IDENTIFICATION AND MUTAGENESIS OF FELINE HERPESVIRUS UL49.5
IMMUNE EVASION GENE
By
Jerome Moulden

A THESIS
Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of
MASTERS OF SCIENCE
Microbiology and Molecular Genetics
2011

ABSTRACT
IDENTIFICATION AND MUTAGENESIS OF FELINE HERPESVIRUS UL49.5
IMMUNE EVASION GENE
By
Jerome Moulden
Cells present peptides on class I major histocompatibility complex (MHC class I)
molecules to cytotoxic CD8+ T lymphocytes (CTL), which recognize viral peptides and
destroy infected cells. Many viruses encode proteins that inhibit the antigen presentation
pathway. Here we demonstrate that feline herpesvirus 1 infection of cat fibroblasts
effectively blocks MHC class I surface expression by blocking the TAP peptide
transporter. Based on previous publications that varicellovirus UL49.5 is an immune
evasion gene, we cloned UL49.5 from FHV-1 and demonstrated that this gene is
sufficient to block MHC class I antigen presentation. As well as being a common
pathogen of cats, FHV1 is a relatively convenient model for viral pathogenesis. Using a
two-step homologous recombination technique, we have constructed a knockout virus
lacking UL49.5 expression. Feline cells infected with the mutant virus show similar
MHC class I surface expression as the uninfected controls. As well as offering a potential
approach to varicellovirus vaccination, these studies give greater understanding of viral
immune evasion and pathogenesis, as well as of the mechanism of MHC class I antigen
processing and presentation.

ACKNOWLEDGEMENTS
Giving thanks and glory to Lord God Jesus Christ who leadeth me besides the still
waters. To my family, thank you for always being there for me. You are all a blessing to
me, with your words of encouragement, sweet smiles, and warm embrace. You will never
know how much you have helped me and how essential you have been to my success.
Thank you mama and dad, Cynthia Gail and Jerome Moulden Sr., you are the best
parents a person could ever have. My childhood was filled with love and that love
continues to this day. Thank you committee members for your guidance and support. Dr.
Ian York is a great mentor and teacher. The way he explained immunology or virology
concepts made them easy to understand. Thank you for your friendly personality and
open door. I would like to give special thanks to Dr. Jackson and Dr. Dunbar for paving
the way for people like me and for being a shining example. To all of my friends thank
you. I dedicate this work to my family, friends and to Annie L. Jones my oldest living
relative.

iii

TABLE OF CONTENTS
Key to Abbreviations……………………………………………………...…...………….v
CHAPTER 1 INTRODUCTION ………………………………….……….……………..1
Feline Herpesvirus………………………………………………………………….……..2
Vaccination…………………………………………………………………..……………2
Virus Deletion Mutants………………………………………………………. …………..3
Treatment…………………………………………………………………………...……..4
MHC class I Antigen Presentation…………………………………………………....…..4
Cytotoxic T Lymphocytes……………………………………………………….…….….5
Virus Lytic and Latent Phase……………………………………………………...….…..6
Virus Immune Evasion………………………………………………………..………..…7
Two-Step Recombineering……………………………………………………....……..…9
CHAPTER 2 FELINE HERPESVIRUS 1 UL49.5 IS AN MHC CLASS I IMMUNE
EVASION MOLECULE………………………………………….......…………………11
Introduction………………………………………………………………………………13
Methods/ Materials ……………………………………………………………….……..15
Results……………………………………………………………………………..…….18
Discussion…………………………………………………………………………..……21
CHAPTER 3 FINAL DISCUSSION AND CONCLUSION……………………………25
Discussion…………………………………………………………………….………….27
Conclusion ……………………………………………………………..……………….28
Literature Cited……………………………………………………………..……………29

iv

KEY TO ABBERVIATIONS

BAC

bacterial artificial chromosome

CMV2

cytomegalovirus

CRFK

Crandell Rees feline kidney cells

CTL

cytotoxic T lymphocyte

FHV-1

feline herpesvirus 1

H-2kb

mouse MHC allele

HLA-A3

human MHC allele

MHC-1
SIINFEKL (S8L)
TAP

major histocompatibility complex
peptide single letter amino acid abbreviation
transporter associated with antigen processing

UL

unique long

v

CHAPTER 1
INTRODUCTION

1

Feline herpesvirus
Feline herpesvirus1 (FHV-1) is a member of the Vavicellovirus genus
Alphaherpes subfamily(1). FHV-1 has a double stranded DNA genome with an
icosahedra capsid and a glycoprotein-lipid envelope. FHV-1 causes the acute respiratory
illness feline viral rhinotracheitis (FVR) (2) (3) (8)and infects domestic cats as well as
other members of Felidae (9). Infection is worldwide, occurring in cats of all ages and
breeds. Cats can often have several upper respiratory infections at the same time,
however FHV-1 is the most common. Cats are usually infected via nasal, oral, and
conjunctival mucous membranes (10)(11). Infected queens are known to pass infection to
their kittens at birth or via nursing(12) (11). Characteristic symptoms of infection include
sneezing, nasal discharge, rhinitis (inflammation of the nose), and conjunctivitis
(inflammation of the membrane lining of the eyelid) (13). FHV-1 infection is most
prevalent in kittens, cats in adoption shelters and multi-cat households, especially if there
is overcrowding. Infection is also common in conditions of poor sanitation, ventilation,
and nutrition. Cats that are physically stressed, have weakened immune system due to
other sicknesses, or are unvaccinated tend to show more clinical signs of infection.
Immune response, vaccination and the overall health of cats seem to determine the
pathogenecity of FHV-1 infection.

Vaccination reduces or prevents clinical symptoms, yet viral persistence exists.
Even in vaccinations where a strong antibody response is induced, there is persistence
(6). The frequency of infection and spread increases especially when kittens lose
maternally derived antibodies (MDA) (14)and/or when cats are grouped together in high

2

numbers. Thus, persistence can lead to virus reactivation and shedding causing difficulty
in disease control. Parenterally administered modified live virus vaccines (MLV) and
inactivated virus vaccines are available. Though both viral shedding and latency load of
the wild-type virus is reduced in cats vaccinated prior to FHV-1 exposure as compared to
unvaccinated controls, these vaccines do not protect against infection or development of
the feline carrier state(15). Intranasal vaccines have been shown to yield better and more
rapid protection, but can often have side effects such as sneezing and other mild clinical
signs. It is not known whether vaccinations help control reactivation of already latent
virus. Also, sarcomas may develop at the site of injection, usually after administration of
aluminum-based adjuvants (16). The majority of cats vaccinated with modified live or
inactivated FHV-1 are protected against disease, however some cats will continue to
show mild signs of infection, particularly if they are exposed within three months of the
initial vaccination(5, 17) (18). Of these vaccines, some have been recombinant
poxviruses and baculoviruses expressing FHV-1 glycoprotein D(19, 20). There are also
several insertion/deletion mutants including thymidine kinase deletion mutants, with
some containing the capsid gene from feline calicivirus(21). Other vaccines include an
insertion mutant of open reading frame 2(ORF2), which is downstream of glycoprotein
C(22).

Maes and colleagues (23) developed a recombinant FHV-1 with deletion of both
glycoproteins I and E (FHVβ-galgIgEΔ), which has been shown to be an effective
vaccine for FVR. The same group has measured the virus latency load of vaccinated cats
after FHV-1 infection. Quantitative PCR was performed on feline genomic DNA isolated

3

from trigeminal ganglia, olfactory bulbs, and brain stems. The authors determined that
reduction of the virus latency load in vaccinated cats was dependent upon glycoproteins
gI and gE deletions in FHVβ-galgIgEΔ.

Treatments of FHV-1 infection using various nucleoside analogs have been
developed. Analogs for treatment of human herpesvirus, including herpes simplex virus
and varicella-zoster virus, have been tested against FHV-1, mainly in vitro. Acyclovir
and valacyclovir have been show to be extremely toxic for cats(24, 25). Treatment with
IFN-α (26)and feline omega IFN (27)to manage FHV-1 keratitis has been used, however
there are no controlled clinical trials. Bacterial infections are common with FHV-1
infection. Broad-spectrum antibiotics are of use to control secondary bacterial infections
in the upper respiratory tract.
Even with current vaccines, treatments, and healthy control of environmental
conditions, FHV-1 infection continues to be a problem. I hypothesize that persistence
may be due to specific evasion proteins, in particular those that inhibit cell-mediated
immunity. The immune evasion gene UL49.5, in particular, is a great candidate for
targeted mutagenesis for vaccine development given that its protein downregulates MHC
class I, inhibiting adaptive immune responses.

MHC class I Antigen Presentation/ Cytotoxic T Lymphocytes
Class I major histocompatibility complex (MHC class I) is expressed on all
nucleated cells and is composed of a light chain (β2-microglobulin), a highly polymorphic
heavy chain, and a small peptide produced from intracellular protein degradation. MHC

4

class I antigen presentation allows the cell to display self and foreign peptides from
potentially pathogenic intracellular microorganisms such as viruses. Viruses produce
proteins that are ubiqutinated and targeted for degradation. These proteins are degraded
by proteasomes in the cytosol, producing short peptides that are further processed and
trimmed by aminopeptidases to about 8 or 11 amino acids in length(28). Peptides are
transported into the endoplasmic reticulum (ER) via the ATP-dependent heterodimer
transporter associated with antigen processing (TAP). Peptides in the ER bind MHC class
I, and the peptide-MHC complex progresses out of the ER, through the Golgi, and are
eventually expressed on the plasma membrane. It is only when peptides are bound by
MHC that the complex is allowed to progress out of the ER to the cellular surface.
Viruses being intercellular pathogens, MHC class I presentation is an essential
function to notify the ‘outside world’ (i.e. the immune system) that there is potential
danger. Cytotoxic T lymphocyte killing is the most important immune response in
controlling a viral infection. The presentation of viral peptides on MHC class I is the
cells’ signal to cytotoxic T lymphocytes (CTLs) that the cell is infected, and the CTLs
recognize and destroy the infected cell. The T cell receptors of CTLs recognize both the
MHC class I and a specific viral peptide. The CTL degranulates releasing perforin and
granzyme B. Perforin polymerize to form pores in the infected cell, while granzyme B
enters the cell to induce apoptosis. Granzyme B induces cell death using two
mechanisms. Granzyme B acts on BID inducing the oligomerzation of BAX in the
mitochondria membrane(29). This causes the release of cytochrome c, assembly of the
apoptosome, and caspase-9 activation. Also, granzyme B directly targets caspase-3 and
caspase-7, leading to a caspase cascade, proteolysis and eventually cell death(29).

5

Many viruses have a lytic and a latent phase, where in the latter there is no
production of virons or any evidence of any viral protein synthesis. This is a hallmark of
α-herpesviurses, which show rapid induction of latency in neurons (11). Evidence of
latently infected neurons is the presence of latency-associated transcripts (LAT). Though
it is believed there is no viral protein synthesis, several reports revealed CD8+ T cells
surrounding the latently infected neurons. It is not fully know why they are attracted to
the cells. The expression of chemokines, such as RANTES, that are essential for
attracting T cell and other antiviral cytokines, such as IFN-γ and TNF-α are detectable in
latently infected trigeminal ganglia for at up to 180 days after HSV-1 corneal
infection(30, 31). However, despite undetectable expression of viral proteins, antigen
specific CD8+ T cells somehow resist reactivation of virus by secretion of IFN-γ; the
mechanism of action is undefined. Data supports the theory of cross-regulation between
IFN-γ and the HSV-1 immediate early gene alpha gene product, infected cell protein 0
(ICP0) that may control latent and lytic infection(32). ICP0 is required for efficient HSV1 reactivation from latency, and also aids in HSV-1 replication by targeting IFN-induced
antiviral proteins for destruction by the proteasome(32). IFN-γ counters the ICP0 effect in
several ways, one mechanism includes inhibiting ICP0 transcripts and upregulating
cyclin-dependant kinases inhibitors(33).

Therefore, T cells are essential for the control of viral titers, pathogenesis and
virus spread. Elimination of virally infected cells during acute infection has been shown

6

to reduce reactivation, while non-apoptotic control with INF-γ secretion reduces
reactivation as well.

Viral Immune Evasion
Many viruses have developed mechanisms that allow escape from the host’s
immune response, including MHC class I antigen presentation. These viral immune
evasion genes result in the down- regulation of MHC class I on infected cells; thereby,
presumably inhibiting CTL recognition and killing.

For example, Nef protein of HIV removes MHC class I from the plasma
membrane(34), murine cytomegalovirus (MCMV) proteins m4, m6 and m152 interfere
with MHC class I antigen processing (35), ICP47 from HSV inhibits peptide
translocation by blocking TAP(36), and E3gp19k from adenoviruses blocks MHC
association with TAP (37). Recently, Koppers-Lalic et al. (2005) (38)showed that the
UL49.5 gene from several members of the varicellovirus family of α-herpesvirus (equine
herpesvirus1, bovine herpesvirus1, and pseudorabies virus) encodes a ~9kDa immune
evasion protein that acts by blocking the TAP peptide transporter.

There are only a few cases where the role of immune evasion proteins in viral
pathogenesis during authentic infections has been studied. Because most immune evasion
genes that have been identified to date are from human or large animal pathogens (cattle,
swine, and horses), analysis of the infection in natural hosts has rarely been attempted,
and most studies have been in tissue culture. Exceptions have been for two mouse

7

viruses, murine cytomegalovirus (MCMV) (39)and murine herpesvirus-68 (MHV 68).
MHV68, a γ-herpesvirus, apparently requires immune evasion genes for efficient
establishment of latency (40).
In the case of MCMV, a β-herpesvirus, deletion of multiple MHC class 1
immune evasion genes made surprisingly little difference, with mutant viruses apparently
establishing normal lytic and persistent infection and only showing some changes in
chronic infection of salivary glands (35, 41). As stated before, MCMV has three known
immune evasion genes that interfere with MHC class 1 presentation: m6 restricts MHC
class 1 molecules to the lysosome(42); m152 retains MHC class 1 in the ER-Golgi
intermediate compartment(40); m4 forms complexes with MHC class 1 where together
they are exported to the cellular surface, and remain associated for many hours(43).
Another evasion strategy of m152 is that it downregulates the expression of RAE-1
ligands for the activating receptor, NKG2D. Thereby cells infected with wild type
MCMV expressing m152 have reduced destruction via NK lysis (44).
Several studies have shown that MCMV-specific CD8 T cells are able to kill cells
infected with virus lacking one or more of the three MHC class 1 immune evasion genes.
However, these CD8 T cells are not able to destroy cells infected with wild type MCMV.
An experiment by Pinto et al. (2000)(45) verified that 16 different CD8 peptide driven T
cell lines can kill cells infected with a mutant MCMV lacking all three immune evasion
genes (Δm4+Δm6+ΔM152-MCMV), but can not kill the wild type MCMV infected cells.
However, in vivo studies have shown that there is no significant difference in CD8 T cell
phenotype and response in chronic infection of B6 mice infected with either a wild type
BAC MCMV, Δm152-MCMV or Δm4+Δm6+ΔM152-MCMV(41, 46, 47). BALB/c mice

8

also shared the same CD8 T cell response in chronic infection. However, disrupting
immune evasion genes in MCMV reduced virus titers. Infection of BALB/c mice with
Δm4+Δm6+ΔM152-MCMV had reduced virus titers in the salivary glands compared to
wild type (35). The role of immune evasion genes in alphaherpesviruses has not been
tested in infections of the natural hosts.

Two-Step Recombineering: Construction of ΔUL49.5 FHV-1
The UL49.5 gene shares some of its coding sequence with UL50. Instead of
making a complete UL49.5 knockout, several point mutations outside of UL50 were
introduced into UL49.5. Dr. Roger Maes and Dr. Sheldon Tai have fully sequenced FHV1 and constructed a bacterial artificial chromosome (BAC) clone.
I used the two-step recombineering method to successfully construct a FHV-1
mutant lacking the UL49.5 gene (Δ49.5 FHV-1). Forward and reverse primers are used
in PCR to make the product used in the homologous recombination with the FHV-1
BAC. The DNA template used is a pEP-KansS plasmid, which contains the kanamycinresistance gene. Next, the PCR product is electroporated into SW105 E. coli that were
transformed with FHV1- BAC. Bacteria with recombined BACs were positively selected
on agar plates containing kanamycin. PCR was also used to screen BACs. A second
recombination step is needed to remove the kanamycin-resistance gene, as well as the
duplicated mutation site. Cells are transformed with pBAD-I-SceI. I-SceI expression cuts
and linearizes the FHV-1 BAC. Heat induction of recombination proteins results in a
second recombination event, in which the kanamycin resistance gene and second
mutation site are removed. The SW105 cells now contain the FHV-1 BAC with the
9

UL49.5 mutation. Mutant colonies were screened by antibiotic selection and PCR.
Colonies were grown in liquid culture and mutant FHV-1 UL49.5 BAC were isolated and
purified. Purified BACs were again screened by PCR and Nae1 restriction enzyme
digestion.

10

CHAPTER 2
FELINE HERPESVIRUS 1 UL49.5 IS AN MHC CLASS I IMMUNE EVASION
MOLECULE

11

Feline Herpesvirus 1 UL49.5 is an MHC class I immune evasion molecule
Jerome Moulden II, Roger Maes, Sheldon Tsai, Cari Hearn, and Ian York
Department of Microbiology and Molecular Genetics, College of Veterinary Medicine,
Michigan State University, East Lansing, MI 48824, USA

12

Herpesviruses are large DNA viruses that typically establish a long-term latent infection.
They are a widespread and ancient family of viruses that infect virtually all vertebrates,
and at least one invertebrate {Davison et al., 2005, J Gen Virol, 86, 41-53}. Since
herpesviruses generally speciate along with their hosts, this distribution implies that the
common ancestor of herpesviruses was present about 1 billion years ago {Davison, 2002,
Virus Res, 82, 127-32}.

As well as structural characteristics and the ability to establish latency, another common
factor among those herpesviruses that have been examined to date is the ability to block
class I major histocompatibility complex (MHC class I) presentation of antigens
(reviewed in {York, 1996, Chem. Biol., 3, 331-5}{Hansen and Bouvier, 2009, Nat Rev
Immunol, 9, 503-13}{Griffin et al., 2010, Vet Microbiol}). MHC class I is the ligand for
cytotoxic T lymphocyte (CTL) binding, and allows CTLs to recognize and eliminate cells
containing intracellular pathogens, such as viruses. CTLs specifically recognize a small
peptide (usually 8-10 amino acids in length) that is associated with the MHC class I
complex at the cell surface.

This peptide is generated by proteolysis within the cytosol, usually by the proteasome
(reviewed in {Rock et al., 2002, Adv Immunol, 80, 1-70}{Rock et al., 2010, J Immunol,
184, 9-15}). Peptides produced in the cytosol are usually degraded further, to amino
acids, but a small fraction of peptides escape destruction and are transported into the
endoplasmic reticulum (ER) by the transporter associated with antigen presentation
(TAP). In the ER, newly synthesized MHC class I heavy chain and β2-microglobulin (β2-

13

m) interact with chaperones and with TAP, and are retained within the ER until peptide is
added to the complex. The mature trimeric complex is then released from the ER and is
allowed to reach the cell surface (reviewed in {Scholz and Tampe, 2009, Biol Chem, 390,
783-94}{Rock et al., 2010, J Immunol, 184, 9-15}.

Feline herpesvirus1 (FHV-1), a ubiquitous pathogen of domestic cats {Gaskell et al.,
2007, Vet Res, 38, 337-54}, is a member of the Vavicellovirus genus within the
Alphaherpvirinae subfamily {Davison et al., 2009, Arch Virol, 154, 171-7}. Acute
infection with FHV-1 can cause an upper respiratory and conjunctival infection (feline
viral rhinotracheitis). Acute infection is generally followed by a lifelong latent infection
in trigeminal ganglia, from which the virus intermittently reactivates and can be
transmitted to naive cats {Gaskell et al., 2007, Vet Res, 38, 337-54}{Gaskell and
Willoughby, 1999, Vet Microbiol, 69, 73-88}{Binns et al., 2000, J Feline Med Surg S, 2,
123-33}. Vaccination against FHV-1 is effective in preventing disease {Gore et al.,
2006, Vet Ther S, 7, 213-22}, but does not prevent infection, reactivation, or shedding
{Coutts et al., 1994, Vet Rec S, 135, 555-6}{Sussman et al., 1997, Virology S, 228, 37982}{Scott and Geissinger, 1999, Am J Vet Res S, 60, 652-8}{Gaskell et al., 2007, Vet
Res, 38, 337-54}{Maggs, 2005, Clin Tech Small Anim Pract S, 20, 94-101}. As with
immunity following natural infection, vaccine-induced immunity is relatively short-lived
{Coyne et al., 2001, Vet Rec S, 149, 545-8}{Mouzin et al., 2004, J Am Vet Med Assoc
S, 224, 61-6}.

14

UL49.5 is a gene that is present in many members of the herpesvirus family. A subset of
herpesviruses, comprising some, but not all, members of the Varicellovirus genus, use
UL49.5 as an MHC class I immune evasion gene {Koppers-Lalic et al., 2005, Proc Natl
Acad Sci U S A, 102, 5144-9; Koppers-Lalic et al., 2008, PLoS Pathog, 4, e1000080}.
Here we demonstrate that the UL49.5 protein from FHV1 is an immune evasion molecule
that acts by blocking TAP.

Methods and Materials
DNA and cloning. FHV-1 UL49.5 was cloned from a bacterial artificial chromosome
(BAC) containing the full-length FHV-1 genome using the following primers, which also
contain a 5’ EcoRI and a 3’ XbaI site for cloning purposes: 5’cggggtaccccgTCCACGCCTCTGAAGTCTTT-3’ and 5’gctctagagcCCACTAATCCCGGGTCTTTT-3’. Following amplification the gene was
cloned into pTracerCMV2.

For making a mutant version of FHV-1 UL49.5, we used the QuickChange II XL SiteDirected Mutagenesis Kit using primers 5' - CAA AAT CTT CCG CGT TGC GGG
CCG GCT AAA TCG CTG TAG TAG AAG ACA T - 3' and 5' - ATG TCT TCT ACT
ACA GCG ATT TAG CCG GCC CGC AAC GCG GAA GAT TTT G - 3'. The mutant
UL49.5 was cloned into pZero and then into pTracerCMV2.

Plasmids expressing precursors of the immunodominant H2-Kb-restricted peptide
SIINFEKL (S8L) have been previously described: Full-length ovalbumin in

15

pTracerCMV2 {York et al., 2005, J Immunol, 174, 6839-46}, cytosolic S8L expressed as
a ubiquitin fusion protein {York et al., 2002, Nat Immunol, 3, 1177-84.}, and S8L
targeted to the ER with a signal sequence ({York et al., 2002, Nat Immunol, 3, 117784.}. Plasmids expressing H-2Kb (as a single-chain fusion protein, fused to mouse b2microglobulin by a flexible linker) and HLA-A3 (expressed as a single-chain fusion
protein with human b2-m) have been previously described {York et al., 2005, J Immunol,
174, 6839-46}.

FHV-1 mutagenesis. We constructed a mutant FHV-1 virus in which UL49.5 was
disrupted. Since UL49.5 partially overlaps UL50, rather than delete the gene, we
introduced a stop codon UAG 69 base pairs from the start of UL49.5 in a region that does
not overlap other genes (The mutant is 23 amino acids; the wild-type is 95 amino acids).
A UL49-5-disrupted bacterial artificial chromosome (BAC) was constructed using a twostep recombineering approach as described {Copeland et al., 2001, Nat Rev Genet, 2,
769-79; Testa et al., 2003, Nat Biotechnol, 21, 443-7}. Briefly, a kanamycin resistance
cassette flanked by the mutant sequence was constructed by PCR using the following
primers: 5’-TTATCCGTAA CATCAGTGCT GGTTATCCTA TTGGTCGCCA
TGTCTTCTAC TACAGCGATT tAGccGgCCC GCAACGCGGA AGATTTTGAG
AGTATGG AGGATGACGACGATAAGTAGGG‐3 and 5’- ACGAGGCGCT
CCAAAATTGC TTTAGCCGCT CCATACTCTC AAAATCTTCC GCGTTGCGGG
cCggCTaAAT CGCTGTAGTA GAAGACATGG CGACCAA
CAACCAATTAACCAATTCTGATTAG‐3 (the introduced mutations that do not match
the wild-type sequence are shown in lower-case). This cassette was transfected into

16

E.coil SW105 containing the FHV1 genome in a BAC, and the bacteria were shifted to
the permissive temperature for recombination. Kanamycin-resistant colonies were
screened by PCR for the presence of the mutant sequence. Positive colonies were
transfected with the plasmid pBAD-I-SceI and shifted to the permissive temperature for
recombination in order to remove the kanamycin resistance gene and kanamycinsensitive colonies were screened for the mutation using PCR, sequencing, and restriction
digests.

A BAC containing the mutant UL49.5 sequence was transfected into CRFK cells for
virus rescue. PCR was performed using the primers 5’TCTTCTACTACAGCGATTTAGCC-‘3 and 3’-GGTAAGCAGCGAACTTCGAC-‘5 to

amplify UL49.5 and its flanking region, and the products were sequenced to confirm the
presence of the mutation.

Cells, virus, and transfections. Hela-Kb (Hela cells, stably expressing the mouse MHC
class I allele H-2Kb) have been previously described {York et al., 2002, Nat Immunol, 3,
1177-84.}

FHV-1 was obtained from Roger Maes. It was grown and titrated on CRFK cells. CRFK
cells were transfected using FuGene according to the manufacturer’s protocol. Hela-Kb
cells were transfected using the Hela-MONSTER reagent according to the manufacturer’s
protocol.

17

Antibodies and flow cytometry. Anti-feline MHC class I monoclonal antibody CF298
was purchased from Veterinary Medical Research & Development, Inc. Anti-human
HLA-A, B, C (PA2.6) {Parham and Bodmer, 1978, Nature, 276, 397-9} and anti-H-2Kb
(B8.24.3) {Kohler. G. et al., 1981, Immune Syst., 2, 202} were obtained from the ATCC.
Anti-influenza hemagglutinin H36.5-4.2 {Caton et al., 1982, Cell, 31, 417-27} was
kindly provided by Dr W. Gerhard (The Wistar Institute, University of Pennsylvania).
The anti-H-2Kb/SIINFEKL antibody 25.D1.16 has been previously described {Porgador
et al., 1997, Immunity, 6, 715-726}. Secondary antibodies tagged with Cy5 were
purchased from Jackson Immunoresearch.
Results
FHV-1 blocks MHC class I antigen presentation. CRFK cells were infected with FHV-1
at a multiplicity of infection (MOI) of 7.5. In some experiments, CRFK cells were
transiently transfected with mouse MHC class I (H-2Kb) or human MHC class I (HLAA3). Infection with FHV-1 led to a marked reduction in MHC class I surface expression,
both of endogenous (feline) MHC class I and of exogenous (transiently-transfected
mouse and human) MHC class I alleles.

Epitopes for the feline MHC class I alleles present on CRFK cells are not known. H-2Kb
is known to bind strongly to the immunodominant epitope from chicken ovalbumin,
SIINFEKL (S8L). Co-transfection of H-2Kb with S8L targeted to the ER via a signal
sequence (thus bypassing TAP) completely restored surface expression of H-2Kb on
FHV-1-infected cells, compared to cells in which empty vector was co-transfected with

18

H-2Kb. This suggests that FHV-1 does not destroy MHC class I, or prevent its
transcription or translation, but rather prevents peptides from entering the ER.

FHV-1 UL49.5 blocks antigen presentation. Because several varicelloviruses closely
related to FHV-1 use UL49.5 as an MHC class I immune evasion molecule {KoppersLalic et al., 2005, Proc Natl Acad Sci U S A, 102, 5144-9; Koppers-Lalic et al., 2008,
PLoS Pathog, 4, e1000080}, we used PCR to clone UL49.5 from the FHV-1 genomic
BAC and subcloned the gene into pTracerCMV2. We transfected feline (CRFK) and
human (Hela-Kb) cells with the plasmid. Two days after transfection, cells were stained
for surface MHC class I and analyzed by flow cytometry, gating on GFP (expressed by
the plasmid) to limit analysis to transfected cells. Cells expressing UL49.5 showed a
marked reduction in MHC class I.

Hela-Kb cells transfected with full-length chicken ovalbumin normally generate the H2Kb-binding peptide SIINFEKL in the cytosol and transport this peptide into the ER via
TAP, leading to presentation of H2-Kb/SIINFEKL complexes at the cell surface. H2Kb/SIINFEKL complexes can be quantified with the T cell receptor-like antibody
25.D1.16 {Porgador et al., 1997, Immunity, 6, 715-726}. Hela-Kb cells transfected with
full-length ovalbumin, and co-transfected with FHV-1 UL49.5, showed a marked
reduction in cell-surface H-2Kb/SIINFEKL complexes. Similarly, generation of H2Kb/SIINFEKL complexes from cytosolic SIINFEKL (expressed as a ubiquitin fusion
protein, from which ubiquitin C-terminal hydrolases efficiently remove the peptide
moiety to generate processed, cytosolic SIINFEKL) was markedly reduced by co-

19

transfection of FHV-1 UL49.5, demonstrating that bypassing processing in the cytosol
does not rescue the block in antigen presentation imposed by FHV-1.

In contrast, co-transfection with SIINFEKL targeted to the ER by a signal sequence
(bypassing the requirement for TAP) completely restored surface expression of H2Kb/SIINFEKL complexes even in the presence of FHV-1 UL49.5. (In fact, surface
expression of H-2Kb/SIINFEKL complexes were significantly and consistently increased
in the presence of FHV-1 UL49.5, probably because UL49.5 eliminated any competing
peptides from the ER.)

These observations demonstrate that FHV-1 UL49.5 is a specific MHC class I immune
evasion gene, and strongly suggest that (like UL49.5 from related varicelloviruses) FHV1 UL49.5 acts by blocking TAP-mediated peptide transport.

FHV1 lacking UL49.5 does not inhibit MHC class I expression. We constructed a
mutant FHV-1 lacking UL49.5. Since UL49.5 overlaps UL50, we used point mutations
to insert stop codons in UL49.5 outside the coding region of UL50. The mutant UL49.5,
expressed from a transfected plasmid, had no effect on surface MHC class I in transfected
Hela-Kb cells. We used a two-step recombineering approach {Copeland et al., 2001, Nat
Rev Genet, 2, 769-79; Testa et al., 2003, Nat Biotechnol, 21, 443-7} to introduce this
mutation into the FHV-1 genomic BAC. The presence of the mutation in the BAC was
confirmed by PCR screening and by restriction enzyme digestion, which demonstrated
that a new NaeI site was introduced as expected. The mutant and wild-type BACs were

20

transfected into CRFK cells and virus was rescued from the transfected cells. Sequencing
of the UL49.5 region from the genome of these viruses confirmed that the mutation was
present.

CRFK infected with mutant FHV-1 showed similar plaque size and reached similar titers
as wild type virus, but expression of MHC class I at the cell surface was not reduced,
demonstrating that UL49.5 is the sole FHV-1 gene that blocks MHC class I antigen
presentation.

We conclude that FHV-1 UL49.5 is a specific immune evasion molecule that prevents
MHC class I antigen presentation by blocking ER transport of peptides, probably by
inhibiting TAP.

Discussion
The ability to block MHC class I antigen presentation is found in many virus families,
and is especially common (if not universal) among the herpesviruses. Herpesviruses of
the α, β, and γ families all block MHC class I antigen presentation, using a wide range of
immune evasion genes and targeting virtually every stage of the antigen processing
pathway. However, the functional significance of MHC class I immune evasion in viral
pathogenesis is not well understood, mainly because there are few authentic laboratory
animal models of herpesvirus infection. The demonstration here that the ubiquitous virus
of domestic cats, feline herpesvirus 1, encodes an immune evasion gene, UL49.5, may

21

offer a small-animal model to examine the role of MHC class I immune evasion in that
pathogenesis of an α-herpesvirus.

Herpesviruses tend to be highly species-specific, and while there are β and γherpesviruses of mice (MCMV and Mus musculus rhadinovirus 1 (MmusRHV1) {Ehlers
et al., 2007, J Virol, 81, 8091-100}, respectively), no rodent-specific a-herpesviruses are
known {Ehlers et al., 2007, J Virol, 81, 8091-100}. MCMV lacking all three known
MHC class I immune evasion genes is able to establish acute and latent infection of mice
almost normally {Gold et al., 2004, J Immunol, 172, 6944-53}{Pinto and Hill, 2005,
Viral Immunol, 18, 434-44} (with the exception of reaching lower titers in salivary
glands {Lu et al., 2006, J Virol, 80, 4200-2}) and the immune response to the mutant
virus is apparently identical to that against the wild-type virus {Gold et al., 2002, J
Immunol, 169, 359-65}{Gold et al., 2004, J Immunol, 172, 6944-53}{Munks et al., 2007,
J Immunol, 178, 7235-41}.

Although the γ-herpesvirus MHV68 is not a natural pathogen of laboratory mice (Mus
musculus), the infection does seem to be fairly similar to that in the natural host, wood
mice (Apodemus sylvaticus) {Hughes et al., 2010, J Virol, 84, 3949-61}. In laboratory
mice, MHV68 MHC class I immune evasion does not affect acute infection, but is
apparently important for maintenance of latent infection {Stevenson et al., 2002, Nat
Immunol, 3, 733-40}{Bennett et al., 2005, PLoS Biol, 3, e120}.

22

These findings, limited though they are, suggest that different herpesvirus families may
use MHC class I immune evasion at different stages of their life cycle. The role of MHC
class I immune evasion by a-herpesviruses in pathogenesis of a natural infection remains
unclear.

Several (though not all) members of the varicellovirus family of α-herpesviruses
(pseudorabies virus, bovine herpesvirus 1, and equine herpesviruses 1 and 4) use the
molecule UL49.5 to block MHC class I antigen presentation by inhibiting TAP function
{Koppers-Lalic et al., 2005, Proc Natl Acad Sci U S A, 102, 5144-9; Koppers-Lalic et al.,
2008, PLoS Pathog, 4, e1000080}. However, infection of cattle, horses, or pigs with
UL49.5-deleted versions of their respective viruses has not been described.

Here, we have shown that UL49.5 of the feline α-herpesvirus FHV-1 blocks MHC class I
expression. This blockade is rescued by ER-targeted peptides, strongly suggesting that
FHV1 UL49.5 (like other immune evasion UL49.5 molecules {Koppers-Lalic et al.,
2008, PLoS Pathog, 4, e1000080}) acts by blocking feline TAP. UL49.5 is expressed in
many herpesviruses, and in most it does not act as an immune evasion molecule
{Koppers-Lalic et al., 2005, Proc Natl Acad Sci U S A, 102, 5144-9}. The molecular
adaptations that allow some UL49.5 proteins to block TAP are not known. Howerver, it
is reported that the N-terminal region has two residues (9RXE11) (BHV-1 RRE; SHV-1
and EHV-1 REE) required for TAP inhibition. The last two C-terminal residues RG in
conjunction with the N-terminal residues target TAP for proteasomal degradation. FHV-1
UL49.5 N-terminus has SME residues, and PH as the last two C-terminal residues.

23

FHV-1 is a ubiquitous varicellovirus of domestic cats. It usually infects kittens {Binns et
al., 2000, J Feline Med Surg S, 2, 123-33}, in some cases causing upper respiratory and
ocular disease during acute infection {Stiles, 2003, Clin Tech Small Anim Pract S, 18,
178-85}. Like human herpes simplex virus 1, FHV-1 rapidly establishes a lifelong latent
infection in trigeminal ganglia, from which the virus reactivates at intervals and is shed
into the environment, potentially infecting new hosts {Stiles, 2003, Clin Tech Small
Anim Pract S, 18, 178-85} {Gaskell et al., 2007, Vet Res, 38, 337-54}{Gaskell and
Willoughby, 1999, Vet Microbiol, 69, 73-88}{Binns et al., 2000, J Feline Med Surg S, 2,
123-33}. Cats are therefore a potential model for understanding the role of MHC class I
immune evasion in natural infection.
Domestic cats are usually vaccinated against FHV-1. The vaccine is effective in
preventing disease {Gore et al., 2006, Vet Ther S, 7, 213-22}, but does not prevent
infection, reactivation, or shedding {Coutts et al., 1994, Vet Rec S, 135, 555-6}{Sussman
et al., 1997, Virology S, 228, 379-82}{Scott and Geissinger, 1999, Am J Vet Res S, 60,
652-8}{Gaskell et al., 2007, Vet Res, 38, 337-54}{Maggs, 2005, Clin Tech Small Anim
Pract S, 20, 94-101}. As with immunity following natural infection, vaccine-induced
immunity is relatively short-lived {Coyne et al., 2001, Vet Rec S, 149, 545-8}{Mouzin et
al., 2004, J Am Vet Med Assoc S, 224, 61-6}. It is of interest to learn whether a virus
lacking MHC class I immune evasion would induce a more potent immune response, or
whether other mechanisms (such as cross-presentation) compensate for immune
evasion{Snyder et al., 2010, PLoS One, 5, e9681} and allow the development of an
effective immune response even in the presence of such gene products.

24

CHAPTER 3
FINAL DISCUSSION AND CONCLUSION

25

There is the possibility that FHV-1 has other immune evasion properties that not
only prevent antigen presentation, but also evade other immune responses. Other genes
can be identified by measuring the immune response in vitro and with in vivo experiment.
I can observe many cell types and their activation levels (i.e., cytokines chemokines,
transcription factors, intracellular and cell surface receptor). Many genes can be observed
using microarray, or flow cytometry for analysis of protein levels. The disruption of
UL49.5 alone may not be effective as a vaccine if FHV-1 has other genes that evade
immune responses. These are potential genes that I can mutate and evaluate their
disruption in in vitro and in vivo experiments. If other evasion genes are found, several
FHV-1 mutants can be generated with various combinations of mutant evasion genes.

UL49.5 has not been mutated in feline herpesvirus-1. UL49.5 maybe an essential
gene for the virus. Mutations in the gene may inhibit viral replication or cell-to-cell
spread. In EHV-1, deletion of gM/gE and gI (Rudolph et al., 2002), and also HΔgK
(Neubauer and Osterrieder, 2004) deletions, led to dramatic inhibition of cell-to-cell
spread. There is also great reduction in viral spread when UL49.5 and UL10 were deleted
from Marek’s disease virus (MDV-1) (Tischer et al., 2002). This may not allow the host
to mount a strong cytotoxic T cell response along with other immune responses, which
may interfer with effective immunity toward the wild-type virus. This can be tested with
in vivo experiments comparing wild-type and mutant FHV-1 virus titers and cell viability
kinetics. UL49.5 may not be a potential candidate target gene if shown to be essential for
viral replication.

26

There is the possibility that the mutant virus will increase disease. Adenovirus
encodes the E3 region that contains the immune evasion gene E3gp19k. E3gp19k
similarly to UL49.5 reduces MHC class 1 antigen presentation (Burgert and Kvist, 1987).
A cotton rat model of adenovirus pneumonia was used to study the function of the E3
region and the evasion gene. Virus with large deletions in E3 (H2d180 1747-268bp) lost
their MHC class I immune evasion function and were able to replicate like the wild-type
virus (Ginsberg et al., 1989). However, there were substantial lymphocyte and
macrophage inflammatory responses in the lung (Ginsberg et al., 1989). Other
adenoviruses, E3 mutants, show a correlation to increased lung inflammation and
restoration of antigen presentation. It is possible that infected cells are presenting some
viral antigen and massively activating inflammatory cells, thereby releasing large
amounts of pro-inflammatory cytokine. Even though the E3 region of adenovirus is
termed “non-essential”, it plays an important role in an evolutionary balance between
virus and host.
Though UL49.5 mutants will only have a few point mutations and not a complete
knock out, I presume there will be restored antigen presentation. It is possible this
mutation could have similar inflammatory effects as adenovirus E3 deletion mutants.
It maybe that FHV-1 has the ability to “out run” CTL control and quickly infect
neurons, becoming latent. However, it is not known if IFN-secreting T cells inhibit
reactivation in either MCMV or FHV-1 infection. Those subset of CD8+ T cells may be
one of many factors for control of viral latency, reactivation and shedding.
In conclusion, these experiments will give greater insight into viral mechanisms
of immune evasion by inhibition of antigen presentation. Also, it will provide better

27

understanding of viral pathology in natural hosts. In addition to being a clinically
important virus of cats, FHV-1 is a useful model for studying the role of immune evasion
genes in the pathogenesis of α-herpesvirus infections in humans (e.g., varicella-zoster
virus) and large animals (e.g., pseudorabies virus). The availability of a small-animal
model for studying α-herpesvirus immune evasion genes will contribute to a better
understanding of viral pathogenesis. This knowledge will aid in the production of better
vaccines for animals, leading toward potential application in humans.

28

References
1.

Davison, A. J., Eberle, R., Ehlers, B., Hayward, G. S., McGeoch, D. J., Minson, A.
C., Pellett, P. E., Roizman, B., Studdert, M. J. and Thiry, E. (2009) Arch Virol 154,
171-177

2.

Gaskell, R. and Willoughby, K. (1999) Vet Microbiol 69, 73-88

3.

Binns, S. H., Dawson, S., Speakman, A. J., Cuevas, L. E., Hart, C. A., Gaskell, C.
J., Morgan, K. L. and Gaskell, R. M. (2000) J Feline Med Surg S 2, 123-133

4.

Stiles, J. and Pogranichniy, R. (2007) J Feline Med Surg

5.

Johnson, R. P. and Povey, R. C. (1985) J Am Vet Med Assoc 186, 149-152

6.

Dawson, S., Willoughby, K., Gaskell, R. M., Wood, G. and Chalmers, W. S. (2001)
J Feline Med Surg S 3, 17-22

7.

Verweij, M. C., Koppers-Lalic, D., Loch, S., Klauschies, F., de la Salle, H.,
Quinten, E., Lehner, P. J., Mulder, A., Knittler, M. R., Tampe, R., Koch, J.,
Ressing, M. E. and Wiertz, E. J. (2008) J Immunol 181, 4894-4907

8.

Holland, J. L., Outerbridge, C. A., Affolter, V. K. and Maggs, D. J. (2006) J Am Vet
Med Assoc S 229, 1442-1446

9.

Daniels, M. J., Golder, M. C., Jarrett, O. and MacDonald, D. W. (1999) J Wildl Dis
35, 121-124

10.

Crandell, R. A. (1973) Adv Vet Sci Comp Med 17, 201-224

11.

Stiles, J. (2003) Clin Tech Small Anim Pract S 18, 178-185

12.

Maggs, D. J., Lappin, M. R., Reif, J. S., Collins, J. K., Carman, J., Dawson, D. A.
and Bruns, C. (1999) J Am Vet Med Assoc S 214, 502-507

13.

Andrew, S. E. (2001) J Feline Med Surg S 3, 9-16

14.

Gaskell, R. M. and Povey, R. C. (1982) Vet Rec 111, 359-362

15.

Sussman, M. D., Maes, R. K. and Kruger, J. M. (1997) Virology S 228, 379-382

16.

Deim, Z., Palmai, N. and Cserni, G. (2008) Acta Vet Hung 56, 111-116

29

References
17.

Orr, C. M., Gaskell, C. J. and Gaskell, R. M. (1978) Vet Rec 103, 200-202

18.

Scott, F. W. (1977) Am J Vet Res 38, 229-234

19.

Maeda, K., Ono, M., Kawaguchi, Y., Niikura, M., Okazaki, K., Yokoyama, N.,
Tokiyoshi, Y., Tohya, Y. and Mikami, T. (1996) Virus Res 46, 75-80

20.

Spatz, S. J., Rota, P. A. and Maes, R. K. (1994) J Gen Virol 75, 1235-1244

21.

Mishima, M., Xuan, X., Nishikawa, Y., Makala, L., Yokoyama, N., Nagasawa, H.
and Mikami, T. (2001) Mol Biochem Parasitol 117, 103-106

22.

Willemse, M. J., Chalmers, W. S., Cronenberg, A. M., Pfundt, R., Strijdveen, I. G.
and Sondermeijer, P. J. (1994) J Gen Virol 75, 3107-3116

23.

Sussman, M. D., Maes, R. K., Kruger, J. M., Spatz, S. J. and Venta, P. J. (1995)
Virology 214, 12-20

24.

Nasisse, M. P., Dorman, D. C., Jamison, K. C., Weigler, B. J., Hawkins, E. C. and
Stevens, J. B. (1997) Am J Vet Res 58, 1141-1144

25.

Owens, J. G., Nasisse, M. P., Tadepalli, S. M. and Dorman, D. C. (1996) J Vet
Pharmacol Ther 19, 488-490

26.

Sandmeyer, L. S., Keller, C. B. and Bienzle, D. (2005) Am J Vet Res 66, 210-216

27.

Gaskell, R., Dawson, S., Radford, A. and Thiry, E. (2007) Vet Res 38, 337-354

28.

Rock, K., York, I. and Goldberg, A. (2004) Nature immunology 5, 670-677

29.

Cullen, S. P. and Martin, S. J. (2008) Cell Death Differ 15, 251-262

30.

Liu, T., Tang, Q. and Hendricks, R. L. (1996) J Virol 70, 264-271

31.

Halford, W. P., Gebhardt, B. M. and Carr, D. J. (1996) J Immunol 157, 3542-3549

32.

Lin, R., Noyce, R. S., Collins, S. E., Everett, R. D. and Mossman, K. L. (2004) J
Virol 78, 1675-1684

33.

Mandal, M., Bandyopadhyay, D., Goepfert, T. M. and Kumar, R. (1998) Oncogene
16, 217-225

34.

Johnson, W. E. and Desrosiers, R. C. (2002) Annu Rev Med 53, 499-518
30

References
35.

Lu, X., Pinto, A. K., Kelly, A. M., Cho, K. S. and Hill, A. B. (2006) J Virol 80,
4200-4202

36.

York, I., Roop, C., Andrews, D., Riddell, S., Graham, F. and Johnson, D. (1994)
Cell 77, 525-535
Beier, D. C., Cox, J. H., Vining, D. R., Cresswell, P. and Engelhard, V. H. (1994) J.
Immunol. 152, 3862-3872

37.
38.

Koppers-Lalic, D., Reits, E. A., Ressing, M. E., Lipinska, A. D., Abele, R., Koch,
J., Marcondes Rezende, M., Admiraal, P., van Leeuwen, D., BienkowskaSzewczyk, K., Mettenleiter, T. C., Rijsewijk, F. A., Tampe, R., Neefjes, J. and
Wiertz, E. J. (2005) Proc Natl Acad Sci U S A 102, 5144-5149

39.

Doom, C. M. and Hill, A. B. (2008) Med Microbiol Immunol 197, 191-204

40.

Ziegler, H., Thäle, R., Lucin, P., Muranyi, W., Flohr, T., Hengel, H., Farrell, H.,
Rawlinson, W. and Koszinowski, U. H. (1997) Immunity 6, 57-66

41.

Munks, M. W., Pinto, A. K., Doom, C. M. and Hill, A. B. (2007) J Immunol 178,
7235-7241

42.

Reusch, U., Muranyi, W., Lucin, P., Burgert, H. G., Hengel, H. and Koszinowski,
U. H. (1999) EMBO J 18, 1081-1091

43.

Wagner, M., Gutermann, A., Podlech, J., Reddehase, M. J. and Koszinowski, U. H.
(2002) J Exp Med 196, 805-816

44.

Krmpotic, A., Busch, D. H., Bubic, I., Gebhardt, F., Hengel, H., Hasan, M., Scalzo,
A. A., Koszinowski, U. H. and Jonjic, S. (2002) Nat Immunol 3, 529-535

45.

Pinto, A. K., Munks, M. W., Koszinowski, U. H. and Hill, A. B. (2006) J Immunol
177, 3225-3234

46.

Gold, M. C., Munks, M. W., Wagner, M., McMahon, C. W., Kelly, A., Kavanagh,
D. G., Slifka, M. K., Koszinowski, U. H., Raulet, D. H. and Hill, A. B. (2004) J
Immunol 172, 6944-6953

47.

Gold, M. C., Munks, M. W., Wagner, M., Koszinowski, U. H., Hill, A. B. and
Fling, S. P. (2002) J Immunol 169, 359-365

31