DEVELOPMENT AND APPLICATION OF A RAPID, USER-FRIENDLY AND INEXPENSIVE METHOD TO DETECT AND QUANTIFY DEHALOCOCCOIDES MCCARTYI GENES IN GROUNDWATER SAMPLES By Yogendra Hemant Kanitkar A DISSERTATION Submitted to Michigan State University in partial fulfillment of the requirements for the degree of Environmental Engineering––Doctor of Philosophy 2017 ABSTRACT DEVELOPMENT AND APPLICATION OF A RAPID, USER-FRIENDLY AND INEXPENSIVE METHOD TO DETECT AND QUANTIFY DEHALOCOCCOIDES MCCARTYI GENES IN GROUNDWATER SAMPLES By Yogendra Hemant Kanitkar Tetrachloroethene (PCE) and trichloroethene (TCE) are the predominant contaminants at hazardous waste sites in the United States. The remediation of these chlorinated solvents at contaminated sites frequently involves bioremediation approaches such as biostimulation or bioaugmentation. Both approaches aim at increasing the population of Dehalococcoides cells in the subsurface. It has become common to quantify the population of these microorganisms both before and during the remediation process. TaqMan probe based quantitative polymerase chain reaction (qPCR) specific to the biomarker reductive dehalogenase (RDase) genes, such as vcrA, bvcA, and tceA, is now a widely accepted molecular biological tool (MBT) for this task. To date, a wide range of qPCR protocols based on vcrA, bvcA, and tceA genes have been successful for monitoring the reductive dechlorination driven by Dehalococcoides cells. However, alternate molecular methods that are faster and cheaper may make quantification significantly easier. Loop mediated isothermal amplification (LAMP) assays were developed for the rapid and specific quantification of the RDase genes, vcrA, tceA, and bvcA in groundwater samples. As a first step, the developed LAMP assays were validated using DNA templates prepared from commercially available bioaugmenting cultures (SDC-9 and KB-1) and groundwater samples. To do this, the concentrations of Dehalococcoides mccartyi RDase genes with DNA templates obtained using LAMP were compared to concentrations obtained using qPCR on a real time thermal cycler. Additionally, the use of direct amplification was investigated. LAMP assays were then adapted for the development a field deployable kit. Here, an approach that requires only low cost laboratory equipment (a bench top centrifuge and a water bath) and significantly less time and resources compared to qPCR is described. The method involves the concentration of biomass from groundwater (without DNA extraction) and LAMP of the cell templates. The amplification products are detected by a simple visual color change (orange/green). Finally, the most probable number technique was incorporated into the altered visual detection LAMP method for the quantitative estimation of RDase gene concentrations in groundwater samples. Overall, quantification with LAMP on a real time thermal cycler was comparable to quantification with qPCR when DNA extracts prepared from SDC-9 and KB-1 or bioaugmented groundwater samples were used as templates for amplification. The LAMP assays to visually detect RDase genes, without DNA extraction or a thermal cycler, was successful to 1.8 X 105 gene copies per L for vcrA and 1.3 X 105 gene copies per L for tceA. Both values are below the threshold recommended for effective in situ dechlorination. Quantification with the MPN-LAMP assay using cell templates underestimated the concentration of RDase genes in groundwater samples by an order of magnitude compared to quantification with DNA templates and qPCR assay. Based on these results, response factors to correlate the MPN-LAMP data to estimated concentrations of RDase genes in groundwater samples are suggested. Future work should include a technology transfer of MPN-LAMP protocols to remediation practitioners. Copyright by YOGENDRA HEMANT KANITKAR 2017 This thesis is dedicated to my Mom. Thank you for always believing in me. v ACKNOWLEDGEMENTS I would like to thank Dr. Alison Cupples, for her continual guidance and support as well as the opportunity to work on this project. I would also like to thank the members of my committee, Dr. Syed Hashsham, Dr. Irene Xagoraraki, and Dr. Terence Marsh. I would like to acknowledge my colleagues Dr. Robert Stedtfeld, Tiffany Stedtfeld, and Yanlyang Pan. I am very grateful to Simon Vainberg, Sheryl Streger, Robert E. Mayer, Michael Martinez, David Lippincott, and Dr. Paul Hatzinger from CB&I Federal Services for supplying me with countless groundwater samples and the SDC-9 culture. Many thanks are due to Dr. Frank Löffler from University of Tennessee at Knoxville for providing the tceA plasmid standard and Phil Dennis from SiREM for supplying the KB-1 culture. A warm thanks to Lori Larner, Margaret Connor, Mary Morz, and Laura Taylor for their administrative support. This dissertation research would have been impossible to complete without their assistance. Last, but not least, I would like to thank my family and friends for their unending support. vi TABLE OF CONTENTS LIST OF TABLES ......................................................................................................................... ix LIST OF FIGURES ....................................................................................................................... xi KEY TO ABBREVIATIONS ...................................................................................................... xiii Chapter 1: Introduction ................................................................................................................... 1 1.1 Microbial reductive dechlorination for remediation of chlorinated ethene sites ............ 1 1.2 Use of MBTs for quantification of Dehalococcoides mccartyi populations .................. 2 1.3 Loop mediated isothermal amplification (LAMP) ......................................................... 3 1.4 Dissertation outline and objectives ................................................................................. 4 REFERENCES ........................................................................................................................... 8 Chapter 2: Development of Loop Mediated Isothermal Amplification (LAMP) for Rapid Detection and Quantification of Dehalococcoides mccartyi Biomarker Genes in Commercial Reductive Dechlorinating Cultures KB-1 and SDC-9 .................................................................. 11 2.1 Abstract ......................................................................................................................... 11 2.2 Introduction ................................................................................................................... 12 2.3 Materials and methods .................................................................................................. 13 2.3.1 Cultures and growth conditions ................................................................................ 13 2.3.2 Groundwater samples................................................................................................ 14 2.3.3 Preparation of plasmid standards .............................................................................. 15 2.3.4 Design of LAMP primers.......................................................................................... 16 2.3.5 qPCR and LAMP amplification ................................................................................ 18 2.3.1 Gene-Z analysis of groundwater samples ................................................................. 19 2.4 Results ........................................................................................................................... 20 2.4.1 Amplification with LAMP primers and their application ......................................... 20 2.4.2 Monitoring Dehalococcoides mccartyi growth in KB-1 and SDC-9 cultures .......... 20 2.4.3 Validation of new LAMP assays with the Gene-Z using groundwater templates .... 27 2.5 Discussion ..................................................................................................................... 28 REFERENCES ......................................................................................................................... 31 Chapter 3: Development and Application of a Rapid, User-Friendly and Inexpensive Method to Detect Dehalococcoides mccartyi RDase Genes from Groundwater ........................................... 36 3.1 Abstract ......................................................................................................................... 36 3.2 Introduction ................................................................................................................... 37 3.3 Methods......................................................................................................................... 39 3.3.1 Groundwater samples................................................................................................ 39 3.3.2 Preparation of DNA templates .................................................................................. 39 3.3.3 Preparation of direct and centrifuged cell templates (no DNA extraction) .............. 40 3.3.4 LAMP specificity experiments ................................................................................. 40 3.3.5 Amplification with LAMP and qPCR in a real time thermal cycler......................... 41 vii 3.3.6 SYBR Green LAMP in a water bath......................................................................... 41 3.4 Results ........................................................................................................................... 43 3.4.1 Comparison of qPCR and LAMP for DNA extracts from groundwater samples..... 43 3.4.2 Optimization of cell template concentration, without DNA extraction .................... 45 3.4.3 LAMP detection of RDase Genes without DNA extraction or a thermal cycler ...... 48 3.4.4 Detection limits of visual detection .......................................................................... 49 3.5 Discussion ..................................................................................................................... 54 APPENDIX ............................................................................................................................... 57 REFERENCES ......................................................................................................................... 63 Chapter 4: The Application of Most Probable Number Method with Visual Detection LAMP for Quantitative Estimation of RDase Gene Concentrations in Groundwater Samples ..................... 67 4.1 Abstract ......................................................................................................................... 67 4.2 Introduction ................................................................................................................... 68 4.3 Methods......................................................................................................................... 70 4.3.1 Integration of the dUTP-UNG contamination control system in to the SYBR Green LAMP assay .......................................................................................................................... 70 4.3.2 Optimized SYBR Green LAMP amplification ......................................................... 71 4.3.3 Preparation of dilution series for MPN analysis from centrifuged cell templates of groundwater samples. ........................................................................................................... 71 4.3.4 Quantification with MPN LAMP.............................................................................. 72 4.3.5 Preparation of DNA templates from groundwater samples for qPCR ...................... 75 4.4 Results ........................................................................................................................... 76 4.4.1 Optimization of SYBR Green LAMP assay with dUTP-UNG contamination control system (DNA templates) ....................................................................................................... 77 4.4.2 Optimization of SYBR Green LAMP assay with dUTP-UNG contamination control system (centrifuged cell templates) ...................................................................................... 80 4.4.3 Quantitative estimation of vcrA and tceA genes with SYBR Green LAMP using MPN ................................................................................................................................... 82 4.5 Discussion ..................................................................................................................... 87 APPENDIX ............................................................................................................................... 90 REFERENCES ......................................................................................................................... 94 Chapter 5: Conclusions ................................................................................................................. 98 5.1 Future Work ................................................................................................................ 100 viii LIST OF TABLES Table 1.1 Dehalococcoides mccartyi RDase biomarker genes (4, 7-9) .......................................... 2 Table 2.1 LAMP primer sets designed and used in this study ...................................................... 17 Table 2.2 qPCR primers used in this study ................................................................................... 19 Table 3.1 vcrA gene concentrations (gene copies per L) for SYBR Green assay for groundwater samples and dilutions examined in triplicates and the predicted outcome for in situ reductive dechlorination ............................................................................................ 53 Table 3.2 tceA gene concentrations (gene copies per L) for SYBR Green assay for groundwater samples and dilutions examined in triplicate and the predicted outcome for in situ reductive dechlorination ............................................................................................ 53 Table 3.3 The gene targets, assay type and template type used for each well and site. ............... 58 Table 3.4 Gene concentrations (vcrA and tceA per L) and estimated gene concentration in serial dilutions of cell templates from groundwater from six monitoring wells (Indian Head site) ............................................................................................................................ 60 Table 3.5 Time based comparison of qPCR and SYBR green LAMP assays .............................. 61 Table 3.6 Cost based comparison of qPCR and SYBR green LAMP assays ............................... 62 Table 4.1 Data table denoting the endpoint color change in six replicates of seven fold 10X dilution series templates for MPN analysis of vcrA gene in groundwater sample MW100 ...................................................................................................................... 73 Table 4.2 Data table denoting the endpoint color change in six replicates of seven fold 10X dilution series templates for MPN analysis of tceA gene in groundwater sample MW100 ...................................................................................................................... 73 Table 4.3 List of groundwater samples used to prepare DNA and centrifuged cell templates..... 91 Table 4.4 Concentrations of vcrA and tceA genes obtained using SYBR Green LAMP coupled to MPN method with centrifuged cell templates and qPCR with DNA templates. ....... 92 Table 4.5 Representative calculation table for MPN analysis of vcrA gene in groundwater sample MW100 based on the outcomes of the SYBR Green LAMP assay performed on dilutions of centrifuged cell template. ....................................................................... 93 ix Table 4.6 Representative calculation table for MPN analysis of tceA gene in groundwater sample MW100 based on the outcomes of the SYBR Green LAMP assay performed on dilutions of centrifuged cell template. ....................................................................... 93 x LIST OF FIGURES Figure 1.1 Organohalide respiration of PCE and TCE to ETH by Dehalococcoides mccartyi ...... 2 Figure 2.1 Mean mass of TCE, cDCE, VC, and ETH in triplicate KB-1 cultures and an abiotic control. ....................................................................................................................... 22 Figure 2.2 Gene copies of vcrA (A), bvcA (B), and tceA (C) per L in triplicate cultures of KB-1 while growing on TCE, LAMP vcrA set C was used to target vcrA ......................... 23 Figure 2.3 Mean mass of VC and ETH in triplicate SDC-9 cultures and an abiotic control. ....... 24 Figure 2.4 vcrA gene copies per L measured via qPCR and two LAMP assays (vcrA set A and vcrA set B) in triplicate cultures of SDC-9 (A, B, C) during growth of VC ............. 24 Figure 2.5 Mean mass of vcrA (A), bvcA (B), and tceA (C) per L in triplicate cultures of KB-1 while growing on TCE............................................................................................... 25 Figure 2.6 Comparison of vcrA (A), bvcA (B), tceA (C) mean gene copies (per L) in triplicate cultures of KB-1 while growing on TCE. .................................................................. 26 Figure 2.7 Comparison of vcrA and tceA mean gene copies (per L) in triplicates of eight different groundwater DNA templates observed using qPCR on a real time thermal cycler and the Gene-Z. ................................................................................................................ 27 Figure 3.1 Comparison of qPCR and LAMP to quantify tceA (A) and vcrA (B) gene copies in DNA extracted from groundwater from different chlorinated solvent sites. ............. 44 Figure 3.2 Correlation between gene concentrations (tceA and vcrA) determined via qPCR and LAMP using DNA extracted from numerous groundwater samples. ........................ 45 Figure 3.3 Comparison of tceA (A) and vcrA (B) gene concentrations (log gene copies per L) determined using DNA extracts, direct cells or centrifuged cells as templates......... 47 Figure 3.4 Comparison of the LAMP generated gene concentrations (vcrA and tceA) determined using DNA as a template to those values obtained using cells as a template (direct and centrifuged cells) ................................................................................................. 48 Figure 3.5 Specificity of LAMP/SYBR green assays with triplicates of plasmid standards (106 gene copies/reaction) containing RDase genes .......................................................... 49 Figure 3.6 Amplification results using a 10X dilution series of centrifuged cell templates from groundwater for tceA (A) and vcrA (B). .................................................................... 52 Figure 3.7 Testing of detection guidance values using groundwater from different sites ............ 54 xi Figure 3.8 Examples of SYBR green LAMP assays for vcrA with triplicates of 10X dilutions for centrifuged cells from groundwater from the Indian Head site ................................. 61 Figure 4.1 Schematic of the SYBR Green LAMP method for detection of RDase genes from groundwater samples (14).......................................................................................... 77 Figure 4.2 Optimization of amount of UNG required to destroy a vcrA gene AUGC contamination of 1.44 x 104 gene copies per reaction while preserving amplification resulting from ATGC vcrA plasmid DNA template from up to ~100 gene copies per reaction. ..................................................................................................................... 79 Figure 4.3 Optimization of UNG with concentrated cell templates prepared from groundwater spiked with known quantities SDC-9 culture ............................................................ 81 Figure 4.4 Endpoint color observed in a six replicate seven fold 10X dilution series prepared from a single centrifuged cell template of groundwater sample MW100 for vcrA gene. ........................................................................................................................... 84 Figure 4.5 log10 concentrations obtained using qPCR with DNA templates (grey) and MPN coupled to SYBR Green LAMP with centrifuged cell templates (black) for vcrA (A) and tceA (B) genes. .................................................................................................... 85 Figure 4.6 Correlation between concentrations of vcrA and tceA genes obtained using qPCR with DNA templates and MPN coupled to SYBR Green LAMP with centrifuged cell templates on linear scaled axes with log10 values (A) and log scaled axes (B) ....... 86 xii KEY TO ABBREVIATIONS PCE Tetrachloroethene TCE Trichloroethene cDCE cis-1, 2-Dichloroethene VC Chloroethene ETH Ethene qPCR quantitative polymerase chain reaction RDase reductive dehalogenase MBT molecular biological tool LAMP loop mediated isothermal amplification MPN most probable number dUTP deoxyuridine triphosphate UNG Uracil-DNA glycosylase xiii Chapter 1: Introduction 1.1 Microbial reductive dechlorination for remediation of chlorinated ethene sites Chlorinated solvents such as PCE and TCE have been widely used as metal degreasing agents in various industrial processes. The inappropriate disposal of hazardous waste from these processes has resulted in widespread contamination of groundwater aquifers across the US. Today, chlorinated solvents are the predominant contaminants at hazardous waste sites in the United States (1). As of 2000, EPA classifies PCE as a likely human carcinogen and TCE as a known human carcinogen by all routes of exposure. The maximum contaminant level goal (MCLG) and the maximum contaminant level (MCL) for the two contaminants have been set to 0 and 0.005 mg/L, respectively (2). Microbially mediated reductive dechlorination plays a vital role in the degradation of the chlorinated ethenes, PCE and TCE. Under reducing conditions, PCE and TCE undergo sequential reductive dechlorination via hydrogenolysis to cDCE and VC, finally forming environmentally benign ethene (ETH). At each step, a chlorine atom is replaced by hydrogen, which is used as an electron donor (Figure 1.1). When reductive dechlorination is linked to microbial growth, it is called organohalide respiration; a metabolism commonly associated with the microorganism Dehalococcoides mccartyi (3-6). The biomarker RDase genes, tceA, vcrA, and bvcA, responsible for organohalide respiration of PCE and TCE to ETH in Dehalococcoides mccartyi, have been identified and annotated (Table 1.1) (4, 7-9). Today, bioremediation practitioners often use bioaugmentation and biostimulation as two key cost effective strategies for in situ attenuation of chlorinated solvent plumes. Bioaugmentation refers to the addition of commercially available reductive dechlorinating mixed cultures (e.g. KB-1 and SDC-9) 1 containing several Dehalococcoides mccartyi strains while biostimulation is defined as the nourishment of native Dehalococcoides mccartyi populations to metabolize PCE and TCE by the addition of various amendments to the subsurface environment. In 2009, it was estimated that bioaugmentation and biostimulation had been used at several hundred sites in the US (10, 11). Cl Cl Cl Cl Cl C C Cl PCE Cl Cl H H C C Cl H H H C C TCE Cl H H H C C cDCE VC H C C H Ethene (non-hazardous) Figure 1.1 Organohalide respiration of PCE and TCE to ETH by Dehalococcoides mccartyi Table 1.1 Dehalococcoides mccartyi RDase biomarker genes (4, 7-9) Substrate  Product RDase biomarker genes TCE  cDCE tceA cDCE, VC  ETH vcrA VC  ETH bvcA 1.2 Use of MBTs for quantification of Dehalococcoides mccartyi populations Since bioaugmentation and biostimulation both aim to increase the concentration of Dehalococcoides mccartyi in the subsurface, it has become common to quantify the population of these microorganisms both before and during the remediation process. TaqMan probe based qPCR specific to the biomarker RDase genes, tceA, vcrA, and bvcA is now a widely accepted MBT for these tasks. To date, several qPCR protocols are available for detecting and quantifying Dehalococcoides mccartyi 16S rRNA and RDase genes using DNA extracts from groundwater samples as templates for amplification (12). 2 While alternative MBTs to qPCR have been explored, they have been scarcely used for a variety of reasons. For example, unlike qPCR, catalyzed reporter deposition fluorescence in situ hybridization (CARD-FISH) is a cytogenic method, which can be used to detect active microbes. Despite being very sensitive, this MBT uses sophisticated equipment for visualization and quantification (13-15). Consequently, most remediation professionals either quantify RDase genes in-house using qPCR or use the service of a commercial laboratory with expertise in qPCR. However, there are significant costs associated with this approach. Specifically, the cost of purchasing a real time thermal cycler (~$20K) for in-house analysis or the cost of having many samples analyzed by a commercial laboratory (typically >$200 per sample). Given this expense and the large number of projects still addressing chlorinated solvent contamination, there is clearly a need for the development of a fast, cost-effective and user friendly approach to detect RDase genes. 1.3 Loop mediated isothermal amplification (LAMP) LAMP is a novel molecular method recently developed for the specific detection of nucleic acids. LAMP is a one-step amplification reaction that amplifies a target DNA sequence using four to six primers. These primers are forward and backward internal primers (FIP and BIP), forward and backward outer primers (F3 and B3), and forward and backward loop primers (LF and LB). Amplification creates stem loop structures with several inverted repeats of the target and cauliflower like structures with multiple loops. The Bst large fragment DNA polymerase has strand displacement activity and helicase-like activity allowing it to unwind and amplify DNA strands in the 60-65 ºC temperature range (16). Because LAMP is rapid, sensitive, specific and occurs isothermally, it has emerged as an alternative to PCR based methods in a wide variety of applications. For example, many LAMP assays have been developed for testing 3 food borne bacterial and viral contaminants. Recently, LAMP primer sets have been developed and tested for the detection of plasmids, pXO1 and pXO2, which impart infectious properties to several strains of Bacillus anthracis. LAMP can also be used to detect RNA viruses. A reverse transcription step is used to convert the RNA from viruses such as HIV-1 or the Ebola virus to DNA (17, 18). In 2014, LAMP primer sets were developed for the 16S rRNA and vcrA genes of Dehalococcoides mccartyi. In that study, a field deployable approach for harvesting biomass from groundwater samples bioaugmented with SDC-9 was described. Direct amplification of templates with LAMP was performed using the hand held microfluidic platform, the Gene-Z. Detection limits below 107 gene copies/L were reported (this is the generally accepted threshold for acceptable in situ dechlorination). However, larger volumes of groundwater were required when Dehalococcoides mccartyi numbers were less than 104 gene copies/L (19). 1.4 Dissertation outline and objectives The overall research objective of this dissertation was to develop LAMP as a rapid, sensitive, and specific method to quantify Dehalococcoides genes in groundwater samples without DNA extraction. Chapter 2 – The development of specific LAMP primers for Dehalococcoides mccartyi RDase genes, vcrA, bvcA, and tceA is discussed. This chapter addresses the validation of quantification with LAMP using these primers on a real time thermal cycler. Data presented compares quantification with LAMP and qPCR using DNA templates prepared from SDC-9, KB-1, and bio augmented groundwater samples. A preliminary comparison between quantification data obtained with LAMP on the Gene-Z to qPCR for DNA templates prepared from SDC-9 bioaugmented groundwater samples is also presented. 4 The key objectives of this chapter were: 1. To evaluate if LAMP can be used for the quantification of Dehalococcoides mccartyi RDase genes (vcrA, bvcA, tceA) in two commonly used commercial bioaugmentation cultures, KB-1 (from SiREM) and SDC-9 (from CB&I) using DNA templates rather than direct amplification of harvested biomass. 2. To compare and contrast quantification (i.e. gene copies/L values) between LAMP and qPCR during one growth cycle in order to evaluate the effectiveness of LAMP as a tool to monitor the growth of Dehalococcoides mccartyi in KB-1 and SDC-9. 3. To validate quantification of the developed assays with LAMP on the Gene-Z using DNA templates isolated from eight groundwater samples. Chapter 3 – The chapter outlines the modification of the LAMP protocol for potential field deployment. The LAMP protocol was altered to allow for the visual detection of direct cell templates without DNA extraction from SDC-9 bioaugmented groundwater samples. The new protocol can detect RDase genes, without DNA extraction or a thermal cycler, below 106 gene copies/L, the concentration threshold recommended for effective in situ dechlorination. The primary objectives of this chapter were: 1. To compare LAMP and qPCR for tceA and vcrA gene quantification using DNA extracted from numerous groundwater samples and a real time thermal cycler in order to establish that the LAMP assays were comparable to methods currently used 2. To optimize a template preparation approach for LAMP, which does not require DNA extraction. 5 3. To develop and test a rapid, user-friendly, and low-cost method based on LAMP to detect vcrA and tceA genes in groundwater samples from different chlorinated solvent sites. Chapter 4 – The primary goal of this chapter was to make the visual detection LAMP assay quantitative by incorporating the MPN technique into the groundwater sample processing workflow. Moreover, visual detection with LAMP assay was optimized to include a dUTP-UNG contamination control system without significant increase in the detection limits. Two data sets are presented. The first set of data deals with the optimization of the amount of UNG required to destroy a vcrA gene contamination of ~104 gene copies per reaction while preserving amplification resulting from plasmid DNA and direct cell templates. The second set of data demonstrates the use of MPN technique coupled with visual detection LAMP to estimate the concentrations of RDase genes in groundwater samples without the extraction of DNA templates. Response factors correlating the concentrations observed with MPN visual detection LAMP and direct cell templates, to concentrations observed with qPCR and DNA templates were determined. These response factors would aid potential field deployment of the LAMP assay in the future. The key objectives of this chapter were: 1. To optimize the SYBR Green LAMP assay to incorporate dUTP and UNG based enzymatic control for prevention of false positives due to carry over contamination without a significantly increasing the detection limits of the SYBR Green LAMP assay. 2. To extend the application of MPN technique with the optimized SYBR Green LAMP assay for quantitative estimation of Dehalococcoides mccartyi RDase genes in groundwater samples without DNA extraction. 6 Chapter 5 – In this chapter, conclusions of this dissertation are outlined and a summary of the results and the future direction of the work are presented. 7 REFERENCES 8 REFERENCES 1. ATSDR. (October 2008 ). CERCLA priority list of hazardous substances. Agency for Toxic Substances and Disease Registry. http://www.atsdr.cdc.gov/cercla/07list.html. 2. USEPA 13 October 1999. Technical Factsheet on: Trichlorethylene. Office of Ground Water and Drinking Water. [Online.] 3. Freedman DL, Gossett JM. 1989. Biological reductive dechlorination of tetrachloroethylene and trichloroethylene to ethylene under methanogenic conditions. Applied and Environmental Microbiology 55:2144-2151. 4. He J, Ritalahti KM, Yang K-L, Koeningsberg SS, Löffler FE. 2003. Detoxification of vinyl chloride to ethene coupled to growth of an anaerobic bacterium. Nature 424:62-65. 5. Holliger C, Schraa G, Stams AJM, Zehnder AJB. 1993. A highly purified enrichment culture couples reductive dechlorination of tetrachloroethene to growth. Applied and Environmental Microbiology 59:2991-2997. 6. Löffler FE, Yan J, Ritalahti KM, Adrian L, Edwards EA, Konstantinidis KT, Müller JA, Fullerton H, Zinder SH, Spormann AM. 2013. Dehalococcoides mccartyi gen. nov., sp. nov., obligately organohalide-respiring anaerobic bacteria relevant to halogen cycling and bioremediation, belong to a novel bacterial class, Dehalococcoidia classis nov., order Dehalococcoidales ord. nov. and family Dehalococcoidaceae fam. nov., within the phylum Chloroflexi. International Journal of Systematic and Evolutionary Microbiology 63:625-635. 7. He J, Ritalahti KM, Aiello MR, Löffler FE. 2003. Complete detoxification of vinyl chloride by an anaerobic enrichment culture and identification of the reductively dechlorinating population as a Dehalococcoides species. Applied and Environmental Microbiology 69:996-1003. 8. Magnuson JK, Romine MF, Burris DR, Kingsley MT. 2000. Trichloroethene reductive dehalogenase from Dehalococcoides ethenogenes: sequence of tceA and substrate range characterization. Applied and Environmental Microbiology 66:51415147. 9. Muller JA, Rosner BM, von Abendroth G, Meshulam-Simon G, McCarty PL, Spormann AM. 2004. Molecular identification of the catabolic vinyl chloride reductase from Dehalococcoides sp. strain VS and its environmental distribution. Applied and Environmental Microbiology 70:4880-4888. 10. Major DW, McMaster ML, Cox EE, Edwards EA, Dworatzek SM, Hendrickson ER, Starr MG, Payne JA, Buonamici LW. 2002. Field demonstration of successful bioaugmentation to achieve dechlorination of tetrachloroethene to ethene. Environmental Science & Technology 36:5106-5116. 9 11. Vainberg S, Condee CW, Steffan RJ. 2009. Large-scale production of bacterial consortia for remediation of chlorinated solvent-contaminated groundwater. Journal of Industrial Microbiology & Biotechnology 36:1189-1197. 12. Cupples AM. 2008. Real-time PCR quantification of Dehalococcoides populations: methods and applications. Journal of Microbiological Methods 72:1-11. 13. Dijk JA, Breugelmans P, Philips J, Haest PJ, Smolders E, Springael D. 2008. Catalyzed reporter deposition-fluorescent in situ hybridization (CARD-FISH) detection of Dehalococcoides. Journal of Microbiological Methods 73:142-147. 14. Johnson DR, Brodie EL, Hubbard AE, Andersen GL, Zinder SH, Alvarez-Cohen L. 2008. Temporal transcriptomic microarray analysis of "Dehalococcoides ethenogenes" strain 195 during the transition into stationary phase. Applied and Environmental Microbiology 74:2864-2872. 15. Löffler FE, Edwards EA. 2006. Harnessing microbial activities for environmental cleanup. Current Opinion in Biotechnology 17:274-284. 16. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T. 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Research 28:60-63. 17. Herzog AB, Pandey AK, Reyes-Gastelum D, Gerba CP, Rose JB, Hashsham SA. 2012. Evaluation of sample recovery efficiency for bacteriophage P22 on fomites. Applied and Environmental Microbiology 78:7915-7922. 18. Kurosaki Y, Takada A, Ebihara H, Grolla A, Kamo N, Feldmann H, Kawaoka Y, Yasuda J. 2007. Rapid and simple detection of Ebola virus by reverse transcription-loopmediated isothermal amplification. Journal of Virological Methods 141:78-83. 19. Stedtfeld RD, Stedtfeld TM, Kronlein M, Seyrig G, Steffan RJ, Cupples AM, Hashsham SA. 2014. DNA extraction-free quantification of Dehalococcoides spp. in groundwater using a hand-held device. Environmental Science & Technology 48:1385513863. 10 Chapter 2: Development of Loop Mediated Isothermal Amplification (LAMP) for Rapid Detection and Quantification of Dehalococcoides mccartyi Biomarker Genes in Commercial Reductive Dechlorinating Cultures KB-1 and SDC-9 This chapter is adapted from previously published work in Applied and Environmental Microbiology: Kanitkar YH, Stedtfeld RD, Steffan RJ, Hashsham SA, Cupples AM. 2016. Development of loop mediated isothermal amplification (LAMP) for rapid detection and quantification of Dehalococcoides spp. biomarker genes in commercial reductive dechlorinating cultures KB-1 and SDC-9. Applied and Environmental Microbiology, 82:1799-1806. 2.1 Abstract Real time quantitative polymerase chain reaction (qPCR) protocols specific to the reductive dehalogenase (RDase) genes, vcrA, bvcA, and tceA are commonly used to quantify Dehalococcoides mccartyi in groundwater from chlorinated solvent contaminated sites. In this study, LAMP was developed as an alternative approach for the quantification of these genes. LAMP does not require a real time thermal cycler (amplification is isothermal) allowing the method to be performed using less expensive and potentially field deployable detection devices. LAMP primers were designed for each of three RDase genes (vcrA, bvcA, tceA) using Primer Explorer V4. The LAMP assays were compared to conventional qPCR approaches using plasmid standards and two commercially available bioaugmentation cultures, KB-1 and SDC-9 (both contain Dehalococcoides mccartyi). DNA was extracted over a growth cycle from KB-1 and SDC-9 cultures amended with trichloroethene and vinyl chloride, respectively. All three genes 11 were quantified for KB-1 whereas only vcrA was quantified for SDC-9. A comparison of LAMP and qPCR using standard plasmids indicated quantification was similar over a large range of gene concentrations. In addition, the quantitative increase in gene concentrations over one growth cycle of KB-1 and SDC-9 using LAMP was comparable to that of qPCR. The developed LAMP assays for vcrA and tceA genes were validated by comparing quantification on the hand held platform, the Gene-Z, and a real time thermal cycler using DNA isolated from eight groundwater samples obtained from a SDC-9 bioaugmented site (Tulsa, OK). These assays will be particularly useful at sites subject to bioaugmentation with these two commonly used Dehalococcoides mccartyi -containing cultures. 2.2 Introduction Commercially available reductive dechlorinating mixed cultures (e.g. KB-1 and SDC-9) are frequently used for bioaugmenting contaminated groundwater aquifers (2, 3). The growth of these strains in the field and in the laboratory is commonly monitored using real time quantitative PCR (qPCR) targeting the genes vcrA, bvcA, and tceA, which encode for highly specific RDases implicated in organohalide respiration (4). To date, a number of qPCR protocols with DNA binding dyes or TaqMan probes to quantify vcrA, bvcA, and tceA genes have been developed (5). Although qPCR has been successful for monitoring reductive dechlorination, alternative methods would be advantageous for laboratories or practitioners without access to a real time thermal cycler. In addition, any method that is more economical and faster compared to qPCR would be beneficial. Loop mediated isothermal amplification (LAMP) is a novel molecular method recently developed for the specific detection of nucleic acids. It is has a one-step amplification mechanism, which amplifies a target DNA sequence using four to six primers. Because LAMP is 12 rapid, sensitive, specific, and occurs isothermally, it has emerged as an alternative to PCR based methods in a wide variety of applications. For example, many LAMP assays have been developed for testing food borne bacterial pathogens and fungal contaminants (6, 7). In 2014, LAMP primer sets were developed for the 16S rRNA and vcrA genes of Dehalococcoides mccartyi (8). In that study, a field deployable approach for harvesting biomass from samples of groundwater bio augmented with SDC-9 was described. Direct amplification of templates with LAMP was performed using the hand held platform, the Gene-Z. Detection limits below 107 gene copies/L were reported (this is the generally accepted threshold for acceptable in situ dechlorination). Here, the objective was to evaluate if LAMP can be used for the quantification of Dehalococcoides mccartyi RDase genes (vcrA, bvcA, tceA) in two commonly used commercial bioaugmentation cultures, KB-1 (from SiREM) and SDC-9 (from CB&I). This study involved DNA templates rather than direct amplification of harvested biomass. Quantification (i.e. gene copies/L values) was compared between LAMP and qPCR during one growth cycle to evaluate the effectiveness of LAMP as a tool to monitor the growth of Dehalococcoides mccartyi in KB-1 and SDC-9. Further, we used DNA templates isolated from eight groundwater samples to validate quantification of the LAMP assays on the Gene-Z. The data generated from the groundwater samples were also compared to data obtained using a real time thermal cycler. 2.3 Materials and methods 2.3.1 Cultures and growth conditions All experiments were carried out in triplicate serum bottles (160 mL nominal volume) containing 100 mL (final volume) of culture and sealed with grey butyl rubber septa. After transferring the microcosms into an anaerobic chamber, the KB-1 or SDC-9 inoculum (10 mL) 13 and sterile mineral medium (90 mL) were added to the serum bottles using aseptic techniques. The bottles were capped with grey butyl rubber septa, removed from the anaerobic chamber, and sparged with 30% CO2/70% N2 to adjust the pH. During the growth cycle, the pH of each bottle was measured and adjusted to neutral, as needed using 1.0 M NaOH. The bottles were incubated quiescently, shielded from light, at room temperature (~22-24°C), and with the liquid in contact with the septum to minimize the loss of volatile compounds. The concentration of chlorinated ethenes was monitored by GC-FID, as previously described (9). All KB-1 serum bottles were amended with 10 µL of feed solution (1:10 dilution of neat TCE in methanol) to yield final amounts of ~23 µmol TCE and ~112 µmol of methanol in each bottle. Bottles were also amended with ethanol (~44.0 mg/L) each week if residual cDCE and VC were observed. An aliquot (1.0 mL) of culture fluid was removed on days 0, 7, 14, 21, 28, 35, 38, 41, and 44 for DNA extraction. DNA was isolated from 100 µL aliquots using Mo Bio DNA Isolation kit as per the manufacturer’s protocol (Mo Bio Laboratories, Inc., Carlsbad, CA). All SDC-9 bottles were amended with ~20 µmol VC along with a 0.1 mL spike of 100 mM sodium lactate. DNA was extracted from 30 µL aliquots of 3 mL culture fluid on days 0, 6, 22, 27, 32, and 40. 2.3.2 Groundwater samples Groundwater samples were obtained from a site in Tulsa, OK, which was recently bioaugmented with SDC-9. Eight amber glass bottles containing ~1.0 L groundwater sample representative of monitoring wells (MW) 1 - 4 (MW1-MW4) and injection wells (IW) 1-4 (IW1IW4) were bubble wrapped and shipped overnight in a cooler packed with icepacks. Upon receipt, the bottles were stored at 4.0 ºC in the absence of light for the duration of testing. Groundwater samples (100.0 mL) were filtered through 0.22 µm filter (EMD Millipore Corp., Billerica, MA) using a vacuum pump. Membranes were cut into 0.5 mm strips inside a petri dish 14 with a 15 blade using aseptic technique and these were added to 15.0 mL bead tubes supplied with the Mo Bio UltraClean water kit. DNA was extracted from this solution (1.5 mL) using the manufacturer’s protocol. The DNA was precipitated by adding 150.0 µL of 5 M NaCl and 3.0 mL of absolute ice-cold ethanol and incubating for 30 min at 4 ºC. Following centrifugation (14000 x g, 20 min, room temperature), the DNA pellet was rinsed with 70% ethanol, air dried and suspended in 100 µL of dH2O. The extracted DNA was immediately used for amplification or stored at -20 ºC for future use. 2.3.3 Preparation of plasmid standards Genomic DNA was extracted from 5 mL of KB-1 (from SiREM Guelph, ON, Canada) using Mo Bio DNA isolation kit, as per the manufacturer’s protocol. The vcrA and the bvcA genes were amplified using PCR with primers described previously (10). Amplified templates were cloned into E. coli DH5α using pCR2.1 TOPO TA-cloning vector (Invitrogen) to generate plasmid inserts. E. coli cultures were grown overnight in LB medium amended with 50 mg/mL ampicillin and 7.0% glycerol at 37 ºC. Plasmid standards for tceA were provided by Dr. Frank Löffler (University of Tennessee, Knoxville). Plasmid inserts were extracted using 5 mL E. coli culture and the Qiagen plasmid extraction kit. Gene copies were calculated as previously described (10). Serial dilutions of plasmid inserts from 3.16 × 108 plasmids to ~316 plasmids per μL for vcrA, 2.65 × 109 plasmids to ~265 plasmids per μL for bvcA, and 1.41 × 1010 to 141 plasmids per μL for tceA were used as standards for the amplifications. By plotting the log of the calculated copy number against the cycle threshold (for qPCR) or threshold time (for LAMP) at which fluorescence for that sample crosses the threshold value, standard curves were obtained. 15 2.3.4 Design of LAMP primers The LAMP primer sets used for this study are listed in Table 2.1. FASTA files for the functional RDase genes vcrA (Accesssion#NC_013552.1, region 1187298-1188857), bvcA (Accession# NC_009455.1 region 834959 to 836509), and tceA (Accession# AY165309.1) of Dehalococcoides mccartyi were downloaded and aligned with the relevant environmental sequences on the NCBI nucleotide database to identify the conserved regions. Next, LAMP primer sets were designed for those regions using Primer Explorer V4 (https://primerexplorer.jp/e/). For the vcrA gene, two new LAMP primer sets, vcrA set A and vcrA set C, targeting the 857-1072 bp region were designed and used along with vcrA set B, which was designed and tested (11). One primer set, bvcA set A, targeting the 895-1139 bp region was designed for the bvcA gene. Similarly, tceA set A was designed to target the 8821156 bp region of the tceA gene. Finally, NCBI nucleotide BLAST was used to determine the fidelity of the primer sets to the target sequences in environmental submissions on the database by setting the default expect value as 1×10-5. 16 Table 2.1 LAMP primer sets designed and used in this study Target Primer Gene set vcrA vcrA set A Primer F3 B3 FIP BIP vcrA set B (11) LF LB F3 B3 FIP BIP vcrA set C LF LB F3 B3 FIP BIP bvcA bvcA Set A LF LB F3 B3 FIP BIP tceA tceA Set A LF LB F3 B3 FIP BIP LF LB Sequence (5’3’) Target region (bp) GTAAGTTTTACGCGAGATGG Accesssion# GTCATCGGCTGAGCTTTC NC_013552. ACCCTCCCATTTTGGTACGCTTGTA 1, region TGGTCCGCCACAT 1187298AAGACAATTTTCTAATGCTGAGGGC 1188857 ATTTGGGATCTGCCAGGT (857-1072) CATCAGGTGGCGCTGAATC AGCTGCAAAATATTTTGGTGCTGG ACTAATATATAAGAAAGCTCAGCC Accesssion# TCTTATTGAGTTCTTGTGGTTG NC_013552. GGTCAGGAACCTTGGGATAAATTTT 1, region GATGACTCTAGGAAAAGGAACA 1187298AACTTTAAGGAAGCGGATTATAGC 1188857 TATGGATTCACACTTTGTTGG (652-886) CCTGGTCCACCTAATTCACTGTA ACTACAATGATGCAGAGTGGGTTA GTAAGTTTTACGCGAGATGG Accesssion# GTCATCGGCTGAGCTTTC NC_013552. ACCCTCCCATTTTGGTACGCTTGTA 1, region TGGTCCGCCACAT 1187298AAGACAATTTTCTAATGCTGAGGGC 1188857 ATTTGGGATCTGCCAGGT (857-1072) CCATCAGGTGGCGCTGAA TGGTGCTGGTGGCGTT ACAATGCCTTTACCAGAAGA Accession# ACCGTATTTGGGGCTGAT NC_009455. TCGGCCTCCATTAAAAGCCATTCTC 1 region TAGGGTGGTCATGT 834959 to ATCAAGGACTTGGTGGCGACCTTGT 836509 TCGGAAAGACACTCA (895-1139) AGGCAATCATACTTGAAGCGTC TGTGGGGACCTGGTGGT GCCGTTTATTCCATTCATGG Accession# GCATAGACTGGATGAAGGAA AY165309.1 ACATAATTGCTGGGAGAACCCG(882-1156) TCGCATAGAGAGATAAGGCC GCCATTCGTGGCGGCATATATCAGATTATGACCCTGGTGAA CTTTATGGACGCTATGAAGGTTCTA TCTTCCCTGCGGTCGCCATA 17 2.3.5 qPCR and LAMP amplification Each 20µL LAMP reaction contained 1x isothermal amplification buffer (NEB, Catalog# B0537S), 1.4 mM dNTPs, 0.8 mM Betaine, 6.0 mM MgSO4, 1.6 units of BST 2.0 Warm Start (NEB), 0.8 µL SYTO 82 orange fluorescent dye (Life Technologies, Inc., Grand Island, NY), 0.8 µL Pluronic (Life Technologies, Inc., Grand Island, NY), 0.8 µL Bovine Serum Albumin, 0.25 µM 10X Primer Mix and balance water to make up 18 µL. Reactions were incubated at 63 ºC for 60 min for amplification. All TaqMan assays were set up as 20 µL reactions. Each 20 µL reaction contained 10 µL iTaq Universal super mix supplied by Bio-Rad, 1.2 µL TaqMan probe described previously (1214), and balance water to make up 18 µL. PCR amplifications were performed using cycling conditions of 95 °C for 15 s, 60 °C for 1 min, a slow ramp of 1% to 95 °C for 15 s and 60 °C for 15 s. DNA templates and plasmid standards were added to each LAMP and qPCR reaction as 2 µL aliquots. All qPCR primers and probes used in this study are listed in Table 2.2. All qPCR experiments were performed in the commercially available real time thermal cycler (Chromo 4 PCR thermal cycler). For KB-1 and SDC-9 templates, amplification with LAMP was carried out in the real time thermal cycler while amplification with groundwater templates was performed in both the Gene-Z (below) as well as in the real time thermal cycler. Triplicate reactions for each test, positive and no-template controls were used for all experiments. 18 Table 2.2 qPCR primers used in this study Target Primer Gene vcrA vcrA1022F vcrA1093R vcrA1042Probe bvcA bvcA925F bvcA1017R bvcA977Probe tceA tceA1270F tceA1336R 2.3.1 Sequence Reference CGGGCGGATGCACTATTTT GAATAGTCCGTGCCCTTCCTC FAM-CGCAGTAACTCAACCATTTCCT GGTAGTGG-TAMRA AAAAGCACTTGGCTATCAAGGAC CCAAAAGCACCACCAGGTC FAM-TGGTGGCGACGTGGCTATGTGGTAMRA ATCCAGATTATGACCCTGGTGAA GCGGCATATATTAGGGCATCTT (10) (10) (10) (10) (10) (10) (12, 14) (12, 14) Gene-Z analysis of groundwater samples Inside the Gene-Z device, an array of 64 LEDs, a bundle of optical fibers, and a single photodiode were used to measure fluorescence in real-time (8). An iPod Touch (gen 5) was used to control reaction temperature and time, start the device, stream data via Bluetooth connectivity, sort, plot, store, and transmit results. Disposable chips were made by etching channels and wells into black acrylic (1.58 mm thick) via a 40 W CO2 laser (Full Spectrum). Etched chips were cleaned and prepared as previously described (15). Briefly, chips were cleaned with distilled water, soaked in 70% ethanol for 10 min, and dried for 10 min at 70 oC. Once dry, primers were dispensed and dried in wells at 70 oC for 5 min. Wells were enclosed with optical adhesive film (MicroAmp, Applied Biosystems) and chips were stored at -20 oC until use. Chips were cut with eight reaction wells per sample, and four samples per chip (i.e. 32 reaction wells per chip with 20 L reaction volume). Six chips were used to test groundwater samples and two additional chips were used to test plasmid dilution standards. vcrA and tceA primers were each dispensed into three separate reaction wells per sample lane. 19 2.4 Results 2.4.1 Amplification with LAMP primers and their application As stated previously, vcrA set B was previously designed and tested using templates obtained from groundwater spiked with SDC-9 (11). In that study, larger volumes of groundwater samples (1 to 4 L) were required when the vcrA gene copies were less than 104 gene copies/L. In this study, we developed two new LAMP primer sets (vcrA set A and vcrA set C) that exhibited faster LAMP threshold times than vcrA set B with 103.5 gene copy templates (23.9 ±0.4 min. for vcrA set A, 21.2 ± 0.2 min. for vcrA set C, and 28.3 ± 0.3 min. for vcrA set B). Moreover, the new primer sets had equivalent or better detection limits compared to vcrA set B (103.5 gene copies/reaction for vcrA set A, 102.5 gene copies/reaction for vcrA set C, and 103.5 gene copies/reaction for vcrA set B). Here, the first set of experiments targeted vcrA in SDC-9 using both vcrA set A and vcrA set B. The second set of experiments involved vcrA set C, the most refined LAMP primer set for vcrA, with KB-1 templates. Additionally, new primer sets were developed for bvcA and tceA genes and these were tested with KB-1 templates. One aim was to evaluate if the new LAMP primer sets could be used to track the growth of Dehalococcoides mccartyi in actively dechlorinating KB-1 and SDC-9 cultures over one growth cycle. As SDC-9 does not contain bvcA, this assay was not tested with this culture. qPCR was used as a control assay for all experiments. While in-silico specificity of the new primer sets was not evaluated, LAMP reaction requires six primers 6 different primers for amplification it is less likely to produce false positives. 2.4.2 Monitoring Dehalococcoides mccartyi growth in KB-1 and SDC-9 cultures The mean mass of TCE, cDCE, VC, and ETH in triplicate KB-1 cultures and an abiotic control is shown (Figure 2.1). As expected, TCE was reduced to cDCE, VC, ETH. cDCE 20 accumulated and peaked at 7 days after inoculation, while VC peaked at ~35 days before being rapidly degraded to ETH. Stoichiometric amounts of ETH accumulated at the end of the growth cycle. TCE, cDCE, and VC were not detected at the end of the 48-day incubation period. At each time point, the concentration of two Dehalococcoides mccartyi strains, VS and BAV1, were investigated using qPCR and LAMP targeting the vcrA and bvcA genes in DNA extracted from the KB-1 cultures. Figure 2.2 illustrates the gene copies of vcrA (A), bvcA (B), and tceA (C) per L in triplicate cultures of KB-1 while growing on TCE. We observed a comparable steady increase in the number of vcrA gene copies from ~5.8 × 106 gene copies/L on day 7 to ~6.4 × 109 gene copies/L on day 38 using both LAMP and qPCR. This was followed by a more rapid increase between days 38 and 44 from ~6.4 × 109 gene copies/L to ~1.1 × 1011 gene copies/L coupled to significant reduction of VC to ETH. A similar trend was observed with the bvcA gene. Gene copy numbers steadily increased from 3.2 × 106 gene copies/L at day 7 to 5.7 × 108 gene copies/L, followed by a more rapid increase to 5.49 × 109 gene copies/L. Gene copies of tceA increased to ~1.4 × 108 gene copies/L from day 0 to day 14, coupled to the reduction of TCE to cDCE and VC, which was then followed by a slight increase to ~3.8 ×108 gene copies/L on day 44. Similarly, the growth of Dehalococcoides mccartyi in SDC-9 culture was investigated using the vcrA gene. The mean mass of VC and ETH in triplicate SDC-9 cultures and an abiotic control is shown in Figure 2.3. The bars represent standard deviation from the mean values. Rapid reductive dechlorination of ~24 µmol VC from day 20 to day 40 was coupled to the stoichiometric accumulation of ETH. Figure 2.4 illustrates vcrA gene copies per liter measured via two LAMP primer sets (vcrA set A and vcrA set B) and qPCR in the triplicate cultures. The vcrA gene copies steadily 21 increased to ~ 9.0 × 107 gene copies/L. As VC rapidly dechlorinated to ETH, we observed that the vcrA gene copies increased from ~ 9.0 × 107 gene copies/L to ~1.1 × 109 gene copies/L. The mean gene copies of vcrA (A), bvcA (B), and tceA (C) per L in triplicate cultures of KB-1 while growing on TCE are shown (Figure 2.5). The bars represent standard deviations from the mean values. Note, the y-axis is a log scale, which does not start at zero to illustrate the differences between vcrA, bvcA, and tceA concentrations. To elucidate the potential of LAMP as an alternate method to monitor Dehalococcoides mccartyi in commercial reductive dechlorinating cultures, the absolute quantification of each gene in KB-1 templates was compared using both methods. Figure 2.6 is a comparison of vcrA (A), bvcA (B), and tceA (C) mean gene copies (per L) in triplicate cultures of KB-1 while growing on TCE. The bars represent standard deviations from the mean values. For each gene, the qPCR data is plotted against the LAMP data at each time point over the growth cycle. The dashed line represents a 1:1 comparison. 15 TCE cDCE VC ETH Abiotic control TCE, cDCE, VC, ETH (µmol/bottle) 10 5 0 0 10 20 Time (d) 30 40 50 Figure 2.1 Mean mass of TCE, cDCE, VC, and ETH in triplicate KB-1 cultures and an abiotic control. Note: The bars represent one standard deviation from the mean values 22 A log10 vcrA gene copies /L 11.5 log10 bvcA gene copies /L qPCR vcrA 10.5 9.5 8.5 7.5 6.5 5.5 0 10 B 11.5 20 30 Time (days) LAMP bvcA 40 50 qPCR bvcA 10.5 9.5 8.5 7.5 6.5 5.5 0 10 20 30 Time (days) LAMP tceA C 11.5 log10 tceA gene copies /L LAMP vcrA 40 50 qPCR tceA 10.5 9.5 8.5 7.5 6.5 5.5 0 10 20 30 Time (days) 40 50 Figure 2.2 Gene copies of vcrA (A), bvcA (B), and tceA (C) per L in triplicate cultures of KB-1 while growing on TCE, LAMP vcrA set C was used to target vcrA Note: The bars represent one standard deviation from the mean values 23 VC, Ethene (µmol/bottle) 30 VC Ethene Abiotic control VC 20 10 0 0 10 20 30 40 50 Time (d) Figure 2.3 Mean mass of VC and ETH in triplicate SDC-9 cultures and an abiotic control. log10 vcrA gene copies/L 10.0 qPCR LAMP Set A LAMP Set B 9.0 8.0 7.0 6.0 0 10 20 30 40 50 Time (d) Figure 2.4 vcrA gene copies per L measured via qPCR and two LAMP assays (vcrA set A and vcrA set B) in triplicate cultures of SDC-9 (A, B, C) during growth of VC Note: The bars represent one standard deviation from the mean values 24 11.5 LAMP vcrA qPCR vcrA LAMP bvcA qPCR bvcA LAMP tceA qPCR tceA 10 20 Time (days) Log10 gene copies /L 10.5 9.5 8.5 7.5 6.5 5.5 0 30 40 50 Figure 2.5 Mean mass of vcrA (A), bvcA (B), and tceA (C) per L in triplicate cultures of KB-1 while growing on TCE Note: The bars represent standard deviation from the mean values. The y-axis is a log scale and does not start at zero. 25 qPCR log10 gene copies /L 11.5 10.5 A vcrA 9.5 8.5 7.5 6.5 5.5 5.5 6.5 7.5 8.5 9.5 10.5 11.5 LAMP log10 gene copies /L qPCR log10 gene copies /L 11.5 10.5 B bvcA 9.5 8.5 7.5 6.5 5.5 5.5 6.5 7.5 8.5 9.5 10.5 11.5 LAMP log10 gene copies /L qPCR log10 gene copies /L 9.5 C tceA 8.5 7.5 6.5 6.5 7.5 8.5 9.5 LAMP log10 gene copies /L Figure 2.6 Comparison of vcrA (A), bvcA (B), tceA (C) mean gene copies (per L) in triplicate cultures of KB-1 while growing on TCE. Note: The bars represent standard deviations from the mean values. The dashed line represents a 1:1 comparison 26 2.4.3 Validation of new LAMP assays with the Gene-Z using groundwater templates Nucleic acids extracted from groundwater from a previously bio augmented, chlorinated solvent contaminated site were used to validate the novel LAMP assays with a hand held device, the Gene-Z. The data obtained using the new LAMP assays on the Gene-Z were compared to those obtained using qPCR on a real time thermal cycler. Specifically, vcrA and tceA gene copies (per L) from four monitoring wells and four injection wells (in triplicate) were compared using the new LAMP assays and qPCR (Figure 2.7). Again, the dashed line represents 1:1 slope. vcrA 11.0 tceA qPCR BioRad values log10 gene copies/L 10.0 9.0 8.0 7.0 6.0 5.0 5.0 6.0 7.0 8.0 9.0 10.0 LAMP Gene-Z values log10 gene copes/L 11.0 Figure 2.7 Comparison of vcrA and tceA mean gene copies (per L) in triplicates of eight different groundwater DNA templates observed using qPCR on a real time thermal cycler and the Gene-Z. 27 2.5 Discussion To date, LAMP primer sets have been developed for phylogenetic or functional genes of prokaryotes, eukaryotes, and viruses to detect target sequences in templates extracted from a variety of environmental matrices such as air, water, soil, fecal matter, or blood. For example, LAMP can be used for detection of the invA gene in all known 89 Salmonella spp. strains, a food borne bacterial pathogen causing Salmonellosis (7, 16). LAMP was also applied to detect Cryptosporidium oocysts, which cause cryptosporidiosis, using functional gene gp60 (17). Similarly, LAMP primer sets for detection of viral pathogens such as HIV-1 and Ebola have also been described (18, 19). Another application of LAMP has been the identification of beef contaminated with ostrich meat. The LAMP assay successfully identified ostrich meat contamination of up to 0.01% using direct cell amplification from swabs (20). These examples demonstrate the versatility of LAMP in terms of its application to human health, environmental and food microbiology. In this study, LAMP was applied for the rapid quantification of the key biomarker RDase genes, vcrA, bvcA, and tceA. These biomarker genes are important for monitoring the activity of Dehalococcoides mccartyi in groundwater during natural attenuation, biostimulation, and bioaugmentation at chlorinated solvent contaminated sites. The growth patterns observed in this study are characteristic of cultures such as KB-1 and SDC-9 when amended with TCE and VC, respectively. KB-1 is highly enriched in a few unique Dehalococcoides mccartyi strains, which are capable of catabolic growth using cDCE and VC as electron acceptors for reductive dechlorination (21). Typically, the individual cells of such strains carry one copy of vcrA or bvcA genes that code for the two distinct vinyl chloride reductases (22-24). However, neither vinyl chloride reductase is capable of growth linked metabolic reduction of TCE to cDCE or VC. When amended with TCE, initial growth is 28 cometabolic and often slower (4, 25, 26). As a result, the increase in vcrA and bvcA gene copies observed is faster and more discernable when cDCE and VC are being dechlorinated. In contrast, the tceA gene codes for trichloroethene reductive dehalogenase responsible for the reductive dechlorination of TCE to cDCE and VC (27). An initial increase in the tceA gene copies coupled to rapid reduction of TCE to cDCE and VC was observed in all KB-1 microcosms, but, as TCE depleted, the increase in tceA gene copies was substantially less. This is indicative of growth of Dehalococcoides mccartyi strains with the tceA gene. However, the abundance of the tceA gene within the Dehalococcoides genus is more widespread than vcrA or bvcA genes and strains that carry the tceA gene may carry vcrA or bvcA genes (4, 10, 28). Additionally, TCE dechlorination may also be driven by Geobacter strains in KB-1 along with Dehalococcoides mccartyi (29), which may explain the less discernable growth pattern. In this research, the novel LAMP assays for vcrA and tceA were validated using DNA extracted from groundwater samples. We compared the quantification i.e. gene copies/L values for both genes obtained using qPCR on a real time thermal cycler with LAMP on the Gene-Z. The Gene-Z yields slightly higher values compared to qPCR, which may be attributed to the difference in fluorescence sensing mechanisms of the two platforms. Nevertheless, similar values were obtained for each gene on both platforms, indicating quantification with LAMP on the Gene-Z is a viable alternative to qPCR. Moreover, the new LAMP primer sets were able to detect quantities below 107 gene copies/L, the accepted limit for natural attenuation. LAMP offers two key advantages over qPCR. First, the LAMP primer sets described here may be used with a variety of several less expensive platforms (with diverse types of detection mechanisms), which include real time turbidimeters, microfluidic chips (e.g. Gene-Z), electrochemical, or ultrasonic sensors (11, 30-33). These platforms are cheaper and more accessible alternatives to 29 qPCR thermal cyclers. Second, these platforms use different reaction chemistries (e.g. producing significant visible fluorescence or post reaction electrochemical changes) for the detection of amplified target sequences and thus can be more economical compared to qPCR. In time-limited studies, another potential advantage is that amplification during LAMP is faster than qPCR. With the primer sets and reaction chemistries described in this study, all LAMP reactions were complete in less than one hour, which is significantly shorter than a typical qPCR run (>1.5 h). In summary, the development of LAMP assays for the detection of the RDase genes, vcrA, bvcA, and tceA will enable using alternative, potentially field deployable platforms, such as the Gene-Z (11), for the rapid detection and quantification of Dehalococcoides mccartyi in groundwater from contaminated solvent sites. Further, the development of LAMP assays specific to two commonly used commercially available cultures will facilitate specific detection of these RDase genes at sites subject to bioaugmentation. 30 REFERENCES 31 REFERENCES 1. Kanitkar YH, Stedtfeld RD, Steffan RJ, Hashsham SA, Cupples AM. 2016. Development of loop mediated isothermal amplification (LAMP) for rapid detection and quantification of Dehalococcoides spp. biomarker genes in commercial reductive dechlorinating cultures KB-1 and SDC-9. Applied and Environmental Microbiology:AEM. 03660-03615. 2. Major DW, McMaster ML, Cox EE, Edwards EA, Dworatzek SM, Hendrickson ER, Starr MG, Payne JA, Buonamici LW. 2002. Field demonstration of successful bioaugmentation to achieve dechlorination of tetrachloroethene to ethene. Environmental Science & Technology 36:5106-5116. 3. Vainberg S, Condee CW, Steffan RJ. 2009. Large-scale production of bacterial consortia for remediation of chlorinated solvent-contaminated groundwater. Journal of Industrial Microbiology & Biotechnology 36:1189-1197. 4. Löffler FE, Yan J, Ritalahti KM, Adrian L, Edwards EA, Konstantinidis KT, Müller JA, Fullerton H, Zinder SH, Spormann AM. 2013. Dehalococcoides mccartyi gen. nov., sp. nov., obligately organohalide-respiring anaerobic bacteria relevant to halogen cycling and bioremediation, belong to a novel bacterial class, Dehalococcoidia classis nov., order Dehalococcoidales ord. nov. and family Dehalococcoidaceae fam. nov., within the phylum Chloroflexi. International Journal of Systematic and Evolutionary Microbiology 63:625-635. 5. Cupples AM. 2008. Real-time PCR quantification of Dehalococcoides populations: methods and applications. Journal of Microbiological Methods 72:1-11. 6. Ahmad F, Tourlousse DM, Stedtfeld RD, Seyrig G, Herzog AB, Bhaduri P, Hashsham SA. 2009. Detection and occurence of indicator organisms and pathogens. Water Environment Research 81:959-980. 7. Ohtsuka K, Yanagawa K, Takatori K, Hara-Kudo Y. 2005. Detection of Salmonella enterica in naturally contaminated liquid eggs by loop-mediated isothermal amplification, and characterization of Salmonella isolates. Applied and Environmental Microbiology 71:6730-6735. 8. Stedtfeld RD, Tourlousse DM, Seyrig G, Stedtfeld TM, Kronlein M, Price S, Ahmad F, Gulari E, Tiedje JM, Hashsham SA. 2012. Gene-Z: a device for point of care genetic testing using a smartphone. Lab on a Chip 12:1454-1462. 9. Freedman DL, Gossett JM. 1989. Biological reductive dechlorination of tetrachloroethylene and trichloroethylene to ethylene under methanogenic conditions. Applied and Environmental Microbiology 55:2144-2151. 32 10. Ritalahti KM, Amos BK, Sung Y, Wu Q, Koenigsberg SS, Loffler FE. 2006. Quantitative PCR targeting 16S rRNA and reductive dehalogenase genes simultaneously monitors multiple Dehalococcoides strains. Applied and Environmental Microbiology 72:2765-2774. 11. Stedtfeld RD, Stedtfeld TM, Kronlein M, Seyrig G, Steffan RJ, Cupples AM, Hashsham SA. 2014. DNA extraction-free quantification of Dehalococcoides spp. in groundwater using a hand-held device. Environmental Science & Technology 48:1385513863. 12. Aiello MR. 2003. Quantitative environmental monitoring of PCE dechlorinators in a contaminated aquifer and PCE-fed reactor. M.S. thesis. Michigan State University, East Lansing. 13. Hatt JK, Löffler FE. 2012. Quantitative real-time PCR (qPCR) detection chemistries affect enumeration of the Dehalococcoides 16S rRNA gene in groundwater. Journal of Microbiological Methods 88:263-270. 14. Johnson DR, Lee PK, Holmes VF, Alvarez-Cohen L. 2005. An internal reference technique for accurately quantifying specific mRNAs by real-time PCR with application to the tceA reductive dehalogenase gene. Applied and Environmental Microbiology 71:3866-3871. 15. Stedtfeld RD, Liu Y-C, Stedtfeld TM, Kostic T, Kronlein M, Srivannavit O, Khalife WT, Tiedje JM, Gulari E, Hughes M. 2015. Static self-directed sample dispensing into a series of reaction wells on a microfluidic card for parallel genetic detection of microbial pathogens. Biomedical Microdevices 17:1-12. 16. Zhang G, Brown EW, González-Escalona N. 2011. Comparison of real-time PCR, reverse transcriptase real-time PCR, loop-mediated isothermal amplification, and the FDA conventional microbiological method for the detection of Salmonella spp. in produce. Applied and Environmental Microbiology 77:6495-6501. 17. Karanis P, Thekisoe O, Kiouptsi K, Ongerth J, Igarashi I, Inoue N. 2007. Development and preliminary evaluation of a loop-mediated isothermal amplification procedure for sensitive detection of Cryptosporidium oocysts in fecal and water samples. Applied and Environmental Microbiology 73:5660-5662. 18. Curtis KA, Rudolph DL, Owen SM. 2008. Rapid detection of HIV-1 by reversetranscription, loop-mediated isothermal amplification (RT-LAMP). Journal of Virological Methods 151:264-270. 19. Kurosaki Y, Takada A, Ebihara H, Grolla A, Kamo N, Feldmann H, Kawaoka Y, Yasuda J. 2007. Rapid and simple detection of Ebola virus by reverse transcription-loopmediated isothermal amplification. Journal of Virological Methods 141:78-83. 33 20. Abdulmawjood A, Grabowski N, Fohler S, Kittler S, Nagengast H, Klein G. 2014. Development of loop-mediated isothermal amplification (LAMP) assay for rapid and sensitive identification of ostrich meat. PloS one 9:e100717. 21. Duhamel M, Mo K, A. EE. 2004. Characterization of a highly enriched Dehalococcoides-containing culture that grows on vinyl chloride and trichloroethene. Applied and Environmental Microbiology 70:5538–5545. 22. Krajmalnik-Brown R, Holscher T, Thomson IN, Saunders FM, Ritalahti KM, Loffler FE. 2004. Genetic identification of a putative vinyl chloride reductase in Dehalococcoides sp. strain BAV1. Applied and Environmental Microbiology 70:63476351. 23. McMurdie PJ, Behrens SF, Müller JA, Göke J, Ritalahti KM, Wagner R, Goltsman E, Lapidus A, Holmes S, Löffler FE. 2009. Localized plasticity in the streamlined genomes of vinyl chloride respiring Dehalococcoides. PLoS Genetics 5:e1000714e1000714. 24. Muller JA, Rosner BM, von Abendroth G, Meshulam-Simon G, McCarty PL, Spormann AM. 2004. Molecular identification of the catabolic vinyl chloride reductase from Dehalococcoides sp. strain VS and its environmental distribution. Applied and Environmental Microbiology 70:4880-4888. 25. Cupples AM, Spormann AM, McCarty PL. 2003. Growth of a Dehalococcoides-like microorganism on vinyl chloride and cis-dichloroethene as electron acceptors as determined by competitive PCR. Applied and Environmental Microbiology 69:953-959. 26. He J, Ritalahti KM, Yang K-L, Koeningsberg SS, Löffler FE. 2003. Detoxification of vinyl chloride to ethene coupled to growth of an anaerobic bacterium. Nature 424:62-65. 27. Magnuson JK, Romine MF, Burris DR, Kingsley MT. 2000. Trichloroethene reductive dehalogenase from Dehalococcoides ethenogenes: sequence of tceA and substrate range characterization. Applied and Environmental Microbiology 66:51415147. 28. Sung Y, Ritalahti KM, Apkarian RP, Loffler FE. 2006. Quantitative PCR confirms purity of strain GT, a novel trichloroethene-to-ethene-respiring Dehalococcoides isolate. Applied and Environmental Microbiology 72:1980-1987. 29. Hug LA, Beiko RG, Rowe AR, Richardson RE, Edwards EA. 2012. Comparative metagenomics of three Dehalococcoides-containing enrichment cultures: the role of the non-dechlorinating community. BMC Genomics 13:327. 30. Hsieh K, Ferguson BS, Eisenstein M, Plaxco KW, Soh HT. 2015. Integrated electrochemical microsystems for genetic detection of pathogens at the point of care. Accounts of Chemical Research 48:911-920. 34 31. Mori Y, Kitao M, Tomita N, Notomi T. 2004. Real-time turbidimetry of LAMP reaction for quantifying template DNA. Journal of Biochemical and Biophysical Methods 59:145-157. 32. Rane TD, Chen L, Zec HC, Wang T-H. 2015. Microfluidic continuous flow digital loop-mediated isothermal amplification (LAMP). Lab on a Chip 15:776-782. 33. Xu G, Gunson RN, Cooper JM, Reboud J. 2015. Rapid ultrasonic isothermal amplification of DNA with multiplexed melting analysis - applications in the clinical diagnosis of sexually transmitted diseases. Chemical Communications 51:2589-2592. 35 Chapter 3: Development and Application of a Rapid, User-Friendly and Inexpensive Method to Detect Dehalococcoides mccartyi RDase Genes from Groundwater This chapter is adapted from previously published work in Applied Microbiology and Biotechnology: Kanitkar YH, Stedtfeld RD, Hatzinger PB, Hashsham SA, Cupples AM. 2017. Development and application of a rapid, user-friendly, and inexpensive method to detect Dehalococcoides mccartyi reductive dehalogenase genes from groundwater. Applied Microbiology and Biotechnology 101:4827-4835. 3.1 Abstract TaqMan probe based qPCR specific to the biomarker RDase genes is a widely accepted MBT for determining the abundance of Dehalococcoides mccartyi in groundwater samples from chlorinated solvent contaminated sites. However, there are significant costs associated with this MBT. In this study, we describe an approach that requires only low cost laboratory equipment (a bench top centrifuge and a water bath) and requires less time and resources compared to qPCR. The method involves the concentration of biomass from groundwater, without DNA extraction, and loop mediated isothermal amplification (LAMP) of the cell templates. The amplification products are detected by a simple visual color change (orange/green). The detection limits of the assay were determined using groundwater from a contaminated site. In addition, the assay was tested with groundwater from three additional contaminated sites. The final approach to detect RDase genes, without DNA extraction or a thermal cycler, was successful to 1.8 X 105 gene 36 copies per L for vcrA and 1.3 X 105 gene copies per L for tceA. Both values are below the threshold recommended for effective in situ dechlorination. 3.2 Introduction The remediation of chlorinated solvent contaminated sites frequently involves approaches such as biostimulation or bioaugmentation to facilitate the reductive dechlorination of these chemicals via a process known as organohalide respiration (2). Both approaches aim at increasing the population of Dehalococcoides cells in the subsurface. It has become common to quantify the population of these microorganisms both before and during the remediation process. TaqMan probe based qPCR specific to the biomarker RDase genes, such as vcrA, bvcA, and tceA, is now a widely accepted MBT for these tasks (3-7). Other methods for detecting Dehalococcoides cells include catalyzed reporter deposition-fluorescent in situ hybridization (CARD-FISH) and microarray based platforms (8-10). Despite being very sensitive, these MBTs use sophisticated equipment for visualization and quantification. Consequently, most remediation professionals either detect RDase genes in-house using qPCR or use the service of a commercial laboratory with expertise in qPCR. However, there are significant costs associated with both approaches. Specifically, the cost of purchasing a real time thermal cycler (~$20K) for in-house analysis or the cost of having many samples analyzed by a commercial laboratory (typically >$250 per sample). Given this expense and the large number of on-going projects addressing chlorinated solvent contamination, there is clearly a need for the development of a fast, cost-effective, and user-friendly approach to detect RDase genes. Our previous research involved LAMP to detect Dehalococcoides and Dehalobacter 16S rRNA and RDase genes in groundwater using a hand-held proprietary microfluidic platform 37 called the Gene-Z (11, 12). Also, in 2016, additional LAMP assays for vcrA and tceA were validated using DNA extracted from two commercial cultures (KB-1 and SDC-9) commonly used in bioaugmentation (13). The latter study found that the quantification of vcrA and tceA gene copies from these cultures using LAMP was comparable on both the Gene-Z and a real time thermal cycler. The research also illustrated that the results were similar for groundwater samples, however, only groundwater from one site was examined (Tulsa, OK). In both studies, amplification was performed either in a real time thermal cycler or in the Gene-Z. The core objective of the current research was to develop an approach to detect RDase genes without either platform, so that the method could be more widely applied. Additional goals were to shorten the analysis time and decrease the cost per sample compared to qPCR. In this study, we developed a rapid, easy to use and lower cost method to detect vcrA and tceA genes in groundwater and then tested the method with multiple groundwater samples from different chlorinated solvent sites. The first stage of the research involved a comparison of LAMP to qPCR for tceA and vcrA gene quantification using DNA extracted from numerous groundwater samples and a real time thermal cycler (to establish that the LAMP assays were comparable to methods currently used). Following this, experiments were conducted to optimize a sample concentration approach, which, unlike qPCR, does not involve DNA extraction. Finally, a method was developed which requires only a bench top centrifuge and a water bath (no Gene-Z or thermal cycler) for RDase detection. 38 3.3 Methods 3.3.1 Groundwater samples Groundwater samples were collected from monitoring wells at five different chlorinated solvent sites (San Antonio TX, Tulsa OK, Edison NJ, Quantico VA, and Indian Head MD) using traditional low-flow sampling (14). The groundwater was pumped into autoclaved 1L amber bottles, which were subsequently placed on ice and shipped overnight to Michigan State University for analysis. Each of these sites was previously bioaugmented with the commercially available reductive dechlorinating culture SDC-9 (15-17), which contains the vcrA and tceA genes. A summary of the groundwater wells and sites is provided, along with the gene targets, assay type and template type used for each sample in Table 3.3 3.3.2 Preparation of DNA templates Extracted DNA from groundwater was used in several sets of experiments. First, extracted DNA was used to enable the comparison of LAMP with qPCR. In addition, extracted DNA was used in the experiments to evaluate the gene numbers obtained using centrifuged cell templates and direct cell templates (see below). Lastly, extracted DNA was used to determine the detection thresholds for the SYBR green assay and to test the SYBR green assay with centrifuged cell templates from a number of contaminated sites. For producing DNA templates, groundwater (100 mL) was filtered through 0.22 µm filter (EMD Millipore Corp., Billerica, MA) using a vacuum pump. Membranes were cut into 5 mm strips inside a petri dish with a 15 blade (Bard Parker, catalog no. 37615) using aseptic technique and were added to 15 mL bead tubes supplied with the MO BIO Ultraclean water kit (MO BIO Laboratories Inc., Carlsbad, CA) (18). The DNA was eluted according to the instructions supplied by the manufacturer and the final template was suspended in 100 µL of dH2O. The extracted DNA template was immediately used 39 for real time amplification or stored at -20 ºC for future use. The entire process was repeated three times to generate triplicates of each groundwater sample. 3.3.3 Preparation of direct and centrifuged cell templates (no DNA extraction) To concentrate Dehalococcoides cells from groundwater, a 5 µm nylon membrane filter (Nalgene, Rochester, NY) and a 0.22 µm Sterivex filter (EMD Millipore Corp., Billerica, MA) were placed in series to form a groundwater filtration module (to remove turbidity). Groundwater samples (100 mL) were filtered through the groundwater filtration module using a sterile 160 mL syringe. Dehalococcoides sp. are 0.3- 1.0 µm (19). A cell elution buffer was prepared by adding compound ST1B (MO Bio Catalog #14600-50-NF-1B) to solution ST1A (MO Bio Catalog #14600-50-NF-1A) according to manufacturer’s protocol. The buffer (1000 µL) was added to the filter and the filter was capped on both ends. The whole module was vortexed for 10 min (at medium speed) to resuspend the retained biomass. The filters were cut open and the suspension was poured into a 1.5 mL tube. The resuspended cell templates will herein be referred to as “direct cells”. To obtain cell templates with centrifugation (herein called “centrifuged cells”), the resuspended biomass was further centrifuged (13000 g x 15 min.) to obtain a biomass pellet by decanting the liquid content from the tube. The pellet was then resuspended in 100 µL of 1X phosphate buffer and was immediately used for amplification. Each process was repeated three times to generate triplicates of each groundwater sample for both the centrifuged cells and the direct cells. 3.3.4 LAMP specificity experiments The specificity of each RDase LAMP SYBR green assay was examined using plasmid standards. Plasmid templates for vcrA and bvcA genes were prepared as previously described (13), while the plasmid template for the tceA gene was gifted from Dr. Frank Löffler’s laboratory 40 (University of Tennessee, Knoxville). The specificity of each assay was determined using positive controls (the plasmid with the target gene) and negative controls (plasmids with other RDase genes as well as no template controls). The plasmids were present at 106 gene copies per reaction. 3.3.5 Amplification with LAMP and qPCR in a real time thermal cycler qPCR and LAMP real time amplification reactions were performed using two commercially available real time thermal cyclers (Chromo 4 PCR thermal cycler or Bio-Rad Laboratories C1000 touch with CFX96 real time platform). Real time LAMP reactions were set up using the primers and protocol previously described (12, 13). Each 20 µL LAMP reaction contained 1x isothermal amplification buffer (NEB, Catalog# B0537S), 1.4 mM dNTPs, 0.8 mM Betaine, 6.0 mM MgSO4, 1.6 units of BST 2.0 Warm Start (NEB), 0.8 µL SYTO 82 orange fluorescent dye (Life Technologies, Inc., Grand Island, NY), 0.8 µL Pluronic (Life Technologies, Inc., Grand Island, NY), 0.8 µL Bovine Serum Albumin, 0.25 µM 10X Primer Mix and balance water to make up 18 µL. The reactions were incubated at 63 ºC for 60 min for amplification. Each 20 µL TaqMan reaction contained 10 µL iTaq Universal super mix supplied by BioRad, 1.2 µL TaqMan probe, and balance water to make up 18 µL. PCR amplifications were performed using cycling conditions of 95 °C for 15 s, 60 °C for 1 min, a slow ramp of 1% to 95 °C for 15 s and 60 °C for 15 s. Templates and standards were added to each LAMP and qPCR reaction as 2 µL aliquots. All qPCR primers and probes are listed (Table 2.2). From the LAMP primers supplied in Table 2.1 vcrA set C, bvcA set A, and tceA set A were used for this study. 3.3.6 SYBR Green LAMP in a water bath Before preparing the reactions, a calibrated water bath (Cole-Parmer, Catalog # EW14576-04) was set to 63 ºC. The reactions were performed using 0.2 mL PCR tubes or a 96 well 41 plate. Each 50 µL reaction contained 45µL Master mix containing 25 µL of 2X reaction mix (2X Isothermal amplification buffer, 2.3 mM dNTPs Betaine 1.6 mM Betaine, 12.0 mM MgSO4 and balance water), 32 units (4 µL) of BST 2.0 WarmStart enzyme, 2.0 µL Pluronic, 5.0 µL Bovine serum albumin, 5.0 µL 10X primer mix for specific genes described previously (12, 13) as 2.0 µM F3 and B3, 16.0 µM FIP and BIP, 8.0 µM LF and LB, and 5.0 µL templates. After dispensing the master mix and the templates, PCR tubes were capped and placed in a polypropylene 96 well PCR tube rack. The rack was then incubated in the water bath for 1 hour after which it was removed, dried, and allowed to cool to room temperature (~5.0 min.). Then, 2.0 µL 0.1 X SYBR green 1 (Molecular Probes, Catalog #S7563) was added to each tube. If a 96 well plate was used, the plate was sealed using a real time PCR optical film before direct incubation in the water bath. 42 3.4 Results To date, LAMP has been used with the Gene-Z, a hand-held device, to quantify the vcrA gene in groundwater samples spiked with known quantities of that gene (12). Recently, new LAMP primers were developed for tceA and vcrA genes and these were used to quantify the growth of Dehalococcoides mccartyi in the bioaugmentation cultures, SDC-9 and KB-1 (12, 13). With primers developed in that study, the goals in the current research were 1) to evaluate if quantification with LAMP was comparable to qPCR for DNA extracted from multiple groundwater samples from different chlorinated solvent sites, 2) to optimize the cell concentration approach (when DNA extraction is not used), 3) to develop a rapid, cost-effective approach for RDase detection and 4) to evaluate the detection limits for vcrA and tceA in groundwater using the novel approach. 3.4.1 Comparison of qPCR and LAMP for DNA extracts from groundwater samples Our previous research compared LAMP and qPCR for DNA extracted from groundwater samples from a single site. The current study expands on the previous work to ascertain if the two methods produce similar results for a larger number of samples, sites, and site conditions. For this, DNA from each groundwater sample was extracted in triplicate (23 samples for tceA and 27 samples for vcrA) from five different active remediation sites. A comparison of gene copy data for all sites/wells by each technique is provided (Figure 3.1). The gene concentrations ranged from approximately 104 to 1010 gene copies/L for tceA and 105 to 1010 gene copies/L for vcrA. The data generated via LAMP and qPCR were highly correlated (R2 = 0.9908, slope of 1.2129) across this wide concentration range of the two genes (Figure 3.2). 43 44 4 2 0 IW3 IW2 IW1 MW9 PMW 3 PMW 1 303S 114 W820 IW6 PMW 3 PMW 1 303S 114 W820 IW6 6 IW4 8 IW4 LAMP vcrA IW3 IW2 IW1 MW9 MW8 MW7 qPCR vcrA MW8 MW7 MW6 qPCR tceA MW6 B MW5 12 MW4 MW5 MW4 MW3 MW2 MW1 MW514 MW113 A MW3 MW2 MW1 514 513 504 40 MW514 MW113 10 MW35 MW34 Log tceA gene copies per L 10 MW35 MW34 Log vcrA gene copies per L 12 LAMP tceA 8 6 4 2 0 Figure 3.1 Comparison of qPCR and LAMP to quantify tceA (A) and vcrA (B) gene copies in DNA extracted from groundwater from different chlorinated solvent sites. qPCR vs LAMP (vcrA and tceA) Log gene copies per L (LAMP) 1.E+10 1.E+08 y = 1.2129x0.9853 R² = 0.9908 1.E+06 1.E+04 1.E+02 1.E+00 1.E+00 1.E+02 1.E+04 1.E+06 1.E+08 1.E+10 Log gene copies per L (qPCR) Figure 3.2 Correlation between gene concentrations (tceA and vcrA) determined via qPCR and LAMP using DNA extracted from numerous groundwater samples. 3.4.2 Optimization of cell template concentration, without DNA extraction Following the establishment of similar results with qPCR and LAMP for tceA and vcrA, the next step was to determine if a cell concentration method could be developed to eliminate the need for DNA extraction. In previous research, direct cell amplification with LAMP was successfully used to detect 16S rRNA and vcrA templates (12). In this study, we optimized this approach by concentrating the direct cell templates using centrifugation. Here, we also compared gene concentrations for each sample using 1) LAMP with DNA extracts, 2) LAMP with direct amplification of cells, and 3) LAMP with amplification of centrifuged cells. This comparison was performed for groundwater samples from different sites for both tceA and vcrA (Figure 3.3) 45 In all samples, DNA templates yielded greater gene concentrations compared to centrifuged cells or direct cell templates. This is likely because adequate cell lysis does not occur while incubating LAMP reactions at 63ºC. A visual comparison of the two cell based methods (direct and centrifuged cells, Figure 3.3) clearly illustrates the centrifuged cell method resulted in higher gene concentrations. Moreover, in some samples where LAMP was not able to detect the direct cell templates, while centrifuged cell templates produced threshold times, which were quantifiable. In many samples (indicated with an asterisk, Figure 3.3), the centrifuged cell method successfully quantified vcrA and tceA gene copies in all three replicates. When gene concentrations determined without DNA extraction (direct or centrifuged cells) were plotted against those determined with DNA extraction, it was again clear that the centrifuged cell method produced improved data (greater gene copy numbers) over the direct cell method (Figure 3.4). There was also a better correlation between the values from centrifuged cell templates and those produced from DNA templates compared to the correlation between direct cell templates and DNA templates (R2 = 0.918 vs. 0.687). Overall, centrifuged cells templates had higher quantities of vcrA and tceA genes than direct cell templates, suggesting that concentrating cell templates by centrifugation was an effective way of improving the quantification approach without DNA extraction. The high level of correlation between the values generated from centrifuged cells and those determined with DNA extracts, suggests the centrifuged method could be used to quantify vcrA or tceA genes in groundwater, saving the time and expense associated with DNA extraction. The regression equation between the two approaches (Figure 3.4) could be used on data generated from the centrifuged cell method to determine the concentration expected using DNA extracts. 46 LAMP log tceA gene copies per L 12 10 A DNA Centrifuged Direct 8 6 4 2 LAMP log vcrA gene copies per L 0 12 10 8 6 4 2 0 B DNA Centrifuged Direct Figure 3.3 Comparison of tceA (A) and vcrA (B) gene concentrations (log gene copies per L) determined using DNA extracts, direct cells or centrifuged cells as templates. Note: The values represent means of triplicate groundwater samples and the bars represent one standard deviation. *Templates were quantification was possible in all three replicates for centrifuged cells. 47 Log gene copies per L (no DNA Extraction) 1E+10 Centrifuged Direct 1E+8 1E+6 y = 1.7812x0.7953 R² = 0.918 1E+4 y = 0.125x0.771 R² = 0.687 1E+2 1E+0 1E+0 1E+2 1E+4 1E+6 1E+8 1E+10 Log gene copies per L (with DNA Extraction) Figure 3.4 Comparison of the LAMP generated gene concentrations (vcrA and tceA) determined using DNA as a template to those values obtained using cells as a template (direct and centrifuged cells) 3.4.3 LAMP detection of RDase Genes without DNA extraction or a thermal cycler The method described above (centrifuged cells with LAMP) will be valuable to those interested in quantifying RDase genes without the time and cost associated with DNA extraction. However, the method requires access to a real time thermal cycler. Therefore, the next step was to apply the assay without the use of a thermal cycler, using only visual detection and SYBR green dye. In other studies, for other targets, SYBR green for visual detection of LAMP amplicons has been well documented (20, 21). To evaluate the specificity of the SYBR green LAMP assay for each RDase gene, plasmid standard templates containing the three genes (vcrA, bvcA, tceA) were amplified (by 48 incubation in a water bath) and, following this, SYBR green was added to all reaction tubes. For the vcrA gene, target templates (plasmid standard for vcrA gene, 106 gene copies/reaction) fluoresced green, while the negative control templates (water, bvcA and tceA plasmid standards) remained orange (Figure 3.5). The same results of amplification in the positive controls (green fluorescence) but not in the negative controls (106 copies/reaction) occurred for both the bvcA and tceA LAMP assays. These results indicate the LAMP primers were specific using SYBR green for visual detection of vcrA, tceA, and bvcA genes. Control bvcA plasmid tceA plasmid vcrA plasmid vcrA LAMP assay tceA LAMP assay bvcA LAMP Figure 3.5 Specificity of LAMP/SYBR green assays with triplicates of plasmid standards (106 gene copies/reaction) containing RDase genes 3.4.4 Detection limits of visual detection Triplicate samples of centrifuged cell templates were created from groundwater from six wells (IW5, IW7, MW38, MW40, MW41, and MW43) from the Indian Head site. To evaluate the gene copy concentration limits of visual detection with the SYBR green LAMP assays with tceA and vcrA genes, a five-fold 10X dilution series was generated for each triplicate of the centrifuged cell templates. The reactions were incubated in a water bath and SYBR green was added post amplification. The results of this analysis have been summarized (Figure 3.6 and Table 3.4). Each bar represents the tceA and vcrA gene copies expected from the four dilutions in each triplicate. The color of the bar represents the endpoint visualization of that dilution (green – 49 positive detection, orange – no detection). An example image of the assay is shown for two samples (MW40 and MW41) for the detection of vcrA gene in Figure 3.8. The five reaction tubes in each row represent amplicons created with templates produced by making the five-fold 10X dilution series of that triplicate. The tubes were arranged in a descending order of concentration for the templates starting from the undiluted template (highest concentration) to the left and lowest concentration to the right. The final row containing three tubes represents negative controls (no template, water and 106 gene copy plasmid standard of tceA gene). As with the plasmid standards, a very clear color change from orange to green was observed in templates that amplified, however, templates that did not amplify remained orange. At higher and lower RDase gene concentrations, all three replicates turned green or remained orange. However, between these values (9 X 104 to 5 X 105 and 1 X 105 to 6 X 105 for tceA and vcrA, respectively) some replicates turned green while some remained orange. To eliminate the uncertainly associated with these ranges, we suggest that conclusions should only been made if all three triplicates produce the same result. The dilution data were examined to determine the lowest concentration were all three triplicates turned green for vcrA and tceA and guidance tables were generated to estimate the gene concentrations (Table 3.1 and Table 3.2). The guidance tables also list hypothetical gene concentrations if dilutions of the original sample are made. The approach, along with additional replicate dilutions, could be used with the MPN technique to enable the method to be used in a quantitative manner. The accuracy of the detection thresholds was tested using the vcrA assay and groundwater from additional sites (Figure 3.7). As predicted, in samples containing > 1.8 x 105 vcrA gene copies/L all replicates fluoresced green, while in samples below this value, all replicates were orange. In samples, PMW1, PMW3, and TW265 quantities of vcrA gene were 50 below detection limit. SYBR green LAMP on templates created with these samples remained orange. 51 B MW43… MW43… MW43… MW41… MW41… MW41… MW40… MW40… MW40… MW38… MW38… MW38… IW7 Rep 3 IW7 Rep 2 IW7 Rep 1 IW5 Rep 3 No dilution X10 dilution X100 dilution Orange bars = ND > 8.23 ✕ 105, all green 9.20 X104 to 5.04 X 105, three orange, fourteen green < 9.20✕ 104, all orange > 5.97 ✕ 105, all green 1.02 X105 to 5.97 X105, two orange, eleven green < 1.02 ✕ 105, all orange 1E+7 1E+6 1E+5 1E+4 1E+3 1E+2 MW43… MW43… MW43… MW41… MW41… MW41… MW40… MW40… MW40… MW38… IW7 Rep 3 IW7 Rep 2 IW7 Rep 1 IW5 Rep 3 IW5 Rep 2 IW5 Rep 1 1E+0 MW38… 1E+1 MW38… vcrA gene copies per L 1E+8 IW5 Rep 2 1E+9 1E+8 1E+7 1E+6 1E+5 1E+4 1E+3 1E+2 1E+1 1E+0 No dilution X10 dilution X100 dilution Orange bars = ND IW5 Rep 1 tceA gene copies per L A Figure 3.6 Amplification results using a 10X dilution series of centrifuged cell templates from groundwater for tceA (A) and vcrA (B). Note: The highest value in each dilution series was measured (DNA extraction and LAMP) and the resulting dilution values are estimated from this. The green bars indicate positive gene detection. 52 Table 3.1 vcrA gene concentrations (gene copies per L) for SYBR Green assay for groundwater samples and dilutions examined in triplicates and the predicted outcome for in situ reductive dechlorination Dilution vcrA None None X 10 3 replicates = green 3 replicates = orange 3 replicates = green Concentration in groundwater > 1.8 X105 gene copies per La < 1.1 X105 gene copies per Lb > 1.8 X106 gene copies per L Prediction Possible dechlorination Possible dechlorination Threshold for effective dechlorination X 102 3 replicates = green > 1.8 X107 gene copies per L Effective dechlorination 3 8 X 10 3 replicates = green > 1.8 X10 gene copies per L Effective dechlorination X 104 3 replicates = green > 1.8 X109 gene copies per L Effective dechlorination 5 10 X 10 3 replicates = green > 1.8 X10 gene copies per L Effective dechlorination a Derived from the lowest copy number when all three turned green (1.77 X105) b Derived from the highest copy number when all remained orange (10 fold dilution of 1.1 X 106) Table 3.2 tceA gene concentrations (gene copies per L) for SYBR Green assay for groundwater samples and dilutions examined in triplicate and the predicted outcome for in situ reductive dechlorination Dilution tceA None None X 10 3 replicates = green 3 replicates = orange 3 replicates = green Concentration in groundwater > 1.3 X105 gene copies per La < 3.2 X104 gene copies per Lb > 1.3 X106 gene copies per L Prediction Possible dechlorination Possible dechlorination Threshold for effective dechlorination 2 7 X 10 3 replicates = green > 1.3 X10 gene copies per L Effective dechlorination X 103 3 replicates = green > 1.3 X108 gene copies per L Effective dechlorination X 104 3 replicates = green > 1.3 X109 gene copies per L Effective dechlorination 5 X 10 3 replicates = green > 1.3 X1010 gene copies per L Effective dechlorination a Derived from the lowest copy number when all three turned green (1.32 X105) b Derived from the highest copy number when all remained orange (10 fold dilution of 3.19 X 105) From Lebrón, C. A., E. Petrovskis, F. Löffler & K. Henn, Jan 2011, Guidance Protocol, ER-0518 53 San Antonio, TX Edison, NJ Quantico, VC IW5 IW7 MW38 MW40 MW41 MW43 MW35 MW514 MW113 MW 303S MW114 CW2 PMW2 AW1 MW15R PMW4 PMW1 CW7 PMW3 TW265 vcrA gene copies/L Indian Head, MD 1E+8 1E+7 1E+6 1E+5 1E+4 1E+3 1E+2 1E+1 1E+0 Figure 3.7 Testing of detection guidance values using groundwater from different sites Note: The dashed line represents the determined threshold for vcrA gene detection. Green and orange bars represent samples with the vcrA gene above and below the detection threshold, respectively. Three samples (PMW1, PMW3, and TW265) contained vcrA genes below the detection limit. 3.5 Discussion The correlation between the in situ dechlorination activity and the observed quantity of Dehalococcoides mccartyi in groundwater has been documented (5, 22). In groundwater samples where Dehalococcoides mccartyi counts are low (<104 16S rRNA gene copies/L), efficient dechlorination and production of ethene is unlikely. Predicting whether dechlorination will occur with moderate Dehalococcoides sp. counts (104 to 106 16S rRNA gene copies/L), is less definitive. High Dehalococcoides mccartyi counts (>106 16S rRNA gene copies/L) are often associated with high dechlorination rates and ethene generation (5). Visual detection with the LAMP and SYBR green assays using centrifuged cells detects the vcrA gene above 1.8 x 105 gene copies/L and the tceA gene above 1.3 x 105 gene copies/L. Therefore, if the assay produces 54 three green vials for a groundwater sample, this will indicate the site contains moderate Dehalococcoides mccartyi counts. Further, if the sample produces three green vials following one 10X dilution, this will indicate the cell concentration has been reached for effective dechlorination. The developed LAMP SYBR green approach is a low cost and user-friendly alternative to qPCR for the quantitative evaluation of Dehalococcoides mccartyi RDase genes in groundwater samples. Compared to current methods, there are three key advantages to using visual detection with the LAMP and SYBR green assay: time, in situ application, and cost. The use of centrifuged cells, instead of DNA, reduces the time required for sample preparation (Table 3.5). In addition, compared to qPCR, the LAMP assay has a shorter run time and the visualization of amplification products is immediate. Additionally, the approach has the potential for use in the field, as it requires equipment that could be easily transported on site and powered by a generator. Such flexibility would enable decisions concerning remediation (e.g. to add more bioaugmentation culture) to be made immediately. A third important advantage concerns the cost of the two approaches (Table 3.6). A 50 µL LAMP reaction with centrifuged cells is slightly cheaper (~$ 0.30) than a 20 µL qPCR reaction when consumables and reagents are considered. However, commercially available master mixes are used for qPCR, whereas reagents are mixed manually for LAMP. When commercial master mixes for LAMP become available, this will further decrease the time and cost associated with LAMP. More importantly, qPCR requires DNA extraction, which adds approximately $9 to each sample (almost doubles the cost). Another key difference concerns the use of low cost laboratory equipment for LAMP (centrifuge and water bath, ~$600) compared to the high cost of a real time thermal cycler (~$20K) for qPCR. This makes the assay more accessible to a larger number of researchers and environmental 55 engineers. As discussed above, if the assay is performed in triplicate of a dilution series, then the gene copies can be estimated, provided the concentration is above ~105 gene copies per L. This value is less than the concentration required for effective dechlorination in situ. Future research will focus on optimizing the overall process to achieve detection limits < 104 gene copies/L. In addition, future work will focus on the optimization of the LAMP SYBR green approach to enable quantification of RDase genes (e.g. using most probable number) and on addressing problems reported by others concerning the aerosolization of LAMP products (causing contamination between experiments). 56 APPENDIX 57 Appendix Table 3.3 The gene targets, assay type and template type used for each well and site. Site San Antonio, TX Tulsa, OK Well Name Date 34B1 35B1 40B1 113B1 504B1 513B1 514B1 35B2 113B2 514B2 MW1 MW2 MW3 MW4 MW5 MW6 MW7 MW8 MW9 IW1 IW2 IW3 IW4 IW5 IW6 W820 03/03/15 03/03/15 04/13/15 04/13/15 12/1/15 12/1/15 12/1/15 08/06/16 08/06/16 08/06/16 06/11/15 06/11/15 06/11/15 06/11/15 06/11/15 06/11/15 06/11/15 06/11/15 06/11/15 06/11/15 06/11/15 06/11/15 06/11/15 06/11/15 06/11/15 06/11/15 DNA Templates qPCR LAMP DNA DNA tceA tceA D D D D ND ND D D ND ND ND ND D D X D X D X D D D D D D D D D D D D D D D D D D D D D D D D D D D ND ND D D D D qPCR DNA vcrA D D D D D D D X X X D D D D D D D D D D D D D ND D D LAMP DNA vcrA D D D D D D D D D D D D D D D D D D D D D D D ND D D qPCR DNA bvcA ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND 58 LAMP DNA bvcA X X X X X X X X X X X X X X X X X X X X X X X X X X Cells Direct cells tceA D D X D X X D ND ND ND D D D ND ND D D D D D D D ND X ND D Direct cells vcrA D D D D D D ND ND ND D D D D ND D D D D D D D D D X D D Direct cells bvcA X X X X X X X X X X X X X X X X X X X X X X X X X X Centrifuged cells tceA D D X D X X D D D D D D D D D D D D D D D D ND X D D Centrifuged cells vcrA D D D D D D D D D D D D D ND D D D D D D D D D X D D Centrifuged cells bvcA X X X X X X X X X X X X X X X X X X X X X X X X X X Table 3.3 (cont’d) Quantico, VA Edison, NJ Indian Head, MD PMW1B1 PMW3B1 CW2 PMW2 AW1 MW 15R PMW4 PMW1B2 CW7 PMW3B2 TW265 114 303S IW5 IW7 MW38 MW40 MW41 MW43 D = template was detected = Assay was performed 11/10/15 11/10/15 11/16/15 11/16/15 11/16/15 11/16/15 11/16/15 11/16/15 11/16/15 11/16/15 11/16/15 11/10/15 11/10/15 06/24/16 06/24/16 06/24/16 06/24/16 06/24/16 06/24/16 D D D D D D D ND ND ND ND D D X X X X X X D D D D D D D ND ND ND ND D D D D D D D D D D D D D D D ND D ND ND D D X X X X X X D D D D D D D ND D ND ND D D D D D D D D ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND = template was not detected X= Assay was not performed X X X X X X X X X X X X X X X X X X X ND ND ND ND ND ND ND ND ND ND ND ND ND X X X X X X B1 = Batch 1 B2 = Batch 2 59 ND ND ND ND ND ND ND ND ND ND ND D ND X X X X X X X X X X X X X X X X X X X X X X X X X ND ND ND ND ND ND ND ND ND ND ND ND ND D D D D D D D D D ND ND ND ND ND D ND ND D D D D D D D D X X X X X X X X X X X X X X X X X X X Table 3.4 Gene concentrations (vcrA and tceA per L) and estimated gene concentration in serial dilutions of cell templates from groundwater from six monitoring wells (Indian Head site) Sample IW5 IW7 MW38 MW40 MW41 MW43 Replicate # 1 2 3 1 2 3 1 2 3 1 2 3 1 2 3 1 2 3 tceA gene copies/L No 10X Dilution Dilution 4.77 X107 4.77 X106 9.88 X107 9.88 X106 2.20 X107 2.20 X106 2.13 X107 2.13 X106 3.19 X107 3.19 X106 2.68 X107 2.68 X106 5.04 X106 ND 5.07 X106 5.07 X105 4.34 X106 4.34 X105 9.20 X106 9.20 X105 1.23 X107 1.23 X106 8.40 X106 8.40 X105 1.32 X108 1.32 X107 2.20 X108 2.20 X107 1.86 X108 1.86 X107 1.47 X105 ND 1.64 X105 ND 1.47 X105 ND 100X Dilution ND 9.88 X105 2.20 X105 2.13 X105 3.19 X105 2.68 X105 ND ND ND 9.20 X104 1.23 X105 ND 1.32 X106 2.20 X106 1.86 X106 ND ND ND 1000X Dilution ND ND ND ND ND ND ND ND ND ND ND ND 1.32 X105 2.20 X105 1.86 X105 ND ND ND 10000X Dilution ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND = template 60 vcrA gene copies/L No 10X Dilution Dilution 9.04 X106 9.04 X105 8.84 X106 8.84 X105 5.97 X106 ND 7.77 X105 ND 9.56 X105 ND 9.04 X105 ND 1.10 X107 1.10 X106 5.78 X106 5.78 X105 3.99 X106 3.99 X105 2.41 X107 2.41 X106 1.38 X107 1.38 X106 1.02 X107 1.02 X106 6.22 X107 6.22 X106 5.34 X107 5.34 X106 4.13 X107 4.13 X106 2.68 X106 2.68 X105 2.30 X106 2.30 X105 1.77 X106 1.77 X105 100X Dilution ND ND ND ND ND ND ND ND ND ND 1.38 X105 1.02 X105 6.22 X105 5.34 X105 4.13 X105 ND ND ND 1000X Dilution ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND 10000X Dilution ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND MW40 vcrA LAMP assay MW41 vcrA LAMP assay Replicate 1: X10 dilution series Replicate 2: X10 dilution series Replicate 3: X10 dilution series Controls Figure 3.8 Examples of SYBR green LAMP assays for vcrA with triplicates of 10X dilutions for centrifuged cells from groundwater from the Indian Head site Note: The dilution levels increase to the right. Table 3.5 Time based comparison of qPCR and SYBR green LAMP assays Process Filtering DNA extraction Centrifugation and template elution Master Mix Preparation Analysis qPCR 5-25 min. per sample 35-45 min per sample No centrifugation or sample elution <5 min. if commercial master mix is used. 90 -120 min SYBR Green LAMP 5-25 min. per sample No DNA extraction <15 min per sample 20-30 min. <1.5 hr. (1 hr. in the water bath and <0.5 hr. for adding SYBR greena) Total 135-195 min 115-160 min Value based on a 96 well plate. The value is significantly lower if fewer samples are processed (1 hour in the water bath and < 5 min for adding the SYBR green) a 61 Table 3.6 Cost based comparison of qPCR and SYBR green LAMP assays Process DNA extraction Consumables + reagents Instrument costs a qPCR (20µL reaction) $ 9.30 per samplea $ 12.70 per sample ~$ 20,000 MO BIO PowerWater DNA Isolation Kit ($465 for 50 preps 62 SYBR Green LAMP (50 µL reaction) No cost $ 12.38 per sample ~$395 (water bath) ~$300 (centrifuge) REFERENCES 63 REFERENCES 1. Kanitkar YH, Stedtfeld RD, Hatzinger PB, Hashsham SA, Cupples AM. 2017. Development and application of a rapid, user-friendly, and inexpensive method to detect Dehalococcoides sp. reductive dehalogenase genes from groundwater. Applied Microbiology and Biotechnology 101:4827-4835. 2. Leys D, Adrian L, Smidt H. 2013. Organohalide respiration: microbes breathing chlorinated molecules. The Royal Society. 3. Cupples AM. 2008. Real-time PCR quantification of Dehalococcoides populations: methods and applications. Journal of Microbiological Methods 72:1-11. 4. Hatt JK, Löffler FE. 2012. Quantitative real-time PCR (qPCR) detection chemistries affect enumeration of the Dehalococcoides 16S rRNA gene in groundwater. Journal of Microbiological Methods 88:263-270. 5. Lebrón C, Petrovskis E, Löffler F, Henn K. 2011. Final report: application of nucleic acid based tools for monitoring monitored natural attenuation (MNA), biostimulation and bioaugmentation at chlorinated solvent sites. ESTCP project ER-200518. 6. Lee PKH, Macbeth TW, Sorenson KS, Jr., Deeb RA, Alvarez-Cohen L. 2008. Quantifying genes and transcripts to assess the In situ physiology of "Dehalococcoides" spp. in a trichloroethene-contaminated groundwater site. 10.1128/AEM.02199-07. Applied and Environmental Microbiology 74:2728-2739. 7. Ritalahti KM, Amos BK, Sung Y, Wu Q, Koenigsberg SS, Loffler FE. 2006. Quantitative PCR targeting 16S rRNA and reductive dehalogenase genes simultaneously monitors multiple Dehalococcoides strains. Applied and Environmental Microbiology 72:2765-2774. 8. Dijk JA, Breugelmans P, Philips J, Haest PJ, Smolders E, Springael D. 2008. Catalyzed reporter deposition-fluorescent in situ hybridization (CARD-FISH) detection of Dehalococcoides. Journal of Microbiological Methods 73:142-147. 9. Johnson DR, Brodie EL, Hubbard AE, Andersen GL, Zinder SH, Alvarez-Cohen L. 2008. Temporal transcriptomic microarray analysis of "Dehalococcoides ethenogenes" strain 195 during the transition into stationary phase. Applied and Environmental Microbiology 74:2864-2872. 10. Löffler FE, Edwards EA. 2006. Harnessing microbial activities for environmental cleanup. Current Opinion in Biotechnology 17:274-284. 11. Stedtfeld RD, Liu Y-C, Stedtfeld TM, Kostic T, Kronlein M, Srivannavit O, Khalife WT, Tiedje JM, Gulari E, Hughes M. 2015. Static self-directed sample dispensing into 64 a series of reaction wells on a microfluidic card for parallel genetic detection of microbial pathogens. Biomedical Microdevices 17:1-12. 12. Stedtfeld RD, Stedtfeld TM, Kronlein M, Seyrig G, Steffan RJ, Cupples AM, Hashsham SA. 2014. DNA extraction-free quantification of Dehalococcoides spp. in groundwater using a hand-held device. Environmental Science & Technology 48:1385513863. 13. Kanitkar YH, Stedtfeld RD, Steffan RJ, Hashsham SA, Cupples AM. 2016. Development of loop mediated isothermal amplification (LAMP) for rapid detection and quantification of Dehalococcoides spp. biomarker genes in commercial reductive dechlorinating cultures KB-1 and SDC-9. Applied and Environmental Microbiology:AEM. 03660-03615. 14. Puls RW, Barcelona MJ. 1996. Low-flow (minimal drawdown) ground-water sampling procedures. US Environmental Protection Agency, Office of Research and Development, Office of Solid Waste and Emergency Response. 15. Schaefer CE, Condee CW, Vainberg S, Steffan RJ. 2009. Bioaugmentation for chlorinated ethenes using Dehalococcoides sp.: Comparison between batch and column experiments. Chemosphere 75:141-148. 16. Schaefer CE, Lippincott DR, Steffan RJ. 2010. Field‐scale evaluation of bioaugmentation dosage for treating chlorinated ethenes. Groundwater Monitoring & Remediation 30:113-124. 17. Vainberg S, Condee CW, Steffan RJ. 2009. Large-scale production of bacterial consortia for remediation of chlorinated solvent-contaminated groundwater. Journal of Industrial Microbiology & Biotechnology 36:1189-1197. 18. Ritalahti KM, Hatt JK, Lugmayr V, Henn K, Petrovskis EA, Ogles DM, Davis GA, Yeager CM, Lebrón CA, Löffler FE. 2010. Comparing on-site to off-site biomass collection for Dehalococcoides biomarker gene quantification to predict in situ chlorinated ethene detoxification potential. Environmental Science & Technology 44:5127-5133. 19. Löffler FE, Yan J, Ritalahti KM, Adrian L, Edwards EA, Konstantinidis KT, Müller JA, Fullerton H, Zinder SH, Spormann AM. 2013. Dehalococcoides mccartyi gen. nov., sp. nov., obligately organohalide-respiring anaerobic bacteria relevant to halogen cycling and bioremediation, belong to a novel bacterial class, Dehalococcoidia classis nov., order Dehalococcoidales ord. nov. and family Dehalococcoidaceae fam. nov., within the phylum Chloroflexi. International Journal of Systematic and Evolutionary Microbiology 63:625-635. 20. Chen X, Wang X, Jin N, Zhou Y, Huang S, Miao Q, Zhu Q, Xu J. 2012. Endpoint visual detection of three genetically modified rice events by loop-mediated isothermal amplification. International Journal of Molecular Sciences 13:14421-14433. 65 21. Njiru ZK, Mikosza ASJ, Armstrong T, Enyaru JC, Ndung'u JM, Thompson ARC. 2008. Loop-mediated isothermal amplification (LAMP) method for rapid detection of Trypanosoma brucei rhodesiense. PLOS Neglected Tropical Diseases 2:e147. 22. van der Zaan B, Hannes F, Hoekstra N, Rijnaarts H, de Vos WM, Smidt H, Gerritse J. 2010. Correlation of Dehalococcoides 16S rRNA and chloroethene-reductive dehalogenase genes with geochemical conditions in chloroethene-contaminated groundwater. Applied and Environmental Microbiology 76:843-850. 66 Chapter 4: The Application of Most Probable Number Method with Visual Detection LAMP for Quantitative Estimation of RDase Gene Concentrations in Groundwater Samples The data presented in this chapter is being compiled for preparation of a manuscript. 4.1 Abstract Recently, a LAMP based assay, which allows for the visual detection of RDase genes from groundwater, was described. In that study, Dehalococcoides mccartyi cells from bioaugmented groundwater samples were concentrated using filtration and centrifugation and were added to LAMP reactions as templates for amplification. The reactions were incubated in a water bath, avoiding the use of an expensive thermal cycler, and amplification was visualized by the addition of dilute SYBR Green dye (post incubation). Despite having a detection limit (~1.18 x 105 gene copies/L) lower than 107 gene copies/L (the threshold for effective in situ remediation), the application of the assay was limited because of the semi-quantitative nature of the data generated. Moreover, the assay was prone to false positives due to the aerosolization of amplicons. In this study, a dUTP-UNG system was incorporated in the reaction mix of SYBR Green LAMP assay to reduce the probability of false positives due to carry over contamination. Optimization experiments revealed a UNG concentration of 0.2 units per reaction is adequate for degrading trace levels of AUGC contamination of ~1.2 x 104 gene copy reaction without significant increases in the detection limit of ~100 gene copies/reaction of template. Additionally, the optimized SYBR Green LAMP assay was used with the MPN method to provide quantitative estimates of RDase gene concentrations in seven groundwater samples obtained from a chlorinated solvent waste site. Concentrations obtained using this approach were 67 significantly correlated to concentrations obtained using qPCR and DNA templates prepared from the same samples for both vcrA (ρ = 0.952, p-value = 0.0329) and tceA (ρ = 0.994, p-value = 0.0484) genes. Although the SYBR Green LAMP assay under-estimated the concentrations of vcrA and tceA genes, this study demonstrates a strong correlation between the two data sets and could be used to calibrate the SYBR Green LAMP method for quantification by using the slopes of the trend lines for vcrA (10.386) and tceA (11.873) genes as response factors. 4.2 Introduction Subsurface injections of commercial microbial mixed cultures and various amendments to remediate of chlorinated solvent plumes at hazardous waste sites aim at facilitating biological reductive dechlorination of these chemicals by a process known as organohalide respiration. These approaches aim at increasing the population of Dehalococcoides cells in the contaminated groundwater aquifers (1). It has become standard practice to monitor the concentrations of these microorganisms both before and during the remediation process using TaqMan probe based quantitative polymerase chain reaction since high Dehalococcoides mccartyi counts (>106 16S rRNA gene copies/L) are often associated with high dechlorination rates and ethene generation (2). Consequently, qPCR primers and probes highly specific to the biomarker RDase genes, vcrA, bvcA, and tceA, are now widely used for monitoring the in situ growth of Dehalococcoides mccartyi (2, 3). Many remediation professionals either carry out qPCR in-house or use the service of a commercial laboratory with expertise in qPCR. Both approaches involve significant costs like the cost of purchasing a real time thermal cycler (~$20K) for in-house analysis or the cost of having many samples analyzed by a commercial laboratory (typically >$250 per sample). Given the economic constraints, there is a need for fast, cost-effective quantification assays for RDase genes. 68 LAMP is a sensitive, specific, and one-step isothermal amplification method, which is often used as an alternative point-of-care diagnostic tool to PCR for a wide variety of applications (4-6). For example, many LAMP assays have been developed for testing food borne bacterial pathogens and fungal contaminants (7, 8). LAMP assays for the quantification of Dehalococcoides mccartyi 16S rRNA and vcrA genes without DNA extraction on a proprietary microfluidic platform, the Gene-Z, are also available (9, 10). Kanitkar, et al. (2016) developed new LAMP primer sets for Dehalococcoides mccartyi RDase genes and validated the use of LAMP as a quantification tool by monitoring the growth of commercial dechlorinating cultures (SDC-9 and KB-1), and comparing the concentrations obtained using LAMP to qPCR with DNA templates extracted at several time points over one growth cycle. Additionally, DNA templates extracted from groundwater samples were used to compare concentrations obtained using LAMP on the Gene-Z to qPCR. Similar values were obtained for each RDase gene on both platforms, indicating quantification with LAMP is a viable alternative to qPCR when DNA templates were used. In the first phase of the research described in this chapter, the reaction chemistry of the SYBR Green LAMP assay, developed in chapter three, was optimized to incorporate dUTP and UNG based enzymatic control for prevention of false positives due to carry over contamination without a significant increase in the detection limits of the SYBR Green LAMP assay. Replacing dTTP with dUTP in the reaction mixture produces LAMP amplicons containing uracil. Before initiating LAMP, the reaction mixture is treated with UNG to destroy carry over contamination from the previous set of experiments. This strategy is often used to prevent carry-over contamination in qPCR. In 2015, this strategy of an altered reaction mixture with a dTTP to dUTP substitution was tested along with the addition of UNG to the LAMP reaction. The 69 modified LAMP method successfully prevented carry over contamination issues while detecting plant viruses (12). Here, we have optimized the amount of UNG required to destroy lab relevant cross contamination of ~1.23 x 104 gene copies while preserving the detection limit of SYBR Green LAMP of ~102 gene copies/reaction. Recently, Ahmad, et al. (2017) coupled the LAMP amplification on a microfluidic chip similar to the Gene-Z to MPN to create MPN-LAMP technique for the quantification of gram negative and gram positive water borne pathogens. In the second phase, we extend the application of this technique with the optimized SYBR Green LAMP assay for quantitative estimation of Dehalococcoides mccartyi RDase gene concentrations in groundwater samples without DNA extraction. 4.3 Methods 4.3.1 Integration of the dUTP-UNG contamination control system in to the SYBR Green LAMP assay The reaction mix recipe described by Kanitkar et al. (2017) for visually detecting centrifuged cell templates was used as a basis for LAMP experiments described below. The dNTPs mix used in that recipe were replaced with PCR Nucleotide Mix plus containing sodium salts of dATP, dCTP, dGTP, each at a concentration of 10 mM, and dUTP at a concentration of 30 mM in PCR grade water (Roche Diagnostics Inc. Catalog number #11888412001) to obtain a final concentration of 1.15 mM. The quantities of each reaction component were calculated for a reaction volume of 25 µL to make up a reaction mix volume of 22 µL per reaction. To determine the precise amount of UNG (Thermo Fischer, Catalog# EN0361) required for eliminating carry over contamination, reaction mixes with variable concentrations of UNG (1.0, 0.8, 0.6, 0.4, 0.2 70 units per reaction) were prepared. The reaction mixes were then incubated for 1.5 min at room temperature after adding UNG. Finally, 3.0 µL templates were dispensed to each tube. 4.3.2 Optimized SYBR Green LAMP amplification SYBR Green LAMP reactions were set up to have a final volume of 25µL with 22µL master mix and 3µL template. Master mix for each reaction comprised of 12.5 µL of 2X reaction mix (2X Isothermal amplification buffer, 2.3 mM dUTP-dNTPs mix, 1.6 mM Betaine, 12.0 mM MgSO4 and balance water), 32 units (2 µL) of BST 2.0 WarmStart enzyme, 1.0 µL Pluronic, 2.5 µL Bovine serum albumin, 2.5 µL 10X primer mix for specific gene described previously (11, 14) as 2.0 µM F3 and B3, 16.0 µM FIP and BIP, 8.0 µM LF and LB. UNG was added to the master mix, such that each reaction received 0.2 units (1unit/µL) to make up a final volume of 22.0 µL. After adding UNG, the master mix was incubated at room temperature for 1.5 min before adding templates. After dispensing the templates, PCR tubes were capped and placed in a polypropylene 96 well PCR tube rack. The rack was then incubated in the water bath for 1 hour after which it was removed, dried, and allowed to cool to room temperature (~5.0 min.). Then, 2.0 µL 0.1 X SYBR green 1 (Molecular Probes, Catalog #S7563) was added to each tube. From the LAMP primers supplied in Table 2.1 vcrA set C, bvcA set A, and tceA set A were used for this study. 4.3.3 Preparation of dilution series for MPN analysis from centrifuged cell templates of groundwater samples. Centrifuged cell templates were prepared from all groundwater samples listed in Table 4.3 using a protocol described previously (14). Briefly, a 5 µm nylon membrane filter (Nalgene, Rochester, NY) and a 0.22 µm Sterivex filter (EMD Millipore Corp., Billerica, MA) were placed in series to form a groundwater filtration module (to remove turbidity). Groundwater samples 71 (150 -250 mL) were filtered through the groundwater filtration module using a sterile 160 mL syringe. Dehalococcoides mccartyi are 0.3- 1.0 µm (15) and are thus expected to pass through the 5 µm filter but be retained on the 0.22 µm Sterivex filter. A cell elution buffer was prepared by adding compound ST1B (MO Bio Catalog #14600-50-NF-1B) to solution ST1A (MO Bio Catalog #14600-50-NF-1A) according to manufacturer’s protocol. The buffer (1000 µL) was added to the filter and the filter was capped on both ends. The whole module was vortexed for 10 min (at medium speed) to resuspend the retained biomass. The suspension was extracted using a 1 mL syringe. The resuspended biomass was further centrifuged (13000 g x 15 min.) to obtain a biomass pellet by decanting the liquid content from the tube. The pellet was then resuspended in 100 µL of 1X phosphate buffer to obtain centrifuged cells. Using these centrifuged cells, a seven fold 10X dilution series was created. Six such replicate dilution series were created for each groundwater sample and used as templates for SYBR Green LAMP amplification. 4.3.4 Quantification with MPN LAMP Pictures of the six replicate dilution series templates for each groundwater sample showing the endpoint color were captured using a cell phone camera (IPhone 6) and used to create data tables for MPN analysis. If the endpoint color in a single reaction tube was green, it was denoted with a value of one while that of orange was denoted with zero. Table 4.1 and Table 4.2 show the representative data recorded for MPN analysis of vcrA and tceA genes in groundwater sample MW100 using SYBR Green LAMP method. Concentrations of Dehalococcoides cells in centrifuged cell templates were then determined using the statistical method of result rejection (Equation 1) developed by Hurley and Roscoe (1983). Six replicates of each dilution were used for the MPN calculations. 72 Table 4.1 Data table denoting the endpoint color change in six replicates of seven fold 10X dilution series templates for MPN analysis of vcrA gene in groundwater sample MW100 Replicate Replicate #1 Replicate #2 Replicate #3 Replicate #4 Replicate #5 Replicate #6 Number of positives (pi) Dilution 1 1 1 1 1 1 1 6 Dilution 2 1 1 1 1 1 1 6 Dilution 3 1 1 1 1 1 1 6 Dilution 4 1 1 1 1 1 1 6 Dilution 5 1 0 1 1 0 1 4 Dilution 6 1 1 0 1 0 0 3 Dilution 7 1 0 0 0 0 0 1 Table 4.2 Data table denoting the endpoint color change in six replicates of seven fold 10X dilution series templates for MPN analysis of tceA gene in groundwater sample MW100 Replicate Replicate #1 Replicate #2 Replicate #3 Replicate #4 Replicate #5 Replicate #6 Number of positives (pi) Dilution 1 1 1 1 1 1 1 6 Dilution 2 1 1 1 1 1 1 6 Dilution 3 1 1 1 1 1 1 6 Dilution 4 1 1 1 1 1 1 6 Dilution 5 1 1 1 1 0 1 5 Dilution 6 1 1 1 1 0 1 5 Dilution 7 1 0 1 1 0 0 3 Equation 1 The equation described by Hurley and Roscoe for MPN analysis: 𝑘 𝑘 𝑖=1 𝑖=1 𝑣𝑖 𝑑𝑖 𝑝𝑖 = ∑ 𝑣𝑖 𝑑𝑖 𝑛𝑖 ∑ 1 − 𝑒 −𝑣𝑖𝑑𝑖 𝑥 Here, k is the dilution level, ni is the number of subsamples, pi is the number of positive subsamples, di is the dilution factor, vi is the volume of each subsample, and x is the estimated concentration of the RDase gene. A numerical spreadsheet was set up using Microsoft Excel 2016 was used to iterate the value of x. 73 Table 4.4 Concentrations of vcrA and tceA genes obtained using SYBR Green LAMP coupled to MPN method with centrifuged cell templates and qPCR with DNA templates. Samples Concentrations in gene copy/L MW100 IW5B1 IW6B1 IW5B2 IW6B2 MW113 MW514 MPN vcrA 4.00E+05 3.60E+06 4.30E+06 6.68E+06 3.20E+07 1.02E+06 4.35E+05 MPN tceA 9.60E+05 6.00E+06 1.20E+07 6.44E+06 2.90E+07 7.84E+05 4.98E+05 qPCR vcrA 2.24E+06 6.06E+07 5.47E+07 3.94E+07 5.50E+07 3.13E+06 1.46E+06 74 qPCR tceA 7.28E+06 2.01E+07 7.78E+07 4.86E+07 8.85E+07 2.41E+06 2.96E+06 Standard deviation for qPCR vcrA tceA 9.36E+05 1.08E+07 5.71E+06 6.92E+06 2.09E+07 1.65E+06 4.97E+05 1.10E+06 4.07E+06 1.09E+07 7.96E+06 2.87E+07 9.90E+05 3.88E+05 Table 4.5 and Table 4.6 show the sample calculations used in the iterative evaluation of vcrA and tceA gene concentrations (i.e., x) in groundwater sample MW100. We assumed that the Dehalococcoides cells were colloidal, and had a uniform clustering in the template added. Moreover, MPN values at the microliter scale were assumed consistent with milliliter and liter volumes. If the dilution series provided all positive results, then the calculation was performed using the most dilute samples. On the other hand, if dilutions provided all negative results, then MPN values were calculated using the most concentrated dilutions. These assumption are similar to those made by Ahmad, et al. (2017) for their MPN-LAMP method. 4.3.5 Preparation of DNA templates from groundwater samples for qPCR For producing DNA templates, groundwater (100 - 250 mL) was filtered through 0.22 µm filter (EMD Millipore Corp., Billerica, MA) using a vacuum pump. Membranes were cut into 5 mm strips inside a petri dish with a 15 blade (Bard Parker, catalog no. 37615) using aseptic technique and were added to 15 mL bead tubes supplied with the MO BIO Ultraclean water kit (MO BIO Laboratories Inc., Carlsbad, CA) (17). The DNA was eluted according to the instructions supplied by the manufacturer and the final template was suspended in 100 µL of dH2O. The extracted DNA template was immediately used for qPCR or stored at -20 ºC for future use. The entire process was repeated three times to generate triplicates of each groundwater sample. Each 20 µL TaqMan reaction contained 10 µL iTaq Universal super mix supplied by BioRad, 1.2 µL TaqMan probe, and balance water to make up 18 µL. PCR amplifications were performed using cycling conditions of 95 °C for 15 s, 60 °C for 1 min, a slow ramp of 1% to 95 °C for 15 s and 60 °C for 15 s. Templates and standards were added to qPCR reaction as 2 µL 75 aliquots. From the primers listed in Table 2.2, the primers for vcrA and tceA gene were used for qPCR in this study. 4.4 Results Kanitkar, et al. (2017) described a novel assay for the visual detection of Dehalococcoides mccartyi RDase gene in groundwater samples without DNA extraction. Figure 4.1 provides a brief outline of the protocol for that assay. In this study, the protocol was altered with three key changes. First, the reaction volume was reduced from 50 µL to 25 µL. The original protocol involved adding 5 µL templates to the 45 µL master mix, while the current protocol adds 3µL templates to a 22 µL master mix effectively increasing the availability of the template from 10% in the original protocol to 12% in the current method. Second, reaction mix was altered to include this dUTP-UNG contamination control system, which involves using dNTPs mix with dUTP instead of dTTP for producing amplicons containing uracil. For all subsequent experiments involving LAMP, trace levels of carry over contamination resulting from aerosolization of templates were destroyed using UNG. Both changes required using a master mix with lower water content compared to the original recipe to accommodate a larger template volume as well as UNG. Finally, greater volumes (100-250 mL) of groundwater were filtered in order to avoid false negatives, which might result from the addition of UNG. In the second set of experiments, the optimized SYBR Green LAMP assay was coupled to the MPN technique and quantitative concentration estimates of vcrA and tceA genes in groundwater samples listed in Table 4.3 were obtained using centrifuged cell templates prepared from each sample. Then, qPCR with DNA templates was used to precisely determine the concentration of vcrA and tceA genes in each sample. Finally, concentration estimates obtained using the SYBR Green LAMP method and centrifuged cell templates, were compared to the 76 concentrations obtained using qPCR with DNA templates. The goal of these experiments was to determine if the SYBR Green LAMP assay can be used for quantification of RDase genes from groundwater samples without DNA extraction. Elution buffer (1000 µL), then vortex & remove cell Pre-filter (5 µm) 250 mL*, then use Sterivex filter Centrifuge, then resuspend pellet Orange: No Template Control Add 3 µLa of sample to optimized LAMP master mixb, and then move to water o bath (1 hr., 63 C) Add SYBR Green 5 Three Green: ~1.0 X 10 vcrA gene copies per L Figure 4.1 Schematic of the SYBR Green LAMP method for detection of RDase genes from groundwater samples (14). *Greater volumes of groundwater samples were filtered to avoid a significant increase in detection limit of the SYBR Green LAMP assay resulting from incorporation of dUTP-UNG contamination control system. a The optimized assay also delivered greater volume of template to the final reaction while reducing the reaction volume from 50 µL to 25 µL. b LAMP master mix was incubated with UNG at room temperature before addition of templates. 4.4.1 Optimization of SYBR Green LAMP assay with dUTP-UNG contamination control system (DNA templates) The primary goal of this set of experiments was to determine the precise amount of UNG required for degrading trace levels of carry over contamination of vcrA gene while preserving the amplification resulting from four fold 10X dilution series templates of vcrA plasmid. To do this, the master mix described above was deliberately contaminated with a vcrA AUGC LAMP amplicon such that each tube received 1.44 x 104 vcrA gene copies. The contaminated master 77 mix was then treated with UNG and incubated at room temperature for 1.5 min before dispensing the plasmid standard templates. Figure 4.2 shows the results of that experiment. The endpoint color of the reaction is denoted on the y-axis. If the endpoint color a reaction was green (positive detection), it was plotted with a value of one. On the other hand, if the endpoint color of the reaction was orange, it was plotted with a value of zero. The gene copies of ATGC template of the vcrA plasmid DNA added per reaction is plotted on the x-axis while the amount of UNG in the LAMP master-mix is plotted on the depth axis. Amplification from the four fold 10X dilution series as well as the negative controls with water templates using the spiked master mix at different amount of UNG is represented with bars. The false positives in negative controls are marked with an asterisk. At high levels of UNG (1.0 and 0.8 units per reaction) amplification in all templates was inhibited indicating that these levels were excessive, while 0.6 units of UNG produced false negatives in tubes containing the 1.04 x 103 and 1.04 x 102 gene copies of plasmid standard template. Similarly, 0.4 units of UNG produced a false negative in tube containing 1.04 x 102 gene copies of plasmid standard template. At 0.2 units of UNG, all the tubes containing plasmid standard template produced a green color while the negative control fluoresced orange. On the other hand, if the level of UNG was reduced below 0.2 units, contamination persisted and the negative control fluoresced green. 78 1 0.8 0.6 0.4 0.2 0.1 0 1 * * 0 1.04E+02 1.04E+05 1.04E+04 1.04E+03 0 1 0.8 0.6 0.4 0.2 0.1 0 Figure 4.2 Optimization of amount of UNG required to destroy a vcrA gene AUGC contamination of 1.44 x 104 gene copies per reaction while preserving amplification resulting from ATGC vcrA plasmid DNA template from up to ~100 gene copies per reaction. Note, if the endpoint color change was green, it was denoted with a value of one while that of orange was denoted with zero. No template controls not represented in the figure remained orange. *Amplification observed in negative controls (water + contaminant template) 79 4.4.2 Optimization of SYBR Green LAMP assay with dUTP-UNG contamination control system (centrifuged cell templates) The detection limit of SYBR Green LAMP assay was tested with seven fold 10X dilution series templates prepared from the SDC-9 culture and 0.4, 0.3 and 0.2 units of UNG. Figure 4.3 shows the results of that study. The endpoint color of the reaction is denoted on the y-axis. If the endpoint color in a replicate of reaction was green, it was plotted with a value of one. On the other hand, if the endpoint color of the reaction was orange, it was plotted with a value of zero. Since each dilution had triplicates, the maximum and the minimum values on y-axis can be three and zero respectively. qPCR estimated gene copies in the seven fold 10X dilution series of centrifuged cell templates are plotted on x-axis while the amount of UNG in the LAMP mastermix is plotted on the depth axis. At 0.4 units of UNG, the SYBR Green LAMP assay failed to produce any amplification below 8.4 x 106 gene copies. Moreover, at 8.4 x 106 gene copies only one replicate fluoresced green. With 0.3 units of UNG, the detection limit was reduced to 8.4 x 103 gene copies. In this case, two replicates each of dilutions containing 8.4 x 103 and 8.4 x 102 gene copies fluoresced green. On the other hand, at 0.2 units of UNG, detection limit was closer to ~84 gene copies which is similar to the detection limit with DNA templates. This detection limit translates to a hypothetical vcrA gene concentration of 1.12 x 104 gene copies per liter. These results indicate that the inclusion of dUTP and UNG into the SYBR green LAMP successfully prevents false positives due to carry over contamination. With 0.2 units of UNG per reaction the hypothetical detection limit of SYBR Green LAMP assay is 1.12 x 104 gene copies per liter, which is lower than acceptable limit for monitored natural attenuation (2, 17). 80 0.4 0.3 0.2 3 2 1 0 0.2 0.3 0.4 Figure 4.3 Optimization of UNG with concentrated cell templates prepared from groundwater spiked with known quantities SDC-9 culture Note, if the endpoint color change in a replicate was green, it was denoted with a value of 1 while that of orange was denoted with 0. No template controls not represented in the figure remained orange. 81 4.4.3 Quantitative estimation of vcrA and tceA genes with SYBR Green LAMP using MPN Centrifuged cell templates were prepared from groundwater samples listed in Table 4.3. Quantitative estimates of vcrA and tceA genes in these samples were obtained using SYBR Green LAMP with MPN technique according to previously described methods (13, 14, 16). Figure 4.4 shows the endpoint color observed in a six replicates of seven fold 10X dilution series prepared from a single centrifuged cell template of groundwater sample MW100 for vcrA gene. Picture A has the first set of triplicates, and Picture B has the second set. No template controls for each replicate are on the right hand side. If the endpoint color change was green, it was denoted with a value of one while that of orange was denoted with zero in Table 4.1. qPCR with DNA templates from the same sample set were used to validate these concentrations of vcrA and tceA genes. Figure 4.5 shows the concentrations of vcrA (A) and tceA (B) genes obtained using qPCR with DNA templates and SYBR Green LAMP coupled to MPN technique with centrifuged cell templates. The sample names are plotted on the x-axis and the log10 concentrations for both assays are plotted on the y-axis. The concentrations obtained using qPCR and SYBR Green LAMP, are represented with grey and black bars respectively. The error bars with qPCR represent one standard deviation from the mean. Samples from batch 1 and batch 2 are marked B1 and B2 respectively and represent samples collected at two different sampling events from the same well. Between different groundwater samples, the maximum concentration of vcrA gene obtained using qPCR and DNA templates was 6.06 x 107 gene copies/L while that for tceA gene was 8.85 x 107 gene copies/L. The minimum concentration of vcrA gene obtained using qPCR and DNA templates in these samples was 1.4 x 106 gene copies/L while that for tceA gene was 82 2.41 x 106 gene copies/L. Over all, concentrations obtained using qPCR were greater than concentrations obtained using SYBR Green LAMP (See Table 4.4). The maximum concentration of vcrA gene obtained using SYBR Green LAMP and centrifuged cell templates was 3.2 x 107 gene copies/L while that for tceA gene was 2.9 x 107 gene copies/L. The minimum concentration of vcrA gene obtained using SYBR Green LAMP and centrifuged cell templates in these samples was 4.0 x 105 gene copies/L while that for tceA gene was 4.98 x 105 gene copies/L. Concentrations obtained using the SYBR green LAMP assay coupled to the MPN method with centrifuged cell templates, were compared to qPCR with DNA templates. Figure 4.6 shows a correlation between concentrations of vcrA and tceA genes obtained using qPCR and SYBR Green LAMP on linear scaled axes with log10 values (A) and log scaled axes (B). The concentrations obtained using qPCR are plotted on the y-axis and the concentrations obtained using SYBR Green LAMP are plotted on the x-axis. The concentrations of vcrA gene are plotted with closed markers while the concentrations of tceA gene are plotted with open markers. A strong correlation was observed between concentrations obtained using the SYBR Green LAMP and qPCR. It is worthwhile to note that the SYBR Green LAMP assay used centrifuged cell templates while the qPCR assay used DNA templates. For the vcrA gene the Spearman’s coefficient (ρ) of 0.952 and the p-value of 0.0329 was observed while for the tceA gene these values were 0.994 and 0.0484 respectively. The correlation between qPCR and SYBR Green LAMP concentrations is plotted with solid line for the vcrA gene and a dashed line for the tceA. On linear axes, the slope and the intercept of the trend line for vcrA gene were 0.9549 and 1.0165 (R2 = 0.78096) while for the tceA gene, these values were 0.9413 and 1.0745 (R2 0.92501) respectively. On log axes, for a trend line passing through origin the slope and the 83 exponent values for vcrA gene were 10.386 and 0.9549. Similarly, these values for the tceA gene were 11.873 and 0.9413. A B Figure 4.4 Endpoint color observed in a six replicate seven fold 10X dilution series prepared from a single centrifuged cell template of groundwater sample MW100 for vcrA gene. Note: Picture A has the first set of triplicates, and Picture B has the second set. No template controls for each replicate are on the right hand side. If the endpoint color change was green, it was denoted with a value of one while that of orange was denoted with zero in Table 4.1 84 9.0 log10 concentrations (gene copy/L) 8.0 qPCR vcrA MPN vcrA A 7.0 6.0 5.0 4.0 3.0 2.0 1.0 0.0 MW100 9.0 log10 concentrations (gene copy/L) 8.0 IW5B1 IW6B1 IW5B2 IW6B2 Sample Names qPCR tceA MW113 MW514 MPN tceA B 7.0 6.0 5.0 4.0 3.0 2.0 1.0 0.0 MW100 IW5B1 IW6B1 IW5B2 IW6B2 MW113 MW514 Sample Names Figure 4.5 log10 concentrations obtained using qPCR with DNA templates (grey) and MPN coupled to SYBR Green LAMP with centrifuged cell templates (black) for vcrA (A) and tceA (B) genes. 85 qPCR log10 Concentrations (gene cpies/L) 8.50 vcrA A tceA 8.00 7.50 vcrA rseponse factor y = 0.9549x + 1.0165 R² = 0.78096 tceA response factor y = 0.9413x + 1.0745 R² = 0.92501 7.00 6.50 6.00 5.00 5.50 6.00 6.50 7.00 7.50 MPN LAMP log10 Concentrations (gene copies/L) 8.00 1.0E+09 qPCR Concentrations (gene copies/L) B 1.0E+08 vcrA response factor y = 10.386x0.9549 R² = 0.78096 1.0E+07 1.0E+06 1.0E+05 tceA response factor y = 11.873x0.9413 R² = 0.92501 1.0E+06 1.0E+07 MPN-LAMP Concentrations (gene copies/L) 1.0E+08 Figure 4.6 Correlation between concentrations of vcrA and tceA genes obtained using qPCR with DNA templates and MPN coupled to SYBR Green LAMP with centrifuged cell templates on linear scaled axes with log10 values (A) and log scaled axes (B) 86 4.5 Discussion The use of dUTP and UNG to control carry over contamination in qPCR is ubiquitous (18-21). In fact, several commercial master mixes for qPCR with varying concentrations of UNG (e.g. Applied Biosystems SYBR Green PCR Master Mix, Catalog #4309155 or QuantiTect SYBR Green PCR, Catalog # 204141) are available. However, the application of dUTP-UNG system to LAMP is relatively new. In 2011, He and Xu (2011) developed a LAMP reaction recipe for simultaneous detection of white spot syndrome virus and infectious hypodermal and hematopoietic necrosis virus in penaeid shrimp. To date, there are three other examples of application of dUTP-UNG to LAMP exist (12, 23, 24). In this study, the SYBR Green LAMP assay developed for the visual detection of RDase genes was optimized to include the dUTP UNG system. Plasmid DNA and centrifuged cell templates containing known quantities of vcrA gene were used to determine the concentration of UNG required to degrade a trace AUGC contamination of ~104 gene copies while preserving fluorescence resulting from amplification of ATGC templates for a detection limit of 102 gene copies. Between 1.0 to 0.3 units of UNG, the SYBR Green LAMP assay produced several false negatives at lower concentrations of vcrA gene. At UNG concentrations below 0.2 units, amplification was observed in negative controls resulting from carry over contamination. This data suggests that the addition of 0.2 units of UNG per reaction suppresses amplification due to carry over contamination of up to 104 gene copies/reaction. A detection limit of ~84 gene copies per reaction was observed with this optimized reaction chemistry for both plasmid DNA templates as well as centrifuged cell templates. With a groundwater filtration volume of 100-250 mL, a detection limit of 84 gene copies per reaction corresponds to a concentration of 1.12 x 104 gene copies/L. Never the less, Kanitkar et al. (2017) observed a detection limit of ~ 1.18 x 105 gene copies/L for the vcrA gene 87 and 5.0 X 105 gene copies/L for tceA gene. This increase in detection limit may be attributed to the effect of humic substances of the amplification efficiency on LAMP (25) as well as the smaller filtration volumes used in that study. Ahmad, et al. (2017) demonstrated the use of MPN based LAMP approach on a microfluidic platform for quantification of representative gram-negative and gram-positive water borne pathogens, Escherichia coli and Enterococcus faecalis, respectively. In that study, quantification with direct cell templates in samples containing < 10 CFU was observed. Here, the application of MPN to the SYBR Green LAMP assay previously described is extended for quantitative estimation of vcrA and tceA genes from seven different groundwater samples obtained from the former Kelly Air Force Base site bioaugmented with SDC-9 culture. Quantitative estimates of vcrA gene concentrations determined using SYBR Green LAMP and centrifuged cell templates with MPN in these samples were strongly correlated to concentrations obtained using qPCR and DNA templates (ρ = 0.952, p-value = 0.0329). However, the value of the slope (10.386) of the trend line indicates that concentrations obtained using SYBR Green LAMP were at least an order of magnitude smaller compared to concentrations obtained using qPCR. Similar result was observed with tceA gene. The tceA gene concentrations determined using SYBR Green LAMP and centrifuged cell templates with MPN in these samples were also strongly correlated to concentrations obtained using qPCR and DNA templates (ρ = 0.994, pvalue = 0.0484). In this case, the slope of the trend line was 11.783. These slope and intercept values can be used as response factors to determine the concentrations of vcrA and tceA genes in groundwater samples for future applications of SYBR Green LAMP for quantification of RDase genes in groundwater samples. 88 In conclusion, SYBR Green LAMP approach is a low cost and user-friendly alternative to qPCR for the quantitative evaluation of Dehalococcoides mccartyi RDase genes in groundwater samples. It offers three key advantages compared to existing methods: time, potential in situ application, and cost. The use of centrifuged cells, instead of DNA, reduces the time required for sample preparation Also, compared to qPCR, the LAMP assay has a shorter run time and the visualization of amplification products is immediate. Moreover, the dUTP-UNG system reduces the probability of false positives due to carry over contamination and increases the overall robustness of visual detection with SYBR Green LAMP. The response factors generated for SYBR Green LAMP assay with MPN technique can be used to calibrate the assay and demonstrate its potential for use in the field. 89 APPENDIX 90 Appendix Table 4.3 List of groundwater samples used to prepare DNA and centrifuged cell templates. Well name Date of analysis IW5B1 IW6B1 MW100 IW5B2 IW6B2 MW514 MW113 06/02/17 06/02/17 06/02/17 06/20/17 06/20/17 06/20/17 06/20/17 Concentration of DNA templates (ng/µL) 33.17 63.58 20.22 45.69 75.07 44.8 93.6 B1 = Batch 1 B2 = Batch 2 91 Table 4.4 Concentrations of vcrA and tceA genes obtained using SYBR Green LAMP coupled to MPN method with centrifuged cell templates and qPCR with DNA templates. Samples Concentrations in gene copy/L MW100 IW5B1 IW6B1 IW5B2 IW6B2 MW113 MW514 MPN vcrA 4.00E+05 3.60E+06 4.30E+06 6.68E+06 3.20E+07 1.02E+06 4.35E+05 MPN tceA 9.60E+05 6.00E+06 1.20E+07 6.44E+06 2.90E+07 7.84E+05 4.98E+05 qPCR vcrA 2.24E+06 6.06E+07 5.47E+07 3.94E+07 5.50E+07 3.13E+06 1.46E+06 92 qPCR tceA 7.28E+06 2.01E+07 7.78E+07 4.86E+07 8.85E+07 2.41E+06 2.96E+06 Standard deviation for qPCR vcrA tceA 9.36E+05 1.08E+07 5.71E+06 6.92E+06 2.09E+07 1.65E+06 4.97E+05 1.10E+06 4.07E+06 1.09E+07 7.96E+06 2.87E+07 9.90E+05 3.88E+05 Table 4.5 Representative calculation table for MPN analysis of vcrA gene in groundwater sample MW100 based on the outcomes of the SYBR Green LAMP assay performed on dilutions of centrifuged cell template. Dilution level Dilution factor (di) Number of subsamples (ni) Volume of subsample in µL (vi) Number of positive subsamples (pi) vi x di x ni vi x di x pi vi x di 1 1 6 2 0.1 6 3 0.01 6 4 0.001 6 5 0.0001 6 6 0.00001 6 7 0.000001 6 25 25 25 25 25 25 25 6 6 6 6 4 3 1 150 150 25 15 15 2.5 1.5 1.5 0.25 0.15 0.15 0.025 0.015 0.01 0.0025 0.0015 0.00075 0.00025 0.00015 0.000025 0.000025 Table 4.6 Representative calculation table for MPN analysis of tceA gene in groundwater sample MW100 based on the outcomes of the SYBR Green LAMP assay performed on dilutions of centrifuged cell template. Dilution level Dilution factor ((di)) Number of subsamples (ni) Volume of subsample in µL (vi) Number of positive subsamples (pi) vi x di x ni vi x di x pi vi x di 1 1 6 2 0.1 6 3 0.01 6 4 0.001 6 5 0.0001 6 6 0.00001 6 7 0.000001 6 25 25 25 25 25 25 25 6 6 6 6 5 5 3 150 150 25 15 15 2.5 1.5 1.5 0.25 0.15 0.15 0.025 0.015 0.0125 0.0025 0.0015 0.00125 0.00025 0.00015 0.000075 0.000025 93 REFERENCES 94 REFERENCES 1. Leys D, Adrian L, Smidt H. 2013. Organohalide respiration: microbes breathing chlorinated molecules. The Royal Society. 2. Lebrón C, Petrovskis E, Löffler F, Henn K. 2011. Final report: application of nucleic acid based tools for monitoring monitored natural attenuation (MNA), biostimulation and bioaugmentation at chlorinated solvent sites. ESTCP project ER-200518. 3. Cupples AM. 2008. Real-time PCR quantification of Dehalococcoides populations: methods and applications. Journal of Microbiological Methods 72:1-11. 4. Ahmad F, Tourlousse DM, Stedtfeld RD, Seyrig G, Herzog AB, Bhaduri P, Hashsham SA. 2009. Detection and occurence of indicator organisms and pathogens. Water Environment Research 81:959-980. 5. Herzog AB, Pandey AK, Reyes-Gastelum D, Gerba CP, Rose JB, Hashsham SA. 2012. Evaluation of sample recovery efficiency for bacteriophage P22 on fomites. Applied and Environmental Microbiology 78:7915-7922. 6. Kurosaki Y, Takada A, Ebihara H, Grolla A, Kamo N, Feldmann H, Kawaoka Y, Yasuda J. 2007. Rapid and simple detection of Ebola virus by reverse transcription-loopmediated isothermal amplification. Journal of Virological Methods 141:78-83. 7. Ohtsuka K, Yanagawa K, Takatori K, Hara-Kudo Y. 2005. Detection of Salmonella enterica in naturally contaminated liquid eggs by loop-mediated isothermal amplification, and characterization of Salmonella isolates. Applied and Environmental Microbiology 71:6730-6735. 8. Zhang G, Brown EW, González-Escalona N. 2011. Comparison of real-time PCR, reverse transcriptase real-time PCR, loop-mediated isothermal amplification, and the FDA conventional microbiological method for the detection of Salmonella spp. in produce. Applied and Environmental Microbiology 77:6495-6501. 9. Stedtfeld RD, Stedtfeld TM, Kronlein M, Seyrig G, Steffan RJ, Cupples AM, Hashsham SA. 2014. DNA extraction-free quantification of Dehalococcoides spp. in groundwater using a hand-held device. Environmental Science & Technology 48:1385513863. 10. Stedtfeld RD, Tourlousse DM, Seyrig G, Stedtfeld TM, Kronlein M, Price S, Ahmad F, Gulari E, Tiedje JM, Hashsham SA. 2012. Gene-Z: a device for point of care genetic testing using a smartphone. Lab on a Chip 12:1454-1462. 11. Kanitkar YH, Stedtfeld RD, Steffan RJ, Hashsham SA, Cupples AM. 2016. Development of loop mediated isothermal amplification (LAMP) for rapid detection and quantification of Dehalococcoides spp. biomarker genes in commercial reductive 95 dechlorinating cultures KB-1 and SDC-9. Applied and Environmental Microbiology:AEM. 03660-03615. 12. Kil E-J, Kim S, Lee Y-J, Kang E-H, Lee M, Cho S-H, Kim M-K, Lee K-Y, Heo N-Y, Choi H-S. 2015. Advanced loop-mediated isothermal amplification method for sensitive and specific detection of Tomato chlorosis virus using a uracil DNA glycosylase to control carry-over contamination. Journal of Virological Methods 213:68-74. 13. Ahmad F, Stedtfeld RD, Waseem H, Williams MR, Cupples AM, Tiedje JM, Hashsham SA. 2017. Most probable number - loop mediated isothermal amplification (MPN-LAMP) for quantifying waterborne pathogens in <25min. Journal of Microbiological Methods 132:27-33. 14. Kanitkar YH, Stedtfeld RD, Hatzinger PB, Hashsham SA, Cupples AM. 2017. Development and application of a rapid, user-friendly, and inexpensive method to detect Dehalococcoides sp. reductive dehalogenase genes from groundwater. Applied Microbiology and Biotechnology 101:4827-4835. 15. Löffler FE, Yan J, Ritalahti KM, Adrian L, Edwards EA, Konstantinidis KT, Müller JA, Fullerton H, Zinder SH, Spormann AM. 2013. Dehalococcoides mccartyi gen. nov., sp. nov., obligately organohalide-respiring anaerobic bacteria relevant to halogen cycling and bioremediation, belong to a novel bacterial class, Dehalococcoidia classis nov., order Dehalococcoidales ord. nov. and family Dehalococcoidaceae fam. nov., within the phylum Chloroflexi. International Journal of Systematic and Evolutionary Microbiology 63:625-635. 16. Hurley MA, Roscoe M. 1983. Automated statistical analysis of microbial enumeration by dilution series. Journal of Applied Bacteriology 55:159-164. 17. Ritalahti KM, Hatt JK, Lugmayr V, Henn K, Petrovskis EA, Ogles DM, Davis GA, Yeager CM, Lebrón CA, Löffler FE. 2010. Comparing on-site to off-site biomass collection for Dehalococcoides biomarker gene quantification to predict in situ chlorinated ethene detoxification potential. Environmental Science & Technology 44:5127-5133. 18. Bedard DL, Ritalahti KM, Loffler FE. 2007. The Dehalococcoides population in sediment-free mixed cultures metabolically dechlorinates the commercial polychlorinated biphenyl mixture Aroclor 1260. Appl. Environ. Microbiol. 73:2513-2521. 19. Champlot S, Berthelot C, Pruvost M, Bennett EA, Grange T, Geigl E-M. 2010. An efficient multistrategy DNA decontamination procedure of PCR reagents for hypersensitive PCR applications. PLoS One 5:e13042. 20. Cho SY, Kim MJ, Suh J-T, Lee HJ. 2011. Comparison of diagnostic performance of three real-time PCR kits for detecting Mycobacterium species. Yonsei Medical Journal 52:301-306. 96 21. Yoshida A, Suzuki N, Nakano Y, Oho T, Kawada M, Koga T. 2003. Development of a 5′ fluorogenic nuclease-based real-time PCR assay for quantitative detection of Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis. Journal of Clinical Microbiology 41:863-866. 22. He L, Xu H-s. 2011. Development of a multiplex loop-mediated isothermal amplification (mLAMP) method for the simultaneous detection of white spot syndrome virus and infectious hypodermal and hematopoietic necrosis virus in penaeid shrimp. Aquaculture 311:94-99. 23. Joon D, Nimesh M, Varma-Basil M, Saluja D. 2017. Evaluation of improved IS6110 LAMP assay for diagnosis of pulmonary and extra pulmonary tuberculosis. Journal of Microbiological Methods 139:87. 24. Nimesh M, Joon D, Varma-Basil M, Saluja D. 2014. Development and clinical evaluation of sdaA loop-mediated isothermal amplification assay for detection of Mycobacterium tuberculosis with an approach to prevent carryover contamination. Journal of clinical microbiology 52:2662-2664. 25. Stedtfeld RD, Stedtfeld TM, Samhan F, Kanitkar YH, Hatzinger PB, Cupples AM, Hashsham SA. 2016. Direct loop mediated isothermal amplification on filters for quantification of Dehalobacter in groundwater. Journal of Microbiological Methods 131:61-67. 97 Chapter 5: Conclusions LAMP is a rapid, user friendly, and a cost effective method for quantification of Dehalococcoides mccartyi RDase genes vcrA, bvcA, and tceA. The highly specific LAMP primers developed for these genes can be used to monitor the in-situ growth of Dehalococcoides cells in commercial reductive dechlorinating cultures SDC-9 and KB-1 using DNA templates. Since quantification with LAMP was comparable to qPCR over a wide concentration range, assays can be performed on real time thermal cycler or proprietary microfluidic platforms like the Gene-Z (Chapter 2). To date the growth of SDC-9 and KB-1 is routinely monitored using qPCR. Platforms like the Gene-Z are cheaper and more accessible alternatives to qPCR thermal cyclers. Since these platforms use different reaction chemistries (e.g. producing significant visible fluorescence or post reaction electrochemical changes) for the detection of amplified target sequences, they are more economical compared to qPCR. In time-limited studies, another potential advantage is that amplification during LAMP is faster than qPCR. With the primer sets and reaction chemistries described in this study, all LAMP reactions were complete in less than one hour, which is significantly shorter than a typical qPCR run (>1.5 h). The SYBR Green LAMP assay is a user-friendly assay and can be used for quantitative evaluation of Dehalococcoides mccartyi RDase gene concentrations in groundwater samples. A key feature of this assay is the use of low cost laboratory equipment for LAMP (centrifuge and water bath, ~$600) compared to the high cost of a real time thermal cycler (~$20K) for qPCR. This makes the assay more accessible to a larger number of researchers and environmental engineers. With the detection limits of ~105 gene copies/L, the assay can potentially be applied 98 to track the growth of Dehalococcoides mccartyi at sites where monitored natural attenuation of chlorinated solvents is used as a clean-up strategy (Chapter 3). The optimization of SYBR Green LAMP assay by reducing the reaction volume further reduces the cost per reaction. The dUTP – UNG contamination control system increases the overall robustness of the assay by reducing the probability of false positives while retaining a detection limit of ~102 gene copies per reaction. The application of MPN to the SYBR Green LAMP assay previously described by Dr. Hashsham’s laboratory is extended for quantitative estimation of vcrA and tceA genes from seven different groundwater samples obtained from the former Kelly Air Force Base site bioaugmented with SDC-9 culture. Overall, the estimates of concentration obtained using MPN with SYBR Green LAMP assay on centrifuged cell templates showed a significant correlation to the concentrations obtained using qPCR and DNA templates. However, the SYBR Green LAMP assay under estimated the concentration of vcrA and tceA genes compared to qPCR. To account for the difference in concentrations between the two assays, response factors for correlating the MPN SYBR Green LAMP data to actual concentrations of vcrA and tceA genes in groundwater samples were developed (Chapter 4). In summary, the SYBR green LAMP method can potentially be used for on-site quantification of Dehalococcoides mccartyi RDase genes in groundwater samples without DNA extraction. Since the method is fast, user-friendly, and inexpensive, large number of replicates can be run for every sample to increase the confidence level of the quantification obtained using MPN LAMP at a lower cost compared to qPCR. The response factors developed here could then be used as a guide to evaluate the actual concentration of RDase genes in each sample. Moreover, because SYBR Green LAMP assay uses ubiquitously available laboratory equipment 99 it could free remediation engineers from relying on services of commercial laboratories with expertise in qPCR 5.1  Future Work Development and commercialization of a LAMP master mix – A significant portion of time associated with setting up SYBR Green LAMP assay is consumed in mixing the different ingredients of the master mix and adding LAMP primers of each gene. Additionally, this step is prone to pipetting errors, which can affect the outcome of experiment. Commercialization of the SYBR Green LAMP assay would therefore require supplying a premade master mix for each RDase gene.  Chip based LAMP and multiplexing with probe based chemistries – Chip based platforms could be developed to allow for detection of multiple RDase genes in a single tube. This can be achieved by designing unincorporated amplification signal reporters complimentary to the FIPs of existing primer sets and then labeling the respective FIPs with probes, which fluoresce at different wavelengths.  LAMP primers for other genes relevant for bioremediation – With the onset of high throughput sequencing data, novel putative reductive dehalogenases (e.g. cerA, mbrA) and several other monoxygenases (e.g. etnC, etnE, pmoA) have become relevant to the bioremediation of chlorinated solvents. Specific LAMP primers for these genes need to designed and tested with bioaugmenting cultures and groundwater samples from various sites. 100