INVESTIGATIONS ON THE INTRICATE INTERACTIONS BETWEEN EPIZOOTIC
EPITHELIOTROPIC DISEASE VIRUS (SALMONID HERPESVIRUS-3) AND ITS HOST,
THE LAKE TROUT (SALVELINUS NAMAYCUSH)
By
Megan Ann Shavalier

A DISSERTATION
Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of
Comparative Medicine and Integrative Biology–Doctor of Philosophy
2017

ABSTRACT
INVESTIGATIONS ON THE INTRICATE INTERACTIONS BETWEEN EPIZOOTIC
EPITHELIOTROPIC DISEASE VIRUS (SALMONID HERPESVIRUS-3) AND ITS HOST,
THE LAKE TROUT (SALVELINUS NAMAYCUSH)
By
Megan Ann Shavalier
Epizootic Epitheliotropic Disease Virus (EEDV; Salmonid Herpesvirus-3) is an
Alloherpesvirus (Order Herpesvirales) capable of causing severe morbidity and mortality in lake
trout (Salvelinus namaycush). After several decades of absence, EEDV re-emerged in the Great
Lakes basin and was the causative agent of substantial mortality events in fingerling and two
year old lake trout in 2012 and 2017 respectively. This resurgence highlighted the challenges
associated with managing an infectious disease when many questions remain regarding its
biological and pathological properties. As a result, several studies were designed in order to
advance our knowledge of viral targets, disease progression, and the availability of research
models and diagnostic assays. As EEDV cannot be propagated in vitro, I first aimed to determine
the in vivo viral exposure dose required to cause clinical disease consistent with that seen in
natural outbreaks of EEDV. Results revealed that 103 viral copies per mL of immersion bath
water is not a sufficient dose to produce clinical disease, while 106 viral copies per mL of water
can produce up to 100% mortality. Utilizing this predetermined dose range, I then assessed the
temporal course of an EEDV infection by determining the sequential distribution of virus and
identification of specific viral target tissues and cells using quantitative PCR and in situ
hybridization assays. Following exposure of naïve juvenile lake trout to EEDV, the virus first
targeted the epidermis of the skin and fins followed by the epithelial lining of primary and
secondary gill lamellae and eventually infection of endothelial cells and monocytes resulting in

viremia and disseminated infection of multiple visceral organs. However, viral titers remained
significantly higher among external tissues compared to visceral organs throughout the study.
Subsequently, in order to elucidate a more comprehensive understanding of the pathologic
changes associated with EEDV infection, I next examined sequential gross and pathological
alterations in lake trout tissues. After an extended incubation period, severe pathology was first
observed grossly and microscopically in the cutaneous epithelium followed by the hematopoietic
organs and vessels during the later viremic stage of disease. Following these advancements in
our understanding of EEDV-lake trout interactions and associated pathology, my focus shifted to
expanding future experimental and diagnostic capabilities. First, I produced two novel cell lines
of lake trout origin. With the limited number of commercially available aquatic cell lines, and
none originating from lake trout, diagnosis of, and research into lake trout specific immunology
or disease pathology, has been hampered. The successful production of primary cultures from
adult liver, yearling fin, yearling gonad and fry body cells of lake trout origin, contributes to
what was previously a void in salmonid tissue culture options. Without an established in vitro
model of EEDV replication to date, there was a need for a diagnostic assay that was not only
sensitive and specific, but also time and cost effective, leading to the development of a loop
mediated isothermal amplification (LAMP) assay for the quantitative diagnosis of EEDV in fish
tissues. This assay is highly specific for the EEDV glycoprotein gene, is cost effective, and has
the potential for commercialization and use in field conditions. The end result of this dissertation
is the uncovering of new insights on EEDV ecology, and a significant advancement in our
understanding of EEDV-lake trout interactions.

This dissertation is dedicated to Ann Fee Elliott, the woman who taught me to treasure the
natural world around us and to do so with grace and compassion and love.

iv

ACKNOWLEDGEMENTS

I would like to start by sincerely thanking my major advisor, my mentor, Dr. Mohamed
Faisal. Over the past ten and a half years you have not only given me the opportunity to
participate in significant and ground breaking research, and taught me the value of hard work,
you have also introduced me to a world of aquatic animal medicine I didn’t know existed. Most
importantly however, you have taught me to be a scholar, to always reach for more, and to
always have confidence in my training, my knowledge and myself. I can never thank you enough
for the role you had in shaping who I am today.
I would also like to thank the rest of my guidance committee, Dr. Scott Fitzgerald, Dr.
Jun Li, and Dr. Kristin Parent, for their counsel and assistance throughout my graduate work. In
addition I offer my heartfelt thanks to everyone in the CMIB program who helped to guide me
throughout this tortuous journey, including Dimity Palazzola, Dr. Linda Mansfield and of course,
our fearless leader, Dr. Vilma Yuzbasiyan-Gurkan.
I am incredibly fortunate to have had the opportunity to work with an awesome group of
people in the Aquatic Animal Health Lab. Thank you for your friendship, for your mentorship,
for your assistance, and on those days when it seemed I would never finish, for being the proof
that yes, it can be done. Thank you Dr. Thomas Loch, Michelle Van Deuren, Dr. Isaac Standish,
Dr. Danielle Van Vliet, Dr. Andrew Winters, Dr. Traimat Boonthai, Elizabeth Throckmorton,
Dr. Robert Kim, Dr. Elena Millard, and Dr. Carolyn Richards for showing me the type of
scientist I hope to be. And thank you to Chris Knupp, Aji Purbayu, Heather Brownlee, Taylor
Schoen, Morgan Burke, Jenny Southwell, Steven Sisolak, Nadine Bratu, Amber Johnston, and

v

Lauren Eby for your friendship, assistance and support. I would not be where I am today without
all of you.
I would also like to acknowledge the generous support of all of the funding agencies,
without whom this work would not have been accomplished. Thank you to the Great Lakes
Fishery Trust, the National Institute of Health, the MSU Graduate Office, the Schrems West
Michigan Chapter of Trout Unlimited, and Hal and Jean Glassen. I would also like to thank the
Michigan Department of Natural Resources and Marquette State Fish Hatchery for not only
providing the fish for my research, but also for caring about the health of these fish, for
understanding the importance of the work I’ve been doing and for being willing to implement
change. Your enthusiasm and cooperation allows my work to have a much greater impact.
To my friends and my family, your continued support and patience through this process
has meant the world to me. Mom and Dad, Gwen and Ron, and Tess, my favorite sister, you kept
me sane, you kept me focused and you kept me fed. I could not have asked for more. Hermes and
Rowen, I promise your time of midnight dinners is almost at an end. To Uncle John and Uncle
Rob, I am proud to be the third generation “fish person” in the family, thank you for paving the
way. To all of you, and all the rest, and those who are no longer with us, I love you and would
not be who and where I am today without each and every one of you.

vi

TABLE OF CONTENTS

LIST OF TABLES ....................................................................................................................... xi
LIST OF FIGURES ................................................................................................................... xiii
KEY TO ABBREVIATIONS ................................................................................................... xix
Introduction ....................................................................................................................................1
Chapter 1. Literature Review .......................................................................................................7
1. Fish Pathogens .......................................................................................................................8
1.1. Overview .......................................................................................................................8
1.2. Immunology ..................................................................................................................9
1.3. Treatment ....................................................................................................................10
2. Fish Viruses .........................................................................................................................11
2.1. Overview .....................................................................................................................11
2.2. OIE reportable diseases...............................................................................................12
3. Order Herpesvirales .............................................................................................................13
4. Family Alloherpesviridae.....................................................................................................15
4.1. Classification...............................................................................................................15
4.2. Clinical presentation and latency ................................................................................15
4.3. Specific Alloherpesviruses..........................................................................................16
4.3.1. Genus Cyprinivirus ............................................................................................16
4.3.2. Genus Ictalurivirus .............................................................................................17
4.3.3. Genus Salmonivirus ...........................................................................................19
5. Epizootic Epitheliotropic Disease Virus (EEDV)................................................................21
5.1. Initial epidemics ..........................................................................................................21
5.2. Pathogen identification ...............................................................................................22
5.3. Disease management ...................................................................................................23
5.4. Early pathogenesis studies ..........................................................................................24
6. Lake trout (Salvelinus namaycush) ......................................................................................25
7. Diagnostic Tools ..................................................................................................................26
7.1. Cell culture ..................................................................................................................26
7.2. Imaging .......................................................................................................................28
7.3. Molecular techniques ..................................................................................................29
7.3.1. PCR ....................................................................................................................29
7.3.2. LAMP ................................................................................................................30
8. Knowledge Gaps and Study Objectives ...............................................................................31
APPENDIX ..............................................................................................................................36
Chapter 2. Resurgence of Salmonid Herpesvirus-3 infection (Epizootic Epitheliotropic
Disease) in hatchery propagated lake trout (Salvelinus namaycush) in Michigan ................39
1. Abstract ................................................................................................................................40

vii

2. Introduction ..........................................................................................................................41
3. Materials and Methods .........................................................................................................42
3.1. Lake trout mortality events .........................................................................................42
3.2. Clinical examination ...................................................................................................43
3.3. Bacteriology ................................................................................................................43
3.4. Virus isolation .............................................................................................................44
3.5. Histopathology ............................................................................................................44
3.6. Molecular analysis ......................................................................................................45
3.7. Gene sequencing and phylogenetic analysis ...............................................................47
3.8. Pilot experimental challenges .....................................................................................48
3.9. Intra- and extra-hatchery EEDV surveillance .............................................................50
4. Results ..................................................................................................................................51
4.1. Description of MSFH mortality events .......................................................................51
4.2. Clinical examination ...................................................................................................52
4.3. Bacterial and viral isolation ........................................................................................53
4.4. Histopathology ............................................................................................................53
4.5. Molecular identification ..............................................................................................53
4.6. Sequencing and phylogenetics ....................................................................................54
4.7. Pilot experimental challenges .....................................................................................55
4.8. Intra- and extra-hatchery EEDV surveillance .............................................................55
5. Discussion ............................................................................................................................56
APPENDIX ..............................................................................................................................63
Chapter 3. Evaluation of the dose-dependent effects following in vivo infection with
Epizootic Epitheliotropic Disease Virus (EEDV; Salmonid Herpesvirus-3) ..........................73
1. Abstract ................................................................................................................................74
2. Introduction ..........................................................................................................................75
3. Materials and Methods .........................................................................................................76
3.1. Fish and maintenance ..................................................................................................76
3.2. EEDV in vivo serial passages and stock production ...................................................77
3.3. Virus detection and quantification ..............................................................................78
3.4. Experimental challenges .............................................................................................79
3.4.1. Dose range determination ..................................................................................79
3.4.2. Repeatability ......................................................................................................80
4. Results ..................................................................................................................................80
4.1. EEDV in vivo serial passages .....................................................................................80
4.2. Morbidity and mortality response to varying doses of EEDV ....................................81
4.3. Immersion model reproducibility ...............................................................................81
5. Discussion ............................................................................................................................82
APPENDIX ..............................................................................................................................87
Chapter 4. Progression of Epizootic Epitheliotropic Disease Virus (Salmonid Herpesvirus3) in target tissues and cells of its host, the lake trout (Salvelinus namaycush)......................94
1. Abstract ................................................................................................................................95
2. Introduction ..........................................................................................................................96
3. Materials and Methods .........................................................................................................98

viii

3.1. Fish and maintenance ..................................................................................................98
3.2. Infectious virus stock ..................................................................................................99
3.3. Experimental challenge .............................................................................................100
3.4. Sample collection ......................................................................................................100
3.5. Quantification of EEDV DNA in tissues ..................................................................101
3.6. Statistical analysis .....................................................................................................101
3.7. Design and preparation of ISH probes ......................................................................102
3.8. Performance of ISH on fixed tissue sections ............................................................102
4. Results ................................................................................................................................104
4.1. Clinical disease, morbidity and mortality .................................................................104
4.2. Quantification of EEDV DNA ..................................................................................104
4.3. Design and verification of ISH assay........................................................................106
4.4. Visualization of EEDV-infected tissues and cells ....................................................107
5. Discussion ..........................................................................................................................108
APPENDIX ............................................................................................................................112
Chapter 5. Development and progression of gross and microscopic lesions in lake trout
(Salvelinus namaycush) experimentally infected with Epizootic Epitheliotropic Disease
Virus (Salmonid Herpesvirus-3) ...............................................................................................123
1. Abstract ..............................................................................................................................124
2. Introduction ........................................................................................................................125
3. Materials and Methods .......................................................................................................127
3.1. Fish and maintenance ................................................................................................127
3.2. Virus..........................................................................................................................128
3.3. Experimental challenge .............................................................................................129
3.4. Sample collection and preparation ............................................................................129
3.5. Virus detection ..........................................................................................................130
3.6. Histopathology and lesion scoring ............................................................................130
4. Results ................................................................................................................................131
4.1. Clinical disease and mortalities ................................................................................131
4.2. Virus identification ...................................................................................................132
4.3. Microscopic lesions and scoring ...............................................................................132
5. Discussion ..........................................................................................................................135
APPENDIX ............................................................................................................................139
Chapter 6. Establishment and characterization of two novel cell lines from lake trout
(Salvelinus namaycush) ..............................................................................................................148
1. Abstract ..............................................................................................................................149
2. Introduction ........................................................................................................................149
3. Materials and Methods .......................................................................................................151
3.1. Fish and tissue collection ..........................................................................................151
3.2. Isolation and in vitro culture of primary cells ...........................................................153
3.3. Routine subculture ....................................................................................................154
3.4. Optimization of culture conditions ...........................................................................155
3.4.1. Influence of temperature on cell growth ..........................................................155
3.4.2. Influence of serum type and concentration on cell growth ..............................155

ix

3.4.3. Influence of growth medium base on cell growth ...........................................155
3.5. Confirmation of species of origin .............................................................................156
3.6. Viral susceptibility ....................................................................................................157
3.6.1. Quantification of viral DNA ............................................................................158
4. Results ................................................................................................................................158
4.1. Primary culture and routine subculture .....................................................................158
4.2. Optimization of culture conditions ...........................................................................160
4.2.1. Influence of temperature on cell growth ..........................................................160
4.2.2. Influence of serum type and concentration on cell growth ..............................160
4.2.3. Influence of growth medium base on cell growth ...........................................161
4.3. Morphologic characteristics ......................................................................................161
4.4. Confirmation of species of origin .............................................................................162
4.5. Virus susceptibility ...................................................................................................162
5. Discussion ..........................................................................................................................163
APPENDIX ............................................................................................................................167
Chapter 7. Development of a loop-mediated isothermal amplification (LAMP) assay for the
detection and quantification of Epizootic Epitheliotropic Disease Virus (Salmonid
Herpesvirus-3) in lake trout (Salvelinus namaycush) .............................................................178
1. Abstract ..............................................................................................................................179
2. Introduction ........................................................................................................................179
3. Materials and Methods .......................................................................................................181
3.1. Virus and template DNA ..........................................................................................181
3.2. Primers and LAMP design ........................................................................................181
3.3. Analytical specificity of the EEDV LAMP assay.....................................................183
3.4. Analytical sensitivity of the EEDV LAMP assay .....................................................183
3.5. Quantitative EEDV LAMP assay .............................................................................183
3.6. Evaluation of the EEDV LAMP assay on samples ...................................................184
4. Results ................................................................................................................................185
4.1. Optimization of the EEDV LAMP reaction..............................................................185
4.2. Analytical specificity of the EEDV LAMP assay.....................................................185
4.3. Analytical sensitivity of the EEDV LAMP assay .....................................................186
4.4. Quantitative EEDV LAMP and validation against SYBR Green qPCR ..................186
5. Discussion ..........................................................................................................................187
APPENDIX ............................................................................................................................190
Chapter 8. Conclusions and future research ...........................................................................199
1. Conclusions ........................................................................................................................200
2. Future Research .................................................................................................................205
REFERENCES...........................................................................................................................209

x

LIST OF TABLES

Table 2.1 Number of positive fish detected by EEDV screening at Marquette State Fish
Hatchery, 2007-2017 (number positive / number tested). Sampling during mortality episodes
denoted by a (*). Tissues tested included kidney (K), spleen (Sp), heart (H), mucous (M), gill
(G), skin (Sk), fin (F), and eye (E) and were either pooled (i.e., KSpH) or individual (i.e., K, Sp,
H). All samples tested using EEDV TaqMan qPCR as described, except where indicated: (!)
tested with EEDV SYBR green qPCR, (§) tested with both qPCR assays....................................66
Table 2.2 EEDV screening in Cherry Creek, 2011-2017. No sampling was associated with a
mortality episode. All testing performed in pools of five fish per pool. All samples tested using
EEDV TaqMan qPCR as described, except where indicated: (!) tested with EEDV SYBR green
qPCR. .............................................................................................................................................67
Table 3.1 Mortality data following in vivo passage of EEDV stocks. Virus stock passage #
represents stock batch used to infect specified group of fish. Method of Infection: (IP) =
intraperitoneal injection; (Imm) = Immersion bath. Dose received is presented in viral copies per
fish (IP) or viral copies per mL water (Imm). First and last mortalities presented as days post
virus exposure. Viral titers calculated per mg skin tissue from infected fish following mortality.88
Table 3.2 Dose-dependent mortalities and qPCR identification of EEDV following experimental
exposure of naïve, juvenile lake trout (Salvelinus namaycush). Negative control mortalities
showed no evidence of EEDV infection. .......................................................................................91
Table 3.3 Calculated lethal immersion doses of EEDV based on dose dependent cumulative
mortalities and calculated following methods developed by Reed and Muench (1938). ..............92
Table 3.4. Mortalities and EEDV qPCR results following immersion challenge for repeatability.
All high dose fish were exposed to 9.5x106 viral copies per mL immersion water. Positive
control fish received 2.85x109 viral copies per fish. Viral titers presented as a low-high range of
viral copies per mg of skin tissue...................................................................................................93
Table 4.1 Identification of EEDV DNA in various tissues of experimentally challenged lake
trout (Salvelinus namaycush) sampled in parallel on pre-determined days (n = 6 fish/day) after
exposure to the virus using qPCR. “+” indicates identification of EEDV DNA in designated fish
and tissue; “−” indicates no detectible EEDV DNA. ...................................................................113
Table 4.2 EEDV glycoprotein gene copies per mg tissue by day post-infection following
experimental exposure of lake trout to the virus via immersion bath as calculated using SYBR
qPCR. Data points marked with a “--“ indicate no virus detected. ‡All tissues from all fish tested
prior to Day 18 showed no detectible levels of EEDV except the eye of a single fish on Day 9
(3.81x104 copies/mg). ..................................................................................................................114

xi

Table 5.1 Summary of gross pathologic changes observed following immersion challenge of
naïve juvenile lake trout with EEDV. ..........................................................................................141
Table 5.2 Identification of EEDV genomic material in tissues of experimentally challenged lake
trout (Salvelinus namaycush) collected in parallel on predetermined days using a SYBR Green
qPCR assay. “-“ indicates no EEDV genetic material; “+” indicates presence of EEDV DNA. 142
Table 5.3 Summary of histopathologic changes on all sampling days. No appreciable lesions
were observed in the eyes or brains, on any days. .......................................................................143
Table 7.1 Primers used for EEDV loop-mediated isothermal amplification. .............................191
Table 7.2 Results of EEDV LAMP temperature optimization. Mean and standard deviation
produced from duplicate repeats of LAMP assay. .......................................................................192
Table 7.3 Results of MgCl2 and dNTP concentration optimization for EEDV LAMP. Mean and
standard deviation produced from duplicate repeats of LAMP assay. ........................................193
Table 7.4 Comparison of SYBR Green qPCR assay (14) results and newly developed qLAMP
assay results performed on 100 experimental samples of lake trout skin tissue. Data is presented
as viral copies per reaction (50 ng template DNA added to each reaction, qPCR and qLAMP).
There was no statistical difference between qPCR and qLAMP quantification (p > 0.05) using a
paired t test run in SAS software, Version 9.4 of the SAS System (© 2017 SAS Institute Inc.).198

xii

LIST OF FIGURES

Figure 1.1 Cladogram depicting relationships of select viruses within the order Herpesvirales
and between the families Herpesviridae, Malacoherpesviridae and Alloherpesviridae (modified
from Waltzek et al. (2009) (1)). .....................................................................................................37
Figure 1.2 Phylogram depicting relationships of the four genera within the Alloherpesviridae
family (modified from Waltzek et al. (2009) (1) and Glenney et al. (2016) (14)). .......................38
Figure 2.1 Layout depicting water flow within spatially separated broodstock and production
raceway buildings at Marquette State Fish Hatchery; (A) production raceways in 2012; (B)
broodstock raceways in 2017. Numbered circles represent order of disease progression
through production lake trout in 2012 and broodstock in 2017. Stars indicate raceways from
which EEDV genomic material was detected with no associated mortalities. .............................64
Figure 2.2 Cumulative percent mortalities during the 2012 mortality event at MSFH among
juvenile production lake trout, by rearing unit raceway. Prior to mortality event, production fish
numbers were approximately as follows: (4A) 125,105 fish; (4B) 124,782 fish; (5A) 75,031 fish;
(5B) 76,085 fish; and (6) 56,167 fish.............................................................................................65
Figure 2.3 Gross clinical signs exhibited by lake trout naturally infected with EEDV in 2012;
Lake Superior lake trout (A, D, E, G) and Seneca Lake lake trout (B, C, F, H). (A) advanced
stage ocular degeneration with hemorrhage and corneal opacity; (B) ocular hemorrhage; (C)
diffuse skin “blotchiness”, dermal erosion and excess mucous production; (D) dermal erosion,
“blotchiness” and erythema, anal fin congestion; (E) dermal erosion, ulceration of trunk and
caudal peduncle; (F) caudal peduncle ulceration, necrosis and dermal erosion; (G) ocular
degeneration with substantial water mold overgrowth; (H) caudal fin ulceration with exposed
vertebrae; (I) caudal fin ulceration, necrosis, petechial hemorrhage and yellow discoloration,
exposed fin rays. ............................................................................................................................68
Figure 2.4 Gross clinical signs exhibited by Lake Superior strain lake trout naturally infected
with EEDV in 2017. (A) ocular hemorrhage and ulceration; (B) cranial epithelial erosion,
ulceration and hemorrhage; (C) skin erosion, ulceration and hemorrhage of trunk and dorsum;
(D) skin ulceration with secondary overgrowth and hemorrhagic margins. ..................................69
Figure 2.5 Hematoxylin and eosin (H&E) stained tissue sections from hatchery-reared lake trout
that were naturally infected with Epizootic Epitheliotropic Disease Virus. A) corneal epithelial
ulceration and necrosis (400x magnification); B) epithelial ulceration and necrosis of the skin
(400x magnification); C) gill lamellar edema (400x magnification); D) gill epithelial
swelling/hypertrophy (400x magnification); E) proteinaceous exudate within both Bowman’s
space and the renal tubular epithelium (400x magnification); and F) renal tubular epithelial
necrosis and multifocal necrosis of the renal interstitium (400x magnification)...........................70

xiii

Figure 2.6 Dendrogram depicting the relationships of eight Epizootic Epitheliotropic Disease
Virus (EEDV) isolates (denoted in bold) from the 2012 and 2017 hatchery outbreaks with
isolates representing the five currently described salmonid herpesviruses. The dendrogram was
generated in MRBAYES 3.1.2 (120) using the Kimura Two Parameter model with gamma
distribution based upon the lowest Bayesian Information Criterion. The Markov chains (n = 4)
were run until an average standard deviation of split frequencies of < 0.01 was attained. Two
independent analyses were conducted, with the initial 25% of Markov chain Monte Carlo
samples being discarded as burnin. Posterior probabilities > 70 are displayed at the nodes, where
an * denotes that the same node was supported in Neighbor-Joining analysis (i.e., boot strap
value > 70). The final data set contained 303 bp of the terminase gene. ......................................71
Figure 2.7 Gross pathology associated with experimentally challenged lake trout. (A) ocular
hemorrhage; (B) multifocal pallor, skin and fin erosion; (C) generalized pallor with skin and fin
erosion. ...........................................................................................................................................72
Figure 3.1 Typical gross pathology observed following experimental infection of juvenile lake
trout (Salvelinus namaycush) with EEDV. A) multifocal skin erosions with erythema and excess
mucous accumulation; B) ocular hemorrhage; C) anal and caudal fin erosion with congestion,
caudal peduncle erosion with erythema, generalized pallor; D) normal skin. ...............................89
Figure 3.2 Dose-dependent percent cumulative mortality of juvenile lake trout (Salvelinus
namaycush) following immersion bath exposure to EEDV. Doses presented as a base-10 log of
the number of copies per mL immersion bath water. ....................................................................90
Figure 3.3 Box plot highlighting calculated lethal immersion doses of EEDV based on dose
dependent cumulative mortalities and calculated following methods developed by Reed and
Muench (1938) (127). Lower hash mark represents LD10 (i.e., dose required to cause 10%
mortality), lower box margin represents LD25, middle box bar represents LD50, upper box bar
represents LD75, and upper hash mark represents LD90. ................................................................92
Figure 4.1 Box plots showing minimum, 1st quartile, median, 3rd quartile and maximum viral
glycoprotein gene copies per mg of tissue by tissue type across all EEDV-positive samples on all
sampling days...............................................................................................................................115
Figure 4.2 Top: Total number of EEDV-positive samples by tissue type across all sampling
days. “*” indicates statistical significance compared to tissues below the horizontal bar; (p <
0.05). Bottom: Median EEDV viral titer by tissue type across all sampling days. “*” indicates
statistical significance compared to tissues below the horizontal bar; (p < 0.01). Error bars
signify one standard deviation. ....................................................................................................116
Figure 4.3 Total number of EEDV-positive samples by tissue type and by sampling day. “*”
indicates statistical significance compared to tissues below the horizontal bar; (p < 0.01).
Additional significant pairwise comparisons not pictured include: liver vs. spleen, heart and brain
on Day 21; spleen vs. kidney, liver, intestine and brain plus heart vs. intestine on Day 35; and
kidney vs. spleen, liver, and brain, plus heart vs. spleen, liver, intestine and brain, plus intestine
vs. spleen and brain on Day 42. ...................................................................................................117

xiv

Figure 4.4 Median EEDV viral titer by tissue type and sampling day. “*” indicates statistical
significance compared to tissues below the horizontal bar; Day 21: p < 0.01 for brain vs. eye and
fin, liver vs. eye and fin and kidney vs. fin; p < 0.05 for all remaining combinations. Day 28: p <
0.01 for all pictured comparisons with the exception of eye vs. heart (p < 0.05); Additional
significant pairings include brain vs. heart, intestine and spleen (p < 0.05). Day 35: p < 0.05. Day
42: p < 0.01 for all skin and eye comparisons, p < 0.05 for all fin comparisons. Error bars signify
one standard deviation. ................................................................................................................118
Figure 4.5 A) Total number of EEDV positive tissues by day and external vs. internal tissue
type. “*” indicates statistical significance compared to tissues below the horizontal bar; p < 0.01
on Days 21, 35 and 42. B) Median EEDV viral titer by tissue type (external vs. internal) and
sampling day. “*” indicates statistical significance compared to tissues below the horizontal bar;
p < 0.01 on all sampling days. .....................................................................................................119
Figure 4.6 Distribution of EEDV within skin lesions of lake trout during early and late stages of
experimental infection. Magnification 400X, Hematoxylin and eosin (A, C, E) and in-situ
hybridization for EEDV (B, D, F) with NBT labeling (blue) and nuclear fast red counterstaining.
Early skin lesions (A, B) are characterized by individual epithelial cell necrosis (A: arrow) and
sloughing of degenerated cells (A: arrowhead). Viral nucleic acid is detected in individual
necrotic epithelial cells (B: arrowhead). At advanced stages (C, D) more widespread epithelial
cell necrosis causes focal erosions (C: arrow) and sloughing of degenerate cells is common (C:
arrowhead). Viral nucleic acid is readily detected in large numbers of degenerate and necrotic
cells that commonly slough off (D: arrowheads). The most severe lesions (E, F) are characterized
by widespread erosions and full thickness necrosis with only a few necrotic (E: arrow) and
degenerate (E: arrowhead) cells clinging to the basement membrane. Viral nucleic acid can be
detected in the vast majority of epithelial cells throughout all layers (F: arrowheads) prior to
epithelial loss. ..............................................................................................................................120
Figure 4.7 Distribution of EEDV within gill lesions of lake trout during early and late stages of
experimental infection. Magnification 400X, Hematoxylin and eosin (A, C, E) and in-situ
hybridization for EEDV (B, D, F) with NBT labeling (blue) and nuclear fast red counterstaining.
Early gill lesions (A, B) are characterized by mild thickening of the primary lamellae, infiltration
of mononuclear cells into the propria (A: arrow), swelling of epithelial cells, congested blood
vessels and few degenerated epithelial cells. Viral nucleic acid is detected in nuclei of
morphologically unremarkable epithelial cells (B: arrowheads). More advanced gill disease (C,
D, E, F) is characterized by loss of secondary lamellae and massive infiltration of mononuclear
cells (C and E: arrows). Viral nucleic acid is detected in attenuated epithelial cells (D: arrow) and
nuclei of infiltrating mononuclear cells (D and F: arrowheads). .................................................121
Figure 4.8 Distribution of EEDV within lesions of internal organs in lake trout during late stages
of experimental infection. Magnification 400X, Hematoxylin and eosin (A, C) and in-situ
hybridization for EEDV (B, D) with NBT labeling (blue) and nuclear fast red counterstaining.
During the later diseases stages lesions develop in internal organs and depletion of lymphoid
cells and multifocal necrosis (arrow) in the spleen (A) is the most prominent finding. Viral
nucleic acid can be detected in large numbers of mononuclear cells in the spleen (B). A severe

xv

lymphhistiocytic perivasculitis (C) also develops secondary to viremia and is most severe in the
omentum, but can also be found in other organs. This perivasculitis is most likely secondary to
viral infection of endothelial cells (D: arrowhead). Viremia is caused by large numbers of
monocytes being infected as evidenced by significant nuclear labeling of mononuclear cells (D:
arrows) within this hepatic vessel. ...............................................................................................122
Figure 5.1 Gross pathology following experimental exposure of naïve juvenile lake trout to
EEDV by bath immersion. A) ocular hemorrhage; B) pectoral fin congestion; C) engorgement or
hyperemia of major hepatic vasculature; D) caudal and anal fin congestion, generalized pallor of
the caudal peduncle, erosion of caudal peduncle and caudal fin. ................................................140
Figure 5.2 Liver collected from negative control fish and lake trout experimentally infected with
EEDV. Magnification 400X. A) negative control, Day 1, severe hepatic lipidosis; B) negative
control, Day 9, moderate hepatic lipidosis; C) infected, Day 18, focal hepatocellular necrosis
(arrow) and lymphohistiocytic perivascular inflammation (arrowhead), severe hepatic lipidosis;
D) infected, Day 42, focal hepatocellular necrosis and lymphohistiocytic inflammation
(arrowhead), mild hepatic lipidosis..............................................................................................144
Figure 5.3 Skin collected from negative control fish and lake trout experimentally infected with
EEDV. Magnification 200X, hematoxylin and eosin staining. A) negative control, Day 35; B)
infected, Day 21, Individual epithelial cell necrosis (arrow) and intracytoplasmic eosinophilic
vacuoles in few cells (arrowhead) as well as rare intraepithelial inflammatory cells are the
earliest lesions; C) infected, Day 21, Early epithelial erosion with sloughing of degenerated
epithelial cells (arrow); D) infected, Day 28, more severe epithelial erosions with extensive
intraepithelial inflammatory infiltrates and cellular degeneration (arrowheads); E) infected, Day
28, Advanced stage with epithelial cells undergoing degeneration and necrosis throughout all
layers of the epidermis (arrowheads); F) infected, Day 35, late stage with massive epithelial
ulceration and complete epidermal loss. ......................................................................................145
Figure 5.4 Tissues collected from lake trout experimentally infected with EEDV. Magnification
200X (except B; magnification 400X), hematoxylin and eosin staining A) spleen, Day 28,
Diffuse lymphoid depletion with focal areas of necrosis (arrowhead); B) spleen, Day 28, Focal
areas of necrosis (arrowhead); C) omentum, Day 28, Severe lymphohistiocytic perivasculitis
(arrowhead); D) omentum, Day 28, lymphohistiocytic perivasculitis (arrowhead) with
intranuclear inclusion body in blood monocyte (arrow); E) heart, Day 28, lymphohistiocytic
perivasculitis (arrowhead) and epicarditis; F) gill, Day 28, proliferative branchitis with focal
lymphohistiocytic inflammatory cell infiltrate (arrowhead). .......................................................146
Figure 5.5 Kidney collected from negative control fish and lake trout experimentally infected
with EEDV. Magnification 100X (E), 200X (A), 400X (B, C, D, F). A) negative control, Day 35;
B) negative control, Day 35; C) infected, Day 28, hematopoietic cellular necrosis and depletion;
D) infected, Day 28, hematopoietic cellular necrosis; E) infected, Day 28, hematopoietic cellular
depletion; F) infected, Day 28, hematopoietic cellular depletion. ...............................................147
Figure 6.1 Liver cells cultured from an adult lake trout (Salvelinus namaycush). A) primary
culture, 6 days after seeding; B) 6th subculture, confluent...........................................................168

xvi

Figure 6.2 Fin cells cultured from yearling lake trout (Salvelinus namaycush), primary culture.169
Figure 6.3 Gonad cells cultured from yearling lake trout (Salvelinus namaycush). A) primary
culture, 3 days after seeding; B) primary culture, 5 days after seeding, ready for subculture; C)
6th subculture; D) 32nd subculture. ...............................................................................................170
Figure 6.4 Cell cultures established from body tissue of lake trout (Salvelinus namaycush) sac
fry. A) primary culture, 2 days after seeding; B) primary culture, ready for subculture; C) 14th
subculture; D) 47th subculture. .....................................................................................................171
Figure 6.5 Influence of incubation temperature on growth of novel lake trout cell cultures. A) fry
cells; B) gonad cells. Solid lines indicate cell density (cells per cm2); segmented lines indicate
subjective percent confluence. 2 flasks examined for confluence and cell density per sampling
day. ...............................................................................................................................................172
Figure 6.6 Influence of serum supplement concentration and type on growth of novel lake trout
cell cultures. A) fry cells; B) gonad cells. Solid lines indicate cell density (cells per cm2);
segmented lines indicate subjective percent confluence. 2 flasks examined for confluence and
cell density per sampling day. ......................................................................................................173
Figure 6.7 Influence of growth medium base on growth of novel lake trout cell cultures. A) fry
cells; B) gonad cells. Solid lines indicate cell density (cells per cm2); segmented lines indicate
subjective percent confluence. 2 flasks examined for confluence and cell density per sampling
day. ...............................................................................................................................................174
Figure 6.8 Cell cultures infected with VHSV or IPNV. A) EPC negative control; B) EPC cells
infected with VHSV, displaying typical CPE; C) fry cell negative control; D) fry cells infected
with VHSV, cell lysis; E) fry cell negative control; F) fry cells infected with IPNV, cell lysis. 175
Figure 6.9 Lake trout cells inoculated with EEDV. A) fry cells (47th subculture), cell rounding;
B) fry cells (47th subculture), cell rounding, some lysis; C) gonad cells (32nd subculture),
vacuolation, some rounding; D) gonad cells (32nd subculture), vacuolation, early lysis.............176
Figure 6.10 Relative viral loads following inoculation of lake trout fry cells with EEDV positive
tissue sample homogenate; represented as number of viral copies per qPCR reaction. P1 = 1st
pass infection, P2 = 2nd pass infection, Cells = cell pellet tested for presence of EEDV, Sup =
flask supernatant tested for presence of EEDV. Number in parentheses indicates temperature of
incubation. Numbers at bottom indicate separate infection trials, but have no sequential
significance. .................................................................................................................................177
Figure 7.1 Alignments of the EEDV (Salmonid Herpesvirus-3) target gene region (GenBank
JX886027) with the most related sequences of viruses available in GenBank including Atlantic
salmon papillomatosis virus (Salmonid Herpesvirus-4; JX886028) and Namaycush herpesvirus
(Salmonid Herpesvirus-5; KP686091). Notice that the eight EEDV LAMP primers cover 35 or

xvii

more mutation sites in the corresponding sequences of the other two SalHV strains. F: forward
primer, B: backward primer, LF: loop-forward primer, LB: loop-backward primer. .................194
Figure 7.2 Ability of the EEDV LAMP assay to discriminate EEDV from other viruses (i.e.,
analytical specificity). The amplification plot of EEDV is indicated by the arrow and appears as
expected. ......................................................................................................................................195
Figure 7.3 Analytical sensitivity shown in the standard curve generated from the amplification
plots of the quantitative LAMP (qLAMP) assay for known concentrations of EEDV glycoprotein
gene plasmid (pCR®2.1-EEDV plasmid). Plasmid was serially diluted 10-fold from 1.6x107 to
1.6x101 copies/reaction over three replicates...............................................................................196
Figure 7.4 Analytical sensitivity or limits of detection of EEDV-positive lake trout gill DNA by
the diagnostic LAMP assay for EEDV. Amplification plots 1–7 (from left to right): reaction
conducted using 10-fold serial dilutions of DNA from lake trout: 7.8x106, 7.8x105, 7.8x104,
7.8x103, 7.8x102, 7.8x101, and 7.8 pg, respectively. Amplification plot 8 was the negative control
(NC). ............................................................................................................................................197

xviii

KEY TO ABBREVIATIONS

(NH4)2SO4

Ammonium sulfate

AciHV

Acipenserid herpesvirus

AFS-FHS

American Fisheries Society Fish Health Section

AngHV

Anguillid herpesvirus

ASP(V)

Atlantic Salmon Papillomatosis (Virus)

ATCC

American Type Culture Collection

BLAST

Basic Local Alignment Search Tool

bp(s)

Base pair(s)

CA

Cytophaga agar

CCV

Channel Catfish Virus

CHSE

Chinook salmon embryo

CO1

Cytochrome c oxidase 1

CPE

Cytopathic effect

Ct

Threshold cycle

CyHV

Cyprinid Herpesvirus

DMSO

Dimethyl sulfoxide

DNA

Deoxyribonucleic acid

DNR

Department of Natural Resources

dNTP

Deoxynucleotide triphosphate

DSe

Diagnostic sensitivity

DSp

Diagnostic specificity

xix

EEDV

Epizootic Epitheliotropic Disease Virus

ELISA

Enzyme-linked immunosorbent assay

EPC

Epithelioma Papulosum Cyprini

FBS

Fetal bovine serum

FHM

Fathead minnow

GLB

Great Lakes Basin

GLFHC

Great Lakes Fish Health Committee

GSRV

Golden Shiner Reovirus

H&E

Hematoxylin and Eosin

HCl

Hydrochloric acid

HSM

Hsu Shotts medium

IcHV

Ictalurid Herpesvirus

IDT

Integrated DNA Technologies

IHNV

Infectious Hematopoietic Necrosis Virus

IP

Intraperitoneal

IPNV

Infectious Pancreatic Necrosis Virus

ISH

In situ hybridization

kbp

Kilobase pairs

KCl

Potassium chloride

KF

Koi fin

KHV

Koi herpesvirus

LAMP

Loop mediated isothermal amplification

LS

Lake Superior strain

xx

MALT

Mucosa-associated lymphoid tissue

MEM

Minimal essential medium

MgCl2

Magnesium chloride

MgSO4

Magnesium sulfate

MS-222

Tricaine methanesulfonate

MSFH

Marquette State Fish Hatchery

NCBI

National Center for Biotechnology Information

OIE

World Organization for Animal Health

OMV

Oncorhynchus masou Virus

p.i.

Post-infection

P1

First pass

P2

Second pass

PBS

Phosphate buffered saline

PCR

Polymerase chain reaction

qPCR

Quantitative PCR

RNA

Ribonucleic acid

RTG

Rainbow trout gonad

RTH

Rainbow trout hepatoma

SalHV

Salmonid Herpesvirus

SALT

Skin-associated lymphoid tissue

SE

Seneca Lake strain

spp.

Species

SVCV

Spring Viremia of Carp Virus

xxi

TSA

Trypticase soy agar

USA

United States of America

UV

Ultraviolet

VHSV

Viral Hemorrhagic Septicemia Virus

WSS

White sturgeon spleen

WSSK

White sturgeon skin

xxii

Introduction

1

Epizootic Epitheliotropic Disease Virus (EEDV) is a serious pathogen of lake trout
(Salvelinus namaycush), one which the aquaculture and scientific communities yet know little
about. Officially named Salmonid Herpesvirus-3, an Alloherpesvirus (Order Herpesvirales) (1),
this virus was initially described in the 1980s following mass mortality events in Midwestern
state and federal hatcheries (2–4). Epizootics were notably preceded by stressor events
associated with either standard hatchery operations or environmental changes and were
characterized by rapid mortalities (up to 90% cumulative) and behavioral changes such as spiral
swimming patterns, ataxia, and lethargy with intermittent hyperexcitability (2, 4). Electron
microscopy revealed the presence of viral particles with characteristics (e.g., size, capsomere
number) consistent with a herpesvirus, however as the affected species and clinical signs were
inconsistent with the previously described salmonid herpesivirus-1 or -2 outbreaks, it was
determined this was a novel virus and was designated Salmonid Herpesvirus-3, Epizootic
Epitheliotropic Disease Virus (3).
Early research focused on disease etiology and pathogen identification with multiple
researchers demonstrating the ability to produce clinical disease in experimentally challenged
juvenile lake trout (e.g., intraperitoneal injection, immersion bath, cohabitation) consistent with
natural epizootics (3, 4). Following the 1980s mortality events, hatchery staff and managers
instigated stringent disease control measures which included depopulation of lake trout within
the hatchery system and cessation of all lake trout movement within the Great Lakes basin (5).
EEDV then remained undetected in the Great Lakes for several decades, and it was believed to
have been eradicated, until mortality events once again occurred in Wisconsin and Michigan
hatcheries (5) (Chapter 2).

2

This re-emergence of EEDV in Great Lakes hatchery lake trout populations is
particularly concerning due to the potential for mass casualties in such a valuable species. The
lake trout is currently under intensive population management by state and federal regulatory
agencies in an attempt to mitigate past declines caused by invasive species, habitat destruction
and overfishing (6–12). These fish, found throughout much of northern North America, are
particularly valuable within the Great Lakes as they are a native, apex predator, have a
stabilizing effect on many ecosystems, and are prized by both sports and commercial fishermen
(6, 13). These fish are slow growing, and don’t reach sexual maturity until 7-10 years of age (6),
meaning that were an infectious agent, such as EEDV, to decimate a hatchery population of lake
trout, it would be particularly devastating due to the extended length of time required to recover
and bolster wild populations once again. Throughout this study, lake trout will serve as our
model species as they are historically the species most affected by EEDV infections.
While it has been established that EEDV remains a threat to the ongoing recovery efforts
with Great Lakes lake trout populations, our knowledge of the pathogenesis of this deadly virus,
and our ability to detect and study it, have gone largely unchanged in the past 30 years. While
molecular diagnostic techniques have advanced to the point where genome sequencing and
primer design for PCR-based assay detection are possible (1, 14), there as of yet are no available
cell cultures capable of supporting viral replication. While attempts were made following the
initial EEDV epizootics to produce a susceptible cell line, minimal cytopathic effect was
appreciable, any such cultures are no longer preserved (15), and past efforts demonstrated that
established cell lines (e.g., CHSE-214, EPC, RTG-2) do not support the growth of EEDV (3, 4).
This lack of a powerful research and diagnostic tool is particularly detrimental to efforts aimed at
uncovering the complex biological and pathological properties of EEDV. Consequently, there is

3

a dire need to better characterize the interactions between EEDV and its host, the lake trout
through improved diagnostic assays and research models.
To that end, Chapter 1 of this dissertation presents a review of literature encompassing
the extent of current knowledge concerning EEDV, the history of associated disease outbreaks in
lake trout, diagnostic options, and past research, focusing on other closely related
Alloherpesviruses where EEDV-specific answers do not yet exist. The culmination of this
summary was used as a basis for formulation of the study objectives.
Chapter 2 of this dissertation focuses on detailing the two most recent epizootic mortality
events contributable to EEDV, which occurred in Michigan’s Upper Peninsula in the fall of 2012
and 2017. I highlight certain epidemiological aspects of the outbreak such as the temporal and
spatial spread between and among lake trout strains, and discuss diagnostic confirmation of viral
infection and ongoing screening within and without the hatchery. I also demonstrate our
capability of reproducing clinical disease in a controlled laboratory environment through the
experimental infection of juvenile lake trout with infectious tissue homogenate collected from
naturally diseased fish. Chapter 2 serves to highlight the need for improved screening protocols,
biosecurity and readiness of reactionary plans should there be additional EEDV epizootics in the
future and also brings to light the scope of questions left unanswered regarding the biology and
pathogenesis of EEDV.
In order to address these crucial questions, we first require an understanding of the dosedependent effects of experimental exposure to EEDV and knowledge of whether clinical disease
can be reproduced in a controlled laboratory environment. Based on the pilot study from Chapter
2, in Chapter 3, we design two studies; the first aimed at determining the viral load necessary to
cause clinical disease and the second with a goal of developing an immersion model that

4

appropriately mimics a natural route of infection. Following development, this model could
subsequently be used for future experimental studies focused on improving our understanding of
EEDV disease ecology.
In Chapter 4, I utilized the predetermined dose range to infect a group of naïve juvenile
lake trout with a moderate dose of EEDV that allowed the tracking and temporal localization of
viral DNA throughout the course of infection. Identification of EEDV DNA within certain
tissues collected on specific days was reinforced through the development and use of an in situ
hybridization assay, which allowed for the visualization of EEDV genetic material within target
cells. Identification of EEDV cellular and tissue targets throughout a course of disease provides
key information concerning the pathogenesis of the virus, its interactions with the host fish, and
potential ideal diagnostic targets.
Following up on these results, Chapter 5 focuses on identifying and characterizing
sequential pathology in a multitude of organs through gross and histopathologic study. While
comprehensive histopathologic studies have been performed on several of the other
Alloherpesviruses (16, 17) previous studies of EEDV have been limited to analysis during and
after a mortality event (2, 4), often resulting in subtle lesions becoming obscured by the
advanced severity of disease.
Armed with the novel information uncovered in the first four chapters, I then turned to
improving diagnostic capabilities in the next two sections. Chapter 6 discusses the development
of novel cell cultures of lake trout origin. All previous attempts at EEDV propagation in cell
culture have been unsuccessful (3, 4) and despite the one time production of lake trout cells (15),
there are currently no established cell lines of lake trout origin. As the species specificity of
many herpesviruses translates into host-specific cell lines, we created primary cultures of lake

5

trout cells and assessed their viability for use in EEDV diagnosis and research. As novel cell
lines continue to evolve and improve, additional molecular diagnostic assays were also being
developed. Chapter 7 outlines the design of a novel loop mediated isothermal amplification
(LAMP) assay for the detection and quantification of EEDV. LAMP assays have become
popular due to their reasonable cost, comparable specificity and sensitivity to PCR assays and
the high potential for commercialization into a kit that can be performed in a field setting, a fact
that is particularly appealing for fish health professionals (18, 19).
Lastly, Chapter 8 summarizes my overall conclusions and provides suggestions for future
research. The culmination of the methodology and analyses of this dissertation is an improved
understanding of the pathogenesis of EEDV as well as improved diagnostic options, all of which
can be used to prevent or limit future spread of this virus.

6

Chapter 1

Literature Review

7

1. Fish Pathogens
1.1. Overview
In comparison to other vertebrate classes, fish have an extremely high level of species
diversity and make up a vast proportion of the earth’s biomass (20). Due to this, changes such as
over-exploitation, habitat modification and the introduction of invasive species, which result in
population level alterations, have the potential for dramatic ecological consequences (21–23).
Aquatic species have been heavily stocked for decades in an attempt to balance the effects of
such changes (24, 25). While stocking can be an effective tool for population management, it can
also lead to decreased evolutionary potential and genetic integrity (26–28), and it has been
suggested that captive reared fish display a decreased level of fitness compared with those born
in the wild (26). Certainly there are inherent risks and stress associated with the density of
captive fish as well as day-to-day hatchery management practices.
Plumb & Hanson (2011) (29) state that infectious diseases of fish (e.g., caused by viral,
bacterial and parasitic agents), are constraining the expansion of the aquaculture industry. Often,
mass mortality events are caused by the eruption of endemic diseases, after fish are exposed to
stressful conditions such as those experienced with intensive captive rearing (29). In general, fish
react more quickly to environmental changes than terrestrial animals due to their poikilothermic
nature, resulting in substantial morbidity and mortality due to handling stress, abrupt water
temperature changes or water chemistry alterations (29). A compromised immune system is
another disadvantageous side effect of increased stress, leaving the fish more susceptible to
infectious diseases (29). Many aquatic diseases occur on a seasonal trend based on cyclical water
temperatures and the presence of susceptibly aged fish in the environment (30, 31). Good

8

biosecurity practices are vital to preventing disease outbreaks as well as limiting their spread
within a hatchery (32).
Disease manifestation can take on many forms, however one common early clinical sign,
regardless of pathogen, is a change in behavior such as cessation of feeding activity or inability
to remain upright (i.e., loss of equilibrium). Lethargy, listlessness, or crowding around water
inlets are additional clues to the presence of diseased fish (29). Unfortunately, most frequently,
external signs of infectious disease are nonspecific and there are very few aquatic diseases with
overt pathognomonic clinical signs (29), leading researchers, veterinarians and fishery managers
to pursue additional diagnostics in order to effectively manage captive populations of fish.

1.2. Immunology
Every pathogen has an optimal or primary point of entry into its host. In fish, these sites
are most commonly the intestines, gills or skin (29). Fish possess a mucous layer over their
epithelium which can provide protection against certain pathogens, however if this layer is
damaged, by human handling either at a hatchery, or via catch-and-release for example, then that
fish is at an increased risk for water-borne infections both pathogenic and opportunistic (29).
Nutritional status and environmental conditions also play a large role in the ability of a fish to
fight off disease. For example, adult fish are at a higher risk of acquiring infectious diseases
during spawning season when many have compromised immune systems due to a cessation of
feeding entirely (29).
The skin of all vertebrates is the first line of defense against disease and consists of an
epidermis and dermis (33). Fish skin functions to provide mechanical, chemical and immune
barriers to injury and pathologic invasion (34). Unlike mammals, fish epidermis consists of

9

living cells capable of mitotic division in all layers (34). Primary epithelial cells include the
filamentous Malpighian cells and glandular, mucus-secreting goblet cells (34). Teleost fish skin
has a cuticle (i.e., mucous) layer covering the epidermis (34). This mucous layer is continuously
moving downstream, which reduces pathogen access to epithelial cells similarly to the mucociliary escalator in pulmonate animals (34). The mucous also contains immunoglobulins and
enzymes capable of neutralizing many microorganisms. Stressors that alter or disturb this
mucous layer can increase a fish’s susceptibility to infectious pathogens (34).
As with other vertebrates, in addition to the physical barriers, fish have several natural
mechanisms of disease resistance including natural killer cells, the phagocytic activity of
neutrophils and macrophages, and serum components such as interferons and complement (29).
In teleost fish, IgT likely plays a major role in the neutralization of pathogens both on the skin
and within the gut (33). Trout skin-associated lymphoid tissue (SALT) functions very similar to
mammalian mucosal-associated lymphoid tissue (MALT) and contains populations of B and T
cells capable of responding to immune stimuli (33, 35).

1.3. Treatment
Treatment of aquatic diseases can, at times, be challenging and disheartening, as there is
but a short list of approved therapies and medications available, mainly due to limitations
concerning environmental levels of certain chemicals and tissue withdrawal times prior to human
consumption. Fortunately, the use of vaccines is beginning to become generally more acceptable
and feasible in the aquaculture industry. The earliest aquatic vaccines date back to the 1940s
when a Aeromonas salmonicida preparation was fed to trout in an attempt to prevent
furunculosis (29, 36). Leong and Fryer (1993) (37) explained that an aquaculture vaccine needs

10

to demonstrate specific features: 1) adequate immunoprotection under intensive conditions, 2)
effectiveness when the fish is most susceptible, 3) long term protection, 4) protection against all
serotypes, 5) be easily administered, 6) be safe for the fish, and 7) be cost effective. There is a
concern however that vaccinated fish could become reservoirs or carriers for diseases (29) if, for
example, a modified live vaccine reverted to a pathogenic strain or if the vaccine limited clinical
signs but not pathogen infection. With the relatively short list of approved medications and
vaccinations available for use in fish, often times aquatic animal health programs focus efforts on
prevention of outbreaks and limiting affected individuals after a pathogen is detected. These
goals can be achieved through the rigorous screening of any novel fish populations entering a
hatchery, public education regarding movement between bodies of water, strong biosecurity
practices within hatcheries and frequent disease surveillance within hatchery fish. The failure of
these goals is potentially disastrous as fish in their aquatic habitats are vulnerable to infection
with a myriad of pathogens, the most serious of which are fish-pathogenic viruses.

2. Fish Viruses
2.1. Overview
Viruses represent a potential for catastrophic losses of fish kept under intensive rearing
conditions (29). Many of the recent viral outbreaks have occurred following exposure of infected
fish populations to environmental stressors (29). The Great Lakes support a more than $7 billion
fishery industry and encompasses commercial, recreational, and tribal fisheries (38). Fish
stocking has occurred in the Great Lakes for more than 50 years with goals of bolstering the
sports and commercial fishing industries as well as restoring and rehabilitating specific fish
populations. The Great Lakes Fish Health Committee (GLFHC) developed a “Great Lakes Fish

11

Disease Control Policy and Model Program” with a goal of coordinating disease management
between fishery agencies throughout the region (39). The model program serves as a guideline
for fishery managers, fish health professionals and policy makers in regards to hatchery
management, fish health testing and transportation within the Great Lakes Basin, and applies to
all fish species that have the potential to harbor transmissible pathogens within the Great Lakes
Basin (39). Specific goals include prevention of fish pathogen introduction and spread within the
basin as well as providing classification of hatchery disease status (39). Agency responsibilities
include developing regulations to eradicate or minimize fish pathogens, limiting the rearing and
release of infected fish, preventing the transportation and importation of infected fish, and
developing response plans in case of disease outbreaks (39).
Detection of viral infection in fish involves virus isolation in tissue culture (gold
standard), electron microscopic examination, and serologic assays (29). Following isolation from
cell culture, virus identification can be confirmed using such techniques as enzyme-linked
immunosorbent assay (ELISA), polymerase chain reaction (PCR), or loop mediated isothermal
amplification (LAMP) (19, 40).

2.2. OIE reportable diseases
There are currently twelve fish-specific diseases listed as reportable to the World
Organization for Animal Health (OIE) (41). Of the 12, one is a fungal infection (Aphanomyces
invadans), one is an ectoparasite (Gyrodactylus salaris) and the remaining ten are viruses (41).
All of these pathogens are reportable due to their potential to cause significant mortalities in a
variety of fish species or populations and have very limited treatment options. While
vaccinations are a popular area of study, there are few commercially available vaccines for the

12

above-mentioned viruses. As a group, these viruses have the potential to cause mass mortalities
and have dramatic economic and ecologic effects on a wide range of both marine and aquatic
fish species.

3. Order Herpesvirales
Two of the OIE reportable fish viruses are members of the order Herpesvirales. Koi
Herpesvirus (KHV) or Cyprinid Herpesvirus-3, causes an acute viremia in all forms of carp
including common carp (Cyprinus carpio) and koi (domesticated Cyprinus carpio) (16, 42),
while Oncorhynchus masou virus (OMV; Salmonid Herpesvirus-2) causes tumors, ulcerative
skin lesions, and mass mortalities in multiple salmonid species in Japan (42, 43).
Herpesviruses have been isolated from every class of vertebrates as well as from a single
invertebrate (1, 44). In general, each herpesvirus is closely associated with a single host species,
however individual hosts may be affected by multiple species of herpesviruses (44), indicating a
co-evolution of virus and host; as hosts evolve and become extinct, so too do their herpesviruses
(44). Herpesviruses have large genomes with a highly conserved yet complex viral structure (44,
45). The virus particles are typically 200-250 nm in diameter with a double stranded DNA
genome ranging from 125 to 245 kbp long, packed densely inside an icosahedral capsid (44, 45).
The capsid contains 162 capsomeres and is embedded in a tegument matrix layer. The outermost
layer is a lipid bilayer envelope derived from the host cell (46).
Prior to the 1980s, designation as a herpesvirus was made based on virion morphology
plus antigenic and biologic properties (44, 46), however recently, complete genome sequencing
has allowed for the construction of phylogenetic trees (44). The current viral taxonomy has
herpesviruses within the order Herpesvirales, which consists of three families: Herpesviridae,

13

Alloherpesviridae and Malacoherpesviridae (44) (Figure 1.1). The family Herpesviridae contains
viruses that infect mammals, birds and reptiles and is further divided into three subfamilies:
Alphaherpesvirinae (primary hosts mammals, birds, reptiles), Betaherpesvirinae (primary hosts
mammals) and Gammaherpesvirinae (primary hosts mammals) (1, 46–51). The family
Alloherpesviridae contains those viruses infecting fish and amphibians while
Malacoherpesviridae contains the single virus isolated from an invertebrate host (1, 47, 48).
While gene order is highly conserved among closely related herpesviruses, there is a high degree
of divergence between the three main “boughs”, making it difficult to prove a single common
viral ancestor using amino acid sequences (44). None of the genes common to all three
herpesvirus families are unique to herpesviruses alone (44), and it has been suggested that
herpesviruses may share a common fundamental ancestor with the T4 bacteriophages (44).
Division between the mammalian and fish viruses occurred approximately 400 million years ago
and extant lineages have lost most remnants of common inheritance unlike the divisions among
the mammalian viruses, which occurred only 200 million years ago and retain many related
genes (44). There are several examples where multiple herpesviruses affect a single species such
as the nine human herpesviruses and the five equine herpesviruses. These groups likely survived
due to the occupation of separate biological niches. There are also examples of closely related
viruses that affect different species such as Varicella zoster virus in humans (chickenpox) and
Simian Varicella Virus (SVV) in old-world monkeys, indicating viral divergence may have
occurred following host speciation (44).

14

4. Family Alloherpesviridae
4.1. Classification
The family Alloherpesviridae encompasses over 14 known herpesviruses associated with
clinical disease in fish and consists of four genera: Batrachovirus (primary hosts frogs),
Cyprinivirus (primary hosts carp and eel), Ictalurivirus (primary hosts catfish and sturgeon), and
Salmonivirus (primary hosts salmon and trout) (52) (Figure 1.2). While many of these
herpesviruses cause only mild or unapparent disease under natural conditions, they can often be
fatal in either immune compromised or naïve fish such as in captive bred populations or
aquaculture facilities (45). To date, all characterized alloherpesviruses have the ability to cause
disease in just a single species, which is a characteristic also displayed in the difficulty of cell
culture isolation (45).
Within the Alloherpesviridae family there are at least 12 conserved genes (45). Regions
within these conserved genes have been used to establish primers for PCR amplification
including regions of the polymerase, terminase and glycoprotein genes. Coevolution of the
Alloherpesviruses with their hosts is only supported at the most distal phylogenetic branches (1).
There is not a close relationship between the herpesviruses that infect cyprinid and ictalurid
fishes despite both fish families being members of the Ostariophysi superorder (1). The two
herpesviruses that infect sturgeon are not sister taxa even though sturgeons are an ancient fish
lineage (1), however the herpesviruses that infect salmonids do form a monophyletic clade.

4.2. Clinical presentation and latency
Most of the alloherpesviruses are epitheliotrophic, replicate in epithelial cells, and cause
pathology such as epidermal and branchial necrosis, hypertrophy, or hyperplasia, and formation

15

of papillomas or adenocarcinomas (45). Clinical signs are often mild in mature fish and severe in
immature fish resulting in high mortalities in fry and fingerlings (53). Latency has been
demonstrated in five of the Alloherpesviruses (Cyprinid Herpesvirus-1 and -3, Salmonid
Herpesvirus-2, Anguillid Herpesvirus-1 and Ictalurid Herpesvirus-1) via detection of viral DNA
in fish without infectious virus (54–61). While the Alloherpesviruses have diverged from
members of the Herpesviridae family, they maintain many similar biological and pathological
properties including high host specificity and ability to develop latency (1, 45).

4.3. Specific Alloherpesviruses
4.3.1. Genus Cyprinivirus
Cyprinid Herpesvirus-1 (CyHV-1) is also known as Carp Herpesvirus, Carp Pox Virus
and Herpesvirus Cyprinid (47). Carp pox is one of the oldest fish diseases on record, dating back
to the Middle Ages, and the causative agent, CyHV-1, currently has a world-wide distribution
(47, 62). The most common clinical sign associated with CyHV-1 is the presence of epidermal
growths on either common carp or koi carp (47). CyHV-1 leads to a biphasic infection with an
acute, lethal systemic disease in young carp and a recurring, nonlethal, proliferative skin disease
in adult fish (63, 64).
Cyprinid Herpesvirus-2 (CyHV-2) is called Goldfish Hematopoietic Necrosis Virus and
also has a global distribution (47, 65). Epizootics result in high mortalities in all ages of goldfish
(Carassius auratus) with minimal gross external lesions, however the liver and kidney may be
pale and enlarged on necropsy with white, granular nodules in the spleen (66). Upon
histopathologic examination, mild to severe, multifocal to diffuse, coagulative necrosis has been

16

seen in the kidney and spleen (65). Goodwin et al. (2006) (67) reported that CyHV-2 has been
detected in apparently healthy goldfish, which suggests that a latent infection can be established.
The third Cyprinivirus, CyHV-3, is called Koi Herpes Virus, Carp Nephritis Virus or Gill
Necrosis Virus (16, 68) and causes disease in both common and koi carp (47). CyHV-3 has a
global distribution and infection results in mass mortalities in all ages of carp, common or koi
(16, 69, 70). Secondary bacterial and fungal infections are common with CyHV-3, and upon
necropsy, typical findings include enlarged kidney and spleen, flaccid and mottled heart,
hyperplasia and/or hypertrophy of the branchial epithelium and fusion of the secondary lamella
(16). The primary mode of entry is through the skin and fins leading to secondary disease in the
gills (34, 71). Infections with KHV are reportable to the World Organization for Animal Health
(OIE) as this virus is of specific concern to the global ornamental fish trade.
According to current classification by the International Committee on Taxonomy of
Virusses, Anguillid Herpesvirus 1 (AngHV-1) is also a member of the Cyprinivirus genus.
AngHV-1 is known as Eel Herpesvirus or Herpesvirus Anguillae, was first isolated from
Japanese eel (Anguilla japonica) in the 1980s (72), and has since spread throughout eel farms in
Europe (73). While it is suspected that this virus is ubiquitous in wild eel populations, when the
virus is present in dense captive populations, fatal disease outbreaks can occur (73). Clinical
signs associated with AngHV-1 outbreaks include skin and gill erythema and necrosis, liver
necrosis, systemic hemorrhaging and mortality rates ranging from 1-7% (72, 73).

4.3.2. Genus Ictalurivirus
Ictalurid Herpesvirus-1 or Channel Catfish Virus (IcHV-1, CCV) was first characterized
following isolation from juvenile channel catfish (Ictalurus punctatus) during a mass mortality

17

event in the southern United States in the late 1960s (17, 74). Natural outbreaks of CCV most
frequently occur in fingerling catfish, and when water temperatures are above 27°C, mortalities
can reach 90% within the span of a couple weeks (45). Common clinical signs include erratic
swimming, exophthalmia, a distended abdomen and fin hemorrhages (45), with gross pathology
including yellow ascites and a swollen kidney and spleen. CCV appears to have high host
specificity with only channel catfish, blue catfish (Ictalurus furcatus) and their hybrid showing
any level of susceptibility (45). In order to limit commercial losses, many producers attempt to
decrease stress and crowding of juvenile catfish, particularly during the times of year when water
temperatures are ideal for CCV replication (45). Additionally, several experimental vaccines
have been developed including a DNA vaccine (75), an attenuated live vaccine (76) and multiple
recombinant vaccines (77, 78) with varying degrees of protection.
Ictalurid Herpesvirus-2 (IcHV-2) was first isolated in 1994 from two farms in northern
Italy experiencing mass mortalities in black bullhead catfish (Ictalurus melas) (79). Throughout
these mortality events, fish exhibited abnormal behavior including spiral swimming patterns and
developed multifocal hemorrhages along the abdomen, fin base and in many internal organs (79,
80). Under experimental conditions IcHV-2 was infectious to both black bullhead as well as
channel catfish suggesting a broader host range than CCV (80). While at this time IcHV-2 has
been limited to European waters, were it to spread to areas with heavier channel catfish
production such as the southern United States, catastrophic losses could occur (80).
The third member of the genus Ictalurivirus is Acipenserid Herpesvirus-2 (AciHV-2) or
White Sturgeon Herpesvirus-2. This virus was initially detected in ovarian fluid of apparently
healthy captive white sturgeon (Acipenser transmontanus) broodstock in the early 1990s in
California, USA (81). The novel virus was isolated from sturgeon spleen (WSS-2) and skin

18

(WSSK-1) cells following development of cytopathic effect (CPE) characterized by focal
rounding, enhanced refractility, enlargement and detachment of spleen cells as well as syncytia
formation and discrete, grape-like clusters in skin cells (81). Experimentally challenged fish
developed lethargy and erratic swimming behavior within 10 days of exposure, followed by the
development of discrete, raised hypochromatic lesions on the head and pectoral fins with
cumulative mortalities reaching 80% (81). One particular concern with this virus is its potential
to contribute to increased mortalities in juvenile captive bred sturgeon due to chronic skin
diseases (81).

4.3.3. Genus Salmonivirus
The salmonid herpesviruses are particularly concerning in the Great Lakes basin due to
the importance both economically and ecologically of the four trout species, three salmon species
and one trout hybrid in the region that are all potentially at risk of viral exposure or infection.
There are currently three confirmed members of the Salmonivirus genus: Salmonid Herpesvirus1, Salmonid Herpesvirus-2, and Salmonid Herpesvirus-3; and two proposed viruses: Salmonid
Herpesvirus-4 and Salmonid Herpesvirus-5.
Salmonid Herpesvirus-1 (SalHV-1), also known as Herpesvirus Salmonis or Steelhead
Herpesvirus, was first isolated from healthy rainbow trout in the state of Washington (82).
Distinguishing itself from previously described aquatic herpesviruses, SalHV-1 required water
temperatures below 10°C for replication (82). Electron microscopy demonstrated morphological
characteristics consistent with other herpesviruses, and syncytia plus nuclear inclusions were
seen in cell culture (82). Clinical findings associated with SalHV-1 infection include increased
mortalities in rainbow trout fry, with erratic swimming and loss of motor control, generalized

19

darkening, exophthalmia, ocular hemorrhage, abdominal distention, pale gills, ascites and
visceral pallor and/or edema (83).
Salmonid Herpesvirus-2 (SalHV-2, Oncorhynchus masou Virus, OMV) was first isolated
in RTG-2 and CHSE-214 cell lines following inoculation of tissues collected from masou
salmon, (Oncorhynchus masou) coho salmon (Oncorhynchus kisutch), sockeye salmon
(Oncorhynchus nerka) and rainbow trout (84–87). Beginning in 1970, Sockeye salmon fry in
Japan began having increased mortalities (up to 80%) following generalized darkening and
behavioral changes (84). A syncytia-forming virus was isolated from RTG-2 cells and a similar
virus was isolated from ovarian fluid of adult masu salmon a few years later (84, 88). Designated
OMV, this virus was shown to be significantly pathogenic and oncogenic to juvenile salmonids
(43, 88) with epithelial tumors developing in 12-100% of fish surviving initial infection (89).
Following the implementation of iodine disinfection of eyed eggs, this virus is now only rarely
detected in Japanese hatcheries (88).
Doszpoly et al. (2013) (90) proposed a new virus as SalHV-4 to be called Atlantic salmon
papillomatosis virus (ASPV). This disease was first reported in the 1950s in both wild and
farmed fish in Scandanavia, Scotland and Russia (90). ASP is a benign skin disease mainly
affecting young Atlantic salmon (Salmo salar), although occasionally adult fish returning to
spawn can become infected (91). Common clinical signs include slowly forming areas of focal
epithelial hyperplasia and petechial hemorrhage followed by end-stage large pale papilloma-like
lesions. Secondary opportunistic infections are also common (90). Wolf (1988) (92) and
Shchelkunov et al. (1992) (93) both described a viral agent found inside the proliferative
epithelial cells of the papilloma lesions with morphology consistent with a herpesvirus. They
were however, unable to isolate the virus in cell culture. Based on the sequencing of three partial

20

gene fragments, Doszpoly classified ASP as an Alloherpesvirus and sister-species to SalHV-3
with the proposition of designating ASP as SalHV-4.
Salmonid Herpesvirus-5 was initially described following isolation from apparently
healthy lake trout (Salvelinus namaycush) in Keuka Lake, New York in 2011 (94). While fish
exhibited no clinical signs of disease and kidney samples inoculated onto EPC and CHSE-214
cells demonstrated no cytopathic effect, tissue samples were PCR-positive for a novel
herpesvirus, most closely related to salmonid herpesviruses -3 and -4 (94).
SalHV-3, known as Epizootic Epitheliotropic Disease Virus (EEDV), is the salmonid
herpesvirus of most concern within the Great Lakes basin today (2–4) and will be discussed in
great detail below.

5. Epizootic Epitheliotrophic Disease Virus (EEDV)
5.1. Initial epidemics
Salmonid Herpesvirus-3 (Epizootic Epitheliotropic Disease Virus; EEDV) is an
Alloherpesvirus and a serious pathogen of lake trout (Salvelinus namaycush), one that the
aquaculture and scientific communities yet know little about. This virus was initially described in
the 1980s following mass mortality events in Midwestern state and federal hatcheries, which
were preceded by potential stressor events associated with either environmental changes or
standard hatchery operations. These epizootics were characterized by rapid mortalities, spiral
swimming patterns, ataxia, gasping at the surface and lethargy with intermittent
hyperexcitability, specific to juvenile lake trout (3). Reported mortalities ranged from 15% to
greater than 95% and over a million fish either died or were euthanized following onset of
clinical disease (2).

21

Over the next several years, many similar natural epizootics were associated with
environmental or handling stress and occurred following the subjection of apparently healthy
lake trout to stress caused by standard hatchery operations (3, 5). Each new epizootic lasted for
two to three months and younger fish (fry versus fingerlings versus broodstock) appeared to be
more susceptible (3). Following routine tagging operations in 1986, yearling lake trout at the Iron
River National Fish Hatchery experienced severe mortalities, followed shortly by mortalities in
fingerling lake trout as well (4). Mortalities at the Iron River NFH reached almost 100% with
this outbreak (4). Attempted treatment options included the addition of sodium chloride,
formalin, benzalkonium chloride, teramycin, erythromycin and malachite green but all were
ineffective at preventing the onset of disease or improving clinical signs (3). Additionally, the
use of oxytetracycline had no therapeutic effect on diseased fish and did not prevent disease
transmission to uninfected fish (3). Secondary infections with Pseudomonas spp. and Aeromonas
spp. were found in several epizootics but were not considered the inciting event (3).

5.2. Pathogen identification
Histopathologic examination performed during the original epidemics revealed branchial
inclusions (9-15 µm in diameter) with densely packed coccoidal particles interspersed along the
secondary lamellae (2). Some fish also had marked epithelial hyperplasia and hypertrophy of the
primary and secondary lamellae as well as a generalized thickening of the secondary lamellae
and the interlamellar regions with increased mucus accumulation (2). Transmission electron
microscopy revealed an organism in the inclusion bodies present in samples from multiple
epidemic sites that was 9-25 um in diameter, observed along the secondary lamellae (2).
Systemic lesions consistent in the outbreaks were renal glomerulitis, renal tubule degeneration

22

and epithelial hyperplasia (2). Electron microscopy revealed icosahedral virus particles that were
both enveloped and unenveloped. The unenveloped particles measured 100-105 nm in diameter,
had 5 capsomeres per capsid side and a hollow center. The enveloped particles had a diameter of
220-235 nm (3). The total number of capsomeres (i.e., 162) is consistent with a member of the
Herpesviridae family and as all herpesviruses are enveloped, the finding of unenveloped particles
may be due to the fragility of the viral envelope (3). Immunofluorescent data was not supportive
of a Chlamydial agent and eventually, it was concluded that a herpes virus was responsible for
these epizootics in juvenile lake trout (3) and was designated Epizootic Epitheliotrophic Disease
Virus.

5.3. Disease management
Brood stock strains were developed from wild populations in the Great Lakes in the
1980s in order to begin a lake trout restoration program (5), however, outbreaks of EEDV
occurred in the first year progeny in both state and federal hatcheries (5). EEDV outbreaks also
occurred in fish raised on well water from eggs obtained from the Apostle Islands and Michigan
hatcheries (5). The original source of infection was difficult to establish in both instances, based
on complexity of hatchery water use and fish movement between facilities (5). Depopulation was
recommended and a total of approximately 15 million fish were destroyed due to EEDV (5).
Severe restrictions were put in place regarding the movement of lake trout within the Great
Lakes Basin (5). In hopes of obtaining a “disease-free” strain of lake trout, eggs were collected
and shipped in from a federal hatchery in the state of Wyoming (5). Egg collections from wild
lake trout in the Great Lakes for use in stocking resumed in the year 2000 (5).

23

5.4. Early pathogenesis studies
Virus propagation was attempted on FHM, RTG, CHSE-214, EPC or RTH cell lines,
however all were unsuccessful (3). In vivo experimental infections were performed using an
infectious filtrate of the unknown virus (3) and within 32 days resulted in clinical signs such as
spiral swimming, ataxia, and lethargy with intermittent hyperexcitability, consistent with the
primary epizootic. Mortalities began at 33 days post-exposure and 100% mortality occurred
within the following week. No mortalities were observed when the filtrate was passed through a
220 nm filter prior to infection (3), which may have been due to clumping of viral particles. Fish
exposed to purified virus began dying at 35 days post-exposure with 100% mortality occurring
by 43 days post-exposure.
Gross lesions included secondary saprolegnia infections, hemorrhaging in the eyes and at
fin bases, fin degeneration, and renal swelling. Histopathologic examination revealed epidermal
hyperplasia, hypertrophy and necrosis with intranuclear inclusion bodies as well as lamellar
edema, renal tubular degeneration and dilation of renal glomeruli (3).
In order to further characterize the etiologic agent behind these mortality events,
McAllister & Herman (1989) (4) performed additional experimental infections. Naïve lake trout
fingerling died following exposure to either moribund lake trout or to filtered skin homogenates
and scrapings (4). Clinical signs developed beginning 7-9 days following viral exposure via
cohabitation (4). From skin homogenates and scrapes, the virus was able to pass through 0.45
and 0.22 µm average pore diameter membrane filters (4) and clinical signs occurred 5-7 days
following exposure. Multiple fish species of the family Salmonidae were exposed to EEDV in
order to examine virus host range. No brown trout (Salmo trutta), rainbow trout or Atlantic
salmon died following exposure via either cohabitation or a waterborne route. One brook trout

24

(Salvelinus fontinalis) died, however EEDV was ruled out as the cause of death (4).
Histopathologic findings in tissues from experimentally infected lake trout were similar for both
methods of exposure and included epithelial hyperplasia with lymphocytic infiltrates, hydrophic
cells and necrosis as well as macrophages with cellular debris in the kidneys and vacuolated
hepatocytes (indicative of reduced glycogen reserves) (4). No cytopathic effect was noted on cell
culture (primary or secondary passages) (4), however viral particles were detected in the
epidermis (ellipsoidal to spherical particles) and were 150-200 nm in diameter (4).

6. Lake trout (Salvelinus namaycush)
EEDV is of particular concern within the Great Lakes Basin due to the vital importance
of the lake trout. The lake trout is one example of a species currently under intensive population
management by regulatory agencies including the United States Fish and Wildlife Service and
Michigan Department of Natural Resources (DNR). Lake trout are found naturally throughout
much of northern North America, and are the largest of the chars, a genus within the Salmonidae
family, which also includes the brook trout and their hybrid, the splake (6). Lake trout are
extremely valuable to the commercial fishing trade in the Great Lakes, second only to whitefish
in both pounds produced and economic value (Michigan DNR commercial fishing report 20012013), as well as to sports fishermen who prize these fish for their size and their fight when on a
line (6). There is also an intrinsic value placed on the species, as they are one of the only native
apex predators in the Great Lakes, and posses a life cycle well adapted to these waters, utilizing a
wide range of habitats and resources, which results in a stabilizing effect on local fish
communities across the basin (13).

25

Prior to the 1940’s, Lake Michigan contained one of the world’s largest populations of
lake trout (13). Unfortunately, this period of history saw the inadvertent introduction of two
invasive species to the Great Lakes Basin: the sea lamprey (Petromyzon marinus) which prey
upon the fish which had previously been apex predators in the Great Lakes, and also the alewife
(Alosa pseudoharengus) which outcompeted the lake herring (Coregonus artedi), the primary
food source of lake trout (10, 13). Along with overfishing and habitat degradation, the
introduction of these invasive species led to the depletion of native lake trout populations in
Lakes Ontario, Erie and Michigan (6–9, 11, 12, 95). Both sport and commercial fishing
industries suffered collapses following the decline of this dominant predator (13). In response,
state and federal management agencies developed programs to regulate harvest and create selfsustaining lake trout populations across the nation. This included the introduction of these fish
into new habitats (e.g., Lake Tahoe, California and Harding Lake, Alaska) and bolstering native
wild stock populations (e.g., Lake Michigan) (6). Unfortunately, these lake trout rehabilitation
efforts have encountered many hurdles including emerging infectious diseases, continued
predation by sea lamprey, and inadvertent overfishing following the introduction of Pacific
salmon into the Great Lakes (13).

7. Diagnostic Tools
7.1. Cell culture
The use of cell culture has become a staple in the study of virology, toxicology,
carcinogenesis, immunology, endocrinology, aquaculture, and more (96, 97). Tissue culture has
been successfully used in research laboratories as an alternative to whole animal models for
many years now (96) and is often the first step in the diagnosis of and surveillance for aquatic

26

viruses in populations of interest or concern. While American Type Culture Collection (ATCC)
carries over 3,400 commercially available distinct cell lines, there are less than 20 that are
derived from fish tissues. Several members of Alloherpesviridae have been isolated in cell
culture including Cyprinid Herpesvirus-1 (Carp Pox) and -2 (Koi Herpesvirus) in KF-1 cells (16,
63), Acipenserid Herpesvirus-1 (White Sturgeon Herpesvirus-1) in WSS-1 cells (98), and
Salmonid Herpesvirus-1 (Herpesvirus Salmonis) and -2 (Oncorhynchus Masou Virus) in both
RTG and CHSE-214 cells (82, 99, 100). As evidenced by the cell lines used to isolate these
viruses, herpesviruses are not only host-species-specific in vivo but also in vitro, with the carp
herpesviruses being isolated using cell lines of carp (i.e., cyprinid) origin and the salmonid
herpesvirus being isolated in cell lines originating from Oncorhynchus species (i.e., Chinook
salmon and rainbow trout). Unfortunately there are currently no established cell lines originating
from Salvelinus fish (i.e., lake trout or brook trout).
In vitro propagation of EEDV was attempted by both Bradley et al. (1989) (3) and
McAllister and Herman (1989) (4), yet both were unsuccessful. Established cell lines including
CHSE-214, EPC, FHM, McCoy, RTG-2, and RTH-149 were inoculated with tissue homogenates
from EEDV-infected fish and showed no evidence of cytopathic effect (3, 4). Without the ability
to isolate the EED virus in cell culture, diagnosis initially depended on observation of viral
particles by transmission electron microscopy (5) and more recently, PCR (5, 14).
One solution to the lack of available aquatic cell lines is the development of novel
primary cell cultures. Normal somatic cells are not immortal and will trigger senescence either
via cell cycle arrest or via shortening of telomeres (96). In order to take primary cultures and
immortalize them, either or both of these mechanisms must be overcome. Frequently, this is
done by inducing expression of a telomerase reverse transcriptase protein, which can be

27

accomplished with the use of a eukaryotic plasmid (96). One of the concerns with maintaining an
immortal cell line is the alteration of original characteristics over time (96). As the number of
passages increases, cell lines often begin to behave differently as they are placed under selective
pressures (96). Cheng, Spitsbergen and Bowser (1990) (15) aimed to produce EEDV-susceptible
cell lines of lake trout origin and while they were able to produce a number of cell cultures and
observed plaque formation in a few infected wells, they were unable to produce consistent results
in subsequent passes (15). Unfortunately, these cell cultures no longer exist and there are no
commercially available cells of lake trout origin.

7.2. Imaging
In order to address and elucidate the pathology and host-pathogen interactions of these
herpesviruses, many researchers turn to the use of advanced imaging assays such as
histopathology, electron microscopy and in situ hybridization. Such tools can be used not only in
the diagnosis of known pathogens, but also in advancing our knowledge of the complexities
behind viral disease progression, tissue and cellular targets and pathogenesis.
Furihata et al. (2005) (87) performed experimental challenges with Oncorhynchus masou
Virus (OMV; Salmonid Herpesvirus-2) and rainbow trout and demonstrated the development of
hemorrhagic and necrotizing alterations in the spleen, kidney, liver and intestines (87). Wolf and
Smith (1981) (101) produced clinical disease in juvenile rainbow trout experimentally
challenged with Herpesvirus Salmonis (Salmonid Herpesvirus-1) (101). Histopathologic
examination of these fish revealed a systemic disease with extensive and degenerative changes in
many tissues including renal tubular necrosis, necrosis and sloughing of gut mucosa and the
presence of syncytia in pancreatic acinar tissue.

28

Comprehensive histopathologic studies have been completed on several of the nonsalmonid Alloherpesviruses as well, including Koi Herpesvirus (KHV; Cyprinid Herpesvirus-3)
and Channel Catfish Virus (CCV; Ictalurid Herpesvirus-1). Histopathologic examination of koi
fish experimentally challenged with KHV revealed prominent lesions in multiple organs
including nuclear degeneration of myocardial cells, necrotic hematopoietic cells in the kidney,
and capillary and venous congestion within the valvula cerebelli, with the principal lesions being
seen in the gill filaments (e.g., swollen, vacuolated respiratory epithelial cells with nuclear
degeneration) (16). Wolf et al. (1971) (17) experimentally challenged juvenile channel catfish
with CCV and reported development of a hemorrhagic disease with systemic edema, renal,
hepatic and enteric necrosis as well as necrosis of the renal hematopoietic tissues (17).
During the original EEDV outbreak in the 1980s, some preliminary histopathology was
performed on an undisclosed number of affected lake trout where branchial tissues were
collected and examined using light and electron microscopy. Changes included epithelial
hyperplasia and hypertrophy of the primary and secondary gill lamellae as well as branchial
inclusions along the secondary lamellae (2). Additional organs collected from a limited number
of fish revealed renal glomerulitis, renal tubule degeneration and epithelial hyperplasia of the
skin, nares, upper palate and alimentary tract.

7.3. Molecular techniques
7.3.1. PCR
Without the ability to isolate EEDV in cell culture, recent diagnosis has involved the use
of molecular techniques including PCR. In 2009 a diagnostic quantitative PCR (qPCR) assay for
detection of EEDV was developed based on the terminase gene sequences for the three salmonid

29

herpesviruses described at that time (1, 5). This assay uses a Taq polymerase and has a reported
detection limit of 10 viral copies (5). Following the identification and molecular description of
salmonid herpesviruses -4 and -5, it was determined that this initial qPCR assay was unable to
distinguish between the later three viruses (14). At this time, a novel assay was designed using
SYBR Green and primer sets that recognized sequences on the glycoprotein gene, which was
capable of quantifying and differentiating between all five salmonid herpesviruses (14).

7.3.2. LAMP
Loop-mediated isothermal amplification (LAMP) assays have become a promising
method of virus detection due to their rapid speed, cost effectiveness (compared to the relatively
expensive qPCR), specificity and sensitivity (19), as well as their potential for commercialization
(18). LAMP assays have several advantages when compared to PCR, first of which is the
performance of amplification under isothermal conditions negating the need for expensive
laboratory thermal cyclers (19). Additionally, LAMP makes use of three primer sets rather than
just one, resulting in increased specificity and decreased background noise and non-specific
binding (19). Finally, LAMP has the potential to be commercialized and used in peripheral
laboratories with minimal staff training and no specialized equipment (102). In an aquaculture
setting, such a tool would be invaluable in that pathogen identification could occur on site at a
hatchery in a short period of time, allowing for more rapid instigation of treatment protocols. In
fact, LAMP assays have been designed and implemented for the identification of the aquatic
pathogens such as fathead minnow nidovirus (103) and Edwardsiella tarda (104).

30

8. Knowledge Gaps and Study Objectives
Our current knowledge of EEDV is based mainly on case reports and studies following
the initial disease outbreaks in the 1980s (2–4) with the addition of improved molecular
diagnostic assays over the past few years (5, 14). Despite the catastrophic losses of a valuable
native fish species caused by this virus, with its apparent disappearance for up to a decade at a
time, coupled with its challenging diagnosis, our knowledge base regarding the biologic and
pathologic properties of EEDV remains mostly unchanged over the past several decades; a fact
that recent events have thrown into sharp focus. While initially believed to have been eradicated
by depopulation of infected fish, increasing intra- and inter-hatchery biosecurity and decreasing
transportation of fish between at-risk bodies of water (5), the continued identification of EEDV
genomic material coupled with recent disease outbreaks (5, 14) demonstrates the virus’
continued presence in the Great Lakes basin and underscores the need for further research
focused at improving our understanding of this deadly pathogen.
It is currently believed that EEDV is host species specific and has no significant
deleterious effects on exposed salmonid species other than lake trout (3) and potentially its
hybrid (105), however with the recent re-emergence of the virus after an extended quiescent
period, it is unknown whether or not this remains true for current active virus strain(s). While
previous studies have shown that EEDV is specific for lake trout (4) it is still possible that other
species may develop unapparent infections and/or act as disease reservoirs or carriers. The
identification of viral targets and at risk populations is vital to preventing additional losses from
EEDV infections.
Current disease prevalence in hatchery and wild lake trout is unknown due to lack of
accurate and practical diagnostic tests (5). Vertical transmission potential is unknown, however

31

EEDV DNA was detected in ovarian fluid of spawning adult lake trout, indicating a potential for
vertical or egg-associated transmission (5). Detection of viral DNA was also found in the skin of
non-clinical juvenile lake trout (5) suggesting the potential for latency. While this data highlights
the continued presence of EEDV in the Great Lakes basin, many questions remain regarding
origin of and pathogenesis behind these positive tissue samples.
The most likely targets for viral entry into the body are via the skin or fins, based on the
results of histologic and electronmicroscopic examination of tissues from infected fish (3).
Unfortunately, while pathogenesis studies have been performed and analyzed for many of the
aquatic herpesviruses, there is a lack of extensive, controlled histopathologic studies on EEDV as
much of the previous work with this virus has focused primarily on improving diagnostics
through genome sequencing, assay development and tissue culture trials. The result is that while
there are reports of pathologic changes observed in severely diseased fish collected during
mortality events, the early stages of infection remain a mystery (3, 4).
The continued presence of EEDV in the Great Lakes basin presents a major threat to
established rehabilitation efforts, yet unfortunately there remains a large knowledge gap
surrounding EEDV, which is preventing the effective management and prevention of this
disease. The potential for outbreaks in either hatcheries or wild lake trout populations is
particularly sobering without the knowledge of how to effectively manage such an epizootic. To
that end, this dissertation was designed with the following study objectives:
Objective 1. Shed light on the details of two recent EEDV epizootics. Within the past six
years, there have been two mortality episodes among captive lake trout at a state fish hatchery in
northern Michigan. With the identification of EEDV as the causative agent in these epizootics, a
virus which had not caused such mortalities in almost 30 years, it is clear that this virus still

32

constitutes a major threat to lake trout rehabilitation efforts in the Great Lakes basin. A complete
and thorough understanding of when and how and why these mortality events occurred is vital to
not only the furthering of knowledge of EEDV ecology, but also in preventing future disease
outbreaks.
Objective 2. Establish a repeatable model of infection capable of mimicking natural
EEDV disease in controlled laboratory environments. As an in vitro model of viral replication
has not yet been established for EEDV, in order to proceed with experimental challenges aimed
at improving the understanding of EEDV disease ecology, two things must first occur: 1) a stock
of infectious virus must be produced from the tissues of naturally infected fish, and 2) it must be
shown that this stock is repeatedly capable of producing clinical EED in controlled laboratory
conditions. Previously in our laboratory, similar studies have been performed using Viral
Hemorrhagic Septicemia Virus (106), and Fathead Minnow Nidovirus (107) which served as a
guide for development of an in vivo model of EEDV replication and disease development.
Initially, a stock of infectious EEDV tissue homogenate was produced via in vivo serial passages
through naïve juvenile lake trout. Next, in order to mimic a natural route of infection, a new
group of lake trout were exposed to EEDV via immersion bath at a wide range of doses so to
determine a range at which clinical disease is produced. Based on the results of that trial,
additional challenges were performed, in replicate, in order to assess the reproducibility of
experimentally induced morbidity and mortality.
Objective 3. Determine the sequential distribution of EEDV among various tissues and
cell types using qPCR and in situ hybridization. Quantitative PCR and in situ hybridization have
been utilized as tools to identify tissue targeted entry points of Cyprinid Herpesvirus-3 in koi and
common carp (71) as well as to determine that gill, kidney and spleen are the primary tissue

33

targets of Cyprinid Herpesvirus-2 in Prussian carp (Carassius auratus gibelio) (108). Based on
these study designs, in order to evaluate the tissue and cellular targets of EEDV in lake trout
hosts, juvenile fish were exposed to a moderate dose of EEDV via immersion bath, after which
ten separate tissues were collected over the course of 42 days. Viral load amongst tissues and
visualization of viral genetic material within specific cell types over the course of the study was
evaluated.
Objective 4. Determine the extent to which EEDV infection sequentially alters individual
organs and tissue layers both grossly and microscopically in its natural host, the lake trout.
Many comprehensive histopathologic studies have been performed with members of the
Alloherpesviridae family (87, 90, 101, 109), however EEDV is not one of them. Current
understanding of EEDV-caused pathology is limited to analysis of lesions collected during
mortality events, which naturally lack details regarding the early stages of disease. In order to
assess the gross and microscopic pathology associated throughout the early stages of an EEDV
infection through development of severe morbidity or mortality, a complete set of tissues was
collected from multiple fish on pre-determined sampling days. Microscopic lesions were scored
in order to help evaluate the progression of disease severity over time.
Objective 5. Develop and characterize a cell culture system of lake trout origin. Cell
culture has become a vital tool in aquatic animal medicine and research. Unfortunately there are
often instances where a species-specific cell line is required, however the number of
commercially available cell lines originating from fish tissue is severely lacking, and none exist
from lake trout. In order to rectify this, tissues were collected from three different groups of lake
trout (i.e., broodstock, yearling and fry), digested and seeded into cell culture flasks to produce
primary cultures. Upon becoming confluent, flasks were subcultured, and eventually viral

34

susceptibility to three different aquatic viruses was assessed as well as determining optimal
growing conditions for newly established cell cultures (e.g., incubation temperature, growth
medium, and serum concentration).
Objective 6. Develop and evaluate the sensitivity and specificity of a quantitative loop
mediated isothermal amplification (LAMP) assay for the detection of the EEDV virus by
comparison to the SYBR green quantitative PCR assay already in use. LAMP assays have
become favored in molecular diagnostics as they are equally as sensitive and specific as PCR,
more cost effective to develop and run, and have the potential for commercialization and use in
field environments (19). In the absence of a cell line capable of supporting EEDV replication,
molecular assays become the primary mode of diagnosis. A novel quantitative LAMP assay was
optimized in the presence of calcein to MgCl2 and dNTP concentration as well as incubation
temperature. Diagnostic sensitivity and specificity were established and compared to real-time
qPCR as was the capability of the assay for viral load quantification.

35

APPENDIX

36

Figure 1.1 Cladogram depicting relationships of select viruses within the order Herpesvirales
and between the families Herpesviridae, Malacoherpesviridae and Alloherpesviridae (modified
from Waltzek et al. (2009) (1)).

37

Figure 1.2 Phylogram depicting relationships of the four genera within the Alloherpesviridae
family (modified from Waltzek et al. (2009) (1) and Glenney et al. (2016) (14)).

38

Chapter 2

Resurgence of Salmonid Herpesvirus-3 infection (Epizootic Epitheliotropic Disease) in
hatchery propagated lake trout (Salvelinus namaycush) in Michigan

39

1. Abstract
Over the past century, populations of the economically and ecologically important North
American lake trout (Salvelinus namaycush) have been threatened throughout the Great Lakes
basin (GLB) due to over-fishing, habitat destruction, introduction of invasive species, and
emerging infectious disease. To combat these declines, state and federal fishery management
agencies undertook substantial fishery conservation efforts, including more stringent regulation
of sport and commercial catch limits and increasing hatchery propagation of lake trout that are
stocked into GLB waterways. One state fish hatchery involved in these rehabilitation efforts
experienced mass mortality events in the fall of 2012 and of 2017. In 2012, following a period of
abnormally heavy rain, hatchery staff observed abnormal behavior followed by increased
mortalities in two strains of lake trout fingerlings that reached upwards of 20% and totaled a loss
of approximately 100,000 fish. In 2017, following another heavy rain season, 6-8% of two-year
old lake trout experienced morbidity and mortality similar to that observed in 2012. During both
episodes, brook trout (Salvelinus fontinalis) and splake (lake trout x brook trout hybrid) reared in
flow-through systems receiving water from diseased lake trout remained clinically unaffected.
Molecular analyses revealed that all lots of affected lake trout were infected with Salmonid
Herpesvirus-3 (Epizootic Epitheliotropic Disease Virus, EEDV). Further sampling detected
EEDV in apparently healthy 5-year old lake trout, and in wild mottled sculpin (Cottus bairdii).
Rivers’ postulates were fulfilled by exposing naïve lake trout to infectious material, resulting in
similar disease signs. Despite going undetected for many years, these two EEDV episodes
clearly demonstrate the continued presence of this deadly virus in the Great Lakes basin.

40

2. Introduction
The lake trout (Salvelinus namaycush) is an invaluable constituent of the fish fauna
residing within the Laurentian Great Lakes Basin of North America (13). In addition to their
intrinsic ecological value as a native species, lake trout are also a valuable commercial and sports
fishery commodity (6). Unfortunately, Great Lakes lake trout fisheries have steadily declined due
to overfishing, habitat degradation, predation by the sea lamprey (Petromyzon marinus), and
alewife (Alosa pseudoharengus) invasion (6–9, 11, 12, 95). As a result, state and federal fishery
management agencies developed programs to regulate lake trout harvest and create selfsustaining wild populations (6), which included bolstering depleted wild populations by the
stocking of hatchery-raised lake trout as well as supplementing wild populations in water bodies
with low natural egg survival rates (6).
During their tenure in hatcheries, lake trout are susceptible to a number of infectious
diseases (110, 111), including one particularly devastating disease caused by Epizootic
Epitheliotropic Disease Virus (EEDV; Herpesvirales, Alloherpesviridae). This herpesvirus, also
known as Salmonid Herpesvirus-3, led to the loss of approximately 15 million juvenile,
hatchery-reared lake trout in the 1980s in seven state and federal hatcheries across three states in
the Great Lakes region (2–4). In an attempt to control this virus and limit its spread, fishery
managers opted for depopulation and disinfection of affected hatcheries, along with the
implementation of movement restrictions for Great Lakes basin lake trout (5). It appeared these
control efforts were largely successful because reports of EEDV outbreaks, characterized by a
rapid onset of mortality in young (< 2 years of age) lake trout, hyperplastic lesions of the skin
and gill epithelia, ocular hemorrhage (2), and secondary infections (5) ceased. However, the
virus was detected in the reproductive fluids of wild, spawning adult lake trout in Lake Superior,

41

Wisconsin as well as in the skin of both apparently healthy hatchery-raised juvenile lake trout
and those experiencing mortalities (severity of mortalities unreported) (5).
Herein, we report two mortality events associated with EEDV that occurred in lake trout
at a state fish hatchery in Michigan’s Upper Peninsula during the fall of 2012 and 2017. This
apparent resurgence of EEDV following decades of covertness highlights the need to better
understand the biological properties of this virus, along with the intricacies of the host-virus
interactions.

3. Materials and Methods
3.1. Lake trout mortality events
In September of 2012, Michigan’s Upper Peninsula experienced several days of heavy
rain, resulting in the flooding of many smaller streams and creeks including Cherry Creek, which
is a surface water source for Marquette State Fish Hatchery (MSFH; Marquette County, Lake
Superior watershed). At the time, MSFH was raising two strains of lake trout (i.e., Lake Superior
(LS) and Seneca Lake (SE) strains), brook trout (Salvelinus fontinalis), and splake (lake trout x
brook trout hybrid), all of which were housed in covered, outdoor raceways (12,786-14,793
gallons) with an average of 90,000 fish per raceway. As a whole, the hatchery receives both well
water and spring water from nearby Cherry Creek; production aged fish receive Cherry Creek
water at an approximate rate of 1,200 gallons per minute. As an additional precaution, all water
supplying broodstock fish is passed through an ultraviolet filter before entering the raceways.
Among the production fish, the brook trout, LS lake trout, and a portion of the SE lake trout were
receiving first pass water, whereas the splake and the remainder of the SE lake trout were
receiving second pass water and were housed immediately downstream of the first pass raceways

42

(Figure 2.1). Shortly after the period of abnormally heavy rains, mortality began to climb in both
strains of juvenile (approximately 8 months post-hatch) lake trout (Figure 2.2). Between October
2nd and November 8th 2012, moribund lake trout from two lots were collected live for clinical
examination. Over the five-week period, diagnostic examinations were performed on a total of
60 LS and SE lake trout (30/strain).
In September of 2017, elevated mortality was once again reported at MSFH, also
following a heavy rain event, this time in one lot of 2-year old LS lake trout. Moribund fish (n =
10) were collected live and sent for clinical examination.

3.2. Clinical examination
Upon receipt at the laboratory, fish were euthanized with an overdose of tricaine
methansulfonate (MS-222; Argent Chemical Laboratories, Redmond, Washington; 0.25 mg/mL)
and immediately subjected to gross external pathological examination. Wet mounts of gill tissues
and skin lesions were prepared and examined for presence of parasites, fungi and bacteria via
light microscopy. Next, fish were surface disinfected with 70% ethanol and gross internal
pathological examination and aseptic tissue collections performed following guidelines presented
in the American Fisheries Society Fish Health Section (AFS-FHS) Blue Book (2016) (40).

3.3. Bacteriology
For primary bacterial isolation, 10 µL sterile disposable loops were used to streak kidney
tissues directly onto trypticase soy agar (TSA; Remel Inc., San Diego, California, USA), Hsu
Shotts medium (HSM) (112), and cytophaga agar (CA) (113), which were incubated aerobically
at 22°C (TSA and HSM) or 15°C (CA) for up to seven days. Additionally, representative brain

43

and gill tissues, as well as tissues from skin/muscle lesions, were streaked onto HSM and/or CA
due to suspicion of flavobacterial involvement. Resultant bacterial growth was recorded, subcultured, and identified as recommended in the AFS-FHS Blue Book (40). Specifically for F.
psychrophilum, molecular confirmation was performed as previously described (114).

3.4. Virus isolation
Kidney, spleen and heart tissue samples were aseptically collected, diluted 1:4 (w/v) with
Earle’s salt-based minimal essential medium (MEM; Invitrogen, Thermo Fisher Scientific,
Waltham, Massachusetts, USA), supplemented with 12 mM Tris buffer (Sigma-Aldrich, St
Louis, Missouri, USA), penicillin (100 IU/mL; Invitrogen), streptomycin (100 µg/mL;
Invitrogen), and amphotericin B (250 µg/mL; Invitrogen). Tissues and diluent were then
homogenized and centrifuged at 4,700 x g for 30 minutes, and the supernatant clarified by a
second centrifugation at 2,700 x g for 20 minutes. The final supernatant was used to inoculate
cell cultures of Epithelioma papulosum cyprini (EPC) (115) and Chinook salmon embryo
(CHSE-214) (116) cell lines and examined for cytopathic effects as per the guidelines of the
AFS-FHS Blue Book (2016) (40). Skin, fin, gill (2012 and 2017), and eye (2017 only) tissues
were collected and stored at -20°C for further molecular diagnostics (see below).

3.5. Histopathology
Skin, muscle, fin, gill, eye, kidney, spleen, heart, and liver tissues, as well as transverse
and sagittal whole body sections were collected from representative fish and preserved in
phosphate-buffered 10% formalin for histopathological assessment. After embedding within

44

paraffin, tissues were sectioned at 5 µm, stained with hematoxylin and eosin (H&E) (117) and
examined under a light microscope.

3.6. Molecular analysis
In the years following the 2012 mortality episode and as EEDV molecular assays were
being designed and improved, two novel salmonid herpesviruses (i.e., SalHV-4; Atlantic salmon
papillomatosis virus (90), and SalHV-5; Namaycush Herpesvirus (94)) were identified and found
to possess some terminase gene sequence similarity with EEDV (14). However, glycoprotein
gene sequence analysis allowed for development of highly sensitive qPCR assays specific to
each of salmonid herpesviruses -3, -4, and -5 (14). Therefore, in the present study, three separate
PCR assays were employed (14):

a) End-point PCR (terminase gene; amplifies DNA from SalHV-3, -4, and -5) (14)
b) TaqMan qPCR (terminase gene; amplifies DNA from SalHV-3, -4, and -5) (14)
c) SYBR Green qPCR (glycoprotein gene; amplifies DNA from SalHV-3 only) (14)

End-point PCR was used in the 2012 and 2017 EEDV outbreaks for gene sequencing and
phylogenetic analyses (see below) whereas the TaqMan qPCR was used for screening purposes
from 2012 through the summer of 2016 until the SYBR Green qPCR assay was developed and
optimized to definitively identify EEDV infected fish (14).
As the available molecular assays changed between 2012 and 2017, so too did the
knowledge of EEDV tissue tropism and optimal diagnostic samples (data not shown). As a
result, early EEDV testing following the 2012 mortality episode was performed on pools of

45

kidney, spleen and gill tissues lethally collected from juvenile fish, while mucous was nonlethally collected from adult broodstock in order to allow for screening of a larger number of fish
without significantly influencing broodstock availability for future fish production. Historical
samples from 2007-2012 consisted of kidney, spleen and heart pools previously collected for
virological screening and stored at -20°C.
For viral DNA extraction, one of two extraction methods was used. For the TaqMan
qPCR, the MagMaxTM 96 Viral RNA isolation kit (Life Technologies, Grand Island, New York,
USA) was used manually, following manufacturer’s instructions. Samples were lysed using
Proteinase K and Lysis buffer (Qiagen, Germantown, MD, USA), and incubated in a water bath
at 55°C for 1 hour. Following lysis, samples were centrifuged at 21,000 x g for 10 minutes and
the supernatant used in the extraction process. Following the development of the SYBR Green
qPCR assay, viral DNA extractions were performed manually using the Mag Bind® Blood and
Tissue DNA Kit (OMEGA Bio-tek, Inc, Norcross, Georgia, USA), following the manufacturer’s
instructions and with the addition of a filtering step using the E-Z 96® Lysate Clearance Plate
(OMEGA Bio-tek, Inc, Norcross, Georgia, USA) after tissue digestion (14). Following all
nucleic acid extractions, DNA was quantified using a Quant-iT DS DNA Assay Kit and a Qubit
fluorometer (Life Technologies, Grand Island, New York, USA) and diluted to a standard
concentration using nuclease free water.
All qPCR reactions were carried out in a Mastercycler ep realplex2 S real-time PCR
machine (Eppendorf, Hauppauge, New York, USA). Both the TaqMan and SYBR Green assays
were performed as described previously (14) with the exception that the total reaction volume of
the SYBR Green assay was 20 µL; 30-60 ng total DNA was added to each qPCR reaction. Using
the Mastercycler ep realplex2 S accompanying software at the manufacturer’s default settings,

46

samples were considered positive based on a threshold setting of the computer default noiseband
for the TaqMan assay and 10% maximum florescence for the SYBR Green assay with a limit of
35 cycles for all samples. Positive extraction controls consisted of EEDV-positive tissue samples
from diseased lake trout collected during a natural EEDV outbreak. Positive amplification
controls and standards were produced for both the TaqMan and SYBR Green assays as
previously described (14). Negative controls consisted of water as well as negative tissue
extraction controls from disease-free lake trout.

3.7. Gene sequencing and phylogenetic analysis
Representative samples (n = 4 per episode) that were positive via the TaqMan qPCR (in
2012) or SYBR Green qPCR (in 2017) were selected for endpoint PCR and subsequent gene
sequencing and phylogenetic analysis. Amplicons for sequence analysis were produced using
primers 194F (5’ - TAG TCT GAT CCC CCT CAT GC - 3’) and 249R (5’ - GTC GAG TCC
GAC ACC AGA TT - 3’), which amplify a 324 bp fragment of the terminase gene (14). Each 50
µL reaction mixture was comprised of 25 µL 2x Go-Taq Green Master Mix (Promega, Madison,
Wisconsin, USA), 250 mM of each primer, 50 ng of DNA template, and DNase-free water.
Cycling parameters consisted of an initial denaturation step at 95°C for 15 minutes followed by
35 cycles of 94°C for 30 seconds, 59.5°C for 30 seconds and 72°C for 1 minute with a final step
of 72°C for 10 minutes and were carried out in a Mastercycler Pro Thermal Cycler (Eppendorf,
Hamburg, Germany). Amplicons and a 1 kb molecular ladder (Roche Applied Science,
Penzberg, Germany) were combined with SYBR Green (Cambrex Bio-Science, Lonza Group,
Basel, Switzerland), electrophoresed through a 1.5% agarose gel at 50V for 45 minutes, and
visualized under ultraviolet light. Amplicons were then purified using a QIAquick PCR

47

Purification Kit (Qiagen, Hilden, Germany) and Sanger sequenced at the Michigan State
University Research Technology Support Facility using both the forward and reverse primers.
For phylogenetic analyses, contigs were assembled using the contig assembly program in
Bioedit Sequence Alignment Editor (118). Multiple sequence alignment was done using
ClustalW in the Molecular Evolutionary Genetics Analysis software (MEGA; version 6.0) (119),
whereby reference terminase gene sequences for Salmonid Herpesvirus-1 through -5 were
downloaded from GenBank (NCBI) and included in the alignment (a total of 303 bases were
included in the final data alignment set). The optimal model for phylogenetic reconstruction was
assessed in MEGA 6.0 and the model with the lowest Bayesian Information Criterion (Kimura
Two Parameter model with gamma distribution, K2+G) was selected. Neighbor-joining analysis
was carried out in MEGA 6.0 with 1,000 resamplings. Bayesian analysis was conducted in
MRBAYES version 3.1.2 (K2+G model) (120). The Markov chains (n = 4) were run for up to
one million generations, with a stopping rule in place once the analysis reached an average
standard deviation of split frequencies of <0.01. Two independent analyses were conducted, with
the initial 25% of Markov chain Monte Carlo samples being discarded as burnin and sampling
occurring every 500 generations. Results from Bayesian analyses were visualized in FigTree
v1.3.1 (121).

3.8. Pilot experimental challenges
To confirm the virulence of the EEDV strain associated with the 2012 hatchery disease
outbreak and fulfill Rivers’ Postulates, pilot experimental challenges were performed. Juvenile
LS strain lake trout (approximately 6 months post hatch) were collected from MSFH while
maintained on a closed (i.e., well) water system and transported live to the Michigan State

48

University - University Research and Containment Facility (East Lansing, Michigan). The
originating lot of fish used for experimental challenges was not present in the hatchery system
during either mortality episode. Upon receipt, fish were held in a 680 L fiberglass tank supplied
with continuous flow-through oxygenated well water (12.0 ± 1.0°C). Fish were fed 1.0 mm
sinking feed (BioOregon, Westbrook, Maine, USA) daily and allowed to acclimate to laboratory
conditions for at least one month prior to use in experimental challenges. Sixty fish were
randomly collected, clinically examined, and determined to be free from fish pathogens as per
the guidelines of the AFS-FHS Blue Book (2016) (40). Likewise, EEDV qPCR confirmed an
absence of EEDV. Experimental challenges were performed in accordance with the Institutional
Animal Care and Use Committee.
All experimental challenges were performed in 42 L continuous, flow-through tanks
receiving oxygenated, chilled, well water (9.0 ± 0.5°C), and fish were allowed to acclimate for a
minimum of 48 hours to experimental conditions prior to start of challenges. A stock of
infectious EEDV was produced from the skin of MSFH-naturally infected lake trout following
mortality. Skin was homogenized in a sterile phosphate buffered saline solution (PBS; pH 7.5 ±
0.5; Sigma-Aldrich, St Louis, Missouri, USA) at a 1:3 (w/v) ratio, and clarified via low speed
centrifugation (1,400 x g) for 20 minutes at 4°C.
Next, LS strain lake trout (n = 5 challenge group and n = 5 control group) were
anesthetized using tricaine methansulfonate (MS-222; Argent Chemical Laboratories, Redmond,
Washington; 0.1 mg/mL) then IP injected with either EEDV stock (1.22x107 viral copies per
fish) or sterile PBS. Following recovery from anesthesia, fish were transferred back to
experimental tanks for the duration of the studies.

49

All fish were fed and monitored daily for development of clinical signs of disease,
morbidity or mortality for 2 months following injection. Any moribund fish displaying severe
clinical signs such as altered behavior, inability to maintain balance, gasping for air or
significantly pale gills was euthanized with MS-222 (0.25 mg/mL). At the end of the two-month
period, surviving fish were euthanized. Skin tissues were collected from all fish immediately
following death and tested for the presence of EEDV using the TaqMan qPCR protocol
described above.

3.9. Intra- and extra-hatchery EEDV surveillance
After the 2012 mortality event, all lots of fish at the hatchery were screened for the
presence of EEDV. Between the fall of 2012 and the spring of 2013, pools of kidney, spleen and
gill were collected from a total of 120 juvenile LS lake trout, 240 juvenile SE lake trout, 480
juvenile brook trout, and 240 juvenile splake while mucous was collected non-lethally from 60
adult brook trout and 270 adult LS lake trout. Routine EEDV surveillance screening continued
among MSFH lake trout through 2017 for both production fish (n = 60 per lot) and broodstock
fish (n = 10 per lot) with the testing of kidney, spleen, gill, fin, skin and eye tissues (Table 2.1).
Additionally, wild fish were collected by standard electrofishing from Cherry Creek,
upstream of MSFH, and tested for the presence of EEDV (Table 2.2). In 2012, 70 each of brook
trout, brown trout (Salmo trutta), and mottled sculpin (Cottus bairdii) were collected from
Cherry Creek with 60 of each of these three species collected and tested in 2013. From 20142017, 60 mottled sculpin per year were collected from Cherry Creek for EEDV screening.

50

4. Results
4.1. Description of MSFH mortality events
In 2012, approximately 10 days after the heavy rains, juvenile LS lake trout began
exhibiting decreased appetites, evidenced by a lack of interest in food. Within three days, the LS
lake trout in raceways 5a and 5b (Figure 2.1) began displaying flashing and were lethargic.
Similar changes were noted 10 days later in the SE lake trout in raceway 6, followed one month
later by the SE lake trout in raceways 4a and 4b. Affected fish developed multifocal skin pallor
that in some instances became overgrown with white. The mortality episode spanned over 200
days, with the cumulative mortality by raceway ranging from >15% to >25% (Figure 2.2) and
total losses exceeding 100,000 lake trout. Based upon initial clinical examinations, disease signs,
and the detection of Flavobacterium psychrophilum in external lesions (see below), affected lake
trout initially received an immersion treatment with Chloramine-T (Halamid®, Syndel USA,
Ferndale, Washington, USA; 10 mg/mL for 1 hour for 3 consecutive days, repeated a second
time after two days of no treatment). After no discernible improvements, this was followed by
two treatment courses with Florfenicol medicated feed (Aquaflor; Merck Animal Health,
Madison, New Jersey, USA; 10 mg/kg body weight per day for 10 days), which resulted in only
a slight and brief decrease in mortality.
Likewise, in late September 2017, 2-year old LS lake trout (20-27 cm in length) at MSFH
began developing disease signs similar to those seen in 2012. Initial mortalities were
approximately 5 fish per day with an additional 12-15 showing signs of morbidity by day. These
levels of mortalities continued through the following month.

51

4.2. Clinical examination
During the 2012 mortality event, both strains of moribund lake trout showed a number of
external disease signs, including ocular hemorrhage with or without corneal opacity (Figure 2.3a,
2.3b), gill pallor, multifocal to diffuse skin “ blotchiness” (Figure 2.3c) that was sometimes
accompanied by erythema (Figure 2.3d), ulcerations that penetrated through the epidermis and
dermis of the skin into the underlying muscle (Figures 2.3e, 2.3f), as well as ulcers that were
overgrown by water mold hyphae (Figure 2.3g). In some instances, ulceration progressed to the
point where the caudal fin had eroded completely (Figure 2.3h) and was also accompanied by a
yellowish discoloration (Figure 2.3i), which is commonly associated with flavobacteria (see
below). Other notable disease signs included erythema of the fins (Figure 2.3d), oral cavity,
isthmus and ventrum, and excess mucus production of the skin. Internally, occasional
hemorrhage within the adipose tissue, hemorrhagic enteritis, splenomegaly, and renal congestion
were observed. Clinical findings were similar between both strains of lake trout; however, those
seen in the LS strain tended to be more severe than those in the SE strain.
During the 2017 outbreak, disease signs similar to the 2012 outbreak were observed and
were once again predominated by ocular hemorrhage (Figure 2.4a), varying degrees of skin
ulceration (Figure 2.4b, 2.4c), and overgrowth by water mold (Figure 2.4d). In both the 2012 and
2017 outbreaks, microscopic examination of skin and gill preparations revealed the presence of
occasional monogeneans (Gyrodactylus spp.), gliding filamentous bacterial rods consistent with
flavobacteria, and aseptated hyphae consistent with the oomycete Saprolegnia.

52

4.3. Bacterial and viral isolation
Flavobacterium psychrophilum was recovered from a portion of the external lesions, and
motile Aeromonas spp. were occasionally recovered in kidney cultures, albeit in relatively low
quantities. No signs of viral replication were observed following cell culture inoculation.

4.4. Histopathology
Histopathological findings in EEDV-infected lake trout collected during the 2012
outbreak included corneal epithelial necrosis and/or ulceration (Figure 2.5a), epithelial necrosis
and ulceration of the skin (Figure 2.5b), lamellar edema (Figure 2.5c), gill epithelial
swelling/hypertrophy (Figure 2.5d), proteinaceous exudate within both Bowman’s space and the
renal tubules (Figure 2.5e), renal tubular epithelial necrosis (Figure 2.5f), and multifocal necrosis
of the renal interstitium (Figure 2.5f). Similar microscopic changes were observed in EEDVinfected 2 year old LS lake trout in 2017; however, individual necrosis of the gill lamellar
epithelium and a moderate dermatitis in the skin were also observed, as was hemosiderosis
within the spleen.

4.5. Molecular identification
PCR-based molecular assays clearly demonstrated the presence of a Salmonid
Herpesvirus in affected MSFH lake trout tissues from 2012. Skin, gill and kidney/spleen tissues
from 16 fish (8 LS and 8 SE strain lake trout) tested positive via endpoint and TaqMan qPCR,
although sequencing was required for confirmation of EEDV identity (see below). EEDV was
detected in the LS lake trout from 7/8 gill samples, 7/8 kidney/spleen samples and 8/8 skin
samples and in the SE lake trout from all 24 tissues tested. Viral gene copy number per reaction

53

in the LS lake trout ranged from 30-2.3x103 (median = 201) in the gills, to 14-656 (median =
134) in the kidney/spleen, and 1.98x104-9.80x105 (median = 9.22x104) in the skin. Viral gene
copy number per reaction in the SE lake trout ranged from 1.92x103-9.63x104 (median =
1.26x104) in the gills, to 10-5.45x104 (median = 40.6) in the kidney/spleen, and 270-1.44x104
(median = 2.56x103) in the skin.
The presence of EEDV in the 2017 mortality event was confirmed using the SYBR green
qPCR assay, as well as with endpoint PCR and gene sequencing (see below). All tissues
collected from moribund fish were positive for EEDV: 10/10 skin lesions (2.57x104-1.42x106;
median = 2.04x105 copies) and 10/10 eye tissues (8.68x103-2.38x107; median = 1.38x106
copies).

4.6. Sequencing and phylogenetics
Amplification and sequencing of a portion of the EEDV terminase gene from four
naturally infected lake trout from each of the 2012 and 2017 EEDV outbreaks led to the
generation of gene fragments totaling 311-322 bps in length. Percent similarity analysis revealed
that 3 out of 4 MSFH EEDV isolates from 2012 and 4 out of 4 2017 isolates were 100% similar
to the Salmonid Herpesvirus-3 isolate from Wisconsin (accession # EU349284) at this locus,
whereas 1 2012 isolate was 99.7% similar (310/311 bp) to the Wisconsin reference isolate.
Phylogenetic analyses placed the eight MSFH EEDV isolates into a robustly supported clade
(i.e., posterior probability and bootstrap values >70) that also contained the Wisconsin reference
isolate, which shared a most recent common ancestor with Salmonid Herpesvirus-4 and -5
(Figure 2.6).

54

4.7. Pilot experimental challenges
In the EEDV experimentally challenged fish, 80% mortality was reached at 29 days postinfection with previous mortalities occurring at days 6, 13, and 20 post-infection. EEDV was
detected in multiple tissues from infected fish that died on days 13, 20, and 29 post-infection.
The virus was found in the skin/fin (3/5 fish; 9.40x104-2.50x106; median = 5.85x105 copies per
reaction), gill (2/5 fish; 4.61x103-5.26x103; median = 4.93x103 copies per reaction), and
kidney/spleen (3/5 fish; 360-2.72x103; median = 868 copies per reaction) of experimentally
challenged fish. Clinical signs were consistent with those seen in the natural epizootics and
included ocular hemorrhage (Figure 2.7a), skin pallor, erosions and ulcerations (Figure 2.7b,
2.7c), with congestion and erosion of the fins. The control group experienced only a single
mortality, and no evidence of EEDV infection was detected in any control fish.

4.8. Intra- and extra-hatchery EEDV surveillance
Using qPCR as detailed above, EEDV was not detected in any of the adult brook trout or
lake trout broodstock tested in 2012. Of the 120 juvenile LS lake trout and 240 juvenile SE lake
trout tested in 2012 following the mortality episode, EEDV was detected in 24 fish (21-113 virus
copies per reaction; median = 36) and 21 fish (20-1,828 virus copies per reaction; median = 69)
respectively. It is interesting to note that while beyond the established cut off of 35 cycles,
amplification was observed from a total of 132 additional juvenile lake trout tested in 2012.
Likewise, while no juvenile splake or brook trout had detectible levels of EEDV, amplification
was observed after 35 cycles in two brook trout samples and four splake samples (kidney, spleen,
and gill tissues). Following the 2012 mortality event, EEDV screening at MSFH continued

55

through 2017 as detailed in Table 2.1, including the testing of stored historical samples from
2007 and 2011.
During routine surveillance in 2017, EEDV was detected in 8 adult (5 years post-hatch)
and 5 juvenile (2 years post-hatch) LS strain lake trout in fin and eye tissues ranging from 127 to
1.1x107 viral copies in the fin (median = 3.89x103) and 6.9x103 to 2.5x105 viral copies in the eye
(median = 1.28x105). Of note, these samples were collected just prior to the appearance of
disease signs in the affected lot.
EEDV screening in fish collected from Cherry Creek (i.e., the surface water system
feeding MSFH) is detailed in Table 2.2. All brook trout and brown trout collected were EEDVnegative (n = 150 and n = 185 respectively). All mottled sculpin were EEDV-negative except for
five pools (n = 25 fish) in 2013.

5. Discussion
The lake trout-lethal herpesvirus, EEDV, has re-emerged in at least one hatchery within
the Great Lakes basin, where it was once again associated with substantial mortality, severe
disease signs, and high viral loads in multiple strains of fingerling lake trout, with the addition of
disease signs in 2 year old lake trout and virus detection in 5 year old lake trout as well.
Moreover, laboratory experiments aimed at fulfilling Rivers’ postulates confirmed the ability of
the causative virus strain to produce clinical signs and mortality consistent with those seen in
natural EEDV outbreaks, despite the absence of secondary invaders (e.g., oomyetes, F.
psychrophilum, etc.) that were present in the natural outbreaks. The resurgence of EEDV after
decades of an apparent absence is both surprising and perplexing. On one hand, it is known that
some human and animal herpesviruses can run a covert, low-level infection in which the host

56

survives and becomes a viral reservoir within a system (122). On the other hand, sub-lethal
infections are uncommon among the other fish-pathogenic alloherpesviruses, although shedding
of infectious virus has been detected following survival from Cyprinid Herpesvirus-3 infection
(an OIE reportable pathogen) (45, 123, 124). In the case of EEDV, the 1980s reports
demonstrated its high pathogenicity to lake trout and suggested that survival of infected fish was
unlikely. This concept prevailed until Kurobe et al. (2009) (5) developed a novel PCR assay
based on the terminase gene sequence and reported the presence of EEDV in apparently healthy
lake trout collected from Wisconsin waters, signifying that EEDV may be capable of causing
sub-lethal infections within lake trout. Indeed, such infections have subsequently been reported
for EEDV (i.e., Salmonid Herpesvirus-3) and Salmonid Herpesvirus-5 in wild, clinically normal,
adult lake trout throughout the northeastern United States (14, 94). In this context, it is possible
that the MSFH lake trout harbored a sub-clinical EEDV infection prior to the fall of 2012 and
that stressors, such as the heavy rain events that preceded each of the outbreaks and resulted in
an influx of sediment-laden water into hatchery rearing units, led to clinical outbreaks of EEDV.
Alternatively, it is possible the virus found its way into the hatchery via the source water,
as, in 2013, EEDV DNA was detected in mottled sculpin residing upstream of MSFH in Cherry
Creek, the tributary supplying water to the affected fish. Indeed, it was a surprise to detect EEDV
DNA in non-salmonids, as alloherpesviruses are known to be highly species-specific. Detection
of viral DNA on external tissues alone would be questionable as to whether these fish were truly
infected, or if EEDV genetic material was present in the water only. However, the detection of
EEDV DNA within pools of kidney, spleen and heart tissues raises the possibility that these fish
were truly infected, although conclusive determination of whether the virus was active or not

57

was unfortunately not possible. Nevertheless, experiments examining the susceptibility of
sculpin to EEDV are currently underway.
Finally, it is also possible that the lake trout broodstock harbored a sub-clinical EEDV
infection and acted as a source of infection for the progeny in 2012. Although there are no
reports of EEDV vertical transmission, Kurobe et al. (2009) (5) detected EEDV DNA in the
ovarian fluids of spawning lake trout from Lake Superior, and both Salmonid Herpesvirus-3 and
-5 have been detected in the ovarian fluid of clinically normal lake trout from Lake Champlain,
Vermont (14). Likewise, it was suggested that broodstock may be a source of infectious virus
after multiple EEDV outbreaks in the 1980s occurred in juvenile lake trout reared on well water
(4, 5), indicating a source of infection other than the water supply. Additionally, EEDV
outbreaks occurred in first year progeny from wild source broodstock in the 1980s (5), and while
infection source tracking wasn’t possible at the time, the more recent detection of EEDV
genomic material in apparently clinically normal fish (5, 14) allows for the supposition that these
broodstock were harboring an undetected EEDV infection.
The EEDV outbreak in 2017 was equally surprising given that: a) the virus had not been
detected in MSFH since 2012 despite regular surveillance of broodstock and production fish with
the highly sensitive TaqMan and SYBR green qPCR assays; b) it led to mortality in 2-year old
lake trout as opposed to fingerlings or yearlings, which to our knowledge has not been reported
previously; and c) it was associated with severe signs of disease and high virus loads in older
fish. Importantly, during each mortality event, detection of EEDV was limited to a single cluster
of raceways (Figure 2.1), further supporting the importance of biosecurity within the hatchery.
As was the case in the 2012 outbreak, heavy rains preceded the 2017 mortality episode, during
which raceway water temperatures were also within what is believed to be the optimal

58

temperature range (i.e., 9.0 ± 1.0°C) for EEDV outbreaks. Thus, this study suggests that EEDV
is not only capable of causing mortality and frank disease in fingerlings and yearlings, but older
fish as well, further demonstrating the effect this virus can have on lake trout rehabilitation
efforts. Typically, only two year classes of production lake trout are housed on hatchery grounds
at any given time, the youngest of which are held in indoor “nursery” raceways on well water
until the older fish (in the Production Building) are stocked into the wild. Because of this
process, a mortality event in production aged fish, while problematic to that year’s stocking
goals, can potentially be compensated for in following years with alterations in the number of
spawning family pairs and stocking management plans. Significant mortalities in captive
broodstock however have the potential to be catastrophic to lake trout rehabilitation and
population management as these fish are frequently used to produce many consecutive years
worth of production fish. Additionally, lake trout are slow maturing fish, taking typically 6-7
years to reach sexual maturity, meaning were a hatchery to lose a younger lot of broodstock to
EEDV, it could take close to a decade to rebuild a new line of reproductive stock.
The 2012 disease outbreak also revealed some interesting epidemiological aspects of
EEDV within a hatchery environment. First, it is noteworthy that in 2012, the LS lake trout were
the first to show clinical signs of disease, followed by the SE lake trout receiving 2nd pass water
that included water from the affected LS lake trout rearing units, followed lastly by the SE lake
trout that were housed next to the affected LS lake trout (Figure 2.1). As noted previously, the
source of EEDV (e.g., source water, covert infections, and/or broodstock) for this outbreak is
unknown, but the pattern of EED initiation in 2012, coupled to the fish strain, suggests that
susceptibility to EEDV may vary by lake trout strain. Interestingly however, comparison of viral
loads between strains during the 2012 mortality event revealed comparable levels of EEDV

59

between the two strains in the kidney, spleen and skin while the SE lake trout had higher viral
loads in the gills. However, in future screening the virus was detectible either at comparable
levels between strains (2012), or only in the LS lake trout (2017). Knowledge of strain variation
in disease resistance and research into specific genetic markers provides resource managers with
the option to focus or tailor management strategies toward producing more resistant strains of
fish or protecting more susceptible ones. Such a strain variation in susceptibility of rainbow trout
(Oncorhynchus mykiss) to the Infectious Pancreatic Necrosis Virus (IPNV) has been well
documented (125). Armed with the ability to experimentally induce clinical EED, future
experiments can focus on dissecting these potential strain variations as well as more closely
examining the non-lake trout species susceptibility to EEDV.
In addition, the observed temporal pattern of disease also suggests that a water borne
route of transmission (i.e., from LS strain fish in raceways 5a and 5b to SE strain fish in raceway
6), without the need for direct fish to fish contact, may be important in EEDV contagion.
Similarly, the initiation of disease signs and mortality in SE lake trout maintained next to, not upor down-stream from, the LS lake trout that first showed disease signs, highlights the importance
of biosecurity and the potential for virus spread without rearing unit interconnectivity. Lastly,
brook trout, which were reared next to the affected SE lake trout, and splake, which were
receiving 2nd pass water from the EEDV-infected SE and LS lake trout rearing units, never
developed EED. These findings are in line with the reports of Bradley et al. (2) and McAllister &
Herman (4) as no other salmonids on hatchery grounds during the 1980s EEDV outbreaks
experienced mortalities, and experimental challenge of brook trout did not result in clinical
disease or mortalities (3, 4). Interestingly, although there is no peer-reviewed data, it has been
reported that lake trout hybrids can be experimentally infected with EEDV (105).

60

Gross and histopathologic findings in these cases were consistent with those seen in the
initial description of EEDV in the 1980s. As the name of this virus implies, the most significant
microscopic lesions noted in this study were in the skin and gill epithelia, which may contribute
to death of the host through osmoregulatory impairment and/or respiratory dysfunction.
Additionally, the outer layers of the skin and gills serve as an important line of defense against
fish pathogens, and as a result, any insult to this layer can predispose the affected host to a suite
of opportunistic microbial pathogens, as was observed in this study in the form of F.
psychrophilum, Aeromonas spp., and water mold infections in the more progressed EEDVassociated skin lesions.
Recent advancements in phylogenetics have allowed for improvements in our knowledge
of the relationship between fish herpesviruses (1). Gene sequencing and phylogenetic analyses
performed in this study confirmed the identity of the etiological agent as EEDV and also showed
that seven of the eight isolates from the 2012 and 2017 outbreaks were identical to the salmonid
herpesvirus 3 reference isolate (1) over the sequenced portion of the terminase gene. One isolate
displayed a single nucleotide polymorphism (SNP) when compared to the other seven MSFH
isolates and the reference isolate (Figure 2.6). Of note, this SNP led to an amino acid shift from a
glutamine to a leucine (data not shown), but its effects on the functionality of the terminase gene
product, which involve packaging viral DNA into the virus capsid (126), are currently unknown.
Nevertheless, this study confirms the continued presence of highly similar EEDV strains in
multiple Great Lakes states, a matter of grave concern in the context of lake trout rehabilitation
and conservation efforts in the Laurentian Great Lakes.
These recent outbreaks of EEDV within the Great Lakes basin have highlighted the
magnitude of work remaining to be completed in order to fully understand this devastating

61

disease. As molecular diagnostic assays continue to improve, other testing strategies must
improve to match. This includes identifying and screening all at risk populations, particularly
gametes and live fish slated to enter a hatchery system as well as focusing diagnostic efforts on
sample collections most likely to highlight an EEDV infection by identifying viral target tissues.
Increasing our working knowledge of lake trout immunology will allow for the identification of
previously exposed fish and potential susceptibility differentiation between strains of lake trout,
leading to alterations in management strategies to produce larger numbers of more resistant fish.
Efforts must be made to culture this virus, as the current lack of an EEDV-susceptible
cell line hampers both diagnostic options as well as research opportunities. Without the ability to
culture and produce an infectious stock of EEDV, frozen tissues and epizootic-surviving fish,
both potentially containing active EED virus are of vital importance. Possession of these unique
materials will allow this laboratory to perform this much-needed research. Moreover, further
research into the pathogenesis and biological properties of this deadly virus will provide fishery
management agencies with the tools and information necessary to not only prevent future
outbreaks of EEDV, but also continue the successful rehabilitation of lake trout populations
across North America.

62

APPENDIX

63

Figure 2.1 Layout depicting water flow within spatially separated broodstock and
production raceway buildings at Marquette State Fish Hatchery; (A) production raceways in
2012; (B) broodstock raceways in 2017. Numbered circles represent order of disease
progression through production lake trout in 2012 and broodstock in 2017. Stars indicate
raceways from which EEDV genomic material was detected with no associated mortalities.

64

Figure 2.2 Cumulative percent mortalities during the 2012 mortality event at MSFH among juvenile
production lake trout, by rearing unit raceway. Prior to mortality event, production fish numbers were
approximately as follows: (4A) 125,105 fish; (4B) 124,782 fish; (5A) 75,031 fish; (5B) 76,085 fish; and (6)
56,167 fish.

65

Year Tested

Species (Strain)

Age

Tissue Tested

EEDV-positive

2007

Lake trout (LS)

Adult

KSp

0/11

2011

Lake trout (LS)
Lake trout (SE)

Juvenile
Juvenile

KSpH
KSpH

0/6
0/20

Brook trout
Brook trout
Lake trout (LS)
Lake trout (LS)*
Lake trout (LS)
Lake trout (SE)*
Lake trout (SE)
Splake

Adult
Juvenile
Adult
Juvenile
Juvenile
Juvenile
Juvenile
Juvenile

M
KSpG
KSpH, M
KSp, G, Sk
KSpH, G
KSp, G, Sk
KSpH, G
KSpG

0/60
0/480
0/270
8/8
24/120
8/8
21/240
0/240

Lake trout (LS)
Lake trout (LS)
Lake trout (SE)
Splake

Adult
Juvenile
Juvenile
Juvenile

KSpG
G, F, KSpG
G, F, KSpG
G

0/30
2/300
0/240
0/60

Lake trout (LS)
Lake trout (SE)

Juvenile
Juvenile

G
G

0/60
0/80

Lake trout (LS)
Lake trout (LS)
Lake trout (SE)

Adult
Juvenile
Juvenile

SkG
G, SkG
G

0/20!
0/70§
0/60

Lake trout (LS)
Lake trout (LS)
Lake trout (LS)*
Lake trout (SE)

Adult
Juvenile
Juvenile
Juvenile

F, E
F
Sk, E
F

8/80!
5/120!
10/10!
0/120!

2012

2013

2014

2016

2017

Table 2.1 Number of positive fish detected by EEDV screening at Marquette State Fish
Hatchery, 2007-2017 (number positive / number tested). Sampling during mortality episodes
denoted by a (*). Tissues tested included kidney (K), spleen (Sp), heart (H), mucous (M), gill
(G), skin (Sk), fin (F), and eye (E) and were either pooled (i.e., KSpH) or individual (i.e., K,
Sp, H). All samples tested using EEDV TaqMan qPCR as described, except where indicated:
(!) tested with EEDV SYBR green qPCR, (§) tested with both qPCR assays.

66

Year

Species

Tissue

EEDV-positive

2011

Brook trout
Brown trout
Mottled sculpin

Kidney/Spleen/Heart
Kidney/Spleen/Heart
Kidney/Spleen/Heart

0/4
0/11
0/12

2012

Brook trout
Brown trout
Mottled sculpin

Kidney/Spleen/Heart
Kidney/Spleen/Heart
Kidney/Spleen/Heart

0/14
0/14
0/14

Brook trout

Kidney/Spleen/Heart
Gills
Kidney/Spleen/Heart
Gills
Kidney/Spleen/Heart
Gills

0/12
0/12
0/12
0/12
2/12
3/12

2013

Brown trout
Mottled sculpin

2015

Mottled sculpin

Gills

0/12

2016

Mottled sculpin

Gills

0/12

2017

Mottled sculpin

Fin

0/12!

Table 2.2 EEDV screening in Cherry Creek, 2011-2017. No sampling was associated with
a mortality episode. All testing performed in pools of five fish per pool. All samples tested
using EEDV TaqMan qPCR as described, except where indicated: (!) tested with EEDV
SYBR green qPCR.

67

Figure 2.3 Gross clinical signs exhibited by lake trout naturally infected with EEDV in 2012;
Lake Superior lake trout (A, D, E, G) and Seneca Lake lake trout (B, C, F, H). (A) advanced
stage ocular degeneration with hemorrhage and corneal opacity; (B) ocular hemorrhage; (C)
diffuse skin “blotchiness”, dermal erosion and excess mucous production; (D) dermal erosion,
“blotchiness” and erythema, anal fin congestion; (E) dermal erosion, ulceration of trunk and
caudal peduncle; (F) caudal peduncle ulceration, necrosis and dermal erosion; (G) ocular
degeneration with substantial water mold overgrowth; (H) caudal fin ulceration with exposed
vertebrae; (I) caudal fin ulceration, necrosis, petechial hemorrhage and yellow discoloration,
exposed fin rays.

68

Figure 2.4 Gross clinical signs exhibited by Lake Superior strain lake trout naturally infected
with EEDV in 2017. (A) ocular hemorrhage and ulceration; (B) cranial epithelial erosion,
ulceration and hemorrhage; (C) skin erosion, ulceration and hemorrhage of trunk and
dorsum; (D) skin ulceration with secondary overgrowth and hemorrhagic margins.

69

Figure 2.5 Hematoxylin and eosin (H&E) stained tissue sections from hatchery-reared lake
trout that were naturally infected with Epizootic Epitheliotropic Disease Virus. A) corneal
epithelial ulceration and necrosis (400x magnification); B) epithelial ulceration and
necrosis of the skin (400x magnification); C) gill lamellar edema (400x magnification); D)
gill epithelial swelling/hypertrophy (400x magnification); E) proteinaceous exudate within
both Bowman’s space and the renal tubular epithelium (400x magnification); and F) renal
tubular epithelial necrosis and multifocal necrosis of the renal interstitium (400x
magnification).

70

Figure 2.6 Dendrogram depicting the relationships of eight Epizootic Epitheliotropic Disease
Virus (EEDV) isolates (denoted in bold) from the 2012 and 2017 hatchery outbreaks with
isolates representing the five currently described salmonid herpesviruses. The dendrogram was
generated in MRBAYES 3.1.2 (120) using the Kimura Two Parameter model with gamma
distribution based upon the lowest Bayesian Information Criterion. The Markov chains (n = 4)
were run until an average standard deviation of split frequencies of < 0.01 was attained. Two
independent analyses were conducted, with the initial 25% of Markov chain Monte Carlo
samples being discarded as burnin. Posterior probabilities > 70 are displayed at the nodes, where
an * denotes that the same node was supported in Neighbor-Joining analysis (i.e., boot strap
value > 70). The final data set contained 303 bp of the terminase gene.

71

Figure 2.7 Gross pathology associated with experimentally challenged lake trout. (A) ocular
hemorrhage; (B) multifocal pallor, skin and fin erosion; (C) generalized pallor with skin and fin
erosion.

72

Chapter 3

Evaluation of the dose-dependent effects following in vivo infection with Epizootic
Epitheliotropic Disease Virus (EEDV; Salmonid Herpesvirus-3)

73

1. Abstract
Epizootic Epitheliotropic Disease Virus (EEDV; Salmonid Herpesvirus-3) is the
Alloherpesvirus (Order Herpesvirales) of most concern in the Great Lakes basin today, due to its
potentially catastrophic effect on lake trout (Salvelinus namaycush) rehabilitation efforts.
Although it was initially described in the early 1980s, there are many questions remaining
unanswered regarding the virus’ disease ecology, due in part do a lack of an in vitro model to
support its replication. As an alternative, we explored the feasibility of using an in vivo model
with naïve, juvenile lake trout to propagate the virus and study the dose-dependent effects of an
EEDV infection. Primordial rounds of experimental challenges utilized both intraperitoneal
injections and immersion bath challenges in order to establish consistent viral stocks of clarified
skin homogenates as well as to maintain and increase virulence in available viral stocks by
avoiding long-term freezing. Mortalities were seen as early as 6 days post viral challenge with
cumulative percent mortalities ranging from 66-100% and viral titers in stock batches of EEDV
increased approximately 1,000-fold between 1st and 6th passages. After production of an
adequate volume of 7th passage EEDV stock, a study was performed in order to examine
morbidity and mortality following dose-dependent immersion challenge with EEDV, allowing us
to calculate the relative expected doses of EEDV required to produce a range of mortality
percentages (e.g., 50% at 4.70x104 versus 90% at 8.83x105). Following identification of a viral
dose range capable of inducing morbidity and mortality, immersion bath challenges were
performed in triplicate in order to address repeatability of the immersion model. These
immersion challenges served to highlight that 103 viral copies per mL of water is not a sufficient
dose to produce clinical disease, while 106 viral copies per mL of water can produce up to 100%
mortality. This information will allow researchers to proceed with additional studies aimed at

74

uncovering more specific aspects of EEDV biology and pathology such as tissue tropism and the
effect of stressors on development of clinical disease, furthering our knowledge of this highly
destructive virus.

2. Introduction
Epizootic Epitheliotropic Disease Virus (EEDV; Salmonid Herpesvirus-3), Family
Alloherpesviridae, Order Herpesvirales, is of special concern in the Great Lakes basin (GLB)
due to its catastrophic potential on the rehabilitation efforts of lake trout (Salvelinus namaycush)
populations in North America. First reported in the early 1980s, EEDV outbreaks resulted in the
loss of greater than 15 million lake trout before seemingly disappearing for almost three decades
(2–4). While EEDV genetic material has been detected by molecular assay in apparently healthy
lake trout (5, 14), it wasn’t until the fall of 2012 that infection with this virus once again led to a
mass mortality event in a Michigan hatchery (Chapter 2). The re-emergence of this virus in
Michigan’s Upper Peninsula has highlighted the dire need to expand our understanding of the
detailed interactions between this pathogenic herpesvirus and its host. Due to the inability to
replicate this virus in a cell culture system, investigators have been unable to design and
implement research projects to understand the virus’ pathogenic mechanisms or to develop
effective control strategies. As a result, a need arose to explore the feasibility of using
standardized and reproducible in vivo models to propagate the virus and determine its effects in a
dose dependent manner. Herein, we hypothesized that exposing naïve, juvenile lake trout to
clarified EEDV-positive tissue homogenate would result in clinical disease consistent with that
seen in the natural epizootics. The development of such a model would be vital to the success of
future experimental studies and improving our understanding EEDV disease ecology.

75

3. Materials and Methods
3.1. Fish and maintenance
Juvenile, Lake Superior strain lake trout (6 months post hatch) were obtained from
Marquette State Fish Hatchery (Marquette, Michigan) for use in experimental studies. Due to a
history of EEDV at the hatchery, prior to their use in experimental challenges, the originating
rearing lot for these fish was determined to be free of EEDV using the real time, quantitative
PCR (qPCR) assay as detailed below. Additionally, these fish were determined to be free of
reportable diseases outlined by the OIE Aquatic Code (41) and the American Fisheries Society –
Fish Health Section Blue Book (2016) (40) via external and internal clinical examination as well
as bacterial and viral screening (n = 60 fish randomly collected).
Upon receipt, experimental fish were held in a 680-liter fiberglass tank with continuous,
flow-through, oxygenated well water (12.0 ± 1.0°C) at the Michigan State University –
University Research and Containment Facility (East Lansing, Michigan) in accordance with the
Institutional Animal Care and Use Committee. Fish were fed ad lib with 1.0 mm sinking feed
(BioOregon, Westbrook, Maine, USA) and allowed to acclimate to standard laboratory
conditions for at least one month prior to use in experimental challenges.
All experimental challenges were performed in 42-liter flow-through tanks receiving
chilled, oxygenated well water. Studies were performed at water temperatures ranging from 812°C; for experiments performed at lower temperatures, fish were allowed to acclimate to the
colder water temperatures for a minimum of 48 hours prior to the start of experimental
challenges.

76

3.2. EEDV in vivo serial passages and stock production
A stock of infectious EEDV was produced from the skin of naturally infected lake trout
collected during a natural outbreak. Skin was homogenized in a sterile phosphate buffered saline
solution, (pH 7.5 ± 0.5; Sigma-Aldrich, St Louis, Missouri, USA) at a 1:3 (w/v) ratio, and
clarified via low speed centrifugation (1,400 x g) for 20 minutes at 4°C. The initial EEDV stock
was then passed through multiple groups of naïve juvenile lake trout via either an intraperitoneal
injection or an immersion bath challenge. For the intraperitoneal challenges, fish were
anesthetized using tricaine methansulfonate (MS-222; Argent Chemical Laboratories, Redmond,
Washington; 0.1 mg/mL) then injected with 300-400 µL of virus stock solution and allowed to
recover from sedation prior to return to flow-through aquaria for the duration of the study. For
the immersion bath challenges, fish were transferred to glass aquaria containing pre-determined
and combined volumes of virus stock and water. Fish were held in these static aquaria at a
constant water temperature with continuous aeration for 1 hour, after which time they were
transferred back to their flow-through aquaria for the duration of the study. Following virus
exposure, fish were monitored daily for development of morbidity or mortality, where upon
death or development of severe clinical disease (e.g., loss of equilibrium, difficulties respiring),
the fish were euthanized with MS-222 (0.25 mg/mL), and their skin collected and processed as
described above with the substitution of Earle’s salt-based minimal essential medium (MEM;
Invitrogen, Thermo Fisher Scientific, Waltham, Massachusetts, USA), supplemented with 12
mM Tris buffer (Sigma-Aldrich, St Louis, Missouri, USA), penicillin (100 IU/mL; Invitrogen),
streptomycin (100 µg/mL; Invitrogen), and amphotericin B (250 µg/mL; Invitrogen) rather than
PBS. Skin homogenates created from multiple individual fish within each passage were pooled
together to create new batches of EEDV stock from which a new group of naïve lake trout were

77

infected in turn. This process continued until an adequate volume of 7th passage stock was
produced for use in all future studies. Viral exposure route and dose are presented in Table 3.1.

3.3. Virus detection and quantification
Without the use of a susceptible cell line, identification and quantification of EEDV in
challenge fish, passage stocks and experimental tissues was achieved using qPCR as described
by Glenney et al. (2016) (14). Briefly, DNA extractions were performed using the Mag Bind®
Blood and Tissue DNA Kit (OMEGA Bio-tek, Inc, Norcross, Georgia, USA), following the
manufacturer’s instructions and with the addition of a filtering step using the E-Z 96® Lysate
Clearance Plate (OMEGA Bio-tek, Inc, Norcross, Georgia, USA). Approximately 10 mg of
tissue was used for each extraction and eluted DNA was quantified using a Quant-iT DS DNA
Assay Kit and a Qubit fluorometer (Life Technologies, Grand Island, New York, USA). All PCR
reactions were carried out in a Mastercycler ep realplex2 S real-time PCR machine (Eppendorf,
Hauppauge, New York, USA) with a total reaction volume of 20 µL. Each reaction contained 10
µL SYBR Select Master Mix (2x; Life Technologies, Grand Island, New York, USA), 1.0 µM of
forward and reverse primers and 50 nmol total DNA template. Positive control standards for
quantification were produced using known positive skin samples following the method outlined
by Glenney et al. (2016) (14). Positive extraction controls consisted of known positive skin
samples; MEM was used for the negative extraction control and nuclease free water was used for
a PCR negative control.

78

3.4. Experimental challenges
3.4.1. Dose range determination
Following the challenges outlined in Table 3.1, our first experiment extrapolated on
preliminary results in order to examine the dose range or viral load required in order to lead to
infection and clinical EED. This study included a total of 60 fish and six treatment groups (5
viral doses and 1 negative control group). Viral doses and the negative control dose were
prepared as described above using 7th pass EEDV stock. The highest infected group was exposed
to 9.5x107 viral copies/mL water with subsequent doses being 1:10 dilutions made using sterile
sample diluent (MEM). Exact viral doses were determined using qPCR to test water samples and
calculate viral copies per mL of water for each dose (Table 3.2).
Immersion exposure was achieved by transferring experimental fish into static, aerated
glass aquaria where the infectious or control dose had been added. Fish were monitored for 1
hour during which time the immersion water was held at a constant temperature consistent with
the flow-through experimental tanks (9 ± 0.5°C) by submerging the experimental aquaria in
larger flow-through vessels. After one hour, fish were transferred back to their flow-through
aquaria and monitored daily for a period of 30 days for mortalities or development of clinical
morbidity. Any moribund fish displaying severe clinical signs such as altered behavior, inability
to maintain balance, gasping for air or significantly pale gills was euthanized. Skin and gill
tissues were collected from each fish immediately following death. These tissues were tested for
the presence of EEDV using qPCR as described above and viral loads in water samples were
used to calculate projected viral dose ranges and mortality percentage pairings based on the
calculations of Reed and Muench (1938) (127) (Table 3.3).

79

3.4.2. Repeatability
Following establishment of a minimum viral dose required for development of clinical
disease, we wished to determine whether these morbidity and mortality rates could be
reproduced across multiple infections groups within the target dose range. This study involved a
total of 95 naïve juvenile lake trout and four treatment groups (high and low doses of EEDV via
immersion, negative control sample diluent via immersion, and positive control virus
intraperitoneal injection). For the positive control, five fish were intraperitoneally injected with
300 µL of 7th pass stock using sedation and recovery as described above. The remaining fish
were divided into three treatment groups (i.e., high dose, low dose and negative control) and the
experiment run in triplicate (10 fish per group) (Table 3.4). Viral doses were created using 7th
pass EEDV stock (9.5x106 copies/µL). The high dose fish were exposed to 9.5x106 viral
copies/mL water while the low dose fish were exposed to 9.5x103 viral copies/mL water and the
negative control fish were exposed to sample diluent (MEM) containing no virus.

4. Results
4.1. EEDV in vivo serial passages
Consecutive rounds of intraperitoneal and immersion challenge of naïve juvenile lake
trout with clarified tissue homogenate from previously EEDV-infected fish consistently
produced morbidity and mortality, from which EEDV genetic material was recovered (Table
3.1). Additionally, clinical signs were comparable with those seen in natural infections and
included multifocal skin erosions (Figure 3.1a), petechial ocular hemorrhage (Figure 3.1b), fin
erosion and congestion (Figure 3.1c), pale gills and visceral organs, renal congestion, and
hemorrhagic enteritis. Initiation of mortality ranged from 6 to 36 days following viral exposure

80

with the majority of trials seeing the first mortality 2-3 weeks after viral exposure. A similar
range was seen regarding cessation of mortalities with 0-2 fish surviving in most trials after
approximately 1 month after initial infection (Table 3.1). Viral titers in EEDV stocks increased
approximately 1,000-fold from the initial stock to the 6th pass (Table 3.1).

4.2. Morbidity and mortality response to varying doses of EEDV
Fish were monitored for a period of 35 days following viral exposure to the 10-fold
dilutions of EEDV, after which time all survivors were euthanized. During that time, the
negative control group had 2 mortalities (no evidence of EEDV infection) while mortalities (out
of 10) in dilution groups from low dose to high dose ranged as follows: 3, 1, 0, 8, and 10 (Figure
3.2). Clinical findings were consistent with those seen in previous experimental challenges and
detailed above. Using qPCR to test skin samples collected from all fish, EEDV was detected in
all 10 of the high dose fish, one of the fish in the first dilution group and none of the remaining
study specimens (Table 3.2). Using the calculation method developed by Reed and Muench
(1938) (127), doses were calculated to theoretically represent a range of projected mortality
percentages (Table 3.3, Figure 3.3).

4.3. Immersion model reproducibility
Out of the ten treatment groups (3 immersion high dose, 3 immersion low dose, 3
immersion negative control, 1 intraperitoneal positive control), no EEDV related mortalities
were seen in either the low dose or negative control fish. Replicate 1 of the high dose had 9/10
mortalities, replicate 2 had 6/10 mortalities and replicate 3 had no mortalities (Table 3.4). All
five positive control fish succumbed and had detectible levels of EEDV in their tissues. No

81

evidence of an EEDV infection was detected in any of the fish from the negative control or low
dose groups nor were there any clinical signs suggestive of an EEDV infection.
On the other hand, disease signs in the high dose fish were overt and included substantial
mortalities along with fin erosions, generalized pallor, epidermal erosions, ocular petechial
hemorrhage, pale gills, pale and swollen spleen, pale liver, congested kidney, hyperemia of
enteric vessels, and a swollen vent. Water mold growth was often noticed over skin erosions of
infected fish. Surprisingly, fish in high dose replicate 3 had no clinical signs of disease except
one fish with mild splenomegaly and one with mild hemorrhagic enteritis and fin erosions. Skin,
gill and a kidney/spleen pool were tested for presence of EEDV from all 95 fish. No EEDV was
detected in any of the negative control or low dose tissues. The three high dose replicates had
10/10 fish positive, 9/10 fish positive and 1/10 fish positive for EEDV (Table 3.4).

5. Discussion
Recent mortality events have highlighted the continued presence of EEDV within the
Great Lakes basin and more importantly, within the hatchery system (Chapter 2), representing a
dangerous threat to recently established populations and ongoing rehabilitation efforts for one of
the region’s most economically prized and ecologically vital native fish species, the lake trout.
With the vast remaining knowledge to uncover regarding this deadly virus and a current lack of a
susceptible cell line, it is of great importance to develop a repeatable in vivo challenge model that
as closely as possible mimics a natural EEDV infection. Such a model is important both in
producing a uniform, infectious EEDV stock for future studies and also in order to more
thoroughly examine the biologic and pathologic properties of this virus. Without an in vitro
method of viral replication available, serial in vivo passage is the only way to ensure continuous

82

infectious viral stocks are available for future studies. What we have proven here is that while
direct intraperitoneal injection is capable of producing clinical disease, so too is immersion
challenge, supporting our hypothesis. With the close association of fish and their water
environment, plus an epitheliotropic virus such as EEDV, an immersion model is not only more
accurate in terms of mimicking a natural infection, but also has the potential to produce more
severe clinical disease.
Challenges outlined in Table 3.1 served multiple purposes: to maintain virus infectivity
as some herpesviruses are known to lose their virulence following extensive frozen storage
(128), to serve as a guide for future experimental challenge dose range choices, to increase viral
titers in available stocks, and to expand our knowledge about the disease course and associated
clinical signs following exposure to EEDV. With these trials we were able to successfully
maintain an active and virulent stock of EEDV over the span of 12 months, increase the relative
viral loads within each stock batch, and reproduce clinical EED consistent with natural outbreaks
in a controlled laboratory environment.
Based on the results of the dose-dependent challenges, for future in vivo experiments with
EEDV, in order to produce clinical morbidity and mortality in juvenile lake trout, we would
recommend an immersion challenge model as follows: virus dose at or above the 4.7x104
copies/mL water, exposure of at least 1 hour, and constant maintenance during and after viral
exposure of water temperature at 9 ± 1°C. The use of these conditions with EEDV has
demonstrated the ability to cause juvenile LS strain lake trout to develop clinical disease. Finally,
we would recommend a monitoring period of at least 60 days rather than the 30 used here, as this
virus appears to be rather slow growing and may take additional time to develop an active
infection.

83

In order to test our own theories, additional immersion challenges were implemented
using juvenile lake trout exposed to EEDV doses either above or below the proposed minimum
level. As evidenced herein, a dose of 103 viral copies per mL of water is not capable of
producing infection and clinical disease while 106 is, although in only 2/3 trials. While high dose
fish were exposed to 9.5x106 copies per mL immersion water, calculated copies per mg tissue
ranged from 4.1x103 to 1.3x109. With an average total body weight per fish of 6,500 mg, this
suggests an overall increase in viral load and lends support to viral replication within the high
dose exposed fish.
The experimental infections presented herein resulted in a few inconsistencies in
cumulative mortalities as well as disease development and virus identification. For example,
while two of the high dose replicates had >50% mortalities and ≥90% viral recovery, EEDV was
detected from only a single fish in the third replicate and there were no mortalities. This
demonstrates the challenging nature of working with a slowly propagating virus, where multiple
factors (e.g., water temperature, fish density, relative health of other fish in the environment)
must be precisely accounted for in order for a disease to develop. One explanation for the
differences in mortality percentages in the high dose challenge groups could be individual
variations in fish susceptibility to the virus, as density, water temperature and all other conditions
remained the same among trials. As was demonstrated during the 2012 EEDV mortality event
(Chapter 2), there appears to be intra-species variation in susceptibility to this virus. In 2012,
mortalities originated in the individual raceways over a span of approximately eight weeks.
Combined with the results of our immersion replicates herein, it is reasonable to surmise that in
some trials, EEDV will take longer to induce morbidity than initially accounted for, and if the
present studies had been extended for a period of 60 days rather than 30, more consistent

84

cumulative mortalities may have been observed. The inter-replicate variation in day to first death
could be explained by individual fish variation in susceptibility as stated above.
At relatively low fish densities (i.e., low stress), it may be that most fish are able to fight
off the EEDV virus at the viral doses used herein, however if a single fish fails to do so, and
begins not only showing clinical signs but also shedding additional active virus, it may be
enough to lead to more fish becoming infected in a snowballing effect. This is particularly
apparent when comparing the relatively low density of natural populations of salmonids to the
higher densities in aquaculture facilities where fish are more likely to pass pathogens among
themselves. One aspect of experimental challenges that we have altered for later studies is
adjusting the fish density in challenge tanks following exposure to the virus to more closely
mimic that seen in a hatchery setting. It is well known that high density leads to increased stress
and that high stress levels lead to decreased immune function (129, 130). Hatchery settings are
typically very dense, particularly with juvenile, production-aged fish (129), making hatcheries an
ideal environment for infectious diseases that can be shed and subsequently picked up by fish in
close association with one another. In our experiments, it was also apparent that in earlier
infection challenges when the water temperature was allowed to reach 11 or 12°C, clinical
disease was not observed (as quickly, as severely or at all), indicating the importance of
maintaining a constant cold (<10°C) water temperature in order to study this finicky virus.
Using this acquired information we can proceed in further studies examining the disease
course, tissue tropism and more specific effects of stressors on development of clinical disease as
a result of EEDV infection. Determination of optimal lethal dose ranges will allow for the
infection of a large number of fish with a viral dose that allows for deliberate monitoring
throughout development of clinical disease and potential recovery from infection. Based on these

85

studies above, we can predict that this virus has a relatively long incubation period (up to several
months in some situations) requiring the ability to implement an extensive study to monitor
development of disease. The procedures developed here have opened the doors and will allow
for limitless additional studies into the mysteries surrounding this highly destructive virus.

86

APPENDIX

87

Table 1. Mortality data following in vivo passage of EEDV stocks
Virus Stock
Passage #

Method of
Infection

Dose
Received

Day of First
Mortality

Day of Last
Mortality

Total
Mortalities

Virus Titer
(per mg tissue)

1
1
1
2
2
2
3
3
4
5
6

IP
IP
IP
IP
IP
Imm
IP
IP
IP
Imm
Imm

1.22x107
1.50x107
1.50x107
8.85x107
1.23x104
6.18x104
7.32x108
7.32x108
3.55x106
7.09x103
1.46x104

6
22
36
113
26
25
24
11
7
19
11

29
66
116
134
30
45
41
26
13
23
33

4/5
10/10
10/10
8/10
4/5
9/10
10/10
2/3
2/3
4/5
9/10

5.39x105
6.4x104
2.21x104
1.07x106
6.64x104
5.49x106
2.99x105
5.49x106
2.66x104
2.13x104
4.38x107

stock:
Stock batched
to infect
the fish.
Table 3.1 *Virus
Mortality
data following
in vivoused
passage
of EEDV
stocks. Virus stock passage # represents stock batch used to infect
specified group
of fish.
Method ofIntraperitoneal
Infection: (IP) injection
= intraperitoneal
injection; (Imm)
= Immersion bath. Dose received is
**Method
of Infection:
(IP) or Immersion
bath (Imm).
presented in
viral
copies
per
fish
(IP)
or
viral
copies
per
mL
water
(Imm).
First
and
last
mortalities
presented as days post virus
***Dose Received: copies per fish (IP) or copies per ml water (Imm).
exposure. Viral
titers and
calculated
per mg skinPresented
tissue from
fishvirus
following
mortality.
****First
Last Mortality:
asinfected
days-post
exposure.
*****Virus Titer: In skin collected from infected fish following mortality.

88

Figure 3.1 Typical gross pathology observed following experimental infection of
juvenile lake trout (Salvelinus namaycush) with EEDV. A) multifocal skin erosions with
erythema and excess mucous accumulation; B) ocular hemorrhage; C) anal and caudal fin
erosion with congestion, caudal peduncle erosion with erythema, generalized pallor; D)
normal skin.

89

Figure 3.2 Dose-dependent percent cumulative mortality of juvenile lake trout (Salvelinus namaycush) following
immersion bath exposure to EEDV. Doses presented as a base-10 log of the number of copies per mL immersion bath
water.

90

Table 3. EEDV immersion dose-dependent mortalities and qPCR results.
(copies/ml water)

Viral Dose

Cumulative
Mortalities

qPCR
Positives

0
2.08x101
7.95x102
1.82x104
1.92x105
1.01x106

2/10
3/10
1/10
0/10
8/10
10/10

0/10
0/10
0/10
0/10
1/10
10/10

Table 3.2 Dose-dependent mortalities and qPCR identification of EEDV
following experimental exposure of naïve, juvenile lake trout (Salvelinus
namaycush). Negative control mortalities showed no evidence of EEDV
infection.

91

Table 4. Projected EEDV lethal immersion doses
% Mortality

Viral copies per
ml immersion water

10
25
50
75
90

2.30x101
1.07x103
4.70x104
1.21x105
3.83x105

Table 3.3 Calculated lethal immersion doses of EEDV based on dose
dependent cumulative mortalities and calculated following methods
developed by Reed and Muench (1938).

Figure 3.3 Box plot highlighting calculated lethal
immersion doses of EEDV based on dose dependent
cumulative mortalities and calculated following methods
developed by Reed and Muench (1938) (127). Lower hash
mark represents LD10 (i.e., dose required to cause 10%
mortality), lower box margin represents LD25, middle box
bar represents LD50, upper box bar represents LD75, and
upper hash mark represents LD90.

92

Table 2. Mortalities and EEDV qPCR results following immersion challenge for repeatability.
Dose (Replicate)

Mortalities

PCR Positive

Copies/mg (skin)

Negative Control (1)
Negative Control (2)
Negative Control (3)

0/10
2/10
0/10

0/10
0/10
0/10

0
0
0

Low Dose (1)
Low Dose (2)
Low Dose (3)

0/10
0/10
0/10

0/10
0/10
0/10

0
0
0

High Dose (1)
High Dose (2)
High Dose (3)

9/10
6/10
0/10

10/10
9/10
1/10

2.4x107-1.2x109
4.1x103-6.5x107
2.3x102

Positive Control

5/5

5/5

2.04x105-1.47x108

6
Table 3.4.*All
Mortalities
andfish
EEDV
qPCRtoresults
following
challenge forwater.
repeatability. All high dose fish
high dose
exposed
9.5x10
copiesimmersion
per ml immersion
6
9 control fish received 2.85x109 viral copies per
were exposed
to
9.5x10
viral
copies
per
mL
immersion
water.
Positive
**Positive control fish received a total of 2.85x10 viral copies per fish.
fish. Viral titers presented as a low-high range of viral copies per mg of skin tissue.

93

Chapter 4

Progression of Epizootic Epitheliotropic Disease Virus (Salmonid Herpesvirus-3) in target
tissues and cells of its host, the lake trout (Salvelinus namaycush)

94

1. Abstract
Salmonid Herpesvirus-3 (commonly known as the Epizootic Epitheliotropic Disease
Virus; EEDV) is an Alloherpesvirus (Order Herpesvirales) responsible for the deaths of millions
of hatchery-raised lake trout (Salvelinus namaycush) in the Laurentian Great Lakes Basin (GLB)
over the past three decades. Despite being recognized as a deadly virus for decades, there is little
known about the tissue and cellular tropism of EEDV and the associated pathology of the
affected tissues. In this study, we immersion-challenged naïve, juvenile lake trout with a
predetermined moderately lethal dose of EEDV. Experimentally infected fish were monitored
daily for morbidity and mortality and were euthanized on pre-determined days over the course of
six weeks. EEDV viral load was determined in individually collected tissues using quantitative
real-time PCR (qPCR). Oligoprobes targeting the EEDV glycoprotein were designed for the use
in an in situ hybridization (ISH) assay to visualize the virus tropism in infected fish and to
associate viral infection with tissue pathology. The epidermis of the skin and fins was the first
tissues targeted by the virus and yielded higher viral loads compared to other tissues examined,
such as gills or kidney. ISH labeling corroborated qPCR findings. During the early stages of
disease manifestation, intense labeling for viral nucleic acid was identified in degenerated and
necrotic epithelial cells of the epidermis. Subsequent labeling was detected in the epithelial
lining of primary and secondary gill lamellae. After initial viral replication in surface epithelium
associated with epithelial cell degeneration and necrosis, EEDV next infected endothelial cells
and dendritic cells as well as blood monocytes. EEDV infection of endothelial cells and white
blood cells was followed by viremia that resulted in disseminated infection of multiple visceral
organs including the spleen, heart, omentum, liver, kidney and intestine. Severe lymphoid
necrosis and lymphohistiocytic perivasculitis were most commonly associated with detection of

95

large amounts of viral nucleic acid by in-situ hybdridization and qPCR of affected tissues. Our
study characterized EEDV tissue tropism and associated pathology for the first time, and sheds
light on the pathogenesis of this unusual Alloherpesvirus. Our results will serve to guide future
research aimed at understanding EEDV disease ecology, as well as helping to improve strategies
for diagnostic sampling and disease control.

2. Introduction
The family Alloherpesviridae is comprised of a group of highly pathogenic aquatic
viruses that often result in devastating mortality events in populations of their fish hosts, such as
is the case with the OIE-reportable Koi Herpes Virus (KHV; Cyprinid Herpesvirus-3) (16).
While KHV can cause significant morbidity and mortality in common and ornamental carp,
Ictalurid Herpesvirus-1 and -2 cause severe disease in catfish (80, 131), and Salmonid
Herpesvirus-2 and -3 have caused mass mortalities in trout and salmon (2, 87) (Chapter 2).
Despite the losses caused by each of these viruses, for long periods of time, little was known
about their pathogenesis, a step that is vital in understanding or predicting infection outcome.
Recently, however, the development of sensitive and specific molecular and serologic assays has
expedited research aimed at determining the tropism and dissemination of a few related viruses
within their hosts’ bodies.
For example, using quantitative PCR (qPCR), and in situ hybridization (ISH) assays,
Miwa et al. (2015) (132) demonstrated that in experimentally challenged Koi and Common Carp
(Cyprinus carpio), skin is the major entry point of KHV, followed by the gills within an
additional 1-4 days and internal organs after that. ISH positive labeling was particularly intense
in the epithelial cells of both skin and gills of these fish (132). Similarly, a fluorescence ISH

96

assay, paired with conventional PCR, was used to identify the gill, kidney and spleen as the
target tissues of Cyprinid Herpesvirus-2 (the causative agent of Goldfish Hematopoietic Necrosis
Virus) in Prussian carp (Carassius auratus gibelio) (108). These molecular advances have
allowed for the elucidation of viral targets of other herpesviruses outside the Alloherpesvirus
family, including the localization of Ostreid Herpesvirus-2 (Family Malacoherpesviridae) DNA,
RNA and viral proteins in the gills, mantle, heart, adductor muscle, and labial palps of the host
by 28 hours post viral exposure (133).
What is highlighted by this subset of studies, is that herpesviruses target a wide range of
host tissues and cells and while specific interactions between virus and host have been identified
for some of these pathogens, many more require further scrutiny to pinpoint the pathogenesis and
targets at a cellular level.
Of particular concern to fishery managers in the Midwestern United States is the
Alloherpesvirus Salmonid Herpesvirus-3, (Epizootic Epitheliotropic Disease Virus; EEDV),
which targets lake trout (Salvelinus namaycush) (2–4). A highly prized, indigenous species in the
Laurentian Great Lakes Basin (GLB), the lake trout is of high economic and recreational
importance in addition to being a key apex predator in many ecosystems (6). Since its primordial
emergence more than 30 years ago, this virus has appeared and disappeared among various state
and federal fish hatcheries, seemingly without warning, and often resulting in the death or
destruction of millions of fish (2, 3, 5, 6) (Chapter 2). To date, EEDV has not been successfully
replicated in vitro, making the study of the pathogenesis of this viral disease especially difficult.
With the recent development of an in vivo model for replication and propagation of EEDV in a
controlled laboratory environment, studies aimed at uncovering the target cells of viral infection
and viral spread within the host species can be implemented. Herein, we identify and track

97

EEDV viral targets throughout a course of infection using quantification of viral load by real
time quantitative PCR (qPCR), and visualization of viral DNA by in situ hybridization (ISH)
conjointly. Specifically we hypothesized that EEDV would first and primarily target external
tissues such as the skin and gills.

3. Materials and Methods
3.1. Fish and maintenance
Juvenile, Lake Superior strain lake trout (6 months post-hatch) collected from Marquette
State Fish Hatchery (Marquette, Michigan) were used for experimental infections with EEDV.
The lot from which these fish was obtained was determined to be free of pathogens of interest at
a 95% confidence level based on recommendations by the American Fisheries Society Fish
Health Section blue book (40) and the Model program for fish health management in the Great
Lakes (39). Additionally, the presence of EEDV was excluded from these fish with the use of
qPCR as described below.
All experiments were performed at the Michigan State University –Research
Containment Facility (East Lansing, Michigan) in accordance with the Institutional Animal Care
and Use Committee. Fish were allowed to acclimate to laboratory conditions for a minimum of
one month prior to the start of experimental challenges while being held in a 680-liter fiberglass
aquarium with continuous, oxygenated well water (12.0 ± 1.0°C), and fed ad lib with 1.0 mm
sinking trout feed (BioOregon, Westbrook, Maine, USA).
All experimental challenges were performed in fiberglass aquaria receiving flow-through,
chilled, oxygenated well water. Studies were performed at a water temperature of 9.0 ± 0.5°C,

98

and fish were allowed to acclimate to colder water temperatures for a minimum of 48 hours prior
to the start of experimental challenges.

3.2. Infectious virus stock
As EEDV has not been successfully replicated in vitro, a stock of infectious virus for use
in experimental challenges was produced from the skin of lake trout collected during a natural
outbreak and stored at -80oC. Skin was homogenized in a sterile phosphate buffered saline
solution, (pH 7.5±0.5; Sigma-Aldrich, St Louis, Missouri, USA) at a ratio of 1:3 (w/v), and
clarified via low speed centrifugation (1,400 x g) for 20 minutes at 4°C. This supernatant was
then used to infect naïve juvenile lake trout via an intraperitoneal injection. Fish were
anesthetized using tricaine methansulfonate (MS-222; Argent Chemical Laboratories, Redmond,
Washington; 0.1 mg/mL) then injected with 300 µl of virus stock and allowed to recover from
sedation prior to return to flow-through aquaria for the duration of the study. Following virus
exposure, fish were monitored daily for development of morbidity or mortality, and upon death
or development of severe clinical disease, the fish were collected or euthanized with an overdose
of MS-222 (0.25 mg/mL), and their skin sampled and processed as described above to create a
new batch of EEDV stock. After the initial stock production, skin samples were homogenized
with an Earle’s salt-based minimal essential medium (MEM; Invitrogen, Thermo Fisher
Scientific, Waltham, Massachusetts, USA), supplemented with 12 mM Tris buffer (SigmaAldrich, St Louis, Missouri, USA), penicillin (100 IU/mL; Invitrogen), streptomycin (100
µg/mL; Invitrogen), and amphotericin B (250 µg/mL; Invitrogen) rather than PBS. This process
of infection and stock production was repeated with new groups of naïve fish until an adequate
volume of 7th passage virus stock was produced for use in the current study (Chapter 3).

99

3.3. Experimental challenge
For this study, 84 lake trout were immersion challenged with the previously determined
moderately lethal dose of EEDV (Chapter 3) while 48 lake trout were exposed to a sham
suspension of MEM as a negative control group. Immersion exposure was achieved by
transferring experimental fish to aerated glass aquaria where the infectious or control dose was
added. Fish were maintained and monitored for 1 hour during which time the water was held at a
constant temperature (9 ± 0.5°C). After one hour, fish were transferred back to their flowthrough aquaria and monitored daily for mortalities or development of clinical disease for the
duration of the study.

3.4. Sample collection
Seven infected fish and four negative control fish were collected in parallel and
euthanized on Days 0, 1, 3, 6, 9, 12, 15, 18, 21, 28, 35, and 42 post-infection (p.i.), focusing on
minimizing stress for both sampled and remaining fish throughout the sampling event. On these
days, one fish from each group was preserved whole in 10% neutral buffered formalin following
creation of a ventral midline incision to allow for improved fixation. External and internal
examinations were performed on the remaining 6 infected and 3 control fish at which time
individual portions of skin, fin, gill, eye, brain, spleen, heart, liver, intestine, and kidney were
collected from each fish. Each tissue was divided, one portion to be frozen at -20°C for
quantification of EEDV DNA while the other portion was fixed in 10% neutral buffered formalin
for viral DNA visualization. Eyes were collected whole, utilizing both right and left rather than
attempting to split, portions of both anterior and posterior kidney were collected for “kidney”
samples, and “intestine” tissues consisted of a portion of the intestine approximately 1 cm oral to

100

the vent. Fixed tissues were processed for paraffin embedding, sectioned and applied to glass
slides.

3.5. Quantification of EEDV DNA in tissues
Tissues collected for viral DNA quantification were individually digested and DNA
extractions performed using the Mag Bind® Blood and Tissue DNA Kit (OMEGA Bio-tek, Inc,
Norcross, Georgia, USA), following the manufacturer’s instructions and with the addition of a
filtering step using the E-Z 96® Lysate Clearance Plate (OMEGA Bio-tek, Inc, Norcross,
Georgia, USA) based on the protocol outlined by Glenney et al. (2016) (14). After individual
digestion, negative control tissues were extracted from in pools of 3, by tissue type. Eluted DNA
was quantified using a Quant-iT DS DNA Assay Kit and a Qubit fluorometer (Life
Technologies, Grand Island, New York, USA). All PCR reactions were carried out in a
Mastercycler ep realplex2S real-time PCR machine (Eppendorf, Hauppauge, New York, USA)
with a total reaction volume of 20 µL. Each reaction contained 10 µL SYBR Select Master Mix
(2x; Life Technologies, Grand Island, New York, USA), 1.0 µM of forward and reverse primers
(14) and 50 nmol total DNA template. Positive control standards were produced using known
positive skin samples following the method outlined in Glenney et al. (2016) (14). Viral loads
(copies/mg) were then calculated using resulting reaction copy number following qPCR and
original digested tissue weights (mg).

3.6. Statistical analysis
Statistical analyses were performed in order to evaluate the relationships between the
number of positive samples or the viral DNA load with respect to organ, days post viral exposure

101

and external vs. internal tissue groups. These comparison analyses were generated using a
generalized linear mixed model in SAS software, Version 9.4 of the SAS System (Copyright ©
2017 SAS Institute Inc.). For viral loads, analyses were performed on log-transformed copies per
mg tissue in order to increase normality of distribution. Statistical significance was determined
based on a probability level of 1% or 5% as indicated below.

3.7. Design and preparation of ISH probes
An EEDV specific oligonucleotide probe was designed following a previously described
algorithm (134), using the computer program Oligo 6 and based on the glycoprotein gene
sequence published in GenBank (JX886027.1). This oligonucleotide probe (5’-GCT CAA TTT
ATC GTG CTC AAA TGG TTC ACT GGC CAG CTC CAT GTC CAT CG-3’) is labeled with
digoxigenin at the 5’ end (IDT). This specific probe was developed to differentiate EEDV from
the other four salmonid herpesviruses, and use of the Basic Local Alignment Search Tool
(www.ncbi.nlm.nih.gov/blast.cgi) demonstrated no cross-reactivity with salmonid herpesvirus-1,
-2, -4, or -5. The probe was purified by high performance liquid chromatography (HPLC) (IDT).

3.8. Performance of ISH on fixed tissue sections
In order to maximize the sensitivity and specificity of this ISH assay, preliminary tests
were performed in order to identify the optimal protocol and reagent concentrations as
previously described (135). Briefly, 5 µm thick sections were cut from paraffin-embedded tissues
previously collected and placed onto positively charged slides, which were then deparaffinized
and fixed using the Discovery XT automated slide-processing system (Ventana Medical
Systems, Inc., Tucson, Arizona) as programed in the protocol for the RiboMap in situ

102

hybridization reagent system (Ventana Medical Systems). Protease 3 (0.02 units/mL alkaline
protease; Ventana Medical Systems) was used for 12 minutes at 37°C for a proteolytic treatment
followed by a mild cell conditioning step using the citrate buffer-based RiboCC reagent
(Ventana Medical Systems) for 4 minutes at 95°C. The slides were then denatured for 4 minutes
at 37°C, followed by hybridization for 1 hour at 37°C with the antisense oligonucleotide probe
for EEDV suspended in hybridization buffer (RiboHybe; Ventana Medical Systems). The
concentration used for the EEDV probe was 1.59 ng/mL (1:10,000 dilution). Four stringency
washing steps were performed at 42°C using 0.1× RiboWash (equivalent to 0.1× saline sodium
citrate; Ventana Medical Systems) for 4 minutes for the first three and for 8 minutes for the
fourth washing step. After the stringency washes, the slides were incubated with a rabbit
monoclonal antidigoxigenin antibody (Invitrogen Corporation, Frederick, MD) at a dilution of
1:10,000 for 32 minutes at 37°C. Slides were then incubated in streptavidin-alkaline phosphatase
conjugate (UMap anti-Rb AP; Ventana Medical Systems) for 16 minutes at 37°C and the signal
was detected automatically using the BlueMap nitroblue tetrazolium-BCIP (5-bromo-4-chloro-3indolyl phosphate) substrate kit (Ventana Medical Systems) for 2 hours at 37°C. The final step
involved conterstaining the slides with nuclear fast red-equivalent reagent Red Counterstain II
(Ventana Medical Systems) for 4 minutes before adding a coverslip. Skin and gill tissues
collected from naïve lake trout raised in a bio-secure containment facility were used as negative
controls while experimentally infected lake trout with qPCR confirmed EEDV-positive tissues
were used as positive controls.

103

4. Results
4.1. Clinical disease, morbidity and mortality
Following exposure to either EEDV or sterile medium, all infected and negative control
lake trout were monitored daily while maintained at a water temperature of 9 ± 0.5°C for 42
days. Gross disease signs in experimentally challenged fish were consistent with those seen
during natural EEDV outbreaks. Clinical signs observed as early as three days p.i. included
petechiae to ecchymoses in the lower quadrant of the eyes as well as hyperemia or engorgement
of enteric blood vessels. By Day 15 p.i., multifocal to coalescing erosions and ulcerations of the
skin were observed along with proximal congestion and distal erosion of all fins. Abnormalities
in visceral organs ranged from mild pallor to congestion, and hyperemia of both hepatic and
enteric vessels was commonly observed after Day 6. The only mortalities occurred on Day 28
p.i. (n = 4 fish), despite the continuously decreasing fish density within the tank caused by
sampling as outlined above. No clinical signs were observed and no mortalities occurred in the
negative control group.

4.2. Quantification of EEDV DNA
A quantitative analysis of viral load in tissues of experimentally infected lake trout was
performed using a SYBR Green qPCR assay. EEDV DNA was detectible from a single fish on
Day 9 post-infection (p.i.) as well as from multiple fish, beginning on Day 18 p.i. and through
the end of the study. No EEDV DNA was detected by qPCR in any tissues collected from
infected fish on Days 0-6 or 12-15 p.i., as summarized in Table 4.1. No EEDV DNA was
detected in any of the tissues sampled from the negative control fish.

104

Ocular tissue contained high loads of EEDV DNA as early as 9 days post exposure to the
virus (Table 4.2). By 18 days p.i., EEDV DNA was also detectible in the fin and skin, followed
on Day 21 by the kidney, spleen, liver and brain. EEDV DNA was not identified within heart or
intestinal tissues until Day 28, at which time the virus was detected in all 10 tissues from all six
fish sampled that day. In comparison to other tissues, eye, skin and fin consistently had the
highest EEDV loads, often 100 to 1,000 fold higher than the load in internal organs (Table 4.2).
When examining differences between tissue types across the entire study, eye, skin, fin
and gill were EEDV-positive most commonly, however, the only statistically significant pairings
were between heart (n = 13) and eye, skin or fin (n = 25 each; p < 0.05) (Figure 4.2). However,
when amounts of viral DNA were examined, eye, skin and fin each had significantly higher
loads than the gills as well as each of the internal organs (p < 0.01) (Figure 4.2). Interestingly,
while the upper range of EEDV copy numbers detected in gill tissues equaled that in the other
external tissues, the median viral load more closely matched that of the internal tissues.
Comparisons of the number of EEDV-positive samples per tissue type, by day postinfection (p.i.) are presented in Figure 4.3. On Day 18 p.i., the number of positive skin and fin
tissues (n = 2 each) was statistically significantly different from the number of positive gill,
kidney, spleen, heart, liver, intestine, or brain tissues (n = 0 each; p < 0.01). On Day 21 p.i., in
pairwise comparisons, the number of positive eye, skin, fin, or gill tissues (n = 5 each) was
statistically significantly different from the number of positive kidney (n = 3), spleen (n = 2),
heart (n = 2), intestine (n = 3), or brain (n = 2) tissues (p < 0.01). On Day 35 p.i., in pairwise
comparisons, the number of positive eye, skin, fin, or gill tissues (n = 6 each) was statistically
significantly higher than the number of positive spleen (n = 3) or heart tissues (n = 4) (p < 0.01).
Finally, on Day 42 p.i., the number of positive eye, skin, fin, or gill tissues (n = 6 each) was

105

statistically significantly higher than the number of positive kidney (n = 2), heart (n = 1), liver (n
= 4) or intestine (n = 3) tissues.
At the apparent peak of infection, on Day 28 p.i., EEDV DNA was detectible in all 60
tissues collected, with viral loads in external tissues ranging from 106 to 109 copies per mg host
tissue while the viral loads in internal tissues ranged from 104 to 107 copies per mg host tissue
(Table 4.2). As mentioned above, while certain gill tissues contained a viral load equal to those
of the eye, skin and fin, as a whole, viral loads in gill tissues were more similar to viral loads of
internal tissues as is evidenced in Figure 4.4. When analyzing pairwise comparisons of viral
loads, the eye, skin, and fin tissues had statistically significantly higher viral loads than the
internal organs on Day 21 (kidney, liver, and brain; p < 0.05), Day 28 (kidney, spleen, heart,
liver, intestine, and brain; p < 0.05), Day 35 (all other tissue types; p < 0.01), and Day 42 p.i.
(liver, intestine, and brain; p < 0.05).
An additional statistical analysis was performed comparing the number of positive
samples, as well as the average viral load, by sampling day, from all external tissues combined
versus all internal organs combined on Days 21-42 (Figure 4.5). On all four sampling days, the
external tissues had a statistically significantly higher viral load compared to internal organs (p <
0.01) and except for Day 28 when EEDV was detected in all 60 tissues, the external tissues also
harbored the virus in a higher number of tissue samples than the internal organs (p < 0.01).

4.3. Design and verification of ISH assay
Initially, skin and gill tissues with high EEDV loads based on qPCR (i.e., ct values < 20)
were used as positive controls and compared to tissues from negative control fish in order to
standardize the ISH procedure as well as to confirm a lack of non-specific reaction. Using this

106

standardized procedure, no signal was detected in any negative control tissues, while specific
intranuclear labeling was detected in positive tissues.

4.4. Visualization of EEDV-infected tissues and cells
Following quantification of viral loads, tissues were examined for pathologic alterations
using an H&E stain, and in situ hybridization was performed on tissues with specific lesions.
Positive labeling was observed in the skin, gills, and spleen as well as endothelial cells and
monocytes of vessels in different organs from fish sampled on Days 28, 35, and 42 post
infection. The number of positive cells varied between days with the largest number of positive
cells correlating to the most advanced stages of disease and the highest viral load based on
qPCR. Positive labeling was not evident in any of the negative control tissues tested.
In skin tissues collected from fish in early stages of disease, positive ISH labeling
confirmed the presence of EEDV in the nuclei of degenerating epithelial cells as well as in
infiltrating lymphocytes and dendritic cells (Figure 4.6). Early skin lesions (Figure 4.6a and
4.6b) were characterized by individual epithelial cell necrosis and sloughing of degenerated cells,
and viral nucleic acid was detected in nuclei of individual necrotic epithelial cells. Advanced
cutaneous lesions (Figure 4.6c and 4.6d) had more widespread epithelial cell necrosis that caused
focal erosions, and sloughing of degenerate epithelial cells was common. Viral nucleic acid was
readily detected in large numbers of nuclei of degenerate and necrotic epithelial cells that
commonly slough off. The most severe skin lesions (Figure 4.6e and 4.6f) were characterized by
widespread erosions and full thickness necrosis with only a few necrotic and degenerate cells
clinging to the basement membrane. Viral nucleic acid was detected in the nuclei of the vast
majority of epithelial cells throughout all layers prior to epithelial loss. In the gills, early gill

107

lesions were characterized by mild thickening of the primary lamellae, infiltration of
mononuclear cells into the propria, swelling of epithelial cells, congested blood vessels and few
degenerated epithelial cells (Figure 4.7a). Viral nucleic acid was detected in nuclei of
morphologically unremarkable epithelial cells (Figure 4.7b). More advanced gill disease (Figure
4.7c-f) was characterized by loss of secondary lamellae and massive infiltration of monomuclear
cells (Figure 4.7c and 4.7e). Viral nucleic acid was detected in nuclei of attenuated epithelial
cells and nuclei of infiltrating mononuclear cells (Figure 4.7d and 4.7f).
During the later disease stages, lesions in internal organs most likely developed
secondary to viremia, as is supported by the sudden detection of large amounts of virus in
internal organs by qPCR. Depletion of lymphoid cells and multifocal necrosis in the spleen was
the most prominent finding (Figure 4.8a) indicating widespread viral replication in hematopoietic
cells at the height of viremia. Viral nucleic acid was detected in nuclei of large numbers of
mononuclear cells in the spleen (Figure 4.8b). A severe lymphohistiocytic perivasculitis also
developed secondary to viremia and was most severe in the omentum (Figure 4.8c), but was also
found in other organs. This perivasculitis was most likely secondary to viral infection of
endothelial cells (Figure 4.8d). Viremia was most likely caused by large numbers of monocytes
being infected as evidenced by significant nuclear labeling of mononuclear cells (Figure 4.8d) in
the vessels of different organs.

5. Discussion
The reemergence of highly pathogenic and deadly Salmonid Herpesvirus-3 in the
Laurentian Great Lakes Basin in 2012 as well as 2017 (Chapter 2) has highlighted the fact that
EEDV remains a significant threat to lake trout populations throughout the GLB and continues to

108

represent a major hurdle in the species’ rehabilitation throughout the Midwestern United States.
The present study reports the development of an in situ hybridization probe capable of detecting
the EEDV glycoprotein gene within both external and internal tissues that have been formalinfixed and paraffin-embedded. Additionally, this is the first account of the tracing of EEDV
within target cells and tissues of lake trout throughout the course of disease. This study utilized
both the ISH assay as well as a quantitative SYBR Green PCR assay to identify EEDV target
tissues and cells at a wide range of disease progression time points following experimental
exposure to the virus.
Previous studies conducted immediately after the initial EEDV mortality episodes, while
lacking these novel techniques, were capable of determining infectivity of EEDV and
identification of target species (3, 4). In order to expand our knowledge of the pathogenesis of
EEDV, juvenile lake trout were exposed to a previously determined dose of the virus capable of
causing morbidity via immersion challenge (simulating a natural route of infection) (Chapter 3).
The first six weeks of infection were investigated by quantifying viral load within specific target
tissues as well as visualizing the virus within microscopic lesions.
In the present study, samples were collected at 1-7 day intervals from 10 separate tissues.
For the first week of sampling, EEDV levels remained below the detection limit of both the
qPCR and the ISH assays. While first detectible in ocular tissues on Day 9, it wasn’t until Day 18
when the virus became consistently detectible from multiple tissues and multiple fish. However,
until Day 21, the virus was only identified in external tissues, and throughout the study, the
external tissues had consistently higher viral loads, particularly the eyes, skin, and fins. This
apparent delayed or prolonged spread of virus to visceral organs (e.g., kidney, spleen, and liver)
after initial detection within external tissues is evidence of EEDV first targeting and establishing

109

an infection in the epithelium, followed after a few days by viremia that leads to development of
systemic disease. This pattern of an initial infection site in an external tissue followed by
systemic spread has also been observed in the herpesviruses of cyprinids, catfish, and eels (136).
While occasionally viral loads in the gills were comparable to those in the other external
tissues, the median viral load in the gills was more comparable to those of the internal organs
across all time points (Figure 4.1), suggesting the gills are a less preferred viral target and thus a
less ideal diagnostic target than the skin, fins or eyes. This is in opposition to trends seen with
Ictalurid Herpesvirus-1, Cyprinid Herpesvirus-2, and Anguillid Herpesvirus-1 in their hosts
where the gills are preferentially and persistently infected (54, 57, 137).
Of particular note is the consistently lower viral load in the kidney, spleen, and heart,
tissues that are commonly used when attempting to diagnose unknown pathogenic aquatic
viruses or suspected viruses such as Viral Hemorrhagic Septicemia Virus or Infectious
Pancreatic Necrosis Virus (40). Surprisingly, while the viral titers in brain tissue were
comparable to those of other internal organs, the virus was detectible in brain tissue on the same
day as all tissues other than eye, skin and fin, despite the presence of a blood-brain barrier. We
speculate that infected monocytes may be responsible for carrying the virus across the blood
brain barrier functioning as a Trojan horse as has been reported for other viral diseases. While
the data herein suggests a sequential spread of EEDV from external to internal tissues, additional
sampling efforts focusing at and around the time of first detection through development of
systemic disease should be carried out to further characterize this process.
Visualization of EEDV DNA using in situ hybridization within epithelial cells of both the
skin and gills, associated with degeneration and sloughing, indicates these cells are likely the
primary targets of viral infection, after which, cell to cell transmission allows EEDV to infect

110

infiltrating dendritic cells. This infection of mononuclear cells along with the endothelial cells
lining blood vessels both in the gills and in visceral organs indicates a source of viremia and
widespread infection of internal organs in later stages of disease. In particular hematopoietic
cells seem to be the primary target of viral infection at advanced disease stages. These findings
correlate with the qPCR data in support of development of systemic disease beyond 21 days post
infection.
Identification of viral targets throughout a course of disease is important for many
reasons, one of which is diagnostics. As mentioned previously, kidney and spleen are commonly
used for diagnosis of pathogenic aquatic viruses. However, as is also the case with some of the
other aquatic herpesviruses such as KHV (132), these are not appropriate tissues for diagnosis of
EEDV. When compared to external tissues (e.g., eye, skin, fin), kidney and spleen carry
consistently lower viral loads not detectible as early in the course of infection. While internal
tissues collected and tested from a highly infected individual may have detectible levels of
EEDV, in order to maximize chances at detecting low-level carriers of the virus, external tissues
should be screened instead. This study has vastly improved our understanding of the
pathogenesis of EEDV, allowing for the tailoring and focusing of diagnostic efforts.
In conclusion, the data provided herein establishes that EEDV primarily targets epithelial
cells, supporting our hypothesis, with later stages developing into a systemic disease through the
infection of blood and endothelial cells. Additionally, the newly developed ISH assay has been
established as a viable confirmatory tool in support of positive qPCR results or histopathologic
lesions. This information can be used to alter screening efforts of GLB lake trout populations as
well as to focus future research into the location and establishment of latency as an explanation
for the long periods of undetection in this virus’ history.

111

APPENDIX

112

Table 1. Identification of EEDV DNA in various tissues of experimentally challenged lake trout (Salvelinus
namaycush) sampled on different days (n=6 fish/day) after exposure to the virus using qPCR. “+” Indicates
identification of EEDV DNA in designated fish and tissue; “− ” indicates no detectible EEDV DNA.

Day Post Viral Exposure
Tissue
Brain
Eye	 	
	
Fin	 	
	
Gill	 	
	
Heart	
	
Intestine	 	
Kidney	 	
Liver	
	
Skin		
	
Spleen	 	

0−6

9

12

15

18

21

28

35

42

−−−−−−	

−−−−−−	

−−−−−−	

−−−−−−	

−−−−−−	

++−−−−	

++++++	

−+++++	

++++−+	

−−−−−−	

−−−+−−	

−−−−−−	

−−−−−−	

−−+−−−	

+++++−	

++++++	

++++++	

++++++	

−−−−−−	

−−−−−−	

−−−−−−	

−−−−−−	

++−−−−	

++−+++	

++++++	

++++++	

++++++	

−−−−−−	

−−−−−−	

−−−−−−	

−−−−−−	

−−−−−−	

++−+++	

++++++	

++++++	

++++++	

−−−−−−	

−−−−−−	

−−−−−−	

−−−−−−	

−−−−−−	

−−−−−−	

++++++	

++−+−+	

+−+−−−	

−−−−−−	

−−−−−−	

−−−−−−	

−−−−−−	

−−−−−−	

−−−−−−	

++++++	

++++++	

+−++−−	

−−−−−−	

−−−−−−	

−−−−−−	

−−−−−−	

−−−−−−	

+−+−−+	

++++++	

++++−+	

+−+−−−	

−−−−−−	

−−−−−−	

−−−−−−	

−−−−−−	

−−−−−−	

+++−−−	

++++++	

++++++	

++++−−	

−−−−−−	

−−−−−−	

−−−−−−	

−−−−−−	

−−−−++	

++++−+	

++++++	

++++++	

++++++	

−−−−−−	

−−−−−−	

−−−−−−	

−−−−−−	

−−−−−−	

+−+−−−	

++++++	

−++−−+	

+++++−

	

Table 4.1 Identification of EEDV DNA in various tissues of experimentally challenged lake trout (Salvelinus namaycush) sampled
in parallel on pre-determined days (n = 6 fish/day) after exposure to the virus using qPCR. “+” indicates identification of EEDV
DNA in designated fish and tissue; “−” indicates no detectible EEDV DNA.

113

Table 2. EEDV glycoprotein gene copies per mg tissue by day post-infection following experimental exposure of
lake trout to the virus via immersion bath as calculated using SYBR qPCR. Data points marked with a “--“ indicate
no virus detected. ‡All tissues from all fish tested prior to day 18 showed no detectible levels of EEDV except the
eye of a single fish on day 9 (3.81x1004 copies/mg).
Day ‡ Fish

Brain

Eye

Fin
3

Gill

Heart

Intestine

Kidney

Liver

Skin

Spleen

18

1
2
3
4
5
6

-------

--1.37x103
----

6.59x10
8.56x103
-----

-------

-------

-------

-------

-------

----2.93x105
3.45x104

-------

21

1
2
3
4
5
6

4.25x102
5.37x104
-----

2.50x104
1.41x106
2.69x106
2.98x106
2.32x107
--

2.65x107
6.95x107
-5.27x105
1.29x107
1.79x104

3.32x104
1.27x105
-1.67x104
2.80x105
2.52x105

---1.07x104
-1.33x105

4.81x104
1.89x103
3.94x105
----

1.82x104
-1.83x104
--1.30x104

3.25x105
4.26x103
3.43x104
--2.46x103

2.23x107
1.23x108
1.54x105
1.87x103
-8.07x104

7.48x104
-1.51x105
----

28

1
2
3
4
5
6

1.44x105
2.70x105
1.98x105
1.43x104
9.62x104
6.48x104

4.11x107
8.09x108
1.14x108
1.62x108
2.20x106
1.08x108

9.27x107
1.82x109
5.70x108
4.30x108
9.56x107
1.83x109

1.01x107
1.65x107
1.29x106
2.12x106
3.03x106
1.62x107

1.39x106
9.99x105
1.46x107
8.61x107
1.15x105
1.91x106

1.33x107
6.88x106
1.78x106
1.51x105
1.38x105
5.26x106

9.26x105
4.67x106
2.83x106
1.32x105
5.88x105
2.13x106

1.57x105
1.68x106
3.45x106
3.58x104
5.21x105
4.62x106

1.29x108
1.64x108
4.96x108
1.40x108
3.91x108
2.07x109

1.02x106
6.68x105
4.18x106
9.01x104
3.01x106
3.42x107

35

1
2
3
4
5
6

-7.97x106
3.20x105
1.21x105
3.43x105
4.74x103

1.78x108
1.72x108
3.82x106
9.76x107
1.01x108
1.81x108

8.97x108
7.58x108
4.06x108
5.27x106
6.45x107
9.33x108

2.63x106
1.67x104
2.91x104
2.00x104
2.57x104
4.22x106

1.25x106
6.08x104
-3.42x103
-2.11x105

8.50x105
2.22x105
2.96x104
9.84x104
1.69x105
7.91x105

3.80x105
2.30x105
1.35x104
1.91x104
-1.10x105

2.49x105
3.86x104
-1.83x104
6.95x104
7.18x103

4.74x108
5.57x108
8.53x107
6.00x108
1.68x109
5.97x106

-8.85x104
1.85x104
--6.32x104

42

1
2
3
4
5
6

1.34x106
2.36x106
6.29x104
9.90x103
-2.05x106

2.03x108
8.61x107
1.75x108
1.49x108
1.19x105
4.13x107

5.82x108
6.53x107
3.54x108
3.45x106
2.93x104
3.09x104

9.68x107
1.95x104
1.92x109
9.50x104
5.74x104
1.15x104

--2.39x106
----

1.70x104
-9.26x105
5.03x104
---

3.30x105
-1.22x105
----

2.36x104
5.20x104
1.05x106
1.57x105
---

3.13x108
3.91x107
1.75x109
3.29x107
4.87x107
1.25x107

2.09x104
5.06x105
1.56x105
2.33x106
1.79x107
--

Table 4.2 EEDV glycoprotein gene copies per mg tissue by day post-infection following experimental
exposure of lake trout to the virus via immersion bath as calculated using SYBR qPCR. Data points
marked with a “--“ indicate no virus detected. ‡All tissues from all fish tested prior to Day 18 showed no
detectible levels of EEDV except the eye of a single fish on Day 9 (3.81x104 copies/mg).
114

1.0x1010	

	

1.0x109	

	

1.0x108	

Copies	per	mg	tissue	

	
1.0x107	

	
1.0x106	

	
1.0x105	

	

1.0x104	

	

1.0x103	

	
1.0x102	

	

1.0x101	

	

1.0x100	
	
	

Eye	

Skin	

Fin	

Gill	

Kidney	

Spleen	

Heart	

Liver	

Intestine	

Brain	

Tissue	Type	

Figure 4.1 Box plots showing minimum, 1st quartile, median, 3rd quartile and maximum viral glycoprotein gene copies per
mg of tissue by tissue type across all EEDV-positive samples on all sampling days.

115

Figure 4.2 Top: Total number of EEDV-positive samples by tissue type across all sampling
days. “*” indicates statistical significance compared to tissues below the horizontal bar; (p <
0.05). Bottom: Median EEDV viral titer by tissue type across all sampling days. “*” indicates
statistical significance compared to tissues below the horizontal bar; (p < 0.01). Error bars
signify one standard deviation.

116

Figure 4.3 Total number of EEDV-positive samples by tissue type and by sampling day. “*”
indicates statistical significance compared to tissues below the horizontal bar; (p < 0.01).
Additional significant pairwise comparisons not pictured include: liver vs. spleen, heart and brain
on Day 21; spleen vs. kidney, liver, intestine and brain plus heart vs. intestine on Day 35; and
kidney vs. spleen, liver, and brain, plus heart vs. spleen, liver, intestine and brain, plus intestine
vs. spleen and brain on Day 42.
117

Figure 4.4 Median EEDV viral titer by tissue type and sampling day. “*” indicates statistical
significance compared to tissues below the horizontal bar; Day 21: p < 0.01 for brain vs. eye and
fin, liver vs. eye and fin and kidney vs. fin; p < 0.05 for all remaining combinations. Day 28: p <
0.01 for all pictured comparisons with the exception of eye vs. heart (p < 0.05); Additional
significant pairings include brain vs. heart, intestine and spleen (p < 0.05). Day 35: p < 0.05. Day
42: p < 0.01 for all skin and eye comparisons, p < 0.05 for all fin comparisons. Error bars signify
one standard deviation.
118

Figure 4.5 A) Total number of EEDV positive tissues by day and external vs. internal tissue
type. “*” indicates statistical significance compared to tissues below the horizontal bar; p < 0.01
on Days 21, 35 and 42. B) Median EEDV viral titer by tissue type (external vs. internal) and
sampling day. “*” indicates statistical significance compared to tissues below the horizontal bar;
p < 0.01 on all sampling days.

119

Figure 4.6 Distribution of EEDV within skin lesions of lake trout during early and late
stages of experimental infection. Magnification 400X, Hematoxylin and eosin (A, C, E)
and in situ hybridization for EEDV (B, D, F) with NBT labeling (blue) and nuclear fast
red counterstaining. Early skin lesions (A, B) are characterized by individual epithelial
cell necrosis (A: arrow) and sloughing of degenerated cells (A: arrowhead). Viral
nucleic acid is detected in individual necrotic epithelial cells (B: arrowhead). At
advanced stages (C, D) more widespread epithelial cell necrosis causes focal erosions
(C: arrow) and sloughing of degenerate cells is common (C: arrowhead). Viral nucleic
acid is readily detected in large numbers of degenerate and necrotic cells that
commonly slough off (D: arrowheads). The most severe lesions (E, F) are characterized
by widespread erosions and full thickness necrosis with only a few necrotic (E: arrow)
and degenerate (E: arrowhead) cells clinging to the basement membrane. Viral nucleic
acid can be detected in the vast majority of epithelial cells throughout all layers (F:
arrowheads) prior to epithelial loss.
120

Figure 4.7 Distribution of EEDV within gill lesions of lake trout during early and late stages of
experimental infection. Magnification 400X, Hematoxylin and eosin (A, C, E) and in situ
hybridization for EEDV (B, D, F) with NBT labeling (blue) and nuclear fast red counterstaining.
Early gill lesions (A, B) are characterized by mild thickening of the primary lamellae, infiltration
of mononuclear cells into the propria (A: arrow), swelling of epithelial cells, congested blood
vessels and few degenerated epithelial cells. Viral nucleic acid is detected in nuclei of
morphologically unremarkable epithelial cells (B: arrowheads). More advanced gill disease (C,
D, E, F) is characterized by loss of secondary lamellae and massive infiltration of mononuclear
cells (C and E: arrows). Viral nucleic acid is detected in attenuated epithelial cells (D: arrow) and
nuclei of infiltrating mononuclear cells (D and F: arrowheads).

121

Figure 4.8 Distribution of EEDV within lesions of internal organs in lake trout during late stages
of experimental infection. Magnification 400X, Hematoxylin and eosin (A, C) and in situ
hybridization for EEDV (B, D) with NBT labeling (blue) and nuclear fast red counterstaining.
During the later diseases stages lesions develop in internal organs and depletion of lymphoid
cells and multifocal necrosis (arrow) in the spleen (A) is the most prominent finding. Viral
nucleic acid can be detected in large numbers of mononuclear cells in the spleen (B). A severe
lymphhistiocytic perivasculitis (C) also develops secondary to viremia and is most severe in the
omentum, but can also be found in other organs. This perivasculitis is most likely secondary to
viral infection of endothelial cells (D: arrowhead). Viremia is caused by large numbers of
monocytes being infected as evidenced by significant nuclear labeling of mononuclear cells (D:
arrows) within this hepatic vessel.

122

Chapter 5

Development and progression of gross and microscopic lesions in lake trout (Salvelinus
namaycush) experimentally infected with Epizootic Epitheliotropic Disease Virus
(Salmonid Herpesvirus-3)

123

1. Abstract
Epizootic Epitheliotropic Disease Virus (EEDV; Salmonid Herpesvirus-3) is a lethal
disease of lake trout (Salvelinus namaycush) currently threatening the rehabilitation efforts of
this indigenous fish species. Virus biology, pathology and host interactions remain mostly
unknown, thereby preventing the design of effective control strategies. Our current knowledge
on the pathology caused by EEDV stems from the examination of severely moribund fish
collected at the peak of natural mortality events when many external lesions were obscured by
secondary bacterial agents and water mold contaminants invading lacerated tissues. This study
aims at examining the progression of disease and associated pathology following exposure of
naïve juvenile lake trout to EEDV via bath immersion. Groups of six fish were randomly
collected and euthanized following a pre-determined schedule over the course of 6 weeks with
individual tissues analyzed for gross and histopathologic changes. Based on our data, there was
an incubation period of three weeks prior to observation of clinical signs and morbidity in EEDV
infected fish, which is significantly longer than that of other pathogenic fish viruses. Early gross
pathology included exophthalmia and ocular hemorrhage as well as fin congestion, and
hyperemia of enteric and hepatic blood vessels. Advanced disease manifested as the previous
gross pathology with the addition of multifocal to coalescing erosions and ulcerations of the skin
and fins as well as congestion of visceral organs. The earliest microscopic lesions developed at
21 days post-exposure in the skin and fins, and were characterized by localized cellular
degeneration of epidermal epithelial cells that progressed to erosions and ultimately focally
extensive necrosis and associated dermatitis and perivasculitis. Early signs of systemic disease
were observed at Day 28, characterized by multifocal to confluent necrosis in the spleen,
multifocal intestinal necrosis and lymphohistiocytic perivasculitis of multiple internal organs

124

including the omentum and the epicardium. In addition, fish presented with focal necrosis of
interstitial hematopoietic cells in the anterior kidney and rare apoptotic cells in the liver. The
progression of lesions is consistent with the cutaneous epithelium representing the primary target
of viral infection with hematopoietic organs and vessels undergoing pathology at the later
viremic phase of the disease.

2. Introduction
Epizootic Epitheliotropic Disease Virus (EEDV; Salmonid Herpesvirus-3) has been
implicated in multiple mortality events throughout the Midwestern United States over the past
three decades (2, 5) and continues to be a concern in Great Lakes fisheries management today
(Chapter 2). EEDV has been shown to be particularly pathogenic to juvenile lake trout
(Salvelinus namaycush) based both on viral identification during mortality events (2) (Chapter 2)
as well as through experimental challenges (3, 4) (Chapter 3). The clinical manifestation of
EEDV in experimental challenges was consistent with that seen in natural outbreaks which
included catastrophic mortalities in juvenile hatchery raised lake trout, with fish exhibiting
ocular hemorrhage, corneal opacity, gill pallor, skin lesions ranging from pallor to erosions and
ulcerations, water mold overgrowth, erosion and congestion of the fins and erythema of the oral
cavity, isthmus and ventrum (Chapter 2). Additional detection of EEDV was reported from the
reproductive fluids and kidneys of mature spawning lake trout (5, 14). Unfortunately, specific
information regarding virus biology, pathology and host interactions remains largely unknown in
part due to the lack of an EEDV susceptible cell line and inability to culture this virus in vitro.
This knowledge gap hampers the design and implementation of effective disease control
strategies in the Laurentian Great Lakes Basin. A recently developed in vivo model of immersion

125

challenge and virus replication (Chapter 3) has provided a crucial step in the ability to study the
pathogenesis of EEDV, allowing for examination of EEDV pathology and disease progression
under controlled laboratory conditions.
Elucidating the sequential pathology and disease progression following EEDV infection
is of vital importance as this virus continues to threaten lake trout rehabilitation efforts
throughout the Midwestern United States. While many questions remain about the pathology of
EEDV, this is not the case for all Alloherpesviruses. Evaluation of samples collected during
natural outbreaks and experimental challenges aided in describing the pathology associated with
infection of rainbow trout (Oncorhynchus mykiss) with Oncorhynchus masou virus (OMV;
Salmonid Herpesvirus-2) (87). In both naturally and experimentally infected fish, severe
pathology was observed in the intestine, spleen and kidney including necrotic and hemorrhagic
foci in the splenic pulp and hematopoietic tissue. Some fish also displayed necrotized gill
filaments and hepatocytes, yet surprisingly, carcinoma development was not noted in surviving
fish as is typical with other salmonids infected with OMV (87).
Similar experimental studies performed with Salmonid Herpesvirus-1 resulted in gross
lesions including alterations of pigmentation, exophthalmia and abdominal distension as well as
hemorrhages in the fins, pale gills and yellow to red tinged ascites (101). Microscopic pathologic
lesions were noted in the heart, musculature, liver, kidney and pancreas (101). Salmonid
herpesvirus-4 is the causative agent of Atlantic salmon papillomatosis (ASP), a proliferative
disease seen primarily in juvenile Atlantic salmon (Salmo salar) undergoing the smolting process
(109). Reported ASP lesions consist of epithelial cell hyperplasia and karyomegaly with a loss of
goblet cells and disruption of the basement membrane (90).

126

Previous histopathologic examination of EEDV-infected tissues has been limited to
primarily severely diseased fish collected during an epizootic (2) (Chapter 2). In such severe
cases, epithelial lesions have often been obscured and contaminated by the invasion of
opportunistic and pathogenic bacteria and water mold into lacerated tissues, leading to
difficulties in accurate assessment of underlying disease pathology. In order to alleviate the
inherent challenges of attributing severe lesions during natural infections to EEDV, a study was
designed to characterize the progression of gross and histopathologic disease after experimental
exposure of naïve host fish to a moderately lethal dose of EEDV. The data generated herein will
provide researchers, diagnosticians and fisheries managers with crucial information regarding the
pathogenesis of EEDV.

3. Materials and Methods
3.1. Fish and maintenance
EEDV experimental challenges were performed using juvenile, Lake Superior strain lake
trout (6 months post-hatch) supplied by the Marquette State Fish Hatchery (Marquette,
Michigan). All experimental fish were randomly collected from a lot certified to be free of any
reportable pathogens as per the AFS-FHS Bluebook (40). Certification was achieved following
normal clinical examination of 60 randomly collected fish. Additionally, the absence of EEDV in
the lot was confirmed using qPCR as detailed below. Experimental challenges were performed at
the Michigan State University – Research Containment Facility (East Lansing, Michigan) in
accordance with the Institutional Animal Care and Use Committee guidelines and approval.
Upon receipt, all fish were housed in a 680-liter fiberglass aquarium and allowed to acclimate to
standard laboratory conditions for a minimum of one month prior to experimental challenges. At

127

all times fish received continuous, oxygenated well water and were fed 1.0mm sinking feed ad
lib (BioOregon, Westbrook, Maine, USA). During the experimental studies, fish were housed in
42 L fiberglass aquaria receiving continuous, flow-through, oxygenated well water at a
temperature of 9.0 ± 0.5°C.

3.2. Virus
A stock of infectious EEDV for use in experimental challenges was produced through in
vivo serial passage. Skin was initially collected from lake trout experiencing a natural EEDV
outbreak in 2012 and stored at -80 °C. This skin was homogenized in a sterile phosphate
buffered saline solution (pH 7.5 ± 0.5; Sigma-Aldrich, St Louis, Missouri, USA) at a ratio of 1:3
(w/v), clarified via low speed centrifugation (1,400 x g) for 20 minutes at 4°C and used to infect
naïve juvenile lake trout via intraperitoneal injection (IP). Prior to IP injections, naïve fish were
anesthetized using tricaine methansulfonate (MS-222; Argent Chemical Laboratories, Redmond,
Washington; 0.1 mg/mL). After an IP injection of 300 µL virus stock, fish were allowed to
recover from sedation and returned to flow-through aquaria for the duration of the study. Fish
were monitored daily, collected immediately upon death or development of morbidity
(euthanized with an overdose of MS-222; 0.25 mg/mL), and a necropsy performed. Skin was
again collected, processed as previously with the substitution of Earle’s salt-based minimal
essential medium (MEM; Invitrogen, Thermo Fisher Scientific, Waltham, Massachusetts, USA),
supplemented with 12 mM Tris buffer (Sigma-Aldrich, St Louis, Missouri, USA), penicillin (100
IU/mL; Invitrogen), streptomycin (100 µg/mL; Invitrogen), and amphotericin B (250 µg/mL;
Invitrogen) rather than PBS, and used to infect a new group of naïve lake trout. This process

128

continued until an adequate volume of 7th passage stock was created for use in this and future
experimental studies.

3.3. Experimental challenge
Fish were divided into an EEDV group (n = 84) and a negative control group (n = 48).
All fish were challenged via the immersion method previously described (Chapter 3). Briefly,
fish were transferred to static, aerated glass aquaria to which experimental dose (virus or sham
control) was added directly to the water. Fish were monitored in these holding aquaria for a
period of one hour during which water temperature was maintained at 9.0 ± 0.5°C by utilizing a
separated, larger surrounding bath of continuous water flow. The EEDV group was exposed to a
moderate lethal dose of EEDV (Chapter 3) while the negative control group was immersed in a
sham suspension of MEM diluent. After completion of the exposure period (1 hour), fish were
transferred back to their experimental flow through aquaria for the duration of the study where
they were monitored daily for development of clinical disease.

3.4. Sample collection and preparation
Sampling occurred in parallel from the two experimental groups on Days 0, 1, 3, 6, 9, 12,
15, 28, 21, 28, 35, and 42-post infection (p.i.) at which time seven EEDV infected fish and four
negative control fish were collected and euthanized in a manner which minimized the stress for
both sampled and remaining fish. On each sampling day, one infected fish and one control fish
were preserved whole in 10% neutral buffered formalin; a ventral midline incision was created in
order to allow for improved internal fixation. Full external and internal exams were performed
on the remaining six infected and three negative control fish and portions of skin, fin, gill, eye,

129

brain, spleen, heart, liver, intestine, and kidney were collected from each fish. Each tissue was
divided for: 1) detection of EEDV by PCR (frozen at -20°C) and 2) microscopic examination
(fixed in 10% neutral buffered formalin). Portions were collected from both anterior and
posterior kidney, one whole eye was collected for each assay, and the “intestine” sample
consisted of a segment approximately 1 cm oral to the vent.

3.5. Virus detection
The presence of EEDV in sampled tissues was confirmed using quantitative PCR. DNA
extractions and PCR reactions were performed following the protocol outlined by Glenney et al
(2016) (14). DNA extractions were performed manually using the Mag Bind® Blood and Tissue
DNA Kit (OMEGA Bio-tek, Inc, Norcross, Georgia, USA), following the manufacturer’s
instructions and with the addition of a filtering step using the E-Z 96® Lysate Clearance Plate
(OMEGA Bio-tek, Inc, Norcross, Georgia, USA) after tissue digestion. Eluted DNA was
quantified using a Quant-iT DS DNA Assay Kit and a Qubit fluorometer (Life Technologies,
Grand Island, New York, USA). All PCR reactions were carried out in a Mastercycler ep
realplex2 S real-time PCR machine (Eppendorf, Hauppauge, New York, USA) with a total
reaction volume of 20 µL and 50 nmol total DNA template.

3.6. Histopathology and lesion scoring
After fixation, tissues were processed for routine paraffin embedding. Paraffin blocks
were sectioned at 5 µm, and slides were routinely stained with hematoxylin and eosin (H&E) for
histopathologic examination (117). All slides were examined by an American College of
Veterinary Pathologists board-certified pathologist who was blinded to the presence of gross

130

lesions or results of EEDV detection in individual tissues. All identifiable lesions were scored on
a scale of 0 to 3 with 0 being no lesion (normal), 1 being mild lesion, 2 being moderate lesion
and 3 being severe lesion.

4. Results
4.1. Clinical disease and mortalities
Infected fish exhibited exophthalmia and ocular hemorrhage (Figure 5.1a) as early as one
day post infection, increasing from 33% of fish sampled on Day 1 (n = 2/6) to 100% of fish
sampled on Day 28 (n = 6/6). Other early signs of clinical disease (i.e., first observed in a
minimum of 2 fish/day prior to Day 18 p.i.) included congestion at the base of pectoral and
pelvic fins (Figure 5.1b) and along the isthmus, mild splenic pallor, and hyperemia or
engorgement of enteric and hepatic blood vessels (Figure 5.1c). During later stages of disease
(i.e., Days 21-42 p.i.), fish consistently exhibited moderate to severe congestion of multiple fins
(Figure 5.1d), ocular hemorrhage and exophthalmia, multifocal to coalescing erosions and
ulcerations of the skin, fins and caudal peduncle (Figure 5.1d) as well as congestion of visceral
organs such as kidney, liver and spleen. The number of fish with clinical disease increased each
sampling day from 33% of fish being affected at Day 6 to 100% being affected by Day 15
through the end of the study. Likewise, the total number of observed gross lesions each day
increased from ≤ 6 on Days 0-12 (average of < 1 per fish per day) to averaging > 5 lesions per
fish per day from Day 21 through the end of the study. Mortalities occurred in the infected group
on Day 28 post-infection (n = 4) while no mortalities or gross lesions were noted in the negative
control group. A detailed account of gross pathology is presented in Table 5.1.

131

4.2. Virus identification
In order to confirm the presence of EEDV in experimentally challenged fish, external
tissues (e.g., skin) and internal organs (e.g., kidney) were tested via qPCR as described above.
EEDV DNA was detected in the skin (n = 2/6 fish) as early as Day 18 p.i., and from Days 21-42
p.i. the virus was detected in the skin of 96% of fish sampled (n = 23/24) (Table 5.2). In
comparison, the virus was not detected in the kidney until Day 21 p.i., and in only 67% of fish
from Days 21-42 p.i. (n = 16/24). Throughout the experiment, no EEDV nucleic acid was
detected from control fish.

4.3. Microscopic lesions and scoring
A total of 754 tissues from 12 control fish and 67 infected fish were examined for
microscopic lesions. A small number of tissues (< 5%) were unable to be appropriately examined
due to preservation, preparation artifact, or sectioning angle which led to insufficient tissue
available for analysis. A detailed chart of lesions by day and tissue type, along with the number
of fish from which lesions were observed is presented in Table 5.3.
Hepatic lipidosis was nearly ubiquitous among control fish throughout the study (Figure
5.2a, 5.2b), and among infected fish during the early weeks of the experiment (Figure 5.2c, 5.2d)
yet was observed in only 30% of infected fish examined during the last three sampling weeks
(Figure 5.2e, 5.2f). Fixation artifact was observed in many intestinal sections from fish in both
the EEDV group and the negative control group where distal villi became mild to heavily,
multifocally vacuolated which was likely caused by superficial epithelial cells swelling due to
contact with buffered formalin prior to complete fixation. There was a mild, patchy proliferative
branchitis in the gills of many fish in both groups throughout the study. This was characterized

132

by a loss of secondary lamellae coupled with a thickening epithelial layer and infiltration of
mononuclear cells. There was no evidence of an increasing severity over time, and there were no
differences in distribution and severity of branchitis between fish in the negative control group
and the EEDV group.
The primary microscopic lesions noted in this current study were observed in the skin and
fins (Figure 5.3). The earliest lesions were observed in the epidermis at Day 21 and consisted of
individual epithelial cell degeneration and single acantholytic cells. In multiple areas there were
intracytoplasmic eosinophilic vacuoles in few epithelial cells as well as rare intraepithelial
inflammatory cells (Figure 5.3b). Lesions progressed in some areas to epithelial erosions with
sloughing of degenerated epithelial cells (Figure 5.3c). By Day 28 epithelial erosions were more
severe with extensive intraepithelial inflammatory infiltrates and cellular degeneration (Figure
5.3d) and in the most advanced lesions epithelial cells were undergoing degeneration and
necrosis throughout all layers of the epidermis (Figure 5.3e). The most severe lesions were
observed at Day 35 and characterized by massive epithelial ulceration and complete epidermal
loss (Figure 5.3d). Cutaneous lesions were not observed prior to Day 21, but were observed in all
fish examined at later time points except for a single fish on Day 35 and one fish on Day 42.
As early as Day 3 post-exposure, focal areas of single cell necrosis were observed in the
liver (Figure 5.2c), characterized by cells with deeply basophilic, shrunken, pyknotic
hepatocellular nuclei and hypereosinophilic, contracted cytoplasm. Such changes were observed
with increasing severity as evidenced by increasing numbers of foci of pyknotic cells and in
more fish per sampling day. Beginning on Day 9, ≥ 66% of fish were affected by similar lesions
with 100% of fish sampled over the final three weeks showing at least mild changes. Starting at
Day 18, single cell necrosis focally expanded to small foci of hepatocellular necrosis and there

133

was also lymphohistiocytic perivascular inflammation affecting both hepatocellular arteries and
veins (Figure 5.2c). Lesions were most severe in fish collected on days 21 and 28, but similar
lesions were found in fish examined at later days (Figure 5.2d).
Also at 28 days post exposure, both examined fish had severe lymphoid necrosis of the
spleen (Figure 5.4a and 5.4b) and lymphohistiocytic perivasculitis affecting multiple organs, but
being most severe in the omentum (Figure 5.4c and 5.4d), heart (Figure 5.4e) and as previously
discussed liver. Lymphohistiocytic perivasculitis was most severe in the omentum of one fish
euthanized on Day 28 and there were rare intranuclear inclusion bodies in monocytes in the
lumens of affected blood vessels (Figure 5.4d). While proliferative branchitis with focal
lymphohistiocytic inflammatory cell infiltrates (Figure 5.4f) was observed in numerous EEDV
infected fish, similar lesions were also found in control fish.
Microscopic lesions in the kidneys were not observed until Day 28 post-exposure,
however, once these changes began to occur, they were noted in every fish examined from that
point through the end of the study. Renal pathology was characterized by depletion and
multifocal necrosis of interstitial hematopoietic cells. At higher magnifications, pyknotic and
degenerate nuclei were found in hematopoietic cells (Figure 5.5c, 5.5d), while at low
magnifications, lesions were characterized by a marked reduction in the number of interstitial
cells (Figure 5.5e, 5.5f). While these changes were observed in both anterior and posterior
kidney sections, no significant pathology was noted in the renal tubules at any time points.
Epithelial lesions in the skin and fins were not appreciable until Day 21 p.i., and
represented the first evidence of viral disease. While single cell necrosis in the liver was
described at an earlier stage of the experiment, these lesions were less specific and multi organ

134

involvement with lymphohistiocytic perivasculitis and lymphoid necrosis was not reported until
Day 28 p.i.

5. Discussion
In this study, we have demonstrated that infection with Epizootic Epitheliotropic Disease
Virus (EEDV; Salmonid Herpesvirus-3) leads to development of a lethal, systemic disease in
lake trout and have further elucidated the pathogenesis of EEDV in its primary host species.
Clinical signs and gross and microscopic lesions induced through experimental immersion
challenge were consistent with those seen observed in natural EEDV outbreaks (2) (Chapter 2).
The incubation period was significantly longer for EEDV infected fish compared to other viral
diseases of fish and the earliest lesions were observed in the eyes, skin and fin. While
exophthalmia and ocular hemorrhage were described grossly, no ocular lesions were reported
microscopically. This discrepancy may simply reflect our inability to track individual fish with
gross lesions across subsequent sampling days. The grossly observed skin lesions corresponded
with the reported degenerative and necrotic epidermal lesions described microscopically and
represent the first manifestation of EEDV in lake trout. Early cutaneous lesions were followed by
viremia that resulted in severe lesions in internal organs and mortality at Day 28. The severity of
gross lesions, histopathologic lesions, and mortalities also coincided with peak viral
identification around 28 days p.i. via qPCR in the previous study (Chapter 4). These results
demonstrate the prolonged and delayed development of clinical disease following exposure to
EEDV. This is ecologically and epidemiologically important in terms of identifying potential
viral sources following a mortality event. The point of exposure may have been up to a month
prior to observation of diseased fish given the extended incubation period in the present study.

135

Interestingly, while EEDV nucleic acid was not identified in the liver until Day 21,
pathological changes were observed among hepatocytes soon after exposure. One hypothesis is
that the virus may rapidly lead to irreversible hepatic damage prior to establishment of
appreciable systemic disease. Alternatively, the single cell necrosis in the liver may represent a
response to the actual inoculum and not true viremia and hepatocellular infection by EEDV.
Additionally, it is important to highlight the fact that while hepatic lipidosis is common in
captive reared fish due to the limited amount of work required for the fish to receive high
volumes of nutrient dense food, identification of such lesions in the present study revealed an
interesting trend. Hepatic lipidosis was observed in nearly all negative control fish as well as
infected fish sampled early in the study, however by the end of the challenge period, prevalence
had dropped to less than a third of the fish over the final three sampling weeks. This can be used
as an indicator that these fish, while surviving the EEDV infection were ill and had reduced feed
intakes as a result. While hepatic lipidosis in many instances is an abnormal finding, in hatcheryraised fish such as these, it is in fact the absence of such a lesion that is the noteworthy finding.
Despite previous reports of pathologic changes in the gills and more specifically the
lamellar epithelium (3), in this study we were unable to attribute the observed gill lesions directly
to EEDV infection. There was no difference in gill lesions between infected and control fish and
no progression of branchitis was observed in EEDV infected fish throughout the course of
infection. Further studies using in situ hybridization were carried out to determine a potential
association between EEDV and gill lesions and the results are presented in Chapter 4. The cause
of proliferative branchitis in control fish remains unclear, but may be due to a number of reasons.
Many of the fish used for this experiment had shortened opercula, a not uncommon
developmental abnormality seen in captive reared salmonids. While not particularly life

136

threatening to the fish, this shortening allows for an increase in gill exposure to environmental
conditions. This could have led to increased exposure to waterborne infectious agents, but also
increased exposure of the sensitive gill lamellae to non-infectious debris and particles in the
environment, leading to thickening and increased cellular infiltrates as described. So while the
EED virus may cause degenerative and inflammatory changes within the gills, variation in
individual fish anatomy may cause similar changes that could obscure such lesions. Additionally,
an oblique angle when sectioning gill arches can have a great affect on the ability to interpret
lamellar changes. In order to more definitively identify EEDV-related lamellar changes, multiple
gill arches from each fish should be examined.
This study also provides evidence for the potential cause of death of EEDV infected fish.
During the last three weeks of the experiment, cutaneous lesions were observed in 80-100% of
infected fish and epithelial necrosis as observed here is known to lead to hypo-osmotic shock and
death in fish infected with other viruses such as Koi Herpesvirus (Cyprinid Herpesvirus-3) (132).
Additionally, by Day 28 p.i., infected fish had developed lesions in multiple organs that were
primarily centered on vessels. Observation of intranuclear inclusion bodies in blood monocytes
indicates transmission of virus from affected surface epithelium through infected monocytic cells
causing viremia and secondary infection of internal organs. Such lesions are most likely
indicative of an overall poor systemic health of viremic fish. As renal tubular damage was not
appreciated throughout the study, renal function was likely unaffected. However, the
combination of lymphoid necrosis causing immune suppression, perivasculitis most likely
resulting in a systemic cytokine response, and epithelial damage coupled with the general stress
caused by high densities and standard operating procedures within salmonid hatcheries is enough
to tip the scales, resulting in the observed mortalities.

137

Finally, when comparing the relatively minor mortality rates observed in the current
study with the high viral titers demonstrated in the previous chapter, a concern arises that lake
trout are able to not only survive an EEDV infection, but such fish may in fact be able to act as a
viral reservoir and subsequently pose a substantial risk to younger, more susceptible populations
of fish. While we have demonstrated that EEDV causes a lethal disease in experimentally
challenged lake trout, we have also shown that fish are able to survive despite high viral loads
and advanced pathological lesions. This highlights the need for aggressive and persistent
screening for EEDV in captive lake trout in order to rapidly identify and quarantine any
potentially infected populations before the virus can spread throughout the hatchery. Recent
mortality events (Chapter 2) have highlighted the fact that EEDV remains present and a threat
within the Great Lakes basin, and this current study has provided us with key information
regarding the host-virus interactions.

138

APPENDIX

139

Figure 5.1 Gross pathology following experimental exposure of naïve juvenile lake trout
to EEDV by bath immersion. A) ocular hemorrhage; B) pectoral fin congestion; C)
engorgement or hyperemia of major hepatic vasculature; D) caudal and anal fin
congestion, generalized pallor of the caudal peduncle, erosion of caudal peduncle and
caudal fin.

140

Fish #

Day 0

Day 1

Day 3

Day 6

Day 9

Day 12

Day 15

Day 18

Day 21

Day 28

Day 35

Day 42

1

Mildly short
right
operculum.
Mildly
congested,
melanotic,
darkened
kidney.

Normal
external.
Normal
internal.

Mildly short
operculum,
bilateral.

Normal
external.
Mildly pale
heart.

Mild bilateral
exophthalmia.
Mildly short
operculum
bilateral. Mild
splenomegaly.

Normal
external.
Mildly pale
kidney.

Normal external.
Mildly hyperemic
hepatic vessels.

Normal external.
Mild hyperemic
enteric vessels.

Mildly short operculum
bilateral. Normal internal.

Occular hemorrhage 6:00 bilateral.
Congestion base pectoral and pelvic
fins. Mildly swollen vent. Moderate
autolysis. Congested kidney.

Swollen vent. Occular
hemorrhage 6:00
bilateral.

Mild erosion caudal fin.
Multifocal skin palor and
erosion. Mildly swollen
spleen. Mildly pale kidney.

2

Mildly short
operculum,
bilateral.
Normal
internal.

Normal
external.
Normal
internal.

Mild
exophthalmia
left eye.
Mildly short
operculum
bilateral.
Normal
internal.

Mildly short
right
operculum.
Normal
internal.

Normal external.
Mildly pale liver

Mild congestion
4x4 mm pale patch, mild
base pectoral fin erosion, between dorsal and
& isthmus. Mild
adipose fins. Severe
erosion around
congestion base of right
dorsal opercular
pectoral fin. Mild erosion
margin (left side).
caudal, dorsal, anal fins.
Mild hyperemia
Mild hyperemia enteric
enteric vessels.
vessels.

Hemorrage 6:00 left eye. Congestion
base all fins. Moderate autolysis.

Normal external.
Mild congestion liver.
Moderate congestion
kidney.

Multifocal skin erosion
and swelling. Mild erosion
all fins. Multifocal
hemorrhagic staining in
abdominal adipose tissue
around spleen. Congested
and friable spleen.
Congested kidney.

Hemorhage 6:00 left eye. Generalized
palor. Mild erosion/ragged all fins.
Moderate autolysis.

Multifocal mucous
accumulations along
dorsum and on left
eye. Mildly swollen
spleen. Hyperemia
hepatic and enteric
vessels. Moderate
congestion kdiney.

Multifocal erosion and
swellingin the skin. Mild
erosion all fins.
Moderately pale gills.
Mildly swollen spleen.
Hyperemia hepatic/enteric
vessels. Mildly congested
kidney.

3

4

5

6

Hemorrhage
Normal
6:00 left eye.
external.
Mild hyperemia
Normal internal.
hepatic vessels.

Normal
external.
Normal
internal.

Mild
exophthalmia
Moderate
left eye. Mildly
congestion base Mild short right
short/eroded
of right pectoral
operculum.
right
fin. Normal
Normal internal.
operculum.
internal.
Mild hyperemia
enteric vessels.

Normal
external.
Normal
internal.

Mild short right
operculum.
Hemorrhage
Mild congestion 6:00 left eye.
isthmus.
Mildly pale
Hemorrhage
spleen. Mild
6:00 left eye.
hyperemia
Normal
enteric vessels.
internal.

Mild congestion
base of left
Normal
pectoral,
external. Mild
bilateral pelvic
hyperemia
fins. Mildly
hepatic vessels
pale spleen.

Mildly short
operculum,
bilateral. Mildly
small spleen.

Mild
generalized
melanosis,
mildly
prominent
lateral line.
Normal
internal.

Normal
external. Green
distended gall
bladder.

Normal
external.
Normal
internal.

Normal
external.
Normal
internal.

Hemorrhage
6:00 left eye.
Normal
internal.

Mild exophthalmia
left eye. Mildly
congested kidney.

Hemorrhage 6:00 left
eye. Mild erosion
Hemorrhage
between right nare
6:00 left eye.
and eye. Hyperemic
Swollen spleen.
hepatic vessels.
Midly congested
kidney.

Moderate
congestion base
of left pectoral
fin. Mildly pale
spleen.

Normal
external.
Normal
internal.

Mild
congestion
base of pelvic
Normal
fins. Mildly
external. Mild
short
hyperemia
operculum
enteric vessels.
bilateral.
Normal
internal.

Normal
external.
Normal internal.

Normal
external.
Normal
internal.

Normal
external.
Mildly
hyperemic
enteric/coloni
c vessels.

Hemorrhage
6:00 left eye.
Normal
internal.

Mild erosion dorsal
margin opercular
opening bilaterally.
Mild bilateral
exophthalmia.
Hyperemic enteric
vessels.

Midlly pale gills.
Normal internal.

Mild erosion caudal/anal
fins. Mild erosion around
nares. Mildly pale spleen.
Mild hyperemia enteric
vessels.

Mild erosion caudal fin. 3x3
mm erosion/pale patch
Multifocal skin
caudal to head (dorsal).
erosion along dorsum.
Mort. Hemorrhage 6:00 left eye.
Multifocal skin
Hemorrhage 6:00 Mild generalized palor and
Mildly short right
Swollen vent. Congestion base
erosion/swelling/palor.
left eye. Mildly
scale loss. Mild
operculum. Mild
pectoral/pelvic fins. Generalized palor.
Mildly pale gills. Swollen
pale liver.
exophthalmia. Moderately
generalized palor.
Moderate autolysis.
spleen. Congested kidney
pale spleen. Hyperemia
Mildly swollen
enteric vessels. Mildly
spleen.
congested kidney.

Mild generalized
palor. Mild
hyperemia enteric
vessels.

Normal external.
Mild hyperemia enteric
vessels.

Mild erosion/scale loss
Mild development
Hemorrhage 6:00 left
caudal peduncle and left
deformity pectoral
eye. Mild congestion
lateral side cranial to dorsal
fins bilateral. Mild
base pelvic/anal fins.
fin. Moderate hyperemia
congestion kidney.
enteric vessels.

Moribund. Hemorrhage 6:00 left eye. Hemorrhage 6:00 left
Swollen vent. Congesiton base of anal
eye. No right eye
fin/caudal fin. Moderately ragged
(chronic/healed).
caudal fin. Multifocal generalized
Mildly pale gills.
palor and epidermal erosion. Green
Mild congestion
distended gallbladder. Mild congestion
liver/kidney.
kidney. Mild hyperemia enteric
Hyperemia enteric
vessels.
vessels.

Generalized palor. Mild
bilateral exophthalmia.
Mildly pale gills. Pale
liver.

Generalized palor.
Hemorrhage 6:00 left eye. Mild
Mild congestion liver.
erosion all fins and caudal peduncle.
Mild hyperemia
Multifocal generalized palor and mild
enteric vessels.
erosion skin. Mild hyperemia enteric
Mildlly swollen
vessels. Moderate congestion kidney.
spleen.

Mild erosion caudal
peduncle. Multifocal skin
erosoin/scale loss.

Table 5.1 Summary of gross pathologic changes observed following immersion challenge of naïve juvenile lake trout with EEDV.

141

EEDV Positive Samples
Day P.I.
0
1
3
6
9
12
15
18
21
28
35
42

Skin

Kidney

Fish Number

Fish Number

1

2

3

4

5

6

1

2

3

4

5

6

+	
+
+
+

+
+
+
+

+
+
+
+

+
+
+
+

+
+
+
+

+
+
+
+
+

+
+
+
+

+
+
-

+
+
+
+

+
+
-

+
-

+
+
+
-

Table 5.2 Identification of EEDV genomic material in tissues of experimentally
challenged lake trout (Salvelinus namaycush) collected in parallel on predetermined days
using a SYBR Green qPCR assay. “-“ indicates no EEDV genetic material; “+” indicates
presence of EEDV DNA.

142

Tissue
# of Fish

Fin

Gill

Intestine

Kidney

Liver

Skin

Spleen

Heart

Day 0

Day 1

Day 3

Day 6

Day 9

Day 12

Day 15

Day 18

Day 21

Day 28

Day 35

Day 42

0/6

0/6

0/6

0/6

0/6

0/6

0/6

0/6

0/6

1/2

1/4

4/5

Mild epidermal erosion
Moderate epidermal
Mild epidermal
and ulceration with
erosion amd ulceration erosion and necrosis.
necrosis.

Lesion
Description

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

# of Fish

3/4

4/5

5/5

5/6

5/6

1/4

5/5

1/3

4/5

1/2

3/5

3/6

Mild
proliferative
branchitis

Mild proliferative
branchitis

Mild proliferative
branchitis

Mild proliferative
branchitis

Mild proliferative
branchitis

Mild proliferative
branchitis

Mild proliferative
branchitis

Mild
Mild-moderate
Mild
Mild
Lesion
Mild proliferative
proliferative
proliferative proliferative proliferative
Description
branchitis
branchitis
branchitis
branchitis
branchitis
# of Fish

3/6

2/6

1/6

3/6

0/6

2/6

3/6

5/6

2/6

2/2

0/6

0/6

Lesion
Description

Mildmoderate
distal villar
vacuolation

Moderate distal
villar vacuolation

Mild distal
villar
vacuolation

Mildmoderate
distal villar
vacuolation

n/a

Mild-moderate
distal villar
vacuolation

Mild distal villar
vacuolation

Mild distal villar
vacuolation

Mild-moderate distal
villar vacuolation

Lymphohistiocytic
perivasculitis. Mild
distal villar
vacuolation

n/a

n/a

# of Fish

0/6

1/6

0/6

0/6

0/6

0/6

0/6

0/6

0/6

2/2

5/5

6/6

Lesion
Description

n/a

Mild multifocal
hemorrhage,
posterior kidney

n/a

n/a

n/a

n/a

n/a

n/a

n/a

# of Fish

5/6

6/6

6/6

6/6

6/6

6/6

6/6

6/6

6/6

Hepatic
lipidosis;
Mild
multifocal
single cell
necrosis

Hepatic
lipidosis;
Mild
multifocal
single cell
necrosis

Hepatic
lipidosis; Mild
multifocal
single cell
necrosis

Hepatic lipidosis;
Mild-moderate
multifocal single
cell necrosis and
lymphohistiocytic
perivascular
inflammation.

Mild-moderate
Mild-moderate
Mild-moderate
hematopoietic cell
hematopoietic cell
hematopoietic cell
depletion and necrosis,
depletion and
depletion and necrosis,
anterior and posterior necrosis, anterior and anterior and posterior
kidney
posterior kidney
kidney

2/2

5/5

6/6

Hepatic lipidosis;
Hepatic lipidosis;
Hepatic lipidosis; Mild- Hepatic lipidosis; MildMild-severe
Mild-moderate
moderate multifocal
moderate multifocal
multifocal single
multifocal single cell Hepatic lipidosis; Mildsingle cell necrosis and
single cell necrosis
cell necrosis and
necrosis and
moderate multifocal
lymphohistiocytic
and lymphohistiocytic
lymphohistiocytic
lymphohistiocytic
single cell necrosis.
perivascular
perivascular
perivascular
perivascular
inflammation.
inflammation.
inflammation.
inflammation.

Lesion
Description

Hepatic
lipidosis

Hepatic lipidosis

Hepatic
lipidosis; Mild
multifocal
single cell
necrosis

# of Fish

0/4

0/3

0/3

0/6

0/6

0/6

0/5

0/6

2/6

2/2

4/5

4/5

Lesion
Description

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

Individual epithelial
cell necrosis and
intracytoplasmic
eosinophilic vacuoles,
focal erosins.

Mild epidermal
erosion and focal
ulceration

Severe epidermal
erosions and
ulcerations with
focally extensive
necrosis

Moderate epidermal
erosions and focal
ulceration.

# of Fish

0/6

0/6

0/6

0/6

0/6

0/5

0/6

0/6

0/5

2/2

4/5

5/6

Lesion
Description

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

Multifocal to diffuse
lymphoid necrosis

Multifocal lymphoid
necrosis

Multifocal lymphoid
necrosis

# of Fish

0/4

0/3

0/3

0/6

0/6

0/6

0/5

0/6

0/6

2/2

0/6

0/6

n/a

Lymphohistiocytic
perivasculitis and
epicarditis

n/a

n/a

Lesion
Description

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

Table 5.3 Summary of histopathologic changes on all sampling days. No appreciable lesions were observed in the eyes or brains, on
any days.
143

Figure 5.2 Liver collected from negative control fish and lake trout experimentally infected
with EEDV. Magnification 400X. A) negative control, Day 1, severe hepatic lipidosis; B)
negative control, Day 9, moderate hepatic lipidosis; C) infected, Day 18, focal hepatocellular
necrosis (arrow) and lymphohistiocytic perivascular inflammation (arrowhead), severe hepatic
lipidosis; D) infected, Day 42, focal hepatocellular necrosis and lymphohistiocytic
inflammation (arrowhead), mild hepatic lipidosis.

144

Figure 5.3 Skin collected from negative control fish and lake trout experimentally infected
with EEDV. Magnification 200X, hematoxylin and eosin staining. A) negative control, Day
35; B) infected, Day 21, individual epithelial cell necrosis (arrow) and intracytoplasmic
eosinophilic vacuoles in few cells (arrowhead) as well as rare intraepithelial inflammatory
cells are the earliest lesions; C) infected, Day 21, early epithelial erosion with sloughing of
degenerated epithelial cells (arrow); D) infected, Day 28, more severe epithelial erosions with
extensive intraepithelial inflammatory infiltrates and cellular degeneration (arrowheads); E)
infected, Day 28, advanced stage with epithelial cells undergoing degeneration and necrosis
throughout all layers of the epidermis (arrowheads); F) infected, Day 35, late stage with
massive epithelial ulceration and complete epidermal loss.

145

Figure 5.4 Tissues collected from lake trout experimentally infected with EEDV.
Magnification 200X (except B; magnification 400X), hematoxylin and eosin staining A)
spleen, Day 28, diffuse lymphoid depletion with focal areas of necrosis (arrowhead); B)
spleen, Day 28, focal areas of necrosis (arrowhead); C) omentum, Day 28, severe
lymphohistiocytic perivasculitis (arrowhead); D) omentum, Day 28, lymphohistiocytic
perivasculitis (arrowhead) with intranuclear inclusion body in blood monocyte (arrow); E)
heart, Day 28, lymphohistiocytic perivasculitis (arrowhead) and epicarditis; F) gill, Day 28,
proliferative branchitis with focal lymphohistiocytic inflammatory cell infiltrate (arrowhead).

146

Figure 5.5 Kidney collected from negative control fish and lake trout experimentally infected
with EEDV. Magnification 100X (E), 200X (A), 400X (B, C, D, F). A) negative control, Day
35; B) negative control, Day 35; C) infected, Day 28, hematopoietic cellular necrosis and
depletion; D) infected, Day 28, hematopoietic cellular necrosis; E) infected, Day 28,
hematopoietic cellular depletion; F) infected, Day 28, hematopoietic cellular depletion.

147

Chapter 6

Establishment and characterization of two novel cell lines from lake trout (Salvelinus
namaycush)

148

1. Abstract
In this study, we establish two novel lake trout (Salvelinus namaycush) cell lines,
produced from yearling gonad tissue and sac fry bodies with species origin confirmed using
DNA barcoding. These cell lines were each produced following manual and enzymatic digestion
of tissue and incubation at 15°C with Earle’s salt-based minimal essential medium (MEM)
supplemented with 15% fetal bovine serum (FBS). Primary cultures of both cell types were
readily established and subculturing occurred within 2-4 weeks of initial seeding. Repeated
passaging of cells has resulted in gonad cells reaching subculture number 35 and fry cells
reaching 52. Additional primary cell cultures were produced from yearling fin and broodstock
liver tissues, however these cultures were unable to be reliably subcultured. Morphologically,
both fry and gonad cells started out as mixed populations with a substantial percentage of
fibroblast-like cells, however as passages went on, cells became increasingly epithelial-like.
Infection of novel lake trout cell lines with pathogenic aquatic viruses VHSV, IPNV and EEDV
suggested the cells are capable of supporting viral replication. The lake trout is ecologically and
economically important in the Great Lakes basin, and the production of novel lake trout cell lines
will provide fish health professionals and natural resource managers with an additional
diagnostic and research tool.

2. Introduction
The lake trout (Salvelinus namaycush) is an extremely important native fish species in the
Laurentian Great Lakes Basin (GLB), and in fact, Lake Michigan once held the world’s largest
population of this species (13). This coldwater, apex predator is well adapted to life in the Great
Lakes, has a steadying effect on local ecosystems and is prized by the sports and commercial

149

fishing industries alike (6, 13). Tragically, fishery managers and enthusiasts have been
confronted with significant population threats and declining numbers over the past 60 years due
to a conglomerate of ecological and anthropogenic factors including invasive species invasion
(i.e., sea lamprey (Petromyzon marinus) and alewife (Alosa pseudoharengus)), habitat
destruction, over fishing, and emerging infectious diseases (7–13, 95). Rehabilitation programs
focused on the recovery of this important fish rely heavily on the use of captive breeding
programs, unfortunately, the intensive nature of salmonid aquaculture serves as a ripe location
for the eruption of infectious diseases (6, 13).
Lake trout, particularly in the Great Lakes, are susceptible to a number of viral diseases.
In the mid 2000s, Infectious Pancreatic Necrosis Virus (IPNV) was detected in the Allegheny
National Fish Hatchery in Warren, Pennsylvania, leading to the culling of all lake trout and
brook trout (Salvelinus fontinalis) on site (111). Lake trout are also especially sensitive to
infection with the Epizootic Epitheliotropic Disease Virus (EEDV), which led to the death or
culling of more than 15 million lake trout in the mid 1980s (2, 4, 5) and has recently re-emerged
as a pathogen of particular interest in the Great Lakes (Chapter 2). Lake trout are also
susceptible to the OIE reportable pathogen Viral Hemorrhagic Septicemia Virus (VHSV) which
has been detected throughout the Great Lakes basin and led to mortality events in multiple
species of fish (41, 138, 139).
One key aspect of aquatic animal health programs is the diagnosis, prevention and study
of viruses such as these, tasks that often utilize cell culture techniques and assays. Cell culture
has become ubiquitous in many fields of study, including toxicology, immunology and others
(96, 97), and tissue culture in vitro models often also serve as an acceptable alternative to whole
animal models in research study design (96). Unfortunately, while American Type Culture

150

Collection (ATCC) carries over 3,400 commercially available distinct cell lines, less than 20 of
those are derived from fish tissues, leaving many researchers and diagnosticians no choice but to
develop their own cell lines for particular projects. The development of primary cell cultures has
inherent difficulties as normal somatic cells are not immortal and will eventually trigger
senescence if not immortalized (96). Additionally, as primary cells are passaged and subcultured,
original characteristics may be altered over time, affecting their usefulness to virological,
pathological or toxicological studies (96). Attempts were made several decades ago following
the initial outbreak of EEDV, to produce a cell line of lake trout origin, unfortunately, the cell
cultures were not preserved (15). To date, there are no established cell lines originating from lake
trout tissues. However, primary cultures have been successfully created from rainbow trout gills
and head kidney for use in immunology and pharmacology studies (140, 141).
We hypothesized that cell cultures originating from lake trout tissues would demonstrate
an increased susceptibility to EEDV as compared to other established salmonid cell lines. In the
present study we describe the establishment and characterization of two novel cell lines from
lake trout tissues, which can be used in virology, toxicology or immunology studies to improve
the health and maintenance of this treasured species.

3. Materials and Methods
3.1. Fish and tissue collection
For this study, three different groups of lake trout were obtained for tissue collection and
production of primary cell cultures: 1) a single sexually mature fish (>12 years of age), which
had been spawned and housed its entire life at the University Research Containment Facility
(Michigan State University, East Lansing, Michigan); 2) yearling fish collected from the

151

Marquette State Fish Hatchery (MSFH, Marquette, Michigan); and 3) sac fry collected from the
Marquette State Fish Hatchery (MSFH, Marquette, Michigan).
The adult lake trout was removed from its holding tank, and euthanized with an overdose
of tricaine methansulfonate (MS-222; Argent Chemical Laboratories, Redmond, Washington;
0.25 mg/mL) prior to tissue collection. After dissection each tissue was placed in sterile cell
culture media (MEM-0) of Earle’s salt-based minimal essential medium (MEM; Invitrogen,
Carlsbad, California) and supplemented with 10% tryptose phosphate broth (BD Biosciences,
San Jose, California), 29.2 mg/mL L-glutamine (Invitrogen), penicillin (100 IU/mL)
(Invitrogen), streptomycin (0.1 mg/mL) (Invitrogen), amphotericin B (250 µg/mL; Invitrogen)
and sodium bicarbonate (7.5% w/v) (Sigma) for temporary holding and to prevent trying during
transport between facilities.
Blood was drawn directly from the ventricle following a cut down dissection of the heart
and diluted 1:2 with MEM-0 containing heparin at a minimum of 30 IU/mL blood. External
tissues (i.e., skin and fin) were briefly flame sterilized to remove external pathogens and then
dissected and placed into a solution of MEM-3x, which contained triple antibiotic/antifungal
(penicillin (300 IU/mL), streptomycin (0.3 mg/mL) amphotericin B (550 µg/mL)), for 30
minutes, after which time tissue were transferred to MEM-0 while remaining tissues were
collected. The opercular cavity was briefly dried with sterile gauze after which an entire gill arch
was dissected and placed in MEM-3x for 30 minutes and transferred to MEM-0 for transport.
Finally, portions of liver, testes, anterior kidney and posterior kidney were aseptically collected
and placed directly into MEM-0.
Tissues were collected similarly from yearling lake trout with the exclusion of blood. For
lake trout sac fry, fish were dissected in order to remove the yolk sac and the head (cranial to

152

opercular margin) with the remaining body processed as a singular tissue sample. Multiple
individual fry were processed together until an adequate amount of tissue was collected.

3.2. Isolation and in vitro culture of primary cells
Individual tissues collected from all three groups of fish were transferred to sterile petri
dishes where they were manually digested using scissors until they reached a size of
approximately 1-2 mm diameter. Next, enzymatic digestion was performed using 0.25%
Trypsin-EDTA (Gibco, Life Technologies, Carlsbad, California). Minced tissue was combined
with 10 mL trypsin in an Erlenmeyer flask and placed on a stir plate. After three minutes, the
initial trypsin was removed and replaced with a fresh 20 mL of trypsin. This solution was left to
stir for 20-60 minutes or until tissues visually determined to have reached complete digestion.
The tissue-trypsin suspension was then filtered through sterile gauze to remove any remaining
tissue pieces, after which, MEM-10 (10% fetal bovine serum; Hyclone Laboratories Inc.) was
added to the resulting filtrate at a ratio of 2:1 (medium/trypsin) in order to deactivate the trypsin.
The single cell suspension was then centrifuged at 190 x g for 5 minutes at 15°C. Following
centrifugation the supernatant was discarded and the cell pellet resuspended in 10 mL of MEM10. This rinsing step was repeated a total of three times. The final cell suspension was seeded
into 25cm2 cell culture flasks (Corning) and incubated at 15°C. This process was repeated for all
tissue types with the exception of the blood. Heparinized blood diluted with MEM-0 was
centrifuged at 4,700 x g for 10 minutes at 4°C. Next, the visible buffy coat plus one half mL red
cells were collected, mixed with sterile water 1:1, then washed with MEM-10 and seeded into
culture flasks as above.

153

3.3. Routine subculture
Primary cell flasks were monitored daily for evidence of attachment and replication.
Unattached cells and spent media were removed from the flask every 2-3 days, replaced (75%)
by fresh MEM-10 and unattached cells checked for viability using Trypan Blue (Sigma-Aldrich,
St. Louis, Missouri) exclusion staining. If greater than 20% viable cells were observed in stained
sample, remaining cell suspension was pelleted (centrifuged at 190 x g for 5 minutes),
resuspended in 10 mL of MEM-10, and seeded into a new culture vessel. If no viable cells were
detected either attached to the culture surface, or in suspension via exclusion staining, flasks
were discarded.
In flasks where primary cell growth occurred, once cultures reached >90% confluence, or
if replication rate slowed, they were subcultured per standard laboratory protocols. Growth
media was removed from the flask and cells rinsed briefly with 1 mL 0.25% trypsin-EDTA (<10
seconds). After first trypsin rinse was removed, 2 mL fresh trypsin was added to the flask and
very gently rocked until cells had released from flask, at which time MEM-10 growth media was
added at a ratio of 3:1 (medium/trypsin) in order to deactivate the trypsin. Cell suspension was
centrifuged at 190 x g for 5 minutes at 15°C after which the supernatant was removed, cell pellet
resuspended in MEM-10 and centrifuged a second time. Final cell suspension was reseeded into
culture flask with approximately 40-60% of original cells. Subculturing continued in the same
manner once flasks reached near 100% confluence with select cultures being cryopreserved in
liquid nitrogen (180 µL dimethyl sulfoxide (DMSO) per 1 mL cell suspension).

154

3.4. Optimization of culture conditions
3.4.1. Influence of temperature on cell growth
The effect of incubation temperature on cell growth was evaluated for the two most
promising cell lines: yearling gonad tissue (subculture 4) and fry tissue (subculture 11). Gonad
and fry cells were seeded into 12.5 cm2 culture flasks (CELLTREAT Scientific Products,
Pepperell, Massachusetts) at a density of 4x105 and 1.5x105 cells per flask respectively. Flasks
were incubated at 15, 21, and 25°C while all other culture conditions remained consistent as
described above. Flasks were monitored daily for a subjective assessment of percent confluence.
Every 2-5 days, cells were detached using trypsin, from n = 2 flasks per day, and counted using a
hemacytometer in order to assess relative cell growth and density (cells per cm2).

3.4.2. Influence of serum type and concentration on cell growth
The effect of serum supplementation type and concentration on cell growth was also
evaluated for the same two cell cultures, seeded as with the temperature trial. In this experiment,
all flasks were incubated at 15°C but contained growth medium supplemented with either 10%
fetal bovine serum (FBS), 15% FBS, or 15% FBS plus 1% heat inactivated lake trout serum. All
other culture conditions remained identical. Lake trout serum was collected from mature lake
trout such as was used to produce primary cultures and heat inactivated at 56°C for 30 minutes.
Flasks were monitored and assessed as described above.

3.4.3. Influence of growth medium base on cell growth
The effect of two different growth medium bases was evaluated for the yearling gonad
and fry cell cultures as well. All cells were seeded as above in growth medium containing 15%

155

FBS and incubated at 15°C. Growth medium was produced using either Earle’s salt-based
minimal essential medium as described above, or Leibovitz’s L-15 medium. All other culture
conditions remained identical. Cells were monitored and counted as above.

3.5. Confirmation of species of origin
In order to establish that these novel cell lines were indeed of lake trout origin, a DNA
barcoding technique was employed to amplify and sequence the cytochrome c oxidase 1 (CO1)
gene (142, 143). An early and late passage cell sample from both the fry and yearling gonad cell
lines were used, with lake trout skin tissue serving as a positive control and Epitheliosum
papulosum cyprini (EPC; ATCC) cells as a negative control. DNA extractions were performed
using the Mag Bind® Blood and Tissue DNA Kit (OMEGA Bio-tek, Inc, Norcross, Georgia,
USA), following the manufacturer’s instructions for extractions from cell cultures. All PCR
reactions were carried out in a Mastercycler Gradient thermocycler (Eppendorf, Hamburg,
Germany). The COI-3 primer cocktail designed by Ivanova et al. (2007) (142) was used to
amplify a 631 bp fragment of the COI gene. Each 25 µL reaction mixture was comprised of 12.5
µL 2x Go-Taq Green Master Mix (Promega, Madison, Wisconsin, USA), 0.8 µM of each primer,
and 4.5 µL DNA template. Cycling parameters were as described by Ivanova et al. (2007) (142)
for the COI-3 primer cocktail. Amplicons and a 1 kb Plus molecular ladder (Roche Applied
Science, Penzberg, Germany) were, electrophoresed through a 2% agarose gel with SYBR Safe
DNA Gel Stain (Thermo Fisher Scientific) at 100V for 30 minutes, and visualized under
ultraviolet light.
Amplicons were prepared for sequencing using ExoSAP-IT (Thermo Fisher Scientific). 1
µL of each PCR product was combined with 3 µL 1x MgCl2 Buffer and 0.25 µL ExoSAP-IT

156

reagent. The ExoSAP-IT mixture was placed in the thermocycler with a program of 37°C for 20
minutes followed by 95°C for 10 minutes. After clean up, amplicons were Sanger sequenced at
the Michigan State University Research Technology Support Facility using M13 forward and
reverse primers (142). Sequences and chromatograms provided by the Michigan State University
Research Technology Support Facility were visually examined using 4Peaks software
(http://nucleobytes.com/4peaks/; Version 1.8) and contigs were assembled and aligned using
ClustalW in the Molecular Evolutionary Genetics Analysis software (MEGA; version 6.0) (119).
Resulting contigs were then entered into the Barcode of Life Data System (BOLD) (144) search
function where each sequence was compared against the ID System to identify nearest neighbors
using a global alignment of more than 3,000,000 barcode sequences from 180,000 animal
species.

3.6. Viral susceptibility
The susceptibility of our newly established lake trout cells to three different aquatic
viruses was evaluated. Flasks of fry cell cultures were exposed to isolates of viral hemorrhagic
septicemia virus (VHSV), and infectious pancreatic necrosis virus (IPNV), while both fry and
gonad cells were inoculated with EEDV. Viral stocks of VHSV and IPNV were inoculated into
25cm2 flasks of fry cells at and incubated at 15°C. After inoculation, cells were monitored via
light microscopy for development of cytopathic effect (CPE) at 48 and 72 hours post infection.
As a current in vitro model of replication does not exist for EEDV, our lake trout cells
were exposed to virus-positive tissue homogenate supernatant (first passage on cells), followed
by a second passage on cells of either first pass supernatant or first pass cells. As optimal

157

incubation temperature for EEDV in vitro is unknown, infected cells were incubated at a range of
temperatures (i.e., 4, 9, and 15°C).

3.6.1. Quantification of viral DNA
A TaqMan quantitative PCR (qPCR) described by Glenney et al. (2016) (14) was used to
compare viral titers in tissue samples to those in cells and supernatant following inoculation of
lake trout cells. In this manner, a relative increase in viral loads would suggest replication by
active virus rather than merely the presence of viral genetic material. For DNA extractions, the
MagMaxTM 96 Viral RNA isolation kit (Life Technologies, Grand Island, New York, USA) was
used manually, following manufacturer’s instructions, after which, extracted DNA was
quantified using a Quant-iT DS DNA Assay Kit and a Qubit fluorometer (Life Technologies,
Grand Island, New York, USA). All qPCR reactions were carried out in a Mastercycler ep
realplex2 S real-time PCR machine (Eppendorf, Hauppauge, New York, USA) with qPCR
protocols as previously described (14).

4. Results
4.1. Primary culture and routine subculture
Out of the eight tissues collected from the lake trout broodstock, within two days of
seeding, attached cells were observed from the gills (few, <1% confluence), and the liver
(moderate number, ~5% confluence). No attached cells were observed in the skin, testes, anterior
kidney, posterior kidney, fin or blood cultures and flasks were discarded on Day 5 post-seeding.
The flasks of gill cells improved to contain a few small clusters of attached cells on Day 3,
however by Day 5, almost all of these had detached and on Day 8 the flasks were discarded. The

158

number of attached liver cells decreased between days 3 and 5, at which time a media change
was performed. By the following day, small clusters of cells had begun to develop (Figure 6.1a).
The number and size of these small clusters increased through Day 10, however by Day 15 the
cells were beginning to detach, and the flask was subcultured. Following subculture, the flask
was monitored, with media changes performed once weekly until the flask reached 50%
confluence around Day 85 at which time a second subculture was performed. A total of 9
subcultures were performed before cell growth began to significantly decrease, with the flask
reaching 100% confluence (Figure 6.1b) within an average of 3-4 weeks from subcultures 3-8.
Of the tissues collected from yearling lake trout, no cell attachment or growth was
observed from either the anterior or posterior kidney. Occasional attached cells were observed
over the first few days following seeding of the skin, gill and liver tissues, however only a single
liver flask produced replicating cells, and these ceased to grow following the second subculture.
Fin cells proceeded to grow (Figure 6.2) and reached 90% confluence by Day 20, were
successfully subcultured and again reached 100% confluence in a second 20 days, however
following the second subculture, no growth was recovered. Yearling gonad cells on the other
hand had a moderate number of attached cells and a few small clusters by Day 2 after primary
seeding (Figure 6.3a) with large areas of up to 50% confluence by Day 3 (Figure 6.3b).
Subculturing occurred as early as two weeks after primary seeding with subsequent passages
occurring approximately every month for the first five months and every 1-2 weeks after that
(Figure 6.3c). To date, gonad cells have reached 35 subcultures and continue to grow (Figure
6.3d).
Primary cultures established from fry tissues (Figure 6.4a) reached 50% confluence
within the first 3 days after seeding (albeit with patchy growth), and 75-100% confluence by Day

159

14 (Figure 6.4b) at which time they were subcultured. The next 3 subcultures occurred 3-4 weeks
apart (flasks reaching 75-80% confluence), and after the 4th subculture the flasks were reaching
100% confluence within 2 weeks (Figure 6.4c). In later passages (e.g., >20), the fry cells could
be subcultured weekly. Fry cells have been successfully cultured out to 52 subcultures (Figure
6.4d).

4.2. Optimization of culture conditions
4.2.1. Influence of temperature on cell growth
Both fry and gonad cells grew extremely poorly at 25°C (Figure 6.5, light grey lines).
While some level of growth was achieved in both cell types at 21 and 15°C the trend was for best
growth at the coldest temperature (although statistical strength is low due to the size). In fact, in
the fry, both the percent confluence as well as the number of cells per cm2 was higher at all time
points beyond 3 days post seeding. As such, all further growth of lake trout cells was performed
at 15°C.

4.2.2. Influence of serum type and concentration on cell growth
When comparing the three different serum supplement concentrations, it was clear that a
15% FBS concentration was preferred over 10% FBS (Figure 6.6). When grown in media
containing only 10% FBS, fry cells only reached a final percent confluence level of just under
30%, while the other two trials resulted in more than 80% confluence by the end of two weeks. A
similar although less defined trend was observed in the gonad cells. The addition of the lake trout
serum did not appear to have a positive affect on cell growth and in fact, for both the fry cells
and the gonad cells, the ultimate percent confluence was approximately 20% lower in the flasks

160

receiving media with the lake trout serum. As such, 15% FBS was used in all future medium
preparations.

4.2.3. Influence of growth medium base on cell growth
A comparison of the two main growth medium bases (i.e., MEM vs. L-15) showed mixed
results. While 100% confluence was achieved in the fry cells with both media types (Figure
6.7a), relatively poor growth was observed in the gonad cells grown in MEM (Figure 6.7b),
which was uncharacteristic compared to all previous gonad cell growth. In spite of the
inconsistencies in this single trial, all cells continued to be grown in MEM rather than changing
to L-15.

4.3. Morphologic characteristics
Primary cultures of the gonad cells (Figure 6.3a, 6.3b) displayed fibroblast-like
morphologic characteristics. Cells appeared to be bipolar with a length > 2x cell width. However,
by the 6th subculture, a more mixed population of fibroblast-like and epithelioid cell were
observed, with the epithelial-like cells appearing more polygonal and in discrete patches between
the other cells. This trend toward an epithelial-like cell morphology continued through the later
subcultures as pictured in Figure 6.3d.
Morphologically, the fry cells appeared to be a mixture of fibroblast-like and epitheliallike cells in the primary cultures (Figure 6.4a, 6.4b). However, through passages, they became
consistently more epithelioid with regular dimensions growing in discrete patches.

161

4.4. Confirmation of species of origin
Origin of both fry and gonad cell cultures was verified through DNA barcoding.
Resulting barcode sequences for fry cells (early and late subcultures), gonad cells (early and late
subcultures), lake trout skin and EPC cells were entered into the BOLD ID System. This analysis
returned a 100% probability that all four lake trout cell cultures and the lake trout skin tissue
were in fact lake trout (Salvelinus namaycush) while the EPC cells were confirmed to be of
fathead minnow (Pimephales promelas) origin.

4.5. Virus susceptibility
Clear changes were observed in the fry cells infected with both VHSV and IPNV within
48 hours post infection (Figure 6.8). Fry cells began to round, shrink and release from the
growing surface, disrupting the monolayer. This lysis and rounding of cells is comparable with
the typical CPE seen in EPC cells infected with VHSV.
Both gonad and fry cells were infected with various samples known to be EEDVpositive. While cytological changes were observed following initial inoculation, including cell
rounding (Figure 6.9a, 6.9b), piling of cells, vacuolation (Figure 6.9c), and mild areas of cell
lysis (Figure 6.9b, 6.9d), upon subsequent passages such changes were no longer observed. In
order to account for the potential necessity of cell to cell contact for in vitro infection as is seen
with Marek’s Disease Virus (145) EEDV infectivity trials were completed using both
supernatant and cell suspensions for second passages. However, while mild cytotoxicity was
observed from the previous cells being introduced onto new cultures, no overt CPE was
observed. Cellular changes were more severe when infected flasks incubated at 9°C than at 4°C
or 15°C.

162

The viral loads from four separate infectivity trials with fry cells are highlighted in Figure
6.10. This data highlights how the viral load detected from fry cells or supernatant following
infection with EEDV tissue homogenate is consistently substantially lower than in the original
samples. The exception was in the fourth group where it appeared there might in fact be some
viral replication (evidenced by an increase in viral load from sample to P1 supernatant), however
upon passage to a P2 using both supernatant and cells, once again viral titers decreased
substantially.

5. Discussion
Cell lines originating from aquatic species are important for a variety of scientific fields,
but unfortunately, the number of well established fish cell lines is substantially lacking compared
to that of mammals. In this study, we established primary cultures of multiple different lake trout
tissues, and subcultured, expanded and characterized two: one from yearling gonads and one
from fry. As demonstrated by Hedrick et al. (1991), there are times when situations require the
availability of host species specific cell lines, such as was the case when in the 1980s significant
mortalities were seen in juvenile white sturgeon (Acipenser transmontanus) caused by what was
later determined to be three separate viruses (an adenovirus, an iridovirus, and a herpesvirus), but
at the time were unculturable in the only two established sturgeon cell lines, originating from
different species (98).
The methods described herein resulted in the creation of primary cell cultures from all
three age groups of lake trout tested: liver from the broodstock, fin and gonads from the yearling
fish and whole sac fry. While neither the yearling fin nor the adult liver cells survived beyond 10
subcultures, the establishment of primary cultures from both of these tissues indicates that they

163

remain potential options for future studies utilizing primary cultures rather than established cell
lines. Both yearling gonad and fry cells on the other hand readily established monolayers and
produced stable subcultures. These cells were subcultured with relative ease, suggesting that they
will be suitable for use in standard laboratory assays.
We determined that both gonad and fry cells were well adapted for growth in either
MEM or L-15 growth media, supplemented with 15% fetal bovine serum and incubated at 15°C.
These conditions are comparable to those required by other salmonid cell lines (97), however
differ slightly from those used in previous attempts at producing lake trout cell cultures which
grew best at a higher temperature (18-21°C) (15).
Morphologically, in early passages, all cultures contained mixed populations of cells,
both epithelial- and fibroblast-like. This was particularly clear in the fry cells, which was not
surprising as these cells originated from whole body tissues as opposed to a single organ.
However, as passage number increased, proportions of fibroblast-like and epithelioid cells
changed with both cell types becoming more epithelial-like. In many individual flasks, it became
clear that with mixed cell populations, the fibroblast-like cells were out competing the epithelioid
cells, however through regular subculturing and splitting of flasks, certain cultures of epitheliallike fry cells were able to prevail.
A crucial component of cell line characterization is definitive identification of species
origin. Historically, methods such as karyotyping, and isoenzyme analysis have been popular
(146), however recent advancements in molecular diagnostics have helped cement a new
protocol for cell line species identification, DNA Barcoding, which has been used successfully to
determine the species of origin of a wide range of cell lines from all animal kingdoms (143). By
sequencing a stretch of the cytochrome c oxidase 1 (COI) gene in early and late passages from

164

both the fry and gonad cell lines, and comparing the sequence to the BOLD database, we
established that these cells were indeed of lake trout origin.
Following inoculation of fry cells with VHSV and IPNV we demonstrated the
development of cytopathic effect (CPE) including rounding and lysis of cells (Figure 8). This is
crucial, as it suggesting the susceptibility of lake trout cells to two key lake trout pathogens in the
Great Lakes Basin. If further investigation reveals that these cultures are truly capable of
becoming infected with VHSV and IPNV, the have the potential to serve as a diagnostic tool in
the detection and identification of these important aquatic pathogens. Inoculation of both fry and
gonad cells with EEDV resulted in the development of mild, inconsistent CPE that included
some lysis and rounding of cells, as well as vacuolation of cells exposed to the virus, indicating a
decreased health of the cells. However, qPCR data indicates a substantial difference in viral titers
in tissue samples compared to that recovered from cell cultures. With the exception of one
inoculation on fry cells (trial number 4 in Figure 6.10), the identification of EEDV in these cell
cultures is consistent with the detection of genetic material rather than active and replicating
virus. While these results with EEDV are inconclusive, and do no fully support our hypothesis,
we have demonstrated the ability to produce lake trout cell cultures and further attempts can be
made with additional cell types and culture conditions to improve changes at supporting EEDV
replication in vitro.
The lake trout is a commercially, recreationally and ecologically important fish species
throughout the Great Lakes Basin (GLB). Unfortunately, lake trout populations in the
Midwestern United Stated have faced continued threats due to invasive species, overfishing and
infectious diseases throughout the past half century (6, 13). In order to combat these threats to
species rehabilitation, we have established two novel cell lines of lake trout origin that have the

165

potential to be used in future diagnostic assays and research studies on viral diseases of lake trout
as well as other fields such as genetics, toxicology and medicine.

166

APPENDIX

167

Figure 6.1 Liver cells cultured from an adult lake trout (Salvelinus namaycush). A) primary
culture, 6 days after seeding; B) 6th subculture, confluent.

168

Figure 6.2 Fin cells cultured from yearling
lake trout (Salvelinus namaycush), primary
culture.

169

Figure 6.3 Gonad cells cultured from yearling lake trout (Salvelinus namaycush). A) primary
culture, 3 days after seeding; B) primary culture, 5 days after seeding, ready for subculture; C)
6th subculture; D) 32nd subculture.

170

Figure 6.4 Cell cultures established from body tissue of lake trout (Salvelinus namaycush) sac
fry. A) primary culture, 2 days after seeding; B) primary culture, ready for subculture; C) 14th
subculture; D) 47th subculture.

171

Figure 6.5 Influence of incubation temperature on growth of novel lake trout cell
cultures. A) fry cells; B) gonad cells. Solid lines indicate cell density (cells per cm2);
segmented lines indicate subjective percent confluence. 2 flasks examined for
confluence and cell density per sampling day.

172

Figure 6.6 Influence of serum supplement concentration and type on growth of novel
lake trout cell cultures. A) fry cells; B) gonad cells. Solid lines indicate cell density
(cells per cm2); segmented lines indicate subjective percent confluence. 2 flasks
examined for confluence and cell density per sampling day.

173

Figure 6.7 Influence of growth medium base on growth of novel lake trout cell cultures.
A) fry cells; B) gonad cells. Solid lines indicate cell density (cells per cm2); segmented
lines indicate subjective percent confluence. 2 flasks examined for confluence and cell
density per sampling day.
174

Figure 6.8 Cell cultures infected with VHSV or IPNV. A) EPC negative
control; B) EPC cells infected with VHSV, displaying typical CPE; C) fry
cell negative control; D) fry cells infected with VHSV, cell lysis; E) fry
cell negative control; F) fry cells infected with IPNV, cell lysis.

175

Figure 6.9 Lake trout cells inoculated with EEDV. A) fry cells (47th subculture), cell rounding;
B) fry cells (47th subculture), cell rounding, some lysis; C) gonad cells (32nd subculture),
vacuolation, some rounding; D) gonad cells (32nd subculture), vacuolation, early lysis.

176

Figure 6.10 Relative viral loads following inoculation of lake trout fry cells with
EEDV positive tissue sample homogenate; represented as number of viral copies per
qPCR reaction. P1 = 1st pass infection, P2 = 2nd pass infection, Cells = cell pellet tested
for presence of EEDV, Sup = flask supernatant tested for presence of EEDV. Number
in parentheses indicates temperature of incubation. Numbers at bottom indicate separate
infection trials, but have no sequential significance.

177

Chapter 7

Development of a loop-mediated isothermal amplification (LAMP) assay for the detection
and quantification of Epizootic Epitheliotropic Disease Virus (Salmonid Herpesvirus-3) in
lake trout (Salvelinus namaycush)

178

1. Abstract
Epizootic Epitheliotropic Disease Virus (EEDV; Salmonid Herpesvirus-3) causes a
serious disease of lake trout (Salvelinus namaycush) that threatens the restoration efforts of this
species in North America. The current inability to replicate EEDV in vitro necessitates the search
for a reproducible, sensitive, and specific diagnostic assay that allows for accurate diagnosis that
is both time and cost effective. Herein, we describe a loop-mediated isothermal amplification
(LAMP) assay that we developed for the rapid and quantifiable detection of EEDV in infected
fish tissues. The newly developed LAMP reaction was optimized in the presence of calcein, and
the best results were produced using 2 mM MgCl2, 1.8 mM dNTPs and an incubation
temperature of 67.1ºC. The analytical sensitivity of the LAMP method was estimated to be as
low as 7.8 pg extracted DNA from lake trout tissues. The diagnostic sensitivity and specificity of
the newly developed LAMP assay compared to the SYBR Green qPCR assay were 84.3% and
93.3%, respectively. The quantitative LAMP for EEDV had a high correlation coefficient (R2 =
0.990), and when compared to the SYBR Green quantitative PCR for validation, no statistical
difference found between the two assays (p > 0.05). Thus, it is anticipated that the developed
LAMP and quantitative LAMP methods will be instrumental in the future reliable diagnosis of
EEDV.

2. Introduction
Viruses in the Alloherpesviridae family (Order Herpesvirales) cause a variety of diseases
in amphibians and teleost fish, often with severe economic consequences (45, 147). Within the
Alloherpesviridae is the genus Salmonivirus, which currently contains five viruses: the Salmonid
Herpesvirus-1 (Herpesvirus salmonis), Salmonid Herpesvirus-2 (Oncorhynchus masou virus),

179

Salmonid Herpesvirus-3 (Epizootic Epitheliotropic Disease Virus; EEDV), Salmonid
Herpesvirus-4 (Atlantic salmon papillomatosis virus), and Salmonid Herpesvirus-5 (Namaycush
herpesvirus) (90, 94, 148).
Among the five salmonid herpesviruses, EEDV causes one of the more lethal diseases in
its host, leading, for example, to the morality of over 15 million hatchery-reared juvenile lake
trout in the early 1980s (2–4). Recently, after 30 years of minimal mortalities associated with
EEDV, the virus reappeared in Wisconsin and Michigan hatcheries, resulting in morbidity and
mortality in hundreds of thousands of lake trout (5) (Chapter 2). In the absence of other available
control measures to combat this virus, the implementation of stringent biosecurity measures and
use of avoidance strategies remain our only tools to prevent EEDV spread to additional lake trout
rearing units or facilities should another outbreak occur. A sensitive and specific diagnostic tool
that is rapid and reasonably inexpensive is needed in order to perform testing of wild gamete
donor fish as well as periodic testing of hatchery-reared fish throughout their growth. Early
detection of EEDV prior to the start of a mortality episode, would allow for more rapid disease
control and perhaps prevention of such devastating losses as previously seen.
Endpoint and quantitative PCR-based detection assays for EEDV have been developed
that target stretches of the EEDV terminase gene (5, 14). After the molecular characterization of
Salmonid Herpesvirus-4 and -5, it was determined however, that the current EEDV qPCR assay
was unable to distinguish between Salmonid Herpesvirus-3, -4, and -5, as the viruses share high
sequence identity in the terminase gene. This led Glenney et al. (2016) (14) to design three
primer sets based on the glycoprotein gene; and using a SYBR Green qPCR assay, was able to
amplify each virus individually. Herein, we report on the development of a loop-mediated
isothermal amplification (LAMP) assay for the detection and quantification of EEDV in infected

180

lake trout tissues, which we hypothesized would be faster, more cost effective and yet equally as
specific and sensitive as previously established assays.

3. Materials and Methods
3.1. Virus and template DNA
Tissues used in this study for the development and testing of the EEDV LAMP assay
were obtained from juvenile naïve lake trout experimentally infected with EEDV-positive tissue
homogenate by either intraperitoneal injection or immersion bath (Chapter 3).
For the purpose of this study, tissues of selected fish were collected, and enzymatically
digested with Proteinase K. Viral DNA extractions were performed manually using the Mag
Bind® Blood and Tissue DNA Kit (OMEGA Bio-tek, Inc, Norcross, Georgia, USA), following
the manufacturer’s instructions and with the addition of a filtering step using the E-Z 96® Lysate
Clearance Plate (OMEGA Bio-tek, Inc, Norcross, Georgia, USA) after tissue digestion (24).
Following all nucleic acid extractions, DNA was quantified using a Quant-iT DS DNA Assay
Kit and a Qubit fluorometer (Life Technologies, Grand Island, New York, USA) and diluted to a
standard concentration using nuclease free water.

3.2. Primers and LAMP design
A partial sequence of the Salmonid Herpesvirus-3 glycoptorein gene (GenBank accession
number JX886027.1) was used as a template to design the EEDV LAMP primer set with the
Primer Explorer software, version 4.0 (http://primerexplorer.jp/elamp4.0.0/index.html). The
details of the primers are displayed in Table 7.1. Following alignment of the EEDV primer target
sequences on the glycoprotein gene with the same segment of Salmonid Herpesvirus-4

181

(GenBank accession number JX886028) and Salmonid Herpesvirus-5 (GenBank accession
number KP686091), the in silico analysis guided the selection of primer sets that are strictly
specific to Salmonid Herepesvirus-3 and hence used in this study.
The LAMP reaction was carried out in a 25 µL reaction mixture containing 1.6 µM of
each of the forward inner primer (FIP) and backward inner primer (BIP); 0.8 µM of each of the
LF and LB primers; 0.2 µM of each of the F3 and B3 primers; 1X isothermal amplification
buffer (20 mM Tris-HCl, 10 mM (NH4)2SO4, 50 mM KCl, 2 mM MgSO4, 0.1% Tween 20, pH
8.8); 2 mM MgCl2; 1 M betaine; 1.6 mM deoxynucleoside triphosphates (dNTPs); 0.2 mM
MnCl2; 20 µM calcein; 8 U Bst DNA polymerase (New England Biolabs, Beverly,
Massachusetts, USA) and 1 µL template DNA. Calcein was used as a fluorescent indicator which
yields strong fluorescence by forming complexes with divalent magnesium ions in LAMP
reactions as reported by Tomita et al. (2008) (149).
The mixture was incubated for 50 minutes (one cycle per minute) in an Eppendorf
mastercycler real/plex ep gradient S PCR machine (Eppendorf, Hauppauge, New York). Changes
in fluorescence were monitored every min at 520 nm. Three separate assay factors were
optimized: 1) temperature, assay run at 58.3, 60.3, 62.6, 64.9, 67.1, 69.1, and 70.7ºC, (each
followed by 80°C for 20 min to terminate the reaction); 2) MgCl2 concentration; and 3) dNTP
concentration. MgCl2 and dNTP concentrations were optimized by Taguchi’s L16 (2(4))
orthogonal design with two elements (dNTPs and MgCl2) at four concentration levels (Table
7.2).

182

3.3. Analytical specificity of the EEDV LAMP assay
The specificity of the LAMP primer set was tested by performing the assay under the
optimized conditions as described above. Nucleic acids were extracted from a number of DNA
and RNA fish pathogenic viruses such as Salmonid Herpesvirus-1, -2, -4, and -5, Infectious
Pancreatic Necrosis Virus (IPNV), Spring Viremia of Carp Virus (SVCV), Infectious
Hematopoietic Necrosis Virus (IHNV), Golden Shiner Reovirus (GSRV), Fathead Minnow
Nidovirus, and Viral Hemorrhagic Septicemia Virus (VHSV) and used as templates in this
analysis. Additionally, the 212 bp target sequences of glycoprotein gene of Salmonid
Herpesvirus-3, -4, and -5 were aligned and compared using BLAST and the software BioEdit
7.0.

3.4. Analytical sensitivity of the EEDV LAMP assay
The detection limit of the EEDV LAMP assay was analyzed with two kinds of templates.
One template was a plasmid vector (pCR®2.1-TOPO®) containing the target fragment from the
EEDV glycoprotein gene (designated as pCR®2.1-EEDV). A 10-fold serial dilution of plasmid
pCR®2.1-EEDV (1.6x107–101 copies) was used as the template for the LAMP under the
predetermined conditions. The other template was gill tissue DNA extracted from infected lake
trout and serially diluted (7.8x106–100 pg).

3.5. Quantitative EEDV LAMP assay
A quantitative LAMP assay was produced by using ten-fold dilutions of purified PCR
product as standards. The end-point PCR assay for production of quantification standards
consisted of a 50 µL reaction containing 25 µL GoTaq Green Mastermix, 0.25 µM each of F3

183

and B3 primers and 80 ng DNA template. The PCR reaction was 95ºC for 2 minutes followed by
40 cycles of 95ºC for 15 seconds, 50ºC for 15 seconds and 72ºC for 45 seconds and finished with
a single cycle of 95ºC for 15 minutes. PCR product was purified using the Wizard SV Gel and
PCR Clean-Up System (Promega) and copy number in each 10-fold dilution was calculated as
described above for the plasmid.
For real-time monitoring, the qLAMP reactions were incubated at 67.1ºC for 50 cycles
(one minute per cycle) with an Eppendorf realplex 2 (Eppendorf). For quantitative detection of
samples, a standard curve was generated for EEDV qLAMP by plotting a graph between
different concentrations of standards ranging from 101 to 107 copies to cycle threshold (Ct) value
through real-time monitoring of the amplification.

3.6. Evaluation of the EEDV LAMP assay on samples
In order to validate the quantitative abilities of the EEDV LAMP assay, a group of 100
previously tested lake trout tissue samples with known viral load ranges (i.e., negative, low,
medium, or high titers) were chosen in order to test a comprehensive range of virus loads in
tissue. All samples came from experimentally infected or control group fish (Chapter 3). DNA
was extracted from these tissue samples using the BioOregon kit described above after which the
qLAMP was run in parallel with the SYBR Green qPCR assay as described by Glenney et al.
(2016) (14). Resulting copy numbers from qLAMP and qPCR were analyzed using a paired t test
run in SAS software, Version 9.4 of the SAS System (© 2017 SAS Institute Inc.).
The diagnostic sensitivity (DSe) and specificity (DSp), as defined by the World
Organization for Animal Health (2011), of the qLAMP compared to the qPCR were calculated
according to Zhang et al. (2013) (42, 150).

184

4. Results
4.1. Optimization of the EEDV LAMP reaction
In order to determine the optimal reaction conditions, the LAMP assay was carried out
for 50 minutes at 7 temperatures. As displayed in Table 7.2, the smallest average Ct value
(17.35) was achieved when the reaction was incubated at 67.1ºC and resulted in a relatively
small standard error of Ct value (0.45) compared to other incubation temperatures.
Concerning the optimization of MgCl2 and dNTPs, the results indicated that the smallest
average Ct value (17.19) was produced when the concentrations of MgCl2 and dNTPs were 2.0
mM and 1.8 mM, respectively (Table 7.3). The smallest average Ct value was accompanied by a
standard error of 0.34, indicating negligible fluctuation of amplification efficiency. Meanwhile,
the second smallest Ct value (17.66) resulted in a higher standard error of 1.05, and was
produced when the concentration of MgCl2 and dNTP were 2.0 mM and 1.6 mM, respectively.
Therefore, the optimal concentrations of MgCl2 and dNTP were determined to be 2.0 mM and
1.8 mM, respectively. Based on these results, further LAMP assays were incubated for a total of
50 min at 67.1 ºC with 2 mM MgCl2 and 1.8 mM dNTPs.

4.2. Analytical specificity of the EEDV LAMP assay
Alignment of the EEDV LAMP target sequence (212 bp) with the corresponding
sequences from the closely related Salmonid Herpesvirus-4 and -5 indicated that the eight EEDV
LAMP primers covered 35 or more mutation sites in the corresponding sequences of the other
two Salmonid Herpesviruses (Figure 7.1). Positive results were obtained only when the template
used contained the DNA from EEDV-infected fish tissue; no amplification was observed for the
DNA or RNA extracted from stocks of Salmonid Herpesviruses-1, -2, -5, or -5, IPNV, SVCV,

185

IHNV, GSRV, Nidovirus or VHSV samples (Figure 7.2). Taken together, these results indicate
that the LAMP primer set is specific for amplification of EEDV nucleic acid.

4.3. Analytical sensitivity of the EEDV LAMP assay
When the reaction was tested using 1 µL of 10-fold serial dilutions of plasmid pCR®2.1EEDV DNA (7.2 ng/µL, equivalent to 1.6x109 copies/µL), the analytical sensitivity of the
EEDV-LAMP method was estimated to be as low as 16 copies of the plasmid per reaction while
becoming more sporadic below 16 copies per reaction (Figure 7.3). When the reactions were
tested using 1 µL of 10-fold serial dilutions of EEDV positive DNA from lake trout, the
analytical sensitivities of the LAMP method were determined as 78 pg of DNA extracted from
gill tissues (Figure 7.4).

4.4. Quantitative EEDV LAMP and validation against SYBR Green qPCR
DNA from 100 tissue samples collected from experimentally challenged lake trout were
used to compare the newly developed qLAMP assay with the SYBR Green qPCR currently in
use (14). A high correlation coefficient (r2 = 0.990) was obtained by the EEDV qLAMP when
the initial template was above 1000 copies (Figure 7.3). Quantification of viral copies in the
experimental samples was extrapolated based on the Ct value of DNA samples using the
generated standard curve. Positive qPCR samples ranged from 10.0 to 1.69x108 copies per
reaction while positive qLAMP samples ranged from 4.18 to 6.89x107 copies per reaction (Table
7.4). Statistical analysis comparing the paired samples using a paired t test run in SAS software,
Version 9.4 of the SAS System (© 2017 SAS Institute Inc.) revealed no significant difference
between the quantifications recovered via the two assays (p > 0.05).

186

The qPCR results indicated that 70/100 samples were positive for EEDV. The qLAMP
agreed that 59 of those qPCR positives were positive again. Meanwhile, of the 30 qPCR negative
samples, the qLAMP agreed that 28 of those were negative again. Therefore, the DSe and DSp
values for the qLAMP method compared to the SYBR Green qPCR method were 84.3% and
93.3% respectively.

5. Discussion
In light of the current absence of a cell line that can support the replication of EEDV,
diagnostic tools are limited to endpoint PCR (5), real-time PCR (14), or electron microscopy (3).
In the current study, we developed a time and cost effective LAMP assay for EEDV detection.
This method amplifies EEDV DNA in fish tissue with high specificity and sensitivity, and
therefore, represents a valuable diagnostic tool for the detection and quantification of this deadly
virus.
The optimal reaction temperature was determined to be 67.1°C which is relatively higher
than the optimal LAMP reaction temperatures reported for other viruses such as 62°C for the orf
virus (151), 63°C for human papillomavirus (152), and 64°C for nervous necrosis virus (153).
This anomaly could be explained due to the use of different primer sets for different viruses.
Actually, the results of the temperature optimization showed that Bst DNA polymerase
effectively amplified the nucleic acid templates at a relatively wide temperature range from 62.6
to 69.1ºC, which should greatly benefit the possible application of the method under field
conditions. The Ct value of samples tested using the EEDV LAMP assay showed substantial
variation when the concentration of MgCl2 changed from 2 mM to 6 mM, and also when the

187

concentration of dNTPs changed from 1.2 mM to 1.4 mM, both of which are indications that the
concentration of MgCl2 and dNTPs are critical parameters in the EEDV LAMP reaction.
Testing the analytical specificity of the EEDV LAMP clearly demonstrated that
amplification occurred only when DNA from EEDV was used as a template; no amplification
occurred with the other fish pathogenic DNA viruses including the other closely related
Salmonid Herpesviruses-4 and -5. The fact that the EEDV LAMP primers designed in this study
cover gene stretches with greater than 35 mutation sites compared to the corresponding sequence
stretch of Salmonid Herpesvirus-4 and -5, and did not cross react, attests to the high specificity
of this newly developed assay for detection of EEDV.
The analytical sensitivity of the EEDV LAMP assay was determined to be 7.8 pg total
DNA extracted from EEDV-positive lake trout gills, which is considerably higher than those
reported by Chen et al. (2010) (154) for the swine transmissible gastroenteritis coronavirus, Li
and Ling (2014) (155) for the tomato necrotic stunt virus, and Ma et al. (2016) (156) for the
Eriocheir sinensis reovirus.
A standard curve was constructed using serial 10-fold dilutions of the pCR®2.1-EEDV
plasmid with reference to Ct value. Based on the standard curve, an equation was calculated
using regression analysis comparing Ct value to the standard copy number. In the range of 107
to103 plasmid copies, the correlation coefficient was high (r2 = 0.990), which indicates that the
LAMP is appropriate as a quantification tool. However, when numbers of plasmid decrease to
less than 1000 copies, the correlation coefficient declines significantly (data not shown).
Previous reports also demonstrated that it is difficult to determine the exact correlation of virus
quantity and Ct value at very low concentrations of template (157, 158).

188

When the developed EEDV LAMP assay was compared to the real-time SYBR Green
qPCR (14), the diagnostic specificity was greater than 90%, however the diagnostic sensitivity
was only 84.3%. While the qPCR identified 11 samples as positive that the qLAMP did not, all
but two of them were less than 1,000 copies and as indicated above, accurate quantification
below this level can be difficult.
When the viral loads determined by qLAMP were compared to those of the SYBR Green
qPCR, both assays were capable of quantifying viral loads over a wide range (Table 7.4). While
there were some discrepancies with identification of individual positive tissues between the two
assays, when all samples were examined together, the paired t test demonstrated no significant
difference between the results of the two different assays (p > 0.05). In total, these quantification
results lend further support to the use of this qLAMP assay as a diagnostic tool, both in the
laboratory and in field conditions.
In summary, a specific, sensitive LAMP assay was developed for the detection of EEDV
in fish tissues, supporting our hypothesis. This novel assay has the advantage of being rapid and
is promising to be an ideal surveillance tool for identification of EEDV. Moreover, the qLAMP
established in this study provides a low-cost quantification method for EEDV loads in tissue
samples, and the use of calcein as a fluorescent indicator, which can also be visualized by the
naked eye, or under a UV light, provides a good platform for optimization of an assay that can be
used in field conditions, such as at a fish hatchery.

189

APPENDIX

190

Primer

Sequence

F3
B3
FIP
(F1c+TTTT+F2)
BIP
(B1c+TTTT+B2)
LF
LB

GGGGAGAGATCCCAGGTTC
CGTGCTCAAATGGTTCACTG
GCTCTCCGTGTCCCAACTGGTTTTTGAACGAGCGTCAACAGTG
ACTTGGAGAAAATCAAGCGCGCTTTTCCAGCTCCATGTCCATCGA
CCTCAAAGACGGTCTGGCAA
TTTCGAGGAATACAGGATCACCT

Table 7.1 Primers used for EEDV loop-mediated isothermal amplification.

191

Primer set III
Temperature
58.3
60.3
62.6
64.9
67.1
69.1
70.7

Mean* of
Ct value
27.07
24.13
18.99
18.41
17.35
18.22
24.40

SD* of
Ct value
0.28
0.01
0.01
0.09
0.45
1.22
1.15

Table 7.2 Results of EEDV LAMP
temperature optimization. Mean and
standard deviation produced from
duplicate repeats of LAMP assay.

192

MgCl2
dNTP
concentration concentration
2mM
2mM
2mM
2mM
4mM
4mM
4mM
4mM
6mM
6mM
6mM
6mM
8mM
8mM
8mM
8mM

1.2 mM
1.4 mM
1.6 mM
1.8 mM
1.2 mM
1.4 mM
1.6 mM
1.8 mM
1.2 mM
1.4 mM
1.6 mM
1.8 mM
1.2 mM
1.4 mM
1.6 mM
1.8 mM

Primer set
Mean* of Ct
value
21.39
18.50
17.66
17.19
36.93
32.52
28.24
27.03
47.51
45.02
40.63
-

SD* of Ct value
0.74
0.39
1.05
0.34
0.68
1.13
1.00
0.93
0.60
1.15
1.32
-

Table 7.3 Results of MgCl2 and dNTP concentration optimization for
EEDV LAMP. Mean and standard deviation produced from duplicate
repeats of LAMP assay.

193

F3

F2

B1c

F1c

LF

LB

B2

B3

Figure 7.1 Alignments of the EEDV (Salmonid Herpesvirus-3) target gene region
(GenBank JX886027) with the most related sequences of viruses available in GenBank
including Atlantic salmon papillomatosis virus (Salmonid Herpesvirus-4; JX886028) and
Namaycush herpesvirus (Salmonid Herpesvirus-5; KP686091). Notice that the eight EEDV
LAMP primers cover 35 or more mutation sites in the corresponding sequences of the other
two SalHV strains. F: forward primer, B: backward primer, LF: loop-forward primer, LB:
loop-backward primer.

194

Figure 7.2 Ability of the EEDV LAMP assay to discriminate EEDV from
other viruses (i.e., analytical specificity). The amplification plot of EEDV is
indicated by the arrow and appears as expected.

195

Figure 7.3 Analytical sensitivity shown in the standard curve generated from
the amplification plots of the quantitative LAMP (qLAMP) assay for known
concentrations of EEDV glycoprotein gene plasmid (pCR®2.1-EEDV
plasmid). Plasmid was serially diluted 10-fold from 1.6x107 to 1.6x101
copies/reaction over three replicates.

196

7.8 µg
780 ng
78 ng
7.8 ng
780 pg
78 pg
NC
7.8 pg

Figure 7.4 Analytical sensitivity or limits of detection of EEDV-positive lake trout
gill DNA by the diagnostic LAMP assay for EEDV. Amplification plots 1–7 (from
left to right): reaction conducted using 10-fold serial dilutions of DNA from lake
trout: 7.8x106, 7.8x105, 7.8x104, 7.8x103, 7.8x102, 7.8x101, and 7.8 pg, respectively.
Amplification plot 8 was the negative control (NC).

197

#
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34

qPCR
202
256
166
84.9
102
1.41x103

qLAMP
2.54x103
18.3
1.14x104

#
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68

qPCR
4

qLAMP
4

1.79x10
960
122
159
1.86x103
347
1.40x104
3.00x105
1.60x104
3.63x105
1.80x103
220
495
527
1.40x103
4.50x103
937
3.13x103
1.95x103
825
1.34x103
4.02x103
2.18x103
1.38x103
1.62x106

7.54x10
820
-

1.20x106
2.22x105
1.83x106
1.69x106
1.64x106
5.93x105
3.44x104

1.41x106
1.53x105
3.17x106
1.78x106
2.80x106
8.43x105
1.53x103

9.66x103
8.60x104
1.03x106
4.96x104
6.96x105
3.42x103
3.04x103
95.3
5.40x103
579
4.18
267
566
119
283
205
1.86x106

#
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100

qPCR
5

3.47x10
2.07x105
6.38x104
1.05x104
9.24x103
1.86x104
2.49x105
2.30x103
3.30x104
3.09x106
7.71x106
6.62x106
9.44x107
2.47x107
1.83x107
1.23x107
7.12x107
6.74x107
2.60x107
1.69x108
3.14x107
1.47x107
1.84x107
1.73x107
1.47x107
2.71x107
2.15x107
7.40x106
5.55x106
1.58x107
1.12x107
7.02x106

qLAMP
2.16x105
1.71x105
5.48x104
4.94x103
635
8.25x103
2.52x105
144
1.04x104
6.45x106
1.27x107
2.97x106
6.11x107
2.01x107
2.59x107
1.45x107
4.31x107
5.13x107
1.53x107
6.89x107
3.49x107
4.18x107
1.62x107
1.37x107
1.23x107
2.87x107
6.48x106
4.42x106
4.11x106
4.34x106
4.99x106
1.44x106

Table 7.4 Comparison of SYBR Green qPCR assay (14) results and newly developed qLAMP
assay results performed on 100 experimental samples of lake trout skin tissue. Data is
presented as viral copies per reaction (50 ng template DNA added to each reaction, qPCR and
qLAMP). There was no statistical difference between qPCR and qLAMP quantification (p >
0.05) using a paired t test run in SAS software, Version 9.4 of the SAS System (© 2017 SAS
Institute Inc.).

198

Chapter 8

Conclusions and future research

199

1. Conclusions
While Epizootic Epitheliotropic Disease Virus (EEDV; Salmonid Herpesvirus-3) was
first identified as a serious pathogen of lake trout (Salvelinus namaycush) more than 30 years ago
(3), and has been the causative agent in numerous mass mortality events in the Midwestern
United States throughout the time since (2, 5) (Chapter 2), there are many details of its
pathogenesis and biology that remain unknown. Further, much of what we do know about this
virus is either based on research from 30 years ago, or from retrospective case reports (3–5, 14).
Herein I have presented work that serves to satisfy some of these unanswered questions
as well as to set up a platform for future research. My work focused on understanding the
epidemiological factors influencing a natural epizootic, developing a standardized experimental
model, uncovering the sequential pathology and distribution of EEDV in its host from infection
to death, and finally improving research and diagnostic tools. Armed with additional knowledge
of virus-host interactions and with improved diagnostic assays, fish health professionals and
natural resource managers are better prepared to handle the next EEDV outbreak, to limit the
spread of this virus, and to prevent additional mortalities. The lake trout is an extremely
important natural resource in the Great Lakes basin, prized by the fishing industry as well as for
its intrinsic value as a native apex predator (6). Rehabilitation and management of this valuable
species remain threatened today due to the continued presence of EEDV within hatchery-reared
lake trout populations. Chapter 1 highlights not only what we currently know about EEDV, but
also where the knowledge gaps remain.
In order to begin the discussion as to how to prevent future outbreaks of EEDV, we must
first understand what led to the initiation and spread of past epizootics. In Chapter 2, I describe
the resurgence of EEDV in the State of Michigan as is highlighted by two mortality events in

200

2012 and 2017. The 2012 mortality event, the first of its kind since the early 1980s occurred in
juvenile, fingerling lake trout of both the Lake Superior and Seneca Lake strains. Cumulative
mortalities reached approximately 20% in all affected raceways, with the Lake Superior strain
fish being affected sooner and to a more severe degree than the Seneca Lake strain. The disease
appeared to be limited to only that age group and species, as none of the other fish on hatchery
grounds at the time developed clinical disease or had detectible levels of EEDV genetic material.
However, EEDV DNA was detected in mottled sculpin collected from upstream of the hatchery
the following year, suggesting a potential virus reservoir in wild fish and hatchery source water.
Following the mortality episode in the fall of 2012, EEDV was detected in two hatchery fish in
2013 and then not again until 2017 when mortalities once again occurred. What made the 2017
EEDV outbreak particularly interesting is the identification of the virus as well as development
of clinical disease in older fish. All previous reports of EEDV-related mortalities have occurred
in either fingerling or yearling aged fish whereas the fish experiencing mortalities in 2017 were
two years old.
In addition to highlighting the importance of strong biosecurity practices in limiting the
spread of disease, Chapter 2 serves to demonstrate the magnitude of work remaining in order to
fully understand this devastating disease. Whether it be from exposure of naïve populations to
carrier fish (e.g., hatchery water supply, fomite transfer), or recrudescence of disease in
previously infected fish, it is clear that EEDV remains a threat to lake trout populations in the
Great Lakes, and remaining chapters of this dissertation focus on some of the still unanswered
questions. As the Lake Superior strain fish appeared, during the natural outbreak, to be more
susceptible to EEDV than the Seneca Lake fish (e.g., earlier and more severe disease), the Lake
Superior stain was used for the remainder of my studies.

201

Chapter 3 addresses the problem that in order to study this deadly virus, we need
understand the dose dependent effects of EEDV infection and determine whether we are capable
of reproducing clinical disease in a controlled laboratory environment. In this chapter, I answer
two questions: 1) what is the necessary viral load or dose required to cause clinical disease? and
2) can morbidity and mortality be reproducibly initiated using an immersion bath method? In the
first experiment, naïve, juvenile lake trout were exposed to a range of viral doses and monitored
for development of clinical disease. Based on my results, I demonstrated that exposure to a viral
dose of greater than or equal to 4.7x104 viral copies per mL immersion bath water leads to
development of clinical disease consistent with that seen in natural outbreaks. A second study
was performed exposing lake trout to high and low viral doses in triplicate in order to assess
reproducibility of this immersion infection model. Results of this study showed that I was able to
reproduce clinical disease in experimentally challenged lake trout, however there may be
additional factors such as individual fish variability and external stressors in a hatchery
environment that contribute to development of disease.
Armed with a model of experimental disease challenge I was able to move onto my next
two chapters, which address the temporal changes following an EEDV infection. In Chapter 4, I
examined the sequential distribution of EEDV following viral exposure, in order to identify
specific target tissues and cells. A quantitative PCR assay (14) was used to compare viral loads
among ten different tissues over twelve predetermined sampling days while a novel in situ
hybridization assay was developed in order to visualize EEDV DNA within specific cells. This
study serves to widen our knowledge on the pathogenesis of EEDV, and identify specific viral
targets throughout the course of disease. I show that the virus is first detectible in the eye, skin
and fins and that consistently external tissues carry a higher viral load than visceral tissues. The

202

establishment of epithelial tissues as primary viral targets helps to not only better understand
host-virus interactions, but also to guide the choice of diagnostic and surveillance tissues.
In Chapter 5, I present specific gross and histopathologic lesions throughout an EEDV
infection. Primary lesions were observed in the skin and fins and correlated with qPCR data from
the previous chapter in that lesion severity increased over time, appearing to peak around Day
28-35 post infection. Interestingly, one of the first signs of disease was actually the lack of an
abnormality. While healthy fish had moderate to severe hepatic lipidosis, once the fish began
displaying clinical signs consistent with an active EEDV infection, the hepatic lipidosis went
away, an indication that the fish ceased eating. While I was unable to identify a specific point of
entry, the severity of total epithelial damage of the skin by the end of the study likely resulted in
hypo-osmotic shock and death. A final interesting finding form Chapters 4 and 5 is that I
identified extremely high viral loads in tissues collected from fish that were only mildly affected
grossly and microscopically. This highlights the importance of screening at risk populations of
fish, as there is the potential for survivors to become a source of future exposure.
In Chapter 6, I shift my focus toward improving research and diagnostic tools and
describe the development of two novel cell lines of lake trout origin. I established primary cell
cultures from multiple lake trout tissues, and successfully expanded and subcultured cells from
yearling gonads and sac fry bodies out beyond 35 and 50 subcultures respectively. Optimal
growth conditions for these cells were established, and DNA barcoding was used to prove lake
trout as the species of origin. Additionally, I demonstrated that these cells were capable of
developing cytopathic effect following exposure to multiple aquatic viruses including Viral
Hemorrhagic Septicemia Virus and Infectious Pancreatic Necrosis Virus. With a limited number
of established cell lines originating from fish tissues, study of specific fish species and pathogens

203

falls to the development of novel cell cultures. With no commercially available cell lines of lake
trout origin, this work serves to provide an extremely useful research and diagnostic tool.
Finally, in Chapter 7 I discuss the development of a novel molecular assay for
quantitative diagnosis of EEDV. While endpoint and quantitative PCR assays have previously
been developed, Loop Mediated Isothermal Amplification (LAMP) assays have several benefits
including being both cost and time efficient as well as having the potential for commercialization
and use in field conditions. I present a new quantitative method capable of amplifying EEDV
DNA in fish tissue with relatively high specificity and sensitivity. There was no statistical
difference between the viral loads obtained from this qLAMP and those of the SYBR Green
qPCR (14).
The culmination of this dissertation shows that EEDV remains a significant threat to lake
trout populations in the Great Lakes basin, but we are now better armed to combat its spread than
ever before. Epidemiological analysis of the two recent EEDV outbreaks (as presented in
Chapter 2) has demonstrated that not only is the virus still within the hatchery system, but also
that it is capable of causing disease in both juvenile and older fish. In order to identify potential
sources of infection before a mortality event erupts, continued surveillance for EEDV within the
hatchery should continue among all age groups of lake trout on the property. Early identification
of these infected fish would allow for more rapid implementation of control strategies such as
decreasing densities (through culling or spreading out of fish lots) or increased biosecurity
between infected and non-infected via establishment of a quarantine area. In order to accurately
identify infected fish, appropriate diagnostic samples and assays must be run. The work within
this dissertation has established that external tissues such as eyes, skin or fins are the primary
viral targets, and thus should constitute primary diagnostic samples. Collection and analysis of

204

these tissues using the recently established qPCR (14), or the qLAMP assay described herein,
will maximize detection of EEDV-positive fish and allow confidence in negative results.

2. Future Research
In this dissertation I have expanded our knowledge of the pathogenesis of EEDV and
developed tools in the form of a disease model and diagnostic assays that can be put to use in
future research studies.
While I have established herein that EEDV remains a threat to hatchery-reared lake trout
in the Great Lakes basin, one key point that remains to be addressed is the current prevalence of
EEDV among both hatchery and wild lake trout populations. Removal of infected individuals
from the hatchery system as well as avoidance of gamete collection from bodies of water with
high EEDV prevalence in wild fish may aid in the prevention of future mortality events.
Comprehensive screening of all broodstock fish prior to the use of gametes for production
purposes should continue. Direct molecular assays such as qPCR and qLAMP can be coupled
with an ELISA for detection of EEDV antibodies in wild fish. It is clear that EEDV outbreaks
are worsened by the relatively high fish densities in hatcheries, and that discovery of a mortality
event in wild fish is unlikely, however, the detection of EEDV antibodies in wild fish can help to
identify certain bodies of water, or locations where sampling of wild fish for gametes should be
avoided. While it is likely that EEDV is fairly ubiquitous in Great Lakes lake trout populations,
both hatchery and wild, every effort should be made to prevent the introduction of additional
virus.
Next, the definitive identification of susceptible host species and potential viral reservoirs
should be determined. The identification of epithelial viral targets including the eye, skin and fin

205

as described in Chapter 4, allows for more targeted sampling efforts in order to identify these
“at-risk” fish populations. Of particular interest are splake (a lake trout x brook trout hybrid) and
wild mottled sculpin. Past reports have stated that splake can be experimentally infected with
EEDV (105), however in neither of the natural outbreaks did we see any evidence of clinical
disease in the splake, even when housed directly downstream of diseased lake trout. One
particular concern would be the capability of splake to act as a viral reservoir without
development of clinical disease, representing a substantial biosecurity concern within hatcheries.
The identification of EEDV DNA in wild mottled sculpin following the 2012 mortality event
was extremely surprising. Susceptibility trials need to be performed in order to determine
whether these findings can be reproduced in a controlled laboratory environment. Additionally,
surveillance of the wild fish surrounding the Marquette State Fish Hatchery should continue in
order to determine if mottled sculpin remain infected and to identify potential sources of EEDV
before the water enters the hatchery.
Based on the history of EEDV outbreaks in hatcheries (2, 4, 5) (Chapter 2), they are most
frequently preceded by a stressor event such as alterations in water quality or routine hatchery
practices including tagging or transfer to a new raceway. This is a concept that can be put to use
in the screening for infected individuals through the use of a stress test (39). I would recommend
additional experimental studies examining the effect of different stressors both on the severity of
disease as well as the eruption of disease in previously infected fish. Identification of stressors
most likely to result in resurgence of EEDV can be useful to hatchery managers in planning to
minimize stress and prevent disease outbreaks.
With the development of novel lake trout cell cultures, the next task will be to determine
the necessary conditions in order to support replication of EEDV. In my dissertation I attempted

206

only a portion of potential viral culture techniques. Additional methods of viral replication are
used to culture avian and mammal herpesviruses such as the cloning of Merek’s Disease Virus
into a Bac vector (145). This type of method requires the full genome sequence of the virus,
something we don’t yet have for EEDV, however were it to be completed, a method such as is
used for Marek’s disease, coupled with the established lake trout cells may result in an effective
in vitro model of EEDV replication.
I would also recommend additional studies aimed at identification of latent infections and
carrier hosts. The newly developed in situ hybridization assay can be utilized in combination
with the experimental model described in this dissertation in order to localize EEDV genetic
material in surviving fish. While I have established that the fin, skin and eye are prime viral
targets at the start of and throughout a disease outbreak, it is still unknown where or if the EED
virus establishes latency. Answering this question will provide an additional level of sensitivity
when screening for infected or reservoir fish.
Finally, following the recent natural disease outbreaks as well as experimental challenge,
a proportion of exposed or infected lake trout survived. As the immunologic status of these
surviving fish is unknown, it would be of interest to experimentally determine if survivor status
provides any degree of protection against re-exposure to EEDV. Should susceptibility of
surviving fish be lower upon re-exposure to EEDV, and should a measureable and correlative
antibody response occur, it could have significant value in terms of understanding the
immunologic response to EEDV and vaccine development. Development of a modified live
vaccine for Koi Herpesvirus (Salmonid Herpesvirus-3) has proven to be efficacious and safe
when administered to koi fish (Cyprinus carpio koi) weighing more then 87 grams (159).

207

Preliminary genome sequencing data (unpublished) has identified the presence of potential
virulence factor genes, which may serve as logical targets for vaccine design.
In conclusion, the study design and methods described herein can be readily extrapolated
in order to address the remaining questions concerning EEDV in lake trout. The results of this
dissertation demonstrate the significance of this virus to North American lake trout populations
and the need for swift and decisive action toward preventing further losses due to EEDV. These
research recommendations, coupled with the results of this dissertation will serve to provide a
basis for an action plan regarding EEDV in the Great Lakes basin.

208

REFERENCES

209

REFERENCES

1.

T. B. Waltzek et al., Phylogenetic relationships in the family Alloherpesviridae. Dis.
Aquat. Organ. 84, 179–194 (2009).

2.

T. M. Bradley, C. E. Newcomer, K. O. Maxwell, Epitheliocystis associated with massive
mortalities of cultured lake trout Saivelinus namaycush. Dis. Aquat. Organ. 4, 9–17
(1988).

3.

T. M. Bradley, D. J. Medina, P. W. Chang, J. McClain, Epizootic epitheliotrophic disease
of lake trout (Salvelinus namaycush): history and viral etiology. Dis. Aquat. Org. 7, 195–
201 (1989).

4.

P. McAllister, R. Herman, Epizootic mortality in hatchery-reared lake trout Salvelinus
namaycush caused by a putative virus possibly of the herpesvirus group. Dis. Aquat.
Organ. 6, 113–119 (1989).

5.

T. Kurobe, S. Marcquenski, R. P. Hedrick, PCR assay for improved diagnostics of
epitheliotropic disease virus (EEDV) in lake trout Salvelinus namaycush. Dis. Aquat.
Organ. 84, 17–24 (2009).

6.

R. R. Redick, A review of literature on lake trout life history with notes on Alaskan
management. (State of Alaska, Department of Fish and Game, Homer, Alaska, 1967).

7.

M. E. Holey et al., Progress Toward Lake Trout Restoration in Lake Michigan. J. Great
Lakes Res. 21, 128–151 (1995).

8.

R. Hile, P. H. Eschmeyer, G. F. Lunger, Decline of the lake trout fishery in Lake
Michigan. Fish. Bull. U. S. Fish Wildl. Serv. 52, 77–95 (1951).

9.

T. J. Cline, V. Bennington, J. F. Kitchell, Climate change expands the spatial extent and
duration of preferred thermal habitat for Lake Superior fishes. PLoS One. 8 (2013),
doi:10.1371/journal.pone.0062279.

10.

M. J. Hansen et al., Lake trout (Salvelinus namaychus) populations in Lake Superior and
their restoration in 1959-1993. J. Great Lakes Res. 21 Sup. 1, 152–175 (1995).

11.

L. Wells, A. L. McLain, “Lake Michigan: man’s effects on native fish stocks and other
biota,” Great Lakes Fishery Commission Tech. Rep. No. 20 (1973).

12.

R. L. Eshenroder, K. L. Amatnagelo, "Reassessment of the lake trout population collaspe
in Lake Michigan during the 1940s," Great Lakes Fishery Commission Tech. Rep. No. 65
(2002).

13.

C. Bronte, C. Krueger, M. Holey, M. Toneys, "A guide for the rehabilitation of lake trout
in Lake Michigan," Great Lakes Fishery Commission, Miscellaneous Publication 2008210

01, Ann Arbor, Michigan (2008).
14.

G. W. Glenney, P. A. Barbash, J. A. Coll, A quantitative polymerase chain reaction assay
for the detection and quantification of epizootic epitheliotropic disease virus (EEDV;
salmonid herpesvirus 3). J. Aquat. Anim. Health. 28, 56–67 (2016).

15.

L. L. Cheng, P. R. Bowser, J. M. Spitsbergen, Development of cell cultures derived from
lake trout liver and kidney in a hormone-supplemented, serum-reduced medium. J. Aquat.
Anim. Health. 5, 119–126 (1993).

16.

R. P. Hedrick et al., A herpesvirus associated with mass mortality of juvenile and adult
koi, a strain of common carp. J. Aquat. Anim. Health. 12, 44–57 (2000).

17.

K. Wolf, R. W. Darlington, Channel catfish virus: a new herpesvirus of ictalurid fish. J.
Virol. 8, 525–533 (1971).

18.

X. Fang, Y. Liu, J. Kong, X. Jiang, Loop-mediated isothermal amplification integrated on
microfluidic chips for point-of-care quantitative detection of pathogens. Anal. Chem. 82,
3002–3006 (2010).

19.

T. Notomi et al., Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28,
E63 (2000).

20.

P. M. Moyle, J. J. Czech Jr., Fishes: An introduction to ichthyology (Prentice Hall,
Uppersaddle River, NJ, ed. 5th, 2000).

21.

J. A. Hutchings, Collapse and recovery of marine fishes. Nature. 406, 882–885 (2000).

22.

F. W. Allendorf, P. R. England, G. Luikart, P. A. Ritchie, N. Ryman, Genetic effects of
harvest on wild animal populations. Trends Ecol. Evol. 23 (2008), pp. 327–337.

23.

D. M. T. Sharpe, A. P. Hendry, Life history change in commercially exploited fish stocks:
An analysis of trends across studies. Evol. Appl. 2, 260–275 (2009).

24.

R. S. Waples, Dispelling some myths about hatcheries. Fisheries. 24, 12–21 (1996).

25.

G. Helfman, Fish Conservation. A guide to understanding and restoring global aquatic
Biodiversity and Fishery resource. (Island, Washington, ed. 1, 2007).

26.

H. Araki, B. A. Berejikian, M. J. Ford, M. S. Blouin, Fitness of hatchery-reared salmonids
in the wild. Evol. Appl. 1, 342–355 (2008).

27.

M. M. McClure et al., Evolutionary effects of alternative artificial propagation programs:
implications for viability of endangered anadromous salmonids. Evol. Appl. 1, 356–375
(2008).

28.

L. Laikre, M. K. Schwartz, R. S. Waples, N. Ryman, Compromising genetic diversity in
the wild: Unmonitored large-scale release of plants and animals. Trends Ecol. Evol. 25,
211

520–529 (2010).
29.

J. A. Plumb, L. A. Hanson, Health Maintenance and Principal Microbial Diseases of
Cultured Fishes. (Wiley, ed. 3rd, 2011).

30.

F. P. Meyer, Seasonal fluctuations in the incidence of disease on fish farms. Symp. Amer.
Fisb. Soco Ois. Shell Fish Spec. 5, 21–29 (1970).

31.

J. A. Plumb, J. M. Grizzle, J. Defigueiredo, Necrosis and bacterial infection in channel
catfish (Ictalurus punctatus) following hypoxia. J. Wildl. Dis. 12, 247–253 (1976).

32.

E. J. Noga, Fish Disease Diagnosis and Treatment (John Wiley & Sons, 2011).

33.

Z. Xu et al., Teleost skin, an ancient mucosal surface that elicits gut-like immune
responses. Proc. Natl. Acad. Sci. 110, 13097–13102 (2013).

34.

V. S. Raj et al., Skin mucus of Cyprinus carpio inhibits cyprinid herpesvirus 3 binding to
epidermal cells. Vet. Res. 42, 92 (2011).

35.

I. Salinas, The mucosal immune system of teleost fish. Biology (Basel). 4, 525–539
(2015).

36.

D. C. B. Duff, The oral immunisation of trout against Bacterium salmonicida. J. Immunol.
44, 81–94 (1942).

37.

J. C. Leong, J. L. Fryer, Viral vaccines for aquaculture. Annu. Rev. Fish Dis. 3, 225–240
(1993).

38.

“Fact Sheet 2: the Great Lakes Fishery” (Great Lakes Fishery Commission, 2014).

39.

K. A. Phillips, A. Noyes, L. Shen, G. Whelan, “Model program for fish health
management in the Great Lakes.” (Ann Arbor, Michigan, 2014).

40.

AFS-FHS, FHS blue book: suggested procedures for the detection and identification of
certain finfish and shellfish pathogens (2016 editi., 2016).

41.

International Office of Epizootics. Aquatic Animal Health Standards Commission.,
Aquatic Animal Health Code (World Organisation for Animal Health, Paris, France, ed.
20th, 2017).

42.

International Office of Epizootics. Aquatic Animal Health Standards Commission.,
Manual of diagnostic tests for aquatic animals (Office International des épizooties, ed.
6th, 2009).

43.

T. Kimura, M. Yoshimizu, M. Tanaka, H. Sannohe, Studies on a new virus (OMV) from
Onchorhynchus masou - I. Characteristics and pathogenicity. Fish Pathol. 15, 143–147
(1981).

44.

A. J. Davison, Evolution of the herpesviruses. Vet. Microbiol. 86, 69–88 (2002).
212

45.

L. Hanson, A. Dishon, M. Kotler, Herpesviruses that infect fish. Viruses. 3, 2160–2191
(2011).

46.

D. J. McGeoch, F. J. Rixon, A. J. Davison, Topics in herpesvirus genomics and evolution.
Virus Res. 117, 90–104 (2006).

47.

A. J. Davison et al., Comparative genomics of carp herpesviruses. J. Virol. 87, 2908–2922
(2013).

48.

P. Pellett, “Taxonomic proposal to the ICTV Executive Committee (2008.028- 032v 1 6)”
(2008).

49.

L. Herbst, A. Ene, M. Su, R. Desalle, J. Lenz, Tumor outbreaks in marine turtles are not
due to recent herpesvirus mutations. Curr. Biol. 14 (2004), pp. R697–R699.

50.

R. J. Greenblatt et al., Genomic variation of the fibropapilloma-associated marine turtle
herpesvirus across seven geographic areas and three host species. J. Virol. 79, 1125–32
(2005).

51.

D. J. McGeoch, D. Gatherer, Integrating reptilian herpesviruses into the family
herpesviridae. J. Virol. 79, 725–31 (2005).

52.

E. J. Lefkowitz et al., “ICTV Virus Taxonomy The Online (10th) Report of the
International Committee on Taxonomy of Viruses” (2017).

53.

R. P. Hedrick, T. Sano, in Viruses of Lower Vertebrates (Springer Berlin Heidelberg,
Berlin, Heidelberg, 1989), pp. 161–170.

54.

N. Sano, M. Moriwake, R. Hondo, T. Sano, Herpesvirus cyprini: a search for viral genome
in infected fish by infected fish by in situ hybridization. J. Fish Dis. 16, 495–499 (1993).

55.

K. E. Eide et al., Investigation of koi herpesvirus latency in koi. J. Virol. 85, 4954–4962
(2011).

56.

D. F. Gou, H. Kubota, M. Onuma, H. Kodama, Detection of salmonid herpesvirus
(Oncorhynchus masou virus) in fish by southern-blot technique. J. Vet. Med. Sci. 53, 43–
48 (1991).

57.

J. A. Wise, J. A. Boyle, Detection of channel catfish virus in channel catfish, Ictalurus
punctatus (Rafinesque): use of a nucleic acid probe. J. Fish Dis. 8, 417–424 (1985).

58.

J. Boyle, J. Blackwell, Use of polymerase chain reaction to detect latent channel catfish
virus. Am. J. Vet. Res. 52, 1965–1968 (1991).

59.

Y. S. Baek, J. A. Boyle, Detection of channel catfish virus in adult channel catfish by use
of a nested polymerase chain reaction. J. Aquat. Anim. Health. 8, 97–103 (1996).

60.

W. L. Gray, R. J. Williams, R. L. Jordan, B. R. Griffin, Detection of channel catfish virus
213

DNA in latently infected catfish. J. Gen. Virol. 80, 1817–1822 (1999).
61.

A. P. Van Nieuwstadt, S. G. Dijkstra, O. L. M. Haenen, Persistence of herpesvirus of eel
Herpesvirus anguillae in farmed European eel Anguilla anguilla. Dis. Aquat. Organ. 45,
103–107 (2001).

62.

S. Van Beurden, M. Engelsma, Herpesviruses of Fish, Amphibians and Invertebrates,
Herpesviridae - A Look Into This Unique Family of Viruses (2012).

63.

M. Sano, H. Fukuda, M. Furukawa, H. Hosoya, Y. Moriya, A herpesvirus isolated from
carp papilloma in Japan. Fish Shell Path. 32, 307–311 (1985).

64.

T. Sano, N. Morita, N. Shima, M. Akimoto, A preliminary report on pathogenicity and
oncogenicity of Cyprinid Herpesvirus. Bull. Eur. Assoc. Fish Pathol. 10, 11–13 (1990).

65.

A. E. Goodwin, J. Sadler, G. E. Merry, E. N. Marecaux, Herpesviral haematopoietic
necrosis virus (CyHV-2) infection: case studies from commercial goldfish farms. J. Fish
Dis. 32, 271–278 (2009).

66.

S. J. Jung, T. Miyazaki, Herpesviral haematopoietic necrosis of goldfish, Carassius
auratus (L.). J. Fish Dis. 18, 211–220 (1995).

67.

A. Goodwin, G. Merry, J. Sadler, Detection of the herpesviral hematopoietic necrosis
disease agent (Cyprinid herpesvirus 2) in moribund and healthy goldfish: validation of a
quantitative PCR diagnostic method. Dis. Aquat. Organ. 69, 137–143 (2006).

68.

A. Ronen et al., Efficient vaccine against the virus causing a lethal disease in cultured
Cyprinus carpio. Vaccine. 21, 4677–4684 (2003).

69.

C. I. Walster, Clinical observations of severe mortalities in koi carp, Cyprinus carpio, with
gill disease. Fish Vet. J. 3, 54–58 (1999).

70.

A. Perelberg et al., Epidemiological description of a new viral disease afflicting cultured
Cyprinus carpio in Israel. Isr. J. Aquac. - Bamidgeh. 55, 5–12 (2003).

71.

B. Costes et al., The major portal of entry of Koi Herpesvirus in Cyprinus carpio is the
skin. J. Virol. 83, 2819–2830 (2009).

72.

M. Sano, H. Fukuda, T. Sano, in Pathology in Marine Science (Academic Press,
Gloucester Point, Virginia, 1990), pp. 15–31.

73.

O. L. M. Haenen et al., Herpesvirus anguillae (HVA) isolations from disease outbreaks in
cultured European eel, Anguilla anguilla in the Netherlands since 1996. Bull. Eur. Assoc.
Fish Pathol. 22, 247–257 (2002).

74.

N. N. Fijan, T. L. Welborn, "An acute viral disease of channel catfish," U.S. Fish &
Wildlife Service Tech. Rep. No. 43 (1970).

214

75.

K. E. Nusbaum, B. F. Smith, P. De Innocentes, R. C. Bird, Protective immunity induced
by DNA vaccination of channel catfish with early and late transcripts of the channel
catfish herpesvirus (IHV-1). Vet. Immunol. Immunopathol. 84, 151–168 (2002).

76.

E. J. Noga, J. X. Hartmann, Establishment of walking catfish (Clarias batrachus) cell
lines and development of a Channel Catfish (Ictalurus punctatus) Virus vaccine. Can. J.
Fish. Aquat. Sci. 38, 925–930 (1981).

77.

H. G. Zhang, L. A. Hanson, Recombinant channel catfish virus (Ictalurid herpesvirus 1)
can express foreign genes and induce antibody production against the gene product. J.
Fish Dis. 19, 121–128 (1996).

78.

N. Vanderheijden, J. A. Martial, L. A. Hanson, Channel catfish virus vaccine (2001).

79.

L. Alborali, G. Bovo, A. Lavazza, H. Cappellaro, P. F. Guadagnini, Isolation of an
herpesvirus in breeding catfish (Ictalurus mela). Bull. Eur. Assoc. Fish Pathol. 16, 134–
137 (1996).

80.

R. P. Hedrick, T. S. McDowell, O. Gilad, M. Adkison, G. Bovo, Systemic herpes-like
virus in catfish Ictalurus melas (Italy) differs from Ictalurid herpesvirus 1 (North
America). Dis. Aquat. Organ. 55, 85–92 (2003).

81.

L. R. Watson, S. C. Yun, J. M. Groff, R. P. Hedrick, Characteristics and pathogenicity of a
novel herpesvirus isolated from adult and subadult white sturgeon Acipenser
transmontanus. Dis. Aquat. Organ. 22, 199–210 (1995).

82.

K. Wolf, R. W. Darlington, W. G. Taylor, M. C. Quimby, T. Nagabayashi, Herpesvirus
salmonis: characterization of a new pathogen of rainbow trout. J. Virol. 27, 659–66
(1978).

83.

K. Wolf, T. Sano, T. Kimura, "Herpesvirus Disease of Salmonids," U.S. Fish & Wildlife
Service Fish Disease Leaflet No. 44 (1975).

84.

T. Sano, Viral diseases of cultured fishes in Japan. Fish Pathol. 10, 221–226 (1976).

85.

T. Kimura, M. Yoshimizu, M. Tanaka, in Phyletic approaches to cancer (1981), pp. 59–
68.

86.

M. Horiuchi, M. Miyazawa, M. Nakata, K. Iida, S. Nishimura, A case of herpesvirus
infection on freshwater-reared coho salmon Oncorthynchus kisutch in Japan. Aquac. Sci.
36, 297–305 (1989).

87.

M. Furihata, K. Suzuki, A. Hosoe, T. Miyazaki, Histopathological study on Oncorhynchus
masou Virus Disease (OMVD) of cultured rainbow trout in natural outbreaks and artificial
infection. Fish Pathol. 40, 161–167 (2005).

88.

M. Yoshimizu, H. Fukuda, T. Sano, T. Kimura, Salmonid herpesvirus 2. Epizootiology
and serological relationship. Vet. Res. 26, 486–492 (1995).
215

89.

M. Yoshimizu, M. Tanaka, T. Kimura, Oncorhynchus masou virus (OMV): Incidence of
tumor development among experimentally infected representative salmonid species. Fish
Pathol. 22, 7–10 (1987).

90.

A. Doszpoly, T. A. Karaseva, T. B. Waltzek, I. M. Kalabekov, I. S. Shchelkunov, Atlantic
salmon papillomatosis in Russia and molecular characterization of the associated
herpesvirus. Dis. Aquat. Organ. 107, 121–127 (2013).

91.

J. C. Carlisle, R. J. Roberts, An epidermal papilloma of the Atlantic salmon I:
Epizootiology, pathology and immunology. J. Wildl. Dis. 13, 230–234 (1977).

92.

K. Wolf, Fish viruses and fish viral diseases (Cornell University Press, Ithaca, New York,
1988).

93.

I. S. Shchelkunov, T. A. Karseva, Y. U. P. Kadoshnikov, Atlantic salmon papillomatosis:
visualization of herpesvirus-like particles in skin growths of affected fish. Bull. Eur.
Assoc. Fish Pathol. 12, 28–31 (1992).

94.

G. W. Glenney, P. A. Barbash, J. A. Coll, Initial detection and molecular characterization
of namaycush herpesvirus (Salmonid herpesvirus 5) in lake trout. J. Aquat. Anim. Health.
28, 46–55 (2016).

95.

P. H. Eschmeyer, The near extinction of lake trout in Lake Michigan. Trans. Am. Fish.
Soc. 85, 102–119 (1957).

96.

W. S. Lakra, T. R. Swaminathan, K. P. Joy, Development, characterization, conservation
and storage of fish cell lines: A review. Fish Physiol. Biochem. 37, 1–20 (2011).

97.

J. L. Fryer, C. N. Lannan, Three decades of fish cell culture: A current listing of cell lines
derived from fishes. J. Tissue Cult. Methods. 16, 87–94 (1994).

98.

R. Hedrick, T. McDowell, R. Rosemark, Two cell lines from white sturgeon. Trans. Am.
Fish. Soc. 120, 528–534 (1991).

99.

T. Kimura, M. Yoshimizu, M. Tanaka, Studies on a new virus (OMV) from
Onchorhynchus masou - II. Oncogenic nature. Fish Pathol. 15, 149–153 (1981).

100. W. D. Eaton, W. H. Wingfield, R. P. Hedrick, Prevalence and experimental transmission
of the steelhead herpesvirus in salmonid fishes. Dis. Aquat. Organ. 7, 23–30 (1989).
101. K. Wolf, C. E. Smith, Herpesvirus salmonis: pathological changes in parenterally infected
rainbow trout, Salmo gairdneri Richardson, fry. J. Fish Dis. 4, 445–457 (1981).
102. C. C. Boehme et al., Operational feasibility of using loop-mediated isothermal
amplification for diagnosis of pulmonary tuberculosis in microscopy centers of developing
countries. J. Clin. Microbiol. 45, 1936–40 (2007).
103. Q. Zhang et al., Development and evaluation of reverse transcription loop-mediated
216

isothermal amplification assay for the detection of the fathead minnow nidovirus. J. Virol.
Methods. 202, 39–45 (2014).
104. X. I. E. Guosi, Z. Qingli, H. A. N. Nana, An improved method for detection of
Edwardsiella tarda by loop-mediated isothermal amplification by targeting the EsrB
gene*. Chinese J. Oceanol. Limnol. 30, 595–603 (2012).
105. P. E. McAllister, “Lake Trout Epidermal Hyperplasia,” Pacific Northwest Fish Health
Protection Committee Informational Report No. 4 (1991).
106. R. K. Kim, M. Faisal, The Laurentian Great Lakes strain (MI03) of the viral haemorrhagic
septicaemia virus is highly pathogenic for juvenile muskellunge, Esox masquinongy
(Mitchill). J. Fish Dis. 33, 513–527 (2010).
107. M. Faisal et al., Isolation of the Fathead Minnow Nidovirus from muskellunge
experiencing lingering mortality. J. Aquat. Anim. Health. 28, 131–141 (2016).
108. Z. Ding et al., Histopathological characterization and fluorescence in situ hybridization of
Cyprinid herpesvirus 2 in cultured Prussian carp, Carassius auratus gibelio in China. J.
Virol. Methods. 206, 76–83 (2014).
109. L. Hanson, A. Doszpoly, S. J. van Beurden, P. H. de Oliveira Viadanna, T. Waltzek, in
Aquaculture Virology (Kibenge, Frederick S. B.Godoy, Marcos G., 2016), pp. 153–172.
110. M. Faisal, A. E. Eissa, C. E. Starliper, Recovery of Renibacterium salmoninarum from
naturally infected salmonine stocks in Michigan using a modified culture protocol. J. Adv.
Res. 1, 95–102 (2010).
111. M. Faisal et al., in Great Lakes fisheries policy and management: a binational
perspective, W. W. Taylor, A. J. Lynch, N. J. Leonard, Eds. (Michigan State University
Press, East Lansing, ed. 2nd, 2013), pp. 259–302.
112. G. L. Bullock, T. C. Hsu, E. B. Shotts, "Columnaris disease of fishes," U.S. Fish &
Wildlife Service Fish Disease Leaflet No. 72 (1986).
113. R. L. Anacker, E. J. Ordal, Studies on the myxobacterium Myxobacterium chondrococcus
columnaris I. Serological Typing. J. Bacteriol. 78, 25–32 (1959).
114. D. Van Vliet, T. P. Loch, M. Faisal, Flavobacterium psychrophilum infections in
salmonid broodstock and hatchery-propagated stocks of the great lakes basin. J. Aquat.
Anim. Health. 27, 192–202 (2015).
115. N. Fijan et al., Some properties of the Epitherlioma papulosum cyprini (EPC) cell line
from carp cyprinus carpio. Ann. Virol. (Institue Pasteur). 134, 207–220 (1983).
116. J. L. Fryer, A. Yusha, K. S. Pilcher, The in vitro cultivation of tissue and cells of Pacific
salmon and steelhead trout. Ann. N. Y. Acad. Sci. 126, 566–586 (1965).

217

117. E. Prophet, B. Mills, J. B. Arrington, L. H. Sobin, in Washington: American Registry of
Pathology (1992), p. 278.
118. T. Hall, BioEdit: a user-friendly biological sequence alignment editor and analysis
program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98 (1999).
119. K. Tamura, G. Stecher, D. Peterson, MEGA6: molecular evolutionary genetics analysis
version 6.0. Molec. Biol. Evol. 30, 2725–2729 (2013).
120. F. Ronquist et al., Mrbayes 3.2: Efficient bayesian phylogenetic inference and model
choice across a large model space. Syst. Biol. 61, 539–542 (2012).
121. A. Rambaut, FigTree v1.3.1 Institute of Evolutionary Biology, University of Edinburgh,
Edinburgh. (2009).
122. M. B. Bonsall, S. M. Sait, R. S. Hails, Invasion and dynamics of covert infection strategies
in structured insect-pathogen populations. J. Anim. Ecol. 74, 464–474 (2005).
123. K. Yuasa, T. Ito, M. Sano, Effect of water temperature on mortality and virus shedding in
carp experimentally infected with Koi Herpesvirus. Fish Pathol. 43, 83–85 (2008).
124. A. Baumer, M. Fabian, M. Wilkens, D. Steinhagen, M. Runge, Epidemiology of cyprinid
herpesvirus-3 infection in latently infected carp from aquaculture. Dis. Aquat. Organ. 105,
101–108 (2013).
125. A. Ozaki et al., Quantitative trait loci (QTLs) associated with resistance/susceptibility to
infectious pancreatic necrosis virus (IPNV) in rainbow trout (Oncorhynchus mykiss). Mol.
Genet. Genomics. 265, 23–31 (2001).
126. S. Selvarajan Sigamani, H. Zhao, Y. N. Kamau, J. D. Baines, L. Tang, The structure of the
Herpes Simplex Virus DNA-packaging terminase pUL15 nuclease domain suggests an
evolutionary lineage among eukaryotic and prokaryotic viruses. J. Virol. 87, 7140–7148
(2013).
127. L. J. Reed, H. Muench, A simple method of estimating fifty per cent endpoints. Am. J.
Epidemiol. 27, 493–497 (1938).
128. C. Wallis, J. L. Melnick, Stabilization of enveloped viruses by dimethyl sulfoxide. J.
Virol. 2, 953–954 (1968).
129. P. Yarahmadi, H. K. Miandare, S. Fayaz, C. M. A. Caipang, Increased stocking density
causes changes in expression of selected stress- and immune-related genes, humoral innate
immune parameters and stress responses of rainbow trout (Oncorhynchus mykiss). Fish
Shellfish Immunol. 48, 43–53 (2016).
130. A. D. Pickering, T. G. Pottinger, Stress responses and disease resistance in salmonid fish:
Effects of chronic elevation of plasma cortisol. Fish Physiol. Biochem. 7, 253–258 (1989).

218

131. J. A. Plumb, in Viruses of Lower Vertebrates (Springer Berlin Heidelberg, Berlin,
Heidelberg, 1989), pp. 198–216.
132. S. Miwa, I. Kiryu, K. Yuasa, T. Ito, T. Kaneko, Pathogenesis of acute and chronic
diseases caused by cyprinid herpesvirus-3. J. Fish Dis. 38, 695–712 (2015).
133. C. Martenot et al., In situ localization and tissue distribution of ostreid herpesvirus 1
proteins in infected Pacific oyster, Crassostrea gigas. J. Invertebr. Pathol. 136, 124–135
(2016).
134. M. Erdtmann-Vourliotis et al., Rational design of oligonucleotide probes to avoid
optimization steps in in situ hybridization. Brain Res. Protoc. 4, 82–91 (1999).
135. R. C. Menezes et al., Sensitivity and specificity of in situ hybridization for diagnosis of
cutaneous infection by Leishmania infantum in dogs. J. Clin. Microbiol. 51, 206–211
(2013).
136. O. Gilad et al., Concentrations of a Koi herpesvirus (KHV) in tissues of experimentally
infected Cyprinus carpio koi as assessed by real-time TaqMan PCR. Dis. Aquat. Organ.
60, 179–187 (2004).
137. N. S. Lee, J. Kobayashi, T. Miyazaki, Gill filament necrosis in farmed Japanese eels,
Anguilla japonica (Temminck and Schlegel), infected with Herpesvirus anguillae. J. Fish
Dis. 22, 457–463 (1999).
138. I. F. Standish, E. V. Millard, T. O. Brenden, M. Faisal, A DNA vaccine encoding the viral
hemorrhagic septicemia virus genotype IVb glycoprotein confers protection in
muskellunge (Esox masquinongy), rainbow trout (Oncorhynchus mykiss), brown trout
(Salmo trutta), and lake trout (Salvelinus namaycush). Virol. J. 13 (2016),
doi:10.1186/s12985-016-0662-8.
139. M. Faisal et al., Spread of the emerging viral hemorrhagic septicemia virus strain,
genotype IVb, in Michigan, USA. Viruses. 4 (2012), doi:10.3390/v4050734.
140. L. C. Stott, S. Schnell, C. Hogstrand, S. F. Owen, N. R. Bury, A primary fish gill cell
culture model to assess pharmaceutical uptake and efflux: Evidence for passive and
facilitated transport. Aquat. Toxicol. 159, 127–137 (2015).
141. A. R. Khansari, D. Parra, F. E. Reyes-López, L. Tort, Cytokine modulation by stress
hormones and antagonist specific hormonal inhibition in rainbow trout (Oncorhynchus
mykiss) and gilthead sea bream (Sparus aurata) head kidney primary cell culture. Gen.
Comp. Endocrinol. 250, 122–135 (2017).
142. N. V. Ivanova, T. S. Zemlak, R. H. Hanner, P. D. N. Hebert, Universal primer cocktails
for fish DNA barcoding. Mol. Ecol. Notes. 7, 544–548 (2007).
143. J. K. Cooper et al., Species identification in cell culture: a two-pronged molecular
approach. In Vitro Cell. Dev. Biol. Anim. 43, 344–351 (2007).
219

144. S. Ratnasingham, P. D. N. Hebert, BARCODING, BOLD : The Barcode of Life Data
System (www.barcodinglife.org). Mol. Ecol. Notes. 7, 355–364 (2007).
145. D. Schumacher, B. K. Tischer, W. Fuchs, N. Osterrieder, Reconstitution of Marek’s
Disease Virus Serotype 1 (MDV-1) from DNA cloned as a bacterial artificial chromosome
and characterization of a glycoprotein B-negative MDV-1 mutant. J. Virol. 74, 11088–
11098 (2000).
146. R. I. Freshney, Culture of Animal Cells: A Manual of Basic Technique and Specialized
Applications: Sixth Edition (John Wiley & Sons, Inc., Hoboken, NJ, USA, 2011).
147. M. Boutier et al., in Advances in Virus Research (Academic Press, 2015), vol. 93, pp.
161–256.
148. A. M. Q. King, M. J. Adams, E. B. Carsten, E. J. Lefkowitz, Virus Taxonomy:
Classification and Nomenclature of Viruses. Ninth Report of the International Committee
on Taxonomy of Viruses. (Elsevier, 2012).
149. N. Tomita, Y. Mori, H. Kanda, T. Notomi, Loop-mediated isothermal amplification
(LAMP) of gene sequences and simple visual detection of products. Nat. Protoc. 3, 877–
882 (2008).
150. Q.-L. Zhang et al., Development of a reverse transcription loop-mediated isothermal
amplification assay for rapid detection of grass carp reovirus. J. Virol. Methods. 187, 384–
389 (2013).
151. J. Li et al., Rapid detection of orf virus by loop-mediated isothermal amplification based
on the DNA polymerase gene. Arch. Virol. 158, 793–798 (2013).
152. C. Saetiew et al., Rapid detection of the most common high-risk human papillomaviruses
by loop-mediated isothermal amplification. J. Virol. Methods. 178, 22–30 (2011).
153. J. Hwang et al., Detection of coat protein gene of nervous necrosis virus using loopmediated isothermal amplification. Asian Pac. J. Trop. Med. 9, 235–240 (2016).
154. Q. Chen, J. Li, X.-E. Fang, W. Xiong, Detection of swine transmissible gastroenteritis
coronavirus using loop-mediated isothermal amplification. Virol. J. 7, 206 (2010).
155. R. Li, K. S. Ling, Development of reverse transcription loop-mediated isothermal
amplification assay for rapid detection of an emerging potyvirus: Tomato necrotic stunt
virus. J. Virol. Methods. 200, 35–40 (2014).
156. Y. Ma, T. Dai, A. Serwadda, H. Shen, Detecting a novel Eriocheir sinensis reovirus by
reverse transcription loop-mediated isothermal amplification assay. Lett. Appl. Microbiol.
63, 363–368 (2016).
157. Y. Suzuki et al., Comparison of real-time reverse-transcription loop-mediated isothermal
amplification and real-time reverse-transcription polymerase chain reaction for detection
220

of noroviruses in municipal wastewater. J. Biosci. Bioeng. 112, 369–372 (2011).
158. H. Wei et al., A novel method of real-time reverse-transcription loop-mediated isothermal
amplification developed for rapid and quantitative detection of human astrovirus. J. Virol.
Methods. 188, 126–131 (2013).
159. E. P. S. Weber et al., Efficacy and safety of a modified-live cyprinid herpesvirus 3 vaccine
in koi (Cyprinus carpio koi) for prevention of koi herpesvirus disease. Am. J. Vet. Res. 75,
899–904 (2014).

221