ASSESSING DROUGHT TOLERANCE IN CBF1 TRANSGENIC CULTIVATED
POTATO LINES (SOLANUM TUBEROSUM); AND A SOCIOLOGICAL SURVEY OF
COLLEGE STUDENTS’ ATTITUDES TOWARDS GENETICALLY MODIFIED
POTATOES

By
Nicole Laurel Nichol

A THESIS
Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of
MASTER OF SCIENCE
Plant Breeding, Genetics and Biotechnology - Crop and Soil
2011

ABSTRACT
ASSESSING DROUGHT TOLERANCE IN CBF1 TRANSGENIC CULTIVATED POTATO
LINES (S. TUBEROSUM); AND A SOCIOLOGICAL SURVEY OF COLLEGE STUDENTS’
ATTITUDES TOWARDS GENETICALLY MODIFIED POTATOES
By
Nicole Laurel Nichol
Drought prone areas have been increasing around the world, and due to climate change, it
is expected that these areas will only further increase and become more severe. Therefore, the
need for drought tolerant crops is imperative. The potato (Solanum tuberosum) is the fourth
most important food crop in the world, and increasing this crop’s ability to tolerate drought stress
could aid in feeding our growing global population. Transforming the CBF1 gene into plants has
been shown to increase the plants’ freezing, drought and saline stress tolerance. CBF1 genes
from Arabidopsis thaliana, Solanum commersonii and Solanum tuberosum have been
transformed into cultivated potato lines under the stress inducible promoter COR15a. The
AtCBF1 lines were evaluated using an electrolyte leakage assay and field trials. Two of the
lines, E74.8 and E74.9 showed the lowest percent of electrolyte leakage and were able to
maintain a yield similar to the wild type control under drought stressed field conditions. The
ScCBF1 and StCBF1 lines were evaluated using an in vitro osmotic stress assay. Two of the
ScCBF1 lines and five of the StCBF1 lines were able to outperform the wild type controls.
A questionnaire was developed to study the effect of information on college students’
attitudes towards genetically modified potatoes. It was found that those whom received the
information were more approving of GM potatoes for human consumption, and felt they were
safer, than those in the control group. However, the information had no effect on their
willingness to consume foods with GM potato ingredients.

ACKNOWLEDGMENTS

I would like to start off by thanking Dr. Dave Douches, my major professor, for all of his
time and energy in molding me into the potato scientist that I am today. He gave me such a
breadth of opportunities and experiences, without which, I doubt I would be where I am today.
I would also like to thank all of the other spuds, both past and present, in the potato
program: Kelly, Dan and Kim for all of your help in the lab; Joe, Jay, Devon, Greg and Matt for
all of your help with my field trials and Joe for your statistical knowledge; all of the
undergraduate students for your assistance in both the field and lab; and Donna for all of your
assistance in keeping my lines alive in tissue culture and all the many other acts of your kind
heart.
A big thanks goes out to Drs. Mike Thomashow, Sarah Gilmour and Marcela Carvallo for
all of their help, resources, and use of equipment over the years.
I would also like to thank Dr. Ryan Warner, along with Dr. Thomashow and Dr. Craig
Harris, for serving on my committee with patience. A special thanks to Dr. Harris for his time in
helping me put together and administer the GM potato questionnaire, and the free coffee.
Also thanks to Dr. Rebecca Grumet, and the entire faculty of the PBGB program, for
offering me the National Needs Fellowship and giving me a worldview of the issues around
biotechnology. I would also like to thank Patrick Bigelow for his companionship throughout the
fellowship.
Another big thanks to all of the other PBGB students (and post docs) for providing
friendship, camaraderie, an open ear and help when needed.

iii

Thank you to Dr. Cori Fata-Hartley for hiring me as a grad TA in Lyman Briggs and for
all of the enriching experiences that provided. Also thanks to Drs. Doug Luckie and Jim Smith,
and David Malakauskas for their time while I was in Briggs.
Finally, the biggest thanks goes out to my family who has supported me through the
many years I have spent in graduate school. This thesis is dedicated to my husband Chris for his
many hours in helping me by either entering data, watering my plants or watching our son Jack
so I could get my work done.

iv

TABLE OF CONTENTS

LIST OF TABLES………………………………………………………………………………..vi
LIST OF FIGURES…………………………………………………………………………...…vii
CHAPTER 1
LITERATURE REVIEW…………………………………………………………………………1
Literature Cited…………………………………………………………………………..11
CHAPTER 2
EVALUATION OF AtCBF1 TRANSGENIC POTATOES……………………………………..17
Research Objectives……………………………………………………………………...17
Materials and Methods…………………………………………………………………...17
Results……………………………………………………………………………………25
Discussion………………………………………………………………………………..38
Literature Cited…………………………………………………………………………..44
CHAPTER 3
EVALUATION OF StCBF1 AND ScCBF1 TRANSGENIC POTATOES……………………..46
Research Objectives……………………………………………………………………...46
Materials and Methods…………………………………………………………………...46
Results……………………………………………………………………………...…….53
Discussion………………………………………………………………………………..60
Literature Cited…………………………………………………………………………..63
CHAPTER 4
A STUDY OF THE EFFECT OF INFORMATION ON COLLEGE STUDENTS’ ATTITUDES
TOWARDS GENETICALLY MODIFIED POTATOES……………………………………….65
Introduction and Literature Review……………………………………………………...65
Materials and Methods……....…………………………………………………………...70
Results……………………………………………………………………………………72
Discussion………………………………………………………………………………..79
Literature Cited…………………………………………………………………………..82
APPENDIX
QUESTIONNAIRE AND STUDENT RESPONSES…………………………………………...86

v

LIST OF TABLES

Table 2.1 Transformed lines from MSU and OSU……………………………………………...18
Table 2.2 OSU and MSU’s designation of OSU AtCBF1 lines………………………………..22
Table 2.3 Primer sequences used in RT-PCR analysis of AtCBF1 transgenic lines……………24
Table 2.4 100 cwt./acre ANOVA between the two field locations for each growing season. The
different letters denote statistically significant values within the year ( = 0.05)……………….29
Table 2.5 Specific gravity ANOVA between the two field locations for each growing season.
The different letters denote statistically significant values within the year ( = 0.05)………….30
Table 2.6 2007-2010 CSSF 100 cwt./acres and specific gravity; means with the same letter are
not significantly different ( = 0.05)…………………………………………………………….31
Table 2.7 2007-2010 MRF 100 cwt./acre and specific gravity, means with the same letter are not
significantly different ( = 0.05)………………………………………………………………...31
Table 2.8 2008 and 2009 t-test of sugar analysis; means with the same letter are not significantly
different ( = 0.05)………………………………………………………………………………32
Table 2.9 2008 sugar analysis of tubers; means with the same letter are not significantly different
( = 0.05)………………………………………………………………………………………..32
Table 2.10 2009 sugar analysis of tubers; means with the same letter are not significantly
different ( = 0.05)………………………………………………………………………………32
Table 3.1 PCR positive transformed lines for pSPUD89 and pSPUD90………………………..54
Table 4.1 Distribution of race/ethnicity between the treatment and control groups, and the total
student population at Michigan State University………………………………………………...73
Table 4.2 Average of responses separated out by gender and race-gender……………………...78
Table 4.3 Average of responses separated out by self-declared knowledge of GM crops and
number of college biology courses………………………………………………………………79
Table A.1 Demographic responses to GM Questionnaire……………………………………….94
Table A.2 Means of responses to GM Questionnaire for Treatment and Control Groups. Means
compared by LSD, α = 0.05, * denotes significant difference between the treatment and control
group……………………………………………………………………………………………..95

vi

LIST OF FIGURES

Figure 2.1 Schematic of pSPUD74 construct. The CBF1 gene from Arabidopsis thaliana is
directed by the stress-inducible promoter AtCOR15a.…………………………………………..18
Figure 2.2 Electrolyte Leakage Assay for the MSE lines. Each line was tested twice, once
with no cold treatment and once with a 4°C cold treatment for 24 hrs (labeled Trt) prior to the
experiment. MSE149-5Y is the WT control. All of the temperature treatments were analyzed by
ANOVA using Fishers LSD (=0.05) between the lines within the non-treated and cold treated
experiments. In each of the temperature treatments, none of the non-treated lines were able to
maintain a percent leakage less than 50%. A percent leakage of 50% or more is considered
lethal. At the 0C control treatment; E74.14 was significantly different from E149-5Y. E74.8
was significantly different from all of the lines and had the greatest % leakage. At the -2C
treatment; E74.14 had significantly less ions loss than E74.8 and E149-5Y. At the -2.5C
treatment; E74.14 has significantly less ion loss than all of the other lines. At the -3C treatment;
E74.14 and E74.16 had significantly more ion loss than the other three lines. For the cold treated
lines at the 0C control treatment; E74.16 lost significantly more ions than E149-5Y and E74.8.
E74.16 lost significantly more ions than all of the other four lines. At the -2C treatment; E74.8
and E74.9 showed an increase in freezing tolerance at this temperature having a % leakage less
than 50%. Both lines were significantly different from the other three lines. At the -2.5C
treatment; both the E74.8 and E74.9 were again statistically significant from the other three lines.
However, only E74.9 maintained a % leakage less than 50%. At the -3C treatment; all of the
lines had a % leakage far greater than 50%. E74.8 had a significantly less % leakage than all of
the other lines. E74.14 and E74.16 % leakages were significantly greater than the other three
lines.………………………...……………………………………………………………………27
Figure 2.3 Electrolyte Leakage Assay for Non-Acclimated OSU Lines. All of the
temperature treatments were analyzed by ANOVA using Fishers LSD (=0.05). The different
letters above each column denote statistically different % leakage values. A. 0C control
treatment; OR1.15 had statistically the lowest % leakage compared to the other five lines. B. 2C treatment; all of the lines except OR2.6 had a % leakage less than 50%. C. -2.5C
treatment; only OR1.11 and OR1.15 maintained a % leakage less than 50% and both were
significantly less than the other four lines. D. -3C treatment, all of the lines had a % leakage
greater than 50% and only OR1.11 and OR2.1 were significantly different from each other…..28
Figure 2.4 Total Precipitations at the CSSF. The total amount of precipitation measured at the
CSSF plot during the 125 day growing season (on average mid-May to mid-September). These
conditions are below the standard practice of 20-24 inches of water for potato crops.………….29
Figure 2.5 Reverse Transcriptase PCR from the 2008 field trial. The gene expression of four
different genes was visualized by RT-PCR from RNA isolated from fresh leaf tissue collected in
the field. The lane designations of M1, M2… C1, C2 denote the location from which the sample
was taken from (M = MRF, C =CSSF) and the number signifies the timing of the sampling (1 =
pre-flowering, 2 = flowering, 3 = tuber bulking). The AtCBF1 gene is the transgene in the E74.8
vii

– E74.16 lines and was expressing in all of the samples except E74.9 M3, E74.14 C2, and
E74.16 M3; and was not found in the WT control MSE149-5Y. The DHN10 gene is a stress
induced potato gene and was found to be expressing at slightly varying levels across all the lines.
The S. tuberosum galactinol synthase 3 gene, StGolS3, has also been found to be a stressed
induced gene and downstream of the CBF regulon. It was being expressed in most of the
samples except MSE149-5Y C3, E74.8 C1 and C3, E74.9 C1 and C3. The 18S gene was the
ribosomal control gene used in all of the samples. The positive control for each primer set was
RNA isolated from OR1.11 (35S:AtCBF1) grown in tissue culture and the negative control was
water used in place of cDNA in the reactions……………………………………………………35
Figure 2.6 Reverse Transcriptase PCR from the MSU lines in the 2010 field trial. The gene
expression of four different genes was visualized by RT-PCR from RNA isolated from fresh leaf
tissue collected in the field. The AtCBF1 transgene was expressed in most of the transgenic
samples except E74.9 M1, M2, C2, and E74.14 C2 and all of the WT control lines MSE149-5Y.
The stressed induced DHN10 gene was found to be expressing in most of the samples except
E74.9 M2 and C2, E74.14 C1 and C2, and E74.16 M2 and C2. The other stress induced gene
StGolS3 was expressed in all of the lines at varying degrees. The 18S gene was the ribosomal
control gene used in all of the lines. The positive control for each primer set was RNA isolated
from OR1.11 (35S:AtCBF1) grown in tissue culture and the negative control was water used in
the reactions……………………………………………………………………………………...36
Figure 2.7 Reverse Transcriptase PCR from the OSU lines in the 2010 field trial. The gene
expression of four different genes was visualized by RT-PCR from RNA isolated from fresh leaf
tissue collected in the field. The AtCBF1 transgene was not detectable in the 35S samples
(OR1.11 – OR1.2). AtCBF1 expression was not found in any of the rd29A lines OR2.1 and
OR2.3. The stressed induced DHN10 gene was found to be expressing most of the samples
except OR1.11 M1, C1 and C2, and OR1.2 C2. The other stress induced gene StGolS3 was
expressed in all of the samples at varying degrees except OR2.1 M1. The 18S gene was the
constitutive control gene used in all of the lines. The positive control for each primer set was
RNA isolated from OR1.11 (35S:AtCBF1) grown in tissue culture and the negative control was
water used in place of cDNA in the reactions.…………………………………………………...37

Figure 3.1 Schematic of p SPUD89 and pSPUD90 constructs. A. Contains the CBF1 from S.
commersonii. B. Contains the CBF1 from S. tuberosum. In both constructs the stress-inducible
promoter AtCOR15a directs the genes…………………………………………………………..47
Figure 3.2 Days to rooting of transgenic lines in osmotic in vitro assay. Each of the
Sc/StCBF1 transgenic lines were placed in standard MS media with 3 different concentrations of
agar: 6, 8 and 10 g/L. There were three replications of each line, for each concentration, and the
means and standard errors were calculated for each line. For the majority of the lines there was
no significant difference between the agar concentrations. Des89.32, Des89.45, E89.2B,
Des90.24 and the WT control Desiree took longer to root as the concentration of agar increased
and E90.14 and E90.15 rooted faster in the 8 and 10 g/L than in the 6 g/L concentration……..57

viii

Figure 3.3 Root Length of transgenic lines in osmotic in vitro assay. For the majority of the
lines there was no significant difference between the agar concentrations. Des89.32, Des89.47,
Des89.48, E89.2B, E89.2D, and E90.9’s root lengths significantly decreased as the agar
concentrations increased. Des89.18, Des89.43, Des90.3B, Des90.15, Des90.20, E90.14 and
E90.15’s root lengths significantly increased as the agar concentration increased……………...58

Figure 3.4 Shoot heights of transgenic lines in osmotic in vitro assay. For the majority of the
lines there was no significant difference between the agar concentrations. Des89.32, Des89.47,
Des89.48, E89.2B, E89.2D, and E90.9 had significantly shorter shoots as the agar concentration
increased. Des89.18, Des89.43, Des90.3B, Des90.15, Des90.20, Des90.24, E90.14 and E90.15
had significantly taller shoots as the agar concentrations increased……………………………..59
Figure 3.5 RT-PCR of Sc/StCBF1 transgenes from osmotic in vitro assay. RNA was isolated
from leaf tissue from all of the lines at each of the agar concentrations. Only E89.2B and
Des90.2 at the 10 g/L concentration were positive for expression of their respective
transgenes………………………………………………………………………………………...60

ix

Chapter 1

Literature Review

The Potato
The potato, Solanum tuberosum is the cultivated potato that is consumed by people
worldwide. It is the fourth largest food crop in production following the grains of rice (Oryza
sativa), wheat (Triticum aesitvum) and maize (Zea mays) (FAOSTAT, 2009). Potatoes are
grown on every continent, except Antarctica, with over 18 million hectares under production in
2009, valued at over $55 billion (FAOSTAT, 2009). Potatoes offer many vitamins and minerals
in addiction to its’ starchy calories including substantial levels Vitamin C, potassium and fiber
(Kolbe and Stephan-Beckmann, 1997).
The cultivated potato is in the Solanaceae family along with tobacco (Nicotianum
tabacum), tomato (Solanum lycopersicum) and pepper (Capsicum annuum). Solanum tuberosum
is believed to have a single origin from a wild potato progenitor S. brevicaule in southern Peru
(Spooner et al., 2005). From that point potatoes spread throughout the Andes and up into
Central America and southern North America. The potato has adapted to a wide range of
th

climates, altitudes and latitudes. In the mid-16

century there is record of potatoes being

transported by Spanish explorers to the Canary Islands (Hawkes and Francisco-Ortega, 1993).
From there potatoes were able to make their way across Europe and became a cheap food crop
for many people. There are approximately 190 wild and cultivated species of potatoes divided
into four clades (Spooner et al., 2008). Part of the division of species is based on the ploidy level
of the plant ranging from diploid to hexaploid.

1

The potato is a perennial plant that is mostly self-pollinated but cross-pollination can
occur. The plant produces flowers that can range from white to blue (Cutter and Harris, 1992).
Many potato cultivars are not able to produce the small green berry fruit due to male sterility,
failure to flower and other factors. The tuber that is the edible portion of the plant is
morphologically a swollen stem, called a stolon, and grows underground (Cutter and Harris,
1992).
The potato has five growth stages. In stage I, the seed tubers break dormancy and sprouts
grow from the eyes of the tuber. The seed tuber utilizes the starch and other compounds within it
to initiate sprout growth. In stage II, the plant begins its vegetative growth including leaves,
vines, roots and stolons. At this point the plant is able to conduct photosynthesis to obtain its’
energy. In stage III, the stolons begin to swell initiating tuber formation. This process can occur
when the plant flowers. In stage IV, the tubers bulk up by accumulating water, nutrients and
carbohydrates translocated from the roots and leaves. In the final stage, the plant begins to
senesce with the leaves turning yellow. At this point the tubers mature by thickening and
hardening the skin.
Seed potatoes that are generally used in commercial production are clonally propagated
from small or cut tubers. The advantage to using clonally propagated seed tubers, instead of true
seed produced from sexual reproduction, is that they are genetically identical and will produce a
monoculture crop. True seed is heterozygous and can vary widely in its traits and yield. The
disadvantage in using seed tubers is that disease transmission can easily be carried over to from
year to year. Sexual reproduction is generally used for crop improvement through breeding
strategies, rather than commercial production (Dean, 1994).

2

There are, however, some challenges that come with breeding potatoes through sexual
reproduction. The first challenge is the varying ploidy levels, and the second is the variation in
endosperm balance number (EBN). S. tuberosum is an autotetraploid (2n = 4x = 48) with an
EBN of four. The EBN hypothesis was developed to predict the interspecific and interploidy
crosses of Solanum species (Peloquin et al., 1989). The actual assignment of the EBN value is
based on the crossing of Solanum species to standard tester species (Carputo et al., 2003). In
general diploid species have an EBN of one or two, triploid species are two, tetraploids are either
two or four, and pentaploids and hexaploids are 4. Species with the same EBN value can cross
freely, and viable seed is produced when the maternal to paternal EBN ratio is 2:1 (Hawkes et
al., 1994). To overcome differences in EBN values 2n gametes are used. The most common
mechanisms of 2n gamete formation in potato are first-division restitution and second-division
restitution (Peloquin et al., 1989). First-division restitution results in the failure of the
chromosomes to move to the opposite poles during meiosis I. In second-division restitution the
cell plate fails to form during meiosis II.

Plant Biotechnology
The genetic engineering of plants over the last several decades has mainly taken
advantage of tissue culture and the plant pathogen Agrobacterium tumefaciens. The ability to
introduce a gene that is not found in one individual plant’s genome from a separate genome has
significantly widened the gene pool. Since potato can be difficult to breed due to the varying
ploidy and EBN values, biotechnology has opened up new avenue for introducing genes of
interest.

3

Potatoes were among the early crop plants to be successfully transformed by the
Agrobacterium-mediated technique (An et al., 1986). Agrobacterium tumefaciens is a soil-born
bacterium that causes crown gall disease in dicotyledonous plants (Smith and Townsend, 1907).
In the 1970’s scientists found that a large plasmid within A. tumefaciens was the causative agent
for producing tumors and was essential to its’ virulence (Van Larebeke et al., 1974). They
named this plasmid the tumor inducing or Ti plasmid. It was later found that a particular region
of the plasmid’s DNA is transferred into the nuclear genome of the host plant’s cell (Thomashow
et al., 1980). This region was then named the Transfer DNA or T-DNA. The Ti plasmid also
contains genes known as Virulence, or vir, genes and these genes assist bacterium in integrating
the T-DNA into the plant host’s genome. Plant biotechnology harnesses Agrobacterium’s
natural ability to insert foreign genes into a plant’s nuclear genome. In order for Agrobacteriummediated transformation to be successful, the tumor causing genes are removed from the Ti
plasmid. This gives the plant cells a chance to produce a fertile plant. The binary vector system
was then developed where one plasmid contains the T-DNA with the gene of interest and the
other plasmid contains the vir genes (Hoekema et al., 1983). This system increases the
efficiency and allows for easier manipulation of the plasmids.
One example of a valuable gene being introduced into a cultivated potato variety is the
late blight resistant gene from the wild species S. bulbocastanum. Potato late blight,
Phytophthora infestans L., is one of the most devastating pests in potato. Late blight wiped out
the potato crop between 1845 and 1852 in Ireland, and led to the infamous Irish potato famine.
A gene for late blight resistance was cloned from S. bulbocastanum and was inserted into the
genome of a susceptible cultivar, cv. Katahdin (Song et al., 2003). The transformed Katahdin
then conferred resistance to late blight. For years breeders had been trying to cross S.

4

bulbocastanum with a susceptible cultivated variety but the differences in ploidy level and EBN
values were making it necessary to use a bridging species. Somatic hybrids of S. bulbocastanum
and S. tuberosum were created using PEG-mediated fusion (Helgeson et al., 1998). However,
the main advantage to genetic engineering is that only one or a few genes of interest will be
inserted instead of the other remaining portion of a genome as it occurs in sexual reproduction.
One of the many areas of potato cultivation that could benefit from the use of
biotechnology is abiotic stress tolerance. There are several species of potato that are known to
be freezing tolerant, such as S. acaule and S. commersonii, as they grow in the higher elevations
of the Andes (Li, 1977). It has been found in some plants that freezing and drought tolerance are
related in the plant’s ability to produce membrane-stabilizing proteins. However, S. tuberosum is
sensitive to several abiotic stresses, and this can result in crop loss.

CBF1 and Abiotic Stress Tolerance
Due to the sessile nature of plants, they have adapted many strategies to combat the
stresses and damage that can occur during their life cycle. Plants have evolved methods to
overcome both biotic and abiotic stresses. Some abiotic stresses a plant can be faced with
include freezing, heat, drought, flood, and saline conditions. Because many crop plants have
been developed in a particular location, usually under ideal conditions, they can struggle when
moved to different regions or are faced with varying environmental conditions. Plant
biotechnology offers options to increase a crop plant’s abiotic stress tolerance by introducing
novel genes.
One group of genes that has received much attention for abiotic stress tolerance are the
CBFs/DREBs (C-repeat Binding Factor/Dehydration Responsive Element Binding). The

5

transcription factors that were first isolated from Arabidopsis were CBF1 (Stockinger et al.,
1997) and DREB1A and DREB2A (Liu et al., 1998). To date CBF/DREB genes have been found
in every higher plant that has been examined including: barley (Choi, 2002), rice (Dubouzet et
al., 2003), canola, rye, tomato (Jaglo et al., 2001) wheat (Kume et al., 2005), soybean (Li et al.,
2005), blueberry (Naik et al., 2007), grape (Xiao et al., 2008), tobacco (Park et al., 2001), pepper
(Hong and Kim, 2005), and potato (Rensink et al., 2005).

The Discovery of CBF
Early studies on cold acclimation in Arabidopsis revealed four cold-regulated (COR)
genes: COR6.6, COR15, COR47, and COR78 (Hajela et al., 1990), with COR6.6, COR15a and
COR78 encoding hydrophilic polypeptides (Thomashow, 1998). The COR gene transcripts
accumulated after 4 hr of cold treatment and can stay induced for up to two weeks. It was also
found that some of the COR genes were induced by drought (Hajela et al., 1990). COR15a was
found to enhance chloroplast and plasma membrane dehydration tolerance by stabilizing the
membranes (Steponkus et al., 1998). CBF1 was then discovered as the element that binds to the
C-repeat involved with the promoter of two of the COR genes.
In Arabidopsis there are six members of the CBF family, with CBF1, CBF2 and CBF3
being cold-induced (Gilmour et al., 2004). The CBF proteins are members of the AP2/ERBP
family of transcription factors. The three cold-induced CBFs are major regulators in the cold
acclimation process in Arabidopsis. CBF transcripts are detected within 15 min of exposure to
low temperatures and peak around two hrs (Gilmour et al., 1998). Studies in Arabidopsis show
that when any of the three cold-induced CBFs are expressed using a constitutive promoter, the
CBF target genes are turned on even at warm temperatures (Jaglo-Ottosen et al., 1998; Gilmour

6

et al., 2000). It also gives the plant the ability to turn on the cold acclimation pathway without
having to be exposed to cold temperatures.

The CBF Regulon
Microarray technology allowed for the identification of hundreds of genes that are
responsive to low temperature in Arabidopsis and other plant species. Some of the genes that are
found to accumulate under low temperature treatment include enzymes involved in the synthesis
of sucrose and galactinol, both membrane protective sugars (Vogel et al., 2004). Other genes
outside of the CBF regulon have also been found in these microarray studies, implying there are
other transcription factors that have a role in cold acclimation.
One of the known upstream inducers of the CBF regulon is the inducer of CBF
expression 1 (ICE1). It is a MYC-like transcriptional activator that binds to the Myc recognition
site of the CBF3 promoter. In the ice1 mutant, CBF1 and CBF2 expression was only slightly
decreased in the beginning of the cold treatment, but several of the CBF target genes had
decreased expression (Chinnusamy et al., 2003). Overexpression of ICE1 increases the
expression of CBF2 and CBF3, however, only during cold treatment. This indicates there may
be upstream factors needed to activate CBF genes. HOS1 is negative regulator of cold
acclimation and targets ICE1 for ubiquination (Dong et al., 2006).
Several other regulators of the CBF genes have also been identified; CAMTA3 and
LHY/CCA1. CAMTA3 has been identified as a positive regulator of CBF2 (Doherty et al., 2009).
It is a member of a calmodulin-binding transcription factor family. The camta3 mutant had a 50
and 40% reductions of CBF2 and CBF1 expression, respectively, under low temperature.
LHY/CCA1 are involved in circadian clock gene regulation (Mikkelsen and Thomashow, 2009).

7

It was shown that the expression of CBF1-3 genes were highest when transferred to the cold
during the light period (Fowler et al., 2005).
Negative regulators of the CBF regulon have also been identified. CBF2 has actually
been shown to be a negative regulator of CBF1 and CBF3 (Novillo et al., 2004). The
overexpression of Myb15 and ZAT12 have also been shown to reduce the expression of CBF1-3
at low temperatures (Vogel et al., 2004). Interestingly both of these transcripts are cold induced,
however, a knockout of Myb15 does not change the expression of COR15 or rd29a genes.

The CBF Pathway in Other Plant Systems
The CBF proteins have been shown to be highly conserved across both cold acclimating
and non-acclimating plants. The region that is most highly conserved in the amino acid sequence
is within the AP2/EREBP DNA binding domain (Jaglo et al., 2001). Because the Arabidopsis
CBF (AtCBF) genes have been so well studied, many have introduced AtCBF genes into other
plant systems. The overexpression of any of the cold induced CBF genes in B. napus increased
the plant’s freezing tolerance without cold acclimation (Jaglo et al., 2001). Overexpression of
AtCBF3 has also been shown to increase the freezing tolerance in tobacco and potato, along with
AtCBF1 in potato (Kasuga et al., 2004; Pino et al., 2007; Pino et al., 2008). In tomato, the
overexpression of AtCBF3 or the tomato’s CBF1 gene (LeCBF1) does not increase the freezing
tolerance of the plant (Zhang et al., 2004b). This suggests that there is a significant difference in
the CBF pathways between Arabidopsis and tomato. One issue that has been observed across
many of the plant species is that when a CBF gene is overexpressed negative phenotypes appear.
These include dwarfed growth, delayed flowering, and shorter petioles (Kasuga et al., 2004;

8

Gilmour et al., 2000). However, this issue can mostly be overcome by using an inducible
promoter such as COR15 or rd29a.
Recently the transcriptomes and CBF regulons of S. commersonii (a freezing tolerant
wild potato species), S. tuberosum (cultivated non-freezing tolerant potato) and Arabidopsis
thaliana were studied (Carvallo et al., 2011). It was found that both potato species have CBF
regulons composed of hundreds of genes. However, there were sizeable differences in the sets of
genes that were a part of the low temperature transcriptome, but the data did not clearly point to
any specific genes that may be the key differences in why S. commersonii is freezing tolerant and
S. tuberosum is not.
CBF genes have also been indicated to increase a plant’s tolerance to other abiotic stress
other than freezing (Vogel et al., 2004). Transgenic CBF plants either using a constitutive or an
inducible promoter have been studied under drought and salinity stress (Zhang et al., 2004a).
Depending on the CBF gene used and its origin, the CBF gene can confer tolerance to cold,
drought, saline and/or abscisic acid. There has been an increasing interest in drought tolerant
crop plants as drought prone areas have been increasing around the world, and due to climate
change, it is expected that these areas will only further increase and become more severe
(Gornall et al., 2010). Therefore, the need for drought tolerant crops is imperative. Drought,
saline soil, freezing temperatures and high temperatures can all negatively affect the yield of
potatoes (Byun et al., 2007). A variety of potato that could maintain a high yield and good
agronomic traits under both optimal and drought conditions would increase the areas where
potatoes could be grown. The world’s population is also expected to increase over the next few
decades, especially in rural areas where they are less capable of fighting drought (Gornall et al.,
2010). Drought tolerant potatoes could aid in feeding the growing population.

9

In the following two chapters the role of AtCBF1, ScCBF1, and StCBF1 under the stressinducible promoter COR15a in S. tuberosum was evaluated in field and in vitro studies. The
final chapter studied college students’ attitudes towards genetically modified potatoes.

10

LITERATURE CITED

11

An, G., Watson, B. D. &Chiang, C. C. (1986). Transformation of tobacco, tomato, potato, and
Arabidopsis thaliana using a binary Ti vector system. Plant Physiology 81(1): 301.
Byun, M. O., Kwon, H. B. &Park, S. C. (2007). Recent advances in genetic engineering of
potato crops for drought and saline stress tolerance. Advances in Molecular Breeding
Toward Drought and Salt Tolerant Crops: 713-737.
Carputo, D., Frusciante, L. &Peloquin, S. J. (2003). The role of 2n gametes and endosperm
balance number in the origin and evolution of polyploids in the tuber-bearing Solanums.
Genetics 163(1): 287.
Carvallo, M. A., Pino, M. T., Jeknić, Z., Zou, C., Doherty, C. J., Shiu, S. H., Chen, T. H. H.
&Thomashow, M. F. (2011). A comparison of the low temperature transcriptomes and
CBF regulons of three plant species that differ in freezing tolerance: Solanum
commersonii, Solanum tuberosum, and Arabidopsis thaliana. Journal of Experimental
Botany 62(11): 3807.
Chinnusamy, V., Ohta, M., Kanrar, S., Lee, B., Hong, X., Agarwal, M. &Zhu, J. K. (2003).
ICE1: a regulator of cold-induced transcriptome and freezing tolerance in Arabidopsis.
Genes & development 17(8): 1043.
Choi, D. W. (2002). Barley Cbf3 Gene Identification, Expression Pattern, and Map Location.
Plant Physiology 129(4): 1781-1787.
Cutter, E. &Harris, P. (1992). Structure and development of the potato plant. The potato crop:
the scientific basis for improvement. (Ed. 2): 65-161.
Dean, B. B. (1994). Managing the potato production system. CRC.
Doherty, C. J., Van Buskirk, H. A., Myers, S. J. &Thomashow, M. F. (2009). Roles for
Arabidopsis CAMTA Transcription Factors in Cold-Regulated Gene Expression and
Freezing Tolerance. The Plant Cell Online 21(3): 972-984.
Dong, C. H., Agarwal, M., Zhang, Y., Xie, Q. &Zhu, J. K. (2006).The negative regulator of plant
cold responses, HOS1, is a RING E3 ligase that mediates the ubiquitination and
degradation of ICE1. National Acad Sciences.
Dubouzet, J. G., Sakuma, Y., Ito, Y., Kasuga, M., Dubouzet, E. G., Miura, S., Seki, M.,
Shinozaki, K. &Yamaguchi Shinozaki, K. (2003). OsDREB genes in rice, Oryza sativa
L., encode transcription activators that function in drought , high salt and cold responsive
gene expression. The Plant Journal 33(4): 751-763.
FAOSTAT (2009).http://faostat.fao.org/site/567/DesktopDefault.aspx?PageID=567.
Fowler, S. G., Cook, D. &Thomashow, M. F. (2005). Low temperature induction of Arabidopsis
CBF1, 2, and 3 is gated by the circadian clock. Plant Physiology 137(3): 961-968.

12

Gilmour, S. J., Fowler, S. G. &Thomashow, M. F. (2004). Arabidopsis transcriptional activators
CBF1, CBF2, and CBF3 have matching functional activities. Plant Molecular Biology
54(5): 767-781.
Gilmour, S. J., Sebolt, A. M., Salazar, M. P., Everard, J. D. &Thomashow, M. F. (2000).
Overexpression of the Arabidopsis CBF3transcriptional activator mimics multiple
biochemical changes associated with cold acclimation. Plant Physiology 124(4): 1854.
Gilmour, S. J., Zarka, D. G., Stockinger, E. J., Salazar, M. P., Houghton, J. M. &Thomashow, M.
F. (1998). Low temperature regulation of theArabidopsisCBF family of AP2
transcriptional activators as an early step in cold inducedCORgene expression. The Plant
Journal 16(4): 433-442.
Gornall, J., Betts, R., Burke, E., Clark, R., Camp, J., Willett, K. &Wiltshire, A. (2010).
Implications of climate change for agricultural productivity in the early twenty-first
century. Philosophical Transactions of the Royal Society B: Biological Sciences
365(1554): 2973-2989.
Hajela, R. K., Horvath, D. P., Gilmour, S. J. &Thomashow, M. F. (1990). Molecular cloning and
expression of cor (cold-regulated) genes in Arabidopsis thaliana. Plant Physiology 93(3):
1246.
Hawkes, J., Bradshaw, J. &Mackay, G. (1994). Origins of cultivated potatoes and species
relationships. Potato genetics.: 3-42.
Hawkes, J. G. &Francisco-Ortega, J. (1993). The early history of the potato in Europe. Euphytica
70(1): 1-7.
Helgeson, J., Pohlman, J., Austin, S., Haberlach, G., Wielgus, S., Ronis, D., Zambolim, L.,
Tooley, P., McGrath, J. &James, R. (1998). Somatic hybrids between Solanum
bulbocastanum and potato: a new source of resistance to late blight. TAG Theoretical and
Applied Genetics 96(6): 738-742.
Hoekema, A., Hirsch, P., Hooykaas, P. &Schilperoort, R. (1983). A binary plant vector strategy
based on separation of vir-and T-region of the Agrobacterium tumefaciens Ti-plasmid.
Hong, J. P. &Kim, W. T. (2005). Isolation and functional characterization of the Ca-DREBLP1
gene encoding a dehydration-responsive element binding-factor-like protein 1 in hot
pepper (Capsicum annuum L. cv. Pukang). Planta 220(6): 875-888.
Jaglo, K. R., Kleff, S., Amundsen, K. L., Zhang, X., Haake, V., Zhang, J. Z., Deits, T.
&Thomashow, M. F. (2001). Components of the Arabidopsis C-Repeat/DehydrationResponsive Element Binding Factor Cold-Response Pathway Are Conserved inBrassica
napus and Other Plant Species. Plant Physiology 127(3): 910.

13

Jaglo-Ottosen, K. R., Gilmour, S. J., Zarka, D. G., Schabenberger, O. &Thomashow, M. F.
(1998). Arabidopsis CBF1 overexpression induces COR genes and enhances freezing
tolerance. Science 280(5360): 104.
Kasuga, M., Miura, S., Shinozaki, K. &Yamaguchi-Shinozaki, K. (2004). A combination of the
Arabidopsis DREB1A gene and stress-inducible rd29A promoter improved drought-and
low-temperature stress tolerance in tobacco by gene transfer. Plant and Cell Physiology
45(3): 346.
Kolbe, H. &Stephan-Beckmann, S. (1997). Development, growth and chemical composition of
the potato crop (Solanum tuberosum L.). II. Tuber and whole plant. Potato Research
40(2): 135-153.
Kume, S., Kobayashi, F., Ishibashi, M., Ohno, R., Nakamura, C. &Takumi, S. (2005).
Differential and coordinated expression of Cbf and Cor/Lea genes during long-term cold
acclimation in two wheat cultivars showing distinct levels of freezing tolerance. Genes &
genetic systems 80(3): 185-197.
Li, P. (1977). Frost killing temperatures of 60 tuber-bearing Solanum species. American Journal
of Potato Research 54(9): 452-456.
Li, X. P., Tian, A. G., Luo, G. Z., Gong, Z. Z., Zhang, J. S. &Chen, S. Y. (2005). Soybean DREbinding transcription factors that are responsive to abiotic stresses. TAG Theoretical and
Applied Genetics 110(8): 1355-1362.
Liu, Q., Kasuga, M., Sakuma, Y., Abe, H., Miura, S., Yamaguchi-Shinozaki, K. &Shinozaki, K.
(1998). Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA
binding domain separate two cellular signal transduction pathways in drought-and lowtemperature-responsive gene expression, respectively, in Arabidopsis. The Plant Cell
Online 10(8): 1391.
Mikkelsen, M. D. &Thomashow, M. F. (2009). A role for circadian evening elements in coldregulated gene expression in Arabidopsis. The Plant Journal 60(2): 328-339.
Naik, D., Dhanaraj, A. L., Arora, R. &Rowland, L. J. (2007). Identification of genes associated
with cold acclimation in blueberry (Vaccinium corymbosum L.) using a subtractive
hybridization approach. Plant Science 173(2): 213-222.
Novillo, F., Alonso, J. M., Ecker, J. R. &Salinas, J. (2004). CBF2/DREB1C is a negative
regulator of CBF1/DREB1B and CBF3/DREB1A expression and plays a central role in
stress tolerance in Arabidopsis. Proceedings of the National Academy of Sciences of the
United States of America 101(11): 3985.
Park, J. M., Park, C. J., Lee, S. B., Ham, B. K., Shin, R. &Paek, K. H. (2001). Overexpression of
the tobacco Tsi1 gene encoding an EREBP/AP2ñtype transcription factor enhances

14

resistance against pathogen attack and osmotic stress in tobacco. The Plant Cell Online
13(5): 1035.
Peloquin, S., Jansky, S. &Yerk, G. (1989). Potato cytogenetics and germplasm utilization.
American Journal of Potato Research 66(10): 629-638.
Pino, M.-T., Skinner, J. S., JekniĆ, Z., Hayes, P. M., Soeldner, A. H., Thomashow, M. F.
&Chen, T. H. H. (2008). Ectopic AtCBF1 over-expression enhances freezing tolerance
and induces cold acclimation-associated physiological modifications in potato. Plant,
Cell & Environment 31(4): 393-406.
Pino, M.-T., Skinner, J. S., Park, E.-J., Jeknić, Z., Hayes, P. M., Thomashow, M. F. &Chen, T.
H. H. (2007). Use of a stress inducible promoter to drive ectopic AtCBF expression
improves potato freezing tolerance while minimizing negative effects on tuber yield.
Plant Biotechnology Journal 5(5): 591-604.
Rensink, W., Hart, A., Liu, J., Ouyang, S., Zismann, V. &Buell, C. R. (2005). Analyzing the
potato abiotic stress transcriptome using expressed sequence tags. Genome 48(4): 598605.
Smith, E. F. &Townsend, C. (1907). A plant-tumor of bacterial origin. Science 25(643): 671.
Song, J., Bradeen, J. M., Naess, S. K., Raasch, J. A., Wielgus, S. M., Haberlach, G. T., Liu, J.,
Kuang, H., Austin-Phillips, S. &Buell, C. R. (2003). Gene RB cloned from Solanum
bulbocastanum confers broad spectrum resistance to potato late blight. Proceedings of the
National Academy of Sciences of the United States of America 100(16): 9128.
Spooner, D. M., McLean, K., Ramsay, G., Waugh, R. &Bryan, G. J. (2005). A single
domestication for potato based on multilocus amplified fragment length polymorphism
genotyping. Proceedings of the National Academy of Sciences of the United States of
America 102(41): 14694.
Spooner, D. M., Rodriguez, F., Polgar, Z., Ballard Jr, H. E. &Jansky, S. H. (2008). Genomic
origins of potato polyploids: GBSSI gene sequencing data.
Steponkus, P. L., Uemura, M., Joseph, R. A., Gilmour, S. J. &Thomashow, M. F. (1998). Mode
of action of the COR15a gene on the freezing tolerance of Arabidopsis thaliana.
Proceedings of the National Academy of Sciences 95(24): 14570.
Stockinger, E. J., Gilmour, S. J. &Thomashow, M. F. (1997). Arabidopsis thaliana CBF1
encodes an AP2 domain-containing transcriptional activator that binds to the Crepeat/DRE, a cis-acting DNA regulatory element that stimulates transcription in
response to low temperature and water deficit. Proceedings of the National Academy of
Sciences of the United States of America 94(3): 1035.

15

Thomashow, M. F. (1998). Role of cold-responsive genes in plant freezing tolerance. Plant
Physiology 118(1): 1.
Thomashow, M. F., Nutter, R., Montoya, A. L., Gordon, M. P. &Nester, E. W. (1980).
Integration and organization of Ti plasmid sequences in crown gall tumors. Cell 19(3):
729-739.
Van Larebeke, N., Engler, G., Holsters, M., Van den Elsacker, S., Zaenen, I., Schilperoort, R.
&Schell, J. (1974). Large plasmid in Agrobacterium tumefaciens essential for crown gallinducing ability.
Vogel, J. T., Zarka, D. G., Van Buskirk, H. A., Fowler, S. G. &Thomashow, M. F. (2004). Roles
of the CBF2 and ZAT12 transcription factors in configuring the low temperature
transcriptome of Arabidopsis. The Plant Journal 41(2): 195-211.
Xiao, H., TATTERSALL, E. A. R., SIDDIQUA, M. K., CRAMER, G. R. &Nassuth, A. (2008).
CBF4 is a unique member of the CBF transcription factor family of Vitis vinifera and
Vitis riparia. Plant, Cell & Environment 31(1): 1-10.
Zhang, J. Z., Creelman, R. A. &Zhu, J. K. (2004a). From laboratory to field. Using information
from Arabidopsis to engineer salt, cold, and drought tolerance in crops. Plant Physiology
135(2): 615.
Zhang, X., Fowler, S. G., Cheng, H., Lou, Y., Rhee, S. Y., Stockinger, E. J. &Thomashow, M. F.
(2004b). Freezing-sensitive tomato has a functional CBF cold response pathway, but a
CBF regulon that differs from that of freezing-tolerant Arabidopsis. The Plant Journal
39(6): 905-919.

16

Chapter 2

Evaluation of AtCBF1 Transgenic Potatoes

Research Objectives
This research evaluates the CBF1 gene from Arabidopsis thaliana transformed into MSE149-5Y
under the stress inducible promoter COR15a. The objectives were:
1. Evaluate the efficacy of the transgenic potato plants in their ability to decrease electrolyte
ion leakage induced by freezing temperature treatments compared to the wild type
control.
2. Evaluate the agronomic performance of the transgenic potato plants under irrigated and
rain-fed conditions in repeated field trials.
a. Evaluate the 100 cwt./acre yield of the potatoes.
b. Evaluate the specific gravity of the potatoes.
c. Evaluate the percent glucose and sucrose of the potatoes.
3. Study the gene expression of the transgene and other stress-induced genes from RNA
isolated from leaf tissue samples collected in the field.

Materials and Methods
Plant Material
The potato line MSE149-5Y had been previously transformed with the pSPUD74 construct using
Agrobacterium mediated transformation (K. Zarka, personal communication; Li et al., 1999).
MSE149-5Y is a round yellow fleshed breeding line from Michigan State University. The

17

construct pSPUD74 contains the Arabidopsis thaliana CBF1 (AtCBF1) gene (GenBank
accession AY667247.1) under the inducible promoter, also from A. thaliana, COR15a (GenBank
accession U01377.1; Figure 2.1). The transformations resulted in four independent lines: E74.8,
E74.9, E74.14 and E74.16. Potato lines transformed with AtCBF1 under either the 35S
constitutive promoter or the rd29A inducible promoter (GenBank accession D13044) were
graciously donated by Dr. Chen’s laboratory (Oregon State University, Corvallis, OR; Table
2.1). The Oregon State University (OSU) lines were transformed into a long russet cultivar,
Umatilla Russet (Pino et al., 2007). The potato lines were maintained in tissue culture by nodal
propagation either in 25 x 150 mm culture tubes or GA-7 Magenta boxes (Magenta Corp,
Chicago, IL) in modified Murashige and Skoog (MS) media (4.3 g/L MS salts, 30 g/L sucrose,
1.4 mM sodium phosphate, 1.1 μM thiamine, 0.55 mM myo-inositol, pH 6.0, 8 g/L Agar). The
cultures were maintained at 25 ± 3°C, with a 16 hr photoperiod.

Figure 2.1 Schematic of pSPUD74 construct. The CBF1 gene from Arabidopsis thaliana is
directed by the stress-inducible promoter AtCOR15a.

Table 2.1 Transformed lines from MSU and OSU.

MSE149-5Y

Promoter:Gene of
Interest
Wild Type Control

E74.8, E74.9, E74.14, E74.16

COR15a:AtCBF1

OR1.2, OR1.11, OR1.15
OR2.1, OR2.3, OR2.6

35S:AtCBF1
rd29A:AtCBF1

Experimental Lines

18

Experiments
Field Trials 2007-2010, Electrolyte
Leakage
Field Trials 2007-2010, Electrolyte
Leakage
Field Trial 2010, Electrolyte Leakage
Field Trial 2010, Electrolyte Leakage

Electrolyte Leakage Assay
Plant Growth and Temperature Treatment
Seed tubers of MSE149-5Y, E74.8, E74.9, E74.14 and E74.16 that were harvested in the
Fall of 2007 were cut into seed pieces and planted in 6” round plastic pots filled with 70% peat
moss, 21% perlite, 9% vermiculite (v/v) (Suremix, Michigan Grower Products Inc., Galesburg,
MI). A total of eight pots were planted for each line. The plants were placed in the greenhouse
and watered daily. Forty days after planting (DAP), the plants were moved to a growth chamber
(PGR15, Conviron, Winnipeg, Manitoba, Canada) at 22°C under a 16 hr photoperiod, 60%
-2 -1

humidity, 100-130 µmol m s fluorescent plus incandescent lighting for seven weeks; watered
daily. The pots were placed in a completely randomized block design in the greenhouse and
growth chamber.
After the seven wks, four pots of each line were moved into a walk-in cooler set at 4°C
for 24 hrs, with fluorescent lights, to allow the plants to begin to acclimate. The other four pots
remained in the previous growth chamber at 22°C.

Electrolyte Leakage Assay
Following the temperature acclimation treatment, young fully expanded leaves were
excised from the plant and transferred to 16 x 100 mm glass culture tubes placed on ice. Two –
three leaves from each plant were placed in one tube. There were three tubes for each line
(MSE149-5Y, E74.8, E74.9, E74.14 and E74.16), for each acclimation treatment (4 and 22ºC),
and for each freezing temperature treatment (control, -2, -2.5, -3, -3.5, -4, -4.5, -5, -5.5, -6ºC), for
a total of 60 tubes per line. When all leaves had been transferred, all of the tubes, except the
19

control tubes, were moved to a -2ºC antifreeze bath (master bath) in a complete randomized
design, and incubated for 60 min. The control tubes were kept on ice throughout the experiment
and were covered with Saran wrap. An additional four antifreeze baths were set at temperatures
starting at -2ºC, and descended by 0.5 degrees for each bath.
After 60 min, a small ice pellet (approximately 14 x 20 mm) was added to each test tube
(including the control tubes), and then all tubes were plugged with foam. All of the test tubes
were then incubated for an additional 60 min. After the second 60 min incubation, three tubes
for each line from the 4ºC and three tubes from the 22ºC treatments were moved to the second
antifreeze bath also set at -2ºC and incubated for 40 min. Meanwhile, the master bath
temperature was then lowered to -2.5ºC. After 20 min, six tubes (representing the lines and
acclimation treatments) were moved into the third bath set at -2.5ºC. After each set of tubes had
incubated at its test temperature for 60 min, the tubes were placed in racks on ice. This process
continued for all temperatures tested (-2, -2.5, -3, -3.5, -4, -4.5, -5, -5.5, -6ºC). All of the tubes
were then placed at 2.5ºC to thaw overnight.
The following day, 3 mL of deionized water was added to each test tube with the thawed
leaves and incubated with shaking at room temperature for three hours. Following the shaking,
the liquid was transferred to a new test tube without the leaves. The electrical conductivity (L1)
of the water in the new tubes was measured using a conductivity meter (YSI model 35 with cell
#3403, k = 1.0/cm), rinsing the meter with deionized water between samples. The older test
tubes still containing the leaves were then autoclaved for 15 min to release all of the ions
remaining in the leaves. The water in the new tubes was then returned to the old tubes and
incubated with shaking at room temperature for three hours. The final ion concentration (L2)
was then measured again with the same conductivity meter. Percent of the total electrolyte

20

leakage at each test temperature was calculated by (L1 ÷ L2) × 100. ANOVA analysis and mean
separations using Fisher’s LSD (α = 0.05) were conducted on the percent leakage values using
PROC GLM to compare the lines within each temperature treatment using SAS software (release
9.20; SAS Institute, Cary, NC).
The assay was later repeated in a similar manner for the Umatilla CBF1 lines. The
modifications were that the lines were originally propagated from tissue culture then transplanted
into soil, they were not acclimated to 4ºC prior to the experiment and the temperatures for
freezing were only tested down to -5ºC.

Field Trials of AtCBF1 Transformed Lines
Four years of field trials were conducted at both the Michigan State University Montcalm
Research Farm (Entrican, MI) and on the campus of Michigan State University’s Crop and Soil
Science Farm (East Lansing, MI) between 2007 and 2010. Every year, at both locations, tubers
of MSE149-5Y (the wild type control), E74.8, E74.9, E74.14 and E74.16 were planted in a
randomized complete block design with four replications. Each plot was 3 m in length with 1 m
spacing between rows. Each plot contained 10 seed pieces with red skinned potato plants
separating each plot. Guard rows were planted on the flanking sides of each plot. The
Montcalm Research Farm plot (MRF) was maintained under irrigated conditions, and the
Michigan State University plot (MSU) was maintained under rain fed/dry land conditions. Both
plots were maintained using best management practices of fertilizer and pesticide applications.
In the 2010 season, the six OSU lines (Table 2.2) were included in the field trial.

21

Table 2.2. OSU and MSU’s designation of OSU AtCBF1 lines.
OSU’s designation
MSU’s designation
(Pino et al., 2007)
35S:AtCBF1 Line 2
OR1.2
35S:AtCBF1 Line 11

OR1.11

35S:AtCBF1 Line 15

OR1.15

rd29A:AtCBF1 Line 1

OR2.1

rd29A:AtCBF1 Line 3

OR2.3

rd29A:AtCBF1 Line 6

OR2.6

Throughout the season leaf tissue samples were collected before flowering, during
flowering and during tuber bulking for later RNA isolation. The leaf tip of a young, fully
expanded leaf was excised using the cap of a 1.5 mL Eppendorf tube and immediately placed in
liquid nitrogen. During the first sampling, a white flag was placed at the base of the plant to
mark the plant for later tissue sampling. Three samples were collected from the first three
replicates for each line, and this was repeated at both locations. All of the frozen samples were
then stored at -80ºC until used for RNA isolation.
Two weeks before harvest the plots were treated with a foliar applied vine desiccant
(Rely280, Bayer CropScience, Research Triangle Park, NC). At harvest, tubers were collected
in bags marked with the location, line and replicate. A tag was also included in each bag
indicating the location, line, and replicate. Each line was graded for yield and specific gravity.
Recently harvested tubers from each line were used for sugar analysis in 2008 and 2009.
Tubers were peeled and cut into 1 x 2” pieces then fed into a commercial electric juicer (Waring
Products 6001C, Torrington, CT) until 30 mL were obtained for each line, from each field

22

location. The sucrose and the glucose concentrations of the lines were determined by Techmark
Inc. (Lansing, MI) using the YSI 2700D Bioanalyzer (Yellow Springs, OH).
Statistical analysis for the yield, specific gravity and sugar profiles were conducted using
ANOVA and LSD for means separation (α = 0.05) on SAS software (release 9.20; SAS Institute,
Cary, NC).

Gene Expression Analysis Using RT-PCR
Frozen leaf tissue stored at -80C was ground to a fine powder using liquid nitrogen and
total RNA was then isolated using the RNeasy Plant Mini-Kit (Qiagen Inc., Valencia, CA). The
RNA was then DNase treated using RQ1 RNase-Free DNase (Promega Corp., Madison, WI) to
remove any residual DNA. RNA was quantified using a Nanodrop 8000 spectrometer (Thermo
Fisher Scientific Inc., Wilmington, DE). cDNA was obtained by reverse transcription of 100200 ng/µL of total RNA using the Applied Biosystems High Capacity cDNA Reverse
Transcription Kit (Life Technologies Corp., Carlsbad, CA). Each 20 µL reaction contained 2 µL
10X RT Buffer, 0.8 µL of 25X dNTP mix (100mM), 2 µL 10X RT random primers, 1 µL
MultiScribe Reverse Transcriptase, 4.2 µL of nuclease free water, and 10 µL of template
RNA. The reaction occurred according to the manufacturer’s directions of 10 min at 25ºC, 2 hrs
at 37ºC, 5 min at 85ºC and held at 4ºC. Eight microliters of cDNA were then used as template in
50 µL PCR amplifications each containing: 10 µL 5X Green GoTaq® Reaction Buffer, 1 µL
dNTP mix 10mM, 0.25 µL GoTaq® DNA Polymerase (Promega, Madison, WI), 1 µL of each
primer, and 34.75 µL of nuclease free water. The PCRs were carried out under the following
conditions: 94ºC of four min, 30 cycles of 94ºC for 60 secs, 60ºC for 90 secs, 72ºC for 90 secs, a
final extension for four min at 72ºC and held at 4ºC. The gene specific primers for 18S,

23

AtCBF1, DHN10 and Solanum tuberosum galactinol synthase 3 (StGolS3) are listed in Table 2.3.
Control reactions were carried out using RNA isolated from OR1.11 and water replacing
template cDNA.
Table 2.3. Primer sequences used in RT-PCR analysis of AtCBF1 transgenic lines.
Primer
Sequence
Source
18S F

GGGCATTCGTATTTCATAGTCAGAG

18S R

CGGTTCTTGATTAATGAAAACATCCT

AtCBF1 F

CTCCGATTACGAGCCTCAAG

AtCBF1 R

ATCGTCTCCTCCATGTCCAG

DHN10 F

GCTAAACCCCAAAAAAAAACTCATT

DHN10 R

GTCCAAAAGACGAGTACATTCAC

StGolS3 F

AGCCATGGAGGTACACTGGA

StGolS3 R

TTGTCAGCTTCAACTTCACCA

(X67238.1, Primer-BLAST,
www.ncbi.nlm.nih.gov)

24

(AT4G25490, Primer-BLAST,
www.ncbi.nlm.nih.gov)

(Pino et al., 2007)

(M. A. Carvallo, personal
communication, 2008)

Results

Electrolyte Leakage Assay
To evaluate the efficacy of the transgenic potato plants in their ability to decrease
electrolyte ion leakage an electrolyte leakage assay was used. When a plant confers freezing or
drought stress, the cells are maintaining their ions. If more than 50% of a plant’s ions are lost
due to a freezing or drought stress, this is considered lethal for the plant. In this study three sets
of experiments were carried out. The first two sets both involved the four MSE transgenic lines
with the AtCBF1 gene under the stress-inducible AtCOR15a promoter and the wild type control
line MSE149-5Y. In the first experiment the plants where kept at 22°C and in the second
experiment the plants were kept at 4°C for 24 hrs prior to the experiment. In the third
experiment the OSU transgenic lines with the AtCBF1 gene under either under the constitutive
35S promoter or the stress-inducible promoter rd29a. For the OSU lines they were only used
after being kept at 22°C due to a previous study by Pino et al (2007) showing little difference in
the % of ion leakage when the plants were kept at room temp. or cold acclimated at 2°C for two
weeks.
In the first experiment on the MSE lines, all of the lines lost more than 50% of their ions
at each temperature treatment. In the 0C control treatment, minimal ions were lost for each line
(Figure 2.2). At the -2C treatment, E74.14 lost significantly fewer ions than the WT control
line and E74.8. However, with a % leakage at 50.5% the plant would not survive. At the -2.5C
treatment, E74.14 lost significantly less ions than all the other lines, but was well over 50%
leakage (69.7%). At the -3C treatment, E74.14 and E74.16 lost significantly more ions than the
other lines, but all were near 100% leakage.

25

When the lines were cold treated at 4C prior to the freezing treatments, the lines E74.8
increased in freezing tolerance to -2C and E74.9 to -2.5C. All the remaining lines did not
increase in freezing tolerance. At the -2 and -2.5C treatment, E74.8 and E74.9 lost
significantly fewer ions than the other lines and their losses were less than 50% (Figure 2.2).
However, only E74.9 lost less than 50% at the -2.5 (44.9%). At the -3C treatment, all of the
lines lost more than 50% of their ions, with E74.8 losing the least amount of ions.
For the OSU lines it had previously been determined by Pino et al. (2007) with
acclimation at 2C for two weeks all six lines increased their freezing tolerance to -5C. In this
experiment the OSU lines were maintained at 22C (non-acclimated). The 35S lines OR1.11 and
OR1.15 were able to maintain 50% or more of their ions at -2.5C, with all of the other lines
except OR2.6 able to maintain 50% or more of their ions at only -2C (Figure 2.3). At the -2C
treatment, only OR2.6 had an ion leakage greater than 50%. The remaining OSU lines were not
significantly different from each other at this treatment. At the -2.5C treatment, only the 35S
lines OR1.11 and OR1.15 were able to maintain more than 50% of their ions and were
significantly different from the remaining lines. At the -3C treatment, all of the lines had a
percent leakage greater than 50%.

26

100
90

0

-2

-2.5

-3

80
70
60
50

40
30
20
10
0

Figure 2.2 Electrolyte Leakage Assay for the MSE lines. Each line was tested twice, once
with no cold treatment and once with a 4°C cold treatment for 24 hrs (labeled Trt) prior to the
experiment. MSE149-5Y is the WT control. All of the temperature treatments were analyzed by
ANOVA using Fishers LSD (=0.05) between the lines within the non-treated and cold treated
experiments. In each of the temperature treatments, none of the non-treated lines were able to
maintain a percent leakage less than 50%. A percent leakage of 50% or more is considered
lethal. At the 0C control treatment; E74.14 was significantly different from E149-5Y. E74.8
was significantly different from all of the lines and had the greatest % leakage. At the -2C
treatment; E74.14 had significantly less ions loss than E74.8 and E149-5Y. At the -2.5C
treatment; E74.14 has significantly less ion loss than all of the other lines. At the -3C treatment;
E74.14 and E74.16 had significantly more ion loss than the other three lines. For the cold treated
lines at the 0C control treatment; E74.16 lost significantly more ions than E149-5Y and E74.8.
E74.16 lost significantly more ions than all of the other four lines. At the -2C treatment; E74.8
and E74.9 showed an increase in freezing tolerance at this temperature having a % leakage less
than 50%. Both lines were significantly different from the other three lines. At the -2.5C
treatment; both the E74.8 and E74.9 were again statistically significant from the other three lines.
However, only E74.9 maintained a % leakage less than 50%. At the -3C treatment; all of the
lines had a % leakage far greater than 50%. E74.8 had a significantly less % leakage than all of
the other lines. E74.14 and E74.16 % leakages were significantly greater than the other three
lines.

27

0

100

-2

-2.5

-3

90
80
70
60
50
40
30
20
10
0
OR1.11

OR1.15

OR1.2

OR2.1

OR2.3

OR2.6

Figure 2.3 Electrolyte Leakage Assay for OSU Lines. All of the temperature treatments were
analyzed by ANOVA using Fishers LSD (=0.05). At the 0C control treatment; OR1.15 had
statistically the lowest % leakage compared to the other five lines. At the -2C treatment; all of
the lines except OR2.6 had a % leakage less than 50%. At the -2.5C treatment; only OR1.11
and OR1.15 maintained a % leakage less than 50% and both were significantly less than the
other four lines. At the -3C treatment, all of the lines had a % leakage greater than 50% and
only OR1.11 and OR2.1 were significantly different from each other.

Field Trials of AtCBF1 Transformed Lines
In order to test the agronomic performance, using best practices, of the MSU AtCBF1
lines under non-irrigated conditions, seed potatoes were planted in two field locations from
2007-2010, and the OSU lines were planted in 2010. The Montcalm Research Farm (MRF) and
was one location and was maintained under irrigated conditions. Michigan State University’s
Crop and Soil Science Farm (CSSF) was the second location and was maintained under rain fed
conditions. Each year the potatoes were planted in early to mid-May and were harvested
approximately 125 days later in the fall. All four of the years the CSSF plot experienced drier
conditions than the MRF plot (Figure 2.4). It is standard recommendations for potatoes to
receive between 20-24 inches of water in a growing season. These conditions were maintained
at the MRF plot with the utilization of irrigation. The CSSF
28

16.5
Precipitation (inches)

16
15.5
15
14.5

14
13.5
13
12.5
12
2007

2008

2009

2010

Year

Figure 2.4 Total Precipitations at the CSSF. The total amount of precipitation measured at the
CSSF plot during the 125 day growing season (on average mid-May to mid-September). These
conditions are below the standard practice of 20-24 inches of water for potato crops.

plots received far less water, thus creating an environment for short-term drought events to
compare the drought tolerance of the lines.
In the 2007 and 2010 field seasons the MRF field had significantly greater 100 cwt./acre
yield and specific gravity than the CSSF field (Table 2.4 and 2.5). In 2008, there was no
significant difference in yield; however, MRF had a significantly lower specific gravity. In
2009, CSSF had a significantly greater yield than MRF, but there was no significance in the
specific gravity.

Table 2.4 100 cwt./acre yield ANOVA between the two field
locations for each growing season. The different letters denote
statistically significant values within the year ( = 0.05).
Year MRF – Irrigated CSSF – Non-irrigated
LSD
2007
195.37 - A
118.33 - B
16.76
2008
276.4 - A
261.7 - A
36.80
2009
79.6 – B
441 – A
46.68
2010
287.8 – A
183.59 - B
56.93

29

Table 2.5 Specific gravity ANOVA between the two field
locations for each growing season. The different letters denote
statistically significant values within the year ( = 0.05).
Year MRF – Irrigated CSSF – Non-irrigated
LSD
2007
1.066 - A
1.056 - B
0.0018
2008
1.073 - B
1.076 - A
0.0016
2009
1.068 - A
1.058 - A
0.0104
2010
1.069 - A
1.064 - B
0.0037

To compare the yield and specific gravity of each line the years were combined for
ANOVA of each location. OR2.6 was dropped from the analysis due to a significant loss of
plants at the CSSF location. The wild type control line, MSE149-5Y, had the greatest 100
cwt./acre yield mean at the CSSF location (Table 2.6). It was significantly greater than all the
transgenic lines except E74.8 and E74.9. The OSU lines had a significantly lower yield than the
MSU lines. There was little difference between the lines for specific gravity with OR1.11 being
significantly less than E74.16, E74.8 and E74.9 at the CSSF location. There was more difference
in specific gravity at the MRF location (Table 2.7). All of the OSU lines, except OR2.3, were
greater than all of the MSU lines. There were no significant differences between the MSU lines
for specific gravity. All of the OSU lines were significantly greater in yield than all of the MSU
transgenic lines. The WT control line was only significantly less than OR1.11 and significantly
greater than E74.16.
In 2008 and 2009 tuber samples from each line, and from each location, were submitted
for analysis of the percent glucose and sucrose. Between 2008 and 2009 there was a significant
difference in both percents of glucose and sucrose (Table 2.8). The percent glucose was highest
in 2009; however, the percent sucrose was highest in 2008. The combined percent glucose in

30

Table 2.6 2007-2010 CSSF 100 cwt./acre yields and
specific gravity; means with the same letter are not
significantly different ( = 0.05).
Line
100 cwt./acre
Specific Gravity
Yield Mean (LSD Mean (LSD = 0.009)
= 70.51)
MSE149-5Y
313.7 - A
1.061 - AB
E74.8
248.4 - AB
1.063 - A
E74.9
256.2 - AB
1.063 - A
E74.14
231.1 - B
1.058 - AB
E74.16
212.7 - B
1.062 - A
OR1.11
106.1 - C
1.053 - B
OR1.15
105.9 - C
1.058 - AB
OR1.2
105.5 - C
1.056 - AB
OR2.1
66 - C
1.055 - AB
OR2.3
51.34 - C
1.054 - AB

Table 2.7 2007-2010 MRF 100 cwt./acre yield and specific
gravity, means with the same letter are not significantly
different ( = 0.05).
Line
100 cwt./acre
Specific Gravity
Yield Mean (LSD Mean (LSD = 0.009)
= 72.63)
MSE149-5Y
277.88 - BC
1.068 - C
E74.8
205.4 - CD
1.070 - BC
E74.9
213.38 - CD
1.065 - C
E74.14
212.31 - CD
1.068 - C
E74.16
205.06 - D
1.069 - BC
OR1.11
384.75 - A
1.083 - A
OR1.15
350 - AB
1.082 - A
OR1.2
350.5 - AB
1.080 - A
OR2.1
336.5 - AB
1.081 - A
OR2.3
333 - AB
1.078 - AB

2008 and 2009 was within range for a chipping variety. The combined percent sucrose was high
in both years for a chipping variety. The percent glucose remained the same for each line in both
years at the CSSF under rain fed conditions (Tables 2.9 and 2.10).

In 2008, there was a

significant increase in both the percent glucose and sucrose in the tubers at the CSSF location. In

31

2009, the percent glucose at CSSF was lower than at the MRF location, however, the percent
sucrose increased at the CSSF similar to 2008.

Table 2.8 2008 and 2009 t-test of sugar analysis; means with the same letter are not
significantly different ( = 0.05).
Year
% Glucose means (LSD = 0.0021) % Sucrose means (LSD = 0.0033)
2008
0.0052 - B
0.6332 - A
2009
0.0105 - A
0.2945 - B

Table 2.9 2008 sugar analysis of tubers; means with the same letter are not
significantly different ( = 0.05).
MRF
CSSF
Line
% Glucose
% Sucrose
% Glucose
% Sucrose
MSE149-5Y
0.0034 - C
0.477 - C
0.012 - B
0.851 - BC
E74.8
0.0026 - A
0.411 - AB
0.005 - A
0.789 - AB
E74.9
0.0024 - A
0.462 - BC
0.006 - A
0.759 - A
E74.14
0.0032 - BC
0.389 - A
0.005 - A
0.802 - AB
E74.16
0.0028 - AB
0.490 - C
0.01 - B
0.901 - C

Table 2.10 2009 sugar analysis of tubers; means with the same letter are not
significantly different ( = 0.05).
MRF
CSSF
Line
% Glucose
% Sucrose
% Glucose
% Sucrose
MSE149-5Y
0.016 - A
0.222 - B
0.012 - A
0.396 -B
E74.8
0.012 - BC
0.191 - D
0.005 - B
0.367 - D
E74.9
0.011 - C
0.215 - C
0.006 - B
0.353 - E
E74.14
0.015 - AB
0.181 - E
0.005 - B
0.373 - C
E74.16
0.013 - ABC
0.228 - A
0.01 - A
0.419 - A

RT-PCR
To study the gene expression of the transgene and other stress-induced genes, RNA was
isolated from leaf tissue samples collected in the field from the transgenic and WT lines.
Reverse transcriptase PCR (RT-PCR) was then employed to semi-quantitatively measure the
gene expression of the transgene and two other stress inducible genes native to potato.
Arabidopsis CBF1 (AtCBF1), dehydrin 10 (DHN10), and S. tuberosum galactinol synthase 3
32

(StGolS3) genes along with 18S ribosomal control were used. The samples that were collected at
the MRF location are designated with the letter M and the samples collected at the CSSF location
are designated with the letter C. The times when the samples were collected are designated by
numbers following the letters (1 = pre-flowering, 2 = flowering, 3 = tuber bulking). In 2008, the
transgene AtCBF1 was expressed in all of the samples except E74.9 M3, E74.14 C2, and E74.16
M3; and was not found in the WT control MSE149-5Y (Figure 2.5). In the E74.8 line the three
highest expressing samples were M1, M2 and C2. In the E74.9 line the two highest expressing
samples were C1 and C3. In the E74.14 lines the three highest expressing samples were M1, M2
and C3. In the E74.16 the least expressing sample was C3. The stress-induced gene DHN10 was
found to be expressing at slightly varying levels across all the lines. In the WT control line
(MSE149-5Y) the two highest expressing samples were C1 and C2. In the E74.8 line the three
highest expressing samples were M1, M2, and C2. In the E74.9 line the two least expressing
samples were M3 and C3. In the E74.14 line the two least expressing samples were M3 and C2.
In the E74.16 line the least expressing sample was C3. The other stress-induced gene StGolS3
was expressed in most of the samples except MSE149-5Y C3, E74.8 C1 and C3, E74.9 C1 and
C3. In the WT line all of the samples were expressing at similar levels. In the E74.8 line the
three highest expressing samples were again M1, M2 and C2. In the E74.9 line the three highest
expressing samples were also M1, M2 and C2. In the E74.14 line the three highest expressing
samples were M1, M2 and C1. In the E74.16 line the two least expressing samples were M3 and
C3. The 18S ribosomal control was consistently expressed across all the lines and samples.
In 2010 for the MSU lines the AtCBF1 transgene was expressed in most of the transgenic
samples except E74.9 M1, M2, C2, and E74.14 C2 and all of the WT control lines (Figure 2.6).
In the E74.8 line the two highest expressing samples were C1 and C2. In the E74.9 line C1 was

33

the only expressing sample. In the E74.14 line M1 and M2 samples were the highest expressing.
In the E74.16 line the highest expressing sample was M2. The DHN10 gene was found to be
expressing in most of the samples except E74.9 M2 and C2, E74.14 C1 and C2, and E74.16 M2
and C2. In the WT line all of the samples were expressing at a similar level. In the E74.8 line,
C1 and C2 had slightly higher expression than the other two samples. In the E74.9 line C1 had
higher expression over M1. In the E74.14 line, M1 and M2 had similar expression. In the
E74.16 line M1 and C1 had similar expression. The StGolS3 gene was expressed in all of the
lines at varying degrees. In the WT line, C1 and C2 had the highest expression. In the E74.8
line, C1 and C2 also had the highest expression. In the E74.9 line, C1 had the highest
expression. In the E74.14 line M2 had the highest expression. In the E74.16 line, C1 had the
highest expression. The 18S ribosomal control was consistently expressed across all the lines and
samples.
In 2010 for the OSU lines, the AtCBF1 transgene was not detected in the 35S lines
(OR1.11-OR1.2, Figure 2.7). AtCBF1 expression was not found in any of the rd29A lines OR2.1
and OR2.3. The expression of AtCBF1 was weak for all of the expressing samples. The DHN10
gene was found to be expressing in most of the samples except OR1.11 M1, C1 and C2, and
OR1.2 C2. In the OR1.15 line, M2 was the highest expressing. In OR1.2 the expression was
similar across the three samples. The expression in OR2.1 and OR2.3 was weak but similar
across the samples. The StGolS3 gene was expressed in all of the samples at varying degrees
except OR2.1 M1. In OR1.11, OR1.15 and OR2.1 C1 and C2 were the highest expressing
samples. In OR1.2 C1 was the highest expressing sample. In OR2.3 M2 was the least expressing
sample. The 18S ribosomal control was consistently expressed across all the lines and samples.

34

Figure 2.5 Reverse Transcriptase PCR from the 2008 field trial. The gene expression of four different genes was visualized by
RT-PCR from RNA isolated from fresh leaf tissue collected in the field. The lane designations of M1, M2… C1, C2 denote the
location from which the sample was taken from (M = MRF, C =CSSF) and the number signifies the timing of the sampling (1 = preflowering, 2 = flowering, 3 = tuber bulking). The AtCBF1 gene is the transgene in the E74.8 – E74.16 lines and was expressing in all
of the samples except E74.9 M3, E74.14 C2, and E74.16 M3; and was not found in the WT control MSE149-5Y. The DHN10 gene is
a stress induced potato gene and was found to be expressing at slightly varying levels across all the lines. The S. tuberosum galactinol
synthase 3 gene, StGolS3, has also been found to be a stressed induced gene and downstream of the CBF regulon. It was being
expressed in most of the samples except MSE149-5Y C3, E74.8 C1 and C3, E74.9 C1 and C3. The 18S gene was the ribosomal
control gene used in all of the samples. The positive control for each primer set was RNA isolated from OR1.11 (35S:AtCBF1) grown
in tissue culture and the negative control was water used in place of cDNA in the reactions.

35

Figure 2.6 Reverse Transcriptase PCR from the MSU lines in the 2010 field trial. The gene expression of four different genes was
visualized by RT-PCR from RNA isolated from fresh leaf tissue collected in the field. The AtCBF1 transgene was expressed in most
of the transgenic samples except E74.9 M1, M2, C2, and E74.14 C2 and all of the WT control lines MSE149-5Y. The stressed
induced DHN10 gene was found to be expressing in most of the samples except E74.9 M2 and C2, E74.14 C1 and C2, and E74.16 M2
and C2. The other stress induced gene StGolS3 was expressed in all of the lines at varying degrees. The 18S gene was the ribosomal
control gene used in all of the lines. The positive control for each primer set was RNA isolated from OR1.11 (35S:AtCBF1) grown in
tissue culture and the negative control was water used in place of cDNA in the reaction.

36

Figure 2.7 Reverse Transcriptase PCR from the OSU lines in the 2010 field trial. The gene expression of four different genes was
visualized by RT-PCR from RNA isolated from fresh leaf tissue collected in the field. The AtCBF1 transgene was not detectable in
the 35S samples (OR1.11 – OR1.2). AtCBF1 expression was not found in any of the rd29A lines OR2.1 and OR2.3. The stressed
induced DHN10 gene was found to be expressing most of the samples except OR1.11 M1, C1 and C2, and OR1.2 C2. The other stress
induced gene StGolS3 was expressed in all of the samples at varying degrees except OR2.1 M1. The 18S gene was the constitutive
control gene used in all of the lines. The positive control for each primer set was RNA isolated from OR1.11 (35S:AtCBF1) grown in
tissue culture and the negative control was water used in place of cDNA in the reactions.

37

Discussion

Previous studies have shown that plants transformed with CBF genes are able to increase
their freezing tolerance as studied by electrolyte leakage assays (Jaglo-Ottosen et al., 1998; Pino
et al., 2007). The transgenic MSU lines were only able to increase their freezing tolerance after
they had been cold acclimated for 24 hr. E74.8 and E74.9 were the only two lines that were able
to increase their freezing tolerance to -2.5°C and -3°C, respectively. E74.14 and E74.16 did not
perform any better than the WT control, even when cold acclimated. The OSU transgenic lines
were not cold acclimated and had a similar freezing tolerance increase to that of the cold
acclimated MSU transgenic lines. The overexpressed OSU lines had the lowest percent ion
leakage, along with OR2.3 (under the inducible promoter), at -2°C. Surprisingly, OR1.2
performed similarly to the inducible promoter lines at the -2.5°C treatment. OR2.6 was the only
line that was not able to increase its freezing tolerance. It had previously been shown by Pino et
al. that with cold-acclimation, all of the lines increased their freezing tolerance to -5°C (2007).
Since the OSU lines were not cold acclimated in this study, they can only be compared to the
MSU lines that were not cold acclimated. In this comparison the OSU lines OR1.11, OR1.15,
OR1.2 and OR2.3 showed more freezing tolerance than the MSU lines. It has also been shown
in B. napus that the plants were able to increase freezing tolerance without cold acclimation
when the CBF gene was overexpressed (Jaglo et al., 2001). It is encouraging to see that at least
two of the MSU lines under inducible promoters were able to increase their freezing tolerance
when cold acclimated.
In order to truly test the transgene’s ability to confer abiotic stress tolerance, the MSU
transgenic lines were subjected to agronomic field trials for four years. There have been few

38

studies of transgenic crops tested for abiotic stress tolerance in the field (Waterer et al., 2010;
Dunwell, 2000; Schafleitner et al., 2007). Field trials are, however, the best way to determine if
a line (transgenic or not) is going to have the preferred agronomic traits and produce the needed
yield. From 2007-2010 the rain-fed only plot was planted at the Crop and Soil Science Farm
(CSSF) in East Lansing, MI and the control plot was planted at the Montcalm Research Farm
(MRF) in Entrican, MI. At the MRF site, irrigation was administered to the plot according to
best management practices. At the CSSF site, the plot was only rain-fed. Because of limited
resources, no roof or other modification to keep the field dry was implemented. The weather in
East Lansing consisted of irregular rainfall through out the field trials and induced a short-term
drought stress on the plot. It is standard practice for potato fields to receive between 20 to 24” of
water during a growing season. As seen in Figure 2.4, the CSSF location did not receive any
more than 16” in a season. Each year the plants at CSSF appeared water-stressed with leaf curl
in July, and wilting with early senescence in August.
To indirectly test if the plants at the CSSF location were experiencing an osmotic stress,
the sugar profiles of the tubers were analyzed in 2008 and 2009. In 2008 the percent glucose and
the percent sucrose were elevated at the CSSF location compared to the MRF location across all
the lines. In 2009, only the percent sucrose was elevated at the CSSF location. The percent
glucose levels at the MRF location were elevated in 2009 compared to 2008. Elevated sugar
levels have been associated with water deficit stress (Geigenberger et al., 1997). There was no
correlation between the transgenic lines and the WT control in the glucose and sucrose levels in
the tubers in either year. Interestingly, the % glucose at the CSSF location remained the same
between 2008 and 2009. The % sucrose level at CSSF was much higher for all of the lines and
this may be related to the fact that 2008 (15.63’) had slightly less rain then 2009 (16.1”) and that

39

a majority of the rain in 2009 fell in the early part of the season, and was very dry later during
the tuber bulking period of growth.
In 2007 and 2010, MRF had a much greater yield overall, than at CSSF. In 2008, there
was no significant difference in yield between the two locations. At CSSF, when all of the yields
had been combined from all four seasons, the WT control E149-5Y had the highest yield, even
under the dry conditions. However, E74.8 and E74.9 did not have a significantly less yield. As
noted previously, E74.8 and E74.9 were also the only two lines that increased their freezing
tolerance in the electrolyte leakage assay. The yields for the OSU lines were the lowest overall,
but they had only been grown in the field in 2010. Remarkably, the inducible OSU lines had
even lower yields than the constitutively expressed OSU lines. This result goes against the
notion that using an inducible promoter reduces negative phenotypes (Kasuga et al., 2004). At
the MRF location, the OSU lines did the opposite in terms of yield and had greater yields than
the MSU lines. This may be the result of including the 2009 yield data, in which the MSU lines
yielded significantly less than the other three years. However, seeing that the OSU lines could
perform as well as the MSU WT, this suggests that it was not the transgenic insertion that
decreased the yield under the stressed conditions. Even the overexpressing OSU lines were able
to give good yields at the MRF location. For this limited field trial of the OSU lines, it appears
they are not able to increase their drought tolerance and still perform to the agronomic standards.
There seemed to be a correlation between the electrolyte leakage data and the field data for the
MSU lines, however, the OSU results contradict the electrolyte leakage data from both this study
and Pino 2007. It would be interesting to see if the data trend would hold up over repeated field
trials of the OSU lines.

40

The specific gravity of all the lines combined tended to be higher at the MRF location
except in 2008. Most of the transgenic lines had specific gravities that were not significantly
different from each other and the WT at the CSSF location. Only OR1.11 had specific gravity
lower than E74.8, E74.9 and E74.16. At the MRF location the OSU lines had significantly
higher specific gravities than the MSU lines. Only OR2.3 was not significantly different from
E74.8 and E74.16. In general the water stress slightly decreased the specific gravity in the MSU
lines, and more dramatically decreased the specific gravity in the OSU lines.
Only the gene expression data from 2008 and 2010 was available as all of the RNA
samples from 2007 and 2009 were used up in attempts to optimize Northern hybridizations. The
expression of the AtCBF1 transgene was variable across the lines and between the locations.
There was little correlation between high gene expression in samples from the CSSF location. In
2008, the DHN10 stress induced gene was expressed across all of the lines, including the WT, at
both locations. High expression of DHN10 was seen in correlation with the expression of
AtCBF1 in E74.8 E74.14 and E74.16. The gene also had slightly higher expression in the WT in
the first two CSSF samplings. The StGolS3 gene was most closely correlated to the AtCBF1
expression in all of the lines. In 2010, AtCBF1 was expressed more in the CSSF samples than
the MRF samples. However, in E74.14 and E74.16 the AtCBF1 expression was the highest in
the MRF samples. In E74.9 the only sample that was positive for AtCBF1 expression was the
first one from CSSF. The expression of DHN10 was mostly correlated to the AtCBF1 expression
levels. The only sample that did not fit this model was the M2 from E74.16, where there was
strong AtCBF1 expression but no DHN10 expression. The StGolS3 gene was expressed across
all of the lines, and in the majority of the samples the level of its expression would mirror the
expression of AtCBF1. There is no strong evidence from the RT-PCR data that correlates with

41

any lines’ performance in the field or in the electrolyte leakage assay. In some lines and for
some samples the gene expression correlated with the field location, but in other samples there
was no correlation.
Some of the factors that may have contributed to the irregularity of AtCBF1 gene
expression in the transgenic lines may have been that the gene can become desensitized to the
stress and activation by mechanical agitation (Zarka et al., 2003). It was shown with CBF2 that
when the transgenic plant was kept at a low temperature for an extended period of time, that the
transcript levels would decrease and eventually be undetectable. The plants would need time to
recover at a warm temperature, then placed back in a cold temp treatment before the transcript
could be seen. This may be the case with the MSU transgenic lines in that they are constantly
being exposed to several abiotic stresses (water deficit, heat, etc.) and that the transcript level
may not be detectable at the time the sample was collected. The fact that CBF genes have been
found to be activated by mechanical agitation may also have been the reason for the gene to have
turned on in samples from both locations and at varying levels within lines and locations.
Overall it was found that E74.8 and E74.9 are the best candidates out of all the lines
tested. Both of these lines showed that they could decrease electrolyte ion leakage induced by
freezing temperature treatments by a couple degrees Celsius and were able to maintain a yield
similar to the WT under water stressed conditions. However, it should be noted that the yields at
the CSSF location were generally lower than at the MRF, and thus under ideal locations the
transgenic lines would not be the best candidates. Further field trials with the OSU transgenic
lines could reveal more about their ability to confer abiotic stress tolerance. Another way to
improve this type of research would be to better optimize the tissue sampling in the field to better
improve the gene expression data. As always, incorporting different genes under new and

42

different promoters may also lead to a transgenic potato that can confer abiotic stress tolerance
and maintain yield.

43

LITERATURE CITED

44

Dunwell, J. M. (2000). Transgenic approaches to crop improvement. Journal of Experimental
Botany 51(suppl 1): 487.
Geigenberger, P., Reimholz, R., Geiger, M., Merlo, L., Canale, V. &Stitt, M. (1997). Regulation
of sucrose and starch metabolism in potato tubers in response to short-term water deficit.
Planta 201(4): 502-518.
Jaglo, K. R., Kleff, S., Amundsen, K. L., Zhang, X., Haake, V., Zhang, J. Z., Deits, T.
&Thomashow, M. F. (2001). Components of the Arabidopsis C-Repeat/DehydrationResponsive Element Binding Factor Cold-Response Pathway Are Conserved inBrassica
napus and Other Plant Species. Plant Physiology 127(3): 910.
Jaglo-Ottosen, K. R., Gilmour, S. J., Zarka, D. G., Schabenberger, O. &Thomashow, M. F.
(1998). Arabidopsis CBF1 overexpression induces COR genes and enhances freezing
tolerance. Science 280(5360): 104.
Kasuga, M., Miura, S., Shinozaki, K. &Yamaguchi-Shinozaki, K. (2004). A combination of the
Arabidopsis DREB1A gene and stress-inducible rd29A promoter improved drought-and
low-temperature stress tolerance in tobacco by gene transfer. Plant and Cell Physiology
45(3): 346.
Li, W., Zarka, K., Douches, D., Coombs, J., Pett, W. &Grafius, E. (1999). Coexpression of
potato PVY (o) coat protein and cryV-Bt genes in potato. Journal of the American
Society for Horticultural Science.
Pino, M.-T., Skinner, J. S., Park, E.-J., Jeknić, Z., Hayes, P. M., Thomashow, M. F. &Chen, T.
H. H. (2007). Use of a stress inducible promoter to drive ectopic AtCBF expression
improves potato freezing tolerance while minimizing negative effects on tuber yield.
Plant Biotechnology Journal 5(5): 591-604.
Schafleitner, R., Gutierrez, R., Espino, R., Gaudin, A., Perez, J., Martinez, M., Dominguez, A.,
Tincopa, L., Alvarado, C. &Numberto, G. (2007). Field screening for variation of
drought tolerance in Solanum tuberosum L. by agronomical, physiological and genetic
analysis. Potato Research 50(1): 71-85.
Waterer, D., Benning, N. T., Wu, G., Luo, X., Liu, X., Gusta, M., McHughen, A. &Gusta, L. V.
(2010). Evaluation of abiotic stress tolerance of genetically modified potatoes (Solanum
tuberosum cv. Desiree). Molecular Breeding 25(3): 527-540.
Zarka, D. G. (2003). Cold Induction of Arabidopsis CBF Genes Involves Multiple ICE (Inducer
of CBF Expression) Promoter Elements and a Cold-Regulatory Circuit That Is
Desensitized by Low Temperature. Plant Physiology 133(2): 910-918.

45

Chapter 3

Evaluation of StCBF1 and ScCBF1 Transgenic Potatoes

Research Objectives
This research evaluates the CBF1 gene from Solanum tuberosum and S. commersonii
transformed into cv. MSE149-5Y and cv. Desiree under the stress inducible promoter COR15a.
The objectives were:
1. Genetically engineer MSE149-5Y and Desiree with two separate constructs of
COR15a:StCBF1 and COR15a:ScCBF1.
2. Evaluate the transgenic plants under osmotic stress to study the transgene’s ability to
confer stress tolerance.

Materials and Methods

Construction of Plasmids for Transformation
Two constructs were created for this study: pSPUD89 and pSPUD 90. The pSPUD89
vector contains the Solanum commersonii CBF1 (GenBank: EU849672.1) gene and the
Arabidopsis thaliana COR15a promoter (GenBank: U01377.1, Baker et al., 1994) in a vector
with a pBINPLUS (van Engelen et al., 1995) backbone with the nptII selectable marker (Figure
3.1A). The pSPUD90 vector has all of the same characteristics as pSPUD89 except it contains
the S. tuberosum CBF1 (GenBank: EU849677.1) gene (Figure 3.1B). Both of the S.
commersonii and

46

A.

B.

Figure 3.1 Schematic of p SPUD89 and pSPUD90 constructs. A. Contains the CBF1 from S.
commersonii. B. Contains the CBF1 from S. tuberosum. In both constructs the stress-inducible
promoter AtCOR15a directs the genes.

S. tuberosum genes were provided by Dr. Chen’s laboratory (Oregon State University, Corvallis,
OR) in glycerol stocks of the plasmids pZJ/ScCBF1 and pZJ/StCBF1. Both of the CBF1 genes
were excised from their respective plasmids by digesting the plasmids with HindIII and BamHI
(New England Biolabs Inc., Ipswich, MA) according to the manufacturers directions. The genes
were then PCR amplified using the following primers: ScCBF1 forward primer 5’-CCA GCT
GGC AGG AAG AAG TTT CG-3’, reverse primer 5’-GCC ATG TAA GCA TCA GCT TCC
ACA-3’, StCBF1 forward primer 5’- CCA GCT GGC AGG AAG AAG TTT CG-3’, reverse
primer 5’- TCT GCA CAT TGA GGT GGA GGT AGC A-3’. Two μL of the respective PCR
amplified CBF1 genes were used in 50 µL PCRs each containing: 10 µL 5X Green GoTaq®
Reaction Buffer, 1 µL dNTP mix 10mM, 0.25 µL GoTaq® DNA Polymerase (Promega,
Madison, WI), 1 µL of each primer 10mM, and 34.75 µL of nuclease free water. The PCR
amplifications were carried out under the following conditions: 94ºC of four min, 30 cycles of

47

94ºC for 60 secs, 60ºC for 90 secs, 72ºC for 90 secs, a final extension for four min at 72ºC and
held at 4ºC. The PCR products were run on a 1% agarose gel and the bands were excised and the
DNA was isolated using the QIAquick Gel extraction kit (Qiagen, Valencia, CA). The isolated
DNA was then digested with SacI and HindIII according to the manufacturer’s directions for
three hrs (New England Biolabs Inc.).
The pSPUD14 vector containing the COR15a promoter was digested with HindIII (New
England Biolabs Inc., Ipswich, MA) according to the manufacturer’s directions for three hrs then
heat inactivated at 65C for 20 min. The digested DNA was run on a 1% agarose gel to confirm
the digestion and to isolate the sample using the QIAquick Gel extraction kit (Qiagen). The
isolated COR15a gene and either the ScCBF1 or StCBF1 genes were ligated together with T4
ligase (New England Biolabs Inc.). The ligation was run on a 1% agarose gel and the band that
was at the appropriate size of approximately 1700 bp was excised and isolated using the
QIAquick Gel extraction kit (Qiagen).
The pSPUD77 vector (a pBINPLUS plasmid with a pBI121 based terminator) was
digested with HindIII (New England Biolabs Inc., Ipswich, MA) according to the manufacturer’s
directions for three hrs then heat inactivated at 65C for 20 min. Four microliters of purified
COR15a ligated to the respective CBF1 gene and one μL of the digested pSPUD77 were ligated
with T4 ligase (New England Biolabs Inc.). The reaction was incubated at room temp. for 12
min, and then transformed into E. coli DH5 Competent Cells (Invitrogen, Carlsbad, CA)
according to the manufacturer’s directions. After the cells had been plated out on LB Kan (50
g/mL) plates and colonies had been selected, the plasmids were isolated and purified with the
Wizard Plus SV Miniprep kit (Promega, Madison, WI) according to the manufacturer’s
directions.

48

The plasmids pSPUD89 and pSPUD90 were transformed into Agrobacterium
tumefaciens GV3101 (Holsters et al., 1980) by collecting 50 L of Agrobacterium cells growing
on a LB Kan plate and added the cells to one mL of ddH2O. The cells were vortexed briefly and
centrifuged at maximum speed for one min. The supernatant was discarded and the cells were
washed with one mL of ddH2O, mixed by pipetting and centrifuged at maximum speed for one
min. The wash step was repeated two more times. The supernatant was discarded leaving 100
L of cells and water. One microliter of purified plasmid was added to the cells and mixed by
gently pipetting up and down. The cells and plasmid mixture were transferred to a chilled
cuvette and were electroporated using the Ec2 setting (2.5 kV/cm) on the MicroPulser
Electroporator (Bio-Rad Laboratories, Hercules, CA).

One milliliter of LB liquid was added to

the cuvette and the mixture was transferred to a 1.5 mL Eppendorf tube. The tube was incubated
at 30C with shaking for one hr and then aliquots of the liquid were plated out on TY Kan plates
(5 g/L Bacto-tryptone, 3 g/L Yeast extract, 0.5 g/L CaCL2-2H2O, 15 g/L Agar, 50 m/mL
Kanamycin). The plates were incubated at 30C for 48 hrs.

Transformation
Transgenic Sc/StCBF1 potato lines were generated using an Agrobacterium mediated
transformation protocol adapted from (Cearley and Bolyard, 1997). Using a single
Agrobacterium colony of either pSPUD89 or pSPUD90 to inoculate three milliliters of TY
media with 50 m/mL Kanamycin (TY+Kan). The culture was grown overnight at room temp.
with 200 rpm shaking. The culture was then transferred to 50 mL of TY+Kan and grown
overnight at room temp with 200 rpm shaking. The next day stem internodes of the Michigan

49

State University breeding line MSE149-5Y and the cultivar Desiree were obtained from material
maintained in tissue culture as described in Chapter 2. The stems were cut into 0.5 – 1.0 cm
explant pieces, and placed in liquid MS medium (4.3 g/L MS Basal Salts, 20 g/L sucrose).
The Agrobacterium cultures were spun down for 15 min. at 3000 rpm. The supernatant
was discarded and the pellet was re-suspended in 25 mL of MS media. The absorbance of the
culture was measured at 600 nm and the culture was diluted to obtain an OD between 0.6 and
0.8. The stem explants were placed in the diluted Agrobacterium cultures and incubated for 20
min at room temp. The Agrobacterium culture was discarded and the explants were placed on
ZIG media plates (4.3 g/L MS Basal Salts, 20 g/L sucrose, 6 g/L Agar, 9.1 M zeatin riboside,
0.057 M, IAA, 0.577 M GA3, pH 5.7). The plates were sealed with parafilm and incubated at
-2 -1

22C with a 16/8 hr photoperiod (60-80 uEm s ) under four layers of cheesecloth. After four
days of co-culture, the explants were washed in sterile dH2O with Timentin (300 g/mL) then
placed on ZIG plus antibiotic plates (ZIG+Ab; see ZIG media above with the addition of 300
g/mL Timentin and 50 g/mL of Kanamycin). The plates were sealed with parafilm and
incubated under the same conditions above with the cheesecloth. Every 10-16 days the explants
were moved to new ZIG+Ab plates until shoots appeared. After the appearance of shoots the
cheesecloth was removed. When the shoots were approximately two centimeters long, they were
cut above the callus and placed on rooting media (4.3 g/L MS salts, 30 g/L sucrose, 1.4 mM
sodium phosphate, 1.1 μM thiamine, 0.55 mM myo-inositol, pH 6.0, 8 g/L Agar, 50 g/mL
Kanamycin). After rooting was obtained the plantlets were maintained in tissue culture in the
general MS prop media without antibiotics.

50

Molecular Characterization
For all of the transformed lines, DNA was isolated from fresh leaf tissue using the
DNeasy Plant kit (Qiagen) following the manufacturer’s directions. For each line approximately
200 mg of fresh leaf tissue was frozen in liquid nitrogen and ground to fine powder using a
mortar and pestle. In the final step, the DNA was eluted using 50 L of the provided Buffer AE.
PCR was used to confirm the presence of the transgene in each of the lines. The forward primer
5’-AGC TGA GAA AGC TGC GGC GT-3’ and the reverse primer 5’-CAG CTG GCC TTT
TTG GGT TAT TCG A-3’ were used for the lines transformed with pSPUD89. The forward
primer 5’-GCC GCT GAG GCT GCC GAA AT-3’ and the reverse primer 5’-GCG GCC GCT
GAA AAC GCA T-3’ were used for the lines transformed with pSPUD90. Each 50 µL PCR
amplifications contained: 10 µL 5X Green GoTaq® Reaction Buffer, 1 µL dNTP mix 10mM,
0.25 µL GoTaq® DNA Polymerase (Promega), 1 µL of each primer 10mM, and 34.75 µL of
nuclease free water. The PCRs were carried out under the following conditions: 94ºC of four
min, 30 cycles of 94ºC for 60 secs, 60ºC for 90 secs, 72ºC for 90 secs, a final extension for four
min at 72ºC and held at 4ºC. The PCR products were run on a 1% agarose gel using ten L of
the PCR product.

Osmotic in vitro Assay
To study the efficacy of the transgene’s ability to improve the plants ability to tolerate
osmotic stress, increasing concentrations of agar were used in media for an in vitro assay as
described by Gopal et al. (2008). Three concentrations of agar were used: six, eight, and ten g/L.
The media was made up also containing 4.3 g/L MS salts and 30 g/L sucrose with a pH of 5.7.
Ten milliliters of media were poured into 25 x 150 mm glass culture tubes. A node from tissue

51

culture grown plantlets of each transgenic line was placed in each of the three concentrations of
agar with three replications for each line, for a total of nine nodes from each line. MSE149-5Y
and Desiree nodes were also included as wild type controls. The cultures were incubated at 25C
-2 -1

with a 16/8 hr photoperiod (60-80 uEm s ) for 25 days. Over those 25 days the cultures were
observed for roots that penetrated the media (days to rooting). A line was declared to have
rooting when a root could be seen by the naked eye, and the root was penetrating the media. On
th

the 25 day the plantlets were gently removed from the media and the shoot height and root
lengths were recorded. Leaf tissue samples were also collected and immediately frozen in liquid
nitrogen.
Total RNA was isolated from the leaf tissue samples using the Spectrum Plant Total
RNA kit (Sigma-Aldrich Corp., St. Louis, MO) following the manufacturer’s directions for
protocol A. The RNA was then DNase treated using RQ1 RNase-Free DNase (Promega Corp.,
Madison, WI). RNA was quantified using a Nanodrop 8000 spectrometer (Thermo Fisher
Scientific Inc., Wilmington, DE). cDNA was obtained by reverse transcription as described in
Chapter 2. Eight microliters of cDNA were then used as template in 50 µL PCR reactions as
described above. The primers for ScSBF1 (pSPUD89) and StCBF1 (pSPUD90) listed above
were used and primers for 18S (Table 2.3) were used as the control. Ten microliters of each
reaction product was run on a 1% agarose gel.

52

Results

pSPUD89 and pSPUD90 Transformations
The Agrobacterium-mediated transformation using the GV3101 stain was effective in
producing transgenic potato lines with either of the Sc/StCBF1 genes. Six shoots were collected
from 50 MSE149-5Y explants transformed with pSPUD89. Four of these shoots rooted in the 50
µg/mL Kanamycin rooting media. Sixteen shoots were collected from 50 MSE149-5Y explants
transformed with pSPUD90; eight of these shoots rooted. All of the putative transgenic plants in
the MSE149-5Y background were denoted as E89 or E90 followed by shoot number. For some
lines, a letter denoting that the shoot was collected from the same explant but a different callus
piece follows the shoot line. Sixty-two shoots were collected from 100 Desiree explants
transformed with pSPUD89; 26 of these shoots rooted. Fifty-two shoots were collected from
100 Desiree explants transformed with pSPUD90; eighteen of these shoots rooted. All of the
putative transgenic plants in the Desiree background were denoted as Des89 or Des90 followed
by the shoot number and sometimes letter. All of the putative lines that were carried through
appeared phenotypically normal in the culture tubes.
For the E89 lines, all four were PCR positive for DNA amplification of the 353 bp
ScCBF1 fragment. One line was later lost due to contamination. There were five PCR positive
lines for DNA amplification of the 345 bp StCBF1 fragment out of the E90 lines (63%). There
were eleven PCR positive lines out of the Des89 lines (42%) and nine PCR positive out of the
Des90 lines (50%) (Table 3.1).

53

Table 3.1 PCR positive transformed lines for
pSPUD89 and pSPUD90.
MSE149-5Y PCR
Desiree PCR
positive
positive
transformed lines
transformed lines
E89.2B
E90.8
Des89.1 Des90.1A
E89.2D
E90.9
Des89.5 Des90.3B
E89.2E
E90.14 Des89.18 Des90.8
E90.15 Des89.27 Des90.11
Des89.29 Des90.15
Des89.32 Des90.18
Des89.37 Des90.20
Des89.43 Des90.24
Des89.45
Des89.47
Des89.48

Osmotic in vitro Assay
To study the transgene’s ability to confer stress tolerance in the transformed lines, an in
vitro osmotic assay was employed. In this assay three concentrations of agar were used: 6, 8 and
10 g/L. Typically 6 g/L are used in tissue culture and the increased concentrations of agar
created increased levels of osmotic stress for the plantlets. All of the transgenic lines were tested
at each of the agar concentration levels. The effect of the agar concentrations on each of the
transgenic lines varied widely. This first parameter that was measured was days to rooting, or
how long it took each plant to develop roots that penetrated the media. In the days to rooting
analysis only Des89.32, Des89.45, E89.2B, Des90.24 and the WT control Desiree took longer to
root as the concentration of agar increased (Figure 3.2). E90.14 and E90.15 rooted faster in the 8
and 10 g/L concentrations than the 6 g/L concentration. For all of the remaining lines there was
no significant difference between the concentrations in the number of days it took for the lines to
root. Within the 6 g/L Des89.1, Des89.37, Des90.1A and Des90.11 took significantly more days
to root than the WT control Desiree. Only E89.2E took significantly more days to root than the

54

WT control E149-5Y. None of the remaining lines took significantly less days to root than the
WT controls. Within the 8 g/L, Des90.15 took longer to root than Desiree, and E90.9 took fewer
days to root than E149-5Y. None of the other lines were significantly different from the WT
controls. Within the 10 g/L, only E89.2B took longer to root than E149-5Y. None of the other
lines were significantly different from the WT controls.
The root lengths of Des89.32, Des89.47, Des89.48, E89.2B, E89.2D, and E90.9
significantly decreased as the agar concentrations increased (Figure 3.3). The root lengths of
Des89.18, Des89.43, Des90.3B, Des90.15, Des90.20, E90.14 and E90.15 significantly increased
as the agar concentration increased. For all of the remaining lines there was no significant
difference between the concentrations for root lengths. Within the 6 g/L, all of the Desiree
transgenic lines, except Des89.27, had significantly shorter roots than Desiree. None of the
E149-5Y transgenic lines had either significantly shorter or longer roots than the WT control.
Within the 8 g/L, only Des89.45, Des90.8, and Des90.15 had roots that were not significantly
shorter than the WT control; all of the other lines had significantly shorter roots. Within the 10
g/L, only Des89.18, Des89.27, Des90.20, and Des90.3B had roots that were not significantly
shorter than the WT control. None of the E149-5Y transgenic lines were significantly different
from the WT control.
The shoot heights of Des89.32, Des89.47, Des89.48, E89.2B, E89.2D, and E90.9
significantly decreased as the agar concentration increased (Figure 3.4). The shoot heights of
Des89.18, Des89.43, Des90.3B, Des90.15, Des90.20, Des90.24, E90.14 and E90.15 significantly
increased as the agar concentrations increased. For all of the remaining lines there was no
significant difference between the concentrations for shoot heights. Within the 6 g/L only
Des90.3B and Des89.43 had significantly shorter shoots than the WT control. None of the other

55

lines were significantly different than the WT controls. Within the 8 g/L only Des90.18 was not
significantly shorter than the WT control, and only E89.2D’s shoots were significantly shorter
than the WT control. None of the other lines were significantly different from the WT controls.
Within the 10 g/L only Des89.18 and Des89.20 were not significantly shorter than Desiree.
E89.2B, E89.2D and E90.9 were significantly shorter than E149-5Y. None of the other lines
were significantly different from the WT controls.
Reverse transcriptase PCR was performed on the RNA that was isolated from all of the
leaf tissue samples that were collected from each line at each agar concentration. The primers
for either the Sc or StCBF1 genes were used. Only E89.2B and Des90.20 from the 10 g/L
concentration were positive for gene expression (Figure 3.5).

56

6 g/L

8 g/lL

10 g/L

20
18
16

No. of days

14
12
10
8
6
4
2

0

Lines
Figure 3.2 Days to rooting of transgenic lines in osmotic in vitro assay. Each of the Sc/StCBF1 transgenic lines were placed in
standard MS media with 3 different concentrations of agar: 6, 8 and 10 g/L. There were three replications of each line, for each
concentration, and the means and standard errors were calculated for each line. For the majority of the lines there was no significant
difference between the agar concentrations. Des89.32, Des89.45, E89.2B, Des90.24 and the WT control Desiree took longer to root as
the concentration of agar increased and E90.14 and E90.15 rooted faster in the 8 and 10 g/L than in the 6 g/L concentration.
57

6 g/L

8 g/L

10 g/L

18

16

Length (cm)

14
12
10
8

6
4
2
0

Lines
Figure 3.3 Root Length of transgenic lines in osmotic in vitro assay. For the majority of the lines there was no significant
difference between the agar concentrations. Des89.32, Des89.47, Des89.48, E89.2B, E89.2D, and E90.9’s root lengths significantly
decreased as the agar concentrations increased. Des89.18, Des89.43, Des90.3B, Des90.15, Des90.20, E90.14 and E90.15’s root
lengths significantly increased as the agar concentration increased.

58

6 g/L

8 g/L

10 g/L

18
16

Height (cm)

14
12
10

8
6
4
2
0

Lines

Figure 3.4 Shoot heights of transgenic lines in osmotic in vitro assay. For the majority of the lines there was no significant
difference between the agar concentrations. Des89.32, Des89.47, Des89.48, E89.2B, E89.2D, and E90.9 had significantly shorter
shoots as the agar concentration increased. Des89.18, Des89.43, Des90.3B, Des90.15, Des90.20, Des90.24, E90.14 and E90.15 had
significantly taller shoots as the agar concentrations increased.

59

- Control

+ Control

Des90.20

- Control

+ Control

E89.2B

ScCBF1

StCBF1

Figure 3.5 RT-PCR of Sc/StCBF1 transgenes from osmotic in vitro assay. RNA was isolated
from leaf tissue from all of the lines at each of the agar concentrations. Only E89.2B and
Des90.2 at the 10 g/L concentration were positive for expression of their respective transgenes.

Discussion

In total there were nine PCR positive lines for the transgene in the MSE149-5Y
background and 20 in the Desiree background. One of the projects that emerged during this
research was optimizing the Agrobacterium-mediated transformation of S. tuberosum.
Throughout this process the protocols for transformation and a regeneration system were
optimized using the protocol that was adapted from Cearley and Bolyard (1997) and using the
GV3101 Agrobacterium tumefasciences strain. These changes lead to increased transformation
efficiency and regeneration of the cv. Desiree, and slightly increased the transformation and
regeneration of cv. MSE149-5Y.
The osmotic in vitro assay that was adopted from (Gopal et al., 2008) was used to test the
efficacy of the transgene in the transgenic lines. Des89.32 and E89.2B consistently performed
poorly in the three parameters of number of days to rooting, root length, and shoot height.
Des89.47, Des89.48, E89.2D, and E90.9 also performed poorly in both the root length and shoot
height measurements. E90.14 and E90.15 consistently outperformed the WT and other lines in
all three parameters. Des89.18, Des89.43, Des90.3B, Des90.15, Des90.20 also outperformed the

60

WT and other lines in the root length and shoot height measurements. This assay is a crude tool
to evaluate lines, but Des89.32 and E89.2B could easily be removed from further studies if space
were an issue. Interestingly, E89.2B was one of the only two lines that had a positive result in the
RT-PCR. It may be that the high expression of the transgene in this plant is having negative
effects on its growth and development. The best candidate lines that stand out from this assay
are: Des89.18, Des89.43, Des90.3B, Des90.15, Des90.20, Des90.24, E90.14 and E90.15. These
lines were able to increase their root lengths and shoot heights as the agar concentrations
increased. Des90.20 was the other line that was positive for the transgene expression and this
line did well in the root and shoot measurements.
The issue with using the results of the root and shoot measurements is that it cannot be
determined if the transgene was responsible for increasing the root length and shoot height, or if
the increased root length caused the shoot height to increase. The only line that one can make a
weak conclusion is Des90.20 where there was transgene expression present, as measured by RTPCR. The expression of the transgene may be conferring tolerance to the osmotic stress and
allowing the plant to grow well under such conditions. Further analysis of all the lines in
osmotic stress studies in growth chambers and in the field would help to validate the results of
this in vitro study.
It is hypothesized that using either the S. commersonii or the native S. tuberosum CBF1
genes will confer more abiotic stress tolerance rather than using the AtCBF1 gene in cultivated
potatoes. Based on this preliminary data it is too early to tell if there are some potential
candidate lines that may outperform the E74.8 and E74.9 lines that have been previously studied.
There are, however, many other candidate genes out there that have been identified in both

61

potatoes and other plants that may hold more promise in bringing increased abiotic stress
tolerance.

62

LITERATURE CITED

63

Baker, S. S., Wilhelm, K. S. &Thomashow, M. F. (1994). The 5’-region of Arabidopsis thaliana
cor15a has cis-acting elements that confer cold-, drought-and ABA-regulated gene
expression. Plant Molecular Biology 24(5): 701-713.
Cearley, J. &Bolyard, M. G. (1997). Regeneration of Solanum tuberosum cv. Katahdin from leaf
expiants in vitro. American Journal of Potato Research 74(2): 125-129.
Gopal, J., Iwama, K. &Jitsuyama, Y. (2008). Effect of water stress mediated through agar on in
vitro growth of potato. In Vitro Cellular & Developmental Biology - Plant 44(3): 221228.
van Engelen, F. A., Molthoff, J. W., Conner, A. J., Nap, J. P., Pereira, A. &Stiekema, W. J.
(1995). pBINPLUS: an improved plant transformation vector based on pBIN19.
Transgenic Research 4(4): 288-290.

64

Chapter 4

A Study of the Effect of Information on College Students’ Attitudes Towards Genetically
Modified Potatoes.

Introduction
The social and scientific discussions on genetically modified (GM) foods and the public’s
opinion of them has been on going for decades. In Europe these discussions have led to tighter
regulations and an overall negative public opinion of GM crops that reached a high in the 1990’s
(Gaskell et al., 2004). In the United States there is no regulation on the labeling of GM foods
like there is in Europe, but there are some U.S. consumer groups that are calling for a change. If
the labeling requirements were to change, what kind of information would benefit the consumers
the most and how would that affect their buying practices? In the present study, college students
were given a questionnaire to study the effects of information on their attitudes towards
genetically modified potatoes.

Literature Review
Public Perceptions and Attitudes
In 2004, Hallman et al. found that in general American consumers are unaware of GM
food and the topics related to human health. The respondents expressed a desire for GM foods to
be labeled, however, they admit to having never sought after information on GM foods (Hallman
et al., 2004). They also found that Americans have little knowledge of the general facts of
genetic engineering technology. The respondents were in general split on their approval of GM

65

crops. Another group found that with a telephone survey in 2002, 34% of Americans were
against GM food (Ganiere, 2006).
Onyango (2004a) studied consumers’ willingness to consume GM foods. He found that
males, Caucasians, Southerners, and those with some college education were more willing to
consume GM foods. When the consumers were informed of the alleged risks associated with
GM food, their willingness to consume GM food significantly decreased. A related study found
that minorities and women were less approving of GM technology (Pudurl, 2005). They also
found that those with increased formal education were more accepting of plant-based GM
technology.
The consumers’ willingness to pay for GM products with a direct consumer benefit was
studied (Onyango, 2005). They found that consumers were more apt to choose products with
direct health, environmental and production related benefits. They also found that consumers
had more positive attitudes towards products that were plant-based instead of animal or bacterial
based. Another study found that consumers were more likely to choose nutritionally enhanced
food products if they had been developed through plant-plant methods as opposed to animalplant methods (Onyango, 2004b).
Tegene et al. (2003) studied the willingness of consumers to pay based on food labels.
They had three products that they used: vegetable oil, tortilla chips, and potatoes. Participants
also were given information packets that included either the industry, environmental
rd

(Greenpeace) or independent 3 party perspectives. All of the information packets had points
on scientific impact, human impact, financial impact and environmental impact. They found that
negative information had more of an impact than positive information, thus the consumers were

66

not willing to pay higher prices when they received more negative information. The lowest bids
overall were placed on GM potatoes.

Information Treatments
Developing effective communication strategies to inform the public on genetic
engineering of food is critical for successful commercialization of the technology. Qin and
Brown (2007) used two different information formats to explore the public’s understanding of,
interest in, and attitudes towards genetically modified salmon. They found that those that read
the “consequences” format learned more, were more interested, and expressed a higher level of
confidence in judgment than those that read the “perspective” format. They also found that
women were less approving of GM salmon than men. Through their pre and post measurements
they found that reading the information (either format) led to a positive change in attitude toward
the GM salmon.
Scholderer and Frewer (2003) used technology driven information formats to study
changes in consumer’s attitude towards GM foods in four European countries. Compared to the
control group that received no information, the treatment groups’ attitudes all decreased in their
preference for GM foods. They concluded that the technology driven information strategy is not
what is needed to convince consumers of the benefits to GM foods. Another study by Frewer et
al. (2003) studied the trust consumers have when information is provided by different sources
regarding GM food. Again they were in four European countries and provided the participants
with either product specific information or balanced/general information on genetic engineering
in food production. The participants were asked to evaluate beer or yogurt. There was very little
difference in the attitudes as it correlates to the type of information or the source of the

67

information. The participants’ trust depended on their pre-measured attitudes of GM foods.
Huffman et al. (2007) studied the effects of prior beliefs and learning on the consumers’
acceptance of GM foods. They found that uninformed participants were more susceptible to
information from interested and third parties. Informed participants were not significantly
affected by new information.
A study of Turkish high school and university students’ attitudes towards biotechnology
was recently conducted (Usak et al., 2009). They found that there was a strong statistical
correlation between the level of biotechnology knowledge and the sub dimensions of attitudes
towards biotechnology. They found no differences in attitudes between genders. Attitudes
towards purchasing GM foods were negative, despite an appreciation of agricultural
biotechnology.

GM Potatoes and Acrylamide
In 1995 Monsanto released a new potato variety that had been genetically modified to
contain the Bt cry3a gene, making the potato resistant to an important potato pest – the Colorado
Potato Beetle (Thornton, 2003). The potatoes were marketed under the brand NewLeaf and
over the course of several years the potatoes went under several other modifications to make
them resistant to two potato viruses. Initially growers quickly adapted the new technology and
were pleased to reduce their insecticide costs. The difficulties that can come with the new
technology, however, became apparent in the potato processing industry. Potatoes were one of
the first genetically modified (GM) foods that still looked like it came from potatoes when
consumers saw it on their plate. Because of this, industry wanted to make sure that the GM
potatoes remained separate for the non-GM throughout the processing chain. This division in the

68

processing plants was costing the processors more than they intended, and they thus passed this
cost on to the growers (Thornton, 2003). By 1999 the percent of potato acreage that was planted
as NewLeaf significantly decreased, and by 2001 Monsanto shut down their potato
biotechnology program. Since then, there have not been any genetically modified potatoes
released for production and consumption in the U.S.
Acrylamide is a chemical compound that is both used in the chemical industry and can be
naturally formed in some foods when cooked. In 2002, Swedish scientists found that acrylamide
could naturally form in foods with high carbohydrate levels when they were baked at high
temperatures (Vinci et al., 2011). It was later found that acrylamide levels form at significant
levels when the amino acid asparagine is present with reducing sugars from carbohydrates and
the food is heated to a high temperature. Elevated levels of acrylamide have been found in
coffee, baked goods, roasted and processed potatoes. Acrylamide has been shown to be a
neurotoxin and carcinogenic compound in rodents, and is thus a possible human carcinogen
(Friedman et al., 1995). In 2005, the World Health Organization (WHO) along with the Food
and Agriculture Organization of the United Nations (FAO) recommended that the
carcinogenicity of acrylamide in humans continue to be studied and that appropriate efforts to
reduce acrylamide concentrations in food should continue (WHO/FAO, 2005).
Genetically modifying cultivated potatoes is one approach scientists have taken. In 2008
a group of scientists reported altering the asparagine levels in potatoes by incorporating tuberspecific silencing of two genes in the asparagine biosynthesis pathway (Rommens et al., 2008).
This transgenic method was also novel in that it employed all-native (only potato) genes in the
genetic modification. They concluded that if these low-asparagine potatoes replaced the
conventional potatoes, people could reduce their acrylamide consumption by 30%. In 2010, the

69

same group reported another method to reduce over all acrylamide levels by silencing another
gene that reduces the levels of reducing sugars in the tubers during cold storage (Ye et al., 2010).
The purpose of this study is to investigate the effect of information on college students’
attitudes towards a genetically modified food. The low-acrylamide potatoes were used as the
example of a genetically modified crop that provides a direct benefit to the consumer. In the
treatment group, the students are provided with information on the new findings of acrylamide’s
potential harmful effects. The students are also provided with some information on GM crops in
general, and on the specific low-acrylamide GM potatoes. The control group is not introduced to
the acrylamide issue and is only provided with the same information on GM crops in general and
some very basic information on genetically modified potatoes. It is hypothesized that the
treatment group will have a more favorable attitude towards the GM potatoes knowing they
provide a direct consumer benefit.

Methods and Materials

Questionnaire Design and Administration
Two versions of the questionnaire were developed and managed via surveymonkey.com.
The control questionnaire was slightly shorter as it did not contain any reading or questions on
acrylamide. The treatment questionnaire included information and questions on acrylamide and
also contained more detail in the GM potato reading about low-acrylamide potatoes. The
treatment group was also asked of their likelihood of seeking out more information on
acrylamide and GM potatoes.
Participants were recruited from Integrative Studies of Social Sciences classes at
Michigan State University in the spring of 2011. The students were asked to voluntarily respond
70

to the questionnaire that would be sent to them via email. It was explained that the questionnaire
would be completely anonymous and the outcome would have no effect on their grade. In order
to randomly divide up the respondents between the two versions of the questionnaire the students
were instructed in the email to click on the first link if the last digit of their phone number was
between 0-4 and to click on the second link if the last digit was between 5-9.

Measurements
The majority of the questions used a 5-point Likert scale with 3 being neutral. Some
questions only needed a yes or no response, while a few others only used four levels. The
demographic questions were used to gather typical demographic data in addition to some more
detailed data on the student’s educational background. The full questionnaires can be found in
Appendix A.

Pre and Post Measurements
For the pre-measurements respondents were asked about their potato consumption, both
fresh and processed potatoes. They were asked if they have heard of genetically modified (GM)
crops, and to self rate their knowledge of GM crops. The treatment group was also asked if they
have heard of acrylamide and to self rate their knowledge of acrylamide. Each section contained
a short reading passage and the respondents were asked to rate the difficulty and trustworthiness
of the reading. Only the treatment group was asked the post measurements of their likelihood of
seeking out more information on acrylamide and GM potatoes.

71

Data Analysis
SAS 9.2v was used to analyze the results (Cary, NC). The PROC GLM program with the
control and treatment groups as a class was used to compare the two groups for each of the
questions. To explore the many effects of each of the sub-classes, t-tests using the least
significant difference (LSD) at  = 0.05 were used for each question.

Results

Respondents
A total of 113 completed the survey for the treatment group and 130 for the control
group. Similar percentages of males and females responded to both the treatment (30.4% male,
69.6% female) and control (34.6% male, 65.4% female) questionnaires, and there was no
significant difference between the two groups. In both groups the majority of the respondents
(86.7% treatment, 82.3% control) were 20 years old or younger. This younger age is also
reflected in the majority of respondents being of either freshman or sophomore standing. There
was no significant difference in the distribution of GPA between the two groups. There was also
no significant difference between the two groups in the racial/ethnic distribution (Table 4.1).
There was a higher percentage of Asians that responded to the questionnaire than the percentage
at the University level.

72

Table 4.1 Distribution of race/ethnicity between the treatment and
control groups, and the total student population at Michigan State
University.
Treatment
Control
Responses
MSU
group
group
American Indian/Alaskan
2.7%
1.6%
0.4%
Native
Asian
8.8%
11.6%
4.3%
Black or African American
5.3%
6.2%
6.5%
Chicano
0.9%
0.8%
No data
Hawaiian/Pacific Islander
2.7%
0%
0.1%
Hispanic
2.7%
3.9%
3.3%
White/Caucasian
82.3%
77.5%
69.5%
Other
3.5%
6.2%
3.6%

Effect of Information: Treatment versus Control
There was no significant difference between the two groups on whether they have heard
of genetically modified (GM) crops and their self rated knowledge of GM crops. Both groups
had mostly heard of GM crops (Yes: 93% treatment, 85.3% control) and said they were
“knowledgeable.” The control group did differ in their ratings of the difficulty and
trustworthiness of the reading passage. The control group found the GM crops reading slightly
more difficult and less trustworthy than the treatment group. Both groups “approved” of GM
crops for human consumption. The control group said GM foods were slightly more risky than
the treatment group. Both groups were “willing” to consume foods with GM ingredients and
were “confident” in their understanding of how GM crops are tested and regulated.
For the GM potato portion of the questionnaire there were significant differences in the
content of the reading passages. The control group had a very short reading:
“Each year the average American consumes 126 pounds of potatoes. Currently in
the U.S., none of the potatoes grown for human consumption are genetically
modified. However, scientists are currently developing GM potatoes.”

73

The treatment group had a longer reading that contained more content on acrylamide as they had
been previously read a passage and answered a few questions on acrylamide:
“Each year the average American consumes 126 pounds of potatoes. Currently in
the U.S., none of the potatoes grown for human consumption are genetically
modified. In response to the findings of elevated levels of acrylamide in cooked
potatoes, scientists have developed a GM potato that results in significantly lower
levels of acrylamide when cooked. This GM potato was modified by moving two
potato genes into an area of the potato genome where they are able to “turn down”
the genes responsible for making the amino acid asparagine (the amino acid that
when present with starch produces acrylamide). The scientists state that if the
GM Low-Acrylamide potatoes replaced conventional potato varieties, people
could reduce their acrylamide consumption by 30%.”
The treatment group did find their reading more difficult than the control group. Both groups
found the reading trustworthy, but the treatment group found the GM potato reading slightly less
trustworthy than the GM crops reading. Both groups were “confident” in their understanding of
how the GM potatoes are developed; however, the control group was “neutral” in their
understanding of the effects of GM potatoes on consumer’s health. The control group was less
approving of GM potatoes for human consumption and said GM potatoes are less safe compared
to the treatment group. There was no difference between the groups as they were both “willing”
to consume foods with GM potato ingredients, said it was “important” to be informed about GM
potatoes, and “neutral” in their interest to receive more information on GM potatoes.

Male/Female Differences
The males had heard of GM crops less than the females, but both groups reported to be
“knowledgeable” of GM crops. Both groups rated the difficulty and trustworthiness of the
reading as “easy” and “trustworthy.” The females, however, were less approving of GM crops
for human consumption, less willing to consume foods with GM ingredients and less confident

74

in understanding how GM crops are tested and regulated (Table 4.2). Both males and females
deemed the risk of GM food in terms of effects on human health “risky.”
For the GM potato section there were no significant differences between males and
females for all of the questions. The females had slightly increased their approval of GM
potatoes from their approval of GM crops, and were slightly more willing to consume foods with
GM potato ingredients.
Within the control group, males were more approving of GM crops, and were more
willing to consume foods with GM and GM potato ingredients. There was no difference
between the two groups on their rating of the risk of GM crops and GM potatoes. Within the
treatment group there were no significant differences between males and females in their
approval, assessment of risk or willingness to consume either GM crops or GM potatoes.

Race
Chicanos and Others have heard of GM crops less than Hawaiian/Pacific Islanders,
Hispanics, and White/Caucasians. Chicanos are more willing to consume foods with GM
ingredients than Others, American Indian/Alaskan Natives, Asians, and Black/African
Americans. Hawaiian/Pacific Islanders were less confident in understanding how GM crops are
tested and regulated than Others. American Indian/Alaskan Natives, Black/African Americans,
and Hawaiian/Pacific Islanders are less willing to consume GM potatoes than Chicanos.
Chicanos felt it was less important to be informed on GM L-A potatoes than Black/African
Americans and Others. Chicanos were also the least interested in receiving more info than
Asians, Black/African Americans, Hawaiian/Pacific Islanders, White/Caucasians and Others.

75

White-Males
Within the control group, white males and white females were more willing to consume
foods with GM or GM potato ingredients than minority females. Within the treatment group,
white males and white females were more approving of GM crops than minority males and
females. Minority males said GM crops are more risky than minority females, white males and
white females. White males and white females are more willing to consume foods with GM
ingredients than their minority counterparts. White males were more approving of GM potatoes
than minority males and minority females. White males said GM potatoes were less risky than
minority males. White males were more willing to consume foods with GM potato ingredients
than minority males.

Other Class Effects
Consumption of Potatoes
There was no significant difference in potato consumption between the control and
treatment groups or between males and females. Within the control and treatment groups those
that never eat baked or mashed potatoes said the risk of GM food and GM potatoes in terms of
effects on human health was more risky than those that eat baked or mashed potatoes 2-4
times/week. Within the control group those that eat processed potatoes daily were more willing
to consume foods with GM potato ingredients than those that only eat processed potatoes 2-4
times/year or never. Within the treatment group, those that eat processed potatoes daily were
more approving of GM crops and were more willing to consume foods with GM ingredients
those that eat them 2-4 times/year. Those that only eat processed potatoes 2-4 times/year said
GM crops are more risky than those that eat them 2-4 times/week. Those that eat processed

76

potatoes 2-4 times per year were less approving of GM potatoes for human consumption, and
were less willing to consume foods with GM potato ingredients than those that eat them daily, 24 times/week and 2-4 times/month.

Number of College Level Biology Courses Taken
There were no significant differences between the control and treatment groups or
between males and females for the number of biology courses taken. Those that had no college
biology courses declared themselves “less knowledgeable” about GM crops than those that have
had 3 or more classes. Those that have had no college biology courses found the GM crops
reading more difficult than those with 5 or more classes. Those that had 2 or less classes found
the reading less trustworthy, and were less confident in understanding how GM potatoes are
developed than those with 5 or more classes. Those with 5 or more classes said GM potatoes are
safer than those with 4 or less classes (Table 4.3). Those with 5 or more classes said it was more
important to them to be informed and were more interested in receiving more information than
those with 2 or less classes. Within the treatment group, those than have taken 3 or more biology
courses said the GM potatoes were less risky than those that have taken 2 or less biology courses.

Self-Rated Knowledge of GM Crops
There were no significant differences between the control and treatment groups or
between males and females in their self-ratings on their knowledge of GM crops. Within the
control group those that were “very knowledgeable” were more approving than those that were
“knowledgeable,” “not very knowledgeable” or “not at all” for approval of GM crops and GM
potatoes for human consumption. Those that were very knowledgeable and knowledgeable were

77

more neutral on the risk of GM food in terms of effects on human health. Those that were very
knowledgeable were also more neutral on the risk of GM potatoes. The two knowledgeable
groups were also more willing to consume foods with GM ingredients than the less
knowledgeable groups. The very knowledgeable were more willing to consume products with
GM potato ingredients than those claimed to be not knowledgeable at all.
Within the treatment group, those that were not knowledgeable at all were less willing to
consume products with GM ingredients than those that were knowledgeable. Those that were
not knowledgeable at all were less approving of GM potatoes than those that were very
knowledgeable. Those that were very knowledgeable said GM potatoes were less risky than
those that were not knowledgeable. Those that were not knowledgeable at all were less willing
to consume foods with GM potatoes ingredients than the other knowledgeable groups.
Table 4.2 Average of responses separated out by gender and race-gender.
Male
Approve GM crops
Less Approval

X

Willing to eat GM
crops
Less willing to eat

X

Approve GM
potatoes
Less approval

X

GM potatoes risky
GM potatoes safe

X

Willing to eat GM
potatoes
Less willing to eat

X

WhiteMale

WhiteFemale

X

X

GM crops risky
GM crops safe

Female

X

X

MinorityFemale

X

X

MinorityMale

X

X
X

X

X

X

X

X

X

X

X

X

X
X
X

X

X

X

X

X

X

X

X

X

X

78

Table 4.3 Average of responses separated out by self-declared knowledge of GM crops
and number of college biology courses.
Very
Knowledgeable
of GM crops
Approve GM crops
Less Approval
GM crops risky
GM crops safe

Less
Knowledgeable
of GM crops

5 or more
College
Biology
Courses

Less than 5
College
Biology
Courses

X
X
X
X

Willing to eat GM
crops
Less willing to eat

X

X

Approve GM
potatoes
Less approval

X

X

GM potatoes risky
GM potatoes safe
Willing to eat GM
potatoes
Less willing to eat

X

X
X
X

X
X

X
X

Discussion

The attempt to randomize the respondents between the control and treatment groups was
successful as there were no significant differences between the two groups. Unlike Hallman et
al., (2004) the students in this study were all aware of GM crops at some level, and many
reported that they were very/knowledgeable on the subject.
The effect of the information on the students’ attitude was in general favorable towards
genetically modified (GM) potatoes. These results contradict the results from studies using
European participants whose attitudes towards GM foods became more negative when

79

information was provided (Frewer et al., 2003; Frewer, 2003). In another study that looked at
the consumers’ prior beliefs and learning and their relation to acceptance of GM foods, they
found that informed participants were not affected by the new information (Hallman et al.,
2004). In this study, most of the students claimed they were knowledgeable about GM crops, yet
they were receptive to the new information. This may have been that the information provided
about the low-acrylamide potatoes was much more novel than the GM crops that are on the
market at this time, or that their interest in the possible health effect of acrylamide made them
more receptive to the new information. Although the treatment group was more approving of
GM potatoes, and said they were less risky than the control group; the two groups were similar in
their willingness to consume GM potatoes. The students that have had five or more college
level biology classes viewed the GM potatoes as safer and were more approving of them than
their peers with less biology courses. They also, not surprisingly, had more confidence in
understanding how the GM potatoes were developed. Corresponding to the Turkish student
study, these students with a lot of biology education were no more willing to consume GM
potatoes than all of their peers (Usak et al., 2009).
One interesting difference early on between the control and the treatment groups was that
they did differ in their ratings of the difficulty and trustworthiness of the GM crops reading
passage. Both groups had the exact same GM crops reading passages, however, the treatment
group had just read and answered questions about acrylamide. This may have affected the
treatment group’s responses to the reading.
Analogous to Onyango’s findings; our study also showed that females and minorities
were less approving of GM crops and less willing to consume foods with GM ingredients
(Onyango, 2004a). The information treatment increased females’ approval of GM potatoes and

80

willingness to consume, but had no significant effects on the males. It was investigated to see if
this study also revealed a “white-male effect.” There is a growing body of evidence that men
worry less than women, and whites less than minorities on topics from environmental pollution
to abortion (Bord and O'Connor, 1997; Wilcox, 1990). Kahan et al. (2007) supports the theory
that the white-male effect is an artifact of variance in cultural worldviews. The white-males’
insensitivity to risk is based on a defensive response to maintain the cultural identity of the risk
insensitive white-male. Indeed it was found that white-males, along with white females, were
less sensitive to the perceived risks of GM crops. In the treatment group, minority females were
more influenced than minority males by the information and the minority females shifted closer
in their responses to the white females.
Overall this study illustrates that providing information to potential consumers about a
genetically modified food that provides a direct benefit to the consumer improves the consumers’
approval of the food for human consumption. It also reduces the consumer’s perception of the
risks associated with the GM food. These results can give scientists, marketing groups and
policy makers a platform on which to build their information formats they wish to provide to
consumers regarding the next wave of genetically modified food crops.

81

LITERATURE CITED

82

Bord, R. J. & O'Connor, R. E. (1997). The gender gap in environmental attitudes: The case of
perceived vulnerability to risk: Research on the environment. Social Science Quarterly
78(4): 830-840.
Frewer, L. (2003). Societal issues and public attitudes towards genetically modified foods.
Trends in Food Science & Technology 14(5-8): 319-332.
Frewer, L. J., Scholderer, J. & Bredahl, L. (2003). Communicating about the Risks and Benefits
of Genetically Modified Foods: The Mediating Role of Trust. Risk Analysis 23(6): 17.
Friedman, M. A., Dulak, L. H. & Stedham, M. A. (1995). A lifetime oncogenicity study in rats
with acrylamide. Toxicological Sciences 27(1): 95.
Ganiere, P. W. S. C., & David Hahn (2006). A Continuum of Consumer Attitudes Toward
Genetically Modified Foods in the United States. Journal of Agricultural and Resource
Economics 31(1): 129-149.
Gaskell, G., Allum, N., Wagner, W., Kronberger, N., Torgersen, H., Hampel, J. & Bardes, J.
(2004). GM foods and the misperception of risk perception. Risk Analysis 24(1): 185194.
Hallman, W. K., Hebden, W. C., Cuite, C. L., Aquino, H. L. & Lang, J. T. (2004).Americans and
GM Food: Knowledge, Opinion and Interest in 2004. 21 New Brunswick, New Jersey:
Food Policy Institute, Cook College, Rutgers.
Huffman, W. E., Rousu, M., Shogren, J. F. & Tegene, A. (2007). The effects of prior beliefs and
learning on consumers’ acceptance of genetically modified foods. Journal of Economic
Behavior & Organization 63(1): 193-206.
Kahan, D. M., Braman, D., Gastil, J., Slovic, P. & Mertz, C. K. (2007). Culture and IdentitiyProtective Cognition: Explaining the White-Male Effect in Risk Perception. Journal of
Empirical Legal Studies 4(3): 41.
Onyango, B. (2004a). Consumer Acceptance of Genetically Modified Foods: The Role of
Product Benefits and Perceived Risks. Journal of Food Distribution Research 35(1): 7.
Onyango, B. G., Ramu (2005). Consumer Willingness to Pay for GM Food Benefits: Pay-off or
Empty Promise? Implications for the Food Industry Choices 20(4): 3.
Onyango, B. M. & Rodolfo M. (2004b). Consumer Acceptance of Nutritionally Enhanced
Genetically Modified Food: Relevance of Gene Transfer Technology. Journal of
Agriculture and Resource Economics 29(3): 16.
Pudurl, V. G., Ramu; Lang, John T.; and Onyango, Benjamin (2005). I Will Not Eat It with a
Fox; I Will Not Eat It in a Box: What Determines Acceptance of GM Food for American
Consumers? Choices 20(4): 257-261.

83

Qin, W. & Brown, J. L. (2007). Public Reactions to information about genetically engineered
foods: effects of information formats and male/female differences. Public Understanding
of Science 16: 17.
Rommens, C. M., Yan, H., Swords, K., Richael, C. & Ye, J. (2008). Low-acrylamide French
fries and potato chips. Plant Biotechnology Journal 6(8): 843-853.
Scholderer, J. & Frewer, L. J. (2003). The Biotechnology Communication Paradox:
Experimental Evidence and the Need for a New Strategy. Journal of Consume Policy 26:
27.
Thornton, M. (2003). The Rise and Fall of NewLeaf Potatoes. NABC Report 15: Biotechnology
Science and Society at a Crossroad.: 235-243.
Usak, M., Erdogan, M., Prokop, P. & Ozel, M. (2009). High school and university students'
knowledge and attitudes regarding biotechnology. Biochemistry and Molecular Biology
Education 37(2): 123-130.
Vinci, R. M., Mestdagh, F. & De Meulenaer, B. (2011). Acrylamide formation in fried potato
products-Present and Future, a critical review on mitigation strategies. Food Chemistry.
WHO/FAO (2005). Joint FAO/WHO expert committee on food additives. (Ed J. O. Larsen,
Monica). Rome.
Wilcox, C. (1990). Race differences in abortion attitudes: Some additional evidence. Public
Opinion Quarterly 54(2): 248.
Ye, J., Shakya, R., Shrestha, P. & Rommens, C. M. (2010). Tuber-Specific Silencing of the Acid
Invertase Gene Substantially Lowers the Acrylamide-Forming Potential of Potato. J
Agric Food Chem.

84

APPENDIX

85

Questionnaire
The sections in italics were only included in the treatment group’s questionnaire.
1. How often do you eat mashed or baked potatoes?
A. Daily
B. 2-4 times/week
C. 2-4 times/month
D. 2-4 times/year
E. Never
2. How often do you eat fried or processed potatoes (i.e. French fries, chips, hash-browns)?
A. Daily
B. 2-4 times/week
C. 2-4 times/month
D. 2-4 times/year
E. Never
3. Have you heard of acrylamide?
A. Yes
B. No
4. How knowledgeable are you about acrylamide?
A. Very knowledgeable
B. Knowledgeable
C. Not very knowledgeable
D. Not at all
Acrylamide Reading Passage:
Acrylamide is a compound found in food that contains starch and the amino acid
asparagine. It is formed when it is cooked under a high-temperature process (baking, frying,
roasting). French fries, potato chips, breakfast cereal and coffee contain elevated levels of
acrylamide. Acrylamide has the potential to cause cancer according to national and
international food and health organizations*. It is recommended by these national and
international agencies that consumers avoid foods that have been over-cooked (i.e. dark brown
fries, toast) to lower acrylamide consumption.
*The Food and Drug Administration (FDA), Centers for Disease Control and Prevention (CDC)
and World Health Organization (WHO)

86

Acrylamide Questions:
1. For you, how difficult was it for you to read the passage?
A. Very easy
B. Easy
C. Okay
D. Somewhat difficult
E. Difficult
2. For you, how trustworthy was the reading?
A. Completely trustworthy
B. Somewhat trustworthy
C. Neutral
D. Somewhat untrustworthy
E. Completely untrustworthy
How confident are you in understanding:
3. Where acrylamide is found?
A. Very confident
B. Confident
C. Neutral
D. Somewhat unconfident
E. Not confident
4. How it is formed in food?
A. Very confident
B. Confident
C. Neutral
D. Somewhat unconfident
E. Not confident
5. Acrylamide’s potential effects on human health?
A. Very confident
B. Confident
C. Neutral
D. Somewhat unconfident
E. Not confident
6. Overall, how important is it to you to be fully informed about acrylamide?
A. Very important
B. Important
C. Neutral
D. Slightly unimportant
E. Not important at all

87

7. How interested are you in receiving more information on acrylamide?
A. Very interested
B. Interested
C. Neutral
D. Slightly uninterested
E. Not interested at all
Genetically Modified Crops Section:
1. Have you heard of genetically modified crops?
A. Yes
B. No
2. How knowledgeable are you about genetically modified crops?
A. Very knowledgeable
B. Knowledgeable
C. Not very knowledgeable
D. Not at all
GM Crops:
Genetically modified (GM) crops are produced by moving genetic material from one
species to another species; for example a corn plant that is resistant to insect damage has been
produced by incorporating genetic material from a bacteria into the corn’s genetic material. In
U.S. agriculture, food from some GM crops has been grown and consumed by animals and
humans since the mid 1990’s.
In the U.S., GM crops are tested, inspected and regulated by the United States
Department of Agriculture (USDA), the Food and Drug Administration (FDA) and the
Environmental Protection Agency (EPA). Before a GM crop can be approved for production
and consumption, it must be tested for many aspects pertaining to human and animal health
impact (i.e. allergies, toxins) and environmental impact.
GM Questions:
1. For you, how difficult was it for you to read the passage?
A. Very easy
B. Easy
C. Okay
D. Somewhat difficult
E. Difficult
2. For you, how trustworthy was the reading?
A. Completely trustworthy
B. Somewhat trustworthy
C. Neutral
D. Somewhat untrustworthy
E. Completely untrustworthy

88

3. Overall, how do you feel about the use of GM crops for human consumption?
A. Strongly approve
B. Approve
C. Neutral
D. Disapprove
E. Strongly disapprove
4. How risky would you say GM foods are in terms of their effects on human health?
A. Very risky
B. Somewhat risky
C. Neutral
D. Safe
E. Very Safe
5. How willing are you to consume foods produced with GM ingredients?
A. Very willing
B. Somewhat willing
C. Neutral
D. Slightly unwilling
E. Not willing at all
6. How confident are you in understanding how GM crops are tested and regulated?
A. Very confident
B. Confident
C. Neutral
D. Somewhat unconfident
E. Not confident
GM Low-Acrylamide Potato:
Each year the average American consumes 126 pounds of potatoes. Currently in the
U.S., none of the potatoes grown for human consumption are genetically modified. In response
to the findings of elevated levels of acrylamide in cooked potatoes, scientists have developed a
GM potato that results in significantly lower levels of acrylamide when cooked. This GM potato
was modified by moving two potato genes into an area of the potato genome where they are able
to “turn down” the genes responsible for making the amino acid asparagine (the amino acid that
when present with starch produces acrylamide). The scientists state that if the GM LowAcrylamide potatoes replaced conventional potato varieties, people could reduce their
acrylamide consumption by 30%.
GM Potato:
Each year the average American consumes 126 pounds of potatoes. Currently in the
U.S., none of the potatoes grown for human consumption are genetically modified. However,
scientists are currently developing GM potatoes.
GM Potato Questions:

89

1. For you, how difficult was it for you to read the passage?
A. Very easy
B. Easy
C. Okay
D. Somewhat difficult
E. Difficult
2. For you, how trustworthy was the reading?
A. Completely trustworthy
B. Somewhat trustworthy
C. Neutral
D. Somewhat untrustworthy
E. Completely untrustworthy
3. How confident are you in understanding how the GM Low-Acrylamide potatoes were
developed?
A. Very confident
B. Confident
C. Neutral
D. Somewhat unconfident
E. Not confident
4. How confident are you in understanding the potential effects of the GM Low-Acrylamide
potatoes on consumer’s health?
A. Very confident
B. Confident
C. Neutral
D. Somewhat unconfident
E. Not confident
5. Overall, how do you feel about the use of GM Low-Acrylamide potatoes for human
consumption?
A. Strongly approve
B. Approve
C. Neutral
D. Disapprove
E. Strongly disapprove
6. How risky would you say GM Low-Acrylamide potatoes are in terms of their effects on
human health?
A. Very risky
B. Somewhat risky
C. Neutral
D. Safe
E. Very Safe

90

7. How willing are you to consume foods produced with GM Low-Acrylamide potato
ingredients?
A. Very willing
B. Somewhat willing
C. Neutral
D. Slightly unwilling
E. Not willing at all
8. Overall, how important is it to you to know about GM Low-Acrylamide potatoes?
A. Very important
B. Important
C. Neutral
D. Slightly unimportant
E. Not important at all
9. How interested are you in receiving more information on GM Low-Acrylamide potatoes?
A. Very interested
B. Interested
C. Neutral
D. Slightly uninterested
E. Not interested at all
How likely are you to seek out the following information regarding acrylamide and GM
potatoes?
5. New scientific findings on the impact of acrylamide and GM potatoes on consumer’s health:
A. Very likely
B. Likely
C. Neutral
D. Slightly unlikely
E. Never
6. New scientific findings on acrylamide and GM potatoes and their impact on the environment:
A. Very likely
B. Likely
C. Neutral
D. Slightly unlikely
E. Never
7. How GM potatoes are regulated:
A. Very likely
B. Likely
C. Neutral
D. Slightly unlikely
E. Never

91

8. The process used to of modify the GM potatoes:
A. Very likely
B. Likely
C. Neutral
D. Slightly unlikely
E. Never
Demographic data
1. Course in which you were asked to complete this survey
2. How many college level (NOT including AP) biological science classes have you taken (or
are currently enrolled in)?
A. 0
B. 1-2
C. 3-4
D. 5 or more
3. Gender
A. Female
B. Male
4. Age:
A. 20 or less
B. 21-24
C. 25 and above
5. Class Standing
A. Freshman
B. Sophomore
C. Junior
D. Senior
E. Graduate or other
6. Current GPA
A. 4.0
B. 3.5 – 3.9
C. 3.0 – 3.4
D. 2.5 -2.9
E. 2.4 or less
7. Race/ethnicity (check all that apply):
A. Y. Hispanic
B. Z. Chicano
C. AA. American Indian/Alaskan Native

92

D.
E.
F.
G.
H.

Asian
Black or African American
Hawaiian/Pacific Islander
White/Caucasian
Other

93

Table A.1 Demographic responses to GM Questionnaire.
Category
Gender
Age

Class Standing

Current GPA

Race/ethnicity
(check all that
apply)

Responses
Male
Female
20 or younger
21-24
25 or older
Freshman
Sophomore
Junior
Senior
4.0
3.5-3.9
3.0-3.4
2.5-2.9
2.4 or less
American Indian/Alaskan
Native
Asian
Black or African American
Chicano
Hawaiian/Pacific Islander
Hispanic
White/Caucasian
Other

Treatment
group
30.4%
69.6%
86.7%
10.6%
2.7%
47.8%
35.4%
13.3%
3.5%
5.3%
41.6%
31%
15.9%
6.2%

Control
group
34.6%
65.4%
82.3%
12.3%
5.4%
54.6%
25.4%
16.9%
3.1%
5.4%
36.9%
31.5%
22.3%
3.8%

2.7%

1.6%

8.8%
5.3%
0.9%
2.7%
2.7%
82.3%
3.5%

11.6%
6.2%
0.8%
0%
3.9%
77.5%
6.2%

Table A.2 Means of responses to GM Questionnaire for Treatment and Control Groups. Means
compared by LSD, α = 0.05, * denotes significant difference between the treatment and control

94

group.

Question
Mashed or baked potato consumption
Fried or processed potato consumption
Heard of acrylamide
Knowledge of acrylamide
Acrylamide Reading Passage
Difficulty of reading
Trustworthiness of reading

Scale
1 = Daily
3= 2-4 times/month
5 = Never
1= Yes

Means
Treatment
(n = 113)
2.8636
2.5273
1.9231

1 = Very knowledgeable
4 = Not at all

3.7787

1 = Very easy
5 = Difficult
1 = Completely
trustworthy
5 = Completely
untrustworthy

No Data

1.8407

2.0265

Confidence in knowing:
Where acrylamide is found 1 = Very confident
5 = Not confident
How acrylamide is formed in food
Importance to be informed about acrylamide 1 = Very important
5 = Not important at all
Interested in receiving more information on
1 = Very interested
acrylamide
5 = Not interested at all
Genetically Modified Crops Reading Passage
Heard of GM crops
1 = Yes
2 = No
Knowledge of GM crops
1 = Very knowledgeable
4 = Not at all
Difficulty of reading
1 = Very easy
5 = Difficult
Trustworthiness of reading
1 = Completely
trustworthy
5 = Completely
untrustworthy
Approval of GM crops for human
1 = Strongly approve
consumption
5 = Strongly disapprove
Risk of GM food in terms of effects on
1 = Very risky
human health
5 = Very safe
Willing to consume foods with GM
1 = Very willing
ingredients
5 = Not willing at all
Table A.2 cont’d
Confidence in understanding how GM crops

Means
Control
(n = 130)
3.0385
2.5116

1 = Very confident
95

2.4071

No Data

2.4860
2.6814
3.1504

1.0714

1.1473

2.4779

2.6589

1.7788

2.0*

1.9823

2.2713*

2.6071

2.8268

2.885*

2.6032

2.4336

2.5984

2.8407

2.8898

are tested and regulated
5 = Not confident
t
GM/Low-Acrylamide (L-A) Potato Reading Passage t only the treatment group had “LowAcrylamide” included in the reading and questions
Difficulty of reading
1 = Very easy
1.8739*
1.3438
5 = Difficult
Trustworthiness of reading
1 = Completely
trustworthy
2.2054
2.1953
5 = Completely
untrustworthy
Confidence in understanding how GM L-A
2.4867
2.7222
potatoes are developed
1 = Very confident
Confidence in understanding effects of GM
5 = Not confident
2.6071
3.112*
L-A potatoes on consumer’s health
Approval of GM L-A potatoes for human
1 = Strongly approve
2.5133
2.9127*
consumption
5 = Strongly disapprove
Risk of GM L-A potatoes in terms of effects 1 = Very risky
3.0991*
2.6032
on human health
5 = Very safe
Willing to consume foods with GM L-A
1 = Very willing
2.3874
2.624
potato ingredients
5 = Not willing at all
Importance to be informed about GM L-A
1 = Very important
2.8571
2.5984
potatoes
5 = Not important at all
Interested in receiving more information on
1 = Very interested
3.1593
3.2344
GM L-A potatoes
5 = Not interested at all
Likeliness to seek out information on:
New scientific findings on acrylamide and
3.2394
GM potatoes on consumer’s health
New scientific findings on acrylamide and
3.2035
1 = Very likely
GM potatoes impact on the environment
3 = Neutral
No Data
How GM potatoes are regulated
3.2566
5 = Never
The process used to modify the GM potatoes

3.2297

96