. Pharmacology, biochemistry, and behavior
18, 19-23 (1983).
255
Bailey, C. J. & Flatt, P. R. Anorectic effect of fenfluramine, cholecystokinin and
neurotensin in genetically obese (ob/ob) mice. Comparative biochemistry and
physiology. A, Comparative physiology 84, 451-454 (1986).
256
Sandoval, S. L. & Kulkosky, P. J. Effects of peripheral neurotensin on behavior of the rat.
Pharmacology, biochemistry, and behavior 41, 385-390 (1992).
257
Kelley, A. E., Cador, M., Stinus, L. & Le Moal, M. Neurotensin, substance P, neurokininalpha, and enkephalin: injection into ventral tegmental area in the rat produces
differential effects on operant responding. Psychopharmacology 97, 243-252 (1989).
258
Stanley, B. G., Hoebel, B. G. & Leibowitz, S. F. Neurotensin: effects of hypothalamic and
intravenous injections on eating and drinking in rats. Peptides 4, 493-500 (1983).
53
259
Richy, S., Burlet, A., Max, J., Burlet, C. & Beck, B. Effect of chronic intraperitoneal
injections of leptin on hypothalamic neurotensin content and food intake. Brain Res 862,
276-279 (2000).
260
Sahu, A. Evidence suggesting that galanin (GAL), melanin-concentrating hormone
(MCH), neurotensin (NT), proopiomelanocortin (POMC) and neuropeptide Y (NPY) are
targets of leptin signaling in the hypothalamus. Endocrinology 139, 795-798,
doi:10.1210/endo.139.2.5909 (1998).
261
Sahu, A., Carraway, R. E. & Wang, Y. P. Evidence that neurotensin mediates the central
effect of leptin on food intake in rat. Brain research 888, 343-347 (2001).
262
Blum, K., Thanos, P. K. & Gold, M. S. Dopamine and glucose, obesity, and reward
deficiency syndrome. Frontiers in psychology 5, 919, doi:10.3389/fpsyg.2014.00919
(2014).
263
Dawe, S. & Loxton, N. J. The role of impulsivity in the development of substance use
and eating disorders. Neuroscience and biobehavioral reviews 28, 343-351,
doi:10.1016/j.neubiorev.2004.03.007 (2004).
264
Stice, E., Yokum, S., Burger, K. S., Epstein, L. H. & Small, D. M. Youth at risk for obesity
show greater activation of striatal and somatosensory regions to food. The Journal of
neuroscience : the official journal of the Society for Neuroscience 31, 4360-4366,
doi:10.1523/jneurosci.6604-10.2011 (2011).
265
Wang, G. J. et al. Brain dopamine and obesity. Lancet 357, 354-357 (2001).
266
Volkow, N. D. et al. Low dopamine striatal D2 receptors are associated with prefrontal
metabolism in obese subjects: possible contributing factors. NeuroImage 42, 1537-1543,
doi:10.1016/j.neuroimage.2008.06.002 (2008).
267
de Weijer, B. A. et al. Lower striatal dopamine D2/3 receptor availability in obese
compared with non-obese subjects. EJNMMI research 1, 37, doi:10.1186/2191-219x-137 (2011).
268
Kessler, R. M., Zald, D. H., Ansari, M. S., Li, R. & Cowan, R. L. Changes in dopamine
release and dopamine D2/3 receptor levels with the development of mild obesity.
Synapse (New York, N.Y.) 68, 317-320, doi:10.1002/syn.21738 (2014).
269
Barnard, N. D. et al. D2 dopamine receptor Taq1A polymorphism, body weight, and
dietary intake in type 2 diabetes. Nutrition (Burbank, Los Angeles County, Calif.) 25, 5865, doi:10.1016/j.nut.2008.07.012 (2009).
270
Carpenter, C. L., Wong, A. M., Li, Z., Noble, E. P. & Heber, D. Association of dopamine
D2 receptor and leptin receptor genes with clinically severe obesity. Obesity (Silver
Spring, Md.) 21, E467-473, doi:10.1002/oby.20202 (2013).
271
Stice, E., Spoor, S., Bohon, C. & Small, D. M. Relation between obesity and blunted
striatal response to food is moderated by TaqIA A1 allele. Science (New York, N.Y.) 322,
449-452, doi:10.1126/science.1161550 (2008).
54
272
Thompson, J. et al. D2 dopamine receptor gene (DRD2) Taq1 A polymorphism: reduced
dopamine D2 receptor binding in the human striatum associated with the A1 allele.
Pharmacogenetics 7, 479-484 (1997).
273
Stice, E., Yokum, S., Bohon, C., Marti, N. & Smolen, A. Reward circuitry responsivity to
food predicts future increases in body mass: moderating effects of DRD2 and DRD4.
NeuroImage 50, 1618-1625, doi:10.1016/j.neuroimage.2010.01.081 (2010).
274
Carlin, J., Hill-Smith, T. E., Lucki, I. & Reyes, T. M. Reversal of dopamine system
dysfunction in response to high-fat diet. Obesity (Silver Spring, Md.) 21, 2513-2521,
doi:10.1002/oby.20374 (2013).
275
Vucetic, Z., Carlin, J. L., Totoki, K. & Reyes, T. M. Epigenetic dysregulation of the
dopamine system in diet-induced obesity. Journal of neurochemistry 120, 891-898,
doi:10.1111/j.1471-4159.2012.07649.x (2012).
276
Davis, J. F. et al. Exposure to elevated levels of dietary fat attenuates psychostimulant
reward and mesolimbic dopamine turnover in the rat. Behavioral neuroscience 122,
1257-1263, doi:10.1037/a0013111 (2008).
277
Geiger, B. M. et al. Deficits of mesolimbic dopamine neurotransmission in rat dietary
obesity. Neuroscience 159, 1193-1199, doi:10.1016/j.neuroscience.2009.02.007 (2009).
278
Johnson, P. M. & Kenny, P. J. Dopamine D2 receptors in addiction-like reward
dysfunction and compulsive eating in obese rats. Nature neuroscience 13, 635-641,
doi:10.1038/nn.2519 (2010).
279
Caravaggio, F. et al. Ventral striatum binding of a dopamine D2/3 receptor agonist but
not antagonist predicts normal body mass index. Biological psychiatry 77, 196-202,
doi:10.1016/j.biopsych.2013.02.017 (2015).
280
Karlsson, H. K. et al. Obesity is associated with decreased mu-opioid but unaltered
dopamine D2 receptor availability in the brain. The Journal of neuroscience : the official
journal of the Society for Neuroscience 35, 3959-3965, doi:10.1523/jneurosci.474414.2015 (2015).
281
Tuominen, L. et al. Aberrant mesolimbic dopamine-opiate interaction in obesity.
NeuroImage 122, 80-86, doi:10.1016/j.neuroimage.2015.08.001 (2015).
282
Eisenstein, S. A. et al. A comparison of D2 receptor specific binding in obese and
normal-weight individuals using PET with (N-[(11)C]methyl)benperidol. Synapse (New
York, N.Y.) 67, 748-756, doi:10.1002/syn.21680 (2013).
283
Kravitz, A. V., O'Neal, T. J. & Friend, D. M. Do Dopaminergic Impairments Underlie
Physical Inactivity in People with Obesity? Frontiers in human neuroscience 10, 514,
doi:10.3389/fnhum.2016.00514 (2016).
284
Friend, D. M. et al. Basal Ganglia Dysfunction Contributes to Physical Inactivity in
Obesity. Cell metabolism 25, 312-321, doi:10.1016/j.cmet.2016.12.001 (2017).
55
285
Beeler, J. A., Faust, R. P., Turkson, S., Ye, H. & Zhuang, X. Low Dopamine D2 Receptor
Increases Vulnerability to Obesity Via Reduced Physical Activity, Not Increased
Appetitive Motivation. Biological psychiatry 79, 887-897,
doi:10.1016/j.biopsych.2015.07.009 (2016).
286
Stice, E., Spoor, S., Bohon, C., Veldhuizen, M. G. & Small, D. M. Relation of reward
from food intake and anticipated food intake to obesity: a functional magnetic resonance
imaging study. Journal of abnormal psychology 117, 924-935, doi:10.1037/a0013600
(2008).
287
Drewnowski, A., Brunzell, J. D., Sande, K., Iverius, P. H. & Greenwood, M. R. Sweet
tooth reconsidered: taste responsiveness in human obesity. Physiology & behavior 35,
617-622 (1985).
288
Rissanen, A. et al. Acquired preference especially for dietary fat and obesity: a study of
weight-discordant monozygotic twin pairs. International journal of obesity and related
metabolic disorders : journal of the International Association for the Study of Obesity 26,
973-977, doi:10.1038/sj.ijo.0802014 (2002).
289
Rothemund, Y. et al. Differential activation of the dorsal striatum by high-calorie visual
food stimuli in obese individuals. NeuroImage 37, 410-421,
doi:10.1016/j.neuroimage.2007.05.008 (2007).
290
Stoeckel, L. E. et al. Widespread reward-system activation in obese women in response
to pictures of high-calorie foods. NeuroImage 41, 636-647,
doi:10.1016/j.neuroimage.2008.02.031 (2008).
291
Berridge, K. C., Ho, C. Y., Richard, J. M. & DiFeliceantonio, A. G. The tempted brain
eats: pleasure and desire circuits in obesity and eating disorders. Brain research 1350,
43-64, doi:10.1016/j.brainres.2010.04.003 (2010).
292
Volkow, N. D. et al. Decreased dopamine D2 receptor availability is associated with
reduced frontal metabolism in cocaine abusers. Synapse (New York, N.Y.) 14, 169-177,
doi:10.1002/syn.890140210 (1993).
293
Volkow, N. D. et al. Low level of brain dopamine D2 receptors in methamphetamine
abusers: association with metabolism in the orbitofrontal cortex. The American journal of
psychiatry 158, 2015-2021, doi:10.1176/appi.ajp.158.12.2015 (2001).
294
Wang, G. J. et al. Dopamine D2 receptor availability in opiate-dependent subjects before
and after naloxone-precipitated withdrawal. Neuropsychopharmacology : official
publication of the American College of Neuropsychopharmacology 16, 174-182,
doi:10.1016/s0893-133x(96)00184-4 (1997).
295
Blum, K. et al. Increased prevalence of the Taq I A1 allele of the dopamine receptor
gene (DRD2) in obesity with comorbid substance use disorder: a preliminary report.
Pharmacogenetics 6, 297-305 (1996).
296
Stice, E., Figlewicz, D. P., Gosnell, B. A., Levine, A. S. & Pratt, W. E. The contribution of
brain reward circuits to the obesity epidemic. Neuroscience and biobehavioral reviews
37, 2047-2058, doi:10.1016/j.neubiorev.2012.12.001 (2013).
56
297
Colantuoni, C. et al. Evidence that intermittent, excessive sugar intake causes
endogenous opioid dependence. Obesity research 10, 478-488,
doi:10.1038/oby.2002.66 (2002).
298
Avena, N. M., Rada, P. & Hoebel, B. G. Evidence for sugar addiction: behavioral and
neurochemical effects of intermittent, excessive sugar intake. Neuroscience and
biobehavioral reviews 32, 20-39, doi:10.1016/j.neubiorev.2007.04.019 (2008).
299
Feifel, D. et al. The reversal of amphetamine-induced locomotor activation by a selective
neurotensin-1 receptor agonist does not exhibit tolerance. Psychopharmacology 200,
197-203, doi:10.1007/s00213-008-1197-5 (2008).
300
Beck, B., Nicolas, J. P. & Burlet, C. Neurotensin decreases with fasting in the
ventromedian nucleus of obese Zucker rats. Metabolism: clinical and experimental 44,
972-975 (1995).
301
Beck, B., Burlet, A., Nicolas, J. P. & Burlet, C. Hyperphagia in obesity is associated with
a central peptidergic dysregulation in rats. The Journal of nutrition 120, 806-811 (1990).
302
Wilding, J. P. et al. Increased neuropeptide-Y messenger ribonucleic acid (mRNA) and
decreased neurotensin mRNA in the hypothalamus of the obese (ob/ob) mouse.
Endocrinology 132, 1939-1944, doi:10.1210/endo.132.5.7682936 (1993).
303
Williams, G. et al. Reduced hypothalamic neurotensin concentrations in the genetically
obese diabetic (ob/ob) mouse: possible relationship to obesity. Metabolism: clinical and
experimental 40, 1112-1116 (1991).
304
Boules, M. et al. The neurotensin receptor agonist NT69L suppresses sucrosereinforced operant behavior in the rat. Brain research 1127, 90-98,
doi:10.1016/j.brainres.2006.10.025 (2007).
305
Li, J. et al. An obligatory role for neurotensin in high-fat-diet-induced obesity. Nature 533,
411-415, doi:10.1038/nature17662 (2016).
306
Thomas, J. B. et al. Identification of 2-({[1-(4-Fluorophenyl)-5-(2-methoxyphenyl)-1Hpyrazol-3-yl]carbonyl}amino)tricyc lo[3.3.1.13,7]decane-2-carboxylic Acid (NTRC-844) as
a Selective Antagonist for the Rat Neurotensin Receptor Type 2. ACS chemical
neuroscience 7, 1225-1231, doi:10.1021/acschemneuro.6b00097 (2016).
57
Chapter 2. Determination of Neurotensin Projections to the
Ventral Tegmental Area in Mice
Authors: Hillary L. Woodworth, Juliette A. Brown, Hannah M. Batchelor, Raluca Bugescu, and
Gina M. Leinninger
This chapter is a modified version of a manuscript under review.
2.1 Abstract
Pharmacologic treatment with the neuropeptide neurotensin (Nts) modifies motivated behaviors
such as feeding, locomotor activity, and reproduction. Dopamine (DA) neurons of the ventral
tegmental area (VTA) control these behaviors, and Nts directly modulates the activity of DA
neurons via Nts receptor-1. However, the endogenous sources of Nts to the VTA remain
incompletely understood, impeding determination of which Nts circuits orchestrate specific
behaviors. To overcome this obstacle we injected the retrograde tracer fluorogold into the VTA
of mice that express GFP in Nts neurons. Identification of GFP-Nts cells that accumulate
fluorogold revealed the Nts afferents to the VTA in mice. Similar to rats, most Nts afferents to
the VTA of mice arise from the medial and lateral preoptic areas (POA) and the lateral
hypothalamic area (LHA), brain regions that are critical for coordination of feeding and
reproduction. Additionally, the VTA receives dense input from Nts neurons in the nucleus
accumbens shell (NAsh) of mice, and minor Nts projections from the amygdala and
periaqueductal gray area. Collectively, our data reveal multiple populations of Nts neurons that
provide direct afferents to the VTA and which may regulate specific aspects of motivated
behavior. This work lays the foundation for understanding endogenous Nts actions in the VTA,
58
and how circuit-specific Nts modulation may be useful to correct motivational and affective
deficits in neuropsychiatric disease.
2.2 Introduction
Neurotensin (Nts) is a 13 amino-acid neuropeptide that was first extracted from the
bovine hypothalamus by Carraway and Leeman. Nts has subsequently been identified
throughout the brain1-4 and has been implicated in regulating a diverse repertoire of physiology
and motivated behaviors including feeding, locomotor activity, social behavior, sleep, and
response to addictive drugs5-10. Nts may direct certain behaviors via actions in the ventral
tegmental area (VTA), based on findings that different types of VTA neurons orchestrate distinct
goal-directed behaviors11-13. The VTA is predominantly comprised of dopamine (DA) neurons
that project to and release DA in the nucleus accumbens (NA), prefrontal cortex (PFC),
hippocampus, or amygdala to modify goal-directed behaviors (see14,15 for review). The VTA
also contains GABA-ergic neurons including those within the newly defined “tail” of the VTA or
rostromedial tegmental nucleus (RMTg) that locally inhibit VTA DA neurons, thus serving as
negative regulators of DA-mediated behaviors12,16-18. Given that alterations in both VTA DA and
Nts signaling have been implicated in the pathogenesis of drug addiction, depression, anxiety,
schizophrenia, autism, and obesity6,8,19-28, there is likely some functional overlap of the DA and
Nts signaling systems. It is therefore critical to define the precise neural mechanisms by which
Nts engages the VTA to understand how it regulates diverse motivated behaviors, and how they
become maladaptive in disease.
Numerous lines of evidence support a role for Nts acting directly within the VTA to
modify behavior. Nts signals via the G-protein coupled receptors, Nts receptor 1 and 2 (NtsR1
and NtsR2), both of which are expressed within the VTA of rodents and humans29-38, including
on some VTA DA neurons31,38-41. Pharmacologic administration of Nts or Nts analogs into the
59
VTA activates DA neurons37,42-46 and increases DA release in the NA43,44,47,48. Mechanistically,
Nts may promote DA signalling via direct stimulation of NtsRs on DA neurons, by enhancing
excitatory input to VTA DA neurons and/or by decreasing D2 receptor-mediated
autoinhibition42,46,49-51, all of which can lead to DA release that modifies behavior. Indeed, Nts
within the VTA suppresses homeostatic and motivated feeding52,53 and increases locomotor
activity47,48,52,54-58, identifying dual VTA-mediated behaviors by which Nts modifies energy
balance. Pharmacologic Nts in the VTA also supports self-administration50,59,60, conditioned
place preference (CPP) 61,62 and locomotor sensitization similar to addictive drugs47,56,63,64,
suggesting that Nts may be rewarding. Furthermore, blockade of Nts receptor signalling
disrupts or delays sensitization to amphetamine, cocaine, and morphine58,65-67. Intriguingly,
many of these behavioral effects are specific to the VTA because Nts administration outside of
the VTA elicits different effects. For example, while Nts injection in the VTA increases
locomotor activity and DA release, intra-NA or central Nts decreases locomotor activity and
does not alter DA release48,68-72. Similarly, intra-VTA Nts does not alter acute locomotor
response to psychostimulants56, whereas ICV or intra-NA Nts reduces psychostimulant-induced
hyperactivity73-76. One notable exception to this is Nts-mediated suppression of feeding
behavior, as both central and direct administration of Nts in the VTA suppress feeding in both
fasted and satiated animals52,77,78. Taken together, these data indicate that Nts can act directly
in the VTA to regulate motivated locomotor and reward behaviors.
Although it is clear that exogenous Nts impacts the mesolimbic DA system, the
endogenous sources of Nts input to the VTA remain incompletely understood. Abundant Ntsimmunoreactive terminals are found within the VTA38,40,79,80, including in close apposition to
39
VTA DA neurons , indicating that some Nts is released to the VTA. Nts afferents to the VTA
were examined in rats by injecting the retrograde tracer fluorogold (FG) into the VTA and using
60
in situ hybridization (ISH) to label Nts cell bodies, demonstrating that most Nts-ergic inputs to
the VTA originate from the preoptic area (POA) and rostral lateral hypothalamic area (LHA)81.
Yet, lesioning the POA and LHA in rats does not substantially reduce Nts terminals in the VTA,
82
suggesting there may be other important sources of endogenous input . Indeed, injection of
the wheat germ agglutinin transynaptic tracer into the VTA of rats confirmed afferents from the
POA and LHA, and identified putative afferents from the NA shell, dorsal raphe (DR), ventral
endopiriform area, lateral septum (LS), pedunculopontine tegmental nucleus (PPTg), and
83
laterodorsal tegmental nucleus (LDTg) . Wheat germ agglutinin can move both retrogradely
and anterogradely, however, so some of these sites may be targets of VTA neurons rather than
providing afferents84,85. Further studies were limited by the inability to easily identify Ntsexpressing cells, but the recent development of NtsCre mice enables the facile detection and
manipulation of Nts neurons using cre-lox technology. Using these mice we have identified a
large population of Nts neurons in the LHA that project to the VTA, consistent with the prior
afferent mapping done in rats, and manipulation of these LHA Nts neurons reveals their crucial
contributions to motivated behavior and energy balance39,86-88. The LHA may be just one of
several sites by which Nts orchestrates distinct behavioral responses in the VTA, thus it will be
important to define all Nts afferents to the VTA and test their roles individually. Since mice and
rats differ in Nts expression89, they may also differ in the distribution of Nts afferents to the VTA,
thus it is crucial to characterize these in mice. We therefore defined the Nts neurons that
project to the VTA in mice by injecting the retrograde tracer FG into the VTA of NtsCre;GFP
reporter mice, permitting robust, simultaneous detection of Nts neurons and VTA afferents.
2.3 Results
The VTA Contains a Small Population of Non-Dopaminergic Nts Neurons: Nts neurons
have been previously difficult to identify because immunohistochemical reagents label fibers,
61
but are insufficient to label cell bodies unless animals are pre-treated with the axonal transport
inhibitor, colchicine88. To overcome this, we bred mice expressing Cre-recombinase in Nts
neurons88 to a Cre-inducible L10-eGFP reporter90, producing progeny that express GFP
selectively in Nts neurons (we refer to these as NtsCre;GFP mice). To understand whether the
VTA itself could serve as a local source of Nts input, we first examined the VTA of NtsCre;GFP
mice for GFP expression. We observed a small population of Nts neurons within the
boundaries of the VTA (372 ± 44 total neurons), which were predominantly localized in the
caudolateral region (Fig. 2). Interestingly, 97% of Nts neurons within the VTA did not colocalize
with TH, indicating that most VTA Nts neurons are not DA-ergic. Since VTA neurons that
express GABA or glutamate can project to VTA DA neurons91,92, these data support the
possibility that VTA Nts neurons could locally regulate neighboring VTA neurons. Given the
relatively small number of VTA Nts neurons, but the substantial behavioral modifications
induced by pharmacological Nts administration to the VTA, we hypothesized that other Nts
populations may provide more substantial Nts input to the VTA.
Characterization of Nts Neurons that Project to the VTA: To identify all Nts neurons that
project to the VTA, we stereotaxically injected NtsCre;GFP mice with the retrograde tracer FG,
which labels VTA afferents throughout the brain. Any cell body found to contain both FG
(magenta) and GFP (green) represents a Nts neuron that projects to the VTA (gray) (Fig. 3A).
We verified VTA targeting by mapping the locations of the midbrain injection tracts and by
carefully assessing FG labeling within brain regions known to preferentially project to the VTA
vs. the SN, based on the previous work of Watabe-Uchida et al93. For example, at the level of
the hypothalamus, VTA afferents are found in the LHA and zona incerta (ZI), but not in the
neighboring dorsal striatum (DS), while SN afferents reside preferentially in the DS. Similarly,
the NA heavily innervates the VTA, while the DS preferentially innervates the SN93 (Fig. 3B).
Out of 10 animals injected with FG, 5 had injection sites within the VTA and had many FG62
labeled neurons in the LHA, ZI, and NA, but not the DS (Fig. 3C-E); these 5 mice were
subsequently analyzed to define Nts afferents to the VTA. Although the injection tracts of cases
F19 and F29 appeared on the lateral border of the VTA, these mice were included for analysis
because their FG expression was consistent with VTA rather than SN targeting (e.g. robust in
the LHA, ZI and NA, with minimal FG+ neurons in the DS). While our analysis revealed
substantial numbers of GFP-labeled Nts neurons and FG-labeled neurons throughout the brain,
we will describe only the select brain regions containing colocalized neurons, henceforth
referred to as Nts/FG+ neurons.
Striatum and Septum: We observed many Nts/FG+ neurons in the NA shell (NAsh)
between +1.75 and 0.85 bregma, but few Nts/FG+ in the NA core (Fig. 4A and Fig. 10). We
investigated whether these Nts/FG+ neurons localized to a specific NAsh subregion that might
suggest their function, given that site-specific cells along the rostrocaudal NAsh mediate
behaviors with either positive or negative valence94. The Nts/FG+ neurons, however, were
found within a continuous band across the rostrocaudal axis of the NAsh, with no clear
localization to rostral or caudal regions. While Geisler and Zahm reported a minor NAsh Nts
input to the VTA in rats83, our quantitative analysis in mice identifies the NAsh as one of the
most significant contributors of Nts input to the VTA (Fig. 10). GFP-labeled neurons were also
abundant in the olfactory tubercle (OFT), a structure considered to be ventral extension of the
NA with similar roles in DA-mediated motivated behaviors95. However, the OFT does not
provide significant VTA afferents in mice93,96 and accordingly, we detected few FG-labeled
neurons in the OFT (Fig. 4B), suggesting that OFT Nts neurons project to and act at sites other
than the VTA.
Compared to the ventral striatum, the dorsal striatum contained relatively few Nts
neurons, which clustered around the lateral and medial borders of the caudate/putamen (CPu)
63
(Fig. 4C, D). The CPu preferentially projects to the SN with minimal afferents to the VTA93,96;
similarly, we observed some FG+ neurons in the ventral CPu between +1.94 and 0.62 bregma,
but the vast majority did not colocalize with GFP (Fig. 4C). Nts neurons in lateral septum (LS)
project to the VTA in rats83, but we observed ≤1 Nts/FG+ neuron per coronal section in the LS of
mice. While Nts neurons were abundant in the LS, there were few FG+ neurons (Fig. 4D),
consistent with previous work that the LS does not send substantial projections to the VTA in
mice93,96.
Cortex and Amygdala: The neocortex contained relatively few GFP-labeled Nts neurons
with the exception of a prominent band of Nts neurons in the prefrontal cortex (PFC). The PFC
is the predominant source of cortical input to the VTA, while the lateral orbital cortex (LO) also
provides afferents specifically to VTA DA neurons93. We noted distinct populations of FGlabeled or Nts neurons in separate layers of the PFC and the LO, but no Nts/FG+ neurons (Fig.
5A, B). Thus, neither the PFC nor the associated neocortex are significant sources of Nts input
to the VTA, indicating that they mediate control of the VTA via other, non-Nts signals.
Examination of the amygdala revealed FG-labeled neurons in the central amygdala
(CeA) and extended amygdala (EA) with relatively few in the basolateral amygdala (BLA),
consistent with previous reports93,96,97. Similar to findings from rats, we detected a concentrated
area of Nts neurons in the CeA of mice, which were more numerous in the lateral division in
caudal sections (Fig. 5C). Some CeA Nts neurons project to the VTA, and were predominantly
found between -1.30 and -0.80 bregma (Fig. 5D). A smaller population of Nts/FG+ neurons was
observed in the EA. Together these data indicate that the amygdala provides modest Nts input
to the VTA in mice (Fig. 10).
64
IPAC, Pallidum and Stria Terminalis: The interstitial nucleus of the posterior limb of the
anterior commissure (IPAC) is closely related to both the ventral striatum and the amygdala98,99
and also provides afferents to the VTA93,96. We noted a few Nts/FG+ neurons in the lateral
IPAC (Fig. 6A), which appeared to represent a caudal extension of the Nts/FG+ neurons
described in the NAsh. By contrast, Nts expression was consistently scarce in the ventral
pallidum (VP) and globus pallidus (GP) (Fig. 6A, B), coinciding with previous work showing low
levels of Nts in these structures3,100. A few Nts/FG+ neurons were found in the VP, especially
near the border with the LPO (Fig. 10). In rats, the stria terminalis (ST) provides Nts afferents to
the VTA83, and similarly we identified a few Nts/FG+ neurons in the ST of mice. Together, the
ST, VP, and IPAC provided relatively minor Nts inputs to the VTA (Fig. 10).
Hypothalamus: Compared to other brain regions, the hypothalamus was the largest
contributor of Nts neurons that project to the VTA, with most Nts/FG+ neurons located in the
preoptic area (POA), LHA, or zona incerta (ZI). The LHA is a key site for integration of
peripheral energy cues with motivated behaviors (see 5 for review) and contained a robust
population of Nts neurons between -1.30 to -1.70 bregma. Many of these LHA Nts neurons
were labeled with FG from the VTA (Fig. 7B), consistent with other reports that LHA Nts
neurons directly project to the VTA39,87,101, and supporting a mechanism by which LHA Nts
neurons can coordinate VTA-mediated behaviors such as feeding. Compared to the LHA, other
hypothalamic sub-regions contained sparser populations of Nts neurons, including the
dorsomedial hypothalamus (DMH), ventromedial hypothalamus (VMH), arcuate nucleus (ARC),
and paraventricular hypothalamus (PVH) (Fig. 7B-D). Similar to rats83, we identified a few
Nts/FG+ neurons in the ARC and PVH of mice, though the number of ARC and PVH Nts
afferents to the VTA are minor compared to the robust number of Nts afferents from the LHA
(Fig. 10). The ZI runs along the dorsal border of the LHA but appears to be functionally unique
from the LHA and neighboring thalamic areas102. Interestingly, while there are minimal Nts
65
neurons in the ZI, many of them are Nts/FG+ (Fig. 7A, top panel), such that the ZI and LHA
contain comparable numbers of Nts neurons projecting to the VTA (Fig. 10). Our examination
also revealed a dense population of Nts neurons in the neighboring subthalamic nucleus (STN)
(Fig. 7A, bottom panel), but we did not observe FG+ neurons in the STN, which is more likely to
provide afferent input to the SN than the VTA93. Indeed, the absence of FG labeling in the STN
further verified that FG injections were confined to the VTA in the mice analyzed for this study.
Along with the LHA and ZI, the POA provided a large number of Nts afferents to the
VTA, whose distribution varied along the rostro-caudal axis. In the caudal POA, the Nts
population was most dense in the medial preoptic area (MPO) adjacent to the third ventricle.
Many Nts/FG+ neurons were found in the MPO (Fig. 7E) and these VTA-projecting neurons
formed a dense cluster centered between -0.22 and +0.02 bregma. Our finding of POA Nts
afferents to the VTA in mice is consistent with the recent description of MPO Nts neurons that
regulate social reward via the VTA103. Collectively, this data and our work characterizing LHA
Nts neurons that project to the VTA39,87,88 provides support for the idea that region-specific Nts
input to the VTA controls distinct motivated behaviors (e.g. POA Nts modifies social interaction
while LHA Nts modifies energy balance). In the rostral POA the Nts population was sparse in
the MPO but dense within the lateral preoptic area (LPO), where we observed many Nts/FG+
neurons (Fig. 7F) spanning between -0.10 and +0.40 bregma. One potential role for these LPO
Nts neurons may be initiation of locomotor activity, as LPO-mediated locomotor activity is
blunted by microinjection of Nts receptor antagonists in the VTA104.
Midbrain and Hindbrain: Brainstem nuclei provide direct sensory afferents to the VTA,
thus our identification of Nts/FG+ neurons throughout the midbrain and hindbrain suggests roles
for Nts in conveying sensory information to the VTA. First, examination of the dorsal midbrain
revealed Nts/FG+ neurons in the superior colliculus (SC) and anterior prectectal nucleus (APT)
66
(Fig. 8A, B), midbrain regions involved in visual and somatosensory processing,
respectively105,106. Dense populations of GFP-labeled Nts neurons were noted in the
parabrachial nucleus (PBN) and the DR, but few of these contained FG, and thus provided
minimal projections to the VTA (Fig. 8F, G). The lateral PBN contained segregated groups of
either GFP or FG-labeled neurons with the GFP-labeled neurons clustered more laterally, and
most co-labeled neurons were found in the middle where the two populations overlap (Fig. 8G).
Nts neurons in the DR were most abundant in caudal sections between -4.8 to -5.0 bregma,
which also gave rise to the highest numbers of colocalized neurons per section. VTA afferents
arising from the pedunculopontine nucleus (PPTg) and laterodorsal tegmentum (LDTg) are
associated with reward behaviors11,107 and we detected small numbers of Nts/FG+ neurons in
these regions (Fig. 8D,H). The periaqueductal grey (PAG) contained the highest number of
brainstem Nts afferents to the VTA, which were evenly distributed throughout its rostrocaudal
extent. Thus while only 4-6 Nts/FG+ neurons were present in each coronal section of the PAG,
the cumulative neurons observed across the large rostrocaudal span of the PAG (approximately
2.5 mm) amounted to an appreciable number of Nts afferents from this structure.
Habenula and RMTg: Both the lateral habenula (LHb) and RMTg provide afferent input
to the VTA that inhibits DA neurons and mediates aversive behaviors11,108. Although most
literature strongly suggests that Nts action in the VTA supports reward rather than
aversion50,61,62, we examined the LHb and RMTg to assess whether Nts is co-expressed in
aversive inputs to the VTA. Analysis of the LHb revealed many FG+ neurons, but sparse GFPNts neurons, and few LHb neurons contained both labels (Fig. 9A). When quantified, we found
the LHb Nts neurons provided minimal afferents to the VTA, similar to the modest input from the
DMH, VMH and AHA (Fig. 10).
67
The anatomic boundaries of the RMTg in mouse were recently mapped onto the Allen
Brain Atlas109, and we used these to locate the RMTg in our experiments. In the caudal RMTg,
FG+ neurons occasionally colocalized with GFP, but the majority were GFP-negative (Fig. 9B),
suggesting that Nts neurons only occasionally provide aversive input to the VTA. Assessment
of rostral RMTg Nts afferents was hindered by its close proximity to the FG injection site, and
due to the mechanical tissue damage in this region we could not determine whether RMTg Nts
neurons also contained FG. Examination of the rostral RMTg in uninjected NtsCre;GFP reporter
mice, however, revealed an average of 3-4 TH-negative Nts neurons per coronal section (Fig.
9C, D). Thus although we cannot determine whether these RMTg Nts neurons project locally,
their modest number suggests that Nts is unlikely to mediate aversion via input to the VTA.
2.4 Discussion
Here, we characterized the endogenous sources of Nts that can directly regulate the
VTA in mouse. Our findings reveal that the largest source of Nts input to the VTA comes from
the hypothalamus, predominantly from the LPO, MPO, and LHA. The NAsh also provides
significant Nts afferents to the VTA, while the amygdala, ST, VP, and sub-regions of the
hindbrain provide more modest Nts input. To our knowledge, this is the first comprehensive
definition of mouse Nts afferents to the VTA, and is a first step toward understanding how Nts
coordinates a diverse repertoire of behaviors. Indeed, since Nts afferents from the MPO and
LHA modify DA-mediated social interaction and energy balance, respectively, it is possible that
each Nts circuit orchestrates a specific motivated behavior via the VTA. Going forward it will be
important to determine the unique roles of each Nts projection, and hence precise mechanisms
to influence feeding, locomotor activity, social behavior, sleep, and response to addictive drugs.
While the VTA receives input from many brain structures93,96,110,111, the Nts afferents
were confined to a limited number of regions. For example, the DR, VP, and PBN provide major
68
input to the VTA 96,112, and we also observed many FG-labeled neurons in these regions but
very few were Nts-specific VTA afferents. By contrast, the highest number of Nts-labeled VTA
afferents came from the POA (the LPO and MPO, specifically), yet the POA only provides ~2%
of all VTA input in mouse96. Overall, our data support Geisler and Zahm’s hypothesis that Nts
inputs to the VTA preferentially originate from regions associated with reward rather than
aversion83. Indeed, in mice we find that the largest Nts projections to the VTA originate from the
POA, LHA and NAsh, regions that are essential for mediating ingestive and social reward
behavior113-115. By contrast, we detected few Nts afferents from aversion-inducing areas that
project to the VTA, such as the LHb and RMTg11,116,117. In sum, these data identify specific
neural circuits by which Nts may be released to the VTA to mediate positive
reinforcement50,59,61,62.
Comparison to Previous Work: Our work in mice, taken together with tracing studies in
rats, confirms that the LHA and POA are the predominant endogenous sources of Nts to the
VTA of rodents83. We did, however, note several discrepancies in the distribution of Nts
afferents in mice compared to those in rats, indicative of species differences in Nts signaling.
For example, rats have a continuous band of Nts afferents from the LPO and rostral LHA, while
mice exhibit significant clusters of Nts afferents in the perifornical LHA (between -1.30 and -1.80
from bregma) and the LPO with sparse afferents between these regions. Additionally, although
mice and rats have many Nts neurons in the LS and endopiriform areas118,119, mice lack the
substantial Nts-afferents to the VTA observed in rats. This discrepancy may be explained by
the general paucity of VTA projections from the LS and endopiriform areas in mice (0.1-0.3% of
all VTA afferents96) compared to rats (~2-3% of all VTA afferents112). Thus, Nts from the LS and
endopiriform regions of mice and rats likely act via distinct targets, and may differentially
influence physiology. Additionally, while the DR provides significant Nts input to the VTA in rats,
mice have only modest Nts projections from the DR and other mid- and hindbrain nuclei (e.g.
69
the LDTg, PBN, PPTg). We did, however, detect small populations of VTA-projecting Nts
neurons in the APTN, PAG, and SC, which were not previously identified in rats. Additionally,
our mouse data are consistent with reports of rat Nts afferents to the VTA from the NAsh, ST
and amygdala, though the density of afferents differs between species. Overall, our data reveal
species-conserved Nts circuits from the LHA and POA that can engage the VTA, but also point
to other species-specific mechanisms for Nts action that may have functional importance.
We also addressed whether there are Nts neurons within the VTA that provide a local
source of Nts. Previously, immunohistochemistry was used to identify a large population of Nts
cell bodies that co-express TH, and hence are DA-ergic79,120 but very few Nts-expressing cells
are detected in the VTA via ISH100. This discrepancy may be explained by the subsequent
recognition that immunoreagents do not reliably detect Nts in cell bodies without the use of
colchicine treatment to inhibit axonal transport. Using NtsCre;GFP reporter mice, we observed
only a small population of GFP-labeled Nts neurons within the VTA, similar to Nts ISH. Only 3%
of these VTA Nts neurons co-expressed TH, thus the vast majority are not DA-ergic. VTA Nts
neurons may instead contain either glutamate or GABA and project locally within the VTA to
directly regulate DA neuron firing91. Intriguingly, the small number of TH-negative Nts neurons
was primarily detected in the caudal VTA along the rostral lateral borders, where the majority of
VTA GABA neurons reside121. These data suggest that VTA Nts neurons may be GABAergic,
and could provide local inhibitory control over neighboring DA neurons. Overall, our finding of
few local VTA Nts neurons compared to the robust Nts input from the POA, LHA and NAsh
suggests that non-VT sources of Nts are the predominant mechanism to modulate the VTA and
motivated behaviors.
Functional Implications of Nts Afferents to the VTA from the POA: Our results reveal
that the both the MPO and LPO subregions of the POA contribute substantial Nts input to the
70
VTA. The POA is sexually dimorphic122,123, and in female rodents MPO-mediated regulation of
the mesolimbic DA system influences mating and care of offspring124-126. Nts signaling from the
MPO may play a role in maternal behaviors, given that Nts expression in the MPO is altered
post-partum127 and in maternal aggression128, and mouse MPO Nts neurons are activated
during interaction with pups129. Nts in the POA may also mediate mating behavior. Indeed, Nts
immunoreactivity in the VTA is positively correlated with sexually-motivated behaviors in
European starlings9,130, while optogenetic stimulation of MPO Nts neurons projecting to the VTA
mediates social attraction and mesolimbic DA release103. Taken together, these data suggest
that the dense MPO Nts circuit to the VTA is a mechanism by which Nts can modify mating,
parenting, and other social behaviors.
The LPO provides similarly large numbers of Nts afferents to the VTA as the MPO, yet
much less is known about the role of the LPO coordinating motivated behaviors. The LPO is
implicated in fluid balance and thirst regulation131, thus it is possible that the abundant Nts
neurons in the LPO may modify water intake. However, while central administration of Nts
increases water intake132-134, application of Nts directly into the VTA does not alter drinking
behavior52, suggesting that LPO Nts neurons may modify drinking via other non-VTA targets.
The LPO has also been implicated in regulating locomotor activity. Dis-inhibition of the LPO
and rostral LHA continuum in rats induces locomotor activity, which is prevented by blockade of
NtsR1-signalling in the VTA104. These data support a role for endogenous LPO Nts release to
the VTA in mediating locomotor activity, and may account for the induction of locomotor activity
observed after pharmacologic administration of Nts into the VTA. Given the role of the LPO in
drinking and locomotor behavior, it will be important to determine whether the large number of
LPO Nts afferents to the VTA selectively modulate these, or other motivated behaviors.
71
Nts released from the POA may also modify sleeping behavior via the VTA. Modulation
of VTA DA neurons directly regulates arousal, such that the activation of VTA DA neurons
promotes wakefulness while inhibition drives sleep and sleep-oriented nesting behaviors135.
The afferent inputs to the VTA controlling sleep are not clearly defined, but we demonstrate
dense Nts inputs from the POA to the VTA, and the POA is an established regulator of sleepwake behaviors (see 136 for review). GABAergic neurons in the ventrolateral POA promote
induction and maintenance of sleep137,138 and project to the VTA139, though it remains to be
determined if these neurons co-express Nts. Nts has, however, been implicated in sleeping
behavior. For example, central administration of Nts alters sleeping patterns7,140 and NtsR1
knockout mice have altered baseline sleeping behavior and disrupted response to sleep
deprivation6. Thus, the large number of Nts inputs to the VTA from the LPO and MPO therefore
could potentially play a role in mediating sleep, and may be useful targets to treat the sleep
disturbances that commonly co-occur in many neuropsychiatric diseases.
Functional Implications of Nts Afferents to the VTA from the LHA: The LHA provided a
large number of Nts afferents to the VTA of mice, consistent with prior tracing studies from
mice141 and rats83. The LHA is a hub for coordinating peripheral energy status with motivated
behaviors such as feeding and locomotor activity that impact body weight (see 5 for review).
Indeed, pharmacological Nts treatment reduces feeding and increases locomotor activity in a
NtsR1-dependent manner52,53,77,78,142-144, and these effects are mediated, in part, by LHA Nts
neurons that project to the VTA39,87,88. The LHA Nts neurons are molecularly distinct from other
orexigenic neuropeptide-containing populations such as orexin (OX) and melanin-concentrating
hormone (MCH) neurons86, and instead are selectively activated by peripheral cues that
suppress feeding such as leptin, inflammation, and dehydration88,145,146. Furthermore, loss of
leptin receptor signaling from LHA Nts neurons leads to hypoactivity and weight gain88. Given
that LHA Nts neurons respond to cues that suppress feeding and project directly to the VTA, we
72
hypothesize that they coordinate peripheral energy status with feeding behavior and energy
expenditure, a process that becomes disrupted in obesity and eating disorders. Since
stimulation of LHA fibers projecting to the VTA and Nts administration into the VTA are both
rewarding50,59,62,147, LHA Nts afferents may also regulate other motivated via the VTA. For
example, some LHA neurons that project to the VTA are activated by acute amphetamine
exposure148, expression of morphine CPP149, and cue-induced reinstatement of cocaine150.
Going forward, it will therefore be important to define the specific contributions of LHA Nts inputs
to the VTA to Nts-mediated behaviors, and whether they modify consumption of both natural
and pharmacologic rewards.
Functional Implications of Nts Afferents to the VTA from the NA: The NAsh provides
substantial Nts projections to the VTA similar to the magnitude from the MPO and LPO. NAsh
Nts neurons likely overlap with the GABAergic medium spiny neurons in this region that project
to the VTA151,152, which are thought to comprise a feedback loop to regulate the activity of VTA
DA neurons153,154. For example, NA medium spiny neuron projections to VTA GABA neurons
cause dis-inhibition of neighboring DA neurons, which contributes to the reinforcing effects of
cocaine155. NA afferents to the VTA are also preferentially activated during acute amphetamine
exposure148 and cue-induced reinstatement of cocaine150. Together these data indicate that NA
projections to the VTA may be involved in drug-seeking behavior, thus NAsh Nts projections are
anatomically positioned to modify intake of pharmacological rewards. While many studies
implicate roles for central or systemic Nts treatment in modifying drug-intake, it remains unclear
what part of these effects are mediated specifically by Nts release into the VTA (see 8 for
review). Injection of Nts into the VTA does not alter the acute response to amphetamine56, but
may be required for the expression of amphetamine sensitization58. Thus, although
administration of Nts to the VTA is rewarding, it is unclear whether NAsh Nts inputs specifically
modulate the strong reinforcing properties of abusive drugs or natural rewards.
73
Conclusions: Collectively, our work defines the central circuits capable of providing
endogenous Nts to the VTA in mice, which are summarized in Fig. 11. Identification of these
Nts afferents to the VTA also suggests specific mechanisms that presumably underlie the ability
of Nts to modify feeding, sleeping, and social behavior. These data will be useful to direct the
application of optogenetic and/or chemogenetic strategies to selectively modulate the activity of
site-specified Nts populations, and thereby to define their contributions to behavior and
physiology. One limitation of our present work is that it identifies Nts neurons that project to the
VTA in general, but does not reveal which specific VTA neurons are targets of Nts signaling
(e.g. DAergic, GABAergic, and/or glutamatergic neurons). Since it is now appreciated that VTA
neuronal subpopulations control specific motivated behaviors and their reinforcing or aversive
valence, it will be crucial to establish how Nts neurons mechanistically engage VTA neurons to
fully understand their role in behavior. Indeed, given that Nts inputs from the LHA and POA
appear to differentially modify motivated behaviors, there may be distributed Nts circuits and Nts
mechanisms to appropriately coordinate environmental stimuli with feeding, arousal and/or
social interaction responses. Modulation of specific Nts afferents to the VTA may therefore be
useful to normalize maladaptive behaviors associated with neuropsychiatric diseases.
2.5 Methods
Animals: Mice were bred and housed in a 12h light/12h dark cycle and cared for by
Campus Animal Resources (CAR) at Michigan State University. Animals had ad lib access to
chow (Teklad 7913) and water. All animal protocols were approved by the Institutional Animal
Care and Use Committee (IACUC) at Michigan State University.
Ntscre mice 88 [Jackson stock ♯ 017525], were bred to wild-type C57/Bl6 mice for seven
generations to obtain fully backcrossed animals. To visualize Nts neurons, heterozygous Ntscre
74
mice were crossed with homozygous Rosa26EGFP-L10a mice 90, and progeny heterozygous for
both Ntscre and Rosa26EGFP-L10a alleles were studied (referred to as Ntscre;GFP). Genotyping
was performed using standard PCR using the following primer sequences: Ntscre: common
forward: 5' ATA GGC TGC TGA ACC AGG AA, Cre reverse: 5' CCA AAA GAC GGC AAT ATG
GT and WT reverse: 5’ CAA TCA CAA TCA CAG GTC AAG AA. Rosa26EGFP-L10a : mutant
forward: 5’ TCT ACA AAT GTG GTA GAT CCA GGC, WT forward: 5’ GAG GGG AGT GTT
GCA ATA CC and common reverse: 5’ CAG ATG ACT ACC TAT CCT CCC. Adult male and
female NtsCre;GFP mice were used for all studies.
Surgery: Adult NtsCre;GFP mice received a pre-surgical injection of carprofen (5mg/kg
s.c.) and were anesthetized with 3-4% isoflurane/O2 in an induction chamber before being
placed in a stereotaxic frame (Kopf). Under 1-2% isoflurane, access holes were drilled in the
skull and a guide cannula with stylet (PlasticsOne) was used to deliver 15 nL of FG unilaterally
into the VTA in accordance with the atlas of Paxinos and Franklin156 (A/P: -3.2mm, M/L: 0.48mm, D/V: -4.6mm from bregma). Animals were included in the study if 1) the FG injection
was targeted to and confined within the VTA and 2) FG-labeled neurons were observed in a
pattern consistent with mouse VTA afferents based on the work of Watabe-Uchida et al. and
Faget et al.93,96. Out of 10 FG-injected NtsCre;GFP mice, 5 were excluded from analysis
because the injection was targeted lateral or dorsal to the VTA and/or the pattern of FG-labeled
neurons was more consistent with SN rather than VTA afferents (see Fig. 3 for verification).
Perfusions and Immunohistochemistry: Seven days after surgery, FG-injected
Ntscre;GFP mice were deeply anesthetized with sodium pentobarbital, transcardially perfused
with 10% formalin and brains were post-fixed for 24 hours. After dehydration with 30% sucrose
the brains were coronally sectioned (30 µm) using a freezing microtome (Leica). Each brain
was sectioned into four separate but equally represented series. Immunofluorescence was
75
performed as previously described88. Sections were incubated with chicken anti-GFP (1:2000,
Abcam) and mouse anti-tyrosine hydroxylase (TH) (1:1000, Millipore) or rabbit anti-fluorogold
(1:500, Fluorochrome).
Imaging and Quantification: Brain sections were analyzed using an Olympus BX53
fluorescence microscope outfitted with FITC and Texas Red filters. Microscope images were
collected using Cell Sens software and a Qi-Click 12 Bit cooled camera, and images were
analyzed using Photoshop software (Adobe). Each image was assigned a bregma coordinate
based on the mouse brain atlas of Paxinos and Franklin156. For each brain area of interest,
images from the 5 well-targeted animals were organized by bregma coordinate and placed sideby-side with images of Nts ISH from the Allen Brain Project100. For quantification of Nts neurons
in the VTA, four representative coronal sections across similar bregma coordinates from each
animal were assessed for total number of Nts neurons and colocalization with TH. Images were
viewed and quantified in Photoshop CS6 (Adobe). To estimate the total number of Nts neurons
that project to the VTA, 10x images of every section from FG-injected NtsCre;GFP mice were
analyzed for the number the neurons that colocalized with Nts and FG. To improve visualization
of FG+ neurons, a contrast mask of +100 was applied to each image for quantification. To
ensure that each area was sufficiently represented in each animal, the total span over which a
brain area was counted in mm (determined by difference between the two furthest bregma
coordinates) and the distance was divided by the total number of sections analyzed. Because
30µm brain sections were collected in four separate series, each section represented
approximately 0.12 mm of tissue; thus the average mm per section analyzed for each brain area
was kept as close to 0.12 as possible to ensure that the entire region was accounted for in the
rostrocaudal axis. Animals that did not have enough sections to meet these criteria for a given
region were excluded from quantification. To facilitate clarity of neuronal features, all figures
76
depicting FG+ neurons have been digitally enhanced in Photoshop to improve contrast and, in
some cases, brightness.
77
APPENDIX
78
Figure 2. Local Nts expression in the VTA. NtsCre;GFP mice (n = 6) were used to determine
the number and distribution of VTA Nts neurons and whether or not they co-express TH.
A,B,C) Representative images of GFP-identified Nts neurons across three different bregma
coordinates in the VTA of NtsCre;GFP mice (scale bar = 200um). Insets highlight individual Nts
neurons and the presence or absence of colocalization with TH (gray arrows=TH+ Nts neurons,
white arrows=TH-negative Nts neurons). ml=medial lemniscus, ip=interpeduncular nucleus,
fr=fasciculus retroflexus, mt=mammillothalamic tract.
79
Figure 3. Validation of VTA targeting in NtsCre;GFP mice injected unilaterally with FG. A)
NtsCre;GFP reporter mice were injected unilaterally in the VTA with FG allowing for simultaneous
visualization of neurons that project to the VTA (FG positive neurons), Nts neurons (GFP
positive neurons) and Nts afferents to the VTA (GFP/FG+ double-positive neurons). B)
Expected afferent patterns to the VTA or SN based on Watabe-Uchida et al.93. C) Midbrain
images of the five VTA-targeted NtsCre;GFP mice included in the final analysis. Red dotted-line
circles indicate the injection sites while the spread of FG is shown in white. D) FG-labeled cell
bodies of VTA-targeted animals are confined to the LHA, ZI, CeA, and absent from the DS.
Scale bar=200µm. E) FG-labeled neurons of VTA-targeted animals are located preferentially in
the ventral, not dorsal striatum. Scale bar=100µm.
80
Figure 4. The NA shell contains clusters of Nts neurons that project to the VTA. A) Many
Nts/FG+ neurons were found in the NAsh (yellow arrows), but not NAc. B) Nts expression in
the OFT, an area that does not provide significant VTA input and hence few FG+ neurons were
observed. C) Representative expression of Nts and FG in the CPu shows little to no
colocalization. D) Nts neurons were numerous in the LS, an area that does not provide
substantial input to the VTA. Green or purple arrows represent non-colocalized GFP or FG+
neurons in the neighboring CPu. Scale bar=100uM. NAc=nucleus accumbens core,
NAsh=nucleus accumbens shell, OFT=olfactory tubercle, CPu=caudate/putamen, LS=lateral
septum, MS=medial septum, lv=lateral ventricle, cc=corpus callosum, aca=anterior commissure.
81
Figure 5. Cortical Nts inputs to the VTA originate in the CeA but not neocortex.
Representative images show the absence of FG and Nts co-labeling in the A) PFC and B) LO.
C) A dense population of Nts neurons resided in the lateral division of the caudal CeA, but these
neurons were unlikely to project to the VTA. D) Some Nts neurons in the medial CeA
colocalized with FG (yellow arrows). Scale bar=100uM. PFC= prefrontal cortex, CeA=central
amygdala, CeM=medial division of CeA, CeL=lateral division of CeA, CeC=central division of
central amygdala, BLA=basolateral amygdala, ot=optic tract, EA=extended amygdala,
PrL=prelimbic cortex, IL=infralimbic cortex, LO=lateral orbital cortex, ec=external capsule.
82
Figure. 6. Nts neurons in the IPAC, pallidum, and ST that project to the VTA. A) Nts/FG+
neurons were observed in the lateral IPAC (yellow arrows) while the adjacent VP contained low
numbers of Nts neurons. B) Nts/FG+ neurons were observed in the ST (yellow arrows), but not
GP. Scale bar=100uM. STlp=lateral posterior division of stria terminalis, STlv= lateral ventral
division of stria terminalis, stm=medial portion of bed of stria terminalis, sti=intermediate division
of bed of stria terminalis, stl=lateral division of bed of stria terminalis, ic=internal capsule,
GP=globus pallidus, VP=ventral pallidum, LPO=lateral preoptic area, aca=anterior commissure.
83
Figure 7. Sub-regions of the hypothalamus provide Nts afferents to the VTA.
84
Figure 7 (cont’d). A) Caudal section of the hypothalamus showing Nts/FG+ neurons in the ZI
(top panel, yellow arrows) but not the STN (bottom panel). B) The LHA contained a large
number of Nts/FG+ neurons (yellow arrows). C) The VMH (top panel) and ARC (bottom panels)
did not provide many Nts afferents to the VTA. Purple arrows indicate VTA afferents that did
not express GFP. D) The PVH contained minimal Nts neurons and was not a major source of
Nts input to the VTA. E) A dense Nts population resided in the caudal MPO and many of these
were Nts/FG+ neurons that projected to the VTA (yellow arrows). F) Numerous Nts/FG+
neurons were also observed in the rostral LPO (yellow arrows). Scale bars=100uM. ZI=zona
incerta, pSTN=para subthalamic nucleus, cp=cerebral peduncle, mt=mammillothalamic tract,
STN=subthalamic nucleus, LHA=lateral hypothalamic area, DMH=dorsomedial hypothalamic
area, 3V=third ventricle, f=fornix, VMH=ventromedial hypothalamus, ARC=arcuate nucleus,
PVH=paraventricular nucleus, AHA=anterior hypothalamic area, LPO=lateral preoptic area,
MPO=medial preoptic area, MPN=medial preoptic nucleus.
85
Figure 8. Brainstem Nts inputs to the VTA. A small number of Nts/FG+ neurons were
detected in the A) superior colliculus (SC) and B) anterior pretectal nucleus (APTN).
86
Figure 8 (cont’d). Representative images show occasional FG/Nts+ neurons observed in the
C) PAG, D) PTg, E) DR, F) PBN, and G) LDTg. Scale bar=100uM. SC=superior colliculus,
iSC=inferior superior colliculus, dSC=dorsal superior colliculus, pc=posterior commissure,
aq=cerebral aqueduct, APT=anterior pretectal nucleus, PAG=periaqueductal gray,
DLPAG=dorsolateral PAG, LPAG=lateral PAG, VLPAG=ventrolateral PAG, 3N=oculomotor
nucleus, DR=dorsal raphe, PTg=peduncolopontine tegmentum, SPTg=subpenduncular
tegmental nucleus, xscp=decussation of superior cerebellar peduncle, ATg=anterior tegmental
nucleus, LDTg=laterodorsal tegmental nucleus, scp=superior cerebellar peduncle, DTg=dorsal
tegmental nucleus, MPBN=medial parabrachial nucleus, LPBN=lateral parabrachial nucleus.
87
Figure 9. Nts-ergic VTA inputs from the LHb and RMTg. A) The LHb contained only
occasional colocalized neurons (yellow arrow). B) Some Nts/FG+ neurons were detected in the
caudal (yellow arrows). C, D) Images of the rostral RMTg in uninjected NtsCre;GFP mice
showing TH-negative Nts neurons (white arrows). D3V=dorsal third ventricle, MHb=medial
habenula, LHb=lateral habenula, xscp=decussation of cerbellar peduncle, ts=tectospinal tract,
RLi=raphe linear nucleus, ip=interpeduncular nucleus, ml=medial lemniscus.
88
Figure 10. Quantification of Nts-expressing afferents to the VTA by anatomical subregion. Cell bodies colocalizing with GFP and FG were quantified by sampling every fourth
coronal section, thus the bars represent approximately one quarter of the total number of
neurons in each region. Areas that contained ≤1 colocalized neuron per section were not
included in the quantification.
89
Figure 11. Schematic illustration of Nts afferents to the VTA. Distribution patterns of Nts
neurons and VTA afferents at different bregma coordinates. Green ovals represent GFPlabeled neurons, pink ovals represent FG-labeled neurons, and white stars indicate colocalized
Nts/FG+ neurons. Only the sub-regions included in analysis are outlined in black and labeled,
and blank regions do not necessarily indicate lack of GFP or FG.
90
REFERENCES
91
REFERENCES
1
Carraway, R. & Leeman, S. E. The isolation of a new hypotensive peptide, neurotensin,
from bovine hypothalami. The Journal of biological chemistry 248, 6854-6861 (1973).
2
Carraway, R. & Leeman, S. E. Characterization of radioimmunoassayable neurotensin in
the rat. Its differential distribution in the central nervous system, small intestine, and
stomach. The Journal of biological chemistry 251, 7045-7052 (1976).
3
Uhl, G. R., Goodman, R. R. & Snyder, S. H. Neurotensin-containing cell bodies, fibers
and nerve terminals in the brain stem of the rat: immunohistochemical mapping. Brain
research 167, 77-91 (1979).
4
Jennes, L., Stumpf, W. E. & Kalivas, P. W. Neurotensin: topographical distribution in rat
brain by immunohistochemistry. The Journal of comparative neurology 210, 211-224,
doi:10.1002/cne.902100302 (1982).
5
Brown, J. A., Woodworth, H. L. & Leinninger, G. M. To ingest or rest? Specialized roles
of lateral hypothalamic area neurons in coordinating energy balance. Frontiers in
systems neuroscience 9, 9, doi:10.3389/fnsys.2015.00009 (2015).
6
Fitzpatrick, K. et al. Altered sleep and affect in the neurotensin receptor 1 knockout
mouse. Sleep 35, 949-956, doi:10.5665/sleep.1958 (2012).
7
Cape, E. G., Manns, I. D., Alonso, A., Beaudet, A. & Jones, B. E. Neurotensin-induced
bursting of cholinergic basal forebrain neurons promotes gamma and theta cortical
activity together with waking and paradoxical sleep. The Journal of neuroscience : the
official journal of the Society for Neuroscience 20, 8452-8461 (2000).
8
Ferraro, L. et al. Neurotensin: A role in substance use disorder? Journal of
psychopharmacology (Oxford, England) 30, 112-127, doi:10.1177/0269881115622240
(2016).
9
Merullo, D. P., Cordes, M. A., Susan DeVries, M., Stevenson, S. A. & Riters, L. V.
Neurotensin neural mRNA expression correlates with vocal communication and other
highly-motivated social behaviors in male European starlings. Physiology & behavior
151, 155-161, doi:10.1016/j.physbeh.2015.07.019 (2015).
10
Gammie, S. C., D'Anna, K. L., Gerstein, H. & Stevenson, S. A. Neurotensin inversely
modulates maternal aggression. Neuroscience 158, 1215-1223,
doi:10.1016/j.neuroscience.2008.11.045 (2009).
11
Lammel, S. et al. Input-specific control of reward and aversion in the ventral tegmental
area. Nature 491, 212-217, doi:10.1038/nature11527 (2012).
12
van Zessen, R., Phillips, J. L., Budygin, E. A. & Stuber, G. D. Activation of VTA GABA
neurons disrupts reward consumption. Neuron 73, 1184-1194,
doi:10.1016/j.neuron.2012.02.016 (2012).
92
13
Stamatakis, A. M. et al. A unique population of ventral tegmental area neurons inhibits
the lateral habenula to promote reward. Neuron 80, 1039-1053,
doi:10.1016/j.neuron.2013.08.023 (2013).
14
Salamone, J. D. & Correa, M. The mysterious motivational functions of mesolimbic
dopamine. Neuron 76, 470-485, doi:10.1016/j.neuron.2012.10.021 (2012).
15
Bromberg-Martin, E. S., Matsumoto, M. & Hikosaka, O. Dopamine in motivational
control: rewarding, aversive, and alerting. Neuron 68, 815-834,
doi:10.1016/j.neuron.2010.11.022 (2010).
16
Carr, D. B. & Sesack, S. R. GABA-containing neurons in the rat ventral tegmental area
project to the prefrontal cortex. Synapse (New York, N.Y.) 38, 114-123,
doi:10.1002/1098-2396(200011)38:2<114::aid-syn2>3.0.co;2-r (2000).
17
Tan, K. R. et al. GABA neurons of the VTA drive conditioned place aversion. Neuron 73,
1173-1183, doi:10.1016/j.neuron.2012.02.015 (2012).
18
Margolis, E. B., Toy, B., Himmels, P., Morales, M. & Fields, H. L. Identification of rat
ventral tegmental area GABAergic neurons. PloS one 7, e42365,
doi:10.1371/journal.pone.0042365 (2012).
19
Kim, E. R. & Mizuno, T. M. Role of neurotensin receptor 1 in the regulation of food intake
by neuromedins and neuromedin-related peptides. Neuroscience letters 468, 64-67,
doi:10.1016/j.neulet.2009.10.064 (2010).
20
Ellenbroek, B. A., Angelucci, F., Husum, H. & Mathe, A. A. Gene-environment
interactions in a rat model of depression. Maternal separation affects neurotensin in
selected brain regions. Neuropeptides 59, 83-88, doi:10.1016/j.npep.2016.05.001
(2016).
21
Theoharides, T. C., Tsilioni, I., Patel, A. B. & Doyle, R. Atopic diseases and inflammation
of the brain in the pathogenesis of autism spectrum disorders. Translational psychiatry 6,
e844, doi:10.1038/tp.2016.77 (2016).
22
Caceda, R., Binder, E. B., Kinkead, B. & Nemeroff, C. B. The role of endogenous
neurotensin in psychostimulant-induced disruption of prepulse inhibition and locomotion.
Schizophrenia research 136, 88-95, doi:10.1016/j.schres.2011.10.013 (2012).
23
Boules, M. M., Fredrickson, P., Muehlmann, A. M. & Richelson, E. Elucidating the role of
neurotensin in the pathophysiology and management of major mental disorders.
Behavioral sciences (Basel, Switzerland) 4, 125-153, doi:10.3390/bs4020125 (2014).
24
Li, J. et al. An obligatory role for neurotensin in high-fat-diet-induced obesity. Nature 533,
411-415, doi:10.1038/nature17662 (2016).
25
Volkow, N. D., Wang, G. J., Tomasi, D. & Baler, R. D. The addictive dimensionality of
obesity. Biological psychiatry 73, 811-818, doi:10.1016/j.biopsych.2012.12.020 (2013).
93
26
Rothwell, P. E. Autism Spectrum Disorders and Drug Addiction: Common Pathways,
Common Molecules, Distinct Disorders? Frontiers in neuroscience 10, 20,
doi:10.3389/fnins.2016.00020 (2016).
27
Howes, O. D., McCutcheon, R., Owen, M. J. & Murray, R. M. The Role of Genes, Stress,
and Dopamine in the Development of Schizophrenia. Biological psychiatry 81, 9-20,
doi:10.1016/j.biopsych.2016.07.014 (2017).
28
Nestler, E. J. & Carlezon, W. A., Jr. The mesolimbic dopamine reward circuit in
depression. Biological psychiatry 59, 1151-1159, doi:10.1016/j.biopsych.2005.09.018
(2006).
29
Fassio, A. et al. Distribution of the neurotensin receptor NTS1 in the rat CNS studied
using an amino-terminal directed antibody. Neuropharmacology 39, 1430-1442 (2000).
30
Lepee-Lorgeoux, I., Betancur, C., Rostene, W. & Pelaprat, D. Differential ontogenetic
patterns of levocabastine-sensitive neurotensin NT2 receptors and of NT1 receptors in
the rat brain revealed by in situ hybridization. Brain research. Developmental brain
research 113, 115-131 (1999).
31
Nicot, A., Rostene, W. & Berod, A. Differential expression of neurotensin receptor mRNA
in the dopaminergic cell groups of the rat diencephalon and mesencephalon. Journal of
neuroscience research 40, 667-674, doi:10.1002/jnr.490400512 (1995).
32
Palacios, J. M. & Kuhar, M. J. Neurotensin receptors are located on dopaminecontaining neurones in rat midbrain. Nature 294, 587-589 (1981).
33
Sarrieau, A. et al. Characterization and autoradiographic distribution of neurotensin
binding sites in the human brain. Brain research 348, 375-380 (1985).
34
Quirion, R., Welner, S., Gauthier, S. & Bedard, P. Neurotensin receptor binding sites in
monkey and human brain: autoradiographic distribution and effects of 1-methyl-4phenyl-1,2,3,6-tetrahydropyridine treatment. Synapse (New York, N.Y.) 1, 559-566,
doi:10.1002/syn.890010608 (1987).
35
Boudin, H., Pelaprat, D., Rostene, W. & Beaudet, A. Cellular distribution of neurotensin
receptors in rat brain: immunohistochemical study using an antipeptide antibody against
the cloned high affinity receptor. The Journal of comparative neurology 373, 76-89,
doi:10.1002/(SICI)1096-9861(19960909)373:1<76::AID-CNE7>3.0.CO;2-A (1996).
36
Leonetti, M. et al. The neurotensin receptor antagonist SR 142948A blocks the efflux of
dopamine evoked in nucleus accumbens by neurotensin ejection into the ventral
tegmental area. Naunyn-Schmiedeberg's archives of pharmacology 365, 427-433,
doi:10.1007/s00210-002-0574-6 (2002).
37
St-Gelais, F., Legault, M., Bourque, M. J., Rompre, P. P. & Trudeau, L. E. Role of
calcium in neurotensin-evoked enhancement in firing in mesencephalic dopamine
neurons. The Journal of neuroscience : the official journal of the Society for
Neuroscience 24, 2566-2574, doi:10.1523/jneurosci.5376-03.2004 (2004).
94
38
Szigethy, E. & Beaudet, A. Correspondence between high affinity 125I-neurotensin
binding sites and dopaminergic neurons in the rat substantia nigra and ventral tegmental
area: a combined radioautographic and immunohistochemical light microscopic study.
The Journal of comparative neurology 279, 128-137, doi:10.1002/cne.902790111
(1989).
39
Opland, D. et al. Loss of neurotensin receptor-1 disrupts the control of the mesolimbic
dopamine system by leptin and promotes hedonic feeding and obesity. Molecular
metabolism 2, 423-434, doi:10.1016/j.molmet.2013.07.008 (2013).
40
Beaudet, A. & Woulfe, J. Morphological substrate for neurotensin-dopamine interactions
in the rat midbrain tegmentum. Annals of the New York Academy of Sciences 668, 173185 (1992).
41
Brouard, A. et al. Mesencephalic dopaminergic neurons in primary cultures express
functional neurotensin receptors. The Journal of neuroscience : the official journal of the
Society for Neuroscience 12, 1409-1415 (1992).
42
Legault, M., Congar, P., Michel, F. J. & Trudeau, L. E. Presynaptic action of neurotensin
on cultured ventral tegmental area dopaminergic neurones. Neuroscience 111, 177-187
(2002).
43
Sotty, F. et al. Differential effects of neurotensin on dopamine release in the caudal and
rostral nucleus accumbens: a combined in vivo electrochemical and electrophysiological
study. Neuroscience 85, 1173-1182 (1998).
44
Sotty, F. et al. Comparative effects of neurotensin, neurotensin(8-13) and [DTyr(11)]neurotensin applied into the ventral tegmental area on extracellular dopamine in
the rat prefrontal cortex and nucleus accumbens. Neuroscience 98, 485-492 (2000).
45
Seutin, V., Massotte, L. & Dresse, A. Electrophysiological effects of neurotensin on
dopaminergic neurones of the ventral tegmental area of the rat in vitro.
Neuropharmacology 28, 949-954 (1989).
46
Werkman, T. R., Kruse, C. G., Nievelstein, H., Long, S. K. & Wadman, W. J.
Neurotensin attenuates the quinpirole-induced inhibition of the firing rate of dopamine
neurons in the rat substantia nigra pars compacta and the ventral tegmental area.
Neuroscience 95, 417-423 (2000).
47
Kalivas, P. W. & Duffy, P. Effect of acute and daily neurotensin and enkephalin
treatments on extracellular dopamine in the nucleus accumbens. The Journal of
neuroscience : the official journal of the Society for Neuroscience 10, 2940-2949 (1990).
48
Kalivas, P. W., Burgess, S. K., Nemeroff, C. B. & Prange, A. J., Jr. Behavioral and
neurochemical effects of neurotensin microinjection into the ventral tegmental area of
the rat. Neuroscience 8, 495-505 (1983).
49
Bose, P., Rompre, P. P. & Warren, R. A. Neurotensin enhances glutamatergic EPSCs in
VTA neurons by acting on different neurotensin receptors. Peptides 73, 43-50,
doi:10.1016/j.peptides.2015.08.008 (2015).
95
50
Kempadoo, K. A. et al. Hypothalamic neurotensin projections promote reward by
enhancing glutamate transmission in the VTA. The Journal of neuroscience : the official
journal of the Society for Neuroscience 33, 7618-7626, doi:10.1523/jneurosci.258812.2013 (2013).
51
Stuhrman, K. & Roseberry, A. G. Neurotensin inhibits both dopamine- and GABAmediated inhibition of ventral tegmental area dopamine neurons. Journal of
neurophysiology 114, 1734-1745, doi:10.1152/jn.00279.2015 (2015).
52
Cador, M., Kelley, A. E., Le Moal, M. & Stinus, L. Ventral tegmental area infusion of
substance P, neurotensin and enkephalin: differential effects on feeding behavior.
Neuroscience 18, 659-669 (1986).
53
Kelley, A. E., Cador, M., Stinus, L. & Le Moal, M. Neurotensin, substance P, neurokininalpha, and enkephalin: injection into ventral tegmental area in the rat produces
differential effects on operant responding. Psychopharmacology 97, 243-252 (1989).
54
Kalivas, P. W., Nemeroff, C. B. & Prange, A. J., Jr. Increase in spontaneous motor
activity following infusion of neurotensin into the ventral tegmental area. Brain research
229, 525-529 (1981).
55
Steinberg, R. et al. SR 48692, a non-peptide neurotensin receptor antagonist
differentially affects neurotensin-induced behaviour and changes in dopaminergic
transmission. Neuroscience 59, 921-929 (1994).
56
Elliott, P. J. & Nemeroff, C. B. Repeated neurotensin administration in the ventral
tegmental area: effects on baseline and D-amphetamine-induced locomotor activity.
Neuroscience letters 68, 239-244 (1986).
57
Feifel, D. & Reza, T. L. Effects of neurotensin administered into the ventral tegmental
area on prepulse inhibition of startle. Behavioural brain research 106, 189-193 (1999).
58
Panayi, F. et al. Endogenous neurotensin in the ventral tegmental area contributes to
amphetamine behavioral sensitization. Neuropsychopharmacology : official publication
of the American College of Neuropsychopharmacology 30, 871-879,
doi:10.1038/sj.npp.1300638 (2005).
59
Glimcher, P. W., Giovino, A. A. & Hoebel, B. G. Neurotensin self-injection in the ventral
tegmental area. Brain research 403, 147-150 (1987).
60
Rompre, P. P. & Gratton, A. Mesencephalic microinjections of neurotensin-(1-13) and its
C-terminal fragment, neurotensin-(8-13), potentiate brain stimulation reward. Brain
research 616, 154-162 (1993).
61
Rouibi, K., Bose, P., Rompre, P. P. & Warren, R. A. Ventral Midbrain NTS1 Receptors
Mediate Conditioned Reward Induced by the Neurotensin Analog, D-Tyr[11]neurotensin.
Frontiers in neuroscience 9, 470, doi:10.3389/fnins.2015.00470 (2015).
62
Glimcher, P. W., Margolin, D. H., Giovino, A. A. & Hoebel, B. G. Neurotensin: a new
'reward peptide'. Brain research 291, 119-124 (1984).
96
63
Kalivas, P. W. & Taylor, S. Behavioral and neurochemical effect of daily injection with
neurotensin into the ventral tegmental area. Brain research 358, 70-76 (1985).
64
Voyer, D., Levesque, D. & Rompre, P. P. Repeated ventral midbrain neurotensin
injections sensitize to amphetamine-induced locomotion and ERK activation: A role for
NMDA receptors. Neuropharmacology 112, 150-163,
doi:10.1016/j.neuropharm.2016.06.005 (2017).
65
Panayi, F. et al. Chronic blockade of neurotensin receptors strongly reduces sensitized,
but not acute, behavioral response to D-amphetamine. Neuropsychopharmacology :
official publication of the American College of Neuropsychopharmacology 26, 64-74,
doi:10.1016/s0893-133x(01)00354-2 (2002).
66
Felszeghy, K. et al. Neurotensin receptor antagonist administered during cocaine
withdrawal decreases locomotor sensitization and conditioned place preference.
Neuropsychopharmacology : official publication of the American College of
Neuropsychopharmacology 32, 2601-2610, doi:10.1038/sj.npp.1301382 (2007).
67
Levesque, K., Lamarche, C. & Rompre, P. P. Evidence for a role of endogenous
neurotensin in the development of sensitization to the locomotor stimulant effect of
morphine. European journal of pharmacology 594, 132-138,
doi:10.1016/j.ejphar.2008.07.048 (2008).
68
Kalivas, P. W., Nemeroff, C. B. & Prange, A. J., Jr. Neurotensin microinjection into the
nucleus accumbens antagonizes dopamine-induced increase in locomotion and rearing.
Neuroscience 11, 919-930 (1984).
69
van Wimersma Greidanus, T. B. et al. Neurotensin and bombesin, a relationship
between their effects on body temperature and locomotor activity? Pharmacology,
biochemistry, and behavior 21, 197-202 (1984).
70
Vadnie, C. A. et al. Activation of neurotensin receptor type 1 attenuates locomotor
activity. Neuropharmacology 85, 482-492, doi:10.1016/j.neuropharm.2014.05.046
(2014).
71
Meisenberg, G. & Simmons, W. H. Motor hypoactivity induced by neurotensin and
related peptides in mice. Pharmacology, biochemistry, and behavior 22, 189-193 (1985).
72
Elliott, P. J., Chan, J., Parker, Y. M. & Nemeroff, C. B. Behavioral effects of neurotensin
in the open field: structure-activity studies. Brain research 381, 259-265 (1986).
73
Skoog, K. M., Cain, S. T. & Nemeroff, C. B. Centrally administered neurotensin
suppresses locomotor hyperactivity induced by d-amphetamine but not by scopolamine
or caffeine. Neuropharmacology 25, 777-782 (1986).
74
Nemeroff, C. B. et al. Interactions of neurotensin with brain dopamine systems:
biochemical and behavioral studies. The Journal of pharmacology and experimental
therapeutics 225, 337-345 (1983).
75
Ervin, G. N., Birkemo, L. S., Nemeroff, C. B. & Prange, A. J., Jr. Neurotensin blocks
certain amphetamine-induced behaviours. Nature 291, 73-76 (1981).
97
76
Sarhan, S., Hitchcock, J. M., Grauffel, C. A. & Wettstein, J. G. Comparative
antipsychotic profiles of neurotensin and a related systemically active peptide agonist.
Peptides 18, 1223-1227 (1997).
77
Luttinger, D. et al. The effect of neurotensin on food consumption in the rat. European
journal of pharmacology 81, 499-503 (1982).
78
Cooke, J. H. et al. Peripheral and central administration of xenin and neurotensin
suppress food intake in rodents. Obesity (Silver Spring, Md.) 17, 1135-1143,
doi:10.1038/oby.2008.652 (2009).
79
Hokfelt, T., Everitt, B. J., Theodorsson-Norheim, E. & Goldstein, M. Occurrence of
neurotensinlike immunoreactivity in subpopulations of hypothalamic, mesencephalic,
and medullary catecholamine neurons. The Journal of comparative neurology 222, 543559, doi:10.1002/cne.902220407 (1984).
80
Woulfe, J. & Beaudet, A. Immunocytochemical evidence for direct connections between
neurotensin-containing axons and dopaminergic neurons in the rat ventral midbrain
tegmentum. Brain research 479, 402-406 (1989).
81
Zahm, D. S., Grosu, S., Williams, E. A., Qin, S. & Berod, A. Neurons of origin of the
neurotensinergic plexus enmeshing the ventral tegmental area in rat: retrograde labeling
and in situ hybridization combined. Neuroscience 104, 841-851 (2001).
82
Geisler, S. & Zahm, D. S. On the retention of neurotensin in the ventral tegmental area
(VTA) despite destruction of the main neurotensinergic afferents of the VTA--implications
for the organization of forebrain projections to the VTA. Brain research 1087, 87-104,
doi:10.1016/j.brainres.2006.02.108 (2006).
83
Geisler, S. & Zahm, D. S. Neurotensin afferents of the ventral tegmental area in the rat:
[1] re-examination of their origins and [2] responses to acute psychostimulant and
antipsychotic drug administration. The European journal of neuroscience 24, 116-134,
doi:10.1111/j.1460-9568.2006.04928.x (2006).
84
Louis, G. W., Leinninger, G. M., Rhodes, C. J. & Myers, M. G., Jr. Direct innervation and
modulation of orexin neurons by lateral hypothalamic LepRb neurons. The Journal of
neuroscience : the official journal of the Society for Neuroscience 30, 11278-11287,
doi:10.1523/jneurosci.1340-10.2010 (2010).
85
Hanno, Y., Nakahira, M., Jishage, K., Noda, T. & Yoshihara, Y. Tracking mouse visual
pathways with WGA transgene. The European journal of neuroscience 18, 2910-2914
(2003).
86
Brown, J. A. et al. Loss of Action via Neurotensin-Leptin Receptor Neurons Disrupts
Leptin and Ghrelin-Mediated Control of Energy Balance. Endocrinology,
doi:10.1210/en.2017-00122 (2017).
87
Patterson, C. M. et al. Ventral tegmental area neurotensin signaling links the lateral
hypothalamus to locomotor activity and striatal dopamine efflux in male mice.
Endocrinology 156, 1692-1700, doi:10.1210/en.2014-1986 (2015).
98
88
Leinninger, G. M. et al. Leptin action via neurotensin neurons controls orexin, the
mesolimbic dopamine system and energy balance. Cell metabolism 14, 313-323,
doi:10.1016/j.cmet.2011.06.016 (2011).
89
Smits, S. M., Terwisscha van Scheltinga, A. F., van der Linden, A. J., Burbach, J. P. &
Smidt, M. P. Species differences in brain pre-pro-neurotensin/neuromedin N mRNA
distribution: the expression pattern in mice resembles more closely that of primates than
rats. Brain research. Molecular brain research 125, 22-28,
doi:10.1016/j.molbrainres.2004.03.001 (2004).
90
Krashes, M. J. et al. An excitatory paraventricular nucleus to AgRP neuron circuit that
drives hunger. Nature 507, 238-242, doi:10.1038/nature12956 (2014).
91
Omelchenko, N. & Sesack, S. R. Ultrastructural analysis of local collaterals of rat ventral
tegmental area neurons: GABA phenotype and synapses onto dopamine and GABA
cells. Synapse (New York, N.Y.) 63, 895-906, doi:10.1002/syn.20668 (2009).
92
Dobi, A., Margolis, E. B., Wang, H. L., Harvey, B. K. & Morales, M. Glutamatergic and
nonglutamatergic neurons of the ventral tegmental area establish local synaptic contacts
with dopaminergic and nondopaminergic neurons. The Journal of neuroscience : the
official journal of the Society for Neuroscience 30, 218-229, doi:10.1523/jneurosci.388409.2010 (2010).
93
Watabe-Uchida, M., Zhu, L., Ogawa, S. K., Vamanrao, A. & Uchida, N. Whole-brain
mapping of direct inputs to midbrain dopamine neurons. Neuron 74, 858-873,
doi:10.1016/j.neuron.2012.03.017 (2012).
94
Richard, J. M., Castro, D. C., Difeliceantonio, A. G., Robinson, M. J. & Berridge, K. C.
Mapping brain circuits of reward and motivation: in the footsteps of Ann Kelley.
Neuroscience and biobehavioral reviews 37, 1919-1931,
doi:10.1016/j.neubiorev.2012.12.008 (2013).
95
Ikemoto, S. Dopamine reward circuitry: two projection systems from the ventral midbrain
to the nucleus accumbens-olfactory tubercle complex. Brain research reviews 56, 27-78,
doi:10.1016/j.brainresrev.2007.05.004 (2007).
96
Faget, L. et al. Afferent Inputs to Neurotransmitter-Defined Cell Types in the Ventral
Tegmental Area. Cell reports 15, 2796-2808, doi:10.1016/j.celrep.2016.05.057 (2016).
97
Lee, H. J., Gallagher, M. & Holland, P. C. The central amygdala projection to the
substantia nigra reflects prediction error information in appetitive conditioning. Learning
& memory (Cold Spring Harbor, N.Y.) 17, 531-538, doi:10.1101/lm.1889510 (2010).
98
Shammah-Lagnado, S. J., Alheid, G. F. & Heimer, L. Striatal and central extended
amygdala parts of the interstitial nucleus of the posterior limb of the anterior
commissure: evidence from tract-tracing techniques in the rat. The Journal of
comparative neurology 439, 104-126, doi:10.1002/cne.1999 (2001).
99
Gartner, U., Hartig, W., Riedel, A., Brauer, K. & Arendt, T. Immunocytochemical
evidence for the striatal nature of the rat lateral part of interstitial nucleus of the posterior
99
limb of the anterior commissure (IPAC). Journal of chemical neuroanatomy 24, 117-125
(2002).
100
Lein, E. S. et al. Genome-wide atlas of gene expression in the adult mouse brain. Nature
445, 168-176, doi:10.1038/nature05453 (2007).
101
Beier, K. T. et al. Circuit Architecture of VTA Dopamine Neurons Revealed by
Systematic Input-Output Mapping. Cell 162, 622-634, doi:10.1016/j.cell.2015.07.015
(2015).
102
Navarro, M. et al. Lateral Hypothalamus GABAergic Neurons Modulate Consummatory
Behaviors Regardless of the Caloric Content or Biological Relevance of the Consumed
Stimuli. Neuropsychopharmacology : official publication of the American College of
Neuropsychopharmacology 41, 1505-1512, doi:10.1038/npp.2015.304 (2016).
103
McHenry, J. A. et al. Hormonal gain control of a medial preoptic area social reward
circuit. Nature neuroscience, doi:10.1038/nn.4487 (2017).
104
Reynolds, S. M., Geisler, S., Berod, A. & Zahm, D. S. Neurotensin antagonist acutely
and robustly attenuates locomotion that accompanies stimulation of a neurotensincontaining pathway from rostrobasal forebrain to the ventral tegmental area. The
European journal of neuroscience 24, 188-196, doi:10.1111/j.1460-9568.2006.04791.x
(2006).
105
Jassik-Gerschenfeld, D. Somesthetic and visual responses of superior colliculus
neurones. Nature 208, 898-900 (1965).
106
Rees, H. & Roberts, M. H. The anterior pretectal nucleus: a proposed role in sensory
processing. Pain 53, 121-135 (1993).
107
Mena-Segovia, J., Winn, P. & Bolam, J. P. Cholinergic modulation of midbrain
dopaminergic systems. Brain research reviews 58, 265-271,
doi:10.1016/j.brainresrev.2008.02.003 (2008).
108
Lecca, S., Melis, M., Luchicchi, A., Muntoni, A. L. & Pistis, M. Inhibitory inputs from
rostromedial tegmental neurons regulate spontaneous activity of midbrain dopamine
cells and their responses to drugs of abuse. Neuropsychopharmacology : official
publication of the American College of Neuropsychopharmacology 37, 1164-1176,
doi:10.1038/npp.2011.302 (2012).
109
Quina, L. A. et al. Efferent pathways of the mouse lateral habenula. The Journal of
comparative neurology 523, 32-60, doi:10.1002/cne.23662 (2015).
110
Geisler, S. & Zahm, D. S. Afferents of the ventral tegmental area in the rat-anatomical
substratum for integrative functions. The Journal of comparative neurology 490, 270294, doi:10.1002/cne.20668 (2005).
111
Phillipson, O. T. Afferent projections to the ventral tegmental area of Tsai and
interfascicular nucleus: a horseradish peroxidase study in the rat. The Journal of
comparative neurology 187, 117-143, doi:10.1002/cne.901870108 (1979).
100
112
Yetnikoff, L., Cheng, A. Y., Lavezzi, H. N., Parsley, K. P. & Zahm, D. S. Sources of input
to the rostromedial tegmental nucleus, ventral tegmental area, and lateral habenula
compared: A study in rat. The Journal of comparative neurology 523, 2426-2456,
doi:10.1002/cne.23797 (2015).
113
Hoebel, B. G. & Teitelbaum, P. Hypothalamic control of feeding and self-stimulation.
Science (New York, N.Y.) 135, 375-377 (1962).
114
Caggiula, A. R. & Hoebel, B. G. "Copulation-reward site" in the posterior hypothalamus.
Science (New York, N.Y.) 153, 1284-1285 (1966).
115
Garris, P. A. et al. Dissociation of dopamine release in the nucleus accumbens from
intracranial self-stimulation. Nature 398, 67-69, doi:10.1038/18019 (1999).
116
Stamatakis, A. M. & Stuber, G. D. Activation of lateral habenula inputs to the ventral
midbrain promotes behavioral avoidance. Nature neuroscience 15, 1105-1107,
doi:10.1038/nn.3145 (2012).
117
Sanchez-Catalan, M. J. et al. Response of the Tail of the Ventral Tegmental Area to
Aversive Stimuli. Neuropsychopharmacology : official publication of the American
College of Neuropsychopharmacology, doi:10.1038/npp.2016.139 (2016).
118
Alexander, M. J. et al. Distribution of neurotensin/neuromedin N mRNA in rat forebrain:
unexpected abundance in hippocampus and subiculum. Proceedings of the National
Academy of Sciences of the United States of America 86, 5202-5206 (1989).
119
Sato, M., Kiyama, H., Yoshida, S., Saika, T. & Tohyama, M. Postnatal ontogeny of cells
expressing prepro-neurotensin/neuromedin N mRNA in the rat forebrain and midbrain: a
hybridization histochemical study involving isotope-labeled and enzyme-labeled probes.
The Journal of comparative neurology 310, 300-315, doi:10.1002/cne.903100303
(1991).
120
Bayer, V. E., Towle, A. C. & Pickel, V. M. Vesicular and cytoplasmic localization of
neurotensin-like immunoreactivity (NTLI) in neurons postsynaptic to terminals containing
NTLI and/or tyrosine hydroxylase in the rat central nucleus of the amygdala. Journal of
neuroscience research 30, 398-413, doi:10.1002/jnr.490300216 (1991).
121
Mazei-Robison, M. S. & Nestler, E. J. Opiate-induced molecular and cellular plasticity of
ventral tegmental area and locus coeruleus catecholamine neurons. Cold Spring Harbor
perspectives in medicine 2, a012070, doi:10.1101/cshperspect.a012070 (2012).
122
Raisman, G. & Field, P. M. Sexual dimorphism in the preoptic area of the rat. Science
(New York, N.Y.) 173, 731-733 (1971).
123
Shah, N. M. et al. Visualizing sexual dimorphism in the brain. Neuron 43, 313-319,
doi:10.1016/j.neuron.2004.07.008 (2004).
124
Stolzenberg, D. S. et al. Dopamine D1 receptor stimulation of the nucleus accumbens or
the medial preoptic area promotes the onset of maternal behavior in pregnancyterminated rats. Behavioral neuroscience 121, 907-919, doi:10.1037/07357044.121.5.907 (2007).
101
125
Numan, M. & Smith, H. G. Maternal behavior in rats: evidence for the involvement of
preoptic projections to the ventral tegmental area. Behavioral neuroscience 98, 712-727
(1984).
126
Stolzenberg, D. S. & Numan, M. Hypothalamic interaction with the mesolimbic DA
system in the control of the maternal and sexual behaviors in rats. Neuroscience and
biobehavioral reviews 35, 826-847, doi:10.1016/j.neubiorev.2010.10.003 (2011).
127
Driessen, T. M., Zhao, C., Whittlinger, A., Williams, H. & Gammie, S. C. Endogenous
CNS expression of neurotensin and neurotensin receptors is altered during the
postpartum period in outbred mice. PloS one 9, e83098,
doi:10.1371/journal.pone.0083098 (2014).
128
Gammie, S. C. et al. Altered gene expression in mice selected for high maternal
aggression. Genes, brain, and behavior 6, 432-443, doi:10.1111/j.1601183X.2006.00271.x (2007).
129
Tsuneoka, Y. et al. Functional, anatomical, and neurochemical differentiation of medial
preoptic area subregions in relation to maternal behavior in the mouse. The Journal of
comparative neurology 521, 1633-1663, doi:10.1002/cne.23251 (2013).
130
Merullo, D. P., Cordes, M. A., Stevenson, S. A. & Riters, L. V. Neurotensin
immunolabeling relates to sexually-motivated song and other social behaviors in male
European starlings (Sturnus vulgaris). Behavioural brain research 282, 133-143,
doi:10.1016/j.bbr.2015.01.007 (2015).
131
Blass, E. M. & Epstein, A. N. A lateral preoptic osmosensitive zone for thirst in the rat.
Journal of comparative and physiological psychology 76, 378-394 (1971).
132
Hawkins, M. F., Baker, J. D. & Baumeister, A. A. Neurotensin-induced polydipsia: a
structure-activity study. Brain research 487, 188-191 (1989).
133
Quirk, W. S., Wright, J. W. & Harding, J. W. Tachyphylaxis of dipsogenic activity to
intracerebroventricular administration of angiotensins. Brain research 452, 73-78 (1988).
134
Baker, J. D., Hawkins, M. F., Baumeister, A. A. & Nagy, M. Microinjection of neurotensin
into the CNS induces hyperdipsia in the rat. Pharmacology, biochemistry, and behavior
33, 7-10 (1989).
135
Eban-Rothschild, A., Rothschild, G., Giardino, W. J., Jones, J. R. & de Lecea, L. VTA
dopaminergic neurons regulate ethologically relevant sleep-wake behaviors. Nature
neuroscience 19, 1356-1366, doi:10.1038/nn.4377 (2016).
136
Luppi, P. H., Peyron, C. & Fort, P. Not a single but multiple populations of GABAergic
neurons control sleep. Sleep medicine reviews, doi:10.1016/j.smrv.2016.03.002 (2016).
137
Gvilia, I., Turner, A., McGinty, D. & Szymusiak, R. Preoptic area neurons and the
homeostatic regulation of rapid eye movement sleep. The Journal of neuroscience : the
official journal of the Society for Neuroscience 26, 3037-3044,
doi:10.1523/jneurosci.4827-05.2006 (2006).
102
138
Sherin, J. E., Shiromani, P. J., McCarley, R. W. & Saper, C. B. Activation of ventrolateral
preoptic neurons during sleep. Science (New York, N.Y.) 271, 216-219 (1996).
139
Saito, Y. C. et al. GABAergic neurons in the preoptic area send direct inhibitory
projections to orexin neurons. Frontiers in neural circuits 7, 192,
doi:10.3389/fncir.2013.00192 (2013).
140
Castel, M. N., Stutzmann, J. M., Lucas, M., Lafforgue, J. & Blanchard, J. C. Effects of
ICV administration of neurotensin and analogs on EEG in rats. Peptides 10, 95-101
(1989).
141
Leinninger, G. M. et al. Leptin acts via leptin receptor-expressing lateral hypothalamic
neurons to modulate the mesolimbic dopamine system and suppress feeding. Cell
metabolism 10, 89-98, doi:10.1016/j.cmet.2009.06.011 (2009).
142
Feifel, D., Goldenberg, J., Melendez, G. & Shilling, P. D. The acute and subchronic
effects of a brain-penetrating, neurotensin-1 receptor agonist on feeding, body weight
and temperature. Neuropharmacology 58, 195-198,
doi:10.1016/j.neuropharm.2009.07.001 (2010).
143
Boules, M. et al. A novel neurotensin peptide analog given extracranially decreases food
intake and weight in rodents. Brain research 865, 35-44 (2000).
144
Remaury, A. et al. Targeted inactivation of the neurotensin type 1 receptor reveals its
role in body temperature control and feeding behavior but not in analgesia. Brain
research 953, 63-72 (2002).
145
Grossberg, A. J. et al. Inflammation-induced lethargy is mediated by suppression of
orexin neuron activity. The Journal of neuroscience : the official journal of the Society for
Neuroscience 31, 11376-11386, doi:10.1523/jneurosci.2311-11.2011 (2011).
146
Watts, A. G., Sanchez-Watts, G. & Kelly, A. B. Distinct patterns of neuropeptide gene
expression in the lateral hypothalamic area and arcuate nucleus are associated with
dehydration-induced anorexia. The Journal of neuroscience : the official journal of the
Society for Neuroscience 19, 6111-6121 (1999).
147
Nieh, E. H. et al. Decoding neural circuits that control compulsive sucrose seeking. Cell
160, 528-541, doi:10.1016/j.cell.2015.01.003 (2015).
148
Colussi-Mas, J., Geisler, S., Zimmer, L., Zahm, D. S. & Berod, A. Activation of afferents
to the ventral tegmental area in response to acute amphetamine: a double-labelling
study. The European journal of neuroscience 26, 1011-1025, doi:10.1111/j.14609568.2007.05738.x (2007).
149
Richardson, K. A. & Aston-Jones, G. Lateral hypothalamic orexin/hypocretin neurons
that project to ventral tegmental area are differentially activated with morphine
preference. The Journal of neuroscience : the official journal of the Society for
Neuroscience 32, 3809-3817, doi:10.1523/jneurosci.3917-11.2012 (2012).
150
Mahler, S. V. & Aston-Jones, G. S. Fos activation of selective afferents to ventral
tegmental area during cue-induced reinstatement of cocaine seeking in rats. The Journal
103
of neuroscience : the official journal of the Society for Neuroscience 32, 13309-13326,
doi:10.1523/jneurosci.2277-12.2012 (2012).
151
Nauta, W. J., Smith, G. P., Faull, R. L. & Domesick, V. B. Efferent connections and nigral
afferents of the nucleus accumbens septi in the rat. Neuroscience 3, 385-401 (1978).
152
Kalivas, P. W., Churchill, L. & Klitenick, M. A. GABA and enkephalin projection from the
nucleus accumbens and ventral pallidum to the ventral tegmental area. Neuroscience
57, 1047-1060 (1993).
153
Einhorn, L. C., Johansen, P. A. & White, F. J. Electrophysiological effects of cocaine in
the mesoaccumbens dopamine system: studies in the ventral tegmental area. The
Journal of neuroscience : the official journal of the Society for Neuroscience 8, 100-112
(1988).
154
Rahman, S. & McBride, W. J. Feedback control of mesolimbic somatodendritic
dopamine release in rat brain. Journal of neurochemistry 74, 684-692 (2000).
155
Bocklisch, C. et al. Cocaine disinhibits dopamine neurons by potentiation of GABA
transmission in the ventral tegmental area. Science (New York, N.Y.) 341, 1521-1525,
doi:10.1126/science.1237059 (2013).
156
Keith B.J. Franklin, G. P. The Mouse Brain In Stereotaxic Coordinates. Third edn,
(Elsevier, 2007).
157
Kiyama, H., Emson, P. C. & Ruth, J. Distribution of Tyrosine Hydroxylase mRNA in the
Rat Central Nervous System Visualized by Alkaline Phosphatase in situ Hybridization
Histochemistry. The European journal of neuroscience 2, 512-524 (1990).
104
Chapter 3. Identification of Neurotensin Receptor Expressing Cells in the Ventral
Tegmental Area Across the Lifespan
Authors: Hillary L. Woodworth, Bethany G. Beekly, Trevor J. Lewis, and Gina M. Leinninger
The is a modified version of a manuscript under revision.
3.1 Abstract
Neurotensin (Nts) promotes activation of dopamine (DA) neurons in the ventral tegmental area
(VTA) via incompletely understood mechanisms. Nts can signal via the G-protein coupled
neurotensin receptors 1 and 2 (NtsR1 and NtsR2), but the lack of methods to detect NtsR1 and
NtsR2-expressing cells has limited mechanistic understanding of Nts action. To overcome this
challenge, we generated dual recombinase mice that express FlpO-dependent Cre
recombinase in NtsR1 or NtsR2 cells. This strategy permitted temporal control over
recombination, such that we could identify NtsR1 or NtsR2-expressing cells and determine if
their distributions differed between the developing and adult brain. Using this system we found
that NtsR1 is transiently expressed in nearly all DA neurons and in many non-DA neurons in the
VTA during development. However, NtsR1 expression is more restricted within the adult brain,
where only two thirds of VTA DA neurons expressed NtsR1. By contrast, NtsR2 expression
remains constant throughout lifespan but it is predominantly expressed within glia. Anterograde
tract tracing revealed that NtsR1 is selectively expressed by mesolimbic, not mesocortical DA
neurons, thus VTA NtsR1 neurons are a projection-specified and functionally unique subset of
VTA DA neurons. Collectively, this work reveals a cellular mechanism by which Nts can directly
engage NtsR1-expressing DA neurons to modify DA signaling. Going forward, the dual
recombinase strategy developed here will be useful to selectively modulate NtsR1 and NtsR2expressing cells, and to parse their contributions to Nts-mediated behaviors.
105
3.2 Introduction
The neuropeptide, neurotensin (Nts), is expressed throughout the central nervous
system and has been linked to numerous physiologic and behavioral processes including
regulation of feeding, body temperature, nociception, emotional state, and sleep1-5. While the
precise neural circuits by which Nts acts to modify behavior remain undetermined, it is wellestablished that Nts modulates dopamine (DA) transmission. Nts signaling may therefore be a
target of interest for the treatment of diseases linked with altered DA signaling, including
Parkinson’s disease, schizophrenia, drug addiction, and obesity5,6.
Nts signals via the G-protein coupled neurotensin receptors 1 and 2 (NtsR1 and NtsR2)
which are both expressed in the brain and have been implicated in Nts-mediated behaviors7-10.
Nts also binds the intracellular receptor, NtsR3/sortilin, which may regulate recycling and sorting
of Nts3,11. Studies using pharmacological antagonists and mice null for NtsR1 or NtsR2 suggest
that each receptor isoform mediates distinct aspects of physiology, and hence that they may be
expressed on different cell types. The lack of methods to detect and manipulate NtsR1 or
NtsR2-expressing cells, however, has limited understanding of the cellular mechanisms by
which Nts regulates behavior. NtsR1 was the first NtsR identified and has a 10-30 fold higher
affinity for Nts compared to NtsR27-10. Nts binding to NtsR1 activates Gq-coupled induction of
phospholipase C and intracellular Ca++ release7,8,12. The signaling mechanism of NtsR2 is less
clear, and both Gq and Gi-coupled mechanisms have been reported9,13. In situ hybridization
(ISH) and autoradiography methods to detect NtsR1 indicate that it is expressed robustly within
the ventral tegmental area (VTA) and substantia (SN) of adult animals14-17. Similar techniques
revealed diffuse expression of NtsR2 throughout the brain that may be within both neurons and
glia18-20, with the highest levels of expression restricted to the cerebellum, hippocampus, and
periaqueductal gray (PAG)9,19,21. Interestingly, the expression patterns of NtsR1 and NtsR2 in
106
the brain may vary with age. For example, central NtsR1 is transiently upregulated during
gestation and peaks during the first week of life, but is subsequently downregulated as animals
reach maturity, with high levels persisting in select brain regions including the VTA and SN22,23.
By contrast, NtsR2 expression is low at birth but gradually increases with age, peaking in
adulthood21,22. Taken together, these data indicate that NtsR1 and NtsR2 have distinct
expression patterns that vary across the lifespan, and may be found on different cell types
within the nervous system.
Given the different sites and distribution of NtsR1 and NtsR2 expression throughout
lifespan, each receptor isoform may regulate distinct aspects of developmental and adult
physiology. Indeed, previous work demonstrates that central Nts promotes DA release,
locomotor activity, hypothermia, anorexia, and reward via NtsR11,24-29, whereas NtsR2 may
confer the pain-reducing effects of Nts1,3,30,31. However, the evidence for distinct roles of NtsR1
and NtsR2 is not entirely consistent and interpretation of the data is complicated by
methodological limitations. For example, the commonly used NtsR1-selective antagonist
SR48692 also acts as an agonist at NtsR213,32,33, while a potential compound to selectively
antagonize NtsR2 has only recently been developed3,34. NtsR1 and NtsR2 knockout mice have
also been used to examine the specific roles of each receptor, but developmental deletion in
these models may lead to compensatory changes that mask normal action of the Nts system.
For example, it has been suggested that NtsR1 or NtsR2 null mice have increased expression
of the remaining receptor isoform26,35 and exhibit alterations in DA signaling and locomotor
activity that misrepresent the functional roles of the NtsR receptor signaling1,24,26,35,36. Finally,
the lack of immunohistochemical reagents to detect NtsR1 or NtsR2 has impeded determination
of the cells and circuits that mediate Nts action. Thus, while NtsR-selective pharmacologic
agents and knockout models have added to understanding of central Nts action, developing
107
methods to visualize and manipulate select NtsR1 or NtsR2 populations in vivo is essential to
deciphering the neural circuits and physiology regulated by each receptor.
To address this challenge, we developed dual recombinase knock-in mouse models in
which FlpO is required to induce IRES-Cre in cells that express NtsR1 or NtsR2. Cre-mediated
recombination can then be used to induce fluorescent reporters in these cells to permit their
detection, and indeed Cre-driver lines have proven to be reliable reagents to identify genetically
specified cell populations37-39. A limitation of mouse models that constitutively express Cre is
that recombination-mediated labeling occurs whenever Cre is expressed and persists thereafter.
This may confound interpretation in cases where gene-induced Cre expression changes over
lifespan, as has been suggested to occur for NtsRs (with extensive expression during
development but more restricted expression in the adult brain22,23). We thus engineered FlpOdependent Cre expression in NtsR1 and NtsR2 cells, allowing for temporal control over
recombination by inducing FlpO expression at defined time points (either embryogenesis or
adulthood). Given the well-established description of Nts as a modulator of DA signaling, but
the lack of understanding of which VTA cells mediate it, we used these mice to define the
cellular distribution of NtsR1 and NtsR2 within the VTA.
3.3 Results
Dual Recombinase Strategy to Label NtsR1 and NtsR2 Expressing Cells: To identify
NtsR1 or NtsR2 cells “on command”, we generated knock-in mouse models that express Cre in
NtsR1 or NtsR2 cells only after FlpO-mediated recombination. To do this, we inserted an frtflanked NEO cassette upstream of an IRES-Cre sequence and cloned it into the non-coding
region of the Ntsr1 or Ntsr2 genomic sequences; we refer to these as
108
NtsR1NEO-Cre and NtsR2NEO-Cre mice (Fig. 12). The frt-flanked NEO cassette blocks Cre
expression unless NEO is removed, thus NtsR1NEO-Cre and NtsR2NEO-Cre mice lack Cre
expression until exposure to FlpO.
To reveal cells that express NtsR1 and NtsR2 during development, we crossed
NtsR1NEO-Cre and NtsR2NEO-Cre mice to a FlpO deleter line, producing progeny that lack the frtflanked NEO cassette and thus produce Cre whenever NtsR1 or NtsR2 is transcribed
throughout the lifespan (NtsR1∆NEO-Cre and NtsR2∆NEO-Cre mice). The NtsR1∆NEO-Cre and
NtsR2∆NEO-Cre mice were subsequently bred to a Cre-inducible eGFP-L10a reporter line; in
progeny heterozygous for each allele, any cell that expresses NtsR1 or NtsR2 will undergo Cremediated recombination to express GFP. Notably, the recombination is permanent, so GFP
labeling persists even in cells that cease to express NtsR1 or NtsR2. This model enables us to
visualize any cells that expressed NtsR1 or NtsR2 from conception onward, and we refer to
these as NtsR1Dev;GFP and NtsR2Dev;GFP mice (Fig. 12A).
To study the adult expression pattern of NtsR1 and NtsR2, we bred NtsR1NEO-Cre and
NtsR2NEO-Cre mice to the Cre-inducible eGFP-L10a reporter. In this case, the progeny
(NtsR1NEO-Cre;GFP and NtsR2NEO-Cre;GFP) carry the GFP allele, but no reporter is expressed
because the frt-flanked NEO cassette suppresses Cre expression. These mice were
maintained in our colony until they reached adulthood, then were injected with an adenovirus
expressing FlpO recombinase into the lateral ventricles to permit FlpO expression throughout
the adult brain. FlpO excises the frt-flanked NEO, which permits Cre-mediated GFP expression
only in cells that actively express NtsR1 or NtsR2, allowing us to visualize the adult expression
pattern of NtsR1 and NtsR2 (NtsR1Adult;GFP and NtsR2Adult;GFP) (Fig. 12B).
109
Distribution and Morphology of NtsR1 and NtsR2 in the VTA: Previously, identification of
NtsR1 and NtsR2 neurons has been challenging given the lack of reliable immunohistochemical
reagents to visualize them. The dual recombinase mouse models we generated, however,
enabled us to visualize the distributions of NtsR1 and NtsR2 in the VTA, and whether they
differed between developmental and adult stages. First, analysis of NtsR1Dev;GFP mice
revealed a wide-spread, dense population of GFP+ neurons in the VTA (Fig. 13A) and
throughout the brain (data not shown). Despite many GFP-labeled neurons, we ruled out the
possibility of ectopic expression via lack of GFP in regions that are thought to have minimal
NtsR1 expression at any point in life, including the interpeduncular nucleus (ip)40 (see ip in Fig.
13A). By contrast, NtsR1Adult;GFP mice had far fewer GFP+ neurons in general and were
primarily restricted to the VTA and SN (Fig. 13B). These findings are consistent with previous
work showing that central NtsR1 expression peaks during gestation, but subsequently
decreases and only remains prominent within the midbrain of adult rodents22,23.
Analysis of NtsR2-reporter mice revealed two morphologically distinct populations of
GFP-labeled cells in the VTA. A few GFP+ cells displayed clear neuronal features (Fig. 13C,
white arrows) but the vast majority of GFP-labeled cells in both developmental and adult models
were detected in cells with diffuse, stellate morphology indicative of glial cells (Fig. 13C). This
finding supports previous work suggesting that NtsR2 is expressed on astrocytes20,41,42.
Neuronal GFP expression was sparse in both NtsR2Dev;GFP and NtsR2Adult;GFP models but
slightly more neurons were detected in NtsR2Dev;GFP mice (Fig. 13C,D). When quantified, we
found that NtsR1-GFP+ neurons outnumber NtsR2-GFP+ neurons approximately 18 to 1 (Fig.
13E). While the total number of NtsR1-GFP+ neurons in adult animals is about half of that
observed in the developmental model, adult NtsR1-GFP+ neurons outnumber NtsR2-GFP+
neurons by 60 to 1 (Fig. 13F). Collectively, these data indicate that NtsR1 is the predominant
isoform expressed on VTA neurons in development and adulthood, while NtsR2 is primarily
110
expressed on cells with glial morphology. Furthermore, our findings reveal that many cells
express NtsR1 and NtsR2 at some stage of development, but in the adult brain, NtsR1
expression is confined to a subset of VTA cells.
NtsR1 is the Predominant Isoform on VTA DA Neurons: To define the neurochemical
phenotype of NtsR1 and NtsR2 neurons, we examined VTA sections from the adult and
developmental mouse models via immunofluorescence for tyrosine-hydroxylase (TH), the ratelimiting enzyme in catecholamine synthesis and a marker of DA neurons. This analysis
revealed that nearly all (~98%) of VTA DA neurons express NtsR1 at some point in
development (Fig. 14A, E), while about two thirds (~70%) of DA neurons actively co-express
NtsR1 in adulthood (Fig. 14B, F). Interestingly, many TH-negative VTA neurons co-expressed
NtsR1 in the developmental model (~30% of NtsR1-GFP+ neurons) but not the adult model
(Fig. 14G, H). Thus during development NtsR1 is expressed in, and presumably regulates, both
DA and other VTA neurons, but only mediates Nts actions in the adult brain via DA neurons. By
contrast, the majority of the small population of NtsR2-GFP+ neurons in the developmental and
adult models did not colocalize with TH (Fig. 14C, D, E, F) and NtsR2-GFP expression was
found on only 6.5% of DA neurons in NtsR2Dev;GFP mice and <1% of DA neurons in
NtsR2Adult;GFP mice (Fig. 14G, H). Taken together, these data support the hypothesis that
NtsR1 is the dominant isoform regulating VTA DA neurons in both development and adulthood,
and suggests that NtsR1 may also modulate non-DA neurons in the VTA during development.
Projections of VTA NtsR1 Neurons: Given that NtsR1 was expressed on some, but not
all VTA DA neurons in adult mice, we investigated whether NtsR1 defined the subset of VTA DA
neurons that project to the NA or the prefrontal cortex (PFC)43, two major outputs of VTA DA
neurons. To do this, we injected adult NtsR1∆NEO-Cre;GFP mice in the VTA with the Cremediated tract tracer Ad-syn-mCherry27 (Fig. 15A). In these brains, GFP identifies any cell that
111
expressed NtsR1 throughout lifespan, but only cells that actively express NtsR1 can undergo
Cre-mediated recombination to express both GFP and the synaptophysin-mCherry fusion
protein within cell bodies and terminals27. Thus, this method allows us to discriminate cells that
only expressed NtsR1 during development from the adult cells that currently express NtsR1 and
can mediate DA release. Visualization of the VTA revealed that nearly all mCherry+ neurons
co-expressed GFP, however many GFP+ neurons within the injection site did not co-express
mCherry (Fig. 15B, yellow arrows). These findings are consistent with our detection of almost
twice as many NtsR1-GFP+ neurons in NtsR1Dev;GFP mice compared to NtsR1Adult;GFP mice
(Fig. 12E, F) and confirms that NtsR1 expression, and hence induction of Cre, is confined to a
limited set of VTA neurons in the adult brain. Out of 5 injected mice, 3 had mCherry-labeling
confined to the VTA and were used for analysis (Fig. 15C). We also injected Ad-syn-mCherry
into the VTA of NtsR2∆NEO-Cre;GFP mice to verify the minor population NtsR2 neurons in the
adult brain and define their projections. In contrast to the numerous mCherry-labeled neurons
observed in NtsR1∆NEO-Cre;GFP mice (Fig. 15D), examination of NtsR2∆NEO-Cre;GFP mice
revealed mCherry+ cells with predominantly stellate morphology in the VTA. This small
population of VTA NtsR2 neurons provided <10 single terminals observed throughout the entire
brain, including a minor projection to the NA and IPAC (Fig. 15 E, white arrows). These data
confirm the dearth of NtsR2-expressing neurons in the adult VTA (Fig. 12F) and support a
predominant role for NtsR1 in directly modifying VTA DA signaling.
Analysis of the projections from the well-targeted NtsR1∆NEO-Cre;GFP mice is summarized
in Fig. 16M. VTA NtsR1 neurons most densely project to sub-regions of the ventral striatum,
including the NA core (NAc), NA shell (NAsh), and olfactory tubercle (OFT) (Fig. 16A, B, C). By
contrast, the lack of terminals in the PFC implicates VTA NtsR1 neurons in regulating
mesolimbic, but not mesocortical, DA signaling (Fig. 16D)43. We also observed dense VTA
NtsR1 terminals within the interstitial nucleus of the posterior limb of the anterior commissure
112
(IPAC) and modest terminals in the neighboring stria terminals (ST) (Fig. 16F). The caudate
putamen (CPu) contained sparse VTA NtsR1 terminals (Fig. 16E), consistent with the VTA
providing less input to the dorsal striatum compared to SN43,44. A few mCherry-labeled
terminals were observed in the ventral pallidum (VP) (Fig. 16G) and the central amygdala (CeA)
(Fig. 16H), where DA release is associated with emotional learning and feeding45-48. While we
detected few terminals within the lateral hypothalamus (LHA), the dense patch of mCherry+
fibers in the neighboring nigrostriatal tract likely represents VTA NtsR1 axons traversing the
brain en route to the striatum (Fig. 16J, see nigrostriatal tract (ns)). Intriguingly, the lateral
habenula (LHb) also contained many mCherry-labeled terminals (Fig. 16I), although VTA
neurons projecting to the LHb do not release DA and instead inhibit the LHb to indirectly
promote reward49. We also observed low to medium terminal density in the hindbrain, namely in
the laterodorsal tegmental nucleus (LDTg) (Fig. 16K), the parabrachial nucleus (PBN) (Fig.
16L), and the dorsal raphe (DR) (Fig. 16M).
3.4 Discussion
Here, we used dual recombinase mice to identify NtsR1 and NtsR2 cells in the VTA to
establish the precise cellular mediators of Nts action. We demonstrate that NtsR2 is
predominately expressed on glial cells and only a small number of both DA and non-DAergic
neurons throughout life. By contrast, NtsR1 is expressed on many VTA DA neurons during both
development and adulthood. Furthermore, VTA NtsR1 neurons project to the ventral striatum,
not the PFC, and hence are positioned to specifically modify mesolimbic DA signaling. Thus,
our data are the first to demonstrate NtsR1 as the predominant receptor isoform by which Nts
can directly engage DA neurons to modify DA-dependent signaling and physiology.
Our findings provide cellular resolution that will be essential to understand how Nts
mechanistically acts in the VTA. Consistent with our finding of NtsR1 expression on some VTA
113
DA neurons, the application of Nts or Nts analogues into the VTA activates DA neurons,
increases NA DA release, restrains food intake, and promotes reward behaviors, and these
effects are reduced by NtsR1 antagonists or developmental deletion of NtsR11,25,26,28,29.
Similarly, Bose et al. suggested that Nts enhances excitatory input onto VTA DA neurons via
NtsR150. However, not all studies using pharmacological agents or receptor null mice have
supported a predominant role for NtsR1 in directly modulating VTA DA signaling. For example,
Kempadoo et al. found that low doses of intra-VTA Nts increased excitatory transmission to DA
neurons via NtsR1, while high doses of Nts reduced excitatory input through an NtsR1independent mechanism, implying involvement of NtsR229. Similarly, Rouibi et al. reported that
Nts action in the VTA reduces excitatory input to DA neurons via an NtsR1-independent
mechanism, again suggesting involvement of NtsR228. Our finding that <1% of adult VTA DA
neurons co-express NtsR2 suggest it is unlikely that Nts directly modulates most DA neurons
via NtsR2. One possible mechanism to resolve these discrepancies arises from our finding that
NtsR2 is predominantly expressed on astrocytes, which might act via tripartite synapses to
mediate local regulation of DA neurons51. Going forward, the ability to identify NtsR1 and NtsR2
cells will permit direct testing of how Nts engages these cells to orchestrate DA signaling.
Previously, NtsR expression was characterized using in situ hybridization (ISH), which
labels mRNA but does not always provide sufficient signal to visualize morphologic features of
the cell in which the transcript is expressed. An advantage of the dual recombinase strategy we
used to identify NtsR-expressing cells is that Cre-induced GFP fills the entire cell, which allowed
us to clearly distinguish between neuronal and glial morphologies. We were thus able to
discern that most NtsR2 is expressed by glial cells throughout the brain, consistent with the
diffuse, low intensity signal observed via ISH for Ntsr29,19,21,52. Similarly, cultured astrocytes
express NtsR220,41,42 and Nts modulates their activity53,54. Interestingly, because astrocytes also
express endopeptidases that catabolize Nts55-57, they might act as a sink to internalize and
114
degrade residual Nts at the synapse via NtsR2. Loss of NtsR2 signaling, as in NtsR2-null mice,
could therefore lead to excess synaptic Nts and enhanced Nts-NtsR1 activation of VTA DA
neurons, which may explain their increased striatal DA levels and hyperactivity35.
VTA DA neurons are heterogeneous and have been defined by their projection targets
(see 58,59 for review). We found that VTA NtsR1 neurons comprise ~70% of VTA DA neurons
and project primarily to the NA, OFT, and IPAC, but not to other efferent targets of VTA NA
neurons such as the PFC or hippocampus43. Given that VTA NtsR1 neurons are mesolimbic,
they are likely to modulate the reinforcing properties of natural and pharmacologic rewards,
which depend upon DA release to the NA60-62 63,64. Furthermore, our current data provides a
cellular and circuit mechanism to explain how Nts signaling directly via VTA NtsR1 neurons can
increase NA DA release and mediate conditioned reward12,28,29,65-69. The functional implications
of the VTA NtsR1 projections to the IPAC are less clear. The IPAC is structurally related to the
amygdala70, and DA release in the amygdala has been implicated in emotional learning46-48 and
in regulation of food intake45. Finally, we noted several VTA NtsR1 projections to the LHb, a
structure that mediates aversion. However, TH+ neurons that project to the LHb do not release
DA, but rather inhibit the LHb, which then disinhibits VTA DA neurons49. Thus, the TH+ VTA
projections to the LHb, including NtsR1-expressing neurons, may indirectly support reward
rather than aversion. Overall, VTA NtsR1 neurons project to regions that can modify reward
intake, suggesting that Nts action via the VTA may be necessary to drive pursuit of
pharmacological and natural rewards, such as food.
A limitation of the developmental NtsR1∆NEO-Cre;GFP and NtsR2∆NEO-Cre;GFP models we
developed is that GFP expression does not necessarily reflect cells with active NtsR1 or NtsR2
expression. Inducing Cre expression from the beginning of embryonic development in the
developmental models leads to permanent GFP expression in all cells that expressed NtsR1 or
115
NtsR2 at any point in life. Comparing findings from developmental to adult models however,
can inform how NtsR expression patterns change through life. For example, essentially all VTA
DA neurons colocalize with GFP in NtsR1Dev;GFP mice whereas only ~70% colocalize in
NtsR1Adult;GFP mice. These data imply that at some point in development ~30% of DA neurons
transiently expressed NtsR1, but do not identify when they cease expressing NtsR1. Inducing
FlpO expression at discrete time points across development will be required to define the
temporal dynamics of NtsR1 expression. This could be accomplished by breeding mice to a
tamoxifen-inducible FlpO deleter line, whereby injection of tamoxifen would induce Cre
expression at any desired point in development71 to label cells actively expressing NtsR1.
While NtsR1 is robustly expressed on VTA DA neurons throughout life, our NtsR1NEO-Cre;
GFP models do not distinguish between neurons that express NtsR1 on the soma/dendrites vs.
synaptic terminals. The subcellular localization of NtsR1 is functionally important because NtsNtsR1 signaling elicits different behavioral effects via either pre- or post-synaptic mechanisms.
Nts-NtsR1 signaling on DA cell bodies in the VTA increases DA release and locomotor activity
similar to psychostimulants12,65-67,72,73. By contrast, Nts-NtsR1 action in the NA suppresses
locomotor activity induced by AMPH, cocaine, and DA itself, similar to antipsychotic
medications74-76, and is thought to be mediated by NtsR1 expressed pre-synaptically on DA
terminals in the striatum. Studies using immunohistochemistry and autoradiography suggest
that NtsR1 binding sites are present on DA terminals in the ventral and dorsal striatum77-79.
Furthermore, radiolabeled Nts injected in to the striatum accumulates in the cell bodies of VTA
DA neurons80-82, indicating that Nts binds DA neurons at presynaptic terminals and is
internalized. Collectively, VTA Nts-NtsR1 signaling appears to have opposing behavioral
outcomes depending on whether it occurs pre- or post-synaptically, and this should be taken
into account when interpreting future data from NtsR1NEO-Cre mice.
116
Our work indicates vast expression of NtsR1 throughout the brain in NtsR1Dev;GFP mice,
and a heretofore unappreciated potential role for Nts to mediate development of the central
nervous system. Within the VTA, NtsR1Dev;GFP mice showed nearly 100% of VTA DA neurons
colocalizing with GFP, which represented ~65% of all GFP+ neurons. Curiously, this is similar
to the overall distribution of DA and non-DA neurons in adults (~65% TH+, 35% TH-)58 and
suggests that at some point in life, almost every VTA neuron, both DA and non-DAergic,
expresses NtsR1. Nts-NtsR1 signaling may thus play a critical role in establishing VTA circuits
during development. Mice null for NtsR1 may therefore suffer from abnormal formation of the
VTA DA system that causes aberrant DA signaling, locomotor activity, body weight, anxiety,
sleep, and exaggerated response to psychostimulants that has been reported to occur in this
line1,2,27,35,36. Our data also identify a substantial population of VTA NtsR1 neurons that persist
in the adult brain, and hence signify roles for Nts signaling via NtsR1 in regulating normal
physiology. Going forward, using NtsR1NEO-Cre mice will permit selective manipulation of the
VTA NtsR1 neurons in the adult brain to discern how they contribute to DA signaling, physiology
and behavior.
3.5 Methods
Generation of NtsR1NEO-Cre and NtsR2NEO-Cre Knock-In Mice: NtsR1NEO-Cre and
NtsR2NEO-Cre targeting vectors were generated by inserting an IRES-Cre between the stop
codon and the polyadenylation site of the sequence encoding the 3’ end of the mouse Ntsr1
gene, with an frt-flanked NEO cassette placed upstream of the IRES-Cre. The linearized
targeting vector was electroporated into mouse R1 embryonic stem (ES) cells (129sv
background) and cells were selected with G418. DNA from ES cell clones was analyzed via
qPCR for loss of homozygosity using Taqman primer and probes for the genomic Ntsr1 or Ntsr2
insertion sites (NtsR1: Forward: TCTGATGTTGGACTTGGGTTC, Reverse:
TCTGATGTTGGACTTGGGTTC, Probe: TCTGATGTTGGACTTGGGTTC. NtsR2: Forward:
117
ACCCATCAGATAAGCCATGC, Reverse: GTGGGAAGTTGAGGGCAG, Probe:
GTCTAAGCGGACCTACTGACCCA). NGF was used as a copy number control83. Putative
positive ES clones were expanded, confirmed for homologous recombination by Southern blot
and injected into mouse C57BL/6 blastocysts to generate chimeras. Chimeric males were
mated with C57BL/6 females (Jackson Laboratory), and germline transmission was determined
initially via progeny coat color, then confirmed via conventional PCR for IRES-Cre.
Breeding and Genotyping: Mice were bred and housed in a 12h light/12h dark cycle with
ad libitum access to water and food (Harlan Teklad #7913). All procedures were approved by
the Institutional Animal Care and Use Committee (IACUC) at Michigan State University.
Heterozygous NtsR1NEO-Cre and NtsR2NEO-Cre mice were bred to either FlpO deleter mice (Jax
Stock #012930), a Cre-inducible RosaeGFP-L10a reporter84, or C57/Bl6 wild-type mice to maintain
the lines. Developmental Model: NtsR1NEO-Cre and NtsR2NEO-Cre mice were bred to a FlpO
deleter line and progeny that inherited the FlpO allele (NtsR1∆NEO-Cre and NtsR2∆NEO-Cre) were
subsequently mated to a Cre-inducible RosaeGFP-L10a reporter, generating NtsR1Dev;GFP and
NtsR2Dev;GFP mice. Progeny that were heterozygous for both IRES-Cre and GFP alleles were
used for analysis. Adult Model: NtsR1NEO-Cre and NtsR2NEO-Cre mice were mated directly to Creinducible RosaeGFP-L10a animals, producing heterozygous NtsR1NEO-Cre;GFP and NtsR2NEOCre
;GFP progeny. These animals were then injected with FlpO adenovirus in adulthood (see
below) to generate NtsR1Adult;GFP and NtsR2Adult;GFP study mice. All animals were genotyped
by standard PCR using the following primer sequences: IRES-Cre: Forward:
GGACGTGGTTTTCCTTTGAA. Reverse: AGGCAAATTTTGGTGTACGG. Rosa26EGFP-L10a :
Mutant forward: TCTACAAATGTGGTAGATCCAGGC, WT forward:
GAGGGGAGTGTTGCAATACC, Common: CAGATGACTACCTATCCTCCC. FlpO: Mutant:
GCGAAGAGTTTGTCCTCAACC, Common: GCG AAG AGT TTG TCC TCA ACC, Wild-type:
GGAGCGGGAGAAATGGATATG. Adult male and female mice of each model were studied.
118
Surgery: Adult NtsR1Adult;GFP and NtsR2Adult;GFP mice received a pre-surgical injection
of carprofen (5mg/kg s.c.) and were anesthetized with 3-4% isoflurane/O2 in an induction
chamber before being placed in a stereotaxic frame (Kopf). Under 1-2% isoflurane, access
holes were drilled in the skull allowing a guide cannula with stylet (PlasticsOne) to be lowered
into the lateral ventricles (A/P: -0.22, M/L: +/- 1.0, D/V: -2.0). Mice were bilaterally injected with
1µL FlpO adenovirus (Vector Biolabs), which was infused at a rate of 1µL/minute. The animals
recovered for 10 days prior to perfusion to permit sufficient time for FlpO-mediated excision of
the frt-flanked NEO cassette and GFP expression. For tracing studies, NtsR1∆NEO-Cre;GFP mice
were injected unilaterally in the VTA (A/P: -3.2, M/L: +/-0.48, D/V: -4.65) with 75-100nL of Adsyn-mCherry, an adenovirus expressing a Cre-dependent synaptophysin-mCherry fusion
protein27 (provided by Martin Myers, University of Michigan). Mice recovered for 7-10 days after
surgery to allow for Cre-mediated recombination and synaptophysin-mCherry expression at presynaptic terminals.
Perfusion and Immunofluorescence: Mice were treated with a lethal dose of i.p.
pentobarbital followed by transcardial perfusion with 10% neutral-buffered formalin (Fisher
Scientific). Brains were removed, post-fixed in 10% formalin overnight at 4˚C, dehydrated with
30% sucrose in PBS for 2-3 days, and sectioned into 30 µm slices using a sliding microtome
(Leica). Brain sections were then analyzed by immunofluorescence or immunohistochemistry
as previously described27,37. For characterization of NtsR1 and NtsR2 expression, sections
were exposed to chicken anti-GFP (1:2000, Abcam) and mouse anti-TH (1:1000, Millipore),
followed by incubation with species-specific secondary antibodies conjugated to AlexaFluor 488
or 568 fluorophores (Life Technologies or Jackson ImmunoResearch). Brains were analyzed
using an Olympus BX53 fluorescence microscope outfitted with FITC and Texas Red filters.
Microscope images were collected using Cell Sens software and a Qi-Click 12 Bit cooled
camera, and images were analyzed using Photoshop software (Adobe). Five representative
119
sections spanning the entire VTA were selected from each mouse and were used to determine
the number and colocalization of GFP and/or TH positive neurons.
Statistics. All data were analyzed in Prism 6 (GraphPad) using unpaired t-tests. Bar
graphs represent mean ± SEM.
120
APPENDIX
121
Figure 12. Generation of mouse models to identify developmental vs. adult expression
patterns of NtsR1 and NtsR2.
122
Figure 12 (cont’d). A) Schematic demonstrating how constitutive Cre expression is induced in
NtsR1Neo-Cre mice, resulting in GFP labeling of any neuron that expresses NtsR1 throughout the
lifespan (NtsR1Dev model). B) Schematic depiction of how Cre expression is suppressed until
adulthood in NtsR1Neo-Cre mice, resulting in GFP labeling restricted to cells actively expressing
NtsR1 in adult animals (NtsR1Adult model). *The same strategies depicted in A-B were used in
NtsR2Neo-Cre mice.
Figure 13. Developmental vs. adult expression of NtsR1 and NtsR2 in the VTA.
NtsR1NEO-Cre and NtsR2NEO-Cre mice were bred to a Cre-inducible GFP reporter line and Cre
expression was induced constitutively from conception (developmental expression) or only in
adulthood. A-B) Developmental and adult distributions of NtsR1 neurons. C-D) Developmental
and adult distributions of NtsR2 neurons. GFP+ cells have either neuronal (white arrows) or
glial morphology. ip=interpeduncular nucleus, ml=medial lemniscus. Scale bars represent 200
µm. Insets are digital enlargements of the areas within dashed boxes. E, F) Total number of
GFP+ NtsR1 or NtsR2 neurons in developmental and adult models in the VTA (NtsR1Dev n=3,
NtsR2Dev n=3, NtsR1Adult n=3, NtsR2Adult n=6). Each bar represents mean ± SEM and data were
analyzed by unpaired t-tests.
123
Figure 14. NtsR1 and NtsR2 colocalization with TH in development compared to
adulthood.
124
Figure 14 (cont’d). Representative images showing TH co-expression in the VTA with A)
developmental NtsR1-GFP+ neurons, B) adult NtsR1-GFP+ neurons, C) developmental NtsR2GFP+ neurons D) adult NtsR2-GFP+ neurons. Yellow arrows = TH/GFP+ colocalized neurons,
green arrows = GFP+ only neurons, pink arrows = TH+ only neurons, green asterisks = GFP+
glia. Scale bars=100µm. ml=medial lemniscus, ip=interpeduncular nucleus. Insets are digital
enlargements of the indicated boxed areas. Percentage of NtsR1 and NtsR2 neurons that
colocalize with TH in E) developmental and F) adult expression models. Percentage of all VTA
TH+ neurons that colocalize with NtsR1 or NtsR2 in G) developmental and H) adult models.
(NtsR1Dev n=3; NtsR2Dev n=3; NtsR1Adult n=3; NtsR2Adult n=6). Bars represent mean ± SEM and
data were analyzed by unpaired t-tests.
125
Figure 15. Ad-syn-mCherry reveals projections of VTA NtsR1 neurons. A) Schematic
showing NtsR1∆NEO-Cre;GFP mice injected in the VTA with Ad-syn-mCherry, which labels VTA
NtsR1 projections by expression of a Cre-inducible synaptophysin-mCherry fusion protein. B)
VTA of NtsR1∆NEO-Cre;GFP mouse injected with Ad-syn-mCherry showing GFP+ neurons that do
not co-express mCherry (yellow arrows), representing neurons that transiently expressed NtsR1
during development. C) Distribution of mCherry+ cell bodies within the VTA from 3 individual
NtsR1∆NEO-Cre;GFP mice, confirming selective labeling of VTA NtsR1 neurons. Comparison of
VTA injection site and mCherry labeled terminals in the NAc and IPAC of D) NtsR1∆NEO-Cre;GFP
mice vs. E) NtsR2∆NEO-Cre;GFP mice. Scale bars represent 100µm. ml=medial lemniscus,
ip=interpeduncular nucleus, aca=anterior commissure.
126
Figure 16. Projections of VTA NtsR1 neurons.
127
Figure 16 (cont’d). Ad-syn-mCherry-labeled terminals in the A) nucleus accumbens core
(NAc), B) nucleus accumbens shell (NAsh), C) olfactory tubercle (OFT), D) absence of
terminals in the prefrontal cortex (PFC), E) caudate/putamen (CPu), F) IPAC and stria terminals
(ST), G) ventral pallidum (VP), H) central amygdala (CeA), I) lateral habenula (LHb), J) lateral
hypothalamic area (LHA), K) laterodorsal tegmentum (LDTg), L) parabrachial nucleus (PBN).
M) Schematic summarizing projections of VTA NtsR1 neurons (purple stars). Scale bars
represent 100µm. aca=anterior commissure, cc=corpus callous, BLA=basolateral amygdala,
3V= third ventricle, ns= nigrostriatal tract, f=fornix, 4V=fourth ventricle, scp=superior cerebellar
peduncle.
128
REFERENCES
129
REFERENCES
1
Remaury, A. et al. Targeted inactivation of the neurotensin type 1 receptor reveals its
role in body temperature control and feeding behavior but not in analgesia. Brain
research 953, 63-72 (2002).
2
Fitzpatrick, K. et al. Altered sleep and affect in the neurotensin receptor 1 knockout
mouse. Sleep 35, 949-956, doi:10.5665/sleep.1958 (2012).
3
Kleczkowska, P. & Lipkowski, A. W. Neurotensin and neurotensin receptors:
characteristic, structure-activity relationship and pain modulation--a review. European
journal of pharmacology 716, 54-60, doi:10.1016/j.ejphar.2013.03.004 (2013).
4
Bissette, G., Luttinger, D., Mason, G. A., Hernandez, D. E. & Loosen, P. T. Neurotensin
and thermoregulation. Annals of the New York Academy of Sciences 400, 268-282
(1982).
5
Boules, M. M., Fredrickson, P., Muehlmann, A. M. & Richelson, E. Elucidating the role of
neurotensin in the pathophysiology and management of major mental disorders.
Behavioral sciences (Basel, Switzerland) 4, 125-153, doi:10.3390/bs4020125 (2014).
6
Caceda, R., Kinkead, B. & Nemeroff, C. B. Neurotensin: role in psychiatric and
neurological diseases. Peptides 27, 2385-2404, doi:10.1016/j.peptides.2006.04.024
(2006).
7
Tanaka, K., Masu, M. & Nakanishi, S. Structure and functional expression of the cloned
rat neurotensin receptor. Neuron 4, 847-854 (1990).
8
Vita, N. et al. Cloning and expression of a complementary DNA encoding a high affinity
human neurotensin receptor. FEBS letters 317, 139-142 (1993).
9
Mazella, J. et al. Structure, functional expression, and cerebral localization of the
levocabastine-sensitive neurotensin/neuromedin N receptor from mouse brain. The
Journal of neuroscience : the official journal of the Society for Neuroscience 16, 56135620 (1996).
10
Chalon, P. et al. Molecular cloning of a levocabastine-sensitive neurotensin binding site.
FEBS letters 386, 91-94 (1996).
11
Mazella, J. et al. The 100-kDa neurotensin receptor is gp95/sortilin, a non-G-proteincoupled receptor. The Journal of biological chemistry 273, 26273-26276 (1998).
12
St-Gelais, F., Legault, M., Bourque, M. J., Rompre, P. P. & Trudeau, L. E. Role of
calcium in neurotensin-evoked enhancement in firing in mesencephalic dopamine
neurons. The Journal of neuroscience : the official journal of the Society for
Neuroscience 24, 2566-2574, doi:10.1523/jneurosci.5376-03.2004 (2004).
130
13
Vita, N. et al. Neurotensin is an antagonist of the human neurotensin NT2 receptor
expressed in Chinese hamster ovary cells. European journal of pharmacology 360, 265272 (1998).
14
Alexander, M. J. & Leeman, S. E. Widespread expression in adult rat forebrain of mRNA
encoding high-affinity neurotensin receptor. The Journal of comparative neurology 402,
475-500 (1998).
15
Elde, R., Schalling, M., Ceccatelli, S., Nakanishi, S. & Hokfelt, T. Localization of
neuropeptide receptor mRNA in rat brain: initial observations using probes for
neurotensin and substance P receptors. Neuroscience letters 120, 134-138 (1990).
16
Nicot, A., Rostene, W. & Berod, A. Neurotensin receptor expression in the rat forebrain
and midbrain: a combined analysis by in situ hybridization and receptor autoradiography.
The Journal of comparative neurology 341, 407-419, doi:10.1002/cne.903410310
(1994).
17
Lein, E. S. et al. Genome-wide atlas of gene expression in the adult mouse brain. Nature
445, 168-176, doi:10.1038/nature05453 (2007).
18
Sarret, P., Perron, A., Stroh, T. & Beaudet, A. Immunohistochemical distribution of NTS2
neurotensin receptors in the rat central nervous system. The Journal of comparative
neurology 461, 520-538, doi:10.1002/cne.10718 (2003).
19
Walker, N. et al. Tissue distribution and cellular localization of the levocabastinesensitive neurotensin receptor mRNA in adult rat brain. Brain research. Molecular brain
research 57, 193-200 (1998).
20
Nouel, D. et al. Differential binding profile and internalization process of neurotensin via
neuronal and glial receptors. The Journal of neuroscience : the official journal of the
Society for Neuroscience 17, 1795-1803 (1997).
21
Sarret, P., Beaudet, A., Vincent, J. P. & Mazella, J. Regional and cellular distribution of
low affinity neurotensin receptor mRNA in adult and developing mouse brain. The
Journal of comparative neurology 394, 344-356 (1998).
22
Lepee-Lorgeoux, I., Betancur, C., Rostene, W. & Pelaprat, D. Differential ontogenetic
patterns of levocabastine-sensitive neurotensin NT2 receptors and of NT1 receptors in
the rat brain revealed by in situ hybridization. Brain research. Developmental brain
research 113, 115-131 (1999).
23
Palacios, J. M., Pazos, A., Dietl, M. M., Schlumpf, M. & Lichtensteiger, W. The ontogeny
of brain neurotensin receptors studied by autoradiography. Neuroscience 25, 307-317
(1988).
24
Pettibone, D. J. et al. The effects of deleting the mouse neurotensin receptor NTR1 on
central and peripheral responses to neurotensin. The Journal of pharmacology and
experimental therapeutics 300, 305-313 (2002).
131
25
Leonetti, M. et al. Specific involvement of neurotensin type 1 receptor in the neurotensinmediated in vivo dopamine efflux using knock-out mice. Journal of neurochemistry 89, 16, doi:10.1046/j.1471-4159.2003.02231.x (2004).
26
Kim, E. R., Leckstrom, A. & Mizuno, T. M. Impaired anorectic effect of leptin in
neurotensin receptor 1-deficient mice. Behavioural brain research 194, 66-71,
doi:10.1016/j.bbr.2008.06.024 (2008).
27
Opland, D. et al. Loss of neurotensin receptor-1 disrupts the control of the mesolimbic
dopamine system by leptin and promotes hedonic feeding and obesity. Molecular
metabolism 2, 423-434, doi:10.1016/j.molmet.2013.07.008 (2013).
28
Rouibi, K., Bose, P., Rompre, P. P. & Warren, R. A. Ventral Midbrain NTS1 Receptors
Mediate Conditioned Reward Induced by the Neurotensin Analog, D-Tyr[11]neurotensin.
Frontiers in neuroscience 9, 470, doi:10.3389/fnins.2015.00470 (2015).
29
Kempadoo, K. A. et al. Hypothalamic neurotensin projections promote reward by
enhancing glutamate transmission in the VTA. The Journal of neuroscience : the official
journal of the Society for Neuroscience 33, 7618-7626, doi:10.1523/jneurosci.258812.2013 (2013).
30
Maeno, H. et al. Comparison of mice deficient in the high- or low-affinity neurotensin
receptors, Ntsr1 or Ntsr2, reveals a novel function for Ntsr2 in thermal nociception. Brain
research 998, 122-129 (2004).
31
Roussy, G. et al. Altered morphine-induced analgesia in neurotensin type 1 receptor null
mice. Neuroscience 170, 1286-1294, doi:10.1016/j.neuroscience.2010.08.016 (2010).
32
Botto, J. M., Guillemare, E., Vincent, J. P. & Mazella, J. Effects of SR 48692 on
neurotensin-induced calcium-activated chloride currents in the Xenopus oocyte
expression system: agonist-like activity on the levocabastine-sensitive neurotensin
receptor and absence of antagonist effect on the levocabastine insensitive neurotensin
receptor. Neuroscience letters 223, 193-196 (1997).
33
Yamada, M., Yamada, M., Lombet, A., Forgez, P. & Rostene, W. Distinct functional
characteristics of levocabastine sensitive rat neurotensin NT2 receptor expressed in
Chinese hamster ovary cells. Life sciences 62, PL 375-380 (1998).
34
Thomas, J. B. et al. Identification of 2-(306amino)tricyc lo[3.3.1.13,7]decane-2-carboxylic
Acid (NTRC-844) as a Selective Antagonist for the Rat Neurotensin Receptor Type 2.
ACS chemical neuroscience 7, 1225-1231, doi:10.1021/acschemneuro.6b00097 (2016).
35
Liang, Y. et al. Hyperactivity of the dopaminergic system in NTS1 and NTS2 null mice.
Neuropharmacology 58, 1199-1205, doi:10.1016/j.neuropharm.2010.02.015 (2010).
36
Li, Z., Liang, Y., Boules, M., Gordillo, A. & Richelson, E. Effect of amphetamine on
extracellular concentrations of amino acids in striatum in neurotensin subtype 1 and 2
receptor null mice: a possible interaction between neurotensin receptors and amino acid
systems for study of schizophrenia. Neuropharmacology 58, 1174-1178,
doi:10.1016/j.neuropharm.2010.02.016 (2010).
132
37
Leinninger, G. M. et al. Leptin action via neurotensin neurons controls orexin, the
mesolimbic dopamine system and energy balance. Cell metabolism 14, 313-323,
doi:10.1016/j.cmet.2011.06.016 (2011).
38
Vong, L. et al. Leptin action on GABAergic neurons prevents obesity and reduces
inhibitory tone to POMC neurons. Neuron 71, 142-154,
doi:10.1016/j.neuron.2011.05.028 (2011).
39
Krashes, M. J. et al. Rapid, reversible activation of AgRP neurons drives feeding
behavior in mice. The Journal of clinical investigation 121, 1424-1428,
doi:10.1172/jci46229 (2011).
40
Geisler, S., Berod, A., Zahm, D. S. & Rostene, W. Brain neurotensin, psychostimulants,
and stress--emphasis on neuroanatomical substrates. Peptides 27, 2364-2384,
doi:10.1016/j.peptides.2006.03.037 (2006).
41
Nouel, D., Sarret, P., Vincent, J. P., Mazella, J. & Beaudet, A. Pharmacological,
molecular and functional characterization of glial neurotensin receptors. Neuroscience
94, 1189-1197 (1999).
42
Yamauchi, R. et al. Neurotensin type 2 receptor is involved in fear memory in mice.
Journal of neurochemistry 102, 1669-1676, doi:10.1111/j.1471-4159.2007.04805.x
(2007).
43
Swanson, L. W. The projections of the ventral tegmental area and adjacent regions: a
combined fluorescent retrograde tracer and immunofluorescence study in the rat. Brain
research bulletin 9, 321-353 (1982).
44
Bentivoglio, M., van der Kooy, D. & Kuypers, H. G. The organization of the efferent
projections of the substantia nigra in the rat. A retrograde fluorescent double labeling
study. Brain research 174, 1-17 (1979).
45
Anderberg, R. H., Anefors, C., Bergquist, F., Nissbrandt, H. & Skibicka, K. P. Dopamine
signaling in the amygdala, increased by food ingestion and GLP-1, regulates feeding
behavior. Physiology & behavior 136, 135-144, doi:10.1016/j.physbeh.2014.02.026
(2014).
46
Darvas, M., Fadok, J. P. & Palmiter, R. D. Requirement of dopamine signaling in the
amygdala and striatum for learning and maintenance of a conditioned avoidance
response. Learning & memory (Cold Spring Harbor, N.Y.) 18, 136-143,
doi:10.1101/lm.2041211 (2011).
47
Rosenkranz, J. A. & Grace, A. A. Dopamine-mediated modulation of odour-evoked
amygdala potentials during pavlovian conditioning. Nature 417, 282-287,
doi:10.1038/417282a (2002).
48
Guarraci, F. A., Frohardt, R. J., Young, S. L. & Kapp, B. S. A functional role for
dopamine transmission in the amygdala during conditioned fear. Annals of the New York
Academy of Sciences 877, 732-736 (1999).
133
49
Stamatakis, A. M. et al. A unique population of ventral tegmental area neurons inhibits
the lateral habenula to promote reward. Neuron 80, 1039-1053,
doi:10.1016/j.neuron.2013.08.023 (2013).
50
Bose, P., Rompre, P. P. & Warren, R. A. Neurotensin enhances glutamatergic EPSCs in
VTA neurons by acting on different neurotensin receptors. Peptides 73, 43-50,
doi:10.1016/j.peptides.2015.08.008 (2015).
51
Perea, G., Navarrete, M. & Araque, A. Tripartite synapses: astrocytes process and
control synaptic information. Trends in neurosciences 32, 421-431,
doi:10.1016/j.tins.2009.05.001 (2009).
52
Asselin, M. L., Dubuc, I., Coquerel, A. & Costentin, J. Localization of neurotensin NTS2
receptors in rat brain, using. Neuroreport 12, 1087-1091 (2001).
53
Hosli, E., Stauffer, S. & Hosli, L. Autoradiographic and electrophysiological evidence for
the existence of neurotensin receptors on cultured astrocytes. Neuroscience 66, 627633 (1995).
54
Trudeau, L. E. Neurotensin regulates intracellular calcium in ventral tegmental area
astrocytes: evidence for the involvement of multiple receptors. Neuroscience 97, 293302 (2000).
55
Woulfe, J., Checler, F. & Beaudet, A. Light and Electron Microscopic Localization of the
Neutral Metalloendopeptidase EC 3.4.24.16 in the Mesencephalon of the Rat. The
European journal of neuroscience 4, 1309-1319 (1992).
56
Mentlein, R. & Dahms, P. Endopeptidases 24.16 and 24.15 are responsible for the
degradation of somatostatin, neurotensin, and other neuropeptides by cultivated rat
cortical astrocytes. Journal of neurochemistry 62, 27-36 (1994).
57
Vincent, B., Vincent, J. P. & Checler, F. Neurotensin and neuromedin N undergo distinct
catabolic processes in murine astrocytes and primary cultured neurons. European
journal of biochemistry 221, 297-306 (1994).
58
Morales, M. & Margolis, E. B. Ventral tegmental area: cellular heterogeneity, connectivity
and behaviour. Nature reviews. Neuroscience 18, 73-85, doi:10.1038/nrn.2016.165
(2017).
59
Juarez, B. & Han, M. H. Diversity of Dopaminergic Neural Circuits in Response to Drug
Exposure. Neuropsychopharmacology : official publication of the American College of
Neuropsychopharmacology 41, 2424-2446, doi:10.1038/npp.2016.32 (2016).
60
Hart, A. S., Rutledge, R. B., Glimcher, P. W. & Phillips, P. E. Phasic dopamine release in
the rat nucleus accumbens symmetrically encodes a reward prediction error term. The
Journal of neuroscience : the official journal of the Society for Neuroscience 34, 698704, doi:10.1523/jneurosci.2489-13.2014 (2014).
61
Fiorillo, C. D., Tobler, P. N. & Schultz, W. Discrete coding of reward probability and
uncertainty by dopamine neurons. Science (New York, N.Y.) 299, 1898-1902,
doi:10.1126/science.1077349 (2003).
134
62
Rutledge, R. B., Dean, M., Caplin, A. & Glimcher, P. W. Testing the reward prediction
error hypothesis with an axiomatic model. The Journal of neuroscience : the official
journal of the Society for Neuroscience 30, 13525-13536, doi:10.1523/jneurosci.174710.2010 (2010).
63
Lammel, S., Ion, D. I., Roeper, J. & Malenka, R. C. Projection-specific modulation of
dopamine neuron synapses by aversive and rewarding stimuli. Neuron 70, 855-862,
doi:10.1016/j.neuron.2011.03.025 (2011).
64
Lammel, S. et al. Input-specific control of reward and aversion in the ventral tegmental
area. Nature 491, 212-217, doi:10.1038/nature11527 (2012).
65
Kalivas, P. W., Burgess, S. K., Nemeroff, C. B. & Prange, A. J., Jr. Behavioral and
neurochemical effects of neurotensin microinjection into the ventral tegmental area of
the rat. Neuroscience 8, 495-505 (1983).
66
Legault, M., Congar, P., Michel, F. J. & Trudeau, L. E. Presynaptic action of neurotensin
on cultured ventral tegmental area dopaminergic neurones. Neuroscience 111, 177-187
(2002).
67
Sotty, F. et al. Comparative effects of neurotensin, neurotensin(8-13) and [DTyr(11)]neurotensin applied into the ventral tegmental area on extracellular dopamine in
the rat prefrontal cortex and nucleus accumbens. Neuroscience 98, 485-492 (2000).
68
Glimcher, P. W., Giovino, A. A. & Hoebel, B. G. Neurotensin self-injection in the ventral
tegmental area. Brain research 403, 147-150 (1987).
69
Glimcher, P. W., Margolin, D. H., Giovino, A. A. & Hoebel, B. G. Neurotensin: a new
'reward peptide'. Brain research 291, 119-124 (1984).
70
Gartner, U., Hartig, W., Riedel, A., Brauer, K. & Arendt, T. Immunocytochemical
evidence for the striatal nature of the rat lateral part of interstitial nucleus of the posterior
limb of the anterior commissure (IPAC). Journal of chemical neuroanatomy 24, 117-125
(2002).
71
Lao, Z., Raju, G. P., Bai, C. B. & Joyner, A. L. MASTR: a technique for mosaic mutant
analysis with spatial and temporal control of recombination using conditional floxed
alleles in mice. Cell reports 2, 386-396, doi:10.1016/j.celrep.2012.07.004 (2012).
72
Kalivas, P. W. & Duffy, P. Effect of acute and daily neurotensin and enkephalin
treatments on extracellular dopamine in the nucleus accumbens. The Journal of
neuroscience : the official journal of the Society for Neuroscience 10, 2940-2949 (1990).
73
Steinberg, R. et al. SR 48692, a non-peptide neurotensin receptor antagonist
differentially affects neurotensin-induced behaviour and changes in dopaminergic
transmission. Neuroscience 59, 921-929 (1994).
74
Kalivas, P. W., Nemeroff, C. B. & Prange, A. J., Jr. Neurotensin microinjection into the
nucleus accumbens antagonizes dopamine-induced increase in locomotion and rearing.
Neuroscience 11, 919-930 (1984).
135
75
Ervin, G. N., Birkemo, L. S., Nemeroff, C. B. & Prange, A. J., Jr. Neurotensin blocks
certain amphetamine-induced behaviours. Nature 291, 73-76 (1981).
76
Robledo, P., Maldonado, R. & Koob, G. F. Neurotensin injected into the nucleus
accumbens blocks the psychostimulant effects of cocaine but does not attenuate
cocaine self-administration in the rat. Brain research 622, 105-112 (1993).
77
Quirion, R., Chiueh, C. C., Everist, H. D. & Pert, A. Comparative localization of
neurotensin receptors on nigrostriatal and mesolimbic dopaminergic terminals. Brain
research 327, 385-389 (1985).
78
Dilts, R. P. & Kalivas, P. W. Autoradiographic localization of mu-opioid and neurotensin
receptors within the mesolimbic dopamine system. Brain research 488, 311-327 (1989).
79
Schotte, A. & Leysen, J. E. Autoradiographic evidence for the localization of high affinity
neurotensin binding sites on dopaminergic nerve terminals in the nigrostriatal and
mesolimbic pathways in rat brain. Journal of chemical neuroanatomy 2, 253-257 (1989).
80
Castel, M. N., Woulfe, J., Wang, X., Laduron, P. M. & Beaudet, A. Light and electron
microscopic localization of retrogradely transported neurotensin in rat nigrostriatal
dopaminergic neurons. Neuroscience 50, 269-282 (1992).
81
Castel, M. N., Malgouris, C., Blanchard, J. C. & Laduron, P. M. Retrograde axonal
transport of neurotensin in the dopaminergic nigrostriatal pathway in the rat.
Neuroscience 36, 425-430 (1990).
82
Faure, M. P., Nouel, D. & Beaudet, A. Axonal and dendritic transport of internalized
neurotensin in rat mesostriatal dopaminergic neurons. Neuroscience 68, 519-529
(1995).
83
Soliman, G. A. et al. A simple qPCR-based method to detect correct insertion of
homologous targeting vectors in murine ES cells. Transgenic research 16, 665-670,
doi:10.1007/s11248-007-9110-2 (2007).
84
Krashes, M. J. et al. An excitatory paraventricular nucleus to AgRP neuron circuit that
drives hunger. Nature 507, 238-242, doi:10.1038/nature12956 (2014).
136
Chapter 4. Neurotensin Receptor-1 Identifies a Subset of Ventral Tegmental
Dopamine Neurons that Coordinate Energy Balance
Authors: Hillary L. Woodworth, Hannah M. Batchelor, Bethany G. Beekly, Raluca Bugescu,
Juliette A. Brown, Gizem Kurt, Patrick M. Fuller, and Gina M. Leinninger
This chapter is a modified version of a manuscript accepted to Cell Reports.
4.1 Abstract
Dopamine (DA) neurons in the ventral tegmental area (VTA) are heterogeneous and
differentially direct ingestive and locomotor behaviors that impact energy balance. Identification
of which VTA DA neurons mediate behaviors that limit weight gain has been hindered, however,
by the lack of molecular markers to distinguish VTA DA populations. Here, we identified a
specific subset of VTA DA neurons that express neurotensin receptor-1 (NtsR1) and project to
the nucleus accumbens (NA). Genetically targeted ablation of VTA NtsR1 neurons uncouples
motivated feeding and physical activity, biasing behavior toward energy expenditure and
protecting mice from age-related and diet-induced weight gain. VTA NtsR1 neurons thus
represent the first molecularly defined subset of mesolimbic DA neurons that are essential for
the coordination of energy balance. Modulation of VTA NtsR1 neurons may therefore be useful
to promote behaviors that prevent the development of obesity.
4.2 Introduction
Obesity is caused by overconsumption of calorie-dense food combined with insufficient
physical activity, and predisposes individuals to myriad chronic conditions that shorten life span.
Proper diet and exercise are important for maintaining healthy weight but these lifestyle
modifications are difficult to maintain long-term. Consequently, most individuals that lose weight
137
through changes in diet and activity tend to regain it over time1. Therapeutic strategies to
suppress feeding and encourage physical activity would therefore be helpful to prevent weight
gain and combat the obesity epidemic.
The motivated feeding and locomotor behaviors that influence body weight are
regulated, in part, by dopamine (DA) neurons in the ventral tegmental area (VTA) that release
DA within the nucleus accumbens (NA) and prefrontal cortex (PFC)2,3. DA itself is essential for
energy balance, demonstrated by the aphagia, hypolocomotion, reduced body weight and early
lethality of mice that genetically lack DA4. Disruptions in DA signaling are also observed in
obese rodents and humans, suggesting that inappropriate regulation of DA circuits contributes
to weight gain5-7. Yet, the mechanisms by which VTA DA neurons orchestrate energy balance
remain poorly understood. One emerging theory is that VTA DA neurons are not homogenous,
but in fact consist of subsets of neurons that coordinate distinct aspects of feeding and
locomotor activity. Indeed, VTA DA neurons can be differentiated according to their anatomical
inputs and projections8,9 or their electrophysiological firing properties10. VTA DA neurons
projecting to the NA are primarily activated by “rewarding” stimuli, whereas DA neurons
projecting to the PFC are regulated by “aversive” cues8. VTA DA neurons may also contain the
classical neurotransmitters GABA or glutamate11,12, whose co-release with DA at distinct
projection sites may either promote or suppress feeding13. Collectively, these data suggest the
interesting, and as yet untested possibility that distinct VTA DA circuits promote or suppress
obesogenic behaviors. Unfortunately, neither projection output nor transmitter content identifies
which specific VTA DA neurons may be leveraged to treat energy balance disorders. Certainly,
molecular markers to differentiate functionally distinct subsets of VTA DA neurons would be
useful in this regard, but to date no such markers have been identified.
138
Neuropeptides such as orexin, corticotropin releasing factor (CRF), glucagon-like
peptide-1 (GLP-1), and neurotensin (Nts) differentially modify DA-dependent behaviors14-17, thus
we reasoned that VTA DA neurons might be distinguished by their expression of neuropeptide
receptors. Of these systems, Nts holds particular promise for modifying obesogenic behaviors,
since pharmacologic administration of Nts in the VTA restrains feeding, increases locomotor
activity and induces weight loss in obese rodents18-20. Nts signals via neurotensin receptors -1
and -2 (NtsR1 and NtsR2) that are expressed in the VTA21,22, and Nts enhances the activation
of VTA DA neurons and DA release in the NA14,23. The lack of reagents to identify cells
expressing NtsRs, however, has hampered a more detailed understanding of how Nts
mechanistically engages DA neurons. To overcome this challenge, we used Cre-lox technology
to selectively visualize and manipulate NtsR1 or NtsR2-expressing cells in mice and in doing so
identified a unique subset of VTA DA neurons that express NtsR1. Furthermore, we found that
disrupting VTA NtsR1 neurons alters DA-mediated behaviors to prevent weight gain, suggesting
that this subset of VTA neurons may represent a novel cellular target for preventing the
development of obesity.
4.3 Results
NtsR1 and NtsR2 Identify Distinct VTA Cell Types: We crossed existing transgenic
NtsR1Cre mice and newly generated knock-in NtsR2Cre mice onto a Cre-inducible-GFP reporter
line, such that progeny expressed GFP selectively in NtsR1 or -2 expressing cells, respectively
(Fig. 17). These models revealed striking differences in the morphology, number, and
distribution of NtsR1-GFP and NtsR2-GFP cells throughout the rostrocaudal axis of the VTA
(Fig. 18A). While a few NtsR2-GFP cells appeared to be neurons (Fig. 18A, white arrows), the
vast majority were stellate-shaped cells consistent with glial morphology (Fig. 18A, yellow
arrows). By contrast, NtsR1-GFP cells were exclusively neuronal (Fig. 18A) and more
numerous than NtsR2-GFP neurons. The NtsR1-GFP neurons were predominantly located in
139
the rostral VTA (bregma-3.40 to -3.05), while the few NtsR2-GFP neurons clustered along the
ventral-medial border of the caudal VTA (bregma -3.64), a region enriched in GABA-ergic
neurons24.
Given the distinct morphology and distribution of NtsR1-GFP and NtsR2-GFP cells, we
next used immunolabeling to determine if they represent distinct cellular populations. The
NtsR2-GFP cells with stellate morphology co-localized with the astrocyte marker S100,
confirming that most NtsR2 cells are glia (Fig. 18B, yellow arrows). By contrast, none of the
NtsR1-GFP cells or the few NtsR2-GFP cells with neuronal morphology co-localized with S100
(Fig. 18B, C, white arrows). Instead >90% of NtsR1-GFP neurons co-expressed tyrosine
hydroxylase (TH), a marker of DA neurons (Fig. 18E-I), consistent with our previous findings25.
Only ~30% of the much smaller population of NtsR2-GFP neurons co-expressed TH,
representing ≤1% of all VTA DAergic neurons (Fig. 18D, F-I). Collectively, these data reveal
that NtsR1 and NtsR2 are expressed in non-overlapping VTA subpopulations, that NtsR1 is the
predominant receptor isoform expressed on VTA neurons, and that VTA NtsR1 neurons are a
subset of all VTA DA neurons.
VTA NtsR1 Neurons are a Projection-Defined Subset of VTA DA Neurons: We next
investigated whether the novel subset of VTA NtsR1 neurons are a projection-specific
population of VTA DA neurons by injecting the Cre-mediated anterograde tract tracer Ad-SynmCherry25 into the VTA of transgenic NtsR1Cre mice (Fig. 19A, B). This method revealed that
VTA NtsR1 neurons densely innervate the ventral striatum, particularly the NA core and shell
(NAc and NAs) and the nearby olfactory tubercle (OFT) (Fig. 19C, E). The second most
densely innervated structure was the interstitial nucleus of the posterior limb of the anterior
commissure (IPAC), which adjoins the NA (Fig. 19C, E). Moderate terminal density was
observed in the ventral caudate/putamen (CPu) just adjacent to the NA (Fig. 19C, E), as well as
140
sparse projections within the caudal CPu and basolateral amygdala (BLA). By contrast, no
projections were found in the central amygdala (CeA), hippocampus (Hipp) or the PFC (Fig.
19C-E). Thus, NtsR1 defines a subset of VTA DA neurons that regulate the NA and contiguous
subregions, and can be used as a molecular marker to parse mesolimbic vs. mesocortical
populations of VTA DA neurons.
Loss of VTA NtsR1 Neurons Alters Energy Balance to Promote Leanness: To determine
if VTA NtsR1 neurons contribute to the control of energy balance, we specifically ablated VTA
NtsR1 neurons in adult mice (Fig. 20A). Adult NtsR1Cre;GFP mice received bilateral injections of
an adeno-associated virus (AAV) expressing Cre-dependent Diphtheria Toxin A subunit (AAVDTA) into the VTA, and DTA expression selectively kills VTA NtsR1 neurons (NtsR1DTA mice).
Surrounding cells remain intact since DTA is not transmitted outside of Cre-expressing
neurons26. Separate NtsR1Cre;GFP mice received bilateral VTA injections of AAV-GFP and
retained intact NtsR1 neurons (NtsR1GFP controls). We verified that AAV-DTA sufficiently
depleted VTA NtsR1 neurons as early as two weeks post-surgery, but the remaining TH+ DA
neurons confirmed that this method does not ablate DA neurons that do not express NtsR1 (Fig.
20B). We therefore compared NtsR1DTA mice and controls to reveal the role of VTA NtsR1
neurons in energy balance. NtsR1DTA mice exhibited significantly reduced body weight
compared to NtsR1GFP controls by 4 wk post-surgery and remained leaner (Fig. 20C) with
decreased body fat percentage (Fig. 20D). Surprisingly, NtsR1DTA mice consumed increasingly
more chow (Fig. 20E) and drank more water over the study compared to NtsR1GFP controls (Fig.
21A), suggesting that loss of VTA NtsR1 neurons promotes ingestive behavior. While the
increased energy intake of NtsR1DTA mice was surprising given their decreased body weight
(Fig. 20G, I), we wondered if augmented energy expenditure might explain why these mice
remain lean. To this end, we noted hyperactivity of NtsR1DTA mice in their home cages and
metabolic analysis confirmed increased locomotor activity compared to NtsR1GFP controls (Fig.
141
20F). Further, when energy intake was plotted against energy expenditure and the distributions
were tested for differences using linear regression, we found a significantly increased yintercept in the NtsR1DTA group at 4 but not 16 weeks (Fig. 20S, T). This indicates that at a
given caloric intake, NtsR1DTA mice use more energy than controls and thus may not be able to
appropriately adjust caloric intake to support their elevated activity at least 4 weeks after
ablation, which likely contributes to their reduced body weight and adiposity. Lack of differences
between groups at 16 weeks (Fig. 20T) suggests that compensatory feeding eventually occurs
with time, but is not sufficient to match the normal body weight and adiposity levels of controls
(Fig. 20C, D).
Increased locomotion generally demands a commensurate increase in respiration to
support the activity, and indeed the hyperlocomotive NtsR1DTA mice had increased VO2 and
VCO2 (Fig. 21C-G) and exhibited increasingly higher rates of energy expenditure (adjusted for
weight) over the course of the study compared to controls (Fig. 20H, J). The respiratory
exchange ratio (RER) was unaffected (Fig. 21E-H) indicating that loss of VTA NtsR1 neurons
does not alter energy substrate usage. Collectively, these data indicate that loss of VTA NtsR1
neurons biases energy balance toward increased physical activity and energy expenditure to
promote leanness.
Given the lean phenotype of mice lacking VTA NtsR1 on a normal chow diet, we
hypothesized that they would be protected from diet-induced obesity. NtsR1DTA mice gained
significantly less weight on high fat (HF) diet and were completely protected from diet-induced
increase in body fat percentage compared to control mice (Fig. 20K, L). Although NtsR1DTA
mice consumed more HF diet (Fig. 20M) and had higher weight-adjusted energy intake than
NtsR1GFP controls (Fig. 20O, Q), they also exhibited escalating increases in locomotor activity
(Fig. 20N), VO2, VCO2 (Fig. 21I-N) and energy expenditure (Fig. 20P, R) over the study. Thus,
142
NtsR1DTA mice remain lean in spite of their obesogenic diet, and this was due to chronically
increased locomotor activity and energy expenditure.
Loss of VTA NtsR1 Neurons Alters Hedonic and Motivated Sucrose Intake: Loss of VTA
NtsR1 neurons could also promote leanness by reducing the hedonic value of food, leading to
insufficient caloric intake needed to balance increased energy expenditure. Surprisingly,
NtsR1DTA mice prefer and overconsume sucrose compared to control mice (Fig. 22A-C). We
reasoned that if NtsR1DTA mice drink more sucrose to meet homeostatic need then their intake
should be suppressed by treatment with the appetite-suppressing hormone, leptin27. While
leptin mildly diminished sucrose preference in NtsR1GFP controls, it did not suppress the sucrose
preference of NtsR1DTA mice (Fig. 22D). These data suggest that loss of VTA NtsR1 neurons
prevents appropriate response to leptin, compromising the ability to adapt caloric intake and
locomotor behaviors as needed to maintain normal weight.
We next examined whether loss of VTA NtsR1 neurons might have uncoupled motivated
feeding required to offset increased energy expenditure. Despite being hyperactive, NtsR1DTA
mice correctly learned to self-administer sucrose in a time frame similar to that of control mice
(Fig. 22E, H), confirming that loss of VTA NtsR1 neurons does not compromise learning or
attention processes required for motivated intake. Furthermore, NtsR1DTA and NtsR1GFP work
equally to obtain sucrose (Fig. 22I, J), thus loss of VTA NtsR1 neurons does not prevent
sucrose “wanting”. Given the extreme energy demands of NtsR1DTA mice, however, their lack of
increased motivated responding is counterintuitive: these mice should be more motivated than
controls to consume calories28. We therefore reasoned that VTA NtsR1 neurons may be
required to coordinate signals of energy status with appropriate adaptations in motivated
behavior needed to maintain body weight. If this were true, then NtsR1DTA mice lacking VTA
NtsR1 neurons should be unable to adjust their motivated intake in response to peripheral
143
energy cues. As expected, NtsR1GFP control mice were less motivated to nose-poke for sucrose
in response to cues of energy sufficiency such as sucrose pre-feeding29 or leptin30, but NtsR1DTA
mice did not adjust their intake in response to these cues (Fig. 22K, L). Taken together, these
findings reveal an important role for VTA NtsR1 neurons in linking metabolic status and
motivated feeding necessary to maintain body weight.
Loss of VTA NtsR1 Neurons Modifies DA-Mediated Locomotor Activity: The
hyperactivity of NtsR1DTA mice suggested that they retained DA-mediated locomotor behavior.
Consistent with this, open field locomotor activity of NtsR1DTA and NtsR1GFP mice was not
disrupted by PBS-injection stress (Fig. 23A, B, Test A), whereas treatment with the D1 receptor
antagonist SCH23390 (0.1mg/kg i.p.) blunted locomotor activity in both groups (Fig. 23A, B,
Test B). We therefore used amphetamine (AMPH)-induced locomotor activity to assess the
integrity of the mesolimbic DA system in NtsR1DTA mice. As expected, AMPH treatment
(4mg/kg i.p.) significantly increased locomotor activity in NtsR1GFP mice, but NtsR1DTA mice did
not respond with increased activity (Fig 23D-G). Instead, we anecdotally observed that AMPHtreated NtsR1DTA mice engaged in stationary, stereotypic movements typical with ceiling effects
of DA signaling, which account for their apparent decrease in ambulatory activity (Fig. 23D-G).
Since NtsR1DTA mice lack a subset of VTA DA neurons that projects to the NA, we examined the
ability of AMPH to induce DA release in the NA using AMPH-induced cFos immunoreactivity to
identify activated NA neurons. AMPH treatment significantly increased numbers of cFospositive cells in the NA of both NtsR1DTA and control mice, although the response was nonsignificantly blunted in NtsR1DTA mice, consistent with loss of some, but not all NA-projecting
VTA DA neurons (Fig. 23H, I). Together, these data indicate that loss of VTA NtsR1 neurons
does not completely abolish mesolimbic signaling. In fact, the high baseline locomotor activity
and AMPH-induced stereotypy observed in NtsR1DTA mice may indicate enhanced DA signaling,
similar to compensatory increases in extracellular DA that occur with partial loss of DA
144
neurons31. Although hyperactivity and excessive DA have been linked with anxiety, there were
no differences in anxiety-like behavior between NtsR1GFP and NtsR1DTA mice as assessed via
open field center activity (Fig. 23C, F) and elevated plus maze (EPM) (Fig. 24).
Loss of VTA NtsR1 Neurons Modifies the Mesolimbic DA System: Lastly, we examined
how loss of VTA NtsR1 neurons impacts the integrity of the mesolimbic DA system. NtsR1DTA
mice have reduced TH and DAT immune-labeled terminals in the NA and OFT compared to
control mice (Fig. 25A, B) but residual immunoreactivity suggests preservation of non-NtsR1
expressing mesolimbic neurons. To assess molecular alterations in the VTA, we administered
unilateral VTA injections of AAV-DTA or AAV-GFP to NtsR1Cre;GFP mice and analyzed the fold
difference in gene expression between the injected and un-injected sides; we refer to these as
NtsR1GFP-Uni and NtsR1DTA-Uni mice (Fig. 25C). As expected, NtsR1 and DA-associated
transcripts such as Th, Dat and D2 were significantly reduced in the VTA of NtsR1DTA-Uni mice,
consistent with the loss of DAergic VTA NtsR1 cell bodies (Fig. 25D). The slight reduction in
vglut2 and vgat in NtsR1DTA-Uni mice suggests that VTA NtsR1 neurons may also contain
glutamate and/or GABA in addition to DA. Ntsr2 expression, however, did not differ between
NtsR1DTA-Uni mice and controls, consistent with our finding that NtsR1 and NtsR2 are expressed
on distinct VTA cell populations (Fig. 18). No differences in NA expression of D1 or D2 were
observed between groups (Fig. 25E). In sum, loss of VTA NtsR1 neurons results in structural
and molecular adaptations in the mesolimbic DA system but does not abrogate the entirety of
DA-mediated signaling that is required for survival.
4.4 Discussion
The lack of molecular markers to differentiate functionally heterogeneous and projectionspecified VTA DA neurons has impeded understanding of how these neurons orchestrate
behavior and body weight. A recent study reported that a subpopulation of VTA DA neurons
145
that project to the lateral septum can be identified by the transcription factor, Neurod632,
however no additional markers of projection-specific VTA subsets have been identified. Here,
we show that NtsR1 expression identifies a subset of VTA DA neurons that specifically projects
to the ventral striatum and thus is the first molecular marker specific to mesolimbic DA neurons.
Loss of this VTA NtsR1 population alters DA-mediated behaviors to protect against weight gain
without compromising DA-mediated signaling necessary for survival4. Collectively, our data
identify VTA NtsR1 neurons as important coordinators of energy intake and output behaviors
that determine body weight.
Since Nts actions via NtsR1 and NtsR2 are implicated in control of distinct physiology,
we hypothesized that these receptors might identify functionally distinct DA neurons. We
therefore used Cre-mediated reporter mice to identify the cells expressing each receptor
isoform, confirming that NtsR1 is almost exclusively expressed by DA neurons while NtsR2 is
primarily expressed by non-DAergic neurons and astrocytes. Since NtsR1 is a Gq-coupled
receptor33, our findings indicate a mechanism for Nts to directly enhance the activation of
NtsR1-expressing DA neurons, consistent with the established roles for NtsR1 in promoting DA
release to the striatum and DA-mediated locomotor activity34,35, anorexia35, and reward36,37. Our
data do not, however, rule out roles for the non-DAergic populations of NtsR2 cells to indirectly
promote DA signaling. The TH-negative NtsR2 neurons found primarily within the ventromedial,
GABA-rich portion of the VTA may disinhibit local DA neurons and promote their activation37,38.
Nts may also act via the numerous NtsR2-expressing astrocytes within the VTA to indirectly
modify DA-mediated behavior, consistent with reports of glia mediating NtsR2-dependent fear
behavior39. Going forward, it will be important to define the neural circuits by which Nts engages
these distinct NtsR1 and NtsR2-expressing cell types and their individual contributions to DAmediated behaviors and energy balance.
146
In situ hybridization predicts a larger population of NtsR1-expressing neurons in the VTA
than were identified using transgenic NtsR1Cre-GFP mice (Allen Brain Atlas and Figure 1). This
discrepancy may be due to low Cre expression common to transgenic lines, diminishing the
intensity of Cre-mediated EGFP expression necessary to identify NtsR1 cells. Increasing the
concentration of Cre-inducible transcripts can enhance recombination, and indeed, injecting
NtsR1Cre mice with AAV-GFP identifies additional NtsR1 neurons in the VTA. The AAVidentified VTA NtsR1-GFP neurons exclusively co-label with a subpopulation of TH cells,
confirming that VTA NtsR1 neurons are a subset of all DA neurons (Fig. 26). In sum, these data
suggest that the VTA NtsR1 neuronal population is larger than depicted in Fig. 18, but that
subsequent AAV manipulations were able to transduce and modulate most VTA NtsR1 neurons
(see further discussion in Chapter 6).
Although generalized depletion of VTA DA neurons does not alter locomotor activity or
energy intake40-42, ablation of the specific subset of VTA NtsR1 neurons altered both behaviors
and prevented age-associated and diet-induced weight gain. Since aging and obesogenic
environment are the two most significant instigators of human weight gain, our findings suggest
roles for VTA NtsR1 neurons in countering the development of obesity. Intriguingly, the
pronounced physical activity and energy expenditure of NtsR1DTA mice appears to be the
primary source of protection from weight gain, and is consistent with the established role for
mesolimbic DA in regulating locomotor behavior. Although NtsR1DTA mice eat slightly more than
controls, their energy intake is only sufficient to compensate for elevated levels of activity and
energy expenditure, and did not promote weight gain. Thus, mesolimbic VTA NtsR1 neurons
are not essential drivers of feeding per se, but they coordinate energy intake required to support
physical activity.
147
While open-circuit indirect calorimetry systems are widely accepted methods to analyze
VO2 and energy expenditure53, methodological limitations should be taken into account when
interpreting the data. For example, the metabolic chambers record food intake by detecting
slight differences in weight of the food hopper as food is removed by the mouse during feeding.
However, this does not ensure that all food removed from the hopper was consumed. Further,
the analysis does not take into account the possibility of differences in digestion efficiency
between NtsR1DTA and control mice as not all ingested food may have been absorbed for
energy. Differences in digestion could be addressed by assessing caloric content of fecal
matter, which was not performed in this study. These two caveats together pose the possibility
that food intake could be slightly overestimated. Another limitation is that O2 and CO2
concentrations were collected once for 3 minutes every 27 minutes over the duration each 4 day
experiment. Thus, we can only assume that metabolism during the 3 minute collection period
represents the entire 27 minute interval, which could overestimate or underestimate energy
expenditure. To examine this, we plotted energy intake vs. expenditure for both groups at 4 and
16 weeks post-ablation (Fig. 20S, T). As long as no weight gain or loss occur, the slope of the
distributions between intake and expenditure should be near 1.0. We found however, that the
slopes were much less than 1.0 but similar between groups. A slope <1.0 suggests that the
food intake exceeds energy expenditure, yet neither group gained weight during the study
periods (data not shown), suggesting that either 1) food intake is overestimated due to lack of
complete consumption or differences in digestion or 2) energy expenditure is underestimated,
perhaps due to the assumption that energy expenditure during the 3 minute recording interval is
representative of a larger time period, or a combination of both. However, the fact that the
slopes did not vary significantly between ablated and control mice suggests that any error in
estimating caloric intake or expenditure applies equally to both groups. Further, we used
weight-adjusted ANCOVA analysis to detect significant increases in VO2, VCO2, and energy
expenditure with VTA NtsR1 ablation (Fig. 20, 21), which eliminates the potential for erroneous
148
differences that can occur when metabolic parameters are simply divided by body weight53.
Thus, although the absolute values for caloric intake and expenditure may vary by system, we
firmly believe the differences detected between groups are valid.
Given that VTA NtsR1 neurons project to the NA, where DA release regulates the
motivation for palatable foods2,3, we were surprised that NtsR1DTA mice did not differ from
controls in their willingness to work for sucrose rewards. Furthermore, NtsR1DTA mice
demonstrated intact liking and wanting of palatable foods. These findings suggest that VTA
NtsR1 neurons are not required for DA-mediated ingestive behavior, and that other non-NtsR1
expressing circuits exert this control. It may be argued, however, that NtsR1DTA mice with low
body weight and adiposity should display increased motivation for sucrose28, and thus have a
deficit in coordinating intake behavior to meet energy demands. This is consistent with our
findings that NtsR1DTA mice also lack the ability to adapt motivated intake in the face of satiety
cues such as sucrose pre-feeding and leptin treatment30. Taken together, these data suggest
that VTA NtsR1 neurons are not required for the execution of motivated food intake, but rather
serve to tune it in response to peripheral energy needs.
VTA NtsR1 neurons must receive information about peripheral energy status to
coordinate metabolic state and DA-mediated behavior. The adipocyte-derived hormone leptin
modulates energy balance in part via the actions of Nts and NtsR125,43, and we demonstrate an
obligate role of VTA NtsR1 neurons in this process. It is unlikely that VTA NtsR1 neurons are
direct targets of leptin because VTA NtsR1- and leptin receptor (LepRb) expressing populations
have distinct anatomical distributions and projection sites (Fig. 19 and 44), suggesting that they
comprise distinct neuronal populations. Leptin does, however activate LepRb neurons of the
lateral hypothalamic area (LHA) that project to and release Nts into the VTA, promoting NtsR1-
149
dependent release of DA in the NA25,45. LHA LepRb neurons may thus be the neural hubs
linking leptin action with Nts and DA signaling.
We used NtsR1 as a marker to identify VTA NtsR1 neurons, but it remains to be
determined which signals from these neurons are critical for regulation of energy balance. VTA
NtsR1 neurons may co-express both GABA and/or glutamate to modify activation of striatal
targets. Nts action via NtsR1 expressed on VTA NtsR1 neurons may also contribute to DAmediated behaviors. Indeed, the phenotype of NtsR1DTA mice resembles whole-body NtsR1
knockout mice with hyperactivity, increased sucrose preference, and lack of adaptive response
to leptin25. Together, these models argue that chronic disruption of Nts signaling via VTA NtsR1
neurons biases homeostasis toward energy expenditure. Perhaps the most important signal
from VTA NtsR1 neurons may be DA itself. Although NtsR1DTA mice exhibit substantial loss of
VTA NtsR1 neurons and diminished DAergic projections to the NA, their intact AMPH-induced
cFos confirms that at least some DA neurons remain and are functional. If anything, chronic
loss of VTA NtsR1 neurons may lead to enhanced DA signaling. Indeed, mice lacking VTA
NtsR1 neurons display increased general ambulatory behavior, but decreased AMPH-induced
locomotor activity accompanied by stereotypy, a behavioral response typically associated with
high-dose AMPH and ceiling-levels of DA efflux46. We thus speculate that loss of VTA NtsR1
neurons leads to increased striatal DA signaling, and AMPH further increases DA to levels that
promote stereotypy instead of augmenting ambulatory activity. Numerous mechanisms could
enhance DA action, such as altered balance of D1/D2 protein expression or impaired DAT
kinetics, and will be important to define in the future.
Our data indicate that VTA NtsR1 neurons play an important role in preventing dietinduced obesity, hence VTA NtsR1 neurons may represent a novel cellular target for preventing
and treating human obesity. Ablation of neurons is not a feasible therapeutic strategy, thus it
150
will be imperative to identify pharmacological means to selectively modulate VTA NtsR1
neurons to promote behaviors that prevent weight gain. Previous work demonstrates that
pharmacologic treatment of Nts or Nts agonists in the VTA suppresses operant-reinforced
feeding47 and enhances locomotor activity in an NtsR1-dependent manner19,34. Conversely,
other studies showed suppression of locomotor activity when Nts was applied directly to the
NA14, underscoring the need for circuit-specific interventions. Although developmental loss of
NtsR1 in NtsR1 knockout mice promotes palatable food intake and weight gain25, our current
data show that selective ablation VTA NtsR1 neurons in adult mice protects them from obesity,
suggesting that pharmacological modulation of Nts signaling may be useful in adults with
established VTA NtsR1 DA circuits. Going forward, it will be important to define how Nts and
other signals engage VTA NtsR1 neurons to identify strategies that prevent obesity
4.5 Methods
Reagents: Recombinant leptin was purchased from the National Hormone and Peptide
Program (Torrance, CA). The dopamine receptor-1 antagonist, SCH233990, was purchased
from Sigma. Amphetamine hydrochloride was from Cayman Pharmaceuticals.
Mice: Transgenic NtsR1Cre mice were purchased from the Mutant Mouse Regional
Resource Center at UC Davis (B6.FVB(Cg)-Tg(NtsR1-cre)GN220Gsat/Mmucd, Stcok number
030648-UCD). NtsR2Cre mice were generated via homologous recombination (knock-in)
methods described previously48. To visualize NtsR1 and NtsR2-expressing neurons, NtsR1Cre
and NtsR2Cre mice were bred to a Cre-inducible RosaeGFP-L10a reporter line, generating mice that
express GFP selectively in NtsR1 and NtsR2 neurons (NtsR1Cre;GFP and NtsR2Cre;GFP). Mice
were bred and housed in a 12h light/12h dark cycle and all procedures were approved by the
Institutional Animal Care and Use Committee (IACUC) at Michigan State University.
151
Generation of NtsR2Cre Knock-In Mice: An NtsR2cre targeting vector was generated by
inserting an IRES-Cre sequence between the stop codon and the polyadenylation site of the
sequence encoding the 3’ end of the mouse NtsR2 gene, with an frt-flanked Neo cassette
inserted upstream of the IRES-Cre. The linearized targeting vector was electroporated into
mouse R1 embryonic stem (ES) cells (129sv background) and cells were selected with G418.
DNA from ES cell clones was analyzed via qPCR for loss of homozygosity using Taqman primer
and probes for the genomic NtsR2 insertion site (Forward: ACCCATCAGATAAGCCATGC,
Reverse: GTGGGAAGTTGAGGGCAG, Probe: GTCTAAGCGGACCTACTGACCCA). NGF was
used as a copy number control49. Putative positive ES clones were expanded, confirmed for
homologous recombination by Southern blot and injected into mouse C57BL/6 blastocysts to
generate chimeras. Chimeric males were mated with C57BL/6 females (Jackson Laboratory),
and germline transmission was determined initially via progeny coat color, then confirmed via
conventional PCR for IRES-Cre.
Genotyping: NtsR1Cre and NtsR2Cre mice were bred to C57BL/6J mice to maintain the
lines, and progeny were genotyped via standard PCR (NtsR1Cre: F:
GACGGCACGCCCCCCTTA, R: CGGCAAACGGACAGAAGCATT, NtsR2Cre:
CCGTGTCTTCCTTCAGA, R: CTACACCTTGGTTGCACAGG).
Surgery: Mice received a pre-surgical injection of carprofen (5mg/kg s.c.) and were
anesthetized with 3-4% isoflurane/O2 in an induction chamber before being placed in a
stereotaxic frame (Kopf). Under 1-2% isoflurane, access holes were drilled in the skull allowing
a guide cannula with stylet (PlasticsOne) to be lowered into the brain target area. After 7 min to
allow for AAV absorption, the injector and cannula were removed from the skull and the incision
was closed using Vet Bond. To generate NtsR1GFP and NtsR1DTA study mice, 8-10 wk old
NtsR1Cre;GFP males received bilateral injections of either 150 nL of Cre-inducible AAV-GFP
152
(rAAV2/hSvn-DIO-eGFP, University of North Carolina Vector Core) or AAV-DTA (lox-mCherryloxDTA-WPRE-AAV, serotype 10), which expresses the cytotoxic Subunit A of Diptheria Toxin
in the presence of Cre, into the VTA (A/P: -3.2, M/L: +/-0.48, D/V: -4.65). NtsR1GFP and
NtsR1DTA mice were monitored weekly for body weight after surgery, but did not undergo
analysis until 4 wks post-surgery to allow DTA-mediated cell death to occur. We generated and
studied NtsR1GFP = 7, NtsR1DTA =15 and NtsR1GFP HF=10, NtsR1DTA HF=13. Mice were only
included in the final study data if injections were localized to, and contained within the VTA
which was determined by specific lack of GFP expression in the VTA. After post-hoc
examination, 2/15 NtsR1DTA and 3/13 NtsR1DTA-HF mice were excluded due to unilateral targeting
and/or spread of the injection site to the substantia nigra (SN), leaving NtsR1GFP = 7 and
NtsR1DTA =13; NtsR1GFP HF=10 and NtsR1DTA HF=10.
To visualize NtsR2 neurons, adult male and female NtsR2Cre;GFP were bilaterally
injected with 1uL FlpO adenovirus (Vector Biolabs) into the lateral ventricles in accordance with
the atlas of Paxinos and Franklin50: A/P: -0.22, M/L: +/- 1.0, D/V: -2.0. Mice were perfused 10
days after surgery to permit sufficient time for FlpO-mediated excision of the frt-flanked Neo
cassette and GFP expression. For tracing studies, NtsR1Cre mice were injected unilaterally in
the VTA with 75-100 nL of an anterograde cre-inducible adenovirus expressing a
synaptophysin-mCherry fusion protein, Ad-syn-mCherry25, (Martin Myers, University of
Michigan) using the same coordinates described above. Mice recovered for 7-10 days after
surgery to allow for synaptophysin-mCherry expression at pre-synaptic terminals.
Metabolic Profiling: At 4, 8 and 16 wk post-surgery the mice were analyzed for body
composition using and NMR-based instrument (Minispec mq7.5, Bruker Optics). At 4 and 16 wk
post-surgery, mice were placed in TSE cages for metabolic phenotyping (PhenoMaster, TSE
Systems). After 24 hours of acclimation, mice were continuously monitored for food and water
153
intake, locomotor activity, and energy expenditure over 4 days. Ambient temperature was
maintained at 20-23˚C and the airflow rate through the chambers was adjusted to maintain an
oxygen differential around 0.3% at resting conditions. The O2 and CO2 sensors were calibrated
to gas mixtures with verified gas concentrations. All air entering the system was filtered and
dried to avoid variation in gas partial pressure due to moisture. O2 and CO2 concentrations and
gas flow rates were measured over a 3 minute period from each cage individually, every 27
minutes for the duration of the run. The system consisted of 8 air-tight cages containing singlyhoused study animals and an empty cage from which gas concentrations were used as a
reference to calculate oxygen consumption (VO2), carbon dioxide production (VCO2), energy
expenditure, and respiratory exchange ratio (RER) as described below.
Metabolic Calculations:
VO2 = (Flowin * [O2]in) – (Flowout * [O2]out)
VCO2 = (Flowin * [CO2]in) – (Flowout * [CO2]out)
In these equations, [O2]out, [CO2]out and Flowout are measured from air exiting the experimental
cage, while [O2]in and [CO2]in are measured from the reference cage. Note that although gas
concentrations from both reference and experimental cages are measured after they exit the
cage, no gas exchange has occurred in the reference cage concentrations can be used for the
“in” terms for all cages. The only term not measured directly is Flowin, which can be solved for
using the Haldane correction, based on the principle that the nitrogen concentration if air going
into the cage should equal air exiting the cage as nitrogen is physiologically inert. Taking this
into account:
Haldane Correction: Flowin * (1-([O2]in +[CO2]in)) = Flowout * (1-([O2]out +[CO2]out))
Thus, Flowin can be solved for and used to calculate VO2 and VCO2.
154
RER= VCO2/VO2 indicates whether glucose or fatty acids are preferentially used as energy
substrates. Fatty acid oxidation yields a ratio of 0.7 while glycolysis is 1.0.
Energy Expenditure was calculated using the Weir equation:
Metabolic rate (kcal/hr) = (3.815+1.232*RER) * VO2
All parameters were calculated by the TSE system software.
Sucrose Preference: NtsR1DTA and NtsR1GFP mice were given two identical 50 mL
sipper bottles in their home cages for 4 consecutive days. On days 1-2, both bottles were filled
with water to acclimate the animals to the test environment. On days 3-4, one bottle was
switched to 0.5% sucrose while the other contained water. The bottle positions were rotated
daily to avoid position bias, and the volume consumed from each bottle was measured at the
same time each day. To assess leptin-induced changes in sucrose preference, animals were
re-tested one month later for 6 consecutive days. On days 1-2, animals received once daily
sham i.p. injections while both bottles contained water. On day 3, one bottle was switched to
0.5% sucrose. Mice were treated with PBS on days 3-4 and leptin (5mg/kg ip) on days 5-6. All
injections were administered at the onset of the dark cycle when most food and water intake
naturally occurs. Data are reported as sucrose preference, which is the percentage of sucrose
consumed out of total liquid consumed.
Operant Testing: Standard Testing: NtsR1DTA and NtsR1GFP were trained to nose-poke
for unflavored 20 mg sucrose pellets (TestDiet 1811555) using operant-responding chambers
(Med Associates). As previously described30, mice were food restricted to 90% of their body
weight and trained on a fixed ratio-1 (FR1) schedule until they achieved 75% response accuracy
155
with ≥20 rewards earned on 3 consecutive days. Training sessions were terminated after 1 hr
or when the animal had earned 50 rewards. Mice achieving these criteria were then switched to
ad lib food and trained on an FR5 schedule for 3 consecutive days. On test days, mice were
subject to a progressive ratio (PR) schedule were PR=[5e(R*0.2)]-5 with R=number food rewards
earned+151. Thus, the number of correct responses needed to earn a sucrose reward increases
as follows: 1, 2, 4, 6, 9, 12, 15, 20, 25, 32, 40, 50, 62, 77, 95 etc. The PR breakpoint was
recorded as the highest ratio completed for each 1 hr test session. Mice were tested until they
achieved stable PR which was defined as <10% variation in rewards earned over 3 consecutive
sessions. Sucrose pre-feeding: After achieving stable PR, mice were given ad lib access to 3g
of sucrose pellets in their home cages overnight. The following morning, they were re-tested on
the PR schedule. Leptin Treatment: Mice with stable PR responses were injected with PBS or
leptin (5mg/kg, ip) on different days and tested one hour later.
Elevated Plus Maze: Mice were assessed for anxiety-like behavior using an elevated
plus maze (EPM) as previously described52. Briefly, the EPM apparatus was custom-built
based on plans from ANY-maze (www.anymaze.com, Stoelting Co.) and mice were given free
access to the open and closed arms for 5 minutes. Their behavior was recorded using a digital
CCD camera and the percentages of time spent in the open and closed arms were analyzed
using Topscan automated video tracking software (Clever Sys).
Open Field Locomotor Activity: Open field locomotor activity was assessed using a
digital CCD camera and video-tracking software (Clever Sys)52. Mice were tested on 3 separate
days; each day, mice were placed in the boxes to acclimate, followed by an i.p. injection of PBS
30 min later. At 60 min, mice received either a second injection of PBS, or SCH23390
(0.1mg/kg) or amphetamine (4mg/kg) and recorded for another 60 minutes.
156
Immunohistochemistry and Immunofluorescence: Mice were treated with a lethal dose
of ip pentobarbital followed by transcardial perfusion with 10% neutral-buffered formalin
(Fisher). Brains were removed, post-fixed in 10% formalin overnight at 4˚C, dehydrated with
30% sucrose in PBS for 2-3 days, and sectioned into 30 µm slices using a sliding microtome
(Leica). Brain sections were then analyzed by immunofluorescence or immunohistochemistry
as previously described25,48. For characterization of NtsR1 and NtsR2 expression, sections from
NtsR1Cre;GFP and NtsR2Cre;GFP mice were stained with chicken anti-GFP (1:2000, Abcam),
mouse anti-TH (1:1000, Millipore), or rabbit anti-S100 (1:1000, Abcam), followed by incubation
with species-specific secondary antibodies conjugated to AlexaFluor 488 or 568 fluorophores
(Life Technologies or Jackson ImmunoResearch). For ablation studies, NtsR1DTA and NtsR1GFP
mice were treated with PBS or amphetamine (4mg/kg) 90 minutes prior to perfusion, and brain
sections were stained for cFos (1:500, goat, Santa Cruz) with secondary detection via DAB (Life
Technologies), followed by immunofluorescent detection of GFP, TH, or DAT (1:1000, Millipore)
as described above. Brains were analyzed using an Olympus BX53 fluorescence microscope
outfitted with transmitted light to analyze DAB-labeled tissue, as well as FITC and Texas Red
filters. Microscope images were collected using Cell Sens software and a Qi-Click 12 Bit cooled
camera, and images were analyzed using Photoshop software (Adobe). For quantification and
colocalization of NtsR1 and NtsR2 neurons with TH, five representative sections spanning the
entire VTA were selected from each mouse, from which all GFP and/or TH positive neurons
were counted.
Gene Expression: At 16 weeks post-surgery, NtsR1DTA-Uni (n=17) and NtsR1GFP-Uni (n=7)
were deeply anesthetized with sodium pentobarbital and tissue from the injected and uninjected
sides of the VTA and NA were separately microdissected. Tissue was immediately snap frozen
on dry ice and stored at -80˚C for later processing. RNA was extracted using Trizol (Invitrogen)
and 200 ng samples were converted to cDNA using the Superscript First Strand Synthesis
157
System for RT-PCR (Invitrogen). Sample cDNAs were analyzed in triplicate via quantitative RTPCR for gene expression using TaqMan reagents and an ABI 7900 (Applied Biosystems) at the
MSU Genomics Core. With GAPDH expression as an internal control, relative mRNA
expression values were calculated by the 2-∆∆Ct method and normalized to the uninjected side of
each mouse. To verify targeting, NtsR1DTA-Uni mice were considered sufficiently ablated if the
fold change in NtsR1 expression was less than 1 standard deviation below the mean NtsR1 fold
change in AAV-GFP-injected mice. By this criterion, 7 of 15 NtsR1DTA-Uni mice were deemed
insufficiently ablated and were excluded from the analysis.
Statistics: Student’s t-tests and 2-way ANOVA were calculated using Prism 6
(GraphPad). For all metabolic data, analysis of covariance (ANCOVA) was computed in SPSS
22 (IBM). Body weight was analyzed as a covariate to correct for any inherent differences it
may have on metabolism53. All data were tested for homogeneity of regression, independence
of the covariate (body weight), and linearity of regression prior to running the ANCOVA. For all
data, *p<0.05, **p<0.01 and ***p<0.001.
158
APPENDIX
159
Figure 17. Generation of NtsR1Cre;GFP and NtsR2Cre;GFP reporter mice to visualize NtsR1
and NtsR2 neurons in the VTA. A) Commercially-available transgenic NtsR1Cre mice were
bred to a Cre-inducible GPP reporter line to generate mice expressing GFP selectively in NtsR1
neurons (NtsR1Cre;GFP mice). B) NtsR2NEO-Cre mice were created by inserting an IRES-Cre
sequence downstream of an frt-flanked NEO cassette directly into the Ntsr2 locus using
homologous recombination. NtsR2NEO-Cre mice were then crossed to a Cre-inducible GFP
reporter line, however GFP is not expressed because the NEO cassette prevents Cre
expression. Thus, adult NtsR2NEO-Cre;GFP mice were injected with an adenovirus expressing
FlpO recombinase ICV to remove the frt-flanked NEO cassette, resulting in Cre and therefore
GFP expression in NtsR2-positive cells (NtsR2NEO-Cre;GFP mice).
160
Figure 18. Distribution and neurochemical phenotype of VTA NtsR1 and NtsR2 neurons.
VTA NtsR1and NtsR2 neurons were visualized by crossing NtsR1Cre and NtsR2Cre mice to a Creinducible GFP reporter line. See Fig. 17 for more details. A) Rostrocaudal distribution of VTA
NtsR1 and NtsR2 neurons, with bregma positions from the mouse brain atlas of Paxinos and
Franklin. White arrows denote neurons, yellow arrows denote glial cells. B) Colocalization of
glial cell marker S100 (purple) in the VTA with NtsR2 cells (green) and C) NtsR1 cells (green).
D) Colocalization of tyrosine hydroxylase (TH, purple) in the VTA with NtsR2 cells (green) and
E) NtsR1 cells (green). F) Percentage of NtsR1 and NtsR2 neurons that colocalize with TH. G)
Percentage of TH positive neurons that colocalize with NtsR1 or NtsR2. H) Total number of
GFP-identified NtsR1 and NtsR2 neurons in the VTA. I) Schematic depicting the distribution of
VTA DA and non-DA neurons that co-express NtsR1 and NtsR2. NtsR1Cre;GFP n=4,
NtsR2Cre;GFP n=6. Data represent mean ± SEM, *p < 0.05, ***p < 0.001 determined by
unpaired t-test. Scale bars = 100 µm. ml = medial lemniscus; ip = interpeduncular nucleus; fr =
fasciculus retroflexus.
161
Figure 19. VTA NtsR1 neurons project to the ventral striatum. A) NtsR1Cre mice were
unilaterally injected in the VTA with Ad-Syn-mCherry, resulting in expression of a
synaptophysin-mCherry fusion protein in the cell bodies and presynaptic terminals of VTA
NtsR1 neurons (n=5). B) VTA injection site (left, asterisk) with mCherry-labeled NtsR1 cell
bodies. Scale bar = 200 µm. C) Major efferent targets of VTA NtsR1 neurons. D) Minor
efferent targets of VTA NtsR1 neurons. Numbered dashed-boxes in coronal schematic images
correspond to microscopy images below. Bregma positions are according to the mouse brain
atlas of Paxinos and Franklin. Scale bars in c, d = 100 µm. E) Table summarizing relative
NtsR1 terminal density across multiple brain areas with emphasis on previously established
VTA efferents. Note: n.p.= not present. aca=anterior commissure, cc=corpus callosum,
ic=internal capsule, ml=medial lemniscus, ip=interpeduncular nucleus, CeA= central amygdala,
BLA= basolateral amygdala.
162
Figure 20. Loss of VTA NtsR1 neurons disrupts energy balance. A) 8 wk old male
NtsR1Cre;GFP mice received bilateral injections of AAV-DTA or AAV-GFP in the VTA. B)
Images show representative NtsR1-GFP (green) and TH (purple) expression from NtsR1GFP and
NtsR1DTA mice two weeks after surgery. Scale bars =200µm. ml=medial lemniscus,
ip=interpeduncular nucleus.
163
Figure 20 (cont’d). C-J) Metabolic assessment of NtsR1GFP and NtsR1DTA mice on chow diet
(NtsR1GFP n=7, and NtsR1DTA n=13). C) Percentage change in body weight from starting weight
and D) percentage of body fat determined via NMR-based instrument. E) Chow intake and F)
total locomotor activity as measured in TSE metabolic cages. G) Weight- adjusted energy
intake and H) energy expenditure at 4 wk post-surgery and I) weight-adjusted energy intake and
J) energy expenditure measured at 16 wk post-surgery. K-R) Metabolic assessment of
NtsR1GFP and NtsR1DTA mice on HF diet (NtsR1GFPHF n=10 and NtsR1DT HF n=10). K)
Percentage change in body weight from starting weight, L) percentage of body fat, M) HF diet
intake and N) total locomotor activity. O) Energy intake and P) energy expenditure at 4 wk postsurgery, and Q) energy intake and R) energy expenditure measured at 16 wk post-surgery,
normalized to body mass. S) Total energy intake vs. estimated expenditure over 48 hours at 4
weeks (NtsR1GFP: y=0.317x+26.43, NtsR1DTA: y= 0.271x+31.74) and T) 16 weeks post-ablation
(NtsR1GFP: y=0.456x+16.48, NtsR1DTA: y= 0.695x+9.298) . For B-E and J-M, graphed data
represent mean ± SEM, *p < 0.05, **p < 0.01, ****p < 0.0001 analyzed by two-way ANOVA. For
scatterplots in G-J and O-R data were analyzed using ANCOVA to account for body weight as a
covariate. S-T were analyzed by linear regression. See Fig. 21 for water intake and additional
metabolic parameters.
164
Figure 21. Water intake and additional metabolic parameters in mice lacking VTA NtsR1
neurons. Fluid intake and metabolic parameters were assessed over 4 days in TSE metabolic
cages in NtsR1GFP and NtsR1DTA mice at 4 and 16 wk post-surgery.
165
Figure 21 (cont’d). Water consumption in A) chow-fed and B) HF diet-fed mice. Data
represent mean ± SEM, analyzed by two-way ANOVA. C) oxygen consumption (VO2), D)
carbon dioxide production (VCO2) and E) respiratory exchange ratio (RER) at 4 weeks-post
ablation in chow-fed animals. F) VO2, G) VCO2, and H) RER in chow-fed mice 16 weeks postablation. I) VO2, J) VCO2, and K) RER in HF diet-fed mice at 4 weeks. L) VO2, M) VCO2 and
N) RER in HF-diet fed mice 16 weeks post-ablation. All metabolic data were analyzed via
ANCOVA to adjust for body weight as a covariate. (NtsR1GFP n=7, NtsR1DTA n=13, NtsR1GFPHF
n=10 and NtsR1DTA HF n=10).
Figure 22. VTA NtsR1 neurons modulate hedonic and motivated ingestive behavior.
A) Water intake, B) 0.5% sucrose intake and C) sucrose preference in untreated NtsR1GFP and
NtsR1DTA mice over 4 days. D) Sucrose preference while mice received PBS or leptin (5mg/kg,
i.p.) at the onset of the dark cycle. Graphed data represent the difference in average sucrose
preference during PBS and leptin treatments. NtsR1GFP n=7, and NtsR1DTA n=13, n.s.=not
significant, *p < 0.05, ***p < 0.001 by unpaired t-test. E-H) NtsR1GFP and NtsR1DTA mice were
trained to nose-poke for sucrose pellets and assessed for response accuracy and magazine
entries during FR1 training. E) Number of correct responses, F) number of incorrect responses
G) number of magazine entries and H) days required to complete FR1 training. I-L) NtsR1GFP
and NtsR1DTA mice were tested on a PR schedule until the number of rewards earned varied
<10% over 3 consecutive days. I) Average stable PR breakpoint and J) percentage of correct
responses over the three stable PR days. K) PR breakpoint was assessed after animals
received ad lib access to sucrose rewards the night before testing. L) NtsR1GFP and NtsR1DTA
mice were tested one hour after treatment with either PBS or leptin (5mg/kg, i.p.). NtsR1GFP
n=6, and NtsR1DTA =10, n.s.=not significant, *p < 0.05, **p < 0.01, analyzed via repeated
measures two-way ANOVA with Bonferroni post-tests. All graphed data represent mean ±
SEM.
166
Figure 23. Loss of VTA NtsR1 neurons alters response to amphetamine. A) Locomotor
activity of NtsR1GFP and NtsR1DTA mice in open field boxes during acclimation (Acc), treatment
with PBS, and either PBS (Test A) or D1R antagonist SCH23390 (0.1mg/kg, i.p.) (Test B). Data
represent average distance traveled per 5 min interval ± SEM (NtsR1GFP n=6, and NtsR1DTA
n=10). B) Mean distance traveled during treatment period ± SEM, analyzed by two-way
ANOVA. C) Percentage of distance traveled in the center zone of boxes over each testing
period. D) Open field locomotor activity of NtsR1GFP and NtsR1DTA mice after treatment with
PBS and AMPH (4mg/kg, i.p.). Data represent average distance traveled per 5 min interval ±
SEM (NtsR1GFP n=6, and NtsR1DTA n=10). E) Mean difference between locomotor activity after
AMPH treatment relative to PBS, **p=0.003. F) Percentage of distance traveled in the center
zone over each period. See Fig. 24 for additional anxiety data. G) Representative heat maps
demonstrating mouse location during acclimation, PBS, and AMPH treatment. H) cFos
expression in the NA (-1.34 bregma) of NtsR1GFP and NtsR1DTA treated with PBS or AMPH 90
minutes prior to perfusion). aca = anterior commissure; NAc = nucleus accumbens core; NAs =
nucleus accumbens shell. I) Number of cFos positive (cFos+) cells in NA. Graphed data
represent mean ± SEM, analyzed by two-way ANOVA. ƗƗƗƗ p<0.001, ƗƗƗ p<0.001, indicates
significant difference between PBS and amphetamine treatment within each group, (NtsR1GFP
PBS n=3, AMPH=3; NtsR1DTA PBS n=3, AMPH n=5).
167
Figure 24. Anxiety-like behavior assessed via elevated-plus maze. No significant
differences were found between groups in A) percentage of time spent on open arms or B)
number of open arm entries (NtsR1GFP n=4, NtsR1DTA n=7).
Figure 25. Ablation of VTA NtsR1 neurons decreases markers of DA signaling. Post-hoc
analysis of A) tyrosine hydroxylase (TH) and B) dopamine transporter (DAT) immunoreactivity
in the NA and OFT (-1.50 bregma) of NtsR1GFP and NtsR1DTA mice perfused 7-11 months after
surgery. Scale bars = 100 µm. White boxes identify digitally enlarged areas from each image.
C) NtsR1Cre mice were injected unilaterally with AAV-DTA to ablate VTA NtsR1 neurons or AAVGFP as a control. The VTA and NA were microdissected separately from each side of the brain
and expression of DA-related genes was assessed at 16 wk post-surgery in the D) VTA and E)
NA. Fold change was determined for each animal relative to the un-injected side. Data are
expressed as mean ± SEM (NtsR1GFP n=6-7, NtsR1DTA n=8-9). Significant differences were
determined by unpaired t-test *p < 0.5, **p < 0.1, ***p < 0.001. aca = anterior commissure.
168
Figure 26. Virally-induced vs. endogenous GFP reporter expression for identification of
VTA NtsR1 neurons. A) GFP expression induced by Cre-inducible AAV-GFP injected into the
VTA of NtsR1Cre;GFP transgenic mice. Yellow arrows indicate NtsR1 neurons with reduced
GFP expression that do not express endogenous L10-GFP and colocalize with TH. B)
Endogenous L10-GFP expression in the VTA of uninjected NtsR1Cre;GFP mice reveals fewer
labeled neurons compared to AAV-GFP-injected mice of the same genotype. Scale bar
represents 100 µm. ip=interpeduncular nucleus, ml=medial lemniscus.
169
REFERENCES
170
REFERENCES
1
Soleymani, T., Daniel, S. & Garvey, W. T. Weight maintenance: challenges, tools and
strategies for primary care physicians. Obesity reviews : an official journal of the
International Association for the Study of Obesity 17, 81-93, doi:10.1111/obr.12322
(2016).
2
Day, J. J., Roitman, M. F., Wightman, R. M. & Carelli, R. M. Associative learning
mediates dynamic shifts in dopamine signaling in the nucleus accumbens. Nature
neuroscience 10, 1020-1028, doi:10.1038/nn1923 (2007).
3
McCullough, L. D., Cousins, M. S. & Salamone, J. D. The role of nucleus accumbens
dopamine in responding on a continuous reinforcement operant schedule: a
neurochemical and behavioral study. Pharmacology, biochemistry, and behavior 46,
581-586 (1993).
4
Zhou, Q. Y. & Palmiter, R. D. Dopamine-deficient mice are severely hypoactive, adipsic,
and aphagic. Cell 83, 1197-1209 (1995).
5
Beeler, J. A., Faust, R. P., Turkson, S., Ye, H. & Zhuang, X. Low Dopamine D2 Receptor
Increases Vulnerability to Obesity Via Reduced Physical Activity Not Increased
Appetitive Motivation. Biological psychiatry, doi:10.1016/j.biopsych.2015.07.009 (2015).
6
Stice, E., Spoor, S., Bohon, C. & Small, D. M. Relation between obesity and blunted
striatal response to food is moderated by TaqIA A1 allele. Science (New York, N.Y.) 322,
449-452, doi:10.1126/science.1161550 (2008).
7
Johnson, P. M. & Kenny, P. J. Dopamine D2 receptors in addiction-like reward
dysfunction and compulsive eating in obese rats. Nature neuroscience 13, 635-641,
doi:10.1038/nn.2519 (2010).
8
Lammel, S., Ion, D. I., Roeper, J. & Malenka, R. C. Projection-specific modulation of
dopamine neuron synapses by aversive and rewarding stimuli. Neuron 70, 855-862,
doi:10.1016/j.neuron.2011.03.025 (2011).
9
Lammel, S. et al. Input-specific control of reward and aversion in the ventral tegmental
area. Nature 491, 212-217, doi:10.1038/nature11527 (2012).
10
Lammel, S. et al. Unique properties of mesoprefrontal neurons within a dual
mesocorticolimbic dopamine system. Neuron 57, 760-773,
doi:10.1016/j.neuron.2008.01.022 (2008).
11
Root, D. H. et al. Single rodent mesohabenular axons release glutamate and GABA.
Nature neuroscience 17, 1543-1551, doi:10.1038/nn.3823
http://www.nature.com/neuro/journal/v17/n11/abs/nn.3823.html#supplementaryinformation (2014).
171
12
Stamatakis, A. M. et al. A unique population of ventral tegmental area neurons inhibits
the lateral habenula to promote reward. Neuron 80, 1039-1053,
doi:10.1016/j.neuron.2013.08.023 (2013).
13
Reynolds, S. M. & Berridge, K. C. Positive and negative motivation in nucleus
accumbens shell: bivalent rostrocaudal gradients for GABA-elicited eating, taste
"liking"/"disliking" reactions, place preference/avoidance, and fear. The Journal of
neuroscience : the official journal of the Society for Neuroscience 22, 7308-7320,
doi:20026734 (2002).
14
Kalivas, P. W., Burgess, S. K., Nemeroff, C. B. & Prange, A. J., Jr. Behavioral and
neurochemical effects of neurotensin microinjection into the ventral tegmental area of
the rat. Neuroscience 8, 495-505 (1983).
15
Vittoz, N. M. & Berridge, C. W. Hypocretin/orexin selectively increases dopamine efflux
within the prefrontal cortex: involvement of the ventral tegmental area.
Neuropsychopharmacology : official publication of the American College of
Neuropsychopharmacology 31, 384-395, doi:10.1038/sj.npp.1300807 (2006).
16
Wanat, M. J., Hopf, F. W., Stuber, G. D., Phillips, P. E. & Bonci, A. Corticotropinreleasing factor increases mouse ventral tegmental area dopamine neuron firing through
a protein kinase C-dependent enhancement of Ih. The Journal of physiology 586, 21572170, doi:10.1113/jphysiol.2007.150078 (2008).
17
Anderberg, R. H., Anefors, C., Bergquist, F., Nissbrandt, H. & Skibicka, K. P. Dopamine
signaling in the amygdala, increased by food ingestion and GLP-1, regulates feeding
behavior. Physiology & behavior 136, 135-144, doi:10.1016/j.physbeh.2014.02.026
(2014).
18
Cador, M., Kelley, A. E., Le Moal, M. & Stinus, L. Ventral tegmental area infusion of
substance P, neurotensin and enkephalin: differential effects on feeding behavior.
Neuroscience 18, 659-669 (1986).
19
Elliott, P. J. & Nemeroff, C. B. Repeated neurotensin administration in the ventral
tegmental area: effects on baseline and D-amphetamine-induced locomotor activity.
Neuroscience letters 68, 239-244 (1986).
20
Feifel, D., Goldenberg, J., Melendez, G. & Shilling, P. D. The acute and subchronic
effects of a brain-penetrating, neurotensin-1 receptor agonist on feeding, body weight
and temperature. Neuropharmacology 58, 195-198,
doi:10.1016/j.neuropharm.2009.07.001 (2010).
21
Lepee-Lorgeoux, I., Betancur, C., Rostene, W. & Pelaprat, D. Differential ontogenetic
patterns of levocabastine-sensitive neurotensin NT2 receptors and of NT1 receptors in
the rat brain revealed by in situ hybridization. Brain research. Developmental brain
research 113, 115-131 (1999).
22
Palacios, J. M., Pazos, A., Dietl, M. M., Schlumpf, M. & Lichtensteiger, W. The ontogeny
of brain neurotensin receptors studied by autoradiography. Neuroscience 25, 307-317
(1988).
172
23
Sotty, F. et al. Differential effects of neurotensin on dopamine release in the caudal and
rostral nucleus accumbens: a combined in vivo electrochemical and electrophysiological
study. Neuroscience 85, 1173-1182 (1998).
24
Mazei-Robison, M. S. & Nestler, E. J. Opiate-induced molecular and cellular plasticity of
ventral tegmental area and locus coeruleus catecholamine neurons. Cold Spring Harbor
perspectives in medicine 2, a012070, doi:10.1101/cshperspect.a012070 (2012).
25
Opland, D. et al. Loss of neurotensin receptor-1 disrupts the control of the mesolimbic
dopamine system by leptin and promotes hedonic feeding and obesity. Molecular
metabolism 2, 423-434, doi:10.1016/j.molmet.2013.07.008 (2013).
26
Pei, H., Sutton, A. K., Burnett, K. H., Fuller, P. M. & Olson, D. P. AVP neurons in the
paraventricular nucleus of the hypothalamus regulate feeding. Molecular metabolism 3,
209-215, doi:10.1016/j.molmet.2013.12.006 (2014).
27
Halaas, J. L. et al. Weight-reducing effects of the plasma protein encoded by the obese
gene. Science (New York, N.Y.) 269, 543-546 (1995).
28
Fulton, S., Woodside, B. & Shizgal, P. Modulation of brain reward circuitry by leptin.
Science (New York, N.Y.) 287, 125-128 (2000).
29
Scheggi, S., Secci, M. E., Marchese, G., De Montis, M. G. & Gambarana, C. Influence of
palatability on motivation to operate for caloric and non-caloric food in non food-deprived
and food-deprived rats. Neuroscience 236, 320-331,
doi:10.1016/j.neuroscience.2013.01.027 (2013).
30
Sharma, S., Hryhorczuk, C. & Fulton, S. Progressive-ratio responding for palatable highfat and high-sugar food in mice. Journal of visualized experiments : JoVE, e3754,
doi:10.3791/3754 (2012).
31
Robinson, T. E., Mocsary, Z., Camp, D. M. & Whishaw, I. Q. Time course of recovery of
extracellular dopamine following partial damage to the nigrostriatal dopamine system.
The Journal of neuroscience : the official journal of the Society for Neuroscience 14,
2687-2696 (1994).
32
Khan, S. et al. Survival of a Novel Subset of Midbrain Dopaminergic Neurons Projecting
to the Lateral Septum Is Dependent on NeuroD Proteins. The Journal of neuroscience :
the official journal of the Society for Neuroscience 37, 2305-2316,
doi:10.1523/jneurosci.2414-16.2016 (2017).
33
Tanaka, K., Masu, M. & Nakanishi, S. Structure and functional expression of the cloned
rat neurotensin receptor. Neuron 4, 847-854 (1990).
34
Steinberg, R. et al. SR 48692, a non-peptide neurotensin receptor antagonist
differentially affects neurotensin-induced behaviour and changes in dopaminergic
transmission. Neuroscience 59, 921-929 (1994).
35
Remaury, A. et al. Targeted inactivation of the neurotensin type 1 receptor reveals its
role in body temperature control and feeding behavior but not in analgesia. Brain
research 953, 63-72 (2002).
173
36
Rouibi, K., Bose, P., Rompre, P. P. & Warren, R. A. Ventral Midbrain NTS1 Receptors
Mediate Conditioned Reward Induced by the Neurotensin Analog, D-Tyr[11]neurotensin.
Frontiers in neuroscience 9, 470, doi:10.3389/fnins.2015.00470 (2015).
37
Kempadoo, K. A. et al. Hypothalamic neurotensin projections promote reward by
enhancing glutamate transmission in the VTA. The Journal of neuroscience : the official
journal of the Society for Neuroscience 33, 7618-7626, doi:10.1523/jneurosci.258812.2013 (2013).
38
Piccart, E., Courtney, N. A., Branch, S. Y., Ford, C. P. & Beckstead, M. J. Neurotensin
Induces Presynaptic Depression of D2 Dopamine Autoreceptor-Mediated
Neurotransmission in Midbrain Dopaminergic Neurons. The Journal of neuroscience :
the official journal of the Society for Neuroscience 35, 11144-11152,
doi:10.1523/jneurosci.3816-14.2015 (2015).
39
Yamauchi, R. et al. Neurotensin type 2 receptor is involved in fear memory in mice.
Journal of neurochemistry 102, 1669-1676, doi:10.1111/j.1471-4159.2007.04805.x
(2007).
40
Ouachikh, O., Dieb, W., Durif, F. & Hafidi, A. Differential behavioral reinforcement effects
of dopamine receptor agonists in the rat with bilateral lesion of the posterior ventral
tegmental area. Behavioural brain research 252, 24-31, doi:10.1016/j.bbr.2013.05.042
(2013).
41
Drui, G. et al. Loss of dopaminergic nigrostriatal neurons accounts for the motivational
and affective deficits in Parkinson's disease. Molecular psychiatry 19, 358-367,
doi:10.1038/mp.2013.3 (2014).
42
Pioli, E. Y. et al. Differential behavioral effects of partial bilateral lesions of ventral
tegmental area or substantia nigra pars compacta in rats. Neuroscience 153, 1213-1224,
doi:10.1016/j.neuroscience.2008.01.084 (2008).
43
Kim, E. R., Leckstrom, A. & Mizuno, T. M. Impaired anorectic effect of leptin in
neurotensin receptor 1-deficient mice. Behavioural brain research 194, 66-71,
doi:10.1016/j.bbr.2008.06.024 (2008).
44
Leshan, R. L. et al. Ventral tegmental area leptin receptor neurons specifically project to
and regulate cocaine- and amphetamine-regulated transcript neurons of the extended
central amygdala. The Journal of neuroscience : the official journal of the Society for
Neuroscience 30, 5713-5723, doi:10.1523/jneurosci.1001-10.2010 (2010).
45
Patterson, C. M. et al. Ventral tegmental area neurotensin signaling links the lateral
hypothalamus to locomotor activity and striatal dopamine efflux in male mice.
Endocrinology 156, 1692-1700, doi:10.1210/en.2014-1986 (2015).
46
Yates, J. W., Meij, J. T., Sullivan, J. R., Richtand, N. M. & Yu, L. Bimodal effect of
amphetamine on motor behaviors in C57BL/6 mice. Neuroscience letters 427, 66-70,
doi:10.1016/j.neulet.2007.09.011 (2007).
174
47
Kelley, A. E., Cador, M., Stinus, L. & Le Moal, M. Neurotensin, substance P, neurokininalpha, and enkephalin: injection into ventral tegmental area in the rat produces
differential effects on operant responding. Psychopharmacology 97, 243-252 (1989).
48
Leinninger, G. M. et al. Leptin action via neurotensin neurons controls orexin, the
mesolimbic dopamine system and energy balance. Cell metabolism 14, 313-323,
doi:10.1016/j.cmet.2011.06.016 (2011).
49
Soliman, G. A. et al. A simple qPCR-based method to detect correct insertion of
homologous targeting vectors in murine ES cells. Transgenic research 16, 665-670,
doi:10.1007/s11248-007-9110-2 (2007).
50
Keith B.J. Franklin, G. P. The Mouse Brain In Stereotaxic Coordinates. Third edn,
(Elsevier, 2007).
51
Richardson, N. R. & Roberts, D. C. Progressive ratio schedules in drug selfadministration studies in rats: a method to evaluate reinforcing efficacy. Journal of
neuroscience methods 66, 1-11 (1996).
52
Eagle, A. L. et al. Experience-Dependent Induction of Hippocampal DeltaFosB Controls
Learning. The Journal of neuroscience : the official journal of the Society for
Neuroscience 35, 13773-13783, doi:10.1523/jneurosci.2083-15.2015 (2015).
53
Tschop, M. H. et al. A guide to analysis of mouse energy metabolism. Nature methods 9,
57-63, doi:10.1038/nmeth.1806 (2012).
175
Chapter 5. A Central Neurotensin Circuit That
Coordinates Weight Loss Behaviors
Authors: Hillary L. Woodworth, Bethany G. Beekly, Hannah M. Batchelor, Raluca Bugescu,
Patricia Perez-Bonilla, Laura E. Schroeder, and Gina M. Leinninger
This chapter is a modified version of a manuscript under review
5.1 Abstract
The central mechanism by which neurotensin (Nts) potentiates weight loss has remained
elusive. We leveraged chemogenetics to reveal that Nts-expressing neurons of the lateral
hypothalamic area (LHA) promote weight loss by increasing volitional activity and restraining
food intake. Intriguingly, these dual weight loss behaviors are mediated by distinct signaling
pathways: Nts action via NtsR1 is required for the anorectic effect of the LHA Nts circuit, but not
for regulation of locomotor or drinking behavior. Furthermore, although LHA Nts neurons
cannot reduce intake of freely available obesogenic foods, they effectively restrain motivated
feeding in hungry, weight-restricted animals. LHA Nts neurons are thus vital mediators of
central Nts action, particularly in the face of negative energy balance. Enhanced action via the
LHA Nts circuit may be useful to suppress the increased appetite that occurs after lifestylemediated weight and prevent weight regain.
5.2 Introduction
Obesity is a formidable health concern yet diet and exercise remain the only effective
non-surgical treatments to support weight loss1. Individuals who lose weight via lifestyle
176
modification experience compensatory increases in appetite and diminished metabolic rate, and
as a result, most regain weight2,3. Understanding how the brain coordinates feeding and energy
expenditure is therefore crucial to identify strategies that support sustained weight loss.
Dopamine (DA) released from the ventral tegmental area (VTA) and substantia nigra
(SN) is essential for feeding behavior, volitional physical activity, and the maintenance of body
weight4. In particular, VTA DA released to the nucleus accumbens (NA) modifies food seeking
and “wanting” of palatable foods that can override homeostatic need, leading to
overconsumption of calorie-rich food and weight gain5-7. Indeed, DA signaling is altered in
obesity8,9 but broad pharmacologic manipulation of DA action (with effects in the NA and other
sites of DA release) provides only modest weight loss1. Selective modulation of mesolimbic DA
signaling may be useful to modulate feeding and weight without off-target effects. One possible
candidate to modify mesolimbic DA action and body weight is the neuropeptide, neurotensin
(Nts). Direct application of Nts to the VTA suppresses food intake, increases locomotor activity,
and increases DA release to the NA10-12. Nts signals via Nts receptors 1 and 2 (NtsR1 and
NtsR2), and NtsR1 in particular is expressed on a subset of VTA DA neurons and has been
implicated in Nts-mediated suppression of feeding13-15. Although Nts expression is reduced in
the brain of obese animals16, treatment with NtsR1 agonists reduces their food intake and
promotes weight loss13. Thus, Nts is a putative anorectic signal, but the neural circuits by which
Nts engages the mesolimbic DA system to coordinate energy balance remain to be elucidated.
An important source of central Nts originates from the lateral hypothalamic area (LHA), a
crucial hub for coordinating peripheral energy cues with DA-mediated motivated behaviors to
regulate body weight14,17. The numerous Nts-expressing neurons in the LHA are distinct from
orexigenic neurons expressing melanin-concentrating hormone and orexin/hypocretin, project to
the VTA and are activated by signals that suppress feeding such as the appetite-suppressing
177
hormone, leptin18. Indeed, loss of leptin signaling via LHA Nts neurons increases adiposity
through diminished volitional physical activity, and disrupts coordination between peripheral
energy status and motivated feeding behavior18,19. By contrast, experimental activation of LHA
Nts neurons increases Nts release in the VTA, promotes NA DA release via NtsR1, and
enhances locomotor activity20. We therefore hypothesized that LHA Nts neurons are
physiological mediators of Nts-mediated weight loss behaviors. Using a chemogenetic strategy
(DREADDs) to selectively activate LHA Nts neurons in the presence and absence of NtsR1, we
reveal an important role for these neurons, and specifically for Nts action via NtsR1 in regulating
body weight.
5.3 Results
To experimentally activate LHA Nts neurons and simultaneously determine the
requirement for Nts signaling via NtsR1, we crossed NtsCre mice to a NtsR1 knockout line,
generating NtsCre mice that have either intact or absent NtsR1 signaling (NtsCre;++ and
NtsCre;NtsR1KOKO mice); these mice are henceforth referred to as WT and NtsR1KO. Adult WT
and NtsR1KO mice were injected with Cre-inducible AAV-hM3Dq-mCherry in the LHA to
express excitatory DREADD receptors selectively in LHA Nts neurons (Fig. 27A). Treating mice
with clozapine-N-oxide (CNO) induced cFos in mCherry-labeled LHA Nts neurons, verifying that
this method activates LHA Nts neurons (Fig. 27B). We confirmed that WT and NtsR1KO mice
have similar amounts of mCherry-labeled Nts cell bodies in the LHA and terminals in the VTA,
indicating that developmental deletion of NtsR1 does not structurally disrupt the LHA Nts circuit
(Fig. 27 C, D). Additionally, NtsR1KO mice lack VTA Ntsr1, but they do not exhibit any
compensatory increase in the other signaling receptor for Nts, NtsR2, (Fig. 27Ee). Furthermore,
although LHA Nts neurons project to the VTA and within the LHA14,19, the dearth of LHA NtsR1
neurons suggests that Nts signaling is predominantly mediated via the dense population of VTA
NtsR1 neurons (Fig. 27F). Together these data confirm an intact LHA Nts projection to the
178
NtsR1-rich VTA, and that activating LHA Nts neurons in WT and NtsR1KO mice can reveal the
physiological role of Nts action via this circuit
Acute Activation of LHA Nts Neurons Promotes Activity and Suppresses Feeding: We
first examined how activation of LHA Nts neurons alters energy balance by analyzing WT and
NtsR1KO mice in metabolic chambers after single injections of VEH or CNO. Activation of LHA
Nts neurons robustly increased water intake over 8 hr in WT mice and (to a lesser extent) in
NtsR1KO mice, suggesting that NtsR1 is not essential for LHA Nts-induced drinking (Fig. 28A,
B). WT and NtsR1KO mice also exhibited increased locomotor activity and energy expenditure
for several hours after CNO-mediated activation of LHA Nts neurons (Fig. 28C-F). CNO-treated
mice were less active during the dark cycle, presumably to compensate for increased light cycle
activity, yet the locomotor activity over 24 hr was significantly increased in WT but not NtsR1KO
mice (Fig. 29A-C). Energy expenditure over 24 hr was elevated in both WT and NtsR1KO mice
(Fig. 29D, E, p=0.051 for NtsR1KO group), indicating that that activation of LHA Nts neurons
enhances caloric usage in an NtsR1-independent manner. Given the increased energy
demands induced by activation of LHA Nts neurons, we examined whether WT or NtsR1KO
mice consumed more calories to maintain energy balance. Interestingly, WT mice did not
increase feeding after CNO injection, when they are also most active (Fig. 28G vs. C), and
reduced feeding during the dark cycle resulting in decreased total food intake over 24 hr (Fig.
29F-H). By contrast, NtsR1KO mice increased their food intake immediately after CNO injection
and minimally reduced it throughout the dark cycle, resulting in no feeding difference over 24 hr
compared to VEH treated mice (Fig 28H, Fig 29F-H). While activation of LHA Nts neurons in
WT mice suppressed feeding, increased energy expenditure and resulted in weight loss, the
NtsR1KO mice retained weight due to their compensatory food intake (Fig. 28I). Collectively,
these data suggest that activation of LHA Nts neurons promotes locomotor activity and energy
179
expenditure, and that Nts signaling via NtsR1 is required to concomitantly suppress feeding and
promote weight loss.
To verify the requirement for NtsR1 in LHA Nts-induced anorectic behavior, we pretreated WT and NtsR1KO mice with the NtsR1 antagonist SR48692 (0.3 mg/kg, i.p.), then
administered VEH or CNO to activate LHA Nts neurons. The NtsR1 antagonist had no effect on
the CNO-induced water intake or locomotor activity of WT and NtsR1KO mice (Fig. 30A, B, D,
E), confirming that LHA Nts neurons promote these behaviors by an NtsR1-indpendent
mechanism. By contrast, the LHA Nts-mediated reduction of chow intake over 24 hr was
abolished in WT mice pre-treated with the NtsR1 antagonist (Fig. 30C). Thus, activation of LHA
Nts neurons while NtsR1 signaling was either pharmacologically or genetically disrupted
promoted increased feeding during the light cycle, perhaps to compensate for increased energy
expenditure (Fig. 31A, B, Fig. 28H). These data suggest that NtsR1 is necessary for LHA Nts
neurons to acutely suppress feeding. Since NtsR1 is expressed on VTA DA neurons14 and
activation of LHA Nts neurons promotes DA release20, we next investigated whether DA
signaling is necessary for LHA Nts-induced weight-loss behaviors. Pre-treatment with the D1
receptor antagonist SCH23390 (0.1 mg/kg i.p.) prior to activating LHA Nts neurons did not block
drinking behavior in WT mice (Fig. 30G). Drinking was generally blunted in NtsR1KO mice
during this experiment as they acclimated to the lixits in the metabolic cages, but the D1
receptor antagonist did not significantly block their water intake compared to PBS treatment
(Fig. 30J). Together these data suggest that DA signaling via D1R is not required LHA Ntsinduced water intake. Consistent with previous work20, D1 receptor antagonism blunted LHA
Nts-induced locomotor activity in WT and NtsR1KO mice (Fig. 30H, K, p=0.06 for NtsR1KO
mice). D1R blockade also abolished the ability of LHA Nts neurons to suppress feeding in WT
mice, similar to the effect of disrupting NtsR1 signaling (Fig. 30I, Fig. 31C, D). D1R blockade
did not alter LHA Nts-induced hypophagia in NtsR1KO mice, as lack of NtsR1 on VTA DA
180
neurons likely impedes the ability of LHA Nts neurons to induce DA release to the NA. In sum,
these data indicate that NtsR1 and D1 signaling are required for LHA Nts neurons to acutely
restrain food intake.
LHA Nts Action Promotes Sustained Weight Loss: To determine if LHA Nts action could
sustain weight loss, we activated the LHA Nts neurons of WT mice in their home cages for 5
consecutive days. Similar to our previous observations, activating LHA Nts neurons nonsignificantly diminished chow intake on day 1 (Fig. 32A, p=0.14), but did not alter feeding on
days 2-5. The increased error of hand-weighing chow from home cages, compared to the
previous automated measurements from metabolic cages likely reduced our ability to detect
significant feeding differences on day 1. Nonetheless, WT mice lost weight after the first
injection of CNO and maintained that reduced body weight throughout the study (Fig. 32B).
Given that acute activation of LHA Nts neurons promoted weight loss via both suppressing
feeding and increasing physical activity and energy expenditure, we measured the physical
activity of mice in locomotor chambers for 1 hr after their final VEH or CNO treatment on day 5.
We observed a strong trend towards increased activity in CNO-treated mice (Fig. 32C, p=0.06),
suggesting that chronic activation of LHA Nts neurons maintains elevated locomotor activity and
presumably increased energy expenditure. Chronic activation of LHA Nts neurons also
sustained vigorous water consumption throughout the study (Fig. 32D). Importantly, CNO
treatment had no effect on WT or NtsR1KO mice expressing Cre-inducible channel rhodopsin
(ChR) in LHA Nts neurons instead of hM3Dq-mCherry, confirming that our results are not due to
off-target effects of CNO (Fig. 33). Collectively, these data demonstrate that repeated activation
of LHA Nts neurons supports sustained weight loss.
Role of LHA Nts Neurons in Palatable Food Intake: Next we investigated whether
activating LHA Nts neurons could support weight loss in mice made obese by free access to a
181
palatable high fat (45%), high sucrose diet (HF diet). Obese WT mice expressing hM3DqmCherry in LHA Nts neurons were given daily treatments of VEH or CNO while assessed in
metabolic chambers. As in normal weight mice, chronic activation of LHA Nts neurons
promoted locomotor activity immediately after CNO injection, followed by a compensatory
decrease in activity during the dark cycle (Fig. 34A, B). Despite a trend toward increased total
locomotor activity over 5 days in CNO-treated mice (p=0.07, data not shown), chronic activation
of LHA Nts neurons did not significantly increase energy expenditure in obese mice as observed
in lean animals (Fig. 34C vs. Fig. 28E, F, Fig. 29D, E). Whereas activating LHA Nts neurons
suppressed feeding in normal weight mice, activation in obese mice increased intake of the
palatable HF diet during the light cycle with no subsequent suppression of feeding during the
dark phase (Fig. 34D, E). As a result, CNO-treated mice maintained their obesity while VEHtreated controls slightly lost weight during the experiment due to handling stress (Fig. 34F).
Thus, although activation of LHA Nts neurons promoted locomotor activity in obese mice it was
insufficient to offset the consumption of freely available palatable food necessary to support
weight loss.
Prolonged obesity disrupts DA signaling8,9, hence activation of LHA Nts neurons in
profoundly obese mice may not be able to appropriately modify mesolimbic DA signaling to
promote weight loss behaviors. We therefore tested whether LHA Nts neurons could prevent
normal weight mice from HF diet-induced weight gain. Lean chow-fed WT mice were switched
to ad lib palatable HF diet followed by daily VEH or CNO treatments to activate LHA Nts
neurons. Similar to obese mice, activation of LHA Nts neurons caused lean WT mice to
consume significantly more palatable HF diet than VEH-treated controls (Fig. 35A, B). Although
activation of LHA Nts neurons also increased locomotor activity (Fig. 35C, measured on day 5),
any concomitant increase in energy expenditure was counteracted by increased food intake,
182
leading to weight gain (Fig. 35D). Thus, while activation of LHA Nts neurons suppresses chow
intake, it cannot restrain consumption of freely accessible palatable foods that promote obesity.
LHA Nts Neurons Suppress Motivated Feeding: VTA DA signaling modifies the
motivation to obtain food rewards (e.g. “wanting”) but their hedonic value (“liking”) is mediated
via separate systems7. Thus, LHA Nts neurons engaging the VTA are not anatomically
positioned to modify palatability-driven intake of freely accessible food, consistent with our
findings (Figs. 34 and 35). We reasoned, however, that LHA Nts neurons might suppress
motivated feeding via Nts-signaling to VTA NtsR1 neurons. We therefore asked if activating
LHA Nts neurons in fasted WT and NtsR1KO mice could blunt their motivation to eat once food
was restored21. CNO-mediated activation of LHA Nts neurons restrained re-feeding, which
persisted over 24 hr in WT mice (Fig. 36A, B, p=0.10 for NtsR1KOs at 24 hrs) and resulted in
less weight regain compared to VEH-treated controls (Fig. 36C). These data demonstrate that
LHA Nts neurons can suppress chow feeding and subsequent weight gain even under
conditions that increase the drive to feed, such as fasting-induced weight loss22.
To determine if activation of LHA Nts neurons suppresses the motivation to obtain
palatable food, WT and NtsR1KO mice were trained to nose-poke (e.g. work) for sucrose
pellets, and both groups learned the task equally well (Fig. 37A-D). We then examined whether
VEH treatment or CNO-mediated activation of LHA Nts neurons alters the progressive ratio
(PR) breakpoint for sucrose, a measure of the motivation to obtain rewards that is dependent on
mesolimbic DA signaling23. Activation of LHA Nts neurons prior to testing did not alter PR
breakpoints in ad lib fed (Sated) WT or NtsR1KO mice (Fig. 36D). Thus, activation of LHA Nts
neurons in an energy-replete context does not suppress freely accessible (Fig. 35) or operantreinforced intake of palatable food. By contrast, activation of LHA Nts neurons after overnight
fasting suppressed sucrose self-administration in WT but not NtsR1KO mice (Fig. 36D),
183
suggesting that LHA Nts action via NtsR1 reduces motivated sucrose “wanting” in the face of
physiologic energy deficit. Importantly, the increased locomotor activity of mice upon activation
of LHA Nts neurons did not impair their ability to obtain sucrose, as magazine entries were
unaffected by CNO treatment (Fig. 37E). Together, these data provide evidence that enhanced
LHA Nts neuronal activity counteracts the drive to consume palatable food in an energyrestricted state22,24, similar to what occurs with diet-induced weight loss.
Aversive stimuli or stress25,26 also suppress feeding, so we investigated if activation of
LHA Nts neurons promotes these conditions. First we determined whether WT and NtsR1KO
mice exhibited any aversion for chambers paired with either VEH or CNO. WT mice
demonstrated neither aversion nor preference for the CNO-paired chamber. By contrast,
NtsR1KO mice significantly preferred the chamber associated with CNO-mediated activation of
LHA Nts neurons (Fig. 38A), but CNO failed to modify place preference in mice expressing ChR
in LHA Nts neurons instead of hM3Dq-mCherry (Fig. 38B). Together, these data suggest that
intact LHA Nts signaling via NtsR1 does not suppress feeding due to aversion, but loss of action
via NtsR1 may underlie the reward-induced feeding observed in NtsR1KO and NtsR1antagonist treated mice. Furthermore, activation of LHA Nts neurons did not increase anxietylike behavior measured via elevated plus maze (EPM), thus this circuit does not mediate stressinduced suppression of feeding (Fig. 38C, D). Lastly, because we anecdotally observed CNOinduced behaviors such as gnawing, grooming, and digging, we examined if these were directed
at procuring food or toward any object, in this case a nestlet placed in the cage. Activation of
LHA Nts neurons significantly increased nestlet-shredding in both WT and NtsR1KO mice (Fig.
38E, F), consistent with a role for increased DA signaling in mediating arousal behavior27.
Collectively, these data indicate that LHA Nts-mediated suppression of food intake is not
confounded by aversion or anxiety, and is associated with locomotor behaviors directed toward
non-food objects.
184
5.4 Discussion
We demonstrate that the LHA Nts circuit increases volitional activity and energy
expenditure while suppressing food intake, and hence promotes dual behaviors to support
weight loss. Intriguingly LHA Nts neurons modulate these behaviors via distinct mechanisms:
Nts-mediated signaling via NtsR1 is required for the anorectic effects of this circuit but the
locomotor behavior occurs via an NtsR1-independent mechanism. Although LHA Nts neurons
cannot suppress intake of freely accessible palatable foods that promote weight gain, they do
restrain feeding in fasted, weight-reduced mice that are highly motivated to eat. Taken together,
these data suggest that activation of the LHA Nts circuit might be useful to maintain weight loss
in the face of negative energy balance. For example, restraining the increased appetitive drive
that occurs after an initial bout of weight loss may prevent weight regain and support further
weight loss via continued diet and exercise.
Previous work implicated a role for central Nts signaling in regulating feeding and
locomotor activity via modifying DA signaling10,11,13 yet the specific neural circuits mediating Nts
action remained unclear. Similar to the effects of pharmacologic Nts or NtsR1 agonists in the
VTA10-12,28, we demonstrate that activation of LHA Nts neurons that project to the VTA increased
physical activity while suppressing food intake in energy-replete mice. However, because LHA
Nts-induced locomotor activity did not depend on intact NtsR1, and was only mildly blunted by
D1R antagonism, it is likely controlled by a non-Nts signal released from LHA Nts neurons. By
contrast, both NtsR1 and D1R antagonism abolished LHA Nts-induced suppression of feeding,
implying obligate, overlapping roles for Nts and DA in this process. Given that LHA Nts neurons
directly engage VTA NtsR1 neurons to promote DA release14,20, our data suggest that induction
of DA signaling via this circuit functionally restrains feeding to potentiate weight loss. While DA
release to the NA is most commonly linked to increased feeding rather than suppression, DA
signaling is also necessary for the anorectic and weight-reducing effects of some medications29.
185
Thus, discrete DA circuits may differentially modify feeding, and LHA Nts-induced NtsR1
signaling may be a specific pathway to engage mesolimbic DA circuits that suppress appetite.
LHA Nts neurons do not provide an absolute brake on feeding, as their activation only
suppressed ad lib intake of chow but not HF diet. A possible explanation for this discrepancy is
that the palatability and/or caloric value of HF diet overrides the ability of LHA Nts neurons to
restrain intake. Mechanistically this may signify that LHA Nts neurons do not modify the opioid
signaling systems that encode food “liking” that can drive overconsumption7. Intake of sucrose
or fat increases DA release independently of taste, and this post-ingestive DA signaling is
important for coordinating caloric intake with energy demands45,46. Thus, it is possible that
activating LHA Nts modifies downstream mesolimbic DA circuits in a way that renders them
incapable of sensing post-ingestive cues, causing overconsumption of calorie-dense HF diet,
whereas post-ingestive DA signaling may play less of a role during intake of less palatable
chow. DA signaling also modifies the motivation to work for food rewards7 and hence may be
important for coordinating the motivation to consume food necessary for survival. For example,
the changes in circulating ghrelin and leptin during food-deprivation modulate VTA DA signaling
to increase the motivation to eat and restore energy balance30-32. Anorectic signals thus more
profoundly diminish feeding in fasted animals with an elevated drive to eat, similar to the effect
of exogenous leptin treatment, which reduces food intake more effectively in fasted state21,22.
Similarly, LHA Nts neurons robustly suppress fasting-induced chow intake and weight regain,
and may in fact contribute to leptin-mediated suppression of feeding19. Interestingly, activation
of LHA Nts neurons only suppressed DA-dependent operant responding for palatable food in
fasted WT mice, but not sated mice. Since feeding suppression is more easily detected when
levels of food “wanting” are high (as during fasting), our finding in consistent with the possibility
that LHA Nts neurons suppress feeding by reducing the “wanting” of food. The failure of LHA
186
Nts neurons to suppress operant palatable intake in the absence of NtsR1, however, supports
an essential role for Nts action via NtsR1 in limiting both ad lib and motivated feeding.
Some LHA Nts-mediated behaviors, including water intake and locomotor activity were
not different between WT and NtsR1KO mice, suggesting that they occur via NtsR1-indpendent
mechanisms. Nts may still contribute to these behaviors via engaging NtsR2, which is
predominantly expressed by astrocytes in the VTA (Woodworth et al., unpublished). Glia can
regulate neuronal signaling33, so the possibility of LHA Nts signaling acting through NtsR2 to
alter behavior deserves consideration in the future. Alternately, signals other than Nts that are
released from LHA Nts neurons might mediate drinking and locomotor activity. For example, at
least some LHA Nts neurons contain GABA34, which is presumably co-released with Nts upon
DREADD-induced activation. Similar to LHA Nts action, optogenetic activation of LHA GABA
neurons increases NA DA release35, water intake and non-appetitive gnawing36,37. Conversely,
optogenetic or pharmacogenetic activation of LHA GABA neurons increases feeding and either
does not affect or suppresses locomotor activity25,36,37, whereas LHA Nts activation suppresses
chow feeding and increases locomotor activity. Furthermore, LHA GABA neurons that project to
the VTA promote conditioned reward35 whereas LHA Nts neurons only induce such reward in
the absence of NtsR1. These discrepancies suggest that LHA Nts neurons do not fully overlap
with the population of LHA GABA neurons, and that perhaps only a subset of LHA Nts neurons
are also GABAergic. Within this putative subset of LHA Nts-GABA neurons, the loss of Nts
signaling via NtsR1 might bias GABAergic actions in the VTA, and could explain our observation
that activation of LHA Nts neurons in NtsR1KO mice causes conditioned place preference
similar to that induced by the activation of LHA GABA neurons. Similarly, hypothalamic Nts is
reduced in obesity, and this might also favor GABAergic signaling that potentiates feeding and
weight gain, as observed in rodents with experimentally activated LHA GABA neurons25,36,37.
Alternately, some LHA Nts neurons may co-express glutamate38 and the phenotype of LHA Nts
187
activation partially overlaps with activation of all LHA glutamatergic neurons as well. In
particular, LHA glutamatergic neurons suppress feeding in food-restricted animals39, similar to
LHA Nts neurons. By contrast, while LHA Nts activation is neither rewarding nor aversive, LHA
glutamatergic stimulation produces aversion39,40, which again supports the idea that Nts is coexpressed on some, but not all LHA glutamatergic neurons. Collectively, we hypothesize that
Nts is co-expressed on subsets of glutamatergic and GABAergic LHA neurons, and stimulation
of the LHA Nts population as a whole promotes a repertoire of beneficial behaviors that may
promote weight loss.
LHA Nts neurons may also differentially control locomotor, drinking and feeding
behaviors is via distinct projections. Since LHA Nts neurons robustly project to the VTA, where
NtsR1 is expressed almost exclusively on DA neurons, the NtsR1-dependent suppression of
feeding is likely mediated via LHA Nts inputs to the VTA. Determining whether VTA-projecting
LHA Nts neurons co-release glutamate, GABA, or a combination of both may provide insight
into the control of non-feeding behaviors. For instance, LHA Nts neurons might co-release
GABA onto VTA GABA interneurons, thereby disinhibiting DA neurons and promoting DA
signaling35. LHA Nts neurons also project locally to inhibit neighboring orexin (OX) neurons19,41,
which could decrease food intake, especially in a food-restricted state. The mechanism of this,
however, is likely independent of NtsR1 signaling given the lack of NtsR1 expression in the
LHA, and could explain why both WT and NtsR1KO mice have suppressed food intake with
LHA Nts activity in a fasted state. Our data thus reveal that LHA Nts neurons are important
mediators of central anorectic Nts action via NtsR1. Future work will be key to define the
additional signaling mechanisms by which LHA Nts neurons support weight loss behaviors.
188
5.5 Methods
Reagents: CNO was obtained from the NIH as part of the Rapid Access to Investigative
Drug Program funded by the NINDS. 40x CNO stock solutions were made by diluting with
PBS/10% beta-cyclodextrin (Sigma). VEH was PBS. SR48690 was purchased from Sigma and
20x stock solutions were made in 1% TWEEN. SCH23390 was also purchased from Sigma and
50x stock solutions were made in PBS. All stock solutions were aliquoted and stored at -20 until
use.
Animals: Mice were bred and housed in a 12h light/12h dark cycle and cared for by
Campus Animal Resources (CAR) at Michigan State University. Animals had ad lib access to
chow (Teklad 7913) and water unless otherwise noted. All animal protocols were approved by
the Institutional Animal Care and Use Committee (IACUC) at Michigan State University.
Generation of NtsR1IRES-Cre Knock-In Mice: An NtsR1IRES-Cre targeting vector was
generated by inserting an IRES-Cre sequence between the stop codon and the polyadenylation
site of the sequence encoding the 3’ end of the mouse Ntsr1 gene, with an frt-flanked Neo
cassette inserted upstream of the IRES-Cre. The linearized targeting vector was electroporated
into mouse R1 embryonic stem (ES) cells (129sv background) and cells were selected with
G418. DNA from ES cell clones was analyzed via qPCR for loss of homozygosity using
Taqman primer and probes for the genomic Ntsr1 insertion site (Forward: TCT GAT GTT GGA
CTT GGG TTC, Reverse: TCT GAT GTT GGA CTT GGG TTC, Probe: TCT GAT GTT GGA
CTT GGG TTC). NGF was used as a copy number control42. Putative positive ES clones were
expanded, confirmed for homologous recombination by Southern blot and injected into mouse
C57BL/6 blastocysts to generate chimeras. Chimeric males were mated with C57BL/6 females
(Jackson Laboratory), and germline transmission was determined initially via progeny coat
color, then confirmed via conventional PCR for IRES-Cre.
189
Breeding and Genotyping: To generate breeders, heterozygous Ntscre mice19 (Jackson
stock #017525) were mated to NtsR1KO+ (Jackson stock #005826) mice, and progeny with the
genotypes NtsCre;NtsR1KO+ and ++; NtsR1KO+ were subsequently mated to generate NtsCre;++
and NtsCre;NtsR1KOKO study animals. To maximize animal usage, study animals also arose from
the following crosses: NtsCre:++ X WT or NtsCre;NtsR1KOKO X ++;NtsR1KOKO. To visualize NtsR1
neurons, NtsR1IRES-Cre mice were crossed to homozygous Rosa26EGFP-L10a mice and progeny
heterozygous for both alleles were studied. Genotyping was performed with standard PCR
using the following primer sequences: Ntscre: common forward: 5' ATA GGC TGC TGA ACC
AGG AAC, reverse: 5' CCA AAA GAC GGC AAT ATG GT and WT reverse: 5’ CAA TCA CAA
TCA CAG GTC AAG AA. Rosa26EGFP-L10a : mutant forward: 5’ TCT ACA AAT GTG GTA GAT
CCA GGC, WT forward: 5’ GAG GGG AGT GTT GCA ATA CC and common reverse: 5’ CAG
ATG ACT ACC TAT CCT CCC. NtsR1KO: Forward: CTC TAA TGT GCC ACA GCT CAG AGA
G, common: CAG CAA CCT GGA CGT GAA CAC TGA C, Reverse: CCA AGC GGC TTC GGC
CAG TAA CGT T NtsR1IRES-Cre: Forward: GGA CGT GGT TTT CCT TTG AA, Reverse: AGG
CAA ATT TTG GTG TACG G.
Surgery: At 8-12 weeks of age, male NtsCre;++ and NtsCre:NtsR1KOKO mice received a
pre-surgical injection of carprofen (5mg/kg s.c.) and were anesthetized with 3-4% isoflurane/O2
in an induction chamber before being placed in a stereotaxic frame (Kopf). Under 1-2%
isoflurane, access holes were drilled in the skull allowing a guide cannula with stylet
(PlasticsOne) to be lowered into the brain target area. Mice were injected bilaterally with either
300 uL of AAV-hM3Dq-mCherry or AAV-ChR-mCherry (UNC vector core) in the LHA (AP: -1.34,
ML: -1.05, DV: -5.2 ). After 5 min to allow for virus absorption, the injector and cannula were
removed from the skull and the incision was closed using Vet Bond. Analysis began 1-2 weeks
after recovery. Mice were only included in the final study data if injections were confined to the
190
LHA on both sides. Approximately 90% of animals included in the study were bilaterally
targeted; however in 10% of cases, animals with robust unilateral targeting were included in the
study if CNO injection induced >1mL of water consumption, as analysis of several cohorts
revealed this as a reliable indicator of LHA Nts targeting. To visualize NtsR1 neurons, adult
male and female NtsR1Cre;GFP mice were bilaterally injected with 1uL FlpO adenovirus (Vector
Biolabs) into the lateral ventricles (A/P: -0.22, M/L: +/- 1.0, D/V: -2.0). Mice were perfused 10
days after surgery to permit sufficient time for FlpO-mediated excision of the frt-flanked Neo
cassette and GFP expression.
Metabolic Analysis: At 1-2 weeks post-surgery, mice were placed in TSE cages for
metabolic phenotyping (PhenoMaster, TSE Systems). After 24-48 hours of acclimation, mice
were i.p. injected 1-2 hr after the onset of the light cycle with PBS, SR48692 (0.3 mg/kg), or
SCH23390 (0.1mg/kg), followed by VEH or CNO (0.3 mg/kg) 30 min later. Mice were given a
24 hr washout between PBS and antagonist injections. They were continuously monitored for
food and water intake, locomotor activity, and energy expenditure. Ambient temperature was
maintained at 20-23˚C and the airflow rate through the chambers was adjusted to maintain an
oxygen differential around 0.3% at resting conditions. Metabolic parameters including VO2,
respiratory exchange ratio, and energy expenditure were assessed via indirect calorimetry by
comparing O2 and CO2 concentrations relative to a reference cage.
Gene Expression: Male 12-16wk old WT (++/++) and NtsR1KO mice (NtsR1KOKO) were
deeply anesthetized with sodium pentobarbital and tissue from the VTA was microdissected and
immediately snap frozen on dry ice and stored at -80˚C (n=10-11 per group). RNA was
extracted using Trizol (Invitrogen) and 200 ng samples were converted to cDNA using the
Superscript First Strand Synthesis System for RT-PCR (Invitrogen). Sample cDNAs were
analyzed in triplicate via quantitative RT-PCR for gene expression using TaqMan reagents and
191
an ABI 7500 (Applied Biosystems). With GAPDH expression as an internal control, relative
mRNA expression values are calculated by the 2-∆∆Ct method. Ntsr1 expression levels in 10 of
11 NtsR1KO mice were undetectable and fold change was reported as 0 for those samples.
Chronic Activation in Lean Mice: Chow-Experiments: Mice were injected with VEH or
CNO between 8-9AM once daily for five consecutive days in home cages while fed ad lib
standard chow (Harlan Teklad 7913). Food, water, and body weight were weighed prior to the
morning injection and again between 5-6pm. On day 5, locomotor activity was assessed in CPP
chambers described below. Animals were randomly assigned to one side of the chamber and
were allowed to acclimate for 30 min. Following acclimation, they received VEH or CNO and
locomotor activity was measured by laser beam breaks for 1 hr. The study was performed
using a cross-over design such that each animal received both VEH and CNO over the course
of two separate experiments, with 24 hr of rest between studies.
HF-Diet Experiments: As above, mice were injected once daily with VEH or CNO between 89AM in home cages with ad lib access to high fat, high sugar diet (D12451, Research Diets).
Mice received 24 hr of access to HF diet prior to the study. On day 5, locomotor activity was
assessed as described above, and injections were given for 10 consecutive days to allow time
for weight gain. These experiments were also performed using a cross-over design, however
mice were given a two-week washout period in between studies with access only to standard
chow between experiments.
Activation of LHA Nts Circuit in Obese Mice: Four week old male NtsCre;++ mice were
weaned onto 45% high fat, high sucrose diet (HF diet, D12451, Research Diets) to induce
obesity. After 6-8 months of HF diet consumption, AAV-hM3Dq-mCherry was stereotaxically
delivered in the LHA bilaterally as described above. Following a 2 wk recovery period, obese
mice were then analyzed in TSE metabolic cages as described above. Following two days of
192
acclimation, mice were divided into separate treatment groups and injected with VEH or CNO
for 5 consecutive days in TSE cages at 8AM each morning.
Operant Testing: Based on methods by Fulton et al.21, mice were food restricted to 90%
of their body weight and trained on a fixed ratio-1 (FR1) schedule until they achieved 75%
response accuracy with ≥20 rewards earned on 3 consecutive days. Training sessions were
terminated after 1 hr or when the animal had earned 50 rewards. Mice achieving these criteria
were then switched to ad lib food and trained on an FR5 schedule for 3 consecutive days. On
test days, mice were subject to a progressive ratio (PR) schedule were PR=[5e(R*0.2)]-5 with
R=number food rewards earned+1. Thus, the number of correct responses needed to earn a
sucrose reward increases as follows: 1, 2, 4, 6, 9, 12, 15, 20, 25, 32, 40, 50, 62, 77, 95 etc. The
PR breakpoint was recorded as the highest ratio completed for each 1 hr test session. Mice
were tested until they achieved stable PR which was defined as <10% variation in rewards
earned over 3 consecutive sessions.
Conditioned Place Preference (CPP): CPP boxes (San Diego Instruments) consisted of
a box divided into two chambers with different visual and tactile cues (gray wall and smooth
floor or striped wall and rough floor) separated by a small center chamber. Day 1 (Pre-test):
Mice were allowed to roam freely between chambers for 15 min. After pre-test data were
collected, an unbiased, counterbalanced strategy was then used to assign which chamber was
paired with either VEH or CNO injection, such that approximately half the mice received CNO
pairing in the preferred side and half received CNO in the non-preferred side. Days 2-5
(conditioning): Each morning, mice received an injection of VEH and were immediately placed in
the VEH-paired side for 30 min. After the session, mice were returned to their housing
environment to facilitate memory consolidation and 4 hours later, they were conditioned with
CNO for 30 minutes in the opposite chamber. Day 6 (post-test): Mice were again allowed two
193
roam freely amongst both chambers for 15 minutes. Time-spent and locomotor activity in each
side of the box was assessed by laser beam breaks and data were gathered using the
manufacturer’s software. One NtsR1KO animal was excluded for displaying strong sidepreference in the pre-test (>75% of time spent on that side).
Nestlet-Shredding: Immediately after receiving VEH or CNO injection, mice received a
white cotton pillow (Ancare) in their home cages, which was weighed prior to placement in the
cage. After 90 min, any intact remnants of the original pillow were removed from the cage and
allowed to air-dry overnight. The pillow remnants were weighed the following day.
Elevated Plus Maze (EPM): Mice were assessed for anxiety-like behavior using an
elevated plus maze (EPM) as previously described43. Briefly, the EPM apparatus was custombuilt based on plans from ANY-maze (www.anymaze.com, Stoelting Co.) and mice were given
free access to the open and closed arms for 5 minutes. Their behavior was recorded using a
digital CCD camera and the percentages of time spent in the open and closed arms were
analyzed using Topscan automated video tracking software (Clever Sys).
Fasting-Induced Re-feeding: Chow pellets were removed from home cages around 5PM
and mice were given a clean cage bottom to prevent feeding of food that may have fallen into
the bedding. Mice had ad lib access to water during food-deprivation. The following morning
between 8AM-9AM, fasted mice were given i.p. VEH or CNO and chow pellets were returned to
the feeder. Food intake, water intake, and body weight was measured at 1 hr and 24 hr after
injection. The study was performed using a cross-over design, such that half the mice received
VEH or CNO, and after 3 full days of recovery from fasting, the experiment was repeated with
the opposite treatment allowing each animal to serve as its own control.
194
Immunohistochemistry: Mice were treated with a lethal dose of i.p. pentobarbital
followed by transcardial perfusion with 10% neutral-buffered formalin (Fisher Scientific). Brains
were removed, post-fixed in 10% formalin overnight at 4˚C, dehydrated with 30% sucrose in
PBS for 2-3 days, and sectioned into 30 µm slices using a sliding microtome (Leica). Brain
sections were then analyzed by immunofluorescence or immunohistochemistry as previously
described14,19. For characterization of NtsR1 expression, sections from NtsR1Cre;GFP mice
were stained with chicken anti-GFP (1:2000, Abcam) followed by donkey anti-chicken
conjugated to AlexaFluor 488 (Jackson ImmunoResearch). For DREADD studies, WT and
NtsR1KO mice were treated with VEH or CNO 90 minutes prior to perfusion, and brain sections
were stained for cFos (1:500, goat, Santa Cruz) with secondary detection via DAB (Life
Technologies), followed by immunofluorescent detection of dsRed (1:1000, Clontech) as
described above. Brains were analyzed using an Olympus BX53 fluorescence microscope
outfitted with transmitted light to analyze DAB-labeled tissue, as well as FITC and Texas Red
filters. Microscope images were collected using Cell Sens software and a Qi-Click 12 Bit cooled
camera, and images were analyzed using Photoshop software (Adobe).
Statistics: Student’s t-tests and 2-way ANOVA were calculated using Prism 6
(GraphPad). Repeated measures two-way ANOVA with Sidak post-tests was used when each
animal was given both VEH and CNO, and when data from the same animals were collected at
different time points. For energy expenditure data, analysis of covariance (ANCOVA) was
computed in SPSS 22 (IBM). Body weight was analyzed as a covariate to correct for any
inherent differences it may have on metabolism44. Data were tested for homogeneity of
regression, independence of the covariate (body weight), and linearity of regression prior to
running the ANCOVA. For all data, *p<0.05, **p<0.01 and ***p<0.001. (#) is used to indicate
comparison to starting time line within a given group.
195
APPENDIX
196
Figure 27. Examination of the LHA NtsVTA circuit in WT and NtsR1KO mice. A) NtsCre
mice with either intact or developmentally deleted NtsR1 (WT or NtsR1KO mice) were injected
bilaterally in the LHA with cre-inducible AAV-hm3Dq-mCherry, permitting pharmacogenetic
activation of LHA Nts neurons by CNO injection. B) i.p CNO treatment induces cFos expression
in LHA Nts neurons (white arrows). C) LHA Nts neurons expressing hM3Dq-mCherry in WT and
NtsR1KO mice (scale bar=200µm). D) hM3Dq-mCherrry-labeled LHA Nts cell bodies in the LHA
and terminals in the VTA of WT mice. E) Ntsr1 and Ntsr2 mRNA expression in the VTA of WT
and NtsR1KO mice (n=10-11 per group). Data were analyzed by unpaired-test for each gene.
F) NtsR1 expression in NtsR1IRES-Cre;GFP mice in the LHA and VTA. For D and F, scale
bar=100µM. f=fornix, ml=medial lemniscus.
197
Figure 28. Acute activation of LHA Nts neurons promotes energy expenditure and
suppresses feeding.
198
Figure 28 (cont’d). VEH or CNO-treated WT and NtsR1KO mice were analyzed in TSE
metabolic cages to understand how acute LHA Nts neuron activation alters energy balance. In
A-H, each point represents 108 minutes and gray boxes denote the dark cycle. A, B) water
intake, C, D) locomotor activity, E, F) energy expenditure, and G, H) feeding in WT and
NtsR1KO mice. I) total change in body weight 24 hours post-injection. Data were analyzed by
repeated measures two-way ANOVA. WT n=10-11; NtsR1KO n=9-10.
Figure 29. Additional acute metabolic data in WT and NtsR1KO mice. Light refers to the
period 9 hours post VEH or CNO injection while dark refers to data collected during dark cycle
(gray background). A) Locomotor activity during the light cycle, B) dark cycle, and C) over 24
hours. D, E) Average energy expenditure over 24 hours with VEH or CNO injection. F) Weightadjusted food intake during the light cycle, G) dark cycle, and H) total over 24 hours. Bar graphs
were analyzed by repeated measures two-way ANOVA, while energy expenditure was analyzed
by ANCOVA. WT n=10-11; NtsR1KO n=9-10.
199
Figure 30. Acute NtsR1 or D1R blockade abolishes LHA Nts-induced suppression of
feeding. Mice were pretreated with PBS, SR48692 (NtsR1 antagonist) or SCH23390 (D1R
antagonist) 30 min. prior to VEH or CNO injection. Each bar reflects ingestive behavior or
locomotor activity over 24 hours post VEH or CNO injection. A, B, C) Water intake, locomotor
activity and feeding in WT mice pretreated with the NtsR1 antagonist. D, E, F) Water intake,
locomotor activity and feeding in NtsR1KO mice pretreated with a NtsR1 antagonist. G, H, I, J,
K, L) Same parameters in WT or NtsR1KO mice pretreated with a D1R antagonist (SCH23390).
Data were analyzed by repeated measures two-way ANOVA. WT n=10-11; NtsR1KO n=9-10.
200
Figure 31. Food intake separated by circadian period with NtsR1 or D1R antagonists.
A, B) Food intake in WT mice during light or dark phases with NtsR1 antagonist pre-treatment
or C, D) D1 receptor pre-treatment. E, F) Food intake in NtsR1KO mice during light or dark with
NtsR1 antagonist pre-treatment or G, H) D1R antagonist pre-treatment. Data were analyzed by
repeated measures two-way ANOVA.
201
Figure 32. Chronic activation of LHA Nts neurons induces mild weight loss in chow-fed
lean mice. WT and NtsR1KO mice were treated once daily with VEH or CNO for five
consecutive days. A) chow intake, B) body weight, C) 1 hr locomotor activity, and D) water
intake in WT mice (n=11). Data were analyzed by repeated-measures two-way ANOVA, except
for locomotor activity which was analyzed by paired t-test.
Figure 33. Chronic VEH or CNO injection in WTChR controls. A) Chow intake, B) body
weight, C) 1 hr locomotor activity, and D) water intake in WTChR controls (n=6). Data were
analyzed by repeated-measures two way ANOVA, except for locomotor activity which was
analyzed by paired t-test.
202
Figure 34. Repeated activation of LHA Nts neurons does not induce weight loss in
obesity. LHA Nts neurons were activated each morning for five consecutive days in dietinduced obese mice analyzed in TSE metabolic chambers. A) Daily locomotor activity during
the light cycle vs. B) dark cycle. C) Plot showing average rate of energy expenditure vs. body
weight. D) Food intake during light cycle compared to E) dark cycle. F) Percent original body
weight over five days of chronic VEH or CNO injections. VEH n=6, CNO n=5-6. Data were
analyzed by standard two-way ANOVA except for C which was analyzed by ANCOVA. (*)
indicates significant difference between VEH and CNO at given time point. In F, (#) represents
significant difference in body weight at days 4-5 compared to day 0 in the VEH group.
203
Figure 35. Chronic activation of LHA Nts neurons does not prevent weight gain in lean
mice on HF diet. Lean WT and NtsR1KO mice were injected each morning on VEH or CNO for
10 consecutive days with ad lib access to HF diet in home cages. A) HF diet intake during the
light cycle, B) total food consumed over 10 days, C) 1 hour locomotor activity, and D) body
weight in WT mice (n=10). (*) represents p<0.05 between VEH and CNO from Days 4-10. (#)
indicates p<0.05 for CNO time point compared to Day 1. Daily food intake and body weight
were analyzed by repeated-measures two-way ANOVA. Total food intake and locomotor
activity was analyzed by paired t-test.
204
Figure 36. Activation of LHA Nts neurons suppresses fasting-induced ad lib and
motivated food intake. WT and NtsR1KO mice were food-deprived overnight and received
VEH or CNO with food restoration the following morning. A, B) Ad lib chow re-feeding 1 and 24
hours after food restoration. C) Body weight gain during 24 hours of ad lib re-feeding after
overnight food-deprivation. D) PR breakpoint for sucrose pellets after VEH or CNO injection in
both fed and fasted states. WT n=9, NtsR1KO n=12, data were analyzed by repeated
measures two-way ANOVA.
205
Figure 37. Learning acquisition during operant training. WT and NtsR1KO mice were
trained to nose-poke for sucrose pellets on an FR1 schedule until they earned >20 rewards with
75% accuracy for 3 consecutive days. A, B, C) No differences were detected in total number of
active and inactive nose pokes, accuracy, and number of magazine during FR1 training. D) WT
and NtsR1KO mice required a similar number of training sessions to learn the task. E) CNO
treatment did not significantly increase the number of magazine entries during PR testing. WT
n=9; NtsR1KO n=12. Data were analyzed by repeated-measures two-way ANOVA (A,B,C,E) or
unpaired t-test (D).
206
Figure 38. Assessment of reward, anxiety, and repetitive behaviors associated with LHA
NtsNtsR1 circuit activation. CPP was used assess whether activation of LHA Nts neurons
could be either positively or negatively reinforcing. A) Time-spent in the CNO and VEH-paired
sides during the pre- and post-tests reveals that activation of LHA Nts neurons is rewarding in
NtsR1KO (n=15) but not WT (n=17) mice. B) No differences were detected in WTChR (n=12)
and NtsR1KOChR (n=10) controls. Data were analyzed by two-way ANOVA. Anxiety-like
behavior was assessed via EPM and no differences were detected in open arm C) entries or D)
time spent (WT+VEH n=10, WT+CNO n=10, NtsR1KO+VEH n=6, NtsR1KO+CNO n=8). E, F)
Nestlet weight 90 minutes after VEH or CNO injection in WT and NtsR1KO mice (WT+VEH n=8,
WT+CNO n=10, NtsR1KO+VEH n=6, NtsR1KO+CNO n=8). Nestlet-shredding and EPM data
were analyzed by standard two-way ANOVA while CPP was analyzed by repeated-measures
two-way ANOVA to compare pre-test to post-test.
207
REFERENCES
208
REFERENCES
1
Khera, R. et al. Association of Pharmacological Treatments for Obesity With Weight
Loss and Adverse Events: A Systematic Review and Meta-analysis. JAMA : the journal
of the American Medical Association 315, 2424-2434, doi:10.1001/jama.2016.7602
(2016).
2
Wing, R. R. & Hill, J. O. Successful weight loss maintenance. Annual review of nutrition
21, 323-341, doi:10.1146/annurev.nutr.21.1.323 (2001).
3
Sumithran, P. et al. Long-term persistence of hormonal adaptations to weight loss. The
New England journal of medicine 365, 1597-1604, doi:10.1056/NEJMoa1105816 (2011).
4
Zhou, Q. Y. & Palmiter, R. D. Dopamine-deficient mice are severely hypoactive, adipsic,
and aphagic. Cell 83, 1197-1209 (1995).
5
Ahn, S. & Phillips, A. G. Dopaminergic correlates of sensory-specific satiety in the
medial prefrontal cortex and nucleus accumbens of the rat. The Journal of neuroscience
: the official journal of the Society for Neuroscience 19, RC29 (1999).
6
Hernandez, L. & Hoebel, B. G. Feeding and hypothalamic stimulation increase
dopamine turnover in the accumbens. Physiology & behavior 44, 599-606 (1988).
7
Berridge, K. C., Ho, C. Y., Richard, J. M. & DiFeliceantonio, A. G. The tempted brain
eats: pleasure and desire circuits in obesity and eating disorders. Brain research 1350,
43-64, doi:10.1016/j.brainres.2010.04.003 (2010).
8
Stice, E., Spoor, S., Bohon, C. & Small, D. M. Relation between obesity and blunted
striatal response to food is moderated by TaqIA A1 allele. Science (New York, N.Y.) 322,
449-452, doi:10.1126/science.1161550 (2008).
9
Johnson, P. M. & Kenny, P. J. Dopamine D2 receptors in addiction-like reward
dysfunction and compulsive eating in obese rats. Nature neuroscience 13, 635-641,
doi:10.1038/nn.2519 (2010).
10
Cador, M., Kelley, A. E., Le Moal, M. & Stinus, L. Ventral tegmental area infusion of
substance P, neurotensin and enkephalin: differential effects on feeding behavior.
Neuroscience 18, 659-669 (1986).
11
Kelley, A. E., Cador, M., Stinus, L. & Le Moal, M. Neurotensin, substance P, neurokininalpha, and enkephalin: injection into ventral tegmental area in the rat produces
differential effects on operant responding. Psychopharmacology 97, 243-252 (1989).
12
Kalivas, P. W., Burgess, S. K., Nemeroff, C. B. & Prange, A. J., Jr. Behavioral and
neurochemical effects of neurotensin microinjection into the ventral tegmental area of
the rat. Neuroscience 8, 495-505 (1983).
209
13
Feifel, D., Goldenberg, J., Melendez, G. & Shilling, P. D. The acute and subchronic
effects of a brain-penetrating, neurotensin-1 receptor agonist on feeding, body weight
and temperature. Neuropharmacology 58, 195-198,
doi:10.1016/j.neuropharm.2009.07.001 (2010).
14
Opland, D. et al. Loss of neurotensin receptor-1 disrupts the control of the mesolimbic
dopamine system by leptin and promotes hedonic feeding and obesity. Molecular
metabolism 2, 423-434, doi:10.1016/j.molmet.2013.07.008 (2013).
15
Remaury, A. et al. Targeted inactivation of the neurotensin type 1 receptor reveals its
role in body temperature control and feeding behavior but not in analgesia. Brain
research 953, 63-72 (2002).
16
Beck, B., Stricker-Krongrad, A., Burlet, A., Nicolas, J. P. & Burlet, C. Changes in
hypothalamic neurotensin concentrations and food intake in rats fed a high fat diet.
International journal of obesity and related metabolic disorders : journal of the
International Association for the Study of Obesity 16, 361-366 (1992).
17
Brown, J. A., Woodworth, H. L. & Leinninger, G. M. To ingest or rest? Specialized roles
of lateral hypothalamic area neurons in coordinating energy balance. Frontiers in
systems neuroscience 9, 9, doi:10.3389/fnsys.2015.00009 (2015).
18
Brown, J. A. et al. Loss of Action via Neurotensin-Leptin Receptor Neurons Disrupts
Leptin and Ghrelin-Mediated Control of Energy Balance. Endocrinology,
doi:10.1210/en.2017-00122 (2017).
19
Leinninger, G. M. et al. Leptin action via neurotensin neurons controls orexin, the
mesolimbic dopamine system and energy balance. Cell metabolism 14, 313-323,
doi:10.1016/j.cmet.2011.06.016 (2011).
20
Patterson, C. M. et al. Ventral tegmental area neurotensin signaling links the lateral
hypothalamus to locomotor activity and striatal dopamine efflux in male mice.
Endocrinology 156, 1692-1700, doi:10.1210/en.2014-1986 (2015).
21
Sharma, S., Hryhorczuk, C. & Fulton, S. Progressive-ratio responding for palatable highfat and high-sugar food in mice. Journal of visualized experiments : JoVE, e3754,
doi:10.3791/3754 (2012).
22
Ahima, R. S. et al. Role of leptin in the neuroendocrine response to fasting. Nature 382,
250-252, doi:10.1038/382250a0 (1996).
23
Salamone, J. D., Correa, M., Farrar, A. & Mingote, S. M. Effort-related functions of
nucleus accumbens dopamine and associated forebrain circuits. Psychopharmacology
191, 461-482, doi:10.1007/s00213-006-0668-9 (2007).
24
van der Plasse, G. et al. Modulation of cue-induced firing of ventral tegmental area
dopamine neurons by leptin and ghrelin. International journal of obesity (2005) 39, 17421749, doi:10.1038/ijo.2015.131 (2015).
25
Jennings, J. H. et al. Visualizing hypothalamic network dynamics for appetitive and
consummatory behaviors. Cell 160, 516-527, doi:10.1016/j.cell.2014.12.026 (2015).
210
26
Stamatakis, A. M. et al. A unique population of ventral tegmental area neurons inhibits
the lateral habenula to promote reward. Neuron 80, 1039-1053,
doi:10.1016/j.neuron.2013.08.023 (2013).
27
Berridge, C. W. Neural substrates of psychostimulant-induced arousal.
Neuropsychopharmacology : official publication of the American College of
Neuropsychopharmacology 31, 2332-2340, doi:10.1038/sj.npp.1301159 (2006).
28
St-Gelais, F., Legault, M., Bourque, M. J., Rompre, P. P. & Trudeau, L. E. Role of
calcium in neurotensin-evoked enhancement in firing in mesencephalic dopamine
neurons. The Journal of neuroscience : the official journal of the Society for
Neuroscience 24, 2566-2574, doi:10.1523/jneurosci.5376-03.2004 (2004).
29
Kalyanasundar, B. et al. D1 and D2 antagonists reverse the effects of appetite
suppressants on weight loss, food intake, locomotion, and rebalance spiking inhibition in
the rat NAc shell. Journal of neurophysiology 114, 585-607, doi:10.1152/jn.00012.2015
(2015).
30
Branch, S. Y. et al. Food restriction increases glutamate receptor-mediated burst firing of
dopamine neurons. The Journal of neuroscience : the official journal of the Society for
Neuroscience 33, 13861-13872, doi:10.1523/jneurosci.5099-12.2013 (2013).
31
Wilson, C., Nomikos, G. G., Collu, M. & Fibiger, H. C. Dopaminergic correlates of
motivated behavior: importance of drive. The Journal of neuroscience : the official
journal of the Society for Neuroscience 15, 5169-5178 (1995).
32
Larder, R. & O'Rahilly, S. Shedding pounds after going under the knife: guts over glorywhy diets fail. Nature medicine 18, 666-667, doi:10.1038/nm.2747 (2012).
33
Perea, G., Navarrete, M. & Araque, A. Tripartite synapses: astrocytes process and
control synaptic information. Trends in neurosciences 32, 421-431,
doi:10.1016/j.tins.2009.05.001 (2009).
34
Leinninger, G. M. et al. Leptin acts via leptin receptor-expressing lateral hypothalamic
neurons to modulate the mesolimbic dopamine system and suppress feeding. Cell
metabolism 10, 89-98, doi:10.1016/j.cmet.2009.06.011 (2009).
35
Nieh, E. H. et al. Inhibitory Input from the Lateral Hypothalamus to the Ventral
Tegmental Area Disinhibits Dopamine Neurons and Promotes Behavioral Activation.
Neuron 90, 1286-1298, doi:10.1016/j.neuron.2016.04.035 (2016).
36
Navarro, M. et al. Lateral Hypothalamus GABAergic Neurons Modulate Consummatory
Behaviors Regardless of the Caloric Content or Biological Relevance of the Consumed
Stimuli. Neuropsychopharmacology : official publication of the American College of
Neuropsychopharmacology 41, 1505-1512, doi:10.1038/npp.2015.304 (2016).
37
Nieh, E. H. et al. Decoding neural circuits that control compulsive sucrose seeking. Cell
160, 528-541, doi:10.1016/j.cell.2015.01.003 (2015).
38
Kempadoo, K. A. et al. Hypothalamic neurotensin projections promote reward by
enhancing glutamate transmission in the VTA. The Journal of neuroscience : the official
211
journal of the Society for Neuroscience 33, 7618-7626, doi:10.1523/jneurosci.258812.2013 (2013).
39
Jennings, J. H., Rizzi, G., Stamatakis, A. M., Ung, R. L. & Stuber, G. D. The inhibitory
circuit architecture of the lateral hypothalamus orchestrates feeding. Science (New York,
N.Y.) 341, 1517-1521, doi:10.1126/science.1241812 (2013).
40
Stamatakis, A. M. et al. Lateral Hypothalamic Area Glutamatergic Neurons and Their
Projections to the Lateral Habenula Regulate Feeding and Reward. The Journal of
neuroscience : the official journal of the Society for Neuroscience 36, 302-311,
doi:10.1523/jneurosci.1202-15.2016 (2016).
41
Goforth, P. B., Leinninger, G. M., Patterson, C. M., Satin, L. S. & Myers, M. G., Jr. Leptin
acts via lateral hypothalamic area neurotensin neurons to inhibit orexin neurons by
multiple GABA-independent mechanisms. The Journal of neuroscience : the official
journal of the Society for Neuroscience 34, 11405-11415, doi:10.1523/jneurosci.516713.2014 (2014).
42
Soliman, G. A. et al. A simple qPCR-based method to detect correct insertion of
homologous targeting vectors in murine ES cells. Transgenic research 16, 665-670,
doi:10.1007/s11248-007-9110-2 (2007).
43
Eagle, A. L. et al. Experience-Dependent Induction of Hippocampal DeltaFosB Controls
Learning. The Journal of neuroscience : the official journal of the Society for
Neuroscience 35, 13773-13783, doi:10.1523/jneurosci.2083-15.2015 (2015).
44
Tschop, M. H. et al. A guide to analysis of mouse energy metabolism. Nature methods 9,
57-63, doi:10.1038/nmeth.1806 (2012).
45
Ferreira, J. G., Tellez, L. A., Ren, X., Yeckel, C. W. & de Araujo, I. E. Regulation of fat
intake in the absence of flavour signalling. The Journal of physiology 590, 953-972,
doi:10.1113/jphysiol.2011.218289 (2012).
46
de Araujo, I. E. et al. Food reward in the absence of taste receptor signaling. Neuron 57,
930-941, doi:10.1016/j.neuron.2008.01.032 (2008).
212
Chapter 6. Summary, Discussion, and Translational Implications
6.1 Summary of Dissertation
The goal of this thesis was to understand how Nts engages mesolimbic DA signaling to
modify body weight. In Chapter 2, we established the sources of endogenous Nts input to the
VTA, and found that it originates from neurons of the LHA, POA, and NA. This anatomical
framework was necessary to reveal which brain regions can coordinate Nts release to the VTA,
and hence may utilize Nts signaling to modify energy balance. Next, in Chapter 3, we defined
which VTA cells express NtsRs and thus are capable of intercepting Nts to modify DA signaling.
We determined that NtsR1 is the predominant Nts receptor isoform on VTA DA neurons, while
NtsR2 is instead expressed on glial cells. Furthermore, the subset of VTA DA neurons that
express NtsR1 project heavily to the NA and not the PFC. Collectively, these data reveal the
cellular mechanism for Nts to engage mesolimbic DA signaling: via binding to NtsR1-expressing
VTA DA neurons that exclusively project to, and can release DA into, the NA. We then tested
whether these VTA NtsR1-expressing DA neurons are essential for energy balance by
genetically ablating them in Chapter 4. Indeed, loss of VTA NtsR1-DA neurons led to chronic
hyperactivity and elevated energy expenditure that impaired age- or diet-related weight gain
compared to intact controls. Additionally, loss of VTA NtsR1-DA neurons disrupted coordination
of motivated feeding behavior with peripheral energy cues, indicating that this VTA DA neuronal
subset may serve to adjust feeding behavior in response to peripheral energy status. Finally in
Chapter 5, we put these data together to investigate whether LHA Nts neurons that project to
the VTA are endogenous mediators of feeding and locomotor behaviors via Nts signaling to
NtsR1. Using DREADD technology, we found that activation of LHA Nts neurons suppresses
chow feeding in both fed and fasted states via NtsR1 and DA-dependent mechanisms. LHA Nts
neurons also promoted increased physical activity and energy expenditure independently of
NtsR1. The dual anorectic and activity-enhancing effects of LHA Nts neurons supported both
213
short and long-term weight loss, but palatability/caloric value can subvert the anorectic effects of
the LHA Nts circuit. Importantly, LHA Nts action suppressed motivated sucrose selfadministration in hungry animals via an NtsR1-dependent mechanism, which coincides with the
ability of Nts to modulate mesolimbic DA signaling via NtsR1, and the specific requirement of
mesolimbic DA signaling for reward “wanting”, not ad libitum feeding (discussed in Chapter 1).
Collectively, this work defines a neuronal circuit whereby Nts input from the LHA modifies
mesolimbic DA via NtsR1 and restrains feeding in the face of negative energy balance, which
may help initiate and maintain weight loss (summarized in Fig. 39).
6.2 Discussion
6.2.1 Technical Considerations of Transgenic vs. Knock-in Models to Study VTA NtsR1
Neurons
When these studies were initiated, the only Cre-driver line available to study NtsR1 was
a commercially-available NtsR1Cre transgenic model. We therefore began using transgenic
NtsR1Cre mice to determine the functional requirement for VTA NtsR1 neurons in Chapter 4,
while simultaneously working to generate a knock in NtsR1Neo-Cre model. Our rationale for
developing a knock-in model was based on their proven utility for reporting endogenous gene
expression, particularly for lowly-expressed transcripts such as receptors1,2. Transgenic models,
however, come with inherent limitations; due to the transgene (i.e. Cre) being inserted randomly
into the genome, expression levels tend to be low and may vary across generations3. Indeed,
when bred to a Cre-inducible GFP reporter, the transgenic NtsR1Cre model reported 5% of VTA
DA neurons co-expressing NtsR1 (Fig. 18) and the overall number of GFP-labeled neurons was
much less than expected compared to Ntsr1 ISH data from the Allen Brain atlas4. By contrast,
subsequent examination of the NtsR1Neo-Cre knock-in mice revealed that 70% of VTA DA
neurons co-expressed NtsR1 (Fig. 14), more consistent with the Allen Brain distribution of
214
Ntsr1. Naturally, labeling 5% vs. 70% of cells is an appreciable difference, and suggests that
NtsR1Neo-Cre knock-in mice are more advantageous for detecting NtsR1 neurons via breeding to
Cre-inducible mouse lines. However, we observed labeling of far more than 5% of DA neurons
in the transgenic NtsR1Cre model after injection of Cre-inducible viral reporters (Fig. 26). We
thus suspect that Cre expression is quite low in most of the NtsR1-expressing cells of the
transgenic model and as a result, only a few NtsR1 neurons have sufficient amounts of Cre
protein to induce recombination of a Cre-inducible GFP allele necessary to be labeled (5% of
TH+ neurons, Fig. 18). By contrast, injection of viral vectors leads to a much higher amount of
Cre-inducible reporter in cells, requiring a lower threshold of Cre expression to induce
recombination. Thus, transgenic NtsR1Cre mice with very low levels of Cre expression are more
likely to exhibit Cre-mediated recombination and be labeled after treatment with viral vectors
(Fig. 26). Despite the discrepancy between the transgenic and knock-in models when bred to
reporter lines, we suspect that injection of the AAV-DTA targeted a substantial number of the
true NtsR1+ population (i.e. closer to 70% rather than 5% of TH+ neurons). This is further
supported by the anterograde tracing data, which was largely consistent between the transgenic
and knock-in models (Fig. 15 vs. Fig. 19), with the knock-in model revealing some additional
minor projections to regions outside the ventral striatum that may not have been appreciable in
the transgenic line. Going forward, it will be critical to validate the behavioral data in Chapter 4
using Cre-mediated ablation or inhibitory chemogenetics in NtsR1Neo-Cre knock-in mice, which
reliably detect the full extent of NtsR1 neurons.
6.2.2 Phenotype of Mice Lacking VTA NtsR1 Neurons
A prominent feature of mice with genetically ablated NtsR1 neurons (Chapter 4) was
their persistently elevated volitional locomotor activity. This behavior, and the increased energy
expenditure to support it, is likely what protected these mice from weight gain, as their food
intake was either unchanged or slightly increased compared to controls with normal activity (Fig.
215
20). A limitation of ablating neuronal populations is that the entire neuron, including all its
neurotransmitters and receptors are abolished, thus resultant behaviors cannot be reliably
attributed to one particular signal originating from the neuron. Therefore, we cannot conclude
that the hyperactivity or uncoupling of energy balance is due to loss of NtsR1, and Nts action,
per se. We speculate that the hyperactivity is due to compensatory remodeling of mesolimbic
DA circuits that occurs independently of NtsR1. Loss of substantial mesolimbic DA terminals
may have potentiated increased DA release and turnover from the remaining intact terminals,
causing the DA system to constantly function on overdrive, similar to the action of
psychostimulants. In fact, multiple colleagues remarked that the ablated mice look similar to
normal mice treated with cocaine, which is characterized by inhibition of DA reuptake and
persistently high levels of DA in the synapse. We suspect that if ablated mice were not
hyperactive, they may instead have overconsumed palatable food and become overweight due
to their impaired ability to respond to satiety cues, an effect that likely is dependent on NtsNtsR1 signaling. In support of this hypothesis, mice constitutively lacking NtsR1 have intact
VTA DA neurons, but exhibit an impaired anorectic response to leptin and are prone to weight
gain on HF diet, indicating that NtsR1 is required for adjusting feeding in response to satiety
cues5,6. Loss of neurons expressing NtsR1 selectively in the VTA produced a similar disruption
in coordinated feeding behavior, however the increased energy expenditure may have masked
any susceptibility to weight gain. In the future, deletion of NtsR1 itself from the VTA, not the
entire neuron, will be essential to verifying the necessity of VTA Nts-NtsR1 signaling in
coordination of energy balance. Developing floxed NtsR1 mice, and injecting them in the VTA
with Cre-inducible reagents to delete NtsR1 from adult VTA NtsR1 neurons could accomplish
this, and holds promise to reveal the physiological role of NtsR1 in the adult brain.
216
6.2.3 Chemogenetic Activation of LHA Nts Neurons: Limitations and Future Directions
In Chapter 5, we demonstrated that activation of LHA Nts neurons suppressed feeding
via an NtsR1 and DA-dependent mechanism, suggesting this occurred via an LHA NtsVTA
NtsR1 circuit. While the VTA is the most likely site of Nts-NtsR1 action, the study was designed
such that all LHA Nts neurons were activated by the chemogenetic strategy, including LHA Nts
neurons that may not project to the VTA. Future work will be important to provide more circuitspecific resolution to determine whether or not the anorectic effects of LHA Nts neurons are
mediated at the level of the VTA or elsewhere. In addition to suppressing food intake via NtsR1,
LHA Nts neurons also increased locomotor activity and energy expenditure by an NtsR1independent mechanism. Thus, these effects could be mediated by other neurotransmitters
released by LHA Nts neurons such as GABA, glutamate, or other neuropeptides, to the VTA or
elsewhere. To determine whether behavioral effects are specifically mediated by the VTA, CNO
could be infused directly into the VTA of WT and NtsR1KO mice. Injecting drugs through
cannulae would be more technically challenging than i.p. injections, especially for studies
requiring mice to be treated multiple times over the course of an experiment. Additionally,
generating study animals would be more difficult, as this would require both bilateral targeting of
AAV to the LHA and of cannulae to the VTA. An alternative approach would be to design a twostep retrograde Cre-inducible DREADD virus that traveled monosynaptically, whereby injection
into the VTA would allow the virus to travel to Nts neurons that project to the VTA and a second
injection of a helper virus into the LHA would permit DREADD receptor expression only in LHA
Nts neurons that project to the LHA, similar to modified rabies viruses7.
While we experimentally activated all LHA Nts neurons, they may not all contribute to the
regulation of energy balance. Indeed, LHA Nts neurons can be divided into functionally distinct
subpopulations. For example, ~15-30% of LHA Nts neurons are regulated by leptin, while a
separate group is selectively regulated by dehydration2,8,9. Thus general activation of all LHA
217
Nts neurons may produce a mixed phenotype due to the simultaneous actions of feedingspecific and drinking-specific subsets. We suspect that the anorectic effects of LHA Nts
neurons are likely mediated by the subset of LHA Nts neurons that express LepRb, while the
drinking behavior is induced by the dehydration-sensitive LHA Nts neurons. Since all of these
neurons are activated by peripheral CNO, some of the behavioral findings may be complicated
by desire to drink, since animals did not have access to water in the operant chambers or CPP
boxes. Per the sucrose self-administration studies, this is likely not the case as activation of all
LHA Nts neurons did not alter baseline PR breakpoint and was only effective at reducing
responding in a fasted state (Fig. 36D). Animals had free access to water during the overnight
fast and although they may have consumed less, it is unlikely that slight dehydration and/or
desire to drink suppressed motivation for sugar pellets; it is much more likely that increased
activation of the leptin-sensitive LHA Nts subset is responsible for reduced operant responding
in a fasted state, similar to a peripheral injection of leptin10.
From a translational perspective, an important finding was that activation of LHA Nts
neurons was neither rewarding nor aversive in the presence of NtsR1 (Fig. 38A). Hence, our
studies suggest that an NtsR1 agonist, preferentially delivered to the VTA, could restrain
appetite in a food-deprived state to help initiate and maintain weight loss but without promoting
dependence. It was vital to address the potential addictive nature of activating Nts-NtsR1
signaling, given that it increases mesolimbic DA release11,12 similar to addictive drugs like
cocaine and amphetamine. Indeed, prior work suggested that pharmacologic administration of
Nts to the VTA is positively reinforcing13-15, but this could have been due to high, nonphysiologic concentrations of Nts tested. A novel anti-obesity agent with abuse potential would
not be clinically viable. However, our data suggest that activating LHA Nts neurons, and hence
endogenous Nts release, may act via a specific subset of VTA DA neurons that either do not
218
functionally promote positive reinforcement or simply does not cause sufficient DA release to be
reinforcing.
We found that activation of LHA Nts neurons suppresses feeding in hungry, fasted mice.
To clarify the translational potential of this circuit, a series of critical follow-up experiments will
be necessary. A key future experiment would be to calorically restrict diet-induced obese mice
(i.e. put them on a “diet”) and after initial weight loss, activate LHA Nts neurons in the presence
of ad libitum chow or HF diet to see if increased action of the circuit can prevent weight regain in
weight-reduced obese mice. This experiment mirrors the metabolic circumstances faced by
obese individuals who struggle to maintain weight loss in the face of negative energy balance.
If this experiment shows that LHA Nts neurons support sustained weight loss over time, then the
circuit holds strong translational potential for maintaining reduced bodyweight in previously
overweight individuals. It is possible however, that the LHA Nts circuitry is altered after the
onset obesity, as suggested by the inability of LHA Nts neuronal activation to induce weight loss
in well-fed obese mice (Chapter 5, Fig. 34). If this is the case, then the LHA Nts circuit may still
hold promise in in preventing weight gain or maintain weight loss in younger individuals who
have not had long-standing obesity but are at risk for continued weight gain.
6.3 Translational Implications
6.3.1 Neurotensin Circuits as a Translational Target
Although this work provides preliminary evidence that LHA NtsNtsR1 signaling may be
a candidate anti-obesity target, several questions and challenges need to be addressed to fully
understand the function of this circuit in weight control. First, the circuit needs to be tested in
the presence of additional variables representative of human populations, including gender,
age, and genetic background. All studies in Chapter 5 were performed with male mice with
219
mixed genetic backgrounds (C57/Bl6 and 129 strains) and although testing occurred at a variety
of ages, the mice were always injected with DREADD virus between 8-12 wk of age, thus the
expression of DREADD receptors would have been similar across the lifespan. It will also be
important to know whether LHA Nts or VTA NtsR1 expression varies with age or gender. We
did not observe any overt differences in NtsR1 expression across gender or age (Chapter 3),
but these studies were not designed to interrogate those variables. Importantly, we must
understand whether the NtsNtsR1 system is anatomically present in humans, a question that
is difficult to answer given the inability of immunohistochemistry to reliably detect Nts and
NtsR1-expressing cell bodies. To date, one study examined Nts immunoreactivity in the human
brain and reported Nts expression in both the LHA and VTA16, however more work with human
tissue is necessary to confirm similarity in the LHA Nts VTA NtsR1 circuit across species.
Nts has been investigated as a drug target for both schizophrenia and Parkinson’s
disease. In 2004, the results of a clinical trial testing the efficacy of an NtsR1 antagonist
(SR48692 or meclinertant) for schizophrenia found no differences in symptom improvement
compared to placebo17. In a letter to the editor, Richelson et al. expressed that they were not
surprised by the lack of efficacy of an NtsR1 antagonist and proposed instead that a brain
penetrating non-peptide NtsR1 agonist which they had developed and intended to use in clinical
trials would be more effective18. However, the fate of this non-peptide agonist is unclear. An
Nts analogue (NT69L) and an NtsR1 agonist (PD149163) have been used routinely in animals,
however data regarding testing of these agents in clinical trials is either unavailable or nonexistent. Interestingly, a conjugated Nts nanoparticle has been used to deliver neuroprotective
genes specifically to DA neurons in animal models of Parkinson’s disease19,20. This approach
takes advantage of the internalization of Nts-NtsR1 receptor complexes, and thus genes
packaged and tagged to a modified Nts peptide are specially targeted to DA neurons, which
have the high levels of NtsR1 expression. While this method proves promising in preclinical
220
studies, the nanoparticle has only been administered directly to the SN, and it is unclear
whether or not the particle would have the same effect if administered orally or peripherally.
While this approach could be used to enhance Nts-NtsR1 signaling specifically on DA neurons,
which could have potential as an anti-obesity agent based on this dissertation, a considerable
challenge would be developing a drug with minimal peripheral side effects. As discussed in
Chapter 1, peripheral Nts promotes hypotension and increased absorption of dietary fat, which
could provide undesirable side effects21,22. Interestingly however, Nts-NtsR1 signaling is a
candidate drug target for a wide variety of cancers due to its role in tumor growth, and currently,
meclinertant (the NtsR1 antagonist) is being assessed in a clinical trial for lung cancer
(ClinicalTrials.gov identifier NCT00290953). Thus, although an NtsR1 agonist would be
desirable for weight-loss, perhaps Nts-targeted agents developed through these pipelines may
also prove useful in controlling body weight, and underscores the utility of idea-sharing across
disciplines among medical professionals and scientists.
6.3.2 Final Thoughts on the Challenges of Addressing Obesity
From the perspective of a future scientist and healthcare provider, the challenges posed
by the obesity epidemic are humbling. The standard first-line treatment recommended by
physicians is diet and exercise, despite overwhelming evidence that diets do not succeed in the
long term23. Thus when patients fail to maintain weight loss, many feel tremendous guilt due to
perceived lack of will-power to avoid high calorie foods. Patients are often not told that strong
biological mechanisms, not personal weakness, are driving them to overconsume food and
regain the weight. Biology drives behavior, and unfortunately many people falsely assume that
obese individuals are too lazy or unmotivated to lose weight, attributing their excess weight to
personal flaw. This is simply not the case. Perhaps better education of both patients and
healthcare providers in the science of energy balance and weight loss could help alleviate the
negative stereotypes and emotional guilt experienced by obese individuals. While it seems
221
clear that diets are not the answer, this leaves a giant gap in the treatment options for obesity.
This is where scientists have enormous opportunity to develop better treatment options, which I
hope will be fueled by the advent of optogenetic and pharmacogenetic techniques to decipher
neural feeding circuits. Ultimately, addressing the multi-factorial nature of obesity will require
concerted effort from medical professionals, scientists, policy-makers, and public health
advocates. Although the stakes are high, the future holds promise for a solution to the obesity
crisis.
Figure 39. LHA Nts neurons restrain feeding and promote locomotor activity, in part via
NtsR1 and the mesolimbic DA system. Enhanced activation by the LHA Nts circuit may be
useful to support weight-loss in weight-reduced individuals.
222
REFERENCES
223
REFERENCES
1
Leshan, R. L., Bjornholm, M., Munzberg, H. & Myers, M. G., Jr. Leptin receptor signaling
and action in the central nervous system. Obesity (Silver Spring, Md.) 14 Suppl 5, 208S212S, doi:10.1038/oby.2006.310 (2006).
2
Leinninger, G. M. et al. Leptin action via neurotensin neurons controls orexin, the
mesolimbic dopamine system and energy balance. Cell metabolism 14, 313-323,
doi:10.1016/j.cmet.2011.06.016 (2011).
3
Haruyama, N., Cho, A. & Kulkarni, A. B. Overview: engineering transgenic constructs
and mice. Current protocols in cell biology Chapter 19, Unit 19 10,
doi:10.1002/0471143030.cb1910s42 (2009).
4
Lein, E. S. et al. Genome-wide atlas of gene expression in the adult mouse brain. Nature
445, 168-176, doi:10.1038/nature05453 (2007).
5
Opland, D. et al. Loss of neurotensin receptor-1 disrupts the control of the mesolimbic
dopamine system by leptin and promotes hedonic feeding and obesity. Molecular
metabolism 2, 423-434, doi:10.1016/j.molmet.2013.07.008 (2013).
6
Kim, E. R., Leckstrom, A. & Mizuno, T. M. Impaired anorectic effect of leptin in
neurotensin receptor 1-deficient mice. Behavioural brain research 194, 66-71,
doi:10.1016/j.bbr.2008.06.024 (2008).
7
Kim, E. J., Jacobs, M. W., Ito-Cole, T. & Callaway, E. M. Improved Monosynaptic Neural
Circuit Tracing Using Engineered Rabies Virus Glycoproteins. Cell reports,
doi:10.1016/j.celrep.2016.03.067 (2016).
8
Brown, J. A. et al. Loss of Action via Neurotensin-Leptin Receptor Neurons Disrupts
Leptin and Ghrelin-Mediated Control of Energy Balance. Endocrinology,
doi:10.1210/en.2017-00122 (2017).
9
Watts, A. G., Sanchez-Watts, G. & Kelly, A. B. Distinct patterns of neuropeptide gene
expression in the lateral hypothalamic area and arcuate nucleus are associated with
dehydration-induced anorexia. The Journal of neuroscience : the official journal of the
Society for Neuroscience 19, 6111-6121 (1999).
10
Ahima, R. S. et al. Role of leptin in the neuroendocrine response to fasting. Nature 382,
250-252, doi:10.1038/382250a0 (1996).
11
Patterson, C. M. et al. Ventral tegmental area neurotensin signaling links the lateral
hypothalamus to locomotor activity and striatal dopamine efflux in male mice.
Endocrinology 156, 1692-1700, doi:10.1210/en.2014-1986 (2015).
12
Leonetti, M. et al. Specific involvement of neurotensin type 1 receptor in the neurotensinmediated in vivo dopamine efflux using knock-out mice. Journal of neurochemistry 89, 16, doi:10.1046/j.1471-4159.2003.02231.x (2004).
224
13
Rouibi, K., Bose, P., Rompre, P. P. & Warren, R. A. Ventral Midbrain NTS1 Receptors
Mediate Conditioned Reward Induced by the Neurotensin Analog, D-Tyr[11]neurotensin.
Frontiers in neuroscience 9, 470, doi:10.3389/fnins.2015.00470 (2015).
14
Glimcher, P. W., Margolin, D. H., Giovino, A. A. & Hoebel, B. G. Neurotensin: a new
'reward peptide'. Brain research 291, 119-124 (1984).
15
Glimcher, P. W., Giovino, A. A. & Hoebel, B. G. Neurotensin self-injection in the ventral
tegmental area. Brain research 403, 147-150 (1987).
16
Mai, J. K., Triepel, J. & Metz, J. Neurotensin in the human brain. Neuroscience 22, 499524 (1987).
17
Meltzer, H. Y., Arvanitis, L., Bauer, D. & Rein, W. Placebo-controlled evaluation of four
novel compounds for the treatment of schizophrenia and schizoaffective disorder. The
American journal of psychiatry 161, 975-984, doi:10.1176/appi.ajp.161.6.975 (2004).
18
Richelson, E., Fredrickson, P. A. & Boules, M. M. Neurotensin receptor agonists and
antagonists for schizophrenia. The American journal of psychiatry 162, 633-634; author
reply 635, doi:10.1176/appi.ajp.162.3.633-b (2005).
19
Espadas-Alvarez, A. J. et al. Regulation of human GDNF gene expression in nigral
dopaminergic neurons using a new doxycycline-regulated NTS-polyplex nanoparticle
system. Nanomedicine : nanotechnology, biology, and medicine 13, 1363-1375,
doi:10.1016/j.nano.2017.02.006 (2017).
20
Gonzalez-Barrios, J. A. et al. Neurotensin polyplex as an efficient carrier for delivering
the human GDNF gene into nigral dopamine neurons of hemiparkinsonian rats.
Molecular therapy : the journal of the American Society of Gene Therapy 14, 857-865,
doi:10.1016/j.ymthe.2006.09.001 (2006).
21
Di Paola, E. D. & Richelson, E. Cardiovascular effects of neurotensin and some
analogues on rats. European journal of pharmacology 175, 279-283 (1990).
22
Li, J. et al. An obligatory role for neurotensin in high-fat-diet-induced obesity. Nature 533,
411-415, doi:10.1038/nature17662 (2016).
23
Mann, T. et al. Medicare's search for effective obesity treatments: diets are not the
answer. The American psychologist 62, 220-233, doi:10.1037/0003-066x.62.3.220
(2007).
225