PHENOTYPIC, CELLULAR AND MOLECULAR
CHARACTERIZATION OF THE CRX-LCA FELINE MODEL
AND POTENTIAL THERAPIES
By
Laurence Mireille Alice Occelli

A DISSERTATION
Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of
Comparative Medicine and Integrative Biology — Doctor of Philosophy
2017

ABSTRACT
PHENOTYPIC, CELLULAR AND MOLECULAR CHARACTERIZATION
OF THE CRX-LCA FELINE MODEL AND POTENTIAL THERAPIES
By
Laurence Mireille Alice Occelli
Leber’s congenital amaurosis (LCA) is one of the major inherited causes of childhood
blindness. Mutations in the cone-rod homeobox (CRX) gene result in severe dominant
retinopathies and can be responsible for LCA. CRX is a transcription factor essential for normal
photoreceptor development and survival. The CrxRdy cat has a spontaneous frameshift mutation in
Crx and represents a model for Class III CRX mutations where the mutant CRX allele binds DNA
but fails to transactivate it. The CrxRdy cat model is valuable for investigating disease
mechanisms as well as potential therapy development.
In this model, early disease stages in the heterozygous cat (CrxRdy/+) mimic severe
Leber’s congenital amaurosis. This is characterized by a dominant negative effect of the mutant
Crx mRNA/protein over the wild-type mRNA/protein. This study fully investigated the early
phenotype as well as the timing and extent of retinal remodeling during retinal degeneration.
There is early halting of photoreceptor development coupled with over expression of the mutant
Crx allele, accumulation of abnormally high mutant Crx protein levels, resulting in markedly
impaired visual function followed by retinal degeneration. During the late stages of the disease,
extensive inner retinal remodeling occurred with some retinal pigmentary epithelium (RPE)
degeneration in the area centralis (macula-like high retinal acuity region of the feline retina) and
also vascular remodeling. The homozygous cat (CrxRdy/Rdy) had a different phenotype with halting
of photoreceptor development at an earlier stage resulting in complete blindness and total lack of
photoreceptor function. This was followed by a slower photoreceptor degeneration and extensive

retinal remodeling that differed from that of the heterozygote cat. Additionally, there was a
marked increase in globe size with a severe alteration in refraction.
There is currently no treatment for dominant negative LCA diseases. Yet, the
investigation findings on CrxRdy/+ cat model and the similarities between the feline eye and the
human eye with the presence of a macula-like region make this feline model valuable for
preclinical testing of therapies for dominant CRX diseases. The detailed phenotyping sheds light
on the therapeutic approach needed. Prior to photoreceptor degeneration, a therapeutic approach
aiming to restore function to endogenous photoreceptors would need to increase the expression
levels of the wild-type allele over the mutant transcript. Following photoreceptor degeneration,
therapeutic approaches to replace photoreceptors or to activate light-induced responses in other
retinal neurons would need to be performed before retinal remodeling and neuronal cell loss
become too extensive. Trial therapy using a gene augmentation approach showed some promise
to improve the phenotype but requires further optimization.
The CrxRdy cat is a valuable model for Class III CRX mutations, RPE degeneration and
deprivation myopia mechanism, and therapy development.

Copyright by
LAURENCE MIREILLE ALICE OCCELLI
2017

This dissertation is dedicated to my parents who supported me since the
beginning and never let me down no matter what. But most importantly it is
dedicated to all research animals especially the cats whose lives were used for
Human research. Thank you for never giving me grief, for making me smile
and for giving the love that kept me going.

v

ACKNOWLEDGEMENTS

I would like to thank my major advisor Dr Simon Petersen-Jones for giving me that
research opportunity and for the endless hours of discussion (animated or not) that we spent
together speaking about research; the last 6 years flew!
I also thank my committee members. I would to thank Dr András Komáromy, although
always very quiet he always supported me. He knows I owe him a lot for in my future career. I
thank Dr Debra Thompson, the only woman of my committee; she was there and took time for
me when I needed a major advice. Finally, I would like to acknowledge Dr John Kruger for
always being available for medical advice for our animal colonies and for providing scientific
and financial support.
I would like to thank all the collaborators far or near this project who helped me develop
my skills and knowledge and therefore at a major impact on me and this work:


Dr Shiming Chen and Dr Nicholas Tran, the mouse experts in CRX mutations.



Dr Patrick Venta and Dr Arthur Weber, always available for scientific advice and

discussion.


Dr Alicia Withrow and Dr Melinda Frame, the electron microscopy and confocal experts.



The Univeristy of Florida viral vector expert; Dr William Hauswirth, Dr Shannon Boye

and Sanford Boye.


Dr Kristina Narfström, from whom the Crx cat colony came.



Dr Bryan Jones, the retinal remodeling expert.



The many scientists from the Kellogg Eye Center who were always available for advice

notably Dr Patrice Fort and Dr Thomas Gardner.

vi



Other collaborators such as Dr Don Hood; the OCT expert, Isis Pharmaceuticals, Dr

Steve Surh, MPI, Dr Yuzbasivan-Gurkan Lab (Dr Maciej Parys), Dr John Fyfe.


The RATTS group; Janice Querubin for her endless hours of some kitten ERGs and

others, Kristin Koehl for her help and moral support, and Heather Defore for pulling with me and
their tremendous understanding those last months.


The vivarium and ULAR staffs for taking care for our animals especially those who I

would like to refer as “my” precious cats to me; Lisa Allen, Kim Williamson, the students.
Special thanks to Ramona Stambaugh for all her help with the animal care but mainly her moral
support during weekends over the years.


The CMIB staff for their help and guidance during this PhD expecially Dr Yuzbasivan-

Gurkan, Dr Victoria Hoelzer-Maddox and Dimity Palazzola.


The CVM MSU staff especially Debbie Roman and Whitney Smith for their availability

and huge help in administrative matters.


My major fundings: Myers-Dunlap Endowment, George H. Bird and ‘‘Casper’’

Endowment for Feline Initiatives, Michigan State University Center for Feline Health and WellBeing and Michigan State University College of Veterinary Medicine Endowed Research Funds.

On a more personal note, I would like to thank the endless number of people I met and
for some work with those last 6 years and family members for their support.


All my labmates who taught me a lot about working environment and relationships. I am

happy to say I gained friends; Dr Paige Winkler, Dr Kara Gornik thanks for being there in my
dark hours during my MSU time.

vii



All the students who worked or were involved at some point in the SPJ lab. A big thank

you to Taylor Chambers, Dr Ashlee Bruewer, Nate Parsmanter, Dr Laure Damitio for their
understanding and free help.


Christine Harman and Kristin Koehl for their help with lab stuffs and friendships.



Previous residents and MSU mentors: a huge thanks to Dr Joshua Bartoe for his help and

moral support over the years and Dr Ryan Boyd for sharing a scientific passion.

Finally I would like to thank people how have a huge place in my personal life.


My parents for their moral and financial support over so many years of studying…. your

patient is endless and I love you.


The rest of my family for believing in me.



My previous mentors and for some now dear friends who have impacted my career: Dr

Jacques Fajardi, Dr Margie Neaderland, Dr Joe Wolfer, Dr Peter Bedford, Dr Hatim Alibhai, my
high schools teachers.


Sanjuanita Perez for driving me back home at 1am after long hours and for all her support

and friendship over the years.


My dear friends who were there on the phone during my darkest hours and make

themselves available: Fabien, Damien, Isabelle, Leah, Steph, Pablo, Elodie, Candide, Penny,
Wendy.


Cwen for her last minute tremendous help and support.



My boyfriend Caleb and his cute clumsy but honest endless support. Thanks for pulling

with me and accepting my animated discussions. I love you and hope we will go through many
more years together. Thanks to his family to have welcomed me in theirs.

viii



Last but not the least; all my pets present and past who gave me my vet passion

especially the Gus Gus but mostly all the lab animals. To all my research cats I do and will
remember every single one of you, whatever people might say you all had your own personality
and I miss the ones gone dearly.

ix

TABLE OF CONTENTS

LIST OF TABLES ............................................................................................................ .xv
LIST OF FIGURES .......................................................................................................... xvi
KEY TO ABBREVIATIONS ........................................................................................... xxi
CHAPTER 1
INTRODUCTION
ANIMAL MODELS FOR DOMINANT LEBER CONGENITAL AMAUROSIS (LCA)
DUE TO CRX MUTATIONS – INTRODUCTION OF THE FELINE MODEL AND
POTENTIAL THERAPIES ................................................................................................ 1
1.1. RETINAL INHERITED DISEASES AND BLINDNESS ............................................... 2
1.2. THE EYE AND ANIMAL MODELS ............................................................................. 3
1.2.1. General eye and retinal anatomy .............................................................................. 4
1.2.1.1. General eye anatomy and development ............................................................ 4
1.2.1.2. General retinal anatomy and retinogenesis ....................................................... 7
1.2.1.3. Specificities of the feline photoreceptor development ..................................... 12
1.2.2. Specificities in globe and retinal anatomy in large animal models compared to
small animal model and humans ...................................................................................... 18
1.2.3. Cat large animal models in retinal hereditary research ........................................... 24
1.3. RETINAL DEVELOPMENT AND TRANSCRIPTION FACTORS ............................ 25
1.4. CRX-LCA INHERITED RETINAL DISEASE ............................................................. 29
1.4.1. Leber Congenital Amaurosis (LCA) ...................................................................... 29
1.4.2. CRX transcription factor ........................................................................................ 31
1.4.3. CRX mutation classifications ................................................................................. 35
1.5. CRX-LCA INHERITED RETINAL DISEASE AND POTENTIAL THERAPIES ........ 43
1.5.1. The disease phenotype leads to the potential therapy choices ................................. 43
1.5.2. Viral vectors for gene supplementation and their potential for therapy ................... 44
1.5.2.1. Viral vectors used for gene therapy ................................................................ 45
1.5.2.2. Adeno-associated vectors (AAV) ................................................................... 46
1.5.2.2.1. Properties of AAV vectors ...................................................................... 46
1.5.2.2.2. Transduction mechanism of action of AAV vectors ................................ 48
1.5.2.2.3. Optimization of AAV vectors – recombinant AAV (rAAV) and other
modifications ......................................................................................................... 50
1.5.2.2.4. Delivery route of AAV vectors for inherited retinal dystrophy
diseases .................................................................................................................. 55
1.5.2.2.5. Immune responses to AAV vectors ......................................................... 57
1.5.3. Potential silencing therapies .................................................................................. 58
1.6. AIM AND OUTLINE OF THIS THESIS ..................................................................... 60
1.7. CONCLUSION ............................................................................................................ 62
REFERENCES .................................................................................................................... 63

x

CHAPTER 2
CRXRDY/+ CAT: A LARGE ANIMAL MODEL FOR CRX-ASSOCIATED LEBER
CONGENITAL AMAUROSIS ......................................................................................... 79
2.1. ABSTRACT ................................................................................................................. 80
2.2. INTRODUCTION ........................................................................................................ 81
2.3. MATERIALS AND METHODS .................................................................................. 83
2.3.1. Ethics Statement .................................................................................................... 83
2.3.2. Animals ................................................................................................................. 83
2.3.3. Ophthalmic examination and fundus imaging ........................................................ 84
2.3.4. Electroretinography (ERG) .................................................................................... 84
2.3.5. Retinal morphology ............................................................................................... 85
2.3.5.1. In vivo Spectral Domain-Optical Coherence Tomography (SD-OCT) ............. 85
2.3.5.2. Immunohistochemistry (IHC) ........................................................................ 86
2.3.5.3. Plastic embedded sections .............................................................................. 86
2.3.6. Quantitative Reverse Transcriptase-Polymerase Chain Reaction (qRT-PCR) ......... 86
2.3.7. Western blot assay ................................................................................................. 87
2.3.8. Dual-Luciferase assay ........................................................................................... 88
2.3.9. Statistical analysis ................................................................................................. 88
2.4. RESULTS .................................................................................................................... 89
2.4.1. CrxRdy/+ kittens have markedly reduced retinal function ......................................... 89
2.4.2. CrxRdy/+ kittens have a progressive photoreceptor degeneration starting in the
area centralis .................................................................................................................. 94
2.4.3. CrxRdy/+ retinas had markedly reduced levels of cone and rod transcripts .............. 101
2.4.4. Effect of the Rdy mutation on Crx’s transcription regulatory activity ................... 105
2.5. DISCUSSION ............................................................................................................. 105
2.5.1. The CrxRdy/+ kitten provides a model for the human CRX- LCA phenotype .......... 106
2.5.2. Molecular mechanism underlying CrxRdy phenotype and implications in therapy
development ................................................................................................................. 109
2.6. ACKNOWLEDGEMENTS ........................................................................................ 111
APPENDICES ................................................................................................................... 112
APPENDIX A – Figure 2.S1 ............................................................................................. 113
APPENDIX B – Figure 2.S2 .............................................................................................. 114
APPENDIX C – Figure 2.S3 .............................................................................................. 115
APPENDIX D – Figure 2.S4 ............................................................................................. 116
APPENDIX E – Figure 2.S5 .............................................................................................. 117
APPENDIX F – Figure 2.S6 .............................................................................................. 118
APPENDIX G – Figure 2.S7 ............................................................................................. 119
APPENDIX H – Table 2.S1 ............................................................................................... 120
APPENDIX I – Table 2.S2 ................................................................................................ 121
REFERENCES .................................................................................................................. 122

xi

CHAPTER 3
METABOLIC CHANGES AND RETINAL REMODELING IN HETEROZYGOUS
CRX MUTANT CATS (CRXRDY/+) .................................................................................. 128
3.1. ABSTRACT ............................................................................................................... 129
3.2. INTRODUCTION ...................................................................................................... 130
3.3. MATERIALS AND METHODS ................................................................................ 132
3.3.1. Ethics Statement .................................................................................................. 132
3.3.2. Animals ............................................................................................................... 132
3.3.3. Ophthalmic examination and fundus imaging ...................................................... 133
3.3.4. Retinal morphology and vasculature evaluation ................................................... 133
3.3.4.1. In vivo Spectral Domain-Optical Coherence Tomography (SD-OCT) ........... 133
3.3.4.2. Post-mortem retinal and vascular morphology and remodeling
investigation .............................................................................................................. 135
3.3.4.2.1. Immunohistochemistry (IHC) ............................................................... 135
3.3.4.2.2. Regular plastic embedded histologic thin sections ................................. 136
3.3.4.2.3. Immunocytochemistry for computational molecular phenotyping for
macromolecules and small molecules (CMP) ....................................................... 136
3.3.5. Statistical analysis ............................................................................................... 137
3.4. RESULTS .................................................................................................................. 138
3.4.1. CrxRdy/+ cats present with severe retinal degeneration starting and more
pronounced in the area centralis ................................................................................... 138
3.4.2. CrxRdy/+ cat retinas undergo marked retinal remodeling ........................................ 144
3.4.3. CrxRdy/+ cat retinas undergo marked retinal vasculature remodeling ..................... 148
3.4.4. CrxRdy/+ cat present with severe area centralis retinal pigmentary epithelium
degeneration ................................................................................................................. 151
3.4.5. Other findings in individual CrxRdy/+ cats ............................................................. 153
3.5. DISCUSSION ............................................................................................................. 155
3.6. ACKNOWLEDGEMENTS ........................................................................................ 158
APPENDICES ................................................................................................................... 159
APPENDIX J – Figure 3.S1 ............................................................................................... 160
APPENDIX K – Figure 3.S2 ............................................................................................. 161
APPENDIX L – Figure 3.S3 .............................................................................................. 163
APPENDIX M – Table 3.S1 .............................................................................................. 164
APPENDIX N – Table 3.S2................................................................................................ 165
REFERENCES .................................................................................................................. 166
CHAPTER 4
PHENOTYPIC CHARACTERIZATION OF CATS HOMOZYGOUS FOR A
FRAMESHIFT MUTATION IN CRX (CRXRDY/RDY)....................................................... 170
4.1. ABSTRACT ............................................................................................................... 171
4.2. INTRODUCTION ...................................................................................................... 173
4.3. MATERIALS AND METHODS ................................................................................ 175
4.3.1. Ethics Statement .................................................................................................. 175
4.3.2. Animals ............................................................................................................... 175
4.3.3. Ophthalmic examination and fundus imaging ...................................................... 175
4.3.4. Measurement of globe length ............................................................................... 176
4.3.5. Intraocular pressure (IOP) ................................................................................... 176
xii

4.3.6. Refractive error ................................................................................................... 177
4.3.7. Electroretinography (ERG) .................................................................................. 177
4.3.8. Retinal morphology and vasculature ..................................................................... 177
4.3.8.1. In vivo Spectral Domain-Optical Coherence Tomography (SD-OCT) ........... 177
4.3.8.2. Immunohistochemistry (IHC) ...................................................................... 178
4.3.8.3. Plastic embedded sections ............................................................................ 178
4.3.9. Quantitative Reverse Transcriptase-Polymerase Chain Reaction (qRT-PCR) ....... 178
4.3.10. Western blot assay ............................................................................................. 179
4.3.11. Statistical analysis ............................................................................................. 180
4.4. RESULTS .................................................................................................................. 181
4.4.1. CrxRdy/Rdy cats have an increased globe length and a myopic refractive error ......... 181
4.4.2. CrxRdy/Rdy kittens lack retinal function .................................................................. 184
4.4.3. CrxRdy/Rdy kittens have changes in fundus reflectivity and tapetal thinning, but
superficial retinal vasculature persists into adulthood .................................................... 185
4.4.4. The CrxRdy/Rdy cat lacks development of photoreceptor inner and outer
segments, and despite extensive retinal remodeling has preservation of total retinal
thickness ....................................................................................................................... 187
4.4.5. CrxRdy/Rdy retinas had a marked reduction of transcript levels for cone and rod
specific genes and changes in expression levels of transcription factors involved in
the photoreceptor development/fate cascade .................................................................. 196
4.5. DISCUSSION ............................................................................................................. 200
4.5.1. The CrxRdy/Rdy kitten develops significant globe enlargement without glaucoma ... 200
4.5.2. The CrxRdy/Rdy kitten is a model for severe CRX-LCA retinopathies ....................... 201
4.5.3. Molecular mechanism underlying CrxRdy/Rdy phenotype ........................................ 202
4.6. ACKNOWLEDGEMENTS ........................................................................................ 204
APPENDICES ................................................................................................................... 205
APPENDIX O – Figure 4.S1 ............................................................................................. 206
APPENDIX P – Figure 4.S2 .............................................................................................. 207
APPENDIX Q – Figure 4.S3 ............................................................................................. 208
APPENDIX R – Figure 4.S4 .............................................................................................. 209
APPENDIX S – Figure 4.S5 .............................................................................................. 210
APPENDIX T – Figure 4.S6 .............................................................................................. 211
APPENDIX U – Figure 4.S7 ............................................................................................. 212
APPENDIX V – Figure 4.S8 ............................................................................................. 213
APPENDIX W – Figure 4.S9 ............................................................................................ 214
APPENDIX X – Table 4.S1 ............................................................................................... 216
APPENDIX Y – Table 4.S2 ............................................................................................... 218
APPENDIX Z – Table 4.S3 ............................................................................................... 220
APPENDIX a – Table 4.S4 ................................................................................................ 221
APPENDIX b – Table 4.S5 ............................................................................................... 222
APPENDIX c – Table 4.S6 ................................................................................................ 223
REFERENCES .................................................................................................................. 224

xiii

CHAPTER 5
ADENO-ASSOCIATED VIRUS GENE AUGMENTATION THERAPY TRIAL
FOR CRX-LCA DOMINANT NEGATIVE MUTATION IN THE CRXRDY/+
FELINE MODEL ............................................................................................................ 230
5.1. ABSTRACT ............................................................................................................... 231
5.2. INTRODUCTION ...................................................................................................... 232
5.3. MATERIALS AND METHODS ................................................................................ 234
5.3.1. Ethics Statement .................................................................................................. 234
5.3.2. Animals ............................................................................................................... 234
5.3.3. Subretinal injections and vectors delivered .......................................................... 235
5.3.4. Outcome evaluations ........................................................................................... 239
5.3.4.1. Ophthalmic examination and fundus imaging ............................................... 239
5.3.4.2. Retinal function assessment – Electroretinography (ERG) ............................ 239
5.3.4.3. Retinal morphology and CRX expression ..................................................... 240
5.3.4.3.1. In vivo Spectral Domain-Optical Coherence Tomography (SD-OCT) ... 240
5.3.4.3.2. Immunohistochemistry (IHC) ............................................................... 240
5.4. RESULTS .................................................................................................................. 241
5.4.1. CrxRdy/+ kittens show retinal attachment after subretinal injection and only
minor side effects .......................................................................................................... 241
5.4.2. Functional rescue ................................................................................................. 246
5.4.3. Morphological rescue and molecular expression of the vector ............................. 248
5.5. DISCUSSION ............................................................................................................. 251
5.6. ACKNOWLEDGEMENTS ........................................................................................ 254
REFERENCES .................................................................................................................. 255

CHAPTER 6
CONCLUSIONS AND FUTURE DIRECTIONS .......................................................... 260
6.1. CONCLUSIONS ON THE CRX-LCA FELINE MODELS AND THERAPY TRIAL .. 261
6.2. FUTURE DIRECTIONS ............................................................................................ 262
6.2.1. Investigation of the underlying disease mechanisms ............................................ 262
6.2.2. Developing therapies for treatment of dominant negative CRX-LCA retinal
dystrophies .................................................................................................................... 264
6.2.2.1. Supplementation therapies: selecting rAAV serotypes and promoters that
most efficiently transduce both cones and rods in wild-type kittens .......................... 264
6.2.2.2. Silencing therapies ....................................................................................... 265
6.2.2.2.1. Use of antisense gene silencing therapy to reduce the level of mutant
Crx and rescue the retinal phenotype .................................................................... 265
6.2.2.2.2. Knockdown the mutant Crx allele using siRNA or shRNA ................... 266
6.2.2.3. Other possible therapies ............................................................................... 266
6.2.3. Developing vision assessment in the cat .............................................................. 267
REFERENCES .................................................................................................................. 268

xiv

LIST OF TABLES

Table 1.1. Identified retinal genes in which mutations can be responsible for LCA .............. 29
Table 1.2. Genes which contain a CRX-binding site revealed by ChIP seq that are
known to be expressed in specific retinal cells ..................................................................... 32
Table 1.3. Genes containing a CRX-binding site revealed by ChIP seq, that are known to
be expressed in the retina ..................................................................................................... 33
Table 1.4. Phenotype summary of heterozygous Crx mutant mice ....................................... 38
Table 2.S1. List of antibodies used for IHC – their origins and dilutions ............................ 120
Table 2.S2. Primer sequences for qRT-PCR assays ............................................................ 121
Table 3.S1. Experimental numbers of CrxRdy/+ cats ............................................................ 164
Table 3.S2. List of antibodies used for IHC – their origins and dilutions ............................ 165
Table 4.1. Summary of the results by indicating fold expression changes for each mRNA
between CrxRdy/Rdy, CrxRdy/+ and WT kittens ....................................................................... 197
Table 4.S1. Experiments and numbers of animal for globe length in CrxRdy/Rdy,
CrxRdy/+and WT cats ........................................................................................................... 216
Table 4.S2. Experiments and numbers of animal for IOP, refraction, qRT-PCR, Western
blot, immunohistochemistry and histology in CrxRdy/Rdy, CrxRdy/+and WT cats .................... 218
Table 4.S3. Experiments and numbers of animal for fluorescein angiography, ERG and
SD-OCT in CrxRdy/Rdy cats .................................................................................................. 220
Table 4.S4. List of antibodies used for IHC – their origins and dilutions ............................ 221
Table 4.S5. Primer sequences for qRT-PCR assays ............................................................ 222
Table 4.S6. P values for qRT-PCR assays results ............................................................... 223
Table 5.1. List of animals, the vector and titer they received .............................................. 237
Table 5.2. Experimental design .......................................................................................... 238
Table 5.3. List of antibodies used for IHC – their origins and dilutions .............................. 241
Table 5.4. Details of outcomes for each kitten .................................................................... 241

xv

LIST OF FIGURES

Figure 1.1. Mapped and Identified Retinal Disease Genes 1980-2016 .................................... 3
Figure 1.2. Functional categories of retinal disease genes ...................................................... 3
Figure 1.3. Schematic of the eye ............................................................................................ 4
Figure 1.4. Schematic overview of vertebrate eye development ............................................. 6
Figure 1.5. Anatomy of embryonic mouse forebrain and eyes ................................................ 7
Figure 1.6. Representative photographs and images of a feline eye and retina ........................ 8
Figure 1.7. Schematic showing major retinal pathways and cells composing the retina .......... 9
Figure 1.8. Retinal neurogenesis proceeds in a fixed histogenetic order ............................... 10
Figure 1.9. Structural organization of the developing and adult vertebrate retina .................. 11
Figure 1.10. Temporal differentiation and maturation of the feline retina ............................. 13
Figure 1.11. Positioning of a cat for ERG ............................................................................ 14
Figure 1.12. Analysis if composite retinal action potential at to intensities from a cat
retina ................................................................................................................................... 15
Figure 1.13. Typical feline dark-adapted ERG waveform and its origins .............................. 16
Figure 1.14. Examples of the ERGs recorded from kittens of different ages in response
to a long stimulus of light .................................................................................................... 18
Figure 1.15. Schematic of the human, dog, mouse and cat eye ............................................ 19
Figure 1.16. Photoreceptor cells distribution in the mouse retina .......................................... 20
Figure 1.17. Images of a feline and a human right eye fundus .............................................. 21
Figure 1.18. Schematic diagrams of cone distributions in a retinal wholemount of
normal cat ............................................................................................................................ 22
Figure 1.19. Photoreceptor cell densities in the cat and human ............................................. 23
Figure 1.20. The complexity of transcriptional regulation .................................................... 27
Figure 1.21. Model for transcription factor network regulation of photoreceptor subtype
development ........................................................................................................................ 28
xvi

Figure 1.22. Cumulative number of identified LCA genes ................................................... 30
Figure 1.23. Main LCA causing-genes: their spatial expression and their prevalence
importance ........................................................................................................................... 30
Figure 1.24. CRX transcription factor structure .................................................................... 31
Figure 1.25. Schematic representation of the roles in cones of the proteins, which are
encoded by genes with a CRX-binding site .......................................................................... 34
Figure 1.26. Human mutations schematic and animal models mutations .............................. 36
Figure 1.27. Schematic diagram of wild-type (WT) and mutant CRX proteins made by
the indicated mouse models ................................................................................................. 38
Figure 1.28. Changes in phototransduction photoreceptor-specific gene expression ............. 39
Figure 1.29. Model of how Crx mutation-caused gene expression changes affect rod and
cone development ................................................................................................................ 39
Figure 1.30. Wild-Type and mutant feline cDNA and the predicted protein ......................... 42
Figure 1.31. Wild-type and mutant Rdy Crx feline proteins .................................................. 43
Figure 1.32. Proteins whose genes are candidates for gene supplementation therapy .......... 45
Figure 1.33. Schematic of an AAV vector – its capsid and single stranded DNA ................. 47
Figure 1.34. AAV vector mechanism of action leading to gene expression .......................... 49
Figure 1.35. Structure and production of a rAAV vector ...................................................... 52
Figure 1.36. Examples of hybrid rAAV and their cell tropism of rAAV in the canine
retina ................................................................................................................................... 53
Figure 1.37. Comparison of scAAV and rAAV vectors......................................................... 53
Figure 1.38. Intraocular AAV administration routes ............................................................. 55
Figure 1.39. Figure showing the currently used oligonucleotide therapeutic approaches ....... 59
Figure 2.1. Dark-adapted luminance series ERG from CrxRdy/+ and WT kittens, a-wave
modeling and b-wave Naka-Ruston fitting ........................................................................... 91
Figure 2.2. A-wave and b-wave amplitude and implicit time plotted relative to flash
luminance and maximal recorded amplitude plotted relative to age ...................................... 93
Figure 2.3. Color fundus photographs .................................................................................. 94

xvii

Figure 2.4. Spectral Domain – Optical Coherence Tomography (SD-OCT) in vivo retinal
morphology analysis ............................................................................................................ 96
Figure 2.5. Representative plastic sections of retina from central, dorsal and ventral
regions in WT and CrxRdy/+ kittens at 6 and 20 weeks of age ................................................ 98
Figure 2.6. Immunohistochemistry using rod and cone markers ......................................... 100
Figure 2.7. Changes of mRNA expression in CrxRdy/+ retinas ............................................. 102
Figure 2.8. Western blot analysis for Crx nuclear protein ................................................... 104
Figure 2.S1. List of the CRX human mutations .................................................................. 113
Figure 2.S2. Retinal regions imaged by SD-OCT ............................................................... 114
Figure 2.S3. Sites of retinal sampling for qRT-PCR ........................................................... 115
Figure 2.S4. TR, REC+, ONL and IR layer thicknesses ..................................................... 116
Figure 2.S5. Immunolabeling of the retina for S cones and inner retinal cells ..................... 117
Figure 2.S6. Western blot for Crx protein in retinal nuclear and cytoplasmic extracts
from 2 week old kittens ..................................................................................................... 118
Figure 2.S7. Dual-Luciferase assays for CRX transactivation activity on mouse Crx-Luc
reporter .............................................................................................................................. 119
Figure 3.1. Representative SD-OCT high resolution cross-section image of a normal cat ... 134
Figure 3.2. Fundus changes and morphological changes in the CrxRdy/+ cat at different
ages ................................................................................................................................... 139
Figure 3.3. Total retina (TR), Receptor+ (REC+) and Inner retina (IR) thicknesses
scatter plots ....................................................................................................................... 141
Figure 3.4. Histologic images from plastic sections from the Superior Mid-Periphery
(Sup MP) and the area centralis regions and their nuclei cell counts .................................. 143
Figure 3.5. Immunohistochemisty during disease progression in the CrxRdy/+ cat ................ 145
Figure 3.6. Retinal amino acid signatures in a 6-week, 20-week, 5-year and 10-year-old
CrxRdy/+ cats ....................................................................................................................... 146
Figure 3.7. TQE and YGE CMP mapping and semithin histologic sections in the CrxRdy/+
cat ..................................................................................................................................... 147
Figure 3.8. Retinal vascular remodeling in the CrxRdy/+ cat ................................................. 149

xviii

Figure 3.9. Area centralis lesion in a 6.5-year-old CrxRdy/+ cat ........................................... 152
Figure 3.10. Additional lesions observed in the CrxRdy/+ cat ............................................... 154
Figure 3.S1. Fundus areas sampled .................................................................................... 160
Figure 3.S2. Outer nuclear layer (ONL), inner nucler layer (INL) and ganglion cell
complex (GCC) layer thicknesses scatter plots ................................................................... 161
Figure 3.S3. Cell nuclei count of the ONL, INL and GCC from the Superior FarPeriphery (Sup FP), Inferior Mid-Periphery and Inferior Far-Periphery ............................. 163
Figure 4.1. Globe lengths ................................................................................................... 182
Figure 4.2. (A) Intraocular pressure (IOP) ......................................................................... 184
Figure 4.3. Dark-adapted intensity series ERGs from WT, CrxRdy+/- and CrxRdy/Rdy kittens .. 185
Figure 4.4. Fundus images during development and adulthood .......................................... 186
Figure 4.5. Spectral Domain – Optical Coherence Tomography (SD-OCT) in vivo retinal
morphology analysis of the dorsal retina ............................................................................ 189
Figure 4.6. Spectral Domain – Optical Coherence Tomography (SD-OCT) in vivo retinal
morphology analysis of the area centralis ......................................................................... 190
Figure 4.7. Representative histologic sections and morphologic characteristic in the
CrxRdy/Rdy cats .................................................................................................................... 192
Figure 4.8. Immunolabeling of the CrxRdy/Rdy cat central retinal region for rod, rod
bipolar, Müller cell and Neural cell markers ...................................................................... 194
Figure 4.9. Changes in mRNA expression in CrxRdy/Rdy retinas compared to CrxRdy/+
retinas – levels are normalized to WT retinas ..................................................................... 198
Figure 4.10. Western blot analysis for Crx nuclear protein ................................................ 199
Figure 4.11. The molecular mechanism of congenital blindness caused by
dominant CRX frameshift mutations .................................................................................. 203
Figure 4.S1. Retinal regions imaged by SD-OCT and regions biopsied for histologic
sections ............................................................................................................................. 206
Figure 4.S2. Sites of retinal sampling for qRT-PCR ........................................................... 207
Figure 4.S3. Globe lengths ................................................................................................. 208
Figure 4.S4. Thicknesses of retinal layers in the dorsal and area centralis region .............. 209

xix

Figure 4.S5. Thicknesses of retinal layers in the temporal region ....................................... 210
Figure 4.S6. Thicknesses of retinal layers in the nasal region ............................................. 211
Figure 4.S7. Thicknesses of retinal layers in the ventral region .......................................... 212
Figure 4.S8. Regular histologic and electron microscopy images of a 2-week-old
CrxRdy/Rdy cat ...................................................................................................................... 213
Figure 4.S9. Immunolabeling of the CrxRdy/Rdy cat central retina frozen sections for
cones’ markers, inner retina cells’s markers, retinal pigmentary epithelium cell marker
and Crx antibody ............................................................................................................... 214
Figure 5.1. 175 μL subretinal injection in the central retinal region of a 3-week-old
CrxRdy/+ kitten .................................................................................................................... 236
Figure 5.2. Side effects of subretinal injections .................................................................. 245
Figure 5.3. Summary of the outcome assessment from kitten OA02533517, which
presented with functional rescue ........................................................................................ 247
Figure 5.4. Molecular expression ....................................................................................... 250

xx

KEY TO ABBREVIATIONS

AAV

Adeno-associated virus

AC

Area centralis

AF

Autofluorescence

Arr

Arrestin

bp

Base pair

CBA

Chicken β-actin

CoRD

Cone-rod dystrophy

Crx

Cone-rod homeobox

CrxRdy/+

Heterozygous Crx mutant cat

CrxRdy/rdy

Homozygous Crx mutant cat

cSLO

Confocal scanning laser ophthalmoscopy

DAPI

4',6-diamidino-2-phenylindole

ELM

External limiting membrane

EM

Electron microscopy

ERG

Electroretinography/Electroretinogram

EZ

Ellipsoid zone

F

Phenylalanine

FA

Fluorescein angiography

FAF

Fundus autofluorescence

GAPDH

Glyceraldehyde-3-phosphate dehydrogenase

GCC

Ganglion cell complex

GCL

Ganglion cell layer
xxi

GFAP

Glial fibrillary acidic protein

GFP

Green fluorescent protein

hCAR

Human cone arrestin

IHC

Immunohistochemistry

ILM

Inner limiting membrane

INL

Inner nuclear layer

IPL

Inner plexiform layer

IR

Infrared

IR

Inner retina

IS

Inner photoreceptor segment

IZ

Interdigitation zone

LCA

Leber congenital amaurosis

ML-opsin (MLO)

Medium-Long wavelength opsin

NeuN

Neuronal nuclei

NFL

Nerve fiber layer

NRL

Neural retina-specific leucine zipper protein

NR2E3

Photoreceptor-specific nuclear receptor

OTX2

Orthodenticle homebox 2

ONL

Outer nuclear layer

OS

Outer photoreceptor segment

OPL

Outer plexiform layer

PBS

Phosphate buffered saline

PFA

Paraformaldehyde

PKCα/PKCa

Protein kinase C alpha
xxii

PR

Photoreceptor

REC+

Receptor+

Rho

Rhodopsin

ROR

Orphan nuclear receptor

RP

Retintis pigmentosa

RPE

Retinal pigmentary epithelium

SD-OCT

Spectral Domain – Optical Coherence Tomography

S-opsin (SO)

Short-wavelength opsin

TR

Total retina

TRβ2

Thyroid hormone receptor β2

Tuba1b

Tubulin alpha-1B chain

Y

Tyrosine

xxiii

CHAPTER 1
INTRODUCTION
ANIMAL MODELS FOR DOMINANT LEBER CONGENITAL AMAUROSIS (LCA)
DUE TO CRX MUTATIONS –
INTRODUCTION OF THE FELINE MODEL AND POTENTIAL THERAPIES

1

1.1. RETINAL INHERITED DISEASES AND BLINDNESS
Severe impairment of vision and more dramatically blindness is widespread across the
globe. The World Health Organization (WHO; http://www.who.int/mediacentre/factsheets/fs282/
en/ available in the public domain) estimates that impairment of vision affected about 285 million
people including 19 million children (under 15) with about 246 million people having low vision
and 39 million being blind.1 Blindness is an important factor affecting the life quality of a
significant number of people. Causes of visual impairment and in more severe case blindness can
be metabolic (like diabetes mellitus), infectious (like onchocerciasis, leprosy), traumatic or
inherited. About 43% of visual impairment is reported to be due to uncorrected refractive errors
like myopia, hyperopia or astigmatism, 33% due to unoperated cataract and 2% from glaucoma. 1
Inherited diseases affecting notably the retina are another cause of visual impairment and in
worse cases blindness.
Hereditary disorders are a common cause of photoreceptor dysfunction and degeneration
resulting in vision loss with a prevalence of 1 in approximately 3,000.3-5 Currently 293 genes and
loci are mapped and 256 identified (Fig.1.1) as being associated with hereditary retinal disease by
RetNet, the Retinal Information Network (RetNet6; https://sph.uth.edu/retnet; available in the
public domain). The known genes are divided into many functional categories reflecting both the
complexity of the retina but also the stresses involved in the unique retinal environment with high
oxygen requirements and light exposure (Fig. 1.2).5

2

Figure 1.1. Mapped and identified retinal disease genes 1980-2016 (from RetNet 2017 6).

Figure 1.2. Functional categories of retinal disease genes (from Wright et al. 2010) 5.

1.2. THE EYE AND ANIMAL MODELS
To understand the underlying mechanisms of single-gene human retinal diseases, animal
models are used. Indeed, there is a high degree of homology between genomes and notably
mammalian genomes. Many of the human genes are also found in small animal models like
rodents (mice and rats) and large animal models like cats, dogs and primates.

3

1.2.1. General eye and retinal anatomy
1.2.1.1. General eye anatomy and development
The eye is a neurosensitive organ. It acts as the black box of a camera and the retina
located at the back of the eye as a sensitive film where the image forms (Fig. 1.3).

Figure 1.3. Schematic of the eye (from Hejtmancik et al.,2015).
The light rays go through the cornea, aqueous humor, lens and vitreous before focusing onto the
retina. The viewed object (here indicated as an arrow) will be projected onto the retina as an
inverted image, which will be converted into electrical impulse by the retina and transmitted to
the brain.7

The eye is composed from its front to its back by (Fig. 1.3 above):
The anterior segment including:
- the cornea, transparent structure at the front of the eye
- the aqueous humor in the anterior chamber
- the lens, structure which help to focus the light on the retina
- the posterior chamber between the lens and iris
- The iris and ciliary bodies
The posterior segment including:
4

- the vitreous
- the retina
- the choroid then sclera
The eye is linked to the brain by the optic nerve, which transmits the information transformed
from light to electrical impulse by the retina.

During prenatal development, the different structures of the eye come from the ectoderm
(neuroectoderm and surface ectoderm) or the head mesenchyme (neural crest and mesoderm).
The retinal pigmented epithelium, ciliary body and iridal epitheliums, the sensory retina and
innermost layer of the ciliary bodies (non-pigmented), the optic nerve, the iris sphincter and
dilator muscles and part of the vitreous originate from the neuroectoderm. The surface ectoderm
is at the origin of the lens, the corneal epithelium, the conjunctiva and caruncle, the eyelid skin
and the lacrimal apparatus (glands and drainage system). The rest of the structures originate from
the neural crest and/or mesoderm; blood vessels, corneal stroma and endothelium, stroma of the
choroid, ciliary body stroma and part of the iris, ciliary muscle, sclera, optic nerve sheath
(meninges), extraocular muscles and fasciase, remainder of the eyelids (i.e. orbicularis oculi
muscle, tarsus, orbital septum, etc…) and part of the vitreous (Figs. 1.4 and 1.5).7, 8

5

Figure 1.4. Schematic overview of vertebrate eye development (from Chow et al., 2001).9
In panels (A–D), presumptive or differentiated eye tissues are color-coded in the following
manner: blue, lens/cornea; green, neural retina; yellow, retinal pigmented epithelium
(RPE); purple, optic stalk (for explanation of why only the ventral region of optic stalk is
colored, see the text section on defining axes in the developing eye); red, ventral
forebrain/prechordal mesenchyme; grey, mesenchyme.
(A) Formation of the optic vesicle is initiated by an evagination (indicated by arrow) of the
presumptive forebrain region resulting in the formation of the optic pit (OP). The optic vesicle
region is divided into dorso-distal region (green), which contains the presumptive neural retina
(PNR) and RPE (not shown), and the proximo-ventral region, which gives rise to the presumptive
ventral optic stalk (POS); PLE, presumptive lens ectoderm; M, mesenchyme; VF, ventral
forebrain; PCM, prechordal mesoderm.
(B) Continued growth of the optic vesicle culminates with a period of close contact between the
lens placode (LP) and the presumptive neural retina (NR) during which important inductive
signal likely exchange: RPE, presumptive retinal pigmented epithelium; VOS, ventral optic stalk;
DOS, dorsal optic stalk.
(C) Invagination of the optic vesicle results in formation of the lens vesicle (LV) and neural
retina (NR) and establishes the overall structure of the eye. The point at which the neural retina
and RPE meet gives rise to components of the ciliary body and iris (C/I).
(D) Mature eye: C, cornea; LE, lens epithelium; LF, lens fiber cells; I, iris; CB, ciliary body;
GCL, ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer; ON, optic nerve.

6

Figure 1.5. Anatomy of embryonic mouse forebrain and eyes (from Heavner et al., 2012).10
(A) Frontal view of embryonic day E8.5 forebrain, just before the eye field splits. The optic sulci
are the large pits protruding from the ventral neural ectoderm. (B) Wide and (D) high
magnification views of frontal sections of the E9.0 to E9.5 optic vesicle. (E) The coordinated
invagination of the distal optic vesicle and the surface ectoderm, where the lens placode has
thickened, begins at E9.5. (C) Wide and (F) high magnification views of frontal sections of the
E10.5 optic cup and lens vesicle. The retinal pigment epithelium is the thin layer of cells
proximal to the neural retina, which is dorsal to the optic stalk. The optic stalk is continuous with
the ventral forebrain. The lens vesicle is distal to the neural retina. Dorsal is to the top (A–F), and
proximal is to the right (D–F). Scale bars, 50 mm (A); 100 mm (B, C). (Photo from Lee Langer)

1.2.1.2. General retinal anatomy and retinogenesis
The retina covers the back of the eye and extends from the optic nerve head to the ora
ciliaris. The retinal structure (Figs. 1.6 and 1.7) is composed of 10 layers of very specialized
cells. They include from its basal side (referred as “outer” structures) to the side in contact with
the vitreous (referred as “inner” structures):
- Retinal pigmentary epithelium (RPE),
- Photoreceptor outer and inners segments (Photoreceptor OS/IS),
- External limiting membrane (ELM),
- Outer nuclear layer (ONL),
- Outer plexiform layer (OPL),
- Inner nuclear layer (INL),
7

- Inner plexiform layer (IPL),
- Ganglion cell layer (GCL),
- Nerve fiber layers (NFL)
- Internal limiting membrane (ILM).

Figure 1.6. Representative photographs and images of a feline eye and retina.
The yellow arrows represent the light path that goes through the eye traversing the cornea,
aqueous humor, lens and vitreous before hitting the retina, which is the neural covering the back
of the eye. This structure is composed of 10 layers and most importantly the photoreceptor layer
composed of rod and cones, which is a structure that converted the light into electrical signal as
the level of the discs. The feline fundus image shows that in the dorsal region the feline eye has a
colored structure called the tapetum, which is thought to increase light exposure of the
photoreceptors; RPE; Retinal pigmentary epithelium; Photoreceptor OS/IS; Photoreceptor outer
and inners segments, ELM; External limiting membrane, ONL; Outer nuclear layer, OPL; Outer
plexiform layer, INL; Inner nuclear layer, IPL; Inner plexiform layer, GCL; Ganglion cell layer,
NFL; Nerve fiber layers; ILM; Internal limiting membrane, EZ; ellipsoid zone and IZ;
Interdigitation zone.
8

Figure 1.7. Schematic showing major retinal pathways and cells composing the retina (from
D’Orazi et al., 2014).11
Rod and cone photoreceptors detect changes in illumination, with rods functioning at low light
levels, and cones at high light levels. Photoreceptor signals are conveyed by bipolar cells to
retinal ganglion cells (RGCs). Cone bipolar cells (CBC) that largely contact cone photoreceptors
are grouped into two major subclasses. Light increments depolarize ON-bipolar cells and
hyperpolarize OFF-bipolar cells. ON and OFF synaptic connections are organized into separate
laminae within the IPL. Horizontal cells (HC) and amacrine cells (AC) modulate information
flow in the outer and inner retina, respectively. Rod bipolar cells (RBCs) predominantly convey
rod input, and contact AII amacrine cells (AII AC) that inhibit transmission from OFF-CBCs.

The development of the retina is called retinogenesis or retinal neurogenesis (Figs. 1.8
and 1.9). This phenomenon results in the formation of the layered retina, which is comprised of
three distinct cellular layers. From the exterior of the eye to the inside (side of the vitreous), those
cell layers include the outer nuclear layer containing the cell nuclei of the rod and cone
photoreceptor cells, the inner nuclear layer composed of the nuclei of the Müller, amacrine,
horizontal and bipolar cells and the neuronal layer formed by the nuclei of the ganglion cells. The
time for retinogenesis varies depending on the species, but overall they have the same order of
cell differentiation as illustrated for the mouse (Figs. 1.8 and 1.9).12, 13

9

The neurosensory retina consists of all retinal layers excluding the retinal pigment
epithelium, which is positioned external to the neurosensoryretina. Photoreceptors, which are
divided into rods and cones, are specialized cells that are responsible for the conversion of the
image focused onto the retina into an electrical message, which is then processed in the rest of the
retina and transmitted to the brain (Figs. 1.6 and 1.7). Cones are responsible for higher visual
acuity, daytime color vision, whereas rods are highly sensitive allowing for vision at low light
levels.
Retinogenesis is controlled by transcription factors and neurotransmitters that determine
the fate of retinal progenitors cells and lead to retinal cell differentiation. Retinal progenitor cells
undego specific mitosis and migration within the retina to end up differentiating to a specific type
of cells and fate. Ganglion cells, horizontal cells, cone photreceptor cells and amacrine cells
differentiate first while rod photoreceptor cells, bipolar cells and Müller glail cells differentiate at
a later time (Figs. 1.8 and 1.9).

Figure 1.8. Retinal neurogenesis proceeds in a fixed histogenetic order (time scaled from
mouse) (from Marquardt et al. 2002).13

10

Figure 1.9. Structural organization of the developing and adult vertebrate retina (from
Martins et al.,2008).14
(A) In early retinogenesis, the developing neural retina is composed of undifferentiated dividing
cells. These neuroblasts undergo a period of rapid cell division, which allows for the expansion of
the retinal progenitor cell pool. As observed throughout most CNS tissue, the nuclei of retinal
progenitor cells migrate up and down throughout the depth of the retinal tissue. S-phase occurs at
the basal surface, while mitosis occurs at the apical surface, adjacent to the retinal pigmented
epithelium (RPE). The nuclei migrate between these two surfaces during G1 and G2 in a process
called interkinetic nuclear movement (INM). The extracellular environment undergoes dramatic
changes as progenitor cells begin to exit the cell cycle. During neurogenesis the differentiating
cells (initially ganglion and amacrine cells) may release a variety of signaling molecules into the
environment, which may send feedback to modulate progenitor cell proliferation.
11

Figure 1.9 (cont’d)
(B) The mature vertebrate retina is mainly comprised of seven cell types (ganglion, amacrine,
horizontal and bipolar cells, cone and rod photoreceptors and the Müller glial cell), which are
organized into three cell layers. The proportion of the different cell types in the adult retina varies
dramatically (more than 100-fold). The generation of the correct proportions of each cell type is
crucial for visual function and depends on the appropriate control of proliferation and cell-cycle
exit. The approximate proportion of the retinal cell types in the mouse adult retina is shown.
(C) Retinal histogenesis follows an evolutionarily conserved birth order. For clarity, the
approximate timing and sequence of neurogenesis of the different retinal cell types during
development of the mouse, chick, rat, rabbit and human neural retinas are shown.

1.2.1.3. Specificities of the feline photoreceptor development
Although having similar retinogenesis, the feline retina has its own temporal specificities.
The first wave of cell differentiation during retinogenesis involves 3 cell classes: the
ganglion cells, cone photreceptor cells and horizontal cells. The amacrine cells then develop
followed by the rod photoreceptor cells, Müller cells then bipolar cells. The known details of the
timeline of the cat retina development and maturation are summarized in Fig. 1.10 below.15
It should be noted that a spatial/temporal difference in development exists and that a
central to peripheral maturation happens during feline retinal retinogenesis and maturation.
Indeed the cytogenesis first ceases in the area centralis and then in the visual streak (high
photoreceptor density areas that will be described in more detail later in the chapter).16, 17
Paralleling the retinal cells differentiation, the retinal vasculature also matures from the
center to the periphery. The inner vasculature development starts with the spread of mesenchymal
cells at E26; then by E48 some coarse capillaires have formed from those spindle cells, and
finally the major vessels differentiate and capillaries thinned. Starting at P7-10 and spreading to
the periphery, additional vasculature forms from the existing vasculature resulting in vasculature
of the area centralis inner layer, the outer layer vasculature and also to the capillaries surrounding
the optic papilla (which form at P20).18

12

Figure 1.10. Temporal differentiation and maturation of the feline retina. RPE; retinal
pigmentary epithelium, ELM; external limiting membrane; OS and IS; outer and inner
photoreceptor segments.15-17, 19-21

Concomittantly to morphological maturation, the feline retina, similarly to that of other
species, undergoes a functional maturation, which can be followed by the electroretinogram
(ERG) that assesses the retinal response to a light stimulus. Two types of regular ERG are usually
assessed, the dark-adapted or scotopic ERG (where the animal is dark adapted; we allow one
hour in our laboratory) and the light-adapted or photopic ERG (where the animal is adapted in a
ganzfeld dome to a rod suppressing backgound light of 30 cd/m2 light for 10 min) (Fig. 1.11, left
image). Scotopic ERG are used to assess rod photoreceptor at low light stimulus luminances
13

while assessing a mixed rod and cone responses at stronger light stimuli. The photopic (lightadapted) ERG is used to assess cone photoreceptor function. Alternating current (AC) ERGs are
recorded using three electrodes. A recording electrode which can be an electrode on the cornea
(Fig. 1.11, right image) or in some research settings an intraocular electrode may be used. A skin
reference electrode is positioned adjacent to the lateral canthus, between the eyes or on the
conjunctiva/lid. A ground electrode is usually a skin electrode placed on the forehead, on the
occiput or between scapulas. The electrode positioning can be different depending on the
laboratory protocol.

Figure 1.11. Positioning of a cat for ERG. Left image: The image shows a cat with its head in
a ganzfeld dome during light adaptation. Right image: The image shows the positioning of a
corneal Burrian Allen bipolar electrode lens on a cat where the white part is a speculum, which is
painted with silver paint that contacts the lids and conjunctiva and acts as the reference electrode
and the wire loop on the cornea is the active electrode.

The individual components of the ERG response were first described by Granit in 1933
(Fig. 1.12, corneal recording).22 In a simplified description, the direct current (DC) ERG response
consists of three main components: the a-wave, the b-wave and the c-wave (Fig. 1.12). The awave component (representing the leading edge of the PIII wave) is a negative deflection
representing the hyperpolarization that the photoreceptors undergo during light stimulation. More
14

precisely the a-wave results from the elimination of the “dark current” as the photoreceptors
hyperpolarize in response to light induced closure of cyclic GMP-gated channels. The b-wave
component (predominantly shaped by the P II response) is a positive deflection that results from
the depolarization of the ON-bipolar cells. The c-wave is a slower wave due to the summation of
the P II and P III waves coming from the retinal pigmentary epithelium cells (RPE). This is
present in ERGs recorded under DC conditions but not in the more commonly used AC recording
as shown in Fig. 1.13).23

Figure 1.12. Analysis of composite retinal action potential at two intensities from a cat
retina (from Granit, 1933).22 The typical ERG is represented in full trace while the different
components P I, P II and P III are represented in dotted tracings. The light stimilus is 2 seconds as
shown on the lower scale (On-Off).

15

Figure 1.13. Typical feline dark-adapted ERG waveform and its origins. The a-wave
predominantly results from the hyperpolarization of the photoreceptor cells while the b-wave
originates from the depolarization of the ON-bipolar cells. The amplitude of the a-wave is
measured from the baseline to the peak of deflection while the b-wave amplitude is measured
from the deflection of the a-wave to the its own positive deflection peak. For both a- and b-waves
the implicit times are measured from the light stimulus to their deflection peak.

The feline retina physiological development follows and is related to anatomical
differentiation. Scotpic ERG (dark-adapted) of the cat was reported in more detail in 1980’s
literature and is characterized below.24
Functional development of the feline retina as assessed by the ERG can be divided into 3
stages. The first stage is a slow phase during the first few postnatal weeks during which the late
receptor potential (slow recovering portion of the PII wave; reflecting the recovery stage to the
absorption of light by the disk membranes) and the b-wave first develop.23 The second stage
occurs more rapidly and is characterized by an increase in b-wave amplitudes and the appearance
of oscillatory potentials (which are a series of small high frequency wavelets that are present
surimpposed to the ascending limb of the b-wave thought to be originated from amacrine cell in
the inner retina with a potential ganglion cell component).23 The last stage is slower and results in
16

the full maturation of the retina and is correlated to the end of the morphological differentiation
of the retina and development of full neuronal connections. Similarly to the different specialized
retinal cell types, the different ERG components reach maturation at different ages.
A more precise description of the maturation of the feline ERG follows: At 3 weeks of
age, the kitten ERG is not yet mature. At low intensities only there is a late photorecepor
potential negative wave, and at higher intensities an a-wave and b-wave can be distinguished but
do not have an adultlike waveform shape. By 4 weeks of age, the ERG waveform is adultlike in
shape, however, the a-wave is still more prominent than the b-wave, with the b-wave having a
lower amplitude and longer implicit time. From 5 weeks and over the following weeks, the bwave amplitude increases although it is still decreased compared to adulthood at low light stimuli
(Fig. 1.14). By 10-12 weeks of age, amplitudes are adultlike. Similarly to the maturation of the
ERG amplitudes, the b-wave implicit time shortens with age to reach maturation at
approximately 10 weeks of age. On a side note, the oscillatory potentials, a waveform that
originates from amacrine cells in the inner retina, are comparable to those of adults by 18 weeks
of age.
The photopic (light-adapted) ERG seems to mature differently to that dark-adapted ERG,
with some b-wave responses becoming higher in amplitude than adult waveforms and then
stabilizing to similar amplitudes to adults by around 14 weeks of age. The impliticit time reaches
maturation around 11.5 weeks of age.25

17

Figure 1.14. Examples of the ERGS recorded from kittens of different ages in response to a
long stimulus of light (from Hamasaki et al., 1985).24
The numbers on the left represent the value of the neutral density filters used to attenuate the full
intensity stimulus. At 0, luminance = 1.1 x l04 cd/m2. The 50 µV calibration scale for 3 and 4
weeks apply to all intensities. The up arrow shows when the stimulus was turned on, and the
down arrow shows when the stimulus was turned off.

1.2.2. Specificities in globe and retinal anatomy in large animal models compared to
small animal model and humans
Rodents are small animal models that are commonly used to investigate phenotype,
disease mechanisms and test therapies.26 Yet, although rodents have provided a lot of information
on retinal disease mechanisms, they have some important differences from humans in their eye
structure and retina i.e. especially in the distribution of their photoreceptors density. The eye of
rodents is very small compared to the human eye (Fig. 1.15), and they have a relatively large lens
that occupies most of the posterior part of the eye making the development of surgical techniques

18

more difficult for therapy trials. Also, their retina differs in distribution of cones and rods
compared to the human retina (as detailed in the following paragraphs).27
Large animal models like the cat and dog have the advantages that they present
similarities to humans with comparable eyes’ size and anatomy. They possess eyes that have a
closer structure to the human eye with similar globe and vitreous chamber sizes (Fig. 1.15).

Figure 1.15. Schematic of the human, dog, mouse and cat eye.
Left panel: Human (A-left), dog (B-center) and mouse (C-right) eye schematic (from PetersenJones et al., 2012 27). Right panel: The schematic eye in the cat (from Vakkur et al., 1963).28
This figure gives the physical dimensions of the feline adult eye.

In general, rods are distributed across the entire retina and represent the majority of
photoreceptors in many mammalian species, e.g. 94-97% in human and mouse retinas.29-33 In
contrast, cone ratio, subtypes and distribution (mosaic patterns) vary significantly among
mammalian species.31, 34-36 The human retina contains three cone subtypes: red (long wavelength,
or L), green (medium wavelength or M) and blue (short wavelength or S) based on the specific
cone opsin expressed.37, 38 These cones are highly enriched in a central retinal region called the
macula with a cone-only center the fovea, which is essential for visual acuity.39, 40 In contrast,
rodents like the mouse lack a centralized cone-rich region. The mouse retina contains a dorsal-to-

19

ventral distribution gradient of M versus S-cone subtypes with some dual expression cones in
their central retina (Fig. 1.16).34 Thus, despite being a commonly utilized model species, which
can be genetically well-controlled and have a high cone and rod-density 41, the mouse may not be
the best model for human cone development and associated diseases due to its lack of marked
regional differences in cone density. In contrast, large animal models such as dogs and cats
similarly to humans have marked difference in photoreceptor density and have a central
photoreceptor-rich region called the “area centralis”, which has a high localized cone-density
similar to that of the human macula.32, 42-46

Figure 1.16. Photoreceptor cells distribution in the mouse retina.
Left panel: This figure shows the homogenous distribution of cones and rods dorsally and
ventrally and compares their density to other cell types.31 Right panel: This figure shows the
distribution of M- and S- cones subtypes in the mice. Dorsally cones only express M-opsin while
ventrally they only express S-opsin. Centrally the mouse cones have been shown to express both
M- and S-opsins.34
20

As humans have a macula and fovea, the feline and canine retina is characterized by a
regional difference in photoreceptor density with similar proportions of cone and rod
photoreceptors and the presence of a high-density photoreceptor area – the area centralis (region
dorso-temporal to the optic nerve) and the visual streak (Fig. 1.17).

Figure 1.17. Images of a feline and a human right eye fundus.
Left image: The image shows the fundus of an adult cat. The area centralis is indicated at the tip
of the black arrow and is situated dorso-temporally to the optic nerve. The visual streak is a
region situated longitudinally dorsal to the optic nerve going nasally to temporally. Right image:
The image shows the fundus image of an adult human. The fovea is indicated at the tip of the
white arrow at the center of the region called macula (darker area surrounding the fovea).

The area centralis is comparable to the human macula due to its very high cone density.
In the cat, as in humans, the majority of photoreceptors are rods, with cones only accounting for
~9-10% of photoreceptors in the area centralis and ~5% or less in the peripheral retina.32, 47 Cats
present with only two cone subtypes, red-green (medium-long wavelength, or ML), and blue
(short wavelength or S) based on the specific cone opsin expressed.44 ML cones represent the
majority of cones and are highly concentrated in the area centralis while the S cones have a
higher concentration in the ventro-temporal area of the retina. As previously stated, the area
centralis contains a high density of cones (and rods) – similar to the human macula (Figs. 1.18
21

and 1.19). The center of the area centralis of the cat is reported to have ~26,000-27,000
cones/mm2 and 275,000 rods/mm2 with a peak of 460,000 rods/mm2 at 10-15° from the region of
maximum cone density.32, 43, 44 The human macula has a fovea with maximum cone density of
between ~115,000 to ~227,000 cones/mm2 with a mean of ~164,000 cones/mm2 and a lack of
rods. The area surrounding the fovea has fewer cones and a peak of 160,000 rods/mm 2 at 18°
from the fovea.30, 48-50

Figure 1.18. Schematic diagrams of cone distributions in a retinal wholemount of normal
cat (from Linberg et al., 2001).44
(A) Total cone density. A sharp peak of just under 28,000 cones/mm2 was counted at the area
centralis. Cone densities declined rapidly away from this central region, though more slowly
along the horizontal nasotemporal axis wherein a smear of higher density is found. One site at the
far inferior periphery had the lowest total cone density of 3,100/mm2.
(B) Medium wavelength (M)-cone density. Because M-cones predominate in the cat’s retina, the
isodensity map for M-cones closely parallels that of total cones.
(C) S-cone density. The robust fluorescence of labeled S-cone outer segments facilitated density
counts. Peak S-cone densities lie at the far periphery, at the area centralis itself, and in the central
portions of the inferior hemiretina. Lowest S-cone densities occur in a broad region across the
superior retina outside the area centralis.
(D) Percent S-cones. A low S-cone percentage is typical for most of the central superior retina,
whereas a broad expanse of the inferior hemiretina contains the highest S-cone percentages. S,
superior; T, temporal; N, nasal; I, inferior.

22

The higher density of photoreceptors and in particular cones in the area centralis of the
cat makes it important as a model for the study of conditions where the degeneration tends to be
cone-led. This is an advantage over mouse models where a central region of high photoreceptor
packing is not present. Therefore, the cat represents a good model for human retinal diseases as
for its photoreceptor distribution compared to the small animal models like the mouse. This
characteristic makes such models valuable for understanding human retinal diseases and
developing therapeutic approaches, such as adeno-associated virus (AAV)-mediated gene
therapy.51-54

Figure 1.19. Photoreceptor cell densities in the cat and human (from Steinberg et al., 1973)32
Left panel: The figure shows the densities of rods and cones in the cat (0 is the position of the
area centralis). Right panel: The figure shows superimposed the cone density in the area
centralis of a cat and the cone density in the fovea of a human.

23

1.2.3. Cat large animal models in retinal hereditary research
Large animal models of inherited retinal degenerations such as dogs, cats, pigs and even
sheep play an important role as models for the comparable conditions in humans. They typically
have mutations in the homologous gene.55-59 Over the last decade, the dog model has proven to be
particularly useful because of the spontaneous occurrence of several different forms of inherited
retinal degenerations such as retinal dystrophies caused by mutation in the RPE65, PDE6A,
CNGB1 genes. The different dog models (summarized in Petersen-Jones et al, 2015)57, 60 have
proven valuable in the investigation of disease mechanisms but also in the assessment of
promising therapeutic interventions including gene augmentation therapy, drug therapy and
optogenetic approaches. More recently the cat has emerged as a source of valuable spontaneous
IRD models.55 This was possible due to the advance in mapping genetic traits in cats. 61,

62

Spontaneous mutations in four different genes that cause early onset IRD in humans, classified
most commonly as Leber congential amaurosis, have been identified and studied. Spontaneous
mutations in Cep290, Crx, Aipl1, Kif3b genes have been described. Those mutations are
responsible for LCA like phenotype. The mutations in the Cep290 gene is known to be a major
cause of recessive LCA in humans (about 20%), Crx (3%) which results in a variety of typically
dominant IRDs, most commonly LCA (see following text), Aipl1 (4-8%) and Kif3b which results
in a recessive LCA phenotype.63-66 Contrary to the other 3 models, the Cep290 feline models
show a slow progressive retinal dystrophy phenotype, while the Crx and Aipl1 show a rapid
retinal dystrophy phenotype. The Kif3b phenotype is also relatively rapid but a bit slower than the
latter two.

24

1.3. RETINAL DEVELOPMENT AND TRANSCRIPTION FACTORS
Gene expression is most commonly regulated at the transcription level, which is the
process of transcribing DNA (deoxyribonucleic acid) to mRNA (messenger ribonucleic acid).
The transcription is regulated by the enzyme RNA polymerase, which using the gene’s DNA
template catalyzes the synthesis of RNA. Associated with proteins the transcription factors
control the RNA polymerases function during the initiation. Transcription consists basically of
three steps: the initiation step in which the RNA polymerase binds to a specific DNA sequence
called the promoter, the elongation i.e. the step where the RNA is synthesized using the DNA as
a template, and the termination step in which the RNA polymerase separates from the DNA
strand when it recognizes the transcription termination sequence.
Transcription factors 67, 68 are proteins generally acting in multi-subunit protein complexes
that lead to a specific expression during development and homeostasis of each gene in different
cell types by initiating and regulating gene transcription. Therefore, transcription factors are
essential for normal development, dictating individual cell fate and regular cellular functions.
Transcription factors can activate or repress the transcription of a gene; they are essential in
controlling whether the gene is functional at a given time. They are essential during the cell cycle
by determining the genes’ activity and also are used by cells to respond to extracellular stimuli
and signals from the environment or other cells.
Transcription factors function in the nucleus, where the genomic DNA containing genes is
located, and nuclear transport (i.e., import or export) of transcription factors can influence their
activity. Another important general mechanism controlling the activity of transcription factors is
post-translational modification such as phosphorylation. Finally, in addition to controlling the
genes and transcription of other transcription factors, these protein complexes can also control the
genes responsible for their own transcription, leading to complex feedback control mechanisms.
25

Structurally, transcription factors are characterized by the possession of DNA-binding domains.
Transcription factors can bind to RNA polymerase in which case they are called basal
transcription factors; examples include TFIIA, TFIIB, TFIID/TATA-BOX binding protein (TBP),
TFIIE, TFIIF, and TFIIH. Alternatively, they can bind to another transcription factor or cis-acting
DNA sequences. More precisely, transcription factors are necessary for the RNA polymerases to
recognize sequences to transcribe; they can be activated or repressed by other proteins and can
bind to DNA at specific sequences called promoter or enhancers that regulate transcription.
The homeobox genes, which are about 180 base pairs long, encode for transcription
factors. They consist of a family of over 200 similar genes directly involved in critical steps
during embryonic development such as structural pattern development (i.e. limb formation or
front to back axis). The transcribed proteins contain a homedomain, which consists of about 60
amino acids with a helix-turn-helix structure. The homedomain, exclusively found in eukaryotes,
has the ability to bind to DNA or RNA specific regulatory target sequences in genes. Most
proteins that possess a homedomain are transcription factors and therefore have the ability to
control gene expression by binding to promoters or enhancers or regulatory sequences and so
induce cascade events necessary for development. This explains why mutations in homeobox
genes can have dramatic consequences on development.
Transcription factor genes include retinal transcription factors involved in the eye
development like PAX6 and more specifically in retinal development factors such as OTX2,
NR2E3, NRL and the cone-rod homeobox (CRX) gene (Fig. 1.20).

26

Figure 1.20. The complexity of transcriptional regulation (from Boije et al., 2014).69

There are 6 main transcription factors that lead the photoreceptor precursor to form either
a rod or a cone: the homeobox protein OTX2, the cone–rod homeobox protein CRX, the neural
retina leucine zipper protein NRL, the photoreceptor-specific nuclear receptor NR2E3, the
thyroid hormone receptor β2 TRβ2 and the nuclear receptor RORβ (Fig. 1.21).70-72

27

Figure 1.21. Model for transcription factor network regulation of photoreceptor subtype
development (from Hennig et al, 2008).70

OTX2, the Orthodenticle Homeobox 2 is responsible for the commitment to a
photoreceptor fate by being a key regulator of the photoreceptor lineage. It intervenes during
final mitosis in retinal progenitors and in early precursors. CRX, the cone-rod homeobox is
responsible for the terminal differentiation of photoreceptors. It is also expressed in mature
photoreceptor and bipolar cells. CRX is expressed early in post-mitotic photoreceptor precursors
and acts downstream of OTX2. CRX is essential for terminal differentiation of rods and cones
and is an enhancer for photoreceptor-specific genes expression. NRL, Neural retina-specific
leucine zipper protein is responsible for rod photoreceptor fate. NRL interacts with CRX and
many other transcription factors and induces the expression of rod-specific genes. NR2E3, the
photoreceptor-specific nuclear receptor is a repressor of cone gene expression and with NRL and
28

CRX, it activates rod genes. RORβ, the orphan nuclear receptor is a transcription factor that is
expressed in all cell layers of the neural retina and in the pineal gland. It regulates the
development of both cones and rods. In addition to being essential to photoreceptor outer
segment formation, RORβ is necessary for the development of inner nuclear and synaptic layers.
TRβ2, the thyroid hormone nuclear receptor regulates the development of the M cone and plays a
role in the cone opsin retinal patterns.70, 71, 73

1.4. CRX-LCA INHERITED RETINAL DISEASE
1.4.1. Leber Congenital Amaurosis (LCA)
LCA is an inherited retinal disease with childhood onset, which leads to very severe
visual impairment or blindness. It was first described by Theodor Karl Gustav von Leber.74 LCA
is the most severe form of the photoreceptor dystrophies and accounts for ~5% of all inherited
retinopathies with a prevalence of about 1 in 30,000 to 81,000 newborns.75-78 Clinical signs of
LCA include wandering nystagmus, delayed and very decreased pupillary light reflexes and
absent or severely reduced ERG responses. Additional clinical signs described include fundus
changes, keratoconus, cataracts, changes in refraction, sensitivity to light and a behavioral
oculodigital sign in young children. 74, 79
Known genes harboring mutations causing LCA are summarized in Table 1.1 and Figs.
1.22 and 1.23.
Leber
congenital
autosomal dominant
Leber
congenital
autosomal recessive

amaurosis,

CRX, IMPDH1, OTX2

amaurosis,

AIPL1, CABP4, CEP290, CLUAP1, CRB1, CRX, DTHD1,
GDF6, GUCY2D, IFT140, IQCB1, KCNJ13, LCA5,
LRAT, NMNAT1, PRPH2, RD3, RDH12, RPE65,
RPGRIP1, SPATA7, TULP1, MERTK (ALMS, CNGA3,
MYO7A, BBS4)

Table 1.1. Identified retinal genes in which mutations can be responsible for LCA.6, 79, 80
29

Figure 1.22. Cumulative number of identified LCA genes (from Den Hollander et al., 2016).80
During the past 20 years, more than 20 genes have been identified for LCA through a candidate
gene approach, by homozygosity mapping, or, more recently, using exome sequencing.

Figure 1.23. Main LCA causing-genes: their spatial expression and their prevalence
importance (from Den Hollander et al., 2008).81
Left panel: this figure shows the LCA causing-genes can be grouped according to nine different
retinal functions. BB, basal body; CC, connecting cilium; OLM, outer limiting membrane; OS,
outer segments; PR, photoreceptor. Right panel: This figure shows that among LCA causinggenes the CRX gene represents only a small prevalence.

30

1.4.2. CRX transcription factor
CRX encodes an OTX-like homeodomain transcription factor essential for photoreceptor
development, maturation and survival.82-85 It plays a major role at the center of a network of
photoreceptor transcription factors controlling the maturation of photoreceptor progenitor cells
during retinal development and maintenance of transcription in differentiated photoreceptors.70, 86
The CRX gene is well-conserved among species. In humans it encodes a 299 amino acid
protein, which as with other transcription factors has two characteristic domains: a DNA binding

39

P263d1

L237d1
V242M

G217d1

WSP

Homeodomain

1

Y191d1
A196i1
A196d4

L146d12
A158T
E168d1
E168d2 DN

R115Q
G122D

A56T

R41Q
R41W

P9i1
H10D

1.24).87

V66I
E80A
E80L
R90W LOF

domain (homeodomain) near its N-terminal and a transactivation domain at the C-terminal (Fig.

98

OTX

161 170

DNA binding and dimerization

299

284 295

Transactivation

Figure 1.24. CRX transcription factor structure (Courtesy Dr Shiming Chen).87

As described above, CRX directly regulates several major genes involved in normal
retinal function, including many key components of the phototransduction cascade and the CRX
gene itself, by binding to the target gene’s regulatory elements and interacting with co-factors.82,
88-91

As being a transcription factor, the wild-type Crx protein is believed even at a very low level

to have an impact on the production of other proteins; proteins encoded by a gene containing a
binding site for Crx. For example, impairment of the proper transcription rate of CNGA3 and
KNCV2 genes can have an effect on phototransduction. Similarly, altered production of ABCA4
protein could lead to inefficient visual cycle function (recovery of the photopigment necessary for
phototransduction). Crx also has a binding site on the gene encoding for structural proteins such

31

as PROM1 or for proteins essential for proper transport through the photoreceptor connecting
cilium (i.e. RPGRIP1 or AIPL1) (Tables 1.2 and 1.3, Fig. 1.25). In mice, Crx binds to 48 genes
within the retinal cells. It binds to promoters for genes encoding for proteins essential in
phototransduction (Cnga3, Cngb3, Gnat2, Opn1mw, Opn1sw, Rho, Grk1, Kcnv2), the visual
cycle (Abca4), transport processes within the photoreceptor (Aipl1, Rpgrip1, Tulp1, Unc119) and
development and formation of the normal structure of the photoreceptor (Crx, Nrl, Nr2e3, Prom1,
Prph2) (Tables 1.2 and 1.3, Fig. 1.25).91

Mouse Gene
symbol
Cnga3
Cngb3
Gnat2
Opn1mw
Opn1sw
Pde6c
Gnat1

Expression
(BioGPS)
Retina (cones)
Retina (cones)
Retina (cones)
Retina (cones)
Retina (cones)
Retina (cones)
Retina (rods)

Pde6b

Retina (rods)

Rho
Grm6
Cerkl
Rbp4
Rdh12

Retina (rods)
Retina (BP)
Retina (RGC)
RPE
RPE

Disease
Achromatopsia 2
Achromatopsia 3
Achromatopsia 4
Colorblindness Deutan
Colorblindness Tritan
Cone Dystrophy 4
Congenital Stationary Night Blindness Autosomal
Dominant 3
Congenital Stationary Night Blindness Autosomal
Dominant 2, Retinitis Pigmentosa 40
Retinitis Pigmentosa 4
Congenital Stationary Night Blindness Type 1B
Retinitis Pigmentosa 26
RPE Degeneration
Leber Congenital Amaurosis 13

Mode
ar
ar
ar
X
ad
ar
ad
ar
ad, ar
ar
ar
ar
ar, ad

Table 1.2. Genes which contain a CRX-binding site revealed by ChIP seq that are known to
be expressed in specific retinal cells (modified from Corbo et al., 2010)91 (ar; autosomal
recessive, ad; autosonomal dominant, X; X-linked).

32

Mouse Gene
Expression
symbol
(BioGPS)
Abca4
Retina
Aipl1
Cabp4
Cacna1f
Cnga1
Crb1

Retina
Retina
Retina
Retina
Retina

Crx

Retina

Elovl4
Fscn2
Gpr98
Grk1
Guca1a
Guca1b
Kcnv2
Lca5
Nr2e3
Nrl
Nyx
Pde6a
Pitpnm3
Prcd
Prom1

Retina
Retina
Retina
Retina
Retina
Retina
Retina
Retina
Retina
Retina
Retina
Retina
Retina
Retina
Retina

Prph2
Rbp3
Rd3
Rgs9
Rgs9bp
Rom1
Rp1
Rpgrip1
Rs1
Sag
Trpm1
Tulp1
Unc119

Retina
Retina
Retina
Retina
Retina
Retina
Retina
Retina
Retina
Retina
Retina
Retina
Retina

Disease

Mode

Cone-Rod Dystrophy 3, Retinitis Pigmentosa 19,
ar
Stargardt Disease 1
Leber Congenital Amaurosis 4
ar, ad
Congenital Stationary Night Blindness Type 2B
ar
Congenital Stationary Night Blindness Type 2A
X
Retinitis Pigmentosa 41
ar
Leber Congenital Amaurosis 8, Retinitis Pigmentosa
ar
12
Cone-Rod Dystrophy 2, Leber Congenital Amaurosis
ar, ad
7
Stargardt Disease 3
ad
Retinitis Pigmentosa 30
ar
Usher Syndrome Type 2C
ar
Oguchi Disease 2
ar
Cone Dystrophy 3
ad
Retinitis Pigmentosa 48
ad
Retinal Cone Dystrophy 3B
ar
Leber Congenital Amaurosis 5
ar
Retinitis Pigmentosa 37
ar, ad
Retinitis Pigmentosa 27
ad
Congenital Stationary Night Blindness Type 1A
X
Retinitis Pigmentosa 43
ar
Cone-Rod Dystrophy 5
ad
Retinitis Pigmentosa 36
ar
Macular Dystrophy 2, Stargardt Disease 4, Retinitis
ad, ar
Pigmentosa 41
Retinitis Pigmentosa 7
ad/digenic
Retinitis Pigmentosa
ar
Leber Congenital Amaurosis 12
ar
Bradyopsia
ar
Bradyopsia
ar
Retinitis Pigmentosa 7
ad/digenic
Retinitis Pigmentosa 1
ar
Leber Congenital Amaurosis 6
ar
X-Linked Retinoschisis
X
Retinitis Pigmentosa 47
ar
Congenital Stationary Night Blindness 1C
ar
Retinitis Pigmentosa 14
ar
Cone-Rod Dystrophy
ad

Table 1.3. Genes containing a CRX-binding site revealed by ChIP seq that are known to be
expressed in the retina (modified from Corbo et al., 2010)91 (ar; autosomal recessive, ad;
autosonomal dominant, X; X-linked).

33

Figure 1.25. Schematic representation of the roles in cones of the proteins that are encoded
by genes with a CRX-binding site (modified from Roosing et al., 2014).92
Proteins which are encoded by genes with a CRX-binding site are indicated by a light red oval
shape.

As previously described in detail, CRX is a photoreceptor-specific transcription factor
(TF) essential for normal photoreceptor development with a major role in the differentiation of
multipotent progenitor cells to photoreceptors precursors then to photoreceptor subtypes, but it
also plays an invaluable role in photoreceptor function maintenance and survival. CRX is also
expressed in the pineal gland.70
The essential role of CRX at an early stage of photoreceptor development and also for
maintenance of photoreceptors in the mature retina explains why CRX mutations result in a
spectrum of retinopathies. They are typically dominantly inherited due to a dominant negative
34

effect of the mutated protein that is expressed in many instances. The phenotypes vary in severity
and are responsible for 4 major phenotypes: Leber congenital amaurosis (LCA) a childhood onset
of blindness, cone-rod dystrophy (CoRD), retinitis pigmentosa (RP) and macular dystrophy.87,93
Mutations in the CRX gene have been reported to account for just approximately 2-3% of LCA.94
LCA caused by CRX mutations is classified as LCA type 7.

1.3. CRX mutation classifications
Recent studies have utilized both spontaneous animal models with Crx mutations (2
mouse models) as well as two engineered mouse models of some human CRX mutations to
understand the mechanisms of how the mutations cause disease and to explain the variation in
phenotype severity. Human CRX mutations have been classified into four classes based on
disease mechanism, more specifically on the mutation type and the functional characteristic of
the resulting mutant protein with the existing animal models representing 3 of the classes.87 Class
I and II mutations result from missense mutations in the homeodomain while Class III and IV are
frame-shift or nonsense mutations (Fig. 1.26).87

35

Figure 1.26. Human mutations schematic and animal models mutations (from Tran et al.
2014).87

Missense mutations in the homeodomain (Classes I and II) lead to milder phenotypes
while frameshift or nonsense mutations in the activation domain (Classes III and IV) cause a
severe phenotype.87
The first two CRX mutation classes include missense mutations located in the DNA
binding domain. Class I mutations are hypomorphic mutations where the resulting mutant protein
has a reduced DNA binding ability but does not interfere with the wild-type protein, while Class
II mutations are antimorphic mutations which interfere with wild-type CRX and have variable
DNA binding properties. The R90W mouse model (CrxR90W knockin; Arg90Trp substitution
mutation in the CRX homeodomain) has been developed as a model of Class I mutations. The
mutant protein has decreased binding ability for the rhodopsin promoter, which is a well-known
target of CRX. The Class I mutations cause later-onset disease; the R90W mouse model has a
milder phenotype and the Crx knockout mouse when heterozygous shows only a slight delay in

36

photoreceptor development. Taken together this indicates that the more severe disease
phenotypes are not simply the result of haploinsufficiency. In contrast, the predicted Class II
mutations have a more severe phenotype predicted to result from interference with the wild-type
CRX protein. There are currently no animal models for the Class II mutations.
Class III and IV mutations consist of frameshift and nonsense mutations in the activation
domain of the CRX protein and have antimorphic effects. Class III mutations lead to the
production of a truncated protein with intact DNA binding abilities while Class IV mutations
show reduced DNA binding. The E168d2 mouse model (CrxE168d2 knockin; Glu168del2
frameshift mutation in the CRX activation domain) is a model of Class III mutations. The CrxRip
mouse model (spontaneous mouse model; Gly255del1 frameshift mutation in the CRX activation
domain) is a model of Class IV mutations, but at present no human equivalent mutations have
been reported. Studies of the R90W (Class I) and E168d2 (Class II) mutant mice have shown that
the more severe phenotypes result from a dominant negative effect of the expressed mutant
transcript causing misregulated gene expression in many pathways critical for photoreceptor
structure, function and survival. This is supported by the fact that E168d2 mouse from which a
neomycin resistance cassette had not been excised had a lower expression level of the mutant
allele and had a milder phenotype than the model in which the neomycin cassette had been
excised. Taken together these findings indicate that the phenotypic variations seems to be related
to the molecular structure and binding ability of the CRX mutant protein (Fig. 1.27 and Table
1.4).87, 95

37

Figure 1.27. Schematic diagram of wild-type (WT) and mutant CRX proteins made by the
indicated mouse models (from Ruzycki et al., 2015).87, 96, 97
The WT CRX protein shown on the top is 299 amino acids (A.A.) in length and contains the
indicated DNA-binding and transactivation domains (indicated by bars above the diagram) and
several conserved motifs (marked by solid grey and black boxes). The substitution
mutation R90W lies within the homeodomain and reduces DNA-binding. The frameshift
mutation E168d2 results in a C-terminus truncated CRX protein that retains DNA-binding
capability but fails to activate transcription, and is, therefore, antimorphic. The frameshift
mutation G255d1 ‘Rip’ results in a non-homologous C-terminal extension (dark grey hashed
box), creating an antimorphic protein that no longer binds DNA.

Mutation
Class

CRX
expression

Rod

Cone

Function

Degeneration

Function

WT

NA

+

++++

Undetectable

R90W/+

I

+

++++

E168d2
Neo/+

III

+

E168d2/+

III

Rip/+
-/-

Degeneration

Disease
model

Phenotype
severity

++++

Undetectable

NA

NA

Undetectable

++++

Undetectable

CoRD

Mild

+++

Undetectable

++

≥ 1year

CoRD

Moderate

++

++

1-6 months

+

1 month

LCA

Severe

IV

+

-

1-18 months

-

Undetectable

LCA

Null

-

-

1-3 months

-

Undetectable

LCA

E168d2/
d2

+++

-

1-3 months

-

Undetectable

LCA

R90W/W

+/-

-

1-3 months

-

Undetectable

LCA

Rip/Rip

+/-

-

1-9 months

-

Undetectable

LCA

Mouse

Very
severe
Very
severe
Very
severe
Very
severe
Very
severe

Table 1.4. Phenotype summary of heterozygous Crx mutant mice (from Tran et al., 2014,
Roger et al., 2014 and Ruzycki et al., 2015)87, 96, 97
CRX expression is based on quantitative Western blots. Rod and cone function is based on ERG
peak amplitudes. Phenotype severity is based on morphological and functional deficits.
The effect of Crx mutations on expression levels of photoreceptor genes has been
investigated in some of the mouse models (Figs. 1.28 and 1.29).95, 96
38

Figure 1.28. Changes in phototransduction photoreceptor-specific gene expression of
Crx mutant mice retinas photoreceptor-enriched genes involved in phototransduction (changes
assessed by RNAseq) (from Ruzycki et al., 2015).96

Figure 1.29. Model of how Crx mutation-caused gene expression changes affect rod and
cone development (from Ruzycki et al., 2015).96
The left panel describes the formation of cones in a subset of the Crx mutants and variable levels
of those cells’ expression of phototransduction genes. The right panel shows how development
of rods in all models is related to their gene expression changes. It also emphasizes the novel
findings that Crx mutant rods display a graded phenotype of both the decreased expression of
proper rod genes, and the mis-expression of cone genes.
39

The initial phenotypic description and investigation of mode of inheritance of the CrxRdy
mutant cat was published in 1985 by Roger Curtis and Keith Barnett.98 This was followed by
publications that described the condition as an autosomal dominant retinopathy and more
specifically a rod-cone dysplasia. These authors gave the mutant mode the name Rdy (rod-cone
dysplasia) cat. This name has been maintained although the condition was subsequently shown to
be a cone-rod dysplasia.
The CrxRdy cat phenotype is also comparable to human and E168d2 mouse model
phenotype with retinal dystrophies caused by similar-type mutations making the CrxRdy cat an
excellent model for studying severe human LCA7 (LCACRX) phenotype. Similarly to LCA7
patients and the E168d2 mouse model with the severe phenotype, studies revealed that the
heterozygous CrxRdy/+ cats have a severe, early-onset dominant photoreceptors dystrophy with
cones being affected more severely. The CrxRdy/+ kittens show signs of retinal disease as early as
4-5 weeks of age at which time they have moderate mydriasis and nystagmus. Abnormal
pupillary light reflexes (PLR) are noticed as early as 6 weeks of age and changes in fundus
appearance first appear as a discoloration in the region of the area centralis. With disease
progression with age retinal atrophy with superficial retinal vascular attenuation develops.
Histologically, the CrxRdy/+ kittens show a failure of photoreceptor maturation with photoreceptor
degeneration starting in the region of the area centralis (macula-like region). Photoreceptors are
shortened, with sparse and dystrophic outer segments, which do not develop further with age.
Inner photoreceptor segments degeneration as well as retinal thinning and photoreceptor nuclei
death develop with disease progression. There is mislocalization of opsins to the inner
photoreceptor segments, outer nuclear layer and up to the photoreceptor synapse terminal in the
outer plexiform layer. Affected cats also showed a significant increase in glial fibrillary acidic
protein (GFAP) expression in Müller cells. Accompanying those cellular and morphologic
40

changes, the CrxRdy/+ kitten has severely reduced visual function with severely decreased darkadapted electroretinogram (ERG) responses and no cone (light-adapted) ERG responses.98-102
Similarly to Class III human CRX mutations and the E168d2 mouse model, in which the
mutant protein retains DNA binding and has an antimorphic effect, the Crx-mutant cat (CrxRdy)
has a mutation in the activation domain and develops a severe dominant retinopathy mimicking
human autosomal dominant LCA. The causal mutation is a one base pair deletion
(p.Pro185LysfsTer2 – c.546delC) in the final exon of the Crx gene (which has 4 exons in total).
This causes a frameshift mutation resulting in a premature stop codon at residue 186. The
position of the stop codon is at an analogous site to several reported human mutations that most
frequently result in an LCA phenotype (for a summary, see Table 1.2 in Tran et al, 2014 87 and 75,
103-111

). Because the mutation position is in the last exon, the mRNA is predicted to avoid

nonsense mediated decay and to produce a truncated Crx protein (185 amino acids long instead of
299). The truncated protein would be predicted to have an intact DNA binding site but a
truncated transactivation site (Figs. 1.30 and 1.31).112

41

Figure 1.30. Wild-Type and mutant feline cDNA and the predicted protein.
This figure indicates the location of the feline mutation (indicated in yellow a deletion of a
cytosine) at position 546. This introduces a premature stop codon and therefore encodes a
truncated protein. Start codons are indicated in green while stop codons are indicated in red.

42

Figure 1.31. Wild-type and mutant Rdy Crx feline proteins (from Menotti-Raymond et al,.
2010).112
Y exon splice junctions, * Start codon , X stop codon, Shaded box homeobox WSP domain,
Transcriptional transactivation domains 1 and 2 (TTD1 and TTD2) and OTX tail.

1.5. CRX-LCA INHERITED RETINAL DISEASE AND POTENTIAL THERAPIES
1.5.1. The disease phenotype leads to the potential therapy choices
Currently, there are no actual approved treatments for LCA in humans although there are
a number of ongoing clinical trials for LCA resulting from RPE65 mutations.27,

113

Ongoing

therapy testing in rodents exists in LCA caused by mutations in AIPL1, GUCY2 and CEP290 for
example.114-117 The CrxRdy cat could therefore be a valuable large animal model to provide new
insights into the development of therapies for dominant LCA and for other conditions that have a
dominant negative mechanism. Different therapeutic approaches have been developed over the
past decade that could be applied to the treatment of LCA.
CRX-LCA retinopathies caused by a dominant negative mechanism present a challenge
for treatment compared to recessive diseases. Indeed, recessive diseases result in a simple lack of
gene product, which can be treated by gene augmentation. In dominant recessive disease such as
CRX-LCA retinopathies, due to the over expression of the mutant allele having a negative effect
on the wild-type allele, other strategies must be used in order to manipulate the ratio between
mutant and WT Crx alleles/proteins.

43

Therefore, prior to loss of photoreceptors potential therapeutic interventions that may be
translatable to human patients are those that address the over expression of the mutant Crx
transcript compared to wild-type Crx transcript. These include either knocking down the levels of
the mutant transcript, using for example anti-sense oligonucleotides

118-120

or shRNA

121-123

, or

over expressing the wild-type transcript by gene supplementation using adeno-associated viral
vectors

51-54

, or a combination of both approaches. Supporting evidence for this approach is

provided by the p.E168d2 mouse model where a line of p.E168d2 mice in which a Neo cassette
had not been excised (p.E168d2Neo) was investigated. The presence of the Neo cassette reduced
expression of the p.E168d2 transcript compared to the wild-type transcript and this line of mice
had a milder phenotype than the line where the Neo cassette had been excised and had over
expression of the mutant transcript.95 Also, mice or humans heterozygous for null mutations in
CRX have either a mild phenotype or no phenotype.83, 85

1.5.2. Viral vectors for gene supplementation and their potential for therapy
Over the last 15 years viral vectors have been used for gene supplementation (Fig. 1.32).
Vectors commonly used in basic science and translational research include those based on adenoassociated virus, adenovirus and lentivirus. Each has their own advantages and disadvantages,
and so far the adeno-associated virus has been the most commonly used ocular gene for therapy.

44

Figure 1.32. Proteins whose genes are candidates for gene supplementation therapy (from
Smith et al., 2012).124
(MC; Müller cells, ONL; outer nuclear layer, IS: inner segment, CC; connecting cilim; OS; outer
segment, RPE; retinal pigmentary epithelium.)

1.5.2.1. Viral vectors used for gene therapy
Lentiviruses are enveloped double-stranded RNA virus. They infect non-dividing cells
and can integrate themselves into the host cells’ genome allowing for long-term transgene
expression. They can carry up to ~836 kb of genetic material. Random insertion of Lentiviruses
runs the risk of causing tumors (if, for example, they disrupt a tumor suppressor gene or may
impair the wild-type gene expression of the host genes). Other disadvantages include variable
transgene expression and immune reaction (see review Escors et al., 2010 and Sack et al.,
2009).125-127

45

Adenoviruses are double-stranded DNA viruses that are non-enveloped. They do not
integrate, so they carry a very low risk of insertional mutogenesis. They can carry as much as ~36
kb of genetic material. However, disadvantages are frequent off target transduction and induction
of immune responses (see review Douglas, 2007, Brunetti-Pierri et al., 2017, Sack et al.,
2009).127-129
It is to be noted that all viruses used in gene therapy are foreign to the body cell of the
host and therefore can potentially cause an immune reaction. Over the years, tremendous efforts
have been made in research to optimize viral vectors to target specific cells with minimal adverse
effects such as an adverse immune reaction. Adeno-associated virus vectors have become the
vectors of choice for ocular gene therapy and are considered in more detail in the following
section.

1.5.2.2. Adeno-associated vectors (AAV)
1.5.2.2.1. Properties of AAV vectors
Adeno-associated viruses are parvoviruses, which are non-replicating, non-enveloped
viruses that have an icosahedral protein capsid and contains a single-stranded DNA genome (Fig.
1.33). Their advantages are that they are small in size and can infect both non-dividing and
dividing cells. They can induce prolonged expression of the transgene, and certain serotypes can
efficiently transduce photoreceptor and retinal pigment epithelial cells. They tend not to be very
immunogenic and rarely integrate into the host genome. Their main disadvantage is that they
have a relatively low genetic material cargo capacity, typically up to about 4.7 kb (although some
techniques suggest up to 8.9 kb may be inserted).130, 131 This is a significant limitation to their use
for gene supplementation in diseases due to mutations in large genes such as CEP290, which is
important because it is responsible for over 20% of LCA or ABCA4, a gene responsible for
46

Stargardt macular dystrophy. The CRX gene described in this dissertation is ~2.9 kb and therefore
will fit in an AAV vector (see review Buning et al., 2008, Flotte, 2004, Conlon et al., 2004,
Carter, 2004, Hastie et al., 2015).131-142

Figure 1.33. Schematic of an AAV vector – its capsid and single stranded DNA (from
Lipinski et al., 2013).143
The left panel shows the icosahedral viral capsid containing a single-stranded DNA AAV
genome. The right panel represents at the top the single stranded DNA of AAV, which is
composed by Rep (replication) and Cap (capsid) genes surrounded by inverted terminal repeats
(ITR). For creating a recombinant AAV, the Rep and Cap genes of the AAV are replaced by a
transgene cassette containing a promoter, a transgene and poly-a tail (bottom), which are the
regulatory elements required for gene expression.
The AAV genome is composed of 2 genes – open reading frames (ORFs) (Rep and Cap)
and 2 inverted terminal repeats (ITRs) at both ends of the DNA strand flanking both genes that
are necessary for the AAV genome multiplication and for packaging the DNA into capsids (Fig.
1.30). The Rep gene produces four overlapping transcripts Rep78, Rep68, Rep52 and Rep40 that
are essential for viral replication. Cap encodes the capsid structural proteins: VP1, VP2 and
VP3.49 Due to its genome simplicity, the AAV genome can be easily modified and used for

47

development of therapies. Replacing the Rep and Cap genes allows the creation of a recombinant
AAV (rAAV), which can deliver a DNA sequence of interest for gene therapy.144, 145 The AAV
can only replicate in the presence of a helper virus such as herpesvirus, papillomavirus, or
adenovirus, which co-infect the host cell.139, 140

1.5.2.2.2. Transduction mechanism of action of AAV vectors
The transduction mechanism of action of AAV is summarized below (Fig. 1.34).
1) The first step consists of the recognition by the AAV vectors of the target cells. This
happens through binding of the viral capsid proteins to specific membrane surface receptors such
as integrins, FGFR-2 and heparin sulfate receptors. This then results in endocytosis of the AAV
with the help of co-receptors. This step is an important rate-limiting step.
2) The AAV is then very rapidly internalized by endocytosis in an endosome or lysozome,
mainly through the formation of clathrin-coated pits. This endocytosis is thought to be essential
for viral trafficking by exposing the viral capsid protein. During this step amino acid residues of
the capsid proteins such as tyrosine, serine and threonine can undergo phosphorylation, making
the viral particle the target for ubiquitination and subsequent proteasomal degradation within the
host cell cytoplasm. This can decrease transduction efficiency. During this “maturation” step the
capsid is processed within endosomal compartments of the Golgi apparatus and endoplasmic
reticulum to be ready for nuclear entry.
3) After this processing the AAV is then released in to the perinuclear region.
4) The viral vector subsequently enters into the nucleus through a pore complex. It is
thought that the VP1 capsid protein is necessary for this entrance.
5) Inside the nucleus, the viral vector undergoes uncoating of the capsid and release of the
viral single-stranded DNA genome. This is another rate limiting step for AAV transduction.
48

6) The AAV genome is then made double-stranded by the host cell machinery.
7) This double-stranded DNA can either be maintained as episomes or integrated into the
host genome leading to step 8), transgene expression.139, 142, 143, 146-151

.

Figure 1.34. AAV vector mechanism of action leading to gene expression from Lipinski et al.,
2013).143

49

1.5.2.2.3. Optimization of AAV vectors – recombinant AAV (rAAV)
and other modifications
When developing gene therapy, the aim is to use an AAV that will transduce the correct
tissue and cell type as well as obtaining the maximum transgene expression with minimal side
effects. To achieve these aims, modifications have been made to AAV vectors that have an
impact on the efficiency of each step required for AAV transduction.

Over a hundred different AAV serotypes have been identified, and so far twelve different
naturally occurring human AAV serotypes (AAV1-12) have been characterized with AAV1-9
having been studied in most detail.152,

153

The differences between the serotypes result from

differences in capsid proteins, and this also accounts for differences in tissue and cell tropism.142
The AAV2 serotype has been studied in most detail and is most commonly used for
developing therapies. This virus is known to be ubiquitous in the human population with a
prevalence of up to 72%.154
The isosahedral AAV capsid, which defined the serotype, is composed of 60 capsid
protein subtypes of the three viral proteins VP1, VP2 and VP3 in a 1:1:10 ratio. 155-157 Each capsid
protein has a specific primary glycosaminoglycan receptor, which is responsible for its
tropism.152 For the purpose of this dissertation, we will not detail here the tropism for tissues
other than the retina. For example, AAV1, AAV5 and AAV6 have a N-linked sialic acid glycan
receptor associated with other co-receptors. AAV1 has a tropism for retinal-pigmented
epithelium. AAV5 has a tropism for photoreceptors, Müller cells and retinal pigmented
epithelium. AAV6 has a tropism for amacrine cells, Müller cells, bipolar cells and retinal
ganglion cells. AAV2, AAV3 and AAV6 have a heparan sulfate proteoglycan receptor associated
with other co-receptors. AAV2 has a tropism for photoreceptors, Müller cells, retinal ganglion
50

cells and retinal pigmented epithelium. AAV3 has a tropism for photoreceptor and retinal
ganglion cells. AAV4 has an O-linked sialic acid receptor and a tropism for amacrine and Müller
cells. The receptors of AAV7 and AAV8 are not known. AAV7 has a tropism for photoreceptors
and retinal pigmented epithelium. AAV8 has a tropism for photoreceptors, Müller cells, retinal
ganglion cells and retinal pigmented epithelium. AAV9 has a N-linked galactose receptor
associated to other co-receptors and has a tropism for Müller cells and retinal pigmented
epithelium.139, 158, 159
As stated previously, recombinant AAV (rAAV) for therapeutic uses are produced by
introducing the desired cDNA into the AAV genome by replacing the Rep and Cap genes (Fig.
1.35). Those rAAV can be optimized to target specific tissue or cells by manipulating the capsid
to improve their cell-specific tropism (Fig. 1.36). For such a modification, the backbone genome
of the AAV serotype 2 is most commonly used and inserted in the capsid of another AAV
serotype (referred to as pseudotyping). If it is inserted into the capsid of the AAV serotype 8, the
hybrid vectors are called AAV2/8 (often shortened to AAV8). Capsid serotype is also important
during AAV processing in the host cell nucleus and is an additional rate-limiting step, which is
dependent on the AAV serotype. For example, the AAV2/2 single-stranded DNA take longer (up
to 6 weeks) to be uncoated and released in the host nucleus whereas AAV2/8 vectors are much
more rapidly uncoated.
To overcome the rate limiting step of making the transgene double-stranded DNA, one
engineering solution has been the development of self-complementary AAV genomes. With this
strategy a complementary version of the transgene is packaged in the expression cassette
(separated by a mutated termination site). This allows the genome to bind to itself and therefore
become double-stranded DNA immediately after release in the host nucleus (Fig. 1.37). This
results also in a more robust transgene expression. The main disadvantage is that it increases the
51

genome size and therefore limits the size of the cDNA of the gene of interest to be delivered. 56,
160-163

Figure 1.35. Structure and production of a rAAV vector (from Beltran, 2009).56 The
recombinant AAV vector (rAAV) is engineered by removing the rep and cap genes from the
wild-type AAV serotype 2 backbone genome. Those are replaced by a promoter (Pro), the cDNA
of a therapeutic gene capped with a poly-adenylation site (PolyA) between the two inverted
terminal repeats (ITR). This new genome is then inserted into a plasmid and used with a helper
plasmid containing the rep and cap genes to transfect cells in culture. These cells produce a
replication-defective recombinant AAV. In this figure both the genome and the capsid originate
from an AAV2 serotype thus generating a rAAV2/2 vector.

52

Figure 1.36. Examples of hybrid rAAV and their cell tropism of rAAV in the canine retina.
RPE: retinal pigment epithelium; PRs: photoreceptors; INL: inner nuclear layer; GC: ganglion
cells; LGN: lateral geniculate nucleus; SC: superior colliculus (from Beltran, 2009).56

Figure 1.37. Comparison of scAAV and rAAV vectors (from Daya et al., 2008).163

53

Other modifications to improve AAV vectors are the modification of the surface capsid
proteins topography and amino-acid composition; this creates hybrid vectors. The parts of the
proteins that are modified are the exposed residues (such as tyrosine, serine, threonine, and
lysine) that are targets for modification such as phosphorylation that can lead to proteasomal
degradation.91,92 Modifications by mutating those amino acids (producing “mutant capsid
AAVs”) can help to improve transgene expression efficiency and decrease the potential host
immune reaction by avoiding phosphorylation and ubiquitination and therefore degradation by
proteosomes that would recognize the viral capsid proteins thorough those residues. This escape
from the host defense might also improve the extracellular transport and penetration into the
targeted cell.146, 164-172 Examples of engineered capsid protein mutations are the replacement of a
tyrosine by a phenylalanine residue (Y-F) or a threonine by a valine residue (T-V). Mutations can
be single (Y733F, replacement of a tyrosine by a phenylalanine residue at the position 733),
triple, quadruple…etc. Recent approaches for capsid modification utilize a technique called
“directed evolution”. This is where mutations of the Cap gene are created by error prone PCR,
random peptide insertion, or capsid DNA shuffling, to generate a large library of capsid variant
vectors. These vectors are then tested for efficiency, to reach a target tissue for example. The
target tissue is isolated and the rAAVs within it isolated and perhaps used for subsequent rounds
of enrichment to identify capsid variants with the desired characteristic.52, 138, 173
At a viral genome level, the use of a specific promoter to drive expression of the transgene
can help limit expression of the transgene to the chosen cells. This will limit off-target expression
and therefore side-effects (i.e. mOP, hGK1 and PR2.1 promoters).54, 174, 175
More recently, advances in AAV engineering have been achieved, such as using a hybrid
technique to deliver genes that are too big to fit into the rAAV vector. This technique consists of
54

using two AAV vectors, each containing separate parts of the cDNA needed. The theory is that
they allow recombination of the full transgene cDNA within the host cell and therefore
expression of the overlarge cDNA.176, 177

1.5.2.2.4. Delivery route of AAV vectors for inherited retinal dystrophy
diseases
The two most common AVV delivery routes to treat the retina for inherited retinal
dystrophies are intravitreal and subretinal injections (Fig. 1.38).51 The least invasive is the
intravitreal technique, which is suitable for transducing inner retinal cell types. However, for
retinal dystrophies, where the RPE or photoreceptors need to be transduced, most rAAVs only
inefficiently traverse the retina to reach photoreceptor cells, which are located on the basal side of
the retina. Work is progressing to produce vectors that can efficiently target the outer retina from
the vitreal cavity.178-181

Figure 1.38. Intraocular AAV administration routes from Dalkara (http://www.visionresearch.eu/index.php?id=906).182 Subretinal injection creates a space between the RPE and the
photoreceptor and therefore allows delivering of gene therapy vectors directly in proximity of the
photoreceptor and RPE cells while the intravitreal injection delivers the AAV vector in the
vitreous throughout, which it diffuses to allow treatment of inner retinal cells. RPE: retinal
pigment epithelium, RGC: retinal ganglion cells.
55

For gene therapy targeting photoreceptors (to treat diseases like CRX-LCA, CEP290LCA, AIPL1-LCA) and retinal pigmentary epithelium (to treat diseases such as RPE65-LCA),
subretinal delivery of the AAV vector is still required. This technique allows direct supply of the
therapeutic genome to the cell targeted. Moreover, a specificity of the subretinal space is that it is
an immune-privileged site; therefore, the risk of humoral response towards the AAV vector and
its transgene is reduced. However, it is an invasive technique that causes a retinal detachment
between the photoreceptor and the RPE. The retina usually reattached within a couple of days,
but this could be enough to lead to some cell damage (notably photoreceptor outer segments and
apoptosis).183-190 Another disadvantage of subretinal injection is that effectively only the retina in
the region injected is transduced.191
Intravitreal injection is less invasive (Fig. 1.38) and potentially could treat the entire
retina. One drawback is that immune responses are more likely from intravitreal compared to
subretinal administration. Active research is in development to overcome those obstacles; notably
using cell-specific promoters as intravitreal injection can easily be done as a routine treatment
under local anesthesia without sedation in humans. For instance, investigations have been done
in large animal models like the dogs and macaques to look at the effect of vitrectomy. Results are
variable; some showed that vitrectomy two weeks prior to intravitreal injection of rAAV can lead
to reduction of the transgene transduction and cause vector-immune reaction179 while others
showed that vitrectomy immediately prior to rAAV injection improves transgene tranduction
efficiency.192

56

1.5.2.2.5. Immune responses to AAV vectors.
One of the major risks of the use of AAV for gene therapy is the potential immune
reaction which increases morbidity. The eye has several advantages; it is an isolated organ and is
an immune-privileged site, which is due to the anterior chamber-associated immune deviation
(ACAID), a process present in the anterior chamber and the vitreous humor. ACAID is a process
by which an immunosuppressive intraocular state is maintained within the eye by specific
dendritic cells present in various structure of the eye. If any traumatic or inflammatory events
intervene in the eye or its tissues, ACAID can be disrupted and the immunosuppressive state of
the eye lost leading to severe inflammation or damage. 193-197
Both humans and large animal models are naturally exposed to AAV; therefore, systemic
circulating neutralizing antibodies (NAb) may be present prior to any rAAV gene therapy
injection. This can lead to therapeutic failure and an immune reaction to the injected rAAV. As
stated above, the subretinal injection is a technique that has less risk of immune response than the
intravitreal injection. It has been shown that repeated subretinal injections can be performed
without eliciting any NAb production by humoral response while this is not the case for
intravitreal injection.138, 154, 198-202
Finally, systemic administration of AAV can lead to cell-mediated responses. Those
responses target the protein capsid and the transgene through cytotoxic T lymphocyte reactions.
This type of immune reaction can be severe and lead to both the attack of the rAAV but also of
the host cells.203-206

57

1.5.3. Potential silencing therapies
There are various existing silencing therapies that include the use of oligonucleotides
(ON), which have been developed for a long time and used in clinics.
The different oligonucleotides mechanisms are as follows (Fig. 1.39):
- Binding to Toll-like receptors (TLRs) in the endosome,
- Small interfering RNA (siRNA),
- Micro-RNA (miR) mimic,
- Antagomir, sterically blocking endogenous miR,
- Gapmer AON, inducing RNase H degradation (steric block ONs also exist),
- Aptamer, binding alters protein surface,
- Splice switching ON (SSO),
- Anti-gene ONs,
- ONs directed against nuclear regulatory RNA species, (never yet used in clinics).

58

Figure 1.39. Figure showing the currently used oligonucleotide therapeutic approaches
(from Lundin et al. 2015). The approaches labeled 1 to 7 in the diagram have been used in the
clinic.207

Others therapies in addition to those described above include pharmacological
interventions, CRISPR-Cas9 targeted genome editing, cell transplantation, retinal prosthesis and
cortical devices.
All of these therapies could potentially be applied to CRX-LCA animal models so long as
the phenotype and disease mechanism are well defined and therapies are tested at the correct
disease stage and in most appropriate model.
59

1.6. AIM AND OUTLINE OF THIS THESIS
Based on the findings in the CRXE168d2 mouse model, we hypothesized that the severe
CrxRdy/+ feline phenotype would result from a similar mechanism, namely an antimorphic effect
associated with over expression of the mutant transcript and that a potential therapeutic approach
would be to use an intervention that reduced the mutant-to-wild-type mRNA/protein ratio.

The detailed hypotheses that guided these studies are as follows:
1. CrxRdy/+ cats have a failure of retinal structural and functional maturation associated with
reduced expression of specific retinal genes due to expression of the mutant Crx transcript, which
has a dominant negative effect.
2. CrxRdy/+ cats show severe retinal remodeling that worsens with disease progression,
affecting not only the outer retina but also the inner retina and the retinal vasculature.
3. CrxRdy/Rdy cats have a marked reduction in expression of specific retinal genes resulting in
absence or severely decreased retinal function and incomplete photoreceptor maturation with
marked morphological abnormalities.
4. Partial rescue of the CrxRdy/+ phenotype will be achievable using gene therapy to either
augment the levels of normal Crx transcript or to reduce the levels of the mutant transcript or a
combination of both approaches.

To test these hypotheses, we aimed to further characterize the phenotype of the CrxRdy/+
cat and to also characterize the phenotype of the CrxRdy/Rdy cat by a number of techniques. These
included ophthalmic examination and fundus imaging (fundus photography, confocal scanning
laser ophthalmoscope and fluorescein angiography) morphological investigations using spectral
domain

optical

coherence

tomography

and
60

histology,

and

functional

changes

by

electroretinography. Retinal gene expression changes were assessed by immunohistochemistry,
qRT-PCR and Western blot. Disease mechanisms were further investigated by measuring both
expression of the mutant Crx transcript and the transactivation activity of the mutant protein. We
also investigated treatment strategies to rescue the phenotype of retinopathies due to antimorphic
CRX mutations.

This current dissertation outline follows detailed aims based on the research-driven
hypotheses stated above.
Chapter 1 gives an introduction on animal models for dominant Leber Congenital
Amaurosis (LCA) due to CRX mutations and introduces the feline model as well as potential
therapies.

Chapter 2 tests the hypothesis that the heterozygous Crx mutant cat (CrxRdy/+) cat has a
failure of retinal structural and functional maturation associated with reduced expression of
specific retinal genes due to expression of the mutant Crx transcript which has a dominant
negative effect. Therefore, the aim of this chapter is to describe a detailed investigation of the
phenotype of the CrxRdy/+ cat and the mechanisms underlying the disease.

Chapter 3 investigated the hypothesis that in the late stages of the disease the
heterozygous Crx mutant cat (CrxRdy/+) presents with severe retinal remodeling throughout all
layers of the retina. This chapter aims to give a description of morphologic and metabolic
changes undergone by the retina as well as a description of the retinal vasculature changes
occurring during the disease progression in CrxRdy/+ cat.

61

Chapter 4 tests the hypothesis that the homozygous Crx mutant (CrxRdy/Rdy cat) will have
a marked reduction in expression of specific retinal genes resulting in an absence or severe
decrease in retinal function and incomplete photoreceptor maturation with marked morphological
abnormalities. This chapter’s aim is to detail the phenotype of the CrxRdy/Rdy cat and start
unraveling some of the mechanisms underlying the disease pathogenesis.

Chapter 5 initiates work on the hypothesis that partial rescue of the CrxRdy/+ phenotype
can be achieved using gene therapy to either augment the levels of normal Crx transcript or to
reduce the level of the mutant transcript or a combination of both approaches. This chapter gives
preliminary results for vision restoration in CrxRdy+/- cat using gene supplementation therapy.

Chapter 6 gives conclusions and future directions.

1.7. CONCLUSION
CRX is an essential transcription factor essential for the development of photoreceptors
and their maintenance. Mutations in CRX lead severe retinal disease like Leber Congenital
Amaurosis. Currently, a few mouse models exist, but only one large animal model is available,
the CrxRdy cat. Mouse models have been investigated and their phenotype described; however, the
feline model needs further study, and the mechanism underlying the disease needs to be fully
elucidated. These models, and in particular the feline model, are highly valuable for the
development of therapies for CRX-LCA disease and other dominant negative diseases.

62

REFERENCES

63

REFERENCES

1.
Organization WH. Visual Impairment and Blindness. Fact Sheet N°282. WhoInt; August
2014:Web. 12 June 2017.
2.
Ma W, Wei J, Wei Y, et al. Immunogenicity of the capsid precursor and a nine-aminoacid site-directed mutant of the 3C protease of foot-and-mouth disease virus coexpressed by a
recombinant goatpox virus. Arch Virol. 2014;159:1715-1722.
3.
Pacione LR, Szego MJ, Ikeda S, Nishina PM, McInnes RR. Progress toward
understanding the genetic and biochemical mechanisms of inherited photoreceptor degenerations.
Annu Rev Neurosci. 2003;26:657-700.
4.
Rattner A, Sun H, Nathans J. Molecular genetics of human retinal disease. Ann Rev
Genet. 1999;33:89-131.
5.
Wright AF, Chakarova CF, Abd El-Aziz MM, Bhattacharya SS. Photoreceptor
degeneration: genetic and mechanistic dissection of a complex trait. Nat Rev Genet. 2010;11:273284.
6.
Daiger SP, Rossiter BJF, Greenberg J, Christoffels A, Hide W. Data services and software
for identifying genes and mutations causing retinal degeneration. Invest Ophthalmol Vis Sci.
(Suppl) 1998;39:S295.
7.
Hejtmancik JF, Nickerson JM. Overview of the Visual System. Prog Mol Biol Transl Sci.
2015;134:1-4.
8.

Graw J. Eye development. Curr Top Dev Biol. 2010;90:343-386.

9.
Chow RL, Lang RA. Early eye development in vertebrates. Annu Rev Cell Dev Biol.
2001;17:255-296.
10.
Heavner W, Pevny L. Eye development and retinogenesis. Cold Spring Harb Perspect
Biol. 2012;4.
11.
D'Orazi FD, Suzuki SC, Wong RO. Neuronal remodeling in retinal circuit assembly,
disassembly, and reassembly. Trends Neurosci. 2014;37:594-603.
12.
Bassett EA, Wallace VA. Cell fate determination in the vertebrate retina. Trends
Neurosci. 2012;35:565-573.
13.
Marquardt T, Gruss P. Generating neuronal diversity in the retina: one for nearly all.
Trends Neurosci. 2002;25:32-38.

64

14.
Martins RA, Pearson RA. Control of cell proliferation by neurotransmitters in the
developing vertebrate retina. Brain Res. 2008;1192:37-60.
15.
Zimmerman RP, Polley EH, Fortney RL. Cell birthdays and rate of differentiation of
ganglion and horizontal cells of the developing cat's retina. J Comp Neurol. 1988;274:77-90.
16.
Rapaport DH, Stone J. The topography of cytogenesis in the developing retina of the cat.
J Neurosci. 1983;3:1824-1834.
17.
Johns PR, Rusoff AC, Dubin MW. Postnatal neurogenesis in the kitten retina. J Comp
Neurol. 1979;187:545-555.
18.
Chan-Ling TL, Halasz P, Stone J. Development of retinal vasculature in the cat: processes
and mechanisms. Curr Eye Res.1990;9:459-478.
19.
Morrison JD. Morphogenesis of photoreceptor outer segments in the developing kitten
retina. J Anat. 1983;136:521-533.
20.
Mastronarde DN, Thibeault MA, Dubin MW. Non-uniform postnatal growth of the cat
retina. J Comp Neurol. 1984;228:598-608.
21.
Vogel M. Postnatal development of the cat’s retina. Germany: Springer-Verlag Berlin
Heidelberg; 1978:66.
22.
Granit R. The components of the retinal action potential in mammals and their relation to
the discharge in the optic nerve. J Physiol. 1933;77:207-239.
23.
Frishman LJ. Origins of the electroretinogram. In: Heckenlively J.R. AGB (ed),
Principles and practice of clinical electrophysiology of vision. Cambridge, Massachusetts: The
MIT press; 2006:139-183.
24.
Hamasaki DI, Maguire GW. Physiological development of the kitten's retina: an ERG
study. Vision Res. 1985;25:1537-1543.
25.
Jacobson SG, Ikeda H, Ruddock K. Cone-mediated retinal function in cats during
development. Doc Ophthalmol. 1987;65:7-14.
26.
Veleri S, Lazar CH, Chang B, Sieving PA, Banin E, Swaroop A. Biology and therapy of
inherited retinal degenerative disease: insights from mouse models. Dis Model Mech.
2015;8:109-129.
27.
Petersen-Jones SM, Annear MJ, Bartoe JT, et al. Gene augmentation trials using the
Rpe65-deficient dog: contributions towards development and refinement of human clinical trials.
Adv Exp Med Biol. 2012;723:177-182.
28.

Vakkur GJ, Bishop PO. The Schematic Eye in the Cat. Vision Res. 1963;61:357-381.
65

29.
Curcio CA, Sloan KR, Kalina RE, Hendrickson AE. Human photoreceptor topography. J
Comp Neurol. 1990;292:497-523.
30.
Østerberg G. Topography of the layer of rods and cones in the human retina. Acta
Ophthalmol. 1935;13:11-103.
31.
Jeon CJ, Strettoi E, Masland RH. The major cell populations of the mouse retina. J
Neurosci. 1998;18:8936-8946.
32.
Steinberg RH, Reid M, Lacy PL. The distribution of rods and cones in the retina of the cat
(Felis domesticus). J Comp Neurol. 1973;148:229-248.
33.
Wikler KC, Williams RW, Rakic P. Photoreceptor mosaic: number and distribution of
rods and cones in the rhesus monkey retina. J Comp Neurol. 1990;297:499-508.
34.
Applebury ML, Antoch MP, Baxter LC, et al. The murine cone photoreceptor: a single
cone type expresses both S and M opsins with retinal spatial patterning. Neuron. 2000;27:513523.
35.
Bowmaker JK, Dartnall HJ. Visual pigments of rods and cones in a human retina. J
Physiol. 1980;298:501-511.
36.

Bowmaker JK. Evolution of vertebrate visual pigments. Vision Res. 2008;48:2022-2041.

37.
Yokoyama S. Molecular bases of color vision in vertebrates. Genes Genet Syst.
1999;74:189-199.
38.
Yokoyama S, Radlwimmer FB. The molecular genetics of red and green color vision in
mammals. Genetics. 1999;153:919-932.
39.
Provis JM, Dubis AM, Maddess T, Carroll J. Adaptation of the central retina for high
acuity vision: cones, the fovea and the avascular zone. Prog Retin Eye Res. 2013;35:63-81.
40.
Rossi EA, Roorda A. The relationship between visual resolution and cone spacing in the
human fovea. Nature Neurosci. 2010;13:156-157.
41.
Volland S, Esteve-Rudd J, Hoo J, Yee C, Williams DS. A comparison of some
organizational characteristics of the mouse central retina and the human macula. PloS one.
2015;10:e0125631.
42.
Beltran WA, Cideciyan AV, Guziewicz KE, et al. Canine retina has a primate fovea-like
bouquet of cone photoreceptors which is affected by inherited macular degenerations. PloS one.
2014;9:e90390.
43.
Bishop PO, Kozak W, Vakkur GJ. Some quantitative aspects of the cat's eye: axis and
plane of reference, visual field co-ordinates and optics. J Physiol. 1962;163:466-502.
66

44.
Linberg KA, Lewis GP, Shaaw C, Rex TS, Fisher SK. Distribution of S- and M-cones in
normal and experimentally detached cat retina. J Comp Neurol. 2001;430:343-356.
45.
Mowat FM, Petersen-Jones SM, Williamson H, et al. Topographical characterization of
cone photoreceptors and the area centralis of the canine retina. Mol Vis. 2008;14:2518-2527.
46.
Rapaport DH, Stone J. The area centralis of the retina in the cat and other mammals: focal
point for function and development of the visual system. Neuroscience. 1984;11:289-301.
47.
Kemp CM, Faulkner DJ, Jacobson SG. The distribution and kinetics of visual pigments in
the cat retina. Invest Ophthalmol Vis Sci. 1988;29:1056-1065.
48.
Carroll J, Neitz M, Hofer H, Neitz J, Williams DR. Functional photoreceptor loss
revealed with adaptive optics: an alternate cause of color blindness. Proc Natl Acad Sci U S A.
2004;101:8461-8466.
49.
Putnam NM, Hofer HJ, Doble N, Chen L, Carroll J, Williams DR. The locus of fixation
and the foveal cone mosaic. J Vis. 2005;5:632-639.
50.
Li KY, Tiruveedhula P, Roorda A. Intersubject variability of foveal cone photoreceptor
density in relation to eye length. Invest Ophthalmol Vis Sci. 2010;51:6858-6867.
51.
Dalkara D, Sahel JA. Gene therapy for inherited retinal degenerations. C R Biol.
2014;337:185-192.
52.
Day TP, Byrne LC, Schaffer DV, Flannery JG. Advances in AAV vector development for
gene therapy in the retina. Adv Exp Med Biol. 2014;801:687-693.
53.
Kotterman MA, Schaffer DV. Engineering adeno-associated viruses for clinical gene
therapy. Nat Rev Genet. 2014;15:445-451.
54.
McClements ME, MacLaren RE. Gene therapy for retinal disease. Transl Res.
2013;161:241-254.
55.
Narfstrom K, Holland Deckman K, Menotti-Raymond M. The domestic cat as a large
animal model for characterization of disease and therapeutic intervention in hereditary retinal
blindness. J Ophthalmol. 2011;2011:906943.
56.
Beltran WA. The use of canine models of inherited retinal degeneration to test novel
therapeutic approaches. Vet Ophthalmol. 2009;12:192-204.
57.
Petersen-Jones SM, Komaromy AM. Dog models for blinding inherited retinal
dystrophies. Hum Gene Ther Clin Dev. 2015;26:15-26.
58.
Li ZY, Wong F, Chang JH, et al. Rhodopsin transgenic pigs as a model for human
retinitis pigmentosa. Invest Ophthalmol Vis Sci. 1998;39:808-819.
67

59.
Banin E, Obolensky A, Ejzenberg A, et al. Gene therapy in a sheep model of CNGA3
achromatopsia. Invest Ophthalmol Vis Sci. 2014;55:4566-.
60.
Winkler PA, Ekenstedt KJ, Occelli LM, et al. A large animal model for CNGB1
autosomal recessive retinitis pigmentosa. PloS one. 2013;8:e72229.
61.
Gandolfi B, Alhaddad H. Investigation of inherited diseases in cats: genetic and genomic
strategies over three decades. J Feline Med Surg. 2015;17:405-415.
62.
Montague MJ, Li G, Gandolfi B, et al. Comparative analysis of the domestic cat genome
reveals genetic signatures underlying feline biology and domestication. Proc Natl Acad Sci U S
A. 2014;111:17230-17235.
63.
Menotti-Raymond M, David VA, Schaffer AA, et al. Mutation in CEP290 discovered for
cat model of human retinal degeneration. J Hered. 2007;98:211-220.
64.
Menotti-Raymond M, Deckman KH, David V, Myrkalo J, O'Brien SJ, Narfstrom K.
Mutation discovered in a feline model of human congenital retinal blinding disease. Invest
Ophthalmol Vis Sci. 2010;51:2852-2859.
65.
Alhaddad H, Gandolfi B, Grahn RA, et al. Genome-wide association and linkage analyses
localize a progressive retinal atrophy locus in Persian cats. Mamm Genome. 2014;25:354-362.
66.
Ofri R, Reilly CM, Maggs DJ, et al. Characterization of an Early-Onset, Autosomal
Recessive, Progressive Retinal Degeneration in Bengal Cats. Invest Ophthalmol Vis Sci.
2015;56:5299-5308.
67.
Spitz F FEE. Transcription factors: from enhancer binding to developmental control. Nat
Rev Genet. 2012;13:613-626.
68.

DS L. Transcription Factors: An Overview. Int J Biochem Cell Biol. 1997;29:1305-1312.

69.
Boije H, MacDonald RB, Harris WA. Reconciling competence and transcriptional
hierarchies with stochasticity in retinal lineages. Curr Opin Neurobiol. 2014;27:68-74.
70.
Hennig AK, Peng GH, Chen S. Regulation of photoreceptor gene expression by Crxassociated transcription factor network. Brain Res. 2008;1192:114-133.
71.
Oh EC, Khan N, Novelli E, Khanna H, Strettoi E, Swaroop A. Transformation of cone
precursors to functional rod photoreceptors by bZIP transcription factor NRL. Proc Natl Acad Sci
U S A. 2007;104:1679-1684.
72.
Swaroop A, Kim D, Forrest D. Transcriptional regulation of photoreceptor development
and homeostasis in the mammalian retina. Nat Rev Neurosci. 2010;11:563-576.

68

73.
Beltran WA, Cideciyan AV, Lewin AS, et al. Gene therapy rescues photoreceptor
blindness in dogs and paves the way for treating human X-linked retinitis pigmentosa. Proc Natl
Acad Sci U S A. 2012;109:2132-2137.
74.
Leber T. Über retinitis pigmentosa und angeborene Amaurose. G Graefes Arch Clin Exp
Ophthalmol. 1869;15:1-25.
75.
Stone EM. Leber congenital amaurosis - a model for efficient genetic testing of
heterogeneous disorders: LXIV Edward Jackson Memorial Lecture. Am J Ophthalmol.
2007;144:791-811.
76.
Koenekoop RK. An overview of Leber congenital amaurosis: a model to understand
human retinal development. Surv Ophthalmol. 2004;49:379-398.
77.
Alström CH, Olson O. Heredo-retinopathia congenitalis; monohybrida recessiva
autosomalis. Lund, Sweden: Berlingska Boktryckeriet; 1957:178 p.
78.
Schappert-Kimmijser J, Henkes HE, Van Den Bosch J. Amaurosis congenita (Leber).
Arch Ophthalmol. 1959;61:211-218.
79.
Chacon-Camacho OF, Zenteno JC. Review and update on the molecular basis of Leber
congenital amaurosis. World J Clin Cases. 2015;3:112-124.
80.
den Hollander AI. Omics in Ophthalmology: Advances in Genomics and Precision
Medicine for Leber Congenital Amaurosis and Age-Related Macular Degeneration. Invest
Ophthalmol Vis Sci. 2016;57:1378-1387.
81.
den Hollander AI, Roepman R, Koenekoop RK, Cremers FP. Leber congenital amaurosis:
genes, proteins and disease mechanisms. Prog Retin Eye Res. 2008;27:391-419.
82.
Chen S, Wang QL, Nie Z, et al. Crx, a novel Otx-like paired-homeodomain protein, binds
to and transactivates photoreceptor cell-specific genes. Neuron. 1997;19:1017-1030.
83.
Furukawa T, Morrow EM, Cepko CL. Crx, a novel otx-like homeobox gene, shows
photoreceptor-specific expression and regulates photoreceptor differentiation. Cell. 1997;91:531541.
84.
Chau KY, Chen S, Zack DJ, Ono SJ. Functional domains of the cone-rod homeobox
(CRX) transcription factor. J Biol Chem. 2000;275:37264-37270.
85.
Morrow EM, Furukawa T, Raviola E, Cepko CL. Synaptogenesis and outer segment
formation are perturbed in the neural retina of Crx mutant mice. BMC Neurosci. 2005;6:5.
86.
Peng GH, Chen S. Crx activates opsin transcription by recruiting HAT-containing coactivators and promoting histone acetylation. Hum Mol Genet. 2007;16:2433-2452.

69

87.
Tran NM, Chen S. Mechanisms of blindness: Animal models provide insight into distinct
CRX-associated retinopathies. Dev Dyn. 2014;243:1153-1166.
88.
Livesey FJ, Furukawa T, Steffen MA, Church GM, Cepko CL. Microarray analysis of the
transcriptional network controlled by the photoreceptor homeobox gene Crx. Curr Biol.
2000;10:301-310.
89.
Hsiau TH, Diaconu C, Myers CA, Lee J, Cepko CL, Corbo JC. The cis-regulatory logic of
the mammalian photoreceptor transcriptional network. PloS one. 2007;2:e643.
90.
Blackshaw S, Fraioli RE, Furukawa T, Cepko CL. Comprehensive analysis of
photoreceptor gene expression and the identification of candidate retinal disease genes. Cell.
2001;107:579-589.
91.
Corbo JC, Lawrence KA, Karlstetter M, et al. CRX ChIP-seq reveals the cis-regulatory
architecture of mouse photoreceptors. Genome Res. 2010;20:1512-1525.
92.
Roosing S, Thiadens AA, Hoyng CB, Klaver CC, den Hollander AI, Cremers FP. Causes
and consequences of inherited cone disorders. Prog Retin Eye Res. 2014;42:1-26.
93.
Hull S, Arno G, Plagnol V, et al. The phenotypic variability of retinal dystrophies
associated with mutations in CRX, with report of a novel macular dystrophy phenotype. Invest
Ophthalmol Vis Sci. 2014;55:6934-6944.
94.
Huang L, Xiao X, Li S, et al. CRX variants in cone-rod dystrophy and mutation overview.
Biochem Biophys Res Commun. 2012;426:498-503.
95.
Tran NM, Zhang A, Zhang X, Huecker JB, Hennig AK, Chen S. Mechanistically distinct
mouse models for CRX-associated retinopathy. PLoS Genet. 2014;10:e1004111.
96.
Ruzycki PA, Tran NM, Kefalov VJ, Kolesnikov AV, Chen S. Graded gene expression
changes determine phenotype severity in mouse models of CRX-associated retinopathies.
Genome Biol. 2015;16:171.
97.
Roger JE, Hiriyanna A, Gotoh N, et al. OTX2 loss causes rod differentiation defect in
CRX-associated congenital blindness. J Clin Invest. 2014;124:631-643.
98.
Barnett KC, Curtis R. Autosomal dominant progressive retinal atrophy in Abyssinian cats.
J Hered.1985;76:168-170.
99.
Curtis R, Barnett KC, Leon A. An early-onset retinal dystrophy with dominant inheritance
in the Abyssinian cat. Clinical and pathological findings. Invest Ophthalmol Vis Sci.
1987;28:131-139.
100. Leon A, Curtis R. Autosomal dominant rod-cone dysplasia in the Rdy cat. 1. Light and
electron microscopic findings. Exp Eye Res. 1990;51:361-381.
70

101. Leon A, Hussain AA, Curtis R. Autosomal dominant rod-cone dysplasia in the Rdy cat. 2.
Electrophysiological findings. Exp Eye Res. 1991;53:489-502.
102. Chong NH, Alexander RA, Barnett KC, Bird AC, Luthert PJ. An immunohistochemical
study of an autosomal dominant feline rod/cone dysplasia (Rdy cats). Exp Eye Res. 1999;68:5157.
103. Nichols LL, 2nd, Alur RP, Boobalan E, et al. Two novel CRX mutant proteins causing
autosomal dominant Leber congenital amaurosis interact differently with NRL. Hum Mutat.
2010;31:E1472-1483.
104. Freund CL, Gregory-Evans CY, Furukawa T, et al. Cone-rod dystrophy due to mutation
in a novel photoreceptor-specific homeobox gene (CRX) essential for maintenance of the
photoreceptor. Cell. 1997;91:543-553.
105. Perrault I, Hanein S, Gerber S, et al. Evidence of autosomal dominant Leber congenital
amaurosis (LCA) underlain by a CRX heterozygous null allele. J med Genet. 2003;40:e90.
106. Zou X, Yao F, Liang X, et al. De novo mutations in the cone-rod homeobox gene
associated with leber congenital amaurosis in Chinese patients. Ophthalmic Genet. 2015;36:2126.
107. Wang P, Guo X, Zhang Q. Further evidence of autosomal-dominant Leber congenital
amaurosis caused by heterozygous CRX mutation. Graefes Arch Clin Exp Ophthalmol.
2007;245:1401-1402.
108. Ziviello C, Simonelli F, Testa F, et al. Molecular genetics of autosomal dominant retinitis
pigmentosa (ADRP): a comprehensive study of 43 Italian families. J Med Genet. 2005;42:e47.
109. Nakamura M, Ito S, Miyake Y. Novel de novo mutation in CRX gene in a Japanese
patient with leber congenital amaurosis. Am J Ophthalmol. 2002;134:465-467.
110. Koenekoop RK, Loyer M, Dembinska O, Beneish R. Visual improvement in Leber
congenital amaurosis and the CRX genotype. Ophthalmic Genet. 2002;23:49-59.
111. Zhang Q, Li S, Guo X, et al. Screening for CRX gene mutations in Chinese patients with
Leber congenital amaurosis and mutational phenotype. Ophthalmic Genet. 2001;22:89-96.
112. Menotti-Raymond M, Deckman KH, David V, Myrkalo J, O'Brien SJ, Narfström K.
Mutation discovered in a feline model of human congenital retinal blinding disease. Invest
Ophthalmol Vis Sci. 2010;51:2852-2859.
113. Bainbridge JW, Mehat MS, Sundaram V, et al. Long-term effect of gene therapy on
Leber's congenital amaurosis. N Engl J Med. 2015;372:1887-1897.
114. Ku CA, Chiodo VA, Boye SL, et al. Viral-mediated vision rescue of a novel AIPL1 conerod dystrophy model. Hum Mol Genet. 2015;24:670-684.
71

115. Boye SL, Peterson JJ, Choudhury S, et al. Gene Therapy Fully Restores Vision to the AllCone Nrl(-/-) Gucy2e(-/-) Mouse Model of Leber Congenital Amaurosis-1. Hum Gene Ther.
2015;26:575-592.
116. Burnight ER, Wiley LA, Drack AV, et al. CEP290 gene transfer rescues Leber congenital
amaurosis cellular phenotype. Gene Ther. 2014;21:662-672.
117. Garanto A, Chung DC, Duijkers L, et al. In vitro and in vivo rescue of aberrant splicing in
CEP290-associated LCA by antisense oligonucleotide delivery. Hum Mol Genet. 2016;25:25522563.
118. Ostergaard ME, Southwell AL, Kordasiewicz H, et al. Rational design of antisense
oligonucleotides targeting single nucleotide polymorphisms for potent and allele selective
suppression of mutant Huntingtin in the CNS. Nucleic Acids Res. 2013;41:9634-9650.
119. Bennett CF, Swayze EE. RNA targeting therapeutics: molecular mechanisms of antisense
oligonucleotides as a therapeutic platform. Ann Rev Pharmacol Toxicol. 2010;50:259-293.
120. Singh J, Kaur H, Kaushik A, Peer S. A Review of Antisense Therapeutic Interventions for
Molecular Biological Targets in Various Diseases. Int J Pharmacol. 2011;7:294-315.
121. Liao Y, Tang L. Inducible RNAi system and its application in novel therapeutics. Crit Rev
Biotechnol.2015;1-9.
122. Lambeth LS, Smith CA. Short hairpin RNA-mediated gene silencing. Methods Mol Biol.
2013;942:205-232.
123. Rayburn ER, Zhang R. Antisense, RNAi, and gene silencing strategies for therapy:
mission possible or impossible? Drug Discov Today. 2008;13:513-521.
124. Smith AJ, Bainbridge JW, Ali RR. Gene supplementation therapy for recessive forms of
inherited retinal dystrophies. Gene Ther. 2012;19:154-161.
125. Nayak S, Herzog RW. Progress and prospects: immune responses to viral vectors. Gene
Ther. 2010;17:295-304.
126. Escors D, Breckpot K. Lentiviral vectors in gene therapy: their current status and future
potential. Arch Immunol Ther Exp. 2010;58:107-119.
127. Sack BK, Herzog RW. Evading the immune response upon in vivo gene therapy with
viral vectors. Curr Opin Mol Ther. 2009;11:493-503.
128.

Douglas JT. Adenoviral vectors for gene therapy. Mol. Biotechnol. 2007;36:71-80.

129. Brunetti-Pierri N, Ng P. Gene therapy with helper-dependent adenoviral vectors: lessons
from studies in large animal models. Virus genes. 2017.
72

130. Allocca M, Doria M, Petrillo M, et al. Serotype-dependent packaging of large genes in
adeno-associated viral vectors results in effective gene delivery in mice. J Clin Invest.
2008;118:1955-1964.
131. Buning H, Perabo L, Coutelle O, Quadt-Humme S, Hallek M. Recent developments in
adeno-associated virus vector technology. J Gene Med. 2008;10:717-733.
132. Flotte TR. Gene therapy progress and prospects: recombinant adeno-associated virus
(rAAV) vectors. Gene Ther. 2004;11:805-810.
133. Conlon TJ, Flotte TR. Recombinant adeno-associated virus vectors for gene therapy.
Expert Opin Biol Ther. 2004;4:1093-1101.
134. Carter BJ. Adeno-associated virus and the development of adeno-associated virus vectors:
a historical perspective. Mol Ther. 2004;10:981-989.
135. Hastie E, Samulski RJ. Adeno-associated virus at 50: a golden anniversary of discovery,
research, and gene therapy success--a personal perspective. Hum Gene Ther. 2015;26:257-265.
136. Tenenbaum L, Lehtonen E, Monahan PE. Evaluation of risks related to the use of adenoassociated virus-based vectors. Curr Gene Ther. 2003;3:545-565.
137. Flannery JG, Visel M. Adeno-associated viral vectors for gene therapy of inherited retinal
degenerations. Methods Mol Biol. 2013;935:351-369.
138. Bartel MA, Weinstein JR, Schaffer DV. Directed evolution of novel adeno-associated
viruses for therapeutic gene delivery. Gene Ther. 2012;19:694-700.
139. Nonnenmacher M, Weber T. Intracellular transport of recombinant adeno-associated virus
vectors. Gene Ther. 2012;19:649-658.
140. Surace EM, Auricchio A. Adeno-associated viral vectors for retinal gene transfer. Prog
Retin Eye Res. 2003;22:705-719.
141. Surace EM, Auricchio A. Versatility of AAV vectors for retinal gene transfer. Vision Res.
2008;48:353-359.
142. Schultz BR, Chamberlain JS. Recombinant adeno-associated virus transduction and
integration. Mol Ther. 2008;16:1189-1199.
143. Lipinski DM, Thake M, MacLaren RE. Clinical applications of retinal gene therapy. Prog
Retin Eye Res. 2013;32:22-47.
144. Muzyczka N. Use of adeno-associated virus as a general transduction vector for
mammalian cells. Curr Top Microbiol Immunol. 1992;158:97-129.
73

145. McLaughlin SK, Collis P, Hermonat PL, Muzyczka N. Adeno-associated virus general
transduction vectors: analysis of proviral structures. J Virol. 1988;62:1963-1973.
146. Zhong L, Li B, Jayandharan G, et al. Tyrosine-phosphorylation of AAV2 vectors and its
consequences on viral intracellular trafficking and transgene expression. Virology. 2008;381:194202.
147. Seisenberger G, Ried MU, Endress T, Buning H, Hallek M, Brauchle C. Real-time singlemolecule imaging of the infection pathway of an adeno-associated virus. Science.
2001;294:1929-1932.
148. Sonntag F, Bleker S, Leuchs B, Fischer R, Kleinschmidt JA. Adeno-associated virus type
2 capsids with externalized VP1/VP2 trafficking domains are generated prior to passage through
the cytoplasm and are maintained until uncoating occurs in the nucleus. J Virol. 2006;80:1104011054.
149. Thomas CE, Storm TA, Huang Z, Kay MA. Rapid uncoating of vector genomes is the key
to efficient liver transduction with pseudotyped adeno-associated virus vectors. J Virol.
2004;78:3110-3122.
150. Zhong L, Zhao W, Wu J, et al. A dual role of EGFR protein tyrosine kinase signaling in
ubiquitination of AAV2 capsids and viral second-strand DNA synthesis. Mol Ther.
2007;15:1323-1330.
151. Zhao W, Wu J, Zhong L, Srivastava A. Adeno-associated virus 2-mediated gene transfer:
role of a cellular serine/threonine protein phosphatase in augmenting transduction efficiency.
Gene Ther. 2007;14:545-550.
152. Wu Z, Asokan A, Samulski RJ. Adeno-associated virus serotypes: vector toolkit for
human gene therapy. Mol Ther. 2006;14:316-327.
153. Schmidt M, Voutetakis A, Afione S, Zheng C, Mandikian D, Chiorini JA. Adenoassociated virus type 12 (AAV12): a novel AAV serotype with sialic acid- and heparan sulfate
proteoglycan-independent transduction activity. J Virol. 2008;82:1399-1406.
154. Boutin S, Monteilhet V, Veron P, et al. Prevalence of serum IgG and neutralizing factors
against adeno-associated virus (AAV) types 1, 2, 5, 6, 8, and 9 in the healthy population:
implications for gene therapy using AAV vectors. Hum Gene Ther. 2010;21:704-712.
155. Agbandje-McKenna M, Kleinschmidt J. AAV capsid structure and cell interactions.
Methods Mol Biol. 2011;807:47-92.
156. Becerra SP, Rose JA, Hardy M, Baroudy BM, Anderson CW. Direct mapping of adenoassociated virus capsid proteins B and C: a possible ACG initiation codon. Proc Natl Acad Sci U
S A. 1985;82:7919-7923.

74

157. Trempe JP, Carter BJ. Alternate mRNA splicing is required for synthesis of adenoassociated virus VP1 capsid protein. J Virol. 1988;62:3356-3363.
158. Lebherz C, Maguire A, Tang W, Bennett J, Wilson JM. Novel AAV serotypes for
improved ocular gene transfer. J Gene Med. 2008;10:375-382.
159. Hellstrom M, Ruitenberg MJ, Pollett MA, et al. Cellular tropism and transduction
properties of seven adeno-associated viral vector serotypes in adult retina after intravitreal
injection. Gene Ther. 2009;16:521-532.
160. Petersen-Jones SM, Bartoe JT, Fischer AJ, et al. AAV retinal transduction in a large
animal model species: comparison of a self-complementary AAV2/5 with a single-stranded
AAV2/5 vector. Mol Vis. 2009;15:1835-1842.
161. McCarty DM. Self-complementary AAV vectors; advances and applications. Mol Ther.
2008;16:1648-1656.
162. Ferrari FK, Samulski T, Shenk T, Samulski RJ. Second-strand synthesis is a rate-limiting
step for efficient transduction by recombinant adeno-associated virus vectors. J Virol.
1996;70:3227-3234.
163. Daya S, Berns KI. Gene therapy using adeno-associated virus vectors. Clin Microbiol
Rev. 2008;21:583-593.
164. Gao G, Vandenberghe LH, Alvira MR, et al. Clades of Adeno-associated viruses are
widely disseminated in human tissues. J Virol. 2004;78:6381-6388.
165. Xie Q, Bu W, Bhatia S, et al. The atomic structure of adeno-associated virus (AAV-2), a
vector for human gene therapy. Proc Natl Acad Sci U S A. 2002;99:10405-10410.
166. Walters RW, Agbandje-McKenna M, Bowman VD, et al. Structure of adeno-associated
virus serotype 5. J Virol. 2004;78:3361-3371.
167. Nam HJ, Lane MD, Padron E, et al. Structure of adeno-associated virus serotype 8, a gene
therapy vector. J Virol. 2007;81:12260-12271.
168. Kern A, Schmidt K, Leder C, et al. Identification of a heparin-binding motif on adenoassociated virus type 2 capsids. J Virol. 2003;77:11072-11081.
169. Gabriel N, Hareendran S, Sen D, et al. Bioengineering of AAV2 capsid at specific serine,
threonine, or lysine residues improves its transduction efficiency in vitro and in vivo. Hum Gene
Ther Methods. 2013;24:80-93.
170. Aslanidi GV, Rivers AE, Ortiz L, et al. Optimization of the capsid of recombinant adenoassociated virus 2 (AAV2) vectors: the final threshold? PloS one. 2013;8:e59142.

75

171. Zhong L, Li B, Mah CS, et al. Next generation of adeno-associated virus 2 vectors: point
mutations in tyrosines lead to high-efficiency transduction at lower doses. Proc Natl Acad Sci U
S A. 2008;105:7827-7832.
172. Mowat FM, Gornik KR, Dinculescu A, et al. Tyrosine capsid-mutant AAV vectors for
gene delivery to the canine retina from a subretinal or intravitreal approach. Gene Ther.
2014;21:96-105.
173. Dalkara D, Byrne LC, Klimczak RR, et al. In vivo-directed evolution of a new adenoassociated virus for therapeutic outer retinal gene delivery from the vitreous. Sci Transl Med.
2013;5:189ra176.
174. Martin KR, Klein RL, Quigley HA. Gene delivery to the eye using adeno-associated viral
vectors. Methods. 2002;28:267-275.
175. Beltran WA, Boye SL, Boye SE, et al. rAAV2/5 gene-targeting to rods:dose-dependent
efficiency and complications associated with different promoters. Gene Ther. 2010;17:11621174.
176. Ghosh A, Yue Y, Lai Y, Duan D. A hybrid vector system expands adeno-associated viral
vector packaging capacity in a transgene-independent manner. Mol Ther. 2008;16:124-130.
177. Grose WE, Clark KR, Griffin D, et al. Homologous recombination mediates functional
recovery of dysferlin deficiency following AAV5 gene transfer. PloS one. 2012;7:e39233.
178. Boyd RF, Sledge DG, Boye SL, et al. Photoreceptor-targeted gene delivery using
intravitreally administered AAV vectors in dogs. Gene Ther. 2016;23:400.
179. Boyd RF, Boye SL, Conlon TJ, et al. Reduced retinal transduction and enhanced
transgene-directed immunogenicity with intravitreal delivery of rAAV following posterior
vitrectomy in dogs. Gene Ther. 2016;23:548-556.
180. Scalabrino ML, Boye SL, Fransen KM, et al. Intravitreal delivery of a novel AAV vector
targets ON bipolar cells and restores visual function in a mouse model of complete congenital
stationary night blindness. Hum Mol Genet.2015;24:6229-6239.
181. Kay CN, Ryals RC, Aslanidi GV, et al. Targeting photoreceptors via intravitreal delivery
using novel, capsid-mutated AAV vectors. PloS one. 2013;8:e62097.
182. Dalkara D. Deniz Dalkara and her Research Work. Vision Resaerch - European Vision
Institute; 2017:Web. 12 June 2017.
183. Bainbridge JW, Smith AJ, Barker SS, et al. Effect of gene therapy on visual function in
Leber's congenital amaurosis. N Engl J Med. 2008;358:2231-2239.

76

184. Jacobson SG, Cideciyan AV, Ratnakaram R, et al. Gene therapy for leber congenital
amaurosis caused by RPE65 mutations: safety and efficacy in 15 children and adults followed up
to 3 years. Arch Ophthalmol. 2012;130:9-24.
185. Nork TM, Murphy CJ, Kim CB, et al. Functional and anatomic consequences of
subretinal dosing in the cynomolgus macaque. Arch Ophthalmol. 2012;130:65-75.
186. Arroyo JG, Yang L, Bula D, Chen DF. Photoreceptor apoptosis in human retinal
detachment. Am J Ophthalmol. 2005;139:605-610.
187. Lewis GP, Chapin EA, Luna G, Linberg KA, Fisher SK. The fate of Muller's glia
following experimental retinal detachment: nuclear migration, cell division, and subretinal glial
scar formation. Mol Vis. 2010;16:1361-1372.
188. Fisher SK, Lewis GP, Linberg KA, Verardo MR. Cellular remodeling in mammalian
retina: results from studies of experimental retinal detachment. Prog Retin Eye Res. 2005;24:395431.
189. Lewis GP, Charteris DG, Sethi CS, Fisher SK. Animal models of retinal detachment and
reattachment: identifying cellular events that may affect visual recovery. Eye (London, England)
2002;16:375-387.
190. Le Meur G, Weber M, Pereon Y, et al. Postsurgical assessment and long-term safety of
recombinant adeno-associated virus-mediated gene transfer into the retinas of dogs and primates.
Arch Ophthalmol. 2005;123:500-506.
191. Boye SE, Boye SL, Lewin AS, Hauswirth WW. A comprehensive review of retinal gene
therapy. Mol Ther. 2013;21:509-519.
192. Tshilenge KT, Ameline B, Weber M, et al. Vitrectomy Before Intravitreal Injection of
AAV2/2 Vector Promotes Efficient Transduction of Retinal Ganglion Cells in Dogs and
Nonhuman Primates. Hum Gene Ther Methods. 2016;27:122-134.
193. Streilein JW. Ocular immune privilege: the eye takes a dim but practical view of
immunity and inflammation. J Leukoc Biol. 2003;74:179-185.
194. Streilein JW. Ocular immune privilege: therapeutic opportunities from an experiment of
nature. Nature reviews Immunology. 2003;3:879-889.
195. Streilein JW, Masli S, Takeuchi M, Kezuka T. The eye's view of antigen presentation.
Hum Immunol. 2002;63:435-443.
196. Wenkel H, Streilein JW. Analysis of immune deviation elicited by antigens injected into
the subretinal space. Invest Ophthalmol Vis Sci. 1998;39:1823-1834.
197. Mochizuki M, Sugita S, Kamoi K. Immunological homeostasis of the eye. Prog Retin Eye
Res. 2013;33:10-27.
77

198. Willett K, Bennett J. Immunology of AAV-Mediated Gene Transfer in the Eye. Front
Immunol. 2013;4:261.
199. Annear MJ, Bartoe JT, Barker SE, et al. Gene therapy in the second eye of RPE65deficient dogs improves retinal function. Gene Ther. 2011;18:53-61.
200. Kotterman MA, Yin L, Strazzeri JM, Flannery JG, Merigan WH, Schaffer DV. Antibody
neutralization poses a barrier to intravitreal adeno-associated viral vector gene delivery to nonhuman primates. Gene Ther. 2015;22:116-126.
201. Anand V, Chirmule N, Fersh M, Maguire AM, Bennett J. Additional transduction events
after subretinal readministration of recombinant adeno-associated virus. Hum Gene Ther.
2000;11:449-457.
202. Li Q, Miller R, Han PY, et al. Intraocular route of AAV2 vector administration defines
humoral immune response and therapeutic potential. Mol Vis. 2008;14:1760-1769.
203. Gao G, Wang Q, Calcedo R, et al. Adeno-associated virus-mediated gene transfer to
nonhuman primate liver can elicit destructive transgene-specific T cell responses. Hum Gene
Ther. 2009;20:930-942.
204. Vandenberghe LH, Wang L, Somanathan S, et al. Heparin binding directs activation of T
cells against adeno-associated virus serotype 2 capsid. Nat Med. 2006;12:967-971.
205. Mingozzi F, Anguela XM, Pavani G, et al. Overcoming preexisting humoral immunity to
AAV using capsid decoys. Sci Translat Med. 2013;5:194ra192.
206. Hareendran S, Balakrishnan B, Sen D, Kumar S, Srivastava A, Jayandharan GR. Adenoassociated virus (AAV) vectors in gene therapy: immune challenges and strategies to circumvent
them. Rev Med Virol. 2013;23:399-413.
207. Lundin KE, Gissberg O, Smith CI. Oligonucleotide Therapies: The Past and the Present.
Hum Gene Ther. 2015;26:475-485.

78

CHAPTER 2
CRXRDY/+ CAT: A LARGE ANIMAL MODEL FOR CRX-ASSOCIATED LEBER
CONGENITAL AMAUROSIS

Occelli LM, Tran NM, Narfström K, Chen S, Petersen-Jones SM.
CrxRdy Cat: A Large Animal Model for CRX-Associated Leber Congenital Amaurosis.
Invest Ophthalmol Vis Sci. 2016; 57: 3780-3792. DOI:10.1167/iovs.16-19444, PMID: 27427859

79

2.1. ABSTRACT
PURPOSE. Mutations in the retinal transcription factor cone-rod homeobox (CRX) gene
result in severe dominant retinopathies. A large animal model, the Rdy cat, carrying a
spontaneous frameshift mutation in Crx, was reported previously. The present study aimed to
further understand pathogenesis in this model by thoroughly characterizing the Rdy retina.
METHODS. Structural and functional changes were found in a comparison between the retinas
of CrxRdy/+ kittens and those of wild-type littermates and were determined at various ages by
fundus examination, electroretinography (ERG), optical coherence tomography and histologic
analyses. RNA and protein expression changes of Crx and key target genes were analyzed using
quantitative reverse transcriptase-PCR, Western blot and immunohistochemistry. Transcription
activity of the mutant Crx was measured by a dual-luciferase transactivation assay. RESULTS.
CrxRdy/+ kittens had no recordable cone ERGs. Rod responses were delayed in development and
markedly reduced at young ages and lost by 20 weeks. Photoreceptor outer segment development
was incomplete and was followed by progressive outer retinal thinning starting in the cone-rich
area centralis. Expression of cone and rod Crx target genes was significantly down-regulated.
The mutant Crx allele was overexpressed, leading to high levels of the mutant protein lacking
transactivation activity. CONCLUSIONS. The CrxRdy mutation exerts a dominant negative
effect on wild-type Crx by overexpressing mutant protein. These findings, consistent with those
of studies in a mouse model, support a conserved pathogenic mechanism for CRX frameshift
mutations. The similarities between the feline eye and to the human eye with the presence of a
central region of high cone density makes the CrxRdy/+ cat a valuable model for preclinical testing
of therapies for dominant CRX diseases.
.

80

2.2. INTRODUCTION
Inherited retinal degenerations result in a range of different phenotypes and can be caused
by mutations in a multitude of different genes (currently mutations in 240 different genes that
cause inherited retinal degenerations are listed. RetNet1 ; https://sph.uth.edu/retnet; available in
the public domain). Mutations in one of these genes, the cone-rod homeobox (CRX) gene, cause a
spectrum of retinopathies that vary in severity and age of onset. These CRX-linked retinopathies
are mostly dominantly inherited. Among them, Leber congenital amaurosis (LCA) is the most
severe, leading to vision loss starting in childhood. The less severe forms have a later onset and
can cause a variety of phenotypes including cone-rod dystrophy, retinitis pigmentosa and an
adult-onset macular dystrophy.2,

3

CRX is an OTX-like homeodomain transcription factor

expressed in both rod and cone photoreceptors and is essential for their development, maturation,
and continued survival.4-7 CRX interacts with subtype-specific transcription factors to control
rod-versus-cone specification during development and directly regulates many genes essential for
normal retinal function, including key components of the phototransduction cascade and the CRX
gene itself.8, 9 CRX binds to regulatory sequences of target genes and interacts with cofactors to
influence transcription levels.6, 10-13 It has a homeodomain near the N terminus that mediates
DNA binding6, 14 and two transactivation domains in the C-terminal portion for activating target
gene transcription.14
Disease-causing CRX mutations can be grouped into four classes based on the mutation
type and the functional characteristic of the resulting mutant protein.3 Among them, Class III
mutations consist of frameshift and nonsense mutations causing truncations of the protein
affecting the transactivation domains. The C-terminal truncated forms of CRX maintain DNA
binding but lack transcriptional activation function and thus have an antimorphic effect.2, 3, 15, 16
All identified Class III mutations are linked to autosomal dominant LCA or early onset severe
81

cone-rod dystrophy. To understand the pathogenesis of the Class III mutations, a knock-in
mouse model, Crx-E168d2 has been generated.15 The 2 bp deletion at the E168 codon
(Glu168del2) is equivalent to a human CRX-LCA mutation.15,

17

The heterozygous E168d2

mouse develops severe retinopathy, similar to CRX-LCA, and has been used to complete a
detailed investigation of the disease mechanism.15 This investigation revealed that the mutant
allele is overexpressed and interferes with the function of the wild-type (WT) allele. Although we
have learned a great deal from this mouse model, it has certain limitations. First, the mouse retina
differs from the human retina in photoreceptor distribution, particularly in the cone mosaic
patterns.18-22 Humans have a macula, a central retinal region of higher photoreceptor density, in
particularly of cones, including a central cone-only foveola. This macula region is responsible for
high-acuity color vision. The lack of an equivalent retinal region in the mouse is especially
problematic for a disease primarily affecting cones at early stages. Second, it is unclear if the
pathogenic mechanisms learned from this singular animal model are conserved among
mammalian species, including humans.
To overcome the above limitations, we carried out an in-depth characterization of a feline
model, the rod-cone dysplasia (Rdy) cat, which has a dominantly inherited, severe retinal
dystrophy23-27 due to a 1 bp deletion in Crx (p.Pro185LysfsTer2).28 The frameshift mutation leads
to a premature stop codon at the 185th residue with loss of the last 114 amino acids, eliminating
the region of Crx that is presumed to mediate transactivation. Several human CRX retinopathies,
most frequently classified as LCA, are due to frameshift mutations causing a stop codon at the
same position (see Table 2 in Tran et al.3) (Appendix A - Fig. 2.S1).29-38 The Rdy cat is a
valuable model for CRX-LCA because cats have an area centralis, a region of higher
photoreceptor density enriched with cones, which has strong similarities to human macula.39-41
Although the phenotype of the heterozygous Rdy cat (CrxRdy/+) has been partially characterized2382

26

, the dynamics of disease progression and underlying molecular changes have not been

investigated. The current study addresses this knowledge gap by providing a detailed
investigation of the progression of functional, cellular and molecular phenotypes of the
CrxRdy/+cat. The mutant cat shows incomplete photoreceptor maturation with cones more
severely affected than rods, followed by a progressive cone-led photoreceptor degeneration,
starting in the cone-rich area centralis. This phenotype is more accurately classified as an early
onset, severe cone-rod dystrophy (rather than a rod-cone dystrophy as originally described) that
mimics CRX-LCA. Similar to the E168d2 mouse model, the CrxRdy/+cat retina undergoes
significant biochemical and molecular changes before and during disease progression. More
strikingly, the mutant Crx allele produces much more mRNA and protein than the WT allele,
supporting across-species conservation of the cellular and molecular mechanisms underlying
Class III CRX mutation-mediated blinding disease. The CrxRdy/+cat provides an excellent large
animal model of CRX-LCA and will be invaluable for the preclinical testing of treatment
strategies.

2.3. MATERIALS AND METHODS
2.3.1. Ethics statement
All procedures were performed in accordance with the ARVO statement for the Use of
Animals in Ophthalmic and Vision Research and approved by the Michigan State University
Institutional Animal Care and Use Committee.

2.3.2. Animals
Purpose-bred CrxRdy cats maintained as a colony at Michigan State University were used
in this study. They were housed under 12L:12D cycles and fed a commercial feline dry diet
83

(Purina One Smartblend and Purina kitten chow; Nestlé Purina, St Louis, MO. USA). Animals
ranging from 4 weeks to one year of age were studied.

2.3.3. Ophthalmic examination and fundus imaging
Full ophthalmic examinations included indirect ophthalmoscopy, fundus photography
(Ret-Cam II, Clarity Medical Systems, Inc., Pleasanton, CA, USA) and imaging with confocal
scanning laser ophthalmoscopy (Spectralis OCT+HRA; Heidelberg Engineering Inc., Heidelberg,
Germany).

2.3.4. Electroretinography (ERG)
The kittens were dark-adapted for 1 hour and pupils were dilated with tropicamide
ophthalmic solution, UPS 1% (Falcon Pharmaceuticals Ltd., Fort Worth, TX, USA). Anesthesia
was induced, and following intubation, maintained with isoflurane (IsoFlo; Abbott Laboratories,
North Chicago, IL, USA). A Burian-Allen bipolar electrode contact lens (Burian-Allen ERG
electrode; Hansen Ophthalmic Development Lab, Coralville, IA, USA) was used, and a platinum
needle skin electrode placed over the occiput as used for grounding (Grass Technologies,
Warwick, RI, USA). ERGs were recorded using an Espion E2 Electrophysiology system with
ColorDome Ganzfeld (Diagnosys LLC, Lowell, MA, USA). A dark-adapted luminance-response
series (-4.5 to 1.4 log cd.s/m²), followed by light adaptation (10 minutes expose to a 30 cd/m²
white light), and a light-adapted series (-2.4 to 1.4 log cd.s/m²) and 33 Hz cone flicker (-0.4 log
cd.s/m²) were recorded. ERG a- and b-wave amplitudes and implicit times were measured in a
standard fashion.

84

The leading edge of the rod a-wave was fitted to the Birch and Hood42 version of the
Lamb and Pugh rod phototransduction model using the following equation:

The amplitude R is a function of the retinal luminance, I, and time, t, after the flash, and td is a
brief delay. S is a sensitivity factor, and Rmax is the maximum amplitude of the response.
The first limb of the dark-adapted b-wave luminance-amplitude plot was fitted to the
Naka-Rushton equation to derive values for retinal sensitivity (K is a semisaturation constant, the
luminance, L, that induces a response amplitude of ½ Rmax).43

where Rmax represents the maximum response amplitude of the first limb of the b-wave
luminance-response plot, the K is a semi-saturation constant, considered a measurement of retinal
sensitivity, and n is a factor of the slope of the plot at the position of K, suggested to indicate
retinal homogeneity.

2.3.5. Retinal morphology
2.3.5.1. In vivo Spectral Domain-Optical Coherence Tomography (SD-OCT)
SD-OCT imaging (Heidelberg Engineering) was used to capture single scan line and
volume scan images from the central retinal to include the area centralis and from the four
retinal quadrants (4 optic nerve head distances from the edge of the optic nerve head superiorly,
inferiorly, nasally and temporally as illustrated in Appendix B - Fig. 2.S2). Thicknesses of the
total retinal and outer nuclear layer (ONL) and receptor+ (including layers between retinal
pigmentary epithelium and outer plexiform layer 44) and inner retina layers between the inner
nuclear layer and the internal limiting membrane were measured using the Heidelberg Eye
Explorer (HEYEX) software.
85

2.3.5.2. Immunohistochemistry (IHC)
After cats were euthanized, their eyes were removed and immersed in 4%
paraformaldehyde (Electron Microscope Sciences, Hatfield, PA, USA) in phosphate-buffered
saline (PBS, Sigma-Aldrich Corp., Saint Louis, MO, USA) on ice for 2 to 3.25 hours. They were
then processed for immunohistochemistry and imaged as previously described 45 (Appendix H Table 2.S1 lists the antibodies used).

2.3.5.3. Plastic embedded sections
Eyes were fixed in 3% glutaraldehyde, 2% paraformaldehyde (Electron Microscope
Sciences) in 0.1 M PBS pH 7.4 (Sigma-Aldrich Corp.) on ice for 1 hour, then hemisectioned, and
the posterior eyecups were placed in the same fixative overnight. Following rinsing in 0.1 M
sodium cacodylate buffer samples from the dorsal, central and ventral retinal regions were
dissected, embedded in 2% agarose gel, 0.1 M sodium cacodylate buffer then embedded in resin
(SPURR;, Low Viscosity, Embedding Kit, Electron Microscopy Sciences).46 Five hundrednanometers sections were stained with Epoxy Tissue Stain (Electron Microscope Sciences).

2.3.6. Quantitative Reverse Transcriptase-Polymerase Chain Reaction (qRT-PCR)
Two retinal regions (central and peripheral) from 2-week-old kittens were dissected
(Appendix C - Fig. 2.S3A); in older animals samples were collected from five areas (superior farperiphery, superior mid-periphery, central (area centralis), inferior mid-periphery, inferior farperiphery (Appendix C - Fig. 2.S3B)). Samples were flash frozen and stored at -80°C until RNA
extraction. RNA extraction, cDNA synthesis, and qRT-PCR reaction were performed as
previously described.15 Levels of arrestin3 (Arr3, specific to cones), rhodopsin (Rho, specific to
rods), and total Crx (WT and mutant) mRNA were measured and normalized to Tubulin alpha86

1B chain (Tuba1b) and Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (for primers
sequence, see Appendix H - Table 2.S2).
Due to the difficulty of establishing a qRT-PCR assay to differentially amplify mutant
and WT Crx cDNA a PCR restriction enzyme assay was developed to estimate the mutant-to-WT
Crx mRNA ratio. Total combined Crx cDNA was amplified (forward primer 5'cgtggccacggtgcccatct-3' reverse primer 5'-tccaggccactgaaatagga-3') followed by Hpa II digestion
(BioLabs, Inc., Ipswich, MA, USA). The mutant Crx amplicon (189 bp) is not cut by Hpa II,
whereas the WT is (112 and 78 bp products). Following electrophoresis on 2% agarose gel, the
bands were imaged and quantified, and the mutant amplicon-to-WT amplicon ratio of calculated
(Image Lab 5.2.1. Bio-Rad Laboratories; Hercules, CA, USA). A control using known WT-tomutant Crx PCR product ratios generated from plasmid-cloned WT and mutant feline Crx was
included to verify the accuracy of the technique.

2.3.7. Western blot assay
Retina remaining after samples for qRT-PCR were dissected was flash frozen in liquid
nitrogen and stored at -80°. Protein extraction from nuclear versus cytoplasmic fractions and
Western blot assay was performed as previously described.15 Monoclonal mouse anti-β-actin
antibody (Sigma-Aldrich Corp.) and polyclonal rabbit anti-CRX 119b115 at 1:1000 were used to
probe the membranes. Secondary antibodies were goat anti-mouse IRDye 680LT and goat antirabbit IRDye 800CW (LI-COR Biosciences, Lincoln, NE, USA) respectively. Fluorescence was
detected using the Odyssey Infrared Imager (LI-COR Biosciences) and quantified using ImageJ
software47 (http://imagej.nih.gov/ij/; provided in the public domain by the National Institutes of Health,
Bethesda, MD, USA).

87

2.3.8. Dual-Luciferase assay
Dual-luciferase assays were performed as previously described.15 HEK293 cells (catalog ATCC
CRL-11268; American Type Culture Collection, Manassas, VA, USA) were cultured in
Dulbecco minimum essential media (Gilco, Life technologies, Carlsbad, CA, USA) with 10%
fetal bovine serum and penicillin/streptomycin (100 U/mL, Gibco, Life technologies). Cells at
60% confluence were transfected with 2 µg of mCrx-Luc reporter, which carries 500 bp of the
mouse Crx promoter driving firefly luciferase in the pGL3 vector (Promega Corp., Madison, WI,
USA) and 100 ng pcDNA3.1hisc, 100 ng of pCAGIG-feline Crx WT or 100 ng of pCAGIG-feline
CrxRdy, using CaCl2 (0.25 M) and boric acid-buffered saline (1x), pH 6.75 as previously
described.15 Cells were harvested 48 hours post transfection, and dual-luciferase assays run.

2.3.9. Statistical analysis
Statistical analysis of ERG, SD-OCT, cDNA levels, Western blots, and fluorescence
levels data differences were tested for normality (Shapiro-Wilk test for normality). Normally
distributed data was analyzed by unpaired 2-tailed Student’s T-test (significance level set at P <
0.05), nonparametric data by a Mann-Whitney rank sum test (SigmaPlot 12.0; Systat Software,
Inc., San Jose, CA, USA).
Statistical analysis of mRNA levels (using qRT-PCR) was carried out using a 2-way
repeat measure ANOVA (Holm-Sidak parametric method and Shapiro-Wilk normality test)
(SigmaPlot 12.0; Systat Software).

88

2.4. RESULTS
2.4.1. CrxRdy/+ kittens have markedly reduced retinal function
To examine the progression of functional changes in CrxRdy/+ kittens, ERGs were
recorded at multiple time points from 4 to 20 weeks of age (n = 4-8) and compared with those of
WT littermate controls (n = 3-7). Light-adapted ERGs could not be recorded from CrxRdy/+ kittens
at any time point. Small dark-adapted responses were recordable and showed that the CrxRdy/+
kittens had severely reduced retinal function (Figs. 2.1 and 2.2). At 4 weeks, a very low
amplitude negative waveform typical of a scotopic threshold response (STR) was recordable
from CrxRdy/+ kittens, whereas the waveform of WT kittens was similar in shape to that of adult
cats (data not shown). By 6 weeks of age the CrxRdy/+ kittens had very small a- and b-wave
responses. Interestingly, responses continued to develop through 10 weeks of age, although they
were very reduced compared to the WT (the WT kitten ERGs had peak amplitudes at 12 weeks
of age). After peaking at 10 weeks of age, responses progressively declined until the ERG was
unrecordable at approximately 20 weeks of age (Figs. 2.1A and 2.2C). At peak retinal function
(10 weeks of age), the a-wave of CrxRdy/+ kittens had a similar threshold to that of WT kittens,
although the relatively prominent STR made precise identification of the a-wave threshold
difficult (Figs. 2.1A and 2.2A). However, compared to the peak WT controls, the peak mean
maximum a-wave amplitude was significantly reduced and delayed, at only ~30% of the mean
control amplitude (P = 0.002) and with a mean implicit time approximately 2.5 to 4.5 times
longer, depending on the stimulus strength (P < 0.001 to 0.003) (Figs. 2.1A, 2.1B, 2.2B and
2.2C). Although the a-wave of the CrxRdy/+ kitten was very reduced it was still possible to fit the
leading edge of the response at 10 weeks of age to the Birch and Hood model to assess rod
phototransduction. This showed a significant decrease in Rmax in the CrxRdy/+ kittens compared to
that in WT kittens (-23.86 ± 10.34 compared to -64.76 ± 25.87 µV, respectively; P = 0.003). The
89

sensitivity log S of the response was also significantly decreased in the CrxRdy/+ kittens (0.54 ±
0.23 compared to 1.27 ± 0.12 log scot td−1.sec−3 (scotopic torland-seconds) in WT kittens, P <
0.001) (Fig. 2.1B).
The b-wave of the CrxRdy/+ kitten was even more severely decreased in amplitude than the
a-wave and was also delayed. At 10 weeks of age, compared to that in WT controls, the b-wave
response threshold was elevated by about 1.5 to 2 log units, and the mean maximum amplitude
was only ~20% that of controls (P < 0.001), and implicit times were 2 to 3 times longer (P <
0.001 to 0.071) (Figs. 2.1A and 2.2). Naka-Rushton fittings were performed in CrxRdy/+ kittens (n
= 7) and WT control kittens (n = 6) at 10 weeks of age to derive values for the Rmax, the semisaturation constant K and n the slope factor. All three factors were significantly different between
CrxRdy/+ kittens and WT controls. The mean Rmax was much lower in CrxRdy/+ kittens (20.1 ± 14.7
compared with 169.3 ± 52.5 µV in controls, P = 0.001), indicating reduced retinal function. The
mean of the factor n was increased, suggesting a reduction in the homogeneity of the retinal
response (2.3 ± 1.98 compared to 0.91 ± 0.08, respectively, P = 0.035). Finally the mean
luminance required to induce a response of ½Rmax was significantly increased (0.027 ± 0.013
compared to 0.008 ± 0.003 cd.s/m2, respectively, P = 0.033) indicating decreased retinal
sensitivity. This ~0.5 log unit increase in stimulus luminance required to induce a response of
½Rmax was less than the increase in response threshold for the dark-adapted b-wave (1.5 to 2 log
units) (Fig. 2.1C).

90

Figure 2.1. Dark-adapted luminance series ERG from CrxRdy/+ and WT kittens, a-wave
modeling and b-wave Naka-Ruston fitting.
(A) Representative dark-adapted luminance series ERG from CrxRdy/+ and WT kittens at 6,
10, 15 and 20 weeks of age. Flash stimuli ranged from -4.5 (top) to 1.4 (bottom) log cd.s/m². The
CrxRdy/+ kitten has very reduced (note the scale difference) and delayed a- and b-waves.
Oscillatory potentials were present on the b-wave of the CrxRdy/+ kitten ERG. Note the relatively
large STR in the CrxRdy/+ kitten, which remains prominent to higher flash luminances than
normal; the developing a-wave becoming superimposed on it. A- and b-wave thresholds occurred
at similar flash luminances in contrast to those of the WT, where b-wave threshold occurs at a
much lower stimulus strength than a-wave threshold.
91

Figure 2.1. (cont’d)
(B) Modeling of the leading edge of the rod-isolated ERG a-wave of a representative
CrxRdy/+ and WT kitten at 10 weeks of age.
The raw a-waves (solid lines) and fitted curves (dashed lines) for four flash stimuli ranging 0 to
1.4 log cd.s/m². Note the CrxRdy/+ kitten rod photoreceptor Rmax (maximum receptor response) is
much lower than that of the WT kitten.
(C) Naka-Rushton fitting of the first limb of the dark-adapted b-wave luminance-response
plot of a representative CrxRdy/+ and WT kitten at 10 weeks of age.
The raw b-waves data values are shown by round symbols and the Naka-Rushton fit by solid
lines. ½Rmax of each waveform is represented by the horizontal dashed lines, and the luminance
required to elicit a response of ½Rmax (the semisaturation constant K) is indicated by the vertical
dashed lines. Note the semisaturation constant K of CrxRdy/+ kitten is elevated by approximately
0.8 log units compared to the WT and the Rmax (maximum amplitude of the first limb of the bwave luminance amplitude plot) is very reduced.

92

Figure 2.2. A-wave and b-wave amplitude and implicit time plotted relative to flash
luminance (A-B) and maximal recorded amplitude plotted relative to age (C).
(A) Dark-adapted a- and b-wave luminance-response plots from 10-week-old WT and
CrxRdy/+ kittens (the age at which maximum amplitudes were recordable from the CrxRdy/+
kittens). Note the CrxRdy/+ kittens had markedly reduced a- and b-wave amplitudes. The a-wave
threshold was masked by the STR in the CrxRdy/+ kittens (see Fig. 2.1A). Therefore, the negative
component of the waveform at intensities lower than that indicated by the arrow in the figure
consisted of the STR then with increasing intensities a combination of STR and a-wave. At
intensities greater than -1.6 log cd.s/m2 the a-wave was clearly discernible. The b-wave threshold
was elevated by ~2 log units in CrxRdy/+ kittens.
(B) Dark-adapted STR, a- and b-wave luminance-implicit time plots from 10-week-old WT
and CrxRdy/+ kittens. Note the increased implicit times for the CrxRdy/+ kittens for both a- and bwaves. The implicit times (left plot) at intensities below that indicated by the arrow represent that
of the STR.
93

Figure 2.2. (cont’d)
(C) A-wave and b-wave maximum amplitudes-age plots. The increase in ERG waveforms
reflects retinal maturation. Peak amplitudes were recorded at 10 weeks of age for the CrxRdy/+
kitten compare to 12 weeks of age for WT kittens. By 20 weeks of age the CrxRdy/+ ERG was
almost extinguished. †P ≤ 0.1,*P < 0.05, **P < 0.01 and ***P < 0.001 (n = 3 to 8).
2.4.2. CrxRdy/+ kittens have a progressive photoreceptor degeneration starting in the
area centralis
To determine how photoreceptor degeneration evolved in CrxRdy/+ kittens, in vivo
ophthalmic imaging was performed at multiple time points from 6 weeks to 1 year of age.
Ophthalmoscopic examination revealed tapetal hyperreflectivity in CrxRdy/+ kittens (an indication
of retinal thinning) in the area centralis from 7 weeks of age. Generalized tapetal
hyperreflectivity and superficial retinal blood vessel attenuation was apparent from as early as 20
weeks of age (Fig. 2.3).

Figure 2.3. Color fundus photographs showing progression of fundus changes in CrxRdy/+
kittens from 6 weeks of age to 1 year of age ((E-H) right eye shown) compared to WT (A-D).
The CrxRdy/+ kitten developed tapetal hyperreflectivity (indicative of retinal thinning) in the area
centralis (high photoreceptor density – region indicated by the (arrows)) as first seen in the
image at 12 weeks of age. Hyperreflectivity of the entire tapetal fundus was discernible from 20
weeks of age and had progressed by one year of age. Superficial retinal blood vessel attenuation
developed ((H) remaining very attenuated superficial retinal blood vessels are indicated by
arrowheads).
94

Retinal SD-OCT cross-sectional images were recorded from 4 to 26 weeks of age (n = 38 for CrxRdy/+ kittens and n = 2-8 for WT littermate controls). The first abnormality detected in
the CrxRdy/+ kittens was a halt in the maturation of the zone on the SD-OCT image that
corresponds to the photoreceptor inner and outer segments (IS/OS). This was followed by a
progressive thinning of the outer retinal layers starting in the area centralis (Fig. 2.4 and
Appendix D - Fig. 2.S4). The SD-OCT image of layers representing inner and outer segments
was thinner than in controls, and the bands that comprise the interdigitation zone and ellipsoid
zone48 could not be discerned in the CrxRdy/+ kittens. In WT kittens, these zones became clearly
visible as the retina matured (typically they could easily be seen by 6 weeks of age (Fig. 2.4A,
top panel)). In the CrxRdy/+ kittens, there was further progressive thinning of the IS/OS until it
disappeared as the entire outer retina progressively thinned (Fig. 2.4A, lower panel). The
lamination of the rest of the retina on SD-OCT imaging initially appeared normal, and at 4 weeks
of age, CrxRdy/+ and WT kittens had comparable ONL thickness in the area centralis (Fig. 2.4B).
Thereafter a progressive outer retinal thinning occurred starting in the area centralis and
eventually spreading to involve the peripheral retina (the heat map in Fig. 2.4C illustrates the
more severe retinal thinning in the area centralis). Despite developing some retinal function, by
6 weeks of age, the ONL was significantly thinned in the region of the area centralis (Figs. 2.4A
and 2.4B) and by 12 weeks of age, it was reduced to ~25% the thickness of that in the WT kitten
(P < 0.001), (Figs. 2.4A and 2.4B). The REC+ layer (which approximates the entire length of the
photoreceptors, i.e., synaptic termini, cell bodies, and IS/OS) was reduced by ~50% by 12 weeks
of age (P < 0.001) (Figs. 2.4A and 2.4B). The thinning of the outer retinal layers progressed, and
by 26 weeks of age, the ONL in the area centralis was no longer discernible (Figs. 2.4A and
2.4B). As the outer retina thinned, the inner retina initially thickened, such that by 12 weeks the
inner retina of the CrxRdy/+ kittens was ~30% greater than that of controls in the area centralis
95

region (P < 0.001), whereas due to the severe thinning of the outer retina the total retinal
thickness had decreased to ~80% of normal (P < 0.001) (Figs. 2.4B and 2.4C). Similar retinal
changes developed in the four retinal quadrants between 10 and 20 weeks of age (Appendix D Fig. 2.S4).

Figure 2.4. Spectral Domain – Optical Coherence Tomography (SD-OCT) in vivo retinal
morphology analysis.
(A) SD-OCT cross-section views of the retina in the region of the area centralis of
representative WT (1-5) and CrxRdy/+ (6-10) cats at the following ages: 6, 12, and 20 weeks, 6
months and 1year of age. The white arrows indicate the outer nuclear layer (ONL) which
progressively thinned in the area centralis region of CrxRdy/+ cats. Note, specific features of the
SD-OCT image including photoreceptor ellipsoid zone (EZ) and interdigitation zone (IZ)
boundaries were not discernible in the CrxRdy/+ kittens. The magnified image of an OCT image of
a WT retina on the right indicates the layers that were measured.
96

Figure 2.4. (cont’d)
TR, total retina; REC+, receptor plus, which includes all layers from the interdigitation zone to
the outer plexiform layer (OPL), representing the entire photoreceptor cell length; ONL, outer
nuclear layer; IR, inner retina, including all layers from inner nuclear layer to the external
limiting membrane.
(B) Thickness of retinal layers in the area centralis.
1. ONL thickness in area centralis of CrxRdy/+ and WT kittens at 4, 6, 8, 10, 12, 15, and 20
weeks and 6 months of age. Significant ONL thinning was apparent at 6 weeks of age with a
decrease ~50% normal thickness between 7 to 10 weeks of age in CrxRdy/+ kittens. By 6 months
of age the ONL was no longer apparent. †P ≤ 0.1; ***P < 0.001 (n = 2-8).
2. TR, REC+, ONL and IR layer thicknesses in the area centralis of CrxRdy/+ kittens
normalized to controls at 4, 6, 8, 10, 12, 15, and 20 weeks and 6 months of age.
ONL, REC+, and TR thicknesses were decreased in CrxRdy/+ kittens from 6 weeks of age. In
contrast, the IR became significantly thicker in CrxRdy/+ kittens compared to that of WT kittens.
Those differences were statistically significant from 10-weeks of age (P < 0.001 for ONL, REC+,
and TR; P = 0.008 for IR).
(C) Total retinal thickness map in the area centralis. The region of the area centralis indicated
on the confocal scanning laser ophthalmoscope image (1) is represented as a color heat map (the
optic nerve head is on the left lower). Warmer colors represent thicker retina, whereas cooler
colors are thinner retina. Althought the WT kittens had a relatively homogenous retinal thickness
in this region at 6 months of age (2), the CrxRdy/+ kittens showed a progressive thinning the center
of the area centralis, with severe thinning by 6 months of age (3-6). The color map also
demonstrates that in both WT and CrxRdy/+ kittens, the retina is thicker in the region of retinal
vessels and thinner towards the periphery (top left).

Examination of plastic embedded semi-thin sections revealed that the maturation of the
shape of CrxRdy/+ photoreceptor nuclei appeared delayed; at 6 weeks of age, they still had a
spindle shape typical of the immature photoreceptor, whereas in WT kittens, they had gained a
mature, round shape by this age (Fig. 2.5). Also at this age mislocalized photoreceptor nuclei
could be seen in the subretinal space in the central region of the CrxRdy/+ kittens (Figs. 2.5 and
2.6). These mislocalized photoreceptor nuclei were positive for ML-opsin (medium/long
wavelength-opsin) immunolabeling (Fig. 2.6). Compared to the well-developed WT
photoreceptor OS, those of CrxRdy/+ kittens were much shorter and were disorganized. Those
defects worsened with age, and by 20 weeks, OS were no longer apparent (Figs. 2.5 and 2.6).

97

Figure 2.5. Representative plastic sections of retina from central, dorsal and ventral regions
in WT and CrxRdy/+ kittens at 6 and 20 weeks of age.
Note that mislocalized photoreceptor nuclei ((black arrowheads) see magnified views) were
present in the subretinal space or bulging through the ELM of the central region of the CrxRdy/+
retina at both ages. OS, photoreceptor outer segment; IS, photoreceptor inner segment; ONL,
Outer Nuclear Layer; OPL, Outer Plexiform Layer; INL, Inner Nuclear Layer; IPL, Inner
Plexiform Layer; GCL/NFL, Ganglion Cell Layer/Nerve Fiber Layer; white star, photoreceptor
IS; black star, photoreceptor OS; black arrow, External Limiting Membrane (ELM); white
arrowhead, Retinal Pigmentary Epithelium (RPE) nuclei.

98

To further investigate rod versus cone subcellular structural changes, immunolabeling of
key photoreceptor structural and phototransduction proteins was performed on frozen retinal
sections (Fig. 2.6, Appendix E - Fig. 2.S5 and Appendix H - Table 2.S1). At 2 weeks of age,
CrxRdy/+ kittens had minimal human cone arrestin (hCAR) signals (hCAR labels both cone types)
compared to the WT kittens (Fig. 2.6). By 6 weeks of age, a reduced number of hCAR-labeled
cones (compared to those in WT controls) were detectable, but they had very short, stunted OS as
well as shorter IS. At 12 weeks of age, although cones in the WT retina appeared mature,
CrxRdy/+ retinas showed a severe loss of cones, and the remaining cones had severely shortened
OS/IS. By 20 weeks of age, there were very few remaining cones. Short wavelength cones were
more severely affected than medium/long wavelength cones. At 2 weeks of age S-opsin (short
wavelength-opsin) labeling of a few cone cell bodies and OPL synaptic terminals could be seen
in some animals, but no S-opsin immunolabeling was detected at 6, 12 and 20 weeks of age
(Appendix E - Fig. 2.S5). Apart from the few S-opsin positive cones at 2 weeks of age, the
remaining cones were ML-opsin positive (Fig. 2.6). Occasional stunted ML-opsin labeled OS
were present, but most labeling was of the stunted IS, cell bodies, and synaptic terminals,
indicative of mislocalization (in WT controls, ML-opsin only labeled the OS) (Fig. 2.6 and
Appendix E - Fig. 2.S5).

99

Figure 2.6. Immunohistochemistry using rod and cone markers.
Frozen sections from the dorso-temporal retinal region of CrxRdy/+ kittens and WT controls at the
indicated ages were immunostained with rhodopsin (RetP1), cone arrestin (hCAR) and
medium/long wavelength-opsin (ML-opsin) along with the pan cone marker peanut agglutinin
(PNA). The higher magnification views of CrxRdy/+ sections (bottom row) show mislocalization
of ML-opsin to the inner segments, cell bodies and pedicles of the cones (white arrowheads).
photoreceptor outer segment; ONL, Outer Nuclear Layer; OPL, Outer Plexiform Layer; INL,
Inner Nuclear Layer; IPL, Inner Plexiform Layer; GCL/NFL, Ganglion Cell Layer/Nerve Fiber
Layer; white arrowhead, mislocalized photoreceptor nuclei.
CrxRdy/+ retinas had reduced labeling for rod opsin (RetP1, Fig. 2.6). Rod OS did start to
develop, but this was halted prior to maturation and was followed by a progressive degeneration
such that by 20 weeks of age they were markedly atrophied in all retinal regions. Parallel with
the failure of rod maturation, mislocalization of rod opsin to the inner segments, cell body and
synaptic terminal occurred and was present at all ages tested.

100

Immunolabeling for rod bipolar cells (using an anti-PKCalpha antibody) showed
apparently normal numbers of rod bipolar cells at the ages examined, but their dendrites were
retracted from an early age (Appendix E - Fig. 2.S5).
Immunolabeling for glial fibrillary acidic protein (GFAP) was markedly increased by 12
weeks of age, indicative of extensive Müller cell activation (Appendix E - Fig. 2.S5).49-51

2.4.3. CrxRdy/+ retinas had markedly reduced levels of cone and rod transcripts
To decipher the molecular changes underlying CrxRdy/+ retinal pathology, we investigated
mRNA levels of selected CRX target genes; cone arrestin (arrestin3 (Arr3)), rhodopsin (Rho,
specific to rods), and total Crx (mutant plus WT) (Fig. 2.7 and Appendix I - Table 2.S2) in retinal
subregions (Appendix C - Fig. 2.S3). For all retinal regions at the four ages tested (2, 6, 12 and
20 weeks of age) mRNA levels for Arr3 and Rho in the CrxRdy/+ kittens were significantly
decreased. Arr3 was more dramatically decreased (between 93 and 99%) than Rho (between 31
and 81%). There were no consistent differences in the mRNA levels between the different retinal
regions tested. In contrast, Crx mRNA was overexpressed in the CrxRdy/+ kittens when compared
to WT controls (between 9 and 185%). For the average of all retinal regions, the difference was
significant at 6 and 20 weeks of age (P = 0.037 and 0.038, respectively) (Fig. 2.7A); however
these differences did not achieve statistical significance for every retinal region tested at each
age. More importantly, when allele-specific expression levels for the mutant versus WT allele
were assessed, a significantly higher level of mutant Crx transcript than WT Crx transcript was
detected (P < 0.001) (Figs. 2.7B and 2.7C) with a ratio of 7.4 ± 0.4 times the amount of mutant
transcript to WT transcript at 6 weeks of age.

101

Figure 2.7. Changes of mRNA expression in CrxRdy/+ retinas.
(A) qRT-PCR overall (average of the areas assessed) mRNA expression levels of arrestin3
(Arr3 = Cone arrestin), rhodopsin (Rho) and Crx in CrxRdy/+ retina at 2, 6, 12 and 20 weeks of
age relative to levels in WT retinas.
The CrxRdy/+ kitten retinas had significantly decreased levels of cone and rod opsin mRNA. In
contrast, the expression of total Crx was significantly increased. P-values comparing the mean
CrxRdy/+ and WT expression levels are †P ≤ 0.1,*P < 0.05, **P < 0.01, and ***P < 0.001 (n = 3).
(B, C) PCR restriction enzyme digest was used to compare the levels of mutant mRNA
compared to those of WT mRNA by using cDNA from 6-week-old CrxRdy/+ and WT retinas.
(B) Agarose gel of PCR nondigested (ND) and digested (D) products digested with HpaII,
which digests the amplicon from WT cDNA. Note the presence of both the mutant Crx
transcript (189 bp of length) and the WT Crx transcript (digested in to products of 78 and 112 bp)
in the CrxRdy/+ kitten retina (kittens 4, 5 and 6). The WT kitten retina contains only WT Crx
transcript (completely digested in kittens 1, 2 and 3).
102

Figure 2.7. (cont’d)
(C) Wild-type-to-mutant Crx transcripts level ratios in wild-type and CrxRdy/+ kittens.
Densitometry measurements of the bands in the agarose gel ((B) mutant 189 bp and sum of WT
transcript digested products 78 and 112 bp) from the CrxRdy/+ kitten retinas were assessed. In 6week-old CrxRdy/+ kitten, the mutant-to-WT Crx transcript ratio was ~7.4:1. (mutant transcript
representing 88% of the total transcript; P < 0.001). As expected in WT kittens, the WT
transcript represents 100% of the total Crx mRNA.

This allele specific overexpression of the mutant product was confirmed by Western blot
assays (Fig. 2.8). The mutant Crx protein was at higher levels than the WT Crx protein in the
CrxRdy/+ retinas at each time point (Fig. 2.8B). The mutant protein was able to enter the nucleus as
indicated by the results of Western blot of separated retinal nuclear and cytoplasmic fractions
(Appendix F - Fig. 2.S6). As anticipated for a heterozygous animal, the amount of WT Crx
protein was lower in the CrxRdy/+ kittens than in WT and the difference was significant at 12 and
20 weeks of age (P < 0.01) (Fig. 2.8B). Because of the overproduction of the truncated mutant
protein, the level of the combined Crx proteins was markedly higher in the CrxRdy/+ kittens
compared to WT kittens at 2, 6 and 12 weeks of age but not at 20 weeks of age (an age at which
photoreceptor degeneration was well established).

103

Figure 2.8. Western blot analysis for Crx nuclear protein.
(A) Western blot for nuclear Crx protein (immunolabeled with antibody 119b1). The
amount of Crx protein present in retinal nuclear extract was investigated by Western blot from
kittens at 2, 6, 12, and 20 weeks of age. Note the presence in the CrxRdy/+ kitten’s retina of the
truncated mutant Crx protein, which persisted to the 20 week-old time point, whereas the amount
of WT protein had decreased by 20 weeks of age. Beta-actin was used as protein loading control.
(B) Normal and mutant protein levels in CrxRdy/+ and wild-type kittens.
Crx protein levels were normalized to beta-actin levels, and the CrxRdy/+ kitten protein levels
shown normalized to the Crx levels in the WT retinas. The level of normal protein was lower in
the CrxRdy/+ kitten retina than in the WT kittens at each age. Note high levels of the truncated
mutant Crx protein compared to the amount of normal protein in CrxRdy/+ kitten retina and
therefore the overall higher total Crx protein levels (normal plus mutant) in CrxRdy/+ kitten retina
compared to WT kitten retina. †P ≤ 0.1; *P < 0.05; **P < 0.01 (n = 2 to 4; statistical analysis was
applied only when n ≥ 3 for both WT and CrxRdy/+ kitten retina sample).

104

2.4.4. Effect of the Rdy mutation on Crx’s transcription regulatory activity
To determine whether the Rdy mutation altered Crx function, we measured the ability of
recombinant Crx proteins to activate the target gene promoter Crx, driving a luciferase reporter in
HEK293 cells. This dual-luciferase reporter assay revealed that the mutant Crx protein failed to
activate the Crx promoter (P = 0.729) while the WT protein led to significant activation (P <
0.001) (Appendix G - Fig. 2.S7), confirming that this class III Crx mutation eliminated
transactivation function.

2.5. DISCUSSION
This study expanded on previous studies showing that the CrxRdy/+ cat has a severe, early
onset, dominantly inherited, retinal degeneration.24-27 Similar to other Class III CRX mutation
models, overexpression of the mutant transcript occurs and most likely exerts a dominant
negative effect. These findings support previous studies in mouse models that suggest a
therapeutic approach by which early intervention to increase the normal-to-mutant CRX
transcript ratios could lessen the disease severity in CRX-LCA patients.3,

15

The CrxRdy/+ cat

enables characterization of the early changes that occur in retinal regions of high cone density,
which model the environment within the human macula. Such investigations are not possible in
mouse models because mice lack the retinal regional differences in photoreceptor distribution
and density of the human retina. The cat will be invaluable for preclinical testing of therapies to
rescue photoreceptors in this region that is so critical for human visual function.

105

2.5.1. The CrxRdy/+ kitten provides a model for human CRX- LCA phenotype
CrxRdy/+ kittens show incomplete maturation of photoreceptors associated with reduced
expression of photoreceptor transcripts and followed by progressive photoreceptor degeneration.
Despite the importance of CRX as a transcription factor, the retina in the CrxRdy/+ kitten develops
relatively normal stratification (Figs. 2.4, 2.5, 2.6 and Appendix E - Fig. 2.S5). Cone nuclei do
become aligned to form a single layer in the outer most row of the ONL, similar to the WT
kittens, although from an early stage some become mislocalized to the subretinal space,
particularly in the area centralis. In the p.E168d2 mouse model of Class III CRX mutations,
retinal stratification also develops normally, but in contrast to the cat model, more extensive
mislocalization of cone nuclei to the inner portions of the ONL occurs.15 The photoreceptor
nuclei in the CrxRdy/+ kittens retain an immature oval shape because they are delayed in attaining
the adult circular appearance in retinal sections, reflecting the incomplete photoreceptor
maturation (Figs. 2.5, 2.6 and Appendix E - Fig. 2.S5). Similarly, only partial development of
inner and outer segments occurs. Cones are more severely affected than rods, with cone function
not being recordable by ERG at any age and photoreceptor degeneration developing most rapidly
in the area centralis, the region of highest cone density.39,41 Expression of the cone proteins
investigated (cone arrestin by qRT-PCR and IHC, and cone opsins by IHC) was much reduced,
more so than that of rod opsin (qRT-PCR and IHC). S-opsin positive cones were only detectable
in some kittens at 2 weeks of age and at no other ages, showing the most severe effects were on
the S-cones. The ML-cones remained present for longer but only developed very stunted outer
segments which did not show expression of ML-opsin. The reduced amounts of ML-opsin
present were mislocalized to other parts of the cell (Fig. 2.6 and Appendix E - Fig. 2.S5).
Rod photoreceptors showed evidence of maturing further than cones. Although outer
segments were stunted there was rod opsin present, although expression levels were much
106

reduced. Rod function was recordable by ERG and showed evidence of maturation to 10 weeks
of age prior to a rapid decline thereafter (Figs. 2.1A and 2.2C). Leon et al.26 had previously
performed a detailed electrophysiological study on the Rdy cat but needed to use intravitreal
recording, or to perform testing on ex-vivo retinal pieces, to reliably record responses and
overcome background electrical noise present when using corneal electrodes. In the current study
it was possible to record very small ERGs using corneal contact lens electrodes without resorting
to invasive methods. This probably reflects improvements in recording techniques rather than a
drift in phenotype over the ~25 years since the study by Leon et al.26 Similar to that study, a
negative waveform ERG waveform was recorded to lower stimuli strengths in our study. The
shape and timing of this waveform are in keeping with it representing an inner retinal component
of the ERG present close to response threshold, the STR.52 A-and b-wave components of the
ERG developed later in age than in WT cats reflecting the delay and only partial nature of rod
photoreceptor maturation. They were much reduced in amplitude and showed delayed timing.
Modeling of the leading edge of the rod a-wave showed a significant decrease in maximum
amplitude response Rmax and sensitivity log S (Fig. 2.1B). This reflects the reduced rod outer
segment length and low rod opsin levels in the affected cats. In the normal dark-adapted cat ERG
the b-wave appears with increasing strength of stimuli initially superimposed on the STR and as
its amplitude increases obscures it. In the CrxRdy/+ cat the appearance of the b-wave with
increasing stimulus strength was more severely delayed than that of the a-wave meaning the awave became superimposed on the STR prior to the development of the b-wave. These findings
of a more severe delay and suppression of the b-wave compared to the a-wave may reflect an
altered maturation of rod bipolar cells which are the origin of the rod ERG b-wave.53 CRX is
expressed in developing bipolar cells,54 so it is conceivable that impaired bipolar cell maturation
may be a cause for the more severe changes in the b-wave than the a-wave. An electron
107

microscopy study of Rdy cats previously reported an early reduction in the number of rod
spherules and cone pedicles,25 and synaptophysin (a synaptic vesicle protein) immunolabeling
was reported to be reduced in another study.27 PKCalpha immunolabeling of rod bipolar cells in
this study did not reveal an alteration in numbers of labeled cells early in the disease process
although an early retraction of dendrites was noted. Inner retinal components of the ERG such as
the STR and oscillatory potentials which would require bipolar cell signal transmission were
present and relatively prominent in the very small ERG responses from the CrxRdy/+ kittens.
Naka-Rushton fitting of the rod b-wave luminance-amplitude plots showed very reduced
values for the receptor response and also for retinal sensitivity (Fig. 2.1C). There was an
increase in the n value, which is a component reflective of the slope of the plot at the point of ½
Rmax and has been suggested to reflect a less homogeneous retinal response 55 and may reflect the
regional variation in the rapidity of photoreceptor degeneration.
Of the nine reported human disease causing CRX frameshift mutations that result in a
transcript shortened to 185 residues (as in the CrxRdy cat) (Appendix A - Fig. 2.S1), eight were
reported to result in an LCA phenotype.29-38 ERG results were reported from patients
representing seven of the nine mutations (Appendix A - Fig. 2.S1) (Table 2.2 in Tran et al.3).
ERGs were not recordable from infants when tested for three of the mutations.29, 34, 36, 56 When
tested in older children and adults the ERG was also reported to be nonrecordable,32, 35, 37, 38 with
the exception of one patient reported by Koenekoop et al.36 who had a p.A177d1 mutation. This
patient had a nonrecordable ERG at 8 months of age, then as a child had some improvement in
vision and a recordable cone ERG when tested at both 10 and 11 years of age. This is the only
instance in the literature where improvement in visual function was noted in a CRX-LCA patient.
It seems likely that this was due to some degree of delayed retinal maturation occurring prior to
photoreceptor degeneration. Development of the small ERG responses in the CrxRdy cat are
108

delayed and there is some evidence of rod maturation but unlike the human patient, cone function
was not recordable and cones deteriorated prior to rods.
Following the halting of photoreceptor development in the CrxRdy/+ kitten, a rapid coneled loss in photoreceptors occurs, resulting in outer retinal thinning starting in the area centralis
(Fig. 2.4). With disease progression, outer retinal thinning in the more peripheral retinal regions
also developed (Appendix D - Fig. 2.S4). The initial thickening of the inner retina detected on
SD-OCT imaging, may be due to neuronal remodeling and glial activation as commonly seen in
models of retinal degeneration57 (Appendix E - Fig. 2.S5).

2.5.2. Molecular mechanism underlying CrxRdy phenotype and implications in
therapy development
The CrxRdy mutation results in a premature stop codon in the transactivation domain of
Crx28, the mutant transcript escapes nonsense-mediated decay and as shown in this study is
overexpressed (Fig. 2.7). Studies of other Class III CRX mutations have also shown that there is
mutant allele overexpression (human CRX-LCA p.I138d1 mutation, truncation at codon 185, and
the p.E168d2 knock-in mouse model, truncation at codon 171).15, 16, 29 The elevation of CrxRdy
transcript levels may be the result of increased synthesis or decreased degradation of the mutant
mRNA. Class III mutation-introduced premature stop codons could enhance RNA stability of the
mutant allele over its WT counterpart. A feedback regulatory mechanism to decrease Crx
transcripts when overexpressed could attribute to the reduction of WT Crx transcripts, while
mutant allele transcripts are resistant to this regulation. Further studies are required to ascertain
the precise mechanism involved. In the CrxRdy/+ kitten the mutant transcript and protein remained
at elevated levels even when photoreceptor degeneration was well established and the levels of
expression of the WT allele were very reduced (Figs. 2. and 2.8). This continued overexpression
109

of mutant Crx despite photoreceptor loss has not been previously demonstrated in similar
models. Similar to findings in the p.E168d2 knock-in mouse model, the truncated feline CrxRdy
protein fails to activate its own promoter in vitro (Appendix G - Fig. 2.S7) thus showing acrossspecies conservation of the cellular and molecular mechanisms underlying Class III CRX
mutations.
Prior to loss of photoreceptors potential therapeutic interventions that address the
overexpression of the mutant Crx transcript may be translatable to human patients. These include
either knocking down the levels of the mutant transcript using, for example, anti-sense
oligonucleotides,58-60 or shRNA,61-63 or overexpressing the WT transcript

by gene

supplementation using adeno-associated viral vectors,64-67 or a combination of both approaches.
Supporting evidence for this approach is provided by a line of E168d2 mice where a Neo cassette
was not excised (E168d2neo) resulting in lowered expression of the truncated Crx protein and a
much milder phenotype than in the line of E168d2 mice where the Neo cassette had been
excised.15 Also, mice or humans heterozygous for null mutations in CRX have either a mild
phenotype or no phenotype indicating that severe phenotypes are not the result of simple
haploinsufficiency and supporting the hypothesis of a dominant negative effect of the mutant
protein.5, 7
To summarize, the CrxRdy/+ cat provides a large animal model for the severe dominant
CRX mutations associated with overexpression of a mutant transcript with an antimorphic effect
resulting in a LCA phenotype. The area centralis is affected earliest and degenerates prior to the
peripheral retina. Presence of the area centralis allows the assessment of therapeutic
interventions aiming to rescue function in this critical retinal region meaning the CrxRdy cat has a
valuable advantage over mouse models. The slow inner retinal degeneration in the face of
photoreceptor loss and complete blindness will also make this an excellent model for testing
110

optogenetic approaches to provide visual function by expression of light-sensitive proteins in
bipolar or ganglion cells.

2.6. ACKNOWLEDGEMENTS
The authors would like to thank Dr Cheryl Craft for the donation of the hCAR antibody,
Nate Pasmanter for his help with analyzing the ERG a-wave leading edges, and Hui Wang for
constructing feline Crx expression vectors.
Supported by National Institutes of Health Grants EY012543 and EY025272-01A1 (SC),
EY002687 (P30 Core Grant) (Washington University Department of Ophthalmology and Visual
Sciences [WU-DOVS]), EY013360 (T32 Predoctoral Training Grant) (WU), unrestricted funds
from Research to Prevent Blindness (WUDOVS), Foundation Fighting Blindness (SC), Hope for
Vision (SC), George H. Bird and ‘‘Casper’’ Endowment for Feline Initiatives (LMO and SMPJ),
Michigan State University Center for Feline Health and Well-Being (LMO and SMPJ), and
Myers-Dunlap Endowment (SMPJ).

111

APPENDICES

112

APPENDIX A – Figure 2.S1

Figure 2.S1. List of the CRX human mutations leading to the production of a premature stop
codon at amino acid 185 compared to the human wild-type and feline mutant sequence.

113

APPENDIX B – Figure 2.S2

Figure 2.S2. Retinal regions imaged by SD-OCT. Cross sectional retinal images were captured
for measurement of retinal layer thicknesses at the following regions (as indicated on the fundus
image by an asterisk): the area centralis; 4 optic nerve diameters from the optic nerve edge
superiorly, inferiorly, temporally and nasally.

114

APPENDIX C – Figure 2.S3

Figure 2.S3. Sites of retinal sampling for qRT-PCR. A. For the 2-week-old kittens, due to the
small globe size, retina was collected from two regions as indicated (central and peripheral
retinal regions). B. In the 6, 12 and 20 weeks of age kittens retinal biopsies were collected from
the indicated five regions (area centralis – AC; inferior mid-peripheral – Inf MP; inferior farperipheral – Inf FP; superior mid-peripheral – Sup MP; and superior far-periphery – Sup FP).

115

APPENDIX D – Figure 2.S4

Figure 2.S4. TR, REC+, ONL and IR layer thicknesses on SD-OCT images, four optic nerve
distance from the optic nerve rim itself A. Superiorly, B. Inferiorly, C. Temporally and D.
Nasally of CrxRdy/+ kittens normalized to control WT kittens at 4, 6, 8, 10, 12, 15, 20 weeks-old
and 6 months of age.
The ONL and REC+ thicknesses showed thinning with age in CrxRdy/+ kittens compared to WT.
TR was not significant thinned until 6 months of age inferiorly. Conversely, the IR became
thicker in CrxRdy/+ kittens compared to the wild-type kittens in all regions from 10 weeks of age.

116

APPENDIX E – Figure 2.S5

Figure 2.S5. Immunolabeling of the retina for S cones and inner retinal cells.
Frozen sections of central retinal labeled with PNA combined with S-opsin, and with GFAP, and
PKCalpha.
The CrxRdy/+ retina showed a lack of S-opsin staining cells. Cone nuclei (PNA positive) became
mislocalized to the subretinal space but did not stain for S-opsin (indicated by white arrowheads
in the bottom panel – high magnification view). There was marked Müller cell activation as
indicated by GFAP upregulation at 12 and 20 weeks of age. Rod bipolar cells were labeled by
PKCalpha and showed dendrite retraction in the CrxRdy/+ retina.
Key: OS= Photoreceptor Outer segment, IS= Photoreceptor Inner segment, ONL= Outer Nuclear
Layer, OPL= Outer Plexiform Layer, INL= Inner Nuclear Layer, IPL= Inner Plexiform Layer,
GCL/NFL= Ganglion Cell Layer/Nerve Fiber Layer; White arrowhead= Mislocalized
photoreceptor nuclei.

117

APPENDIX F – Figure 2.S6

Figure 2.S6. Western blot for Crx protein in retinal nuclear and cytoplasmic extracts from
2 week old kittens.
Note that the truncated mutant Crx protein was exclusively detected in the nuclear extract from
the CrxRdy/+ kitten and was at a higher level than the wild-type protein (immunolabeled with antiCrx antibody 119b1).
Beta-actin was used as protein loading control.

118

APPENDIX G – Figure 2.S7

Figure 2.S7. Dual-Luciferase assays for CRX transactivation activity on mouse CrxLuc reporter.
Crx auto-activation ability of WT or mutant Crx protein on its own promoter Crx (containing 2
binding sites within 500 bp upstream region of the mouse Crx gene) was tested using HEK293
cells transfected by plasmids containing the 500 bp mouse Crx promoter-luciferase
reporter (mCrx-Luc) and the indicated Crx protein expression vector. Comparing to
pcDNA3.1hisc control, only pCAGIG-feline Crx WT significantly activated the mCrxLuc reporter. pCAGIG-feline CrxRdy mutant did not show any transactivation compared to the
control vector.
P-values indicate as followed: **P<0.01 and ***P<0.001.

119

APPENDIX H – Table 2.S1.
Antibody – Source

Type

hCAR
(Human cone arrestin)
Dr. Cheryl Craft; LUMIJ,
University of Southern California,
Los Angeles, CA, USA
PNA
(Biotinylated Peanut Agglutinin)
Vector Labs Inc., Burlin-game,
CA, USA
ML-opsin
(Anti-Opsin, Red/Green;
Medium/ Long wavelength cone
opsin)
Millipore Corp., Billerica, MA,
USA
S-opsin
(Anti-Opsin, Blue; Short
wavelength cone opsin)
Millipore Corp., Billerica, MA,
USA
RetP1
(Rhodopsin Ab-1)
Thermo Scientific, Rockford, IL,
USA
GFAP
(Anti-Glial Fibrillary Acidic
Protein)
Cell Signaling Technology Inc.,
Danvers, MA, USA
PKCa
(Protein Kinase C-alpha)
BD Biosciences, San Jose, CA,
USA

Polyclonal
rabbit

Primary
Dilution
1:10,000

Secondary
Antibody – Source
Alexa Fluor 488 Goat antirabbit IgG
Life technologies, Carlsbad,
CA, USA

Secondary
Dilution
1:500

Biotinylated
Lectin

1:500

Alexa Fluor 488 Streptavadin
Life technologies, Carlsbad,
CA, USA

1:500

Polyclonal
rabbit

1:1,000

Alexa Fluor 568 or 594 Goat
anti-rabbit IgG
Life technologies, Carlsbad,
CA, USA

1:500

Polyclonal
rabbit

1:1,000

Alexa Fluor 568 or 594 Goat
anti-rabbit IgG
Life technologies, Carlsbad,
CA, USA

1:500

Monoclonal
mouse

1:2

1:500

Monoclonal
mouse

1:300

Alexa Fluor 594 Rabbit antimouse IgG
Life technologies, Carlsbad,
CA, USA
Alexa Fluor 594 Rabbit antimouse IgG
Life technologies, Carlsbad,
CA, USA

Monoclonal
mouse

1:500

Alexa Fluor 594 Rabbit antimouse IgG
Life technologies, Carlsbad,
CA, USA

1:500

Table 2.S1. List of antibodies used for IHC – their origins and dilutions

120

1:500

APPENDIX I – Table 2.S2.
Primer
name

Forward primer

Reverse primer

Amplicon
size (bp)

Annealing
temperature
(°C)

Crx Total

5' AAGACTCAGTACCCGGATGTGTA 3'

5' GGGGCTGTAGGAGTCTGAGAT 3'

223

60

Arr3

5' CGTTGTCCTGTATTCCCTAGAC 3'

5' GCTAGAGGCCAGATTAGTATCAC 3'

190

60

Rho

5' GGTGCCCTACGCCAGCGTG 3'

5' CAGTGGGTTCTTGCCACAG 3'

190

60

Tuba1b

5' GCTCTATTGCCTGGAACACG 3'

5' CATCTTCCTTGCCCGTGATG 3'

230

60

GAPDH

5' GGTCTTCACCACCATGGAGA 3'

5' TGGACTGTGGTCATGAGTCC 3'

237

60

Table 2.S2. Primer sequences for qRT-PCR assays

121

REFERENCES

122

REFERENCES

1.
Daiger SP, Rossiter BJF, Greenberg J, Christoffels A, Hide W. Data services and
software for identifying genes and mutations causing retinal degeneration. Invest Ophthalmol Vis
Sci. 1998;39:S295.
2.
Hull S, Arno G, Plagnol V, et al. The phenotypic variability of retinal dystrophies
associated with mutations in CRX, with report of a novel macular dystrophy phenotype. Invest
Ophthalmol Vis Sci. 2014;55:6934-6944.
3.
Tran NM, Chen S. Mechanisms of blindness: animal models provide insight into distinct
CRX-associated retinopathies. Dev Dyn. 2014;243:1153-1166.
4.
Chau KY, Chen S, Zack DJ, Ono SJ. Functional domains of the cone-rod homeobox
(CRX) transcription factor. J Biol Chem. 2000;275:37264-37270.
5.
Morrow EM, Furukawa T, Raviola E, Cepko CL. Synaptogenesis and outer segment
formation are perturbed in the neural retina of Crx mutant mice. BMC Neurosci. 2005;6:5.
6.
Chen S, Wang QL, Nie Z, et al. Crx, a novel Otx-like paired-homeodomain protein, binds
to and transactivates photoreceptor cell-specific genes. Neuron. 1997;19:1017-1030.
7.
Furukawa T, Morrow EM, Cepko CL. Crx, a novel otx-like homeobox gene, shows
photoreceptor-specific expression and regulates photoreceptor differentiation. Cell. 1997;91:531541.
8.
Hennig AK, Peng GH, Chen S. Regulation of photoreceptor gene expression by Crxassociated transcription factor network. Brain Res. 2008;1192:114-133.
9.
Peng GH, Chen S. Crx activates opsin transcription by recruiting HAT-containing coactivators and promoting histone acetylation. Hum Mol Genet. 2007;16:2433-2452.
10.
Corbo JC, Lawrence KA, Karlstetter M, et al. CRX ChIP-seq reveals the cis-regulatory
architecture of mouse photoreceptors. Genome Res. 2010;20:1512-1525.
11.
Livesey FJ, Furukawa T, Steffen MA, Church GM, Cepko CL. Microarray analysis of the
transcriptional network controlled by the photoreceptor homeobox gene Crx. Curr Biol.
2000;10:301-310.
12.
Blackshaw S, Fraioli RE, Furukawa T, Cepko CL. Comprehensive analysis of
photoreceptor gene expression and the identification of candidate retinal disease genes. Cell.
2001;107:579-589.
13.
Hsiau TH, Diaconu C, Myers CA, Lee J, Cepko CL, Corbo JC. The cis-regulatory logic
of the mammalian photoreceptor transcriptional network. PLoS One. 2007;2:e643.

123

14.
Chen S, Wang QL, Xu S, et al. Functional analysis of cone-rod homeobox (CRX)
mutations associated with retinal dystrophy. Hum Mol Genet. 2002;11:873-884.
15.
Tran NM, Zhang A, Zhang X, Huecker JB, Hennig AK, Chen S. Mechanistically distinct
mouse models for CRX-associated retinopathy. PLoS Genet. 2014;10:e1004111.
16.
Terrell D, Xie B, Workman M, et al. OTX2 and CRX rescue overlapping and
photoreceptor-specific functions in the Drosophila eye. Dev Dyn. 2012;241:215-228.
17.
Freund CL, Wang QL, Chen S, et al. De novo mutations in the CRX homeobox gene
associated with Leber congenital amaurosis. Nat Genet. 1998;18:311-312.
18.
Applebury ML, Antoch MP, Baxter LC, et al. The murine cone photoreceptor: a single
cone type expresses both S and M opsins with retinal spatial patterning. Neuron. 2000;27:513523.
19.
Provis JM, Dubis AM, Maddess T, Carroll J. Adaptation of the central retina for high
acuity vision: cones, the fovea and the avascular zone. Prog Retin Eye Res. 2013;35:63-81.
20.
Rossi EA, Roorda A. The relationship between visual resolution and cone spacing in the
human fovea. Nat Neurosci. 2010;13:156-157.
21.
Volland S, Esteve-Rudd J, Hoo J, Yee C, Williams DS. A comparison of some
organizational characteristics of the mouse central retina and the human macula. PLoS One.
2015;10:e0125631.
22.
Jeon CJ, Strettoi E, Masland RH. The major cell populations of the mouse retina. J
Neurosci. 1998;18:8936-8946.
23.
Barnett KC, Curtis R. Autosomal dominant progressive retinal atrophy in the Abyssinian
cat. J Hered. 1985;76:168-170.
24.
Curtis R, Barnett KC, Leon A. An early-onset retinal dystrophy with dominant
inheritance in the Abyssinian cat. Clinical and pathological findings. Invest Ophthalmol Vis Sci.
1987;28:131-139.
25.
Leon A, Curtis R. Autosomal dominant rod-cone dysplasia in the Rdy cat. 1. Light and
electron microscopic findings. Exp Eye Res. 1990;51:361-381.
26.
Leon A, Hussain AA, Curtis R. Autosomal dominant rod-cone dysplasia in the Rdy cat. 2.
Electrophysiological findings. Exp Eye Res. 1991;53:489-502.
27.
Chong NH, Alexander RA, Barnett KC, Bird AC, Luthert PJ. An immunohistochemical
study of an autosomal dominant feline rod/cone dysplasia (Rdy cats). Exp Eye Res. 1999;68:5157.

124

28.
Menotti-Raymond M, Deckman KH, David V, Myrkalo J, O'Brien SJ, Narfstrom K.
Mutation discovered in a feline model of human congenital retinal blinding disease. Invest
Ophthalmol Vis Sci. 2010;51:2852-2859.
29.
Nichols LL II, Alur RP, Boobalan E, et al. Two novel CRX mutant proteins causing
autosomal dominant Leber congenital amaurosis interact differently with NRL. Hum Mutat.
2010;31:E1472-E1483.
30.
Stone EM. Leber congenital amaurosis - a model for efficient genetic testing of
heterogeneous disorders: LXIV Edward Jackson Memorial Lecture. Am J Ophthalmol.
2007;144:791-811.
31.
Wang P, Guo X, Zhang Q. Further evidence of autosomal-dominant Leber congenital
amaurosis caused by heterozygous CRX mutation. Graefes Arch Clin Exp Ophthalmol.
2007;245:1401-1402.
32.
Ziviello C, Simonelli F, Testa F, et al. Molecular genetics of autosomal dominant retinitis
pigmentosa (ADRP): a comprehensive study of 43 Italian families. J Med Genet. 2005;42:e47.
33.
Freund CL, Gregory-Evans CY, Furukawa T, et al. Cone-rod dystrophy due to mutation
in a novel photoreceptor-specific homeobox gene (CRX) essential for maintenance of the
photoreceptor. Cell. 1997;91:543-553.
34.
Perrault I, Hanein S, Gerber S, et al. Evidence of autosomal dominant Leber congenital
amaurosis (LCA) underlain by a CRX heterozygous null allele. J Med Genet. 2003;40:e90.
35.
Nakamura M, Ito S, Miyake Y. Novel de novo mutation in CRX gene in a Japanese
patient with Leber congenital amaurosis. Am J Ophthalmol.2002;134:465-467.
36.
Koenekoop RK, Loyer M, Dembinska O, Beneish R. Visual improvement in Leber
congenital amaurosis and the CRX genotype. Ophthalmic Genet. 2002;23:49-59.
37.
Zhang Q, Li S, Guo X, et al. Screening for CRX gene mutations in Chinese patients with
Leber congenital amaurosis and mutational phenotype. Ophthalmic Genet 2001;22:89-96.
38.
Zou X, Yao F, Liang X, et al. De novo mutations in the cone-rod homeobox gene
associated with Leber congenital amaurosis in Chinese patients. Ophthalmic Genet. 2015;36:2126.
39.
Steinberg RH, Reid M, Lacy PL. The distribution of rods and cones in the retina of the
cat (Felis domesticus). J Comp Neurol. 1973;148:229-248.
40.
Rapaport DH, Stone J. The area centralis of the retina in the cat and other mammals: focal
point for function and development of the visual system. Neuroscience. 1984;11:289-301.
41.
Linberg KA, Lewis GP, Shaaw C, Rex TS, Fisher SK. Distribution of S- and M-cones in
normal and experimentally detached cat retina. J Comp Neurol. 2001;430:343-356.

125

42.
Hood DC, Birch DG. Light adaptation of human rod receptors: the leading edge of the
human a-wave and models of rod receptor activity. Vision Res. 1993;33:1605-1618.
43.
Evans LS, Peachey NS, Marchese AL. Comparison of three methods of estimating the
parameters of the Naka-Rushton equation. Doc Ophthalmol. 1993;84:19-30.
44.
Hood DC, Lin CE, Lazow MA, Locke KG, Zhang X, Birch DG. Thickness of receptor
and post-receptor retinal layers in patients with retinitis pigmentosa measured with frequencydomain optical coherence tomography. Invest Ophthalmol Vis Sci. 2009;50:2328-2336.
45.
Mowat FM, Gornik KR, Dinculescu A, et al. Tyrosine capsid-mutant AAV vectors for
gene delivery to the canine retina from a subretinal or intravitreal approach. Gene Ther.
2014;21:96-105.
46.
Spurr AR. A low-viscosity epoxy resin embedding medium for electron microscopy. J
Ultrastruct Res. 1969;26:31-43.
47.
Schneider CA, Rasband WS, Eliceiri KWNIH. Image to ImageJ: 25 years of image
analysis. Nat Methods. 2012;9:671-675.
48.
Staurenghi G, Sadda S, Chakravarthy U, Spaide RF; International Nomenclature for
Optical Coherence Tomography Panel. Proposed lexicon for anatomic landmarks in normal
posterior segment spectral-domain optical coherence tomography: the INOCT consensus.
Ophthalmology. 2014;121:1572-1578.
49.
Ekstrom P, Sanyal S, Narfström K, Chader GJ, van Veen T. Accumulation of glial
fibrillary acidic protein in Müller radial glia during retinal degeneration. Invest Ophthalmol Vis
Sci. 1988;29:1363-1371.
50.
Linberg KA, Fariss RN, Heckenlively JR, Farber DB, Fisher SK. Morphological
characterization of the retinal degeneration in three strains of mice carrying the rd-3 mutation.
Vis Neurosci. 2005;22:721-734.
51.
Sarthy PV, Fu M. Transcriptional activation of an intermediate filament protein gene in
mice with retinal dystrophy. DNA 1989;8:437-446.
52.
Sieving PA, Frishman LJ, Steinberg RH. Scotopic threshold response of proximal retina
in cat. J Neurophysiol. 1986;56:1049-1061.
53.
Stockton RA, Slaughter MM. B-wave of the electroretinogram. A reflection of ON
bipolar cell activity. J Gen Physiol. 1989;93:101-122.
54.
Glubrecht DD, Kim JH, Russell L, Bamforth JS, Godbout R. Differential CRX and OTX2
expression in human retina and retinoblastoma. J Neurochem. 2009;111:250-263.
55.
Massof RW, Wu L, Finkelstein D, Perry C, Starr SJ, Johnson MA. Properties of
electroretinographic intensity-response functions in retinitis pigmentosa. Doc Ophthalmol.
1984;57:279-296.
126

56.
Koenekoop RK. An overview of Leber congenital amaurosis: a model to understand
human retinal development. Surv Ophthalmol. 2004;49:379-398.
57.
Zhao TT, Tian CY, Yin ZQ. Activation of Müller cells occurs during retinal degeneration
in RCS rats. Adv Exp Med Biol. 2010;664:575-583.
58.
Ostergaard ME, Southwell AL, Kordasiewicz H, et al. Rational design of antisense
oligonucleotides targeting single nucleotide polymorphisms for potent and allele selective
suppression of mutant Huntingtin in the CNS. Nucleic Acids Res. 2013;41:9634-9650.
59.
Bennett CF, Swayze EE. RNA targeting therapeutics: molecular mechanisms of antisense
oligonucleotides as a therapeutic platform. Annu Rev Pharmacol Toxicol. 2010;50:259-293.
60.
Singh J, Kaur H, Kaushik A, Peer S. A review of antisense therapeutic interventions for
molecular biological targets in various diseases. Int J Pharmacol. 2011;7:294-315.
61.
Liao Y, Tang L. Inducible RNAi system and its application in novel therapeutics. Crit
Rev Biotech. 2016;36:630-638.
62.
Lambeth LS, Smith CA. Short hairpin RNA-mediated gene silencing. Methods Mol Biol.
2013;942:205-232.
63.
Rayburn ER, Zhang R. Antisense, RNAi, and gene silencing strategies for therapy:
mission possible or impossible? Drug Discov Today. 2008;13:513-521.
64.
Day TP, Byrne LC, Schaffer DV, Flannery JG. Advances in AAV vector development for
gene therapy in the retina. Adv Exp Med Biol. 2014;801:687-693.
65.
McClements ME, MacLaren RE. Gene therapy for retinal disease. Trans Res.
2013;161:241-254.
66.
Kotterman MA, Schaffer DV. Engineering adeno-associated viruses for clinical gene
therapy. Nat Rev Genet. 2014;15:445-451.
67.
Dalkara D, Sahel JA. Gene therapy for inherited retinal degenerations. C R Biol.
2014;337:185-192.

127

CHAPTER 3
METABOLIC CHANGES AND RETINAL REMODELING IN HETEROZYGOUS CRX
MUTANT CATS (CRXRDY/+)

128

3.1. ABSTRACT
PURPOSE. CRX is a transcription factor essential for normal photoreceptor development
and survival. The CrxRdy cat has a spontaneous mutation in Crx. Early disease stages in
heterozygous cats (CrxRdy/+) mimic severe Leber’s congenital amaurosis. This study investigated
the timing and extent of retinal remodeling during retinal degeneration. This will help optimizing
the best time for therapies such as retinal prosthesis or optogenetics before retinal rewiring and
glial scar formation becomes too extensive. METHODS. CrxRdy/+ cats from 6 weeks to 10 years
of age were investigated. In vivo structural changes of retinas were analyzed by fundus
examination, confocal scanning laser ophthalmoscopy, spectral domain optical coherence
tomography and fluorescein angiography. Post-mortem, structural changes were characterized by
histologic analyses including immunohistochemistry, regular thin histologic sections and
immunocytochemistry for computational molecular phenotyping for macromolecules and small
molecules. RESULTS. As early as 12 weeks of age, the retina of the CrxRdy/+ cats showed some
glial reaction to photoreceptor death followed by formation of a glial seal, rewiring and inner
nuclear layer cell migration with disease progression as well as changes in inner retina thickness.
There was preservation of inner retinal cells such as bipolar, amacrine and horizontal cells in
early adulthood. Additionally, marked retinal and retinal pigmentary epithelium atrophy
developed in the area centralis. With further progression, microneuroma formation, severe
retinal thinning and more severe remodeling occured. The superficial retinal vasculature was
attenuated with eventually a lack of peripheral fundus perfusion and development of arteriovenous shunts. CONCLUSIONS. This study indicates that retinal degeneration in the CrxRdy/+
cat retina follows the 3 phases that have been described for retinal remodeling. These findings
suggest that therapy dependent on targeting inner retinal cells may be useful in young adults with
preserved inner retinas prior to advanced stages of retinal remodeling and neuronal cell loss.
129

3.2. INTRODUCTION
Cone-rod homeobox (CRX) is an OTX-like homeobox gene encoding a transcription factor
essential for normal photoreceptor development, function and homeostasis. 1, 2 CRX mutations
result in a spectrum of dominant retinopathies ranging from Leber congenital amaurosis (LCA) to
cone–rod dystrophy (CoRD), retinitis pigmentosa (RP) and macular degeneration (MD). 3, 4 The
CrxRdy cat has a spontaneous frameshift mutation in Crx (single nucleotide deletion in exon 4)
leading to a premature stop codon and therefore the production of a truncated mutant Crx
protein.5 This type of mutation is an example of a Class III CRX mutation in which accumulation
of mutant CRX protein with a functional DNA binding domain but disrupted or missing
transactivation occurs and has a dominant negative action. 6 The heterozygous Crx mutant cat
(CrxRdy/+) develops an autosomal dominant cone-rod dystrophy characterized by very early
dysfunction and degeneration of photoreceptors, thus mimicking the severe Leber congenital
amaurosis phenotype.7-10 A detailed phenotypic description of the early disease stages of the
CrxRdy/+ cat has been reported in chapter 2. Affected animals have a halted development of
photoreceptors followed by a progressive retinal degeneration. 10 The retinal changes that develop
later in the disease process have not been reported.
A feature of Class III CRX mutations is accumulation of the mutant protein by a
mechanism that is not yet fully understood. The presence of increased amounts of mutant
transcript and mutant protein with a dominant negative effect makes development of potential
therapeutic approaches challenging. Similar to other dominant retinopathies an approach to
reduce the level of mutant transcript may be necessary, unlike the situation in many recessive
conditions where a gene augmentation approach is appropriate. Furthermore the rapid loss of
photoreceptors may dictate that alternative approaches such as optogenetics, retinal prosthesis,
transplantation of cells or retinal sheets may be needed once patients have lost their
130

photoreceptors. Such approaches rely on the retaining inner retinal structure and retinal
vasculature for them to be feasible. Investigation of later disease stages are important to provide
information on the retinal status following photoreceptor loss which is the stage that will need to
be treated. Studies of animal models have already revealed the extensive and progressive retinal
remodeling that occurs as photoreceptors die. Understanding of this very dynamic process will
aid in development of novel treatments to be performed on patients with late stage disease.
Animal models such as the CrxRdy/+ cat show potential for developing these treatment modalities.
Immunohistochemistry can provide some information about changes in specific retinal
cell types but over the last 15 years, the use of amino acid retinal signatures has been developed
and used to investigate retinal remodeling resulting from inherited and acquired retinal
diseases.11-14 Amino acid retinal signatures have also been described in normal and detached cat
retinas.15, 16 Fourteen separable biochemical theme classes have been identified: photoreceptor,
bipolar and ganglion cells characterized by specific glutamate signature, amacrine cells by
glycine and gamma-aminobutyric acid (GABA) signature, horizontal cells by GABA signature,
Müller cells by taurine-glutamine signature and retinal pigmentary epithelium (RPE) cells by an
aspartate-glutamate-taurine-glutamine signature. The rest of the cells which fill the neuronal
space, present with glutamate, GABA, or glycine signatures.
Three phases have been described during retinal remodeling in hereditary retinal
degenerations (retinitis pigmentosa and rod/cone dystrophies).13, 17, 18 Phases are classified as
follow: during the initial Phase 0-1, down regulation of glutamate receptor expression occurs in
rod bipolar cells dendrites; during Phase 1-2, rod and cone photoreceptors undergo stress which
leads to their death, concurrently dendritic modules are lost; during the last stage Phase 3,
sprouting and formation of new axonal modules develop and generalized retinal remodeling

131

occurs. In models in which cones die later than rods, some bipolar cell dendrites sprout and make
contact with different targets.
The purpose of this study was to investigate the timing and extent of retinal remodeling
during retinal degeneration in the CrxRdy/+ cat. This information will be important for assessing
the stages of remodeling that may be amenable to therapies such as retinal prosthesis or
optogenetics. For translational therapies it will be important to know at which stages of retinal
remodeling that such interventions may be of benefit.

3.3. MATERIALS AND METHODS
3.3.1. Ethics Statement
All procedures were performed in accordance with the ARVO statement for the Use of
Animals in Ophthalmic and Vision Research and approved by the Michigan State University
Institutional Animal Care and Use Committee.

3.3.2. Animals
Heterozygous mutant CrxRdy/+ cats and wild-type (WT) control cats maintained within a
colony at Michigan State University housed under a 12L:12D cycles, were studied. They received
commercial feline dry diet (Purina One Smartblend and Purina Kitten Chow, Nestlé Purina, St
Louis, MO. USA). Cats were studied during retinal maturation and adulthood from 6 weeks to 10
years of age.
A table of the number of animals/samples from each experiment is available in Appendix
M – Table 3.S1.

132

3.3.3. Ophthalmic examination and fundus imaging
In vivo ophthalmic fundus and retinal changes in the heterozygous CrxRdy/+ cats was
investigated by ophthalmic examination, fundus photography (Ret-Cam II, Clarity Medical
Systems, Inc., Pleasanton, CA, USA) and confocal scanning laser ophthalmoscopy (cSLO)
including autofluorescence imaging (AF) and spectral domain – optical coherence tomography
(SD-OCT) (Spectralis OCT+HRA, Heidelberg Engineering Inc., Heidelberg, Germany) as
previously described.10
To assess retinal vasculature, fluorescein angiography (FA) was performed injecting 20
mg/kg of 10% sodium fluorescein (Fluorescite 10%, Alcon Laboratories Inc, Fort Worth, Texas,
USA) in the left cephalic vein. One-minute movies then images at regular intervals were recorded
with confocal scanning laser ophthalmoscopy (cSLO) and a 55° wide field lens. Anesthesia, pupil
dilation and globe positioning were performed as described chapter 2 for ERG and SD-OCT.10

3.3.4. Retinal morphology and vasculature evaluation
3.3.4.1. In vivo Spectral Domain-Optical Coherence Tomography (SD-OCT)
Retinal morphology was assessed in CrxRdy/+ and wild-type control kittens from 4 weeks
to 10.25 years of age were included (animals from 4 weeks to 26 weeks of age from chapter 2
were included in the analysis).
Anesthesia, pupil dilation and globe positioning were performed as described for ERG
and SD-OCT in chapter 2.10 cSLO retinal images were captured. Then spectral-domain optical
coherence tomography (SD-OCT) imaging was performed to obtain detailed retinal cross section
images (Spectralis OCT+HRA, Heidelberg Engineering Inc., Heidelberg, Germany). SD-OCT
single scan line and volume scan images were recorded from the center of the area centralis and
in the four retinal quadrants (at 4 optic nerve head distances from the edge of the optic nerve head
133

superiorly, inferiorly, nasally and temporally as illustrated in chapter 2. Total thickness,
Receptor+ (REC+; including layers between retinal pigmentary epithelium and outer plexiform
layer included)19, inner nuclear layer (INL), ganglion cell complex (GCC; including the inner
plexiform layer (IPL) and the ganglion cell layer (GCL)) and inner retina (IR; layers between
inner nuclear layer and internal limiting membrane) thickness were measured (Fig. 3.1) using the
Heidelberg Eye Explorer (HEYEX) software.

Figure 3.1. Representative SD-OCT high resolution cross-section image of a normal cat
showing the different layers that can be viewed. In the present study, measurements of TR,
REC+, IR, ONL, INL and GCC were performed.
TR; Total retina, REC+; Receptor+, IR; Inner retina, ONL; Outer nuclear layer, INL; Inner
nuclear layer, GCC; Ganglion cell complex, NFL; Nerve fiber layer, ILM; Inner limiting
membrane, ELM; external limiting membrane, EZ; Ellipsoid zone, IZ; Interdigitation zone,
IS/OS; photoreceptor inner and outer segments.
The REC+ includes layers from IZ to OPL. The GCC includes the IPL and GCL/NFL layers. IR
includes the INL and GCC.

134

3.3.4.2. Post-mortem retinal and vascular morphology and remodeling
investigation
Retinal

and

vascular

morphology

and

remodeling

were

investigated

using

immunohistochemistry (IHC), regular plastic histologic thin sections and immunocytochemistry
for computational molecular phenotyping (CMP).

3.3.4.2.1. Immunohistochemistry (IHC)
IHC was performed on frozen sections from eyes at different ages to evaluate retinal
changes and remodeling with disease progression. After euthanasia, eyes were processed as
previously described.10, 20 The antibodies used are listed in Appendix N – Table 3.S2.
Retinas from four cats (three CrxRdy/+ and one WT cats) were flatmounted to evaluate
retinal vasculature changes. Eyes were fixed for 3.25 hours similarly as for regular IHC. After
eyecup dissection and an additional 30 minutes fixation, the eyecups were rinsed 2 times for 10
minutes in 1M phosphate-buffered saline pH 7.4 (PBS; Sigma-Aldrich Corp., St. Louis, MO,
USA). The retinas were dissected and blocked with 10% horse serum (Sigma-Aldrich Corp.) and
0.3% Triton X-100 (Sigma-Aldrich Corp.) in PBS for 2 hours at room temperature. Primary
antibodies; Isolectin GS-IB4 Alexa Fluor 488 conjugate at a 1:1,000 dilution (Life technologies,
Carlsbad, CA, USA) and Collagen Type IV at a 1:200 dilution (Millipore Corp. Billerica, MA,
USA) were applied and flatmounts incubated for 4 days at 4°C. Retinas were then rinsed 3 times
for 20 minutes in 0.3% Triton X-100. Secondary antibody (Alexa Fluor 546 goat anti-rabbit IgG,
Life technologies, Carlsbad, CA, USA) at a 1:1,000 dilution were applied and the flatmounts
incubated for 24 hours at 4°C. After 3 washes for 5 minutes with PBS the retina were
flatmounted on slides.
3.3.4.2.2. Regular plastic embedded histologic thin sections
135

Eyes were fixed in 2.5% glutaraldehyde (Glutaraldehyde, Alfa Aesar, Heysham,
England), 1% formaldehyde (Formal-Fixx, Thermo Shandon Ltd., Runcorn, UK) in 0.2 M PBS
pH 7.4 (Sigma-Aldrich Corp.), 0.1% magnesium sulfate (MgSO4; Sigma-Aldrich Corp.) and 3%
sucrose on ice for 1 hour. The eyes were then hemisectioned, the vitreous removed and the
posterior eyecups placed in the same fixative until processed as described in chapter 2. 10 Retinal
samples were collected from 5 different regions (Appendix J – Fig. 3.S1.) and epoxy-embedded:
area centralis (AC), superior mid- and far-periphery (SupMP, SupFP), and inferior mid- and farperiphery (InfMP, InfFP) to investigate regional differences. ONL, INL and GCC cells were
counted on 3 different 1 µm sections for each time point (same area/same animal) and on a 100
µm width for each area.

3.3.4.2.3.

Immunocytochemistry

for

computational

molecular

phenotyping for macromolecules and small molecules (CMP)
The same eyes as previously fixed in mixed aldehyde buffer for regular histologic sections
were used. Retinas were collected from 5 different areas of the fundus (Appendix J – material
Fig. 3.S1) and epoxy-embedded: area centralis (AC), superior mid- and far-periphery (SupMP,
SupFP) and inferior mid- and far- periphery (InfMP, InfFP) to investigate regional differences.
200 nm serial retinal sections were assessed.
Retinal remodeling was then evaluated by computational molecular phenotyping (CMP)
then

evaluate

as

previously

described.21

Retinal

samples

were

processed

for

immunocytochemistry for CMP for macromolecules and small molecules (CMP) including
GABA (yy), glycine (G), L-glutamate (E), taurine (TT), L-glutamine (Q), glutathione red ox (J),
L-aspartate (D), L-arginine (R), red-green opsin (RGO), rhodopsin (1D4), cellular retinaldehyde
binding protein (CRALBP), and glutamine synthetase (GS) (for the antibodies list and dilution
136

refer to Jones et al., 2016 22). CMP were visualized with secondary antibodies conjugated to 1.4
nm gold, followed by silver intensification as previously described 21. Images were captured and
processed 23. Molecular signals were visualized on images as rgb maps using red, green, and blue
for example respectively TQE: Taurine red, L-Glutamine green, L-Glutamate E blue, YGE:
GABA γ red, glycine G green, glutamate E blue.

3.3.5. Statistical analysis
A mixed effect model using R studio was used to analyze the data for SD-OCT and
measurements as data was evaluated over time. The equation below was used.24

where ß is the parameter vector. X is the independent variable matrix, αi is the cat level residual,
and the Ɛi is the individual observation level residual.
No statistical analysis was performed for the cell nuclei counting as only a n number of 1
was available for most of the ages and there was a lack of age-matched WT controls.

137

3.4. RESULTS
3.4.1. CrxRdy/+ cats present with severe retinal degeneration starting and more
pronounced in the area centralis
Fundus and retinal changes were investigated during retinal maturation and adulthood in
the CrxRdy/+ cat and compare to age matched WT controls. As early as 7 weeks of age, tapetal
hyperreflectivity was present in the area centralis, and then in the rest of the fundus by 20 weeks
of age in the CrxRdy/+ cat (Fig. 3.2). By 6.5 years of age some affected cats had developed a bluish
appearing lesion in the area centralis. This progressed such that in the older cats the lesion
appeared dark in color. On fundus autofluorescence (FAF) cSLO, the lesion showed a decrease in
FAF in the region of the area centralis which extended along the visual streak and with disease
progression could worsen to be a more severe lesion with a complete lack FAF in the area
centralis (Fig. 3.2). Vasculature attenuation was noticeable as early as 20-weeks of age and
obvious by 9-months of age as seen on color and cSLO fundus images and became advanced
with disease progression (Fig. 3.2). Vasculature changes were further investigated by fluorescein
angiography and IHC (detailed further, Fig. 3.8). Morphological changes were investigated in
vivo by high resolution cross-section SD-OCT images in the area centralis and the four quadrant
regions. SD-OCT images showed a lack discernible ellipsoid and interdigitation zones from as
early as 4 weeks of age, earliest age imaged (Fig. 3.2.).

138

Figure 3.2. Fundus changes and morphological changes in the CrxRdy/+ cat at different ages.
Color fundus images. Vasculature attenuation was noticeable as early as 20-weeks of age and
obvious by 9-months of age. Fundus hyperreflectivity was noticeable in the region of the area
centralis at 12-weeks of age (in this panel) then became more generalized by 20-weeks of age.
Color fundus images also showed that by at 6.5 and 10.3-years of age a lesion in the region of the
area centralis had developed.
Infrared cSLO fundus images. Those images demonstrate the vascular attenuation that occured
with the disease progression and was very obvious after 20-weeks of age.
Autofluorescence cSLO fundus images. Similarly to the color and infrared cSLO images,
images illustrate the vascular attenuation. They also show the presence of a lesion seen as a
decrease in fundus autofluorescence in the region of the area centralis and extending along the
visual streak in the 6.5- and 10-years of age affected cats. The 10.3-years of age affected cat
showed a more severe lesion with a complete lack of fundus autofluorescence in the area
centralis.
High resolution cross-section SD-OCT images of the dorsal (Sup Mid-Periphery) and area
centralis regions. SD-OCT images showed a lack discernible ellipsoid and interdigitation zones
from as early as 6-weeks of age. They showed initially a thinning of the outer retina with
apparent absence of the outer nuclear layer from 9-months of age. The inner retina initially
thickened then thinned in the late stages disease progression. The disease progression started
earlier the area centralis (as early as 6 weeks of age).

139

Measurements of the different outer and inner retina layers and total retina showed
significant changes in thicknesses in all regions of the retina of the CrxRdy/+ cat during the disease
progression (Fig. 3.3 and Appendix K – Fig. 3.2). The changes were similar in all regions but
more marked in the area centralis. As shown in chapter 2, the Receptor+ (REC+) and the outer
nuclear layer (ONL) layer, which is part of the REC+, show severe thinning from an early age (as
early as 6 weeks of age in the area centralis and 10/12 weeks of age in the other regions). For
example, the thickness of the REC+ layer was 29.0 ± 8.2 µm in the area centralis of the CrxRdy/+
cat at 1 year of age compared to 125.3 ± 9.3 µm in WT controls. The total retina (TR) underwent
also severe thinning but not until after 26 weeks of age. At 1 year of age, the TR thickness in the
dorsal region of the CrxRdy/+ cat was 161.5 ± 15.0 µm compared to 197.9 ± 3.7 µm in the WT cat.
The inner retina (IR) as well as the individual layers it includes (inner nuclear layer; INL,
ganglion cell complex; GCC) became thickened after 20 to 26 weeks of age and this peaked at
around 1 year of age. After 2 years of age the IR thinned as part of the severe generalized retinal
degeneration (Fig. 3.3 and Appendix K – Fig. 3.2). For example at 1 year of age, the IR thickness
in the dorsal region of the CrxRdy/+ cat was 132.1 ± 12.78 µm (while being 107.8 ± 7.9 µ at 10
weeks of age) compared to 78.7 ± 2.1 µm in the WT cat.

140

Figure 3.3. Total retina (TR), Receptor+ (REC+) and Inner retina (IR) thicknesses scatter
plots from CrxRdy/+ and WT control cats from 4 weeks to 10.25 years of age.

141

Figure 3.3 (cont’d)
Measures were made on SD-OCT images from the area centralis region and from four optic
nerve distance from the optic nerve rim itself dorsally, ventrally, temporally and nasally.
The TR and REC+ showed some severe thinning such that it became undiscernible with disease
progression in the CrxRdy/+ cats. Interestingly, in the WT animals in all retinal areas except the
area centralis the REC+, TR and REC+ thinned during the first year of age after which thickness
remained similar for the duration of the study.
In the CrxRdy/+ the IR thickened in all regions (except for the GCC layer in the area centralis)
with a peak around 1 to 2 years of age then thinned with the disease progression.

In order to further evaluation the changes in retinal cellular layers, we evaluated the
number of cell nuclei of each layer in each retinal region during the disease progression. There
was a severe loss of ONL nuclei during the first 6 months of life. The INL did not have major
changes. This was not proven statistically due to the n number of only one individual for most of
the time points assessed. (Fig. 3.4 and Appendix L – Fig. 3.3B). For example, in the area
centralis there was a decrease of ONL nuclei from 129 ± 7.2 at 6 weeks of age to 44.7 ± 6.0 at 9
months of age (over a 100 µm width). While it decreased from 270 ± 9.5 to 34 ± 2.6 in the dorsal
Sup MP region.
As in he SD-OCT characteristics described above, for all regions there was a severe
thinning of the retina could be seen in the CrxRdy/+ cat by 20 weeks of age. Abnormal
photoreceptor IS/OS were seen as early as 6 weeks of age and by 20 weeks of age only stunted IS
are seen. More extensive remodeling is seen from as early as 9 months of age where the different
layers of nuclei start to show severe disorganization. The changes observed and layer thinning is
more rapid in the area centralis region. It is to be noted that ganglion cells are well preserved
during the disease progression. (Figs. 3.4A and 3.4C).

142

Figure 3.4. Histologic images from plastic sections from (A) the Superior Mid-Periphery
(Sup MP) and (C) the area centralis regions and (B) their nuclei cell counts.
(A) Semithin histological sections from the SupMP periphery. With age, a severe thinning of
the retina could be seen in the CrxRdy/+ cat by 20 weeks of age. Abnormal photoreceptor IS/OS
were seen as early as 6 weeks of age and by 20 weeks of age only stunted IS are seen. In early
age some ectopic nuclei are seen in the subretinal space (indicated by black arrowheads). More
extensive remodeling is seen as early as 9 months of age where the different layers of nuclei start
to show severe disorganization.
(B) Cell nuclei count of the ONL, INL and GCC in the Sup MP and area centralis regions
(number of cell nuclei per 100 µm retinal section). Severe loss of nuclei was seen in both regions.
The area centralis has a less number from the earliest age tested (6 weeks of age) then WT.
(C) Semithin histological sections from the area centralis region. The changes observed and
layer thinning is more rapid than in (A). It is to be noted that ganglion cells are well preserved
during the disease progression.

143

3.4.2. CrxRdy/+ cat retinas undergo marked retinal remodeling
To

more

precisely

investigate

the

retinal

changes,

further

histology,

immunohistochemistry (IHC) and computational molecular phenotyping (CMP) were performed.
They allowed characterization of the molecular and metabolic of the retinal remodeling during
maturation and adulthood in the CrxRdy/+ cat.
As on SD-OCT and histology, IHC and thin sections for CMP showed a significant retinal
thinning over time with the outer nuclear layer (ONL) being the first to thin then at a later stage
the inner retina also thinned. On IHC, as reported in chapter 210, cone human arrestin (hCAR)
labeling was not present after 12 weeks of age. Labeling with a S-cone opsin antibody was never
detectable. ML-cones detectable by IHC showed opsin mislocalization to the photoreceptor inner
segments and cell bodies (Fig. 3.5). Rods photoreceptors were identified by both IHC and CMP
and similarly to ML-cones developed some rhodopsin mislocalization to the inner segments (IS)
and cell bodies from as early as 6 weeks of age. Immunolabeling for rhodopsin was not detected
in older animals (Figs. 3.5 and 3.6). IHC did show some ML-opsin labeling mislocalization to the
inner segment and ONL which disappear with the disease. CMP did not detect it. Some migration
of rod bipolar cells to the ONL was detected and there was extensive Müller cell activation (Fig.
3.5B). Glutamate and aspartate CMP labeling was present in most cells except Müller cells which
showed an increased activation with development of glial seals and columns (Fig. 3.6). There was
migration of inner retinal cells towards both the outer retina and the ganglion cell layer as
demonstrated by CMP GABA labeling of the horizontal cells, bipolar and amacrine cells and
calbindin and PKCα IHC labeling. Taurine labeling showed the loss of inner-outer photoreceptor
segments and that most cells remaining had an inner retinal origin. CRALBP labeling was
decreased from an early age. Interestingly, labeling with NeuN, a marker for neuronal cells, was
increased in the CrxRdy/+ cat.
144

Figure 3.5. Immunohistochemisty during disease progression in the CrxRdy/+ cat.
(A) Photorceptor cell markers. 1. ML-opsin was mislocalized to the ONL initially and then not
detectable (only background is detectable). 2. Rhodopsin was similarly mislocalized to the ONL
and was detectable in the ONL up to 6.5 year of age.
(B) Inner retinal cell markers. 1. Rod bipolar cells were present in the CrxRdy/+ cat until later in
disease progression. However, with disease progression some of their nuclei migrate to the outer
retina starting at 1.5 years of age. Age at which, it is noticed that their dendrites are retracted and
quasi absent. 2. Müller cells are highly activated and from an early age they invaded the ONL
towards the subretinal space. 3. Calbindin labeling of the inner retinal cells showed some
moderate changes in normal staining sign of remodeling. Contrarily of that in the WT control
(very faint), no staining of cone photoreceptor was noted. 4. NeuN labeling showed some
abnormal localization to the ONL and a more prominent labeling of the INL nuclei than normal.

145

Figure 3.6. Retinal amino acid signatures in a 6-week, 20-week, 5-year and 10-year-old
CrxRdy/+ cats. Serial 200 nm sections in the superior mid-periphery (SupMP; central retina).
146

Figure 3.6 (cont’d)
There was significant retinal thinning over time, with some individual variation at later ages. The
outer nuclear layer was the first to thin then the inner retina. Rhodopsin labeling decreased with
age and became extensively mislocalized to the photoreceptor inner segments and rod somas,
then disappeared at ~5 years of age. GABA labeling the horizontal cells, bipolar and amacrine
cells showed migration of inner retinal cells towards the outer retina and the ganglion cell layer.
Glutamate and aspartate labeling was present in most cells except Müller cells which showed
an increased activation with development of glial seals and columns. Taurine labeling showed
the loss of inner-outer photoreceptor segments and that most cells remaining had an inner retinal
origin. CRALBP labeling was decreased from an early age.

TQE and YGE mapping on thin sections as well as examination of semithin histologic
sections showed major remodeling with migration of inner retina cells into the outer retina
through some migration column. Remodeling of inner retinal cells led to formation of
microneuroma forming abnormal connection between cells. Retinal pigmentary epithelium
atrophy is also noticeable on many sections (Fig. 3.7).

Figure 3.7. TQE and YGE CMP mapping and semithin histologic sections in the CrxRdy/+ cat
at different ages in the superior mid-periphery area (central retina) and 1 µm histologic semithin
sections epoxy-stained from in a dorso-central retinal samples (from 5- and 10-year-old animals).

147

Figure 3.7 (cont’d)
This figure displays the different stages of degeneration and remodeling with loss of
photoreceptor outer and inner segments then death followed by Müller cell activation then
hypertrophy. With disease progression, migration columns appeared, inverted and everted inner
nuclear cells as well as microneuromas and RPE atrophy.

3.4.3. CrxRdy/+ cat retinas undergo marked retinal vasculature remodeling
To further investigate the vascular changes seen on fundus imaging, fluorescein
angiography was performed and IHC flatmounts prepared. As age increased, the retina became
increasing thin seen by an increase of tapetal hyperreflectivity (Fig. 3.8A). Fundus images
showed a loss in retinal vasculature definition as early as 26 weeks of age and severe vascular
attenuation was present by one year of age. As indicated previously, fundus images also showed
hyporeflective changes in the area centralis.
Fluorescein angiography showed a severe loss of peripheral vessels, which worsened with
disease progression. Disappearance of the peripheral and ventral vasculature was seen first.
Additionally, an interesting feature was noted; some arterio-venous shunts developed in the
peripheral CrxRdy/+ cat fundus. These became more prominent with age. These appeared as
vascular loops and were most readily detected at the periphery of the remaining vasculature (Fig.
3.8A). Investigation of the remaining vasculature was performed in 3 adult cats (3.5, 4.7 and 6.5
years of age) by flatmounting and immunolabeling their retina (Fig. 3.8B). The same features
were seen as with the fluorescein angiography imaging. Isolectin GS-B4, a marker of perfused
vessels25, 26 (green), labeled the same pattern of vessels as seen on fluorescein angiography (see
respectively Figs. 3.8A and 3.8B). Collagen IV, a marker of the vascular basement membrane 27,
labeled all vessels present regardless of whether they were patent. All the vessels in the CrxRdy/+
cat were labeled by the Collagen IV antibody, although only the central vessels were perfused (as
148

seen labeling by isolectin GS-B4) and the shunts between patent vessels were also labeled.
Additionally on close views, it was noted that the vessels from the CrxRdy/+ cat became more
tortuous.

Figure 3.8. Retinal vascular remodeling in the CrxRdy/+ cat.
(A) Fundus images showing the generalized tapetal hyperflectivity on color images. On all
images thinning of the vasculature is seen (indicated by the black arrows). In both the 3.5- and
6.5-year-old an area centralis lesion is seen (indicated by the black arrowheads). On fluorescein
angiography this lesion has a lack of fluorescence. On fluorescein angiography, generalized
retinal vasculature atrophy is noted especially in the periphery and ventrally. Arterio-venous
shunts are present especially at the edges of the vasculature. These shunts can be tortuous. (IR;
infrared, AF, autofluorescence)
149

Figure 3.8 (cont’d)

(B) Retinal flatmounts. Perfused vessels on the center of the retina as seen on fluorescein
angiography are also detected by labeling with isolectin GS-B4 which also labeled microglia
(green stars on close-up views)28. In the peripheral retina, vessels were present but not patent as
detected by anti-collagen IV antibody. Compared to the WT retina, we noticed arterio-venous
shunts (1, 2 and 3)and disappearance of small secondary vessels. Some of the remaining
functional vessels had a tortuous appearance pattern (2 and 3).

150

3.4.4. CrxRdy/+ cat present with severe area centralis retinal pigmentary epithelium
degeneration
Additional to the generalized retinal remodeling, a focal lesion was detected on both color
and autofluorescence fundus imaging (Fig. 3.2). This could also be seen during fluorescein
angiography (Fig. 3.8A) as a dark lesion lacking fluorescence in the early filling phase followed
by some secondary fluorescence in the later phases. As described above, the lesion seems to
initially be characterized by a slight sometimes bluish fundus color changes then a darker lesion
in the region of the area centralis (extending along the visual streak in one cat). On FAF, the
lesion is seen as a loss of AF then a complete absence of AF. When further investigating it, it was
found to correspond to a loss of retinal pigmentary epithelium (RPE) on both SD-OCT high
resolution cross sectional imaging and on IHC (Fig. 3.9). Analysis of the SD-OCT as well as
histologic and IHC sections within the area of degeneration some islands of remaining RPE cells
are present and some hypertrophy can be present in those areas and at the edge of the lesion (Fig.
3.9 shows hyperfluorescent spots of fluorescein angiography (A), thicker RPE and REC+ on
color thicknesses map B1 and SD-OCT (B2) and seen on histologic (B3) and IHC (B4) sections).

151

Figure 3.9. Area centralis lesion in a 6.5-year-old CrxRdy/+ cat.
(A) Fundus images indicating the lesion in the area centralis (black arrows). The lesion has has
a bluish appearance on the color fundus images, darker appearance on IR cSLO and shows some
loss of autofluorescence on FAF. Fluorescein angiography shows some lack of fluorescence in
the region of the area centralis and its surroundings.
152

Figure 3.9 (cont’d)
(B) Retinal epithelium pigmentary changes.
1. Thickness maps in the area of the lesion show some full thickness thinning but also of the
REC+. Interesting the RPE layer is thinned but some thinned spots (green to red color are seen in
the edges of the lesion. Those corresponded on retinal cross sections (2) to an RPE thickening
(right panel), seen as RPE cells proliferation on histologic and immunolabeled sections (2,3,4:
black and white stars). The center of the lesion is thin and has a lack of RPE layer (central panels;
3,4). The region where the integrity of the RPE stops can be seen on SD-OCT, histologic section
and IHC (white and black arrows; left panels; 2,3,4)

3.4.5. Other findings in individual CrxRdy/+ cats
Additionally to the lesions described above, individual cats presented with the following
lesions. Very old cats presented some retinal holes in their ventral retina due to the extreme
degeneration. This could be seen either by fundus examination (fundus images) or SD-OCT
retinal cross-section (Fig. 3.10). However in some areas cells accumulations of cells could be
detected on SD-OCT and CMP histology. Small areas of retinal detachments could be seen next
to the area centralis degeneration in SD-OCT imaging. One cat presented with retinoschisis in its
ventral non-tapetal retinal region (Fig. 3.10)

153

Figure 3.10. Additional lesions observed in the CrxRdy/+ cat.
(A) Dorsal lesions were seen as bullous elevation of the retina (black arrowheads) with internal
limiting membrane detachments. Some retinal hypertrophy was noticed in the far dorsal
periphery and some tapetal atrophy was randomly found (seen as a lack of tapetal
autofluorescence on IHC).
(B) Ventral lesions included presence of retinal holes (white arrowheads) in very advanced
degeneration cases and one cat presented with bilateral retinoschisis (white arrow left panel) and
retinal detachments (white arrow right panel).
154

3.5. DISCUSSION
This study expands on previous studies showing that the CrxRdy/+ cat has a severe, early
onset, dominantly inherited, retinal degeneration.7-10, 29 No functional evaluation was performed
in this study as no ERG responses have been detectable after 20 weeks of age in the CrxRdy/+ cat.9,
10

The CrxRdy/+ cat showed a severe retinal degeneration involving first the outer retina layer
which thinned. Due to a compensatory remodeling mechanism, the total retina thickness is
initially preserved until 6 months of age after which it also decreased. Concomitantly extensive
remodeling developed. The CrxRdy/+ cat showed similar remodeling as previously described in
other inherited retinal dystrophies. Retinal degeneration and remodeling in the cone-rod
dystrophy CRX-LCA feline model follows the 3 previously described phases of retinal
remodeling.13, 17, 18 In this model, cones degenerate first followed by rods then the rest of the
retina which is in contrast to typical retinitis pigmentosa in humans in which the peripheral retina
progresses into phases 1-3 before the central retina and fovea does. During the first phase, the
photoreceptors undergo stress and in the case of the CrxRdy/+ cat incomplete development then
death and degeneration with the start of second phase of remodeling. During the second phase,
the Müller cell are activated and lead to formation of glia seals accompanied by hypertrophy and
extension of horizontal cell neurites and bipolar cell dendrite retraction. During the third phase,
the neuronal retina remodels. During that phase, the glial seal becomes fibrotic and Müller cell
hypertrophic. Neuronal cells start dying and microneuromas start to form. This worsens at the
end of the remodeling. In the CrxRdy/+ cat, the first phase occurs during the first few weeks of age.
The second phase is also rapid; occurring over the first months of age. By 1.5-years of age, the
inner retina is severely affected and by 5-years of age severe neuronal remodeling has developed.
.
155

Further immunohistochemistry and molecular investigations to precise the remodeling
mechanism with synapses labeling for example would help to further characterize the changes. It
would also be of value to further investigate changes in melanopsin expressing ganglion cells
both functionally by chromatic pupillometry and also morphologically by IHC.30, 31 The NeuN
labeling showed good preservation of ganglion cells until very late in the disease progression
therefore investigating ganglion cells as potential target for optogenetic treatment would be of
value.
During advanced stages of the disease the CrxRdy/+ cat develops a severe lesion in the area
centralis region characterized by retinal pigmentary epithelium degeneration. The lesion was
shown to be caused by a loss of the RPE cells starting from the edge of the lesion. Some islands
of RPE hypertrophy were also seen. This lesion is similar to a lesion in humans with macular
degeneration and further supports the fact that the cat is a comparable model to the human form
of the disease. The mechanism of RPE degeneration in the macula-like region of the CrxRdy/+ cat
warrants further investigation to determine the underlying causal factors and molecular
mechanism. Also we need to investigate if it is a consequence of the dominant negative effect of
the Crx mutant allele or due to the retinal degeneration and its molecular consequences. 32 The
possibility that the CrxRdy/+ cat be a good model for RPE atrophy mechanistic studies in inherited
disease or age macular degeneration is of importance. 33, 34
Interestingly, the CrxRdy/+ cat presents severe vascular thinning with vascular remodeling
leading to arterio-venous shunt formation. As with many models of retinal inherited
dystrophies35, 36, the CrxRdy/+ cat develops severe attenuation of retinal vasculature and loss of
patent vasculature in the peripheral and ventral retina. Yet, the CrxRdy/+ cat present a very specific
characteristic which have rarely been described in inherited disease37, 38. During the vascular
degeneration, the retina vessels remained but were not perfused. The remaining vessels
156

developed some arterio-venous shunts and in some older animals the vessels became more
tortuous. During fluorescein angiography the arterio-venous shunting could be seen as a direct
communication between an artery and a vein without blood flow through a capillary bed. More
investigation on the molecular mechanism underlying the arterio-venous shunt formation is
necessary. The CrxRdy/+ cat could be an interesting model for vascular changes in human inherited
disease but also for branch vein occlusion, retinal detachments or surgery induced vascular
shunts.
This study showed that retinal degeneration in the CrxRdy/+ cat retina follows the 3
proposed phases of retinal remodeling. As early as 12 weeks of age, some glial reaction to
photoreceptor death was observed followed by formation of a glial seal, rewiring and inner
nuclear layer cell migration. Finally, microneuroma formation, severe retinal thinning and
remodeling developed. Paralleling those characteristic, the RPE degeneration in the macula-like
region of the cat and some vascular remodeling occurs quite early in the disease progression.
These findings emphasize the importance of testing therapies like optogenetics or retinal
transplant well before 1.5-years of age to ensure healthy neuronal environment at the time of
treatment. Adding to the previous description of the CrxRdy phenotype (chapter 2) these findings
provide baseline information for planned therapeutic interventions and evaluation. The CrxRdy cat
is a valuable large animal model for studying the severe forms of Leber congential amaurosis due
to CRX mutations but also retinal pigmentary atrophy and vascular arterio-venous shunts

157

3.6. ACKNOWLEDGEMENTS
The authors would like to thank Dr Bryan Jones for its help with CMP processing and
analysis, Dr Alicia Withrow for her help with semithin sections, Hope Morrison for her help with
thin sectioning and CMP processing, Dr Melinda Frame for her help with the flatmount images
capture, Wenjuan Ma from MSU CSTAT for her help with statistical analysis, Dr Cheryl Craft
for the donation of the hCAR antibody, Dr Debra Thompson for the donation of

RPE65

antibody, Taylor Chamber for help with SD-OCT and cell counting measurements and Janice
Querubin for help with animal anesthesia.
Supported by National Institutes Health Grants EY02576 (BWJ), EY015128 (BWJ),
EY014800(BWJ), EY024234(BWJ), unrestricted funds from Research to Prevent Blindness
(BWJ), Myers Dunlap Endowment (SMPJ), George H. Bird and "Casper" Endowment for Feline
Initiatives (LMO and SMPJ), MSU Center for Feline Health and Well Being (LMO and SMPJ).

158

APPENDICES

159

APPENDIX J – Figure 3.S1

Figure 3.S1. Fundus areas sampled from 5 retinal areas were collected: area centralis, midand far-superior as well as mid and far-inferior regions.

160

APPENDIX K – Figure 3.S2

Figure 3.S2. Outer nuclear layer (ONL), inner nucler layer (INL) and ganglion cell complex
(GCC) layer thicknesses scatter plots from CrxRdy/+ and WT control cats from 4 weeks to 10.25
years of age.
161

Figure 3.S2 (cont’d)
Measures were made on SD-OCT images from the area centralis region and from four optic
nerve distance from the optic nerve rim itself dorsally, ventrally, temporally and nasally.
The ONL showed some severe thinning to be quasi inexistent with disease progression in the
CrxRdy/+ cats. Interestingly, except in the area centralis the ONL in the WT controls thinned
during maturation and then stabilized after a year of age.
The INL and GCC layers thickened in all regions (except for the GCC layer in the area centralis)
with a peak around 0.5 to 2 years of age then thinned with the disease progression.

162

APPENDIX L – Figure 3.S3

Figure 3.S3. Cell nuclei count of the ONL, INL and GCC from (A) the Superior FarPeriphery (Sup FP), (B) Inferior Mid-Periphery and (C) Inferior Far-Periphery.
In all regions, a severe ONL loss of nuclei is seen between 6 weeks and 9 months of age to be
more subtle at a later age. Sight increase in INL number was seen in the SupFP.

163

APPENDIX M – Table 3.S1.
Age
(years)

Age
(weeks)

SDOCT

0.08
4
4
0.12
6
6
0.13
7
0.15
8
3
0.19
10
5
0.23
12
8
0.27
14
0.29
15
6
0.34
17.5
0.38
20
9
0.5
26
3
0.58
0.75
2
1
4
1.5
3
2
1
3
7
3.5
1
4
6
4.5
3
5
3
6
4
6.5
2
7
7.5
1
9
2
10.25
2
Total different animals
28

SDOCT
WT
2
7
1
3
5
8
2
5

CMP
Cell
counting

Fluorescein
angiography

IHC

1

3

1

4

Retinal
flatmount

5
7
3

1

1
3
3
4
5

1

1

1

1

1
1
1
2
1
3
1

1
1
2
1

2

1

1

2
1

1

2

1

2

2
27

1

9 + 1 WT

8 + 6 WT

22

3 + 1 WT

Table 3.S1. Experimental numbers of CrxRdy/+ cats
Ages for adult SD-OCT, fluorescein angiography, IHC and flatmounts where approximate.

164

APPENDIX N – Table 3.S2.
Antibody – Source
hCAR
(Human cone arrestin)
Dr. Cheryl Craft; LUMIJ,
University of Southern California,
Los Angeles, CA, USA
PNA
(Biotinylated Peanut Agglutinin)
Vector Labs Inc., Burlin-game,
CA, USA
ML-opsin
(Anti-Opsin, Red/Green;
Medium/ Long wavelength cone
opsin)
Millipore Corp., Billerica, MA,
USA
S-opsin
(Anti-Opsin, Blue; Short
wavelength cone opsin)
Millipore Corp., Billerica, MA,
USA
RetP1
(Rhodopsin Ab-1)
Thermo Scientific, Rockford, IL,
USA
GFAP
(Anti-Glial Fibrillary Acidic
Protein)
Cell Signaling Technology Inc.,
Danvers, MA, USA
PKCa
(Protein Kinase C-alpha)
BD Biosciences, San Jose, CA,
USA
Calbindin
Swant, Marly, Switzerland


NeuN
(Neuron-Specific Nuclear
Protein)
Millipore Corp., Billerica, MA,
USA
RPE65
(Retinal pigmentary epitheliumspecific 65kDA protein)
Dr. Debra Thompson; Kellogg
eye center, University of
Michigan, Ann Arbor, MI, USA

Type

Primary
Dilution

1:500

1:500

Alexa Fluor 488 Streptavadin
Life technologies, Carlsbad,
CA, USA

1:500

1:1,000

Alexa Fluor 568 or 594 Goat
anti-rabbit IgG
Life technologies, Carlsbad,
CA, USA

1:500

1:1,000

Alexa Fluor 568 or 594 Goat
anti-rabbit IgG
Life technologies, Carlsbad,
CA, USA

1:500

Alexa Fluor 594 Goat antimouse IgG
Life technologies, Carlsbad,
CA, USA

1:500

Alexa Fluor 594 Rabbit antimouse IgG
Life technologies, Carlsbad,
CA, USA

1:500

1:10,000

Biotinylated
Lectin

Polyclonal
rabbit

Monoclonal
mouse

Monoclonal
mouse

1:2

1:300

Monoclonal
mouse

1:500

Monoclonal
mouse

1:500

Monoclonal
mouse

Monoclonal
mouse

Secondary
Dilution

Alexa Fluor 488 Goat antirabbit IgG
Life technologies, Carlsbad,
CA, USA

Polyclonal
rabbit

Polyclonal
rabbit

Secondary
Antibody – Source

Alexa Fluor 594 Goat antimouse IgG
Life technologies, Carlsbad,
CA, USA
Alexa Fluor 568 Goat antimouse IgG
Life technologies, Carlsbad,
CA, USA

1:500

1:500

1:2,000

Alexa Fluor 488 Goat antimouse IgG
Life technologies, Carlsbad,
CA, USA

1:500

1:500

Alexa Fluor 568 Goat antimouse IgG
Life technologies, Carlsbad,
CA, USA

1:500

Table 3.S2. List of antibodies used for IHC – their origins and dilutions
165

REFERENCES

166

REFERENCES

1.
Hennig AK, Peng GH, Chen S. Regulation of photoreceptor gene expression by Crxassociated transcription factor network. Brain Res. 2008;1192:114-133.
2.
Furukawa T, Morrow EM, Cepko CL. Crx, a novel otx-like homeobox gene, shows
photoreceptor-specific expression and regulates photoreceptor differentiation. Cell. 1997;91:531541.
3.
Sohocki MM, Sullivan LS, Mintz-Hittner HA, et al. A range of clinical phenotypes
associated with mutations in CRX, a photoreceptor transcription-factor gene. Am J Hum Genet.
1998;63:1307-1315.
4.
Hull S, Arno G, Plagnol V, et al. The phenotypic variability of retinal dystrophies
associated with mutations in CRX, with report of a novel macular dystrophy phenotype. Invest
Ophthalmol Vis Sci. 2014;55:6934-6944.
5.
Menotti-Raymond M, Deckman KH, David V, Myrkalo J, O'Brien SJ, Narfström K.
Mutation discovered in a feline model of human congenital retinal blinding disease. Invest
Ophthalmol Vis Sci. 2010;51:2852-2859.
6.
Tran NM, Chen SM. Mechanisms of Blindness: Animal Models Provide Insight Into
Distinct CRX-Associated Retinopathies. Dev Dyn. 2014;243:1153-1166.
7.
Curtis R, Barnett KC, Leon A. An early-onset retinal dystrophy with dominant inheritance
in the Abyssinian cat. Clinical and pathological findings. Invest Ophthalmol Vis Sci.
1987;28:131-139.
8.
Leon A, Curtis R. Autosomal dominant rod-cone dysplasia in the Rdy cat. 1. Light and
electron microscopic findings. Exp Eye Res. 1990;51:361-381.
9.
Leon A, Hussain AA, Curtis R. Autosomal dominant rod-cone dysplasia in the Rdy cat. 2.
Electrophysiological findings. Exp Eye Res. 1991;53:489-502.
10.
Occelli LM, Tran NM, Narfstrom K, Chen S, Petersen-Jones SM. CrxRdy Cat: A Large
Animal Model for CRX-Associated Leber Congenital Amaurosis. Invest Ophthalmol Vis Sci.
2016;57:3780-3792.
11.
Marc RE, Jones BW, Watt CB, Strettoi E. Neural remodeling in retinal degeneration.
Prog Retin Eye Res. 2003;22:607-655.
12.
Marc RE, Jones BW. Retinal remodeling in inherited photoreceptor degenerations. Mol
Neurobiol. 2003;28:139-147.

167

13.
Jones BW, Watt CB, Frederick JM, et al. Retinal remodeling triggered by photoreceptor
degenerations. J Comp Neurol. 2003;464:1-16.
14.
Jones BW, Marc RE. Retinal remodeling during retinal degeneration. Exp Eye Res
2005;81:123-137.
15.
Marc RE, Murry RF, Fisher SK, Linberg KA, Lewis GP, Kalloniatis M. Amino acid
signatures in the normal cat retina. Invest Ophthalmol Vis Sci. 1998;39:1685-1693.
16.
Marc RE, Murry RF, Fisher SK, Linberg KA, Lewis GP. Amino acid signatures in the
detached cat retina. Invest Ophthalmol Vis Sci. 1998;39:1694-1702.
17.
Jones BW, Pfeiffer RL, Ferrell WD, Watt CB, Marmor M, Marc RE. Retinal remodeling
in human retinitis pigmentosa. Exp Eye Res. 2016;150:149-165.
18.
Jones BW, Kondo M, Terasaki H, Lin Y, McCall M, Marc RE. Retinal remodeling. Jpn J
Ophthalmol. 2012;56:289-306.
19.
Hood DC, Lin CE, Lazow MA, Locke KG, Zhang X, Birch DG. Thickness of receptor
and post-receptor retinal layers in patients with retinitis pigmentosa measured with frequencydomain optical coherence tomography. Invest Ophthalmol Vis Sci. 2009;50:2328-2336.
20.
Mowat FM, Gornik KR, Dinculescu A, et al. Tyrosine capsid-mutant AAV vectors for
gene delivery to the canine retina from a subretinal or intravitreal approach. Gene Ther.
2014;21:96-105.
21.
Marc RE, Murry RF, Basinger SF. Pattern recognition of amino acid signatures in retinal
neurons. J Neurosci. 1995;15:5106-5129.
22.
Jones BW, Pfeiffer RL, Ferrell WD, Watt CB, Tucker J, Marc RE. Retinal Remodeling
and Metabolic Alterations in Human AMD. Front Cell Neurosci. 2016;10:103.
23.
Marc RE, Jones BW. Molecular phenotyping of retinal ganglion cells. J Neurosci.
2002;22:413-427.
24.
RStudio Team (2015). RStudio: Integrated Development for R. RStudio I, Boston, MA
URL http://www.rstudio.com/.
25.
Ernst C, Christie BR. Isolectin-IB 4 as a vascular stain for the study of adult neurogenesis.
J Neurosci Methods. 2006;150:138-142.
26.
Walchli T, Mateos JM, Weinman O, et al. Quantitative assessment of angiogenesis,
perfused blood vessels and endothelial tip cells in the postnatal mouse brain. Nat Protoc.
2015;10:53-74.
27.
Kalluri R. Basement membranes: structure, assembly and role in tumour angiogenesis.
Nat Rev Cancer. 2003;3:422-433.
168

28.
Lehnardt S, Massillon L, Follett P, et al. Activation of innate immunity in the CNS
triggers neurodegeneration through a Toll-like receptor 4-dependent pathway. Proc Natl Acad Sci
U S A. 2003;100:8514-8519.
29.
Chong NH, Alexander RA, Barnett KC, Bird AC, Luthert PJ. An immunohistochemical
study of an autosomal dominant feline rod/cone dysplasia (Rdy cats). Exp Eye Res. 1999;68:5157.
30.
Yeh CY, Koehl KL, Harman CD, et al. Assessment of Rod, Cone, and Intrinsically
Photosensitive Retinal Ganglion Cell Contributions to the Canine Chromatic Pupillary Response.
Invest Ophthalmol Vis Sci. 2017;58:65-78.
31.
Athanasiou D, Aguila M, Bevilacqua D, Novoselov SS, Parfitt DA, Cheetham ME. The
cell stress machinery and retinal degeneration. FEBS Lett. 2013;587:2008-2017.
32.
Veleri S, Lazar CH, Chang B, Sieving PA, Banin E, Swaroop A. Biology and therapy of
inherited retinal degenerative disease: insights from mouse models. Dis Model Mech.
2015;8:109-129.
33.

Green WR. Histopathology of age-related macular degeneration. Mol Vis. 1999;5:27.

34.
Ramkumar HL, Zhang J, Chan CC. Retinal ultrastructure of murine models of dry agerelated macular degeneration (AMD). Prog Retin Eye Res. 2010;29:169-190.
35.
Blanks JC, Johnson LV. Vascular atrophy in the retinal degenerative rd mouse. The J
Comp Neurol. 1986;254:543-553.
36.
Winkler PA, Ekenstedt KJ, Occelli LM, et al. A large animal model for CNGB1
autosomal recessive retinitis pigmentosa. PloS one. 2013;8:e72229.
37.
Abu el-Asrar AM, Kahtani ES, Tabbara KF. Retinal arteriovenous communication in
retinitis pigmentosa with Refsum's disease-like findings. Doc Ophthalmol. 1995;89:313-320.
38.
Mansour AM, Walsh JB, Henkind P. Arteriovenous anastomoses of the retina.
Ophthalmology 1987;94:35-40.

169

CHAPTER 4
PHENOTYPIC CHARACTERIZATION OF CATS HOMOZYGOUS FOR A
FRAMESHIFT MUTATION IN CRX (CRXRDY/RDY)

170

4.1. ABSTRACT
PURPOSE. CRX is a transcription factor essential for normal photoreceptor
development and survival. The Rdy cat has a spontaneous frameshift mutation in Crx. This type
of mutation is similar to Class III CRX mutations that result in accumulation of mutant CRX
protein, which has a dominant negative action. The heterozygous cat (CrxRdy/+) has early
dysfunction and degeneration of photoreceptors mimicking the severe Leber congenital
amaurosis phenotype. This study investigated the phenotype of the homozygous cat (CrxRdy/Rdy).
METHODS. Functional and structural characteristics of the retina and the globe of the CrxRdy/Rdy
cats were investigated at various ages by ophthalmic examination, combined A-and B-mode
ultrasound (US), intraocular pressure (IOP), refraction, electroretinography (ERG), spectral
domain optical coherence tomography (SD-OCT) and histology. Molecular changes were
assessed by quantitative reverse transcriptase-PCR (qRT-PCR, Western blot (WB) and
immunohistochemistry (IHC). RESULTS. CrxRdy/Rdy cats lacked vision and showed an absence
of menace response and dazzle reflex. They also had a very decreased pupillary light reflex.
Unlike the CrxRdy/+ cats, the CrxRdy/Rdy cats did not exhibit nystagmus. The globe length was
significantly greater than that of wild-type and CrxRdy/+ kittens, showing severe posterior segment
myopia with no IOP increase when investigated at adulthood. Scotopic and photopic ERG
responses were absent at all ages tested. CrxRdy/Rdy cats developed tapetal hyperreflectivity
detectable as early as 12 weeks of age, but there was no obvious retinal vasculature attenuation
with disease progression. The features that represent the photoreceptor inner/outer segments
(IS/OS) were not discernible on SD-OCT images from an early age. Histological examination
showed that only very small photoreceptor inner segments formed; outer segments were never
identified. Although the other retinal layers appeared relatively normal at 2 weeks of age, retinal
stratification became increasingly abnormal with age. QRT-PCR in 2-week-old kittens revealed a
171

marked decrease in cone and rod opsin mRNA levels while that of Crx was elevated and the
expression level of other transcription factors was also changed. WB revealed that the amount of
mutant Crx present was greater than that of normal Crx protein in wild-type control retinas.
CONCLUSIONS. The retina of the CrxRdy/Rdy cat failed to fully mature resulting in congenital
blindness. Also, abnormal globe growth with myopia occurred. Although relatively normal
retinal stratification had developed at a very early age, lack of normal development of
photoreceptor IS/OS was noted, and retinal layers became disorganized with disease progression.
This was accompanied by decreased expression of rod and cone opsins and absence of
photoreceptor function. The phenotype of the CrxRdy/Rdy differs considerably from that of the
CrxRdy/+ cat.

172

4.2. INTRODUCTION
Cone-rod homeobox (CRX) is an OTX-like homeobox gene encoding a transcription
factor essential for normal photoreceptor development, function and survival.1-3 Indeed,
numerous genes necessary for the retinal functions such as genes coding for proteins involved in
phototransduction or the visual cycle have a binding site for CRX in their promoter, and CRX
also has a binding site on its own promoter. 4-9 In humans, CRX mutations result in a spectrum of
typically dominant retinopathies with variable severity ranging from Leber congenital amaurosis
(LCA7) to cone–rod dystrophy, retinitis pigmentosa and macular degeneration.10, 11 LCA is the
most severe form. LCA represents approximately 5% of all human inherited retinopathies with a
prevalence of 1 in 30,000 to 81,000 newborns.12, 13 CRX mutations accounts for approximately
2.35% of the cases of LCA.14
Mice models for CRX-retinopathies have been well described even though the precise
mechanisms underlying the diseases need to be further elucidated (see review Tran et al., 2014).9,
15

Among the available CRX-retinopathy models one large animal model exists: the CrxRdy cat.

This cat model has a spontaneous frameshift mutation in Crx (single nucleotide deletion in exon
4 leading a truncated protein of 185 amino acids compared to 299 residues in the wild-type
protein).16 The position of the introduced premature stop codon is at an analogous site to several
reported human mutations that most frequently result in an LCA phenotype and are classified as
Class III CRX mutations. Those mutations are believed to be associated with an accumulation of
mutant CRX protein which has a dominant negative action.9,

15, 17, 18

The heterozygous cat

(CrxRdy/+) has been described previously and presents with an LCA phenotype characterized by
an early dysfunction and degeneration of photoreceptors.

16, 19, 20

There is over expression of the

mutant Crx allele resulting in a higher level of Crx protein compared to wild-type cat’s retina,

173

which has a dominant negative effect

17

and is similar to the phenotype of the Class III E168d2

heterozygous mouse model.15, 17
Among the mice models for CRX-retinopathies, the phenotype of homozygous animals has
been well described in the literature.3, 9, 21-23 The Class III E168d2/d2 homozygous mouse model
has a similar yet more severe phenotype to the Class III E168d2 heterozygous mouse. The
E168d2 homozygous mouse undergoes rapid photoreceptor degeneration, with absence of
photoreceptor outer segments (OS) development and rapid loss of outer nuclear layer (onl)
thickness. This mouse model lacked vision and did not have any recordable electroretinographic
responses at any time point. The E168d2/d2 homozygous mouse also has a more marked
decrease in expression of certain retinal genes compared to the E168d2 heterozygous mouse.
These include cone arrestin, and cone and rod opsin.9
Based on the studies in the CrxRdy/+ cats and the homozygous E168d2 mouse, we
hypothesized that the phenotype of the homozygous cat will have a more severe phenotype than
that of the heterozygote, with no photoreceptor development and a total absence of normal Crx
mRNA/protein, but normal development of other cell types. We expect even higher levels of
mutant Crx mRNA and protein. Even though there is a very low incidence of humans
homozygous for CRX mutations, the study of the homozygous cat and its comparison with the
mice models may give a valuable insight into the dominant negative mutation mechanism or help
to guide therapeutic interventions. The purpose of this study was to investigate the functional,
morphological and molecular phenotype of the Class III Crx mutant homozygous cat (CrxRdy/Rdy).

174

4.3. MATERIALS AND METHODS
4.3.1. Ethics statement
All procedures were performed in accordance with the ARVO statement for the Use of
Animals in Ophthalmic and Vision Research and approved by the Michigan State University
Institutional Animal Care and Use Committee.

4.3.2. Animals
A colony of CrxRdy cats maintained at Michigan State University was used for this study
and bred to obtain homozygote affected (CrxRdy/Rdy), heterozygote affected (CrxRdy/+) kittens and
wild-type (WT) control cats. Animals were housed under 12D:12L cycles during breeding and
14D:10L the rest of the time. They were fed a commercial feline dry diet (Purina One
Smartblend and Purina Kitten Chow; Nestlé Purina, St Louis, MO. USA). Animals studied
ranged from 4 weeks to 6 years of age. For n numbers used in the different experiments, please
refer to Appendices X, Y, and Z – Tables 4.S1, 4.S2 and 4.S3.

4.3.3. Ophthalmic examination and fundus imaging
At each time point assessed, kittens underwent a full ophthalmic examination including
indirect ophthalmoscopy and capture of digital wide-field color fundus images (Ret-Cam II,
Clarity Medical Systems, Inc., Pleasanton, CA, USA). Fundus images were also captured using a
confocal scanning laser ophthalmoscope (cSLO) (Spectralis OCT+HRA, Heidelberg Engineering
Inc., Heidelberg, Germany). (This was performed under anesthesia after each Spectral domainoptical coherence tomography (SD-OCT) examination: see below).
In vivo fluorescein angiography imaged with a confocal scanning laser ophthalmoscope
(cSLO) was performed in a few animals. Retinal vasculature was assessed in CrxRdy/Rdy kittens
175

and compared with CrxRdy/+ kittens and WT controls from chapter 3. Anesthesia, pupil dilation
and globe positioning were performed as described in chapter 2 for ERG and SD-OCT.17 Firstly
cSLO retinal images were captured with both 875 nm and 488 nm lasers. Fluorescein
angiography imaging was then performed by injecting 20 mg/kg of 10% sodium fluorescein
(Fluorescite 10%, Alcon Laboratories Inc, Fort Worth, Texas, USA) as a bolus through a 20G
catheter in the left cephalic vein followed by a 2mL bolus of Ringer Lactate. The timer was
started at the beginning of injection. One-minute movies then images at regular intervals were
recorded using cSLO with a 55° wide field angled lens.

4.3.4. Measurement of globe length
Axial globe length was measured using a combined A- and B-mode ultrasound (A/B Scan
System 835, Humphrey, Dublin, CA, USA) under anesthesia (after SD-OCT in some of the
animals). Initially, only the axial globe length was measured, but in later studies the corneaanterior segment width, lens width and posterior segment depth were also measured.
Measurements in millimeters (mm) were taken from the best A scan and B scan combined on the
same images (Fig. 4.1A).

4.3.5. Intraocular pressure (IOP)
Intraocular pressure was assessed in few CrxRdy/Rdy and wild-type control adults (older
than 6 months of age) using a TonoVet (Icare Finland Oy, Helsinki, Finland). Due to the feline
species having a tendency to be fractious, only animals of a temperament that allowed them to be
assessed without tight restraint and without being stressed were included. Measurements were
done within a week between 8.10-9.30 am. Each animal was assessed two to three times during
that week. During each session, the IOP was measured 3 times for each eye.
176

4.3.6. Refractive error
Refractive error was assessed in few CrxRdy/Rdy, CrxRdy/+ and WT control adult cats (older
than 6 months of age) using a retinoscopy and standard refractive bars. It was noted that due to
the blindness in the CrxRdy/Rdy and CrxRdy/+ cats, the pupil dilation and absence of focusing made
measurements challenging.

4.3.7. Electroretinography (ERG)
Electroretinography was performed on CrxRdy/Rdy kittens as described in chapter 2.17
Scotopic and photopic ERGs were recorded in animals from 4 to 20 weeks of age and compared
to those from wild-type and heterozygous animals (chapter 2).

4.3.8. Retinal morphology and vasculature
4.3.8.1. In vivo Spectral Domain-Optical Coherence Tomography
Retinal morphology was assessed by SD-OCT in CrxRdy/Rdy kittens, CrxRdy/+ kittens and
wild-type control kittens from 4 weeks to 5 years of age.
Anesthesia, pupil dilation and globe positioning were performed as described for ERG
and SD-OCT in chapter 2. cSLO retinal images were captured. Then, spectral-domain optical
coherence tomography (SD-OCT) imaging was performed to obtain detailed retinal cross section
images (Spectralis OCT+HRA, Heidelberg Engineering Inc., Heidelberg, Germany). SD-OCT
single scan line and volume scan images were recorded from the center of the area centralis and
in the four retinal quadrants (at 4 optic nerve head diameter distances from the edge of the optic
nerve head superiorly, inferiorly, nasally and temporally as illustrated in Appendix O – Fig.
4.S1). Total retinal thickness, Receptor+ (REC+; including layers between retinal pigmentary
epithelium and outer plexiform layer included) 24, inner nuclear layer (INL), ganglion cell
177

complex (GCC; including the inner plexiform layer (IPL) and the ganglion cell layer (GCL)) and
inner retina (IR; layers between inner nuclear layer and internal limiting membrane) thickness
were measured using the Heidelberg Eye Explorer (HEYEX) software.

4.3.8.2. Immunohistochemistry (IHC)
After humane euthanasia, eyes from CrxRdy/Rdy and wild-type kittens were collected (at 2,
6, 12 and 20 weeks, and 2 and 3.5 years of age). They were processed as described in chapter 2.17
They were then processed for immunolabeling and imaged.17, 25 The antibodies used are listed in
Appendix a – Table 4.S4.

4.3.8.3. Plastic embedded sections
Eyes were processed for plastic histologic sections and imaged as described in chapter
2.17 Samples from the dorsal, central, nasal, temporal and area centralis regions were obtained
by using a biopsy punch of 3 to 3.5 mm diameter Appendix O – Fig. 4.S1.

4.3.9. Quantitative Reverse Transcriptase-Polymerase Chain Reaction (qRT-PCR)
As described in chapter 2, immediately following euthanasia and globe removal, the
neurosensory retina was dissected from 2-week-old CrxRdy/Rdy, CrxRdy/+ and wild-type kittens.
Two areas (central and peripheral areas) were dissected (Appendix P – Fig. 4.S2). Retinal
samples were flash frozen in liquid nitrogen and stored at -80°C until RNA extraction. RNA
extraction, cDNA synthesis and qRT-PCR reaction were performed as previously described.9
RNA quality was assessed, and only samples with an RNA integrity number RIN > 7.0 were
used to evaluate gene expression changes.

178

Levels of arrestin3 (Arr3, specific to cones), medium-long wavelength opsin (MOP,
specific to cones), short wavelength opsin (SO, specific to cones), rhodopsin (Rho, specific to
rods), total Crx (WT and mutant), homeobox protein (Otx2), neural retina leucine zipper protein
(Nrl), photoreceptor-specific nuclear receptor (Nr2e3), thyroid hormone receptor β2 (Trβ2) and
the nuclear receptor (Rorβ) mRNA were measured and normalized to Tubulin alpha-1B chain
(Tuba1b) and Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (for primers sequence, see
Appendix b – Table 4.S5). mRNA expression levels of retinal transcription profiles of CrxRdy/Rdy
and CrxRdy/+ kittens were compared to control wild-type kittens.

4.3.10. Western blot assay
As described in chapter 2, following sampling of the retina for qRT-PCR the remaining
retina was flash frozen in liquid nitrogen, then protein extraction and western blot assay were
performed.9, 17 Monoclonal mouse anti-β-actin antibody (Sigma-Aldrich, Saint Louis, MO, USA)
and polyclonal rabbit anti-CRX 119b1 at 1:1000 dilution were used to probe the membranes.
Secondary antibodies goat anti-mouse IRDye 680LT and goat anti-rabbit IRDye 800CW (LICOR Biosciences, Lincoln, NE, USA) respectively were used. Fluorescence was detected using
the Odyssey Infrared Imager (LI-COR Biosciences, Lincoln, NE, USA). Quantification was
performed using Image J (http://imagej.nih.gov/ij/; provided in the public domain by the National
Institutes of Health, Bethesda, MD, USA). 26

179

4.3.11. Statistical analysis
Statistical analysis of IOP, refraction, cDNA level and Western blot fluorescence level
data differences were tested for normality (Shapiro-Wilk test for normality). Normally
distributed data was analyzed by unpaired 2-tailed Student’s T-test (significance level set at P <
0.05), nonparametric data by a Mann-Whitney rank sum test (SigmaPlot 12.0; Systat Software,
Inc., San Jose, CA, USA). Student’s T-test was performed when comparing only two groups. A
mixed effect model using R studio was used to analyze the data for globe length and SD-OCT
measurements; SD-OCT measurements as data was evaluated over time. This was also used to
analyze the effect of other factors on IOP and refraction (age) using the equation below.27

Where ß is the parameter vector, X is the independent variable matrix, αi is the cat level residual,
and the Ɛi is the individual observation level residual.

180

4.4. RESULTS
4.4.1. CrxRdy/Rdy cats have an increased globe length and a myopic refractive error
Analysis of the CrxRdy/Rdy cat axial globe length showed a significant increase compared to
heterozygous CrxRdy/+ and to control WT cats (Fig. 4.1) (P < 0.002 and = 0.003, respectively).
For example, at one year of year the CrxRdy/Rdy, CrxRdy/+ and WT cats had an axial globe length of
respectively 23.1 ± 0.4, 19.5 ± 0.3 and 20.1 ± 0.4 mm. This difference was obvious on US, and in
the enucleated eye (Figs. 4.1A and 4.1B). Measurement analysis (Fig. 4.1C) confirmed that
finding. Statistical analysis showed that the eye (left or right), or sex had no effect and that the
differences in axial length increased with age. A difference in axial globe length was also present
between CrxRdy/+ and WT cats (P = 0.02), with WT having a slightly longer globe. It is to be
noted that the CrxRdy/Rdy group included measurements from 55 males (M) and 13 females (F)
(each time point considered independently), the WT group included measurements in 94 M and
54 F and the CrxRdy/+ group in 44 M and 106 F. It is possible that the difference between the
CrxRdy/+ and the WT group was due to high number of females that were of smaller size
compared to the males. For example, at 3 years of age female and male CrxRdy/+ cats had a mean
axial globe length of 20.4 ± 0.13 and 21.50 ± 0.34 mm respectively, a difference which was
statistically significant (P ≤ 0.001).

181

Figure 4.1. Globe lengths.
(A) Combined A- and B-Mode ocular ultrasound images. The images show the different
measurements taken. C-AC: Cornea-Anterior chamber width, L: lens width, PS: posterior
segment depth and GL: axial globe length. Representative ultrasound images of the globe from a
CrxRdy/Rdy, a CrxRdy/+ and a WT 12-week-old cat show the enlarged globe of the CrxRdy/Rdy due to
an enlarged posterior segment.
(B) Enucleated fixed eyes from a 12-week-old CrxRdy/Rdy and CrxRdy/+ cats. These pictures
show an enlarged globe with a deeper posterior segment in the CrxRdy/Rdy cat.
(C) Scatter plot of the axial globe length versus the age. A significant difference can be seen
between the axial globe length of the CrxRdy/Rdy cat compared to that of the CrxRdy/+ and WT cats
at all ages tested.
(D) Scatter plot of the posterior segment depth versus the age. A significant difference can be
seen between the posterior segment depth of the CrxRdy/Rdy cat compared to that of the CrxRdy/+
and WT cats at all ages tested.

182

To investigate the anatomical origin of the increase in axial globe length, cornea-anterior
segment width, lens width and posterior segment depth measures were analyzed and showed a
significant increase in posterior segment depth in CrxRdy/Rdy cats compared to CrxRdy/+ and to
control WT cats (P < 0.0001) (Fig. 4.1D and Appendix Q – Fig. 4.S3). No difference was found
overall between CrxRdy/+ and WT cats (P = 0.250) although an effect of the sex between CrxRdy/+
and WT groups (more male in WT group) was found (P = 0.006). For example, at one year of
age the CrxRdy/Rdy, CrxRdy/+ and WT cats had a posterior segment depth of respectively 10.9 ± 0.1,
7.1 ± 0.1 and 7.8 ± 0.3 mm. For the axial globe length and the posterior segment depth, the older
the animals were the greater the differences. No significant difference was found in corneaanterior chamber widths, yet an effect of the sex between CrxRdy/+ and WT groups (more male in
WT group) was found (P = 0.007). Similarly, no significant difference was found in corneaanterior chamber widths; the effect of the sex between CrxRdy/+ and WT groups (more male in
WT group) was significant (P = 0.011) (Appendix Q – Fig. 4.S3).
Due to the increase in posterior segment depth, investigation of the possibility for
increase in intraocular pressure and changes in refractive error were performed. There were no
differences in IOPs between CrxRdy/Rdy and WT cats (16.0 ± 1.8 and 15.4 ± 1.6 mmHg,
respectively P = 0.577) in the animals investigated (Fig. 4.2A). However, a statistically marked
significant difference was found in refractive state. The CrxRdy/Rdy cats had a very myopic
refractive error of a mean of -14 ± 1.1 D compared to -0.9 ± 0.4 D in the WT cats (P = 0.004,
Ttest) (Fig. 4.2B). A refractive error was also present in the CrxRdy/+ cats with an average of -2.7
± 0.8 D (P < 0.001 compared to CrxRdy/Rdy cats and P = 0.002 compared to WT cats, Ttest). When
analyzed with a mixed effect model, age had a significant influence in the difference between the
CrxRdy/+ cats and both the CrxRdy/Rdy and WT cats (P = 0.003). The eye (left or right) did not have
an effect on the difference between groups nor did it have an effect on refraction or IOP.
183

Figure 4.2. (A) Intraocular pressure (IOP). There was no significant difference in IOP
between the CrxRdy/Rdy and WT cats. (B) Refractive error. Severe myopia was found in the
CrxRdy/Rdy cats with a mean -14 D of compared to -0.9 D in the WT cats. **P < 0.01

4.4.2. CrxRdy/Rdy kittens lack retinal function
At all ages examined, the CrxRdy/Rdy cats had an absence of menace response and dazzle
reflex (although this could be hard to assess due to the animals moving and blinking) and
decreased pupillary light reflexes. Nystagmus was not noted at any age. To more precisely assess
retinal functional, ERGs were recorded at multiple time points from 4 to 20 weeks of age.17
CrxRdy/Rdy kittens did not have any recordable ERG responses at any age tested for either scotopic
or photopic ERG (Fig. 4.3). Therefore no statistical analysis was performed.

184

Figure 4.3. Dark-adapted intensity series ERGs from WT, CrxRdy+/- and CrxRdy/Rdy kittens at
10-weeks of age (age of peak maturation of the ERG in the CrxRdy/+ cat). The CrxRdy/+ kitten
waveforms are very reduced in amplitude (note the scale differences between the sets of tracings)
and have increased implicit times. There was no recordable ERG from the CrxRdy/Rdy kitten.
Responses to stimulation from top to bottom of -1.6, -1.2, -0.8, -0.4, 0.0, 0.4, 0.9, and 1.4 log
cdS/m². (Scale bars: vertical 100 µV; horizontal 50 ms).

4.4.3. CrxRdy/Rdy kittens have changes in fundus reflectivity and tapetal thinning, but
superficial retinal vasculature persists into adulthood
To determine the progression of retinal degeneration in CrxRdy/Rdy kittens, in vivo
ophthalmic imaging was performed at multiple time points from 4 weeks to 5 years of age.
Ophthalmoscopic examination revealed that there were some changes in tapetal reflectivity as
early as 6 to 8 weeks of age (when the tapetum develops). Discernible tapetal hyperreflectivity
(indicative of retinal thinning) was visible as early as 12 weeks of age (Fig. 4.4). The appearance
of the tapetum and tapetal reflectivity in CrxRdy/Rdy kittens was never normal with a generalized
abnormally appearing “sheen” to it when compared to WT cats. Interestingly, all animals
developed a specific lesion with the choroidal vessels starting to become apparent at an early age,
and some increased cSLO autofluorescence was visible paralleling choroidal vessels as early as

185

12-15 weeks of age (Fig. 4.4B). This worsened with age and seemed to correlate with the SDOCT imaging, with severe thinning of the tapetum lucidum but also choroidal thinning.
The generalized tapetal reflectivity changes were not so severe as in the CrxRdy/+ cats
where marked hyperreflectivity developed (Fig. 4.4). In the CrxRdy/Rdy kittens superficial retinal
vasculature is preserved up to at least 5 years (oldest animal examined). In contrast in the
CrxRdy/+ cats by this age vessels were markedly attenuated, arteriovenous shunts had developed,
and there was a mild leakage of fluorescein apparent a few minutes after injection of fluorescein.
(Fig. 4.4B).

Figure 4.4. Fundus images during development and adulthood.
186

Figure 4.4 (cont’d)
(A) Fundus color images showing tapetal hyperreflectivity (a sign of retinal thinning) as early
as 12 weeks of age, while the retinal vasculature is relatively well preserved even though thinned
during advanced disease stages. At 26 weeks of age, extreme thinning of the tapetum can be
seen, which allows the choroidal vessels to be seen (shown by the white arrows in (B).
(B) Fundus color and cSLO images from WT adult cat, 4-year-old CrxRdy/Rdy and CrxRdy/+ cats.
Infrared (IR, 875nm), Autofluorescence (AF, 488nm) and Fluorescein angiography (FA, 488nm)
images showing the preservation of the retinal vasculature despite disease progression. Arrows
indicate an area of tapetal thinning exposing the choroidal vasculature (dark streak on AF and
hyperfluorescent streak on FA: white arrows). Note the difference compared to the CrxRdy/+ cat in
which the retinal vessels are very thinned (white arrow head and show some arterio-venous
shunts: black arrow heads).
4.4.4. The CrxRdy/Rdy cat lacks development of photoreceptor inner and outer
segments, and despite extensive retinal remodeling has preservation of total retinal
thickness
Retinal SD-OCT cross-sectional images were captured from CrxRdy/Rdy animals between 4
weeks and 5 years of age. SD-OCT zones representing photoreceptor inner/outer segments
(IS/OS) could not be detected at any age from CrxRdy/Rdy animals (Fig. 4.5A). These included the
ellipsoid zone and differentiation of the interdigitation zone and external limiting membrane.28
Due primarily to the absence of IS/OS the overall retinal thickness was thinner than in agematched CrxRdy/+ and WT cats. The rest of the retinal layers appeared to have developed normally
and were clearly discernible. Interestingly, at an early age (4 and 6 weeks of age) the ONL
appeared to be bilayered; this corresponded on IHC and histology to two ONL cell nuclei
populations: the outer portion consisted of elongated nuclei elongated while the nuclei in the
inner portion were circular (Fig. 4.7 and Appendix V – Fig. 4.S8). With disease progressive the
clear demarcation of retinal layers was lost as remodeling occurred, and it became harder to
recognize them and therefore to measure them. We noted that there was some degree of
individual variation. Interestingly, the retina did not thin so severely with age as in the CrxRdy/+
cats. The retina seems to initially thin and then become thicker (Figs. 4.5A and 4.5B). While the
187

total retinal thickness (TR) of the CrxRdy/Rdy cat was similar to the WT cat in most regions, the
REC+ was thinner than in the WT cat while the inner retinal layers (IR) became thicker as also
occurs in the CrxRdy/+ cat. In the CrxRdy/Rdy cat, overall all layers had a tendency to thicken with
age, yet the area centralis was thinner. (Fig. 4.6 and Appendix R – Fig. 4.S4). This overall
thickness preservation indicates that there is photoreceptor nuclei/cell degeneration and inner
retinal proliferation (Fig. 4.7). To summarize, there is an initial reduction in TR thickness
followed by an increase, which is mainly due to IR thickening (INL and GCC maintained and
thickening) while the REC+, even if initially thinner than that of CrxRdy/+ and WT cats (due to the
lack of photoreceptor IS/OS), is maintained or only mildly thinned (Appendix S, T and U – FigS.
4.S5, 4.S6 and 4.S7).

188

Figure 4.5. Spectral Domain – Optical Coherence Tomography (SD-OCT) in vivo retinal
morphology analysis of the dorsal retina.
(A) SD-OCT cross-section images of the retina in the region dorsal to the optic disc.
Showingrepresentative CrxRdy/Rdy animals at 6, 12 and 26 weeks, 1.5, 3 and 4 years of age. As
comparison, cross-sections of the retina of representative of CrxRdy/+ and WT cats at 6 weeks and
4 years of age are shown. Note that initially, while the inner and outer segments are not
detectable (causing the total retina to be thinner than that of CrxRdy/+ and WT cats at 6 weeks), the
rest of the retinal layers appear normally developed. With disease progressive the layers start to
remodel and become harder to identify. However, the retina of CrxRdy/Rdy cats does not thin so
severely with age as that of the CrxRdy/+ cats. The retina seems to initially thin then thicken.
(B) Thicknesses of retinal layers in the dorsal region. Top panels show the different retinal
layers’ thicknesses in the dorsal area of CrxRdy/Rdy, CrxRdy/+ and WT cats over the course of the
disease. The CrxRdy/Rdy cat retina does not develop a similar degeneration as that of the CrxRdy/+
cat. Bottom panels show comparison of the total retina (TR), receptor+ (REC+) and inner
retina (IR) from CrxRdy/Rdy, CrxRdy/+ and WT cats during disease progression. Note the
maintenance of the TR but thinning of REC+ and thickening of the IR in the CrxRdy/Rdy cat.
TR; Total retina, REC+; Receptor+, IR; Inner retina, INL; Inner retina layer, GCC; Ganglion cell
complex.
189

Figure 4.6. Spectral Domain – Optical Coherence Tomography (SD-OCT) in vivo retinal
morphology analysis of the area centralis.
190

Figure 4.6 (cont’d)
(A) Thicknesses of retinal layers in the area centralis region.
The total retina (TR), receptor+ (REC+) and inner retina (IR) thicknesses in CrxRdy/Rdy,
CrxRdy/+ and WT cats are shown during disease progression. The TR and IR of CrxRdy/Rdy cats
were thinner than those of CrxRdy/+ and WT cats before maturation. However, unlike with the
CrxRdy/+ cat, their TR, REC+ and IR thicknesses remain stable, and the IR actually has a tendency
to thicken with age.
(B) Total retinal, Receptor+ and Inner retina thicknesses color map in the area centralis.
The left panel shows color (heat) maps for a representative CrxRdy/Rdy cat from 6 weeks to 4 years
of age. The right top panel shows the retinal location of the color map. The bottom right panel
shows the color map for representative CrxRdy/+and WT cats at 6 weeks and 4 years of age. Note
the thinner TR and REC+ in the CrxRdy/Rdy cat from an early age. The IR is thicker than that of the
CrxRdy/+ and WT cats. With disease progression, thickening surrounding the center of the area
centralis can be seen in the CrxRdy/Rdy cat, leading to slight TR and REC+ thickening, which is in
contrast with the severe thinning of retinal layers in the CrxRdy/+ cats at 4 year of age.

The SD-OCT findings were confirmed by histology and IHC (Figs. 4.7 and 4.8). Careful
examination of plastic embedded semi-thin sections (Fig. 4.7 and Appendix V – Fig. 4.S8)
confirmed the lack of normal development of photoreceptor inner and outer segments, although
all other retinal layers seemed to develop properly. Only very small rudimentary inner segments
are present in the CrxRdy/Rdy cat retina (visible on high magnification histology and electron
microscopy images). Those are surrounded and in contact with RPE villosities (Appendix V –
Fig. 4.S8). On SD-OCT, as well as histology and immunohistochemistry sections, as mentioned
earlier, the outer nuclear layer had a bilayered appearance at a young age. Progressive
disorganization of the retinal layers developed with age. Initially, the lamination of the retina
seemed normal (see Fig. 4.7A), but as early as 6 weeks of age some abnormal tissue can be seen
between the ONL and INL nuclei. Additionally, it was noted that the shape and appearance of the
chromatin of the ONL nuclei changed such that it was not so dense as in healthy photoreceptor
nuclei. By 2 and 3.5 years of age, there was a complete disorganization of the retinal layers
although retinal thickness was maintained with the exception of at the very center of the area
centralis, which was thinned in most animals (Fig. 4.7).
191

Figure 4.7. Representative histologic sections and morphologic characteristic in the
CrxRdy/Rdy cats.
With the exception of the inner segment and outer segment layers, all retinal layers were present.

192

Figure 4.7 (cont’d)
(A) Representative plastic sections of retina from centro-dorsal regions in CrxRdy/Rdy cats
and an adult WT cat.
Note the absence of photoreceptor inner and outer segment during maturation and at adulthood.
The retinal thickness is preserved over time (although there is some individual variation). The
preservation of thickness is accounted for by activation of the inner retinal components with
development of advanced glial scaring. The black arrowheads indicated the Müller cell processes
advancing between the ONL cell bodies.
OS, photoreceptor outer segment; IS, photoreceptor inner segment; ONL, Outer Nuclear Layer;
OPL, Outer Plexiform Layer; INL, Inner Nuclear Layer; IPL, Inner Plexiform Layer; GCL/NFL,
Ganglion Cell Layer/Nerve Fiber Layer; RPE, Retinal Pigmentary Epithelium
(B) SD-OCT, Histology and DAPI fluorescent staining (1) 6-week-old, (2) 2-week-old and
20-week-old CrxRdy/Rdy cats.
As in (A), all retinal layers were present except the inner segment and outer segment layers. Only
small rudimentary inner segments could be seen (2.3.: white arrow head). The photoreceptor
nuclei (ONL) developed into a bilayered arrangement with nuclei in the outer portion being
elongated while those in the inner portion were circular (1 and circled nuclei in 2.1). Progressive
disorganization of the retinal layers developed (1.3., 3.1. and 3.2.), and the ONL thinned with
most severe thinning in the center of the area centralis (3.).

To further investigate structural changes, immunolabeling of key photoreceptor structural
and phototransduction proteins was performed on frozen retinal sections using markers to
identify retinal cell types (Fig. 4.8, Appendix W – Fig. 4.S9 and Appendix a – Table 4.S4). At
none of the ages tested did any cells label with human cone arrestin (hCAR) (hCAR labels both
cone types), S-opsin (SO, short wavelength-opsin) or ML-opsin (MLO, medium/long
wavelength-opsin) in the CrxRdy/Rdy cat. Additionally, no photoreceptors ware labeled with
calbindin, which labels cones in normal cats (Appendix W - Figs. 4.S9A and 4.S9B).29 There
was some RetP1 (a marker for rods) labeling in the CrxRdy/Rdy cat, although this was severely
decreased at all ages and abnormally distributed. The very short vestigial inner segments labeled,
as did some photoreceptor cell bodies indicating mislocalization of rhodopsin, which was
apparent from as early as 2 weeks of age. By 3.5 years of age, only few remaining ONL nuclei
were labeled for rhodopsin (Fig. 4.8A).

193

Figure 4.8. Immunolabeling of the CrxRdy/Rdy cat central retinal region for (A) rod, (B) rod
bipolar, (C) Müller cell and (D) Neural cell markers.
(A) In the CrxRdy/Rdy cat, as early as 2 week of age, RetP1 (which labels rod outer segments (OS)
in normal cats) can be seen labeling the very small inner segments (IS) and the ONL cell bodies.
This mislocalization of rhodopsin persisted until adulthood, at which time only few rod positive
nuclei were detectable. Cones labeling was absent at all ages tested in the CrxRdy/Rdy retina.

194

Figure 4.8 (cont’d)
(B) Rod bipolar cells can be seen labeled by PKCα in 2-week-old CrxRdy/Rdy retinas. By 12 weeks
of age, the rod bipolar cells seemed to start sprouting towards the ONL. By 3.5 years of age,
some major modifications happened, and the rod bipolar cells dendrites have invaded the ONL
(indicated by the white star) forming a matrix within the latter.
(C) During disease progression, Müller cells became highly activated, and extensive GFAP
labeled can be seen in the CrxRdy/Rdy retina. At 3.5 years of age the GFAP positive Müller cell
processes had extensively invaded all layers of the retina (spreading of the activated Müller cells
is indicated by the white arrows).
(D) Labeling with NeuN antibody showed apparently normal labeling of ganglion cells and some
INL cells, but there was also some abnormal labeling through the ONL nuclei.
OS; Photoreceptor outer segment, IS; Photoreceptor inner segment, ONL; Outer nuclear layer,
OPL; Outer plexiform layer, INL; Inner nuclear layer, IPL; Inner plexiform layer, GCL; ganglion
cell layer.

Immunolabeling for rod bipolar cells (using an anti-PKCα antibody) showed that in the
CrxRdy/Rdy kittens there initially appear to be normal numbers of PKCα expressing cells in the
INL. Sprouting of PKCα labeled dendrites can be seen by 12 weeks of age, and by 3.5 years of
age they were stretched and invaded the outer retina creating a matrix within the ONL (Fig.
4.8B). Other inner retinal cells were investigated using calbindin labeling (Appendix W - Fig.
4.S9B). It showed what seemed to be normal labeling of the inner retinal cells such as amacrine,
horizontal and ganglion cells in the CrxRdy/Rdy retina.
Immunolabeling for glial fibrillary acidic protein (GFAP) was markedly increased
indicating Müller cell activation. At 2 weeks of age only very minor activation of Müller cells
was seen, but by 12 weeks of age they were invading the INL and had extended toward the ONL.
By 3.5 years of age, GFAP labeling was present within all retinal layers, indicative of extensive
Müller cell activation characteristic of retinal scaring and remodeling (Fig. 4.8C).30-32
NeuN, a neuronal marker, labeled ganglion cells as in normal retina but it also
abnormally labeled inner retinal cells and ONL nuclei at all age tested in the CrxRdy/Rdy retina
(Fig. 4.8D).

195

Immunolabeling indicated the presence of the retinal pigmentary epithelium (RPE65
antibody) in all ages tested and in all retinal regions (Appendix I - Fig. 4.S9C).
Crx labeling was present at 12 weeks and 3.5 years of age in CrxRdy/Rdy retina and seems
to be more extensive in older animals (Appendix I - Fig. 4.S9D).

4.4.5. CrxRdy/Rdy retinas had a marked reduction of transcript levels for cone and rod
specific genes and changes in expression levels of transcription factors involved in
the photoreceptor development/fate cascade
To investigate molecular changes underlying CrxRdy/Rdy retinal pathology, we assessed
mRNA levels of selected CRX target genes in retinal subregions of 2-week-old CrxRdy/rdy,
CrxRdy/+ and WT kittens (Appendix B - Fig. 4.S2). This included investigation of cone specific
genes such as cone arrestin (arrestin3, Arr3), medium-long wavelength opsin (MOP), short
wavelength opsin (SO), and a rod specific gene like rhodopsin (Rho). Transcription factors
involved in the photoreceptor development cascade were also investigated (Fig. 4.9, Appendix b
- Table 4.S5): total Crx (WT and mutant), homeobox protein (Otx2), neural retina leucine zipper
protein (Nrl), photoreceptor-specific nuclear receptor (Nr2e3), thyroid hormone receptor β2
(Trβ2) and the nuclear receptor (Rorβ) were measured.
Table 4.1. gives a summary of the results showing relative expression changes between
CrxRdy/Rdy, CrxRdy/+ and WT kittens.

196

CrxRdy/Rdy vs CrxRdy/+

CrxRdy/Rdy vs WT

CrxRdy/+ vs WT

Arr3

27.4x less

1724.1x less

62.9x less

SO

15.8x less

62.7x less

4.0x less

MOP

Not detectable in CrxRdy/Rdy

Not detectable in CrxRdy/Rdy

4.3x less

Rho
total
Crx
Otx2

10.9x less

32.5x less

3.0x less

No significant difference

1.8X more

1.8X more

No significant difference

2.4X more

1.9X more

Nrl

2.3x less

No significant difference

No significant difference

Nr2e3

2.1x less

1.9x less

No significant difference

Trβ2

No significant difference

1.4X more

No significant difference

Rorβ

1.3X more

1.3X more

No significant difference

mRNA

Table 4.1. Summary of the results by indicating fold expression changes for each mRNA
between CrxRdy/Rdy, CrxRdy/+ and WT kittens.
The CrxRdy/Rdy and CrxRdy/+ kitten retinas had significantly decreased levels of cone and
rod opsin mRNA compared to the WT cats (Fig. 4.9, for all P values, see Appendix c – Table
4.S6). Arr3, SO and Rho expression was respectively 27.4, 15.8, 10.9 times higher in CrxRdy/+
kitten’s retina compared to CrxRdy/Rdy kitten’s retina. MOP was not detectable in CrxRdy/Rdy
kitten’s retina. To investigate the effect of the mutation on the Crx expression itself we evaluated
expression of the total transcript. In both the CrxRdy/Rdy and CrxRdy/+ kitten’s retinas total levels of
Crx were at a significantly higher level (1.8 times higher) than the levels of WT Crx transcript in
the WT kitten’s retina. No significant difference between total Crx expression levels in the
CrxRdy/Rdy and CrxRdy/+ kitten’s retina was detected. Otx2, a transcription factor involved in
photoreceptor development, was expressed at 2.4 and 1.9 times higher respectively in the
CrxRdy/Rdy and CrxRdy/+ kitten’s retinas compared to the WT kitten’s retina. Total Crx and Otx2
were significantly increased compared to WT retinas, but there was no significant difference
between the levels in the CrxRdy/Rdy and CrxRdy/+ kitten’s retinas. Nrl expression was
197

downregulated by 2.3 times in the CrxRdy/Rdy compared to the CrxRdy/+ kitten’s retina while there
was no significant difference compared to the WT levels. Nr2e3 was expressed at 2.1 and 1.9
times lower levels in the CrxRdy/Rdy compared to the CrxRdy/+ kitten’s retina and WT kitten’s retina
while there was no significant difference between the CrxRdy/+ and WT kitten’s retinas. Trβ2 was
expressed at a 1.4 times higher levels in the CrxRdy/Rdy compared to the WT kitten’s retina while
no difference was significant between the CrxRdy/+ and the CrxRdy/Rdy or WT kitten’s retinas. Rorβ
was expressed at a 1.3 times higher levels in the CrxRdy/Rdy compared to the CrxRdy/+ kitten’s
retina and WT kitten’s retina while no difference was significant between the CrxRdy/+ and WT
kitten’s retinas.

Figure 4.9. Changes in mRNA expression in CrxRdy/Rdy retinas compared to CrxRdy/+ retinas
– levels are normalized to WT retinas.

198

Figure 4.9 (cont’d)
qRT-PCR overall (average of the areas assessed) mRNA expression levels of arrestin3 (Arr3,
specific to cones), medium-long wavelength opsin (MOP, specific to M/L cones), short
wavelength opsin (SO, specific to S cones), rhodopsin (Rho, specific to rods), total Crx (WT and
mutant), homeobox protein (Otx2), neural retina leucine zipper protein (Nrl), photoreceptorspecific nuclear receptor (Nr2e3), thyroid hormone receptor β2 (Trβ2) and the nuclear receptor
(Rorβ) in CrxRdy/Rdy and CrxRdy/+ retina in 2-week-old kittens retinas relative to levels in WT
retinas.
The CrxRdy/Rdy and CrxRdy/+ kitten retinas had significantly decreased levels of cone and rod opsin
mRNA compared to the WT cats. In contrast, the expression of total Crx and Otx2 were
significantly increased compared to WT retinas. Nrl and Nr2e3 were expressed at lower levels in
the CrxRdy/Rdy compared to the CrxRdy/+ and WT kitten’s retinas while Trβ2 and Rorβ were
expressed at higher levels compared to the WT kitten’s retinas. P-values comparing the means
CrxRdy/Rdy, CrxRdy/+ and WT expression levels are †P ≤ 0.1,*P < 0.05, **P < 0.01, and ***P <
0.001.

To confirm the specific over expression of the mutant Crx product we performed Western
blot assays (Fig. 4.10). This assay confirmed that the mutant Crx protein was at 3 times higher
levels in the CrxRdy/Rdy retinas than the WT Crx protein was in the WT retinas (P = 0.005) (Fig.
4.10B).

Figure 4.10. Western blot analysis for Crx nuclear protein.
(A) Western blot for nuclear Crx protein (immunolabeled with antibody 119b1). The
amount of Crx protein present in retinal nuclear extract was investigated by Western blot from 2week-old CrxRdy/Rdy and WT kittens. In the CrxRdy/Rdy kitten’s retina only the truncated mutant Crx
protein is present while as expected only the full length Crx protein is present in the WT kitten’s
retina. Beta-actin was used as protein loading control.
(B) Quantification of normal and mutant protein levels in CrxRdy/Rdy and wild-type kittens.
Crx protein levels were normalized to beta-actin levels, and the CrxRdy/Rdy kitten protein levels
shown normalized to the Crx levels in the WT retinas. The level of truncated protein was higher
in the CrxRdy/Rdy kitten retina than the level of WT protein in the WT kittens. **P < 0.01
199

4.5. DISCUSSION
This study adds to previous studies characterizing the Rdy cat. While some phenotyping
of the heterozygous CrxRdy/+ cat had been previously performed, there had been no studies
reporting on the homozygous CrxRdy/Rdy cat.17-20, 33 In keeping with previous studies of Class III
CRX mouse mutant models, the CrxRdy/Rdy cat showed an over expression of the mutant Crx
transcript that we predict exerts a dominant negative effect. The Rdy feline model offers
important advantages due to the presence of a macula-like retinal region allowing for further
characterization of the phenotype of Class III CRX mutations. Compared to other models the
CrxRdy/Rdy cat phenotype has certain unique features.

4.5.1. The CrxRdy/Rdy kitten develops significant globe enlargement without glaucoma
The CrxRdy/Rdy cat has a significant increase in axial globe length predominantly as a result
of an increase in posterior segment length (Fig. 4.1). This was not associated with any increase in
IOP (Fig. 4.2A).34 Refraction (Fig. 4.2B) revealed that the globes had extreme myopia.35-38
Abnormal globe length is a well-recognized feature in animals with abnormal visual input.39, 40
The increase in globe size may be responsible for the choroidal thinning that was noted in the
homozygous cats (Fig. 4.4).41 The chicken has been used extensively for the study of myopia
induced by visual deficits. Some models with enlarged globes have developed splits in Bruch’s
membrane (laquer cracks), which is also a feature of human high myopes. Further studies of the
choroidal thinning in the CrxRdy/Rdy cat are needed to see if splits in Bruch’s membrane also
develop.42-48 The large degree of globe enlargement in the CrxRdy/Rdy cat may make it a useful
model for studying the mechanism of developmental myopia.

200

4.5.2. The CrxRdy/Rdy kitten is a model for severe CRX-LCA retinopathies
The CrxRdy/Rdy cat phenotype is characterized by blindness from birth, with a sluggish
PLR, and no dazzle reflex or menace response. We suspected that the remaining PLR was driven
by melanopsin containing ganglion cells and IHC showed very well conserved ganglion cells
(Fig. 4.8D). Ophthalmoscopic features of the model included the development of tapetal
hyperreflectivity, which is considered an indicator of generalized retinal thinning. However,
there was not a significant decrease in total retinal thickness so the tapetal hyperreflectivity may
have resulted from the almost total lack of cone and rod opsins that in a normal eye would absorb
photons passing through the retina. The CrxRdy/Rdy cat only developed very short inner segments
that express rhodopsin (Fig. 4.8A) before photoreceptor maturation became halted. The
photoreceptor nuclei consisted of two populations with different nuclear morphology: one which
population had oval-shaped nuclei comparable to the appearance in an immature retina while the
other showed a more mature morphology (round nuclei). It appeared that the normal migration of
cell bodies of photoreceptors that occurs during maturation of the retina did not occur. The lack
of photoreceptor maturation was reflected in the complete lack of detectable ERG responses (Fig.
4.3). Interestingly, there was not a rapid photoreceptor degeneration as occurs in the CrxRdy/+ cat,
although some evidence of degeneration and cell migration occurred. There was initially
relatively normal stratification of the retinal layers, but over time there was extensive activation
of Müller cells and sprouting and migration of bipolar cells. This retinal remodeling resulted in
some thickening of the inner retinal layers, which counteracted the thinning of the outer retain
and thus preserved the overall retinal thickness (Figs. 4.5, 4.6, 4.7, 4.8B and 4.8C and
Appendices R, S, T and U – Figs. 4.S4, 4.S5, 4.S6 and 4.S7).30-32, 49 This retinal remodeling was
more severe than in the CrxRdy/+ feline phenotype

17

but was similar to the E168d2/d2

homozygous mouse.50 The relative lack of overall retinal thinning may account for the striking
201

persistence of retinal vasculature until advanced disease stages (Figs. 4.4, 4.5, 4.6 and 4.7). The
area centralis had slightly different changes compared to the peripheral retina with thinning of
the total retina and receptor+ layers (Fig. 4.6). There was an earlier and marked loss of
photoreceptor nuclei in the center of the area centralis.
The phenotype of the CrxRdy/Rdy cat is quite different to that of the heterozygote, not being
simply a more severe version. The CrxRdy/Rdy cat has some similarities with the engineered
knockout Crx-/- or CrxRip mice models

3, 21

with respectively some absence of outer segments at

any time with rhodospin expression level decreased and some very small inner segments tips
(Fig. 4.7 and Appendix V – Fig. 4.S8), and some absence of ERG response from an early age
(Fig. 4.3) with mild retinal thickness changes and absence of cone marker expression. Although
some similarities to other models, the CrxRdy/Rdy cat presents with a particular phenotype that does
not resemble any other.
The absence of photoreceptor development with no OS and very vestigial IS might be
responsible for the relatively slow photoreceptor nuclei loss compared to the CrxRdy/+ cat. In the
CrxRdy/+ cats, the degeneration of photoreceptors expressing phototransduction proteins and
retinal degeneration can result from altered phototransduction cascade dynamics and
mislocalization of opsins.51-56

4.5.3. Molecular mechanism underlying CrxRdy/Rdy phenotype
The Rdy mutation introduces a premature stop codon 16 in Crx with the mutant transcript
escaping nonsense-mediated decay and resulting in overexpression of the mutant allele (Fig. 4.8
and 4.9).9, 57, 58
Lack of normal Crx activity resulted in a marked decrease in cone and rod transcripts in
the CrxRdy/Rdy cat retinas. It also had effects on the levels of other transcription factors involved in
202

photoreceptor development. Crx, Otx2 and Rorβ showed an increase in expression. The increase
in Otx2 expression may be due to a retroactive feedback mechanism compensating for the lack of
other transcription factors. Nrl and Nr2e3 expression level was decreased, perhaps contributing
to the partial failure in maturation of the photoreceptor nuclei. Despite the slightly increased
expression of Trβ2, which is involved in cone maturation, there was a lack of cone opsin
expression and failure in cone maturation. Interpretation regarding the transcription factors’
expression changes are still very difficult as the mechanism of interactions is still not completely
understood and complex (Fig. 4.11).2, 21

Figure 4.11. The molecular mechanism of congenital
dominant CRX frameshift mutations from Roger et al, 2014.

blindness

caused

by

The CrxRdy/Rdy cat provides a large animal model for investigating scleral growth factors
implicated in myopia development and for the severe dominant CRX mutations associated with
over expression of a mutant transcript with an antimorphic effect.

203

4.6. ACKNOWLEDGEMENTS
The authors would like to thank Dr. Cheryl Craft for the donation of the hCAR antibody,
Dr. Debra Thompson for the donation of the RPE65 antibody, Dr. Alicia Withrow for her help
with thick sections, Dr. Wenjuan Ma for statistical advice and the RATTS group for their help
with animal handling and anesthesia as well as our collaborator on this project Dr. Shiming Chen
and Dr. Nicholas Tran.
Supported by National Institutes of Health Grants EY012543 and EY025272-01A1 (SC),
EY002687 (P30 Core Grant) (Washington University Department of Ophthalmology and Visual
Sciences (WU-DOVS)), EY013360 (T32 Predoctoral Training Grant) (WU), unrestricted funds
from Research to Prevent Blindness (WUDOVS), Foundation Fighting Blindness (SC), Hope for
Vision (SC), George H. Bird and ‘‘Casper’’ Endowment for Feline Initiatives (LMO and SMPJ),
Michigan State University Center for Feline Health and Well-Being (LMO and SMPJ), and
Myers-Dunlap Endowment (SMPJ).

204

APPENDICES

205

APPENDIX O – Figure 4.S1

Figure 4.S1. Retinal regions imaged by SD-OCT and regions biopsied for histologic
sections. Cross sectional retinal images were captured for measurement of retinal layer
thicknesses at the following regions (as indicated on the fundus image by an asterisk): the area
centralis; 4 optic nerve diameters from the optic nerve edge superiorly, inferiorly, temporally and
nasally. Similarly, 3 to 3.5 mm retina-sclera biopsies were taken in the same area from
processing to obtain histologic sections.

206

APPENDIX P – Figure 4.S2

Figure 4.S2. Sites of retinal sampling for qRT-PCR (from Chapter 2).17 Due to the small
globe size of 2-week-old kittens, retina was collected from two regions as indicated (central and
peripheral retinal regions).

207

APPENDIX Q – Figure 4.S3

Figure 4.S3. Globe lengths.
(A) Scatter plot of the cornea-anterior segment width versus the age. No difference was
present between the cornea-anterior segment width of the CrxRdy/Rdy cat compared to that of the
CrxRdy/+ and WT cats at any age tested.
(B) Scatter plot of the lens width versus the age. No difference was found between the lens
width of the CrxRdy/Rdy cat compared to that of the CrxRdy/+ and WT cats at any age tested.

208

APPENDIX R – Figure 4.S4

Figure 4.S4. Thicknesses of retinal layers in the dorsal and area centralis region.
(A) Dorsal region. The CrxRdy/Rdy cat shows a thickening of the INL and GCC as occurs in
the CrxRdy/+ cats, but in the homozygote the increased thickness is maintained with age.
(B) Area centralis region. As for the dorsal region (Fig. 4.5) the CrxRdy/Rdy cats do not exhibit
thinning of the retinal layers with disease progression in contrast to the CrxRdy/+ cats. The INL has
a tendency to thicken, and the GCC thickness is maintained.
TR; Total retina, REC+; Receptor+, IR; Inner retina, INL; Inner retina layer, GCC; Ganglion cell
complex.
.

209

APPENDIX S – Figure 4.S5

Figure 4.S5. Thicknesses of retinal layers in the temporal region.
As for the other regions retinal layer thicknesses are maintained in the CrxRdy/Rdy cats in contrast
to the severe thinning that occurs in the CrxRdy/+ cats. In the CrxRdy/Rdy cats the INL, GCC and IR
have a tendency to thicken while the TR initially thins then thickens after which the thickness is
maintained. The REC+ thinned a bit but is maintained over time.
TR; Total retina, REC+; Receptor+, IR; Inner retina, INL; Inner retina layer, GCC; Ganglion cell
complex.

210

APPENDIX T – Figure 4.S6

Figure 4.S6. Thicknesses of retinal layers in the nasal region.
As for the other regions retinal layer thicknesses are maintained in the CrxRdy/Rdy cats in contrast
to the severe thinning that occurs in the CrxRdy/+ cats In the CrxRdy/Rdy cats the INL, GCC and IR
have a tendency to thicken while the TR initially thins then thickens after which the thickness is
maintained. The REC+ thinned a bit but is maintained over time.
TR; Total retina, REC+; Receptor+, IR; Inner retina, INL; Inner retina layer, GCC; Ganglion cell
complex.

211

APPENDIX U –Figure 4.S7

Figure 4.S7. Thicknesses of retinal layers in the ventral region.
As for the other regions retinal layer thicknesses are maintained in the CrxRdy/Rdy cats in contrast
to the severe thinning that occurs in the CrxRdy/+ cats. The INL, GCC and IR thicknesses are
maintained. The REC+ and TR thinned a bit but then thickened over time.
TR; Total retina, REC+; Receptor+, IR; Inner retina, INL; Inner retina layer, GCC; Ganglion cell
complex

212

APPENDIX V – Figure 4.S8

Figure 4.S8. Regular histologic and electron microscopy images of a 2-week-old CrxRdy/Rdy
cat.
Note the absence of photoreceptor outer segment layers on all images. Some very small
rudimentary inner segments develop, indicated by white arrowheads (2. and 3.). Electron
microscopy images showed similar rudimentary inner segments protruding through the external
limiting membrane into the subretinal space, indicated by white arrowheads. The rudimentary
inner segments are surrounded and in contact with RPE villosities, indicated by the white stars.

213

APPENDIX W – Figure 4.S9

Figure 4.S9. Immunolabeling of the CrxRdy/Rdy cat central retina frozen sections for (A)
cones’ markers, (B) inner retina cells’s markers, (C) retinal pigmentary epithelium cell
marker and (D) Crx antibody.

214

Figure 4.S9 (cont’d)

At any age tested, an absence of cones labeling was noted in the CrxRdy/Rdy retina (A). Human
cone arrestin (hCAR) antibody that labels the entire cone cell bodies as seen in the WT adult
retina was not detected. Labeling for medium/long wavelength opsin (MLO) or short wavelength
opsin (SO) was also absent. This absence of cone labeling was also present with calbindin
antibody labeling (B) (see the top row nuclei of the ONL labeled in red in the WT adult retina
which is cone labeling). Calbindin labeling showed apparently normal labeling of the inner
retinal cells such as amacrine, horizontal and ganglion cells in the CrxRdy/Rdy retina at any age
tested. Yet, it was difficult to assess precise morphology of those cell populations. (C) Retinal
pigmentary epithelium labeled with RPE65 antibody was also present at any age tested. The Crx
expression was present at high level especially in adult CrxRdy/Rdy retina (D).
OS; Photoreceptor outer segment, IS; Photoreceptor inner segment, ONL; Outer nuclear layer,
OPL; Outer plexiform layer, INL; Inner nuclear layer, IPL; Inner plexiform layer, GCL; ganglion
cell layer.

215

APPENDIX X – Table 4.S1.
CrxRdy/Rdy
Age
GL
(years) both eyes
0.074
0.082
0.112
0.118
0.148
0.165
0.192
0.2
0.227
0.23
0.274
0.288
0.297
0.337
0.384
0.412
0.474
0.499
0.567
0.778
1
1.5
2

1
1
3
2
1
1
1
1
1
2
1
2
2
2
2
1
1
2
1
1
2
1
2

WT

CrxRdy/+

C-AC, L,
C-AC, L,
C-AC, L,
Age
GL
Age
GL
PS
PS
PS
(years) both eyes
(years) both eyes
both eyes
both eyes
both eyes
0.071
3
0.038
1
0.074
1
0.071
2
3
0.09
3
0.074
2
0.109
3
0.09
2
0.112
1
1
0.109
3
0.118
2
0.112
1
1
1
0.123
2
0.118
2
1
0.129
2
0.129
1
1
0.137
3
0.137
2
1
0.14
1
0.165
1
1
0.142
1
0.175
2
1
0.148
1
0.194
1
0.165
1
0.197
2
1
0.175
3
0.2
1
1
0.192
1
0.225
2
1
0.194
1
0.227
1
1
0.197
1
0.233
1
2
0.2
1
0.236
1
0.203
1
0.238
1
0.225
1
0.274
1
1
0.227
2
1
0.288
4
1
0.233
1
0.297
2
2
0.236
1
0.329
1
0.238
2
0.337
1
0.271
1
0.377
3
1
0.274
1
0.384
3,5
0.288
3
0.412
2
0.297
2
0.499
3

Table 4.S1. Experiments and numbers of animal for globe length in CrxRdy/Rdy, CrxRdy/+and
WT cats

216

Table 4.S1 (cont’d)
0.329
0.337
0.377
0.384
0.412
0.479
0.499
0.567
0.775
1
1.5
2
6
Total different animals
6
5

2
2
3
1
2
1
1
2
1
9
2
1
1

1

24

9

5
1
1

0.567
0.775
1
1.5
2.5
3
4
4.5
4.75
5
9
10.1

1
1
4
1
1
6
2
2
1
2
2
2

30

1
1
1
1
2
1

2

12

GL both eyes: Axial globe length measurements in both eyes of one individual.
C-AC, L, PS both eyes: Cornea-Anterior chamber width, Lens width and Posterior Segment in
both eyes of one individual.

217

APPENDIX Y – Table 4.S2.
IOP
Age (years)
0.6
0.8
0.9
2.5
4.1
6.2
Total different
animals

Refraction
Age (years)
0.6
0.8
0.9
1.4
2.5
3.2
3.7
4.1
4.6
6.2
6.6
6.7
Total different
animals

CrxRdy/Rdy

WT
2

2
1
1
1
1

1

6

5

CrxRdy/Rdy

WT
2

2

CrxRdy/+
1

1
1
2
1
1
1

1
1

1
1
1
6

5

6

qRT-PCR
Age (weeks)
2

CrxRdy/Rdy
3

WT
3

CrxRdy/+
3

Western
Age (weeks)
2

CrxRdy/Rdy
2

WT
3

Table 4.S2. Experiments and numbers of animal for IOP, refraction, qRT-PCR, Western
blot, immunohistochemistry and histology in CrxRdy/Rdy, CrxRdy/+and WT cats

218

Table 4.S2 (cont’d)

Age (years)
0.04
0.12
0.23
0.38
2
3.5

Age (weeks)
2
6
12
20

Immunohistochemistry
CrxRdy/Rdy
2
2
2
3
1
1

219

Histology
CrxRdy/Rdy
2
2
2
3
1
1

APPENDIX Z – Table 4.S3.
Age
(years)
0.08
0.12
0.15
0.19
0.23
0.29
0.34
0.38
0.5
0.58
0.77
1
1.5
2
3
3.5
4
5
Total different
animals

Age
(weeks)
4
6
8
10
12
15
17.5
20
26

Fluorescein
angiography

ERG

SD-OCT

2
6
2
4
5
4
1
7

2
4
2
3
8
4

10

12

2

1
1
1
1
4

6
3
1
1
4
3
3
2
1
2
1

Table 4.S3. Experiments and numbers of animal for fluorescein angiography, ERG and SDOCT in CrxRdy/Rdy cats

220

APPENDIX a – Table 4.S4.
Antibody – Source
Hcar (Human cone arrestin)
Dr. Cheryl Craft; LUMIJ,
University of Southern California,
Los Angeles, CA, USA
PNA (Biotinylated Peanut
Agglutinin)
Vector Labs Inc., Burlin-game,
CA, USA
ML-opsin (Anti-Opsin,
Red/Green; Medium/ Long
wavelength cone opsin)
Millipore Corp., Billerica, MA,
USA
S-opsin (Anti-Opsin, Blue; Short
wavelength cone opsin)
Millipore Corp., Billerica, MA,
USA

Type

Primary
Dilution

Polyclonal
rabbit

1:10,000

Biotinylated
Lectin

1:500

Alexa Fluor 488 Streptavadin
Life technologies, Carlsbad,
CA, USA

1:500

1:1,000

Alexa Fluor 568 or 594 Goat
anti-rabbit IgG
Life technologies, Carlsbad,
CA, USA

1:500

Polyclonal
rabbit

Polyclonal
rabbit

1:1,000

RetP1 (Rhodopsin Ab-1)
Thermo Scientific, Rockford, IL,
USA

Monoclonal
mouse

GFAP (Anti-Glial Fibrillary
Acidic Protein)
Cell Signaling Technology Inc.,
Danvers, MA, USA

Monoclonal
mouse

1:300

PKCα (Protein Kinase C-alpha)
BD Biosciences, San Jose, CA,
USA

Monoclonal
mouse

1:500

Calbindin
Swant, Marly, Switzerland

Monoclonal
mouse

1:500

Monoclonal
mouse

1:2,000

NeuN (Neuron-Specific Nuclear
Protein)
Millipore Corp., Billerica, MA,
USA
RPE65 (Retinal pigmentary
epithelium-specific 65kDA
protein)
Dr. Debra Thompson; Kellogg
eye center, University of
Michigan, Ann Arbor, MI, USA
Crx (Cone rod homebox)
Sigma-Aldrich, St Louis, MO,
USA

Monoclonal
mouse

Monoclonal
mouse

1:2

Secondary
Antibody – Source
Alexa Fluor 488 Goat antirabbit IgG
Life technologies, Carlsbad,
CA, USA

Alexa Fluor 568 or 594 Goat
anti-rabbit IgG
Life technologies, Carlsbad,
CA, USA
Alexa Fluor 594 Goat antimouse IgG
Life technologies, Carlsbad,
CA, USA
Alexa Fluor 594 Rabbit antimouse IgG
Life technologies, Carlsbad,
CA, USA
Alexa Fluor 594 Goat antimouse IgG
Life technologies, Carlsbad,
CA, USA
Alexa Fluor 568 Goat antimouse IgG
Life technologies, Carlsbad,
CA, USA
Alexa Fluor 488 Goat antimouse IgG
Life technologies, Carlsbad,
CA, USA

Secondary
Dilution
1:500

1:500

1:500

1:500

1:500

1:500

1:500

1:500

Alexa Fluor 568 Goat antimouse IgG
Life technologies, Carlsbad,
CA, USA

1:500

1:20,000

Alexa Fluor 568 Goat antimouse IgG
Life technologies, Carlsbad,
CA, USA

1:500

Table 4.S4. List of antibodies used for IHC – their origins and dilutions

221

APPENDIX b – Table 4.S5.
Primer
name

Forward primer

Reverse primer

Amplicon
size (bp)

Arr3

5' CGTTGTCCTGTATTCCCTAGAC 3'

5' GCTAGAGGCCAGATTAGTATCAC 3'

190

Rho

5' GGTGCCCTACGCCAGCGTG 3'

5' CAGTGGGTTCTTGCCACAG 3'

190

MOP

5' TGTCTCCTTGTGTGGGATCA 3'

5' GTACGAGCTGCCACTGAACA 3'

257

SO

5' AGTCAGCCTCAACCCAGAA 3'

5' CACCATCTCCATGATGCAAG 3'

326

Crx Total

5' AAGACTCAGTACCCGGATGTGTA 3'

5' GGGGCTGTAGGAGTCTGAGAT 3'

223

OTX2

5' GCTAGACGTGCTGGAAGCTC 3'

5' GGGCTGGAGAGGTCTTCTTT 3'

209

Nrl

5' CCCACAGCTACTACCCAGGA 3'

5' TCACACCACTCCCTCTCCTC 3'

207

Nr2e3

5' CATCCCCATACTCCTCCTCA 3'

5' GAGGCAGGGACCACTGTATG 3'

198

TrB2

5' GACTCCGAACTTGTCGCATT 3'

5' TTTGGTTGATGTTGCTGTGG 3'

197

RorB

5' GAGGAATGCAGATGTTCAAGG 3'

5' GCTTCTGGACCTTCCTTGGT 3'

177

Tuba1b

5' GCTCTATTGCCTGGAACACG 3'

5' CATCTTCCTTGCCCGTGATG 3'

230

GAPDH

5' GGTCTTCACCACCATGGAGA 3'

5' TGGACTGTGGTCATGAGTCC 3'

237

Table 4.S5. Primer sequences for qRT-PCR assays

222

APPENDIX c – Table 4.S6.
CrxRdy/Rdy vs WT
P = 0.004
Arr3
P = 0.004
Rho
P ≤ 0.001
MOP
P = 0.004
SO
Crx Total P = 0.032
P ≤ 0.001
OTX2
P = 0.058
Nrl
P ≤ 0.001
Nr2e3
P = 0.030
TrB2
P = 0.049
RorB

CrxRdy/Rdy vs CrxRdy/+
P = 0.003
P ≤ 0.001
P = 0.001
P = 0.010
P = 0.792
P = 0.119
P = 0.029
P ≤ 0.001
P = 0.507
P = 0.021

CrxRdy/+ vs WT
P = 0.002
P ≤ 0.001
P = 0.002
P = 0.026
P = 0.002
P ≤ 0.001
P = 0.603
P = 0.295
P = 0.069
P = 0.822

Table 4.S6. P values for qRT-PCR assays results
Significant values are indicated in red.
Note only P values for the overall retina sample are given. Indeed, difference per region was not
considered interpretable as the risk of Type II error was quite high.

223

REFERENCES

224

REFERENCES

1.
Furukawa T, Morrow EM, Cepko CL. Crx, a novel otx-like homeobox gene, shows
photoreceptor-specific expression and regulates photoreceptor differentiation. Cell. 1997;91:531541.
2.
Hennig AK, Peng GH, Chen S. Regulation of photoreceptor gene expression by Crxassociated transcription factor network. Brain Res. 2008;1192:114-133.
3.
Morrow EM, Furukawa T, Raviola E, Cepko CL. Synaptogenesis and outer segment
formation are perturbed in the neural retina of Crx mutant mice. BMC Neurosci. 2005;6:5.
4.
Chau KY, Chen S, Zack DJ, Ono SJ. Functional domains of the cone-rod homeobox
(CRX) transcription factor. J Biol Chem. 2000;275:37264-37270.
5.
Chen S, Wang QL, Nie Z, et al. Crx, a novel Otx-like paired-homeodomain protein, binds
to and transactivates photoreceptor cell-specific genes. Neuron. 1997;19:1017-1030.
6.
Peng GH, Chen S. Crx activates opsin transcription by recruiting HAT-containing coactivators and promoting histone acetylation. Hum Mol Genet. 2007;16:2433-2452
.
7.
Corbo JC, Lawrence KA, Karlstetter M, et al. CRX ChIP-seq reveals the cis-regulatory
architecture of mouse photoreceptors. Genome Res. 2010;20:1512-1525.
8.
Livesey FJ, Furukawa T, Steffen MA, Church GM, Cepko CL. Microarray analysis of the
transcriptional network controlled by the photoreceptor homeobox gene Crx. Curr Biol.
2000;10:301-310.
9.
Tran NM, Zhang A, Zhang X, Huecker JB, Hennig AK, Chen S. Mechanistically Distinct
Mouse Models for CRX-Associated Retinopathy. PLoS Genet. 2014;10:e1004111.
10.
Sohocki MM, Sullivan LS, Mintz-Hittner HA, et al. A range of clinical phenotypes
associated with mutations in CRX, a photoreceptor transcription-factor gene. Am J Hum Genet.
1998;63:1307-1315.
11.
Hull S, Arno G, Plagnol V, et al. The phenotypic variability of retinal dystrophies
associated with mutations in CRX, with report of a novel macular dystrophy phenotype. Invest
Ophthalmol Vis Sci. 2014;55:6934-6944.
12.
Stone EM. Leber congenital amaurosis - a model for efficient genetic testing of
heterogeneous disorders: LXIV Edward Jackson Memorial Lecture. Am J Ophthalmol.
2007;144:791-811.
13.
Koenekoop RK. An overview of Leber congenital amaurosis: a model to understand
human retinal development. Surv Ophthalmol. 2004;49:379-398.
225

14.
Huang L, Xiao X, Li S, et al. CRX variants in cone-rod dystrophy and mutation
overview. Biochem Biophys Res Commun. 2012;426:498-503.
15.
Tran NM, Chen SM. Mechanisms of Blindness: Animal Models Provide Insight Into
Distinct CRX-Associated Retinopathies. Dev Dyn. 2014;243:1153-1166.
16.
Menotti-Raymond M, Deckman KH, David V, Myrkalo J, O'Brien SJ, Narfstrom K.
Mutation discovered in a feline model of human congenital retinal blinding disease. Invest
Ophthalmol Vis Sci. 2010;51:2852-2859.
17.
Occelli LM, Tran NM, Narfstrom K, Chen S, Petersen-Jones SM. CrxRdy Cat: A Large
Animal Model for CRX-Associated Leber Congenital Amaurosis. Invest Ophthalmol Vis Sci.
2016;57:3780-3792.
18.
Leon A, Hussain AA, Curtis R. Autosomal dominant rod-cone dysplasia in the Rdy cat. 2.
Electrophysiological findings. Exp Eye Res. 1991;53:489-502.
19.
Curtis R, Barnett KC, Leon A. An early-onset retinal dystrophy with dominant
inheritance in the Abyssinian cat. Clinical and pathological findings. Invest Ophthalmol Vis Sci.
1987;28:131-139.
20.
Leon A, Curtis R. Autosomal dominant rod-cone dysplasia in the Rdy cat. 1. Light and
electron microscopic findings. Exp Eye Res. 1990;51:361-381.
21.
Roger JE, Hiriyanna A, Gotoh N, et al. OTX2 loss causes rod differentiation defect in
CRX-associated congenital blindness. J Clini Invest. 2014;124:631-643.
22.
Swaroop A, Wang QL, Wu W, et al. Leber congenital amaurosis caused by a
homozygous mutation (R90W) in the homeodomain of the retinal transcription factor CRX:
direct evidence for the involvement of CRX in the development of photoreceptor function. Hum
Mol Genet. 1999;8:299-305.
23.
Pignatelli V, Cepko CL, Strettoi E. Inner retinal abnormalities in a mouse model of
Leber's congenital amaurosis. J Comp Neurol. 2004;469:351-359.
24.
Hood DC, Lin CE, Lazow MA, Locke KG, Zhang X, Birch DG. Thickness of receptor
and post-receptor retinal layers in patients with retinitis pigmentosa measured with frequencydomain optical coherence tomography. Invest Ophthalmol Vis Sci. 2009;50:2328-2336.
25.
Mowat FM, Gornik KR, Dinculescu A, et al. Tyrosine capsid-mutant AAV vectors for
gene delivery to the canine retina from a subretinal or intravitreal approach. Gene Ther.
2014;21:96-105.
26.
Schneider CA, Rasband WS, Eliceiri KW. NIH Image to ImageJ: 25 years of image
analysis. Nat Methods. 2012;9:671-675.
226

27.
RStudio Team (2015). RStudio: Integrated Development for R. RStudio I, Boston, MA
URL http://www.rstudio.com/.
28.
Staurenghi G, Sadda S, Chakravarthy U, Spaide RF, International Nomenclature for
Optical Coherence Tomography P. Proposed lexicon for anatomic landmarks in normal posterior
segment spectral-domain optical coherence tomography: the IN*OCT consensus.
Ophthalmology. 2014;121:1572-1578.
29.
Pasteels B, Rogers J, Blachier F, Pochet R. Calbindin and calretinin localization in retina
from different species. Vis. Neurosci. 1990;5:1-16.
30.
Ekstrom P, Sanyal S, Narfstrom K, Chader GJ, van Veen T. Accumulation of glial
fibrillary acidic protein in Muller radial glia during retinal degeneration. Invest Ophthalmol Vis
Sci. 1988;29:1363-1371.
31.
Sarthy PV, Fu M. Transcriptional activation of an intermediate filament protein gene in
mice with retinal dystrophy. DNA. 1989;8:437-446.
32.
Linberg KA, Fariss RN, Heckenlively JR, Farber DB, Fisher SK. Morphological
characterization of the retinal degeneration in three strains of mice carrying the rd-3 mutation.
Vis Neurosci. 2005;22:721-734.
33.
Chong NH, Alexander RA, Barnett KC, Bird AC, Luthert PJ. An immunohistochemical
study of an autosomal dominant feline rod/cone dysplasia (Rdy cats). Exp Eye Res. 1999;68:5157.
34.
Rusanen E, Florin M, Hassig M, Spiess BM. Evaluation of a rebound tonometer
(Tonovet) in clinically normal cat eyes. Vet Ophthalmol. 2010;13:31-36.
35.
McMullen RJ, Jr., Davidson MG, Gilger BC. The effect of 1% tropicamide-induced
mydriasis and cycloplegia on spherical refraction of the adult horse. Vet Ophthalmol.
2014;17:120-125.
36.
Twelker JD, Mutti DO. Retinoscopy in infants using a near noncycloplegic technique,
cycloplegia with tropicamide 1%, and cycloplegia with cyclopentolate 1%. Optom Vis Sci.
2001;78:215-222.
37.
Schaeffel F, Feldkaemper M. Animal models in myopia research. Clin Exp Optom.
2015;98:507-517.
38.
Konrade KA, Hoffman AR, Ramey KL, Goldenberg RB, Lehenbauer TW. Refractive
states of eyes and associations between ametropia and age, breed, and axial globe length in
domestic cats. Am J Vet Res. 2012;73:279-284.
39.
Whitmore WG. Congenital and developmental myopia. Eye (London, England) 1992;6 (
Pt 4):361-365.
227

40.
Ritchey ER, Zelinka C, Tang J, et al. Vision-guided ocular growth in a mutant chicken
model with diminished visual acuity. Exp Eye Res. 2012;102:59-69.
41.

Rada JA, Shelton S, Norton TT. The sclera and myopia. Exp Eye Res. 2006;82:185-200.

42.
Liang H, Crewther DP, Crewther SG, Barila AM. A role for photoreceptor outer
segments in the induction of deprivation myopia. Vis Res. 1995;35:1217-1225.
43.
Troilo D, Quinn N, Baker K. Accommodation and induced myopia in marmosets. Vis
Res. 2007;47:1228-1244.
44.
Montiani-Ferreira F, Fischer A, Cernuda-Cernuda R, et al. Detailed histopathologic
characterization of the retinopathy, globe enlarged (rge) chick phenotype. Mol Vis. 2005;11:1127.
45.
Montiani-Ferreira F, Kiupel M, Petersen-Jones SM. Spontaneous lacquer crack lesions in
the retinopathy, globe enlarged (rge) chick. J Comp Pathol. 2004;131:105-111.
46.
Inglehearn CF, Morrice DR, Lester DH, et al. Genetic, ophthalmic, morphometric and
histopathological analysis of the Retinopathy Globe Enlarged (rge) chicken. Mol Vis.
2003;9:295-300.
47.
McBrien NA, Gentle A. Role of the sclera in the development and pathological
complications of myopia. Prog Retin Eye Res. 2003;22:307-338.
48.
Gollender M, Thorn F, Erickson P. Development of axial ocular dimensions following
eyelid suture in the cat. Vis Res. 1979;19:221-223.
49.
Hippert C, Graca AB, Barber AC, et al. Muller glia activation in response to inherited
retinal degeneration is highly varied and disease-specific. PloS one. 2015;10:e0120415.
50.
Tran NM, Chen S. Mechanisms of blindness: Animal models provide insight into distinct
CRX-associated retinopathies. Dev Dyn. 2014;243:1153-1166.
51.
Hollingsworth TJ, Gross AK. Defective trafficking of rhodopsin and its role in retinal
degenerations. Int Rev Cell Mol Biol. 2012;293:1-44.
52.
Gao J, Cheon K, Nusinowitz S, et al. Progressive photoreceptor degeneration, outer
segment dysplasia, and rhodopsin mislocalization in mice with targeted disruption of the retinitis
pigmentosa-1 (Rp1) gene. Proc Natl Acad Sci U S A. 2002;99:5698-5703.
53.
Hollingsworth TJ, Gross AK. The severe autosomal dominant retinitis pigmentosa
rhodopsin mutant Ter349Glu mislocalizes and induces rapid rod cell death. J Biol Chem.
2013;288:29047-29055.
54.
Bandyopadhyay M, Kono M, Rohrer B. Explant cultures of Rpe65-/- mouse retina: a
model to investigate cone opsin trafficking. Mol Vis. 2013;19:1149-1157.
228

55.
Rana T, Shinde VM, Starr CR, et al. An activated unfolded protein response promotes
retinal degeneration and triggers an inflammatory response in the mouse retina. Cell Death Dis.
2014;5:e1578.
56.
Athanasiou D, Aguila M, Bevilacqua D, Novoselov SS, Parfitt DA, Cheetham ME. The
cell stress machinery and retinal degeneration. FEBS lett. 2013;587:2008-2017.
57.
Nichols LL, 2nd, Alur RP, Boobalan E, et al. Two novel CRX mutant proteins causing
autosomal dominant Leber congenital amaurosis interact differently with NRL. Hum Mutat.
2010;31:E1472-1483.
58.
Terrell D, Xie B, Workman M, et al. OTX2 and CRX rescue overlapping and
photoreceptor-specific functions in the Drosophila eye. Dev Dyn. 2012;241:215-228.

229

CHAPTER 5
ADENO-ASSOCIATED VIRUS GENE AUGMENTATION THERAPY TRIAL
FOR CRX-LCA DOMINANT NEGATIVE MUTATION
IN THE CRXRDY/+ FELINE MODEL

230

5.1. ABSTRACT
PURPOSE. Mutations in the retinal transcription factor cone-rod homeobox (CRX) gene
are cause of severe dominant LCA retinopathies. There is currently no treatment for dominant
negative LCA diseases. The CrxRdy/+ feline large animal model was reported to be a valuable
model for Class III CRX mutations for mechanistic disease mechanisms as well as potential
therapy development. In this model, the disease is characterized by a toxic effect of the mutant
Crx mRNA/protein over the WT mRNA/protein. The aim of this project was to shift the ratio of
mutant to WT mRNA/protein in order to slow down retinal degeneration and rescue some visual
function. METHODS. 3-week-old CrxRdy/+ kittens received a subretinal injection of an adenoassociated viral (AAV) vector containing the human CRX cDNA sequence with an attached
FLAG-sequence. Two different AAV serotypes were used: AAV2/5 and AAV2/8 with a single
capsid mutation (Y733F). Transgene expression was driven by an ubiquitous promoter (chicken
ß-actin, CBA) or a photoreceptor specific promoter (G-protein-dependent receptor kinase,
GRK1). Outcome was assessed by fundus examination, electroretinography (ERG), optical
coherence tomography and immunohistochemistry analyses. RESULTS. The ubiquitous
promoter resulted in low levels of transgene expression. The vectors with a GRK1 promoter
provided strong expression. Mixture of AAV2/8 Y733F containing vectors with both promoters
(ubiquitous and GRK1) resulted also in an increased combined transgene. No major adverse
effects were noted. Only one kitten showed significant functional rescue as assessed by ERG.
CONCLUSIONS. Subretinal delivery of vector in 3-week-old kittens was possible, but it could
be challenging to specifically target the area centralis, which is the most rapid degenerating
region in the CrxRdy/+ model. Some transgene expression as demonstrated by FLAG expression
was present in most kittens, yet only one kitten showed functional rescue. Further optimization is
necessary, and gene augmentation might not be sufficient to shift the mutant to WT Crx ratio to
231

reach consistent and sustainable rescue. It may be of value to combine it with other techniques
aiming to downregulate the mutant Crx allele.

5.2. INTRODUCTION
Mutations in the cone-rod homeobox (CRX) gene are an important cause of severe, early
onset retinal dystrophies, which rapidly progress to blindness.1, 2 In children, they result in one
form of dominantly inherited childhood vision loss classified as Leber congenital amaurosis
(LCA)3, 4 for which there is an unmet need for a therapy to slow or prevent vision loss.
LCA accounts for ~5% of all inherited retinopathies with a prevalence of between 1 in
30,000 to 81,000 newborns.5, 6 Mutations in the CRX gene account for about 2% of LCA.7 CRX
encodes a transcription factor that is essential for photoreceptor development, maturation and
post-development survival. The protein has a DNA-binding domain and transactivation
domains.8-12
In the Rdy cat, a single basepair deletion (p.Pro185LysfsTer2) in Crx was identified as the
cause of a severe, dominant, early-onset form of progressive retinal atrophy.13 The Rdy mutation
results in a frameshift and premature stop codon at codon 186 resulting in a similar truncation to
the Ed168d2 mouse model and several different Class III human CRX frameshift mutations.13-15
The heterozygous Rdy (CrxRdy/+) cat has been shown to have a LCA phenotype strikingly similar
to those. The truncated mRNA in Rdy cats, as well as in animal and in vitro models of similar
truncating mutations, escapes non-sense mediated decay and is transcribed into a truncated
protein.2, 14, 15 In chapter 2, we demonstrated that CrxRdy/+ feline retinas, prior to degeneration,
have higher levels of mutant Crx mRNA and protein than they have of the wild-type Crx mRNA
and protein, which is in keeping with the findings in mouse models with similar mutations. The

232

Crx mutant protein in Class III CRX mutations has an antimorphic effect by binding the promoter
of target genes but failing to transactivate them.2, 14
In addition, to being a valuable model for mechanistic disease investigation, the feline
model is extremely important for preclinical assessment of therapy in humans. As described in
chapter 1, the cat eye has similar globe dimensions16, 17 as the human eye making it suitable for
therapy delivery techniques that are used in human patients. Also, the distribution of
photoreceptors across the feline retina is similar to the human retina unlike laboratory mice,
which have a dorsal to ventral photoreceptor gradient.18-24 The area centralis of the feline retina
has a higher density of photoreceptors, including cones, analogous to the human macula. This is
particularly valuable when investigating conditions such as CRX-LCA retinopathies, which
present with early cone photoreceptors involvement. The phenotypic similarity, along with an
identical proposed disease mechanism for the frameshift mutations affecting the transactivation
domains of CRX, make the CrxRdy/+ feline model a valuable model to use for preclinical testing of
therapies for CRX-LCA retinopathies.
In designing a therapeutic approach, phenotypic characteristics of animals with Class III
CRX mutations have been taken into account. The E168d2 mouse model has two distinct lines.
In one line an intronic Neo cassette remains (E168d2Neo line), and this line has a lower level of
mutant Crx transcript and protein than a second line where the Neo cassette has been excised
(E168d2). The E168d2Neo line has a much milder phenotype than the E168d2 line suggesting
that increasing the ratio of wild-type to mutant Crx will improve the phenotype.2, 15 Additionally,
humans and animal models heterozygous for null mutations of CRX have been shown to have
very mild or non-existent phenotype, indicating that haploinsufficiency does not explain the
severe phenotype associated with frameshift mutations.2,

233

12, 15, 25-28

Taken together these

observations confirm that the severe dominant CRX-related retinopathies are not due to
haploinsufficiency but due to a deleterious effect of the mutant protein.
As a treatment strategy, we therefore hypothesize that increasing the ratio of wild-type to
mutant Crx protein will result in a milder phenotype in animals heterozygous for antimorphic Crx
mutations. The aim of this study was to start investigating whether increasing expression of wildtype Crx improves the retinal phenotype of CrxRdy/+ kittens, making this a useful approach for
translational therapy that aims to slow down vision loss in CRX-LCA patients with similar
frameshift antimorphic mutations.

5.3. MATERIALS AND METHODS
Using an adeno-associated viral vector construct that has been previously shown to
efficiently target cone and rod photoreceptors in wild-type cats29,

30

and kittens (personal

communication) and both wild-type and E168d2 mouse31, Crx was expressed in the
photoreceptors of CrxRdy/+ kittens. This will be aiming to increase the ratio of wild-type Crx
protein to mutant Crx protein to reduce the antimorphic effect of the mutant protein.

5.3.1. Ethics statement
All procedures were performed in accordance with the ARVO statement for the Use of
Animals in Ophthalmic and Vision Research and approved by the Michigan State University
Institutional Animal Care and Use Committee.

5.3.2. Animals
Fifteen purpose-bred CrxRdy/+ kittens maintained as a colony at Michigan State University
were included in this study. They were housed under 12L:12D cycles and fed by the queens and a
234

commercial feline dry diet (Purina kitten chow; Nestlé Purina, St Louis, MO. USA). Animals
ranging from 3 weeks to 12 weeks of age were studied.

5.3.3. Subretinal injections and vectors delivered
AAV were delivered by subretinal injection in 3-4-week-old (21 to 26 days of age)
CrxRdy/+ kittens, the earliest age in which a subretinal injection could be reproducibly performed.
Kittens were anesthetized with isoflurane (IsoFlo; Abbott Laboratories, North Chicago,
IL, USA) delivered in oxygen. Pupils were dilated with tropicamide ophthalmic solution
(Tropicamide UPS 1% Falcon Pharmaceuticals Ltd., Fort Worth, TX, USA). The kittens were
placed in dorsal recumbency for the procedure. Subretinal injection was performed as previously
described. 32
A vitrectomy was not performed due to the small size of the eye. A sclerotomy with a 25
or 30G needle was performed at 2.5 mm from the limbus and an aqueocentesis with a 30G needle
(except for one kitten). Visualization of the fundus was performed using a 10mm diameter cover
slip (CS-No1-10, Bioscience Tools, Highland, CA, USA) coupled on the cornea with Optixcare
eye lube (Waterdown, Ontario, Canada). The subretinal injection was performed with a 33G
Hamilton syringe (Reno, NV, USA). 32 After injection, a subconjunctival injection of a mixture of
2 mg methylprednisolone acetate (Depo-Medrol 40 mg/mL, Zoetis, Kalamazoo, MI, USA or
Pfizer Inc, NYC, NY, USA), 0.1 mg dexamethasone (Dexa-ject 2mg/mL, Henry Schein Animal
Health, Dublin, OH, USA or Dexium, Bimeda, Inc., Le Sueur, MN, USA) and 1.2 mg
Gentamicin (40mg/ml, Hospira Inc, Lake Forest, IL, USA or GentaFuse, Bulter Schein Animal
Health, Dublin, OH, USA) for a total volume of 0.13 mL was given.
One eye was injected with a therapeutic AAV-FLAG-CRX vector and the contralateral
eye as either injected with a therapeutic vector as well or was uninjected, or received a construct
235

of the similar serotype and promoter but delivering the GFP gene. The central retina was targeted
and approximately 30-200µL was injected (Fig. 5.1).

Figure 5.1. 175 µL subretinal injection in the central retinal region of a 3-week-old CrxRdy/+
kitten.

Several titers of vector were tested based on our preliminary studies and initial results (5x
1011, 1x1012, 5x1012 and 7.5x1012 vg/mL).
The different AAV vectors tested were AAV2/5 with an ubiquitous promoter and
AAV2/8 Y733F (single mutant capsid tyrosine to phenylalanine mutation) with an ubiquitous
(Chicken ß-Actin CBA or Universoti of Florida UF) or GRK1 promoter (for details on injections,
titers and volumes refer to Table 5.1 below).
After preliminary results and evidence of functional rescue in one eye in which the cornea
was partially covered by its nictitans membrane, 5 kittens were kept in dim light conditions (0.04
to 3.45 cd/m2) from eyelid opening (1 to 2 weeks of age) until euthanasia at 12 weeks of age.

236

ID

Age at
injection
(days)

Viral Construct injected in OD

Viral Construct injected in OS

AAV2/5 – Ubiquitous promoter
OA01785531

24

AAV2/5 UF-SB-FLAG-hCRX
K2583

AAV2/5 sc-smCBA-hGFP

5x1011vg/mL

5x1011vg/mL

AAV2/8 Y733F mutant capsid
AAV2/8 Y733F mutant capsid – Ubiquitous promoter
OA02532731

21

AAV2/8 Y733F, UF-SB-FLAGhCRX, Ω4030

-

1x1012vg/mL
OA02532018

OA02525638

28

24

AAV2/8 Y733F, UF-SB-FLAGhCRX, Ω4030

AAV2/8 Y733F, UF11-GFP,
I1838c

5x1011vg/mL

5x1011vg/mL

AAV2/8 Y733F, UF-SB-FLAGhCRX, Ω4030

AV2/8 Y733F, UF11-GFP, I1838c

5x1011vg/mL

5x1011vg/mL

AAV2/8 Y733F mutant capsid – GRK1 promoter
OA02532828

21

AAV2/8 Y733F, GRK1-FLAG-Crx,
K2822

-

1x1012vg/mL
OA02533517

21

AAV2/8 Y733F, GRK1-FLAG-Crx,
K2822

-

1x1012vg/mL
OA02496941

26

26

AAV2/8 Y733F, GRK1-FLAG-CRX,
P4376

-

1x1012vg/mL

Dark conditions
OA025001214

-

1x1012vg/mL

Dark conditions
OA02497929

AAV2/8 Y733F, GRK1-FLAG-CRX,
P4376

26

AAV2/8 Y733F, GRK1-FLAG-CRX,
P4376

-

Table 5.1. List of animals, the vector and titer they received. Animals maintained in dark light
conditions were indicated under their ID number.

237

Table 5.1 (cont’d)
Dark conditions

5x1012vg/mL

OA02501046

A AAV2/8 Y733F, GRK1-FLAGCRX, P4376

26

-

5x1012vg/mL

Dark conditions
OA02496779

AAV2/8 Y733F, GRK1-FLAG-CRX,
P4376

24

-

7.5x1012vg/mL

Dark conditions
OA02496004

AAV 8 733, GRK1-FLAG-CRX,
P4376

24

-

7.5x1012vg/mL

Dark conditions
Age at
injection
(days)

ID

Viral Construct injected in OD

Viral Construct injected in OS

AAV2/8 Y733F mutant capsid – Ubiquitous and GRK1 promoters
OA01790762

24

OA02527420

21

RSA 15-071
Died at recovery

21

AAV2/8 Y733F, GRK1-FLAG-Crx,
K2822

AV2/8 Y733F, UF11-GFP, I1838c

5x1011vg/mL

5x1011vg/mL

Mix Half/half
AAV2/8 Y733F, UF-SB-FLAGhCRX, Ω4030
AAV2/8 Y733F, GRK1-FLAG-Crx,
K2822

Mix Half/half
AAV2/8 Y733F, UF-SB-FLAGhCRX, Ω4030
AAV2/8 Y733F, GRK1-FLAG-Crx,
K2822

1x1012vg/mL

1x1012vg/mL

AAV2/8 Y733F, UF-SB-FLAGhCRX, Ω4030

Mix Half/half
AAV2/8 Y733F, UF-SB-FLAGhCRX, Ω4030
AAV2/8 Y733F, GRK1-FLAG-Crx,
K2822

1x1012vg/mL

1x1012vg/mL

5.3.4. Outcome evaluations

Age
(weeks)

Subretinal
injection

Fundus
imaging

ERG

cSLO

SD-OCT

Euthanasi
a

IHC

3

6,10,12

6, 10, 12

12

12

12

12

Table 5.2. Experimental design
238

5.3.4.1. Ophthalmic examination and fundus imaging
Eyes were examined regularly for any adverse response to the therapy such as
inflammation or differential retinal degeneration between injected and uninjected regions and
between treated and control eyes.

Full ophthalmic examinations included

indirect

ophthalmoscopy daily up to 3 days post-operatively, then weekly until 6 weeks of age and finally
at 10 and 12 weeks of age. Fundus photography (Ret-Cam II, Clarity Medical Systems, Inc.,
Pleasanton, CA, USA) was performed at 6, 10 and 12 weeks of age. Infrared and
autofluorescence imaging with confocal scanning laser ophthalmoscopy (Spectralis OCT+HRA;
Heidelberg Engineering Inc., Heidelberg, Germany) was performed before euthanasia at 12
weeks of age.
Animals injected with the AAV-GFP vector were monitored for GFP expression using
wide-field fundus photography (RetCam II, Clarity Medical Systems, Inc., Pleasanton, CA,
USA), and fluorescence was also monitored using a cSLO (confocal scanning laser
ophthalmascope) (Spectralis® OCT+HRA, Heidelberg Engineering Inc., Heidelberg, Germany) at
similar ages to the regular fundus imaging.

5.3.4.2. Retinal function assessment – Electroretinography (ERG)
Scotopic and photopic ERGs were recorded from kittens described previously in chapter
2.14 The kittens were dark-adapted for 1 hour, and pupils were dilated with tropicamide
ophthalmic solution, (Falcon Pharmaceuticals Ltd., Fort Worth, TX, USA). A Jet-lens monopolar
electrode contact lens with a platinum needle skin reference electrode (Grass Technologies,
Warwick, RI, USA) was placed 0.5 cm from the lateral canthus, and a ground electrode was
placed over the occiput (Grass Technologies, Warwick, RI, USA). ERG a- and b-wave
amplitudes and implicit times were measured in a standard fashion. Evidence of a positive effect
239

of therapy would be the presence of a cone-mediated response (not recordable from untreated
kittens) and an improvement (lowering) of the threshold of dark-adapted responses and an
increase in amplitudes compared to non-treated eyes.

5.3.4.3. Retinal morphology and CRX expression
5.3.4.3.1. In vivo Spectral Domain-Optical Coherence Tomography
(SD-OCT)
SD-OCT imaging (Heidelberg Engineering) was used to capture single scan line and
volume scan images from treated and untreated regions. The treated regions were assessed for
retinal reattachment and any side effects from the procedure.33 They were also assessed for
evidence of photoreceptor morphology by examining the regions of the SD-OCT scan representing
photoreceptor inner and outer segments and the ellipsoid zone. 33 Improvement in the definition of
those layers was considered a positive outcome.

5.3.4.3.2. Immunohistochemistry (IHC)
After kittens were euthanized at 12 weeks of age (age of peak retinal function in wild-type
kittens)14, their eyes were removed and immersed in 4% paraformaldehyde (Electron Microscope
Sciences, Hatfield, PA, USA) in phosphate-buffered saline (PBS, Sigma-Aldrich Corp., Saint
Louis, MO, USA) on ice for 3 hours. They were then processed for immunohistochemistry and
imaged as previously described14, 30 (Table 5.3. lists the antibodies used). Treated and untreated
region were examined for FLAG expression (marker of transgene and thus CRX expression) and
hCAR, a cone photoreceptor marker to assess for evidence of rescue of photoreceptor maturation
in the CrxRdy/+ kittens post AAV gene supplementary therapy.
240

Antibody – Source

Type

FLAG (Anti-FLAG® M2)
Sigma, St. Louis, MI, USA

Monoclonal
mouse

hCAR (Human cone arrestin)
Dr. Cheryl Craft; LUMIJ,
University of Southern California,
Los Angeles, CA, USA

Polyclonal
rabbit

Primary
Dilution
1 :500

1:10,000

Secondary
Antibody – Source
Alexa Fluor 568 Goat antimouse IgG, Life technologies,
Carlsbad, CA, USA
Alexa Fluor 488 Goat antirabbit IgG, Life technologies,
Carlsbad, CA, USA

Secondary
Dilution
1:500

1:500

Table 5.3. List of antibodies used for IHC – their origins and dilutions

5.4. RESULTS
5.4.1. CrxRdy/+ kittens show retinal attachment after subretinal injection and only
minor side effects
Summary of the volume and titer injected as well as side effects were detailed in Table 5.4
below. One kitten died during recovery and was excluded from the study.
ID

Eye

Vector
injected

OA01785531

OD

AAV2/5 UFSB-FLAGhCRX K2583

OS

AAV2/5 scsmCBAhGFP

Titer, volume
Side effects/
and location of
Fluorescence
the injection
on cSLO/SD-OCT
AAV2/5 – Ubiquitous promoter
5x1011vg/mL
Retinal lesion and
50µL dorsoretinal tear at the
temporal
injection site best
(not sure all in,
seen on FAF
flattened bleb)
5x1011vg/mL
50µL temporal area centralis

Retinal lesion at the
injection site best
seen on FAF, GFP
fluorescence on FAF

AAV2/8 Y733F mutant capsid
AAV2/8 Y733F mutant capsid – Ubiquitous promoter
Retinal lesion at the
AAV2/8
1x1012vg/mL
injection site best
Y733F, UF- 150µL nasal and seen on FAF, retina
OD
OA02532731
SB-FLAGvery small
mild disorganization
hCRX, Ω4030 temporal bleb
and thinning from
injection
OS

-

-

N/A

Table 5.4. Details of outcomes for each kitten.
241

Scotopic
ERG rescue

IHC
FLAG /GFP
labeling

No rescue

Low FLAG
expression

N/A normal
disease ERG
progression

Low GFP
expression in
cones and offtarget expression
in Müller cells

No rescue

Moderate FLAG
expression

N/A normal
disease ERG
progression

None

Table 5.4 (cont’d)

OA02532018

5x1011vg/mL
Retinal lesion at the
200µL in 3 blebs
AAV2/8
injection site best
with were not
Y733F, UFseen on FAF, retina
OD
easy to see
SB-FLAGno very well
including one far
hCRX, Ω4030
reattached in few
nasal and one
areas (mild folds)
dorsal
AAV2/8
GFP fluorescence on
Y733F,
5x1011vg/mL
OS
FAF and nerve
UF11-GFP, 100µL temporal
fibers fluorescence
I1838c

No rescue

Low FLAG
expression

N/A normal
disease ERG
progression

Strong GFP
expression in
photoreceptors

No rescue

Low FLAG
expression

N/A normal
disease ERG
progression

Strong GFP
expression in
photoreceptors

1x10 vg/mL
200µL dorsal
about 100µL in
the bleb

Retinal lesion at the
injection site best
seen on FAF, very
few
hyperfluorescent
dots in the treated
area seen on FAF

No rescue

Mild FLAG
expression

-

N/A

N/A normal
disease ERG
progression

None

AAV2/8 Y733F mutant capsid
AAV2/8 Y733F mutant capsid – Ubiquitous promoter
AAV2/8
5x1011vg/mL
Retinal lesion and
Y733F, UF- 200µL in 2 blebs
retinal tear at the
OD
OA02525638
SB-FLAG1dorso-temporal
injection site best
hCRX, Ω4030
and one nasal
seen on FAF
AAV2/8
GFP fluorescence on
Y733F,
5x1011vg/mL
OS
FAF and nerve
UF11-GFP, 100µL temporal
fibers fluorescence
I1838c
AAV2/8 Y733F mutant capsid – GRK1 promoter

OA02532828

AAV2/8
Y733F,
OD
GRK1-FLAGCrx, K2822

OS

OA02533517

-

12

AAV2/8
Y733F,
11x1012vg/mL
OD
GRK1-FLAG- 150µL temporal
Crx, K2822

OS

-

-

Hyperfluorescent
dots in the treated
area seen on FAF

N/A

242

ERG rescue,
improvement
of amplitudes,
implicit times
and threshold
(yet better at
10w then 12w)
N/A normal
disease ERG
progression

Strong FLAG
expression

None

Table 5.4 (cont’d)

OA02496941

Dark conditions

OA02497929

AAV2/8
Y733F,
OD
GRK1-FLAGCRX, P4376
OS

-

AAV2/8
Y733F,
OD
GRK1-FLAGCRX, P4376

Dark conditions

OS

OA025001214

AAV2/8
Y733F,
OD
GRK1-FLAGCRX, P4376

Dark conditions

OS

OA02501046

Dark conditions

OA02496779

Dark conditions

-

-

AAV2/8
Y733F,
OD
GRK1-FLAGCRX, P4376

OS

-

AAV2/8
Y733F,
OD
GRK1-FLAGCRX, P4376

OS

-

1x1012vg/mL
100µL dorsonasal

Hyperfluorescent
dots in the treated
area seen on FAF,
abnormalitis in the
OPL layer

No rescue

IHC not
performed

-

N/A

N/A normal
disease ERG
progression

IHC not
performed

1x1012vg/mL
75µL dorsal

No abnormalities

No rescue

Strong FLAG
expression

-

N/A

N/A normal
disease ERG
progression

None

5x1012vg/mL
100µL dorsonasal

Hyperfluorescent
dots in the treated
area seen on FAF

No rescue

IHC not
performed

-

N/A

N/A normal
disease ERG
progression

IHC not
performed

No rescue

Strong FLAG
expression

N/A normal
disease ERG
progression

None

Retinal tear at the
injection site,
5x1012vg/mL
hyperfluorescent
100µL dorsodots in the treated
temporal miosis
area seen on FAF
at the end
and suspicious of
IS/OS damage seen
as layer irregularities
-

N/A

7.5x1012vg/mL
100µL dorsal

Hyperfluorescent
dots in the treated
area seen on FAF

-

N/A

243

Very mild
ERG rescue
seen as a very
small b-wave
in OD
compared to
OS
N/A normal
disease ERG
progression

Moderate FLAG
expression

None

Table 5.4 (cont’d)

OA02496004

Dark conditions

AAV2/8
Y733F,
OD
GRK1-FLAGCRX, P4376

OS

-

7.5x1012vg/mL
100µL nasal
(50µL in
vitreous)

Retinal lesion at the
injection site best
seen on FAF

-

N/A

AAV2/8 Y733F mutant capsid – Ubiquitous and GRK1 promoters
Small retinal lesion
and retinal tear at the
11
AAV2/8
5x10 vg/mL
injection site best
Y733F,
50µL dorsal
OD
seen on FAF,
OA01790762
GRK1-FLAG(20µL in
hyperfluorescent
Crx, K2822
vitreous)
dots in the treated
area seen on FAF
5x1011vg/mL
AV2/8
50µL dorsal
GFP fluorescence on
Y733F,
OS
(50µL subretinal
FAF and nerve
UF11-GFP,
and 40µL in
fibers fluorescence
I1838c
vitreous)

OA02527420

Mix Half/half
AAV2/8
Y733F, UFSB-FLAGOD hCRX, Ω4030
AAV2/8
Y733F,
GRK1-FLAGCrx, K2822
Mix Half/half
AAV2/8
Y733F, UFSB-FLAGOS hCRX, Ω4030
AAV2/8
Y733F,
GRK1-FLAGCrx, K2822

1x1012vg/mL
175µL dorsal

12

1x10 vg/mL
175µL dorsonasal

Very mild
ERG rescue
seen as a very
small b-wave
in OD
compared to
OS
N/A normal
disease ERG
progression

IHC not
performed

IHC not
performed

No rescue

Moderate FLAG
expression

N/A normal
disease ERG
progression

Strong GFP
expression in
photoreceptors

Retinal lesion at the
injection site best
seen on FAF

No rescue

Strong FLAG
expression

Retinal lesion at the
injection site best
seen on FAF,
hyperfluorescent
dots in the treated
area seen on FAF

N/A normal
disease ERG
progression

Strong FLAG
expression

Most of the kittens received a subretinal injection of 50 to 100µL. Bigger blebs were more
challenging to perform and had increased risk of not reattaching normally. Ophthalmic
examination showed that in all cases the retina reattached within a couple of days. At 9 weeks
post-injection (12 weeks of age), SD-OCT retinal high-resolution cross-section images confirmed
244

that there was retinal reattachment in all eyes injected. No major retinal disorganization of the
retinal layers secondary to the retinal detachment was noted, with the exception of two eyes that
had some mild folds probably due to lack of proper reattachments (Fig. 5.2A) and two eyes that
had some disorganization and thinning of the retina (Fig. 5.2B). The proper re-attachment postinjection allows us to believe that the surgery technique used is valuable as it allows proper subretinal injection without performing vitrectomy and so without being too invasive. Yet, it was
noticed during surgery that, due to gauge size of the needle being used, the retinotomy created
was big enough to allow some minor leakage from the sub-retinal injection site to the vitreous.
The injection site had a retinal scaring in most of the kittens, which appeared as a dark lesion on
fundus autofluorescence (FAF) (Fig. 5.2C). A couple of eyes also presented with a persistent
retinal tear at the injection site (Fig. 5.2D).

Figure 5.2. Side effects of subretinal injections.
245

Figure 5.2 (cont’d)
(A) SD-OCT cross retinal section showing improper retinal reattachment. This can lead to
the formation of some folds or elevations of the retina (as indicated by the white arrows)
(separation between the photoreceptor outer segment layer and the retinal pigmentary
epithelium).
(B) SD-OCT cross retinal section showing retinal thinning and disorganization. This can
occur following toxicity or improper retinal reattachment post-injection.
(C) Fundus autofluorescence cSLO image showing retinal/sclera scaring at the injection site
(white arrowhead).
(D) RetCam fundus image (right image) and SD-OCT cross retinal (left image) section
showing remnant retinal tear post-injection (indicated by the black arrow).

No major inflammation was seen. One kitten had some conjunctivitis due to canthal
suture rubbing. Few kittens had some canthal suture dehiscence due to the excessive mother
bathing. Four eyes had some corneal to iris synechias, and two had focal cataracts, which were
thought to be due to technical error during the aqueocentesis.
Due to a surgical technique error, one kitten (OA02533517) had some damage to its nictitans
membrane muscle. This did not seem to create any discomfort at any time but was covering 2/3
of its cornea.

5.4.2. Functional rescue
Photopic ERG responses were not detectable from any of the treated eyes, suggesting
either no cone rescue or rescue that was below the threshold for ERG detection. Among the 15
treated eyes (14 cats), only one cat showed significant rescue of the scotopic ERG (2 cats showed
a very minor increase in b-wave compared to the untreated eye). The cat (OA02533517) showing
scotopic ERG response showed minor rescue at 6 weeks of age but more pronounced rescue at 10
and 12 weeks of age with improvement of amplitudes and implicit times as well as lower
threshold ERG responses compared to the untreated eye. These ERG amplitudes were small
compared to those of age-matched WT kittens (Fig. 5.3B). Interestingly, this was not the cat with
246

the bigger or more central bleb (Fig. 5.3A), and it also showed some hyperfluorescent dots on
FAF. It received a 150µL bleb of 1x1012vg/mL AAV2/8 Y733F GRK1-FLAG-Crx, dorsotemporally. This was also the cat presented that had a nictitans membrane prolapsed due to a
technical error. Based on this result, we hypothesized that reduced light exposure may have a
beneficial effect on therapy. Subsequently, a cohort of kittens was kept under a dim red light
following subretinal injections, however, no functional rescue was observed in those kittens.

Figure 5.3. Summary of the outcome assessment from kitten OA02533517, which presented
with functional rescue.
247

Figure 5.3 (cont’d)
(A) Fundus images. Left image: RetCam fundus image of a subretinal injection of 150µL of
1x1012vg/mL AAV2/ 8 Y733F GRK1-FLAG-Crx in the dorso-temporal retinal region in a 3week-old CrxRdy/+ kitten indicated by the white star. Middle image: Follow-up RetCam fundus
image of the same kitten at 12 weeks of age (9 weeks post-injection) showing no fundus lesion.
Right image: cSLO autofluorescent image (AF) showing some changes in the bleb area (white
star) seen as some hyperfluorescent dots.
(B) Functional rescue in the treated eye. Dark-adapted ERG raw tracings at 12 weeks of age
from the treated right eye (OD) and untreated left eye (OS) of kitten OA02533517 and a wildtype control kitten at the same age for a 2.8 cd.m2 light stimulus in scotopic condition. The right
tracings show some rescue in OD, yet the amplitude is still very decreased compared to WT
kitten. The left tracings, on a different scale, showed that, even though small, the rescue is
significant compared to the untreated eye.
The black arrow indicated the light stimulus.
(C) Immunohistochemistry of the treated right eye retina. IHC showed strong expression of
FLAG (therefore of CRX) in the treated region. hCAR labeled cones but no improvement in their
IS/OS (indicated by the white arrowheads) development was noted.
IS/OS; photoreceptor inner/outer segments, ONL; outer nuclear layer, OPL; outer plexiform
layer, INL; inner nuclear layer, IPL; inner plexiform layer.

5.4.3. Morphological rescue and molecular expression of the vector
No obvious improvement of photoreceptor inner and outer segments was observed on SDOCT cross retinal section. Yet, as stated above most of the kittens did not show any severe retinal
thinning or disorganization as a consequence of the AVV subretinal injection, which was
confirmed by a finding on IHC.
Both use of the AAV2/5 sc sc-smCBA-hGFP in one eye and AAV2/8 Y733F UF11-GFP
at 5x1011vg/mL in 3 eyes led to strong fluorescence revealed by autofluorescence imaging by
488nm cSLO imaging. IHC showed very different targeting of both vectors in kittens. The
AAV2/5 sc-smCBA-hGFP injected eyes showed some expression in cone photoreceptor but not
in rods and some significant off-target expression in Müller cell. The AAV2/8 Y733F UF11-GFP
injected eyes had high transgene GFP expression in both cones and rods in the 3 eyes injected,
and 2 of the eyes showed mild off-target expression to amacrine and ganglion cells (Fig. 5.4A).

248

Additionally, it seems that there was less hCAR labeling in the center of the bleb, possibly
indicating an adverse effect of transgene or viral vector presence.
All eyes injected with either construct or promoter showed some FLAG expression
suggestive of CRX transgene expression (see details in Table 5.4). Yet, important variation
existed between results from different serotypes and promoters. AAV2/5 UF-SB-FLAG-hCRX
only resulted in low transgene expression. AAV2/8 Y733F with a ubiquitous promoter induced
low to moderate transgene expression in the photoreceptors.

The construct with a GRK1

promoter or a combination of vectors with ubiquitous and GRK1 promoters led to a stronger
transgene expression (Fig. 5.4C). The use of the AAV2/8 Y733F combined to a GRK1 promoter
seemed to be associated with hyperfluorescent dots of fundus autofluoresccence cSLO images
(Fig. 5.4B).
Most eyes did not show any changes in hCAR labeling compared to historical data

14

,

although a few eyes (Fig. 5.4D) seemed to have a stronger labeling of cones by hCAR in the
treated versus the untreated regions.

249

Figure 5.4. Molecular expression.
(A) GFP expression was present on cSLO imaging for both serotype AAV vectors at similar
intensities, yet on IHC the AAV2/8 Y733F had a much higher GFP transgene expression of
photoreceptors with less off-target expression.
(B) cSLO imaging of the bleb for injection with AAV2/8 Y733F combined to the GRK1
promoter led to the appearance of hyperfluorescent dots of FAF in the treated region.
(C) Immunolabeling for FLAG marker of CRX expression. The FLAG expression was
extremely low when the AAV2/5 UF-SB-FLAG-hCRX was used at a titer of 5x1011 vg/mL while
it was moderate when using the AAV2/8 Y733F UF11-GFP at a titer of 1x1012vg/mL and strong
while using AAV2/8 Y733F GRK1-FLAG-Crx at a titer of 1x1012vg/mL.
(D) Combined FLAG/hCAR labeling. Some eyes showed brighter hCAR (green) labeling in the
treated region (left region) compared to the untreated region (right image).
250

5.5. DISCUSSION
Subretinal injections were successfully achieved in all kittens although it was difficult to
precisely target the region including the area centralis. We wanted to target this region because it is
the first region to degenerate in the CrxRdy/+ cat, and therefore any preservation of structure, as
assessed by SD-OCT or IHC/EM, would have been easier to detect and obvious at an earlier
age.14 The subretinal injection treated no more than one quarter of the retinal area for the biggest
bleb so it is conceivable that a mild degree of rescue would not result in a detectable
improvement in the full-field electroretinogram. Multifocal or focal ERG to allow comparison of
treated versus non treated retina would be of interest as well as developing some vision testing
devices. Increasing the volume of fluid injected subretinally is not an option, because if the bleb
is too large, we have found that retinal reattachment is not accurate, and retinal folds form
(unpublished observations). A delay in reattachment could lead to retinal damage; we have
noticed that delay in reattachment of large detachments can lead to cone loss24 (unpublished
observations). The effect of retinal detachment is not benign and has been extensively studied.
Early changes include modification in rod terminals and rod bipolar spherules connection notably
to horizontal cells altering the synapse complex, changes in ON- and OFF-bipolar cells.24, 34-40
One way of transducing a larger retinal area is to do 2 or more separate subretinal injections
allowing the treatment of larger retinal surface with lesser side effects.
The FLAG tag enabled the detection of which cells were expressing the transgene. IHC for
Crx could not be used since it would not be possible to distinguish between the transgene (human
CRX) and the endogenous Crx. FLAG expression was detected in all retinas suggesting that the
appropriate cells had been transduced. One possibility for the apparent lack of rescue could be that
the FLAG protein altered the function of the CRX transgene itself.

251

When used with an ubiquitous promoter, both the injections with the AAV2/5 and
AAV2/8 Y733F serotypes resulted in low FLAG and therefore CRX expression. The use of
AAV2/8 Y733F with a photoreceptor targeting promoter GRK1 improved transgene expression
and led to strong FLAG expression. Additionally, eyes receiving a combination of AAV2/8
Y733F containing both the ubiquitous and GRK1 promoters seemed to have an even better effect
with a stronger FLAG expression as seen by IHC. Those results need yet to be taken with
caution. Indeed, the AAV2/5 UF-SB-FLAG-hCRX (ubiquitous promoter) was only tested at a low
titer of 5x1011vg/mL and such in only one eye. Similarly, the use of AAV2/8 Y733F UF-SBFLAG-hCRX (ubiquitous promoter) at a low 5x1011vg/mL titer only led to mild transgene
expression compared to moderate FLAG expression when used at 1x1012vg/mL titer. The use of
AAV2/8 Y733F GRK1-FLAG-CRX (photoreceptor specific promoter) showed some strong
expression from a titer to 1 to 7.5 x1012vg/mL. The transgene expressions obtained in this study
are therefore only mildly comparable between serotypes and promoters as they were not all used
at the same titers. It is necessary to perform a better dose-response study to compare transgene
expression between different titers but also different serotypes and promoters. Investigation of
various serotype-promoters and mutant capsid vectors specifically in the cats as a particular
species is of value, and investigation in kittens (different retinal maturation stage) would be
valuable as well. This is supported by the fact that target species, serotypes, mutant capsid,
promoter and well as self-complementary AAV have been shown to make a difference in cell
targeting.29, 30, 32, 41, 42
Only one kitten showed significant functional rescue. It is not clear why the ERG rescue
achieved in the one kitten could not be repeated. In this animal, due to a surgical technique error,
the nictitans was damaged resulting in partial coverage the cornea, which may have limited light
exposure. Working on the hypothesis that reducing light exposure could improve the degree of
252

rescue, we tested a cohort of kittens with the same vector and kept them in dim lighting
conditions, but this did not result in significant functional rescue. The bleb created in the kitten
with rescue was quite peripheral (dorso-temporal). As the progression of the degeneration starts
in the central retina and spreads to the periphery (following the pattern of retinal maturation), in
theory the peripheral injection was in a region that was at an earlier stage of degeneration than the
central retinal region treated in the rest of the kittens.
The lack of rescue could be caused by not being able to shift the mutant to WT: Crx allele
ratio to sufficiently counteract the toxic effect of the mutant protein. There was no improvement
in photoreceptor inner and outer segment morphology detectable on SD-OCT and on retinal
sectioning (IHC). Many of the blebs did not include the area centralis. As a result, for the
duration that the animals were kept there would be little loss of retinal layer thickness, so a mild
preservation of thickness would not be detectable.14 A few animals had stronger hCAR labeling
in the injected area that might indicate a mild treatment-related improvement in cone health and
maturation but not sufficient to lead to normal maturation or to improve function sufficiently to
be detectable by full-field ERG.
In conclusion, subretinal injection in the 3-week-old kitten was possible, but it proved to
be difficult to specifically include the area centralis at that age. Some transgene expression was
detectable in the photoreceptors of most kittens when using an AVV2/8 Y733F mutant capsid
with a GRK1 promoter or a combination, but only one kitten had detectable functional rescue.
Further refinement of the rAAV to optimize photoreceptor targeting is necessary. Gene
augmentation therapy using AAV might not be sufficient to decrease the mutant to WT Crx ratio
and achieve the degree of rescue that is required. It may be of value to combine it with other
techniques that aim to downregulate the mutant Crx allele. This highlights the difficulties of

253

treating dominant disease, where the expression of the mutant allele has a strong deleterious
effect.16, 43, 44

2.6. ACKNOWLEDGEMENTS
The authors would like to thank Dr. Cheryl Craft for the donation of the hCAR antibody
and Dr. William Hauswirth and Sanford Boye for providing adeno-associated viral vectors.
Supported by Myers-Dunlap Endowment and Michigan State University College of
Veterinary Medicine Endowed Research Funds.

254

REFERENCES

255

REFERENCES

1.
Hull S, Arno G, Plagnol V, et al. The phenotypic variability of retinal dystrophies
associated with mutations in CRX, with report of a novel macular dystrophy phenotype. Invest
Ophthalmol Vis Sci. 2014;55:6934-6944.
2.
Tran NM, Zhang A, Zhang X, Huecker JB, Hennig AK, Chen S. Mechanistically Distinct
Mouse Models for CRX-Associated Retinopathy. PLoS Genet. 2014;10:e1004111.
3.
Leber T. Über retinitis pigmentosa und angeborene Amaurose. Graefe Arch Clin Exp
Ophthalmol 1869;15:1-25.
4.
Schappert-Kimmijser J, Henkes HE, Van Den Bosch J. Amaurosis congenita (Leber).
Arch Ophthalmol. 1959;61:211-218.
5.
Stone EM. Leber congenital amaurosis - a model for efficient genetic testing of
heterogeneous disorders: LXIV Edward Jackson Memorial Lecture. Am J Ophthalmol.
2007;144:791-811.
6.
Koenekoop RK. An overview of Leber congenital amaurosis: a model to understand
human retinal development. Surv Ophthalmol. 2004;49:379-398.
7.
Huang L, Xiao X, Li S, et al. CRX variants in cone-rod dystrophy and mutation overview.
Biochem Biophys Res Commun. 2012;426:498-503.
8.
Hennig AK, Peng GH, Chen S. Regulation of photoreceptor gene expression by Crxassociated transcription factor network. Brain Res. 2008;1192:114-133.
9.
Chau KY, Chen S, Zack DJ, Ono SJ. Functional domains of the cone-rod homeobox
(CRX) transcription factor. J Biol Chem. 2000;275:37264-37270.
10.
Furukawa T, Morrow EM, Cepko CL. Crx, a novel otx-like homeobox gene, shows
photoreceptor-specific expression and regulates photoreceptor differentiation. Cell. 1997;91:531541.
11.
Morrow EM, Furukawa T, Raviola E, Cepko CL. Synaptogenesis and outer segment
formation are perturbed in the neural retina of Crx mutant mice. BMC neuroscience 2005;6:5.
12.
Chen S, Wang QL, Xu S, et al. Functional analysis of cone-rod homeobox (CRX)
mutations associated with retinal dystrophy. Hum Mol Genet. 2002;11:873-884.
13.
Menotti-Raymond M, Deckman KH, David V, Myrkalo J, O'Brien SJ, Narfstrom K.
Mutation discovered in a feline model of human congenital retinal blinding disease. Invest
Ophthalmol Vis Sci. 2010;51:2852-2859.

256

14.
Occelli LM, Tran NM, Narfstrom K, Chen S, Petersen-Jones SM. CrxRdy Cat: A Large
Animal Model for CRX-Associated Leber Congenital Amaurosis. Invest Ophthalmol Vis Sci.
2016;57:3780-3792.
15.
Tran NM, Chen SM. Mechanisms of Blindness: Animal Models Provide Insight Into
Distinct CRX-Associated Retinopathies. Dev Dyn. 2014;243:1153-1166.
16.
Petersen-Jones SM, Annear MJ, Bartoe JT, et al. Gene augmentation trials using the
Rpe65-deficient dog: contributions towards development and refinement of human clinical trials.
Adv Exp Med Biol. 2012;723:177-182.
17.

Vakkur GJ, Bishop PO. The Schematic Eye in the Cat. Vis Res. 1963;61:357-381.

18.
Østerberg G. Topography of the layer of rods and cones in the human retina. Acta
Ophthalmol. 1935;13:11-103.
19.
Curcio CA, Sloan KR, Kalina RE, Hendrickson AE. Human photoreceptor topography. J
Comp Neurol. 1990;292:497-523.
20.
Jeon CJ, Strettoi E, Masland RH. The major cell populations of the mouse retina. J
Neurosci. 1998;18:8936-8946.
21.
Applebury ML, Antoch MP, Baxter LC, et al. The murine cone photoreceptor: a single
cone type expresses both S and M opsins with retinal spatial patterning. Neuron. 2000;27:513523.
22.
Steinberg RH, Reid M, Lacy PL. The distribution of rods and cones in the retina of the cat
(Felis domesticus). J Comp Neurol. 1973;148:229-248.
23.
Provis JM, Dubis AM, Maddess T, Carroll J. Adaptation of the central retina for high
acuity vision: cones, the fovea and the avascular zone. Prog Retin Eye Res. 2013;35:63-81.
24.
Linberg KA, Lewis GP, Shaaw C, Rex TS, Fisher SK. Distribution of S- and M-cones in
normal and experimentally detached cat retina. J Comp Neurol. 2001;430:343-356.
25.
Nichols LL, 2nd, Alur RP, Boobalan E, et al. Two novel CRX mutant proteins causing
autosomal dominant Leber congenital amaurosis interact differently with NRL. Hum Mutat.
2010;31:E1472-1483.
26.
Swaroop A, Wang QL, Wu W, et al. Leber congenital amaurosis caused by a homozygous
mutation (R90W) in the homeodomain of the retinal transcription factor CRX: direct evidence for
the involvement of CRX in the development of photoreceptor function. Hum Mol Genet.
1999;8:299-305.
27.
Furukawa T, Morrow EM, Li T, Davis FC, Cepko CL. Retinopathy and attenuated
circadian entrainment in Crx-deficient mice. Nat Genet. 1999;23:466-470.
257

28.
Silva E, Yang JM, Li Y, Dharmaraj S, Sundin OH, Maumenee IH. A CRX null mutation
is associated with both Leber congenital amaurosis and a normal ocular phenotype. nvest
Ophthalmol Vis Sci. 2000;41:2076-2079.
29.
Minella AL, Mowat FM, Willett KL, et al. Differential targeting of feline photoreceptors
by recombinant adeno-associated viral vectors: implications for preclinical gene therapy trials.
Gene Ther. 2014;21:913-920.
30.
Mowat FM, Gornik KR, Dinculescu A, et al. Tyrosine capsid-mutant AAV vectors for
gene delivery to the canine retina from a subretinal or intravitreal approach. Gene Ther.
2014;21:96-105.
31.
Tran NMA. Understanding CRX-Associated Retinopathies Using Animal Models.
Washington University; 2013:174.
32.
Petersen-Jones SM, Bartoe JT, Fischer AJ, et al. AAV retinal transduction in a large
animal model species: comparison of a self-complementary AAV2/5 with a single-stranded
AAV2/5 vector. Mol Vis. 2009;15:1835-1842.
33.
Staurenghi G, Sadda S, Chakravarthy U, Spaide RF, International Nomenclature for
Optical Coherence Tomography P. Proposed lexicon for anatomic landmarks in normal posterior
segment spectral-domain optical coherence tomography: the IN*OCT consensus.
Ophthalmology. 2014;121:1572-1578.
34.
Linberg KA, Lewis GP, Matsumoto B, Fisher SK. Immunocytochemical evidence that
rod-connected horizontal cell axon terminals remodel in response to experimental retinal
detachment in the cat. Mol Vis. 2006;12:1674-1686.
35.
Linberg KA, Lewis GP, Fisher SK. Retraction and remodeling of rod spherules are early
events following experimental retinal detachment: an ultrastructural study using serial sections.
Mol Vis. 2009;15:10-25.
36.
Sakai T, Tsuneoka H, Lewis GP, Fisher SK. Remodelling of retinal on- and off-bipolar
cells following experimental retinal detachment. Clin Exp Ophthalmol. 2014;42:480-485.
37.
Lewis GP, Chapin EA, Luna G, Linberg KA, Fisher SK. The fate of Muller's glia
following experimental retinal detachment: nuclear migration, cell division, and subretinal glial
scar formation. Mol Vis. 2010;16:1361-1372.
38.
Fisher SK, Lewis GP, Linberg KA, Verardo MR. Cellular remodeling in mammalian
retina: results from studies of experimental retinal detachment. Prog Retin. Eye Res.
2005;24:395-431.
39.
Marc RE, Murry RF, Fisher SK, Linberg KA, Lewis GP. Amino acid signatures in the
detached cat retina. nvest Ophthalmol Vis Sci. 1998;39:1694-1702.

258

40.
Fisher SK, Lewis GP, Linberg KA, Barawid E, Verardo MR. Cellular Remodeling in
Mammalian Retina Induced by Retinal Detachment. In: Kolb H, Fernandez E, Nelson R (eds),
Webvision: The Organization of the Retina and Visual System. Salt Lake City (UT); 1995.
41.
Boyd RF, Sledge DG, Boye SL, et al. Photoreceptor-targeted gene delivery using
intravitreally administered AAV vectors in dogs. Gene Ther. 2016;23:223-230.
42.
Beltran WA, Boye SL, Boye SE, et al. rAAV2/5 gene-targeting to rods:dose-dependent
efficiency and complications associated with different promoters. Gene Ther. 2010;17:11621174.
43.
Annear MJ, Mowat FM, Bartoe JT, et al. Successful Gene Therapy in Older Rpe65Deficient Dogs Following Subretinal Injection of an Adeno-Associated Vector Expressing
RPE65. Hum Gene Ther. 2013;24:883-893.
44.
Acland GM, Aguirre GD, Ray J, et al. Gene therapy restores vision in a canine model of
childhood blindness. Nat Genet. 2001;28:92-95.

259

CHAPTER 6
CONCLUSIONS AND FUTURE DIRECTIONS

260

6.1. CONCLUSIONS ON THE CRX-LCA FELINE MODELS AND THERAPY TRIAL
The cone-rod homeobox transcription factor CRX mediates photoreceptor development and
survival by regulating the expression of many photoreceptor genes. CRX mutations are mostly
associated with dominant retinopathies: Leber congenital amaurosis (adLCA), cone-rod
dystrophy (adCRD) and retinitis pigmentosa (adRP), with a remarkable heterogeneity in age of
onset and severity. The precise mechanism by which these mutations cause dominant disease is
not totally understood, and no treatment is available.
Recently, in vitro and animal model studies have been developed to study the pathogenic
mechanisms of CRX mutations. We have been studying a spontaneously occurring feline model.
This model has a severe phenotype analogous to autosomal dominant LCA characterized by
early-onset of a severe cone-led retinal dystrophy leading to blindness. Our preliminary work on
the feline model – CrxRdy, which carries p.Pro185LysfsTer2, a spontaneous antimorphic
frameshift mutation in the final exon in Crx causing a premature stop codon at residue 186 –
reveals that heterozygous CrxRdy/+ cats have a retinal phenotype similar to what have been
classified as Class III CRX mutations in humans and mice. The severe phenotype (delayed retinal
morphological and functional development, then degeneration and loss of vision) is the result of a
dominant antimorphic effect of the mutant Crx allele over the wild-type allele. The phenotype is
described in detail in young animals in chapter 2 of the current work with later disease stages
being described in chapter 3. Older CrxRdy/+ cats have a severe retinal degeneration accompanied
by extensive inner retinal and vascular remodeling. At very late stage disease RPE atrophy
develops in the area centralis, somewhat similar to a macular dystrophy. The homozygous
CrxRdy/Rdy cats have a different phenotype with an early halting of photoreceptor maturation, a
complete lack vision and yet only a slow degeneration of photoreceptors and considerable
migration and remodeling of retinal cells. They develop globe enlargement, likely secondary to
261

the complete lack of vision, with expansion primarily of the posterior segment. Photoreceptor
development halts after the development of small vestigial inner segments, and there is a
complete lack of outer segment development, a lack of expression of photoreceptor specific
genes and a total absence of retinal function. In contrast to the CrxRdy/+ cats, they do not develop
marked retinal or vasculature thinning although they do undergo extensive retinal remodeling.
An attempt to improve the phenotype of the CrxRdy/+ cats by over-expressing wild-type Crx
using AAV vector delivery resulted in minor evidence of rescue in one kitten. The lack of
consistent improvements suggests that a strategy to concurrently reduce expression of the mutant
allele will also be required.

6.2. FUTURE DIRECTIONS
6.2.1. Investigation of the underlying disease mechanisms
In the Rdy feline as well as in knockin mice models, the precise mechanism leading to the
over expression of the mutant allele and its subsequent antimorphic effect is not fully understood.
Investigation of the underlying mechanism is essential in order to understand these retinal
dystrophies, suggest possible therapeutic interventions and perhaps also add to the understanding
of dominant negative retinal dystrophies in general.1-3
More detailed investigation of the effect of the disease on gene expression at different
stages of retinal maturation would be valuable using techniques such as transcriptome
sequencing (RNA-seq)4. Newer techniques such as massively parallel single-cell RNA profiling
could be used to investigate the altered transcriptome in individual retinal cell types. In addition
further investigation of the action of Crx by chromatin immuno-precipitation (ChIP)5 on retinal
samples could be used to determine the targets of the mutant allele. It would be highly valuable
in both the CrxRdy/+ and CrxRdy/Rdy cats to compare such transcriptome analysis with those for the
262

comparable mouse model to see if the same pattern of expression occurs within different Class
III CRX mutation models. Regional expression differences would be useful to investigate in the
cat model, for example, comparing changes within the area centralis and the more peripheral
retina. Such studies to investigate changes in a retinal region like the area centralis that is
comparable to the human macula is not possible in the mouse models and could be important
because of the early macular involvement in human patients. This could be achieved by
investigating regional difference of protein expression by IHC and with the use of additional
antibodies to characterize changes in retinal remodeling, notably at the synapse levels in
younger animal and also to use markers for immature cells, especially in the CrxRdy/Rdy cats.
Electron microscopy at an early age could also be performed in the CrxRdy/Rdy cat to further
investigate ultrastructural features; an example of this would be to investigate whether the
stunted inner segments start developing cilia. Moreover, investigations of the mechanisms of
photoreceptor cell death and retinal remodeling would be valuable.6-13
Despite the lack of vision and photoreceptor outer segments the CrxRdy/Rdy cat retains a
slow PLR. Chromatic pupillometry to investigate whether this is driven by melanopsin
expressing ganglion cells could be performed. Pupil responses could also be developed as an
outcome measure for therapeutic rescue.
Investigation to determine the mechanism for mutant allele over expression and how the
mutant protein impairs the ability of wild-type Crx to activate target gene expression would be
important. It is possible that the mutant mRNA and mutant protein may be more stable.
Therefore, more investigations on mRNA and protein stability could be performed in cell lines.
Bioinformatics could also be used as a tool to try to predict the structural conformation and
potential post-translational changes such as phosphorylation of the mutant Crx protein that could
therefore affect its function and binding to target gene promoter.14, 15
263

Investigation of the globe expansion in the CrxRdy/Rdy cat to further understand the
mechanism by which myopia develops would be valuable. Investigation of the course of vitreous
expansion as well as refractive error and sclera/choroidal changes can be performed by more SDOCT and histologic studies, but more specifically by investigating molecular and gene changes
during growth by scleral and ocular mRNA and microRNA analysis. 16-22

6.2.2. Developing therapies for treatment of dominant negative CRX-LCA retinal
dystrophies
Our long-term goal is to advance the understanding of CRX-linked dominant retinopathies
and develop safe and effective treatments. In addition to the therapy trial tested in chapter 5, other
approaches can be tested as described below.

6.2.2.1. Supplementation therapies: selecting rAAV serotypes and promoters
that most efficiently transduce both cones and rods in wild-type kittens
Recombinant adeno-associated viral vectors rAAV-mediated gene transfer therapy in
order to increase levels of normal Crx to compete with the mutant Crx protein is currently being
tested as described in chapter 5.
To pursue developing and optimizing therapies for the CrxRdy/+ cats, selecting effective
serotype-promoter combinations and its optimal titers is needed. The vector will need to
efficiently target photoreceptor without leading to toxicity or off-target transgene expression.
Newer generations of rAAV that increase the transduction efficiency need to be tested. For
example, self-complementary vectors23 that avoid the step of synthesizing a second DNA strand
have been shown to have a more rapid and stronger transgene expression. Other advances include
264

modification in the viral vector packaging, which overcomes the limitations caused by barriers
encountered by the viral vector when transducing the target cells (e.g. ubiquitination, nuclear
accumulation). Those rAAV vectors containing capsid amino-acid substitutions24-26 (substitutions
which allow rAAV to avoid ubiquitination and proteosome degradation during intracellular
transport) will also be interesting to test in cats. Lastly, evaluation of rAAV vectors containing a
different promoter to allow more precise tissue transduction should be considered e.g. G-proteindependent receptor kinase (GRK) promoter24 and interphotoreceptor retinoid-binding protein
(IRBP) promoter26, 27.
Once an optimal rAAV serotype-promoter combination is identified, it can be packaged
with hCRX-FLAG to further test the gene supplementation approach in the CrxRdy/+ kittens.

6.2.2.2. Silencing therapies
6.2.2.2.1. Use of antisense gene silencing therapy to reduce the level of
mutant Crx and rescue the retinal phenotype
It is likely that a combination of increasing expression of WT Crx will need to be combined
with a strategy to reduce levels of the mutant protein. Toward the latter goal, allele-specific
antisense oligonucleotides (ASOs) could be used.28, 29 ASO have been used and proven successful
in some inherited retinal degenerations such as the CEP290-LCA mouse model.30-34
Allele-specific antisense oligonucleotides (ASOs) are single strand nucleic acids that have a
complementary sequence to the target mRNA. The ASO binds to the target mutant mRNA;
RNase H enzyme recognizes the heteroduplex and binds to it. The enzyme then degrades the
mRNA, leaving the DNA strand (ASO) intact 35 and therefore decreasing the production of
mutant protein. Our preliminary investigations of ASOs to specifically target the mutant allele
and leave the WT allele unaffected have not been successful so far.
265

6.2.2.2.2. Knockdown the mutant Crx allele using siRNA or shRNA
Both the use of siRNA and shRNA would aim at interfering with the mutant Crx allele
and therefore decrease its negative effect. They have been used in retinal disease therapy in the
past.36-40 siRNA are small interfering RNA sequences that can be artificially synthesized and
injected into the vitreous or subretinally. shRNA is produced by the cell. Therefore rAAV-CrxshRNA knockdown vectors would have to be injected into the eye to enable the production of
shRNA which would target the endogenous Crx. siRNA are simpler to produce but would require
repeated injection. The rAAV-shRNA are more challenging to produce, but once introduced into
a cell they should lead to continuous production of shRNA. These approaches have the potential
disadvantage of also targeting wild-type Crx expression. Producing a “hardened” Crx allele that
is also introduced by a rAAV vector and is functional and yet resistant to the shRNA would be a
strategy to overcome this problem.

6.2.2.3. Other possible therapies
Over the last decade, new therapy techniques have been developed and could be tested in
the CrxRdy cat to help rescue vision. One technique that is currently receiving much interest is
CRISPR-Cas9 editing.

41-44

This technique aims to edit the gene of interest. One strategy would

be to try and target the mutant allele and render it non-pathogenic, and another approach is to
correct the mutation. Although this technique has been proven to be successful in retinal
diseases45, 46, it presents many potential difficulties including in vivo efficiency and the potential
for significant off-target effects. In the case of the CrxRdy cat the correction of a one base-pair
deletion would be challenging and would require extensive in vitro optimization before therapy

266

could be tried in animal models. Additionally, the delivery of the CRISPR-Cas9 complex requires
AAV target optimization as for AAV gene supplementation.
Another potential therapy to be tested is retinal sheet or cell transplant.47-52 For example,
retinal sheet allograft has been tested in a feline CEP290-LCA model of progressive retinal
dystrophy, showing integration but no ERG rescue. 53, 54 To be more effective genetic correction
of iPS would be more valuable. This technique requires the development of induced pluripotent
stem cell (iPS) using cells from the “patient” such as skin or adipocytes.55 The iPS cells are then
induced to form immature photoreceptor cells for transplantation or even developed into retinal
organoids for transplantation. So far, growing iPS cells from adult cat cells has proven
challenging.

6.2.3. Developing vision assessment in the cat
In comparison to the canine species, the feline species is harder to vision test in a reliable
way. Indeed, cats are not consistently motivated by food or human interaction. Development of a
similarly reliable test as published for dogs (Fig.1)56, 57 is needed. Optokinetic testing could be
developed by trying to adapt rodents’ optokinetic device and additional maze test

58

to a bigger

size using a computer screen. Other techniques or devices need to be developed in order to assess
functional vision after therapy in addition to ERG testing.

267

REFERENCES

268

REFERENCES

1.
Grayson C, Molday RS. Dominant negative mechanism underlies autosomal dominant
Stargardt-like macular dystrophy linked to mutations in ELOVL4. J Biol Chem. 2005;280:3252132530.
2.
Barroso I, Gurnell M, Crowley VE, et al. Dominant negative mutations in human
PPARgamma associated with severe insulin resistance, diabetes mellitus and hypertension.
Nature. 1999;402:880-883.
3.
Marivin A, Leyme A, Parag-Sharma K, et al. Dominant-negative Galpha subunits are a
mechanism of dysregulated heterotrimeric G protein signaling in human disease. Sci Signal.
2016;9:ra37.
4.
Ruzycki PA, Tran NM, Kefalov VJ, Kolesnikov AV, Chen S. Graded gene expression
changes determine phenotype severity in mouse models of CRX-associated retinopathies.
Genome Biol. 2015;16:171.
5.
Corbo JC, Lawrence KA, Karlstetter M, et al. CRX ChIP-seq reveals the cis-regulatory
architecture of mouse photoreceptors. Genome Res. 2010;20:1512-1525.
6.
Morrow EM, Furukawa T, Raviola E, Cepko CL. Synaptogenesis and outer segment
formation are perturbed in the neural retina of Crx mutant mice. BMC Neurosci. 2005;6:5.
7.
Pignatelli V, Cepko CL, Strettoi E. Inner retinal abnormalities in a mouse model of
Leber's congenital amaurosis. J Comp Neurol. 2004;469:351-359.
8.
Chong NH, Alexander RA, Barnett KC, Bird AC, Luthert PJ. An immunohistochemical
study of an autosomal dominant feline rod/cone dysplasia (Rdy cats). Exp Eye Res. 1999;68:5157.
9.
Sancho-Pelluz J, Arango-Gonzalez B, Kustermann S, et al. Photoreceptor cell death
mechanisms in inherited retinal degeneration. Mol. Neurobiol. 2008;38:253-269.
10.
Athanasiou D, Aguila M, Bevilacqua D, Novoselov SS, Parfitt DA, Cheetham ME. The
cell stress machinery and retinal degeneration. FEBS Lett. 2013;587:2008-2017.
11.
Arango-Gonzalez B, Trifunovic D, Sahaboglu A, et al. Identification of a common nonapoptotic cell death mechanism in hereditary retinal degeneration. PloS one. 2014;9:e112142.
12.
Paquet-Durand F, Sahaboglu A, Dietter J, et al. How long does a photoreceptor cell take
to die? Implications for the causative cell death mechanisms. Adv Exp Med Biol. 2014;801:575581.

269

13.
Sahaboglu A, Paquet-Durand O, Dietter J, et al. Retinitis pigmentosa: rapid
neurodegeneration is governed by slow cell death mechanisms. Cell Death Dis. 2013;4:e488.
14.
Chen S, Wang QL, Xu S, et al. Functional analysis of cone-rod homeobox (CRX)
mutations associated with retinal dystrophy. Hum Mol Genet. 2002;11:873-884.
15.
Valastyan JS, Lindquist S. Mechanisms of protein-folding diseases at a glance. Model
Mec. 2014;7:9-14.
16.
Metlapally R, Park HN, Chakraborty R, et al. Genome-Wide Scleral Micro- and
Messenger-RNA Regulation During Myopia Development in the Mouse. Invest Ophthalmol Vis
Sci. 2016;57:6089-6097.
17.
Metlapally R, Wildsoet CF. Scleral Mechanisms Underlying Ocular Growth and Myopia.
Prog Mol Biol Transl Sci. 2015;134:241-248.
18.
Metlapally R, Gonzalez P, Hawthorne FA, Tran-Viet KN, Wildsoet CF, Young TL.
Scleral micro-RNA signatures in adult and fetal eyes. PloS one. 2013;8:e78984.
19.
Jobling AI, Gentle A, Metlapally R, McGowan BJ, McBrien NA. Regulation of scleral
cell contraction by transforming growth factor-beta and stress: competing roles in myopic eye
growth.J Biol Chem. 2009;284:2072-2079.
20.
Yang J, Reinach PS, Zhang S, et al. Changes in retinal metabolic profiles associated with
form deprivation myopia development in guinea pigs. Sci Rep. 2017;7:2777.
21.
Zhou X, Ye J, Willcox MD, et al. Changes in protein profiles of guinea pig sclera during
development of form deprivation myopia and recovery. Mol Vis. 2010;16:2163-2174.
22.
Ritchey ER, Zelinka C, Tang J, et al. Vision-guided ocular growth in a mutant chicken
model with diminished visual acuity. Exp Eye Res. 2012;102:59-69.
23.
Petersen-Jones SM, Bartoe JT, Fischer AJ, et al. AAV retinal transduction in a large
animal model species: comparison of a self-complementary AAV2/5 with a single-stranded
AAV2/5 vector. Mol Vis. 2009;15:1835-1842.
24.
Kay CN, Ryals RC, Aslanidi GV, et al. Targeting photoreceptors via intravitreal delivery
using novel, capsid-mutated AAV vectors. PloS one. 2013;8:e62097.
25.
Mowat FM, Gornik KR, Dinculescu A, et al. Tyrosine capsid-mutant AAV vectors for
gene delivery to the canine retina from a subretinal or intravitreal approach. Gene Ther.
2014;21:96-105.
26.
Boyd RF, Sledge DG, Boye SL, et al. Photoreceptor-targeted gene delivery using
intravitreally administered AAV vectors in dogs. Gene Ther. 2016;23:400.

270

27.
Dyka FM, Boye SL, Ryals RC, Chiodo VA, Boye SE, Hauswirth WW. Cone specific
promoter for use in gene therapy of retinal degenerative diseases. Adv Exp Med Biol.
2014;801:695-701.
28.
Crooke ST. Vitravene--another piece in the mosaic. Antisense Nucleic Acid Drug Dev.
1998;8:vii-viii.
29.
El Harchaoui K, Akdim F, Stroes ES, Trip MD, Kastelein JJ. Current and future
pharmacologic options for the management of patients unable to achieve low-density lipoproteincholesterol goals with statins. Am J Cardiovasc Drugs. 2008;8:233-242.
30.
Garanto A, Chung DC, Duijkers L, et al. In vitro and in vivo rescue of aberrant splicing in
CEP290-associated LCA by antisense oligonucleotide delivery. Hum Mol Genet. 2016;25:25522563.
31.
Gerard X, Garanto A, Rozet JM, Collin RW. Antisense Oligonucleotide Therapy for
Inherited Retinal Dystrophies. Adv Exp Med Biol. 2016;854:517-524.
32.
Gerard X, Perrault I, Hanein S, et al. AON-mediated Exon Skipping Restores Ciliation in
Fibroblasts Harboring the Common Leber Congenital Amaurosis CEP290 Mutation. Mol Ther
Nucleic Acids. 2012;1:e29.
33.
Collin RW, den Hollander AI, van der Velde-Visser SD, Bennicelli J, Bennett J, Cremers
FP. Antisense Oligonucleotide (AON)-based Therapy for Leber Congenital Amaurosis Caused by
a Frequent Mutation in CEP290. Mol Ther Nucleic Acids. 2012;1:e14.
34.
Collin RW, Garanto A. Applications of antisense oligonucleotides for the treatment of
inherited retinal diseases. Curr Opin Ophthalmol. 2017;28:260-266.
35.
Bennett CF, Swayze EE. RNA targeting therapeutics: molecular mechanisms of antisense
oligonucleotides as a therapeutic platform. Ann Rev Pharmacol Toxicol. 2010;50:259-293.
36.
Mao H, Gorbatyuk MS, Rossmiller B, Hauswirth WW, Lewin AS. Long-term rescue of
retinal structure and function by rhodopsin RNA replacement with a single adeno-associated viral
vector in P23H RHO transgenic mice. Hum Gene Ther. 2012;23:356-366.
37.
Georgiadis A. Viral vector-mediated RNA interference in the retina Division of Molecular
Therapy, Institute of Ophthalmology. University College London 2009:227.
38.
Gorbatyuk M, Justilien V, Liu J, Hauswirth WW, Lewin AS. Suppression of mouse
rhodopsin expression in vivo by AAV mediated siRNA delivery. Vis Res. 2007;47:1202-1208.
39.
O'Reilly M, Palfi A, Chadderton N, et al. RNA interference-mediated suppression and
replacement of human rhodopsin in vivo. Am J Hum Genet. 2007;81:127-135.
40.
Thakur A, Fitzpatrick S, Zaman A, et al. Strategies for ocular siRNA delivery: Potential
and limitations of non-viral nanocarriers. J Biol Eng. 2012;6:7.
271

41.
Jiang F, Doudna JA. CRISPR-Cas9 Structures and Mechanisms. Ann Rev Biophys.
2017;46:505-529.
42.
Doudna JA, Charpentier E. Genome editing. The new frontier of genome engineering
with CRISPR-Cas9. Science. 2014;346:1258096.
43.
Wang H, La Russa M, Qi LS. CRISPR/Cas9 in Genome Editing and Beyond. Ann Rev
Biochem. 2016;85:227-264.
44.
Sander JD, Joung JK. CRISPR-Cas systems for editing, regulating and targeting genomes.
Nat Biotechnol. 2014;32:347-355.
45.
Yu W, Mookherjee S, Chaitankar V, et al. Nrl knockdown by AAV-delivered
CRISPR/Cas9 prevents retinal degeneration in mice. Nat Commun. 2017;8:14716.
46.
Peng YQ, Tang LS, Yoshida S, Zhou YD. Applications of CRISPR/Cas9 in retinal
degenerative diseases. Int J Ophthalmol. 2017;10:646-651.
47.
West EL, Pearson RA, MacLaren RE, Sowden JC, Ali RR. Cell transplantation strategies
for retinal repair. Prog Brain Res. 2009;175:3-21.
48.
Pearson RA, Hippert C, Graca AB, Barber AC. Photoreceptor replacement therapy:
challenges presented by the diseased recipient retinal environment. Vis Neurosci. 2014;31:333344.
49.
Jayakody SA, Gonzalez-Cordero A, Ali RR, Pearson RA. Cellular strategies for retinal
repair by photoreceptor replacement. Prog Retin Eye Res. 2015;46:31-66.
50.
Lakowski J, Gonzalez-Cordero A, West EL, et al. Transplantation of Photoreceptor
Precursors Isolated via a Cell Surface Biomarker Panel From Embryonic Stem Cell-Derived SelfForming Retina. Stem Cells. 2015;33:2469-2482.
51.
Seiler MJ, Aramant RB. Cell replacement and visual restoration by retinal sheet
transplants. Prog Retin Eye Res. 2012;31:661-687.
52.
Nistor G, Seiler MJ, Yan F, Ferguson D, Keirstead HS. Three-dimensional early retinal
progenitor 3D tissue constructs derived from human embryonic stem cells. J Neurosci Methods.
2010;190:63-70.
53.
Ivert L, Gouras P, Naeser P, Narfstrom K. Photoreceptor allografts in a feline model of
retinal degeneration. Graefe Arch Clin Exp Ophthalmol. 1998;236:844-852.
54.
Seiler MJ, Aramant RB, Seeliger MW, Bragadottir R, Mahoney M, Narfstrom K.
Functional and structural assessment of retinal sheet allograft transplantation in feline hereditary
retinal degeneration. Vet Ophthalmol. 2009;12:158-169.
272

55.
Jumabay M, Bostrom KI. Dedifferentiated fat cells: A cell source for regenerative
medicine. World J Stem Cells. 2015;7:1202-1214.
56.
Gearhart PM, Gearhart CC, Petersen-Jones SM. A novel method for objective vision
testing in canine models of inherited retinal disease. Invest Ophthalmol Vis Sci. 2008;49:35683576.
57.
Garcia MM, Ying GS, Cocores CA, Tanaka JC, Komaromy AM. Evaluation of a
behavioral method for objective vision testing and identification of achromatopsia in dogs. Am J
Vet Res. 2010;71:97-102.
58.
Kretschmer F, Sajgo S, Kretschmer V, Badea TC. A system to measure the Optokinetic
and Optomotor response in mice. J Neurosci Methods. 2015;256:91-105.

273