INVESTIGATING NOVEL REGULATORY MECHANISMS OF HISTONE H3 AND
SHUGOSHIN I IN MITOTIC CHECKPOINT CONTROL IN SACCHAROMYCES
CEREVISIAE
By
Christopher J. Buehl

A DISSERTATION
Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of
Cell and Molecular Biology–Doctor of Philosophy
2017

ABSTRACT
INVESTIGATING NOVEL REGULATORY MECHANISMS OF HISTONE H3 AND
SHUGOSHIN I IN MITOTIC CHECKPOINT CONTROL IN SACCHAROMYCES
CEREVISIAE
By
Christopher J. Buehl
Errors in chromosomal segregation during mitosis can result in a wide array of negative
outcomes, including tumorigenesis and cell death. Cells prevent mislocalization of genomic
DNA by monitoring the critical signal of tension generated between paired sister chromatids by
opposing poleward forces. In budding yeast, a critical protein required for tension sensing is the
Shugoshin protein, Sgo1p. Sgo1p must be recruited to the centromere and pericentric regions of
chromatin to facilitate efficient tension sensing. This coordinated recruitment of Sgo1p creates
specific Sgo1p domains on mitotic chromosomes. We have previously reported on an important
regulatory regions on histone H3, termed the tension sensing motif (TSM). The TSM is
responsible for retention of Sgo1p in the pericentric chromatin by direct interaction. This
interaction is negatively regulated by the histone acetyltransferase activity of Gcn5p, but the
mechanism governing this regulation was unclear.

In this work, we present evidence that when tension sensing is impaired, the histone H3 tail can
function as an auxiliary binding site in the presence of a defective TSM. This novel function is
regulated through selective lysine residues on the H3 tail. Mutations to Gcn5p targets K14 and
K23 suppress mitotic defects that results from a tsm– background. Restoration of mitotic fidelity
is accompanied by an increase in Sgo1p retention in the pericentric chromatin. These data
revealed a novel mitotic role for the histone H3 tail domain, and reinforced the integral role of
chromatins in their faithful segregation during mitosis. In addition, domain mapping of Sgo1p
revealed novel functional and regulatory domains. Disruption of the conserved N’ coiled-coil
domain nullifies Sgo1p function. Truncations from the C’ terminus are more tolerable to Sgo1p
function. Truncation of Sgo1p shorter than residue 411 (of 590) impairs pericentric localization

and benomyl resistance. However, truncation of Sgo1p at residues Y317 or K337 suppresses tsm–
hypersensitivity without restoring pericentric enrichment. This novel finding demonstrates the
suppressor function of Sgo1p is separate from its pericentric accumulation. We posit that a
negative regulatory motif resides between residues 337 and 363, and the deletion of this region
allows Sgo1p to bypass a mutant TSM. These discoveries reveal novel functional and regulatory
motifs in both Sgo1p and histone H3 that intimately involved in tension detection during mitosis.

ACKNOWLEDGEMENTS

I would like to extend my deepest thanks to my mentor Min-Hao Kuo for giving me the
opportunity to join the lab. His generosity of time, knowledge, and wisdom have been invaluable
in both my professional and personal development. His support for both my research and future
goals has helped me to prepare for the next steps in my career, and has led to my significant
growth as both a scientist and as a person. I would also like to thank the past and present
members of the Kuo lab for all their assistance, discussions, and camaraderie.

I would like to thank my committee members: Dr. Bill Henry, Dr. John LaPres, Dr. Erik
Martinez-Hackert, and Dr. Susan Conrad. Their guidance, suggestions, and criticisms have been
invaluable for the development of this project, and for my improvement. In addition, I would like
to thank the GEDD group for the excellent opportunities to share my research and be exposed to
a wide array of different ideas and approaches. I also thank the CMB program for the excellent
support and wonderful community.

Finally, I would like to thank my friends and family for all the discussions, laughs, and
adventures. Most of all, I’d like to thank them for their support, and providing all the assistance
for me to make it to this point. Finally, I have to thank my wife Amber for her constant and
unwavering belief, caring, and love. I would not be who I am today without it.

iv

TABLE OF CONTENTS

LIST OF TABLES.........................................................................................................................vii
LIST OF FIGURES...................................................................................................................... viii
KEY TO ABBREVIATIONS...........................................................................................................x
CHAPTER 1: LITERATURE REVIEW..........................................................................................1
Part I: Structure of nucleosomes and roles in cell cycle...................................................... 2
Nucleosome structure and positioning in chromatin............................................... 2
Histone variants and functions.................................................................................3
Histone mutations and chromatin function.............................................................. 4
Part II: Posttranslational modifications of histones............................................................. 6
Histone methylation................................................................................................. 6
Histone phosphorylation.......................................................................................... 8
Histone acetylation.................................................................................................10
Gcn5p histone acetyltransferase............................................................................ 11
Interactions of histone modifications.....................................................................12
Part III: The spindle assembly checkpoint.........................................................................14
Ipl1 and the CPC....................................................................................................15
Sgo1p function and regulation............................................................................... 16
Part IV: Research interests and significance......................................................................19
REFERENCES.................................................................................................................. 22
CHAPTER 2: HISTONE H3 ACTS AS A SECONDARY SITE FOR SGO1P RECRUITMENT
AND REGULATION FOR TENSION SENSING DURING MITOSIS IN S.
CEREVISIAE..................................................................................................................................34
Abstract.............................................................................................................................. 35
Introduction........................................................................................................................36
Materials and Methods.......................................................................................................38
Yeast strains and plasmid constructs......................................................................38
Yeast methods....................................................................................................... 38
Chromatin immunoprecipitation (ChIP)................................................................46
Recombinant protein preparation...........................................................................46
GST pulldown assay...............................................................................................47
Results................................................................................................................................48
Histone H3 tail provides a site for Gcn5p acetylation and mediates suppression
of tsm– mitotic defects............................................................................................48
K14A also rescues the mitotic defects of tsm– K42A mutant................................ 53
K14A mutation complements mitotic defects of tsm– cells................................... 55
K14A mutation increases pan-chromatin association of Sgo1p and binds
Sgo1p physically.................................................................................................... 57
Discussion.......................................................................................................................... 63
REFERENCES.................................................................................................................. 66
CHAPTER 3: NOVEL FUNCTIONAL AND REGULATORY DOMAINS OF SHUGOSHIN 1
IN SACCHAROMYCES CEREVISIAE.......................................................................................... 71
Abstract.............................................................................................................................. 72
v

Introduction........................................................................................................................73
Materials and Methods.......................................................................................................76
Yeast strains and plasmid constructs......................................................................76
Sgo1p allele construction.......................................................................................76
Chromatin fractionation......................................................................................... 81
Protein expression and purification....................................................................... 81
GST pulldown assay...............................................................................................82
Results................................................................................................................................83
Screen for Sgo1p suppressors of H3 G44S tension sensing defect....................... 83
Y317X Sgo1p rescues benomyl hypersensitivity of K42A and T45A tsm–...........86
Y317X Sgo1p is recruited to the centromere, but not pericentric chromatin........ 86
Y317X Sgo1p physically interacts with the H3 tail domain..................................91
Mapping novel Sgo1p domains............................................................................. 94
Sgo1p C’ required for pericentric localization.......................................................98
Discussion........................................................................................................................ 101
REFERENCES................................................................................................................ 105
CHAPTER 4: SUMMARY AND CONCLUSIONS................................................................... 109
Specific aims and results..................................................................................................110
Objective 1 and results.........................................................................................110
Objective 2 and results.........................................................................................111
Study outcome................................................................................................................. 112
Future directions.............................................................................................................. 117
REFERENCES................................................................................................................ 120
SUPPLEMENTAL CHAPTER: RESOLVING ACETYLATED AND PHOSPHORYLATED
PROTEINS BY NEUTRAL UREA TRITON-POLYACRYLAMIDE GEL
ELECTROPHORESIS, NUT-PAGE........................................................................................... 123
Abstract............................................................................................................................ 124
Introduction......................................................................................................................125
Materials and Methods.....................................................................................................127
Cloning, Protein Expression, and Purification.....................................................127
!-synuclein Preparation.......................................................................................127
Recombinant Histone H3 Preparation................................................................. 128
HeLa Treatment and Histone Preparation............................................................128
Reverse Phase HPLC Separation of Core Histones.............................................129
SDS-PAGE...........................................................................................................129
NUT-PAGE.......................................................................................................... 129
Triton Acetic Acid Urea Gel Electrophoresis.......................................................132
Protein Staining and Visualization.......................................................................132
NUT-PAGE Transfer and Western Blotting......................................................... 134
Results..............................................................................................................................135
Overview of NUT-PAGE..................................................................................... 135
Gel Electrophoresis of !-synuclein..................................................................... 135
Western blot analysis of !-synuclein of proteins resolved by NUT-PAGE......... 136
Histone H3 Acetylation and Phosphorylation......................................................140
Analysis of Modified Histone in Cell Culture..................................................... 143
Discussion........................................................................................................................ 146
Author Contribution......................................................................................................... 147
Acknowledgments............................................................................................................148
REFERENCES................................................................................................................ 149
vi

LIST OF TABLES

Table 2-1: Yeast strains used in this study......................................................................................39
Table 2-2: Plasmid constructs used in this study........................................................................... 44
Table 2-3: Oligos used in this study...............................................................................................45
Table 3-1: Yeast strains used in this study......................................................................................77
Table 3-2: Plasmid constructs used in this study........................................................................... 79
Table 3-3: Oligos used in this study...............................................................................................80
Table S-1: Composition of NUT polyacrylamide gel.................................................................. 131
Table S-2: Composition of TAU polyacrylamide gel.................................................................. 133

vii

LIST OF FIGURES
Figure 1-1: Sgo1p prevents premature sister chromatid segregation through two pathways........ 17
Figure 1-2: Key functional domains of Sgo1p...............................................................................20
Figure 2-1: Tension sensing motif function is modulated by lysine residues within the histone
H3 tail domain in an SGO1-dependent manner................................................................. 49
Figure 2-2: Lysine-to-arginine mutations on the histone H3 tail, or K14A mutation alone can
rescue G44S benomyl hypersensitivity..............................................................................52
Figure 2-3: K14A can rescue benomyl hypersensitivity of other tsm– mutants, but has no effect
on hydroxyurea hypersensitivity........................................................................................ 54
Figure 2-4: K14A mutation partially rescues recovery from benomyl arrest................................ 56
Figure 2-5: K14A tsm– suppressor partially rescues aberrant mating phenotypes of diploid tsm–
strain...................................................................................................................................58
Figure 2-6: K14A restores chromosome stability of G44S tsm– cells........................................... 59
Figure 2-7: K14A enhances Sgo1p recruitment to chromatin in both wild-type and G44S
strains................................................................................................................................. 61
Figure 2-8: Sgo1p binds Cse4p tail and both acetylated and unacetylated histone H3 tail........... 62
Figure 3-1: Sgo1p suppressors of H3 G44S benomyl hypersensitivity......................................... 84
Figure 3-2: Y317X Sgo1p suppresses benomyl hypersensitivity of tsm–......................................87
Figure 3-3: Y317X Sgo1p binds at the centromere, but does not accumulate in the pericentric
region of chromatin............................................................................................................89
Figure 3-4: Sgo1p and Y317X Sgo1p are extracted from chromatin at similar salt concentrations
as histone H3......................................................................................................................90
Figure 3-5: Y317X Sgo1p genetically and physically interacts with the H3 tail and is rescued
from benomyl hypersensitivity by E173H gcn5– similar to full-length Sgo1p................. 92
Figure 3-6: Sgo1p truncations created based on the predicted disordered regions of the
full-length protein.............................................................................................................. 95
Figure 3-7: Truncations of Sgo1p suppress H3 G44S benomyl hypersensitivity, but result in
benomyl sensitivity in wild-type H3..................................................................................96
Figure 3-8: C’ region of Sgo1p is required for pericentric localization.........................................99
Figure 4-1: Model of Sgo1p recruitment and regulation during the cell cycle............................115

viii

Figure S-1: NUT-PAGE resolves phosphorylated !-synculein into multiple species................. 137
Figure S-2: Immunoblotting application following NUT-PAGE.................................................139
Figure S-3: Both acetylated and phosphorylated histone H3 isoforms can be resolved by
NUT-PAGE, whereas TAU-PAGE can only resolve the acetylated H3 species.............. 141
Figure S-4: Post-translationally modified histones isolated from cell culture can be resolved by
NUT-PAGE...................................................................................................................... 144

ix

KEY TO ABBREVIATIONS

APC

Anaphase Promoting Complex

ChIP

Chromatin Immunoprecipitation

CIN

Chromosomal Instability

CPC

Chromosomal Passenger Complex

D Box

Destruction Box

Esp1p

Separase

GST

Glutathione S-Transferase

HAT

Histone Acetyltransferase

HDAC

Histone Deacetylase

HU

Hydroxyurea

Ipl1p

Aurora B kinase

KAT

Lysine Acetyltransferase

KDAC

Lysine Deactylase

MAT

Mating type

MCC

Mitotic Checkpoint Complex

NUT

Neutral Urea Triton

ORF

Open Reading Frame

PCR

Polymerase Chain Reaction

Pds1p

Securin

PP2A

Protein Phosphotase 2A

SAC

Spindle Assembly Checkpoint

Sgo1p

Shugoshin 1

TAU

Triton Acid Urea

x

TSM

Tension Sensing Motif

xi

CHAPTER 1:

LITERATURE REVIEW

1

PART I: Structure of nucleosomes and roles in cell cycle
Nucleosome structure and positioning in chromatin
Eukaryotic cells face the immense challenge of condensing a large amount of genomic material
into the nucleus, which requires packaging into a higher order structure called chromatin.
Chromatin is arranged into 147 base pairs (bp) of DNA wrapped around a histone octamer,
which consists of four core histones: H2A, H2B, H3, and H4. These histones are arranged in a
H3-H4 tetramer with two H2A-H2B dimers (Luger et al. 1997). Nucleosomes consist of a
globular basic domain around which the DNA is wrapped, and flexible N’ tails that extend out
from the nucleosome core. The arrangement of these nucleosomes is critical for forming higher
order structures of chromatin, and creating a compacted form of genomic material capable of
being stored within the nucleus (Jenuwein and Allis 2001). To further condense chromatin,
histone H1 binds to both the linker DNA and the core nucleosome to provide additional
organization to the chromatin structure (Routh et al. 2008; Happel and Doenecke 2009).

The packaging of genomic DNA around a nucleosome core affects the accessibility of the DNA
sequences to proteins involved in transcription, replication, recombination, and repair (Downs et
al. 2000; Hodges et al. 2009; Bintu et al. 2012; Watanabe et al. 2013; Ramachandran and
Henikoff 2015). The positioning of these nucleosomes can either act as a physical barrier to these
processes or enhance them, and to facilitate these processes, nucleosomes can be removed or
repositioned by a variety of nucleosome remodeling complexes (Längst and Manelyte 2015; Lai
and Pugh 2017). The initial positioning of nucleosomes is linked to nucleotide sequence favoring
TA, TT, and AA dinucleotides (Simpson and Stafford 1983; Segal et al. 2006). Nucleosomes are
repositioned or removed at promoter and enhancer regions in cells undergoing differentiation
(McAndrew et al. 2016; Teif et al. 2017), and are known to be depleted at the transcriptional
start sites of actively transcribed genes (Yuan et al. 2005; Jiang and Pugh 2007; Whitehouse et
al. 2007; Mavrich et al. 2008; Rudnizky et al. 2017).
2

Histone variants and functions

Nucleosomes can incorporate variants of the canonical core histone proteins, which specialize
the nucleosome to new structural or functional roles. Multiple variants of H2A, H2B, and H3
have been found in humans, though H4 variants have only been identified in lower eukaryotes
such as trypanosomes (Siegel et al. 2009; Moosmann et al. 2011). While canonical histones are
typically deposited into chromatin during replication, different classes of chaperones incorporate
histone variants into chromatin throughout the cell cycle. For example, in higher eukaryotes the
HIRA complex inserts histone H3.3 into nucleosomes in a replication-coupled manner, while the
DAXX-ATRX complex loads histone H3.3 to help establish heterochromatin (Goldberg et al.
2010; Ray-Gallet et al. 2011). The H2A variant H2A.Z is less stably associated with other
components of the nucleosome core, and when paired with H3.3, the core nucleosome is more
readily evicted from chromatin during transcription (Jin et al. 2009; Chen et al. 2014). The
presence of these variants, and their effects on nucleosome positioning and stability, make the
non-canonical nucleosomes important for both chromatin structure and gene regulation.

A critical histone variant involved in chromatin structure during mitosis is the CENP-A protein
(Cse4p in budding yeast). CENP-A replaces the canonical histone H3 in centromeric
nucleosomes, and is well conserved throughout eukaryotes (Yoda et al. 2000; Hasson et al. 2013;
Jing et al. 2017; Wang et al. 2017). The yeast Cse4p shares 64% sequence identity with histone
H3, and binds to DNA with a similar affinity (Stoler et al. 1995; Keith and Fitzgerald-Hayes
2000). Cse4p replaces histone H3 in an octamer, forming a centromeric nucleosome consisting of
H2A, H2B, Cse4p, and H4 (Furuyama and Biggins 2007; Camahort et al. 2009; Fukagawa and
Earnshaw 2014).

3

Histone mutations and chromatin function

The tail regions of both histones H3 and H4 have been extensively studied by mutational
analysis to elucidate important roles for these residues in the cell cycle. The flexible N’ tail
domains of both H3 and H4 are involved in G2/M progression, and deletion of these regions
results in a delay passing through this stage of the cell cycle (Morgan et al. 1991). Lysine
residues located on the histone H4 tail domain are important for nuclear division, DNA
replication, and protecting the integrity of the genome (Megee et al. 1990; Megee et al. 1995).
These lysines (K5, K8, K12, and K16) are all known sites of acetylation, suggesting an important
role for posttranslational modifications.

Additional functions of the histone H3 N’ tail domain were probed by scanning for second site
mutations that would create additional phenotypes in an H3 N’ tail deletion background (Ma et
al. 1996). Two genes, termed histone synthetic-lethal genes (HSL1 and HSL7) were uncovered,
and found to antagonize Swe1p. Swe1p is the S. cerevisiae homologue of Wee1p, and therefore
inhibits Cdc28p activity. The loss of HSL1 or HSL7 results in cells unable to delay their mitotic
progression when errors in bud formation occur. These data demonstrate an important role for
histones in cell cycle control and progression.

Increasingly, mutations in the canonical histones can result in cell cycle defects. The histone H4
T82I A89V double mutant (termed the hhf1-20 allele) does not stably interact with Cse4p, the
centromeric specific H3 variant, and thereby impairs centromere formation at restrictive
temperature (Smith et al. 1996). In addition, mutation to either of two residues in histone H2A
(S20F or G30D) results in an increase in ploidy, chromosome loss, and defective growth in cold
temperatures (Pinto and Winston 2000). Interestingly, these ploidy defects are rescued by
mutations in the histone deacetylase HDA1 (Kanta et al. 2006). These data suggest a role for

4

histones and posttranslational modifications in cell cycle control, but the specific function of core
nucleosomes in these mechanisms is not well understood.

Previous work in our lab uncovered that individual mutations to three key residues on histone H3
(K42, G44, and T45) lead to mitotic defects, increased chromosome loss, and impaired growth in
cold temperatures (Luo et al. 2010). The mitotic phenotypes are ameliorated by deletion of
histone acetyltransferase GCN5, and were exacerbated in the absence of histone deacetylase
RPD3, demonstrating an important role for acetylation-deacetylation cycles in this function (Luo
et al. 2016). The residues of histone H3, termed the tension sensing motif due to their mitotic
function, are located in a reverse turn structure that emerges from the nucleosome core and
extends to the flexible N’ tail region. These findings, as well as those previously described
present critical roles for both the core nucleosome and flexible tail region of histones in a myriad
of cell cycle processes, but the mechanisms that govern this function are poorly understood.

5

PART II: Posttranslational modifications of histones

The flexible N’ tail of the core histones is subjected to a wide variety of posttranslational
modifications that can alter chromatin structure and dynamics to influence processes such as
transcription and DNA synthesis (Jenuwein and Allis 2001). Some of the key histone
modifications include methylation, acetylation, and phosphorylation (Strahl and Allis 2000;
Cheung et al. 2000; Jason et al. 2002; Hyun et al. 2017). Histone methylation is regulated by the
interplay of histone methyltransferases (HMTs) and demethylases to create docking sites for
proteins that bind and alter the local chromatin structure and dynamics for a variety of outcomes
(Hyun et al. 2017; Wesche et al. 2017). Reversible acetylation of histones can adjust nucleosome
stability, increase the accessibility of DNA to transcription factors, and promote gene expression
(Zhang et al. 1998; Berger 2007). Phosphorylation of residues on histone tail domains have been
associated with mitotic progression and chromatin compaction as well as DNA synthesis (Hans
and Dimitrov 2001; Baker et al. 2010).

Histone methylation

Histones are primarily methylated on either arginine and lysine residues, with lysine methylation
serving as one of the most common histone modifications in eukaryotic cells (Kouzarides 2007;
Wesche et al. 2017). Lysine residues can be mono-, di-, or tri- methylated, and as the addition of
methyl groups does not alter the charge of the side chain, the methylation status alters the
potential effector proteins that can interact with the lysine (Martin and Zhang 2005). The
maintenance of these marks is balanced by the opposing activities of histone methyltransferases
and demethylases. Each enzyme possesses a preferred magnitude of methylation or
demethylation, which allows greater control of methylation at specific residues (Lee et al. 2007;
Lee and Skalnik 2008). Histone methyltransferases also work in conjunction with DNA
methyltransferases to promote various chromatin functions, such as condensation and replication
6

(Fuks et al. 2003; Rothbart et al. 2012). Defects in the regulation or distribution of these
methylation marks results in a wide variety of diseases, such as neurodegenerative diseases,
cancers, or drug addiction (Wozniak et al. 2007; Casciello et al. 2015). Due to this cooperative
effect of DNA and histone methylation, it can be difficult to isolate the effects of DNA
methylation from histone methylation. It is worth noting that, alongside Drosophila
melanogaster, S. cerevisiae does not methylate its DNA, and therefore are intriguing models for
dissecting the effects of histone methylation on gene expression and cellular function (Proffitt et
al. 1984; Zemach et al. 2010; Iyer et al. 2011).

Histones can be methylated on both lysine (H3 K4, K9, K27, K36, K79, and H4 K20) and
arginine residues (H2A R3, H3 R2, R8, R17, R26, and H4 R3) (Sakabe and Hart 2010; Hyun et
al. 2017). These marks are often associated with active transcription (i.e. H3 trimethylated K4)
or with transcriptional repression (i.e. H3 dimethylated K9) (Mikkelsen et al. 2007; Psathas et al.
2009). The magnitude of methylation can also be associated with either transcriptionally active
or repressed genes. For example, asymmetric dimethylation of H3 R2 is found at inactive
chromatin regions, while monomethylated H3 R2 is localized to sites of active transcription
(Kirmizis et al. 2009; Migliori et al. 2012). In fission yeast and other higher eukaryotes, H3 K9
methylation is important to the establishment of heterochromatin, which reinforces the
condensed chromatin structure through recruitment of HP1 (Grewal 2010). In addition, studies
performed in HeLa cells demonstrated that histone methylation at H3 K9 and H4 K20 was
integral to chromosomal segregation during the G2 phase by stabilizing heterochromatin
structure (Heit et al. 2009). These data reveal that histone methylation, while predominantly
associated with transcriptional regulation, can play an important role in cell cycle regulation.

7

Histone phosphorylation

The phosphorylation status of histone H3 has long been associated with mitotic progression as
well as chromatin accessibility during gene transcription. These two seemingly contradictory
processes are both associated with the phosphorylation of H3 S10. H3 S10 phosphorylation has
been reported in gene activation, and therefore chromatin opening (Cheung et al. 2000; Ivaldi et
al. 2007), but also during chromatin condensation in the cell cycle (Van Hooser et al. 1998; Hsu
et al. 2000; Hans and Dimitrov 2001). Phosphorylation also occurs on H3 T3 and H3 S28 in a
cell cycle-dependent manner (Goto et al. 2002; Dai et al. 2005). Histone phosphorylation
increases from prophase to metaphase as Aurora B kinase becomes activated, and through the
positive feedback loop acting on Haspin kinase (Wang et al. 2011). Haspin can phosphorylate H3
T3, which is then recognized by Survivin and leads to subsequent recruitment of Aurora B kinase
and phosphorylation of H3 S10 and H3 S28 (Kelly et al. 2010; Sawicka et al. 2014). This
feedback loop ensures the chromatin localization of a variety of integral mitotic factors, and
therefore maintains mitotic fidelity (Lens et al. 2003; Castedo et al. 2004).

Chromatin condensation correlates with the accumulation of phosphorylated histone H3 during
mitosis. Phosphorylation of H3 S10 begins in prophase, while H3 S28 is phosphorylated starting
in early mitosis, with both sites peaking during metaphase (Goto et al. 1999). Interestingly, in
budding yeast individual mutations of H3 S10 or S28 do not result in a significant mitotic
phenotype, suggesting that in budding yeast H3 phosphorylation are redundant for mitotic
progression (Hsu et al. 2000). Xenopus laevis chromatin can be condensed in vitro with only core
histones, topoisomerase, chaperones, and condensins (Shintomi et al. 2015). However, while
condensins are critical for chromatin compaction, Aurora B phosphorylated H3 is important for
the efficient recruitment of condensin to the chromatin (Lipp et al. 2007; Collette et al. 2011).
These data demonstrate that chromatin condensation is driven by condensins which are
efficiently recruited by histone H3 phosphorylation.
8

Phosphorylation of H3 S10 during mitosis begins in the pericentromeric heterochromatin and
spreads to the chromosome arms (Hendzel et al. 1997; Polioudaki et al. 2004). H3 K4
trimethylation, associated with active gene transcription, can decorate the euchromatin regions in
the arms in vivo, and this mark inhibits the activity of Haspin kinase, and therefore could explain
the delay of phosphorylation from the pericentromeric heterochromatin to the arm euchromatin
(Han et al. 2011; Karimi-Ashtiyani and Houben 2013). H3 S10, and subsequently S28,
phosphorylation continues to spread until metaphase, when phosphorylation and chromatin
condensation are maximized (Gurley et al. 1978; Goto et al. 1999). After the metaphase-toanaphase transition, the levels of histone phosphorylation begin to decrease, though the
chromatin stays in a highly condensed state until telophase, which suggests that histone
phosphorylation is an important epigenetic marker for promoting condensation, but not essential
for maintaining condensed chromatin (Qian et al. 2011).

Histone phosphorylation is associated with other key periods of the cell cycle. The first residue
of H2A and H4 is serine. In both proteins S1 phosphorylation is linked to chromatin
condensation, much like H3 S10/28 phosphorylation, but is also increased during DNA synthesis
(Barber et al. 2004). These observations suggest an important role for histone H4 and H2A
phosphorylation in loading histones onto newly synthesized DNA strands. Histone H3 T45
phosphorylation is also observed in S. cerevisiae during DNA synthesis (Baker et al. 2010).
Mutation of the H3 T45 residue resulted in increased replication defects, suggesting an important
role for this phosphorylation in successful chromosomal duplication. H3 T45 phosphorylation is
also present at transcription termination sites in HeLa cells, indicating multiple roles for H3 T45
phosphorylation (Lee et al. 2015).

9

Histone acetylation

Histone lysine acetylation was first discovered more than 50 years ago, and has been linked to a
diverse and critical set of biological functions, most notably gene transcription (Allfrey et al.
1964). The addition of an acetyl group, provided by acetyl-coenzyme A, to a positively charged
lysine residue neutralizes the charge, and thereby loosens the interaction between the nucleosome
and DNA, creating a more relaxed chromatin state (Jenuwein and Allis 2001; Filippakopoulos
and Knapp 2014). Lysine acetylation is performed by a class of enzymes called histone
acetyltransferases (HATs), or more generally lysine acetyltransferases (KATs). The acetylation
marks are removed by histone/lysine deacetylases (HDACs/KDACs). Acetylation of histone
lysines has a variety of effects on the chromatin state, whether by directly altering chromatin
structure or by providing a binding site for other protein factors. These factors often contain the
bromodomain that specifically recognizes acetyllysine modifications (Tamkun et al. 1992).
Bromodomain-containing proteins include transcription factors, HATs, and chromatin
remodelers. Through the bromodomain, these proteins are targeted to specific sites on the
genome by histone lysine acetylation. For example, the human transcriptional corepressor
TRIM33 efficiently interacts with acetyllysine on histone H3, but only in the absence of H3 R2/
K4 methylation (Agricola et al. 2011).

HATs and their histone acetylation target sites are integral to efficient gene expression (Durrin et
al. 1991; Kuo and Allis 1998; Kuo et al. 1998; Reid et al. 2000). Lysine acetylation of the
histone H3 and H4 tails correlates with the activation of transcription (Kurdistani et al. 2004; Liu
et al. 2005a; Pokholok et al. 2005). An important enzyme in budding yeast is Gcn5p, which is
the catalytic subunit of two HAT complexes that acetylate H3, H4, and H2B (Brownell et al.
1996; Kuo et al. 1996; Wang et al. 1997). Gcn5p targets (such as H3 K14 and H3 K36) are
enriched in the promotors of actively transcribed genes (Morris et al. 2007; Karmodiya et al.
2012). H3 K36 is also a methylation target, and the presence of an acetylation mark allows for a
10

biological “switch”, in which the swapping of one mark to the other alters the chromatin
dynamics and gene expression profile (Morris et al. 2007; Lin et al. 2010).

Histone lysine acetylation on H3 and H4 plays an important role in the formation of nucleosomes
from newly produced histones (Sobel et al. 1995). H3 K56 acetylation is implicated as an
essential histone mark for installing nucleosomes after DNA repair or loading nucleosomes onto
newly synthesized double stranded DNA (Chen et al. 2008; Downs 2008; Li et al. 2008). This
process is also important during the activation of origins of replication during DNA synthesis,
suggesting that histone acetylation is important for a wide variety of cellular processes that
require greater accessibility to naked DNA (Unnikrishnan et al. 2010).

Gcn5p histone acetyltransferase

Gcn5p HAT is a well conserved protein that is present in multiple complexes in budding yeast,
most notably SAGA and ADA (Grant et al. 1997; Eberharter et al. 1999; Brown et al. 2000;
Sendra et al. 2000). ADA and SAGA contain distinct proteins as well as shared components that
appear in both HAT complexes. Both complexes regulate gene expression through acetylation of
histone targets but with differential target specificities. SAGA primarily acetylates H3 K14, and
to a lesser extent H3 K18, H3 K9, and H3 K23. ADA similarly prefers H3 K14 as a target, and
also acetylates H3 K18 with lesser affinity (Howe et al. 2001). Gcn5p-mediated acetylation is
diminished in a E173Q gcn5– background (Trievel et al. 1999; Langer et al. 2001), and is
completely abolished with an E173H gcn5– mutation (Liu et al. 2005b). A mutation at this site
does not significantly impact Gcn5p structure, or the Acetyl-CoA binding, but creates a drastic
defect in the HAT activity of Gcn5p. Additionally, the presence of Gcn5p is not required for the
assembly and stability of the SAGA complex, suggesting that Gcn5p may be recruited to the
periphery of the complex, rather than as a central component (Wu et al. 2004).

11

GCN5 is not required in budding yeast, but in a gcn5! background, cells are delayed in the G2/M
phase of the cell cycle, suggesting that Gcn5p plays a role in mitotic progression (Zhang et al.
1998). The catalytic component of HAT complex NuA3, Sas3p, also preferentially acetylates
lysine on histone H3 (John et al. 2000; Howe et al. 2001). In the absence of both Gcn5p and
Sas3p, there is a global loss of histone H3 acetylation, and cells are arrested in mitosis,
demonstrating a critical role for H3 acetylation in progressing through G2/M. Recent studies in
our lab and others have demonstrated that Gcn5p can localize to the centromere and pericentric
regions during mitosis, and that it might provide a level of mitotic regulation through acetylation
of H3 residues in these regions (Vernarecci et al. 2008; Luo et al. 2016). As acetylation plays an
important role in mitotic progress, it would follow that deacetylation, and therefore HDACs,
could also have mitotic functions. Indeed it has been noted that the Hda family of proteins
(Hda1p, Hda2p, and Hda3p) as well as Rpd3p can be involved in centromere function and
chromosomal segregation (Kanta et al. 2006; Luo et al. 2016).

Interactions of histone modifications

Histones are often decorated with a variety of posttranslational modifications, and the
interactions between these modifications results in a broad spectrum of chromatin states and
gene expression patterns. For example, trimethylation of H3 K4 (associated with transcriptional
start sites) inhibits Haspin phosphorylation of H3 T3 in vitro (Han et al. 2011; Karimi-Ashtiyani
et al. 2013). H3 K9 acetylation (a signal of gene activation), but not H3 K9 trimethylation
(associated with heterochromatin), prevents H3 phosphorylation (Li et al. 2006). Interestingly,
phosphorylation of H3 S10 increases the efficiency of Gcn5p mediated H3 K14 acetylation (Lo
et al. 2000). These marks are associated with transcriptional activation, which suggests S10
phosphorylation could promote K14 acetylation and therefore transcription.

12

The nucleosome contains two copies of each core histone, which allows for asymmetric
modification of each histone. Asymmetric modification of nucleosomes has a diverse array of
effects on chromatin function. In HeLa cells H3 K27 di- and trimethylation marks occur equally
as symmetric and asymmetric marks in native chromatin (Voigt et al. 2012). In the case of
asymmetric modification, the sister H3 is often decorated with an activating mark (H3 K4
trimethylation or H3 K36 di- or trimethylation), in stark contrast to the repressive H3 K27 di- or
trimethylation mark. This “bivalent” chromatin potentially presents a poised transcriptional state,
provides a mechanism for intra- or internucleosomal interactions, provides a different spatial
accessibility for chromatin binding domains, or some combination of these (Taverna et al. 2007;
Ruthenburg et al. 2011).

Histone modifications provide a large range of tools to modulate chromatin structure, DNA
accessibility, protein binding interactions, and cellular processes. These modifications interact to
create either synergistic or antagonistic effects, and these can result in a complex system of gene
expression and mitotic progression.

13

PART III: The spindle assembly checkpoint

Genomic stability relies on cells correctly segregating duplicated genomes in dividing cells. The
transition from metaphase to anaphase requires rigorous checks to ensure that the sister
chromatids will be properly distributed during anaphase. This checkpoint is called the spindle
assembly checkpoint (SAC) which prevents entrance into anaphase until paired sister chromatids
have bipolar attachments of spindle fibers at their kinetochores (Silva et al. 2011). This
checkpoint is highly conserved among eukaryotes, and is critical to responding to errors in
spindle attachment (Musacchio and Salmon 2007). An unattached kinetochore triggers the
formation of the mitotic checkpoint complex (MCC), which consists of a variety of SAC proteins
such as Mad2p, Bub3p, and BubR1p, and inhibits Cdc20p (Sudakin et al. 2001; Logarinho and
Bousbaa 2008). Cdc20p functions as the activator of Anaphase Promoting Complex (APC/C), a
ubiquitin ligase integral to the procession from metaphase to anaphase. One important target of
APC/C ubiquitination is securin (Pds1p in budding yeast). Pds1p inhibits the activity of the
cohesin protease separase Esp1p, and therefore the loss of Cdc20p activity prevents the
premature activation of APC/C, which thereby stabilizes Pds1p and consequently cohesin
(Bharadwaj and Yu 2004). Therefore SAC activation prevents cells from progressing beyond
metaphase until bipolar attachment has been satisfied.

Biorientation of cohesin-linked sister chromatids results in opposing poleward forces and
therefore tension between sister chromatids (Lew and Burke 2003). The SAC monitors both
kinetochore attachment as well as tension between sister chromatids, but the relative importance
of these two signals has been difficult to parse (Pinsky and Biggins 2005; Nezi and Musacchio
2009). The SAC protein Aurora B (Ipl1p in budding yeast), which functions as the enzymatic
component of the chromosomal passenger complex (CPC), provides a good candidate to
differentiate between attachment and tension (Biggins and Murray 2001).

14

Ipl1p and the CPC

The CPC localizes to the centromeric region where it generates a phosphorylation gradient of
multiple proteins that peaks at the pericentromere, and decreases moving outwards into the arm
regions (Wang et al. 2011). The CPC consists of the kinase Ipl1p, as well as the structural and
regulatory elements Bir1p, Sli15p, and Nbl1p (Ruchaud et al. 2007). When spindle fibers are
erroneously attached, the lack of tension between sister chromatids allows the pericentric regions
to be spatially close to the kinetochore attachment machinery, and thereby allows Ipl1p to
phosphorylate targets that are involved in stable spindle attachment such as Ase1p, Mad3p, and
Dam1p (Rancati et al. 2005; Kotwaliwale et al. 2007; Tien et al. 2010). This phosphorylation
induces the destabilization and detachment of the spindle fiber from the kinetochore, and forces
the checkpoint to activate due to an unattached kinetochore. In this manner, Ipl1p promotes a
trial and error process of achieving bipolar attachment of spindle fibers.

The localization of the CPC to chromatin is essential for its function during the SAC. CPC
recruitment is mediated by two kinases; Haspin/Hrk1p and Bub1p. Haspin interacts with the
cohesin associated protein Pds5p, and therefore is recruited to the pericentromeric regions of
chromatin during mitosis (Yamagishi et al. 2010). Once localized to chromatin, Haspin
phosphorylates H3 T3 which is bound by the Bir1p element of the CPC, thereby targeting the
CPC to the critical pericentromeric region of chromatin during mitosis (Kelly et al. 2010; Wang
et al. 2010; Jeyaprakash et al. 2011). Bub1p functions to direct the CPC to the centromere
through phosphorylation of H2A S121 (H2A T120 in humans) at the centromere (Kawashima et
al. 2010). This phosphorylation recruits the conserved eukaryotic protein Shugoshin 1 (Sgo1p) to
the centromere where it binds chromatin and allows the localization of the CPC. In fission yeast,
the Sgo2p can interact directly with the Bir1p subunit of the CPC (Tsukahara et al. 2010). This
Sgo1p dependent recruitment of the CPC is critical for robust function of the SAC.

15

Sgo1p function and regulation

The Shugoshin family of proteins was initially discovered to be important for the protection of
centromeric cohesin during meiosis I in budding yeast (Katis et al. 2004; Kitajima et al. 2004;
Marston et al. 2004). Shugoshin proteins also protect centromeric cohesin in mitosis in
vertebrates, and the sole Shugoshin protein in budding yeast, Sgo1p, performs this protective
function in both meiosis and mitosis (Indjeian et al. 2005). The roles of Sgo1p in the SAC are
diagrammed in Figure 1-1. Sgo1p prevents the premature cleavage of centromeric cohesin
through the recruitment of protein phosphotase 2A (PP2A) (Kitakima et al. 2006; Riedel et al.
2006). The cohesin component Mcd1p can be phosphorylated by Cdc5p, which targets cohesin
cleavage by separase (Esp1p in budding yeast) (Alexandru et al. 2001). PP2A can be recruited in
a Sgo1p-dependent manner to centromeric chromatin to dephosphorylate Mcd1p and stabilize
cohesin, and in this way prevent premature sister chromatid separation (Xu et al. 2009). The
generation of tension from proper biorientation could lead to the eviction of Sgo1p from the
inner centromeric region, and thereby allow the degradation of cohesin and chromosomal
segregation (Gregan et al. 2008).

The role of Sgo1p in mitosis was elucidated by the specific impact of a SGO1 mutant that was
unable to activate the SAC in response to the lack of tension between sister chromatids, but was
effective in responding to the catastrophic loss of microtubules (Indjeian et al. 2005). These data
demonstrate that Sgo1p is responsive to the absence of biorientation (and therefore tension), but
not for responding to unattached kinetochores. In addition, these results suggested Sgo1p and
Ipl1p both function in the same tension sensing pathway. Indeed, in fission yeast, Shugoshin
proteins recruit Ark1 (the fission yeast Ipl1p) and the CPC through interactions with Bir1
(Tsukahara et al. 2010). This is additionally supported by data demonstrating that the loss of
SGO1 in budding yeast results in cells incapable of correcting misoriented sister chromatids
(Indjeian et al. 2007; Kiburz et al. 2008). In addition, recent work has revealed that in some
16

Sgo1p recruits PP2A to
maintain cohesin in the
absence of tension

Sgo1p
PP2A

Separase
Cohesin

Sgo1p

Ipl1p
Sgo1p recruits an Ipl1 containing
complex to correct erroneous
kinetochore attachments

Figure 1-1: Sgo1p prevents premature sister chromatid segregation through two pathways.
The left panel shows a cell in metaphase with sister chromatids aligned at the metaphase plate.
Spindle pole bodies (green) extend spindle fibers (gray) to bind at the kinetochores (red).
Biorientation results in tension between sister chromatids. The right panel displays the role of
Sgo1p in preventing sister chromatid segregation in the case of monopolar attachment. Sgo1p
(orange) can recruit an Ipl1p-containing complex (light blue) to phosphorylate targets at the
centromere to detach and destabilize incorrect spindle attachments. In addition, Sgo1p recruits
PP2A (yellow) to the pericentric chromatin to desphosphorylate and protect cohesin from
cleavage by separase (purple).

17

cancers, SGO1 expression is downregulated, or presents cancer-specific splice variants (see
below), indicating Sgo1p dysfunction in higher eukaryotes can correlate to tumorigenesis.

Sgo1p recruitment to the chromatin requires the spindle checkpoint protein Bub1p kinase
(Fernius and Hardwick 2007; Kawashima et al. 2010). Bub1p phosphorylates H2A S121 at the
centromere, and this phosphorylation serves as a recruitment site for Sgo1p. This
phosphorylation is critical for SAC function, as an H2A S121A mutation is a phenocopy of the
bub1-KD kinase deficient mutant in terms of mitotic defects. In addition, the combination of
H2A S121A and bub1-KD does not show any additive mitotic defects, demonstrating that H2A
S121 and Bub1p are likely functioning through the same pathway to recruit Sgo1p. Centromeric
H2A S121 phosphorylation is also required for pericentric Sgo1p recruitment, though this
phosphorylation does not appear in the pericentric regions. Our lab has demonstrated a role for
histone H3 in Sgo1p recruitment through the tension sensing motif (TSM) (Luo et al. 2010; Luo
et al. 2016). The TSM consists of 42KPGT, with mutations to any one of three residues (K42,
G44, and T45) results in mitotic defects. These phenotypes were similar to sgo1!, and are
rescued by overexpression of Sgo1p or by artificially tethering Sgo1p to the chromatin. Sgo1p
binds to wild-type histone H3, and this interaction is disrupted in a H3 G44S mutant background.
These data presented a model in which Sgo1p binds to histone H3 in a TSM-dependent manner
in the percentric region, but the mechanisms by which this interaction was regulated were not
clearly understood.

18

PART IV: Research interests and significance

A key driving force of cancer is chromosomal instability (CIN), which results from errors in
chromosomal segregation that lead to abnormal numbers of chromosomes (Lengauer et al.
1997). During mitosis, failure of the SAC to activate in response to spindle errors can result in
increased CIN, and therefore has been linked to carcinogenesis (Kops et al. 2004). Consistent
with this observation, experiments utilizing human colorectal cancer cell lines identified
mutations in Bub1 that, when expressed, disrupted the SAC (Cahill et al. 1998). In addition,
Shugoshin proteins are downregulated in colorectal cancer, a cancer highly associated with CIN
(Iwaizumi et al. 2009; Yamada et al. 2012). Intriguingly, samples taken from both colorectal
cancer and non-small cell lung cancer have shown variants of a human Shugoshin protein,
SGOL1, specifically expressed in tumor tissue as compared to wild type tissue (Kahyo et al.
2011; Matsuura et al. 2013). These data demonstrate a potential role for SAC elements, and
Shugoshin proteins specifically, in tumorigenesis.

The regulation of Sgo1p recruitment to the pericentric chromatin, as well as the mechanisms for
release of Sgo1p from chromatin upon bipolar attachment are poorly understood. In addition,
how Sgo1p is limited to the pericentric regions after initial recruitment is unclear. Our previous
work involving the TSM of histone H3 and the genetic effects of gcn5! suggest a role for
chromatin modifications in this regulation. The location and effect of these posttranslational
modifications are of great interest to allow a better appreciation of how Sgo1p is recruited.

The functional regions of Sgo1p are not well understood, and how various regions impact Sgo1p
function is still a point of interest. The characterized regions of Sgo1p are shown in Figure 1-2.
The N’ coiled-coil region and C’ basic region (or SGO domain) both are well conserved and have
been implicated in dimerization and centromere recruitment, respectively. In addition, recent

19

494 498
43

88

N’ Coiled
Coil Domain

363

590

390

C’ Basic
Domain

D Box Motif

Figure 1-2: Key functional domains of Sgo1p. The well characterized regions of Sgo1p are
highlighted in yellow with numbers indicated the amino acid residues that constitute the
boundaries of each domain. The N’ coiled coil domain is implicated in homodimerization and
protein-protein interactions with downstream SAC components. The C’ basic domain interacts
with phosphorylated H2A S121 at the centromere to localize Sgo1p. The D Box motif is
ubiquitinated by the APC to target Sgo1p for degradation.

20

work has also revealed a destruction box motif that targets Sgo1p for degradation by the APC.
However, other regions of the protein have not been carefully studied. The splice variants found
in cancer could have different biological functions due to manipulation of the amino acid
sequence, but these motifs or residues that help to regulate Sgo1p recruitment or function have
not been elucidated.

The studies described herein reveal a novel role of the H3 tail domain in tension sensing. The H3
tail provides a secondary site for Sgo1p interaction, and also presents an intriguing model for the
mechanism that limits Sgo1p spread to the pericentric chromatin. In addition, we are able to
define new functional regions of Sgo1p that are associated with chromatin localization and tsm–
suppression. These findings underscore the important role of histone H3 in the SAC, and provide
greater understanding of important regions of both histone H3 and Sgo1p that modulate tension
sensing during mitosis.

21

REFERENCES

22

REFERENCES

Agricola, E., Randall, R.A., Gaarenstroom, T., Dupont, S., and Hill, C.S. (2011). Recruitment of
TIF1! to chromatin via its PHD finger-bromodomain activates its ubiquitin ligase and
transcriptional repressor activities. Mol. Cell 43, 85–96.
Alexandru, G., Uhlmann, F., Mechtler, K., Poupart, M.A., and Nasmyth, K. (2001).
Phosphorylation of the cohesin subunit Scc1 by Polo/Cdc5 kinase regulates sister chromatid
separation in yeast. Cell 105, 459–472.
Allfrey, V.G., Faulkner, R., and Mirsky, A.E. (1964). Acetylation and methylation of histones and
their possible role in the regulation of RNA synthesis. Proc. Natl. Acad. Sci. U.S.A. 51, 786–794.
Baker, S.P., Phillips, J., Anderson, S., Qiu, Q., Shabanowitz, J., Smith, M.M., Yates, J.R., Hunt,
D.F., and Grant, P.A. (2010). Histone H3 Thr 45 phosphorylation is a replication-associated posttranslational modification in S. cerevisiae. Nature Cell Biology.
Barber, C.M., Turner, F.B., Wang, Y., Hagstrom, K., Taverna, S.D., Mollah, S., Ueberheide, B.,
Meyer, B.J., Hunt, D.F., Cheung, P., et al. (2004). The enhancement of histone H4 and H2A
serine 1 phosphorylation during mitosis and S-phase is evolutionarily conserved. Chromosoma
112, 360–371.
Berger, S.L. (2007). The complex language of chromatin regulation during transcription. Nature
447, 407–412.
Bharadwaj, R., and Yu, H. (2004). The spindle checkpoint, aneuploidy, and cancer. Oncogene 23,
2016–2027.
Biggins, S., and Murray, A.W. (2001). The budding yeast protein kinase Ipl1/Aurora allows the
absence of tension to activate the spindle checkpoint. Genes Dev. 15, 3118–3129.
Bintu, L., Ishibashi, T., Dangkulwanich, M., Wu, Y.-Y., Lubkowska, L., Kashlev, M., and
Bustamante, C. (2012). Nucleosomal elements that control the topography of the barrier to
transcription. Cell 151, 738–749.
Brown, C.E., Lechner, T., Howe, L., and Workman, J.L. (2000). The many HATs of transcription
coactivators. Trends Biochem. Sci. 25, 15–19.
Brownell, J.E., Zhou, J., Ranalli, T., Kobayashi, R., Edmondson, D.G., Roth, S.Y., and Allis,
C.D. (1996). Tetrahymena histone acetyltransferase A: a homolog to yeast Gcn5p linking histone
acetylation to gene activation. Cell 84, 843–851.
Cahill, D.P., Lengauer, C., Yu, J., Riggins, G.J., Willson, J.K., Markowitz, S.D., Kinzler, K.W.,
and Vogelstein, B. (1998). Mutations of mitotic checkpoint genes in human cancers. Nature 392,
300–303.
Camahort, R., Shivaraju, M., Mattingly, M., Li, B., Nakanishi, S., Zhu, D., Shilatifard, A.,
Workman, J.L., and Gerton, J.L. (2009). Cse4 is part of an octameric nucleosome in budding
yeast. Mol. Cell 35, 794–805.
Casciello, F., Windloch, K., Gannon, F., and Lee, J.S. (2015). Functional Role of G9a Histone
Methyltransferase in Cancer. Front Immunol 6, 487.

23

Castedo, M., Perfettini, J.-L., Roumier, T., Andreau, K., Medema, R., and Kroemer, G. (2004).
Cell death by mitotic catastrophe: a molecular definition. Oncogene 23, 2825–2837.
Chen, C.-C., Carson, J.J., Feser, J., Tamburini, B., Zabaronick, S., Linger, J., and Tyler, J.K.
(2008). Acetylated lysine 56 on histone H3 drives chromatin assembly after repair and signals for
the completion of repair. Cell 134, 231–243.
Chen, P., Wang, Y., and Li, G. (2014). Dynamics of histone variant H3.3 and its coregulation
with H2A.Z at enhancers and promoters. Nucleus 5, 21–27.
Cheung, P., Tanner, K.G., Cheung, W.L., Sassone-Corsi, P., Denu, J.M., and Allis, C.D. (2000).
Synergistic coupling of histone H3 phosphorylation and acetylation in response to epidermal
growth factor stimulation. Mol. Cell 5, 905–915.
Collette, K.S., Petty, E.L., Golenberg, N., Bembenek, J.N., and Csankovszki, G. (2011).
Different roles for Aurora B in condensin targeting during mitosis and meiosis. J. Cell. Sci. 124,
3684–3694.
Dai, J., Sultan, S., Taylor, S.S., and Higgins, J.M.G. (2005). The kinase haspin is required for
mitotic histone H3 Thr 3 phosphorylation and normal metaphase chromosome alignment. Genes
Dev. 19, 472–488.
Downs, J.A., Lowndes, N.F., and Jackson, S.P. (2000). A role for Saccharomyces cerevisiae
histone H2A in DNA repair. Nature 408, 1001–1004.
Downs, J.A. (2008). Histone H3 K56 acetylation, chromatin assembly, and the DNA damage
checkpoint. DNA Repair 7, 2020–2024.
Durrin, L.K., Mann, R.K., Kayne, P.S., and Grunstein, M. (1991). Yeast histone H4 N-terminal
sequence is required for promoter activation in vivo. Cell 65, 1023–1031.
Eberharter, A., Sterner, D.E., Schieltz, D., Hassan, A., Yates, J.R., Berger, S.L., and Workman,
J.L. (1999). The ADA complex is a distinct histone acetyltransferase complex in Saccharomyces
cerevisiae. Mol. Cell. Biol. 19, 6621–6631.
Fernius, J., and Hardwick, K.G. (2007). Bub1 kinase targets Sgo1 to ensure efficient
chromosome biorientation in budding yeast mitosis. PLoS Genet. 3, e213.
Filippakopoulos, P., and Knapp, S. (2014). Targeting bromodomains: epigenetic readers of lysine
acetylation. Nat Rev Drug Discov 13, 337–356.
Fukagawa, T., and Earnshaw, W.C. (2014). The Centromere: Chromatin Foundation for the
Kinetochore Machinery. Developmental Cell 30, 496–508.
Fuks, F., Hurd, P.J., Deplus, R., and Kouzarides, T. (2003). The DNA methyltransferases
associate with HP1 and the SUV39H1 histone methyltransferase. Nucleic Acids Res. 31, 2305–
2312.
Furuyama, S., and Biggins, S. (2007). Centromere identity is specified by a single centromeric
nucleosome in budding yeast. Proc. Natl. Acad. Sci. U.S.A. 104, 14706–14711.
Goldberg, A.D., Banaszynski, L.A., Noh, K.-M., Lewis, P.W., Elsaesser, S.J., Stadler, S., Dewell,
S., Law, M., Guo, X., Li, X., et al. (2010). Distinct factors control histone variant H3.3
localization at specific genomic regions. Cell 140, 678–691.

24

Goto, H., Tomono, Y., Ajiro, K., Kosako, H., Fujita, M., Sakurai, M., Okawa, K., Iwamatsu, A.,
Okigaki, T., Takahashi, T., et al. (1999). Identification of a novel phosphorylation site on histone
H3 coupled with mitotic chromosome condensation. J. Biol. Chem. 274, 25543–25549.
Goto, H., Yasui, Y., Nigg, E.A., and Inagaki, M. (2002). Aurora-B phosphorylates Histone H3 at
serine28 with regard to the mitotic chromosome condensation. Genes Cells 7, 11–17.
Grant, P.A., Duggan, L., Côté, J., Roberts, S.M., Brownell, J.E., Candau, R., Ohba, R., OwenHughes, T., Allis, C.D., Winston, F., et al. (1997). Yeast Gcn5 functions in two multisubunit
complexes to acetylate nucleosomal histones: characterization of an Ada complex and the
SAGA (Spt/Ada) complex. Genes Dev. 11, 1640–1650.
Gregan, J., Spirek, M., and Rumpf, C. (2008). Solving the shugoshin puzzle. Trends Genet. 24,
205–207.
Grewal, S.I. (2010). RNAi-dependent formation of heterochromatin and its diverse functions.
Curr. Opin. Genet. Dev. 20, 134–141.
Gurley, L.R., D’Anna, J.A., Barham, S.S., Deaven, L.L., and Tobey, R.A. (1978). Histone
phosphorylation and chromatin structure during mitosis in Chinese hamster cells. Eur. J.
Biochem. 84, 1–15.
Han, A., Lee, K.H., Hyun, S., Lee, N.J., Lee, S.J., Hwang, H., and Yu, J. (2011). Methylationmediated control of aurora kinase B and Haspin with epigenetically modified histone H3 Nterminal peptides. Bioorg. Med. Chem. 19, 2373–2377.
Hans, F., and Dimitrov, S. (2001). Histone H3 phosphorylation and cell division. Oncogene 20,
3021–3027.
Happel, N., and Doenecke, D. (2009). Histone H1 and its isoforms: contribution to chromatin
structure and function. Gene 431, 1–12.
Hasson, D., Panchenko, T., Salimian, K.J., Salman, M.U., Sekulic, N., Alonso, A., Warburton,
P.E., and Black, B.E. (2013). The octamer is the major form of CENP-A nucleosomes at human
centromeres. Nat. Struct. Mol. Biol. 20, 687–695.
Heit, R., Rattner, J.B., Chan, G.K.T., and Hendzel, M.J. (2009). G2 histone methylation is
required for the proper segregation of chromosomes. J. Cell. Sci. 122, 2957–2968.
Hendzel, M.J., Wei, Y., Mancini, M.A., Van Hooser, A., Ranalli, T., Brinkley, B.R., Bazett-Jones,
D.P., and Allis, C.D. (1997). Mitosis-specific phosphorylation of histone H3 initiates primarily
within pericentromeric heterochromatin during G2 and spreads in an ordered fashion coincident
with mitotic chromosome condensation. Chromosoma 106, 348–360.
Hodges, C., Bintu, L., Lubkowska, L., Kashlev, M., and Bustamante, C. (2009). Nucleosomal
fluctuations govern the transcription dynamics of RNA polymerase II. Science 325, 626–628.
Howe, L., Auston, D., Grant, P., John, S., Cook, R.G., Workman, J.L., and Pillus, L. (2001).
Histone H3 specific acetyltransferases are essential for cell cycle progression. Genes Dev. 15,
3144–3154.
Hsu, J.Y., Sun, Z.W., Li, X., Reuben, M., Tatchell, K., Bishop, D.K., Grushcow, J.M., Brame,
C.J., Caldwell, J.A., Hunt, D.F., et al. (2000). Mitotic phosphorylation of histone H3 is governed
by Ipl1/aurora kinase and Glc7/PP1 phosphatase in budding yeast and nematodes. Cell 102, 279–
291.

25

Hyun, K., Jeon, J., Park, K., and Kim, J. (2017). Writing, erasing and reading histone lysine
methylations. Exp. Mol. Med. 49, e324.
Indjeian, V.B., Stern, B.M., and Murray, A.W. (2005). The centromeric protein Sgo1 is required
to sense lack of tension on mitotic chromosomes. Science 307, 130–133.
Indjeian, V.B., and Murray, A.W. (2007). Budding yeast mitotic chromosomes have an intrinsic
bias to biorient on the spindle. Curr. Biol. 17, 1837–1846.
Ivaldi, M.S., Karam, C.S., and Corces, V.G. (2007). Phosphorylation of histone H3 at Ser10
facilitates RNA polymerase II release from promoter-proximal pausing in Drosophila. Genes
Dev. 21, 2818–2831.
Iwaizumi, M., Shinmura, K., Mori, H., Yamada, H., Suzuki, M., Kitayama, Y., Igarashi, H.,
Nakamura, T., Suzuki, H., Watanabe, Y., et al. (2009). Human Sgo1 downregulation leads to
chromosomal instability in colorectal cancer. Gut 58, 249–260.
Iyer, L.M., Abhiman, S., and Aravind, L. (2011). Natural history of eukaryotic DNA methylation
systems. Prog Mol Biol Transl Sci 101, 25–104.
Jason, L.J.M., Moore, S.C., Lewis, J.D., Lindsey, G., and Ausió, J. (2002). Histone
ubiquitination: a tagging tail unfolds? Bioessays 24, 166–174.
Jenuwein, T., and Allis, C.D. (2001). Translating the Histone Code. Science 293, 1074–1080.
Jeyaprakash, A.A., Basquin, C., Jayachandran, U., and Conti, E. (2011). Structural basis for the
recognition of phosphorylated histone h3 by the survivin subunit of the chromosomal passenger
complex. Structure 19, 1625–1634.
Jiang, C., and Pugh, B.F. (2009). Nucleosome positioning and gene regulation: advances through
genomics. Nat. Rev. Genet. 10, 161–172.
Jin, C., Zang, C., Wei, G., Cui, K., Peng, W., Zhao, K., and Felsenfeld, G. (2009). H3.3/H2A.Z
double variant-containing nucleosomes mark “nucleosome-free regions” of active promoters and
other regulatory regions. Nat. Genet. 41, 941–945.
Jing, R., Xi, J., Leng, Y., Chen, W., Wang, G., Jia, W., Kang, J., and Zhu, S. (2017). Motifs in the
amino-terminus of CENP-A are required for its accumulation within the nucleus and at the
centromere. Oncotarget.
John, S., Howe, L., Tafrov, S.T., Grant, P.A., Sternglanz, R., and Workman, J.L. (2000). The
something about silencing protein, Sas3, is the catalytic subunit of NuA3, a yTAF(II)30containing HAT complex that interacts with the Spt16 subunit of the yeast CP (Cdc68/Pob3)FACT complex. Genes Dev. 14, 1196–1208.
Kahyo, T., Iwaizumi, M., Shinmura, K., Matsuura, S., Nakamura, T., Watanabe, Y., Yamada, H.,
and Sugimura, H. (2011). A novel tumor-derived SGOL1 variant causes abnormal mitosis and
unstable chromatid cohesion. Oncogene 30, 4453–4463.
Kanta, H., Laprade, L., Almutairi, A., and Pinto, I. (2006). Suppressor analysis of a histone
defect identifies a new function for the hda1 complex in chromosome segregation. Genetics 173,
435–450.

26

Karimi-Ashtiyani, R., and Houben, A. (2013). In vitro phosphorylation of histone H3 at
threonine 3 by Arabidopsis haspin is strongly influenced by posttranslational modifications of
adjacent amino acids. Mol Plant 6, 574–576.
Karmodiya, K., Krebs, A.R., Oulad-Abdelghani, M., Kimura, H., and Tora, L. (2012). H3K9 and
H3K14 acetylation co-occur at many gene regulatory elements, while H3K14ac marks a subset
of inactive inducible promoters in mouse embryonic stem cells. BMC Genomics 13, 424.
Katis, V.L., Galova, M., Rabitsch, K.P., Gregan, J., and Nasmyth, K. (2004). Maintenance of
cohesin at centromeres after meiosis I in budding yeast requires a kinetochore-associated protein
related to MEI-S332. Curr. Biol. 14, 560–572.
Kawashima, S.A., Yamagishi, Y., Honda, T., Ishiguro, K. -i., and Watanabe, Y. (2010).
Phosphorylation of H2A by Bub1 Prevents Chromosomal Instability Through Localizing
Shugoshin. Science 327, 172–177.
Keith, K.C., and Fitzgerald-Hayes, M. (2000). CSE4 genetically interacts with the
Saccharomyces cerevisiae centromere DNA elements CDE I and CDE II but not CDE III.
Implications for the path of the centromere dna around a cse4p variant nucleosome. Genetics
156, 973–981.
Kelly, A.E., Ghenoiu, C., Xue, J.Z., Zierhut, C., Kimura, H., and Funabiki, H. (2010). Survivin
reads phosphorylated histone H3 threonine 3 to activate the mitotic kinase Aurora B. Science
330, 235–239.
Kiburz, B.M., Amon, A., and Marston, A.L. (2008). Shugoshin promotes sister kinetochore
biorientation in Saccharomyces cerevisiae. Mol. Biol. Cell 19, 1199–1209.
Kirmizis, A., Santos-Rosa, H., Penkett, C.J., Singer, M.A., Green, R.D., and Kouzarides, T.
(2009). Distinct transcriptional outputs associated with mono- and dimethylated histone H3
arginine 2. Nat. Struct. Mol. Biol. 16, 449–451.
Kitajima, T.S., Kawashima, S.A., and Watanabe, Y. (2004). The conserved kinetochore protein
shugoshin protects centromeric cohesion during meiosis. Nature 427, 510–517.
Kops, G.J.P.L., Foltz, D.R., and Cleveland, D.W. (2004). Lethality to human cancer cells through
massive chromosome loss by inhibition of the mitotic checkpoint. Proc. Natl. Acad. Sci. U.S.A.
101, 8699–8704.
Kotwaliwale, C.V., Frei, S.B., Stern, B.M., and Biggins, S. (2007). A pathway containing the
Ipl1/aurora protein kinase and the spindle midzone protein Ase1 regulates yeast spindle
assembly. Dev. Cell 13, 433–445.
Kouzarides, T. (2007). Chromatin modifications and their function. Cell 128, 693–705.
Kuo, M.H., Brownell, J.E., Sobel, R.E., Ranalli, T.A., Cook, R.G., Edmondson, D.G., Roth, S.Y.,
and Allis, C.D. (1996). Transcription-linked acetylation by Gcn5p of histones H3 and H4 at
specific lysines. Nature 383, 269–272.
Kuo, M.H., and Allis, C.D. (1998). Roles of histone acetyltransferases and deacetylases in gene
regulation. Bioessays 20, 615–626.
Kuo, M.H., Zhou, J., Jambeck, P., Churchill, M.E., and Allis, C.D. (1998). Histone
acetyltransferase activity of yeast Gcn5p is required for the activation of target genes in vivo.
Genes Dev. 12, 627–639.

27

Kurdistani, S.K., Tavazoie, S., and Grunstein, M. (2004). Mapping global histone acetylation
patterns to gene expression. Cell 117, 721–733.
Lai, W.K.M., and Pugh, B.F. (2017). Understanding nucleosome dynamics and their links to gene
expression and DNA replication. Nat. Rev. Mol. Cell Biol.
Langer, M.R., Tanner, K.G., and Denu, J.M. (2001). Mutational analysis of conserved residues in
the GCN5 family of histone acetyltransferases. J. Biol. Chem. 276, 31321–31331.
Längst, G., and Manelyte, L. (2015). Chromatin Remodelers: From Function to Dysfunction.
Genes (Basel) 6, 299–324.
Lee, M.G., Villa, R., Trojer, P., Norman, J., Yan, K.-P., Reinberg, D., Di Croce, L., and
Shiekhattar, R. (2007). Demethylation of H3K27 regulates polycomb recruitment and H2A
ubiquitination. Science 318, 447–450.
Lee, J.-H., and Skalnik, D.G. (2008). Wdr82 is a C-terminal domain-binding protein that recruits
the Setd1A Histone H3-Lys4 methyltransferase complex to transcription start sites of transcribed
human genes. Mol. Cell. Biol. 28, 609–618.
Lee, J.-H., Kang, B.-H., Jang, H., Kim, T.W., Choi, J., Kwak, S., Han, J., Cho, E.-J., and Youn,
H.-D. (2015). AKT phosphorylates H3-threonine 45 to facilitate termination of gene transcription
in response to DNA damage. Nucleic Acids Research 43, 4505–4516.
Lengauer, C., Kinzler, K.W., and Vogelstein, B. (1997). Genetic instability in colorectal cancers.
Nature 386, 623–627.
Lens, S.M.A., Wolthuis, R.M.F., Klompmaker, R., Kauw, J., Agami, R., Brummelkamp, T.,
Kops, G., and Medema, R.H. (2003). Survivin is required for a sustained spindle checkpoint
arrest in response to lack of tension. EMBO J. 22, 2934–2947.
Lew, D.J., and Burke, D.J. (2003). The Spindle Assembly and Spindle Position Checkpoints.
Annual Review of Genetics 37, 251–282.
Li, Y., Kao, G.D., Garcia, B.A., Shabanowitz, J., Hunt, D.F., Qin, J., Phelan, C., and Lazar, M.A.
(2006). A novel histone deacetylase pathway regulates mitosis by modulating Aurora B kinase
activity. Genes Dev. 20, 2566–2579.
Li, Q., Zhou, H., Wurtele, H., Davies, B., Horazdovsky, B., Verreault, A., and Zhang, Z. (2008).
Acetylation of histone H3 lysine 56 regulates replication-coupled nucleosome assembly. Cell
134, 244–255.
Lin, L.-J., Minard, L.V., Johnston, G.C., Singer, R.A., and Schultz, M.C. (2010). Asf1 can
promote trimethylation of H3 K36 by Set2. Mol. Cell. Biol. 30, 1116–1129.
Lipp, J.J., Hirota, T., Poser, I., and Peters, J.-M. (2007). Aurora B controls the association of
condensin I but not condensin II with mitotic chromosomes. J. Cell. Sci. 120, 1245–1255.
Liu, C.L., Kaplan, T., Kim, M., Buratowski, S., Schreiber, S.L., Friedman, N., and Rando, O.J.
(2005a). Single-nucleosome mapping of histone modifications in S. cerevisiae. PLoS Biol. 3,
e328.
Liu, Y., Xu, X., Singh-Rodriguez, S., Zhao, Y., and Kuo, M.-H. (2005b). Histone H3 Ser10
Phosphorylation-Independent Function of Snf1 and Reg1 Proteins Rescues a gcn5- Mutant in
HIS3 Expression. Molecular and Cellular Biology 25, 10566–10579.

28

Lo, W.S., Trievel, R.C., Rojas, J.R., Duggan, L., Hsu, J.Y., Allis, C.D., Marmorstein, R., and
Berger, S.L. (2000). Phosphorylation of serine 10 in histone H3 is functionally linked in vitro
and in vivo to Gcn5-mediated acetylation at lysine 14. Mol. Cell 5, 917–926.
Logarinho, E., and Bousbaa, H. (2008). Kinetochore-microtubule interactions “in check” by
Bub1, Bub3 and BubR1: The dual task of attaching and signalling. Cell Cycle 7, 1763–1768.
Luger, K., Mäder, A.W., Richmond, R.K., Sargent, D.F., and Richmond, T.J. (1997). Crystal
structure of the nucleosome core particle at 2.8 A resolution. Nature 389, 251–260.
Luo, J., Xu, X., Hall, H., Hyland, E.M., Boeke, J.D., Hazbun, T., and Kuo, M.-H. (2010).
Histone H3 Exerts a Key Function in Mitotic Checkpoint Control. Molecular and Cellular
Biology 30, 537–549.
Luo, J., Deng, X., Buehl, C., Xu, X., and Kuo, M.-H. (2016). Identification of Tension Sensing
Motif of Histone H3 in Saccharomyces cerevisiae and Its Regulation by Histone Modifying
Enzymes. Genetics 204, 1029–1043.
Ma, X.J., Lu, Q., and Grunstein, M. (1996). A search for proteins that interact genetically with
histone H3 and H4 amino termini uncovers novel regulators of the Swe1 kinase in
Saccharomyces cerevisiae. Genes Dev. 10, 1327–1340.
Marston, A.L., Tham, W.-H., Shah, H., and Amon, A. (2004). A genome-wide screen identifies
genes required for centromeric cohesion. Science 303, 1367–1370.
Martin, C., and Zhang, Y. (2005). The diverse functions of histone lysine methylation. Nat. Rev.
Mol. Cell Biol. 6, 838–849.
Matsuura, S., Kahyo, T., Shinmura, K., Iwaizumi, M., Yamada, H., Funai, K., Kobayashi, J.,
Tanahashi, M., Niwa, H., Ogawa, H., et al. (2013). SGOL1 variant B induces abnormal mitosis
and resistance to taxane in non-small cell lung cancers. Scientific Reports 3.
Mavrich, T.N., Ioshikhes, I.P., Venters, B.J., Jiang, C., Tomsho, L.P., Qi, J., Schuster, S.C.,
Albert, I., and Pugh, B.F. (2008). A barrier nucleosome model for statistical positioning of
nucleosomes throughout the yeast genome. Genome Res. 18, 1073–1083.
McAndrew, M.J., Gjidoda, A., Tagore, M., Miksanek, T., and Floer, M. (2016). Chromatin
Remodeler Recruitment during Macrophage Differentiation Facilitates Transcription Factor
Binding to Enhancers in Mature Cells. J. Biol. Chem. 291, 18058–18071.
Megee, P.C., Morgan, B.A., Mittman, B.A., and Smith, M.M. (1990). Genetic analysis of histone
H4: essential role of lysines subject to reversible acetylation. Science 247, 841–845.
Megee, P.C., Morgan, B.A., and Smith, M.M. (1995). Histone H4 and the maintenance of
genome integrity. Genes Dev. 9, 1716–1727.
Migliori, V., Müller, J., Phalke, S., Low, D., Bezzi, M., Mok, W.C., Sahu, S.K., Gunaratne, J.,
Capasso, P., Bassi, C., et al. (2012). Symmetric dimethylation of H3R2 is a newly identified
histone mark that supports euchromatin maintenance. Nat. Struct. Mol. Biol. 19, 136–144.
Mikkelsen, T.S., Ku, M., Jaffe, D.B., Issac, B., Lieberman, E., Giannoukos, G., Alvarez, P.,
Brockman, W., Kim, T.-K., Koche, R.P., et al. (2007). Genome-wide maps of chromatin state in
pluripotent and lineage-committed cells. Nature 448, 553–560.

29

Moosmann, A., Campsteijn, C., Jansen, P.W., Nasrallah, C., Raasholm, M., Stunnenberg, H.G.,
and Thompson, E.M. (2011). Histone variant innovation in a rapidly evolving chordate lineage.
BMC Evol. Biol. 11, 208.
Morgan, B.A., Mittman, B.A., and Smith, M.M. (1991). The highly conserved N-terminal
domains of histones H3 and H4 are required for normal cell cycle progression. Mol. Cell. Biol.
11, 4111–4120.
Morris, S.A., Rao, B., Garcia, B.A., Hake, S.B., Diaz, R.L., Shabanowitz, J., Hunt, D.F., Allis,
C.D., Lieb, J.D., and Strahl, B.D. (2007). Identification of histone H3 lysine 36 acetylation as a
highly conserved histone modification. J. Biol. Chem. 282, 7632–7640.
Musacchio, A., and Salmon, E.D. (2007). The spindle-assembly checkpoint in space and time.
Nat. Rev. Mol. Cell Biol. 8, 379–393.
Nezi, L., and Musacchio, A. (2009). Sister chromatid tension and the spindle assembly
checkpoint. Curr. Opin. Cell Biol. 21, 785–795.
Pinsky, B.A., and Biggins, S. (2005). The spindle checkpoint: tension versus attachment. Trends
in Cell Biology 15, 486–493.
Pinto, I., and Winston, F. (2000). Histone H2A is required for normal centromere function in
Saccharomyces cerevisiae. EMBO J. 19, 1598–1612.
Pokholok, D.K., Harbison, C.T., Levine, S., Cole, M., Hannett, N.M., Lee, T.I., Bell, G.W.,
Walker, K., Rolfe, P.A., Herbolsheimer, E., et al. (2005). Genome-wide map of nucleosome
acetylation and methylation in yeast. Cell 122, 517–527.
Polioudaki, H., Markaki, Y., Kourmouli, N., Dialynas, G., Theodoropoulos, P.A., Singh, P.B., and
Georgatos, S.D. (2004). Mitotic phosphorylation of histone H3 at threonine 3. FEBS Lett. 560,
39–44.
Proffitt, J.H., Davie, J.R., Swinton, D., and Hattman, S. (1984). 5-Methylcytosine is not
detectable in Saccharomyces cerevisiae DNA. Molecular and Cellular Biology 4, 985–988.
Psathas, J.N., Zheng, S., Tan, S., and Reese, J.C. (2009). Set2-dependent K36 methylation is
regulated by novel intratail interactions within H3. Mol. Cell. Biol. 29, 6413–6426.
Qian, J., Lesage, B., Beullens, M., Van Eynde, A., and Bollen, M. (2011). PP1/Repo-man
dephosphorylates mitotic histone H3 at T3 and regulates chromosomal aurora B targeting. Curr.
Biol. 21, 766–773.
Ramachandran, S., and Henikoff, S. (2015). Replicating nucleosomes. Science Advances 1,
e1500587–e1500587.
Rancati, G., Crispo, V., Lucchini, G., and Piatti, S. (2005). Mad3/BubR1 phosphorylation during
spindle checkpoint activation depends on both Polo and Aurora kinases in budding yeast. Cell
Cycle 4, 972–980.
Ray-Gallet, D., Woolfe, A., Vassias, I., Pellentz, C., Lacoste, N., Puri, A., Schultz, D.C.,
Pchelintsev, N.A., Adams, P.D., Jansen, L.E.T., et al. (2011). Dynamics of histone H3 deposition
in vivo reveal a nucleosome gap-filling mechanism for H3.3 to maintain chromatin integrity.
Mol. Cell 44, 928–941.

30

Reid, J.L., Iyer, V.R., Brown, P.O., and Struhl, K. (2000). Coordinate regulation of yeast
ribosomal protein genes is associated with targeted recruitment of Esa1 histone acetylase. Mol.
Cell 6, 1297–1307.
Riedel, C.G., Katis, V.L., Katou, Y., Mori, S., Itoh, T., Helmhart, W., Gálová, M., Petronczki, M.,
Gregan, J., Cetin, B., et al. (2006). Protein phosphatase 2A protects centromeric sister chromatid
cohesion during meiosis I. Nature 441, 53–61.
Rothbart, S.B., Krajewski, K., Nady, N., Tempel, W., Xue, S., Badeaux, A.I., Barsyte-Lovejoy,
D., Martinez, J.Y., Bedford, M.T., Fuchs, S.M., et al. (2012). Association of UHRF1 with
methylated H3K9 directs the maintenance of DNA methylation. Nat. Struct. Mol. Biol. 19, 1155–
1160.
Routh, A., Sandin, S., and Rhodes, D. (2008). Nucleosome repeat length and linker histone
stoichiometry determine chromatin fiber structure. Proc. Natl. Acad. Sci. U.S.A. 105, 8872–
8877.
Ruchaud, S., Carmena, M., and Earnshaw, W.C. (2007). Chromosomal passengers: conducting
cell division. Nat. Rev. Mol. Cell Biol. 8, 798–812.
Rudnizky, S., Malik, O., Bavly, A., Pnueli, L., Melamed, P., and Kaplan, A. (2017). Nucleosome
mobility and the regulation of gene expression: Insights from single-molecule studies. Protein
Sci.
Ruthenburg, A.J., Li, H., Milne, T.A., Dewell, S., McGinty, R.K., Yuen, M., Ueberheide, B.,
Dou, Y., Muir, T.W., Patel, D.J., et al. (2011). Recognition of a mononucleosomal histone
modification pattern by BPTF via multivalent interactions. Cell 145, 692–706.
Sakabe, K., and Hart, G.W. (2010). O-GlcNAc transferase regulates mitotic chromatin dynamics.
J. Biol. Chem. 285, 34460–34468.
Sawicka, A., Hartl, D., Goiser, M., Pusch, O., Stocsits, R.R., Tamir, I.M., Mechtler, K., and
Seiser, C. (2014). H3S28 phosphorylation is a hallmark of the transcriptional response to cellular
stress. Genome Res. 24, 1808–1820.
Segal, E., Fondufe-Mittendorf, Y., Chen, L., Thåström, A., Field, Y., Moore, I.K., Wang, J.-P.Z.,
and Widom, J. (2006). A genomic code for nucleosome positioning. Nature 442, 772–778.
Sendra, R., Tse, C., and Hansen, J.C. (2000). The yeast histone acetyltransferase A2 complex, but
not free Gcn5p, binds stably to nucleosomal arrays. J. Biol. Chem. 275, 24928–24934.
Shintomi, K., Takahashi, T.S., and Hirano, T. (2015). Reconstitution of mitotic chromatids with a
minimum set of purified factors. Nat. Cell Biol. 17, 1014–1023.
Siegel, T.N., Hekstra, D.R., Kemp, L.E., Figueiredo, L.M., Lowell, J.E., Fenyo, D., Wang, X.,
Dewell, S., and Cross, G.A.M. (2009). Four histone variants mark the boundaries of
polycistronic transcription units in Trypanosoma brucei. Genes Dev. 23, 1063–1076.
Silva, P., Barbosa, J., Nascimento, A.V., Faria, J., Reis, R., and Bousbaa, H. (2011). Monitoring
the fidelity of mitotic chromosome segregation by the spindle assembly checkpoint. Cell Prolif.
44, 391–400.
Simpson, R.T., and Stafford, D.W. (1983). Structural features of a phased nucleosome core
particle. Proc. Natl. Acad. Sci. U.S.A. 80, 51–55.

31

Smith, M.M., Yang, P., Santisteban, M.S., Boone, P.W., Goldstein, A.T., and Megee, P.C. (1996).
A novel histone H4 mutant defective in nuclear division and mitotic chromosome transmission.
Mol. Cell. Biol. 16, 1017–1026.
Sobel, R.E., Cook, R.G., Perry, C.A., Annunziato, A.T., and Allis, C.D. (1995). Conservation of
deposition-related acetylation sites in newly synthesized histones H3 and H4. Proc. Natl. Acad.
Sci. U.S.A. 92, 1237–1241.
Stoler, S., Keith, K.C., Curnick, K.E., and Fitzgerald-Hayes, M. (1995). A mutation in CSE4, an
essential gene encoding a novel chromatin-associated protein in yeast, causes chromosome
nondisjunction and cell cycle arrest at mitosis. Genes Dev. 9, 573–586.
Strahl, B.D., and Allis, C.D. (2000). The language of covalent histone modifications. Nature 403,
41–45.
Sudakin, V., Chan, G.K., and Yen, T.J. (2001). Checkpoint inhibition of the APC/C in HeLa cells
is mediated by a complex of BUBR1, BUB3, CDC20, and MAD2. J. Cell Biol. 154, 925–936.
Tamkun, J.W., Deuring, R., Scott, M.P., Kissinger, M., Pattatucci, A.M., Kaufman, T.C., and
Kennison, J.A. (1992). brahma: a regulator of Drosophila homeotic genes structurally related to
the yeast transcriptional activator SNF2/SWI2. Cell 68, 561–572.
Taverna, S.D., Li, H., Ruthenburg, A.J., Allis, C.D., and Patel, D.J. (2007). How chromatinbinding modules interpret histone modifications: lessons from professional pocket pickers. Nat.
Struct. Mol. Biol. 14, 1025–1040.
Teif, V.B., Mallm, J.-P., Sharma, T., Mark Welch, D.B., Rippe, K., Eils, R., Langowski, J., Olins,
A.L., and Olins, D.E. (2017). Nucleosome repositioning during differentiation of a human
myeloid leukemia cell line. Nucleus 8, 188–204.
Tien, J.F., Umbreit, N.T., Gestaut, D.R., Franck, A.D., Cooper, J., Wordeman, L., Gonen, T.,
Asbury, C.L., and Davis, T.N. (2010). Cooperation of the Dam1 and Ndc80 kinetochore
complexes enhances microtubule coupling and is regulated by aurora B. J. Cell Biol. 189, 713–
723.
Trievel, R.C., Rojas, J.R., Sterner, D.E., Venkataramani, R.N., Wang, L., Zhou, J., Allis, C.D.,
Berger, S.L., and Marmorstein, R. (1999). Crystal structure and mechanism of histone
acetylation of the yeast GCN5 transcriptional coactivator. Proc. Natl. Acad. Sci. U.S.A. 96,
8931–8936.
Tsukahara, T., Tanno, Y., and Watanabe, Y. (2010). Phosphorylation of the CPC by Cdk1
promotes chromosome bi-orientation. Nature 467, 719–723.
Unnikrishnan, A., Gafken, P.R., and Tsukiyama, T. (2010). Dynamic changes in histone
acetylation regulate origins of DNA replication. Nat. Struct. Mol. Biol. 17, 430–437.
Van Hooser, A., Goodrich, D.W., Allis, C.D., Brinkley, B.R., and Mancini, M.A. (1998). Histone
H3 phosphorylation is required for the initiation, but not maintenance, of mammalian
chromosome condensation. J. Cell. Sci. 111 ( Pt 23), 3497–3506.
Vernarecci, S., Ornaghi, P., Bagu, A., Cundari, E., Ballario, P., and Filetici, P. (2008). Gcn5p
Plays an Important Role in Centromere Kinetochore Function in Budding Yeast. Molecular and
Cellular Biology 28, 988–996.
Voigt, P., LeRoy, G., Drury, W.J., Zee, B.M., Son, J., Beck, D.B., Young, N.L., Garcia, B.A., and
Reinberg, D. (2012). Asymmetrically modified nucleosomes. Cell 151, 181–193.
32

Wang, L., Mizzen, C., Ying, C., Candau, R., Barlev, N., Brownell, J., Allis, C.D., and Berger,
S.L. (1997). Histone acetyltransferase activity is conserved between yeast and human GCN5 and
is required for complementation of growth and transcriptional activation. Mol. Cell. Biol. 17,
519–527.
Wang, F., Dai, J., Daum, J.R., Niedzialkowska, E., Banerjee, B., Stukenberg, P.T., Gorbsky, G.J.,
and Higgins, J.M.G. (2010). Histone H3 Thr-3 phosphorylation by Haspin positions Aurora B at
centromeres in mitosis. Science 330, 231–235.
Wang, E., Ballister, E.R., and Lampson, M.A. (2011). Aurora B dynamics at centromeres create a
diffusion-based phosphorylation gradient. J. Cell Biol. 194, 539–549.
Wang, J., Liu, Y., Su, H., Guo, X., and Han, F. (2017). Centromere structure and function
analysis in wheat-rye translocation lines. Plant J.
Watanabe, S., Radman-Livaja, M., Rando, O.J., and Peterson, C.L. (2013). A histone acetylation
switch regulates H2A.Z deposition by the SWR-C remodeling enzyme. Science 340, 195–199.
Wesche, J., Kühn, S., Kessler, B.M., Salton, M., and Wolf, A. (2017). Protein arginine
methylation: a prominent modification and its demethylation. Cell. Mol. Life Sci.
Whitehouse, I., Rando, O.J., Delrow, J., and Tsukiyama, T. (2007). Chromatin remodelling at
promoters suppresses antisense transcription. Nature 450, 1031–1035.
Wozniak, R.J., Klimecki, W.T., Lau, S.S., Feinstein, Y., and Futscher, B.W. (2007). 5-Aza-2’deoxycytidine-mediated reductions in G9A histone methyltransferase and histone H3 K9 dimethylation levels are linked to tumor suppressor gene reactivation. Oncogene 26, 77–90.
Wu, P.-Y.J., Ruhlmann, C., Winston, F., and Schultz, P. (2004). Molecular architecture of the S.
cerevisiae SAGA complex. Mol. Cell 15, 199–208.
Xu, Z., Cetin, B., Anger, M., Cho, U.S., Helmhart, W., Nasmyth, K., and Xu, W. (2009).
Structure and Function of the PP2A-Shugoshin Interaction. Molecular Cell 35, 426–441.
Yamada, H.Y., Yao, Y., Wang, X., Zhang, Y., Huang, Y., Dai, W., and Rao, C.V. (2012).
Haploinsufficiency of SGO1 results in deregulated centrosome dynamics, enhanced
chromosomal instability and colon tumorigenesis. Cell Cycle 11, 479–488.
Yamagishi, Y., Honda, T., Tanno, Y., and Watanabe, Y. (2010). Two histone marks establish the
inner centromere and chromosome bi-orientation. Science 330, 239–243.
Yoda, K., Ando, S., Morishita, S., Houmura, K., Hashimoto, K., Takeyasu, K., and Okazaki, T.
(2000). Human centromere protein A (CENP-A) can replace histone H3 in nucleosome
reconstitution in vitro. Proc. Natl. Acad. Sci. U.S.A. 97, 7266–7271.
Yuan, G.-C., Liu, Y.-J., Dion, M.F., Slack, M.D., Wu, L.F., Altschuler, S.J., and Rando, O.J.
(2005). Genome-scale identification of nucleosome positions in S. cerevisiae. Science 309, 626–
630.
Zemach, A., McDaniel, I.E., Silva, P., and Zilberman, D. (2010). Genome-Wide Evolutionary
Analysis of Eukaryotic DNA Methylation. Science 328, 916–919.
Zhang, W., Bone, J.R., Edmondson, D.G., Turner, B.M., and Roth, S.Y. (1998). Essential and
redundant functions of histone acetylation revealed by mutation of target lysines and loss of the
Gcn5p acetyltransferase. EMBO J. 17, 3155–3167.
33

CHAPTER 2:

HISTONE H3 ACTS AS A SECONDARY SITE FOR SGO1P RECRUITMENT AND
REGULATION FOR TENSION SENSING DURING MITOSIS IN S. CEREVISIAE

(Submitted to Genetics)

Christopher J. Buehl*, Xiexiong Deng†, Jianjun Luo†,1, Visarut Buranasudja‡, Tony Hazbun‡,
Min-Hao Kuo*,†
*Cell

and Molecular Biology Program, †Department of Biochemistry and Molecular Biology,

Michigan State University, East Lansing, MI, 48824, ‡Department of Medicinal Chemistry and
Molecular Pharmacology, Purdue University, West Lafayette, IN, 47907

1Present

address: Institute of Biophysics, Chinese Academy of Sciences, Beijing, China.

Keywords: Shugoshin 1, histone H3, spindle assembly checkpoint, Gcn5

34

Abstract

Mitotic fidelity is ensured by achieving biorientation on all paired chromosomes. The key signal
for proper chromosome alignment is the tension between sister chromatids created by opposing
poleward force from the spindles. In the budding yeast, the tension sensing function requires that
the Shugoshin protein, Shugoshin 1, be recruited to the centromeres and the neighboring
pericentric regions. Concerted actions integrating proteins at centromeres and pericentromeres
create highly specific Shugoshin 1 domains on mitotic chromosomes. We have previously
reported that an important regulatory region on histone H3, termed the tension sensing motif, is
responsible for retaining Shugoshin 1 at pericentromeres. The tension sensing motif is negatively
regulated by the acetyltransferase Gcn5p, but the underlying mechanism was elusive. In this
work, we provide evidence that, when the tension sensing motif function is impaired, the histone
H3 tail adopts a role that complements the damaged tension sensing motif to ensure faithful
mitosis. This novel function of the H3 tail is controlled by Gcn5p that targets selective lysine
residues. Mutations to K14 and K23 ameliorate the mitotic defects resulting from tension sensing
motif mutations. The restoration of faithful segregation is accompanied by regaining Shugoshin
1 access to the pericentric regions. Our data reveal a novel pathway for mitotic Shugoshin 1
recruitment and further reinforce the active role played by chromatins during their segregation in
mitosis.

35

Introduction

A core functional and structural unit in eukaryotic chromatin is the nucleosome, which is
composed of four canonical histone proteins (H2A, H2B, H3, and H4) and 147 base pairs of
DNA (Luger et al. 1997). These histones not only provide a framework for packaging DNA
within the nucleus, but also have important roles in a wide variety of cellular processes,
including transcription (Zhang et al. 1998; Berger 2007), nuclear import (Blackwell et al. 2007),
DNA replication (Ramachandran and Henikoff 2015), recombination (Hunt et al. 2013), and cell
cycle (Megee et al. 1995; Ng et al. 2013). Contrary to the general perception that chromosomes
are merely passive cargos during cell division, work from our lab and others has demonstrated an
active role for histones in mitotic control and maintaining chromosome fidelity during cell
division (Luo et al. 2010; Yamagishi et al. 2010; Luo et al. 2016).

Eukaryotic cells ensure faithful segregation of sister chromatids through the action of the
conserved Spindle Assembly Checkpoint (SAC). The SAC monitors both the attachment of
spindle microtubules to the kinetochores as well as the existence of tension between sister
chromatids held together by the cohesin complex (Lew and Burke 2003; Pinsky and Biggins
2005). Proper biorientation of chromosomes generates tension between sister chromatids due to
the poleward pulling force by spindles. A family of proteins integral to the tension sensing
pathway of the SAC are Shugoshin. Shugoshin monitors the tension between sister chromatids
and are well conserved throughout eukaryotes (Indjeian et al. 2005; Wang and Dai 2005;
Kitajima et al. 2006; Yamagishi et al. 2008). Shugoshin is enriched at the centromeres and
pericentric regions (Kitajima et al. 2005; Fernius and Hardwick 2007; Haase et al. 2012) from
which the tension originates (Bloom et al. 2006). In S. pombe, Shugoshin 1 (Sgo1) is recruited to
these regions by binding directly to histone H2A that is phosphorylated by the Bub1 kinase, as
well as to specific heterochromatin marks on histones (Kawashima et al. 2010; Yamagishi et al.
2010). The budding yeast S. cerevisiae lacks these heterochromatin marks, and therefore the
36

centromeric Bub1p-mediated histone H2A S121 phosphorylation provides the major nucleation
for the recruitment of Sgo1p (Fernius and Hardwick 2007; Kawashima et al. 2010). We have
reported that the tension sensing motif (TSM), 42KPGT, of histone H3 is critical to the pericentric
recruitment of Sgo1p (Luo et al. 2010; Luo et al. 2016). Point mutations within this motif
diminish pericentric Sgo1p recruitment without significantly affecting its centromeric
localization. Mitotic phenotypes that result from these TSM mutations include chromosomal
instability and missegregation, and the inability to activate the SAC when there is no tension
between sister chromatids. These phenotypes overlap with those seen with knocking out the
SGO1 gene, and can be rescued by overexpressing or by artificially tethering Sgo1p to the
pericentric chromatin, suggesting that maintaining Sgo1p at or near the centromeres feeds the
tension status signal to the SAC.

Recently, we showed that the Sgo1p pericentric recruitment is regulated by the histone
acetyltransferase Gcn5p (Luo et al. 2016). Deleting GCN5 or overexpressing a catalytically
inactive form of Gcn5p rescues tsm– mitotic defects. Deleting a histone deacetylase, RPD3,
enhances the chromosomal instability defect. These data suggest a role for acetylation in the
tension sensing function of the SAC. Lysine residues in the histone H3 tail, most prominently
K14, are well characterized targets of Gcn5p acetyltransferase activity (Kuo et al. 1996). Indeed,
a role of Gcn5p and H3 acetylation in centromeric function has been reported (Vernarecci et al.
2008). In this report, we demonstrate that in a tsm– background, cells require the histone H3 tail
to survive when put under mitotic stress. The mitotic defects of tsm– mutants can be alleviated by
replacing the H3 tail lysine residues with alanine, specifically K14. Sgo1p binds the histone H3
tail, allowing the H3 tail to act as a secondary site of Sgo1p binding to ensure the SAC function
when TSM is crippled.

37

Materials and Methods

Yeast strains and plasmid constructs

The yeast strains, plasmids, and oligos used in this work are listed in Tables 2-1, 2-2, and 2-3,
respectively.

Histone mutations were generated in pMK439 by two-step PCR site-directed mutagenesis (Luo
et al. 2010). Yeast transformations were performed by the lithium acetate method (Gietz et al.
1992). 5-FOA selection was conducted to select for yeast cells that had lost the plasmid pMK440
(a URA3 plasmid bearing all four core histone genes).

Yeast methods

Yeast growth media, conditions, and transformations were based on standard procedures
(Sherman 1991). When appropriate, 5% casamino acids (CAA) were used to substitute for
synthetic amino acid mixtures as selective medium for uracil, tryptophan, or adenine prototrophs.
Mating assays to assess chromosome stability were conducted by patching diploid cells from
single colonies to YPD plates and incubated at 30° for 2 to 3 days until saturation. Cell patches
were replica plated YPD plates pre-spread with a or ! tester cells (227a or 70!, respectively) and
allowed to mate at 30° before replica plating again to synthetic minimal medium. Mating
between the tester and the subject strains resulted in complete complementation of nutrient
requirement and hence colonies on the minimal medium.
Western analyses of yeast proteins were conducted as described in reference (Luo et al. 2010).

38

Table 2-1: Yeast strains used in this study
Strain
227a
70!
yCB006

Relevant genotype
lys1
thr3 met–
MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1

Source or reference
Gift of E. Grayhack
Gift of E. Grayhack
This study

hht1-hhf1::KAN hht2-hhf2::KAN hta1-htb1::Nat hta2htb2::HPH pMK439 "N [ARS CEN LEU2 HTA1-HTB1
yCB007

hht2-!2-28-HHF2]
MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 This study
hht1-hhf1::KAN hht2-hhf2::KAN hta1-htb1::Nat hta2htb2::HPH pMK439 "N G44S [ARS CEN LEU2 HTA1-

yCB031

HTB1 hht2-!2-28 G44S-HHF2]
MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 This study
hht1-hhf1::KAN hht2-hhf2::KAN hta1-htb1::Nat hta2htb2::HPH pMK439 4K-A [ARS CEN LEU2 HTA1-HTB1

yCB032

hht2-K9A-K14A-K18A-K23A-HHF2]
MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 This study
hht1-hhf1::KAN hht2-hhf2::KAN hta1-htb1::Nat hta2htb2::HPH pMK439 4K-A G44S [ARS CEN LEU2 HTA1-

yCB033

HTB1 hht2-K9A-K14A-K18A-K23A-G44S-HHF2]
MATa ade2-1 can1-100 his3-11,15 leu2-3,112

This study

trp1-1::sgo1::TRP1 ura3-1 hht1-hhf1::KAN hht2-hhf2::KAN
hta1-htb1::Nat hta2-htb2::HPH pQQ18 [ARS CEN LEU2
yCB034

HTA1-HTB1 HHT2-HHF2]
MATa ade2-1 can1-100 his3-11,15 leu2-3,112
trp1-1::sgo1::TRP1 ura3-1 hht1-hhf1::KAN hht2-hhf2::KAN
hta1-htb1::Nat hta2-htb2::HPH pMK439 4K-A [ARS CEN
LEU2 HTA1-HTB1 hht2-K9A-K14A-K18A-K23A-HHF2]

39

This study

Table 2-1 (cont’d)
yCB035

MATa ade2-1 can1-100 his3-11,15 leu2-3,112

This study

trp1-1::sgo1::TRP1 ura3-1 hht1-hhf1::KAN hht2-hhf2::KAN
hta1-htb1::Nat hta2-htb2::HPH pMK439 4K-A G44S [ARS
CEN LEU2 HTA1-HTB1 hht2-K9A-K14A-K18A-K23AyCB060

G44S-HHF2]
MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 This study
hht1-hhf1::KAN hht2-hhf2::KAN hta1-htb1::Nat hta2htb2::HPH pMK439 K14A G44S [ARS CEN LEU2 HTA1-

yCB066

HTB1 hht2-K14A-G44S-HHF2]
MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 This study
hht1-hhf1::KAN hht2-hhf2::KAN hta1-htb1::Nat hta2htb2::HPH pMK439 K14A [ARS CEN LEU2 HTA1-HTB1

yCB068

hht2-K14A-HHF2]
MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 This study
hht1-hhf1::KAN hht2-hhf2::KAN hta1-htb1::Nat hta2htb2::HPH pMK439 K9A [ARS CEN LEU2 HTA1-HTB1

yCB115

hht2-K9A-HHF2]
MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 This study
hht1-hhf1::KAN hht2-hhf2::KAN hta1-htb1::Nat hta2htb2::HPH pMK439 K23A G44S [ARS CEN LEU2 HTA1-

yCB116

HTB1 hht2-K23A-G44S-HHF2]
MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 This study
hht1-hhf1::KAN hht2-hhf2::KAN hta1-htb1::Nat hta2htb2::HPH pMK439 K18A G44S [ARS CEN LEU2 HTA1HTB1 hht2-K18A-G44S-HHF2]

40

Table 2-1 (cont’d)
yCB168

MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 This study
hht1-hhf1::KAN hht2-hhf2::KAN hta1-htb1::Nat hta2htb2::HPH pMK439 K23A [ARS CEN LEU2 HTA1-HTB1

yCB203

hht2-K23A-HHF2]
MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 This study
hht1-hhf1::KAN hht2-hhf2::KAN hta1-htb1::Nat hta2htb2::HPH pMK439 K18A [ARS CEN LEU2 HTA1-HTB1

yCB207

hht2-K18A-HHF2]
MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 This study
hht1-hhf1::KAN hht2-hhf2::KAN hta1-htb1::Nat hta2htb2::HPH pMK439 4K-R G44S [ARS CEN LEU2 HTA1-

yCB208

HTB1 hht2-K9R-K14R-K18R-K23R-G44S-HHF2]
MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 This study
hht1-hhf1::KAN hht2-hhf2::KAN hta1-htb1::Nat hta2htb2::HPH pMK439 K9A G44S [ARS CEN LEU2 HTA1-

yCB233

HTB1 hht2-K9A-G44S-HHF2]
MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 This study
hht1-hhf1::KAN hht2-hhf2::KAN hta1-htb1::Nat hta2htb2::HPH pMK439 4K-R [ARS CEN LEU2 HTA1-HTB1

yCB317

hht2-K9R-K14R-K18R-K23R-HHF2]
MATa/! his3!1 leu2!0 met15!0 ura3!0 hht1-hhf1::KAN

This study

hhf2-hht2::NAT hta1-htb1::HPH hta2-htb2::NAT pMK439
yCB318

K14A [ARS CEN LEU2 HTA1-HTB1 hht2-K14A-HHF2]
MATa/! his3!1 leu2!0 met15!0 ura3!0 hht1-hhf1::KAN
hhf2-hht2::NAT hta1-htb1::HPH hta2-htb2::NAT pMK439
K14A G44S [ARS CEN LEU2 HTA1-HTB1 hht2-K14AG44S-HHF2]

41

This study

Table 2-1 (cont’d)
yCB325

MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 This study
hht1-hhf1::KAN hht2-hhf2::KAN hta1-htb1::Nat hta2htb2::HPH pMK439 K14A T45A [ARS CEN LEU2 HTA1-

yCB326

HTB1 hht2-K14A-T45A-HHF2]
MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 This study
hht1-hhf1::KAN hht2-hhf2::KAN hta1-htb1::Nat hta2htb2::HPH pMK439 K14A K42A [ARS CEN LEU2 HTA1-

yCB343

HTB1 hht2-K14A-K42A-HHF2]
MATa ade2-1 bar1! ::URA3 can1-100 his3-11,15 leu2-3,112 This study
trp1-1::SGO1-6xHAis::TRP1 ura3-1 hht1-hhf1::KAN hht2hhf2::KAN hta1-htb1::Nat hta2-htb2::HPH pMK439 K14A

yCB344

[ARS CEN LEU2 HTA1-HTB1 hht2-K14A-HHF2]
MATa ade2-1 bar1! ::URA3 can1-100 his3-11,15 leu2-3,112 This study
trp1-1::SGO1-6xHAis::TRP1 ura3-1 hht1-hhf1::KAN hht2hhf2::KAN hta1-htb1::Nat hta2-htb2::HPH pMK439 K14A
G44S [ARS CEN LEU2 HTA1-HTB1 hht2-K14A-G44S-

yJL145

HHF2]
MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 Luo et al. 2010
hht1-hhf1::KAN hht2-hhf2::KAN hta1-htb1::Nat hta2htb2::HPH pMK439 G44S [ARS CEN LEU2 HTA1-HTB1

yJL170

hht2-G44S-HHF2]
MATa ade2-1 can1-100 his3-11,15 leu2-3,112

This study

trp1-1::sgo1::TRP1 ura3-1 hht1-hhf1::KAN hht2-hhf2::KAN
hta1-htb1::Nat hta2-htb2::HPH pMK439 G44S [ARS CEN
yJL340

LEU2 HTA1-HTB1 hht2-G44S-HHF2]
MATa/! his3!1 leu2!0 met15!0 ura3!0 hht1-hhf1::KAN
hhf2-hht2::NAT hta1-htb1::HPH hta2-htb2::NAT pMK439
G44S [ARS CEN LEU2 HTA1-HTB1 hht2-G44S-HHF2]

42

Luo et al. 2016

Table 2-1 (cont’d)
yJL467

MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 This study
hht1-hhf1::KAN hht2-hhf2::KAN hta1-htb1::Nat hta2htb2::HPH pMK439 K42A [ARS CEN LEU2 HTA1-HTB1

yJL471

hht2-K42A-HHF2]
MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 This study
hht1-hhf1::KAN hht2-hhf2::KAN hta1-htb1::Nat hta2htb2::HPH pMK439 T45A [ARS CEN LEU2 HTA1-HTB1

hht2-T45A-HHF2]
yMK1174 MATa/! his3!1 leu2!0 met15!0 ura3!0 hht1-hhf1::KAN

Luo et al. 2016

hhf2-hht2::NAT hta1-htb1::HPH hta2-htb2::NAT pJH33
[ARS CEN URA3 HTA1-HTB1 HHT2-HHF2]
yMK1243 MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 Luo et al. 2010
hht1-hhf1::KAN hht2-hhf2::KAN hta1-htb1::Nat hta2htb2::HPH pQQ18 [ARS CEN LEU2 HTA1-HTB1 HHT2yXD143

HHF2]
MATa ade2-1 bar1::URA3 can1-100 his3-11,15 leu2-3,112

This study

trp1-1::SGO1-6xHA::TRP1 ura3-1 hht1-hhf1::KAN hht2hhf2::KAN hta1-htb1::Nat hta2-htb2::HPH pQQ18 [ARS
yXD144

CEN LEU2 HTA1-HTB1 HHT2-HHF2]
MATa ade2-1 bar1::URA3 can1-100 his3-11,15 leu2-3,112
trp1-1::SGO1-6xHA::TRP1 ura3-1 hht1-hhf1::KAN hht2hhf2::KAN hta1-htb1::Nat hta2-htb2::HPH pMK439 G44S
[ARS CEN LEU2 HTA1-HTB1 hht2-G44S-HHF2]

43

This study

Table 2-2: Plasmid constructs used in this study
Plasmid
pCB034
pCB035
pCB043
pCB044
pCB045
pJH33/pMK439
pMK120
pMK144
pMK144 E173H
pMK515
pYCF1/CEN3.L

Main features
pGEX-4T-1 3xHA-SUMO
pGEX-4T-1 3xHA-SUMO-SGO1
pGEX-6P-1 GST-[2-135 CSE4]
pGEX-6P-1 GST-[2-150 CNN1]
pGEX-6P-1 GST-[2-38 HHT2]
pRS316-HTA1-HTB1 HHT2-HHF2
2 µm URA3 vector with CUP1 promoter
2 µm URA3 pCUP1-GCN5
2 µm URA3 pCUP1-gcn5E173H
pET21 6xHis-GCN5
YRp14/TEL cassette (pYCF1) with a CEN3 insert

44

Source or reference
This study
This study
This study
This study
This study
Luo et al. 2010
Kuo et al. 1998
Kuo et al. 1998
Kuo et al. 1998
Liu et al. 2005
Spencer et al. 1990

Table 2-3: Oligos used in this study
Oligo

Sequence

oCB007

AGGTCGAACATTTCTCACCA

oCB008

AGCCGTCCGATATATCCTCT

oCB023

CGAGAAGTAGTTCAAATGCAGA

oCB024

TGAGGACAGCCTATGGACATT

oCB031

CAACCACGCAATGAGTCTT

oCB032

TGGGGATATCTCAGAATGGA

oCB053

CCTCACGCGCTCTAATCC

oCB054

AGGAAGAAGACCCCAACGA

oCB123

CCCATCCGATACGAGCAT

oCB124

GGGAAGCCTGTGCGAAAT

oXD70

GCATAAGTGTGCCTTAGTATG

oXD71

GCGCTTGAAATGAAAGCTCCG

45

Red sectoring assays were performed as described by Spencer et al. 1990. Briefly, strains were
transformed with plasmid pYCF1/CEN3.L linearized with BglII. Ura+ transformants were grown
in CAA-Ura medium overnight and then plated directly onto YPD plates for colony formation
and scoring.

Chromatin immunoprecipitation (ChIP)

Yeast cultures for chromatin immunoprecipitation were grown in YPD into log phase and
arrested with 2 µg/mL ! factor for 4 hours in a 30º shaker, pelleted, and washed with sterile
water. Cell pellets were resuspended in original volume of YPD, and allowed to grow for 60
minutes at 30º before cells were cross-linked with 1% formaldehyde at room temperature for 45
minutes, washed with ice-cold TBS, and stored at –80º. ChIP was conducted as previously
described (Kuo et al. 1999; Luo et al. 2010). ChIP results were quantified using qPCR performed
on a Roche LightCycler 480 and normalized with 0.1% inputs.

Recombinant protein preparation

To express and purify 6His-SUMO-Sgo1p and 6His-Gcn5p from E. coli, 100 mL BL21–
CodonPlus E. coli cells were induced (at optical density 0.5 -0.6 in LB + 50 µg/mL Kanamycin)
with 1 mM IPTG at 16º for 16 hours. Cells were pelleted (5,000 x g, 5 min, 4º) and resuspended
in 10 mL Lysis/Sonication Buffer (300 mM NaCl, 50 mM Na2HPO4, 1 mM DTT, 1 mM PMSF, 1
mg/mL lysozyme) and incubated on ice 30 minutes. Cells were flash frozen and thawed twice.
Cells were then sonicated six times, 15–second bursts, with 1 minute on ice in between rounds of
sonication. Debris was pelleted at 10,000 rpm, 15 minutes, 4º and the soluble fraction was
transferred to a new tube and mixed with 5 mL Ni-NTA beads for purification of 6His tag. Beads
were incubated at 4º for 1 hour, washed twice with 10 mL wash buffer (300 mM NaCl, 50 mM
Na2HPO4, 1 mM DTT, 1 mM PMSF, 10% glycerol) at pH 6.0, and once with 10 mL wash buffer
46

at pH 5.5. 6His-SUMO was eluted with 6 mL wash buffer at pH 4.0 supplemented with 200 mM
imidazole. The pH of the eluate was neutralized with 300 µL 1 M Na2HPO4. Purification of H3
(2-38)-GST protein was the same except the soluble fraction was mixed with 200 µL glutathione
Sepharose beads, and washed three times with IPP-150 (10 mM Tris pH 8.0, 150 mM NaCl,
0.1% NP-40, 1 mM DTT, 1 mM PMSF), and eluted with IPP-150 supplemented with 15 mM
reduced glutathione at 4º for 1 hour. All proteins yield and purity were assessed by SDS-PAGE
analysis.

GST pulldown assay

H3(2-38)-GST was acetylated in reaction buffer (50 mM Tris pH 7.4, 50 mM NaCl, 500 µM
Acetyl CoA) by recombinant 6His-Gcn5p for 1 hour at 30º. Mock treatment was the same except
lacking Acetyl CoA. H3(2-38)-GST, Ac H3(2-38)-GST, or GST was bound to glutathione
Sepharose beads in IPP-150 for 1 hour at 4º. Beads were then mixed with equivalent moles of
6His-SUMO-Sgo1p or 6His-SUMO and incubated for 2 hours at 4º. Beads were washed four
times with IPP-150, and retained proteins were eluted by boiling with SDS-PAGE loading dye
and analyzed by western blot.

47

Results

Histone H3 tail provides a site for Gcn5p acetylation and mediates suppression of tsm– mitotic
defects

Our previous results have shown the negative regulator function of Gcn5p for the H3 TSM in
that the loss of Gcn5p or its HAT activity rescues the impaired SAC function (Luo et al. 2016).
The converse effects can be seen with the deletion of RPD3, consistent with the opposing
enzymatic activity of Rpd3p HDAC. Because Gcn5p and Rpd3p act on the H3 tail, we
hypothesized that in tsm– strains, acetylation of the histone H3 tail or one of the downstream
effectors of acetylation assumes a more pronounced mitotic role when the TSM function is
crippled. To test this notion, we first removed the H3 tail by deleting residues 2-28 of histone H3.
We also overexpressed wild-type Gcn5p or a catalytically dead allele, E173H, to examine the
involvement of H3 tail in the TSM function (Figure 2-1A). The loss of H3 tail did not cause a
significant phenotype, but when combined with the G44S tsm– allele, cells were sick without any
stress. The role of H3 tail in mitotic tension sensing was tested by cellular growth in response to
benomyl, a microtubule destabilizing drug that exacerbates defects in tension sensing
(Kawashima et al. 2011; Haase et al. 2012; Luo et al. 2016). As shown before (Luo et al. 2016),
overexpressing the E173H allele of Gcn5p rescues the benomyl hypersensitivity phenotype
caused by the G44S tsm– mutation. However, this rescue was eradicated by the "2-28 H3 mutant,
suggesting that the H3 tail is targeted by Gcn5p to regulate the function of TSM. Because the tail
deletion itself does not have an effect on the cellular sensitivity to the mitosis toxin benomyl (see
"2-28 H3 row 4), we suggest that the H3 tail is an auxiliary for the TSM whose function
becomes appreciable only when TSM is crippled.

As H3 tail deletion causes G44S cells to become sick (see "2-28 G44S H3, row 1), a more
targeted approach was taken. Lysine-to-alanine substitutions were made at residues K9, K14,
48

A

WT

G44S H3

!2-28 H3

!2-28 G44S H3

EV

YPD

Gcn5
E173H
Gcn5

EV

10 "g/mL
Benomyl

Gcn5
E173H
Gcn5

B

WT

4K-A H3

G44S H3

4K-A G44S H3

EV
Gcn5

YPD

E173H
Gcn5
F221A
Gcn5
EV
10 !g/mL
Benomyl

Gcn5
E173H
Gcn5
F221A
Gcn5

Figure 2-1: Tension sensing motif function is modulated by lysine residues within the
histone H3 tail domain in an SGO1-dependent manner.

49

Figure 2-1 (cont’d)

C

YPD

10 !g/mL Benomyl

WT
sgo1!
4K-A sgo1!
G44S sgo1!
4K-A G44S sgo1!

A) Strains with the listed histone H3 alleles were transformed with overexpression plasmids for
either wild-type or a catalytically inactive E173H Gcn5p. Logarithmically growing cultures were
serially diluted and spotted to YPD or YPD containing 10 µg/mL benomyl. B) Strains with
histone H3 K9, 14, 18, and 23 mutated to alanine (4K-A) along with a wild-type or G44S TSM
allele were assessed by spot assay as described above. C) The 4K-A mutations were tested in
sgo1! strains to assess the SGO1 dependence of the 4K-A rescue.

50

K18, and K23 (4K-A). K14 is the primary site of Gcn5p acetylation, whereas K18 and K23 are
secondary targets, and K9 is the least efficient substrate for Gcn5p (Kuo et al. 1996; Zhang et al.
1998). Replacing these four lysine residues with alanine did not cause discernible phenotypes
under normal growth conditions, with or without the G44S mutation (Figure 2-1B). Strikingly,
the 4K-A allele alone was sufficient to rescue the G44S benomyl hypersensitivity phenotype (see
4K-A G44S, row 4). This suppression does not add additional strength to the E173H gcn5p–
allele (see 4K-A G44S row 6), suggesting a common mechanism of these two suppressors. To
further verify the specificity of the 4K-A suppressor, we deleted SGO1, the primary effector for
TSM. When SGO1 is deleted, the 4K-A allele no longer rescues the benomyl hypersensitivity of
G44S (Figure 2-1C). Gcn5p thus most likely targets the lysine residues in the N’ tail of histone
H3 to regulate the function of TSM.

An alanine substitution imposes a profoundly different structure from the original lysine side
chain. In order to test if the 4K-A suppression of benomyl hypersensitivity was reliant on the loss
of a positive charge, we tested 4K-R quadruple mutations to mimic the unacetylated lysine. The
4K-R allele performed similarly to the 4K-A in that the benomyl hypersensitivity defect of the
G44S mutant was effectively abolished (Figure 2-2A), suggesting that lysine per se is critical for
the functional interaction between the tail and TSM.

All lysine residues in the H3 tail are not acetylated with equal affinity by Gcn5p. The most
preferred target of Gcn5p acetylation is K14, while K18, and K23 have also been identified as
sites of Gcn5p mediated acetylation (Kuo et al. 1996; Kuo and Andrews 2012). Therefore, we
tested if mutations of any single lysine residue to alanine would be sufficient to rescue the G44S
benomyl hypersensitivity (Figure 2-2B). Among the four point mutants, K14A rescued the G44S
tsm– benomyl hypersensitivity very effectively. K23A displayed modest suppression, while K9A
and K18A did not significantly alleviate the G44S mitotic defect. As K14 is a favored site of
Gcn5p acetylation in vitro, this result is consistent with the model that Gcn5p acetylation of
51

A

WT TSM

G44S TSM

H3
WT
!2-28

YPD
4K-A
4K-R
WT
!2-28

10 "g/mL
Benomyl

4K-A
4K-R

B

G44S TSM

WT TSM
H3
WT

K9A

YPD

K14A
K18A
K23A
WT
K9A

10 !g/mL
Benomyl

K14A
K18A
K23A

Figure 2-2: Lysine-to-arginine mutations on the histone H3 tail, or K14A mutation alone
can rescue G44S benomyl hypersensitivity.

52

histone H3 tail lysine acts as a negative regulator for TSM.

K14A also rescues the mitotic defects of tsm– K42A mutant

The TSM consists of K42, P43, G44, and T45 (Luo et al. 2016), with alanine substitutions of any
one residue except P43 resulting in mitotic defects. To gain a deeper understanding of the
functional interaction between H3 K14 and TSM, we also tested the suppressing activity of
K14A in K42A and T45A tsm– mutants. K14A demonstrated a strong rescue of K42A benomyl
hypersensitivity (Figure 2-3A), and a more modest rescue of T45A benomyl hypersensitivity on
lower concentrations of benomyl (data not shown). T45A displays a more severe phenotype than
K42A or G44S (Luo et al. 2016), possibly due to the prevention of T45 phosphorylation that is
critical for DNA replication (Dai et al. 2008; Baker et al. 2010; Kawashima et al. 2011). The
partial rescue of T45A phenotypes by K14A may thus be attributed to the pleiotropic damages
caused by the T45A mutation. Consistent with this suggestion are the observations that
hypersensitivities to hydroxyurea and UV are associated with mutations of residues in the TSM
(Luo et al. 2010; Luo et al. 2016). Hydroxyurea (HU) inhibits ribonucleotide reductase for
deoxyribonucleotide synthesis during DNA replication (Slater 1973; Koc et al. 2004). HU
hypersensitivity therefore likely indicates defects in DNA synthesis that is reminiscent of the
additional role of T45 phosphorylation in the S phase. Importantly, this phenotype of tsm–
mutations is refractory to suppressors such as Sgo1p overexpression and GCN5 deletion (Luo et
al. 2010; Luo et al. 2016). To see whether H3 tail lysine mutations act selectively on the mitotic
function of TSM, cell growth in the presence of HU was tested (Figure 2-3B). None of the above
tail mutations reduced the sensitivity to hydroxyurea caused by the G44S tsm– mutation, strongly
suggesting that the tail domain of H3, in particular those acetylatable lysine residues, genetically
interact with the TSM for mitotic regulation.

53

A

YPD

7.5 µg/mL
Benomyl

WT
K14A
K42A
K14A K42A
G44S
K14A G44S
T45A
K14A T45A

B

YPD

75 mM HU 100 mM HU

Tail
WT

WT
TSM

4K-A
4K-R
K14A
K23A
WT

G44S
TSM

4K-A
4K-R
K14A
K23A

Figure 2-3: K14A can rescue benomyl hypersensitivity of other tsm– mutants, but has no
effect on hydroxyurea hypersensitivity. HU, hydroxyurea.

54

K14A mutation complements mitotic defects of tsm– cells

Benomyl treatment is an efficient method to interrogate the SAC response, as it perturbs
microtubule formation and consequently activates the SAC for the lack of both tension and
spindle-kinetochore attachment. One of the approaches to examining benomyl-induced tension
defects is to treat cells with high doses of benomyl for a short period of time before plating cells
to a benomyl-free culture plate. During the recovery phase in which the spindle-kinetochore
association is being re-established, cells tend to commit erroneous attachment, leading to
tensionless mistakes (Glotzer 1996; Loncarek et al. 2007). Elevated mortality indicates defects in
tension sensing (Jeganathan et al. 2007; Santaguida and Amon 2015). To further link K14A and
G44S mutations to the tension sensing function, wild-type, K14A, G44S, and K14A G44S strains
were first arrested by benomyl (40 µg/mL) for increasing time intervals, then washed and plated
on YPD. As expected, both wild-type and K14A strains displayed minimal sensitivity to any
length of benomyl treatment (Figure 2-4). The G44S tsm– strain showed rapid loss of viability
after benomyl treatment. This phenotype was partially rescued by the K14A mutation, indicating
that cells regained the ability to detect and to respond to defects in tension surveillance.

Improper segregation of sister chromatids results in chromosome instability and hence
aneuploidy. In order to evaluate the ability of cells to maintain genome integrity, we exploited the
mating systems of budding yeast. Haploid yeast possesses one copy of either MATa or MAT!
mating locus on chromosome III. MATa cells are capable of mating with MAT! cells to form
MATa/! diploid cells. These diploid cells transcriptionally repress both copies of the mating loci,
and therefore are no longer able to mate. Chromosome instability causes cells to randomly lose
chromosomes during cell division. If a single copy of chromosome III is lost, cells will regain the
ability to mate. Diploid his3!1 strains containing the various histone H3 mutations were patched
and grown before replica plating to the lawn of MATa or MAT! tester strains (lys1 and thr3 met1–
respectively). Successful mating enabled the pseudo triploid to form colonies in minimal
55

% Of Total Cells Forming Colonies
100

% Viability

75

WT
K14A
G44S
K14A G44S

50

Fix WT
Fix K14A
Fix G44S

25

Hours in
Benomyl

0

0

1

2

3

4

5

6

Figure 2-4: K14A mutation partially rescues recovery from benomyl arrest. Exponentially
growing cells with the indicated histone H3 mutations were treated with 40 µg/mL benomyl for
the indicated time. Colony forming units, expressed as % viability, were measured on benomylfree YPD plates. Data is from three independent biological replicates, with the error bars
representing the standard error.

56

medium (Figure 2-5A). We quantified the number of colonies on the minimal medium plate and
found that the wild-type and K14A strains displayed low levels of colony formation (Figure
2-5B), as expected from cells with normal chromosome stability. G44S mutant cells exhibited
significantly higher rates of chromosome loss whereas the addition of K14A effectively reduced
the number of colonies, suggesting that K14A also suppressed the chromosome instability
defects caused by the G44S mutation.

A more quantitative approach to examining chromosome instability is by use of a synthetic
chromosome bearing the SUP11 tRNA suppressor for a chromogenic ade2– allele. Ade2p
converts beta-isopropylmalate to alpha-ketoisocaproate in leucine biosynthesis (Jones and Fink
1982). The accumulation of beta-isopropylmalate gives ade2– colonies a dark red coloration.
Introducing the SUP11 suppressor on a non-essential synthetic chromosome complements this
defect and generates white colonies. Spontaneous loss of this synthetic chromosome causes the
accumulation of the red pigmentation. Chromosome stability can thus be assessed by comparing
the rate of colonies displaying significant red sectoring (Spencer et al. 1990). Specifically, we
counted half-red/half-white colonies that resulted from a first-division chromosome loss event
(Figure 2-6, arrows). Both wild-type and K14A strains had low rates of red sectoring, indicating
high chromosome stability. As reported before, the G44S cells had a significantly higher rate of
chromosome loss per one thousand cell divisions (Luo et al. 2010). On the other hand, K14A
G44S cells were able to maintain the SUP11 synthetic chromosome at a rate similar to that of
wild-type cells. The number of half-red/half-white colonies was reduced significantly, indicating
restoration in chromosome stability. From Figures 2-4 through 2-6, we conclude that the K14A
mutation effectively suppresses the mitotic defects caused by the G44S tsm– mutant allele.

K14A mutation increases pan-chromatin association of Sgo1p and binds Sgo1p physically

Previous work demonstrated that Sgo1p is recruited to both centromeres and pericentric regions
57

WT
WT

K14A

WT
A
WT WT
K14A
WT

K14A

G44S

K14A
G44S
K14A
G44S
K14A
G44S

K14A G44S
G44S
K14A G44S

K14A

K14A G44S
K14A
G44S
G44S
G44S

K14A G44S

x

Median
Mean
25%-75%
9%-91%

•

Colonies per patch

B

Outlier
x

x
x

x

WT

K14A

G44S

K14A
G44S

Figure 2-5: K14A tsm– suppressor partially rescues aberrant mating phenotypes of diploid
tsm– strain. Diploid strains containing the wild-type, K14A, G44S, and K14A G44S alleles as
the sole copy of H3 were subjected to mating with haploid tester strains. Colony formation on
minimal medium indicates aberrant mating resulting from aneuploidy. A) Representative images
of colonies on minimal medium plates. Arrows indicate colony growth. B) Colony growth shown
by box plot. Both wild-type and K14A strains show low levels of mating, which are greatly
increased in the G44S strain. This aberrant mating can be reduced with the introduction of K14A
into the G44S strain.

58

Chromosome Loss
per 1000 Divisions

100

*

75

50

WT

K14A

G44S

K14A G44S

25

0

WT

K14A

G44S

K14A G44S

Figure 2-6: K14A restores chromosome stability of G44S tsm– cells. Strains with the indicated
histone H3 backgrounds were transformed with a synthetic chromosome containing the SUP11
gene that suppressed the ochre mutation of ade2-1. Loss of this synthetic chromosome is
indicated by red sectoring in colonies. Half-red/half-white colonies were counted, as they
indicated first-division chromosome loss. The left panel presents the quantification of
chromosome loss per one thousand cells divisions as assayed by the method. * indicates
significantly different (p < 0.05) from wild-type.

59

during mitosis (Fernius and Hardwick 2007; Kiburz et al. 2008), and that the G44S mutation
selectively affects the pericentric recruitment of Sgo1p (Luo et al. 2010). One possible
explanation for the K14A-mediated suppression of tsm– defects is that Sgo1p regains its
pericentric localization in this background. We conducted ChIP experiments to test this
hypothesis (Figure 2-7). Centromeric Sgo1p localization was normal in all H3 backgrounds, for
H3 is replaced by Cse4p in centromeric nucleosomes (Meluh et al. 1998; Wieland et al. 2004).
Sgo1p was also enriched at the pericentromeres in wild-type cells (yellow bars, Figure 2-7), and
the pericentric localization is lost in G44S cells (purple bars). As predicted, the K14A G44S
double mutant (orange bars) showed apparent increased Sgo1p abundance in pericentric regions,
consistent with the notion that retaining Sgo1p at the pericentric regions is a key determinant for
the tension sensing function of the SAC. However, K14A mutation achieves this suppression by
allowing wide-spread association of Sgo1p with chromatin (red bars). All loci tested, proximal
or distal to centromeres, showed significantly higher levels of Sgo1p, suggesting that K14
acetylation by Gcn5p has a global function that also includes the regulation of the SAC and
tension sensing.

That K14A alone enables Sgo1p to be present in pericentric and arm regions of chromatin even
in the G44S background suggests that the H3 tail may be bound by Sgo1p. To test this notion, we
fused GST to the tail domains of H3, Cse4p, and a kinetochore protein Cnn1p for pulldown
assays. Figure 2-8A shows that recombinant Sgo1p interacts with the tail domains of H3 and
Cse4p but not that of Cnn1p or the GST control. To test whether acetylation directly influences
the H3 tail-Sgo1p interaction, we acetylated the H3 tail-GST fusion protein in vitro by Gcn5p
(Figure 2-8B). To our surprise, acetylation did not cause an appreciable reduction of Sgo1p
interaction in vitro (Figure 2-8C), suggesting the existence of an additional factor(s) that acts
downstream of Gcn5p-mediated H3 acetylation for more direct control of Sgo1p-chromatin
association.

60

0.05

*
*
No Tag

0.04

%IP

No Ab
WT H3

0.03

K14A H3
G44S H3
0.02

K14A G44S H3

*

*

*

*

0.01

b
5k

kb

-9
CE
N

9

1
CE
N

1

+8

+5

00

bp
-5
1
CE
N

CE
N

00

kb
CE
N

1

-3

.5

1
CE
N

bp

0

Figure 2-7: K14A enhances Sgo1p recruitment to chromatin in both wild-type and G44S
strains. Strains with the indicated H3 backgrounds were synchronized with ! factor, released
into fresh medium, and grown for 60 minutes. Cells were then processed for Sgo1p ChIP. ChIP
DNA was analyzed using qPCR and quantified as percent of IP. Four independent biological
replicates were used to prepare this data. * indicates p < 0.05.

61

A

Cse4p Tail GST

GST

Cnn1p Tail - H3 Tail GST
GST

1% 6HisSgo1p

Cse4p Tail GST

GST

Cnn1p Tail -H3 Tail - 1% 6HisSgo1p
GST
GST

WB: !-GST

C

B
H3 Tail Ac H3
GST
Tail - GST

WB: !-6His

H3 Tail - Ac H3
GST
GST Tail - GST

1% Input

Sgo1p

SUMO
WB: !-6His

WB: !-AcK9/14

Figure 2-8: Sgo1p binds Cse4p tail and both acetylated and unacetylated histone H3 tail. A)
Tail peptides from Cse4p, Cnn1p, and histone H3 were C’-tagged with GST and bound to
glutathione Sepharose beads. Beads were then mixed with 6His-Sgo1p and retained protein was
assessed by immunoblotting. Full length Sgo1p is displayed in the red box. B) H3 tail peptide
was either mock treated or in vitro acetylated by recombinant Gcn5p. Acetylation of histone H3
tail peptide at K9/14 was confirmed by immunoblotting with anti-acetylated K9/14 antibodies.
C) H3 tail peptides were mixed with a 6His-SUMO-Sgo1p or 6His-SUMO control and bound to
glutathione Sepharose beads. Bound materials were analyzed by immunoblotting with anti-His
tag antibodies.

62

Discussion

We recently reported the identification and functional characterization of the tension sensing
motif, TSM, of H3 (42KPGT) that is critical for faithful mitotic segregation (Luo et al. 2016). By
retaining Sgo1p at the pericentric regions following its centromeric recruitment (Fernius and
Hardwick 2007; Kawashima et al. 2010; Williams et al. 2017), the TSM ensures that cells
establish bipolar attachment before initiating metaphase-to-anaphase transition. The TSM is
negatively regulated by a histone acetyltransferase Gcn5p. Here we present evidence that Gcn5p
likely exerts its TSM regulatory function by targeting selective lysine residues within the tail
domain of histone H3. Deleting this domain (residues 2 to 28) abolishes the gcn5– suppression of
TSM mutations. Substituting the tail domain acetylatable lysine residues, in particular, K14, with
either alanine or arginine bypasses the need for TSM, and suppresses chromosome instability
phenotypes resulting from the tsm– G44S mutation. Significantly, pericentric localization of
Sgo1p is partially restored in the H3 K14A G44S mutant, consistent with the notion that the
presence of Sgo1p at pericentromeres is essential for the surveillance of mitotic tension between
sister chromatids. While Sgo1p regains accessibility to pericentromeres in the K14A G44S
background, in the K14A background it also becomes detectable in the arm region that is
typically devoid of Sgo1p. Together with the biochemical evidence for Sgo1p-H3 tail interaction,
we suggest that the tail domain of H3 serves as an auxiliary anchor for Sgo1p. Under normal
conditions, TSM is the primary docking site for pericentric Sgo1p that is first recruited to the
centromeres by phosphorylated H2A (Fernius and Hardwick 2007; Kawashima et al. 2010).
Mutations at K42, G44, or T45 damage this binding surface and hence perturb the pericentric
retention of Sgo1p spilled from centromeres. By deleting Gcn5p or mutating its major targets
K14 or K23, the H3 tail assumes the capability of attracting Sgo1p to chromatin. The
reappearance of pericentric Sgo1p population thus restores the tension sensing function.
Genome-wide alteration of H3 acetylation status resulting from the loss of Gcn5p activity or tail
K-to-A or -R mutations render the arm region amenable to Sgo1p binding, therefore the elevation
63

of Sgo1p abundance at these otherwise low-abundance areas of chromosomes.

It is also interesting that Sgo1p binds H3 tail in a manner that does not seem to be affected
appreciably by the acetylation status of the latter. This observation argues against the hypothesis
that acetylation of the H3 tail by Gcn5p directly regulates Sgo1p binding, instead it suggests the
existence of additional regulators. For example, it is well-documented that lysine acetylation
attracts bromodomain-containing proteins for direct association (Dhalluin et al. 1999; Zhang et
al. 2010; Gong et al. 2016). Acetylated K14 attracts yeast proteins such as Snf2p, Sth1p, and
several Rsc proteins (Zhang et al. 2010). It is possible that one or more of these bromodomain
proteins occlude Sgo1p from the tail domain. In the presence of a functional TSM, this occlusion
does not impact the SAC function, as Sgo1p binds TSM at pericentric regions of chromatin. In
tsm– strains, Sgo1p loses its pericentric footing, and therefore requires the interaction with the
histone H3 tail to maintain a presence in pericentric chromatin. In this case, tail acetylation and
competition from bromodomain proteins results in the loss of Sgo1p at the pericentric regions,
and therefore impairs effective SAC function.

This report shows a novel role of the histone H3 tail as a regulator in the maintenance of mitotic
fidelity through TSM. We also show that selective lysine residues in the H3 tail domain may
facilitate Sgo1p function by helping the latter to maintain its pericentric footings. The critical yet
unanswered question remains to be how Sgo1p relays the tension status to the activity of the
SAC. It has been shown that the removal of Sgo1p from the pericentric region occurs after
biorientation (Nerusheva et al. 2014). The tension-dependent conformational changes in the
chromatin may be a determinant for Sgo1p-chromatin association (Haase et al. 2012;
Verdaasdonk et al. 2012). We favor a scenario that tension-instigated conformational changes of
chromatin are translated through the nucleosomes to deform the TSM of histone H3, which
dislodges pericentric Sgo1p. After evicting the final molecule of Sgo1p from the pericentric
regions of the last bioriented chromosome pair, cells turn off the SAC and initiate the metaphase64

to-anaphase transition. When the TSM is crippled, pericentric Sgo1p is retained by its association
with the H3 tail in the absence of Gcn5p and the downstream effectors such as one of the
bromodomain-containing proteins. Spatially, the tail domain precedes the TSM. It seems
plausible that the tension generated by biorientation may be transmissible from the TSM to the
tail region (or vice versa). The restored pericentric Sgo1p population can then again monitor the
tension status and relays that information to the SAC. This model also alludes to an intriguing
hypothesis that the interplays between Gcn5p and H3 tail may restrict Sgo1p from chromosomal
arms. Further genetic and molecular dissection may shed light on the involvement of H3 tail and
its associated factors in the critical tension sensing mechanism.

65

REFERENCES

66

REFERENCES

Baker, S.P., Phillips, J., Anderson, S., Qiu, Q., Shabanowitz, J., Smith, M.M., Yates, J.R., Hunt,
D.F., and Grant, P.A. (2010). Histone H3 Thr 45 phosphorylation is a replication-associated posttranslational modification in S. cerevisiae. Nature Cell Biology.
Berger, S.L. (2007). The complex language of chromatin regulation during transcription. Nature
447, 407–412.
Blackwell, J.S., Wilkinson, S.T., Mosammaparast, N., and Pemberton, L.F. (2007). Mutational
Analysis of H3 and H4 N Termini Reveals Distinct Roles in Nuclear Import. Journal of
Biological Chemistry 282, 20142–20150.
Bloom, K., Sharma, S., and Dokholyan, N.V. (2006). The path of DNA in the kinetochore. Curr.
Biol. 16, R276-278.
Dai, J., Hyland, E.M., Yuan, D.S., Huang, H., Bader, J.S., and Boeke, J.D. (2008). Probing
Nucleosome Function: A Highly Versatile Library of Synthetic Histone H3 and H4 Mutants. Cell
134, 1066–1078.
Dhalluin, C., Carlson, J.E., Zeng, L., He, C., Aggarwal, A.K., and Zhou, M.M. (1999). Structure
and ligand of a histone acetyltransferase bromodomain. Nature 399, 491–496.
Fernius, J., and Hardwick, K.G. (2007). Bub1 kinase targets Sgo1 to ensure efficient
chromosome biorientation in budding yeast mitosis. PLoS Genet. 3, e213.
Gietz, D., St Jean, A., Woods, R.A., and Schiestl, R.H. (1992). Improved method for high
efficiency transformation of intact yeast cells. Nucleic Acids Res. 20, 1425.
Glotzer, M. (1996). Mitosis: Don’t get mad, get even. Current Biology 6, 1592–1594.
Gong, F., Chiu, L.-Y., and Miller, K.M. (2016). Acetylation Reader Proteins: Linking Acetylation
Signaling to Genome Maintenance and Cancer. PLoS Genet. 12, e1006272.
Gurley, L.R., D’Anna, J.A., Barham, S.S., Deaven, L.L., and Tobey, R.A. (1978). Histone
phosphorylation and chromatin structure during mitosis in Chinese hamster cells. Eur. J.
Biochem. 84, 1–15.
Haase, J., Stephens, A., Verdaasdonk, J., Yeh, E., and Bloom, K. (2012). Bub1 Kinase and Sgo1
Modulate Pericentric Chromatin in Response to Altered Microtubule Dynamics. Current Biology
22, 471–481.
Hendzel, M.J., Wei, Y., Mancini, M.A., Van Hooser, A., Ranalli, T., Brinkley, B.R., Bazett-Jones,
D.P., and Allis, C.D. (1997). Mitosis-specific phosphorylation of histone H3 initiates primarily
within pericentromeric heterochromatin during G2 and spreads in an ordered fashion coincident
with mitotic chromosome condensation. Chromosoma 106, 348–360.
Hunt, C.R., Ramnarain, D., Horikoshi, N., Iyengar, P., Pandita, R.K., Shay, J.W., and Pandita,
T.K. (2013). Histone Modifications and DNA Double-Strand Break Repair after Exposure to
Ionizing Radiations. Radiation Research 179, 383–392.
Indjeian, V.B., Stern, B.M., and Murray, A.W. (2005). The centromeric protein Sgo1 is required
to sense lack of tension on mitotic chromosomes. Science 307, 130–133.
67

Jeganathan, K., Malureanu, L., Baker, D.J., Abraham, S.C., and van Deursen, J.M. (2007). Bub1
mediates cell death in response to chromosome missegregation and acts to suppress spontaneous
tumorigenesis. The Journal of Cell Biology 179, 255–267.
Jones, E. W., and G. R. Fink, 1982 Regulation of amino acid and nucleotide biosynthesis in
yeast. Molecular Biology of the Yeast Saccharomyces: Metabolism and Gene Expression, Cold
Spring Harbor Press (Cold Spring Harbor, NY) Pp. 181-299.
Kawashima, S.A., Yamagishi, Y., Honda, T., Ishiguro, K. -i., and Watanabe, Y. (2010).
Phosphorylation of H2A by Bub1 Prevents Chromosomal Instability Through Localizing
Shugoshin. Science 327, 172–177.
Kawashima, S., Nakabayashi, Y., Matsubara, K., Sano, N., Enomoto, T., Tanaka, K., Seki, M.,
and Horikoshi, M. (2011). Global analysis of core histones reveals nucleosomal surfaces required
for chromosome bi-orientation. EMBO J. 30, 3353–3367.
Kiburz, B.M., Amon, A., and Marston, A.L. (2008). Shugoshin promotes sister kinetochore
biorientation in Saccharomyces cerevisiae. Mol. Biol. Cell 19, 1199–1209.
Kitajima, T.S., Hauf, S., Ohsugi, M., Yamamoto, T., and Watanabe, Y. (2005). Human Bub1
Defines the Persistent Cohesion Site along the Mitotic Chromosome by Affecting Shugoshin
Localization. Current Biology 15, 353–359.
Kitajima, T.S., Sakuno, T., Ishiguro, K., Iemura, S., Natsume, T., Kawashima, S.A., and
Watanabe, Y. (2006). Shugoshin collaborates with protein phosphatase 2A to protect cohesin.
Nature 441, 46–52.
Koc, A., Wheeler, L.J., Mathews, C.K., and Merrill, G.F. (2004). Hydroxyurea Arrests DNA
Replication by a Mechanism That Preserves Basal dNTP Pools. Journal of Biological Chemistry
279, 223–230.
Kuo, M.H., Brownell, J.E., Sobel, R.E., Ranalli, T.A., Cook, R.G., Edmondson, D.G., Roth, S.Y.,
and Allis, C.D. (1996). Transcription-linked acetylation by Gcn5p of histones H3 and H4 at
specific lysines. Nature 383, 269–272.
Kuo, M.H., Zhou, J., Jambeck, P., Churchill, M.E., and Allis, C.D. (1998). Histone
acetyltransferase activity of yeast Gcn5p is required for the activation of target genes in vivo.
Genes Dev. 12, 627–639.
Kuo, Y.-M., and Andrews, A.J. (2013). Quantitating the specificity and selectivity of Gcn5mediated acetylation of histone H3. PLoS ONE 8, e54896.
Lew, D.J., and Burke, D.J. (2003). The Spindle Assembly and Spindle Position Checkpoints.
Annual Review of Genetics 37, 251–282.
Liu, Y., Xu, X., Singh-Rodriguez, S., Zhao, Y., and Kuo, M.-H. (2005). Histone H3 Ser10
Phosphorylation-Independent Function of Snf1 and Reg1 Proteins Rescues a gcn5- Mutant in
HIS3 Expression. Molecular and Cellular Biology 25, 10566–10579.
Liu, H., Rankin, S., and Yu, H. (2012). Phosphorylation-enabled binding of SGO1–PP2A to
cohesin protects sororin and centromeric cohesion during mitosis. Nature Cell Biology 15, 40–
49.

68

Lo, W.S., Trievel, R.C., Rojas, J.R., Duggan, L., Hsu, J.Y., Allis, C.D., Marmorstein, R., and
Berger, S.L. (2000). Phosphorylation of serine 10 in histone H3 is functionally linked in vitro
and in vivo to Gcn5-mediated acetylation at lysine 14. Mol. Cell 5, 917–926.
Loncarek, J., Kisurina-Evgenieva, O., Vinogradova, T., Hergert, P., La Terra, S., Kapoor, T.M.,
and Khodjakov, A. (2007). The centromere geometry essential for keeping mitosis error free is
controlled by spindle forces. Nature 450, 745–749.
Luger, K., Mäder, A.W., Richmond, R.K., Sargent, D.F., and Richmond, T.J. (1997). Crystal
structure of the nucleosome core particle at 2.8 A resolution. Nature 389, 251–260.
Luo, J., Xu, X., Hall, H., Hyland, E.M., Boeke, J.D., Hazbun, T., and Kuo, M.-H. (2010).
Histone H3 Exerts a Key Function in Mitotic Checkpoint Control. Molecular and Cellular
Biology 30, 537–549.
Luo, J., Deng, X., Buehl, C., Xu, X., and Kuo, M.-H. (2016). Identification of Tension Sensing
Motif of Histone H3 in Saccharomyces cerevisiae and Its Regulation by Histone Modifying
Enzymes. Genetics 204, 1029–1043.
Megee, P.C., Morgan, B.A., and Smith, M.M. (1995). Histone H4 and the maintenance of
genome integrity. Genes Dev. 9, 1716–1727.
Meluh, P.B., Yang, P., Glowczewski, L., Koshland, D., and Smith, M.M. (1998). Cse4p is a
component of the core centromere of Saccharomyces cerevisiae. Cell 94, 607–613.
Nerusheva, O.O., Galander, S., Fernius, J., Kelly, D., and Marston, A.L. (2014). Tensiondependent removal of pericentromeric shugoshin is an indicator of sister chromosome
biorientation. Genes & Development 28, 1291–1309.
Ng, T.M., Lenstra, T.L., Duggan, N., Jiang, S., Ceto, S., Holstege, F.C.P., Dai, J., Boeke, J.D.,
and Biggins, S. (2013). Kinetochore Function and Chromosome Segregation Rely on Critical
Residues in Histones H3 and H4 in Budding Yeast. Genetics 195, 795–807.
Paulson, J.R., and Taylor, S.S. (1982). Phosphorylation of histones 1 and 3 and nonhistone high
mobility group 14 by an endogenous kinase in HeLa metaphase chromosomes. J. Biol. Chem.
257, 6064–6072.
Peplowska, K., Wallek, A.U., and Storchova, Z. (2014). Sgo1 Regulates Both Condensin and
Ipl1/Aurora B to Promote Chromosome Biorientation. PLoS Genetics 10, e1004411.
Pinsky, B.A., and Biggins, S. (2005). The spindle checkpoint: tension versus attachment. Trends
in Cell Biology 15, 486–493.
Ramachandran, S., and Henikoff, S. (2015). Replicating nucleosomes. Science Advances 1,
e1500587–e1500587.
Santaguida, S., and Amon, A. (2015). Short- and long-term effects of chromosome missegregation and aneuploidy. Nature Reviews Molecular Cell Biology 16, 473–485.
Sharma, S.K., Yamamoto, M., and Mukai, Y. (2016). Dual modified antiphospho (Ser10)-acetyl
(Lys14)-histone H3 predominantly mark the pericentromeric chromatin during mitosis in
monokinetic plants. Journal of Genetics 95, 965–973.
Sherman, F. (1991). Getting started with yeast. Meth. Enzymol. 194, 3–21.

69

Slater, M.L. (1973). Effect of reversible inhibition of deoxyribonucleic acid synthesis on the
yeast cell cycle. J. Bacteriol. 113, 263–270.
Spencer, F., Gerring, S.L., Connelly, C., and Hieter, P. (1990). Mitotic chromosome transmission
fidelity mutants in Saccharomyces cerevisiae. Genetics 124, 237–249.
Verdaasdonk, J.S., Gardner, R., Stephens, A.D., Yeh, E., and Bloom, K. (2012). Tensiondependent nucleosome remodeling at the pericentromere in yeast. Molecular Biology of the Cell
23, 2560–2570.
Wang, X., and Dai, W. (2005). Shugoshin, a guardian for sister chromatid segregation.
Experimental Cell Research 310, 1–9.
Wieland, G., Orthaus, S., Ohndorf, S., Diekmann, S., and Hemmerich, P. (2004). Functional
complementation of human centromere protein A (CENP-A) by Cse4p from Saccharomyces
cerevisiae. Mol. Cell. Biol. 24, 6620–6630.
Williams, S.J., Abrieu, A., and Losada, A. (2017). Bub1 targeting to centromeres is sufficient for
Sgo1 recruitment in the absence of kinetochores. Chromosoma 126, 279–286.
Yamagishi, Y., Sakuno, T., Shimura, M., and Watanabe, Y. (2008). Heterochromatin links to
centromeric protection by recruiting shugoshin. Nature 455, 251–255.
Yamagishi, Y., Honda, T., Tanno, Y., and Watanabe, Y. (2010). Two histone marks establish the
inner centromere and chromosome bi-orientation. Science 330, 239–243.
Zhang, W., Bone, J.R., Edmondson, D.G., Turner, B.M., and Roth, S.Y. (1998). Essential and
redundant functions of histone acetylation revealed by mutation of target lysines and loss of the
Gcn5p acetyltransferase. EMBO J. 17, 3155–3167.
Zhang, Q., Chakravarty, S., Ghersi, D., Zeng, L., Plotnikov, A.N., Sanchez, R., and Zhou, M.-M.
(2010). Biochemical Profiling of Histone Binding Selectivity of the Yeast Bromodomain Family.
PLoS ONE 5, e8903.

70

CHAPTER 3:

NOVEL FUNCTIONAL AND REGULATORY DOMAINS OF SHUGOSHIN 1 IN
SACCHAROMYCES CEREVISIAE

(Manuscript in preparation)

Christopher J. Buehl1, Jianjun Luo2,*, Xiexiong Deng2, and Min-Hao Kuo1,2

1Cell

and Molecular Biology Program, and 2Department of Biochemistry and Molecular Biology,

Michigan State University, East Lansing, MI 48824

*Present address: Institute of Biophysics, Chinese Academy of Sciences, Beijing, China

71

Abstract

Successful partitioning of duplicated sister chromatids during mitosis requires each kinetochore
to be captured by an opposing pole to achieve biorientation. The resultant tension between
cohesin-linked sister chromatids is a prerequisite for transitioning from metaphase to anaphase.
A critical, well-conserved protein for tension sensing in budding yeast is the Shugoshin 1 protein
(Sgo1p). This protein interacts with a previously described domain in histone H3, the tension
sensing motif (TSM). Sgo1p contains two functional domains, the N’ coiled coil domain and the
C’ basic domain. These domains govern interactions with downstream SAC effector proteins and
Sgo1p localization, respectively. The regions of Sgo1p that regulate its chromatin interaction and
tension sensing remain elusive. Analysis of truncation alleles of Sgo1p in this work showed that
deletion into the N’ coiled-coil domain (residues 43-88) renders the Sgo1p non-functional.
Shortening Sgo1p from the C’ end is functionally more tolerable. However, C’ truncation to
smaller than 411 residues (out of 590 amino acids) ablates the normal pericentric accumulation
and results in the anticipated benomyl hypersensitivity. Surprisingly, further truncations to K337
and Y317 rescue mitotic defects of tsm– mutants without apparent restoration of the pericentric
enrichment of Sgo1p. These results reveal for the first time that the pericentric accumulation of
Sgo1p is separable from its tension sensing function. Removing a likely negative regulatory
motif between 337 and 363 liberates a TSM-bypassing function. Together, these findings reveal
novel functional motifs of Sgo1p that are intimately involved in Sgo1p localization and tension
surveillance.

72

Introduction

The faithful segregation of sister chromatids during mitosis is essential to maintaining a viable
cell population. A critical conserved checkpoint that must be satisfied to pass from metaphase
into anaphase is the Spindle Assembly Checkpoint (SAC). This checkpoint monitors both
attachment of spindle microtubules to the kinetochores of chromosomes as well as the physical
force of tension between sister chromatids (Lew and Burke 2003; Pinsky and Biggins 2005;
Silva et al. 2011). Bipolar attachment of spindle microtubules results in opposing poleward
forces, generating the crucial signal of tension. The conserved eukaryotic family of proteins
essential for tension sensing are Shugoshin, of which there is one (Sgo1p) in budding yeast
(Katis et al. 2004; Kitajima et al. 2004; Marston et al. 2004).

In S. pombe, Sgo1p is recruited to centromere by Bub1 kinase-mediated phosphorylation of
histone H2A and by interactions with heterchromatin marker HP1 (Kawashima et al. 2010;
Yamagishi et al. 2010). The budding yeast S. cerevisiae does not possess these heterochromatin
marks, and therefore centromeric Bub1p-mediated H2A phosphorylation drives Sgo1p chromatin
association (Fernius and Hardwick 2007; Kawashima et al. 2010). Chromatin-bound Sgo1p
prevents entry into anaphase through two different pathways. Sgo1p recruits the chromosomal
passenger complex (CPC) to the centromere where phosphorylation of multiple kinetochore
proteins by the kinase component of the CPC, Ipl1p, destabilizes spindle microtubule
attachments (Indjeian et al. 2007; Kiburz et al. 2008). This creates unattached kinetochores,
which activates other components of the SAC and prevents transition into anaphase. In addition,
Sgo1p also recruits protein phosphotase 2A (PP2A) to protect and maintain pericentric cohesin
(Xu et al. 2009; Eshleman and Morgan 2014). Phosphorylation of the cohesin component Mcd1p
by Cdc5p targets cohesin cleavage by separase (Esp1p in budding yeast) (Alexandru et al. 2001).
PP2A is recruited in a Sgo1p-dependent manner to centromeric chromatin to dephosphorylate
Mcd1p and stabilize cohesin, and in this way prevent premature sister chromatid separation (Xu
73

et al. 2009). Through these two functions, Sgo1p maintains cells in metaphase. Upon
biorientation, tension is generated between sister chromatids, and Sgo1p is evicted from
chromatin (Nerusheva et al. 2014). Tension-dependent conformational changes in chromatin
structure may be the cause of Sgo1p chromatin disassociation (Haase et al. 2012; Verdaasdonk et
al. 2012).

The role of Sgo1p in mitosis is well established, but the domains of Sgo1p required for
pericentric interaction are poorly understood. Sgo1p has two well conserved domains, the N’
coiled-coil domain and the C’ basic domain. The N’ coiled-coil domain is important for
homodimerization, PP2A interaction, and CPC localization (Xu et al. 2009; Tsukahara et al.
2010; Peplowska et al. 2014). The C’ basic region of Sgo1p physically interacts with
phosphorylated histone H2A at the centromere, and in S. pombe facilitates binding to HP1 in
heterochromatin (Yamagishi et al. 2008; Kawashima et al. 2010). These two domains are integral
to interaction with downstream SAC proteins (through the N’ coiled-coil domain) and chromatin
localization (through the C’ basic domain). Recent work has also identified a destruction box
motif (494NKSEN) in the C’ of the protein that is important for Sgo1p ubiquitination and
degradation by the Anaphase Promoting Complex (APC) (Fu et al. 2007; Eshleman and Morgan
2014). However, the residues of Sgo1p responsible for pericentric chromatin binding remains
elusive.

We have previously reported a critical motif in histone H3, termed the tension sensing motif
(TSM), which is integral to Sgo1p recruitment to pericentric chromatin (Luo et al. 2010; Luo et
al. 2016). The TSM, 42KPGT of histone H3, provides a primary site of Sgo1p binding on the
chromatin. In a tsm– background, Sgo1p enrichment at pericentric regions is abolished. In this
chapter, we generated random alleles of Sgo1p to perform a screen for Sgo1p mutations that
could act as tsm– suppressors. We isolated a suppressor allele of Sgo1p that possessed a
premature stop codon at residue 317 that generates a mutant allele which partially rescues a tsm–
74

mitotic defect. Domain mapping of Sgo1p revealed deletion of residues 337-590, but not the
deletion of 364-590, suppressed tsm– benomyl hypersensitivity. In addition, we demonstrate that
pericentric accumulation of Sgo1p requires residues 364-410, and that disruption of the N’
coiled-coil domain results in severe mitotic defects. Together, these findings reinforce the
importance of the N’ coiled-coil domain and C’ basic region, and suggest that the 337-363 region
of Sgo1p may contain a negative regulatory domain for Sgo1p tension monitoring in S.
cerevisiae.

75

Materials and Methods

Yeast strains and plasmid constructs

The yeast strains, plasmids, and oligos used in this study are listed in Tables 3-1, 3-2, and 3-3,
respectively.

Yeast growth media and conditions were based on standard procedures (Sherman 1991). Yeast
transformations were performed by the lithium acetate method (Gietz et al. 1992). When
appropriate, 5% casamino acids were substituted in synthetic amino acid mixtures for uracil,
tryptophan, and adenine prototrophs. ChIP experiments were performed as previously described
(Kuo and Allis 1999). Western blotting was performed as described in reference (Luo et al.
2010).

Sgo1p allele construction

To screen for Sgo1p mutations capable of rescuing H3 G44S or G44A benomyl hypersensitivity,
error-prone PCR amplification was utilized to introduce random mutations into the SGO1 ORF.
Primers MHK98 and MHK99 were used to amplify SGO1 ORF from pJL53 in a mixture of 1x
PCR reaction buffer, 7 mM MgCl2, 1 mM dNTP mixture, 0.4 µM primers, 0.4 mM MnCl2, and
0.05 units/µL DNA polymerase. The PCR program was 30 cycles of 94º for 1 min, 45º for 1 min,
and 72º for 2 min. The PCR product was subsequently gel purified and co-transformed with a
NotI linearized basal expression plasmid (pJL52) into either H3 G44S or G44A mutant cells with
a !sgo1 background (strains yJL170 and yJL431). Transformants able to suppress the benomyl
hypersensitivity caused by both !sgo1 and H3 G44S or G44A were processed for further
analyses. Selected transformants were patched onto YPD and YPD supplemented with 20 µg/mL
benomyl to screen for potential suppressors. For positive suppressors, 5-FOA selection was
76

Table 3-1: Yeast strains used in this study

Strain

Relevant genotype

Source or
reference

yCB033

MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1::sgo1::TRP1 This study
ura3-1 hht1-hhf1::KAN hht2-hhf2::KAN hta1-htb1::Nat hta2-

yCB319

htb2::HPH pQQ18 [ARS CEN LEU2 HTA1-HTB1 HHT2-HHF2]
MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1::sgo1::TRP1 This study
ura3-1 hht1-hhf1::KAN hht2-hhf2::KAN hta1-htb1::Nat hta2htb2::HPH pMK439 K42A [ARS CEN LEU2 HTA1-HTB1 hht2-

yCB321

K42A-HHF2]
MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1::sgo1::TRP1 This study
ura3-1 hht1-hhf1::KAN hht2-hhf2::KAN hta1-htb1::Nat hta2htb2::HPH pMK439 T45A [ARS CEN LEU2 HTA1-HTB1 hht2-

yJL145

T45A-HHF2]
MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 hht1- Luo et al. 2010
hhf1::KAN hht2-hhf2::KAN hta1-htb1::Nat hta2-htb2::HPH

yJL170

pMK439 G44S [ARS CEN LEU2 HTA1-HTB1 hht2-G44S-HHF2]
MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1::sgo1::TRP1 This study
ura3-1 hht1-hhf1::KAN hht2-hhf2::KAN hta1-htb1::Nat hta2htb2::HPH pMK439 G44S [ARS CEN LEU2 HTA1-HTB1 hht2-

yJL345

G44S-HHF2]
MATa ade2-1 can1-100 his3-11,15 leu2-3,112
trp1-1::SGO1-6HA::TRP1 ura3-1 hht1-hhf1::KAN hht2hhf2::KAN hta1-htb1::Nat hta2-htb2::HPH pQQ18 [ARS CEN
LEU2 HTA1-HTB1 HHT2-HHF2]

77

Luo et al. 2010

Table 3-1 (cont’d)

yMK1243 MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 hht1- Luo et al. 2010
hhf1::KAN hht2-hhf2::KAN hta1-htb1::Nat hta2-htb2::HPH

yXD133

pQQ18 [ARS CEN LEU2 HTA1-HTB1 HHT2-HHF2]
MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1:: sgo1

This study

Y317X-6HA::TRP1 ura3-1 hht1-hhf1::KAN hht2-hhf2::KAN hta1htb1::Nat hta2-htb2::HPH pQQ18 [ARS CEN LEU2 HTA1-HTB1

yXD134

HHT2-HHF2]
MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1:: sgo1
Y317X-6HA::TRP1 ura3-1 hht1-hhf1::KAN hht2-hhf2::KAN hta1htb1::Nat hta2-htb2::HPH pMK439 G44S [ARS CEN LEU2
HTA1-HTB1 hht2-G44S-HHF2]

78

This study

Table 3-2: Plasmid constructs used in this study

Plasmid

Main features

Source or reference

pCB034

pGEX-4T-1 6His-SUMO

This paper

pCB035

pGEX-4T-1 6His-SUMO-SGO1

This paper

pCB036

pGEX-4T-1 6His-SUMO-sgo1 Y317X

This paper

pCB045

pGEX-6T-1 GST-[2-38 HHT2]

This paper

pCB096

ARS CEN URA3 pADH1-3HA-sgo1 Y317X-tADH1

This paper

pJL52

ARS CEN URA3 pADH1-tADH1

Luo et al. 2010

pJL53

ARS CEN URA3 pADH1-3HA-SGO1-tADH1

Luo et al. 2010

pMK120

2 µm URA3 vector with CUP1 promoter

Kuo et al. 1998

pMK144

2 µm URA3 pCUP1-GCN5

Kuo et al. 1998

pMK144 E/H 2 µm URA3 pCUP1-gcn5 E173H

Kuo et al. 1998

pMK439

Luo et al. 2010

pRS315-HTA1-HTB1 HHT2-HHF2

79

Table 3-3: Oligos used in this study

Oligo

Sequence

CEN1 AS

CTTAAGAGTTCTGTACCAC

CEN1 S

CAGCTTCAATAACTC

CEN16-6.4

AGGGAAGAAGTGATTTGGC

CEN16-6.4as

GATAGCGTATTAGGACTAC

CEN16+1.7

GGCAGAAATAGCCGCCTAAG

CEN16+1.7as

GCAAACGAAGCATTCTTG

CEN16+4

GCCCTGATAAAGTCGACC

CEN16+4as

GAACTCTTGCAAGTTGAAG

MHK98

CAAGTATAAATAGACCTG

MHK99

GCCGACAACCTTGATTGG

OJL19

TGTCATCATGCGTATTAGAG

OJL20

CGTATAGGGAATTTAACGTC

oXD70

GCATAAGTGTGCCTTAGTATG

oXD71

GCGCTTGAAATGAAAGCTCCG

80

applied to remove the plasmid bearing mutant sgo1 to verify the plasmid dependency of the
rescue. Plasmid DNA was then extracted, sequenced, and re-transformed into !sgo1 H3 G44S or
G44A mutant cells. Spot assays and chromatin immunoprecipitation approaches were then
followed to characterize Sgo1p suppressors. Domain mapping was performed by PCR
amplification of the selected regions of Sgo1p from pJL53, and co-transformation with NotIlinearized pJL52 was performed as described above.

Chromatin fractionation

100 mL of logarithmically growing yeast strains were pelleted, washed with sterile water, and
resuspended in 5 mL 0.1 M Tris pH 9.4, 10 mM DTT. Cells were incubated at room temperature
for 15 minutes and pelleted. Cells were then washed once with spheroplasting buffer (1 M
sorbitol, 50 mM potassium phosphate pH 7.2, 14 mM #-mercaptoethanol) and pelleted. Pellets
were resuspended in 5 mL spheroplasting solution (1 M sorbitol, 50 mM potassium phosphate
pH 7.2, 50 units/mL lyticase, 1 mM PMSF, 1 µg/mL leupeptin, 1 µg/mL pepstatin A, 14 mM #mercaptoethanol) and incubated at 30º until spheroplasting was $80% as measured by a
spectrophotometer. Cells were then pelleted and washed with with 10 mL spheroplasting buffer
supplemented with 1 mM PMSF, 1 µg/mL leupeptin, 1 µg/mL pepstatin A. Nuclei were isolated
by washing three times with nuclear isolation buffer (0.25 M sucrose, 60 mM KCl, 5 mM MgCl2,
1 mM CaCl2, 15 mM MES pH 6.6, 1 mM PMSF, 1 µg/mL leupeptin, 1 µg/mL pepstatin A, 0.8%
Triton X-100). Pellets were then washed sequentially with 100 mM NaCl, 500 mM NaCl, 1 M
NaCl, and 1 M NaCl/1% Triton at room temperature for 10 minutes.

Protein expression and purification

To express and purify 6His-SUMO-tagged proteins from E. coli, 100 mL BL21–CodonPlus E.
coli cells were induced (at optical density 0.5 -0.6 in LB + 50 µg/mL Kanamycin) with 1 mM
81

IPTG at 16º for 16 hours. Cells were pelleted (5,000 x g, 5 min, 4º) and resuspended in 10 mL
Lysis/Sonication Buffer (300 mM NaCl, 50 mM Na2HPO4, 1 mM DTT, 1 mM PMSF, 1 mg/mL
lysozyme) and incubated on ice for 30 minutes, then flash frozen and thawed twice. Cells were
then sonicated six times, 15-second bursts, with 1 minute on ice in between rounds of sonication.
Debris was pelleted at 10,000 rpm, 15 minutes, 4º and the soluble fraction was transferred to a
new tube and mixed with 5 mL Ni-NTA beads for purification of 6His-SUMO tagged proteins.
Beads were incubated at 4º for 1 hour, washed twice with 10 mL wash buffer (300 mM NaCl, 50
mM Na2HPO4, 1 mM DTT, 1 mM PMSF, 10% glycerol) at pH 6.0, and once with 10 mL wash
buffer at pH 5.5. 6His-SUMO was eluted with 6 mL wash buffer at pH 4.0 + 200 mM imidazole,
and pH was neutralized with 300 µL 1 M Na2HPO4. Purification of H3(2-28)-GST proteins was
the same except the soluble fraction was mixed with 200 µL glutathione Sepharose beads, and
sequentially washed with IPP-150 (10 mM Tris pH 8.0, 150 mM NaCl, 0.1% NP-40, 1 mM DTT,
1 mM PMSF), and eluted with IPP-150 + 15 mM reduced glutathione at 4º for 1 hour. All
proteins yield and purity were assessed by SDS-PAGE analysis.

GST pulldown assay

H3(2-28)-GST or GST was bound to glutathione Sepharose beads in IPP-150 for 1 hour at 4º.
Beads were then mixed with equivalent moles of 6His-SUMO-Sgo1p, 6His-SUMO-Y317X
Sgo1p, or 6His-SUMO and incubated for 2 hours at 4º. Beads were washed four times with
IPP-150, and retained proteins was eluted by boiling with SDS-PAGE loading dye and analyzed
by western blot.

82

Results

Screen for Sgo1p suppressors of H3 G44S tension sensing defect

The TSM of histone H3 consists of 42KPGT, with alanine substitutions of K42, G44, or T45
causing loss of Sgo1p from the pericentric regions of chromatin and consequently the defects of
detecting and/or responding to the lack of tension between sister chromatids in the metaphase of
mitosis (Luo et al. 2010; Luo et al. 2016). These tsm– mutations inhibit H3-Sgo1p interaction
both in vivo and in vitro. Chapter 2 shows that K14A and K23A mutations in the N’ tail domain
act as intragenic suppressors for tsm– mutations of K42A and G44S on the same histone
molecule through increasing the overall chromatin association of Sgo1p. The pericentric
abundance of Sgo1p also increases, thus restoring the cellular ability to monitor the
biorientation-derived tension at pericentric chromatin. These results reveal a backup docking site
on H3 for Sgo1p that becomes critical when TSM is mutated. To obtain deeper insights into the
H3-Sgo1p interaction for segregation, we embarked on a genetic screen for mutations in SGO1
that can bypass a damaged tsm–. Such mutations may help to identify the regulation on Sgo1p
pertaining to the functional and/or physical interaction with the TSM.

To isolate Sgo1p mutants that bypass the need for the TSM, error-prone PCR was conducted to
randomly introduce mutations to the open reading frame of SGO1 (Figure 3-1A). The sgo1!
cells bearing the G44S tsm– allele were transformed with the error-prone PCR products. This step
replaced the endogenous copy of SGO1 with a plasmid-borne version bearing random mutations.
Transformation colonies were patched and tested for their growth under the influence of
benomyl. H3 G44S sgo1! cells exhibit more severe benomyl hypersensitivity than either mutant
(Luo et al. 2010). Clones with benomyl resistance higher than the G44S single mutant were
considered as candidates. A former student (Jianjun Luo) performed the original screen and has
identified and sequenced five candidates. The mutations of these five alleles are shown in Figure
83

A

Error-Prone PCR

H3 G44S sgo1!

SGO1

Transform mutant
SGO1 alleles
Fig. B-2

B

O

50

100

150

200

250

300

350

400

450

500

550 590aa

SG01
L240S

109T
A5

S355R

M
N293S

N31D
A1

P483T

iL!..
D248E

S53
M215L
S68

K345E

D248N

P353L

T324A

N539K

H404R

UJJt
Y317X

S71

L490F

D519G

ir

Figure 3-1: Sgo1p suppressors of H3 G44S benomyl hypersensitivity.

FIG. B-2. Schematic list of mutations identified
in the intra-genic suppressor
84
screen.

Figure 3-1 (cont’d)

C

YPD

10 !g/mL
Benomyl

WT H3 sgo1! + EV

1

WT H3 sgo1! + Sgo1p

2

WT H3 sgo1! + Y317X Sgo1p

3

H3 G44S sgo1! + EV

4

H3 G44S sgo1! + Sgo1p

5

H3 G44S sgo1! + Y317X Sgo1p

6

A) Mutations were randomly generated in SGO1 by error prone PCR and assessed for
suppression of H3 G44S benomyl hypersensitivity. B) Suppressors were sequenced and the
mutations were mapped on the Sgo1p sequence. C) Logarithmically growing cultures with the
indicated backgrounds were serially diluted and spotted onto YPD or YPD containing indicated
benomyl concentration.

85

3-1B. Each allele has more than one mutation except S71, which contains a premature stop
codon at residue Y317. Translational termination at this position renders the downstream D591G
mutation irrelevant. For this simplicity, we therefore focused our research on the truncation allele
Y317X. Figure 3-1C demonstrates that the Y317X allele can indeed confer resistance to benomyl
in the G44S cells (rows 5 and 6). Intriguingly, in the presence of a functional TSM, Y317X
appears to cause a slight increase of benomyl hypersensitivity (rows 2 and 3), suggesting that a
part of Sgo1p function was lost, yet this change benefits cells coping with the stress of a
disrupted TSM.

Y317X Sgo1p rescues benomyl hypersensitivity of K42A and T45A tsm–

The TSM consists of 42KPGT (Luo et al. 2016), with alanine substitutions to any one residue
except P43 compromising the SAC. In order to assess if Y317X Sgo1p was a general suppressor
of tsm–, we tested Y317X Sgo1p rescue of mitotic defects in K42A and T45A strains (Figure
3-2). Y317X Sgo1 is a strong suppressor of benomyl hypersensitivity in all TSM mutants tested.
Strikingly, Y317X Sgo1p is able to restore benomyl resistance to the very severely sick T45A
strain. T45A displays a greater benomyl hypersensitivity phenotype than either K42A or G44S
(Luo et al. 2016), potentially due to a role of T45 phosphorylation in DNA replication (Dai et al.
2008; Baker et al. 2010; Kawashima et al. 2011). Other suppressors, such as "gcn5 or H3 K14A,
only weakly restore benomyl resistance in this background (Luo et al. 2016; see Chapter 2).
Together, these data demonstrate that Y317X Sgo1p is a potent suppressor of tsm– mitotic defects
and is able to bypass the requirement for the TSM for tension sensing.

Y317X Sgo1p is recruited to the centromere, but not pericentric chromatin

The mitotic defects of tsm– mutants are accompanied by a loss of a pericentric population of
Sgo1p. These mitotic phenotypes can be rescued by restoring Sgo1p to the pericentric chromatin
86

WT H3 sgo1!

H3 K42A sgo1!

H3 G44S sgo1!

H3 T45A sgo1!

EV

YPD

Sgo1p
Y317X
Sgo1p

EV

10 !g/mL
Benomyl

Sgo1p
Y317X
Sgo1p

Figure 3-2: Y317X Sgo1p suppresses benomyl hypersensitivity of tsm–. Low copy expression
plasmids of either Sgo1p or Y317X Sgo1p were inserted into H3 K42A, G44S, or T45A mutants
and assessed for benomyl sensitivity.

87

either by bromodomain fusion, or through H3 K14A mutation (Luo et al. 2010; see Chapter 2).
One possible reason underlying the Y317X suppression is the restoration of Sgo1p interaction
with pericentric chromatin. Alternatively, the rescue of alanine and serine substitutions of the
three key residues of TSM (Figure 3-2) argue that Y317X Sgo1p suppresses the mitotic defects
of tsm– without the restoration of physical interaction with the mutant TSM. To test these two
hypotheses, we assessed the localization of full-length and Y317X Sgo1p by chromatin
immunoprecipitation (ChIP) in wild-type and H3 G44S backgrounds. The results, shown in
Figure 3-3, revealed that Y317X Sgo1p is efficiently recruited to the centromeres of both wildtype and G44S strains, demonstrating truncation did not abolish interaction with the centromere.
Pulldown assays also demonstrate that Y317X Sgo1p specifically binds to the centromere
specific H3 variant Cse4p (T. Hazbun, personal communication). However, Y317X Sgo1p did
not accumulate in the pericentric region of either wild-type or G44S H3 backgrounds. The
absence of pericentric Y317X Sgo1p even in the wild-type H3 background suggested that the
loss of residues 317-590 removes the region for pericentric recruitment. This finding supports the
hypothesis that Y317X Sgo1p rescues tsm– mitotic defects independent of physical interaction
with the mutant TSM. On the contrary, Y317X Sgo1p remains centromere bound, indicating the
major domain for centromere localization resides in the N’ two-thirds of Sgo1p.

Maintaining the centromeric Sgo1p alone apparently is insufficient for tension sensing as tsm–
strains still keep Sgo1p at centromeres. The Y317X truncation thus likely assumes a new
function that, despite the inability to stay at pericentric regions, complements the defective tsm–
mutations. To begin to understand the mechanism of Y317X function, we first checked whether
it is associated with the chromatin by differential salt and detergent washes of nuclear proteins.
Chromatin bound proteins are often insoluble in low salt conditions due to their charge-based
interaction with chromatin (Travis et al. 1984; Herrmann et al. 2017). As salt concentration is
increased, these interactions are disrupted, and chromatin bound proteins are eluted. Fractions
were analyzed by Western blot and are shown in Figure 3-4. Both Sgo1p and Y317X Sgo1p were
88

WT H3

H3 G44S

No Ab Sgo1 Y317X Sgo1 Y317X

Input

CEN1
CEN16
R1.7
CEN16
R4.0

SPT15
Figure 3-3: Y317X Sgo1p binds at the centromere, but does not accumulate in the
pericentric region of chromatin. Exponentially growing cells of the indicated H3 backgrounds
were harvested and utilized for ChIP analysis of Sgo1p localization. ChIP DNA was analyzed by
semi-quantitative PCR with primers specific to the marked loci. Stars indicate the internal
control DED1.

89

NaCl: 100 mM 500 mM

1M

1 M/
1% Triton

Pellet

Sgo1p
Y317X
Sgo1p
H3
Figure 3-4: Sgo1p and Y317X Sgo1p are extracted from chromatin at similar salt
concentrations as histone H3. Fractions were assessed by immunoblotting for 6His (Sgo1p and
Y317X Sgo1p) or histone H3.

90

present in the 500 mM and 1 M NaCl fractions, similar to the histone H3. These results
supported the notion that both Sgo1p and Y317X Sgo1p are nuclear and chromatin-bound, and
are only removed when nucleosomes are disrupted. Taken together, Figures 3-3 and 3-4
demonstrate that Y317X Sgo1p is recruited to centromeres and chromatin associated, but not
enriched on pericentric chromatin.

Y317X Sgo1p physically interacts with the H3 tail domain

Y317X Sgo1p is capable of partially rescuing the mitotic defects of tsm–, demonstrating the
truncation allows Y317X to bypass the requirement for an intact TSM. Fractionation experiments
demonstrated that Y317X Sgo1p is chromatin associated, therefore Y317X may bind an
alternative site on chromatin to monitor tension. We have previously shown an important
auxiliary role for the histone H3 tail in Sgo1p recruitment to chromatin as well as SAC function
(see Chapter 2). Sgo1p specifically binds to a H3 tail peptide, and we propose that the H3 tail
domain provides a secondary binding site that becomes essential when the TSM is crippled. We
hypothesized that Y317X Sgo1p interacts with chromatin and rescues tsm– mitotic defects
through interactions with the H3 tail. To test this theory, Y317X Sgo1p suppression of benomyl
hypersensitivity was tested in H3 G44S strains lacking the H3 tail domain (Figure 3-5A). The
deletion of the H3 tail negates the Y317X suppression (compare rows 3 and 6), supporting the
hypothesis that Y317X interactions with the H3 tail mediate the restoration of tension
surveillance. In order to test if Y317X Sgo1p can specifically bind the H3 tail, H3(2-28)-GST
fusion proteins were prepared and used for pulldown assays. Figure 3-5B shows that
recombinant Y317X Sgo1p, similar to full length Sgo1p, binds to the histone H3 tail, supporting
a model in which Y317X Sgo1p also utilizes the H3 tail as a binding site. Gcn5p acts as a
negative regulator of Sgo1p-TSM interaction (Luo et al. 2016), and this regulation is coordinated
through lysine residues on the H3 tail domain (see Chapter 2). As Y317X requires the H3 tail
domain for tsm– suppression, and can physically bind to the H3 tail, we posited that Y317X
91

A

YPD

10 !g/mL
Benomyl

H3 G44S sgo1! + EV

1

H3 G44S sgo1! + Sgo1p

2

H3 G44S sgo1! + Y317X Sgo1p

3

H3 "N G44S sgo1! + EV

4

H3 "N G44S sgo1! + Sgo1p

5

H3 "N G44S sgo1! + Y317X Sgo1p

6

B

H3 N’

GST

5% Input
Sgo1

Y317X

Sgo1

Y317X Sgo1

H3 N’

GST

5% Input

SUMO
WB: !-6His
Figure 3-5: Y317X Sgo1p genetically and physically interacts with the H3 tail and is
rescued from benomyl hypersensitivity by E173H gcn5– similar to full-length Sgo1p.

92

Figure 3-5 (cont’d)

C

WT

Y317X Sgo1p

G44S H3

G44S H3
Y317X Sgo1p

EV

1

Gcn5p

2

E173H
Gcn5p

3

EV

4

Gcn5p

5

E173H
Gcn5p

6

YPD

10 !g/mL
Benomyl

A) Strains with the indicated H3 and Sgo1p backgrounds were assessed for benomyl
hypersensitivity. B) H3(2-28)-GST peptide was bound to glutathione Sepharose beads, and
utilized to pulldown 6His-SUMO tagged Sgo1p proteins. Bound proteins were analyzed by
immunoblotting for the 6His tag. C) Strains with the indicated H3 and Sgo1p status were
transformed with the noted Gcn5p overexpression plasmid. Benomyl hypersensitivity was
assessed by spot assay.

93

Sgo1p would also be subject to Gcn5p negative regulation. As can be seen in Figure 3-5C, the
benomyl hypersensitivity of H3 G44S is suppressed by the HAT-deficient Gcn5p allele, E173H
(see G44S H3 row 6). Y317X Sgo1p also suppresses H3 G44S benomyl hypersensitivity
independent of Gcn5p status (see Y317X Sgo1p G44S H3 row 4-5), but the introduction of the
E173H gcn5– allele rescues benomyl hypersensitivity with equal strength to full-length Sgo1p
(see row 6). This result indicates that Y317X interaction with the histone H3 tail may be
subjected to the same Gcn5p-mediated regulation as Sgo1p. Together these data support a model
in which Y317X Sgo1p interacts with chromatin through the H3 tail domain.

Mapping novel Sgo1p domains

The truncation of Y317X Sgo1p deletes approximately one third of the Sgo1p amino acid
sequence, including the well conserved C’ basic domain and the destruction box motif. The C’
basic domain is important for localization of Sgo1p to chromatin (Fernius and Hardwick 2007;
Yamagishi et al. 2008; Kawashima et al. 2010), while the destruction box motif is ubiquitinated
by the APC to target Sgo1p for degradation upon entering anaphase (Fu et al. 2007; Eshleman
and Morgan 2014). In order to investigate the impact of these domains on tsm– suppression as
well as uncover novel domains of Sgo1p involved in tension surveillance, we generated a series
of truncations of Sgo1p (Figure 3-6). The protein disorder prediction system (PrDOS) (Ishida
and Kinoshita, 2007) was utilized to map predicted disordered regions of Sgo1p. Sgo1p is largely
an unstructured protein, with the majority of the amino acid sequence predicted to be unfolded.
Truncations were generated to include these ordered regions, and to assess the potential role of
the intervening unfolded regions, which are often sites of regulation through posttranslational
modifications (Zhang et al. 2007; Mittag et al. 2011; Kurotani et al. 2014).

sgo1! strains expressing truncated Sgo1p alleles from low-copy expression plasmids were first
assessed for benomyl sensitivity, as shown in Figure 3-7A. In a wild-type H3 background, Sgo1p
94

Shugoshin N Coiled Coil
Domain (43-88)

Shugoshin C basic
region (364-390)

D Box Motif
(494-498)

1.0
0.9
0.8

disorder probability

0.7
0.6
0.5
0.4
0.3
0.2
0.1
0.0

Prediction
Threshold
(FP rate= 5.0%)

0

50

100

150

200

250
300
350
residue number

1-590
1-150
1-316
1-336
1-363
1-390
1-411
1-523
52-316
128-316

400

450

500

550

WT

G44S

+++
ø
++
++
++
++
+++
+++
ø
ø

+
ø
+++
+++
+
+
+
+
ø
ø

Figure 3-6: Sgo1p truncations created based on the predicted disordered regions of the fulllength protein. PrDOS disorder prediction of each residue of Sgo1p. Points above the red line
are predicted to be part of disordered regions. Below are schematic representations of Sgo1p
truncations, along with the scored benomyl resistance of these alleles in both wild-type (WT) H3
and G44S backgrounds.

95

A

10 !g/mL
Benomyl

YPD

H3 G44S
10 !g/mL
Benomyl

WT Sgo1

1

1-150

2

1-316

3

1-336

4

1-363

5

1-390

6

1-411

7

1-523

8

X

2X

T5
24

41
N

91
X

7X

64
X

S3

S3

7X

33

o1
p

31
Y

Sg

X

2X

T5
24

41

91
X

H3 G44S
N

7X

64
X

S3

S3

7X
31

33
K

Y

Sg

o1
p

WT H3

K

B

Non-specific

WB: !-HA

Figure 3-7: Truncations of Sgo1p suppress H3 G44S benomyl hypersensitivity, but result in
benomyl sensitivity in wild-type H3. A) Spot assays were performed as previously described in
both wild-type H3 sgo1! and G44S H3 sgo1! backgrounds. B) Expression levels of truncated
3HA-Sgo1p were analyzed by immunoblotting for the HA tag. The bottom bands are nonspecific signal.

96

C’ truncations up to residue 412 appeared to be phenotypically neutral. However, further deletion
to residue 390 and beyond caused increased benomyl sensitivity (rows 2 to 6, Figure 3-7A).
Strikingly, in a H3 G44S background, alleles 1-316 (equivalent to Y317X above) and 1-336
Sgo1p enhance benomyl resistance (see rows 3-4). The inclusion of residues 337-363 of Sgo1p
ablates the apparent suppression for H3 G44S. The 1-150 Sgo1p allele (row 2) appears to
generate nonfunctional protein, as the benomyl resistance of the strains is indistinguishable from
sgo1! (data not shown), suggesting the minimal functional domain extends beyond residue 150.
Similarly, deletions on the N’ of Sgo1p result in severe sensitivity to benomyl, likely due to the
disruption of the N’ coiled-coil domain (see 52-316 and 128-316 alleles). This finding is
consistent with the well characterized role of the coiled-coil domain in numerous protein-protein
interactions that have defined roles in SAC activation (Xu et al. 2009; Tsukahara et al. 2010;
Peplowska et al. 2014). A full summary of all truncated Sgo1p alleles is shown in Figure 3-6. To
ensure that the differences in benomyl resistance were not due to varied protein levels, we
prepared whole cell extracts and assayed Sgo1p levels by Western blots against the HA tag,
shown in Figure 3-7B. All truncated alleles of Sgo1p are expressed at similar levels,
demonstrating that benomyl resistance is not due to differences in protein expression or stability.
It should be noted that full length Sgo1p was not strongly detected in our immunoblots. In our
hands, full-length N’ HA-tagged Sgo1p is not well detected by immunoblotting, though C’ HAtagged Sgo1p can be readily detected (data not shown). It is possible that a portion of the C’
terminus on the full-length protein folds in a manner that occludes the N’ epitope, and diminishes
the signal during Western blotting. Taken together, Figures 3-6 and 3-7 demonstrate that N’
truncations cripple Sgo1p function, 1-316 and 1-336 Sgo1p are potent tsm– suppressors, and
suppression is not due to increased protein expression or stability.

97

Sgo1p C’ is required for pericentric localization

The 1-316 Sgo1p allele suppresses tsm– benomyl hypersensitivity without displaying pericentric
accumulation (Figures 3-1 through 3-3), though is still chromatin associated, likely with the H3
tail (Figures 3-4 and 3-5). We suspected that the truncation removed the residues of Sgo1p that
interact with the TSM, allowing 1-316 Sgo1p to function even in the absence of an intact TSM.
This raised the possibility that the loss of pericentric enrichment was intrinsically linked to
suppressor activity. To this end, we assessed the localization of the Sgo1p truncations at various
loci by ChIP (Figure 3-8A). Only 1-411, 1-523, and full-length Sgo1p are recruited to the
pericentric regions of wild-type H3 strains (quantified in Figure 3-8B). These data demonstrate
that the 391-411 region is required for pericentric enrichment. Both the suppressor alleles (1-316
and 1-336) as well as two non-suppressors (1-363 and 1-390) were not enriched on pericentric
chromatin. As both suppressor and non-suppressor alleles displayed the loss of pericentric
enrichment, the tsm– rescue is not linked to lack of pericentric accumulation. Consistent with our
previous results, no allele of Sgo1p is enriched in the pericentric regions of an H3 G44S strain.
In addition, all C’ truncations of Sgo1p assayed are enriched at the centromere (quantified in
Figure 3-8C), demonstrating that the C’ basic domain is not required for centromeric localization.
Taken together, Figures 3-7 and 3-8 reveal that the C’ basic region is
not required for centromeric recruitment, residues 391-411 are required for pericentric
enrichment, and residues 336-363 contain a region of Sgo1p important for suppression of tsm–
benomyl hypersensitivity.

98

WT H3

52
4
0.
1%
In

41
1
1-

39
0

1-

36
3
1-

33
6
1-

31
6
1-

N

o

Sg

o1
p

Ta
g

In

52
3

0.
1%

1-

41
1
1-

39
0

1-

36
3
1-

33
6
1-

1-

31
6

o1
p
Sg

N

o

Ta
g

pu
t

pu
t

G44S H3
1-

A

CEN1
CEN16
R1.7 kb
CEN16
L6.4 kb

CEN16 R1.7 kb

CEN16 L6.4 kb

6

6

5

5

4

4

3

3

2

2

1

1

0

0

No Tag
Sgo1p
1-316 Sgo1p
1-336 Sgo1p
1-363 Sgo1p
1-390 Sgo1p
1-412 Sgo1p

S
G
3
H

H
W
T

44

3

S

1-523 Sgo1p

44
G
3
H

W
T

H

3

Ratio to 0.1% Input

B

Figure 3-8: C’ region of Sgo1p is required for pericentric localization.

99

Figure 3-8 (cont’d)

C
CEN1
Ratio to 0.1% Input

25

20

Sgo1p

15

1-336 Sgo1p
10

1-363 Sgo1p
1-411 Sgo1p

5

44
G
3
H

W
T

H

3

S

0

A) Asynchronous cultures containing the indicated Sgo1p allele were used for ChIP analysis of
Sgo1p localization. Stars indicate the internal control DED1 locus. B) Quantification of
pericentric Sgo1p localization. Enrichment was normalized to internal control and then displayed
as fold change over input. Error bars represent standard error. Right panel represents a single
experiment. C) qPCR quantification of CEN1 Sgo1p enrichment of selected Sgo1p alleles. Data
are from one experiment.

100

Discussion

We have previously characterized the tension sensing motif (42KPGT) of histone H3 (Luo et al.
2016). tsm– disrupts pericentric Sgo1p binding, resulting in mitotic defects. Here, we define
residues of Sgo1p critical for tsm– suppression by performing error-prone PCR to generate Sgo1p
mutants that ameliorate the mitotic defects of a tsm– background. Surprisingly, a profound rescue
of H3 G44S benomyl hypersensitivity resulted from the insertion of a premature stop codon at
residue Y317 of Sgo1p. This benomyl resistance was not simply due to increased expression or
protein stability, as the Y317X Sgo1p is expressed at a level similar to other truncation mutants
that do not display tsm– suppression. The Y317X allele also rescued the benomyl hypersensitivity
of the K42A and T45A mutants, further strengthening the functional link between Sgo1p and the
TSM. In wild-type cells, Sgo1p binds both the centromere and pericentric chromatin (Kitajima et
al. 2005; Fernius and Hardwick 2007; Haase et al. 2012). However, our data demonstrated that
while Y317X Sgo1p is enriched at the centromere, it does not accumulate at pericentric regions
in either wild-type or H3 G44S backgrounds. Rather, chromatin fractionation data strongly
suggest that Y317X remains associated with chromatin. These results seemed incongruous with
the suppression of benomyl hypersensitivity, as G44S mitotic defects can be ameliorated through
the overexpression of Sgo1p, tethering Sgo1p to chromatin, and by an H3 K14A mutation, all of
which restore the presence of Sgo1p to pericentric chromatin. We favor a scenario that Y317X
Sgo1p still binds chromatin, but loses the preference for pericentric accumulation. Given that
Y317X Sgo1p binds the histone H3 tail, and that this domain functions as an auxiliary site for
Sgo1p binding (see Chapter 2), we suggest that Y317X Sgo1p bypasses the TSM requirement
through interactions with the histone H3 tail. Y317X Sgo1p cannot rescue the H3 G44S benomyl
hypersensitivity in the absence of the H3 tail, supporting the requirement for the H3 tail in
suppression. The mitotic defects of a tsm– background can be suppressed by the introduction of
the E173H gcn5– allele, which inhibits H3 tail acetylation and restores a pericentric Sgo1p
population. This suppressor also rescues a Y317X Sgo1p H3 G44S strain with similar strength to
101

full-length Sgo1p, suggesting Y317X Sgo1p also benefits from the loss of Gcn5p-mediated tail
acetylation to restore mitotic fidelity.

Domain mapping revealed that the suppression of H3 G44S benomyl hypersensitivity is lost with
the addition of residues 336-363. Both 1-336 and 1-363 Sgo1p alleles are not localized to the
pericentric region, suggesting the 1-336 Sgo1p rescue is not due solely to changes in chromatin
localization. We therefore hypothesize that this region includes a negative regulatory region that
could inhibit Sgo1p function. A screen of phosphorylated proteins in S. cerevisiae unveiled three
sites on Sgo1p that are putative phosphorylation targets: S148, S151, and S421 (Swaney et al.
2013). No function has been reported for these sites, and in our hands, alanine substitutions of
the residues yields no discernible phenotype (data not shown). However, in the human Shugoshin
1 protein, phosphorylation of a central threonine residue (T346) has been shown to promote
interaction and protection of cohesin (Liu et al. 2012). This raises the possibility that previous
unidentified posttranslational modifications in this region could serve to modulate Sgo1p
interactions with other SAC components. Three residues from the suppressor screen (Figure
3-1B, suppressors A1, A5, and S53) fall within this region with two, K345 and S355, serving as
potential targets for posttranslational modification, and merit additional studies.

Our study focused on novel domains of Sgo1p that could restore mitotic fidelity in a tsm–
background. However, our truncation mutants also allowed the analysis of the roles of previously
identified domains in both tension surveillance and chromatin localization. Sgo1p has two well
conserved domains: the N’ coiled coil domain, and the C’ basic domain (Kitajima et al. 2004).
Disruption of the N’ domain of Sgo1p resulted in benomyl hypersensitivity similar to "sgo1 (see
Figure 7C). These data are consistent with previous reports, which have shown that the N’ coiled
coil domain is important for homodimerization, CPC interaction, and PP2A interaction (Xu et al.
2009; Tsukahara et al. 2010; Peplowska et al. 2014). The N’ coiled coil domain coordinates with
the Rts1p component of PP2A to localize condensin and structurally promote biorientation
102

(Peplowska et al. 2014). Thusly, the loss of the N’ coiled coil domain renders Sgo1p incapable of
recruiting key SAC proteins to chromatin, resulting in an inability to respond to the lack of
tension and promote biorientation. Our studies were able to demonstrate that interruption of the
N’ coiled-coil domain cripples Sgo1p, and severely impairs SAC function.

The C’ basic region of Sgo1p interacts with phosphorylated histone H2A S121 at the centromere
(Yamagishi et al. 2008; Kawashima et al. 2010). Substitution of H2A S121 or disruption of the
kinase domain of Bub1p, the kinase responsible for S121 phosphorylation, results in severe
mitotic defects and depletion of both centromeric and pericentric Sgo1p (Fernius and Hardwick
2007; Kawashima et al. 2010). The Y317X Sgo1p suppressor and domain mapping experiments
demonstrate that while the loss of the C’ basic domain abolishes pericentric enrichment, this
domain is not essential to Sgo1p function. Intriguingly, the deletion of the C’ basic domain only
results in loss of pericentric localization, while centromeric association is retained. Our data
suggests that in S. cerevisiae, the presence of the C’ basic domain is not required for centromeric
localization or downstream SAC activation.

Sgo1p is also an APC substrate through a destruction box motif reported in both human and
budding yeast (494NKSEN in budding yeast) (Fu et al. 2007; Eshleman and Morgan 2014). It is
also striking that deletion of this motif does not significantly impact Sgo1p function, or induce
mitotic arrest. This is consistent with previous reports (Fu et al. 2007; Eshleman and Morgan
2014), and suggests that SAC exit does not require Sgo1p degradation. We propose that under
normal conditions, the TSM serves as a docking site for Sgo1p on pericentric chromatin. Upon
biorientation, tension is generated between sister chromatids which results in a conformational
change in the TSM, evicting bound Sgo1p. Upon eviction, Sgo1p is no longer spatially
positioned to inhibit mitotic progression, and therefore cells enter into anaphase. In this manner,
Sgo1p can be regulated by chromatin localization, rather than degradation.

103

This chapter has further defined regions of Sgo1p that are important for pericentric localization
and tsm– suppression. We have demonstrated that deletion of the C’ basic region prevents Sgo1p
enrichment in the pericentric region. In addition, we reveal that 1-316 Sgo1p is sufficient for
centromeric recruitment. 1-336 Sgo1p bypasses the requirement for an intact TSM to partially
rescue this phenotype, but not 1-363 Sgo1p, suggesting the 336-363 region contains a negative
regulatory residue/residues that modulate Sgo1p function in the SAC. The mechanism and
potential mediators of this regulation are still to be elucidated.

104

REFERENCES

105

REFERENCES

Alexandru, G., Uhlmann, F., Mechtler, K., Poupart, M.A., and Nasmyth, K. (2001).
Phosphorylation of the cohesin subunit Scc1 by Polo/Cdc5 kinase regulates sister chromatid
separation in yeast. Cell 105, 459–472.
Baker, S.P., Phillips, J., Anderson, S., Qiu, Q., Shabanowitz, J., Smith, M.M., Yates, J.R., Hunt,
D.F., and Grant, P.A. (2010). Histone H3 Thr 45 phosphorylation is a replication-associated posttranslational modification in S. cerevisiae. Nature Cell Biology.
Dai, J., Hyland, E.M., Yuan, D.S., Huang, H., Bader, J.S., and Boeke, J.D. (2008). Probing
Nucleosome Function: A Highly Versatile Library of Synthetic Histone H3 and H4 Mutants. Cell
134, 1066–1078.
Eshleman, H.D., and Morgan, D.O. (2014). Sgo1 recruits PP2A to chromosomes to ensure sister
chromatid bi-orientation during mitosis. Journal of Cell Science 127, 4974–4983.
Fernius, J., and Hardwick, K.G. (2007). Bub1 kinase targets Sgo1 to ensure efficient
chromosome biorientation in budding yeast mitosis. PLoS Genet. 3, e213.
Fu, G., Hua, S., Ward, T., Ding, X., Yang, Y., Guo, Z., and Yao, X. (2007). D-box is required for
the degradation of human Shugoshin and chromosome alignment. Biochem. Biophys. Res.
Commun. 357, 672–678.
Gietz, D., St Jean, A., Woods, R.A., and Schiestl, R.H. (1992). Improved method for high
efficiency transformation of intact yeast cells. Nucleic Acids Res. 20, 1425.
Haase, J., Stephens, A., Verdaasdonk, J., Yeh, E., and Bloom, K. (2012). Bub1 Kinase and Sgo1
Modulate Pericentric Chromatin in Response to Altered Microtubule Dynamics. Current Biology
22, 471–481.
Herrmann, C., Avgousti, D.C., and Weitzman, M.D. (2017). Differential salt fractionation of
nuclei to analyze chromatin-associated proteins from cultured mammalian cells. Bio-Protocol 7,
e2175.
Indjeian, V.B., and Murray, A.W. (2007). Budding yeast mitotic chromosomes have an intrinsic
bias to biorient on the spindle. Curr. Biol. 17, 1837–1846.
Ishida, T., and Kinoshita, K. (2007). PrDOS: prediction of disordered protein regions from amino
acid sequence. Nucleic Acids Res. 35, W460-464.
Katis, V.L., Galova, M., Rabitsch, K.P., Gregan, J., and Nasmyth, K. (2004). Maintenance of
cohesin at centromeres after meiosis I in budding yeast requires a kinetochore-associated protein
related to MEI-S332. Curr. Biol. 14, 560–572.
Kawashima, S.A., Yamagishi, Y., Honda, T., Ishiguro, K. -i., and Watanabe, Y. (2010).
Phosphorylation of H2A by Bub1 Prevents Chromosomal Instability Through Localizing
Shugoshin. Science 327, 172–177.
Kawashima, S., Nakabayashi, Y., Matsubara, K., Sano, N., Enomoto, T., Tanaka, K., Seki, M.,
and Horikoshi, M. (2011). Global analysis of core histones reveals nucleosomal surfaces required
for chromosome bi-orientation. EMBO J. 30, 3353–3367.

106

Kiburz, B.M., Amon, A., and Marston, A.L. (2008). Shugoshin promotes sister kinetochore
biorientation in Saccharomyces cerevisiae. Mol. Biol. Cell 19, 1199–1209.
Kitajima, T.S., Kawashima, S.A., and Watanabe, Y. (2004). The conserved kinetochore protein
shugoshin protects centromeric cohesion during meiosis. Nature 427, 510–517.
Kitajima, T.S., Hauf, S., Ohsugi, M., Yamamoto, T., and Watanabe, Y. (2005). Human Bub1
Defines the Persistent Cohesion Site along the Mitotic Chromosome by Affecting Shugoshin
Localization. Current Biology 15, 353–359.
Kuo, M.H., and Allis, C.D. (1999). In vivo cross-linking and immunoprecipitation for studying
dynamic Protein:DNA associations in a chromatin environment. Methods 19, 425–433.
Kurotani, A., Tokmakov, A.A., Kuroda, Y., Fukami, Y., Shinozaki, K., and Sakurai, T. (2014).
Correlations between predicted protein disorder and post-translational modifications in plants.
Bioinformatics 30, 1095–1103.
Lew, D.J., and Burke, D.J. (2003). The Spindle Assembly and Spindle Position Checkpoints.
Annual Review of Genetics 37, 251–282.
Liu, H., Rankin, S., and Yu, H. (2012). Phosphorylation-enabled binding of SGO1–PP2A to
cohesin protects sororin and centromeric cohesion during mitosis. Nature Cell Biology 15, 40–
49.
Luo, J., Xu, X., Hall, H., Hyland, E.M., Boeke, J.D., Hazbun, T., and Kuo, M.-H. (2010).
Histone H3 Exerts a Key Function in Mitotic Checkpoint Control. Molecular and Cellular
Biology 30, 537–549.
Luo, J., Deng, X., Buehl, C., Xu, X., and Kuo, M.-H. (2016). Identification of Tension Sensing
Motif of Histone H3 in Saccharomyces cerevisiae and Its Regulation by Histone Modifying
Enzymes. Genetics 204, 1029–1043.
Marston, A.L., Tham, W.-H., Shah, H., and Amon, A. (2004). A genome-wide screen identifies
genes required for centromeric cohesion. Science 303, 1367–1370.
Mittag, T., Marsh, J., Grishaev, A., Orlicky, S., Lin, H., Sicheri, F., Tyers, M., and Forman-Kay,
J.D. (2010). Structure/Function Implications in a Dynamic Complex of the Intrinsically
Disordered Sic1 with the Cdc4 Subunit of an SCF Ubiquitin Ligase. Structure 18, 494–506.
Nerusheva, O.O., Galander, S., Fernius, J., Kelly, D., and Marston, A.L. (2014). Tensiondependent removal of pericentromeric shugoshin is an indicator of sister chromosome
biorientation. Genes & Development 28, 1291–1309.
Peplowska, K., Wallek, A.U., and Storchova, Z. (2014). Sgo1 Regulates Both Condensin and
Ipl1/Aurora B to Promote Chromosome Biorientation. PLoS Genetics 10, e1004411.
Pinsky, B.A., and Biggins, S. (2005). The spindle checkpoint: tension versus attachment. Trends
in Cell Biology 15, 486–493.
Sherman, F. (1991). Getting started with yeast. Meth. Enzymol. 194, 3–21.
Silva, P., Barbosa, J., Nascimento, A.V., Faria, J., Reis, R., and Bousbaa, H. (2011). Monitoring
the fidelity of mitotic chromosome segregation by the spindle assembly checkpoint. Cell Prolif.
44, 391–400.

107

Swaney, D.L., Beltrao, P., Starita, L., Guo, A., Rush, J., Fields, S., Krogan, N.J., and Villén, J.
(2013). Global analysis of phosphorylation and ubiquitylation cross-talk in protein degradation.
Nature Methods 10, 676–682.
Travis, G.H., Colavito-Shepanski, M., and Grunstein, M. (1984). Extensive purification and
characterization of chromatin-bound histone acetyltransferase from Saccharomyces cerevisiae. J.
Biol. Chem. 259, 14406–14412.
Tsukahara, T., Tanno, Y., and Watanabe, Y. (2010). Phosphorylation of the CPC by Cdk1
promotes chromosome bi-orientation. Nature 467, 719–723.
Verdaasdonk, J.S., Gardner, R., Stephens, A.D., Yeh, E., and Bloom, K. (2012). Tensiondependent nucleosome remodeling at the pericentromere in yeast. Molecular Biology of the Cell
23, 2560–2570.
Williams, S.J., Abrieu, A., and Losada, A. (2017). Bub1 targeting to centromeres is sufficient for
Sgo1 recruitment in the absence of kinetochores. Chromosoma 126, 279–286.
Xu, Z., Cetin, B., Anger, M., Cho, U.S., Helmhart, W., Nasmyth, K., and Xu, W. (2009).
Structure and Function of the PP2A-Shugoshin Interaction. Molecular Cell 35, 426–441.
Yamagishi, Y., Sakuno, T., Shimura, M., and Watanabe, Y. (2008). Heterochromatin links to
centromeric protection by recruiting shugoshin. Nature 455, 251–255.
Zhang, Y., Stec, B., and Godzik, A. (2007). Between Order and Disorder in Protein Structures:
Analysis of “Dual Personality” Fragments in Proteins. Structure 15, 1141–1147.

108

CHAPTER 4:

SUMMARY AND CONCLUSIONS

109

Specific aims and results

The overall aim of this study was to define novel regions and residues of histone H3 and Sgo1p
that genetically and physically interact with the TSM of histone H3. The physical binding of
Sgo1p with the TSM is negatively regulated by histone acetyltransferase Gcn5p. We therefore
hypothesized that Gcn5p attenuates the Sgo1p–TSM interaction through acetylation of target
lysine residues on the H3 tail. Our studies were designed to dissect the mechanism of this
regulation. In addition, the TSM binding interface of Sgo1p is not known. We undertook a
program of suppressor screens to isolate mutant alleles of Sgo1p that would rescue a defective
TSM, and thereby provide information on critical regions of Sgo1p involved in TSM interaction.
Overall, we utilized systematic genetic and biochemical approaches to map histone H3 and
Sgo1p domains and elucidate mechanisms regulating Sgo1p–H3 interactions. A summary of the
results is listed below:

Objective 1 and results

To determine the effect of Gcn5p-mediated H3 tail acetylation on TSM regulation, and elucidate
the mechanism through which the acetylation impairs Sgo1p pericentric binding. Results from
this objective include:
1. Deletion of the H3 tail domain leads to severe synthetic sickness with tsm–.
2. Lysine-to-alanine mutations on the histone H3 tail rescue tsm– benomyl hypersensitivity.
3. H3 K14A or K23A suppresses the mitotic defects of tsm–.
4. The H3 K14A suppressor does not gain additional strength from the E173H gcn5– suppressor,
suggesting they share a common mechanism.
5. Sgo1p pericentric localization is partially restored by the H3 K14A suppressor allele.
6. Sgo1p abnormally accumulates in the arm region of chromatin in a H3 K14A background.

110

7. Sgo1p can physically interact with the histone H3 tail, allowing the H3 tail to function as an
auxiliary site for tension sensing.
8. Acetylation of the H3 tail does not directly impair Sgo1p interaction, suggesting an indirect
mechanism of regulation.

Objective 2 and results

To elucidate novel Sgo1p suppressors of tsm–, determine the mechanism of suppression, and map
critical regions of Sgo1p for TSM interaction. Results from this objective include:
1. A truncation of Sgo1p at Y317 results in the suppression of tsm–, but enhances sensitivity in a
wild-type background.
2. Disruption of the N’ coiled-coil domain renders Sgo1p non-functional.
3. Pericentromeric enrichment of Sgo1p is reliant on C’ residues located in the 391-411 region of
Sgo1p.
4. Centromeric enrichment does not require the C’ basic domain.
5. The inclusion of residues 336-363 of Sgo1p ablates tsm– suppression, potentially due to the
presence of a negative regulatory domain.

111

Study outcome

This dissertation presented our findings on novel domains in both histone H3 and Sgo1p that are
involved in Sgo1p recruitment and tension sensing. Two studies were carried out to discern: 1)
the mechanism through which Gcn5p-mediated acetylation regulates the chromatin association
and function of Sgo1p, and 2) the domains of Sgo1p that genetically or physically interact with
the TSM.

Our early studies of Gcn5p-mediated regulation of Sgo1p and the SAC focused on the well
studied target of Gcn5p acetylation: the histone H3 tail domain (Durrin et al. 1991; Kuo and
Allis 1998; Kuo et al. 1998; Reid et al. 2000). In a tsm– background, deletion of the H3 tail
domain (residues 2-28) results in severe synthetic sickness and abolishes the gcn5– suppression
of tsm– benomyl hypersensitivity. The H3 tail contains multiple lysine residues that are well
characterized targets of Gcn5p-mediated acetylation, most notably K14. Alanine or arginine
substitutions of H3 tail lysine residues, specifically K14, are sufficient to restore benomyl
resistance in a tsm– background (Kuo et al. 1996; Kuo and Andrews 2013). Further experiments
were performed to assess the effect of H3 K14A on mitotic fidelity in a tsm– background. H3
K14A suppressed tsm– chromosome instability phenotypes as assessed by recovery from
benomyl arrest, diploid mating assays, and red sectoring assays. Taken together, these results
demonstrate that H3 K14A genetically interacts with the TSM and rescues the mitotic defects
associated with tsm– mutants.

ChIP experiments revealed Sgo1p is partially restored in most H3 K14A G44S pericentric loci
tested. In addition, Sgo1p displays pan-chromatin association in the H3 K14A mutant, spreading
into the arm region where Sgo1p is usually absent. Sgo1p also interacts with an H3 tail peptide in
vitro through pulldown experiments. Taken together, these results add merit to a model in which
the histone H3 tail becomes an auxiliary docking site for Sgo1p when the TSM is damaged.
112

From this secondary vantage point, Sgo1p performs the critical tension sensing function. The
finding that Sgo1p binds the H3 tail irrespective of acetylation status argues against direct
regulation of Sgo1p interaction by acetylation. We propose that acetylation of the H3 tail could
allow the recruitment of various bromodomain proteins that could obstruct Sgo1p from tail
binding. When the preferred TSM site is mutated, Sgo1p must interact with the H3 tail to surveil
tension, with the presence of acetylation and associated bromodomain proteins impeding
pericentric Sgo1p accumulation and therefore, SAC function.

We began our studies on the key domains of Sgo1p by generating random mutations in SGO1
with error-prone PCR and screening these mutants for tsm– suppressors. The screen revealed that
a premature stop codon inserted at residue Y317 results in an Sgo1p allele that rescues H3 G44S
benomyl hypersensitivity. This suppression was not due to increased protein levels, as the
Y317X suppressor was expressed at similar levels to non-suppressor truncation mutants. Y317X
Sgo1p also rescued the benomyl hypersensitivity of K42A and T45A tsm– mutants,
demonstrating that this allele bypasses the need for an intact TSM. While the Y317X Sgo1p
suppressor is enriched at the centromere, it does not accumulate in the pericentric region of either
wild-type or H3 G44S chromatin. Intriguingly, chromatin fractionation experiments strongly
supported that Y317X Sgo1p is chromatin associated. This result is in stark contrast with other
tsm– suppressors, which restore a pericentric population of Sgo1p. We posit that Y317X Sgo1p
binds chromatin, but without a pericentric preference. As the H3 tail can function as a secondary
site of Sgo1p interaction, it was possible that Y317X could also bind the tail. Indeed, Y317X can
specifically bind the H3 tail domain, and in the absence of this domain, Y317X tsm– suppression
is lost. Together, we propose that Y317X Sgo1p suppresses the mitotic defects of a damaged
TSM through interactions with the H3 tail domain.

Domain mapping experiments revealed that disruption of the N’ coiled-coil domain of Sgo1p
result in nonfunctional Sgo1p alleles, consistent with the well established functional role of the
113

coiled-coil domain (Xu et al. 2009; Tsukahara et al. 2010; Peplowska et al. 2014). However, a
1-150 Sgo1p allele is also phenotypically similar to !sgo1, indicating a minimal functional
domain that extends into residues 150-316 of Sgo1p. The suppression of H3 G44S benomyl
hypersensitivity is lost with the inclusion of residues 336-363, a region we hypothesize contains
a negative regulatory domain. Strikingly, ChIP analysis revealed the pericentric enrichment of
Sgo1p requires residues located between 391-411. This finding demonstrated that tsm–
suppressor activity is separate from pericentric localization. Taken together, our data has revealed
novel domains in Sgo1p with implications for both TSM interaction and chromatin localization.

The finding presented above have illuminated novel roles for domains in both histone H3 and
Sgo1p. Our model of Sgo1p recruitment and regulation is shown in Figure 4-1. We have
demonstrated that the tail domain of histone H3 is critical in tension sensing deficient strains, and

114

Prophase to Metaphase
Sgo1p

Gcn5p
Sgo1p

Sgo1p

Transition through S
and G2 Phases

Ac

TSM

pS121

Centromere

Ac

Sister Chromatids
align at Metaphase
Plate

Nucleosome

Sgo1p recruitment to chromatin is nucleated at the centromere by
phospho-S121 on histone H2A, then spreads out into the pericentric
chromatin through the histone H3 tail and TSM. Spread into the arm
regions is inhibited by Gcn5p acetylation and subsequent recruitment
of bromodomain proteins.

G1 Phase

Bipolar Attachment

Gcn5p

Sgo1p

Sgo1p

Ac

TSM

Centromere

Ac

TSM

Nucleosome

Centromere

Sgo1p is absent during the G1 phase. Gcn5p acetylation of histone H3
is involved in the upregulation of gene transcription.

Ac
Ac

Nucleosome

Upon bipolar attachment, the resultant tension deforms the TSM,
leading to the eviction of Sgo1p from chromatin.

Transition to Anaphase
Sgo1p

Sgo1p

Mitotic Exit

TSM

Centromere

Ac
Ac

SAC Silencing

Nucleosome

The efficient silencing of the SAC is potentially facilitated by a prolyl
isomerase acting on P353 of Sgo1p to alter Sgo1p function to impair
SAC activation.

Figure 4-1: Model of Sgo1p recruitment and regulation during the cell cycle. In the top
panel, Sgo1p is recruited to the centromere by interaction with phosphorylated S121 of histone
H2A, and spreads to the pericentric chromatin through interactions with the TSM and histone H3
tail. Gcn5p-mediated acetylation of the H3 tail recruits bromodomain proteins to prevent the
spread of Sgo1p beyond the pericentric chromatin. Upon the generation of tension (right panel),
the TSM is deformed, and Sgo1p is evicted. Sgo1p function is then regulated through residues in
the 337-363 region (potentially P353) assist in the silencing of the SAC. Sgo1p is subsequently
degraded, and the cells can enter into the G1 phase.

115

propose the H3 tail functions as a secondary binding site for Sgo1p. In addition, acetylation of
lysine residues on the H3 tail domain provides an intriguing mechanism to limit the spread of
Sgo1p onto the chromosome arms. We have also revealed new regions of Sgo1p that play
important roles in both tsm– suppressor activity and the localization of Sgo1p. Our findings
emphasize the key role of the N’ coiled-coil domain and further defined the minimal functional
region of Sgo1p. Taken together, these results elucidate novel domains on both histone H3 and
Sgo1p that are important regulators of Sgo1p localization, tension surveillance, and mitotic
fidelity.

116

Future directions

Future experiments will be required to determine the precise mechanism through which H3 K14
interacts with the TSM. The H3 K14A mutation suppresses the mitotic defects of tsm– and
restores a pericentric Sgo1p population. Acetylation of K14 has no significant impact on Sgo1p
interaction with the H3 tail domain in vitro, suggesting an indirect regulation of Sgo1pchromatin binding. This could occur through competition with bromodomain proteins that favor
H3 K14 acetylation, such as Snf2p, Sth1p, and several Rsc proteins (Zhang et al. 2010). As
deletion of many of these bromodomain proteins results in phenotypes independent of mitotic
tension sensing (Deutschbauer et al. 2005; Andersen et al. 2008; Qian et al. 2012), a genetic
approach may not be preferred. Instead, recombinant bromodomain proteins could be prepared
and used for competition binding assays with Sgo1p to the acetylated histone H3 tail in vitro.

Post-translational modifications on core histones correlate with various stages of the cell cycle.
In mammalian cells histone H3 S10 phosphorylation, associated with condensing chromatin,
begins in prophase, peaks in metaphase, and decreases upon entry into anaphase (Gurley et al
1978; Paulson and Taylor 1982). In mammalian cells H3 S10 phosphorylation begins in the
pericentric regions and spreads out into the arm regions of the chromosomes (Hendzel et al.
1997). Studies have observed mitotic defects in Tetrahymena thermophila in the presence of an
H3 S10A mutation or H3 kinase inhibition (Van Hooser et al. 1998; Wei et al. 1999). In S.
cerevisiae, S10 is disposable for mitotic progression, potentially due to redundancies with other
phosphorylated serine residues such as H3 S28 and sites on histone H2B (Hsu et al. 2000).
Intriguingly, it has been reported that phosphorylation of H3 S10 can promote H3 K14
acetylation by yeast Gcn5p in vitro (Lo et al. 2000). This suggests phosphorylated H3 S10
promotes Gcn5p acetylation of H3 K14 during mitotic progression. In fact, coincident
phosphorylation of H3 S10 and acetylation of H3 K14 occurs in the pericentric regions of
monokinetic plants during mitosis (Sharma et al. 2016). These findings, combined with the data
117

presented above, invites an intriguing model in which H3 S10 phosphorylation drives H3 K14
acetylation during mitotic progression. We propose that acetylation establishes boundaries for
Sgo1p spread in a wild-type TSM background, but in a tsm– background, acetylation inhibits
Sgo1p-H3 interaction. If H3 S10 phosphorylation promotes K14 acetylation, it would follow that
a S10A mutation could rescue a tsm– background similar to K14A. Future experiments could
involve characterization of a S10A G44S double mutant, as well as ChIP experiments to analyze
the pericentric enrichment of phosphorylated S10 and acetylated K14 during mitosis. Elucidating
the mechanisms through which chromatin and selective chromatin modifying enzymes can
regulate Sgo1p interaction will provide a greater understanding of the systems that govern
tension sensing.

Our studies of Sgo1p domains have revealed that the addition of residues 337-363 to Sgo1p
ablates the tsm– suppression of the 1-316 and 1-336 alleles. The initial suppressor screen revealed
additional Sgo1p alleles that also rescue the benomyl hypersensitivity of H3 G44S. Some of
these mutations were mapped to residues 337-363 (K345, P353, and S355, see Figure 3-1).
However, these suppressors also carry mutations at other sites, complicating the analysis of the
individual mutations. Assessing the effects of alanine substitutions at each site could be of great
value in further defining the important residues on Sgo1p that impact tsm– suppression. The
336-363 region could be a site of negative regulation. If this regulation is due to posttranslational
modifications, the truncated suppressors would likely lose the interaction with the enzyme
responsible for inhibiting Sgo1p function. Sgo1p could be purified from cell extracts through a
TAP-tag approach and bound proteins could be analyzed by mass spectrometry. In this manner,
Sgo1p protein interactions can be identified, and putative regulatory enzymes that bind to fulllength Sgo1p, but not the suppressor alleles, can be elucidated. This would allow a greater
understanding of the regulation of Sgo1p in metaphase. As Sgo1p has been found to be
differentially expressed or present as a splice variant in a variety of cancers (Iwaizumi et al.
2009; Kahyo et al. 2011; Yamada et al. 2012; Matsuura et al. 2013), developing a greater
118

understanding of its key functional domains, and how deletion of these domains impact Sgo1p
function could potentially lead to a better understanding of Sgo1p in cancer.

119

REFERENCES

120

REFERENCES

Andersen, M.P., Nelson, Z.W., Hetrick, E.D., and Gottschling, D.E. (2008). A genetic screen for
increased loss of heterozygosity in Saccharomyces cerevisiae. Genetics 179, 1179–1195.
Deutschbauer, A.M., Jaramillo, D.F., Proctor, M., Kumm, J., Hillenmeyer, M.E., Davis, R.W.,
Nislow, C., and Giaever, G. (2005). Mechanisms of haploinsufficiency revealed by genome-wide
profiling in yeast. Genetics 169, 1915–1925.
Durrin, L.K., Mann, R.K., Kayne, P.S., and Grunstein, M. (1991). Yeast histone H4 N-terminal
sequence is required for promoter activation in vivo. Cell 65, 1023–1031.
Fernius, J., and Hardwick, K.G. (2007). Bub1 kinase targets Sgo1 to ensure efficient
chromosome biorientation in budding yeast mitosis. PLoS Genet. 3, e213.
Gurley, L.R., D’Anna, J.A., Barham, S.S., Deaven, L.L., and Tobey, R.A. (1978). Histone
phosphorylation and chromatin structure during mitosis in Chinese hamster cells. Eur. J.
Biochem. 84, 1–15.
Hendzel, M.J., Wei, Y., Mancini, M.A., Van Hooser, A., Ranalli, T., Brinkley, B.R., Bazett-Jones,
D.P., and Allis, C.D. (1997). Mitosis-specific phosphorylation of histone H3 initiates primarily
within pericentromeric heterochromatin during G2 and spreads in an ordered fashion coincident
with mitotic chromosome condensation. Chromosoma 106, 348–360.
Hsu, J.Y., Sun, Z.W., Li, X., Reuben, M., Tatchell, K., Bishop, D.K., Grushcow, J.M., Brame,
C.J., Caldwell, J.A., Hunt, D.F., et al. (2000). Mitotic phosphorylation of histone H3 is governed
by Ipl1/aurora kinase and Glc7/PP1 phosphatase in budding yeast and nematodes. Cell 102, 279–
291.
Iwaizumi, M., Shinmura, K., Mori, H., Yamada, H., Suzuki, M., Kitayama, Y., Igarashi, H.,
Nakamura, T., Suzuki, H., Watanabe, Y., et al. (2009). Human Sgo1 downregulation leads to
chromosomal instability in colorectal cancer. Gut 58, 249–260.
Kahyo, T., Iwaizumi, M., Shinmura, K., Matsuura, S., Nakamura, T., Watanabe, Y., Yamada, H.,
and Sugimura, H. (2011). A novel tumor-derived SGOL1 variant causes abnormal mitosis and
unstable chromatid cohesion. Oncogene 30, 4453–4463.
Kiburz, B.M., Amon, A., and Marston, A.L. (2008). Shugoshin promotes sister kinetochore
biorientation in Saccharomyces cerevisiae. Mol. Biol. Cell 19, 1199–1209.
Kuo, M.H., Brownell, J.E., Sobel, R.E., Ranalli, T.A., Cook, R.G., Edmondson, D.G., Roth, S.Y.,
and Allis, C.D. (1996). Transcription-linked acetylation by Gcn5p of histones H3 and H4 at
specific lysines. Nature 383, 269–272.
Kuo, M.H., and Allis, C.D. (1998). Roles of histone acetyltransferases and deacetylases in gene
regulation. Bioessays 20, 615–626.
Kuo, M.H., Zhou, J., Jambeck, P., Churchill, M.E., and Allis, C.D. (1998). Histone
acetyltransferase activity of yeast Gcn5p is required for the activation of target genes in vivo.
Genes Dev. 12, 627–639.
Kuo, Y.-M., and Andrews, A.J. (2013). Quantitating the specificity and selectivity of Gcn5mediated acetylation of histone H3. PLoS ONE 8, e54896.
121

Lo, W.S., Trievel, R.C., Rojas, J.R., Duggan, L., Hsu, J.Y., Allis, C.D., Marmorstein, R., and
Berger, S.L. (2000). Phosphorylation of serine 10 in histone H3 is functionally linked in vitro
and in vivo to Gcn5-mediated acetylation at lysine 14. Mol. Cell 5, 917–926.
Luo, J., Xu, X., Hall, H., Hyland, E.M., Boeke, J.D., Hazbun, T., and Kuo, M.-H. (2010).
Histone H3 Exerts a Key Function in Mitotic Checkpoint Control. Molecular and Cellular
Biology 30, 537–549.
Matsuura, S., Kahyo, T., Shinmura, K., Iwaizumi, M., Yamada, H., Funai, K., Kobayashi, J.,
Tanahashi, M., Niwa, H., Ogawa, H., et al. (2013). SGOL1 variant B induces abnormal mitosis
and resistance to taxane in non-small cell lung cancers. Scientific Reports 3.
Paulson, J.R., and Taylor, S.S. (1982). Phosphorylation of histones 1 and 3 and nonhistone high
mobility group 14 by an endogenous kinase in HeLa metaphase chromosomes. J. Biol. Chem.
257, 6064–6072.
Peplowska, K., Wallek, A.U., and Storchova, Z. (2014). Sgo1 Regulates Both Condensin and
Ipl1/Aurora B to Promote Chromosome Biorientation. PLoS Genetics 10, e1004411.
Qian, W., Ma, D., Xiao, C., Wang, Z., and Zhang, J. (2012). The genomic landscape and
evolutionary resolution of antagonistic pleiotropy in yeast. Cell Rep 2, 1399–1410.
Reid, J.L., Iyer, V.R., Brown, P.O., and Struhl, K. (2000). Coordinate regulation of yeast
ribosomal protein genes is associated with targeted recruitment of Esa1 histone acetylase. Mol.
Cell 6, 1297–1307.
Sharma, S.K., Yamamoto, M., and Mukai, Y. (2016). Dual modified antiphospho (Ser10)-acetyl
(Lys14)-histone H3 predominantly mark the pericentromeric chromatin during mitosis in
monokinetic plants. Journal of Genetics 95, 965–973.
Tsukahara, T., Tanno, Y., and Watanabe, Y. (2010). Phosphorylation of the CPC by Cdk1
promotes chromosome bi-orientation. Nature 467, 719–723.
Van Hooser, A., Goodrich, D.W., Allis, C.D., Brinkley, B.R., and Mancini, M.A. (1998). Histone
H3 phosphorylation is required for the initiation, but not maintenance, of mammalian
chromosome condensation. J. Cell. Sci. 111 ( Pt 23), 3497–3506.
Wei, Y., Yu, L., Bowen, J., Gorovsky, M.A., and Allis, C.D. (1999). Phosphorylation of histone
H3 is required for proper chromosome condensation and segregation. Cell 97, 99–109.
Xu, Z., Cetin, B., Anger, M., Cho, U.S., Helmhart, W., Nasmyth, K., and Xu, W. (2009).
Structure and Function of the PP2A-Shugoshin Interaction. Molecular Cell 35, 426–441.
Yamada, H.Y., Yao, Y., Wang, X., Zhang, Y., Huang, Y., Dai, W., and Rao, C.V. (2012).
Haploinsufficiency of SGO1 results in deregulated centrosome dynamics, enhanced
chromosomal instability and colon tumorigenesis. Cell Cycle 11, 479–488.
Zhang, Q., Chakravarty, S., Ghersi, D., Zeng, L., Plotnikov, A.N., Sanchez, R., and Zhou, M.-M.
(2010). Biochemical Profiling of Histone Binding Selectivity of the Yeast Bromodomain Family.
PLoS ONE 5, e8903.

122

SUPPLEMENTAL CHAPTER:

RESOLVING ACETYLATED AND PHOSPHORYLATED PROTEINS BY NEUTRAL
UREA TRITON-POLYACRYLAMIDE GEL ELECTROPHORESIS, NUT-PAGE

Published in BioTechniques 2014; 57(2): 72-80.

Christopher J. Buehl1,*, Xiexiong Deng2,*, Mengyu Liu2,*, Stacy Hovde2, Xinjing Xu2, Min-Hao
Kuo1,2

1Cell

and Molecular Biology Program, 2Department of Biochemistry and Molecular Biology,

Michigan State University, East Lansing, MI
*These

authors contributed equally to this work.

Keywords: acetylation, phosphorylation, !-synuclein, histone H3

123

Abstract

Protein acetylation and phosphorylation can be key modifications that regulate both normal and
pathological protein functions. Current gel systems used to analyze modified proteins require
either expensive reagents or time–consuming second dimension electrophoresis. In this
manuscript, we present a neutral pH gel system that allows the analysis of acetylated and
phosphorylated proteins. This neutral pH urea Triton-polyacrylamide gel electrophoresis system,
or NUT-PAGE, separates proteins based on their charge at pH 7 and generates discrete bands
from each acetylated and phosphorylated species. In addition, the gel is composed of common
and inexpensive laboratory reagents, and requires only a single dimension of electrophoresis. We
are able to demonstrate the effectiveness of this system by analyzing phosphorylated species of
an acidic protein, !-synuclein, and both acetylated and phosphorylated species of a basic protein,
histone H3. NUT-PAGE thus provides a cost-effective alternative to resolving acetylated and
phosphorylated proteins, and potentially proteins with other post-translational modifications that
alter net charge.

124

Introduction

Protein lysine (Lys) acetylation and serine/threonine (Ser/Thr) phosphorylation are among the
most pervasive posttranslational modifications that control the normal and even the pathological
functions of numerous proteins. It has been estimated that 30% of human proteins are
phosphorylated at any given moment, and that acetylation of histones and non-histones are
increasing found to play critical roles in a variety of cellular and nuclear functions, including
metabolism, nutrient sensing, and gene regulation (see, e.g., Aka et al. 2011; Walsh 2006). A gel
system that can effectively resolve acetylated and phosphorylated proteins is of tremendous
values in biomedical research. While SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel
electrophoresis) (Laemmli 1970) has been an essential laboratory technique, in most cases, it is
unable to resolve protein isoforms resulting from such modifications as acetylation and
phosphorylation. This is because acetylation and phosphorylation add only 42 and 80 daltons,
respectively, to the protein. On the other hand, these two modifications reduce the net charge per
modification site by one (acetylation) or by one to two (phosphorylation) at physiological pH,
rendering acetylated and phosphorylated proteins amenable to electrophoresis systems based on
separation by protein charge. Isoelectric focusing (IEF) is one such method. In IEF, proteins are
introduced to a gel matrix with a stable pH gradient generated by ampholytes. Electric current
pushes proteins to migrate until they reach the zone where the pH is equivalent to the pI of the
protein (Vesterberg and Svensson 1966). IEF can resolve proteins differing by a small charge
variation. However, proteins with similar charges may differ significantly in their sizes. To
further separate such proteins, IEF is paired with a second dimension SDS-PAGE (O’ Farrell
1975), increasing the cost and labor of the assay. In addition to IEF, other charge-based gel
systems are available as well. These systems typically use urea to denature proteins, and various
chemicals and buffers to maintain a set pH in the gel and the running buffer, so that proteins are
ionized and resolved by both the size and the charge. One of the most successful gel systems in
this category is the Triton acetic acid urea gel (TAU). TAU-PAGE has been used widely to
125

resolve acetylated histones (Johmann and Gorovsky 1976; Jackson 1999; Shechter et al. 2007).
However, because of the acidity of the gel system, the phosphate group of certain phosphorylated
proteins might become protonated and less charged, rendering acid urea gels less effective in
separating phosphoproteins. In principle, at neutral pH, the charge differences caused by Lys
acetylation and Ser/Thr phosphorylation are maintained. Thus, a gel system that runs at pH 7
should be a useful and versatile tool.

Protocols for urea-containing PAGE at or near neutral pH were described in several reports
(Taber and Sherman 1964; Hoffman and Chalkley 1976; Thomas and Hodes 1981). However,
these methods have been relatively underutilized, in particular in the realm of post-translational
modifications. In this paper, we present a neutral urea Triton-polyacrylamide gel electrophoresis
system (NUT-PAGE). NUT-PAGE maintains neutral pH via the use of imidazole and MOPS (3(N-morpholino)propanesulfonic acid), two common and inexpensive chemicals in biochemistry
and molecular biology laboratories. For a proof of principle, we used !-synuclein, an acidic
protein, and histone H3, a basic protein, as the examples to demonstrate the feasibility of NUTPAGE in resolving both acetylated and phosphorylated proteins. This method provides a versatile
and affordable alternative to IEF and 2-D systems.

126

Materials and Methods

Cloning, Protein Expression, and Purification

Human !-synuclein (AAS83394.1, GI:46242542) and budding yeast histone H3 (GI: 855700)
were cloned into the PIMAX system vectors developed in our lab (Sui et al, unpublished data)
allowing the co-expression of a substrate with the cognate modifying enzyme, resulting in highly
efficient modification of the substrate protein. !-synuclein was co-expressed with the human
Aurora A kinase (NP_940835.1, GI:38327564), and histone H3 was co-expressed with either S.
cerevisiae Gcn5 histone acetyltransferase (GI: 853167) or S. cerevisiae Ipl1 kinase (GI: 855892).

!-synuclein and histone H3 constructs were transformed into BL21–CodonPlus E. coli cells. All
bacterial growth and induction were conducted in LB medium containing 100 "g/ml ampicillin.
For induction, cells were seeded from an overnight culture at an OD600 of 0.1 and grown until
OD600 was 0.3 at 37° C. !-synuclein and histone H3 were induced by 0.5 mM and 0.25 mM
IPTG respectively at 37° C for two hours. Cells were then pelleted at 5,000 x g at 4° C and
resuspended in Buffer A (100 mM NaCl, 20 mM Tris•HCl pH 7.4, 10% glycerol) and disrupted
by sonication using a Misonix Sonicator 3000 (Farmingdale, NY) with ten 15-second bursts at
20% output.

!-synuclein Preparation

!-synuclein was purified by differential precipitation of unwanted protein with 0.5% perchloric
acid (Gasparini et al. 2011). After ice incubation for 10 minutes, precipitated proteins were
removed by centrifugation at 15000 x g for 20 minutes, and the soluble !-synuclein was
collected, and the pH was adjusted to 7.4 by the addition of 2 M unbuffered Tris base. The

127

supernatant was further purified by passing through a 40 "m ceramic hydroxyapatite column
(Bio-Rad, Hercules, CA) and !-synuclein was eluted with a 75 mM sodium phosphate buffer
(pH 6.8). Purified !-synuclein was concentrated using a Ultra-15 10K spin column (Millipore,
Billerica, MA) with a molecular weight cutoff of 10,000 daltons, and diluted into Buffer A for
storage at -80° C.

Recombinant Histone H3 Preparation

After sonication, bacterial cell debris was removed by centrifugation at 5,000 x g at 4° C for 5
minutes. The supernatant was then centrifuged again for 20 minutes at 10,000 x g at 4° C. The
insoluble pellet, which contained H3 inclusion bodies, was collected and washed twice with
Triton wash buffer (50 mM Tris•HCl pH 7.4, 100 mM NaCl, 1 mM EDTA, 1% Triton X-100),
then washed twice with wash buffer (50 mM Tris•HCl pH 7.4, 100 mM NaCl, 1 mM EDTA).
Proteins were then denatured in 2 mL of unfolding buffer (8 M Urea, 20 mM Tris•HCl pH 7.4)
and gently rocked at room temperature for one hour. Denatured proteins were further clarified
by centrifugation at 10,000 x g for 10 minutes. The supernatant was collected and dialyzed stepwise against 6, 4, 2 and 0 M urea in 20 mM Tris•HCl pH 7.4 using a 12-14 kD cutoff tube
(Spectrum Laboratories, Rancho Dominguez, CA) at 4°C for 2 hours. 10% of glycerol was added
to the final dialyzed product before -80° C storage.

HeLa Treatment and Histone Preparation

HeLa cells were grown in DMEM supplemented with 5% FBS and 1% Pen/Strep L-glut. For
sodium butyrate and nocodazole treatments, HeLa cells were grown to 60% and 40% confluency,
respectively. Sodium butyrate treatments were performed as previously established (Koprinarova
et al. 2010). Briefly, HeLa cells were treated with fresh DMEM containing 5 mM sodium
butyrate for 24 hours. Cells were then washed twice with PBS pH 7.4, scraped, and pelleted.
128

Nocodazole treatment was performed by first treating cells with DMEM containing 2 mM
thymidine for 24 hours. Cells were then washed twice with PBS pH 7.4 and released into fresh
medium for three hours. Cells were then treated with DMEM containing 100 ng/mL nocodazole
for 12 hours, followed by two PBS pH 7.4 washes. Cells were pelleted and crude histones were
prepared by acid extraction as described (Shechter et al. 2007).

Reverse Phase HPLC Separation of Core Histones

Histone H3 was isolated from the crude histones by Reverse Phase High Performance Liquid
Chromatography (RP-HPLC), using a Zorbax Rx-C8 column (4.6 mm inner diameter % 250 mm)
(Agilent, Santa Clara, CA), with a multistep gradient method as previously described (Shechter
et al. 2007). RP-HPLC fractions containing histone H3 were pooled, proteins were vacuum
dried, and dissolved in distilled water. The identity and purity of histone H3 was assessed by
SDS-PAGE.

SDS-PAGE

Protein samples boiled in 1 x SDS-PAGE loading dye (60 mM Tris•HCl pH 6.8, 0.02%
bromophenol blue, 2% SDS, 10% glycerol, 400 mM #-mercaptoethanol) for 5 minutes. Protein
species were then resolved in a 15% SDS polyacrylamide gel at 180V for 70 minutes in a SE250
Mighty Small II Mini Vertical Electrophoresis Unit (Hoefer, Holliston, MA). Gels were then
stained using the Coomassie blue protocol as described (Wong et al. 2000).

NUT-PAGE

To resolve proteins by NUT or TAU gels, it is imperative to remove any residual salt by
precipitating proteins in 25% TCA (trichloroacetic acid) or 80% acetone. For acetone
129

precipitation, protein samples were mixed with four volumes of –20° C acetone, incubated at –
20° C for one hour, and pelleted by centrifugation at 24,000 x g for 10 minutes at 4° C. Air dried
protein samples were then dissolved in 2 &L distilled water, to which 6 &L of scavenger/loading
dye [6 M urea, 60 mM MOPS pH 8.0, 5% glycerol, 12.5 mg/mL protamine sulfate and 0.15%
methyl green (for histone H3 and other basic proteins) or bromophenol blue (for !-synuclein and
other acidic proteins)] was added and mixed.

NUT gels were prepared by pipetting 5 mL of resolving gel (as described by Table S-1) in 10 cm
x 10.5 cm x 0.075 cm assembly, layered with 1 mL of water, and allowed to polymerize for 10
minutes at room temperature. 2 mL of stacking gel solution was prepared as described in Table
A-1 and layered on top of the resolving gel. The comb, 0.075 cm in thickness, was inserted
immediately. The gel was allowed to polymerize for 30 minutes at room temperature. It is
recommended to trace the bottom of each well with a marker. This aides subsequent sample
loading.

Gel assemblies were placed in a SE260 Mighty Small II Deluxe Mini Vertical Electrophoresis
Unit (Hoefer, Holliston, MA) and the upper and lower reservoirs were filled with NUT-PAGE
running buffer (22 mM MOPS pH 7.0, 100 mM imidazole). The comb was then removed
carefully. Gel debris, if visible, were flushed out of the wells by injecting a stream of running
buffer through the use of a 25G needle and a syringe. To load protein samples, a 10-&l Hamilton
syringe was used. The negatively charged !-synuclein was run from cathode to anode at 125 V
for 20 min, then at 100 V for 12 hours (1,200 V•hr). The positively charged histone H3 was run
from anode toward cathode at 125 V for 20 min, then 100 V for 2,500 V•hr. The electrophoresis
was typically run at room temperature, but could be done in a cold room (without pre-chilling).
The lower temperature reduced protein migration by about 50%.

130

Table S-1: Composition of NUT polyacrylamide gel

Resolving Gel

6 mL (8.2 cm x 9.7 cm x 0.075 cm)

Final Concentration

Urea

2.16 g

6M

Acrylamide, 60% (60:0.4) 1.5 mL (15%) / 1 mL (10%)

15% / 10%

MOPS, 0.5 M, pH 7.0

1.2 mL

100 mM

10% (v/v) Triton X-100

0.222 mL

0.37% (v/v)

ddH2O

1.34 mL (15%) / 1.84 mL (10%)

N/A

APS, 10% (w/v)

16 µL

0.027% (w/v)

TEMED

8 µL

0.13% (v/v)

Stacking Gel

2 mL (8.2 cm x 9.7 cm x 0.075 cm) Final Concentration

Urea

0.72 g

6M

Acrylamide, 60% (60:0.4) 0.3 mL

9%

MOPS, 0.5 M, pH 8.0

0.4 mL

100 mM

10% (v/v) Triton X-100

0.074 mL

0.37% (v/v)

ddH2O

0.646 mL

N/A

APS, 10% (w/v)

12 µL

0.06% (w/v)

TEMED

6 µL

0.3% (v/v)

131

Triton Acetic Acid Urea Gel Electrophoresis

Histone samples were prepared by acetone precipitation as described above, and dissolved in no
more than 6 uL of loading dye comprised of 6 M urea, 5% glycerol, 12.5 mg/mL protamine
sulfate, 0.15% methyl green, and 5% glacial acetic acid. Triton acid-urea gels were prepared by
pipetting 5 mL of resolving gel in 10 cm x 10.5 cm x 0.075 cm assembly with a gel mixture
prepared as described in Table S-2. Gels were layered with 1 mL water and allowed to
polymerize for 20 minutes at room temperature. 2 mL of stacking gel solution were formulated
as shown in Table A-2 and layered on top of the resolving gel. A comb of 0.075 cm thickness was
quickly inserted, and the gel was allowed to polymerize for 45 minutes at room temperature.

For electrophoresis, gels were placed in a SE260 Mighty Small II Deluxe Mini Vertical
Electrophoresis Unit (Hoefer, Holliston, MA). Both reservoirs were filled with 5% glacial acetic
acid. Histone H3 samples were then loaded and run from anode to cathode at 150 V for 20 min,
followed by 100 V for 1,200 V•hr. Leaked urea was flushed out of each well immediately before
sample loading.

Protein Staining and Visualization

Gels were stained using Coomassie blue dye (Wong et al. 2000) or silver nitrate stain (Wray et
al. 1981) for general purposes. Phospho-specific stain was conducted with ProQ Diamond
staining (Invitrogen, Carlsbad, CA) per the user manual. Briefly, gels were removed from the gel
box and fixed at room temperature in 50% methanol/10% acetic acid for 30 minutes, followed by
overnight fixation in fresh methanol/acetic acid solution with gentle agitation. Gels were then
washed three times in ultrapure water for 10 minutes with gentle agitation, then soaked with
ProQ Diamond stain for 90 minutes, followed by three 30-minute washes in de-stain solution
(20% acetonitrile/50 mM sodium acetate pH 4.0). Finally, gels were washed twice in ultrapure
132

Table S-2: Composition of TAU polyacrylamide gel

Resolving Gel

6 mL (8.2 cm x 9.7 cm x 0.075 cm) Final Concentration

Urea

2.16 g

6M

Acrylamide, 60% (60:0.4) 1.5 mL

15%

Glacial Acetic Acid

0.3 mL

5% (v/v)

10% (v/v) Triton X-100

0.222 mL

0.37% (v/v)

ddH2O

2.24 mL

N/A

APS, 10% (w/v)

80 µL

0.13% (w/v)

TEMED

40 µL

0.67% (v/v)

Stacking Gel

2 mL (8.2 cm x 9.7 cm x 0.075 cm) Final Concentration

Urea

0.72 g

6M

Acrylamide, 60% (60:0.4)

0.3 mL

9%

Glacial Acetic Acid

0.1 mL

5% (v/v)

10% (v/v) Triton X-100

0.074 mL

0.37% (v/v)

ddH2O

0.946 mL

N/A

APS, 10% (w/v)

60 µL

0.3% (w/v)

TEMED

30 µL

1.5% (v/v)

133

water for five minutes and imaged on a Typhoon 9200 (GE Healthcare, Little Chalfont, UK) with
excitation at 532 nm and emission at 560 nm.

NUT-PAGE Transfer and Western Blotting

For immunoblotting analysis following NUT-PAGE, gels were removed from the assembly after
finishing the run, and proteins were transferred to a nitrocellulose membrane using a PhosPhor
semi-dry blotter (Hoefer, Holliston, MA) under constant current of 1.0 mA/cm2 for 2 hours.
Transfer was conducted in either NUT-PAGE running buffer supplemented with 20% methanol
or Towbin’s transfer buffer (25 mM Tris•HCl pH 7.4, 192 mM glycine, and 20% methanol)
(Towbin et al. 1979). When using the NUT-PAGE running buffer for electroblotting, positively
charged proteins such as histones moved from anode to cathode, whereas negatively charged
proteins such as !-synuclein traveled in an opposite direction. If the Towbin’s buffer was used,
all proteins moved from cathode to anode. The assembly of gel and membrane was adjusted
accordingly. It is not necessary to equilibrate the NUT polyacrylamide gel in either transfer
buffer before transferring to the membrane. After transfer, membranes were blocked with 5%
milk in TBST (150 mM NaCl, 27 mM KCl, 250 mM Tris pH 7.4, and 0.05% Tween 20) at room
temperature for 1 hour. Standard procedures for immunoblotting were followed using 1:2,000
dilution of !-synuclein antibody (ab27766) (Abcam, Cambridge, UK) or 1:1,000 dilution of
phospho-S129 !-synuclein antibody (ab59264) (Abcam, Cambridge, UK) in TBST containing
0.4% gelatin at 4°C overnight. Blots were washed with TBST, probed with goat anti-mouse
horseradish peroxidase conjugated secondary antibody (1:5,000 dilution) for 90 minutes, washed
three times with TBST, incubated with Lumilight chemiluminescent substrate (Roche,
Indianapolis, IN) for 5 minutes, and exposed to film.

134

Results

Overview of NUT-PAGE

The NUT-PAGE system is designed to separate proteins by exploiting the differences of net
charge at neutral pH. This gel system uses urea to denature proteins while preserving their
ionization status, unlike SDS that coats proteins with negative charges. Electrophoresis is
conducted at pH 7 that is maintained by a combination of two common laboratory chemicals,
MOPS and imidazole. Neutral pH allows both acidic and alkaline proteins to be separated.
Acidic proteins (pI < 7) and basic proteins (pI > 7) are negatively and positively charged at pH
7.0, respectively, thus migrate toward different electrodes. Electric current direction is adjusted
to match the pI of the protein. In addition, the NUT-PAGE system is compatable with common
immunoblotting techniques and equipment. The following sections demonstrate the setup and
applications of NUT-PAGE.

Gel Electrophoresis of !-synuclein

!-synuclein is an acidic protein with a close link to the development of Parkinson’s disease and
several other neurodegenerative disorders collectively known as the synucleinopathies. These
diseases are manifested by the intraneuronal Lewy bodies containing high abundance of
phosphorylated !-synuclein (Bellucci et al. 2012; Marques and Outeiro 2012). Phosphorylation
of !-synuclein has been reported to occur at several residues, including serines 87 and 129, and
tyrosines 125, 133 and 136 (Chen and Feany 2005). Oligomerization and neurotoxicity of !synuclein can be regulated by phosphorylation (Cavallarin et al. 2010). A simple gel system that
enables the separation of !-synuclein based on its degree of phosphorylation will likely have a
positive impact on the basic and translational research of Parkinson’s disease.

135

Unmodified and Aurora A kinase phosphorylated !-synuclein samples were first analyzed by
SDS-PAGE (Figure S-1A). Like many other phosphorylated proteins, reproducible but subtle
migration retardation was seen in the phosphorylated isoform (right lane). This relatively minor
alteration of mobility was not sufficient to reveal the relative abundance of the phosphorylated
species, nor did it show the degree of !-synuclein phosphorylation. In contrast, the charge
negation caused by each deprotonated phosphate group at the neutral pH is likely to cause a
substantial alteration in the electrophoretic mobility of !-synuclein (pI = 4.7; net charge at pH
7.0 is -8.8 without phosphorylation). Indeed, when resolved by NUT-PAGE, phosphorylated !synuclein ran as multiple faster-migrating species, suggesting different degrees of
phosphorylation (Figure S-1B). This notion was further supported by phosphatase treatment
(Figure S-1C) in that the “weight” of the bands shifted up toward the unphosphorylated !synuclein band, coinciding with the increasing phosphatase doses.

Western blot analysis of !-synuclein of proteins resolved by NUT-PAGE

Western blotting following typical SDS-PAGE provides a convenient method for protein
identification. To establish a protocol for immunoblotting for proteins resolved by NUT-PAGE,
we used a standard semi-dry blotting approach (see Materials and Methods) to transfer !synuclein isoforms from a NUT gel to nitrocellulose membrane. Using the NUT-PAGE running
buffer supplemented with methanol or the Towbin buffer for SDS-PAGE blot transfer, we
successfully transferred !-synuclein to nitrocellulose membrane, as evidenced by the subsequent
immunoblotting with a general !-synuclein antibody and one recognizing phosphorylated
Ser129 of !-synuclein (Okochi et al. 2000) (Figure S-2). As expected, the pSer129 antibody did
not recognize unphosphorylated !-synuclein, but bound three faster migrating species of the
phosphorylated isoform. As this antibody failed to bind to the second highest band (i.e., the
likely monophosphorylated species), it seems likely that Ser129 is a secondary phosphorylation

136

A

!-synuclein

Phosphorylated
!-synuclein

C

B

!Phosphorylated
synuclein !-synuclein

–

+
Figure S-1. NUT-PAGE resolves phosphorylated !-synuclein into multiple species.
A) Phosphorylated !-synuclein exhibits minimal mobility shift in SDS-PAGE. Unmodified and
phosphorylated !-synuclein were resolved by 12% SDS-PAGE and detected by Coomassie blue
staining. B) Multiple isoforms of phosphorylated !-synuclein were resolved by NUT-PAGE.
Purified !-synuclein proteins were analyzed by 10% NUT-PAGE and stained by Coomassie blue.
Unmodified !-synuclein migrated as a single band, whereas phosphorylated !-synuclein were
separated into multiple, higher-mobility bands. Note that these proteins migrated from cathode
(-) to anode (+); more negatively charged phosphorylated species thus exhibited faster mobility

137

Figure S-1 (cont’d) under the electrophoresis condition. C) Phosphatase treatment reduces
mobility of phosphorylated !-synuclein. Phosphorylated !-synuclein was treated with increasing
amounts of calf intestinal phosphatase (CIP) at 37ºC for 60 minutes before NUT-PAGE and
Commassie blue staining. The relative abundance of the faster-migrating species decreased upon
CIP action. Densitometry traces below were generated by ImageJ (http://rsbweb.nih.gov/ij/).
ASYN, !-synuclein, p-ASYN, phosphorylated !-synuclein.

138

A

!synuclein

Phosphory
lated !synuclein

B

A

!synuclein

Phosphory
lated !synuclein

B

–

+
Ab: anti-phosphorylated
S129 !-synuclein

Ab: anti-!-synuclein

Figure S-2: Immunoblotting application following NUT-PAGE. Following 10% NUT-PAGE
resolution, unmodified and phosphorylated !-synuclein were transferred to a nitrocellulose
membrane, and probed with a general anti-!-synuclein antibody (A) or anti-phosphorylated
Ser129 antibody (B) using standard western blotting procedures. Note that panels A and B were
from two independent protein preps and PAGE runs. A parallel anti-!-synuclein immunoblot of
that shown in panel B allowed us to mark the bands not detectable by the phosphorylationspecific antibody (dotted circles), suggesting that Ser129 is phosphorylated only in the presence
of other pre-existing phosphorylation events.

139

site for Aurora A kinase under the experimental condition. Indeed, preliminary mass
spectrometry and mutation studies suggested that Ser84 was the primary phosphorylation site by
Aurora A (data not shown), an observation that is yet to be examined for its biological relevance.
Regardless of the sites of phosphorylation, the results of Figure S-2 confirmed that the NUTPAGE system can be readily integrated into the daily operation of many biochemistry and
molecular biology laboratories.

Histone H3 Acetylation and Phosphorylation

At neutral pH, many proteins are sufficiently charged, rendering them good subjects for NUTPAGE analysis. However, the pI of the underlying protein determines its net charge at any given
pH. For example, basic proteins have a pI that is higher than pH 7.0, and will be positively
charged in the neutral environment of NUT-PAGE. These proteins, such as histones, shall be
loaded at the positive end (anode) of the gel. Acidic proteins including !-synuclein will have to
be loaded on the cathode (negative) end of the gel (Figure S-1). By simply switching the two
electrodes of the gel apparatus, these protein-specific running direction requirements can be met.
To test this prediction, histone H3 was chosen for its well-documented acetylation and
phosphorylation, which are linked to a variety of nuclear activities (Jenuwein and Allis 2001;
Downs 2008; Zentner and Henikoff 2013). Acetylation neutralizes the positive charge of lysine,
whereas phosphorylation adds up to two negative charges to serine or threonine at pH 7. In either
case, the net charge of histone H3 decreases. The mobility is thus predicted to be retarded by
acetylation and phosphorylation when H3 migrates toward the cathode.

The resolution of acetylated and phosphorylated H3 by NUT-PAGE is shown in Figure S-3.
Unmodified H3 ran as a single band, whereas both acetylated and phosphorylated H3 showed
multiple discrete bands with retarded mobility through the NUT gel (Figure S-3A), consistent
with the negation of overall positive charge on the protein. Interestingly, densitometry tracing
140

A

H3

Acetylated Phosphorylated
H3
H3

+

–

B

H3

Acetylated
H3

TAU, Silver Stain

H3

Phosphorylated
H3

TAU, Silver Stain

H3

Phosphorylated
H3

TAU, ProQ Diamond Stain

Figure S-3: Both acetylated and phosphorylated histone H3 isoforms can be resolved by
NUT-PAGE, whereas TAU-PAGE can only resolve the acetylated H3 species.
141

Figure S-3 (cont’d)(A) 15% NUT-PAGE was used to separate the positively charged histone H3.
The densitometric traces (bottom) of the silver-stained histone H3 species were generated by
ImageJ (http://rsbweb.nih.gov/ij/). Both acetylation and phosphorylation reduce the net positive
charge on histone H3, resulting in multiple bands that display reduced mobility in the gel matrix.
Note that histone H3 is a basic protein, which thus was run from annode to cathode. (B) Tritonacetic acid-urea (TAU) gel does not resolve phosphorylated histone H3. A conventional TAU gel
(15%) was used to resolve different H3 isoforms. The left panel shows silver stained unmodified
and acetylated histone H3 after electrophoresis. Acetylated species of histone H3 migrate at a
slower rate, with comparable resolution to NUT-PAGE. The right panel shows unmodified and
phosphorylated histone H3 stained by either silver stain or the phospho-specific ProQ Diamond
stain following TAU-PAGE. Phosphorylated histone H3 displays only a marginal decrease in
mobility. ProQ Diamond staining confirmed phosphorylation was present on the modified
protein.

142

shows that acetylation and phosphorylation caused discernible differences in mobility
retardation. This distinction probably results from the charge difference between these two
modifications, although the sizes of acetyl and phosphate groups (42 Da vs. 80 Da) may also
contribute to this phenomenon.

The same batch of acetylated and phosphorylated H3 were also analyzed using a traditional TAU
gel system. Figure S-3B shows the separation of acetylated H3 isoforms in the acidic matrix.
Multiple bands were observed but the number of acetylated H3 isoforms was frequently smaller
in TAU gels. Additionally, the phosphorylated forms of H3 co-migrated in a single band and
displayed only a modest mobility shift. The phosphorylation status of histone H3 was confirmed
by utilizing the ProQ Diamond stain that specifically detected phosphorylated proteins (right
panel, Figure S-3B). The inability of TAU gel to resolve phosphorylated H3 species was most
likely because of the acidity of the gel (pH 2.4) that is close to pKa1 (2.15) and well below pKa2
(~7) (Weast 1966; Peacock and Nickless 1969) of the phosphate group within a protein, leading
to significant protonation and hence a minimal charge difference. Therefore, while the TAU gel
has been used widely to resolve acetylated H3, it might not be as useful in resolving
phosphorylated H3.

Analysis of Modified Histones in Cell Culture

Results of Figure S-3 have displayed the utility and effectiveness of NUT-PAGE for
investigating the modification status of recombinantly expressed proteins purified from E. coli.
To test whether NUT-PAGE can also be utilized to probe the post-translational modifications of
proteins isolated from cultured cells, we prepared HeLa histones after treating the cells with
sodium butyrate and nocodazole that, respectively, triggered histone hyperacetylation and
hyperphosphorylation (Wei et al. 1999). Total histones were obtained from the untreated and
treated cultures for NUT-PAGE (Figure S-4A). Purified chicken histones were used
143

A

B

HeLa Histones
H2A

H2B

Un

NaB

Noc.

H3

H4

B

+

Nocodazole

HeLa Histone H3
-

+

-

+

-

+

+

–

–

Silver Stain

Ab: anti-H3

Ab: antipS10 H3

Figure S-4: Post-translationally modified histones isolated from cell culture can be resolved
by NUT-PAGE. (A) HeLa cells were treated with sodium butyrate to induce hyperacetylation or
nocodazole to block progression through mitosis and enrich for phosphorylated serine 10 of
histone H3. Histone proteins were then isolated and separated by NUT-PAGE. Sodium butyrate
treatment resulted in increased histone H4 acetylation, as can be seen by a decreased mobility of
multiple bands resulting from the loss of charge. Histone H3 phosphorylation cannot be noted
due to co-migration of histones H2B and H3. Purified chicken histones were used as mobility
references for each core histone protein. (B) Histone H3 was isolated from crude histones by RPHPLC and modified species of histone H3 were resolved by NUT-PAGE and visualized by silver
staining. Histone H3 collected from untreated HeLa cells migrates as three distinct bands, while
histone H3 from nocodazole treated HeLa cells displayed additional bands with overall lowered
mobility in NUT-PAGE, consistent with the fact that metaphase H3 is phosphorylated at Ser10.
Western analysis using an antibody against H3 phosphorylated at Ser10 confirmed that
phosphorylation is associated with retarded gel mobility of NUT-PAGE.

144

as the indicators for their HeLa counterparts. Hyperactylation can be observed in the sodium
butyrate treated sample by noting the shift of “weight” in the histone H4 species to slower
migrating species, indicating acetylation and the consequent loss of charge. However, the
anticipated H3 phosphorylation resulting from mitotic arrest was difficult to detect, as histone H3
and histone H2B display similar mobility, and therefore overlap in NUT-PAGE. To solve this
problem, we used reverse phase HPLC to fractionate H3 from H2B. Silver staining of H3
separated by NUT-PAGE revealed clear mobility retardation in the nocodazole-treated sample
(Figure S-4B). This change in mobility was associated with Ser10 phosphorylation, as confirmed
by western analysis with a phospho-S10 H3 antibody (Figure S-4B). We therefore conclude that
NUT-PAGE also can be used for probing the post-translational modification status of histones
from a natural source.

145

Discussion

Experimental results presented above show that the NUT-PAGE system can resolve both
acetylated and phosphorylated species of acidic and basic proteins. Inexpensive and common
laboratory chemicals are used. We also provided the protocols for blotting and western detection.
Together, the NUT-PAGE system affords an attractive alternative to acid urea gels and
isoelectrofocusing.

The neutral pH of NUT-PAGE ensures that each phosphate group is deprotonated (pKa1 = ~2;
pKa2 = ~7) (Peacock and Nickless 1969), whereas the acidic pH of the widely used TAU gel may
restrict phosphate group deprotonation to a minimal. While this partial deprotonation was
sufficient for the resolution of hyperphosphorylated H1 (Ryan and Annunziato 2001),
phosphorylated H3 only exhibited subtle mobility changes in the TAU gel system. In theory,
NUT-PAGE is also compatible with other phosphorylation marks, i.e., phosphotyrosine and the
acid-labile phosphohistidine. By the same token, other charge-altering PTMs such as
deamination (converting glutamine to glutamate) and sulfation (addition of a sulfate to tyrosine)
may also be good subjects for NUT-PAGE.

The effectiveness of NUT-PAGE is limited by two factors intrinsic to proteins: pI and molecular
weight. Proteins with a pI near 7.0 will possess very little net charge at pH 7.0, resulting in low
or no electrophoretic mobility. Posttranslational modifications that alter the net charge of these
proteins may help push the modified species into the gel. Changes made to the current NUTPAGE recipe, such as a slightly different pH and the addition of Coomassie blue G-250, which,
unlike SDS, only adds a limited amount of charges to proteins (Congdon et al. 1993), may
broaden the applicability of the current methodology. The effect of molecular weight was first
noted when we tried to resolve bovine serum albumin (BSA; molecular weight ca. 65 kD) by
NUT-PAGE. BSA displayed limited mobility and resolution (data not shown). A lower
146

percentage gel (e.g., 10%) did provide some improvement, but we have yet to try even lower
concentrations due to the increased frailty of the gel. A thicker gel matrix will likely be useful.

NUT-PAGE sometimes runs overnight for a better resolution. An important precaution for
overnight electrophoresis is to ensure that the seal between the plate and the top buffer reservoir
is intact as buffer leakage may severely impair the overall quality. Additionally, common
practices help maintain consistency in gel quality. These include de-aeration and filtering the gel
solutions before casting; flushing each well with the running buffer immediately before sample
loading; and using minimal volume of the sample. Pre-running with or without the scavenger
solution (i.e., the gel loading buffer) did not result in appreciable improvement and sometimes
reduces band sharpness (data not shown). Pre-running thus is not recommended.

Lastly, we suspect that certain deviations of the gel recipes are worth testing for improvement.
For example, Triton DF-16 and Trixon X-100 have differential effects on histone resolution by
TAU gel electrophoresis (Alfageme et al. 1974). Varying the concentration of Triton X-100 or
switching to Triton DF-16 may be desirable for certain applications. Employment of buffering
agents other than MOPS and imidazole may also provide refinement.

Author Contribution

CB established the immunoblotting procedures for NUT-PAGE. CB and SH were responsible for
the preparation of HeLa histones. ML and XD each was responsible for the cloning, expression,
isolation, and gel characterization of !-synuclein and histone H3, respectively. RP-HPLC was
performed by XD. MHK developed the original NUT-PAGE recipe and coordinated the
compilation of this manuscript. The initial setup of the gel system was done by XX.

147

Acknowledgments

The authors acknowledge anonymous reviewers for their insightful suggestions and constructive
comments. This work was supported by grants from the Rackham Fund, Michigan State
University, the NIH (AG039768), and NSF (MCB1050132).
The authors declare no competing interests.

148

REFERENCES

149

REFERENCES

Aka, J.A., Kim, G.-W., and Yang, X.-J. (2011). K-acetylation and its enzymes: overview and new
developments. Handb Exp Pharmacol 206, 1–12.
Alfageme, C.R., Zweidler, A., Mahowald, A., and Cohen, L.H. (1974). Histones of Drosophila
embryos. Electrophoretic isolation and structural studies. J. Biol. Chem. 249, 3729–3736.
Bellucci, A., Zaltieri, M., Navarria, L., Grigoletto, J., Missale, C., and Spano, P. (2012). From "synuclein to synaptic dysfunctions: New insights into the pathophysiology of Parkinson’s
disease. Brain Research 1476, 183–202.
Cavallarin, N., Vicario, M., and Negro, A. (2010). The role of phosphorylation in
synucleinopathies: focus on Parkinson’s disease. CNS Neurol Disord Drug Targets 9, 471–481.
Chen, L., and Feany, M.B. (2005). "-Synuclein phosphorylation controls neurotoxicity and
inclusion formation in a Drosophila model of Parkinson disease. Nature Neuroscience 8, 657–
663.
Congdon, R.W., Muth, G.W., and Splittgerber, A.G. (1993). The binding interaction of
Coomassie blue with proteins. Anal. Biochem. 213, 407–413.
Downs, J.A. (2008). Histone H3 K56 acetylation, chromatin assembly, and the DNA damage
checkpoint. DNA Repair 7, 2020–2024.
Gasparini, L., Anthony Crowther, R., Martin, K.R., Berg, N., Coleman, M., Goedert, M., and
Spillantini, M.G. (2011). Tau inclusions in retinal ganglion cells of human P301S tau transgenic
mice: Effects on axonal viability. Neurobiology of Aging 32, 419–433.
Hoffmann, P.J., and Chalkley, R. (1976). A neutral pH acrylamide gel electrophoretic system for
histones and other basic proteins. Anal. Biochem. 76, 539–546.
Jackson, V. (1999). Formaldehyde cross-linking for studying nucleosomal dynamics. Methods
17, 125–139.
Jenuwein, T., and Allis, C.D. (2001). Translating the Histone Code. Science 293, 1074–1080.
Johmann, C.A., and Gorovsky, M.A. (1976). Purification and characterization of the histones
associated with the macronucleus of Tetrahymena. Biochemistry 15, 1249–1256.
Koprinarova, M., Markovska, P., Iliev, I., Anachkova, B., and Russev, G. (2010). Sodium
butyrate enhances the cytotoxic effect of cisplatin by abrogating the cisplatin imposed cell cycle
arrest. BMC Mol. Biol. 11, 49.
Laemmli, U.K. (1970). Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 227, 680–685.
Marques, O., and Outeiro, T.F. (2012). Alpha-synuclein: from secretion to dysfunction and death.
Cell Death and Disease 3, e350.
O’Farrell, P.H. (1975). High resolution two-dimensional electrophoresis of proteins. J. Biol.
Chem. 250, 4007–4021.

150

Okochi, M., Walter, J., Koyama, A., Nakajo, S., Baba, M., Iwatsubo, T., Meijer, L., Kahle, P.J.,
and Haass, C. (2000). Constitutive phosphorylation of the Parkinson’s disease associated alphasynuclein. J. Biol. Chem. 275, 390–397.
Peacock, C.J., and Nickless, G. (1969). The Dissociation Constants of some Phosphorus(V)
Acids. Zeitschrift Für Naturforschung A 24.
Ryan, C.A., and Annunziato, A.T. (2001). Separation of histone variants and post-translationally
modified isoforms by triton/acetic acid/urea polyacrylamide gel electrophoresis. Curr Protoc Mol
Biol Chapter 21, Unit 21.2.
Shechter, D., Dormann, H.L., Allis, C.D., and Hake, S.B. (2007). Extraction, purification and
analysis of histones. Nature Protocols 2, 1445–1457.
Taber, H.W., and Sherman, F. (1964). Spectrophotometric analyzers for disc electrophoresis:
studies of yeast cytochrome c. Ann. N. Y. Acad. Sci. 121, 600–615.
Thomas, J.M., and Hodes, M.E. (1981). A new discontinuous buffer system for the
electrophoresis of cationic proteins at near-neutral pH. Anal. Biochem. 118, 194–196.
Towbin, H., Staehelin, T., and Gordon, J. (1979). Electrophoretic transfer of proteins from
polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad.
Sci. U.S.A. 76, 4350–4354.
Vesterberg, O., and Svensson, H. (1966). Isoelectric fractionation, analysis, and characterization
of ampholytes in natural pH gradients. IV. Further studies on the resolving power in connection
with separation of myoglobins. Acta Chem Scand 20, 820–834.
Walsh, C. (2006). Posttranslational modification of proteins: expanding nature’s inventory
(Englewood, Colo: Roberts and Co. Publishers).
Weast, R.C. editor (1966). CRC Handbook of Physics and Chemistry, 47th ed. (Cleveland, Ohio:
CRC Press).
Wei, Y., Yu, L., Bowen, J., Gorovsky, M.A., and Allis, C.D. (1999). Phosphorylation of histone
H3 is required for proper chromosome condensation and segregation. Cell 97, 99–109.
Wong, C., Sridhara, S., Bardwell, J.C., and Jakob, U. (2000). Heating greatly speeds Coomassie
blue staining and destaining. BioTechniques 28, 426–428, 430, 432.
Wray, W., Boulikas, T., Wray, V.P., and Hancock, R. (1981). Silver staining of proteins in
polyacrylamide gels. Anal. Biochem. 118, 197–203.
Zentner, G.E., and Henikoff, S. (2013). Regulation of nucleosome dynamics by histone
modifications. Nature Structural & Molecular Biology 20, 259–266.

151