THE ROLE OF LATERAL HYPOTHALAMIC NEUROTENSIN NEURONS
IN ADAPTIVE ENERGY BALANCE
By
Juliette Anne Brown

A DISSERTATION
Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of
Pharmacology and Toxicology–Environmental Toxicology–Doctor of Philosophy
2017

ABSTRACT
THE ROLE OF LATERAL HYPOTHALAMIC NEUROTENSIN NEURONS
IN ADAPTIVE ENERGY BALANCE
By
Juliette Anne Brown
The lateral hypothalamic area (LHA), receives cues of energy and fluid status from the
body and coordinates appropriate feeding, drinking and activity (e.g. adaptive responses) to
ensure survival. The LHA contains many distinct populations of neurons, however, and it
remains unclear how each of these contribute to energy balance. Here we sought to
understand how LHA neurons expressing the neuropeptide neurotensin (LHA Nts neurons)
coordinate distinct behaviors necessary for adaptive response and control of body weight.
While activation of most LHA Neurons increases both feeding and drinking, activation of LHA
Nts neurons specifically promotes drinking but reduces feeding. LHA Nts neurons may exert
these divergent actions via distinct circuits, as they have been shown to modulate dopamine
(DA) signaling and local orexin (OX) neurons. Consistent with this, we have distinguished two
projection-specific and molecularly distinct subsets of LHA Nts neurons. One subset coexpresses Nts and the long form of the leptin receptor (LepRb), is activated by leptin and
projects to the ventral tegmental area (VTA) and substantia nigra compacta (SNc); we refer to
these as NtsLepRb neurons. A separate subset of LHA Nts neurons lacks LepRb, is activated by
dehydration and does not project to the VTA or SNc; we refer to these as NtsDehy neurons.
Intriguingly, however, we found all LHA Nts neurons are similar in that they express the
inhibitory neurotransmitter, GABA. We next investigated the role of the NtsLepRb subpopulation
for adaptive response by studying mice lacking leptin signaling via NtsLepRb neurons. Loss of
leptin regulation only via NtsLepRb neurons induced obesity, blunted adaptive response to leptin
and to ghrelin (a hormonal activator of OX neurons) and dysregulated DA signaling. Finally, we

defined the necessity of LHA Nts neurons for energy balance by genetically ablating or
chemogenetically inhibiting them in adult mice. Prolonged loss of LHA Nts neurons decreased
drinking, locomotor activity and deranged OX expression in target neurons that led to increased
adiposity. By contrast, LHA Nts inhibition preserved OX expression but still blunted locomotor
activity. Together these data suggest that LHA Nts neurons modulate physical activity that is
not dependent on OX, but that the LHA NtsOX circuit is necessary for regulation of drinking
and adiposity. Collectively, our data show that LHA Nts neurons are necessary for regulation of
adaptive energy balance, and that distinct subpopulations of LHA Nts neurons may control
ingestive and locomotor behavior via OX-dependent and independent pathways. This work
suggests that there may be unique LHA Nts circuits to regulate drinking, motivated feeding
ingestive disorders such as obesity, anorexia nervosa, psychogenic polydipsia and dehydration.

To my family, lab mates and mentors

iv

ACKNOWLEDGEMENTS

I would like to sincerely thank my mentor and science hero, Gina Leinninger for her
unrelenting support and guidance.

I have grown as a scientist, as a mentor and as a human

being, thanks to the unwavering, patience and encouragement she has provided. There was
never a moment that I did not feel supported or heard and my work was always appreciated. I
feel very lucky to have had this opportunity. It has been a true honor.
I would also like to thank my thesis committee members, Drs. A.J. Robison, James
Galligan, Cheryl Rockwell, and Keith Lookingland for thoughtful suggestions, enthusiastic
discussion, and support.
I want to acknowledge the work of some very talented undergraduate students, who
made substantial contributions to this project: Thomas Mayer, Anna Wright, and Andrew
Sagante.

It’s been amazing to have the opportunity to teach them so much and to watch them

as they continue to grow and succeed.
I would like to thank all the members of the Leinninger lab: Raluca Bugescu, Hillary
Woodworth, Gizem Kurt, Patricia Perez-Bonilla, and Laura Schroeder, for being so supportive
and inspiring. All of these women are remarkable human beings, and it has been such a
privilege to work with, and be inspired by each of them.
Sandra O’Reilly played a key role in the execution of metabolic testing. Her diligence
and attention to detail played a big role in the behavioral and metabolic aspects of this project.
Finally, none of this work would have possible without the tireless work of the MSU animal care
staff, who vigilantly watched over our precious test subjects.
This research was supported by grants from the National Institutes of Health to JAB
(T32-ES00725527, F31-DK107081) and GML (R00-DK090101, R01-DK103808)
v

TABLE OF CONTENTS
LIST OF FIGURES...................................................................................................................................vii
KEY TO ABBREVIATIONS ..................................................................................................................... ix
CHAPTER 1 An Introduction: Body Weight Regulation – Neuronal Populations in the Lateral
Hypothalamus ............................................................................................................................................. 1
1.1
Introduction.................................................................................................................................... 1
1.2
Melanin Concentrating Hormone (MCH) Neurons ........................................................................ 9
1.3
Orexin/Hypocretin (OX) Neurons ................................................................................................ 13
1.4
Neurotensin (Nts) Neurons ......................................................................................................... 16
1.5
Summary and Rationale for Studying LHA Nts Neurons in Energy Balance .............................. 23
1.6
Goals of the Dissertation ............................................................................................................. 24
1.7
Figures ........................................................................................................................................ 27
CHAPTER 2 Heterogeneity of Lateral Hypothalamic Neurotensin Neurons: Distinct Subsets Are
Activated by Leptin or Dehydration ........................................................................................................ 28
2.1
Abstract ....................................................................................................................................... 28
2.2
Introduction.................................................................................................................................. 29
2.3
Materials and Methods ................................................................................................................ 31
2.4
Results ........................................................................................................................................ 36
2.5
Discussion ................................................................................................................................... 46
2.6
Figures ........................................................................................................................................ 53
CHAPTER 3 Loss of Action via Neurotensin-Leptin Receptor Neurons Disrupts Leptin and GhrelinMediated Control of Energy Balance ...................................................................................................... 67
3.1
Abstract ....................................................................................................................................... 67
3.2
Introduction.................................................................................................................................. 68
3.3
Materials and Methods ................................................................................................................ 70
3.4
Results ........................................................................................................................................ 78
3.5
Discussion ................................................................................................................................... 89
3.6
Figures ........................................................................................................................................ 95
CHAPTER 4 Lateral Hypothalamic Area Neurotensin Neurons are Required for Control of Energy
Balance
104
4.1
Abstract ..................................................................................................................................... 104
4.2
Introduction................................................................................................................................ 105
4.3
Materials and Methods .............................................................................................................. 106
4.4
Results ...................................................................................................................................... 111
4.5
Discussion ................................................................................................................................. 118
4.6
Figures ...................................................................................................................................... 123
CHAPTER 5 Summary, Discussion of Outcomes and Future Directions ........................................ 134
5.1
Summary of Dissertation ........................................................................................................... 134
5.2
Discussion ................................................................................................................................. 137
5.3
Figure ........................................................................................................................................ 146
REFERENCES ......................................................................................................................................... 149

vi

LIST OF FIGURES
Figure 1-1: Proposed Model of LHA Nts Neuronal Regulation of Energy Balance .................................... 27
Figure 2-1: Validation of NtsCre;GFP Mice to Visualize LHA Nts Neurons .................................................. 53
Figure 2-2: LHA Nts Neuron Project to the VTA and SNc .......................................................................... 54
Figure 2-3: Nts LepRb Neurons Project to the VTA and SNc ..................................................................... 56
Figure 2-4: Dehydration-sensitive LHA Nts Neurons Do Not Project to the VTA or SNc ........................... 58
Figure 2-5: LHA NtsLepRb Neurons are Molecularly Distinct from NtsDehy Neurons ..................................... 60
Figure 2-6: Visualization of LHA GABA and Glutamate Neurons ............................................................... 61
Figure 2-7: FlpO-Mediated Detection of Nts Neurons ................................................................................ 62
Figure 2-8: Dual Recombinase Identification of Neurotransmitter Content of Nts Neurons ....................... 63
Figure 2-9: Confirmation of Dual Recomibinase Results With Colchicine Treatment ................................ 65
Figure 2-10: Model of LHA Nts Subpopulations and Their Neurotransmitter Content and Projection
Targets ................................................................................................................................................ 66
Figure 3-1: Distribution of Neuropeptide-Defined and LepRb Neuron in the LHA ...................................... 95
Figure 3-2: Nts and OX neurons Respond to Distinct Hormonal Cues ...................................................... 96
Figure 3-3: Loss of Leptin Action via NtsLepRb Neurons Blunts the Ghrelin-Mediated Activation of OX
Neurons ............................................................................................................................................... 97
Figure 3-4: Loss of Leptin Signaling via NtsLepRb Neurons Disrupts Energy Balance ............................. 98
Figure 3-5: Loss of Action via NtsLepRb Neurons Disrupts Adaptive Reward Preference ........................ 99
Figure 3-6: Loss of Action via NtsLepRb Neurons Disrupts Adaptive Reward Wanting........................... 100
Figure 3-7: Loss of Action via NtsLepRb Neurons Disrupts LHA Gene Expression................................. 101
Figure 3-8: Projections of LHA Nts Neurons and Activation of Mesolimbic DA Signaling ....................... 102
Figure 3-9: Model Leptin-Mediated LHA Nts Neuronal Contribution to Energy Balance .......................... 103
Figure 4-1: Ablation of LHA Nts Neurons Increases Adiposity ................................................................. 123
Figure 4-2: Loss of LHA Nts Neurons Blunts Water Intake and Locomotion............................................ 124
Figure 4-3: Motivational Locomotor Activity is Blunted by Loss of LHA Nts Neurons .............................. 125
Figure 4-4: Loss of LHA Nts Neurons Decreases Drinking but Not Sucrose Preference ......................... 126
Figure 4-5: Time Course Showing Loss of LHA Neurons After Ablation of Nts Population ..................... 127
Figure 4-6: Loss of LHA Nts Neurons Leads to a Decrease in OX Peptide Expression .......................... 129
Figure 4-7: Inhibition of LHA Nts Neurons Blunts Locomotion ................................................................. 130

vii

Figure 4-8: Inhibition of LHA Nts Neurons Does Not Reduce OX ............................................................ 132
Figure 4-9: Chemogenetic Inhibition of LHA Nts Neurons Blunts Response to Leptin ............................ 133
Figure 5-1: Model Showing Major Study Findings .................................................................................... 146
Figure 5-2: Table Comparing Animal Models Used in This Research ...................................................... 147

viii

KEY TO ABBREVIATIONS

3V

third ventricle

ANOVA

analysis of variance

ARC

arcuate nucleus

CNO

clozapine-N-oxide

CPu

caudate/putamen

DA

dopamine

DAT

dopamine transporter

Dlk1

delta-like 1

DREADD

Designer Receptors Exclusively Activated by Designer Drugs

EGFP

enhanced green fluorescent protein

f

fornix

FG

fluorogold

FR

fixed ratio

GABA

gamma-aminobutyric acid

Gal

galanin

GFP

green fluorescent protein

GHSR

growth hormone secretagogue receptor

i.p.

intraperitoneal

ix

ICV

intracerebroventricular

ISH

in situ hybridization

LepRb

leptin receptor

LHA

lateral hypothalamic area

LPO

lateral preoptic area

LRKO

LepRb knocked out

MCH

melanin-concentrating hormone

mt

mammillothalamic tract

NAc

nucleus accumbens core

NAsh

nucleus accumbens shell

Nts

neurotensin

NtsR1

neurotensin receptor 1

OX

orexin/hypocretin

PCR

polymerase chain reaction

POA

preoptic area

PR

progressive ratio

PVN

paraventricular hypothalamic nucleus

RER

resting energy expenditure

RT

reverse transcription

SEM

standard error of the mean
x

SN

substantia nigra

STN

subthalamic nucleus

TH

tyrosine hydroxylase

VMH

ventromedial hypothalamus

VTA

ventral tegmental area

ZI

zona incerta

xi

CHAPTER 1

An Introduction: Body Weight Regulation

– Neuronal Populations in the Lateral Hypothalamus
1.1 Introduction
An organism’s survival depends on its ability to sense nutrient status and accordingly
regulate intake and energy expenditure behaviors. Uncoupling of energy sensing and behavior,
however, underlies energy balance disorders such as anorexia or obesity. The hypothalamus
regulates energy balance, and the lateral hypothalamic area (LHA) is poised to coordinate
peripheral cues of energy status and behaviors that impact weight. The LHA modulates food
intake, thus was dubbed the ‘feeding center’ of the brain, but is also an essential regulator of
drinking, locomotor behavior, arousal/sleep and autonomic output. There are several
populations of LHA neurons that are defined by their neuropeptide content and contribute to
energy balance. LHA neurons that express the neuropeptides melanin-concentrating hormone
(MCH) or orexins/hypocretins (OX) are best defined and these neurons play important roles in
regulating ingestion, arousal, locomotor behavior and autonomic function via distinct neuronal
circuits. Recently, another major population of LHA neurons containing the neuropeptide
Neurotensin (Nts) has been implicated in coordinating anorectic stimuli and behavior to regulate
hydration and energy balance. Intriguingly, there are subsets of Nts neurons that are ‘tuned’ to
specific cues of energy status; this heterogeneity potentially allows for more discrete control and
rectification of energy imbalance. Understanding the neuronal circuits via which the LHA
coordinates energy sensing and behavior and the role that Nts neurons and the underlying subpopulations has the potential to inform pharmacological strategies to modify behaviors and treat
energy balance disorders.

1

1.1.1

The Periphery and the Brain Act in Concert to Regulate Energy Balance
Food and water are essential for survival, and organisms have developed physiological

systems to ensure that the body maintains sufficient stores of these resources 1. Such systems
must synthesize two crucial processes: energy sensing (to determine the resource needs of the
body) and appropriate output behaviors that are organized by the brain (to resolve bodily need).
For example, resource deficits such as fasting, or dehydration increase the motivation to find
and ingest food and water, respectively. Resource excess is also coordinated with an
appropriate behavioral response: stomach fullness or increased energy reserves (e.g. body fat)
cue the cessation of feeding while also promoting physical activity and fat burning to resolve
energy excess 2;3. At their essence, such physiologic ‘drive’ systems thus match bodily need
and behavior to ensure survival. These systems must also be dynamic, since bodily resource
needs fluctuate considerably each day (from periods of repletion to deficit and back again), and
must continually survey the energy and hydration status of the body to detect and resolve any
imbalance. Further, physiologic systems that modulate drive to drink, eat and move inherently
regulate energy balance: the caloric intake and amount of energy expended that together
determine the weight of the organism. Extreme deficits in energy intake impair survival, while
excesses in energy can promote metabolic disease and morbidity. Thus, survival and energy
balance are irrevocably linked, and rely on constant, dynamic communication between the
periphery and the brain.

How then does the body convey messages that can be ‘read’ by the brain, and how
does the brain interpret these into behaviors to correct energy imbalance? A major step
forward in understanding this process was the discovery of circulating hormones that
communicate energy status, and how loss of communication between the periphery and brain
promotes disease. One such body-to-brain regulator is the hormone leptin, which is produced
2

in adipose tissue and acts to suppress feeding and promote energy expenditure via neurons in
the brain that express the long form of the leptin receptor, LepRb 4-7. Loss of either peripheral
leptin production or central LepRb expression promotes overeating, decreases energy output
and leads to severe obesity in rodents 4-6 and humans 8;9, revealing the crucial role of this
periphery/brain regulatory system. The hormone ghrelin also mediates powerful control of
energy balance via regulation in the brain. Ghrelin is produced by the stomach during periods
of energy deficit and acts via brain neurons expressing the growth hormone secretagogue
receptor (GHSR) to stimulate feeding 10;11. Increased ghrelin action via GHSR promotes overfeeding and potentiates weight gain 12. These examples demonstrate that peripheral cues
access and regulate the brain to either promote or inhibit feeding behaviors, and thus regulate
energy balance.

Normal energy balance relies on the appropriate synergism of peripheral cues and
behavior, but uncoupling these deranges energy balance. Indeed, individuals with anorexia
nervosa self-restrict their feeding despite intact cues signaling energy need 13. Similarly,
tastiness can trump satiation: few among us are invulnerable to the attractive sight and smell of
a dessert, despite having just consumed an ample meal and being energy replete. As such,
normal weight and obese individuals may over consume palatable, calorie-dense foods despite
the presence of energy excess signals that should inhibit intake 14. Thus, eating disorders or
obesity occur when the need to eat no longer matches the desire to eat 15, incurring serious
health tolls including increased morbidity. Yet despite the increasing severity of anorexia in
youth 16 and the obesity pandemic 17;18, there remain limited pharmacologic treatments to modify
energy imbalances 19;20. Modifying diet and exercise remains the gold standard treatment for
disordered energy balance, but these lifestyle changes are difficult to maintain long term, yield
modest improvements in body weight and prove largely ineffective at improving functional
3

outcomes and life expectancy 19;21-23. Surgical interventions such as gastric banding or gastric
bypass are effective in promoting weight loss in obese individuals, but these procedures are
highly invasive, and many individuals regain weight in subsequent years 24;25. It is therefore
imperative to identify strategies to restore normal energy balance function to treat the millions of
individuals suffering from these diseases. Identifying the brain mechanisms that coordinate
energy cues and appropriate behavioral response will suggest tractable pharmacological
pathways to treat feeding and energy balance disorders.

While many areas of the brain contribute importantly to the regulation of feeding and
metabolism, this review will focus on the role of the lateral hypothalamic area (LHA) in
controlling energy balance for three reasons. 1) The LHA modifies intake of natural and
pharmacologic rewards and physical activity, and such function via the LHA is required for
survival. 2) The LHA is anatomically positioned to receive peripheral cues and regulate
motivated behaviors. 3) Distinct neuronal populations within the LHA are ‘tuned’ to specific
energy cues and induce cue-appropriate behavioral responses. Thus, understanding the
precise neurochemistry, connectivity and function of the LHA neuronal subpopulations will
suggest mechanisms by which to suppress or enhance feeding, drinking and energy
expenditure as required to restore energy balance. Modifying action via the LHA therefore has
potential to improve a spectrum of health problems.

1.1.2

The Lateral Hypothalamic Area (LHA) is a Crucial Regulator of Energy Balance
The hypothalamus as a whole has long been recognized to modulate body weight, water

balance, body temperature and the sympathetic nervous system 26. Hetherington and Ranson
were the first to imply that each sub-region of the hypothalamus controls specific facets of

4

energy balance, demonstrating that selective lesion of the ventromedial nucleus of the
hypothalamus (VMH) caused profound overeating and obesity. The VMH was hence deemed
an essential ‘satiety center’ of the brain 27;28 and inspired many labs to study ‘hypothalamic
obesity’ caused by VMH lesions It was in this context that Bal K. Anand, (while working at Yale
with Brobeck) was using stereotaxic techniques to lesion the VMH of rats and, by his account,
“…was much disconcerted to find that my rats immediately after such lesions completely
stopped eating and would die of starvation”. This phenotype was completely opposite of the
hyperphagia and obesity expected due to lesion of the VMH 29. As it turned out, Anand and
Brobeck had made a (fortuitous) targeting error, missing the VMH, but instead ablating the LHA
in their experimental rats. The resulting LHA-lesioned rats had the ability to move, eat and
drink, but lost all inclination to do so: as a result, they all died of self-inflicted starvation and
dehydration 30-32. By contrast, electrical stimulation of the LHA promotes feeding and drinking
behaviors, as well as increasing physical activity 33-35. Collectively, these seminal loss and gain
of function experiments suggested that the LHA is a ‘feeding center’ that acts in opposition to
the VMH satiety center and led to the ‘dual center hypothesis’ of feeding regulation 36;37. Today
the LHA is still regularly described as the feeding center of the brain, which often overshadows
its other crucial roles for regulating drinking, physical activity, alertness/arousal and coordination
of sensory stimuli with appropriate output behaviors 38

The fact that LHA-lesioned animals imminently died of starvation and dehydration
complicated their use to determine how the LHA promoted feeding. Teitelbaum and Stellar
found that rats with LHA lesions could only be kept alive via force-feeding them liquid nutrients
three times per day 39. This regimen was a serious toll for Teitelbaum (the last daily treatment
was at 2:00 AM!) and he grew desperate for a way to induce the animals to feed themselves.
He recalled another time he’d had to stay up till the wee hours dealing with rats, while
5

performing husbandry of a rat colony during his assistantship: “I used to stop, munch chocolate
bars, and offer the rats some. I soon discovered that shortly before my break, many rats were
lined up at the front of each cage, all waiting for their treat. Later, I remembered this when
trying to tempt aphagics to eat. Nevertheless, it was a thrill to see a rat, being kept alive by
tube-feeding, refusing food and water for two months postoperatively, suddenly gobble up bits
of chocolate.” 40 Thus, Teitelbaum found that LHA-lesioned rats eschewed normal foods, but
could be coaxed to eat sufficient calories in the form of palatable substances (i.e. evaporated
milk, cookies, milk chocolate but not bittersweet chocolate) to permit their survival 41.
Eventually, the lesioned rats overcome their aphagia, resume normal feeding and regain weight.
Importantly, this discovery suggested that loss of LHA function didn’t negate the ability to feed,
but blunted the motivation to feed, even when food is desperately needed for survival. Further,
it identified the LHA as an important center for feeding drive, though it is not the sole mediator of
motivated ingestion; other neuronal systems exert some (presumably lesser) drive that can, in
time, be sufficient to mediate survival 41. Intriguingly, drinking drive remains particularly
impaired in LHA-lesioned animals even after their ‘recovery’. These seemingly normal rats do
not coordinate physiologic perturbations (e.g. high salt-intake/dehydration, hunger, altered food
valuation) with appropriately paired drinking or feeding behavior 38;42;43. Close observation
revealed that drinking is strictly time-locked with feeding bouts in these rats, “…as if the animal
were drinking not to quench its thirst but simply to wet its mouth…perhaps just as a means to
wet food and make it swallow-able” 43. Thus, while other neuronal systems can mediate
aspects of motivational drive, the LHA is crucial for pairing physiologic cues and drive response.

Anatomists challenged the notion that the ‘cell-poor’ LHA could itself regulate motivation,
arguing that it was actually due to lesion or stimulation of the diffuse fiber systems passing
through the LHA. Coursing through the LHA are nigro-striatal dopamine fibers as well as axons
6

of passage within the medial forebrain bundle (mfb), each of which terminate in brain centers
associated with reward and motivation 44. Indeed, these tracts regulate motivation, and
disruption of the mfb or dopamine-containing neurons blunts feeding, drinking and movement
behavior, similar to LHA lesions 42;44-47. Two crucial findings, however, solidified a specific role
for LHA neurons in regulating motivation relevant to energy balance. First, stimulation of the
LHA still induces motivated feeding even in rats with a severed mfb 47. Secondly, neurotoxins
that selectively ablate LHA cell bodies, but spare axons passing through the LHA, results in
aphagia and adipsia similar to the original lesions that disrupted both cells and fibers 48;49.
Thus, these data confirm that neurons of the LHA directly modulate motivated behaviors. It was
subsequently determined that LHA neurons are anatomically linked with neural systems that
regulate reward and goal-directed behaviors, including direct projections onto midbrain
dopamine neurons that release dopamine into the forebrain 50. Collectively these classical
lesion, stimulation and anatomical studies established the LHA as a powerful coordinator of the
drive to eat, drink and move. Such methodologies could not, however, fully elucidate the
mechanisms by which the LHA mediated these effects: how does the LHA receive status cues
(e.g. resource/energy need) from the body and how does it translate these into appropriate
output behaviors?

1.1.3

Connectivity and Neuronal Diversity in the LHA: Implications for Energy Balance
The strikingly different phenotypes produced by lesion of the LHA (aphagia, adipsia,

weight loss) or the medial hypothalamic regions (hyperphagia, obesity) suggests that these
regions differ in neurochemistry and/or their anatomical engagement of brain systems that
regulate behavior. Medial hypothalamic nuclei, such as the VMH, arcuate nucleus (ARC),
dorsomedial hypothalamus (DMH) and paraventricular hypothalamic nucleus, (PVN) are
compact, cell-dense and have well-defined projection targets throughout the brain. The LHA, by
7

contrast, encompasses a large swath of tissue over the entire rostral-caudal extent of the
hypothalamus. The sheer expanse of the LHA, coupled with the fact that it lacks obvious
cellular architecture, complicated anatomical and functional studies. The LHA can, however, be
roughly subdivided into regions based on proximity to fiber tracts. For example, the
mamillothalamic tract lies at the medial limit of the LHA, where it borders with the DMH and later
the PVN. The fornix is a large and easily identifiable tract that runs through the ventral aspect
of the LHA, and the area just above and surrounding the fornix is often referred to as the
perifornical area of the LHA. Pioneering work by the Saper group utilized these anatomical
landmarks in combination with neuronal tract tracing methods to determine the precise
connectivity of LHA subregions with the rest of the brain 51;52. While these studies characterized
some subregion-specific projection targets, as a whole, they demonstrate that the LHA projects
broadly throughout the forebrain, midbrain and hindbrain regions, each of which is implicated in
distinct facets of physiologic control. The lack of a unified output region, however, suggests that
LHA-mediated regulation of behavior and energy balance is complicated and not homogenous
in nature.

The next leap in understanding the LHA’s role in energy balance was the discovery of its
hetero-cellularity, and the resulting concept that specific populations of LHA neurons coordinate
discrete energy cues and behavioral response. Indeed, it is clear that there are many distinct
populations of neurons within the LHA that differ in molecular signature. The full extent of LHA
neurons are yet to be characterized, but three substantial populations of neurons have been
described and can be defined by their expression of a specific neuropeptide: neurons containing
melanin concentrating hormone (MCH), the orexins/hypocretins (OX) and neurons containing
neurotensin (Nts). Intriguingly, these subpopulations are molecularly and spatially distinct
(Figure 1-1) suggesting that each population may also differ in connectivity and functional
8

output. The emergence of molecular techniques that enable site-specific manipulation of
genetically-distinct neuronal populations has allowed the field to probe the roles of MCH, OX
and Nts neurons, and suggests that each of these populations have roles in regulating energy
balance. While there are also smaller populations of neurons within the LHA expressing other
neuropeptides and neurotransmitters, we will focus on the emerging and distinct roles of MCH,
OX and Nts neurons on coordinating peripheral energy cues and behaviors, and their respective
contributions to energy balance.

1.2 Melanin Concentrating Hormone (MCH) Neurons
1.2.1

General Overview of Melanin Concentrating Hormone (MCH) Neurons
Melanin concentrating hormone (MCH) is a 19-amino acid cyclic neuropeptide that was

first documented in the pituitary of teleost fish, enabling them to change skin color and blend
into their environment 53;54. Soon after MCH was identified in the brains of rats 55 and humans
56

, where it is primarily found within neuronal cell bodies of the LHA as well as small number of

neurons in the zona incerta 57. Most often these are solely referred to as MCH neurons, but
they also contain the classical (fast) neurotransmitters GABA or glutamate via which they can
inhibit synaptic contacts 58. Additional sub-populations of MCH neurons can be differentiated by
their co-expression of nesfatin 59 or the neuropeptide cocaine-amphetamine-regulated transcript
(CART) 58;60-63. CART co-expression signifies a distinct MCH population that projects to
forebrain sites involved in behavior modulation, while non-CART expressing MCH neurons
preferentially project to caudal brainstem and spinal cord 61;62

9

MCH acts via neurons expressing the Gi/o-protein coupled receptor MCH Receptor-1
(MCHR-1), thus MCH action is inhibitory 64-68. Higher order mammals and humans (but not
rodents) also express a Gq-coupled MCH Receptor-2 that activates target neurons and may
exert opposite actions to MCHR-1 69-71. MCHR-1 is highly expressed within neurons of the
cerebral cortex, olfactory tubercle, limbic structures (hippocampus, septum, nucleus of the
diagonal band, bed nucleus of the stria terminalis, amygdala) forebrain (caudate-putamen,
nucleus accumbens core and shell) and the arcuate nucleus 72. MCH neurons also project to
areas implicated in regulating feeding, such as the parabrachial nucleus 73 and PVN 74, but
project sparsely to regions that regulate arousal, such as the dorsal raphe, ventrolateral
periaqueductal gray, locus coeruleus and preoptic area 64;68;72;75;76. Though the LHA as a whole
densely projects into the dopamine (DA)-enriched ventral tegmental area (VTA) and regulates
DA-mediated ingestive and locomotor behaviors 77, MCH neurons do not regulate the VTA 72.
Rather, MCH neurons engage the DA system via projections to the nucleus accumbens (NA),
where MCHR-1 is expressed on dopamine receptor-1 (D1R) and dopamine receptor-2 (D2R)expressing neurons 78. MCH neurons also project to hindbrain regions including the nucleus of
the solitary tract, dorsal motor nucleus of the vagus and ventral medulla sympathetic premotor
areas 57;79.

1.2.2

MCH plays a role in feeding and drinking regulation.
Central injection of MCH into the brain increases feeding in rodents and promotes

obesity 80-82. MCH treatment, however, does not preferentially stimulate intake of palatable
food or sucrose, suggesting a role for MCH in regulating general ingestive behavior, but not
necessarily in hedonic aspects of feeding 83;84. Consistent with this, MCH expression is
increased in hungry animals, including fasted or hyperphagic leptin-deficient mice (ob/ob),
compared to normal controls 81. Similarly, mice that genetically overexpress MCH are
10

hyperphagic and gain weight 85. In contrast, genetically engineered mice that lack MCH eat
less, are lean and exhibit improved metabolic profiles throughout aging 86-88. Mice lacking
MCHR-1 are also lean with less body fat than controls, but this is primarily due to their
increased locomotor activity and energy expenditure. While one might expect decreased
feeding in MCHR-1 deficient mice (due to loss of orexigenic MCH action), they actually display
mild overeating. In this case the modest hyperphagia may be required to support their
increased energy expenditure, but at any rate, is not sufficient to produce obesity 89;90. Blocking
acute action of MCHR-1 via selective antagonists, however, does suppress feeding, meal size
and weight gain in normal weight and obese rodents 76;91;92. These findings have accordingly
spurred interest in development of brain-permeable MCHR-1 antagonists to reduce food intake
and promote weight loss.

MCH action in the NA shell is particularly important for regulating motivation and
reinforcement for drugs of abuse and natural rewards, including food. Selective administration
of MCH in the NA increases feeding, and conversely, delivery of an MCHR-1 antagonist in this
region inhibits food intake 93. Genetic deletion or pharmacologic antagonism of MCHR-1 also
blunts cue-induced responding for food, suggesting a deficit in learning processes that drive
motivated feeding 94. MCH neurons sense nutrient status and accordingly promote the
motivation to feed in order to maintain euglycemia 95. Indeed, activation of MCH neurons
promotes intake of sweetened liquids along with DA output into NA 96. Thus, MCH neuronal
signaling via MCHR-1 in the NA is sufficient to coordinate energy need and feeding, and may be
a tractable pathway to modulate feeding in energy balance disorders.

11

Central administration of MCH increases water intake in the presence or absence of
food 84;97. Woods and colleagues demonstrated, however, that MCH does not specifically
promote water intake, and also increases ingestion of ethanol, sucrose solution and food 98.
Therefore, MCH is likely a general inducer of intake behavior (eating and drinking). Feeding
and drinking are time-coupled behaviors, and so-called ‘prandial drinking’ occurs just prior to,
during and following bouts of feeding 99. MCH action may influence the desire to drink in order
to wet the mouth or via a DA-mediated reward mechanism, but does not seem to have a role in
thirst per se 100.

Based upon the hypophagia of mice lacking MCH, it was hypothesized that MCH
deletion could curb feeding to promote weight loss in obesity. The Maratos-Flier group tested
this by genetically deleting MCH in mice that are deficient for leptin, and hence are hyperphagic
and obese. The resulting double MCH/leptin knock-out mice were leaner than leptin-depleted
controls, but did not exhibit any blunting of feeding. Instead, the reduced adiposity of
MCH/leptin knock-out mice was due to their increased energy expenditure 101. Indeed, MCH
neurons act via polysynaptic connections to the hindbrain and spinal cord to regulate brown
adipose tissue, the vital tissue for promoting thermogenesis and basal metabolic rate 102. MCH
neurons presumably inhibit thermogenic energy expenditure via this pathway 57;79. By contrast,
blockade of MCH signaling increases brown adipose tissue mass and thermogenesis and
reduces body weight 103. Genetic deletion of MCHR-1 in mice also promotes hyperactivity via
changes in the NA 104, suggesting that the combined increase of thermogenesis and physical
activity supports weight loss and leanness. Interestingly, ablation of MCH neurons in adult
obese mice does not decrease their feeding or body weight 105, suggesting that developmental
disruption of MCH neurons is essential for modifying energy balance.

12

1.3 Orexin/Hypocretin (OX) Neurons
1.3.1

General Overview of Orexin (OX) Neurons
In 1998 separate research groups reported the discovery of two neuropeptides produced

from the same gene product: one group dubbed them the hypocretins 106 and the other referred
to them as orexins 107. We will utilize the orexin (OX) designation due to its simple abbreviation.
OX action is transduced via two Gq protein coupled receptors, orexin receptor-1 (OXR-1) and
Orexin receptor-2 (OXR-2) 107-109. OXR-1 binds OX-A and -B with equal affinities, but OXR-2
preferentially binds OX-B. Strikingly, OX neurons project broadly throughout the brain 110 and
virtually every brain region contains at least one of the two OX receptors, suggesting that central
OX action controls a wide array of functions 111. Although OX neurons are located in a similar
distribution to MCH neurons, they appear to be regulated by completely different stimuli and
inputs, so studies of the LHA often contrast the roles of MCH and OX neurons. Compared to
MCH neurons OX neurons are spontaneously active. The OX and MCH neuronal systems may
not be entirely divergent, however, since at least some OX neurons project to and regulate MCH
neurons 112.

1.3.2

OX regulation of feeding and drinking.
Central OX administration acutely promotes feeding 107;113;114 though more modestly

compared to other orexigenic neuropeptides 115. OX neurons also regulate the mesolimbic
reward system and intake of natural and drug rewards via direct projections onto VTA dopamine
neurons 116;117. OX neurons are activated during cue-induced feeding 118;119, and in turn they
activate VTA DA neurons and promote DA release into the NA and prefrontal cortex 120-122. OX
regulation via this mesolimbic circuit promotes ingestion of highly salient substances (e.g. high
fat diet, drugs of abuse) but not of comparatively bland chow or aversive substances 122-127. OX
13

specifically promotes motivated response (work) for palatable foods that is attenuated by OXR
antagonists 119;128;129. OX enhances the activation of DA neurons via a similar mechanism to
cocaine, suggesting that OX is required for structural changes in the DA system that increase
motivated drive, reward craving and intake 130. Both OX and glutamate release are required for
cue-induced reinstatement (seeking) of rewards via the VTA. Given that OX and glutamate are
released from same neuron, it is proposed that OX acutely modulates reward intake while
glutamate mediates long-term modifications known to underlie addiction to drugs and natural
rewards 125.

In normal weight animals the synaptic inputs onto OX neurons are predominantly
excitatory, but fasting (e.g. low leptin tone) increases the excitatory inputs onto OX neurons.
Leptin treatment attenuates the fasting-induced increase in excitatory tone, presumably
restoring (diminishing) activation of OX neurons to normal levels 131. While it is tempting to infer
that leptin solely acts to oppose OX neurons, more recent data suggest that leptin and OX act
cooperatively to coordinate energy sensing and behavior in the long term. For example, in the
obese state the bias of excitatory inputs onto OX neurons shifts, such that synaptic tone is
primarily inhibitory. Leptin treatment reverses the inhibitory synaptic bias to OX neurons, in
essence, promoting restored activation of OX neurons 132. At some level leptin and OX
signaling may be synergistic, since disruption of one system also deranges the other. Indeed,
loss of leptin or LepRb promotes obesity and decreases OX expression compared to normal
weight animals 133;134. Similarly, chronic OX overexpression or treatment with OXR-2 agonists
improves leptin sensitivity, and suppresses palatable food intake and weight gain 135. Parsing
the acute and developmental interactions of leptin and OX signaling will be important to fully
understand dynamic regulation of feeding via these systems.

14

Central OX treatment in rats increases drinking, while water deprivation increases OX
expression 136. Similarly, pharmacogenetic activation of OX neurons increases water intake 137
but genetic ablation of OX neurons decreases drinking (as well as feeding, locomotor,
wakefulness) suggesting drive reduction 138-140. Mice lacking OX also drink less sucrose,
although their preference for it is unaffected 141. Consistent with this, pharmacological
antagonism of OXRs reduces all liquid intake (water, ethanol and sucrose), suggesting that the
OX system promotes general drinking behavior, regardless of the liquid’s caloric or rewarding
value 142. Activation of OX neurons is linked with bodily fluid status, such that OX neurons are
inactive during dehydration, but are activated just after drinking/re-hydration occurs 100. OX
neurons may, therefore, enhance the motivation to drink when fluid is available to resolve the
water imbalance.

Mechanistically, OX neurons may modulate drinking behavior via projections to, and
excitatory regulation of the subfornical organ 136;143 as well as projections to the medulla 114. OX
neurons may also modify drinking behavior via projections into the mesolimbic and striatal
systems, which are implicated in motivational drinking and drinking secondary to psychiatric
dysfunction (psychogenic polydipsia).

Central OX increases locomotor activity, mainly in the form of grooming and food
seeking behaviors 113;144;145. OX neurons are maximally activated during exploration, grooming
and feeding, 146, and pharmacogenetic-mediated activation of OX neurons increases locomotor
activity 137, linking OX action with locomotor drive. Inflammatory challenge, however, reduces
OX activation 147;148 and produces the lethargy characteristic of acute and chronic illness 149;150.
OX regulates somatic movement 151 but primarily controls motivated locomotor activity via

15

activation of VTA DA neurons and DA release into the NA 152. Inhibitors of DA signaling thus
blunt OX-mediated locomotor activity 153. Rodents lacking OX are hypoactive, exhibit less
motivated wheel running and the decreased volitional energy expenditure promotes weight gain
140;154

.

1.4 Neurotensin (Nts) Neurons
1.4.1

General Overview of Neurotensin (Nts) Neurons
In 1973 Carraway and Leeman isolated a 13-amino acid peptide from bovine

hypothalamus. Upon finding that intravenous Nts injection dilated blood vessels, lowered blood
pressure and caused cyanosis in rats they coined this peptide neurotensin (Nts) to reflect its
pressor function 155. Most Nts is expressed within the intestine or adrenal gland, and accounts
for the bulk of the Nts released into the plasma. While Nts is rapidly degraded in the circulation,
a limited amount of circulating Nts may access the brain 156;157 158. However, approximately 10%
of bodily Nts expression is produced within the brain, is enriched in synaptosomes 159;160 and is
released after neuronal depolarization via a calcium dependent mechanism, signifying that in
the brain Nts is a peptide neurotransmitter 161. Nts in the brain is also rapidly degraded by
membrane-bound angiotensin converting enzyme, proline endopeptidase and prohormone
convertases-1 and -2, suggesting that it mediates short-acting signal transduction that is quickly
inactivated 162-165. Using in situ hybridization or radioimmunolabeling Nts was identified
throughout the nervous system, including within the spinal cord, hindbrain (nucleus of solitary
tract, LC, parabrachial nucleus), midbrain (periaqueductal gray, VTA, SN) limbic system
(amygdala, hippocampus), forebrain (caudate putamen, NA), thalamus, and within the
hypothalamus, particularly the preoptic area, PVN and the LHA 166-170. Immunohistochemical
detection of Nts, however, requires treating rodents with colchicine, an anterograde transport
16

inhibitor that leads to accumulation of proteins within the cell body, but which is inherently toxic
and prevents study of these neurons in normal physiologic context 166;167;171;172. As such, the
technical limitations of identifying Nts neurons have restricted study of their roles in physiology
and behavior.

Nts binds to neurotensin receptor-1 (NtsR1) and NtsR2, both of which are Gq-coupled
protein receptors 173;174. A third receptor, neurotensin receptor-3 (NtsR3, also called sortillin) is
a single transmembrane receptor with unclear function, but NtsR-3 does not specifically
transduce Nts signals 175. NtsR1 has high affinity for Nts and is predominantly expressed on
neurons 176, including on dopamine-expressing neurons in the midbrain 177. NtsR2 exhibits low
affinity Nts binding, is antagonized by the antihistamine levocabastine and is expressed on a
few neurons, but primarily within astrocytes 178-181; 177. Nts specifically promotes activation of
NtsR-expressing neurons in the prefrontal cortex, VLPAG, SN and in VTA DA neurons 182-184.
Nts action via NtsRs induces a non-selective cation current to promote neuronal depolarization
185

. Additionally, Nts interacts with D2Rs on DA neurons to block their inhibitory effects, thus

Nts acts via dual mechanisms to promote the activation of DA neurons 186-189. Indeed, within the
VTA Nts-containing axon terminals are primarily apposed with DA neurons 190 191 and Nts acts
via the VTA to promote DA release into the NA and modify reward behavior 192;193 194 . Both
NtsR1 and NtsR2 are implicated in regulating DA neurons 195-197, but treatment with NtsR1sepecific antagonists blocks Nts-mediated DA release from midbrain neurons, suggesting that
NtsR1 is the predominant modulator of VTA DA neurons 198;199 177.

The development of mice that express cre recombinase in Nts neurons (NtsCre mice)
permitted the facile identification of Nts neurons throughout the brain, including a large

17

population of Nts neurons within the LHA 200. These NtsCre mice, when bred onto a cremediated green fluorescent reporter line, identify LHA Nts neurons that are distinct from
adjacent neurons expressing MCH or OX (Figure 2 A), similar to previous reports that identified
Nts, OX and MCH via in situ hybridization or colchicine-mediated immunostaining 100;200;201. Nts
neurons in the LHA are also more abundant, by far, than MCH or OX neurons (Figure 2 B).
Given the important roles for MCH and OX neurons, the comparative multitude of Nts neurons
suggests that they have a sizeable physiologic impact. LHA Nts neurons, however, are not a
homogenous population; there are subpopulations of Nts-containing neurons within the LHA
with distinct molecular signatures, though these have yet to be fully characterized. Some LHA
Nts neurons co-express the long form of the leptin receptor (LepRb) and are activated by leptin
200

and some of these neurons also co-express the inhibitory neuropeptide galanin and/or

melanocortin-4 receptor 201. Other subpopulations of Nts neurons contain CRH 100 or MCHR-1
72

. Additionally, LHA Nts neurons have been reported to co-express either the classical

neurotransmitter GABA or glutamate 200;202. As a whole, LHA Nts neurons project densely
within the LHA to OX neurons and also to the VTA, via which they likely regulate DA neurons
191

. Indeed, activation of LHA Nts neurons causes release of Nts to the VTA that potentiates the

activation of VTA DA neurons and DA release to the nucleus accumbens via an NtsR1dependent mechanism 194. Mice self-stimulate LHA Nts neurons, including those that project to
the VTA, presumably because it is rewarding 202. Nts action also regulates the activity of OX
neurons via mechanisms that remain to be determined 200;203. Thus, LHA Nts neurons exert
control of OX neurons and VTA DA neurons that could (as established above) modulate
feeding, drinking and locomotor activity. While the precise roles of LHA Nts neurons in these
physiologic behaviors have yet to be fully elucidated, there is a large literature to suggest that
central Nts can indeed modify behaviors relevant to energy balance.

18

1.4.2

Role of Neurotensin (Nts) Neurons in Regulating Feeding
Central Nts has been considered an anorectic neuropeptide, but appears to have site-

specific effects on feeding. Pharmacologic Nts in the SN and VTA modestly decreases food
intake in satiated and food-deprived rodents 204-208. Administration of Nts into the LHA or ventral
striatum, however, does not alter feeding, suggesting that Nts mediates other aspects of
behavior via these regions 205;209. NtsR1 is the essential receptor isoform for Nts-mediated
suppression of feeding 210;211. Brain permeable NtsR1-specific agonists accordingly decrease
feeding and body weight in normal mice, as well as in leptin-deficient obese mice, suggesting
that Nts action via NtsR-1 may be useful in treating obesity 211. Loss of Nts expression might
therefore be expected to promote feeding and exacerbate weight gain, and indeed hyperphagic,
obese rodents have reduced Nts expression in the brain, including the hypothalamus that may
have contributed to the disease state 212-217.

Nts neurons are regulated by the anorectic hormone leptin, suggesting coordinated roles
of Nts and leptin to modify feeding and body weight. Chronic leptin treatment decreases food
intake and body weight as expected, and also decreases Nts expression within the LHA 218;219.
By contrast, acute leptin treatment of hypothalamic-derived cell lines increases Nts expression
220

. Nts potentiates leptin-mediated inhibition of feeding via NtsR-1 221;222 but mice deficient in

NtsR1 have an impaired anorectic response to leptin, confirming that leptin and Nts/NtsR1
synergistically modify feeding 223. Intriguingly, the leptin/NtsR1 system may have more impact
in regulating non-homeostatic feeding: while mice lacking NtsR1 exhibit normal chow intake,
they over consume palatable, high-fat diet or a sucrose solution that promotes obesity 191. The
LHA is the site of leptin and Nts synergy: a subset of Nts neurons co-express LepRb, are
exclusively found within the LHA, and represent the only Nts neurons in the brain that are
directly activated by leptin. Deletion of LepRb specifically in LHA Nts-LepRb neurons promotes
19

mild hyperphagia and obesity in mice 200. Furthermore, intact NtsR1 expression is required for
LHA NtsLepRb neurons to restrain feeding, indicating the functional integration of leptin and
Nts/NtsR-1 action 191. In this regard, stimulating NtsR1 neurons (similar to leptin-mediated Nts
release from LHA Nts-LepRb neurons) may be useful to suppress feeding and body weight.
Indeed, brain permeable NtsR1-specific agonists decrease feeding and body weight in normal
mice, as well as in leptin-deficient obese mice, suggesting that Nts action via NtsR1 may be
useful in treating obesity 211. LHA Nts neurons, including NtsLepRb neurons, likely exert some
regulation of feeding via their projections to the VTA. Nts activates VTA neurons, promotes
reinforcement 224 and rats will self-administer Nts as if it is rewarding 225. Similarly, activation of
LHA Nts neurons promotes reward responding 202 but, intriguingly, suppresses food intake 177.
Given that Nts-mediated anorexia is enhanced by co-administration with DA agonists 209,
activation of LHA Nts neurons may stimulate VTA DA neurons to suppress feeding. LHA Nts
neurons may also project to the parabrachial nucleus 226, and it is possible that Nts contributes
to anorectic drive via this brain region 227. Additionally, some LHA Nts neurons co-express
MC4R and LepRb (but not OX or MCH) and may be regulated via melanocortins to modulate
feeding. Together these data suggest that LHA Nts neurons can suppress feeding, but it
remains unclear if they are necessary for feeding regulation and the precise mechanisms by
which they control it.

1.4.3

Role of Neurotensin (Nts) Neurons in Regulating Drinking
Water deprivation or osmotic stimulation specifically increases Nts expression in the

LHA 228;229 and experimental activation of LHA Nts neurons promotes voracious drinking 177.
These data suggest that at least some LHA Nts neurons may detect water deficit and coordinate
drinking behavior to restore fluid homeostasis. Rats have a modest population of LHA Nts
neurons that co-expresses CRH and are responsive to water deficit 230, but mice have very few
20

Nts-CRH co-expressing neurons, suggesting they detect water imbalance via distinct
mechanisms. While it remains unclear how water deprivation affects the activity of LHA Nts
neurons, it is clear that the OX neurons that they project to are inhibited by water deprivation.
After drinking, however, activation of OX neurons is restored 100. It is tempting to speculate that
Nts neurons detect water deprivation and suppress OX neurons to promote the drive for water,
while drinking behavior releases Nts action and permits OX activation. Consistent with this
idea, central Nts treatment increases water intake in rats 204;231-233. Nts may also have a general
role in inhibiting intake of ‘rewarding’ liquids such as ethanol 234;235, sucrose 191 or thirst-induced
water intake, which may be itself be pleasurable after dehydration. In sum, these data hint at a
role for LHA Nts neurons in drinking behavior, but the underlying mechanisms and necessity for
LHA neurons in regulating fluid balance remain unclear.

1.4.4

Role of Neurotensin (Nts) Neurons in Regulating Physical Activity
Similar to the site-specific effect of Nts in mediating feeding, Nts also exerts brain site-

specific control of locomotor activity. Nts in the NA (which is not directly regulated by LHA Nts
neurons) suppresses locomotor activity 171;236-239. By contrast, Nts treatment in the VTA
promotes locomotor activity along with DA output into NA and olfactory tubercle 240-243. Chronic
Nts administration into the VTA causes long-lasting sensitization and progressively increased
locomotor activity even after treatment is suspended, suggesting that sustained, endogenous
release of Nts remodels VTA circuits to modulate locomotor output 244;245. Given that LHA Nts
neurons project to and can activate NtsR-expressing DA neurons 191;200, they may promote
locomotor activity via the VTA. Indeed, silencing the subset of LHA Nts neurons that co-express
LepRb, and presumably silencing Nts release to the VTA, reduces locomotor activity and
disrupts DA signaling 200. Functionally, Nts action in the VTA may also exert antidepressant
effects, as it increases forced swim efforts even at sub-threshold doses that do not promote
21

general locomotor increase 246. Stress increases Nts in the VTA, perhaps to potentiate adaptive
locomotor behaviors needed for survival 247;248. Central or systemic Nts, however, diminishes
locomotor effects, suggesting that Nts actions in the NA outweigh those via the VTA 241;249;250.
The cellular localization of NtsRs likely accounts for the differential control of locomotor activity
via NA and VTA neurons. VTA DA neurons express NtsRs at the dendrites and soma, so Nts
action via stimulatory NtsRs promotes activation of DA neurons and release of DA into the NA
that induces locomotor activity. By contrast, Nts injected directly into NA acts via postsynaptic
NtsRs on the dendrites and soma of GABAergic spiny neurons 251. Increasing Nts action via the
NA may be useful to suppress the excessive locomotor effects in schizophrenia, similar to the
effects of antipsychotics 252. LHA Nts neurons, however, do not project into the ventral or dorsal
striatum, and thus likely promote locomotor activity via projections to, and regulation of VTA DA
neurons.

LHA Nts neurons additionally project within the LHA and modulate OX neurons, which
also regulate ambulatory activity. Some Nts neurons in the LHA are activated by inflammatory
signals, but adjacent OX neurons are inhibited in these conditions, suggesting differential
control of these neuronal populations. LHA Nts neurons project onto and inhibit OX neurons 253,
thus inflammation or illness-mediated activation of Nts neurons suppresses the activity of OX
neurons and decreases locomotor activity during these states 150;200;254. Similarly, loss of action
via NtsLepRb neurons decreases locomotor activity and energy expenditure in mice that promotes
obesity 200, and some portion of these effects are likely mediated via regulation of OX neurons
191;200

22

To date there are no direct reports concerning the role of LHA Nts neurons in arousal.
Burdakov described a large population of non-MCH, non-OX GABAergic neurons in the LHA
that are spontaneously active during waking and sleeping periods, and it is possible that these
are Nts neurons. There were four subtypes of these uncharacterized GABAergic neurons, each
of which exhibited distinct electrophysiologic properties (firing rate/response). Similarly, LHA
Nts neurons are heterogeneous, and at least some of them are GABAergic 255, so it is possible
that these electrophysiologically-distinct populations are in fact subpopulations of LHA Nts
neurons 256-258. Central administration of Nts promotes alertness and prolongs latency to sleep
stages, suggesting that LHA Nts neurons could play a role in sustained arousal 259. Overall,
these data suggest rationale for LHA Nts neurons to influence locomotor activity and possibly
arousal, but this has yet to be explicitly studied.

1.5 Summary and Rationale for Studying LHA Nts Neurons in Energy
Balance
The LHA is an essential brain region for coordinating feeding, drinking and energy
expenditure behaviors that inherently modify energy balance and weight, but the underlying
mechanisms are incompletely understood. The LHA receives a diverse array of peripheral
cues that communicate bodily energy and fluid balance (e.g. hormones, nutrient levels, changes
in osmolality) and contains multiple populations of neurons that project to virtually every region
of the brain. The discovery of neuropeptide-specific populations within the LHA has catapulted
the field’s understanding of how the LHA can manage the formidable task of coordinating
diverse ingestive and locomotor responses via specialized, cue-sensitive neurons that mediate
actions via distinct neuronal projections. While the characterization of MCH and OX neurons
have advanced understanding of how the LHA coordinates some behaviors, these populations
23

mainly increase feeding to support energy-consuming physical activity and alertness. In
contrast, LHA Nts neurons are implicated in restraining feeding, increasing drinking and
promoting physical activity, but this has not been directly studied due to the previous inability to
easily detect and manipulate Nts neurons. Taken together, these studies hint that LHA Nts
neurons may exert opposing roles to their MCH and OX-expressing neighbors. If this is true,
then LHA Nts neurons may be unique targets for modifying behavior and treating specific
ingestive disorders such as disruptions of feeding (obesity, anorexia nervosa) or drinking
(dehydration, psychogenic polydipsia) that endanger health.

1.6 Goals of the Dissertation
The body of work presented here will explore the Nts population in the LHA in an effort
to elucidate its specific role in ingestive behavior, energy balance and control of body weight.
My central hypothesis is that there are distinct subpopulations of LHA Nts neurons that
coordinate ingestive behaviors, and that LHA Nts neurons are essential for control of body
weight (Figure 1-1). I will therefore use novel mouse models expressing Cre or FlpO
recombinase in Nts neurons that enable me to specifically manipulate these neurons and define
their phenotypes and contributions to ingestive behaviors and energy balance. Using these
mice, I will pursue the following goals:

1: Define Subsets of LHA Nts That Could Coordinate Ingestive Behavior (Chapter 2)
Hypothesis: Separate populations of LHA Nts neurons are distinguishable via
molecular, circuit and neurochemical criteria, and detect either cues of energy or fluid status.

24

Method: We utilized NtsCre and newly generated NtsFlpO mice to identify LHA Nts
neurons, distinguish their molecular expression, neurochemistry and responses to cues of
energy or fluid status.

2: Establish the Contribution of LHA NtsLepRb Neurons to Adaptive Energy Balance
(Chapter 3)
Hypothesis: LHA Nts neurons that co-express the long form of the leptin receptor
(NtsLepRb neurons) are essential for leptin and ghrelin-mediated adaptations in energy balance.
Method: We studied mice with developmental deletion of LepRb specifically from LHA
NtsLepRb neurons to characterize how loss of action via NtsLepRb neurons impacts neurocircuitry,
cellular responses to leptin and ghrelin and control of energy balance.

3: Determine the Role of LHA Nts Neurons in Adaptive Energy Balance (Chapter 4).
Hypothesis: LHA Nts neurons are essential for control of ingestive behavior and body
weight.
Method: We specifically lesioned LHA Nts neurons or suppressed their activity to reveal
their requirement for control of feeding, drinking, movement and body weight.

Through these goals (Figure 1-1), we describe specific subsets of LHA Nts neurons
positioned to coordinate distinct peripheral cues and ingestive behaviors. Furthermore, we
demonstrate that LHA Nts neurons, in total, are required for appropriate control of energy
balance and fluid homeostasis. Our work is novel in that it, for the first time, defines an obligate
physiological role for LHA Nts neurons, and establishes neural mechanisms by they contribute
25

to adaptive behaviors necessary for health. These findings may lead to development of
strategies to treat specific ingestive disorders, which will be discussed in Chapter 5.

26

1.7 Figures
Figure 1-1: Proposed Model of LHA Nts Neuronal Regulation of Energy Balance

Subpopulations of Nts neurons in the LHA may each contribution to regulation of energy
balance independently by coordinating distinct peripheral signals and behaviors in response to
different energy status conditions.

27

CHAPTER 2

Heterogeneity of Lateral Hypothalamic

Neurotensin Neurons: Distinct Subsets Are Activated by
Leptin or Dehydration
Authors: Juliette A. Brown, Anna Wright, Raluca Bugescu, Lindsey Christensen and Gina M.
Leinninger
This Chapter is an adaptation of a manuscript that has been prepared for submission

2.1 Abstract
The lateral hypothalamic area (LHA) is essential for ingestive behavior, but it remains
unclear how LHA neurons coordinate feeding vs. drinking. Most LHA populations promote food
and water consumption, but LHA neurotensin (Nts) neurons preferentially induce water intake
while suppressing feeding. Here we identify two molecularly and projection-specified
subpopulations of LHA Nts neurons that are positioned to coordinate either feeding or drinking.
One subpopulation co-expresses the long form of the leptin receptor (LepRb) and is activated
by the anorectic hormone leptin (NtsLepRb neurons). A separate subpopulation lacks LepRb and
is activated by dehydration (NtsDehy neurons). These molecularly distinct LHA Nts
subpopulations also differ in connectivity: the NtsLepRb neurons project to the ventral tegmental
area (VTA) and substantia nigra compacta (SNc), but NtsDehy neurons do not. We then
investigated whether LHA Nts neurons can be differentiated by expression of the inhibitory
neurotransmitter GABA or the excitatory neurotransmitter glutamate (glut). Using a genetic dual
recombinase approach to simultaneously label Nts neurons and GABA or glutamate-containing
neurons, we confirm that all LHA Nts neurons are GABAergic. Collectively, our data identify two
molecularly- and projection-specified subpopulations of LHA Nts neurons that intercept either
leptin or dehydration cues, and hence these populations may separately regulate feeding or
drinking behavior. In the future, selective regulation of these LHA Nts subpopulations might be
useful to treat ingestive disorders such as polydipsia or obesity.
28

2.2 Introduction
The lateral hypothalamic area (LHA) of the brain receives cues of osmotic and energy
status, and accordingly coordinates goal-directed ingestive behavior necessary for maintaining
homeostasis 51;52;260-263. Indeed, the LHA was initially deemed an essential “feeding center”
because animals with LHA lesions lose all motivation to eat food 30;31. Less emphasized, but
equally important, is that animals with LHA lesions also lose the motivation to drink water, and
their resulting dehydration causes death well before starvation32. Thus, the LHA as a whole
modifies both types of ingestive behavior necessary for survival but the underlying mechanisms
by which it does so remain incompletely understood.

The discovery of molecularly- and projection-specified populations of neurons within the
LHA suggested that some of them might be specialized to coordinate drinking vs. feeding.
However, most of the LHA populations studied to date indiscriminately promote intake of food
and water. For example, LHA neurons expressing melanin concentrating hormone (MCH)
promote intake of both substances, and do not specifically organize feeding vs. drinking 98. A
separate population of orexin/hypocretin-expressing LHA neurons regulate arousal-dependent
behaviors, including feeding, drinking and locomotor activity, but do not specify any particular
ingestive behavior per se 137. Instead, animals with activated orexin/hypocretin neurons appear
to consume more food and water simply because they are awake more, and have more
opportunity to ingest. LHA neurons have also been distinguished by their expression of the
classical neurotransmitters glutamate or GABA. Inhibiting LHA glutamate neurons in mice
increases their intake of a palatable ‘meal replacement” drink 264, but it is unclear if this is an
effort to obtain fluid, calories or if both ingestive behaviors are modulated by these neurons.
Similarly, activation of all LHA GABA neurons increases behaviors to obtain food and liquids,
but also increases gnawing at non-caloric objects such as wood or the cage floor 265-267; thus,
29

bulk activation of LHA GABA neurons cannot be considered to direct any specific ingestive
behavior. While such en masse activation of the large LHA GABA population is unlikely to
occur physiologically, there are functionally and molecularly distinct subpopulations of LHA
GABA neurons that have yet to be fully characterized 194;255;265;268.

It is therefore possible that

subsets of LHA GABA neurons might be activated by distinct physiologic cues, and hence
differentially control food vs. water intake. However, the studies of LHA populations to date do
not explain how the LHA specifically coordinates feeding or osmolality cues to direct the
appropriate ingestive behavior.

We recently characterized a large, molecularly distinct population of LHA
neurons that express the neuropeptide Neurotensin (Nts), but which are separate from the MCH
or orexin/hypocretin neurons 177;269. Unlike other LHA populations that promote both food and
water consumption, experimental activation of LHA Nts neurons promotes voracious drinking
but restrains feeding via incompletely understood mechanisms 177 Since LHA Nts neurons have
been reported to contain glutamate 194 or GABA 200, we hypothesized that LHA Nts neurons
might be molecularly and functionally heterogeneous, such that subsets of LHA Nts neurons
exist to coordinate drinking vs. feeding. Indeed, some (but not all) LHA Nts neurons co-express
GABA and the long form of the leptin receptor (LepRb) and are activated by the anorectic
hormone leptin 200;269 we refer to these as NtsLepRb neurons. This NtsLepRb population comprises
a small, but essential subset of LHA Nts neurons necessary to mediate the anorectic response
to leptin and proper regulation of energy balance 269. However, mice lacking LepRb in LHA
NtsLepRb neurons do not exhibit any disruptions in drinking or bodily fluid content, suggesting that
LHA Nts-mediated drinking may be mediated via different LHA Nts neurons 269. At least some
LHA Nts neurons are responsive to physiologic changes in serum osmolality, as dehydration
increases expression of Nts mRNA within the LHA 230; we refer to these as NtsDehy neurons.
30

Exogenous Nts treatment also promotes drinking 270, though the endogenous sources of Nts
mediating this effect remained unknown. Given that experimental activation of LHA Nts neurons
promotes Nts release 177;194, and drinking 100;177;194;229, the dehydration-induced upregulation of
LHA Nts could serve as a physiologic signal to drive water seeking and intake once water
becomes available 228. Taken together, these data suggest that some LHA Nts neurons can be
activated by cues of energy status (leptin) or osmolality status (dehydration), and might
comprise separate populations of LHA Nts neurons to coordinate feeding or drinking behavior.
We therefore assessed whether LHA NtsLepRb neurons and NtsDehy neurons are the same, or
whether they are separate populations that are distinguishable via molecular, circuit and
neurochemical criteria.

2.3 Materials and Methods
2.3.1

Animals
Adult male and female mice were used for studies. Some NtsCre;GFP and LepRbCre;GFP

mice were generated and treated with euhydration or dehydration at the University of Michigan,
under the supervision of the Unit for Laboratory Animal Medicine (ULAM). These procedures
were approved by the University of Michigan Institutional Animal Care and Use Committee
(IACUC). All other mice were generated from a breeding colony at Michigan State University,
where mice were housed in a 12h light/12h dark cycle and had ad libitum access to water and
chow diet (Teklad 7913). MSU mice were cared for by Campus Animal Resources (CAR) and
all animal protocols were approved by the Institutional Animal Care and Use Committee
(IACUC) at Michigan State University.

31

2.3.2

Generation of NtsFlpO Knock-In Mice
We modified the targeting vector used to generate NtsCre mice 200 to create an NtsFlpO

targeting vector. Briefly, the IRES-Cre was replaced with an IRES-FlpO sequence, such that it
is inserted between the stop codon and the polyadenylation site of the sequence encoding the
3’ end of the mouse Nts gene. An frt-flanked NEO cassette lied upstream of the IRES-FlpO for
selection purposes. The linearized NtsFlpO targeting vector was electroporated into mouse R1
embryonic stem (ES) cells (129sv background) and cells were selected with G418. DNA from
ES cell clones was analyzed via qPCR for loss of homozygosity using Taqman primer and
probes for the genomic Nts insertion sites (Nts-IRES: Forward:
TGAAAAGGCAGCTGTATGAAAATAA, Nts-IRES: Reverse:
TCAAGAATTAGCTTCTCAGTAGTAGTAGGAA, Nts-IRES: Probe:
CCAGAAGGCCCTACATTCTCAAGAGG. NGF was used as a copy number control. Putative
positive ES clones were expanded, confirmed for homologous recombination by Southern blot
and injected into mouse C57BL/6 blastocysts to generate chimeras. Chimeric males were
mated with C57BL/6 females (Jackson Laboratory), and germline transmission was determined
initially via progeny coat color, then confirmed via conventional PCR for FlpO (as described
below).

2.3.3

Breeding and Genotyping
The NtsCre;GFP and LepRbCre;GFP mice used for Figure 2-6 were generated and

genotyped as described previously 255. For all other experiments we utilized Ntscre mice
(Jackson stock #017525) that had been bred onto the C57/Bl6 background (Jackson #008327)
mice for at least seven generations. To visualize Nts, vGat and vGlut2-expressing neurons,
heterozygous Ntscre mice, homozygous Slc32a1tm2(cre)Lowl (Vong 2011) [Jackson stock #028862]

32

and Slc17a6tm2(cre)Lowl (Vong 2011) [Jackson stock # 028863] mice were crossed with
homozygous Rosa26EGFP-L10a mice (Krashes 2014) and progeny heterozygous for both alleles
were studied (Ntscre;GFP mice, vGatCre;GFP and vGlut2Cre;GFP mice respectively). To
simultaneously detect Nts and vGat or vGlut2 we utilized a dual-recombinase strategy. Briefly,
we interbred NtsFlpO mice (to permit FlpO-mediated recombination) and Slc32a1tm2(cre)Lowl or
Slc17a6tm2(cre)Lowl mice (that enable Cre-mediated recombination) to generate progeny that were
heterozygous for FlpO and Cre. These mice were injected with FlpO- and Cre-dependent
reporters to visualize Nts and vGAT/vGlut-expressing neurons as described below. Genotyping
was performed using standard PCR using the following primer sequences: Ntscre: common
forward: 5' ATA GGC TGC TGA ACC AGG AA, Cre reverse: 5' CCA AAA GAC GGC AAT ATG
GT and WT reverse: 5’ CAA TCA CAA TCA CAG GTC AAG AA. Rosa26EGFP-L10a : mutant
forward: 5’ TCT ACA AAT GTG GTA GAT CCA GGC, WT forward: 5’ GAG GGG AGT GTT
GCA ATA CC and common reverse: 5’ CAG ATG ACT ACC TAT CCT CCC. NtsFlpO: Nts-FlpOWT: Forward: CCAGGAAGATATCCTTGATAACGTCAAT, Reverse:
GCAAGAAACATCACATCCAATAAAGCA N, Nts-FlpO-M: Forward:
TGACCTACCTGTGCTGGATGAT, Reverse: CCACGTTCTTGATGTCGCTGAA. vGatCre:
VgatIRESCre Common Forward: CTTCGTCATCGGCGGCATCTG, VgatIRESCre -WT
Reverse: CAGGGCGATGTGGAATAGAAA, VgatIRESCre -Mutant Reverse:
CCAAAAGACGGCAATATGGT.

2.3.4

Stereotaxic Injections
Stereotaxic surgeries were performed as described previously 269 using coordinates from

the mouse brain atlas of Paxinos and Franklin 271. To facilitate detection of Nts containing cell
bodies via Nts-IR, adult Ntscre;GFP, vGatCre;GFP and vGlut2Cre;GFP mice received injections of
colchicine (10 μg in a volume of 500 nL) into the lateral ventricle (A/P -0.2, M/L -1.0, D/V -2.1),
33

and were euthanized via cardiac perfusion ~48 hours after treatment. For tract tracing studies,
Ntscre;GFP mice were injected unilaterally with 75 nL of the retrograde tracer FluoroGold (FG)
into the VTA (A/P: -3.2, M/L: +/-0.48, D/V: -4.65) or SNc (A/P: -3, M/L +/-1.3, D/V -4.7), and
recovered for 7-10 days to allow for accumulation of FG in cell bodies of origin. Animals were
only included in the study if the FG injection was targeted to, and confined within the VTA or
SNc. To simultaneously identify Nts and vGAT or vGlut, adult NtsFlpO;vGatCre and
NtsFlpO;vGlut2Cre mice were injected in the LHA with 400 nL of AAV-FrtGFP adenovirus
(provided by David Olson, University of Michigan) followed by 400 nL AAV-DREADDq (AAVhM3Dq-mCherry; UNC Vector Core), which were infused at a rate of 100 nL/minute. LHA
coordinates were A/P: -1.34, M/L +/-1.5, D/V -4.9, angle: 6°. Mice recovered for 2 – 3 weeks to
permit sufficient time for recombinase-mediated reporter expression.

2.3.5

Leptin or Dehydration Treatment
Some FG-injected Ntscre;GFP mice were treated with PBS or recombinant mouse leptin

(5 mg/kg, i.p.) purchased from the National Hormone and Peptide Program (Los Angeles
Biomedical Research Institute, Los Angeles, CA), then were perfused 2 hours later. Males and
females were studied but no notable differences between sexes were observed, so they were
pooled for analysis: VTA-injected vehicle-treated n=6; female VTA-injected leptin-treated n =
10; SNc-injected vehicle-treated n = 5; SNc-injected leptin-treated n = 9.

Other FG-injected Ntscre;GFP mice underwent a dehydration-activation paradigm in
which they were either had ad-lib access to water (euhydration) or the water bottle was removed
for 12 hr during the dark cycle (when mice drink most of their daily water). Mice were perfused
the following morning and brain sections were stained for cFos, GFP and FG. Due to the lack of
34

observable differences between sexes, males and females were pooled for analysis: VTA-

injected, euhydrated n = 5; VTA-injected, dehydrated n = 9; SNc-injected, euhydrated n =
5, SNc-injected, dehydrated n = 9.

Adult male 8-12 wk old NtsCre;GFP and LepRbCre;GFP mice were also treated via
euhydration or had water bottles removed for 24 hr (including during the dark cycle) to induce
dehydration, then were perfused (Euhydrated NtsCre;GFP n=7, LepRbCre;GFP n = 5;
Dehydrated NtsCre;GFP n=4, LepRbCre;GFP n = 3). Brains were analyzed for cFos and GFP,
and 3 LHA sections from each mouse were analyzed using Photoshop to count the number of
GFP-only labeled neurons and GFP neurons containing cFos. Graphed data represent the
average percentage of GFP neurons containing cFos out of the total number of GFP-labeled
neurons ± SEM. Significant differences between genotypes and treatments were determined
via 2-way ANOVA with Bonferroni posttests.
2.3.6

Immunohistochemistry and Immunofluorescence
Mice were treated with a lethal dose of i.p. pentobarbital and perfused transcardially with

either 10% formalin or 4% paraformaldehyde (Sigma-Aldrich 158127) containing 0.4% picric
acid (Sigma-Aldrich 197378). Brains were removed, post-fixed in the same fixative overnight at
4˚C, then dehydrated with 30% sucrose in PBS for 2-3 days, and sectioned into 30 µm slices
using a sliding microtome (Leica). Brain sections were then analyzed by immunohistochemistry
and/or immunofluorescence as previously described 269. For activation studies, brain sections
first were exposed to either rabbit-anti pSTAT3 (1:500, Cell Signaling) or goat-anti cFos (1:500,
Santa Cruz) followed by incubation with species specific Alexa-488 conjugated (Jackson
ImmunoResearch, 1:200) or Alexa-568 conjugated antibodies (LifeTech, 1:200) ) and
visualization with DAB (Sigma). Immunofluorescent labeling was performed exposing sections

35

to primary antibodies, including chicken anti-GFP (1:2000, Abcam), rabbit anti-FG (1:500,
Fluorochrome), rabbit-anti Nts (1:500, Phoenix) and/or anti-dsRed (1:1000, Clontech), followed
by incubation with species-specific secondary antibodies conjugated to AlexaFluor 488 or 568
fluorophores (1:200, Life Technologies or Jackson ImmunoResearch). Immunolabeled brain
sections were analyzed using an Olympus BX53 fluorescence microscope outfitted with
transmitted light to analyze DAB-labeling, as well as FITC and Texas Red filters for IF.
Microscope images were collected using Cell Sens software and a Qi-Click 12 Bit cooled
camera, and images were analyzed using Photoshop software (Adobe).

2.4 Results
2.4.1

Validation of NtsCre;GFP Mice to Identify LHA Nts Neurons
In situ hybridization (ISH) data from the Allen Brain atlas identifies a significant

population of Nts-expressing cells within the LHA (Figure 2-1 A-B), which is consistent with
previous ISH reports 230. However, ISH-mediated detection is not ideal to permit further
characterization of Nts cells, such as determination of co-expressed transcripts or responses to
leptin or dehydration. Immunoreactivity (IR) is a more facile detection method that is compatible
with co-expression and activation analyses, but Nts-IR only labels fibers, not cell bodies (Figure
2-1 B). In agreement with previous reports, we found that Nts-containing cell bodies could be
detected via Nts-IR in animals that have been pre-treated with the axonal transport inhibitor,
colchicine (Figure 2-1 D), but this treatment precludes assessment of normal physiologic
responses 272. However, the similar distribution of Nts labeling from ISH and colchicinemediated Nts-IR (Figure 2-1 B vs 2-1 D), confirm that there is a large population of Ntscontaining neurons within the LHA.

36

The recent development of NtsCre mice enables the facile detection and manipulation of
mouse Nts neurons using Cre-Lox technology, hence we reasoned that this model would be
useful to examine the molecular expression, projections, activation responses and
neurochemistry of LHA Nts neurons without physiology-disrupting colchicine treatment. As a
first step we verified the fidelity of NtsCre mice for identifying Nts neurons by crossing them onto
a Cre-inducible GFP reporter line 273, to produce mice that express GFP selectively in Nts
neurons (NtsCre;GFP mice). Adult NtsCre;GFP mice were treated with colchicine, and their brains
were analyzed for GFP and Nts-IR. We examined two brain regions that have been shown via
ISH to contain numerous Nts neurons in mice: the subthalamic nucleus (STN) and the LHA 274.
Similar to these ISH findings, NtsCre;GFP mice have dense populations of GFP-labeled neurons
within the STN and LHA, and these co-label with Nts-IR (Figure 2-1 E-K). Intriguingly, Nts-IR is
more highly-expressed within the LHA compared to the STN, hinting at a potentially important
LHA function for this neuropeptide. In any case, these data verify that NtsCre;GFP mice reliably
identify Nts neurons, and that we can use them to characterize features of LHA Nts neurons.

2.4.2

NtsCre;GFP Mice Confirm that Some LHA Nts Neurons Project to the VTA and SNc
LHA Nts neurons project to two adjacent midbrain regions, the ventral tegmental area

(VTA) and the substantia nigra compacta (SNc) 191;200, which regulate motivated behaviors and
motor function, respectively 275;276. We therefore hypothesized that different subsets of LHA Nts
neurons might project to the VTA or SNc to differentially control behavior. As a first step to
addressing this hypothesis, we verified that we can identify LHA Nts neurons that project to the
VTA or SNc. NtsCre;GFP mice were injected in either the VTA (Figure 2-2 A) or the SNc (Figure
2-2 C) with the retrograde tract tracer FluoroGold (FG), which is taken up by local terminals and
transported retrogradely back to the cell bodies of origin. Examination of VTA-injected mice
revealed many LHA cell bodies that have accumulated FG, some of which also contained GFP
37

and hence identify LHA Nts neurons that project to the VTA (Figure 2- 1 B, yellow arrows).
There were also numerous LHA Nts neurons that did not accumulate FG from the VTA,
indicating that these neurons do not project to the VTA (Figure 2-1 B, cyan arrows). Analysis of
SNc-injected mice reveals some FG-labeled LHA Nts neurons that project to the SNc (Figure 21 D, yellow arrows) but also many LHA Nts neurons devoid of FG that do not synapse within the
SNc (Figure 2-1 D, cyan arrows). Together, these data verify that that some LHA Nts neurons
project to the VTA and SNc. In addition, the LHA Nts neurons lacking FG labeling hint that
there are separate populations of LHA Nts neurons, which might project to either the VTA or
SNc, or sites other than the midbrain.

2.4.3

NtsLepRb neurons are a Subset of LHA Nts Neurons that Project to the Midbrain
At least one subset of LHA Nts neurons may be molecularly distinguished via their

expression of LepRb (NtsLepRb neurons), and we reasoned that they might project to either the
VTA or SNc. To identify NtsLepRb neurons, we treated NtsCre;GFP mice with vehicle or leptin (5
mg/Kg i.p. 4hr), which induces phosphorylation of STAT3 (pSTAT3) specifically in LepRbexpressing neurons. While no pSTAT3 is observed in the LHA of vehicle treated mice (Figure
2-3 A-C), leptin treatment increases pSTAT3 (Figure 2-3 E, red arrows and blue-outlined red
arrows). Some GFP-labeled LHA Nts neurons contain leptin-induced pSTAT3 and these are
NtsLepRb neurons (Figure 2-3 D-F, blue-outlined red arrows). However, many GFP-labeled LHA
Nts neurons do not contain pSTAT3 (Figure 2-3 D-F, blue arrows). Together, these data
confirm that there are at least two molecularly distinct populations of LHA Nts neurons: one LHA
Nts population expresses LepRb and can be revealed by leptin-induced pSTAT3 treatment (the
NtsLepRb neurons), but another LHA Nts population lacks LepRb.

38

Next, we asked whether the molecularly-specified NtsLepRb neurons are also projectionspecified, targeting the VTA or SNc. As in Figure 2, we injected NtsCre;GFP mice with FG to
label LHA Nts neurons that project to the VTA or SNc, and also treated mice with leptin to
permit pSTAT3-mediated identification of NtsLepRb neurons. Via this paradigm we identified
NtsLepRb neurons that accumulated FG from the VTA, indicating that some NtsLepRb neurons
project to the VTA (Figure 2-3 G-K, white arrows). We also noted some NtsLepRb neurons that
project to the SNc (Figure 2-3 L-P, white arrows). In each case we also observed NtsLepRb
neurons that did not accumulate FG; these may be NtsLepRb neurons that project to the midbrain
region that wasn’t injected with FG, or these neurons might project to a yet undetermined site
outside of the midbrain (Figure 2-3 G-P, orange arrows). As expected, we also observed LHA
Nts neurons lacking LepRb, some of which project to the VTA or SNc (Figure 2-3 G-P, yellow
arrows), but other LHA Nts neurons did not accumulate FG and hence do not project to either
midbrain region (Figure 2-3 G-P, cyan arrows). In sum, these data signify that NtsLepRb neurons
are a molecularly-specified subset of LHA Nts neurons that project to both the VTA and SNc.

2.4.4

NtsDehy Neurons are a Subset of LHA Nts Neurons that Do Not Project to the
Midbrain
Since dehydration disrupts bodily osmolality and upregulates Nts mRNA in the LHA 230,

we postulated that it might also modify the activity of some LHA Nts neurons. To test this
hypothesis, we provided NtsCre;GFP mice with ad lib water (Euhydration) or removed their water
overnight, when mice consume most of their daily fluid (Dehydration). Brains were then
examined for GFP (to identify Nts neurons) and cFos (a marker of recent neuronal
depolarization). During euhydration we observed few LHA Nts neurons with cFos, suggesting
that LHA Nts neurons are not activated during normal fluid balance (Figure 2-4 A-C). In
contrast, overnight dehydration increased cFos within some (but not all) LHA Nts neurons
39

(Figure 2-4 D-F, blue outlined red arrows); these are NtsDehy neurons. These data demonstrate
that a distinct physiologic cue, dehydration, activates a subset of LHA Nts neurons (NtsDehy
neurons), but it remained unclear if NtsDehy neurons are distinct from NtsLepRb neurons at a
molecular or projection level.

To assess the midbrain projections of NtsDehy neurons, NtsCre;GFP mice were injected
with FG in the VTA or SNc (as in Figure 2-2), and then were dehydrated overnight to label
NtsDehy neurons. Although we observed NtsDehy neurons in the LHA, none of these accumulated
FG from the VTA or SNc (Figure 2-4 G-P). We did, however, observe FG accumulation within
other LHA Nts neurons that were not activated by dehydration, confirming successful retrograde
labeling. Together with our previous data (Figure 2-2), these data indicate that some LHA Nts
neurons, including NtsLepRb neurons, project to the midbrain, but NtsDehy neurons do not. Given
that NtsDehy neurons and NtsLepRb neurons have different projection targets, they must comprise
distinct subsets of LHA Nts neurons.

2.4.5

NtsLepRb and NtsDehy neurons Are Separate Subpopulations of LHA Nts Neurons
We reasoned that if NtsLepRb neurons are distinct from NtsDehy neurons they would not be

activated by dehydration. However, the requirement for leptin or dehydration to functionally
identify NtsLepRb and NtsDehy neurons meant that we could not simultaneously label these subsets
in NtsCre;GFP mice. Instead, to test our hypothesis, we analyzed cFos-IR to identify activated
neurons in brains from euhydrated or dehydrated NtsCre;GFP mice (where GFP identifies all
LHA Nts neurons) and from LepRbCre;GFP mice (where GFP identifies LepRb neurons). Since
the majority of LHA LepRb neurons co-express Nts, the LepRbCre;GFP mice identify the NtsLepRb
neurons as well as some non-Nts expressing neurons 200. While dehydration significantly

40

increased the percentage of LHA Nts neurons containing cFos (Figure 2-5 A,C), it did not alter
the proportion of LepRb neurons containing cFos compared to the euhydrated state (Figure 2-5
B,C). Since LHA LepRb neurons contain the subset of NtsLepRb neurons, this means that the
population of NtsLepRb neurons is not activated by dehydration, but other non-LepRb containing
Nts-containing neurons are activated by dehydration. These data signify that NtsLepRb neurons
are functionally distinct from NtsDehy neurons, as distinguished via their response to dehydration.
Furthermore, these subpopulations of LHA Nts neurons are molecularly distinct, such that
LepRb expression can be used to distinguish NtsLepRb neurons from NtsDehy neurons. Taken
together, data from Figures 2-3, 2-4 and 2-5 reveal that LHA Nts neurons are not a
homogeneous population, but contain molecularly and projection-specified subsets of NtsLepRb
neurons and NtsDehy neurons, that are differentially activated in response to changes in energy
or fluid balance, respectively.

2.4.6

Verification of Cre-Dependent Reagents to Determine Classical Neurotransmitter
Content
Given the heterogeneity of LHA Nts neurons at the molecular and circuit level, we

hypothesized that they might differ in other ways, such as in their classical neurotransmitter
content. Indeed, neuropeptide-expressing neurons may contain either the classical/fast
neurotransmitters GABA or glutamate, and release of the classical/fast neurotransmitter thereby
determines whether synaptic targets are inhibited or activated 277. However, there have been
conflicting reports on the neurochemistry of LHA Nts neurons, with some studies indicating that
LHA Nts neurons co-express the inhibitory neurotransmitter GABA 200 while others suggest they
are glutamatergic 202 We therefore sought to define the classical neurotransmitter content of

41

LHA Nts neurons, and whether subpopulations might be neurochemically distinguishable due to
containing GABA or glutamate.

As a first step we required a method to identify GABA and glutamate-containing cell
bodies, since they cannot be detected using immunoreagents. vGatCre and vGlut2Cre mice have
been used to identify GABA and glutamate-expressing neurons, respectively, so we verified the
fidelity of these lines for identifying classical neurotransmitter expression within the vicinity of the
LHA. First, we crossed vGatCre and vGlut2Cre mice onto a Cre-inducible GFP reporter line, such
that any cells that express these transcripts during development will be labeled with GFP
(vGatCre;GFP and vGlut2Cre;GFP mice). One caveat of such developmental labeling, however,
is that developing neurons may alter neurotransmitter expression over lifespan, which might
confound interpretation of how they signal in the adult brain 278. Thus, we also injected adult
vGatCre and vGlut2Cre mice with an AAV Cre-inducible red fluorescent protein (RFP), to visualize
mature neurons containing GABA and glutamate via expression of RFP. We then compared the
GFP- and AAV-RFP reporter expression with ISH data from the Allen Brain atlas to verify
whether each method faithfully identified classical neurotransmitter expression in LHA-adjacent
brain regions known to primarily contain glutamatergic neurons (the STN) or GABAergic
neurons (the zona incerta, ZI). ISH for vgat confirms high expression within the zona incerta
(ZI), but not the adjacent STN (Figure 2-6 A,D,E) and the vGatCre;GFP mice (Figure. 2-6 B,F,G)
similarly exhibit numerous GFP-labeled vGAT neurons within the ZI but few in the STN (Figure
2-6 F,G). The vGatCre mice injected with AAV-RFP exhibited RFP-labeled vGAT cells in a
similar distribution, with many RFP-labeled cell bodies in the ZI but none in the adjacent STN
(Figure 2-6 C,H,I). In sum, these data confirm that Cre-mediated expression via reporter mice
or AAVs can be used to visualize GABA neurons. In contrast, ISH for vglut2 indicates minimal
ZI expression, but robust labeling in the STN (Figure 2-6 J,M,N) and the distribution of GFP42

labeled vGlut2 neurons is similar from vGlut2Cre:eGFP mice (Figure 6 K,O,P). Many GFP
positive cells are present in the STN (Figure 2-5 O) in contrast to a marked absence of GFPlabeled cells in the STN (Figure 2-5 P). We observed some RFP expression within the STN of
vGlutCre mice that were injected in the LHA with AAV-RFP (Figure 2-6 L,Q), but the AAV did not
spread laterally enough to robust infect this region. Consistent with the lack of glutamate
neurons in the ZI, we observed minimal RFP within the ZI even though the AAV-RFP appears to
have transduced cells in adjacent regions (Figure 2-6 L,R). Taken together, these data
demonstrate that the Cre-dependent GFP reporter and AAV-RFP reporters can be used along
with vGatCre and vGlut2Cre mice to accurately identify GABA and glutamate neurons, and hence
we can use these models to examine the neurotransmitter content of the LHA.

2.4.7

NtsFlpO Mice Identify LHA Nts Neurons Without the Use of Cre
To define the neurotransmitter content of LHA Nts neurons we must simultaneously label

Nts and vGat or vGlut. However, the use of vGatCre and vGlut2Cre mice necessary for detection
of GABA and glutamate neurons precludes simultaneous Cre-dependent detection of Nts using
NtsCre mice. To overcome this limitation, we generated a dual recombinase system, whereby
Cre-mediated recombination identifies vGAT or vGlut-expressing cells, but FlpO-dependent
recombination is used to visualize Nts expressing cells. To enable FlpO-dependent
identification of Nts neurons, we modified the targeting vector that was used to generate NtsCre
mice, and replaced the coding sequence for Cre-recombinase with FlpO recombinase. We then
injected the resulting NtsFlpO mice or control mice lacking Cre (WT) with an AAV that drives
FlpO-inducible expression of GFP (AAV-FrtGFP) to verify the specificity of the FlpO-dependent
system for visualizing LHA Nts neurons (Figure 2-7). No GFP-labeled cells were observed in
the LHA, ZI or STN of WT mice injected with AAV-FrtGFP, confirming the FlpO-dependence for
GFP expression (Figure 2-7 A-E). By contrast, injection of AAV-FrtGFP into the LHA of NtsFlpO
43

mice resulted in GFP-labeled cell bodies within the LHA, ZI and STN (Figure 2-7 F-H). The
distribution of GFP-labeled cells in NtsFlpO mice is similar to that of NtsCre;GFP mice, though
fewer cells are reported; these results are consistent with the limited recombination efficiency of
Flp as compared to Cre 279. However, the NtsFlpO mouse model enables dual recombinase
studies necessary to permit simultaneous detection of Nts and other signals that require Cremediated detection, such as vGAT and vGlut.

2.4.8

Determination of Classical Neurotransmitter Content Within LHA Nts Neurons
Using the Dual Recombinase System
Next, we verified the fidelity of the dual recombinase system to simultaneously label Nts

cells and vGat or vGlut-expressing cells. NtsFlpO mice were crossed to vGatCre or vGlut2Cre mice
to produce NtsFlpO;vGatCre and NtsFlpO;vGlutCre mice respectively. As a first step we injected
these mice in the ZI with AAV-Frt-GFP (to permit FlpO-mediated expression of GFP that
identifies Nts neurons) and AAV-LoxP-RFP (to permit Cre-mediated expression of RFP for
detection of vGat or vGlut neurons). Since the ZI primarily contains GABAergic but not
glutamatergic neurons (Figure 2-6), the dual recombinase system should only result in GFP and
RFP co-labeling of ZI cells in NtsFlpO;vGatCre mice, but not in NtsFlpO;vGlutCre mice. As
anticipated, dual AAV injection into the ZI of NtsFlpO;vGlutCre mice results in many GFP-labeled
Nts neurons, none of which contain RFP-vGlut (Figure 2-8 A, B, cyan arrows). The GABAergic
ZI is in fact devoid of RFP-vGlut, despite the robust induction of RFP in surrounding regions
known to contain glutamate (Figure 2-8 A,B). By contrast, in dual AAV-injected NtsFlpO;vGatCre
mice, we observed that all of the GFP-labeled Nts cells co-label with RFP-vGat, indicating that
ZI Nts neurons are GABAergic (Figure 2-8 C,D; white arrows indicate co-labeled cells, cyan
arrows identify RFP-vGat cells that do not contain GFP-Nts). Taken together, these data
confirm that the ZI Nts cells are GABAergic, but not glutamatergic, as would be expected of this
44

primarily GABAergic brain region. Furthermore, these data confirm the fidelity of the dual
recombinase system to distinguish the classical neurotransmitter content of LHA Nts neurons.

Next, we used to dual recombinase system to determine whether subsets of LHA Nts
neurons can be discriminated via their classical neurotransmitter expression. Dual AAV
injection into the LHA of NtsFlpO;vGlutCre mice identifies GFP-Nts neurons (Figure 2-8 E,F, cyan
arrows) and RFP-vGlut2 neurons (Figure 2-8 E,F, magenta arrows), but we did not observe any
LHA cells that co-express both labels. By contrast, dual AAV injection into the LHA of
NtsFlpO;vGatCre mice identified GFP-Nts neurons, most of which co-label with RFP-vGat (Figure
2-8 G,H, white arrows). We also observed many RFP-vGAT neurons that did not co-label with
GFP-Nts (Figure 2-8, G, magenta arrows). Together these data suggest that LHA Nts neurons
are predominantly GABAergic, and they comprise a subset within the larger population of LHA
GABA neurons.

2.4.9

Determination of Classical Neurotransmitter Content of LHA Nts Neurons Using
Colchicine-Mediated Nts-IR
The dual recombinase method suggests that LHA Nts neurons do not contain glutamate,

based on the absence of neurons co-expressing both Nts-GFP and RFP-vGlut. However, this
negative result could occur due to experimental artifact. For example, inefficient AAV-LoxPRFP infection within NtsFlpO;vGlutCre mice might result in under-detection of LHA glutamate
neurons. We therefore sought to validate the classical neurotransmitter content of LHA Nts
neurons via a strategy that did not depend on AAV-mediated recombination. We attempted to
generate dual-reporter mice, but commercially available FlpO and Cre reporter lines proved
ineffective for simultaneous labeling of Nts and vGat or vGlut neurons. This also raised concern

45

that limited efficiency of FlpO-mediated recombination in NtsFlpO mice might under-report LHA
Nts neurons, and diminish the likelihood of detecting a small population of glutamatergic LHA
Nts neurons.

As an alternate method, we treated vGatCre;GFP and vGlut2IRESCre;GFP mice (validated in
Figure 2-6) with colchicine, allowing for simultaneous visualization of GFP-labeled vGat and
vGlut neurons and Nts-IR cell bodies (as in Figure 2-1). Similar to findings using the dual
recombinase strategy, we observed numerous Nts-IR cell bodies within the LHA and ZI of
colchicine-treated mice (Figure 2-9 A-F). While the ZI from vGlut2Cre;GFP mice was devoid of
GFP-vGlut2 neurons (Figure 2-9 E), vGatCre;GFP mice had many GFP-vGat neurons in the ZI,
many of which also contained Nts-IR (Figure 2-9 F, white arrows). These data are consistent
with the GABAergic phenotype of the ZI, and our findings using the dual recombinase system
(Figure 2-8) that ZI Nts neurons are GABAergic but not glutamatergic. We observed many NtsIR labeled cell bodies within the LHA (Figure 2-9 A-D), as well as GFP-labeled LHA glutamate
neurons (Figure 2-9 C) and GFP-labeled GABA neurons (Figure 2-9 D). Despite the robust
GFP-labeling induced in both lines, we did not observe any Nts-IR cell bodies within the LHA
that co-localized with GFP-vGlut (Figure 2-9 C). By contrast, essentially all of the LHA Nts-IR
cell bodies overlap with GFP-vGat (Figure 2-9 D, white arrows), but we also observed GFPvGat neurons that did not contain Nts-IR (Figure 2-9 D, magenta arrows). In sum, colchicinemediated Nts-IR recapitulated our findings using the dual-recombinase system: that LHA Nts
neurons are GABAergic, but comprise a subset of the larger population of LHA GABA neurons.

2.5 Discussion
The LHA is essential for the motivation to eat and drink, but the neural mediators of
these behaviors have yet to be fully understood. While most LHA populations promote food and
46

liquid intake, LHA Nts neurons divergently regulate ingestive behavior by suppressing feeding
and promoting drinking 177;269 . Since LHA Nts neurons regulate ingestion in opposing
directions, we hypothesized that there may be separate subpopulations of LHA Nts neurons to
coordinate feeding vs. drinking behavior. Consistent with this, we have characterized two
separate subpopulations of LHA Nts neurons that are differentially activated by leptin (NtsLepRb
neurons) or dehydration (NtsDehy neurons). While all LHA Nts neurons are GABAergic, the
NtsLepRb and NtsDehy subpopulations differ in molecular expression of LepRb and at the circuit
level, and hence can be distinguished via these criteria. These data demonstrate, for the first
time, the heterogeneity of LHA Nts neurons, and their specific responsiveness to either energy
or fluid balance cues suggest that they may coordinate different ingestive behaviors (feeding vs.
drinking). Going forward, it will be important to define the roles of NtsLepRb neurons and NtsDehy
neurons in coordinating ingestive behavior. The projection and molecular differences between
neural subpopulations, as we have defined here, may enable development of molecular tools to
selectively modulate either NtsLepRb or NtsDehy neurons, and thereby to discern their receptive
contributions to homeostasis.

LHA Nts neurons have been less studied compared to other LHA populations, largely
because the methods to detect Nts-expressing cell bodies (ISH or colchicine-mediated Nts-IR)
were difficult to employ. Furthermore, these methods impeded examination of any coexpressed markers, circuit differences or responses to physiologic status necessary to
understand their function. We overcome these limitations by using NtsCre mice, which provide a
non-invasive means of reliably identifying Nts neurons, and permit their study under normal,
physiologic conditions. Using these mice, we found that ~12% of the LHA Nts neurons are
NtsDehy neurons (Figure 2-5 C), and NtsLepRb neurons make up a separate 15% of LHA Nts
neurons 269. While these are modestly sized populations, they can significantly influence
47

homeostasis; for example, mice lacking leptin-regulation via NtsLepRb neurons have impaired
ability to respond to energy balance cues and diminished dopamine signaling that cause them
to become overweight 200;269. Further characterization of the remaining 70% of LHA Nts neurons
at the molecular and circuit level may provide insights about their function. For example, at
least some LHA Nts neurons are activated by LPS-mediated inflammation and inhibit local
orexin/hypocretin neurons, and these may contribute to illness-behavior 150. Although these
LPS-regulated LHA Nts neurons are distinct from LepRb-expressing neurons (data not shown),
it remains unclear if they overlap with the NtsDehy population. Nts signaling is also implicated in
regulation of analgesia, thermoregulation, stress and addiction, so it will be important to
determine if/how the remaining LHA Nts neurons contribute to these diverse aspects of
physiology. Characterizing the heterogeneity of LHA Nts neurons may also suggest
intersectional or pharmacological strategies to target specific subpopulations of LHA Nts
neurons, and hence selective physiological outputs.

LHA neurons project widely throughout the brain, and differentially modify behavior
depending on what brain regions they target. Our finding that only NtsLepRb neurons, and not
NtsDehy neurons, project to the midbrain suggests that there are distinct LHA Nts neural
mechanisms for leptin-mediated suppression of feeding vs. regulation of drinking and fluid
balance. We previously showed that experimental activation of LHA Nts neurons causes
release of Nts to the VTA, and dopamine release into the nucleus accumbens 194 that can
modify motivated intake behavior 194;280;281. Thus, at least some portion of anorectic leptin
regulation via NtsLepRb neurons occurs via their modulation of the mesolimbic dopamine
signaling. This is consistent with the requirement of leptin action via NtsLepRb neurons for
adaptive energy balance in response to hormonal cues of energy status, and for regulating body
weight and the integrity of the mesolimbic dopamine system, which are due in part to Nts
48

signaling via VTA neurons expressing neurotensin receptor-1 (NtsR1) 191;200. In contrast, NtsDehy
neurons must act via other yet-to-be determined projection targets, and do not directly modulate
dopamine signaling to modify physiology. While the function of NtsDehy neurons and their
projection sites remains to be established, the activation of NtsDehy neurons in response to
dehydration suggests that they may coordinate fluid need with the motivation to drink, and
perhaps to maintaining fluid homeostasis. The discovery of specific subsets of LHA Nts
neurons data also provides context for understanding why experimental activation of all LHA Nts
neurons results in diverging ingestive behaviors. Such activation simultaneously induces
NtsLepRb neurons that act via the VTA (and may be anorectic) as well as the NtsDehy neurons that
regulate separate targets, and it is possible that these populations suppress feeding and
promote drinking, respectively 177. Since NtsLepRb and NtsDehy neurons are induced by separate
physiological cues (leptin or dehydration), it remains to be determined whether there are any
physiological situations in which these subpopulations are concurrently activated. In any case,
our data confirm that NtsLepRb and NtsDehy neurons have distinct circuitry, thus projection-specific
modulation may be a useful strategy to discern their respective contributions to ingestive
behavior.

Our data reveal molecular and circuit heterogeneity of LHA Nts neurons, but surprisingly
all LHA Nts neurons contain the same classical neurotransmitter, GABA. Thus, LHA Nts
neurons presumably inhibit synaptic targets via release of GABA, as well as regulating
postsynaptic and adjacent neurons via release of Nts. It remains to be determined if GABA and
Nts are always co-released from LHA Nts neurons, and hence the importance of the dual
neurotransmitter and neuropeptide signals for control of ingestive behavior. However, work
from other LHA neurons suggests that different physiological stimuli bias the release of
neurotransmitter vs. neuropeptide signals, and the receipt of these messages depends on the
49

repertoire of receptors expressed on target neurons, which can also vary 282-284. In this sense,
the dual Nts and GABA expression may permit signaling flexibility, such that LHA Nts neurons
can adapt signaling in various contexts and via different circuits. Our finding that LHA Nts
neurons are GABAergic is consistent with other reports of overlapping LHA Nts and GABAergic
neurons 194;285 but contrasts with the reported population of glutamatergic LHA Nts neurons that
directly project to the VTA 202. This discrepancy may be due to characterization of different Nts
neurons between this study and our own. We characterized LHA neurons in the vicinity of the
perifornical region, roughly between Bregma -1.34 to 1.70 271, but the reported glutamatergic
LHA Nts neurons were identified around the “rostral lateral hypothalamus” corresponding to
Bregma -0.4. In fact, Bregma -0.4 is well beyond the boundary of the perifornical LHA, and
occurs at the rostral border of the LHA where it merges into the preoptic area. Hence, it is
entirely possible that the perifornical LHA Nts neurons studied here are GABAergic, while the
much more rostral population of LHA Nts neurons within the hypothalamus-preoptic continuum
are glutamatergic. We did not assess LHA Nts neurotransmitter content in this rostral region,
since it is well beyond the accepted LHA region defined by the presence of MCH and
orexin/hypocretin neurons. However, in the future, we could use the dual recombinase system
to define the neurochemistry of these, and other Nts neurons throughout the brain.

While all LHA Nts neurons contain GABA, they comprise only a minor subset of the vast
population of LHA GABA neurons (Figure 2-8, 2-9). This may account for the strikingly different
behaviors observed after experimental activation of LHA Nts neurons (suppression of feeding,
increased drinking) vs. activation of all LHA GABA neurons (increased feeding, drinking and
gnawing directed at non-biological objects) 177;194;266;267. Since activation of LHA Nts and LHA
GABA neurons promotes drinking, LHA Nts neurons contribute to at least some of the polydipsic
effect. The orexigenic effect observed with activation of all LHA GABA neurons, however, likely
50

masks the anorectic effects mediated by the modest population of LHA Nts neurons
(presumably NtsLepRb neurons) encompassed within them. Our findings agree with reports that
there are functionally-distinct subpopulations of LHA GABA neurons 265, and LHA Nts neurons
identify a functionally unique subset within the larger population of all GABA neurons that
suppresses feeding instead of promoting it. Additionally, the finding that LHA Nts neurons are a
subset of LHA GABA neurons may explain the proposed differences in VTA regulation that have
been ascribed to these populations. Some LHA GABA neurons project to the VTA, where they
disinhibit VTA GABA neurons that in turn releases inhibition of DA neurons to facilitate DA
release and feeding 266;286. Some GABA-containing LHA Nts neurons, including NtsLepRb
neurons, also project to the VTA, and their precise synaptic targets are yet to be defined.
However, NtsR1 is predominantly expressed by VTA dopamine neurons, suggesting that LHA
Nts neurons might act via different targets then the general VTA-projecting LHA GABA neurons.
Going forward, it will be important to distinguish how subsets of LHA Nts neurons and other LHA
GABA neurons modify VTA signaling to understand how they differentially coordinate feeding
behavior.

Taken together, our data reveal the heterogeneity of LHA Nts neurons, and suggest at
least some molecular and projection differences between subpopulations that may be useful to
modulate specific subsets. Since LHA Nts neurons are differentially regulated by energy status
(leptin) vs fluid status (dehydration), and comprise separate subpopulations, our data
intriguingly suggest that there are separate neural mechanisms to coordinate feeding and
drinking necessary for homeostasis and survival. If true, then the molecular and projection
features we report here may enable design of strategies to selectively modify the LHA Nts
neurons that control feeding vs. those that modify drinking. Such strategies could prove useful

51

to treat life-threatening feeding disorders such as obesity or anorexia nervosa, or disrupted fluid
balance, as commonly occurs due to aging-related loss of thirst or in psychogenic polydipsia.

52

2.6 Figures

Figure 2-1: Validation of NtsCre;GFP Mice to Visualize LHA Nts Neurons

A) Representative portion of the LHA that contains B) Nts-expressing cell bodies detected via
ISH (courtesy of the Allen Brain Atlas (Lein 2007), C) Nts-Immunoreactivity (IR) only identifies
fibers within the LHA unless D) mice were pretreated with ICV colchicine, which inhibits axonal
transport and permits detection of Nts-IR within cell bodies (white outline arrows). E) Nts-IR
(red) in colchicine-treated NtsCre;GFP mice that express GFP in Nts neurons (green). F-H)
Insets show the STN from E. F) Many GFP-labeled Nts cell bodies are found within the STN
consistent with Nts ISH (Lein 2007),and the G) Nts-IR cell bodies in this region H) entirely
overlap with the GFP (Nts) cells (yellow outline arrows). I-K) Insets show the LHA from E,
where I) the GFP-labeled cell bodies and J) Nts-IR cell bodies K) overlap (yellow outline
arrows). Together these data confirm that NtsCre;GFP mice correctly identify Nts-expressing
cells, and can be used to visualize them.

53

Figure 2-2: LHA Nts Neuron Project to the VTA and SNc

A) NtsCre;GFP mice were injected in the VTA with the retrograde tract tracer FluoroGold (FG).
B-D) Representative insets from the LHA showing B) GFP-labeled Nts cell bodies (green) and
54

Figure 2-2 (cont’d)
C) cell bodies that have accumulated FG (red) and from the VTA. D) Some GFP-labeled Nts
cells contain FG, indicating LHA Nts neurons that project to the VTA (yellow arrows) while GFPlabeled Nts cells lacking FG do not project to the VTA (green arrows). Some non-Nts cells also
project to the VTA (red arrows). E) NtsCre;GFP mice received FG into the SNc. F-H) Insets from
the LHA show F) GFP-labeled Nts cell bodies (green) and G) cell bodies that have accumulated
FG (red) and from the SNc. The LHA contains cells co-labeled with Nts-GFP and FG indicating
that they project to the SNc (yellow arrows), as well as GFP-labeled Nts neurons that lack FG
and do not project to the SNc (green arrows). There are also non-Nts neurons that project to
the SNc (red arrows). Together, these data demonstrate that many LHA Nts neurons project to
the VTA and the SNc, but the projection density to the VTA is slightly more robust than to the
SNc. VTA-injected n = 12, SNc-injected n = 11. Abbreviations: mt = mammillothalamic tract; f =
fornix; LHA = lateral hypothalamic area.

55

Figure 2-3: Nts LepRb Neurons Project to the VTA and SNc

NtsCre;GFP mice were treated with A-C) vehicle or D-F) leptin (5mg/kg, IP, 2 hr) to permit
detection of A) GFP-labeled Nts neurons (green) and B) phosphorylated STAT3 (pSTAT3), a
marker for leptin-activated LepRb neurons (blue). Cyan arrows label Nts neurons without
56

Figure 2-3 (cont’d)
pSTAT3. Magenta arrows identify pSTAT3 that does not co-label with GFP (e.g. LepRb
neurons that do not express Nts). Cyan-outlined magenta arrows identify GFP-labeled Nts
neurons that co-localize with pSTAT3 and are NtsLepRb neurons. G-P) NtsCre;GFP mice
received FG in the VTA or SNc (to identify midbrain projecting neurons) and were treated with
leptin (5mg/kg, IP, 2 hr) to permit identification of LepRb neurons via induction of pSTAT3.
Examination of the LHA from VTA-injected mice revealed H) GFP-labeled Nts neurons, I) FGlabeled neurons that project to the VTA and J) pSTAT3 neurons. K) Merged panels identify
some neurons containing GFP, FG and pSTAT3 that are NtsLepRb neurons that project to the
VTA (white arrows). L-P) Examination of the LHA from SNc-injected mice reveal M) GFPlabeled Nts neurons, N) FG-labeled neurons that project to the SNc and O) pSTAT3 neurons.
P) Merged panels identify some neurons containing GFP, FG and pSTAT3 that are NtsLepRb
neurons that project to the SNc (magenta-outlined yellow arrows). Key for other arrows: cyan
arrows = Nts-GFP only neurons; magenta arrows = pSTAT3-only (LepRb) neurons; cyanoutlined magenta arrows = NtsLepRb neurons that do not project to the VTA/SNc; yellow arrows =
FG-only neurons that project to the VTA/SNc; cyan-outlined yellow arrows = Nts neurons that
project to the VTA/SNc but do not contain LepRb; magenta-outlined yellow arrows = VTA/SNc
projecting LepRb neurons that do no express Nts; white arrows = VTA/SNc-projecting NtsLepRb
neurons. These data demonstrate that at least some NtsLepRb neurons project to the VTA and
the SNc. VTA-injected vehicle-treated n=6; female VTA-injected leptin-treated n = 10; SNcinjected vehicle-treated n = 5; SNc-injected leptin-treated n = 9.

57

Figure 2-4: Dehydration-sensitive LHA Nts Neurons DO Not Project to the VTA or SNc

LHA NtsDehy Neurons Do Not Project to the VTA or SNc. A-F) NtsCre;GFP mice were given
ad-lib water (Euhydrated) or were dehydrated overnight. Brains were assessed for GFP-labeled
Nts neurons (green) and cFos, a marker of recent neuronal depolarization (blue). Cyan arrows
label
58

Figure 2-4 (cont’d)
Nts-GFP neurons and magenta arrows identify dehydration activated neurons that do not
express Nts-GFP. Cyan-outlined magenta arrows identify Nts-GFP neurons that co-express
cFos (NtsDehy neurons). G-P) NtsCre;GFP mice were injected with FG into the VTA or SNc (to
identify midbrain projecting neurons) and dehydrated overnight (to identify dehydration-activated
neurons via cFos-IR). Assessment of the LHA revealed some NtsDehy neurons (Cyan-outlined
magenta arrows), but none of these accumulated FG. Similarly, L-P) NtsDehy neurons were
found within the LHA of SNc-injected mice, but none of these contained FG. Key for arrows:
cyan arrows = Nts-eGFP only neurons; magenta arrows = cFos-only (dehydration-activated)
neurons; cyan-outlined magenta arrows = NtsDehy neurons that do not project to the VTA/SNc;
yellow arrows = FG-only neurons that project to the VTA/SNc; cyan-outlined yellow arrows = Nts
neurons that project to the VTA/SNc but are not activated by dehydration; magenta-outlined
yellow arrows = dehydration-activated VTA/SNc projecting neurons that do no express Nts. No
arrows are present to label VTA/SNc-projecting NtsDehy neurons because no such neurons were
found. These data demonstrate that the subpopulation of LHA NtsDehy neurons does not project
to the VTA or SNc. VTA-injected, euhydrated n = 5; VTA-injected, dehydrated n = 9; SNcinjected, euhydrated n = 5, SNc-injected, dehydrated n = 9.

59

Figure 2-5: LHA NtsLepRb Neurons are Molecularly Distinct from NtsDehy Neurons

In order to further verify that the dehydration and leptin-sensitive subpopulations of LHA Nts
neurons do not overlap we employed a mouse model that expresses GFP in all LepRb neurons
(LepRb;GFP mice). LepRb-GFP mice and NtsCre;GFP mice were treated with dehydration
(O.N) or given ad lib water and brains were immunostained for GFP and cFos (a marker of
recent neuronal activation). A) Dehydration induces cFos expression within Nts neurons in the
LHA. However, B) while cFos induction can been seen, there is no colocalization with LepRb
neurons. C) Quantification of cFos induction in Nts vs LepRb neurons after dehydration.
This data shows that dehydration does not activate LepRb neurons and therefor the LepRb
expressing subpopulation of LHA Nts neurons is necessarily distinct from LHA NtsDehy neurons.

60

Figure 2-6: Visualization of LHA GABA and Glutamate Neurons

A) ISH for vGat expression from the Allen Brain Atlas (Lein 2007), B, B’) Digital magnifications
of the STN and ZI show that the STN lacks vGat expression while the Zona Incerta (ZI) contains
many vGat-expressing cell bodies. C, D, D’) vGatCre;GFP mice show a similar distribution of
vGat-GFP labeled cells as vGat ISH (A), including few vGat-GFP cells in the STN and many
within the ZI. E, F, F’) vGatCre mice injected with AAV Cre-inducible RFP have no RFP labeling
in the STN but many ZI-labeled RFP cells, and mirror the distribution observed via vGat ISH and
from vGatCre;GFP mice. G) ISH for vGlut2 expression from the Allen Brain Atlas. Boxed regions
are digitally magnified in H, H’) and identify many vGlut2 cell bodies in the STN but none within
the ZI. I, J, J’) vGlut2Cre;GFP mice identify a similar distribution of GFP-labeled vGlut2 cells as
the vGlut2 ISH, including many GFP vGlut2-GFP cells in the STN but none in the ZI. K, L, L’)
Likewise, vGlut2Cre mice injected in the LHA with AAV Cre-inducible RFP have some viral
spread and vGlut2-RFP labeled cell bodies in the STN but none in the ZI. Collectively these
data demonstrate that vGatCre and vGlut2Cre mice can be used with Cre-inducible reporter mice
or AAVs to reliably identify vGat and vGlut neurons. Abbreviations: mt = mammillothalamic
tract; f = fornix; LHA = lateral hypothalamic area, STN = Sub-thalamic Nucleus, ZI = Zona
Incerta.
61

Figure 2-7: FlpO-Mediated Detection of Nts Neurons

A-B’’) Nts ISH identifies many Nts-containing cell bodies within the LHA, and some within the ZI
and STN, courtesy of Allen Brain atlas (Lein 2007). C-D’’) WT mouse injected with AAV-FrtGFP
in the LHA shows no induced GFP expression within the LHA, ZI or STN. E-F’’) NtsFlpO mouse
injected with AAV-FrtGFP in the LHA shows many GFP-labeled cell bodies around the injection
site, similar to the distribution of Nts ISH (A). Many GFP-induced cell bodies are found within
the LHA and some are observed within the ZI and STN. These data confirm the specificity of
NtsFlpO model and AAV-FrtGFP to identify Nts neurons in a Cre-independent manner.
Abbreviations: mt = mammillothalamic tract; f = fornix; LHA = lateral hypothalamic area, STN =
Sub-thalamic Nucleus, ZI = Zona Incerta.

62

Figure 2-8: Dual Recombinase Identification of Neurotransmitter Content of Nts Neurons

Content of Nts Neurons. A-B’’) NtsFlpO;vGlut2Cre mice were injected in the ZI with AAV-FrtGFP
(to identify Nts neurons, green) and AAV CreRFP (to identify vGlut2/glutamate neurons, red).
Digital magnification of the boxed area in A revealed many GFP-Nts neurons (cyan arrows) but
no vGlut2 neurons in the ZI, consistent with the GABAergic nature of this brain region. C-D’’)
Dual AAV injection into the ZI of NtsFlpO;vGatCre mice identifies vGat/GABA neurons in the ZI
(magenta arrows), and all observed Nts-vGat2 neurons contain vGat2 (white arrows). These
63

Figure 2-8 (cont’d)
data confirm that the dual recombinase method correctly discerns GABA vs glutamatecontaining areas of the brain while also permitting identification of Nts neurons. E-F’’) Dual AAV
injection into the LHA of NtsFlpO;vGlut2Cre mice identifies RFP-vGlut2 neurons (magenta arrows)
and GFP-Nts neurons (cyan arrows). No overlapping RFP-vGlu2 and GFP neurons were
observed, indicating that LHA Nts neurons do not contain glutamate. G-H’’) Dual AAV injection
into the LHA of NtsFlpO;vGatCre mice revealed many RFP-vGat neurons (magenta arrows), and
also GFP-Nts neurons that overlapped with RFP-vGat cells (white arrows). Together, these
data confirm that LHA Nts neurons express GABA but not glutamate. NtsFlpO;vGlut2cre n=5,
NtsFlpO;vGatCre n=6). Abbreviations: mt = mammillothalamic tract; f = fornix; LHA = lateral
hypothalamic area, STN = Sub-thalamic Nucleus, ZI = Zona Incerta.

64

Figure 2-9: Confirmation of Dual Recomibinase Results With Colchicine Treatment

A, B) vGlut2Cre;GFP mice and vGatCre;GFP mice were treated with colchicine to permit detection
of Nts-IR (red) and GFP (green). C-C’’) In vGlut2Cre;GFP mice, many GFP-vGlut2 cell bodies
are found in the LHA (magenta arrows) along with Nts-IR cell bodies (cyan arrows), but no
overlapping cells were found. E-E’’) Analysis of the ZI from vGlut2Cre;GFP mice revealed a few
Nts-IR neurons, but no vGlut2-GFP cells, consistent with the GABAergic neurochemistry of the
ZI. D-D’’) The LHA of vGatCre;GFP mice contained many GFP-vGat cell bodies (magenta
arrows) and Nts-IR cells that all co-labeled with GFP-vGat (white arrows). D-D’) Similarly, colabeling was observed in the GABAergic ZI, F-F’) but not in vGlut2Cre;GFP mice. These data
confirm that LHA Nts neurons contain vGat and are GABAergic, but do not contain
vGlut/glutamate. vGlut2Cre;GFP mice n=4; vGatCre;GFP mice n=5. Abbreviations: mt =
mammillothalamic tract; f = fornix; LHA = lateral hypothalamic area, STN = Sub-thalamic
Nucleus, ZI = Zona Incerta.

65

Figure 2-10: Model of LHA Nts Subpopulations and Their Neurotransmitter Content and
Projection Targets

All LHA Nts neurons co-express the classical neurotransmitter, GABA and some project to the
VTA and SNc. Of these, there are distinct subpopulations of LHA Nts neurons that respond to
different anorectic cues; some are leptin-sensing (NtsLepRb neurons) and some are dehydrationactivated (NtsDehy neurons). NtsLepRb neurons project the VTA and SNc where they can access
the mesolimbic DA circuit, but NtsDehy neurons do not. Collectively, these data describe
functionally, molecularly and projection-distinct subpopulations of LHA Nts neurons that may
contribute to adaptive energy balance.

66

CHAPTER 3

Loss of Action via Neurotensin-Leptin

Receptor Neurons Disrupts Leptin and Ghrelin-Mediated
Control of Energy Balance
Authors: Juliette A. Brown, Raluca Bugescu, Thomas A. Mayer, Adriana V. Gata-Garcia, Gizem
Kurt, Hillary L. Woodworth and Gina M. Leinninger
This is a modified version of a published manuscript: Brown et al. (2017) Endocrinology

3.1 Abstract
The hormones ghrelin and leptin act via the lateral hypothalamic area (LHA) to modify
energy balance but the underlying neural mechanisms remain unclear. We investigated how
leptin and ghrelin engage LHA neurons to modify energy balance behaviors and whether there
is any cross-talk between leptin and ghrelin-responsive circuits. We demonstrate that ghrelin
activates LHA neurons expressing Hypocretin/Orexin (OX) to increase food intake. Leptin
mediates anorectic actions via separate neurons expressing the long form of the leptin receptor
(LepRb), many of which co-express the neuropeptide neurotensin (Nts); we refer to these as
NtsLepRb neurons. Since NtsLepRb neurons inhibit OX neurons, we hypothesized that disruption of
the NtsLepRb neuronal circuit would impair both NtsLepRb and OX neurons from responding to their
respective hormonal cues, thus compromising adaptive energy balance. Indeed, mice lacking
leptin action via NtsLepRb neurons, in a from-birth knock out model, exhibit blunted adaptive
responses to leptin and ghrelin that discoordinate the mesolimbic dopamine system, and
ingestive and locomotor behaviors, leading to weight gain. Collectively these data confirm that
NtsLepRb neurons are important neuronal hubs within the LHA for hormone-mediated control of
ingestive and locomotor behaviors and the regulation of body weight.

67

3.2 Introduction
Adaptive energy balance is the process by which the brain detects changes in energy
status and directs appropriate feeding and energy expenditure behaviors to resolve the
imbalance. The lateral hypothalamic area (LHA) is crucial for this process, as demonstrated by
rodents with LHA lesions that lose motivation to ingest and move even in the face of starvation
31;32

. Understanding of how the LHA mediates adaptive energy balance, however, has been

complicated by the neuronal complexity of this brain region 287. For example, LHA neurons
containing the classical neurotransmitters GABA or glutamate modify ingestion, but yet-to-be
defined subpopulations appear to control distinct aspects of feeding behavior 264-266. LHA
neurons can also be defined by their neuropeptide expression, such as populations that express
the neuropeptides melanin concentrating hormone (MCH) or hypocretin/Orexin (OX) and play
important roles in arousal and promoting feeding 81;106;288. The LHA also contains neurons that
express the neuropeptide neurotensin (Nts), which are implicated in suppressing feeding
behavior in response to dehydration-anorexia 289, inflammation 150 or the anorectic hormone
leptin 200. Indeed, at least some LHA Nts neurons express the long form of the leptin receptor
(LepRb) and are directly activated by leptin: we refer to these as NtsLepRb neurons.

LHA neuronal populations may detect specific energy cues, and thus differentially
control feeding and locomotor behavior to adapt energy balance. The LHA receives two
important hormone regulators of adaptive energy balance: leptin and ghrelin. Leptin is made by
adipose cells in proportion to energy stores, is released into the circulation and binds to LepRbexpressing neurons throughout the brain 2. Leptin acts specifically via LepRb neurons in the
LHA to modify feeding, physical activity and nutrient reward, and loss of leptin action via these
neurons promotes weight gain 200;290. Cells of the stomach and gastrointestinal tract secrete
ghrelin, a hormone that acts via neurons expressing the growth hormone secretagogue receptor
68

(GHSR) to increase food intake 291. LHA OX neurons express GHSR, are activated by ghrelin
and mediate at least some part of the orexigenic response to this hormone 292-294. Since leptin
and ghrelin depolarize target neurons in the LHA 200;295 but promote opposing behaviors, it is
tempting to speculate that they act via separate LHA populations. For example, there are leptinregulated NtsLepRb neurons and ghrelin-regulated OX neurons that each project to the dopaminerich ventral tegmental area (VTA) 255;296 and promote dopamine release to the nucleus
accumbens (NAc) that can modify feeding and locomotor activity. Furthermore, leptin and
ghrelin action via the LHA engages the dopamine signaling system to suppress or promote
feeding, respectively 191;200;297. Thus, there may be separate leptin and ghrelin-mediated LHA
circuits to coordinate peripheral need and dopamine-mediated behaviors required to restore
energy balance. It remains possible, however, that there is also cross talk between leptin and
ghrelin-mediated neural circuits to coordinate hormonal responses. Indeed, since NtsLepRb
neurons project to and inhibit OX neurons 200;298, leptin action via NtsLepRb neurons might be able
to suppress the ability of OX neurons to respond to ghrelin. Understanding precisely how leptin
and ghrelin engage the LHA is crucial to understand the regulation of adaptive energy balance,
and whether pharmacological modulation of these circuits might be a useful strategy to modify
body weight.

Here we examined the neural mechanisms by which leptin and ghrelin coordinate
adaptive energy balance via the LHA. We found that leptin and ghrelin act directly via separate
LHA populations- NtsLepRb and OX neurons, respectively. However, since NtsLepRb neurons
project to and inhibit OX neurons 200;298 we speculated that leptin action via NtsLepRb neurons
suppresses OX neurons and their ability to respond to ghrelin. In the face of increased
adiposity this circuit arrangement would simultaneously enable leptin action while suppressing
ghrelin-mediated signaling via the LHA, thus favoring weight loss behaviors. Loss of action via
69

NtsLepRb neurons, however, could derange the response to both leptin and ghrelin. We therefore
investigated whether loss of leptin signaling via NtsLepRb neurons impairs the NtsLepRb  OX
neuronal circuit, and thus prevents adaptive energy responses to both leptin and ghrelin.

3.3 Materials and Methods
3.3.1

Animals
All procedures were approved by the Michigan State University and the University of

Michigan Institutional Animal Care and Use Committees, in accordance with Association for
Assessment and Accreditation of Laboratory Animal Care and National Institute of Health
guidelines. Mice were bred in house, maintained on a 12h light/dark cycle with ad libitum
access to food and water, unless otherwise noted in experimental methods. Male mice were
used in all metabolic studies, and both males and females were used to examine the distribution
of LHA neurons.

Ntscre mice 200 [Jackson stock ♯ 017525], were crossed onto the C57/Bl6 line for seven
generations to obtain fully backcrossed animals. To visualize Nts neurons, Ntscre mice were
crossed with Rosa26EGFP-L10a mice 273, and heterozygotes were studied (referred to as NtsEGFP
mice). Mice lacking LepRb expression in Nts neurons (LRKO mice) were generated similar to
200

, but here only C57/Bl6 backcrossed animals were utilized. Briefly, mixed background Leprfl/fl

mice were crossed onto the C57/Bl6 background (Jackson #008327) for 7 generations. Next,
backcrossed Ntscre mice were bred with backcrossed Leprfl/fl mice to generate Ntscre/+;Leprfl/+ and
Nts+/+;Leprfl/+ mice, which were subsequently intercrossed to obtain Ntscre/+;Leprfl/fl study animals
(LRKO) and Nts+/+;Leprfl/fl littermate controls (controls). Note that all resulting study mice are on

70

the C57/Bl6 background. Male LRKO and control study mice were single housed at 4 wk of age
and studied between 8 and 37 wk of age.

DNA was extracted from tail biopsies of progeny and analyzed via standard PCR to
identify study animals. Ntscre: common forward: 5' ATA GGC TGC TGA ACC AGG AA, cre
reverse: 5' CCA AAA GAC GGC AAT ATG GT and WT reverse: 5’ CAA TCA CAA TCA CAG
GTC AAG AA. Rosa26EGFP-L10a : mutant forward: 5’ TCT ACA AAT GTG GTA GAT CCA GGC,
WT forward: 5’ GAG GGG AGT GTT GCA ATA CC and common reverse: 5’ CAG ATG ACT
ACC TAT CCT CCC). Leprfl/fl mice were genotyped to verify cre-mediated deletion and the
absence of germline Lepr excision (referred to as LeprΔ): mLepR-105: 5' TGA ACA GGC TTG
AGA ACA TGA ACA C, mLepR-65-A: 5' AGA ATG AAA AAG TTG TTT TGG GAC GAT,
mLepR-106: 5' GGT GTC TGA TTT GAT AGA TGG TCT T). Mice that genotyped as Lepr∆
were not used for studies or for breeding purposes and were euthanized. A terminal tail biopsy
was collected at the conclusion of each study, and isolated DNA was used to verify genotype.

3.3.2

Reagents
Recombinant mouse leptin was purchased from the National Hormone and Peptide

Program (Los Angeles Biomedical Research Institute, Los Angeles, CA), and mice were treated
with 5 mg/kg leptin via intraperitoneal (IP) injection; this leptin dose optimally identifies leptinresponsive LepRb neurons throughout the hypothalamus 191. Recombinant rat ghrelin was
purchased from the PolyPeptide Group (Torrance, CA). Mice were treated with either
intracerebroventricular (ICV, 3 µg) or IP (100 µg) ghrelin. In all cases, control injections
consisted of equal volumes of vehicle solution. D-Amphetamine hydrochloride (Cayman

71

Chemical, Ann Arbor MI) was administered to assess activation of the dopamine system (4
mg/kg, IP).

3.3.3

Immunohistochemistry and immunofluorescence
Mice were anesthetized with a lethal dose of IP pentobarbital and transcardially perfused

with PBS followed by 10% neutral buffered formalin (Fisher Scientific, Pittsburgh, PA). Brains
were removed, post-fixed overnight in 10% formalin and then dehydrated in 30% sucrose before
coronal sectioning (30 µm) into four series using a freezing microtome (Leica, Buffalo Grove,
IL). A single series of brain sections was analyzed for each immunostaining experiment. To
identify NtsLepRb neurons in the LHA, NtsEGFP mice were treated with leptin (5 mg/kg, IP, 2h) and
brains were analyzed for EGFP (Nts), OX and phosphorylated-STAT3 (pSTAT3; a specific
marker of leptin-activated LepRb neurons 299. To identify neurons activated by ghrelin, NtsEGFP
mice were treated with ghrelin (100 µg, IP, 4 hr) and brains were analyzed for EGFP (Nts), OX
and cFos (a marker of neuronal depolarization). Leptin and ghrelin-induced neuronal activation
in the NAc was assessed in LRKO and control mice treated for 4 hr with IP leptin, ghrelin or
vehicle (as described above), and brains were analyzed via immunohistochemistry for cFos.
Immunostaining was performed as previously described 255. Briefly, brain sections were
exposed to primary antibodies for either cFos (Santa Cruz, goat, 1:500) or pSTAT3 (Cell
Signaling, rabbit, 1:500), followed by species-specific biotinylated antibodies (Jackson
ImmunoResearch, 1:100), avidin-biotinylation reaction (Vectastain, Vector Laboratories) and
diaminobenzidine (DAB) detection (Sigma). Other antibodies were subsequently added and
visualized via immunofluorescence, using species-specific Alexa-488 conjugated (Jackson
ImmunoResearch, 1:200) or Alexa-568 conjugated antibodies (LifeTech, 1:200). Antibodies
used for immunofluorescence included GFP (Abcam, chicken, 1:2000), dsRed/Tomato
(Clonetech, rabbit, 1:1000), Orexin-A (Santa Cruz, goat, 1:1000) and MCH (Santa Cruz, goat,
72

1:1000). Brains were analyzed using an Olympus BX53 fluorescence microscope outfitted with
transmitted light to analyze DAB-labeled tissue, as well as FITC and Texas Red cubes.
Microscope images were collected using Cell Sens software and a Qi-Click 12 Bit cooled
camera, and images were analyzed using Photoshop software (Adobe, San Jose, CA). Cell
counts were determined from microscope images, and an average of 6 LHA sections were
counted from each brain. For counting purposes, the LHA was designated as the area below
and lateral to the mammillothalamic tract (mt) and above the fornix. Each cell type was counted
individually and only once (i.e. cells expressing Nts only were counted separately from those
expressing Nts and pSTAT3). Counts were made in one series of brain sections, but were
multiplied by 4 to obtain total number of neurons per mouse. Graphs represent the average
number of neurons ± SEM.

3.3.4

Stereotaxic Injection for ICV Ghrelin Treatment and Tract Tracing
ICV cannulas were placed in LRKO and control mice to deliver ghrelin centrally. Mice

were administered pre-surgical analgesic, then were anesthetized using vaporized isoflurane/O2
and placed in a stereotaxic frame. After exposing the skull, an indwelling 26-gauge stainless
steel cannula with a removable dummy injector (Plastics One, Roanoke, VA) was implanted into
the ventricle. Coordinates to the lateral ventricle (from bregma) were A/P: -0.34, M/L: -1.0 and
D/V: -2.4 in accordance with the atlas of Paxinos and Franklin 271. Mice were allowed to recover
for 1 week. For treatment, the dummy was replaced with an injector with a 2.45 mm projection
used to deliver either 3 µL of sterile PBS or ghrelin (1 µg/µL), thus 3 µg total ghrelin was
administered. Mice were excluded from analysis if their cannulas were misplaced or if they
failed to gain weight and eat normally during the surgical recovery period prior to the study.

73

Cre-mediated tract tracing was performed in NtsCre and Ntscre/+;Leprfl/fl mice similar to
above, but instead a guide cannula with a stylet was placed into the LHA (A/P: 1.34, M/L, 1.13
and D/V, 5.20 in accordance with the atlas of Paxinos and Franklin

271

. The stylet was removed

and replaced by an injector, via which 250 nL of Adenoviral-Synaptophysin-mCherry (Ad-SynmCherry, graciously provided by Dr. Martin G. Myers Jr, University of Michigan) was injected
into the LHA at a rate of 100 nL/min. After 5 min the injector and cannula were removed from
the skull, and the incision was closed using VetBond surgical adhesive. Mice were then
housed individually for 5–7 days to allow for viral-mediated expression of new proteins and their
transport before euthanasia and tissue collection. Mice were only included for study if SynmCherry expressing cell bodies were confined to the LHA.

3.3.5

Metabolic Profiling:
LRKO and control mice were weaned at 4 weeks of age, maintained on standard rodent

chow, and single housed at 7 wk of age. Body composition was measured between 8-10 wk of
age using an NMR-based analyzer (Bruker Minispec L550, Billerica, MA). Mice were then
placed in TSE PhenoMaster metabolic cages (TSE Systems, Chesterfield MO), which are
home-cage sized cages outfitted with calorimetry sensors and beam-break sensors to detect –x,
-y and –z plane movement. Ambient temperature was maintained at 20-23˚C throughout
analysis and the airflow rate through the chambers was adjusted to maintain an oxygen
differential around 0.3% at resting conditions. VO2 and VCO2 in each chamber were sampled
for 3 min bouts rotating through each cage and –x, -y and –z beam breaks were recorded
continuously. Mice were acclimated in chambers for 1 day then measurements were collected
for three full 24 hr cycles. Data from the last full 12 hr light and 12 hr dark cycle were used for
analysis. Mice were returned to their home cages for 1 wk, then were placed in TSE cages

74

containing a running wheel to assess their voluntary movement, including the amount of time
spent on the wheel and running speed.

3.3.6

Sucrose preference testing
LRKO and control mice (10–16 wk) were single housed for at least one week prior to

two-bottle sucrose preference testing. For baseline testing of water intake, mice were given
two water bottles with sipper tubes, which were placed adjacent to the food hopper. The
positions of the bottles were swapped each morning to control for any proximity preference for
the bottle closest to the food hopper. Next, the content of one of the bottles was replaced with
1% sucrose, such that the mice had constant access to both water and sucrose-containing
bottles. In one experiment, mice were treated every 12 hr for 2 days with vehicle, then with
leptin (5 mg/kg, IP), and their daily liquid consumption was measured at 08:00 by weighing the
bottles. In a separate experiment, mice were treated every 12 hr for 2 days with vehicle,
followed by ghrelin (100 µg, IP), during which daily liquid consumption was measured at 17:00
by weighing the bottles. Data are reported as sucrose preference, which is the percentage of
sucrose consumed out of total liquid consumed. Total water consumption during baseline
testing days and during preference testing days was also calculated but no differences in water
intake were observed between genotypes.

3.3.7

Operant Responding
Single-housed LRKO and control littermates ages 9 – 37 weeks were given 15 sucrose

testing pellets (20 mg sucrose tablets, TestDiet, St. Louis, MO) in their home cage the night
before beginning daily testing in operant chambers (Med Associates, St. Albans, VT) to prevent
neophobia to sucrose rewards. Each session in the operant chambers lasted 1 hr or until mice
75

the received a maximum of 50 sucrose rewards. On the first training day a sucrose pellet was
delivered into the magazine every 30 seconds for a maximum of 50 pellets, so that the mice
learned where to obtain sucrose. Mice were then food restricted to 85% of their average food
intake, during which they trained to nose-poke for sucrose pellets on a fixed ratio (FR)-1
schedule and then an FR-5 schedule. The food restriction was used to incentivize mice to learn
the nose-poking task, and is commonly used for food-related operant testing. During FR-1 a
nose poke in the active port results in delivery of one sucrose pellet to the magazine, followed
by a 5-second timeout during which nose poking will not elicit a sucrose reward (to allow the
mouse time to eat the pellet). No sucrose pellet is delivered in response to nose poking in the
inactive port. The position of the active poke (right or left side of the chamber) was
counterbalanced between mice. Mice were trained on FR-1 until they received a minimum of
20 rewards with ≥ 75% accuracy (active pokes out of total active and inactive pokes) for three
consecutive days. Next the mice were trained for three days on an FR-5 schedule (5 active
nose pokes required to receive a sucrose reward, with a 5 second time out). Mice were then
restored ad libitum food in their home cages throughout progressive ratio (PR) testing. During
PR testing the response ratio was calculated such that the number of responses required to
earn a food reward followed the order: 1, 2, 4, 6, 9, 12, 15, 20, 25, 32, 40, 50, 62, 77, 95 and so
on. The final ratio completed is the breakpoint. Mice were tested via PR until they maintained a
stable breakpoint for a minimum of 3 days (defined as the point at which the number of earned
rewards deviates by no more than 1 reward.) After achieving stable PR, each mouse was
treated with IP vehicle, leptin (5 mg/kg) or ghrelin (100 µg) 1 hr prior to PR testing to assess
how these hormones modify motivated responding. Mice received only one hormone per day,
but each mouse received all of the treatments over the course of the experiment.

76

3.3.8

Gene Expression.
LRKO (n=10) and control mice (n=10) were euthanized and brains were microdissected

to obtain the LHA, VTA and NAc. The microdissection of the LHA is performed such that it is
enriched in MCH, OX and Nts neurons located above the fornix (the perifornical region) and just
lateral and below the MT, roughly between Bregma -2.18 mm and -1.06 mm 271. Two of the
LHA samples from control mice were excluded from analysis because the dissections were too
rostral, and were not centered on the perifornical region. The tissue samples were snap frozen
on dry ice and stored at -80˚C for later processing. RNA was extracted using Trizol (Invitrogen,
Carlsbad, CA) and 200 ng samples were converted to cDNA using the Superscript First Strand
Synthesis System for RT-PCR (Invitrogen, Carlsbad, CA). Sample cDNAs were analyzed in
triplicate via quantitative RT-PCR for gene expression using TaqMan reagents and an Applied
Biosystems 7500 (Applied Biosystems, Foster City, CA). GAPDH expression was used as an
internal control. Relative mRNA expression values are calculated by the 2-∆∆Ct method, with
normalization of each sample to the average ΔCt value from control mice. Two of the LHA
samples from LRKO mice were compromised during tissue processing and were not included in
the final results. Additionally, there was a pipetting error while preparing one of the control LHA
samples for Dlk1 RT-PCR, thus it was excluded from the final analysis.

3.3.9

Amphetamine-Induced Assessment of Striatal Activation
To assess activation of the dopamine system, animals were treated with D-amphetamine

hydrochloride (4mg/kg, IP). Mice were perfused 2 hr after treatment, and brains were
immunostained for cFos as described above.

77

3.3.10 Data analysis
Paired t-tests (to compare two groups) or one-way ANOVA with Bonferroni post-testing
(for comparisons between multiple groups) were calculated using GraphPad Prism (GraphPad
Software Inc., San Diego, CA). Error bars depict ± standard error of the mean (SEM).
Differences were considered significant for p < 0.05.

3.4 Results
3.4.1

Neurotensin Neurons are a Distinct Population of LHA Neurons and Some
Respond to Leptin
As a first step, we examined the distribution of three neuropeptide-defined populations of

LHA neurons that have been implicated in regulating energy balance: those containing MCH,
OX or Nts. Since Nts-expressing neurons cannot be visualized using standard immunolabeling
techniques, we examined brains from NtsEGFP mice for expression of Nts-EGFP to identify Nts
neurons, along with immunofluorescent labeling of MCH and OX neurons (Figure 3-1 A). While
neurons expressing MCH, OX and Nts are co-distributed throughout the LHA, they do not
overlap, indicating that they comprise three separate populations of neurons. Neuronal counts
(Figure 3-1 B) reveal similarly sized MCH and OX neuronal populations within the LHA (MCH =
2596 ± 497 neurons, OX = 2779 ± 319 neurons, n = 4) but there are three times as many NtsEGFP-labeled neurons (Nts = 8832 ± 494 neurons, n =4). These data confirm that LHA Nts
neurons are a distinct, highly abundant neuronal population within the LHA with presumably
unique contributions to physiology.

The LHA also contains neurons expressing LepRb, some of which co-express Nts 200.
Given the large number of LHA Nts neurons, we sought to clarify what proportion of them

78

express LepRb and thus can adaptively modify energy balance in response to leptin. We
treated NtsEGFP mice with leptin (5 mg/kg, IP, 2 h) and examined the distribution of Nts-EGFP
neurons along with leptin-induced phosphorylated signal transducer and activator-3 (pSTAT3),
which identifies neurons containing functional LepRb. We observed that some, but not all NtsEGFP neurons contained pSTAT3 (Figure 3-1 C, filled arrows). We also observed pSTAT3positive cells that did not co-label with Nts-EGFP (Figure 3-1 C, unfilled arrows), consistent with
reports that some LHA LepRb neurons do not contain Nts 200;201. Cell counts confirmed that
approximately 15 % of all Nts-EGFP neurons co-expressed pSTAT3, and these are hence
referred to as NtsLepRb neurons. Thus, NtsLepRb neurons represent a leptin-sensitive subset of all
Nts neurons, and they are intermixed with but distinct from MCH and OX neurons (Figure 3-1
D).

3.4.2

LHA Nts and OX Neurons are Directly Regulated by Different Energy Balance
Hormones
The orexigenic hormone ghrelin and the anorectic hormone leptin modify energy

balance, in part via actions in the LHA. Leptin activates LepRb expressing neurons, including
NtsLepRb neurons (Figure 3-1). Neurons expressing the Gq-coupled GHSR can be activated by
ghrelin, including OX neurons 293. It remained unclear, however, if leptin and ghrelin act via
completely separate or overlapping populations of LHA neurons (e.g. perhaps leptin and ghrelin
regulate both Nts and OX neurons). To examine this, we first treated NtsEGFP mice with either
vehicle or leptin (5 mg/kg, IP, 4 h) and examined whether Nts and OX neurons exhibit leptininduced pSTAT3. Leptin treatment significantly increased the percentage of Nts-EGFP neurons
containing nuclear pSTAT3 (Figure 3-2 A, filled arrows and Figure 3-2 B: vehicle = 1.2 ± 0.6%,
n=4; leptin =16.1 ± 1.5%, n=5, p < 0.0001), confirming that NtsLepRb neurons respond to leptin.
By contrast, very few OX neurons exhibited nuclear pSTAT3 with vehicle treatment, and this
79

percentage did not increase in response to leptin (Figure 3-2 A unfilled arrows and Figure 3-2 B;
vehicle = 0.5 ± 0.3%, n=4, leptin =0.9 ± 0.3%, n=5). Next, we treated NtsEGFP mice with either
vehicle or ghrelin (100 µg, IP, 4 h) and examined whether Nts and OX neurons exhibit cFos, a
marker of neuronal depolarization that has been used to identify ghrelin-activated neurons in
rodents and primates 292;293;300. Ghrelin treatment did not increase the percentage of Nts-EGFP
neurons that co-express cFos compared to vehicle treatment, suggesting that ghrelin does not
activate Nts neurons (Figure 3-2 C unfilled arrows and Figure 3-2 D: vehicle = 2.1 ± 0.5%, n=4,
ghrelin = 2.9 ± 0.3%, n=4). Ghrelin treatment did, however, significantly increase the
percentage of OX neurons that contain nuclear cFos (Figure 3-2 C filled arrows and Figure 3-2
D: vehicle = 9.2 ± 3.2%, n=4, ghrelin = 25.3 ± 4.3%, n=4), p = 0.005), consistent with previous
reports that OX neurons are directly regulated by ghrelin. Together these data demonstrate that
leptin specifically activates NtsLepRb neurons while ghrelin specifically activates OX neurons, and
thus that these hormones modify energy balance via separate LHA neuronal populations.

3.4.3

Generation of Mice to Study the Contribution of NtsLepRb Neurons to Homeostasis
and Motivated Behavior
Leptin action via LepRb is crucial for normal regulation of body weight 5;6;8, thus the

subset of Nts neurons that respond to leptin, the NtsLepRb neurons, likely contributes to energy
balance. Since NtsLepRb neurons are specific to, and confined within the LHA 200, they may
control unique aspects of leptin action compared to non-Nts expressing LepRb neurons in other
parts of the brain. Indeed, we previously examined the contribution of NtsLepRb neurons in
mixed-background mice with LepRb knocked out specifically from LHA Nts neurons (LRKO
mice); these LRKO mice exhibit mild hyperphagia at young ages, decreased physical activity
and blunted activation of the mesolimbic dopamine system that collectively cause increased
body weight 200. These data suggested that loss of leptin action specifically via NtsLepRb
80

neurons might disrupt both homeostatic and dopamine-mediated motivated behaviors that
impact energy balance, such as palatable feeding and non-obligate locomotor activity 297;301-303.
Such motivated behaviors must be assessed in pure-background mice to detect meaningful
differences, and indeed we could not detect differences in palatable feeding or non-obligate
activity in mixed-background LRKO mice (data not shown). Thus, to investigate the contribution
of NtsLepRb neurons to motivated behavior and energy balance, we backcrossed control and
LRKO mice onto to the C67/Bl6 background, which is the most commonly used genetic
background for assessment of motivated behaviors (Figure 3-3 A). As a first step we verified
that backcrossed LRKO mice lack functional LepRb in NtsLepRb neurons by visualizing vehicle
and leptin-induced pSTAT3 immunoreactivity in backcrossed control and LRKO mice (5 mg/kg
leptin, IP, 2 h). Vehicle treated control and LRKO mice had essentially no pSTAT3 within the
LHA (Figure 3-3 B). Leptin treatment robustly induced pSTAT3 in the LHA of control mice, but
much less so in the LHA of LRKO mice, confirming the loss of functional LepRb in NtsLepRb
neurons (Figure 3-3 B). LRKO mice do, however, exhibit some pSTAT3-positive neurons within
the LHA, indicating that the non-Nts containing LHA LepRb neurons are intact. Loss of LepRb
is specific to the LHA, the site of NtsLepRb neurons, as demonstrated by the finding that leptininduces similar amounts of pSTAT3 within other brain regions of control and LRKO mice, such
as the arcuate nucleus (Figure 3-3 B, insets). These data confirm that backcrossed LRKO
mice, like the previously generated mixed-background line 200, lack functional LepRb in NtsLepRb
neurons and thus are ideal models to examine the contributions of NtsLepRb neurons in both
homeostatic and motivated behaviors that impact energy balance. Backcrossed LRKO mice
were thus used for all subsequent experiments.

81

3.4.4

Loss of Action via NtsLepRb Neurons Disrupts Ghrelin Action in the LHA
Since NtsLepRb neurons project to and inhibit OX neurons 200;298;304 we speculated that

loss of leptin signaling via NtsLepRb neurons might disrupt regulation of OX neurons, including
their response to ghrelin, thus compromising adaptive energy balance. To test this, we treated
control and LRKO mice with central vehicle and ghrelin (3 µg, ICV, 4 hr) and quantified the
percentage of OX neurons that co-express nuclear cFos (OX:cFos) as a marker of activated OX
neurons. As expected, ghrelin treatment significantly increased the percentage of OX:cFos
neurons in control mice (Figure 3-3 C arrows and 3D: control mice, vehicle = 35.5 ± 2.0%, n =6;
ghrelin = 43.0 ± 2.5%, n=5, p = 0.049). By contrast, ghrelin treatment did not increase the
percentage of OX:cFos neurons in LRKO mice compared to vehicle treatment (Figure 3-3 C
arrows and 3D: LRKO mice, vehicle = 44.5 ± 1.8%, n=3; ghrelin = 44.1 ± 2.4%, n=3). It is
possible that the loss of inhibitory input from NtsLepRb neurons leads to biased excitatory input
onto OX neurons, such that they are at a maximal threshold of activation and cannot be further
activated by other signals (such as ghrelin). Differences in ghrelin-mediated activation in control
and LRKO mice are not due to altered numbers of OX neurons, since control and LRKO mice
have equivalently-sized populations of OX neurons (Figure 3-3 E: control = 1002 ± 24 neurons,
n = 11; LRKO = 985 ± 23 neurons, n = 6, p = 0.928). Thus, although leptin and ghrelin act via
separate populations of LHA neurons, loss of leptin sensing via NtsLepRb neurons that project to
OX neurons impairs the ability of OX neurons to be activated by ghrelin. These data suggest
that loss of leptin signaling via NtsLepRb neurons may disrupt adaptive energy balance in
response to both anorectic and orexigenic cues of energy balance.

82

3.4.5

Loss of Action via NtsLepRb Neurons Disrupts Energy Balance to Cause Weight
Gain
Leptin and ghrelin are important for modifying homeostatic and motivated behaviors that

impact energy balance 297;301-303. Since our data suggest that LRKO mice have blunted leptin
and ghrelin-mediated regulation of LHA neurons, we reasoned that their regulation of body
weight is disrupted due to altered homeostatic and motivated behaviors. To test this, we
compared control and LRKO mice in a battery of metabolic and behavioral tests. Indeed, adult
backcrossed LRKO mice weigh more than control mice (Figure 3-4 A, control = 23.93 ± 0.42 g,
LRKO = 25.39 ± 0.53 g, p=0.037), and have increased body fat (Figure 3-4 B, control = 3.89 ±
0.36 %, LRKO = 5.84 ± 0.77 %, p=0.024) similar to the overweight phenotype of mixed
background LRKO mice 200. Interestingly, adult LRKO mice do not become overweight due to
increased chow intake (Figure 3-4 C, control = 3.79 ± 0.28 g, LRKO = 3.50 ± .22 g, p=0.422) or
a deranged respiratory quotient (RQ), which would indicate altered metabolism of carbohydrate
and fat compared to controls (Figure 3-4 D, control = 0.89 ± 0.01, LRKO = 0.88 ± 0.02 g,
p=0.890.). Given the lack of increased caloric intake or altered usage, we examined whether
the increased body weight of LRKO mice could be due to altered energy expenditure. Indeed,
LRKO mice have significantly reduced spontaneous locomotor activity compared to control mice
(Figure 3-4 E, control = 91,341 ± 6,505 activity counts, LRKO = 70,330 ± 4,669 activity counts,
p=0.016) and exhibit a trend toward reduced spontaneous oxygen consumption/VO2 (Figure 3-4
F, control = 3488 ± 118 mL/hr/kg, LRKO = 3283 ± 133 mL/hr/kg, p=0.257). These data suggest
that deficits in energy expenditure promote weight gain in LRKO mice, and are consistent with
data from mixed background mice 200. Spontaneous locomotor activity contributes to the
regulation of body weight 305 but we reasoned that deficits in motivated, non-volitional locomotor
activity might also contribute to disrupted energy expenditure. Motivated locomotor activity can
be assessed in rodents by giving them access to a running wheel, and wheel running promotes

83

activation of mesolimbic dopamine neurons and dopamine release into the striatum 306;307. We
therefore gave control and LRKO mice access to running wheels to determine if loss of leptin
signaling through Nts neurons alters non-obligatory (volitional) locomotion. Indeed, LRKO mice
spent significantly less time on running wheels than control mice (Figure 3-4 G, control = 204.5
± 25.2 min, LRKO = 87.3 ± 32.5 min, p=0.009) and thus consumed less oxygen (Figure 3-4 H,
control = 4766 ± 185 mL/hr/kg , LRKO = 3862 ± 148, p=0.001). Collectively, these data indicate
that loss of leptin action via NtsLepRb neurons disrupts regulation of body weight due to
decreased energy expenditure, including impairing spontaneous and motivated locomotor
activity that is mediated via the mesolimbic dopamine system.

3.4.6

Loss of Action via NtsLepRb Neurons Disrupts Adaptive Feeding and Preference for
Palatable Food
In addition to locomotor activity, the mesolimbic dopamine system also modifies the

motivation to eat. Since loss of leptin action via NtsLepRb neurons disrupts the mesolimbic
dopamine system 200 and motivated locomotor activity (Figure 3-4), we reasoned that LRKO
mice might also have altered motivation to eat. Motivated feeding is influenced by two factors:
how much the food is preferred (or “liked”) and how much the food is “wanted” 308. We first
investigated whether food preference is altered in LRKO mice via a two-bottle sucrose
preference test. Control and LRKO mice did not exhibit any differences in total liquid intake
(Figure 3-5 A: control = 9.13 ± 0.52 g vs. LRKO = 9.42 ± 0.47, p =0.696), or sucrose preference
(Figure 3-5 B: control = 71.05 ± 1.91 % vs. LRKO = 72.11 ± 1.73 %, p =0.685), indicating that
loss of action via NtsLepRb neurons does not impede general sucrose preference or ingestion.
We reasoned, however, that the disruption of leptin signaling via NtsLepRb neurons might impair
the ability to modify preference in response to changes in circulating leptin, such as might occur
with increased adiposity. To examine the adaptive response to leptin, we treated control and
84

LRKO mice with vehicle or leptin (5 mg/kg, IP) during sucrose preference testing. As expected,
leptin decreases feeding compared to vehicle treatment in control mice but LRKO mice do not
significantly attenuate feeding in response to leptin (Figure 3-5 C: control = -3.13 ± 0.73 g vs.
LRKO = -0.49 ± 0.79 g, p =0.023). Sucrose preference, however, did not differ significantly
between leptin-treated control and LRKO mice (Figure 3-5 D: control = -1.86 ± 1.61 % vs. LRKO
= 1.18 ± 1.27 %, p =0.168). In sum these data indicate that increased leptin suppresses
feeding, in part, via LHA NtsLepRb neurons, but that leptin does not modify sucrose preference or
“liking” via NtsLepRb neurons.

Increases in circulating ghrelin promote feeding, and this response is mediated, in part,
via OX neurons 294;297. Since ghrelin-mediated activation of OX neurons is impaired in LRKO
mice we investigated whether this altered their feeding. Both control and LRKO mice increase
chow intake in response to ghrelin treatment (Figure 3-5 E: control = 0.48 ± 0.15 g vs. LRKO =
0.69 ± 0.15 g, p =0.557, indicating that adaptive feeding responses to ghrelin remain intact.
Ghrelin treatment also increases sucrose preference in control mice, as expected, but ghrelininduced sucrose preference is significantly blunted in LRKO mice (Figure 3-5 F: control = 5.10 ±
1.11 % vs. LRKO = -0.45 ± 1.58 %, p =0.018). These data support a role for OX neurons in
mediating sucrose preference, and suggests that disruption of the NtsLepRb  OX circuit
prevents ghrelin-mediated liking of palatable foods.

3.4.7

Loss of Action via NtsLepRb Neurons Disrupts Adaptive “Wanting” of Palatable
Food
Mesolimbic dopamine signaling can modify how much foods are “wanted” and thereby

modify food intake. Since NtsLepRb neurons and their OX projection targets both engage the

85

mesolimbic dopamine system 200;297, we investigated whether loss of action via these circuits
impaired food wanting. We therefore assessed control and LRKO mice for their willingness to
work for sucrose pellets in a progressive ratio (PR) operant task, in which the breakpoint
indicates the animal’s relative level of reward “wanting”. At baseline, the breakpoint of control
and LRKO animals is similar, indicating that they similarly want, and will work for palatable food
(Figure 3-6 A: control = 44.55 ± 8.08 vs. LRKO = 33.00 ± 3.34, p =0.157). Leptin however,
decreases operant responding for rewards 309, which might be mediated, in part, via NtsLepRb
neurons. To examine this hypothesis, we treated control and LRKO mice with vehicle and leptin
during PR testing. As expected, control mice decrease their PR breakpoint in response to
leptin, indicating suppressed sucrose wanting, but LRKO mice do not (Figure 3-6 B: control = 10.18 ± 4.15 vs. LRKO = 0.40 ± 1.67, p =0.015).

Ghrelin treatment increases PR breakpoint in

control mice, consistent with previous reports 294, but this increased wanting is blunted in
ghrelin-treated LRKO mice (Figure 3-6 C: control = 26.67 ± 8.91 vs. LRKO = 7.60 ± 2.59, p
=0.020). Together these data indicate that loss of action via the NtsLepRb neuronal circuit
impairs leptin and ghrelin from modifying the incentive salience of palatable foods, and thus
prevents appropriate hormone-coordinated feeding.

3.4.8

Expression of LHA Signaling Peptides is Altered After Disruption of the NtsLepRb
Circuit
Our previous and current data confirm that loss of action via NtsLepRb neurons prevents

LHA neurons from being appropriately activated by leptin or ghrelin. Loss of neuronal activation
could therefore impair adaptive response via preventing release of LHA signaling peptides that
regulate postsynaptic target neurons, such as OX and mesolimbic dopamine neurons. To
investigate this possibility, we isolated RNA from the LHA of control and LRKO mice, and
assessed expression of neuropeptides and hormone receptors that are specifically expressed in
86

NtsLepRb neurons and OX neurons. Indeed, the loss of NtsLepRb neuronal action in LRKO mice
coincides with diminished expression of Nts (Figure 3-7 A: control = 1.05 ± 0.13-fold, n=8 vs.
LRKO = 0.62 ± 0.07, n=7, p =0.012), suggesting that NtsLepRb neurons are no longer making
sufficient Nts to mediate downstream signaling. Intriguingly, although at least some NtsLepRb
neurons also co-express the neuropeptide galanin, LRKO mice retain normal galanin
expression. LepRb expression, however, is upregulated in LRKO mice, which likely reflects a
compensatory effort to enhance leptin action via the population of non-Nts expressing LepRb
neurons (Figure 3-3 B).

Since NtsLepRb neurons project to and inhibit OX neurons, we hypothesized that
expression of energy balance neuropeptides and receptors might be disrupted in OX neurons of
LRKO mice. OX expression remains similar between control and LRKO mice, consistent with
previous findings 200. There is a slight increase, however, in delta-like 1 (Dlk1), which is
expressed in OX neurons and can be released to modify neuronal signaling 310;311. GHSR
expression is also similar in control and LRKO mice, suggesting that the loss of ghrelinresponse in LRKO mice is not due to lacking the ability to bind ghrelin directly, but likely due to
disruption of other signaling mechanisms.

NtsLepRb neurons also project to the VTA, where released Nts activates neurotensin
receptor-1 (NtsR1) expressing dopamine neurons and induces dopamine release into the NAc
194;200

. Despite the loss of action via NtsLepRb neurons in LRKO mice, however, they do not

exhibit any differences in VTA expression of tyrosine hydroxylase (TH- the rate limiting marker
of dopamine synthesis), the dopamine active transporter (DAT) or NtsR1. These data suggest
that loss of action via NtsLepRb neurons does not impair the functionality of VTA dopamine

87

neurons and their ability to respond to Nts, per se. Instead, it is possible that the loss of leptin
and ghrelin mediated activation of LHA neurons results in diminished activation of VTA
dopamine neurons, and therefore reduces dopamine release to the NAc that regulates
motivated behaviors.

3.4.9

Loss of Action via the NtsLepRb Circuit Disrupts the Mesolimbic Dopamine System
LRKO mice exhibit blunted motivated feeding and locomotor responses to leptin and

ghrelin, thus we reasoned that these mice have diminished activation of the mesolimbic
dopamine system. This could be solely due to diminished activation of the NtsLepRb and OX
neurons (Figures 3-2, 3-3) that project to the VTA to activate dopamine neurons and promote
dopamine release into the NAc. Another possibility is that the developmental deletion of LepRb
in LRKO mice causes them to develop fewer neuronal projections to the VTA with which to
modify dopamine signaling. To investigate this possibility, we visualized the projections of LHA
Nts neurons by injecting NtsCre and LRKO mice in the LHA with Ad-Syn-mCherry, which causes
cre-dependent expression of the synaptophysin-mCherry fusion protein in Nts-expressing
neurons. Importantly, Syn-mCherry is expressed within cell bodies and also localizes to axon
terminals, thereby enabling detection of projections throughout the brain 191. Injection of AdSyn-mCherry identifies similar numbers of cell bodies and projections within the LHA of control
and LRKO mice (Figure 3-8 A, D) suggesting that there is no developmental defect in the
number of Nts neurons or their local projections to OX neurons. By contrast, we observed that
LRKO animals had fewer projections to the VTA than control mice (Figure 3-8 B,C,E,F). These
data indicate that deletion of LepRb from NtsLepRb neurons diminishes the development of
projections to the VTA, and thus presumably reduces the activation of VTA dopamine neurons
and dopamine release to the NAc. If this were true, we anticipated that leptin and ghrelinmediated activation of the NAc would be decreased in LRKO mice compared to controls. To
88

investigate this, we examined cFos in the NAc shell (NAcSh) and Core (NAcC), where
dopamine release modifies motivated feeding and locomotion. As a first step, we treated
control and LRKO mice with amphetamine, which promotes DA release and induces cFos, to
verify that LRKO mice can exhibit dopamine-mediated activation of the NAc. Indeed,
amphetamine increases cFos in both control and LRKO mice, though it is reduced in the latter
(Figure 3-8 G,K). These data are consistent with the reduced amphetamine-mediated
locomotor activity of LRKO mice compared to controls, suggesting that they have reduced
capacity to adapt to signals that should increase mesolimbic dopamine signaling 200. Next, we
queried the activation of the mesolimbic dopamine system in response to vehicle, leptin or
ghrelin, to determine whether the blunted adaptive response to hormones corresponds with
diminished NAc activation. Control and LRKO mice have similarly low levels of striatal cFos
after vehicle treatment (Figure 3-8 H,L). Leptin treatment modestly increases cFos within the
NAcC of control mice, but this response is absent in LRKO mice (Figure 3-8 I,M). Ghrelin
treatment robustly increases cFos in the NAcC and NAcSh of control mice, but there is
essentially no increase of cFos in ghrelin-treated LRKO mice (Figure 3-8 J,N). In sum, these
data confirm that loss of action via the NtsLepRb circuit disrupts leptin and ghrelin-mediated
activation of mesolimbic dopamine signaling, and thus can blunt the adaptive motivated
behaviors regulated by these hormones.

3.5 Discussion
Here we define neural mechanisms by which the LHA coordinates leptin and ghrelinmediated adaptations in energy balance. Leptin specifically activates a subset of LHA Nts
neurons that co-express LepRb, the NtsLepRb neurons, to mediate weight loss behaviors. By
contrast, ghrelin acts upon OX neurons to promote feeding. Since NtsLepRb neurons project to

89

and inhibit OX neurons they can indirectly modify ghrelin-mediated regulation of OX neurons.
Loss of action via NtsLepRb neurons thus disrupts leptin and ghrelin-mediated adaptive
responses, dis-coordinating appropriate ingestive and locomotor behavior that leads to weight
gain. Collectively, these data reveal an important role for NtsLepRb neurons in mediating adaptive
energy balance and normal body weight.

Our findings establish Nts neurons as a major neuronal population within the LHA that
are vital for mediating energy balance. Previous physiological study of LHA Nts neurons was
impeded by the inability to immunohistochemically detect them, as this required functionimpairing colchicine treatment. Similar limitations deterred understanding of LHA populations
containing galanin (Gal), GABA or glutamate, but the recent development of cre-inducible
mouse models enabled determination of their roles in energy balance 286;290;312. We thus used a
knock-in cre-inducible mouse model to identify Nts neurons within the LHA, and find that Nts
neurons are co-distributed amongst, but distinct from, OX and MCH neurons. Our findings
differ from a report that all OX neurons contain Nts 203, which was determined with a commercial
antibody that is no longer available. However, our data agree with reports that Nts is required
for leptin-mediated inhibition of OX neurons, suggesting that Nts is released from LepRb
neurons and is not in fact co-expressed within OX neurons 295. Furthermore, since Nts is an
anorectic neuropeptide 222;313, it is unlikely that it would be co-expressed within orexigenic OX
neurons. Indeed, Nts in the LHA has been linked to suppressing feeding in response to
dehydration, inflammation and leptin 150;200;229. Intriguingly, only 15% of LHA Nts neurons coexpress LepRb and are activated by leptin (NtsLepRb neurons). Thus, there are at least two
subpopulations of LHA Nts neurons: the leptin-responsive NtsLepRb neurons and other nonLepRb expressing Nts neurons with yet-to-be determined physiological roles. LHA Nts
subpopulations may differ in neuropeptide or classical neurotransmitter content 194;201;202, though
90

at least the NtsLepRb neurons are GABAergic 200. Going forward it will be important to distinguish
LHA Nts populations at the molecular and functional levels to determine their contributions to
energy balance.

Our data demonstrate that leptin and ghrelin engage separate, but interconnected LHA
circuits to exert adaptive energy balance (Figure 3-9). Leptin directly activates NtsLepRb neurons,
but not OX neurons since they lack LepRb 255. Leptin regulates OX neurons indirectly,
however, since NtsLepRb neurons synapse upon and inhibit OX neurons 298. NtsLepRb neurons also
project to the VTA, where Nts activates dopamine neurons to induce dopamine release into the
NAc 194;200. Therefore, leptin-regulated NtsLepRb neurons modify energy balance through two
separate neuronal circuits: 1) via inhibiting orexigenic OX neurons and 2) via Nts-mediated
activation of mesolimbic dopamine neurons. While the specific contributions of these pathways
have yet to be understood, leptin action via these NtsLepRb projections is required to limit feeding,
promote physical activity, and hence maintain normal body weight. By contrast, ghrelin
increases the proportion of activated OX neurons, but does not activate Nts neurons or LepRb
neurons [this manuscript] 293;295. Collectively, these data suggest that anorectic leptin directly
activates LepRb-expressing neurons, while ghrelin can activate GHSR-expressing OX neurons,
in agreement with electrophysiological studies 288;295. It remains unclear, however, whether all
OX neurons express GHSR and can be directly activated by ghrelin. Indeed, we observed that
ghrelin increases activation of some, but not all OX neurons, suggesting that there may be at
least some non-GHSR expressing OX neurons with unique functions. OX neurons can be
distinguished into glucose-excited and glucose-inhibited populations, and this latter population is
more likely to be activated during energy depletion, when circulating ghrelin is high 314. Our
current work also does not exclude the possibility that ghrelin may also activate GHSRexpressing neurons outside of the LHA that project to and activate OX neurons. In any case,
91

ghrelin can either directly or indirectly promote activation of OX neurons, but does not activate
the separate NtsLepRb neurons. In the future it will be important to define the precise
subpopulations of LepRb and OX neurons regulated by leptin and ghrelin, to fully understand
how they dynamically modify adaptive energy balance.

NtsLepRb neurons are required for normal energy balance, and loss of action via NtsLepRb
neurons in LRKO mice results in hypo-locomotion and increased body weight. Intriguingly,
LRKO mice exhibit diminished physical activity but do not commensurately reduce food intake,
thereby promoting weight gain. Reduced movement may result from disruption of the NtsLepRb
 OX and/or NtsLepRb  VTA circuits, since both OX and dopamine signaling promote locomotor
activity 305;315. Indeed, leptin modifies dopamine -mediated running reward 301 and Nts activates
VTA dopamine neurons to promote locomotor activity 244. Since NtsLepRb neurons directly
engage the mesolimbic dopamine system, the NtsLepRb  VTA circuit may signal via Nts to
couple excess energy status with the motivation to engage in volitional exercise, thereby
potentiating energy expenditure and weight loss. Restoring action via the NtsLepRb  VTA circuit
could promote the motivation to engage in physical activity and support weight loss.

To date there have been two populations of LepRb-expressing neurons reported in the
LHA: those expressing Nts (NtsLepRb neurons) or Gal (GalLepRb neurons.) While many LHA Gal
neurons co-express LepRb 290, and at least some Gal neurons co-express Nts 201, it remained
unclear whether NtsLepRb and GalLepRb neurons were in fact overlapping populations. The
phenotype of mice lacking LepRb in GalLepRb neurons (termed GRKO mice), however, contrasts
from that of LRKO mice, suggesting that NtsLepRb and GalLepRb neurons are distinct populations
200;290

. First, LRKO mice exhibit reduced spontaneous and volitional physical activity, but

92

locomotor activity is normal in GRKO mice. Second, loss of leptin action via NtsLepRb neurons
does not alter baseline sucrose preference, but GRKO mice have increased preference for
palatable sucrose. Third, Gal expression is normal in the LHA of LRKO mice, but reduced in
GRKO mice, suggesting that the LRKO and GRKO phenotypes result from different
neurochemistry. Fourth, NtsLepRb neurons directly project to the VTA, but GalLepRb neurons do not.
Collectively, these findings suggest that NtsLepRb and GalLepRb neurons are distinct neuronal
populations, and mediate different aspects of adaptive energy balance. NtsLepRb and GalLepRb
and neurons are similar, however, in that they both project to and inhibit OX neurons 200;290. It
remains possible that they regulate distinct subpopulations of OX neurons, and thus
differentially modify locomotor activity and nutrient drive.

LRKO mice do not adapt their responding for sucrose rewards in response to leptin and
ghrelin, likely due to reduced engagement of the mesolimbic dopamine system that governs the
incentive salience of rewards. NtsLepRb neurons project to the VTA directly and inhibit OX
neurons that modify motivational drive via the VTA. Loss of action via NtsLepRb neurons may
therefore blunt appropriate responses to leptin, such as increases in leptin during obesity, and
fail to suppress the motivation for palatable foods, thereby exacerbating intake and weight gain.
Interestingly, ghrelin-mediated sucrose preference and operant responding for sucrose is
blunted in LRKO mice, suggesting that loss of action via NtsLepRb neurons disrupts both the
ghrelin-mediated liking and wanting of sucrose. Our data suggest two mechanistic disruptions of
the mesolimbic dopamine system in LRKO mice that may underlie altered food motivation. First,
there is a reduction in NtsLepRb projections to the VTA, resulting in diminished activation of the
mesolimbic dopamine “wanting” system in response to leptin. Second, the loss of NtsLepRb
neuronal regulation of OX neurons causes them to be less responsive to ghrelin treatment, such
that OX  VTA neurons may not be activated and induce mesolimbic dopamine release. We
93

acknowledge that the LRKO mice used in this study have developmental deletion of LepRb from
NtsLepRb neurons, and so do not necessarily reflect the requirement for LepRb in the adult LHA.
Our data do, however, reveal a crucial role for LepRb in proper formation of LHA circuits and
activation of the mesolimbic dopamine system, and suggest that intact signaling via these
circuits is important for regulation of body weight. Indeed, while the central and systemic
hormone treatments in this study engaged many intact LepRb and GHSR-expressing neurons
throughout the brain, the loss of action from just the NtsLepRb neurons confined to the LHA was
sufficient to disrupt motivated responding and energy balance. These data confirm that NtsLepRb
neurons are significant contributors to hormone-mediated adaptive energy balance.

Collectively these data identify NtsLepRb neurons as important controllers of OX neurons,
the mesolimbic DA system and adaptive energy balance. Loss of action via NtsLepRb neurons
promotes overweight by preventing leptin-mediated weight loss behaviors. Simultaneously, loss
of action via NtsLepRb neurons also impairs the ability to appropriately respond to energy
deprivation signals such as ghrelin, leading to a loss of recognition of when to eat, and when not
to eat. Loss of action via NtsLepRb neurons therefore deranges adaptive energy balance, and
leads to inappropriate locomotor and ingestive behaviors that promote weight gain. In the
future, determining the precise mechanisms by which NtsLepRb neurons regulate OX and
mesolimbic dopamine target neurons may reveal pharmacological approaches to restore
appropriate regulation of adaptive energy balance.

94

3.6 Figures
Figure 3-1: Distribution of Neuropeptide-Defined and LepRb Neuron in the LHA

A) The distribution of LHA neurons was determined via immunofluorescent labeling of melanin
concentrating hormone neurons (MCH, blue), orexin neurons (OX, red) and neurotensin neurons
(Nts-EGFP, green) in the brains of NtsEGFP mice (n = 4). The dashed-box area is enlarged in the
panels below, showing the individual staining for each neuronal population and the merged image.
Abbreviations: mt = mammillothalamic tract; f = fornix; DMH = dorsomedial hypothalamus; VMH =
ventromedial hypothalamus; ARC = arcuate nucleus. B) Quantitation of the average number of
MCH, OX and Nts neurons in the LHA ± SEM, n=4. C) NtsEGFP mice were treated with leptin
(5mg/kg, IP, 2 hr) and brains were analyzed via immunohistochemistry and immunofluorescence to
identify Nts-EGFP neurons (green) and phosphorylated STAT3 (pSTAT3), a marker for LepRb
activation (blue). Filled arrows identify Nts-EGFP neurons that co-localize with pSTAT3 and are
NtsLepRb neurons. Unfilled arrows identify LepRb neurons that do not express Nts. D) Schematic
depicting the relative size and distribution of the MCH, OX, Nts, NtsLepRb and LepRb neuronal
populations in the LHA.
95

Figure 3-2: Nts and OX neurons Respond to Distinct Hormonal Cues

A) Male NtsEGFP mice were treated with vehicle or leptin (5 mg/kg, IP, 2 hr) and brains were
immunostained for Nts-EGFP (green), OX (red) and pSTAT3, a marker of leptin-activated LepRb
neurons (blue). In the top panels, the filled arrows identify pSTAT3-labeled nuclei within Nts-EGFP
neurons, which are leptin-activated NtsLepRb neurons. In the bottom panels, the unfilled arrows
identify the same pSTAT3-labeled nuclei, none of which are found within OX neurons. B)
Quantification of the percentage of Nts and OX neurons that contain pSTAT3 (e.g. are activated by
leptin) in response to vehicle or leptin treatment (vehicle n=4, leptin n=5). C) Male NtsEGFP mice
were treated with ghrelin (100 μg/treatment, IP, 4 hr) and brains were immunostained for Nts-EGFP
(green), OX (red) and cFos, a marker of neuronal depolarization (blue). In the top panels, the
unfilled arrows identify cFos-labeled nuclei that are not found within Nts neurons. In the bottom
panels, the filled arrows identify the same cFos-labeled nuclei from the top panels, which are found
within OX neurons. D) Quantification of the percentage of Nts and OX neurons that contain cFos
(e.g. are activated by ghrelin) in response to vehicle or ghrelin treatment (vehicle n=4, leptin n=4).
Graphed data represent average values ± SEM. Statistical differences were determined via oneway ANOVA, ** P ≤ 0.01, *** P ≤ 0.001, **** P ≤ 0.0001.

96

Figure 3-3: Loss of Leptin Action via NtsLepRb Neurons Blunts the Ghrelin-Mediated
Activation of OX Neurons

A) Generation of LRKO mice, which lack functional LepRb only in Nts neurons. B) Backcrossed
Control (Nts++;Leprflfl) and LRKO (NtsCre+;Leprflfl) mice were treated with vehicle or leptin (5 mg/kg,
IP, 2 hr) and brains were immunostained for pSTAT3 to identify leptin-activated LepRb neurons.
LRKO mice have fewer pSTAT3-positive neurons in the LHA compared to controls, confirming loss
of functional LepRb from LHA NtsLepRb neurons. C) Male control and LRKO mice were treated with
saline or ghrelin (3 µg, ICV, 4 hr) and brains were analyzed via immunohistochemistry and
immunofluorescence for OX (red) and cFos (green). Arrows identify OX neurons that contain cFoslabeled nuclei (e.g. OX:cFos cells), which are activated OX neurons. D) Quantitation of the
percentage of OX neurons that contain cFos (OX:cFos) in treated control and LRKO mice. (Control
+ saline, n=6; control + ghrelin, n=6; LRKO + vehicle, n=3; LRKO + ghrelin, n=3). E) Quantitation
of the total number of LHA OX neurons from three representative LHA sections of control mice (n =
12) and LRKO mice (n = 6). Graphed data represent average values ± SEM, * p ≤ 0.05 by ANOVA.
97

Figure 3-4: Loss of Leptin Signaling via NtsLepRb Neurons Disrupts Energy Balance

A-E) Energy balance was assessed in spontaneously moving adult (8-12 wk) male control (n = 13)
and LRKO mice (n=14). A) Body weight and B) the percentage of body fat was increased in LRKO
mice compared to controls, but C) chow intake and D) respiratory quotient are not significantly
different. E) Spontaneous locomotor activity is decreased in LRKO animals relative to controls, and
F) there is a trend for decreased spontaneous VO2. When offered a running wheel, control mice
exhibit increased G) wheel running time and H) VO2 compared to LRKO mice (n = 10-12 per
genotype). Graphed data represents average value ± SEM, *p<0.05, **p<0.01 by Student’s t test.

98

Figure 3-5: Loss of Action via NtsLepRb Neurons Disrupts Adaptive Reward Preference

A) Total liquid intake and B) sucrose preference were similar in control and LRKO mice at baseline
(control n=20, LRKO n=18). C) Control mice adaptively decrease chow intake in response to leptin
but LRKO mice do not. D) There is no significant difference in leptin-mediated adaptive sucrose
preference between control and LRKO mice (control n=14, LRKO n=11). E) Control and LRKO
mice adaptively increase chow intake in response to ghrelin treatment (control n=11, LRKO n=11).
F) Ghrelin treatment adaptively increases sucrose preference in control mice, but not in LRKO mice
(control n=10, LRKO n=11). Graphed data represents average value ± SEM. *p<0.05, by Student’s t
test.

99

Figure 3-6: Loss of Action via NtsLepRb Neurons Disrupts Adaptive Reward Wanting

Adult male control and LRKO mice were tested via a progressive ratio (PR) paradigm for their
willingness to work for sucrose rewards (9 – 37 wk old, control n=11, LRKO n=15). The PR
breakpoint represents how much the sucrose reward is wanted. A) Control and LRKO mice have
similar baseline PR breakpoints at baseline. B) Leptin treatment adaptively decreases the PR
breakpoint in control mice, but not in LRKO mice that are unable to respond to leptin via NtsLepRb
neurons. C) Ghrelin treatment adaptively increases the PR breakpoint in control mice, but not in
LRKO mice. Graphed data represents average value ± SEM, *p<0.05 by Student’s t test.

100

Figure 3-7: Loss of Action via NtsLepRb Neurons Disrupts LHA Gene Expression

Gene expression was assessed in the brains of adult male (13 -19 wk) control and LRKO mice (n =
7-8 per genotype). A-C) Gene expression in the LHA for transcripts that are specific to LepRb
neurons, including A) Nts, B) galanin and C) LepR. D-F) Gene expression in the LHA for transcripts
that are specific to OX neurons, including D) OX, E) Dlk1 and F) GHSR. G-I) VTA gene expression
of transcripts found in mesolimbic dopamine neurons, including G) TH, H) DAT and I) NtsR1.
Graphed data represents average value ± SEM. *p<0.05 by Student’s t test.

101

Figure 3-8: Projections of LHA Nts Neurons and Activation of Mesolimbic DA Signaling

A-F) Immunofluorescent detection of synaptophysin-mCherry in adult (21-31 wk) male NtsCre mice
(Control, n = 3) and LRKO mice (n = 4) mice following intra-LHA injection of the cre-inducible
anterograde tract tracer, Ad-Syn-mCherry. A) Representative image of the LHA from a control
mouse, showing Nts cell bodies and local projections within the LHA and B) projections to the VTA.
C) Enlargement of the boxed area from panel B. D) Representative image of the Nts-containing cell
bodies and location projections from a LRKO mouse, and E) projections to the VTA. F)
Enlargement of the boxed area from panel E. Insets in A and D identify the injection site into the
LHA. G-N) Immunohistochemical detection of cFos in the nucleus accumbens core (NAcC) and
shell (NAcSh) of adult male control and LRKO mice following treatment with G, K) amphetamine
(control n = 5, LRKO n = 5), H, L), vehicle (control n = 7, LRKO n = 6), I, M) leptin (control n = 5,
LRKO n = 6) and J, N) ghrelin (control n = 4, LRKO n = 5). Mice were male, 17-23 wk of age.
102

Figure 3-9: Model Leptin-Mediated LHA Nts Neuronal Contribution to Energy Balance

LHA NtsLepRb neurons act as “command neurons” and regulate hormone-mediated adaptive
feeding and activity both directly and by modulation of ghrelin-sensitive OX neurons.

103

CHAPTER 4

Lateral Hypothalamic Area Neurotensin Neurons

are Required for Control of Energy Balance
Authors: Juliette Brown, Andrew Sagante, Tom Mayer, Anna Wright, Raluca Bugescu, Patrick M.
Fuller and Gina Leinninger
This chapter is an adaptation of a manuscript in preparation for submission Abstract

4.1 Abstract
The lateral hypothalamic area (LHA) is essential for motivated ingestive and locomotor
behaviors that impact body weight. Yet, despite the clear necessity of the LHA as a whole, it
remains unclear how the neurochemically-defined subpopulations of LHA neurons contribute to
energy balance. In particular, the role of the large population of LHA neurotensin (Nts) neurons has
remained ambiguous due to the lack of methods to easily visualize and modulate these neurons.
Since some LHA Nts neurons are activated by leptin and other anorectic cues, and they modulate
dopamine or local LHA Orexin neurons implicated in energy balance, we reasoned that LHA Nts
neurons are necessary for control of motivated behaviors and body weight. To test this hypothesis,
we used a genetic lesion technique to selectively ablate LHA Nts neurons in adult mice. Loss of
LHA Nts neurons resulted in profoundly increased adiposity compared to mice with intact LHA Nts
neurons, as well as diminished locomotor activity, energy expenditure and water intake. Loss of
LHA Nts neurons also led to downregulation of Orexin, revealing important cross-talk between the
LHA Nts and Orexin populations in maintenance of behavior and body weight. Chronic
chemogenetic inhibition of LHA Nts neurons did not disrupt Orexin expression, but it suppressed
locomotor activity and the adaptive response to leptin. Taken together, these data reveal
independent and OX-dependent actions of LHA Nts neurons, and reveal their necessity in
controlling energy balance.

104

4.2 Introduction
Obesity affects millions of individuals worldwide, predisposing them to chronic conditions and
increased mortality 86. Yet, there are few efficacious interventions for the disease and diet and
exercise remain the most prescribed treatment. While such lifestyle changes can induce weight
loss, they are difficult to maintain and are thwarted by bodily adaptations that oppose sustained
weight loss 316-319. Understanding how the brain regulates feeding and locomotor behaviors that
impact body weight may suggest strategies to support weight loss and maintenance of healthy body
weight.

Experimental brain lesions have been pivotal for determining how specific brain regions
regulate physiology, and this method exposed the essential role of the lateral hypothalamic area
(LHA) in control of body weight. Lesion of the entire LHA causes adipsia, aphagia and impaired
motivation to move that leads to profound weight loss and death 30;31. Global LHA lesion, however,
disrupts all of the neurochemically and projection-specified populations of LHA neurons, obscuring
determination of which specific neurons mediate facets of energy balance. For example, LHA
neurons defined by their expression of the neuropeptide melanin concentrating hormone (MCH) are
activated by glucose and facilitate feeding, but suppress locomotor activity and arousal 86;88;320.
Separate neurons expressing the neuropeptide Orexin/Hypocretin (OX) are activated by signals of
energy deficit and promote arousal along with feeding, drinking, and locomotor activity 288;321. LHA
neurons are also defined by their expression of either GABA or glutamate; while GABA neurons
promote voracious ingestive behavior in part via projections to the mesolimbic dopamine (DA)
system, glutamate neurons suppress motivated intake via projections to the lateral habenula 264-266.
These LHA populations, however, do not explain the entirety of LHA actions, particularly how the
LHA intercepts anorectic cues such as leptin or dehydration and coordinates appropriate ingestive
behavior.

105

The LHA also contains a large population of neurotensin (Nts)-expressing neurons that are
distinct from, and more numerous than OX and MCH neurons 269, yet, their requirement for energy
balance was unknown. Unlike MCH and OX neurons, LHA Nts neurons specifically respond to
feeding suppressing cues such as dehydration and the adipose derived hormone, leptin 200;229;269.
Indeed, a subset of LHA Nts neurons co-express the long form of the leptin receptor (LepRb), and
developmental deletion of LepRb from these cells causes weight gain 200 . Activation of the entire
population of LHA Nts neurons suppresses feeding and promotes voracious drinking and locomotor
activity, indicating that LHA Nts neurons can differentially modify ingestive behavior compared to
activation of neighboring MCH and OX neurons. Projection mapping from LHA Nts neurons
suggests two circuit mechanisms by which they might modulate behavior and energy balance. At
least some LHA Nts neurons project to the VTA where they modify DA release to the nucleus
accumbens, where DA modulates motivated ingestive and locomotor behavior 194. Alternately, LHA
Nts neurons project to and inhibit OX neurons, which impedes OX-mediated regulation of feeding,
including in response to the orexigenic hormone ghrelin 200. Taken together, these data suggest that
LHA Nts neurons may coordinate unique facets of energy balance, but it remained unclear whether
they are necessary for maintaining normal body weight. We therefore used genetic lesion and
chemogenetic inhibition to explore the specific requirement for LHA Nts neurons in control of
behavior and body weight.

4.3 Materials and Methods
4.3.1

Reagents
CNO was obtained from the NIH as part of the Rapid Access to Investigative Drug Program

funded by the NINDS. Aliquots of 40x CNO stock solution were made by diluting with PBS/10%
beta-cyclodextrin (Sigma) and stored at -20˚C until use. CNO stock solution was diluted to 1X with

106

PBS (VEH) just prior to use. Recombinant leptin was purchased from the National Hormone and
Peptide Program (Torrance, CA).

4.3.2 Animals
All procedures were approved by the Michigan State University and the University of
Michigan Institutional Animal Care and Use Committees, in accordance with Association for
Assessment and Accreditation of Laboratory Animal Care and National Institute of Health guidelines.
Mice were bred in house, maintained on a 12h light/dark cycle with ad libitum access to food and
water, unless otherwise noted in experimental methods. Male mice were used in all metabolic and
chronic studies, and both males and females were used for acute leptin refeeding studies.

4.3.3 Mice
Ntscre mice (Jackson stock #017525) were crossed with homozygous Rosa26EGFP-L10a mice
(Krashes 2014) and progeny heterozygous for both alleles were used for study (Ntscre;GFP mice).
Heterozygous Ntscre mice were also used for separate experiments. Genotyping was performed
using standard PCR using the following primer sequences: Ntscre: common forward: 5' ATA GGC
TGC TGA ACC AGG AA, Cre reverse: 5' CCA AAA GAC GGC AAT ATG GT and WT reverse: 5’
CAA TCA CAA TCA CAG GTC AAG AA. Rosa26EGFP-L10: mutant forward: 5’ TCT ACA AAT GTG
GTA GAT CCA GGC, WT forward: 5’ GAG GGG AGT GTT GCA ATA CC and common reverse: 5’
CAG ATG ACT ACC TAT CCT CCC.

4.3.4

Generation and Phenotyping of LHA Nts-Ablated Mice
8-10 wk old NtsCre;GFP males received bilateral LHA stereotaxic injections of AAVs as

described previously 269 using coordinates to target the LHA (A/P: 1.34, M/L, 1.13 and D/V, 5.20 in
107

accordance with the mouse brain atlas of Paxinos and Franklin

271

. One cohort of mice received

500 nL of AAV-DTA (lox-mCherry-loxDTA-WPRE-AAV, serotype 10), which induces Cre-dependent
expression of cytotoxic Subunit A of Diphtheria Toxin in the presence that leads to cell death; we
refer to these as LHA Nts-ablated mice. A separate group of mice received 500 nL of AAV-GFP
(rAAV2/hSyn-DIO-eGFP, University of North Carolina Vector Core), which induces Cre-dependent
GFP expression and leaves LHA Nts neurons intact; these are Controls. Mice were single-housed
and assessed weekly for food intake and body weight. At 16 wk-post surgery, mice were analyzed
for body composition using an NMR-based instrument (Minispec mq7.5, Bruker Optics). Mice were
then acclimated for 24 hr within TSE cages (PhenoMaster, TSE Systems), followed by 4 days of
continuously measurement of food and water intake, locomotor activity, and energy expenditure.
Ambient temperature was maintained at 20-23˚C and the airflow rate through the chambers was
adjusted to maintain an oxygen differential around 0.3% at resting conditions. Metabolic parameters
including VO2, respiratory exchange ratio, and energy expenditure were assessed via indirect
calorimetry by comparing O2 and CO2 concentrations relative to a reference cage. After metabolic
analysis the mice were assessed for 1% sucrose preference as described previously 269. Preference
was assessed by determining the % of total volume drunk that was sucrose solution. Mice were
included in the final data-set if post-hoc analysis confirmed that injections were localized to, and
contained within the LHA. Additionally, AAV-DTA injected mice were only included if they had
visible loss of Nts-GFP neurons within the LHA but not in adjacent regions, as assessed via
immunofluorescent detection of Nts-GFP. After post-hoc examination, 4/13 Nts-ablated and 3/8
control mice were excluded from analysis due to unilateral targeting and/or spread of the injection
site outside of the LHA; thus, final bilateral groups consisted of LHA Nts-ablated n=9 and control
n=5. For qualitative assessment of LHA cell types, a separate cohort of NtsCre;GFP mice received
unilateral LHA injections of AAV-DTA and were perfused either 2 or 10 wk later (6 and 6 mice,
respectively). After post-hoc analysis and exclusion of mis-targeted animals, there were 4 welltargeted and ablated 2 wk mice and 4, 10 wk mice.

108

4.3.5 Gene Expression of LHA Nts-Ablated Mice
NtsCre mice received unilateral LHA injections of AAV-DTA. Mice were euthanized 2 or 10 wk
post-surgery to recover the un-injected (control) and AAV-DTA injected (LHA Nts-ablated) sides of
the LHA (2-week n=6, 10-week n=8). Tissue samples were immediately snap frozen on dry ice and
stored at -80˚C for later processing. RNA was extracted using Trizol (Invitrogen) and 200 ng
samples were converted to cDNA using the Superscript First Strand Synthesis System for RT-PCR
(Invitrogen). Sample cDNAs were analyzed in triplicate via quantitative RT-PCR for gene
expression using TaqMan reagents and an ABI 7500 (Applied Biosystems, Foster City, CA). Using
GAPDH expression as an internal control, the relative mRNA expression values were calculated by
the 2-∆∆Ct method and the AAV-DTA injected values were normalized to the un-injected values. To
verify AAV-DTA mediated ablation, the fold change in Nts was compared between the ablated and
intact sides of the LHA. Mice were only included in final analysis if the ablated side fold change in
Nts expression was greater than one standard deviation from the mean fold change of the control
side.

By this method, 4 mice were excluded from analysis (Final 2-week n=4, 10-week n=6).

4.3.6

Chemogenetic Inhibition of LHA Nts Neurons
Mice were injected bilaterally with 500 μL of AAV-hM4D-mCherry (UNC vector core) into the

LHA and began analysis 3 wk later. Mice received twice-daily i.p. injections (8-9AM and 6-7PM) of
VEH for two days to acclimatize them to treatment. Mice were then separated into two groups that
received twice-daily treatments for 28 days: one group received VEH (controls) and the other
received CNO (to inhibit LHA Nts neurons). Mice were analyzed within TSE cages during the first 5
days and then again for the final 6 days of treatment. In the interim, mice were housed in home
cages and daily food intake and body weight were assessed via hand-measuring. Mice were only
included in the final study if post hoc analysis confirmed that mCherry expression was localized to,

109

and confined within the LHA on both sides of the brain. Of 14 mice injected, 2 VEH-treated and 2
CNO-treated were exclude as misses (Chronic VEH-treated n = 7, Chronic CNO-treated n = 7).

4.3.7

Fasting-Induced Re-feeding
Chow was removed from home cages at 6PM and mice were given a clean cage bottom to

prevent intake of food that may have fallen into the bedding. Mice had ad lib access to water during
food-deprivation. The following morning between 8AM-9AM, fasted mice were treated with i.p. VEH
or CNO to inhibit LHA Nts neurons. Then, 30 minutes later mice were treated with PBS or leptin (5
mg/kg, i.p.). Chow was returned 30 min after PBS/leptin treatment, and food intake and body weight
were measured 1, 3, 9 and 24 hr after return of food. The study was performed using a cross-over
design, such that each mouse received every treatment (VEH/PBS, VEH/Leptin, CNO/PBS and
CNO/Leptin) and could serve as its own control. Mice were given at least 2 full days of recovery
from fasting between each trial to ensure complete weight regain.

4.3.8 Imaging and Quantification of Neuronal Populations
Immunofluorescence was performed as in 269. Primary antibodies used included chicken
anti-GFP (Abcam, 1:1000), goat-anti Orexin (Santa Cruz, 1:1000), goat-anti MCH (Phoenix
Peptides, 1:1000), DLK1 (Santa Cruz, 1:500). Species-specific secondary antibodies were used for
detection at 1:200 (Jackson ImmunoResearch or Thermo Fisher-Invitrogen) using either Alexa
Fluor-488 or 586-conjugated fluorophores. Brain sections were analyzed using an Olympus BX53
fluorescence microscope outfitted with FITC and Texas Red filters. Microscope images were
collected using Cell Sens software and a Qi-Click 12 Bit cooled camera, and images were analyzed
using Photoshop software (Adobe). For quantification of LHA neurons, two representative sections
were selected from each animal and counts were performed in an area defined as ventral and lateral

110

to the mt, and dorsal to the fornix. Since each brain is sectioned into four equally representative
series of sections, the total number of each neurons is multiplied by four for final analysis.

4.3.9 Statistics
Students t-test (to compare two groups) or one-way ANOVA with Bonferroni post-testing (for
comparisons between multiple groups) were used to determine significant differences between
groups, and were calculated using GraphPad Prism (GraphPad Software Inc., San Diego, CA).
Error bars depict ± standard error of the mean (SEM). Differences were considered significant for p
< 0.05. For all data, *p<0.05, **p<0.01 and ***p<0.001.

4.4
4.4.1

Results
Loss of LHA Nts Neurons Causes Obesity
To determine if LHA Nts neurons are required for the control of energy balance, we

genetically lesioned them 177;322 (Figure 4-1-A). Adult NtsCre mice were injected unilaterally in the
LHA with an AAV expressing Cre-dependent Diphtheria Toxin A subunit (AAV-DTA), such that the
DTA expression selectively kills LHA Nts neurons. Adjacent cells remain intact because DTA lacks
the B-subunit necessary to internalize other cells, so it is not transmitted outside of the Nts Creexpressing neurons. We confirmed that AAV-DTA resulted in ablation of Nts neurons by 2 weeks
post-surgery, while adjacent MCH neurons remained intact (Figure. 4-1-B). Next, we generated
cohorts of mice bilaterally injected in the LHA with AAV-DTA (LHA Nts-Ablated mice) or with AAVGFP, which drives Cre-dependent expression of GFP so that Nts neurons remain intact (Control).
By 16 wk post-injection the LHA Nts-ablated mice were visibly larger than the controls (Figure 4-1C,D). Intriguingly, the LHA Nts-ablated mice did not exhibit increased total body weight or ∆ body
weight over the course of study compared to controls, but the LHA Nts-ablated mice have a
111

significantly higher percentage of body fat (Figure 4-1-E-G). These data suggest that LHA Nts
neurons are required to prevent excess adiposity and for maintaining appropriate body weight.

4.4.2

Loss of LHA Nts Neurons Blunts Water Intake and Locomotor Activity
Next, we sought to determine the cause of the obesity in LHA Nts-ablated mice, and whether

it resulted from disrupted ingestive behavior and/or energy expenditure. LHA Nts-ablated mice ate
similar amounts of chow as control mice, thus their obesity is not due to excess caloric intake
(Figure 4-2 A,B). Interestingly, LHA Nts-ablated mice drank less water than controls, suggesting
some disruption of ingestive behavior (Figure 4-2 B). Additionally, the LHA Nts-ablated mice
displayed reduced ambulatory locomotion relative to control mice (Figure 4-2 C) as well as a
decrease in VO2 and a trend for lower VCO2 (Figure 4-2 D,E,F). The respiratory exchange ratio
(RER) was not different between groups suggesting that substrate usage is not changed with loss of
LHA Nts neuronal function (data not shown). Taken together, these data suggest that loss of LHA
Nts neurons diminishes locomotor activity and energy expenditure, which can promote the
development of obesity.

4.4.3

Loss of LHA Nts Neurons Decreases Motivated Activity and Adaptive Energy Balance
One of the main projections of LHA Nts neurons is to the mesolimbic dopamine circuit that

modifies the motivation to ingest and move 191. We therefore reasoned that loss of LHA Nts
neurons, in addition to disrupting homeostatic energy balance, might particularly impair motivated
behaviors that impact body weight. To examine this, we gave control and LHA Nts-ablated mice
access to running wheels within metabolic cages, allowing us to examine their non-obligatory,
motivated locomotor activity (wheel running) and its effects on other metabolic parameters. As
expected, control mice with intact LHA Nts neurons engaged the running wheels, but the LHA Nts-

112

Ablated exhibited vastly reduced running time, wheel rotations and shorter run bouts over 48 hr
(Figure 4-3 A-C). The wheel-running control mice also consumed significantly more chow and water
than LHA Nts-ablated mice (Figure 4-3 D,E). Since both feeding and drinking are elevated in the
control mice during wheel-running as compared to baseline (Figure 4-2 A,B), which likely reflects the
increased and fluid intake necessary to support increased energy demand due to the wheel running.
Similarly, energy expenditure, VO2 and VCO2 was higher in control mice compared to LHA Ntsablated mice, consistent with their increased energy output via wheel running (Figure 4-3 F-H).
RER remained similar between groups, indicating that substrate usage is not altered even with the
higher energy demands of the wheel-running control mice (Figure 4-3 I). These data reveal that
loss of LHA Nts neurons impairs volitional motivated locomotor activity and associated energy
expenditure, while mice with intact LHA Nts neurons choose to engage in exercise-like behavior.
Since sustained exercise along with a healthy diet protects against weight gain 323, via LHA Nts
neurons may be necessary for the motivation to exercise and ability to maintain normal body weight.

4.4.4

Loss of LHA Nts Neurons Disrupts Drinking but Not Sucrose Preference
LHA Nts neurons project to and release Nts into the ventral tegmental area (VTA), a brain

region implicated in modifying the motivation to work for food rewards (e.g. dopamine-dependent
“wanting”) and their hedonic value (e.g. opioid-dependent “liking”) 15;324. While our data suggest that
LHA Nts neurons are required for motivated running behavior, which is known to be DA-dependent
325

, we also examined whether these neurons are required for hedonic intake. We therefore tested

control and LHA Nts-ablated mice via a two-bottle sucrose preference assay, which is well
established to identify hedonic intake 326. Prior to receiving sucrose, LHA Nts-ablated mice
consumed less water than control mice, consistent with our findings from metabolic cages (Figure 4
A). While LHA Nts-ablated and control mice both increased intake of sucrose over water, and
exhibited similar sucrose preference, the LHA Nts-ablated mice consumed less total volume of each

113

liquid compared to controls (Figure 4-4 B-D). Together, these data indicate that LHA Nts neurons
are important mediators of homeostatic drinking behavior, but that they are not required for hedonic
consumption.
4.4.5

Lesion of LHA Nts Neurons Precedes Reduction in Orexin Expression
Some LHA Nts neurons synaptically modulate OX neurons 269;298;304 , thus loss of LHA Nts

neurons might impair OX function over time and indirectly contribute to the behavioral derangements
and obesity of LHA Nts-ablated mice. We therefore investigated the impact of LHA Nts ablation at 2
wk post-injection, when AAV-DTA mediated ablation should be complete, yet control and LHA Ntsablated mice exhibit comparable weight gain at this time point (Figure 4-5 A). We also examined
mice 10 wk-post injection, when LHA Nts-ablated mice show a trend toward increased weight gain
compared to controls (Figure 4-5 A). As a first step, we evaluated NtsCre;GFP mice that were
unilaterally injected with AAV-DTA for Nts-GFP neurons and MCH and OX peptide expression via
immunofluorescence (IF); in these experiments, the contralateral un-injected LHA serves as an
intact control. As observed previously (Figure 4-1 B), AAV-DTA injection depletes LHA Nts-GFP
neurons at 2 wk relative to the control side but the MCH population remained intact (Figure 4-5 B,C).
OX-IF appeared somewhat reduced, but bright, highly-expressing OX neurons were still apparent at
2 wk post-injection (Figure 4-5 B,C). Depletion of LHA Nts-GFP neurons was also evident at 10 wk
post AAV-DTA injection compared to the control side, and MCH-IF was also somewhat reduced at
this time. OX-IF, however, was more obviously diminished, with fewer brightly-labeled OX
expressing cell bodies at 10 wk post-injection compared to the control LHA or 2 wk-ablated mice
(Figure 4-5 D,E). Cell counts confirmed a significant reduction in Nts-GFP neurons in the ablated
LHA compared to the control side at 2 and 10 wk (Figure 4-4 F). The number of IF-detected MCH
and OX neurons was similar in the ablated and control LHA at 2 wk, but was significantly decreased
at 10 wk (Figure 4-5 F). These data confirm that the genetic lesion method causes a rapid and
sustained loss of LHA Nts neurons. Furthermore, our data verify that the LHA Nts lesion was
specific, since these neurons were depleted by 2 wk post-injection, at which point adjacent MCH
114

and OX neurons remained intact. However, the reduction in OX-IF at 10 wk suggests that
prolonged loss of LHA Nts neurons impaired OX expression, which may have contributed to the
behavioral and energy balance impairments observed in LHA Nts ablated mice.

Since LHA Nts neurons act, in part, via projections onto OX neurons, sustained loss of LHA
Nts input could disrupt the function and/or viability of OX-expressing neurons. To examine the
repercussions of LHA Nts lesion on transcription, we assessed gene expression in NtsCre mice that
received AAV-DTA in one side of the LHA, while the un-injected side served as an intact LHA
control (Figure 4-5 A, B).

As expected, Nts expression was significantly decreased in the Nts-

ablated LHA at 2 and 10 wk after AAV-DTA injection. MCH expression remained unchanged
between the control and Nts-ablated LHA at both time points, consistent with our previous
observation of intact MCH-IF in LHA Nts lesioned mice (Figure 4-5-F). Conversely, we observed a
trend for decreased OX expression in the Nts-ablated LHA at 2 wk post-injection, and a significant
OX reduction by 10 wk (Figure 4-6 A,B). This downregulation of OX could represent a specific
consequence of loss of LHA Nts signaling input, but could also result from general suppression of
transcription in OX neurons and/or decreased viability. To assess this possibility, we measured
DLK-1 expression, a gene product that is co-expressed within OX neurons, but not by other LHA
neurons 310. DLK-1 expression was similar in the intact and Nts-ablated LHA at 2 and 10 wk postinjection, indicating that loss of LHA Nts neurons does not generally impair gene expression within
OX neurons. We also examined DLK1 protein expression via IF, which revealed similar numbers of
DLK1 and OX+DLK1-expressing neurons in the Nts-ablated and control LHA, suggesting that at
least these OX neurons remain intact (Figure 4-5 C). By contrast, we observed significantly fewer
neurons with OX-IF in the Nts-ablated LHA compared to the control side. Taken together, these data
indicate that lesion of LHA Nts neurons specifically downregulates OX transcription, which reduces
OX peptide and hence impairs detection of the “OX neurons” via OX-IF. This is not necessarily
indicative of OX neuronal cell death, however; the retention of DLK1 protein known to be co115

expressed within “OX neurons”, confirms that at least some of them remain intact. Thus, loss of
LHA Nts neurons specifically leads to decreased OX expression without disrupting all function and
viability of the “OX” population.

4.4.6

Chronic Inhibition of LHA Nts Neurons Decreases Locomotion
Our LHA Nts ablation data confirm that LHA Nts neurons are necessary for proper regulation

of OX neurons, and that prolonged loss of LHA Nts neurons disrupts both Nts, OX and energy
balance. While these findings reinforce the interdependence of Nts and OX neurons 269, they
impaired determination of which facets of the LHA Nts-ablated phenotype are specifically due to loss
of LHA Nts neurons (rather than loss of OX-mediated control.) To circumvent this issue, we used
chemogenetics (DREADD technology) to selectively inhibit LHA Nts neurons for 4 wk, thereby
avoiding long-term structural changes that might impair OX neurons and obfuscate LHA Nts effects.
Adult NtsCre mice were bilaterally injected with Cre-inducible AAV-hM4Di-mCherry in the LHA to
drive expression of inhibitory DREADD-mCherry selectively on LHA Nts-GFP neurons (Figure 4-7 A,
B). We then treated mice with either vehicle or the DREADD agonist clozapine-N-oxide (CNO) to
inhibit LHA Nts neurons, and examined how acute (24 hr) or chronic (4 wk) inhibition impacted
energy balance (Figure 4-7 C,D). Neither acute nor chronic CNO-treatment altered body weight,
adiposity, feeding or drinking relative to vehicle-treated controls (Figure 4-7 E-H). However,
locomotor activity was significantly diminished by acute and chronic CNO treatment. While not
significant, CNO-treated mice also showed a trend toward decreased ambulatory activity speed.
Despite the reduction in locomotor activity, CNO-mediated inhibition of LHA Nts neurons did not
alter respiration rates (VO2, VCO2) or substrate usage (RER) (Figure 4-7 K-M).
indicate that inhibition of LHA Nts neurons specifically blunts locomotor activity.

116

These data

4.4.7

Inhibition of LHA Nts Neurons Does Not Reduce OX
We next examined the distribution of Nts-DREADDi-mCherry neurons and OX-IF in

chronically CNO-treated mice, to determine if prolonged inhibition of LHA Nts neurons impaired OX
expression similar to the effect of LHA Nts ablation. Nts-DREADDi-mCherry was robustly expressed
in the LHA from mice treated for 4-wk with Vehicle or CNO (Figure 4-8 A). We also observed a
similar distribution of OX-IF labeled cells in both groups, although the OX-IF was somewhat less
intense in the cell bodies of the CNO-treated mice compared to vehicle-treated animals (Figure 4-8
B). These data suggest that, unlike prolonged LHA Nts lesion, chronic inhibition of LHA Nts neurons
does not significantly derange OX peptide expression. Thus, the inhibition model presumably
reflects the behaviors governed by LHA Nts neurons alone, without effects mediated by disruption of
OX neurons.

4.4.8

Inhibition of LHA Nts Neurons Disrupts Leptin-Sensitivity
The disruption of LHA Nts and downstream OX neurons after LHA Nts lesion prevented

assessment of how LHA Nts neurons selectively contribute to adaptive energy balance in the lesion
model. However, because OX neurons are preserved in mice with chronically inhibited LHA Nts
neurons, they can be used to study the specific requirement for LHA Nts neuronal activity in
mediating adaptive energy balance without the influence of OX neurons. Since ~15% of LHA Nts
neurons express the long form of the leptin receptor (LepRb), we reasoned that suppression of LHA
Nts neural activity would blunt the anorectic response to leptin 269. To test this, we fasted mice
expressing DREADDi-mCherry in LHA Nts neurons overnight, to increase their motivation to eat.
Mice were then treated with either vehicle or CNO to inhibit LHA Nts neurons just prior to injection
with PBS or leptin, and then chow was returned to their cages. As expected, leptin decreased refeeding and prevented weight gain even in the hungry vehicle-treated mice at 3 and 9 hr post
treatment (Figure 4-9 A-F). By comparison, CNO-mediated inhibition of LHA Nts neurons blunted

117

the anorectic effect of leptin at 3 and 9 hr post treatment. CNO-treated mice, however, gained less
body weight, suggesting that leptin-mediated effects via some non-LHA Nts neurons can restrain
weight regain even without suppressing feeding, presumably via increasing energy expenditure.
Both vehicle and CNO-treated mice resumed normal feeding and body weight 24 hr after treatment,
indicating that LHA Nts inhibition does not cause permanent impairments in homeostatic energy
balance. These data confirm that inhibition of LHA Nts neurons impairs the adaptive anorectic
response to leptin. LHA Nts neurons are thus required for the appropriate coordination of leptin and
reduced feeding behavior, as might occur in response to elevated adiposity. Loss of function via
LHA Nts neurons may therefore impair both locomotor activity and appropriate adaptive feeding in
response to peripheral energy cues that could, over time, potentiate weight gain.

4.5 Discussion
We demonstrate that LHA Nts neurons are necessary for control of behavior and body
weight, confirming an important role for this neuronal population in energy balance. In particular,
loss of LHA Nts neurons decreases OX expression, drinking behavior, locomotor activity and energy
expenditure, and leads to obesity. By comparison, inhibition of LHA Nts neurons blunts locomotor
activity and the anorectic response to leptin without disrupting OX expression. Together, these data
implicate a specific role for LHA Nts neurons in regulating locomotor activity and the adaptive
response to leptin, as these effects were not contingent upon loss of action via downstream OX
neurons. Since deficits in drinking and energy expenditure were only observed after sustained LHA
Nts ablation and with OX reduction, these behaviors may depend on sustained communication
between LHA Nts and OX neurons. In sum, our findings support different LHA Nts circuit
mechanisms in controlling behaviors relevant to energy balance, and that chronic disruption of LHA
Nts neurons may contribute to maladaptive behaviors that potentiate obesity.

118

Experimental lesions of the entire LHA revealed its important role in energy balance, but they
masked the individual contributions of discrete, neurochemically-defined LHA populations. Due to
the ability to easily detect MCH and OX via immunoreactivity, the roles of these neurons have been
well studied within the LHA, and both are considered to be orexigenic, glucose responsive and to
modulate arousal in opposing directions (MCH promotes sleep and limits locomotor activity, OX
facilitates waking and locomotor activity)327 320. Genetic ablation has previously been used to
discern the necessity of MCH or OX neurons for energy balance, and their distinct contributions to
energy balance. Ablation of MCH neurons in adult mice caused significantly increased locomotor
activity, improved glucose tolerance and leanness, but did not significantly alter food intake 328 .
Conversely, ablation of adult OX neurons decreased arousal/wake time, locomotor activity and
drinking, while it increased cataplexy and body weight, with no observed change in feeding 140 By
comparison, we found that adult lesion of LHA Nts neurons decreased locomotor activity and
drinking and increased adiposity, with no effect on homeostatic or hedonic feeding. The
phenotypes resulting from LHA Nts or OX ablation are strikingly similar, and may be due to the fact
that LHA Nts neurons synaptically regulate OX neurons and coordinate at least some physiology via
OX neurons 135;269. Hence, loss of LHA Nts neurons and the subsequent downregulation of OX
presumably impairs OX-mediated functions, and accounts for the overlapping LHA Nts and OXablation phenotypes. Prolonged loss of action via the LHA Nts  OX circuit could also impair MCH
neurons, which are synaptically regulated by OX neurons. These data suggest that LHA Nts
neurons are crucial master controllers of OX neurons and perhaps the LHA as a whole.

LHA neurons have also recently been parsed by their classical neurotransmitter content, and
at least some LHA Nts neurons co-express GABA 255. Accordingly, we note some similarities
between mice with genetic lesion of GABA neurons or disruption of LHA Nts neurons. For example,
loss of LHA GABA neurons blunts fasting induced refeeding 265 and in our study fasted LHA Ntsinhibited mice had impaired anorectic responses to leptin (Figure 4-8). However, the phenotypes of
119

LHA GABA vs Nts-ablated neurons do not perfectly overlap. Interestingly, ablation of LHA GABA
neurons did not affect locomotor behavior 265, while loss or inhibition of LHA Nts neurons resulted in
substantial reductions in physical activity. While modulation of LHA GABA neurons must include the
subset of LHA Nts-GABA neurons, the differences in observed ablation phenotypes suggest that the
LHA GABA and LHA Nts neurons are not fully overlapping populations. Thus, there are likely to be
some separate behaviors mediated via GABA and Nts neurons, which have yet to be disentangled.
Intriguingly, ablation of MCH, OX or LHA Nts neurons does not impair homeostatic feeding,
despite the well-established roles of these peptides to modify food intake 140;328 (Figure 4-2). This
may suggest that the LHA is more important for regulating adaptive feeding in response to changing
peripheral signals of energy status, and for why we did not observe any reduction in homeostatic
feeding of LHA Nts ablated mice. One important signal for adaptive energy balance is leptin, which
communicates high peripheral energy stores to the brain and suppresses resultant feeding to
prevent weight gain. At least some LHA Nts neurons co-express LepRb and mediate the adaptive
leptin response. We therefore reasoned that loss of LHA Nts neurons would impair the adaptive
feeding and body weight response to leptin. Indeed, inhibition of LHA Nts neurons blunted leptinmediated suppression of feeding and resulted in increased body weight. Thus, loss of LHA Nts
neurons disrupts leptin-mediated adaptive energy balance, particularly under conditions of increased
appetitive drive (as in the fasted mice we tested). Individuals who lose weight via a long-term diet
and exercise regime also have an increased appetitive drive, which may prompt feeding and weight
regain

329

. We postulate that this could be due, in part, to diminished actions of LHA Nts neurons,

and the inability to suppress feeding drive necessary for sustained weight loss. Furthermore, this
would impair individuals from responding to elevated leptin, as might occur due to increased
adiposity, and from being able to curb the motivation to eat.

120

At least some LHA Nts neurons that project to the VTA, co-express LepRb, and presumably
they coordinate anorectic leptin response with DA regulation200;269. Indeed, LHA Nts neurons
regulate mesolimbic DA neurons in the VTA, and promote DA release to the nucleus accumbens
that modulates motivated ingestion and physical activity 177;191;269. Loss of LHA Nts neurons
presumably impairs DA-dependent actions, which may be more apparent in conditions that elevate
motivation. For example, LHA Nts-ablated mice exhibit reduced ambulatory locomotor activity, but
have more profound deficits in motivated locomotor activity (e.g. wheel running). LHA Nts-ablated
mice remained capable of moving, and did engage their running wheels, though to a lesser extent
than control mice. Given that loss of mesolimbic DA blunts locomotor activity 330, it is possible that
loss of the LHA Nts  VTA DA circuit contributes to the diminished physical activity, which over time
may potentiate fat accumulation despite normal caloric intake (Figure 4-2 A). LHA Nts-Inhibited
mice also demonstrated a decrease in activity, without any apparent downregulation of OX,
providing rationale that this effect might be mediated via an OX-independent pathway. Similarly, the
blunting of locomotor activity in both the LHA Nts-ablated and inhibited models suggests that at least
some portion of LHA Nts-mediated control of physical activity occurs independently of OX, and may
be mediated via projections to the VTA or other LHA Nts projection sites. While our data do not rule
out a contribution of LHA Nts  OX neurons in regulating physical activity, this circuit is not the sole
mediator of the behavior. By contrast, the blunted drinking and energy balance was only noted in
the LHA Nts-ablated mice with downregulation of OX neurons, suggesting that these may be
predominantly mediated via an LHA Nts  OX circuit. Going forward it will be crucial to dissect the
circuit-specific roles of LHA Nts neurons, which may reveal specific targets to modify drinking,
feeding and locomotor activity.

In contrast to global LHA manipulations, we selectively modulated LHA Nts neurons to reveal
their contributions to energy balance, and their necessity to prevent obesity. A caveat of our studies
is that LHA Nts neurons are not homogeneous, hence by modulating all LHA Nts neurons, we have
121

obscured the specific roles of any subpopulations of LHA Nts neurons. For example, LHA Nts
neurons can be divided into at least two subpopulations: ~15% of LHA Nts neurons express LepRb
and are regulated by leptin 200;269, while other LHA Nts neurons are regulated by dehydration 229. As
such, simultaneous loss of all LHA Nts neuronal subtypes may yield a mixed phenotype by
disrupting function of LepRb-expressing neurons that modify feeding, and dehydration-modulated
neurons that presumably coordinate drinking to restore fluid balance. Identification of genetic
markers to discern molecularly-specified subpopulations of LHA Nts neurons will be necessary to
selectively ablate them and reveal their specific functions. Alternately, ablating LHA Nts neurons
that project to local OX neurons vs. those that project to the VTA may be useful to assess whether
these circuits separately modify drinking vs feeding and locomotor behavior. While there is still
much to be learned about how LHA Nts neurons modify physiology, our data reveal that they are
necessary and important mediators for locomotor activity, adaptive feeding responses, drinking and
control of normal adiposity. Thus, loss of action via LHA Nts neurons may contribute to behavioral
deficits that lead to obesity. In the future, defining the signaling and circuit mechanisms by which
LHA Nts neurons coordinate ingestive and locomotor behavior may suggest strategies to restore
LHA Nts function and healthy body weight.

122

4.6

Figures

Figure 4-1: Ablation of LHA Nts Neurons Increases Adiposity

A) To examine the role of LHA Nts neurons in energy balance, we injected NtsCre mice bilaterally
with a control virus or AAV-DTA to specifically ablate LHA Nts neurons (Nts-Ablated n=9, Control
n=5). B) On the control side, Nts-GFP and MCH IF can be seen in the LHA. However, on the DTAinjected side, while MCH IF reveals an intact population of MCH neurons, there is a marked
reduction in GFP IF demonstrating that this model specifically targets and ablated Nts neurons while
avoiding other adjacent neuronal populations. C) A control mouse of average body weight is shown
with a quarter for size reference. D) An LHA Nts-Ablated animals displays a much fattier body
composition and oily looking for showing that specific loss of LHA Nts neurons clearly changes body
composition. E, F) Interestingly, on average, body weight was not significantly different between
ablated and control mice, nor was weight gained after surgery. However, G) body adiposity is
significantly increased in ablated mice relative to controls.

123

Figure 4-2: Loss of LHA Nts Neurons Blunts Water Intake and Locomotion

The Nts-Ablated animals generated as described in Figure 2-1 were studies for feeding, drinking
and activity levels. A) The increased in body fat that we observed was not because of increased
chow-feeding, in fact ablated mice ate slightly less than controls and B) drank significantly less
water. To asses if locomotion led to the increase in body fat, mice were assessed in TSE metabolic
cages which revealed that C) ablated mice exhibit a decrease in activity relative to controls and
show a decrease in D) VO2 and E) a trend toward and decrease in VCO2 and a F) decrease in
energy expenditure.

124

Figure 4-3: Motivational Locomotor Activity is Blunted by Loss of LHA Nts Neurons

The Nts-Ablated animals generated as described in Figure 2-1, were studied for feeding, drinking
and activity levels in metabolic cages as in Figure 2-2, but with the addition of a running wheel to
measure non-obligatory (volitional) locomotion (LHA NTs-Ablated n=7; control n=5). A-C) When
offered the opportunity to run in a running wheel, LHA Nts-Ablated mice spend significantly less time
on wheels, run for fewer revolutions and in shorter bouts, when compared to control animals. D, E)
Because they use less energy running than controls, LHA Nts-Ablated animals do not upregulate
their intake of food or water relative to controls. F-I) As expected, ablated animals exhibit F) lower
energy expenditure, VO2 and VCO2 relative to controls. I) No change in RER between groups
suggests that these changes result from a motivation and not metabolic shift. Taken together these
data show that loss of LHA Nts neurons blunts volitional locomotor activity and as such
compensatory upregulation of feeding and metabolism are absent.

125

Figure 4-4: Loss of LHA Nts Neurons Decreases Drinking but Not Sucrose Preference

LHA Nts-Ablated and control animals (LHA Nts-Ablated n=6, Control n=5) were given a two-bottle
choice sucrose preference test. A) Water consumption was assessed before animals were given a
choice between sucrose and water and LHA Nts-Ablated animals drank less water than controls at
baseline. B) However, overall preference for sucrose was not different between groups. C) During
testing days (when mice had both water and sucrose available) the total volume drunk was
decreased in ablated animals. D) Volumes of each liquid are shown here. Ablated mice
increased their intake of sucrose relative to water, but not as much as control animals. Both groups
drank the same volume of water on test days. These data show that loss of LHA Nts neurons does
not decrease hedonic preference for sucrose, but it does lead to a decrease in overall drinking.

126

Figure 4-5: Time Course Showing Loss of LHA Neurons After Ablation of Nts Population

Mice from the longitudinal study described in Figure 1-3) were examined histologically to identify
which were appropriately targeting to include for analysis. At that time, it was observed that not only
127

Figure 4-5 (cont’d)
was there a decrease in Nts IF in well targeting animals, but also a decrease in OX IF. A) The
longitudinal weights of study animals were plotted over time and while not significant, there is a
divergence of body weights of ablated animals from controls at around 4 weeks post-surgery. To
determine when the loss of each population occurred, mice were injected unilaterally with AAV-DTA
and brains were examined at 2, 6 and 10 weeks post-injection. B, C) Brains show a dramatic
decrease in Nts-GFP on the ablated vs the control hemisphere at 2 weeks, but MCH and OX IF
remains mostly consistent on both sides. D, E) At 10 weeks post-surgery, Nts IF is decreased on
the ablated side relative to controls and MCH remains intact. However, the OX IF has not
decreased in number of neurons and some of the remaining neurons appear less bright than the
control side. F) Quantification of LHA Nts, MCH and OX neurons at 2 and 10 weeks post-surgery.
These data indicate that ablation of Nts neurons by AAV-DTA is complete or nearly complete by 2
weeks post-surgery but there is a slow loss of OX IF that occurs by 10 weeks.

128

Figure 4-6: Loss of LHA Nts Neurons Leads to a Decrease in OX Peptide Expression

To further investigate the impact of ablation of LHA Nts neurons on other LHA populations we
generated unilateral LHA Nts-Ablated mice as described in Figure 4-5. A, B) Gene expression
levels of Nts, MCH OX and DLK-1 (a marker of OX neurons) were examined for fold change relative
to controls. Nts expression is decreased relative to controls at both 2 and 10 weeks but MCH is not
at either time point. At two weeks OX appears to be slightly, but not significantly decreased, but by
ten weeks it is significantly decreased. Interestingly, DLK-1 expression is not decreased at two or
10 weeks post-surgery suggesting that loss of OX IF is not due entirely because of loss OX neurons,
but because expression levels of the OX peptide have been downregulated. F) Counts of OX and
DKL-1 neuronal immunofluorescence in unilaterally ablated animals show a significant decrease in
OX IF, but not DKL-1 or cola belled neurons. Collectively these data suggest that loss of LHA Nts
neurons disrupts LHA OX neurons leading to downregulation of the OX peptide.

129

Figure 4-7: Inhibition of LHA Nts Neurons Blunts Locomotion

Bilateral injection of NtsCre mice with AAV-HM4D-mCherry into the LHA of NtsCre mice Credependent expression of DREADD receptors to allow for chemical inhibition of LHA Nts neurons
130

Figure 4-7 (cont’d)
(CNO n=8; vehicle n=7). C) I.P. treatment with the agonist CNO in one group of injected mice
inhibits Nts neurons, while a control group is treated with vehicle. D) Mice were treated 2x/day for 4
weeks with CNO/vehicle to chronically inhibit neurons and mice were examined for body
composition and metabolic parameters at onset of treatment and after 4 weeks of treatment. E – H)
Body weight, body fat, chow-feeding and water-drinking were not different between CNO and
vehicle groups acutely or chronically. I) However, activity levels were decreased in CNO treated
animals both acutely and chronically. J) A trend for a decrease in maximum activity speed can also
be seen both acutely and chronically. K-M) Despite the decrease in locomotor activity, VO2, VCO2
and RER are not different among groups at either time point. This data demonstrates the inhibition
of LHA Nts neurons decreases locomotion.

131

Figure 4-8: Inhibition of LHA Nts Neurons Does Not Reduce OX

Chemogenetic Inhibition of LHA Nts Neurons Disrupts LHA OX Neuronal Function. NtsCre mice
received bilateral LHA injections of AAV-HM4D-mCherry to allow for chemical inhibition of LHA Nts
neurons (CNO n=8; vehicle n=7). Mice were treated 2x/day for 4 weeks with CNO/vehicle to
chronically inhibit neurons. B A) Viral induced expression of DREADD receptors is coupled with a
fluorescent tag to show viral spread and targeting in Nts neurons (shown in cyan) and OX IF (shown
in red). In the LHA of the vehicle treated animal, Nts-DREADDi fluorescence is visible and a robust
population of LHA OX neurons. These exist near each other but do not overlap (merged panel). B)
In a CNO-treated animal after chronic inhibition of Nts neurons we see a similar number of NtsDREADDi IF neurons. The orexin population appears similar in number, but the cells appear
dimmer – suggesting a possible downregulation of OX peptide due to chronic loss of input from LHA
Nts neurons.

132

Figure 4-9: Chemogenetic Inhibition of LHA Nts Neurons Blunts Response to Leptin

NtsCre mice were bilaterally injected with AAV-HM4D-mCherry into the LHA and allowed to recover.
Mice were food restricted O.N. and the following morning, they received I.P. CNO/Vehicle treatment
followed by I.P. leptin/PBS (5mg/kg) and food was returned (crossover study design so each animal
had all four treatments (n=10). A) Three hours after food was returned, leptin reduced food intake in
vehicle treated mice. However, CNO treated mice did not respond as robustly to leptin. B) This
same effect can be seen nine hours after food is returned, but by 24 hours C) there is not difference
between treatment groups. D) Similarly, at 3 hours both vehicle and CNO treated mice show a
leptin-induced blunting of re-feeding, but the effect in more profound in the vehicle treated mice
when compared to controls and E) this pattern remains at 9 hours. F) 24 hours after treatment all
groups have regained similar amounts of weights. These data show that inhibition of LHA Nts
neurons blunts leptin-suppression off fasting-induced re-feeding.

133

CHAPTER 5

Summary, Discussion of Outcomes and Future
Directions

5.1 Summary of Dissertation
The goal of this project was to understand the role of LHA Neurotensin (Nts) neurons in
adaptive energy balance. Regulation of energy balance is crucial for survival, and coordination of
energy status and appropriate response behaviors is necessary for maintaining this balance.
Disorders like anorexia nervosa and obesity result when there is a loss of appropriate coordination
between energy status and adaptive response behaviors.

The Lateral Hypothalamic Area (LHA)

receives energy and hydration status cues from the periphery and initiates adaptive response
behaviors, thus may be important for properly coordinating energy balance. The LHA contains
several population of neuropeptide- or neurotransmitter defined neurons that may each contribute to
the regulation of energy balance. LHA populations that express orexin (OX) or melanin
concentrating hormone (MCH) respond indiscriminately to thirst and hunger signals. By contrast,
there were hints that the separate population of LHA Nts neurons might coordinate responses to
cues of energy excess or thirst, and may exert important contributions to adaptive energy and fluid
balance. Until recently, however, study of Nts neurons was hindered by a lack of reagents to easily
detect Nts-expressing cells and manipulate them in vivo. To overcome this obstacle, this thesis
describes the development and use of mouse models that allowed for facile visualization and
modulation of LHA Nts neurons, and revealed their important, novel contributions to adaptive energy
balance.

134

5.1.1

Chapter 2 - Heterogeneity of LHA Nts Neurons: Distinct Subsets are Activated by
Leptin or Dehydration
Hypothesis: Separate population of LHA Nts neurons are distinguishable by molecular,

circuit and neurochemical criteria and detect energy statue or fluid balance cues.
Defining the neurochemistry and projections of LHA neurons is essential for understanding
the signaling mechanisms by which they contribute to energy balance. This work shows that there
are at least two molecularly distinct populations of LHA Nts neurons: one co-expresses LepRb and
responds to the anorectic hormone leptin (NtsLepRb neurons) while a separate population lacks
LepRb and is activated by dehydration (NtsDehy neurons) (Figure 2-2). The NtsLepRb neurons project
to the VTA and SN, but NtsDehy neurons do not, suggesting that these subpopulations of LHA Nts
neurons exert effects via different pathways (Figure 2-3, 2-4). The subpopulations are, however,
similar in their classical neurotransmitter content, as a newly developed dual-recombinase strategy
revealed that LHA Nts neurons co-express GABA but not glutamate (Figure 2-8, 2-9). This suggests
that LHA Nts neurons can release either Nts and/or GABA, which could have differential effects on
downstream targets. Going forward, it will be important to discern if GABA and Nts are released at
all projection sites of LHA Nts neurons, or whether there are conditions for differential release or
action that may permit adaptive energy balance. Indeed, there is precedence for differential release,
as OX neurons bias release of OX, glutamate or dynorphin depending on environmental status 284.
Furthermore, it is possible that release of Nts vs. GABA might be affected by obesity, resulting in
impaired regulation of energy balance, and this will be important to test in the future. In sum, these
data establish a framework for understanding the molecular and circuit mechanisms by which LHA
Nts neurons may coordinate energy or fluid balance.

135

5.1.2

Chapter 3 - Loss of Action via Neurotensin-Leptin Receptor Neurons Disrupts Leptin
and Ghrelin-Mediated Control of Energy Balance
Hypothesis: LHA Nts neurons that co-express the long form of the leptin receptor are

essential for leptin and ghrelin-mediated adaptations in energy balance.
Here, the leptin-sensitive subpopulation of LHA Nts neurons (NtsLepRb neurons) was
examined to determine its specific role in energy balance. LHA NtsLepRb neurons could mediate
actions via their projections to local OX neurons or to the VTA, the seat of the mesolimbic DA
system that modifies motivated behaviors. Study of mice genetically lacking LepRb in Nts neurons
allowed determination of how loss of leptin signaling via otherwise intact LHA Nts neurons impacts
energy balance. Leptin-disrupted mice exhibited increased body adiposity and weight, but not chow
intake.

They also had decreased locomotor behavior (both ambulatory and motivated) and a

diminished ability to respond appropriately to the feeding-suppressing hormone, leptin. Importantly,
the ability to respond appropriately to ghrelin (an orexigenic signal that activates OX neurons) was
also disrupted. Since LHA NtsLepRb neurons project to OX neurons 200 these data suggest that
interrupting function of the LHA NtsLepRb neurons also deranges downstream OX neurons. Taken
together, these data reveal interdependence of OX and LHA Nts neurons in control of adaptive
energy balance.

5.1.3

Chapter 4 – Lateral Hypothalamic Neurotensin Neurons are Essential for Control of
Locomotor Activity and Body Weight
Hypothesis: LHA Nts neurons are essential for control of ingestive behavior and body weight
Here all LHA Nts neurons were ablated in adult animals to reveal their collective role in

adaptive energy balance. Using a genetic lesion technique to specifically target and ablate LHA Nts
neurons, it was found that loss of LHA Nts neurons increased adiposity and decreased locomotor

136

activity. Interestingly, acute ablation of LHA Nts neurons had no impact on adjacent MCH or OX
neurons, but prolonged loss of LHA Nts neurons caused downregulation of OX at the transcript and
peptide level. By contrast, another protein expressed within OX neurons, DLK-1, was unaffected by
loss of LHA Nts neurons, and its retention suggests that the “OX” neurons remain intact despite their
downregulation of OX. These data support a mechanism via which loss of LHA Nts neurons
specifically deranges the expression of OX, but not all peptides, in downstream OX neurons.
Additionally, DREADD technology was employed to inhibit LHA Nts neurons; since this method did
not cause downregulation of OX, it specifically revealed the role of LHA Nts neurons, without
consequences from loss of downstream OX action. Acute or chronic LHA Nts inhibition decreased
locomotor activity, and blunted the anorectic response to leptin necessary for adaptive energy
balance. These data reveal that LHA Nts neurons are necessary to coordinate appropriate
locomotor activity and adaptive energy balance, and loss of these functions may predispose
individuals to adiposity.

Taken together, the data generated from all of these studies establishes LHA Nts neurons as
necessary for energy balance. Furthermore, this work identifies discrete LHA Nts subpopulations
that may contribute in distinct ways to regulation of motivated locomotor behavior, motivated
consumption and drinking behavior.

5.2 Discussion
5.2.1

Mouse models used in the study of LHA Nts neurons.
To facilitate the study of LHA Nts neurons, several mouse models were employed in this

project, that either modulated all LHA Nts neurons or a specific subpopulation of them (NtsLepRb
neurons). A visual summary of the phenotypes of these models is included in Figure 5-2.
137

Assessment and comparison of these three models, when aligned with the current body of LHA
research, builds a comprehensive description of LHA Nts neuronal function.

As the LHA contains

other neuronal populations that regulate energy balance, it is helpful to also consider the
phenotypes obtained from the current work to that resulting from loss of all LHA neurons (LHA
lesion), and specific ablation of MCH, OX, GABA or glutamate neurons. These are discussed below
by phenotype.

Body composition: Genetic lesion of adult LHA Nts neurons (LHA Nts-ablated mice, Chapter
4) caused an obese phenotype. While the LHA Nts-ablated mice did not weigh significantly more
than controls, their percent body fat was much higher, they looked very round and they had oily
coats similar to diet-induced obese mice or those with congenital leptin deficiency that are
profoundly obese.

Mice with genetically disrupted leptin signaling specifically in Nts neurons

(LRKO mice, Chapter 2) also had substantially increased adiposity and modest increases in body
weight relative to controls.

Likewise, increased body size/adiposity is observed with lesion of OX

or glutamate neurons, many of which co-express OX 140;264. Since loss of LHA Nts neurons was
accompanied by a decrease in OX-IF (Figure 4-4), loss of input from LHA Nts neurons may cause
dysregulation of downstream OX neurons that contributes to adiposity. This is consistent with data
from Chapter 2 and prior work demonstrating that Nts neurons regulate OX neurons 200;298. However,
the significance of this finding was that loss of OX peptide expression must have contributed to the
phenotype of LHA Nts-Ablated mice.

Locomotor Activity: Chemogenetic inhibition of LHA Nts neurons (LHA Nts-Inhibited mice)
did not alter OX expression, suggesting that any phenotypes arising from this model were not
influenced by OX dysfunction. The LHA Nts-Inhibited phenotype was more restricted than that of
LHA Nts-Ablated mice, but both models exhibited decreased activity. These data suggest that LHA
138

Nts neurons modify locomotor activity that is not dependent on their regulation of OX neurons. By
contrast, other phenotypes associated with LHA Nts ablation (e.g. blunted drinking and energy
expenditure) may require action via an intact LHA Nts  OX circuit. LRKO mice also showed a
decrease in activity at baseline. This could be mediated via LHA Nts neurons projections to the
VTA, where they can modulate DA neurons expressing NtsR-1 191;200, and indeed, LRKO mice have
blunted DA signaling and DA-mediated locomotor activity 200. To further assess motivated
locomotion, Nts-ablated and LRKO mice were offered wheels to examine non-obligatory dopaminemediated rewarding activity 306;325. LRKO and Nts-ablated mice spent much less time on wheels
than controls, revealing that LHA Nts neurons are necessary for motivated locomotion. Given that
LHA Nts neurons project to and can activate NtsR1-expressing DA neurons191;194;200, they may
promote locomotor activity via the VTA. Going forward it will be important to selectively test whether
locomotor behavior is mediated via LHA Nts projections to the VTA or other sites that have yet to be
determined.

Feeding: No change in chow intake was found in any of the models relative to controls.
However, as some LHA Nts neurons are activated by the feeding suppressing hormone, leptin 200;269,
mice were tested for leptin response.

In WT mice, leptin reduces fasting-induced re-feeding, which

was blunted in Nts-Inhibited mice and LRKO mice (Figure 3-5 A, Figure 4-9).

LRKO mice were

also assessed for motivated intake of palatable rewards, and showed a failure to respond to leptin,
including no leptin-mediated blunting of motivated responding for sucrose (Figure 3-6).
Interestingly, ablation of LHA glutamate neurons increases motivated feeding similar to LRKO mice.
Since many LHA glutamate neurons co-express OX, loss of action via the Nts → OX pathway may
mirror the effect of glutamate neuron lesion due to suppression of OX/glutamate neurons 200.
Together, these data suggest a role for the NtsLepRb subpopulation in regulation of motivated feeding,
which may be mediated, in part, via regulation of (glutamatergic) OX neurons.

139

Drinking: LHA Nts-ablated mice show a drastic decrease in water intake (Figure 4-2), but
this was not observed in LRKO mice that only have impaired NtsLepRb neurons.

An important

consideration with LHA Nts-Ablated and LHA Nts-Inhibited models employed in this study, is that
they target all LHA Nts neurons. As LHA Nts neurons are comprised of distinct NtsLepRb and NtsDehy
subpopulations (and likely more that have yet to be determined), this means that bulk LHA Nts
ablation/inhibition will have produced mixed phenotypes due to the contributions of all of the LHA
Nts subsets. Dehydration activated ~12% of all LHA Nts neurons, which are NtsDehy neurons (Figure
2-4), but did not alter regulation of LHA LepRb neurons that contain the NtsLepRb subpopulation.
Therefore, necessarily NtsLepRb neurons are not dehydration sensitive and do not overlap with the
NtsDehy subpopulation (Figure 2-5). Additionally, NtsLepRb neurons project to the VTA and SNc where
they are poised to modulate motivated behavior via DA neurons, but LHA NtsDehy neurons do not,
suggesting that regulation of adaptive drinking behavior occurs by other, not yet characterized,
circuits.

5.2.2

LHA Nts Neuronal Subtypes
Hormonal response was considered in chapters 3 and 4, as changes in peripheral energy

status hormones are essential for the control of adaptive energy balance. Inhibition of LHA Nts
neurons disrupts appropriate response to leptin (Figure 4-9) which agreed with data from LRKO
mice with developmental LepRb deletion and hence loss of leptin regulation of the NtsLepRb neurons
(Figure 3-5, 3-6). While LHA Nts-inhibition did not cause a change in body composition, disruption
of leptin signaling via NtsLepRb neurons increased both weight and adiposity, which is again similar to
OX or glutamate ablation 140;264. By contrast, the disruption of leptin action via NtsLepRb neurons (e.g.
in LRKO mice) did not cause a change in drinking, as it did in the LHA Nts-ablated model. Together
these models show a functionally different mechanism for regulation of activity vs. drinking by LHA
Nts neurons, and agree with findings from Chapter 2 that leptin-sensitive NtsLepRb neurons are

140

distinct from dehydration-sensitive NtsDehy neurons. As expected, LRKO mice lacking leptin action
via NtsLepRb neurons had an inability to respond appropriately to leptin-treatment (Figure 3-5, 3-6).
Additionally, loss of LHA Nts-leptin signaling impaired appropriate response to the OX neuronal
activator, ghrelin (Figure 3-5, 3-6). This is consistent with previous work demonstrating an LHA Nts
 OX circuit by which LHA Nts neurons regulate the activity of OX neurons 200;298. Similarly, work
from Chapter 4 demonstrates that ablation of LHA Nts neurons leads to downregulation of OX
peptide (Figure 4-4), providing further rationale that LHA Nts neurons are necessary for the function
of OX neurons, and in particular, for OX expression and OX-mediated effects.

Taken together, data from the LRKO, LHA Nts-ablated and LHA Nts-inhibited models
describe: 1) potential pathways via which LHA Nts neurons regulate negative energy balance and 2)
subpopulations of LHA Nts neurons that are distinguishable by their activation cues, projections to
the VTA and may modulates distinct aspects of adaptive energy balance.

These results fit into a

larger body of research on LHA neurons and particularly have implications regarding the regulation
of the VTA DA reward circuit.

The leptin-sensitive population of LHA NtsLepRb neurons projects to

the VTA, where it is poised to engage the mesolimbic DA circuit to modulate motivated consumption
and locomotion. Furthermore, the definition of LHA Nts neurons as GABAergic (Chapter 2)
suggests how LHA Nts neurons might modulate the activity of the VTA. Pharmacologic Nts is well
established to activate VTA DA neurons 184;188, but this seems at odds with findings that LHA Nts
neurons contain stimulatory Nts and inhibitory GABA. A possible circuit mechanism to explain these
contradictory signals is that GABA and Nts act at different VTA target neurons. LHA Nts neurons
may release GABA onto VTA GABA neurons, which inhibits them, and in turn causes disinhibition of
downstream VTA DA neurons. These actions could reinforce the direct Nts-mediated activating
effects on NtsR-1 expressing VTA DA neurons 194;331. Our data cannot rule out that the leptinsensitive LHA NtsLepRb neurons may also act via local OX neurons, and prior evidence supports that
at least some of them do 298. Dehydration sensitive LHA NtsDehy neurons, however, do not project to
141

the VTA, and hence may contribute to drinking behavior regulation via a non-mesolimbic circuit.
LHA Nts-mediated drinking could perhaps be due to projections to OX neurons or other yet to be
characterized mechanisms.

5.2.3

Summary and Translational Potential
Collectively this work has described the functional contribution of LHA Nts neurons to energy

balance and established that they are crucial mediators of adaptive response to peripheral energy
and fluid status cues. Furthermore, this work confirms that there are discrete subpopulations of LHA
Nts neurons, which presumably contribute distinctly to coordination of adaptive energy balance.
About 15% of LHA Nts neurons are leptin-sensitive (NtsLepRb neurons) and regulate locomotor
activity and motivated food intake by accessing the mesolimbic DA circuit. Additionally, another
population of LHA Nts neurons is sensitive to dehydration NtsDehy neurons), but these do not project
to the midbrain; thus, LHA Nts-mediated regulation of drinking behavior is modulated by a yet to be
determined circuit.

These findings suggest that LHA Nts neurons, and perhaps specific subpopulations and
circuits, may be potential therapeutic targets for separate ingestive disorders that threaten human
health. One possible application may be to leverage the LHA NtsDehy neurons to regulate drinking
behavior. Many individuals suffer from derangements in water balance that threaten survival, yet
the incomplete understanding of control of water balance has prevented development of treatments
to normalize drinking and fluid homeostasis. For example, aging is often accompanied by
dysregulation of homeostatic control, including a decrease in thirst that can lead to dehydration 332.
Inability to recognize a need for fluids and a failure to drink, can lead to sodium and water imbalance
and dangerous conditions that precipitate cardiovascular events and early death 333;334. Since the
subset of NtsDehy neurons respond to thirst, these neurons could potentially be manipulated
142

pharmacologically to treat age-related loss of thirst. Sadly, many age-related disorders are
regarded as simply inevitable and geriatric patients can feel dismissed and isolated. If it were
possible to enhance drinking behavior, it could extend, and improve quality of life elderly patients.
Conversely, this circuit could be manipulated to treat overactive thirst, such is the case in
psychogenic polydipsia, which can lead to catastrophic electrolyte imbalance and death 335.

Modulating LHA Nts neurons may be also be useful to treat energy balance disorders, such
as obesity. Currently, the only widely available treatment has been diet and exercise or “lifestyle
modification”, the goal of which is to reduce caloric intake compared to caloric need. Caloric deficits
obtained in this manner can produce weight loss. Unfortunately, compliance with this treatment is
often a struggle and those who do initially have success often re-gain weight in the long term. One
complication of maintained excess weight is that is brings about changes within the body and brain
317;319

, that make maintenance of reduced weight particularly challenging. While there are current

pharmacological interventions available that decrease weight, they are not used nearly as often as
drugs for co-morbid disorders like type II diabetes 336 which implies a lack of physician confidence in
existing pharmaceuticals. Additionally, efficacy of available drugs ranges from 2-8% loss of body
weight over a year of therapy 337 which is not enough to reduce the body weight of someone with a
BMI categorized as morbidly obese into a healthy BMI, so there is a clear need to better understand
the neural circuitry that is implicated in obesity in order to improve available drug therapies.

5.2.4

Pharmacotherapeutic Targets
This work demonstrates that the leptin-sensitive subpopulation of LHA Nts neurons is

necessary to suppress motivated feeding and increase physical activity, dual behaviors that can
support weight loss. While these leptin-sensitive LHA NtsLepRb neurons are induced with activation
of all LHA Nts neurons, specifically activating just this subset might enhance anorectic and pro143

activity behaviors to enhance weight loss. Thus, further investigation of this circuit may identify
strategies to help restrain feeding, encourage exercise motivation and ultimately facilitate weight
loss. Data herein has shown that LHA NtsLepRb neurons project to the VTA (Figure 2-3) where they
can access and modulate DA neurons, a subset of which respond to Nts 177;194. Mice lacking LepRb
signaling in LHA Nts neurons have decreased activity and decreased mesolimbic activation after
leptin treatment 269, promoting this LHA Nts  VTA DA circuit as a potential target for
pharmacotherapeutic intervention.
functional NtsR-1 177.

Activation of LHA Nts neurons suppresses feeding, but requires

However, LHA Nts-mediated induction of activity is NtsR-1-independent 177

suggesting that these two adaptive behaviors could potentially be targeted and manipulated by
separate mechanisms. This could allow assistance with exercise compliance to be enhanced
independently from NtsR1-agonist mediated appetite suppression.

In general, the LHA GABA  VTA circuit employs GABA signaling to regulate motivated
feeding 286, suggesting that GABA-modulation may be a potential therapeutic avenue. In fact,
GABA-targeted pharmacotherapy is currently used for weight loss. Phentermine is the most widely
prescribed weight loss drug on the market 337 and combination therapy with Bupropion and
zonisamide is being investigated 338. This LHA VTA GABA circuit has potential to modify feeding
to promote weight loss and should be further characterized. LHA NtsLepRb neurons that project to the
VTA are a subpopulation of LHA GABA neurons (Figures 2-8, 2-9), and thorough characterization of
the specific role this circuit plays in regulation of ingestion could prove to be an effective target for
therapy.

5.2.5

Toxicological Implications
The relationship between LHA Nts neurons and OX neurons is both functional and potentially

fragile. It has been established that LHA Nts neurons project to and regulate OX neuron within the
144

LHA 200, and this work as has reaffirmed that relationship. Nts neurons fill the role of ‘command
neuron’ in the LHA; they regulate energy balance both directly, and by modulation of OX neurons.
This arrangement allows for control and versatility, but it also puts the OX population at the mercy of
the Nts population. In these studies, a modified DTA virus was used to selectively target and ablate
Nts neurons. After loss of the Nts population, OX neurons exhibited dysregulation with a reduction
in cell number as well as a decrease in OX mRNA expression by the cells that remain. Furthermore,
DREADD-mediated chronic inhibition of LHA Nts neurons lead to dimming of OX
immunofluorescence, suggesting a decrease in peptide expression. What this means, is that, if Nts
neurons suffer some insult, OX neurons will too, and loss of OX neurons or loss of OX peptide in
intact neurons, gives rise to narcolepsy symptoms and changes in behavior 140;339.

While there is

not currently a known environmental toxicant that targets Nts neurons, this interdependent Nts – OX
relationship must be considered when targeting LHA Nts neurons. Even when considering
development of a drug that might inhibit Nts neurons, the potential impact on OX neurons must be
considered.

Development of effective therapeutic strategies to support sustained weight loss are sorely
needed for the millions of adults and children with obesity, as current obesity treatments, even when
used in concert with diet and exercise have not proven sufficient to manage the disease. Other
diseases resulting from dysregulation of energy balance could also benefit from understanding of
the role that LHA Nts neurons play in adaptive feeding and activity.

Manipulation of these circuits

to increase feeding and decrease motivation to exercise, could be used to develop treatments for
anorexia nervosa and bulimia. Better understanding of specific neural circuits that support weight
management behaviors, as we have potentially uncovered in LHA Nts neurons, may help to develop
disease modifying treatment and improve human health.

145

5.3 Figure
Figure 5-1: Model Showing Major Study Findings

A subpopulation of LHA Nts neurons is activated by dehydration, and does not project to the VTA.
However separate LHA Nts neurons are leptin-sensitive and project to the VTA where they can
manage leptin-mediated regulation of activity. LHA Nts neurons also regulate OX neurons and loss
of all LHA Nts neurons decreases drinking and activity resulting in obesity. Here we have shown
that LHA Nts neurons regulate energy balance by OX-dependent and independent mechanisms,
and that distinct subpopulation regulate feeding and drinking discreetly.
146

Figure 5-2: Table Comparing Animal Models Used in This Research

To facilitate the study of the functional role for LHA Nts neurons in adaptive energy balance, several
mouse models were employed. Shown in this table are the experimental models along with a
control animal and an LHA lesion model to illustrate the phenotypic changes that arise from each.

147

REFERENCES

148

REFERENCES

1 - Sternson, S. M. 2013. 'Hypothalamic Survival Circuits: Blueprints for Purposive
Behaviors', Neuron, 77: 810-24. - 94
2 - Myers, M. G., Jr., Munzberg, H., Leinninger, G. M., and Leshan, R. L. 2009. 'The
Geometry of Leptin Action in the Brain: More Complicated Than a Simple Arc', Cell Metab, 9: 11723. - 53
3 - Nogueiras, R., Tschop, M. H., and Zigman, J. M. 2008. 'Central Nervous System
Regulation of Energy Metabolism: Ghrelin Versus Leptin', Ann N Y Acad Sci, 1126: 14-9. - 110
4 - Halaas, J. L., Gajiwala, K. S., Maffei, M., Cohen, S. L., Chait, B. T., Rabinowitz, D.,
Lallone, R. L., Burley, S. K., and Friedman, J. M. 1995. 'Weight-Reducing Effects of the Plasma
Protein Encoded by the Obese Gene', Science, 269: 543-6. - 111
5 - Pelleymounter, M. A., Cullen, M. J., Baker, M. B., Hecht, R., Winters, D., Boone, T., and
Collins, F. 1995. 'Effects of the Obese Gene Product on Body Weight Regulation in Ob/Ob Mice',
Science, 269: 540-3. - 112
6 - Chua, S. C., Jr., Chung, W. K., Wu-Peng, X. S., Zhang, Y., Liu, S. M., Tartaglia, L., and
Leibel, R. L. 1996. 'Phenotypes of Mouse Diabetes and Rat Fatty Due to Mutations in the Ob
(Leptin) Receptor', Science, 271: 994-6. - 113
7 - Cohen, P., Zhao, C., Cai, X., Montez, J. M., Rohani, S. C., Feinstein, P., Mombaerts, P.,
and Friedman, J. M. 2001. 'Selective Deletion of Leptin Receptor in Neurons Leads to Obesity', J
Clin Invest, 108: 1113-21. - 114
8 - Farooqi, I. S., Jebb, S. A., Langmack, G., Lawrence, E., Cheetham, C. H., Prentice, A.
M., Hughes, I. A., McCamish, M. A., and O'Rahilly, S. 1999. 'Effects of Recombinant Leptin Therapy
in a Child with Congenital Leptin Deficiency', N Engl J Med, 341: 879-84. - 115
9 - Montague, C. T., Farooqi, I. S., Whitehead, J. P., Soos, M. A., Rau, H., Wareham, N. J.,
Sewter, C. P., Digby, J. E., Mohammed, S. N., Hurst, J. A., Cheetham, C. H., Earley, A. R., Barnett,
A. H., Prins, J. B., and O'Rahilly, S. 1997. 'Congenital Leptin Deficiency Is Associated with Severe
Early-Onset Obesity in Humans', Nature, 387: 903-8. - 116
10 - Nakazato, M., Murakami, N., Date, Y., Kojima, M., Matsuo, H., Kangawa, K., and
Matsukura, S. 2001. 'A Role for Ghrelin in the Central Regulation of Feeding', Nature, 409: 194-8. 117
11 - Zigman, J. M., Nakano, Y., Coppari, R., Balthasar, N., Marcus, J. N., Lee, C. E., Jones,
J. E., Deysher, A. E., Waxman, A. R., White, R. D., Williams, T. D., Lachey, J. L., Seeley, R. J.,
Lowell, B. B., and Elmquist, J. K. 2005. 'Mice Lacking Ghrelin Receptors Resist the Development of
Diet-Induced Obesity', J Clin Invest, 115: 3564-72. - 118
12 - Tschop, M., Smiley, D. L., and Heiman, M. L. 2000. 'Ghrelin Induces Adiposity in
Rodents', Nature, 407: 908-13. - 119
13 - Kaye, W. H., Wierenga, C. E., Bailer, U. F., Simmons, A. N., and Bischoff-Grethe, A.
2013. 'Nothing Tastes as Good as Skinny Feels: The Neurobiology of Anorexia Nervosa', Trends
Neurosci. - 120

149

14 - Berthoud, H. R. 2012. 'The Neurobiology of Food Intake in an Obesogenic Environment',
Proc Nutr Soc: 1-10. - 121
15 - Berridge, K. C., Ho, C. Y., Richard, J. M., and DiFeliceantonio, A. G. 2010. 'The
Tempted Brain Eats: Pleasure and Desire Circuits in Obesity and Eating Disorders', Brain Res,
1350: 43-64. - 2
16 - Smink, F. R., van Hoeken, D., and Hoek, H. W. 2012. 'Epidemiology of Eating Disorders:
Incidence, Prevalence and Mortality Rates', Curr Psychiatry Rep, 14: 406-14. - 122
17 - Flegal, K. M., Carroll, M. D., Kit, B. K., and Ogden, C. L. 2012. 'Prevalence of Obesity
and Trends in the Distribution of Body Mass Index among Us Adults, 1999-2010', JAMA, 307: 491-7.
- 123
18 - Swinburn, B. A., Sacks, G., Hall, K. D., McPherson, K., Finegood, D. T., Moodie, M. L.,
and Gortmaker, S. L. 2011. 'The Global Obesity Pandemic: Shaped by Global Drivers and Local
Environments', Lancet, 378: 804-14. - 124
19 - Bray, G. A., and Ryan, D. H. 2014. 'Update on Obesity Pharmacotherapy', Ann N Y
Acad Sci, 1311: 1-13. - 125
20 - Bailey, A. P., Parker, A. G., Colautti, L. A., Hart, L. M., Liu, P., and Hetrick, S. E. 2014.
'Mapping the Evidence for the Prevention and Treatment of Eating Disorders in Young People', J
Eat Disord, 2: 5. - 126
21 - Jensen, M. D., Ryan, D. H., Apovian, C. M., Ard, J. D., Comuzzie, A. G., Donato, K. A.,
Hu, F. B., Hubbard, V. S., Jakicic, J. M., Kushner, R. F., Loria, C. M., Millen, B. E., Nonas, C. A., PiSunyer, F. X., Stevens, J., Stevens, V. J., Wadden, T. A., Wolfe, B. M., and Yanovski, S. Z. 2014.
'2013 Aha/Acc/Tos Guideline for the Management of Overweight and Obesity in Adults: A Report of
the American College of Cardiology/American Heart Association Task Force on Practice Guidelines
and the Obesity Society', Circulation, 129: S102-38. - 127
22 - Hart, S., Franklin, R. C., Russell, J., and Abraham, S. 2013. 'A Review of Feeding
Methods Used in the Treatment of Anorexia Nervosa', J Eat Disord, 1: 36. - 128
23 - Look, Ahead Research Group, Wing, R. R., Bolin, P., Brancati, F. L., Bray, G. A., Clark,
J. M., Coday, M., Crow, R. S., Curtis, J. M., Egan, C. M., Espeland, M. A., Evans, M., Foreyt, J. P.,
Ghazarian, S., Gregg, E. W., Harrison, B., Hazuda, H. P., Hill, J. O., Horton, E. S., Hubbard, V. S.,
Jakicic, J. M., Jeffery, R. W., Johnson, K. C., Kahn, S. E., Kitabchi, A. E., Knowler, W. C., Lewis, C.
E., Maschak-Carey, B. J., Montez, M. G., Murillo, A., Nathan, D. M., Patricio, J., Peters, A., PiSunyer, X., Pownall, H., Reboussin, D., Regensteiner, J. G., Rickman, A. D., Ryan, D. H., Safford,
M., Wadden, T. A., Wagenknecht, L. E., West, D. S., Williamson, D. F., and Yanovski, S. Z. 2013.
'Cardiovascular Effects of Intensive Lifestyle Intervention in Type 2 Diabetes', N Engl J Med, 369:
145-54. - 129
24 - Dayyeh, B. K., Lautz, D. B., and Thompson, C. C. 2010. 'Gastrojejunal Stoma Diameter
Predicts Weight Regain after Roux-En-Y Gastric Bypass', Clin Gastroenterol Hepatol. - 130
25 - Meguid, M. M., Glade, M. J., and Middleton, F. A. 2008. 'Weight Regain after Roux-EnY: A Significant 20% Complication Related to Pyy', Nutrition, 24: 832-42. - 131
26 - Ranson, S. W. 1937. 'Some Functions of the Hypothalamus: Harvey Lecture, December
17, 1936', Bull N Y Acad Med, 13: 241-71. - 132
27 - Ranson, A.W. Hetherington and S.W. 1939. 'Experimental Hyothamico-Hypophyseal
Obesity in the Rat', Proceedings of the Soceity for Experimental Biology and Medicine, 41: 2. - 133

150

28 - Ranson, A.W Heatherington and S.W. 1940. 'Hypothalamic Lesions and Adiposity in the
Rat', Anatomical Record, 78. - 134
29 - Anand, B.K. 1980. 'This Week's Citation Classic: Anand Bk & Brobeck Jr. Hypothalamic
Control of Food Intake in Rats and Cats. Yale J. Biol. Med. 24: 124-40, 1951', Current Contents:
Citation Classic Commentaries, 32. - 135
30 - Anand, B. K., and Brobeck, J. R. 1951. 'Hypothalamic Control of Food Intake in Rats
and Cats', Yale J Biol Med, 24: 123-40. - 136
31 - ———. 1951. 'Localization of a "Feeding Center" in the Hypothalamus of the Rat', Proc
Soc Exp Biol Med, 77: 323-4. - 137
32 - Morrison, S. D., Barrnett, R. J., and Mayer, J. 1958. 'Localization of Lesions in the
Lateral Hypothalamus of Rats with Induced Adipsia and Aphagia', Am J Physiol, 193: 230-4. - 14
33 - Delgado, J. M., and Anand, B. K. 1953. 'Increase of Food Intake Induced by Electrical
Stimulation of the Lateral Hypothalamus', Am J Physiol, 172: 162-8. - 138
34 - Mogenson, G. J., and Morgan, C. W. 1967. 'Effects of Induced Drinking on SelfStimulation of the Lateral Hypothalamus', Exp Brain Res, 3: 111-6. - 139
35 - Mogenson, G. J., and Stevenson, J. A. 1967. 'Drinking Induced by Electrical Stimulation
of the Lateral Hypothalamus', Exp Neurol, 17: 119-27. - 140
36 - Hoebel, B. G. 1965. 'Hypothalamic Lesions by Electrocauterization: Disinhibition of
Feeding and Self-Stimulation', Science, 149: 452-3. - 141
37 - Hoebel, B. G., and Teitelbaum, P. 1962. 'Hypothalamic Control of Feeding and SelfStimulation', Science, 135: 375-7. - 142
38 - Levitt, D. R., and Teitelbaum, P. 1975. 'Somnolence, Akinesia, and Sensory Activation
of Motivated Behavior in the Lateral Hypothalamic Syndrome', Proc Natl Acad Sci U S A, 72: 281923. - 143
39 - Teitelbaum, P., and Stellar, E. 1954. 'Recovery from the Failure to Eat Produced by
Hypothalamic Lesions', Science, 120: 894-5. - 144
40 - Teitelbaum, P. 1978. 'This Week's Citation Classic: Teitalbaum P & Epstein An. The
Lateral Hypothalamic Syndrome Recovery of Feeding and Drinking after Lateral Hypothalamic
Lesions. ', Current Contents: Citation Classic Commentaries, 11: 1. - 145
41 - Teitelbaum, P., and Epstein, A. N. 1962. 'The Lateral Hypothalamic Syndrome:
Recovery of Feeding and Drinking after Lateral Hypothalamic Lesions', Psychol Rev, 69: 74-90. 146
42 - Marshall, J. F., and Teitelbaum, P. 1973. 'A Comparison of the Eating in Response to
Hypothermic and Glucoprivic Challenges after Nigral 6-Hydroxydopamine and Lateral Hypothalamic
Electrolytic Lesions in Rats', Brain Res, 55: 229-33. - 147
43 - Teitelbaum, P., Cheng, M. F., and Rozin, P. 1969. 'Stages of Recovery and
Development of Lateral Hypothalamic Control of Food and Water Intake', Ann N Y Acad Sci, 157:
849-60. - 148
44 - Ungerstedt, U. 1971. 'Adipsia and Aphagia after 6-Hydroxydopamine Induced
Degeneration of the Nigro-Striatal Dopamine System', Acta Physiol Scand Suppl, 367: 95-122. - 149

151

45 - Szczypka, M. S., Rainey, M. A., Kim, D. S., Alaynick, W. A., Marck, B. T., Matsumoto, A.
M., and Palmiter, R. D. 1999. 'Feeding Behavior in Dopamine-Deficient Mice', Proc Natl Acad Sci U
S A, 96: 12138-43. - 150
46 - Szczypka, M. S., Rainey, M. A., and Palmiter, R. D. 2000. 'Dopamine Is Required for
Hyperphagia in Lep(Ob/Ob) Mice', Nat Genet, 25: 102-4. - 151
47 - Morgane, P. J. 1961. 'Distinct "Feeding" and "Hunger Motivating" Systems in the Lateral
Hypothalamus of the Rat', Science, 133: 887-8. - 152
48 - Grossman, S. P., Dacey, D., Halaris, A. E., Collier, T., and Routtenberg, A. 1978.
'Aphagia and Adipsia after Preferential Destruction of Nerve Cell Bodies in Hypothalamus', Science,
202: 537-9. - 153
49 - Dunnett, S. B., Lane, D. M., and Winn, P. 1985. 'Ibotenic Acid Lesions of the Lateral
Hypothalamus: Comparison with 6-Hydroxydopamine-Induced Sensorimotor Deficits', Neuroscience,
14: 509-18. - 154
50 - Hernandez, L., and Hoebel, B. G. 1988. 'Feeding and Hypothalamic Stimulation
Increase Dopamine Turnover in the Accumbens', Physiol Behav, 44: 599-606. - 155
51 - Goto, M., Canteras, N. S., Burns, G., and Swanson, L. W. 2005. 'Projections from the
Subfornical Region of the Lateral Hypothalamic Area', J Comp Neurol, 493: 412-38. - 156
52 - Hahn, J. D., and Swanson, L. W. 2010. 'Distinct Patterns of Neuronal Inputs and
Outputs of the Juxtaparaventricular and Suprafornical Regions of the Lateral Hypothalamic Area in
the Male Rat', Brain Res Rev, 64: 14-103. - 157
53 - Kawauchi, H., Kawazoe, I., Tsubokawa, M., Kishida, M., and Baker, B. I. 1983.
'Characterization of Melanin-Concentrating Hormone in Chum Salmon Pituitaries', Nature, 305: 3213. - 158
54 - Oshima, N., Kasukawa, H., Fujii, R., Wilkes, B. C., Hruby, V. J., and Hadley, M. E. 1986.
'Action of Melanin-Concentrating Hormone (Mch) on Teleost Chromatophores', Gen Comp
Endocrinol, 64: 381-8. - 159
55 - Zamir, N., Skofitsch, G., Bannon, M. J., and Jacobowitz, D. M. 1986. 'MelaninConcentrating Hormone: Unique Peptide Neuronal System in the Rat Brain and Pituitary Gland',
Proc Natl Acad Sci U S A, 83: 1528-31. - 160
56 - Mouri, T., Takahashi, K., Kawauchi, H., Sone, M., Totsune, K., Murakami, O., Itoi, K.,
Ohneda, M., Sasano, H., and Sasano, N. 1993. 'Melanin-Concentrating Hormone in the Human
Brain', Peptides, 14: 643-6. - 161
57 - Bittencourt, J. C., Presse, F., Arias, C., Peto, C., Vaughan, J., Nahon, J. L., Vale, W.,
and Sawchenko, P. E. 1992. 'The Melanin-Concentrating Hormone System of the Rat Brain: An
Immuno- and Hybridization Histochemical Characterization', J Comp Neurol, 319: 218-45. - 162
58 - Elias, C. F., Lee, C. E., Kelly, J. F., Ahima, R. S., Kuhar, M., Saper, C. B., and Elmquist,
J. K. 2001. 'Characterization of Cart Neurons in the Rat and Human Hypothalamus', J Comp Neurol,
432: 1-19. - 163
59 - Foo, K. S., Brismar, H., and Broberger, C. 2008. 'Distribution and Neuropeptide
Coexistence of Nucleobindin-2 Mrna/Nesfatin-Like Immunoreactivity in the Rat Cns', Neuroscience,
156: 563-79. - 164

152

60 - Vrang, N., Larsen, P. J., Clausen, J. T., and Kristensen, P. 1999. 'Neurochemical
Characterization of Hypothalamic Cocaine- Amphetamine-Regulated Transcript Neurons', J
Neurosci, 19: RC5. - 165
61 - Cvetkovic, V., Brischoux, F., Jacquemard, C., Fellmann, D., Griffond, B., and Risold, P.
Y. 2004. 'Characterization of Subpopulations of Neurons Producing Melanin-Concentrating Hormone
in the Rat Ventral Diencephalon', J Neurochem, 91: 911-9. - 166
62 - Brischoux, F., Cvetkovic, V., Griffond, B., Fellmann, D., and Risold, P. Y. 2002. 'Time of
Genesis Determines Projection and Neurokinin-3 Expression Patterns of Diencephalic Neurons
Containing Melanin-Concentrating Hormone', Eur J Neurosci, 16: 1672-80. - 167
63 - Jego, S., Glasgow, S. D., Herrera, C. G., Ekstrand, M., Reed, S. J., Boyce, R.,
Friedman, J., Burdakov, D., and Adamantidis, A. R. 2013. 'Optogenetic Identification of a Rapid Eye
Movement Sleep Modulatory Circuit in the Hypothalamus', Nat Neurosci, 16: 1637-43. - 168
64 - Chambers, J., Ames, R. S., Bergsma, D., Muir, A., Fitzgerald, L. R., Hervieu, G., Dytko,
G. M., Foley, J. J., Martin, J., Liu, W. S., Park, J., Ellis, C., Ganguly, S., Konchar, S., Cluderay, J.,
Leslie, R., Wilson, S., and Sarau, H. M. 1999. 'Melanin-Concentrating Hormone Is the Cognate
Ligand for the Orphan G-Protein-Coupled Receptor Slc-1', Nature, 400: 261-5. - 169
65 - Hawes, B. E., Kil, E., Green, B., O'Neill, K., Fried, S., and Graziano, M. P. 2000. 'The
Melanin-Concentrating Hormone Receptor Couples to Multiple G Proteins to Activate Diverse
Intracellular Signaling Pathways', Endocrinology, 141: 4524-32. - 170
66 - Lembo, P. M., Grazzini, E., Cao, J., Hubatsch, D. A., Pelletier, M., Hoffert, C., St-Onge,
S., Pou, C., Labrecque, J., Groblewski, T., O'Donnell, D., Payza, K., Ahmad, S., and Walker, P.
1999. 'The Receptor for the Orexigenic Peptide Melanin-Concentrating Hormone Is a G-ProteinCoupled Receptor', Nat Cell Biol, 1: 267-71. - 171
67 - Pissios, P., Trombly, D. J., Tzameli, I., and Maratos-Flier, E. 2003. 'MelaninConcentrating Hormone Receptor 1 Activates Extracellular Signal-Regulated Kinase and Synergizes
with G(S)-Coupled Pathways', Endocrinology, 144: 3514-23. - 172
68 - Saito, Y., Nothacker, H. P., Wang, Z., Lin, S. H., Leslie, F., and Civelli, O. 1999.
'Molecular Characterization of the Melanin-Concentrating-Hormone Receptor', Nature, 400: 265-9. 173
69 - Rodriguez, M., Beauverger, P., Naime, I., Rique, H., Ouvry, C., Souchaud, S., Dromaint,
S., Nagel, N., Suply, T., Audinot, V., Boutin, J. A., and Galizzi, J. P. 2001. 'Cloning and Molecular
Characterization of the Novel Human Melanin-Concentrating Hormone Receptor Mch2', Mol
Pharmacol, 60: 632-9. - 174
70 - An, S., Cutler, G., Zhao, J. J., Huang, S. G., Tian, H., Li, W., Liang, L., Rich, M., Bakleh,
A., Du, J., Chen, J. L., and Dai, K. 2001. 'Identification and Characterization of a MelaninConcentrating Hormone Receptor', Proc Natl Acad Sci U S A, 98: 7576-81. - 175
71 - Chee, M. J., Pissios, P., Prasad, D., and Maratos-Flier, E. 2014. 'Expression of MelaninConcentrating Hormone Receptor 2 Protects against Diet-Induced Obesity in Male Mice',
Endocrinology, 155: 81-8. - 176
72 - Chee, M. J., Pissios, P., and Maratos-Flier, E. 2013. 'Neurochemical Characterization of
Neurons Expressing Melanin-Concentrating Hormone Receptor 1 in the Mouse Hypothalamus', J
Comp Neurol, 521: 2208-34. - 177

153

73 - Touzani, K., Tramu, G., Nahon, J. L., and Velley, L. 1993. 'Hypothalamic MelaninConcentrating Hormone and Alpha-Neoendorphin-Immunoreactive Neurons Project to the Medial
Part of the Rat Parabrachial Area', Neuroscience, 53: 865-76. - 178
74 - Fekete, C., Wittmann, G., Liposits, Z., and Lechan, R. M. 2004. 'Origin of Cocaine- and
Amphetamine-Regulated Transcript (Cart)-Immunoreactive Innervation of the Hypothalamic
Paraventricular Nucleus', J Comp Neurol, 469: 340-50. - 179
75 - Yoon, Y. S., and Lee, H. S. 2013. 'Projections from Melanin-Concentrating Hormone
(Mch) Neurons to the Dorsal Raphe or the Nuclear Core of the Locus Coeruleus in the Rat', Brain
Res, 1490: 72-82. - 180
76 - Borowsky, B., Durkin, M. M., Ogozalek, K., Marzabadi, M. R., DeLeon, J., Lagu, B.,
Heurich, R., Lichtblau, H., Shaposhnik, Z., Daniewska, I., Blackburn, T. P., Branchek, T. A., Gerald,
C., Vaysse, P. J., and Forray, C. 2002. 'Antidepressant, Anxiolytic and Anorectic Effects of a
Melanin-Concentrating Hormone-1 Receptor Antagonist', Nat Med, 8: 825-30. - 181
77 - Kenny, P. J. 2011. 'Reward Mechanisms in Obesity: New Insights and Future
Directions', Neuron, 69: 664-79. - 182
78 - Pissios, P., Frank, L., Kennedy, A. R., Porter, D. R., Marino, F. E., Liu, F. F., Pothos, E.
N., and Maratos-Flier, E. 2008. 'Dysregulation of the Mesolimbic Dopamine System and Reward in
Mch-/- Mice', Biol Psychiatry, 64: 184-91. - 183
79 - Zheng, H., Patterson, L. M., Morrison, C., Banfield, B. W., Randall, J. A., Browning, K.
N., Travagli, R. A., and Berthoud, H. R. 2005. 'Melanin Concentrating Hormone Innervation of
Caudal Brainstem Areas Involved in Gastrointestinal Functions and Energy Balance', Neuroscience,
135: 611-25. - 184
80 - Rossi, M., Choi, S. J., O'Shea, D., Miyoshi, T., Ghatei, M. A., and Bloom, S. R. 1997.
'Melanin-Concentrating Hormone Acutely Stimulates Feeding, but Chronic Administration Has No
Effect on Body Weight', Endocrinology, 138: 351-5. - 185
81 - Qu, D., Ludwig, D. S., Gammeltoft, S., Piper, M., Pelleymounter, M. A., Cullen, M. J.,
Mathes, W. F., Przypek, R., Kanarek, R., and Maratos-Flier, E. 1996. 'A Role for MelaninConcentrating Hormone in the Central Regulation of Feeding Behaviour', Nature, 380: 243-7. - 186
82 - Glick, M., Segal-Lieberman, G., Cohen, R., and Kronfeld-Schor, N. 2009. 'Chronic Mch
Infusion Causes a Decrease in Energy Expenditure and Body Temperature, and an Increase in
Serum Igf-1 Levels in Mice', Endocrine, 36: 479-85. - 187
83 - Clegg, D. J., Air, E. L., Woods, S. C., and Seeley, R. J. 2002. 'Eating Elicited by Orexina, but Not Melanin-Concentrating Hormone, Is Opioid Mediated', Endocrinology, 143: 2995-3000. 188
84 - Sakamaki, R., Uemoto, M., Inui, A., Asakawa, A., Ueno, N., Ishibashi, C., Hirono, S.,
Yukioka, H., Kato, A., Shinfuku, N., Kasuga, M., and Katsuura, G. 2005. 'Melanin-Concentrating
Hormone Enhances Sucrose Intake', Int J Mol Med, 15: 1033-9. - 189
85 - Ludwig, D. S., Tritos, N. A., Mastaitis, J. W., Kulkarni, R., Kokkotou, E., Elmquist, J.,
Lowell, B., Flier, J. S., and Maratos-Flier, E. 2001. 'Melanin-Concentrating Hormone Overexpression
in Transgenic Mice Leads to Obesity and Insulin Resistance', J Clin Invest, 107: 379-86. - 190
86 - Shimada, M., Tritos, N. A., Lowell, B. B., Flier, J. S., and Maratos-Flier, E. 1998. 'Mice
Lacking Melanin-Concentrating Hormone Are Hypophagic and Lean', Nature, 396: 670-4. - 191

154

87 - Jeon, J. Y., Bradley, R. L., Kokkotou, E. G., Marino, F. E., Wang, X., Pissios, P., and
Maratos-Flier, E. 2006. 'Mch-/- Mice Are Resistant to Aging-Associated Increases in Body Weight
and Insulin Resistance', Diabetes, 55: 428-34. - 192
88 - Willie, J. T., Sinton, C. M., Maratos-Flier, E., and Yanagisawa, M. 2008. 'Abnormal
Response of Melanin-Concentrating Hormone Deficient Mice to Fasting: Hyperactivity and Rapid
Eye Movement Sleep Suppression', Neuroscience, 156: 819-29. - 193
89 - Marsh, D. J., Weingarth, D. T., Novi, D. E., Chen, H. Y., Trumbauer, M. E., Chen, A. S.,
Guan, X. M., Jiang, M. M., Feng, Y., Camacho, R. E., Shen, Z., Frazier, E. G., Yu, H., Metzger, J.
M., Kuca, S. J., Shearman, L. P., Gopal-Truter, S., MacNeil, D. J., Strack, A. M., MacIntyre, D. E.,
Van der Ploeg, L. H., and Qian, S. 2002. 'Melanin-Concentrating Hormone 1 Receptor-Deficient
Mice Are Lean, Hyperactive, and Hyperphagic and Have Altered Metabolism', Proc Natl Acad Sci U
S A, 99: 3240-5. - 194
90 - Chen, Y., Hu, C., Hsu, C. K., Zhang, Q., Bi, C., Asnicar, M., Hsiung, H. M., Fox, N.,
Slieker, L. J., Yang, D. D., Heiman, M. L., and Shi, Y. 2002. 'Targeted Disruption of the MelaninConcentrating Hormone Receptor-1 Results in Hyperphagia and Resistance to Diet-Induced
Obesity', Endocrinology, 143: 2469-77. - 195
91 - Kowalski, T. J., Farley, C., Cohen-Williams, M. E., Varty, G., and Spar, B. D. 2004.
'Melanin-Concentrating Hormone-1 Receptor Antagonism Decreases Feeding by Reducing Meal
Size', Eur J Pharmacol, 497: 41-7. - 196
92 - Kowalski, T. J., Spar, B. D., Weig, B., Farley, C., Cook, J., Ghibaudi, L., Fried, S.,
O'Neill, K., Del Vecchio, R. A., McBriar, M., Guzik, H., Clader, J., Hawes, B. E., and Hwa, J. 2006.
'Effects of a Selective Melanin-Concentrating Hormone 1 Receptor Antagonist on Food Intake and
Energy Homeostasis in Diet-Induced Obese Mice', Eur J Pharmacol, 535: 182-91. - 197
93 - Georgescu, D., Sears, R. M., Hommel, J. D., Barrot, M., Bolanos, C. A., Marsh, D. J.,
Bednarek, M. A., Bibb, J. A., Maratos-Flier, E., Nestler, E. J., and DiLeone, R. J. 2005. 'The
Hypothalamic Neuropeptide Melanin-Concentrating Hormone Acts in the Nucleus Accumbens to
Modulate Feeding Behavior and Forced-Swim Performance', J Neurosci, 25: 2933-40. - 198
94 - Sherwood, A., Wosiski-Kuhn, M., Nguyen, T., Holland, P. C., Lakaye, B., Adamantidis,
A., and Johnson, A. W. 2012. 'The Role of Melanin-Concentrating Hormone in Conditioned Reward
Learning', Eur J Neurosci, 36: 3126-33. - 199
95 - Kong, D., Vong, L., Parton, L. E., Ye, C., Tong, Q., Hu, X., Choi, B., Bruning, J. C., and
Lowell, B. B. 2010. 'Glucose Stimulation of Hypothalamic Mch Neurons Involves K(Atp) Channels, Is
Modulated by Ucp2, and Regulates Peripheral Glucose Homeostasis', Cell Metab, 12: 545-52. - 200
96 - Domingos, A. I., Sordillo, A., Dietrich, M. O., Liu, Z. W., Tellez, L. A., Vaynshteyn, J.,
Ferreira, J. G., Ekstrand, M. I., Horvath, T. L., de Araujo, I. E., and Friedman, J. M. 2013.
'Hypothalamic Melanin Concentrating Hormone Neurons Communicate the Nutrient Value of Sugar',
Elife, 2: e01462. - 201
97 - Clegg, D. J., Air, E. L., Benoit, S. C., Sakai, R. S., Seeley, R. J., and Woods, S. C. 2003.
'Intraventricular Melanin-Concentrating Hormone Stimulates Water Intake Independent of Food
Intake', Am J Physiol Regul Integr Comp Physiol, 284: R494-9. - 202
98 - Duncan, E. A., Proulx, K., and Woods, S. C. 2005. 'Central Administration of MelaninConcentrating Hormone Increases Alcohol and Sucrose/Quinine Intake in Rats', Alcohol Clin Exp
Res, 29: 958-64. - 203

155

99 - Zorrilla, E. P., Inoue, K., Fekete, E. M., Tabarin, A., Valdez, G. R., and Koob, G. F.
2005. 'Measuring Meals: Structure of Prandial Food and Water Intake of Rats', Am J Physiol Regul
Integr Comp Physiol, 288: R1450-67. - 204
100 - Watts, A. G., and Sanchez-Watts, G. 2007. 'Rapid and Preferential Activation of Fos
Protein in Hypocretin/Orexin Neurons Following the Reversal of Dehydration-Anorexia', J Comp
Neurol, 502: 768-82. - 205
101 - Segal-Lieberman, G., Bradley, R. L., Kokkotou, E., Carlson, M., Trombly, D. J., Wang,
X., Bates, S., Myers, M. G., Jr., Flier, J. S., and Maratos-Flier, E. 2003. 'Melanin-Concentrating
Hormone Is a Critical Mediator of the Leptin-Deficient Phenotype', Proc Natl Acad Sci U S A, 100:
10085-90. - 206
102 - Oldfield, B. J., Allen, A. M., Davern, P., Giles, M. E., and Owens, N. C. 2007. 'Lateral
Hypothalamic 'Command Neurons' with Axonal Projections to Regions Involved in Both Feeding and
Thermogenesis', Eur J Neurosci, 25: 2404-12. - 207
103 - Pereira-da-Silva, M., Torsoni, M. A., Nourani, H. V., Augusto, V. D., Souza, C. T.,
Gasparetti, A. L., Carvalheira, J. B., Ventrucci, G., Marcondes, M. C., Cruz-Neto, A. P., Saad, M. J.,
Boschero, A. C., Carneiro, E. M., and Velloso, L. A. 2003. 'Hypothalamic Melanin-Concentrating
Hormone Is Induced by Cold Exposure and Participates in the Control of Energy Expenditure in
Rats', Endocrinology, 144: 4831-40. - 208
104 - Smith, D. G., Tzavara, E. T., Shaw, J., Luecke, S., Wade, M., Davis, R., Salhoff, C.,
Nomikos, G. G., and Gehlert, D. R. 2005. 'Mesolimbic Dopamine Super-Sensitivity in MelaninConcentrating Hormone-1 Receptor-Deficient Mice', J Neurosci, 25: 914-22. - 209
105 - Wu, Q., and Palmiter, R. D. 2011. 'Gabaergic Signaling by Agrp Neurons Prevents
Anorexia Via a Melanocortin-Independent Mechanism', Eur J Pharmacol. - 210
106 - de Lecea, L., Kilduff, T. S., Peyron, C., Gao, X., Foye, P. E., Danielson, P. E.,
Fukuhara, C., Battenberg, E. L., Gautvik, V. T., Bartlett, F. S., 2nd, Frankel, W. N., van den Pol, A.
N., Bloom, F. E., Gautvik, K. M., and Sutcliffe, J. G. 1998. 'The Hypocretins: Hypothalamus-Specific
Peptides with Neuroexcitatory Activity', Proc Natl Acad Sci U S A, 95: 322-7. - 211
107 - Sakurai, T., Amemiya, A., Ishii, M., Matsuzaki, I., Chemelli, R. M., Tanaka, H.,
Williams, S. C., Richarson, J. A., Kozlowski, G. P., Wilson, S., Arch, J. R., Buckingham, R. E.,
Haynes, A. C., Carr, S. A., Annan, R. S., McNulty, D. E., Liu, W. S., Terrett, J. A., Elshourbagy, N.
A., Bergsma, D. J., and Yanagisawa, M. 1998. 'Orexins and Orexin Receptors: A Family of
Hypothalamic Neuropeptides and G Protein-Coupled Receptors That Regulate Feeding Behavior',
Cell, 92: 1 page following 696. - 212
108 - Zhu, Y., Miwa, Y., Yamanaka, A., Yada, T., Shibahara, M., Abe, Y., Sakurai, T., and
Goto, K. 2003. 'Orexin Receptor Type-1 Couples Exclusively to Pertussis Toxin-Insensitive GProteins, While Orexin Receptor Type-2 Couples to Both Pertussis Toxin-Sensitive and -Insensitive
G-Proteins', J Pharmacol Sci, 92: 259-66. - 213
109 - Holmqvist, T., Johansson, L., Ostman, M., Ammoun, S., Akerman, K. E., and
Kukkonen, J. P. 2005. 'Ox1 Orexin Receptors Couple to Adenylyl Cyclase Regulation Via Multiple
Mechanisms', J Biol Chem, 280: 6570-9. - 214
110 - Peyron, C., Tighe, D. K., van den Pol, A. N., de Lecea, L., Heller, H. C., Sutcliffe, J. G.,
and Kilduff, T. S. 1998. 'Neurons Containing Hypocretin (Orexin) Project to Multiple Neuronal
Systems', J Neurosci, 18: 9996-10015. - 215

156

111 - Trivedi, P., Yu, H., MacNeil, D. J., Van der Ploeg, L. H., and Guan, X. M. 1998.
'Distribution of Orexin Receptor Mrna in the Rat Brain', FEBS Lett, 438: 71-5. - 216
112 - van den Pol, A. N., Acuna-Goycolea, C., Clark, K. R., and Ghosh, P. K. 2004.
'Physiological Properties of Hypothalamic Mch Neurons Identified with Selective Expression of
Reporter Gene after Recombinant Virus Infection', Neuron, 42: 635-52. - 217
113 - Ida, T., Nakahara, K., Katayama, T., Murakami, N., and Nakazato, M. 1999. 'Effect of
Lateral Cerebroventricular Injection of the Appetite-Stimulating Neuropeptide, Orexin and
Neuropeptide Y, on the Various Behavioral Activities of Rats', Brain Res, 821: 526-9. - 218
114 - Zheng, H., Patterson, L. M., and Berthoud, H. R. 2005. 'Orexin-a Projections to the
Caudal Medulla and Orexin-Induced C-Fos Expression, Food Intake, and Autonomic Function', J
Comp Neurol, 485: 127-42. - 219
115 - Edwards, C. M., Abusnana, S., Sunter, D., Murphy, K. G., Ghatei, M. A., and Bloom, S.
R. 1999. 'The Effect of the Orexins on Food Intake: Comparison with Neuropeptide Y, MelaninConcentrating Hormone and Galanin', J Endocrinol, 160: R7-12. - 220
116 - Fadel, J., and Deutch, A. Y. 2002. 'Anatomical Substrates of Orexin-Dopamine
Interactions: Lateral Hypothalamic Projections to the Ventral Tegmental Area', Neuroscience, 111:
379-87. - 221
117 - Korotkova, T. M., Sergeeva, O. A., Eriksson, K. S., Haas, H. L., and Brown, R. E. 2003.
'Excitation of Ventral Tegmental Area Dopaminergic and Nondopaminergic Neurons by
Orexins/Hypocretins', J Neurosci, 23: 7-11. - 222
118 - Petrovich, G. D., Hobin, M. P., and Reppucci, C. J. 2012. 'Selective Fos Induction in
Hypothalamic Orexin/Hypocretin, but Not Melanin-Concentrating Hormone Neurons, by a Learned
Food-Cue That Stimulates Feeding in Sated Rats', Neuroscience, 224: 70-80. - 223
119 - Cason, A. M., and Aston-Jones, G. 2013. 'Role of Orexin/Hypocretin in Conditioned
Sucrose-Seeking in Rats', Psychopharmacology (Berl), 226: 155-65. - 224
120 - Vittoz, N. M., and Berridge, C. W. 2006. 'Hypocretin/Orexin Selectively Increases
Dopamine Efflux within the Prefrontal Cortex: Involvement of the Ventral Tegmental Area',
Neuropsychopharmacology, 31: 384-95. - 225
121 - Espana, R. A., Oleson, E. B., Locke, J. L., Brookshire, B. R., Roberts, D. C., and
Jones, S. R. 2010. 'The Hypocretin-Orexin System Regulates Cocaine Self-Administration Via
Actions on the Mesolimbic Dopamine System', Eur J Neurosci, 31: 336-48. - 226
122 - Espana, R. A., Melchior, J. R., Roberts, D. C., and Jones, S. R. 2011. 'Hypocretin
1/Orexin a in the Ventral Tegmental Area Enhances Dopamine Responses to Cocaine and
Promotes Cocaine Self-Administration', Psychopharmacology (Berl), 214: 415-26. - 227
123 - Borgland, S. L., Chang, S. J., Bowers, M. S., Thompson, J. L., Vittoz, N., Floresco, S.
B., Chou, J., Chen, B. T., and Bonci, A. 2009. 'Orexin a/Hypocretin-1 Selectively Promotes
Motivation for Positive Reinforcers', J Neurosci, 29: 11215-25. - 228
124 - Richardson, K. A., and Aston-Jones, G. 2012. 'Lateral Hypothalamic Orexin/Hypocretin
Neurons That Project to Ventral Tegmental Area Are Differentially Activated with Morphine
Preference', J Neurosci, 32: 3809-17. - 229
125 - Mahler, S. V., Smith, R. J., and Aston-Jones, G. 2013. 'Interactions between Vta
Orexin and Glutamate in Cue-Induced Reinstatement of Cocaine Seeking in Rats',
Psychopharmacology (Berl), 226: 687-98. - 230
157

126 - Harris, G. C., Wimmer, M., and Aston-Jones, G. 2005. 'A Role for Lateral Hypothalamic
Orexin Neurons in Reward Seeking', Nature, 437: 556-9. - 231
127 - Thorpe, A. J., and Kotz, C. M. 2005. 'Orexin a in the Nucleus Accumbens Stimulates
Feeding and Locomotor Activity', Brain Res, 1050: 156-62. - 232
128 - Choi, D. L., Davis, J. F., Fitzgerald, M. E., and Benoit, S. C. 2010. 'The Role of Orexina in Food Motivation, Reward-Based Feeding Behavior and Food-Induced Neuronal Activation in
Rats', Neuroscience, 167: 11-20. - 233
129 - Cason, A. M., and Aston-Jones, G. 2013. 'Attenuation of Saccharin-Seeking in Rats by
Orexin/Hypocretin Receptor 1 Antagonist', Psychopharmacology (Berl), 228: 499-507. - 234
130 - Borgland, S. L., Taha, S. A., Sarti, F., Fields, H. L., and Bonci, A. 2006. 'Orexin a in the
Vta Is Critical for the Induction of Synaptic Plasticity and Behavioral Sensitization to Cocaine',
Neuron, 49: 589-601. - 235
131 - Horvath, T. L., and Gao, X. B. 2005. 'Input Organization and Plasticity of Hypocretin
Neurons: Possible Clues to Obesity's Association with Insomnia', Cell Metab, 1: 279-86. - 236
132 - Cristino, L., Busetto, G., Imperatore, R., Ferrandino, I., Palomba, L., Silvestri, C.,
Petrosino, S., Orlando, P., Bentivoglio, M., Mackie, K., and Di Marzo, V. 2013. 'Obesity-Driven
Synaptic Remodeling Affects Endocannabinoid Control of Orexinergic Neurons', Proc Natl Acad Sci
U S A, 110: E2229-38. - 237
133 - Cai, X. J., Lister, C. A., Buckingham, R. E., Pickavance, L., Wilding, J., Arch, J. R.,
Wilson, S., and Williams, G. 2000. 'Down-Regulation of Orexin Gene Expression by Severe Obesity
in the Rats: Studies in Zucker Fatty and Zucker Diabetic Fatty Rats and Effects of Rosiglitazone',
Brain Res Mol Brain Res, 77: 131-7. - 238
134 - Sakurai, T. 1999. 'Orexins and Orexin Receptors: Implication in Feeding Behavior',
Regul Pept, 85: 25-30. - 239
135 - Funato, H., Tsai, A. L., Willie, J. T., Kisanuki, Y., Williams, S. C., Sakurai, T., and
Yanagisawa, M. 2009. 'Enhanced Orexin Receptor-2 Signaling Prevents Diet-Induced Obesity and
Improves Leptin Sensitivity', Cell Metab, 9: 64-76. - 240
136 - Kunii, K., Yamanaka, A., Nambu, T., Matsuzaki, I., Goto, K., and Sakurai, T. 1999.
'Orexins/Hypocretins Regulate Drinking Behaviour', Brain Res, 842: 256-61. - 241
137 - Inutsuka, A., Inui, A., Tabuchi, S., Tsunematsu, T., Lazarus, M., and Yamanaka, A.
2014. 'Concurrent and Robust Regulation of Feeding Behaviors and Metabolism by Orexin
Neurons', Neuropharmacology, 85C: 451-60. - 242
138 - Zhang, S., Zeitzer, J. M., Sakurai, T., Nishino, S., and Mignot, E. 2007. 'Sleep/Wake
Fragmentation Disrupts Metabolism in a Mouse Model of Narcolepsy', J Physiol, 581: 649-63. - 243
139 - McGregor, R., Wu, M. F., Barber, G., Ramanathan, L., and Siegel, J. M. 2011. 'Highly
Specific Role of Hypocretin (Orexin) Neurons: Differential Activation as a Function of Diurnal Phase,
Operant Reinforcement Versus Operant Avoidance and Light Level', J Neurosci, 31: 15455-67. - 244
140 - Tabuchi, S., Tsunematsu, T., Black, S. W., Tominaga, M., Maruyama, M., Takagi, K.,
Minokoshi, Y., Sakurai, T., Kilduff, T. S., and Yamanaka, A. 2014. 'Conditional Ablation of
Orexin/Hypocretin Neurons: A New Mouse Model for the Study of Narcolepsy and Orexin System
Function', J Neurosci, 34: 6495-509. - 245

158

141 - Matsuo, E., Mochizuki, A., Nakayama, K., Nakamura, S., Yamamoto, T., Shioda, S.,
Sakurai, T., Yanagisawa, M., Shiuchi, T., Minokoshi, Y., and Inoue, T. 2010. 'Decreased Intake of
Sucrose Solutions in Orexin Knockout Mice', J Mol Neurosci. - 246
142 - Anderson, R. I., Becker, H. C., Adams, B. L., Jesudason, C. D., and Rorick-Kehn, L. M.
2014. 'Orexin-1 and Orexin-2 Receptor Antagonists Reduce Ethanol Self-Administration in HighDrinking Rodent Models', Front Neurosci, 8: 33. - 247
143 - Ono, K., Kai, A., Honda, E., and Inenaga, K. 2008. 'Hypocretin-1/Orexin-a Activates
Subfornical Organ Neurons of Rats', Neuroreport, 19: 69-73. - 248
144 - Kiwaki, K., Kotz, C. M., Wang, C., Lanningham-Foster, L., and Levine, J. A. 2004.
'Orexin a (Hypocretin 1) Injected into Hypothalamic Paraventricular Nucleus and Spontaneous
Physical Activity in Rats', Am J Physiol Endocrinol Metab, 286: E551-9. - 249
145 - Rodgers, R. J., Halford, J. C., Nunes de Souza, R. L., Canto de Souza, A. L., Piper, D.
C., Arch, J. R., Upton, N., Porter, R. A., Johns, A., and Blundell, J. E. 2001. 'Sb-334867, a Selective
Orexin-1 Receptor Antagonist, Enhances Behavioural Satiety and Blocks the Hyperphagic Effect of
Orexin-a in Rats', Eur J Neurosci, 13: 1444-52. - 250
146 - Mileykovskiy, B. Y., Kiyashchenko, L. I., and Siegel, J. M. 2005. 'Behavioral Correlates
of Activity in Identified Hypocretin/Orexin Neurons', Neuron, 46: 787-98. - 251
147 - Park, S. M., Gaykema, R. P., and Goehler, L. E. 2008. 'How Does Immune Challenge
Inhibit Ingestion of Palatable Food? Evidence That Systemic Lipopolysaccharide Treatment
Modulates Key Nodal Points of Feeding Neurocircuitry', Brain Behav Immun, 22: 1160-72. - 252
148 - Becskei, C., Riediger, T., Hernadfalvy, N., Arsenijevic, D., Lutz, T. A., and Langhans,
W. 2008. 'Inhibitory Effects of Lipopolysaccharide on Hypothalamic Nuclei Implicated in the Control
of Food Intake', Brain Behav Immun, 22: 56-64. - 253
149 - Gaykema, R. P., and Goehler, L. E. 2009. 'Lipopolysaccharide Challenge-Induced
Suppression of Fos in Hypothalamic Orexin Neurons: Their Potential Role in Sickness Behavior',
Brain Behav Immun, 23: 926-30. - 254
150 - Grossberg, A. J., Zhu, X., Leinninger, G. M., Levasseur, P. R., Braun, T. P., Myers, M.
G., Jr., and Marks, D. L. 2011. 'Inflammation-Induced Lethargy Is Mediated by Suppression of
Orexin Neuron Activity', J Neurosci, 31: 11376-86. - 50
151 - Zhang, J., Li, B., Yu, L., He, Y. C., Li, H. Z., Zhu, J. N., and Wang, J. J. 2011. 'A Role
for Orexin in Central Vestibular Motor Control', Neuron, 69: 793-804. - 255
152 - Narita, M., Nagumo, Y., Hashimoto, S., Narita, M., Khotib, J., Miyatake, M., Sakurai, T.,
Yanagisawa, M., Nakamachi, T., Shioda, S., and Suzuki, T. 2006. 'Direct Involvement of Orexinergic
Systems in the Activation of the Mesolimbic Dopamine Pathway and Related Behaviors Induced by
Morphine', J Neurosci, 26: 398-405. - 256
153 - Kotz, C. M., Wang, C., Teske, J. A., Thorpe, A. J., Novak, C. M., Kiwaki, K., and
Levine, J. A. 2006. 'Orexin a Mediation of Time Spent Moving in Rats: Neural Mechanisms',
Neuroscience, 142: 29-36. - 257
154 - Anaclet, C., Parmentier, R., Ouk, K., Guidon, G., Buda, C., Sastre, J. P., Akaoka, H.,
Sergeeva, O. A., Yanagisawa, M., Ohtsu, H., Franco, P., Haas, H. L., and Lin, J. S. 2009.
'Orexin/Hypocretin and Histamine: Distinct Roles in the Control of Wakefulness Demonstrated Using
Knock-out Mouse Models', J Neurosci, 29: 14423-38. - 258

159

155 - Carraway, R., and Leeman, S. E. 1973. 'The Isolation of a New Hypotensive Peptide,
Neurotensin, from Bovine Hypothalami', J Biol Chem, 248: 6854-61. - 259
156 - Gevaert, B., Wynendaele, E., Stalmans, S., Bracke, N., D'Hondt, M., Smolders, I., van
Eeckhaut, A., and De Spiegeleer, B. 2016. 'Blood-Brain Barrier Transport Kinetics of the
Neuromedin Peptides Nmu, Nmn, Nmb and Nt', Neuropharmacology, 107: 460-70. - 829
157 - Ratner, C., Skov, L. J., Raida, Z., Bachler, T., Bellmann-Sickert, K., Le Foll, C.,
Sivertsen, B., Dalboge, L. S., Hartmann, B., Beck-Sickinger, A. G., Madsen, A. N., Jelsing, J., Holst,
J. J., Lutz, T. A., Andrews, Z. B., and Holst, B. 2016. 'Effects of Peripheral Neurotensin on Appetite
Regulation and Its Role in Gastric Bypass Surgery', Endocrinology, 157: 3482-92. - 830
158 - Lee, Y. C., Uttenthal, L. O., Smith, H. A., and Bloom, S. R. 1986. 'In Vitro Degradation
of Neurotensin in Human Plasma', Peptides, 7: 383-7. - 260
159 - Uhl, G. R., and Snyder, S. H. 1977. 'Neurotensin Receptor Binding, Regional and
Subcellular Distributions Favor Transmitter Role', Eur J Pharmacol, 41: 89-91. - 261
160 - Uhl, G. R., Kuhar, M. J., and Snyder, S. H. 1977. 'Neurotensin: Immunohistochemical
Localization in Rat Central Nervous System', Proc Natl Acad Sci U S A, 74: 4059-63. - 262
161 - Iversen, L. L., Iversen, S. D., Bloom, F., Douglas, C., Brown, M., and Vale, W. 1978.
'Calcium-Dependent Release of Somatostatin and Neurotensin from Rat Brain in Vitro', Nature, 273:
161-3. - 263
162 - Checler, F., Vincent, J. P., and Kitabgi, P. 1983. 'Degradation of Neurotensin by Rat
Brain Synaptic Membranes: Involvement of a Thermolysin-Like Metalloendopeptidase
(Enkephalinase), Angiotensin-Converting Enzyme, and Other Unidentified Peptidases', J
Neurochem, 41: 375-84. - 264
163 - McDermott, J. R., Virmani, M. A., Turner, J. D., and Kidd, A. M. 1986. 'Peptidases
Involved in the Catabolism of Neurotensin: Inhibitor Studies Using Superfused Rat Hypothalamic
Slices', Peptides, 7: 225-30. - 265
164 - Rovere, C., Barbero, P., and Kitabgi, P. 1996. 'Evidence That Pc2 Is the Endogenous
Pro-Neurotensin Convertase in Rmtc 6-23 Cells and That Pc1- and Pc2-Transfected Pc12 Cells
Differentially Process Pro-Neurotensin', J Biol Chem, 271: 11368-75. - 266
165 - Rovere, C., Viale, A., Nahon, J., and Kitabgi, P. 1996. 'Impaired Processing of Brain
Proneurotensin and Promelanin-Concentrating Hormone in Obese Fat/Fat Mice', Endocrinology,
137: 2954-8. - 267
166 - Uhl, G. R. 1982. 'Distribution of Neurotensin and Its Receptor in the Central Nervous
System', Ann N Y Acad Sci, 400: 132-49. - 268
167 - Kahn, D., Hou-Yu, A., and Zimmerman, E. A. 1982. 'Localization of Neurotensin in the
Hypothalamus', Ann N Y Acad Sci, 400: 117-31. - 269
168 - Roberts, G. W., Woodhams, P. L., Polak, J. M., and Crow, T. J. 1984. 'Distribution of
Neuropeptides in the Limbic System of the Rat: The Hippocampus', Neuroscience, 11: 35-77. - 270
169 - Zahm, D. S. 1987. 'Neurotensin-Immunoreactive Neurons in the Ventral Striatum of the
Adult Rat: Ventromedial Caudate-Putamen, Nucleus Accumbens and Olfactory Tubercle', Neurosci
Lett, 81: 41-7. - 271
170 - Allen, G. V., and Cechetto, D. F. 1995. 'Neurotensin in the Lateral Hypothalamic Area:
Origin and Function', Neuroscience, 69: 533-44. - 272
160

171 - Kalivas, P. W., Nemeroff, C. B., and Prange, A. J., Jr. 1982. 'Neuroanatomical Sites of
Action of Neurotensin', Ann N Y Acad Sci, 400: 307-18. - 273
172 - Bean, A. J., During, M. J., Deutch, A. Y., and Roth, R. H. 1989. 'Effects of Dopamine
Depletion on Striatal Neurotensin: Biochemical and Immunohistochemical Studies', J Neurosci, 9:
4430-8. - 274
173 - Mazella, J., Kitabgi, P., and Vincent, J. P. 1985. 'Molecular Properties of Neurotensin
Receptors in Rat Brain. Identification of Subunits by Covalent Labeling', J Biol Chem, 260: 508-14. 275
174 - Wang, H. L., and Wu, T. 1996. 'G Alpha Q/11 Mediates Neurotensin Excitation of
Substantia Nigra Dopaminergic Neurons', Brain Res Mol Brain Res, 36: 29-36. - 276
175 - Mazella, J., Zsurger, N., Navarro, V., Chabry, J., Kaghad, M., Caput, D., Ferrara, P.,
Vita, N., Gully, D., Maffrand, J. P., and Vincent, J. P. 1998. 'The 100-Kda Neurotensin Receptor Is
Gp95/Sortilin, a Non-G-Protein-Coupled Receptor', J Biol Chem, 273: 26273-6. - 277
176 - Tanaka, K., Masu, M., and Nakanishi, S. 1990. 'Structure and Functional Expression of
the Cloned Rat Neurotensin Receptor', Neuron, 4: 847-54. - 278
177 - Woodworth, H. L., Batchelor, H. M., Beekly, B. G., Bugescu, R., Brown, J. A., Kurt, G.,
Fuller, P. M., and Leinninger, G. M. 2017. 'Neurotensin Receptor-1 Identifies a Subset of Ventral
Tegmental Dopamine Neurons That Coordinates Energy Balance', Cell Rep, 20: 1881-92. - 408
178 - Kitabgi, P., Rostene, W., Dussaillant, M., Schotte, A., Laduron, P. M., and Vincent, J.
P. 1987. 'Two Populations of Neurotensin Binding Sites in Murine Brain: Discrimination by the
Antihistamine Levocabastine Reveals Markedly Different Radioautographic Distribution', Eur J
Pharmacol, 140: 285-93. - 279
179 - Nouel, D., Faure, M. P., St Pierre, J. A., Alonso, R., Quirion, R., and Beaudet, A. 1997.
'Differential Binding Profile and Internalization Process of Neurotensin Via Neuronal and Glial
Receptors', J Neurosci, 17: 1795-803. - 280
180 - Nouel, D., Sarret, P., Vincent, J. P., Mazella, J., and Beaudet, A. 1999.
'Pharmacological, Molecular and Functional Characterization of Glial Neurotensin Receptors',
Neuroscience, 94: 1189-97. - 281
181 - Yamauchi, R., Wada, E., Kamichi, S., Yamada, D., Maeno, H., Delawary, M.,
Nakazawa, T., Yamamoto, T., and Wada, K. 2007. 'Neurotensin Type 2 Receptor Is Involved in Fear
Memory in Mice', J Neurochem, 102: 1669-76. - 282
182 - Audinat, E., Hermel, J. M., and Crepel, F. 1989. 'Neurotensin-Induced Excitation of
Neurons of the Rat's Frontal Cortex Studied Intracellularly in Vitro', Exp Brain Res, 78: 358-68. - 288
183 - Behbehani, M. M., Shipley, M. T., and McLean, J. H. 1987. 'Effect of Neurotensin on
Neurons in the Periaqueductal Gray: An in Vitro Study', J Neurosci, 7: 2035-40. - 289
184 - Seutin, V., Massotte, L., and Dresse, A. 1989. 'Electrophysiological Effects of
Neurotensin on Dopaminergic Neurones of the Ventral Tegmental Area of the Rat in Vitro',
Neuropharmacology, 28: 949-54. - 290
185 - Lu, B., Su, Y., Das, S., Wang, H., Wang, Y., Liu, J., and Ren, D. 2009. 'Peptide
Neurotransmitters Activate a Cation Channel Complex of Nalcn and Unc-80', Nature, 457: 741-4. 291

161

186 - Farkas, R. H., Chien, P. Y., Nakajima, S., and Nakajima, Y. 1997. 'Neurotensin and
Dopamine D2 Activation Oppositely Regulate the Same K+ Conductance in Rat Midbrain
Dopaminergic Neurons', Neurosci Lett, 231: 21-4. - 292
187 - Werkman, T. R., Kruse, C. G., Nievelstein, H., Long, S. K., and Wadman, W. J. 2000.
'Neurotensin Attenuates the Quinpirole-Induced Inhibition of the Firing Rate of Dopamine Neurons in
the Rat Substantia Nigra Pars Compacta and the Ventral Tegmental Area', Neuroscience, 95: 41723. - 293
188 - Legault, M., Congar, P., Michel, F. J., and Trudeau, L. E. 2002. 'Presynaptic Action of
Neurotensin on Cultured Ventral Tegmental Area Dopaminergic Neurones', Neuroscience, 111: 17787. - 55
189 - Shi, W. X., and Bunney, B. S. 1991. 'Neurotensin Modulates Autoreceptor Mediated
Dopamine Effects on Midbrain Dopamine Cell Activity', Brain Res, 543: 315-21. - 294
190 - Woulfe, J., and Beaudet, A. 1992. 'Neurotensin Terminals Form Synapses Primarily
with Neurons Lacking Detectable Tyrosine Hydroxylase Immunoreactivity in the Rat Substantia
Nigra and Ventral Tegmental Area', J Comp Neurol, 321: 163-76. - 295
191 - Opland, D., Sutton, A., Woodworth, H., Brown, J., Bugescu, R., Garcia, A.,
Christensen, L., Rhodes, C., Myers, M., Jr., and Leinninger, G. 2013. 'Loss of Neurotensin
Receptor-1 Disrupts the Control of the Mesolimbic Dopamine System by Leptin and Promotes
Hedonic Feeding and Obesity', Mol Metab, 2: 423-34. - 21
192 - Singh, J., Desiraju, T., and Raju, T. R. 1997. 'Effects of Microinjections of
Cholecystokinin and Neurotensin into Lateral Hypothalamus and Ventral Mesencephalon on
Intracranial Self-Stimulation', Pharmacol Biochem Behav, 58: 893-8. - 296
193 - Blaha, C. D., Coury, A., Fibiger, H. C., and Phillips, A. G. 1990. 'Effects of Neurotensin
on Dopamine Release and Metabolism in the Rat Striatum and Nucleus Accumbens: CrossValidation Using in Vivo Voltammetry and Microdialysis', Neuroscience, 34: 699-705. - 54
194 - Patterson, C. M., Wong, J. M., Leinninger, G. M., Allison, M. B., Mabrouk, O. S.,
Kasper, C. L., Gonzalez, I. E., Mackenzie, A., Jones, J. C., Kennedy, R. T., and Myers, M. G., Jr.
2015. 'Ventral Tegmental Area Neurotensin Signaling Links the Lateral Hypothalamus to Locomotor
Activity and Striatal Dopamine Efflux in Male Mice', Endocrinology: en20141986. - 404
195 - Nalivaiko, E., Michaud, J. C., Soubrie, P., and Le Fur, G. 1998. 'Electrophysiological
Evidence for Putative Subtypes of Neurotensin Receptors in Guinea-Pig Mesencephalic
Dopaminergic Neurons', Neuroscience, 86: 799-811. - 297
196 - Sotty, F., Souliere, F., Brun, P., Chouvet, G., Steinberg, R., Soubrie, P., Renaud, B.,
and Suaud-Chagny, M. F. 1998. 'Differential Effects of Neurotensin on Dopamine Release in the
Caudal and Rostral Nucleus Accumbens: A Combined in Vivo Electrochemical and
Electrophysiological Study', Neuroscience, 85: 1173-82. - 59
197 - Szigethy, E., and Beaudet, A. 1989. 'Correspondence between High Affinity 125iNeurotensin Binding Sites and Dopaminergic Neurons in the Rat Substantia Nigra and Ventral
Tegmental Area: A Combined Radioautographic and Immunohistochemical Light Microscopic
Study', J Comp Neurol, 279: 128-37. - 298
198 - Brouard, A., Heaulme, M., Leyris, R., Pelaprat, D., Gully, D., Kitabgi, P., Le Fur, G.,
and Rostene, W. 1994. 'Sr 48692 Inhibits Neurotensin-Induced [3h]Dopamine Release in Rat
Striatal Slices and Mesencephalic Cultures', Eur J Pharmacol, 253: 289-91. - 299

162

199 - Gully, D., Canton, M., Boigegrain, R., Jeanjean, F., Molimard, J. C., Poncelet, M.,
Gueudet, C., Heaulme, M., Leyris, R., Brouard, A., and et al. 1993. 'Biochemical and
Pharmacological Profile of a Potent and Selective Nonpeptide Antagonist of the Neurotensin
Receptor', Proc Natl Acad Sci U S A, 90: 65-9. - 300
200 - Leinninger, G. M., Opland, D. M., Jo, Y. H., Faouzi, M., Christensen, L., Cappellucci, L.
A., Rhodes, C. J., Gnegy, M. E., Becker, J. B., Pothos, E. N., Seasholtz, A. F., Thompson, R. C.,
and Myers, M. G., Jr. 2011. 'Leptin Action Via Neurotensin Neurons Controls Orexin, the Mesolimbic
Dopamine System and Energy Balance', Cell Metab, 14: 313-23. - 16
201 - Laque, A., Zhang, Y., Gettys, S., Nguyen, T. A., Bui, K., Morrison, C. D., and
Muenzberg-Gruening, H. 2013. 'Leptin Receptor Neurons in the Mouse Hypothalamus Are CoLocalized with the Neuropeptide Galanin and Mediate Anorexigenic Leptin Action', Am J Physiol
Endocrinol Metab. - 301
202 - Kempadoo, K. A., Tourino, C., Cho, S. L., Magnani, F., Leinninger, G. M., Stuber, G.
D., Zhang, F., Myers, M. G., Deisseroth, K., de Lecea, L., and Bonci, A. 2013. 'Hypothalamic
Neurotensin Projections Promote Reward by Enhancing Glutamate Transmission in the Vta', J
Neurosci, 33: 7618-26. - 302
203 - Furutani, N., Hondo, M., Kageyama, H., Tsujino, N., Mieda, M., Yanagisawa, M.,
Shioda, S., and Sakurai, T. 2013. 'Neurotensin Co-Expressed in Orexin-Producing Neurons in the
Lateral Hypothalamus Plays an Important Role in Regulation of Sleep/Wakefulness States', PLoS
One, 8: e62391. - 1
204 - Stanley, B. G., Hoebel, B. G., and Leibowitz, S. F. 1983. 'Neurotensin: Effects of
Hypothalamic and Intravenous Injections on Eating and Drinking in Rats', Peptides, 4: 493-500. 303
205 - Hawkins, M. F. 1986. 'Central Nervous System Neurotensin and Feeding', Physiol
Behav, 36: 1-8. - 304
206 - ———. 1986. 'Aphagia in the Rat Following Microinjection of Neurotensin into the
Ventral Tegmental Area', Life Sci, 38: 2383-8. - 305
207 - Vaughn, A. W., Baumeister, A. A., Hawkins, M. F., and Anticich, T. G. 1990. 'Intranigral
Microinjection of Neurotensin Suppresses Feeding in Food Deprived Rats', Neuropharmacology, 29:
957-60. - 306
208 - Boules, M., Cusack, B., Zhao, L., Fauq, A., McCormick, D. J., and Richelson, E. 2000.
'A Novel Neurotensin Peptide Analog Given Extracranially Decreases Food Intake and Weight in
Rodents', Brain Res, 865: 35-44. - 307
209 - Hawkins, M. F., Barkemeyer, C. A., and Tulley, R. T. 1986. 'Synergistic Effects of
Dopamine Agonists and Centrally Administered Neurotensin on Feeding', Pharmacol Biochem
Behav, 24: 1195-201. - 308
210 - Remaury, A., Vita, N., Gendreau, S., Jung, M., Arnone, M., Poncelet, M., Culouscou, J.
M., Le Fur, G., Soubrie, P., Caput, D., Shire, D., Kopf, M., and Ferrara, P. 2002. 'Targeted
Inactivation of the Neurotensin Type 1 Receptor Reveals Its Role in Body Temperature Control and
Feeding Behavior but Not in Analgesia', Brain Res, 953: 63-72. - 309
211 - Feifel, D., Goldenberg, J., Melendez, G., and Shilling, P. D. 2010. 'The Acute and
Subchronic Effects of a Brain-Penetrating, Neurotensin-1 Receptor Agonist on Feeding, Body
Weight and Temperature', Neuropharmacology, 58: 195-8. - 310

163

212 - Beck, B., Burlet, A., Nicolas, J. P., and Burlet, C. 1990. 'Hyperphagia in Obesity Is
Associated with a Central Peptidergic Dysregulation in Rats', J Nutr, 120: 806-11. - 311
213 - Williams, G., Cardoso, H., Lee, Y. C., Ghatei, M. A., Flatt, P. R., Bailey, C. J., and
Bloom, S. R. 1991. 'Reduced Hypothalamic Neurotensin Concentrations in the Genetically Obese
Diabetic (Ob/Ob) Mouse: Possible Relationship to Obesity', Metabolism, 40: 1112-6. - 312
214 - Beck, B., Stricker-Krongrad, A., Burlet, A., Nicolas, J. P., and Burlet, C. 1992. 'Changes
in Hypothalamic Neurotensin Concentrations and Food Intake in Rats Fed a High Fat Diet', Int J
Obes Relat Metab Disord, 16: 361-6. - 313
215 - Wilding, J. P., Gilbey, S. G., Bailey, C. J., Batt, R. A., Williams, G., Ghatei, M. A., and
Bloom, S. R. 1993. 'Increased Neuropeptide-Y Messenger Ribonucleic Acid (Mrna) and Decreased
Neurotensin Mrna in the Hypothalamus of the Obese (Ob/Ob) Mouse', Endocrinology, 132: 1939-44.
- 314
216 - Beck, B., Burlet, A., Nicolas, J. P., and Burlet, C. 1989. 'Neurotensin in Microdissected
Brain Nuclei and in the Pituitary of the Lean and Obese Zucker Rats', Neuropeptides, 13: 1-7. - 315
217 - Sheppard, M. C., Bailey, C. J., Flatt, P. R., Swanston-Flatt, S. K., and Shennan, K. I.
1985. 'Immunoreactive Neurotensin in Spontaneous Syndromes of Obesity and Diabetes in Mice',
Acta Endocrinol (Copenh), 108: 532-6. - 316
218 - Sahu, A. 1998. 'Evidence Suggesting That Galanin (Gal), Melanin-Concentrating
Hormone (Mch), Neurotensin (Nt), Proopiomelanocortin (Pomc) and Neuropeptide Y (Npy) Are
Targets of Leptin Signaling in the Hypothalamus', Endocrinology, 139: 795-8. - 317
219 - Richy, S., Burlet, A., Max, J., Burlet, C., and Beck, B. 2000. 'Effect of Chronic
Intraperitoneal Injections of Leptin on Hypothalamic Neurotensin Content and Food Intake', Brain
Res, 862: 276-9. - 318
220 - Cui, H., Cai, F., and Belsham, D. D. 2006. 'Leptin Signaling in Neurotensin Neurons
Involves Stat, Map Kinases Erk1/2, and P38 through C-Fos and Atf1', Faseb J, 20: 2654-6. - 319
221 - Beck, B., Stricker-Krongrad, A., Richy, S., and Burlet, C. 1998. 'Evidence That
Hypothalamic Neurotensin Signals Leptin Effects on Feeding Behavior in Normal and Fat-Preferring
Rats', Biochem Biophys Res Commun, 252: 634-8. - 320
222 - Sahu, A., Carraway, R. E., and Wang, Y. P. 2001. 'Evidence That Neurotensin
Mediates the Central Effect of Leptin on Food Intake in Rat', Brain Res, 888: 343-7. - 321
223 - Kim, E. R., Leckstrom, A., and Mizuno, T. M. 2008. 'Impaired Anorectic Effect of Leptin
in Neurotensin Receptor 1-Deficient Mice', Behav Brain Res, 194: 66-71. - 26
224 - Glimcher, P. W., Margolin, D. H., Giovino, A. A., and Hoebel, B. G. 1984. 'Neurotensin:
A New 'Reward Peptide'', Brain Res, 291: 119-24. - 323
225 - Glimcher, P. W., Giovino, A. A., and Hoebel, B. G. 1987. 'Neurotensin Self-Injection in
the Ventral Tegmental Area', Brain Res, 403: 147-50. - 324
226 - Moga, M. M., Saper, C. B., and Gray, T. S. 1990. 'Neuropeptide Organization of the
Hypothalamic Projection to the Parabrachial Nucleus in the Rat', J Comp Neurol, 295: 662-82. - 325
227 - Carter, M. E., Soden, M. E., Zweifel, L. S., and Palmiter, R. D. 2013. 'Genetic
Identification of a Neural Circuit That Suppresses Appetite', Nature, 503: 111-4. - 326

164

228 - Watts, A. G. 1992. 'Osmotic Stimulation Differentially Affects Cellular Levels of
Corticotropin-Releasing Hormone and Neurotensin/Neuromedin N Mrnas in the Lateral
Hypothalamic Area and Central Nucleus of the Amygdala', Brain Res, 581: 208-16. - 327
229 - Watts, A. G., Sanchez-Watts, G., and Kelly, A. B. 1999. 'Distinct Patterns of
Neuropeptide Gene Expression in the Lateral Hypothalamic Area and Arcuate Nucleus Are
Associated with Dehydration-Induced Anorexia', J Neurosci, 19: 6111-21. - 71
230 - Watts, A. G., Kelly, A. B., and Sanchez-Watts, G. 1995. 'Neuropeptides and Thirst: The
Temporal Response of Corticotropin-Releasing Hormone and Neurotensin/Neuromedin N Gene
Expression in Rat Limbic Forebrain Neurons to Drinking Hypertonic Saline', Behav Neurosci, 109:
1146-57. - 328
231 - Quirk, W. S., Wright, J. W., and Harding, J. W. 1988. 'Tachyphylaxis of Dipsogenic
Activity to Intracerebroventricular Administration of Angiotensins', Brain Res, 452: 73-8. - 329
232 - Baker, J. D., Hawkins, M. F., Baumeister, A. A., and Nagy, M. 1989. 'Microinjection of
Neurotensin into the Cns Induces Hyperdipsia in the Rat', Pharmacol Biochem Behav, 33: 7-10. 330
233 - Sandoval, S. L., and Kulkosky, P. J. 1992. 'Effects of Peripheral Neurotensin on
Behavior of the Rat', Pharmacol Biochem Behav, 41: 385-90. - 331
234 - Lee, M. R., Hinton, D. J., Song, J. Y., Lee, K. W., Choo, C., Johng, H., Unal, S. S.,
Richelson, E., and Choi, D. S. 2010. 'Neurotensin Receptor Type 1 Regulates Ethanol Intoxication
and Consumption in Mice', Pharmacol Biochem Behav, 95: 235-41. - 333
235 - Lee, M. R., Hinton, D. J., Unal, S. S., Richelson, E., and Choi, D. S. 2011. 'Increased
Ethanol Consumption and Preference in Mice Lacking Neurotensin Receptor Type 2', Alcohol Clin
Exp Res, 35: 99-107. - 334
236 - Ervin, G. N., Birkemo, L. S., Nemeroff, C. B., and Prange, A. J., Jr. 1981. 'Neurotensin
Blocks Certain Amphetamine-Induced Behaviours', Nature, 291: 73-6. - 335
237 - Nemeroff, C. B., Hernandez, D. E., Luttinger, D., Kalivas, P. W., and Prange, A. J., Jr.
1982. 'Interactions of Neurotensin with Brain Dopamine Systems', Ann N Y Acad Sci, 400: 330-44. 336
238 - Jolicoeur, F. B., Rivest, R., St-Pierre, S., Gagne, M. A., and Dumais, M. 1985. 'The
Effects of Neurotensin and [D-Tyr11]-Nt on the Hyperactivity Induced by Intra-Accumbens
Administration of a Potent Dopamine Receptor Agonist', Neuropeptides, 6: 143-56. - 337
239 - Skoog, K. M., Cain, S. T., and Nemeroff, C. B. 1986. 'Centrally Administered
Neurotensin Suppresses Locomotor Hyperactivity Induced by D-Amphetamine but Not by
Scopolamine or Caffeine', Neuropharmacology, 25: 777-82. - 338
240 - Kalivas, P. W., Nemeroff, C. B., and Prange, A. J., Jr. 1981. 'Increase in Spontaneous
Motor Activity Following Infusion of Neurotensin into the Ventral Tegmental Area', Brain Res, 229:
525-9. - 339
241 - Kalivas, P. W., Burgess, S. K., Nemeroff, C. B., and Prange, A. J., Jr. 1983. 'Behavioral
and Neurochemical Effects of Neurotensin Microinjection into the Ventral Tegmental Area of the
Rat', Neuroscience, 8: 495-505. - 85
242 - Kalivas, P. W., Jennes, L., and Miller, J. S. 1985. 'A Catecholaminergic Projection from
the Ventral Tegmental Area to the Diagonal Band of Broca: Modulation by Neurotensin', Brain Res,
326: 229-38. - 340
165

243 - Kalivas, P. W., and Duffy, P. 1990. 'Effect of Acute and Daily Neurotensin and
Enkephalin Treatments on Extracellular Dopamine in the Nucleus Accumbens', J Neurosci, 10:
2940-9. - 62
244 - Kalivas, P. W., and Taylor, S. 1985. 'Behavioral and Neurochemical Effect of Daily
Injection with Neurotensin into the Ventral Tegmental Area', Brain Res, 358: 70-6. - 342
245 - Elliott, P. J., and Nemeroff, C. B. 1986. 'Repeated Neurotensin Administration in the
Ventral Tegmental Area: Effects on Baseline and D-Amphetamine-Induced Locomotor Activity',
Neurosci Lett, 68: 239-44. - 343
246 - Cervo, L., Rossi, C., Tatarczynska, E., and Samanin, R. 1992. 'Antidepressant-Like
Effect of Neurotensin Administered in the Ventral Tegmental Area in the Forced Swimming Test',
Psychopharmacology (Berl), 109: 369-72. - 344
247 - Deutch, A. Y., Bean, A. J., Bissette, G., Nemeroff, C. B., Robbins, R. J., and Roth, R.
H. 1987. 'Stress-Induced Alterations in Neurotensin, Somatostatin and Corticotropin-Releasing
Factor in Mesotelencephalic Dopamine System Regions', Brain Res, 417: 350-4. - 345
248 - Wachi, M., Okuda, M., Togashi, S., Miyashita, O., and Wakahoi, T. 1987. 'Effects of
Methamphetamine Administration on Brain Neurotensin-Like Immunoreactivity in Rats', Neurosci
Lett, 78: 222-6. - 346
249 - Elliott, P. J., Chan, J., Parker, Y. M., and Nemeroff, C. B. 1986. 'Behavioral Effects of
Neurotensin in the Open Field: Structure-Activity Studies', Brain Res, 381: 259-65. - 347
250 - Vadnie, C. A., Hinton, D. J., Choi, S., Choi, Y., Ruby, C. L., Oliveros, A., Prieto, M. L.,
Park, J. H., and Choi, D. S. 2014. 'Activation of Neurotensin Receptor Type 1 Attenuates Locomotor
Activity', Neuropharmacology, 85C: 482-92. - 348
251 - Herve, D., Tassin, J. P., Studler, J. M., Dana, C., Kitabgi, P., Vincent, J. P., Glowinski,
J., and Rostene, W. 1986. 'Dopaminergic Control of 125i-Labeled Neurotensin Binding Site Density
in Corticolimbic Structures of the Rat Brain', Proc Natl Acad Sci U S A, 83: 6203-7. - 349
252 - Binder, E. B., Kinkead, B., Owens, M. J., Kilts, C. D., and Nemeroff, C. B. 2001.
'Enhanced Neurotensin Neurotransmission Is Involved in the Clinically Relevant Behavioral Effects
of Antipsychotic Drugs: Evidence from Animal Models of Sensorimotor Gating', J Neurosci, 21: 6018. - 350
253 - Goforth P, Leinninger G, Patterson C, Satin L and Myers Jr. M, . 2014. 'Leptin Acts Via
Lha Neurotensin Neurons to Inhibit Ox Neurons by Multiple Gaba-Indepenent Mechanisms', Journal
of Neuroscience - in press. - 351
254 - Palomba, M., Seke Etet, P. F., and Veronesi, C. 2014. 'Effect of Inflammatory
Challenge on Hypothalamic Neurons Expressing Orexinergic and Melanin-Concentrating Hormone',
Neurosci Lett, 570: 47-52. - 352
255 - Leinninger, G. M., Jo, Y. H., Leshan, R. L., Louis, G. W., Yang, H., Barrera, J. G.,
Wilson, H., Opland, D. M., Faouzi, M. A., Gong, Y., Jones, J. C., Rhodes, C. J., Chua, S., Jr., Diano,
S., Horvath, T. L., Seeley, R. J., Becker, J. B., Munzberg, H., and Myers, M. G., Jr. 2009. 'Leptin
Acts Via Leptin Receptor-Expressing Lateral Hypothalamic Neurons to Modulate the Mesolimbic
Dopamine System and Suppress Feeding', Cell Metab, 10: 89-98. - 51
256 - Karnani, M. M., Szabo, G., Erdelyi, F., and Burdakov, D. 2013. 'Lateral Hypothalamic
Gad65 Neurons Are Spontaneously Firing and Distinct from Orexin- and Melanin-Concentrating
Hormone Neurons', J Physiol, 591: 933-53. - 43

166

257 - Hassani, O. K., Henny, P., Lee, M. G., and Jones, B. E. 2010. 'Gabaergic Neurons
Intermingled with Orexin and Mch Neurons in the Lateral Hypothalamus Discharge Maximally During
Sleep', Eur J Neurosci, 32: 448-57. - 353
258 - Sapin, E., Berod, A., Leger, L., Herman, P. A., Luppi, P. H., and Peyron, C. 2010. 'A
Very Large Number of Gabaergic Neurons Are Activated in the Tuberal Hypothalamus During
Paradoxical (Rem) Sleep Hypersomnia', PLoS One, 5: e11766. - 354
259 - Castel, M. N., Stutzmann, J. M., Lucas, M., Lafforgue, J., and Blanchard, J. C. 1989.
'Effects of Icv Administration of Neurotensin and Analogs on Eeg in Rats', Peptides, 10: 95-101. 355
260 - Watts, A. G., and Boyle, C. N. 2010. 'The Functional Architecture of DehydrationAnorexia', Physiol Behav, 100: 472-7. - 66
261 - Saper, C. B., Swanson, L. W., and Cowan, W. M. 1979. 'An Autoradiographic Study of
the Efferent Connections of the Lateral Hypothalamic Area in the Rat', J Comp Neurol, 183: 689706. - 11
262 - Hahn, J. D., and Swanson, L. W. 2012. 'Connections of the Lateral Hypothalamic Area
Juxtadorsomedial Region in the Male Rat', J Comp Neurol, 520: 1831-90. - 795
263 - ———. 2015. 'Connections of the Juxtaventromedial Region of the Lateral
Hypothalamic Area in the Male Rat', Front Syst Neurosci, 9: 66. - 796
264 - Stamatakis, A. M., Van Swieten, M., Basiri, M. L., Blair, G. A., Kantak, P., and Stuber,
G. D. 2016. 'Lateral Hypothalamic Area Glutamatergic Neurons and Their Projections to the Lateral
Habenula Regulate Feeding and Reward', J Neurosci, 36: 302-11. - 381
265 - Jennings, J. H., Ung, R. L., Resendez, S. L., Stamatakis, A. M., Taylor, J. G., Huang,
J., Veleta, K., Kantak, P. A., Aita, M., Shilling-Scrivo, K., Ramakrishnan, C., Deisseroth, K., Otte, S.,
and Stuber, G. D. 2015. 'Visualizing Hypothalamic Network Dynamics for Appetitive and
Consummatory Behaviors', Cell, 160: 516-27. - 379
266 - Nieh, E. H., Matthews, G. A., Allsop, S. A., Presbrey, K. N., Leppla, C. A., Wichmann,
R., Neve, R., Wildes, C. P., and Tye, K. M. 2015. 'Decoding Neural Circuits That Control Compulsive
Sucrose Seeking', Cell, 160: 528-41. - 380
267 - Navarro, M., Olney, J. J., Burnham, N. W., Mazzone, C. M., Lowery-Gionta, E. G.,
Pleil, K. E., Kash, T. L., and Thiele, T. E. 2016. 'Lateral Hypothalamus Gabaergic Neurons Modulate
Consummatory Behaviors Regardless of the Caloric Content or Biological Relevance of the
Consumed Stimuli', Neuropsychopharmacology, 41: 1505-12. - 411
268 - Qualls-Creekmore, E., Yu, S., Francois, M., Hoang, J., Huesing, C., Bruce-Keller, A.,
Burk, D., Berthoud, H. R., Morrison, C. D., and Munzberg, H. 2017. 'Galanin-Expressing Gaba
Neurons in the Lateral Hypothalamus Modulate Food Reward and Noncompulsive Locomotion', J
Neurosci, 37: 6053-65. - 412
269 - Brown, J. A., Bugescu, R., Mayer, T. A., Gata-Garcia, A., Kurt, G., Woodworth, H. L.,
and Leinninger, G. M. 2017. 'Loss of Action Via Neurotensin-Leptin Receptor Neurons Disrupts
Leptin and Ghrelin-Mediated Control of Energy Balance', Endocrinology, 158: 1271-88. - 652
270 - Hawkins, M. F., Baker, J. D., and Baumeister, A. A. 1989. 'Neurotensin-Induced
Polydipsia: A Structure-Activity Study', Brain Res, 487: 188-91. - 427
271 - Paxinos, G, and Franklin, BJ. 2001. The Mouse Brain in Stereotaxic Coordinates
(Academic Press: San Diego, CA). - 392
167

272 - Kahn, D., Abrams, G. M., Zimmerman, E. A., Carraway, R., and Leeman, S. E. 1980.
'Neurotensin Neurons in the Rat Hypothalamus: An Immunocytochemical Study', Endocrinology,
107: 47-54. - 421
273 - Krashes, M. J., Shah, B. P., Madara, J. C., Olson, D. P., Strochlic, D. E., Garfield, A.
S., Vong, L., Pei, H., Watabe-Uchida, M., Uchida, N., Liberles, S. D., and Lowell, B. B. 2014. 'An
Excitatory Paraventricular Nucleus to Agrp Neuron Circuit That Drives Hunger', Nature, 507: 238-42.
- 390
274 - Lein, E. S., Hawrylycz, M. J., Ao, N., Ayres, M., Bensinger, A., Bernard, A., Boe, A. F.,
Boguski, M. S., Brockway, K. S., Byrnes, E. J., Chen, L., Chen, L., Chen, T. M., Chin, M. C., Chong,
J., Crook, B. E., Czaplinska, A., Dang, C. N., Datta, S., Dee, N. R., Desaki, A. L., Desta, T., Diep, E.,
Dolbeare, T. A., Donelan, M. J., Dong, H. W., Dougherty, J. G., Duncan, B. J., Ebbert, A. J., Eichele,
G., Estin, L. K., Faber, C., Facer, B. A., Fields, R., Fischer, S. R., Fliss, T. P., Frensley, C., Gates, S.
N., Glattfelder, K. J., Halverson, K. R., Hart, M. R., Hohmann, J. G., Howell, M. P., Jeung, D. P.,
Johnson, R. A., Karr, P. T., Kawal, R., Kidney, J. M., Knapik, R. H., Kuan, C. L., Lake, J. H.,
Laramee, A. R., Larsen, K. D., Lau, C., Lemon, T. A., Liang, A. J., Liu, Y., Luong, L. T., Michaels, J.,
Morgan, J. J., Morgan, R. J., Mortrud, M. T., Mosqueda, N. F., Ng, L. L., Ng, R., Orta, G. J., Overly,
C. C., Pak, T. H., Parry, S. E., Pathak, S. D., Pearson, O. C., Puchalski, R. B., Riley, Z. L., Rockett,
H. R., Rowland, S. A., Royall, J. J., Ruiz, M. J., Sarno, N. R., Schaffnit, K., Shapovalova, N. V.,
Sivisay, T., Slaughterbeck, C. R., Smith, S. C., Smith, K. A., Smith, B. I., Sodt, A. J., Stewart, N. N.,
Stumpf, K. R., Sunkin, S. M., Sutram, M., Tam, A., Teemer, C. D., Thaller, C., Thompson, C. L.,
Varnam, L. R., Visel, A., Whitlock, R. M., Wohnoutka, P. E., Wolkey, C. K., Wong, V. Y., Wood, M.,
Yaylaoglu, M. B., Young, R. C., Youngstrom, B. L., Yuan, X. F., Zhang, B., Zwingman, T. A., and
Jones, A. R. 2007. 'Genome-Wide Atlas of Gene Expression in the Adult Mouse Brain', Nature, 445:
168-76. - 414
275 - Wise, R. A., and McDevitt, R. A. 2017. 'Drive and Reinforcement Circuitry in the Brain:
Origins, Neurotransmitters, and Projection Fields', Neuropsychopharmacology. - 415
276 - Bissonette, G. B., and Roesch, M. R. 2016. 'Development and Function of the Midbrain
Dopamine System: What We Know and What We Need To', Genes Brain Behav, 15: 62-73. - 416
277 - van den Pol, A. N. 2012. 'Neuropeptide Transmission in Brain Circuits', Neuron, 76: 98115. - 566
278 - Dulcis, D., Lippi, G., Stark, C. J., Do, L. H., Berg, D. K., and Spitzer, N. C. 2017.
'Neurotransmitter Switching Regulated by Mirnas Controls Changes in Social Preference', Neuron,
95: 1319-33 e5. - 420
279 - Kranz, A., Fu, J., Duerschke, K., Weidlich, S., Naumann, R., Stewart, A. F., and
Anastassiadis, K. 2010. 'An Improved Flp Deleter Mouse in C57bl/6 Based on Flpo Recombinase',
Genesis, 48: 512-20. - 419
280 - Ferrario, C. R., Labouebe, G., Liu, S., Nieh, E. H., Routh, V. H., Xu, S., and O'Connor,
E. C. 2016. 'Homeostasis Meets Motivation in the Battle to Control Food Intake', J Neurosci, 36:
11469-81. - 417
281 - Berridge, K. C., and Kringelbach, M. L. 2015. 'Pleasure Systems in the Brain', Neuron,
86: 646-64. - 418
282 - Barbano, M. F., Wang, H. L., Morales, M., and Wise, R. A. 2016. 'Feeding and Reward
Are Differentially Induced by Activating Gabaergic Lateral Hypothalamic Projections to Vta', J
Neurosci, 36: 2975-85. - 424

168

283 - Baimel, C., Lau, B. K., Qiao, M., and Borgland, S. L. 2017. 'Projection-Target-Defined
Effects of Orexin and Dynorphin on Vta Dopamine Neurons', Cell Rep, 18: 1346-55. - 425
284 - Muschamp, J. W., Hollander, J. A., Thompson, J. L., Voren, G., Hassinger, L. C.,
Onvani, S., Kamenecka, T. M., Borgland, S. L., Kenny, P. J., and Carlezon, W. A., Jr. 2014.
'Hypocretin (Orexin) Facilitates Reward by Attenuating the Antireward Effects of Its Cotransmitter
Dynorphin in Ventral Tegmental Area', Proc Natl Acad Sci U S A, 111: E1648-55. - 426
285 - Leinninger, G. M. 2009. 'Location, Location, Location: The Cns Sites of Leptin Action
Dictate Its Regulation of Homeostatic and Hedonic Pathways', Int J Obes (Lond), 33 Suppl 2: S14-7.
- 52
286 - Nieh, E. H., Vander Weele, C. M., Matthews, G. A., Presbrey, K. N., Wichmann, R.,
Leppla, C. A., Izadmehr, E. M., and Tye, K. M. 2016. 'Inhibitory Input from the Lateral Hypothalamus
to the Ventral Tegmental Area Disinhibits Dopamine Neurons and Promotes Behavioral Activation',
Neuron. - 406
287 - Brown, J. A., Woodworth, H. L., and Leinninger, G. M. 2015. 'To Ingest or Rest?
Specialized Roles of Lateral Hypothalamic Area Neurons in Coordinating Energy Balance', Front
Syst Neurosci, 9: 9. - 378
288 - Yamanaka, A., Beuckmann, C. T., Willie, J. T., Hara, J., Tsujino, N., Mieda, M.,
Tominaga, M., Yagami, K., Sugiyama, F., Goto, K., Yanagisawa, M., and Sakurai, T. 2003.
'Hypothalamic Orexin Neurons Regulate Arousal According to Energy Balance in Mice', Neuron, 38:
701-13. - 382
289 - Watts, A. G. 1999. 'Dehydration-Associated Anorexia: Development and Rapid
Reversal', Physiol Behav, 65: 871-8. - 383
290 - Laque, A., Yu, S., Qualls-Creekmore, E., Gettys, S., Schwartzenburg, C., Bui, K.,
Rhodes, C., Berthoud, H. R., Morrison, C. D., Richards, B. K., and Munzberg, H. 2015. 'Leptin
Modulates Nutrient Reward Via Inhibitory Galanin Action on Orexin Neurons', Mol Metab, 4: 706-17.
- 107
291 - Muller, T. D., Nogueiras, R., Andermann, M. L., Andrews, Z. B., Anker, S. D., Argente,
J., Batterham, R. L., Benoit, S. C., Bowers, C. Y., Broglio, F., Casanueva, F. F., D'Alessio, D.,
Depoortere, I., Geliebter, A., Ghigo, E., Cole, P. A., Cowley, M., Cummings, D. E., Dagher, A.,
Diano, S., Dickson, S. L., Dieguez, C., Granata, R., Grill, H. J., Grove, K., Habegger, K. M.,
Heppner, K., Heiman, M. L., Holsen, L., Holst, B., Inui, A., Jansson, J. O., Kirchner, H., Korbonits,
M., Laferrere, B., LeRoux, C. W., Lopez, M., Morin, S., Nakazato, M., Nass, R., Perez-Tilve, D.,
Pfluger, P. T., Schwartz, T. W., Seeley, R. J., Sleeman, M., Sun, Y., Sussel, L., Tong, J., Thorner,
M. O., van der Lely, A. J., van der Ploeg, L. H., Zigman, J. M., Kojima, M., Kangawa, K., Smith, R.
G., Horvath, T., and Tschop, M. H. 2015. 'Ghrelin', Mol Metab, 4: 437-60. - 384
292 - Diano, S., Horvath, B., Urbanski, H. F., Sotonyi, P., and Horvath, T. L. 2003. 'Fasting
Activates the Nonhuman Primate Hypocretin (Orexin) System and Its Postsynaptic Targets',
Endocrinology, 144: 3774-8. - 385
293 - Lawrence, C. B., Snape, A. C., Baudoin, F. M., and Luckman, S. M. 2002. 'Acute
Central Ghrelin and Gh Secretagogues Induce Feeding and Activate Brain Appetite Centers',
Endocrinology, 143: 155-62. - 109
294 - Perello, M., Sakata, I., Birnbaum, S., Chuang, J. C., Osborne-Lawrence, S., Rovinsky,
S. A., Woloszyn, J., Yanagisawa, M., Lutter, M., and Zigman, J. M. 2010. 'Ghrelin Increases the
Rewarding Value of High-Fat Diet in an Orexin-Dependent Manner', Biol Psychiatry, 67: 880-6. - 386

169

295 - Sheng, Z., Santiago, A. M., Thomas, M. P., and Routh, V. H. 2014. 'Metabolic
Regulation of Lateral Hypothalamic Glucose-Inhibited Orexin Neurons May Influence Midbrain
Reward Neurocircuitry', Mol Cell Neurosci, 62: 30-41. - 387
296 - Beier, K. T., Steinberg, E. E., DeLoach, K. E., Xie, S., Miyamichi, K., Schwarz, L., Gao,
X. J., Kremer, E. J., Malenka, R. C., and Luo, L. 2015. 'Circuit Architecture of Vta Dopamine
Neurons Revealed by Systematic Input-Output Mapping', Cell, 162: 622-34. - 388
297 - Cone, J. J., McCutcheon, J. E., and Roitman, M. F. 2014. 'Ghrelin Acts as an Interface
between Physiological State and Phasic Dopamine Signaling', J Neurosci, 34: 4905-13. - 389
298 - Goforth, P. B., Leinninger, G. M., Patterson, C. M., Satin, L. S., and Myers, M. G., Jr.
2014. 'Leptin Acts Via Lateral Hypothalamic Area Neurotensin Neurons to Inhibit Orexin Neurons by
Multiple Gaba-Independent Mechanisms', J Neurosci, 34: 11405-15. - 108
299 - Munzberg, H., Huo, L., Nillni, E. A., Hollenberg, A. N., and Bjorbaek, C. 2003. 'Role of
Signal Transducer and Activator of Transcription 3 in Regulation of Hypothalamic
Proopiomelanocortin Gene Expression by Leptin', Endocrinology, 144: 2121-31. - 391
300 - Toshinai, K., Date, Y., Murakami, N., Shimada, M., Mondal, M. S., Shimbara, T., Guan,
J. L., Wang, Q. P., Funahashi, H., Sakurai, T., Shioda, S., Matsukura, S., Kangawa, K., and
Nakazato, M. 2003. 'Ghrelin-Induced Food Intake Is Mediated Via the Orexin Pathway',
Endocrinology, 144: 1506-12. - 393
301 - Fernandes, M. F., Matthys, D., Hryhorczuk, C., Sharma, S., Mogra, S., Alquier, T., and
Fulton, S. 2015. 'Leptin Suppresses the Rewarding Effects of Running Via Stat3 Signaling in
Dopamine Neurons', Cell Metab, 22: 741-9. - 394
302 - Fulton, S., Pissios, P., Manchon, R. P., Stiles, L., Frank, L., Pothos, E. N., MaratosFlier, E., and Flier, J. S. 2006. 'Leptin Regulation of the Mesoaccumbens Dopamine Pathway',
Neuron, 51: 811-22. - 395
303 - Jerlhag, E., Egecioglu, E., Dickson, S. L., and Engel, J. A. 2010. 'Ghrelin Receptor
Antagonism Attenuates Cocaine- and Amphetamine-Induced Locomotor Stimulation, Accumbal
Dopamine Release, and Conditioned Place Preference', Psychopharmacology (Berl), 211: 415-22. 396
304 - Louis, G. W., Leinninger, G. M., Rhodes, C. J., and Myers, M. G., Jr. 2010. 'Direct
Innervation and Modulation of Orexin Neurons by Lateral Hypothalamic Leprb Neurons', J Neurosci,
30: 11278-87. - 102
305 - Teske, J. A., Billington, C. J., and Kotz, C. M. 2014. 'Mechanisms Underlying Obesity
Resistance Associated with High Spontaneous Physical Activity', Neuroscience, 256: 91-100. - 397
306 - Greenwood, B. N., Foley, T. E., Le, T. V., Strong, P. V., Loughridge, A. B., Day, H. E.,
and Fleshner, M. 2011. 'Long-Term Voluntary Wheel Running Is Rewarding and Produces Plasticity
in the Mesolimbic Reward Pathway', Behav Brain Res, 217: 354-62. - 398
307 - Mathes, W. F., Nehrenberg, D. L., Gordon, R., Hua, K., Garland, T., Jr., and Pomp, D.
2010. 'Dopaminergic Dysregulation in Mice Selectively Bred for Excessive Exercise or Obesity',
Behav Brain Res, 210: 155-63. - 399
308 - Berridge, K. C. 2009. ''Liking' and 'Wanting' Food Rewards: Brain Substrates and Roles
in Eating Disorders', Physiol Behav, 97: 537-50. - 400
309 - Sharma, S., Hryhorczuk, C., and Fulton, S. 2012. 'Progressive-Ratio Responding for
Palatable High-Fat and High-Sugar Food in Mice', J Vis Exp: e3754. - 401
170

310 - Meister, B., Perez-Manso, M., and Daraio, T. 2013. 'Delta-Like 1 Homologue Is a
Hypothalamus-Enriched Protein That Is Present in Orexin-Containing Neurones of the Lateral
Hypothalamic Area', J Neuroendocrinol, 25: 617-25. - 402
311 - Villanueva, C., Jacquier, S., and de Roux, N. 2012. 'Dlk1 Is a Somato-Dendritic Protein
Expressed in Hypothalamic Arginine-Vasopressin and Oxytocin Neurons', PLoS One, 7: e36134. 403
312 - Jennings, J. H., Rizzi, G., Stamatakis, A. M., Ung, R. L., and Stuber, G. D. 2013. 'The
Inhibitory Circuit Architecture of the Lateral Hypothalamus Orchestrates Feeding', Science, 341:
1517-21. - 405
313 - Cador, M., Kelley, A. E., Le Moal, M., and Stinus, L. 1986. 'Ventral Tegmental Area
Infusion of Substance P, Neurotensin and Enkephalin: Differential Effects on Feeding Behavior',
Neuroscience, 18: 659-69. - 25
314 - Schone, C., Venner, A., Knowles, D., Karnani, M. M., and Burdakov, D. 2011.
'Dichotomous Cellular Properties of Mouse Orexin/Hypocretin Neurons', J Physiol, 589: 2767-79. 48
315 - Giros, B., Jaber, M., Jones, S. R., Wightman, R. M., and Caron, M. G. 1996.
'Hyperlocomotion and Indifference to Cocaine and Amphetamine in Mice Lacking the Dopamine
Transporter', Nature, 379: 606-12. - 407
316 - Sumithran, P., and Proietto, J. 2013. 'The Defence of Body Weight: A Physiological
Basis for Weight Regain after Weight Loss', Clin Sci (Lond), 124: 231-41. - 461
317 - Sumithran, P., Prendergast, L. A., Delbridge, E., Purcell, K., Shulkes, A., Kriketos, A.,
and Proietto, J. 2011. 'Long-Term Persistence of Hormonal Adaptations to Weight Loss', N Engl J
Med, 365: 1597-604. - 460
318 - Wing, R. R., and Hill, J. O. 2001. 'Successful Weight Loss Maintenance', Annu Rev
Nutr, 21: 323-41. - 813
319 - Fothergill, E., Guo, J., Howard, L., Kerns, J. C., Knuth, N. D., Brychta, R., Chen, K. Y.,
Skarulis, M. C., Walter, M., Walter, P. J., and Hall, K. D. 2016. 'Persistent Metabolic Adaptation 6
Years after "the Biggest Loser" Competition', Obesity (Silver Spring), 24: 1612-9. - 462
320 - Burdakov, D., Luckman, S. M., and Verkhratsky, A. 2005. 'Glucose-Sensing Neurons of
the Hypothalamus', Philos Trans R Soc Lond B Biol Sci, 360: 2227-35. - 814
321 - Venner, A., Karnani, M. M., Gonzalez, J. A., Jensen, L. T., Fugger, L., and Burdakov,
D. 2011. 'Orexin Neurons as Conditional Glucosensors: Paradoxical Regulation of Sugar Sensing by
Intracellular Fuels', J Physiol, 589: 5701-8. - 42
322 - Pei, H., Sutton, A. K., Burnett, K. H., Fuller, P. M., and Olson, D. P. 2014. 'Avp Neurons
in the Paraventricular Nucleus of the Hypothalamus Regulate Feeding', Mol Metab, 3: 209-15. - 815
323 - Mann, T., Tomiyama, A. J., Westling, E., Lew, A. M., Samuels, B., and Chatman, J.
2007. 'Medicare's Search for Effective Obesity Treatments: Diets Are Not the Answer', Am Psychol,
62: 220-33. - 439
324 - Salamone, J. D., and Correa, M. 2012. 'The Mysterious Motivational Functions of
Mesolimbic Dopamine', Neuron, 76: 470-85. - 480

171

325 - Novak, C. M., Burghardt, P. R., and Levine, J. A. 2012. 'The Use of a Running Wheel
to Measure Activity in Rodents: Relationship to Energy Balance, General Activity, and Reward',
Neurosci Biobehav Rev, 36: 1001-14. - 805
326 - Sclafani, A. 2006. 'Sucrose Motivation in Sweet "Sensitive" (C57bl/6j) and
"Subsensitive" (129p3/J) Mice Measured by Progressive Ratio Licking', Physiol Behav, 87: 734-44. 808
327 - Saper, C. B., Fuller, P. M., Pedersen, N. P., Lu, J., and Scammell, T. E. 2010. 'Sleep
State Switching', Neuron, 68: 1023-42. - 90
328 - Whiddon, B. B., and Palmiter, R. D. 2013. 'Ablation of Neurons Expressing MelaninConcentrating Hormone (Mch) in Adult Mice Improves Glucose Tolerance Independent of Mch
Signaling', J Neurosci, 33: 2009-16. - 810
329 - Soleymani, T., Daniel, S., and Garvey, W. T. 2016. 'Weight Maintenance: Challenges,
Tools and Strategies for Primary Care Physicians', Obes Rev, 17: 81-93. - 271
330 - Zhou, Q. Y., and Palmiter, R. D. 1995. 'Dopamine-Deficient Mice Are Severely
Hypoactive, Adipsic, and Aphagic', Cell, 83: 1197-209. - 492
331 - St-Gelais, F., Legault, M., Bourque, M. J., Rompre, P. P., and Trudeau, L. E. 2004.
'Role of Calcium in Neurotensin-Evoked Enhancement in Firing in Mesencephalic Dopamine
Neurons', J Neurosci, 24: 2566-74. - 61
332 - Rolls, B. J., and Phillips, P. A. 1990. 'Aging and Disturbances of Thirst and Fluid
Balance', Nutr Rev, 48: 137-44. - 817
333 - Morley, J. E. 2015. 'Dehydration, Hypernatremia, and Hyponatremia', Clin Geriatr Med,
31: 389-99. - 826
334 - Mackenbach, J. P., Borst, V., and Schols, J. M. 1997. 'Heat-Related Mortality among
Nursing-Home Patients', Lancet, 349: 1297-8. - 827
335 - Hawken, E. R., Crookall, J. M., Reddick, D., Millson, R. C., Milev, R., and Delva, N.
2009. 'Mortality over a 20-Year Period in Patients with Primary Polydipsia Associated with
Schizophrenia: A Retrospective Study', Schizophr Res, 107: 128-33. - 824
336 - Thomas, C. E., Mauer, E. A., Shukla, A. P., Rathi, S., and Aronne, L. J. 2016. 'Low
Adoption of Weight Loss Medications: A Comparison of Prescribing Patterns of Antiobesity
Pharmacotherapies and Sglt2s', Obesity (Silver Spring), 24: 1955-61. - 821
337 - Bessesen, D. H., and Van Gaal, L. F. 2017. 'Progress and Challenges in Anti-Obesity
Pharmacotherapy', Lancet Diabetes Endocrinol. - 820
338 - Gadde, K. M., Yonish, G. M., Foust, M. S., and Wagner, H. R. 2007. 'Combination
Therapy of Zonisamide and Bupropion for Weight Reduction in Obese Women: A Preliminary,
Randomized, Open-Label Study', J Clin Psychiatry, 68: 1226-9. - 822
339 - Hara, J., Beuckmann, C. T., Nambu, T., Willie, J. T., Chemelli, R. M., Sinton, C. M.,
Sugiyama, F., Yagami, K., Goto, K., Yanagisawa, M., and Sakurai, T. 2001. 'Genetic Ablation of
Orexin Neurons in Mice Results in Narcolepsy, Hypophagia, and Obesity', Neuron, 30: 345-54. - 760

172